C o n t r i b u t o r s to Volume 164 Article numbers are in parentheses followingthe names of contributors. Affiliations listed are eurr~L
STEVENAEo (10), Department of Chemistry,
Yale University, New Haven, Connecticut 06511 ANDREA BARTA(24), lnstitutfftr Biochemie, Universitdt Wien, A-1090 Vienna, Austria ANDREAS BARTETZKO (44), Max-Planck-lnstitut J~r Molekulare Genetik, Abt. Wittman, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany N. V. BELITSINA(43), A. N. Bakh Institute of Biochemistry, Academy of Sciences of the USSR, Moscow, USSR EGBERT BOEr~MA (2), Fritz-Haber-Institut der Max-Planck-Gesellschafl, D-1000 Berlin 33, Federal Republic of Germany ALEXEY A. BOODANOV (29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR ANGELA BORDEN (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York 14263 MILOSLAV BOUBLIK (3), Roche Institute of Molecular Biology, Roche Research Center, Nutley, New Jersey 07110 RICHARD BRIMACOMBE (19), Max-PlanckInstitut fi~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany MELISSA A. BUCK (36), NINCDS, National Institutes of Health, Bethesda, Maryland 20892 V. N. BusnuEv (9), Institute of Experimental Cardiology, Cardiology Research Center of the USSR Academy of Medical Sciences, 121552 Moscow, USSR DAVID G. CAMP (26), Department of Biochemistry and Biophysical Sciences, University of Houston, Houston, Texas 77004 PAULINE A. CANN (34), Department of BiD-
logical Chemistry, UCLA School of Medicine, University of California, Los Angeles, Los Angeles, California 90024 MALCOLM S. CAPEL (7, 37), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 Lx-MINa CHANGCHIEN(16, 17), Wadsworth Center for Labs and Research, New York State Department of Health, Empire State Plaza, Albany, New York 12201 C. CmARUTTrNI (20), Institut de Biologie Physico-Chimique, Laboratoire de Chimie Cellulaire, 75005 Paris, France NINA V. CmCHKOVA(29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR JAN CHRISTIANSEN(30, 49), Department of Clinical Chemistry, Bispebjerg Hospital, DK-2400 Copenhagen NF,, Denmark ROBERT CONRAD (16), Department of Biology, Indiana University, Bloomington, Indiana 47405 BARRY S. COOPERMAN(23, 36), Department of Chemistry, University of Pennsylvania, Philadelphia, Pennsylvania 19104 GARY R. CRAVENI (16, 17, 37), Laboratory of Molecular Biology and Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706 ALBERT E. DAHLBERG(47), Section of BiDchemistry, Division of Biology and Medicine, Brown University, Providence, Rhode Island 02912 DIPAK B. DATTA (17, 37), Department of Botany, University of Wisconsin, Madison, Wisconsin 53706 INGRID C. DECKMAN(13), Smith, Kline & 'Deceased.
xiii
xiv
CONTRIBUTORS TO VOLUME 164
French Research Laboratories, Molecular Genetics Research and Development, King of Prussia, Pennsylvania 19406 H.-Y. DENG (11), Clayton Foundation Biochemical Institute, Chemistry Department, University of Texas, Austin, Texas 78712 ROBERT DENMAN (25), Institute for Basic Research in Developmental Disabilities, Staten Island, New York 10314 DAVID E. DRAPER (13, 14), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 JAN EGEBJERG (49), Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark MANs EHRENBERG(42), Department of Molecular Biology, University of Uppsala, S- 751 24 Uppsala, Sweden MOHAMED ETTAYEm (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York, 14263 A. EXPERT-BEzANtTON(20), Institut Jacques Monod-C.N.R.S., Laboratoire de Photobiologie Moleculaire, 75251 Paris Cedex 05, France ANTONIO FOCELLA (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110 JOACmM FRANK (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, and School of Public Health, State University of New York at Albany, Albany, New York 12201 BETTY FREEBORN (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 ROVER GARRETT (30, 49), Department of Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark UTE GEIGENMOLLER (45), Max*Planck-Institut far Molekulare Genetik, Abt. Wittman, D-1000 Berlin 33 (Dahlem), Federal Republic of Germany DANIEL T. GEWIRTH (10), Department of Molecular Biophysics and Biochemistry,
Yale University, New Haven, Connecticut 06511 DOHN G. GLITZ (34), Department of Biological Chemistry and Molecular Biology Institute, UCLA School of Medicine, University of California, Los Angeles, Los Angeles, California 90024 LARRY GOLD (27), Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309 H. U. GORINGER (50), Max-Planck-Institut far Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany A. T. G u D t o v (9), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR JAMES F. HAINFELD (3), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 GEOROE HARAUZ(2), Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario, N1G 21 W Canada BOYD HARDESTY(11), Clayton Foundation Biochemical Institute, Chemistry Department, University of Texas, Austin, Texas 78712 DIETER HARTZ (27), Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309 JOHN E. HEARST(22), Department of Chemistry, University of California, Berkeley, Berkeley, California 94720 HANS A. HEUS (12), Department of Biochemistry, Leiden University, 2333 AL Leiden, The Netherlands WALTER E. HILL (26), Department of Chemistry, University of Montana, Missoula, Montana 59812 PAUL W. HUBER (31), Department of Chemistry, University of Notre Dame, Notre Dame, Indiana 46556 DAVID K. JEMIOLO (47), Biology Depart-
CONTRIBUTORS TO VOLUME 164
ment, Vassar College, Poughkeepsie, New York 12601 ROZA MARIA KAMP (38), Max-Planck-Institut far Molekulare Genetik, Abt. Wittman, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany JOANNE M. KEAN (14), Division of Biophysics, School of Hygeine and Public Health, Johns Hopkins University, Baltimore, Maryland 21218 ALEXEYM. KOPYLOV(29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR JOACHIM KRIEG (39), Freidrich MiescherInstitut, CH-4002 Basel, Switzerland ERNST KUECHLER (24), lnstitut far Biochemie, Universitdt Wien, A-1090 Vienna, Austria C. G. KURLAND(42), Department of Molecular Biology, University of Uppsala, S-751 24 Uppsala, Sweden APOSTOLOS KYRIATSOULIS(19), I Medizinische Klinik der Johannes, Gutenberg Universitdit, D-6500 Mainz, Federal Republic of Germany LANCE G. LAING(15), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 LINDA S. LASATER(34), Department of Biological Chemistry, UCLA School of Medicine, University of California, Los Angeles, California 90024 NEOCLES B. LEONTIS (10), Chemistry Department, Bowling Green State University, Bowling Green, Ohio 43403 ARNOLD LIEBMAN (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey07110 ROLF LIETZKE(18), Max-Planck-Institutfar Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany ROLAND LILL (41), Department of Biological Chemistry, School of Medicine, University of California, Los Angeles, Los Angeles, California 90024
XV
SAMUEL E. LIPSON (22), CODON, South
San Francisco, California 94080 DAVID MALAREK (25), Department
of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110 PETER MALY (19), Biochemisches Institut der Universitdt Zftrich, CH-8057 Zarich, Switzerland VALSAN MANDIYAN (3), Roche Institute of Molecular Biology, Roche Research Center, Nutley, New Jersey 07I 10 ALEXANDER S. MANKIN (29), A. N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, Moscow 119899, USSR DAVID S. MCPHEETERS(27), Division of Biology, California Institute of Technology, Pasadena, California 91125 DANESH MOAZED (33), Thimann Laboratories, University of California, Santa Cruz, Santa Cruz, California 95064 PETER B. MOORE (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 EDWARD A. MORGAN (46), Department of Experimental Biology, Roswell Park Memorial Institute, Buffalo, New York 14263 KNUD H. NIERHAUS (8, 18, 44, 45), Max-
Planck-Institut ff~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany CONCEPCION R. NIER~S (37), Laboratory of Molecular Biology, University of Wisconsin, Madison, Wisconsin 53706 KAYOKO NISHI (48), Department of Biological Chemistry, School of Medicine, University of California, Davis, Davis, California 95616 HARRY F. NOLLER (32, 33), Board of Studies in Biology, University of California, Santa Cruz, Santa Cruz, California 95064 PETRA NOWOTNY (8), Max-Planck-Institut )~r Molekulare Genetick, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany VOLKER NOWOTNY (8), Max-Planck-Institut far Molekulare Genetik, Abt. Witt-
xvi
CONTRIBUTORS TO VOLUME 164
Planck-Institut J~r Molekulare Genetik, mann, D-IO00 Berlin 33 (Dahlem), FedAbt. Wittmann, D-IO00 Berlin 33 (Daheral Republic of Germany lem), Federal Republic of Germany KELVIN NORSE (25), Department of BioJAMES M. ROBERTSON(40), Thimann Labochemistry, Roche Institute of Molecular ratories, University of California, Santa Biology, Roche Research Center, Nutley, Cruz, Santa Cruz, California 95064 New Jersey 07110 JOACHIM SCrINIER (48), Department of BioO. W. ODOM (11), Clayton Foundation Biological Chemistry, School of Medicine, chemical Institute, Chemistry Department, University of California, Davis, Davis, University of Texas, Austin, Texas 78712 California 95616 JAMES OFENOAND(25), Department of BioIVAN N. SHATSKY(5), A. N. Belozersky Labchemistry, Roche Institute of Molecular oratory of Molecular Biology and BioorBiology, Roche Research Center, Nutley, ganic Chemistry, Moscow State UniverNew Jersey 07110 sity, 117234 Moscow, USSR YASUNARI OGIHARA(51), Kihara Institute, CURT D. SIOMUND(46), Department of ExYokohama City University, Yokohama perimental Biology, Roswell Park Memo232, Japan rial Institute, Buffalo, New York 14263 ANDR~E R. OLIVIER (39), Friedrich EVOENY A. SKRIPraN (29), A. N. Belozersky Miescher-Institut, CH-4002 Basel, SwitLaboratory of Molecular Biology and zerland Bioorganic Chemistry, Moscow State UniGARY J. OLSEN (53), Department of Microversity, Moscow 119899, USSR biology, University of Illinois, Urbana, IlliA. S. SPIRIN (28, 43), Institute of Protein nois 61801 Research, Academy of Sciences of the HELEN McKuSFdE OLSON (34), Department USSR, 142292 Pushchino, Moscow Reof Biological Chemistry, UCLA School of gion, USSR Medicine, University of California, Los MICHAEL J. R. STARK (47), Leicester BioAngeles, Los Angeles, California 90024 centre, University of Leicester, Leicester, GERRIT T. OOSTERGETEL(3), Roche InstiEngland tute of Molecular Biology, Roche Research ROLE STEEN (47), Department of Molecular Center, Nutley, New Jersey 07110 Biology, Biomedicum, University of UppHARALD PAULSEN (40), Botanisches Instisala, S-751 24 Uppsala, Sweden tut, Universit~t Mf2nchen, D-8000 Mfmchen 19, Federal Republic of Germany GONTER STEINER (24), Allg. Krankenhaus, II. Med. Universitdtsklinik, A-1090 ANASTASIA PROMBONA (51), Max-PlanckVienna, Austria Institut far Molekulare Genetik, Abt. Wittmann, D-1000 Berlin 33 (Dahlem), Fed- SETH STERN (33), Thimann Laboratories, eral Republic of Germany University of California, Santa Cruz, Santa Cruz, California 95064 MICHAEL RADERMACHER (1), Wadsworth Center for Laboratories and Research, WOLFGANG STIEGE (19), Max-Planck-InstiNew York State Department of Health, Altut f~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Fedbany, New York, 12201 eral Republic of Germany V. RAMAKRISHNAN (7), Biology Department, Brookhaven National Laboratory, GEORG STOFFLER(4, 35), InstitutfarMikroUpton, New York 11973 biologie der Medizinische Fakultd~t, Universiti~t Innsbruck, A-6020 Innsbruck, BERNHARD REDL (4), Institut far MikrobioAustria logie der Medizinische Fakult,~t, Universitdt Innsbruck, A-6020 Innsbruck, Austria MARINA STOFFLER-MEILICKE(4, 35), MaxPlanck-Institut ~ r Molekulare Genetik, HANS-JORG RHEINBERGER (45), Max-
CONTRIBUTORS TO VOLUME 164
Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany ALAP R. SUBRAMANIAN(51), Max-PlanckInstitut fi~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany GRACE SUN (10), Department of Chemistry, Yale University, New Haven, Connecticut 06511 WILLIAM E. TAPPRICH (26), Division of Biology and Medicine, Brown University, Providence, Rhode Island 02912 ANCHALEE TASSANAKAJOHN(26), Department of Chemistry, Ramkamhangu University, Bangna, Bangkok 10260, Thailand GEORGE THOMAS (39), Friedrich MiescherInstitut, CH-4002 Basel, Switzerland ROBERT TRAUT (27), Department of Biological Chemistry, School of Medicine, University of California, Davis, Davis, California 95616 MARIN VAN HEEL (2), Fritz-Haber-lnstitut der Max-Planck-Gesellschafi, D-IO00 Berlin 33, Federal Republic of Germany PETER H. VAN KNIPPENBERG (12), Department of Biochemistry, Leiden University, 2333 AL Leiden, The Netherlands BARBARA J. VAN STOLK (32), Thimann Laboratories, University of California, Santa Cruz, Santa Cruz, California 95064 JAILAXMI V. VARTIKAR(13), Department of Chemistry, Johns Hopkins University, Baltimore, Maryland 21218 VICTOR D. VASILIEV(5), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR ADRIANA VERSCHOOR (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, Albany, New York 12201 BIRTE VESTER (49), Biostructural Chemistry, Kemisk Institut, Aarhus Universitet, 8000 Aarhus C, Denmark HELGA VOSS (8), Max-Planck-lnstitut fi2r Molekulare Genetik, Abt. Wittmann,
xvii
D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany TERENCE WAGENKNECHT (1), Wadsworth Center for Laboratories and Research, New York State Department of Health, Albany, New York 12201 R. WAGNER (50), Institut fflr Physikalische Biologie, Universitlit Dftsseldo~ D-4000 D~sseldorf 1, Federal Republic of Germany JOSEPH S. WALL (3), Biology Department, Brookhaven National Laboratory, Upton, New York 11973 JAN WALLECZEK (4), Max-Planck-lnstitut fiir Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany MICHAEL S. WATERMAN(52), Departments of Mathematics and Molecular Biology, University of Southern California, Los Angeles, California 90089 MARKUS WEDDE (45), Max-Planck-lnstitut J'fir Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany CARL J. WEITZMANN(36), Roche Institute of Molecular Biology, Nutley, New Jersey 07110 SUSANA. WHITE (14), Department of Chemistry, Yale University, New Haven, Connecticut 06511 ERIC WICKSTROM (15), Department of Chemistry, University of South Florida, Tampa, Florida 33620 WOLFGANG WINTERMEYER(40, 41), Instirut fftr Physiologische Chemie, Universitdt Witten/Herdecke, D-5810 Witten, Federal Republic of Germany H. G. WITTMANN(6), Max-Planck-lnstitut fi~r Molekulare Genetik, Abt. Wittmann, D-1000 Berlin (Dahlem), Federal Republic of Germany BRIGITTE WITTMANN-LIEBOLD(38), Max-
Planck-Institut f~r Molekulare Genetik, Abt. Wittmann, D-IO00 Berlin 33 (Dahlem), Federal Republic of Germany PAUL L. WOLLENZIEN(2 l), E. A. Doisy De-
XVlll
CONTRIBUTORS TO VOLUME 1 6 4
partment of Biochemistry, St. Louis University Medical School, St. Louis, Missouri 63104 IRA G. WOOL (31), Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago, Illinois 60637 A. YONATH (6), Max-Planck-Unitfor Structural Molecular Biology, D-2000 Hamburg 52, Federal Republic of Germany, and Wiezmann Institute of Science, Rehovot, Israel
M. M. YusuPov (28), Institute of Protein
Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR G. Z. YUSUPOVA(TNALINA)(43), Institute of Protein Research, Academy of Sciences of the USSR, 142292 Pushchino, Moscow Region, USSR GLADYS ZENCHOFF (25), Department of Chemistry, Hoffmann-LaRoche Inc., Nutley, New Jersey 07110
Preface The overwhelming structural complexity of ribosomes continues to present a great technical challenge to those who study these interesting ribonucleoprotein particles. Ribosomologists have responded over the years by inventing a wide range of novel biochemical, physicochemical, and genetic approaches, many of which have found widespread application outside the ribosome field. The most recent period of research in this area is no exception as is reflected in the contents of this volume. Among the notable advances that we have seen during this time are a vastly sharpened understanding of the structure of ribosomal RNA and how it may participate in the translation process, major accomplishments in the area of ribosome structure, and the emergence of the ribosome as an evolutionary chronometer. This volume supplements some of the recent ones in this series dealing with various aspects of protein synthesis (XXX, LIX, LX, and 101). Much of the methodology relating to the function of ribosomes in translation, the preparation and characterization of ribosomes and their constituent parts, their interaction with other translational components (protein factors, aminoacyl-tRNAs, mRNAs, nucleotides, etc.), and the properties of cellfree translating systems is to be found in these volumes. Also presented are a number of methods used for the characterization of the changes that occur in ribosomes when they react with other components in the translational system. In this rapidly moving area of research, many procedures are continually being modified and improved, and new methodologies are being developed which allow for more incisive analyses and elaboration of more detailed, reliable information regarding the structure of the particle, its component proteins and ribonucleic acids, and its diverse functional states. This volume includes a variety of methods involving electron microscopy and other biophysical techniques, such as crystallography, neutron scattering, and NMR, procedures for the analysis of protein-RN A or RNARNA interactions by cross-linking, the use of chemical, enzymatic, and immunological probes, as well as functional, kinetic, and genetic approaches for the study of this ribonucleoprotein. These methodologies will contribute to the continued progress toward the elucidation of the structure, function, and regulatory processes that affect this most important complex cellular component, the ribosome. HARRY F. NOLLER, JR. KIVIE MOLDAVE xix
METHODS IN ENZYMOLOGY EDITORS-IN-CHIEF
Sidney P. Colowick and Nathan 0. Kaplan
VOLUMEVIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME
IX. CarbohydrateMetabolism
Edited by WILLIS A. WOOD VOLUME
X. Oxidation and Phosphorylation
Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME
XI. Enzyme Structure
Edited by C. H. W. HIRS VOLUME
XII. Nucleic Acids (PartsA and B)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME
XIII. Citric Acid Cycle
Edited by J. M. LOWENSTEIN VOLUME
XIV. Lipids
Edited by J. M. LQWENSTEIN VOLUME
XV. Steroidsand Terpenoids
Edited by RAYMOND B. CLAYTON VOLUME
XVI. Fast Reactions
Edited by KENNETH KUSTIN VOLUME
XVII. Metabolism of Amino Acids and Amines (PartsA and B)
Edited by HERBERT TABOR AND CELIA WHITE TABOR .. xx111
xxiv
METHODS INENZYMOLOGY
VOLUME XVIII. Vitamins and Coenzymes(PartsA, B, and C) Edited MCDONALD B. MCCORMICKANDLEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited ~~GERTRUDE E. PERLMANNANDLASZLOLORAND VOLUME XX. Nucleic Acids and Protein Synthesis(Part C) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME XXI. Nucleic Acids (Part D) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME XXII. Enzyme Purification and RelatedTechniques Editedby WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis(Part A) Editedby ANTHONYSANPIETRO VOLUME XXIV. Photosynthesisand Nitrogen Fixation (Part B) Editedby ANTHONY SANPIETRO VOLUME XXV. Enzyme Structure(Part B) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVI. Enzyme Structure(Part C) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVII. Enzyme Structure(Part D) Editedby C. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XXVIII. Complex Carbohydrates(Part B) Editedby VICTORGINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis(Part E) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis(Part F) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME XXXI. Biomembranes(Part A) Editedby SIDNEYFLEISCHERANDLESTERPACKER
METHODSINENZYMOLOGY
xxv
VOLUME XxX11. Biomembranes(Part B) Edited ~~SIDNEYFLEISCHERANDLESTERPACKER VOLUME XxX111. Cumulative SubjectIndex Volumes I- XXX Edited ~~MARTHAG.DENNISANDEDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques(Enzyme Purification: Part B) Editedby WILLIAM B. JAKOBY AND MEIRWILCHEK VOLUME XXXV. Lipids (Part B) Editedby JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: SteroidHormones) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XXXVII. Hormone Action (Part B: PeptideHormones) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Editedby JOELG.HARDMANANDBERT W. O'MALLEY VOLUME XxX1X. Hormone Action (Part D: IsolatedCells, Tissues,and
OrganSystems) Editedby
JOELG.HARDMANANDBERT
W. O'MALLEY
VOLUME XL. Hormone Action (Part E: Nuclear Structureand Function) Editedby BERT W. O'MALLEYANDJOELG.HARDMAN VOLUME XLI. CarbohydrateMetabolism (Part B) Edited by W. A. WOOD VOLUME XLII. CarbohydrateMetabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Editedby KLAUSMOSBACH VOLUME XLV. Proteolytic Enzymes(Part B) Editedby LASZLO LORAND
xxvi
METHODSINENZYMOLOGY
VOLUME XLVI. Affinity Labeling Edited ~~WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure(Part E) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME XLVIII. Enzyme Structure(Part F) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME XLIX. Enzyme Structure(Part G) EditedbyC. H.W. HIRSANDSERGEN.TIMASHEFF VOLUME L. Complex Carbohydrates(Part C) Editedby VICTORGINSBURG VOLUME LI. Purine and Pyrimidine NucleotideMetabolism Editedby PATRICIA A. HOFFEEANDMARYELLENJONES VOLUME LII. Biomembranes(Part C: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LIII. Biomembranes(Part D: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LIV. Biomembranes(Part E: Biological Oxidations) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LV. Biomembranes(Part F: Bioenergetics) Editedby SIDNEYFLEISCHERANDLESTERPACKER VOLUME LVI. Biomembranes(Part G: Bioenergetics) Editedby SIDNEYFLEISCHERAND LESTER PACKER VOLUME LVII. Bioluminescenceand Chemiluminescence Editedby MARLENE A. DELUCA VOLUME LVIII. Cell Culture Editedby WILLIAM B. JAKOBYANDIRAPASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis(Part Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN
G)
xxvii
METHODSINENZYMOLOGY VOLUME LX. Nucleic Acids and Protein Synthesis(Part H) Editedby KIVIEMOLDAVEANDLAWRENCEGROSSMAN VOLUME 6 1. Enzyme Structure(Part H) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME 62. Vitamins and Coenzymes(Part D) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and
Inhibitor Methods) DANIEL L. PURICH
Editedby
VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes
and Complex Enzyme Systems) DANIEL L. PIJRICH
Editedby
VOLUME 65. Nucleic Acids (Part I) Editedby LAWRENCEGROSSMANANDKIVIEMOLDAVE VOLUME 66. Vitamins and &enzymes (Part E) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 67. Vitamins and Coenzymes(Part F) Editedby DONALD B. MCCORMICKANDLEMUEL
D. WRIGHT
VOLUME 68. RecombinantDNA Edited by RAY Wu VOLUME 69. Photosynthesisand Nitrogen Fixation (Part C) Editedby ANTHONYSANPIETRO VOLUME 70. Immunochemical Techniques(Part A) Editedby HELENVANVUNAKISANDJOHN J. LANGONE VOLUME 7 1. Lipids (Part C) Editedby JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Editedby JOHN M. LOWENSTEIN
...
xxvlll
METHODSINENZYMOLOGY
VOLUME 73. Immunochemical Techniques(Part B) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS VOLUME 74. Immunochemical Techniques(Part C) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS
75. Cumulative Subject Index Volumes XxX1, XxX11,
VOLUME
XXXIV-LX Editedby
EDWARDA.DENNISANDMARTHAG.DENNIS
VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, CHIANCONE
LUIGI ROSSI-BERNARDI, AND EMILIA
VOLUME 77. Detoxication and Drug Metabolism Editedby WILLIAM B. JAKOBY VOLUME 78. Interferons(Part A) Editedby SIDNEYPESTKA VOLUME 79. Interferons(Part B) Editedby SIDNEYPESTKA VOLUME 80. Proteolytic Enzymes(Part C) Editedby LASZLO LORAND VOLUME 81. Biomembranes(Part H: Visual Pigmentsand Purple Mem-
branes,I) Editedby
LESTERPACKER
VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Editedby LEON W. CUNNINGHAMANDDIXIE W. FREDERIK~EN VOLUME 83. Complex Carbohydrates(Part D) Editedby VICTORGINSBURG VOLUME 84. ImmunochemicaI Techniques (Part D: Selected Immunoassays) Editedby JOHN J. LANGONEANDHELENVANVUNAKIS
METHODSINENZYMOLOGY
xxix
VOLUME 85. Structural and Contractile Proteins(Part B: The Contractile
Apparatusand the Cytoskeleton) Editedby DIXIE W. FREDERIKSEN ANDLEON W. CUNNINGHAM VOLUME 86. Prostaglandinsand ArachidonateMetabolites Editedby WILLIAM E.M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates,
Stereochemistry,and Rate Studies) DANIEL L. PURICH
Editedby
VOLUME 88. Biomembranes(Part I: Visual Pigments and Purple Mem-
branes,II) Editedby
LESTERPACKER
VOLUME 89. CarbohydrateMetabolism (Part D) Editedby WILLIS A. WOOD VOLUME 90. CarbohydrateMetabolism (Part E) Editedby WILLIS A. WOOD VOLUME 9 1. Enzyme Structure(Part I) EditedbyC. H.W. HIRS ANDSERGEN.TIMASHEFF VOLUME 92. Immunochemical Techniques(Part E: Monoclonal Antibod-
ies and GeneralImmunoassayMethods) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 93. Immunochemical Techniques(Part F: Conventional Anti-
bodies,Fc Receptors,and Cytotoxicity) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 94. Polyamines Editedby HERBERTTABORANDCELIAWHITETABOR VOLUME 95. Cumulative SubjectIndex Volumes 6 1- 74,76 - 80 Editedby EDWARD A. DENNISANDMARTHAG.DENNIS VOLUME 96. Biomembranes[Part J: MembraneBiogenesis:Assemblyand
Targeting(GeneralMethods; Eukaryotes)] Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
xxx
METHODSINENZYMOLOGY
VOLUME 97. Biomembranes [Part K: Membrane Biogenesis:Assembly
and Targeting(Prokaryotes,Mitochondria, and Chloroplasts)] Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 98. Biomembranes(Part L: Membrane Biogenesis:Processing
and Recycling) Editedby
SIDNEYFLEISCHERAND
BECCA FLEISCHER
VOLUME 99. Hormone Action (Part F: Protein Kinases) Editedby JACKIE D. CORBINANDJOELG.HARDMAN VOLUME 100.Recombinant DNA (Part B) Editedby RAY WV, LAWRENCEGROSSMAN,ANDKIVIEMOLDAVE VOLUME 101.RecombinantDNA (Part C) Editedby RAY WV, LAWRENCEGROSSMAN,ANDKIVIEMOLDAVE
102. Hormone Action (Part G: Calmodulin and CalciumBinding Proteins) Editedby ANTHONY R. MEANSANDBERT W. O'MALLEY
VOLUME
VOLUME 103.Hormone Action (Part H: NeuroendocrinePeptides) Editedby P. MICHAELCONN VOLUME 104.Enzyme Purification and RelatedTechniques(Part C) Editedby WILLIAM B. JAKOBY VOLUME 105.OxygenRadicalsin Biological Systems Editedby LESTERPACKER VOLUME 106.PosttranslationalModifications (Part A) Editedby FINN WOLD AND KIVIE MOLDAVE VOLUME 107.Posttranslational Modifications(PartB) Editedby FINN WOLDAND KIVIEMOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and
Characterizationof Lymphoid Cells) Editedby GIOVANNIDISABATO,JOHNJ.LANGONE,AND HELENVANVUNAKIS VOLUME 109.Hormone Action (Part I: PeptideHormones) Editedby LUTZBIRNBAUMERANDBERT W. O'MALLEY
METHODSINENZYMOLOGY
xxxi
VOLUME 110.Steroidsand Isoprenoids(Part A) Edited UPJOHN H. LAWANDHANSC.RILLING VOLUME 111.Steroidsand Isoprenoids(Part B) Edited ~~JOHNH.LAWANDHANSC.RILLING VOLUME 112.Drug and Enzyme Targeting(Part A) Edited ~~KENNETH J. WIDDERANDRALPHGREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Com-
pounds Editedby
ALTON MEISTER
VOLUME 114.Diffraction Methodsfor Biological Macromolecules(Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115.Diffraction Methodsfor BiologicalMacromolecules(Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116.Immunochemical Techniques(Part H: Effectersand Media-
tors of Lymphoid Cell Functions) Editedby GIOVANNI DI SABATO,JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117.Enzyme Structure(Part J) EditedbyC. H. W. HIRSANDSERGEN.TIMASHEFF VOLUME 118.Plant Molecular Biology Editedby ARTHUR~EISSBACH AND HERBERT WEISSBACH VOLUME 119.Interferons(Part C) Editedby SIDNEYPESTKA VOLUME 120.Cumulative SubjectIndex Volumes 8 1- 94,96 - 101 VOLUME 121. Immunochemical Techniques(Part I: Hybridoma Technol-
ogy and Monoclonal Antibodies) JOHN J. LANGONEANDHELENVANVUNAKIS
Editedby
VOLUME 122.Vitamins and &enzymes (Part G) Editedby FRANKCHYTILANDDONALD B. MCCORMICK
xxxii
METHODSINENZYMOLOGY
VOLUME 123.Vitamins and &enzymes (Part H) Editedby FRANKCHYTILANDDONALD B. MCCORMICK VOLUME 124.Hormone Action (Part J: NeuroendocrinePeptides) Editedby P. MICHAELCONN VOLUME 125.Biomembranes(Part M: Transport in Bacteria,Mitochon-
dria, and Chloroplasts:GeneralApproachesand Transport Systems) Editedby
SIDNEY FLEISCHER AND BECCAFLEISCHER
VOLUME 126. Biomembranes(Part N: Transport in Bacteria,Mitochon-
dria, and Chloroplasts:Protonmotive Force) Editedby
SIDNEYFLEISCHERAND
BECCAFLEISCHER
VOLUME 127.Biomembranes(Part 0: Protons and Water: Structureand Translocation) Editedby
LESTERPACKER
VOLUME 128. Plasma Lipoproteins (Part A: Preparation,Structure, and Molecular Biology) Editedby JERE P. SEGRESTANDJOHN J. ALBERS VOLUME 129.PlasmaLipoproteins(Part B: Characterization,Cell Biology,
and Metabolism) JOHN J. ALBERSANDJERE P. SEGREST
Editedby
VOLUME 130.Enzyme Structure(Part K) EditedbyC. H. W.HIRSAND SERGEN.TIMASHEFF VOLUME 131.Enzyme Structure(Part L) EditedbyC. H. W. HIRSAND SERGEN.TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosisand
Cell-MediatedCytotoxicity) Editedby
GIOVANNIDISABATOANDJOHANNESEVERSE
VOLUME 133.Bioluminescenceand Chemiluminescence(Part B) Editedby MARLENEDELUCAANDWILLIAM D. MCELROY VOLUME 134.Structuraland Contractile Proteins(Part C: The Contractile
Apparatusand the Cytoskeleton) RICHARD B. VALLEE
Editedby
METHODSINENZYMOLOGY
... xxxm
VOLUME 135.Immobilized Enzymesand Cells(Part B) Editedby KLAUS MOSBACH VOLUME 136.Immobilized Enzymesand Cells (Part C) Editedby KLAUS MOSBACH VOLUME 137.Immobilized Enzymesand Cells (Part D) Editedby KLAUSMOSBACH VOLUME 138.Complex Carbohydrates(Part E) Editedby VICTORGINSBURG VOLUME 139. Cellular Regulators(Part A: Calcium- and Calmodulin-
Binding Proteins) Editedby
ANTHONY R. MEANSAND P. MICHAELCONN
VOLUME 140.Cumulative SubjectIndex Volumes 102- 119, 121- 134 VOLUME 141.Cellular Regulators(Part B: Calcium and Lipids) Editedby P. MICHAELCONNANDANTHONY R. MEANS VOLUME 142.Metabolism of Aromatic Amino Acids and Amines Editedby SEYMOURKAUFMAN VOLUME 143.Sulfur and Sulfur Amino Acids Editedby WILLIAM B. JAKOBYAND OWENGRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular
Matrix) Editedby
LEON W. CUNNINGHAM
VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular
Matrix) Editedby
LEON W. CUNNINGHAM
VOLUME 146.PeptideGrowth Factors(Part A) Editedby DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147.PeptideGrowth Factors(Part B) Editedby DAVIDBARNESANDDAVID A. SIRBASKU VOLUME 148.Plant Cell Membranes Editedby LESTERPACKERANDROLANDDOUCE
xxxiv
METHODSINENZYMOLOGY
VOLUME 149.Drug and Enzyme Targeting(Part B) Edited ~~RALPHGREENANDKENNETH J. WIDDER VOLUME 150.Immunochemical Techniques(Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Editedby GIOVANNI DI SABATO VOLUME 151. Molecular Geneticsof Mammalian Cells Editedby MICHAEL M. GOTTESMAN VOLUME 152.Guide to Molecular Cloning Techniques Editedby SHELBY L. BERGERANDALAN R. KIMMEL VOLUME 153.Recombinant DNA (Part D) Editedby RAY Wu ANDLAWRENCEGROSSMAN VOLUME 154.Recombinant DNA (Part E) Editedby RAY WV ANDLAWRENCEGROSSMAN VOLUME 155.RecombinantDNA (Part F) Edited by RAY WV VOLUME 156. Biomembranes(Part P: ATP-Driven Pumps and Related Transport: The Na,K-Pump) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 157. Biomembranes(Part Q: ATP-Driven Pumps and Related
Transport:Calcium, Proton, and PotassiumPumps) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 158.Metalloproteins(Part A) Editedby JAMES F. RIORDANANDBERT
L. VALLEE
VOLUME 159.Initiation and Termination of Cyclic NucleotideAction Editedby JACKIE D. CORBINANDROGER A. JOHNSON VOLUME 160.Biomass(Part A: Celluloseand Hemicellulose) Editedby WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161.Biomass(Part B: Lignin, Pectin,and Chitin) Editedby WILLIS A. WOODANDSCOTT T. KELLOGG
METHODSINENZYMOLOGY
xxxv
VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and
Inflammation) Editedby
GIOVANNI DI SABATO
VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and
Inflammation) Editedby
GIOVANNI DI SABATO
VOLUME 164.Ribosomes Editedby HARRY F. NOLLER,JR.ANDKIVIEMOLDAVE VOLUME 165.Microbial Toxins: Tools for Enzymology Editedby SIDNEYHARSHMAN VOLUME 166.Branched-ChainAmino Acids Editedby ROBERTHARRISANDJOHN R. SOKATCH VOLUME 167.Cyanobacteria Editedby LESTERPACKERANDALEXANDERN.GLAZER VOLUME 168. Hormone Action (Part K: NeuroendocrinePeptides)(in
preparation) P. MICHAELCONN
Editedby
VOLUME 169.Platelets:Receptors,Adhesion,Secretion(PartA) (in prepa-
ration) Editedby
JACEKHAWIGER
VOLUME 170.Nucleosomes(in preparation) Editedby PAUL M. WASSARMANANDROGER D. KORNBERG VOLUME 171. Biomembranes(Part R: TransportTheory: Cellsand Model
Membranes)(in preparation) Editedby
SIDNEYFLEISCHERANDBECCAFLEISCHER
VOLUME 172.Biomembranes(Part S: Transport Theory: Membrane Iso-
lation and Characterization)(in preparation) Editedby
SIDNEY FLEISCHER AND BECCAFLEISCHER
[ 1]
IMAGE PROCESSING
OF SINGLE RIBOSOMES IMAGED
BY
EM
3
[ 1] Studying Ribosome Structure by Electron
Microscopy and Computer-Image Processing
By JOACHIM FRANK, MICHAEL RADERMACHER, TERENCE WAGENKNECHT, and ADRIANA VERSCHOOR Introduction T o date, the most detailed knowledge o f ribosomal morphology has been obtained by the combination o f electron microscopy and single-particle averaging ~-3 and three-dimensional (3-D) reconstruction methods. The term single-particle averaging refers to a m e t h o d whereby m a n y (e.g., several hundred) images o f a macromolecular structure appearing in a characteristic orientation are averaged after precise correlation alignment. Thus, this m e t h o d is equivalent to the averaging, by Fourier techniques, o f a micrograph showing a flat, two-dimensional protein crystal. 4-6 The averaging is required because the individual images o f a macromolecular structure obtained in the electron microscope contain a large a m o u n t o f noise, allowing the significant part o f the image to be extracted only from a set o f repeated measurements. Because o f the presence o f systematic variations a m o n g the individual projections o f a structure, e.g., due to variations in orientation or a m o u n t o f staining, a multivariate statistical analysis is frequently necessary before a meaningful average (or several averages) can be formed. 7,8 In the m e t h o d o f single-particle 3-D reconstruction, 9,'° the macromolecule is reconstructed in three dimensions from a large n u m b e r o f projections. In the variant o f this m e t h o d most viable for structure research, these
J. Frank, W. Goldfarb, D. Eisenberg,and T. S. Baker, Ultramicroscopy 3, 283 (1978). 2j. Frank, A. Verschoor, and M. Boublik, Science 214, 1353 (1981). 3j. Frank, A. Verschoor,and T. Wagenknecht, in "New Methodologiesin Studies of Protein Configuration" (T. T. Wu, ed.), p. 36. Van Nostrand-Reinhold, New York, 1985. 4 H. P. Erickson and A. Klu~, Philos. Trans. R. Soc. London, Ser. B 261, 105 (1970). 5p. N. T. Unwin and R. Henderson, J. Mol. Biol. 94, 425 (1975). 6 L. A. Amos, R. Henderson, and P. N. T. Unwin, Prog. Biophys. Mol. Biol. 39, 183 (1982). 7M. van Heel and J. Frank, Ultramicroscopy 6, 187 (1981). s j. Frank and M. van Heel, J. Mol. Biol. 161, 134 (1982). 9 W. Hoppe, J. Gassmann, N. Hunsmann, J. Schramm, and M. Sturm, Hoppe-Seyler's Z. Physiol. Chem. 355, 1483 (1975). lo W. Hoppe and R. Hagerl, in "Computer Processingof Electron MicroscopeImages" (P. W. Hawkes, ed.), p. 127. Spfinger-Vedag Berlin, Federal Republic of Gcrmany, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All l~hts of~produclion in any form reaerved.
