MOLECULAR BIOLOGICAL AND IMMUNOLOGICAL TECHNIQUES AND APPLICATIONS FOR FOOD CHEMISTS
Bert Popping Eurofins Scientific Group Yorkshire, England
Carmen Diaz-Amigo U.S. Food and Drug Administration Maryland, USA
Katrin Hoenicke Eurofins WEJ Contaminants GmbH Hamburg, Germany
MOLECULAR BIOLOGICAL AND IMMUNOLOGICAL TECHNIQUES AND APPLICATIONS FOR FOOD CHEMISTS
MOLECULAR BIOLOGICAL AND IMMUNOLOGICAL TECHNIQUES AND APPLICATIONS FOR FOOD CHEMISTS
Bert Popping Eurofins Scientific Group Yorkshire, England
Carmen Diaz-Amigo U.S. Food and Drug Administration Maryland, USA
Katrin Hoenicke Eurofins WEJ Contaminants GmbH Hamburg, Germany
Copyright 2010 by John Wiley &Sons, Inc. All rights reserved. Published by John Wiley & Sons, Inc., Hoboken, New Jersey Published simultaneously in Canada No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, scanning, or otherwise, except as permitted under Section 107 or 108 of the 1976 United States Copyright Act, without either the prior written permission of the Publisher, or authorization through payment of the appropriate per-copy fee to the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400, fax 978-750-4470, or on the web at www.copyright.com. Requests to the Publisher for permission should be addressed to the Permissions Department, John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, 201-748-6011, fax 201-748-6008, or online at http: //www. wiley.com/go/permission. Limit of Liability/Disclaimer of Warranty: While the publisher and author have used their best efforts in preparing this book, they make no representations or warranties with respect to the accuracy or completeness of the contents of this book and specifically disclaim any implied warranties of merchantability or fitness for a particular purpose. No warranty may be created or extended by sales representatives or written sales materials. The advice and strategies contained herein may not be suitable for your situation. You should consult with a professional where appropriate. Neither the publisher nor author shall be liable for any loss of profit or any other commercial damages, including but not limited to special, incidental, consequential, or other damages. For general information on our other products and services or for technical support, please contact our Customer Care Department within the United States at 877-762-2974, outside the United States at 317-572-3993 or fax 317- 572-4002. Wiley also publishes its books in a variety of electronic formats. Some content that appears in print may not be available in electronic formats. For more information about Wiley products, visit our web site at www.wiley.com. Library of Congress Cataloging-in-Publicatton Data: Popping, Bert. Molecular biological and immunological techniques and applications for food chemists / Bert Popping, Carmen Diaz-Amigo, Katrin Hoenicke. p. cm. Includes index. ISBN 978-0-470-06809-0 (cloth) 1. Food–Analysis. 2. Molecular biology. 3. Immunoassay. I. Diaz-Amigo, Carmen. II. Hoenicke, Katrin. III. Title. TX545.P67 2009 6640 . 07–dc22 2009009723 Printed in the United States of America 10 9 8 7 6 5 4 3 2 1
To Sue Hefle Sue Hefle was an internationally recognized food scientist with major contributions in the area of Food Allergy and Food Allergens where she was considered a pioneer. She was the recipient of numerous national and international awards and because of her expertise she was member of numerous advisory panels, task forces, and working groups. During her career at the University of Nebraska she worked very closely with the food industry, governments, and consumer organizations. Unfortunately, we lost her in 2006 at the age of 46 after a long fight against cancer. She fought the disease with the same energy and positive attitude she showed during her professional career. To recognize her hard work and significant contributions in the field of Food Science and in particular Food Allergens—something she did with passion—we are dedicating this book to Sue, our friend and colleague.
CONTENTS
CONTRIBUTORS PREFACE
PART Ia
xi xiii
MOLECULAR BIOLOGICAL METHODS: TECHNIQUES EXPLAINED
1. Molecular Biology Laboratory Layout
3
Rainer Schubbert
2. Polymerase Chain Reaction
41
Hermann Broll
3. Quantitative Real-Time PCR
59
Hermann Broll
4. Polymerase Chain Reaction–Restriction Fragment Length Polymorphism Analysis
85
Klaus Pietsch and Hans-Ulrich Waiblinger
5. Single-Stranded Conformation Polymorphism Analysis
105
Hartmut Rehbein
6. Sequencing
119
Rainer Schubbert
PART Ib
MOLECULAR BIOLOGICAL METHODS: APPLICATIONS
7. Meat
135
Ines Laube
8. Genetically Modified Organisms
157
Bert Popping
vii
viii
CONTENTS
9. Detection of Food Allergens
175
Carmen Diaz-Amigo and Bert Popping
10. Offal
199
Neil Harris
11. Aquatic Food
209
Hartmut Rehbein
PART IIa
IMMUNOLOGICAL METHODS: TECHNIQUES EXPLAINED
12. Antibody-Based Detection Methods: From Theory to Practice
223
Carmen Diaz-Amigo
PART IIb
IMMUNOLOGICAL METHODS: APPLICATIONS
13. Animal Specification in Speciation
249
Bruce W. Ritter and Laura Allred
14. International Regulatory Environment for Food Allergen Labeling
267
Samuel Benrejeb Godefroy and Bert Popping
15. Japanese Regulations and Buckwheat Allergen Detection
293
Hiroshi Akiyama, Shinobu Sakai, Reiko Adachi, and Reiko Teshima
16. Egg Allergen Detection
311
Masahiro Shoji
17. Soy Allergen Detection
335
Marcello Gatti and Cristina Ferretti
18. Milk Allergen Detection
349
Sabine Baumgartner
19. Gluten Detection
359
Ulrike Immer and Sigrid Haas-Lauterbach
20. Nut Allergen Detection
377
Richard Fielder, Warren Higgs, and Katie Barden
21. Fish Allergen Detection
407
Christiane Kruse Fæste
22. Lupin Allergen Detection Christiane Kruse Fæste
423
CONTENTS
23. Mustard Allergen Detection
ix
445
Anne E. Ryan and Michael S. Ryan
24. Celery Allergen Detection
451
Charlotta Engdahl Axelsson
INDEX
459
CONTRIBUTORS
Reiko Adachi, Division of Novel Foods and Immunochemistry, National Institute of Health Sciences, Tokyo, Japan Hiroshi Akiyama, Division of Novel Foods and Immunochemistry, National Institute of Health Sciences, Tokyo, Japan Laura Allred, ELISA Technologies, Inc., Gainesville, Florida Charlotta Engdahl Axelsson, Eurofins Food & Agro Sweden AB, Ldink€oping, Sweden Katie Barden, Tepnel Research Products and Services, Deeside Industrial Park, Flintshire, UK Sabine Baumgartner, Center for Analytical Chemistry, University of Natural Resources and Applied Life Sciences, Tulln, Austria Hermann Broll, Bundesinstitut f€ ur Risikobewertung, Berlin, Germany Carmen Diaz-Amigo, Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, Maryland, USA Christiane Kruse Fæste, National Veterinary Institute, Oslo, Norway Cristina Ferretti, Microbiotech Department, Neotron S.p.a., Modena, Italy Richard Fielder, Tepnel Research Products and Services, Deeside Industrial Park, Flintshire, UK Marcello Gatti, Microbiotech Department, Neotron S.p.a., Modena, Italy Samuel Benrejeb Godefroy, Food Directorate, Health Products and Food Branch, Health Canada, Ottawa, Ontario, Canada Sigrid Haas-Lauterbach, R-Biopharm AG, Darmstadt, Germany Neil Harris, LGC Limited, Teddington, Middlesex, UK Warren Higgs, Tepnel Research Products and Services, Deeside Industrial Park, Flintshire, UK Katrin Hoenick, Eurofins WEJ Contaminants GmbH, Hamburg, Germany Ulrike Immer, R-Biopharm AG, Darmstadt, Germany xi
xii
CONTRIBUTORS
Ines Laube, Institut f€ ur Lebensmitteltechnologie und Lebensmittelchemie, Technische Universit€at Berlin, Berlin, Germany Klaus Pietsch, Chemisches und Veterin€aruntersuchungsamt Freiburg, Freiburg, Germany Bert Popping, Eurofins Scientific Group, Pocklington, Yorkshire, UK Hartmut Rehbein, Max Rubner-Institut, Hamburg, Germany Bruce W. Ritter, ELISA Technologies, Inc., Gainesville, Florida Anne E. Ryan, ELISA Systems Pty. Ltd., Brisbane, Queensland, Australia Michael S. Ryan, ELISA Systems Pty. Ltd., Brisbane, Queensland, Australia Shinobu Sakai, Division of Novel Foods and Immunochemistry, National Institute of Health Sciences, Tokyo, Japan Rainer Schubbert, Eurofins Medigenomix GmbH, Ebersberg, Germany Masahiro Shoji, Morinaga Institute of Biological Science, Inc., Yokohama, Japan Reiko Teshima, Division of Novel Foods and Immunochemistry, National Institute of Health Sciences, Tokyo, Japan Hans-Ulrich Waiblinger, Chemisches und Veterin€aruntersuchungsamt Freiburg, Freiburg, Germany
PREFACE
From a historical point of view, the analysis of food is performed predominantly using typical chemical or physicochemical methods. These are, for example, wet chemical methods for proximity analysis or chromatographic methods for the analysis of pesticides and veterinary drug residues. In addition, food chemists use such physics-based methods as viscosity measurement and atomic absorption spectroscopy for the analysis of heavy metals. Food chemists in general tend to have good knowledge in some areas of biological analysis: in particular, regarding methods for the detection and enumeration of microorganisms and enzymatic methods for the analysis of single sugars or nitrite/ nitrate. In the past, use of these methods was sufficient for compliance with regulations and for quality assurance of food. However, in recent years several new issues have arisen in the field of food analysis which cannot be solved simply by applying chemical methods. Companies and regulators alike now have higher demands for safer food and product quality. This is reflected in more stringent customer product specifications as well as new regulations issued across the world. An example is an allergen-labeling regulation introduced in the United States on January 1, 2006. Similar regulations with an expanded scope have come into force in Europe and, some years ago, in Japan. Another example is the introduction of regulations for the labeling and traceability of genetically modified organisms. Although at present these are not regulated in the United States, regulations exist in Europe, Japan and other Asian countries, and in other parts of the world. Other regulations cover the protection of consumers from deception by mislabeling or adulteration of products. Examples are the adulteration of mandarine/tangerine juice, mislabeling of premium products such as Angus beef, and the protection of ethnic minorities from eating products forbidden by their religion. These analytical challenges can be solved easily using methods based on molecular biological or immunological principles: polymerase chain reaction (PCR), real-time PCR, and restriction fragment length polymorphism, or in the immunological field, enzymelinked immunosorbent assay and dot and Western blot, to name but a few. For the typical food chemist this tends to be a generally new field, since molecular biological and immunological methods are based on other principles. But especially over the past few years, borderlines between biological and physicochemical techniques have moved and fields previously separate have amalgamated somewhat as techniques have been combined to make it possible to provide answers faster and more xiii
xiv
PREFACE
cost-efficiently. One example is the invention of biochips, which, packed with antibodies, are being used to determine amounts of veterinary drug residues such as chloramphenicol, which until recently could only be determined by gas chromatographic or high-performance liquid chromatographical methods. Such methods serve not only to answer questions faster but also complement each other by confirming results through a completely independent method. As biological methods gain more importance in food analysis, it is prudent for the food chemist to become familiar with the techniques and to know the advantages and disadvantages, the fields of useful application, and the pitfalls of biological methods. For scientists with a basic chemical education, the contributors provide, in a simple and understandable but still comprehensive manner, descriptions of the most important methods used in routine molecular biology and immunology and give selected examples of important applications of these techniques in food analysis. The book is aimed at students and professional food chemists as well as quality assurance managers and can serve as guidance in understanding the techniques as well as implementing them in a laboratory to expand and complete a service portfolio. BERT POPPING Yorkshire, England CARMEN DIAZ-AMIGO Maryland, USA KATRIN HOENICKE Hamburg, Germany
Note: Several of the figures that appear in the book may be viewed in color at ftp://ftp.wiley.com/public/sci_tech_med/molecular_biological.
PART Ia
MOLECULAR BIOLOGICAL METHODS: TECHNIQUES EXPLAINED
CHAPTER 1
Molecular Biology Laboratory Layout RAINER SCHUBBERT Eurofins Medigenomix GmbH, Ebersberg, Germany
1.1
INTRODUCTION
In this chapter methods for the analysis of biological samples using molecular biological methods are described. The main focus will be on topical methods used in routine laboratories. However, the developmental rate of analytical methods and instruments is high in this field, and every year new applications are established in routine laboratories. Perhaps in a few years some types of routine DNA analysis will be performed with transportable instruments directly in food production facilities or food stores. The applications described herein are examples that represent the wide field of analyses performed by molecular biological methods in daily analysis work. Generally, the success of the analysis depends on correct sampling and storage, the DNA content of the sample, the correct DNA extraction method, and the corresponding analysis method. All methods described here are based on polymerase chain reaction (PCR), which is described later. For some of the analyses described, the methods are defined by legislation, for some analyses commercially available kits can be used, and for other analyses in-house methods must be developed and validated directly in the laboratory. The protocols for DNA extraction depend on the method used and are available from the manufacturer of the respective kit. Also, PCR reaction mixes and cycling conditions are specific for each assay and therefore are not described here. Generally, guidelines for forensic labs describe a very high standard and are therefore recommended (ILAC, 2002).
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
3
4
MOLECULAR BIOLOGY LABORATORY LAYOUT
1.2
LABORATORY
The laboratory design depends on the type of analysis performed. Detailed recommendations for a laboratory design are available, for example, at www.ilac.org/ publicationslist.html, www.dach-gmbh.de/, and www.eurachem.ul.pt/. In this chapter, only principles are explained. Generally, a molecular biological laboratory should be separated into three departments (pre-PCR, thermocycler, post-PCR), as shown in Figure 1.1. 1.2.1
Pre-PCR Department
At least three different rooms are necessary: . .
Room 1: Sample registration. In this room the biological samples are registered (e.g., barcoded) and subsamples are taken if necessary. Room 2: DNA extraction. In this room the DNA is extracted. All working steps should be performed with filter pipette tips. Coats and gloves must be worn to protect both the lab personal and the samples. Air conditioning is recommended. For work with samples with small amounts of DNA, a specific portion of the room
FIGURE 1.1 A molecular biological laboratory should be separated into three departments: pre-PCR (rooms 1 to 3), thermocycler (room 4), and post-PCR (room 5). A computer for sample tracking should be present in every room. In rooms where work with liquids is expected, a basin or separate waste bin is recommended. Equipment such as laminar flow or thermocycler are positioned in the schematic. Freezers or refridgerators should be planned depending on the number of samples expected in every room.
METHODS
.
5
should be separated off. If samples with infectious content are expected, laminar flow should be present. Room 3: PCR setup. In this room the PCR reaction is pipetted using filter tips. If possible, all PCR reagents are pipetted on one bench and the genomic DNA is added on a second bench to avoid contamination of the PCR reagents with the DNA. Air conditioning is recommended.
After each working step the benches have to be cleaned with suitable reagents. It is absolutely necessary that no PCR products be treated in one of these rooms. If contamination has occurred, all surfaces, instruments, and coats must be cleaned, and all chemicals and working solutions must be exchanged. 1.2.2
Thermocycler Department
PCR cycling is performed in the thermocycler department (room 4). No plastic material or solutions should be transferred from this department to the pre-PCR department. Air conditioning is recommended. 1.2.3
Post-PCR Department
In the post-PCR department (room 5) PCR products are handled using agarose gel electrophoresis, capillary electrophoresis, and other procedures. For this work a separate set of pipettes, plastic material, gloves, and coats are necessary. Air conditioning is recommended and is required if the analysis is performed using genetic analyzers with a laser and CCD (charge-coupled device) camera as the detection system. As mentioned above, instruments, coats, single-use plastic, and all other materials must not be transferred from this department into the pre-PCR department. If it should be necessary to reamplify PCR products, the PCR master mix has to be prepared in the pre-PCR department, transferred to the post-PCR department, and the PCR product added here.
1.3 1.3.1
METHODS Collection of Samples and Storage of Sample Material
One major aspect of the success of the analysis is correct sampling of the biological material and storage of the samples. Any mistake at this point would deeply influence succeeding steps of the analysis and could lead to a complete failure or to incorrect analysis results. Even if DNA extraction from clotted blood, decomposed meat, or swabs overgrown with fungi might be successful, it should only be used in forensic casework or in cases where no other biological material is available. Swabs for DNA extraction should be air-dried after sampling. Swabs stored in any gel or liquid (swabs for cultivation of bacteria) must not be used. The best storage conditions for biological materials are listed in Table 1.1. For all biological material, freez–thaw cycles should
6
MOLECULAR BIOLOGY LABORATORY LAYOUT
TABLE 1.1
Sampling and Storage Conditions for Biological Material
Biological Material
Sampling and Storage Conditions
Liquid blood for DNA extraction
Preserved with EDTA (first choice) or heparin (second choice); short-term storage and transport at þ 4 C, long-term storage at 20 C. Avoid thawing and freezing cycles; transport at 20 C; thawing in a water bath at 37 C directly before DNA extraction. Preserved with specific buffers [e.g., RNAlater solution (content of Qiagen RNA extraction kits)], storage at 80 C; transport on dry ice. Blood up to 200 mL dropped on filter paper [e.g., FTA, FTA-elute (Whatman)]; long-term storage under dry conditions at room temperature. Short-term storage (up to 24 h) at þ 4 C, long-term storage and transport longer than 24 h at 20 C. Strictly avoid thawing of frozen material. 10 to 15 min drying at room temperature after sampling; storage and transport under dry conditions at room temperature. Short-term storage at þ 4 C, long-term storage 20 C. Avoid thawing and refreezing. Storage and transport frozen in liquid nitrogen. If transported at þ 4 C or 20 C, do not store again in liquid nitrogen. Dry and protect from light at room temperature.
Liquid blood for RNA extraction Blood spots (only for DNA extraction) Fresh meat, fish meat, meat from seafood Swabs from surfaces, buccal swabs Bones, teeth, connective tissues Sperm samples (conserved for artificial insemination) Dried sperm spots
be avoided. If a frozen sample has thawed and has been refrozen, the laboratory must be informed in order to choose the most suitable DNA extraction method. Example 1: If a frozen sperm sample normally used for artificial insemination was thawed and later refrozen in liquid nitrogen, the heads of the sperm cells may have been destroyed. In routine protocols for DNA extraction from sperm cells a special step is included to pretreat the heads. After this step the used buffer is not reused in later extraction steps because for a native sperm sample the DNA is in the pellet and not in the buffer. In contrast, for thawed and refrozen samples, most of the DNA can be in this buffer and therefore DNA extraction from the pellet would fail. Example 2: Experiments have shown that fish meat frozen directly after capture contains sufficient amounts of DNA for analysis in about 100 mg of sample. But after thawing and refreezing, 1 to 2 g of fish is needed to obtain sufficient amounts of DNA; analysis with only 100 mg could fail. However, for meat from mammals, the influence is not that strong. During the sampling process, wearing of gloves, cleaning of instruments, and the use of single-use material is strictly enforced to avoid contamination. Especially for samples
METHODS
7
with a low DNA content (e.g., decomposed samples, degraded samples, bones, teeth), the risk of contamination is high and can lead to incorrect or unreliable results. 1.3.2
DNA Extraction
In recent years, several methods for the isolation of DNA from biological material have been developed, and kits are commercially available. The method used depends on the consistency of the biological material, the ratio expected for the amount of DNA per amount of biological material, the potential presence of PCR inhibitors in the biological material, and the instruments or pipetting machines present in the laboratory. Treatment of the sample with proteinase K and an EDTA buffer, followed by extraction with phenol and chloroform and ethanol precipitation of the DNA, leads to very pure DNA but has all the disadvantages inherent in handling organic substances. Therefore, most of the kits available work without phenol and chloroform. The principle of these kits is treatment of the sample with a low-salt lysis buffer which contains proteinase K and the addition of a binding buffer containing a chaotropic salt. In the presence of the correct concentration of the salt (e.g., guanidinium thiocyanate) the DNA binds to silica which is fixed on membranes (column-based DNA extraction kits) or coated on magnetic beads. Proteins, salts, and other components from the biological material do not bind to silica. After different washing steps, the DNA is eluted into water or TE buffer. Other kits are based, for example, on the characteristics of DNA at various levels of pH (Charge Switch, Invitrogen). Kits for low throughput, where all steps are processed manually, to kits for high throughput, where most or all steps are processed on pipetting machines, are available from most suppliers (see Table 1.2). 1.3.3
Measurement of DNA Concentration
For a successful analysis it is necessary to determine the DNA concentration. The presence of high concentrations of DNA can influence downstream applications, which can lead to a total or partial inhibition of PCR, especially for commercially available multiplex PCR kits. For DNA concentrations greater than 10 ng/mL, the measurement of DNA concentration by a determination of OD (optical density) 260/ 280 nm with a photometer will lead to reliable results. With this method all DNA that is present in the solution is measured. This is sufficient with DNA from fresh blood or meat samples, for example. If an analysis were performed to prove the identity of a degraded tissue sample, it would be necessary to determine separately the amount of DNA from the tissue and from bacteria and fungi grown on this tissue. These methods are described in Section 1.3.8. 1.3.4
Variants in the Sequences of Genomic DNA
The DNA of higher organisms is separated into DNA located in the nucleus (genomic DNA) and DNA located in the mitochondria (mtDNA). The genomic DNA is separated on the chromosomes. At every somatic cell two copies of the autosomal
8
MN
Supplier/ Biological Material
TABLE 1.2
Blood on Filter Paper
Animal Tissue or Meat Bones and Teeth
NucleoSpin NucleoSpin NucleoSpin NucleoSpin DNA Blood Tissue Tissue Trace (740951.10/.50/ (740952.10/.50/ (740952.10/.50/ (740942.4/.25) .250) .250) .250) NucleoSpin NucleoSpin 8 NucleoSpin 8 þ NucleoSpin Blood L Trace Tissue Trace Bone (740954.20) (740722/.1) (740740/.5) Buffer Set (740943.25) NucleoSpin NucleoSpin 96 NucleoSpin 96 Blood XL Trace Tissue (740950.10/.50) (740726.2/.4) (740741.2/.4/.24) NucleoSpin 8 NucleoMag 96 NucleoMag 96 Blood Trace (744600.1/ Tissue (740664/.5) .4/.24) (744300.1/.4/.24) NucleoSpin 96 NucleoSpin Food Blood (740665.1/ (740945.10/.50/ .4/.24) .250) NucleoMag 96 NucleoSpin 8 Food Blood (740975/. 5) (744500.1/.4/.24) NucleoSpin 96 Food (740976.2/. 4/.24)
Liquid Blood
Kits for DNA Extraction a
Swabs
Homepage
NucleoSpin NucleoSpin 96 Plant XL Trace (740540.6) (740726.2/.4) NucleoSpin 8 NucleoMag 96 Plant Trace (740662/.5) (744600.1/.4/.24) NucleoSpin 96 Plant (740661.2/ .4/.24) NucleoMag 96 Plant (74400.1/ .4/.24)
NucleoSpin NucleoSpin www.mnPlant II Tissue net.com (740770.10/.50/ (740952.10/.50/ .250) .250) NucleoSpin NucleoSpin 8 Plant L Trace (740539.20) (740722/. 1)
Plant Material
9
QIAamp DNA Blood Mini Kits QIAamp DNA Micro Kit Generation Capture Card Kit
—
DNA IQ System DNA IQ System Wizard Genomic ReadyAmp DNA Purification Genomic DNA Kit Purification System
Gentra Puregene Blood Kits FlexiGene DNA Kits Generation Capture Kits
EZ1 DNA Blood Kits (200 or 350 m L) QIAamp DNA Blood BioRobot MDx Kit
QIAamp DNA Blood Kits (Mini, Midi, Maxi) QIAamp 96 DNA Blood Kits
XK02-04 Genisol ABgene/ Maxi-Prep Kit Thermo (single preps) Fisher Scientific
Promega
Qiagen
XK02-04 Genisol Maxi-Prep Kit (single preps)
Wizard SV Genomic DNA Purification System
DNeasy Blood and Tissue Kit
XK02-04 Genisol Maxi-Prep Kit (single preps)
—
—
QIAamp 96 DNA Swab BioRobot Kit
QIAamp DNA Micro Kit
Wizard Genomic DNA IQ System DNA Purification Kit
DNeasy Plant Maxi Kit
DNeasy Blood and Tissue Kit
QIAamp DNA Mini Kits
DNA IQ System
DNeasy Plant Mini Kit
QIAamp DNA Micro Kit
(continued)
www. abgene. com
www. promega. com
www.qiagen. com
10
For 1, 8, and 96 samples as noted.
a
GeneCatcher gDNA Blood Kits (1) DNAzol BD Reagent (1)
ChargeSwitch gDNA Serum Kits (1)
ChargeSwitch Forensic DNA Purification Kit (1)
ChargeSwitch gDNA Mini or Micro Tissue Kit (1) PureLink Genomic DNA Purification Kit (1) DNAzol Reagent (1)
DNAzol Reagents (1) (bone marrow)
PureLink Plant DNA Purification Kit (1) Plant DNAzol Reagent (1)
ChargeSwitch gDNA Plant Kit (1)
Nucleon Phytopure
—
—
—
First-DNA all tissue 10/50/ 100/500
First-DNA all tissue 10/50/ 100/500
First-DNA all tissue 10/50/ 100/500
First-DNA all tissue 10/50/ 100/500
First-DNA all tissue 10/50/ 100/500 —
Plant Material
Bones and Teeth
Animal Tissue or Meat
Blood on Filter Paper
Liquid Blood
Invitrogen ChargeSwitch gDNA Blood Kits (96)
Tepnel Life Sciences
Genial
Supplier/ Biological Material
TABLE 1.2 (Continued)
ChargeSwitch Forensic DNA Purification Kit (1)
First-DNA all tissue 10/50/ 100/500
Swabs
www. invitrogen. com
www. genial.de
Homepage
METHODS
11
chromosomes are present (diploid chromosome set). Therefore, from all genetic information located on these chromosomes, two copies (alleles) are present in every cell. From the gonosomal chromosomes two copies of one variant or one copy of each of the two variants is present, depending on the gender of the individual (X and Y chromosomes in mammals, W and Z chromosome in birds). In the germ cells only one copy of the autosomal chromosomes and one gonosomal chromosome are present. The genomic DNA is separated into introns and exons as shown in Figure 1.2. An exon is any region of the DNA within a gene that is transcribed to the final messenger RNA (mRNA) molecule, which is translated into proteins, for example (Gilbert, 1978). Therefore, mutations in these regions can have a strong influence on the organism where they occur. Examples are variants in BRCA genes, which lead to a higher risk of developing breast cancer in humans; mutations at the PKD 1 gene, which leads to polycystic kidney disease in cats; or variations at the PrP gene in sheep or goat, which leads to higher or lower risk to develop scrapie after exposure to the infectious agent. Mutation in the exon regions can be insertions (new bases are added to the DNA), deletions (single bases up to longer parts of DNA are missing), point mutations [singlenucleotide polymorphisms (SNPs)], duplications, or translocations. Therefore, most of the DNA sequences of exonic regions are highly conserved in an animal or plant species. Some can be used for animal species determination. One example is SNPs at the mitochondrial cytochrome b gene, which can be detected, for example, by RFLP (restriction fragment length polymorphism) followed by agarose gel electrophoresis. Depending on the DNA sequence, specific restriction enzymes cut the PCR products. From the number and length of the fragments it is possible to conclude the DNA sequence at the restriction sites (see Section 1.3.9). In contrast to these conserved exonic sequences, at intronic sequences (sections that are spliced out after transcription but before the RNA is used) mutations have in most cases no influence on the individual in which they occurred and therefore are passed on to the next generation. Furthermore, insertions, deletions, SNPs, duplications, and translocations exist in the intronic regions. In addition, regions with repeated DNA motifs are present, known as STRs (short tandem repeats) or VNTRs (variable number tandem repeats). From the length of the repeated motif they are separated into
Intron
Exon
Intron
Exon
Intron
DNA
RNA
Protein
FIGURE 1.2 Genomic DNA is separated into introns (white) and exons (black). Sequences from exons were transcribed to RNA and translated to proteins.
12
MOLECULAR BIOLOGY LABORATORY LAYOUT
Intron
Exon
Intron
Exon
Intron
DNA
Short Tandem Repeat
Sample A: 11 Repeats
ACGTCAGATAGTTGCAT CG CG CG CG CG CG CG CG CG CG CG TTAAAGCCGATAG TGCAGTCTATCAACGTA GC GC GC GC GC GC GC GC GC GC GC AATTTCGGCTATC
Sample B: 9 Repeats
ACGTCAGATAGTTGCAT CG CG CG CG CG CG CG CG CG TTAAAGCCGATAG TGCAGTCTATCAACGTA GC GC GC GC GC GC GC GC GC AATTTCGGCTATC
Sample C: 8 Repeats
ACGTCAGATAGTTGCAT CG CG CG CG CG CG CG CG TTAAAGCCGATAG TGCAGTCTATCAACGTA GC GC GC GC GC GC GC GC AATTTCGGCTATC
Sample D: 5 Repeats
ACGTCAGATAGTTGCAT CG CG CG CG CG TTAAAGCCGATAG TGCAGTCTATCAACGTA GC GC GC GC GC AATTTCGGCTATC
FIGURE 1.3 Microsatellites and other variable regions are located in introns. In this scheme, four different sequences of a microsatellite with the dinucleotide motif CG with 11, 9, 8, and 5 repeats are shown.
microsatellites and minisatellites. At microsatellites the repeat motif contains 1 to 5 base pairs (bp) (Figure 1.3), at minisatellites more than 15 bp. Even if the repeat motif is specific for any microsatellite (e.g., main motif AGAAn for the human marker D18S51), incomplete repeats also exist. Alleles with incomplete repeats are described as microvariants. At every microsatellite, different numbers of repeats can be found (e.g., at the very polymorphic human STR SE33/ACTBP2, there are about 100 different alleles with 4 to 50 complete and incomplete repeats (Schubbert, 2002). For example, at most markers used in routine analysis for human identification, the difference between the shortest and longest alleles is 20 to 30 bp. It is necessary to distinguish between the nearest possible fragments, which can be 1 bp at several markers. In principle, PCR products can be separated by highly concentrated agarose gels, combined agarose–polyacrylamide (PAA) gels, PAA gels, or capillary electrophoresis with liquid polymer, as described in Section 1.3.7. 1.3.5
PCR
Since the first publication of the PCR method (Mullis, 1990), thousands of applications for DNA analysis have been developed. The principle of PCR is shown in Figure 1.4. 1. Melting step. Double-stranded DNA is denatured (single-stranded) in a first temperature step at 94 to 95 C for 15 to 30 s. 2. Annealing step. The reaction mixture is cooled down to 48 to 60 C for 15 to 30 s. At this lower temperature, primers (short DNA molecules with 15 to 40 bp specific for the DNA fragment, which should be amplified) bind
METHODS
13
1 2 Primer Taq - Polymerase
3 4 5
FIGURE 1.4 In PCR double-stranded DNA become denaturated (1) to single strands (2). Sequence-specific primers bind to single-stranded DNA (3) and Taq polymerase starts the duplication of DNA from these primers (4). The next cycle starts with these duplicated fragments (5).
to the single-stranded DNA. The optimal temperature at this step depends on the melting temperature of the primers. 3. Elongation step. At 72 C, Taq polymerase starts elongation of the DNA strand in the 50 ! 30 direction, starting from the primer, for 30 s up to some minutes, depending on the length of the fragment amplified. These three steps (cycles) are repeated 30 to 40 times, depending on the amount of DNA measured at the beginning of the reaction. The complete analysis runs automatically in combined heating–cooling instruments known as thermocyclers. These are available from a variety of suppliers for the analysis of one up to 2 384 samples in parallel. In the past year, several thermocyclers with very high heating and cooling rates have been developed to reduce the PCR time (Table 1.3). PCR for microsatellite analysis or other multiplex analysis can be performed with labeled primers as shown in Figure 1.5. Depending on the analysis system, different dyes are used which can be detected with ultraviolet (UV) or infrared light. Combinations of dyes used in routine analysis are listed in Table 1.4. If only a few samples should be analyzed with a higher number of markers, it may be more economical to elongate a specific primer with a universal DNA sequence tail. PCR will than be performed with a mixture of the specific primers and a labeled primer that binds to the universal tail in a singleplex reaction (Qin et al., 2006). If one anticipates that a specific marker set will be used in routine analysis in the future, it could be useful to redesign the primers. With optimized primer sets it is possible to perform multiplex PCR reactions with 10 to 15 markers. In this case one specific primer from every marker should be labeled.
14
MOLECULAR BIOLOGY LABORATORY LAYOUT
TABLE 1.3
Thermocycler Suppliers
Manufacturer ABI Eppendorf
Stratagene (Robocycler)
1.3.6
Number of Samples Processed in Parallel 96/384/2 96/2 384 Various devices/ configurations available: . 0.5-mL reaction volume: 16 or 77 samples . 0.2-mL reaction volume: 25 or 96 (tubes or plate) samples . 384-well format 96
Homepage www.appliedbiosystems.com www.eppendorf.com
http://www.stratagene.com/ products/displayproduct. aspx?pid¼260
Agarose Gel Electrophoresis
DNA fragments can be separated by agarose gel electrophoresis and stained with dyes such as ethidium bromide or PicoGreen. These dyes interact with double-stranded DNA and emit fluorescent light after stimulation with UV light. As ethidium bromide is
FIGURE 1.5 Dye-labeled DNA fragments are produced by PCR with dye-labeled primers (a). The size of two different alleles (b) with 7 or 5 repeats (4 bp) differs from that of 8 bp. By coseparation of a size standard (c, black lines) and an allelic ladder (c, gray lines), the size can be determined and the alleles determined correctly.
METHODS
TABLE 1.4
Dye Sets Used in Routine Analysis on ABI Genetic Analyzers
Filter Set/ Channel
Blue
Green
Yellow
FAM FAM FAM FAM
HEX JOE JOE VIC
NED NED TMR JOE
D F G5
15
Orange (Used with Five-Dye Sets)
Red (Used as Internal Size Standard)
— — — PET
ROX ROX RXN LIZ
carcinogenic and toxic, nitrile gloves should be worn to protect the hands when handling dyes, stained gels, or contaminated buffers. Depending on the workflow in the laboratory, the dye is already mixed with the melted agarose and is present in the gel during electrophoresis, or the gel is stained after electrophoresis. Also, ready-to-use agarose gels are available with or without dyes from some manufacturers. If prestained gels are used, special attention has to be paid because the buffers and chambers will be contaminated with the dye. In this case, strict rules should be established in the laboratory and chambers, pipettes, and instruments contaminated with the dye must be controlled. Contaminated objects should always be handled with gloves. Depending on the size of the DNA, the concentration of agarose, and its quality, fragments with differences of at least 4 bp can be separated. Agarose Gel Electrophoresis of Genomic DNA The concentration of DNA can be determined by OD measurement. However, this technique gives no information about possible degradation of the DNA, which it is necessary to know for some applications. For these reasons, agarose gel electrophoresis of genomic DNA can be performed. A size marker that covers the sizes expected (up to 40 kb) has to be co-separated on the same gel. In Figure 1.6, examples of different grades of degradation of genomic DNA are demonstrated. If agarose gel electrophoresis shows that almost all DNA is degraded to fragments shorter than 400 bp, for example, it will be very difficult to amplify a PCR fragment of about 450 or 1000 bp length, which is used routinely for the analysis of mtDNA in humans or animals. With the information from this agarose gel, the strategy has to be changed and the amplification of two or three smaller fragments would lead to a successful analysis. Agarose Gel Electrophoresis of PCR Products Agarose gel electrophoresis of PCR products can be performed as quality control before further analyses. For RFLP analysis or sequencing of the PCR product, it is necessary to determine whether a PCR product is present and how much PCR product is present. Therefore, a size marker that again covers the expected fragment sizes (at PCR products, normally about 100 to 1200 bp) with known concentration has to be co-separated (see Figure 1.12). After detection of PCR products and estimation of the concentration, the following analyses will be more successful because optimal amounts of DNA can be applied to downstream reactions. For proof of the presence of fungi, bacteria, or viruses, PCR followed by agarose gel electrophoresis is sometimes sufficient for diagnosis. This is the case if the PCR product is specific
16
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.6 Agarose gel picture. The quantity and quality of isolated genomic DNA can be determined in comparison with defined size standards (lanes 1 and 8) From dried fish (lane 2), degraded muscle (lane 5), and heart tissue (lane 7) only weak amounts of mostly degraded DNA can be isolated. From freshly frozen fish (lane 3) or prawns (lane 4) and bone marrow (lane 6), high-molecular DNA can be isolated.
for the organism, all controls show the results expected, and subtyping is not necessary (e.g., detection of Chlamydia). 1.3.7
PAA Gel Electrophoresis and Capillary Electrophoresis
Today, high-throughput microsatellite analysis is performed with PAA gels or capillary electrophoresis (CE) with automated instruments (Table 1.5). When using older instruments, a swab gel has to be prepared and the samples must be loaded manually. In the first step two panes of glass are treated with NaOH, washed, fixed together, and a PAA solution is placed between the panes. After polymerization, the panes are mounted on the instrument and a pre-run is performed to stabilize the electrophoresis conditions. Finally, the samples, mixed with running buffer, are loaded manually to the instrument using an eight-channel pipette. After every run the glass panes have to be cleaned and the buffer has to be exchanged. The advantage of this type of instrument is better resolution for specific types of samples and robustness if only a few runs are performed per week. With the current generation of capillary electrophoresis instruments, PCR products are mixed with formamide and put into the instrument. Filling the capillaries with viscous polymer, loading the samples and the size standard to the capillary, and starting
METHODS
TABLE 1.5
17
Instruments for PAA or Capillary Electrophoresis
Numbers of Samples Processed in Number Swab Gel Parallel of Dyes or CE Homepage Manufacturer Instrument ABI Amersham LiCor
3130 XL MegaBACE 4300
96 96
5 4
48
2
CE CE
www.appliedbiosystems.com www.4.amershambiosciences. com Swab gel www.licor.com
and performing electrophoresis are carried out by the instrument automatically. In one capillary analyzer, the ABI 3130 (Figures 1.7 and 1.8), 30 runs of 16 samples with a read length of 600 bp can be run within 24 h. Routine work for this instrument is reduced to refilling the buffers and viscous polymers or capillary arrays and routine cleanup of the instrument (buffer chambers, injection pumps), which should be carried out once a week. One disadvantage of this type of instrument is the aging of the polymer and array if mounted on the instrument, which can be critical if only a few runs are performed per week. For PAA electrophoresis or CE with automated fragment detection and size calling, the PCR products must be labeled with dyes (Table 1.4). During the establishment of a new assay, for best results several dilutions of PCR products should be tested after PCR. For electrophoresis the PCR products have to be mixed with a loading dye according to the concentrations given by the manufacturer and an internal size standard that is co-separated in every line or capillary. During electrophoresis a laser stimulates
FIGURE 1.7
Genetic analyzer ABI 3130 with control computer.
18
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.8 Detailed view of ABI 3130. Liquid polymer stored in a bottle (a) became transported to a capillary array (b) by a pump (c). Samples prepared for electrophoresis became stored in a tray (d). By electrophoresis, PCR products migrate to the detection window (e) and become measured by a CCD camera.
the dyes to emit fluorescent light, which is measured by a CCD camera. This camera scans the detection window 5000 to 10,000 times per run. Thereby, the data collection software of the instrument collects the data of four or five different dye channels. By comparing the raw data from the red channel (on ABI instruments, the internal size standard is recorded in the red channel) with data from the other channel, the analysis software (e.g., GeneScan or Genemapper for instruments from Applied Biosystems) calculates the fragment size of the PCR products (Figure 1.9). For a reproducible allele calling, categories can be defined by the software (for instruments from Applied Biosystems, e.g., Genotyper or GeneMapper) for every marker at additional analysis steps which can be used for further analyses. Depending on the instrument and size standard used, the same allele/PCR fragment can be defined with different lengths (Figure 1.10). Therefore, it is necessary to standardize the results for intra- and interlaboratory data exchange. For some commercially available microsatellite multiplex PCR kits, allelic ladders are available (Figure 1.11). These ladders should be analyzed within every run in a separate line or capillary to assure the quality of the analysis. For individual marker sets it is recommended that an allelic ladder be developed or at least that one or two control samples with a known genotype be analyzed in every batch of samples. For some marker sets, ring trials were organized [e.g., by ISAG (International Society for Animal Genetics) for horse, cattle, sheep, goat, dogs, and cats; and by ISFG (International Society for Forensic Genetic) and DGRM (German Society for Legal Medicine) for humans].
METHODS
19
FIGURE 1.9 Data from GeneScan analysis. Size of PCR products (blue, green, and black peaks) is measured by comparison with an internal size standard co-separated in the same capillary. (a) Size standard ROX500 from ABI; (b) PCR fragments and size standard. (See insert for color representation.)
FIGURE 1.10 Comparison of data from Genotyper analysis. Identical PCR was co-separated with size standard ILS600, Promega (a, b) and with size standard ROX500 (ABI) (c, d) in parallel on an ABI 3100. Using ROX500, fragment lengths seems to be 2 to 3 bp longer than when using ILS.
20
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.11 Comparison of data from Genotyper analysis. Comparing PCR products with fragments of allelic ladders, intra- and interlaboratory data exchange is possible. Upper panel: allelic ladder of markers D3S1358, TH01, and D18S51 used for human identification shown; at the lower panel: DNA profiles from four different DNA samples.
1.3.8
Real-Time PCR
For some applications it is necessary to determine the amount of specific DNA or RNA in a biological sample. At the beginning of every PCR reaction only a few amplified fragments are present. In the following logarithmic phase the number of PCR products is doubled in every cycle under optimal conditions. Depending on the amount of DNA at the beginning of the reaction, after various cycles the reaction reaches the plateau phase. This is influenced by several factors. During PCR the amount of free nucleotides available, which are necessary to synthesize a new DNA strand, and the amount of free primers decrease. At a later time, high numbers of PCR fragments are present. These fragments also reanneal and are not available to bind primers. Finally, the efficiency of the enzyme weakens from cycle to cycle. Applying PCR with, for example, 35 cycles and a separation on agarose gel, no difference can be detected, whether 10, 25, 50, or 100 ng of genomic DNA is analyzed in the PCR reaction (Figure 1.12). In contrast, using real-time PCR it is possible to distinguish between the various amounts of DNA (Figure 1.13). Real-time PCR can be carried out with a pair of unlabeled primers and the presence of SybrGreen, which emits fluorescent light after stimulation when double-stranded DNA is present. However, SybrGreen also binds to the high-molecular DNA that is added to the PCR reaction, to primer–dimmers, and to unspecific PCR products. As a consequence, only one PCR product can be detected per reaction. Therefore, during the development phase of a new assay, the PCR products should be controlled by an agarose gel electrophoresis after real-time PCR. The optimal amount of high-molecular DNA added to the PCR also has to be determined. The performance of a melting curve after the PCR reaction can assure that the PCR products expected are amplified.
METHODS
21
FIGURE 1.12 Agarose gel picture. In comparism with defined size standard (lane 1) the quantity and fragment size length of PCR products can be determined. Different amounts of DNA (60 ng, 30 ng, 15 ng, 7.5 ng, 3.75 ng, 1.8 ng, and 900 pg; lanes 2 to 8) were analyzed by real-time PCR with primers specific for mitochondrial DNA. In contrast to online measurement during real-time PCR by agarose gel electrophoresis, quantification of the amount of genomic DNA put into this PCR is not possible.
FIGURE 1.13 Different amounts of DNA (60 ng, 30 ng, 15 ng, 7.5 ng, 3.75 ng, 1.8 ng, and 900 pg) were analyzed by real-time PCR with primers specific for mitochondrial DNA. Depending on the amount of DNA put into PCR, the amplification curves cross the threshold (horizontal line) with one cycle difference (upright gray lines).
22
MOLECULAR BIOLOGY LABORATORY LAYOUT
Real-time PCR is more specific when primer and labeled probes are used. By a combination of specific primers and probes with a 10 C higher melting temperature, it is possible to detect, for example, 1-bp mutations (SNPs) by real-time PCR. Different types of probes are developed. At dual-labeled probes at the 50 end a reporter dye is labeled, which emits fluorescent light after stimulation. At the 30 end a quencher dye is labeled. If reporter and quencher are localized nearby, the fluorescent light of the reporter dye is quenched. The Taq polymerase used for PCR also has exonuclease activity. Therefore, during the elongation phase of the PCR the probe is not melted from the DNA strand and is destroyed by the Taq polymerase. The reporter and quencher dyes are separated and the light emitted from the reporter can be measured by the detection system of the thermocycler. At the beginning of the reaction the instrument measures the background signal from the reporter dye. During every cycle the instrument measures the signal intensity and determines the cycle at which the signal is significant higher than the background signal of the samples at the start of the analysis. This cycle is called a cycle of threshold (Ct). High Ct values mean that less DNA was present at the beginning of the PCR. Real-time PCR can also be used for the quantitative analysis of DNA or RNA. In expression analysis, the Ct values of a constant-expressed gene (a housekeeper gene) and a variable-expressed gene (a gene of interest) are compared. Expression analysis is not often used in the analysis of meat or food products. Currently, different instruments are available for real-time PCR. Depending on the manufacturer, the stimulating light is emitted from a laser or from a tungsten bulb in combination with a filter. The fluorescent light emitted from the reporter dye is measured through a prism or filter system. The number of parallel dyes detected varies from three to five. Instruments currently available are listed in Table 1.6. 1.3.9
RFLP Analysis
For RFLP (restriction fragment length polymorphism) analysis, the qualities of restriction endonuleases are used. These cut genomic DNA or PCR products at or near specific sequences. At a single basepair mutation, two different sequences are present. The corresponding enzyme cleaves only one of the two possible DNA strands. The fragments can be detected by agarose gel analysis. 1.4
APPLICATIONS
1.4.1
PCR and Detection of PCR Fragments
Gender Determination of Animals Cattle
The gender determination of cattle is necessary to answer two questions:
1. During embryogenesis of twins, anastomotic blood vessels can be developed between the placentas, which can lead to problems with dioecious twins. Through these blood vessels, stem cells and hormones can be exchanged. If the female twin
23
Roche Stratagene (Mx3005P)
96/384 96
96
ABI
Eppendorf
48/96/384
Manufacturer 5
Number of Dyes
Two options available: up to two or four different dyes detectable 4 5
Instruments for Real-Time PCR
Number of Samples Processed in Parallel
TABLE 1.6
Halogen lamp; photomultiplier
LED/Halogen/ Laser 96 LEDs for excitation; channel photomultiplier for detection
Stimulating Light/Detection System
yes yes
yes
yes
Performance of Melting Curve Possible?
www.roche-applied-science.com www.stratagene.com/qpcr
www.eppendorf.com
www.appliedbiosystems.com
Homepage
24
MOLECULAR BIOLOGY LABORATORY LAYOUT
receives the anti-Mueller hormone from the male twin, sexual organ development will be inhibited. This can range from missing organs in the newborn calf to functional problems even when the organs are present. In almost all cases such female twins will not become pregnant. Development of the sexual organs of the male twin is not influenced. A farmer thus has two choices after the birth of dioecious twins: He or she can feed the female calf and slaughter it as he or she would a male calf, or can determine by PCR whether blood cells that carry a Y chromosome are present in the circulating blood of the female calf. If these cells are present, it is very likely that the anti-Mueller hormone was transferred to the female twin. The analysis has to be performed with EDTA or heparin blood. Hairs with roots would lead to an incorrect result because the cells transferred are present only in the blood. The cells transferred are underrepresented when using muscle biopsies and buccal swabs and therefore may not be detected. 2. If female calves or cattle are slaughtered, female meat might be declared to be male meat, perhaps unintentionally. Because male meat receives higher prizes and higher prices are paid for exports, female meat might intentionally and deceitfully be declared to be male meat. According to European Commission (EC) Regulation 2002/765/EC of 3/5/2002, the analysis of gender determination has to be performed by PCR with primers specific for DNA fragments which are located on both the X and Y chromosomes: .
.
Forward and reverse amelogenin (Ennis and Gallagher, 1994); the length of a PCR fragment specific for the X chromosome is 280 bp, one specific for the Y chromosome is 218 bp. ZFX and ZFY forward and ZFX/ZFY reverse (Zinovieva et al., 1995); the length of a PCR fragment specific for the X chromosome is 132 bp, one specific for the Y chromosome is 282 bp.
The use of two primer pairs reduces the risk of an incorrect result. Since mutations of DNA sequences are spread over the complete genome, a mutation can also be present at any primer binding site. If this occurs at the binding site of genes located on the Y chromosome but not on the X chromosome, only the fragment specific for the X chromosome is amplified. In this case, male meat can be determined incorrectly to be female meat. The use of two independent DNA fragments for the analysis reduces the risk of a wrong result dramatically. PCR products can be detected by agarose gel electrophoresis or capillary electrophoresis (with one labeled primer per pair). In Figure 1.14, genotypes of a male and a female sample detected by CE are shown. Birds Gender determination can be necessary for bird species without external gender differences. As surgery (laparatomy) with anesthesia for gender determination can lead to the death of the birds, DNA analysis from blood or feathers is a noninvasive alternative. Normally, gender determination by DNA analysis is not performed for
APPLICATIONS
25
FIGURE 1.14 Gender determination of beef meat. Samples of male (a) or female (b) origin were analyzed by PCR with primers specific for bovine amelogenin locus. With samples of male origin, two PCR products can be detected; with samples of female origin, one PCR product can be detected.
poultry such as geese but, rather, for parrots, parakeets, and some birds of prey. For gender determination of a wide variety of birds, except the ratites (ostrich, rhea), which are sometimes grown for meat production, universal primers were used (Griffiths et al., 1998). For gender determination of cattle, PCR products can be detected by agarose gel electrophoresis or CE. In Figure 1.15 genotypes of a male and a female sample detected by CE are shown. Analysis of Special Ingredients in Food Products In modern food production different groups of additives are used, which sometimes cannot be detected or distinguished by methods other than PCR. Examples for those
FIGURE 1.15 Gender determination of birds. Samples of male parrot (a) or female parrot (b) origin were analyzed by PCR. With samples of male origin, one PCR product can be detected; with samples of female origin, two PCR products can be detected.
26
MOLECULAR BIOLOGY LABORATORY LAYOUT
additives are hydrocolloids [e.g., xanthan (E415), guar gum (E412), or locust bean gum (E410)], which are added to products such as yogurt, ketchup, or instant soup for technical reasons. However, in some cases these additives may not be declared. Xanthan, which is allowed to be added to organic food, is produced by the fermentation of wood by Xanthomonas campestris strains. Xanthan can therefore be detected with primers specific for the DNA of these bacterial strains. Cellulose and pectin are produced from the shells of apples and citrus fruits. Theoretically, these substances can be detected with primers specific, for example, for apple chloroplast genes. However, experiments have shown that for most samples the DNA was too degraded during the production process for a successful analysis. The detection of guar gum (E412) or locust bean gum (E410) is possible with primers specific for the DNA of Cyamopsis (guar bean) and Ceratonia (carob), as described elsewhere (Urdiain et al., 2004). For the analysis of food products the DNA extraction should be performed with specially developed kits. With these types of kits it is possible, for example, to extract DNA from chocolate, cheese and other milk products, or marmalade without coextraction of such PCR inhibitors as salts, fatty acids, or humid acids. Examples of kits are the food kits from MN and Genial (see Table 1.2). For some highly processed food products the DNA content might be very low. For these applications the Funnel Food Kit from MN allows lysis of the sample material in volumes up to 10 mL and the elution of the DNA into volumes less than 100 mL. PCR products can be detected with agarose gels. Bacterial Species and Antibiotic Resistance Determination As described in Chapter 6, determination of bacterial species may be necessary for pathogen detection in meat and food products: identification of infectious pathways of persons working in food production or other sensitive departments, or for identification of bacterial strains used in food production. With sequencing of PCR products of the bacterial 16S RNA gene, identification is possible if only one strain is present. For mixed samples, interpretation of sequencing data can be difficult or impossible. For this analysis at least 6 h is necessary after DNA extraction. In contrast, PCR with primers specific for single strains followed by agarose gel electrophoresis gives results in 3 to 4 h following DNA extraction. Using real-time PCR, results can be available as quickly as 2 h after DNA extraction. For both applications, kits are available from different manufacturers. For several bacterial strains, sequences of plasmids causing antibiotic resistances are known. Therefore, PCR detection of specific sequences can reduce the analysis time and accelerate the therapy. Example: Testing of Enterococcus against vancomycin and teicoplanin resistance with other methods (e.g., VITEK, bioMerieux) can lead to unclear or variable results. By PCR four different plasmids that encode for high-level resistance against vancomycin and teicoplanin (plasmid VanA), high-level resistance against vancomycin and variable resistance against teicoplanin (plasmid VanB), or lowlevel resistance against vancomycin, and practically no resistance against teicoplanin (plasmids VanC 1, VanC 2/3) can be detected specifically (Dutka-Malen et al., 1995; Ballard et al., 2005).
APPLICATIONS
TABLE 1.7 Manufacturer
Commercially Available Kits for Microsatellite Analysis Animal Species
Number of Markers
Allelic Ladder Available?
Homepage
Applied Biosystems
Cattle Horse Dog
11 16 10
no no no
www.appliedbiosystems. com/
Finnzymes
Cattle
—
no
www.finnzymes.fi
Biotype
Pork
—
yes
www.biotype.de
1.4.2
27
Microsatellites and Variable Number of Tandem Repeats
DNA Profiling By microsatellite analysis DNA fingerprints can be made from almost all mammals. Primers are published for a wide variety of mammals, birds, and fishes. For some animal species used in agriculture, commercial PCR kits are available (Table 1.7); for other species, sets of markers are available some of which were tested in ring trials (sheep, goat, pig). In contrast to the analysis of human DNA, currently no allelic ladders are commercially available for these marker sets except for porcine microsatellite analysis with a kit from Biotype. For proof of the identity of animals grown for food production or of the origin of meat, DNA profiling can be used based on several concepts: 1. DNA profiles from all animals used for breeding are collected within a database. From every offspring a DNA profile is generated, compared with the profile of the parents, and put into the database. For every marker analyzed, the offspring must have one common allele with the biological father and one with the biological mother (Figure 1.16). When, for example, the animal is sold or transported and there is any doubt about the identity, a new profile can be generated from the blood, tissue, or hairs. After the animal has been slaughtered, a sample is taken from the meat and the DNA profile is compared with the existing profile. 2. From all sires used for breeding the DNA profile is collected in a database. With a specific type of eartag, a small piece of tissue is collected during the collecting process. This tissue sample is stored until the animal loses the eartag. Before the animal gets a new eartag, the DNA is extracted from the tissue collected earlier and compared with the current DNA profile and/or with the profile of the putative father. After the animal has been slaughtered, the DNA profile from the meat can be compared with the profile of the tissue sample collected earlier. 3. From all newborn animals, tissue is collected as described above. DNA profiling is performed only if there is any doubt about the identity of the animal. The sires used for breeding are not tested in this concept. With all these concepts, controls can be exercised randomly. Depending on the statistical concept, the costs for the analysis can be reduced, but there remains a
28
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.16 Paternity testing. DNA profiles from offspring (a), dam (b), and two possible fathers (c, d) with two markers specific for canine DNA (PEZ10 and FH2361) are shown. At PEZ 10, offspring and dam share allele 283. Therefore, allele 299 present in the offspring has to be present in the biological father (present only at sample c). At FH2361, offspring and dam share allele 338. Therefore, allele 342 present in the offspring has to be present in the biological father (present at both samples c and d). From marker PEZ10, sample d could not be from the biological father of sample a.
probability of up to 99% that a wrong declaration can be detected. DNA for the analysis can be extracted from EDTA blood, heparine blood, blood spots on filter paper, tissue/ meat, bones, or teeth. It is also possible to extract DNA from hairs with roots, but hairs can be contaminated with DNA from the saliva of other animals or with feces. With most farm animals, DNA extracted from buccal swabs contains less genomic DNA from the animal. In ruminants a swab contains a large amount of saliva and bacteria from the rumen but a small amount of cells from the mucosa. In addition, PCR inhibitors from food may be present. The quantity and the quality of DNA extracted from meat should be determined by OD measurement and/or agarose gel control. Applying PCR with multiplex kits, the amount of DNA suggested by the manufacturer should be added to the PCR to provide balanced DNA profiles (Figure 1.17). Population Genetic or Animal Breed Determination For some reason it may be necessary to determine whether an individual animal is part of a specific population or breed. The first step in answering this question is to define the population or breed and identify all animals that are typical for the respective group. DNA profiles can then be generated and compared. Example 1: Information was requested from a breeding organization, the Aberdeen Angus Society, as to which sires were used most often for artificial insemination and natural insemination. Sperm samples were collected from these sires and also from
APPLICATIONS
29
FIGURE 1.17 DNA profile with 11 markers specific for bovine DNA. From left to right: (a) TGLA 227, BM2113, TGLA53, ETH10, SPS115; (b) TGLA126, TGLA122, INRA23; (c) ETH3, ETH225, BM1824.
other breeds present in the same region that could deliver meat which could wrongly be declared to be Aberdeen Angus (AA) meat. The DNA was extracted and analyzed with about 120 markers. The allele frequencies of these 120 markers from the AA samples and non-AA samples were compared. Markers were identified that show typical alleles of the AA samples and other alleles of the non-AA samples. With these markers, blind tests were performed with meat samples of known origin. All of these samples were typed correctly. Example 2: At a control on a farm, several animals without eartags were found. Normally, all such animals have to be slaughtered. According to documents of the farmer, the biological mothers of some of the animals were still on the farm, some were sold or slaughtered, but closely related animals were still present. Blood samples were collected from all animals on the farm and DNA profiles were generated. Parallel samples from other animals of the same breed were collected and analyzed. By comparison of the DNA profiles of the offspring with those of the putative parents, some of the animals could be identified. Profiles from the other animals were compared with profiles of the closely related animals of the putative mothers and the unrelated animals. The likelihood that these animals could be offspring of the animals as documented by the farmer was calculated. Example 3: A fish retailer declared smoked salmon to be wild from salmon captured in a specific river. The food analyst has doubts about this declaration; he thinks that the meat is from farmed salmon. In this case reference samples must be collected from salmon captured in the river and from salmon raised on all farms. After microsatellite analysis, allele frequencies have to be determined and the likelihood has to be calculated whether the salmon can be from the river population or from one of the farm populations. Determination of Basmati Rice Basmati rice is a long-grain rice that grows in the Himalaya region of India and Pakistan. Actually, 17 Basmati varieties are recognized (Table 1.8). Since Basmati rice
30
MOLECULAR BIOLOGY LABORATORY LAYOUT
TABLE 1.8
Approved Basmati Rice Varieties
Variety from India
Variety from India or Pakistan
Variety from Pakistan
Basmati 217 Ranbir Basmati 370 Basmati 386 Taraori Dehradun Pusa Kasturi Mahi Suganda Haryana Punjab
Basmati 370
Basmati 370 Super Kernel Basmati 198 Basmati 385
is more expensive than other long-grain rice and upon import into the European Union (EU) lower tax rates have to be paid, controls are necessary as to whether a sample contains only Basmati rice or a mixture with other rice varieties. A DNA microsatellite method was developed by the Food Standards Agency (FSA) in London to check retail sales of Basmati rice in the UK market (FSA, 2004). In the UK, Basmati is defined by a code of practice (COP) agreed to among the rice industry, retailers, and the enforcement authorities. The COP lists the varieties that can be described as Basmati (Table 1.8) and outlines a specification for the rice in which a realistic level of unavoidable contamination with non-Basmati rice varieties is set. Contamination can happen during harvesting of the rice, transport to local traders, and export into the EU. The contamination allowed following COP is a maximum of 7%. Because the detailed analysis protocol may change in the near future and because it can be retrieved from the FSA homepage on the web, only the principle of analysis is explained. About 100 g of rice is milled with a coffee grinder. From this powder DNA should be extracted in triplicate. From each of the three DNA samples, PCR is performed with at least 10 microsatellite markers (actually, the list of markers RM1, RM16, RM44, RM55, RM171, RM201, RM202, RM223, RM229, RM241). The genotypes detected are compared with known genotypes of the approved varieties. In mixtures, contamination with nonapproved varieties is documented. In 2006 a ring trial of the quantitative determination of non-Basmati rice varieties in a mixture with Basmati rice varieties was organized by the FSA. The results from 9 of the 11 participating laboratories differed by less than 0.6% from the weighted mixtures; two laboratories had bigger differences. This test demonstrated that laboratories with experience in microsatellite analysis can deliver reliable results in analyses of Basmati rice or mixtures of Basmati- and non-Basmati varieties. In Figure 1.18 profiles from Basmati rice and a mixture of Basmati and non-Basmati varieties are shown.
APPLICATIONS
31
FIGURE 1.18 DNA profiles with two markers specific for rice DNA (left marker, RM171; right marker, RM55: (a, b) two different mixtures of rice varieties Pusa and Dehradun; (c) pure sample of rice variety Pusa; (d) pure sample of rice variety Dehradun.
Similar analyses can also be made on other rice varieties, such as Jasmine rice. Authentic samples of typical Jasmine rice and of other rice varieties that can be used to minic Jasmine rice have to be collected and analyzed with a broad range of markers. The next step is performed similar to that described earlier for the establishment of a breed-specific analysis for Aberdeen Angus cattle. Basmati and Jasmine rice are both famous for their specific flavor, caused by a mutation at the putative betaine aldehyde dehydrogenase 2 (BAD2) gene, which can also be determined by DNA analysis (Bradbury et al., 2005a, b). As the predisposition “flavor” is recessive, only rice grains that are homozygous for the mutation develop the flavor (Figure 1.19) Identification of Bacterial Strains by VNTR Analysis For some bacterial strains, sequencing of 16S rRNA or real-time PCR with specific primers cannot provide all the information needed. Especially if infectious pathways have to be followed, subtyping with VNTR is the method of choice. For several bacterial species, VNTR (and STR) analysis methods are described that can be used. In Figure 1.20 DNA profiles received by VNTR analysis of Francisella strains are shown. The method can also be used to determine whether reference strains are pure or contain a mixture of two or more substrains (Bystr€ om et al., 2005).
32
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.19 DNA profiles with PCR product coding for fragrance. Rice sample contains (a) fragrant and nonfragrant grains; (b) only fragrant grains; (c) only nonfragrant grains.
1.4.3
Real-Time PCR
Determination of DNA Concentrations As described above, for several applications it is necessary to determine the DNA concentration before PCR. For DNA concentrations higher than 10 ng/mL, measurement of the DNA concentration by a determination of OD 260/280 with a photometer will lead to reliable results. These amounts of DNA can be expected after DNA
FIGURE 1.20 DNA profiles with two markers specific for Francisella DNA (left marker, FtM08; right marker, FtM21). Strain (a) can be distiguished from strains (b) and (d) by marker FtM08 and from strain (c) by marker FtM21. Strain (b) can be distiguished from strains (a), (c), and (d) by marker FtM08 and from strains (c) and (d) by marker FtM21. Strain (c) can be distiguished from strains (b) and (d) by marker FtM08 and from strains (a), (b), and (d) by marker FtM21. Strain (d) can be distiguished from strains (a), (b), and (d) by markers FtM08 and FtM21.
APPLICATIONS
TABLE 1.9
33
DNA Yield of Biological Material
Biological Material EDTA or heparin blood Muscle tissue, liver tissue Plant material Rice grains Processed food products
Average DNA Concentration of Optimally Stored or Fresh-Drawn Samples 5 ng/mL blood 40–70 mg/100 mg tissue 1–30 mg/100 mg tissue 15–300 ng/ g grains 0.1–5 mg/100 mg product
extraction from blood, fresh tissue samples, and buccal swabs with high numbers of attached cells. In Table 1.9 ranges of DNA concentrations are listed. By OD measurement, all DNA present in a sample is detected. This should be no problem for fresh-drawn or optimally stored blood or tissue samples because in this case it is expected that only DNA from the donor of the sample is present. For older or nonoptimally collected or stored buccal swabs or decomposed samples, it can happen that a part of the measured DNA comes from bacteria or fungi. In addition, for those samples the DNA yield expected will be lower than that listed in Table 1.9. Other biological material, such as teeth, bones, or connective tissue, or boiled, grilled, or smoked meat, contains less DNA. In this case a determination of DNA concentration by real-time PCR is necessary. Using a real-time instrument it is possible to determine the total amount of DNA in a sample or the amount of DNA from a specific species. Total DNA Kits are available from some suppliers to determine the concentration of DNA or RNA by staining with PicoGreen (e.g., Quant-iT PicoGreen dsDNA Assay Kit, Invitrogen). The kit also contains a control DNA of known concentration. Normally, analysis with this kit should be performed with a fluorometer, but it is also possible to perform the analysis on some real-time instruments. For this, the DNA solution is mixed with a very low concentration of PicoGreen and a melting curve is analyzed (Figure 1.21). By comparing the signal intensities of controls and samples at a specific temperature, the DNA concentration can be determined. DNA from Vertebrates For the differentiation of DNA from bacteria and the DNA from vertebrates, analysis can utilize primers specific for genomic or mitochondrial DNA. Real-time PCR with primers specific for conserved sequences of the mitochondrial cytochrome b gene detects DNA from all mammals and most fishes. For the detection of chondrichtyes (ray, shark) and prawns, other primers have to be chosen. The analysis can be performed with unlabeled primers. Amplicons can be detected by SybrGreen. For most instruments, control samples with known concentrations can be used as markers, and using these the DNA concentration of samples is calculated automatically. DNA from Specific Species For the analysis of genomic human DNA, kits from two suppliers (i.e., Applied Biosystems, Promega) are currently available. With these
34
MOLECULAR BIOLOGY LABORATORY LAYOUT
FIGURE 1.21 Different amounts of DNA were analyzed using a melting curve from a realtime PCR instrument (ABI 7900). A mixture of genomic DNA and PicoGreen melted. During cooling the DNA rehybridizes and PicoGreen intercalates with the DNA. Measured fluorescence is relative to the amount of DNA.
kits the detection of concentration of total human DNA or male human DNA is possible. Dilutions of the control DNA contained in the kit allow calculation of the concentration down to 6 pg/mL, which corresponds to one genome equivalent. Results of analysis with a Quantifiler kit from Applied Biosystems are shown in Figure 1.22. Several publications describe assays for genomic animal DNA. Analysis of short interspersed nuclear elements (SINEs) allows specific detection of DNA from many species, including cattle, horse, pig, deer, and dog. SINEs are repeated, unblocked, and dispersed throughout the genome sequences. They represent retroposons (included in the genome transcripts of intracellular RNA) and constitute more than 20% of the genome of humans and other mammals. Unique sequences could be identified for every species and used for the development of a species-specific PCR assay (Walker et al., 2003). For this application the laboratory has to prepare its own control samples with the DNA extracted from reference samples. Specific detection of DNA can also be carried out by real-time PCR with primers specific for microsatellites. Examples of microsatellites that are specific to one species are listed in Table 1.10. In principle, all DNA sequences that are known as species specific can be used for the development of an assay for the detection of DNA from specific animals, plants, or bacteria. In control experiments it must be shown that no other DNA fragments are amplified using the primers chosen. Generally, assays with primers and a specific
APPLICATIONS
35
FIGURE 1.22 Quantification of human DNA with a quantifiler kit. Serial dilutions (1:3) of human DNA leads to corresponding differences in Ct values (b) which should be located on a straight line (a) with a regression coefficient as high as 0.99.
labeled probe will be more specific and show fewer background signals than will assays with unlabeled primers and detection with SybrGreen. Assays specific for mtDNA are more sensitive than assays for genomic DNA. They can be used if analysis of mtDNA is necessary (e.g., for sequencing of human HV I and II regions) (see Chapter 6). For all assays specific for genomic DNA, the limit of detection should be 6 pg DNA per reaction for assays specific for single-copy genes (one copy per haploid genome). If the self-developed assay is less sensitive, the PCR conditions may not be optimized or the reference DNA will have a lower concentration than expected or measured. If the assay is more sensitive, it may be because the reference DNA has a higher concentration than expected or the assay detects a multicopy gene (more than one copy per haploid genome). Degradation of the DNA In most real-time PCR assays, fragments of 60 to 100 bp are amplified. For degraded DNA these short fragments can be overrepresented. This TABLE 1.10 Species-Specific Microsatellites Species Horse Cattle Pig Dog Cat
Microsatellite Marker
Fragment Size (bp)
AHT 4 TGLA 53 SW 0155 PEZ 1 F85
140–160 150–180 150–160 96–120 183–301
36
MOLECULAR BIOLOGY LABORATORY LAYOUT
can lead to failed microsatellite or other PCR analysis even when the optimal amount of DNA was given to the PCR following the results of real-time PCR analysis. To overcome this problem, species-specific PCR assays can be developed with longer fragments. The size of these fragments should correspond that of analysis by real-time PCR. Comparison of Ct values for shorter (e.g., 100 bp) and longer (e.g., 300 bp) fragments provides a hint of degradation of the DNA in the sample. Animal Species Determination (Known Species With or Without Quantification) Animal species determination in processed material or food products can be performed by PCR amplification of mitochondrial DNA followed by sequencing analysis of the product (see Chapter 6) or by RFLP. RFLP analysis can be successful only if the DNA detected is from a species with a known RFLP pattern. In addition, if DNA from only one animal is detected by sequencing analysis or RFLP, there is actually no guarantee that DNA from other species is also present at very low amounts. Low contaminations can also be detected by real-time PCR. For sequencing analysis or RFLP, PCR primers are used that amplify DNA from almost all mammals. In contrast, for real-time PCR, primers specific for each species have to be used. Example 1: DNA Analysis of Carcass Meal After DNA extraction, PCR with universal primers should be performed to exclude PCR inhibition. In addition, PCR with primers specific for species that are allowed to be processed as carcass meal (e.g., pig, chicken) and with primers specific for species that are not allowed to be processed (e.g., cattle, sheep) is carried out. Example 2: Analysis of Raw Gelatin Gelatin can be produced from both bovine and porcine material. In Europe, gelatin from pig is preferred; in other countries, gelatin from pigs cannot be used, for ethical or religious reasons. To determine whether gelatin is produced from pigs or cattle, a primer pair should be used that amplifies DNA from both species with the same efficiency. The primers have to be located in a conserved region of the mitochondrial genome, with identical sequences for pig and cattle. In addition, two probes must be designed, one specific for bovine DNA labeled with one dye (e.g., FAM) and one specific for porcine DNA labeled with another dye (e.g., VIC). This assay design has the advantage that controls are included. Since DNA extracted from gelatin has to be amplified with the primers, a negative result means that an insufficient amount of DNA was extracted from the gelatin. For pure gelatin samples one signal (FAM or VIC) is detected; for mixed samples both signals have to be analyzed. If both signals are detected, the result of the analysis should be interpreted carefully because how strong the DNA was degraded during the production process of the gelatin cannot be calculated. When analyzing cow milk products for gelatin, bovine DNA is detected in every case and it is not possible to determine whether the bovine DNA extracted is from the gelatin or from the cells of the milk. Therefore, the detection of porcine DNA cannot exclude the admixture of bovine gelatin. For milk products from sheep or goat milk, bovine DNA can be analyzed from intentional or unintentional contamination with cow’s milk or from the addition of bovine gelatin.
APPLICATIONS
37
Example 3: Analysis of Chondroitine Sulfate Chondroitine sulfate can be produced from raw material of cattle, pigs, chicken, or sharks. With universal primers for cytochrome b used for species determination, the amplification of DNA from cattle and pigs is more efficient than the amplification of DNA from chicken. DNA from shark is not amplified using these primers. Therefore, universal primers for the detection of DNA from all shark species have to be designed. Four independent realtime PCR reactions have to be carried out for the analysis. As described for the analysis of gelatin, it cannot be guaranteed that DNA will be degraded during the production of chondroitine sulfate from the various raw materials. Therefore, the quantitative results of mixed samples have to be interpreted very carefully. Amplified PCR products can be used for sequencing (e.g., to determine shark species, if necessary). ^ e A sample of duck liver p^ate was Example 4: Analysis of Duck Liver Pat declared as a mixture of 20% duck meat and liver and 80% porcine meat, liver, and fat. For PCR with universal primers for cytochrome b, amplification from porcine DNA is more efficient than that from duck DNA. Therefore, in a first sequencing analysis, no DNA from duck can be detected. However, real-time PCR with primers specific for DNA from pig and duck can confirm the ingredients declared. DNA/RNA Contamination on Surfaces and DNAse/RNAse Contamination For some applications or for quality assurance, it can be necessary to control whether instruments, surfaces, reaction tubes, or used buffers are contaminated with DNA, RNA, DNAse, or RNAse. For the detection of DNAse or RNAse, known amounts of DNA or RNA are incubated with the suspected buffers or in the tubes at 37 to 40 C for 30 to 60 min. After this, real-time PCR is performed with the untreated DNA or RNA as control. If the analysis of incubated DNA or RNA shows a higher Ct value than the control, and the internal process control gives no hint of inhibition, DNAse or RNAse was present. For the detection of DNA or RNA contaminations, humid swab samples (in TE or phosphate-buffered saline buffer) have to be collected from surfaces or instruments and the nucleic acids extracted into the TE buffer. The buffer can also be incubated in the suspected reaction tube or pipette tip. Real-time PCR is performed with universal primers specific for cytochrome b, human DNA, or any other DNA/RNA that is identified as a source of contamination in the laboratory. Detection of SNPs and InDel SNPs and InDel (Insertion/deletion) are distributed equally over the total genome of animals, plants, fungi, and bacteria. They have very low mutation rates and therefore can be used for animal or plant species determination, identification of fungi or bacterial strains, proof of identity, and authenticity testing. Detection of SNPs can be carried out on both genomic and mitochondrial DNA. For high-throughput screening of SNPs, techniques such as MALDI-TOF-MS (matrix-assisted laser desorption–Ionization time-of-flight mass spectroscopy) are used. Examples of projects are population studies/gene diagnostics, clinical studies, analysis of mitochondrial DNA or Y- chromosomal SNPs, and DNA forensics. The
38
MOLECULAR BIOLOGY LABORATORY LAYOUT
advantages of this technique are possible multiplex analyses, competitive costs per analysis (a few cents per SNP for multiplex analysis), high throughput (production of 10,000 data points per hour), and the detection of SNP and InDel in one assay or reaction. The disadvantages are that only the detection of known mutations is possible, the fixed costs are high, and a complex infrastructure is necessary for analysis. In laboratories with lower throughput, SNP detection for analysis of food or food products can be performed by real-time PCR or sequencing analysis. Detection of Genetically Modified Organisms Due to legislative guidelines (e.g., EU Guideline 90/220), it is necessary to carry out qualitative and quantitative detection of genetically modified organisms (GMOs). If GMOs are imported into the EU, the product has to be declared as a GMO and information as to how the GMO can be identified must be available. However, it has been shown in the past that this does not always happen (e.g., import of nondeclared GMO rice into the EU from the United States in 2006). Since GMO and non-GMO products are stored, transported, and processed in the same facilities, contamination of non-GMO products by GMO products can occur unintentionally. Therefore, quantitative analysis is performed to determine if the GMO content is higher than a defined threshold. For the quantitative analysis of several GMOs, reference material with different GMO/non-GMO ratios is commercially available. By an analysis of a housekeeper gene specific for the plant species, the total amount of DNA present in the single reactions could be determined. PCR is performed in parallel specifically for the sequences of the transgenic region that have been published (e.g., a promoter of cauliflower mosaic virus). From the ratio of the Ct values of the two genes of the reference samples with a known content of GMO and the samples to be analyzed, the GMO content of the samples analyzed can be determined. De novo detection of GMO is more difficult. If there is any doubt that a sample contains transgenic DNA sequences, an analysis has to be performed specifically for all known sequences used for the development of the GMO. This analysis should be done in specialized laboratories. After the new transgenic sequence is detected and published, the analysis can also be performed in other laboratories.
REFERENCES Ballard SA, Grabsch EA, Johnson PDR, Grayson ML (2005). Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli. Antimicrob. Agents Chemother., Jan., 49(1):77–81. Bradbury L, Robert H, Jin Q, Reinke RF, Waters DLE (2005a). A perfect marker for fragrance genotyping in rice. Mol. Breed., Nov., 16(4):279–283. Bradbury LMT, Fitzgerald TL, Henry RJ, Jin Q, Waters DLE (2005). The gene for fragrance in rice. Plant Biotechnol. J., 3(3):363–370. Bystr€om M, B€ocher S, Magnusson A, Prag J, Johansson A (2005). Tularemia in Denmark: identification of a Francisella tularensis subsp. holarctica strain by real-time PCR and
REFERENCES
39
high-resolution typing by multiple-locus variable-number tandem repeat analysis. J. Clin. Microbiol., Oct., 43(10):5355–5358. Dutka-Malen S, Evers S, Courvalin P (1995). Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol., 33:24–27. Gallagher ES (1994). A PCR-based sex-determination assay in cattle based on the bovine amelogenin locus. Anim. Genet., Dec. 25(6):425–427. FSA (Food Standards Agency) (2004). Survey on Basmati Rice. FSIS 47/04. Food safety and Inspection service, U.S. Department of Agriculture, Washington, DC. Gilbert W (1978). Why genes in pieces? Nature, Feb. 9, 271(5645):501. Griffiths R, Double MC, Orr K, Dawson RJG (1998). A DNA test to sex most birds. Mole. Ecol., 7(8):1071–1075. ILAC (International Laboratory Accreditation Cooperation) (2002). Guidelines for Forensic Science Laboratories. ILAC-G19:2002. ILAC, silver water, Australia. Mullis KB (1990). Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris), 48(8):579–582. Qin Y, Liu X, Zhang H, Zhang G, Guo X (2006). Segregation and linkage analysis of 75 novel microsatellite DNA markers in pair crosses of Japanese abalone (Haliotis discus hannai) using the 50 -tailed primer method. Mar. Biotechnol. (NY), Sept.–Oct. 8(5):453–466. Schubbert R (2002). Detection of microvariants and large alleles in microsatellite systems SE33/ ACTBP 2, FGA/FIBRA and D21S11. Presented at the 14th International Symposium on Human Identification. Urdiain M, Domenech-Sanchez A, Albertı S, Benedı VJ, Rosselló JA (2004). Identification of two additives, locust bean gum (E-410) and guar gum (E-412), in food products by DNAbased methods. Food Addit. Contam., 21(7):619–625. Walker JA, Hughes DA, Anders BA, Shewale J, Sinha SK, Batzer MA (2003). Quantitative intra-short interspersed element PCR for species-specific DNA identification. Anal. Biochem., May 15, 316(2):259–269. Zinovieva N, Palma G, M€uller M, Brem G (1995). A rapid sex determination test for bovine blastomeres using allele-specific PCR primers and capillary PCR. Theriogenology, 43:365.
CHAPTER 2
Polymerase Chain Reaction HERMANN BROLL € r Risikobewertung, Berlin, Germany Bundesinstitut fu
2.1
INTRODUCTION
In 1983, while driving on a moonlit California road, Kary Mullis from the Cetus Corporation came up with a simple and very elegant concept: the basic idea for the polymerase chain reaction (PCR), which solved a core problem in genetics: how to make copies of a strand of DNA in which you are interested. In 1993, Kary Mullis received the Nobel Prize in Chemistry, emphasizing the great importance of this very simple idea. At the beginning the method was slow, expensive, and imprecise. PCR turns the job over to the biomolecules that nature uses for copying DNA: two primers, which comprise the beginning and end of the DNA stretch to be copied; an enzyme called polymerase, which walks along part of the DNA, reading its code, and assembling a copy; and plenty of the DNA building nucleotides that the polymerase needs to make the copy. PCR is a technique that amplifies a specific DNA template to produce identical DNA fragments in vitro. To get enough material for subsequent analysis, traditional methods of cloning a DNA sequence into a vector and replicating it in a living cell usually require days or even weeks of work. In contrast, amplification of DNA sequences by PCR requires only minutes up to a few hours. Whereas most biochemical analyses, including nucleic acid detection with radioisotopes or fluorescence labels, require the input of significant amounts of biological material, the PCR process requires very little starting material. Thus, PCR can achieve more sensitive detection and higher levels of amplification of specific sequences in less time than can other techniques used so far. These features make the technique extremely useful not only in basic research but also in applied science, including genetic authenticity testing, forensics, industrial quality control, and in vitro diagnostics. Simple PCR has become ordinary in many molecular biology labs, where it is used to amplify DNA fragments and detect DNA or, after reverse Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
41
42
POLYMERASE CHAIN REACTION
transcription, RNA sequences in a cell or environment. Nonetheless, PCR has evolved far beyond easy amplification and detection, and many further developments of the original PCR method have been described. In this chapter we provide an overview of the PCR method, applications, and optimization. The reference section will provide a valuable guide to researchers who require more comprehensive information. 2.2
ORIGINAL PCR
The PCR process was developed originally to amplify short segments of a longer DNA molecule (Saiki et al., 1985). A typical amplification reaction includes the target DNA, a thermostable DNA polymerase, two oligonucleotide molecules used as primers, deoxynucleotide triphosphates (dNTPs), a reaction buffer, and magnesium. Once combined, the reaction is placed in a thermal cycler, an instrument that subjects the reaction to a series of temperatures for varying amounts of time. This series of temperature and time adjustments is referred to as one cycle of amplification. Theoretically, each PCR cycle doubles the amount of targeted sequence in the reaction. Today, the term amplicon is used widely, although it has been defined in conjunction with plasmids containing the origin of replication and the cleavage/packaging site of herpesvirus genomes since 1984. Theoretically, 10 cycles multiply the amount of products amplified by a factor of about 1000 in a matter of hours; 20 cycles, by a factor of more than 1 million (Figure 2.1 and Table 2.1). PCR is carried out in cycles, each of which can be separated into three phases, including steps for template denaturation, primer annealing, and primer extension
target cycle 1
cycle 2
cycle 3
cycle 4
35 to 45 cycles
Exponential amplification: 21 = 2 copies
22 = 4 copies
23 = 8 copies
24 = 16 copies
235 = 34 billion copies
FIGURE 2.1 Theoretical amplification efficiency in PCR. From a theoretical point of view, the amount of target DNA is duplicated in each individual cycle, resulting in 34 billion identical copies of the same DNA after 35 cycles.
ORIGINAL PCR
TABLE 2.1
43
Amplification Efficiency in PCR a
Theory Average amplification factor per cycle Amplification after: 10 cycles 20 cycles 30 cycles 40 cycles
In Practice 2
1.65
1.60
1.55
1.50
1.45
103 106 109 101
150 2.2 104 3.3 106 5 108
110 1.2 104 1.3 106 1.5 108
80 6.4 103 5 105 4.1 107
58 3.3 103 1.9 105 1.1 107
41 1.7 103 7 104 2.8 106
100%
82.5%
80%
77.5%
75%
72.5%
a
Depending on amplification factors in PCR, different amounts of PCR products are amplified after a certain number of cycles. Because the factor is influenced by a number of different factors not known in advance, PCR is in general a qualitative procedure. However, in practice, an amplification factor of about 75 to 80% is reachable.
(Figures 2.2 and 2.3). The initial step denatures the target DNA by heating it to 94 C or even higher for a few seconds up to 2 min. In the denaturation process, the two closely intertwined DNA strands separate from one another, producing the necessary singlestranded DNA (ssDNA) template for replication by the thermostable DNA polymerase. In the next step of a cycle, the temperature is reduced to approximately 40 to 60 C. At this temperature the oligonucleotide primers can form stable associations (anneal) with the denatured target DNA and serve as an initiation for the DNA polymerase to
FIGURE 2.2 Principle of PCR. As indicated PCR is running in cycles. Each cycle is separated in three individual steps (1, denaturation; 2, annealing; 3, polymerization), resulting in doubling the amount of target DNA. A typical PCR temperature–time profile is given in Table 2.2, and a standard PCR setup in Table 2.3.
44
POLYMERASE CHAIN REACTION 1,60E+06 1,40E+06
fluorescence
1,20E+06 1,00E+06 8,00E+05 6,00E+05
exponential phase
4,00E+05 2,00E+05 0,00E+00 0
5
-2,00E+05
10
15
20
cycles
25
30
35
40
FIGURE 2.3 Process of amplification. Two samples containing different amounts of target DNA were analyzed by PCR. In conventional PCR the amount of products amplified from samples indicated an almost similar amount at the endpoint. However, the amplification curve of the sample containing more target molecules left the background earlier, indicating a higher amount of target DNA introduced into the PCR.
synthesize a new DNA strand. This step lasts approximately 15 to 60 s. Finally, the synthesis of new DNA begins as the reaction temperature is raised to the optimum for the DNA polymerase. For most thermostable DNA polymerases, this temperature is in the range 70 to 74 C. The extension step lasts approximately 1 to 2 min. The next cycle begins again with a return to 94 C for denaturation. The original procedure used the DNA polymerase I Klenow fragment from Escherichia coli, but it had the significant drawback that between each cycle the DNA had to be denaturated and new enzyme added. Today the enzyme of choice is the Taq DNA polymerase isolated from the bacterium Thermus aquaticus YT1, which grows in the hot springs of Yellowstone National Park. The enzyme works optimally at 72 C and can withstand heating to over 90 C for short periods of time. Therefore, no more enzyme addition is necessary during 20 cycles of PCR (Saiki et al., 1988). Each step of the cycle should be optimized for each template–primer combination. In certain cases in which the temperature during the annealing and extension steps are similar, the two steps can be combined into a single step in which both primer annealing and extension take place. After 20 to 45 cycles, the products amplified may then be analyzed for size, quantity, sequence, and so on, or used in further experimental procedures. A typical PCR temperature–time profile is given in Table 2.2 and a standard PCR setup in Table 2.3. 2.3
NESTED PCR
A typical problem that occurs in PCR analysis is the very low presence of template DNA isolated from the various samples in the reaction. Although in theory only one
NESTED PCR
TABLE 2.2
45
Example Temperature–Time Program Temperature ( C)
Step Initial denaturation a Denaturation Annealing Extension Final extension Hold
95 95 42–65 b 72 72 4
Time (min) 2 0.5–1 0.5–1 1 min/kb b, c 7 Indefinite
Number of Cycles 1 25–45 1 1
a The thermal cycling protocol has an initial denaturation step where samples are heated at 95 C for 2 min to ensure that the target DNA is denatured completely. This step is also necessary for the activation of today’s most used hot-start Taq DNA polymerase, which is inactive until an initial heating step at 95 C. b Annealing temperature needs to be optimized for each primer set based on the primer melting temperature. c The extension time should be at least 1 min per kilobase pair of target DNA. Typically, target DNA smaller than 1 kb uses a 1-min extension; for target DNA >1 kb, 2 or even more minutes are necessary.
target molecule should be sufficient to generate a positive signal in PCR, in reality it is often not the case. Above 40 cycles, an increase in the number of cycles will not give a satisfying result because of a tendency to generate more background amplification products. A way to overcome this problem and generate a positive signal even from a very low level of target DNA is known as nested PCR. The principle is quite simple and
TABLE 2.3
Standard PCR Reagents a
Reagent
Volume
Final Concentration
Sterile water 10 PCR buffer b MgCl2 dNTP solution, 10 mmol/L Primer 1 c Primer 2 c Taq DNA polymerase, 5 IU/mL Template DNA Final volume
Variable 5 mL Variable 1 mL Variable Variable 0.4 mL Variable 50 mL
1 1.0–2.5 mmol/L 0.2 mmol/L 0.1–1.0 mmol/L 0.1–1.0 mmol/L 2 IU 0.1–1.0 mg
a
A standard PCR is running at a volume of 50 mL. However, if the procedure is optimized, the total volume can be decreased even to 10 mL. b Taq buffer (10) 600 mM Tris-HCl (pH 9.5, room temperature), 150 mM (NH4)2SO4, and 20 mM MgCl2. c The primer sequences should have the following characteristics wherever practicable: .
Length of each primer ¼ 18 to 30 nucleotides.
.
Optimal annealing temperature 60 C (established experimentally; i.e., estimated melting temperature 65 C).
.
GC/AT ratio ¼ 50 : 50 if possible, or as close to this ratio as possible. Avoid concentration of G’s and C’s in short segments of primers (internal high stability).
.
No 30 -end complementarity, to avoid primer–dimer formation.
.
No internal secondary structure.
.
No possible dimer formation with other primers used in multiplex PCR.
.
46
POLYMERASE CHAIN REACTION
based solely on two independent subsequently performed PCR routines. As a target for the second PCR, the amplified products generated in the first PCR are used. The primer pair used in the second PCR needs to be complementary and anneals within the DNA sequence amplified first. By doing this, the background DNA amplified is reduced drastically, due to the selection of the primer pair used in the second PCR, resulting in more specific amplified product afterward. In addition, the sensitivity is increased.
2.4
MULTIPLEX PCR
Multiplex PCR is a variant of PCR that enables simultaneous amplification of several targets of interest in one reaction by using more than one pair of primers. A primary reason to run multiplex PCR is to save money and time when analyzing a lot of samples in parallel. Since its description in 1988 by Chamberlain et al. this method has been employed in many areas of DNA testing, including analyses of deletions, mutations, and polymorphisms, or quantitative assays and reverse transcription PCR. Typically, it is used for genotyping applications where simultaneous analysis of multiple markers is required, the detection of pathogens or the parallel identification of genetically modified organisms (GMOs), or for microsatellite analyses. Multiplex assays can be tedious and time consuming to establish, requiring lengthy optimization procedures. However, attempts to combine more than three to five primer pairs in just one single reaction often fails, because the limit of detection for one or the other target is decreased significantly. In particular, if the presence of different targets varies drastically, multiplexing becomes very complicated. It seems to be very tricky in practice to establish multiplex PCR and is therefore not recommended.
2.5
PCR CONTROLS
In theory, PCR is able to generate a positive signal if only one or a very few target molecules are present in the reaction. Therefore, it is a very powerful tool in various approaches to identify trace amounts of agents such as viruses, bacteria, or even GMOs. This unique advantage, on one hand, is also a disadvantage on the other, due to the possibility of contamination, resulting in false-positive signals. To avoid such cases or at least to identify such contaminations, appropriate positive (analyte present) and negative (analyte absent) controls should be included at each step of the analysis. Some controls should follow the samples to be analyzed in the successive steps of an analysis. Additional controls should be included at regular intervals and always if one of the other controls does not yield the results expected and when contamination is suspected. An exhaustive list of various controls applied in PCR follows. 1. Positive DNA target control: reference DNA or DNA extracted from a certified reference material or known positive sample representative of the sequence or organism under study. The control is intended to demonstrate what the result of analyses of test samples containing the target sequence will be.
ANALYSIS OF PCR PRODUCTS
47
2. Negative DNA target control: reference DNA or DNA extracted from a certified reference material or known negative sample not containing the sequence under study. The control is intended to demonstrate what the result of analyses of test samples not containing the target sequence under study will be. 3. PCR inhibition control: control containing a known amount of positive template DNA added in the same amount of analyte DNA as the reaction (that is to be controlled) (this could be the original target or a spike, e.g., a slightly modified target such as a competitor plasmid). This control allows determination of the presence of soluble PCR inhibitors, particularly necessary in the case of negative amplification. 4. Amplification reagent control: control containing all the reagents except test sample template DNA extracted. Instead of the template DNA, a corresponding volume of nucleic acid–free water is added to the reaction. 5. Extraction blank control: control performing all steps of the extraction procedure except addition of the test portion (e.g., by substitution of water for the test portion). It is used to demonstrate the absence of contaminating nucleic acid during extraction. If many PCR analyses are performed on DNA extracted in separate series, all the appropriate extraction blank controls are included. It can also be used instead of the amplification reagent control. 6. Positive extraction control: control sample meant to demonstrate that the nucleic acid extraction procedure has been performed in a way that will allow for extraction of the target nucleic acid (i.e., by using a sample material known to contain the target nucleic acid).
2.6
ANALYSIS OF PCR PRODUCTS
Independent of the starting copy number of target molecules and number of cycles performed in PCR, the products amplified are not visible in the reaction vessel! It is necessary to run a post-PCR gel electrophoresis to identify the amplified product predicted and to assess the sample under investigation. In the case of nucleic acids the preferred matrix is purified agarose (a component of agar, which is a red seaweed extract), which forms a solid but porous matrix that looks and feels like clear gelatine dessert. For DNA, the direction of migration, from negative to positive electrodes, is due to the natural negative charge carried on their sugar–phosphate backbone. Doublestranded DNA fragments naturally behave as long rods, so their migration through the gel is relative to their size. Shorter molecules move faster and migrate farther than longer ones. Increasing the concentration of agarose in the gel reduces the migration speed and enables separation of smaller DNA molecules. The higher the voltage, the faster the DNA migrates. However, voltage is limited by the fact that it heats and ultimately causes the gel to melt. High voltages also decrease the resolution (above about 5 to 8 V/cm) (Sambrook and Russell, 2001). The most common dye used for agarose gel electrophoresis is ethidium bromide (EtBr). It fluoresces under ultraviolet (UV) light when intercalated into DNA. By running DNA through an EtBr-treated gel and visualizing it with UV light, distinct bands of DNA become visible (Figure 2.4).
48
POLYMERASE CHAIN REACTION
FIGURE 2.4 Agarose gel electrophoresis of PCR products. Along with the PCR products, reference DNA fragments are separated to estimate the size of fragments amplified by PCR.
A range of issues important to the analysis of PCR products are discussed below. Denaturation Denaturation is a very fast step in the process, which starts at a temperature above 70 C. All reaction components are very sensitive with respect to increasing temperatures: The DNA polymerase as well as nuleotides begin to denaturate; template DNA and primer will depurinate by high temperatures. Therefore, temperature as well as time should be selected carefully and reduced to a minimum. In practice, a few seconds (ca. 5 s) are enough to separate the double-stranded DNA molecules. However, at the beginning of the PCR process, an initial denaturation step of approximately 2 min should be used to generate only single-stranded template DNA. Annealing The temperature in the annealing phase is most heavily dependent on primer length and the sequence used. A variety of computer programs are available to calculate the theoretical melting point (Tm) and secondary structure of the primers chosen. All possible calculations are only theoretical considerations. The most convenient and simplest way to calculate Tm for a given primer is based on the GC content and is called a 2 þ 4 rule: Tm ¼ 4ðnumber of G and CÞ þ 2ðnumber of A and TÞ This approximation is valid only for short primers (up to 20 bases). A more sophisticated calculation is the nearest-neighbor approach (Breslauer et al., 1986),
ANALYSIS OF PCR PRODUCTS
49
also taking into account the primer sequence and the fact that nucleotides influence their neighbors. The melting temperature alone is defined as the temperature at which 50% of the primers are no longer annealed to the target; it does not determine reliably the temperature at which the primer is hybridized to the target sequence. Therefore, it is advisable to determine the most appropriate annealing temperature empirically at a temperature 5 to 10 C lower with respect to the one calculated theoretically. Elongation The polymerization time depends on the length of the amplified PCR product predicted. If too-short a temperature is chosen, DNA polymerase cannot complete the polymerization; if it is chosen for too long a period of time, false, nonwanted DNA could be synthesized. Typically, 0.5 to 1 min per 1 kb of amplified product length is calculated if Taq DNA polymerase is used. For proofreading polymerases, a prolonged time should be considered. PCR Efficiency In a simplified way it is considered that during each individual PCR cycle the amount of DNA is duplicated. Based on this assumption the introduction of only one starting template molecule in PCR will result in 1 billion identical copies of the template after 30 cycles and a trillion copies after 40 cycles. If a single molecule 1 kb in length is used as a template, it would endup in 1 mg of amplified products, which is a significant amount of DNA! Unfortunately, this does not reflect what is really going on in the reaction. In reality, the amplification factor is between 1.6 and 1.7 on average; sometimes it is a bit better, sometimes a bit worse (Figure 2.4). The efficiency is not the same even over the entire PCR process. At the beginning the efficiency is lower, probably due to the low probability that template, primer, and Taq DNA polymerase need more time to find each other to establish a complex initiating amplification. During the accumulation of amplified products the efficiency here increased close to 100%. After a certain number of cycles the efficiency decreased again, due to residuals such as the pyrophosphates accumulating as the result of the hydrolyzation of dNTPs. Moreover, the DNA polymerase will be affected by the temperature shift and the products amplified will rehybridize, avoiding the annealing of primers to their complementary sequence. Template Quality The quality of the DNA introduced into PCR is of critical importance. Highly purified template DNA and the absence of inhibitors are the best guarantee of enormous quantities of amplified products. Thus putting a lot of effort into this step of the analysis is highly recommended. Today, a variety of extraction protocols are available from different suppliers, including all components required to get sufficient amounts of DNA from various samples. In particular, for bacterial suspensions and for mammalian cell cultures, ready-to-use kits are on the market. For food samples there are also kits developed to extract amplifiable DNA from the sample. Moreover, the integrity of the
50
POLYMERASE CHAIN REACTION
template DNA influences the outcome of the PCR and hence the analytical results obtained. The applicability of a specific method may therefore depend on whether the sample or material to be analyzed is processed or refined or neither, and on the degree of degradation of the DNA. Template Quantity The amount of template DNA necessary for successful amplification depends on the complexity of the DNA sample. For example, for 4 kb of viral genomic DNA containing a 1-kb target sequence, 25% of the input DNA is the target of interest. Conversely, a 1-kb target sequence in the soybean genome (1.1 109 bp) represents approximately 0.00001% of the DNA input. Thus, approximately 1,000,000-fold more soybean genomic DNA is required to maintain the same number of target copies per reaction. Common mistakes include inputting too much DNA, too much PCR product, or too little genomic DNA as the template. Reactions with too little DNA template will result in low yields; reactions with too much DNA template can be afflicted by nonspecific amplification. As a general role, approximately 104 copies of the target DNA should be used to obtain a signal in 25 to 30 cycles, but the final DNA concentration of the reaction should be kept at or below 10 ng/mL. When reamplifying a PCR product, the concentration of the specific PCR product is often not known. Therefore, the previous amplification reaction should be diluted at least 1:10 to 1:10,000 before reamplification. . . . . .
1 mg 1 mg 1 mg 1 mg 1 mg
of of of of of
1 kb dsDNA ¼ 9.12 1011 molecules pUC19 Vector DNA ¼ 2.85 1011 molecules lambda DNA ¼ 1.9 1010 molecules E. coli genomic DNA ¼ 2 108 molecules soybean genomic DNA ¼ 8.48 105 molecules
Taking into account the calculations above and that in theory only one target molecule is sufficient to be amplified in PCR, it is obvious that 1 mg of soybean DNA does contain more than enough DNA. From a practical point of view it is usually recommended that the sample DNA be diluted rather than concentrating the DNA amount in PCR in order to get a positive signal. Failure of amplification in PCR is probably due to the presence and accumulation of inhibitors after extraction of DNA from samples rather than the low presence of target molecules. Buffer Almost all reaction buffers contain as a buffering agent Tris-based buffer and salt, commonly KCl. The buffer regulates the pH of the reaction, which finally affects the DNA polymerase activity and fidelity. The highest activity of the Taq DNA polymerase is observed above pH 8. Modest concentrations of KCl increase DNA polymerase activity by 50 to 60% over activities in the absence of KCl; 50 mM KCl is considered optimal (Gelfand, 1989).
ANALYSIS OF PCR PRODUCTS
51
MgCl2 Concentration Magnesium is an essential cofactor for thermostable DNA polymerases, and the magnesium concentration is a crucial factor in the success of amplification. Template DNA concentration, chelating agents present in the sample (e.g., EDTA or citrate), dNTP concentration, and the presence of proteins could all affect the amount of free magnesium in PCR. In the absence of adequate free magnesium ions, Taq DNA polymerase is totally inactive. An excess of free magnesium reduces the enzyme fidelity and possible increases the level of nonspecific amplification. Therefore, the optimal magnesium concentration should be determined empirically for each reaction. To do so, a series of reactions containing 1.0 to 4.0 mM Mg2þ in increments of 0.5 to 1.0 mM should be performed and the results visualized in order to determine which magnesium concentration produced the highest yield of product and the minimum amount of nonspecific product. The effect of magnesium concentration and the optimal concentration range can vary with the particular Taq DNA polymerase used. Many Taq DNA polymerases are supplied with a magnesium-free reaction buffer along with a tube of 25 mM MgCl2, so the most appropriate Mg2þ concentration can be adjusted for each reaction. Magnesium chloride solutions can form concentration gradients as a result of multiple freeze–thaw cycles, and vortex mixing is required to obtain a uniform solution. This step eliminates the cause of many failed experiments. It is sometimes preferred to use reaction buffers that already contain MgCl2 at a final concentration of 1.5 mM. However, it should be noted that Hu et al. (1992) reported the performance variability of reaction buffer solutions containing magnesium. The free magnesium changes of 0.6 mM observed in their experiments affected amplification yields dramatically in an allele-specific manner. The authors found that heating the buffer at 90 C for 10 min restored the homogeneity of the solution. They postulated that magnesium chloride precipitates as a result of multiple freeze–thaw cycles (Hu et al., 1992). Primer Design PCR primers typically range from 18 to 25 nucleotides long and are designed to flank the target DNA region of interest. Primers should have 40 to 60% GC content, and care should be taken to avoid sequences that might produce intermolecular or intramolecular secondary structure. To avoid the development of primer–dimers, the 30 ends of the primers should not be complementary. Primer–dimers unnecessarily sequester primers away from the reaction and result in an unwanted polymerase reaction that is in competition with the intended PCR product. Three G or C nucleotides in a row near the 30 end of the primer should be avoided, as this may result in nonspecific primer annealing, increasing the synthesis of undesirable products. Intramolecular regions of secondary structure can interfere with primer annealing to the template and should also be avoided. Ideally, the Tm value of the primer pair, at which 50% of them are annealed to the complementary target DNA, should be within 5 C, allowing both primers to anneal at approximately the same temperature. Finally, the annealing temperature of PCR is dependent on the primer with the lowest Tm value. However, higher annealing temperatures improve the stringency of primer annealing, resulting in more specific product.
52
POLYMERASE CHAIN REACTION
Several software packages are available to aid in primer design, and it is strongly recommended that they be taken into consideration. PCR Enhancers and Additives The addition of enhancing components can influence the PCR and therefore increase the yield of the intended product or decrease the production of undesired products. Many PCR enhancers are described in the literature that can act through a number of different mechanisms. These reagents do not enhance all PCRs; the beneficial effects are very often template and primer specific, and it will be necessary to determine the effect empirically. Some of the most common enhancing reagents are discussed in more detail below. Among them, dimethyl sulfoxide (DMSO) (up to 10% v/v) and formamide (up to 5% v/v) can be helpful when amplifying GC-rich templates and templates that form strong secondary structures, which can cause DNA polymerases to hold up in DNA synthesis. GC-rich templates can be problematic due to inefficient separation of the two strands of DNA or the tendency for the complementary, GC-rich primers to form intermolecular secondary structures, which will compete with primer annealing to the template. DMSO and formamide are thought to reduce the amount of energy required to separate the strands of DNA templates by interfering with the formation of hydrogen bonds between the two strands of DNA (Geiduschek and Herskovits, 1961). Concentrations of DMSO greater than 10% and formamide greater than 5% can inhibit Taq DNA polymerase as well as other DNA polymerases. In some cases, general stabilizing agents such as bovine serum albumin (BSA) (0.1 mg/mL), gelatine (0.1 to 1.0%) and nonionic detergents (0 to 0.5%) can overcome failures to amplify a region of DNA. These additives can increase Taq DNA polymerase stability and reduce the loss of reagents through adsorption to the tube walls. Nonionic detergents such as PEG 6000, Tween-20, and Triton X-100 have the added benefit of overcoming the inhibitory effects of trace amounts of strong ionic detergents, such as 0.01% sodium dodecyl sulfate (SDS). Ammonium ions can make amplification more tolerant of nonoptimal conditions. Therefore, some reactions include 10 to 20 mM (NH4)2SO4. Additional PCR enhancers mentioned in the literature are glycerol (5 to 20%), polyethylene glycol (5 to 15%), and tetramethylammonium chloride (60 mM). Primer Concentration The primer concentration can also influence the yield of PCR products. A concentration of 0.2 mM of each primer is usually chosen. If the yield of PCR products is low, a higher concentration can be adjusted, but it should exceed a concentration of 2 mM, because the yield will decrease again. The purity of synthesized primers should be considered if it is intended to run critical applications. Then HPLC-purifed primers often improve the result of PCR. Number of Cycles Starting with a certain amount of product (ca. 0.3 to 1 pmol) during the PCR process, a “plateau effect” decreases the efficiency significantly. This is due to the accumulation
ANALYSIS OF PCR PRODUCTS
53
of pyrophosphates, the reduced amount of primers/oligonucleotides present in the reactions, and the amount of intact Taq DNA polymerase decreased during the several times the reaction has been heated up to 95 C. In reality, the majority of amplified products are no more specific, resulting in a higher background. This can be observed during electrophoresis as a smear background along with the PCR product amplified. Therefore, the number of cycles should be selected where the plateau effect begins. It should also be noted that the number of cycles is not the appropriate way to distinguish between positive and negative samples. Cases where only after a large number of cycles (more than 40) can a positive signal be obtained indicate either contamination or nonproper selection of primers. The procedure should then be newly designed and tested before use in routine analysis. Thermostable DNA Polymerases Prior to the use of thermostable DNA polymerases in PCR, scientists had to supplement the reaction laboriously with new enzyme (such as Klenow or T4 DNA polymerase) after each denaturation cycle at 95 C. The identification of thermostable DNA polymerases revolutionized PCR because of their ability to withstand high denaturation temperatures. The use of thermostable DNA polymerases also allowed higher annealing temperatures, which improved the stringency of primer annealing. Although the temperature optima of thermostable DNA polymerases are around 70 C, they are not inactive at other temperatures. For example, Taq DNA polymerase is a processive enzyme with an extension rate above 3600 nucleotides/min at 70 C, so an elongation step of 1 min for 1 kb to be amplified is sufficient to produce full-length PCR products. At 55 C the Taq DNA polymerase can synthesize approximately 2800 nucleotides/min, and even at 37 C approximately 1400 nucleotides/min are polymerized to get a full-length DNA strand. The thermostable DNA polymerases can be divided into two groups: those with a 30 ! 50 exonuclease (proofreading) activity, such as Pfu DNA polymerase, and those without the proofreading function, such as Taq DNA polymerase. Both groups have some important differences. Proofreading DNA polymerases are significantly more accurate than nonproofreading polymerases, due to the 30 ! 50 exonuclease activity, which can remove a false-incorporated nucleotide from an extended chain of singlestranded DNA. When the amplified product is to be cloned in a subsequent procedure, Pfu DNA polymerase (derived from Pyrococcus furiosus) or Pwo DNA polymerase (derived from P. woesei) is a better choice, due to its high fidelity. Pfu DNA polymerase has one of the lowest error rates of all known thermostable DNA polymerases used for amplification, due to the highly active 30 ! 50 exonuclease activity (Cline et al., 1996). For cloning and expressing DNA after PCR, Pfu DNA polymerase is the enzyme of choice. Pfu DNA polymerase can be used alone for the amplification of DNA fragments up to 5 kb by increasing the extension time to 2 min/ kb. However, the proofreading activity can shorten PCR primers, leading to decreased yield and increased nonspecific amplification. This exonucleolytic attack can effectively be avoided by initiating the reaction using hot-start PCR or by introducing a single phosphorothioate bond at the 30 termini of the primers (Byrappa et al., 1995).
54
POLYMERASE CHAIN REACTION
However, for routine analysis, where simple detection of an amplified product is the aim, Taq DNA polymerase is the most commonly used enzyme because yields tend to be higher with a nonproofreading DNA polymerase. Amplification with nonproofreading DNA polymerases results in the template independent addition of a single nucleotide to the 30 end of the PCR product. The single-nucleotide overhang can simplify the cloning of PCR products (A overhang) (Zhou et al., 1995). In contrast, blunt-ended PCR products that are the result of use of a proofreading DNA polymerase need to be cloned into a blunt-ended vector system (Clark, 1988; Hu, 1993). Proofreading DNA polymerases are also used in combination with nonproofreading DNA polymerases, or amino-terminally truncated versions of Taq DNA polymerase, to amplify longer fragments of DNA with greater accuracy than for nonproofreading DNA polymerase alone. The classical Taq DNA polymerase is isolated from T. aquaticus and catalyzes the primer-dependent incorporation of nucleotides into duplex DNA in the 50 ! 30 direction in the presence of Mg2 þ . The enzyme does not possess 30 ! 50 exonuclease activity but has a 50 ! 30 exonuclease activity. The Taq DNA polymerase is isolated from T. aquaticus and suitable for most PCR amplifications that do not require a specific high-fidelity enzyme, such as the detection of specific DNA or RNA sequences. However, the error rate of Taq DNA polymerase is approximately 1 105 errors/base and also depends on the reaction conditions. The fidelity is slightly higher at lower pH, lower magnesium concentration, and relatively low dNTP concentration (Eckert and Kunkel, 1990, 1991). Taq DNA polymerase is normally used to amplify PCR products of 5 kb or less. PCR products in the range of 5 to 10 kb can be amplified with Taq DNA polymerase but often require more optimization than do smaller PCR products. For products larger than approximately 10 kb, it is recommended that an enzyme or enzyme mix and reaction conditions be chosen that are designed specifically for long amplification products. Because Taq DNA polymerase is a nonproofreading polymerase, PCR products generated with Taq DNA polymerase will contain a single-nucleotide 30 overhang, usually a 30 A overhang. The characteristics of Tth DNA polymerase (derived from Thermus thermophilus) is similar to those of the Taq DNA polymerase and catalyze the polymerization of nucleotides into duplex DNA in the 50 ! 30 direction in the presence of Mg2 þ ions. The enzyme is also capable of catalyzing the synthesis of DNA using an RNA template in the presence of MnCl2 (Myers and Gelfand, 1991). Therefore, no further reverse transcriptase (RT) is necessary to generate a DNA template for subsequent PCR analysis. For primer extension and RT-PCR and cDNA synthesis using RNA templates with complex secondary structure, the high reaction temperature of Tth DNA polymerase may be an advantage over that of more commonly used reverse transcriptases such as the AMV and M-MLV transcriptases. Tth DNA polymerase shows a 50 ! 30 exonuclease activity but lacks detectable 30 ! 50 exonuclease activity. The error rate of Tth DNA polymerase has been determined to be approximately 7.7 105 error/base. Tth DNA polymerase has been reported to be more resistant to inhibition by blood components than are other thermostable polymerases (Ehrlich et al., 1991). Characteristics of the DNA polymerases described above are summarized in Table 2.4.
HOT-START PCR
TABLE 2.4
Characteristics of Commonly Used Thermostable DNA Polymerases
50 ! 30 DNA polymerase activity Processivity 50 ! 30 exonuclease activity 30 ! 50 exonuclease activity (proofreading) Producing A overhang Reverse transcriptase activity Approximate error rate
2.7
55
Taq
Pfu, Pwo
Tth
þ High þ þ 105
þ High þ þ þ 105
þ High þ þ 106
HOT-START PCR
Today, hot-start PCR is most common technique used to reduce nonspecific amplification due to the assembly of amplification reactions at room temperature or on ice. At room temperature, PCR primers can anneal to template sequences that are not totally complementary. Since thermostable DNA polymerases have activity at these low temperatures, the polymerase can extend misannealed primers. This newly synthesized DNA is 100% complementary to the DNA template, allowing primer extension and the polymerization of undesired amplification products. However, if the reaction is heated to temperatures above 60 C before polymerization begins, the stringency of primer annealing is increased, and subsequent synthesis of undesired PCR products is avoided or reduced. Hot-start PCR can also reduce the amount of primer–dimer formation by increasing the stringency of primer annealing. At lower temperatures, the primers can anneal to each other via regions of complementarity, and the DNA polymerase can extend the annealed primers to produce primer–dimer, which can often be observed as a diffuse band of approximately 50 to 100 bp on an ethidium bromide–stained gel. The formation of nonspecific amplification products and primer–dimer can compete for reagent availability with the amplification of the product desired. Therefore, hot-start PCR can improve the yield of the specific PCR products. To carry out hot-start PCR, the reactions are assembled on ice or at room temperature, but one critical component is omitted until the reaction has been heated to 60 to 65 C, at which point the missing reagent is added. This omission prevents the polymerase from extending primers until the critical component is added at the higher temperature, where primer annealing is more stringent. However, this method is tedious and increases the risk of contamination. A second, much less labor-intensive approach involves the reversible inactivation or physical separation of one or more critical components in the reaction. For example, the magnesium or DNA polymerase can be sequestered in a wax bead, which melts during the reaction as it is heated to 94 C, releasing the component only at higher temperatures. Alternatively, the DNA polymerase can be kept in an inactive state by binding to an oligonucleotide, also known as an aptamer (Dang and Jayasena, 1996; Lin and Jayasena, 1997) or an
56
POLYMERASE CHAIN REACTION
antibody (Scalice et al., 1994). The bond is irreversibly disrupted at the denaturation temperature, releasing the functional DNA polymerase.
2.8
PCR EQUIPMENT
In early PCR experiments, scientists had to rely on a series of water baths to maintain the various temperatures required in order to keep the amplification process ongoing. Cycling involved manual transfer of samples from one water bath to another at specified times. In 1988, Perkin-Elmer introduced the thermal block cycler, a revolutionary device that increased and decreased the temperature of samples automatically and repetitively during the PCR process. This allowed the PCR analysis to be automated. Subsequent refinements of this device extended the flexibility and accuracy of PCR. Today, several suppliers, including Applied Biosystems, Roche Diagnostics, Stratagenes, and Eppendorf, offer thermal cyclers. It is important to validate a certain PCR system before it is used on devices from different suppliers, because ramp rates (time needed for heating and cooling) differ. In the past a drop of mineral oil was used to prevent condensation and evaporation of the liquid. Modern thermal cyclers use a heating lid that reduces the need for the addition of mineral oil.
2.9
LABORATORY ORGANIZATION
Compliance with applicable requirements with respect to safety regulations and manufacturers’ safety recommendations should be assured. Accidental DNA contamination is known to originate from dust and spreading aerosols. As a consequence, the organization of the work area in the laboratory is based logically on the systematic containment of the methodological steps involved in production of the results and a forward-flow principle for sample handling. A minimum of three separately designated contained/dedicated working areas with their own apparatus are required: 1. A working area for extraction of the nucleic acid from the test material 2. A working area dedicated to the setup of PCR/amplification reactions 3. A working area dedicated to subsequent processing, including analysis and characterization of the amplified DNA segments If dust particle–producing grinding techniques are used, they must be carried out in a separate working area. Physical separation through the use of different rooms is the most effective and preferable way of ensuring separate working areas, but other physical or biochemical methods may be used as a protection against contamination provided that their effectiveness is comparable. Laboratory staff should wear different sets of lab coats in each dedicated working area and should wear disposable gloves. Where possible, powdered gloves should be avoided for pre-PCR operations, since the powder can inhibit PCR. Gloves and lab coats should be changed at appropriate
REFERENCES
57
frequencies. All PCR procedures should be carried out under substantially noncontamination conditions. Carryover Contamination The major problem of false-positive signals in PCR occurs frequently even though all individual steps are physically separated. In case all necessary reagents are aliqouted, the easiest way is to take a new aliquot and repeat the analysis. In a few cases this is not enough; false-positives still occur. Then the scientist has two possibilities for continuing with detection of the target DNA: 1. If the DNA sequence is known, an alternative primer pair can be designed, where at least one the primer anneal outside the previous amplification product. Subsequently, PCR can be optimized and applied again. 2. As a prevention tool, thymidine phosphate as part of the dNTP mix can be partially sustituted for by uracyl prior to the PCR. The amplification efficiency of PCR will not be affected. In case carryover contamination occurs, an additional pre-PCR step can be carried out: applying the enzyme uracyl-N-glycosyslate (UNG) at 50 C for 30 min. UNG identifies uracyl incorporated into the DNA and modifies the carbon bonds, resulting in DNA degradation during the initial denaturation step at 95 C. The UNG is degraded, too; thus all contaminating amplified products are destroyed. The addition of UNG is necessary only if contamination occurs. The addition of dUTP is the prerequisite to use of this approach. It should be noted that dUTP hinders subsequent steps, such as cloning or restriction analysis.
REFERENCES Breslauer KJ, et al. (1986). Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. USA, 83:3746–3750. Byrappa S, et al. (1995). A highly efficient procedure for site-specific mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Res., 5:404–407. Chamberlain JS, et al. (1988). Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res., 16:11141–11156. Clark JM (1988). Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res., 16:9677–9686. Cline J, et al. (1996). PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Res., 24:3546–3551. Dang C, Jayasena SD (1996). Oligonucleotide inhibitors of Taq DNA polymerase facilitate detection of low copy number targets by PCR. J. Mol. Biol., 264:268–278. Eckert KA, Kunkel TA (1990). High fidelity DNA synthesis by the Thermus aquaticus DNA polymerase. Nucleic Acids Res., 18:3739–3744. Eckert KA, Kunkel TA (1991). DNA polymerase fidelity and the polymerase chain reaction. PCR Methods Appl., 1:17–24. Ehrlich HA, et al. (1991). Recent advances in the polymerase chain reaction. Science, 252: 1643–1651.
58
POLYMERASE CHAIN REACTION
Geiduschek EP, Herskovits TT (1961). Nonaqueous solutions of DNA. Reversible and irreversible denaturation in methanol. Arch. Biochem. Biophys., 95:114–129. Gelfand DH (1989). Taq DNA polymerase. In Erlich HA (ed.), PCR Technology: Principles and Applications of DNA Amplifications. Stockton Press, New York, pp. 17–22. Hu G (1993). DNA polymerase-catalyzed addition of non-templated extra nucleotides to the 30 end of a DNA fragment. DNA Cell Biol., 12:763–770. Hu CY, et al. (1992). Effect of freezing of the PCR buffer on the amplification specificity: allelic exclusion and preferential amplification of contaminating molecules. PCR Methods Appl., 2:182–183. Lin Y, Jayasena SD (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. J. Mol. Biol., 271:100–111. Myers TW, Gelfand DH (1991). Reverse transcription and DNA amplification by a Thermus thermophilus DNA polymerase. Biochemistry, 30:7661–7666. Rychlik W, et al. (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res., 18:6409–6412. Saiki RK, et al. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239:487–491. Saiki R, et al. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230:1350–1354. Sambrook J, Russell DW (2001). Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Scalice E, et al. (1994). Monoclonal antibodies prepared against the DNA polymerase from Thermus aquaticus are potent inhibitors of enzyme activity. J. Immunol. Methods, 172:147–163. Zhou MY, et al. (1995). Universal cloning method by TA strategy. Biotechniques, 19:34–35.
CHAPTER 3
Quantitative Real-Time PCR HERMANN BROLL € r Risikobewertung, Berlin, Germany Bundesinstitut fu
3.1
INTRODUCTION
Invention of the polymerase chain reaction (PCR) by Kary Mullis in the 1980s revolutionized almost everything in molecular biology. PCR is a fairly standard procedure now, and its use is extremely wide ranging: from basic research up to clinical or other diagnostic purposes. At its most basic application, PCR can amplify a small amount of template DNA into large quantities in a few minutes or hours. This is carried out by mixing the DNA with primers on both sides of the DNA (forward and reverse), Taq polymerase (of the species Thermus aquaticus, a thermophile bacterium whose polymerase is able to withstand extremely high temperatures), free nucleotides [deoxynucleotide triphosphates (dNTPs) for DNA], and buffer containing MgCl2. Applying a specific temperature–time program with alternating hot and cold conditions to denature and reanneal the DNA, the polymerase synthesizes new complementary strands each time. PCR is an integral addition to the molecular biologist’s toolbox, and the method has been improved continually over the years. Fairly recently, a new method of PCR quantification was invented called real-time PCR. It allows scientists to actually view the increase in the amount of DNA as it is amplified. Several different types of real-time PCR are being marketed to the scientific community at this time, each with its own advantages. In this chapter we provide a more detailed view of one of these, TaqMan real-time PCR, and provide an overview of three other types of real-time PCR: molecular beacons, scorpions, and Sybr Green. Basic PCR is an endpoint application in which the amplified target is identified only after the last cycle of the PCR process has finished and a gel electrophoresis is carried out separating the amplified product according to its molecular weight. Because PCR is an exponential procedure in which small variations in the amount of target
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
59
60
QUANTITATIVE REAL-TIME PCR
molecules introduced into the PCR result in big differences in the amount of final products, it is not considered to be quantitative. Real-time PCR has the capability to monitor the progress of the PCR as it occurs (i.e., in real time). Therefore, data are collected throughout the entire PCR process rather than at the end of the PCR. It thereby revolutionizes PCR-based quantitation of DNA and RNA. In real-time PCR, reactions are characterized by the point in time during cycling when amplification of a target is first detected rather than by the amount of target accumulated after a fixed number of cycles. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. In contrast, an endpoint assay (also called a plate-read assay) measures the amount of PCR product accumulated at the end of the PCR cycle. Basic PCR and real-time PCR are generally used in a qualitative format to evaluate biological samples. However, a wide variety of applications, such as determining microbiological presence and characterizing gene expression, are improved by quantitative determination of target abundance. Theoretically, it is quite easy to achieve, based on the exponential nature of PCR. There is a linear relationship between the number of amplification cycles and the logarithm of the number of molecules, at least in theory. In practice, however, the efficiency of amplification is usually lower because of the presence of inhibitors, competitive components, substrate exhaustion, inactivation of the polymerase, and target reannealing. As the number of cycles increases, the amplification efficiency decreases, usually resulting in a plateau effect (Figure 3.1). The primary advantage of real-time PCR quantification includes a broad dynamic range and capability for high-throughput applications. Current detection platforms are able to detect less than 10 pg of DNA and process up to approximately 350 individual samples in a standard format in less than 2 h. In addition, real-time PCR
0.9 Plateau
0.8
Fluorescence
0.7 0.6
Linear
0.5 0.4
Threshold
0.3
Exponential
0.2
Baseline
Ct value
0.1 0
0
10
20 30 PCR cycle
40
50
FIGURE 3.1 Real-time PCR plot. Four distinct phases during real-time PCR can be observed: background without increasing fluorescence, the exponential phase, followed by a shorter linear phase, and the final plateau phase.
INTRODUCTION
61
enables target-specific quantification (e.g., gender determination, pathological diagnosis, determination of GMO presence, and species identification). Real-time PCR template DNA quantification estimates are derived from measured fluorescence accumulation, which is correlated directly with the amount of amplified PCR products produced as the reaction progresses (Heid et al., 1996). Fluorescence is generated either by intercalating dyes that are specific for double-stranded DNA (Wittwer et al., 1997a,b) or by sequence-specific oligonucleotide probes (Holland et al., 1991; Livak et al., 1997). The real-time PCR sequence detection system measures the reporter signal (R) and normalizes it to a passive reference dye. Normalizing accounts for minor well-to-well variations in signal strength, allowing for more accurate sample-to-sample comparisons. The progressive cleavage of the probe at each PCR cycle leads to an increase in normalized reporter signal (Rn) which is proportional to the initial PCR cycles. Reporter fluorescence values are below the baseline detection capabilities of current real-time PCR systems, resulting in stochastic fluctuations in fluorescence (i.e., background fluorescence). To minimize this stochastic effect, normalized reporter signal is subtracted from background noise in the fluorescence signal. Normalized reporter signal minus the background fluorescence signal (DRn) is then plotted against cycle number (Figure 3.1). The real-time PCR fluorescence curve generated by the sequence detection system is composed of four distinct phases. When PCR product and reporter signal accumulate beyond background fluorescence levels, the reaction enters the exponential detection phase. At this point the amplification plot crosses a user-defined detection threshold which is set above the background fluorescence noise, preferable at the beginning of the exponential phase. The fractional cycle number at which the reaction crosses the threshold (Ct) is related inversely to the initial template DNA concentration. As PCR products continues to accumulate, the ratio of Taq DNA polymerase to amplified products decreases, resulting in nonexponential accumulation of amplicons. At this point the reaction enters the linear phase. Once PCR product ceases to accumulate due to assay depletion, DRn values remain relatively constant and the reaction enters the plateau phase. PCR amplification efficiency is the rate at which a PCR amplicon is generated, generally expressed as a percentage. If a particular PCR product doubles in quantity during the geometric phase of its PCR amplification, the PCR assay has 100% efficiency. The slope of a standard curve is commonly used to estimate the PCR amplification efficiency of a real-time PCR. A real-time PCR standard curve is represented graphically as a semi log regression line plot of Ct value versus the log of input nucleic acid. A standard curve slope of 3.32 indicates a PCR with 100% efficiency (Table 3.1). Slopes that are more negative than 3.32 (e.g., 3.9) indicate reactions that are less than 100% efficient. Slopes more positive than 3.32 (e.g.,2.5) probably indicate poor sample quality or pipetting problems. A 100% efficient PCR will yield a 10-fold increase in amplified products every 3.32 cycles during the exponential phase of amplification (log 10 ¼ 3.3219). However, it is not often the case that this value is met exactly. Calculating amplification efficiencies therefore allows early detection of nonoptimal assay conditions and will facilitate troubleshooting problematic samples prior to
62
QUANTITATIVE REAL-TIME PCR
TABLE 3.1 Link Between Slope, Amplification, and Efficiency a Slope
Amplification
Efficiency
3.60 3.55 3.50 3.45 3.40 3.35 3.30 3.25 3.20 3.15 3.10
1.8957 1.9129 1.9307 1.9492 1.9684 1.9884 2.0092 2.0309 2.0535 2.0771 2.1017
0.8957 0.9129 0.9307 0.9492 0.9684 0.9884 1.0092 1.0309 1.0535 1.0771 1.1017
a
Given are various values of the slope and calculated amplification efficiencies. The optimal amplification efficiency is highlighted in boldface type.
sequence analysis. Several strategies have been developed. The mechanisms of PCR inhibition can be grouped into three categories based on the point of action during sample preparation and amplification. Inhibitors can interfere with cell lysis during DNA extraction, degrade or capture nucleic acids, or inhibit Taq DNA polymerase (according to the author’s experience, the most frequent case). Although inhibitory mechanisms may vary, the outcome is a general reduction in amplification efficiency. Probably the most elegant way to identify reduced amplification efficiency is the statistical calculation based on the regression analysis of four to six data points within the window of linearity that have the highest coefficient of determination and slope closest to the maximum (Kontanis and Reed, 2006). These authors reported that the anchor of Ct þ 1 is the best point for starting the analysis. This approach does have the great advantage of avoiding any additional laboratory work, because the calculation is based on the results of the unknown sample. An alternative inhibitor detection strategy is to create a serial dilution of the suspect template and construct an intrinsic calibration curve from which the efficiency can be estimated. Because of the exponential nature of PCR amplification, only a small number of template molecules are required to generate a PCR product. Thus, samples can often be diluted to a point where inhibitors are ineffective at preventing amplification of the remaining template DNA. As a result, diluted assays will cross the detection threshold earlier, decreasing the slope of the linear regression curve generated using the suspect sample dilution series. Efficiency is then calculated from the slope of the linear regression line: E ¼ 101=slope : Low efficiency values suggest that dilution has reduced the effects of amplification inhibitors. Although potentially useful, this alternative approach requires extensive sample manipulation and multiple PCR assays, increasing workloads and financial expenditures substantially. In addition, if template DNA concentrations are low, as is often the case in food analysis context, dilution may result in template depletion and no amplification products. Consequently, this method is of limited utility with challenging
INTRODUCTION
63
template samples. In GMO analysis, a monitor run is often carried out prior to the quantification assay. Usually, 1: 10 and a 1: 40 dilutions of the sample are analyzed in parallel. Only when the Ct difference between reactions (E ¼ 10) is approximately 2 is the sample is counted as “free of any inhibitor”. Internal positive controls (IPCs) can also be used to identify the presence of PCR inhibitors. IPCs are definitively useful for detecting false-negative results; however, they cannot be used to determine a precise measure of inhibition strength when template samples are marginally compromised. Comparing the amplification efficiencies of clean standards with those of unknown samples is a statistically sound method that can be used in conjunction with IPCs when amplifications are successful but are compromised, producing erroneous quantification results. In general, quantitative PCR requires that the measurement be completed before the plateau phase, so the relationship between the number of cycles and molecules is probably linear. This point must always be determined empirically for different reactions because of the various factors that can affect the amplification efficiency. Because the measurement is taken prior to the reaction plateau, quantitative PCR uses fewer amplification cycles than does basic PCR. The amount of final product can cause problems because there is less to detect. To monitor the efficiency of amplification, many applications are designed to include an internal standard in the PCR. One such approach includes a second primer pair that is specific for a housekeeping gene (i.e., a gene that has constant expression levels among the samples compared) in the reaction. Amplification of housekeeping genes verifies that the target nucleic acid and reaction components were of acceptable quality but does not account for differences in amplification efficiencies due to differences in product size or primer annealing efficiency between the internal standard and the target being quantified. The concept of competitive PCR, a variation of quantitative PCR, is a response to this limitation. In competitive PCR, a known amount of a control template is added to the reaction. This template is amplified using the same primer pair as the experimental target molecule but yields a distinguishable product (e.g., different size, restriction digest pattern). The fluorescence signals (i.e., amounts, intensity) of control and test product are compared after amplification. Although these approaches control for the quality of the target nucleic acid, buffer components, and primer annealing efficiencies, they have their own limitations (Siebert and Larrick, 1993; McCulloch et al., 1995), including the fact that it depends finally on the analysis of products by electrophoresis. Numerous fluorescent solution and solid-phase assays have been described to measure the amount of amplification product generated in each reaction, but they can fail to discriminate amplified DNA of interest from nonspecific amplification products due to the missing final confirmation step. Some of these analyses rely on blotting techniques, which introduce another variable due to nucleic acid transfer efficiencies, while other assays have been developed to eliminate the need for gel electrophoresis, yet provide the requisite specificity. Real-time PCR, which provides the ability to view the results of each amplification cycle, is a popular way to overcome the need for post-PCR analysis by electrophoresis.