4
ELECTRON MICROSCOPY
[ 1]
projections come from different particles lying in, or brought into, different orientations providing a wide range of viewing directions. H-m In principle, electron crystallographic techniques6,15are capable of providing structural data on ribosomes. 16,17However, a resolution comparable to that obtained by single-particle reconstruction has not been achieved, mainly because large, well-ordered crystals of ribosomes or ribosomal subunits have been difficult to grow. Electron Microscopy Currently, most electron microscopy studies of ribosomes are done using any one of several modifications of the method of negative staining first developed by Valentine and Green. m Immunoelectron microscopic studies of ribosomes are usually done on specimens that axe sandwiched, along with stain, between two layers of carbon? 9-2~ These so-called double-carbon layer preparations give improved contrast for antibodies bound to ribosomes or ribosomal subunits as compared to the single-carbon layer preparations. Fortunately, these same methods of negative staining can be used to obtain images suitable for the application of single-particle imageprocessing techniques. We have found that, under the proper conditions, the double-carbon layer methods give the most consistent results and provide the most detailed information on the interiors of the particles, whereas the single-layer regions yield better defined outlines of the particles, which are therefore more easily aligned by correlation methods. We prefer the methods described by Tischendorf et al. 2~,22and Boublik et al., ~9 mainly because they usually result in a large proportion of the grid surface being double-layered. II A. Verschoor, J. Frank, M. Radermacher, and T. Wagenknecht, J. Mol. Biol. 178, 677 (1984). 12 M. Radermacher, T. Wagenkneeht, A. Verschoor, and J. Frank, J. Microsc. 141, RPI (1985). ~3M. Radermaeher, T. Wagenkneeht, A. Verschoor, and J. Frank, J. Microsc. 146, 113 (1987); E M B O J. 6, 1107 (1987). t4 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). t5 R. Henderson and P. N. T. Unwin, Nature (London) 257, 28 (1975). t6 W. Kiihlbrandt and P. N. T. Unwin, J. Mol. Biol. 156, 439 (1982). 17A. Yonath, Trends Biochem. Sci. 9, 227 (1984). ~s R. C. Valentine and M. Green, J. Mol. Biol. 27, 615 (1967). ~9M. Boublik, W. Hellman, and A. K. Kleinschmidt, Cytobiologie 14, 293 (1977). 2o j. A. Lake, J. Mol. Biol. 105, 131 (1976). 2t G. W. Tisehendoff, H. Zeiclahard~ and G. St6ttler, Mol. Gen. Genet. 134, 187 (1974). 22 G. St0mer and M. StOtiler-Meilieke, in "Modern Methods in Protein Chemistry" (H. Tsehesehe, ed.), p. 409. de Gruyter, Berlin, Federal Republic of Germany, 1983.
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
5
The conditions required for single-particle averaging and three-dimensional reconstruction are, however, more stringent than those for simple visual analysis of images. Ideally, the particles should be identically stained, they should be embedded in stain (as opposed to just being surrounded by a ring of stain24), and they should not be flattened or collapsed. The double-layer preparations are clearly superior to the single-layer preparations in fulfilling the first of these criteria. However, micrographs obtained with the double-layer technique often contain a very thin layer of stain appearing as a ring of high density surrounding the particles and the particles appear larger than those in the single-layer preparations, implying that some particle flattening may have occurred; we do not analyze micrographs that exhibit these characteristics. We have obtained the highest resolutions with specimens which were prepared by one of the double-carbon layer procedures and in which the stain layer is thick, at least in the immediate vicinity of the particles. In micrographs of this type the stain thins out gradually with distance from the boundaries of the particles such that in areas where the particles are clustered together the stain appears almost uniformly distributed over the grid surface. It should be pointed out that the methodology for obtaining the desired staining characteristics has not been perfected, and often many grids have to be prepared and examined before a suitable set of micrographs is obtained. In order to attain the highest resolution it is desirable to minimize the electron dose applied to the specimen. However, we often observe severe specimen drift (detectable in the optical diffraction patterns of the carbon support films25) when attempting minimal dose microscopy on specimens prepared by the double-carbon layer techniques. It is not unusual to encounter regions of the grid from which virtually all of the micrographs arc unusable because of drift. In order to increase the stability of the specimen so as to minimize drift, we do not use "naked" grids when applying the specimen and carbon support films but, instead, the grids are coated with a thick carbon film densely packed with holes. Only those regions of the micrographs in which the sandwiched specimen is suspended over the holes in the thick carbon film are considered for further analysis. An optimal dose for negatively stained specimens6,26,27 is about 23 Deleted in proof. 24 H. Oettl, R. Hegerl, and W. Hoppe, J. Mol. Biol. 163, 431 (1983). 25 j. Frank, Optik 30, 171 (1969). 26 p. N. T. Unwin, J. Mol. Biol. 87, 657 (1974). 27 T. S. Baker and D. A. Goodenough, J. Cell Biol. 96, 204 (1983).
6
ELECTRON MICROSCOPY
[ 1]
1000 el/nm 2 which, fortunately, can be achieved at medium magnifications (e.g., 40,000-50,000X) without significant loss of signal-to-noise ratio due to electron shot noise. 2s It is feasible to use even lower doses (100 el/nm 2) by recording a pair of micrographs, one at the desired dose and a second at a higher dose and containing sufficient power to determine the translational and rotational alignment parameters for each particle which can then be applied to the low-dose micrograph images. 29 The latter approach might be required, for example, in the analysis of unstained frozen-hydrated ribosomes or subunits. Digitization and Selection of Images The electron micrograph is digitized with a microdensitometer into an array of optical density (OD) values, which are stored on a magnetic tape and read into the computer. 3° In the experimentally important OD range, the OD measured in a given picture clement (pixel) indexed j, p(ri) is proportional to the electron intensity I(rj) at that location. For bright field images of sufficiently thin biological particles obtained in the conventional transmission electron microscope with appropriate defocus, the contrast, i.e., the local variation of the electron intensity A/j ---/j - i relative to the mean intensity i, is a measure of the projected potential distribution. A/j and thus the local OD variation Apj -- pj --/~, is roughly proportional to the total projected mass at location j.31 One of the crucial prerequisites for the image to be interpreted as a projection of the object is that the defocus range be properly selected, such that all spatial frequencies up to the significant resolution (see below) lie essentially in one contrast transfer band. An incorrect choice of focus causes certain spatial frequency bands to be suppressed or transferred with false contrast. 32 Although restoration techniques can be used to correct 2s K. H. Downing and D. A. Grano, Ultramicroscopy 7, 381 (1982). 29 M. Kessel, J. Frank, and W. Goldfarb, J. Supramol. Struct. 14, 405 (1980). 3oj. Frank, in "Advanced Techniques in Electron Microscopy" (J. K. Koehler, ed.), p. 215. Springer-Verlag, Berlin, Federal Republic of Germany, 1973. 31 The transfer of structural information from the object into the image is governed by the phase-contrast transfer theory. The relationship between object projection and image contrast is straightforward only in the resolution range considered here (> 2 nm) and only when a number of simplifying assumptions are made. Among these are that the object is thin, and that its interaction with the electrons can be described as a simple phase shift ("pure phase object"). For details, see, e.g., F. Lenz, in "Electron Microscopy in Material Science" (U. Valdr6, ed.), p. 542. Academic Press, New York, 1971. 32 F. Thon, Z. Naturforsch. 21a, 476 (1966).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
7
images having incorrectly placed transfer bands, a3-35 it has proved more practical to select "good" images from a large number of experimental mierographs with varying quality. Other experimental parameters affecting the quality of the image are axial astigmatism and drift. 25 Microgmphs that are to be analyzed are therefore routinely checked in the optical diffractometer for proper defocus and absence of controllable aberrations. 36 In order for details in the range of 2 n m in size--which have been proved to be reproducible in averaged projections of ribosomal subunits prepared by the negative staining technique2--to be represented in the digitized image, the scanning step of the microdensitometer should be equivalent to a value of 0.5 to 0.7 nm. The factor of between 2 and 1.5 × over the 1 n m step theoretically required provides a safety margin that prevents deterioration of image resolution in computational steps requiring interpolation; e.g., image rotation. Although programs for automatic selection of particles from micrograph fields have been d e v e l o p e d , 37-39 interactive cursor-controlled selection by means of a graphics terminal is the most efficient procedure. After this selection, the particle images exist as a set of arrays {pi(rj), j = 1 . . . P} stored in separate files on the disk of the computer, pi(rj) stands for the OD value of the jth pixel in the/th image. The need to scale micrographs arises in many applications, e.g., averaging of projections selected from different micrographs, comparison of different specimens, and 3-D reconstruction from a large number of projections. The scaling procedure is based on the known properties of bright field_images of weak phase objects. 4° Under these conditions, the contrast AIj/I is independent of the mean intensity I. Consequently, when two particles (p~j and P2j, J = 1 . . . P} are selected from different micrographs, comparable density values are obtained by
plj=plj/pl;
p2j = p2j-//~2
(1)
where/~l and/S2 are the mean densities measured by averaging portions of the micrographs that do not contain particles. 33 W. Hoppe, Acta Crystallogr. A 26, 414 (1970). O. Kfibler, M. Hahn, and J. Seredynski, Optik 51, 171 (1978). 35 T. A. Welton, Adv. Electron. Electron Physics 48, 37 (1979). 3~ B. V. Johansen, Princ. Tech. Electron Microsc. 5, 114 (1975). 37 j. Frank and T. Wagcnknecht, Ultramicroscopy 12, 169 (1984). 3s M. van Heel, Ultramicroscopy 7, 331 (1981). 39 D. W. Andrews, A. H. C. Yu, and F. P. Ottensmeyer, Ultramicroscopy 19, 1 (1986). 4o F. Lenz, in "Electron Microscopy in Material Science" (U. Valdr~, ed.), p. 542. Academic Press, New York, 1971.
8
ELECTRON MICROSCOPY
[ 1]
Alignment of Images The objective of the alignment procedure 1,2 is to determine coordinate transformations Ci ----TiRj (Ti translation, Ri rotation matrix) such that N
P
~ [pt(Cir/) - pl,(Crrj)] 2 ~= rain
(2)
i> i' j - - 1
where N is the number of images. This objective is achieved, to a good approximation, through application of an iterative procedure. First, the error sum, or Euclidean distance P
ET, = ~ [pi(C; rj) - pr(rj)] 2
(3)
j--I
is minimized between each image p~ and a suitably chosen "typical" reference image, denoted by p,. Subsequently, E~ = ~ [pi(C] rj) - p° (rj)] 2
(3a)
j-I
where the new reference p ° (rj) -- 1/N Y~_ ~p~(C~ rj) is the average after the first cycle. This procedure is repeated several times until the error sum E~o of Eq. (3a) or a similar measure of discrepancy no longer shows a significant change. Similarly, as for molecular search methods of X-ray crystallography, 4~ the minimization of the error sum for two images p~(r) and p2(r) is achieved by maximizing a function
x(c) = fa pl(Cr)p2(r) dr
(4)
which is obtained by integration over the image domain A. ~ C ) is closely related to the two-dimensional cross-correlation function (CCF), which is used for translation search only (see below). For increased speed, the three-dimensional search (with respect to x, y, and ~b) is split into a two-dimensional search of translation (x,y) yielding T and a one-dimensional search of rotation (angle ~b) yielding R.l'~2 Optimal alignment of an image set may be achieved by combining four basic techniques (Fig. 1). Initially, the time-saving decoupling of rotation and translation searches is accomplished by centration 13 (A) or by the use of a translation-invariant rotation search (B). ~ Subsequently, the transla41 E. Lattman, this series, Vol. 115, p. 55. 42 R. Langer, J. Frank, A. Feltynowski, and W. Hoppe, Ber. Bunsenges. Phys. Chem. 74, 1120 (1970).
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
A
EM
9
B
CENTER PARTICLE BY 2-D CROSS-CORRELATION WITH A CENTERED, LOW-PASS FILTERED DISK
SEARCH ORIENTATION BETWEEN ACFs OF PARTICLES
C
D
SEARCH ORIENTATION BETWEEN CENTERED PARTICLES ("DIRECT METHOD")
•
ALIGN BY 2-D CROSS-CORRELATION
FIG. 1. Four components of the single-particle alignment procedure (see text).
tion and rotation parameters are refined by alternation between "direct" rotational alignment (C) 2,43and two-dimensional cross-correlation ( D ) . t'44 Examples for common search strategies are, in operator notation to be read from right to left, • . . [C o D] o [C o D] o [C o D] o [C o A]
and
(5) • . . [D o C] o [D o C] o [D o C] o [D o B]
Starting from the right, each term in brackets stands for one alignment pass that uses the average of the previous pass as reference. As stated above, the initial reference is an original, unaveraged image deemed typical. When several dissimilar types of projections are known to be present, several reference images must be tried for each image, and the selection of the appropriate class is then made on the basis of the highest cross-correlation coefficient (multireference alignment45'4*). Both translational and rotational searches are done by fast Fourier techniques. The values of the translation parameters are determined from 43 M. Steinkilberg and H. Schramm, Hoppe-Seyler's Z. Physiol. Chem. 361, 1363 (1980). 44j. Frank, in "Computer Processing of Electron Microscope Images" (P. W. Hawkes, ed.), p. 187. Springer-Verlag, Berlin, Federal Republic of Germany, 1980. 45 M. van Heel, J.-P. Bretaudiere, and J. Frank, Proc. Int. Congr. Electron Microsc., lOth 1, 563 (1982). 46 M. van Heel, Proc. Fur. Congr. Electron Microsc., 8th 2, 1317 (1984).
10
ELECTRON MICROSCOPY
[ 1]
• (r') = fA pl(r + r')p2(r) dr
(6)
the CCF:
where r' is the argument vector describing the translation between the two images p~ and P2. For the fast computation of the CCF the Fourier theorem is exploited47: O(r') -- ~ - ~ ( 3 ~ (r)]3~*[P2(r)]}
(7)
where 3~ and 3~-~ denote the forward and reverse Fourier transformations, respectively, and the asterisk stands for formation of the complex conjugate. /~(r) and P2(r) are derived from the original images (defined by domain A0 by padding into a field A2 whose size is large enough to avoid circular overlapS:
.~(r) = fp(r)
r ~ Al
r ~ A2
(8)
The value of the constant c is chosen to be equal to the mean of the pixels along the boundary of A~ to minimize the density step. (For bright field images, the mean of all pixels lying within A~ may be used instead with little practical difference.) The vector pointing from the origin of the CCF to its maximum is the vector by which Pu is translated relative to pt. For the computation of a rotational search function R(C~) -- fA W(I r I)f~(C+r)f2(r) dr,
(9)
where C+ is the probing rotation matrix and I41(Irl) a weighting function, the two functionsf~ and f2 to be matched are represented on a polar grid by reinterpolation from the cartesian grid, and the Fourier theorem is used, for increased speed, to compute one-dimensional CCFs along each polar coordinate ring?4 The rotational search function ("rotation function") is then obtained by weighted summation over all one-dimensional CCFs A~')(q~); r = [rl:
R(dp) -- ~, W(r) A(lf(q~)
(10)
¢
(see Crowther,4s where a similar simplification is used). The weighting function is chosen such that ring zones whose contributions are most sensitive to rotation receive highest weights. For algorithm C above (Fig. 1), the functionsft and f2 in Eq. (9) are the images themselves, whereas in +7G. D. Bergland, I E E E Spectrum p. 41 (1969). 48 R. A. Crowther, Int. Sci. Rev. Ser. 13, 10 (1972).
[1]
I M A G E P R O C E S S I N G OF SINGLE RIBOSOMES I M A G E D BY
EM
11
algorithm B the autocorrelation functions (ACF) of the images are used instead, and the search extends over only half the angular range. The rotational search may result in several peaks of comparable size. In particular, algorithm B (Fig. 1) leads to an intrinsic 180-degree ambiguity due to the centrosymmetry of the ACF. Such ambiguities are resolved by computing the CCF for each orientation, and then selecting the rotation angle that produces the maximum CCF peak.49 Averaging After alignment (denoted by the final cumulative coordinate transformations CD, projections relating to the same viewing directions may be averaged: N
p(rj) =
1/N ~
p,(C~'rj),
(11)
i--I
which results in an image p(rj) with greatly reduced noise contributions (by the factor Nm). As the sum of Eq. (11) is formed, the so-called variance map 2 is also computed N
v(rj) ---- E
[Pi(CTrj) -- p(rj )]2
(12)
i--I
This map is very informative as it gives an account of the location of regions where high discrepancies occur among images. This typically happens near the stain boundaries and at sites of the particle where positional changes of flexible components are encountered (Fig. 2). Resolution and Reproducibility of Averaged Projections Data obtained by single-particle averaging techniques lack an in-built resolution measure, in contrast to those obtained from crystals, for which diffraction orders can be counted. For determining the reproducible resolution ("cross-resolution"), two independently derived averages are compared in Fourier space: if F~(k) and F2(k) are the Fourier transforms of such averages, the differential phase residual2
"~I/2
A-~k, Ak)= [~'l[Adp(k)]2[]F'(k)]+[F2(k)[][ [~ak, [IFl(k)l + Ie2(k)l]
(13)
J
49 H. P. Zingsheim, D. C. Neugebauer, F. J. Barrantes, and J. Frank, Proc. Natl. Acad. Sci. U.S.A. "17, 952 (1980).
12
ELECTRON MICROSCOPY
[ 1]
a
b
Fro. 2. Averaging of the crown view of the 50S ribosomal subunit from E. coil [A. Verschoor, J. Frank, and M. Boublik, J. Ultrastruct. Res. 92, 180 (1985)]. (a) Portion of micrograph field from single-layer preparation. Scale bar 50 nm. (b) Examples of selected images (first six frames), and average and variance images (seventh and eighth frames, respectively; N = 60). The average image and variance map are displayed with a limiting resolution of 3 nm. Inspection of the variance map (final frame in b) shows that the singlelayer preparation permits a large amount of variation in the position of the L7/LI2 stalk (arrow) and in the amount of peripheral staining. The tip of the stalk has a low contrast and so low variance despite its large positional variation.
with A~b(k)----phase[Fl(k)]- phase[F2(k)] is computed by summation over rings k + A/c, k = Ikl in the Fourier plane, and plotted as a function of ring radius k. Although the entire curve is needed to accurately describe the reproducibility of the averages, it is convenient to state a tingle figure, k45, for which Ad~(k45, Ak) = 45 ° (Fig. 3). It must be stressed that in electron microscopy of stained specimens, the global equivalent to Eq. (13) obtained by summation from 0 to km~5° is not very informative, since the structure factor F(k) falls off, and the phase difference between two transforms increases rapidly, as a function of k. In addition to the phase residual of Eq. (13), another differential measure of cross-resolution, the Fourier ring correlation (FRC), 5~,52 is fre5o p. N. T. Unwin and A. Klu& J. Mol. Biol. 87, 641 (1974). 51 W. O. Saxton and W. Baumeister, J. Microsc. 127, 127 (1982). ~2M. van Heel, W. Keegstra, W. Schutter, and E. F. J. van Bruggen, in "Structure and Function of Invertebrate Respiratory Proteins" (E. J. Wood, ed.), p. 69. Harwood, 1982.
[ 1]
I M A G E P R O C E S S I N G OF SINGLE RIBOSOMES I M A G E D BY
Phase Residual
EM
13
•
AO
60
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1
. . . . . . . . . . . . . . . . . . . . . . . . .
40'
20.
1)4o
'1)2o
A-'
FI~. 3. Resolution determination by phase residual analysis. The particle analyzed is the 50S ribosomal subunit from E. coli prepared by the double-carbon layer method, showing the crown view.t3 (a) Phase residual plot obtained with two independent subset averages (N = 245 each). The 45* limit is reached for a resolution of 2.3 nm (arrow). (b) The two subset averages and the total average (N = 490) limited to the resolution found in (a), displayed as a contoured halftone representation.
quently used: FRC(k, Ak) - -
E F| (k)F2(k)} {[k'ak]
Here the resolution is defined as the spatial frequency for which FRC(k~t, Ak) = [2 Ak/(~k,~t)] 1/2
(14)
(15)
14
ELECTRON MICROSCOPY
[ 1]
Comparisons of k45 and k~t for selected data sets indicate, however, that k~tlt is as a rule larger, and A$(k~it, Ak) is larger than 80 °, suggesting that the FRC criterion may be too liberal for the purpose of resolution estimation.53,54 Statistical Significance of Averages The statistical significance of structural features in an averaged image can be assessed by applying standard statistical tests to the individual image elements) ,55 Assuming Gaussian statistics and that the individual images used to compute the average were correctly aligned, the standard error of the mean for the jth picture element of the average is Em[/~(ri)] = [v(rj)/N] 1/2
( 16)
where v(rj) is the variance map introduced before in Eq. (12). The standard error of the difference between two averaged picture elements is given by Ed [/~1(r~,/~2(rk)] = IV1( r j ) / N 1 + v2(rk)/N2] 1/2
(17)
(N1 and N2 are the numbers of images averaged in each case). The two picture elements may be different elements from a single average (pl ffi/72; j ~ k) or corresponding elements from two different averages (p~ * P2; j - k). The latter case occurs in studies where it is desired, e.g., to map the location of an antibody or other macromolecule (label) bound to a ribosomal subunit by quantitatively comparing averaged images of the labeled and control subunits. Ideally, the only significant differences between corresponding pixels in the two averages will occur at the location of the bound label. As a rule of thumb, we consider a difference between two averaged picture elements to be significant if it exceeds the standard error by a factor of at least three; this factor corresponds to a significance level of 0.2%. It is usually necessary to scale the ODs when comparing averages obtained from different micrographs (see Digitization and Selection of Images). Differences between averages that are strongly dependent upon the scaling parameters should be viewed with suspicion. It should be emphasized that statistically significant differences among averages obtained from different micrographs do not necessarily corre53 M. Radermacher, J. Frank, and C. A. Mannella, Proc. Annu. Meet. Electron Microsc. Soc. Am., 44th, p. 140 (1986). J. Frank, M. Radermacher, T. Wagenknccht, and A. Verschoor, Ann. N.Y. Acad. Sci. 483, 77 (1986). 55 H. P. Zingsheim, F. J. Barrantes, J. Frank, W. H~inicke, and D. C. Neugebauer, Nature (London) 299, 81 (1982).
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
15
spond to genuine differences in macromolecular structure. The detected differences could be due, for example, to variation in the mode of staining in the micrographs. When averaged images of modified (e.g., labeled) and control specimens are being compared, ambiguities of this type can be avoided by analyzing micrographs consisting of a mixture of the two specimen types. It is sometimes feasible, using the technique of correspondence analysis (see following section), to distinguish the two populations present in a tingle micrograph. 3 Alternatively, the aligned images of a mixed population can be averaged and a variance map [Eq. (12)] computed; the differences detected by comparing the two homogeneous populations will be visible in the variance map of the mixed population, provided that the optical density differences due to the label are significantly larger than the random deviations in density due to noise among the images. 56 If there is reason to suspect that the individual images used to compute an average were not correctly aligned, then nonparametric statistical tests may be applied to check the validity of features in the average imageY These tests are quite general, making no assumption on the validity of the statistics of the noise.
Multivariate StatisticalAnalysis Images aligned by the methods sketched out above may not represent particleshaving preciselythe same state of preservation or distributionof stain. Flexible components may occur in differcntpositions. "Rocking" movements around thc characteristicorientation may produce variations in the particle'sprojected appearance. For screening the images without reference to a preconceived model of the structure,correspondence analysis,58,59 a branch of multivariatc statisticalanalysis, is used in the way introduced by van Heel and FrankV,8:the basic philosophy of thisapproach isthat aligned images containing P pixclscan be described as vectors in R ~, a P-dimensional vector space, since, by virtue of the alignment, pixcls fallingonto the same grid point refer to the same absolute location in the molecule's coordinate system. Thc end points of thc vectors dcscribing the images form a "cloud." Points lying closely together belong to images that are closely similar. Thus, the structureof the point cloud (i.e.,itsshape and internalstructure) 56T. Wagenknecht and J. Frank, Biochemistry 23, 3383 (1984). 57W. H~inicke,J. Frank, and H. P. Zingsheim, J. Microsc. 133, 223 (1983). 5sL. Lebart, A. Morineau, and K. M. Warwick, "Multivariate DescriptiveStatistical Analysis." Wiley,New York, 1984. ~9j. p. Benzecri, in "Methodologies of Pattern Recognition" (S. Watanabe, ed.), p. 35. Academic Press, New York, 1969.
ELECTRON MICROSCOPY
16
[ 1]
reflects the existence and relative configurations of classes among the images. The multivariate statistical analysis provides a means for identifying, describing, and separating these classes in a quantitative way. In correspondence analysis of aligned particle projections pi(rj), a matrix with the general element f/J=
N
Pi(rfl P
(18)
E E p,(r,)
i--lj--I
is created. Based on a chi-squared distance metric, a covariance matrix with the general term N
Sjj, = E ft'(:J)l/2(fiJ/f]°:J
-
i-I P
1)(f'J')lY2(ftJ'/fi'f'J"-
1)
(19)
N
Y,-= Ef J; j-i
;:.J= F_,Y,J t-i
is formed. The row vectors {f0; J = 1 . . . P) are referred to as image profiles. The chi-squared metric ensures that the multivariate analysis is independent of the scaling of the individual images. Specifically, brightfield images taken of the same object with different exposures differ by a scalar factor only, and are thus represented by the same point. The matrix S of Eq. (19) is analyzed for its eigenvectors, or factors. These factors form a new set of basis vectors (~mj;J = 1 . . . P) in the P-dimensional vector space, which are ranked by the size of their eigenvalues, with the first factor pointing in the direction of largest extension of the data cloud, the second pointing in the direction of largest extension orthogonal to the first, and so forth. Thus these factors may be used to represent the dispersion or shape of the cloud formed by the rescaled images (f0;J - 1 . . . P}, originally in R e, in a space with greatly reduced dimensionality. In this space, each image is described by a rr6~-tupel of coordinates, (x~,; m - 1 . . . m~O. A new, condensed representation (reconstitution) of the images may be obtained in the form of linear combinations of the m , ~ high-ranking factors59: m~
#i(rj) = ~
Iqj.,%.j
(20)
m--O
The vectors {e~j =f.~mj; J---- 1 . . . P} may be thought of as eigenim-
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
17
ages,~°,6~and the sum in Eq. (20) has a close analogy to a Fourier synthesis from a limited number of orders of reflections. The expression in Eq. (20) can also be formed over any subset of factors, selectively omitting contributions from those factors that express structurally irrelevant features; e.g., variations in the amount and spatial distribution of peripheral staining. 62 To describe the shape of the point cloud formed by the image profile vectors in R e, and to define and isolate homogeneous subsets of the images, one of three methods of interpretation based on the factorial coordinates may be used: (1) inspection of 2-D factor maps, e.g., xi~ versus x,~; (2) identification of dusters and classification; and (3) nonlinear mapping. Which of these methods will be most informative and effective in isolating subsets depends on the type of variations present in the projection set. If strong clustering or a predominant trend occurs, one or two factor maps may be sufficient to identify classes of images (Fig. 4a). If, however, the clusters are separated or stretched in three or more dimensions, then the factor maps may be difficult to interpret. A similar problem arises in the analysis of data exhibiting continuous variationsn especially if linked to a continuous value range of a single parameter (such as tilt angle of a cylindrical particle about the cylinder's axis) n which require determination of the seriation of the data.H The methods dealing with these problems, classification and nonlinear mapping, will be briefly outlined below. Identification of Clusters and Classification Through the alignment of an image series and the subsequent multivariate statistical analysis of the resulting aligned image set, the data are in a form (as points in an up to 8-dimensional vector space, which is the number of factors often used in practice) that allows a variety of clustering procedures to be carried out. The objective is to find clusters, or compact accumulations of points, and to characterize these in terms of their compactness and relative positions. According to their relative locations, the initial clusters can be grouped into classes in a hierarchical manner, and thus the determination of the hierarchy of class associations is required for a full description of the data structure. This second step of cluster analysis is termed classification. Once clusters and classes have been identified, characteristic "average" 6o j._p. Bretaudiere and J. Frank, J. Microsc., 144, 1 (1986). 6~ M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2. North-Holland, Amsterdam, 1985. 62 j. Frank, A. Verschoor, and M. Boublik, J. Mol. Biol. 161, 107 (1982).
18 a
ELECTRON MICROSCOPY : .......
=,. . . . . . .
. .......................
.( .................
[ I]
-E: ...............................
~ - - - l - - ~ - ~
2 "~ •.1
.: . . . . .
•. \
I ,
,
-e.ele
• I
~ i
G
1 • . . . . . . l ~". . . . . . . . . . . . . . . . . . . . . . . . . . .
,
"~pe ~._
*
i
v
I0 • . "
-0.011
II
i
lira
:
o
0 e1
ll?, %, , " ~"
I1
?:3
M
~'
...ca. : ( " a a " ~ . . . . . . le.~-t) "
./;
. e/.o
! ~ ; : . :
~t I "R"
-0.004
r 9"6
,2
O " ~K .t';~; .........
6 " (~
:
/ ~
: :
2 20
2
~ .................
;J
0o
6F~ 6
7 . '
3 2S
.......
4-~ 6
0.003
a 4 ~ /
:
:
! I ~i~ "
. ~
0.011
: "
L
0.810
F~o. 4. Correspondence analysis and classification of the overlap view range exhibited by the 70S ribosome from E. coliP A total of 204 images were included in this analysis. All results were independently reproduced with a second data set comprising 177 images. (a) Correspondence analysis map of factor 1 versus 2, with assignment of clusters following Diday's multiple partitioning method. Each image is represented by a symbol that stands for the cluster it belongs to. The symbols (1 through 9, A through Z, * beyond Z) follow the ranking of the cluster, cluster 1 being the most populous. The images occur ordered along factor I according to the orientation of the ribosome on the specimen grid.ss For the meaning of the classes l, I], and IH, see (c). The images representative for the 11 clusters with memberships of five and above are shown at the bottom. They were obtained by reconstitution using 8-dimensional cluster center coordinates. ~°(Orientation changes reflected by factor 1 are thought to be produced by rotation of the particle about an axis ronghly vertical in this figure.) (b) Hierarchical ascendant classification dendrngram showing the successive merging
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY EM
19
C
III
II
6
4
i
i
?
9
I
I 8
I 10
5
II
1
11
3
2
III
of classes, starting from the 11 most populous clusters, according to the principle of minimum increase of intraclass variance. The distances in v e r t i ~ direction of the dendrogram reflect the distances between aggregated classes. The most sensible cutting level, indicated by a dashed line in (c) generates three classes. These classes are demarcated in (a) by solid lines and are marked by Roman numerals I, II, III. The result indicates that three more or less stable orientations are assumed by the particle in the overlap range of views. The views corresponding to these orientations are typified by the reconstituted class center images I, II, and III shown at the bottom.
20
ELECTRON MICROSCOPY
[1]
images may be computed by using class center coordinates in the reconstitution formula of Eq. (20). As van Heel observes,63 the exact determination of an optimal partitioning of a data set consisting of N points into a given number of compact classes requires a number of trial computations on the order of N!.. Since this number is impractically large for all practical cases, only algorithms for finding local optima have been given in the literature. Of the numerous algorithms proposed, two (discussed in Ref. 58) have been explored and found useful in the analysis of electron microscopic data: hierarchical ascendant classification (HAC) with minimum added variance as merging criterion, 64 and the method of clustering about moving centers combined with multiple cross-partitioning used by Diday. 65 van Heel 45,61,63,66 uses HAC throughout the analysis, starting with the original points as "classes," plus a postprocessing procedure designed to reduce the residual misclassification. Frank et aL 67 use Diday's variant of the method of clustering about moving centers, followed by HAC at the stage where stable clusters have been found. As an example for the application of these techniques, we show the classification67 of the overlap views6s of the 70S ribosome from Escherichia coli (Fig. 4).
Nonlinear M a p p i n g The objective of nonlinear mapping is to display a point distribution that is formed in a three- or higher dimensional space onto a 2-D map such that interpoint distances are optimally preserved. Thus the resulting 2-D map allows the clustering as well as the seriation of the data to be analyzed.69,70 The points in the m~-dimensional space spanned by the factors are first linearly projected onto a 2-D map. Their projected positions are iteratively changed such that the differences between the Euclidean distances in the 2-D map dii, and those in the higher-dimensional space t~ii,are
63 M. van Heel, Ultramicroscopy 13, 165 (1984). S. C. Johnson, Psychometrika 32, 241 (1967). 65 E. Diday, Rev. Fr. Inf. Rech. Oper. 6, 61 (1972). M. van Heel and M. St6fller-Meilicke, EMBO J. 4, 2389 (1985). 67 j. Frank, J.-P. Bretaudiere, J.-M. Carazo, A. Verschoor, and T. Wagenknecht, J. Microsc. 150, 949 (1988). 6a A. Verschoor, J. Frank, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 187, 581 (1986). 69 M. Radermacher and J. Frank, Ultramicroscopy 17, 117 (1985). ToM. Radermacher and J. Frank, Ultramicroscopy 19, 75 (1986).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
21
minimized according to an error criterion E: 1 E-
iv
,,
E
E
'<"
'
(21)
i
The distances are defined by =
(22a)
(It, ira - - X t , m ) 2 1
and d,e =
t)
[x~° - x~')] 2
(22b)
with x~~ = 2-D map coordinates of/th point. The weights flee in Eq. (21) are introduced to weight the distances according to their importance:
if,,, = (~,;,)"
(23)
The choice of a = 0 is appropriate if a clustering of the data is to be expected, and if the short-range relations within a cluster are thought to be of minor importance. The choice of a = 1 is appropriate in situations where short-range relations are to be reflected. However, any value between these two extremes can be used. Experience has shown 69 that rapid convergence is achieved when a = 0 is chosen in a first pass and a > 0 in a refinement pass that uses the map of the first pass as starting distribution. The minimization of E of Eq. (21) is done by the method of steepest descent, which is an iterative algorithm.
D a t a Collection for Three-Dimensional Reconstruction If projections are available over a sufficiently large portion of the hemispherical angular range, the object can be reconstructed in three dimensions. Methods of data collection and reconstruction are viable only if they allow the radiation dose to be minimized. When the negative staining technique is used, the dose should not exceed 2000 e/nm2. 26,27 In practice, this means that in the 3-D reconstruction, data from many different particles must be combined, so that each particle is allowed to be exposed only once, contributing a single projection to the reconstruction. Two methods of data collection and 3-D reconstruction fulfilling this requirement have been described, both of which make use of some type of naturally occurring random orientations of the ribosomal particles:
22
ELECTRON MICROSCOPY
[ 1]
FIG. 5. Principle of two data collection methods that rely on random orientations of a particle, illustrated by the use of synthetic images: (a) Quasi-cylindrical particle occurring in random orientations on the specimen grid (example, prokaryotic 30S ribosomal subunit). A 0 ° view of this field contains a random sample of the 360 ° single-axis projection range. (b) Particle occurring in a unique orientation but with random in-plane azimuths (example, prokaryotic 50S ribosomal subunit). A 60 ° view of this field contains a random sample of a
completeconicalprojectionrange. 1. random orientations of a particle with approximately cylindrical shape, whose axis of rotation lies parallel to the specimen grid (Fig. 5a) H, and 2. random in-plane orientations of a particle that possesses a preferred orientation with respect to the plane of the specimen grid (Fig. 5b). 1,12,13 In the first method, an image of the untilted specimen grid furnishes a large range of views, related by rotation about a single axis, which may be ordered by application of multivariate statistical analysis. However, this method has the serious disadvantage of requiring some independent information, e.g., data from additional tilt experiments, so that angles can be assigned to these views for the purpose of the 3-D reconstruction. The second method, used in the reconstruction from a single-exposure, random conical-tilt series, avoids these problems of angle assignment: a pair of micrographs is taken, one of the tilted (e.g., by 60 °), and one of the untilted specimen grid. The first image, which contains a conical range of projections, is used in the reconstruction, while the sole purpose of the second image is to establish the azimuthal angles, and thereby the precise placement of each tilted image on the theoretical cone. Tilt Axis Determination The direction of the tilt axis is determined by comparing distances between pairs of equivalent points in the image of the tilted and untilted specimen.13
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
23
If I is the length of such a line in the 0 ° image, l' the corresponding line in the tilted image, and d the tilt angle, then the angle a that the tilt axis forms with l in the 0* view is: a = arcsin { .(ll~lln'~ 1/2}
(24a)
and with l' in the tilted view:
(12 _ 1,2 1/2
(24b)
To achieve a high accuracy in the determination of this angle, between 380 (for n = 20 points) and 1560 (for n = 40 points) lines are compared and the results averaged. The accuracy of the determination depends on (1) the tilt angle, since for small angles the length differences are very small; (2) the accuracy of the measurements; and (3) the angle that the line l or l' forms with the actual tilt axis. A satisfactory accuracy is obtained when the tilt angle is larger than 30 °, and the angle between the tilt axis and line l (or line l') is between 20 ° and 70". A program calculating the direction of the tilt axis should allow a m i n i m u m length for l (or 1') to be specified so that the lengths may be measured with an accuracy of at least 2%. Alignment of a Tilt Series Here we will give the principles of alignment for the images in both single-axis and conical-tilt series. A detailed theory for the alignment of a single-axis tilt series is given by Guckenberger. 71 Its principle can be described as follows. Electron micrographs are orthogonal projections of the object, i.e., the projection plane is perpendicular to the direction of projection. For the purpose of aligning the projections to a c o m m o n origin, each image of the tilt series is first stretched by l/cos O, thus creating a set of inclined projections, i.e., projections that all lie parallel to the same plane of the object's coordinate system. These inclined projections are serially aligned by the 2-D cross-correlation procedure described earlier. The translations found in this alignment are mapped back into the coordinate systems of the orthogonal projections and these original projections are shifted accordingly. The alignment of a conical-tilt series proceeds in a similar way. ~3 Inclined projections are again created by stretching the images by 1/cos O 71 p. Guckenberger,
Ultramicroscopy9,
167 (1982).
24
ELECTRON MICROSCOPY
[ 1]
where O is the (fixed) tilt angle. These projections are serially aligned. For each pair of successive projections, the second projection is rotated, by the angular difference determined relative to the first one; the two projections are cross-correlated; and finally the second projection in its unrotated, unstretched version is shifted by the vector found. Both alignment schemes suffer from accumulation of errors, as they both work in a serial manner. This problem can be overcome by aligning the projections always i n sets of three and shifting them by an averaged amount, or by using a similar strategy that effectively reduces the number of steps in one complete alignment cycle. In any case, it is necessary to repeat the alignment several times until no further significant shifts are found. T h r e e - D i m e n s i o n a l Reconstruction In the 3-D reconstruction step, Gilbert's weighted back-projection method 72 is preferred to the iterative methods 73 for its computational efficiency. After a simple back-projection, the reconstructed object ~(r) is subjected to a 3-D Fourier filtration [3-D weighting function W3(k)]: p(r) = 3:-1{ W3(k ) ~(~(r)))
(25)
Equivalent to this procedure is the 2-D Fourier filtration of the individual projections [2-D weighting functions Wz(k)] p(r) -- ~-'(W2(k) ~(p(r)))
(26)
followed by back-projection. The choice of weighting functions W3(k) or W2(k) is determined by the geometry of data collection (single-axis tilt versus conical) and the angular spacing of the projections (even versus random). Data with random spacing can be converted into evenly spaced data by averaging over equal angular intervals. Such a data reduction increases the speed of computation but results in some loss of resolution. Weighting Weighting functions for the various geometries arc given below. Although many different weighting functions can be found in the literature, they differ mainly in the way in which an implicit low-pass filtration or 72p. F. C. Gilbert, J. Theor. Biol. 36, 105 (1972). 73G. T. Herman, "Image Reconstructionfrom Projections." AcademicPress, New York, 1980.
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
25
resolution limitation is realized. None of the weighting functions given here contains any limitation in resolution. Rather, this limitation has to be imposed in a separate step, either prior to the reconstruction, by applying a 2-D filter function to the Fourier transform of each projection, or after the reconstruction, by applying a 3-D filter function to the Fourier transform of the 3-D volume. This latter approach offers a much greater flexibility, since a large choice of low-pass filter functions is available and these can be varied in the last step for the interpretation of the results. In the following we assume that x and y are coordinates in the specimen plane, and z is the coordinate perpendicular to the specimen plane. Furthermore, we assume that y is the direction of the tilt axis in the single-axis tilt series. The transformation from the coordinate system of the object to that of the ith projection with azimuth ~bi and tilt angle Oi is assumed to be r~O = a y ( o , ) • R z ( ~ , ) "r
(27)
with r, object coordinates; r t0, projection coordinates (projection plane x to, yto); Ry, rotation around y-axis; Rz, rotation around z-axis. Although the historical development proceeded in the opposite direction, we will first give the weighting function appropriate for arbitrary, entirely irregular angular sampling 12 and will then show how the functions for regular and single-axis data collection follow from this under appropriate assumptions: N'
Wa(x*,y*,z*) = 1 / ~ D sinc[~tDz*(0]
(28a)
i--I
with x*,y*,z* cartesian coordinates in the 3-D Fourier coordinate system of the object; z *to, z*-coordinate in the coordinate system of the Fourier transform of projection Pi; D, object diameter. The 3-D weighting function for a conical geometry (0 fixed) with equal azimuthal angular increments is independent of the azimuth74: Wa(r*,c~*,z* ) = ½(r . 2 s i n 2 0 - - z . 2 c o s 2 O) 1/2
(28b)
where r* = (x*2+ y,2)1/2, ~b*, and z* are cylindrical coordinates in the object's 3-D Fourier transform. The equivalent 2-D weighting function in the planes corresponding to the 2-D Fourier transform of the single projections isTM W2(x*tO,y*O~) ffi y*O~ sin 0
(28c)
where x.tO, y.t0 are the coordinates in the section of the 3-D Fourier space 74 M. Radermacher and W. Hoppe, Proc. Int. Congr. Electron Microsc., 9th 1, 218 (1978).
26
ELECTRON MICROSCOPY
[ 1]
that corresponds to the projection p~. [The latter weighting function can be calculated from Eq. (28a) by assuming D ~ oo, O constant, and ~b continuous.] The 2-D weighting function for single-axis tilting with equal angular i n c r e m e n t s is 72
W2 = x*
(28d)
Resolution of the Reconstruction The theoretical resolution of a 3-D reconstruction, which depends on the number of projections, may be calculated for equal angular increments in both the single-axis and the conical-tilting schemes. Both formulas are derived by using Shannon's sampling theorem, which states in essence that two measurements must be available for each resolution element. Applied to Fourier space this means that no two neighboring sampling points should be spaced farther apart than 1/D, where D is the diameter of the reconstruction volume. In the case of conical tilting, the volume is assumed to be spherical (diameter, D) and, in the case of single-axis tilting, it is assumed to be cylindrical (diameter of cylinder D), concentric with the tilt axis. The formula linking the number of projections N with the resolution for single-axis tilting is (according to the formula of Crowther et al., 75 modified to account for the accessible angular range76) N = n ( D / d ) . 2(0/n)
(29a)
where tr is the maximum available tilt angle; i.e., the tilt angles range from - d to + d. For conical tilting the formulas a r e 77 N = 2 n ( D / d ) sin d
for N even
N = n / 2 ( D / d ) tan 0116 cos2 d - (d/D)2] m
(29b) for N odd
(29c)
Both formulas determine only the resolution in the directions where the 3-D structure is fully sampled. In the conical-tilting geometry a double cone with vertex angle 90 ° - d is missing, while in the single-axis geometry a double wedge with an angle 90 ° - d is missing. Besides producing artifacts, the gaps in the angular coverge cause an elongation of the image point, which can be expressed by a factor q, the resolution ratio, 7s that has 75 R. A. Crowther, D. J. DeRosier, and A. Klug, Proc. R. Soc. London, Ser. A 317, 319 (1970). 76j. Frank and M. Radermaeher, in "Advanced Techniques in Biological Electron Microseopy" (J. K. Koehler, ed.), p. 1. Springer-Verlag, Berlin, Federal Republic of Germany, 1986. 77 M. Radermaeher and W. Hoppe, Proc. Eur. Congr. Electron Microsc., 7th 1, 132 (1980). 78 The original term used for this quantity, elongation factor, will not be used here.
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
27
to be applied to the resolution calculated with the formulas given above. The resolution ratios are q~ =
( O + sin 0 cos ~)l/2 -- sin 0 cos
for single-axis tilting
(30a)
and / 3. . . .-. . sin 2 0 \ 1/2 qxz = t 2sin2O )
for conical tilting
(30b)
In a reconstruction from a conical-tilt series only two resolution values have to be considered, namely that given b y Eq. (29b,c) in the plane perpendicular to the cone axis, and a value resulting from application of the factor qxz ofEq. (30b) in the direction of the cone axis (Fig. 6). In a reconstruction from a single-axis tilt series the resolution is different in all three axial directions. If y is the tilt axis and z is the direction perpendicular to the specimen, Eq. (29a) provides the resolution in the x-direction, and this value multipled by the factor q= provides the resolution in the z-direction. The resolution in the direction of the tilt axis is equal to the resolution in the original micrographs, unaffected by other variables. The formulas given above are valid for regular geometries. In a reconstruction from a series of projections with statistical angular distribution, the formulas for the resolution ratios are still valid, and there are still two (in the conical case) or three (in the single-axis case) different resolutions to be distinguished. However, in this situation, the formulas of Eq. (29) may only be used as estimates, by assuming even angular increments that reflect
a
Z
b
~
xis tilting
~
conrcoq tilting
0 I
0
I
i
i
i
i
i
i
~0
20
30
~0
so
60
70
i
80 [deg]
FIG. 6. knisotropy of resolution in the reconstructed object. (a) Approximate appearance of a point spread function (PSF) for conical-tilt geometry. In the z direction, the PSF is elongated by a spread factor whose size depends on the tilt angle O. (b) Resolution ratio as a function of the tilt angle for single-axis and conical tilting. From Radermacher and Hoppe. 77
28
ELECTRON MICROSCOPY
[ 1]
the average spacing. Moreover, Eqs. (29) and (30) furnish theoretical values that do not take into account any sources of limitation other than the number of projections. Additional limitations can be imposed by factors such as the resolution of the micrograph, the accuracy of the angle determination, the precision of the alignment, and the consistency of the particle set. A reliable way to determine the resolution actually achieved is by a phase residual calculation. The set of projections is split arbitrarily into two subsets, and two independent reconstructions are calculated. These are then compared in Fourier space by computing the phase residual, similarly as in 2-D averaging techniques. Such a resolution determination is the most objective measure, as it does not make any assumption about the accuracy of any step in the reconstruction process. R e p r e s e n t a t i o n of R e c o n s t r u c t e d Particles The reconstructed volume is first represented as a series of slices. Most informative are halftone representations with overlayed contours of equal density (Fig. 7a). Representations rendering the 3-D shape of the particle are obtained either by physical model building 79 or by computer-generated "solid" modeling. 8°-s2 In either case, an appropriate density threshold delineating the particle boundary must first be selected. For a negatively stained specimen, the boundary can be distinguished on a contour plot of a slice as a region where the steepest change in reconstructed density occurs 1 (arrow c in Fig. 7a). For solid modeling in the computer, the distance of the surface defined by the density threshold is determined as it appears from a given viewing direction (Fig. 8). The distance values, determined by scanning through the volume, are stored in an array referred to as the z-buffer. The z-buffer, when displayed with inverted contrast, already provides a crude representation of the object's surface, with bright areas representing regions of the object close to the viewer and dark areas representing those farther away. The impression of looking at a solid model is greatly enhanced by the addition of shading based on the information in the z-buffer. Any three adjacent points in the z-buffer define a triangular facet, which forms a certain angle to the viewing direction. The cosine-shading algorithm, 83 which we have found very effective, assigns to each pixel the value of the 79 D. J. DeRosicr and A. Klug, Nature (London) 217, 130 (1968). 8°G. T. Herman and H. K. Liu, Comput. Graph. Image Proc. 9, 1 0979). 81 M. van Heel, Ultramicroscopy U , 307 (1983). 82 M. Radermacher and J. Frank, J. Microsc. 136, 77 (1984). 83 H. Gourard, IEEE Trans. Comput. C-20, 623 (1971).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY E M
29
FIG. 7. Three-dimensional reconstructions of the two subunits of the E. coli ribosome, and the choice of threshold used for the solid modeling (scale bars 10 nm). (a-e) 30S subunit at 3 nm resolution as determined from randomly oriented particles (cf. Fig. 5a). From Verschoor et al. H (a) Central section through reconstructed volume. The contour levels marked b, c, d, and e were used as threshold values in the surface representations (b)-(e), respectively. (b-e) Surface representations generated by levels identified in (a). The model (c) is generated by a level that lies midway in the range of steepest slope, and is thought to best approximate the boundary between stain and ribonucleoprotein mass. (f) Surface representations showing different views of the 50S subunit at 3 nm resolution as determined by the single-exposure, random conical-tilt reconstruction method. From Radermacher et al.t3 cosine o f this angle, simulating the a p p e a r a n c e o f a reflective surface. T h e intensities o f the shading are m i x e d with the halftone representation o f the inverted z-buffer for i m p r o v e d d e p t h simulation. T h e best results are o b t a i n e d with a m i x t u r e ratio o f 5 0 : 5 0 (Fig. 7 b - f ) . Software A n u m b e r o f m o d u l a r software systems specialized for electron m i c r o scopic data processing exist t h a t i n c o r p o r a t e m o s t or all o f the algorithms
30
ELECTRON MICROSCOPY R
/~
tz
[1]
R°
0
FI~. 8. Principle of the surface representation algorithm. For a given viewing direction (line originating from observer at 0) a reference plane is constructed (R or R') whose position defines the part of the surface to be represented: in position R, the object is cut by the plane, resulting in the invisibility of a portion $2 of the surface. In position R', the complete surface $1 + $2 will be visualized. The surface is found by scanning the volume leftward from the reference plane until a voxel equal to or larger than the threshold value is encountered. The distance traveled (e.g., tm or te), which is stored in the z-buffer, is used as the basis for the surface representation. From Frank et al. 3 described: SPIDER, s4 developed by our group in Albany, SEMPER, s5 I M A G I C , s6 and EM. $7 (So far, to o u r knowledge, the S E M P E R system lacks the multivariate statistical analysis features.) These packages are characterized by possessing a set o f "basic" c o m m a n d s (such as "Fouriert r a n s f o r m " or " W i n d o w " ) as well as high-level language elements enabling conditional j u m p s , register operations, iterative execution o f p r o g r a m sections, procedure definitions, a n d hierarchical calling. A complex task such as a 3-D reconstruction o f biological particles f r o m micrographs involves a large n u m b e r o f separate processing steps. T o give an example, the case o f the reconstruction f r o m a r a n d o m conical projection set ~2,13 involves 26 such steps, which are listed below. These are either realized as interactive operations (I), single c o m m a n d s (S), or procedures (P) containing a n u m b e r o f single c o m m a n d s : (P)
1. Reduce digitized micrographs (of tilted and untilted specimen) to display size s4 j. Frank, B. Shimkin, and H. Dowse, Ultramicroscopy6, 343 (1981). s5 W. O. Saxton, T. J. Pitt, and M. Homer, Ultramicroscopy4, 343 (1979). s6 M. van Heel and W. Keegstra, Ultramicroscopy 7, 113 (1981). s7 R. Hegefl and A. Althauer, Ultramicroscopy 9, 109 (1982).
[ 1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
(I) (I) (P) (P) (P) (P) (P)
2. 3. 4. 5. 6. 7. 8.
(P) (S) (P)
9. 10. 11.
(P)
12.
(P)
13.
(P) (P)
14. 15.
(P)
16.
(P)
17.
(S)
18.
(S)
19.
(S) 20. (S) 21. (S) 22. (S) 23. (P) 24. (P) 25. (P) 26.
EM
31
Window particles from reduced micrographs Window background areas for contrast normalization Determine contrast scaling parameters Window particles from original micrograph Center particles Prepare 0 ° alignment reference Perform rotational/translational alignment, store rotation angles Average aligned 0 ° particle images Prepare new reference from average Perform rotational/translational alignment, store sum of angles from steps 8 and 11 Average aligned 0 ° particle images to obtain two subaverages + total average Determine cross-resolution from the two subaverages using phase residual analysis Center tilted particle images Translationally align tilted particle images (repeat several times) Transfer angles from rotational alignment of the untilted particles into headers of files containing tilted particle images Split tilted particle set into two sets (#1 and #2), interlaced according to azimuthal angles Apply Fourier weighting function to set #1 of tilted particle images Apply Fourier weighting function to set #2 of tilted particle images Apply Fourier weighting function to complete set of tilted particle images Back-project weighted set #1 resulting in reconstruction #1 Back-project weighted set #2 resulting in reconstruction #2 Back-project weighted complete set resulting in reconstruction #3 Determine cross-resolution between reconstructions #1 and #2 using phase residual analysis Filter reconstruction #3 to resolution determined in step 24 Create representations of the reconstructions (slice by slice, surface, etc.)
Each of the processing steps marked as a procedure contains a number of operations performed by single commands. As an example for the opera-
32
ELECTRON MICROSCOPY
[1]
tions contained within a procedure, we describe the actions performed by the centering procedure listed as step 6 above. This procedure, named QCUCENT in the SPIDER system, centers each particle of a 0 ° projection set of particles by cross-correlation with a blurred version of a disk. At the same time, the procedure creates a series of small control files that are used to check the performance of the procedure and for documentation. A selection list that contains flags indicating "good" or "bad" particles controls the actions of QCUCENT; for "bad" particles, the procedure merely produces a blank control output file. (beginning of the procedure) Get input data: (name of the image set (first image number in image set (last image number (selection list (name to be given to control output images (32 X 32) (name to be given to output images (name to be given to document file receiving shift parameters (radius of circular disk (contrast polarity of images [dark particles on bright background ( - 1) or opposite (+ 1)] Create blank image of size 32 × 32 Create image of circular disk Scale image of disk to positive or negative contrast Low-pass filter disk (loop over all images): Look in selection list if image is to be used (if no): Copy blank image into control output file with current image number control output image (if yes): Mask image with smooth circular mask (Gaussian falloff) Cross-correlate image with blurred circular disk Determine center of gravity of cross-correlation peak Shift image by offset of CCF peak to CCF center ---}output image Store resulting shift vector ---, document file Reduce centered image to a size of 32 X 32 Contrast-enhance reduced centered image ~ control output image (end of procedure)
[1]
IMAGE PROCESSING OF SINGLE RIBOSOMES IMAGED BY
EM
33
Fortran programs for correspondence analysis have been published by Lebart et al. ss,ss Of particular interest in our application are programs that perform the stochastic approximation developed by Lebart et al. for large
data matrices. 5s The programs implementing the method of clustering about moving centers, Diday's method of finding stable clusters, as well as hierarchical ascendant classification are also found in Ref. 88. However, it should be noted that these programs were developed for general purposes, and that a major effort is needed to interface these with image-processing software. Extension of M e t h o d s - - Future Prospects The field of application of the techniques described above is not limited to separate reconstructions of the various ribosomal panicles. For instance, one purpose of 2-D comparisons of structures of different ribosomal particles has been the attempt to correlate morphologically conserved or nonconserved features among prokaryotic and eukaryotic, and more recently archaebacterial, ribosomes,s9 Clearly, future attempts at interkingdom comparisons must be based on quantitative comparisons of 3-D reconstructed (and aligned in three dimensions) subunits and monosomes from organisms from the various phyla. It may be possible to assess gains or losses of ribonucleoprotein mass in specific areas (e.g., the "lobes" of the small subunit), if (1) the particles are reconstructed from demonstrably analogous views (with analogous direction of collapse or flattening, if any), and (2) the species chosen for reconstruction have ribosomal subunits demonstrably representative for their kingdoms. From the latter requirement, given the considerable size and shape variations of the eukaryotic 60S subunit (and thus the 80S monosome), it is obvious that the variations within a kingdom must be assessed quantitatively before interkingdom comparisons can be attempted. In addition to this goal of obtaining parallel reconstructions of the various ribosomal particles, a potentially much more important application involves localizations of functional domains, mappings of individual r-proteins and portions of rRNA, and ligand-binding sites, in other words, 3-D immunoelectron microscopy (IEM). Formerly, the only 3-D information on localization of a bound antibody came from micrographs in which the site could be recognized on two or more different views whose approxis8 L. Lebart, A. Morineau, and N. Tabard, "Techniques de la Description Statistique." Dunod, Paris, 1977. s9 j. A. Lake, Prog. Nucleic Acid Res. Mol. Biol. 30, 163 (1983).
34
ELECTRON MICROSCOPY
[ 1]
mate relationship was known (e.g., the crudely orthogonal crown and kidney views of the 50S subunit). Discounting the possibility that antibody and ribosomal particle are partially overlapped in projection, the investigator mapped his best guess of the site onto the surface of his visually derived model, thus compounding the error in assignment. The 3-D implementation of IEM, for which a monospecific ligand is essential, could exploit labeled particles in a single well-defined view to enable determination in three dimensions of the site of the label. Around this site would appear a blur representing the free end of the Fab fragment of the IgG (or other ligand) in all of its possible orientations, but the increase in density at the actual binding site should be significant.9° In addition to indirect labeling by means of an antibody, direct localization of certain sites in three dimensions should become feasible. Localization of the P site on the 30S subunit, performed through cross-linking of a tRNA to the 16S rRNA, has been attempted in two dimensions through averaging and statistical evaluation of difference maps (Wagenknecht et al., unpublished observations), but unfortunately the 30S subunit has proved a particularly ditficult subject for 3-D investigation. It may be feasible to determine the binding sites of the initiation and elongation factors in three dimensions, once means are devised for producing stable complexes of the necessary ribosomal and nonribosomal components. Although the effect expended in such a reconstruction would be considerable, these methods appear to be the most promising approach presently available. The possibility of cocrystallizing particle and ligand exists, but for many complexes this may never be feasible. One additional development may enable a determination of the closeto-native structure of a ribosomal particle. Frozen-hydrated electron microscopy91'92'93 obviates both the use of a negative stain (with its denaturing effects) and the need for air drying (leading to some degree of collapse of the particle). Because images of ice-embedded specimens have low contrast and signal-to-noise ratio, the methods for 2-D averaging and 3-D reconstruction described above will require modification to increase their sensitivity, particularly at the crucial stages of particle alignment, before they can be successfully applied to this type of data. Nevertheless, the extra effort required to record and analyze low-dose ice images should prove justified, both by providing a standard against which the degree of preser9o See J. Frank, P.-Y. Sizaret, A. Verschoor, and J. Lamy, Proc. Annu. Meet. Electron Microsc. Soc. Am., 41st p. 282 (1983). 9~ K. A. Taylor and R. M. Glaeser, Science 186, 1036 (1974). 92 M. Adrian, J. Dubochet, J. Lepault, and A. D. McDowall, Nature (London) 308, 32 (1984). 93 T. Wagenknecht, R. Grassucci, and J. Frank, J. Mol. Biol. 199, 137 (1988).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
35
vation of particles from negatively stained preparations can be assessed and also by revealing for the first time the structure of the native ribosomal particle as it is investigated by other, non-EM techniques. Acknowledgments This work was supported, in part, by a grant of the National Instituteof Health 1RO1 GM 29169 and a sharedinstrumentationgrant of the National ScienceFoundation831345.
[2] S t a t i s t i c a l I m a g e A n a l y s i s o f E l e c t r o n M i c r o g r a p h s Ribosomal Subunits B y G E O R G E H A R A U Z , E G B E R T BOEKEMA,
of
and M A R I N VAN H E E L
Electron microscopy in combination with computer-image analysis represents a very direct method for determining the structure of biological macromolecules. Crystallographic techniques allow the determination of structure to higher resolution; however, for large macromolecular assemblies such as ribosomes, sufficiently large and perfect crystals are extremely difficult to obtain. Thus, electron microscopy of individual biological macromolecules has been developing as an alternative or complement to the traditional crystallographic approaches. Ribosomal structure has been extensively probed by electron microscopy. ~-7 However, since electron images are very noisy, agreement on even low-resolution models of ribosome structure has been slow in developing, s The visual interpretation of micrographs is a subjective process that varies from observer to observer, especially concerning those details at the limits of the attainable resolution. Our research has focused on establishing a precise methodology based on computerized image analysis and pattern recognition to enhance the visibility of statistically signifi-
H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 2 G. St6ffier and M. St6fller-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 3 V. D. Vasiliev, O. M. Selivanova, and S. N. Ryazantsev, J. Mol. Biol. 1711, 561 (1983). 4 A. P. Korn, D. Elson, and P. Spitnik-Elson, Eur. J. CellBiol. 31, 325 (1983). 5 N. A. Kiselev, E. V. Orlova, V. Ya. Stel'mashchuk, V. D. Vasiliev, O. M. Selivanova, V. P. Kosykh, A. I. Pustovskikh, and V. S. Kirichuk, J. Mol. Biol. 169, 345 (1983). 6 j. Lake, J. Mol. Biol. 161, 89 (1982). 7 j. Lake, J. Mol. Biol. 105, 131 (1976). s O. Meisenberger, I. Pilz, M. St6fller-Meilicke, and G. St6ffier, Biochim. Biophys. Acta 781, 225 (1984).
METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
35
vation of particles from negatively stained preparations can be assessed and also by revealing for the first time the structure of the native ribosomal particle as it is investigated by other, non-EM techniques. Acknowledgments This work was supported, in part, by a grant of the National Instituteof Health 1RO1 GM 29169 and a sharedinstrumentationgrant of the National ScienceFoundation831345.