64
QUANTITATIVE REAL-TIME PCR
Real-time PCR using labeled oligonucleotide probes or primers employs two different fluorescent reporters and relies on the transfer of energy from one reporter (the donor) to the second reporter (the acceptor) when the reporters are in close proximity. The second reporter can be a quencher or a fluorescence dye. If the second reporter is a quencher, the energy from the first reporter is absorbed but reemitted as heat rather than light, leading to a decrease in the fluorescent signal. Alternatively, if the second reporter is a fluorescence dye, the energy can be absorbed and reemitted at another wavelength through fluorescent resonance energy transfer (FRET; reviewed in Didenko, 2001), and the progress of the reaction can be monitored by the decrease in fluorescence of the energy donor or the increase in fluorescence of the energy acceptor. During the exponential phase of PCR, the change in fluorescence is proportional to the accumulation of PCR product. To simplify quantitation, specific instruments perform both the thermal cycling steps to amplify the target and the fluorescence detection to monitor the change in fluorescence in real time during each PCR cycle. There are several general categories of real-time PCR probes, including hydrolysis, hairpin, and simple hybridization probes. These probes contain a complementary sequence that allows the probe to anneal to the accumulating PCR product, but probes can differ in the number and location of the fluorescent reporters.
3.2
REAL-TIME CHEMISTRY
In real-time PCR the fluorescent reporter molecule used can be either a sequencespecific probe comprised of a short oligonucleotide labeled with a fluorescent dye in conjunction with a quencher [e.g., TaqMan probes (hydrolysis probes), molecular beacons, and scorpions] or a nonspecific DNA-binding fluorescence dye such as SybrGreen I, which fluoresces when bound to double-stranded DNA. For selection of the best solution for the individual real-time PCR experiment, the level of sensitivity and accuracy required for the data analysis and the budget available to support the project should be considered. In addition, the solution should be based on the skill and experience of the researcher in designing and optimizing quantitative PCR (qPCR) assays, because primer and probe design is not trivial. Finally, it should be noted whether or not a multiplex assay, in which several targets need to be amplified and subsequently distinguished, is necessary. Almost all chemistries, such as SybrGreen I, TaqMan, LUX primers, FRET probe pairs, or Invader probes will work in all the different types of instruments from various sources. 3.2.1
DNA-Binding Dye Chemistry
In general, small molecules that bind to double-stranded DNA can be divided into two classes: (1) intercalators, and (2) minor-groove binders. DNA binding dyes such as SybrGreen I are cheap and easy to use. Therefore, SybrGreen I is the common choice for optimizing real- time PCR. When free in solution, SybrGreen I displays only a bit
REAL-TIME CHEMISTRY
65
of background fluorescence, but when bound to double-stranded DNA its fluorescence increases over 1000-fold. The more double-stranded DNA that is present, the more binding sites there are for the dye, so fluorescence increases proportionately to DNA concentration. This property of the dye provides a mechanism that allows it to be used to track the accumulation of PCR product. As the target is amplified, the increasing concentration of double-stranded DNA in the solution can be measured directly by the increase in fluorescence signal (Figure 3.1). The assay design is relatively easy, as well as the run of the PCR compared with probebased methods. All that is needed is the design of a set of primers, optimization of the amplification efficiency and specificity, and running the PCR in the presence of the dye. But one limitation of assays based on DNA-binding dye chemistry is the inherent nonspecificity. Sybr Green I will increase in fluorescence when bound to any doublestranded DNA. Therefore, the reaction specificity is determined solely by the primers. Consequently, the primers should be designed to avoid nonspecific binding (e.g., primer–dimer formation). Otherwise, it is possible that the fluorescence measured may include signal contamination, resulting in artificially early Ct values, giving an inaccurate representation of the true target concentration. A nonspecific signal cannot always be avoided, but its presence can easily be identified by performing melting curve analysis on the PCR products from every run. Immediately following the PCR, amplified products can be melted slowly while the SybrGreen I fluorescence is detected. As the temperature increases, the DNA melts and the fluorescence intensity decreases. The temperature at which a DNA molecule melts depends on its length and sequence composition. If the PCR products consist of molecules of homogeneous length and sequence, a single thermal transition will be detected, resulting in a temperature specific only for this amplicon. If more than one population of PCR products is present, it will be reflected as multiple thermal transitions in the fluorescence intensity. In this way, the fluorescence– temperature curve (also called a dissociation curve) is used to differentiate between specific and nonspecific amplicons based on the Tm (melting temperature) value of the reaction end products. To avoid false-positive signals, it is sometimes also advisable to check for nonspecific product formation using agarose gel electrophoresis. Another aspect of using DNA-binding dyes is that multiple dyes bind to a single amplified molecule. This increases the sensitivity for detecting amplification products. A consequence of multiple dye binding is that the amount of signal is dependent on the mass of double-stranded DNA produced in the reaction. Thus, if the amplification efficiencies are the same, amplification of a longer product will generate more signal than will a shorter one. This is in contrast to the use of a fluorogenic probe, in which a single fluorophore is released from quenching for each amplified molecule synthesized, regardless of its length. DNA-binding dyes are often used for initial optimization of PCR assays for diagnostic purposes. In basic research such as for transcription identification and quantification, real-time PCR using DNA-binding dyes is used much more.
66
3.3
QUANTITATIVE REAL-TIME PCR
PROBE-BASED CHEMISTRIES
Compared to nonspecific chemistries such as SybrGreen I dye, a higher level of detection specificity is provided by using an internal probe to detect the real-time PCR product of interest. In the absence of a specific target sequence present in the reaction, the fluorescent probe is not hybridized, remains quenched, and does not result in an increased fluorescence signal. When the probe hybridizes to the target sequence of interest, the reporter dye is no longer quenched, and fluorescence will be detected. The level of fluorescence detected is related directly to the amount of amplified product in each PCR cycle. An important advantage of using probe-based chemistry rather than DNA binding dyes is that multiple probes can be labeled with different reporter dyes and combined to allow detection of more than one target in a single reaction: called multiplex assay. 3.3.1
Hydrolysis Probes
Hydrolysis probes (e.g.,TaqMan probes) are the most widely used and published in detection chemistry literature for probe-based real-time PCR applications. In addition to the primers, it includes a third oligonucleotide, 20 to 26 bases in length, in the reaction known as the probe. A fluorescent reporter dye, most frequently 6-carboxyfluorescein (6-FAM), is attached to the 50 end of the probe and a quencher, generally 6-carboxytetramethylrhodamine (TAMRA) is attached at the 30 end. However, more and more, dark quenchers such as the Black Hole Quenchers (BHQs) are replacing the use of TAMRA because they provide lower background fluorescence. As long as the two molecules (reporter and quencher) are maintained in close proximity, the fluorescence from the reporter is quenched and no fluorescence is detected at the reporter dye’s emission wavelength. TaqMan probes use fluorescence resonance energy transfer (FRET), a quenching mechanism phenomenon first described by in the 1940s (Foerster, 1948), in which quenching can occur over a fairly long distance (100 A or even more), depending on the fluorescence dye and quencher used, so that as long as the quencher is on the same oligonucleotide as the reporting fluorescence dye, quenching will occur, resulting only in a fluorescent signal of the quencher. The probe is designed to anneal to one strand of the target sequence in close proximity to one of the primers. While the polymerase extends that primer, it will encounter the 50 end of the probe. Taq DNA polymerase has 50 ! 30 nuclease activity, so when Taq DNA polymerase reaches the probe, it displaces and degrades the 50 end, releasing free reporter dye into solution (Holland et al., 1991). Following the separation of reporter dye and quencher, fluorescence can be detected from the reporter dye (Figures 3.2 and 3.3). To optimize probe binding and subsequent cleavage, it is critical to adjust the thermal profile to facilitate both the hybridization of probe and primers and the cleavage of the probe. To meet both of these requirements, TaqMan probes will generally use a two-step thermal profile with a denaturing step (usually at 95 C) and a merged annealing-extension step at 60 C. To guarantee the binding of the TaqMan probe, it is selected with a 7 to 10 C higher Tm value than the annealing temperature. If the temperature in the reaction is too high when Taq DNA polymerase extends
PROBE-BASED CHEMISTRIES
67
FIGURE 3.2 Principle of the widely used TaqMan technology. Shown is only one cycle of the entire PCR amplification process. After denaturation and annealing of primers and probes, the Taq DNA polymerase synthesizes a new DNA strand until the probe is reached. Due to its 50 nuclease activity, the oligonucleotide is cleaved and the probe is released.
Emission intensity
Target is present
Target is absent 500,00
600,00 Reporter dye
wave length
Quencher dye
FIGURE 3.3 Fluorescence signal generation. The reporter and quencher signal have different emission optimums. For quantification purposes only the reporter signal is counting. As long as no target DNA is present in the reaction, only quencher fluorescence is measured. As more and more target is amplified, more reporter molecules are released into the reaction, resulting in an increase in fluorescence signal.
68
QUANTITATIVE REAL-TIME PCR
through the primer (such as at a standard extension temperature of 72 C), the probe will be strand-displaced only, rather than cleaved, resulting in no increase in the fluorescence signal. It should be noted that the increase in fluorescence signal is strongly dependent on the exonuclease activity of the Taq DNA polymerase. It is not totally clear if this activity is 100% or (probably) lower, resulting in decreased PCR efficiency. TaqMan MGB probes consist of an oligonucleotide containing a reporter dye (i.e., FAM or VIC) at the 50 end, a minor-groove-binder moiety, and a nonfluorescent quencher dye at the 30 end. The minor-groove binder acts as a probe Tm enhancer. Probes designed as TaqMan MGB probes have much shorter probes, which enhances the Tm differential between matched and mismatched probes. A probe sequence with a single mismatch is more likely to be displaced by the Taq DNA polymerase than it is to be cleaved by the enzyme during amplification. In addition, TaqMan MGB probes contain a nonfluorescent quencher that provides enhanced spectral resolution when using multiple dyes in a single reaction. It is reported that TaqMan MGB probes enhance specific probe binding and are also more suitable for multiplex assays. 3.3.2
Other Probe Systems
Instead of only one single oliginucleotide, the LightCycler hybridization probe method uses two DNA probes that hybridize, in a head-to-tail arrangement, in close proximity to the target DNA. Usually, it should not more than 2 to 5 bases space between the 30 end of probe 1 (donor probe) and the 50 end of probe 2 (acceptor probe). This leaves space for the fluorescence dyes at the ends of the probes. Each probe is labeled with a different fluorescence dye. Interaction of the two dyes occurs when both are bound to their target at the same time. When the two probes are hybridized to their target sequences, the fluorescence dyes are in close proximity and (FRET) can occur between them (Figure 3.4). The choice of hybridization probes should take into consideration a “balanced” sequence region because a sequence region that is nearly equal tends to bind probes tightly, but not too tightly. It should not contain monotonous or repetitive sequences because such sequences can form hybrids and the sequence should not be selfcomplementary. DNA sequences can form loops and therefore be less accessible to hybridization. In principle, those probes can be cheaper than probes bearing two fluorescent labels. Structured probes contain stem–loop structure regions that give enhanced target specificity compared with traditional linear probes. This characteristic enables a higher level of discrimination between similar sequences and makes these chemistries specifically well suited for clinical purposes such as SNP and allele discrimination applications. The widely used molecular beacons include a hairpin loop structure, where the central loop sequence is complementary to the target of interest and the stem arms are complementary to each other. One end, typically the 50 end of the stem, is modified with a reporter fluorescence molecule, and the other end carries a quencher. Rather than using a FRET-quenching mechanism similar to TaqMan probes, molecular beacons are based on static quenching, which requires the fluorescence dye and
PROBE-BASED CHEMISTRIES
69
FIGURE 3.4 LightCycler hybridization probes. During the PCR annealing step, the two oligonucleotides hybridize, head to tail, to adjacent regions of the target DNA. The fluorescence dyes, which are coupled directly to the oligonucleotides, are very close in the hybrid structure. The F1 donor fluorophore (e.g., fluorescein) is excited by an external light source, then passes on part of its excitation energy to the adjacent F2 acceptor (e.g., LightCycler-Red 640) FRET via dipole–dipole interactions. The excited F2 fluorescence dye emits light, which can be measured by the instrument.
quencher to be in very close proximity for quenching to occur. Historically, DABCYL or methyl red has been used for molecular beacons; more common today is the use of the Black Hole Quencher, which reduces background noises. In the absence of a specific target, the molecular beacon’s thermodynamic properties favor the formation of the hairpin over mismatched binding. This places the fluorescence dye and quencher immediately adjacent to each other so that quenching will occur. In the presence of the target sequence, the annealing of the loop sequence to the target is the preferred conformation. When the probe is annealed to the target, the fluorescence dye and quencher are separated, and the reporter fluorescence can be detected. Since molecular beacon chemistry is not based on the 50 ! 30 exonuclease activity of Taq DNA polymerase, it can be used in a traditional three-step thermal profile. When the thermal cycling ramps up to 72 C and the Taq DNA polymerase extends to where the molecular beacon probe is annealed, the probe will simply be strand-displaced, and it will again form the hairpin loop conformation. Because formation of the molecular beacon hairpin loop is a reversible process, the probe will be recycled with each PCR cycle. Proper design of the molecular beacon stem is crucial to ensuring optimized performance of the reaction. If the stem structure is too stable, target hybridization can be inhibited. Additionally, if the molecular beacon probe does not fold in the expected stem loop conformation, it will not quench in the manner expected. It is quite easy to verify after synthesis that the proper design is behaving as wanted before it will be used in any real-time PCR assay. By melting the molecular beacon alone, in the presence of its perfect complement, and/or of a mismatched sequence, the dynamics of the reaction can easily be compared and used to determine the optimal temperature for fluorescence measurement and mismatch discrimination. One advantage of this technique is that hairpin probes are less likely to mismatch than are hydrolysis probes (Tyagi and Kramer, 1996). However, preliminary experiments
70
QUANTITATIVE REAL-TIME PCR
must be performed to show that the signal is specific for the desired PCR product and that nonspecific amplification does not occur. Scorpion probe chemistry is to a certain extent similar to molecular beacons, but rather than having a separate probe, the hairpin structure is incorporated onto one of the primers. The fluorescence dye is attached to the 50 end of the primer, whereas the 30 end is complementary to the target and functions as a site for extension initiation. The quencher is located between the primer and probe regions of the oligonucleotide, so that if the probe is in the hairpin configuration, the reporter dye is located in close proximity to the quencher. After amplification and incorporation of the hairpin probe, the newly created strand is able to adopt a new structure. The loop sequence in the hairpin is complementary to the extension product of the probe/primer. During further rounds of denaturation and annealing, the loop sequence will anneal to the newly formed complementary sequence within the same strand of DNA. In this conformation, the fluorescence dye is separated from the quencher, resulting in an increased fluorescence signal. As is also the case for other types of probes, the primer also contains a “PCR preventing system” in the hairpin, which prevents the stem–loop structure from being copied during PCR by extension from the other primer. Since annealing of the loop sequence with the downstream PCR product is an intramolecular interaction, it is kinetically more favorable than probe systems that require two separate molecules to interact. Therefore, scorpions usually result in a stronger fluorescence signal than those associated with TaqMan and molecular beacons. Like molecular beacons, scorpions are not based on the 50 ! 30 exonuclease activity of Taq DNA polymerase, so the reaction can be performed using a typical three-step thermal profile with the optimal extension temperature for the polymerase (72 C). However, a disadvantage of scorpion chemistry is that the design and optimization of the probe structure are often much more challenging than with either molecular beacons or TaqMan probes, and as a result, scorpions are not generally suggested for those researchers who are new to the real-time technology. The Plexor qPCR and qRT-PCR systems require no probes, only two PCR primers, one of which is labeled fluorescently. These systems take advantage of the specific interaction between two modified nucleotides (Moser and Prudent, 2003; Johnson et al., 2004; Sherrill et al., 2004). The two novel bases, isoguanine (iso-dG) and 50 -methylisocytosine (iso-dC), form a unique base pair in double-stranded DNA (Johnson et al., 2004). To perform fluorescent quantitative PCR using this new technology, one primer is synthesized with an iso-dC residue as the 50 -terminal nucleotide and a fluorescent label at the 50 end; the second primer is unlabeled. During PCR, the labeled primer is annealed and extended, becoming part of the template used during subsequent rounds of amplification, and the complementary iso-dGTP, which is available in the nucleotide mix as dabcyl-iso-dGTP, pairs specifically with iso-dC. When dabcyl-iso-dGTP is incorporated, the close proximity of DABCYL and the fluorescent label on the opposite strand effectively quenches the fluorescent signal. It is important to realize that the initial fluorescence level of the labeled primers is high, which is the opposite for all other real-time systems described here. As amplification product accumulates, the signal decreases. However, in general the system is suitable for quantitative purposes as well as all others.
REAL-TIME PCR PRIMER AND PROBE DESIGN
71
The fluorescence dye ROX is used as an internal reference by some sequence detection instruments to normalize fluorescence. ROX reference dye is available from various suppliers: included in the mix or as a separate vial for optimization.
3.4
REAL-TIME PCR PRIMER AND PROBE DESIGN
There are numerous primer and probe design software programs on the market, and coupled with a set of easy-to-follow design rules, the process is made relatively simple and reliable. However, the first step in primer and probe design is to acquire the sequence of gene or simple DNA sequence of interest. The primary choice to acquire the publicly available sequences is the open-access NCBI database (www.ncbi.nlm. nih.gov). After the sequence is obtained, a primer and probe design software program should be used to simplify and maximize success for the design process. Moreover, such programs have the capacity to check for hundreds of parameters at the same time. Designer software packages are available both as freeware on the Internet and through many oligonucleotide vendors. When using a software program to design primers and probes, it is important to set the concentration of monovalent ions (Na þ /Kþ ) and divalent ions (Mg2 þ ) to those that are used in your reaction for accurate melting temperature prediction. (The buffer conditions will generally be in the range of 50 to 100 mM monovalent cation and 1.5 to 5.5 mM Mg2þ ). The region of the template sequence to be used for detection must be considered carefully. The region of interest should be compared to the entire genome to ensure that the target sequence is unique, and potential secondary structures should be identified and avoided. In addition, it should be checked that no similarity to other cross-contaminating species is occurring. To identify a coding sequence specific to RNA targets, it is most advisable to design the probe to span exon–exon boundaries (excluding intron sequences), thus preventing the detection of sequences from residual genomic DNA in the RNA sample. A DNase I step prior to the reverse transcription (RT) reaction could then be skipped. This is an efficient approach and results in minimal loss of sample when carried out on a column-based purification system. In qRT-PCR, the method of cDNA synthesis needs to be considered when designing primers if oligo-dT priming is used. It is generally safe to assume that the RT reaction has transcribed between 500 and 1000 bases from the polyA site with quantitative linearity, so it is best to design the assay to target a sequence for amplification toward the 30 end of the gene. The presence of SNPs and splice variants within a sequence should also be considered, as these must either be avoided or targeted as required according to the goal of the experiment. For optimal performance, the region spanned by the primers (measured from the 50 end of each primer) should be between 70 and 150 bp in length for probe-based chemistries, and between 100 and 300 bp in length if SybrGreen I will be used. To maximize the efficiency of the PCR amplification, it is generally best to keep the target length relatively short. However, with SybrGreen I it could be advantageous to use a slightly longer target so that more of the dye molecules can bind to the amplified product and produce a higher fluorescence signal. When designing for SybrGreen I with the intention of moving later to a probe-based chemistry, keep in mind using the lower
72
QUANTITATIVE REAL-TIME PCR
range (e.g., 100 to 200 bp) for primer design. General rules for primers used in all chemistries are that each primer should be between 15 and 30 bp in length, and the theoretical Tm value of the two primers should be within 2 C of each other. It is best trying to avoid G/C clamps at the 30 ends of the primers to prevent these oligos from folding on themselves or annealing nonspecifically. The five bases at the 50 terminal end generally should contain no more than two guanines and cytosines, although it is acceptable to have three in the final five bases if no two are adjacent. Since thymidine tends to misprime more readily than the other bases, a 30 terminal T should also be avoided. The 50 end of the primers should not contain an inverted repeat sequence that would allow it to fold on itself. In general, the Gibbs free enthalpy (DG) of primer–dimer and cross-primer–dimer formation should be greater than 4 kcal/mol to ensure that primers do not form stable dimers. For multiplex reactions it may be necessary to loosen the free enthalpy specification to allow for the design of the oligos required to work together in the same reaction. It is best to restrict the DG between each oligo pair to greater than 6 kcal/mol in a triplex reaction, and greater than 8 kcal/mol in a quadruplex reaction. Probes should not contain runs of the same base (avoid more than three of the same base), and optimally should contain more C than G nucleotides. Guanine is an effective fluorescence quencher and should not be adjacent to the reporter dye. Historically, TaqMan probes were situated 3 to 12 bp downstream of the primer on the same strand, but recent evidence suggests that the distance from the upstream primer to the probe is less important than thought previously. TaqMan probes are generally between 20 and 30 bp in length. Ideally, they should have balanced GC content, although probes with varying content (20 to 80% GC) can still be effective. The Tm requirements of the probe will most often dictate the specific percentage of GC. TaqMan assays are conventionally performed as a two-step PCR consisting of a product melt at 95 C, followed by primer annealing and Taq DNA polymerase extension at 60 C (Figure 3.1). For these assays the probe is designed with a Tm value 8 to 10 C higher than the primer Tm values. Using the higher Tm value for the probe ensures hybridization to the target before extension can occur from the primer, so there will always be a corresponding increase in fluorescence signal for every amplified copy that is produced. Since TaqMan chemistry requires using the same thermal profile for each reaction, primers should always be designed with a Tm value of approximately 60 C, and the hydrolysis probe with a Tm value around 70 C. Optimization of the assay is accomplished by adjusting primer concentration rather than optimizing annealing temperatures. Molecular beacon probes should be designed to anneal at 7 to 10 C higher than the primers, to allow hybridization before primer extension. For molecular beacons, the stem sequence should be designed to be 5 to 7 bp in length and should have a Tm value similar to that of the melting temperature of the probe region in the loop. As a general rule, stem sequences that are 5 bp long will have a Tm value of 55 to 60 C, stems that are 6 bp long will have a Tm value of 60 to 65 C, and stems that are 7 bp long will have a Tm value of 65 to 70 C. Unlike TaqMan probes, molecular beacons are usually designed so that the probe is annealed closer to the midpoint between the two primers rather than adjacent to the upstream primer. This should ensure that any low-activity extension by the polymerase at the annealing temperature will not displace the probe before the fluorescence reading is
TYPES OF MACHINES
73
taken. A scorpion probe sequence should be approximately 17 to 30 bp in length. It is best to place the probe no more than 11 bp upstream of the complementary target sequence. The farther downstream this complementary sequence is, the lower the probe efficiency will be. The stem sequence should be about 6 to 7 bp in length and contain sufficient pyrimidines so that the Tm value of the stem loop structure is 5 to 10 C higher than the Tm value of the primer sequence to the target, and the DG value for the stem loop confirmation is negative. The more negative the DG value, the more likely it is that folding will occur. When designing probes, the combination and positioning of reporter dyes and quenchers is important. Make sure that the quencher chosen will efficiently suppress the fluorescence of your chosen reporter dye to ensure a low background. Information on the quenchers recommended for each fluorophore is generally available from companies that synthesize these probes. When designing primers and probes for multiplex reactions, adhere to the following additional rules: All amplicons should be of similar length (5 bp) as well as similar GC content (3%), and the primer set Tm and probe Tm values used in a multiplex assay should be within 1 C of each other. For all real-time PCRs, it is a good idea to verify that all of the oligos (primers and probe) that will be used together in the same reaction will not form dimers, particularly at the 30 ends. The 30 complementarity can be checked by scanning the sequences manually. If you are using primer design software, the program itself may run a check to make sure that the sequence choices it picks are not complementary to each other.
3.4.1
Dye and Quencher Choice
When designing a fluorescent probe it is necessary to ensure that the fluorophore and quencher pair are compatible given the type of detection chemistry. In addition, when designing multiplexed reactions, the spectral overlap between the fluorophores and quenchers for the different targets should be minimized to avoid possible crosstalk issues (see Table 3.1). For TaqMan probes, the most historically common dye–quencher combination is a FAM fluorophore with a TAMRA quencher. This combination will certainly work well, but in recent years dark quenchers have become more popular. Dark quenchers emit the energy they absorb from the fluorophore as heat rather than light of a different wavelength. They tend to give results with lower background and are especially useful in a multiplex reaction, where it is important to avoid light emitted from the quencher, giving a crosstalk signal with one of the reporters.
3.5
TYPES OF MACHINES
Many real-time machines are on the market today. In general, they could be divided into two distinct categories, depending on the technique used to heat and cool the reactions.
74
QUANTITATIVE REAL-TIME PCR
3.5.1
Block Thermal Cyclers
Block thermal cyclers are based on a conventional 96-well-plate format in a metal block combined with either a laser-induced fluorescence system or a LED/halogen lamp–based optical excitation source. Due to the usual thermal block time– temperature profiles, the ramp rates for cooling and heating are approximately 1.5 to 3 C/s, which results in an overall time of about 2 h for a typical PCR run of 45 cycles. Due to the 96-well-plate format, the usual pipetting and equipment can be used. Of particular interest for food analysis, in which relative quantification is often used, the numbers of reactions per run are of great importance. Therefore, those types of machines may have an advantage over the machine types described below. 3.5.2
Rotor-Based Systems
Rotor-based systems are available from only two companies: Roche Diagnostics and Corbett Lifescience. Tubes are arranged in a circular rotor that spins continuously at a low rpm value in a chamber of moving air. Consequently, temperature shifting can be done much faster up to 20 C/s, thus facilitating a significant short-time PCR. However, the usual standard lab format of plates and well cannot be used in those types of instruments. This seems to be a drawback; nevertheless, formats are available in the range of 36 to 100 individual reactions. Thus, there is no temperature variation between tubes, due to positional effects such as the recognized edge effect reported in block thermal cyclers. Importantly, reactions also remain isothermal during programmed temperature transition steps. So there is no equilibration time difference between wells; in other words, every tube changes temperature at the same rate. This eliminates another well-to-well variable normally affecting real-time reaction kinetics. In short, Corbett’s Rotor-Gene has the best thermal characteristics yet developed. Detection is carried out using a photomultiplier detector with variable or automatic gain setting filter sets and a CCD (charge-coupled device) camera. Major differences exist in the software developed and used for the various types of machines. However, all current real-time PCR machines are based on the Windows operating system. A partial list of suppliers and real-time PCR instruments is given in Table 3.2. 3.6
REAL-TIME PCR APPLICATIONS
Real-time PCR can be used in traditional PCR applications as well as new applications that would have been less effective with traditional PCR. With the ability to collect data in the exponential growth phase, the power of PCR has been expanded into such applications as: . . . .
Viral quantification Quantification of gene expression Array verification Drug therapy efficacy
REAL-TIME PCR APPLICATIONS
TABLE 3.2
75
Suppliers and Types of Real-Time Instruments on the Market
Supplier
Real-Time Instrument
Homepage
Applied Biosystems
ABPrism (5700, 7000, 7300, 7500, and 7900) iQ5 real-time PCR detection system DNA Engine Opticon 2 system MiniOpticon real-time PCR detection system Rotor-Gene 6000 LightCycler 2.0 System LightCycler 480 MX4000 SmartCycler system Mastercycler ep realplex
www.appliedbiosystems.com
Bio-Rad Laboratories Bio-Rad Laboratories Bio-Rad Laboratories Corbett Lifescience Roche Diagnostics Stratagene Cepheid Eppendorf
. . . . .
www.bio-rad.com www.bio-rad.com www.bio-rad.com www.corbettlifescience.com www.roche.com www.stratagene.com www.cepheid.com www.eppendorf.com
DNA damage measurement Quality control and assay validation Pathogen detection Genotyping Food control
The advantages of using real-time PCR include the following: . . . . . . .
Traditional PCR is measured at the endpoint (plateau), whereas real-time PCR collects data in the exponential growth phase. An increase in reporter fluorescent signal is directly proportional to the number of amplified products generated. The cleaved probe provides a permanent record of the amplification of an PCR product (assay). The dynamic range of detection is increased. There is no post-PCR processing. Detection can be carried out down to a twofold change. Potential cross-contamination is reduced due to elimination of post-PCR analysis because there is no need to open vials following the PCR process.
However, real-time PCR is not a quantitative method per se. As a starting point for real-time PCR, the following description provides suggestions for PCR conditions and a temperature–time profile that should give reasonable results. Specifically, for TaqMan assays the following procedure is recommended to optimize the primer– probe concentration; it is known as a primer–probe matrix. At the beginning the probe
76
QUANTITATIVE REAL-TIME PCR
TABLE 3.3
PCR Parameters for Various Types of Real-Time PCR Approaches a
Reaction with SybrGreen I 0 to 30 ng template–DNA 6 mM MgCl2 0.5 g/L bovine serum albumin 0.5 mM forward primer 0.5 mM reverse primer 200 mM dNTP-mix 1:30,000 SybrGreen I 0.5 to 1 U DNA polymerase in (1x)-PCR buffer
Reaction with TaqMan Probe
Reaction with Hybridization Probes
0 to 30 ng template–DNA 6 mM MgCl2 —
0 to 30 ng template–DNA 6 mM MgCl2 0.5 g/L BSA
0.5 mM forward primer 0.5 mM reverse primer 0.2 mM TaqMan probe 200.0 mM dNTP-mix 0.5 to 1 U DNA– polymerase in (1x)-PCR buffer
0.5 mM forward primer 0.5 mM reverse primer 0.2 mM donor probe 0.4 mM acceptor probe 200 mM dNTP-mix, 0.5 to 1 U DNA–polymerase in (1x)-PCR buffer
a The total volume varies between 25 – 50 mL. Sometimes it is reduced to only 10 mL to save reagents and therefore reduce significantly the cost related to real-time analysis.
concentration should be kept constant at 200 mL, whereas the primer should be varied between 150, 300, and 900 nmol/mL. Nine individual reactions are necessary to determine the most appropriate primer concentration for both primers. A typical reaction composition for PCR is shown in Table 3.3; a temperature–time profile that usually results in a satisfactory amplification is given in Table 3.4. The primer concentration is optimal where the amplification curve first exits the background: consequently, the reaction with the smallest Ct value. By varying the concentration, a shift in Tm value is mimicked which could adjust for a Tm difference between the theoretical calculated and the true Tm in the reaction. Afterward the probe concentration can be varied as well, usually not below 50 nm/mL and not above 250 nm/mL.
TABLE 3.4
PCR Temperature–Time Profile for Block and LightCycler Machines
Pre-PCR: decontamination (optional) Pre-PCR: activation of DNA polymerase and denaturation of template DNA PCR (45 cycles) Step 1: denaturation Step 2: annealing elongation c a
Time (s)
Temperature ( C)
Acquisition Mode
120 600
50 95
None None
15 a/5 b 60 a/25 b
95 60
None Single
Typical for block thermal cyclers. Optimized for the LightCycler system. c Depending on the nature of the application used, the acquisition of the fluorescence is either during the annealing phase or at the end of the amplification/elongation phase. b
ABSOLUTE VS. RELATIVE QUANTITATION
3.7
77
ABSOLUTE VS. RELATIVE QUANTITATION
When setting up and/or calculating the results of quantification assays, it is possible to use either absolute or relative quantification. 3.7.1
Absolute Quantitation
The absolute quantification assay is used to quantify unknown samples by interpolating their quantity from a standard curve. Absolute quantification might be used to correlate a viral copy number with a disease status. It is of interest to the scientist to know the exact copy number of the target DNA in a given biological sample in order to monitor the progress of the disease. Absolute quantification can be performed with data from all real-time PCR instruments; however, knowledge of the absolute quantities of the standards is an absolute prerequisite in order to run the analysis, and most appropriate by some independent means. The most direct and precise approach to the analysis of quantitative data is use of a standard curve that is prepared from a dilution series of template of known concentration. This is called a standard curve or absolute quantification. The standard curve approach is used when it is important to the experimental design and objective of the project to measure the exact level of template in the samples (e.g., monitoring the viral load in a sample). A variety of sources can be used as standard templates. Examples include a plasmid containing a cloned gene of interest or sequence representing the target of interest, genomic DNA, cDNA, synthetic oligos, or in vitro transcripts. After amplification of the standard dilution series, the standard curve is generated by plotting the log of the initial template copy number against the Ct values generated for each dilution. If the aliquoting of the standard solution was accurate and the efficiency of the amplification does not change over the range of template concentrations being used, the plot of these points should generate a linear regression line. This line represents the standard curve (Figure 3.5). Comparing the Ct values of the unknown samples to this standard curve allows the quantification of initial copy numbers. Ideally, a standard curve will consist of at least four points, and each concentration should be analyzed at least in duplicate (the more points the better). The range of concentrations in the standard curve must cover the entire range of concentrations that will be measured in the assay (this may be several orders of magnitude). Extrapolating of data for unknown samples beyond the lowest and highest standards is totally forbidden because it is not known if the curve will succeed as it was calculated for the range within the standards. In addition, the curve must be linear over the entire concentration range. The linearity is denoted by the R squared value (r2; the Pearson correlation coefficient) and should be ideally 1 or very close to 1 (but at least above 0.985). A linear standard curve also indicates that the efficiency of amplification of real-time PCR is consistent at varying template concentrations. The validity of the standard curve method is based on an assumption of equal amplification efficiencies between DNA samples used as quantification standards and unknown test samples under investigation. If the standard
QUANTITATIVE REAL-TIME PCR
Cycle no. 0
10
20
1 30
40
0.1
0.01
Threshold
Fluorescence
78
0.001 45
Ct value
40 35 30 25 20 15 10 10
100
1000
10000
Genome copies
FIGURE 3.5 Absolute quantification using the standard curve approach. The upper part shows the amplification plot of 1 : 4 dilution series. The crossing points are then plotted against the initial starting copy number of the known standard. The regression of the standard curve is finally used to determine the DNA copies of an unknown sample.
curve becomes nonlinear at a very low template concentration, it is probably approaching the limit of detection for that assay. Usually, Ct values above 35 are no more stable from a statistical point of view, resulting in Ct differences above 0.5 between the repeated standards and unknown samples. Unknown samples of which the Ct values fall within a nonlinear section of the standard curve cannot be quantified accurately. Ideally, the efficiency of both the standard curve and sample reactions should be between 90 and 110%. If the efficiency is significantly less, it implies a nonoptimal reaction, due either to inhibitors present in the reaction mix or suboptimal primer sets or reaction conditions. Efficiencies significantly above 100% typically indicate experimental error (e.g., PCR inhibitors, miscalibrated pipetting devices, probe degradation, formation of nonspecific products, formation of primer–dimers). Primer–dimer formation is typically of greatest concern with SybrGreen I assays, where any double-stranded product will be detected. However, a significant amount of primer–dimer implies a suboptimal real-time PCR system. To identify the formation of primer–dimer, the best way is to check it by gel electrophoresis after conventional or real-time PCR.
ABSOLUTE VS. RELATIVE QUANTITATION
79
Deviations in efficiency can also be due to poor serial dilution preparation as well as extreme ranges of concentrations that either inhibit PCR (high template amounts) or exceed the sensitivity of that particular assay (very low amounts). The most important aspect is to have the efficiencies of standards and targets within about 5% of each other if possible, with both near 100%. Once the reactions for the standard curve and the samples have been optimized, Ct values can be compared to each other and an initial template quantity can be estimated. It is important that for this type of quantification a standard curve must be run on the same sample plate as the unknown samples. To date it has never been demonstrated that sample analysis for initial template DNA based on standard curves run on different plates can be calculated reliably. Replicates can vary in Ct values when run at different times or on different plates, and thus are not directly comparable to other runs. Nevertheless, replicates on the same plate should not vary more than 0.5 Ct below Ct values of 35. If they do, it is advisable to retrain the personnel running the analysis. It should also be kept in mind that the “absolute” quantity obtained from the standard curve is only as good as the DNA quantification methods used to measure the standards, so considerable care should be taken to use a very clean template and to perform replicate measurements (whether using gel-based estimation of the DNA concentration, UV spectrophotometry, or nucleic acid–binding dyes such as PicoGreen). At least two or three no template control (NTC) wells should be included for each individual real-time PCR run. In addition, independent positive controls of known quantities within the range of the standard curve are necessary to ensure that the initial copy numbers calculated are accurate. It is also very advisable to use control charts to get the overall range of measurement uncertainty over time periods. It is therefore necessary to use the same known sample in each individual PCR run and to record the quantity determined. 3.7.2
Relative Quantification
In general, two different strategies are possible for relative quantification: (1) the relative standard curve method and (2) the comparative Ct method (DDCt). Depending on various factors, one method may be more appropriate than the other. The advantages of each method and factors to be considered are described below. Relative Standard Curve Method An advantage of this approach is that it requires the least validation because the PCR efficiencies of the target and reference control do not have to be equivalent. The procedure is based on the use of two independent standard curves. One is established for the reference DNA sequence. This could be a housekeeping gene in case the transcription of a certain gene will be analyzed under various conditions or over a period of time. Or it could be a single-copy DNA sequence in order to determine the relative presence of another DNA sequence, as described in Chapter 6. In all cases, the reference sample is used for both real-time PCR systems as a standard, and the unknown sample needs to be analyzed in both systems. If the same amount of DNA
80
QUANTITATIVE REAL-TIME PCR
from the sample is used in the reference and the target real-time PCR systems, the respective copy numbers calculated can be used directly to determine the percentage. Again, it is very important to use copy numbers for the unknown sample only within the range of standard curves. Extrapolating beyond the lowest and highest standards is forbidden because it is not known whether or not the shape of the standard curves will change. This method requires that each 96-well reaction plate contain the standard curves for both PCR systems. It requires more reagents and more space on a single reaction plate than does the alternative approach, but it gives highly accurate quantitative results because unknown sample quantitative values are interpolated from the standard curve. This method should be considered when low numbers of targets and of samples are tested (Figure 3.6). Comparative Ct Method (DDCt) In contrast to the relative standard curve method, this approach does not require that standard curves run on each plate. This can result in reduced reagent use and therefore contribute to less expensive experiments. The comparative Ct method is useful when a high number of targets and/or number of samples are analyzed. Specifically, for high-throughput analyses and when validating microarray results, for example, the DDCt method is an appropriate strategy, as it avoids a lot of individual reactions. The method is similar to the relative standard curve method except that it uses arithmetic formulas to achieve results for relative quantification. It is possible to eliminate the use of standard curves and to use the DDCt method for relative quantification as long as the PCR efficiencies between the target sequence and reference control sequence are relatively equivalent. The amount of target, normalized to a reference sequence and relative to a calibrator, is given by 2DDCt . For a valid DDCt calculation, the PCR efficiency of the target amplification and the PCR efficiency of the reference amplification must be almost the same. To determine if the two amplification reactions have the same amplification efficiency, it is necessary to look at how the DCt (Ct target Ct reference) varies with template dilution. The sample in the validation experiment must contain both the target and reference genes. For example, a sample that ultimately is evaluated during the experiment (such as the calibrator) could be used. The Ct values generated from equivalent standard curve mass points (target vs. reference) are used in the DCt calculation (Ct target Ct reference). These DCt values are plotted vs. log input amount to create a semilog regression line. The slope of the resulting semilog regression line is used as a general criterion for passing a validation experiment. In a validation experiment that passes, the absolute value of the slope of DCt vs. log input should be smaller than 0.1. However, in an ideal situation, if the efficiencies of the two PCRs are the same, the plot of log input amount vs. DCt has a slope of approximately zero, which means the two regression lines are running absolutely parallel. An example of the parallel shape of two independent regression curves established for the same sample is given in Figure 3.7. From an equation of both standard curves it could be deduced that the two real-time PCR systems have very similar amplification efficiency.
81
FIGURE 3.6 Quantification of a selected gene (target sequence) relative to a reference gene sequence. Two independent standard curves need to be established for a sample under investigation. The copy numbers measured for the unknown sample DNA are obtained by interpolation from standard curves. By dividing the copy number calculated for the target sequence by the reference sequence and subsequent multiplication by 100, a percentage value for the target relative to the reference gene sequence can be determined. Due to the fact that only DNA copy numbers are quantified, the percentage cannot be transferred to any other unit.
82
QUANTITATIVE REAL-TIME PCR
45
Ct value
40 y = -1.4172 ln(x) + 37.744
35 30 25 20
y = -1.3509 ln(x) + 36.217
15 10 10
100
1000 10000 100000 Genome copy number
1000000
FIGURE 3.7 Comparison of the efficiency of two real-time PCR systems. The regression curves for both systems show parallel behavior, also demonstrated by the equation given for each regression curve. Applying the DDCt approach is possible only if the parallel shape can be demonstrated.
Today, real-time PCR is one of the most popular molecular biology methods in laboratories dealing with different issues, such as diagnostics and basic genetic research. It opened totally new areas of research, and real-time PCR applications are already included in global standard procedures (e.g., International Standards Organization) in the field of human diagnostics, identification of pathogens, and the authenticity of food and feed products (Codex Alimentarius).Therefore, it can be expected that further modifications of general principles such as real-time PCR will be developed in the future.
REFERENCES Didenko V (2001). DNA probes using fluorescence resonance energy transfer (FRET): designs and applications. Biotechniques, 31:1106–1121. Foerster T (1948). Zwischenmolekulare energiewanderung and fluoreszenz. Annalen der Physik, 437(1–2):55–75. Heid CA, Stevens J, Livak KJ, Williams PM (1996). Real time quantitative PCR. Genome Res., 6(10):986–994. Holland PM, Abramson RD, Watson R, Gelfand DH (1991). Detection of specific polymerase chain reaction product by utilizing the 50 -30 exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. USA, 88:357–362. Johnson SC, et al. (2004). A third base pair for the polymerase chain reaction: inserting isoC and isoG. Nucleic Acids Res., 32:1937–1941. Kontanis EJ, Reed FA (2006). Evaluation of real-time PCR amplification efficiencies to detect PCR inhibitors. J Forensic Sci., 51(4):795–804. Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K (1997). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl., June, 4(6):357–362.
REFERENCES
83
McCulloch RK, Choong CS, Hurley DM (1995). An evaluation of competitor type and size for use in the determination of mRNA by competitive PCR. PCR Methods Appl., 4(4):219–226. Moser MJ, Prudent JR (2003). Enzymatic repair of an expanded genetic information system. Nucleic Acids Res., 31:5048–5053. Sherrill CB, et al. (2004). Nucleic acid analysis using an expanded genetic alphabet to quench fluorescence. J. Am. Chem. Soc., 126:4550–4556. Siebert PD, Larrick JW (1993). PCR MIMICS: competitive DNA fragments for use as internal standards in quantitative PCR. Biotechniques, 14(2):244–249. Tyagi S, Kramer FR. (1996). Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol., 14:303–308. Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA, Balis UJ (1997a). The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques, 22(1):176–181. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP (1997b). Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques, 22(1):130–131, 134–138.
CHAPTER 4
Polymerase Chain Reaction–Restriction Fragment Length Polymorphism Analysis KLAUS PIETSCH and HANS-ULRICH WAIBLINGER €runtersuchungsamt Freiburg, Freiburg, Germany Chemisches und Veterina
4.1
INTRODUCTION
Polymerase chain reaction–restriction fragment length polymorphism analysis (PCR-RFLP) is a technique in which species may be differentiated by analysis of restriction fragments derived from cleavage of their DNA after PCR. DNA from a species is first extracted and purified. DNA is amplified by PCR and cut into restriction fragments using suitable restriction endonucleases, which digest the DNA molecules only when specific DNA sequences are present, termed recognition sequences. The restriction fragments are separated according to length by agarose gel electrophoresis. If two meat species differ in the distance between sites of cleavage of a particular restriction endonuclease, the length of the restriction fragments produced will be different. Comparison of the patterns generated can be used to differentiate between species. 4.1.1
Restriction Endonucleases
Restriction endonucleases are enzymes that digest DNA molecules at specific DNA sequences, depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 bp in length. Generally, the shorter the recognition sequence, the larger the number of fragments generated. If molecules differ in nucleotide sequence, fragments of different sizes may be obtained. Restriction enzymes are isolated from a wide variety of bacterial genera and are thought to be part of the cell’s defenses
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
85
86
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
against invading bacterial viruses. These enzymes are named by using the first letter of the genus, the first two letters of the species, and the order of discovery. 4.1.2
Mitochondrial DNA
An organism inherits its DNA from its parents. Since DNA is replicated with each generation, any given sequence can be passed on to the next generation. Nucleic acid– based species identification and evolutionary analysis based on PCR-RFLP therefore often targets mitochondrial DNA (mtDNA). Mitochondrial DNA is very often used for evolutionary analysis or species identification. Mitochondria have a higher rate of mutations than nuclear DNA, which makes it easier to resolve differences between closely related individuals. MtDNA is inherited only from the mother, without recombination, which allows tracing a direct genetic line. Mitochondria have their own genome of about 16,500 bp, which exists outside the cell nucleus, coding for 13 protein genes, 22 tRNAs, and two rRNAs. One of the genes is coding for the highly conserved enzyme cytochrome b (cytb) (Meyer et al., 1995). Meyer et al. (1995) described a method using PCR primers for amplification of sequences in the conserved areas of the vertebrate mitochondrial cytochrome b gene, which flank sufficient restriction sites for interspecific differentiation of species (Figure 4.1). During the course of evolution, transfer of mtDNA sequences to the nucleus can occur. Therefore, care in interpreting PCR-generated sequences may be necessary, particularly in those produced with universal primers. These nuclear pseudogenes are a potential source of artifact when total DNA is used in PCR-RFLP analyses. Burgener and H€ ubner (1998) described a quick method for the enrichment of mitochondrial DNA which resulted in unambiguous PCR-RFLP patterns. cytb gene cytb-PCR
Mitochondrial DNA
cytb-amplicon Digestion with restriction enzymes cattle 74 bp
pig
285 bp
74 bp 132 bp 153 bp
Hae III Restriction patterns after gel electrophoresis
285 Hae III 153 132 74 cattle
cattle+ pig
pig
FIGURE 4.1 Principle of PCR-RFLP analysis. Amplification of conserved regions of the mitochondrial cytb gene. For the differentiation of cattle and pig, amplicons were digested with Hae III and restriction patterns separated by gel electrophoresis.
APPLICATIONS: MEAT SPECIES IDENTIFICATION
4.2
87
APPLICATIONS: MEAT SPECIES IDENTIFICATION
4.2.1
Method According to Meyer et al. (1995)
One of the first papers describing PCR methods in food analysis was published by Meyer et al. (1995). A conserved 359-bp region, including a variable 307-bp region, is obtained for lots of mammals, poultry, and game meat species. The differentiation of animal species is possible after endonuclease digestion of the PCR amplicons and gel electrophoretical separation of restriction fragments. In a detailed table, the authors gave information on restriction patterns of important animal species based on sequence data and experimental verification (Table 4.1). In our experience this method can be used in a very broad range of animal species differentiation, especially if no other method is available [e.g., for rare or exotic animal species (birds, mammals, and reptiles)]. The method can also be used for fish species differentiation; however, the use of adapted primer pairs is recommended (see Section 4.2.3). The principal applications and limitations of the method are presented below. Raw Meat Figure 4.2 shows the analysis of important meat species: beef, pork, lamb, turkey, chicken, and ostrich. Amplified DNA was digested with Alu I and Hae III. Even using only these two enzymes, the animal species can be distinguished clearly if no other species is expected. Selection of the enzyme depends on the animal species to be differentiated. In practice, we use three different restriction enzymes. Sometimes, additional unexpected (mostly weak) signals can be obtained. For example, in lane 3 an additional 285-bp fragment was obtained for the lamb reference after digestion with Hae III. One explanation of this phenomenon is the presence of nuclear pseudogenes (see Section 4.1). Mitochondrial genes could have been transferred to the nuclear genome during evolution. Due to the fact that total DNA is extracted and analyzed in PCR-RFLP, possible artifacts caused by nuclear DNA have to be taken into consideration. However, in most cases, these additional signals do not affect PCRRFLP analysis. If uncertainties in species identification remain, mitochondrial DNA
TABLE 4.1 PCR-RFLPs for Differentiation of Meat Species According to Meyer et al. (1995) Restriction Enzyme
Species and Size of DNA Fragment After Digestion with Endonuclease Pig
Cattle
Sheep
Goat
Chicken
Turkey
Alu I
244 115 153 132 74
190 169 285 74
359
359
359
359
159 126 74
230 74 55
159 126 74
126 103 74 56
Hae III
88
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
FIGURE 4.2 Analysis of meat from important farm animal species. Restriction fragments of cytb amplicons (359 bp) obtained with Alu I (left) and Hae III (right) according to Meyer et al. (1995). Lane 1, beef; lane 2, pork; lane 3, lamb; lane 4, turkey; lane 5, chicken; lane 7, ostrich. M, molecular-weight marker (50-bp ladder).
enrichment would be a possible tool to provide unambiguous cytb PCR-RFLP patterns (Burgener and H€ ubner, 1998). Game Meat An analysis of some game meat species is shown in Figure 4.3. Amplified DNA was digested with Hinf I and Mbo II. Differentiation between European and Siberian roe deer is possible using Mbo II (lanes 1 and 2). Most likely, different fragments originate from nuclear pseudogenes (see above). All four game meat samples clearly differ from
FIGURE 4.3 Analysis of game meat species. Restriction fragments of cytb amplicons (359 bp) obtained with Hinf I (left) and Mbo II (right) according to Meyer et al. (1995). Lane 1, Siberian roe deer (Capreolus pygargus); lane 2, European roe deer (Capreolus capreolus); lane 3, European red deer (Cervus elaphus elaphus); lane 4, fallow deer (Dama dama); lane 5, beef. M, molecularweight marker (50-bp ladder).
APPLICATIONS: MEAT SPECIES IDENTIFICATION
89
FIGURE 4.4 Differentiation between rabbit and hare. Restriction fragments of cytb amplicons (359 bp) obtained with Mbo I (left) and Hinf I (right) according to Meyer et al. (1995). Lane 1, hare; lane 2, rabbit. M, molecular-weight marker (50-bp ladder).
beef (lane 5). In our experience, at least three different enzymes should be used for game meat species analysis (Hinf I, Mbo II, and Mbo I). Restriction patterns obtained with Xba I and Hae III can be used for additional verification of the results (Waiblinger and Weber, 1998). Figure 4.4 illustrates the differentiation of rabbit and hare with the enzymes Mbo I and Hinf I. Mixtures and Heated Materials In general, the PCR-RFLP method described can also be used for the analysis of mixtures of meat. However, if more than two different species are present in the sample, the restriction patterns become too complex and can no longer be evaluated easily. In practice, the analysis of mixtures is relevant in heated and processed materials. Figure 4.5 shows some limitations of the PCR-RFLP method: Restriction patterns of heat-treated reference samples (sausages) with defined amounts of different meat species are separated by gel electrophoresis. In lanes 1 to 5, the RFLP patterns of boiled sausages treated 1 h at 70 to 75 C are shown. Proportions of 1% beef, lamb, turkey, and chicken mixed within pork cannot be detected. Furthermore, traces of pork in the range of 1% are not detectable in chicken or turkey meat. Similar (high) amounts of pork and beef in the range of 50% can both be detected (lane 3). However, traces of sheep (4%) also present in the sample can just be presumed from the undigested fragment after digestion with Alu I (lane 3, left). In lanes 6 to 9, the analysis of preserves with different heat treatments (121 C, F value <1 ¼ medium, 3 to 5 ¼ strong) is shown, containing 1% beef in pork and 1% pork in beef, respectively. The strong heat-treated preserve based on beef gave
90
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
FIGURE 4.5 Analysis of mixtures of different meat species in processed and heated products. Restriction fragments of cytb amplicons (359 bp) obtained with Alu I (left) and Hae III (right) according to Meyer et al. (1995). Lanes 1 to 5: boiled sausages, 1 h, 70 to 75 C; lane 1, 1% beef, lamb, turkey, and chicken, each in pork; lane 2, 1% pork in beef; lane 3, 4% lamb, 48% pork, and 48% beef; lane 4, 1% pork in turkey; lane 5, 1% pork in chicken. Lanes 6 to 9: preserved sausages [121 C, F ¼ 3 to 5 (lanes 6 and 8) and F < 1 (lanes 7 and 9)]: lanes 6 and 7, 1% pork in beef; lanes 8 and 9, 1% beef in pork. M, molecular-weight marker (50-bp ladder).
only weak signals (lane 6), whereas the typical restriction fragments from pork can be observed in the pork-based material. In addition, these restriction fragments are visible in the medium heat-treated beef sample with 1% pork contamination. The detection of 1% beef in pork is not possible in this heat-treated sample (see also lane 1). Two factors cause or have an impact on this reduced sensitivity in mixtures of heattreated meat or meat product samples. First, due to the heat treatment, degradation of DNA may occur, leading to average DNA fragment size smaller than amplicon size. However, according to our experience and reports of other authors (Beneke, 1998), the cytb DNA sequence can be amplified in sufficient amounts except from very strongly heated material (preserves, sterilization time 20 min). Obviously, in most cases there are still enough intact copies of the 359-bp multicopy cytb gene sequence present in DNA extracts after heat treatment. In contrast, competitive effects seem to be more relevant here: Due to mismatches (e.g., point mutations) within the conserved region, differences in amplification efficiencies occur between the animal species (Meyer et al., 1995). In our experience, the cytb amplicons of the species pig, turkey, and chicken are amplified with higher efficiency than the species cattle and sheep. This leads to reduced sensitivities in mixtures. For example, the limit of detection (LOD) of beef in mixtures increases from about 2% to about 20% if pork-based matrices are analyzed and the LOD of chicken and turkey proportions increases from 2% to 10% in pork matrices (Beneke and Hagen, 1998). Other Applications Eugster (2003, 2004) reported applications of the method for the detection of contaminations of animal origin in vegetable samples. The analysis of food control samples of cereal flours, cereal dust, and cereal products resulted in several findings of animal contamination by small rodents and insects. In vegetable feedstuffs with the
91
APPLICATIONS: MEAT SPECIES IDENTIFICATION
addition of 1% heat-treated meat and bonemeal, animal DNA was detectable and could be identified. Details of PCR-RFLP Method According to Meyer et al. (1995) DNA from test materials was extracted following the Wizard method described in Meyer et al. (1995). PCR Primers 50 –CCA TCC AAC ATC TCA GCA TGA TGA AA–30 50 –GCC CCT CAG AAT GAT ATT TGT CCT CA–30
CYTB-1 CYTB-2
PCR Reaction
5 pmol/mL 5 pmol/mL
(Master Mixes, 50 mL Total Volume per Reaction)
PCR Reagents Sterile water Primer CYTB-1 (5 pmol/mL) Primer CYTB-2 (5 pmol/mL) dNTP mix (2.5 mM each): PCR buffer (10; 15 mM MgCl2) Taq DNA polymerase (5 U/mL) PCR master mix Addition of sample DNA (optimal concentration 5 to 50 ng/mL)
Final Concentration in PCR Reaction
Commercial PCR-Master Mix (e.g., HotStarTaq Master Mix Kit, Qiagen, Hilden, Germany) (mL)
Single Reagents (mL)
— 0.4 mM 0.4 mM 0.2 mM 1; 1.5 mM MgCl2
13 4.0 4.0 — —
28.8 4.0 4.0 4.0 5.0
1 U/50 mL — —
25 HotStarTaq Master Mix 46 4.0
0.2 46 4.0
PCR Profile Step Pre-denaturation 35 cycles†
Postelongation:
Time
Temperature ( C)
15 min* 20 s 40 s 60 s 3 min
94 94 53 72 72
*With HotStarTaq Master Mix Kit; can be reduced to 1 min if standard polymerase is used. † Standard conditions, range from 28 to 45 cycles possible (depending on problem).
92
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
Endonuclease Digestion and Separation of Fragments Amplification solution 10 mL Restriction solution, prepared from restriction enzyme (2 U) (0.2 mL) 1.3 mL and restriction buffer (10) (1.1 mL) Incubate 3 h at 37 C. Separate 10 mL of each digestion reaction by agarose gel electrophoresis (2–2.5% agarose gel) stained with ethidium bromide. 4.2.2
Method According to Matsunaga (1999)
One weak point of the PCR-RFLP method is the reduced sensitivity in mixtures of different meat species. An approach to overcoming this problem has been described by Matsunaga et al. (1999). A common forward primer located in the conserved region of the mitochondrial cytb gene was combined with six species-specific reverse primers for the detection of goat, beef, chicken, sheep, pork, and horse (as well as within the cytb gene; Figure 4.6). The species-specific primers are located in the variable regions of the cytb gene. Species differentiation is achieved by different sizes of amplicons, ranging from 157 to 439 bp. The method can be carried out in singleplex mode (common forward primer þ one species-specific reverse primer), or as a multiplex PCR reaction (common forward primer þ two or more species-specific reverse primers). Raw Meat An analysis of raw meat samples by multiplex PCR is shown in Figure 4.7. (lanes 2 to 7). The species cattle, pork, sheep, and goat can be distinguished clearly by the size of the amplicons. Poultry (i.e., turkey and chicken) yield the same amplicon size: 227 bp.
Vertebrate Cytochrome b gene
t-RNA Glu
1
t-RNA Thr 1139 up to 1143 bp
H-strand sense L-strand sense Cyt b1
Cyt b2
PCR-RFLP
Cyt b1/ b2 primers ubiquitous
359 bp SIM-G
SIM 157 bp
SIM / SIM-Goat primers SIM-C
SIM / SIM-Chicken primers
227 bp SIM-B
SIM / SIM-Beef primers
274 bp SIM-S
SIM / SIM-Sheep primers
331 bp SIM-P SIM / SIM-Pork primers 398 bp
FIGURE 4.6 Differentiation of meat species by single and multiplex PCR according to Matsunaga et al. (1999). One common forward primer and up to six species-specific reverse primers are used (horse not shown).
APPLICATIONS: MEAT SPECIES IDENTIFICATION
93
FIGURE 4.7 Analysis of raw meat from important farm animal species with multiplex PCR according to Matsunaga et al. (1999). Lane 1, DNA mixture of cattle, pork, sheep, goat, turkey, and chicken; lane 2, cattle (274 bp); lane 3, pork (398 bp); lane 4, lamb (331 bp); lane 5, goat (157 bp); lane 6, turkey (227 bp); lane 7, chicken (227 bp). Hae III digest of chicken and turkey amplicons: lane 8, turkey; lane 9, chicken. M, molecular-weight marker (50-bp ladder).
Differentiation of these two species is possible by digestion with Hae III, yielding fragments of 146 and 86 bp (chicken) and 86 and 50 bp (turkey) (see Table 4.2). Sometimes we observed weak signals showing the same amplicon size for other species (e.g., roe deer) using the cattle-specific method. These signals are probably caused by amplification of nuclear pseudogenes. Therefore, restriction analysis for verification of results is generally recommended (see Table 4.2). Lane 1 shows an analysis of a mixture of cattle, pig, sheep, goat, turkey, and chicken containing about the same DNA
TABLE 4.2
Species
Meat Species Differentiation According to Matsunaga et al. 1999 Length of Amplicon (bp)
Cattle Pig
274 398
Chicken Turkey Sheep
227 227 331
Goat
157
Weak Signals May Also Occur for: Roe deer Goat, cattle, turkey, chicken, horse Sheep Sheep Goat (strong signal), cattle, turkey, chicken Sheep
Enzyme
Characteristic Restriction Fragments (bp)
Alu I Mbo I
202, 72 256, 142
Hae III Hae III Mbo I
141, 86 86, 50 256, 75 (goat: 331, 75) 86, 71
Hae III
94
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
FIGURE 4.8 Analysis of mixtures of different meat species in processed and heated products. Multiplex PCR according to Matsunaga et al. (1999). Lanes 1 to 5: boiled sausages, 1 h, 70 to 75 C; lane 1, 1% beef, lamb, turkey, and chicken, each in pork; lane 2, 1% pork in beef; lane 3, 4% lamb, 48% pork, and 48% beef; lane 4, 1% pork in turkey; lane 5, 1% pork in chicken. Lanes 6 to 9: preserved sausages [121 C, F ¼ 3 to 5 (lanes 6 and 8) and F < 1 (lanes 7 and 9)]: lanes 6 and 7, 1% pork in beef; lanes 8 and 9, 1% beef in pork. M, molecular-weight marker (50-bp ladder).
proportion from each species. Intensity of signals differs from species to species, corresponding to different detection limits using the multiplex approach. Mixtures and Heated Materials Figure 4.8 shows the results of a multiplex PCR analysis with the same processed samples (boiled sausages) as described in Figure 4.5 using the PCR-RFLP-method according to Meyer et al. (1995). Pork (398 bp) can be detected in all samples but with a very weak signal in preserves, which have been heated at 121 C (lanes 6 and 7). One percent poultry is detectable (227 bp) in pork, whereas beef and sheep were detectable at the 1 and 2% levels, respectively (lanes 1 and 3). If sensitive detection of all species is desired, singleplex analysis should be used. The detection of lamb and cattle in singleplex format is demonstrated in Figure 4.9. One percent lamb as well as 1% beef is detectable in sausages, even in preserves (121 C). In our experience, amounts of 1% and less can be achieved for each species (pig, cattle, goat, sheep, turkey, and chicken) if the method is run as a singleplex analysis. Analysis of Dairy Products Using Duplex PCR Milk from mammalian glands contains a varying number of somatic cells (100,000 to 500,000 per millimeter for cows). Indeed, the detection of species DNA in milk and
APPLICATIONS: MEAT SPECIES IDENTIFICATION
95
FIGURE 4.9 Detection of lamb and beef in mixtures of different meat species in processed and heated products. Multiplex PCR according to Matsunaga et al. (1999). Lanes 1 to 3, detection of lamb (331 bp); lanes 4 to 7, detection of beef (274 bp); lanes 1 and 4, 1% lamb and 1% beef in pork matrix (sausage); lane 2, 4% lamb in a pork–beef matrix (sausage); lane 3, lamb (reference); lanes 5 and 6, preserved sausages, 1% beef in pork [121 C, F ¼ 3 to 5 (lane 5) and F < 1 (lane 6)]; lane 7, beef (reference). M, molecular-weight marker (50-bp ladder).
dairy products is not as sensitive as it generally is in samples derived from material rich in cells (e.g., meat). However, the detection of species DNA is still possible if sensitive PCR-methods are used, for example, for the detection of the b-casein gene (Plath et al., 1997). Due to the high number of copies per cell, detection of cytb fragments can be an approach to detecting, for example, adulterations by cows milk in feta cheese. For that purpose, we adapted the method of Matsunaga to a duplex format. An analysis of reference DNA mixtures as well as feta and soft cheese samples is shown in Figure 4.10. Comparing the intensity of the double bands of the mixtures of cattle and sheep DNA (cattle ¼ cow ¼ 274 bp, sheep ¼ 331), the proportion of cattle or cows in dairy products based on sheep milk can be estimated (e.g., “DNA from cow detectable, <5%”). Details of the Method of Matsunaga et al. (1999) DNA from test materials was extracted following the Wizard method described by Meyer et al. (1995).
96
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
FIGURE 4.10 Detection of sheep (s) and cattle/cow (c) DNA in dairy products. Multiplex PCR according to Matsunaga et al. (1999). Sheep, 331 bp; cattle/cow, 274 bp. Lane 1, sample “sheep milk cheese”; lane 2, sample “soft cheese”; lanes 3 to 7, reference DNA (mixtures); lane 3, 100% c; lane 4, 50% c/50% s; lane 5, 10% c/90% s; lane 6, 1% c/99% s; lane 7, 100% s; lane 8, sample “sheep milk cheese”; lane 9, sample “soft cheese.” M, molecular-weight marker (50-bp ladder).
PCR Primers Primer
Sequence
Species
SIM (forward)
50 –GAC CTC CCA GCT CCA TCA AAC ATC TCA TCT TGA AA–30 0 5 –CTC GAC AAA TGT GAG TTA CaG AGG GA–30 0 5 –AAG ATA CAG ATG AAG AAG AAT GAG GCG–30 0 5 –CTA GAA AAG TGT AAG ACC CGT AAT ATA AG–30 0 5 –CTA TGA ATG CTG TGG CTA TTG TCG CA–30 0 5 –GCT GAT AGT AGA TTT GTG ATG ACC GTA–30
Common primer
SIM-goat (reverse) SIM-poultry (reverse) SIM-cattle (reverse) SIM-sheep (reverse) SIM-pig (reverse)
Amplicon Length (bp)
Goat
157
Poultry
227
Cattle
274
Sheep
331
Pig
398
APPLICATIONS: MEAT SPECIES IDENTIFICATION
PCR Reaction
97
(Master Mixes, 50 mL Total Volume per Reaction) Commercial PCR Master Mix (e.g., HotStarTaq Master Mix Kit, Qiagen, Hilden, Germany) (mL)
Single Reagents (mL)
PCR Reagent
Final Concentration in PCR Reaction
Sterile water
—
13 [ (n 3.0) in multiplex assays] 3.0
28.8 [ (n 3.0) in multiplex assays] 3.0
0.3 mM each (slight modifications may be necessary in multiplex assays)
3.0 (in multiplex assays: each)
3.0 (in multiplex assays: each)
0.2 mM 2.0 mM
— 1.0
4.0 1.0
1; 1.5 mM MgCl2
—
5.0
25 (HotStarTaq Master Mix) 45 mL 5.0 mL
0.25
Primer SIM-forward (5 pmol/mL) Primer SIM-reverse: SIM-cattle and/or SIM-pig and/or SIM-poultry and/ or SIM-goat and/ or SIM-sheep (5 pmol/ml) dNTP mix (2.5 mM) MgCl2 solution (25 mM) PCR buffer (10; 15 mM MgCl2) Polymerase (5 U/mL) PCR master mix Addition of sample DNA (optimal concentration 5 to 50 ng/mL)
PCR Reagent Sterile water Primer SIM-forward (5 pmol/mL) Primer SIM-cattle (5 pmol/mL)
0.3 mM
1.25 U/50 mL — —
45 mL 5.0 mL
Final Concentration in PCR Reaction
Commercial PCR Master Mix (e.g., HotStarTaq Master Mix Kit, Qiagen, Hilden, Germany) (mL)
Single Reagents (mL)
— 0.3 mM
12 3.0
27.8 3.0
0.3 mM
3.0
3.0
98
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
Primer SIM-sheep (5 pmol/mL) dNTP mix (2.5 mM) MgCl2 solution (25 mM) Polymerase (5 U/mL) PCR master mix Addition of sample DNA (concentration usually <1 ng/mL)
0.1 mM
1.0
1.0
0.2 mM 2.0 mM 1.25 U/50 mL — —
— 1.0 25 45 5.0
4.0 1.0 0.25 45 5.0
DNA standards used for duplex PCR in dairy products: DNA extracted from meat (tissue: muscles), preparation of DNA mixtures cattle–sheep (0% c/100% s to 100% c/ 0% s); dilution of DNA solutions to about 0.4 ng/mL each. PCR Profile Step Pre-denaturation 35 cycles
Postelongation
Time
Temperature ( C)
15 min* 30 s 30 s 40 s 3 min
95 95 60 72 72
*With HotStarTaq Master Mix Kit; can be reduced to 1 min if standard polymerase is used. Endonuclease Digestion and Separation of Fragments Pork/sheep Cattle Chicken/turkey/goat
Mbo I Alu I Hae III
Amplification solution 10 mL Restriction solution prepared from restriction enzyme (2 U) (0.2 mL) 1.3 mL and restriction buffer (10 ) (1.1 mL) Incubate 3 h at 37 C. Separate 10 mL of each digestion reaction by agarose gel electrophoresis (2–2.5% agarose gel) stained with ethidium bromide. 4.2.3
Method of Wolf (2000)
Differentiation of Fish Species For differentiation of fish species, PCR-RFLP systems based on the cytb gene were optimized by Wolf et al. (2000). Since the cytb gene is not a very variable gene and PCR-RFLP can fail in distinguishing closely related species, the authors developed a second PCR system on a highly variable gene to back up the cytb system. To avoid amplification of nuclear pseudogenes, the primer sequences were changed to increase
APPLICATIONS: MEAT SPECIES IDENTIFICATION
99
the specificity of the mtDNA sequence, which either does not exist as a pseudogene or has a different sequence. A 464-bp sequence of a specific part of the mitochondrial genome (tRNA [Glu]/cytochrome b) is amplified by PCR. The primers were checked for their ability to amplify only mtDNA. Digestion of the products with different endonucleases, followed by agarose gel electrophoresis of the digested products, yielded specific restriction patterns that enabled direct visual identification of the species analyzed. This PCR-RFLP methodology allowed not only clear discrimination of different salmon species in raw and smoked products but also of different fish species that may be present in food products. Russell et al. (2000) demonstrated that this method can be used to differentiate between salmon species. The reliability and practicality of the method was also tested by a collaborative study carried out in five European laboratories (Hold et al., 2004). In a proficiency test (FAPAS proficiency test 2917, 2006), three different fish species (frozen raw materials) had to be identified from a list of eight fish species provided (Table 4.3). Primers used for PCR amplification and conditions are described below. Figure 4.11 exemplifies the DNA restriction fragments generated from digests of 10 reference samples (see Table 4.3) and three unknown samples using the restriction enzyme Hae III. The results indicated the restriction patterns of the fish species as expected (Table 4.3). The differences in restriction patterns of the known fish species allowed identification of the unknown samples as Pollachius virens (A), Hippoglossus hippoglossus (B), and Merluccius merluccius (C). However, identification of unknown fish species in food products usually requires a combination of different restriction enzymes and fragment patterns as well as fish species identified and authenticated morphologically as reference samples. The results have indicated that the method can be applied to a wide range of fish species (Russell et al., 2000; Wolf et al., 2000). TABLE 4.3
PCR-RFLPs for Differentiation of Fish Speciesa
Fish Species Gadus morhua (codfish) Pollachius virens (saithe) Melanogrammus aeglefinus (haddock) Merlangius merlangus (whiting) Pleuronectes platessa (plaice) Limanda limanda (dab) Hippoglossus hippoglossus (halibut) Merluccius merluccius (European hake) Anguilla anguilla (eel) Squalus acanthias (spiny dogfish)
Hae III
Taq I
Nla III
273, 112 323, 112 430
243 (db) 305, 83 300, 139, 79 358, 89 uncut 226 (db), 89
333, 93 396, 95 379, 100
316, 110
300, 186
228, 97
357, 98
260, 126
330, 91
189, 96
338, 97
305, 133, 49 uncut 278, 95, 52 201, 130, 86 204, 156, 93 272, 85, 55
271, 168 417, uncut
183, 125,108 246, 202
uncut
348, 101
295, 169 244, 224
161, 125, 88, 66, 24 371, 93 199, 179, 66, 24 306, 140, 22
uncut uncut
Source: Data from Wolf et al. (2000) and database FischDB (German, www.fischdb.de). a
Sau 3A
Restriction fragments after digestion of the 464-bp amplicon.
100
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
FIGURE 4.11 Analysis of fish species. Restriction fragments of tRNA[Glu]/cytb amplicons (464 bp) obtained with Hae III according to Wolf et al. (2000). Lanes 1 and 2, unknown sample A; lanes 3 and 4, unknown sample B; lanes 5 and 6, unknown sample C; lane 7, Gadus morhua (codfish); lane 8, Pollachius virens (saithe); lane 9, Melanogrammus aeglefinus (haddock), lane 10, Merlangius merlangus (whiting); lane 11, Pleuronectes platessa (plaice), lane 12, Limanda limanda (dab); lane 13, Hippoglossus hippoglossus (halibut); lane 14, Merluccius merluccius (European hake); lane 15, Anguilla anguilla (eel); lane 16, Squalus acanthias (spiny dogfish). M, molecular-weight marker (50-bp ladder).
Differentiation of Game Meat Species In Figure 4.12 the analysis of some game meat species after restriction with Mbo I and Hinf I is shown. The combination of only two restriction patterns is sufficient to differentiate nine game meat and two farm animal species (pig, cattle). Restriction
FIGURE 4.12 Analysis of game meat species. Restriction fragments of tRNA[Glu]/cytb amplicons (464 bp) obtained with Mbo I (a) and Hinf I (b) according to Wolf et al. (2000). Lane 1, mhorr gazelle (Gazelle dama mhorr); lane 2, nyala (Tragelaphus angasii); lane 3, springbok (Antidorcas marsupialis); lane 4, alpine ibex (Capra ibex); lane 5, bactrian camel (Camelus bactrianus); lane 6, wapiti or North American elk (Cervus elaphus ssp.); lane 7, fallow deer (Dama dama); lane 8, European red deer (Cervus elaphus elaphus); lane 9, European roe deer (Capreolus capreolus); lane 10, Siberian roe deer (Capreolus pygargus); lane 11, cattle; lane 12, pig. M, molecular-weight marker (50-bp ladder).
APPLICATIONS: MEAT SPECIES IDENTIFICATION
FIGURE 4.12
101
(Continued )
patterns obtained with Mbo II and Hae III can be used for additional verification of the results (data not shown). In contrast to the method of Meyer et al., (1995) (see above), the related capreolus subspecies European and Siberian roe deer can no longer be discriminated. Details of PCR-RFLP Method According to Russell et al. (2000) DNA from test materials were extracted following the Wizard method described by Meyer et al. (1995). PCR Primers tRNA-Glu 50 –AAA AAC CAC CGT TGT TAT TCA ACT A–30 5 pmol/mL cytb 50 –GCI CCT CAR AAT GAY ATT TGT CCT CA–30 5 pmol/mL
PCR Reaction
PCR Reagent Sterile water Primer tRNA-Glu (5 pmol/mL) Primer cytb (5 pmol/mL)
(Master Mixes, 50 ml Total Volume per Reaction)
Final Concentration in PCR Reaction
Commercial PCR-Master Mix (e.g. HotStarTaq Master Mix Kit, Qiagen, Hilden, Germany) (mL)
Single Reagents (mL)
— 0.4 mM
13 4.0
28.8 4.0
0.4 mM
4.0
4.0
102
PCR–RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS
dNTP mix (2.5 mM 0.2 mM each) PCR buffer (10 ; 1; 1.5 mM MgCl2 15 mM MgCl2) Taq DNA polymerase 1 U/50 mL ( 5u/ml) PCR master mix — Addition of sample — DNA (optimal concentration 5 to 50 ng/mL)
—
4.0
—
5.0
25 (HotStarTaq Master Mix) 46 4.0
0.2 46 4.0
PCR Profile Step Pre-denaturation 35 cycles†
Postelongation:
Time
Temperature ( C)
5 min* 40 s 80 s 80 s 7 min
94 94 50 72 72
*
With HotStarTaq Master Mix Kit; can be reduced to 1 min if standard polymerase is used. † Standard conditions, range from 28 to 45 cycles possible (depending on the problem). Endonuclease Digestion and Separation of Fragments Amplification solution 10 mL Restriction solution prepared from restriction enzyme (10 U) (0.2 mL) 1.3 mL and restriction buffer (10) (1.1 mL) Incubate 3 h at 37 C. Separate 10 mL of each digestion reaction by agarose gel electrophoresis (2–2.5% agarose gel) stained with ethidium bromide.
Acknowledgment We especially thank Mrs. Ulrike Mautner for excellent technical assistance. REFERENCES Beneke B, Hagen M (1998). [Detection of animal species in heated meat samples]. Fleischwirtschaft 78(9):1016–1019. Burgener M, H€ubner P (1998). Mitochondrial DNA enrichment for species identification and evolutionary analysis. Z. Lebensm. Unters. Forsch. A, 207:261–263.
REFERENCES
103
Eugster A (2003). [Contaminations of animal origin in cereals and cereal products: I. Problem and contribution to animal species differentiation by PCR]. Mitt Lebensmittelunters., Hyg. 95:99–109. Eugster A (2004). [Contaminations of animal origin in cereals and cereal products: II. Application of a DNA-based method for animal species differentiation in authentic samples]. Mitt. Lebensmittelunters., Hyg. 95: 99–109. Hold G, Russell V, Pryde S, et al. (2004). Validation of a PCR-RFLP based method for the identification of salmon species in food products. Eur. Food Res. Technol., 212(3):385–389. Matsunaga T, Chikuni K, Taabe R, et al. (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci., 51:143–148. Meyer R, H€ofelein C, L€uthy J, Candrian U (1995). Polymerase chain reaction–restriction fragment length polymorphism analysis: a simple method for species identification in food. J. AOAC Int., 78(6):1542–1551. Plath A, Krause I, Einspanier R (1997). Species identification in dairy products by three different DNA-based techniques. Z. Lebensm. Unters. Forsch. A, 205:437–441. Russell V, Hold G, Pryde S, et al. (2000). Use of restriction fragment length polymorphism to distinguish between salmon species. J. Agric. Food Chem., 48:2184–2188. Waiblinger HU, Weber W (1998). [Differentiation of game meat samples by means of DNAand protein-analysis]. Lebensmittelchemie 52:97–99. Wolf C, Burgener M, H€ubner P, L€uthy J (2000). PCR-RFLP analysis of mitochondrial DNA: differentiation of fish species. Lebensm. Wiss. Technol., 33:144–150.
CHAPTER 5
Single-Stranded Conformation Polymorphism Analysis HARTMUT REHBEIN Max Rubner-Institut, Hamburg, Germany
5.1
INTRODUCTION
Molecular biological techniques are widely used in the following fields of food analysis: . . . . . .
Determination of authenticity (species and population) Identification of tissues (e. g., central nervous system tissues in meat products) Detection and quantification of allergens Detection and quantification of genetically modified organisms Identification and differentiation of microorganisms associated with food spoilage or health risks Identification of genetic traits responsible for quality of products (e.g., genes responsible for meat quality)
Polymerase chain reaction (PCR)–based methods developed into the most important molecular biological techniques for studying the analytical problems listed above. Two types of primers are used in PCR: specific or universal primers. Universal primers have been designed for amplification of the complete mitochondrial 12S rRNA gene in vertebrates (Wang et al., 2000), a segment of the cytochrome b gene of animal species (Verma and Singh, 2003), or the ribosomal internal transcribed spacer regions of insects and other invertebrates (Ji et al., 2003). Amplicons obtained with universal primers have to be further characterized by size [microsatellites, RAPD (random amplified polymorphic DNA), or other fingerprinting techniques], hybridization
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
105
106
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
methods, sequencing, or other secondary methods used for mutation detection (Taylor and Day, 2005). One of the most popular methods for identifying differences in the sequence of amplicons is single-stranded conformation polymorphism (SSCP) analysis, which has been used very often in clinical genetic research (Hayashi, 1992; Bunge et al., 1996; Hestekin and Barron, 2006). In January 2007 more than 10,000 publications were listed in PubMed under the term “SSCP.” In the last two decades, SSCP has also been found useful in tackling various problems related to food analysis. 5.2
PRINCIPLES AND METHODS OF SSCP
SSCP is based on the conformation-dependent migration of single-stranded DNA (ssDNA) or RNA in native polyacrylamide gel electrophoresis (PAGE) or capillary electrophoresis (CE). The protocol of SSCP analysis used most commonly comprises the following steps (Figure 5.1): Sequence 1: ATGCCAGTCA _____ TACGGTCAGT _____
ds DNA
Sequence 2: ATGCAAGTCA _____ TACGTTCAGT _____
Heat and chill Single-strand DNA
Native gel electrophoresis and staining of DNA ___ Cathode
_______ _______ _______ _______
Anode
_______
_______
+
FIGURE 5.1
Principle of SSCP.
ss DNA
ds DNA
PRINCIPLES AND METHODS OF SSCP
107
1. Amplicons of double-stranded DNA (dsDNA) are melted by application of heat and denaturating chemicals such as formamide and NaOH. 2. By rapid chilling in iced water, most of the DNA remains in the single-stranded state. 3. Without any delay, samples are analyzed by native PAGE. 4. DNA bands are visualized either by staining with silver ions or fluorescent DNA-binding dyes, or by autoradiography using 32 P- (or 33 P)-labeled deoxyribonucleotide triphosphates. In recent years numerous modifications of this procedure have been published (Sunnucks et al., 2000). Amplicons of 100 to 200 bp are recommended for SSCP, of a size especially suitable for food analysis. Purification of amplicons prior to denaturation is not necessary (Barroso et al., 1998), but residual primers remaining in the PCR assay may anneal to ssDNA during chilling, influencing the later migration of ssDNA in the course of PAGE (Cai and Touituo, 1993; Kasuga et al., 1995). In this section, methodological variations of the various steps in SSCP analysis are discussed. 5.2.1
Choice of DNA Sequence to Be Amplified by PCR
In food analysis, SSCP has been utilized in most cases to differentiate species or populations. Selection of the DNA sequence depends on the number of base exchanges (mutations) to be expected between the species under consideration, the degradation of DNA during food processing, and the copy number of the gene in the food or feed under study. Short segments of DNA, up to a length of 200 bp, as found in many types of highly processed food, are often difficult to differentiate by RFLP because of the limited number of possible restriction sites, but they are privileged to analysis by SSCP. Since the sensitivity of SSCP increases with decreasing fragment length, larger amplicons (500 to 1000 bp), as existing in raw or cooked meat and fish, may be cut into shorter fragments prior to SSCP by restriction endonucleases. In fact, the combination of RFLP and SSCP has enhanced the power for differentiation between species and can also help to reduce the number of restriction endonucleases necessary to characterize the sample (Barros et al., 1997; Rehbein, 2002). For species identification, mitochondrial genes are favored over nuclear genes, due to the high number of mitochondrial genomes in many tissues used for food production and the greater mutation rate. The haploid character of the mitochondrial genome, as well as the rare occurrence of heteroplasmy (heteroplasmy is the presence of a mixture of more than one type of mitochondrial DNA within a cell, tissue, or individual), make the pattern obtained by the SSCP of mitochondrial genes easy to interpret. 5.2.2
Preparation of Single-Stranded DNA
Several options for getting ssDNA are available: (1) dissociation of double-stranded DNA by heating the PCR product in the presence of formamide and alkali or other
108
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
denaturating agents, (2) two-step asymmetrical PCR, (3) one-step asymmetrical PCR, and (4) exonuclease digestion of the phosphorylated strand of dsDNA (Rehbein et al., 1998). The first method has been used most often. After heating, DNA must be kept single-stranded by rapid chilling of the tubes in iced water. If the other three methods are used, heating and chilling are not necessary, as reannealing is prevented by the absence of the second DNA strand. A disadvantage of methods producing only one DNA strand is the lack of information obtained by the position of the other single DNA strand in electrophoresis slab gels or CE. 5.2.3
Electrophoresis (Slab Gels)
The conditions of electrophoresis are most important for success of the SSCP technique. Separation of ssDNA by nondenaturating (native) electrophoresis may be performed either in slab gels (native PAGE) or in capillaries (CE). The decision for one of these methods may depend on the equipment available and the number of samples to be analyzed. Electrophoresis Conditions in Native PAGE The gel matrix type, the composition of the electrophoresis buffer, and the temperature within the gel all have a strong effect on the migration velocity of ssDNA, which is crucial for the resolving power of the method. Two types of polyacrylamide (PA) gels, together with vinyl polymer Hydrolink-MDE gels, have been compared with respect to the efficiency and cost-effectiveness for SSCP analysis (Gupta and Agarwal, 2003). PA gels, as well as MDE gels, were found to be suited to identify unknown b thalassaemia mutations, but PAGE, especially with PhastSystem (GE Healthcare), was most rapid and cost-effective. PhastGels (GE Healthcare, Freiburg, Germany) and other types of precast PA gels have been compared for applicability in SSCP analysis of fishery products (Rehbein, 1997). PhastGel and CleanGel (ETC, Kirchentellinsfurth, Germany) gave satisfactory results for identification of canned tuna and hotsmoked eel (Rehbein, 1997). As it very difficult up to now to predict the conformation of ssDNA in electrophoresis gels (Nielsen et al., 1995), the best conditions for separation of given DNA single strands have to be established by trial and error. The following guidelines were found to be helpful for searching suitable conditions for successful SSCP: .
.
.
Select a gel matrix reported to give good results. Homemade PA or MDE (Cambrex, Rockland, Maine) gels, as well as commercially available gels (supplied by ETC, GE Healthcare, and other companies), may be used. Test buffers of different composition and pH value (e.g., 0.5 TBE pH 8.3 or Tris-acetate pH 6.4), if necessary with and without additives such as glycerol (Teschauer et al., 1996). Determine the optimal temperature. In most cases, temperatures between 4 and 10 C were found to be optimal. Temperature should be controlled during electrophoresis to improve the reproducibility of results.
PRINCIPLES AND METHODS OF SSCP
109
The duration of electrophoresis depends on the size of ssDNA, the type of gel and buffer, the presence of additives, and the temperature. PA gel electrophoresis needs a few hours, whereas separation of samples in MDE gels takes much more time, up to 16 h. Visualization of DNA Bands From the beginning of SSCP analysis (Orita et al., 1989) up to the present time (Gupta and Agarwal, 2003), radioactively labeled (32 P, 33 P) dNTPs have been used for detection of ssDNA. As work with radioactive material requires special laboratory facilities and costly waste disposal, alternative methods such as silver staining or fluorescent SSCP have been developed (Jenkins and Charlton, 2005; Robinson, 2005). Silver staining of ssDNA and dsDNA has a low detection limit, is relatively cheap, and can be performed automatically by staining apparatus. A number of recipes have been published, and various kits are commercially available. For fluorescent SSCP in slab gels, ethidium bromide is less suited, as binding of this dye to ssDNA is relatively poor, making the method insensitive. SybrGreen II and SybrGold stain (Invitrogen, Molecular Probes) have proven to be sensitive for detecting SSCP products (Tuma et al., 1999). Examples of population screening by SSCP using SybrGold are given by the studies of Hamzeiy et al. 2002 of human populations and Jarman et al. 2002 of Antarctic coastal krill samples. 5.2.4
Capillary Electrophoresis
The need for high-throughput screening methods of human mutations has stimulated the development of CE-based methods for SSCP analysis. For detection of ssDNA, PCR is carried out with primers labeled at the 50 site with fluorescence dyes. Two different labels may be used for identification of the forward and reverse strands. Advantages of CE-SSCP are speed of electrophoresis (ca. 10 min), high sensitivity, reproducibility, and the possibility of automation (Andersen et al., 2003; Hestekin et al., 2006). In food analysis, CE-SSCP has been used to identify bacteria (see Section 5.4.4) but, to the knowledge of the author, not to species identification of meat, fish, or other food up to now. 5.2.5
Interpretation of Results
The pattern of ssDNA obtained by PCR of a haploid gene sequence consists of two principal bands representing the two strands of the amplicon. For example, the mitochondrial cytochrome b gene, which is widely used for identification of animal species, gave two bands of ssDNA in SSCP analysis of eel species (Figure 5.2). The number of bands is increasing if nuclear genes of heterocygotic animals are used for species identification. In addition to the main ssDNA bands, additional, fainter bands are often observable. These bands may indicate the presence of mixed food products if contamination of PCR can be excluded. Another reason for the occurrence of additional bands is given by the existence of several stable conformations of ssDNA under certain conditions of
110
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
FIGURE 5.2 b gene.
Differentiation of eel species by SSCP of a 123-bp sequence of the cytochrome
denaturation and electrophoresis (Kasuga et al., 1995). The additional bands can be a source of additional information and must not be considered as a disadvantage of the technique, because in SSCP analysis, unknown samples and references are run side by side on the same slab gel. It is highly recommended that suitable references be included in PCR-SSCP, especially in the electrophoresis step, as the migration of ssDNA is affected very strongly by the electrophoresis conditions.
5.3
PROTOCOL OF NONRADIOACTIVE SSCP
Numerous protocols for SSCP analysis without the use of radioactive isotopes have been published, and vendors of precast gels and chemicals for preparation of gels offer a detailed description of SSCP electrophoresis. A list of publications and Web sites is given in Table 5.1. Commercially available precast gels may help to ensure the reproducibility of results between laboratories. The reliability of SSCP performed TABLE 5.1
Protocols of Nonradioactive SSCP
Type of Gel
Staining Procedure
Reference
MDE (mutation detection enhancement gel) Polyacrylamide, several types of precast gels) MDE MDE (ABI 377)
Fluorescent DNA-binding dyes Silver staining, SybrGreen II Silver staining Labeled primers (HEX or 6-FAM dye) Silver staining
www.cambrex.com
Silver staining Ethidium bromide Silver staining
Khamnamtong et al. (2005) Orti et al. (1997) Robinson (2005)
Polyacrylamide, precast and homemade gels Polyacrylamide, homemade gels
www.etcelpho.com Highsmith et al. (1999) Highsmith et al. (1999) Rehbein et al. (1999)
APPLICATIONS OF SSCP ANALYSIS
111
under controlled electrophoretic conditions has been proved by collaborative study (Rehbein et al., 1999).
5.4 5.4.1
APPLICATIONS OF SSCP ANALYSIS Food from Warm-Blooded Animals
There are only a few publications dealing with the authentication of meat by SSCP. For discriminating European pig and wild boar meat samples, segments of the mitochondrial D-loop were amplified and subjected to SSCP analysis (Rea et al., 1996), Due to the variability of SSCP patterns of wild boar meat samples, differentiation between pig and wild boar was not possible. In another study of the identification of animal species, PCR with tuna-directed primers amplifiying a 148-bp sequence of the cytochrome b gene resulted in strong, specific ssDNA bands for a number of warm-blooded animal species (Weder et al., 2001). Figure 5.3 gives an example of the suitability of RFLP-SSCP analysis to distinguish between the meat of warm-blooded animals, again with the exception of pig and wild boar. Martinez and Danielsdottir (2000) identified marine mammal species in food products by SSCP and RAPD (random amplified polymorphic DNA) analysis. SSCP using nuclear and mitochondrial genes allowed differentiation between partridge
FIGURE 5.3 RFLP-SSCP of warm-blooded animals. A 464-bp sequence of the cytochrome b gene was amplified and digested with Hinf I. Fragments were denatured and run on CleanGel HP 10% using Delect buffer (ETC). (From H. Rehbein, unpublished results.)
112
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
species (Alectoris rufa and A. chukar) and hybrids (Tejedor et al., 2006). In a comparative study on species identification in dairy products by RFLP, SSCP, and DNA intercalating agent, differentiation between goat’s and cow’s milk by SSCP could be achieved, but the method was less sensitive than RFLP to detecting low levels of cow’s milk in added to goat’s milk (Plath et al., 1997). Other applications of SSCP analysis involved identification of genotypes related to meat quality (Chung et al., 1999; Yilmaz et al., 1999) or casein typing in sheep by single-nucleotide polymorphism (SNP) (Ceriotti et al., 2004) and in cow (Barroso et al., 1998). 5.4.2
Fishery Products
SSCP analysis has been found useful for the authentication of various types of seafood. As shown in Table 5.2, a considerable number of fish species, shrimps, and mollusks could be identified by SSCP of mitochondrial or nuclear genes. As SSCP gives very good results for short DNA segments, species identification of products containing severely degraded DNA (e.g., canned tuna) may be easier to achieve by SSCP than by RFLP (Rehbein et al., 1999). In a study of fish meal authentication, SSCP and RFLPSSCP allowed differentiation between meals produced from a number of fish species, including two closely related sand eel species (Rehbein, 2002). 5.4.3
Parasites
Occurrence of parasites in animal tissues in processed meat and fish products is of major human health importance. Identification of parasite species is necessary for the development of strategies to reduce or eliminate parasites in meat and fish. In recent years, PCR-based methods have expanded the traditional morphological identification methods of taxonomy used in food control laboratories, which quite often rely on visual inspection only (Levsen et al., 2005). Among other PCR-based methods, SSCP analysis has been used to differentiate between nematode species. Utilizing the second internal transcribed spacer (ITS-2) of the ribosomal RNA gene by SSCP, 23 nematode species of the orders Ascaridida and Strongiylida could be identified (Gasser et al., 1997). Later, Trichinella isolates, hookworms, members of the Contracaecum osculatum complex, Benedeniinae, and members of the Pseudoterranova decipiens complex have been differentiated by SSCP (Gasser et al., 1998; Hu et al., 2001, 2002; Zhu et al., 2002; Li et al., 2005). 5.4.4
Bacteria
Detection and differentiation of foodborne bacteria by molecular techniques is accepted increasingly as an alternative to traditional culture methods. As a sensitive, rapid, low-cost method, PCR-SSCP has become popular among food microbiologists. Bacterial community dynamics during production of “registered designation of origin” salers cheese have been studied by SSCP analysis of the 16S rRNA gene using slab gels (Duthoit et al., 2003) or CE (Duthoit et al., 2005). Takahashi et al. (2005) studied histamine-producing bacteria in fish by RFLP-SSCP using the histidine decarboxylase
113
a
RFLP-SSCP.
Mollusks Perna canaliculus 11 bivalve species Ruditapes decussatus, Venerupis pullastra Squid, T. rhombus
Shrimps 5 penaeid shrimp species 7 shrimp species
8 species > 10 fish species
NADH dehydrogenase IV 18S rRNA A-actin Cytochrome oxidase I
Gonad tissue Alcohol-fixed samples Raw foot muscle
Arm muscle
Raw muscle Raw muscle
16S rRNA Cytochrome oxidase I
Cytochrome b Cytochrome b Cytochrome b, parvalbumin, growth hormnone 16S rRNA Cytochrome b
Caviar Canned muscle Raw or cold-smoked fish
Eggs and larvae Fish meal
28S rRNA Cytochrome b Cytochrome b 12S RNA
Gene
Raw fish Frozen or canned muscle Raw or smoked fish Raw fish
Product
Application of SSCP in Seafood Authentication
Fish 30 species from 12 taxa 4 tuna species 4 eel species E. guaza, P. americanus, L. niloticus 5 sturgeon species 8 tunas and bonitos 10 salmonid species
Species
TABLE 5.2
Apte and Gardner (2001) Livi et al. (2006) Fernandez et al. (2002) Kitaura et al. (1998)
250
Khamnamtong et al. (2005) Rehbein (2001)
Garcia-Vazquez et al. (2006) Rehbein (2002)
Rehbein et al. (1999b) Rehbein et al. (1999a) Rehbein (2005)
Hara et al. (1994) Colombo et al. (2005) Rehbein et al. (2002) Asensio et al. (2001)
Reference
484 a 320 150
312 and 560 121
464 301 450 564–568 464 a
100 123 123
Amplicon Size (bp)
114
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
gene as an amplicon. Specific patterns for a number of bacterial species and strains allowed identification of histamine-producing bacteria in samples from supermarkets. 5.5
PROS AND CONS OF SSCP
SSCP gives very good results for short segments of DNA, which are prevalent in many types of food. A difference of 1% between sequences has been found sufficient to deliver different patterns of ssDNA. SSCP analysis is a very fast technique. When using CE for separation of ssDNA, results may be obtained within 1 h following PCR. If slab gels are preferred for SSCP, the time needed until analysis is finished varies from about 6 to 16 h following PCR, depending on gel type and staining procedure. Also, compared to other techniques of PCR-based methods of mutation detection, SSCP is low in cost. The greatest disadvantage of SSCP is the difficulty in standardizing the method because the ssDNA pattern is greatly influenced by conditions (i.e., gel type, buffer, temperature) during electrophoresis. However, using precast commercially available slab gels or CE, the reproducibility of results is very much improved. Nevertheless, unknown samples and references should be run side by side on the same gel. References are easily obtained using frozen stored former PCR assays. REFERENCES Andersen PS, Jespersgaard C, Vuust J, Christiansen M, Larsen LA (2003). Capillary electrophoresis-based single strand DNA conformation analysis in high-throughput mutation screening. Hum. Mutat., 21:455–465. Apte S, Gardner JPA (2001). Three polymorphic mitochondrial DNA markers for Perna canaliculus. Anim. Genet., 32:47–49. Asensio L, Gonzalez L, Fernandez A, et al. (2001). PCR-SSCP: a simple method for the authentication of grouper (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates niloticus) fillets. J. Agric. Food Chem., 49:1720–1723. Barros F, Laren MV, Salas A, Carracedo A (1997). Rapid and enhanced detection of mitochondrial DNA using single-strand conformation analysis of superposed restriction enzyme fragments from polymerase chain-reaction amplified products. Electrophoresis, 18:52–54. Barroso A, Dunner S, Canon J (1998). Technical note: detection of bovine kappa-casein variants A, B, C, and E by means of polymerase chain reaction–single strand conformation polymorphism (PCR-SSCP). J. Anim. Sci., 76:1535–1538. Bunge S, Fuchs S, Gal A (1996). Simple and nonisotopic methods to detect unknown gene mutations in nucleic acids. Methods Mol. Genet., 8:26–39. Cai Q-Q, Touituo I (1993). Excess PCR primers may dramatically affect SSCP efficiency. Nucleic Acids Res., 21:3909–3910. Ceriotti G, Chessa S, Bolla P, et al. (2004). Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain-reaction single strand conformation polymorphism. J. Dairy Sci., 87:2606–2613.
REFERENCES
115
Chung HY, Davis ME, Hines HC, Wulf DM (1999). Relationship of a PCR-SSCP at the bovine calpastatin locus with calpastatin activity and meat tenderness. http://ohioline.osu.edu/ sc170/sc170_3.html. Colombo F, Mangiagalli G, Renon P (2005). Identification of tuna species by computer-assisted and cluster analysis of PCR-SSCP electrophoretic patterns. Food Control, 16:51–53. Duthoit F, Godon J-J, Montel M-C (2003). Bacterial community dynamics during production of registered designation of origin salers cheese as evaluated by 16S rRNA gene single-strand conformation polymorphism analysis. Appl. Environ. Microbiol., 69:3840–3848. Duthoit F, Tessier L, Montel M-C (2005). Diversity, dynamics and acitivity of bacterial populations in “registered designation of origin” salers cheese by single-strand conformation polymorphism analysis of 16S rRNA genes. J. Appl. Microbiol., 98:1198–1208. Fernandez A, Garcia T, Asensio L, et al. (2002). Genetic differentiation between the clam species Ruditapes decussates (grooved carpet shell) and Venerupis pullastra (pulletcarpet shell) by PCR-SSCP analysis. J. Sci. Food Agric., 82:881–885. Garcia-Vazquez E, Alvarez P, Lopes P, et al. (2006). PCR-SSCP of the 16S rRNA gene, a simple methodology for species identification of fish eggs and larvae. Sci. Mar., 70S2:13–21. Gasser RB, Monti JR, Zhu X, Chilton NB, Hung G-C, Guldberg P (1997). Polymerase chain reaction-linked single-strand conformation polymorphism of ribosomal DNA to fingerprint parasites. Electrophoresis, 18:1564–1566. Gasser RB, Zhu XQ, Monti JR, Dou L, Cai X, Pozio E (1998). PCR-SSCP of rDNA for the identification of Trichinella isolates from mainland China. Mol. Cell. Probes, 12:27–34. Gupta A, Agarwal S (2003). Efficiency and cost effectiveness: PAGE-SSCP versus MDE and Phast gels for the identification of unknown mutations of b thalassaemia mutations. J. Clin. Pathol. Mol. Pathol., 56:237–239. Hamzeiy H, Vahdati-Mashhadian N, Edwards HJ, Goldfarb PS (2002). Mutation analysis of the human CYP3A4 gene 50 regulatory region: population screening using non-radioactive SSCP. Mutat. Res., 500:103–110. Hara M, Noguchi M, Naito E, Dewa K, Yamanouchi H (1994). Ribosomal RNA gene typing of fish genome using PCR-SSCP method. Bull. J. Sea Natl. Fish. Res. Inst., 44:131–138. Hayashi K (1992). PCR-SSCP: a method for detection of mutations. GATA (Genet. Anal. Tech. Appl.), 9:73–79. Hestekin CN, Barron AE (2006). The potential of electrophoretic mobility shift assays for clinical mutation detection. Electrophoresis, 27:3805–3815. Hestekin CN, Jakupciak JP, Chiesi TN, Kan CW, O’Connell CD, Barron AE (2006). An optimized microchip electrophoresis system for mutation detection by tandem SSCP and heteroduplex analysis for p53 exons 5–9. Electrophoresis, 27:3823–3835. Highsmith WE, Nataraj AJ, Jin Q, et al. (1999). Use of DNA toolbox for the characterization of mutation scanning methods: II. Evaluation of single-strand conformation polymorphism analysis. Electrophoresis, 20:1195–1203. Hu M, D’Amelio S, Paggi L, Gasser R (2001). Mutation scanning for sequence variation in three mitochondrial DNA regions for members of the Contracaecum osculatum (Nematoda: Ascaridoidea) complex. Electrophoresis, 22:1069–1075. Hu M, Chilton NB, Zhu X, Gasser RB (2002). Single-strand conformation polymorphismbased analysis of mitochondrial cytochrome c oxidase subunit 1 reveals significant substructuring in hookworm populations. Electrophoresis, 23:27–34.
116
SINGLE-STRANDED CONFORMATION POLYMORPHISM ANALYSIS
Jarman SN, Elliott NG, Nicol S, McMinn A (2002). Genetic differentiation in the Antarctic coastal krill Euphausia crystallorophias. Heredity, 88:280–287. Jenkins L, Charlton R (2005). Fluorescent SSCP: slab gels and capillary electrophoresis. In Taylor GR, Day INM (eds.), Guide to Mutation Detection. Wiley–Liss, Hoboken, NJ, pp. 210–220. Ji Y-J, Zhang D-X, He L-J (2003). Evolutionary conservation and versatility of a new set of primers for amplifying the ribosomal internal transcribed spacer regions in insects and other invertebrates. Mol. Ecol. Notes, 3:581–585. Kasuga T, Cheng J, Mitchelson KR (1995). Metastable single-strand DNA conformational polymorphism analysis results in enhanced polymorphism detection. PCR Methods Appl., 4:227–233. Khamnamtong B, Klinbunga S, Menasveta P (2005). Species identification of five penaeid shrimps using PCR-RFLP and SSCP analyses of 16S ribosomal DNA. J. Biochem. Mol. Biol., 38:491–499. Kitaura J, Yamamoto G, Nishida M (1998). Genetic variation in populations of the diamondshaped squid Thysanoteuthis rhombus as examined by mitochondrial DNA sequence analysis. Fish. Sci., 64:538–542. Levsen A, Lunestad BT, Berland B (2005). Low detection efficiency of candling as a commonly recommended inspection method for nematode larvae in the flesh of pelagic fish. J. Food Prot., 68:828–832. Li A-X, Wu X-Y, Ding X-J, et al. (2005). PCR-SSCP as a molecular tool for the identification of Benedeniinae (Monogenea: Capsalidae) from marine fish. Mol. Cell. Probes, 19:35–39. Livi S, Cordisco C, Damiani C, Romanelli M (2006). Identification of bivalve species at an early developmental stage through PCR-SSCP and sequence analysis of partial 18S rDNA. Mar. Biol., 149:1149–1161. Martinez I, Danielsdottir A (2000). Identification of marine mammal species in food products. J. Sci. Food Agric., 80:527–533. Nielsen DA, Novoradovsky A, Goldman D (1995). SSCP primer design based on single-strand DNA structure predicted by a DNA folding program. Nucleic Acids Res., 23:2287–2291. Orita M, Suzuki Y, Sekiya T, Hayashi K (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5:874–879. Orti G, Hare MP, Avise JC (1997). Detection and isolation of nuclear haplotypes by PCR-SSCP. Mol. Ecol., 6:575–580. Plath A, Krause I, Einspanier R (1997). Species identification in dairy products by three different DNA-based techniques. Z. Lebensm. Unters. Forsch. A, 205:437–441. Rea S, Chikuni K, Avellini P (1996). Possibility of using single strand conformation polymorphism (SSCP) analysis for discriminating European pig and wild boar meat samples. Ital. J. Food Sci., 8:211–220. Rehbein H (1997). Comparison of several types of precast polyacrylamide gels for fish species identification by DNA analysis (single strand conformation polymorphism, and random amplified polymorphic DNA). Arch. Lebensmittelhyg., 48:41–43. Rehbein H (2001). Identification of shrimp species by protein- and DNA-based analytical methods. Ann. Soc. Sci. Faeroensis Suppl., 28:195–205. Rehbein H (2002). Identification of the fish species processed to fish meal. J. Aquat. Food Prod. Technol, 11:45–56.
REFERENCES
117
Rehbein H (2005). Identification of the fish species of raw or cold-smoked salmon and salmon caviar by single-strand conformation polymorphism (SSCP) analysis. Eur. Food Res. Technol., 220:625–632. Rehbein H, Mackie IM, Pryde S, et al. (1998). Comparison of different methods to produce single-strand DNA for identification of canned tuna by single-strand conformation polymorphism analysis. Electrophoresis, 19:1381–1384. Rehbein H, Mackie IM, Pryde S, et al. (1999a). Fish species identification in canned tuna by PCR-SSCP: validation by a collaborative study and investigation of intra-species variability of the DNA patterns. Food Chem., 64:263–268. Rehbein H, Gonzales-Sotelo C, Perez-Martin R, et al. (1999b). Differentiation of sturgeon caviar by single strand conformation polymorphism (PCR-SSCP) analysis. Arch. Lebensmittelhyg., 50:13–17. Rehbein H, Sotelo CG, Perez-Martin RI, et al. (2002). Differentiation of raw or processed eel by PCR-based techniques: restriction fragment length polymorphism analysis (RFLP) and single strand conformation polymorphism analysis (SSCP). Eur. Food Res. Technol., 214:171–177. Robinson MD, (2005). Manual SSCP and heteroduplex analysisi gels. In Taylor GR, Day INM (eds.), Guide to Mutation Detection. Wiley–Liss, Hoboken, NJ, pp. 201–209. Sunnucks P, Wilson ACC, Beheregaray LB, Zenger K, French J, Taylor AC (2000). Mol. Ecol., 9:1699–1710. Takahashi H, Kimura B, Yoshikawa M, Fujii T (2003). Cloning and sequencing of the histidine decarboxylase genes of gram-negative, histamine-producing bacteria and their application in detection and identification of these organisms in fish. Appl. Environ. Microbiol., 69:2568– 2579. Taylor GR, Day INM (eds). (2005). Guide to Mutation Detection. Wiley–Liss, Hoboken, NJ. Tejedor MT, Monteagudo LV, Arruga MV (2006). DNA single strand conformation polymorphisms (SSCP’s) studies on Spanish red-legged partridges. Wildl. Biol. Pract., 2:8–12. Teschauer W, Mussack T, Braun A, Waldner H, Fink E (1996). Conditions for single strand conformation polymorphism analysis with broad applicability: a study on the effects of acrylamide, buffer and glycerol concentrations in SSCP analysis of exons of the p53 gene. Eur. J. Clin. Chem. Clin. Biochem, 34:125–131. Tuma RS, Beaudet MP, Jin X, et al. (1999). Characterization of SbryGold nucleic acid gel stain: a dye optimized for use with 300-nm ultraviolet transillumininators. Anal. Biochem., 268:278–288. Verma SK, Singh L (2003). Novel universal primers establish identity of an enormous number of animal species for forensic application. Mol. Ecol. Notes, 3:28–31. Wang H-Y, Tsai M-P, Tu M-C, Lee S-C (2000). Universal primers for amplification of the complete mitochondrial 12S rRNA gene in vertebrates. Zool. Stud., 39:61–66. Weder JKP, Rehbein H, Kaiser K-P (2001). On the specificity of tuna-directed primers in PCR-SSCP analysis of fish and meat. Eur. Food Res. Technol., 213:139–144. Yilmaz A, Davis ME, Hines HC (1999). A PCR-SSCP polymorphism detected in the 50 flanking region of the ovine IGF-I gene. http://ohioline.osu.edu/sc170/sc170_18.html. Zhu XQ, Beveridge I, Berger L, Barton D, Gasser RB (2002). Single-strand conformation polymorphism-based analysis reveals genetic variation within Spirometra erinacei (Cestoda: Pseudophyllidea) from Australia. Mol. Cell. Probes, 16:159–165.
CHAPTER 6
Sequencing RAINER SCHUBBERT Eurofins Medigenomix GmbH, Ebersberg, Germany
6.1
INTRODUCTION
In this chapter we describe methods used to analyze biological samples by sequencing analysis. The main area focuses on methods used typically in routine laboratories. The applications described are examples that represent the wide field of applications for sequencing in daily analysis work. All methods described here are based on polymerase chain reaction (PCR), which is described in Chapter 2. Generally, the success of analysis depends on the correct sampling and storage, the DNA content of the sample, and the correct DNA extraction method. The first methods of sequencing were developed in the late 1970s. With them, sequences of cleaned DNA fragments can be specified quickly and easily. During the last 30 years, sequencing had been automated continuously. By now, the human genome, with its 3.2 billion base pairs, as well as the genomes of over 60 other organisms, have been sequenced. Up to now, several methods of DNA sequencing were developed. Some of the methods are described; other protocols, published by Maxam and Gilbert [1] and Church and Kieffer-Higgins [2], are not used in routine analysis. Nowadays, high-throughput sequencing is performed with automated detection systems (Table 6.1). With some of the instruments, only sequencing can be performed; with others additional applications, such as microsatellite analysis, are possible. As described in more detail in Chapter 1, laboratories in which sequencing is performed should be separated into pre-PCR, PCR setup, and post-PCR departments. Setup of sequencing reactions, cleanup of sequencing reactions for electrophoresis, and capillary electrophoresis should be performed in the post-PCR department.
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
119
120
SEQUENCING
TABLE 6.1
Common Instruments Used for Sequencing
Manufacturer Type of Instrument Throughput Bases ABI Pyroseq LiCor
3730 Pyro Mark ID 4300L or 4300S
Roche
GS FLX
1 106 bases/day 480 short runs per hour 48 1200 bases per swab gel 100 MB/run/7.5 h
Homepage www.appliedbiosystems.com www.pyrosequencing.com www.licor.com www.roche.com
It is suggested that PCR and sequencing reactions be carried out in different thermocyclers.
6.2 6.2.1
METHODS Sanger Protocol
Most sequencing analyses performed today are done by the principles of Sanger and Coulson [3]. The principle of this method is an enzymatic reaction with a DNA polymerase. At the beginning, DNA is denatured into two single strands with NaOH. After neutralization of pH in a short single-stranded DNA fragment, the primer can bind to the single-stranded DNA sequence to be analyzed (template). The sequence of this primer is complementary to the template, which should be sequenced. The reaction is distributed over four separate reaction tubes for the termination reaction. The polymerase starts the synthesis at this primer–template hybrid. By incorporation of complementary bases (A to T and C to G) which are available as deoxyribonucleoside triphosphate (dATP, dCTP, dGTP or dTTP, or dNTPs), the polymerase synthesizes a DNA strand complementary to the template. At the original protocol the DNA strands synthesized were labeled radioactively by incorporation of 35 S-labeled dATP. Additionally, four dideoxyribonucleoside triphosphate nucleotides (ddATP, ddGTP, ddCTP or ddTTP, or ddNTPs) were added to the reaction as terminators. These types of nucleotides are devoid of an essential chemical group. Therefore, elongation of the DNA strand stops after incorporation of a ddNTP. In each of the four separate reaction attempts, from one of the four dNTPs an aliqout of the corresponding ddNTP is added and competes with its normal counterpart. The proportion of dNTPs to ddNTPs (usually 1 to 4% of ddNTPs) are chosen such that the marked cords can be up to several hundred bases long. Each new DNA cord ends on a randomly selected A, C, T, or G. Fragments of different length emerge. The analysis of the DNA strands is performed by highly dissolving polyacrylamide (PAA) gel electrophoresis. Following the original protocol with radioactive labeled dATP, the four reactions are spread on parallel lanes and made visible through an ensuing autoradiography. A modification of the protocol is the use of dye-labeled primers or dye-labeled ddNTP. In this case, two or four reactions can be separated in one lane and analyzed with an automated instrument. The analysis of data could be done automatically or by hand.
METHODS
6.2.2
121
Cycle Sequencing
The cycle-sequencing protocol is based on the classical Sanger protocol with only one elongation step. For cycle-sequencing protocols the critical alkaline denaturation step is exchanged against a thermal denaturation of DNA at 94 to 96 C. Therefore, thermostable polymerases are used for this analysis. In contrast to classical sequencing, where the template strand is copied once by the three steps denaturation– annealing–elongation, in cycle sequencing this cycle is performed 20 to 30 times. The reaction is performed in a thermocycler. Typical cycle conditions are denaturation of double-stranded DNA at 96 C for 15 s, annealing of the primer to the complementary single strand at 55 C for 15 s, and elongation at 70 C for 1 min. Compared to classical Sanger sequencing, this method has the following advantages: . . . .
Less template necessary (e.g., 5 ng of PCR product per 100 bp) Specific primer binding by high annealing temperatures Lower failure rate in reaction preparation and performance Good resolution of secondary structures at problematic templates
The combination of a cycle-sequencing method with dye-labeled terminators allows high-throughput sequencing in automated laboratories with drastically reduced costs per base. Commercially available kits (e.g., BigDye 1.1 or 3.1, Applied Biosystems) with well-balanced ratios of dNTPs and ddNTPs in combination with 16or 96-capillary-array genetic analyzers allow sequencing of up to 1200 bp in a single capillary electrophoresis (Figure 6.1). Kits are also available for specific applications such as sequencing of GC-rich DNA strands (dGTP BigDye Terminators) or sequencing of 16S rRNA from bacteria (MicroSeq 500). After cleanup of the sequencing reaction either manually or in an automated system, the DNA fragments are separated on genetic analyzers. As older instruments
FIGURE 6.1 Example of a DNA sequence: 650 to 740 bases from the starting point of a sequencing reaction. (See insert for color representation.)
122
SEQUENCING
FIGURE 6.2 Genetic analyzer ABI 3730.
work with swab gels, which for some applications still give better resolutions or longer reads, nowadays analysis is performed on 16- or 96-capillary-array instruments with laser stimulation of the fluorescent dyes and detection of emitted fluorescence light by CCD (charge-coupled device) cameras (Figure 6.2). Most working steps, such as filling the capillaries with viscous polymer, loading the samples to the capillary, and starting and performing electrophoresis, are performed by the instrument. Therefore, one instrument can perform up to 12 runs with 96 samples per day with minimized manual handling. Routine service work on this instrument is reduced to changing buffers and viscous polymers or capillary arrays and a routine cleanup of the instrument (buffer chambers, injection pumps), which should be performed once a week. 6.2.3
Pyrosequencing
Some years ago, pyrosequencing emerged as a new sequencing methodology. It has the potential advantages of accuracy, flexibility, and parallel processing, and can easily be automated. Using this technique there is no need for labeled primers, labeled nucleotides, and gel electrophoresis. Since the result of the sequencing reaction is measured directly by the instrument, some authors call this method real-time sequencing. So far, the method has been used successfully for both confirmatory sequencing and de novo sequencing of short PCR products, but not for genome sequencing, due to the limitation in read length. In the analysis of food or food products, it can be used for applications such as genotyping, resequencing of short
METHODS
123
DNA fragments (e.g., animal species determination), and sequence determination of difficult secondary DNA structures. Pyrosequencing is based on the detection of released pyrophosphate (PPi) during DNA synthesis. In a cascade of enzymatic reactions, visible light is generated and detected online by the instrument. The intensity of the light is proportional to the ‘number of nucleotides incorporated. The cascade starts with the injection into the reaction of one of the four nucleotides. During the nucleotide incorporation by the Klenow fragment of Escherichia coli DNA Pol I, which is a relatively slow polymerase, inorganic PPi is released as a result. This PPi is subsequently converted to ATP by ATP sulfurylase. The ATP sulfurylase used in pyrosequencing is a recombinant version from the yeast Saccharomyces cerevisiae, which provides the energy to luciferase from the American firefly, Photinus pyralis. This enzyme oxidizes luciferin, and at this reaction, light is generated. Because the added nucleotide is known, the sequence of the template can be determined. The overall reaction from polymerization to light detection takes place within 3 to 4 s at room temperature. One picomole of DNA in a pyrosequencing generates more than 6 109 photons at a wavelength of 560 nm. This amount of light can easily be detected by a CCD camera. Template preparation for pyrosequencing is straightforward. After generation of the template by PCR, the product should be purified prior to pyrosequencing. Unincorporated nucleotides and PCR primers in PCR reaction perturb the pyrosequencing reaction, and the salt in the PCR reaction can inhibit the enzyme system and should be removed or diluted. Depending on the sequence of the DNA template, up to 200 bp can be read. Stretches of three or more identical bases can lead to problems in data interpretation. As for every sequencing reaction, the primer should bind only once at the template. Protocols has been developed for several applications and are available from the manufacturer. Multiplex sequencing (analysis of more than one sequence per reaction) is also possible with optimized protocols, depending on the sequences following the primers (e.g., screening for scrapie resistance). In this case the sequence detected has to be compared to reference samples because at multiplex analysis the sequence received is a combination from reactions with different primers. 6.2.4
Roche GS FLX/454 Sequencing
Even if GS FLX/454 Sequencing, which is similar to pyrosequencing, is used currently for whole-genome sequencing and screening of cDNA libraries in specialized high-throughput laboratories and obviously will not be used in analysis of food or food products in the near future, a short overview of the method will be useful. 454 Sequencing is a massively parallel sequencing-by-synthesis (SBS) system, capable of sequencing roughly 125 Mb (400 to 600 MB with GS FLX Titanium starting at the end of 2008) of raw DNA sequence per 7.5-h run of their current sequencing machine, the GS FLX, developed by Roche (Figure 6.3). The system relies on fixing nebulized and biotin adapter-ligated single-stranded DNA fragments to small DNA-capture streptavidin-coated beads in a water-in-oil emulsion. The DNA fixed to these beads is
124
SEQUENCING
FIGURE 6.3
Roche GS20.
then amplified by PCR. Finally, each DNA-bound bead is placed into a 44-mm well on a PicoTiterPlate, a fiber-optic chip. A mixture of polymerase, sulfurase, and luciferase is also added to the well. The PicoTiterPlate is then placed into the GS FLX for sequencing. At this stage, the four deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, and dTTP) nucleotides are washed in series over the PicoTiterPlate. During the nucleotide flow, each of the hundreds of thousands of beads with millions of copies of DNA is sequenced in parallel. If a nucleotide complementary to the template strand is flowed into a well, the polymerase extends the existing DNA strand by adding nucleotide(s). Addition of one (or more) nucleotide(s) results in a reaction similar to that described for the pyrosequencing method, which generates a light signal, recorded by the CCD camera in the instrument. The signal strength is proportional to the number of nucleotides (e.g., homopolymer stretches) incorporated in a single-nucleotide flow. With the current instruments, each read of the GS20 is only 220 to 270 bp long (300 to 400 bp with GS FLX Titanium starting at the end of 2008). This can result in some problems when dealing with highly repetitive genomes, as repetitive regions of over 200 bp cannot be “bridged” and thus must be left as separate isolated sequences. These gaps have to be completed using other sequencing methods. In addition, this type of technology can encounter problems in long homopolymer runs. For example, the difference between a stretch of six C’s in a row and seven C’s in a row cannot be
METHODS
125
determined with high confidence. This is a general problem with any pyrosequencing apparatus and in some cases also with classical sequencing methods. 6.2.5
SnapShot
SnapShot analysis is a method based on cycle sequencing used for the detection of single-nucleotide polymorphisms (SNPs). In contrast to cycle sequencing, in SnapShot analysis only dye-labeled ddNTP is in the reaction mixture. The sequencing primer is located directly in front of the SNP. Depending on the base present at the next position after the primer, one of the four ddNTPs is added to the primer. The analysis can be performed on any sequencer that can detect five dyes in one capillary or gel run (four dyes for the dNTP and one dye for an internal size standard). Extraction and analysis of data are performed with software normally used for microsatellite analysis (e.g., GeneScan, Genotyper, or GeneMapper if analysis is performed on instruments from Applied Biosystems). For singleplex reactions only one fragment labeled with one dye (homozygous genotype ¼ both alleles show the same genotype) or two dyes (heterozygous genotype ¼ the two alleles show different genotypes), corresponding to the incorporated dNTP(s), can be detected (Figure 6.4). For multiplexing (analysis of more than one SNP per reaction) the length of the sequencing primers specific for different SNPs should differ in at least
Fl
Fl ddATP Fl Fl ddTTP ddGTP Fl Fl Fl ddCTP ddATP Fl ddGTP Fl Fl ddATP ddCTP Fl Fl ddCTP ddGTP ddTTP ddTTP
(a)
T(35)ACGTTGATAGATCAGTAGCATAGCATAGTGACGT TGCAACTATCTAGTCATCGTATCGTATCACTGCAT
(b) T(35)ACGTTGATAGATCAGTAGCATAGCATAGTGACGT ddATP TGCAACTATCTAGTCATCGTATCGTATCACTGCAT
(c)
Fl
Fl
T(35)ACGTTGATAGATCAGTAGCATAGCATAGTGACGTA
FIGURE 6.4 Principle of the SnapShot Kit. (a) Primers specific to a sequence of PCR product up to a position in front of the single-nucleotide polymorphism binds to PCR product. In the reaction, all four fluorescence dye–labeled ddNTPs are present. (b) Enzymatic elongation stops directly after incorporation of ddNTP. (c) After cleanup of the reaction, the elongated dye-labeled primer is analyzed by capillary electrophoresis.
126
SEQUENCING
FIGURE 6.5 Three different SNPs are analyzed by capillary electrophoresis. By elongation of specific primers with polyT, poly GATC, or other tails, the fragments analyzed differ in length. In this example, three different SNPs with fragment sizes of 65, 66, and 71 bp (lanes a and b) can be analyzed in parallel with an internal size standard (c).
4 bp. For this, primers should be a combination of an unspecific part (e.g., GTACn) at the 50 end and a specific part that is complementary to the template sequence at the 30 end (Figure 6.5).
6.3 6.3.1
APPLICATIONS Animal Species Determination
Animal species determination in meat, processed material, or food products can be carried out by PCR amplification of mitochondrial DNA (mtDNA) followed by sequencing of the product by RFLP or real-time PCR (see Chapters 3 and 4). The structure of mitochondrial DNA is shown in Figure 6.6. The size of mtDNA can vary from 15,700 to about 20,000 bp in higher animals such as mammals, frogs, and insects. In the same species, differences of up to 900 bp can be observed [4]. RFLP analysis can only be successful if the DNA detected is from a species with a known RFLP pattern. For successful real-time PCR it is necessary to know from which species the DNA should be detected, because specific primers for each species have to be used. In contrast, by sequencing of PCR products and databank research (www.ncbi.nlm.nih.gov/BLAST/) no information about the species possibly present is necessary, and species with unknown restriction patterns can be determined. Most analysis for species determination is performed using mitochondrial DNA (mtDNA), which is transferred via the female gametes from the mother to the offspring. In sperm cells, mitochondria are located in the tail. As only the head of a sperm cell penetrates the cell membrane of the egg cell, the mitochondria of the father are not transferred to the offspring. Therefore, recombination of maternal and paternal mtDNA is not possible, and parts of mtDNA sequences are conserved in the
APPLICATIONS
1
127
2 3
4 mtDNA 16,644
base pairs
7
5
6
FIGURE 6.6 Location of genes used for species determination on mitochondrial DNA of Oncorhynchus species: 1, cytochrome b; 2, D-loop (control region); 3, 12S rRNA; 4, 16S rRNA; 5, CO I gene; 6, CO II gene; 7, CO III gene.
various animal species. Candidate genes for animal species determination are cytochrome b, 16S RNA genes, and 18S RNA genes. For cytochrome b, different universal primers exist [5] which recognize DNA from a wide range of vertebrates. For the detection of DNA from chondrichtyes (shark, ray), prawns, mussels, insects, or plants, specific primers have to be used. Species determination with biological material from hybrid animals determines the species of the mother from the animal: DNA from a mule (sire donkey, dam horse) shows a genotype like that of a horse; DNA from a hinny (sire horse, dam donkey) shows a genotype like that of a donkey. For this reason, species determination in samples from hybrid animals has to be performed with genes located on the chromosomal DNA. Therefore, specific assays must be designed for every determination requested. For mixed samples it is sometimes not possible to identify the species present by direct sequencing. If the mixture is too complex, PCR products should be cloned into a vector (services are offered from several laboratories), and a corresponding number of clones should be sequenced. After the species are identified, quantification can be performed by real-time PCR with a primer–probe combination specific for these species. 6.3.2
Control Region HV I and HV II
As described above, the mitochondrial genome contains regions that show interspecies variations from species to species. At other regions, different sequences are detectable for different individuals of the same species. Most variants are present at the D-loop or control region. As the mitochondrial DNA is transferred from the female
128
SEQUENCING
FIGURE 6.7 Sequence of C-stretch located in human hypervariable region II. (See insert for color representation.)
parent to the offspring, all individuals with the same sequence can be followed back to a common female ancestor [6]. In forensic casework, genomic DNA is sometimes not available for analysis in sufficient quantity or quality. However, on average, about 1000 mitochondria are present per cell. Therefore, the chance for detection of mitochondrial DNA is much higher than that for genomic DNA. Especially for the analysis of telogenic hairs (without roots), mtDNA can solve some cases [7]. In human mtDNA, three hypervariable regions (HV I, HV II, and HV III) are described. In routine casework, HV I and HV II are analyzed (Figure 6.7). For interlaboratory data exchange, the nomenclature is based on a comparison of sequences generated with a unique reference sequence (revised Anderson sequence, www.mitomap.org/mitoseq.html). The divergences found in the sequence generated can be used for database research. Public databases for the analysis of animals used in food production do not exist. At the University of Davis–California, a first database for canine mtDNA analysis is under construction. It has been shown that variations at the D-loop region exist in almost all species (Figure 6.8). Therefore, the analysis can lead to reliable results even if no database exists [8,9]. Example 1: At a farm, two calves were found without eartags. The farmer declared that the dam died after birth and the sire has been slaughtered, but samples from the dam’s mother and sisters are available. Microsatellite analysis was unconvincing. By sequencing of mtDNA, differences were found in the D-loop region of the dam’s mother and the calves. Also, comparison with sequences of the dam’s sister demonstrated that the calves cannot have the ancestors declared and must be slaughtered following legislative guidelines.
APPLICATIONS
129
FIGURE 6.8 Sequence of a repetitive motif located at the porcine D-loop (control region). (See insert for color representation.)
Example 2: A costumer declared that hairs were found at the surface of a beef meat he bought from a self-slaughtering butcher. By animal species determination, canine DNA was identified. Since the butcher and the customer both owned a dog, samples were taken from both and mtDNA analysis was performed of the canine D-loop region. The two dogs showed different sequences, but only the customer’s dog showed the same sequence as the hairs found on the meat. Therefore, the butcher’s dog could be excluded as the source of the hairs. Generally, if two samples show the identical sequence, it can be concluded that they are from the same maternal line but not necessarily from the same individual. In these cases, population data have to be generated to calculate the probability that two samples are from the same individual. In animal breeds with fewer founder animals, this can be especially difficult. 6.3.3
Bacterial Species and Antibiotics Resistance Determination
Bacterial species determination can be necessary for pathogen detection in meat and food products, for the identification of infectious pathways of persons working in the food production or other sensitive industries, or for the identification of bacterial strains used in food production. Standard diagnosis of bacterial contaminations or infections depends on growth in culture, which requires at least 12 to 72 h for detection. For different reasons, in some cases it is not possible to cultivate the bacteria (e.g., Mycoplasma, Bordetella). By direct DNA isolation from a swab followed by PCR and sequencing, this problem can be solved and/or the time needed for analysis can be reduced significantly if only one bacterial strain is present. The method can also be used for pure bacterial isolates derived from cultures of clinical specimens analyzed by conventional procedures, and identification of a bacterial strain or serotype was not possible with automated identification systems such as Phoenix (Becton Dickinson) or VITEK2 (bioMerieux). Selective amplification from grampositive or gram-negative bacteria is possible with specific primers [10].
130
SEQUENCING
Several publications describe the analysis of 527 bp of bacterial 16S rRNA genes and identification by comparison of results with databases. Kits for this application are available from several manufacturers (e.g., MicroSeq 16S rRNA, Applied Biosystems) [11]. Although analysis of the 16S rRNA identifies the bacterial strain, in some cases it is necessary to determine whether a strain carries a specific gene. In the analysis of Escherichia coli strains, enteropathogen E. coli (EPEC) is identified by PCR and sequencing of the enterocyte attaching and effacing factor (eae) gene [12]. Enterotoxic E. coli (ETEC) is differentiated by PCR and sequencing of genes coding for heat-stable and heat-labile enterotoxin (ST, LT) [13]. Enteroinvasive E. coli (EIEC) and Shigella are differentiated by detection of the ialregion of the plnv plasmid [14] and of enteroaggregative E. coli (EAEC) by detection of the pCVD plasmid [15]. A further application is the detection and sequencing of resistance genes such as the plasmid RE25, which transfers resistance to tetracycline, lincomycin, chloramphenicol, erythromycin, and similar antibiotics. This plasmid can be found in Enterococcus strains isolated from food products. By sequencing, differences or similarities to related plasmids with other resistances can be detected and, for example, influence the antibiotic therapy [16]. Different types of microorganisms are involved in food production, and some of the strains used are modified by the producer. At every production step there is the risk that contamination of the desired strains with unwelcome strains will occur, which can lead to a loss in production or a health risk for customers. Examples are contamination with Listeria strains in raw milk products and contamination of soft drinks or milk products with toxic E. coli strains. Information about specific positive qualities of modified strains is restricted almost entirely to the food producer and therefore will not be controlled through food inspection. 6.3.4
Scrapie Resistance in Sheep
Sequencing can be used for the detection of defect genes or mutations which lead to desired qualities in animal breeding. In recent years in all countries of the European Union, breeding programs have been established to enhance the resistance of sheep against scrapie. In contrast to cattle, where currently no genetic reason for higher or lower resistance to development of the clinical symptoms of bovine spongiform encephalopathy (BSE) are known, for human, sheep, and goat different sequence variants of the prion protein (PrP) are known. In humans, all patients who have developed clinical symptoms of the classic Jakob–Kreutzfeld disease carry the DNA bases coding for the amino acid methionin at codon 129 of the PrP gene. So far, no patient has shown heterozygous methionin/valin or homozygous valin at this position. By sequencing, the genotype at this position and also those at neighboring positions can be determined. In sheep, amino acids at three codons are responsible for higher or lower resistance. At codon 136, A, T, or V can be present; at position 154, H, Q, or R; at position 171, H, K, R, or Q. Depending on the combination found, the genotypes are separated into five genotype classes, as shown in Table 6.2. Genotyping for scrapie resistance can also be carried out by real-time PCR or SnapShot analysis. However, in
REFERENCES
TABLE 6.2
131
Genotype Classes in Sheep
Class
Genotype
1 2 3 4 5
ARR/ARR ARR/ARQ, ARR/ARH, ARR/AHQ ARQ/ARQ, ARQ/ARH, ARQ/AHQ, AHQ/AHQ, ARH/AHQ, ARH/ARH ARR/VRQ ARQ/VRQ, ARH/VRQ, AHQ/VRQ, VRQ/VRQ
this case it must be noted that different point mutations exist nearby the three codons analyzed, as sequencing data have shown. If an additional mutation is included in the target sequence of the probe or the sequencing primer, the allele affected may not be detected. Animals with amino acid Tat position 136 and K at position 171 are not included in the genotype classes because, due to the low frequency in the population, no information about the grade of resistance is available. Breeders should use dams and sires from class G1 or G2 if possible. In some breeding, G3 animals also have to be bred, because currently too few G1 and G2 sires are available, and selection of a single gene would lead to imprinting effects. If scrapie is diagnosed in one or more animals of a flock before it is possible to test DNA, all animals must be destroyed. In one case of scrapie in Germany, all animals of a flock were tested, and animals with the genotypes G1 and G2 did not have to be killed. REFERENCES 1. Maxam AM, Gilbert W (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA, Feb., 74(2):560–564. 2. Church GM, Kieffer-Higgins S (1988). Multiplex DNA sequencing. Science, Apr. 8, 240 (4849):185–188. 3. Sanger F, Nicklen S, Coulson AR (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, Dec., 74(12):5463–5467. 4. Bermingham E, Lamb T, Avise JC (1986). Size polymorphism and heteroplasmy in the mitochondrial DNA of lower vertebrates. J. Hered., July–Aug., 77(4):249–252. 5. Chikuni K, Tabata T, Saito M, Monma M (1994). Sequencing of mitochondrial cytochrome b genes for the identification of meat species. Anim. Sci. Technol. (Jpn.), 65:571–579. 6. de Oliveira PMC, Moss de Oliveira S, Radomski JP (2001). Simulating the mitochondrial DNA inheritance. Theory Biosci., Sept. 1, 120(2):77–86. 7. H€uhne J, Pfeiffer H, Waterkamp K, Brinkmann B (1999). Mitochondrial DNA in human hair shafts - existence of intra-individual differences? Int. J. Legal Med., Apr., 112(3). 8. Zhang W, Zhang Z, Shen F, Hou R, Lv X, Yue B (2006). Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris). J. Genet., Aug., 85(2):107–116.
132
SEQUENCING
9. Grossi SF, Lui JF, Garcia JE, Meirelles FV (2006). Genetic diversity in wild (Sus scrofa scrofa) and domestic (Sus scrofa domestica) pigs and their hybrids based on polymorphism of a fragment of the D-loop region in the mitochondrial DNA. Genet. Mol. Res., Oct. 31, 5(4):564–568. 10. Klausegger A, Hell M, Berger A, et al. (1999). Gram type-specific broad-range PCR amplification for rapid detection of 62 pathogenic bacteria. J. Clin. Microbiol., Feb., 37(2):464–466. Erratum: J. Clin. Microbiol., May, 37(5):1660. 11. Fontana C, Favaro M, Pelliccioni M, Pistoia ES, Favalli C (2005). Use of the MicroSeq 500 16S rRNA gene-based sequencing for identification of bacterial isolates that commercial automated systems failed to identify correctly. J. Clin. Microbiol., Feb., 43(2): 615–619. 12. Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A (2000). Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun., Jan., 68(1):64–71. 13. Frankel G, Giron JA, Valmassoi J, Schoolnik GK (1989). Multi-gene amplification: simultaneous detection of three virulence genes in diarrhoeal stool. Mol. Microbiol., Dec., 3(12):1729–1734. 14. Frankel G, Riley L, Giron JA, et al. (1990). Detection of Shigella in feces using DNA amplification. J. Infect. Dis., June, 161(6):1252–1256. 15. Schmidt H, Knop C, Franke S, Aleksic S, Heesemann J, Karch H (1995). Development of PCR for screening of enteroaggregative Escherichia coli. J. Clin. Microbiol., Mar., 33 (3):701–705. 16. Schwarz FV (2001). Diss. ETH 14162.
PART Ib
MOLECULAR BIOLOGICAL METHODS: APPLICATIONS
CHAPTER 7
Meat INES LAUBE €r Lebensmitteltechnologie und Lebensmittelchemie, Institut fu €t Berlin, Berlin, Germany Technische Universita
7.1
INTRODUCTION
Since the Middle Ages, meat products have been subjected to many metamorphoses in food culture, the structure of meals, and economic and social factors. Still, meat is a central part of nutrition in Europe. The largest portion of the total consumption of meat in the European Union consists of pork, beef, and poultry. Also important is the consumption of meat from sheep (lamb) and goats, predominantly in Greece, followed by Ireland, Spain, and the United Kingdom. The consumption of meat from horse, rabbit, game, and other animals is lower (Deutscher Fleischer-Verband, 2003). Based on European Commission (EC) Directive 2002/86/EC, meat products must be labeled as to each animal species used as an ingredient and its quantity. This directive complies with the guidelines of QUID (quantitative ingredient declaration) introduced in Directive 1997/4/EC. With the supervision of meat products, the consumer is protected against fraud, not only in terms of meat being replaced by meat from animal species of lower value, but also if certain meat is rejected for religious reasons. Ethical motives also play a role, such as the rejection of special forms of animal husbandry and slaughtering as well as abiding by laws for the protection of species. Allergies to the consumption of beef, pork, or poultry were identified in a low percentage of cases (ca. 3% of food allergies) (Besler et al., 2001a,b,c). Food scandals such as bovine spongiform encephalopathy (BSE) outbreaks, including the detection of false labeling of numerous meat products, show emphatically the need to control the composition of foods.
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
135
136
7.2
MEAT
METHODS
To enable authorized food control agencies to supervise compliance with labeling requirements, suitable detection methods must be available. In contrast to proteinbased methods such as isoelectric focusing in polyacrylamide gel (PAGIF), polyacrylamide gel electrophoresis (PAGE), double gel diffusion according to Ouchterlony, and enzyme-linked immunosorbent assay (ELISA), DNA-based methods take advantage of the stability of DNA, enabling the investigation of highly processed products. Technological processing of enzymatic, thermal, and mechanical effects causes changes in fragment size but not in base sequence. The average fragment size of DNA isolated from high-heat-treated meat products (121 C, 20 min) is about 400 bp (Meyer et al., 1993). In general, DNA analytical methods are suitable, because genes exist in all animal cells. Thus, independent of the type of ingredient (e.g. meat, blood, milk), DNA exists in almost all food products (Behrens and Unthan, 1999). 7.2.1
DNA Techniques for the Differentiation of Animal Species
Southern Hybridization The oldest DNA technique in food analysis is based on labeled probes, which bind directly to DNA if complementary regions exist. This method, called Southern hybridization, is very time consuming. Further disadvantages are insufficient sensitivity for many questions, as well as the problem of nonspecific hybridization signals for closely related animal species (Behrens and Unthan, 1999). PCR-RFLP More sensitive is the polymerase chain reaction (PCR). Using two PCR primers, even small amounts of DNA can be detected, due to selective amplification (Newton and Graham, 1997). Thus, PCR allows the unambiguous identification of animal and plant species in food or feedstuffs. Moreover, the unique specificity, selectivity, and sensitivity of PCR affords the analysis of complex matrices (Meyer et al., 1993). In addition, primers (in contrast to antibodies) as starting points for PCR are independent of commercial sources and easily accessible to everyone. For the differentiation of animal species in food analysis, universal PCR primers binding to the DNA of different animal species have been used predominantly. Therefore, primers are chosen from two DNA regions, which are strongly conserved for animal species overall; thus, primer binding regions show only a few sequence differences between animal species. Synthesized PCR products (amplicons) are normally about the same size, but differ in the composition of bases. The differences based on animal species are used to identify PCR products by means of RFLP analysis. In RFLP (restriction fragment length polymorphism), restriction enzymes cut PCR products at defined positions, resulting in different PCR fragments due to speciesspecific sequence differences. These fragments are separated by gel electrophoresis and compared with the fragment muster of PCR products from reference DNA of animal species for human nutrition. One example is the method published by
METHODS
137
Meyer et al. (1995), in which the primers used were complementary to conserved areas of the vertebrate mitochondrial cytochrome b (cytb) gene and yielded a 359-bp fragment, including a variable 307-bp region. RFLPs were detected when pig, cattle, wild boar, buffalo, sheep, goat, horse, chicken, and turkey amplicons were cut with Alu I, Rsa I, Taq I, and Hinf I. PCR-RFLP is simpler and less time consuming than sequencing, and animals for which sequences are unknown can be analyzed quickly. Intraspecific differentiation within species of the same genus is also possible if appropriate sequence differences exist (e.g. wild boar can be distinguished from domestic pig with additional Taq I, Hinf I, and Hae III sites) (Meyer et al., 1995). But the use of universal primers always involves a compromise regarding the primer sequence used. Thus, the efficiency of the amplification can differ from species to species depending on mismatches in the conserved region. Furthermore, it is even possible that one species is discriminated if an unequal mixing ratio exists. If the method is based on point mutation, an animal species could possibly not be detected, due to further mutation or breeding. Another disadvantage is that PCR products have to be relatively large when they are to be differentiated by RFLP analysis, due to the need for sufficient sequence differences. This can be a problem if the food product is subject to high heat and the DNA is degraded into smaller fragments. PCR Using Specific Primers The problems we have mentioned do not arise if species-specific primers, which are complementary to the DNA of one species, are used. The design of such primers is geared to DNA regions, which are conserved within the species but are divergent to other food-relevant species. Figure 7.1 shows an example of the specific detection of lamb. In the PCR, the primer pair determined for the phosphodiesterase gene (ovis PDE) amplifies a fragment 97 bp in length. Nonspecific amplification of DNA fragments from cattle, pig, goat, horse, fallow deer, red deer, roe deer, rabbit, hare, wild
FIGURE 7.1
Gel electrophoresis of PCR products using ovisPDE primers.
138
MEAT
FIGURE 7.2 Graphical demonstration (electropherogram) of sequence differences in the phosphodiesterase gene between lamb, cattle, and goat. (See insert for color representation.)
boar, chicken, turkey, duck, pheasant, goose, quail, ostrich, wheat, soybean, human being, and salmon could not be observed. The result can be verified by the size of the PCR product. But for exclusion of false-positive results, implementation of an additional method is necessary (e.g. subsequent identification by sequencing) (Newton and Graham, 1997). Figure 7.2 shows a fragment of the phosphodiesterase (PDE) gene of lamb, cattle, and goat, including interspecific sequence differences. This time-consuming and cost-intensive identification of the animal species is unsuitable for continuous monitoring as well as for mixtures of several species. Thus, this method is normally used only for the development of new systems or in case of a clash. A further application area of PCR is in the analysis of feedstuffs. A ban on animalderived meals in the manufacture of feedstuffs was introduced in EC Decision 2002/ 248/EC as a preventive measure to avoid the spread of BSE. For this purpose, a microscopic method based on the analysis of animal bone fragments has been developed. This method has been recognized as the official method in the European strategy against BSE. However, it is time consuming, requires specialized staff, and only enables the detection of zoological classes (mammalian, avian, and fish), while the species origin of bone fragments remains undetermined. Biomolecular techniques have been investigated extensively, as they offer clear advantages, such as having a high degree of specificity and being applicable even to heat-processed products. Thus, Dalmasso et al. (2004) developed a multiplex PCR assay for the rapid identification of
METHODS
139
FIGURE 7.3 Fluorescence signal specific to lamb is detectable in TaqMan PCR. Other animals showed insignificant increases in fluorescence. (See insert for color representation.)
ruminant, poultry, fish, and pork materials in feedstuffs. Primers were designed in different regions of mitochondrial DNA. Using a multicopy sequence, it is possible to detect 0.004% fish and 0.002% ruminants, poultry, and pork. Real-Time PCR In real-time PCR the exponential amplification of target-specific DNA is measured by the use of fluorescence-labeled specific probes (TaqMan technology) (Holland et al., 1991). A specific signal is observed only if the species under investigation is present in the matrix. For example Figure 7.3 shows the detection of lamb in TaqMan PCR. The plots generated by real-time PCR show the fluorescence representing the increasing target copy number as a function of the cycle number. This technique offers significant advantages for routine analysis. First, the real-time PCR happens in a closed tube without post-PCR manipulations, thereby reducing potential PCR product carryover. Second, the assay is less time consuming because, due to the use of specific probes, subsequent verification of PCR products is not necessary. Third, a large number of food samples can be analyzed in a single run. Finally, the technique holds the potential for developing quantitative assays. Beside the use of real-time PCR in the quantification of genetically modified organisms (GMOs) in food (Hagen and Beneke, 2000; Kuribara et al., 2002) differentiation of animal species using this technique becomes more important. A further approach is the detection of closely related animal species on the LightCycler by fluorescence melting curve analysis. Melting curve analysis is performed after the amplification cycles are completed and a PCR product is formed. It can be utilized with two different detection formats supported by the LightCycler instrument: the hybridization probe format and the SybrGreen I format. Starting from low temperatures, the temperature in the thermal chamber is slowly raised. During this process the fluorescence in each tube is measured at frequent intervals. This allows the melting behavior in the capillary to be monitored very closely. As soon as the DNA starts to denature, the SybrGreen I dye is released from the dsDNA, resulting in a decrease in
140
MEAT
ACTCCTACCC ATCATGCAGA TTCTAACATC AGGATTTTTG CTGCATTTGC TTCATC T GTC CTTTTAGAGT TTTCTTTTTT TCTTAGCTGA AATATTTAAA AACA
FIGURE 7.4 bosPDE amplicon – bosPDE LightCycler system.The position of primers is marked with arrows, the position of probes with frames. The differences to the roe and fallow deer sequences are marked in grey, the only difference to the roe deer sequence is framed and the only difference to fallow deer is underlined.
fluorescence. Fluorescence will also decrease with increasing temperature when working with the hybridization probe format. As soon as one of the probes melts off, FRET will no longer take place. A hybridization probe spanning one mismatch can still hybridize to the target sequence but will melt off at lower temperatures than will a hybridization probe with a perfect match. In the following we present an example for the identification of cattle by melting curve analysis with hybridization probes. Figure 7.4 shows the position of primers and hybridization probes for detection of the phosphodiesterase gene of cattle (bosPDE amplicon), highlighting mismatches to the DNA sequences of roe deer and fallow deer. Mixtures of forward and reverse primers were used with slightly differing sequences (see Figure 7.4) to amplify each of the three animal species with the same efficiency. The sequences of the probes showed the four differences in the cattle sequence (see Figure 7.4), which means more complementarity to the sequences of deer. Therefore, the lowest melting temperature was expected for cattle. Figure 7.5 shows the results of the melting curve analysis. For cattle a melting
FIGURE 7.5 Melting curve analysis: DNA of cattle, fallow deer, red deer, and roe deer using the bosPDE LightCycler system. (See insert for color representation.)
METHODS
141
point of 50.30 C, for fallow and red deer a melting point of 53.90 C, and for roe deer a melting point of 60.34 C could be identified. 7.2.2
DNA Techniques for the Differentiation of Animal Breeds
Whereas systems for the detection of animal species should detect all breeds of one species, the detection of the breed can be of interest for food products for which the origin is important. Methods must be available for determination of the origin of food labeled PDO (protected designation of origin) or PGI (protected geographical indication). Therefore, RAPD (random amplified polymorphic DNA), SCAR (sequence characterized amplified region), AFLP (amplified fragment length polymorphism), SNP (single-nucleotide polymorphism), microsatellites, SSCP (single-strand conformation polymorphism), RFLP, and PCR and real-time PCR are the markers to be used. The same markers can be used to differentiate wild and domestic animals. RAPD RAPD is a type of PCR, but the segments of DNA that are amplified are essentially unknown to the scientist (random). In a RAPD assay a short arbitrary primer is used, which generally anneals with multiple sites in different regions of the genome and amplifies several genetic loci simultaneously. As examples, Zhang et al. (2002) analyzed the genetic diversity of Chinese native chicken breeds based on RAPD, and Pozdnyakov et al. (2000) developed RAPD markers of three breeds of the honeybee Apis mellifera. SCAR SCARs are DNA fragments amplified by PCR using specific 15- to 30-bp primers designed from nucleotide sequences established in cloned RAPD fragments. By using longer PCR primers, SCARs do not face the problem of low reproducibility generally encountered with RAPDs. AFLP AFLP is a fingerprinting technique that detects multiple DNA restriction fragments by means of PCR amplification suitable for the rapid screening of genetic diversity. In the first step of AFLP analysis, genomic DNA is restricted with two restriction enzymes, preferably a hexa-cutter and a tetra-cutter. The resulting fragments are ligated to endspecific adapter molecules. The amplification of a subset of the restriction fragments is done using two primers complementary to the adapter and restriction site sequences, extended at their 30 ends by “selective” nucleotides. Gel electrophoretic analysis reveals a pattern (fingerprint) of fragments. Nijman et al. (2003) have shown that AFLP as well as microsatellites are informative for the detection of hybridization of banteng (Bos javanicus) and zebu (Bos indicus). Microsatellites A microsatellite consists of a specific sequence of DNA bases or nucleotides which contains mono, di, tri, or tetra tandem repeats. In the literature they can also be called
142
MEAT
simple sequence repeats (SSRs), short tandem repeats (STRs), or variable number tandem repeats (VNTRs). Alleles at a specific locus can differ in the number of repeats. Microsatellites have high mutation rates and therefore may show a high level of variation between individuals within a species, for example. This makes them ideal for identifying animal breeds, aside from their use in population and conservation biology and in the study of genetic disease and forensics. SNP SNP is a DNA sequence variation occurring when a single nucleotide (A, T, C, or G) in the genome differs between members of the species. Thus, Heaton et al. (2002) selected and used SNP markers for animal identification and paternity analysis in U.S. beef cattle. SSCP SSCP is an electrophoretic separation of single-stranded nucleic acids based on subtle differences in sequence (often a single base pair) which results in a different secondary structure and a measurable difference in mobility through a gel. The general idea is to take a small PCR product, denature it, and electrophorese it through a nondenaturing polyacrylamide gel. SSCP offers a sensitive but inexpensive, rapid, and convenient method for determining which DNA samples in a set differ in sequence so that only an informative subset needs to be sequenced. Sunnucks et al. (2000) illustrates the application of a single simple SSCP protocol to mitochondrial genes, nuclear introns, microsatellites, and anonymous nuclear sequences in a range of vertebrates and invertebrates.
7.3 REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES In this section we describe in detail real-time PCR systems used to identify the most frequently consumed animal species in Europe (i.e. cattle, pig, lamb, goat, chicken, turkey, and duck) as well as a common meat-specific PCR system detecting mammalian and poultry species in foods (Laube et al., 2007a,b). Every system developed is based on single-copy targets which do not exceed the length of 150 bp. Single-copy sequences are the basis for the development of quantitative methods, whereas small targets are required for analysis of species in highly processed foods. 7.3.1
DNA Extraction
Samples are minced and homogenized and DNA is extracted using a modified cetyltrimethylammonium bromide (CTAB) method (Laube et al., 2003) based on a procedure developed by Tinker et al. (1993). One hundred milligrams of homogenate is incubated on a shaker together with 500 mL of CTAB solution (CTAB 20 g/L, NaCl 1.4 mol/L, Tris-HCl 0.1 mol/L, Na2-EDTA 20 mmol/L; pH 8.0) and 20 mL of proteinase K (20 mg/mL) at 65 C for 90 min. The resulting preparation is centrifuged at
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
143
14,500g and the supernatant mixed with 200 mL ReadyRed (a colored mixture of chloroform and isoamyl alcohol, Q-Biogene, Illkirch Cedex, France). After centrifugation at 21,000g for 15 min, the supernatant is mixed with 300 mL of isopropanol and incubated at room temperature for 20 min. This is followed by another centrifugation at 21,000g for 15 min, after which the supernatant is discarded. The precipitated nucleic acid is washed with 500 mL of 70% ethanol and centrifuged at 21,000g for 5 min. The nucleic acid is resuspended in 100 mL of 0.1 TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0). 7.3.2
PCR and Real-Time PCR
PCR is performed in a total volume of 25 mL. The reaction mixture contains 0.2 mM of each deoxynucleotide triphosphate, 0.2 mM of each primer, 1 PCR buffer (GeneAmp PCR buffer, Applied Biosystems), 2 mM MgCl2, 1.5 units Taq polymerase (AmpliTaq Gold DNA Polymerase, Applied Biosystems), and 2 mL (30 to 100 ng) of template DNA solution. Primers and PCR conditions are listed in Tables 7.1 to 7.3. TaqMan PCR is performed on the Applied Biosystems ABI PRISM 7700 or 7900 sequence detection system (SDS). The use of other thermal cyclers might make adaptation necessary. The reaction mixture with a total volume of 25 mL contains 1 TaqMan Buffer A, 0.2 mM of each deoxynucleotide triphosphate (dNTP), 1.5 units of AmpliTaq Gold Polymerase, and 5 mL (25 to 100 ng) of template DNA solution. Primers, probes, and PCR conditions are listed in Tables 7.1 and 7.4. Primers and probes can be ordered from Applied Biosystems among others. The concentration of primers, corresponding probes, and magnesium chloride for the respective system was optimized empirically (Table 7.5). The resulting high magnesium chloride values might be due to the comparatively low melting temperatures of the primer. Moreover, a higher concentration of magnesium chloride is needed for the stabilization of the probe in TaqMan assays, according to Applied Biosystems. 7.3.3
Target Genes
Candidate genes for TaqMan PCR were identified either by database search (Benson et al., 2003) or by DNA sequencing using consensus primers in case no sequence entry is available. The assay is composed of two elements: general proof of the presence of meat, and the identification of species-specific sequences (Laube et al., 2003). A common meat-specific PCR system has been established detecting mammalian and poultry species on the basis of a region of the myostatin gene (GenBank accession: AF320998 for cattle and AY448007 for chicken). In the forward primer MYw-f solution, 50% of the primers have an A and 50% a G at position 8 (written as R at the respective primer position in Table 7.1). In the same way, the probe “MY probe” has been modified at position 21. The optimized system was designated MYw (“w” represents “wobble”) and resulted in comparable efficiencies for cattle, pig, lamb, goat, chicken, and turkey (Figure 7.6, Table 7.6). To detect beef, lamb, and goat, a DNA sequence of the noncoding region of the cyclic GMP phosphodiesterase gene was chosen (GenBank accession: X12756).
144
MEAT
TABLE 7.1
Primer–Probe Systems Used and Amplicon Length Expected a
Cattle Primer forward (bosPDE-f) Primer reverse (bosPDE2-r) Probe (bosPDE-probe) Amplicon (bosPDE2) Pig Primer forward (susRY-f) Primer reverse (susRY-r) Probe (susRY-probe) Amplicon (susRY) Meat Primer forward (MYw-f) Primer reverse (MY-r) Probe (MYw-probe) Amplicon (MYw) Lamb Primer forward (ovisPDE-f) Primer reverse (ovisPDE-r) Probe (ovisPDE-probe) Amplicon (ovisPDE) Goat Primer forward (capraPDE-f) Primer reverse (capraPDE-r) Probe (capraPDE-probe) Amplicon (capraPDE) Chicken Primer forward (galIL-f) Primer reverse (galIL-r) Probe (galIL-probe) Amplicon (galIL) Turkey Primer forward (melIL-f) Primer reverse (melIL-r) Probe (melIL-probe) Amplicon (melIL)
50 –ACT CCT ACC CAT CAT GCA GAT–30 50 –TTT TTA AAT ATT TCA GCT AAG AAA AAA AG–30 50 –(FAM)–AAC ATC AGG ATT TTT GCT GCA TTT GC–(TAMRA)–30 102 bp 50 –CCC CAC CTC AAG TGC CT–30 50 –CAC AGA CTT TAT TTC TCC ACT GC–30 50 –(FAM)–CAC AGC AAG CCC CTT AGC CC–(TAMRA)–30 108 bp 50 –TTG TGC ARA TCC TGA GAC TCA T–30 50 –ATA CCA GTG CCT GGG TTC AT–30 50 –(FAM)–CCC ATG AAA GAC GGT ACA AGR TAT ACT G–(TAMRA)–30 97 bp 50 –ACC CGT CAA GCA GAC TCT AAC G–30 50 –TAA ATA TTT CAG CTA AGG AAA AAA AAG AAG–30 0 5 –(FAM)–CAG GAT TTT TGC CGC ATT CGC TT–(TAMRA)–30 97 bp 50 –TAC CCA TCA AGC AGA CTC TAG CA–30 50 –ATA TTT CAG CTA AGG AAA AAA AAA GAA G–30 50 –(FAM)–ATT TTT GTC GCA TTC GCT TCA TCT GT– (TAMRA)–30 96 bp 50 –TGT TAC CTG GGA GAA GTG GTT ACT–30 50 –TTT TCG ATA TTT TGA ATA GCA GTT ACA A–30 50 –(FAM)–TGA AGA AAG AAA CTG AAG ATG ACA CTG AAA TTA AAG–(TAMRA)–30 95 bp 50 –TGT ATT TCA GTA GCA CTG CTT ATG ACT ACT–30 50 –TTT ATT AAT GCT GGA AGA ATT TCC AA–30 50 –(FAM)–TTA TGG AGC ATC GCT ATC ACC AGA AAA–(TAMRA)–30 86 bp
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
TABLE 7.1 (Continued) Duck Primer forward (anasIL-f) Primer reverse (anasIL-r) Probe (anasIL-probe) Amplicon (anasIL) IPC Primer forward (IPC-f) Primer reverse (IPC-r) Probe (IPC-probe) Amplicon (IPC) Sequencing Primers pGem-f pGem-r
145
50 –GGA GCA CCT CTA TCA GAG AAA GAC A–30 50 –GTG TGT AGA GCT CAA GAT CAA TCC C–30 50 –(FAM)–AGG GGA AAA AAG TTA ATT TTT GTG AAC AAA GTT AAT AGA–(TAMRA)–30 212 bp 50 –CGT TTC GGT GAT GAC GGT G–30 50 –CTG ACG GGC TTG TCT GCT C–30 50 –(VIC)–TGA CAC ATG CAG CTC CCG GAG AC–(TAMRA)–30 99 bp 50 –CGA ATT GGG CCC GAC GT–30 50 –AGG CGG CCG CGA ATT–30
a bosPDE, cyclic GMP phosphodiesterase gene of cattle; susRY, ryanodine receptor gene of pig; MY, myostatin gene of mammals and poultry; ovisPDE, cyclic GMP phosphodiesterase gene of lamb; capraPDE, cyclic GMP phosphodiesterase gene of goat; galIL, interleukin-2 precursor gene of chicken; melIL, interleukin-2 precursor gene of turkey; anasIL, interleukin-2 precursor gene of duck; IPC, internal positive control; pGem, pGem-TEasy Vector.
TABLE 7.2
PCR Temperature–Time Profile
Process
Time (min:s)
Initial denaturation Denaturation Annealing Extension Final elongation
10:00 0:30 0:30 0:30 6:00 1
Temperature ( C) 95 95 See Table 7.3 72 72 4
TABLE 7.3 Optimal Annealing Temperature of the Primer Systems Primer bosPDE ovisPDE capraPDE galIL melIL anasIL susRY MY
Annealing Temperature ( C) 54 56 56 60 56 58 58 58
Cycles 35
146
MEAT
TABLE 7.4
Real-Time PCR Temperature–Time Profile
Process
Time (min:s)
Initial denaturation Denaturation Annealing, extension
Temperature ( C)
10:00 00:15 01:00
95 95 60
A DNA sequence in the noncoding region of the ryanodine receptor gene was selected for the detection of pork (GenBank accession: NM001001534). For the detection of chicken, turkey, and duck, a region of the interleukin-2 precursor gene was chosen (GenBank accession: AJ224516 for chicken, AF209705 for turkey, and AY821656 for duck). 7.3.4
Controls
To check the reliability of PCR performance, positive controls are used. Either meat DNA extracted from the respective species (100%) or plasmids can be developed bearing the target sequence using, for example, the TA-cloning system (pGem-TEasy Vector, Promega). DNA sequencing using, for example, the BigDye Terminator Cycle Sequencing Kit on the ABI PRISM 310 Genetic Analyser (both Applied Biosystems) and the pGem primers listed in Table 7.1 can be used to confirm the identity of the DNA sequence of the integrated fragments. Mixtures can be prepared containing 1% (v/v) of the respective target sequence; for example, one copy of bosPDE plasmid is mixed with 100 copies of MYw plasmid. The copy number (C) is calculated based on DNA concentration determined spectrophotometrically, taking into account the base pair sizes of vector and insert and the genome size described in Gregory (2005), respectively. The term C value refers to the amount of DNA contained within a haploid nucleus of an eukaryotic organism. For diploid organisms the terms C value and genome size are used interchangeably.
TABLE 7.5 Optimum Concentration of Primers, Probes, and MgCl2 Determined by Titration System MYw bosPDE2 susRY ovisPDE capraPDE galIL melIL anasIL IPC
Forward Primer (nM)
Reverse Primer (nM)
Probe (nM)
MgCl2 (mM)
300 50 300 300 50 50 50 300 50
300 300 300 300 300 300 300 300 300
200 200 200 200 200 200 200 200 100
6 8 2 8 6 6 8 6
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
147
FIGURE 7.6 Fluorescence curves for samples of cattle, pig, lamb, goat, chicken, turkey, and duck using the MYw primer–probe system. Ct’s are listed in Table 7.6.
False-negative results due to an inhibition of DNA polymerase can be excluded by using amplification control. On these terms, the MYw system can be regarded as external amplification control. Even if the targeted species is not detected, amplification control should result in a positive signal in PCR. However, internal amplification control [internal positive control (IPC)] has an advantage over a separate amplification control, because species-specific detection and control are both performed in parallel in the same tube. In this approach, the plasmid pUC19 (New England Biolabs) can be used as an IPC. To detect the IPC and the species-specific target in one reaction, primer–probe systems have been developed (Table 7.1) with differently labeled fluorescence probes (reporter dye VIC for the IPC and FAM for the speciesspecific target). The concentrations used for the IPC primers and probes are listed in Table 7.5. The IPC fragment length is 99 bp. A constant number of 1000 copies of the plasmid was added to a 10-fold dilution series of DNA extracts of the various animal species, resulting in a constant Ct value of around 29. Based on a series of repetitions, TABLE 7.6 Ct Values Measured for Each Species Using the MYw Primer–Probe System Species a
Ct
Cattle Pig Lamb Goat Chicken Turkey Duck Water
29.42 29.74 29.78 29.64 30.13 29.61 31.02 45.00
a
1000 DNA copies.
148
MEAT
a Ct value shift of more than two comparing IPC added to the extracted sample DNA and IPC added to the water control (without sample DNA extracted) indicates an inhibition (data not shown). 7.3.5
Specificity
The specificity of the primer–probe systems in TaqMan PCR was studied with DNA from 27 animal or plant species: bison, cattle, chicken, duck, elk, fallow deer, goat, goose, hare, hartebeest, horse, kangaroo, lamb, ostrich, pheasant, pig, quail, rabbit, red deer, roe deer, turkey, wild boar, and zebra as well as human being, salmon, soybean, and wheat. The plots generated by real-time PCR show the fluorescence representing the increasing target copy number as a function of cycle number. Using the MYw primer–probe system (Laube et al., 2003), specific for mammals and poultry (Table 7.1), the DNA of all animal species except salmon, as well as human beings, could be amplified and clearly detected. In addition, the MYw primer–probe system was applied to DNA from onion, garlic, paprika, and pepper. Neither these spices nor wheat or soybean exhibited an increase in fluorescence (data not shown). No crossreactions occurred using the primer–probe systems specific for cattle, pig, lamb, goat, chicken, turkey, and duck, whereas the pig-specific susRY primer–probe system is not suitable for distinguishing between domestic pig and wild boar. Differentiation between cattle and bison is impossible because of identical sequences in the targeted DNA region. The replacement of beef with bison, however, is not a case of fraud in food production. Graphs of fluorescence curves obtained with species-specific primer– probe systems for pork, lamb, goat, chicken, turkey, duck, and cattle are shown in Figure 7.7. To assure that different breeds of the same species result in a positive signal, at least two to three relevant breeds per species were analyzed with the respective TaqMan PCR and by sequencing: cattle (Highland, Holstein-Friesian), pig (Bentheimer, Schw€abisch H€allisches), lamb (Cameroon Sheep, German Blackheaded Mutton), goat (German Improved Fawn, German Improved White), chicken (Hamburg, Leghorn), turkey (Black, White), and duck (Peking, Muscovy Duck, Mallard) (CIBUS, Germany). With the exception of duck, the primer- and probe-binding regions of the different breeds were matched to the respective animal specific sequence. For the three duck breeds the Ct values, starting from the same copy number, varied about 0.5 to 1.5 Ct units, due to sequence differences identified by sequencing (data not shown). Irrespective of these varying Ct values, in principle all of the breeds studied could be detected clearly using the anasIL primer–probe system. 7.3.6
Sensitivity
In addition to the aspect of specificity, determination of the limit of detection (LOD), limit of quantification (LOQ), linearity, efficiency, and repeatability is an important criterion in assessing the suitability and capacity of a detection system. This work was done with dilution series of DNA from the seven animal species. Tenfold dilution series containing 1 to 100 genome copies were tested in 10 replicates and dilutions in
149
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
(a)
(b) 1,0E+01
1,0E+01
lamb
goat
1,0E+00
Fluorescence
Fluorescence
1,0E+00
1,0E-01
1,0E-02
1,0E-03
1,0E-01
1,0E-02
1,0E-03
0
5
10
15
20
25
30
35
40
45
0
5
10
15
Cycle No.
(c)
1,0E-02
1,0E-03
35
40
45
35
40
45
35
40
45
1,0E-01
1,0E-02
1,0E-03 0
5
10
15
20
25
30
35
40
45
0
5
10
15
Cycle No.
(f) duck Fluorescence
1,0E-02
1,0E-03 5
10
15
20
25
25
30
30
35
1,0E+01
pig
1,0E+00
1,0E-01
0
20
Cycle No.
1,0E+01
1,0E+00
Fluorescence
30
turkey
1,0E+00
Fluorescence
Fluorescence
chicken
1,0E-01
40
45
Cycle No.
(g)
25
(d)1,0E+01
1,0E+01
1,0E+00
(e)
20
Cycle No.
1,0E-01
1,0E-02
1,0E-03 0
5
10
15
20
25
30
Cycle No.
1,0E+01
cattle Fluorescence
1,0E+00
1,0E-01
1,0E-02
1,0E-03 0
5
10
15
20
25
30
35
40
45
Cycle No.
FIGURE 7.7 Specificity test. Fluorescence curves for samples of cattle , pig , lamb , goat , chicken , turkey , and duck , including water , using the (a) ovisPDE, (b) capraPDE, (c) galIL, (d) melIL, (e) anasIL, (f) susRY, and (g) bosPDE2 primer– probe system.
the range 1000 to 100,000 genome copies in five replicates. A LOD of 10 genome copies was determined for each system developed, with a probability of 95% to obtain data with Ct values lower than 45. The LOD was also determined in a dilution series of a DNA mixture of 1% pig in a background of 99% chicken. The result shows that
150
MEAT
background DNA, a common realistic situation for composed food, does not decrease the LOD of the respective PCR system. The LOQ is the lowest level of analyte that can be quantified reliably, given a known number of target taxon genome copies (EC Recommendation 2004/787/EC). In the context of the study, the LOQ corresponds to the lowest level of analyte for which relative standard deviation within the laboratory (RSDr) is 30% or less. Taking this into consideration, real-time PCR systems have absolute LOQs in the range 10 to 100 genome copies (data not shown). The efficiency of the systems developed is between 88 and 96% according to (Vaerman et al., 2004) E ¼ 101=s 1 where E is the efficiency and s is the slope (log DNA concentration against Ct). The only exception is duck DNA, amplified by the MYw system with an efficiency of 83%. Most probably, this effect can be attributed to the sequence difference in the binding region of the forward MYw primer in the targeted duck genome sequence. Linearity is given from 10 to 100,000 genome copies, except for the bosPDE2 system, with 10 to 10,000 genome copies, and the anasIL system, with 100 to 100,000 genome copies. Repeatability was determined by measuring duplicates of 100, 1000, and 10,000 genome copies on three different days. The results showed a relative standard deviation of up to 30% (data not shown). 7.3.7
Selectivity
The selectivity of the systems developed was examined using canned food containing varying shares of the seven species. At the same time, different degrees of processing were included in this study. Home-canned food (F ¼ 0.8), normal cans (F ¼ 3.4), cans for use under tropical conditions (F ¼ 12.2), and ultrahigh-heat-treated cans (F ¼ 31) with at least 0.1% of the respective species were analyzed. The F-value is interpreted as the time required to obtain a given reduction in the number of microorganisms at a defined temperature. An F-value of 1.0 indicates a lethality of 12 decimal reductions for Clostridium botulinum, the most dangerous of all toxin-producing organisms, after 1 min at 121.1 C. The respective animal species were clearly identified, even in ultra high-heat-treated cans, down to amounts as low as 0.1% of the respective species. A significant rise in fluorescence was also measured in gelatine and meat and bonemeal containing cattle and pig after three- to tenfold pooling of CTAB-extracted DNA (data not shown). 7.3.8
Ready-to-Use Reaction Plate
To overcome problems of efficiency and sensitivity in multiplex PCR, the identification of seven individual species can be tackled by an alternative approach. Single real-time PCR systems have been developed and applied to a ready-to-use reaction
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
151
plate combining eight detection systems in only one assay. This plate is coated with primers, corresponding probes, positive controls, and magnesium chloride. Only one type of master mix (TaqMan Buffer A, dNTPs, AmpliTaq Gold Polymerase, water) and sample DNA has to be added. Hence, time is saved and throughput enhanced with the persisting potential of separate systems for standardization and suitability in routine analysis. The assay consists of four types of controls: positive, “cutoff,” extraction control (water treated like sample), and the IPC system. The positive control made either from meat DNA or from plasmid DNA containing the respective target sequence aims to be an amplification control to demonstrate the functionality of the primer–probe system. The cut off control contains a low copy number of target DNA, close to the LOD of the primer–probe systems. Based on different levels of controls, the entire system guarantees a high grade of reliability and robustness. The use of plasmid DNA is an innovative tool that avoids problems related to DNA isolated from species of different origins. Furthermore, plasmid DNA can be reproduced easily with the same quality, as often as necessary. Analyzing different meat DNA samples with the aid of the ready-to-use reaction plate in each sample, the presence of the respective animal species could be detected. There was no contamination during extraction and PCR regarding the extraction control. According to the quality of the IPC, inhibition could be excluded. Plasmids fixed on the plate resulted in slightly higher Ct values than for plasmids in solution. This could be explained by the effect that not all DNA bound to the surface of the microtiter plate is available after solubilization. Therefore, fewer targets are present for the PCR. 7.3.9
Quantification
By the use of PCR, even minute amounts of meat of different animal species in complex composed foods can be identified. Thus, it is advantageous to have methods that contribute to distinguishing intentional admixtures from contamination. Utilizing real-time PCR, proportions of species can be determined by relating the copy number of detected species-specific sequences to the copy number of a suitable reference sequence. Statements about the absolute content of proportions of meat or plants are not yet possible. The amount of the ingredients analyzed needs to be determined in addition to the other ingredients (sugar, salt, oil, ice) which cannot be identified by means of DNA-analytical methods, together with additives and flavoring agents. The principle of quantitative determination of animal species in composed meat samples using real-time PCR has been described by Sawyer et al. (2003) for beef. But universal and cattle-specific primer were used in this study, which are complementary to mitochondrial DNA regions. The number of genome copies of these multicopy sequences is variable per cell. Therefore, this method is connected with a high degree of uncertainty if the proportion of an animal species is to be determined in meat products, which are generally prepared using a variety of tissue types. The real-time PCR systems mentioned in Table 7.1 are based on single-copy targets. A relative quantification procedure is performed to determine the proportion of
152
MEAT
10ˆ1 Standard 1 to 5 Sample
ΔRn
10ˆ0
10ˆ-1
10ˆ-2
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle
FIGURE 7.8 Increase in fluorescence as a function of the number of cycles using different starting copy numbers of the nucleic acid target (standard 1 to 5).
a species contained in the food sample compared with the proportion of meat overall (MYw system). The standard curve method is applied as shown in Figures 7.8 and 7.9. Plasmids or genomic DNA of the respective animal species can be used as standards. The threshold cycle (Ct) reflects the cycle number at which the fluorescence generated within a reaction crosses the threshold. The threshold should be placed above any baseline activity and within the exponential increasing phase (which looks linear in the log transformation). The Ct value is related directly to the amount of PCR product and therefore is related to the original amount of target present in the PCR. A low Ct value indicates a high initial level of target DNA, and a high Ct value, a low level. A plot of the logarithm of the initial target copy number for a set of standards versus Ct is used as the regression line. The quantification of the target amount in unknown samples is accomplished by measuring Ct and using the standard curve to determine the starting copy number. Quantitative results showed that whereas the mammalian proportion was determined with smaller deviations from rated values, the results for the proportion of chicken and turkey showed significantly higher deviations, especially in the presence of mammals as the main component. Therefore, the following explanation is possible. Within the DNA-based relative quantification performed as mentioned above, genome 40
y = -3.307× + 36.981
Ct
30 20 10 0 0
1
2
3
4
5
6
log(K) Sample
FIGURE 7.9 Plot of the logarithm of the initial target copy number (standard 1 to 5) versus Ct.
REAL-TIME PCR SYSTEMS FOR THE IDENTIFICATION OF DIFFERENT ANIMAL SPECIES
153
equivalents are compared with each other. Dilution series of plasmid DNA (with the number of copies as an abstract quantity) are used in the standard curve approach, and by means of a linear equation the copy numbers of the samples are determined. In the preparation of sample mixtures, the weight of meat is the decisive criterion; different factors, such as the number of cells per unit of mass, the degree of ploidy, and the genome size, have an influence on the quantification. The introduction of correction factors for a determination of the proportion of species would be a possibility for overcoming the stated uncertainty. Furthermore, the degree of processing is important. Use of published TaqMan PCR systems facilitated a quantitative statement in canned foods for use under tropical conditions down to 1% (w/w). In ultrahigh-heat-treated cans, only the qualitative detection was successful. It must be noted that the starting components can be subject to different degrees of processing. Also, the time span during which a product remained in an unprocessed condition could be relevant. 7.3.10
Conclusions
Seven TaqMan assays can be used to distinguish cattle, pig, lamb, goat, chicken, turkey, and duck from a total of 23 food-relevant animal species. The response was linear over at least four decades of genome copies, and the assays were able to detect as little as 0.1% of the respective animal species corresponding to 10 genome copies. To exclude false-negative results, an external amplification control (MYw) system and an internal positive control have been established. Moreover, a ready-to-use 96-well reaction plate can be used which meets all requirements for quick, reproducible, and efficient routine analysis. Since all primer–probe systems, including controls and magnesium chloride, are precoated on the plate, only one master mix has to be prepared. Furthermore, the use of a multipipette reduces time and labor. The user is in the position to modify the format of the ready-to-use 96-well reaction plate. It is possible to use single tubes as positive controls or stripes consisting of eight wells suitable for the detection of only one animal species. The main field of application of the ready-to-use 96-well reaction plate is qualitative analysis. Nevertheless, all primer–probe systems developed target single-copy genes. Using these systems a determination of the percentage of an animal species relative to the meat total (myostatin gene) can be made. To determine the proportion of meat relative to the total product, a reference system had to be established first detects vegetable and animal material with comparable efficiency considering different factors, such as the degree of ploidy. Second, the proportions of ingredients that cannot be identified by means of DNA-analytical methods (sugar, salt, oil, ice), along with additives and flavoring agents, had to be determined by conventional methods. At the moment a combination of both is impossible. The possibility of quantifying animal species also contributes to distinguish intentional admixtures from contamination. The question arises where the limiting value can be set. Evidently, the list of ingredients is decisive (i.e. species listed on the label have to be present and those not listed must not be present). On principle, meat products have to be prepared within the scope of good manufacturing practice (GMP). The threshold value for complaints is defined by the detection method.
154
MEAT
As demonstrated, for qualitative detection this value is 0.1% in unprocessed products as well as in ultrahigh-heat-treated cans. With regard to quantification, this value is 0.1% in low-processed products and in normal cans and 1% in cans for use under tropical conditions. According to official control laboratories, most complaints about meat products arose when labels had been exchanged, sausage had been reused, or meat had been declared incorrectly by subcontractors. But it will also be possible to detect traces of beef in a meat product if the meat was marinated in cow’s milk during processing. Therefore, it is reasonable to demand postproduction control by the manufacturer if the detection is lower than 1% of a nonlisted species. If findings of a nonlisted species are higher than 1%, the food should be rejected.
7.4
SUMMARY
Recent developments in food control have clearly indicated that molecular biological methods are a valuable tool. PCR is the most commonly used technique in many fields of molecular biology. Nationally as well as internationally accepted PCR-based methods are employed widely in food control: for example, to determine the amount of genetically modified organisms (GMOs) or material derived thereof in food and feed stuffs. In particular, the potential for standardization of PCR-based methods is an advantage. At present, validation studies with real-time PCR systems for the identification and quantification of diverse food-relevant animal and plant species are prospective and under way, respectively.
REFERENCES Behrens M, Unthan M (1999). Tierart-spezifischer DNA-Test von Lebensmitteln. LaborPraxis, 10:24–29. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL (2003). GenBank. Nucleic Acids Res., 31:23–27. Besler M, Fiocchi A, Restani P (2001a). Allergen data collection: beef (Bos domesticus). Internet Symp. Food Allergens, 3(4):171–184. Besler M, Fiocchi A, Restani P (2001b). Allergen data collection: chicken meat (Gallus domesticus). Internet Symp. Food Allergens, 3(4):193–201. Besler M, Fiocchi A, Restani P (2001c). Allergen data collection: pork (Sus scrofa). Internet Symp. Food Allerg., 3(4):185–192. Dalmasso A, Fontanella E, Piatti P, Civera T, Rosati S, Bottero MT (2004). A multiplex PCR assay for the identification of animal species in feedstuffs. Mol. Cell Probes, 18(2):81–87. Deutscher Fleischer-Verband (2003). Gesch€aftsbericht 2002/2003. DF-V, Frankfurt am Main, Germany. EC (European Commission) (1997). Directive 1997/4/EC. EC (2002a). Directive 2002/86/EC. EC (2002b). Decision 2002/248/EC.
REFERENCES
155
EC (2004). Recommendation 2004/787/EC. Gregory TR (2005). Animal genome size database. http://www.genomesize.com/. Hagen M, Beneke B (2000). Detection of genetically modified soy (Roundup-Ready) in processed food products. Berl. Muench. Tierarztl. Wochenschr., 113(11–12):454–458. Heaton MP, Harhay GP, Bennett GL, et al. (2002). Abstract selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm. Genome, 13 (5):272–281. Holland PM, Abramson RD, Watson R, Gelfand DH (1991). Detection of specific polymerase chain reaction product by utilization the 50 to 30 exonuclease activity of Thermus aquaticus. Proc. Nat. Acad. Sci. USA, 88:7276–7280. Kuribara H, Shindo Y, Matsuoka T, et al. (2002). Novel reference molecules for quantitation of genetically modified maize and soybean. J. AOAC Int., 85(5):1077–1089. Laube I, Spiegelberg A, Butschke A, et al. (2003). Methods for the detection of beef and pork in foods using real-time polymerase chain reaction. Int. J. Food Sci. Technol., 38:111–118. Laube I, Zagon J, Spiegelberg A, et al. (2007a). Development and design of a “ready-to-use” reaction plate for a PCR-based simultaneous detection of animal species used in foods. Int. J. Food Sci. Technol., 42:9–17. Laube I, Zagon J, Broll H (2007b). Quantitative determination of commercially relevant species in foods by real-time PCR. Int. J Food Sci., 42:336–341. Meyer R, Candrian U, L€uthy J (1993). Tierartbestimmung und Sojanachweis in erhitzten Fleischprodukten mittels der Polymerase-Kettenreaktion (PCR). Mitt. Geb. Lebensmittelunters. Hyg., 84:112–121. Meyer R, H€ofelein C, L€uthy J, Candrian U. (1995). Polymerase chain reaction–restriction fragment length polymorphism analysis: a simple method for species idenfication in food. J. AOAC Int., 78(6):1542–1551. Newton CR, Graham A (1997). PCR. vol. 2. Spektrum Akademischer Verlag, Heidelberg, Germany. Nijman IJ, Otsen M, Verkaar EL, et al. (2003). Hybridization of banteng (Bos javanicus) and zebu (Bos indicus) revealed by mitochondrial DNA, satellite DNA, AFLP and microsatellites. Heredity, 90(1):10–16. Pozdnyakov VN, Kakpakov VT, Abramova AB, Borodachev AV, Krivtsov NI (2000). RAPD markers of three breeds of honeybee Apis mellifera. Dokl. Biol. Sci., 372:309–311. Sawyer J, Wood C, Shanahan D, Gout S, McDowell D (2003). Real-time PCR for quantitative meat species testing. Food Control, 14:579–583. Sunnucks P, Wilson ACC, Beheregaray LB, Zenger K, French J, Taylor AC (2000). SSCP is not so difficult: the application and utility of single-stranded conformation polymorphism in evolutionary biology and molecular ecology. Mol. Ecol., 9(11):1699–1710. Tinker NA, Fortin MG, Mather DE (1993). Random amplified polymorphic DNA and pedigree relationships in spring barley. Theor Appl Genet., 85:976–984. Vaerman JL, Saussoy P, Ingargiola I (2004). Evaluation of real-time PCR data. J. Biol. Regul. Homeostat. Agents, 18:212–214. Zhang X, Leung FC, Chan DK, Yang G, Wu C (2002). Genetic diversity of Chinese native chicken breeds based on protein polymorphism, randomly amplified polymorphic DNA, and microsatellite polymorphism. Poult. Sci., 81(10):1463–1472.
CHAPTER 8
Genetically Modified Organisms BERT POPPING Eurofins Scientific Group, Pocklington, Yorkshire, UK
8.1
INTRODUCTION
Genetically modified organisms (GMOs) are organisms whose genetic code has been altered. This is typically done in a laboratory, where specific sequences are inserted or deleted. In plants, the modifications can code for a new property (e.g., tolerance to herbicides or resistance to insects). For new genes to be made functional (i.e., to express the new characteristic), they need to have a specific environment in which to function. This environment requires an “on” switch, a gene with the new characteristic, and a stop signal. The technical terms are promoter (i.e., on switch), target gene, and terminator (i.e., stop signal). This is called the construct (Figure 8.1). So far, few promoter and terminator sequences have proven successful in expressing a gene in a genetically modified plant, so few are used in a great number of transgenic constructs. Best known is the 35S promoter from the cauliflower mosaic virus (CaMV). It occurs in the vast majority of all commercialized transgenic plants. Synonyms for the 35S promoter from CaMV are P-35S, 35S promoter, and CaMV promoter. Also frequently used, from the same organism, is the 35S terminator, also known as T-35S. Another viral promoter found in constructs is FMV (Figworth mosaic virus). Another element commonly found is the NOS terminator (or T-NOS) from the soil bacterium Agrobacterium tumefaciens. A list of the most common promoters, terminators, and coding sequences introduced is given in Table 8.1. Best known as genes conveying new properties are the EPSPS1 gene from the plant Petunia hybrida, which codes for tolerance to the herbicide Roundup Ready [this is found in the Roundup Ready soybean (RRS)], and the cry genes from Bacillus 1
EPSPS: a single copy of the gene coding for glyphosate tolerance CP4 5-enolpyruvylshikimate-3phosphate synthase (CP4 EPSPS) from Agrobacterium sp. strain CP4.
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
157
158
GENETICALLY MODIFIED ORGANISMS
PPPPPPPPPPPPGGGGGGGGGGGGGGTTTTTTTTTTTTTTT Promoter coding sequence (gene) Terminator |---------------------------CONSTRUCT-------------------------------------|
FIGURE 8.1 Simplified view of a transgenic construct.
thuringiensis, which encode various insecticidal proteins and thereby convey insect resistance. Recently, other constructs have been created that modify metabolic pathways and thereby enhance or decrease desirable or undesirable substances. The best known example is the high-oleicacid soybean (HO soybean). Once a construct is designed, it should be inserted into the plant genome. The technology available for this is not perfect and does not allow pre determination of the location of the construct in the genome. Each transformation results in a number of transformed cells which carry the same construct but in a different location in the genome. The location of the insert is thereby unique, like a fingerprint. The region in the genome where a construct is inserted is called a junction. Each individual transformation event can thereby be identified by amplifying the sequence in the junction region. This is called event-specific analysis or event-specific PCR. Of each transformation procedure, very few cells (transformation events) are selected for further breeding. The event numbers are often retained in the name of the product TABLE 8.1
Common Promoters, Terminators, and Coding Sequences
Element Promoter P-35S P-NOS P-Ssu P-FMV P-TA29 Terminator T-NOS T-35S T-E9 T-ocs T-tml Coding sequence (gene) Npt II Pat CP4EPSPS Cry GUS Barnase Barstar Bla Bar Aad
Originating from Organism CaMV Agrobacterium tumefaciens Arabidopsis thaliana Figworth mosaic virus Nicotiana tabacum A. tumefaciens CaMV Pisum sativum A. tumefaciens A. tumefaciens Escherichia coli Streptomyces viridochromogenes A. tumefaciens Bacillus thuringiensis E. coli Bacillus amyloquefaciens B. amyloquefaciens E. coli Streptomyces hygroscopicus E. coli
REGULATIONS ON GMOs
159
(e.g., Bt-176, which carries in transformation event 176 a cry gene from Bacillus thuringiensis).
8.2
REGULATIONS ON GMOs
The necessity for developing detection systems for GMOs arose initially from European regulations that require the labeling of products containing genetically modified ingredients and do not permit placing nonapproved genetically modified products on the market. Food products containing or derived from biotech crops have been around for the past 10 years. The first product seen on supermarket shelves in Europe was genetically modified tomato puree. This was sold with a price incentive at Tesco’s and Sainsbury’s, clearly labeled “genetically modified.” According to the supermarkets’ own statements, these products sold well. However, when soups that contained products derived from biotech crops that were not labeled were sold in the same supermarkets, environmental pressure groups campaigned, and consumer pressure increased, leading ultimately to the withdrawal of all products containing transgenic material from supermarket shelves and to the implementation of stringent regulations in Europe. In 1997 the European Commission (EC) adopted the Novel Food Regulation (1997/258/EC), which applied to any type of new food product, including biotech crops derived from or containing foods, and requires evidence that it is safe for human consumption. It also requires labeling of novel foods and novel food ingredients if they are not “substantially equivalent” to their conventional counterparts. The regulation aims to inform the consumer by way of labeling if such a product differs in its composition, nutritional value or effects, or its intended use. The presence of a novel protein such as EPSPS or the DNA coding for it did not automatically constitute any of the cases described above and therefore did not trigger labeling under this particular regulation. Increasing pressure of environmental activist groups and consumers led to stringent but inconsistent labeling regulations imposed through Regulations 1998/1139/EC and 1997/1813/EC. These required labeling of biotech soybeans and biotech maize, based on the presence of transgenic protein or transgenic DNA, covered in Decisions 1996/281/EC [soybean (Glycine max L. cv. A5403) line 40-3-2, commonly known as Roundup Ready soy] and 1998/97/EC [maize (Zea mays L.) line CG 00256-176, commonly known as Bt-176 maize]. None of the other transgenic crops approved under the novel food regulation had to be labeled based on the presence of transgenic DNA or protein only. By then, Europe had a situation where biotech crops approved under the Novel Food Regulation required labeling only if they were not substantially equivalent, but the two crop lines regulated under 1997/1813/EC (Roundup Ready soy and Bt-176 maize) required labeling if transgenic DNA or protein could be detected. Regulation 1998/1139/EC repealed Regulation 1997/1813/EC in Article 3 and requires labeling of the above-mentioned soybean and maize lines using terminology specified. The inconsistency remains, as the new regulation does not apply to crops regulated under the Novel Food Regulation or highly processed products such as flavorings
160
GENETICALLY MODIFIED ORGANISMS
or additives (e.g., lecithin). No threshold is provided in this regulation above which labeling is mandatory. It ultimately led to a race for the lowest sensitivities in analytical laboratories, trade impediments, and confusion of all parties involved. Two years later, the EC realized this situation and acted on it by issuing two new regulations, 2000/49/EC and 2000/50/EC. Regulation 2000/49/EC amended Regulation 1998/1139/EC and introduced a 1% labeling threshold for adventitious contamination (i.e., products that contain up to 1% transgenic material which was unavoidable and not added deliberately do not require labeling). Again, although it became clear in consultations with the EC that the regulation was intended to regulate all approved transgenic crops, it referred back to 1998/1139/EC, which regulated only Roundup Ready soy and Bt-176 maize. This regulation applies to food products and ingredients made of or derived from transgenic crops. The other regulation, 2000/50/EC, makes the labeling of additives and flavorings mandatory. No threshold is provided and labeling is required only if transgenic DNA or protein can be detected. Again, a number of inconsistencies remain and after another three years, the EC acted by issuing another set of regulations. The new regulations, 2003/1829/EC and 2003/1830/EC, are no longer limited to Roundup Ready soy and Bt-176 maize but cover all crops. Another milestone in the regulation is the requirement to label feed in addition to food. Also, new labeling thresholds have been set, requirements for traceability laid down, and approvals are now granted for a period of 10 years. Labeling is now required even if DNA or protein is no longer detectable. Labeling thresholds have been set to 0% for unapproved biotech crops (zero tolerance), 0.5% threshold for crops evaluated positively scientifically that have not received final approval through the European Commission, and 0.9% for approved biotech crops. The 0.5% for crops assessed positively scientifically is temporary approval for a period of three years. It also requires each biotech crop to have a unique identifier. The format of the identifier is regulated in Regulation 2004/65/EC. There are a few other novelties in the regulations: Before 2003/1829/EC came into force, applications for new biotech crops could be made in any EC member states country. The assessment was made (and approved) in that country and was binding for any other EC member state. The assessments were apparently made differently with different stringency by member countries. The newly established European Food Safety Authority (EFSA) was tasked with harmonizing this situation. Every new application for biotech crops must now go directly to the EFSA for assessment and approval. This is laid down in 2003/1829/EC (9): The new authorisation procedures for genetically modified food and feed should include the new principles introduced in Directive 2001/18/EC. They should also make use of the new framework for risk assessment in matters of food safety set up by Regulation (EC) No 178/2002 of the European Parliament and of the Council of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety Authority, and laying down procedures in matters of food safety (1). Thus, genetically modified food and feed should only be authorised for placing on the Community market after a scientific evaluation of the highest possible standard, to be undertaken under the responsibility of the European Food Safety Authority (Authority), of any risks which they present for human and animal health and, as the case may be, for
REGULATIONS ON GMOs
161
the environment. This scientific evaluation should be followed by a risk management decision by the Community, under a regulatory procedure ensuring close cooperation between the Commission and the Member States.
In addition, it has become mandatory for companies or organizations wanting to have their biotech crops approved in Europe to provide reference material as well as a specific detection method. This is then tested and validated by ENGL, the European Network of GMO Laboratories, coordinated by the Community Reference Laboratory of the Joint Research Centre in Ispra, Italy. This is laid down in Regulation 2003/1829/EC: “To facilitate controls on genetically modified food and feed, applicants for authorisation should propose appropriate methods for sampling, identification and detection, and deposit samples of the genetically modified food and feed with the Authority; methods of sampling and detection should be validated, where appropriate, by the Community reference laboratory.”
Methods need to pass the validation process successfully to move the approval process forward. The traceability requirement in Regulation 2003/1830/EC demands that each person in the food production chain dealing with genetically modified organisms keep a record of who they were bought from and to whom they were sold (one up, one down). As long as they have reproduction capabilities, the unique identifier has to be transmitted along with the organism. After that, the fact that the product contains genetically modified material (e.g., GM soy, maize, canola) has to be relayed to the buyer. Products for the final consumer that contain transgenic material have to be labeled according to the wording given in Regulation 2003/1829/EC. In Article 13 of the regulation, it reads: (a) where the food consists of more than one ingredient, the words “genetically modified” or “produced from genetically modified (name of the ingredient)” shall appear in the list of ingredients provided for in Article 6 of Directive 2000/13/EC in parentheses immediately following the ingredient concerned; (b) where the ingredient is designated by the name of a category, the words “contains genetically modified (name of organism)” or “contains (name of ingredient) produced from genetically modified (name of organism)” shall appear in the list of ingredients; (c) where there is no list of ingredients, the words “genetically modified” or “produced from genetically modified (name of organism)” shall appear clearly on the labelling;
This information has to be retained for five years. Once approved through the scientific committee and the European Commission, a biotech crop can be freely traded and, depending on its status, grown in Europe. In some countries, national implementation of European regulations led to the creation of another category, called “without GM” (in German: ohne Gentechnik). Products that are so labeled need to comply with even more stringent requirements. While the use of, say, enzymes for the production of cheese which originate from genetically modified bacteria do not require the cheese to be labeled as a genetically modified product, labeling it “without GM” is not possible. Such labeling would, for example, be an option for milk produced from cattle that have not been fed genetically
162
GENETICALLY MODIFIED ORGANISMS
modified products or where other genetically modified products were not used on the cattle (e.g., pharmaceuticals regardless of the method of production). Globally, the European Union (EU) has the most comprehensive regulations on biotech products. The new regulations, 2000/1829/EC and 2003/1830/EC, were meant to end the de facto moratorium of the EU member states, which until then lasted for four years. However, a small number of new products have been approved until now. European consumers’ reluctantance to accept biotech crops may need to be reevaluated a few years from now, when economic conditions are likely to have changed in Europe, but currently, very few products declared to contain products derived from transgenic organisms will be found in supermarkets. In Japan, labeling is focused on final products reaching the consumer rather than on the labeling of products at the beginning of the production chain. In comparison, highly refined oils need to be labeled in Europe as genetically modified even if no (GM-) DNA or protein can be detected. In Japan, labeling such products is not required. The Japanese Ministry of Health, Labor and Welfare (MHLW) introduced regulations in 2000 that need to be followed by anybody wishing to have biotech crops authorized. The assessment is based on aspects similar to those in Europe, taking into account potential toxicology of new proteins or metabolites, allergenic aspects, and environmental issues. Once the approval passed, there is a de facto 5% labeling threshold. For unapproved biotech products, as in Europe, zero tolerance applies. As in Europe, producers and retailers have aimed to avoid having products in the market that are labeled as genetically modified. But in Japan, unlike Europe, products sold without a GM label may still contain significant quantities of GM-derived material (e.g., GM soy oil) since highly refined products do not need to be labeled. Typical products that may contain GM but do not have to be labeled in Japan include some baked goods, cheese, soy sauce, and a number of manufactured goods. The Japanese regulations are comparatively pragmatic and have not had a significant impact on imports, especially from the United States. Similar regulations can be found in Korea, Saudi Arabia, and Thailand. Between Europe and Japan are such countries as Brazil, China, Russia, and last but not least, Switzerland. These countries have typically quite stringent mandatory labeling regulations which are process based but do not require traceability. In general, it appears that large producers of transgenic crops appear to have less stringent regulations. Most are based on substantial equivalence rather than on detection of DNA or protein. This means that products need to be labeled only if, for example, the nutritional content changes in comparison to the conventional product. The presence of transgenic DNA or protein alone would not trigger labeling. This is similar to the EC Novel Food Regulation, 1997/258/EC, which was later tightened by successive regulations. As labeling regulations tend to be a moving target, and threshold levels for labeling of transgenic crops have been set for some but not all other countries, the following Web sites (noncomprehensive) are recommended for information on up-to-date regulations and thresholds: . . .
Euro-Lex: europa.eu.int/eur-lex/en/index.html GMO Compass: www.gmo-compass.org/eng/home/ AgBioForum: www.agbioforum.org/
WHERE GMOs OCCUR
. . . .
163
AgBios: www.agbios.com/main.php FDA CFSAN: www.cfsan.fda.gov/ Belgian Biosafety Server: biosafety.ihe.be/ BATS Biosicherheit: www.bats.ch/bats/en/genfood.php
It should be noted that although all of these Web sites provide excellent information, some are maintained by industrial or environmental lobby groups and may contain comments or interpretations pro or con regarding biotech aspects. 8.3
GMOs ON THE WORLD MARKET
According to the ISAAA (www.isaaa.org), the percentage of transgenic crops on the world market has grown significantly over the past five years. In 2008, more than 125 million hectares of transgenic crops were planted, an increase of 10.7% over 2007, with an accumulated global area of 800 million hectares between 1996 and 2008, and exceptional growth rates in developing countries. In 2008, 85% of the USA national maize crop was transgenic, and 90% of all cotton crops. The six leading biotech crop-developing countries (i.e. Argentina, Brazil, India, China, Paraguay, and South Africa) grew 52.7 million hectares of biotech crops in 2008, equivalent to 42.2% of the global total. Argentina grew 19.1 million hectares of soybean, maize and cotton, Brazil 15.0 million hectares of soybean and cotton, India 6.2 million hectares of cotton and China 3.8 million hectares of cotton, tomato, poplar, petunia, papaya and sweet pepper. In India, the largest cotton growing country in the world, the current 66% of transgenic cotton are projected to grow to 80% and more, and China, the biggest producer of cotton has a similar adoption rate for GM cotton. South Africa, the leading country in Africa, increases the biotech maize threefold. The number of biotech crop countries, crops and traits and hectarage are projected to double between 2006 and 2015, the second decade of commercialization; in the developing countries, Burkina Faso and Egypt, and possibly Vietnam are potential candidates for adopting biotech crops in the next one or two years. By 2015, the number of farmers adopting biotech crops could increase up to ten fold to 100 million, or more, assuming that only biotech rice will be approved in the near term. Genes conferring a degree of drought tolerance, expected to become available around 2011 will be particularly important for developing countries which suffer more from drought, the most prevalent and important constraint to increased crop productivity worldwide. The second decade of commercialization, 2006-2015, is likely to feature significantly more growth in Asia compared with the first decade, which was the decade of the Americas, where there will be continued vital growth in stacked traits in North America and strong growth in Brazil.
8.4
WHERE GMOs OCCUR
With the continued growth of biotech crops in most countries, any product containing soy, maize, canola, or cotton derivatives has a potential of containing proteins and/or
164
GENETICALLY MODIFIED ORGANISMS
DNA from genetically modified organisms. However, it is often not simple to spot these ingredients on the list. The declaration “vegetable oil” could mean that the oil originated from sunflower, soy, maize, or canola. Some other ingredients are even less obvious than that: 1. Common maize derivatives are any form of starch (modified, bleached, etc.), maltodextrins, dextrose, caramel color, fructose corn syrup, glucose syrup, sorbitol, maltitol, and mannitol. The DNA is usually detectable in starch but not the other derivatives listed. 2. Common soy derivatives (Figure 8.2) are lecithin (raw, fractionated, phosphatidylcholin fraction), tocopherols (vitamin E), soy isoflavones, soy flour, molasses, vegetable oil, and sterols. DNA can usually be found only in raw and some fractionated lecithins and soy flour as well as crude soybean oil. Often, the findings of GMOs in certain products appear to be unexpected but can easily be explained by common processing or agricultural practise. An example is the finding of (transgenic) soy in wheat. This is due to the fact that containers for transport of soya are often cleaned and reused for transport and storage of wheat. Cleaning of the containers often leaves some material behind. The same applies to processing facilities, where total removal of material from the preceding production run is often impossible. This is one of the reasons for legislators allowing a certain percentage of approved GMO in a product; this is often technically unavoidable.
SOY BEANS
Oil Extraction Oil Press Cake Purification of Oil
Lecithin
Remove Extraction Medium
Oil for Food
Toast
Defatted Soy Flakes
Defatted Press Cake
FOODSTUFF
ANIMAL FEED
(a)
FIGURE 8.2
Versatility of soybeans.
DETECTION STRATEGIES FOR GMOs
WHOLE BEANS
SOY BEANS
Fermented Foods Soy sauce Miso, Tempeh, Natto Soy drinks Tofu Products from Roasted Soybeans Soy nuts Crackers, biscuits Products from Full-Fat Soy Flour Baking products Baking flour Instant milk drinks
SOY MILLS
20% 80%
SOY OIL Soy oil
LECITHIN
Baking fats
Cocoa drinks
Margarine
Chocolate
SOY PROTEIN
Defatted soy flour
Ice cream Mayonnaise
Milk-mix
Potato and maize
ANIMAL FEED Meat and meat products Milk and milk products
Milk-substitute products
Total: 20,000 - 30,000 foods
FIGURE 8.2
8.5
165
(Continued ).
DETECTION STRATEGIES FOR GMOs
With the wider acceptance of transgenic crops worldwide, the number of approved (and nonapproved) GMOs has increased dramatically. It is therefore cost prohibitive to event-specifically test products for the potential presence of any possible (approved) GMO. It is therefore necessary to develop a strategy to narrow the possibilities. This is typically done by starting with screening elements. 8.5.1
Qualitative Detection
In a first step, common elements, which are often found in approved (and most unapproved) transgenic crops, are chosen. The choice of elements depends on knowledge of the product. While most first-generation plants could be detected using a combination of P-35S promoter and T-NOS terminator, this is no longer sufficient to detect all marketed transgenic events. Here, additional elements such as CTP2-CP4 EPSPS, bar and 35S pat are needed to detect the vast majority of transgenic lines, but still missing at least five events, namely LY038 maize, soybean events DP-305423 and BPS-CV127-9 and cotton events 281-24-236 and 3006-210-23. In case the laboratory sample does not consist of morphologically unambiguously identifiable plant material (e.g., seeds or leafs known to originate from a specific plant), detection of plant-specific reference genes should be used to identify the plant(s) present in the sample. Once the plant species has/have been identified, the result of the analysis of screening elements gives a first indication of the genetic modification present. However, it should be noted that most screening elements occur naturally and therefore are on their own no proof of the presence of genetic modification. Proof of genetic modification can only be through detection of a sequence that does not occur
166
GENETICALLY MODIFIED ORGANISMS
naturally. This is typically the case in the construct, where the promoter is linked to the coding sequence, the coding sequence is linked to the terminator (construct-specific detection), or in the junction sequence, where the construct integrates into the plant genome (event-specific detection). Two examples of possible screening results: 1. Sample of unknown composition (a) Plant reference genes analyzed: maize, canola, soy, cotton (b) Screening element: P35S, T-NOS, FMV, npt II Results: (a) Maize, canola, cotton tested negative, soy tested positive. (b) P35S and T-NOS tested positive, FMV and npt II tested negative. The transgenic soybean that contains the P35S and T-NOS elements is the Roundup Ready soybean. The next step should be to event-specifically test for Roundup Ready soybean. 2. Sample of unknown composition (a) Plants reference genes analyzed: maize, canola, soy, cotton (b) Screening element: P35S, T-NOS, FMV, npt II Results: (a) Soy, canola, cotton tested negative, maize tested positive. (b) T-NOS tested positive, P35S, FMV, and npt II tested negative. The transgenic maize that contains T-NOS but none of the other elements is the GA21 maize. The next step should be to event-specifically test for GA21 maize. Based on the findings of the screening procedure, approved events tend to be tested first (as there is a higher probability of positive findings) and unapproved events are tested thereafter. 8.5.2
Quantitative Detection
The advent of real-time PCR technology (see Chapter 3) made it possible not only to detect DNA targets with higher specificity but also to quantify the targets. This has great relevance for GMO analysis since biotech regulations in several countries in Europe, Asia, and Africa require determination of the percentage of transgenic GMO, as noted earlier. The regulations require determining relative amounts of GMO rather than the total amount of a crop in a product. As an example, European regulations require that products containing 0.9% GMO at the ingredient level require GMO labeling. The aim is that the total amount of GMO in the final product not exceed 0.9% GMO. If a hypothetical product consists of 50% maize flour, 40% soy flour, and 10% potato flour, the transgenic content of neither maize nor soy nor potato can exceed 0.9%. Otherwise, the product has to be labeled in accordance with EC
DETECTION STRATEGIES FOR GMOs
167
regulations. However, this has in some cases led to situations where products had to be labeled as containing GMO even though the actual GMO-containing component was absolutely minor. As an example, if a product consists of 60% wheat flour, 20% egg, . . ., and 0.2% flavors (where soy flour was used as an ingredient), and the soy flour contains 5% transgenic soya, the product would have to be labeled since the GMO content at the ingredient level is above 0.9%, although the total GM content of the product eaten by the final consumer is only 0.01%. However, having said this, the regulations intend to ensure that the entire food chain controls the level of transgenic material in order to avoid labeling. Let’s look at how the amount of transgenic DNA is determined. A reference gene or household gene is chosen which is present as a single-copy gene. This can, for example, be the lectine gene for soy or the invertase gene for maize. The quantity of these genes as determined by real-time PCR is set to 100%. Then the quantity of transgenic target gene is determined [e.g., Roundup Ready (CP4-EPSPS)] and set in relation to the number of copies of the household gene found. As an example, if 50,000 copies of the household gene (soy lectine) and 1000 copies of the transgenic gene (CP4-EPSPS) are found, this constitutes 2% of the transgenic material relative to the total soy content. A sample containing this amount requires labeling for GMO under European regulations. If only 200 copies were found, it constitutes 0.4% of transgenic soy content and can be considered as adventitious, which does not require labeling. The situation is actually even more complex since some breeding lines contain more than one copy of the transgenic sequence or have stacked genes (i.e., more than one transgenic sequence is present—both would lead to an overestimation of the transgenic content); and the number of stacked traits is steadily increasing: “Notably, 63% of biotech maize, 78% of biotech cotton, and 37% of all biotech crops in the USA in 2007 were stacked products containing two or three traits that delivered multiple benefits.”2
From this perspective it is important to interpret carefully the quantitative analytical results obtained in a laboratory. How are the quantitative assays calibrated? The EC’s Institute for Reference Materials and Measurements (EC JRC IRMM (irmm.jrc.ec.europa.eu/html/homepage. htm)) produced certified reference material calibrants (CRMCs) at levels relevant to EC labeling regulations (e.g., 0%, 0.1%, 0.5%, 1%, and 2%). These materials can be purchased either directly (irmm.jrc.ec.europa.eu/html/reference_materials_catalogue/ catalogue/index.htm) or via different worldwide operating suppliers such as Sigma Aldrich (www.sigmaaldrich.com/sigma-aldrich/home.html). The materials are used to determine the amount of reference gene (household gene) and transgenic gene. The real-time Ct values are recorded. Since this is done at various concentrations with the CRMCs of which the concentration is known, the quantity of transgenic material of 2
ISAAA Brief 37-2007: Executive Summary; www.isaaa.org/resources/publications/briefs/37/executivesummary/default.html (accessed Dec. 28, 2008).
168
GENETICALLY MODIFIED ORGANISMS
the unknown sample can be determined easily. Alternatively to in-house assays, several companies (e.g., www.genescan.de/en.aspx) offer ready-made kits for detection and qantitation of GMO material in foodstuffs. Whereas the quantitation of transgenic soya is still comparatively simple since Roundup Ready soy is the dominant transgenic variety at present (>90% of transgenic soybeans), the quantitation of transgenic maize is much more complex. There are several transgenic lines with different traits grown and marketed worldwide, and to determine the accurate transgenic amount of a product consisting of different transgenic maize lines, one would have to quantitate individually each line identified. However, this is economically not feasible, so a shortcut is often used by determining the 35S content and relating that to the total maize content (as determined by the number of copies of the household gene). This bears an error factor of 3 or more, as some traits contain three or more 35S elements. In addition, several maize lines have recently been grown and marketed which do not contain a 35S element (e.g., GA21). Also, new soya varieties are being marketed that cannot be detected by a screen for Roundup Ready. Here, new economically feasible analytical strategies have to be devised that also cover these new varieties. In summary, while the number of detection methods for new transgenic varieties will increase over the coming years, the quantitation of transgenic content of a product will become increasingly difficult.
APPENDIX: EXAMPLES OF GMO DETECTION SYSTEMS Reference Genes Soy Lectin Gene . . . .
Target: soybean lectin gene Le1 Forward primer (GM03): 50 –gCC CTC TAC TCC ACC CCC ATC C–30 Reverse primer (GM04): 50 –gCC CAT CTg CAA gCC TTT TTg Tg–30 Hybridization probe: GM 50 –ggT AgC gTT gCC AgC TTC g–30
Final Reagent Concentration Reagent Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer GM03, 5 mmol/L Primer GM04, 5 mmol/L Taq DNA polymerase, 5 IU/mL
Final Concentration 10–50 ng 1 1.5 mmol/L 0.8 mmol/L 0.2 mmol/L 0.2 mmol/L 0.5 IU
APPENDIX: EXAMPLES OF GMO DETECTION SYSTEMS
169
Time–Temperature Profile Activation/initial denaturation Amplification
Number of cycles Final extension .
10 min/95 C 30 s/95 C 30 s/60 C 60 s/72 C 35 3 min/72 C
Expected amplification size: 118 bp
Plant Multicopy Gene . . .
Target: multicopy DNA sequences in plant chloroplasts Forward primer (primer c): 50 –CgA AAT Cgg TAg ACg CTA Cg–30 Reverse primer (primer d): 50 –ggg gAT AgA ggg ACT TgA AC–30
Final Reagent Concentration Reagent Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer c, 10 mmol/L Primer d, 10 mmol/L Taq DNA polymerase, 5 IU/mL
Final Concentration 10–50 ng 1 1.5 mmol/L 0.8 mmol/L 0.8 mmol/L 0.8 mmol/L 0.5 IU
Time–Temperature Profile Activation/initial denaturation
4 min/94 C
Amplification
30 s/95 C 30 s/55 C 120 s/72 C 35 5 min/72 C
Number of cycles Final extension .
Expected amplification size: 500 to 600 bp
Maize Invertase Gene . . .
Target: maize invertase gene Forwardprimer(primerIVR1-F):50 –CCgCTgTATCACAAgggCTggTACC–30 Reverse primer (primer IVR1-R): 50 –ggA gCC CgT gTA gAg CAT gAC gAT C–30
170
GENETICALLY MODIFIED ORGANISMS
Final Reagent Concentration Reagent Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer IVR1-F, 10 mmol/L Primer IVR1-R, 10 mmol/L Taq DNA polymerase, 5 IU/mL
Final Concentration 10–50 ng 1 1.5 mmol/L 0.4 mmol/L 0.5 mmol/L 0.5 mmol/L 1 IU
Time–Temperature Profile Activation/initial denaturation Amplification
Number of cycles Final extension .
12 min/95 C 30 s/95 C 30 s/64 C 60 s/72 C 35 10 min/72 C
Expected amplification size: 226 bp
Screening Elements CaMV 35S . . .
Target: CaMV 35S promoter Forward primer (35S-1): 50 –gCT CCT ACA AAT gCC ATC A–30 Reverse primer (35S-2): 50 –gAT AgT ggg ATT gTg CgT CA–30
Final Reagent Concentration Reagent
Final Concentration
Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer 35S-1, 5 mmol/L Primer 35S-2, 5 mmol/L Taq DNA polymerase, 5 IU/mL
10–50 ng 1 1.5 mmol/L 0.8 mmol/L 0.2 mmol/L 0.2 mmol/L 0.5 IU
APPENDIX: EXAMPLES OF GMO DETECTION SYSTEMS
171
Time–Temperature Profile Activation/initial denaturation Amplification
Number of cycles Final extension .
10 min/95 C 20 s/94 C 40 s/54 C 60 s/72 C 40 3 min/72 C
Expected amplification size: 195 bp
CaMV 35S . . .
Target: CaMV 35S promoter Forward primer (35S-cf3): 50 –CCA CgT CTT CAA AgC AAg Tgg–30 Reverse primer (35S-cr4): 50 –TCC TCT CCA AAT gAA ATg AAC TTC C–30
Final Reagent Concentration Reagent
Final Concentration
Sample DNA Water 10 PCR buffer (with MgCl2, 15 mmol/L) dNTP solution, 16 mmol/L Primer 35S-cf3, 20 mmol/L Primer 35S-cr4, 20 mmol/L Taq DNA polymerase, 5 IU/mL
1 0.64 mmol/L 0.6 mmol/L 0.6 mmol/L 0.8 IU
Time–Temperature Profile Activation/initial denaturation
10 min/95 C
Amplification
25 s/95 C 30 s/62 C 45 s/72 C 50 7 min/72 C
Number of cycles Final extension .
Expected amplification size: 123 bp
NOS Terminator . . .
Target: NOS terminator Agrobacterium tumefaciens Forward primer (HA-nos118f): 50 –gCA TgA CgT TAT TTA TgA gAT ggg–30 Reverse primer (HA-nos118r): 50 –gAC ACC gCg CgC gAT AAT TTA TCC–30
172
GENETICALLY MODIFIED ORGANISMS
Final Reagent Concentration Reagent Sample-DNA Water 10 PCR buffer (with MgCl2, 15 mmol/L) dNTP solution, 16 mmol/L Primer HA-nos118f, 20 mmol/L Primer HA-nos118r, 20 mmol/L Taq DNA polymerase, 5 IU/mL
Final Concentration
1 0.64 mmol/L 0.6 mmol/L 0.6 mmol/L 0.8 IU
Time–Temperature Profile Activation/initial denaturation
10 min/95 C
Amplification
25 s/95 C 30 s/62 C 45 s/72 C 50 7 min/72 C
Number of cycles Final extension .
Expected amplification size: 118 bp
NPTII Gene . . .
Target: npt II gene Forward primer (APH2 short): 50 –CTC ACC TTg CTC CTg CCg AgA–30 Reverse primer (APH2 reverse): 50 –CgC CTT gAg CCT ggC gAA CAg–30
Final Reagent Concentration Reagent
Final concentration
Sample DNA Water 10 PCR buffer (with MgCl2 15 mmol/L) dNTP solution, 10 mmol/L Primer APH2 short, 10 mmol/L Primer APH2 reverse, 10 mmol/L Taq DNA polymerase, 5 IU/mL
1 0.2 mmol/L 0.4 mmol/L 0.4 mmol/L 2 IU
APPENDIX: EXAMPLES OF GMO DETECTION SYSTEMS
Time–Temperature Profile Activation/initial denaturation
10 min/95 C
Amplification
25 s/95 C 30 s/60 C 45 s/72 C 35 7 min/72 C
Number of cycles Final extension .
Expected amplification size: 215 bp
Construct-Specific Methods Roundup Ready Construct . . .
Target: Roundup Ready construct Forward primer (35S-f2): 50 –TgA TgT gAT ATC TCC ACT gAC g–30 Reverse primer (petu-r1): 50 –TgT ATC CCT TgA gCC ATg TTg T–30
Final Reagent Concentration Reagent
Final concentration
Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer 35S-f2, 5 mmol/L Primer petu-r1, 5 mmol/L Taq DNA polymerase, 5 IU/mL
10–50 ng 1 1.5 mmol/L 0.8 mmol/L 0.2 mmol/L 0.2 mmol/L 0.5 IU
Time–Temperature Profile Activation/initial denaturation
10 min/95 C
Amplification
30 s/95 C 30 s/60 C 25 s/72 C 35–40 3 min/72 C
Number of cycles Final extension .
Expected amplification size: 172 bp
173
174
GENETICALLY MODIFIED ORGANISMS
BT176 Construct . . . .
Target: cry gene Forward primer (Cry03): 50 –CTC TCg CCg TTC ATg TCC gT–30 Reverse primer (Cry04): 50 –ggT CAg gCT Cag gCT gAT gT–30 Hybridization probe: 50 –ATg gAC AAC AAC CCC AAC ATC–30
Final Reagent Concentration Reagent
Final Concentration
Sample DNA Water 10 PCR buffer (without MgCl2) MgCl2 solution, 25 mmol/L dNTP solution, 10 mmol/L Primer Cry03, 5 mmol/L Primer Cry04, 5 mmol/L Taq DNA polymerase, 5 IU/mL
10–50 ng 1 1.5 mmol/L 0.4 mmol/L 0.25 mmol/L 0.25 mmol/L 0.5 IU
Time–Temperature Profile Activation/initial denaturation
12 min/95 C
Amplification
30 s/95 C 30 s/63 C 30 s/72 C 38 6 min/72 C
Number of cycles Final extension .
Expected amplification size: 211 bp
Event-Specific Methods Current event-specific methods can be downloaded from the Web site of the European Commission: gmo-crl.jrc.ec.europa.eu/statusofdoss.htm.
CHAPTER 9
Detection of Food Allergens CARMEN DIAZ-AMIGO Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, Maryland, USA
BERT POPPING Eurofins Scientific Group, Pocklington, Yorkshire, UK
9.1
INTRODUCTION
Food allergy is an abnormal immune response of a sensitive person to food proteins characterized by the production of allergen-specific immunoglobulin E (IgE), which is the immunoglobulin isotype used as a marker for diagnosis purposes. Because no prophylactic treatments are available, the only way to prevent allergic reactions is by avoiding the offending food. To protect allergic consumers and to help them select safe food products from supermarket shelves, regulatory agencies from various countries have enacted regulations that mandate the labeling of specific food allergens and their derivatives when they are used as food ingredients (Chapters 14 and 15). It is the responsibility of the food industry to ensure the accuracy of labels through good manufacturing practices (GMPs) and allergen control programs, which may be included as part of their hazard analysis and critical control point (HACCP) plans. However, there are situations leading to the inadvertent presence of allergenic material in the final product, in which the allergen is not an intended ingredient. Several practices and potential errors during production may lead to the presence of unexpected allergen in a product: . .
Contaminated ingredients Errors during product formulation
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
175
176 .
. . .
DETECTION OF FOOD ALLERGENS
Cross-contact due to: Improper storage conditions, such as poor segregation plans and handling of ingredients Inadequate production scheduling in shared equipment and rework practices Flawed equipment design, which prevents effective cleaning practices Ineffective cleaning of equipment Improper labeling and packaging
The prevention of cross-contact can be achieved by controlling all these critical points. The use of analytical methods for the detection of food allergens plays an important role in ensuring the absence or inadvertent presence of allergenic ingredients. These methods can be applied not only to the analysis of raw ingredients and final products, but also to ensure the effectiveness of cleaning procedures. Although immunoassays have been the analytical techniques of choice for the detection of food allergens, DNA-based technologies are starting to gain acceptance as alternative or confirmatory methods for food allergens. The implementation of new labeling regulations, the lack of detection methods for some regulated allergens, and the need for confirmatory methods other than immunoassays have lead to the proliferation of DNAbased assays during the last few years. This is an indication that DNA-based analytical tests may have more widespread use in the near future. 9.2 DNA AS A MARKER FOR THE PRESENCE OF ALLERGENIC PROTEINS IN FOOD Because allergenic food proteins are responsible for the sensitization and elicitation of allergic reactions, most detection methods have been based on the detection of these proteins. Alternatively, DNA has been suggested as a target for the detection of allergenic material in food. However, its use has been a controversial topic because the correlation between the presence of allergenic protein and DNA in processed food may not be constant. At least four factors may affect this correlation: 1. Expression of the allergen may be affected by environmental conditions. 2. Food processing may affect protein and DNA in different ways and to different degrees. 3. Protein isolates or protein fractions used to formulate the food product may lack DNA. 4. There may be a matrix effect and interference by other food components. There are a few studies comparing enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) for the detection of the same allergen, showing a generally good correlation for different food matrices (Meyer et al., 1996; Holzhauser et al., 2000, 2002; Dahinden et al., 2001; Stephan and Vieths, 2004; Hirao et al., 2006; Yamakawa et al., 2007; Bettazzi et al., 2008; Demmel et al., 2008;
DNA-BASED TECHNIQUES MOST COMMONLY USED
177
Piknova et al., 2008). Some PCR assays have been reported to be more sensitive than ELISA (Koppel et al., 1998). However, additional studies are needed to determine the applicability of PCR as a primary test or confirmatory tool for ELISA results in specific food matrices. DNA-based assays have major advantages over immunoassays. Immunoassays require the identification and characterization of allergenic proteins to produce allergen-specific antibodies, but this information is not always available. Some ELISA tests, such as commercial kits for peanuts, are based on the detection of multiple proteins by using antibodies obtained by immunizing animals with food extracts that are not fully characterized. The production and characterization of antibodies are time consuming and not all antibodies produced are suitable for an assay application, due to sensitivity and specificity issues. Because DNA-based assays are easier to develop, they can rapidly be adapted to new regulatory requirements, such as the inclusion of new allergens in labeling regulations. In addition, DNA-based techniques may deliver a higher degree of specificity, which is difficult to achieve by immunoassay in case of the detection of certain food groups, such as fish and crustacean species (Brzezinski, 2005). Regulatory agencies do not define the analytical requirements for the detection of food allergen residues in food matrices. Moreover, different countries may differ in their position regarding the use of DNA-based assays as analytical tools for the detection of food allergens. Because of the lack of established safe levels (thresholds), the presence of DNA from an allergenic source may be considered as a marker or indicator of a health hazard, due to the presence of an inadvertent allergenic material in raw ingredients and processed foods, or as an indicator that cleaning procedures for industrial equipment are inadequate (Stephan et al., 2004; Brzezinski, 2006).
9.3 DNA-BASED TECHNIQUES MOST COMMONLY USED FOR THE DETECTION OF FOOD ALLERGENS DNA-based technology is a relatively new use for the detection of food allergens, a field traditionally dominated by immunoassays. DNA assays have been used widely for food authentication, including speciation and for the detection of products of agricultural biotechnology to ensure label accuracy and compliance with regulations. PCR assays developed for food authentication could potentially be used for the detection of food allergens. However, the sensitivity of these methods tends to vary and may, for some purposes, not be sufficiently low [>20 mg/kg (ppm)]. 9.3.1
Polymerase Chain Reaction
Many PCR assays have been published for the detection of allergen residues in crops, raw ingredients, and processed products (Table 9.1). Although the selection of primers and PCR conditions can be optimized as to both specificity and sensitivity, a second step is sometime suggested to confirm specificity of the amplified PCR product because unrelated products with the same base pair size can lead to false positives. To
178
Soybean
1% protein concentrate NR 0.01% soy flour
414 þ 118 343 208
le1 (lectin gene)
trnL (chloroplast tRNA) Gly m Bd 30K
0.001% peanut DNA in wheat DNA samples
PCR þ nested PCR
95
Peanut agglutinin precursor
PCR
Legumes, cakes, hamburgers, sausage
Commercial processed foods Tree nuts, soybean, potato, corn, rice, wheat, meats, fish, commercial foods Processed meat products Soybeans
<10 ppm peanut
86
403
trnL (chloroplast tRNA) ara h 2
PCR
RT-PCR
2 ppm peanut in biscuit
NR a
ara h 2
RT-PCR
NR
Cereals, legumes (soy, lupine), tree nuts, meat, seeds, cookies Tree nuts, meat, fish, seeds, biscuits, chocolate, cake, pastry, sausage Peanut
<2.5 pg peanut DNA or 10 ppm peanut in food
Three primer sets: (a) 78, (b) 105, (c) 114
ara h 3
Food Matrices Tested
RT-PCR (three primer sets)
Sensitivity/LoD
Peanut
Product Size (bp)
Method
Target Gene
Meyer et al. (1996) b James and Schmidt (2004) Torp et al. (2006)
James and Schmidt (2004) Stephan and Vieths (2004) Watanabe et al. (2006)
Hird et al. (2003)
Scaravelli et al. (2008)
Reference
Published DNA-Based Methods for Detection of Food Allergens and Gluten-Containing Cereals Requiring Labeling
Allergen
TABLE 9.1
179
182
152 294 156
82
NR
cor a 1
cor a 1.0401
nad1
cor a 1
cor a 1.04
hsp1
PCR
PCR-ELISA
PCR
PCR-HPLC
RT-PCR
RT-PCR
Hazelnut
129
118
le1
ITS1
RT-PCR
Lupine
118
SIRE-1
13 pg DNA, 0.01% hazelnut in model pastry
0.1 ng DNA
0.001% or 10 ppm in chocolate 5 pg hazelnut DNA
<10 ppm hazelnut
0.001% hazelnut
0.2 wt% soy flour, 1 wt% soy protein isolate 0.1 mg/kg
0.001% soy flour
Breakfast cereals, chocolate, biscuits, snacks Seed, fruits, chocolate, hazelnut creams, biscuits, cornflakes, snacks Confectionery and bakery products
Legumes, cereals, seeds, nuts, spices, fruits, and meat Hazelnut, chocolates, snacks, muesli Food and food ingredients Chocolate
Fish, bread, soymilk, tofu, lecithin, soy sauce, seasoning, biscuits Bread
(continued)
Piknova et al. (2008)
Arlorio et al. (2007)
Holzhauser et al. (2002) Herman et al. (2003) Germini et al. (2005)
Holzhauser et al. (2000)
Demmel et al. (2008)
Gryson et al. (2008)
Yamakawa et al. (2007)
180
matK
PCR þ RFLP
RT-PCR
PCR
Pistachio
1 pg pecan DNA, 0.01% pecan in model pastry
50–100
193
Vicilin-like storage protein
R1,5BP C/O c
<100 mg/kg
1.25 pg cashew DNA, 0.01% cashew in model pastry
2S albumin
RT-PCR
67
0.5 pg or 10 ppm walnut 5 pg cashew DNA, 0.01% cashew in chocolate cookies
0.24 ng walnut DNA, 0.01% walnut in pastry samples
Sensitivity/LoD
67
2S albumin
RT-PCR
Pecan nut
Cashew nut
120
50–100
jur r 2
RT-PCR
Walnut
Product Size (bp)
Method
Allergen
Target Gene
TABLE 9.1 (Continued)
Tree nuts, cereals, potato, cocoa, biscuits, wafers, muesli bars, pastry, cakes Walnut-containing food products Chocolate chip cookies, fruit and nut bars, cereal, crackers, chocolate, granola Tree nuts, cereal flours, cocoa and milk powder, chocolate, breakfast cereals, snacks, biscuits, nougate Pecan, walnut, cereals, flours, potato starch, biscuits, chocolate, praline Mortadella
Food Matrices Tested
Barbieri and Frigeri (2006)
Brezna and Kuchta (2008)
Piknova and Kuchta (2007)
Brzezinski (2006)
Yano et al. (2007)
Brezna et al. (2006)
Reference
181
Triticin precursor
Triticin precursor
PCR
PCR
Nested PCR
RT-PCR
trnL (chloroplast tRNA) Wheat gliadin
PCR
Wheat Rye Barley Oat
16S rRNA gene
PCR-RFLP d
Acetyl-CoA carboxylase RALyase g-Hordein w-Gliadin w-Secalin Hordein Avenin
Parvalbumin
PCR
RT-PCR
5S rDNA NTS
PCR
Wheat Barley
Crustaceans: shrimp, lobster, crab, crawfish Wheat
Fish: Three mackerel species Mackerel
44 73 181 181 164 104
93
141/97 (nested)
141
109
397
Three mackerel species: 359, 359, 311 Three sets of primer: 190, 284, 334 205
Wheat and barley: LOD 1 genome copy, LOQ 10 genome copies For four cereals, LOD; between 5– 50 pg DNA or 0.1–0.01 wt%
NR
0.001–0.1% or 0.04–0.4 mg gliadin/100 g oats 0.005% wheat flour
5 ng mackerel DNA 15–20 ng DNA, <0.1% shrimp in raw pork meat NR
NR
Cereals, flours, bran, crunch, cookies, ice cream, pankcakes
Grains and processed food products Commercial processed foods Cereal flours and cereal-based food products
Oat flake and kernels
Wheat
(continued)
Sandberg et al. (2003)
Hashimoto et al. (2008) Hernandez et al. (2005)
Yamakawa et al. (2007)
James and Schmidt (2004) Koppel et al. (1998)
Choi and Hong (2007) Brzezinski (2005)
Surimi, fish paste Raw pork, shrimp cake
Aranishi and Okimoto (2004)
No food matrix; raw fish
182
Manitol dehydrogenase gene Manitol dehydrogenase gene Manitol dehydrogenase gene
RT-PCR
PCR
Celery
RT-PCR
RT-PCR
sin a 1
ITS1 5.8S rRNA gene ITS1 5.8S rRNA gene api g 1
PCR, RT-PCR
Mustard
TrnL (chloroplast rRNA)
Quantitative Competitive PCR
Wheat Barley Rye Buckwheat
RT-PCR
Target Gene
Method
Allergen
TABLE 9.1 (Continued)
170–180
0.005% (w/w) in spice and flour
1 DNA copy, 5– 10 mg/kg celery seed
101
151
279
145
101
20 pg DNA (wheat), 2 pg DNA (barley, rye) 1 ppm buckwheat (w/w) <10 ppm buckwheat flour 60 pg DNA (root), 30 pg (seed), 250 pg (powder) 490–1530 pg DNA, 0.1% celery in pate model 0.01–0.001% celery powder
Sensitivity/LoD
201 (rye and wheat) 196 (barley) 146
Product Size (bp)
Sausage, seasoning, sauces, bouillon Spice, flour
Meat pâte, seasoning, bouillon Meat, spice, flour, swab test
Rinse solution after cleaning
Buckwheat, wheat
Cereals, bread, baby food
Food Matrices Tested
Mustorp et al. (2008)
Hupfer et al. (2007)
Mustorp et al. (2008)
Dovicovicova et al. (2004)
Stephan et al. (2004)
Hirao et al. (2006)
Hirao et al. (2005)
Dahinden et al. (2001)
Reference
183
Duplex PCR (array)
Hazelnut
50 pg DNA sesame, 0.05% sesame in bread
156 201 156 233
cor a 1.03 cor a 1.04
95
127
141 a
Allergenic storage protein Agglutinin precursor cor a 1.0301 ara h 2
Tricitin precursor
0.3 nmol1 DNA 0.1 nmol1 DNA
50 pg DNA (standard)
NR
b
NR, not reported. Not intended for the detection of food allergens, but adulteration of food with this ingredient. c R1,5 BP CO: ribulose 1,5-biphosphate carboxylase/oxigenase. d Restriction enzymes used on PCR products are used to distinguish shrimp, lobster, crab and crawfish.
a
Duplex PCR (array)
Multiplex PCR
117
Ses i 1
RT-PCR
0.005% (w/w) in spice and flour 5 pg DNA, 50 mg/ kg
Multiplex DNA-Based Assays
66
2S albumin
RT-PCR
64
2S albumin
RT-PCR
Hazelnut Peanut
Peanut
Buckwheat
Wheat
Sesame
Breakfast cereals, snacks, biscuits, chocolate Hazelnut, chocolate, soymilk, biscuits, lecithin
Japanese food products
Breakfast cereals, crackers, chocolate, cookies, fruit bars Chocolate, sesame oil, tahini, snacks, bread
Spice, flour
Bettazzi et al. (2008)
Rossi et al. (2006)
Hashimoto et al. (2007)
Schoringhumer and CichnaMarkl (2007)
Mustorp et al. (2008) Brzezinski (2007)
184
DETECTION OF FOOD ALLERGENS
resolve this issue, several approaches have been applied to the detection of food allergens. Among them: 1. Restriction fragment length polymorphism (RFLP). The amplified product is digested with enzymes at specific nucleotide sites, providing a specific band profile for the target of interest, which differs from potential nonspecific amplified products. However, this confirmation assay is not practical for routine analysis since it is time consuming. Another application of PCR-RFLP is focused on speciation within food groups, such as tree nuts, fish, and crustaceans. The restriction enzyme Bfa1 allows discrimination between walnut and pecan (Yano et al., 2007). PCR-RFLP has also been developed to determine the source of crustaceans (shrimp, lobster, crab, crawfish) after PCR amplification of the 16S rRNA gene (Brzezinski, 2005). 2. Nested PCR. A second amplification takes place using a new set of primers that anneal within PCR products obtained from the first amplification. In seminested PCR, the second amplification is carried out by using one of the two primers from the first amplification and a second one that anneal somewhere in the middle of the PCR product. A nested PCR method has been reported for the detection of soy in processed foods (Meyer et al., 1996). However, the low sensitivity of this method (0.5% soybean) is not sufficient to determine adventitious allergens in food products. 3. Hybridization with a labeled probe. Another option to confirm PCR specificity is to transfer PCR products to a membrane and hybridize these products with a labeled probe complementary to the sequence of interest within the PCR product. 4. PCR product sequencing. The sequence of nucleotides of the amplified product is determined by sequencing. This is a step useful for the characterization of the PCR product in assay development, but it is not practical for screening purposes. 5. PCR coupled with peptide nucleic acid and analyzed by anion-exchange highperformance liquid chromatography (HPLC) with a fluorescence detector. This method was developed originally for the analysis of bioengineered organisms (Lesignoli et al., 2001). HPLC analysis with a specific probe for hazelnut has been developed successfully to confirm the sequence of the PCR amplicon (Germini et al., 2005). This method can be used for confirmation purposes, but it is not practical for use in routine screening because it is time consuming and rather complex. 9.3.2
Real-Time PCR
The advantage of real-time PCR over traditional PCR is the ability to quantify DNA content in the sample. It provides a higher degree of specificity given by a fluorescent probe which anneal in the sequence flanked by the two primers. It also reduces interferences due to the formation of primer dimers and nonspecific products (Brzezinski, 2006). RT-PCR is less prone to contamination and is suitable for automation. Numerous assays based on RT-PCR have been developed for the detection of traces of food allergens in raw materials and processed foods (Table 9.1).
185
DNA-BASED TECHNIQUES MOST COMMONLY USED
DNA purification
PCR
PCR STEP
ELISA STEP P
PCR product binding to plate
PCR product denaturation
FIGURE 9.1
9.3.3
P
Hybridization Binding to to specific enzymeDNA probe conjugated Ab
P
P
Reaction visualization
Steps in PCR-ELISA analysis.
PCR-ELISA
PCR-ELISA is a hybrid assay combining PCR as a first step and using ELISA as a detection system for the amplicons (Figure 9.1). The PCR step produces biotinylated amplicons that are bound further to a streptavidin-coated microtiter plate. The amplicons are denatured to produce single-stranded PCR products, and only the biotinylated strand stays in the well of the microtiter plate. A FITC-labeled probe is bound to the PCR strand, a step that adds an extra level of specificity to the assay. An enzyme-labeled anti-FITC antibody is used to produce a colorimetric signal that can be measured by an ELISA reader. This method has been applied successfully to the detection of <10 ppm hazelnut in processed foods and food ingredients, which eliminated the potential for cross-reactivity observed in ELISA (Holzhauser et al., 2002). 9.3.4
Multiplexing
New trends in the analysis of food contaminants in general focus on the simultaneous detection of different analytes present in the same sample. A multiplex PCR assay has been developed for the simultaneous detection of wheat, buckwheat, and peanut (Hashimoto et al., 2007). A distinct amplicon size for each allergen can be observed in an agarose gel. Since some RT-PCR thermocyclers have the ability to detect several fluorescent probes, they can easily be adapted to detect several food allergens simultaneously. Moreover, other platforms commonly used for multiplexing can be used in combination with PCR. Microarray slides can be spotted with peptide nucleic acid (PNA) capture probes for PCR products obtained from the amplification of DNA
186
DETECTION OF FOOD ALLERGENS
from allergenic material in food. A duplex array has been developed to detect peanuts and hazelnuts present in food samples using this technology (Rossi et al., 2006). An electrochemical DNA array has been reported for the detection of hazelnut (Bettazzi et al., 2008). Although it has been designed for the detection of a single food allergen, it targets two different genes, corresponding to two different isoforms of the major hazelnut allergen, Cor a 1 (Cor a 1.04 and Cor a 1.03). Although the last two examples are based on low-density DNA arrays, they can be adapted to detect many different allergens simultaneously. Ligation-dependent probe amplification (LPA) is another DNA-based assay where ligation probes bind and are ligated, resulting in ligation products of specific size for specific target DNA. The 50 and 30 ends of the ligation product contain a common sequence used as targets for a common set of primers for a further PCR amplification of the ligation product. This technique has been used successfully for the screening of multiple bioengineered products within the same reaction (Moreano et al., 2006; Ehlert et al., 2008). Detection of amplicons is carried out by capillary electrophoresis. 9.3.5
Biosensor Technology
The detection of allergenic material in foods by using biosensor technology has been limited to a few antibody-based applications (Mohammed et al., 2001; Lu et al., 2004; Yman et al., 2006; Hohensinner et al., 2007; Maier et al., 2008). However, it has the potential to be developed for DNA or PCR product detection. In a biosensor, the interaction between the target and the capture component, which is immobilized on a chip, can be visualized in real time. There is no need for labels since the interactions are measured by changes in the physical properties of the system. For example, surface plasmon resonance (SPR) biosensors measure changes in the refractive index when the interaction between the target molecule and the capture component takes place. A genosensor based on electrochemical principles has been developed for the detection of PCR products resulting from amplification of the genes corresponding to the major hazelnut allergen isoforms, Cor a 1.03 and Cor a 1.04 (Bettazzi et al., 2008). This device has several advantages, including portability, cost effectiveness, and disposability.
9.4 TARGETS IN THE DETECTION OF FOOD ALLERGENS: ASSAY SPECIFICITY Multiple approaches have been addressed and reported regarding the target DNA sequence used in DNA-based methods for the detection of allergens. As mentioned above, DNA could be used as a marker for the presence of food allergens, but it may not necessarily correlate with the concentration of allergen in the food sample. Regardless of the set of the target DNA sequence, the assay has to ensure specificity and enough sensitivity to guarantee the detection of the target in highly processed food. Several approaches are used to detect the offending allergenic commodity based on the type of target gene (see Table 9.1): either allergen-encoding genes or non-allergen-encoding
FACTORS AFFECTING ASSAY PERFORMANCE
187
genes. Within the latter group, potential target genes can be located in the genomic DNA or in nongenomic DNA such as that present in mitochondria or chloroplasts. The proper selection of primers and probes should minimize the potential for crossreactivity, which is a special concern between taxonomically related species, due to the high degree of sequence homology across species. A PCR assay developed to detect celery allergen api g 1 (Stephan et al., 2004) has been shown to cross-react with carrot genes (Mustorp et al., 2008). The mustard allergen gene sinA shares a high degree of homology with storage proteins from other Brassica species, resulting in cross-reactivity to radish, broccoli, Rutabaga, Chinese cabbage, and cabbage (Poms et al., 2004; Mustorp et al., 2008). DNA is not tissue specific (i.e., the same DNA sequence is present in all cells of the same organism, resulting in the impossibility of distinguishing egg from other chicken parts and milk from cattle products, including meat and entrails used as ingredients in product formulations. Additional limitations to the analysis of egg and milk by DNAbased assays are discussed in Section 9.5.5.
9.5
FACTORS AFFECTING ASSAY PERFORMANCE
Several factors affect the performance of DNA-based assays. They need to be evaluated carefully before and during the design and development of the assay. Assay performance relies on DNA integrity, DNA quality, DNA quantity and recovery, and the presence of assay inhibitors or interfering compounds. 9.5.1
Effect of Food Processing on DNA Integrity
Although DNA is a very stable molecule, it is known that food processing may affect its integrity, resulting in degradation of the molecule to different degrees, depending on the type and conditions of food manufacturing. The degree of DNA degradation is visualized as a smear using gel electrophoresis due to the presence of DNA fragments of different length. For example, most of the DNA fragments isolated from dough and baked bread range between 100 and 1000 bp (Gryson et al., 2008). The importance of understanding the effects of food processing on DNA integrity is critical for the implementation of DNA-based assays (Murray et al., 2007). Food processes such as heating, extrusion at high temperature, acidification, and fermentation, just to name a few, are industrial activities responsible for DNA degradation and a lower degree of recoverable DNA. Gryson et al. (2008) reported that the amount of DNA in full-fat soybean flour was estimated to be 353 ng/mL, 866 ng/mL in defatted soybean flour, 72 ng/mL in toasted soybean flour, and 144 ng/mL in soy protein isolate. Because of DNA fragmentation during processing, amplification of large DNA regions have a higher probability of being compromised (Bauer et al., 2003; Tilley, 2004). DNA of soy protein isolates and soy concentrates has been shown to be degraded to fragment sizes ranging from 100 to 400 bp (Meyer et al., 1996). PCR designed to detect soybean in processed foods failed to detect soy residue in highly processed foods, including tofu and seasoning containing hydrolyzed soy protein
188
DETECTION OF FOOD ALLERGENS
(Yamakawa et al., 2007). The average DNA size extracted from bread is around 300 bp (Allmann et al., 1992). To overcome this problem partially, the design of PCR for the detection of allergen residues in food should be based on the amplification of smaller DNA regions without compromising the specificity and sensitivity of the method. Watanabe et al. (2007) developed a PCR for the determination of peanut. The 95-bp product was amplified from food sources containing boiled, roasted, and autoclaved peanuts. However, in some products the degree of degradation is such that amplification cannot be observed. This was the case with breakfast cereal samples (Germini et al., 2005). Similarly, sesame could not be detected in this type of product (Brzezinski, 2007). It was estimated that only 10 to 20% of DNA was extracted compared to other products tested, such as wheat crackers and granola bars. 9.5.2
PCR Inhibitors
The presence of specific compounds coextracted with DNA from food samples can partially or totally inhibit the PCR or RT-PCR assay, leading to reduced sensitivity, inaccurate quantification, and false negatives. Among the potential inhibitors from both plant and animal sources, only a few are known to be responsible for an inhibitory effect on the assay. Some known inhibitors are polysaccharides and polyphenolics common in plant sources, such as cocoa, proteins (Rossen et al., 1992; Sejalon-Delmas et al., 2000; Tengel et al., 2001; Germini et al., 2005; Di Pinto et al., 2007), and hemoglobin (Ruano et al., 1992). Oil and fats, common components of many food ingredients and food products, are known to inhibit DNA polymerases (Arlorio et al., 2007). The Swiss Official Methods Book lists the levels at which different components from food inhibit PCR reactions (www.bag-anw.admin.ch/ SLMB_Online_PDF/Data%20SLMB_MSDA/Version%20D/52B_Molekularbiol.% 20Methoden.pdf). PCR inhibitors can be removed during DNA extraction and purification. As a control measure to confirm the presence or absence of inhibitory compounds, blank samples are analyzed with or without a DNA spike. 9.5.3
Recovery of DNA from Food Matrices and DNA Quality
The achievement of a successful analysis depends not only on optimized analytical procedures but also on (1) the ability of the extraction procedure to recover DNA from the sample and to remove potential assay inhibitors, and (2) the quality and purity of the DNA extracted. The analytical technique is useless if the target cannot be extracted from the sample. At this point in time there are no standardized procedures for the extraction of DNA from food samples. The development of DNA extraction procedures is matrix dependent. High fat content and low dry matter seem to explain the decreased extraction efficiency of full-fat soybean flour compared to its defatted counterpart (Gryson et al., 2008). Traditionally, the extraction of DNA has been carried out by treating the sample with detergents such as sodium dodecyl sulfate and proteinases such as proteinase K, followed by the removal of proteins and polysaccharides with phenol–chloroform and precipitation of DNA with ethanol.
FACTORS AFFECTING ASSAY PERFORMANCE
189
However, this protocol uses hazardous reagents (phenol–chloroform) and is time consuming, which is impractical for routine analysis. Commercial kits are available for the extraction of DNA, but their use with processed foods needs to be evaluated and adapted to the matrix (Germini et al., 2005; Rossi et al., 2006). Most commercial DNA purification kits are designed to extract and isolate DNA from raw materials such as plants or tissue. Two different commercial DNA purification methods based on the use of silica as an affinity matrix and magnetic “mobile solid phase” have been compared in terms of extraction efficiency, DNA purity, and sensitivity in different food matrices (Di Pinto et al., 2007). The method, based on a magnetic-based purification, was proved more efficient and sensitive in the isolation of DNA from vegetable sources, probably due to its ability to remove inhibitors such as polysaccharides and polyphenols. The extraction procedure for the second kit, in column format, was modified and resulted in more efficient extraction of DNA from complex food samples, including dumplings, a chocolate snack, a vegetable bouillon cube, and cherry jam. Hird et al. (2003) also evaluated the use of a commercial DNA extraction kits based on different technological strategies to extract DNA from diverse matrices, including nuts, meat tissue, fish tissue, dry seeds, and plant tissue. Arlorio et al. (2007) evaluated the ability of different commercial extraction kits to extract high-quality hazelnut DNA in relation to traditional phenol– chloroform extraction. They reported that a paramagnetic capture–based DNA purification kit (Wizard Magnetic DNA, Promega) was the most efficient procedure in their study, yielding high-quality DNA from hazelnut and processed foods, including chocolate and hazelnut creams. This method has been designed to purify DNA from fatty foods. However, it requires the extraction of a large sample and the use of organic solvent. Similar DNA extraction efficiencies were found between this kit and SureFood PREP Allergen (Congen, R-Biopharm) when applied to food samples, including chocolate, biscuit, and lecithin, among others, and used to determine hazelnut by PCR (Bettazzi et al., 2008). An extensive evaluation of 15 different DNA extraction procedures were used, including modified and unmodified commercial assays and traditional extraction protocols, or a combination of both (Scaravelli et al., 2008). Parameters assessed included DNA yield and quality of DNA from raw and roasted peanuts. A combination of a traditional DNA extraction method followed by a further DNA purification with the Wizard DNA cleanup system (Promega) was chosen among the 15 procedures tested. DNA purity has traditionally been measured using the ratio between the absorbances 280 nm (A280), which is used to evaluate the protein contamination coextracted along with DNA, and 260 nm (A260), used to estimate the DNA concentration. Several published PCR assays for food allergens have described the use of this method. The ratio can be reported as A260/A280, where the higher the resulting ratio, the better the DNA quality. Bettazzi et al. (2008) developed a PCR assay for the detection of hazelnut in food and they reported purity values (A260/A280) for DNA extracted from hazelnut, chocolate, soymilk, biscuits, and soy lecithin supplements. Schoringhumer and Cichna-Markl (2007) used the ratio A280/A260 (the lower the ratio value, the better) to determine DNA purity to be used in PCR assay for sesame residue. Ratio values <1.7 were reported for sesame oil and tahini. However, use of a method based
190
DETECTION OF FOOD ALLERGENS
on an absorbance ratio does not indicate fragmentation and nucleolysis, and it also measures compounds coeluted during DNA purification; therefore, ultraviolet absorbance is not a suitable technique to determine DNA purity from food (Olexova et al., 2004). Fluorometric methods are not suitable either because they do not provide information on the potential presence of PCR inhibitors. The best methods to assess DNA quality and the concentration of amplifiable DNA isolated from food samples are the evaluation of DNA size distribution on agarose gel and the maximum DNA dilution that can be amplified by PCR (Olexova et al., 2004). 9.5.4
Assay Sensitivity
The initial concentration of target DNA in the sample limits assay sensitivity. Assay sensitivity can be achieved by optimizing a combination of factors, including: . . . .
Selection of a proper set of primers and DNA probes Reagent concentrations Extraction of quality DNA, concentration of DNA per reaction, and elimination of PCR inhibitors PCR conditions such as time, temperatures, and number of cycles
Most recently, DNA-based assays have been designed and developed to detect a few micrograms of allergenic material per gram of food (low ppm levels), the same sensitivity range achieved by ELISA. Many PCR-based assays are able to detect fewer than 10 DNA copies or low picograms of DNA (Table 9.1). A PCR assay for buckwheat has been reported to have a limit of detection (LOD) of 1 ppm (w/w) (Hirao et al., 2005). An RT-PCR developed to determine celery content in processed foods has been reported to have an LOD of 5 to 10 ppm in emulsion-type sausage, which is a complex fatty food matrix (Hupfer et al., 2007). The sensitivity of a PCR for the detection of hazelnut in chocolate samples could be lowered to 10 ppm by increasing the concentration of MgCl2 in the reaction buffer (Herman et al., 2003). 9.5.5
Other Considerations
Amplification Control To ensure the extraction of DNA from foods, mainly from highly processed products and the presence or absence of PCR inhibitors, many assays for food allergens include a universal eukaryotic primer pair (Brezna et al., 2006a, b; Brezna and Kuchta, 2008) or plant-specific primer pair used to amplify the noncoding region of chloroplast (Rossi et al., 2006; Watanabe et al., 2007; Yamakawa et al., 2007; Yano et al., 2007). Concentration of Target DNA A minimum concentration of DNA is required to provide a successful amplification and to achieve the sensitivity desired. Positive PCR results for food allergens have been
FACTORS AFFECTING ASSAY PERFORMANCE
191
reported in samples containing as little as one copy of the hazelnut Cor a 1.0104 gene (Holzhauser et al., 2002), although the minimum number of target DNA copies required for a successful amplification usually ranges between 5 and 50. Because the concentration of DNA in egg, milk, vegetable oils, and animal fats is low, use of PCR for the detection of these allergenic foods is rather limited (Holzhauser et al., 2006). Quantification RT-PCR is, in principle, a quantitative technique. However, because this technique is dependent on matrix effect and type of food processing, true quantification should require the use of a specific calibration curve for each type of food product (Brezna et al., 2006a). Quantification of food allergens is not free of issues and controversy. Potential quantification problems can be extrapolated from the analysis of products derived from agricultural biotechnology, which has been studied more extensively. Accurate quantification depends on factors such as the effect of food processing on DNA integrity, sample particle size, food composition and physical properties, extraction procedure, quantification method, recovery estimation, and reference material (Popping, 2006). Currently, there are no thresholds or limits of tolerance established for food allergens, but as they become enforced, limitations related to the quantification aspect of current detection methods for food allergens may affect the choice of assay. Minimization of Errors and Assay Variability An improper manipulation of samples, reagents, containers, and tubes containing PCR products can lead to errors in sensitivity, quantification, false positives, and false negatives: 1. PCR reactions are carried out using low reagent volumes (in the low- microliter range). Pipetting errors have a negative impact on the sensitivity and quantification aspects of the assay (Brzezinski, 2006). The preparation of a master mix that includes all reagents but the DNA sample minimizes variation, due to improper pipetting and excessive manipulation of reagents. 2. False positives are generally due to DNA contamination carryover from samples or as a result of improper manipulation of vials containing PCR products. Preventive measures can be as simple as implementing the use of single-use materials. More complex solutions involve facility infrastructure by limiting certain activities to dedicated laboratories. For example, sample preparation should be carried out in a lab different from that dedicated to the amplification procedure. A measure to prevent carryover is to use dUTP instead of dTTP in the PCR reaction mix (Longo et al., 1990). To prevent the effects of PCR product contamination in subsequent samples, the use of uracyl DNA glycosylase will remove carryover PCR products containing uracil prior to the PCR reaction. 3. False negatives are not only due to the presence of inhibitors coextracted with DNA from the food sample, but also to poorly controlled assay conditions,
192
DETECTION OF FOOD ALLERGENS
contaminants in reagents and containers, contamination during sample preparation (Wilson, 1997), the use of expired reagents, and faulty reagent preparation. There are other sources of variability related to sampling procedures and assay design that can be minimized to some extent: 1. Sample size, particle size, and sample homogeneity are the most important sources of variation in food analysis. The establishment of a proper sampling plan is complex, and it may be limited by sample availability, the type of food product, and processing activities. Food allergens can be distributed in the product heterogeneously, due to contamination at different points of production and also due to product design, such as products containing different layers of ingredients (e.g., chocolate-covered cookies). Moreover, even if the target is distributed homogeneously, processing may affect the target integrity differently, depending on where the target is located (surface vs. interior of the product) and the degree of processing. It has been shown that samples collected from different locations of bread containing soy ingredients may alter the outcome of the PCR result (Gryson et al., 2008). Therefore, proper sampling and sample preparation strategies have to be in place to minimize errors caused by sample heterogeneity. 2. There are other approaches that could help minimize analysis errors. A RTPCR has been developed to detect buckwheat in which an internal standard control is used to compensate for the variability resulting from extraction and amplification efficiencies, as well as for variability due to diversity of sample matrices (Hirao et al., 2006). 3. Depending on the food matrix, multiplex DNA can show some discrepancies in the detection of different allergenic targets, due to differential efficiency of the amplification process. This issue has been shown in the case of the determination of the hazelnut allergen isoforms Cor a 1.03 and Cor a 1.04 in some matrices, including dark chocolate, soy milk, lecithin supplement, and snack muesli (Bettazzi et al., 2008). For this reason, multiplex assays must be evaluated carefully during and after development, to reduce inconsistent results.
9.6
VALIDATION OF DNA-BASED ASSAYS
There are no standardized validation protocols for DNA-based assays as applied to the detection of food allergens. In principle, guidelines used for the validation of products derived from agriculture biotechnology could be adopted. However, one major obstacle that challenges the validation of DNA-based assays for food allergens with respect to bioengineered crops is the availability of the proper reference material needed to prove the applicability of the detection method to real food matrices (Hupfer et al., 2007). Mustorp et al. (2008) validated three different RT-PCR assays for the detection of celery, mustard, and sesame, based on the guideline developed
COMMERCIAL ASSAYS
193
by the European Network of GMO Laboratories (ENGL), “Definition of performance requirements for analytical methods of GMO testing” (gmo-crl.jrc.it). Another RT-PCR for the detection of celery in food has also been validated using the ENGL guideline as a reference (Hupfer et al., 2007). This guideline provides information on: .
.
Phase 1: method acceptance criteria, including the following aspects: applicability, practicability, specificity, dynamic range, accuracy, amplification efficiency, r2 coefficient of the standard curve, repeatability standard deviation (RSDr), limit of detection (LOD), limit of quantitation (LOQ), and robustness. Phase 2: evaluation of validation results, which include the following method performance requirements: dynamic range, RSDr, and trueness.
A qualitative PCR assay was developed for the detection of peanut in foods and validated further with the collaboration of six participant laboratories (Watanabe et al., 2007). Autoclaved, roasted, boiled, and nonprocessed doughs made out of Japanese yam spiked with different levels of defatted peanut flour (0, 0.001, 0.01, 0.1%) were used as food models. Results were compared with ELISA, which showed decreased protein levels in the processed food models, especially in the autoclaved dough. No protein was detected in all of the nonspiked dough. PCR results from the six labs correctly identified dough samples (processed and nonprocessed), which correlated with results obtained from ELISA analysis. The assay was shown to be specific, reproducible, reliable, and applicable for the detection of peanut in the model processed food. 9.7
COMMERCIAL ASSAYS
There is a wide selection of commercial ELISA kits available from different companies. However, the number of companies offering PCR kits is rather limited, probably because its use for the detection of food allergens is not as widely accepted. SureFood products are offered by R-Biopharm (www.r-biopharm.com) and BioKits products are sold by Tepnel BioSystems (www.tepnel.com). Commercial DNA-based methods include both PCR and RT-PCR used as qualitative tests. All the kits have LOD values around or below 10 ppm allergenic food in the sample, although this value is matrix dependent. One company sells RT-PCR kits for peanut, soy, lupine, almond, hazelnut, walnut, crustaceans, mollusks, sesame, celery, mustard, and gluten-containing cereals (wheat, rye, barley, and kamut). The kits used for a collective group of allergens provide positive results across the different species belonging to the group. For example, the kit for fish is able to detect a large number of commercial fish species, and the kit for mollusks allows the detection of snails, mussels, and cephalopods. However, these kits are not designed to identify individual species.
194
DETECTION OF FOOD ALLERGENS
The same company has reported that coakroaches cross-react 100% with the kit for crustaceans. This is a known problem because of the high degree of homology tropomyosin across crustacean species. It is more likely that potential contamination with these insects occurs in crops during growing, harvesting, transportation, and storage, while contamination in the manufacturing facility and analytical labs should be minimal if proper disinfestation programs are in place. This company’s kit for walnut also gives positive results for pecan, which are two closely related tree nuts. The other company has three commercial PCR kits specific for peanut, soy lectin, and beef (as a marker for milk and casein). The soy kit was shown to be 1000 times more than its commercial ELISA counterpart. DNA extraction and purification are carried out by using proprietary procedures, which in the case of this company include the use of magnetic separation. Kit manufacturers provide instructions on measures used to prevent and monitor potential issues during sample preparation and analysis. To prevent carryover contamination, one of the companies recommends the use of separate areas for DNA preparation, reaction setup, and amplification, encouraging that manipulation of PCR products never be performed in the PCR setup or DNA extraction dedicated labs. Also, this kit includes dUTP instead of dTTP, which allows the use of uracil N-glycosylate to prevent PCR product carryover contamination (see Section 9.5.5). Not all laboratories or food industries have facilities designed with the capability to do molecular biology work, including PCR and RT-PCR. But they can send samples to private laboratories offering food allergen testing.
9.8
CONCLUSIONS
The detection of food allergens in food ingredients and processed products can be a very challenging task. The reasons include the effect of food processing on the integrity of the target, and the wide variety of matrices and manufacturing processes. Both immunoassays and DNA-based assays have advantages and limitations. Although immunoassays are preferred because they target the actual allergenic protein, DNAbased assays have been proved to be useful tools by targeting DNA as a marker for the presence of the allergenic component. Especially in view of legislation, where typically not the allergen but the food as a whole (i.e., soy, peanut, walnut, etc.) is targeted by labeling, the presence of DNA could also serve for this purpose. DNAbased assays can not only be used to confirm ELISA results but can also be used for the detection of food allergens for which no immunoassays are available. PCR and RT-PCR are also useful for the detection and identification of individual species within collective allergen groups, such as fish and crustacean shellfish, which is more difficult to achieve by ELISA. It is very likely that DNA-based assays gain even more support in the near future not only because of their ability to determine allergenic ingredients in foods, but also because they are easy to develop and are more easily automated than ELISA. Therefore, a DNA-based assay may be more suitable for use as a high-throughput method and also has a better potential for multiplexing than does ELISA.