[2] S t a t i s t i c a l I m a g e A n a l y s i s o f E l e c t r o n M i c r o g r a p h s Ribosomal Subunits B y G E O R G E H A R A U Z , E G B E R T BOEKEMA,
of
and M A R I N VAN H E E L
Electron microscopy in combination with computer-image analysis represents a very direct method for determining the structure of biological macromolecules. Crystallographic techniques allow the determination of structure to higher resolution; however, for large macromolecular assemblies such as ribosomes, sufficiently large and perfect crystals are extremely difficult to obtain. Thus, electron microscopy of individual biological macromolecules has been developing as an alternative or complement to the traditional crystallographic approaches. Ribosomal structure has been extensively probed by electron microscopy. ~-7 However, since electron images are very noisy, agreement on even low-resolution models of ribosome structure has been slow in developing, s The visual interpretation of micrographs is a subjective process that varies from observer to observer, especially concerning those details at the limits of the attainable resolution. Our research has focused on establishing a precise methodology based on computerized image analysis and pattern recognition to enhance the visibility of statistically signifi-
H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 2 G. St6ffier and M. St6fller-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 3 V. D. Vasiliev, O. M. Selivanova, and S. N. Ryazantsev, J. Mol. Biol. 1711, 561 (1983). 4 A. P. Korn, D. Elson, and P. Spitnik-Elson, Eur. J. CellBiol. 31, 325 (1983). 5 N. A. Kiselev, E. V. Orlova, V. Ya. Stel'mashchuk, V. D. Vasiliev, O. M. Selivanova, V. P. Kosykh, A. I. Pustovskikh, and V. S. Kirichuk, J. Mol. Biol. 169, 345 (1983). 6 j. Lake, J. Mol. Biol. 161, 89 (1982). 7 j. Lake, J. Mol. Biol. 105, 131 (1976). s O. Meisenberger, I. Pilz, M. St6fller-Meilicke, and G. St6ffier, Biochim. Biophys. Acta 781, 225 (1984).
METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
36
ELECTRON MICROSCOPY
[2]
cant structural features in electron images of isolated biological macromolecules,9,~°thereby pushing back the frontier of argumentability. Improving the Signal-to-Noise Ratio of Electron Micrographs Electron micrographs of macromolecules are noisy due to a number of factors: (1) Biological specimens are extremely sensitive to bombardment by electrons. Radiation-induced structural alterations include evaporation of light atoms, translocation of atoms, and ultimately disintegration. (2) Images are formed by electrons impinging on a photographic emulsion. This "electron counting" process is essentially a Poisson statistical one, with the associated uncertainty being the sqfiare root of the number of quanta detected. (3) Heavy atom salts (e.g., uranyl acetate) are commonly used to provide image contrast by negative staining, but .the random distribution of stain and the formation of stain crystallites during electron exposure is yet another source of noise. It is impossible in any experimental situation to eliminate all noise factors at once. Low-dose electron microscopy preserves the specimen, but the recorded images are very noisy since fewer electrons are used to form them. With increasing electron doses, radiation damage increases significantly. Sophisticated techniques such as cryoelectron microscopy can only reduce the rate of destruction by a factor of no more than 10, and also give images with low contrast which are not easily interpreted. Alternative methods of specimen preparation which do not require negative stain, e.g., glucose embedding, also result in low-contrast images. Thus, even under the best possible conditions, the signal-to-noise ratio of electron micrographs will be poor. An improvement of the signal-to-noise ratio of electron images can be achieved by a posteriori image processing. The restoration of noise-degraded images is a topic that has received much attention in many fields.l~ In electron microscopy, the conceptually simplest and most suitable approach to image improvement is that of image averaging. 5,~2-16In a set of many noisy images of an object, the noise at any position varies from 9 M. van Heel and J. Frank, Ultramicroscopy 6, 187 (1981). ~oM. van Heel, Ultramicroscopy 13, 165 (1984). i~ W. K. Pratt, "Digital Image Processing" Wiley, New York, 1978. ~2D. L. Misell, "Image Analysis, Enhancement, and Interpretation," North-Holland, Amsterdam, 1978. 13p. N. T. Unwin and R. Henderson, J. Mol. Biol. 94, 425 (1975). 14j. Frank, W. Goldfarb, D. Eisenberg, and T. S. Baker, Ultramicroscopy 3, 283 (1978). ~5j. Frank, A. Verschoor, and M. Boublik, Science 214, 1353 (1981). ~6M. van Heel and M. St0fller-Meilicke, EMBOJ. 4, 2389 (1985).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
37
FIG. 1. Electron micrograph of 50S ribosomal subunits.
image to image, but the desired feature information is the same. By averaging together these noisy images, the reproducible signal is enhanced with respect to the random background noise. In analyzing electron micrographs of isolated biological macromolecules (Fig. 1), there are two problems concerning particle orientation which must first be overcome, since we can only obtain meaningful averages of images that are very similar. First of all, individual particles lie at all angles and positions on the specimen support film and must first be brought into register both rotationally and translationally. Second, biological macromolecules may assume more than one stable position on the support, thus providing essentially different projections through the object. The analysis of mixed populations of images requires the use of multivariate statistical
38
ELECTRON MICROSCOPY
[9.]
analysis and classification techniques. 9,~°,~6 In this chapter, we shall describe the stepwise application of these powerful image-processing tools to electron micrographs of the 50S ribosomal subunit of Escherichia coli. Data Preparation Isolated 50S subunits were prepared for electron microscopy on a single-layer carbon film by the method of Valentine and negatively contrasted with 1% uranyl acetate. ~7Electron micrographs used in this chapter were taken on a Philips EM 400 at an instrumental magnification of 60,000 and an accelerating voltage of 100 kV. Each specimen area was not preilluminated prior to being micrographed, to minimize the total electron dose. The electron micrographs were digitized using a Datacopy (Datacopy Corporation, Mountain View, CA) digitizing camera, controlled by an IBM personal computer. This process renders the information on the film into a form suitable for manipulation by a computer. Typically, entire micrographs were digitized in 1728 X 2240 picture elements (pixels). The scanning step (pixel size) was 32/zm, and so each pixel corresponds to a square area of 0.53 nm size at the object level. The digitized data were copied to a VAX 11/780 computer (Digital Equipment Corporation) via magnetic tape. There, analyses of digitized images were performed in the framework of the IMAGIC image processing system, ~8 which is a general purpose, interactive, and user-oriented image analysis software package. Selection and P r e t r e a t m e n t of Molecular Projections A typical electron micrograph is shown in Fig. 1. All distinct particles that were not overlapping or in close contact with other particles were selected interactively from each digitized micrograph using a raster-scan image display system in conjunction with a joystick-controlled cursor. ~8At least a few hundred individual molecules must be selected to achieve statistical significance of the results. In this instance, a total of 1956 images were obtained from 15 micrographs. Although at present we do the particle selection interactively, larger populations of molecules can be handled using automated particle selection algorithms. 19,2°At this stage, each indi17 R.C. Valentine, B. M. Shapiro, and E. R. Stadmann, Biochemistry7, 2143 (1968). t8 M. van Heel and W. Keegstra, Ultramicroscopy7, 113 (198 l). t9 M. van Heel, Ultramicroscopy8, 331 (1982). 2o j. Frank and T. Wagenknecht, Ultramicroscopy 12, 169 (1984).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
39
vidual macromolecule and its immediate background are represented as a square array of n × n numbers; n is 72 in this example, but generally n ranges from 48 to 96, depending on the size of the object and the desired resolution. The many single molecular images must be pretreated by band-pass filtering to suppress the very low and very high spatial frequencies. The very high spatial frequencies represent mostly noise and their contribution can thus be weighted down at this early stage. The very low spatial frequencies also represent unwanted information, e.g., gradual fluctuations in the average densities which depend largely on the amount and uniformity of specimen staining. The frequency limits of band-pass filtering generally vary from specimen to specimen. For our ribosome images, we have determined empirically that a low frequency cutoff of about 13 nm and a high-frequency cutoff of about 1.3 nm are reasonable. Moreover, the lowfrequency components (but not the high) are set to a fraction of their original values (typically 1.5%) so that they can be easily restored at a later stage if needed. After band-pass filtering to enhance only the important structural information, the particles are surrounded by a circular mask to cut away unnecessary background. Finally, the images are standardized by (1) "floating" within this mask to a zero average density, and by (2) multiplication of each pixel by a factor (different for each image) to normalize the variance.16 Alignment of Images within the Plane Isolated macromolecules exhibit a full range of rotational orientations in the plane of the support film. Furthermore, the particle is not yet precisely centered in its image, and a translation in the plane is also required to bring all particles into register. To achieve this registration, we use a computerized alignment algorithm (Fig. 2) based on the use of cross-correlation functions. 2~-23 The alignment process requires first the selection of a reference image with respect to which all other molecular images will be aligned. In the case of the 50S ribosomal subunit, the predominant projection view in electron micrographs is the "crown" view; to a much lesser extent, a "kidney" view is exhibited. Therefore, we choose as an initial reference a well-preserved, 21 W. O. Saxton and J. Frank, Ultramicroscopy 2, 219 (1977). 22 j. Frank, in "Computer Processing of Electron Microscope Images" (P. W. Hawkes, ed.), p. 187. Springer-Verlag~ Berlin, Federal Republic of Germany, 1980. 23 M. Steinkelberg and H. J. Schramm, Hoppe-Seyler's Z. Physiol. Chem. 361, 1363 (1980).
40
EL1RCTRONMICROSCOPY
/• /I
[9.]
REFERENCE~~m~m~m~m~m~m~m~m
IMAGE
<~l.
[ <,'~oo;. I I
"6,,-',o 0 m ~ ~ ~ 3 6 o RCF
ROT.ALIGNED
/
i
FT2D
-~ shift I'~
REFERENCE I~,
!I FT2D1
f
ALIGNED
IMAGE
S
FIG. 2. Schematic of single particle alignment process. Cyl. coos, cylindrical coordinates; FTm, FTm, Fourier transform, one-dimensional, two-dimensional; RCF, rotational correlation function; rot. align., rotational alignment; transl., translational; CCF, cross-correlation function.
canonical crown view (Fig. 3a). The particle is centered within the image, masked by interactive contouring ~8 (Fig. 3b) and thresholded within the mask (Fig. 3c) to reduce the effects of any remaining background and of negative stain within the particle. Rotational alignment between a molecular image and the chosen reference image is achieved by searching for a maximum in the rotational correlation function (RCF). The image and reference are both converted from their usual representation in Cartesian coordinates to one in cylindrical coordinates, and the cylindrical images are then Fourier transformed in
[2]
41
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
a
i?
iilii~
~ !!ii!iii
i:!!i i~!ii!iiii ¸~¸
b
c
~!
d
FIG. 3. (a) A single noisy image selected as the initial reference. Dark areas represent stain, while light areas represent protein (or absence of stain). (b) The image in (a) contoured to reduce the effectof the remaining background. (c) The image in (b) thresholded within the contour to reduce the effectof negative stain within the particle. The fight areas remaining represent predominantly structural information. (d) An intermediate sum of the 20 images which correlate best with the image in (c); used as a new referencein another alignment in order to refine further alignment parameters. the tangential direction. The resulting series of one-dimensional Fourier transforms are conjugate multiplied with each other, and the RCF is obtained by integrating the inverse Fourier transform of this product over the radial coordinate. The molecular image is rotated by the angle 0 at which the RCF function is found to have its maximum. Following the rotational alignment, translational alignment is performed by searching for the position of the maximum in the cross-correlation function (CCF). The rotated molecular image and the reference image are Fourier transformed, and the two-dimensional Fourier transforms are conjugate multiplied by each other. The CCF is obtained from this product by inverse Fourier transforming. The rotated molecular image is shifted by ( - A x, - A y) to the position of maximum translational overlap. The value of this peak overlap is called the cross-correlation coefficient (CCC). The sequence of rotational and translational alignment is normally repeated once more to refine the rotation angle and shift parameters. 23 When the entire data set has been aligned with respect to the initial noisy reference, a smaller set of 20 or so molecular images is selected on the basis of the cross-correlation peak height, i.e., those molecules most similar to the reference after alignment. These selected images are then averaged together to give a better, less noisy reference (Fig. 3d), and the double alignment process is repeated again with the original images and using this new reference. R e f i n e m e n t of Alignments This method of aligning images is very sensitive and can deal with noisy images in which the motif may be even more obscured than in Fig. 3a. 2~,23
42
ELECTRON MICROSCOPY
[2]
As with any computational tool, though, it must be carefully applied. For example, the form of band-pass filtering of the data has a strong effect on the success of the alignment. If the alignment is not good, a refinement of the band-pass filter parameters is indicated. The most important factor affecting the results of an alignment is the choice of reference image. Here, a distinct crown view has been chosen as an initial reference. Since this reference still contains noise, repeating the alignments with "better" references will bring the images into better positions relative to each other. A second reference is therefore made from the average of the 20 or so images that correlate best with this first reference. Clearly, these images will "look like" each other, as will the average. Since we have a great deal of a priori knowledge of the low-resolution structure of the ribosome, we have a good idea of the sort of structure we expect to see in the end. However, with a macromolecule of initially unknown structure, it is not clear which projection view is most suitable as an initial reference image and we are faced with a "bootstrapping" problem which can only be solved iteratively. We shall return to this point in the discussion on multireference alignment. Multivariate Statistical Analysis of Mixed Populations For flat, disklike molecules such as glutamine synthetase ~4(glutamateammonia ligase), the two-dimensional alignment process is sufficient to analyze the entire population, since all molecular images have now been brought into a similar orientation. However, most molecules present more than one projection, and thus some means must be developed to determine and extract the predominant and characteristic views. Multivariate statistical analysis techniques are powerful tools for dealing with mixed populations of macromolecular images. 9,16,24-28 In particular, correspondence analysis (a special form of principal components analysis) is used to extract relevant information from the mixed data set. Each image of n × n pixels can be thought of as representing a point in n X n dimensional space, and the entire set of images forms a cloud in this space. Correspondence analysis determines a new, rotated coordinate system in which the first axis represents the direction of greatest interimage variance, the second axis the direction of largest remaining interimage variance, and 24 j. Frank, A. Verschoor, and M. Boublik, J. Mol. Biol. 161, 107 (1982). 25 j. Frank and M. van Heel, J. Mol. Biol. 161, 134 (1982). 26 M. M. C. Bijlholt, M. van Heel, and E. F. J. van Bruggcn, J. Mol. Biol. 161, 139 (1982). 27 j. Frank and A. Vcrschoor, J. Mol. Biol. 178, 696 (1984). 2s A. Verschoor, J. Frank, and M. Boublik, J. UItrastruct. Res. 92, 180 (1985).
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
43
so on. The cloud of images can now be described with respect to this new coordinate system. More precisely, each of the aligned images can be expressed as a linear combination of the predominant, independent eigenimages extracted from the set (Fig. 4a). The first eigenimage (with chisquared metrics) points at the center of mass of the full data set. Subsequent eigenimages describe decreasing amounts of the interimage variance
Fro. 4. (a) The data set of 1956 aligned images is decomposed by correspondence analysis into eigenimages which represent the principal components of interimage variation. The first eigenimage points to the center of mass of the full data set. The second, third, fourth, and fifth eigenimages describe 6.2, 4.9, 1.9, 1.7, and 1.4% of the total interimage variance, respectively, whereas the twenty-fourth eigenimage describes only 0.8%. All 24 eigenimages account for 34.2% of the total interimage variance. (b) Binary mask generated from the total sum of 1956 aligned images, defining the image area active in correspondence analysis. The total sum is a blurry image which indicates those regions within the image area within which the pixels belong (usually) to the molecule and not to negative stain or carbon support film.
44
ELECTRON MICROSCOPY
[2]
of the data set, and in our case soon represent predominantly noise. By disregarding these higher order components, and only considering the significant ones (typically of the order of 6 to 24), the images can be considered as points in a much smaller (than n × n) dimensional space. We have thus achieved a very large reduction in the amount of data to be analyzed as well as a significant amelioration of the effect of noise. The eigenimages of Fig. 4a can often be interpreted in terms of structural features that they describe. The lower order eigenimages typically comprise lower spatial frequency information than the higher order ones. The first eigenimage points to the overall average of the full data set. Eigenimage 2 describes predominantly the shape difference between crown and kidney views, while eigenimage 3 represents internal density modulations. Eigenimage 4 has strong density in the region of the L7/L12 stalk, indicating presence or absence of the stalk. Eigenimage 5 seems to show that the stalk can move up and down. Before performing correspondence analysis, the aligned images must first be pretreated to mask off image areas not representing relevant structural information. 26,27 In other words, we want to compare only those image areas in which the 50S subunit usually lies, and not the surrounding negative stain in which it is embedded. To do this, a mask is formed from the sum of all of the aligned molecules. The region of interest is contoured interactively using a display program, ~8 and a mask image is generated containing l s inside the contour and 0s outside it (Fig. 4b). This mask defines those pixels which are active during correspondence analysis, and which ultimately contribute to the classification statistics. Classification The data compression achieved by correspondence analysis in turn facilitates the grouping together of those images that are most similar, despite the high noise present in them. In our example, each image of 72 × 72 pixels is at this stage represented by only 24 components rather than 5184. We use an automatic hierarchical classification algorithm 1° in which similar images are initially merged together to form classes; these are themselves grouped further together to form larger and larger classes until finally one class containing all of the images is obtained. The classification procedure is usually stopped, however, when a predetermined number of classes (typically from 30 to 60) is obtained. (The number of final classes is chosen so that each class contains of the order of 30 to 40 members.) This partitioning is indicated with the 50S subunit because this particle assumes a relatively small number of positions on the support film, and we would like to find these positions regardless of their relative occurrence. 1°
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
45
During the classification, about 15% of the aligned population is initially rejected (on the basis of their large variance contribution) as representing either misaligned molecules or uncharacteristic images which appear rarely. There are also some "bad" classes which have a high internal variance; either they have few members, or their members are poorly aligned. These classes, too, are discarded. Of most interest in subsequent analyses are the "good" classes, composed of images which are most similar to each other. The aligned images in each class are summed together to give an "average" image with an enhanced signal-to-noise ratio. In these sums, sources of random noise such as variations in the stain distribution around the molecules, radiation-induced structural alterations, and variations in the background carbon support film are averaged out and become less significant compared to the common signal. The class averages thus represent the most commonly occurring projection views with high statistical significance, and indicate directions which we must explore further. In our example of the E. coli 50S subunit, the two-dimensional map of factorial coordinate 2 versus coordinate 3 (Fig. 5) suggests a rough decomposition of the data set into three major groups. Individual class sums representative of each group are shown in Fig. 6. We interpret these as representing different projections of the subunit: two types of crown views and one type of kidney view. One of the differences between the two crown views is the form of the the bulge on the right-hand side of the particle (the L 1 protuberance). This is already a significant result, since previously we were not able to distinguish these subtle differences in the original noisy images. However, the map also indicates that there may be a continuous transition between these extremes, and the hierarchical ascendant classification algorithm elucidated some other minor class averages in addition to the major ones. By this stage, we have some knowledge of the extent and type of heterogeneity in the input data.
Multireference Alignment In the next step of the analysis, a number of class averages (generally from 2 to 12, but 8 in this example) from the data set are selected and used as references, along with their mirror views, in a new set of alignments. These new references are less noisy than the original ones, and this results in a better alignment. Moreover, the new references represent trends in the data set which we want to explore. These trends are due to interparticle variability in specific structural features as well as to the different positions of the macromolecule on the support film. Mirroring the references elimi-
46
ELECTRON MICROSCOPY
.. • .
-..-'.':':.:-.'-t- :..
~.¢',~
" "a-.'.~
.: "
[2]
*-
...~l-!..~1~
.
-$,'
.... - . . ~ . ~ , ~ , ~ . ~ ~ "~Y'G':
•
•
•
•"
~.,g~.i-"/',
i .. ...
..
-.
•
": d: f-.
•
•
"•...":'"
•
"
•#t
.'"
"
•
"
• •
...
..
.~f.
;.
°
"
•
°
°
•
-.
,~,
,b
•
.°
j.-. -.
•
-.s,
"
•
.-
-."
.
.
•
... "..c. ~
-:..~.~..-".;-
:...
::.-,•
$,--,:
.
. . . . •
Fio. 5. Correspondence analysis map of factorial coordinates 3 (vertical axis) versus 2 (horizontal axis). Each image is represented as a dot, and the entire population forms a cloud. There are two major subpopulations, blending into a more diffuse third group.
nates bias in the alignment: the particle usually has only one preferred face of attachment to the support, but may occasionally lie on its other side• In multireference alignment, each macromolecular image is aligned with respect to e a c h new reference in turn. The CCC is a measure both of the goodness of alignment and of the noisy macromolecule's similarity to
FIG. 6. Classes representative of the three groups seen on the correspondence analysis map.
[2]
IMAGE ANALYSIS OF RIBOSOMAL SUBUNITS
47
the particular reference. The alignment parameters giving the highest CCC are the ones finally used to rotate and shift this particular image. The final data set is now better aligned because the reference images are less noisy and are also varied, consistent with the heterogeneity of the input images. The newly aligned data set can now undergo correspondence analysis and classification again. The class sums obtained after this refinement step are the ones finally studied in detail. Figure 7 shows some of the final class sums of the 50S subunit, selected
F16, 7. Partitioning of the population of 1956 images into classes; those with a low intraclass variance are selected for final analysis. The two crown views (a and b) are predominant (forming about two-thirds of the classes). The remaining classes appear to be views intermediate between the crown and kidney (c-g). In the final two crown classes (h and i), the L7/L12 stalk lies in different positions, spanning a distance of over 2 nm.
48
ELECTRON MICROSCOPY
[9.]
on the basis of low intraclass variance and representing the varied characteristic views of the 50S subunit in this population. Previous studies based solely on visual interpretation have defined only two main views, namely, crown and kidney. Our statistical analysis of a large number of particles shows that more views may exist in this electron microscopical preparation. The two types of crown views are the most commonly occurring (about two-thirds of the population), but to a lesser extent we also have kidney views and other views of the subunit appearing to lie in slightly different positions on the support film. The series of seven class sums (Fig. 7a-g) show the 50S subunit apparently rotating from the crown to the kidney view; the LT/L12 stalk gradually becomes weaker in density and eventually disappears, while the L 1 protuberance (on the right-hand side) and the notch between it and the central protuberance become progressively more pronounced. Interestingly, there are no pairs of classes which are mirror views of each other. The sensitivity of correspondence analysis is exemplified by the subtle difference between two crown class averages (Fig. 7h and i) which differ only in the position of the flexible LT/L12 stalk. This flexibility, as well as the variability of the Ll protuberance, have been subjects of previous and independent studies6,7,28and are important to keep in mind when attempting to understand the three-dimensional structure of the 50S subunit. At this stage, however, the computational work is over and we must now revert to our own (human) interpretational abilities to decide whether interclass differences are due to flexibility of structural features or to different positions of the macromolecule on the support film. A more detailed biological analysis will thus appear elsewhere. Visually, the quality of the class averages is much better than of the original images. Objectively, the reproducible resolution between two pairs of similar classes is typically 2.2 to 2.4 nm, determined by the Fourier ring correlation method. 16 Between any two original images of a class, the reproducible resolution is about 6 nm, indicating the significant improvement achieved by image averaging. Concluding Remarks The information content of electron micrographs can be enhanced significantly by a posteriori image processing. We have described and demonstrated powerful techniques for analyzing noisy electron images of isolated macromolecules. The fundamental principle underlying each step of the analysis is the reduction of the effect of noise, whether by band-pass filtering, principal components analysis, or averaging similar images to provide better references for alignment. This approach has allowed us to
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
49
determine objectively both flexibility of certain structural features and the potential existence of numerous distinct projection views in normal electron microscopical preparations of the E. coli 50S ribosomal subunit. With direct three-dimensional reconstruction techniques, 29-33 these projections can be used to obtain the three-dimensional structure of the subunit. • Acknowledgments We thank Professor H. G. Wittmann and Mr. H. Gewitz of the Max-Planck-Institut for Molecular Genetics for the 50S ribosomal subunits, and Professor E. Zeitler for comments on the manuscript. George Hamuz was the recipient of a Postdoctoral Fellowship from the Medical Research Council of Canada. 29 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). 3o A. Verschoor, J. Frank, M. Radermacher, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 178, 677 (1984). 31 G. Harauz and M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2, p. 279. North-Holland, Amsterdam, 1986. 32 G. Harauz and M. van Heel, Optik 73, 146 (1986). 33 M. van Heel, Ultramicroscopy 21, 111 (1987).
[3] S t r u c t u r a l A n a l y s i s o f R i b o s o m e s b y S c a n n i n g Transmission Electron Microscopy B y MILOSLAV BOUBLiK, G E R R I T T. OOSTERGETEL, VALSAN M A N D I Y A N , JAMES F. H A I N F E L D , a n d JOSEPH S. W A L L
The potential of high-resolution transmission electron microscopy (TEM) for the determination of the morphology of ribosomes and topographical mapping of their components and functional sites has been demonstrated elsewhere in this volume [4]. This chapter focuses on those features of dark-field scanning transmission electron microscopy (STEM) which make this technique uniquely suited to the quantitative structural analysis of ribosomes and other sensitive biological specimens.l The major advantage of the dedicated STEM is the separation of the components that affect resolution and contrast (Fig. 1). The probe-forming components (field emission gun, condenser lens, aperture, deflection coils, and objective lens) are all above the specimen, leaving the space below the specimen free for optimization of detectors (annular detectors for elastic scattering, J. S. Wall, in "Introduction~o Analytical Electron Microscopy" (J. J. Hren, J. I. Goldstein, and D. C. Joy, eds.), pp. 333-342. Plenum, New York, 1979.
METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any form reserved.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
49
determine objectively both flexibility of certain structural features and the potential existence of numerous distinct projection views in normal electron microscopical preparations of the E. coli 50S ribosomal subunit. With direct three-dimensional reconstruction techniques, 29-33 these projections can be used to obtain the three-dimensional structure of the subunit. • Acknowledgments We thank Professor H. G. Wittmann and Mr. H. Gewitz of the Max-Planck-Institut for Molecular Genetics for the 50S ribosomal subunits, and Professor E. Zeitler for comments on the manuscript. George Hamuz was the recipient of a Postdoctoral Fellowship from the Medical Research Council of Canada. 29 G. Harauz and F. P. Ottensmeyer, Ultramicroscopy 12, 309 (1984). 3o A. Verschoor, J. Frank, M. Radermacher, T. Wagenknecht, and M. Boublik, J. Mol. Biol. 178, 677 (1984). 31 G. Harauz and M. van Heel, in "Pattern Recognition in Practice" (E. S. Gelsema and L. N. Kanal, eds.), Vol. 2, p. 279. North-Holland, Amsterdam, 1986. 32 G. Harauz and M. van Heel, Optik 73, 146 (1986). 33 M. van Heel, Ultramicroscopy 21, 111 (1987).
[3] S t r u c t u r a l A n a l y s i s o f R i b o s o m e s b y S c a n n i n g Transmission Electron Microscopy B y MILOSLAV BOUBLiK, G E R R I T T. OOSTERGETEL, VALSAN M A N D I Y A N , JAMES F. H A I N F E L D , a n d JOSEPH S. W A L L
The potential of high-resolution transmission electron microscopy (TEM) for the determination of the morphology of ribosomes and topographical mapping of their components and functional sites has been demonstrated elsewhere in this volume [4]. This chapter focuses on those features of dark-field scanning transmission electron microscopy (STEM) which make this technique uniquely suited to the quantitative structural analysis of ribosomes and other sensitive biological specimens.l The major advantage of the dedicated STEM is the separation of the components that affect resolution and contrast (Fig. 1). The probe-forming components (field emission gun, condenser lens, aperture, deflection coils, and objective lens) are all above the specimen, leaving the space below the specimen free for optimization of detectors (annular detectors for elastic scattering, J. S. Wall, in "Introduction~o Analytical Electron Microscopy" (J. J. Hren, J. I. Goldstein, and D. C. Joy, eds.), pp. 333-342. Plenum, New York, 1979.
METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any form reserved.
50
[3]
ELECTRON MICROSCOPY
SCANNINGTRANSMISSION ELECTRONMICROSCOPE-STEM ELECTRON SOURCE (FieldEmissionGun)~/ OBJECTIVE . ~ LENS- - ~ _ ~
CONVENTIONAL TRANSMISSION ELECTRONMICROSCOPE-TEM ELECTRON SOURCE i HotFilament)
..... SPI;CIMEN ------~
/ o%SER o%c,vE
DETECTOR~ DETECTI~I~
DETECTOR ,
<~
APERTURE FILM
FIG. 1. Comparison of the image-forming system in scanning transmission and conventional transmission electron microscope.
energy loss spectrometer for inelastic scattering). Thus, every electron emerging from the specimen can be counted with an appropriate detector to convey information about the specimen volume irradiated at that instant. In the conventional TEM, on the other hand, there is only a single imaging channel with a very limited acceptance angle, restricted to minimize lens aberrations. This means that a conventional TEM operated in the dark-field mode can utilize only - 5 % of the available elastically scattered electrons and none of the unscattered or inelastically scattered electrons (for references see Wall and Hainfeld 2) unless equipped with an energy filter. To compensate for this loss, the specimen dose must be roughly 20 times higher in the dark-field TEM for the same signal-to-noise ratio (S/N) as in STEM. The high contrast of dark-field mode and the superior S/N associated with the STEM annular detector make it possible to visualize unstained freeze-dried ribosomal particles and rRNAs at very low radiation dose (1 electron/AZ). Specimens prepared in this way are free of the main resolution-limiting effects of the conventional TEM, staining, distortion by air-drying, and to a considerable extent, radiation damage. By elimination of staining it becomes possible to relate image intensity directly to the local projected mass of the specimen and thus to obtain quantitative data on the molecular mass and mass distribution within a single macromolecule. 2 j. S. Wall and J. F. Hainfeld, Annu, Rev. Biophys. Biophys. Chem. 15, 355 (1986).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
51
Materials and Methods
Ribosomes and Ribosomal Subunits Prokaryotic (70S) and eukaryotic (80S) monosomes were prepared as described) ,4 Ribosomal subunits of Escherichia coli were obtained from monosomes by dialysis against buffer with low Mg2+ (1 m M magnesium acetate, 20 m M Tris-HCl, pH 7.8, 100 m M NH4C1, l0 m M 2-mercaptoethanol) and by separation by sucrose density gradient centrifugation.5 Monosomes from eukaryotes were dissociated in the presence of 0.5 m M puromycin in high-salt buffer (50 m M Tris-HC1, pH 7.6, 0.5 M KC1, 2 m M magnesium acetate, 10 m M 2-mercaptoethanol) and the ribosomal subunits were separated by sucrose density gradient centrifugation. Ribosomal particles were stored in small aliquots in l0 m M Tris-HC1 or N-2hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-KOH, pH -7.6, 100 mMNH4C1 or KC1, 10 mMmagnesium acetate, l0 m M 2-mercaptoethanol at - 70 °.
Ribosomal rRNAs Prokaryotic and eukaryotic rRNAs were extracted from ribosomal particles by the standard phenol procedure and alcohol precipitation. The purity and integrity of rRNA molecules was checked by agarose gel electrophoresis. They were stored in small aliquots in distilled water at - 2 0 °.
Ribosomal Proteins Escherichia coli ribosomal proteins were isolated and purified from 30S subunits according to Zimmermann.6 The purity of proteins was confirmed by two-dimensional gel electrophoresis. Specimen Preparationfor STEM Deposition. For quantitative imaging it is essential to maintain clean working conditions. All solutions were prepared from deionized water which was processed through Millipore Milli-Q Reagent Grade Water System and distilled. Final concentrations of ribosomal particles in the solution (usually 10-20 m M HEPES-KOH, pH 7.6, 50-100 raM KC1 or 3 N. Brot, E. Yamasaki, B. Redfield, and H. Weissbach, Biochem. Biophys. Res. Commun. 40, 698 (1970). 4 G. E. Brown, A. J. Kolb, and W. M. Stanley, Jr., this series, Vol. 30, p. 368. 5 G. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this series, Vol. 20, p. 391. 6 R. A. Zimmermann, this series, Vol. 59, p. 551.
52
ELECTRON MICROSCOPY
[3]
NH4CI, 2 - 1 0 m M magnesium acetate) were in the range of 0.1-0.3 OD2~o. However, for rRNAs deposited from solutions with salt concentration below 1 # M or from distilled water, the concentrations were raised to 1.00D2~0 for sufficient specimen adsorption. The best reproducibility of specimen deposition was obtained by the "wet-film" technique. 7 In this technique a thin ( - 2 0 A) carbon film, evaporated onto the surface of a freshly cleaved NaC1 single crystal, was floated off the NaCI block onto a clean water surface. A small portion of the film was picked up from above by a titanium support grid (75 X 300 # m mesh) previously coated with holey carbon film. The grid, with the attached droplet of water, was inverted and washed several times with distilled water or with buffer. Each wash was followed by a partial blot of the grid keeping the carbon film always covered with a layer of solution. Ribosomal particles or rRNAs (in the final dilution) in a volume o f - 5/zl were gently injected below the surface of the droplet using an Eppendorf tip. After about 1 min adsorption at room temperature the grid was washed 4 - 6 times by droplets of water or 20-60 m M ammonium acetate. A volatile buffer was used to permit processing of the specimens for mass determination. Specimen conformation after adsorption appears not to be significantly affected by changes in buffer composition, s Mass determination of the specimen required a mass standard. We used tobacco mosaic virus (TMV) as an internal standard because of its well-established morphological parameters. TMV was deposited onto the grid as described above before or after specimen deposition. Freeze-Drying. The specimen for freeze-drying was wicked to the thinnest layer possible without drying and then rapidly frozen in liquid nitrogen slush to avoid specimen damage by ice-crystal formation. The frozen sample was transferred to a holder filled with liquid nitrogen in a special specimen transport cartridge mounted in a stainless steel chamber. When most of the liquid nitrogen in the holder had evaporated, the chamber was evacuated, first with a sorption pump, then with an ion pump to less than 10-s torr. The initial temperature was - 1 5 0 °. The specimen was warmed up at a rate of I °/min until the pressure in the freeze-drying system increased to 10-7 tort. The temperature was then held constant at approximately - 9 5 ° to prevent the system pressure from exceeding 10-7 torr. Completion of the freeze-drying, usually overnight, was indicated by a drop of pressure below 10-8 torr and the resumption of the 1°/min wanning. The holder was withdrawn into the transfer cartridge, sealed, and transferred under vacuum into the STEM cold stage ( - 160 °). 7 j. S. Wall, J. F. Hainfeld, and K. Chung, Proc. Annu. Meet. Electron Micros¢. Soc. Am., 43rdp. 716 (1985). s G. T. Oostergetel, J. S. Wail, J. F. Hainfeld, and M. Boublik, Proc. Natl. Acad. Sci. U.S.A. 82, 5598 (1985).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
53
Electron Microscopy The high-resolution ( 2 - 3 A) dedicated STEM developed at Brookhaven National Laboratory has a field emission gun that operates at 40 keV at 10-~° to 10-~2 A beam current. The gun is located in a separate ionpumped vacuum chamber maintained below 10-~0 torr. The objective lens has a l-mm focal length and is cooled to approximately - 170 ° by helium gas. The specimen is held at - 1 6 0 * to eliminate contamination and to minimize mass loss due to electron irradiation. The electron dose is 1 e/m 2 at a magnification of 50,000× and about 30 e/A 2 at 250,000×. Scans are controlled digitally and detector signals are stored in a digital frame buffer (digital memory that holds one TV frame) under direction of a VAX 11-750 computer. This computer also supports additional terminals for image analysis. Image data are available immediately for analysis or stored digitally on magnetic tape.