REFERENCES
195
REFERENCES Allmann M, Candrian U, L€uthy J (1992). Detection of wheat contamination in dietary non-wheat products by PCR. Lancet, 339(8788):309. Aranishi F, Okimoto T (2004). PCR-based detection of allergenic mackerel ingredients in seafood. J. Genet., 83(2):193–195. Arlorio M, Cereti E, Coisson JD, Travaglia F, Martelli A (2007). Detection of hazelnut (Corylus spp.) in processed foods using real-time PCR. Food Control, 18:140–148. Barbieri G, Frigeri G (2006). Identification of hidden allergens: detection of pistachio traces in mortadella. Food Addit. Contam., 23(12):1260–1264. Bauer T, Weller P, Hammes WP, Hertel C (2003). The effect of processing parameters on DNA degradation in food. Eur. Food Res. Technol., 217:338–343. Bettazzi F, Lucarelli F, Palchetti I, Berti F, Marrazza G, Mascini M (2008). Disposable electrochemical DNA-array for PCR amplified detection of hazelnut allergens in foodstuffs. Anal. Chim. Acta, 614(1):93–102. Brezna B, Kuchta T (2008). A novel real-time polymerase chain reaction method for the detection of pecan nuts in food. Eur. Food Res. Technol., 226(5):1113–1118. Brezna B, Hudecova L, Kuchta T (2006a). Detection of pea in food by real-time polymerase chain reaction (PCR). Food Res. Technol., 222:600–603. Brezna B, Hudecova L, Kuchta T (2006b). A novel real-time polymerase chain reaction (PCR) method for the detection of walnuts in food. Eur. Food Res. Technol., 223:373–377. Brzezinski JL (2005). Detection of crustacean DNA and species identification using a PCR– restriction fragment length polymorphism method. J. Food Prot., 68(9):1866–1873. Brzezinski JL (2006). Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method. J. AOAC Int., 89(4):1035–1038. Brzezinski JL (2007). Detection of sesame seed DNA in foods using real-time PCR. J. Food Prot., 70(4):1033–1036. Choi KY, Hong KW (2007). Genomic DNA sequence of mackerel parvalbumin and PCR test for rapid detection of allergenic mackerel ingredients in food. Food Sci. Biotechnol., 16 (1):67–70. Dahinden I, von Buren M, L€uthy J (2001). A quantitative competitive PCR system to detect contamination of wheat, barley or rye in gluten-free food for coeliac patients. Eur. Food Res. Technol., 212:228–233. Demmel A, Hupfer C, Ilg Hampe E, Busch U, Engel KH (2008). Development of a real-time PCR for the detection of lupine DNA (Lupinus species) in foods. J. Agric. Food Chem., 56 (12):4328–4332. Di Pinto A, Forte VT, Guastadisegni MC, Martino C, Schena FP, Tantillo G (2007). A comparison of DNA extraction methods for food analysis. Food Control, 18:76–80. Dovicovicova L, Olexova L, Pangallo D, Siekel P, Kuchta T (2004). Polymerase chain reaction (PCR) for the detection of celery (Apium graveolens) in food. Eur. Food Res. Technol., 218 (5):493–495. Ehlert A, Moreano F, Busch U, Engel KH (2008). Development of a modular system for detection of genetically modified organisms in food based on ligation-dependent probe amplification. Eur. Food Res. Technol., 227:805–812.
196
DETECTION OF FOOD ALLERGENS
Germini A, Scaravelli E, Lesignoli F, Sforza S, Corradini R, Marchelli R (2005). Polymerase chain reaction coupled with peptide nucleic acid high-performance liquid chromatography for the sensitive detection of traces of potentially allergenic hazelnut in foodstuffs. Eur. Food Res. Technol., 220:619–624. Gryson N, Messens K, Dewettinck K (2008). PCR detection of soy ingredients in bread. Eur. Food Res. Technol., 227:345–351. Hashimoto H, Makabe Y, Hasegawa Y, Sajiki J, Miyamoto F (2007). [Detection of allergenic substances in foods by a multiplex PCR method]. Shokuhin Eiseigaku Zasshi, 48(5):132– 138. Hashimoto H, Makabe Y, Hasegawa Y, Sajiki J, Miyamoto F (2008). Detection of wheat as an allergenic substance in food by a nested PCR method. J. Food Hyg. Soc. Jpn., 49(1):23–30. Herman L, de Block J, Viane R (2003). Detection of hazelnut DNA traces in chocolate by PCR. Int. J. Food Sci. Technol., 38:633–640. Hernandez M, Esteve T, Pla M (2005). Real-time polymerase chain reaction based assays for quantitative detection of barley, rice, sunflower, and wheat. J. Agric. Food Chem., 53 (18):7003–7009. Hirao T, Imai S, Sawada H, Shiomi N, Hachimura S, Kato H (2005). PCR method for detecting trace amounts of buckwheat (Fagopyrum spp.) in food. Biosci. Biotechnol. Biochem., 69 (4):724–731. Hirao T, Hiramoto M, Imai S, Kato H (2006). A novel PCR method for quantification of buckwheat by using a unique internal standard material. J. Food Prot., 69(10):2478–2486. Hird H, Lloyd J, Goodier R, Brown J, Reece P (2003). Detection of peanut using real-time polymerase chain reaction. Eur. Food Res. Technol., 217:265–268. Hohensinner V, Maier I, Pittner F (2007). A “gold cluster-linked immunosorbent assay”: optical near-field biosensor chip for the detection of allergenic beta-lactoglobulin in processed milk matrices. J. Biotechnol., 130(4):385–388. Holzhauser T, Wangorsch A, Vieths S (2000). Polymerase chain reaction (PCR) for the detection of potentially allergenic hazelnut residues in complex food matrixes. Eur. Food Res. Technol., 211:360–365. Holzhauser T, Stephan O, Vieths S (2002). Detection of potentially allergenic hazelnut (Corylus avellana) residues in food: a comparative study with DNA PCR-ELISA and protein sandwich–ELISA. J. Agric. Food Chem., 50(21):5808–5815. Holzhauser T, Stephan O, Vieths S (2006). Polymerase chain reaction (PCR) methods for the detection of allergenic foods. In Koppelman SJ, Hefle SL (eds. ), Detecting Allergens in Food. CRC Press, Boca Raton, FL, pp. 125–143. Hupfer C, Waiblinger HU, Busch U (2007). Development and validation of a real-time PCR detection method for celery in food. Eur. Food Res. Technol., 225:329–335. James D, Schmidt AM (2004). Use of an intron region of a chloroplast tRNA gene (trnL) as a target for PCR identtification of specific food crops including sources of potencial allergens. Food Res. Int., 37:395–402. Koppel E, Stadler M, L€uthy J, H€ubner P (1998). Detection of wheat contamination in oats by polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). Z Lebensm. Unters. Forsch. A, 206:399–403. Lesignoli E, Germini A, Corradini R, et al. (2001). Recognition and strand displacement of DNA oligonucleotides by peptide nucleic acids (PNAs). High-performance ion-exchange chromatographic analysis. J. Chromatogr. A, 922(1–2):177–185.
REFERENCES
197
Longo MC, Berninger MS, Hartley JL (1990). Use of uracil DNA glycosylase to control carryover contamination in polymerase chain reactions. Gene, 93:125–128. Lu Y, Ohshima T, Ushio H (2004). Rapid detection of fish major allergen parvalbumin by surface plasmon resonance biosensor. J. Food Sci., 69(8):652–658. Maier I, Morgan MR, Lindner W, Pittner F (2008). Optical resonance-enhanced absorptionbased near-field immunochip biosensor for allergen detection. Anal. Chem., 80(8):2694– 2703. Meyer R, Chardonnens F, H€ubner P, L€uthy J (1996). Polymerase chain reaction (PCR) in the quality and safety assurance of food: detection of soya in processed meat products. Z. Lebensm. Unters. Forsch., 203(4):339–344. Mohammed I, Mullett WM, Lai EPC, Yeung JM (2001). Is biosensor a viable method for food allergen detection? Anal. Chim. Acta, 444(1):97–102. Moreano F, Ehlert A, Busch U, Engel KH (2006). Ligation-dependent probe amplification for the simultaneous event-specific detection and relative quantification of DNA from two genetically modified organisms. Eur. Food Res. Technol., 222:479–485. Murray SR, Butler RC, Hardacre AK, Timmerman-Vaughan GM (2007). Use of quantitative real-time PCR to estimate maize endogenous DNA degradation after cooking and extrusion or in food products. J. Agric. Food Chem., 55(6):2231–2239. Mustorp S, Engdahl-Axelsson C, Svensson U, Holck A (2008). Detection of celery (Apium graveolens), mustard (Sinapis alba, Brassica juncea, Brassica nigra) and sesame (Sesamum indicum) in food by real-time PCR. Eur. Food Res. Technol., 226(4):771–778. Olexova L, Dovicovicova L, Kuchta T (2004). Comparison of three types of methods for the isolation of DNA from flours, biscuits and instant paps. Eur. Food Res. Technol., 218:390– 393. Piknova L, Kuchta T (2007). Detection of cashew nuts in food by real-time polymerase chain reaction. J. Food Nutr. Res., 46(3):101–104. Piknova L, Pangallo D, Kuchta T (2008). A novel real-time polymerase chain reaction (PCR) method for the detection of hazelnut in foods. Eur. Food Res. Technol., 226(5):1155–1158. Poms RE, Anklam E, Kuhn M (2004). Polymerase chain reaction techniques for food allergen detection. J. AOAC Int., 87(6):1391–1397. Popping B (2006). Can legal limits for GMO be enforced? Accred. Qual. Assurance, 11 (1–2):89–93. Rossen L, Norskov P, Holmstrom K, Rasmussen OF (1992). Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int. J. Food Microbiol., 17(1):37–45. Rossi S, Scaravelli E, Germini A, Corradini R, Fogher C, Marchelli R (2006). A PNA-array platform for the detection of hidden allergens in foodstuffs. Eur. Food Res. Technol., 223:1–6. Ruano G, Pagliaro EM, Schwartz TR, et al. (1992). Heat-soaked PCR: an efficient method for DNA amplification with applications to forensic analysis. Biotechniques, 13(2):266–274. Sandberg M, Lundberg L, Ferm M, Malmheden Yman I (2003). Real Time PCR for the detection and discrimination of cereal contamination in gluten free foods. Eur. Food Res. Technol., 217:344–349. Scaravelli E, Brohee M, Marchelli R, van Hengel AJ (2008). Development of three real-time PCR assays to detect peanut allergen residue in processed food products. Eur. Food Res. Technol., 227(3):857–869.
198
DETECTION OF FOOD ALLERGENS
Schoringhumer K, Cichna-Markl M (2007). Development of a real-time PCR method to detect potentially allergenic sesame (Sesamum indicum) in food. J. Agric. Food Chem., 55 (26):10540–10547. Sejalon-Delmas N, Roux C, Martins M, Kulifaj M, Becard G, Dargent R (2000). Molecular tools for the identification of Tuber melanosporum in agroindustry. J. Agric. Food Chem., 48 (6):2608–2613. Stephan O, Vieths S (2004). Development of a real-time PCR and a sandwich ELISA for detection of potentially allergenic trace amounts of peanut (Arachis hypogaea) in processed foods. J. Agric. Food Chem., 52(12):3754–3760. Stephan O, Weisz N, Vieths S, Weiser T, Rabe B, Vatterott W (2004). Protein quantification, sandwich ELISA, and real-time PCR used to monitor industrial cleaning procedures for contamination with peanut and celery allergens. J. AOAC Int., 87(6):1448–1457. Tengel C, Schussler P, Setzke E, Balles J, Sprenger-Haussels M (2001). PCR-based detection of genetically modified soybean and maize in raw and highly processed foodstuffs. Biotechniques, 31(2):426–429. Tilley M (2004). Amplification of wheat sequences from DNA extracted during milling and baking. Cereal Chem., 81:44–47. Torp AM, Olesen A, Sten E, et al. (2006). Specific, semi-quantitative detection of the soybean allergen Gly m Bd 30K DNA by PCR. Food Control, 17:30–36. Watanabe S, Akiyama H, Maleki S, et al. (2007). A specific qualitative detection method for peanut (Arachis hypogaea) in foods using polymerase chain reaction. J. Food Biochem., 30:215–233. Wilson IG (1997). Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol., 63(10):3741–3751. Yamakawa H, Akiyama H, Endo Y, et al. (2007). Specific detection of soybean residues in processed foods by the polymerase chain reaction. Biosci. Biotechnol. Biochem., 71(1):269– 272. Yano T, Sakai Y, Uchida K, et al. (2007). Detection of walnut residues in processed foods by polymerase chain reaction. Biosci. Biotechnol. Biochem., 71(7):1793–1796. Yman IM, Eriksson A, Johansson MA, Hellenas KE (2006). Food allergen detection with biosensor immunoassays. J. AOAC Int., 89(3):856–861.
CHAPTER 10
Offal NEIL HARRIS LGC Limited, Teddington, Middlesex, UK
10.1
INTRODUCTION
Offal may be described as the entrails and internal organs of a butchered animal, other than muscle or bone. Depending on the market and the cultural context, offal may be considered as a waste material or as an important culinary ingredient. However, offal components can also be used unscrupulously as an adulterant or a substitute for premium “muscle” ingredients in a food product, and depending on the offal component in question, there may be related consumer health and food safety implications. Consumers may also wish to exercise a choice over which animal components are present in their purchases. With these issues in mind, legislation has been set up to specifically prohibit the use of certain offal products and also to further define those that may be used, and ultimately ruling out use of the term offal on a food label. European Commission (EC) food labeling regulations now require a quantitative ingredient declaration (QUID) (2001/101/EC) for any ingredient that is mentioned in the name of a food product. Therefore, specific kinds of meat in a product must be supported by a label indicating the amount present, whereas previously only the total minimum meat content had to be declared on the label. Only skeletal muscle tissue is considered meat from the point of view of labeling [Food Labeling (Amendment) (England), Regulations 2003 and 2001/101/EC], and the term offal is prohibited, with other parts of the carcass present, such as liver and kidney, having to be listed. In addition, these may not be included as part of the “meat content” of a product. Certain parts of the carcass are also specifically prohibited from being used in meat products [Meat Products (England), Regulation 2003]. Included in the offal prohibited are ruminant brain and spinal cord, which are designated specified risk material (SRM) and have to be excluded from the food chain under legislation designed to
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
199
200
OFFAL
prevent the spread of bovine spongiform encephalopathy (BSE) by the removal of potentially infectious material at the abattoir (2001/999/EC). The Analytical Issue The existing legislative requirements place further demands on the analytical techniques required for effective enforcement. There is a requirement to increase the degree of test specificity essentially from the level of being able to detect the animal species component of a meat product (see Chapter 7) to the level of the individual tissue component present from that animal. In essence, tissue-specific rather than speciesspecific detection is what is required to enable accurate discrimination between skeletal muscle tissue and nonmuscle tissue components present in a food product.
10.2
TECHNIQUES USED CURRENTLY
As would be expected, most effort has been most focused on the detection of nonmuscle tissue that is related to the enforcement of human health and food safety. To enable effective enforcement and removal of SRM, there has been a need for the development of robust CNS (central nervous system)-specific detection methods that are applicable to a wide range of processed meat products. In the case of non-DNAbased techniques, methods for the detection of CNS tissue in meat include direct tissue examination (Bauer et al., 1996), histological preparation and microscopic examination (USDA–FSIS, 1998), and the analysis of cholesterol content (L€ucker et al., 1999; Schmidt et al., 1999). However, these techniques can be labor intensive and technically difficult. To carry out a biochemical or molecular biology based test to fit in with modern enzyme-linked immunosorbent assay (ELISA) or polymerase chain reaction (PCR)-based highthroughput platforms, there is a requirement to be able to either detect a gene that is specifically expressed in the target tissue (at the RNA or protein level) or has characteristics or modifications at the genomic level that are tissue specific (such as DNA methylation). Use of a DNA-based analyte, in particular, also makes use of a target molecule that is potentially more resistant to any degradation arising from foodprocessing or treatment conditions prior to analysis (see Chapter 7). Nucleic acid– based assays also allow the design of small PCR amplicons, reducing some of the effects of template degradation and are also amenable to detection using a range of commercially available formats and platforms. Detection at the protein level has been developed by Schmidt et al. (1999) and Wenisch et al. (1999), who both utilized the detection of glial fibrillary acidic protein (GFAP), a protein whose expression is restricted primarily to the CNS. However, these methods are not species specific and can therefore potentially detect target tissues from species not regulated under SRM-related legislation. Real-time PCR is now an accepted analytical tool for food authenticity and offers the advantages of rapidity, reproducibility, and quantitative analysis. It is now a routine technique for such food authenticity applications as species-specific detection and that of genetically modified
TECHNIQUES USED CURRENTLY
201
TABLE 10.1 Methods Used for Detection of (Nonmuscle) Offal Tissues in Meat Products Detection Method
Target Analyte
Target Tissue
References
Direct tissue examination Cholesterol content ELISA
Tissue
CNS general
Bauer et al. (1996)
Cholesterol
CNS general
Protein
CNS general
PCR
DNA
Reverse transcription (RT) PCR
RNA
CNS: bovine and ovine Heart/kidney/liver: bovine and porcine CNS: bovine, ovine, caprine
L€ ucker et al. (1999), Schmidt et al. (1999) Schmidt et al. (1999), Wenisch et al. (1999) Gout et al. (2004)
Seyboldt et al. (2003), Nowak et al. (2005), Abdulmawjood et al. (2005)
ingredients (see Chapter 7). More recently, it has also been the focus of the development of methods to detect nonmuscle or offal components of meat products using both DNA- and RNA-based techniques (Table 10.1). 10.2.1
DNA-Based Detection
To be able to utilize DNA to carry out tissue-specific detection, it is necessary to be able to detect a characteristic of the template that is unique to each of the tissue types under investigation. Hence, if the DNA can be detected in this tissue-specific form, it must indicate the presence of the original source tissue in the food sample under investigation. One area that can be exploited for this is that of the tissue-specific methylation of DNA. Cytosine methylation at specific CpG dinucleotides in the promoter of a gene has been shown to be one of several ways of controlling tissue-specific regulation (Condorelli et al., 1994, 1997; Teter et al., 1994). Consequently, several tissue-specific genes have been shown to possess unmethylated promoter sequences in expressing tissue and be strongly methylated at specific sequences in DNA derived from tissues where little or no expression occurs (Yeivin and Razin, 1993). In several cases, this methylation of specific CpG dinucleotides within a promoter has been shown to correlate with transcriptional repression and hence bring about tissue-specific control of gene expression (Li et al., 1993; Yoder et al., 1997). It is possible to study promoter methylation by using the chemical modification of cytosine to uracil resulting from treatment with sodium bisulfite. In this reaction all cytosines are converted to uracil, but those that are methylated (5-methylcytosine) are resistant to modification (Wang et al., 1980). Following amplification and sequencing the converted bases (nonmethylated) will appear as thymine compared to cytosine in the native sequence (methylated). This therefore provides a mechanism with which
202
OFFAL
both to initially determine methylation sites in a specific promoter target by comparison to the native sequence and also to distinguish two matching nucleotide sequences which at the start of the process differed only in the methylation status of their cyosine residues. As this can result as part of the tissue-specific control mechanisms exerted on a DNA sequence, it provides a mechanism with which to determine the tissue-specific origin of a DNA sample. Using the sequence differences resulting from bisulfite modification of specific bases to design PCR primers specific to the methylation status of a target template, called methylation-specific PCR (MSP) (Herman et al., 1996), enables the discrimination of methylated and nonmethylated sequences and hence the original presence of the tissue of origin of the DNA (Figure 10.1). By designing PCR primers to discriminate between methylated (unmodified by bisulfite treatment) and unmethylated (modified by bisulfite treatment) sequences it is possible to differentiate between skeletal muscle and non-muscle-derived DNA. Primers are designed to encompass a terminal nucleotide at the 30 end corresponding to the unmethylated form (i.e., that derived from the target tissue) of cytosine in a discriminatory CpG site identified within Genomic DNA
Target sequence
Target sequence
METHYLATED
UNMETHYLATED
in DNA originating from MUSCLE tissue.
in DNA originating from NON- MUSCLE tissue. Bisulfite treatment of DNA. All C residues converted to U except at methylation sites. (U amplifies as T in PCR)
Polymerase chain reaction using primer with final 3’ base of A.
MUSCLE DERIVED DNA TEMPLATE Mismatched base at 3’ terminal base of primer, as methylated C remains unmodified.
NO AMPLICON NEGATIVE RESULT
NON-MUSCLE DERIVED DNA TEMPLATE 3’ terminal base of primer hybridizes to genomic DNA sequence, because unmethylated C has been converted.
AMPLICON POSITIVE RESULT
FIGURE 10.1 Process of using specific methylation-specific PCR (MSP) to carry out tissuespecific DNA detection.
TECHNIQUES USED CURRENTLY
203
the promoter sequence. This will then be converted to uracil by bisulfite modification and hybridizes effectively with the terminal adenosine of the primer used. A promoter sequence containing the methylated form of the gene (that derived from muscle tissue) will have the terminal primer binding site, in this case a cytosine residue, unchanged, leading to a 30 mismatch. Thus, Taq polymerase will not carry out efficient amplification. It has been possible to use the promoter sequence of glial fibrillary acid (GFAP), a protein that is specifically expressed in central nervous system tissue, to design an MSP assay that enables the specific detection of brain tissue in both raw and processed mixed meat samples (Gout et al., 2004). By initially measuring the differences in the methylation patterns in the promoter between bovine and ovine brain and muscle tissue (GenBank accession: AF251845 and AF251846), primers were then designed to carry out tissue-specific PCR using the specific sites identified, as demonstrated in Figure 10.1. For real-time PCR detection, one technique that has been used for sensitive detection of methylated alleles is the Methylight assay (Eads et al., 2000). As with MSP, this utilizes methylation-specific amplification primers but enables the use of methylation status-specific TaqMan probes, adding an extra level of discrimination. It also enables the accumulation of fluorescence that results from the increase in amplicon concentration during amplification to be measured, facilitating quantitative PCR measurement. Using the Methylight protocol, assays were designed to incorporate a fluorescent TaqMan probe containing a methylation site in the GFAP promoter. This enabled transfer of the method to the ABI 7700 SDS Prism System (Gout et al., 2004) and it was possible to discriminate DNA derived from bovine spinal cord, brain, or muscle by measuring the cycle number at which the accumulated fluorescence signal for each target crossed a given threshold (Figure 10.2). A reference gene system can also be developed to normalize the target-specific data before comparison. This ensures that tissue-specific differences in samples are due to
Amplification – MGB270701 1.000 Spinal Cord Brain Muscle
0.800
ΔRn
0.600 0.400 0.200 0.000 −0.200 25
27
29 30
32
34 35
37
39 40
42
44 45
47
49 50
Cycle
FIGURE 10.2
Use of MSP and real-time PCR to differentiate neuronal from muscle tissue.
204
OFFAL
methylation status and not as a result of differing amounts of input target material. Primers and probes are designed to amplify part of the target promoter region that does not contain CpG sites, to ensure that amplification is not methylation dependent. This gives the total signal from all the gene copies present in the reaction (regardless of methylation status) and shows whether the levels of target gene in each reaction are the same. It also enables the ratio of the amount of target-tissue-specific signal to that of the total promoter signal (methylated plus unmethylated) to be calculated, allowing normalization for any differences in input template concentrations. By setting up such a reaction in duplex, the ratio of the target-tissue-specific form to that of the total gene concentration can be measured as the difference in threshold cycle (DCt) (see Chapter 7) and a linear relationship between DCt and the log of the target tissue concentration obtained (Gout et al., 2004). Using this assay it was possible to obtain an assay sensitivity of 2.5% in admixtures of bovine and ovine CNS tissue in a muscle background. By utilizing the technique described in Figure 10.1 it was also possible to establish the principle of the assay for the detection of further nonmuscle targets using real-time PCR. By bisulfite treatment of genomic DNA from muscle tissue and nonmuscle target tissues it was possible to identify methylation differences in the promoter sequences for copper amine oxidase and connexin. These were then used to design assays (using the scheme in Figure 10.1) for the detection of bovine heart (copper amine oxidase) and porcine liver and bovine liver/kidney/heart (connexin) (this author, unpublished). Mixed success was obtained, however, due to the fact that the differences in methylation observed between target and nontarget tissues were not great, particularly for the copper amine oxidase–based assay. This meant that this assay would not routinely differentiate target and nontarget tissues and could not be transferred to a realtime PCR platform. The use of methylation analysis for tissue-specific detection, however, introduces several technical complications to the analytical process. Bisulfite treatment is a harsh chemical process that degrades 80 to 95% of the DNA, thus potentially decreasing the target pool within the DNA (Grunau et al., 2001). This can be particularly problematic if the target tissue is already in low abundance in the sample of interest, challenging the limit of detection of the assay. In addition, once the DNA sequence is modified, the template is composed predominantly of three nucleotides (except for methylated C bases) rather than the usual four. Primers sites are also restricted to areas that contain sites of tissue-specific differential methylation. The latter two factors combine to severely limit the locating of suitable PCR primers within a target gene, potentially leading to suboptimal primer design and amplification efficiency. In addition, the differences in methylation levels between DNA from target and nontarget tissues may not be sufficient for an adequate cutoff to be assigned, and therefore robust assay design. 10.2.2
RNA-Based Detection
Recently, alternatives to DNA- and protein-based detection have been developed. Traditionally, it is thought that as RNA in cells can be turned over rapidly and readily
TECHNIQUES USED CURRENTLY
205
degraded by the presence of RNAses, it does not make a good choice of analyte for use in food sample testing. However, this can also be related to the particular sequence present, and some regions of DNA may be more stable than others (Birch et al., 2001). If RNA can be used as the analyte, it means that it is possible to use the actual measurement of transcripts resulting from tissue-specific gene expression to carry out detection of a specific tissue rather than having to use associated DNA modifications and a potentially more complex protocol. This potentially negates the disadvantages of utilizing methylation-based analysis to bring about tissue-specific detection and simplifies the analytical protocol. Initial uses of tissue-specific RNA expression analysis for detecting nonmuscle tissue have focused on the detection of neuronal tissue using the transcript for GFAP as it exhibits predominantly CNS tissue-specific expression. Work by Seyboldt et al. (2003) and Nowak et al. (2005) have utilized PCR-RFLP (polymerase chain reaction–restriction fragment length polymorphism) to detect the presence of tissuespecific transcripts from food samples. In this case, the actual transcript for GFAP was detected using reverse transcription PCR (RT-PCR), followed by nonquantitative gel-based analysis. The use of RFLP analysis of the RT-PCR product post-PCR enables species-specific discrimination. The assay shows some cross-reactivity with other nontarget tissues, such as muscle and heart in raw samples, but this did not occur in heat-treated samples. The overall sensitivity achieved was 0.5%. The authors have also utilized the assay in unison with a commercially available ELISA-based kit for CNS tissue detection. This protein-based method is not species specific, so it is suggested that use of both systems together will provide a two-stage process where the ELISA can be used to screen for the general presence of CNS tissue followed by use of the author’s RT-PCR protocol to indicate the specific presence or otherwise of bovine CNS material and hence conformance to legislation (Nowak et al., 2005). Abdulmawjood et al. (2005) have further refined the use of RT-PCR and demonstrated that use of a specific RNA extraction protocol, coupled to the targeting of a specific region of the GFAP transcript that appears be relatively stable, ensures that the template can be extracted from processed samples in sufficient amounts and quality. In addition, they have also transferred the assay to a real-time PCR platform (see Chapter 7) to enable a quantitative tissue-specific assay to be designed and performed. By careful primer design to conserved sequences, the study authors have developed an assay that will specifically detect the transcript from bovine, ovine, or caprine sources. These three species are covered by current bovine spongiform encephalopathy (BSE)- related regulations, and the assay design ensures that the technique will not detect other potential source species not covered by this legislation, such as porcine. This therefore enables verification that a banned nonmuscle tissue type is present and also that it is from one of the species governed by the legislation. By comparing the results from several tissue types, it was possible to show that although there are small amounts of GFAP transcript present in nontarget tissues, the threshold cycle (Ct) signal originating from CNS tissue occurred several cycles earlier. The Ct value obtained from nontarget organs was above 35 cycles, a typical cutoff for real-time PCR
206
OFFAL
reactions, with 0.01% mixture of brain tissue exhibiting a Ct value of 32.23 cycles. This enables clear differentiation of CNS tissue from any other types likely to be present in a food sample and exhibits better differentiation than that observed with methylationbased analysis. To enable quantitation of the amount of target tissue present, the authors have incorporated detection of an endogenous control transcript from the 18S rRNA gene. This also acts as a control for reverse transcription and PCR reaction and for mRNA quantity, quality, and integrity. The data for the assay are then reported as the difference in gene expression obtained normalized to the 18S rRNA transcript amplification signal and relative to that of a calibrator organ, which for this assay is the predominant nontarget tissue, muscle. The assay has also been shown to have a high degree of sensitivity of <0.01% in mixed meat samples, which is better than that of both the methylation-based assay discussed previously and of currently available commercial protein (ELISA)-based techniques (Hughson et al., 2003). Detection of neuronal tissue using specific regions of RNA as the template represents an opportunity for the development of assays for the detection of other nonmuscle tissues. However, target genes that both contain regions of suitable stability must be identified. These also need to exhibit either truly tissue-specific expression or sufficient difference in levels of expression such that a sufficient cutoff limit can be assigned to an RT-PCR assay to enable detection even at low levels of target analyte concentration, as has been demonstrated for the neuronal detection assay.
10.3
DISCUSSION
Currently, a range of assays comprising visual or histological examination, cholesterol content, immunoassay, and DNA/RNA can be used to carry out tissue-specific detection in meat products to discriminate between muscle tissue and offal components (Table 10.1). Most applications have focused on the detection of CNS tissue for clear food safety reasons. These methods can be subjective and time consuming and may not be applicable to highly processed samples or be species specific. Further nucleic acid–based techniques for the detection of nonmuscle tissue in meat products have now exploited the robustness of DNA and specific regions of RNA, and may give greater applicability to raw, processed, and cooked meat products in the future. The latter certainly holds promise, particularly if its range of applicability can be extended to other target offal tissues.
REFERENCES Abdulmawjood A, Sch€onenbr€ucher H, B€ulte M (2005). Novel molecular method for detection of bovine-specific central nervous system tissues as bovine spongiform encephalopathy risk material in meat and meat products. J. Mol. Diagn., 7:368–374. Bauer NE, Garland T, Edwards JF (1996). Brain emboli in slaughtered cattle. Vet. Pathol., 33:600.
REFERENCES
207
Birch L, Dawson CE, Cornett JH, Keer JT (2001). A comparison of nucleic acid amplification techniques for the assessment of bacterial viability. Lett. Appl. Microbiol., 33:296–301. Condorelli DF, Nicoletti VG, Barresi V, et al. (1994). Tissue-specific DNA methylation patterns of the rat glial fibrillary acidic protein gene. J. Neurosci. Res., 39:694–707. Condorelli DF, Dell’Albni P, Conticello SG, et al. (1997). A neural-specific hypomethylated domain in the 50 flanking region of the glial fibrillary acidic protein gene. Dev. Neurosci., 19:446–456. Eads CA, Danenberg KD, Kawakami K, et al. (2000). Methylight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res., 28:e32. EC (European Commission) (2001a). Regulation 2001/999/EC of May 22, 2001, laying down rules for the prevention, control and eradication of certain transmissible spongiform encephalopathies. EC (2001b). Directive 2001/101/EC of Nov. 26, 2001, amending Directive 2000/13/EC on the approximation of the laws of the member states relating to the labeling, presentation, and advertising of foodstuffs. EC (2003). Food Labeling (Amendment) (England) Regulations, implementing, in England, EC Directive 2001/101/EC (as amended by Directive 2002/86/EC) of Nov. 26, 2001 on the definition of meat used for the labeling of foods for human consumption. Gout SL, McDowell DG, Harris N (2004). Detection of neuronal tissue in meat using tissue specific DNA modifications. Biotechnol. Agron. Soc. Environ., 8:229–234. Grunau C, Clark SJ, Rosenthal A (2001). Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Res., 29:e65. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin S (1996). Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93:9821– 9826. Hughson E, Reece P, Dennis MJ, Oehlschlager S (2003). Comparative evaluation of the performance of two commercial kits for the detection of central nervous system tissue in meat. Food Addit. Contam., 20:1034–1043. Li E, Beard C, Jaenisch R (1993). Role for DNA methylation in genomic imprinting. Nature, 366:362–365. L€ ucker E, Eigenbrodt E, Wenisch S, Failing K, Leiser R, Bulte M (1999). Development of an integrated procedure for the detection of central nervous tissue in meat products using cholesterol and neuron-specific enolase as markers. J. Food. Prot., 62:268–276. Nowak B, Mueffling TV, Kuefen A, Ganseforth K, Seyboldt C (2005). Detection of bovine central nervous system tissue in liver sausages using a reverse transcriptase PCR technique and a commercial enzyme-linked immunosorbent assay. J. Food Prot., 68:2178–2183. Schmidt GR, Hossner KL, Yemm RS, Gould DH, O’Callaghan JP (1999). An enzyme-linked immunosorbent assay for glial fibrillary acidic protein as an indicator of the presence of brain or spinal cord in meat. J. Food Prot., 62:394–397. Seyboldt C, John A, Mueffling TV, Nowak B, Wenzel S (2003). Reverse transcription polymerase chain reaction assay for species-specific detection of bovine central nervous system tissue in meat and meat products. J. Food Prot., 66:644–651. Teter B, Finch CE, Condorelli DF (1994). DNA methylation in the glial fibrillary acidic protein gene: map of CpG methylation sites and summary of analysis by restriction enzymes and by LMPCR. J. Neurosci. Res., 39:708–709.
208
OFFAL
USDA–FSIS (U.S. Department of Agriculture–Food Safety and Inspection Service) (1998). Proposed rules: meat produced by advanced meat/bone separation machinery and recovery systems. Fed. Reg., 63:17959–17965. Wang RY-H, Gerke CW, Ehrlich M (1980). Comparison of bisulphite modification of 5-methyldeoxycytidine and deoxycytidine residues. Nucleic Acids Res., 8:4777–4790. Wenisch S, L€ucker E, Eigenbrodt E, Leiser R, B€ulte M (1999). Detection of central nervous tissue in meat products: an immunohistochemical approach. Nutr. Res., 19:1165–1172. Yeivin A, Razin A (1993). Gene methylation patterns and expression. In Jost JP, Saluz HP (eds.), DNA Methylation: Molecular Biology and Biological Significance, 8th ed. Birkhauser, Basel, Switzerland, pp. 523–568. Yoder JA, Walsh CP, Bestor TH (1997). Cytosine methylation and the ecology of intragenomic parasites. Trends Genet., 13:335–340.
CHAPTER 11
Aquatic Food HARTMUT REHBEIN Max Rubner-Institut, Hamburg, Germany
11.1
INTRODUCTION
The quality assessment of aquatic food (seafood, freshwater fish, crustaceans, and mollusks) by consumers is influenced considerably by the name, the origin, and the production method assigned to the product. Many consumers are willing to appreciate superior quality by a higher price, examples being red snapper (Marko et al., 2004), sushi from bluefin tuna, and sturgeon caviar (Ludwig, 2008). Cheaper imitations such as surimi-based products or artificial caviar have to be labeled properly. However, false declaration or misleading labeling of fish and other aquatic food is not unusual, as demonstrated by reports of food control laboratories and scientific publications (Marko et al., 2004; Asensio et al., 2007; Hubalkova et al., 2008). Some reasons for this practice are shortage of supply, large difference in the price between products from related species, and different customs tariffs. In 1995, the Food and Agriculture Organization (FAO) published the Code of Conduct for Responsible Fisheries (FAO, 1995) demanding in Article 11 (postharvest practices and trade), Section 11.1 (responsible fish utilization): . .
11.1. States should adopt appropriate measures to ensure the right of consumers to safe, wholesome, and unadulterated fish and fishery products. 11.2. States should establish and maintain effective national safety and quality assurance systems to protect consumer health and to prevent commercial fraud.
In recent decades a number of polymerase chain reaction (PCR)-based methods for fish species identification by DNA analysis have been developed to support food control authorities to achieve this goal. In the following sections these techniques are described Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
209
210
AQUATIC FOOD
under consideration of special requirements for analysis of processed fish and shellfish. Recently, many aspects of this topic have been treated by two review articles (Asensio Gil, 2007; Mafra et al., 2007). The method to be used depends on the condition of the DNA (see Figure 11.1). Degradation of DNA is most severe in canned fish (Quinteiro et al., 1998; Chapela et al., 2007a), and in marinated products with pH below 4.8.
FIGURE 11.1
PCR-based authentication of fishery products.
IDENTIFICATION OF FISH SPECIES
11.2 11.2.1
211
IDENTIFICATION OF FISH SPECIES Raw Products
The DNA content of fish fillet varies between 100 and 1000 mg/g wet weight, with higher concentrations found in dark muscle than in light muscle. The DNA fragments in raw fillets are at least several hundred base pairs in size, offering the use of a wide range of PCR-based techniques. In most studies, mitochondrial genes have been used for species identification for the following reasons: 1. Their gene copy number is 10- to 100-fold higher than that of nuclear protein coding genes. 2. The number of fish species with mitochondrial genes sequenced exceeds by far the number of species for which sequences of nuclear genes are known. In April 2008 the database MitoFish (mitofish.ori.u-tokyo.ac.jp) listed 418 DNA sequences of complete mitochondrial genomes and more than 88,000 partial sequences of 10,000 fish species. Comparison of these figures with the total number of fish species (about 29,000) demonstrates the wealth of information available for fish species identification by mitochondrial DNA analysis. 3. The mitochondrial genome is possessing genes of high and low mutation rates during evolution, which may be used to differentiate either between closely related fish species (e.g., tunas, red fishes, eels) or between fishes of different families (e.g., in case of products from flatfishes). The use of mitochondrial DNA for fish species identification is made under the assumption that hybridization between species is a rare event. In the case of fish (but not of mussels; see below) only the mitochondrial genome of the mother is passed on to the next generation (Brown, 2008). Therefore, it is not possible to differentiate between fish of the maternal species and hybrids by analysis of mitochondrial DNA. Interspecific hybridization has been observed for many freshwater species (Hubbs, 1955), but has also been documented for marine species such as flatfish (Garrett et al., 2007) and redfish (Pampoulie and Danielsdottir, 2008). PCR may be performed either by means of species-specific primers or by “universal” primers. The use of specific primers (or probes) has the advantage that the analysis can be performed in a short time, either by endpoint PCR (Infante et al., 2006; Hubalkova et al., 2008) or by real-time PCR (Dalmasso et al., 2007). A number of commercial kits are on the market to identify such fish species as catfish (Ictalurus punctatus), tra pangasius (Pangasius hypophthalmus), basa pangasius (Pangasius bocourti) (www.produktqualitaet.de), rainbow trout (Oncorhynchus mykiss), Atlantic salmon (Salmo salar), saithe (Pollachius virens), coal fish (Pollachius pollachius), North Atlantic hake (Merluccius merluccius), haddock (Melanogrammus aeglefinus), whiting (Merlangius merlangus), and cod (Gadus morhua) (www.coring.de). If species-specific primers are used to identify the origin of a sample and no PCR product has been obtained, a second PCR with universal primers should be performed
212
AQUATIC FOOD
to ensure that the DNA extracted was of sufficient quality for PCR and not contaminated by inhibiting compounds. The specificity of primers has to be confirmed by including all the relevant species in comparative studies. This may be an ambitious objective, as in the case of hakes (Rehbein, 2007), tunas (Quinteiro et al., 1998), and sturgeons (Ludwig, 2008) more than 10 closely related species of the respective taxon have to be differentiated. Species-specific PCR systems are most useful for verification of species declaration (e.g., for customs laboratories or fish industry laboratories involved in checking incoming goods such as fillet blocks). However, in most cases, fish species identification is performed by using primers reacting with a genus, a family, or another taxon of fish. For general detection of fish as an allergenic food, PCR kits with universal primers have been developed by several companies, which should react with a very large number of different species (e.g., www.congen.de, www.genekam.de). If species identification is the aim of the analysis, the amplicon has to be characterized further by techniques such as sequencing, restriction fragment length polymorphism analysis (RFLP), or single-stranded conformation polymorphism analysis (SSCP). In the last two decades, RFLP has been the most popular technique for fish species identification (Bossier, 1999; Hold et al., 2001), whereas application of SSCP has increased only recently (Chapela et al., 2007b; Rehbein, 2007). Sequencing of amplicons is considered to be the “gold standard” for species identification. The simplest way to handle sequences is offered by BLAST (basic local alignment search tool), comparing the sample sequence with sequences deposited in GenBank or similar databases. In the case of closely related species, FINS (forensically informative nucleotide sequencing) analysis will give more reliable results (Bartlett and Davidson, 1992). In FINS analysis, an unknown sample sequence is compared by a genetic distance measurement method with a number of sequences of related organisms. The sequence of the unknown sample is clustered to those sequences of reference species to which the sample is phylogenetically most closely related (Chapela et al., 2003; Tamura et al., 2007). 11.2.2
Heated Products
The quality of DNA of heated fishery products (cooked, fried, baked, smoked), as defined by the length of fragments, is nearly as good for PCR as is the DNA of raw fish. Thus, all the methods listed in Section 11.2.1 have been used successfully to identify the fish species in heat-treated products. It is one of the advantages of PCR against protein techniques that raw or heated product can be analyzed by the same methods. 11.2.3
Canned Fish
Canning of fish is accompanied by severe degradation of DNA (Mackie, 1999). Recently, Chapela et al. (2007a) compared four different methods of extracting DNA from muscle of canned tuna for PCR-based species identification. The study included amplification of sequences differing in length between 100 and 300 bp. Increased size
IDENTIFICATION OF FISH SPECIES
213
of fragments resulted in growing failure of PCR. Furthermore, the liquid used for canning (brine, oil, vinegar, tomato sauce) had a great influence of the amount of extractable DNA and the success of PCR. Species identification of canned tuna has been achieved by FINS (Unseld et al., 1995) and by RFLP (Quinteiro et al., 1998) as well as by SSCP analysis (Rehbein et al., 1999). Canned sardine and anchovy species, as well as herring (Clupea harengus) and sprat (Sprattus sprattus), have been differentiated recently by a protocol using sequencing of 212 to 274-bp amplicons of three mitochondrial genes (Jerôme et al., 2008). A duplex-PCR assay for the authentication of Atlantic mackerel (Scomber scombrus) in commercial canned products has been developed by Infante et al. (2006) using species-specific primers. 11.2.4
Marinades
Marinades are semipreserved fishery products of low pH (ca. 4.5) with a limited shelf life in chill storage. Acetic acid and salt are added to fish or fillet (e.g., from herring or anchovy) to retard bacterial growth and to create suitable conditions for ripening of the fish flesh. As DNA may be degraded by acid and the action of lysosomal and bacterial nucleases, difficulties in performing PCR have to be expected. This was the case for products such as rollmops and Bismarck herring when amplification in mitochondrial and nuclear gene sequences has been compared. We have observed mitochondrial-based PCR systems being superior to nuclear-based systems such as parvalbumin PCR (Rehbein, unpublished results), presumably due to the higher target numbers of mitochondrial genes. 11.2.5
Caviar
The main families of fish species delivering roe for caviar are sturgeons, salmonids, and gadoids. Sturgeon caviar is one of the most valuable fishery products, and due to the very high price, mislabeling occurs frequently (DeSalle and Birstein, 1996). Fish eggs differ from muscle tissue in having a relatively high mitochondrial DNA content (Rehbein and Horstkotte, 2003). Therefore, all PCR-based methods for determination of the origin of caviar make use of mitochondrial genes (Ludwig, 2008). Most of the methods rely on the cytochrome b gene, but the ND4 gene has also been used to differentiate between sturgeon species (Rehbein et al., 2008). The following PCRbased methods have been applied to caviar authentication: PCR with species-specific primers (DeSalle and Birstein, 1996) or PCR using universal primers in connection with sequencing (Ludwig, 2008), RFLP (Wolf et al., 1999), and SSCP (Rehbein et al., 2008) analysis of amplicons. Sturgeons are known to interbreed under natural conditions, and artificial hybridization of Acipenseridae started more than a century ago (Nikoljukin, 1971). Due to depletion of stocks of wild sturgeons, farming of sturgeons for caviar production has increased over the last years. Against this background, development of PCR systems based on nuclear genes becomes more and more necessary. Occasionally, “synthetic” or “artificial” caviar containing no extractable DNA appears in the market. This type of
214
AQUATIC FOOD
caviar is made from different types of protein, carbohydrate, and fat, and stained by different dyes. In this case, PCR should be replaced by protein electrophoretic methods such as SDS-PAGE or urea IEF (Rehbein, 1997). 11.2.6
Fish Meal
DNA analysis of fish meal is performed to answer the following questions: . .
Is the fish meal contaminated by meal of ruminants? Which species have been used for meal production?
The first problem has been solved by development of a number of PCR systems for detection of ruminants and other warm-blooded animals (Santaclara et al., 2007). Knowledge of the fish species used for meal production is interesting for the following reasons: 1. The level of dioxins and other organic pollutants may differ by one order of magnitude between fish from different fishing grounds. 2. In case of multispecies fishmeals, composition should be determinable for enforcement of fishery regulations. 3. According to the guidelines for organic farming of fish, only certain types of fish meal are allowed for production of fish feed. The same methods used for analysis of heat-treated products (see Section 11.2.2) could be employed for the species identification of fish meal (Rehbein, 2002).
11.2.7
Mixed Products
A considerable number of fishery products may contain muscle or other tissue (e.g., liver, roe) of more than one fish species. Examples are fish cakes, pies, pastries, tarama, soups, baby food products, and canned tuna. Recently, the quantitative real-time PCR (qrtPCR) technique has been applied to determine the share of a fish species relative to the total number of fish (Rehbein and Horstkotte, 2003). In the first step, gene copy numbers of species-specific and universal primers have to be measured for raw and processed fish. Nuclear genes are preferred over mitochondrial genes, as the variation of gene copy number per gram of tissue or product may be greater in case of mitochondrial genomes. In the next step, products are analyzed by qrtPCR, and the amount of different species in the product can be calculated under the assumption that degradation of DNA during processing had been the same for all components of the product. qrtPCR has been used to determine the amount of saithe (Pollachius virens) in baby food (Rehbein and Horstkotte, 2003) and to quantify the amount of haddock (Melanogrammus aegelefinus) in model samples and processed fish (Hird et al., 2005). In another study, the mitochondrial 16S RNA gene was amplified by TaqMan PCR
IDENTIFICATION OF INVERTEBRATES
215
systems to quantify the relative amounts of two tuna species in mixtures of raw muscle; the results were promising for raw fish but became highly inaccurate in case of canned samples (Lopez and Pardo, 2005). 11.3 11.3.1
IDENTIFICATION OF INVERTEBRATES Crustaceans
Most of the crustaceans consumed as aquatic food belong to the classes of shrimps, prawns, crabs, and lobsters. Several hundred crustacean species are used for human consumption, and species assignment by visual inspection after removal of external features is extremely difficult. Authentication of crustaceans has been performed by just the same PCR-based techniques as those used for fish, including RFLP and SSCP analysis. In the analysis of shrimps, intraspecies variability of DNA profiles has to be considered (Figure 11.2). In most studies the mitochondrial genes 16S rRNA and cytochrome oxidase I was used as a template. Some recently published studies on differentiation of shrimps are compiled in Table 11.1. 11.3.2
Mollusks
Bivalves (e.g., clams, oysters, scallops, mussels), gastropods (e.g., abalone, snails), and cephalopods (e.g., squid, octopus, cuttlefish) are highly appreciated seafood in many countries. In contrast to fish, mollusks could not be differentiated satisfactorily by protein-based methods. Unlike fish fillet, meat of mussel consists of a number of tissues with different protein profiles. Therefore, PCR is especially useful for identification of mollusks, as all tissues contain the DNA of the same sequence. In the case of
FIGURE 11.2 Comparison of the profiles of single-stranded DNA of commercially important shrimps. A 312-bp sequence of the mitochondrial 16S rRNA gene has been amplified. Lanes 1–3, 5–7, 11, 14–19, different samples of black tiger shrimp, Penaeus monodon; lane 4, speckled shrimp, Metapenaeus monoceros; lanes 8–10, 12, 13, white shrimp, Litopenaeus vannamei. (From Schiefenh€ovel and Rehbein, unpublished results, 2008.)
216
AQUATIC FOOD
TABLE 11.1
Differentiation of Shrimps by PCR-Based Methods
Species, Product
Gene
Method
Reference
Shrimp, crab, lobster, and crawfish species 5 Penaeid shrimps 7 Shrimp species 19 Penaeid shrimp species
16S rRNA
RFLP
Brezezinski et al. (2005)
16S rRNA COX I 16S rRNA/tRNAVal
SSCP, RFLP SSCP, RFLP RFLP
Khamnamtong et al. (2005) Rehbein (2001) Pascoal et al. (2008)
bivalves nuclear ribosomal genes have been preferred quite often for species identification. When developing PCR systems, one must be aware of different types of mitochondrial DNA coexisting in males of marine mussels of the family Mytilidae and others (Breton et al., 2006). In sequencing amplicons, RFLP and SSCP analyses have been applied to identify products from different classes of bivalves (Santaclara et al., 2006; Freire et al., 2008).
11.4 11.4.1
NEW DEVELOPMENTS DNA Barcoding
Five years ago a method to identify species solely by their DNA sequence was introduced under the term DNA barcoding (Hebert et al., 2003). A short fragment of a single gene (cytochrome c oxidase subunit I) has been selected for fish (Ward et al., 2005) and for many other vertebrate and invertebrate species. Up to now, sequences of more than 5100 fish species have been collected (www.fishbol.org), which can also be used for identification of commercially important fish species. It has to be expected that DNA barcoding will become a valuable tool to be used for control of traceability and labeling of seafood, as exemplified by some recent publications (Smith et al., 2008; Ward et al., 2008; Yancy et al., 2008). 11.4.2
Microarrays
Attempts have been made to accelerate and simplify PCR-based fish species identification by development of microarrays. Up to now these attempts have not been very successful, because the large number of fish, many of them closely related, makes it necessary to perform lengthy tests for the specificity of the oligonucleotide probes. Recently, a first prototype has been constructed to identify 11 commercially important fish species using a fragment of the 16S rRNA gene (Kochzius et al., 2008). 11.4.3
Identification of Fish Populations
In addition to the type of species, the origin of aquatic food may also be of interest to consumers and control authorities. Origin in this context means a fishing ground,
REFERENCES
217
a lake or river, or a certain fish farm. For example, wild or farmed Atlantic salmon (Salmo salar) or fish from different rivers or lakes has to be distinguished. In this case, well-established PCR-based methods for differentiation of populations, such as microsatellite, single-nucleotide polymorphism, or amplified fragment length polymorphism analysis, may be employed (Primmer et al., 2000; Liu and Cordes, 2004).
REFERENCES Asensio L (2007). Application of multiplex PCR for the identification of grouper meals in the restaurant industry. Food Control, doi: 10.1016/j.foodcont.2007.11.02. Asensio Gil L (2007). PCR-based methods for fish and fishery products authentication. Trends Food Sci. Technol., 18:558–566. Bartlett SE, Davidson WS (1992). FINS (forensically informative nucleotide sequencing): a procedure for identifying the animal origin of biological specimens. Biotechniques, 12:408–411. Bossier P (1999). Authentication of seafood products by DNA patterns. J. Food Sci., 64:189–193. Breton S, Burger G, Stewart DT, Blier PU (2006). Comparative analysis of gender-associated complete mitochondrial genomes in marine mussels (Mytilus spp.). Genetics, 172:1107–1119. Brezezinski JL (2005). Detection of crustacean DNA and species identification using a PCR–restriction fragment length polymorphism method. J. Food Prot., 68:1866–1873. Brown KH (2008). Fish mitochondrial genomes: sequence, inheritance and functional variation. J. Fish Biol., 72:355–374. Chapela MJ, Sotelo CG, Perez-Martin RI (2003). Molecular identification of cephalopod species by FINS and PCR-RFLP of a cytochrome b gene fragment. Eur. Food Res. Technol., 217:524–529. Chapela MJ, Sotelo CG, Perez-Martin RI, et al., (2007a). Comparison of DNA extraction methods from muscle of canned tuna for species identification. Food Control, 18:1211–1215. Chapela MJ, Sanchez A, Suarez MI, Perez-Martin RI, Sotelo CG (2007b). A rapid methodology for screening hake species (Merluccius spp.) by single-stranded conformation polymorphism analysis. J. Agric. Food Chem., 55:6903–6909. Dalmasso A, Fontanella E, Piatti P, Civera T, Secchi C, Bottero MT (2007). Identification of four tuna species by means of real-time PCR and melting curve analysis. Vet. Res. Commun., 31(Suppl. 1):355–357. DeSalle R, Birstein VJ (1996). PCR identification of black caviar. Nature, 381:197–198. FAO (Food and Agriculture Organization) (1995). Code of Conduct for Responsible Fisheries. FAO, United Nations, Rome. Freire R, Fernandez-Tajes J, Mendez J (2008). Identification of razor clams Ensis arcuatus and Ensis siliqua by PCR-RFLP analysis of ITS1 region. Fish. Sci., 74:511–515. Garrett, DL, Pietsch, TW, Utter, FM, Hauser, L (2007). The hybrid sole Inopsetta ischyra (Teleostei: Pleuronectiformes): Hybrid or biological species? Trans. Am. Fish. Soc., 135:460–468.
218
AQUATIC FOOD
Hebert PDN, Cywinska A, Ball SL, de Waard JR (2003). Biological identifications through DNA barcodes. Proc. R. Soc. London B, 270:313–321. Hird HJ, Hold GL, Chisholm J, et al. (2005). Development of a method for the quantification of haddock (Melanogrammus aeglefinuis) in commercial products using real-time PCR. Eur. Food Res. Technol., 220:633–637. Hold GL, Russel VJ, Pryde SE, et al. (2001). Development of a DNA-based method aimed at identifying the fish species present in food products. J. Agric. Food Chem., 49:1175–1179. Hubalkova Z, Kralik P, Kasalova J, Rencova E (2008). Identification of gadoid species in fish meat by polymerase chain reaction (PCR) on genomic DNA. J. Agric. Food Chem., 56:3454–3459. Infante C, Crespo A, Zuasti E, et al. (2006). PCR-based methodology for the authentication of the Atlantic mackerel Scomber scombrus in commercial canned products. Food Res. Int., 39:1023–1028. Jerôme M, Martinsohn JT, Ortega D, Carreau P, Verrez-Bagnis V, Mouchel O (2008). Toward fish and seafood traceability: anchovy species determination in fish products by molecular markers and support through a public domain database. J. Agric. Food Chem., 56:3460–3469. Khamnamtong B, Klinbunga S, Menasveta P (2005). Species identification of five penaeid shrimps using PCR-RFLP and SSCP analyses of 16S ribosomal DNA. J. Biochem. Mol. Biol., 38:491–499. Kochzius M, et al. (2008). DNA microarrays for identifying fishes. Mar. Biotechnol., 10:207– 217. Liu ZJ, Cordes JF (2004). DNA marker technologies and their applications in aquaculture genetics. Aquaculture, 236:1–37. Lopez I, Pardo MA (2005). Application of relative quantification TaqMan real-time polymerase chain reaction technology for the identification and quantification of Thunnus alalunga and Thunnus albacares. J. Agric. Food Chem., 53:4554–4560. Ludwig A. (2008). Identification of Acipenseriformes species in trade. J. Appl. Ichthyol., 24 (suppl.1):2–19. Mackie IM, Pryde SE, Gonzales-Sotelo C, et al. (1999). Challenges in the identification of species of canned fish. Food Sci. Technol., 10:9–14. Mafra I, Ferreira IMPLVO, Oliveira MBPP (2007). Food authentication by PCR-based methods. Food Res. Technol., doi: 10.1007/s00217-007-0782-x. Marko PB, Lee SC, Rice AM, et al. (2004). Mislabelling of a depleted reef fish. Nature, 430:309–310. Nikoljukin NI (1971). Hybridization of Acipenseridae and its practical significance. Presented at the FAO 1971 Seminar/Study Tour in the U.S.S.R. on Genetic Selection and Hybridization of Cultivated Fishes, Apr. 19–May 29. Lectures. Rep. FAO/UNDP(TA), (2926). Pampoulie C, Danielsdottir AK (2008). Resolving species identification problems in the genus Sebastes using nuclear genetic markers. Fish. Res., doi: 10.1016/j.fishres.2008.02.007. Pascoal A, Barros-Velazques J, Cepeda A, Gallardo JM, Calo-Mata P (2008). A polymerase chain reaction–restriction fragment length polymorphism method based on the analysis of a 16S rRNA/tRNAVal mitochondrial region for species identification of commercial penaeid shrimps (Crustacea: Decapoda; Penaeoidea) of food interest. Electrophoresis, 29:499–509.
REFERENCES
219
Primmer CR, Koskinen MT, Piironen J (2000). The one that did not get away: individual assignment using microsatellite data detects a case of fishing competition fraud. Proc. R. Soc. London B, 267:1699–1704. Quinteiro J, Sotelo CG, Rehbein H, et al. (1998). Use of mtDNA direct polymerase chain reaction (PCR) sequencing and PCR–restriction fragment length polymorphism methodologies in species identification of canned tuna. J. Agric. Food Chem., 46:1662–1669. Rehbein H (1997). Fish as food: fish species determination for caviar by protein and DNA analysis. Anim. Res. Dev., 46:39–46. Rehbein H (2001). Identification of shrimp species by protein- and DNA-based analytical methods. Ann. Soc. Sci. Færoensis Suppl., 28:195–205. Rehbein H (2002). Identification of the fish species processed to fish meal. J. Aquat. Food Prod. Technol., 11:45–56. Rehbein H (2007). Differentiation of hake species by RFLP- and SSCP-analysis of PCR amplified cytochrome b and parvalbumin sequences. Dtsch Lebensm. Rundsch., 103:1–6. Rehbein H, Horstkotte B (2003). Determination of the composition of multispecies fishery products by PCR-based techniques. In Proceedings of the TAFT 2003 Conference, The Icelandic Fisheries Laboratories, Reykjavik, Iceland, pp. 190–192. Rehbein H, Mackie IM, Pryde S et al. (1999). Fish species identification in canned tuna by PCRSSCP: validation by a collaborative study and investigation of intra-species variability of the DNA patterns. Food Chem., 64:263–268. Rehbein H, Molkentin J, Schubring R, Lieckfeldt D, Ludwig A (2008). Development of advanced analytical tools to determine origin of caviar. J. Appl. Ichthyol., 24(suppl. 1), 65– 70. Santaclara FJ, Espineira M, Cabado AG, Aldasoro A, Gonzalez-Lavin N, Vieites JM (2006). Development of a method for the genetic identification of mussel species belonging to Mytilus, Perna, Aulacomy, and other genera. J. Agric. Food Chem., 54:8461–8470. Santaclara FJ, Espineira M, Cabado AG, Vieites JM (2007). Detection of land animal remains in fish meals by the polymerase chain reaction–restriction fragment length polymorphism technique. J. Agric. Food Chem., 55:305–310. Smith PJ, McVeagh SM, Steinke D (2008). DNA barcoding for the identification of smoked fish products. J. Fish Biol., 72:464–471. Tamura K, Dudley, J, Nei M, Kumar S (2007). MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24:1596–1599. Unseld M, Beyermann, B, Brandt P, Hiesel R (1995). Identification of the species origin of highly processed meat products by mitochondrial DNA sequences. PCR Methods Appl., 4:241–243. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005). Barcoding Australia’s fish species. Philos. Trans. R. Soc. London B, 360,1847–1857. Ward RD, Holmes BH, Yearsley GK (2008). DNA barcoding reveals a likely second species of Asian sea bass (barramundi) (Lates calcarifer). J. Fish Biol., 72:458–463. Wolf C, H€ubner P, L€uthy J (1999). Differentiation of sturgeon species by PCR-RFLP. Food Res. Int., 32:699–705. Yancy HF, et al. (2008). Potential use of DNA barcodes in regulatory science: applications of the Regulatory Fish Encyclopedia. J. Food Prot., 71:210–217.
PART IIa
IMMUNOLOGICAL METHODS: TECHNIQUES EXPLAINED
CHAPTER 12
Antibody-Based Detection Methods: From Theory to Practice CARMEN DIAZ-AMIGO Center for Food Safety and Applied Nutrition, U.S. Food and Drug Administration, Maryland, USA
12.1
INTRODUCTION
Immunoassays are analytical techniques based on the use of antibodies (Ab), also called immunoglobulins (Ig), as detecting elements, due to their ability to specifically bind molecules of a heterogeneous chemical nature. For many targets, immunoassays are the detection systems of choice not only because of their specificity, sensitivity, and versatility but also because they are able to detect complex molecules, such as proteins, from complex mixtures. Additional reasons for using immunoassays are based on practical considerations. They may be more cost-effective that alternative techniques: for example, the use of mass spectrometry for the detection of proteins. Immunoassays can be used as quantitative or qualitative screening or semiquantitative techniques, and their versatility allows the analysis of target molecules by a simple user-friendly rapid format or by more complex automated high-throughput systems. This introductory section on immunoassays provides basic principles, with special emphasis not only on practical aspects but also on potential pitfalls.
12.2
ANTIBODIES
A healthy immune system is protecting an organism continuously from pathogens and other chemical compounds by adapting its response to these foreign agents using a highly sophisticated and complex network, including both cellular and humoral components. Antibodies are part of the humoral response, which can be manipulated to produce antibodies specific for the target of choice. Antibodies are proteins of Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
223
224
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
different isotypes (IgA, IgD, IgE, IgG, IgM), but IgG is the most commonly used in immunoassays. The tertiary structure of IgG is very flexible, favoring the binding to the target (antigen) by noncovalent forces. If a protein is the target, antibodies bind a limited number of amino acids (epitope) with a certain strength (affinity). There are two types of epitopes, depending on the position and location of amino acids: (1) linear, formed by contiguous amino acids, and (2) conformational, where nonconsecutive amino acids are brought together as a result of the folding of the tertiary structure of the protein. It is important to understand the differences between the two types of epitopes because the analysis of proteins in processed food samples and the use of specific assays are determined by this feature. In this section we describe briefly the main steps and considerations in the production of antibodies for use in immunoassays. For additional information, see extensive reviews published by Harlow and Lane (1988, 1998) and Howard and Bethell (2001).
12.2.1
Antibody Production: State of the Art
Antibodies are produced in animals after stimulation of the immune system by injecting the target molecule in a procedure called immunization. It is necessary to highlight that the production of antibodies is initiated in an in vivo system and the outcome (i.e., antibody features) is subjected to the specific response of each animal treated. In other words, antibody characteristics cannot be fully predetermined, due to variation in the response of each immunized individual. However, the quality of antibodies, which is critical to provide a good immunoassay, can be optimized, although not controlled completely, for the reasons mentioned above. Because the production of antibodies requires the use of animals, immunization procedures need to be evaluated and approved by the corresponding institutional ethics committee. In the United States, it is called the Institutional Animal Care and Use Committee (IACUC), and its ultimate function is to ensure that animals are treated in a humane manner. There are several parameters that need to be evaluated, depending on the purpose and application of the antibodies to be produced. All these elements are key to optimizing the immunization protocol and therefore to ensuring high-quality antibodies. Selection of Target In principle, antibodies can be produced against most molecules. Immunogenicity is the ability of a compound to naturally induce an immune response. However, smaller molecules such as mycotoxins and some pesticides are less immunogenic than larger molecules such as proteins. In other words, compounds of lower molecular weight tend to be invisible to the immune system, resulting in a weak immune response or no response. Poor immunogens or nonimmunogenic compounds are called haptens. It is possible to produce antibodies against haptens by conjugating them to a larger and more immunogenic “carrier” molecule, usually proteins such us bovine serum albumin, keyhole limpet hemocyanin, or ovalbumin. However, antibodies are produced not only to the hapten but also to the carrier protein, which needs to be further removed.
ANTIBODIES
225
Regarding purity, animals can be immunized against purified or semipurified molecules, a mixture of targets or more complex preparations, including food extracts. It is important to highlight that the better the antigen/hapten purity and characterization are, the easier it is to define the features (e.g., specificity, affinity) of the antibodies produced. In preparation for the immunization process, the antigen needs to be processed to eliminate potential contaminants that could lead to the production of unwanted and nonspecific antibodies. Typical procedures include dialysis against the vehicle buffer and sterilization, usually by filtration through a 0.22-mm-pore-size filter. Selection of Adjuvant It is a common practice to use adjuvants mixed with the antigen to help boost immune response by slow release of the antigen, which leads to extended exposure of the immune system to the antigen. The most common adjuvants used for the production of antibodies are complete (CFA) and incomplete (IFA) Freund’s adjuvant. Both are a combination of water-in-oil emulsions and a surfactant, but they differ in the presence of killed mycobacterium in the complete formula. Because of potential side effects of CFA, its use is limited to the first immunization, and booster doses are applied in IFA. Other adjuvants used are aluminum salts and synthetic polymers, but in our experience they are not as effective as CFA and IFA. We have found that by choosing the amount of inoculum and route of immunization carefully, most adverse side effects of CFA use can be minimized or avoided. Selection of Animal Species Several animal species are commonly used to produce antibodies. Among them, sheep, goat, and rabbit are used most frequently for the production of polyclonal antibodies. Mice are commonly used for the production of monoclonal antibodies. The difference between the two types of antibodies is explained later in the chapter. For practical purposes (size, cost, limited amount of antigen), rabbits are more commonly used. However, larger animals producing higher volumes of sera are more convenient for mass production. Chicken antibody IgY (equivalent to mammalian IgG) can also be produced in high quantities and has the added advantage that blood samples do not need to be collected from the animal, since IgY is purified from the egg yolk. Immunization Schedule Animals are given doses of antigen in the microgram range at 2- to 4-week intervals. A pre-inoculation blood sample is recommended, to ensure that an animal has not been exposed to the antigen of interest and also to use it as a blank to monitor the response of the animal to the antigen during the immunization period. Response is generally monitored by immunoassay. Titer is defined as the dilution of a specific antibody used to reach a specific signal value. During immunization, titer is evaluated by using a given antibody (serum) dilution to monitor the signal increase after each booster dose. By monitoring the titer during the immunization process, it is possible to modify the dose and time between doses. Proper immunization has a significant impact on the quality and performance characteristics of antibodies. It is an empirical process that requires experience. The immunization ends with the bleeding of the animal and
226
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
removal of blood cells and fibrinogen from the blood to obtain the final sera containing the polyclonal antibodies. For the production of monoclonal antibodies, the mouse spleen is harvested. Post-Immunization Antibody specificity and affinity are modified by manipulating the immunization schedule. After the immunization procedure is finished, antibodies need to be characterized in depth to ensure specificity and affinity, which will help select the best-performing antibodies before they are used in assay development. Serum containing antibodies can be used as is, without further treatment, but antibodies can also be purified. Several methods are available to purify antibodies from serum, but the most common procedures use the IgG-binding protein A (or protein G). Purification of antibodies is required when they have to be conjugated to other molecules, such as enzymes, latex and gold particles, radioactive isotopes, or fluorescent labels. Undesired cross-reacting antibodies can be eliminated by immunoaffinity purification. 12.2.2
Polyclonal vs. Monoclonal Antibodies
Polyclonal antibodies (pABs) are a complex mixture of antibodies with different specificities (for different regions of the target or targets) and affinities (binding strength), whereas monoclonal antibodies (mAbs) have a unique specificity and affinity. The production of mAb involves an initial in vivo phase carried out in mice followed by an in vitro phase in cell culture (Figure 12.1). The first stage is similar to the one described in Section 12.2.1, which is the typical procedure used for the production of pAb. The second phase requires the isolation of B lymphocytes (antibody-producing cells)
Antigen Production of Polyclonal Antibodies
Immunization
Serum containing polyspecific antibodies
Antibody-producing cells Hybridoma cells Fusion Tumor cells (cell culture)
Hybriboma screening for antibody production
Hybriboma cloned
Supernatant containing monospecific antibodies
Production of Monoclonal Antibodies
FIGURE 12.1
Production of polyclonal and monoclonal antibodies.
IMMUNOASSAY FORMATS AND PLATFORMS
227
from the spleen of the immunized mouse. Each B cell is responsible for the production of a unique type of antibody. B cells are very difficult to maintain in vitro for long periods of time, making it practically impossible to create B-cell lines. To achieve that, they have to be fused with immortalized myeloma cells, resulting in hybridoma cells that are able to produce antibodies for as long as they are maintained in cell culture. Routine screenings are needed to ensure the selection of hybridomas producing antibodies of the specificity desired. To produce monospecific mAbproducing cell lines, hybridoma cells are individually separated in a procedure called cloning and further expanded. Monospecific antibodies are collected from cell culture supernatant or from ascite fluid if the cloned hybridoma cells are further injected in a mouse. One of the advantages of having a cell line producing a unique antibody is that the quality and characteristics of that particular antibody are lifetime guaranteed. However, in the case of pAb, each immunized animal produces pAbs with unique and unrepeatable properties, which lead to a certain degree of lot-to-lot variability. Monoclonal antibodies are in principle more expensive to produce than pAbs because the screening, selection, and characterization of hybridomas are very time consuming, but it becomes cheaper in the long term once the cell lines are established. The multiple specificity of pAbs makes them very useful for the detection of large molecules, while mAbs are commonly used for the detection of both large and small molecules. The use of either mAbs or pAbs is application dependent. Their use in different assay formats, as well as their advantages and disadvantages, are discussed in the following sections.
12.3
IMMUNOASSAY FORMATS AND PLATFORMS
The development of a good immunoassay is determined by the use of high-quality antibodies. There are numerous immunoassay format designs. The selection of a particular format is determined by a variety of factors, including the characteristics and size of the target molecule, the degree of assay sensitivity and specificity, and the platform where the assay takes place. Regardless of the assay format and platform selected, all immunoassays have the following two components in common: (1) target capture, which is based on the antigen–antibody binding principle, and (2) visualization and measurement of antigen–antibody binding. In this section of the chapter we review the components involved in the most common immunoassays applied to food analysis. Several immunoassay applications and in-depth overviews are available that are recommended for additional information (Gosling, 2000; Wild, 2001).
12.3.1
Labels
Antibody–antigen binding is detected by measuring the signal generated by labels. Numerous labels are available, and selection is based on the application and desired degree of sensitivity.
228
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
1. Enzymes. Enzymes such as horseradish peroxidase and alkaline phosphatase are the most commonly used labels. They give name to the most common immunoassay, enzyme-linked immunosorbent assay (ELISA). The enzyme catalyzes a substrate, producing a measurable product. Two types of substrates are used for ELISA: those that produce a colored product (colorimetric assay) and thoes that form a self-glowing compound (chemiluminescence assay). 2. Fluorescent labels. These emit a determined wavelength after being excited. Such labels have the advantage of increasing sensitivity and to allowing multiplexing, since labels with different emission and excitation wavelengths can be combined within the same assay. 3. Latex and nanogold particles. Latex particles are sold in a variety of colors that can be visualized with the naked eye. Nanogold particles can be used alone or in combination with silver to increase sensitivity. Both types of particles are commonly used in rapid immunoassays such us lateral flow devices. 4. Radioisotopes. Radioisotopes (e.g., 125 I) have been widely used because they provide a high degree of sensitivity. However, in the past few years, the use of this type of label has been discouraged for safety reasons and because of the availability of innocuous and sensitive labels such as fluorophors. Antibody–antigen binding can also be measured without the use of labels in labelfree applications. It is possible to measure the binding because it induces changes in a particular physical property of the assay. Label-free detection is widely used in biosensor applications. 12.3.2
Formats and Design
All immunoassays require the use of a supporting material to immobilize either the antibody or the antigen, depending on the assay design. The most common platform is the polystyrene 96-well microtiter plate. There are other types of supporting materials, such as nitrocellulose or polyvinylidene fluoride (PVDF) membranes or gold-coated chips. The use of ELISA has commonly been associated with the use of microtiter plates. ELISA: Microtiter Plates Microtiter plates are typically composed of 96 wells. High-throughput plates with 384 wells are also available. However, their use is still very limited in food analysis applications. Polyester plates have a high binding capacity. Antibodies, antigens, or haptens are bound to the walls of each well, and the remaining binding spaces are blocked to prevent nonspecific binding to the plate, which can lead to an undesirably high background signal. There are many types of blocking agents, but the most commonly used are proteins such as bovine serum albumin (BSA) and caseins. Immunoassays are classified into two major groups, depending on whether assay reagents are used in excess (noncompetitive assay, Figure 12.2) or are a limiting factor (competitive assays, Figure 12.3). Among noncompetitive assays, sandwich ELISA is one of the most commonly used (Figure 12.2). Capture antibodies bound to the plate bind the target in the first step of
IMMUNOASSAY FORMATS AND PLATFORMS
229
Legend Specific antibody B
Target
B
Co-extractans Enzyme-conjugated Ab S
B
B
S
Biotinylated Ab
B S
Enzyme-conjugated streptavidin Substrate
S
B
S
Results
B
Color = Positive Colorless = Negative
A
B
C
FIGURE 12.2 Noncompetitive immunoassay: (A) direct ELISA; (B) enhanced assay using a biotin–streptavidin system; (C) indirect ELISA.
the assay. Unbound compounds are washed off and the second step involves the addition of the detecting or tracer antibody, which binds the target, resulting in the formation of an antibody–target–antibody complex or sandwich. The detector antibody can be labeled with an enzyme, a fluorophor or biotin, or it can be used unlabeled (Figure 12.2). Biotin-labeled antibodies as well as unlabeled antibodies are used as enhancement systems to improve the assay signal. Biotinylated antibodies are further incubated with streptavidin, which is coupled to a label as described above. Since antibodies can also be targets, labeled anti-species-specific secondary antibodies are used to bind the detector antibody (Figure 12.2C). The signal generated in noncompetitive assay is directly proportional to the concentration of the target analyte in the sample. In competitive assays either the antibody or the target (antigen/hapten) is bound to the supporting material (Figure 12.3). If the molecule bound to the plate is the antibody, the system is incubated with both a known limiting concentration of labeled target and with the sample, which may or may not contain the target molecule (Figure 12.3A). The two targets compete for the antibody sites. The higher the concentration of the analyte in the sample, the larger the displacement of labeled analyte from the antibody. In a second competitive assay format, the antigen or hapten is bound to the plate, which
230
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
Legend Specific antibody Target Co-extractans Enzyme-conjugated Ab Enzyme-conjugated target Substrate
Results A
B
Colorless = Positive Color = Negative
FIGURE 12.3 Competitive immunoassay using (A) an antibody-coated surface, and (B) an antigen-coated platform.
is incubated with a known amount of antibody (labeled or unlabeled) and the sample (Figure 12.3B). A high concentration of the analyte in the sample induces higher antibody binding to the target analyte in the sample and less binding of the antibody to the target bound to the plate (Figure 12.3B). A second step may be required if the antibody is labeled to biotin or is unlabeled (see noncompetitive assay format, Figure 12.2B and C). In competitive assays the signal provided for the assay is inversely proportional to the target molecule in the sample. Competitive assays can be used for both larger and smaller molecules. However, competitive assays are more commonly used than noncompetitive assays for the analysis of small molecules since target size limits the number of antibodies that can bind the target because of stearic hindrance. All the incubations steps are followed by washes to remove unbound material. The effectiveness of wash steps is critical to minimize unwanted background effect. The generated signal (colorimetric, fluorescence, or chemiluminescence) is measured by an ELISA reader. The use of microtiter plate format allows for analysis of multiple samples simultaneously and even automation (especially in high-throughput analysis), which may include processing multiple plates, reagent dispensing, and washing steps. ELISA can be used as a quantitative detection by extrapolating the signal obtained for the target from the standard curve prepared with known concentration of the analyte being tested. Detection limits vary depending on the application. Assays for the detection of mycotoxins are designed to detect low parts per billion (ppb). The analysis of food allergens takes place in the lower parts per million (ppm). However, such low levels of sensitivity are not required for the analysis of other targets, such as those used in the analysis of bioengineered products and speciation.
IMMUNOASSAY FORMATS AND PLATFORMS
231
Rapid Methods: Lateral Flow Devices Lateral flow devices (LFDs) are user-friendly tests that have been used successfully for years to monitor pregnancy and drug abuse. New applications in the analysis of different analytes in foods have also increased in recent years, including testing for food allergens and gluten residues in foods. As with ELISA, there are competitive and noncompetitive formats for LFD. The device is composed of the application pad, which contains detector antibodies (Figure 12.4). In noncompetitive assays, the antibody–antigen complex formed travels along the surface of the nitrocellulose strip by capillary action favored by the sample buffer. Control of the buffer flow is a critical element in achieving a successful assay. The complex goes over two lines, the first one containing capture antibodies that bind the complex at the target site. The second line is used as a control, to ensure that the test has been carried out properly. The sample buffer acts not only as a carrier but also as a wash buffer by removing all the unbound material, which is collected by a pad
Sample pad containing nanogold or latex-conjugated antibodies
1. Blank strip Test line
Control line
2. Sample application
Flow direction
3. Undergoing assay
4. Antibody binding
5. Results Positive Negative Invalid
FIGURE 12.4
Principles of a lateral flow device.
232
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
located at the end of the strip. Antibodies are usually labeled with latex or nanogold particles which are visible to the naked eye. Fluorescent labels are also used, and small handheld readers are available to measure the fluorescent signal. LFDs can be as sensitive as ELISA. They are qualitative in nature and easy to use, and thus do not require trained personnel. An additional advantage of LFDs is that their use does not require complex instrumentation, which makes them suitable for use in the field, such as at industrial equipment and catering installations. However, they are not designed for high-throughput screening. Real-Time Biosensors The detection of target compounds in real time would be the ideal tool for the industry to monitor unwanted contaminants and avoid economical losses due to holding processing activities and storage of suspicious batches. Biosensors, among other sensors, have been widely used in the industry for different applications, including the detection of microorganisms and toxins (Baeumner, 2003). One of the most common biosensors used in the analysis of food products uses surface plasmon resonance (SPR) technology. The principle behind this label-free immunoassay is based on changes in the refractive index of an antibody-coated surface when antigen–antibody binding takes place (Figure 12.5). Several SPR applications have been reported. It has been used widely for the detection of antibiotics. An SPR method has been validated for the detection of sulfonamide residues in milk and pork (Gaudin et al., 2007). It has also been used to detect adulterated milk (Haasnoot et al., 2006) and food allergens (Mohammed et al., 2001; Yman et al., 2006). Biosensors that employ different technologies, such as evanescent wave fluoroimmunosensor for the detection of egg, are also used (Williams et al., 2004)
Polarized light
Light source
Prism
(A)
Flow direction
Antibodies Sensor chip with gold film Reflected light
Optical detection unit
Resonance angle
(B)
Angle Δθ
Resonance Angle shift
Target Flow channel
Reflected Intensity
Multiplexing New analytical trends are focusing on simultaneous detection of several contaminants. Multiplexing also allows minimization of reagent use. Multiplexing takes advantage of the multiple specificity that antibodies can provide. There are two main technologies that can be used: bead-based assays and microarrays. The bead-based technology is based on the flow cytometry principle. Antigen-specific antibodies are bound to small beads containing a combination of two fluorescent compounds in different proportions. Each type of bead is linked to antibodies specific for a particular target. In a
FIGURE 12.5 Principle of a surface plasmon resonance biosensor.
Incidence angle
Δθ Time
IMMUNOASSAY FORMATS AND PLATFORMS
233
sandwich type of assay, the tracer antibody is labeled with a fluorescent label. The detection occurs after the beads are aligned and pass through two laser beams. One of them excites the beads, recognizing the antigen detected, and the second laser excites the label bound to the tracer antibody to allow quantification of the target in the sample. The second technology is the miniaturization of a typical ELISA carried out in slides, which can be made of glass, polymers, or different types of membrane on a solid support. Antibodies or antigens are spotted on the surface of the slide. Spot diameters range from nano- to micrometers. Each spot will be specific for a particular target. The number of microarray applications for the determination of contaminants, drug residue, food allergens, and the degree of adulteration in food products is still very limited because the technology needs to be improved and the pitfalls minimized or eliminated (Seidel and Niessner, 2008). A competitively-based microarray using mAb has been developed for the detection of residues of 10 antibiotics in milk (Knecht et al., 2004). Immunoblotting Immunoblotting requires a first step to separate proteins in a mixture by electrophoresis (Figure 12.6). Proteins can be separated in their native form, but it is more common to
Protein visualization by staining
High MW
Low MW Application of protein mixture to gel
Protein separation by molecular weight (MW) Western blot
FIGURE 12.6
Protein Binding binding by visualization specific antibody Immunoblotting
Scheme for the development of immunoblots.
234
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
use denaturing and reducing conditions, where the proteins lose their tertiary structure and disulfide bonds are broken, facilitating the separation of individual polypeptides along the gel. This type of electrophoresis is called SDS-PAGE. After proteins are separated they are transferred to a membrane (nitrocellulose, PVDF, or nylon) by Western blotting. The next steps are similar to those of a regular ELISA. Free binding sites are blocked and the proteins are detected with specific antibodies. The purpose of this technique, among others, allows the evaluation of antibody specificity and the presence of contaminants such as hidden allergens in food ingredients and processed foods. These applications can confirm or complement the results provided by ELISA. Immunoblots using protein-specific human IgE (marker for food allergy) can be used for diagnostic purposes or to confirm the presence of an allergenic protein in food that has caused an allergic reaction in a sensitive person. However, human IgE is not used to test for food allergens on a regular basis because of the limited availability of human sera and also because of the heterogeneity, in terms of specificity, among IgEs from different sensitive persons.
12.4 PRACTICAL CONSIDERATIONS IN THE USE OF IMMUNOASSAYS In this section we provide some practical considerations to chemists not familiar with the use of immunoassays for food contaminants. We focus primarily on the use of 96-well microtiter ELISA. Regardless of the type of sample and analysis, good laboratory practices (GLPs) and international standards organization (ISO) standards, where they apply, need to be followed to ensure the quality of results and the minimization of variability. Like any other analytical protocol, the analysis of contaminants by immunoassay is a combination of three sequential steps: sample collection and preparation, sample analysis, and data processing followed by the interpretation of results. 12.4.1
Sampling and Sample Preparation
Sample collection is an important component in the analytical process since sampling accounts for one of the major sources of variability. Analytical variability has been evaluated extensively for naturally contaminated samples such as mycotoxins in crops and foods (Vargas et al., 2004; Whitaker, 2006; Whitaker et al., 2006). The way in which sampling is carried out depends on the analyte and the handling and processing practices. For example, sampling for food allergens may not take place only in the food ingredient or final product, but also from surfaces of processing equipment and rinsing solutions after cleaning procedures. Random sampling is more common for food ingredients and finished products. However, there are situations for which samples are not collected randomly. To prevent cross-contact and carryover contamination within a facility, environmental samples are collected by swabbing areas where contamination is more likely to happen. They include corners and surfaces difficult to clean. Sampling also requires special attention to the first food products coming out from
PRACTICAL CONSIDERATIONS IN THE USE OF IMMUNOASSAYS
235
shared lines for allergen- and non-allergen-containing products, because of the higher likelihood for cross-contact (Jackson et al., 2008). To minimize sampling variability, greater sample size has been recommended for the analysis of peanut allergens in chocolate bars and Cry9C in corn flour and meal (Trucksess et al., 2004; Whitaker et al., 2004). There are five major elements of concern during the preparation of food samples that may have a significant impact on the final analytical result if they are not controlled properly: 1. Sample homogeneity. Some adulterated food samples (e.g., cheese sold as made from cheese but made with cow’s milk) are usually more homogeneous than samples containing hidden food allergens due to processing practices. The samples must be representative of the corresponding lot, and they need to be homogenized to ensure analytical reproducibility. 2. Sample extraction buffers. There are critical factors to be considered when selecting the appropriate buffer to be used in immunoassays: . The buffer has to ensure the structural integrity of antibodies, which are proteins. Harsh conditions may affect their binding ability. Aqueous or saline buffers of neutral pH are the most commonly used buffer solutions. However, some buffers can contain a limited amount of organic solvent or reducing and denaturing agents, as reported for the extraction of egg and crustacean allergens (Watanabe et al., 2005; Sakai et al., 2008). These types of extracts need to be diluted before use in ELISA to minimize the effect on antibody–antigen binding. The use of sample extraction buffers does not follow universal rules. Buffers need to be optimized for each particular target (Westphal et al., 2004) and need to be efficient when extracting different food matrices. . Interfering compounds such as polyphenols in chocolate must be minimized. A few extraction enhancers, such as fish gelatin (Stephan and Vieths, 2004) and skimmed dry milk powder (Pomes et al., 2004), can be added to sample extraction buffers to improve the recovery of proteins from complex food matrices. . The buffer must favor antigen–antibody binding. 3. Cross-contact. The possibility of potential cross-contamination during sample preparation can lead to a higher rate of false positives which are not associated with the analytical technique. This issue becomes more critical in the most sensitive immunoassays. The prevention of cross-contamination during sample preparation should be part of the GLPs and should include proper manipulation of the sample, ensuring cleanliness of all material used, and calibration of equipment, including balances and pH meters. Use of disposable material is recommended. When possible, blank samples should be prepared first, followed by the processing of blind samples or samples suspected of containing the target of interest. 4. Target availability/solubility after food processing. There are some practices during sample preparation that may lead to loss of target. For example, some types of glass and membranes used for filtration are known to bind proteins. Proteins can also be
236
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
lost due to excessive blending, vortexing, or heating. Therefore, proper material and practices have to be used for particular targets. 5. Particulate material in extracts. This can cover the walls of the wells or membranes, preventing antibody–antigen binding. To avoid this problem, samples are usually filtered or centrifuged.
12.4.2
Analysis
The following parameters need to be controlled to ensure a successful analytical procedure: 1. Most reagents and buffers are usually kept at 4 C to ensure stability for longer periods of time. However, they need to be brought to room temperature before use, since cool temperatures decrease the antibody–antigen binding rate. 2. Kit manufacturers indicate the number of replicate wells per sample that need to be used in ELISAs, and usually at least two wells per sample are recommended. However, it is not uncommon to use one well per sample for screening purposes. 3. Cross-contamination is very critical in the use of microtiter plates, where adjacent wells can get contaminated during pipetting due to aerosol formation. Also, wells may be contaminated by excessive manual shaking during incubation periods, which can lead to the formation of small droplets dispersing into neighboring wells. 4. The ELISA plates, blots, LFDs, or biosensor chips must be kept undamaged during any analytical procedure. Avoid touching and scratching the surfaces of the device with pipettors, which may lead to the removal of blocking agent and coating antibody or antigen. Scratched devices may be responsible for modification of the final signal, increased background by removal of blocking agent, and decreased assay (antigen–antibody) signal due to removal of the coating antibody or antigen. 5. All sample extracts and standards should be dispensed simultaneously in the corresponding wells, if possible, so that all the samples are incubated for the same approximate period of time. This step is critical in short analytical procedures. To minimize delays between dispensing the first and last samples, it is recommended to place the samples temporarily into low-protein-binding plates or vials, followed by the simultaneous transfer of the samples to the test plate using a multichannel pipettor. 6. The use of orbital shakers increases the exposure of antigens to antibodies favoring antigen–antibody binding. In addition, they increase the homogeneous distribution of the analyte or antibody in solution, which enhances sample reproducibility. 7. Evaporation of buffers during long incubation periods should be prevented by covering the plates with a plate cover or self-adhesive films.
VALIDATION PARAMETERS AND FACTORS AFFECTING PERFORMANCE
237
8. The formation of air bubbles that may alter antigen binding (e.g., immunoblots) and signal measurement (e.g., ELISA plates) must be avoided. 9. Washing steps are critical to remove unbound reagents and to minimize unwanted background. However, background is not always due to improper washing; high background is commonly caused by components in the matrix. 10. Matrix effects may affect assay noise and/or target recovery, thus influencing the final results from both qualitative and quantitative points of view. Changes in assay noise are evaluated by including two different blanks: commonly the zero standard used in the assay (sample extraction solution or diluting buffer) and a matrix-specific blank sample known to be analyte-free. The signals corresponding to the two blanks are compared, and the matrix effect can be reported when the two signals differ significantly. To evaluate the effect of matrix on recovery, a known concentration of the analyte is spiked in the two blanks listed above and the recovery compared. If the recovery of the analyte from the two blanks differs significantly, it can be concluded that there is matrix effect.
12.4.3
Data Processing
Quantitative assays require the use of a calibration curve prepared with known concentrations of the analyte (standard or reference material). The end user has to perform either linear or nonlinear regression in order to extrapolate the concentration of the sample from the standard curve. Some ELISA readers are equipped with software that processes this statistical analysis. Spreadsheets can also be used, as well as commercial statistical packages. Typical nonlinear regression (fitting curves) used in ELISA include, but are not limited to, log-logit and four-parameter. When these options are not available, a more basic alternative is to calculate the final concentration of the analyte in the sample by plotting the optical density (OD) values (y-axis) vs. target concentration (x-axis) on paper and extrapolating manually.
12.5 VALIDATION PARAMETERS AND FACTORS AFFECTING THE PERFORMANCE OF IMMUNOASSAYS To ensure the reliability of analytical techniques, they need to be validated. Validation provides information on the overall performance of the assay as well as on individual parameters and factors that can be used to estimate the degree of uncertainty associated with an assay (Ellison et al., 2000). An adequate validation procedure assesses, and therefore ensures, that the immunoassay performs within an acceptable range of established criteria. Parameters used to evaluate the performance of the assays may be affected by (1) factors inherent to the analytical technique, such as antibody specificity and antibody cross-reactivity, and (2) external factors such as environmental conditions (temperature) and type of sample (matrix, processed food vs. raw ingredients). A
238
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
properly certified reference material suitable for the assay application is a critical element in achieving a successful validation. Institutions such as the U.S. National Institute of Standards and Technology (NIST) and the European Institute for Reference Materials and Measurements (IRMM) offer certified standard materials. Unfortunately, Reference materials are not available for all analytes. An important feature of a good reference material is that it be suitable for the application of interest. For example, whole egg powder reference material (RM) 8415 obtained from NIST was evaluated for its suitability as a reference material for the validation of ELISA kits for egg allergens. However, this reference material was developed originally for the evaluation of metals in foods. The egg powder was found to be unsuitable for use in the evaluation of immunoassays for egg allergens because of solubility issues regarding these proteins (Williams et al., 2004). To overcome this problem, an international working group under the auspices of the Association of Official Analytical Chemists (AOAC), involving regulatory agencies and food industry, evaluated a new egg powder material that has been deposited in NIST as RM 8445. Historically, there have been organizations, such as the AOAC International (www.aoac.org), dedicated to the validation of analytical methods for food nutrients and contaminants, many of which have been adopted worldwide. However, considering the increasing trend in global trade and regulatory activities in the last few years, there is a need for additional efforts to ensure “globally accepted” validated analytical methods. This new scenario is the basis for the formation of MoniQA (monitoring and quality assurance in the food supply chain), a project funded by the European Union (www.moniqa.org). One of the main objectives of the project is not only to provide support for the validation of analytical techniques but also to “harmonize” of standards, including validation protocols and new reference materials. The first step in the validation process involves the establishment of acceptance criteria, which are assay dependent, for the various validation parameters. Assays must meet these criteria in order to receive validation status. The most relevant validation parameters are specificity, accuracy, precision, sensitivity, and robustness. In this section we describe these parameters as they apply to the evaluation of immunoassays. 12.5.1
Specificity
Specificity refers to the ability of an antibody to bind the target of interest exclusively. Antibodies may show different degrees of specificity. They can recognize a particular target only, or they can be designed to bind related targets from different species. For example, most of the antibodies used in the detection of gluten are specific for gliadins (wheat), secalins (rye), and hordeins (barley) (Skerrit and Hill, 1991; Mendez et al., 2005). A concept related to specificity is cross-reactivity, which describes the ability of antibodies to bind compounds other than the desired targets. Cross-reactivity usually takes place when a sample contains compounds related structurally to the target molecule. To illustrate how cross-reactivity is evaluated in the determination of a specific ELISA, extracts of closely related commodities or foods are usually included in the evaluation of a particular ELISA method. Positives values would indicate crossreactivity.
VALIDATION PARAMETERS AND FACTORS AFFECTING PERFORMANCE
12.5.2
239
Accuracy
Accuracy determines how close the analytical value is to the real concentration of the target in the sample. Recovery percentage is the parameter used to measure accuracy. Recovery studies are performed by spiking the sample with a known concentration of the analyte, extracting the sample using the assay extraction procedure, and evaluating how much analyte is detected by the assay. It is important to highlight that concentration units used for spiking must be consistent with those reported by the assay. For example, if the assay report results as mg/kg of protein, spiking concentration needs to be identified as mg/kg of protein material. For many analytes, the preparation of spiking material and the way in which the sample is spiked have not been standardized. Moreover, additional concerns are raised for the spiking method used for the study of recovery of the target from processed samples. Different approaches has been reported for the validation of ELISA methods for food allergens and gluten: (1) addition of the reference material to the food matrix before extraction (Whitaker et al., 2005; Yeung et al., 2000) and (2) production of incurred model foods by spiking reference material in the ingredient mix before the food is processed (Hefle and Lambrecht, 2004; Sakai et al., 2008). The first option is more suitable for assays designed to analyze raw ingredients, but the second option is generally considered more appropriate for assays intended to analyze processed foods. There are several drawbacks to the use of incurred samples, including the cost of producing this type of sample, the risk of producing nonhomogeneous material and the potential lost and modifications of the target during food processing . It is recommended that several matrices be used in recovery studies. It is practically impossible to analyze every matrix, but it is acceptable to select the most representative, including those that are more problematic. A variety of factors affect the accuracy of the assay: 1. Food processing. Food systems are complex mixtures of ingredients of diverse nature that undergo an unknown number and types of modifications as a result of food processing (e.g., baking, frying, irradiation, extrusion, acidification, fermentation). The impact of food processing on large molecules such as proteins can lead to denaturation, aggregation, binding to other food components, and protein breakdown into smaller fragments. They all contribute to a decrease in analyte solubility. This is an important factor to consider in recovery studies using incurred samples. Another outcome of food processing is the modification of the analyte structure, which has a major impact on larger molecules such as proteins. This modification can negatively affect antigen–antibody binding, which is dependent on the integrity of the analyte structure. One of the potential solutions to overcoming this problem is to use antibodies specific for the modified form of the protein, stable proteins, or stable peptides (Yeung et al., 2000; de Luis et al., 2007; Sakai et al., 2008). Additional information on the effect on food proteins of various food practices may be found in the book edited by Yada (2004). 2. Matrix effect and interfering compounds. Some food matrices have a negative impact on target recovery. In the majority of the cases, the interfering food component is unknown. Dark chocolate is one of the most difficult food matrices. It contains
240
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
polyphenols that are known to bind proteins, including antibodies, therefore affecting target availability and antigen–antibody binding. 3. Assay calibrators vs. reference material. Ideally, the material used to calibrate the immunoassay and the reference material used to validate it should be the same. This is not usually an issue for some compounds, such as mycotoxins, antibiotics, and pesticides. However, for other type of targets, such as proteins, reference materials are not always available, or if they exist, they have not been fully characterized. This is a very common issue in the development and validation of immunoassays for food allergens. If calibrators and reference materials are different, the antibodies may show a different affinity for the targets in each material, therefore increasing or decreasing recovery values or leading to false-positive or falsenegative results.
12.5.3
Precision
Precision is a marker for assay reproducibility. It really measures the error or variability observed during analysis of the same sample. Repeatability provides an idea of the variability resulting from multiple measurements of the same sample within the same assay lot within the same day (intraassay variation). Reproducibility refers to the variability associated with analysis of the same sample on different days (interassay variation), and when the sample is analyzed with different assay lots (interlot variability). Immunoassays are biological assays in nature, meaning that they show a higher degree of variability than do other analytical chemical techniques, such us chromatography. Error can also be introduced by the analyst during sample preparation or during the analysis. Reducing this type of error can be achieved by training the analyst properly by highlighting the negative effects of inadequate manipulation of samples and analysis in the final result.
12.5.4
Sensitivity
Sensitivity refers to the lower limit of detection (LOD) of the assay (i.e., the lowest concentration of the analyte that the assay can distinguish from the blank). Limit of quantitation (LOQ) is another parameter related to the use of quantitative assays, which is the lowest concentration of the analyte that can be measured with an acceptable level of precision. Levels below LOQ have an increased degree of statistical uncertainty, which affects the accuracy of the method. There are no standardized definitions and calculations to determine LOD and LOQ for immunoassays. Different definitions of LOD and LOQ have been established by various organizations, such as the International Union of Pure and Applied Chemistry and the American Chemical Society. However, they are not necessarily appropriate for immunoassays since these types of assays commonly have a higher degree of variability.
DIFFERENCES BETWEEN IMMUNOASSAYS AND DNA-BASED DETECTION
12.5.5
241
Robustness
Robustness defines the ability of the immunoassay to perform within specifications (remain unaffected) when it is subjected to variations of analytical conditions, such as changes in temperature, incubation times, and changes in test sample volumes. It is a measure of reliability during normal use of the assay.
12.6 DIFFERENCES BETWEEN IMMUNOASSAYS AND DNA-BASED DETECTION Basically all natural contaminants, such as food allergens or adulterating agents such as cow’s milk in other species’ milk, can be detected by antibody-based applications as well as by alternative DNA-based assays. However, artificially synthesized components can only be determined by the use of immunoassays, since they have no DNA associated with their production. Refer to Chapter 9 for further information on DNA-based assays for food allergens. Both methods have their advantages, disadvantages, and commonalities. The principal advantage of immunoassays over DNA assays is the fact that they detect the actual component of interest (i.e., food allergens, mycotoxins, and species-specific proteins used in speciation, among others), whereas DNA is used only as a marker for the presence of these components in food ingredients or processed foods. Further comparisons between the two are described below. Targets 1. DNA is more stable and less variable in terms of structure and composition than are other large molecules, such as proteins, which are targeted by immunoassays. This factor, along with the fact that DNA databases are more complete than protein databases, allows for easier development of DNA-based tests such as PCR and RT-PCR. 2. Large entities such as proteins vary greatly in terms of structure and stability. These factors must be considered during the production of antibodies and development of the immunoassay. Assay Development 1. In general terms, DNA-based assays are easier to develop than immunoassays since the only requirements are the availability of the gene or DNA sequence to be targeted. These sequences are needed to design primers (PCR) and probes (RT-PCR) as well as for determining the G/C ratio to optimize assay conditions. This information can be obtained from databases, and software is available to facilitate the design of primers and probes. These probes have also become less expensive to produce. 2. The quality and consistency of reagents for PCR is constant between lots. However, antibodies produced by different individuals or species of animals differ in
242
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
their performance characteristics and need to be evaluated to provide some degree or consistency between lots. 3. Immunoassays are more complex to develop, for several reasons. The target of interest is not always known, or it is not well characterized. Moreover, the production of antibodies is time consuming and antibodies need to be further characterized to evaluate their suitability for an application in terms of specificity and sensitivity.
Assay Parameters 1. Specificity. Both assays can be equally specific, depending on the target, if primers and antibodies are selected carefully. However, a higher degree of crossreactivity is expected in immunoassays because some target proteins may show a high degree of homology with cross-reactanting proteins. For example, the fish allergen parvalbumin is a very conserved protein among different fish species that makes the development of species-specific immunoassay very difficult. This problem is easily resolved by the use of DNA-based assays. 2. Sensitivity. It has traditionally been recognized that immunoassays are more sensitive than PCR or RT-PCR. In many cases, low sensitivity is not always required, and both immunoassays and DNA tests are easily able to detect approximate concentrations of target in total food. For example, many studies comparing ELISA assays and PCR-based methods for the detection of food allergens have shown a high degree of agreement (Meyer et al., 1996; Holzhauser et al., 2000, 2002; Dahinden et al., 2001; Stephan and Vieths, 2004; Hirao et al., 2006; Yamakawa et al., 2007; Bettazzi et al., 2008; Demmel et al., 2008; Piknova et al., 2008). However, PCR can also be more sensitive than its ELISA counterpart. An example is the commercial PCR for soybean, which has been reported to be 1000 times more sensitive than its commercial ELISA counterpart (www.tepnel.com). ELISA is more sensitive in those products naturally containing low numbers of DNA copies, much as egg and milk. 3. Sample preparation. Although there is not a “gold standard” for sample preparation and target extraction for analysis by immunoassay, most use saline buffers (e.g., phosphate-buffered saline, Tris saline buffer, high-salt buffers) at neutral pH to prevent interference and inhibition of antigen–antibody binding. Similarly, there is no standardized extraction method for DNA-based assays, and extraction efficiency is matrix dependent. However, unlike immunoassays, DNA-based assays will withstand the use of harsh conditions. 4. Matrix effect. Both assays are known to have issues with some matrices. Moreover, PCR and RT-PCR can be affected by the presence of inhibitors in food samples. 5. Food processing. Basically all types of processing activities have a negative impact on the integrity, stability, and recovery of DNA, proteins, and other food contaminants. Heating, acidification, fermentation, and irradiation, just to mention a few processing procedures, can affect different types of proteins or DNA.
REFERENCES
243
6. Quantification. Quantification is possible by both immunoassays and DNAbased tests. Both can be quite reliable in the analysis of raw materials. However, because of the loss of target during processing, it is very difficult to determine original target concentration in the food product. Therefore, quantification of the compound of interest in processed food is often underestimated. Moreover, different results are expected in those situations where protein fractions, containing no or low DNA, are used as ingredients (Stephan and Vieths, 2004).
12.7
CONCLUSIONS
The versatility and nature of immunoassays allow the detection of virtually any type of compound. The reliability of these detection methods is assessed by validation studies, although they are not always easy to carry out, due to the nature of the analyte and the lack of reference materials. These assays are used by food industry and regulatory agencies for different purposes. Immunoassays can be used by the food industry to (1) guarantee the safety of their product and the effectiveness of cleaning procedures, (2) ensure labeling accuracy, (3) comply with local and international regulations, and (4) provide information for risk assessment and risk management activities. Regulatory agencies may also use immunoassays in (1) compliance programs, (2) enforcement activities, and (3) risk assessment activities. Applications of immunoassays to indicate economic adulteration, and the determination of undeclared food allergens in processed foods are described in the following chapters.
REFERENCES Baeumner AJ (2003). Biosensors for environmental pollutants and food contaminants. Anal. Bioanal. Chem., 377(3):434–445. Bettazzi F, Lucarelli F, Palchetti I, Berti F, Marrazza G, Mascini M (2008). Disposable electrochemical DNA-array for PCR amplified detection of hazelnut allergens in foodstuffs. Anal. Chim. Acta, 614(1):93–102. Dahinden I, von B€uren M, L€uthy J (2001). A quantitative competitive PCR system to detect contamination of wheat, barley or rye in gluten-free food for coeliac patients. Eur. Food Res. Technol., 212:228–233. de Luis R, Perez MD, Sanchez L, Lavilla M, Calvo M (2007). Development of two immunoassay formats to detect beta-lactoglobulin: influence of heat treatment on betalactoglobulin immunoreactivity and assay applicability in processed food. J. Food Prot., 70(7):1691–1697. Demmel A, Hupfer C, Ilg Hampe E, Busch U, Engel KH (2008). Development of a real-time PCR for the detection of lupine DNA (Lupinus species) in foods. J. Agric. Food Chem., 56(12):4328–4332. Ellison SLR, Rosslein M, Williams A (eds.) (2000). Eurachem/CITAC Guide: Quantifying Uncertainty in Analytical Measurement, 2nd ed. Eurachem, St. Gallen, Switzerland.
244
ANTIBODY-BASED DETECTION METHODS: FROM THEORY TO PRACTICE
Gaudin V, Hedou C, Sanders P (2007). Validation of a Biacore method for screening eight sulfonamides in milk and porcine muscle tissues according to European Decision 2002/657/ EC. J. AOAC Int., 90(6):1706–1715. Gosling JP (ed.) (2000). Immunoassays: A Practical Approach. Oxford University Press, New York. Haasnoot W, Marchesini GR, Koopal K (2006). Spreeta-based biosensor immunoassays to detect fraudulent adulteration in milk and milk powder. J. AOAC Int. 89(3):849–855. Harlow E, Lane D (eds.) (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Harlow E, Lane D (eds.) (1998). Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Hefle SL, Lambrecht DM (2004). Validated sandwich enzyme-linked immunosorbent assay for casein and its application to retail and milk-allergic complaint foods. J. Food Pro. 67(9):1933–1938. Hirao T, Hiramoto M, Imai S, Kato H (2006). A novel PCR method for quantification of buckwheat by using a unique internal standard material. J. Food Pro. 69(10):2478–2486. Holzhauser T, Wangorsh A, Vieths S (2006). Polymerase chain reaction (PCR) for detection of potentially allergenic hazelnut residues in complex food matrixes. Eur. Food Res. Technol. 211:360–365. Holzhauser T, Stephan O, Vieths S (2002). Detection of potentially allergenic hazelnut (Corylus avellana) residues in food:a comparative study with DNA PCR-ELISA and protein sandwich–ELISA. J. Agric. Food Chem., 50(21):5808–5815. Howard GC, Bethell DR (eds.) (2001). Basic Methods in Antibody Production and Characterization. CRC Press, Boca Raton, FL, 2001. Jackson LS, Al-Taher FM, Moorman M, et al. (2008). Cleaning and other control and validation strategies to prevent allergen cross-contact in food-processing operations. J. Food Pro. 71(2):445–458. Knecht BG, Strasser A, Dietrich R, Martlbauer E, Niessner R, Weller MG (2004). Automated microarray system for the simultaneous detection of antibiotics in milk. Anal. Chem., 76(3):646–654. Mendez E, Vela C, Immer U, Janssen FW (2005). Report of a collaborative trial to investigate the performance of the R5 enzyme linked immunoassay to determine gliadin in gluten-free food. Euro. J. Gastroenterol Hepatol., 17(10):1053–1063. Meyer R, Chardonnens F, H€ubner P, L€uthy J (1996). Polymerase chain reaction (PCR) in the quality and safety assurance of food: detection of soya in processed meat products. Z. Lebensm. Unters. Forsch., 203(4):339–344. Mohammed I, Mullett WM, Lai EPC, Yeung JM (2001). Is biosensor a viable method for food allergen detection? Anal. Chim. Acta, 444(1):97–102. Piknova L, Pangallo D, Kuchta T (2008). A novel real-time polymerase chain reaction (PCR) method for the detection of hazelnut in foods. Euro. Food Res. Technol., 226(5):1155–1158. Pomes A, Vinton R, Chapman MD (2004). Peanut allergen (Ara h 1) detection in foods containing chocolate. J. Food Pro., 67(4):793–798. Sakai S, Matsuda R, Adachi R, et al. (2008). Interlaboratory evaluation of two enzyme-linked immunosorbent assay kits for the determination of crustacean protein in processed foods. J. AOAC Int., 91(1):123–129.
REFERENCES
245
Seidel M, Niessner R (2008). Automated analytical microarrays: a critical review. Anal. Bioanal. Chem., 391(5):1521–1544. Skerrit JH, Hill AS (1991). Enzyme Immunoassay for determination of gluten in foods: collaborative study. J. AOAC Int., 74:257–264. Stephan O, Vieths S (2004). Development of a real-time PCR and a sandwich ELISA for detection of potentially allergenic trace amounts of peanut (Arachis hypogaea) in processed foods. J. Agric. Food Chem., 54:3754–3760. Trucksess MW, Whitaker TB, Slate AB, et al. (2004). Variation of analytical results for peanuts in energy bars and milk chocolate. J. AOAC Int., 87(4):943–949. Vargas EA, Whitaker TB, Santos EA, Slate AB, Lima FB, Franca RC (2004). Testin green coffee for ochratoxin A: I. Estimation of variance components. J. AOAC Int., 87(4):884–891. Watanabe Y, Aburatani K, Mizumura T, et al. (2005). Novel ELISA for the detection of raw and processed egg using extraction buffer containing a surfactant and a reducing agent. J. Immunol. Methods, 300(1–2):115–123. Westphal CD, Pereira MR, Raybourne RB, Williams KM (2004). Evaluation of extraction buffers using the current approach of detecting multiple allergenic and non-allergenic proteins in food. J. AOAC Int., 87(6):1458–1465. Whitaker TB (2006). Sampling foods for mycotoxins. Food Addit. Contam., 23(1):50–61. Whitaker TB, Trucksess MW, Giesbrecht FG, Slate AB, Thomas FS (2004). Evaluation of sampling plans to detect Cry9C protein in corn flour and meal. J. AOAC Int., 87(4): 950–960. Whitaker TB, Williams KM, Trucksess MW, Slate AB (2005). Immunochemical analytical methods for the determination of peanut proteins in foods. J. AOAC Int., 88 (1):161–174. Whitaker TB, Slate AB, Jacobs M, Hurley JM, Adams JG, Giesbrecht FG (2006). Sampling almonds for aflatoxin: I. Estimation of uncertainty associated with sampling, sample preparation, and analysis. J. AOAC Int., 89(4):1027–1034. Wild D (ed.) (2001). The Immunoassay Handbook, 2nd ed. Nature Publishing Group, New York. Williams KM, Shriver-Lake LC, Westphal CD (2004) Determination of egg proteins in snack food and noodles. J. AOAC Int., 87(6):1485–1491. Yada RY (ed.) (2004). Proteins in Food Processing. CRC Press, Boca Roton, FL. Yamakawa H, Akiyama H, Endo Y, et al. (2007). Specific detection of soybean residues in processed foods by the polymerase chain reaction. Biosc. Biotechnol. Biochem., 71(1):269–272. Yeung JM, Newsome WH, Abbott M (2000). Determination of egg proteins in food products by enzyme immunoassay. J. AOAC Int., 83(1):139–143. Yman IM, Eriksson A, Johansson MA, Hellenas KE (2006). Food allergen detection with biosensor immunoassays. J. AOAC Int., 89(3):856–861.
PART IIb
IMMUNOLOGICAL METHODS: APPLICATIONS
CHAPTER 13
Animal Specification in Speciation BRUCE W. RITTER and LAURA ALLRED ELISA Technologies, Inc., Gainesville, Florida
13.1
INTRODUCTION
Immunoassays were originally developed for clinical testing due to the unique ability of properly characterized antibodies to identify specific proteins. Using techniques to stimulate the immune system of test animals to produce antibodies to selected antigens and then to use the antibodies to indicate detection of the protein selected enabled detection of a wide range of targets. From the early days of observation of precipitating antibodies, through tagging antibodies with radioactive isotopes, to the use of enzymes and substrates to produce visual results, all giving indications that the antibodies had found their target, the use of antibodies to detect specific proteins has been used for many years in human diagnostics. The methodologies were well developed for clinical tests when it became apparent that the methods could be adapted for detection of meat species and other food testing needs with the development of suitable antibodies. The application of immunoassay techniques to determine the species of meat was among the first immunoassays directed toward foods and food products. For several decades immunological tests have been the preferred choice for the speciation of animal products due to their specificity, sensitivity, low cost, rapid results, and ease of use. From the early days of the Ouchterlony assay (Ouchterlony, 1948), immunological analysis has developed to provide both rapid field tests and quantitative assays for laboratory use (for a thorough review of method development in speciation, refer to Hsieh, 2004). Following is a list of immunologic assays used for food testing, ranked in order of the frequency of their use per company: . .
Enzyme-linked immunosorbent assay (ELISA) Enzyme immunoassay (EIA)
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
249
250 . . . . . . . . . . . . . . . . . . . . . .
ANIMAL SPECIFICATION IN SPECIATION
Immunoblotting Immunodiffusion Immunoaffinity chromatography (IAC) Radioimmunoassay (RIA) Immunoelectrophoresis (IE) Immunoprecipitation Fluorescence immunoassay Agglutination immunoassays Enzyme-linked fluorescent immunoassay Chemiluminescence immunoassay (CIA) Flow injection immunoanalysis Immunomagnetic flow cytometry Chemiluminescent enzyme immunoassay (CLEIA) Fluorescence polarization immunoassay (FPIA) Immunodotting Immunofluorescence flow cytometry Immunoassay-capillary electrophoresis Immunoradiometric assay (IRMA) Enhanced chemiluminescent immunoassay High-performance immunoaffinity chromatography Flow-through membrane enzyme immunoassay Time-resolved fluorescence immunoassay
The testsused most frequently forspeciationof animalproductsarethe enzyme-linked immunosorbent assay (ELISA), including immunosticks and, more recently, lateral flow immunoassays (LFIAs), the latter of which now use latex particles or colloidal gold for detection rather than the older enzyme immunoassay (EIA) technology (see Table 13.1). Immunoassays require minimal analyst training, but provide sensitive and specific results. Their flexibility is limited only by the availability of an antibody that is specific to the protein(s) in question and a suitable methodology for extracting the protein(s) of interest. By modifying the parameters of the assay and the extraction protocol, immunoassays can detect species-specific proteins at concentrations as low as 1 ppb, and can recognize proteins that have been extensively heat treated, hydrolyzed, or otherwise processed. Whereas most clinical assays are directed toward serum, urine, or tissue samples that have not been cooked or processed, the application of immunoassays to food products adds the additional challenge of identifying targets in the widely varying food matrices. Current species immunoassays employ highly specific antibodies directed to soluble protein targets that are easily extracted and retain their species specificity. Uses for the antibodies range from simple rapid screening tests to robust regulatory confirmatory tests. In the following sections we discuss the regulations involving animal speciation, the antibodies used, sample types, and test formats with a description and guidelines for the
251
ELISA-TEK Cooked Meat ELISA-TEK Raw Meat MELISA-TEK Ruminant MELISA-TEK Pork
Reveal Meat Species
FeedCheck
Biokits Cooked Meat Biokits Raw Meat
ELISA Technologies, Inc. (www.elisa-tek.com)
Neogen Corporation (www.neogen.com)
Strategic Diagnostics (www.sdix.com)
Tepnel Biosystems Ltd. (www.tepnel.com)
BF, SH, GO BF, SH, GO BK, PK, CK
Bear
BF, PK, PL, SH, HS BF, PK, PL, SH, HS, BU, CK, GO, KA, RA, TU BF, PK, PL, SH, HS, BU, CK, GO, KA, RA, TU
Mammals
BF, SH
BF, PK, PL, SH, HS, WT BF, PK, PL, SH, HS BF, SH PK
Species a
0.5–2 0.01–0.5 2
?
2
1 1
1
1
1 1 0.1 0.1
LOD%
Immunostick ELISA Immunostick
Immunostick
Immunostick
ELISA ELISA
LFIA
LFIA
ELISA ELISA ELISA ELISA
Format
Source: Ibanez and Cifuentes (2001).
BF, beef; PK, pork; PL, poultry; SH, sheep; HS, horse; WT, white-tailed deer; BU, buffalo; CK, chicken; GO, goat; KA, kangaroo; RA, rabbit; TU, turkey.
IC Milk Speciation RC Milk Speciation Sensor Meat Species
Z.E.U. Inmunotech (www.zeu-inmunotec.com)
a
Bear Detection Kit
WSPA (www.wspa-international.com)
FAST (Raw)
Assay
Immunoassays Used in the Analysis of Food Products
Company
TABLE 13.1
252
ANIMAL SPECIFICATION IN SPECIATION
use of the ELISA and LFIA methods that are employed in speciation testing, including protocols, data interpretation, troubleshooting tips, and sources of error for each assay type. This general information will be followed by a detailed section on the development and use of immunoassays for meat speciation.
13.2
REGULATIONS INVOLVING ANIMAL SPECIATION
Every developed country has laws and regulations concerning the labeling and reporting of animal species content in food products intended for human consumption (e.g., USDA–FSIS, 1984; Republic of the Philippines, 1991; EC, 2001b). These regulations are designed primarily to prevent economic adulteration and consumer fraud, in which a cheaper source of meat (e.g., horse) might be substituted for a more expensive meat (e.g., beef). As worldwide trade in meat and dairy products has increased, countries have developed more extensive legislation to govern their import. These expanded regulations are designed to prevent fraud, but more importantly, they are meant to prevent the spread of livestock-borne diseases, to prevent the distribution of products that are prohibited in certain parts of the world for religious and cultural reasons, and to protect endangered species from entering the marketplace. Following the outbreak of bovine spongiform encephalopathy (BSE) in the United Kingdom (UK) in 1987, and its subsequent sporadic appearance in other countries, speciation of animal products became essential in the production and sale of feeds for livestock consumption. Until the early 1990s, animal by-products and processed animal proteins (PAPs), such as meat and bone meal (MBM), were sources of protein in the diets of most commercially raised livestock. The UK alone produced 400,000 metric tons of MBM in 1988 (MAFF, 1990), and the United States, the largest producer of animal feed in the world (Gill, 2004), used over 4 million metric tons of animal products as animal feed ingredients in 1984 (USDA, 1988). After the determination that ruminant MBM is the agent of transmission for BSE (Wilesmith et al., 1988; Horn, 2001; Prince et al., 2003; Thiry et al., 2004), the European Union (EU) banned the feeding of ruminant proteins to ruminant animals in 2001 (EC, 2001b). This was followed by a ban prohibiting feeding of animal proteins to any livestock of the same species (EC, 2002). Due to a lack of species-specific analytical methods, however, this species-to-species feed ban was found to be unenforceable, resulting in reliance on an earlier ban on feeding processed animal proteins to any farm animal (EC, 2000). The goal of the EU is the prevention of ruminant-to-ruminant, swine-to-swine, and poultry-to-poultry feeding practices (van Raamsdonk et al., 2007), which can only be enforced by the use of sensitive tests for the presence of species-specific proteins in processed animal feeds. In the United States, the Harvard study established the importance of restricting the use of MBMs in ruminant feeds. A U.S. Food and Drug Administration (FDA) regulation was established in 1997 to decrease the possibility of BSE in the United States. This regulation and the update in April 2008 bans the feeding of ruminant to ruminant with the exception of milk and milk products, blood, gelatin, and “plate waste.” This regulation increased the difficulty of enforcement due to the tissue specificity required.
REGULATIONS INVOLVING ANIMAL SPECIATION
TABLE 13.2
253
Government Agencies Regulating the Speciation of Animal Products
Country
Agency
Argentina Australia Austria Brazil Canada Chile China Costa Rica Croatia
Servicio Nacional de Sanidad y Calidad Agroalimentaria Australian Quarantine and Inspection Service Veterinary Services, Meat Hygiene/Residue Control Departamento de Inspe¸c~ao de Produtos Origem Canadian Food Inspection Agency Servicio Agrıcola y Ganadero AQSIQ Ministry of Agriculture and Livestock, Division of Animal Health Ministry of Agriculture, Forestry and Water Management, Veterinary Administration State Veterinary Administration Danish Veterinary and Food Administration Community Reference Lab for Feed, Food, Milk and Milk Products National Veterinary and Food Research Institute, Meat Hygiene Unit Federal Office of Consumer Protection and Food Safety Official Inspection Service of Products of Animal Origin Ministry of Agriculture and Regional Development, Animal Health and Food Control Department Agricultural Authority of Iceland The Irish Agriculture and Food Development Authority (Teagasc) Ministry of Agriculture and Rural Development, Veterinary Services and Animal Health Ministry of Health, Department of Food and Nutrition and Public Veterinary Health Ministry of Agriculture, Forestry and Fisheries, National Food Research Institute Department of Veterinary Services, Kenya Bureau of Standards Servicio Nacional de Sanidad Inocuidad y Calidad Agroalimentaria Ministry of Agriculture, Nature and Food Quality New Zealand Food Safety Authority, Meat Monitoring Service Ministerio Agropecuario y Forestal Food Standard Agency, Department of Agriculture and Rural Development Department of Agriculture, National Meat Inspection Service General Veterinary Inspectorate Ministry of Agriculture, Food and Rural Development, National Sanitary Veterinary Agency Istituto Sicurezza Sociale, Veterinary Services Agriculture and Fisheries Ministry Agri-Food and Veterinary Authority of Singapore Animal Genetics Lab, ARC Animal Improvement Institute Ministerio de Sanidad y Consumo, Sanidad Exterior y Veterinaria Food Control Department, Meat Inspection Division United States Department of Agriculture, Food Safety Inspection Service Ministerio de Ganaderıa, Agricultura y Pesca, Servicios Ganaderos, Division Industrial Animal
Czech Republic Denmark European Union Finland Germany Honduras Hungary Iceland Ireland Israel Italy Japan Kenya Mexico Netherlands New Zealand Nicaragua Northern Ireland Philippines Poland Romania San Marino Saudi Arabia Singapore South Africa Spain Sweden United States Uruguay
254
ANIMAL SPECIFICATION IN SPECIATION
In the face of BSE, as well as other highly contagious diseases such as foot-andmouth disease and avian influenza, many countries within and outside the EU regularly limit the importation of certain species from affected areas and regulate the use of animal products regardless of their source. For example, the U.S. Department of Agriculture (USDA) regularly updates a list of animal products eligible for export to the United States, listed by country (www.fsis.usda.gov/PDF/Countries_Products _ Eligible_for_Export.pdf). Most countries, even within the EU, will not import meat or meat products from the UK, and have eliminated the use of animal proteins in animal feeds even when the products are of domestic origin. Due to recent instances of BSE in the United States, Japan, Korea, and other countries have adopted strict regulations on the importation of beef from the United States. Russia, Indonesia, Brunei, Cambodia, Laos, and Myanmar currently have bans on the importation of U.S. beef, and China has limited the importation of U.S. beef and pork from certain manufacturers. Each of these countries, along with most other developed nations, have government institutions in place to test food and feed products for animal species content prior to import or export (Table 13.2), and many food and feed manufacturers chose to test their products for species content in-house prior to export, rather than risking having a shipment rejected at its destination. Animal product bans are also instituted for reasons other than public health. Although many Middle Eastern countries will import beef, they ban the importation of pork or pork-containing products for religious reasons. Other regulations on species content are requiring advances in the technology of speciation, such as the EC’s Novel Food Regulation, which prohibits the importation of animal products that are not from species considered to be domestic livestock (EC, 1997), the International Whaling Commission’s ban on commercial whaling [International Whaling Commission Schedule, 1986, para. 10(e)] and attempts by southeastern U.S. fisheries to prevent the fraudulent substitution of basa or tra species for grouper (Florida Department of Business and Professional Regulation, 2007). Each of these and many other regulations require the use of accurate, sensitive screening tools to determine the species content of foods and feedstuffs.
13.3 INTRODUCTION TO IMMUNOASSAYS: ANTIGENS AND ANTIBODIES All immunoassays are based on antibodies directed toward specific antigens. An antigen is any protein that can induce an antibody response. Within any antigenic protein are one or more amino acid sequences that are the target of the immune response. These sections of the antigen are called epitopes, and their ability to induce an antibody response is dependent on the secondary and tertiary structure of the overall protein as well as on the epitope’s individual amino acid sequence. Antibody preparations are typically referred to as monoclonal if they detect only one epitope on one protein, or polyclonal if they detect multiple epitopes and/or multiple proteins. The type of processing that a product undergoes will affect the presentation of antigenic epitopes and therefore affect the ability of antibodies to recognize that epitope. The most common example of this is heat treatment, which alters the
MEAT SPECIATION ASSAYS
255
secondary and tertiary structure of proteins, changing or masking antigenic sites. This is why speciation kits are divided into tests for raw, cooked, and rendered products. Albumin, which is a common target for species testing in raw products, is easily denatured by heat and is no longer recognized by antialbumin antibodies after a product is cooked. Conversely, many of the epitopes recognized by antibodies in species testing of cooked products are not present in raw samples and are apparently created or exposed by the denaturing effects of heat treatment. Along with heat treatment, many proteins are hydrolyzed either chemically or enzymatically, and the extent of hydrolysis can affect their performance in speciation assays. A detailed introduction to immunoassays is given in Chapter 12.
13.4
MEAT SPECIATION ASSAYS
The majority of immunoassays for speciation are used to analyze raw, cooked, or otherwise processed meats from terrestrial, commercially raised livestock (beef, pork, poultry, sheep, horse, and deer). Early speciation tests worked only in raw, unprocessed samples. Over time, however, tests have been developed that can speciate cooked meats as well as highly processed products such as meat and bone meals. In this section we give a detailed explanation of the development and use of immunoassays specific to this area of speciation testing. 13.4.1
Development of Meat Speciation Assays
The earliest species immunoassays targeted raw or uncooked products. Species serum albumins, a major protein in an animal’s blood, was a natural target, and antibodies were raised to provide the earliest meat species tests. However, the albumins were easily denatured by heating, and cooked and canned meat products remained out of the reach of the tests that relied on detection of the albumin proteins. The high concentration of albumins in uncooked meat products allows these tests to be the most sensitive of the species immunoassays. Indeed, a pork serum albumin assay was generated to test the safety of needle-free injectors that achieved a limit of detection of 1 pg. However, most raw species tests target economic adulteration, and because adulterating a product with minute amounts of cheaper meats does not provide an economic advantage, regulatory testing is generally interested only in adulterations exceeding 1%. As the albumins are readily denatured by heating, tests employing antispecies albumin antibodies are not effective with cooked or processed products. Development of the cooked meat species ELISA (CMSE) by Berger and Mageau at the USDA–FSIS labs in the 1980s was the first practical method for monitoring meat species adulterations in cooked, canned, or processed products. Prior to the introduction of the method as a regulatory tool in 1986 there was no dependable, effective, or readily available method for determining the species of meat once it was heated. The only means of monitoring prior to development of the CMSE was through record keeping and was not very effective. Industry leaders reported that the “cheaters” were selling all beef products such as hot dogs and sausages at prices lower than the cost of making real all-beef products.
256
ANIMAL SPECIFICATION IN SPECIATION
BEEF LSMT CONTROL @ 0.5%
1.2
ELISA ELISA OD 415nm, MELISA OD 450nm
1 MELISA 0.8 0.6 0.4 0.2 0 100 C
111 C
126 C
133 C
138 C
0.5% BEEF LSMT CONTROL
FIGURE 13.1 Diluted control aliquots of the same lean skeletal muscle tissue following treatment across a range of increasing heat and pressure. The graph shows the absorbance values produced by using antibodies against the species-specific heat-resistant glycoproteins developed for the CMSE and by using antibodies to the heat-stable species Troponin I developed for detection of species in the highly heated EU MBMs.
The USDA’s development of the CMSE changed the landscape of meat species testing. From detection of intentional adulterations to finding problems with rework and improper cleaning of processing equipment, the CMSE became the method of choice and has been an important regulatory tool in the United States and indeed around the globe. The key to the success of the CMSE was the development of antibodies to heat- resistant glycoproteins that are species or species group specific, are found in all blood-fed tissues, and are detectable in cooked and canned products. The heat-resistant glycoproteins used in the CMSE are present in smaller amounts than the albumins, necessitating a new format with improved sensitivity, and they employed enzyme-linked antibodies in a direct sandwich immunoassay that produced a group of assays with more than enough sensitivity for the job of identifying economic species adulterations. The new anticooked species antibodies coupled with the 96-wellsandwich ELISA format was named the cooked meat species ELISA (CMSE). When the USDA–FSIS began using the method as a regulatory tool in 1986, the industry was put on notice, and companies selling adulterated products were identified and dealt with. In the more than 20 years since introduction of the CMSE, the integrity of meat products has been enforced by the method to the benefit of conscientious processors and consumers. The CMSE is effective with a wide range of samples that includes raw and uncooked products, cooked and canned products, and non-European MBMs and animal feeds. Indeed, the method has become the most widely used worldwide method for monitoring the species content of meat products. Although suitable for speciation in most MBMs and feeds, the high-temperature high-pressure EU requirements for proper processing of MBMs renders the glycoproteins insoluble and undetectable EU MBMs beyond the range of the CMSE. However, the CMSE antigens cannot be considered heat stable, as they may be
MEAT SPECIATION ASSAYS
257
denatured by the high temperatures and pressures applied during the processing of them into meat and bonemeals. Therefore, the degree of processing must be considered when selecting a method for speciation of samples. The advent of BSE (mad cow disease) and the realization that it was propagated by feeding rendered ruminant material to ruminants raised the bar for species testing. The feed bans made testing of animal MBMs and animal feeds important in preventing the spread to livestock and humans. In addition to banning the use of animal proteins, Europe instituted processing requirements to improve the safety of the MBMs. The products are required to be processed to a core temperature of 133 C under a pressure of 3 bar in a closed container for 20 min. Figure 13.1 shows a sample of the absorbance values produced by two assays, one using antibodies against the species-specific heat-resistant glycoproteins developed for the CMSE, the other using antibodies to the heat-stable species Troponin I developed for detection of species in the highly heated EU MBMs. The graph shows diluted control aliquots of the same lean skeletal muscle tissue (LSMT) following treatment across a range of increasing heat and pressure. It has been noted that increased pressure is an important factor in this loss of signal, as samples processed at higher temperatures but without the pressure are still detectable by the CMSE. The European processing requirements put the species identification of MBMs beyond the reach of existing immunoassays and DNA techniques. Work by Hoffman et al. (1996a) in Germany determined that the glycoprotein antigens detected by the cooked meat species ELISA become insoluble under this combination of temperature and pressure, and therefore the CMSE was ineffective with properly rendered MBMs. Identification of the thermal and pressure limits of the CMSE antibodies enabled development of an immunoassay using the CMSE antibodies to indicate when the proper heating of the MBMs according to the EU mandates was achieved as indicated by the loss of signal in the test. However, this meant that the species content of the properly heated MBMs was now beyond the reach of existing immunoassays as well as DNA techniques. The species glycoproteins that are denatured are not detected in the CMSE, and the DNA fragments were too short to be species specific. The EU processing requirements were shown to increase the safety of using the MBMs by reducing bacterial contamination and also reduced the risk posed by prions. The modified CMSE enabled a method of determining when the biological material had achieved the required processing conditions. However, this also meant that the properly heated materials were now beyond the range of available species testing methods. As the sample heated above 133 C with 3 bar pressure could not be detected by the CMSE or DNA methods, the development of new targets that could still identify the species after being cooked beyond the range of the CMSE and DNA methods was needed. It was work by Chen et al. (2002) at Auburn University that identified a skeletal muscle protein, Troponin I, as a potential species marker for products rendered, as it was thermostable at rendering temperatures. Monoclonal antibodies to species Troponin I were screened for their species specificity and led to development of ELISAs and LFIAs that are effective with properly heated MBMs. Unlike the albumin-based assays and cooked meat glycoprotein assays in which signal is lost as heating and processing increase, Troponin I signals increase with higher degrees of heat and pressure.
258
ANIMAL SPECIFICATION IN SPECIATION
Development of monoclonal antibodies sensitive to species Troponin I by Hsieh at Auburn University proved to be an effective method for these highly processed samples. The signals produced by the CMSE begin to decline as the temperature–pressure combination approaches 121 C and a pressure of 2 bar. As the pressure–temperature combination applied to meat samples approaches 133 C and 3 bar, the signals decrease rapidly, and samples processed beyond that combination will not be detected by the CMSE. While the CMSE is effective in determining the species content of most MBMs, it is not effective with the European MBMs. MBM samples rendered at the hightemperature and high-pressure EU requirements are beyond the capabilities of the CMSE, due to the denaturing of heat-resistant glycoproteins. Such samples are also beyond the reach of sensitive DNA methods, as the processing breaks the DNA into short fragments that lack species specificity. Microscopy is still effective for determining species in products produced at the highest temperatures and is still the only official method recognized in many countries. However, it can only see insoluble fragments and is limited in its ability to distinguish among the mammalian species. The Troponin I species assays and methods employing antibodies still in development will enable the presence of specific tissues as well as the species content of even the most highly processed products. 13.4.2
Selection of Meat Speciation Assays
Selection of the most appropriate species immunoassay for a given sample type requires knowledge of the characteristics of the antigen targets of the antibodies employed in the tests. The available species immunoassays employ antibodies that can detect a range of protein markers and include tests for raw, cooked, canned, and rendered products. The type of sample must be considered when selecting the appropriate speciation test. The primary sample consideration is the degree of processing. While the tests suitable for cooked and rendered products may be used with raw products, the tests suitable for raw products are not effective with processed products. Similarly, while the cooked meat tests may be effective with some animal feeds, they are not effective with meat and bonemeals processed under European regulations, which require processing under high heat and high pressure in a closed container. Therefore, consideration of the antigens detected by the antibodies in the available tests is important in selecting an appropriate test. Species tests for raw products are typically based on monoclonal species-specific antialbumin antibodies. Although these monoclonal antibodies recognize only one epitope on one protein, albumin is ubiquitous throughout the body, resulting in a test that also recognizes most tissues and organs as well as fresh milk products. Cooked and raw species tests are used primarily to detect adulteration, and a lack of tissue specificity is beneficial in these circumstances. However, certain regulations on species content require the use of tests that are both species and tissue specific. For example, the FDA ban on feeding ruminant proteins to ruminant animals exempts blood and milk products (FDA, 1997). Testing used to enforce this ban must be ruminant specific, but also must be tissue specific in order not to detect these exempted
DATA INTERPRETATION
259
protein sources. These tests must also be able to detect highly heat-processed products such as MBM. Current commercially available tests for ruminant products in feeds use monoclonal antibodies to detect highly heat-stable, tissue-specific proteins that are not present in milk, blood, gelatin, or other tissues. The FDA regulation and the subsequent tests developed to enforce it demonstrate the importance of knowing every factor that can affect antibody and assay performance when developing or using an ELISA for speciation. The differences in tissue specificity of the assays are also relevant. The majority of kits used for speciation of cooked samples are based on polyclonal antibodies. This allows them to detect meat as well as most organ tissues from the species against which they were developed.
13.5
DATA INTERPRETATION
Determination of the presence or absence of species content by immunoassay is the subject of regulations in several countries. The available immunoassays can be used with a range of protocols that reflect the effect of the desired sensitivity of the assay and the ability to enforce regulations based on the tests. Following validations by the agencies, the following are three protocols used by the USDA, SENASA (Argentina), and FFIS (Japan) for determining species content by ELISA. 13.5.1
USDA CMSE Protocol
The USDA assay protocol developed in 1986 was designed to be a qualitative test for economic adulteration in cooked and processed meat products and is still the most common species test used today. To provide a yes/no cutoff the USDA protocol utilizes the absorbance, or optical density (OD), of the test developed. By using the 96-well microELISA format and instituting the use of replicates of the samples and controls, they enabled statistical evaluation of the validity of the tests. An accepted method of determining the LOD of EIAs is to determine the mean OD value of the replicates of the appropriate negative controls and adding 3 standard deviations of those replicates. The detection limit of the tests developed, depending on the antibody pool used, was determined to be between 100 and 500 ppm, more than adequate for the detection of economic adulteration. The USDA cutoff for calling a sample positive was set at an OD 0.250 after subtraction of the OD value of the NS blank and subtraction of three standard deviations of the sample replicates. This conservative use of the test and cutoff has been used reliably to indicate adulteration since its first use as a regulatory tool in 1986, and results based on this method and protocol have not been defeated in court. The qualitative protocol utilizes an OD cutoff that is well above the LOD, as it was determined that adulterations of less than 1% would not provide an economic incentive. The absorbance cutoff was established that will reliably detect the presence of species tissues at approximately 1% (OD greater than 0.250, calculated as OD at 415 nm minus OD at 490 nm, minus 3 standard deviations of the sample replicates). Thus, the USDA cutoff is well above the LOD cutoff, which was determined to be in the range 100 to 500 ppm using the usual manner of determining the LOD. Using the
260
ANIMAL SPECIFICATION IN SPECIATION
USDA protocol, the CMSE does not produce false positives, and positive results produced by these tests have not been challenged successfully in U.S. courts in the 22 years that they have been used as a regulatory tool. The controls used were raw lean skeletal muscle tissue (LSMT) of the various species extracted 3:1 with normal saline and heated in a boiling water bath for 20 min. The resulting clarified extract was considered 100% species control. For determining the effectiveness of the method across a range of processing employing higher temperatures, pressure or time LSMT controls have been prepared. As the processing conditions become more severe, some of the antigens detected by the test become insoluble as they are denatured. Consequently, samples with higher heating, pressure, or chemical processing will contain less detectable antigen and produce lower absorbance values than will lesser processed samples. While using the conservative USDA protocols, the CMSE tests may produce absorbance readings that demonstrate low levels of species antigen that fall between the LOD and the USDA cutoff. While samples in this range are considered negative for economic adulteration, readings above the assay detection limit but below the USDA cutoff for economic adulteration indicate the presence of species antigens. It is up to the agency performing the assay to decide if results in this range require further testing or regulatory action. 13.5.2
SENASA (Argentina) Protocol
Data interpretation is different for different regulatory agencies. For instance, SENASA in Argentina uses a cooked meat ELISA assay for determining species content in MBM and in animal feeds. They validated a modified protocol employing a modified sample extraction procedure and using an LOD cutoff value of 3 standard deviations above the mean negative control (SENASA, 2005). The method was validated and is used as an official method for determining the species content of Western animal feeds, in which the MBMs are not processed under the pressure and temperature requirements for EU MBMs. 13.5.3
FFIS (Japan) Protocol
In Japan, concern about the presence of ruminant material in MBMs and animal feeds led to the validation and adoption of the MELISA-TEK Ruminant Assay, which employs muscle-specific antiruminant Troponin I antibodies. Troponin I is a heatstable protein found in the tropomyosin that is increasingly detectable as the other proteins become denatured by the processing allowing for detection species content, even in the highly processed European meat and bonemeals. The LOD for muscle tissue is approximately 0.005% w/w. However, as the test is muscle specific and most MBMs have up to 99% of the muscle removed before rendering, the limit of detection with MBMs is approximately 0.1% in MBMs and animal feeds. The muscle specificity of the anti-Troponin I antibodies is a disadvantage composed mainly of nonmuscle tissues; it is an advantage when considering animal feeds, as it does not detect milk, which is allowed in all countries, or blood or gelatin, which are allowed in the United States.
QUANTITATIVE VS. QUALITATIVE TESTING
13.6
261
QUANTITATIVE VS. QUALITATIVE TESTING
Species immunoassays are designed for qualitative testing, providing a yes/no answer to the question or whether specific species antigens are present. The tests can provide definitive proof of whether a sample contains antigens of the species of interest. Species aduteration regulations most often do not set quantitative levels and simply state that if a species is present it must be declared on the label. The original purpose of the CMSE was to identify economic adulterations. As adulterations of less than 1% do not impart an economic advantage, the USDA protocol utilized an absorbance cut-off that would reliably declare samples positive well above the limit of detection to minimize the possibility of false positives and assure the agency that the species antigens were indeed present and the positive test results were enforceable. Definitive presence of species antigens utilizing the absorbance cut-off allowed for regulatory enforcement without requiring a quantitative determination. The USDA protocol allows for samples with low levels of contamination below the regulatory cut-off but above the scientific LOD of the assay to be declared negative. Although such samples are declared negative according to the regulatory protocols, technically these samples may be positive. One practice to address samples producing absorbance values in this range is to provide a result classifying them as positive but below regulatory action levels (BRAL). In practice, the tests also provide semi-quantitative indications of differences in the amount of antigens detected in a group of samples allowing for comparisons of the antigen levels in a group of samples of identical composition. The semi-quantitative comparisons of test results of identically prepared and processed samples are reliable and consistent within a group of samples and may provide useful information to customers who often request quantitative information. This may be helpful to customers that want to know “how positive,” a sample was or request an estimate of the level of adulteration. Conversely, it may be important to know when a sample is legally negative but just below the qualitative cut-off. Quantitative estimates are limited to comparison of intact antigen levels of samples with the antigen levels of the test controls. The antigens detected by the CMSE, while heat resistant are not heat stable and the level of antigens detected in a sample will vary with the tissue content, the sample matrix and degree of both thermal and chemical processing of the sample. (i.e samples produced with a higher degree of processing than the controls may produce lower responses than the controls at similar dilutions) Conversely, signals produced by troponin-I assays increase as processing temperature and pressure increase. Due primarily to the variable composition and processing of unknown samples there are currently no commercially available quantitative validated species assays. Quantitative estimates of species content of samples of unknown composition and processing have been done experimentally with both the CMSE and troponin-I ELISA (Chen et al. 2004) but are generally too cumbersome and costly to be practical. Following a qualitative determination of the range of species in a group of samples, the process of requires preparation of a complex set of dilutions of species tissue controls, a range of prepared mixtures of species controls, and sample extracts, all of
262
ANIMAL SPECIFICATION IN SPECIATION
identical composition and identically processed. Replicates of all of these controls and sample dilutions are analysed at the same time. Operator precision and timing are very important. Data interpretation includes determining the linear region of the standard curve and determining the sample dilutions that appear in that portion of the curve for each species. The extrapolated content of the sample dilutions that meet these requirements for each species should yield a total species content approximately equal to the non-fat portion of the sample as the species antigens are hydrophilic and are associated only with the aqueous portion of the sample. 13.7
FUTURE DEVELOPMENTS
While the current test formats have provided useful and effective testing for many years, antibodies can be employed in many test formats, and there are emerging test formats and technologies that can allow the use of antibodies in fluorescent and luminescent assays, microarrays, multiplexed assays, surface plasmon resonance (SPR), and others. Development of antibodies to a broader range of antigens allowing sensitive detection and differentiation of species tissues will answer many of the questions that emerge as the quality and safety demands of a wide range of products require sensitive and specific detection. 13.8
CONCLUSIONS
Immunoassays continue to be effective and widely used methods for speciation both for screening for species content in products as well as for confirmatory regulatory use. Regulations requiring proper identification and labeling of the species content of a wide range of food and feed products are in place in most developed countries around the world. Commercial tests employing antibodies to a range of species antigens have been developed and are available for detection of the species content of raw, cooked, and rendered food and feed products. Consideration of the proper test for a given testing requires an understanding of the degree of processing of the samples to be tested as well as the antibodies and antigen they detect. By utilizing a test and protocol suitable for the testing need and sample type the immunoassays have been the preferred choice for speciation of animal products for several decades, due to their specificity, sensitivity, low cost, rapid results, and ease of use. Development of new antibodies to meet the additional species testing requirements and development of new formats for employing the antibodies will extend the future use of speciation assays to a wider range of testing capabilities. REFERENCES Andrews CD, Berger RG, Mageau RP, Schwab B, Johnston RW (1992). Detection of beef, sheep deer and horse meat in cooked meat products by enzyme-linked immunosorbent assay. J. AOAC, 75:572–576.
REFERENCES
263
Ansfield M, Reaney SD, Jackman R (2000). Production of a sensitive immunoassay for detection of ruminant and porcine proteins, heated to >130 C at 2.7 bar, in compound animal feedstuffs. Food Agric. Immunol., 12:273–284. Asensio L, Gonzalez I, Garcia T, Martin R (2008). Determination of food authenticity by enzyme-linked immunosorbent assay. Food Control, 19(1):1–8. Ayaz Y, Ayaz ND, Erol I (2006). Detection of species in meat and meat products using enzymelinked immunosorbent assay. J. Muscle Foods, 17:214–220. Berger RG, Mageau RP, Schwab B, Johnston RW (1988). Detection of poultry and pork in cooked and canned meat foods by enzyme-linked immunosorbent assay. J. AOAC, 71:406– 409. Bjorklund E, Pallaroni L, Unglaub W, von Holst C (2001). Method for the determination of appropriate heat treatment of animal meat using an immunoassay developed for the detection of beef in cooked food: collaborative study. J. AOAC. Bonwick GA, Smith CJ (2004). Immunoassays: their history, development and current place in food science and technology. Chen F-C, Hsieh Y-HP (1999). Detection of pork in heat-processed meat products by monoclonal antibody-based ELISA. J. AOAC, 83(1):79–85. Chen FC, Hsieh YH (2000). Detection of pork in heat-processed meat products by monoclonal antibody-based ELISA. J. AOAC Int., 83:79–85. Chen F-C, Hsieh Y-H, Bridgman RC (1998). Monoclonal antibodies to porcine thermalstable muscle proteins for detection of pork in raw and cooked meats. J. Food Sci., 63: 201–208. Chen FC, Hsieh Y-H, Bridgman RC (2002). Monoclonal antibodies against Troponin-I for the detection of rendered muscle tissues in animal feedstuffs. Meat Sci., 62:405–412. Chen F-C, Hsieh Y-HP, Bridgman RC (2004). Monoclonal antibody-based sandwich enzymelinked immunosorbent assay for sensitive detection of prohibited ruminant proteins in feedstuffs. J. Food Prot., 67(3):544–549. Crowther JR (2001). Methods in Molecular Biology, vol. 149. The ELISA Guidebook. Humana Press, Totowa, NJ. EC (European Commission) (1997). Regulation 1997/258/EC of Jan. 27, 1997, concerning novel foods and novel food ingredients. EC (1998). Directive 1998/88/EC, establishing guidelines for microscopic identification and estimation of constituents of animal origin for the official control of feeding stuffs. EC (2000). Decision 2000/776/EC of Dec. 4, 2000, concerning certain protection measures with regard to bovine spongiform encephalopathy and the feeding of animal proteins. EC (2001a). Regulation 2001/213/EC, methods for the analysis and quality evaluation of milk and milk products. EC (2001b). Regulation 2001/999/EC of May 22, 2001, laying down rules for the prevention, control, and eradication of certain transmissible spongiform encephalopathies. EC (2002). Regulation 2002/1774/EC, laying down health rules concerning animal by-products not intended for human consumption. EC (2003a). Regulation 2003/13/EC, amending Directive 2000/13/EC on the approximation of the laws of the member states relating to the labeling, presentation, and advertising of foodstuffs. EC (2003b). Directive 2003/126/EC, on the analytical method for the determination of constituents of animal origin for the official control of feeding stuffs.
264
ANIMAL SPECIFICATION IN SPECIATION
EC (2003c). Regulation 2003/1234/EC, amending Annexes I, IV, and XI to Regulation 2001/ 999/EC and Regulation 2001/1326/EC as regards transmissible spongiform encephalopathies and animal feeding. EC (2005). Regulation 2005/1292/EC, amending Annex IV to Regulation 2001/999/EC as regards animal nutrition. FDA (Food and Drug Administration) (1997). Substances prohibited from use in animal food or feed. 21CFR589.2000. http://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/ CFRSearch.cfm?fr¼589.2000 (accessed May 30, 2008). Florida Department of Business and Professional Regulation (2007). Chap. 509.292, F.S., Misrepresenting food or food product;penalty. Gill C (2004). Top ten feed makers worldwide. Feed Manag., 55:38–40. Giovannacci I, Guizard C, Carlier M, Duval V, Martin J-L, Demeulemester C (2004). Species identification of meat products by ELISA. Int. J. Food Sci. Technol., 39: 863–867. Gizzi G, van Raamsdonk LWD, Baeten V, Murray I, Berben G, Brambilla G, von Holst C (2003). An overview of tests for animal tissues in feeds applied in response to public health concerns regarding bovine spongiform encephalopathy. Rev. Sci. Tech. Off. Int. Epizoot., 22(1):311–331. Harlow E, Lane D (1999). Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Hitchcock CHS, Crimes AA (1985). Methodology for meat species identification: a review. Meat Sci., 15:215–224. Hofmann K (1996). Proof of proper heating at meat-and-bone meals. Fleischwirtschaft, 76 (10):1037–1039. Hofmann K (1997). Safe controls for renewed confidence: the ELISA meat and bone meal test. Fleischerel, 11:III–IV. Hofmann K (1998). The feed component “meat meal” in a heating test ring experiment. Kraftfutter/Feed Mag., 6:251–255. Hofmann K, Fischer K, Muller E, Kemper V (1996a). Experiments to demonstrate the effectiveness of heat treatments applied to canned meats and meat-and-bone meals. Fleischwirtschaft, 76(9):920–923. Hofmann K, Fischer K, Muller E, Babel W (1996b). ELISA test on species specificity of gelatine and gelatine products. Nahrung/Food. Horn G (2001). Review of the Origin of BSE. Department for Environment, Food and Rural Affairs, London, p. 66. Hsieh YHP (2004). Meat species identification. In Handbook of Food Science, Technology and Engineering, vol. I. Hsieh Y-HP, Woodward BB, Ho S-H (1995). Detection of species substitution in raw and cooked meats using immunoassays. J. Food Prot., 58(3):555–559. Hsieh Y-HP, Sheu S-C, Bridgman RC (1998). Development of a monoclonal antibody specific to cooked mammalian meats. J. Food Prot., 61(4):476–481. Hsieh Y-H, Chen F-C, Djurdjevic N, (1999). Monoclonal antibodies against heat-treated muscle proteins for the species identification and endpoint temperature determination of cooked meats. In Xiong Y-L, Ho CT, Shahidi F (eds.), Quality Attributes of Muscle Foods, Plenum, New York, pp. 287–307.
REFERENCES
265
Hsieh Y-HP, Zhang S, Chen F-C, Sheu SC (2002). Monoclonal antibody-based ELISA for assessment of endpoint heating temperature of ground pork and beef. J. Food Saf., 67(3):1149–1153. Hurley IP, Ireland HE, Coleman RC, Williams JHH (2004). Application of immunological methods for the detection of species adulteration in dairy products. Int. J. Food Sci. Technol., 39:873–878. Ibanez E, Cifuentes A (2001). New analytical techniques in food science. Crit. Rev. Food Sci. Nutr., 41(6):413–450. Liu LH, Chen FC, Dorsey JL, Hsieh YH (2006). Sensitive monoclonal antibody-based sandwich ELISA for the detection of porcine skeletal muscle in meat and feed products. J. Food Sci., 71:M1–M6. Macedo-Silva A, Barbosa SFC, Alkmin MGA, Vaz AJ, Shimokomaki M, and Tenuta-Filho A (2000). Hamburger meat identification by dot-ELISA. Meat Sci., 56:189–192. MAFF (Ministry of Agriculture, Forestry and Fisheries, UK) (1990). Disposal of Fallen Animals and Animal Waste. CVO BSE 1 17. YB90/12.18/3.5. http://www.bseinquiry.gov.uk/files/ yb/1990/12/18003001.pdf. Mageau RP, Cutrufelli ME, Schwab B, Johnston RW (1984). Development of an overnight rapid bovine identification test (ORBIT) for field use. J. AOAC, 67:949–954. Martin DR, Chan J, Chiu JY (1998). Quantitative evaluation of pork adulteration in raw ground beef by radial immunodiffussion and enzyme-linked immunosorbent assay. J. Food Prot., 61:1686–1690. Miller DR, Keeton JT, Acuff GR, Prochaska JF (2003). Verification of cooking endpoint temperatures in beef by immunoassay of lactate dehydrogenase isozyme 5. J. Food Saf., 68(6):2076–2079. Muldoon MT, Onisk DV, Brown MC, Stave JW (2004). Targets and methods for the detection of processed animal proteins in animal feedstuffs. Int. J Food Sci. Technol., 39:851–861. NRA (National Renderers Association) (2005). US Production, Consumption and Export of Rendered Products, 1998–2003. NRA, VA. Necidova L, Rencova E, Svoboda I (2002). Counter immunoelectrophoresis: a simple method for the detection of species-specific muscle proteins in heat-processed products. Vet. Med. Czech., 47(5):143–147. Ouchterlony O (1948). In vitro method for testing the toxin-producing capacity of diptheria bacteria. Acta Pathol. Microbiol. Scand., 25:186–191. Pallaroni L, Bjorklund E, von Holst C (2001). Determination of rendering plant sterilization conditions using a commercially available ELISA test kit developed for detection of cooked beef. J. AOAC, 84(6):1884–1890. Prince MJ, Bailey JA, Barrowman PR, Bishop KJ, Campbell GR, Wood JM (2003). Bovine spongiform encephalopathy. Rev. Sci. Tech. Off. Int. Epizoot., 22(1):37–60. Republic of the Philippines (1991). Republic Act 7394. The Consumer Act of the Phillipines. Article 84-85. SENASA (Servicio Nacional de Sanidad y Calidad Agroalimentaria) (2005). Identificacion de especies cocidas por ELISA en alimentos balanceados. http://www.elisa-tek.com/Senasa% 20protocol.pdf (accessed June 11, 2008). Thiry E, Saegerman C, Xambeu L, Penders J (2004). Current status of transmissible spongiform encephalopathies in ruminants. Biotechnol. Agron. Soc. Environ., 8(4):221–228.
266
ANIMAL SPECIFICATION IN SPECIATION
Toldra F, Reig M (2004). Analysis of meat-containing food. In Nollet LML (ed.), Handbook of Food Analysis. USDA (U.S. Department of Agriculture) (1988). The Formula Feed Manufacturing Industry, 1984. SB-785. USDA, Economic Research Service, Washington, DC. http://usda.mannlib. cornell.edu/data-sets/crops/89005/ (accessed May 30, 2008). USDA (2005). Laboratory Guidebook MLG 17.02:Notice of Change. http://www.elisa-tek. com/Mlg17.02.pdf (accessed June 6, 2008). USDA–FSIS (U.S. Department of Agriculture–Food Safety and Inspection Services) (1984). Ground, mined and chopped meat standards. Regulation S.L. 231.25. USDA, Washington, DC. USDA–FSIS (2005). Identification of Animal Species in Meat and Poultry Products. MLG 17.02. USDA, Washington, DC. van Raamsdonk LWD, von Holst C, Baeten V, Berben G, Boix A, de Jong J (2007). New developments in the detection and identification of processed animal proteins in feeds. Anim. Feed Sci. Technol., 133(1–2):63–83. von Holst C, Honikel KO, Unglaub W, Kramer G, Anklam E (2000). Determination of an appropriate heat treatment of animal waste using the ELISA techniques: results of a validation study. Meat Sci., 54:1–7. von Holst C, Unglaub W, Anklam E (2000b). Post process product control of rendering plant sterilization conditions by ELISA. J. AOAC, 84(6):1793–1798. Wilesmith JW, Wells GA, Cranwell MP, Ryan JB (1988). Bovine spongiform encephalopathy: epidemiological studies. Vet Rec., Dec. 17, 123(25):638–44.
CHAPTER 14
International Regulatory Environment for Food Allergen Labeling SAMUEL BENREJEB GODEFROY Food Directorate, Health Products and Food Branch, Health Canada, Ottawa, Ontario, Canada
BERT POPPING Molecular Biology and Immunology, Eurofins Scientific Group, Pocklington, Yorkshire, UK
14.1 INTRODUCTION TO FOOD ALLERGIES AND FOOD INTOLERANCE Scientific evidence has linked certain food ingredients with severe adverse reactions when consumed by persons with food sensitivities. Adverse reactions to food can be of different natures. Food allergies are adverse reactions to specific food ingredients that occur only in susceptible persons. They are to be differentiated from other reactions that are likely to be produced in the majority of the population, albeit with possible variations, as a result of exposure to either chemical or microbiological contaminants or to pharmacogically active ingredients in food. For example, the microbiological activity associated with the improper refrigeration or preservation of fish leads to the conversion of the high levels of histidine naturally occurring in the flesh into histamine and other bioactive products, which in turn are responsible for acute reactions such as “scrombroid fish poisoning.” These reactions are not dependent on allergic mechanisms and will be produced by anyone who eats a sufficient quantity of such fish. By opposition, the term food allergy is appropriate where an immune mechanism is involved in a previously sensitized person. Based on the nomenclature suggested by the European Academy of Allergology and Clinical Immunology (EAACI), food allergy is a form of hypersensitivity (reproducible, abnormal, nonpsychologically mediated reaction to food) for which the immune mechanism involved is either immunoglobulin E (IgE) or non-IgE mediated (Johansson et al., 2001) (Figure 14.1). Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
267
268
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Clinical Symptoms
“Real” Food Allergy 90% type I 10% other types
“False” Food Allergy Intolerance to tyramine and phenyl ethyl amine Intolerance to benzoates Intolerance to alcohol, nitrites Non-specific histamine-associated
FIGURE 14.1 Real and false food allergies according to Moneret-Vautrin and Andre (1983).
The production of antibodies known as IgE and a series of interactions between various cell types and chemical mediators are known to be involved in most confirmed cases of food allergy. This type of IgE-mediated allergy or type I hypersensitivity reaction produces immediate symptoms, the most severe form being anaphylaxis. Other immediate symptoms, such as rhinitis, urticaria, and other affections of the mouth, gut, skin, and respiratory tract, may precede anaphylaxis or occur alone as a less severe manifestation. These reactions would be considered as immediate hypersensitivities. Any food that contains protein has the potential to elicit such allergic sensitization. More than 170 different foods have been documented to be responsible for eliciting immediate hypersensitivities (Taylor, 2000). Other foods have been known to be linked to delayed hypersensitivities. Symptoms associated with delayed hypersensitivity reactions may not begin to appear until 24 h after ingestion of the offending food. The symptoms of delayed hypersensitivity reactions do not reach the severity involved in immediate hypersensitivity. However, thresholds triggering reactions, or the level of tolerance for the offending food, is equally low for delayed as well as immediate hypersensitivities. Mechanisms involved in delayed hypersensitivities remain poorly defined, except perhaps for celiac disease (Taylor, 2000; Kagnoff, 2007; Braini et al., 2008). Individuals with celiac disease and dermatitis herpetiformis, a related skin condition, react adversely to the specific proteins of wheat, rye and barley which are categorized as “gluten” (a general term). Prolamins (storage proteins) of wheat, rye, barley and their hybridized strains (i.e., triticale) trigger the destruction of the absorptive villous lining of the intestinal tract in celiac patients (Zarkadas et al., 1999; Kagnoff, 2007; Presutti et al., 2007; Briani et al., 2008). Celiac disease (CD) is, in fact, an immune-mediated disease, triggered in genetically susceptible persons by the ingestion of gluten. It is also known as celiac sprue or gluten-sensitive enteropathy. Gluten is a generic name given to storage proteins in wheat, barley, rye, and other closely related cereal grains. In persons with CD, these proteins trigger an inflammatory injury in the absorptive surface of the small intestine, resulting in malabsorption of protein, fat, carbohydrate, fat-soluble vitamins, folate, and minerals, especially iron and calcium. There are other adverse reactions to food for which the mechanism is not fully known. These reactions are identified as idiosyncratic pseudoallergic reactions with similar clinical symptomatology (Ring et al., 2001). Elicitors of this allergy-like
RATIONALE FOR ACTION TO PREVENT FOOD ALLERGY INCIDENTS
269
reaction comprise low-molecular-mass chemicals (preservatives, colorings, flavor substances, etc.) such as sulfites. Several nonimmunogenic mechanisms have been implicated (Simon, 1996; Ring et al., 2001; Valley and Thompson, 2001), and in some cases immune-mediated mechanisms may also play a role (Sussman and Tarlo, 1993; Simon, 1996; Ring et al., 2001; Valley and Thompson, 2001). None of these possible mechanisms have been clearly demonstrated or proven. Sulfite-induced asthma remains, however, an example of these reactions, with an estimated 1 to 2% of asthmatics found to have their reaction triggered by sulfites through well-documented double-blind placebo-controlled clinical trials (Taylor, 2000). Sulfites are common food additives used for a number of different technical functions, but mostly for preservation purposes. Foods responsible for exposure to sulfites can vary from wines to, starch, fruits and vegetables, and vinegars (Simon, 1996; Panconesi, 2008). Studies have suggested that 5 to 10% of asthmatic patients experience an exacerbation of their asthma symptoms 5 to 20 min after ingesting sulfites (Sussman and Tarlo, 1993; Vally and Thompson, 2001). For these sensitive patients the adverse reaction associated with such exposure commonly manifests as asthma but can also lead to urticaria, angioedema, rhinoconjutivitis, seizure, anaphylaxis, and death (Yang and Purchase, 1985; Sussman and Tarlo, 1993; Vally and Thompson, 2001). Small amounts of sulfites can, however, be tolerated by sensitive persons. Although the tolerance thresholds to sulfites vary from one person to another, it was established that exposure to a food where the level of sulfites is lower than 10 mg/kg or parts per million (ppm) is unlikely to lead to a possible reaction (Simon, 1996; Zarkadas et al., 1999; Vally and Thompson, 2001). For the purposes of this chapter, all adverse reactions to food, involving an immune mediated mechanism, including celiac disease, will be called food allergies (both IgE mediated and non-IgE mediated). Food intolerances will be defined as any form of food sensitivity that does not involve any immunologic mechanisms. For the most part, food intolerances involve less severe manifestations, and affected persons can frequently tolerate some offending food in their diets. An example to illustrate this fact is the difference between milk allergy and lactose intolerance. Milk-allergic consumers tend to develop systemic and sometimes severe symptoms when ingesting milk, which they cannot tolerate in their diet (or in very small quantities). On the other hand, people who suffer from lactose intolerance, which is related to an enzyme deficiency in the small intestine, suffer only from gastrointestinal symptoms when ingesting milk, which they can tolerate in larger amounts in their diet.
14.2 RATIONALE FOR ACTION TO PREVENT FOOD ALLERGY INCIDENTS Food allergy affects 6 to 8% of infants and young children and 3.5 to 4% of adults and the prevalence may be increasing (Sicherer et al., 2003, 2004; Grundy et al., 2002). Anaphylaxis is a serious allergic reaction that can be life threatening. Food has been identified as the most common cause of anaphylaxis. In the United States, food allergy remains a leading cause of anaphylaxis treated in emergency rooms, and it is estimated
270
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
that there are 150 deaths from food-related anaphylaxis per year (Sampson, 2004). In Canada, one study examined deaths related to anaphylaxis in Ontario, the most populated Canadian province, over the period 1986–2000. In this study, 63 confirmed deaths due to anaphylaxis were identified, with 32 related to adverse reactions to foods (2.3 deaths per year) (Salter et al., 2007). For people with CD, exposure to gluten can result in the deterioration, over time, of the cell lining of the small intestine. It is a lifelong condition, and if it is not diagnosed early and treated with a strict gluten-free diet, it can be associated with serious complications, including osteoporosis, lymphoma, and other types of malignancies, infertility in both men and women, and a number of autoimmune diseases, including insulin-dependent diabetes in children. Moreover, in children, CD can be associated with failure to grow and delayed puberty (Kagnoff, 2007; Presutti et al., 2007; Schmitz and Garnier-Lenglin, 2008; Briani et al., 2008). The symptoms and associated conditions in CD vary greatly in number and severity, resulting in frequent delays in diagnosis, and misdiagnoses such as irritable bowel syndrome, chronic fatigue syndrome, and fibromyalgia are common. A small intestinal biopsy is necessary to confirm the diagnosis. With the advent of new blood tests, the worldwide prevalence of the disease is now estimated to be between 1:100 and 1:200. Certain groups have markedly elevated risks of CD. First-degree relatives of peoples diagnosed with CD have a 10 to 20% risk of developing CD. A high prevalence is also found in those with Down syndrome. Patients with CD have an increased risk of association with other serious conditions such as type I diabetes mellitus and other autoimmune disorders (Zarkadas et al. 1999; Catassi et al., 2007; Frisk et al., 2008). From the repercussions of food allergies described above, including celiac disease, it is clear that food allergies contribute to further straining public health systems worldwide, through increased numbers in emergency room visits associated with food allergy incidents, some of which can be preventable. Other impacts, such as effects on the quality of life of people with food allergies, their family, and their social circle, are still to be defined. However, some recent studies attempted to estimate the financial and economical impacts of food allergies. In a recent Australian study (ASCIA, 2007), the cost of allergies was estimated to be approximately $7200 per person per year in Australian dollars. These cost estimates were for all types of allergies, including asthma and nonasthma allergies such as food, drug, latex, sting and bite allergies, contact dermatitis, and anaphylaxis. The burden of disease (disability, premature death) accounted for 73% of costs, reduced productivity for 19% of costs, and health system costs for 4%. The largest share of allergy costs (86%) was borne by those having the allergy themselves, due to the large burden of disease costs. Nine percent of costs was borne by the Australian federal government due to their share of health system and productivity costs. Costs specific to food allergies are still being investigated through various initiatives, including EuroPrevall, a project funded by the European Commission which will attempt to further address the economic cost of food allergies (Mills et al., 2007). More comprehensive studies are needed to better qualify the health, economic, and psychological impact on society of food allergies, including celiac disease.
RISK MANAGEMENT OPTIONS FOR FOOD-ALLERGIC CONSUMERS
271
14.3 RISK MANAGEMENT OPTIONS FOR FOOD-ALLERGIC CONSUMERS There are currently no known therapeutic options to cure food allergies, only to treat and manage symptoms. The only feasible option for food allergy sufferers is to prevent food allergy incidents by avoiding food to which they are known to be sensitive. Similarly, there is no known cure for CD. A strict lifelong avoidance of gluten in the diet is the only effective management of this disease and for the prevention of complications (Zarkadas et al., 1999; Troncone et al., 2008). In avoiding foods containing the culprit ingredients to which they are likely to react, food-allergic consumers must rely on information provided to them by food processors and importers. For prepackaged foods, it is critical that such information be included on the food label. Labeling has been identified as a public health tool enabling the consumer to manage avoidance, but also allowing informed choice through safe food sources. Labeling allergens, gluten sources, and sulfites on prepackaged foods should allow the identification of culprit ingredients, either as a result of their inclusion in the product formulation: ingredient labeling; or to identify instances of cross-contamination or cross-contact, where the food transformation process has led to the possible presence of an allergen that could not be avoided or mitigated within reasonable means (e.g., sanitation applied in a diligent manner was unable to remove all traces of an allergenic ingredient in a facility using a shared production line). In this case, a precautionary or advisory statement would be used to alert the allergic consumer of the risk of being exposed to the culprit ingredient, and hence refrain from consuming the food in question. Statements such as “may contain X” or “not suitable for X-allergic individuals” are used for this purpose, where X is the allergen targeted. Labeling can also be used to inform the consumer of the suitability of a particular food product, either because it excluded certain ingredients and/or because special care was taken to control the production process, in a manner that guarantees the absence of the ingredient and hence optimum protection for consumers allergic to that specific ingredient. These foods generally become a targeted source of supply sought by those consumers. Statements such as “gluten free” or “peanut free” are being used on the front of the food package for this purpose. Labeling of prepackaged foods is subject to food legislative and regulatory obligations set by each national jurisdiction. The Codex Committee on Food Labeling (CCFL) has considered allergen labeling as an area of priority and has made recommendations adopted by the Codex Alimentarius Commission (CAC) in 1999 (CAC, 1993). It was recommended that science-based criteria be used to determine which foods or food products should be placed on a priority list of foods whose presence should always be declared in the list of ingredients on a food label, because of their potential to induce an allergic reaction. The list included the following foods: . .
Cereals containing gluten (i.e., wheat, rye, barley, oats, spelt, or their hybridized strains and products of these) Crustaceans and products of these
272 . . . . . . .
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Egg and egg products Fish and fish products Peanuts Soybeans Milk and milk products Tree nuts and nut products Sulfites at concentrations of 10 mg/kg or higher
Subsequent to the adoption of this list, the WHO (the World Health Organisation) convened a food allergens expert panel to provide guidance to JECFA (Joint FAO/ WHO Expert Committee on Food Additives), the committee that advises the Codex Alimentarius Commission and several of its committees on food additives and other chemicals and ingredients in food. The panel was tasked to identify criteria for amending the Codex list of common allergenic foods. The existence of a causeand-effect relationship, based on positive double-blind placebo-controlled food challenge (DBPCFC) or unequivocal reports of reactions, including severe symptoms associated with exposure to the food commodity, would be key factors for considering a new substance to be included in the list. Other criteria, such as prevalence data in children and adults, supported by clinical studies relying on DBPCFC studies would also be appropriate. It was also acknowledged that the availability of such data for some foods and in certain regions of the world may represent a challenge. Building on the Codex list, national food regulatory agencies have used this guidance to develop their own lists of priority foods that should be targeted for mandatory listing on labels of foods available for sale in the country or region under their oversight. In the following sections we review the regulatory context for managing food allergens, gluten and sulfites, and their labeling requirements, in various countries or regions where changes have been made since 1999, to provide enhanced information to food allergic and celiac consumers. We consider labeling rules for ingredient listing and for advisory labeling (“may contain”). Where applicable, some initiatives pertaining to improved manufacturing or labeling practices developed by stakeholders other than government agencies (e.g., consumer groups or industry) will also be cited. The list of the regulatory requirements for allergen labeling and other risk management options represents a snapshot of the situation at the time of development of this manuscript and is therefore subject to change in the context of a rapidly evolving environment in this area. The description of such requirements is based on the authors’ findings and is not considered endorsed by the regulatory authorities cited in this chapter. 14.4 14.4.1
ALLERGEN LABELING REQUIREMENTS Australia and New Zealand
The Australia and New Zealand Food Standards Code (“the Code”) became law in December 2000. The provisions of the Code “apply to food products (a) sold or
ALLERGEN LABELING REQUIREMENTS
273
prepared for sale in Australia and/or New Zealand; and/or, (b) imported into Australia and/or New Zealand.” In July 2001, a user’s guide to Standard 1.2.3: Mandatory Warning and Advisory Statements and Declarations was developed with the following purpose: “. . . to help retailers, manufacturers and other users to interpret and apply Standard 1.2.3 and other standards that require mandatory prescribed warning and advisory statements and declarations. The guide explains which foods must carry these statements and declarations.” In December 2002, following a two-year transitional period, the Code became fully enforceable. New labeling requirements came into effect, one of which was the “mandatory labeling of certain substances” (Standard 1.2.3) when present as an ingredient; or an ingredient of a compound ingredient; or a food additive or a component of a food additive; or a processing aid or a component of a processing aid. They include the following substances and their products: . . . . . . . .
Cereals containing gluten (other than when present in standardized beer and spirits) Crustaceans Egg Fish Milk Peanuts and soybeans Added sulfites in concentrations of 10 mg/kg or more Tree nuts and sesame seeds
For most prepackaged foods these known allergens must be declared on the label (although there is no prescribed format as long as they are declared using their common, descriptive, or generic name). However, in other cases, information must be made available on the food display upon request or may be exempted if they fall under Standard 1.2.1. Provisions for “allergen-free” products were developed solely for gluten-free products. These provisions, along with low-gluten claims, were reviewed in 2004. According to the Code, a gluten-free claim may be made if there is no detectable gluten and no oats or their products or no cereals containing gluten that have been malted, or their products. A low-gluten claim may be made if the product contains no more than 20 mg of gluten per 100 g. Several other initiatives to improve food processing and labeling practices, specific to food allergens and gluten that have been developed by the food industry in Australia and New Zealand, are noteworthy. In 2002, the Food Industry Guide to Allergen Management and Labeling, prepared by the Australian Food and Grocery Council (AFGC) with support from the New Zealand Grocery Marketers Association, was released with the purpose of assisting the food industry in meeting the requirements of the Code; providing guidance on the control of allergens in food manufacturing; advising on strategies in communicating the deliberate or unintentional presence of allergens in food products, and recommending to food companies meaningful labeling techniques.
274
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Concerning “may contain” claims, the document provides guidance on conditions of use for such statements. It clearly considers “may contain” labeling as a last resort where risk of cross-contamination with a known allergenic substance is documented (e.g., through visual observation, test results, or consumer feedback) to be uncontrollable, sporadic, and potentially hazardous. The guide also provides a flowchart for assessing the need for allergen advisory statements and suggests that these should reflect the level of risk. In February 2004 the AFGC Scientific and Technical Committee formed the Allergen Forum (1 of 13 sector-specific forums operated by AFGC) to address the key allergen issues affecting industry. The Allergen Bureau was established in 2005 as an initiative of the Allergen Forum and operates within the Australian Food Safety Centre of Excellence on a membership basis. The Allergen Bureau set an overall objective to share information and experience within the food industry on the management of food allergens to ensure that consumers receive relevant, consistent, and easy-to-understand information on food allergens. In 2007, a revision of the 2002 Food Industry Guide to Allergen Management and Labeling was delivered by the AFGC. Most notable was the suggested management of precautionary statements using VITAL (voluntary incidental trace allergen labeling). This tool is meant to be an integral component of the allergen risk management’s hazard analysis and critical control point (HACCP) program. VITAL is aimed at enabling the application of risk assessment criteria to support labeling of food allergens, either as ingredients or by using an advisory statement. It also identifies situations where labeling would not be required. The overall aim is to provide consumers with a clear and consistent message. Efforts are under way to review current provisions of the Australia and New Zealand Food Standards Code relating to the declaration of priority allergens, including the list of substances that are subject of mandatory labeling, as well as conditions of use of precautionary statements. 14.4.2
Canada
In Canada, Health Canada has the mandate to establish food standards, policies, regulations, and guidelines. The department has oversight on labeling requirements associated with health and safety or nutritional quality concerns. The Canadian Food Inspection Agency (CFIA) is responsible for “. . .the enforcement of the Food and Drugs Act as it relates to food, as defined in Section 2 of that Act . . . ”; in other words, “for . . . any article manufactured, sold or represented for use as food or drink for human beings.” Notwithstanding several voluntary programs, such as the Allergy Aware Program, which was launched in 1991 in a number of Canadian restaurants, the need for more complete labeling of allergenic ingredients in foods sold in Canada was identified in 1993 during consultations with health agencies, consumers, industry and government, which were undertaken as part of a regulatory review of the Food and Drugs Act and Regulations. A working group consisting of representatives of Health Canada, the CFIA, and practicing pediatric allergists working in consultation with the medical
ALLERGEN LABELING REQUIREMENTS
275
community set out to develop a scientifically based list of foods known to cause severe adverse reactions in hypersensitive persons (Zarkadas et al., 1999). Managing food allergy incidents and preventing instances of inadvertent consumption of a hidden source of allergen has been a priority for Canadian food regulators, for a number of years. Statistics of food recalls in Canada between 1997 and 2001 revealed that allergen-related recalls were the highest proportion of class 1 recalls (highest-risk recalls in the joint food-risk ranking process established by Health Canada’s Food Directorate and the Canadian Food Inspection Agency), reaching 75% in 2000–2001 (Ben Rejeb et al., 2004). Since the mid-1990s, Health Canada and, later, Health Canada and the CFIA have developed a risk analysis process associated with food allergy incidents. These incidents are triggered either by consumer complaints, by voluntary incident-related information communicated by a food processor/importer, or by regular inspection activities undertaken by the CFIA. Risk assessments related to food allergens may also be driven by mislabeling of prepackaged foods, discovered by periodic ingredient verification, or discovered through incidents involving adverse responses or sickness in affected persons following consumption of foods containing offending ingredients. Health Canada, at the request of the CFIA, undertakes risk assessments in such incidents to qualify and classify the health risk in any given situation. This is done by reference to the scientific and medical literature, to previous reports on adverse responses, and to information on prevalence. Also considered are whether or not the incidents are life-threatening and an estimate of consumption of the offending substance that triggered the response. Health Canada’s food allergen risk assessment team has been following the generation of new clinical data in support of the development of no adverse effect level/lowest adverse effect level values. However, Health Canada’s risk assessment process acknowledged the limited clinical trial data for most allergens and the limitations of such data in that most available clinical food challenge studies have not been designed to enable the identification of a NOAEL. Health Canada’s risk assessment process also considers that reactions recorded in a clinical setting may not necessarily be representative of the reactions to food allergen exposure that occur in the real world (Health Canada, 2008a). The existence and preponderance of highly sensitive persons or subpopulations and their lack of participation in reported clinical trials constitute another uncertainty to account for. Nonetheless, some threshold levels, based on published LOAELs, have been used in support of regular risk assessment practices, within the context of incident management (e.g., 0.3 to 1 mg for egg; 0.02 to 7.5 mg for tree nuts). These levels are used as reference levels in the qualitative appreciation of the risk incurred by the occurrence of undeclared allergens in food, through a relative comparison of intake levels with such reference levels. It is important to note that various other considerations are accounted for in estimation of the level of risk for each allergen incident on an ad hoc basis. These factors can be aggravating or mitigating and are provided through findings of the investigation of products (e.g., extent of distribution of a product, target consumers, presence of an allergen precautionary statement on the label) (Health Canada, 2008a). Health Canada is engaged in supporting efforts to
276
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
harmonize risk assessment practices for food allergy incidents using the principles of food-related risk analysis. Beyond constant efforts to improve tools supporting incident management, Health Canada and the Canadian Food Inspection Agency have regularly updated their guidance for labeling of prepackaged foods available for sale in Canada, as a systematic preventive measure enabling allergic and gluten-intolerant consumers to avoid sources of priority allergens, gluten sources and added sulfites. The latest guidance available was published in July 2008 (Health Canada, 2008b). Such guidance was meant to remind food processors and importers that while labeling exemptions may exist in the Canadian Food and Drug Regulations, they are responsible for clear and accurate labeling of priority allergens, gluten sources, and added sulfites, as mandated by Section 14.5(1) of the Canadian Food and Drugs Act, which “prohibits the labeling, packaging, treating, processing, selling or advertising of any food in a manner that misleads or deceives consumers as to the character, value, quantity, composition, merit or safety.” This section of the act has been the guide for the development of compliance policies to support evolving labeling requirements for priority allergens and for sources of gluten and added sulfites in prepackaged foods and to enable improved protection of food-allergic consumers and persons with CD. The Canadian Food Inspection Agency has also recommended that all Canadian food manufacturers ensure “complete and appropriate labeling” that is not misrepresentative or fraudulent of all foods they sell, distribute, or import. (Government of Canada, 2003). More recently, Health Canada has published proposed regulatory amendments to clarify requirements for food allergen labeling and to create a predictable environment between regulators and regulatees (food industry and allergic consumers). The proposed amendments define a food allergen as “any protein from any of the following foods or any modified protein, including any protein fraction that is derived from the following foods: . . . . . . . . . .
Almonds, Brazil nuts, cashews, hazelnuts, macadamia nuts, pecans, pine nuts, pistachios, walnuts Peanuts Sesame seeds Wheat, kamut, spelt, triticale Eggs Milk Soybeans Crustaceans Fish Shellfish”
Similarly, gluten is defined in the regulations as “any gluten protein from the grain of any of the following cereals or the grain of a hybridized strain created from at least one of the following cereals:
ALLERGEN LABELING REQUIREMENTS
. . . . .
277
Wheat, spelt, kamut Oats Barley Rye Triticale”
The interesting innovation in these definitions is that they introduce the notion of protein being present in the final prepackaged food to trigger the labeling requirement. They also define which tree nuts are considered among the priority allergens. The principal change introduced by these amendments is that whenever a food allergen or gluten source is present, the name of the food allergen source or gluten source would have to appear either in the list of ingredients, in parentheses, immediately following the common name of the ingredient or component in which it is present or in a specific statement beginning with the words: allergy and intolerance information–contains. . .” which would immediately follow the list of ingredients when a list of ingredients is provided. Therefore, and in application of these amendments, if casein (a protein found in milk) is present in a prepackaged product, the word milk would be required to appear in the list of ingredients. These amendments also pledge to eliminate exemptions from labeling currently in place for components of ingredients, such as flavors, flour, seasoning, and margarine. If these ingredients contain an allergen, gluten source, or sulfite, these will no longer be exempted from labeling and would need to be indicated on the label. Although these changes are not intended to remove exemptions for certain foods from bearing a list of ingredients (e.g., bite-sized foods, foods available for sale in vending machines), they do dictate that an ingredient list added voluntarily on the package of such foods be accurate and complete for food allergens, gluten sources, and sulfites. The guiding principle followed is that allergic persons or those with celiac disease should rely with confidence on the label of a prepackaged foods, should it attempt to provide them with information on the food composition, without omitting declaration of hidden sources of priority allergens and gluten sources. The same proposed provisions for allergens and gluten sources would apply for added sulfites if the total amount of sulfating agents in the final food is equal or exceeds 10 ppm. Other expected changes require that the name of the source of protein be identified in the common name of all hydrolyzed proteins and that the name of the plant source be identified in the common name of all forms of starch or modified starch. A similar requirement will also be imposed on the source of lecithin, whether or not it originates from a source of allergen. The proposed changes also target alcoholic beverages and vinegars, which are currently exempt from ingredient declaration. This exemption will remain, but a mandatory declaration of the allergen or gluten sources, as well as added sulfites at or above 10 ppm, would be required using an “allergen declaration statement.” It is important to note that these labeling provisions are to apply to the declaration of ingredients deliberately added to prepackaged foods, not to cover cross-contamination or cross-contact incidents.
278
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Several considerations are being made while these proposed regulations are being submitted for public comment. The need to harmonize the allergen statement with other food regulatory jurisdictions internationally toward the use of a “contains” statement, the inclusion of oats as part of the gluten sources subject to mandatory declaration, as well as the possibility of expanding the list of priority allergens to include mustard are being discussed. It is expected that the proposed labeling requirements will be published in their final version by December 2009, and enacted one year later. Allergen Precautionary Statements Since the early 1990s, Canadian food regulators have been among the first risk managers to identify the need to alert consumers of the possible presence of undeclared allergens as a result of cross-contamination and have defined general conditions of use of precautionary statements. Health Canada has defined a food allergen precautionary statement as “a declaration on the label of a prepackaged food of the possible inadvertent presence of an allergen in the food” and has indicated that these statements are to be used by food manufacturers and importers on a voluntary basis above and beyond the basic ingredient and nutrition labeling requirements stipulated in the Food and Drug Regulations and related legislation. There is no regulatory requirement for, or prohibition of, precautionary labeling. However, like all labeling statements, precautionary statements are subject to Section 5 (1) of the Canadian Food and Drugs Act. When used, precautionary statements aim to (1) alert the consumer to the possible presence of an allergen in a food, and (2) prevent the consumption of products labeled with a precautionary statement by persons having a food allergy. Health Canada’s policy has been non-prescriptive with respect to the wording of precautionary statements, requiring only that such statements be truthful, clear and nonambiguous and that they not be a substitute for good manufacturing practices. Health Canada acknowledges reports indicating the proliferation of allergen precautionary statements and their overuse in prepackaged foods available for sale in Canada. This situation has led allergic consumers to trivialize the message and compromise their safety. Health Canada and the Canadian Food Inspection Agency have therefore embarked on a review of the current conditions of use of such statements, which will be completed by 2010. In the meantime, and to address the potential risks associated with mis-use of food allergen statements and to provide a “level playing field” for the food industry, Health Canada is moving toward a more prescriptive approach in its policy for the use of food allergen precautionary statements (Health Canada, 2007a). Health Canada andthe CFIA aretherefore recommending that food manufacturersandimporters begin to use only one of the following two precautionary statements on food labels: 1. “may contain X” and 2. “not suitable for consumption by persons with an allergy to X ”. Gluten Free Labeling Division 24 of the Canadian Food and Drug Regulations (food for specialty dietary purposes) have defined gluten-free products (B24.018). The requirements for a
ALLERGEN LABELING REQUIREMENTS
279
gluten free product according to these regulations are as follows: “No person shall label, package, sell or advertise a food in a manner likely to create an impression that it is a gluten free food unless the food does not contain wheat, including spelt and kamut, or oats, barley, rye or triticale or any part thereof.” This regulation was enacted in 1996 and enabled the availability of gluten-free foods for celiac and wheat-allergic persons. This regulation did not include a threshold for compliance, and its enforcement was based on the analytical threshold of the time (i.e., 200 ppm of gluten as detected by ELISA-based methods available during the late 1990s). With the development and availability of more sensitive techniques, this threshold was lowered to 20 ppm. The gluten-free regulation mandates that manufacturers of gluten-free foods ensure that all ingredients in the foods comply with the requirements set in the regulations. They must ensure that cross-contamination in the production facility is prevented, particularly when gluten-containing foods are handled. The application of this regulation extends beyond manufacturing conditions to cover merchandising outlets (wholesale and retail), which must also ensure that gluten-free products are handled in a manner that enables them to remain gluten free. In view of the adoption of the revised gluten-free standard by the Codex Alimentarius Commission (Codex Stan 118-1979, amended in 1983 and revised in 2008), Health Canada is currently reviewing the gluten-free regulations to align them further with its proposed regulatory amendments for labeling of allergens, gluten sources and added sulfites. Current considerations include the use of the same definition for gluten, encompassing the “protein notion” for the list of cereals excluded from gluten-free foods. Such consideration will allow products to make a gluten-free claim, even through they contain an ingredient deriving from the cereal incriminated, as long as the protein fraction has been removed and is not present. Such a provision would, for example, allow products containing maltodextrin or other sugar-derived ingredients from cereals to bear such a claim, therefore enabling more choices. Considerations are also being made for the removal of oats from the list of excluded cereals, while specific requirements are developed for gluten-free oats, being defined as free from protein derived from the other cereals, such as wheat, rye, or barley. The inclusion of oats into gluten-free foods would also be contingent upon the exclusive use of gluten-free oats.” Finally, and to account for Health Canada’s recent opinion on the introduction of pure, uncontaminated oats into a gluten-free diet (Health Canada, 2007), Health Canada would impose specific labeling requirements for gluten-free foods made out of gluten-free oats, such as a warning recommending supervision by a health professional while introducing pure oats as part of a gluten-free diet. Health Canada and the Canadian Food Inspection Agency are continuing their efforts to maintain an up-to-date and evolving regulatory framework and its enforcement, to manage risks associated with allergens, gluten, and sulfites and to cope with the realities of evolving science and clinical information in this field. Updates of the Canadian food allergen labeling requirements and proposals for change are available at www.healthcanada.gc.ca/foodallergies.
280
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
14.4.3
European Union
On November 10, 2003, the European Commission (EC) amended food-labeling directive 2000/13/EC, abolishing the 25% rule and requiring manufacturers to declare any allergen present or any product derived from such allergens. Member states had one year to turn the directive into national law. Before this amendment, components of ingredients needed to be labeled only if a single component constituted more than 25% of the weight of the food, unless it was a food additive. The list of the major allergens was defined in Annex IIIa of Directive 2003/89/EC and included the following foods: . . . . . . . .
. . . .
Cereals containing gluten (i.e., wheat, rye, barley, oats, spelt, kamut, or their hybridized strains) and products thereof Crustaceans and products thereof Eggs and products thereof Fish and products thereof Peanuts and products thereof Soybeans and products thereof Milk and products thereof (including lactose) Nuts [i.e., almond (Amygdalus communis L.), hazelnut (Corylus avellana), walnut (Juglans regia), cashew (Anacardium occidentale), pecan nut (Carya illinoiesis (Wangenh.) K. Koch), Brazil nut (Bertholletia excelsa), pistachio nut (Pistacia vera), Macadamia nut and Queensland nut (Macadamia ternifolia)] and products thereof Celery and products thereof Mustard and products thereof Sesame seeds and products thereof Sulfur dioxide and sulfites at concentrations of more than 10 mg/kg or 10 mg/L expressed as SO2
This list was amended in December 2006 with the addition of mollusks and lupin, as Directive 2006/142/EC, to account for the opinion delivered by the European Food Safety Authority (EFSA) referring to the allergenicity of these foods and the prevalence of such food allergy in European member states. The 2003 labeling directive mandated the labeling of ingredients included in Annex IIIa, due to their allergenicity. Such listing on the food label has to use plain language and cover the entire food commodity and any of its derivatives (not only the protein fraction). No threshold was set by the directive, either analytical or clinical. However, it was made clear that this labeling requirement covers strictly ingredients added deliberately to food recipes, not those potentially present as a result of crosscontamination or cross-contact. On November 10, 2005, new legislation came into force through the European Parliament with respect to food labeling following a directive (2005/26/EC) issued on March 21 making it obligatory to label all food ingredients listed in Annex IIIa,
ALLERGEN LABELING REQUIREMENTS
281
including alcoholic beverages. Member states were asked to bring the provisions of this directive into force as of November 25, 2005. Directive 2005/26/EC also established a list of substances to be excluded provisionally from mandatory labeling while being examined by the European Food Safety Authority. Dossiers were to be provided by food processors and their suppliers to support the scientific basis of maintaining such an exemption, until November 2007. The list of provisionally exempted substances comprised the following ingredients: . . . . . . . . . . . . . . . . . . . . . . .
Wheat-based glucose syrups that include dextrose Wheat-based maltodextrins Glucose syrups based on barley Cereals used in distillates for spirits Lysozym (produced from egg) used in wine Albumin (produced from egg) used as a fining agent in wine and cider Fish gelatine used as a carrier for vitamins and flavors Fish gelatine or Isinglass used as fining agent in beer, cider and wine Fully refined soybean oil and fat Natural mixed tocopherols (E306), natural D-a tocopherol, natural D-a tocopherol acetate, natural D-a tocopherol succinate from soybean sources Vegetable oil-derived phytosterols and phytosterol esters from soybean sources Plant stanol ester produced from vegetable oil sterols from soybean sources Whey used in distillates for spirits Lactitol Milk (casein) products used as fining agents in cider and wines Nuts used in distillates for spirits Nuts (almonds, walnuts) used (as flavor) in spirits Celery leaf and seed oil Celery seed oleoresin Mustard Mustard oil Mustard seed oil Mustard seed oleoresin
The 2005 directive also envisaged options to review and update Annex IIIa with food ingredients that would warrant more attention because of their known or recently established allergenicity and its high prevalence in Europe. The revision will be based on scientific criteria determined by the EFSA set up by Regulation 2002/ 178/EC. In 2007, the EFSA issued health risk opinions lifting the exemptions for several of the food ingredients that were granted such provisional exemption from ingredient declaration, for lack of evidence demonstrating their nonallergenic potential.
282
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
These ingredients were: . . . . . . . . . .
Lysozyme from egg used in wines Albumin from egg used as a fining agent Milk casein used as a fining agent in applewine (cider) and wine Almonds and walnut extracts used as flavors in spirits Celery oil Celery seed oil Celery seed oleoresin Mustard oil Mustard seed oil Mustard seed oleoresin
Applications to further support any exemption from mandatory declarations may be submitted to the EFSA through the EC at any time, based on the availability of additional scientific evidence. Gluten-Free Labeling In September 2008, the EC’s Directorate General for Health and Consumer Protection (DG- SANCO) issued a draft regulation “concerning the composition and labeling of foodstuffs suitable for people intolerant to Gluten.” This draft regulation defines gluten-free foods as foods containing gluten from wheat (i.e., all Triticum species, such as durum wheat, spelt, and kamut), rye, and barley at levels lower than 20 mg/kg in the final food. The gluten present in those grains was associated with adverse health effects to persons intolerant to gluten or persons with celiac disease. The directive excludes pure oats from these grains given that current evidence indicates that most people with celiac disease are able to tolerate pure oats. However, the regulation 2009/41/EC, which was passed in January 2009 still defines gluten as “a protein fraction from wheat, rye, barley, oats or their crossbred varieties and derivatives thereof, to which some persons are intolerant and which is insoluble in water and 0.5 M sodium chloride solution” Another category of foods specific to persons with an intolerance to gluten very low gluten foods is also introduced. These foods are not to contain gluten from wheat, barley and rye at a level equal or higher than 100 mg/kg. Foods in which wheat, barley, or rye were substituted and have levels of gluten from these cereals below 20 mg/kg may bear the claim “gluten-free.” Similarly, foods that were processed to be rendered with low levels of gluten, where these levels do not exceed 100 mg/kg, shall bear the claim low gluten. If the process enables levels of gluten from the same cereals, lower than 20 mg/ kg, they may bear the claim of gluten-free. The regulation offers a provision according to which the two claims must not be borne simultaneously by the same food label. Therefore, when a “gluten-free” claim is made, it is impossible to add the claim of “very low gluten.” The regulation 2009/41/EC also defines the placement of the claim as being in the immediate proximity of the name under which the food is sold. Specific provisions are made for the introduction of oats in gluten-free foods: but only “pure oats,” which have been “specially produced, prepared and processed,
ALLERGEN LABELING REQUIREMENTS
283
in order to avoid contamination by wheat, rye, barley with a gluten content no greater than 20 mg/kg” in the final food. The application of regulation 2009/41/EC is foreseen within a three-year transition period, entering into force on January 1, 2012. Allergen Precautionary Statements Beyond the new legislation and associated directives to improve the declaration of ingredients with allergenic potential, efforts are currently under way to review the use of precautionary statements. Some consumer groups, such as the European Federation of Allergy (EFA), have been calling on the European Commission to regulate precautionary labeling in addition, fearing that this type of labeling will negate the advances that have been made. Some food regulatory agencies in European member states, such as the United Kingdom Food Standards Agency (UK FSA), have taken a leadership role in researching the impacts associated with the use of allergen precautionary statements. In a 2001 study commissioned by the UK FSA in collaboration with the UK Anaphylaxis Campaign, 56% of products purchased as part of a basket of everyday foods indicated a risk of contamination with trace nuts (UK FSA, 2002). The study also indicated that nut-allergic consumers were unable to buy a match or substitute for 18% of the items listed, and in many cases, (9%), they were forced to accept a substitute product of poorer quality. These consumers reported that they took on average 39% longer to shop and paid 11% more for what they purchased. These results confirmed that members of the public were concerned and confused about the inconsistent way that information was provided through allergen precautionary statements. Concern was expressed that “may contain” labeling is used too much, and sometimes when it isn’t really necessary, possibly undermining valid warnings on products and restricting people’s choice unnecessarily In July 2006, the UK FSA published Guidance on Allergen Management and Consumer Information (UK FSA, 2006). This document was developed by the agency after consultation with stakeholders and aims to provide best practice guidance on how to manage food allergens during food production and the process for deciding whether advisory labeling is appropriate. This guidance when applied is likely to bring more consistency in the use of these allergen precautionary statements and boost consumer confidence in the way that allergen labeling is used on prepackaged foods. Recent expert consultations conducted within the European Union clearly supported the need to multiply efforts toward establishing allergen thresholds to be used within the context of food labeling. These thresholds would be essential for the implementation and enforcement of allergen labeling requirements and would improve predictability between regulators and regulates.
14.4.4
Hong Kong, China
The Hong Kong Special Administrative Region in China is equipped with its own Food and Drugs Act and associated regulations. Amendments to the Composition and Labeling Regulations (Cap. 132 W) under the Food and Drugs Act of Hong Kong were
284
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
made in 2004 to address the labeling of allergenic substances, the labeling of food additives, and the labeling of date format. The amended regulations became enforceable in July 2007. To assist stakeholders in the adoption of these changes, the Food and Environmental Hygiene Department of the Government of Hong Kong (Special Administrative Region of China), issued Labelling Guidelines on Food Allergens, Food Additives and Date Format in August 2005. This guidance mandates that prepackaged foods be labeled unless exempted in the regulations and must include the following information on the label in English and/or Chinese: 1. Food name 2. Ingredients list (a) Preceded by “ingredients,” “composition,” “contents,” or similar. (b) “A new provision as laid down in paragraph 2(4E) of Schedule 3 to the Food and Drugs (Composition and Labeling) Regulations (Cap. 132) requires declaration on food labels of the presence of substances which are known to cause allergy.” This provision states that: (1) If a food consists of, or contains, any of the following substances: . Cereals containing gluten (namely wheat, rye, barley, oats, spelt, their hybridized strains and their products), . Crustacean and crustacean products, . Eggs and egg products, . Fish and fish products, . Peanuts, soybeans, and their products, . Milk and milk products (including lactose), . Tree nuts and nut products, the name of the substance must be specified in the list of ingredients. (2) If a food consists of, or contains sulfites in a concentration of 10 parts per million or more, the functional class of the sulfite and its name must be specified in the list of ingredients. The Hong Kong list of priority allergens is identical to that proposed by the Codex Alimentarius Commission in its recommendation. The guidance offers the following examples as acceptable: “wheat”; “rye”; “flour (cereals containing gluten)”; “egg”; “shrimp (crustacean)”; “crab meat (crustacean products)”; “fish”; “mackerel (fish)”; “fish meat”; “peanuts”; “soy sauce (contains soybeans)”; “flavour and flavouring (contains peanut)”; “milk”; “whey protein (milk product).” The guidance provided to food businesses is meant to enhance consistency in the interpretation of labeling standards. It also helps law enforcement officers determine if compliance has been achieved. Unintentional introduction of a known allergen is also to be covered by the use of an allergen precautionary statement, which should be declared in the list of ingredients or in immediate proximity to the ingredients list. Statements such as “may contain traces of X” or “contains traces of X” or “produced in a factory where X is also handled” are among those proposed for use.
ALLERGEN LABELING REQUIREMENTS
14.4.5
285
Japan
Chapter 15 is devoted specifically to the Japanese environment for managing food allergies, including the regulatory context for food allergen labeling. Here we simply summarize current requirements for food allergen labeling in Japan and some conditions of their implementation. Subsequent to the endorsement by the Codex Alimentarius Commission in 1999 to include eight foods and any ingredients containing derivatives of these foods, known to be allergens, as part of a list of commodities subject to mandatory labeling in prepackaged foods, the Ministry of Health, Labour and Welfare (MHLW) of the Government of Japan instituted in April 2001 its labeling program for foods containing allergens, based on provisions of the Food Sanitation Law. Labeling of allergens was made mandatory for five items designated as “specified ingredients,” identified as substances “with a great need for such labeling given the number of allergenic reactions and the risk to health they pose in Japan”. The specified ingredients subject to mandatory labeling by ministerial ordinance are: Eggs Wheat Peanuts
Milk Buckwheat
Another 19 food items were designated as “items corresponding to specified ingredients,” for which labeling was recommended: Abalone Squid Salmon Salmon roe (ikura) Mackerel Crabs Shrimp/prawn
Beef Pork Chicken Oranges Peaches Kiwi fruit
Apples Walnuts Soybeans Yams Gelatine Matsutake mushrooms.
Processed foods and food additives containing these foods must state on the label that this food is present using one of two phrases: “made from X” or “derived from X.” Given that allergenic reactions can occur even from extremely small quantities of allergenic substances, labeling was required or recommended regardless of how little of the food is present. In particular, the five items subject to mandatory labeling are to be so labeled even in the case of carryover or as a result of their presence in processing aids. For the 19 items for which labeling is only recommended, labeling should be made for as small a quantity as possible. The use of “may contain (name of allergen)” within or outside the ingredient list was considered forbidden. The rationale used is that such labeling could be misleading in the sense that it might appear as if the ingredients specified were actually used as such. On the other hand, specifying that the same production line or the same facility has been used for processed foods containing a specified allergen, and others with
286
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
no allergen in the formulation was allowed. These statements vary from declaring that “The (manufacturing) plant that produces a product also manufactures products containing (name of specified ingredients)” to statements such as “Manufactured by equipment using (name of specified ingredients).” However, even in the event where cross-contamination cannot be ruled out, if the presence of the allergen is not due to a deliberate addition as an ingredient, labeling identifying such possible contaminants was not made mandatory. Using class-name labeling such as “meats” or “cereals” was forbidden. Some exceptions are allowed, however, such as the use of terminology such as “protein hydrolysate—fish and shellfish.” In cases where food ingredients considered as “highgrade foods,” such as abalone, salmon roe, and mushroom, are used as part of a mixture but in very small amounts, a declaration such as “contains X extract” was required. Alcoholic beverages and related products were exempted from such allergen declaration. For enforcement purposes, the Japanese MHLW has defined performance criteria for analytical methods to be used for the purposes of identifying and measuring markers of the “specified ingredients.” Methods selected are to identify such markers at a level of 10 mg/kg of soluble protein or higher. In effect, declaration of these priority allergens would therefore be mandatory when the allergen (or its marker) is present at 10 mg/kg protein or above. In 2008, the list of specified ingredients, subject to mandatory declaration by ministerial ordinance, was revised to seven foods, adding shrimp and crab to the list. This measure was justified by the multiple uses of crustaceans in processed foods in Japan and by the increasing number of adverse reactions to these two food commodities reported in allergic patients. The list recommended was set at 18 ingredients: Abalone Squid Salmon roe Orange Kiwifruit Beef
14.4.6
Walnut Salmon Mackerel Soybean Chicken Banana
Pork Matsutake mushroom Peach Yam Apple Gelatin
South Africa
South African food regulatory authorities have introduced amendments to the country’s food labeling regulations to account for the need to identify priority allergens in prepackaged foods. These changes are making South Africa a leading force in the community of developing countries to adopt the Codex Alimentarius Commission’s recommendations about labeling of allergenic ingredients. Regulations 46 to 50 relating to the labeling and advertising of foodstuffs under the Foodstuffs, Cosmetics and Disinfectants Act of 1972 (Staatskoerant, 2007) define food allergens and specify their labeling conditions. The new regulations included the definition of nine allergen categories, recognized as most commonly affecting the general population in South Africa and call for strict conditions and criteria to ensure responsible manufacturing and labeling practices
ALLERGEN LABELING REQUIREMENTS
287
pertaining to food allergens. Labeling is made mandatory for “common allergens,” those known to cause allergic or intolerance reactions and “which are specified in regulations 46 to 50, regardless of the amount.” In regulation 46(a), labeling conditions are set as follows: Where an ingredient derived from egg, milk, crustaceans and molluscs, fish, peanuts, soybeans, tree nuts or wheat or the products of these, is added to a foodstuff or nutritional supplement, the word “egg”, “milk”, “crustaceans”, “molluscs”, “fish”, “peanuts”, “soybeans” or “tree nuts” or “wheat” as the case may be, shall be indicated in parenthesis after the name of such ingredient in the list of ingredients, if it is not self evident from the name of the ingredient. Conditions of declaration of origin were extended beyond common allergens for flavors, whereby regulation 46(b) mandates that “where a natural flavourant is added to a foodstuff or nutritional supplement, the common name of the origin of the flavourant” is to be indicated “in parenthesis after the name natural flavourant, e. g. ‘natural flavourant (banana).’ These regulations make requirements to provide information beyond “common allergens”. Regulation 48(b) mandates that “the presence of rare allergens in or on the foodstuff or its packaging material has to be disclosed by manufacturers upon request by a consumer, inspector or the Department” of Health. Management of Cross-Contamination Incidents and Cross-Contact Specific requirements were set on the use of allergen precautionary labeling in the context of managing cross-contamination incidents. These requirements define situations where unavoidable presence of the allergen is to be managed. They also list some control measures that need documentation prior to resorting to a precautionary statement, such as applying a comprehensive hazard analysis and critical control point (HACCP)–based evaluation of the manufacturing process and ingredient supply as well as suitable testing for specific allergens where applicable. Regulation 49 also specifies conditions of use of allergen precautionary statements on the label, mandating that one statement be used in cases of proven unavoidable cross-contamination: “Not suitable for people with (name of allergen) allergy.” In instances of nondocumented or proven cross-contamination and where due diligence to avoid such cross-contact cannot be established, another statement is required: “unavoidably contaminated with (name of allergen).” Both statements are to be made, using bold legible letters in the same font as the rest of the letter size used for the list of ingredients, at the end or under the list of ingredients. Gluten- and Allergen-Free Labeling Regulations 47(a) and (b) of the South African regulations also define gluten-containing cereals, their labeling requirements, and set conditions for “gluten-free” claims. Regulation 47(a) states that “where an ingredient which is derived from cereals of all Triticum species such as kamut and spelt, wheat, durum wheat, rye, barley, oats; or their crossbred varieties or the products thereof, is added to a foodstuff—the name of the specific cereal species shall be specified in the name of the ingredient in the list of ingredients with the word “gluten” in parenthesis after the name of the cereal.”
288
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Regulation 47(b) states that “the claim ‘gluten-free’ shall not be permitted unless the end-product contains no prolamins from the cereals mentioned above or the products thereof, the gluten level does not exceed 20 mg per kilogram foodstuff as analysed according to Codex and it is not possible to detect the presence of gluten with the Enzyme-Linked lmmunosorbent Assay R5 Mendez (ELISA) test for gluten where 1 mg/kg gliadins corresponds to 2 mg/kg gluten.” Conditions were also set for making claims such as “hypoallergenic” or “nonallergenic” for an ingredient or the whole food specifically requiring that “the foodstuff be modified by chemical or genetic means so as to reduce the quantity of endogenous allergens in such a way that it is not possible to detect the presence of any possible allergen with testing suitable for the specific allergen.” The South African labeling regulations present the unique characteristic of including specific testing requirements, prior to enabling the use of Allergen-free claims. Regulation 50(b) requires that “no claim shall be made that a foodstuff is free from any allergen or similar wording, unless the foodstuff has been tested for the presence of the allergen, using suitable testing for the specific allergen.” Record keeping by manufacturers and importers associated with the allergen labeling, or justification of claims as set by these regulations is made by an imperative requirement with sanctions associated with an offence should such documentation not be produced within 24 h of request by an inspector. 14.4.7
United States
Food labels in the United States for products comprised of two or more ingredients required that all ingredients be listed by their common name or usual names. The major shortcoming of this approach was that the names of some ingredients did not clearly identify their source material (i.e., this labeling strategy did not always account for ingredients “derived from” the common food allergens). In August 2004, the U.S. Congress passed the Food Allergen Labeling and Consumer Protection Act of 2004 (FALCPA) amending the Federal Food, Drug, and Cosmetic Act, effective January 1, 2006. The new law applies to all food regulated by the U.S. Food and Drug Administration (FDA), both domestic and imported, labeled on or after January 1, 2006. [Note: The FDA regulates all foods except meat, poultry, and certain egg products regulated by the U.S. Department of Agriculture.] The amendment removed labeling exemptions for allergens in spices, flavorings, colors, and food additives, and also requiring all packaged foods to declare the “major food allergens” or their protein derivatives. In the United States, the “major food allergens” include: . . . . .
Milk Egg Fish (e.g., bass, flounder, cod) Crustacean shellfish (e.g., crab, lobster, shrimp) Tree nuts (e.g., almonds, walnuts, pecans)
ALLERGEN LABELING REQUIREMENTS
. . .
289
Wheat Peanuts Soybeans
The regulation permits use of a “Contains” statement on a food label provided that the statement includes the names of the food sources of all major food allergens used as ingredients in the packaged food whether or not they already appear in the ingredient list. The “contains” statement should appear on the label immediately after or adjacent to the ingredient list in the same type (i.e., print or font). The law requires that food labels identify the food source of all major food allergens. Unless the food source of a major food allergen is part of the ingredient’s common or usual name (or is already identified in the ingredient list), it must be included in one of two ways. 1. In parentheses following the name of the ingredient. Examples: “lecithin (soy),” “flour (wheat),” and “whey (milk)” 2. Immediately after or next to the list of ingredients in a “contains” statement. Example: “Contains wheat, milk, and soy.” The FALCPA did not address the issue of precautionary or advisory statements, such as “may contain (allergen).” Under the Federal Meat Inspection Act, the Poultry Products Inspection Act (PPIA), and the Egg Products Inspection Act, under which the Food Safety and Inspection Service (FSIS) operates, all ingredients used to formulate a meat, poultry, or egg product must be declared in the ingredients statement on product labeling. FSIS supports positive product labeling including voluntary statements on labels that alert people who have sensitivities or intolerances to the presence of specific ingredients (e.g., “contains: milk”) immediately following the ingredients statement. FSIS also encourages further clarification of the source of a specific ingredient in a parenthetical statement in the ingredients statement on labeling [e.g., “whey (from milk),” as a means of informing consumers]. When good manufacturing practices and effective sanitation standard operating procedures cannot reasonably eliminate the unintended presence of certain ingredient, the use of factual labeling statements about a product’s manufacturing environment may be used on meat and poultry product labeling [e.g., “produced in a plant that uses (name of allergenic ingredient)” or “may contain (name of allergenic ingredient)”]. These statements may only be used in cases where establishments show that practices cannot effectively eliminate the cross-contact issue. FSIS will consider any non-misleading symbols, statements, or logos that industry may want to include on labeling to inform consumers. Allergen Precautionary Statements The FDA has also initiated a review of the current uses of allergen advisory statements or precautionary statements in an effort to develop “a long-term strategy to assist manufacturers” in using such statements in a manner that is truthful and not misleading,
290
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
conveying a clear and uniform message, and adequately informing food allergic consumers and their caregivers. A public hearing was held by the FDA during the fall of 2008 to determine how manufacturers are currently using advisory labeling, how consumers interpret different statements, and what wording is likely to be most effective in communicating to consumers the likelihood that an allergen may be present in a food. Other knowledge gaps will be addressed by various studies being conducted by the FDA and various stakeholders. Draft Gluten-Free Labeling Proposal In January 2007 the FDA proposed a gluten-free labeling proposal, introducing a definition of gluten as proteins that naturally occur in a prohibited grain (“wheat, rye, barley, or a crossbred hybrid of these”) and that may cause adverse health effects in persons with celiac disease. Gluten-free foods would therefore be defined as food bearing this claim in its labeling and that does not contain any one of the following: . . .
.
An ingredient that is a prohibited grain An ingredient that is derived from a prohibited grain and that has not been processed to remove gluten An ingredient that is derived from a prohibited grain and that has been processed to remove gluten if the use of that ingredient results in the presence of 20 ppm or more gluten in the food 20 ppm or more gluten
This proposal is currently awaiting additional information from a safety assessment and public comment before being enacted.
14.5
CONCLUSIONS
For those with food allergies, sensitivities, or intolerances, avoiding specific foods and ingredients is an important health challenge. An allergic person coming into contact with an undeclared allergen in a food product may have symptoms that develop quickly and progress rapidly from mild to severe, including anaphylactic shock and death. For those suffering from celiac disease, the only current treatment is to maintain a strictly gluten-free diet. Several national food regulators have developed regulation or legislation with the aim of strengthening labeling requirements and ensureing that the most common food and food ingredients that can cause lifethreatening or severe allergic reactions as well as gluten sources are always identified by their common names, so that consumers can easily recognize them on food labels. Efforts are still under way to enact these rules and to develop appropriate enforcement and compliance policies. Food allergen analytical methods will constitute a pillar for the implementation of control strategies, both for industry to comply with such requirements and for government to support its enforcement strategies. Various initiatives are under way to enable improved coordination of efforts in harmonizing
REFERENCES
291
labeling requirements and their implementation internationally where possible (MoniQA, 2008).
REFERENCES ASCIA (Australian Society of Clinical Immunology and Allergy) (2007). The economic impact of allergic disease in Australia: not to be sneezed at.13, Nov. 2007. http://www.allergy.org. au/content/view/327/274/ (accessed Dec. 2007), Access Economic Pty. Ltd. Ben Rejeb S, Lauer B, Salminen J, et al. (2004). Regulatory and compliance activities to protect food allergic consumers in Canada: research in support of standard setting and consumer protection. J. AOAC Int., 87(6):1408–1416. Briani C, Samaroo D, Alaedin A (2008). Celiac disease: from gluten to autoimmunity. Autoimmun. Rev., 7:644–650. CAC (Codex Alimentarius Commission) (1993). Labeling of potential allergens. Report of the XXth session of the Codex Alimentarius Commission. http://www.fao.org/docrep/005/ y2770e/y2770e02.htm#bm02 (accessed Nov. 29, 2008). Catassi C, Krystal D, Otto Louis J, et al. (2007). Detection of celiac disease in primary care: a multicenter case-finding study in North America. Am. J. Gastroenterol., 102:1454–1460. Frisk G, Hansson T, Dahlbom L, Tuvemo T (2008). A unifying hypothesis on the development of type 1 diabetes and celiac disease: gluten consumption may be a shared causative factor. Med. Hypotheses., 70:1207–1209. Government of Canada, Canadian Food Inspection Agency (2003). 2003 Guide to Food Labeling and Advertising. http://www.inspection.gc.ca/english/fssa/labeti/guide/ch1e.shtml (accessed Nov. 26, 2008). Grundy J, Matthews S, Bateman B, Dean T, Arshad S (2002). Rising prevalence of allergy to peanut in children: data from 2 sequential cohorts. J. Allergy Clin. Immunol., 110(5):784–789. Health Canada (2007a). The use of allergen precautionary statements in prepackaged foods. http://www.hc-sc.gc.ca/fn-an/label-etiquet/allergen/precaution_label-etiquette-eng.php (accessed in Nov. 2008). Health Canada (2007b). Celiac disease and the safety of oats. http://wwwhc-scgcca/fn-an/ securit/allerg/cel-coe/oats_cd-avoine-eng.php (accessed in Nov. 2008). Health Canada (2008a). Health Canada’s risk assessment of food allergen cross-contact incidents, Internal documents shared at industry meetings. Health Canada (2008b). Health Canada urges food manufacturers to label priority food allergens, gluten sources and added sulfites in the pre-publication period of the Food Allergen Labeling Regulatory Amendments. http://www.hc-sc.gc.ca/fn-an/label-etiquet/allergen/guide_ligne_direct_indust-eng.php (accessed Nov. 2008). Johansson SGO, Hourihane JO’B, Bourset J, et al. (2001). A revised nomenclature for allergy. Allergy, 56:813–824. Kagnoff M (2007). Celiac disease: pathogenesis of a model immunogenetic disease. J. Clin. Investig., 117(1):41–49. Mills C, et al. (2007). The prevalence, cost and basis of food allergy across Europe. Allergy, 62(7):717–722.
292
INTERNATIONAL REGULATORY ENVIRONMENT FOR FOOD ALLERGEN LABELING
Moneret-Vautrin DA, Andre C (1983). Immunopathologie de l’allergie alimentaire et fausses allergies alimentaires, vol.1. Masson, Paris. MoniQA (2008). Allergen Working Group. http://www.moniqaaafp.org/afp (accessed Nov. 2008). Panconesi A (2008). Alcohol and migraine: trigger factor, consumption, mechanisms: a review. J Headache Pain, 9:19–27. Presutti RJ, Cangemi R, Cassidy HD, Hill DA (2007). Celiac disease. Am. Fam. Physician, 76: 1795–1802. Ring J, Brockow K, Behrendt H (2001). Adverse reactions to food. J. Chromatogr., 756:3–10. Salter J, et al. (2007). A study of 32 food-induced anaphylaxis deaths in Ontario, 1986–2000. Anaphylaxis Canada. http://www.anaphylaxis.org/content/programs/programs_research_ deaths.asp (accessed Dec. 2007). Sampson H (2004). Update on food allergy. J. Allergy Clin. Immunol., 113(5):805–819. Schmitz J, Garnier-Lengliné H (2008). [Celiac disease diagnosis in 2008]. Arch Pediatr., 15(4):456–461. Sicherer SH, Muñoz-Furlong A, Sampson HA (2003). Prevalence of peanut and tree nut allergy in the United States determined by means of a random digit dial telephone survey: a 5-year follow-up study. J. Allergy Clin. Immunol., 112(6):1203–1207. Sicherer SH, Muñoz-Furlong A, Sampson HA (2004). Prevalence of seafood allergy in the United States determined by random telephone survey. J. Allergy Clin. Immunol., 114:159– 165. Simon RA (1996). Adverse reactions to food and drug additives. Immunol. Allergy Clin. N. Am., 16(1):137–176. Staatskoerant (2007). Foodstuffs, Cosmetics and Disinfectants Act, 1972 (Act 54 of 1972), Regulations relating to the labeling and advertising of foodstuffs, No. 30075 69, July 20. Sussman GL, Tarlo SM (1993). Asthma and anaphylactiod reactions to food additives. Can. Fam. Physician., 39:1119–1123. Taylor SL (2000). Prospects for the future: emerging problems–food allergens. ALNORM 99/15. Presented at the Conference on International Food Trade Beyond 222: Science-Based Decisions, Harmonization, Equivalence and Mutual Recognition, Melbourne, Australia, Oct. 11–15, 1999. Troncone R, Auricchio R, Granata V (2008). Issues related to gluten-free diet in coeliac disease. Curr. Opin. Clin. Nutr. Metab. Care., 11(3):329–333. UK FSA (United Kingdom, Food Standards Agency (2002). May Contain Labeling. http:// www.food.gov.uk/foodlabeling/researchandreports/maycontainsummary#top (accessed Nov. 25, 2008). UK FSA (2006). Guidance on allergen management and consumer information. http://www. food.gov.uk/multimedia/pdfs/maycontainreport.pdf (accessed Nov. 25, 2008). Vally H, Thompson PJ (2001). Role of sulfite additives in wine induced asthma: single dose and cumulative dose studies. Thorax., 56:763–769. Yang WH, Purchase ECR (1985). Adverse reactions to sulfites. Can. Med. Assoc. J., 133: 865–867. Zarkadas M, Scott FW, Salminen J, Ham Pong A (1999). Common allergenic foods and their labeling in Canada: a review. Can. J. Allergy Clin. Immunol., 4(3):118–141.
CHAPTER 15
Japanese Regulations and Buckwheat Allergen Detection HIROSHI AKIYAMA, SHINOBU SAKAI, REIKO ADACHI, and REIKO TESHIMA Division of Novel Foods and Immunochemistry, National Institute of Health Sciences, Tokyo, Japan
15.1
LABELING OF FOOD ALLERGENIC INGREDIENTS
The Japanese government ministry meeting of the special subcommittee on labeling of the Food Sanitation Investigation Council, stated: “From the viewpoint of preventing the occurrence of health hazards, mandatory labeling of foods containing specific allergenic ingredients should be required.” Accordingly, the Ministry of Health, Labor and Welfare (MHLW) made a decision in 2000 that the Food Sanitation Law should provide for the mandatory labeling of foods containing allergenic ingredients. Since the only therapy for a food allergy is avoidance of the foods responsible, it is essential for food allergy patients to eliminate food allergens from their diet. Therefore, the Japanese MHLW decided to improve the allergen labeling system by amending the Food Sanitation Law in 2001 [1]. They organized a labeling study group consisting of clinical experts, patients, researchers, retailers, and food industrialists. The group discussed various labeling system methods. The results were announced in November 2000 as a report. The report outline is as follows. The labeling was divided into two stages, mandatory and recommended, according to the number of cases of actual illnesses and the degree of seriousness: . .
Mandatory by ministerial ordinance (7 ingredients): egg, milk, wheat, buckwheat, peanut, crab, shrimp/prawn Recommended by ministerial notification (18 ingredients): abalone, squid, salmon roe, orange, kiwifruit, beef, walnut, salmon, mackerel, soybean, chicken, banana, pork, matsutake mushroom, peach, yam, apple, gelatin
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
293
294
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
Consequently, egg, milk, wheat, buckwheat, and peanut, and most recently, shrimp and crab, require mandatory labeling by ministerial ordinance, and we refer to these seven ingredients as specific allergenic ingredients. In addition, the ministerial notification recommends that foods that contain the 18 ingredients mentioned above be labeled. To the best of our knowledge, Japan is the first country to set up mandatory food allergy labeling and to regulate it under national law in 2002. The additional labeling requirement for shrimp/prawn and crab was introduced by the amendment of the food sanitation law under the MHLW in June 2008 because of the almost unlimited use of crustaceans in processed foods in Japan and the fact that they are a frequent cause of adverse food reaction in allergic patients. Among shrimp allergy cases, 64.7% patients showed a positive reaction to crabs. The evidence suggests that a lot of cases with shrimp allergy react to crabs clinically. However, the other 35.3% patients showed no reaction to crabs. Therefore, the study suggests that some patients with a shrimp allergy can eat crabs. It would be important to label “shrimp” and “crab” separate, not as crustaceans, to expand patient choice. Accordingly, the MHLW has revised the mandatory separate labeling for shrimp and crab.
15.2
DETECTION METHODS OF FOOD ALLERGENIC INGREDIENTS
A system of labeling for food allergies is necessary for people with allergies. However, basically, proteins and nucleotides from allergens are not necessarily toxins as such. The threshold dose for the prevention of allergy reactions is often considered to be zero. However, a zero tolerance for the offending food would create enormous practical problems for the food industry. Therefore, the MHLW had to establish a threshold of food allergy labeling and develop an official detection method for specific allergenic ingredients. The MHLW organized a detection method study group consisting of manufacturing companies, retailers, public research institutes, universities, and private inspection institutes. Thus, we have started to develop detection methods for specific allergenic ingredients in foods. The labeling study group determined the threshold for the labeling system: that is, the definition of a trace amount. The group stated that “if more than a few mg/mL protein or a few mg/g protein of an allergen are contained in a food, labeling of that allergen is necessary.” Therefore, we had to develop detection methods for determining a few mg/mL protein or a few mg/g protein in foods based on the definition of a trace amount. However, it should be noted that we cannot determine a completely accurate value because allergen proteins could be denatured and degraded. Furthermore, the standard reference allergen proteins could be changed since we cannot always obtain the identical allergen proteins for every test. In Japan, the seven food ingredient labelings in any processed foods have been mandatory since April 2002, shrimp and crab since June 2008. After that, the MHLW announced the Japanese official methods for the detection of specific allergenic ingredients in a ministry notification, based on methods developed by the detection method study group. The Japanese official methods consisted of two types of enzyme-linked immunosorbent assey (ELISA) kit screenings: the Western blot method for egg and
REFERENCE MATERIAL AND CALIBRATOR
295
milk and the polymerase chain reation (PCR) method for wheat, buckwheat, and peanut—the confirmation tests listed in the ministerial notification of November 2002 [2]. In 2004 the MHLW added the specification and standardization of the extraction buffer, reference material, and standard solution for testing the five allergenic ingredients (see Section 15.3). Furthermore, in 2006 the MHLW announced the validation protocol criteria in the official guidelines to standardize the Japanese official method for allergen detection [2].
15.3
REFERENCE MATERIAL AND CALIBRATOR
The labeling of allergenic ingredients (egg, milk, wheat, buckwheat, and peanuts) in processed foods has been mandatory in Japan since April 1, 2002 [1]. Two types of ELISA methods have been established to assess compliance to the labeling system. However, there were some discrepancies between the results from the two kits. The different antibodies accounted partially for this discrepancy. However, we considered that another possibility for the discrepancies would be due to the differences between the standard solutions attached to the kits. Since the test kits are used for regulatory purposes, we considered that the extraction buffer and reference standard for the measurement should be unified and standardized between the test kits. Therefore, the MHLW set the specifications and standardization of the extraction buffer, reference material, and standard solution for testing the five allergenic ingredients [2]. The specifications and standardization includes the raw materials, the preparation method for the standard solution, the concentration of protein, and the main band on SDS-PAGE. Table 15.1 shows the raw materials and the preparation method used for the initial extract. The preparation procedure for calibrators is as follows. The raw materials are extracted by a solution containing sodium dodecyl sulfate (SDS) and mercaptethanol. The initial extract is prepared by centrifuging and filtration of the extract. The diluted extract was then prepared by the 10-fold dilution of the initial extract with phosphate-buffered saline (PBS) (pH 7.4). The protein concentration of the diluted extract is assayed using the 2-D Quant kit (GE Healthcare). The standard solution is then prepared by a two fold dilution with PBS (pH 7.4) containing 0.2% bovine serum albumin (BSA). The calibrator included in each company kit is prepared by dilution of the standards (concentrated standard solution) to 50 ng/mL, with each company kit’s original buffer containing the carrier protein. Three lots of initial extracts for each allergic ingredient were prepared following the specified procedure, and conformity to the specification was assessed. The reproducibility of the protein concentration and the SDS-PAGE pattern of the initial extract solution were also checked (Table 15.2 and Figure 15.1). The initial extract solutions were stored at 80 C for six months to evaluate their stability. The protein concentration and the SDS-PAGE pattern of the three lots were equivalent, and no significant variability occurred during the storage period. The calibration standard solution was stored at 4 C and 37 C. The calibration standard solutions were tested by the relevant ELISA kits once a month during storage, and the stability was checked by the absorbance obtained.
296
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
TABLE 15.1
Raw Materials and Preparation Method of the Initial Extract a
Allergenic Food
Raw Materials (Ingredients)
Extraction Method (Preparation)
Egg
Fresh eggs of white leghorn hens, homogenized and freeze-dried
Milk
Fresh milk of cows, freeze-dried after defatting by churning
Wheat
Mixture of 14 species of wheat, pulverized
Buckwheat
Mixture of buckwheats produced in Ibaraki Prefecture and in Chinese production, pulverized Virginia species produced in Chiba Prefecture, ground in a mortar
0.2 g of ingredients with 20 mL of extraction solution, by shaking overnight 0.2 g of ingredients with 20 mL of extraction solution, by shaking overnight 1.0 g of ingredients with 20 mL of extraction solution, by shaking overnight 1.0 g of ingredients with 20 mL of extraction solution, by shaking overnight 1.0 g of ingredients with 20 mL of extraction solution, defattig by acetone, with shaking overnight
Peanuts
a Extraction solution: buffer containing 0.5% SDS and 2% mercaptoethanol. The protein content of the initial extract is assayed using or a 2-D Quant kit (GE Healthcare). The initial extract is diluted 20 times to make up the calibration standard solution.
TABLE 15.2
Egg Milk Wheat Buckwheat Peanuts
Reproducibility of the Protein Concentration Lot 1
Lot 2
Lot 3
Average
RSD (%)
4.55 2.57 4.95 3.37 3.99
4.69 2.63 4.96 3.47 4.47
4.88 2.52 5.10 3.59 4.86
4.71 2.57 5.00 3.48 4.44
3.52 2.14 1.68 3.17 9.81
15.4 CRITERIA FOR THE VALIDATION PROTOCOL OF SPECIFIC ALLERGENIC INGREDIENT DETECTION METHODS The MHLW described the validation protocol criteria in the 2006 official guidelines to standardize the Japanese official method for specific allergenic ingredient detection. The outlines of the validation protocol criteria for the food allergenic ingredient quantitative detection method and for the food allergenic ingredient qualitative detection method are shown in Table 15.3. The validation protocol criteria for the food allergenic ingredient quantitative detection method are as follows: 1. The number of laboratories (which are independent of the ELISA developer): eight more labs.
CRITERIA FOR THE VALIDATION PROTOCOL OF SPECIFIC ALLERGENIC INGREDIENT
FIGURE 15.1
297
Reproducibility of SDS-PAGE: (a) egg; (b) milk.
2. The number of food samples (matrices): five or more matrices. 3. Food-specific allergenic ingredients in the food sample should include a concentration of 10 mg/g (the corresponding allergenic ingredient soluble protein weight/food weight) which is the concentration defined as “trace amount of contamination.” (Any foods containing the specific allergenic ingredient protein greater than 10 mg/g must be labeled for the relevant food-specific allergenic ingredients under the Food Sanitation Law. However, if the specific allergenic ingredient protein level would be less than 10 mg/g, the company does not have to include it on the label.) The food sample should be prepared by common processing methods, such as heating, baking, frying, acidifying, and pressurizing processes, which are hereafter termed TABLE 15.3 Japanese Guideline Criteria for the Validation Protocol for Food Allergenic Ingredients Quantitative Detection Method Number of laboratories Number of incurred samples Number of dose levels Recovery Reproducibility
8
5
1, including 10 mg/g a 50–150% 25% Qualitative Detection Method
Number of laboratories Number of incurred samples Number of dose levels Precision
6
5
2, including negative control (blank) and positive control (10 mg/g a)
90%
Source: Ref. 2. a
The corresponding allergenic ingredient soluble protein weight/food weight.
298
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
model-processed (incurred) food. It is recommended that food samples evaluated during validation be selected from foods with the following characteristics: animal products, plant products, highly processed food (long heating, high-pressure preparation), acidic foods—because the corresponding ELISA should be applied to various types of processed foods. 4. The recovery rate from the model-processed food should be in the range 50 to 150%. In addition, the interlaboratory precision (RSDR) value should be less than 25%. 5. The matrix effect data obtained by adding the target-specific allergenic ingredient protein to the matrix extract [that of foods showing a false positive (crossreactivity) or false negative and that of matrices for which the ELISA method hardly applies] should be fully examined and disclosed. 6. Reference Material for Monitoring Foods Containing Specific Allergenic Substances’ should be used in establishing kit standards as well as in model-processed food samples [2]. In the guideline and reference material, the initial extract solution and the extraction procedure for specific allergenic ingredients were also specified and standardized. For developing a food-specific allergenic ingredient ELISA, the ELISA performance should fulfill the interlaboratory validation criteria of the Collaborative Study protocol based on ISO5725 (JIS Z8402), which is basically the same as that of the Association of Official Analytical Chemists (AOAC), and the performance data obtained must be available to the public. 15.5 DETECTION METHODS FOR SPECIFIC ALLERGENIC INGREDIENTS [2] 15.5.1
ELISA
ELISA is the method most commonly used in the food industry and in official food control agency laboratories to detect and quantify hidden specific allergenic ingredients in foods. We have introduced two types of ELISA methods in the Japanese official method [3]. We have discussed the best antibody for detecting specific allergenic ingredients in foods. The antibodies can be classified into two groups: monoclonal and polyclonal. We chose the polyclonal antibody for detecting a variety of allergen proteins. One of the kits is the FASTKIT ELISA Ver. II (Food Allergen Screening Test Kit). This kit uses polyclonal antibodies against multiplex antigens and is produced and sold by Nippon Meat Packers, Inc. The concept of this kit is the use of polyclonal antibodies to detect whole allergen proteins. Basically, many allergenic ingredients contain multiple allergenic proteins; for example, eggs have ovalbumin, ovomucoid, and lysozyme. In addition, these proteins can be denatured, degraded, and combined with other proteins by food processing. To solve this problem, the kit uses multiple antibodies to the native protein and antibodies to the denatured proteins. The five kinds of kits in the series of FASTKIT ELISA Ver. II for allergenic ingredients (egg, milk, wheat, buckwheat, and peanuts) have been commercialized.
DETECTION METHODS FOR SPECIFIC ALLERGENIC INGREDIENTS
299
The other ELISA kit is the FASPEK KIT. This kit uses polyclonal antibodies to detect purified specific proteins or single specific proteins of specific allergenic ingredients. The kit is produced and sold by the Morinaga Institute of Biological Sciences Co., Ltd. Obviously, the target proteins for the ELISA could be divided mainly into whole proteins and specific proteins of the specific allergenic ingredients. For the FASPEK KIT, specific proteins were selected as the target proteins. For egg, the target proteins were ovalbumin and ovomucoid; for milk, casein and b-lactoglobulin; for wheat, gliadin; for buckwheat, the main protein complex; and for peanut, the protein complex, including Ara h 2. The seven kits in the FASPEK KIT series (ovalbumin, ovomucoid, casein, b-lactoglobulin, gliadin, buckwheat main protein complex, and the peanut protein complex, including Ara h 2) have been commercialized. The ovalbumin kit for egg and the casein kit for milk were selected for the Japanese official method because the proportions of these proteins in egg and milk are significant. Using only one type of ELISA system, it is impossible to detect every type of protein within a foodstuff with consistent sensitivity, because the contents and the denaturation of the protein are highly variable. The value determined by ELISA is affected by the denaturation and extraction efficiency of the target protein. Also, conventional methods cannot be applied easily to heat- and pressure-processed foods, such as retort and canned foods. Therefore, we developed a unique extraction buffer for extracting the insoluble antigens produced by heat and pressure processing [4]. In addition, we developed new polyclonal antibodies to the allergen proteins extracted using the new extraction buffer for Japanese official method kits. Since the MHLW has revised mandatory labeling for shrimp/prawn and crab from the labeling recommended in June 2008 because of the almost unlimited uses of crustaceans in processed foods in Japan and the fact that they are a frequent cause of adverse food reaction in allergic patients, two types of ELISA methods for the determination of crustacean protein in processed foods have been developed [5,6]. One of the kits is the FA Test EIA—Crustacean, produced by Nissui Pharmaceutical Co., Ltd.; the other is the Crustacean Kit, produced by Maruha Nichiro Foods, Inc. Both kits have been validated according to the Japanese validation protocol [7] and are commercially available. 15.5.2
Western Blot Method (for Egg and Milk)
The Western blot method is another protein-based qualitative method. This method is specific because specific proteins are separated according to their molecular mass, irrespective of their original electrochemical charge. First there is the preparation of samples, and next, polyacrylamide gel electrophoresis (PAGE), blotting and blocking, and then the reaction with the first antibody, followed by reaction with the second antibody, then reaction with avidin-labeled alkaliphosphatase (AP)–biotin conjugate, followed by reaction with the substrate. The final step is detection of the proteinderived allergens. The Western blot method is prescribed in the Japanese official method as a confirmation test for egg and milk.
300
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
TABLE 15.4
PCR Methods for Wheat, Buckwheat, and Peanut Methods for DNA Extraction
Silica-membrane column kit (QIAGEN DNeasy Plant Mini Kit) Anion-exchange column kit (QIAGEN Genomic-Tip Kit) CTAB method PCR Target Gene Sequences Wheat Buckwheat Peanut Plants
15.5.3
Triticin precursor gene Gene encoding soba allergenic protein Agglutinin precursor gene Noncoding region of chloroplast DNA
PCR Method (for Wheat, Buckwheat, and Peanut)
The PCR method is a DNA-based method and is a very specific and sensitive tool for the detection of specific allergenic ingredients in processed foods. The PCR method was established in the Japanese official method as the confirmation test for wheat, buckwheat, and peanut. Three DNA extraction methods (silica-membrane column kit, anion-exchange column kit, and CTAB method) are prescribed in the Japanese official method. The PCR target genes for the detection of wheat [8], buckwheat [9], and peanut [10] are shown in Table 15.4. The primer pairs were designed to detect these gene sequences. In addition, to check the validity of the extracted DNA for PCR quality, primers recognizing the noncoding region of the chloroplast DNA were designed as the analytical control [10]. To avoid a false-negative result, it is important to check the validity of the extracted DNA for PCR. 15.5.4
Validation Study
We performed collaborative studies using the ELISA methods with model-processed foods (sausage, boiled beef in an aluminum pouch, tomato sauce, biscuit, juice, and jam) containing allergen proteins. The six model-processed foodstuffs were spiked with specific allergenic ingredients to final levels of 10 mg/g in the ingredient stage [3,7]. We assumed that using model-processed foods would be the best way to assess the established ELISA methods by interlaboratory validation. First, we conducted a homogeneity test for the model-processed foods. Basically, the procedure was performed following the AOAC homogeneity test protocol with some modification: 1. Randomly select 3 g 6 samples (n). 2. Take 1 g 2 test portions (p) from each 3-g sample. 3. Analyze the 2n test portions (12 p) in random order under repeatability conditions (two wells). 4. Estimate the sampling variance (S2s) by one-way analysis of variance (2 6 n) using the average value of each well (estimation variance between each portion and each sample).
PRACTICAL TEST FOR MONITORING THE ALLERGY-LABELING SYSTEM
301
TABLE 15.5 Recoveries, Repeatabilities and Reproducibilities for Egg-Soluble Proteins Sample
Number of Labs
Recovery (%)
Repeatability (%)
Reproproducibility (%)
13 13 13 13 13 13
85 96 84 86 98 89
4 3 4 4 3 3
9 9 9 9 9 9
10 9 9 10 9
70 76 52 81 87
5 4 4 4 5
17 8 11 14 9
FASTKIT ELISA Ver. II Rice gruel Sweet adzuki-bean soup Steamed fish paste Meatball Coffee jelly Fermented soybean soup FASPEK ELISA Sausage Boiled beef Cookie Orange juice Jam
5. Estimate the analytical variance (S2a) by one-way analysis of variance (2 12 p) using each well value (estimation variance between each well and each portion). The sausage, boiled beef in an aluminum pouch, and tomato sauce were evaluated using a Nippon Meat Packers kit. The biscuit, orange juice, and jam were evaluated using a Morinaga kit. The evaluation method for interlaboratory validation is as follows: 1. A standard curve (a four-parameter logistic curve) is prepared using the absorbance value collected from each participant lab. 2. The first portion data and second portion data are subjected to a repeatability test using the average values from three wells. 3. Cochran’s test and Grubbs’s test for the removal of outliers are performed (both tests at a significance level of 5%). 4. Estimation of the analytical variance is estimated by one-way ANOVA. The participants’ 10 labs consist of manufacturing companies, public research institutes, local public inspection institutes, and private inspection institutes. Table 15.5 shows the validation results for egg [3] as an example. These results are evaluated according to AOAC protocol and ISO5725-5 robust statistics. Both kits meet the Japanese acceptance criteria. 15.6 PRACTICAL TEST FOR MONITORING THE ALLERGY-LABELING SYSTEM A practical test for monitoring the allergy-labeling system is performed at a local government inspection center. First, the food allergy labeling is investigated.
302
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
Quantitative analyses using two types of ELISA kits for specific allergenic ingredients are then performed to double-check each allergen as the screening test. We determined that the threshold for a positive result is 10 mg/g as a screening test, according to the definition of trace amounts described in the regulation for detection methods of food allergenic ingredients. Next, the manufacturing records are examined. If it cannot be determined whether an allergen is present, a confirmation test using the Western blot method (for egg and milk) or the PCR method (for wheat, buckwheat, or peanut) should be done. If an allergen can be positively detected using a confirmation test, labeling should be corrected using the ministry guidance. If a company does not follow the guidance, it can be punished under the law. Figure 15.2 shows the decision tree for the practical test for monitoring the allergy labeling system. Local governments and health centers monitor the labeling according to the decision tree. Even though they label the specific allergenic ingredients on the processed food products, when incorrect labeling has occurred, it should be corrected using the ministry guidance.
15.7
DETECTION OF BUCKWHEAT IN PROCESSED FOODS
Buckwheat is cultivated worldwide, especially in Asian, European, and South and North American countries, as well as Russia and Australia. Buckwheat (Fagopyrum esculentum) belongs to the Polygonaceae family, and its products are becoming popular in Russia, Italy, the United States, and Canada as a health food with a high protein content and in Asian countries because of the unusually short maturation period. The flour of the buckwheat seed is an important food material used in buckwheat noodles, jelly, and dumplings in East Asian countries and in batter for cakes, pancakes, and crepes in Western countries. It is also eaten as a substitute for wheat by some patients with celiac disease. In addition to being a food, buckwheat husk is also used as a stuffing for pillows. On the other hand, buckwheat is a known food allergen, and ingestion of a small amount can cause severe shock in sensitive patients [11,12]. Such allergic symptoms have been reported mainly in Asian, European, and North American countries [13–17]. Due to the seriousness of the shock and the number of people affected, the Japanese labeling standard states that buckwheat must be listed on food labels [18,19]. In the case of buckwheat, wild species (F. homotropicum, F. cymosum, etc.) belonging to the same genus as the two cultivated species [common buckwheat (F. esculentum) and Tartarian buckwheat (F. tataricum)] exist. According to the phylogenetic tree of the Fagopyrum spp., some wild buckwheat species are classified at closer positions than the evolutionary distance between the two cultivated types of buckwheat considered to be allergenic [20,21]. Besides, it has been reported that some allergenic proteins of cultivated buckwheat might be distributed among the Fagopyrum spp. [22,23]. Thus, the risk of raising the buckwheat allergy due to allergens derived from wild buckwheat may be relatively high. A method of detecting the presence of all the Fagopyrum spp. in food products would therefore be indispensable for ensuring the safety of buckwheat allergy patients.
303
guidance
Prohibited Labeling
guidance
Mandatory Labeling
+
guidance
Mandatory Labeling
OK
Caution
–
OK
Unnecessary Labeling
+
guidance
Recommended labeling
–
Questioning
Confirmatory Test
+
+
–
OK
Unnecessary Labeling
–
Manufacturing Records
–/–
Decision tree for the practical test for monitoring the allergy labeling system.
OK
OK
FIGURE 15.2
Recommended labeling
–
Manufacturing Records
Manufacturing Records
+
+/+ or +/ –
– /–
Two ELISA Tests
Two ELISA Tests
Mandatory Labeling
+/+ or +/ –
–
+
Investigation of Labeling
304
15.7.1
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
Protein-Based Method
Several buckwheat molecules have been reported to react with IgE from allergic patients. For instance, 24-, 19-, 16-, and 9-kDa proteins have been identified as major buckwheat allergens [23–29]. Furthermore, Matsumoto et al. [30] reported a 10-kDa protein and its allergenicity. The 10-kDa protein, which is identical to an 8-kDa buckwheat allergen (GenBank accession: AB055892), is a member of the 2S albumin family [30]. Some of the 2S albumin family proteins have been identified as allergens in Brazil nuts (Ber e 1), English walnuts (Jug r 1), cashew nuts (2S albumins), sesame seeds (Ses i 2), yellow mustard (Sin a 1), and oriental mustard (Bra j 1) [31–32]. Recently, several researchers have characterized the allergenicity of a 16-kDa buckwheat protein (BWp16) [24,29]. BWp16 is thought to be a strong buckwheat allergen candidate in that it was identified as a pepsin-resistant protein associated with immediate hypersensitivity reactions in buckwheat-allergic patients [24,29]. However, the major allergen for buckwheat as a target-specific protein still remains unclear. 15.7.2
Quantitative ELISA Method
As far as we know, only two types of ELISA methods for the determination of buckwheat protein using the Japanese official method are available: the FASTKIT ELISA Ver. II for buckwheat (Nippon Meat Packers, Inc., search.cosmobio.co.jp/ cosmo_search_p/search_gate2/docs/NPH_/999100423EX.20070525.pdf) and the FASPEK KIT for buckwheat (Morinaga Institute of Biological Sciences Co., Ltd., www.seikagaku.co.jp/english/product/medicine/reagent.html). Both ELISA kits are highly specific for the determination of buckwheat. The FASTKIT ELISA Ver. II (buckwheat) used polyclonal antibodies against whole buckwheat soluble protein. The limit of detection (LOD) for FASTKIT ELISA Ver. II (buckwheat) is 0.39 ng/mL, equivalent to 0.15-mg/kg samples, and the limit of quantification (LOQ) is 1.56 ng/mL, equivalent to 0.62-mg/kg samples. The FASPEK KIT for buckwheat used polyclonal antibodies against the purified main protein complex of buckwheat. The LOQ is 0.78 ng/mL, equivalent to 0.31-mg/kg samples. In addition, we conducted the interlaboratory validation study for these kits. The results are shown in Table 15.6. The data suggest that both ELISA kits are precise and reliable tools for the quantification of buckwheat soluble protein in processed foods. 15.7.3
DNA-Based Method
Qualitative PCR We have developed a detection method for common buckwheat and Tatarian buckwheat with a high specificity and greater sensitivity for monitoring of a labeling system for allergenic food material as a confirmation method of the Japanese official method [9]. As shown in Figure 15.3, a fragment (127 bp) amplified using the designed primer pair (FAG 19/FAG 22, Table 15.7) for the detection of buckwheat was detected specifically from the common buckwheat and Tatarian buckwheat genomic DNA. In contrast, no amplified fragment was detected when DNA was extracted from 11 other plant species (common wheat, durum wheat, rye, barley, oats, rice, corn, peanuts, soybean, rapeseed,
DETECTION OF BUCKWHEAT IN PROCESSED FOODS
305
TABLE 15.6 Recoveries, Repeatabilities, and Reproducibilities for Buckwheat-Soluble Proteins Sample
Number of Labs
Recovery (%)
Repeatability (%)
Reproducibility (%)
13 13 13 13 13 13
118 137 123 91 112 94
6 7 4 8 7 5
18 13 10 13 11 13
9 10 10 10 10
101 122 146 149 146
5 7 15 8 12
8 20 18 13 17
FASTKIT ELISA Ver. II Rice gruel Sweet adzuki-bean soup Steamed fish paste Meatball Coffee jelly Fermented soybean soup FASPEK ELISA Sausage Boiled beef Cookie Orange juice Jam
and foxtail millet) as the template DNA. In addition, no amplification of the 127-bp product occurred in Polygonum convolvulus and eight kinds of polygonaceous plants other than the buckwheat (Figure 15.3). The nucleotide sequence analysis of the PCR product obtained from the common buckwheat and Tatarian buckwheat confirmed that the intended sequence of the F. esculentum major allergenic storage protein gene had been amplified. These data suggest that common buckwheat and Tatarian buckwheatgenomic DNA can be detected specifically using the primer pair. The target sequence for the buckwheat was clearly detected in the 0.001 to 100% mixed samples when we tested the mixed wheat flour samples containing 0, 0.0001, 0.001, 0.005, 0.01, 0.1, 1, and 100% of the buckwheat flour powder. This evidence suggests that buckwheat flour contamination as low as 0.001% can be detected in an unprocessed food. To investigate the applicability of the buckwheat DNA detection method to commercial food products, we tested 10 commercial food samples from a local market for the presence of buckwheat DNA using the method developed. Eight of the samples purchased had buckwheat as a listed ingredient. The other two samples were wheat noodles with advisory remarks such as “this food product was made in a factory which manufactures food products containing buckwheat”. A sufficient amount (more than 20 ng/mL) of genomic DNA for the PCR was obtained from almost all the food products, except for the fried snack and buckwheat tea, using the purification method described. The universal primer pair CP 03-50 /CP 03-30 (Table 15.7) for the detection of plant species [10] could generate a specific amplified fragment from all the samples except for the buckwheat tea. In the eight food products, except for the one wheat noodle and buckwheat tea, buckwheat DNA was clearly detected by the PCR methods using the primer pair designed. The amount of buckwheat protein measured by the ELISA method
306
FIGURE 15.3 Specific detection of buckwheat by PCR. N, no template control; M, 100-bp ladder size standard. (A) Specificity of the PCR method for buckwheat. Lanes 1 to 8, common buckwheat [lane 1, U.S. Mancan; lane 2, Canadian Mancan; lane 3, Chinese Mancan; lanes 4 and 5, Chinese cultivar (lane 4, Utimouko; lane 5, Keirin); lanes 6 to 8, domestic cultivar (lane 6, Kitawase; lane 7, Shinano 1; lane 8, Aizuzairai)]; lane 9, Tatarian buckwheat; lane 10, common wheat; lane 11, durum wheat; lane 12, rye; lane 13, barley; lane 14, oats; lane 15, rice; lane 16, corn; lane 17, peanuts; lane 18, soybean; lane 19, rapeseed; lane 20, foxtail millet. (B) Specificity of the PCR method for buckwheat. Lane 1, wild buckwheat; lane 2, Polygonum cuspidatum; lane 3, Polygonum filiforme; lane 4, Polygonum capitatum; lane 5, Persicaria longiseta; lane 6, Persicaria lapathifolia; lane 7, Rumex acetosa; lane 8, Rumex obtusifolius; lane 9, Rheum rhabarbarum; lane 10, common buckwheat (Aizuzairai). (C) Sensitivity of the PCR method for buckwheat. The genomic DNAs extracted from eight mixing levels of buckwheat flour in wheat flour were used as the template DNA. Lane 1, 0%; lane 2, 0.0001%; lane 3, 0.001%; lane 4; 0.005%; lane 5, 0.01%; lane 6, 0.1%; lane 7, 1%; lane 8, 100%. (D) Investigation of commercial food products. Lane 1, wheat noodle 1; lane 2, wheat noodle 2; lane 3, buckwheat noodle; lane 4, rice cake; lane 5, dumpling; lane 6, cookies 1; lane 7, cookies 2; lane 8, fried snack; lane 9, snacks; lane 10, buckwheat tea.
REFERENCES
TABLE 15.7
A:
B:
Primers Designed for the Detection of Buckwheat a
Name
Sequence (50 ! 30 )
CP 03-50
50 –CGG ACG AGA ATA AAG ATA GAG T–30 0 5 –TTT TGG GGA TAG AGG GAC TTG A–30
Chloroplast DNA, sense
FAG 19
50 –AAC GCC ATA ACC AGC CCG ATT-30
FAG 22
50 –CCT CCT GCC TCC CAT TCT TC–30
Fagopyrum esculentum major allergenic storage protein gene, sense Fagopyrum esculentum major allergenic storage protein gene, antisense
CP 03-30
307
Specificity
Amplicon (bp) 123
Chloroplast DNA, antisense 127
a
A, to confirm the validity of DNA extracted from plants for the PCR; B, for specific detection of buckwheat.
for wheat noodle and buckwheat tea was below 1 ppm, and that result appears to be consistent with that for the present PCR method. These results suggest that the PCR method designed using the primer pair is applicable for identifying buckwheat in processed food products, except for those that are highly processed, and that the sensitivity of the PCR method appears to be similar to that of the ELISA method. Quantitative PCR Hirao et al. developed the quantitative PCR method to detect both cultivated and wild buckwheat [32]. The method was based on a real-time PCR targeting internal transcribed spacer region of Fagopyrum spp. and was designed to detect both cultivated and wild buckwheat, because wild buckwheat might potentially be allergenic. As the internal standard material, ground seeds of statice (Limonium sinuatum) were added to food samples prior to the DNA extraction, and the amount of statice DNA measured by real-time PCR was used to standardize the buckwheat content. Statice, an ornamental plant, was chosen as the internal standard material because it was readily available and was inferred to be least likely to be comingled in foods. The specificity of the PCR system was tested against commonly used food materials of plant origin. Quantitative results expressed in the buckwheat protein concentrations (mean standard deviation) for various food samples prepared to contain 10 ppm (w/w) of buckwheat flour (corresponding to 1.2 mg/g, ppm buckwheat protein) ranged from 0.7 0.2 (rice) to 0.9 0.4 (wheat), and for 100 ppm (w/w) samples (12 mg/g, ppm buckwheat protein), from 7.7 1.0 (pepper) to 9.8 0.5 (wheat) ppm (w/w). The method’s accuracy, sensitivity, and specificity were also considered sufficient for the detection of buckwheat contamination at the level required for compliance with the Japanese food allergen labeling regulation. REFERENCES 1. Ebisawa M, Ikematsu K, Imai T, Tachimoto H (2003). J. World Allergy Org., 15: 214–217.
308
JAPANESE REGULATIONS AND BUCKWHEAT ALLERGEN DETECTION
2. Notification 1106001 of Nov. 6, 2002, and revised Notification 0622003 of June 22, 2006, Department of Food Safety, Ministry of Health, Labor and Welfare of Japan. 3. Matsuda R, Yoshioka Y, Akiyama H, et al. (2006). J. AOAC Int., 89:1600–1608. 4. Watanabe K, Aburatani T, Mizumura M, et al. (2005). J. Immunol. Methods, 300:115–123. 5. Shibahara Y, Oka M, Tominaga K, et al. (2007). Nippon Shokuhin Kagaku Kogaku Kaishi, 54:280–286. 6. Seiki K, Oda H, Yoshioka H, et al. (2007). J. Agric. Food Chem., 55:9345–9350. 7. Sakai S, Matsuda R, Adachi R, et al. (2008). J. AOAC Int., 91:123–129. 8. Yamakawa H, Akiyama H, Endo Y, et al. (2007). Biosci. Biotechnol. Biochem., 71:2561– 2564. 9. Yamakawa H, Akiyama H, Endo Y, et al. (2008). Biosci. Biotechol. Biochem, 72:2228–2231. 10. Watanabe T, Akiyama H, Yamakawa H, et al. (2006). J. Food Biochem., 30:215–233. 11. Wieslander G (1996). Review on buckwheat allergy. Allergy, 51:661–665. 12. Wieslander G, Norb€ack D (2001). Buckwheat allergy. Allergy, 56:703–704. 13. Takahashi Y, Ichikawa S, Aihara Y, Yokota S (1998). Buckwheat allergy in 90,000 school children in Yokohama [in Japanese]. Arerugi, 47:26–33. 14. Yuge M, Niimi Y, Kawana S (2001). A case of anaphylaxis caused by buckwheat as an addition contained in pepper (in Japanese). Arerugi, 50:555–557. 15. Noma T, Yoshizawa I, Ogawa N, Ito M, Aoki K, Kawano Y (2001). Fatal buckwheat dependent exercised-induced anaphylaxis. Asian Pac. J. Allergy Immunol., 19:283–286. 16. W€uthrich B, Trojan A (1995). Wheatburger anaphylaxis due to hidden buckwheat. Clin. Exp. Allergy, 25:1263. 17. Davidson AE, Passero MA, Settipane GA (1992). Buckwheat-induced anaphylaxis: a case report. Ann. Allergy, 69:439–440. 18. Imai T, Iikura Y (2003). The national survey of immediate type of food allergy [in Japanese]. Arerugi, 52:1006–1013. 19. Kanagawa Y, Imamura T (2002). The labelling standards of foods containing allergic substances [in Japanese]. Shokuhin Eiseigaku Zasshi, 43:J269–J271. 20. Yasui Y, Ohnishi O (1998). Phylogenetic relationships among Fagopyrum species revealed by the nucleotide sequences of the ITS region of the nuclear rRNA gene. Genes Genet. Syst., 73:201–210. 21. Yasui Y, Ohnishi O (1998). Interspecific relationships in Fagopyrum (Polygonaceae) revealed by the nucleotide sequences of the rbcL and accD genes and their intergenic region. Am. J. Bot., 85:1134–1142. 22. Nair A, Adachi T (2002). Screening and selection of hypoallergenic buckwheat species. Sci. World J., 2:818–826. 23. Wang Z, Zhang Z, Wieslander G, et al. (2000). Purification and some properties of the protein with 24kDa in Tartary buckwheat. Fagopyrum, 17:41–44. 24. Tanaka K, Matsumoto K, Akasawa A, et al. (2002). Pepsin-resistant 16-kD buckwheat protein is associated with immediate hypersensitivity reaction in patients with buckwheat allergy. Int. Arch. Allergy Immunol., 129:49–56. 25. Asero R (2005). Plant food allergies: a suggested approach to allergen-resolved diagnosis in the clinical practice by identifying easily available sensitization markers. Int. Arch. Allergy Immunol., 138:1–11.
REFERENCES
309
26. Park JW, Kang DB, Kim CW, et al. (2000). Identification and characterization of the major allergens of buckwheat. Allergy, 55:1035–1041. 27. Fujino K, Funatsuki H, Inada M, Shimono Y, Kikuta Y (2001). Expression, cloning, and immunological analysis of buckwheat (Fagopyrum esculentum Moench) seed storage proteins. J. Agric. Food Chem., 49:1825–1829. 28. Yoshioka H, Ohmoto T, Urisu A, Mine Y, Adachi T (2004). Expression and epitope analysis of the major allergenic protein Fag e 1 from buckwheat. J. Plant Physiol., 161:761– 767. 29. Koyono S, Takagi K, Teshima R et al. (2006). Molecular cloning of cDNA, recombinant protein expression and characterization of a buckwheat 16kDa major allergen. Int. Arch. Allergy Immunol 140:73–81. 30. Matsumoto R, Fujino K, Nagata Y, et al. (2004). Molecular characterization of a 10-kDa buckwheat molecule reactive to allergic patient IgE. Allergy, 59:533–538. 31. Sampson HA (2004). Update on food allergy. J. Allergy Clin. Immunol., 113:805–819. 32. Sicherer SH, Sampson HA (1999). Food hypersensitivity and atopic dermatitis: pathophysiology, epidemiology, diagnosis, and management. J. Allergy Clin. Immunol., 104: S114–S122. 33. Hirao T, Hiramoto M, Imai S, Kato H (2006). A novel PCR method for quantification of buckwheat by using a unique internal standard material. J. Food Prot., 69:2478–2486.
CHAPTER 16
Egg Allergen Detection MASAHIRO SHOJI Morinaga Institute of Biological Science, Inc., Yokohama, Japan
16.1
INTRODUCTION
In recent years, food allergies have become a significant health issue in industrialized countries. According to an updated estimation [1], food allergies affect 3.7% of U.S adults and 6% of infants (<3 years). In addition, a comparison of food allergy surveys across time shows that the prevalence of food allergies is increasing [2]. To date, various kinds of foods are known to elicit allergic reactions [3]. Although the diet and eating habits of a particular region can obviously affect the incidence of food allergies, the most common foods causing allergic reactions are relatively universal. Egg is one of the most significant cause of food allergies. Recent studies pointed out that egg, along with milk, is a major cause of atopic dermatitis, a type of food-induced allergic disorder which is increasing markedly in the pediatric (babies, infants, and children) population [4]. Because the modern diet contains a number of ingredients derived from eggs, food chemists should have insights regarding of egg allergy in order to serve consumer health interests as well as to fulfill food industry liability. This chapter provides a basic overview of egg allergy, egg allergens, current immunological methods for the detection of egg, and areas where improvement is needed in detection methods.