Computer Image Analysis The availability of small computers interfaced with video graphics allows efficient analysis of electron micrographs. The applied computer imaging system developed at Brookhaven National Laboratory is described elsewhere.9 Digital frame buffers permit an image of 512 × 512 pixel resolution to be displayed and rapidly changed in contrast, brightness, and color. The system performs pan (image~movement), zoom, and marking of individual macromolecules with circles, rectangles, or any arbitrary shape drawn interactively with a track ball-controlled cursor, and displays coordinates and alphanumerics. Quantitative analysis of electron micrographs of unstained freeze-dried ribosomal particles and rRNAs includes particle counting and distribution, length and area measurements, determination of molecular weight and mass per unit length, calculation of apparent radius of gyration) topographical mapping, radial distributions of density within macromolecular complexes, ~° pattern recognition and correlation between isolated structures for model building, and/or phylogenetic studies. Applications
Mass Measurement The linearity of the STEM imaging process makes the direct measurement of particle mass relatively straightforward (for references see Wall 9 j. F. Hainfeld, J. S. Wall, and E. Desmond, Ultramicroscopy8, 263 (1982). 1oA. C. Steven, J. F. Hainfeld, B. L. Trus, P. M. Steinert, and J. S. Wall, Proc. Natl. Acad. Sci. U.S.A. 81, 6363 (1984).
54
ELECTRON MICROSCOPY
[3]
and Hainfeld2). After marking out the region of the image with the particle of interest by circles for compact particles such as ribosomes and ribosomal subunits, or by boxes or arbitrary areas for rRNAs, one has to subtract the background value of the carbon support and correct the obtained net intensity of scattered electrons by a calibration factor. The calibration factor of the STEM is a constant that is calculated for each specimen by using an internal mass standard, usually TMV. The accuracy of the STEM mass measurement depends on the size and thickness of particles, carbon support noise, and counting statistics of the scattered electrons. Measured standard deviation for large compact particles such as monosomes or large ribosomal subunits (MW - 1.5-4.5 X 106) is below 5%, for small ribo-
FIG. 2. Molecular mass measurement by the circle subroutine. The numbered circles enclose individual unstained, freeze-dried 50S E. coli ribosomal subunits selected for mass measurement. The first particle (without number) has an additional annulus around the circle which is used to calculate local background. Boxes denote the segments of tobacco mosaic virus (TMV) used for calibration (for details, see Applications). Bar is 0.1 #m.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
55
somal subunits ( M W = 0 . 7 - 1 . 5 X 106) about 10%, and for tRNAs (MW - 2.5 × 104) 12%. The low molecular mass of individual ribosomal proteins (in average - 15 kDa) and their poorly defined shape excludes them, at present, from mass measurement. An example of STEM image processing for mass determination by the circle subroutine, described in detail elsewhere,9 is shown in Fig. 2. The numbered circles mark individual 50S ribosomal subunits selected for mass measurement. The intensity of scattered electrons within the circles was corrected by subtraction of the averaged background scattering. The elongated particles marked with boxes are TMV used as internal standard for calculation of an absolute scale factor. The overall view (Fig. 3a) displays dark-field images of unstained freeze-dried 50S ribosomal subunits of E. coli with the values of their molecular mass [in kilodaltons (kDa)] obtained by the circle subroutine. Since the digitized image with x and y coordinates for each particle is
! i~ii:~I:!i
,, ~,~,
,
~:,~i ~''~
FIG. 3. STEM images of unstained freeze-dried 50S E. coli subunits (a) with the values of their molecular mass (kDa) as obtained by the circle subroutine. Bar O. 1/zm. Arrow in the gallery of enlarged images of the subunits (b) points to the "crown" region. Bar is 0.01 #m.
56
ELECTRON MICROSCOPY
[3]
FIG. 4. Molecular mass measurement by the arbitrary area subroutine. Contour lines drawn around the extended complex structure of the unstained, freeze.dried 28S rRNA molecule encompass the area for mass measurement with less background noise than the circles (Fig. 2). Bar is 0.05/zm.
stored in the computer memory, any selected particle can be retrieved at any time for additional analysis. The enlarged images in the gallery (Fig. 3b) enable resolution of the characteristic structural features in the preferential crown view of the 50S E. coli subunits established by the conventional TEM. Molecular weights of the 30S E. coli subunits and the 16S and 23S rRNA were obtained in a similar way H with a good agreement with the known composition data of the particles. However, for elongated and branched molecules such as rRNAs, more accurate values of molecular weights can be obtained by the arbitrary area routine, demonstrated in Fig. 4 on a sample of 28S rRNA from baby hamster kidney (BHK) cells large ribosomal subunit. The arbitrary area routine is more elaborate, but circle replacement by contour lines around the complex structure of rRNAs includes substantially less background noise. Moreover, the method of arbitrary area is convenient for the determination of mass distribution within a structurally complex macromolecule and for the calculation of mass per unit length (M/L). i1 M. Boublik, N. Robakis, W. Hellmann, and J. S. Wall, Eur. J. Cell Biol. 27, 177 (1982).
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
57
Mass Distribution within a rRNA Molecule and Mass per Unit Length Application o f the arbitrary area routine to the determination of mass distribution within the r R N A molecule has to be done with extreme care. Figure 5 illustrates use o f this procedure on the example o f B H K cell 28S r R N A molecule. In distilled water or in very low ionic strength (up to 10 # M ) the r R N A molecules are extended and their conformation appears to be formed by a main backbone with several side branches and forks (Fig. 5a). The molecule can be divided into an arbitrary n u m b e r o f segments (1 - 18 in Fig. 5b) and the mass o f each segment within the enclosed area can be calculated as described above. The length o f each segment can be measured directly on highly enlarged electron micrographs. The values o f
FXG.5. Mass distribution within the resolvablestructural segments ofrRNA molecule.(a) 28S rRNA from BHK cells in water; (b) the same molecule divided into 18 structural segments for mass determination. Bar is 0.05/lm.
58
[3]
ELECTRON MICROSCOPY TABLE I MASS DISTRIBUTIONWITHIN A 28S rRNA MOLECULE
Number"
Mass (Da)
Length (~)
M/L (Da/~,)
rP
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
127,000 68,000 67,000 108,000 66,000 108,000 337,000 17,000 75,000 1,000 69,000 123,000 94,000 175,000 10,000 334,000 115,000 59,000
200 153 170 270 200 255 748 1O0 170 306 170 374 170 375 100 748 204 153
635 444 394 400 660 424 451 170 441 444 406 329 553 467 100 447 564 386
5 4 3 3 5 3 4 1 4 4 3 3 4 4 1 4 5 3
Numbers refer to enclosed segments of the molecule shown in Fig. 5b. b The number of strands based on a value of 125 Da/~, for a single strand of RNA derived from 2.8 A axial rise per residue for A-RNA double helices. 12
mass (M) and length (L) are listed in Table I, together with the M/L ratio. The value of M/L can be used for calculation of the average number of rRNA strands in the cross-section of each segment. The number of the strands (n) in Table I is based on the value of 125 Da/A for a single strand of RNA derived from 2.8 A axial rise per residue for A-RNA double helices. 12
Radius of Gyration Knowledge of the shape and mass distribution within a ribosomal particle and/or RNA molecule makes it possible to determine the center of gravity and the value of radius of gyration (Ro). Apparent values of Ro were calculated from the distribution of the measured intensities of scattered electrons after subtracting the contribution from the support carbon 12W. Saenger,
in "Principles of Nucleic Acid Structure." Springer-Verlag, New York, 1984.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
59
film8:
where Ii is the intensity in pixel i, Ib is the intensity due to scattering from the support film (background noise), and Ri is the distance from pixel i to the center of gravity. These apparent values are equivalent to the radius of gyration of the mass distribution projected onto the plane of the support carbon film. Usually about 50 particles are measured for obtaining statistically meaningful results. The values of R~ for the ribosomal subunits obtained by STEM (e.g., 68 _+ 1.4 A for the E. coli 30S subunit) are in agreement with the data from hydrodynamic techniques (for references, see Kearney and Moore~3). The values of RG for isolated rRNAs were considerably larger than those of the corresponding ribosomal subunits and very much dependent on the ionic strength of the buffer solution? For example, Ro for 28S rRNA from BHK cells changed from 600 _+ 150 ~, in distilled water to 240 + 30 ~, in 60 m M ammonium acetate, pH 7.0, and to 160 _ 25 A in 30 m M Tris-HC1, pH 7.6, 20 mM MgC12, 360 mMKC1 (ribosome reconstitution buffer). The values of R~ are of particular importance to the studies of ribosomal particles because they make it possible to compare morphological parameters of individual ribosomes and their components obtained under the stringent conditions of electron microscopy (dehydration, radiation exposure) with those obtained from hydrodynamic and spectroscopic techniques in which the total specimen is studied in the fully hydrated state and in a variety of buffer conditions.
Monitoring the Conformational Changes in rRNAs Apart from the well-established effects of unfolding caused by low Mg2+ concentration (below 1 raM) and protein depletion by high-salt concentrations, the conformation of ribosomes and ribosomal subunits as determined by TEM is not affected by moderate changes of ionic strength. Ribosomal RNAs, on the other hand, undergo distinct conformational transitions, from an extended form in distilled water to tightly packed coil in the reconstitution buffer. Imaging of these conformational changes, demonstrated in Fig. 6a-c, was accomplished by STEM and the wet-film deposition technique.7 The major advantage of this procedure is that the rRNAs are deposited without the structural distortion by denaturation and stretching forces inherent in conventional TEM monolayer spreading tech13 K. R. Kearney and P. B. Moore, J. Mol. Biol. 170, 381 (1983).
60
ELECTRON MICROSCOPY
[3]
FIo. 6. STEM images of unstained freeze-dried BHK cell 28 rRNA molecule (a) in water, (b) in 60 mM ammonium acetate, pH 7.0, (c) in 30 mM Tris-HCl, pH 7.6, 360 mM KCI, 20 mM MgC12, and (d) corresponding 60S ribosomal subunits in 60 mM ammonium acetate, pH 7.0, and 2 mM magnesium acetate. TMV (tobacco mosaic virus) was used as an internal reference for mass measurements. Bar is 0.05 #m.
[3]
STRUCTURAL ANALYSIS OF RIBOSOMES
61
niques for nucleic acids. 14,~s Although the rRNA molecules in distilled water (Fig. 6a) appear extended (Ro = 600 ___150 A), their length is only about one-fourth of that in the fully extended denatured state. This observation is consistent with the physicochemical data which suggest the presence of intramolecular double-stranded stems and single-stranded loops, with resulting shortening of the rRNA molecules. With increasing ionic strength (Fig. 6b and c) the structure of 28S rRNA becomes more complex and compact. However, the RNA molecules still remain considerably more extended than the corresponding 60S ribosome subunits (P~ = 87 ___4 A) under comparable ionic conditions (Fig. 6d). These results are important for studies of the assembly process of the ribosome and nucleic acid- protein interactions. Interactions of rRNAs with Ribosomal Proteins Protein-free deposition of rRNAs under nondenaturing conditions by the wet-film technique and mass analysis enabled us to visualize and analyze rRNA-protein interactions and, ultimately, to use this procedure for studying the process of ribosome assembly. The potential of our approach is demonstrated by the interaction of 16S E. coli rRNA and protein $4, the first protein to bind to the 16S rRNA in the reconstitution of the 30S subunit. The complex of 16S rRNA and $4 was prepared by incubation (at 42* for 1 hr) of 16S rRNA in 30 m M Tris-HC1, pH 7.3, 330 m M KCI, 20 m M MgC12, 1 m M dithiothreitol (DTT) with a threefold excess of protein $4. The complex was pelleted through a 15% sucrose cushion in the above buffer at 30,000 rpm for 16 hr. The pellet was suspended in 10 m M H E P E S - K O H , pH 7.4, 60 m M KC1, 0.5 m M MgCI2, 1 m M DTT, dialyzed exhaustively against the same buffer with 3 - 4 changes of solutions, and subjected to STEM analysis (Fig. 7). The purpose of transferring the complex to a solution of lower ionic strength was to reduce the effect of salt on the conformation of rRNAs, s Figure 7a shows free 16S rRNA molecules deposited from distilled water. Although the molecules appear extended (Ro = 300 + 50 A), their length is about 1200 A, approximately one-fourth of that in the fully extended denatured state. With increasing ionic strength (Fig. 7b), the conformation of 16S rRNA appears more complex and more compact (RG = 136 ___ 20 ~,). The interaction of 16S rRNA with $4 under similar conditions (Fig. 7c) reduces the value o f R o by about 20% (R~ = 112 ___20 ~,). Figure 7d shows the complex of 16S rRNA with $4 deposited after exhaustive dialysis against water, and serves as a simple control. The molecules of the complex ~4A. K. Kleinsehmidt, this series, Vol. 12, p. 361. ~5H. J. VoUenweider, M. J. Sogo, and T. Koller, Proc. Natl. Acad. Sci. U.S.A. 72, 83 (1975).
62
ELECTRON MICROSCOPY
[3]
FIG. 7. STEM images of unstained freeze-dried 16S E. coli rRNA deposited from (a) distilled water; (b) from l0 mM HEPES-KOH, pH 7.4, 60 mM KC1, 0.5 mM MgC'I2; (c) complex of 16S rRNA with protein $4 deposited from 10 mM HEPES-KOH, pH 7.4, 60 mM KC1, 0.5 mM MgC12; and from distilled water (d). Bar is 0.05 gin.
[3]
STRUCTURAL ANALYSISOF RIBOSOMES
63
in distilled water appear more extended than in the buffer (Fig. 7c) but considerably more compact than free 16S rRNA in water (Fig. 7a). The results of these initial experiments (coiling and changes of RG) suggest involvement of $4 in the conformational changes of 16S rRNA during the first assembly step of the 30S E. c o l i subunit. However, structural details such as the number and location of the $4 binding sites to the 16S rRNA cannot, at present, be determined. Concluding R e m a r k s Dedicated STEM is uniquely suited to high-resolution structural studies on ribosomes and other biological macromolecules. High efficiency in collection of scattered electrons in the STEM dark-field mode makes it possible to visualize unstained freeze-dried ribosomes and their components without the main resolution-limited artifacts of staining and distortion by air-drying and radiation inherent in the conventional TEM. The linearity of the relationship between scattering cross-section and molecular weight can be utilized for the determination of the molecular mass of ribosomes and their constituents, mass distribution within the particles, and calculation of the apparent radius of gyration. Protein-free deposition of unstained freeze-dried rRNA molecules improved significantly the visualization of their conformation and made it possible to initiate high-resolution studies of RNA-protein interactions and the process of ribosome assembly. Supplementation of STEM with an electron energy loss spectrometer ~6 and application of computer image averaging and multivariate statistical analysis of electron micrographs ~7-2° provide additional highly specific and quantitative information on three-dimensional structure, mass, and element distribution in the ribosome for topographical and phylogenetic studies. Acknowledgments The Brookhaven STEM Biotechnology Resource is supported by NIH grant No. RR01777. Support for J. S. Wallwas providedby USDOE. The authors gratefullyacknowledge Dr. P. Furcinittifor his assistancein computerprogrammingand the excellenttechnical assistanceof K. Elmorc,W. Hellmann,F. Jenkins, and F. Kito. ~6M. Boublik,G. T. Oostergetel,D. C. Joy,J. S. Wall,J. F. Hainfeld,B. Frankland,and P. F. Ottensmeyer,Ann. N. Y. Acad. Sci. 463, 168 (1986). i7j. Frank, A. Verschoor,and M. Boublik,J. MoL Biol. 161, 107 0982). is A. Verschoor,J. Frank, M. Radermacher,T. Wagenknecht,and M. Boublik,J. MoL Biol. 178, 677 (1984). ~9A. Verschoor,J. Frank, and M. Boublik,J. Ultraswuct. Res. 92, 180 (1985). 2oA. Verschoor,J. Frank, T. Wagenknecht,and M. Boublik,J. MoL Biol. 187, 581 (1986).
64
ELECTRON MICROSCOPY
[4]
[4] Identification of Protein-Protein Cross-Links within the Escherichia coli Ribosome by Immunoblotting Techniques By GEORG STOFFLER,BERNHARD REDL, JAN WALLECZEK,and MARINA STOFFLER-MEILICKE Introduction P r o t e i n - p r o t e i n cross-linking has always been considered an important technique for elucidating the topography o f ribosomal proteins within intact ribosomal particles) -6 Most o f the p r o t e i n - p r o t e i n cross-links described for the ribosomal subunits o f Escherichia coli have been obtained by T r a m and co-workers, using 2-iminothiolane as the cross-linking reagent, v,s However, when other topographical methods, e.g., immunoelectron microscopy9 or neutron scattering,~° began to develop a picture o f the ribosomal protein arrangement within the 30S subunit o f E . coli, it became evident that m a n y o f the reported p r o t e i n - p r o t e i n cross-links are incompatible with the topographical model o f the small ribosomal subunit (discussed in Ref. 10). One cause for these discrepancies could possibly be a misidentification o f the members o f some o f the cross-linked protein pairs. We have developed methods for the unambiguous identification o f the members o f a cross-linked protein pair by immunoblotting procedures, using antibodies specific for single ribosomal proteins. These techniques can be used for the analysis o f cross-links obtained with both cleavable or T. A. Bickle, J. W. B. Hershey, and R. R. Traut, Proc. Natl. Acad. Sci. U.S.A. 69, 1327 (1972). 2 L. C. Lutter, F. Ortanded, and H. Fasold, FEBSLett. 48, 288 0974). 3 C. Cleggand D. Hayes, Eur. J. Biochem. 42, 21 (1974). 4 L. Lutter, U. Bode, C. G. Kurland, and G. St6fller,Mol. Gen. Genet. 129, 167 (1974). 5H. Peretz, H. Towbin, and D. Elson, Eur. J. Biochem. 63, 83 (1976). 6 A. Expert-Bezan¢on,D. Barritanlt, M. Miler, M. F. Gu6dn, and D. H. Hayes, J. Mol. Biol. 112, 603 (1977). 7 j. W. Kenny, J. M. Lambert, and R. R. Traut, this series, Vol. 59, p. 534. s R. R. Traut, D. S. Tewari, A. Sommer, G. R. Gavino, H. M. Olson, and D. G. Glitz, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 286. Spdnger-Verlag,Heidelberg,Federal Republic of Germany, 1986. 9 G. St6itler and M. St6ttler-Meilicke, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 28. Springer-Verlag,Heidelberg,Federal Republic of Germany, 1986. ~0p. B. Moore, M. Capel, M. Kjeldgaard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 87. Springer-Vedag,Heidelberg, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
65
noncleavable cross-linking reagents, and at the same time they allow a rough quantitation of the extent of cross-linking. Here we shall give examples of the different immunoblotting procedures used for the identification of protein pairs cross-linked within the 50S ribosomal subunits of E. coli, using either cleavable 2-iminothiolane or noncleavable dimethyl suberimidate as the cross-linking reagent. Cross-Linking and Analysis of Cross-Linked Proteins by OneDimensional Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis and Immunoblotting 50S subunits from E. coli are isolated as described. H,12 Cross-linking with 2-iminothiolane and subsequent extraction of the ribosomal proteins follows the procedure of Kenny et al. 7 Cross-linking with dimethyl suberimidate is done according to the procedure of Bode et al. 13 and ribosomal proteins are extracted with acetic acid. 14 For a first screening, proteins extracted from cross-linked and uncrosslinked 50S ribosomal subunits are subjected to one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose by electroblotting. The nitrocellulose blots are then incubated with antisera specific for each of the individual ribosomal proteins of the 50S subunit of E. coli, and immunoreactive protein bands can subsequently be visualized by immunostaining (Fig. l a). Untreated total ribosomal protein of the 50S subunit (TPS0) gives a single band, corresponding to the unmodified protein (Fig. la, lane 1). A cross-linked protein pair will give rise to a new band with a higher molecular weight as compared to the uncross-linked protein (Fig. la, lanes 2-6). Materials and Solutions
Separation gel: 15% acrylamide (w/v), 0.4% N, N'-methylenebisacryamide (MBA) (w/v), 0.375 M Tris-HCl, pH 8.8, 0.1% sodium dodecyl sulfate (SDS) (w/v). All gel solutions are degassed for l0 rain. Polymerization is initiated by addition of 25 gl tetramethylenediamine (TEMED) and 100 gl of a freshly prepared solution of ammonium persulfate (10%, v/v) to 30 ml of the gel solution. Stacking gel I: 4.5% acrylamide (w/v), 0.12% MBA (w/v), 0.125 M H M. Noll, B. Hapke, M. H. Schreier, and H. Noll, J. Mol. Biol. 75, 281 (1973). ,z I. Hindennach, G. St6fller, and H. G. Wittmann, Eur. J. Biochem. 23, 7 (1971). 13 U. Bode, L. C. LuRer, and G. StOfller, F E B S Lett. 45, 232 (1974). 14 S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
66
ELECTRON MICROSCOPY
1
2 3 4 5
6
•
[4] 1
2
3
b Fro. 1. Immunoblot obtained from one-dimensional SDS-polyacrylamidegels by incubation with anti-L19 (a) and scan thereof(b). Lane l, l0/zg TP50; lanes 2-6, 10, 5, 2.5, 1.25, and 0.625/zg TP50 extracted from ribosomes, cross-linkedwith 2-iminothiolane. (b) Lanes 1, 2, and 3 were scanned at 525 nm in a Quick Scan Jr., TCL, Helena Laboratories.The closed arrowheads indicate the position of protein L l9, the open arrowheads that of the main cross-link protein band, which contains approximately 30% protein Ll9, as calculated from the scan of lane 3. Note that there are additional, fainter, cross-linkprotein band(s) above the main band, the yield of which is below 5%. t
Tris-HC1, p H 6.8, 0.1% SDS (w/v). Polymerization: 7 . 5 / d T E M E D and 75/zl 10% a m m o n i u m persulfate per 7.5 ml gel solution. Sample buffer I: 8 M urea, 0.25 M T r i s HC1, p H 6.8, 0.18 M S D S , 0.01 M ethylenediaminetetraacetic acid (EDTA), 0.006 M glycerol, 5% 2-mercaptoethanol (v/v), 0.25 m g / m l b r o m p h e n o l blue. W h e n the cleavable reagent 2-iminothiolane was used, 2-mercaptoethanol was omitted from the sample buffer. Electrophoresis buffer (pH 8.5): 0.025 M Tris, 0.192 M glycine, 0.1% SDS (w/v). Transfer buffer I: 0.025 M Tris, 0.190 M glycine, 0.001 M EDTA, 0.1% SDS (w/v), 20% methanol (v/v). Incubation buffer: 10 m M potassium phosphate, p H 7.4, 0.9% NaC1 (w/v), 0.2% N-lauroylsarcosine. Incubation buffer containing 1% bovine serum albumin (BSA).
[4]
IDENTIFICATION OF PROTEIN-PROTEIN CROSS-LINKS
67
Washing buffer: 150 m M NaCI, 10 m M Tris-HC1, pH 7.8, 100 m M MgC12" 6H20, 0.5% Tween 20. Veronal-acetate buffer: 0.396 M sodium barbital, 0.143 M sodium acetate (anhydrous); the pH is adjusted to 9.6 with acetic acid. Staining solution: 0.01% nitrobluetetrazolium (w/v), 0.05% 5-bromo4-chloro-3-indolyl phosphate (w/v), 4 m M MgCl2 in veronal acetate buffer. Acrylamide, MBA, SDS, N-lauroylsarcosine, BSA, bromphenol blue, nitrobluetetrazolium, 5-bromo-4-chloro-3-indolyl phosphate, and antigoat IgG alkaline phosphatase conjugate are obtained from Sigma, and nitrocellulose BA83 is from Schleicher & Schtill. Procedure
One-dimensional SDS-PAGE is carried out essentially according to Laemmli. 15 A 2.5 cm stacking gel is cast on top of a 15% separation gel (1.5 m m thick and 10 cm high). TP50 extracted from cross-linked and uncross-linked ribosomal subunits is dissolved in sample buffer I and applied to the gel ( 1 0 - 5 0 # g per slot). When proteins cross-linked with 2-iminothiolane are analyzed, no mercaptoethanol is added to the sample buffer, in order to avoid cleavage of the disulfide bonds that connect the cross-linked proteins. Electrophoresis is carried out at 15 mA until the bromphenol blue marker reaches the bottom of the gel (approximately 12- 14 hr). The electrophoretic transfer of the proteins to the nitrocellulose is performed as described by Towbin et al.16 After electrophoresis, the gels are equilibrated in transfer buffer I for 20 min. Nitrocellulose sheets are wetted thoroughly by floating them on transfer buffer I. Electrotransfer is performed in an LKB Transphor chamber in transfer buffer I for 4 hr (6 V/cm), either in the cold room (4°) or under water cooling. Transfer of proteins from polyacrylamide gels (PAG) to the nitrocellulose sheets is controlled (1) by staining the gels after the transfer with Coomassie Brilliant Blue and (2) by reversibly staining the proteins transferred onto the nitrocellulose with toluidine blue. 17 Alternatively, one nitrocellulose sheet can be stained irreversibly with amido black (see legend to Fig. 4). The optimal blotting time has to be determined experimentally. The temperature as well as the source of the ribosomal proteins has an influence on the blotting time. msU. K. Laemmli, Nature (London) 227, 680 (1970). 16H. Towbin, T. Staehelin, and G. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4550 (1979). t7 H. Towbin, H. P. Ramjou6, H. Kuster, D. Liverani, and G. Gordon, Z Biol. Chem. 257, 12709 (1982).
68
ELECTRON MICROSCOPY
[4]
After blotting, the nitrocellulose sheets are first equilibrated in incubation buffer (15 min) and subsequently incubated for 45 min in incubation buffer containing 1% BSA, in order to saturate additional protein-binding sites. The blots are then incubated overnight with the different antisera specific for each of the individual ribosomal proteins of the 50S subunit of E. coli. The optimal dilution has to be determined for each antiserum; the antisera from sheep used in this study were routinely diluted 1 : 1000 in incubation buffer containing 1% BSA. Next, the blots are intensively washed with washing buffer (4 × 15 min), incubated for 5 min in incubation buffer containing 1% BSA, and then for 2.5 hr with the anti-goat IgG alkaline phosphatase conjugate (diluted 1 : 1000 in incubation buffer conraining 1% BSA). The blots are again extensively washed with washing buffer, rinsed with distilled water, and equilibrated with veronal-acetate buffer, pH 9.6 (5 min). The immunoreactive bands are stained with staining solution and the enzyme reaction is stopped by rinsing the blots with distilled water. For the immunostaining reaction, a large variety of detection systems can be used. We have also obtained reproducible results with peroxidase-conjugated second antibody ~s as well as with the biotinstreptavidin system, using the peroxidase preformed complex. ~9 Evaluation of the Immunoblots Obtained from One-Dimensional SDS-PAGE TP50s extracted from cross-linked and uncross-linked ribosomal subunits are routinely analyzed in adjacent lanes on the immunoblots. Crosslinking of a protein to another protein will give rise to an additional band, exhibiting a higher molecular weight than the uncross-linked protein. An immunoblot obtained with anti-L19 is shown in Fig. la, and we use this example to describe a cross-linked pair analysis in detail. The yield of a given cross-linked protein complex can be determined by scanning the immunoblots densitometrically and by evaluating the height of the different peaks on the scan. Thus the yield of the main cross-link band seen with anti-Ll9 amounts to approximately 30% (Fig. l b). The titers of our antisera are such that we can detect 0.1 - 1% of a given protein in a cross-linked complex. In order to determine which protein has been cross-linked to protein L 19, the molecular weight of the cross-link is determined, using a calibra~sE. R. Dabbs, R. Hasenbank, B. Kastner K.-H. Rak, B. Wartusch, and G. Strfller, MoL Gen. Genet. 192, 301 (1983). t9 For the biotin-streptavidin system we follow the protocol of the supplier (Amersbam), from whom we purchased the biotinylated second antibody and the preformed complex.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
69
tion curve which has been obtained by using ribosomal proteins as molecular weight standards and plotting their mobility versus their known molecular weights according to Weber and Osborne. 2° Thus, the molecular weight of the main cross-link band obtained with anti-L 19 was determined to be approximately 27,250. If we subtract the known molecular weight of protein L19 (13,002) from this value, we obtain the approximate molecular weight (l 4,250) of the protein cross-linked to L 19. There are several ribosomal proteins having molecular weights close to 14,250; however, the candidates possibly cross-linked to protein L19 can be further reduced by examining the immunoblots obtained with antisera against these candidates, and asking the following questions: (1) Have the candidates been cross-linked to another protein at all, that is, do the immunoblots show a high-molecular-weight cross-link band? (2) Is the cross-link band of the same molecular weight as the one found for protein L19? (3) If candidate(s) have been found which show a cross-link band of approximately the molecular weight in question, is the amount of crosslinking of the candidate(s) approximately the same as that observed with protein L 19? By evaluating all immunoblots in this way, we find two proteins, namely L14 and L25, that reveal a cross-linked protein band with approximately the same molecular weight as observed with protein Ll9. The known molecular weights of the single proteins (13,541 for L14 and 10,694 for L25) as well as the amount of cross-linking (-25% for Ll4 and - 15% for L25, as compared to - 3 0 % for L19) suggest that protein L14 is crosslinked to L19. In order to further substantiate this finding, blots are made from one and the same SDS-PAG and incubated with the three antisera, namely anti-L 14, anti-Ll 9, and anti-L25 (Fig. 2). These immunoblots clearly show that the band obtained after cross-linkage and seen with anti-Ll4 migrates into exactly the same position as the one obtained with anti-L19, whereas the band obtained with anti-L25 migrates into a slightly higher position. Thus these immunoblots show that L14 and L 19 are the members of this cross-linked protein pair. However, the data do not exclude the possibility that protein L25 is also cross-linked to L19 (note the width of the crosslinked protein band seen with anti-L 19). In the case of ambiguous results, separation of ribosomal proteins in different electrophoretic systems (e.g., 5 - 20% or 15-25% SDS-polyacrylamide gradient gels) proved to be useful, since cross-linked protein complexes may migrate with different mobilities, depending on the different
2o K. Weber and M. Osborne, J. Biol. Chem. 244, 4406 (1969).
70
ELECTRON MICROSCOPY
1
2
a
1
2
b
[4]
2
I
c
FIG. 2. Immunoblot obtained from one-dimensional SDS-PAGs by incubation with (a) anti-L14, (b) anti-L19, and (c) anti-L25. Lane 1, 5/Lg TPS0 from E. coil; lane 2, 5/tg TPS0 extracted from subunits, cross-linked with 2-iminothiolane. Note the change in migration behavior of the uncross-linked proteins due to the cross-linking procedure.
electrophoretic conditions. If analyses of immunoblots made from one-dimensional SDS-PAG do not suffice for unambiguous identification of the proteins cross-linked to each other, a more precise identification can be achieved by immunoblotting from two-dimensional SDS-PAG. Immunoblotting from Diagonal SDS-Polyacrylamide Gels When 2-iminothiolane is the cross-linking reagent, we separate the proteins by diagonal electrophoresis, and the blots obtained thereof are treated with a mixture of two antisera. In the diagonal clectrophoresis, originally used by Sommer and Traut, 2' the ribosomal proteins are sepa2] A. Sommer and R. R. Trout, Proc. Natl. Acad. Sci. U.S.A. 71, 3946 (1974).