16.2
EGG ALLERGY
Egg allergy is a type of hypersensitivity involving the immune system and mediated by immunoglobulin E (IgE) directed against allergenic egg protein. Egg proteins may elicit one or more of the following symptoms: cutaneous (e.g., urticaria, edema, rash, dermatitis), gastrointestinal (e.g., oral allergy syndrome, vomiting, abdominal pain, Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
311
312
EGG ALLERGEN DETECTION
diarrhea), and respiratory (e.g., wheezing, asthma) [5,6]. The most severe cases involve multiple system disorders that can lead to life-threatening anaphylactic shock, although egg allergy is considered to induce fewer anaphylactic reactions than do peanuts, tree nuts, and crustaceans (shrimp and crab) [7]. Several epidemiological surveys have reported data on the prevalence of food allergies in different countries (Table 16.1). However, a comprehensive comparison among individual surveys is difficult because of differences in the study population and lack of standardized survey methodologies [26]. Egg is one of the most common allergenic foods across the date of the survey and throughout the countries covered, as shown in Table 16.1, regardless of the local dietary habits in different countries. A Japanese prospective hospital survey representing 3882 allergic patients corroborates this finding [21]. Here egg was the top allergenic food, responsible for 38.3% of food allergy incidences and 25.8% of anaphylactic shock (Table 16.2). Egg anaphylaxis is still a significant issue in Japan. This Japanese study was based on a survey performed on emergency room visits; therefore, the result should be interpreted as one aspect of food allergy incidence in Japan. Another characteristic of egg allergy is that it is observed markedly in the pediatric population and less prevalently in the adult population (Table 16.1). In the United States, the prevalence of egg allergy has been reported to be 1.3% among young children and 0.2% among adults [2]. In Norway, it has been presumed as high as 2.6% of infants (0 to 2.5 years old) [27]. Atopic dermatitis, a type of allergic disorder mediated by IgE, is the predominant clinical symptom of egg allergy observed in the pediatric population [4,28]. The high prevalence of allergy in pediatrics is assumed to be due to the immaturity of the gastrointestinal epithelial membrane barrier of infants, which allows a higher quantity of allergenic proteins to pass into infants’ circulatory systems. It eventually stimulates the immune system to produce IgE against allergenic proteins in sensitive persons [29]. Upon maturation of the gastrointestinal membrane barrier, some children outgrow an allergy by developing tolerance to allergenic proteins by mechanisms that are not well understood. A predictive study suggests that about 68% of those allergic to egg can tolerate egg by the age of 16, which has been linked to a reduction in the eggspecific IgE level. However, people with an egg-specific IgE level greater than 50 kU/L are reported less likely to outgrow an egg allergy [30]. A study by Ebisawa [21] demonstrated the natural history of egg allergy by showing major allergenic foods in different age groups (Table 16.3). Surprisingly, egg is responsible for 62% of food allergy incidence in babies less than 1 year old. The Japanese survey confirmed that egg is the leading cause of food allergy in infants up to 6 years of age, although the proportion decreases with age. The dominant allergenic foods in the adult population (over 20 years) are crustaceans (e.g., shrimp, crab, scallop, squid, octopus), wheat, and fruits (e.g., kiwi, banana, peach); egg becomes less prevalent. Interestingly, allergic reactions to food in persons over 20 years of age seem to be much more diversified. The high prevalence of egg allergy in the physically weak pediatric population increases the social interest in preventing allergic incidence. An allergen management practice to minimize early exposure to eggs has been proposed by physicians since
313
a
4
X
4
X
Milk Egg Peanut Soy Wheat Tree nuts Fish Shellfish
17
X
X X 16
1
X
Milk Egg Soy Wheat
X 17
Peanut Milk Egg
Denmark
Egg Milk Peanut
X 4
Peanut Tree nuts Fish Shellfish
Nuts Vegetable Fruits Other Flour Milk Egg
Germany
Milk Egg Peanut Soy
United States
Spain
X 18
Egg Fish Milk Peach Nuts Lentil Peanut Chick pea
1
X
Milk Egg Peanut Wheat Soy Tree nuts Fish Shellfish
Allergenic Foods in Various Countries
X 1
19
20
X
X X
Australia
X 9 Japan
10
X X
X X X 21
Singapore
12
X
22
X
Bird’s nest Seafood Egg Milk Chinese herbs
11
X
Peanut Milk Milk Tree nuts Egg Peanut Milk Egg Egg Additives Tree nuts Wheat Strawberry Sesame
England
Egg Milk Wheat Buckwheat Shrimp Peanuts
Milk Additives Egg Peanut Tree nuts Wheat Fish Shellfish
Egg Milk Peanut Sesame seed
X 8
Chocolate Additives Citrus Fish/shellfish Cheese Egg Milk Nuts
Egg Milk Sesame
Israel
Shellfish Peanut Tree nuts Fish
Parentheses around the entries for Thailand indicate that allergic foods were not ranked.
Rank: 1 2 3 4 5 6 7 8 Population: Babies/infants Children Adults Reference
Rank: 1 2 3 4 5 6 7 8 Population: Babies/infants Children Adults Reference
TABLE 16.1
23
X
Egg Shellfish Peanut Fish Milk Sesame Wheat Soy
13
X
Egg Peanuts Milk Mustard Cod
X X X 14
24
X
Egg Milk Fish Seafood
Korea
Rosaceae fruit Vegetables Milk Crustaceans Shellfish Fruit Egg Tree nuts
France
25
#a Milk Egg Shrimp
Thailand
X X
"
15
X
Milk Egg Kiwis Peanuts Fish Tree nuts Shrimp
314
EGG ALLERGEN DETECTION
TABLE 16.2
Allergenic Foods in Japan Food Allergy
Food Ingredient Egg Milk/dairy products Wheat Buckwheat Shrimp Peanuts Others Total
Anaphylactic Shock
Rank
Cases
Percent
Rank
Cases
Percent
1 2 3 4 5 6
1486 616 311 179 161 110 1019 3882
38.3 15.9 8.0 4.6 4.1 2.8 26.20 100.00
1 2 3 4 6 5
109 93 70 28 14 18 91 423
25.8 22.0 16.5 6.6 3.3 4.3 21.50 100.00
Source: Ref. 21.
sensitization to egg proteins has been reported to occur before the age of 2 years [31]. The elimination of egg from a baby’s diet may reduce egg allergy episodes. The elimination of egg from a maternal diet is also recommended since egg protein (ovalbumin) has been detected in breast milk of lactating woman after egg intake, which might explain the early onset of egg allergy in infants [32]. Egg may pose a health risk to food industry workers exposed to this ingredient. Egg is commonly used by the food industry in various forms, such as liquid egg, dried egg, condensed egg, and egg white/yolk powder, which may become aerosolized and induce occupational asthma [33,34].
16.3
HEN EGGS
Since ancient times, avian eggs have been one of the most common and important foods in the human diet. Egg is considered the most complete food source from the nutritional perspective since it provides all the nutrients required for embryo development. Egg is used not only because of its high nutritional value, which is especially important as an excellent source of nourishment for growing children, but also because
TABLE 16.3 Rank 1 2 3 Subtotal
Major Allergenic Foods by Age in Japan
<1 year (n ¼ 1270)
1 year (n ¼ 699)
2, 3 years (n ¼ 594)
Egg 62% Milk 20% Wheat 7% 89%
Egg 45% Milk 16% Wheat 7% 68%
Egg 29% Milk 18% Wheat 8% 55%
Source: Ref. 21
4–6 years (n ¼ 454)
7–19 years (n ¼ 499)
Over 20 years (n ¼ 366)
Egg 23% Milk 19% Crustaceans 9% 51%
Crustaceans 16% Egg 15% Buckwheat 11% 42%
Crustaceans 18% Wheat 15% Fruits 13% 46%
EGG ALLERGENS
TABLE 16.4
315
Typical Egg Composition (Average Value, g/egg)
Total egg Wet Liquid egg Egg white Egg yolk Eggshell a Dry Whole egg powder Egg white Egg yolk Eggshell a
Weight
Water
Protein
Lipid
Mineral
Carbohydrate
57.6
38.1
7.0
5.832
6.449
0.484
51.7 33.0 18.7 5.9
38.0 28.9 9.1 0.1
6.6 3.5 3.1 0.38
5.832 0.002 5.83 0
0.549 0.231 0.318 5.9
0.484 0.297 0.187 0
13.7 4.1 9.6 5.8
— — — —
6.6 3.5 3.1 0.38
5.832 0.002 5.83 0
0.549 0.231 0.318 5.9
0.484 0.297 0.187 0
Source: Ref. 36. a Eggshell with eggshell membrane.
of its multiple technological functions in food processing, such as foaming, emulsifying, and water-holding properties. In the food industry environment, “egg” normally refers to a hen egg, due to the minor consumption of such other eggs as duck, quail, and goose. In this chapter we therefore focus on hen eggs, although other avian eggs also show allergenicity [35]. An egg consists of three parts: egg white, egg yolk, and eggshell. The proportions among the various components of an average egg (57.6g) are 33.0 g egg white, 18.7 g egg yolk, and 5.9 g eggshell/membrane (Table 16.4) [36]. From the food industry perspective, edible egg white and yolk are the fractions of interest. The edible part of a fresh egg (51.7 g) is composed of water (38 g), protein (6.6 g), lipid (5.832 g), minerals (0.549 g), and carbohydrates (0.484 g). Because of its high protein content, an egg is regarded as a highly allergenic food [37].
16.4
EGG ALLERGENS
It is generally recognized that allergenic proteins are present in food at high concentrations. The higher the exposure to dietary protein, the more frequent is the potential for sensitization and elicitation of an allergic reaction [37]. A number of egg proteins present in both egg white and egg yolk have been identified to elicit allergic reactions, and the major allergenic proteins recognized by specific IgE from egg-allergic persons are listed in Table 16.5 [36,38–41]. There are still other proteins considered as minor egg allergens [42]. 16.4.1
Allergens in Egg White
Egg white, in which most allergenic egg proteins are located [43], is recognized as being more allergenic than egg yolk. Ovomucoid, ovalbumin, ovotransferrin, and
316
EGG ALLERGEN DETECTION
TABLE 16.5
Major Allergenic Proteins in Edible Parts of an Egg (Average Value)
Description Edible parts of egg Egg white portion Ovomucoid Ovalbumin Ovotransferrin (conalbumin) Lysozyme Egg yolk portion a-Livetin (chicken serum albumin)
Quantity per Egg (g)
Percent of Edible Egg Protein
Percent of Egg White Portion
— — 28 45 76
6.600 3.500 0.385 1.890 0.420
100.0 53.0 5.83 28.6 6.36
100.0 11.0 54.0 12.0
14 — 70
0.119 3.100
1.8 47.0
Allergen Denomination
MW (kDa)
— — Gal d 1 Gal d 2 Gal d 3 Gal d 4 — Gal d 5
3.4
Source: Data from Refs. 36 and 38 to 41.
lysozyme are major allergenic egg white proteins [44,45]. These proteins account for 11%, 54%, 12%, and 3.4% of egg white protein, respectively (Table 16.5). Ovomucoid, termed Gal d 1 as an allergen denomination, is a glycoprotein with a molecular weight of 28 kDa containing 186 amino acid residues with a high carbohydrate content (20 to 25%). Ovomucoid consists of three domains with three intramolecular disulfide bonds responsible for its resistance to heat and denaturing reagents [46–48]. Despite the comparative thermal resistant feature of ovomucoid, heat treatment at 100 C for 30 min induced the irreversible heat-denaturation observed by anti-ovomucoid monoclonal antibody analysis [49]. Separately, we found that elevated heat treatment at 121 C for 20 min, the condition for retorted/canned food processing, resulted in a remarkable reduction in immunoreactivity, approximately 1:50, to antinative ovomucoid polyclonal antibodies (Figure 16.1). Ovomucoid possesses trypsin inhibitor activity, which might explain its resistance to digestive enzymes [50]. These features may contribute to ovomucoid stability and a potential for passing the gastrointestinal barrier in intact form, which probably promotes the sensitization, and elicitation of the allergic response. Ovalbumin, Gal d 2, which constitutes 54% of egg white protein, is a monomeric water-soluble glycoprotein with a molecular weight of 45 kDa. It has 385 amino acid residues and one carbohydrate side chain. Ovalbumin is the only protein that contains a free sulfhydryl group having the potential for cross-linking to modify the molecular structure during food processing by heat, pH, and denaturing reagents [51]. The thermolabile character of ovalbumin at neutral pH was described with denaturation starting at around 80 C, and aggregation/polymerization at a temperature higher than 88 C [52]. Ovotransferrin (conalbumin), Gal d 3, is a single glycosilated polypeptide with a molecular weight of 76 kDa. The metal (e.g., iron, cupper, zinc)-binding capacity of
MECHANISMS OF ALLERGIC REACTIONS
317
3
Absorbance
2.5 2
No treatment 50°C treated 100°C treated 121°C treated
1.5 1 0.5 0 0
1 10 100 1,000 Observed ovomucoid concentration (ng/mL)
10,000
FIGURE 16.1 Reactivity of anti-intact ovomucoid polyclonal antibody to heat-treated ovomucoid. Ovomucoid was heat-treated at 50, 100, and 121 C for 20 min, then was assayed by sandwich ELISA using anti-intact ovomucoid antibody.
ovotransferrin allows it to play a vital role in metabolic activities involving metal transport, especially iron [53]. Lysozyme, Gal d 4, is an enzyme capable of hydrolyzing beta-linkages between N-acetylmuramic acid and N-acetylglucosamine of the gram-positive bacterial mucopolysaccharide. It is a basic protein with a molecular weight of 14 kDa, consisting of a single polypeptide of 129 amino acid residues. Due to four inner disulfide bonds, lysozyme is stable at high temperature. Lysozyme has been used widely as a preservative in the food industry as well as an antibacterial by the pharmaceutical industry. 16.4.2
Allergens in Egg Yolk
Egg yolk is believed less allergenic than egg white. The major proteins present in egg yolk are identified as high- and low-density lipoproteins, phosvitin, and livetin [54]. a-Livetin (chicken serum albumin), Gal d 5, a fractionate of livetin, is a water-soluble glycoprotein of molecular weight of 70 kDa that is reported to be an inhalant allergen in the food industry [55].
16.5 16.5.1
MECHANISMS OF ALLERGIC REACTIONS Factors Eliciting Allergic Reactions
Allergic reactions occur as the result of interactions between factors concerning host allergic individuals and factors concerning assimilated food. Those factors are illustrated in Figure 16.2. Factors concerning the host include:
318
EGG ALLERGEN DETECTION
Factors concerning to host • Sensitizing allergenic protein • Generation of IgE against specific
binding site of allergenic protein • Threshold: eliciting dose (host dependent)
Factors concerning to food
X
• Allergenic protein in food • Binding sites and configuration
= Allergic reactions
of allergenic protein • Exposure to allergenic protein
FIGURE 16.2 Factors eliciting allergic reactions.
1. Sensitization to a particular allergenic protein capable of eliciting allergic reactions in subsequent exposures (i.e., some egg-allergic individuals are sensitized and may react to one or more egg allergens), shown in Table 16.5. 2. Generation of IgE against specific binding sites (i.e., epitope) of exposed allergenic protein. Some epitopes may be modified as food processing may affect the spatial configuration of proteins, which may alter protein allergenicity. For example, different epitopes in raw (i.e., native) and cooked (i.e., denatured) egg may generate IgEs specific for each epitope, resulting in different allergic responses to raw and cooked egg in allergic patients [56]. 3. Individual sensitivities to allergenic proteins determine the threshold dose of allergenic protein, which depends not only on the amounts of allergenic protein in the food, but also on the protein allergenic properties, which may be influenced by food processing. Factors concerning food include: 1. The presence of the allergenic protein in the food (e.g., ovalbumin, ovomucoid, ovotransferrin) 2. The presence of IgE binding sites on the allergenic protein 3. Exposure to allergic protein necessary to elicit an allergic reaction Allergic reactions are quite individualistic in nature, which makes it difficult to determine the allergenic risk of food allergens, as risk assessment on allergenicity needs to consider factors related to the food as well as to the host. 16.5.2
Threshold Dose
One of the advantages of setting thresholds for food allergens is based on the ability of the industry to put in place better food allergen management programs, therefore strengthening the delivery of accurate product information to allergic consumers. Threshold dose has been defined as the lowest amount of the allergen that would elicit mild objective symptoms in the most sensitive persons [57]. However, the complexity of factors involved in allergic reactions (Figure 16.2) makes the establishment of a threshold dose a difficult challenge [58,59]. According to recent findings, the threshold dose eliciting objective allergic reactions is reported as 3.33 mg of spray-dried whole egg in egg-allergic children [57]. The limitation of these types of surveys is that they do not usually include individuals who react severely to allergens since they are often excluded from clinical studies due to
MINIMIZATION OF ALLERGIC REACTIONS
319
ethical reasons. The approach to determine the threshold dose by a statistical model predicted that 3.4 mg of fresh hen’s egg yields a one-in-a-hundred allergic reaction rate, and 0.002 mg results in a one-in-a-million rate [60]. 16.6 16.6.1
MINIMIZATION OF ALLERGIC REACTIONS Attempt Through Food Processing
The reduction of allergenicity by heat processing, which alters the epitope configuration of egg proteins, has been reported [61]. Another study described that heat processing decreased the immunoreactivity of egg proteins to specific human IgE [62]. Although 73% of egg-allergic children older than 5 could tolerate heat-cooked egg, the persistence of egg allergy to heated eggs seemed to be associated with stronger sensitization to specific egg protein epitopes in highly atopic persons [56]. On the other hand, it has also been suggested that processing may result in the formation of new IgE-binding epitopes due to changes in epitope configuration of allergic proteins and also due to the formation of cross-linkage to other food components, such as the protein–sugar reaction, called the Maillard reaction [61,63]. In fact, peanut roasting enhanced the immunoreactivity of specific IgE from peanutallergic persons to roasted peanuts 90-fold compared to raw peanuts [64]. Another study reported the reduction of egg white allergenicity by heating at 90 C, followed by depleting heat-resistant ovomucoid through washing. The daily challenge during 14 and 28 days in 32 persons allergic to egg using heated and ovomucoiddepleted egg white presented no allergic response [65]. The reduction of allergenicity by enzymatic hydrolysis of allergens has also been evaluated for use as hypoallergenic food products, such as rice [66], milk [67–69], and wheat [70]. However, there are no reports for egg. Consequently, the use of food processing as a way to eliminate the risk for allergic reactions is rather limited. 16.6.2
Attempt Through Food Labeling
Currently, the only effective management of food allergy involves complete avoidance of the offending food allergen. That can be achieved by controlling the exposure of allergic persons to food allergens. This implies that by providing accurate allergic information on food labels, allergic persons can examine the labels for the presence of the offending food in order to avoid allergic reactions. Egg and egg derivatives are among the most common ingredients in food preparations, but sometimes they cannot be recognized by the allergic consumer (e.g., egg in bakery products, ice creams, dressings, and also food containing eggderived food additives such as lecithin) [71]. For this reason, the accuracy and language used in labels play a crucial role for allergic persons. Given the potential health consequences for allergic persons, the food industry should take responsibility for ensuring proper labeling of egg-containing food products. Failure to label food products that contain egg appropriately is not compliant with food allergen labeling legislation, and any resulting harm to consumers may lead to the liability of the manufacturer.
320
EGG ALLERGEN DETECTION
Food and Drug Administration (FDA) recall data in 1999 suggested that a major factor accounting for the recalls due to the presence of undeclared food allergens was the result of human error on labeling [72]. A subsequent FDA report proved increasing manufacturer awareness in ensuring proper labeling (i.e., 75% of food manufacturing facilities surveyed self-inspected finished package labels in the year 2003–2004, with 68% in 2002) [73]. However, FDA recall alerts [74] reveal that the leading cause of the recall remains the same erroneous labeling, suggesting the need for additional measures to prevent labeling error. As a primary option to verify labeling validity for undeclared allergens, the confirmatory detection of existing allergens in finished products has become significant.
16.7 16.7.1
DETECTION OF EGG Detection Method for the Presence of Egg
To ensure the safety of food products and compliance with labeling legislation, reliable methods to detect allergens existing in food products are required. To guarantee the complete safety of object food, the examination of all known allergens in an object is theoretical, but in practice, is impossible economically. Therefore, current methods are to examine the existence of allergenic food in an object product by means of maker protein or DNA, which represents allergenic food, although the methods have a limitation on data implementation. Suppose that the major egg protein ovalbumin is employed as a marker for detecting “egg,” the food using only egg white shows a “positive” assay result. However, the patient who has an allergy only for egg yolk does not elicit an allergic reaction to this food. Meanwhile, the food using only egg yolk show a “negative result,” although the patient who has an allergy for egg yolk elicits an allergic reaction to this food. As the elicitation of allergic reaction is depends intrinsically on the host (see Section 16.5.1), an examination of products is not always able to predict the elicitation of a patient’s allergic reaction. Currently, two analytical techniques have been developed for the detection of food allergens (i.e., protein- and DNA-based techniques) [75]. The DNA-based technique, which amplifies a specific DNA fragment of allergic food gene through polymerase chain reaction, being applied to the detection of egg residue in food products, has limitations due to the low DNA content of egg. Moreover, egg DNA cannot be distinguished from chicken DNA, which is also a popular ingredient of various food products. The protein-based technique is based on an immunological (antigen– antibody) reaction, usually called immunoassay. In immunoassays, the antibody is the detecting entity and plays a key role to achieve high sensitivity and specificity. Egg-specific IgE from allergic patients can be used to determine the presence of allergens in the food that caused an unexpected allergic reaction. This is the ideal situation that allows a direct correlation between immunoassay data and allergic symptoms. However, a consistent supply of allergic patient IgE antibody, especially for commercial purposes, is hardly achievable. To overcome this problem, commercial
DETECTION OF EGG
321
assays use antibodies of the IgG type produced in animals (e.g., rabbit polyclonal, mouse monoclonal antibodies), which have facilitated a more consistent supply of antibody in terms of affinity, specificity, and quantity. In general, the antibodies used in immunoassay are designed to target marker protein indicating the presence of allergenic food, preferably a marker is the allergenic protein [76]. For egg immunoassay, ovalbumin and ovomucoid are commonly employed as target proteins because they are highly allergenic and also abundant in egg (Table 16.5). The immunoassays used most often by the food industry are enzyme-linked immunosorbent assay (ELISA), lateral flow devices (immunochromatography, dipstick), and immunoblotting. The characteristics of each immunoassay are shown in Table 16.6. ELISA is used most commonly in routine food analysis, due to its ability to process several samples simultaneously, simple handling, limited equipment requirements, quantification capability, and potential for standardization. Lateral flow assay is a very simple, rapid, and portable assay which is suitable for performing the analysis on site. Immunoblotting assay consists of separation of proteins by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE), transfer of the separated proteins onto a membrane, and detection of the target protein by labeled antibodies [77]. This assay is suitable as confirmatory test because the target protein is identified by both molecular mass and specific-antibody binding. Taking into account the characteristics of each immunoassay, they can be applied for different purposes within the food industry as part of their allergen control programs. Raw materials and ingredients received from suppliers can be examined for the verification of egg content by quantitative ELISA, although certain companies utilize qualitative lateral flow assay due to cost and rapidness. Lateral flow devices may also be utilized to check the efficiency of cleaning and washing of manufacturing facilities and equipment. The final products may be examined by ELISA before releasing the products, to ensure labeling accuracy and to generate a quantitative record for traceability purposes. ELISA and lateral flow assays sometimes generate false-positive and false-negative results, which may be a consequence of a matrix effect, among other possibilities; therefore, data need to be evaluated carefully, especially after the analysis of new food matrices. False positives are observed in those situations where the assay shows a signal increase due to reactions other than antibody binding to intrinsic antigen. There are two types of false positives, specific- and nonspecific reactions. A specific reaction, also known as a cross-reaction, results from the binding of the antibody to proteins, which are different from target proteins but with similar epitopes. For instance, rabbit anti-ovalbumin antibody reacts to other avian eggs, such as pheasant, goose, duck, and quail, probably due to the high homology of the relevant ovalbumin sequence [80]. Also, we experienced chicken-derived/related foods, such as chicken flesh, chicken lever, and turkey flesh show a reactivity to anti-ovalbumin antibody. Also chicken oviduct, which is sometimes included in chicken variety meats, shows strong reactivity since it secretes ovalbumin. A nonspecific false positive is a reaction that occurred as the result of a nonspecific antibody binding. For example, rabbit anti-ovalbumin antibody reacts to fish eggs, such as salmon roe. We have further investigated this positive reaction by immunoblotting
322 10–20 min
Screening
Confirmation
Qualitative
Electrophoresis, blotting, blocking, and immunostaining: Total ca. 5 h
2–3 h
Assay Time (Excluding Sample Preparation Time)
Screening
Application
Quantitative and qualitative Qualitative
Assay Type
0.5–1
0.5–1
0.1
LOD (ppm)
Immunoassay Used for Detecting Food Allergens in Practical Food Production
ELISA (sandwich) Lateral flow (dipstick) Western blotting (immunoblotting)
TABLE 16.6
Complicated
Very simple
Simple
Technique
No equipment needed Electrophoresis and blotting devices
Microplate reader
Instrumentation
82
78–81
References
DETECTION OF EGG
323
FIGURE 16.3 Western blotting analysis of OVA and salmon roe extract. Ovalbumin and fish egg extract were subjected to SDS-PAGE under reducing conditions. After blotting, lanes 1 to 5 were incubated with anti-ovalbumin rabbit IgG, and lanes 6 to 10 with rabbit IgG, respectively. The bound IgG was immunostained by VECTASTAIN ABC-AP Rabbit IgG Kit (Vector Labs) and Alkaline Phosphatase Substrate Kit IV (Vector Labs). Lanes 1 and 6; molecular markers; lanes 2 and 7; ovalbumin 10 ppm; lanes 3 and 8; ovalbumin 1 ppm; lanes 4 and 9; ovalbumin 0.5 ppm; lanes 5 and 10; salmon roe extract.
(Figure 16.3). Although salmon roe extract presents a strong positive reaction by ELISA using rabbit anti-ovalbumin antibody, immunoblotting demonstrates that the same antibody binds to 9 kDa, 30 kDa, and 100–120 kDa bands of salmon roe extract, which shows the same binding as a non-specific rabbit IgG, but not to the 45-kDa band corresponding to ovalbumin. Consequently, the reaction of anti-ovalbumin antibody to salmon roe is concluded to be a nonspecific reaction. According to our experience, spices (e.g., pepper, cumin) and thickening polysaccharides (e.g., alginic acid, carragenan, guar gum) occasionally show a nonspecific reaction. A false positive has a more direct economical impact on the manufacturer. A false positive due to a specific reaction may result in significant losses because manufactured products, potentially unsafe for allergic persons, are hardly released to the market. Similarly, false positives by nonspecific reactions may lead to economical loses due to unnecessary recalls, or additional tedious procedures to ensure product safety. To verify doubtful positive results, immunoblotting assay can be utilized as a confirmatory test. In a false negative, the assay fails to detect the target protein. A false negative is observed frequently in highly processed food, such as retorted/canned products, bread/ bakery, and fried noodles, and it is explained by the lower extraction efficiency of sample extraction solutions, due to decreased solubility of proteins from processed foods. False negatives are also due to the inability of the antibody to recognize the target protein exposed to harsh food processing [83]. Two additional false-negative examples are described below. The first type, the prozone/high-dose hook effect, may occur in lateral-flow assay and one-step sandwich ELISA, which happens when the target protein is present in a sample at a very high concentration. Both capture and labeled antibodies are fully occupied by existing target protein and fail to form the sandwich complex (i.e., labeled-antibody/target
324
EGG ALLERGEN DETECTION
protein/capture antibody complex). Consequently, the test shows a false negative result. The second type, especially important in lateral-flow assay, is caused by the sample matrix effect. Some sample matrices impede the sample and conjugated antibody flow along the assay membrane. For example, viscous or oil-rich matrices sometimes show false negative results, probably due to slow capillary migration of labeled antibody or retardation of binding between target protein and antibody. False negatives can be determined only when the target protein is expected to be in the food as it is used as an ingredient. However, in practice it is very difficult to recognize false negative results when the allergen is an unexpectedly present in the sample. False negatives have an ethical and economical impact for the manufacturer in terms of product liability, as the products can lead to unexpected allergic reaction in sensitive allergic persons. Several quantitative and qualitative immunoassay kits are commercially available for detecting egg (Tables 16.7 and 16.8). 16.7.2
Reference Material
To manage data accuracy and standardize assay results, which is required by recent evidence-based quality assurance and laboratory management such as good laboratory practice, the immunoassays need to be validated by using reference material. Usually, the reference material can be prepared in the form of egg powder or egg protein extract in each laboratory. An internationally recognized reference material can be obtained from the U.S. Commerce Department’s National Institute of Standards and Technology, NIST RM-8445, Spray-Dried Whole Egg for Allergen Detection, which is also recognized by the Institute of Reference Materials and Measurements of the European Commission. Another NIST egg reference, NIST RM-8415, The Egg Powder, used for nutritional analysis, was found not to be appropriate as a reference for egg immunoassays because of the poor solubility of egg proteins [83]. The National Institute of Health Sciences, (Japan) established egg reference material independently in 2006 [84]. 16.7.3
Improved Detection Method for Processed Food
Despite the fact that numerous ELISA kits have been developed for detecting egg in foods, they are limited in their ability to detect egg in processed foods. During food processing, proteins in food are exposed to different physical–chemical conditions, including, but not limited to, heat, pressure, and acidic/alkali environment. Processing may alter the native structure of food proteins by denaturation and aggregation/ polymerization in the food matrix, although the degree to which proteins are affected depends on the processing conditions, coexisting substances, and the physical– chemical characteristics of the protein. These may lead to changes in epitope conformation or binding of the epitope to other food components. Such altered epitopes may not be recognized by antibodies. For instance, a study reported that commercial ELISA kits recovered two to three orders of magnitude less egg from egg-incurred noodles after boiling. This suggests that the target egg protein in noodle
325
ELISA, sandwich 1.0–5.0 ppm Ovalbumin and ovomucoid
Format
48
60 min — — 96
SDS/2-MEb extraction SDS/2-ME buffer extraction buffer 170 min 90 min — 0.078 ppm 0.312 ppm (1 ppm)c
10 mM PBSa þ additive in kit 30 min — — 96
Approx. 13 h
Approx. 13 h
Egg protein
0.312–20 ppm Ovalbumin
Approx. 30 min
0.4–20 ppm Multiantigens (egg)
Egg protein
48
b
R-Biopharm
48
30 min 0.6 ppm 1 ppm
Kit extraction buffer
Approx. 20 min
1–27 ppm Egg white proteins (ovalbumin, ovomucoid, ovotransferrin, lysozyme) Egg white protein
FASTKIT ELISA Ver. FASPEK Egg RADASCREEN II Egg FAST Ei/Egg ELISA, sandwich ELISA, Sandwich ELISA, Sandwich
Morinaga Institute of Biological Science
Whole driedegg
2.5–25 ppm Egg white proteins
ELISA, sandwich
Veratox for egg
Neogen
Nippon Meat Packers
PBS: Phosphate buffered saline. SDS/2-ME: Sodium lauryl sulfate/2-mercaptoethanol. c No description of limit of quantification. One ppm stands for the lowest concentration of kit standard.
a
Incubation time Limit of detection Limit of quantification Wells provided
Result reported as: Egg white protein Sample Approx. preparationtime 35 min Extraction buffer Kit extraction buffer
Assay range Specificity
Egg
Kit name
ELISA Systems
TABLE 16.7 Commercial Quantitative Immunoassay Kits
ELISA, Sandwich
BIOKITS EGG
Tepnel
96
120 min 0.5 ppm 0.6 ppm
Kit extraction buffer
Approx. 40 min
96
75 min 0.1 ppm 0.5 ppm
Tris/high salt þ gelatin
Less than 1 h
Whole egg protein Egg white proteins
0.6–15 ppm 0.5–10 ppm Egg white and yolk Ovomucoid proteins
ELISA, Sandwich
Egg
TECRA
326
Detection limit Specificity Result reported as Reaction time Tests per kit
Format
Kit name
TABLE 16.8
5 ppm Whole egg proteins Egg protein
15 min 20
30 min Up to 20
FASTKIT Immunochromato Egg Lateral flow
Nippon Meat Packers
Alert for Egg Allergen ELISA, sandwich 5 ppm Egg residue Egg residue
Neogen
Commercial Qualitative Immunoassay Kits
15 min 20
0.5 ppm Ovalbumin Egg protein
Lateral flow
Nanotrap Egg
5h 5 gel plates (Mini-gel)
0.5 ppm Ovalbumin Ovalbumin
Egg Westernblot kit (Ovalbumin) Western blotting
5h 5 gel plates (Mini-gel)
0.5 ppm Ovomucoid Ovomucoid
Egg Westernblot kit (Ovomucoid) Western blotting
Morinaga Institute of Biological Science
Low ppm Ovomucoid Egg white protein 10 min 7
BIOKITS RAPID 3-D Lateral flow
Tepnel
DETECTION OF EGG
327
may have undergone self-aggregation and polymerization with wheat proteins during kneading and heat denaturation during boiling. Eventually, the insolubilization of target egg protein made the target unavailable for the assay, and the recovered egg protein may have been denatured, leading to epitope change to reduce immunoreactivity [83]. Protein solubilization and the modification of epitope configuration resulting from processing are challenges that need to be addressed during the development of immunoassays for processed foods. The solubilization of the target protein is a requirement to obtain successful immunoassay results [85,86]. Figure 16.4 shows solubility issues arising from a typical sample preparation prior to ELISA analysis. A homogenized hard-boiled egg, which stands for heat-processed food, is placed in a centrifuge tube, mixed with the sample extraction solution (Tris-buffered saline) to solubilize egg proteins, and insoluble material was separated by centrifugation. The mass of the centrifuged precipitate is approximately equal to that of the original hard-boiled egg, suggesting the unsuccessful solubilization of heat-processed egg proteins. Insolubilization is usually caused by the impaired solubility associated with the aggregation of processed egg proteins, and the interaction with substances in the food matrix (e.g., coexisting proteins, sugars). As result, the target egg proteins remain solid and are separated as precipitate, which is unavailable for the assay. To increase the solubility of egg proteins from a hard-boiled egg, a new solution containing a surfactant, SDS, for solubilization, and a reducing agent, 2-mercaptoethanol (2-ME), for dissociation, has been introduced [87]. As shown in Figure 16.5, the precipitate after SDS/2-ME extraction is much less than that of Tris-buffered saline, and the recovered protein shows a five-fold increase by SDS/2-ME solution in boiled egg and two-fold in raw egg, which is nearly equal to the theoretical protein content (Table 16.9).
FIGURE 16.4
ELISA sample preparation.
328
EGG ALLERGEN DETECTION
FIGURE 16.5
Improvement of solubilization.
Figure 16.6 illustrates our strategy to design an antibody suitable for detecting target egg protein in processed food. The antibody specific to the intact form of the target protein binds to the intact target protein, but may scarcely recognize the denatured target protein because of the different epitope configuration from that of the intact form. To detect protein in processed food consisting primarily of denatured forms, we have produced an antibody that recognizes the denatured and reduced form of the target protein. The exposure of food to SDS/2-ME solubilizing during the extraction procedure facilitates the conversion of intact proteins into denatured form and consequently can be recognized by the antibody targeting denatured form. According to this idea, the new ELISA employing anti-denatured ovalbumin antibody and SDS/2-ME solubilizing solution was developed, and the egg recovery from egg-incurred processed foods was examined, compared with conventional ELISA employing anti-intact ovalbumin antibody and Tris-buffered saline. In preparing egg-incurred food for examination of the recovery, the conditions under which egg-incurred modelprocessed food was manufactured mimicked real industrial conditions. As shown in Figure 16.7, the recovery of new ELISA is 47.2% from biscuit, 46.5% from jam, and 92.8% from orange juice, while those of conventional ELISA are 1.48%, 0.65%, TABLE 16.9
Protein Recovery from Egg by Different Solubilizing Solutions a Protein (g in 100-g edible egg portions)
Raw egg Boiled egg a
Solubilization by Tris-Buffered Saline
Solubilization by SDS/2-ME Solution
Standard Tables of Food Composition in Japan (5th Rev.)
6.9 2.0
11.7 10.1
12.3 12.9
Protein concentration was determinned by a 2-D Quant kit (GE Healthcare).
DETECTION OF EGG
329
FIGURE 16.6 Antibody design for processed proteins.
and 1.2%, respectively. The new ELISA has shown a dramatic improvement in recovering egg protein from processed foods. Independent evaluation of the new ELISA reported a significant egg recovery from egg-containing products, even from the products exposed to harsh processing conditions [88]. Upon a collaborative validation study [89], the new ELISA was authorized by the Ministry of Health,
FIGURE 16.7 Recovery from egg-incurred processed foods.
330
EGG ALLERGEN DETECTION
Labor and Welfare (Japan) in 2006, and is widely applied for the detection of egg in processed food products. Acknowledgments The author appreciates Ms. Hemlata Shah and Mr. Sanjay Shah of Crystal Chem Inc. for providing information about kits on the market.
REFERENCES 1. Sicherer SH, Sampson HA (2006). Food allergy. J. Allergy Clin. Immunol., 117:S470– S475. 2. Sampson HA (2004). Update of food allergy. J. Allergy Clin. Immunol., 11:805–819. 3. Hefle SL, Nordlee JA, Taylor SL (1996). Allergenic foods. Crit. Rev. Food Sci. Nutr., 36:S69–S89. 4. Sicherer SH, Sampson HA (1999). Food hypersensitivity and atopic dermatitis: pathophysiology, epidemiology, diagnosis, and management. J. Allergy Clin. Immunol., 104: S114–S122. 5. Sampson HA (2003). 9. Food allergy. J. Allergy Clin. Immunol., 111:S540–S547. 6. Perry TT, Matsui EC, Conover-Walker MK, Wood RA (2004). Risk of oral food challenges. J. Allergy Clin. Immunol., 114:1164–1168. 7. Sampson HA (2000). Food anaphylaxis. Br. Med. Bull., 56:925–935. 8. Young E, Stoneham MD, Petruckevitch A, Barton J, Rona R (1994). A population study of food intolerance. Lancet, 343:1127–1130. 9. Pereira B, Venter C, Grundy J, Clayton B, Arshad SH, Dean T (2005). Prevalence of sensitization to food allergens, reported adverse reaction to foods, food avoidance, and food hypersensitivity among teenagers. J. Allergy Clin. Immunol., 116:884–892. 10. Colver AF, Nevantaus H, MacDougall CF, Cant AL (2005). Severe food-allergic reactions in children across the UK and Ireland, 1998–2000. Acta Paediatr., 94:689–695. 11. Venter C, Pereira B, Grundy J, Clayton CB, Roberts G, Higgins B, Dean T (2006). Incidence of parentally reported and clinically diagnosed food hypersensitivity in the first year of life. J. Allergy Clin. Immunol., 117:1118–1124. 12. Venter C, Pereira B, Grundy J, Clayton CB, Arshad SH, Dean T (2006). Prevalence of sensitization reported and objectively assessed food hypersensitivity amongst six-year-old children: a population-based study. Pediatr. Allergy Immunol., 17:356–363. 13. Rance F, Kanny G, Dutau G, Moneret-Vautrin DA (1999). Food hypersensitivity in children: clinical aspects and distribution of allergens. Pediatr. Allergy Immunol., 10:33–38. 14. Kanny G, Moneret-Vautrin DA, Flabbee J, Beaudouin E, Morisset M, Thevenin F (2001). Population study of food allergy in France. J. Allergy Clin. Immunol., 108:133–140. 15. Rance F, Grandmottet X, Grandjean H (2005). Prevalence and main characteristics of schoolchildren diagnosed with food allergies in France. Clin. Exp. Allergy, 35:167–172. 16. Zuberbier T, Edenharter G, Worm M, et al. (2004). Prevalence of adverse reactions to food in Germany: a population study. Allergy, 59:338–345.
REFERENCES
331
17. Osterballe M, Hansen TK, Mortz CG, Hest A, Bindsiev-Jensen C (2005). The prevalence of food hypersensitivity in an unselected population of children and adults. Pediatr. Allergy Immunol., 16:567–573. 18. Crespo JF, Pascual C, Burks AW, Helm RM, Eseban MM (1995). Frequency of food allergy in pediatric population from Spain. Pediatr. Allergy Immunol., 6:39–43. 19. Dalal I, Binson I, Reifan R, et al. (2002). Food allergy is a matter of geography after all: sesame as a major cause of severe IgE-mediated food allergic reactions among infants and young children in Israel. Allergy, 57:362–365. 20. Hill DJ, Hosking CS, Zhie CY, et al. (1997). The frequency of food allergy in Australia and Asia. Environ. Toxicol. Pharmacol., 4:101–110. 21. Ebisawa M (2004). (Labeling of food containing allergic substance) [in Japanese]. Report of the Ministry of Health, Labor and Welfare, May 31. http://www.mhlw.go.jp/shingi/2004/ 05/s0531-8a.html (accessed Nov. 2008) 22. Goh DLM, Lau YN, Chew FT, Shek LPC, Lee BW (1999). Pattern of food-induced anaphylaxis in children of an Asian community. Allergy, 54:84–86. 23. Chiang WC, Kidon MI, Liew WK, Goh A, Tang JPL, Chay OM (2007). The changing face of food hypersensitivity in an Asian community. Clin. Exp. Allergy, 37:1055–1061. 24. Oh JW, Pyun BY, Choung JT, et al. (2004). Epidemiological change of atopic dermatitis and food allergy in school-aged children in Korea between 1995 and 2000. J. Korean Med. Sci., 19:716–723. 25. Santadusit S, Atthapaisalsarudee S, Vichyanond P (2005). Prevalence of adverse food reactions and food allergy among Thai children. J. Med. Assoc. Thail., 88(suppl. 8): S27–S32. 26. Ebisawa M (2007). Epidemiology of food allergy (its comparison between Japan and other countries) [in Japanese]. Arerugi., 56:10–17. 27. Eggesbe M, Botten G, Halvorsen R, Magnus P (2001). The prevalence of allergy to egg: a population-based study in young children. Allergy, 36:403–411. 28. Langeland T (1985). Allergy to hen’s egg white in atopic dermatitis. Acta DermatoVenereol. Suppl. (Stockh.), 114:109–112. 29. Burks AW, Sampson HA (1993). Food allergens in children. Curr. Probl. Pediatr., 23:230–252. 30. Savage JH, Matsui EC, Skripak JM, Wood RA (2007). The natural history of egg allergy. J. Allergy Clin. Immunol., 120:1413–1417. 31. Arshad SH (2001). Food allergen avoidance in primary prevention of food allergy. Allergy, 56:113–116. 32. Palmer DJ, Gold MS, Makrides M (2005). Effect of cooked and raw egg consumption on ovalbumin content of human milk: a randomized, double-blind, cross-over trial. Clin. Exp. Allergy, 35:173–178. 33. Park HS, Nahm DH (1997). New occupational allergen in a pharmaceutical industry: serratial peptidase and lysozyme chloride. Ann. Allergy Asthma Immunol., 78:225– 229. 34. Escudero C, Quirce S, Fernandez-Nieto M, de Migel J, Cuesta J, Sastre J (2003). Egg white proteins as inhalant allergens associated with baker’s asthma. Allergy, 58:616–620. 35. Langeland T (1983). A clinical and immunological study of allergy to hen’s egg white: VI. Occurrence of proteins cross-reacting with allergens in hen’s egg white as studied in egg
332
36.
37. 38. 39.
40.
41.
42.
43. 44. 45.
46. 47. 48. 49.
50.
51.
52.
EGG ALLERGEN DETECTION
white from turkey, duck, goose, seagull, and in hen egg yolk, and hen and chicken sera and flesh. Allergy, 38:399–412. Sugino H, Nitoda T, Juneja LR (1996). General chemical compositions of hen eggs. In Yamamoko T, Juneja LR, Hatta H, Kim M (eds.), Hen Eggs. CRC Press, Boca Raton, FL, pp. 13–24. Lehrer SB, Ayuso R, Reese G (2002). Current understanding of food allergens. Ann. NY Acad. Sci., 964:69–85. Hoffman DR (1983). Immunochemical identification of the allergens in egg white. J. Allergy Clin. Immunol., 71:481–486. Langeland T (1983). A clinical and immunological study of allergy to hen’s egg white: IV. Specific IgE-antibodies to individual allergens in hen’s egg white related to clinical and immunological parameters in egg-allergic patients. Allergy, 38:493–500. Walsh BJ, Hill DJ, Macoun P, Cairns D, Howden ME (2005). Detection of four distinct groups of hen egg allergens binding IgE in the sera of children with egg allergy. Allergol. Immunopathol. (Madr.), 33:183–191. Szepfalusi Z, Ebner C, Pandjaitan R, et al. (1994). Egg yolk alpha-livetin (chicken serum albumin) is a cross-reactive allergen in the bird-egg syndrome. J. Allergy Clin. Immunol., 93:932–942. Walsh BJ, Barnett D, Burley RW, Elliott C, Hill DJ, Howden ME (1988). New allergens from hen’s egg white and egg yolk: in vitro study of ovomucin, apovitellenin I and VI, and phosvitin. Int. Arch. Allergy Appl. Immunol., 87:81–86. Mine Y (1995). Advances in the understanding of egg white protein functionalities. Trends Food Sci. Technol., 6:225–232. Ebbehoj K, Dahl AM, Frokier H, Norgaad A, Poulsen LK, Barkholt V (1995). Purification of egg-white allergens. Allergy, 50:133–141. Aabin B, Poulsen LK, Ebbehoj K, et al. (1996). Identification of IgE-binding egg white proteins: comparison of results obtained by different methods. Int. Arch. Allergy Immunol., 109:50–57. Deutsch HF, Morton JI (1956). Immunochemical properties of heated ovomucoid. Arch. Biochem. Biophys., 64:19–25. Matsuda T, Watanabe K, Sato Y (1981). Independent thermal unfolding of ovomucoid domains. Biochim. Biophys. Acta, 669:109–112. Li-Chan E, Nakai S (1989). Biochemical basis for the properties of egg white. Crit. Rev. Poultry Biol., 2:21–58. Hirose J, Kitabatake N, Kimura A, Narita H (2004). Recognition of native and/or thermally induced denatured forms of the major food allergen, ovomucoid, by human IgE and mouse monoclonal IgG antibodies. Biosci. Biotechnol. Biochem., 68:2490–2497. Kato I, Schrode J, Kohr WJ, Lakowski M Jr (1987). Chicken ovomucoid: determination of its amino acid sequence, determination of the trypsin reactive site, and preparation of all three of its domains. Biochemistry, 26:193–201. Fernandez-Diez MJ, Osuga DT, Feeney RE (1964). The sulfhydryls of avian ovalbumins, bovine beta-lactoglobulon, and bovine serum albumin. Arch. Biochem. Biophys., 107:449–458. Photchanachai S, Mehta S, Kitabatake N (2000). Heating of an ovalbumin solution at neutral pH and high temperature. Biosci. Biotechnol. Biochem., 66:1635–1640.
REFERENCES
333
53. Ibrahim HR (1996). Insights into the structure–function relations of ovalbumin, ovotransferrin, and lysozyme. In Yamamoko T, Juneja LR, Hatta H, Kim M (eds. ), Hen Eggs. CRC Press, Boca Raton, FL, pp. 37–56. 54. Juneja LR, Kim M (1996). Egg yolk proteins. In Yamamoko T, Juneja LR, Hatta H, Kim M (eds.), Hen Eggs. CRC Press, Boca Raton, FL, pp. 57–71. 55. Quirce S, Diez-Gomez ML, Eiras P, Cuevas M, Baz G, Losada E (1998). Inhalant allergy to egg yolk and egg white proteins. Clin. Exp. Allergy., 28:478–485. 56. Roches AD, Nguyen M, Paradis L, Primeau MN, Singer S (2006). Tolerance to cooked egg in an egg allergic population. Allergy, 61:900–901. 57. Hefle SL, Taylor SL (2002). How much food is too much? Threshold dose for allergenic foods. Curs. Allergy Asthma Rep., 2:63–66. 58. Hourihane JOB, Knulst AC (2005). Thresholds of allergenic proteins in foods. Toxicol. Appl Pharmacol., 207:S152–S156. 59. Crevel RWR, Ballmer-Weber BK, Holzhauser T, et al. (2008). Thresholds for food allergens and their value to different stakeholders. Allergy, 63:597–609. 60. Bindslev-Jensen C, Briggs D, Osterballe M (2002). Can we determine a threshold level for allergicfoods bystatisticalanalysisofpublisheddataintheliterature?Allergy,57:741–746. 61. Davis PJ, Williams SC (1998). Protein modification by thermal processing. Allergy, 53(suppl. 46):102–105. 62. Besler M, Steinhart H, Paschke A (2001). Stability of food allergens and allergenicity of processed foods. J. Chromatogr. B, 756:207–228. 63. Davis PJ, Smales CM, James DC (2001). How can thermal processing modify the antigenicity of proteins? Allergy, 56(suppl. 67):56–60. 64. Maleki SJ, Chung SY, Champagne ET, Raufman JP (2000). The effects of roasting on the allergenic properties of peanut proteins. J. Allergy Clin. Immunol., 106:763–768. 65. Tokuda R, Yabuta N, Kakumu M, et al. (2004). (Trial to induce the remission by heated and ovomucoid-depleted egg white.)[In Japanese]. Jpn. J. Pediatr. Allergy Clin. Immunol., 18:75–79. 66. Watanabe M, Miyakawa K, Ikezawa Z, et al. (1990). Production of hypoallergenic rice by enzymatic decomposition of constituent proteins. J. Food Sci., 55:781–783. 67. Takase M, Fukuwatari Y, Kawase K, et al. (1979). Antigenicity of casein enzymatic hydrolysate. J. Dairy Sci., 62:1570–1576. 68. Sampson HA, Bernheisel-Broadbent J, Yang E, Scanlon SM (1991). Safety of casein hydrolysate formula in children with cow milk allergy. J. Pediatr., 118:520–525. 69. Morikawa A, Kohno Y, Yamashiro Y, et al. (2002). Nutritional and immunological evaluation of ultrafiltrated extensively hydrolyzed casein formula in infants with cow’s milk protein allergy. Jpn. J. Pediatr. Clin. Immunol., 16:103–114. 70. Watanabe M, Watanabe J, Sonoyama K, Tanabe S (2000). Novel method for producing hypoallergenic wheat flour by enzymatic fragmentation of the constituent allergens and its application to food processing. Biosci. Biotechnol. Biochem., 64:2663–2667. 71. Taylor SL, Hefle SL (2001). Ingredient and labeling issues associated with allergenic foods. Allergy, 56(suppl. 67):64–69. 72. Vierk K, Falci K, Wolyniak C, Klontz KC (2001). Recalls of foods containing undeclared allergens reported to the US Food and Drug Administration, fiscal year 1999. J. Allergy Clin. Immunol., 109:1022–1026.
334
EGG ALLERGEN DETECTION
73. U.S. Department of Health and Human Services, Food and Drug Administration, Center for Food Safety and Applied Nutrition (2006). Food Allergen Labeling and Consumer Protection Act of 2004, Public Law 108-282, Report to the Committee on Health, Education, Labor, and Pensions, United States Senate and the Committee on Energy Commerce, U.S. House of Representatives, July. 74. U.S. Department of Health and Human Services, Food and Drug Administration, Center for Food Safety and Applied Nutrition (2008). Recalls, market withdrawals and safety alerts archive. http://www.fda.gov/oc/po/firmrecalls/archive.html (accessed Nov. 2008). 75. Poms RE, Klein CL, Anklam E (2004). Methods for allergen analysis in food: a review. Food Addit. Contam., 21:1–31. 76. von Hengel AJ (2007). Food allergen detection methods and the challenge to protect foodallergic consumers. Anal. Bioanal. Chem., 389:111–118. 77. Gallagher S, Winston SE, Fuller SA, Hurrell JGR (1998). Immunoblotting and immunodetection. In Current Protocols in Immunology. Wiley, New York, pp. 8.10.1–8.10.21. 78. Edevag G, Eriksson M, Granstrom M (1986). The development and standardization of an ELISA for ovalbumin determination in influenza vaccines. J. Biol. Standard, 14:223–230. 79. Leduc V, Demeulemester C, Polack B, Guizara C, Le Guern L, Peltre G (1999). Immunochemical detection of egg-white antigens and allergens in meat products. Allergy, 54:464–471. 80. Yeung JM, Newsome WH, Abbott MA (2000). Determination of egg proteins in food products by enzyme immunoassay. J. AOAC Int., 83:139–143. 81. Hefle SL, Jeanniton E, Taylor SL (2001). Development of a sandwich enzyme-linked immunosorbent assay for the detection of egg residues in processed foods. J. Food Prot., 11:1812–1816. 82. Baumgartner S, Steiner I, Kloiber S, Hirmann D, Krska R, Yeung J (2002). Towards the development of a dipstick immunoassay for the detection of trace amounts of egg proteins in food. Eur. Food Res. Technol., 214:168–170. 83. Williams KM, Westphal CD, Shriver-Lake LC (2004). Determination of egg protein in snack food and noodles. J. AOAC Int., 87:1485–1491. 84. Ministry of Health, Labor, and Welfare (2006). [SYOKUANHATSU-0622003. ARERUGIBUSSHITSU-WO-HUKUMU-SYOKUHINN-NO-KENSAHOU-NI-TSUITE]. June 22. 85. Westphal CD, Pereira MR, Raybourne RB, Williams KM (2004). Evaluation of extraction buffers using the current approach of detecting multiple allergenic and nonallergenic proteins in food. J. AOAC Int., 87:1458–1465. 86. Poms RE, Capelletti C, Anklam E (2004). Effect of roasting history and buffer composition on peanut protein extraction efficiency. Mol. Nutr. Food Res., 48:459–464. 87. Watanabe Y, Aburatani K, Mizumura T, et al. (2005). Novel ELISA for the detection of raw and processed egg using extraction buffer containing a surfactant and a reducing agent. J. Immunol. Methods, 300:115–123. 88. Feste CK, Lovberg KE (2007). Extractability, stability, and allergenicity of egg white proteins in different heat-processed foods. J. AOAC Int., 90:427–436. 89. Matsuda R, Yoshioka Y, Akiyama H, et al. (2006). Interlaboratory evaluation of two enzyme-linked immunosorbent assay kits for the detection of egg, milk, wheat, buckwheat, and peanut in foods. J. AOAC Int., 89:1600–1608.
CHAPTER 17
Soy Allergen Detection MARCELLO GATTI and CRISTINA FERRETTI Microbiotech Department, Neotron S.p.a., Modena, Italy
17.1
SOY ALLERGY
Soya (or soy) is among the most common foods that can cause allergic reactions. Soy allergies are particularly common in infants and young children. Although most children outgrow soy allergy by the age of 3, soy allergy may persist and is becoming more common in adults [1]. It is estimated that about 0.5% of the population is affected by this pathology. In most cases, signs and symptoms of soy allergy are mild. Severe allergic reactions are more commonly elicited by food allergens other than soy, but in rare cases, soy allergens cause life-threatening allergic reactions (anaphylaxis) [2]. 17.1.1
Soy in Food Products
Soy is a food ingredient with both techno- and biofunctionality properties. Its use has increased considerably in the past decades. Foods such as soy milk, tofu, and other soy products have become more popular because of their apparent health benefits. Moreover, soy milk is widely used as a substitute for cow’s milk in milk-allergic babies. Products with soy as a main ingredient include Edemame, miso, natto, shoyu sauce, soy sauce (tamari), tempeh, textured vegetable protein (TVP), tofu, and all soy byproducts (soy butter, soy protein, soy albumin, soy fiber, soy flour, soy grits, soy milk, soy nuts, soy sprouts, soybean). Soy is also a common ingredient in many processed foods, such as meat products, meat substitutes, baked goods, candies, ice creams and desserts, dressings, butter substitutes, and other foods. Moreover, there are some nonfood sources of soy, such as cosmetics, soap, craft materials, glycerine, milk substitutes for young animals, pet food, and vitamins.
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
335
336
SOY ALLERGEN DETECTION
Soy is listed in Annex IIIa of Directive 2003/89/EC (the European Union’s labeling laws) [3–5], so manufacturers must clearly indicate on the label its presence such as any ingredient listed in the annex, to provide appropriate information to the consumer about the use of ingredients and other substances that can cause hypersensitivity (Article 6, paragraph 10). 17.1.2
Soy as a Hidden Allergen
Apart from labeling foods containing allergenic ingredients, the real concern is related to the presence of undeclared allergenic substances in food products and ingredients that may pose a major risk for sensitized persons. The presence of soy as a “hidden allergen” can be caused by cross-contact: for example, during transportation or storage of raw materials, or during food manufacturing through shared production and packaging equipment. For that reason, it is recommended that food companies establish effective allergen control programs to prevent the occurrence of undeclared allergens due to cross-contact. To avoid possible risks for allergic customers, manufacturers label their products with precautionary statements such as “may contain. . .” or “produced in a factory that handles. . ..” 17.1.3
Soy Allergenic Proteins and Minimum Allergen Dose
Researchers are not yet completely sure which component of soy causes reactions, but so far 16 soy proteins have been linked to clinical food allergy [6]. The major one, P34 (or Gly m Bd 30K) is responsible for 75% of allergic reactions to soy [7]. The major soy allergens are: . . . . . . .
Soy hydrophobic protein Soy hull protein Soy profiling Soy vacuolar protein (P34) Glycinin b-Conglycinin Kunitz trypsin inhibitor
What is not completely known yet is the minimum oral allergen dose required to initiate allergic symptoms. Data obtained from a dose–response test on sensitive patients estimate a greater than 100-fold difference between the safe protein dose for soy and other allergens [8]. A recent statistical analysis data, published by BlindslevJensen et al. [9], has stated that the dose causing reactions at a rate of 1 per 1,000,000 individuals is about 2.4 mg of protein and at rate of 1 per 100 is about 40 mg. Evaluation of the threshold must be considered when setting standards and selecting analytical methods appropriate for measuring soy allergens in food products and in food production environment. Because the minimal provoking doses of food allergens are usually low, from the microgram to the milligram level, the sensitivity of soy tests is now an important issue.
ANALYTICAL METHODS
17.1.4
337
Analytical Targets
The main goal of the tests for soy detection is to verify the absence of soy as a species regardless of the target molecules that will be analyzed. As written above, allergenic proteins are not well characterized yet, and in some cases their concentration is too low to be detected. For these reasons, analytical methods could target other than allergenic proteins or molecules different from proteins (e.g., DNA). 17.2
ANALYTICAL METHODS
In the past two decades a great number of tests for the detection of soy in processed food have been developed. Most of the work focused on the detection of high concentrations of soy added to food products as a nutritional fortifier or functional ingredient. Therefore, detection limits around 0.1% were useful. Unfortunately, these tests have a limited sensitivity. Over the last few years new assays have been designed to detect traces of soy protein that are thought to provoke allergic reactions in soy-allergic consumers. Test sensitivity in the low-ppm range is sufficient to assess adequately the possible presence of traces of soy with regard to the safety of the soy-allergic consumer. 17.2.1
Methods of Analysis Available for Soy Detection [10]
Detection of Soy Protein Using Nonantibody-Based Tests 1. SDS-PAGE. This technique can be applied when soy is the main ingredient because proteins from other sources (e.g., meat) are detected as well. It has the advantage of being easy to perform, but on the other hand, other proteins can give interferences, complex mixtures have poor resolution, and reliability depends on solubilization and disaggregation of proteins. 2. Determination of specific peptides or amino acid composition after hydrolysis (e.g., tryptic hydrolysis). In this case the big disadvantage is the possible interference from other proteins; moreover, it is a laborious method and not sensitive enough to detect traces of soy. Detection of Soy Protein Using Antibody-Based Tests ELISA (enzyme-linked immunosorbent assay) is a powerful analysis tool for the detection of specific proteins. It has the advantage of running a larger series of samples simultaneously at a high level of sensitivity. The main disadvantage is that protein denaturation, which can occur in processed food, often alters the antigen–antibody interactions. Detection of Soy Components Other Than Protein-Indirect Analysis When the protein responsible for the allergy is not known or the quantity is not sufficient, direct protein measurement could be difficult. In this case, indirect methods based on appropriate nonprotein markers associated with soy may be useful. Examples of markers that have been used for the detection of soy include DNA. In methods based
338
SOY ALLERGEN DETECTION
on DNA; the analysis, generally based on polymerase chain reaction (PCR) tests, does not identify proteins but rather, the presence of soy through the research of a specific sequence of DNA. It is assumed that if the DNA of that species is present, there will also be the allergenic proteins. Although different methods of analysis are available for soy detection, few are adopted routinely in analytical laboratories for this aim, in particular DNA and ELISA methods. 17.2.2
Analytical Protocols
Sampling and Sample Preparation One of the most important aspect of allergen detection is sampling, followed by preparation of the sample for analysis. Generally, the distribution of the allergen as contaminant in the food product is extremely heterogeneous, and for this reason an incorrect sampling procedure, which is one of the main sources of error, may lead to poor-quality results. To guarantee the representativeness of the sample, it is necessary: . .
.
To collect a high number of samples which will form the overall sample. These aliquots, called incremental samples, are taken from a single place in the lot. To choose properly, points and methods of sampling. Static sampling: drawing in different points of the lot by the use of proper equipment (e.g., stored product) Dynamic sampling: drawing at different times from a moving mass (e.g., production line) To obtain an overall sample of proper size.
Since there are no standardized sampling methods for the detection of allergens in food products and considering the similar distribution of contaminants such as mycotoxins, other sampling programs could be proposed as reference plans where the modalities of sampling and formation of samples to be analyzed are indicated [11]. The following are important aspects in sample preparation that need to be considered to minimize the error associated to this activity: . .
The sample’s granulometry must be homogeneous to increase the representativeness of the overall sample statistically. Sample particles should be as small as possible to increase the sample surface, therefore improving extraction efficiency.
The overall sample must be homogenized and, if necessary, ground to a fine consistency to obtain the sample to be analyzed. Homogenization can be performed by dry or wet grinding. The latter consists of the formation of a slurry obtained by adding water to dry product before proceeding to homogenization. The equipment used to grind the product must be cleaned properly, and the first aliquot obtained must be thrown away to prevent possible contamination from previous samples.
ELISA TEST
339
Analytical Procedures From the properly ground and homogenized sample it is necessary to take an aliquot for further testing by the method of analysis selected. The proper amount of sample must be taken to guarantee representativeness. From our experience not less than 5 g should be weighed, as smaller amounts could decrease the probability of finding the allergen. The following sample extraction procedure will be carried out according to the detection method chosen. Herein we describe and compare ELISA detection methods for soy determination to a commercial PCR assay.
17.3
ELISA TEST
ELISA tests are used widely for the detection of contaminants both in analytical laboratories and in the food industry. Commercial kits are generally used, as they have the advantage of containing all the materials necessary to run the tests (in some cases the preparation of solutions is required). They meet performance specifications set by the manufacturer, which are evaluated by the end user to see if the method is suitable for his or her application (processed food, type of matrix, etc.). Quantitative tests require the use of a microplate or strip reader. Some commercial ELISA kits are available on the market for the detection of soy allergens [12,13] (see Table 17.1 for performance parameters). The column “raw and processed food” relates to information provided by the manufacturer about the applicability to raw and processed food. 1. The BIOKITS Soya Protein Assay (Tepnel) is intended to be used for the quantitation of soy protein, used as an additive, in raw or processed mixed meat products. The declared quantification limit is actually 0.5% (5000 mg/kg). 2. The Soy Protein Residue Assay (Enhanced Assay) (Elisa Systems) and Veratox for Soy Flour (Neogen) are designed to detect soy traces. These two kits allow quantification of soy proteins with a declared limit of 2.5 mg/kg expressed as soy protein concentration. Sample extraction is very similar for both kits (extraction in a buffered solution by shaking in a heated water bath). ELISA assay time is about 80 min for the Elisa Systems kit and about 35 min for the Neogen kit. 3. The Alert for Soy Flour (Neogen) and Soy Residue Immunoassay Kit (SafePath) are simply qualitative kits. Samples are compared to a supplied positive control that has been set as a screening level. At the moment, validation (through the JRC, Association of Official Analytical Chemists, or multiple laboratory performance test) has not been performed on these kits. Our group has experience with the Soy Protein Residue Assay (Enhanced Assay) (ELISA Systems), which is used routinely for soy detection. This kit was one of the first available commercially for the detection and quantification of soy traces. We verified the applicability of the kit to a wide range of raw and processed matrices with good values for recoveries and reproducibility. Sensitivity is adequate to allergen detection in food (2.5 mg/kg as soy proteins). The extraction phase and subsequent steps of the immunoenzymatic assay are simple and fast. So far we have not found any problem
340
SOY ALLERGEN DETECTION
TABLE 17.1 Commercial ELISA Kits Available on the Market for Detection of Soy Allergens
Manufacturer Tepnel ELISA Systems
Neogen
SafePath
Test Kit Name
Limit of Detection (ppm)
Limit of Quantification (ppm)
Soya Protein 0.5% soy in 0.5% soy in Assay food sample food sample Soy Protein (1.25) 2.5 Residue Assay (Enhanced Assay) Alert for Soy 5 Not reported Flour Veratox for 2.5 2.5 Soy Flour Soy Residue Not reported Not reported Immunoassay Kit
Raw and Processed Food
Protein(s) Detected
Not reported Not reported Yes (for specified foods)
Soy flour proteins
Soy flour proteins Yes Soy flour proteins Not reported Soy trypsin inhibitor Yes
regarding the stability of the materials (standards, reagents, strips) within the validity period. In addition to this, the assay, except for sample extraction, can be performed with an automatic ELISA system. Even though we consider it a good immunoenzymatic kit, some inconveniences can affect analytical determinations using this system. The assay does not always apply to matrices that have undergone thermal processing, hydrolysis, or fermentation, as the protein structure could be destroyed by these treatments. In few cases we obtained doubtful results, probably due to interferences from other food components. In addition to this, as the assay is temperature and time sensitive, it is necessary to perform the analysis complying strictly with the indication reported in the kit instructions. General kit characteristics: . . . .
48-well format All necessary materials included (for both extraction and detection) Double-antibody (sandwich) ELISA using specific anti-soy trypsin inhibitor and other soy protein antibodies coated onto microwells Estimated execution time: 2 h
Sample Preparation Procedure (from the leaflet) 1. Weigh out 5 g of finely blended/ground sample into a suitable clean container for extraction purposes (usually, sterile polypropylene tubes). 2. Add 50 mL of prewarmed (60 C) extraction buffer. Blend or mix until the sample is homogeneous, to ensure consistent results. Note that:
ELISA TEST
341
.
It is possible to modify the initial amount weighed, but a ratio of 1 part sample plus 10 volumes of the extraction solution must be used. . The pH of the sample in the extraction buffer should be in the range 6.8 to 7.4. 3. Place into a water bath at 60 C for 15 min, with shaking–mixing every 5 min. 4. After the completion of this stage, remove from the water bath, allow to reach room temperature (20 to 25 C), centrifuge (500 g for 10 min), and filter through a 0.45-mm cellulose acetate filter. 5. The sample is ready to be tested. . For a liquid sample a ratio of 1 part sample plus 9 parts of the extraction solution must be used (e.g., 5 mL of sample plus 45 mL of extraction solution). . For samples consisting of or containing polyphenols, including dark chocolate, wine, fruit juices, herbs, and tannins, a special extraction solution is required. . For swab samples swabs can be used to monitor the presence or absence of the allergen protein on surfaces (e.g., manufacturing equipment, conveyer belt, containers). Swab the appropriate area and then add 1 mL of extraction solution to the swab tube to extract the material. Proceed as in the cases above. Test Procedure The Soy Protein Residue Assay is a double-antibody (sandwich) ELISA using specific anti-soy tripsyn inhibitor and other soy protein antibodies coated onto microwells. After addition of the sample, the enzyme conjugate, and the TMB substrate, a positive reaction (indicating the presence of soy protein), produces a blue color. Addition of the stop solution ends the assay and turns blue to yellow. The result may be read visually (in the qualitative method) or with an ELISA reader (in the qualitative or quantitative method). Quantification can be obtained by running positive control standards (2.5–5– 10–25 ppm) together with the samples. A standard curve is then plotted using the optical density (OD) values of the control standards (OD vs. concentration). The result is expressed as concentration of soy protein, and the lower limit of quantification (LOQ) is 2.5 ppm. Nevertheless, in the kit leaflet, the manufacturer remarks that “the level of soy protein detected will vary according to the ingredients and manufacturing process. This kind of test may not detect soy protein that has been significantly treated or altered through processes such as high temperature and/or pressure, fermentation or hydrolysis. If no soy protein is detected, this cannot conclusively indicate there is no absolute trace of soy material present.” This means that in some cases the ELISA test is not suitable for soy detection, in particular for samples that have undergone stressing treatments. For this reason a positive result should be regarded as a presumptive result and not taken as an absolute quantification of the soy present in the sample. Validation Data Since there are no standardized validation protocols for the detection of allergens in food products, we verified some fundamental aspects related to analytical methods.
342
SOY ALLERGEN DETECTION
TABLE 17.2 Matrix
Results of Specificity Test Result (mg/kg)
Soy flour Peanut Wallnut Hazelnut Almond Pistachio Pecan nut Cashew nut
>25 <2.5 <2.5 <2.5 <2.5 <2.5 <2.5 <2.5
Matrix Maize Wheat Pine nut Cocoa Bean Chickpea Lupin Lentil
Result (mg/kg) <2.5 <2.5 <2.5 <2.5 <2.5 <2.5 <2.5 <2.5
Specificity Specificity tests have been performed in order to verify possible interferences from matrices other than soy (Table 17.2). Sensitivity The declared limit of quantification is 2.5 mg/kg as soy protein. Nevertheless, sensitivity has been tested on real samples (Table 17.3) to verify possible interferences by analyzing different types of matrices spiked with soy at decreasing levels of contamination. For the final calculation we consider a content of about 40% of protein in soy flour determined with the same kit by diluting the spiking matrix. For the matrix examined, LOQ was verified; similar tests should be carried out with other matrices to verify the effective sensitivity of the assay (at least three spike levels are recommended). Note that results obtained in sensitivity tests by spiking food matrices with raw material (soy flour) are not always confirmed in the analysis of real samples where proteins could have undergone denaturation or concentration processes. This means that for each matrix to be analyzed, sensitivity should be verified with specific tests. The declared limit of detection is 1.25 mg/kg. Actually, we verified that it is possible to obtain an OD significantly different from the blank by analyzing the lower standard (2.5 ppm) diluted 1: 1 with the extraction buffer. The spiked matrix showed good recovery values that stayed in the range 70 to 130% as a fixed limit for acceptability.
TABLE 17.3
Example of Sensitivity Test a
Sample Blank Biscuit Biscuit Biscuit Biscuit Biscuit Biscuit
Result (mg/kg)
þ þ þ þ þ
100 mg/kg soy (40 mg/kg protein) 50 mg/kg soy (20 mg/kg protein) 25 mg/kg soy (10 mg/kg protein) 7.5 mg/kg soy (2.5 mg/kg protein) 5 mg/kg soy (2 mg/kg protein)
Biscuit spiked with soy flour.
a
<2.5 <2.5 >25 23.3 9.1 3.1 <2.5
Recovery (%)
116 91 124
PCR TEST
343
Reproducibility and Uncertainty To verify reproducibility we repeated the quantification of the standard points in different days and with different units of the kit (at least 10 repetitions for each point). To establish a range of acceptability, we fixed the following parameters: 30% for values 10 ppm 50% for values <10 ppm
. .
Taking into account the matrix (solid, liquid, swab) and the values found for the 10 repetitions, we calculated the uncertainty associated with each standard point tested. The uncertainty values obtained range from 20 to 40% depending on the positivity level and the type of matrix.
17.4
PCR TEST
In the last few years the PCR technique has been used for routine analysis, in particular for the detection of genetically modified organisms, allergens, vegetal and animal species, and microbiological pathogens in foodstuff. A PCR test is carried out by extracting DNA from the food matrix and subsequently by detecting a specific sequence. For soy detection the lectin gene is usually investigated. Detection is carried out through amplification of the selected sequence by the use of specific oligonucleotides (primers); the amplified sequence (amplicon) is then analyzed through gel electrophoresis or by real-time PCR, which requires proper equipment. DNA extraction can be achieved through an in-house procedure, or as an alternative, many commercial kits are available. In some cases it is necessary to choose the kit depending on the type of matrix to be extracted. We have some experience with kits (e.g., Ion Force Fast–Generon S.r.l. or equivalent) that are suitable for the extraction of a wide range of simple and complex food matrices (e.g., flours, baked goods, chocolate, fruit juices, baby food, meat, fish, vegetables). The kits generally contain all the materials for complete extraction of DNA. After a first lysis phase, DNA is purified through a series of subsequent steps up to a clean extract that is ready for PCR amplification.
Sample Preparation Procedure (from the leaflet) 1. Weigh out an amount of finely blended and ground sample into a suitable clean container for extraction purposes (usually, 50-mL sterile polypropylene tubes) as indicated in the weighing table reported in the leaflet. Generally, a weighing between 5 and 20 g is suggested to assure proper representativeness of the sample. 2. Add 20 mL of solution A and shake to homogenize the content. 3. Incubate at 85 C for 1 h and agitate occasionally or incubate using a mechanical shaking device.
344
SOY ALLERGEN DETECTION
4. Centrifuge the sample at a speed between 0.8 and 11.2 g for 10 min. 5. Transfer 1 mL of upper phase in a 2-mL tube. The upper phase is generally the watery phase, but in samples containing fats or oils the watery phase could be the lower phase. 6. Add 0.8 mL of purifying solution and shake vigorously for 1 min and centrifuge at 15.7 g for 10 min. Make sure that the surnatant is absolutely clear; in case it is not clear, repeat the centrifuge step. If the surnatant is not clear, the columns may be clogged, and this would force the repetition of the analysis. 7. Prepare a plastic tube containing a quantity of buffer T so that the ratio between buffer and extract is to be 5 : 1. Add the volume of extract indicated in the leaflet and mix gently. Some of the extracts need to be filtered through 0.45-mm cellulose acetate filters and 10-mL sterile syringes. 8. Prepare the columns separately in a vacuum box. Sterilize the single inlets with 1% sodium hypochlorite or equivalent solution. 9. Produce the vacuum using the vacuum pump with controlled vacuum at about 0.5 to 0.9 ATM. Then pour the content of the test tubes in each column. Once the extract has been poured, wash the column with three aliquots of buffer P, each of 0.75 mL. 10. Take the columns out of the vacuum box and centrifuge them at 5.6 g for 5 min to eliminate residual buffer P. 11. Transfer the columns in new 1.5-mL tubes, add 150 mL of solution D, wait for 2 min, and centrifuge for 30 sec at 0.1 g and then for 4 to 5 min at the highest speed. 12. The DNA extracts are ready to be analyzed. DNA Detection Just as for DNA extraction, for amplification of DNA, an in-house procedure can be developed or commercial kits can be employed. Generally, we have adopted an in-house method. Essentially, commercially available reagents are used (e.g., Universal Master-Mix from Applied Biosystems, or equivalent), but specific primers and probe have been designed internally on the basis of available scientific papers (primer lectin F: TCCACCCCCATCCACATTT; primer lectin R: GGCATAGAAGGTGAAGTTGAAGGA; probe lectin: FAM–AACCGGTAGCGTTGCCAGCTTCG–TAMRA). Equivalent primers and probe can be used to detect soy. Detection is carried out using a real-time PCR system (7900 HT Sequence Detection System, Applied Biosystems or equivalent) that unlike gel electophoresis, has the advantage that it is possible to see the results during amplification. The procedure is as follows: 1. DNA is initially quantified by fluorimeter or spectrophotometer. If no DNA has been extracted, the extraction procedure should be repeated by increasing the initial amount. 2. Usually, the specific sequence (lectin) is investigated and an endogenous reference sequence (chloroplast or other) is detected similarly to verify the amplifiability of the DNA extracted.
PCR TEST
345
3. Prepare all the reagents needed for DNA amplification (lectin and endogenous gene) and the multiwell plate for amplification. 4. Prepare the soy DNA standards to be used as references. 5. Prepare the master mix with proper quantities of reagents. Example: For one sample (final volume: 20 mL): Universal Master-Mix: 10 mL Primer F: 0.4 mL (10 mM) Primer R: 0.4 mL (10 mM) Probe: 0.4 mL (5 mM) Multiply these quantities for the number of samples and standards to be analyzed. Carry out the analysis of each sample at least in triple. Consider at least two blank wells to verify possible contaminations. 6. Add 2 mL of extracted DNA. 7. Program the amplification protocol (usually set 45 cycles), insert the tube or the plate in the thermal cycler, and start the analysis. Both lectin and endogenous gene analysis can be run with the same program. 8. At the end of the amplification, analyze the results with SDS software. For each standard and for positive samples, an amplification curve can be seen in the plot (DRn vs. cycle). 9. Amplification curves for the endogenous gene should be present for all the standards and samples. In case no amplification curve is present, the analysis should be repeated. 10. The blank should not show a curve for both lectin and endogenous analysis. 11. Fix a threshold and observe from the report the corresponding Ct value of standards and samples obtained by intersection with amplification curves. The final result is the presence or absence of soy, which is stated by checking if the sample shows an amplification curve. Quantification is not possible, as in complex foods no common endogenous reference could be used to obtain the relative soy quantity. At most, a semiquantitative evaluation can be accomplished by comparing the standards curve with the result obtained for the sample examined. Validation Data Specificity Specificity tests have been performed to verify possible interferences from matrices other than soy (Table 17.4). Sensitivity Sensitivity has been determined by analyzing different types of matrices spiked with soy at decreasing levels of contamination (Table 17.5). On average, the limit of detection (LOD) resulted in 0.01% (100 ppm) expressed as soy. In some cases it is possible to lower the limit to 0.005% (50 ppm), thanks to the high purification capability of DNA extraction kits. In this way, in fact, it is possible to add a higher
346
SOY ALLERGEN DETECTION
TABLE 17.4 Matrix
Results of Specificity Test Result
Soy Peanut Wall nut Hazelnut Almond Pistachio Pecan nut Maize
TABLE 17.5
þ
Matrix
Cashew nut Pine nut Cocoa Bean Chickpea Lupin Lentil Wheat
Example of Sensitivity Test a Average Ct Value
Sample Blank Standard soy 0.1% 0.01% Maize flour þ Maize flour þ Maize flour þ Maize flour þ Maize flour þ a
Result
45
1% soy flour 0.1% soy flour 0.01% soy flour 0.005% soy flour 0.001% soy flour
33.3 36.1 31.1 33.5 36.9 38.8 45
Maize flour spiked with soy flour.
concentration of DNA in the PCR reaction, which makes it possible to increase sensitivity. The results quoted have to be interpreted as qualitative only. In proximity to the LOD, the positiveness of the replicates usually has low repeatability, so that quantitative evaluation is not possible under certain acceptability levels. Note that results obtained in sensitivity tests by spiking food matrices with raw material (soy flour) using either ELISA and PCR techniques are not always confirmed in the analysis of real samples, where proteins or DNA could have undergone denaturation or concentration processes. This means that for each matrix to be analyzed, sensitivity should be verified through the use of specific tests. Table 17.6 includes some examples of determinations performed on the same samples showing, in a few cases, different results using ELISA and PCR techniques.
17.5
COMPARISON OF ELISA AND PCR TECHNIQUES
We used both ELISA and PCR in analyzing real samples to verify the applicability of the two methods and the possible effects of different food matrices on the detection of soy as an allergen (Table 17.6). Generally, ELISA and PCR give comparable results. The only matrices for which results were found to be different are rice ice cream and
347
CONCLUSIONS
TABLE 17.6 Analytical Results of Various Food Matrices for Soy Detection by ELISA and PCR Methods Matrix Maize flour Wheat flour Maize starch Lupin flour Durum wheat pasta Crackers Candy
ELISA (mg/kg)
PCR ( þ /)
<2.5 <2.5 <2.5 7.5 21.5
þ þ
<2.5 <2.5
Matrix Rice ice cream Rice milk Vegetable broth Cocoa biscuits Semolina (baby food) Homogenized meat (baby food) Fruit juice (peach)
ELISA (mg/kg)
PCR ( þ /)
<2.5 <2.5 <2.5 3.4 <2.5
þ þ þ
<2.5
<2.5
rice milk. In these two cases a possible explanation could be the high-temperature processing used during production, which causes protein degradation. In the case of cocoa biscuits as well, PCR seems to be more sensitive than declared compared to the ELISA result (3.4 mg/kg soy proteins). This fact can also be explained by possible protein denaturation due to thermal processing, which leads to undervaluing protein concentration.
17.6
CONCLUSIONS
Among the analytical techniques described in previous sections, ELISA was found to be particularly suitable for routine detection of soy as an allergen in food products. Since commercial kits contain all the materials needed for test execution and the equipment required is comparatively cheap, the assay could also be carried out in unspecialized facilities. The analytical procedure is quite easy and fast, so it could be useful for a quick check of possible contamination or residues from soy. The main disadvantage is that industrial processing could destroy protein structure, and for this reason results related to processed foods should be regarded as presumptive only, never as absolute. From our experience, we would advise performing both ELISA and PCR tests in order to have a double check on the same samples. The advantage of ELISA is that we can quantify proteins with a theoretically high sensitivity. PCR assay, on the other end, detects DNA that is a heat-resisting molecule, so it is possible to verify the presence of soy in processed food as well. Both techniques comply with laws concerning allergens, as they are able to detect soy as species independent of the target molecules investigated. Actually, it is not necessary to detect allergenic proteins, which in some cases are not known or are in poor concentration. To conclude, we suggest choosing the appropriate method of analysis by evaluating the possible source of contamination and the technological treatments used during production.
348
SOY ALLERGEN DETECTION
REFERENCES 1. Giampietro PG, et al. (1992). Soy hypersensitivity in children with food allergy. Ann. Allergy, 69:143–146. 2. Cordle CT (2004). Soy protein allergy: incidence and relative severity. J. Nutri., 134:1213s–1219s. 3. EC (European Commission) (2003). Directive 2003/89/EC, Nov. 10, 2003, amending Directive 2000/13/EC as regards indication of the ingredients present in foodstuffs. 4. EC (2005). Directive 2005/26/EC of Mar. 21, 2005, establishing a list of food ingredients or substances provisionally excluded from Annex IIIa of Directive 2000/13/EC (text with EEA relevance). 5. EC (2006). Directive 2006/142/EC of Dec. 22, 2006, amending Annex IIIa of Directive 2000/13/EC, listing the ingredients that must under all circumstances appear on the labeling of foodstuffs (text with EEA relevance). 6. Eigenmann PA, et al. (1996). Identification of unique peanut and soy allergens in sera absorbed with cross-reacting antibodies. J. Allergy Clin. Immunol., 98:969–978. 7. Helm RM, et al. (2000). Mutational analysis of the IgE-binding epitopes of P34/Gly m Bd 30K. J. Allergy Clin. Immunol., 105:378–384. 8. Morriset M, et al. (2003). Thresholds of clinical reactivity to milk, egg, peanut and sesame in immunoglobulin E–dependent allergies: evaluation by double-blind or single blind placebo-controlled oral challenges. Clin. Exp. Allergy, 33:1046–1051. 9. Bindslev-Jensen C, et al. (2002). Can we determine the threshold level for allergenic foods by statistical analysis of published data in literature? Allergy, 57:741–746. 10. Koppelman SJ, et al. (2004). Detection of soy proteins in processed foods: literature overview and new experimental work. J. AOAC Int., 87(6):1398–1407. 11. EC (European Commission) (2006). Regulation 2006/401/EC, Feb. 23, 2006, laying down methods of sampling and analysis for official control of the levels of mycotoxins in foodstuffs. 12. L’Hocine L, et al. (2007). Detection and quantification of soy allergens in food: study of two commercial enzyme-linked immunosorbent assays. J. Food Sci., Apr., 72(3):145–153. 13. Center for Food Safety and Applied Nutrition, Food and Drug Administration, U.S. Department of Health and Human Services, prepared by the Threshold Working Group (2006). Approaches to Establish Thresholds for Major Food Allergens and for Gluten in Food (revised, Mar.). USDHHS, Washington, DC.
CHAPTER 18
Milk Allergen Detection SABINE BAUMGARTNER Center for Analytical Chemistry, University of Natural Resources and Applied Life Sciences, Tulln, Austria
18.1
INTRODUCTION
Cow’s milk allergy is particularly prevalent in small children and therefore deserves special attention. Milk proteins are one of the first foreign proteins to be ingested by an infant, and the allergy is therefore a common disease in early childhood, where about 2.5% of children can be affected [1]. Nearly 80% of children “outgrow” the allergy by the age of 5. For more than 50 years allergists have debated whether or not food allergies can be prevented. It is recommended that “high-risk” infants be breastfed exclusively and that including solid food should be a delayed until 6 months of age. In the case of a milk allergy, breast-feeding is highly recommended because although both casein and whey proteins are considered to elicit an allergic response, b-lactoglobulin as the main whey allergen is not present in human milk. Milk proteins as ingestion allergens are considered as traditional or class I food allergens. Within class I food allergens the proteins are identified as water soluble, mainly glycoproteins with a molecular weight range from 10 to 70 kDa. These proteins are quite often stable against heat, acid, or protease treatment. Therefore, one strategy for treatment of milk allergy is the avoidance of milk proteins. This can be quite tricky because as already mentioned, in industrialized countries milk or milk proteins are one of the first foreign proteins to be added to an infant’s diet, and in Western food supplies the presence of milk proteins is nearly ubiquitous. 18.2
PHYSICAL AND PHYSICOCHEMICAL PROPERTIES OF MILK
From very early times human beings have used milk from goat, sheep, and cow as food. Today, the “trade name” milk refers primarily to cow’s milk. Milk derives its white Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
349
350
MILK ALLERGEN DETECTION
color from light scattering and light adsorption on fat droplets and protein micelles. Therefore, skimmed milk also appears to be white. The main structural elements in milk are fat globules, casein micelles (mainly calcium salts), globular proteins (whey proteins), and lipoprotein particles. Other proteins, carbohydrates, and minerals are present within the milk serum (the fat-free part of the milk). There is great variability in the general composition of milk between animal species.
18.3
MILK PROTEINS AND ALLERGENS
The composition of milk also changes during lactation, but it is noteworthy that milk from ruminants other than cow and from other species (e.g., humans) consists of very homologous proteins with the same structural, functional, and biological properties. Similar portions of proteins exist, with the exception of b-lactoglobulin, which is not present in human milk. By acidification or the action of chymosin, milk proteins can be divided in two fractions: soluble whey proteins and coagulum (casein fractions). The different proteins in these two fractions are well characterized [2–4] and all of them are commercially available. Table 18.1 shows some principal characteristics of the various milk proteins divided into the two main fractions, the respective allergenic proteins, appearance as a percentage of protein, corresponding concentrations, molecular weights, and protein family, as well as amino acid number where applicable. The molecular weight of the main allergens is within the range 19 to 25 kDa. Especially for milk allergy, it seems that no single protein is responsible for the allergenicity [4]. IgE recognition in patients showed that apart from casein and b-lactoglobulin, the most abundant milk allergens, proteins present in even trace amounts (e.g., lactoferrin, IgG, or bovine serum albumin) also appear to be potentially allergenic. Since no particular structure was specifically identified as being associated with allergenicity [3], the generation of antibodies to the various proteins seems useful and of interest for further assay development (Table 18.1). Although there is already a lot of knowledge about milk allergens, much effort has been put into the identification of the various milk allergens by means of twodimensional immunoblotting and mass spectrometry [4] as well as identification of conformational and linear epitopes [5–7] and the assessment of the amino acid sequences critical for IgE and IgG binding [8,9]. Bioinformatic tools are used for the assessment of protein allergenicity using the knowledge generated by IgEbinding studies [10] although with the bioinformatics approach itself no implications can be made regarding the allergenicity of novel proteins. Another approach is the use of, for example, core sequences of b-lactoglobulin-derived peptides and single amino acid–substituted peptides thereof, considered as candidate peptides for the modification of T-cell responses to b-lactoglobulin in cow’s milk allergy [11]. These in vitro testing systems and IgE binding studies were also used to evaluate the residual allergenicity of milk substitutes (e.g., partially or extensively hydrolyzed casein and whey proteins) [12]. b-Lactoglobulin is always implicated the most in cow’s milk allergy, but all the other proteins mentioned above also have their impact on allergenicity. Therefore, “designer milk” (e.g., milk in which the
351
MILK DETECTION METHODS
TABLE 18.1
Major Milk Protein Characteristics
Appearance in Milk (%)
Protein
Concentration (g/L)
Molecular Weight (kDa)
Specific Amino Acid (Number per Molecule)
Whey (14–24%; ca. 5 g/L) a-Lactalbumin Bos d 4 b-Lactoglobulin Bos d 5 Bovine serum albumin Bos d 6 Igs Bos d 7 Lactoferrin
5
1–1.5
10
3–4
14.2 Albumins 18.3 Globulins 66.3 Albumins
1
0.1–0.4
3
0.6–1.0
150
0.09
80 Transferrins
Traces
123 162 582
703
Whole Casein (76–86%, ca. 30 g/L, Bos d 8) as1-casein Bos d 8 as1 as2-casein Bos d 8 as2 b-casein Bos d 8 b k-casein
32
12–15
23.6
199
10
3–4
25.2
207
28
9–11
24.0
209
10
3–4
19.0
169
b-lactoglobulin gene from cow’s milk can be knocked out) is already discussed controversially [13]. Milk allergy and the proteins involved show that all proteins in food can be potential allergens with a widespread allergenic structure. The technologies used for the assessment of milk protein allergenicity can be adapted and used for the identification and evaluation of the potential allergenicity of novel foods.
18.4
MILK DETECTION METHODS
In the beginning, methods were developed primarily to distinguish cow’s milk from sheep or goats milk [14–16]. Several methods especially target allergenic cow’s milk proteins in food products and, in particular, in hypoallergenic infant formulas [17]. Among the many methods used, Malmheden Yman et al. [18] investigated the presence of milk in various food products analyzed by rocket immunoelectrophoresis (RIE) with a sensitivity of 30 mg/kg. The radio allergosorbent test (RAST) and the
352
MILK ALLERGEN DETECTION
enzyme allergosorbent test (EAST) seem to be a more suitable technique for the analysis of allergenic milk proteins at levels between 1 and 5 mg/kg [19,20]. 18.4.1
Immunoanalytical Techniques
Enzyme-linked immunosorbent assay (ELISA) is the most frequently used assay format, with detection limits between 0.08 and 3.2 mg/mL. In their study, Mariager et al. [21] compared polyclonal and monoclonal antibodies and found the polyclonal antibodies they used to be more suitable. In a study comparing several analytical methods (gel filtration, SDS-PAGE, native PAGE, immunoblotting, dot immunoblotting, and ELISA), antibodies were raised against b-lactoglobulin denatured at different temperatures [17]. ELISA was also used for the analysis of residual allergenic milk proteins, mainly casein, used as fining reagent in bottled wine [22]. The assay is based on a commercially available sheep anti-casein antibody and a monoclonal antibody that is highly specific for a-casein. The optimized casein sandwich ELISA showed a limit of detection (LOD) value of 8 ng a-casein/mL wine. Rapid test systems based on immunoanalytical techniques have also been developed for the detection of allergenic proteins. One such systems, known as a lateral flow device (LFD), comprises a backing material coated with a membrane (nylon or nitrocellulose), with test and control lines sprayed onto the membrane. In immunochromatographic devices a conjugation pad at the beginning and an absorption pad at the end of the strip are responsible for the developing flow. Characteristically, purified and gold-, latex-, or carbon-labeled antibodies provide visible coloring [23]. Only a few commercial kits are available for the detection of milk allergens. Table 18.2 summarizes the different immunoanalytical formats and gives an overview of commercial available tests for the detection of milk proteins as of March 2008. Most quantitative commercial ELISA tests have an LOD value below 5 mg/kg. Tests for casein, b-lactoglobulin, and bovine serum albumin can be performed separately, as shown for the kits from Tepnel and R-Biopharm. Others detect whole milk or casein and whey proteins. The LOD values of immunoanalytical methods have always been contentious and still are. For many known toxic substances legal limits and thresholds exist but there are no limits for allergenic proteins, due mainly to existing “personal” effect levels. Limited double-blind placebo-controlled food challenges have been carried out to assess the sensitivity level for milk [24]. To assure the safety of 98% of milk-allergic patients, a test sensitivity of at least 30 mg/kg milk should be obtained (called the lowest observed adverse effect level.) Studies estimating the no observed adverse effect level, or safe doses, were not successful because often at least one patient reacted to the first dose given, underlining the problem of individual reaction doses. Antibodies are also used in combination with optical biosensors as another alternative method within direct or sandwich immunoassays. The sensors consist of three components: a biological receptor with appropriate specificity for the analyte, a transducer to convert the recognition event into a suitable signal, and the detection, analysis, processing, and display system, which is usually electric. Signals can be from acoustic, electrical, mechanical, or optical sources. Technologies currently in use for
353
ELISA-TEK, noncompetitive, sandwich-type EIA utilizing biotin–avidin enhancement
Veratox for Milk Allergen, sandwich-ELISA Reaveal for Total Milk Allergen, LFD
Ridascreen b-Lactoglobulin, competitive ELISA Ridascreen Fast Casein, sandwich ELISA
ELISASYSTEMS Casein Residue ELISASYSTEMS b-Lactoglobulin Residue
BioKits Casein Assay Kit, indirect competitive ELISA BioKits b-LG Assay Kit, indirect competitive ELISA Rapid 3-D Casein Test Kit
ELISA Technologies, Inc., Alachua, Florida, www.elisa-tek.com
Neogen Corporation, Lansing, Michigan, www.neogen.com
R-Biopharm, Darmstadt, Germany, www.r-biopharm.com
ELISA Systems, Australia, www.elisas.com.au
Tepnel Biosystems Ltd., Flintshire, UK, www.tepnel.com
NA, not available.
a
Test Kit
Company
1.5–25 mg/kg 2.5–40 mg/kg NA
b-Lactoglobulin Casein
0–1 mg/kg
b-Lactoglobulin Bovine casein
0–10 mg/kg
0–14 mg/kg
Casein Casein
Std 10–810 mg/kg
NA
Milk b-Lactoglobulin
2.5–25 mg/kg
25 mg/kg
Detection Range a
Milk
Casein, whey
Allergen
TABLE 18.2 Commercially Available Milk Protein ELISA and LFD Kits with Specific Test Parameters
NA
< 2 mg/kg
< 1 mg/kg
NA
NA
0.12 mg/kg
5 mg/kg
5 mg/kg
NA
NA
LOD a
354
MILK ALLERGEN DETECTION
biosensing include amperometric sensors, potentiometric sensors, light-addressable potentiometric sensors, fluorescence evanescent-wave sensors, and surface plasmon resonance (SPR) sensors [25]. The advantages of the optical detection principle utilizing surface plasmon resonance, for example, can be seen in the real-time measurement, lack of a labeling requirement, and rapid and reproducible analysis. The protein binds to immobilized antibodies on a gold film surface. The antigen– antibody interaction induces a change in the refractive index, which is measured. The SPREETA immunoassay (Texas Instruments, Attleboro, Massachusetts) was adopted to detect fraudulent adulteration of ewe’s and goat’s milk with bovine milk [26]. The SPR technology of Biacore (Uppsala, Sweden) was also used as a label-free technology for the monitoring and quantification of proteins in nonprocessed and heat-treated dairy products [27]. Simultaneous determination of a-, b-, and k-casein was performed, with a resulting LOD of 870, 85, and 470 ng/mL, respectively, using the LOD of a-casein as a global detection limit. a-Lactalbumin was used as a marker protein in its native and heat-treated form to quantify milk processing by means of changes in the a-lactalbumin denaturation index. But this application refers more to milk quality testing rather than to allergen detection in a food matrix. A goldcluster-linked immunosorbent assay using an optical biosensor chip for the detection of b-lactoglobulin in processed milk has been published [28]. Another application for measurement within the milk matrix is immunosensing based on resonance-enhanced absorption (REA) above a reflecting mirror. Further development of the techniques of microarrays or microchips for the determination of proteins in general will facilitate the research and method development in, for example, food allergen–monitoring applications. 18.4.2
Physicochemical Techniques
Apart from the determination of allergenic or marker proteins by more or less immunological methods, separation techniques such as two-dimensional electrophoresis, capillary electrophoresis (CE), or high-performance liquid chromatography (HPLC), coupled to mass spectrometers have been developed. Effectively separated or purified proteins have been gained based on a variety of physical or chemical properties of the proteins, such as pH, molecular weight, and charge. CE has proven to be a fast and efficient protein separation technique, its only drawback coming if ultraviolet detection is used. In this case the sensitivity for proteins is limited to the micromolar-range. Often, preconcentration or fluorescence detection is considered as an alternative, although appropriate labeling is often required. For the detection of bovine serum albumin, b-lactoglobulin, and a-lactalbumin, CE with laser-induced fluorescence detection can be used. In a published study, laboratory-made cheese whey and cereal infant food were used as spiking matrices [29]. However, comparison of concentrations measured by ELISA and CE is difficult, because using CE, the LOD is given in nanometer or nanometers per gram. The determination of molecular masses of allergenic proteins and peptides can be performed using mass spectrometry. The introduction of gentle ionization techniques such as electrospray ionization and matrix-assisted laser desorption/ionization (MALDI) in the late 1980s made mass
CONCLUSIONS
355
spectrometry the most important tool for the analysis of peptides and proteins. Timeof-flight MALDI was used to identify and characterize major and minor milk proteins as well as serum proteins (i.e., albumins, enzymes, immunoglobulins, growth factors, and lactoferrin following two-dimensional electrophoresis [30], particularly to get better knowledge of the range of proteins involved with the host defense. Within recent years mass spectrometric methods have also been used as confirmatory methods to support and corroborate ELISA results. No intact proteins are measured, but tryptic digested peptides are analyzed by tandem mass spectrometry, and the proteolytic fragments gained are identified by means of algorithms and database searches based on amino acid assignments. The presence of milk is indicated by means of two marker parent ions, m/z 634.2 and 692.8, originating from two peptides in as1-casein from Bos taurus [31] in matrices such as cookies, orange sherbet, ice cream, or oatmeal cereals. However, due to the enzymatic step, used, this method cannot be employed for quantification purposes, although the sensitivity for the parent ions is very good. The limitation on providing quantitative results derives from the enzymatic digestion step involved. The rate or efficiency of the proteolytic step is not always repeatable in the same manner and is mostly unknown. However, whey allergens were determined in fruit juices by means of liquid chromatography with mass spectrometric detection. This method does not use any digestion technique but benefits from the stable protonation type, where selected ions for whey proteins are used as markers for milk traces [32]. A detection limit of 1 mg/mL of whey proteins in fruit juices was achieved. The method enables the quantification of intact whey proteins and in contrast to immunoanalytical techniques, will probably lead to a full confirmatory method. Nevertheless, it must be noted that all mass spectrographic methods have in common the fact that considerable effort has to be put into sample preparation and sample cleanup, and probably also into sample concentration. Other techniques for the bioanalytical characterisation of allergenic proteins and for the elucidation of the tertiary structure are nuclear magnetic resonance spectroscopy and x-ray structure analysis, in which separated or purified proteins are used. The two techniques are still the only methods available for a determination of the structure of macromolecules such as proteins and nucleic acid on an atomic level, but are usually not utilized in standard food analysis. Both methods have been employed successfully in the elucidation of allergenic proteins [33,34].
18.5
CONCLUSIONS
Milk, milk proteins, and allergenic milk proteins are very well characterized. The tests that can be used for the determination of allergenic milk proteins range from well-documented protocols to newly developed methods. However, the choice of qualitative rapid tests is still scant and there is an increasing demand for suitable reference materials. A main goal for the future is the development of alternative reference methods such as liquid chromatography–mass spectrometry analysis without the use of antibodies.
356
MILK ALLERGEN DETECTION
REFERENCES 1. 2. 3. 4. 5.
6.
7. 8.
9.
10. 11.
12. 13. 14.
15.
16. 17. 18.
19.
Sampson HA (2003). Food allergy. J. Allergy Clin. Immunol., 111(2):540–547. Wal JM (2001). Structure and function of milk allergens. Allergy, 56(S67):35–38. Wal JM (2004). Bovine milk allergenicity. Ann. Allergy Asthma Immunol., 93(5, S3):2–11. Natale M, Bisson C, Monti G, et al. (2004). Cow’s milk allergens identification by twodimensional immunoblotting and mass spectrometry. Mol. Nutr. Food Res., 48:363–369. Vila L, Beyer K, J€arvinen KM, Chatchatee P, Bardina L, Sampson HA (2001). Role of conformational and linear epitopes in the achievement of tolerance in cow’s milk allergy. Clin. Exp. Allergy, 31:1599–1606. Restani P, Ballabio C, Cattaneo A, Isoardi P, Terracciano L, Fiocchi A (2004). Characterization of bovine serum albumin epitopes and their role in allergic reactions. Allergy, 59(suppl 78):21–24. Tanabe S (2008). Analysis of food allergen structures and development of foods for allergic patients. Biosci. Biotechnol. Biochem., 72(3):649–659. Chatchatee P, J€arvinen KM, Baedina L, Vila L, Beyer K, Sampson HA (2001). Identification of IgE and IgG binding epitopes on b- and k-casein in cow’s milk allergic patients. Clin. Exp. Allergy, 31:1256–1262. Han N, J€arvinen KM, Cocco RR, Busse PJ, Sampson HA, Beyer K (2008). Identification of amino acids critical for IgE-binding to sequential epitopes of bovine k-casein and the similarity of these epitopes to the corresponding human k-casein sequence. Allergy, 63:198–204. Bannon GA, Ogawa T (2006). Evaluation of available IgE-binding epitope data and its utility in bioinformatics. Mol. Nutr. Food Res., 50:638–644. Kondo M, Kaneko H, Fukao T, et al. (2008). The response of bovine beta-lactoglobulinspecific T-cell clones to single amino acid substitution of T-cell core epitope. Pediatr. Allergy Immunol., 1–7. Published online Mar. 5, 2008. Docena G, Rozenfeld P, Fernandez R, Fossati CA (2002). Evaluation of the residual antigenicity and allergenicity of cow’s milk substitutes by in vitro tests. Allergy, 57:83–91. Sabikhi L (2007). Designer milk. Adv. Food Nutr. Res., 53:161–198. Anguita G, Martin R, Garcia T, et al. (1997). A competitive enzyme-linked immunosorbent assay for the detection of bovine milk in ovine and caprine milk and cheese using a monoclonal antibody against bovine b-casein. J. Food Prot., 60:64–66. Negroni L, Bernhard H, Clement G, et al. (1998). Two-site enzyme immunometric assays for determination of native and denatured b-lactoglobulin. J. Immunol. Methods, 220(1–2): 25–37. Plath A, Krause I, Einspanier R (1997). Species identification in dairy products by three different DNA-based techniques. Z. Lebensm. Unters. Forsch. A, 205:437–441. Rosendal A, Barkholt V (1999). Detection of potentially allergenic material in 12 hydrolyzed milk formulas. J Dairy Sci., 83:2200–2210. Malmheden Yman I, Eriksson A, Everitt G, Yman L, Karlsson T (1994). Analysis of food proteins for verification of contamination or mislabelling. Food Agric. Immunol., 6(2):167–172. Niggemann B, Binder C, Klettke U, Wahn U (1999). In vivo and in vitro studies on the residual allergenicity of partially hydrolysed infant formulae. Acta Paediatr., 88:394–398.
REFERENCES
357
20. Fremont S, Kanny G, Bieber S, Nicolas JP, Monerer-Vautrin DA (1996). Identification of a masked allergen, alpha-lactalbumin, in baby-food cereal flour guaranteed free of cow’s milk protein. Allergy, 51:749–754. 21. Mariager B, Solve M, Eriksen H, Brogen CH (1994). Bovine b-lactoglobulin in hypoallergenic and ordinary infant formulas measured by an indirect competitive ELISA using monoclonal and polyclonal antibodies. Food Agric. Immunol., 6(1):73–83. 22. Rolland JM, Apostolou E, De Leon MP, Stockely CS, O’Hehir RE (2008). Specific and sensitive enzyme-linked immunosorbent assays for analysis of residual allergenic food protiens in commercial bottled wine fined with egg white, milk, and nongrape-derived tannins. J. Agric. Food Chem., 56:349–354. 23. Van Herwijnen R, Baumgartner S (2006). The use of lateral flow devices to detect food allergens. In Koppelman SJ, Hefle SL (eds. ), Detecting Allergens in Food. Woodhead Publishing, Cambridge, UK, pp. 175–181. 24. Morisset M, Moneret-Vautrin DA, Kanny G, et al. (2003). Thresholds of clinical reactivity to milk, egg, peanut and sesame in immunoglobulin E-dependent allergies: evaluation by double-blind or single-blind placebo-controlled oral challenges. Clin. Exp. Allergy, 33:1046–1051. 25. Malan PG (1994). Immunological biosensors. In Wild D (ed.), The Immunoassay Handbook. Macmillan, London, pp. 125–134. 26. Haasnoot W, Marchesinsi GR, Koopal K (2006). Spreeta-based biosensor immunoassays to detect fraudultent adulteration in milk and milk powder. J. AOAC Int., 89(3):849–855. 27. Dupont D, Muller-Renaud S (2006). Quantification of proteins in dairy products using an optical biosensor. J. AOAC Int., 89(3):843–848. 28. Hohensinner V, Maier I, Pittner F (2007). A gold cluster-linked immunosorbent assay: optical near-field biosensor chip for the detection of allergenic b-lacotglobulin in processed milk matrices. J Biotech., 130:385–388. 29. Veledo MT, Frutos M, Diez-Masa JC (2005). Development of a method for quantitative analysis of the major whey proteins by capillary electrophoresis with on-capillary derivatization and laser-induced fluorescence detection. J. Sep. Sci., 28:935–940. 30. Smolenski G, Haines S, Kwan FAS, et al. (2007). Characterisation of host defence proteins in milk using a proteomic approach. J. Proteome Res., 6:207–215. 31. Weber D, Raymond P, Ben-Rejeb S, Lau B (2006). Development of a liquid chromatography–tandem mass spectrometry method using capillary liquid chromatography and nanoelecrospray ionization–quadrupole time-of-flight hybrid mass spectrometer for the detection of milk allergens. J. Agric. Food Chem., 54:1604–1610. 32. Monaci L, van Hegel AJ (2008). Development of a method for the quantification of whey allergen traces in miced-fruit juices based on liquid chromatography with mass spectrometric detection. J. Chromatogr. A, doi: 10.1016/j.chroma.2008.03.041. 33. Fukush E, Tanabe S, Watanabe M, Kawabata J (1998). NMR analysis of a model pentapeptide, acetyl-Gln-Gln-Gln-Pro-Pro, as an epitope of wheat allergen. J. Magn Reson. Chem., 36:10:741–746. 34. Betzel C (2001). X-ray structure analysis of food allergens. J. Chromatogr. B, 756:(1–2) 179–181.
CHAPTER 19
Gluten Detection ULRIKE IMMER AND SIGRID HAAS-LAUTERBACH R-Biopharm AG, Darmstadt, Germany
19.1
INTRODUCTION
Celiac disease is becoming a major gastrointestinal disease and is increasingly the focus of scientific discussions. It is a permanent inflammatory disease of the upper small intestine in genetically susceptible individuals induced by the ingestion of storage proteins (gluten) from wheat, rye and barley (Marsh, 1992). This disease manifests itself mostly in children with different symptoms. The classical picture is poor growth, weight loss, diarrhea, and increased fat excretion in stool. Celiac disease is currently considered to be an autoimmune disease and shows a variety of severe side effects, such as osteopenia, neurological disorders, anemia, and vitamin deficiency. In the United States a prevalence of 1 in 133 persons has been reported (Fasano et al., 2003). A lower prevalence, 1 in 300, has been reported for Europe (Catassi et al., 1994). A strict lifelong gluten-free diet is the only effective treatment of this disease to achieve restoration of the villous intestinal architecture. A group of cereal proteins called gluten is responsible for the disease. A gluten-free diet is based on food that does not contain any toxic storage protein from wheat, rye, or barley. The celiac activity of the corresponding oat proteins is a controversial issue discussed until today (Janatuinen et al., 2002, Lundin et al., 2003). Oats seem to be nontoxic for celiac patients with a few exceptional cases (Janatuinen et al., 1995, Leone et al., 1996). For this minority the oat group also has to be excluded. On a strict gluten-free diet, complete recovery of the small intestinal villous can be expected, with resolution of symptoms. Wheat, barley, and rye contamination in oats needs to be confirmed. Cereal kernels contain about 70% carbohydrates and 8 to 17% proteins. About 80% of wheat proteins are gluten. Gluten from the cereals named previously is composed of prolamins (high in proline and glutamine) and glutelins, which are storage proteins Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
359
360
GLUTEN DETECTION
found in the starchy endosperm of cereals. Gluten is defined as the rubbery cohesive mass that remains after washing wheat dough in water to remove starch and other water-soluble constituents. This mass is responsible for the baking properties of wheat. Prolamins (monomeric gliadins) lack intermolecular disulfide bonds, and the polymeric glutenins (glutelins in the case of wheat) are a complex of disulfide-bonded subunits soluble in acid, base, detergent, and some aqueous alcohol solutions under reducing conditions. Generally, the content of prolamin is 50% of the wheat gluten, but it has to be assumed that this ratio may vary. Prolamines from wheat are named gliadins, from rye are named secalins, and from barley are named hordeins. Other cereals, such as buckwheat, maize, rice, millet, sorghum, and teff, are also considered to be nontoxic, but they can also be contaminated by toxic cereals. All of these cereals have to be examined before they can be used in a gluten-free diet. Several classifications based on different physical–chemical properties have been proposed to categorize cereal proteins. Traditionally, cereal proteins have been classified into four groups, according to their solubility: prolamins, glutelins, albumins, and globulins (Osborn, 1907). The prolamin fraction, found to be the most toxic, is not soluble in water but is in aqueous ethanol (40 to 70%). Gliadin, the prolamin fraction from wheat, is classified into a/b-, g-, and w-fractions (w1,2 and w5 gliadins) according to their mobility in an electrical field under acidic conditions. The classification used most often today is based on the primary amino acid composition. Storage proteins are a very heterogeneous group, but they contain repetitive units between different gliadin and glutenin proteins. Shewry et al. (1986) divides gluten into three groups according to the molecular mass: high (HMW), medium (MMW), and low (LMW)-molecular-weight groups, which seems to be a more satisfactory classification. The HMW group contains x- and y-type HMW subunits of about 600 to 800 amino acids, characterized by a high content of glycine and tyrosine, with a long repetitive central unit. The w-gliadins belong to the MMW group (400 to 500 amino acids), which contains high amounts of glutamine, proline, and phenylalanine and represents 80% of the total amino acid sequence but has a low content of sulfur-containing amino acids. The LMW group (250 to 300 amino acids) represents the a/b- and g-gliadins and the LMW subunit of glutenins. All of these proteins contain five domains. Apart from the N-terminal domain, the others have repetitive sequences which are rich on glutamine and proline. A high degree of homology containing a set of repetitive units is found across all the storage proteins. However, fewer repeated motifs are found in HMW prolamins than in the MMW and LMW groups. The composition of these proteins can vary depending on cereal variety and growing conditions. About 90% homology is commonly found, and the remaining 10% can vary due to substitution, insertion, or deletions of single residues or short peptides. Clinical testing of gliadin fractions showed that all of these fractions were toxic (Ciclitira et al., 1984). Recently, much more emphasis has been placed on T-cell toxicity, and it can be shown that both gliadin and glutenin sequences are toxic. The toxicity of gluten fragments has been associated with human leucocyte antigens (HLA) DQ2 and DQ8 of celiac patients (Koning, 2003). A 33-mer amino acid peptide (LQLQPFPQPQLPYPQPQLPYPQPQLPYPQPQPFP) from a2 gliadin, located at amino acids 56 to 88, is particularly resistant
INTRODUCTION
361
to gastric and pancreatic hydrolysis and acts as a strong stimulator to intestinal T cells (Shan et al., 2002), as well as a 20-mer (LQPQQPFPQQPQQPYPQQPQ) from g5 gliadin 60 to 79 (Arentz-Hansen et al., 2000). Kasarda (1997) checked databases for potentially toxic celiac peptides in wheat, rye, and barley and found the notable importance of the hexapeptide QQQPFP in causing celiac disease. The Codex Alimentarius Standard (Codex Stan 118-1981) introduced in 1981 (amended in 1983) defines a gluten-free threshold of 200 ppm (200 mg/kg) gluten/ 100 ppm (100 mg/kg) gliadin. This calculation was based on the nitrogen/gluten ratio in wheat starches and depended on the sensitivity of verification procedures used at the time. Today, it is known that the nitrogen/gluten ratio can be used only as an approximation of the gluten content, because most gluten-free products consist of a mixture of nonceliac toxic cereals such as maize, millet, or others. With new technological developments, more sensitive analytical methods are now available. Therefore, it is mandatory to measure the prolamin content and not the nitrogen content of a product. All methods available in the market at the moment measure only the prolamin content. As used historically, gluten is a term that characterizes the relation between prolamin and glutenin as having a fixed factor of 2, which is not true in all cases. The 200-ppm gluten level has been under consideration for many years. The Codex distinguishes between naturally gluten-free food and foods especially processed to reduce gluten content. Based on more detailed information about the dose–response relationship of gluten proteins and the development of new analytical techniques, a lower limit of 20 ppm (20 mg/kg) gluten was proposed for the declaration of naturally gluten-free food such as maize or rice flour. In the meantime, it was decided to revise the standard. The definition of gluten-free foods is now: Gluten-free foods are dietary foods consisting or made only from one ore more ingredients which do not contain wheat (i.e., all Triticum species, such as durum wheat, spelt, and kamut), rye, barley, oats or their crossbred varieties, and the gluten level does not exceed 20 mg/kg in total, based on the food as sold or distributed to the consumer and/or consisting of one or more ingredients from wheat (i.e., all Triticum species, such as durum wheat, spelt and kamut), rye, barley, oats or their crossbred varieties, which have been specially processed to remove gluten, and the gluten level does not exceed 20 mg/kg in total, based on the food as sold or distributed to the consumer.
Moreover, specially processed gluten content–reduced food is characterized as follows: “These foods consist of one or more ingredients from wheat (i.e., all Triticum species, such as durum wheat, spelt, and kamut), rye, barley and oats or their crossbred varieties, which have been specially processed to reduce the gluten content to a level above 20 up to 100 mg/kg in total, based on food as sold or distributed to the consumer.” The draft version was accepted at the Codex Alimentarius Conference held on June 30–July 4 2008 in Geneva (Alinorm 08/31/26) and adopted (Codex Stan 118-1979). Tests with a limit of determination lower than 20 ppm of prolamin should be acceptable methods for the determination of prolamins in food. Additionally, the methods must be applicable to a wide range of food. There are no reports that gluten toxicity is reduced by heat processing, and consequently, a method must be able to measure gluten in food that has been prepared under a wide variety of
362
GLUTEN DETECTION
conditions. In Section 5.2 of the Codex Standard, the enzyme-linked immunoassay (ELISA) R5 Mendez method is recommended as the method for determining gluten content. Wheat gluten is used primarily to achieve a good texture in bakery products. During kneading, leavening, and baking dough, there is an exchange of disulfide bonds, which results in high-molecular-weight units and insolubilization of the gliadin monomers. Therefore, sufficient and complete extraction must be assured. Obviously, it is very difficult to meet these requirements. 19.2
ANALYSIS
One of the key points in gluten analysis is the availability of an efficient and sensitive method for the detection of gluten from both unprocessed and heat-processed food samples, including an all-purpose extraction procedure. Foods may contain hydrolyzed gluten, peptides of various lengths that can represent just one epitope or even smaller motifs, which can be considered as potentially toxic. Denaturated and crosslinked proteins, commonly resulting from heat processing, are difficult to dissolve in the sample extraction solution and therefore they are much more complicated matrices than are non-heat-treated food or non-processed, unwrought goods, containing just native proteins. It is a challenge to develop an analytical method including an extraction procedure suitable for all these different food matrices. To enable enforcement of the above-mentioned threshold, different analytical methods have been developed. Most of them, such as RIA, EIA, and ELISA, are antibody-based (Engel and Wieser, 1999; Wieser and Antes, 2002). The main requirement for a method is the detection of celiac toxic cereals that do not cross-react with cereals considered to be nontoxic to celiac patients, such as soy, maize, rice, sorghum, and teff. 19.3 19.3.1
METHODS Enzyme-Linked Immunosorbent Assays
Immunoassays such as ELISAs have been found to have considerable use for food and cereal analysis (Chapter 12). These methods are based on a specific antibody used as a detector for the target analyte, such as food allergens or gluten. The antibody is linked to an enzyme and detects the antigen or the antibody. The enzyme converts the colorless substrate (chromogen) to a colored product, indicating the presence of the antigen–antibody complex. At present, immunoassays are rapid, sensitive, and selective and are generally cost-effective. They can be designed as field-portable, semiquantitative methods or as quantitative laboratory methods. Larger numbers of samples can be analyzed and the tests are suitable for automation. There are two possible techniques for antigen detection, the sandwich and the competitive ELISA format. Choice of the format depends mainly on the size of the analyte. Almost all of the allergen ELISAs use the sandwich format, because the target proteins have at least two epitopes which can be detected by the antibodies. The competitive format is chosen for the determination of small fragments or small analytes, which may have
METHODS
363
only one epitope left. ELISA methods became most commonly used (Denary-Papini et al., 1999) because of the high specificity of this immunochemical method. Beside this, the ELISA technique is well accepted in analytical laboratories investigating foodstuffs and can be carried out with relatively cheap equipment, which can also be used for other applications. Many ELISA methods are commercially available as test kits which allow standardization and validation. A list of commercially available test kits and their specifications is given in Table 19.1. 19.3.2
Sandwich ELISA Format
The first commercial available ELISA method for gluten analysis, called the Skerritt antibody, was based on a single monoclonal antibody (Skerritt and Hill, 1990, 1991). The assay detects the most heat stable fraction of gliadin, the w-gliadin, which allowed investigating heat-processed food for the first time. This antibody binds to wheat, rye, and barley. The method is available in a kit format, and a collaborative trial has been carried out. The method has been granted the official method of analysis status by the Association of Official Analytical Chemists (OMA 991.19, 1991). One shortcoming of this method is that the w-gliadin is a relatively minor fraction. Therefore, the method has limited sensitivity compared to methods using antibodies against a broader spectrum of wheat gliadins (Table 19.2). Beside this, the w-gliadin content varies considerably in the European wheat varieties (Wieser et al., 1994). Traded wheat products are often not pure varieties. The w-gliadin/total gliadin ratio is variable. Furthermore the antibody shows about 5% cross-specificity with barley, leading to a significant underestimation of this grain. In 2003 a new sandwich ELISA method based on the monoclonal R5 antibody developed by the working group of Enrique Mendez was published (Valdes et al., 2003, Table 18.2). This monoclonal antibody recognizes the potential celiac-toxic repetitive pentapeptide epitope QQPFP (glutamine–glutamine–proline–phenylalanine–proline) as well as related peptides (Osman et al., 2001). The linear QQPFP epitope occurs repeatedly in a/b-, g-, and w-gliadin fractions and is conserved in different wheat, barley, and rye varieties. This antibody is therefore ideal for detecting total gliadin in an extensive number of wheat, barley, and rye varieties, and is less cultivar dependent than are other antibodies. As the R5 antibody is directed against such a short epitope, which is widely distributed in all subfractions of the gliadins, it can be used to determine partially hydrolyzed gliadins as long as the hydrolyzed fragments contain sufficient repeated QQPFP epitopes. Heat treatment leaves the QQPFP epitope unchanged because of its linear and short structure. This allows the quantitative measurement of gluten also in cooked foods by the R5 antibody. The antibody also reacts with the prolamins of rye and barley. The QQPFP structure is not found in avenins (oats), and no cross-reactivity to oats or maize has been observed. Additionally, it is possible to detect gluten from heat-processed samples, due to the stability of the peptide motif recognized. The high sensitivity of R5 antibody-based ELISA methods allows monitoring gluten levels as low as 2.5 mg/kg (ppm) gliadin in commercial gluten-free foods, raw products, wheat starches, and contaminated oat- or buckwheat-based food.
Test Format
Sandwich ELISA, quantitative
Lateral flow test, qualitative immunochromatographic test
Testb
Tepnel BioKits Gluten
Tepnel Rapid 3-D Gluten
10
60 þ 30 þ 30
Incubation Time (min) Measuring Range
Standards
Extraction buffer
—
—
Extraction solution 3–50 ppm 3/5/10/20/50 ppm gluten in food, gluten 0.024–0.4 ppm in beverages, swabs >5 mg/25 cm2
Extraction
TABLE 19.1 Commercially Available Test Kits for Gliadin Detectiona
—
1 ppm gluten in food
Limit of Detection
Number of Tests/Kit
Skerriitt mab 84 single to w-gliadin, determination or reactive to 42 duplicates durum wheat (40–60%), triticale, rye (110–130%), barley (4–8%); nonreactive to oat, maize, rice, millet Skerritt mab to 10 single w-gliadin, determination reactive to durum wheat (40–60%), triticale, rye (110–130%), barley (4–8%); nonreactive to oat, maize, rice, millet
Specificity
Approvals
Sandwich ELISA, quantitative
R-Biopharm RIDASCREEN FAST Gliadin
R-Biopharm RIDA Lateral flow test, QUICK Gliadin qualitative immunochromatographic test
Sandwich ELISA, quantitative
R-Biopharm RIDASCREEN Gliadin
5–40 ppm gliadin
2.5–40 ppm gliadin
60% ethanol or 2.5 ppm gliadin cocktail solution
Cocktail solution or extraction solution
10 þ 10 þ 10
5
Cocktail solution or extraction solution
30 þ 30 þ 30
—
10/20/40/80 ppb gliadin
5/10/20/40/80 ppb gliadin
(continued )
R5 mab for 84 single AOAC-RI prolamins determination or 120601 Codex (wheat, rye, 42 duplicates Type I Method barley to 100%); no reaction with oats, maize, rice, millet, buckwheat, quinoa, amaranth, teff 2 ppm gliadin R5 mab for 38 single prolamins determination or (wheat, rye, 10 duplicates barley to 100%); no reaction with oats, maize, rice, millet, buckwheat, quinoa, amaranth, teff About 2.5 ppm R5 mab for 25 single gliadin prolamins determination (wheat, rye, barley to 100%); no reaction with oats, maize, rice, millet, buckwheat, quinoa, amaranth, teff
1.5 ppm gliadin
Sandwich EIA, quantitative
Sandwich ELISA, qualitative
Neogen Veratox Gliadin
Neogen Alert Gliadin
Sandwich ELISA, quantitative
Sandwich ELISA, quantitative
Sandwich ELISA, quantitative
Ingenasa Ingezim Gluten
Biocontrol Transia Plate Gluten
Biocontrol Transia Plate Prolamin
Congen Qualitative PCR SureFood Gluten Real-Time PCR
Test Format
Testb
TABLE 19.1 (Continued)
60 þ 60 þ 10
40 þ 40 þ 30
60 þ 60 þ 10
—
10 þ 10 þ 10
10 þ 10 þ 10
Incubation Time (min)
10 ppm gluten
5–50 ppm gliadin protein
Measuring Range
10 ppm
5/10/20/50 ppm gliadin protein
Standards 5 ppm gliadin protein
Limit of Detection pab for gliadin proteins
Specificity 38 single determination or 10 duplicates
Number of Tests/Kit Approvals
< 5 ppm gluten Specific 20 single antibodies to determination prolamin (wheat, rye, and barley) — — Fewer than 10 Specific to the SureFood PREP 2 x 50 reactions Allergen copies of the gluten gluten detection gene detection gene Cocktail 1.56–25 ppb 1.56/3.12/6.25/12.5/ 1.56 ppm R5 mab for 84 single Codex Type I solution gliadin 25 ppb gliadin gliadin prolamins determination or Method (wheat, rye, 42 duplicates barley to 100%) 40% ethanol 0.078–5 mg/mL 0.078/0.156/0.313/ 10 ppm Skerritt mab to 80 single AOAC OMA w-gliadin gliadin 0.625/1.25/2.5/ determination or 991.19 reactive to 5 mg/mL gliadin 40 duplicates durum wheat (40–60%), triticale, rye (110–130%), barley (4–8%) 60% ethanol or 1.56–25 ppb gliadin 1.56/3.12/6.25/12.5/ 1.56 ppm R5 mab for Codex Type I 84 single cocktail solution 25 ppb gliadin gliadin prolamins Method determination or (wheat, rye, 42 duplicates barley to 100%)
40% ethanol þ additive or cocktail extraction 40% ethanol þ extraction additive
Extraction
60 þ 30 þ 10
Extraction solution 156–5000 ppm with gelatine þ gluten or tannin binding 10–200/ reagent 5–100 ppm gluten Special buffer þ mercaptoethanol without ethanol, overnight
Prefilled extraction — buffer
—
Standard concentrate of 50 ng/mL
Skerritt mab to 2/5 or 10 w-gliadin determination reactive to tests durum wheat (40–60%), triticale, rye (110–130%), barley (4–8%) Skerritt 84 single AOAC OMA mab to wheat determination or 991.19 w-gliadin 42 duplicates
0.3 ppm wheat Pab to w-gliadin 48 wells protein reactivity to wheat 100%, to rye >20%, to barley <0.01%
250–10,000 ng/mL <0.5 ppm gluten
—
R-Biopharm does not guarantee the correctness and completeness of the information provided. This listing of test kit suppliers does not contain any judgment; it is based on information commonly available provided by the suppliers/manufacturers of the kits. Additional information or corrections are welcome and should be sent to R-Biopharm AG,
[email protected]. b Contact: Abkem, www.abkemiberia.com; Congen, www.congen.de; ELISA-Systems, www.elisas.com.au; ELISA-Technologies, www.elisa-tek.com; IFP, www.produktqualit€at.com; Ingenasa, www.ingenase.es; Morinaga, www.crystalchem.com; Neogen, www.neogen.com; R-Biopharm AG, www.r-biopharm.com; Tepnel, www.tepnel.com.
a
Sandwich ELISA, quantitative
—
Hallmark Analytical Sandwich ELISA, Ventures HAVen quantitative Gluten ELISA
Morinaga Institute Wheat Protein ELISA Kit
15
Hallmark Analytical Lateral flow Ventures HAVen test qualitative Gluten immunoFlow-Through chromatographic test
368
GLUTEN DETECTION
TABLE 19.2 Comparison of the Skerritt Antibody (RIDASCREEN Gluten) and the R5 Antibody (RIDASCREEN Gliadin) a Spiked Gliadin Content [mg/kg (ppm)]
Sample Corn spiked with WGPAT standard b Rice spiked with WGPAT standard Rice flour I Rice flour II, contaminated
168 41 Negative 13
Skerritt Antibody [mg/kg (ppm) gliadin] 967.2 148.2 < 10 < 10
R5 Antibody [mg/kg (ppm) gliadin] 148.3 30.1 < 2.5 14.6
a The RIDASCREEN Gluten test kit was discontinued as soon as the RIDASCREEN Gliadin assay was launched in 2002. b Heat-treated.
The performance of two R5 antibody-based ELISA test kits from two different manufacturers (R-Biopharm AG, Darmstadt, Germany and Ingenasa, Madrid, Spain) was compared in a collaborative trial organized in 2002 by the Working Group on Prolamin Analysis and Toxicity (WGPAT) (Immer et al., 2003; Immer and HaasLauterbach, 2004). Twelve food samples were analyzed (Table 19.3). Five of them (three heat-treated corn samples, two nonheated rice samples) were spiked with reference gliadin material developed by the WGPAT (86% pure gliadin). Mean recoveries of both test kits were between 71 and 111%. The relative standard deviation (RSD) varied between 22 and 52, depending on the content of gliadin. Codex Alimentarius Committee Methods of Analysis and Sampling (CCMAS) endorsed this method as its type I method in 2006 on the basis of a complete validation and TABLE 19.3
Overview of the Samples Used in the WGPAT Collaborative Trial a
Number
Gliadin Level [mg/kg(ppm)]
Spiked or Contaminated
Type
Heated or Unheated
168 35 79 0 41 0 147 14 13 (12–15) < 1.5 < 1.5
spiked spiked spiked spiked spiked spiked spiked contaminated contaminated contaminated contaminated contaminated
maize maize maize maize rice rice rice wheat starch rice flour wheat starch maize flour maize flour
heated heated heated heated unheated unheated unheated unheated unheated unheated unheated unheated
1 2 3 4 5 6 7 8 9 10 11 12
a All of 12 samples were sent blind-coded to 19 independent European and one Argentinean laboratory. They had to be extracted twice with cocktail solution and measured in two independent runs at three dilutions.
METHODS
369
TABLE 19.4 Statistical Data of the Collaborative Trial Organized by the WGPAT in 2002 Sample 1 2 3 4 5 6c 7 8 9 10 11 c 12 c
Expected a
Mean a
SD a
Uncertainty
168 35 79 0 41 0 147 14 13 12–15 < 1.5 < 1.5
134 33 71 8.7 b 36
9.7 1.7 5.2 0.7 2.0
115 30 60 7.3 32
112 14 16 15
7.6 1.0 1.1 1.3
97 12 14 13
sr
RSDr
sR
RSDR
154 37 81 10 40
21.0 3.6 14.7 1.3 6.1
16 11 21 15 17
42 7.6 23 2.9 9.0
31 23 32 33 25
127 16 18 18
24.2 2.5 3.5 3.4
22 18 22 22
31 4.6 4.9 5.1
28 33 31 33
a
Results reported as mg/kg (ppm) gliadin. Negative sample, contaminated during baking process. c Trial date not available. b
collaborative trial report. A robust statistic evaluation was made without any outlier calculation. The results are shown in Table 19.4. 19.3.3
Competitive ELISA Format
ELISAs in a competitive format do not require multiple or repetitive epitopes, in contrast to sandwich ELISAs, which need at least two specific epitopes for antigen recognition. Thus, a competitive assay can much better determine degraded gluten down to small peptide units in products such as beer, starches, or syrups as well as in solubilized wheat proteins. Generally, prolamins in food or food ingredients can be hydrolyzed or partially hydrolyzed during processing or can occur in food by use as functional ingredients. During proteolytic treatments, prolamins are partially hydrolyzed in more-or-less large fragments containing two or more epitopes and in small fragments having only one epitope or motif, which can still be toxic. Consequently, small hydrolyzed fragments with a unique epitope cannot be reliably determined by a sandwich ELISA. The first competitive assay was developed by Friis in 1988 using a polyclonal antibody against all the gliadins. However, the antibodies showed poor reactivity against rye and barley. In 1995 developed a competitive assay that used a preincubation step of the sample extract with a polyclonal antibody. Actually, the concentration of smaller fragments that are still toxic for celiacs has not been verified. Further clinical studies are required. One of the major problems of developing a competitive ELISA for the quantification of hydrolyzed gliadins is to select the right calibrator. As the R5 antibody is capable of recognizing several small epitopes of prolamins from wheat, rye, and barley, it was decided to use the most strongly recognized pentamer QQPFP as the calibrator in the first commercially available test kit (R-Biopharm AG). The specificity of the antibody is high enough to
370
GLUTEN DETECTION
measure hydrolyzed prolamins down to small sequences of 5 to 10 amino acids in starch, syrup, and beer. In this type of assay (e.g., the RIDASCREEN Gliadin Competitive), the wells of the microtiter plate are coated with a small fixed amount of gliadin as the antigen. A gliadin standards calibrated to the QQPFP-peptide, or a sample extract together with peroxidase-labeled anti-gliadin R5 antibody (conjugate), is added at the same time and incubated for 30 min. The conjugate is bound either to the gliadin on the plate or to the prolamin peptides in the solution. Antigen–antibody complexes are formed. The more abundant gliadin is in the sample, the more binding there is of R5 to the gliadin in the sample and the less gliadin coating to the wells. During a washing step the bound enzyme conjugate in the solution is discarded, while plate-bound conjugate remains. Substrate/chromogen (peroxide/tetramethylbenzidine) is added. Bound enzyme conjugate converts the chromogen into a blue product. The addition of stop solution leads to a color change from blue to yellow. The measurement is made photometrically at 450 nm. The absorption is inversely proportional to the prolamin fragment concentration in the sample. The assay results are expressed as ppm peptide equivalents. It needs micrograms of the peptide to obtain the same immune response as is obtained with nanograms of gliadins. In-house experiments (R-Biopharm AG) have shown that approximately 250 times more purified peptide QQPFP is needed to give the same immune response in the competitive assay as purified gliadin (PWG Standard). Unknown processed food samples contain a mixture of different amounts of peptides with different sizes. The relation between prolamin and the fragments can vary. Therefore, a conversion factor into gliadin cannot be given at the moment. 19.3.4
Lateral Flow Devices
In addition to the immunochemical methods described above, there is still a demand for easy-to-use immunochemical tests to detect traces of allergens and gluten in food and cereals. A rapid strip test platform based on immunochromatography has been developed for the detection of gluten. This lateral flow device (LFD) is based on the rapid flow of fluids running along the surface of a membrane strip, enabling the use of different antibodies at different locations on the strip. Lateral flow devices are suitable for on-site testing at the manufacturing facility as part of the allergen control programs and to perform hazard analysis of critical control points (HACCPs) in the entire production process, from the storage of raw materials to the final product. They may play an important role in minimizing costs related to product holding when results have to be reported quickly (e.g., testing of incoming raw materials). If a qualitative result for a single sample is required, the use of LFDs is recommendable. The sensitivity of some commercial available gliadin dipsticks is sufficient enough for gluten analysis. A list of specifications of commercial LFD tests is reported in Table 19.1. 19.3.5
Polymerase Chain Reaction
Polymerase chain reaction (PCR) is used increasingly in food analysis for verification of allergen labeling of foods to identify hidden allergens in processed food. It is
METHODS
371
important to provide analytical methods that are able to detect very low amounts of allergenic residues. The PCR assay does not detect the allergenic molecule but it targets DNA as a marker for the presence of allergenic material in the sample. The significant advantage of this method is that the analyte, the genes encoding the allergenic protein, is amplified and that very low amounts of DNA can be detected. The sensitivity of PCR depends strongly on the amount and quality of the DNA, which are dependent on the procedure used to extract DNA from food. Like proteins, DNA isolated from food products can be highly degraded, which makes amplification of the specific DNA difficult or even impossible. Often, DNA extraction is influenced by unspecific matrix effects. PCR method is an alternative tool to ELISA methods for screening purposes and especially for confirmation of ELISA test results. The PCR method is complementary to ELISA. Therefore, positive results in both methods give reliable information as to whether certain cereal species are present. The method is more time consuming and equipment intensive than ELISA. Some food ingredients, such as chocolate or thickeners (e.g., carob or guar flour), may cause problems during DNA extraction. In the case of contamination of raw materials such as maize, buckwheat, or oat flour with wheat, rye, or barley, PCR can be a helpful confirmation tool to show which cereal species has been detected by the ELISA. Additionally, PCR allows the identification of false-positive results due to antibody cross-reactivity. Commercial PCR test kits for the determination of gluten are available and also listed in Table 19.1. 19.3.6
Biosensors
Surface plasmon resonance technology biosensors are analytical devices consisting of a gold-coated sensor chip containing a bioactive receptor such as an antibody that captures the analyte. A transducer measures changes in the refractive index resulting from antibody–antigen binding, which is further processed to give an output that is proportional to the concentration of the analyte. SPR instruments are available from different commercial sources. The technique offers several advantages, including inline detection of allergens. Moreover, this technique provides real-time data acquisition and requires little technical training to be operated. However, biosensors are still expensive compared to other methods. High numbers of samples can be analyzed in a short time. 19.3.7 Mass Spectrometric Method and Tandem Liquid Chromatography–Mass Spectrometry Characteristic peptide patterns have been measured for all types of cereals by MALDI-TOF, but the sensitivity is not high enough for gliadin determination at the low level regulated. The method can be used as a confirmation method on certain levels and in some situations. Tandem LC-MS/MS combines the separation power of high-performance liquid chromatography (HPLC) with the exquisite detection power of a mass spectrometer. HPLC can separate digested peptides on the basis of a number of unique or species-specific properties of peptides, such as charge, size,
372
GLUTEN DETECTION
hydrophobicity, and presence of a specific tag or amino acid(s). HPLC is also an excellent way to remove potentially interfering molecules, such as salts, buffers, and detergents, from the sample. These types of molecules greatly influence the efficiency of the ionization and the quality (and quantity) of data generated by the MS. The result depends strongly on a clean sample prior to ionization. Coupling an HPLC system with a mass spectrometer has proved to be a difficult task in the past, and a lot of research effort has focused on this problem. The difficulty posed in coupling the two systems has been that the HPLC system deals with analyte in the liquid phase, yet the MS requires a transformation of these ions from the liquid phase into ions in the gas phase. It is challenging to maintain a sufficient vacuum level in the mass spectrometer because introduction of a liquid at the ion source wreaks havoc on the vacuum. For this reason the solvent must be stripped and gas-phase ions must be generated before introduction to the MS. LC/MS for practical use with biopolymers such as proteins was improved with the introduction of the “thermospray” interface. The next big improvement was the introduction of electrospray (ESI) and atmospheric pressure chemical ionization (APCI). These methods allow ionization at atmospheric pressure and both are considered to produce soft ionization, which is a major prerequisite to the analysis of proteins. Because the HPLC is coupled to a tandem mass spectrometer with an ESI interface complex, protein mixtures can be separated and identified rapidly. A disadvantage of these methods is the need for expensive equipment and trained personnel. Mass spectrometry has a future for confirmation purposes rather than for screening analysis. Moreover, it is likely to be best suited to regulatory agencies or academic labs rather than food manufacturers.
19.4
EXTRACTION
Aqueous alcohol extracts mainly monomeric gliadins and the LMW fractions of gluten. It has to be considered that extraction with aqueous alcohol does not lead to clear separation between gliadins and glutenins. Glutenin subunits are also found in soluble gliadin fractions, whereas gliadins are also present in the insoluble glutenin fraction (Wieser, 1995). Heat-processed food containing cross-linked prolamins, which are difficult to dissolve in conventional aqueous ethanol solvent used for the monomeric prolamin extraction constitutes a much more complicated matrix than that of nonheated processed food containing mainly native proteins. During heat treatment, like baking, most of the a/b- and g-gliadins are denaturated and aggregated as insoluble proteins. With the use of conventional aqueous ethanol solution, only the heat-stable w-gliadins, which lack disulfide bridges, can be extracted, while for a/b- and g-gliadin extraction, reducing disaggregating agents is needed (Wieser, 1998). Consequently, extraction with 60% aqueous ethanol in heat-treated foods underestimates gliadins independent of the analytical method used. In 2005, Garcıa et al. developed the “cocktail” extraction method. This procedure is based on a combination of the disaggregating agent guanidine hydrochloride and the reducing agent 2-mercaptoethanol at concentrations of 2 M and 250 mM, respectively, to reduce homopolymers and heteropolymers of gliadin proteins and LMW and HMW glutenin subunits.
SELECTION OF A METHOD FOR GLUTEN ANALYSIS
373
The cocktail procedure is compatible with the R5 antibody ELISA method since 2mercaptoethanol at the concentration used does not affect the functionality of the immobilized R5 monoclonal antibodies. The extraction of gliadin from spiked heattreated samples is nearly complete (95.5%). Taking into account that it is difficult to predict whether or not a food sample has been heat treated, it is necessary to guarantee the reliability of the analytical result regardless of the degree of processing the food sample has undergone, which is achievable by using the cocktail extraction method developed by Mendez (Patent WO 02/092633 A1, Garcıa et al., 2005). Another customized but more time-consuming extraction procedure has been reported by a Japanese group (Morinaga Institute of Biological Science, Yokohama, Japan).
19.5
STANDARD MATERIAL
Another key point for measuring gluten in food samples is to find a suitable standard by using the proper gluten reference material. Preparations of pure gliadin are difficult to obtain because the material is often contaminated with significant amounts of nonreactive low- and high-molecular-weight components and therefore are often poorly dissolved. These can be co-extracted and lead to an overestimation of the real gliadin content in relation to the initial weight by ELISA. In 2000, a reference gliadin representative of several European wheat varieties was produced by request of the Working Group on Prolamin Analysis and Toxicity (WGPAT) by van Eckert (2001). Gliadin was isolated from the 10 most frequently grown wheat varieties from each of the three main wheat-producing countries in Europe: France, Germany, and Britain. The wheat varieties were harvested in 1999. After examining the solubility, and testing the homogeneity of the gliadin preparation by HPLC, the material was tested in 16 laboratories. The evaluation included testing for protein content, gliadin content and composition, content of residual albumin/globulins and glutenins, and possible loss of gliadins during its production as well as the stability. The immunochemical reaction was investigated using various monoclonal and polyclonal antibodies against gliadin and peptides that are supposed to be celiac active. The PWG reference material exhibits excellent solubility and a high prolamin content. The WGPAT agreed to subtract the albumin–globulin content from the raw protein mass to calculate the prolamin mass of the reference material, which resulted in 86.4% gliadin in the material. The European Union Institute for Reference Materials and Methods (IRMM) started to evaluate this reference material, but stopped the procedure in 2005. Now the material is available for scientific purposes from the Prolamin Working Group (WGPAT).
19.6
SELECTION OF A METHOD FOR GLUTEN ANALYSIS
It is not easy for analytical laboratories to decide on which test kits or methods they should rely on. Because of the lack of analytical reference methods and reference materials, it cannot be stated which tests are measuring the correct or true values.
374
GLUTEN DETECTION
Consequently, the method of choice by a given laboratory will depend on individual preferences and their particular specifications. In most cases analysts choose the method that shows reproducible results at the detection limits requested in their own lab and/or those at which they have been validated successfully by official bodies. The current market offers different ELISA kits for the detection of gliadin, which use different antibodies. It is not easy to decide which test kit is the most accurate. In commercial test kits it is important that the specificity and other characteristics of the antibody are reported by manufacturers. One criterion is whether the antibody detects all of the relevant toxic gluten proteins from different cereal species causing celiac disease. In the case of R5 antibody-based test kits, the analyst has three different advantages. The antibody recognizes prolamins from wheat, rye, and barley completely, as well as small peptide fragments related to the toxicity of the prolamins. Methods using R5 have been calibrated with a purified, defined preparation of prolamins. The two R5 antibody-based ELISA tests have been validated by a collaborative study organized by the WGPAT. The R5 sandwich ELISAs have been accepted as the Codex type I method (ALINORM 08/31, July 2008). The R-Biopharm RIDASCREEN Gliadin has been granted the performance tested status of the AOAC RI (Certificate 120601).The sandwich assay is suitable for all types of food. Moreover, use of the cocktail extraction procedure assures that gluten from heat-treated samples can be extracted and detected. The R5 sandwich assay is also available with shorter incubation times (RIDASCREEN FAST Gliadin) with nearly the same sensitivity. This kit is not validated officially but in-house data confirmed the same performance for all different types of foods as well as for heat-treated samples. As a multilabvalidated method, all R5 antibody-based sandwich assays can be used by different categories of labs (industrial and private laboratories and official food authorities). Industrial labs use the test kits for testing raw materials as well as finished products to assure the proper use of gluten-free labeling. Private labs receive numerous samples of diverse composition processed in very different ways. They have the responsibility of extracting the sample in a way that doesn’t jeopardize the quality of the results. Sample processing is not easy to determine when the physical–chemical properties of the sample are unknown. Therefore, cocktail extraction assures the quality of the results. The portable qualitative LFD format using R5 antibody has the advantage of performing quick screening on-site, with a specificity comparable to its counterpart sandwich ELISAs. Single-sample testing can be performed as a screening. The RIDA QUICK test is suitable for checking the environment and efficiency of cleaning in the production area or laboratories by swabbing surfaces. The LFD technique is a very useful tool for industries where fast decisions have an economical impact: for example, testing incoming raw material. The competitive ELISA format based on the R5 antibody offers additional special information when testing for samples containing prolamin fragments, such as beer, syrup, or starches. These samples are in most cases below the LOQ of the sandwich assay but can be tested again with the competitive test kit to see whether smaller potentially toxic gliadin fragments are present. This limits the risk for celiac patients and allows industries to ensure the accuracy and use of the gluten-free statement.
REFERENCES
375
But even using standardized methods showing reproducible and repeatable values, the results may not reflect the true gluten content in the sample. REFERENCES AOAC (2002). AOAC Official Methods of Analysis. AOAC Official Method 991.19, Chap 32:13 (32.1.24), 1991 revised 2002. AOAC International, Gaithersberg, MD. Arentz-Hansen H, Korner R, Molberg O, Quarsten H, Vader W, Kooy YM (2000). The intestinal T-cell response to alpha-gliadin in adult celiac disease is focused on a single deamidated glutamine targeted by tissue transglutaminase. J. Exp. Med., 191:603–612. Catassi C, R€atsch I-M, Fabinani E, Rossini M, Bordicchia F, Candela F (1994). Coeliac disease in the year 2000: exploring the iceberg. Lancet, 343:200–203. Chirdo FG, Anon MC, Fossati CA (1995). Optimization of a competitive ELISA with polyclonal antibodies for quantitation of prolamins in foods. Food Agric. Immunol., 7:333–343. Ciclitira PJ, Evans DJ, Fagg NLK, Lennox ES, Dowling RH (1984). Clinical testing of gliadin fractions in coeliac patients. Cin. Sci., 66:357–364. Denery-Papini S, Nicolas Y, Popineau Y (1999). Efficiency and limitations of immunochemical assays for the testing of gluten-free foods. J. Cereal Chem., 30:121–131. Engel W, Wieser H (1999). Development of a nephelometric method for the quantitative determination of gliadin in wheat starch. In Proceedings of the 14th Meeting of the Working Group on Prolamin Analysis and Toxicity Neuhausen, Germany; Nov. 5–7, 1999, pp. 47–51; Euro. J. Gastroenterol. Hepatol., 2003, 15: 465–474. Fasano A, Berti I, Gerardzuui T, Colletti RB, Drago S (2003). Prevalence of celiac disease in atrisk groups in the United States: a large multicenter study. Arch. Intern. Med., 163:286–292. Friis SU (1988). Enzyme linked immunosorbentassay for quantitation of cereal proteins toxic in coeliac disease. Clin. Chim. Acta, 166:323–328. Garcıa E, Llorente M, Hernando A, Kieffer R, Wieser H, Mendez E (2005). Development of a general procedure for the extraction of gliadins for heat processed and unheated foods. Eur. J. Gastroenterol. Hepatol., 17(5):529–539. Immer U, Haas-Lauterbach S (2004). Statistical evaluation of gliadin ring trial. In Stern M (ed.), Proceedings of the 18th Meeting of the Working Group on Prolamin Analysis and Toxicity, Oct. 2–5, 2003. Verlag Wissenschaftliche Scripten Zwickau, Germany, pp. 23–36. Immer U, Vela C, Mendez E, Janssen FW (2003). PWG collaborative trial of gluten in glutenfree food through “Cocktail ELISA.” In Stern M (ed.), Proceedings of the 17th Meeting of the Working Group on Prolamin Analysis and Toxicity. London, Oct. 3–6, 2002. Verlag Wissenschaftliche Scripten, Zwickau, Germany, 23–33. Janatuinen EK, Kemppainen TA, Julkunen RJK, Kosma V-M, Maki M, Uusitupa MU (2002). No harm from five year ingestion of oats in celiac disease. Gut, 50:332–335. Janatuinen EK, Pikkarainen PH, Kemppainen TA, Kosma VM, Ja¨rvinen RM, Uusitupa MI, Julkunen RJ (1995). A comparison of diets with and without oats in adults with celiac disease. N. Engl. J. Med., 333(16):1033–1037. Kasarda DD (1997). Gluten and gliadin: precipitating factors in coeliac disease. In Maki M, Collin P, Visakorpi JK (eds.), Coeliac Disease (Proceedings of the 7th International
376
GLUTEN DETECTION
Symposium on Coeliac Disease). Tampere, Finland, 1996. Coeliac Disease Study Group, Tampere, Finland, pp. 195–212. Koning F (2003). The molecular basis of celiac disease. J. Mol. Recognit., 16:333–336. Leone NA, Mazzarella G, Ciacci C, Maurano F, Vacca L, Auricchio S et al. (1996 ). Oats prolamines in vitro activate intestinal cell-mediated immunity in coeliac disease. In: Collin P, Ma¨ki M, (eds.), Abstracts of the Seventh International Symposium on Coeliac Disease, 1996 Sept 5–7. Tampere, Finland. Tampere: Lege Antis. Lundin K, Nilsen EM, Scott HG, Løberg EM, Gjøen A, Bratlie J (2003). Oats induced villious atropy in celiac disease. Gut, 52:1649–1652. Marsh MN (1992). Gluten, major histocompatibility complex, and the small intestine: a molecular and immunobiological approach to the spectrum of gluten sensitivity “celiac sprue.” Gastroenterology, 102:330–354. Osborn TB (1907). The Proteins of Wheat Kernel. Publication 84. Carnegie Institution, Washington, DC. Osman AA, Uhlig HH, Valdes I, Amin M, Mendez E, Mothes T (2001). A monoclonal antibody that recognizes a potential coeliac-toxic repetitive pentapeptide epitope in gliadins. Eur. J. Gastroenterol. Hepatol., 13:1189–1193. Shan L, Molberg O, Parrot I, et al. (2002). Structural basis for gluten intolerance in celiac sprue. Science, 297:225. Shewry PR, Tatham AS, Forde J, Kreis M, Miflin BJ (1986). The classification and nomenclature of wheat gluten proteins: a reassessment. J. Cereal Sci., 4:97–106. Skerritt JH, Hill AS (1990). Monoclonal antibody sandwich enzyme immunoassays for determination of gluten in foods. J. Agric. Food Chem., 38:1771–1778. Skerritt JH, Hill AS (1991). Enzyme-immunoassay for the determination of gluten in foods: collaborative study. J. AOAC, 74:257–264. Valdes I, Garcıa E, Llorente M, Mendez E (2003). Innovative approach to low-level gluten determination in food using a novel sandwich enzyme-linked immunosorbent assay protocol. Eur. J. Gastroenterol. Hepatol., 15(5): 465–474. van Eckert R (2002). The PWG gliadin, a new reference material. In Stern M (ed.), Proceedings of the 16th Meeting of the Working Group on Prolamin Analysis and Toxicity, Sitges, Spain, Nov. 8–11, 2001. Verlag Wissenschaftliche Scripten, Zwickau, Germany, pp. 25–27. Wieser H (1995). The precipitating factor in celiac disease. Balliere’s Clin. Gastroenterol, 9:191–207. Wieser H (1998). Investigations on the extractability of gliadin proteins from wheat bread in comparison with flour. Z. Lebensm. Unters. Forsch., 207:128–132. Wieser H, Antes S (2002). Development of a non-immunochemical method for the quantitative determination of gluten in wheat starch. In Stern M (ed.), Proceedings of the 16th Meeting of the Working Group on Prolamin Analysis and Toxicity, Sitges, Spain, Nov. 8–11, 2001. Verlag Wissenschaftliche Scripten, Zwickau, Germany, pp. 19–23. Wieser H, Seilmeier W, Belitz HD (1994). Quantitative determination of gliadin subgroups from different wheat cultivars. J. Cereal Sci, 19:149–155.
CHAPTER 20
Nut Allergen Detection RICHARD FIELDER, WARREN HIGGS, and KATIE BARDEN Tepnel Research Products and Services, Deeside Industrial Park, Flintshire, UK
20.1
INTRODUCTION
For analytical purposes it is important to define precisely what needs to be measured. Nuts is a general term used for culinary purposes to refer to the dry seed or fruit of certain plants, whereas in botanical terms the term is restricted to a simple dry fruit with one seed, in which the seed wall becomes very hard at maturity. Most nuts included in the diet are the seeds of trees, but the seeds of a few other plants that are not strictly nuts are included (e.g., peanut or “groundnut” is a legume and a seed). Also, coconut (Cocos nucifera) is not a nut (despite its name) but a drupe and is a single fleshy fruit with a hard stone that contains a single seed. In this chapter the culinary definition will be used to discuss the many types of edible nuts that are found around the world (Table 20.1) and included in legislation and codes of practice. The diversity of tree nut species, combined with the emergence of a limited number of methods to detect them, comprise a contributing factor to the lack of monitoring of nut allergens in food products. Legislation has been chosen as the starting point for the discussion: deciding what needs to be measured together with the other factors that determine the special importance of nut detection compared with other allergens. The main discussion covers the current emergence of immunological methods available to meet these requirements and the comparative differences of the methods. This discussion concludes with the practical difficulties of testing that derive from nut-free food manufacture. Finally, some brief observations for providing better nut allergen control and labeling are made together with some latest thoughts on what improvements and new analytical methods are needed.
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
377
378
Castanea spp. (Fagaceae)
Castanea pumila (Fagaceae) Cocos nucifera [Arecaceae (alt. Palmae)] Ginkgo biloba L. (Ginkgoaceae)
Chestnut
Chinquapin
Ginkgo nut
Coconut
Anacardium occidentale (Anacardiaceae)
Juglans cinerea (Juglandaceae) Aleurites moluccana
Cashew
Candlenut
Butternut
Hard-shelled kernel of the fruit of the maidenhair tree
Includes eight or nine species (e.g., Chinese and sweet chestnuts) which are fruits; distinct from water chestnuts and horse chestnuts Related to the chestnut, but produces a single nut to a burr Fruit of the coconut palm
Species of walnut native to North America; a fruit Seed similar to macadamia nut, cultivated mostly for its high oil content Evergreen tree bearing a true fruit within which is the seed
Ten species; a fruit South American tree that bears a fruit
Classified in the same subgenus as walnut; botanically, a seed
Prunus dulcis (Rosaceae); (synonym Amygdalus communis L.) Fagus spp. (Fagaceae) Bertholletia excelsa (Lecythidaceae)
Almond
Beech nut Brazil nut
Comment
Genus/Species
Edible Nut
TABLE 20.1 Overview of Nut Species
Asia
Tropics
Southeastern United States
North America, Europe
Vietnam, India, Brazil, Nigeria, Indonesia
Malaysia, Indonesia, Japan, Hawaii
Canada, United States
Europe, North America Brazil, Bolivia, Colombia, Peru, Venezuela
California, Spain, Syria, Italy, Iran
Where Cultivated
United States
United States
United States
Europe, United States, Canada, Australia, New Zealand United States
Europe, United States, Canada, Australia, New Zealand United States Europe, United States, Canada, Australia, New Zealand United States
Included in Legislation
379
Europe, Asia, North America
Edible seeds of about 20 pine species Small mountain tree bearing a drupe containing a seed Fruit containing an oil-rich seed 21 species, of which J. regia is the common walnut
Carya illinoinensis (Juglandaceae)
Pinus spp. (Pineaceae)
Pistacia vera L. (Anacardiaceae)
Vitellaria paradoxa (Sapotaceae) Juglans spp. (Juglandaceae)
Pecan
Pine nut
Pistacchio
Shea nut
Walnut
Africa
Species of hickory, the fruit producing a thin-shelled nut
Litchi chinensis Sonn. Sapindaceae Macadamia spp./M. ternifolia (Proteaceae) Arachis hypogaea (Fabaceae)
Lichee nut (Lychee) Macadamia/ Bush nut/ Queensland nut Peanut (groundnut) Annual cultivated for the fruits, which develop into a legume that matures underground
Tropical fruit tree that bears a drupe that contains a seed Evergreen trees, with only two species producing edible fruits
Cola
Kola
Asia, Mediterranean, Australia, United States
Europe, Asia, North America
United States, Mexico
America, China, India, Australia
Australia
Africa, Indonesia, Brazil, Jamica China, Asia
United States, Mexico, China, Asia
Carya spp. (Juglandaceae)
Hickory nut
Europe, Asia
Filberts are similar to the related common hazelnut, a fruit produced in clusters 19 species produce a fruit that is a oval nut enclosed in a thick husk which splits open at maturity Evergreen tree bearing a seed
Corylus avellana/C. maxima (Betulaceae)
Hazelnut/filbert
Europe, United States, Canada, Australia, New Zealand
Europe, United States, Canada, Australia, New Zealand Japan, Europe, United States, Canada, Australia, New Zealand Europe, United States, Canada, Australia, New Zealand Europe, United States, Canada, Australia, New Zealand Europe, United States, Canada, Australia, New Zealand United States
United States
Europe, United States, Canada, Australia, New Zealand United States
380
20.2
NUT ALLERGEN DETECTION
REQUIREMENTS FOR DETECTION
20.2.1
The Developing Choice of Methods
Methods employed for detecting nut allergens target specific proteins of the nut (Table 20.2) as an indicator of the presence of the potentially allergenic ingredient. Online databases can be found that identify the major known allergenic proteins (e.g., FARRP, www.allergenonline.com). The protein-based methods can follow a number of immunochemical approaches. However, human-sera-based methods are not used routinely in food analysis, due to the need to handle human sera in specialist clinical laboratories and because they are difficult to standardize (Poms et al., 2004). In-house rocket immunoelectrophoresis, immunodiffusion, and immunoblotting techniques have been developed for food control (Wen et al., 2007) that yield qualitative and semiquantitative results, although it is enzyme-linked immunosorbent assays (ELISAs) that have become the preferred method of choice in laboratories for food control because they offer the potential for greater precision and standardisation plus ease of handling. ELISAs were introduced in the 1960s by Berson for testing insulin and Ekins for testing thyroxine (Diamandis and Christopoulos, 1996). Commercial immunological TABLE 20.2
Nut Allergens
Nut
Allergen
Function/Type
Brazil nut
Ber e 1 Ber e 2 Ana o 1 Ana o 2 Cas s 5 Cas s 8 Cor a 1 Cor a 2 Cor a 8 Cor a 9 Cor a 11 Ara h 1 Ara h 2 Ara h 3 Ara h 4 Ara h 5 Ara h 6 Ara h 7 Ara h 8 Jug r 1 Jug r 2 Jug r 3 Jug r 4
Albumin (2S) Legumin (11S) Vicilin (7S) Legumin (11S) Chitinase 1b PR-14 (LPT) PR-10 (Bet v 1 homologous) Profilin PR-14 (LPT) Globulin (11S) Vicillin (7S) Vicilin Conglutin Glicnin Glicnin Prolifin Conglutin homologous Conglutin homologous PR-10 Albumin (2S) Vicilin (7S) PR-14 (LTP) Legumin (11S)
Cashew Chestnut Hazelnut
Peanut
Walnut
Source: Crespo et al. (2006).
REQUIREMENTS FOR DETECTION
381
TABLE 20.3 Milestone Events in the Development of Methodologies for Nut Residue Detection Year
Milestone Event
Source
1994
ELISA developed for quantitation of peanut protein ELISAs commercialized for peanut determinations ELISA developed for hazelnut protein Peanut test material Nut allergen proficiency testing begun Multiresidue method for detection of nut residues AOAC RI Performance Tested Method approval of three peanut ELISAs German official methods group validated two ELISA kits for hazelnut in plain chocolate
Hefle et al. (1994)
1996 1999 2002 2003
2004
Neogen, Pro-Lab, Tepnel Koppelman et al. IRMM (2002) FAPAS Blais et al. (2003) AOAC Research Institute LFGB (2006)
methods for peanut protein detection became available in 1996: a semiquantitative ELISA test kit developed and commercialized by Cortecs Diagnostics (now called Tepnel); and quantitative assays were commercialized by Pro-Lab and Neogen. At that time (Table 20.3), ELISAs were being developed out of research programs being conducted at Health Canada (Yeung and Collins, 1996) and the University of Nebraska (Hefle et al., 1994). Other screening techniques for detection of allergenic nut residues based on lateral flow immunochromatographic tests were developed in 2004. These rapid methods provide fast and easy qualitative analysis with comparable sensitivity to the ELISAs. The development of these immunochemical techniques arose in response to the apparent growth of peanut allergy that occurred over the last two decades (Sampson, 2002). The food industry was alarmed by the severity and rapid onset in sensitive consumers of reactions to peanuts. This led many food manufacturers and retailers to declare the presence of nuts on their product labels, resulting in a plethora of styles of “may contain” statements (Stephan et al., 2002; Pele et al., 2007) and the need for legislation. 20.2.2
Requirements of Legislation
In Europe, North America, Australia, and New Zealand, peanuts and tree nuts are listed as allergenic ingredients that must be declared clearly when they are used in prepackaged foods. This is regardless of their level of inclusion and poses a particular demand for highly sensitive, yet qualitative methods of analysis. Due to their public health significance in Europe, the European Food Safety Authority (EFSA), defined the first labeling requirement in Annex IIIa of European Commission (EC) Directive 2003/89/EC, published November 25, 2003. All added ingredients and components of added ingredients (e.g., processing aids) are covered by these requirements. The directive amended the general rules on the labeling of foods (Directive 2000/13/EC)
382
NUT ALLERGEN DETECTION
and was revised further in Directive 2007/68/EC. The European legislation specifies the particular tree nuts, that are included in the allergen labeling provisions (Table 20.1). A number of other nuts, such as coconuts, chestnuts, and pine nuts, were not included in the legislation as they were not on the list of nuts of greatest public health concern identified by EFSA. Switzerland does include pine nuts in its positive list, as does the United States. In the United States the Food and Drug Administration (FDA) has in its latest guidance document (FALCPA, 2004), specified 19 different tree nuts that must be identified on packaged foods in order to be compliant with the Food Allergen Labeling and Consumer Protection Act (FALCPA) of 2004. However, there is currently debates to whether all should be included based on scientific rationale (including incidence, prevalence, and severity of the allergy, allergenic potency, consumption data, and history of use). It is proposed (Yeung, 2008) that the list be reduced to just nine nuts: almond, brazil nut, cashew, hazelnut/filbert, macadamia, pecan, pine nut, pistachio, and walnut. This would then be more consistent with the European, Canadian, Australian, and New Zealand positions. In the East, Japan’s Food Sanitation Law (April 2002) includes only peanuts in its list of just five raw materials that must be labeled. In Europe, Directive 2007/68/EC, Published on November 28, 2007, also sets out those ingredients that have permanent exemptions from the labeling requirements, which for nuts are those used for making distillates or ethyl alcohol of agricultural origin for spirit drinks and other alcoholic beverages. Member states had to implement these provisions into national legislation by May 31, 2008, although foodstuffs placed on the market or labeled before May 31, 2009 that complied with the provisions of Directive 2005/26/EC could continue to be marketed until stocks were exhausted. 20.2.3
Importance of Nut Testing
Although it is not mandatory to test in any of the countries listed above, to minimize the risks to consumers, analysis of foods for traces of nut allergens is desirable. Nuts are the most prevalent cause of anaphylaxis caused by foods (Crespo et al., 2006), and in the United States, the United Kingdom, and Scandinavia the allergy can affect approximately 1% of the population. In other countries the frequency may vary, due to the importance of other allergens in the diet (e.g., seafood in Australia, celery in Switzerland: Burks, 2008); different cooking procedures (e.g., peanuts are boiled in China, where the allergy is uncommon); and protein differences (e.g., Ara h 1 and Ara h 3 are believed to be less common in Chinese peanuts than in American peanuts: Cong et al., 2008). Although it is debatable whether the incidence of peanut sensitisation is increasing significantly (Grundy et al., 2002); nut allergy is more important in adults than in children (Sicherer et al., 1999) because it persists (only 9% outgrow the allergy), whereas the converse is generally true for other allergies. Paradoxically, the known health benefits of nuts means that their consumption by the nonallergic consumer has increased by their inclusion in a broader range of foods. These products are often manufactured in the same facility as other food, which increases the risk of cross-contamination and is demanding better levels of on-site control in the supply chain. Product recalls due to undeclared food allergens are
REQUIREMENTS FOR DETECTION
383
significant globally and in most cases preventable (Staniforth, 2006). In the United States, 36% of all FDA food recall reports in 1999 were due to food allergens not being declared (Vierk et al., 2002), which contrasts with the European figure of 10% [European Union (EU) alert data]. In the UK, the number of Food Standards Agency alerts for allergen-related recalls is expected to double in 2008 if current trends continue. Diligent businesses have withdrawn products voluntarily as a precautionary measure to cover perceived risks. This has prompted general advice for tighter checks at the “factory gates”. Foods with “allergen-free” claims have also grown rapidly, with such products attracting a premium; in the UK this market grew by 165% between 2001 and 2002 (Mintel, 2003), and in the United States the market is expected to exceed $4 billion in 2008. This could mean that the situation is likely to get worse before it gets better if improved practises of control cannot be evolved. For these reasons, most North American lawyers would now consider testing to be a minimum standard of care for all food producers. 20.2.4
Methods Available
Food manufacturers are starting increasingly to demand methods to verify their labeling claims and to improve the validation and verification of their factory quality management systems, while health inspection agencies are reliant on validated methods to enforce legislation. An expanding choice of commercially available test kits for nuts is just now emerging (Table 20.4). These are the result of commercial enterprise, commercial partnerships (e.g., University of Nebraska, FARRP, and TABLE 20.4
Commercially Available Immunological Test Kits a
ELISA
Total Lateral flow
Total a
As of May 2008.
Almond
Hazelnut
Peanut
ELISA Systems Neogen R-Biopharm Tepnel
ELISA Systems Neogen R-Biopharm Tepnel
4
4
Abkem Iberia Biotrace (3M) ELISA Systems Incura Ingenasa Morinaga Neogen Nippon R-Biopharm Tepnel 10
Tepnel
R-Biopharm Tepnel
1
2
Neogen Nippon R-Biopharm Tepnel 4
Total
18
7
384
NUT ALLERGEN DETECTION
Neogen), and funded projects (e.g., EU-funded ALLERGENTEST research with partner R-Biopharm). These kits share the common characteristic that they either detect or measure a target nut protein(s) using an antibody which binds only to that target (or antigen). Through the high affinity of the antibody for the target, microgram levels can be detected with both the lateral flow and ELISA techniques. Clearly, much work needs to be conducted by diagnostic companies to expand the range for nine or more nuts and so provide a real choice. Where there are some kit choices for nuts, these are for nuts considered not only to present the greatest risk for the food industry but also a potential market for the kit companies. This presents the dilemma that it could be some time until there is perceived to be a commercial market for the less important nut allergens (unless funded), even though nut allergy sufferers rarely possess single nut sensitivity. Also, there is never a case for one test method being applicable for all requirements. Finding the “right tool for the right job” is again appropriate and a challenge for the analyst until more methods can be developed.
20.3 20.3.1
COMPARATIVE DIFFERENCES IN METHODOLOGIES Choices for On-Site Nut Screening
Monitoring cross-contamination of nuts in a food factory may require testing of the processing environment as well as food samples. To enable food manufacturers to undertake real-time in situ testing, two choices are offered: specific and nonspecific allergen control tests. The simplicity of these tests make it suitable for anyone in food manufacturing or enforcement to check compliance with both manufacturing and hazard analysis and critical control point (HACCP) procedures or food labeling regulations. The nonspecific tests are either based on measuring the presence of ATP (adenosine triphosphate) or protein residues. Both tests offer the user the benefit of convenience and affordability for controlling soil residues. For those based on ATP a luminometer is required to measure (in relative light units) the luciferin–luciferease bioluminescence reaction from the presence of ATP contained in food residues. ATP swabs marketed for nut allergen control are claimed to have greater sensitivity than conventional ATP swabs to achieving the critical limits for control. Many food factories have already adopted ATP testing (because it is extremely useful for rapidly evaluating the effectiveness of hygienic practices), which means that the approach is attractive and the instrument is often already on-site. The instrument software is also user-friendly, allowing data to be easily stored, tracked, and trended. However, in the “mature” market for ATP hygiene swabs, vendors use claims of better sensitivity to differentiate their products from rivals, so more pertinent to the debate is the applicability of ATP for allergen control. ATP testing has generally proved applicable where the test portion contains readily measurable levels of ATP: for example, in the dairy and meat sectors of the food industry. The converse is also true, and some samples are not easily tested (e.g., dried skim milk powder, which contains little ATP). The other difficulty is understanding the complexity of correlating limited ATP data from detection of
COMPARATIVE DIFFERENCES IN METHODOLOGIES
385
TABLE 20.5 Sensitivity of AllerGiene to Almond Slurry Compared to Almond ELISA Roasted Almond Slurry (ppm) 2 5 10 20
AllerGiene (RLU) (% positive, N ¼ 10) 0 (0%) 11778 (40%) 25678 (90%) 65049 (100%)
Almond ELISA Not found, <5 ppm Not found, <5 ppm Positive, >10 ppm Positive, >10 ppm
Source: Charm Sciences (2008).
multiple food residues at ppm levels in the factory to ppm levels of a single nut residue. When simple comparisons are made with another method (Table 20.5), the second method’s own set of limitations also need to be borne in mind (e.g., calibration, units of measurement). These factors have limited the applicability of ATP testing for allergen control. Protein-based tests may also require some degree of instrumentation and rely on the visual assessment of the staining technique. Similar to ATP tests, they also suffer from the difficulty of interpretation of results. There is complexity when interpreting the detection of allergenic and nonallergenic proteins from multiple food residues and the variation in protein content of these different foods. In the absence of sufficient data, specific immunologically based tests for allergen control are finding more widespread acceptance, especially while best practices for factory control are still evolving. The contention is that it is more reliable to use a specific test for nut control rather than one that can only be indicative of multiple residues. 20.3.2
Types of On-Site Immunological Tests
Some variation in formats exists for lateral flow techniques used in the nut specific tests. These relate to their dependence on either two or three lines for interpretation of results, and dependence on equipment (Table 20.6). Currently, only the three line tests are handheld and true on-site tests, whereas the two line tests may require some limited equipment and basic laboratory facilities for extraction. Most tests provide a sensitivity of around 5 ppm nut content, although the performance will be determined by the sample matrix, so validation is always necessary to verify the level that can be detected. Data for the sensitivity of tests will appear better when information is presented as units of nut protein compared to whole nut content. There is also some argumentation regarding the possibility of a high-dose hook effect with high nut concentrations and the potential for some two line tests to produce false-negative results. The design of the three line tests would minimize this effect, while some two-line test manufacturers advise either that no effect will be observed with 100% material or that further dilution of the sample extract may be needed. Lateral flows are about five times more expensive than nonspecific tests, although they are still affordable and convenient to use routinely. Some revision of their design has been made since their introduction.
386
Low ppm (almond content) Almond protein
Ground apricot kernel
May prove unsuitable for acidic foods
Included 10 or 100
Limit of detection
Cross-reactions
Other limitations
Swabbing kit Tests/kit
As of May 2008.
a
Specificity
Tepnel RAPID 3-D 3 line <10 min Included None
Producer Brand Format Total test time Extraction Equipment
Almond
Walnut
—
Included 10 or 100
—
— 25
Low ppm (hazelnut content) Hazelnut protein
5 ppm (hazelnut content) Hazelnut proteins
Sesame, sunflower seeds
Tepnel RAPID 3-D 3 line <10 min Included None
R-Biopharm Rida Quick 2 line >40 min Included Centrifuge, shaker, homogenizer
Hazelnut
May prove unsuitable for hydrolyzed and fermented foods Separate 25
— 20
Almond, cashew, macadamia, hazelnut, soybean, red kidney bean May prove unsuitable for canned, retorted, HT/HP treatments
—
Separate 25
Peanut proteins, including Ara h 1, h 2 and h 3
Included 10 or 100
Low ppm (peanut content) Peanut proteins (conarachin)
5 ppm (peanut content)
Several ppm (peanut protein) Peanut proteins
Tepnel RAPID 3-D 3 line <10 min Included None
R-Biopharm Rida Quick 2 line >40 min Included Centrifuge, shaker, homogenizer
Nippon FASTKIT 2 line >40 min Included Centrifuge, homogenizer
Peanut residue
Neogen REVEAL 2 line >30 min Separate kit Blender, water bath (optional dipstick reader available) 5 ppm peanut
Peanut
TABLE 20.6 Specifications of Currently Available Lateral Flow Devices for Nut Allergen Control a
COMPARATIVE DIFFERENCES IN METHODOLOGIES
20.3.3
387
Procedures for On-Site Immunological Tests
Some of the tests describe the procedures as a single-step lateral flow, others as a dip and test format; all kits are describe a relatively simple procedure that takes a few minutes following extraction (Figure 20.1). The extract is wicked through a filter and conjugate pad containing antibodies specific for nut proteins conjugated to colored particles (Figure 20.1). When the nut proteins are present in the sample, they are captured by the conjugated antibodies. The nut–antibody–particle complex migrates along a membrane by capillary action to reach a line where nut-specific antibody has been dried onto the membrane. This second antibody captures the complex, allowing the particles to concentrate and form a visible colored line. No line will form when nut proteins are absent. A control line adjacent to the test line will form, regardless of the presence of nut proteins, to indicate that the test is functioning correctly. In the three-line RAPID 3-D tests there is an additional, “overload” line, which gradually disappears together with the test line as the amount of nut protein in the sample increases above a threshold where the capacity of the test to bind further nut protein is exceeded. This is the high- dose hook effect described above, which minimizes the risk of false-negative results occurring (e.g., from backflow). To minimize the potential for false-positive results, all tests should be read at the time of adding the extract, specified by the manufacturer. Extraction procedures for the tests vary according to the kit (Tables 20.6 and 20.7) and the sample type (including environmental swabs). Most kits, except for Reveal, include the extraction method. The RAPID 3-D tests have the quickest procedure for extraction involving simple handheld operations and are the only ones to include swabs (the swab extract being used in the test). The other kits require varying amounts of equipment and so need to be performed in a laboratory. All tests require the original subsample or laboratory sample to be homogenous before the test portion is removed for extraction, in order to maximize sampling precision. Manufacturers note some
C
T Sample drop area
C
T
Conjugate pad & filter
FIGURE 20.1 Construction of a lateral flow device. C, control line; T, test line; conjugate.
, antibody
388
Tepnel RAPID 3-D Included 0.25 g shaken in extraction buffer for 1 min.
As of May 2008.
a
Extraction time <3 min
Producer Brand Extraction
Almond
R-Biopharm Rida Quick Included Add 1 g skimmed milk powder and 1 g sample to extraction buffer preheated to 60 C; homogenize for 10 min. Cool and centrifuge at 2500 g for 10 min at 4 C before testing. 30 min <3 min
Tepnel RAPID 3-D Included 0.25 g shaken in extraction buffer for 1 min.
Hazelnut
30 min
Neogen REVEAL Separate kit 5-g sample blended for 2 min in 125 mL of extraction buffer preheated to 50 C. Allow to settle and filter.
30 min
Nippon FASTKIT Included 2-g sample homogenized in 38 mL of diluted extraction buffer for 30 s, followed by centrifugation at 3000g for 20 min at 4 C. Filter and dilute 1 : 10.
30 min
R-Biopharm Rida Quick Included Add 1 g skimmed milk powder and 1 g sample to extraction buffer preheated to 60 C; homogenize for 10 min. Cool and centrifuge at 2500 g for 10 min at 4 C before testing.
Peanut
TABLE 20.7 Extraction Details for Currently Available Lateral Flow Devices for Nut Allergen Control a
<3 min
Tepnel RAPID 3-D Included 0.25 g shaken in extraction buffer for 1 min.
COMPARATIVE DIFFERENCES IN METHODOLOGIES
389
modifications to extractions with different sample types. With RAPID 3-D it is necessary to dilute a further 1:10 with high-tannin-content samples, such as chocolate. RIDAQUICK supernatants need a further filtration step for bakery products and FASTKIT proposes that insoluble substances be removed by extended centrifugation times and greater speeds. Only RIDAQUICK uses skimmed milk powder during extraction, which may limit its application when milk needs to be analyzed at the same time within the laboratory. 20.3.4
Performance of On-Site Immunological Tests
All the tests are designed for screening, and as such should be used only for preliminary screening for the presence of the nut residue. The validity of results obtained with the tests should preferably be viewed in conjunction with data from a validated laboratory assay (Table 20.8). Irrespective of the shade of a line observed in any of the lateral flow tests, a response is recorded (i.e., a positive for a test line appearing in two-line tests to indicate the presence of nut proteins). Additionally, a negative test result cannot exclude the possibility that the food contains the nut proteins because they are either distributed unevenly or may be below the detection limit of the test. Kit manufacturers should be expected to provide evidence of sensitivity, specificity, cross-reactivity, interference, inter- and intra- test variability, and robustness of a test to support their product claims (Table 20.9). Supplementary information from user trials and ring trials are valuable as independent evidence of performance, although they are still a scarce practice at this stage. In 2006, van Hengel of the European Joint Research Centre in Belgium published findings from an interlaboratory trial of two peanut lateral flow devices, RAPID 3-D Peanut and Reveal Peanut tests (van Hengel et al., 2006). Cookies with seven concentration levels of peanut, ranging from 0, 1.5, 4.0, 8.2, 14.0, 21.0, to 30.0 mg peanut/kg food matrix were analyzed by 18 laboratories; leading to 1260 analytical results. Both tests were challenged below their cutoff limits of <5 ppm
TABLE 20.8 Correlation of Results Between FASTKIT Immunochromato Peanut and FASTKIT ELISA Peanut FASTKIT ELISA Peanut >10 ppm FASTKIT Immunochromato Peanut Total
Positive Negative
9 1 10
10–5 ppm 0 0 0
5–1 ppm 3 1 4
Negative 3 232 235
Total 15 244 249
Source: Nippon (2008). Notes: . Overall agreement ratio 244/249 specimens ¼ 96.8%. . Specimens indicating 1 ppm or greater using FASTKIT ELISA Peanut are positive. . Detection (sensitivity) depends on the components in the test portion of the food. . The interpretation of the result was obtained 15 min after commencement of the test. Also, irrespective of the shade, tests were interpreted as positive when a reddish-purple colored line was observed.
390 Detects 0.1 ppm defatted almond protein, 0.06 ppm whole almond Apricot kernel; no crossreactivity with other nuts, legumes, dried vegetables, seeds 1 ppm almond extract spike detected in almond oil, sponge cake, and vegetable stock cube; 1 ppm spike in plain chocolate and tomato paste detected only after further 1 : 10 dilution >90% accuracy; possible contamination or processing effects All gave expected results at 1 ppm
—
Cross-reactivity
Unspiked retail food samples
Sensitivity
Specificity
Spiked retail food samples
Spike recovery
RAPID 3-D Almond
Parameter
Validation Detects 0.1 ppm defatted hazelnut protein, 0.06 ppm whole hazelnut 60 ppm whole walnut; no cross-reactivity with other nuts, legumes, dried vegetables, seeds 1 ppm hazelnut extract spike detected in hazelnut oil, sponge cake, and vegetable stock cube; 1 ppm spike in plain chocolate and tomato paste detected only after further 1 : 10 dilution 84% accuracy; possible contamination or processing effects All gave expected results at 1 ppm
RAPID 3-D Hazelnut
TABLE 20.9 Validation Data of Currently Available RAPID 3-D Tests for Nut Allergen Control
100% accuracy when samples above 5 ppm tested All gave expected results at 25 ppm NIST SRM2387 peanut butter
>65% of samples above correctly tested positive when spiked at 25 ppm peanut content; >75% of blank samples above correctly tested negative
No cross-reactivity with other nuts, legumes, dried vegetables, seeds
Detects 5 ppm peanut content in retail, processed foods
RAPID 3-D Peanut
391
—
Conditions that do not compromise functionality
—
—
Inter- and intra variability
Robustness
Swabbing
User trial feedback
5 mg almond protein/ 25 cm2 detected on plastic, Teflon, and stainless steel Very clear and quick results
Line intensities comparable between batches and operators at 0.1 ppm almond protein Sample weight 4 g – 10%; extraction buffer volume 4 mL – 5%; extraction buffer temperature ambient or 2–8 C; extraction time 1 min – 30; extraction motion hand shaken or whirly mix; incubation time 5 min – 2 min 5 mg hazelnut protein/ 25 cm2 detected on plastic, Teflon and stainless steel Easy and good method; difficult for some matrices
Line intensities comparable between batches and operators at 0.1 ppm hazelnut protein Sample weight 4 g – 10%; extraction buffer volume 4 mL – 5%; extraction buffer temperature ambient or 2–8 C; extraction time 1 min – 30 s; extraction motion hand shaken or whirly mix; incubation time 5 min – 2 min
Line intensities comparable between batches and operators at 1 ppm peanut content Sample weight 4 g – 10%; extraction volume 4 mL – 10%; extraction buffer pH 7.2 – 0.02; extraction buffer temperature ambient or 2–8 C; extraction time 1 min – 1 min; extraction motion hand shaken or vortex; incubation time 5 min – 2 min 1 ppm NIST SRM 2387 peanut butter detected in swabbing solution
392
NUT ALLERGEN DETECTION
peanut. Overall, they both performed well within their stated claims of performance, with sensitivity approaching that of ELISA tests. The Reveal kit showed fewer false negatives than the RAPID 3-D kit, although it led to some false positives with the blank matrix. This observation could be related to the importance of reading the result immediately at the end of the manufacturer’s recommended incubation time. The repeatability was better for RAPID 3-D than for Reveal, and although all participants found the tests easy to use, RAPID 3-D was considered by one participant to be less subjective to read. The RAPID 3-D Peanut test has been improved since this study and has been redesigned in a “dip and test” format. In January 2007, CCFRA in the UK commissioned a member-funded research project to better understand the suitability of rapid allergen detection kits for food allergen control (CCFRA, 2008). Their work will focus more on the catering environment, although it will examine the performance of the rapid allergen kits, particularly in support of cleaning programs. The project is expected to be concluded later in 2008. Importantly, it is always necessary that the user of any rapid test validate the suitability of lateral flow devices for their application and verify the actual level of nut residue that can be detected in their samples (to provide appropriate levels of assurance on the product label) or on their production surfaces (to assess whether nutspecific proteins have been removed prior to production). Users should perform matrix-specific spike recovery validation work (at multiple levels) in conjunction with a validated laboratory assay to help confirm test results (e.g., validation of RAPID 3-D Peanut was made in comparison to the BIOKITS Peanut Assay). This is often best provided by the test kit manufacturer or in conjunction with their preferred laboratory partner. With any of the tests there may be some foods that are not suitable for testing (e.g., FASTKIT notes high-temperature and high-pressure-treated products and RAPID 3-D Almond instructions notes highly processed almond). Other samples may prove difficult to handle and then analyze, as noted in user trials of the RAPID 3-D Hazelnut and RAPID 3-D Peanut validations. These materials can include raw materials with high absorbency and surface areas (e.g., flours, rice). Once the initial validation exercise has been completed, some ongoing external verification is always advisable in order to check that initial assumptions are still valid. The validation exercise should always be repeated when something is known to have changed (e.g., ingredient supplier). 20.3.5
Choices for Laboratory Nut Screening
For the quantification of specific allergenic ingredients, ELISAs have become the “gold standard” approach in laboratories. These methods are sufficiently sensitive to differentiate low ppm levels of contamination, and they detect proteins, the agents implicated in causing allergic reactions in sufferers. Since the first peanut kits were commercialized in 1996, there are now at least 10 on the market. In 1997, Mills et al. developed a rapid dipstick format test for detecting peanut in marzipan and chocolate. In 1999 an immunoaffinity column was developed for peanut protein in chocolate (Newsome & Abbott), and the first method for hazelnut was developed by Holzhauser
COMPARATIVE DIFFERENCES IN METHODOLOGIES
TABLE 20.10
Abkem 3M/Biotrace ELISA Systems Ingenasa Incura Morinaga Neogen Nippon R-Biopharm Tepnel a
393
Commercially Available Test Kits for Nut Detection Almond
Hazelnut
Peanut
þ
þ
þ þ
þ þ
þ
þ
þ þ
þ þ
þ þ þ þ þ þ þ þ þ þ
Walnut
(þ)
(þ)
As of May 2008. þ , Available; ( þ ), in development.
et al. Three years later more sensitive dipsticks than earlier were developed by Stephan et al. (2002) for determination of peanut and hazelnut traces. Other ELISA methods followed and were commercialized by 2003. Commercial kits for almond and other tree nuts have since been added; to date, 24 nut kits are available (Table 20.10), with more in development by existing kit providers as well as new manufacturers that are expected to enter the market soon. There are also in-house methods publicized with the potential to be commercialized by partners (e.g., FARRP has both a pecan and a walnut ELISA, with a cashew ELISA in development). The approach to allergen testing so far has largely involved the use of individual assays for each nut allergen suspected to be present in a food commodity. However, Health Canada has pioneered (Rejeb et al., 2005) the use of a multiresidue indirect competitive ELISA for detection of peanut, almond, brazil nut, cashew, and hazelnut. This method has not been commercialized although it is in use by CFIA laboratories as part of Health Canada’s compliance program to detect the presence of undeclared allergens in foods. 20.3.6
Procedures for Laboratory Nut Screening
Many variations of ELISA exist (e.g., direct, indirect, competitive), although for nut detection most commercial kits are the simpler-to-perform sandwich assays (Tables 20.11 and 20.12). Only DiagnoKits are of the competitive type and therefore additionally require a plate shaker. The 96-well format is more popular for the larger amount of peanut monitoring that is undertaken by laboratories and is therefore more likely to be most economical to use, whereas for other, less tested nuts, the 48-well kit dominates. All kits are quantitative assays despite using a different number of standards, which means that any of the assays can be performed semiquantitatively or even qualitatively (by omitting all but one of the standards). Another common point is that most require a plate reader capable of measuring the optical densities with a standard filter at 450 nm, whereas the Veratox and Tecra VIA plates are measured at 650 nm. Visual assessment of the plates would only be recommended for ELISAs performed qualitatively. Only BIOKITS includes an assay positive control which may also be used for spiking experiments in the matrix under test.
394
As of May 2008.
a
Specificity Standards Standard curve Incubation (minutes) Control
None
Ara h1 6 Ready to use 75
NIST 2387
RIDASCREEN (and FAST) Sandwich 96 (48) 43 (19) þ 3.3–90 (2.5–20)
R-Biopharm
2.5 (1.5) Peanut extract (10% protein) Peanut proteins 5 Ready to use 90 (30)
Sandwich 96 41 þ 1–20
ELISA Wells/plate Max. samples Quantitative Range (ppm) (LOQ) LOD Units
0.1 Peanut
BIOKITS
Tepnel
None
None
Ara h2 6 Ready to use 30
0.5 Total peanut protein
— Peanut Peanut proteins 5 Ready to use 30
Sandwich 48 18 þ 1–15
ELISA Systems
ELISA Systems
Sandwich 48 14 þ 2.5–25
VERATOX
Neogen
Specifications of Commercial Peanut Residue Testsa
Brand
TABLE 20.11
None
7 Dilute <120
— Soluble peanut protein
96 40 þ 0.78 – 50
Food Protein ELISA
Morinaga
None
5 Ready to use <120
0.5 Total peanut
Sandwich 96 43 þ 2.5–20
Tecra VIA
3M/Biotrace
395
None
Nut protein Not provided 6 Ready to use 75
Spike
Units Extraction Standards Standard curve Incubation (minutes) Control
As of May 2008, n/a, not available.
a
1.7 almond, 1.5 ppm hazelnut Whole nut 20x concentrate 5 Ready to use 30
Sandwich 48 19 þ 2.5–20
RIDASCREEN FAST Almond and hazelnut
R-Biopharm
0.1
BIOKITS Almond and hazelnut Sandwich 48 17 þ 1–20
Tepnel
None
Nut residue ? Accessory 5 Ready to use 30
Not stated
VERATOX Almond and hazelnut Sandwich 48 19 þ 2.5–25
Neogen
None
Nut protein Concentrate 4 Ready to use 30
0.5 ppm
ELISA Systems Almond and hazelnut Sandwich 48 20 þ 1–5
ELISA Systems
Specifications of Commercial Almond and Hazelnut Residue Testsa
LOD
ELISA Wells/plate Max. samples Quantitative Range (ppm) (LOQ)
Brand Kits
TABLE 20.12
None
n/a n/a n/a n/a n/a
n/a
DiagnoKit Almond and hazelnut Competitive 96
— Almond and hazelnut þ þ n/a þ n/a
None
Nut protein Provided 8 Dilute 90
þ 0.06–4 almond, 0.08–5 hazelnut, 0.15–10 peanut Not stated
Abkem
Ingenasa
396
NUT ALLERGEN DETECTION
All the assays use a common extraction protocol (Tables 20.13 and 20.14) with only minor changes for analyzing problematic samples, such as ice cream, chocolate, or samples that contain tannins. The Ridascreen FAST kit requires the addition of skimmed milk powder to the extract to guard against low recoveries. This should be performed with care to avoid cross-contamination. Chocolate is frequently analyzed for the presence of nuts, particularly peanut; therefore, reliable methods of extraction are required. The literature indicates that routine analysis is problematic due to low recoveries (Koch et al., 2003; Poms et al., 2003), which will result in lower sensitivity and the potential for false-negative reactions. Comparison of four commercial peanut assays by Hurst et al., (2002) found this to be the case, particularly with plain chocolate. Further, it concluded that the kits were suitable for qualitative screening of milk and dark chocolate samples, but in the range 0 to 200 ppm peanut, results were mixed. In the 10-ppm region the sample values reported ranged from >0 to <25 ppm. It asserted that the kits were not suitable for quantitative assays, although it also acknowledged that all the kits use different peanut standards, so that homogeneity of the sample cannot be guaranteed, which could account for some variability. The tannins (polyphenols) in some samples (e.g., plain chocolate) have the potential to interfere (e.g., bind) with an assay; therefore, the addition of 10% fish gelatine in some of the assays (e.g., BIOKITS, Ridascreen) is added to counter this effect. The performance of the different extraction buffers provided in these kits (BIOKITS, ELISA Systems, Pro-Lab Prolisa, Ridascreen, and Veratox) has been investigated by Poms et al. (2004). They concluded that the kit extraction procedures performed poorly for the extraction of (highly) processed proteins. It is therefore important that the kits are standardized and calibrated against protein extracts from relevant sources with a relevant processing history. Most of the kits are optimized for extraction from a wide variety of matrices as well as for the subsequent steps in ELISA, which performs better in the neutral pH range. They found that for peanut protein extraction efficiency the most significant factor appeared to be the pH, with buffers in the range pH 8 to 11 providing the best yields. Only one of the kits (Morinaga) includes a denaturing reagent in its overnight extraction procedure to improve yields of protein from processed foods (Watanabe et al., 2005). However, the use of 2-mercaptoethanol for extraction means that precautions for safe handling need to be implemented, due to its harmful and pungent properties. Procedures for swab samples are described with all kits except the Ridascreen kits. In the BIOKITS assays the swab extract is applied directly to the plate without further preparation, whereas with the ELISA Systems procedures they are treated as liquid samples and need to be heated. The Ridascreen, Veratox, and ELISA Systems kits can be completed in at least half the time of the other assays. This is achieved primarily through shorter incubation times (only 30 min total) and lower extraction dilutions (at least a fourfold difference from the others). The Veratox and ELISA Systems kits also use more test portion to extract from than the Ridascreen kit. This all means that more extracted protein can be applied to the ELISA plate to illicit a response, which is a prerequisite for a successful detection. The countereffect can be an increased potential for matrix interference or
397
1 : 100
30 þ 15 þ 15 þ 15 450 nm <120 min.
Extraction dilution Incubations
As of May 2008.
a
450 nm 60 min
10 þ 10 þ 10
5 g þ 50 mL buffer (60 C), shake for 15 min, centrifuge, dilute 1 : 10
Extraction
OD reading Total time
1 : 100 (1 : 20)
High-salt Tris buffer þ gelatin
Extraction buffer
RIDASCREEN (and FAST) 20 x concentrate, add 1g skimmed milk powder 1 g þ 20 mL buffer (60 C), shake For 10 min, centrifuge, dilute 1 : 5 (or no dilution option)
BIOKITS
Brand
R-Biopharm
650 nm 60 min
10 þ 10 þ 10
1 : 25
450 nm 60 min
10 þ 10 þ 10
Concentrate provided; additive option 5 g þ 50 mL buffer (60 C), homogenize, water bath shake for 15 min, centrifuge, supernatant used in assay 1 : 20
PBS (pH 7.2) þ extraction additive 5 g þ scoop extraction additive þ 125 mL buffer (60 C), shake for 15 min, centrifuge, supernatant used in assay
ELISA Systems
ELISA Systems
VERATOX
Neogen
Procedural Details for Peanut Residue Test Kits a
Tepnel
TABLE 20.13
450 nm >14.5 hours
Overnight extraction in buffer
b-mercaptoethanol þ SDS surfactant
Food Protein ELISA
Morinaga
650 nm 120 min
60 þ 20 þ 10
Tecra VIA
3M/Biotrace
398
As of May 2008.
a
1:100 30 þ 15 þ 15 þ 15 450 nm <120 min
5g þ 50mL buffer (60 C), shake for 15min, centrifuge, dilute 1:10
BIOKITS High-salt Tris buffer þ gelatin
Tepnel
1:20 10 þ 10 þ 10 450 nm 60 min
RIDASCREEN (and FAST) 20 x concentrate, for hazelnut add 1 g skimmed milk powder 1 g þ 20 mL buffer (60 C), shake for 10 min, centrifuge
R-Biopharm
Procedural Details for Hazelnut and Almond Residue Test Kitsa
Extraction dilution Incubations OD reading Total time
Extraction
Brand Extraction buffer
TABLE 20.14
ELISA Systems Concentrate provided; additive option 5 g þ 50 mL buffer (60 C), homogenize, water bath, shake for 15 min, centrifuge, supernatant used in assay 1:10 10 þ 10 þ 10 450 nm 60 min
PBS (pH 7.2) þ extraction additive 5 g þ scoop extraction additive þ 125mL buffer (60 C), shake for 15 min, centrifuge, supernatant used in assay 1:25 10 þ 10 þ 10 650 nm 60 min
ELISA Systems
VERATOX
Neogen
COMPARATIVE DIFFERENCES IN METHODOLOGIES
399
cross-reactivity being expressed. Such performance information should be provided in a kit’s validation report. 20.3.7
Performance of Laboratory Nut Assays
With reference to Tables 20.11 and 20.12, the BIOKITS Peanut Assay is the most sensitive assay based on its limit of quantification (LOQ) and limit of detection (LOD) (when the units of measurement are made equivalent); the Veratox kit is quicker to perform. However, the performance characteristics (specificity, calibration, matrix effects, LOD, LOQ, cross-reactivity, robustness) of any commercial kits are best assessed by both in-house and external validation and interlaboratory studies. The lack of agreement in these prerequisites and the availability of comprehensive information has led to initiatives by the European Committee on Standardisation (CEN, TC 275, Working Group 12) and by the AOAC Allergen Community in North America to develop guidance on the general considerations for validation and ring trials. There is an intense interest in such data: first, because the detection of trace mounts of nut proteins is very difficult or is masked by the food (Hischenhuber, 2001), and second, due to the continuing risk to nut allergic consumers of incorrectly labeled foods on the market. Following the mixed results from Hurst et al. (2002) comparison of four peanut kits described above, Poms et al. (2003) assessed three commercial peanut kits (BIOKITS, Ridascreen, and Veratox) and found that the tests kits were equally applicable for qualitative analysis but that there were significant differences with quantification. Most reproducible results were obtained in the concentration range 5 to 20 mg peanut material per gram of sample. The calibration curves of BIOKITS and Ridascreen showed a good linear fit (regression coefficient r2 > 0.98). The BIOKITS assay showed the greatest change in assay response for a given concentration change, with a steep slope to the standard curve indicating its greater sensitivity. The Ridascreen and Veratox test kits overreported the actual peanut content by 132 to 211% and 145 to 290%, respectively, for spiking levels of 1 and 10 mg/g. At both of these spiking levels the BIOKITS generated results with higher precision than those obtained with the other kits. In 1993, two external interlaboratory studies were conducted using commercially available peanut kits. In North America, three kits (BIOKITS, Ridascreen, and Veratox) were evaluated in three laboratories and the data submitted to the AOAC Research Institute (RI), and Performance Tested Method status was awarded to all three kits by May of that year (Park et al., 2005). In Europe, Poms et al. (2005) evaluated the performance of five test kits (BIOKITS, ELISA Systems, Prolisa, Ridascreen, and Veratox) to detect and quantify peanut residues in biscuit and dark chocolate at four concentrations (0, 2, 5, and 10 mg peanut/kg) using 31 laboratories in 14 countries. In the AOAC RI validation study, all peanut kits identified successfully 60 spiked (5 mg peanut/g sample) and 60 peanut-free samples (breakfast cereal, cookies, ice cream, and milk chocolate) with >95% sensitivity and >95% specificity, while BIOKITS showed 100%. To a panel of 32 potential cross-reactants, the BIOKITS and Veratox kits showed no cross-reactivity, while Ridascreen, which showed cross-reactivity to chickpeas, lima beans, and green peas at the 100% level. As a result of the study, Parks et al. (2005) recommended that at least two of the validated kits be used for testing of
400
NUT ALLERGEN DETECTION
TABLE 20.15
Method BIOKITS
ELISA Systems
Prolisa
RIDASCREEN
Veratox
Summary of Statistical Results a
Matrix
Average Recovery (%)
False Negative (%)
RSDrx (%)
RSDry (%)
RSDR (%)
Cookie Dark chocolate Cookie
118.0 116.2
1.9 0.0
3.7 4.5
32.1 16.5
37.7 26.5
108.2
6.9
8.7
72.2
72.2
Dark chocolate Cookie Dark chocolate Cookie Dark chocolate Cookie Dark chocolate
78.4
5.9
9.3
17.9
52.9
190.9 60.5
3.3 25.5
3.5 3.3
48.2 40.2
50.5 77.3
72.9 43.7
18.6 17.3
11.1 10.6
71.4 25.6
86.3 67.2
188.3 151.8
2.1 0.0
4.2 3.9
30.3 11.7
37.4 22.3
Source: Poms et al. (2004) a (Mean values accumulated for all concentrations and all participants per test kit and food matrix); RSDrx, variation of duplicate analysis of the same sample, same test kit, and analysis by the same laboratory; RSDry, variation of a duplicate analysis of blind duplicate samples employing the same test kit by the same laboratory.
FDA field samples to provide assurance that (at a 95% probability) a test sample contains peanut. The conclusions drawn from the European study was that both the type of peanut test kit and the matrix are important factors for recovery. All five kits performed well in the concentration range 5 to 10 mg peanut per gram of food rather than in the lower range from 2 or 2.5 mg/g. Recoveries rangedfrom 44to 191% across all concentrations(Table 20.15). The Veratox and BIOKITS ELISAs performed well even at concentrations below 5 mg peanut per gram, with reproducibility better with cookie than with plain chocolate. Whitaker et al. (2005) evaluated the performance of four commercial kits (BIOKITS, Prolisa, Ridascreen, and Veratox) to detect peanut protein in milk chocolate, ice cream, cookies, and breakfast cereals. Defatted peanut flour was added (0, 10, 20, and 100 mg whole peanut per gram) to the incurred samples (i.e., where the known amount of the peanut allergen has been incorporated into the sample during processing, mimicking as closely as possible the actual conditions under which the sample matrix would normally be manufactured) and water-soluble peanut (0, 5, 10, and 20 mg peanut protein per gram) to the spiked samples. The Veratox was assessed to provide the best accuracy, with the lowest percent difference between measured and incurred levels of 15.7% when averaged across all incurred levels and matrices. The Ridascreen kit had the best precision, with a coefficient of variation of 4.2% when averaged across all incurred levels and matrices.
COMPARATIVE DIFFERENCES IN METHODOLOGIES
401
Of the tree nuts, only the almond and hazelnut kits have been evaluated in independent studies. In December 2004 the Veratox Almond kit completed a full evaluation in seven laboratories that met the criteria for it to be added to Health Canada’s Compendium of Food Allergen Methodologies (Health Canada, 2004). Although this evaluation does not confer endorsement of the method, the consistent approach adopted means that the methods can be used for enforcement in Canada should it be required. The study required 630 samples to be analyzed by the laboratories; 10 replicates at each of three levels (0, 6.25, and 15.63 ppm) in cookies and in milk and plain chocolate. The kit produced satisfactory results for the matrices and at the levels tested. Analysis of plain chocolate produced the lowest recoveries, as expected, due to the presence of tannins and other phenolic compounds that interfere with the extraction of proteins. In September 2006, methods for detection of hazelnut contamination in chocolate were published in the official method collection according to the German food and feed law (LFGB, 2006). The Ridascreen FAST and ELISA Systems kits had been validated in an interlaboratory study of up to 14 laboratories testing plain chocolate at four levels (2, 5, 10, and 20 mg hazelnut per gram). Both kits produced acceptable results at levels down to 2 mg hazelnut per gram. This creates the option for the method to be submitted to CEN for consideration and inclusion in a standard to be drafted by Working Group 12. Proficiency testing for nut allergens have been organized by FAPAS in the UK since 2002 and by DLA in Germany more recently (e.g., peanut, hazelnut, and almond in chocolate). Both assist laboratories to compare their analytical performance (expressed as a z score, indicating their deviation from the assigned value) to other laboratories. Although the testing does not provide explicit information on method performance because laboratories are not restricted to their choice of method, the data are often presented from many laboratories, and when collated for a specific method can enable some conclusions as to method performance as well as analyst and laboratory performance. Although some laboratories will misinterpret the reporting units of the kit (e.g., eight labs incorrectly reported peanut protein for BIOKITS in FAPAS round 2741), one of the important differences between methods relates to the calibration. This is due to the absence of certified reference materials or even reference materials for nut detection. The peanut test material IRMM-481, which consists of six vials of defined peanut varieties and treatment, is not a reference material because it could not be tested for homogeneity and stability. The material is used alongside other commercially available materials, such as NIST 2387 for the calibration of kits (e.g., the BIOKITS peanut content standards are calibrated against NIST 2387). All kits should clearly express the units of calibration, and where it is expressed as the level of protein it should be clarified whether this is total protein or soluble protein and how the protein level was determined [e.g., Kjeldahl method for total protein (Holme and Peck, 1983) and Lowry method for soluble protein (Lowry et al., 1951)]. Inconsistencies are encountered with protein determination methods, so the method used should be noted; for example, Health Canada uses a bicinchoninic acid assay (BCA assay) with bovine serum albumin as a reference to determine the total level of protein in solution.
402
20.4
NUT ALLERGEN DETECTION
IMPLICATIONS FOR NUT-FREE MANUFACTURE
It is primarily up to the user of a commercial test kit to decide on the suitability of a method, although test kit manufacturers and service laboratories can assist with the assessment and validation process and provide valuable supporting information. Every factory is different, and validation of a method is vital for the unique context, processing, and samples. Nut-free manufacture cannot be guaranteed because the risk can never be reduced to zero; there has to be a tolerable threshold of risk. Where nut testing is used to validate and verify controls, it could be defined by the performance of the method. However, to determine a threshold accurately and precisely is difficult because of the variability associated with the analysis. Many of the studies discussed have shown significant differences when quantifying nut levels at low levels (mg/g). There are also as yet unquantifiable errors associated with sampling and sample preparation, variability that is likely to be significant given the distribution and particle size of nuts. Expert opinion from EFSA and the FDA has concluded that there is insufficient clinical evidence for the adoption of threshold levels. The threshold approach [e.g., Australia’s Allergen Bureau VITAL (2007) system] appears attractive for food manufacturer, as it allows them to assess the impact of cross-contact controls and provide appropriate precautionary labels. However, there is discussion that such thresholds, focused on finished products, are problematic given the known difficulties of allergen control and analysis. Interpreting results of analysis at these threshold limits would require better quantitative methods. Compatible approaches that first seek to improve allergen controls [e.g., cleaning validation (Jackson et al., 2008)] and evolve best practices are growing (e.g., UK Food Standards Agency Allergen Guidelines, BRC Global Standard v5, UK Anaphylaxis Campaign Food Manufacturing Standard).
20.5
CONCLUSIONS
Given the importance of demonstrating the effectiveness of manufacturers’ nut allergen controls, in order to provide more reliable nut allergen labeling information, the interest in on-site methods has grown in recent years. They are affordable for routine use and offer comparable sensitivity to ELISAs provided that validation is performed to determine the actual level of detection in each unprocessed and processed matrix tested. Additional on-site methods are needed for all the major tree nuts (almond, brazil nut, cashew, hazelnut/filbert, macadamia, pecan, pine nut, pistachio, and walnut) either as single tests or for multiple nut screening. The necessity to verify critical cleaning practices will also require more sensitive and convenient swabbing techniques for on-site control. Similarly, more immunological laboratory methods are needed for detection of these tree nuts, with interlaboratory studies performed to demonstrate both their fitness for a purpose and any unwanted interferences. The studies should have a common approach, because without the availability of CRMs, universally available calibrants are required for standardization of the kits. Better quantitative methods are required as much for
REFERENCES
403
enforcement as for factory control. This may mean that better stewardship of new methods (e.g., adopting a method criteria approach) is required to ensure their reliability. It is expected that research projects (e.g., EuroPreval) on characterizing food allergens and understanding their effects during food processing will aid the selection of suitable antibodies with different affinities to provide new methods. Where all these methodologies can be improved further is through making sampling/sample preparation an integral part of nut allergen analysis, with new confirmatory techniques for nut proteins being employed (e.g., mass spectrometry). Useful Links Abkem Iberia Biotrace/3M ELISA Systems Incura Ingenasa Morinaga Neogen Nippon Pro-Lab Diagnostics R-Biopharm Tepnel
www.abkemiberia.com www.biotrace.co.uk www.elisasystems.com www.incura.it www.ingenasa.eu www.miobs.com www.neogen.com www.rdc.nipponham.co.jp www.pro-lab.com www.r-biopharm.com www.tepnel.com
REFERENCES Allergen Bureau VITAL (2007). Voluntary incidental trace allergen labelling system. http:// www.allergenbureau.net/allergen-guide/vital/ (accessed May 3, 2008). Blais BW, Gaudreault M, Phillippe LM (2003). Multiplex enzyme immunoassay system for the simultaneous detection of multiple allergens in foods. Food Control, 14:43–47. Burks W (2008). Food Allergy Review, Chap. 1, p.12. http://www.hesiglobal.org/NR/rdonlyres/ 57053467-A7CE-4E8F-9E47-646ECB813A93/0/Chapter1FoodAllergyOver.pdf (accessed May 3, 2008). CCFRA (2008). Allergens: control in food processing and catering environments. Project 97606 (Jan.–Dec. 2008). http://campden.co.uk/research/fdsdef.htm#fds6 (accessed June 14, 2008). Charm Sciences (2008). IFT 2006 presentation. http://www.charm.com (accessed May 12, 2008). Cong Y-J, Lou F, Li F-I (2008). Identification and quantitation of major peanut allergens (in China) with Ig-E binding property. J. Food Biochem., 32:353–367. Crespo JF, James JM, Fernandez-Rodriguez C, Rodriguez J (2006). Food allergy: nuts and tree nuts. Br. J. Nutri, 96(suppl 2):S95–S102. Diamandis E, Christopoulos T (1996). Immunoassay. Academic Press, London. EC (European Commission) (2007). Directive 2007/68/EC. http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri¼OJ:L:2007:310:0011:0014:EN:PDF accessed May 12, 2008.
404
NUT ALLERGEN DETECTION
FALCPA (Food Allergen labeling Consumer Protection Act) (2004). Questions and Answers, 4th ed. http://www.cfsan.fda.gov/ dms/alrguid4.html (accessed May 12, 2008). Grundy J, Matthews S, Bateman B, Dean T, Arshad SH (2002). Rising prevalence of allergy to peanut in children: Data from 2 sequential cohorts. J. Allergy Clin. Immunol., 110(5):784–789. Health Canada (2004). Compendium of Food Allergen Methodologies. Neogen Veratox for Almond Kit: performance evaluation. http://www.hc-sc.gc.ca/fn-an/res-rech/analy-meth/ allergen/index-eng.php (accessed May 12, 2008). Hefle SL, Bush RK, Yunginger JW, Chu FS (1994). A sandwich enzyme-linked immunosorbent assay (ELISA) for the quantification of selected peanut proteins in foods. J. Food. Prot., 57 (suppl.):419–423. Hischenhuber C (2001). Analytical methods for the detection of hidden allergens: their use and limitations. Proceedings of the International Workshop on Food Allergy: Chemical and Technological Aspects Ispra, Italy, Nov. 6–8, 2001. EUR 20241 EN. Holme DJ, Peck H (1983). Analytical Biochemistry. Longman Group, London, pp. 391–392. Hurst WJ, Krout ER, Burks WR (2002). A comparison of commercially available peanut ELISA test kits on the analysis of samples of dark and milk chocolate. J. Immunoassay Immunochem., 23(4):451–459. IRMM (Institute for Reference Materials and Measurement) (2002). Activity report, p.17. http:// irmm.jrc.eu.europa.eu/html/publications/promotional_material/documents/irmm2002.pdf (accessed June 14, 2008). Jackson LS, Al-Taher FM, Moorman M, et al. (2008). Cleaning and other control and validation strategies to prevent allergen cross-contact in food processing operations. J. Food Prot., 71 (2):445–458. Koch P, Schappi GF, Poms RE, W€uthrich B, Anklam E, Battaglia R (2003). Comparison of commercially available ELISA kits with human sera based detection methods for peanut allergens in foods. Food Addit. Contam., 20(9):797–803. LFGB (Lebensmittel und Futtermittel Gesetz Buch) (2006). Bestimmung von HaselnussKontaminationen in Schokolade und Schokoladenwaren mittels ELISA im Mikrotiterplattensystem. Method L 44.00-7. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951). Protein measurement with the Folin phenol reagent. J. Biol. Chem., 193:265–275. Mills ENC, Potts A, Plumb GW, Lambert N, Morgan MRA (1997). Development of a rapid dipstick immunoassay for the detection of peanut contamination of food. Food Agric. Immunol., 9:37–50. Mintel International Group Ltd. (2003) Food Labeling Report, published May 1, 2003. Nippon (2008). FASTKIT Immunochromato PEANUT Instruction Manual. http://www.cosmobio.co.jp (accessed May 3, 2008). Park DL, Coates S, Brewer VA, et al. (2005). Performance tested method multiple laboratory validation study of ELISA-based assays for the detection of peanuts in food. J. AOAC Int., 88:(1):156–160. Pele M, Brohee M, Anklam E, van Henkel AJ (2007). Peanut and hazelnut traces in cookies and chocolates: relationship between analytical results and declaration of food allergens on product labels. Food Addit. Contam., 24:1334–1344. Poms RE, Lisi C, Summa C, Stroka J, Anklam E (2003). In-house validation of commercially available ELISA kits for peanut allergens in foods. Report for the Institute of Reference Materials and Measurement, Joint Research Centre, European Commission. EUR 20767 EN.
APPENDIX: FALCPA TREE NUTS DEFINITION
405
Poms RE, Agazzi ME, Bau A, et al. (2004). Inter-laboratory validation of five commercial ELISA test kits for the determination of peanut proteins in biscuits and dark chocolate. Food Addit. Contam., 22:(2):104–112. Poms RE, Agazzi ME, Bau A, et al. (2005). Inter-laboratory validation of five commercial ELISA test kits for the determination of peanut proteins in biscuits and dark chocolate. Food Addit. Contam., 22(2):104–112. Rejeb SB, Abbott M, Davies D, et al. (2002). Immunochemical-based method for detection of hazelnut proteins in processed foods. J. AOAC Int., 86(3):557–563. Rejeb SB, Abbott M, Davies D, Cleroux C, Delahaut P (2005). Multi-allergen screening immunoassay for the detection of protein markers of peanut and four tree nuts in chocolate. Food Addit. Contam., 22(8):709–715. Sampson H (2002). Peanut allergy. N. Engl. J. Med., 346:1294–1299. Sicherer SH, Munoz-Furlong A, Burks AW, Sampson HA (1999). Prevalence of peanut and tree nut allergy in the US determined by a random digit dial telephone survey. J. Allergy Clin. Immunol., 103:559–562. Staniforth J (2006). Assessing food sector product recalls. Int. Food Hyg., 17(6):5–6. Stephan O, Moller N, Lehmann S, Holzhauser T, Vieths S (2002). Development and validation of two dipstick type immunoassays for determination of trace amounts of peanut and hazelnut in processed foods. Eur. Food Res. Technol., 215:431–436. van Hengel A, Capelleti C, Brohee M, Anklam E (2006). Validation of two commercial lateral flow devices for the detection of peanut proteins in cookies: interlaboratory study. J. AOAC Int., 89(2):462–468. Vierk K, Falci K, Wolyniak C, Klonz K (2002). Recalls of foods containing undeclared food allergens reported to the US Food and Drug Administration, fiscal year 1999. J. Allergy Clin. Immunol., 9(6):1022–1026. Watanabe Y, Aburatani K, Mizumura T, et al. (2005). Novel ELISA for the detection of raw and processed egg using extraction buffer containing a surfactant and a reducing agent. J. Immunol. Methods, 300:115–123. Wen H-W, Borejsza-Wysocki W, DeCory TR, Durst RA (2007). Peanut allergy, peanut allergens, and methods for detection of peanut contamination in food products. Compr. Rev. Food Sci. Technol., 6:47–58. Whitaker TB, Williams KM, Truckess MW, Slate AB (2005). Immunochemical analytical methods for the determination of peanut proteins in foods. J. AOAC Int., 88(1):161–174. Yeung JM (2008). Tree nuts: What are they? Presented at the Fifth Workshop on Food Allergen Methodologies, Halifax, Nova Scotia, Canada, May 11–14. Yeung JM, Collins PG (1996). Enzyme immunoassay for determination of peanut proteins in food products. J. AOAC Int., 79(6):1411–1416.
APPENDIX: FALCPA TREE NUTS DEFINITION From www.cfsan.fda.gov/~dms/alrguid4.html: [Added October 2006] Section 201(qq) of the Act defines the term “major food allergen” to include “tree nuts.” In addition to the three examples provided in section 201(qq) (almonds, pecans, and walnuts), what nuts are considered “tree nuts”?
406
NUT ALLERGEN DETECTION
The following are considered tree nuts for purposes of Section 201(qq). The name listed as the common or usual name should be used to declare the specific type of nut as required by Section 403(w)(2). Common or Usual Name
Scientific Name
Almond Beech nut Brazil nut
Prunus dulcis (Rosaceae) Fagus spp. (Fagaceae) Bertholletia excelsa (Lecythidaceae) Juglans cinerea (Juglandaceae) Anacardium occidentale (Anacardiaceae) Castanea spp. (Fagaceae)
Butternut Cashew Chestnut (Chinese, American, European, Seguin) Chinquapin Coconut Filbert/hazelnut Ginko nut Hickory nut Lichee nut Macadamia nut/bush nut Pecan Pine nut/Piñon nut Pili nut Pistachio Sheanut Walnut (English, Persian, Black, Japanese, California), heartnut, butternut
Castanea pumila (Fagaceae) Cocos nucifera L.(Arecaceae (alt. Palmae)) Corylus spp. (Betulaceae) Ginkgo biloba L. (Ginkgoaceae) Carya spp. (Juglandaceae) Litchi chinensis Sonn. Sapindaceae Macadamia spp. (Proteaceae) Carya illinoensis (Juglandaceae) Pinus spp. (Pineaceae) Canarium ovatum Engl. in A. DC. (Burseraceae) Pistacia vera L. (Anacardiaceae) Vitellaria paradoxa C.F. Gaertn. (Sapotaceae) Juglans spp. (Juglandaceae)
The foregoing list reflects FDA’s current best judgment as to those nuts that are tree nuts within the meaning of Section 201(qq). To be comprehensive this list employs broad scientific categories that may include a species that currently has no food use. The fact that a species falls within a scientific category on this list does not mean that the species is appropriate for food use. FDA further advises that as with any guidance, the list may be revised consistent with the process for revising guidance documents in our regulation on good guidance practices in 21 CFR 10.115.
CHAPTER 21
Fish Allergen Detection CHRISTIANE KRUSE FÆSTE National Veterinary Institute, Oslo, Norway
21.1
INTRODUCTION
Allergy to fish has been described as early as 1921 in a classical study in the history of allergology (Prausnitz and K€ ustner, 1921). In an experiment on themselves, the authors discovered the principle of passive transfer of local sensitivity. Injecting serum of the fish-allergic K€ ustner into the skin of the nonallergic Prausnitz elicited a specific positive skin test for fish at the test site. Besides the discovery of a serum factor called Reagin, which in 1967 was identified as immunoglobulin E (IgE), this study already elucidated the influence of food processing on protein allergenicity, as the allergic reaction could be provoked only by extracts of cooked codfish. Taking this experiment as a starting point, several aspects of fish allergy and the immunochemical detection of fish allergens are discussed in this chapter.
21.2
FISH CONSUMPTION
Fish has always been an important source of dietary protein, and it is a main component of the human diet, especially in coastal areas. Edible fish include more than 20,000 species (O’Neil et al., 1993), although the most commonly consumed species belong to only a few orders of the ray-finned fish (Actinopterygii) (Table 21.1). As transport by unbroken cold chain has become routine and the demand for lean food increases, the fish consumption pattern has become less dependent on geographical location. The world average fish consumption per year per capita has been increasing during recent decades up to 16 kg. Further overall growth is expected if the demand for fish increases in countries which at present have low fish consumption (Josupeit, 1996; FAO, 2004).
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
407
408
FISH ALLERGEN DETECTION
TABLE 21.1 Family Tree and Typical Orders of Edible Fish Species Chordata (chordates) Vertebrata (vertebrates) Amphibia (frogs, toads) Aves (birds) Chondichthyes (sharks, rays) Mammalia (mammals) Reptilia (snakes, lizards, alligartors, turtles) Osteichthyes (bony fish) Sarcopterygii (lobe-finned fish) Actinopterygii (ray-finned fish) (43 orders) Anguilliformes (eel) Clupeiformes (herring, anchovy) Cypriniformes (carp, catfish) Escociformes (pike) Gadiformes (cod, pollach, hake) Perciformes (mackerel, perch, snapper, tuna) Pleuronectiformes (flounder) Salmoniformes (salmon, trout) Scarpaeniformes (rock fish) Siluriformes (catfish) Zeiformes (dories)
To meet consumer demands, the fish industry has been expanding through the proliferation of fish farms and the fish processing industry. A large share of fish is now consumed no longer as an entity, but fish and its derivatives are also used as ingredients in processed foods and dietary supplements such as fish gelatine, fish oil, and omega-3 fatty acids. However, consumption data vary considerably between regions, depending on local conditions and eating habits. Whereas the consumption of seafood per capita in 2003 was 160 kg in the Maldives, 91 kg in Island, 75 kg in Japan, 59 kg in Portugal, and 51 kg in Norway, the intake was about 21 kg in the United States, 16 kg in Germany, 5 kg in China, and only 4 kg in Hungary (Laurenti, 2007). 21.3
PREVALENCE OF FISH ALLERGY
The prevalence of fish allergy is commonly thought to be linked to increased fish consumption, although it seems to be affected by other factors. In industrialised countries, a general increase in the number of people with fish hypersensitivity has been reported, and allergy to fish is among the four foods that are most commonly causes of severe food anaphylaxis (Boyano Martinez et al., 1987; Sampson, 2000). In general, the prevalence of food allergy is about 6% in children and 4% in adults in Western countries (Bock, 1987; Kanny et al., 2001; Sampson, 2005) and the prevalence of fish allergy is estimated as 0.1 and 0.3%, respectively, according to Swedish (Bj€ ornsson et al., 1996) and Danish (Mortz et al., 2003) studies. In the United States,
THRESHOLD DOSES
409
0.4% of the total population are affected by fish allergy (Sicherer et al., 2004; Taylor et al., 2004a), thus constituting one of the most important causes of food hypersensitivity in adult Americans (Wild and Lehrer, 2005). Fish allergy is often manifested in small children (Pascual et al., 1992) and tends to be persistent into adulthood. Unlike fish allergy, other food allergies, such as egg and milk, with similar early onset are typically outgrown because of tolerance development (Kajosaari, 1982; Hill et al., 1989; Eigenmann et al., 1998). Between 2.3 and 39% of children and adults allergic to food have been diagnosed with fish allergy, depending on the different study cohorts (Aas, 1966; Dannaeus and Ingañas, 1981; Bock and Atkins, 1990; Crespo et al., 1992; De Martino et al., 1993; Andre et al., 1994; Moneret-Vautrin and Kanny, 1995; Novembre et al., 1998; Rance et al., 1999; Lopata and Jeebhay, 2001; Rance and Dutau, 2002).
21.4
SYMPTOMS OF FISH ALLERGY
Symptoms associated with fish allergy range from urticaria, oral allergy syndrome, and abdominal cramps to nausea, chest tightness, and asthma (Bock and Atkins, 1990; De Martino et al., 1990; Helbing et al., 1999; Sicherer et al., 2000). Additionally, there are a considerable number of reports about anaphylaxis caused by fish ingestion (Yunginger et al., 1988; Sampson et al., 1992; Eigenmann and Calza, 2000; Bock et al., 2001).
21.5
ROUTES OF EXPOSURE
Route of exposure appears to determine whether food allergy or respiratory allergy to fish develops. In food allergy, presumably induced by fish allergen in the food, fish allergen in food will cause food allergy symptoms. However, if fish allergen is inhaled (e.g., in the vapor from boiling fish or in the air at a fish market), symptoms of asthma and even generalized anaphylactic symptoms may develop (Crespo et al., 1995; Taylor et al., 2000). In fish-processing workplaces, occupational exposure to fish allergens can induce the typical IgE-mediated hypersensitive systemic, cutaneous, gastrointestinal, and respiratory reactions (Douglas et al., 1995; Rodrıguez et al., 1997; Sicherer et al., 2000; Lopata et al., 2005).
21.6
THRESHOLD DOSES
A few oral food challenge studies has been performed to determine threshold doses for the onset of immunologic reactions after the ingestion of fish. Although examining different patient cohorts and using different fish species for the food provocation tests (Hansen and Bindslev-Jensen, 1992; Helbing et al., 1999; Sicherer et al., 2000; Rance and Dutau, 1998; Bock et al., 2001; Moneret-Vautrin, 2002). A few milligrams of fish can be sufficient to provoke allergic reactions in persons with fish hypersensitivity. The minimum amounts needed to elicit symptoms were in the range 5 mg to 6000 mg fish
410
FISH ALLERGEN DETECTION
(Taylor et al., 2002). Since the doses relate to the total fish and not to fish protein, the threshold doses given in milligrams of protein are even lower. Considering that fish have total protein contents of 15 to 25%, the lowest observed adverse effect level values published are estimated to range from approximately 1 to 100 mg protein (FDA, 2005).
21.7
LEGISLATION
Because of the seriousness of fish allergy and the risk that undeclared fish ingredients may pose to sensitive consumers, regulatory authorities in many countries have implemented legislation that mandates the labeling of allergenic foods and products thereof when they are used as ingredients. This includes all fish species in any form or state of food processing (e.g., boiled, fried, dried, salted, fermented or raw, and products such as fish oils, gelatine, or hydrosylates). However, the exception of highly purified and degraded products from these regulations is momentarily under examination. According to European Commission (EC) Directive 2007/68/EC amending Annex IIIa to Directive 2000/13/EC, some fish-derived products have been granted permanent exemption from labeling, including fish gelatine used as a carrier for vitamins or carotenoid preparations, and gelatine or isinglass used as a fining agent in beer and wine (EC, 2007). Studies on the residual allergenicity of fish derivatives are much in need in risk assessment programs, which are used to support regulatory activities. It has been shown that in vitro studies using gelatine derived from the skin of various fish species bound to specific IgE in the sera of fish-allergic patients (Sakaguchi et al., 1999). However, the clinical relevance of these findings is uncertain because in double-blind placebo-controlled food challenges (DBPCFCs) involving 30 subjects, none reacted after the ingestion of up 3.61 g fish gelatine (Hansen et al., 2004). See Chapter 14 for additional information on the current international regulatory status regarding the labeling of fish and their products.
21.8
FISH ALLERGENS
Three of the eight major food allergens defined by Codex are collective allergens. They include fish, crustacean shellfish, and tree nuts, which are food groups containing two or more species. In the case of fish and shellfish, collective allergens are characterized by containing a common allergenic protein sharing a high degree of homology across the different species of the group. In fish, the major allergen is parvalbumin, a 12-kDa protein containing 108 to 109 amino acid residues (Figure 21.1). Parvalbumin is an abundant fish protein and one of the first food allergens that has been isolated, crystallized, and characterized at a molecular level (Aas, 1967; Aas and Jebsen, 1967; Coffee and Bradshaw, 1973; Elsayed and Bennich, 1975). The first fully characterized fish parvalbumin, Gad c 1 (previously named Allergen M) was isolated from Baltic cod (Gadus callarias, Aas and Elsayed, 1975; Elsayed and Apold, 1983). This sarcoplasmatic muscle protein is
FISH ALLERGENS
411
FIGURE 21.1 Coomassie blue–stained SDS-PAGE gel of purified parvalbumin from Atlantic cod (Gadus morhua). (From Fæste and Plassen, 2008.)
well-conserved, water-soluble, and resistant to heat, denaturing agents, and extreme pH (Bugajska-Schretter et al., 2000; Untersmayr et al., 2007). It has an isoelectic point (pI) of 4, and its tertiary structure contains three helix–loop–helix (EF hand) structural domains, with two high-affinity calcium ion–binding sites in the loop regions (Valenta et al., 1998). Parvalbumins are Ca2þ -binding proteins involved in muscle relaxation. Studies indicate that if bound calcium is removed, the allergenicity of the protein diminishes (Bugajska-Schretter et al., 1998; Swoboda et al., 2002). Parvalbumins are abundant in the fast skeletal muscles of lower vertebrates such as fish and frog (Wilwert et al., 2006). The content can be as high as 2 g/kg fish muscle (Kobayashi et al., 2006). Only fish and frog parvalbumins are confirmed allergens, belonging phylogenetically to the b-lineage of the protein family, which can be divided into two evolutionarily distinct subfamilies. In contrast, the parvalbumins in the fast twitch muscle of higher vertebrates are of a-lineage and apparently nonallergenic (Blum et al., 1977; Elsayed, 2002; Hilger et al., 2004). Fish parvalbumins are considered to be the major and sole allergens for 95% of patients suffering from IgE-mediated fish allergy (Swoboda et al., 2002). The protein contains at least five IgE binding linear and conformational epitopes (Elsayed and Apold, 1983; Untersmayr et al., 2006). They may not be of equal importance and could provoke reactions of varying severity in allergic patients. Parvalbumins from more than 40 different fish species have been identified and molecularly characterized until now, some of which are used commercially, such as Altantic cod (Gadus morhua, Gad c 1), Atlantic herring (Clupea harengus, Clu h 1), salmon (Salmo salar, Sal s 1), carp (Cyprinus carpio, Cyp c 1), Atlantic mackerel (Scomber scombrus, Sco S 1), and tilapia (Oreochromis mossambicus, Ore m 1) (Das Dores et al., 2002; Van Do et al., 2005b; Lindstrøm et al., 1996; Bugajska-Schretter
412
FISH ALLERGEN DETECTION
TABLE 21.2 Parvalbumins from Various Fish Species That Have Been Identified as Allergens and Characterized Molecularly Parvalbumin a
Scientific Name
Fish Species
Ana l 1 Ang a 1 Ang j 1 Clu h 1 Cyp c 1 Dan r 1 Gad c 1 Gad m 1 Hip h 1 Ict p 1 Kat p 1 Lep i 1 Ore a 1 Ore m 1 Pag m 1 Pam c 1 Par ol 1 Pla f 1 Sal s 1 Sar m 1 Sco a 1 Sco g 1 Sco j 1 Sco s 1 Ser q 1 Sti l 1 Sto i 1 The c 1 Thu a 1 Thu o 1 Thu t 1 Tra j 1
Anarhichas lupus Anguilla anguilla Anguilla japonica Clupea harengus Cyprinus carpio Danio rerio Gadus callarias Gadus morhua Hippoglossus hippoglossus Ictalurus punctatus Katsuwonus pelamis Leptomelanosoma indicum Oreochromis aurea Oreochromis mossambicus Pagrus major Pampus chinensis Paralichthys olivaceus Platichthys flesus Salmo salar Sardinops melanostictus Scomber australasicus Scomberomorus guttatus Scomber japonicus Scomber scombrus Seriola quinqueraradiata Stizostedion lucioperca Stolephorus indicus Theragra chalcogramma Thunnus albacares Thunnus obesus Thunnus thynnus Trachurus japonicus
Atlantic wolffish Atlantic eel Japanese eel Atlantic herring Carp Zebrafish Baltic cod Atlantic cod Hallibut Channel catfish Bonito Indian salmon Blue tilapia Mosambique tilapia Red seabream Chinese pomfret Japanese flounder European flounder Atlantic salmon Japanese sardine Blue mackerel Spotted Spanish mackerel Chub mackerel Atlantic mackerel Buri Perch Indian anchovy Alaska pollock Yellowfin tuna Bigeye tuna Tuna Horse mackerel
a Parvalbumins are named according to the International Union of Immunological Societies allergen nomenclature.
et al., 2000; Hamada et al., 2003; Lee et al., 2006). Parvalbumin isofoms from a number of fish species [e.g., carp and zebrafish (Danio rerio)] have been identified (Friedberg et al., 2005) (Table 21.2). In addition to parvalbumin, more than 15 other minor fish allergens, with molecular weights ranging from 15 to 200 kDa, have also been identified (Aukrust, 1978; Dory et al., 1998; Hansen et al., 1996; Galland et al., 1998; Besler et al., 2000; Das Dores et al., 2002; Das et al., 2005; Rosmilah et al., 2005). These proteins elicit allergic reactions in only a few people. Some of these proteins seem to be species-specific
FISH ALLERGENS
413
FIGURE 21.2 Coomassie blue–stained SDS-PAGE gel of total extract from Atlantic cod (Gadus morhua) in (A) raw extract and (B) precipitate obtained by cooking. Multiple proteins in the range 12 kDa (parvalbumin) to 65 kDa. (From Fæste and Plassen, 2008.)
allergens, such as those found in swordfish, tuna, trout, pollock, and codfish (Kelso et al., 1996; Mata et al., 1994; Galland et al., 1998; Yamada et al., 1999) (Figure 21.2). Type 1 collagen prepared from the muscle of big-eye tuna (Thunnus obesus) showed IgE binding in several Japanese patients allergic to fish (Hamada et al., 2001). Collagen is an abundant protein found in animal connective tissue. Native collagen is formed by three polypeptides which are used to produce gelatine by hydrolysis of collagen. Like parvalbumin, the heat-stable native collagen might cause crossallergenicity among different fish species (Sakaguchi, 2000). Gelatine prepared from fish skin could contain proteins from remaining adherent muscle tissue, although this could not be demonstrated in one study examining the skin raw material (Taylor and Hefle, 2000). Allergenicity to gelatine prepared from cod, salmon, and tuna has been demonstrated (Sakaguchi et al., 1999; Andre et al., 2003). Isinglass is obtained from the swimbladder of certain tropical fish and consists mainly of collagen. Isinglass has the ability to bind proteins in solution, so that they can be further removed from liquids by sedimentation. It has been used for more than 100 years in the beverage industry to clarify alcoholic beverages (Hickman et al., 2000). To date, allergic reactions to isinglass have not been reported. Reports on the allergenicity of fish roe are rare. In a singular study involving Russian Beluga caviar from sturgeon, a patient showed anaphylaxis to roe only but was SPT-negative to fish meat (Untersmayr et al., 2002). A relatively new product derived from fish is made from ice-structuring proteins that occur in fish living in Arctic waters. These proteins protect fish living in cold waters against freezing damages. The ice-structuring proteins are of interest for a number of applications in the food industry because of their ability to modify the conditions for ice formation. To date,
414
FISH ALLERGEN DETECTION
no allergic reactions have been reported (Baderschneider et al., 2002; Bindslev-Jensen et al., 2003).
21.9
CROSS-REACTIVITY
Fish-sensitive patients are often allergic to multiple species of fish. Extensive immunological and clinical cross-reactivity have been reported in several studies. Parvalbumin has been identified as the major fish allergen, and the cross-reactivity shown between fish results from the high degree of homology among parvalbumins across different fish species (Bernhiesel-Broadbent et al., 1992a; Van Do et al., 2005a). People allergic to one type of fish cannot, in many cases, eat other fish (Poulsen et al., 2001). To prevent allergic reactions to fish, physicians recommend that their patients avoid any type of fish as a general management strategy for fish allergy (Hansen et al., 1997). Over 80% cross-reactivity has been shown by serological and skin-prick test studies (Bernhiesel-Broadbent et al., 1992a; Pascual et al., 1992; Hamada et al., 2003), whereas clinical cross-allergy was found to be lower, about 50 to 70% (De Martino et al., 1990; Helbing et al., 1999; Torres Borrego et al., 2003). All species of fish are believed to be allergenic, but allergenic reactions are most frequently caused by cod and salmon (Taylor et al., 2004a). Some authors speculate that scombrids (Scombridae), including tuna (Thunnus sp.), might be more tolerable than other species (Pascual et al., 1992).
21.10
EFFECTS OF FOOD PROCESSING
Food-processing procedures such as boiling, drying, fermenting, and canning can alter the antigenicity and allergenicity of fish allergens (Yamada et al., 1999; Kjærsgard et al., 2006; Chatterjee et al., 2006). However, the major fish allergen parvalbumin from cod remained allergenic even after heating at 100 C, digestion with proteolytic enzymes, or chemical denaturation (Elsayed and Aas, 1971; Untersmayr et al., 2007). Bigeye tuna collagen was found to be very thermostable and to retain its allergenicity. Even when it was denatured to gelatine in a boiling-water bath, about 90% of the original IgE-binding activity could still be measured (Hamada et al., 2001). Allergenicity was not eliminated from 10 boiled fish species in a study evaluating clinical reactivity by DBPCFC (Bernhiesel-Broadbent et al., 1992a). In contrast, canning appeared to reduce allergenic reactions to tuna and salmon (Bernhiesel-Broadbent et al., 1992b). Manufacturing of canned products includes cooking for up to 14 h, which might explain the difference observed in allergenicity. Almost a 99% reduction in IgE binding on immunoblots could be observed (Besler et al., 2001). Surimi, a crab meat– imitate made from minced fish meat retains most of its allergenicity after processing, which involves a brief low-temperature heating step (Helbing et al., 1992; Mata et al., 1994; Musmand et al., 1996). Fish species that are generally not used for other products may be used in surimi (Venugopal and Shahidi, 1995).
ANALYTICAL METHODS FOR THE DETECTION OF FISH IN FOODS
415
Several studies suggest that processing might induce alterations to existing proteins and lead to the formation of neoallergens in certain foods, increasing their allergenicity toward susceptible persons (Pascual et al., 1996; Maleki and Hurlburt, 2004). Fish allergens are not only heat-resistant, their allergenicity may also be enhanced by thermal processing. In the aforementioned Prausnitz–K€ustner experiment, K€ustner could not eat cooked fish without experiencing allergic symptoms such as itching, skin swelling, coughing, sneezing, and vomiting, which took about 12 h to settle down. In contrast, he tolerated raw fish well.
21.11 ANALYTICAL METHODS FOR THE DETECTION OF FISH IN FOODS Avoidance of fish-containing foods is the only measure to prevent allergic reactions. During food manufacturing and meal preparation, great care is required to avoid crosscontamination. Analytical methods for the detection of fish in foods are necessary to monitor hygiene practices and to ensure compliance with legislation (Poms et al., 2004). A number of different techniques for the identification of parvalbumin by chromatography, isoelectric focussing, or mass spectrometry have been developed (Ross et al., 1998; Etienne et al., 2000; Carrera et al., 2006). An IgE-based radioimmunoassay using pooled human serum from fish-allergic patients was established for the determination of raw fish aeroallergens (Taylor et al., 2000). The use of assays using IgE for the detection of allergens in foods is limited and not very common because of the availability of serum and differences in individual antigen-binding profiles, which influence the analytical results. The antigenicity of a protein is not necessarily like its allergenicity; however, IgG-antibodies are useful to develop immunoassays for the detection of food allergens. Polyclonal antibodies against canned pilchard and fresh anchovy were produced to develop an inhibition enzyme-linked immunosorbent assay (ELISA) for the detection of aerosolized fish antigens (Lopata et al., 2005). The assay sensitivity was 0.5 mg/mL in phosphate-buffered saline/0.05% Tween-20 extracts of environmental air samples correlating to a 105-ng/m3 aerosol concentration. Furthermore, two-dimensional electrophoretic and immunoblotting techniques were used successfully to investigate the utility of a commercial monoclonal anti-frog parvalbumin IgG for detecting parvalbumin present in some commonly consumed fish species (Chen et al., 2006). However, no specific immunological assay for the quantitation of fish protein in food has been available until recently, when a novel sandwich ELISA for the quantitative determination of fish has been reported that uses a polyclonal rabbit anti-cod parvalbumin antibody for capture and detection (Fæste and Plassen, 2008). Recoveries ranged between 68 and 138% in typical food matrices such as soup, sauce, and bread, and the detection limit was at about 5 mg of fish per kilogram of food, which seems to be low enough to protect most fish-allergic consumers. Calcium ions had a considerable influence on the assay performance, which can be expected for a calciumbinding protein (Erickson and Moerland, 2006). Calcium depletion led to a strong loss of sensitivity, probably due to protein conformational shifts and therefore affecting the
416
FISH ALLERGEN DETECTION
antibody–antigen binding (Bugajska-Schretter et al., 1998; Swoboda et al., 2002). By increasing calcium ion concentration to a nonphysiological level, the antigen–antibody binding curve of the ELISA became steeper. This indicates that further optimization of the concentration of Ca2 þ in the extraction buffer might be required to provide an optimized working range. Validation results showed that the method is specific for fish and does not cross-react with parvalbumin from other vertebrates. However, it crossreacts with a variety of fish species at different degrees, ranging from <1% (anchovy and yellowfin tuna) up to 100% (cod, saithe, and Mozambique tilapia). Therefore, further development of the method into an assay with improved sensitivity for a greater number of fish would be desirable. A few manufacturers of commercially available food analysis assays offer services for species determination and qualitative measurement of fish in foods by polymerase chain reaction (PCR)-based methods using the presence of specific fish DNA for detection.
21.12
CONCLUSIONS
Fish is an important part of human nutrition and at the same time, one of the most frequent causes for severe food-allergic reactions. Therefore, food supply and food safety with regard to fish are actual issues, and ongoing research will advance understanding of the challenges implicated. Analytical methods for the detection of fish proteins in foods are needed to monitor production hygiene and to allow the enforcement of legislation. Until now, only one quantitative immunochemical method has been published, and commercial test kits for fish are not available. Fish-allergic patients take great care to avoid fish products consistently, and fish is relatively easy to notice. However, with the development of more complex and higher-processed food products, the probability to consume fish involuntarily will increase. Therefore, it is desirable that further quantitative assays covering a wide spectrum of fish species will be developed.
REFERENCES Aas K (1966). Studies of hypersensitivity to fish: a clinical study. Int. Arch. Allergy Appl. Immunol., 29:346–363. Aas K (1967). Studies of hypersensitivity to fish: studies of different fractions of extracts from cod muscle tissue. Int. Arch. Allergy Appl. Immunol., 331:239–260. Aas K, Jebsen JW (1967). Studies of hypersensitivity to fish: partial purification and crytallization of a major allergenic component of cod. Int. Arch. Allergy Appl. Immunol., 32:1–20. Aas K, Elsayed S (1975). Physico-chemical properties and specific activity of a purified allergen (codfish). Dev. Biol. Stand., 29:90–98. Andre F, Andre C, Collin L, Cacaraci F, Cavagna S (1994). Role of new allergens and of allergen consumption in the incidence of food sensitizations in France. Toxicology, 93:77–83.
REFERENCES
417
Andre F, Cavagna S, Andre C (2003). Gelatin prepared from tuna skin: a risk factor for fish allergy or sensitization? Int. Arch. Allergy Immunol., 130:17–24. Aukrust L, Grimmer O, Aas K (1978). Demonstrations of distinct allergens by means of immunological methods: comparison of crossed radioimmunoelectrophoresis, radioallergosorbent test and in vivo passive transfer test. Int. Arch. Allergy Appl. Immunol., 557:183– 192. Baderschneider B, Crevel RWR, Earl LK, Lalljie A, Sanders DJ, Sanders IJ (2002). Sequence analysis and resistance to pepsin hydrolysis as part of an assessment of the potential allergenicity of ice structuring protein type III HPLC 12. Food Chem. Toxicol., 40:965–978. Bernhiesel-Broadbent J, Scanlon SM, Sampson H (1992a). Fish hypersensitivity: I. In vitro and oral challenge results in fish-allergic patients. J. Allergy Clin. Immunol., 89:730–737. Bernhiesel-Broadbent J, Scanlon SM, Sampson H (1992b). Fish hypersensitivity: II. Clinical relevance of altered fish allergenicity caused by various preparation methods. J. Allergy Clin. Immunol., 90:622–629. Besler M, Elsayed S, Helbing A (2000). Allergen data collection—update: codfish. Internet Symp. Food Allergens, 2(suppl. 6):1–18. Besler M, Steinhart H, Paschke A (2001). Stability of food allergens and allergenicity of processed foods. J. Chromatogr. B, 756:207–228. Bindslev-Jensen C, Sten E, Earl LK, et al. (2003). Assessment of the potential allergenicity of ice structuring protein type III HPLC 12 using the FAO/WHO 2001 decision tree for novel foods. Food Chem. Toxicol., 41:81–87. Bj€ornsson E, Janson C, Plaschke P, Norrman E, Sj€oberg O (1996). Prevalence of sensitization to food allergens in adult Swedes. Ann. Allergy Asthma Immunol., 77:327–332. Blum HE, Lehky P, Kohler L, Stein EA, Fischer EH (1977). Comparative properties of vertebrate parvalbumins. J. Biol. Chem., 252:2834–2838. Bock SA, (1987). Prospective appraisal of complaints of adverse reactions to foods in children during the first 3 years of life. Pediatrics, 79:683–688. Bock SA, Atkins FM (1990). Patterns of food hypersensitivity during sixteen years of doubleblind, placebo-controlled food challenges. J. Pediatr., 117:561–567. Bock SA, Muñoz-Furlong A, Sampson HA (2001). Fatalities due to anaphylactic reactions to foods. J. Allergy Clin. Immunol., 107:191–193. Boyano Martinez T, Martin Esteban M, Diaz Pena JM, Ojeda JA (1987). Alergia a alimentos en el niño: I. Clınica y diagnóstico. An. Esp. Pediatr., 26:235–240. Bugajska-Schretter A, Elfman L, Fuchs T, et al. (1998). Parvalbumin, a cross-reactive fish allergen, contains IgE-binding epitopes sensitive to periodate treatment and Ca2 þ depletion. J. Allergy Clin. Immunol., 101:67–74. Bugajska-Schretter A, Grote M, Vangelista L, et al. (2000). Purification, biochemical, and immunological characterisation of a major food allergen: different immunoglobulin E recognition of the apo- and calcium-bound forms of carp parvalbumin. Gut, 46:661–669. Carrera M, Canas B, Pineiro C, Vazquez J, Gallardo JM (2006). Identification of commercial hake and grenadier species by proteomic analysis of the parvalbumin fraction. Proteomics, 6:5278–5287. Chatterjee U, Mondal G, Chakraborti P, Patra HK, Chatterjee BP (2006). Changes in the allergenicity during different preparations of Pomfret, Hilsa, Bhetki and mackerel fish as illustrated by enzyme-linked immunosorbent assay and immunoblotting. Int. Arch. Allergy Immunol., 141:1–10.
418
FISH ALLERGEN DETECTION
Chen L, Hefle SL, Taylor SL, Swoboda I, Goodman RE (2006). Detecting fish parvalbumin with commercial mouse monoclonal anti-frog parvalbumin IgG. J. Agric. Food Chem., 54:5577–5582 Coffee CJ, Bradshaw RA (1973). Carp muscle calcium-binding protein: I. Characterization of the tryptic peptides and the complete amino acid sequence of component B. J. Biol. Chem., 248:3302–3312. Crespo JF, Blanco C, Contreras J, Pascual C, Martin Esteban M (1992). Food allegy: a clinical and epidemiological study. J. Allergy Clin. Immunol., 89:192. Crespo JF, Pascual C, Burks AW, Helm RM, Esteban MM (1995). Frequency of food allergy in a pediatric population from Spain. Pediatr Allergy Immunol., 6:39–43. Dannaeus A, Ingañas M (1981). A follow-up study of children with food allergy: clinical course in relation to serum IgE- and IgG-antibody to milk, egg and fish. Clin. Allergy, 11:533–539. Das A, Chakraborti P, Chatterjee U, Monddal G, Chatterjee BP (2005). Identification of allergens in Indian fishes: hilsa and pomfret exemplified by ELISA and immunoblotting. Indian J. Exp. Biol., 43:1170–1175. Das Dores S, Chopin C, Villaume C, Fleurence J, Gueant JL (2002). A new oligomeric parvalbumin allergen of Atlantic cod (Gad m1) encoded by a gene distinct from that of Gad c1. Allergy, 57:79–83. De Martino M, Novembre E, Galli L, et al. (1990). Allergy to different fish species in cod-allergic children: in vivo and in vitro studies. J. Allergy Clin. Immunol., 86:909–914. De Martino M, Peruzzi M, De Luca M, et al. (1993). Fish allergy in children. Ann. Allergy, 71:159–165. Dory D, Chopin C, Aimone-Gastin I, et al. (1998). Recognition of an extensive range of IgEreactive proteins in cod extract. Allergy, 53:42–50. Douglas JD, McSharry C, Blaikie L, Morrow T, Miles F, Franklin D (1995). Occupational asthma caused by automated salmon processing. Lancet, 346:737–740. Eigenmann PA, Calza A-M (2000). Diagnosis of IgE-mediated food allergy among Swiss children with atopic dermatitis. Pediatr. Allergy Immunol., 11:95–1000. Eigenmann PA, Sicherer SH, Borkowski TA, Cohen BA, Sampson HA (1998). Prevalence of IgE-mediated food allergy among children with atopic dermatitis. Pediatrics, 101:E8. Elsayed S (2002). Fish allergy and the codfish allergen model. In Brostoff J, Callacombe SJ, (eds. ), Food Allergy and Intolerance, 2nd ed. Harcourt, London, pp. 425–433. Elsayed S, Aas K (1971). Characterization of a major allergen (cod): observation on the effect of denaturation on the allergenic activity. J. Allergy, 47:283–291. Elsayed S, Apold J (1983). Immunochemical analysis of codfish allergen: locations of the immunoglobulin binding sites as demonstrated by the native and synthetic peptides. Allergy, 38:449–459. Elsayed S, Bennich H (1975). The primary structure of allergen M from cod. Scand. J. Immunol., 4:203–208. Erickson JR, Moerland TS (2006). Functional characterization of parvalbumin from Arctic cod (Boreogadus saida): similarity in calcium affinity among parvalbumins from polar teleosts. Comp. Biochemi. Physiol. A, 143:228–233. Etienne M, Jerôme M, Fleurence J, et al. (2000). Identification of fish species after cooking by SDS-PAGE and urea IEF: a collaborative study. J. Agric. Food Chem., 48:2653–2658.
REFERENCES
419
EC (European Commission) (2007). Directive 2007/68/EC, amending Annex IIIa to Directive 2000/13/EC as regards certain food ingredients. Fñste CK, Plassen C (2008). Quantitative sandwich ELISA for the determination of fish in foods. J. Immunol. Methods, 329:45–55. FAO (Food and Agriculture Organization) (2004). Report of the Expert Consultation on International Fish Trade, Rio, de Janeiro, Brazil, Dec. 3–5, 2003. FAO Fisheries Report 744. FAO, Rome, p. 155. FDA (Food and Drug Administration) (2005). Approaches to establish thresholds for major food allergens and for gluten in food. http://www.cfsan.fda.gov/ dms/alrgn.html. Friedberg F (2005). Parvalbumin isoforms in zebrafish. Mol. Biol. Rep., 32:167–175. Galland AV, Dory D, Pons L, et al. (1998). Purification of a 41 kDa cod-allergenic protein. J. Chromatogr. B, 706:63–71. Hamada Y, Nagashima Y, Shiomi K (2001). Identification of collagen as a new fish allergen. Biosci. Biotechnol. Biochem., 65:285–291. Hamada Y, Tanaka H, Ishizaki S, Ishida M, Nagashima Y, Shiomi K (2003). Purification, reactivity with IgE and cDNA cloning of parvalbumin as the major allergen of mackerels. Food Chem. Toxicol., 41:1149–1156. Hansen TK, Bindslev-Jensen C (1992). Codfish allergy in adults: identification and diagnosis. Allergy, 47:610–617. Hansen TK, Bindslev-Jensen C, Skov PS, Poulsen LK (1996). Codfish allergy in adults: specific tests for IgE and histamine release vs double-blind, placebo-controlled challenges. Clin. Exp. Allergy, 26:1276–1285. Hansen TK, Bindslev-Jensen C, Skov PS, Poulsen LK (1997). Codfish allergy in adults: IgE cross-reactivity among fish species. Ann. Allergy Asthma Immunol., 78:187–194. Hansen TK, Poulsen LK, Skov PS, et al. (2004). A randomized, double-blind, placebocontrolled oral challenge study to evaluate the allergenicity of commercial, food-grade fish gelatin. Food Chem. Toxicol., 42:2037–2044. Helbing A, Lopez M, Lehrer SB (1992). Fish allergy: Is it a real problem with surimi-based products? Int. Arch. Allergy Immunol., 99:452–455. Helbing A, Haydel R, McCants ML, Musmand JJ, El-Dahr J, Lehrer SB (1999). Fish allergy: Is cross-reactivity among fish species relevant? Double-blind placebo-controlled food challenge studies of fish allergic adults. Ann. Allergy Asthma Immunol., 83:517–523. Hickman D, Sims TJ, Miles CA, Bailey AJ, de Mari M, Koopmans M (2000). Isinglass/ collagen: denaturation and functionality. J. Biotechnol., 79:245–257. Hilger C, Grigioni F, Thill L, Mertens L, Hentges F (2004). IgE antibodies of fish allergic patients cross-react with frog parvalbumin. Allergy., 59:653–660. Hill DJ, Firer MA, Ball G, Hosking CS (1989). Recovery from milk allergy in early childhood: antibody study. J. Pediatr., 114:761–766. Josupeit H (1996). Global overview on fish consumption. Proceedings of the Seminar of the CIHEAM Network on Socio-economic and Legal Aspects of Aquaculture in the Mediterranean (SELAM), Thessaloniki, Greece, Oct. 11–13, 1995. FAO Online Catalogues. Kajosaari M (1982). Food allergy in Finnish children aged 1 to 6 years. Acta Paeaiatr. Scand., 71:815–819. Kanny G, Moneret-Vautrin DA, Flabbee J, Beaudouin E, Morisset M, Thevenin F (2001). Population study of food allergy in France. J. Allergy Clin. Immunol., 108:33–40.
420
FISH ALLERGEN DETECTION
Kelso JM, Jones RT, Yunginger JW (1996). Monospecific allergy to swordfish. Ann. Allergy Asthma Immunol., 77:227–228. Kelso JM, Bardina L, Beyer K (2003). Allergy to canned tuna. J. Allergy Clin. Immunol., 111:9001. Kjñrsgard IVH, Nørrelykke MR, Jessen F (2006). Changes in cod muscle proteins during frozen storage by proteome analysis and multivariate data analysis. Proteomics, 6:1606–1618. Kobayashi A, Tanaka H, Hamada Y, Ishizaki S, Nagashima Y, Shiomi K (2006). Comparison of allergenicity and allergens between fish white and dark muscles. Allergy, 61:357–363. Laurenti G (comp.) (2007). 1961–2003 Fish and Fishery Products: World Apparent Consumption Statistics Based on Food Balance Sheets. FAO Fisheries Circular 821, rev. 8. FAO, Rome. Lee SJ, Ju CC, Chu SL, Chien MS, Chan TH, Liao WL (2006). Molecular cloning, expressing and phylogenetic analyses of parvalbumin in tilapia, Oreochromis mossambicus. J. Exp. Zool. A, 307:51–61. Lindstrøm CD, Van Do T, Hordvik I, Endresen C, Elsayed S (1996). Cloning of two distinct cDNAs encoding parvalbumin, the major allergen of Atlantic salmon (Salmo salar). Scand. J. Immunol., 44:335–344. Lopata AL, Jeebhay MF (2001). Seafood allergy in South Africa: studies in the domestic and occupational setting. ACI Int., 13:204–210. Lopata AL, Jeebhay MF, Reese G, et al. (2005). Detection of fish antigens aerosolized during fish processing using newly developed immunoassays. Int. Arch. Allergy Immunol., 138:21– 28. Maleki SJ, Hurlburt BK (2004). Structural and functional alterations in major peanut allergens caused by thermal processing. J. AOAC Int., 87:1475–1479. Mata E, Favier C, Moneret-Vautrin DA, Nicolas JP, Han Ching L, Gueant JL (1994). Surimi and native codfish contain a common allergen identified as a 63-kDa protein. Allergy, 49:442–447. Moneret-Vautrin DA (2002). [Food allergy diagnosis]. Allerg. Immunol. (Paris), 34:241–244. Moneret-Vautrin DA, Kanny G (1995). L’anaphylaxie alimentaire: nouvelle enqu^ete multicentrique fran¸caise. Ann. Gastroentrol. Hepatol., 31:256–263. Mortz CG, Lauritsen JM, Andersen KE, Bindslev-Jensen C (2003). Type I sensitization in adolescents: prevalence and accociation with atopic dermatitis. The Odense adolescence cohort study on atopic diseases and dermatitis (TOACS). Acta Dermato Venereol., 83:194– 201. Musmand JJ, Helbing A, Lehrer SB (1996). Surimi: something fishy. J. Allergy Clin. Immunol., 98:697–699. Novembre E, Cianferoni A, Bernadini R, et al. (1998). Anaphylaxis in children: clinical and allergological features. Pediatrics, 101:68. O’Neil C, Helbling AA, Lehrer SB (1993). Allergic reactions to fish. Clin. Rev. Allergy, 11:183–200. Pascual C, Esteban MM, Crespo JF (1992). Fish allergy: evaluation of the importance of crossreactivity. J. Pediatr., 121:S29–S34. Pascual CY, Crespo JF, Dominguez Noche C, Ojeda I, Ortega N, Martin Esteban M (1996). IgE-binding proteins in fish and fish steam. Monogr. Allergy, 32:174–180.
REFERENCES
421
Poms RE, Klein CL, Anklam E (2004). Methods for allergen analysis in food: a review. Food Addit. Contam., 21:1–31. Poulsen LK, Hansen TK, Nørgaard A, Vestergaard H, Stahl Skov P, Bindslev-Jensen C (2001). Allergens from fish and egg. Allergy, 56:39–42. € Prausnitz C, K€ustner H (1921). Studien €uber die Uberempfindlichkeit. Zentbl. Bakteriol. 1 Orig., 86:160–169. Rance F, Dutau G (1998). Labial food challenge in children with food allergy. Pediatr. Allergy Immunol., 8:41–44. Rance F, Dutau G (2002). Asthme et allergies alimentaires: a propos de 163 observations pediatriques. Arch. Pediatr., 9(suppl. 3):402–407. Rance F, Kanny G, Dutau G, Moneret-Vautrin DA (1999). Allergenes alimentaires de l’enfant. Arch. Pediatr., 6(suppl. 1):61–66. Rodrıguez J, Reano M, Vives R, et al. (1997). Occupational asthma caused by fish inhalation. Allergy, 52:866–869. Rosmilah M, Shanaz M, Masita S, Noormalin A, Jamaludin M (2005). Identification of major allergens of two species of local snappers: Lutjanus argentimaculatus (merah/red snapper) and Lutjanus johnii (jenahak, golden snapper). Trop. Biomed., 22:171–177. Ross C, Hevener S, Clark R, Hartman JX, Mari F (1998). Isolation of parvalbumin subtypes by preparative HPLC techniques. Prep. Biochem. Biotechnol., 28:49–60. Sakaguchi M (2000). IgE antibody to fish gelatin (type I collagen) in patients with fish allergy. J. Allergy Clin. Immunol., 106:579–584. Sakaguchi M, Hori H, Ebihara T, Irie S, Yanagida M, Inouye S (1999). Reactivity of the immunoglobulin E in bovine gelatine-sensitive children to gelatins from various animals. Immunology, 96:286–290. Sampson HA (2000). Food anaphylaxis. Br. Med. Bull., 56:925–935. Sampson HA (2005). Food allergy: accurately identifying clinical reactivity. Allergy, 60:19–24. Sampson HA, Mendelson L, Rosen JP (1992). Fatal and near-fatal anaphylactic reactions to food in children and adolescents. N. Engl. J. Med., 327:380–384. Sicherer SH, Morrow EH, Sampson HA (2000). Dose–response in double-blind, placebocontrolled oral food challenges in children with atopic dermatitis. J. Allergy Clin. Immunol., 105:582–586. Sicherer SH, Muñoz-Furlong A, Sampson HA (2004). Prevalence of seafood allergy in the United States determined by a random telephone survey. J. Allergy Clin. Immunol., 114:159–165. Swoboda I, Bugajska-Schretter A, Verdino P, et al. (2002). Recombinant carp parvalbumin, the major cross-reactive fish allergen: a tool for diagnosis and therapy of fish allergy. J. Immunol., 168:4576–4584. Taylor SL, Hefle SL (2000). Hidden triggers of adverse reactions to foods. Can. J. Allergy Clin. Immunol., 5:106–110. Taylor AV, Swanson MC, Jones RT, et al. (2000). Detection and quantitation of raw fish aeroallergens from an open-air fish market. J. Allergy Clin. Immunol., 105:166–169. Taylor SL, Hefle SL, Bindslev-Jensen C., Bock SA, Burks AW Jr, Christie L, Hill DJ, Host A, Hourhane JO, Lack G, Metcalfe DD, Moneret-Vautrin DA, Vadas PA, Rance F, Skrypec DJ, Trautman TA, Yman IM, Zeiger RS (2002). Factors effecting the determination of threshold doses for allergenic foods. How much is too much? J. Allergy Clin. Immunol., 109:24–30.