[4]
IDENTIFICATION OF PROTEIN-PROTEIN
CROSS-LINKS
71
rated under identical electrophoretic conditions in the first and in the second dimension. However, 2-mercaptoethanol is used to cleave the cross-link after separation of the proteins in the first dimension. Thus in the second dimension, all proteins that have not been cross-linked will migrate in a diagonal line on the two-dimensional gel, while proteins that had been members of a cross-linked complex will migrate below this diagonal (Fig. 3a). Proteins that have been cross-linked to each other will migrate on one vertical line on the two-dimensional gel, and they can be visualized by incubation of the blots with a mixture of two antisera (Fig. 3c). Solutions Stacking gel II: 15% acrylamide (w/v), 0.4% MBA (w/v), 0.125 M Tris-HC1, pH 6.8, 0.1% SDS. Polymerization: 10/~1 TEMED and 30 pl 10% ammonium persulfate per 5 ml gel solution. All other solutions are the same as described above. Procedure For the first dimension, 30- 50 pg of TP50 from cross-linked subunits is separated on a mini-slab gel 1 m m thick and a total of 7.5 cm in length (5.5 cm separation gel and 2.0 cm stacking gel), which is prepared with the same solution as described above. Electrophoresis is for 2 hr at 180 V and 30 mA. Prior to separation of proteins in the second dimension, the cross-links are cleaved by incubating the gel for 30 min at 65 ° in electrophoresis buffer containing 3O/o 2-mercaptoethanol (v/v). In order to remove 2-mercaptoethanol (which will hinder polymerization of the gel used for the second dimension) and to adjust the pH to that of the stacking gel in the second dimension, the gel is then incubated 3 X 10 min in electrophoresis buffer adjusted to pH 6.8 with 1 MHC1. Lanes are cut from the gel and are ready for polymerization on top of the gel used for the second dimension. For the second dimension, the gel is 2 m m thick and a total of 12.5 cm in length. First, a 7.5 cm separation gel and a 2.5 cm stacking gel I are cast, using the standard solutions described above. The remaining 2.5 cm is used for embedding the lane cut from the one-dimensional gel in stacking gel II. The stacking gel polymerizes so quickly (within 1 min) that TEMED and ammonium persulfate have to be added to each gel separately just prior to use. It is important that no air bubbles are underneath the gel lane. A capillary pipet (1 m m in diameter) is polymerized into the stacking gel II in order to form a slot, into which 5 pl of 0.02% basic fuchsin (w/v) can be applied as tracking dye. Electrophoresis is for 12- 14 hr (15 mA) at room temperature, until the tracking dye reaches the bottom of the gel.
72
ELECTRON MICROSCOPY ®
[4] 'Ist Dim.
®
N3 ~3
3
b~
FIG. 3. Two-dimensional diagonal PAG and immunoblots of TPS0, extracted from ribosomal subunits cross-linked with 2-iminothiolane. (a) Gel, showing a large number of faint protein spots below the diagonal. (b-d) Immunoblots, incubated with (b and e) anti-L9 and anti-L28 and (d) anti-L2, anti-L9, and anti-L28 simultaneously. In (b) cleavage of the cross-links was prevented after the first dimension by omitting the incubation step in electrophoresis buffer containing 3% 2-mercaptoethanol. On the diagonal there are two clear protein spots (indicated by arrowheads) in addition to proteins L9 and L28, indicating that the two proteins are contained in at least two cross-Iin~. The immunoblot in (e) demonstrates that proteins L9 and L28 are members of a cross-linked pair, since the two proteins (arrows) appear on a vertical line below the diagonal. (Note on the diagonal some residual cross-linked material that has not been cleaved.) The presence of a second protein spot below the diagonal at the same level as protein L9 (arrow) indicates that protein L9 is a member of a second cross-finked protein pair. This latter cross-link is identified by the immunoblot shown in (d): two protein spots are seen on a vertical line below the diagonal (arrow) at the same level as proteins L2 and L9.
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
73
Immunoblotting of the diagonal gels is performed exactly as described above for the one-dimensional SDS-PAGs. An unambiguous identification of the members of a cross-linked protein pair is achieved by incubating the immunoblot with a mixture of two antisera: The two proteins derived from the cross-link will migrate on the same vertical line below the diagonal (Fig. 3c). If the two proteins cross-linked to each other have the same molecular weight, only a single protein spot will be seen below the diagonal. Immunoblotting of Two-Dimensional Polyacrylamide Gels If a noncleavable cross-linking reagent like DMS is being used and immunoblots from one-dimensional PAGE do not suffice to identify the members of a cross-linked protein pair, immunoblotting from two-dimensional PAG has also proved to be useful. Different two-dimensional gel electrophoresis systems have been used22~3; here we describe the application of the system of Geyl et al. 23 Solutions
One-dimensional separation gel: 4% acrylamide (w/v), 0.1% MBA (w/v), 0.057 M Bis-Tris, 6 M urea, 5 m M EDTA. The pH is adjusted to 5.0 with acetic acid. For polymerization, 35/~1 TEMED and 100/A 7% ammonium persulfate (v/v) are added per 10 ml gel solution. Upper reservoir one-dimensional electrophoresis buffer: 10 m M BisTris acetate, pH 4.0. Lower reservoir one-dimensional electrophoresis buffer: 180 m M 130tassium acetate, pH 5.0. Sample buffer II: 6 M urea, 10 m M dithiothreitol in 10 m M Bis-Tris acetate, pH 4.0. Two-dimensional separation gel (pH 4.2): 18% acrylamide (w/v), 0.48% MBA (w/v), 6 M urea, 5.4% acetic acid (v/v), 50 m M KOH. Polymerization: 0.6 ml TEMED and 4 ml 7% ammonium persulfate (v/v) per 100 ml two-dimensional separation gel. Two-dimensional electrophoresis buffer: 0.186 M glycine adjusted to pH 4 with acetic acid. Transfer buffer II: 8 M urea, 0.7% acetic acid (v/v). Procedure
The one-dimensional separation gel is poured into silicon-coated glass tubes (0.5 cm × 9 cm) and is overlayed with 4 M urea, which is removed 22 L. J. Mets and L. Bogorad, Anal Biochem. 57, 200 (1974). 23 D. Geyl, A. Brck, and K. Isono, Mol. Gen. Genet. 181, 309 (1981).
74
ELECTRON MICROSCOPY
[4]
with tissue paper after polymerization. One hundred micrograms of lyophilized TPS0 (dissolved at 2 mg/ml in sample buffer II is placed on top of the one-dimensional gels. Bis-Tris acetate, l0 mM, pH 4.0, is used as electrophoresis buffer in the upper reservoir and 180 m M potassium acetate, pH 5.0, in the lower reservoir. Electrophoresis is toward the cathode, starting at 1 mA/tube. After 30 min the current is increased to 4 mA/tube. One tube is loaded with basic fuchsin (0.5 mg/ml) in sample buffer II as tracking dye. Electrophoresis is carded out at room temperature until the fuchsin reaches the bottom of the gels (approximately 7 hr). Following electrophoresis, the gel is removed from the glass tube with the help of a syringe filled with water. The gel is directly polymerized on top of the gel used for the second dimension, which is prepared with two-dimensional separation gel solution (10 X 10 cm and 1.5 m m thick). Electrophoresis is carried out at l0 ° toward the cathode for 14-16 hr at 100 V in two-dimensional electrophoresis buffer using basic fuchsin as tracking dye (0.05 mg/ml in 50% glycerol). After electrophoresis, the gels are removed from the two-dimensional chamber and are equilibrated in transfer buffer II. The nitrocellulose sheets are floated on transfer buffer II and placed on top of the two-dimensional gels. Electrotransfer is performed in an LKB Transphor chamber at 10 ° for 4 hr (6 V/cm) using transfer buffer II. Protein transfer is controlled as described above. Incubation with antisera specific for individual ribosomal proteins and immunodetection is performed as described above for onedimensional SDS gels. Immunoblots obtained from two-dimensional PAG and incubated with anti-L9 and anti-L28, respectively, are shown as examples in Fig. 4. In addition to the unmodified protein that is stained by the specific antibody, an additional spot is stained on the two immunoblots (Fig. 4c and d), representing a cross-linked protein pair. The cross-linked protein complexes stained with both anti-L9 and anti-L28 are located at the same positions on the two immunoblots. Thus the results obtained from immunoblotting of two-dimensional PAG confirm those obtained from onedimensional SDS-PAGE, namely that proteins L9 and L28 have been cross-linked to each other.
Conclusion The powerful technique of protein-protein cross-linking for the analysis of the topography of ribosomal proteins within the ribosomal subunits has recently been criticized, since many of the results seemed incompatible with other topographical data. Here we have presented a new identification
[4]
IDENTIFICATION OF P R O T E I N - P R O T E I N CROSS-LINKS
lst.Dim.-
75
Q
E -o c (',4
®
~--Lt
¢
FIG. 4. Two-dimensional PAGs and immunoblots. TP50, 100/zg, extracted from ribosomal subunits that had been cross-linked with DMS, is separated by two-dimensional PAGE, according to Geyl et al. 2a (a) gel; (b) nitrocellulose blot, stained with amido black; (c and d) immunoblots, incubated with (c) anti-L9 and (d) anti-L28. For stainin& the blot in (b) was incubated for 10 min in a solution containing 0.1% amido black (w/v), 4596 methanol (v/v), and 10% acetic acid (v/v); the blot was destained in 90% methanol (v/v) and 2% acetic acid (v/v).
technique, using antisera against individual ribosomal proteins and imm u n o b l o t t i n g for the u n a m b i g u o u s identification o f the m e m b e r s of a cross-linked protein pair. This approach is especially valuable if noncleavable cross-linking reagents are being used. O u r results show that the migration behavior o f some p r o t e i n s - - d u e to
76
ELECTRON MICROSCOPY
[5]
the cross-linking procedure--is altered during electrophoresis (see Fig. 2a and b), whereas their antigenic properties remain uneffected. This alteration of the mobility of proteins would explain why the analysis of the members of a cross-linked protein pair solely on the basis of their electrophoretic mobility may easily lead to a misidentification of one or both of the components. Clearly, the use of specific antibodies is superior to this latter method, and in addition it allows a rough estimation of the amounts of cross-linking. Acknowledgments We are grateful to R. Brimacombe for critically reading the manuscript, to R. AlbrechtEhrlich for preparation of the figures, to H. G. Wittmann for his constant interest and
support,and to R. Hasenbankfor typingthe manuscript.
[5] E l e c t r o n M i c r o s c o p y S t u d i e s o f R i b o s o m a l R N A B y IVAN N . SHATSKY and VICTOR D. VASILIEV
Electron microscopy (EM) has been successfully used to study the structural organization of ribosomal RNA. (1) Comparative EM studies of the stepwise disassembly and reassembly of ribosomal subunits have shown that rRNA plays a key role in the organization of ribosome structure. The capability of both the high molecular weight 16S and 23S rRNAs to specifically fold, without ribosomal proteins, into compact particles of a unique shape has been directly demonstrated at the final step of these studies. A close relationship between the morphology of the naked rRNAs in the compact conformation and the spatial distribution of RNA within ribosomal subunits has been established by a combination of EM and neutron scattering techniques. 1 This suggests that many tertiary R N A RNA contacts of the ribosome can occur in naked rRNA under appropriate ionic conditions. Recently, the first tertiary structure model of 16S RNA has been constructed, taking its secondary structure as a starting point. 2 The overall shape of this model is very reminiscent of the asymmetric Y-shaped molecules of the naked 16S RNA in compact conformation. 1 (2) Immunoelectron microscopy (IEM) has permitted the study of the i V. D. Vasiliev, I. N. Serdyuk, A. T. Gudkov, and A. S. Spirin, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 128. Spfingvr-Verlag, New York, 1986. 2 A. Expert-Bezancton and P. L. Wollenzien, J. Mol. Biol. 184, 53 0985). METHODSIN ENZYMOLOGY,VOL. 164
English translation copyright © 1988 by AcademicPress, Inc.
76
ELECTRON MICROSCOPY
[5]
the cross-linking procedure--is altered during electrophoresis (see Fig. 2a and b), whereas their antigenic properties remain uneffected. This alteration of the mobility of proteins would explain why the analysis of the members of a cross-linked protein pair solely on the basis of their electrophoretic mobility may easily lead to a misidentification of one or both of the components. Clearly, the use of specific antibodies is superior to this latter method, and in addition it allows a rough estimation of the amounts of cross-linking. Acknowledgments We are grateful to R. Brimacombe for critically reading the manuscript, to R. AlbrechtEhrlich for preparation of the figures, to H. G. Wittmann for his constant interest and
support,and to R. Hasenbankfor typingthe manuscript.
[5] E l e c t r o n M i c r o s c o p y S t u d i e s o f R i b o s o m a l R N A B y IVAN N . SHATSKY and VICTOR D. VASILIEV
Electron microscopy (EM) has been successfully used to study the structural organization of ribosomal RNA. (1) Comparative EM studies of the stepwise disassembly and reassembly of ribosomal subunits have shown that rRNA plays a key role in the organization of ribosome structure. The capability of both the high molecular weight 16S and 23S rRNAs to specifically fold, without ribosomal proteins, into compact particles of a unique shape has been directly demonstrated at the final step of these studies. A close relationship between the morphology of the naked rRNAs in the compact conformation and the spatial distribution of RNA within ribosomal subunits has been established by a combination of EM and neutron scattering techniques. 1 This suggests that many tertiary R N A RNA contacts of the ribosome can occur in naked rRNA under appropriate ionic conditions. Recently, the first tertiary structure model of 16S RNA has been constructed, taking its secondary structure as a starting point. 2 The overall shape of this model is very reminiscent of the asymmetric Y-shaped molecules of the naked 16S RNA in compact conformation. 1 (2) Immunoelectron microscopy (IEM) has permitted the study of the i V. D. Vasiliev, I. N. Serdyuk, A. T. Gudkov, and A. S. Spirin, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 128. Spfingvr-Verlag, New York, 1986. 2 A. Expert-Bezancton and P. L. Wollenzien, J. Mol. Biol. 184, 53 0985). METHODSIN ENZYMOLOGY,VOL. 164
English translation copyright © 1988 by AcademicPress, Inc.
[5]
ELECTRON MICROSCOPY OF r R N A
77
topography of rRNA within the ribosome, and has already provided the locations of the ends and of several internal sites of the rRNA chain on the surface of the ribosomal subunits. 3 Such data are requisite to finding the mutual arrangement of the functional centers and the mode of rRNA folding in situ. Here we describe techniques for EM studies of the naked rRNAs and for the rRNAs within the ribosome. EM
Studies of the Naked r R N A s
Principle The experimental task is to find the ionic conditions at which the rRNA becomes maximally compact and to visualize it in such a state. The rRNA readily changes its conformation. Therefore, procedures for preparing rRNA for EM must exclude the possibility of any change in initial ionic conditions. The technique of freeze-drying and high-resolution shadow casting4 was found to be adequate. Numerous experiments with ribosomal subunits and their protein-deficient derivatives give evidence that fast freezing fixes without distortion the object structure which exists in solution. In principle, the method provides resolution comparable to that of negative staining.
Volatile Salts and Alcohol Requirements Resolution in shadow casting strongly depends on the amount of salts remaining on the supporting film which can result in a background on micrographs. A high concentration of salts lead to the "disappearance" of the object. On the other hand, and this should be specially emphasized, washing of the preparation adsorbed on the supporting film with water or with solutions, differing from that in which the rRNA is to be studied, can lead to the destruction of the tertiary structure existing prior to the washing. In any case, if washing is used there always remains uncertainty as to whether the conformation of rRNA observed by EM corresponds to the one actually existing in the original solution. This imposes limitations on the composition of the solution. In particular, due to high KC1 concentration, rRNA can hardly be visualized by EM after evaporation reconstitution buffer. Therefore an ammonium acetate buffer containing alcohol is used. Methanol or ethanol are added in a 5% (v/v) concentration (l M). Ethanol (1 M) and methanol (2 M) essentially stabilize the association of 3 J. B. Prince, R. R. GutelI, and R. A. Garrett, Trends Biochem. Sci. 9, 359 (1983). 4 V. D. Vasiliev and V. E. Kotelinasky, this series,Vol. 59, p. 612.
78
ELECTRON MICROSCOPY
[5]
c
e~ o
O >
Sedimentation
FIa. 1. A typical sedimentation pattern of the 23S rRNA preparation in buffer EM II. A dimer fraction appears with a sedimentation coefficient of s~0,w = 49S.
ribosomal subunits. 5 We have also found that, in the presence of alcohol, the ribonucleoprotein derivatives of the 30S subunit and the naked 16S and 23S RNAs become more compact than in the presence of only Mg2+. For example, in a buffer containing 10 m M Mg2+, the addition of 1 M ethanol raises the sedimentation coefficient of 23S RNA by 15%. It should be noted that this ethanol concentration is several times lower than that (> 20%, v/v) at which stimulation of some ribosomal functions and conformational changes in ribosomes caused by alcohol are observed. 6 In our experiments, a 30 to 50 m M ammonium acetate buffer containing 1 M ethanol was used. Increasing magnesium acetate and polyamine concentrations in different ratios was added to this buffer, up to the appearance of a dimeric fraction on the sedimentation patterns (Fig. 1). A further increase in magnesium concentration leads to rapid aggregation. Spermine, spermidine, putrescine, and cadaverine were tested as compacting agents. The highest sedimentation coefficient for 23S RNA was obtained by the addition of spermidine.
Buffers and Reagents EM I: 30 mMNI-I4C1, 6 mMmagnesium acetate, 1 Methanol, pH 7.5 EM II: 50 m M NH4C1, 10 m M magnesium acetate, 2 m M spermidine, 1 M ethanol, pH 7.5 Spermidine trihydrochloride was obtained from Sigma 5 A. S. Spirin and E. B. Lishnevskaya, FEBS Lett. 14, 114 (1971). 6 C. Bernabeu, D. Vazqucz, and J. P. G. BaUesta, FEBSLett. 99, 251 (1979).
[5]
ELECTRON MICROSCOPY OF r R N A
79
Isolation of rRNA 16S RNA is obtained from 30S subunits by splitting off the proteins in 3 M LiC1 with 4 M urea 7 followed by phenol deproteinization in the presence of sodium dodecyl sulfate. 23S RNA is obtained by 5-30% sucrose gradient centrifugation (Spinco SW-27 rotor, 26,000 rpm, 20 hr 5 °) of the total RNA. The total RNA is obtained from once-pelleted, unwashed 70S ribosomes by splitting off the proteins in 3 M LiC1 with urea. 7 The isolated 16S and 23S RNAs are reprecipitated three times in an ethanol-50 m M ammonium acetate mixture (pH 5.5), 2:1 (v/v), and stored at - 10 °.
Preparation of Samples Ethanol-precipitated rRNA is pelleted by low-speed centrifugation. The 16S and 23S RNA pellets are dissolved in buffers EM I and EM II, respectively at concentrations of 0.25-1.00 A2eJml, heated for 10 min at 40 °, and cooled to room temperature. After 1 - 2 hr the solution is clarified by centrifugation at 20,000 g for 15 min and used for sample preparation? The surface of the copper block, kept at 4 °, was moistened with water or alcohol and covered with a thin Teflon film (5/tm thick) on which a drop of the solution was applied. A copper grid covered with a carbonized microplastic net with holes of 2 - 5 #m and a supporting carbon film 20 thick is allowed to float on the drop of solution for 1 - 5 min. Then the grid is removed with forceps, the excess solution is sucked off with filter paper, and the grid is plunged into a Dewar flask with liquid nitrogen. The cooling rate is about 200°/sec. Several such grids are fixed onto a special holder in the liquid nitrogen itself and then transferred to a vacuum chamber. Shadow casting with tungsten-tantalum or tungsten-rhenium using an electron gun is done in an oil-free high vacuum. The equipment, preparation of supporting carbon films, and procedure have been described in detail previously.4
Comments 1. Solutions have been found that satisfy the requirements of the EM preparation technique in which compact specific folding of the rRNA chain takes place. The sedimentation coefficient of 16S RNA in buffer EM I and that of 23S RNA in buffer E M I I are 21.5 +_ 0.5 and 34.0 + 0.5 S, respectively. [S 2o.w ° is calculated taking into account the viscosity of 1 M 7 S. I. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
80
ELECTRON MICROSCOPY
[5]
ethanol. The viscosity of buffers EM I and EM II was 1.235 centiPoise (cP).] However, it is possible that these conditions are not optimal and rRNA can acquire a more compact conformation in solution. 2. Application of the described technique to the study of naked rRNA provides evidence that it actually allows visualization of the molecules in the conformation that exists in solution. Figure 2 presents micrographs of the 16S and 23S RNA in their compact forms. A comparison shows that their folding into compact three-dimensional structures is specific for each of them. When the conditions and the technique are strictly observed, the results are readily reproducible with one exception. As conditions for maximal compactness of the RNA are close to those where aggregation begins, it is difficult to obtain sizable fields free of aggregates, and these are seen in variable amounts in different experiments. 3. The conformation of rRNA is extremely sensitive to the solution composition and to the technique of sample preparation. If washing of samples prior to freezing is done, it is actually the secondary and not the tertiary structure of rRNA that is observed, regardless of whether shadow casting and conventional EM or high-resolution scanning transmission EM of an unshadowed sample are used. s
I E M Studies of rRNA Topography
General Strategy This method is based on the chemical modification of selected points in RNA by reagents containing a hapten residue, reconstitution of ribosomal subunits from the modified RNA and total ribosomal protein, and, finally, localization of the modified site of RNA by IEM with the use of haptenspecific antibodies. In general, there are only two sites in the intact RNA that are capable of selective modification: the Y-terminal ribose and 5'-terminal phosphate groups. This does not mean, however, that it is impossible to introduce the hapten into an internal site of the RNA chain. One of the possible approaches is based on formation of specific single cuts within internal sites of RNA species with stable macromolecular structures. Such cuts can offer additional Y-cis-glycol or 5'-phosphate groups that can subsequently be used for modification and localization. Below, we shall present one example of such an "internal" modification.
s M. Boublik, N. Robakis, and W. Hellmann, Eur. 3. Cellt~iol. 27, 177 (1982).
[5]
ELECTRON MICROSCOPY OF r R N A
81
FIG. 2. Micrographs of rRNAs prepared by the freeze-drying and high-resolution shadow-casting technique. (a) 16S RNA prepared from EM I. (b) 23S RNA prepared from EM II.
82
ELECTRON MICROSCOPY
[5]
Preparation of Ribosomal Subunits Labeled by Hapten at the 3'-End of RNA and Formation of Immunocomplexes
Principle Modification of the 'Y-terminal ribose of RNA presents no difficulty. The reaction is very simple and proceeds with high specificity. It involves periodate oxidation of the 3'-cis-glycol followed by treatment with ligands carrying aliphatic amino or hydrazide groups. Different authors have successfully employed different haptens: l-N-[p-(fl-~lactosyl)benzyl]-6-aminohexylamine (LBA), 9 2,4-dinitrophenylethylenediamine (DNP-ethylenediamine),l° and N-(?-2,4-dinitrophenyl)aminobutyric acid hydrazide.l The experimental procedure for modification with the first of these reagents are presented in Scheme I.
CHzOH '
OH
OH
k
CHzOH v
Loc
s
I. H2N-(CHz)6-NH2
Lac-O--~CHO
Loc--O-~CH
2. NaBH4
z - NH
~(CH~)6NH~
SCHEME 1. (a) General formula of phenyl-p-D-lactosides: NH2, CH2NH(CH2)~NH 2. (b) Synthesis of LBA.
R = CHO,
NO 2,
Materials and Reagents Sodium periodate and sodium borohydride were obtained from Merck LBA is prepared according to the method described in Ref. 9 Antibodies against fl-D-lactosides are prepared and purified as described in Ref. 9 9 I. N. Shatsky, L. V. Mochalova, M. S. Kojouharova, A. A. Bogdanov, and V. D. Vasiliev, J. MoL Biol. 133, 501 (1979). ~oH. Olson and D. G. Glitz, Proc. NatL Acad. Sci. U.S.A. 76, 3769 (1979). " M. St6fller-Meilicke, G. St6fller, O. W. Odom, A. Zinn, G. Kramer, and B. Hardesty, Proc. NatL Acad. Sci. U.S.A. 78, 5538 (1981).
[5]
ELECTRON MICROSCOPY OF r R N A
83
Buffers I: 10 m M Sodium acetate, 100 mMNaC1, pH 5.0 II: 100 m M Sodium borate, pH 9.0 III: 20 m M Tris-HC1, pH 7.8, 20 m M MgC12, 200 m M NH4CI, 2 m M dithiothreitol IV:I0 m M Tris-HCl, pH 7.8, 5 m M MgC12, 50 mMNH4C1 V: 10 m M Tris-HC1, pH 7.4, 5 m M MgC12, 50 m M NH4C1
Modification of the 3'- Terminal Ribose of rRNAs Modification of rRNA (23S, 16S, or 5S) is carried out at a concentration of 2 0 - 3 0 A26ounits/ml in buffer I containing a 1000-fold molar excess of NalO4 for 1 hr at 20 ° in the dark. The oxidized RNA is precipitated by ethanol, dissolved in the same buffer to a concentration of 100-150 A26o units/ml, and treated with 0.1% ethylene glycol (final concentration) to remove the excess NalO4. After incubation for 30 rain at 0 ° the RNA is reprecipitated twice using ethanol. The pellet is dried briefly under reduced pressure to remove the ethanol and dissolved in buffer II at a concentration of 2 0 0 - 300 A26o units/ml. (In the case of 5S RNA the indicated RNA concentrations can be 10 to 20 times lower.) LBA is added to a final concentration of 0.025 M and the reaction mixture is allowed to stand for 3.5 hr at 0 °, then NaBH4 in water (10 mg/ml) is added to a final concentration of 1 mg/ml. After standing for another hour at 0 °, the reaction is quenched by addition of 0.25 vol 1 M sodium acetate, pH 5.0. The RNA is reprecipitated three times with ethanol and used for reconstitution of the 30S subunits (16S RNA) or 50S subunits (23S or 5S RNAs).
Reconstitution and Purification of the 30S Subunits Reconstitution of the 30S subunits from the modified 16S RNA and the total 30S ribosomal protein is performed under conditions described by Traub et al. 12 with minor modifications. After reconstitution the subunits are precipitated in a Beckman Ti-50 rotor at 40,000 rpm for 4 hr and the pellet is suspended in "activation buffer" (buffer III). The 30S subunits are clarified by low-speed centrifugation, incubated for 20 min at 40°, 13 and finally purified by sedimentation on a 15 to 30% sucrose gradient prepared with the same buffer (SW-27 rotor, 22,000 rpm, 16 hr). Fractions from the "light" half of the peak are pooled and the subunits are precipitated by addition of 0.7 vol ethanol. 12p. Traub, S. Mizushima, C. V. Lowry,and M. Nomura, this series, Vol. 20, p. 391. 13A. Zamir, R. Maskin, and D. Elson, J. Mol. Biol. 60, 347 (1971).
84 A26°
ELECTRON MICROSCOPY
0
30S
b
30S
30S
/YV
o.5
1-
t
3
9
15
I
4os//
I
3
I
I
9
[5]
I
40S ~
IgG
I
15
9
15
Volume (ml) FIo. 3. Sucrose gradient sedimentation of reconstituted 30S subunits containing Y-modified 16S RNA after incubation with hapten-speciflc antibodies. (a) Control 30S subunits with nonmoditied 16S RNA. (b) 30S subunits with modified 16S RNA + antibodies. (e) 30S subunits with modified 16S RNA + antibodies in the presence of 0.05 M hapten. From Shatsky e t al. 9
Reconstitution and Purification of the 50S Subunits Reconstitution of 50S subunits from the modified 23S RNA (+ nonmodified 5S RNA) or 5S RNA (+ nonmodified 23S RNA) and the total 50S ribosomal protein is done basically as recommended by Nierhaus and Dohme ~4with one modification: 23S RNA is isolated from 70S ribosomes rather than from 50S subunits.
Formation of lmmunocomplexes Modified subunits are dissolved in and dialyzed against buffer IV. For analytical experiments when subunits are to be checked for successful labeling with hapten or its accessibility on the ribosomal surface, one A~0 unit of modified 30S subunits or two A~o units of 50S subunits in 0.05 ml buffer IV are preheated for 5 min at 37* and mixed with various amounts of the hapten-specific IgG (usually from 125 to 500 pmol of adsorbent-purified antibodiesg). The total assay volume is then adjusted to 0.1 ml. The mixture is incubated for 3 min at 37 °, cooled, maintained on ice for 2 hr, and then analyzed by centrifugation on a 5 to 20% sucrose gradient (Beckman SWo27.1 or SW-41 Ti rotor). This analytical step is necessary to determine the optimal antibody/subunit ratio for maximal yield of immunodimers. For large-scale preparation the amounts of subunits and antibodies can be increased 10 to 20 times and the final volume of the ~4K. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443.
[5]
ELECTRON MICROSCOPY OF r R N A
85
incubation mixture is increased up to 0.3 ml. For EM the selected gradient fractions should be freed of sucrose. This is performed by passage of fractions of 0.5 ml through a 0.8 × 5 cm column of BioGel P-100. Typical sedimentation patterns are presented in Fig. 3. Preparation of 30S Ribosomal Subunits Labeled by D N P - H a p t e n at the 5'-End of 16S RNA The reaction studied by Mishenina et aL 15 with a number of short oligonucleotides and poly(U) and extended by us 16 to natural RNAs is employed to attach the hapten to the 5'-terminal phosphate group of RNA (Scheme II). Below, this reaction is described for the preparation of 30S
Ro-~.-o. + Nn,C~C~N. MO,~t'-(t'~') RO-.~-K.F.~-'-(~MO~ ONO~ dr o~, R=I6S RNA
SCHEME 2. Amidation reaction of the 16S RNA 5'-terminal phosphate group by D N P ethylenediamine.
subunits labeled with hapten at the 5'-end of 16S RNA. However, it can be applied to any RNA and the yield of the reaction remains high, regardless of the molecular weight of the RNA. The reaction is very specific and does not proceed at all with internucleotide phosphodiester groups or purine and pyrimidine bases. It is carried out in organic solvents. This rules out the use of hydrophilic haptens. Instead, the hydrophobic ligand, DNPethylenediamine, is employed for this purpose. Also, some problems arise when RNA treated with organic solvents is used in reconstitution experiments. After such treatment, RNA acquires an inactive conformation and loses its competence for reconstitution. Therefore, we had to develop a special procedure to restore the active conformation of the 5'-modified RNA; such a procedure may be of general interest. Materials and Reagents
Triphenylphosphine and 2,2'-dipyridyl disulfide (Merck) are recrystallized twice from petroleum ether DNP-ethylenediamine is prepared as described in Ref. 16 ~s G. F. Mishenina, V. V. Samukov, and T. N. Shubina, Bioorg. Khim. 5, 886 (1979). ]6 L. V. Mochalova, I. N. Shatsky, and A. A. Bogdanov, Bioorg. Khim. 8, 239 (1982).
86
ELECTRON MICROSCOPY
[5]
Antibodies against DNP-haptens are prepared as described by Mochalova eta[. 17 Alternatively, antisera from Miles can be used after purification by affinity chromatography Solvents used include dimethylformamide and ethyl acetate
Buffers V: 15 m M Sodium citrate, pH 7.2, 150 m M NaC1 VI: 30 m M Tris-HCl, pH 7.5, 300 m M KC1 VII: 1 m M Potassium phosphate, pH 7.0
Modification of the Y-Terminal Phosphate Group of l 6S RNA 16S RNA isolated from 30S subunits by deproteinization with phenol is dialyzed against buffer V overnight, the excess salts being removed by dialysis against water for 3 hr. The sodium salt of 16S RNA thus obtained is lyophilized and dissolved in water to a concentration of 20 mg/ml. Amidation of the 5'-phosphate with DNP-ethylenediamine is carried out according to the method described by Mishenina et al.15 with some modifications.~6 One hundred microliters of DNP-ethylenediamine (5-10/zmol) in dimethylformamide is added to 10/zl of 16S RNA ( 3 - 6 A2~o units) in water at 5 °. Then 2,2'-dipyridyl disulfide (50 pmol) and triphenylphosphine (50/tmol) are alternately added to this mixture in small portions for 2 hr at 20 ° in the dark. Ten volumes of cold ethyl acetate saturated with anhydrous NaC104 are added to isolate the 16S RNA from the reaction mixture. It is allowed to stay for several hours at - 20 °. (Usually at this step from 25 to 50% of 16S RNA is lost, and this loss should be taken into account when calculating the initial amount of 16S RNA that is necessary for the whole experiment.) The modified 16S RNA is pelleted by low-speed centrifugation and washed several times with NaC104/ethyl acetate. Finally, the 16S RNA is dissolved in water and precipitated twice with ethanol. If necessary, the RNA can be purified additionally by LiCI precipitation. For this, the ethanol-precipitated 16S RNA is dissolved in water and mixed with an equal volume of 6 M LiC1. The resulting mixture is kept at 0 ° overnight. The Li/16S RNA is pelleted by centrifugation and Li+ is replaced by K + by dialysis overnight against buffer VI.
Reactivation of 5'-Modified 16S RNA and Its Reconstitution into 30S Subunits 16S RNA modified at the 5'-end as described above cannot be reconstituted into 30S subunits. This is a result of a considerable, if not total, ,7 L. V. Mochalova, I. N. Shatsky, A. A. Bogdanov, and V. D. Vasiliev, J. Mol. Biol. 159, 637 (1982).
[5]
A 26c
ELECTRON
o
i 3os
MICROSCOPY
OF rRNA
b
87
c
3os
24S~ 30S
-
0.5
I I
I 2
I 3
I
2
3
4
I I
I 2
I 3
I 4
Volume (ml)
FI~. 4. Sedimentation of the reconstituted modified and unmodified 30S subunits. (a) 30S subunits reconstituted from unmodified 16S RNA; (b) particles reconstituted from the DNP-modified 16S RNA; (c) particles reconstituted from the DNP-modified 16S RNA after heating for 3 rain at 100". A 10 to 30% sucrose gradient in reconstitution buffer was used. Centrifugation was done on a Beckman SW-50.1 rotor, 48,000 rpm, 4 hr. From Mochalovaet aL 17
denaturation o f the initial macromolecular structure o f 16S RNA because o f treatment with organic solvents. The only procedure that leads to a partial restoration o f the active conformation o f 16S R N A is based on that of Barritault et al,18 16S R N A in buffer VI is dialyzed against buffer VII for 3 hr, heated at 100 ° for 3 min, and then slowly cooled to r o o m temperature. After such an "annealing" the 16S R N A is dialyzed against the appropriate solution that is necessary for 30S reconstitution in vitro. The reconstitution is carded out according to the procedure described above. Annealed 16S R N A has, to a large extent, a restored capacity (to 6 0 - 7 0 % ) to interact with ribosomal proteins and to form 30S subunits (see Fig. 4). Dimer Formation
I m m u n o c o m p l e x e s 3 0 S - I g G - 3 0 S are obtained just as described above for 30S subunits labeled at the 3'-end o f 16S RNA. P r e p a r a t i o n o f 5S r R N A L a b e l e d b y H a p t e n at a n I n t e r n a l P o s i t i o n o f Its P o l y n u c l e o t i d e C h a i n Principle
Here we describe one o f the approaches whereby the hapten residue can be introduced into an internal position o f a polyribonucleotide chain. 5S ,s D. Barritault, M. F. Guerin, and D. H. Hayes, Eur. J. Biochem. 98, 567 (1979).