422
FISH ALLERGEN DETECTION
Taylor SL, Kabourek JL, Hefle SL (2004a). Fish allergy: fish and products thereof. J. Food Sci., 69:R175–R180. Taylor SL, Hefle SL, Bindslev-Jensen C, et al. (2004b). A consensus protocol for the determination of the threshold doses for allergenic foods: How much is too much? Clin. Exp. Allergy, 34:689–695. Torres Borego J, Martınez Cuevas JF, Tejero Garcıa J (2003). Reactividad cruzada entre pescados y mariscos. Allergol. Immunopathol., 31:146–151. Untersmayr E, Focke M, Kinaciyan T, et al. (2002). Anaphylaxis to Russian Beluga caviar. J. Allergy Clin. Immunol., 109:1034–1035. Untersmayr E, Szalai K, Riemer AB, et al. (2006). Mimotopes identify conformational epitopes on parvalbumin, the major fish allergen. Mol. Immunol., 43:1454–1461. Untersmayr E, Vestergaard H, Malling H-J, et al. (2007). Incomplete digestion of codfish represents a risk factor for anaphylaxis in patients with allergy. J. Allergy Clin. Immunol., 119:711–717. Valenta R, Hayek B, Seiberler S, et al. (1998). Calcium-binding allergens: from plants to man. Int. Arch. Allergy Immunol., 117:160–166. Van Do T, Hordvik I, Endresen C, Elsayed S (2005a). Characterization of parvalbumin, the major allergen in Alaska pollack, and comparison with codfish allergen M. Mol. Immunol., 42:345–353. Van Do T, Elsayed S, Florvaag E, Hordvik I, Endresen C (2005b). Allergy to fish parvalbumins: studies on the cross-reactivity of allergens from 9 commonly consumed fish. J. Allergy Clin. Immunol., 116:1314–1320. Venugopal V, Shahidi F, (1995). Value-added products from underutilized fish species. Crit. Rev. Food Sci. Nutr., 35:431–453. Wild LG, Lehrer SB (2005). Fish and shellfish allergy. Curr. Allergy Asthma Rep., 5:74–79. Wilwert JL, Madhoun NM, Coughlin DJ (2006). Parvalbumin correlates with relaxation rate in the swimming muscle of sheepshead and kingfish. J. Exp. Biol., 209:227–237. Yamada S, Nolte H, Zychlinsky E (1999). Identification and characterization of allergens in two species of tuna fish. Ann. Allergy Asthma Immunol., 82:395–400. Yunginger JW, Sweeney KG, Sturner WQ, et al. (1988). Fatal food-induced anaphylaxis. JAMA, 260:1450–1452.
CHAPTER 22
Lupin Allergen Detection CHRISTIANE KRUSE FÆSTE National Veterinary Institute, Oslo, Norway
22.1
INTRODUCTION
Lupin, a plant of the Leguminosae family in the subfamiliy Papilionaceae, tribe Genisteae, belongs to the genus Lupinus, which includes 450 species (Kurlovich, 2002). It is widely grown as an ornamental flower, but the usual garden species are poisonous because of high alkaloid levels. However, seeds from some lupin strains have been used since ancient times as human food and animal feed. Years of selective breeding have led to lupin varieties with reduced alkaloid content, the “sweet lupins” (Sengbusch, 1942). Four edible species are cultivated in different geographical regions (Figure 22.1): white lupin (Lupinus albus) in the Mediterranean countries, blue or narrow-leaved lupin (Lupinus angustifolius) in Australia, yellow lupin (Lupinus luteus) in Central Europe, and the Andean lupin (Lupinus mutabilis) in South America. Further details are available at www.ildis.org/LegumeWeb/6.00/ (ILDIS Legumes of the World) and www.plantnames.unimelb.edu.au/Sorting/ Lupinus.html (Multilingual Multiscript Plant Name Database).
22.2
LUPIN PLANT
Legume plants such as lupin, peanut, soy, pea, bean, lentil, or alfalfa are of agricultural interest because they have an ability to fix atmospheric nitrogen into ammonia, which, in turn, can have a fertilizing effect in the soil for subsequent nonlegume crops and pasture. This process occurs through bacteria, known as rhizobia [Bacterium radiuzola Prazuiquski (¼Rhizobium leguminosarum Frank.)], found in the root nodules of
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
423
424
LUPIN ALLERGEN DETECTION
FIGURE 22.1
Species of edible lupines. (See insert for color representation.)
legume plants. Because of their nitrogen-fixing ability, lupins (and other pulse crops) can be used in cropping rotations to replenish nitrogen-depleted soils (Hiltner, 1917). Lupin seeds are produced in pods that develop on the main stem of the lupin plant. The seeds of white lupin are 8 to 14 mm in diameter, flattened, and of cream color. Blue lupins have beige or brown-speckled round and relatively light seeds, whereas yellow lupin seeds are round and resemble soybeans (Figure 22.2).
FIGURE 22.2 (a) Lupin root with Rhizobium lupini nodules; (b) lupin sprout; (c) seed forms 1, Lupinus albus; 2, Lupinus luteus; 3, Lupinus angustifolius. (d) lupin seeds and pods. (From: Fruwirth, 1921 and Hegi, 1964.)
LUPIN PLANT
TABLE 22.1 Species L. L. L. L.
425
Lupin Seed Composition Crude Protein
Fat
Crude Fiber
Ashes
N-Free Extract
38.0 40.2 45.8 42.2
7.6 6.6 4.6 19.5
14.3 15.8 14.7 10.1
4.4 5.0 4.8 3.8
35.9 32.4 30.2 29.1
albus angustifolius luteus mutabilis
Source: R€ omer (1994).
Seeds of wild-type lupin contain considerable amounts of the quinolizidine alkaloids, such as lupinine, sparteine, lupanine, and 13-hydroxylupanin, which make them unsuitable for animal or human consumption because they produce a bitter taste and toxic or pharmacological effects (Cortes Sanchez et al., 2004; Magni et al., 2004; Sirtori et al., 2004; Martins et al., 2005; Lee et al., 2007). The acute lethal dose of lupin alkaloids in humans is approximately 30 mg/kg body weight (Yovo et al., 1984). In 1929, however, von Sengbusch screened approximately 1.5 million lupin plants, finding three yellow and two blue lupins practically free of alkaloids containing only 0.05% alkaloids. By selective breeding, the “sweet lupins” were developed (von Sengbusch, 1942), and subsequently, lupin varieties with low alkaloid content were further optimized. Marketable sweet lupin seeds now have a mean on average alkaloid content of 130 to 150 mg/kg (Butler et al., 1996). The level of alkaloids in high-alkaloid lupin can be reduced to approximately 500 mg/kg by debittering processes using extract solvents or by washing with water (Aguilera and Trier, 1978). Lupin seed is very rich in protein (34 to 43% of dry matter), contains considerable amounts of oil (5.4 to10%) and is fiber-rich (14 to 16.5%) (Vasquez et al., 1989; Zacharıas et al., 1989; Lasztity et al., 2001) (Table 22.1). Therefore, lupin has been tested successfully for improvement of the protein supply in humans (Gross et al., 1976; Taha et al., 1982; Lopez de Romana et al., 1983; Ballester et al., 1984; Gattas Zaror et al., 1990; Egaña et al., 1992). Lupin is gluten-free and has a low starch content (0.7 to 2.2%), which makes it interesting for use in health foods (Wittig de Penna et al., 1987; Marrs, 1996; Feldheim, 1997; Mubarak, 2001). The nutritional value of lupin is similar to that of soybean (Yañez et al., 1979). It contains essential amino acids (lysin, leucin, threonin) (Kanny et al., 2000), although the content of methionine is low and supplementation can increase the protein efficiency ratio (Yañez et al., 1983; Catricheo et al., 1989) (Table 22.2). TABLE 22.2
Content of Essential Amino Acids in Lupin Seeds (g/100 g protein)
Species
Ile
Leu
Lys
Met þ Cys
Phe þ Tyr
Thr
Trp
Val
Lupinus albus L. angustifolius L. luteus L. mutabilis
5.1 3.8 4.6 4.7
8.5 6.6 9.0 7.4
5.6 5.2 6.1 6.0
2.8 2.3 3.1 2.7
8.9 7.1 6.9 7.9
4.1 3.5 4.0 4.0
0.9 0.9 0.9 0.8
4.9 4.0 4.3 4.0
Source: Mukherjee (1989).
426
22.3
LUPIN ALLERGEN DETECTION
LUPIN CONSUMPTION
The cultivation of lupin dates back several thousand years. It was grown for grazing, human consumption, medicinal purposes, and soil improvement by crop rotation: “In turn likewise shalt thou let the stubbles lie fallow, and the idle field crust over unstirred; or else there under changed skies sow golden spelt, where before thou hadst reaped the pea with wealth of rattling pods, or the tiny vetch crop, or the brittle stalks and rustling underwood of the bitter lupin.”
From Georgicae [Publius Vergilius Maro (Virgil) 29 B.C., translated by J.W. MacKail, 1934] (Figure 22.3). In the Andes, tarwi is part of the highland Indian’s diet since the times of the Incas (Fig. 22.4). Sweet lupin is grown as a commercial crop in Australia, Belarus, Chile, Russia, some European countries, and else where. Australia is the dominant world producer of lupins, with an average of 1.2 million metric tons a year, accounting for around 85% of the world lupin production over the past 10 years. The European Union (EU; 27 member states) is the second largest producer of lupins (FAO, 2007). The main lupin-cultivating European countries are Germany (100,000 tons/acre), France (24,000), Spain (98,000 tons/acre), and Italy (5000 tons/acre). The majority of the global lupin production is used by stockfeed manufacturers as a source of protein and fiber for ruminants, pig, and poultry or in aquaculture. Only 4% is currently consumed as human food. Seeds from bitter lupin cultivars are traditionally eaten as “Lupini” snacks in southern Europe. They are commonly sold in a salty solution in jars and can be eaten with or without the skin. However, since
FIGURE 22.3 (a) Wild lupins; (b) a 5th-century portrait of Virgil (Biblioteca Apostolica, Cod. Vat. lat. 3867).
LUPIN CONSUMPTION
427
FIGURE 22.4 L. mutabilis “Tarwi”. (Reprinted with permission from the National Academies Press, Copyright 1989, National Academy of Sciences.)
sweet lupin strains have become available, lupin flour, lupin bran, lupin-tofu, and lupin-derived “milk” are used in an increasing number of food products (Figure 22.5). About 500,000 metric tons of food products consumed per year in Europe contain lupin. Lupin flour (up to 10%) has been introduced as an ingredient in wheat flour in the UK in 1996, in France in 1997, and in Australia in 2001 (Moneret-Vautrin et al., 1999; Dutau et al., 2002; Smith et al., 2004). Currently, lupin is used in biscuits, pasta, sauces, milk substitutes, soy substitutes, chocolate spread, sausages, and pastes (Ivanovic et al., 1983; Uauy et al., 1995; Lee et al., 2006) (Figure 22.5). Additionally, lupin extracts are used to clarify wine (Cattaneo et al., 2003), and in Japan and Indonesia lupin is an ingredient in traditional fermented foods such as tempe and miso. Requirements with regard to the chemical composition, nutritional value, and product safety for the use of sweet lupin in the human diet were stated in 1996 by the Advisory Committee on Novel Foods and Processes (www.acnfp.gov.uk/) in the UK. Currently, only a few companies produce lupin protein ingredients for food use. The products available are toasted and nontoasted lupin flour, lupin grits, lupin granulates, lupin fiber, lupin oil, and lupin protein concentrates from nondefatted seeds. In 2003 to 2005, an EU-funded project coordinating research on lupin from several countries was conducted with the aim of optimizing processes for preparing healthy and addedvalue food ingredients from lupin kernels (Healthy-Profood; users.unimi.it/healthyp/ index.html; EU contract QLRT 2001-002235).
428
LUPIN ALLERGEN DETECTION
FIGURE 22.5 (a) Lupin-containing foods; (b) lupin sausages; (c) bakery goods containing lupin; (d) lupin tofu.
22.4
PREVALENCE OF LUPIN ALLERGY
The prevalence of lupin allergy seems to increase in parallel with the augmented consumption of lupin-containing foods (Rance, 2000; Molkhou, 2003; MoneretVautrin et al., 2004; Moneret-Vautrin, 2007; Reis et al., 2007; Roberts, 2007). The frequency of lupin-allergic reaction in the general population, however, is unknown and is probably dependent on dietary habits and geographical differences (Shaw et al., 2008). As recorded by the Allergy Vigilance Network in France, lupin products held fourth rank among the anaphylaxis-eliciting foods in 2002, after peanuts, nuts, and shellfish (Moneret-Vautrin et al., 2004). In Norway, an increasing number of cases with lupin allergy has been registered by since 2000 by the Norwegian National Reporting System and Register of Severe Allergic Reactions to Food (Løvik et al., 2004).
22.5
LEGISLATION
The possibility of considerable underreporting of lupin allergy cannot be excluded because until recently it was a hidden, undeclared ingredient in foodstuffs (Løvik, 2003; Smith et al., 2004; Rojas-Hijazo et al., 2006; De las Marinas et al., 2007). In Europe, this changed in December 2006, when “lupin and products there-of” was added to Directive 2006/142/EC of the European Parliament and Council, amending
THRESHOLD DOSES
429
Appendix IIIa of Directive 2003/89/EC (EC, 2004), to the list of major allergens that by mandate have to be labeled on prepackaged foods (EC, 2006) in accordance with an opinion of the Scientific Panel on Dietetic Products, Nutrition and Allergies (NDA, 2005). The legislative bodies in other countries, however, have not yet issued labeling regulations for lupin. For further details, see eur-lex.europa.eu/LexUriServ/ LexUriServ.do?uri¼OJ:L:2006:368:0110:0111:EN:PDF.
22.6
ROUTES OF EXPOSURE
Lupin allergy has been described to occur by primary sensitization to ingested lupin protein (Romano et al., 1997; Matheu et al., 1999; Smith et al., 2004; Brennecke et al., 2007; De las Marinas et al., 2007; Peeters et al., 2007; Quaresma et al., 2007; Rotiroti et al., 2007; W€ uthrich, 2008). Additionally, sensitization and triggering of lupin allergy via inhalation (Novembre et al., 1999; Moreno-Ancillo et al., 2005; Reis et al., 2007) and by occupational exposures (Gutierrez et al., 1997; Campbell et al., 2007; Crespo et al., 2001; Parisot et al., 2001) have been described. However, lupin allergy seems to be more often the consequence of cross-reactivity in patients with existing peanut allergy (Hefle et al., 1994; Moneret-Vautrin et al., 1999; Kanny et al., 2000; Leduc et al., 2002; Fæste et al., 2004; Radcliffe et al., 2005; Guarneri et al., 2005; Wassenberg and Hofer, 2007; Lindvik et al., 2008, Shaw et al., 2008).
22.7
SYMPTOMS OF LUPIN ALLERGY
The clinical symptoms occurring after the ingestion or inhalation of lupin are similar to those reported for other food or inhalant allergens. The allergic responses range from mild local reactions to systemic anaphylaxis. Reported symptoms include facial edema, mucosal erythema (Brennecke et al., 2007), angioedema (Hefle et al., 1994; Parisot et al., 2001), rhinoconjunctivitis, urticaria, atopic dermatitis, and abdominal symptoms (Gutierrez et al., 1997; Moneret-Vautrin et al., 1999), throat tingling, cough and asthma (Kanny et al., 2000; Moreno-Ancillo et al., 2005; Cambell et al., 2007), oral allergy syndrome (Romano et al., 1997; Quaresma et al., 2007), and anaphylaxis (Matheu et al., 1999; Smith et al., 2004; Radcliffe et al., 2005; De las Marinas et al., 2007; Rotiroti et al., 2007; Wassenberg and Hofer 2007).
22.8
THRESHOLD DOSES
Little information is so far available on the triggering dose levels of allergic reactions after the ingestion of lupin. Existing data from some studies involving primarily lupin-sensitized and cross-reacting peanut allergic patients indicate that eliciting doses for objective symptoms might be in the range from 265 to 1000 mg of lupin protein (Moneret-Vautrin et al., 1999; Kanny et al., 2000; Peeters et al., 2007; Lindvik et al., 2008). The eliciting dose for subjective oral allergy syndromes was only 1 mg
430
LUPIN ALLERGEN DETECTION
or less (Peeters et al., 2007). However, a lowest adverse effect dose has not been established. By consuming about 100 g of bread made from wheat flour that contains 10% lupin flour, a dose of about 1000 mg of lupin protein would be ingested (Kanny et al., 2000).
22.9
CROSS-REACTIVITY
Extensive in vitro cross-reactivities between different legume plants, such as lupin, peanut (Arachis hypogaea), soy (Glycine max), pea (Pisum sativum), bean (Phaseolus vulgaris), chickpea (Cicer arietinum), and lentil (Lens culinaris) have been observed (Barnett et al., 1987; Bernhiesel-Broadbent and Sampson, 1989; Bernhiesel-Broadbent et al., 1989; Ibañez et al., 2003). The clinical relevance of elevated antilegume IgE serum levels is currently under discussion (Lifrani et al., 2005). However, several studies indicate that the risk of clinically manifest cross-allergy in peanut-allergic patients is higher after the exposure with lupin than with other legumes (MoneretVautrin et al., 1999; Martinez et al., 2000; Leduc et al., 2002; Moreno-Ancillo et al., 2005; Reis et al., 2007). Considering that peanut is a major food allergen and the most common cause of fatal and near-fatal anaphylaxis (Sampson et al., 1992), affecting about 1% of the population in the UK (Radcliffe et al., 2005), the allergenic potential of lupin is an important issue. The prevalence of lupin sensitization in peanut-allergic patients has been reported to be approximately 34% (Shaw et al., 2008), 44% (Moneret-Vautrin et al., 1999), 58% (Lindvik et al., 2008), and 71% (Hefle et al., 1994), whereas clinically relevant cross-reactivity rates of about 4% (Shaw et al., 2008), 17% (Lindvik et al., 2008), 29% (Moneret-Vautrin et al., 1999), and 68% (Leduc et al., 2002) were described. Cross-reactivity is in general a result of homologous epitopes in proteins with conserved amino acid sequences or steric domains (Aalberse, 2007). Like other legumes, lupin seeds contain storage proteins (Melo et al., 1994) that belong to the cupin superfamily, including 11S and 7S seed storage proteins, and the prolamins superfamily, including 2S albumins and hydrolase inhibitors (Breiteneder and Mills, 2005). In addition to the intralegumes cross-reactivities, patients with allergy to grass pollen might develop symptoms of inhalation-induced lupin allergy (Novembre et al., 1999; Parisot et al., 2001; Reis et al., 2007). The eliciting allergen has not been identified so far even if a lupin allergen belonging to the PR10 family with homology to the major birch pollen allergen Bet v 1 has been identified. However, all patient cases described occurred in Mediterranean countries and not in areas with high birch pollen environmental concentrations such as Scandinavia.
22.10
LUPIN ALLERGENS
Seed storage proteins have been characterized as major allergens in several legume seeds and tree nuts (Bernhiesel-Broadbent et al., 1989; Shewry et al., 1995;
LUPIN ALLERGENS
431
Breiteneder and Radauer, 2004; Mills et al., 2004). Proteins from seeds of L. albus and L. angustifolius have been analyzed and identified as potential allergens (Parisot et al., 2001; Magni et al., 2005a; Dooper et al., 2007; Lindvik et al., 2008). Detailed information can be found in the Allergome database, www.allergome.org. Lupin proteins have been analyzed by a number of different techniques, including liquid chromatography (Duranti et al., 1995), differential sedimentation (Franco et al., 1997; Freitas et al., 2000), proteomic analysis by one- and two-dimensional gel electrophoresis (Duranti et al., 1992; Magni et al., 2005b) or liquid chromatography/electrospray ionization tandem mass spectrometry (Schwend et al., 2003; Wait et al., 2005; Magni et al., 2007), isoelectrofocusing (Quaresma et al., 2007), crystallization (Biesiadka et al., 1999), and expression of recombinant protein (Scarafoni et al., 2001). The proteins in lupin seeds are comprised primarily of a- and b-conglutins, and to a lesser extent, g- and d-conglutins (Duranti et al., 1981; Melo et al., 1994; MoneretVautrin et al., 1999; Wait et al., 2005) (Figure 22.6) All four fractions are glycosylated storage proteins (Foss et al., 2006). Both the a-conglutin from the “legumin-like” 11S globulin family and the b-conglutin from the “vicilin-like” 7S family include two cupin domains. The cupins are a large and functionally immensely diverse superfamily of proteins that share a b-barrel structural core domain to which the term cupin (derived from the Latin word cupa for barrel) was given. Cupins can be divided into single and two-domain bicupins. The largest families of bicupins are the 7/8S and 11S seed storage globulins, which are the major components of plant seeds. UniProt entry Q6EBC1 LUPAL Pfam domains on this sequence Cupin_1
Cupin_1
Source Domain Start End PfamA Cupin 1 122 249 PfamA Cupin 1 332 494 (a) UniProt entry Q99235 LUPAN Pfam domains on this sequence
Source Domain Start End PfamA Tryp alpha amyl 68 146 (b)
FIGURE 22.6 Domain structure of (a) b-conglutin (L. albus) (b) d-conglutin (L. angustifolius). [From pfam.sanger.ac.uk/family?acc¼PF00190 (Sonnhammer et al., 1997).]
432
LUPIN ALLERGEN DETECTION
In L. albus, the mature a-conglutin is a hexamer of disulfide-linked basic and glycosylated acidic trimers with molecular weights in the range 47 to 54 kDa linked to a basic polypeptide of approximately 20 kDa (Magni et al., 2005b). The b-conglutin, however, is a non-covalently associated heterogeneous trimer consisting of polypeptides in the range 20 to 80 kDa (Duranti et al., 1992). Another cupin is g-conglutin, a basic protein with homogeneous tetramers consisting of two different disulfide-linked monomers of 17 and 30 kDa, respectively, the latter being glycosylated (Restani et al., 1981; Scarafoni et al., 2001). In contrast, d-conglutin is a 2S albumin of 14 kDa containing two disulfide-linked proteins of 4 and 9 kDa with the typical cysteine-rich prolamin structure (Duranti et al., 1981; Salmanowicz and Weder, 1997) (Figure 22.7). The 2S albumin seed storage proteins belong to the prolamins superfamily, containing
FIGURE 22.7 Unprocessed precursor sequences of L. albus conglutins. (From UniProt Consortium, 2009.)
ANALYTICAL METHODS FOR THE DETECTION OF LUPIN IN FOODS
433
a characteristic a-helical globular domain with a conserved pattern of six or eight cysteine residues that form three or four intramolecular disulfide bonds. However, the subunit structures of the conglutins appear to be complex, and differences in the subunit composition in the different Lupinus cultivars and species have been described (Blagrove and Gillespie, 1975; Melo et al., 1994). In L. angustifolius, a-conglutin consists of four subunits, which are noncovalently linked. The subunits range in size from 55 to 80 kDa and contain a disulfide-bound moiety of 20 kDa. Upon reduction, the larger subunits are split into polypeptides of 36 to 63 kDa. The b-conglutin contains four larger noncovalent subunits, as well as various minor components, which range in their molecular weights from 20 to 60 kDa. The g-conglutin contains monomers of approximately 40 kDa that are composed of two polypeptides of 30 kDa and 17 kDa, and the d-conglutin can be separated in polypeptides with molecular masses of 7 kDa and 11 kDa (Lilley, 1986; Salmanowicz, 2000) (Table 22.3). The major IgE-binding proteins of lupin have molecular weights of approximately 43 to 45 kDa, which has been shown by immunoblotting in several studies involving lupin-allergic patients (Moneret-Vautrinn et al., 1999; Novembre et al., 1999; Parisot et al., 2001; Holden et al., 2008). Other potential major allergens have been identified at 13 kDa (Moneret-Vautrin et al., 1999), 29 kDa (De las Marinas et al., 2007), 34 kDa (Quaresma et al., 2007), 38 kDa (Fæste et al., 2004; Guaneri et al., 2005), and 66 kDa (Peeters et al., 2007) (Figure 22.8). Lupin seed proteins have been fractionated by chromatographic methods (Sironi et al., 2005; Dooper et al., 2007). The separated conglutins have been studied for IgE-binding affinities (Magni et al., 2005a; Holden et al., 2008), and cross-reactivity with major peanut allergens has been elucidated (Dooper et al., 2009). In the patient cohort studied, IgE binding to lupin conglutin could be inhibited by total peanut extract by approximately 80%. a and d-conglutin demonstrated higher allergenicity and were inhibited to a larger extent than b- and g-conglutin. It appeared that the peanut allergen Ara h 2 inhibited most potent IgE binding to a- and d-conglutin, whereas Ara h 1 inhibited binding to b-conglutin most strongly (Figure 22.9).
22.11 ANALYTICAL METHODS FOR THE DETECTION OF LUPIN IN FOODS Since there is no other cure to food allergy than avoidance of the eliciting allergen, allergic consumers have to rely on food ingredient lists when purchasing prepackaged foods. For the protection of this consumer group, legislation concerning manufacturing practice and food labeling has been issued. However, the implementation of rules depends on their verifiability. Therefore, analytical methods are required for the sensitive detection of food allergens in food matrices. Until recently the detection of lupine protein was based on the use of serum from lupin-allergic patients and performed by immunoblot and radioallergosorbent test (RAST) analyses (Figure 22.10). The standardization of serum is difficult, and limited availability makes such methods unsuitable for routine analysis. Recently, a sandwich
434 Q7M1N2_LUPAL Q9FEX1_LUPAL Q9FSH9_LUPAL Q9S8M6_LUPAL
Q42369_LUPAN
Cupin 17, 29 5 7S
g-Conglutin
CGD2L_LUPAN CGD2S_LUPAN Q99235_LUPAN Q333K7_LUPAL
2S albumin 4.6, 9.4 12 2S
d-Conglutin
a UniProt Knowledgebase Release 13.5 consists of UniProtKB/Swiss-Prot Release 55.5 of June 10, 2008, and UniProtKB/TrEMBL Release 38.5 of June 10, 2008: ca.expasy. org/sprot/. (From UniProt Consortium, 2009.)
Q6EBC1_LUPAL Q53HY0_LUPAL
B0YJF7_LUPAN B0YJF8_LUPAN
Q96475_LUPAN
Q53I53_LUPAL Q53I54_LUPAL Q53I55_LUPAL
Cupin “vicilin-like” 19–60 45 7S
b-Conglutin
Cupin “legumin-like” 69–89 33 7S–12S
Source: Values from Foss et al. (2006).
L. albus
Protein family Size (kDa) % of protein Sedimentation coeff. Database entries L. angustifolius
a-Conglutin
TABLE 22.3 Lupin Conglutins a
ANALYTICAL METHODS FOR THE DETECTION OF LUPIN IN FOODS
435
FIGURE 22.8 Immunoblot on lupin protein extract (L. albus) using sera of 11 patients who are sensitized to lupin. M1, M2, molecular-weight markers; L, lupin extract (Coomassie-stained SDS-gel); 1–11, patient sera. (From Fæste et al., unpublished data.)
enzyme-linked immunosorbent assay (ELISA) for the quantitative determination of lupin in foods has been developed that uses a polyclonal rabbit anti-lupin antibody for capture and detection (Holden et al., 2005). The antibody was raised against heattreated protein from L. albus, but also reacts with native and processed proteins from L. angustifolius. Validation results show that the method is specific for lupin and does not cross-react with other legumes, such as peanut or soy. Recoveries range from 60 to 116% from typical food matrices with low coefficients of variation. The detection limit of 1 mg lupin protein per kilogram is in the same range as the minimum
FIGURE 22.9 (a) Fast protein liquid chromatography (FPLC) separation of a-, b- and g-conglutin using a continuous linear NaCl gradient (0–1 M); (From Dooper et al., 2007.) (b) SDS-PAGE of protein extracts: Lp, lupin flour (L. angustifolius); Lo, highly processed lupin proteins (L. albus); a, a-conglutin; b, b-conglutin; g, g-conglutin; d, d-conglutin; protein sizes (in kDa) are indicated on the left side of the gel. (From Holden et al., 2008.) (Figures reprinted with permission of S. Karger AG, Basel.)
436
LUPIN ALLERGEN DETECTION
FIGURE 22.10 (a) Immunoblot using polyclonal anti-lupin antibody (1, molecular-weight marker; 2, L. albus-derived extract; 3, L. angustifolius flour extract); (b) Representative linear six-point calibration curve based on the standard curve obtained using the lupin protein standard in the sandwich ELISA. (From Holden et al., 2005.) (Reprinted with permission from Reference Citation. Copyright 2005 American Chemical Society.)
allergy-eliciting doses observed, so that the assay might be used for routine analysis. The ELISA has been converted into kit format and is commercially available. Furthermore, a novel polyclonal/monoclonal-based sandwich ELISA for the detection of lupin proteins in foods was described (Holden et al., 2007). The monoclonal antibody reacts specifically with a-conglutin (Dooper et al., 2007). The assay has a detection limit of 1mg protein/kg food and is sensitive to both native and processed proteins from L. angustifolius and L. albus. A selection of 112 food samples, both with and without lupin declaration, was analyzed showing that the majority of products were labeled correctly. Protein detection by mass spectrometry has emerged as an alternative method, as the technology has advanced materially. A preliminary study for the development of a highperformance liquid chromatography/electrospray ionization tandem mass spectrometry method for the detection and label-free semiquantitation of the main storage proteins of L. albus in foods demonstrated the prospects and challenges of this approach (Locati et al., 2006). Total protein extracts were digested with trypsin after or without prefractionation by anion-exchange chromatography, and analyzed with HPLC/ESIMS/MS. Lupin proteins were identified using bioinformatic tools for comparison with protein databases. Concentrations of 0.025 to 1.5 mg/mL b-conglutin were detectable with very good linearity, indicating that further method development into a quantitative assay for the determination of lupin protein in foods might be possible. Molecular biological techniques use the presence of species-specific DNAsequences for detection. For lupin, more than 2500 expressed sequence tags are available in public databases. Quite recently, a hybridization probe-based real-time PCR assay for the detection of lupin DNA in foods was developed (Demmel
REFERENCES
437
et al., 2008). The method had a limit of detection of 0.1 mg/kg and did not cross-react with other food ingredients, such as legumes, cereals, seeds, nuts, spices, fruits, and meat. The presence or absence of lupin DNA was proved successfully in a number of frequently encountered food matrices.
22.12
EFFECTS OF FOOD PROCESSING
Legume allergens are relatively resistant to thermal, chemical, and proteolytical degradation (Lalles and Peltre, 1996; Tai and Bush, 1997; Besler et al., 2001; Mills et al., 2004). The allergenicity of lupin after extrusion cooking, boiling, autoclaving, and microwave heating was determined by IgE binding assays using a serum pool of 23 lupin-allergic patients (Alvarez-Alv. et al., 2005). Significantly reduced IgE reactivity was observed only after autoclaving at 138 C for 20 min. However, it has been shown that the in vitro allergenicity to lupins (L. albus) is reduced when an instantaneous controlled pressure drop is applied on lupin cotyledons (Guillamón et al., 2008). Additionally, other factors influencing lupin protein stability, such as saccharide chains (Duranti et al., 1995), the pH (Duranti et al., 2000), and the presence of metal ions (Ferreira et al., 1999; Duranti et al., 2002), have been examined. On the other hand, novel procedures to maintain the native protein properties have been proposed (W€asche et al., 2001; D’Agostina et al., 2006), which certainly also entail conservation of lupin allergenicity.
22.13
CONCLUSIONS
Lupin consumption increases as a consequence of the introduction of lupin flour as an ingredient in wheat flour in the 1990s because of its nutritional and food-processing qualities. Allergy to lupin has been documented, and major lupin allergens have been identified and characterized. Cross-reactivity with peanut proteins is of clinical relevance. Lupin allergenicity is not altered significantly by food-processing procedures. Several methods have been developed for the detection of lupin proteins in food matrices.
REFERENCES Aalberse RC (2007). Assessment of allergen cross-reactivity. Clin. Mol. Allergy, 5:2–7. Aguilera JM, Trier A (1978). The revival of lupin. Food Technol., 32:70–76. Alvarez-Alvarez J, Guillamon E, Crespo JF, Cuadrado C, Burbano C, Rodríguez J, Fernández C, Muzquiz M (2005). Effects of extrusion, boiling, autoclaving, and microwave heating on lupine allergenicity. J. Agric. Food Chem., 53:1294–1298. Ballester D, Zacarias I, Garcıa E, Yañez E (1984). Baking studies and nutritional value of bread supplemented with full-fat sweet lupine flour (L. albus cv. Multolupa). J. Food Sci., 49:14–16.
438
LUPIN ALLERGEN DETECTION
Barnett D, Bonham B, Howden ME (1987). Allergenic cross-reactions among legume foods: an in vitro study. J. Allergy Clin. Immunol., 79:433–438. Bernhiesel-Broadbent J, Sampson HA (1989). Cross-allergenicity in the legume botanical family in children with food hypersensitivity. J. Allergy Clin. Immunol., 83:435–440. Bernhiesel-Broadbent J, Taylor S, Sampson H (1989). Cross-allergenicity in the legume botanical family in children with food hypersensitivity: II. Laboratory correlates. J. Allergy Clin. Immunol., 84:701–709. Besler M, Steinhart H, Paschke A (2001). Stability of food allergens and allergenicity of processed foods. J. Chromatogr. B, 756:207–228. Biesiadka J, Sikorski MM, Bujacz G, Jaskólski M (1999). Crystallization and preliminary x-ray structure determination of Lupinus luteus PR10 protein. Acta Crystallogr. D, 55:1925–1927. Blagrove RJ, Gillespie JM (1975). Isolation, purification and characterization of the seed globulins of Lupinus angustifolius. Aust. J. Plant Physiol., 2:13–27. Breiteneder H, Mills EN (2005). Molecular properties of food allergens. J. Allergy Clin. Immunol., 115:14–23. Breiteneder H, Radauer C (2004). A classification of plant food allergens. J. Allergy Clin. Immunol., 113:821–830. Brennecke S, Becker WM, Lepp U, Jappe U (2007). Anaphylactic reaction to lupine flour. J. Dtsch. Dermatol. Ges., 5:774–776. Butler WH, Ford GP, Creasy DM (1996). A 90-day feeding study of lupin (Lupinus angustifolius) flour spiked with lupin alkaloids in the rat. Food. Chem. Toxicol., 34:531–536. Campbell CP, Jackson AS, Johnson AR, Thomas PS, Yates DH (2007). Occupational sensitization to lupin in the workplace: occupational asthma, rhinitis, and work-aggravated asthma. J. Allergy. Clin. Immunol., 119:1133–1139. Catricheo R, Sanchez F, Aguayo M, Ballester D, Yañez E (1989). [Preparation and chemical and nutritional evaluation of an infant food based on sweet lupine, wheat and milk]. Arch. Latinoam. Nutr., 39(2):141–149. Cattaneo A, Ballabio C, Bernardini R, et al. (2003). Assessment of residual immunoreactivity in red or white wines clarified with pea or lupin extracts. Int. J. Tissue React., 25:159–165. Cortes Sanchez M de, Altares P, Pedrosa MM, et al. (2004). Alkaloid variation during germination in different lupin species. Food Chem., 90:347–355. Crespo JF, Rodrıguez J, Vives R, et al. (2001). Occupational IgE-mediated allergy after exposure to lupine seed flour. J. Allergy Clin. Immunol., 108:295–297. D’Agostina A, Antonioni C, Resta D, et al. (2006). Optimization of a pilot-scale process for producing lupin protein isolates with valuable technological properties and minimum thermal damage. J. Agric. Food. Chem., 54:92–98. De las Marinas D, Cojocariu Z, Escudero R, Pardo N, Sanz ML (2007). Anaphylaxis induced by lupine as a hidden allergen. J. Investig. Allergol. Clin. Immunol., 17:283–284. Demmel A, Hupfer C, Ilg Hampe E, Busch U, Engel KH (2008). Development of a real-time PCR for the detection of lupine DNA (Lupinus species) in foods. J. Agric. Food Chem., PMID: 18512941. Dooper MM, Holden L, Fæste CK, Thompson KM, Egaas E (2007). Monoclonal antibodies against the candidate lupin allergens alpha-conglutin and beta-conglutin. Int. Arch. Allergy Immunol., 143:49–58.
REFERENCES
439
Dooper MMBW, Plassen C, Holden L, Lindvik H, Fæste CK (2009). IgE cross-reactivity between lupin conglutins and peanut allergens in serum of lupin-allergic individuals. J. Investig. Allergol. Clin. Immunol, 19:283-291. Duranti M, Restani P, Poniatowska M, Cerletii P (1981). The seed globulins of Lupinus albus. Phytochemistry, 20:2071–2075. Duranti M, Sessa F, Carpen A (1992). Identification, purification and properties of the precursor of conglutin b, the 7S storage globulin in Lupinus albus L. seeds. J. Exp. Bot., 43:1373– 1378. Duranti M, Gius C, Sessa F, Vecchio G (1995). The saccharide chain of lupin seed conglutin gamma is not responsible for the protection of the native protein from degradation by trypsin, but facilitates the refolding of the acid-treated protein to the resistant conformation. Eur. J. Biochem., 230:886–891. Duranti M, Sessa F, Scarafoni A, Bellini T, Dallocchio F (2000). Thermal stabilities of lupin seed conglutin gamma protomers and tetramers. J. Agric. Food Chem., 48:1118–1123. Duranti M, Di Cataldo A, Sessa F, Scarafoni A, Ceciliani F (2002). Metal ions restore the proteolytic resistance of denatured conglutin gamma, a lupin seed glycoprotein, by promoting its refolding. J. Agric. Food. Chem., 50:2029–2033. Dutau G, Rance F, Michaud P, Juchet A, Bremont F (2002). Flour and allergy: pitfalls which must be recognized. Rev. Fr. Allergol. Immunol. Clini., 42:289–298. Egaña JI, Uauy R, Cassorla X, Barrera G, Yañez E (1992). Sweet lupin protein quality in young men. J. Nutr., 122:2341–2347. EC (European Commision) (2004). Directive 2003/89/EC, amending Directive 2000/13/EC as regards indication of the ingredients present in foodstuffs. EC (2006). Directive 2006/142/EC amending Annex IIIa of Directive 2000/13/EC, listing the ingredients that must under all circumstances appear on the labeling of foodstuffs. Fæste CK, Løvik M, Wiker HG, Egaas E (2004). A case of peanut cross-allergy to lupine flour in a hot dog bread. Int. Arch. Allergy Immunol., 135:36–39. FAO (Food and Agriculture Organisation of the United Nations) (2007). Statistical database. http://www.faostat.fao.org/waicent/portal/statistics_en.asp. Feldheim W (1997). Sweet lupine – a very healthy asset. Int. Food Ingredients, 5:25–26. Ferreira RB, Franco E, Teixeira AR (1999). Calcium- and magnesium-dependent aggregation of legume seed storage proteins. J. Agric. Food Chem., 47:3009–3015. Foss N, Duranti M, Magni C, Frokiaer H (2006). Assessment of lupin allergenicity in the cholera toxin model: induction of IgE response depends on the intrinsic properties of the conglutins and matrix effects. Int. Arch. Allergy. Immunol., 141:141–150. Franco E, Ferreira RB, Teixeira AN (1997). Utilization of an improved methodology to isolate Lupinus albus conglutins in the study of their sedimentation coefficients. J. Agric. Food. Chem., 45:3908–3913. Freitas RL, Ferreira RB, Teixeira AR (2000). Use of a single method in the extraction of the seed storage globulins from several legume species: application to analyse structural comparisons within the major classes of globulins. Int. J. Food. Sci. Nutr., 51:341–352. Fruwirth C (1921). Handbuch des H€ulsenfruchterbaues, vol. 3. Verlag Paul Parey, Berlin. Gattas Zaror V, Barrera Acevedo G, Yanez Soto E, Uauy-Dagach Imbarack R (1990). Tolerance and chronic acceptability of lupine (Lupinus albus var. Multolupa) flour for feeding of young adults. Arch. Latinoam. Nutr., 40:490–502.
440
LUPIN ALLERGEN DETECTION
Gross R, Morales E, Gross U, von Baer E (1976). [Lupine, a contribution to the human food supply: 3. Nutritional physiological study with lupine (Lupinus albus) flour]. Z. Ernahrungswiss., 15:391–395. Guarneri F, Guarneri C, Benvenga S (2005). Identification of potentially cross-reactive peanutlupine proteins by computer-assisted search for amino acid sequence homology. Int. Arch. Allergy Immunol., 138:273–277. Guillamón E, Burbano C, Cuadrado C, et al. (2008). Effect of an instantaneous controlled pressure drop on in vitro allergenicity to lupins (Lupinus albus var. Multolupa). Int. Arch. Allergy Immunol., 145:9–14. Gutierrez D, Conde A, Duran S, et al. (1997). Contact urticaria from lupin. Contact Dermatitis, 36:311. Hefle SL, Lemanske RF Jr, Bush RK (1994). Adverse-reaction to lupine-fortified pasta. J. Allergy Clin. Immunol., 94:167–172. Hegi G (1964). Leguminosen, H€ulsenfr€uchte. In Illustr. Flora von Mitteleuropa, vol. 2, no. IV/3. Verlag Paul Parey, Berlin. Hiltner L (1917). Vermehrte Futtergewinnung aus der heimischen Pflanzenwelt, vol. I, Die Gewinnung von Futter auf dem Ackerland. Verlag Eugen Ulmer, Stuttgart, Germany. Holden L, Fæste CK, Egaas E (2005). Quantitative sandwich ELISA for the determination of lupine (Lupinus spp.) in foods. J. Agric. Food Chem., 53:5866–5871. Holden L, Moen LH, Sletten GB, Dooper MM (2007). Novel polyclonal-monoclonal-based ELISA utilized to examine lupine (Lupinus species) content in food products. J. Agric. Food Chem., 55:2536–2542. Holden L, Sletten GBG, Lindvik H, Fæste CK, Dooper MMBW (2008). Characterization of IgE binding to lupin, peanut and almond with sera from lupin-allergic patients. Int. Arch. Allergy Immunol., 146:267–276. Ibañez MD, Martinez M, Sanchez JJ, Fernandez-Caldas E (2003). [Legume cross-reactivity]. Allergol. Immunopathol. (Madr.), 31:151–161. Ivanovic D, Ballester D, Yañez E (1983). [Formulation and nutritive value of 2 milk substitutes based on sweet lupine (Lupinus albus, var. multolupa).] Arch. Latinoam. Nutr., 33:620– 632. Kanny G, Guerin L, Moneret-Vautrin DA (2000). Risk of serious acute asthma due to lupine flour associated with peanut allergy. Rev. Med. Interne, 21:191–194. Kurlovich BS (ed.) (2002). Lupins: Geography, Classification, Genetic Resources and Breeding. Published by the author, pp. 269–286. ISBN 5-86741-034-X. Lalles JP, Peltre G (1996). Biochemical features of grain legume allergens in humans and animals. Nutr. Rev., 54:101–107. Lasztity R, Khalil MM, Haraszi R, Baticz O, Tomoskozi S (2001). Isolation, functional properties and potential use of protein preparations from lupin. Nahrung, 45:396–398. Leduc V, Moneret-Vautrin DA, Guerin L (2002). Allergenicity of lupin flour. Allergie Immunol., 34:213–217. Lee YP, Mori TA, Sipsas S, et al. (2006). Lupin-enriched bread increases satiety and reduces energy intake acutely. Am. J. Clin. Nutr., 84:975–980. Lee MJ, Pate JS, Harris DJ, Atkins CA (2007). Synthesis, transport and accumulation of quinolizidine alkaloids in Lupinus albus L. and L. angustifolius L. J. Exp. Bot., 58:935– 946.
REFERENCES
441
Lifrani A, Dubarry M, Rautureau M, Aattouri N, Boyaka PN, Tome D (2005). Peanut-lupine antibody cross-reactivity is not associated to cross-allergenicity in peanut-sensitized mouse strains. Int. Immunopharmacol., 5:1427–1435. Lilley GG (1986). The subunit structure and stability of conglutin delta, a sulphur-rich protein from the seeds of Lupinus angustifolius L. J. Sci. Food Agric., 37:895–907. Lindvik H, Holden L, Løvik M, Cvancarova M, Halvorsen R (2008). Lupin sensitization and clinical allergy in food allergic children in Norway. Acta Paediatr., 97:91–95. Locati D, Morandi S, Zanotti M, Arnoldi A (2006). Preliminary approaches for the development of a high-performance liquid chromatography/electrospray ionization tandem mass spectrometry method for the detection and label-free semi-quantitation of the main storage proteins of Lupinus albus in foods. Rapid Commun. Mass Spectrom., 20:1305–1316. Lopez de Romana G, Graham GG, Morales E, Massa E, MacLean WC Jr (1983). Protein quality and oil digestibility of Lupinus mutabilis: metabolic studies in children. J. Nutr., 113:773–778. Løvik M (2003). [Lupine-a “sneaking” food allergen?] Tidsskr. Nor. Laegeforen., 123:2076– 2077. Løvik M, Namork E, Fæste CK, Egaas E (2004). The Norwegian national reporting system and register of severe allergic reactions to food. Norsk Epidemiol., 14:155–160. Magni C, Sessa F, Accardo E, et al. (2004). Conglutin gamma, a lupin seed protein, binds insulin in vitro and reduces plasma glucose levels of hyperglycemic rats. J. Nutr. Biochem., 15:646– 650. Magni C, Ballabio C, Restani P, et al. (2005a). Two-dimensional electrophoresis and Westernblotting analyses with anti Ara h 3 basic subunit IgG evidence the cross-reacting polypeptides of Arachis hypogaea, Glycine max, and Lupinus albus seed proteomes. J. Agric. Food Chem., 53:2275–2281. Magni C, Herndl A, Sironi E, et al. (2005b). One- and two-dimensional electrophoretic identification of IgE-binding polypeptides of Lupinus albus and other legume seeds. J. Agric. Food Chem., 53:4567–4571. Magni C, Scarafoni A, Herndl A, et al. (2007). Combined 2D electrophoretic approaches for the study of white lupin mature seed storage proteome. Phytochemistry, 68:997–1007. Marrs T (1996). Lupin-based food. Health Bull. (Edinburgh), 54:366–367. Martınez SIM, Ibañez SMD, Fernandez-Caldas E (2000). Hypersensitivity to members of the botanical order Fabales (legumes). J. Investig. Allergol. Clin. Immunol., 10:187–199. Martins JM, Riottot M, de Abreu MC, et al. (2005). Cholesterol-lowering effects of dietary blue lupin (Lupinus angustifolius L.) in intact and ileorectal anastomosed pigs. J. Lipid Res., 46:1539–1547. Matheu V, de Barrio M, Sierra Z, Garcia-Bara MT, Tornereo P, Baez ML (1999). Lupineinduced anaphylaxis. Ann. Allergy Asthma Immunol., 83:406–408. Melo TS, Ferreira RB, Teixeira AN (1994). The seed storage proteins from Lupinus albus. Phytochemistry, 37:641–648. Mills EN, Jenkins JA, Alcocer MJ, Shewry PR (2004). Structural, biological, and evolutionary relationships of plant food allergens sensitizing via the gastrointestinal tract. Crit. Rev. Food Sci. Nutr., 44:379–407. Molkhou P (2003). [The problems of the child with food allergies]. Eur. Ann. Allergy Clin. Immunol., 35:7–8.
442
LUPIN ALLERGEN DETECTION
Moneret-Vautrin DA (2007). [Allergic risk and role of the Allergy Vigilance Network]. Bull. Acad. Natl. Med., 191:807–814. Moneret-Vautrin DA, Guerin L, Kanny G, Flabbee J, Fremont S, Morisset M (1999). Crossallergenicity of peanut and lupine: the risk of lupine allergy in patients allergic to peanuts. J. Allergy Clin. Immunol., 104:883–888. Moneret-Vautrin DA, Kanny G, Morisset M, Fardeau F, Beaudouin E, Parisot L (2004). [Severe food anaphylaxis: 107 cases registered in 2002 by the Allergy Vigilance Network]. Allerg. Immunol. (Paris), 36:46–51. Moreno-Ancillo A, Gil-Adrados AC, Dominguez-Noche C, Cosmes PM (2005). Lupine inhalation induced asthma in a child. Pediatr. Allergy Immunol., 16:542–544. Mubarak AE (2001). Chemical, nutritional and sensory properties of bread supplemented with lupin seed (Lupinus albus) products. Nahrung, 45:241–245. Mukherjee KD (1989). Protein-Konzentrate und Protein-Isolate aus Raps und Lupinen. Ber. Landwirtsch. Sondern., 201:259–273. NDA (Scientific Panel on Dietetic Products, Nutrition and Allergies) (2005). Opinion of the Scientific Panel on Dietetic Products, Nutrition and Allergies on a request from the Commission related to the evaluation of lupin for labelling purposes. EFSA J., 302:1–11. Novembre E, Moriondo M, Bernadini R, Azzari C, Rossi ME, Vierucci A (1999). Lupin allergy in a child. J. Allergy Clin. Immunol., 103:1214–1216. Parisot L, Aparicio C, Moneret-Vauttrin DA, Guerin L (2001). Allergy to lupine flour. Allergy, 56:918–919. Peeters KA, Nordlee JA, Penninks AH, et al. (2007). Lupine allergy: not simply cross-reactivity with peanut or soy. J. Allergy Clin. Immunol., 120:647–653. Quaresma RR, Viseu R, Martins LM, Tomaz E, Inacio F (2007). Allergic primary sensitization to lupine seed. Allergy, 62:1473–1474. Radcliffe M, Scadding G, Brown HM (2005). Lupin flour anaphylaxis. Lancet, 365:1360. Rance F (2000). Current childhood food allergies. Allerg. Immunol. (Paris), 32:366–376. Reis AM, Fernandes NP, Marques SL, et al. (2007). Lupine sensitisation in a population of 1,160 subjects. Allergol. Immunopathol. (Madr.), 35:162–163. Restani P, Duranti M, Cerletti P, Simonetti P (1981). Subunit composition of the seed globulins of Lupinus albus. Phytochemistry 20:2077–2083. Roberts G (2007). Anaphylaxis to foods. Pediatr. Allergy Immunol., 18:543–548. Rojas-Hijazo B, Garces MM, Caballero ML, Alloza P, Moneo I (2006). Unsuspected lupin allergens hidden in food. Int. Arch. Allergy Immunol., 141:47–50. Romano C, Ferrara A, Tarallos S (1997). Allergic reaction to lupine seed (Lupinus albus). Allergy, 52:113–114. R€ omer P (1994). Lupinen-Verwertung und Anbau, vol. 2, Gesellschaft zur F€ orderung der Lupinen e.V, Im Rheinfeld 1–13, D-76437 Rastatt, Germany. Rotiroti G, Skypala I, Senna G, Passalacqua G (2007). Anaphylaxis due to lupine flour in a celiac patient. J. Investig. Allergol. Clin. Immunol., 17:204–205. Salmanowicz BP (2000). Capillary electrophoresis of seed 2S albumins from Lupinus species. J. Chromatogr. A, 894:297–310. Salmanowicz BP, Weder JKP (1997). Primary structure of 2S albumin from seeds of Lupinus albus. Z. Lebensm. Unters. Forsch. A, 204:129–135.
REFERENCES
443
Sampson HA, Mendelson L, Rosen JP (1992). Fatal and near-fatal anaphylactic reactions to food in children and adolescents. N. Engl. J. Med., 327:380–384. Scarafoni A, Di Cataldo A, Vassilevskaia TD, et al. (2001). Cloning, sequencing and expression in the seeds and radicles of two Lupinus albus conglutin g genes. Biochim. Biophys. Acta, 1519:147–151. Schwend T, Redwanz I, Ruppert T, Szenthe A, Wink M (2003). Analysis of proteins in the spent culture medium of Lupinus albus by electrospray ionisation tandem mass spectrometry. J. Chromatogr. A, 1009:105–110. Shaw J, Roberts G, Grimshaw K, White S, Hourihane J (2008). Lupin allergy in peanut-allergic children and teenagers. Allergy, 63:370–373. Shewry PR, Napier JA, Tatham AS (1995). Seed storage proteins: structures and biosynthesis. Plant Cell, 7:945–956. Sironi E, Sessa F, Duranti M (2005). A simple procedure of lupin seed protein fractionation for selective food applications. Eur. Food Res. Technol., 221:145–150. Sirtori CR, Lovati MR, Manzoni C, et al. (2004). Proteins of white lupin seed, a naturally isoflavone-poor legume, reduce cholesterolemia in rats and increase LDL receptor activity in HepG2 cells. J. Nutr., 134:18–23. Smith WB, Gillis D, Kette FE (2004). Lupin: a new hidden food allergen. Med J Aust., 181:219–220. Sonnhammer ELL, Eddy SR, Durbin R (1997). Pfam: a comprehensive database of protein families based on seed alignments. Proteins, 28:405–420. Taha FS, Attia M, Shehata NA (1982). Protein enrichment of bread: I. Chemical and sensoric evaluation. Z. Ernahrungswiss., 21:77–82. Tai HH, Bush RS (1997). Analysis of lupin seed protein digestibility using gel electrophoresis and immunoblots. J. Anim. Sci., 75:1934–1940. The UniProt Consortium (2009). The Universal Protein Resource (UniProt). Nucleic Acids Res., 37:D169-D174. Uauy R, Gattas V, Yañez E (1995). Sweet lupins in human nutrition In Simopoulos AP (ed.), Plants in Human Nutrition. World Review on Nutrition and Diet, vol. 77. Karger, Basel, Switzerland, pp. 75–88. Vasquez M, Knapp E, Guzman E, Zacarıas I (1989). [Sweet lupine (Lupinus luteus, var. Aurea/Weico and Lupinus albus, var. Multolupa) proteins: I. Extraction and filtration by Sephadex]. Arch. Latinoam. Nutr., 39:150–158. von Sengbusch R (1942). S€ußlupinen und Öllupinen. Landw. Jahrb., 91:763–874. Wait R, Gianazza E, Brambilla D, et al. (2005). Analysis of Lupinus albus storage proteins by two-dimensional electrophoresis and mass spectrometry. J. Agric. Food Chem., 53:4599– 4606. W€asche A, M€uller K, Knauf U (2001). New processing of lupin protein isolates and functional properties. Nahrung, 45:393–395. Wassenberg J, Hofer M (2007). Lupine-induced anaphylaxis in a child without known food allergy. Ann. Allergy Asthma Immunol., 98:589–590. Wittig de Penna E, Carreno P, Urrutia X, Lopez L, Ballester D (1987). Sensory evaluation and acceptability of cookies enriched with sweet lupine flour (Lupinus albus cv. Multolupa). J. Food Sci., 52:1434–1435. W€uthrich B (2008). Anaphylactic reaction to lupine flour because of a primary sensitization. Allergy, 63:476–477.
444
LUPIN ALLERGEN DETECTION
Yañez E, Gattas V, Ballester D (1979). [Nutritive value of lupine and its potential as human food]. Arch. Latinoam. Nutr., 29:510–520. Yañez E, Ivanovic D, Owen DF, Ballester D (1983). Chemical and nutritional evaluation of sweet lupines. Ann. Nutr. Metab., 27:513–520. Yovo K, Huguet F, Pothier J, Durand M, Breteau M, Narcisse G (1984). Comparitive pharmalogical study of sparteine and its ketonic derivative lupanine from seeds of lupinus albus. Planta Med., 50:420–424. Zacarıas I, Knapp E, Guzman E, Vasquez M, (1989). [Sweet lupine (Lupinus luteus, var. Aurea/Weico and Lupinus albus, var. Multolupa) proteins: II. Separation by electrophoresis]. Arch. Latinoam. Nutr., 39:159–170.
CHAPTER 23
Mustard Allergen Detection ANNE E. RYAN and MICHAEL S. RYAN ELISA Systems Pty. Ltd., Brisbane, Queensland, Australia
23.1
INTRODUCTION
Mustard plants belong to the Brassicaceae (Cruciferae) family, which also includes quite a number of food crops: cabbage, broccoli, cauliflower, turnip, rapeseed (canola), radish, horseradish, cress, and watercress. Mustard seeds used in food are collected from the following plant species: Scientific Name
Alias
Brassica nigra Brassica juncea Sinapis alba
Black mustard Brown or Indian or Oriental mustard White or yellow mustard or B. hirta or B. alba
Mustard is consumed in various forms throughout the world. It can be used as a condiment with meats and a variety of Asian dishes. It can be used to prepare pastes or as an ingredient for a large variety of sauces, soups, salad dressings, and marinades. It has also been used as an ingredient in some traditional remedies. It is frequently encountered in foods as a hidden allergen. 23.2
MUSTARD ALLERGY
Allergic reactions to mustard, including severe anaphylactic reactions, are well documented in clinical and laboratory studies. In 1980, Panconesi et al. described a severe anaphylactic reaction attributed to mustard with pizza and in a collection of case reports in the EFSA (European Food Safety Agency) Journal, skin, respiratory, gastrointestinal, and cardiovascular symptoms are described [2]. Symptoms ranged in Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
445
446
MUSTARD ALLERGEN DETECTION
severity from contact dermatitis to anaphylaxis. Reactions were described in both children and adults. Prevalence rates of mustard allergy seem to vary around the world. Mustard allergy appears to be rare in Australia, North America, Japan, and the UK, but more common in Europe. Skin prick testing results also need to be interpreted with caution because of the presence of chemical irritants in mustard that may cause false-positive skin reactions. From currently available data it appears that in France, food allergy to mustard is among the more common food allergies, accounting for 1–7% of food allergy [2]. A report from a round table conference by Taylor et al. lists 1 mg of mustard or 0.3 mg of total mustard protein as the lowest provoking dose [12]. These results of a double-blind, placebo-controlled food challenge of 15 patients were reported by Fabienne Rance (Department of Allergologie, Hopital des Enfants, Toulouse). A typical 50-g food serving containing 1 mg of mustard corresponds to a concentration of 20 mg of mustard per kilogram of food (or 20 ppm).
23.3
MUSTARD ALLERGENS
2S albumins are a major group of storage proteins that include several tree nut and seed allergens. Two structurally similar major mustard seed allergens have been identified as belonging to the 2S albumin group [4]. Sin a1 is described as a 14 kDa protein isolated from Sinapsis alba. Bra j 1 is described as a 16 kDa protein from Brassica juncea [2]. In 2005, Palomares et al. described another allergen from S. alba, named Sin a 2 [9]. The protein is a 51-kDa two-chain 11S globulin storage protein, shown to belong to the cupin superfamily of plant food allergens. It was demonstrated to bind IgE in mustard-sensitive patients.
23.4
LEGISLATION
On November 10, 2003, Directive 2000/13/EC of the European Parliament was amended and mustard and products thereof were included in Annex IIIa [1]. Mustard was considered a significant food allergen in the European Union and was therefore added to the list of ingredients that must be declared on food labels. Commission Directive 2007/68/EC of November 27, 2007 has continued to include mustard in Annex IIIa [3].
23.5
DETECTION OF MUSTARD IN FOOD SAMPLES
Because of the small size of mustard seeds and a low reported threshold dose (1 mg), sensitive reliable analytical methods are required to detect and quantify undeclared mustard in foods and to enable food manufacturers to check for cross-contamination.
DETECTION OF MUSTARD IN FOOD SAMPLES
447
Assays need to be able to detect a concentration of 20 mg of mustard per 1 kg of sample, to ensure that foods are below the threshold concentration suggested by Taylor et al. [12]. A number of assays using a variety of detection systems have been developed and reported since 2005. R-Biopharm AG has released a qualitative, real-time PCR mustard detection kit, the SureFood Allergen Mustard Kit [10]. The kit targets and amplifies a DNA fragment present in S. alba. The sensitivity of the system is reported to be approximately 10 mg of mustard per kilogram of sample. No cross-reactivity to other plant species has been reported. A number of enzyme-linked immunosorbent assay (ELISA) methods have also been reported. Koppelman et al. (2007) reported the development of ELISA methods to detect mustard protein contamination of mustard seed oil [6]. A rabbit polyclonal antiserum was raised to B. juncea and used to develop an inhibition ELISA assay with a reported detection limit of 1.5 ppm (mg/kg). Weak cross-reactivity with soy (0.016%) and milk (0.28%) was reported. ELISA Systems Mustard Seed Protein Residue kit was released in June 2007. A polyclonal rabbit antiserum was raised and used to develop a quantitative sandwich ELISA that has been demonstrated to detect mustard seed protein from all three species of mustard plants: S. alba, B. nigra, and B. juncea [5]. The detection limit of the kit has been shown to be less than 0.5 ppm (mg/kg) of soluble mustard protein, which corresponds to mustard seed concentrations below 3.4 ppm S. alba, below 4.9 ppm B. nigra, and below 5.5 ppm B. juncea. An example of a calibration curve is presented in Figure 23.1. Cross-reactivity studies were conducted on full-strength extracts from 50 plants and other common foods, and cross-reactivity was observed only with rapeseed (Canola), Brassica napus. This cross-reactivity was approximately 50%, but purified canola oil did not cross react.
2 1.8
OD (450 nm)
1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 0
2
4 6 8 10 Mustard Seed Protein (ppm)
12
FIGURE 23.1 Example of a mustard seed protein calibration curve for a sandwich ELISA. (Courtesy of Elisa Systems.)
448
MUSTARD ALLERGEN DETECTION
In January 2008, Shim and Wanasundara announced their development of a sandwich ELISA that targets the Sin a 1 allergen from S. alba [11]. The assay was developed to quantify Sin a 1 levels in various yellow mustard seed lines, but was reported to be less sensitive than the previously described B. juncea assay developed by Koppleman et al. [6]. In early 2008, Lee et al. reported the development of two sandwich ELISAs to the three varieties of mustard seed [7]. The assays were reported to have limits of quantification of 1 and 3 ppm mustard seed. A wide variety of foods and ingredients were tested for cross-reactivity, but significant cross-reactivity was observed only with rapeseed. In May 2008, Malmheden-Yman et al. reported the development of a competitive ELISA to analyze food products for the presence of S. alba and B. juncea [8]. This qualitative assay has a detection limit below 1 ppm (1 mg/kg) mustard seed, and crossreactivity has been observed only with extract from rapeseed (B. napus). 23.5.1
Some Issues with Mustard Seeds
Mustard seeds are small and may be difficult to detect visually in a mixture of foods substances such as herbs, spices, or grains. The seeds need to be broken open to allow efficient extraction and detection of their proteins when using ELISA techniques. Thorough homogenization of samples is needed to allow accurate determination of mustard concentration levels. There are three different species of plants whose seeds are used alone or in various combinations to produce mustard products. When selecting an analytical technique, careful consideration needs to be given to which species of mustard seeds are detected and which species are likely to be in the samples being tested. Different varieties tend to be dominant in different geographical regions, but in today’s global marketplace, seeds could end up in a location distant to where they were grown. If the species likely to be present is not known, a multispecies assay is required. Most of the ELISA assays developed report cross-reactivity with the closely related rapeseed (B. napus). However, as rapeseed is used to produce canola oil (which does not cross react) and canola meal that is used in animal feed, this cross-reaction is not expected commonly to cause interference when testing foods or food ingredients produced for human consumption. 23.5.2
Some Issues with Food Samples
“The major mustard allergens do not appear to lose significant activity during food processing” [2]. Although this is unfortunate for sensitized consumers, it does mean that mustard proteins are not as easily denatured as some other food allergens and can be detected by ELISA techniques postprocessing. However, as with all ELISA food allergen techniques, chemicals present in foods can interfere with the extraction and detection of mustard allergens from food samples. Polyphenols are colored compounds found in the bark, leaves, and fruit of many plants, giving foods their characteristic colors and flavors. Unfortunately, in the food
REFERENCES
449
testing laboratory, they also interfere with the extraction and detection of food allergens. It may be necessary to use a modified extraction solution to minimize this interference. Extremes of pH can also affect the structure and solubility of biological proteins, including food allergens. Acidic food samples can be a problem in the food testing laboratory. pH adjustment prior to the extraction step may be necessary to optimize the extraction and detection of mustard allergens from acidic foods. Strong spices and flavors such as chillies, peppers, and herbs can also reduce the detection of food allergens. Proteolytic enzymes present in herbs can partially digest food allergens and make them less reactive in ELISA techniques. Other chemicals present in samples can interfere. In such cases it may be necessary to modify the extraction technique using higher volumes of extraction solution to dilute the interfering chemicals. Oily and fatty foods can also present a challenge. If an allergen is to be extracted into an aqueous extraction solution then very thorough mixing is necessary to emulsify the sample in the extraction solution and ensure that there is maximum contact between the lipid and aqueous phases. A vortex style mixer would be helpful. While ELISA techniques can provide a relatively cheap and straightforward method to detect hidden mustard allergens in foods, it is essential that a testing laboratory thoroughly evaluate a technique before it is introduced into routine testing. What type of mustard is detected? Do I need to expect false positives? How efficiently is the mustard allergen extracted and detected from the food matrices I wish to test? Validation data may be a helpful start but will certainly not include every possible allergen/matrix combination. The more familiar you are with a method, the more able you are to interpret results meaningfully.
REFERENCES 1. EC (European Commission) (2003). Directive 2003/89/EC of Nov. 25, 2003. 2. EC (2004). Chapter XVIII, Allergy to mustard. In Opinion of the Scientific Panel on Dietetic Products, Nutrition and Allergies on a request from the Commission relating to the evaluation of allergenic foods for labelling purposes (Request EFSA-Q-2003-016). EFSA J., 32:120–128. 3. EC (2007). (Nov. 28, 2007). Directive 2007/68/EC of Nov. 27, 2007. 4. Breiteneder H, Radauer C (2004). Molecular mechanisms in allergy and clinical immunology: a classification of plant food allergens. J. Allergy Clini. Immunol., 113 (5):821–830. 5. ELISA Systems (June 2007). Mustard seed protein residue detection kit validation report. In-house document. http://www.elisasystems.com/ (accessed May 20, 2008). 6. Koppelman SJ, Vlooswijk R, Bottger G (2007). Development of an enzyme-linked immunosorbent assay method to detect mustard protein in mustard seed oil. J. Food Prot., 70(1):179–183. 7. Lee P-W, Hefle SL, Taylor SL (2008). Sandwich enzyme-linked immunosorbent assay (ELISA) for detection of mustard in foods. J. Food Sci. 73(4):T62–T68. Program and
450
8.
9.
10.
11.
12.
MUSTARD ALLERGEN DETECTION
Abstracts of Papers to Be Presented During Scientific Sessions, 2008 AAAAI Annual Meeting. Malmheden-Yman I, Almgren J, Kruse B, Ferm M (2008). Mustard detection in food samples. National Food Administration, Uppsala, Sweden. Poster presented at the Fifth Workshop on Food Allergen Methodologies, Halifax, Nova Scotia, Canada, May 2008. Palomares O, Cuesta-Herranz J, Vereda A, Sirvent S, Villalba M, Rodriguez R (2005). Isolation and identification of an 11S globulin as a new major allergen in mustard seeds. Ann. Allergy Asthma Immunol., 94(5):586–592. R-Biopharm (2008). S3109 SureFood Allergen mustard real-time PCR kit for the qualitative detection of DNA from mustard. Instruction Manual. http://www.r-bio pharm.com/ product_site.php?product_id¼520&product_class_one¼QWxsZXJnZW5z&product_ class_two¼TXVzdGFyZA¼¼&product_class_three¼&product_range¼Foo d%20and %20Feed%20Analysis& (accessed May 20, 2008). Shim Y, Wanasundara JPD (2008). Quantitative detection of allergenic protein Sin a 1 from yellow mustard (Sinapis alba L.) seeds using enzyme-linked immunosorbent assay. J. Agric. Food Chemi., 56:1184–1192. Taylor SL, Hefle SL, Bindslev-Jensen C, et al. (2002). Factors affecting the determination of threshold doses for allergenic foods: How much is too much? J. Allergy Clini. Immunol., 109(1):24–30.
CHAPTER 24
Celery Allergen Detection CHARLOTTA ENGDAHL AXELSSON € ping, Sweden Eurofins Food & Agro Sweden AB, Ldinko
24.1
INTRODUCTION
Allergy to celery (Apium graveolens) is one of the most common pollen-related food allergies and a common cause of anaphylactic reactions in certain European countries (Andre et al., 1994; Jankiewicz et al., 1996). There is a strong relation between celery allergy and birch pollen and mugwort pollen sensitization (Breiteneder et al., 1995; Vieths et al., 1995; Jankiewicz et al., 1996; Hoffmann-Sommergruber et al., 1999b). Celery is consumed raw, as a cooked vegetable, as fermented pickled preserves, or as a spice. Celeriac powder from the celery root is used extensively as an ingredient in the food industry in various processed foods. Celery oleoresin, an aromatic extract from celery, is a constituent of many spice mixtures. Seeds and leaves of celery may also be included in spice mixtures. A dose of 0,7 g of raw celery can induce allergic reactions, while dried and pulverized celery root can induce symptoms after consumption of 0,16 g (Ballmer-Weber et al., 2000, 2002). This difference is suggested to be related to the increased concentration of proteins in the dried product. Thermal processing such as cooking only partly reduces the allergenic activity of celery (Jankiewicz et al., 1996, 1997a; Ballmer-Weber et al., 2002). Also after cooking for more than 1 h, an allergenic activity remains in celery (Ballmer-Weber et al., 2002). The major allergen of celery is Api g 1 (allergen 1 from Apium graveolens). It is a 16-kDa protein related to the birch pollen Bet v 1 allergen (Breiteneder et al., 1995). Bet v 1 and Api g 1 belongs to the pathogenesis-related protein family 10 (Breiteneder, 2006). Bet v 1 homologous food allergens have been identified in a large number of plant species: for example, in carrot, apple, and cherry (Vanek-Krebitz et al., 1995; Scheurer et al., 1997; Hoffmann-Sommergruber et al., 1999a) and more recently also in pear, hazelnut, peanut, and soy (Karamloo et al., 2001; L€uttkopf et al., 2001; Mittag et al., 2004a,b). Pathogen-inducable proteins from parsley shows a strong sequence Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
451
452
CELERY ALLERGEN DETECTION
similarity to Bet v 1 (Hoffmann-Sommergruber et al., 1997). Both carrot and parsley are, as celery, members of the Apiaceae family. A phylogenetic relationship exists between Bet v 1 homologs from species within Apiaceae and, to a lesser extent, between species of the Apiaceae and Betulaceae and Fabiaceae families (Wen et al., 1997). Cross-inhibition experiments have verified the existence of common B-cell epitopes present on Bet v 1 homologs from celery, carrot (Dau c 1), and birch (Hoffmann-Sommergruber et al., 1999a). The crystal structure of Api g 1 has been evaluated in detail and compared to Bet v 1 to find regions responsible for the crossreactivity between Api g 1 and Bet v 1 (Schirmer et al., 2005). It was suggested that three conserved patches might account for the cross-reactivity. Two isoforms of Api g 1 exist (1.01 and 1.02) which have different characteristics of cross-reactivity to Bet v 1 (Hoffmann-Sommergruber et al., 2000; Wangorsch et al., 2007). Api g 4, a minor celery allergen, is a 15-kDa protein that belongs to a plant pan allergen “family” called profilins (Valenta et al., 1992; Vallier et al., 1992; Ebner et al., 1995). Celery profilin has a high amino acid sequence identity to other profilins, classified as allergens from distantly related plants, such as olive tree, sunflower, peanut, soy, grasses, and birch (Scheurer et al., 2000). There is a high sequence identity and similar allergenic properties in cell mediator release tests between celery profilin and profilins from pear (Pyr c 4), cherry (Pru av 4), and birch pollen (Bet v 2) (Scheurer et al., 2001). However, IgE-binding profiles indicate the presence of epitope differences. Both birch pollen and mugwort pollen extract interfere with IgE binding to celery profilin (L€ uttkopf et al., 2000). Cross-reactive carbohydrate determinants (N-glycans containing xylose and fucose residues), now addressed as Api g 5, also have immunogenic properties (F€otisch et al., 1999; Ganglberger et al., 2000; Bublin et al., 2003). However, their clinical significance is still unclear. Api g 1 is heat labile compared to Api g 4 and the very heat stable cross-reactive carbohydrate determinants (Jankiewicz et al., 1997b). Cooking for 10 min seems to be sufficient for inactivation of the allergenic activity of Api g 1.
24.2
IMMUNOBASED METHODS
Currently, there is no available immunobased method for sensitive and specific detection of celery in foods. Celery is the only allergenic food specified in labeling directive 2007/68/EC for which no commercial enzyme-linked immunosorbent assay (ELISA) test currently exists. Several efforts have been made by kit-producing companies to develop an ELISA test. A difficulty in generating celery-specific antibodies that allows sensitive detection of celery in foods without cross-reacting to other species has been addressed as one of the causes of the present absence of a test. As the allergenic activity of celery can remain after heat treatment, it is important that a test for monitoring unadventious contamination includes detection of the heat-stable celery allergens, such as Api g 4, or a possibility to detect heat-denaturized Api g 1. Use of a possible existing nonallergenic celery-specific heat-stable marker protein as a target could be a different approach. Regardless of which target is chosen,
DNA-BASED METHODS
453
the specificity has to be evaluated carefully considering the many possible crossreactions.
24.3
DNA-BASED METHODS
The use of polymerase chain reaction (PCR) is an alternative to immunobased methods. A presence of celery-specific DNA in a sample is used as a marker for the presence of celery. It is not necessary to detect the genes encoding for a celery allergen. Other more specific genes may be used for the detection of the food item. During PCR a target DNA is amplified if present. The amplified product may be detected either by gel-based PCR (conventional PCR) or by real-time PCR. If gelbased PCR is used, the PCR product should be confirmed. For real-time PCR, a labeled probe, which enables specific detection during amplification, is commonly used. The use of real-time PCR implies a lower risk of contamination and is more suitable for automation than is gel-based PCR. Important aspects of the PCR assay are, besides the specificity of the amplified DNA region, the length of the amplicon. It is generally considered that a base-pair fragment of 60 to 150 is preferable to amplify if processed food is to be analyzed and up to 250 base-pair for nonprocessed foods (CEN, 2009). A gel-based PCR assay targeting the gene encoding Api g 1 has been developed by Jankiewicz et al. (1997a). This assay is based on amplification of a 241- or a 480-bp DNA fragment (two alternatives) and includes sequencing of the PCR product as a confirmation step. The limit of detection of the assay is 100 ppm in various food products using native celery as reference material. This method is not optimally constructed for processed foods, due to the length of the amplicons. It should also be mentioned that celery from fermented celery juice could not be detected, and it is well known that DNA may be degraded by low pH. A real-time PCR assay targeting the gene for Api g 1, although not entirely specific for celery, is described by Stephan et al. (2004). According to FASTA searches in gene databases, the Api g 1 gene is homologous to carrot genes (Mustorp et al. 2008). Several PCR assays using the celery-specific mannitol dehydrogenase gene as a target have been developed. A gel-based PCR assay based on amplifying a 279-bp fragment was demonstrated to be specific for celery (Dovicovicova et al., 2004). The limit of detection was reported to be 100 genome copies, and if related to celery from fresh leaves, 0.1% in meat p^ates, which is possibly too high to be an appropriate tool for control of unadventious contamination of celery in the food industry. A real-time PCR system for specific and sensitive detection of DNA from celery has been developed by Hupfer et al. (2007) targeting a 101-bp fragment within the mannitol dehydrogense gene and within the same area as described by Dovicovicova et al. (2004). This PCR assay has been investigated extensively for possible cross-reactions with closely related species within the Apiaceae family as well as with many other species, and found to be entirely specific. The limit of detection using grounded celery seeds as reference material in sausage was reported to be 5 to 10 mg/kg. The sensitivity of this assay should be sufficiently good to be a
454
CELERY ALLERGEN DETECTION
useful tool for monitoring of unadventious contamination in the food industry provided that the sensitivity related to heat-treated celery is about equal. This system includes an amplification control to demonstrate possible PCR inhibition. Each PCR vessel was spiked with 100 genome copies of the amplicon received by the use of the PCR assay described by Dovicovicova et al. (2004). Another real-time PCR assay for detection of celery also targeting the mannitol dehydrogenase gene has been developed by Mustorp et al. (2008). This assay, based on amplification of a 151-bp fragment, easily detected the presence of celery DNA in the range 10 to 100 ppm when different food products and swabs for sampling of surfaces were spiked with celeriac powder. This celeriac powder had undergone rapid heat treatment at 85 to 90 C, which is a common process for this type of product. The higher limit of detection was found when raw meat was analyzed compared to samples of vegetable products, which could indicate that raw meat is a slightly more difficult matrix to analyze or that the sample preparation was not fully optimized for meat. However, the difference is small, and for practical reasons it is preferable to choose a sample preparation with generally good performance, as the matrices may vary considerable. Therefore, an amplification control should always be used in a concentration relevant to trace PCR inhibition and to evaluate if the result is valid (CEN 2009). For example, an extract of celery DNA with a known copy number in about the same number or slightly higher than the limit of detection may be added to the PCR vessel containing the sample extracted. It is important to consider that this addition may itself affect the detection level. An extra PCR vessel containing the spike control and the extracted sample is often used. The performance characteristics of the methods developed by Mustorp et al. (2008) showed that this assay, besides detection, is suitable for quantification, as the PCR was operated with constant efficiency. However, it is necessary to be able to develop tools for evaluation of the extraction efficiency before a reliable quantitative method can be used. There are also commercially available real-time PCR kits for celery detection, such as SureFood Allergen Celery from R-Biopharm. Generally, there is no information from PCR kit suppliers about the target for the assays, including the length of the amplicons. Information on the limit of detection in foods related to the use of a clearly specified reference material is also often missing.
24.4
CONCLUSIONS
PCR has a great potential for differentiation between phylogenetically closely related species. Also, the entire PCR chemistry and recombinant thermostable DNA polymerase can be synthesized and manufactured in unlimited amounts and constant quality (Holzhauser et al., 2006). This is not always the case regarding ELISA tests, for which the quality may vary considerably between batches, particularly for tests based on polyclonal antibodies. In addition, the use of an amplification control for each individual sample in the PCR vessel enables the measurement of potential adverse effects on the PCR reaction, in contrast to the reaction between target, antibodies, and conjugate in an ELISA reaction.
REFERENCES
455
It is important to understand the correlation between the marker DNA and the potentially allergenic food proteins. For example, aromatic extracts of celery, such as celery oleoresin, sometimes contains proteins but no detectable DNA. These proteins must be considered as potential allergenic unless proved otherwise. Special caution must also be taken that DNA might be separated from the potential allergenic proteins during refining of products such as protein isolates, sugars, starch, and highly processed vegetable oils. In addition, DNA may be degraded by low pH and by extensive heat. The pH and heat affect the protein structure as well and thus the performance of an ELISA assay. Finally, it must be pointed out that neither ELISA tests nor PCR assays currently available have the capability to evaluate the allergenicity of a food sample directly.
REFERENCES Andre F, Andre C, Colin L, Cacaraci F, Cavagna S (1994). Role of new allergens and of allergens consumption in the increased incidence of food sensitization in France. Toxicology, 93:77–83. Ballmer-Weber BK, Vieths S, L€uttkopf D, Heuschmann P, W€ uthrich B (2000). Celery allergy confirmed by double-blind, placebo-controlled food challenge: a clinical study in 32 subjects with a history of adverse reactions to celery root. J. Allergy Clin. Immunol., 106:373–378. Ballmer-Weber BK, Hoffmann A, W€uthrich B, et al. (2002). Influence of food processing on the allergenicity of celery: DBPCFC with celery spice and cooked celery in patients with celery allergy. Allergy, 57:228–235. Breiteneder H (2006). Classifying food allergens. In Koppelman SJ, Hefle SL (eds.), Detecting Allergens in Food. Woodhead Publishing, Cambridge, UK, pp. 21–66. Breiteneder H, Hoffmann-Sommergruber K, O’Riordain G, et al. (1995). Molecular characterization of Api g 1, the major allergen of celery (Apium graveolens), and its immunological and structural relationships to a group of a 17-kDa tree pollen allergens. Eur. J. Biochem., 233:484–489. Bublin M, Radauer C, Wilson IBH, et al. (2003). Cross-reactive N-glycans of Api g 5, a high molecular weight glycoprotein allergen from celery, are required for immunoglobulin E binding and activation of effector cells from allergic patients. FASEB J., 17:1697–1699. CEN (Comite Europeen de Normalisation) (2009). Foodstuffs: Detection of Food Allergens by Molecular Biological Methods, Part 1. General Considerations. EN 15634–1:2009. CEN, Brussels, Belgium. Dovicovicova L, Olexova L, Pangallo L, Siekel P, Kuchta T (2004). Polymerase chain reaction (PCR) for the detection of celery (Apium graveolens) in food. Eur. Food Res. Technol., 218:493–495. Ebner C, Hirschwehr R, Bauer L, et al. (1995). Identification of allergens in fruits and vegetables: IgE cross-reactivities with the important birch pollen allergens Bet v 1 and Bet v 2 (birch profilin). J. Allergy Clin. Immunnol., 95:962–969. F€ otisch K, Altman F, Haustein D, Vieths S (1999). Involvement of carbohydrate epitopes in the IgE response of celery-allergic patients. Int. Arch. Allergy Immunol., 120:30–42.
456
CELERY ALLERGEN DETECTION
Ganglberger E, Radauer C, Grimm R, et al. (2000). N-Terminal sequences of high molecular weight allergens from celery tuber. Clin. Exp. Allergy, 30:566–570. Hoffmann-Sommergruber K, Vanek-Krebitz M, Radauer C, et al. (1997). Genomic characterization of members of the Bet v 1 family: genes coding for allergens and pathogenesis-related proteins share intron positions. Gene, 197:91–100. Hoffmann-Sommergruber K, O’Riordain G, Ahorn H, et al. (1999a). Molecular characterization of Dau c 1, the Bet v 1 homologous protein from carrot and its cross-reactivity with Bet v 1 and Api g 1. Clin. Exp. Allergy, 29:840–847. Hoffmann-Sommergruber K, Demoly P, Crameri R, et al. (1999b). IgE reactivity to Api g 1, a major celery allergen, in a central European population is based on primary sensitization by Bet v 1. J. Allergy Clin. Immunol., 104:478–484. Hoffmann-Sommergruber K, Ferris R, Pec M, et al. (2000). Characterization of Api g 1.0201, a new member of the Api g 1 family of celery allergens. Int. Arch. Allergy Immunol., 122:115–123. Holzhauser T, Stephan O, Vieths S (2006). Polymerase chain reaction (PCR) methods for the detection of allergenic foods. In Koppelman SJ, Hefle SL (eds.), Detecting Allergens in Food. Woodhead Publishing, Cambridge, UK, pp. 125–143. Hupfer C, Waiblinger HU, Busch U (2007). Development and validation of a real-time PCR detection method for celery in food. Eur. Food Res. Technol., 225:329–335. Jankiewicz A, Aulepp H, Baltes W, et al. (1996). Allergic sensitisation to native and heated celery root in pollen-sensitive patients investigated by skin test and IgE binding. Int. Arch. Allergy Immunol., 111:268–278. Jankiewicz A, H€ubner P, B€ogl KW, et al. (1997a). Celery allergy: PCR as a tool for the detection of trace amounts of celery in processed foods. Proceedings of Euro Food Chem IX Interlaken, Switzerland, Sept. 24–26. Jankiewicz A, Baltes W, B€ogl KW, et al. (1997b). Influence of food processing on the immunochemical stability of celery allergens. J. Sci. Food Agric., 75:359–370. Karamloo F, Scheurer S, Wangorsch A, May S, Haustein D, Vieths S (2001). Pyr c 1, the major allergen from pear (Pyrus communis), is a new member of the Bet v 1 allergen family. J. Chromatogr. B, 756:281–293. L€ uttkopf D, Ballmer-Weber BK, W€uthrich B, Vieths S (2000). Celery allergens in patients with positive double-blind placebo-controlled food challenge. J. Allergy Clin. Immunol., 106:390–399. L€ uttkopf D, M€uller U, Skov PS, et al. (2001). Comparision of four variants of a major allergen in hazelnut (Corylus avellena) Cor a 1.04 with the major hazel pollen allergen Cor a 1.01. Mol. Imunol., 38:515–525. Mittag D, Akkerdaas J, Ballmer-Weber BK, et al. (2004a). Ara h 8, a Bet v 1-homologous allergen from peanut is a major allergen in patients with combined birch pollen and peanut allergy. J. Allergy Clin. Immunol., 114:1410–1417. Mittag D, Vieths S, Vogel L, et al. (2004b). Soybean allergy in patients allergic to birch pollen: clinical investigation and molecular characterization of allergens. J. Allergy Clin. Immunol., 113:148–154. Mustorp S, Engdahl Axelsson C, Svensson U, Holck A (2008). Detection of celery (Apium graveolens), mustard (Sinapsis alba, Brassica juncea, Brassica nigra) and sesame (Sesamum indicum) in food by real-time PCR. Eur. Food Res. Technol., 226:771–778.
REFERENCES
457
Scheurer S, Metzner K, Haustein D, Vieths S (1997). Molecular cloning, expression and characterization of Pru a 1, the major cherry allergen. Mol. Immunol., 34:619–629. Scheurer S, Wangorsch A, Haustein D, Vieths S (2000). Cloning of the minor allergen Api g 4 profilin from celery (Apium graveolens) and its cross-reactivity with birch pollen profiln Bet v 2. Clin. Exp. Allergy, 30:962–971. Scheurer S, Wangorsch A, Nerkamp J, et al. (2001). Cross-reactivity within the profilin panallergen family investigated by comparision of recombinant profilins from pear (Pyr c 4), cherry (Pru av 4) and celery (Api g 4) with birch pollen profiling Bet v 2. J. Chromatogr. B, 756:315–325. Schirmer T, Hoffmann-Sommergruber K, Susani M, Breiteneder H, Markovic-Housley Z (2005). Crystal structure of the major celery allergen Api g 1: molecular analysis of crossreactivity. J. Mol. Biol., 351:1101–1109. Stephan O, Weisz N, Vieths S, Weiser T, Rabe B, Vatterott W (2004). Protein quantification, sandwich ELISA, and real-time PCR used to monitor industrial cleaning procedures for contamination with peanut and celery allergens. J. AOAC Int., 87:1448–1457. Valenta R, Duchene M, Ebner C, et al. (1992). Profilins constitute a novel family of functional plant pan-allergens. J. Exp. Med., 175:377–385. Vallier P, Dechamp C, Valenta R, Vial O, Deviller P (1992). Purification and characterization of an allergen from celery immunochemically related to an allergen present in several other plant species. Identification as a profilin. Clin. Exp. Allergy, 22:774–782. Vanek-Krebitz M, Hoffman-Sommergruber K, Laimer Da Camara Machado M, et al. (1995). Cloning and sequencing of Mal d 1, the major allergen from apple (Malus domestica), and its imunological relationship to Bet v 1, the major birch pollen allergen. Biochem. Biophys. Res. Commun., 214:538–551. Vieths S, Jankiewicz A, W€uthrich B, Baltes W (1995). Immunoblot study of IgE binding allergens in celery roots. Ann. Allergy Asthma Immunol., 75:48–55. Wangorsch A, Ballmer-Weber BK, R€osch P, Holzhauser T, Vieths S (2007). Mutational epitope analysis and cross-reactivity of two isoforms of Api g 1, the major celery allergen. Mol. Immunol., 44:2518–2527. Wen J, Vanek-Krebitz M, Hoffman-Sommergruber K, Scheiner O, Breiteneder H (1997). The potential of Bet v 1 homologues, a nuclear multigene family, as phylogenetic markers in flowering plants. Mol. Phylogenet. Evol., 8:317–333.
INDEX
ABI genetic analyzers, 15, 17 disadvantage, 17 routine analysis, dye sets, 15 ABI 7700 SDS prism system, 203 Absolute quantitation, 77–79 assay, 77, 78 vs. relative quantitation, 77–82 standard curve approach, 77, 78 Adenosine triphosphate (ATP), 384 allergen control, 384 hygiene swabs, 384 Advisory Committee on Novel Foods and Processes, 427 Agarose gel electrophoresis, 47 ethidium bromide (EtBr) dye, 47 picture, 16, 21 Agricultural biotechnology, 191, 192 Agrobacterium tumefaciens, 157 NOS terminator (T-NOS), 157 Allelic ladders, 18 Allergenic food, 296, 312, 314. See also Food allergy anaphylactic shock, 314 countries, 313 extraction method, 296 in Japan, age groups, 314 production, practices/potential errors, 175 proteins, DNA as marker, 176–177 raw materials, 296 Allergenic proteins, 315, 318, 352, 355 detection, 352 IgE binding sites, 318
Allergenic reactions mechanism, 176, 285, 290, 317 factors, 317–318 minimization, 319 food labeling, 319–320 food processing, 319 heat processing, 319 threshold dose, 318–319 AllerGiene, sensitivity, 385 Allergy aware program, 274 Allergy labeling system, 301, 303 monitoring, practical test, 301, 303 decision tree, 303 Allergy vigilance network, 428 Almond ELISA, 385 vs. almond slurry, 385 Almond residue tests, 395 kits, 398, 401 procedural details, 398 specifications, 395 Alternative inhibitor detection strategy, 62 Amplicon(s), 33, 42, 73, 105, 107, 136 biotinylated, 185 length, 144–145 Amplification process, 42, 44, 60 efficiency, 60 factor, 49 Amplified fragment length polymorphism (AFLP), 141 Anaphylaxis, 268–270, 312, 335, 382, 408, 409, 413, 428. See also Allergenic reactions mechanism
Molecular Biological and Immunological Techniques and Applications for Food Chemists Edited by Bert Popping, Carmen Diaz-Amigo, and Katrin Hoenicke Copyright 2010 John Wiley & Sons, Inc.
459
460
INDEX
Animal speciation specification, 249 data interpretation, 259–260 future developments, 262 immunoassays, 254–255 antigens/antibodies, 254 meat speciation assays, 255–259 quantitative vs. qualitative testing, 261–262 regulations, 252–254 Animal species determination, 22–25, 28, 36–37, 126–127 population, 28–29 Animal species differentiation, 136, 141 DNA techniques, 136–142 AFLP, 141 microsatellites, 141–142 PCR-RFLP, 136–137 PCR using specific primer, 137–138 RAPD, 141 real-time PCR, 139–141 SCAR, 141 SNP, 142 southern hybridization, 136 SSCP, 142 Animal species identification, 142 real-time PCR systems, 142–153 Antibiotics resistance determination, 26, 129–130 Antibody(ies), 223–227, 230, 238, 254 biotin-labeled, 229 isotypes, 224 monoclonal vs. polyclonal, 226–227, 254 production, 224 adjuvant selection, 225 animal species selection, 225 immunization schedule, 225–226 post-immunization, 226 state of the art, 224 target selection, 224–225 quality assessment, 209 Antibody-based detection methods, 223 antibodies, 223–227 vs. DNA-based detection, 241–243 immunoassays, 237 factors affecting, 237–241 formats/platforms, 227–234 practical considerations in use, 234–237 validation parameters, 237–241
Applied Biosystems, 18, 34 genemapper, 18 genotyper, 18 quantifiler kit, 34 Association of Official Analytical Chemists (AOAC), 238, 298 allergen community, 399 homogeneity test protocol, modification, 300 research institute, 399 Atmospheric pressure chemical ionization (APCI), 372 Atopic dermatitis, allergic disorder, 312 Australian Food and Grocery Council (AFGC), 273 Scientific and Technical Committee, 274 Automated identification systems, 129 Hoenix/VITEK2, 129 Bacillus thuringiensis, 158 Cry genes, 157 Basic local alignment search tool (BLAST), 212 Basmati rice, 29 determination, 29–31 varieties, 30 Beef meat, gender determination, 25 Bicinchoninic acid assay (BCA), 401 Big-eye tuna, muscle, 413 BIOKITS Peanut Assay, 392, 396, 399 limit of detection (LOD), 399 limit of quantification (LOQ), 399 BIOKITS Soya Protein Assay, 339 Biological material, 6, 33 DNA yield, 33 sampling/storage conditions, 6 Biotech crops, 159, 160, 163 developing countries, 163 labeling thresholds, 160 products derived from, 159 Black hole quencher, 69 Blocking agents, 228 bovine serum albumin (BSA), 228 caseins, 228 Block machines, 76 PCR temperature-time profile, 76 Block thermal cycler, 74 bosPDE amplicon-bosPDE lightcycler system, 140
INDEX
Bovine spongiform encephalopathy (BSE), 130, 135, 257 advantages, 257 regulations, 205 Brassica napus, 447 Brassica nigra, 447 Buckwheat allergen detection, 293, 304 DNA detection method, applicability, 305 Buckwheat-soluble proteins, 305 recoveries, 305 repeatabilities, 305 reproducibilities, 305 Canadian Food and Drugs Act, 276, 278 Canadian Food Inspection Agency (CFIA), 274, 275, 278, 279 precautionary statements on food labels, 278 Capillary electrophoresis (CE), 17, 109, 354 instruments, 17 SSCP, advantages, 109 Cauliflower mosaic virus (CaMV), 157 35S promoter, 157 Caviar authentication, 213 PCR-based methods, 213 Celery allergy, 451 allergen detection, heat-stable, 452 anaphylactic reactions, 451 DNA-based methods, 453–454 polymerase chain reaction, use, 453 ELISA test, 452 immunobased methods, 452–453 Celiac disease (CD), 268–270, 359 patients, 359 symptoms, 270 Central nervous system (CNS)-specific detection methods, 200 Certified reference material calibrants (CRMCs), 167 Chelating agents, citrate/EDTA, 51 Chicken serum albumin, 317. See also a-Livetin Chondroitine sulfate analysis, 37 Cloning, 41, 53, 54, 227 Code of practice (COP), 30 Codex Alimentarius Commission (CAC), 271, 279, 284 recommendations, 286 Codex Alimentarius Committee Methods of Analysis and Sampling (CCMAS), 368
461
Codex Committee on Food Labeling (CCFL), 271 Coding sequences, 71, 157, 158, 166 Competitive immunoassay, 230 antibody-coated surface, 230 antigen-coated platform, 230 steps, 229–230 Complete Freund’s adjuvant (CFA), 225 side effects, 225 Conalbumin, 316. See also Ovotransferrin Conglutin, 431–436 domain structure, 431 fast protein liquid chromatography (FPLC) separation, 435 Cooked meat species ELISA (CMSE), 255– 258, 261 development, 255 purpose, 261 species-specific heat-resistant glycoproteins, 256, 257 development, 257 use, 256 Cow’s milk allergy, lactoglobulin gene, 351 CpG dinucleotides, methylation, 201 Cycle of threshold (Ct), 22 vs. target copy number logarithm, plot, 152 Cycle sequencing protocol, 121–122 advantages, 121 Dark quenchers, 66, 73 black hole quenchers (BHQs), 66 Data interpretation, 259–260 FFIS (Japan) protocol, 260 SENASA (Argentina) protocol, 260 USDA CMSE protocol, 259–260 Deoxynucleotide triphosphate (dNTP), 42, 143 Deoxyribonucleoside triphosphate, 124 nucleotides, see Terminators Dietary protein, source, 407 D-loop, region, 127, 128 DNA, 35, 109, 140 analyte, 200 bands, visualization, 109 barcoding, 216 binding dye chemistry, 64–65 aspect, 65 SybrGreen I, 64 binding molecule, classes, 64
462
INDEX
DNA (Continued ) bisulfite treatment, 204 concentration, 190, 191 determination, 32–36 correlation with allergenic protein, 176 factors affecting, 176 degradation, 35–36, 210 electrochemical array, 186 fingerprints, 27 fragments, 14, 47 genomic/nongenomic, target genes, 187 melting curve analysis, 140 polymerase, 44, 49, 55 profiles, 27, 31, 32 variability, 215 sequence, 34, 107, 121 selection, 107 staining dyes, 14 ethidium bromide, 14 PicoGreen, 14 tissue-specific methylation, 201 transgenic, determination, 167 DNA-based assays, 176, 177, 187, 190, 192 advantages, 177 factors affecting performance, 187–192 amplification control, 190 assay sensitivity, 190 assay variability, 191 DNA quality, 188–190 DNA recovery from food matrices, 188–190 errors minimization, 191 food processing effect on DNA integrity, 187–188 PCR inhibitors, 188 quantification, 191 target DNA concentration, 190 vs. immunoassays, 177 proliferation, 176 validation, 192–193 challenges, 192 DNA extraction methods, 8, 142–143, 176, 177, 186, 188, 189, 193–194, 300, 304, 371 cetyltrimethylammonium bromide (CTAB) method, 142 development, 188 kits, 8–10 PCR/RT-PCR, 193
qualitative, 304–307 quantitative, 307 target sequence, 186 DNA purification methods, 189, 194 magnetic-based purification, 189 paramagnetic capture-based kit, 189 Double-blind placebo-controlled food challenges (DBPCFCs), 410, 272 Duck liver pate, analysis, 37 Edible fish species, 407, 408 family tree, 408 Edible nuts, types, 377–379 Egg allergenic proteins, 311, 316 edible parts of, 316 protein recovery, by solubilizing solutions, 328 Egg allergens, 315–317 in egg white, 315–317 in egg yolk, 317 Egg allergy, 311, 312 anaphylactic shock, 312 characteristic of, 312 hen eggs, 314–315 immune system, 311 immunoglobulin E, 311 patients, 318, 319 threshold dose, 318 symptoms, 311 Egg detection method, 320 DNA-based technique, 320 enzyme-linked immunosorbent assay (ELISA), 321–322 kits, 324 labeling legislation, 320 processed food, 324–329 epitope configuration, 328–330 recovery, 329 target protein, solubilization of, 327 prozone/high-dose hook effect, 323 qualitative immunoassay kits, 326 quantitative immunoassay kits, 325–326 reference material, 324 Egg-soluble proteins, 301 recoveries, 301 repeatabilities, 301 reproducibilities, 301
INDEX
Endpoint assay, see Plate-read assay Enzyme allergosorbent test (EAST), 352 Enzyme immunoassay (EIA) technology, 250 Enzyme-labeled anti-FITC antibody, 185 colorimetric signal, 185 Enzyme-linked immunosorbent assay (ELISA), 176, 177, 193, 205, 228, 230, 231, 233, 236, 237, 242, 250, 261, 295, 298–300, 304, 321, 337, 352, 380, 415, 448 antigen-antibody interactions, 337, 416 based high-throughput platforms, 200 based methods, 279 competitive, 228, 231, 362, 369–370, 374, 393, 448 antigen-antibody complexes, 370 food allergen techniques, 448 kits, 374 FASPEK KIT, 299 FASTKIT ELISA, 298 screenings, 294 types, 294, 302 miniaturization, 233 mustard seed allergens, 448, 449 noncompetitive, 228, 231 PCR techniques, comparison, 346–347 R5 Mendez method, 288, 362 substrates, 228 types, 295, 299, 304 Epitopes, 224, 254, 363 conformational, 224 linear, 224 QQPFP, 363 Escherichia coli, 44 DNA polymerase I, 123 enteroaggregative, 130 enteroinvasive, 130 enterotoxic, 130 Ethidium bromide, 14 European Academy of Allergology and Clinical Immunology (EAACI), 267 European Commission (EC), 159–161, 270, 280 Directorate General for Health and Consumer Protection, 282 EuroPrevall project, 270 Institute for Reference Materials and Measurements, 167 regulation, 24, 159, 199
463
directive (2000/13/EC), allergens list, 280 novel food regulation (1997/258/EC), 159, 162 novelties in, 160 quantitative ingredient declaration (QUID) (2001/101/EC), 199 European Food Safety Authority (EFSA), 160, 280, 281, 381 European Institute for Reference Materials and Measurements (IRMM), 238 European network of GMO laboratories (ENGL), 161, 193 biotech crops testing and validity, 161 guideline, 193 European Union (EU), 162, 252 goal of, 252 labeling laws, 336 regulations on biotech products, 162 Event-specific analysis, 158 Exon, 11 boundaries, 71 definition, 11 Fagopyrum species, 302, 307 phylogenetic tree, 302 FASTKIT immunochromato peanut, 389 FASTKIT ELISA peanut, correlation, 389 Federal Food, Drug, and Cosmetic Act, 288 Federal Meat Inspection Act, 289 FFIS (Japan) protocol, 260 Figworth mosaic virus (FMV), 157 Fish, 413 allergenicity, 413 allergic patients, 410 consumption, 407–408 DNA, 416 egg, 321, 323 anti-ovalbumin antibody, 323 fillet, DNA content, 211 hypersensitivity, 408 parvalbumins, Coomassie blue-stained SDS-PAGE gel, 411, 412 populations identification, 216–217 sensitive patients, 414 skin, gelatine, 410, 413 species, 411, 414
464
INDEX
Fish allergens, 410–414 analytical methods, 415–416 cross-reactivity, 414 detection, 407 Fish allergy, 408, 409 exposure, routes of, 409 legislation, 410 prevalence, 408–409 symptoms, 409 threshold doses, 409–410 Fish species identification, 209, 211–215 canned fish, DNA degradation, 212 caviar, 213 fish meal, DNA analysis, 214 heated products, DNA quality, 212 marinades, 213 mitochondrial DNA, use, 211 mixed products, 214 polymerase chain reaction (PCR)-based methods, 209 raw products, 211 FITC-labeled probe, 185 Fluorescence, 61 evanescent-wave sensors, 354 probe, 184 reporter dye, 66 6-carboxyfluorescein (6-FAM), 66 ROX, 71 signal generation, 67 solution, 63 temperature curve, 65 Fluorescent resonance energy transfer (FRET), 64, 66 Fluorometric methods, 190 Food allergen(s), 285, 294–297, 448 control, rapid allergen detection kits, 392 ELISA techniques, 448 labeling, 267, 285, 293, 295 calibrator, 295–296 international regulatory environment, 267 legislation, 319 reference material, 295–296 stages, 293 mustard seeds, 448 Food Allergen Labeling and Consumer Protection Act (FALCPA), 288, 289, 382 tree nuts, definition, 405–406
Food allergen labeling requirements, 272– 290 in Australia and New Zealand, 272–274 in Canada, 274–279 allergen precautionary statements, 278 gluten free labeling, 278–279 in European Union, 280–283 allergen precautionary statements, 283 gluten-free labeling, 282–283 in Hong Kong, China, 283–284 in Japan, 285–286 in South Africa, 286–288 cross-contact management, 287 cross-contamination incidents management, 287 gluten/allergen-free labeling, 287 in United States, 288–290 allergen precautionary statements, 289 draft gluten-free labeling, 290 Food allergens detection methods, 175–177, 186, 194, 294, 296, 298 analytical methods, 176 DNA-based techniques, 177–186 biosensor technology, 186 multiplexing, 185 PCR-ELISA, 185 real-time PCR, 184 ELISA, 298 PCR method, 177–184, 300 targets in, 186–187 validation protocol criteria, 296–298, 300 Western blot method, 299–300 Food allergy(ies), 267, 269, 270, 290, 175, 311, 312, 409, 446 affect, 311 consumers, 271–272 risk management options, 271 detection techniques, 320 immunoassay, 322 protein-based techniques, 320 DNA-based techniques, 320 heat processing, 319 incidents prevention, 269–270 rationale for action, 269 repercussions, 270 skin prick testing, 446 threshold dose, advantages, 318–319
INDEX
Food and Agriculture Organization (FAO), 209 code of conduct for responsible fisheries, 209 Food and Drug Administration (FDA), 258, 320, 382 regulation, 259 Food and Drugs Act and Regulations, 274 Food intolerance, 267, 269 Food processing, 187, 239, 242, 414, 437 DNA fragmentation, 187 effects, 239, 414–415, 437 on DNA integrity, 187 procedures, 414 Food products, 25 Cosmetics and Disinfectants Act of 1972, 286 ingredients analysis, 25–26 samples preparation, elements of concern, 235–236 Food Safety and Inspection Service (FSIS), 289 Food Sanitation Law, 293 Food scandals, 135 bovine spongiform encephalopathy (BSE), 135 Food Standards Agency (FSA), 30 Food transformation process, 271 Forensically informative nucleotide sequencing (FINS) analysis, 212, 213 Gadus callarias, 410 Gadus morhua, 411 Game meat species, analysis, 88 GC content determination, 48 2 þ 4 rule, 48 GC-rich primers, 52 GC-rich templates, 52 GeneScan analysis, data, 19 Genetically modified organisms (GMOs), 38, 46, 139, 157, 159–161, 163–167 findings of, 164 occurrence, 163–165 qualitative detection strategy, 165–168 regulations on, 159–163 transgenic, percentage determination, 166 on world market, 163 Genetically modified organism (GMO) detection systems, 168–174
465
construct-specific methods, 173 BT176 construct, 174 roundup ready construct, 173 development, necessity, 38, 159 event-specific methods, 174 examples, 168 reference genes, 168 maize invertase gene, 169 plant multicopy gene, 169 soy lectin gene, 168 screening elements, 170 CaMV, 35S, 170, 171 NOS terminator, 171 NPTII gene, 172 Genome, junction region, 158 Genomic DNA, 11, 15, 128 agarose gel electrophoresis, 15 exons/introns, 11 measurement, 7 Genotyper analysis, 19, 20 data comparison, 19, 20 Gliadin detection, 364 a/b/g-gliadins, 360, 372 w-gliadin, 360, 363, 372 test kits, 364–367 Glial fibrillary acidic protein (GFAP), 200, 203, 205 detection, 200, 205 promoter sequence, use, 203 transcript, 205 Gluten, 359, 360, 372 cereals containing, labeling requirement, 178–183 definition, 360 extraction method, 372–373 food samples, 373 fragments, toxicity, 360 free food, 282, 359, 361, 363 free labeling, 374 LMW fractions, 372 protein, 276 selection method, 373–375 Gluten detection methods, 362 biosensors, 371 competitive ELISA format, 369–370 enzyme-linked immunosorbent assays, 362–363 lateral flow devices, 370 mass spectrometric method, 371–372
466
INDEX
Gluten detection methods (Continued ) polymerase chain reaction, 370–371 sandwich ELISA format, 363–369 tandem liquid chromatography-mass spectrometry, 371–372 Good laboratory practices (GLPs), 234 Good manufacturing practices (GMPs), 175 Government agencies, 253 Animal Products Speciation Regulation, 253 Haptens, 224, 228, 229 Hazard analysis and critical control point (HACCP) program, 175, 274, 370, 384 Hazelnut allergen, 186, 192 isoforms, 186, 192 Hazelnut residue test kits, 395, 398, 401 procedural details, 398 specifications of, 395 Health Canada food allergen, definition, 276 policy, 278 regulatory amendments, 276 risk assessment process, 275 Health inspection agencies, 383 Heating-cooling instruments, see Thermocyclers Hen eggs, 314–315. See also Egg nutritional value, 314 parts, 315 Heteroplasmy, 107 High-performance liquid chromatography (HPLC), 52, 184, 354, 371 purified primers, 52 High-throughput screening method, 37 matrix-assisted laser desorption-ionization time-of-flight mass spectroscopy (MALDI-TOF-MS), 37 High-throughput sequencing, 119 Housekeeping genes, 63, 167 amplification, 63 Human leukocyte antigens (HLA), 360 Hybridoma cells, 227 Hydrolysis probes, 64 Hypersensitivity reactions, 267, 268, 304, 311, 336, 408, 409 Hypervariable region, 128 C-stretch, sequence, 128
Idiosyncratic pseudoallergic reactions, 268 Immune-mediated mechanisms, role, 269 Immune system, 223, 224, 249 Immunization process, 224, 225 preparation for, 225 Immunoanalytical techniques, 352 Immunoassay, 177, 223, 227, 228, 234, 237–243, 249–251, 254, 261, 362. See also ELISA accuracy, factors affecting, 239 allergenic proteins, identification/ characterization, 177 allergen-specific antibodies production, 177 antigens/antibodies, 254–255 application, 249 competitive assays, 228 components, 227 cost-effective, 223 data processing, 237 vs. DNA-based detection, 241–243 assay development, 241 assay parameters, 242 targets, 241 ELISA, 362 factors affecting, 237 food products analysis, 251 noncompetitive assays, 228 practical considerations in use, 234–237 precision, 240 quantitative vs. qualitative testing, 261– 262 robustness, 241 sampling/sample preparation, 234–236 sensitivity, 240 species-specific proteins detection, 250 specificity, 238 validation parameters, 237 versatility, 243 Immunoassay formats/platforms, 227–234 design, 228–234 ELISA, microtiter plates, 228 immunoblotting, 233–234 lateral flow devices (LFDs), 231 multiplexing, 232 real-time biosensors, 232 labels, 227 antibody-antigen binding, 227 enzymes, 228
INDEX
fluorescent labels, 228 latex and nanogold particles, 228 radioisotopes, 228 Immunobased methods, 453 polymerase chain reaction, use of, 453 Immunoblotting, 233–234 development scheme, 233 using protein-specific human IgE, 234 Immunochemical reaction, 373, 381 Immunoglobulin E (IgE), 175, 224, 226, 267, 268, 311, 407, 415 allergen-specific, 175 based radioimmunoassay, 415 binding protein A, 226 mediated allergy, 268 tertiary structure, 224 Immunological assays, 249, 415 list of, 249–250 test kits, 383 Incomplete Freund’s adjuvant (IFA), 225 Institutional Animal Care and Use Committee (IACUC), 224 Internal positive controls (IPCs), 63 International Standards Organization (ISO), standards, 234 International Union of Pure and Applied Chemistry (IUPAC), 240 International Whaling Commission, 254 Invertebrates identification, 215–216 crustaceans, 215 mollusks, 215 Ionic detergents, sodium dodecyl sulfate (SDS), 52 Isoguanine (iso-dG), 70 Japanese labeling standard, 302 Japanese Ministry of Health, Labor and Welfare (MHLW), 162 regulations in, 162 Japanese official method, 300 Japanese regulations, 293 Joint FAO/WHO Expert Committee on Food Additives (JECFA), 272 Junction sequence, 166 Laboratory screening, 392, 393 choices for, 392–393 performance of, 399–401 procedures for, 393–399
467
b-Lactoglobulin, cow’s milk allergy, 350 Lateral flow device (LFD), 231–232, 352, 370, 374, 387 advantage, 232 competitive/noncompetitive formats, 231 construction of, 387 principles, 231 Lateral flow immunoassays (LFIAs), 250 Lean skeletal muscle tissue (LSMT), 257, 260 Legume plants, 423, 430 allergens, 437 cross-reactivity, 430 Ligation-dependent probe amplification (LPA), 186 LightCycler instrument, 76, 139 detection formats, 139 hybridization probe format, 68, 69, 139 SybrGreen I format, 139 PCR temperature-time profile, 76 Limit of detection (LOD), 190, 240, 304 Limit of quantitation (LOQ), 240, 304, 341 Limonium sinuatum, 307 Livestock-borne diseases, 252 a-Livetin, 317 Lupin, 423–426, 433, 435, 437 allergenicity, 437 allergens, 430–433 conglutins, 434 consumption, 426–427 containing foods, 428 cultivating European countries, 426 in food, detection methods, 433–437 IgE-binding proteins, 433 Leguminosae family, 423 nitrogen-fixing ability, 424 nutritional value, 425 plant, 423–425 production, 426 quantitative determination, 435 enzyme-linked immunosorbent assay (ELISA), 435 root, 424 sensitization, prevalence, 430 Lupin allergy, 428, 429 exposure routes, 429 legislation, 428–429 prevalence, 428 symptoms, 429 threshold doses, 429–430
468
INDEX
Lupin proteins, 431, 435, 436 detection, 436 immunoblot, 435 Lupin seeds, 424, 425, 431, 433 composition, 425 essential amino acids, content, 425 proteins, 431, 433 Lupinus albus, 423–425, 432 a-conglutin, 432 b-conglutin, 432 unprocessed precursor sequences, 432 Lupinus angustifolius, 431, 433 conglutin types, 433 Lupinus mutabilis, 427 Lysozyme, 316, 317 Maillard reaction, 319 Mass spectrometric methods, 355, 371 Matrix-assisted laser desorption/ionization (MALDI), 354 Matrix effect, 237, 239, 242 Meat and bone meal (MBMs), 252, 256, 257, 260 speciation in, 256 species identification, 257 Meat speciation assays, 255–259 development, 255–258 selection, 255–259 Meat species identification, 87 PCR-RFLPs method, 87, 92, 101–102 dairy products analysis using duplex PCR, 94–95 fish species differentiation, 98–100 game meat, 88–89 game meat species differentiation, 100–101 mixtures and heated materials, 88–89, 94 raw meat, 87–88, 92–94 MELISA-TEK ruminant assay, 260 Melting temperature, 49, 65 definition, 49 Methylight protocol, 203 50 -Methylisocytosine (iso-dC), 70 Microarrays, 185, 216, 233, 354 Microsatellite analysis, 12, 27–32, 125, 141–142 commercially available kits, 27 markers, 30 multiplex PCR kits, 18
Microtiter plate, 228, 230 format, 230 Milk, 349 fat-free, 350 physical/physicochemical properties, 349–350 skimmed milk, 350 Milk allergen detection, 349 Bioinformatics tools, 350 cow’s milk allergy, 349 immunoanalytical techniques, 352–354 milk proteins, 349 patients, 335, 352 physicochemical techniques, 354–355 Milk protein, 349 and allergens, 350–351 allergenicity, assessment, 351 characteristics, 350, 351 ELISA technologies, 353 foreign proteins, 349 LFD Kits, 353 Ministry of Health, Labour and Welfare (MHLW), 285, 286, 293, 294, 296, 299 validation protocol criteria, 296–297 Mitochondrial-based PCR systems, 213 Mitochondrial DNA (mtDNA), 35, 86, 126 hypervariable regions, 128 Molecular beacon probe, 68–70, 72 advantage, 69 hairpin loop structure, 68 Molecular biological techniques, 436 Molecular mass, 360 HMW, 360 LMW, 360 MMW, 360 MoniQA project, 238 Monoclonal antibodies (mAbs), production, 226 Monomeric gliadins, 360. See also Prolamins Multiplexing technique, 185–188, 232 advantage, 232 bead-based technology, 232 microarrays, 232 PCR assay, 46, 66, 185 Mustard allergen, 446 food samples detection, 445, 446, 448 ELISA methods, 447
INDEX
R-Biopharm AG, 447 threshold dose, 446 Mustard allergy, 445 anaphylactic reactions, 445 food allergies, 446 prevalence rates of, 446 Mustard plants, family, 445 Mustard seed protein calibration curve, 447 sandwich ELISA, 447 Myeloma cells, 227 MYw primer-probe system, 147, 148 National Institute of Standards and Technology (NIST), 401 Native PAGE, 108 electrophoresis conditions, 108–109 Nearest-neighbor approach, 48 Needle-free injectors, 255 pork serum albumin assay test, 255 Neuronal tissue, 206 detection by RNA specific regions, 206 vs. muscle tissue, MSP/real-time PCR, use, 203 New Zealand Grocery Marketers Association, 273 Noncompetitive immunoassay, 229, 231 antibody-antigen complex, 231 biotin-streptavidin system, 229 ELISA, 229 Nonionic detergents, 52 PEG 6000, 52 triton X-100, 52 tween-20, 52 Non-muscle tissue, detection, 200 Nonradioactive single-stranded conformation polymorphism (SSCP), 110 protocol, 110–111 No template control (NTC) wells, 79 Novel food regulation, 159 Novel protein, EPSPS, 159 Nucleic acid-binding dyes, PicoGreen, 79 Nut allergen control, 386, 390 lateral flow devices, 386 extraction details, 388 specifications of, 386 RAPID 3-D tests, 390 validation data, 390–391 Nut allergen detection, 380, 381, 384, 393
469
allergenic proteins, 380 ELISA methods, 393 immunological test kits, 383, 393 legislation, requirements of, 381–382 methodologies, 381, 384 laboratory nut screening, 392–401 nut-free manufacture, 402 on-site immunological tests, 381, 385–392 on-site nut screening, 381, 384–385 nut testing, importance of, 382–383 proficiency testing, 401 statistical results, 400 Nut species, 377, 378 overview of, 378–379 Offal, 199, 201 analytical issue, 200 components, 199 detection methods in meat products, 201 DNA-based detection, 201–204 RNA-based detection, 204–206 use, 199 On-site immunological tests, 385 performance, 389–392 procedures, 387–389 types, 385–386 Optical density (OD) values, 259, 237 Ouchterlony assay, 249 Ova, Western blotting analysis, 323 Ovomucoid antibody, 315–317 consists of, 316 heat-treated, reactivity of, 317 Ovotransferrin, 316–317 PCR products analysis, 12, 15, 32, 47–55, 137 annealing, 48 buffer, 50 denaturation, 48 elongation, 49 MgCl2 concentration, 51 number of cycles, 52 PCR efficiency, 49 PCR enhancers and additives, 52 primer concentration, 52 primer design, 51 template quality, 49 template quantity, 50 thermostable DNA polymerases, 53–55
470
INDEX
Peanut residue test kits, 392, 394, 397 procedural details, 397 specifications of, 394 Peptide nucleic acid (PNA), 185 Performance tested method, 399 Petunia hybrida, EPSPS gene, 157 Phosphodiesterase (PDE), 137, 138, 140 gene, 138 sequence differences, graphical demonstration, 138 Plateau effect, 52 Plate-read assay, 60 Polyacrylamide (PAA) gel, 17 electrophoresis, 299, 321 instruments, 17 Polyclonal antibodies (pABs), 226 production, 226 Polygonum convolvulus, 305 Polymerase chain reaction (PCR), 4, 41–43, 51, 52, 59, 119, 151, 177–184, 191, 320, 370, 453 amplification efficiency, 42, 43, 61, 343 annealing temperature, 51 applications, 22–38 assay, 61, 177, 189, 190 based high-throughput platforms, 200 based methods, 5–22, 105, 213, 215, 216, 300, 302, 307, 416 differentiation of shrimps, 216 specificity, 307 for wheat/buckwheat/peanut, 300 buckwheat detection, 306 coupling with peptide nucleic acid, 184 DNA, 7–12 concentration, measurement, 7 extraction, 7 genomic, variants, 7–12 electrophoresis, 14–20, 47 polyacrylamide gel, 14–20 capillary, 16–20 ELISA, steps, 185 enhancers, types, 52 false-positive signals, 57 fragments, detection, 22–27 hot-start, 55–56 hybridization with labeled probe, 184 inhibition mechanisms, 62 inhibitors, 188 laboratory organization, 4, 56–57
post-PCR department, 5 pre-PCR department, 4–5 thermocycler department, 5 methylation-specific, assay, 202, 203 nested, 44–46, 184 number of cycles, 52–53 original, 42–44 performance, controls, 46–47, 146–148 polysaccharides/polyphenolics, 188 preventing system, 70 primers, 36, 51, 105, 137–138 species-specific, 211 types, 105 principle, 43 quantification, 151–153 real-time, 20–22. See also Real-time PCR samples collection, 5–7 sensitivity, 190 species-specific systems, 212 steps, 12–13, 42 target genes, 300 temperature-time profile, 145 use of, 453 Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), 22, 85, 136–137, 184, 205 applications, 87–102 principle, 86 Porcine D-loop, 129 repetitive motif, sequence, 129 Poultry Products Inspection Act (PPIA), 289 Prausnitz–Kustner experiment, 415 Primer-dimers, 51 formation, 55, 72, 78 Gibbs free enthalpy, 72 Primer-probe systems, 144–145, 148 annealing temperature, 145 matrix, 75 sensitivity, 148–150 specificity, 148 Probe-based chemistries, 66–71 advantage, 66 hydrolysis probes, 66–68 Processed animal proteins (PAPs), 252 meat and bone meal (MBM), 252 Processed foods, 302, 329 antibody design, 329 buckwheat detection, 302
INDEX
DNA-based method, 304 primers designed for, 307 protein-based method, 304 quantitative ELISA method, 304 Promoters, 157, 158, 166 Protease chain reaction (PCR) tests, 338 Protein, 411 extraction of, 401 b-lineage, 411 residues, 384 Protein-sugar reaction, 319 Public health tool, 271 Pyrosequencing, 122–123. See also Real-time sequencing advantages, 122 Quantification technique, 191 Quantitative ingredient declaration (QUID), 135 guidelines, 135 Quantitative real-time PCR (qRTPCR) technique, 70, 71, 214 cDNA synthesis, 71 Quenching mechanism, 66 6-carboxytetramethylrhodamine, 66 choice, 73 dye, 22 fluorescence resonance energy transfer (FRET), 66 Quinolizidine alkaloids, 425 R5 antibody, 368 ELISA tests, 373, 374 kits, performance, 368 Skerritt antibody, comparison, 368 Radioactive isotopes, 249 Radio allergosorbent test (RAST), 351, 433 Random amplified polymorphic DNA (RAPD), 141 Random sampling, 234 Rapid 3-D tests, 387 for nut allergen control, 387 Raw gelatin analysis, 36 R-Biopharm AG, 369 Real-time machines, 73, 75 biosensors, 232 block thermal cyclers, 74 rotor-based systems, 74
471
suppliers, 75 types, 75 Real-time PCR, 21, 23, 32–38, 59–61, 63, 64, 71, 73–75, 82, 139–141, 143, 151 advantages, 75, 139, 166, 184 applications, 74–76 assay, 453 DNA analysis, 21 efficiency, comparison, 82 fluorescence curve, 60, 61 instruments, 23 kits, 454 phases, 60, 61 primer, 71–73 probes, 64 design, 71–73 quantification, advantage, 60 ready-to-use reaction plate, 150–151 real-time chemistry, 64–65 selectivity, 150 sequence detection system, 61 temperature-time profile, 146 types, 59 Reference gene system, 203 Regulation 2003/1829/EC, 160, 161 Article 13, 161 Relative quantification, 79–82 comparative Ct method (DDCt), 80–82 relative standard curve method, 79–80 advantage, 79 Relative standard deviation (RSD), 368 Reporter dye, 22 Reproducibility, of protein concentration, 296 Resonance-enhanced absorption (REA), 354 Restriction endonucleases, 85–86 Restriction fragment length polymorphism (RFLP), 22, 36, 126, 137, 212 Reverse transcriptases, 54 AMV, 54 M-MLV transcriptases, 54 Reverse transcription PCR (RT-PCR), 191 assays, 192 thermocyclers, 185 Rhizobium leguminosarum, 423 Ribosomal RNA gene, 112 internal transcribed spacer-2 (ITS-2), 112 RIDA QUICK test, 374
472
INDEX
Ridascreen Gliadin, 368, 370, 374. See also R5 antibody Ridascreen Gluten, 368. See also Skerritt antibody Ridascreen/veratox test kits, 399, 401 RNA extraction protocol, 205 Robustness, definition, 241 Roche GS FLX/454 sequencing, 123–125 Rocket immunoelectrophoresis (RIE), 351 Rotor-based systems, 74 Saccharomyces cerevisiae, 123 Sandwich ELISA method, 228, 323, 325, 340, 341, 352, 363, 415, 436, 447, 448 format, 363–369 Sanger protocol, principle, 120 SENASA (Argentina) protocol, 260 Sensitivity, 242 definition, 240 DNA methods, 258 Sequence characterized amplified region (SCAR), 141 Sequence detection system, 143 PAGE gel, 411 Sequencing-by-synthesis (SBS) system, 123 Sequencing methods, 119–126 applications, 126–131 animal species determination, 126–127 antibiotics resistance determination, 129–130 cycle sequencing, 121–122 instruments, 120 pyrosequencing, 122–123 Roche GS FLX/454 sequencing, 123–125 Sanger protocol, 120 SnapShot, 125–126 Sheep, 130, 131 genotype classes, 131 scrapie resistance, 130–131 Short interspersed nuclear elements (SINEs), 34 Short tandem repeats (STRs), 11 Single-nucleotide polymorphisms (SNPs), 37, 112, 125, 142 detection, 37–38 Single-stranded conformation polymorphism (SSCP), 106–111, 113, 142, 212 applications, 111–114, 212
seafood authentication, 113 guidelines, 108 principles, 106–110 protocol, 106 Single-stranded DNA (ssDNA) template, 43, 107, 215 preparation, 107–108 profiles comparison, 215 silver staining, 109 Skim milk powder, 384, 389, 396 FAST kit, 396 SnapShot kits, 125–126 principle, 125 Sodium dodecyl sulfate (SDS), 295, 321 electrophoresis, 234 2-ME extraction, 327 polyacrylamide gel electrophoresis (PAGE), 234, 295, 297 reproducibility, 297 Solid-phase assays, 63 Southern hybridization, 136 Soy food products, 335 genome, target sequence, 50 protein antibodies, 341 transgenic, quantitation, 168 versatility, 164–165 Soya, see Soy Soy allergen detection methods, 335–337 analytical methods, 337–339 analytical protocols, 338–339 protein detection, 337–338 anaphylaxis, 335 ELISA test, 339–343 kits, 340 sample preparation procedure, 340–341 soy protein residue assay, 339 test procedure, 341 validation data, 341–343 PCR test, 343–346 DNA detection, 344–345 DNA extraction, 343 ELISA, comparison, 346–347 sample preparation procedure, 343–344 validation data, 345–346 sensitivity test, 342, 345 specificity tests, 342, 345 Soy allergies, 335
INDEX
consumer, 337 food products, 335 hidden allergen, 336 infants/children, 335 proteins and minimum allergen dose, 336 Soy protein detection, 337, 339, 341 antibody-based tests, 337 non-antibody-based tests, 337 protein-indirect analysis, 337–338 Specificity, 242 definition, 238 test, 149 SPREETA immunoassay, 354 Stabilizing agents, 52 bovine serum albumin (BSA), 52 gelatine, 52 Standard curve, 77, 152. See also Absolute quantification curve Standard reference material (SRM), 238 Structured probes, 68 stem-loop structure regions, 68 SureFood PREP allergen, 189 Surface plasmon resonance (SPR) technology, 232, 262 applications, 232 biosensors, 186 optical detection principle, advantages of, 354 Swab gel, 16, 122 SybrGreen, 20, 64, 65, 71 type I assays, 78 type I dye, 139 type II, 109 Taq DNA polymerase, 44, 49–54, 61, 66, 69, 70 nonproofreading polymerase, 54 TaqMan assays, 72, 75 TaqMan PCR systems, 143, 153 TaqMan probes, 66, 70, 72, 73. See also Hydrolysis probes chemistry, 72 dye-quencher combination, 73 methylation status-specific, 203 MGB probes, reporter dye, 68 TaqMan technology, principle, 67 Taq polymerase, 13, 22
473
Target gene, 143–146, 157, 186, 204 Terminators, 120, 157, 158, 166 Textured vegetable protein (TVP), 335 Thermocyclers, 13, 56 department, 5 suppliers, 14 Thermus aquaticus, 44, 54, 59 Thermus thermophilus, 54 Threshold cycle, 204, 205 Tissue-specific DNA detection, 202 methylation-specific PCR (MSP) process, 202 Tissue-specific RNA expression analysis, 205 Transgenic construct, 157, 158 simplified view, 158 Transgenic crops, 159, 162, 165 regulations and thresholds information, websites for, 162 screening results, 166 Transgenic maize, 166, 168 quantitation of, 168 Troponin I, 257 anti-Troponin I antibodies, 261 species assays, 258 U.S. Department of Agriculture (USDA), 252 CMSE Protocol, 259–260 food safety and inspection service (FSIS), 256, 289 U.S. Food and Drug Administration (FDA), 288 regulation, 252 U.S. National Institute of Standards and Technology (NIST), 238 Uracyl-N-glycosyslate (UNG) enzyme, 57 Variable number tandem repeats (VNTRs) analysis, 11, 27–32 bacterial strains, identification, 31 Veratox/ELISA systems kits, 396 Veratox/Tecra VIA plates, 393 Voluntary incidental trace allergen labeling (VITAL), 274 Warm-blooded animals, 111 RFLP-SSCP, 111
474
INDEX
Western blot method, 234, 299–300, 302 Wheat prolamines, 360 proteins, 359 starches, nitrogen/gluten ratio, 361 Wizard DNA cleanup system, 189
Working group on prolamin analysis and toxicity (WGPAT), 368, 369, 373 statistical data, 369 World Health Organisation (WHO), 272 X-ray structure analysis, 355 Xanthomonas campestris, 26
FIGURE 1.9 Data from GeneScan analysis. Size of PCR products (blue, green, and black peaks) is measured by comparison with an internal size standard co-separated in the same capillary. (a) Size standard ROX500 from ABI; (b) PCR fragments and size standard.
FIGURE 6.1 Example of a DNA sequence: 650 to 740 bases from the starting point of a sequencing reaction.
FIGURE 6.7
Sequence of C-stretch located in human hypervariable region II.
FIGURE 6.8 Sequence of a repetitive motif located at the porcine D-loop (control region).
FIGURE 7.2 Graphical demonstration (electropherogram) of sequence differences in the phosphodiesterase gene between lamb, cattle, and goat.
FIGURE 7.3 Fluorescence signal specific to lamb is detectable in TaqMan PCR. Other animals showed insignificant increases in fluorescence.
FIGURE 7.5 Melting curve analysis: DNA of cattle, fallow deer, red deer, and roe deer using the bosPDE LightCycler system.
FIGURE 22.1
Species of edible lupines.