88
ELECTRON MICROSCOPY
[5]
ribosomal RNA proves to be suitable for this purpose. A single cut can be introduced into this molecule between residues C3s and A39 or A39 and U4o. The large fragment of 5S RNA after its separation from the small one is modified by the DNP-hapten at its 5'-end. After annealing of the nonmodified small fragment and the modified large one, the reassociated 5S RNA is readily incorporated into 50S subunits by in vitro reconstitution. This turns out to be possible because the modified single-stranded region of 5S RNA does not seem to be responsible either for incorporation of 5S RNA into the 50S subunit or its function, t9-2~ Materials and Reagents Nuclease S~ is from Biolar, USSR For other materials, see the preceding section
Buffers VIII: 20 m M Sodium acetate, 10 m M NaC1, 2 m M ZnCI2, 4 m M MgC12, pH 4.5 IX: 20 m M Tris-HC1, pH 7.5, 200 m M KCI, 10 m M MgCI2 Buffer GFS: 0.5 m M ammonium acetate, 0.5% SDS, 1 m M ethylenediamine tetraacetic acid (EDTA) Electrophoresis buffer (EB) I: 50 m M Tris-H3BO3, pH 8.3, 2 m M EDTA EB II: 40 m M Tris, 10 m M EDTA, pH 7.3
Procedure One hundred A260 units of 5S RNA are digested with 2000 units of SI nuclease in 2 ml of buffer VIII at 25 ° for 5 rain. The digest is fractionated by 7.5% polyacrylamide/7 M urea gel electxophoresis. Gel composition: 0.375% bisacrylamide, 7.12% acrylamide in EB I. Before loading on the gel, samples are dissolved in buffer I containing 7 M urea, bromphenol blue, and xylene cyanole. Electrophoresis is carried out at 500 V. 5S RNA and its 41- and 79-nucleotide-long fragments (products of digestion of 5S RNA with ribonuclease TI) can be employed as markers. The bands are detected by UV-shadowing and fragments are eluted from the corresponding gel pieces with buffer GFS + 0.5 vol of H20-saturated phenol. (The phenol layer should completely cover the gel.) Elution is performed for 8 hr with shaking. The fragments are precipitated with ethanol and addi19N. Delihas, J. Dunn, and V. A. Erdmann, F E B S L e t t . 58, 76 (1975). 20R. Monier, in "Ribosomes" (M. Nomura et al., eds), p. 141. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2t L. Zagorska, J. Van Duin, H. F. Noller, B. Pace, K. D. Johnson, and N. R. Pace, J. Biol. Chem. 259, 2798 (1984).
[5]
ELECTRON MICROSCOPYOF rRNA
89
tionally freed from acrylamide contamination by precipitation with 0.2 M CaC12 (final concentration). The Ca precipitate is dissolved in 10 m M EDTA, pH 7.2, and reprecipitated twice with ethanol. Modification of the large fragment at the 5'-phosphate group by D N P ethylenediamine is carried out as indicated in the preceding section. To reassociate the fragments into D N P - 5 S RNA, 3.2 A26o units of the 5S RNA small fragment and 6.0 A260 units of the DNP-modified large fragment are slowly cooled for 1.5 hr in 0.6 ml of buffer IX from 60 ° to 0 °, followed by ethanol precipitation. Assembly of the fragments into DNP-5S RNA is checked by 7.5% polyacrylamide gel electrophoresis in EB II with 5S RNA as marker. Reconstitution of 50S ribosomal subunits containing D N P - 5 S RNA and preparation of immunocomplexes are performed as described above. EM Technique Negative staining is used exclusively in IEM. There are three modifications: the droplet, single carbon layer, and double carbon layer techniques. 22 The latter is usually applied. It is assumed to be the best for revealing both the ribosomal subunits and the antibody molecules, which are different in thickness. However, we have obtained good results using the droplet and single carbon layer techniques. In the droplet technique the preparation is deposited on the surface of the supporting carbon film as described above (see EM Studies of the Naked rRNAs). The grid is then lowered with forceps onto the drop of 1 to 2% aqueous solution of uranyl acetate. After 1 to 5 rain the grid is removed, the solution is sucked offwith filter paper, and dried. With the use of the single carbon layer technique staining is done as in Ref. 22. It is convenient to use a simple micromanipulator for gentle lowering and lifting of the forceps clamping the mica. In general, three-dimensional localization of the IgG binding site requires its localization in at least two different projections. However, there are cases when this is not necessary. Figure 5 shows an example of fine staining of the 30S- IgG- 30S complex with the droplet technique. Both of the 30S subunits in the complex are in equivalent intermediate enantiomorphic projections. 23 However, the morphology of the 30S subunit is such that these projections are sufficient for three-dimensional localization of the binding site of the antibody molecule.
22j. A. Lake,this series,Vol. 61, p. 250. 23V. D. Vasiliev,Acta Biol. Med. Germ. 33, 779 (1974).
90
ELECTRON MICROSCOPY
[5]
Fro. 5. Two reconstituted 30S subunits containing Y-modified 16S RNA bound by a hapten-specific antibody molecule. Negative staining by the droplet method. From Shatsky et al. 9
The experiments on mapping the 3'-ends of 23S RNA and 5S R N A 24'25 and the Y- and 5'-ends of the template polynucleotide26 have shown that the single carbon layer technique also reveals distinctly the antibody molecules both in the 50S-IgG-50S and 70S-IgG-70S complexes, where the difference in the thickness of IgG and the ribosomal particle is even greater than in the 30S-IgG-30S complex. At the same time, in our opinion, the single carbon layer technique reveals ribosome fine structure better than that obtained with the double carbon layer technique. Comments The approach described above for studying ribosomal RNA topography can be also employed to localize other RNA components of the translational apparatus. Thus, the position of the ends of the mRNA segment on the ribosomal surface has been determined and some important conclusions on mRNA binding site organization have been d r a w n . 26 This hapten approach to IEM also has some advantages over IEM methods utilizing antibodies raised directly against a ribosomal component.
24 I. N. Shatsky, A. G. Evstatleva, T. F. Bystrova, A. A. Bogdanov, and V. D. Vasiliev, F E B S Lett. 122, 251 (1980). 25 I. N. Shatsky, A. G. Evstafieva, T. F. Bystrova, A. A. Bogdanov, and V. D. Vasiliev, F E B S Left. 121, 97 (1980). 2+A. G. Evstatieva, I. N. Shatsky, A. A. Bogdanov, Y. P. Semenkov, and V. D. Vasiliev, E M B O J. 2, 799 (1983).
[5]
ELECTRON MICROSCOPY OF rRNA
91
The haptens can also be employed to localize protein components of r i b o s o m e s . 27,2s
That the hapten has only a single antigenic determinant and a flexible connection between the antibody molecule and the ribosome provides advantages to the hapten approach over the traditional one. The method of modification of the 5'-phosphate groups, described here in detail, broadens significantly our potential to introduce not only hapten residues but also fluorescent and affinity labels into RNA molecules. There are some problems concerning the modification of RNA at internal positions of its polynucleotide chain that prevent the method described above from being generally applied. The most promising approach has been proposed by Gayda et al. 29 and is based on the use of short complementary oligodeoxyribonucleotides and ribonuclease H to produce specific single cuts in the internal sites of RNA species with a stable macromolecular structure.
27 M. StOtfler-Mcilicke, B. Epe, K. G. Steinh~user, P. Woolley, and G. StOitler, FEBS Lett. 163, 94 (1983). 2s M. St6fller-Meilicke, B. Epe, P. Woolley, M. Lotti, J. Littlechild, and G. St6mer, Mol. Gen. Genet. 197, 8 (1984). 29 G. Z. Gayda, A. Y. Spounde, E. A. Skripkin, V. K. Kagramanova, V. D. Veyko, N. V. Chichkova, and A. A. Bogdanov, Bioorg. Khim. 8, 1052 (1982).
[6]
CRYSTALLOGRAPHIC
STUDIES ON RIBOSOMES
95
[6] C r y s t a l l o g r a p h i c a n d I m a g e R e c o n s t r u c t i o n S t u d i e s on Ribosomal Particles from Bacterial Sources By A. YONATH and H. G. WITTMANN
Introduction Diffraction methods are the most powerful techniques for reliable elucidation of molecular structures. Such structural information is essential for detailed understanding of mechanisms of biological processes, including protein biosynthesis. Application of diffraction techniques is dependent on the availability of crystalline material. Because of the enormous size, the instability and flexibility of ribosomes, and the intricate and asymmetric nature of their structure, the in vitro growth of three- and two-dimensional crystals seemed, until recently, to be a formidable task. Nevertheless, procedures for crystallization of intact ribosomal particles have been developed recently, and structural analysis of several systems is currently being performed. In this chapter we discuss two techniques: X-ray crystallography and three-dimensional image reconstruction. Progress in structural studies of particles as large and as complex as ribosomes hinges on the correlation of the crystallographic data with electron microscopy. The large size of ribosomal particles, which is an obstacle for crystallographic studies, permits direct investigation by electron microscopy. Thus, electron microscopy can provide a useful tool for rapid evaluation and refinement of crystallization conditions. Using electron microscopy, the initial steps of crystallization can be detected and the tendency of native and modified particles to crystallize can be followed rather quickly, in contrast to the long time needed for the growth of large three-dimensional crystals. Results from electron microscopy can also be used to locate and orient the particles within the crystals and models obtained by three-dimensional image reconstruction may facilitate extraction of phase information. Thus, structure determination by three-dimensional image reconstruction from twodimensional sheets is justified not only in its own right, but also because of its expected contribution to the determination of phases needed for crystallographic analysis. Ribosomes from several eukaryotic species may, under special conditions, organize in vivo into two-dimensional sheets. Therefore they seem to be suitable objects for in vitro crystallization. On the other hand, ribosomes from prokaryotes provide a system for crystallization which is independent of in vivo events. They are smaller and have been characterized biochemiMETHODS IN ENZYMOLOGY, VOL, 164
C ~ t © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved,
96
OTHER BIOPHYSICAL METHODS
[6]
cally in much greater detail than those from eukaryotes. In addition, they can be produced in high purity and large quantity. For effective crystallographic studies, a constant supply of crystallizable material is essential. Suitable sources are those from which one can obtain reproducibly high-quality ribosomes in sufficient amounts for refinement of the crystallization conditions as well as for the production of large crystals needed for data collection. It was found that for the crystallization particles, virtually all preparations of active material yield crystals or twodimensional sheets. These include the whole 70S ribosomes of Bacillus stearothermophilus and E. coli, the 30S subunits of Thermus thermophilus and E. coli, and 50S subunits ofB. stearothermophilus and Halobacterium marismortui. However, because of the intricate nature of the particles, the exact conditions for the growth of well-ordered large crystals still must be varied for each ribosomal preparation. Some details of the preparation are given below. Cells of B. stearothermophilus (strains 799 and NCA-1503) are grown in 50-hter fermenters 1'2 and those of H. marismortui 3 in fermenters of 100 liters. 4,5 The bacteria are harvested in early log phase by continuous flow centrifugation and stored at - 8 0 °. Ribosomes are prepared by differential centrifugation after grinding the cells with alumina powder. Ribosomal subunits are separated in a Til 5 zonal rotor. The subunits of B. stearothermophilus are pelleted either by high-speed centrifugation or by precipitation with 10% polyethylene glycol 6000 followed by low-speed centrifugation, whereas those of H. marismortui are concentrated by ultracentrifugation. It is crucial that the preparation not be frozen at any stage of preparation. The integrity and the biological activity of the ribosomal particles are defined by three criteria: (1) migration profiles in sucrose gradients, obtained by centrifugation in a SW60 rotor; (2) two-dimensional gel electrophoresis of ribosomal proteins using the procedures6'7 for B. stearothermophilus and H. marismortuL respectively; (3) activity in protein biosynthesis ' V. A. Erdmann, S. Fahnestock, K. Higo, and M. Nomura, Proc. NatL Acad. Sci. U.S.A. 68, 2932 (1970). 2 A. Yonath, J. Mfissig, B. Tesche, S. Lorenz, V. A. Erdmann, and H. G. Wittmann, Biochem. Int. 1,428 (1980). 3 M. Ginzburg, L. Sachs, and B. Z. Ginzburg, J. Gen. Physiol. 55, 187 (1970). 4 M. Mevarech, H. Eisenberg, and E. Neumann, Biochemistry 16, 3781 (1977). 5 A. Shevack, H. S. Gewitz, B. Hennemann, A. Yonath, and H. G. Wittmann, F E B S Lett. 184, 68 (1985). 6 D. Geyl, A. BOok, and K. Isono, MoL Gen. Genet. 181, 309 (1981). 7 L. P. Visentin, C. Chow, A. T. Matheson, M. Yaguchi, and F. Rollin, Biochem. £ 130, 103 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
97
using the poly(U) system according to Nierhaus and co-workers8,9 for B. stearothermophilus and H. marismortui, respectively. Three-Dimensional Image Reconstruction Electron microscopy enables direct imaging of biological structures at a macromolecular level. Image reconstruction permits determination of three-dimensional structures from periodically ordered arrays. Combined with electron microscopy, image reconstruction is useful for determination of structures of large biological macromolecules and assemblies at moderate resolution. Three-dimensional image reconstruction has been developed recently, has grown in popularity, and is now considered a standard procedure. It involves averaging, by Fourier transformation, of images obtained by electron microscopy of tilt series of periodically organized identical objects. The principles of this method have been described.~° There are several limitations to three-dimensional image reconstruction and to visualization of single particles by electron microscopy. These arise from the difficulties of preserving biological specimens in the microscope vacuum, from radiation damage, and from the influence of the staining procedure on the resulting model. However, there is a fundamental difference between structural analysis by electron microscopy and by three-dimensional image reconstruction. Whereas visualization of isolated particles is rather subjective, three-dimensional image reconstruction is based on diffraction and thus is inherently of a more objective character. Furthermore, it is conceivable that isolated particles tend to lie on grids in a few preferred orientations. As a result of the contact of the particles with the flat grids, their projected views are likely to be somewhat distorted. In contrast, particles within the crystalline sheets are held together by interparticle contacts. These contacts construct a network which may stabilize the conformation of the particles and decrease, or even eliminate, the influence of the flat surfaces of the grids. The advantages of three-dimensional image reconstruction from ordered two-dimensional sheets can be demonstrated in the cases of the 80S ribosomes from lizards |t and the 50S ribosomal subunits from B. stearothermophilus. ~2 For both, the reconstructed models are of the same size and contain the features observed by visualization or reconstruction of 8 K. H. Nierhaus, K. Bordasch,and H. E. Homann, J. MoL Biol. 74, 584 (1973). 9H. Saruyamaand K. H. Nierhaus, FEBS Lett. 183, 390 (1985). ~oSee, for example, L. A. Amos, R. Henderson, and P. N. T. Unwin, Prog. Biophys. Mol. Biol. 39, 183 (1985). n R. A. Milligan and P. N. T. Unwin, Nature (London) 319, 693 (1986). ~2A. Yonath, K. R. Leonard, and H. G. Wittmann, Science 236, 813 (1987).
98
OTHER BIOPHYSICAL METHODS
[6]
single particles by electron microscopy, but at the same time show key features (e.g., a long tunnel) which could not be detected otherwise. The subjects for three-dimensional image reconstruction are either two-dimensional sheets or thin sections of embedded three-dimensional crystals. These are stained with the same materials used for conventional electron microscopy. For the elucidation of the external contour of particles, two-dimensional sheets are studied mainly unstained or negatively stained with inert materials. In contrast, thin sections of embedded crystals must be positively stained and, when reconstructed, yield information about the distribution of the stain within the studied object. Still, there are boundary cases. Not all negative stains are truly inert. Some, such as uranyl acetate, interact with selected compounds, e.g., rRNA, of the particles. On the other hand, positive stains, which should reveal the internal distribution of the material with which they interact, may contrast preferentially selected parts of the ribosomal particles according to the extent of their accessibility. Reconstruction from unstained specimens is best since it is free from the stain influence, thus giving rise to models whose boundaries are determined by differences in contrast. Furthermore, such studies may show the internal distribution of various compounds of the particles. In addition, the diffraction patterns of unstained specimens usually extend to higher resolution than the comparable stained ones. Unfortunately, this procedure cannot be applied to two-dimensional sheets which have been grown in the presence of salts, since on cooling the excess salt crystallizes on the grids and prevents visualization of the two-dimensional sheets. In favorable cases the influence of the staining procedure is minimal. One example may be the tunnel of the large ribosomal subunits. It is clearly resolved in all reconstructions of salt-grown sheets of the 50S subunits of B. stearothermophilus, independent of the staining material, t2 as well as in the reconstructed model of the unstained sheets from chick embryos.11 Three-dimensional image reconstruction has been successfully applied to some interesting biological systems including two-dimensional sheets and thin sections of crystals of ribosomal particles. 11-19 However, because ~3j. A. Lake and H. S. Slayter, J. Mol. Biol. 66, 271 (1972). 14 p. N. T. Unwin, J. Mol. Biol. 132, 69 0979). 15 R. A. Milligan and P. N. T. Unwin, J. CellBiol. 95, 648 (1982). ~6R. A. Million, A. Brisson, and P. N. T. Unwin, Ultramicroscopy 13, 1 (1984). 17W. Kuhlbrandt and P. N. T. Unwin, J. Mol. Biol. 156, 431 (1980). ~s K. R. Leonard, T. Arad, B. Tesche, V. A. Erdmann, H. G. Wittmann, and A. Yonath, Electron Microsc. 1982 3, 9 (1982). 19L. O'Brien, K. Shelley, J. Towtighi, and A. McPherson, Proc. Natl. Acad. Sci. U.S.A. 77, 2260 (1980).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
99
the order of the two-dimensional sheets is expressed only in a plane, because the objects are viewed in projection rather than in three dimensions, and because the data obtained by tilting are limited (data above a certain tilt angle, the "missing cone," and the (001) reflections are always absent), this technique alone is bound to provide only partial structural information. In Vivo Grown Two-Dimensional Sheets of Ribosomal Particles from Eukaryotes
This article focuses on ribosomal particles from prokaryotes. Because the first objects to be studied by three-dimensional image reconstruction were naturally occurring two-dimensional sheets from eukaryotic ribosomes, a brief description of results obtained from these systems is given below. Under special stressful conditions (such as cooling, lack of oxygen, and hibernation) ribosomes of some eukaryotic species (lizard, chicken, amoeba, and human) associate with each other in vivo to form periodic objects such as helices and two-dimensional ordered layers) 1,13-17,19-23 Furthermore, a semi-in vitro procedure for crystallization of ribosomes from chick embryos subjected to cold treatment has been developed in cell suspensions.tS,24 These sheets and helices are usually made of whole ribosomes and consist of relatively large unit cells. Furthermore, the ribosomes which comprise these sheets are bound to membranes, which may introduce noise when investigated by electron microscopy. In spite of these unfavorable properties, and because until recently there were no other systems of periodically packed ribosomal particles, they have been subjected to threedimensional image reconstruction studies and have yielded useful low-resolution (55- 120 A) information. Sizes of several ribosomal particles have been determined, either directly from the reconstructed particle or indirectly from the unit cell parameters. Thus, the minimum size of the large subunit in brains of senile humans can be derived from lattices which consist of unit cells as small as 130 × 130 A.~9 Information was also derived about the distribution of materials within the particles. It was observed that the rRNA-rich regions are concentrated in the interior of the ribosomes as well as in the interface area between the large and small subunits. For lizard ribosomes a narrow elongated (150-200 A length) region of low density has been detected. This region originates near the 2oB. Byers,J. Mol. Biol. 26, 155 (1967). 21y. Kress, M. Wittner, and R. M. Rosenbaum,J. CellBiol. 49, 773 (1971). 22C. Taddei,Exp. CellRes. 70, 285 (1972). 23M. Barbieri,J. Supramol. Struct. 10, 349 (1979). 24M. Barbieri,J. Theor. Biol. 91, 545 (1982).
100
OTHER BIOPHYSICAL METHODS
[6]
subunit interface and passes through the rRNA-rich core to a point close to the membrane attachment site. It was assigned to be a channel which may provide a path for the nascent polypeptide.H Tetramers are the building units of membrane-bound double layers of whole ribosomes from oocytes of the lizard Lacerta sicula as well as in the ordered sheets of early chick embryos formed in vivo and in cell suspensions) i,~4,~7In both systems, the large ribosomal subunits are located in the center of the tetramer and are involved in the contacts within and between tetramers.
In Vitro Growth of Two-Dimensional Sheets of Ribosomal Particles from Prokaryotes Most of the two-dimensional sheets from prokaryotic ribosomal subunits have been grown in vitro from low-molecular-weight alcohols by vapor diffusion in hanging drops. 25-2s Recently, mixtures of salts and alcohols have been used for the growth of two-dimensional sheets in depression slides or on electron microscopy grids.29-3~ Because only a small fraction of the particles in the crystallization medium comprises the twodimensional sheets, these cannot be separated from the rest of the crystallization mixture. Thus, evidence for the integrity of the ribosomal particles in the sheets may be obtained indirectly by testing the biological activity and the migration profile of the entire crystallization medium. The reconstructed model of the 50S particles from Bacillus stearothermophilus at 30 A resolution ~2shows substantially more detail (Figs. 1 and 2). It includes several projecting arms which are arranged radially near the presumed interface with the 30S subunit, around a cleft which turns into a Y-shaped tunnel of up to 25 A in diameter, in which the longest distance is 100- 120 A. This tunnel spans the particle and may provide the path taken 23M. W. Clark, M. Hammons, J. A. Langer, and J. A. Lake, J. Mol. Biol. 135, 507 (1979). 26j. A. Lake, in "Ribosomes: Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davies, L. Kahan, and M. Nomura, eds.), p. 207. University Park Press, Baltimore, Maryland, 1980. 27M. W. Clark, K. R. Leonard, and J. A. Lake, Science 216, 999 (1982). 2s T. Arad, K. R. Leonard, H. G. Wittmann, andA. Yonath, EMBOJ. 3, 127 (1984). 29T. Arad, J. Piefke, S. Weinstein, H. S. Gewitz, A. Yonath, and H. G. Wittmann, Biochimie 69, 1001 (1987). 30j. Piefke, T. Arad, I. Makowski, H. S. Gewitz, B. Hennemann, A. Yonath, and H. G. Wittmann, FEBS Lett. 209, 104 (1986). 3mA. Yonath, M. A. Saper, and H. G. Wittmann, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 112. Springer-Verlag, Heidelberg, Federal Republic of Germany, 1986. 32Deleted in proof.
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
101
FIG. 1. Computer graphic display of the outline of the reconstructed model of the 50S ribosomal subunit at 30 A resolution. (a) A side view of the model. The entire particle and part of a second one are shown. The arrow (i)points at the crystalcontact between the two particles.(×) marks the approximate axis around which the model was turned to obtain the view shown in (b).(b) The model shown in (a)rotatedabout the (X) axis.(f)points at the cleft between the projectingarms, at the sitewhere itturns into the tunnel. The exitof the tunnel is marked (c).(c) A view into the tunnel from the cleft.
by the nascent polypeptide chain. 12 When only the resolution features of up to 55 A are included in the reconstructions of the 50S particles, the overall shape of the 50S particle is almost spherical and it contains only two thick, short arms. In this respect it resembles the models derived from visualization of isolated particles) TM A tunnel in a similar location was also detected in the reconstructions of the whole 70S ribosome for B. stearothermophilus at 47 A resolution. Other interesting details which were revealed by the three-dimensional reconstruction of the 70S ribosomes include an empty space in the interface of the two subunits large enough to accommodate the components of protein biosynthesis (e.g., tRNA and elongation factors), as well as a groove on the small subunit, rich in RNA, which may be the binding site for the mRNA. 29
33 For a review, see H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983). 34 For a review, see G. Chambliss, G. R. Craven, J. Davies, K. Davies, L. Kahan, and M. Nomura (eds.), "Ribosomes: Structure, Function and Genetics." University Park Press, Baltimore, Maryland, 1980.
102
OTHER BIOPHYSICAL METHODS
[6]
FIG. 2. The model viewed in a projection which resembles models derived from electron microscopy of single particles.
Thin Sections of Embedded Three-Dimensional Crystals When no two-dimensional sheets or large three-dimensional crystals are available, three-dimensional microcrystals may be used for obtaining some three-dimensional information. Since microcrystals are too thick for direct investigation by electron microscopy, they may be sectioned into thin sections. These are positively stained and used for image reconstruction studies. The information obtained from such analysis is somewhat
[6]
C R Y S T A L L O G R A P H I C STUDIES ON RIBOSOMES
103
limited by the lower resolution of the sectioned material and by difficulties in determining the exact sectioning direction. Furthermore, the interpretation of the images is hampered by uncertainty as to the factors governing the stain distribution within the particle, whose chemical nature is not completely defined. In spite of these unfavorable factors, some valuable information concerning the internal distribution of the ribosomal components has been obtained from three-dimensional image reconstruction of thin sections of embedded three-dimensional crystals. Furthermore, in principle, the reconstructed images of the positively stained portions of particles may be incorporated within the outer boundaries obtained from three-dimensional image reconstruction of two-dimensional sheets. Three-dimensional image reconstruction studies on positively stained thin sections of three-dimensional crystals of the large ribosomal subunits from B. stearothermophilus ~s,31indicate that most of the ribosomal RNA is located in two domains in the core of the particle, whereas the proteins are located closer to the surface. This is in agreement with results obtained from unstained two-dimensional sheets of ribosomes from chick embryos and Lacerta sicula. ~,~5 Crystallography of Ribosomal Particles X-Ray crystallography is the only direct method for the determination of complete three-dimensional structures. Inherently, crystallographic studies are not affected by the limitations imposed by other diffraction techniques. About 30-60% of the volume of three-dimensional crystals of biological macromolecules is occupied by solution. Moreover, in contrast to the need to evacuate samples for investigation by electron microscopy, during crystallographic data collection the crystals are kept at high relative humidity, conditions under which a native conformation is likely to be preserved. In addition, the objects studied by X-ray crystallography are periodically arranged in three dimensions, whereas three-dimensional image reconstruction is performed on two-dimensional sheets which lie on flat grids in a specific manner. The geometrical properties of measuring devices--X-ray cameras, detectors, and diffractometersm used for crystallographic studies permit rotations in space. Hence, the three-dimensional crystals are investigated throughout the whole sphere of reflection rather than from a limited tilt series used for image reconstruction. X-Ray structure determination of macromolecules has recently advanced rapidly, especially in the effectiveness in collecting, processing, and analyzing crystallographic data. Consequently, the structure of several
104
OTHER BIOPHYSICAL METHODS
[6]
large biomolecular assemblies have been determined) s-41 However, full crystallographic structure analysis is still a lengthy stepwise procedure, requiring a high level of sophistication, much effort, resources, and advanced technology. A description of the basic concepts of structure determination of biological macromolecules by X-ray crystallography is beyond the scope of this chapter. The reader is advised to consult several excellent books? 2-4S Here we discuss the potential application of X-ray crystallography to structural determination of ribosomal particles. Crystal Growth
Three-dimensional crystal of intact ribosomal particles were grown only after an intensive systematic exploration of crystallization conditions and the development of an innovative experimental procedure for fine control of the content and volume of the crystallization drop. ~ Once the crystallization method was developed, it was found to be reproducible and crystals of 70S ribosomes from E. coli 47, 30S ribosomal subunits from Thermus thermophilus, as well as of 50S ribosomal subunits from B. stearothermophilus 4s-53 and from H. rnarismortul~'54'55 have been obtained. For each crystal form the quality of the crystals depends, in a manner not yet fully characterized, on the procedure used in preparation of the ribosomal subunits and on the bacterial strain.
35T. Richmond, J. T. Finch, B. Rushton, D. Rhodes, and A. Klug~ Nature (London) 311, 533 (1984). 36 C. Abad-Zapatero, S. S. Abdel-Maguid, J. E. Johnson, A. G. W. Leslie, I. Rayment, M. G. Rossmann, D. Suck, and T. Ysuldhar, Nature (London) 286, 33 (1980). 37 j. E. Anderson, M. Ptashne, and S. C. Harrison, Nature (London) 316, 596 (1985). 3s j. Deisenhofer, O. Epp, K. Mild, R. Huber, and H. Michel, Nature (London)318, 618 (1985). 39 I. A. Wilson, J. J. Skehel, and D. C. Wiley, Nature (London) 289, 366 (1981). 4o j. M. Hogle, J. Mol. Biol. 160, 663 (1982). 4t L. Liljas, T. Unge, A. Jones, K. Fddborg, S. Lovgren, U. Skoglund, and B. Strandberg, J. Mol. Biol. 159, 93 (1982). 42 j. p. Glusker and K. N. Trueblood, "Crystal Structure Analysis." Oxford University Press, Oxford, England, 1972. 4ac. R. Cantor and P. R. Schimmel, "Biophysical Chemistry," Part II, Chap. 13, p. 687. Freeman, San Francisco, California, 1980. 44 T. L. Blundell and L. N. Johnson, "Protein Crystallography," Academic Press, New York, 1976. 45 H. W. Wyckoff, C. H. W. Hirs, and S. N. Timasheff(eds.), this series, Vols. 114 and 115. A. Yonath, J. MOssig, and H. G. Wittmann, J. CellBiochem. 19, 629 (1982). 47 H. G. Wittmann, J. M0ssig, H. S. Gewitz, J. Piefke, H. J. Rheinberger, and A. Yonath, FEBSLett. 146, 217 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
105
It was observed that there is a correlation between crystallizability and biological activity. So far, inactive ribosomal particles could not be crystallized. Moreover, in spite o f the natural tendency o f ribosomes to disintegrate, all crystallized particles retain their biological activity, even for several months, in contrast to the short life time o f isolated ribosomes in solution. This property accords well with the hypothesis that, when external conditions (e.g., hibernation) d e m a n d prolonged storage o f potentially active ribosomes in living organisms, temporary periodic organization occurs in vivo. 24'56 All three-dimensional crystals from intact ribosomal particles have been grown by a c o m m o n technique used in protein crystallography, namely vapor diffusion. 57,5s It is based on a slow increase in the concentration o f the crystallizing material (protein or nucleic acid) by controlled evaporation o f the solvent in the crystallization drop. This is achieved in closed systems by equilibrating small droplets o f the crystallizing solution, which also contains a precipitant, with reservoirs o f solutions of higher concentration o f the precipitant. For the crystallization o f ribosomal particles from eubacteria this procedure was somewhat modified. Because these particles fall apart at high salt concentrations, volatile organic solvents were used as precipitants. The crystallization droplets, which contain no precipitant or an extremely small quantity o f it, are equilibrated with a reservoir containing the precipitant as well as an inert salt. In this way, crystallization is facilitated by the diffusion o f the organic solvent into the
4s A. Yonath and H. G. Wittmann, Biophys. Chem. 29, 17 (1988). 49A. Yonath, B. Tesche, S. Lorenz, J. Miissig, V. A. Erdmann, and H. G. Wittmann, FEBS Lett. 154, 15 (1983). 50A. Yonath, Trends Biochem. Sci. 9, 227 (1984). 5~A. Yonath, H. D. Bartunik, K. S. Bartels, and H. G. Wittmann, J. Mol. Biol. 177, 201 (1984). 52A. Yonath, M. A. Saper, I. Makowsld, J. Mfissig, J. Pietl~e,H. D. Bartunik, K. S. Bartels, and H. G. Wittmann, J. Mol. Biol. 187, 633 (1986). s3 S. D. Traldaanov,M. M. Yusupov, S. C. Agalarov, M. B. Garber, S. N. Ryazanlscv, S. V. Tischenko, and V. A. Shirokov, FEBS Lett. 2, 319 (1987). 54I. Makowsld, F. Frolow, M. A. Saper, H. G. Wittmann, and A. Yonath, J. Mol. Biol. 193, 819 (1987). 5s M. Sh0ham, H. S. Gewitz, B. Hennemann, J. Piefke,J. MfLssig,T. Arad, H. G. Witlmann and A. Yonath, FEBSLett. 208, 321 (1986). 56A. Liljas, Prog. Biophys. Mol. Biol. 40, 161 (1982). s7 D. R. Davies and D. M. Segal, this series, Vol. 22, p. 266. ss A. MePhearson, in "Methods of Biochemical Analysis" (D. Glick, ed.), Vol. 23, p. 249. Wiley (Interscience),New York, 1976.
106
OTHER BIOPHYSICAL METHODS
6-9 p.I Hanging drop
Hole
/
..
_c_
[6]
Glass plate
~ ,:,
/
e,r, d,s
ii]i]iiiiiiiiiiii::iiiiiiiiiiiiiiii ::::::i' a
~.,
~
,,I ~ l O m l
~--
reservoir
.----X-roy
capillary
Ilcm
-- Crystallizing column 15- 25/zl ~ I0 ml reservoir
b
t 25cm''
FIG. 3. (a) The crystallization system used for vapor diffusion in hanging drops on glass plates. (b) The crystallization system used for vapor diffusion in capillaries.
drop simultaneously with evaporation of water from it. 59 Two different crystallization systems were assembled: (1) hanging drops on glass plates, used mainly for survey since it leads to the growth of microcrystals, and (2) liquid columns in X-ray capillaries (Fig. 3), in which large crystals are obtained. Growing crystals from alcohols imposes many technical difficulties in handling, data collection, and heavy-atom derivatization. This is one reason for using ribosomal particles from Halobacterium. These partis9 A. Yonath, G. Khavitch, B. Tesehe, J. Miissig, S. Lorenz, V. A. Erdmann and H. G. Wittmann, Biochem. Int. 5, 629 (1982).
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
107
cles are stable and active at high salt concentrations and provide a system for crystallization from salts or less volatile compounds. 5,55 For ribosomal particles, as for many other biological systems, it was observed that there is an inverse correlation between the rate of crystal growth and the internal order of the crystals. This correlation is especially pronounced for crystals from halophilic ribosomes, since these grow very quickly, occasionally within a few hours. Attempts to increase the size of the crystals while enhancing their internal order by slowing down the crystallization process have been successful for the halophilic ribosomes. Whereas at very high salt concentrations only disordered microcrystals could be grown, larger and better ordered crystals were obtained as a result of a drastic reduction in the concentration of KC1 in the crystallization mixture as well as in the reservoir (Fig. 4). 31,54,55However, application of similar procedures to B. stearothermophilus has so far failed, probably because ribosomes from this source are less stable, and, upon slowing down the crystallization process, they deteriorate before they are able to aggregate and form proper nucleation centers. 59 Seeding is a procedure in protein crystallography for increasing the size of crystals. It is an extremely delicate procedure but, at the same time, rewarding. The crystal chosen for seeding is harvested from the crystallization mixture in a solution with slightly higher concentration of the precipitant and washed twice in this solution to dissolve micronucleation sites. After removing the washing solution, the crystal is transferred to a drop with a fresh crystallization mixture which has already been equilibrated with the proper reservoir. Application of seeding technique was not possible for the crystals grown from the 50S subunits of B. stearothermophilus. In contrast, this was the ultimate way for obtaining ordered crystals from the same particles from H. marismortui. Advantage has been taken of the major role played by the Mg 2+ concentration in crystallization of ribosomal particles. It was found that three-dimensional crystals of 50S ribosomal subunits from B. stearothermophilus grow in relatively low Mg 2+ concentration, whereas the production of two-dimensional sheets requires a high Mg2+ concentration, at which growth of three-dimensional crystals is prohibited. Similarly, for spontaneous crystal growth of 50S subunits from H. marismortui, the lower the Mg2+ concentration is, the thicker the crystals are. With these points in mind, a variation of the standard seeding procedure has been developed. Thin crystals of the 50S subunits from H. marismortui grown spontaneously under the lowest possible Mg 2+ concentration are transferred to mixtures in which the Mg2+ concentration is so low that the transferred crystals dissolve, but after several days new microcrystals can be observed. These reach their maximum size after 3 - 4 weeks, are very well ordered, and 10- to 30-fold thicker than the original seeds (Fig. 4).
FIG. 4. Growth of large, ordered thrvv-dimensional crystals of the 50S ribosomal subunits from H. marismortui by vapor diffusion at 19°. (Bar length =- 0.2 mm.) (a) Microcrystah obtained within 1-2 days from 7-8% polyethylene glycol, in the presence of 2.5 M KCI,
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
109
The process of crystal growth is initiated by nucleation. Although many biological molecules and complexes have been crystallized, little is known about the mechanism of nucleation. Theoretical models have been developed for the nucleation of crystals of small molecules. 6°,61 However, most of the data currently available concerning the process of nucleation of crystals of biological systems are based on rather indirect evidence, such as monitoring aggregation under crystallization conditions by scattering techniques. 62 Crystals of ribosomal particles provided an excellent system for direct investigation of nucleation. In this study, the crystallization process was interrupted before the formation of mature crystals, and the crystallization medium was examined by electron microscopy. It was found that the first step in crystal growth is nonspecific aggregation and that nucleation starts by a rearrangement within the aggregates. 59 A severe limitation in crystallographic data collection is the shape of the crystals. So far, all crystals of ribosomal particles have one very thin dimension which corresponds to the longest unit cell edge (see below). They grow either as thin needles (50S particles from B. stearothermophilus) or thin plates (same particles from H. marismortut). It is conceivable that, under microgravity conditions, well-ordered crystals with isotropic dimen-
0.5 M NH+C1, 0.15-0.20 M MgCI2, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.2), and equilibrated against 3.0 M KCI, 9% polyethylene glycol, 0.5 M NH+CI, and 0.20 M MgCI2. (b) Crystals obtained within 2-3 days in droplets containinga lower KC1 concentration than used in (a). The droplet of 4-5% polyethylene glycol, in the presence of 1.2-1.7 MKCI, 0.5 M NH4CI, 0.10 M MgC12, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.6), was equilibrated against 3.0 M KCI, 9% polyethylene glycol, 0.5 M NH4C1, and 0.10 M MgCI2. (c) Crystals obtained within 3-5 days from droplets similar to those used for (b), equilibrated with reservoirs of lower KC1 concentrations. The droplet of 4-5% polyethylene glycol, in the presence of 1.2 MKCI, 0.5 M NH+CI, 0.05-0.10 M MgCI2, and 10 mM spermidine in the crystallization mixture (pH 5.0-5.6), was equilibrated against 1.7 M KCI, 9% polyethylene glycol, 0.5 M NH4CI, and 0.10 M MgCI2. Insert: An X-ray diffraction pattern taken perpendicular to the thin axis of the crystals, obtained under conditions described in Fig. 6. (d) Crystals obtained by seeding of crystals from (c) in a crystallization drop containing 5% polyethylene glycol, 1.2 M KC1, 0.5 M NH+C1, and 0.03 M MgCIz, at pH 5.6, which was equilibrated with 7% polyethylene glycol, 1.7 M KCI, 0.5 M NH4CI, and 0.03 M MgC12, pH 5.6. Seeds were small, well-shaped crystals, transferred in a stabilization solution of 7% polyethylene glycol in 1.7 M KC1, 0.5 M NH4CI, and 0.05 M MgC12,at pH 5.6. Insert: An X-ray dit~etion pattern taken perpendicular to the thin axis of the crystals, obtained under conditions described in Fig. 6. 60j. W. Gibbs, "Collected works ofJ. W. Gibbs," p. 55. Longmans, Green, New York, 1928. 6~A. C. Zettlemoyer, "Nucleation." Marcel Dekker, New York, 1969. 62Z. Kam, H. B. Shore, and G. Feher, J. Mol. Biol. 123, 539 (1978).
110
OTHER BIOPHYSICAL METHODS
[6]
sions will be obtained. Thus, attempts to grow crystals of ribosomal particles in a space shuttle are currently underway.
Progress of Crystallographic Analysis Synchrotron radiation provides the most intense, intrinsically parallel X-ray beam. Thus it permits diffraction patterns to be obtained with short exposures and allows beams of arbitrary size by use of slits. Synchrotron radiation is essential for crystallographic data collection from crystals of ribosomal particles. This is due to the large unit-cell dimensions (Table I), the shape of the crystals (see above), their fragility, and their relatively short life times. Using synchrotron radiation, the unit-cell parameters of three crystal systems have been determined and interpretable data have been collected. Thus, crystallographic studies are currently being performed on crystals from the small ribosomal subunits from Thermus thermophilus as well as from the large ribosomal subunits from B. stearothermophilus and
H. marismortui. It was observed that between - 20 ° and 4 ° all crystal forms are stable in the synchroton X-ray beam for a few hours. However, the reflections with resolution better than 20 .~ decay within a few minutes of irradiation. This imposed serious experimental constraints. To eliminate crystal" damage, crystals were aligned only visually and each of them produced only 1 or 2 rotation photographs. Thus, more than 260 crystals (of 50S subunits from H. marismortuO were used in order to collect a presumably full set of data. In contrast, crystals which were immersed in viscous solutions, mounted on tiny glass rods or spatulas, flashed cooled, and irradiated at cryotemperature (around - 180 °) show hardly any radiation damage even after hours in the synchrotron X-ray beam. Thus complete data sets could be collected from tingle crystals. (A. Yonath, H. Hope, K. von Buehlen, F. Frolow, C. Kratky, I. Makowski, and H. G. Wittmann, manuscript in preparation.) Initially, crystals from the 50S subunits of B. stearothermophilus were obtained directly in X-ray capillaries by vapor diffusion of 4 ° from mixtures of methanol and ethylene glycoP 1,52 as long pointed needles which may reach the size of 1.5 × 0.3 × 0.2 m m (Fig. 5). Since most of them grew with one of their faces adhering to the walls of the capillaries, it was possible to irradiate them without removing the original growth solution. This was essential since any handling of these crystals is virtually impossible. Although most of the crystals grew with their long axes parallel to the capillary axis, a fair number grew in different directions. Thus, it was possible to determine the unit-cell constants (Table I) and to obtain dif-
.<
.<
.< .<
cK
-~
.<
~.<.<.<
E 0
m exl h, < ,,.] <
x
~'x
xx
x
xx
xx
0
0 <
+~ ~o
0 Z
x h'
x
x
xxx
XXXXXX XNN
XX
~-~
8~
Z <
¢..q
'~
1 12
OTHER BIOPHYSICAL METHODS
[6]
Fla. 5. (a) Crystals of the 50S ribosomal subunits from B. stearothermophilus grown in 0.5 mm X-ray capillaries by vapor diffusion at 4*. Bar length = 0.2 ram. CryslaUi7ation mixture of 20 #1 50S ribosomal subunits (10-20 mg/ml) in H-I buffer, 2 10 mMspermine, 1% methanol, 10 m M HEPES or glycine buffer, pH 8.4, was equilibrated with a reservoir of 12% methanol, 12% ethylenediol, 0.5 M NaC1, pH 8.4. (b) X-Ray diffraction patterns from crystals similar to those shown in (a), obtained at - 4 * with synchrotron radiation (A1 station at CHESS/CORNELL University operating at 5 GeV, current 30-40 mA) with 0.3 mm collimated X-ray beam (2 = 1.55 A), on a HUBER precession camera equipped with a He path. Exposure time = 3 rain, crystal-to-film distance = 200 ram. (Left) 1* rotation photograph of Okl zone, 680 × 920 A; (Right) 1* rotation photograph of h01 zone, 360 × 920 A.
[6]
CRYSTALLOGRAPHIC STUDIES ON RIBOSOMES
1 13
fraction patterns from all of the zones (Fig. 5) without manipulating the crystals. Oriented arcs and distinct spots, with spacings similar to those measured from diffuse diffraction patterns of ribosome gels and extracted rRNA, s3-65 and extending to 3.5 A, have been detected on several diffraction patterns of single crystals as well as on those of samples containing large numbers of microcrystals. For aligned crystals the average arc length is ___30 °. Such patterns may arise from partial orientation of the nucleic acid component within the particle. Recently we have developed procedures for growing crystals from this source (i.e., 50S subunits from B. stearothermophilus) using nonvolatile materials. Currently we can grow well-shaped crystals under conditions similar to the physiological ones. These crystals grew from very low concentrations of polyethylene glycol, in the presence of the ions which are essential for their activity and integrity. The crystals, shaped as wide needles (0.3 × 0.1 × 0.05 ram) are packed rather densely in cells of a = 280 A, b = 385 A, and c = 526 A, diffract to better than 11 ~,, and show moderate degree of mosaic spread (1 - 1.5°). Crystallographic data were collected at cryogenic temperature from crystals soaked in viscous solutions of polyethelene glycol containing an antifreeze (ethylene glycol). These conditions were suitable for native crystals, for crystals of the mutated ribosomes (missing protein BL11, see below), and for a complex containing the 50S subunits as well as lys-tRNA + polyLys (18-20mers). Crystals of the 50S subunits from H. marismortui grow at 19 ° by vapor diffusion and seeding as thin plates with a maximum size of 0.6 × 0.6 × 0.2 m m (Fig. 4). Although fragile, they can be manipulated. Among the crystals of the ribosomal particles, they are the most ordered and rigid. They diffract to a resolution of better than 6 A (Fig. 6). They have relatively small, compactly packed unit cells (of 214 × 306 × 594 A, Table
(c) Electron micrographs of positively stained (2% uranyl acetate) thin sections of crystals similar to those shown in (a) that have been fixed in 0.2% glyceraldehyde and embedded in resin ERL 4206. Optical diffraction patterns are inserted. (Right) Micrograph showing the characteristic "open" packing of this crystal form. The orthogonal choice of axes corresponds to the 680 × 920 A zone observed in the X-ray diffraction patterns. Lattice spacing calculated from optical diffraction: 670 × 850 A. (Left) Section approximately perpendicular to that shown on the right. Repeat distances measured from optical diffraction: 330 × 1050 A. This corresponds to the hOl zone (360 × 920 A) in the X-ray patterns. 63A. Klug, K. C. Holmes, and J. T. Finch, J. Mol. Biol. 3, 87 (1961). 64G. Zubay and M. H. F. Wilkins, J. Mol. Biol. 2, 105 (1960). 63R. Langridge and K. C. Holmes, J. Mol. Biol. 5, 611 (1962).
114
OTHER BIOPHYSICAL METHODS
[6]
h FI~. 6. (a) A crystal of the 50S ribosomal subunits of H. marismortui obtained under similar conditions of Fig. 4(d). (b,c) 1" rotation patterns of a crystal shown in (a) aligned along the major crystallographic axes. The patterns were obtained at 4* with synchrotron radiation (X31 station at EMBL/DESY operating at 5 GeV, initial current 60-80 mA). The X-ray beam of wavelength 1.48 A was collimated by vertical and horizontal slits (0.3 × 0.3 mm). Exposure time = 45 min, crystal to film distance = 150 mm. (b) Okl zone; (c) hk0 zone (obtained at a spindle setting at 90* away from the left pattern).
I), in contrast to the open structure o f the large crystals ofB. stearothermophilus (Table I and Fig. 5). Crystallographic data have been collected from crystals o f these subunits, from their complex with t R N A + p o l y P h e ( 1 8 - 2 0 m e r s ) , and from crystals soaked in solutions o f 11-gold or tetrairidium clusters (see below). In all cases crystals were immersed in an inert hydrocarbon, m o u n t e d on tiny glass spatulas, and flash-cooled in a stream o f liquid nitrogen at 8 5 - 9 0 K.
The Phase Problem T o represent a three-dimensional structure by Fourier synthesis it is necessary to sum all the waves (reflections) present in the diffraction pattern o f the crystal. Each reflection is characterized by its direction,
[6]
C R Y S T A L L O G R A P H I C STUDIES ON RIBOSOMES
1 15
intensity, and phase. What keeps it from being a trivial computational problem is that phases cannot be directly observed. The most common method in protein crystallography to derive phases is multiple isomorphous replacement (MIR). For application of this method, a set of at least two heavy-atom derivatives has to be prepared. These are crystals isomorphous to the native ones but including an additional electron-dense compound which must sit in one or a few specific sites at the same locations in each unit cell. The compounds commonly used for heavy-atom derivatization in conventional protein crystallography contain heavy metals, such as platinum, mercury, and gold. Heavy-atom derivatives are obtained by soaking the native crystals in a solution containing such a compound, or by binding of a heavy-atom ligand to a specific group on the protein prior to its crystallization. For an object as large, asymmetric, and complex as the 50S ribosomal subunit, it is necessary to use extremely dense and compact compounds. Heavy-atom dusters are most suitable for this purpose. However, due to its size and complexity, the surface of the ribosomal subunit is a composite of a variety of potential interaction sites for such clusters. Therefore, on soaking in solutions of a heavy-atom cluster, the latter may be attached to multiple sites on the ribosomes and complicate phase determination or make it impossible. Thus, in order to obtain usable heavy-atom derivatives, these clusters should be covalently bound to a few specific sites on the ribosomal particles. This may be achieved by direct interaction of a heavyatom cluster with chemically active groups such as SH or the ends of rRNA 66 on the intact particles prior to crystallization, or by covalent attachment of a cluster to tailor-made carriers which bind to one or a few specific sites on ribosomes. An example of a suitable candidate for this purpose is a gold duster, Ault(CN)3[P(C6H4CH2NH2)317, in which the gold core has a diameter of 8.5 A. This compound has been prepared as a monofunctional labeling reagent. 67,68 Appropriate carriers may be antibiotics,69 DNA oligomers complementary to exposed single-stranded rRNA regions,7° and Fab molecules specific to ribosomal proteins. Since most of the interactions of these materials are characterized biochemically, the crystallographic location of 66O. W. Odom, Jr., D. R. Robbins, J. Lynch, D. Dottavio-Martin, G. Kramer, and B. Hardesty,Biochemistry 19, 5947 (1980). 67H. Yangand P. A. Frey,Biochemistry 23, 3863 (1984). 6aW. Jahn and S. Weinstein,unpublishedobservations. 69K. H. Nierhausand H. G. Wittmann,Naturwissenschafien 67, 234 (1980). 7oW. E. Hill, B. E. Tapprich,and B. Tassanakajohn,in "Structure,Functionand Geneticsof Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Veflag, Heidelberg, Federal Republic of Germany, 1986.
116
OTHER BIOPHYSICAL METHODS
[6]
the heavy-atom compounds will not only be used for phase determination but will also reveal the location of specific sites on the ribosomes. Alternatively, these clusters may be attached to chosen sites on isolated ribosomal components which will subsequently be incorporated into particles in which they are missing. A mutant of B. stearothermophilus which lacks protein L1 1 was obtained by growing cells in the presence of thiostrepton at 60 ° (see above). The 50S mutated ribosomal subunits crystallize in two and three dimensions under the same conditions as, and are isomorphous to, those obtained from the 50S ribosomal subunits of the wild type.~t This shows that L l l, the missing protein, is not involved in crystal forces in the native crystals. Furthermore, binding of N-ethylmaleimide to the SH group of protein L1172 does not reduce the activity and crystallizability of the reconstituted modified particles. 7a Phase information may also be obtained by neutron diffraction, as performed for the nucleosomes,TM and by direct methods. As mentioned above, results of electron microscopy are invaluable for phase determination. The model of the 50S particle, obtained by three-dimensional image reconstruction, could be placed in the crystallographic unit cell using crystal-packing information derived from the electron micrographs of thin sections of the same crystals (Fig. 5), as performed for nucleosomes and viruses. 75,~6In addition, the application of real- and reciprocal-space rotation s e a r c h e s 77 should be feasible by taking advantage of the noncrystallographic symmetry within the asymmetric units. A model obtained at medium resolution could be used, together with high-resolution information obtained from crystallographic studies of isolated individual ribosomal components, for iterative phase determination by molecular replacement methods,77 assuming that the conformations of crystallized isolated components are sufficiently similar to their conformations within the particle.
7~A. Yonath,M. A. Saper,F. Frolow,I. Makowski,and H. G. Wittmann,J. Mol. BioL 192, 161 (1986). 7~ M. Kimura, unpublished observations. 73 S. W¢instcin, unpublished observations. 74 G. A. Bcnfly, A. Lewit-Bcnfly, J. T. Finch, A. D. Podjarny, and M. Roth, J. M o L Biol. 176, 55 (1984). 75 j. E. Johnson and C. Hollingshcad, J. Ultrastruct. Res. 74, 223 (1981). 74 j. T. Finch, L. C. Lutter, D. Rhodes, R. S. Brown, B. Rushton, M. Levitt, and A. Klug, Nature (London) 269, 29 (1977). 7~ M. G. Rossmann, "Molecular Replacement Method: A Collection of Papers on the Use of Non-Crystallographic Symmetry." Gordon & Breach, New York, 1972.
[7]
SMALL SUBUNITQUATERNARYSTRUCTURE
1 17
Concluding Remarks The methods of crystallography and high-resolution three-dimensional image reconstruction have been introduced recently to the field of ribosomes. However, all elements that should assure the success of these techniques have already been demonstrated. Furthermore, a vast amount of knowledge, concerning the chemical, biological, physical, and genetic properties of ribosomes, from which structure analysis should benefit enormously, has been accumulated. It is expected that the results of the structural studies will lead to a better understanding of the role of ribosomes in protein biosynthesis.
[7] N e u t r o n - S c a t t e r i n g T o p o g r a p h y o f P r o t e i n s o f t h e Small Ribosomal Subunit B y MALCOLM S. CAPEL a n d V. RAMAKRISHNAN
The quaternary organization of the proteins of the Escherichia coli small ribosomal subunit has been investigated by nearly every possible experimental approach, including immunoelectron microscopy,' bifunctional chemical cross-linking) fluorescence energy transfer, 3 and neutron scattering.4-6 The results of all of these different mapping efforts are surprisingly consistent with one another, and provide a nearly complete understanding of the quaternary organization of the proteins of the 30S ribosomal subunit. 7,8 In this chapter we describe the low-angle neutronscattering methods we have employed to determine the three-dimensional configuration of the proteins of the 30S ribosomal subunit of E. coli. The basic strategy for data collection and analysis has been discussed before in ' G. St6mer and M. St6ttier-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 2 j. M. Lambert, G. Borleau, J. A. Cover, and R. R. Traut, Biochemistry 22, 3913 (1983). 3 K. H. Huang, R. H. Fairelough, and C. R. Cantor, J. Mol. Biol. 145, 443 (1975). 4 V. R. Ramakrishnan, S. Yabuki, I.-Y. Sillers, D. G. Schindler, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 153, 595 (1981). 5 V. R. Ramakrishnan and P. B. Moore, J. Mol. Biol. 153, 719 (1981). 6 V. R. Ramakrishnan, M. S. Capel, M. Kjeldgaard, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 174, 265 (1984). 7 p. B. Moore, M. S. Opel, M. Kjeld~aard, and D. M. Engelman, Biophys. J. 49, 13 (1986). s p. B. Moore, M. S. Capel, M. Kjeld~aard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.). Springer-Verlag, New York, in press. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[7]
SMALL SUBUNITQUATERNARYSTRUCTURE
1 17
Concluding Remarks The methods of crystallography and high-resolution three-dimensional image reconstruction have been introduced recently to the field of ribosomes. However, all elements that should assure the success of these techniques have already been demonstrated. Furthermore, a vast amount of knowledge, concerning the chemical, biological, physical, and genetic properties of ribosomes, from which structure analysis should benefit enormously, has been accumulated. It is expected that the results of the structural studies will lead to a better understanding of the role of ribosomes in protein biosynthesis.
[7] N e u t r o n - S c a t t e r i n g T o p o g r a p h y o f P r o t e i n s o f t h e Small Ribosomal Subunit B y MALCOLM S. CAPEL a n d V. RAMAKRISHNAN
The quaternary organization of the proteins of the Escherichia coli small ribosomal subunit has been investigated by nearly every possible experimental approach, including immunoelectron microscopy,' bifunctional chemical cross-linking) fluorescence energy transfer, 3 and neutron scattering.4-6 The results of all of these different mapping efforts are surprisingly consistent with one another, and provide a nearly complete understanding of the quaternary organization of the proteins of the 30S ribosomal subunit. 7,8 In this chapter we describe the low-angle neutronscattering methods we have employed to determine the three-dimensional configuration of the proteins of the 30S ribosomal subunit of E. coli. The basic strategy for data collection and analysis has been discussed before in ' G. St6mer and M. St6ttier-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984). 2 j. M. Lambert, G. Borleau, J. A. Cover, and R. R. Traut, Biochemistry 22, 3913 (1983). 3 K. H. Huang, R. H. Fairelough, and C. R. Cantor, J. Mol. Biol. 145, 443 (1975). 4 V. R. Ramakrishnan, S. Yabuki, I.-Y. Sillers, D. G. Schindler, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 153, 595 (1981). 5 V. R. Ramakrishnan and P. B. Moore, J. Mol. Biol. 153, 719 (1981). 6 V. R. Ramakrishnan, M. S. Capel, M. Kjeldgaard, D. M. Engelman, and P. B. Moore, J. Mol. Biol. 174, 265 (1984). 7 p. B. Moore, M. S. Opel, M. Kjeld~aard, and D. M. Engelman, Biophys. J. 49, 13 (1986). s p. B. Moore, M. S. Capel, M. Kjeld~aard, and D. M. Engelman, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.). Springer-Verlag, New York, in press. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
118
OTHER BIOPHYSICALMETHODS ~j--Scattered
j/ ~r...... J
[7]
Neutrons
;-Sam,e
J
[
Entrance S l i t ~
........
..............
c--2D Detector FIG. 1. Basicschemefor a small-anglescatteringexperiment. 20=i. denotesthe minimum observable scattering angle for a given geometry, determined by collimation parameters, sample to detector distance, and beam stop size.Collimator slits consist of disks of cadmium, and the beam stop is a cylinder of boron nitride, backed by cadmium. The sample is contained in a cylindrical quartz cell.
this series, 9,~° so we shall concentrate on improvements in biochemical methods, instrumentation, and data analysis. The essential scheme of a solution neutron-scattering experiment is presented in Fig. 1. Neutrons from a divergent source are collimated by a series of circular slits, and impinge upon the sample. Neutrons scattered by the sample are detected by a two-dimensional position-sensitive detector, while unscattered neutrons (the direct beam), are blocked by an opaque beam stop. The function that one measures from such an experiment is I(q), where q = 4zt sin(20)/2, 20 is the scattering angle, and 2 is the maximum of the wavelength distribution of the incident neutron beam. The scattering vector q is inversely related to distances in real space. Thus larger objects require a knowledge of I(q) at smaller values of q. The smallest value of q that one can measure is a function of the incident wavelength and the degree of collimation of the incident beam. However, the flux delivered on the sample is inversely related to the extent of collimation (narrowness) of the beam. Therefore, the accuracy of the measured scattered signal deteriorates with increasing collimation, unless the measurement time is greatly extended. There is, therefore, a tradeoff between collimation requirements and beam intensity that must be evaluated for each experiment. 9 p. B. Moore and D. M. Engelman, this series, Vol. 59, p. 629. iop. B. Moore, this series, Vol. 59, p. 639.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
119
The total excess I(q) (obtained by subtracting solvent, cell, and background scattering) is modulated by component terms arising from interference between neutrons scattered from all nuclei within and between individual 30S subunits of the sample. Only that component of I(q) generated by interference between neutrons scattered from nuclei within the two labeled proteins, of a single 30S ribosome is germane to interprotein distance measurements. This term is frequently called the interference function and will be denoted by I~(q). All other component I(q) are considered sources of noise, including the term due to interference between neutrons scattered from centers in different 30S subunits, the interparticle interference term. The interference function is extracted from scattered intensity data by a strategy involving isotopic labelling of pairs of proteins within the 30S ribosomal subunit. The strategy exploits the considerable difference in the neutron-scattering lengths of hydrogen and deuterium. In the past, pairs of proteins, labeled by deuterium, were reconstituted into 30S particles, composed of otherwise hydrogenated protein and 16S rRNA. Scattering measurements were made in buffer containing 56.8% D20, which is the contrast match-point for hydrogenated 30S ribosomes. At the match-point, that component of the total scattering signal due to the labeled protein pair is maximized, since the scattering of the ribosome as a whole is on the average equal to that of solvent and thereby minimized. We have recently reversed the labeling strategy in order to increase the signal-to-noise ratio of our scattering measurements by minimizing incoherent scattering due to hydrogen. In this case, pairs of hydrogenated proteins are reconstituted into otherwise deuterated 30S subunits, and scattering measurements taken in 100% D20. This procedural change provides a substantial gain in the statistical quality of scattering measurements, but incurs a huge penalty in the form of increased D20 utilization. Briefly, the procedure is as follows: (1) E. coli cells are grown in normal (hydrogenated) media, or perdeuterated media; (2) 30S ribosomal subunits from both cultures are then purified on zonal sucrose gradients~°; (3) proteins from hydrogenated and perdeuterated subunits are separated to purity by a combination of ion-exchange and reversed-phase high-performance liquid chromatographyt~,~2; (4) hydrogenated and perdeuterated purified proteins are recombined such that only the protein pair of interest is isotopically labeled; (5) finally, 30S particles are reconstituted, using unlabeled 16S rRNA. Actually, for each interprotein distance, four differ11A. R. Kerlavage, C. J. Weitzmann, T. Hasan, and B. S. Cooperman, J. 255 (1983). 12M. S. Capel, D. Datta, C. R. Nierras, and R. Craven, this volume [37].
Chromatogr. 266,
120
OTHER BIOPHYSICAL METHODS
[7]
ent reconstituted 30S particles are required: (1) one in which both proteins of interest are isotopically labeled; (2) one in which none of the proteins are labeled; and (3 and 4) particles in which only one of the two proteins of the pair are labeled. In the following we discuss technical improvements in scattering measurements and detail procedures whereby scattering information [in the form oflz(q)] is used to construct models of the spatial arrangement of the proteins of the 30S subunit. Sample Handling
Scattering buffer: 0.5 m M magnesium acetate, 50 m M KC1, 10 m M Tris, pH 7.5, 1 mMdithiothreitol, 100% 1)20 filtered to 0.4/zm. All salts are deuterium-exchanged prior to formulation by dissolution in 100% I)20, followed by lyophilization. Most of the interprotein distance measurements have involved samples that were pelleted directly into aluminum cells. Procedures involved in these measurements are detailed elsewhere in this series. 13 Since the aluminum of the cells scatters significantly at very small angles, we used sets of cells that were accurately matched with respect to their scattering power at low angle. Surface properties of the aluminum of a given cell were found to have a large effect on its scattering function. Therefore, care was taken in handling and cleaning the cells, so as not to perturb their scattering behavior. Scattering measurements involving very long inte~rotein distances are vulnerable to corruption by differences in the scattering of aluminum ceils, even when matched cells are used. In addition, methodological changes required for distance measurements involving proteins whose binding to 30S subunits is reversible have mandated the use of ribosome solutions rather than pellets in scattering measurements (see below). For these reasons we now use quartz sample cells. The scattering of quartz at low angle is much less than aluminum and is fiat in the small-angle region down to at least 0.005 A-1 in q. Cylindrical quartz cells, with an internal diameter of 13 m m and a depth of 6 m m (total volume 0.9 ml) are now used in all measurements. The depth and diameter of the quartz cells were chosen such that the same mass of 30S subunits could be placed in the neutron beam as with pelleted samples, without substantial loss of signal due to reduced sample transmission. t3 D. M. Engelman, this series, Vol. 59, p. 656.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
121
Previous interprotein distance measurements involved deuterium labeling in a hydrogen "background" 30S particle. The E. coli strain MRE600 was used as the source for all deuterated material due to its tolerance for I)20. The strain HPR13 was the source for 16S rRNA and the background proteins, since high-quality 16S rRNA was readily obtained from this strain because it is deficient in major RNase activities. Because we now employ hydrogen labeling in an otherwise perdeuterated 30S particle, MRE600 serves as the source of background protein and 16S rRNA. We have found that a large fraction ( - 50%) of the 30S particles reconstituted from perdeuterated MRE600 16S rRNA and protein irreversibly dimerize when pelleted. We therefore employ ultrafiltration rather than centrifugation to concentrate 30S subunits prior to cell loading. Sucrose gradient fractions containing reconstituted 30S particles ~° are concentrated to - 4 ml with a UM2 filter (Amicon). The optical densities of all samples needed for a given distance determination are measured to better than 1% precision, and an aliquot containing a fixed mass of 30S subunit from each sample is further concentrated to 0.5 ml with a Centricon-30 microconcentrator (Amicon). Concentrates are then exhaustively dialyzed against scattering buffer. Dialyzed samples are pipetted into pretarred 1.5 ml Eppendorf microcentrifuge tubes and weighed. The volumes of the all samples (determined gravimetrically, assuming a density of 1.1 for pure D20) are all adjusted to 1.0 ml with scattering buffer from the final dialysis bath. Air exposure of all samples must be minimized so as not to perturb the D20 concentration by exchange with airborne moisture. Volume-adjusted samples are then pipetted into quartz cells for scattering measurements. All procedures from dialysis to cell loading are carried out at 6 °, in order to minimize temperature changes which promote outgassing in the sample, with concomitant formation of gas bubbles inside loaded sample cells. Neutron Source and Instrumentation
Early neutron-scattering measurements were made at the H4S instrument at the High Flux Beam Reactor (HFBR) at Brookhaven National Laboratory. This instrument provided neutrons with a wavelength of 2.36 A, with a wavelength spread AA/2 of about 0.01. However, small angle experiments can be accomplished using a beam with a much broader wavelength distribution (which effectively increases the incident flux) before smearing problems become unmanageable. It became apparent that this instrument was far from ideal for the solution scattering measurements we envisioned.
122
OTHER BIOPHYSICAL METHODS
Neutron
Beryllium
Guides
•
1-19
Multiloyer Monochromotor
Cavity
[7]
Sample Axis or Sample Changer
\ \ H9-B \\
~
Co,,~motor
~
H~'u',~d
\\ \\
C Beam--~
A Beam
~
/
2D Detector
~v-
Im Hg-A
Fro. 2. Diagram of the H9b small-angle neutron facility at the High Flux Beam Reactor of Brookhaven National Laboratory.
In 1981 a new small angle spectrometer was commissioned at the cold moderator station (H9B) of the HFBR) 4 A schematic of the spectrometer is shown in Fig. 2. At the H9 station, fast neutrons from the reactor core interact with a volume of liquid hydrogen, the cold moderator, which is maintained at a temperature of 20 K. Inside the cold moderator, neutrons experience multiple inelastic collisions with hydrogen nuclei, a process that effectively "cools" the neutrons, so that their wavelength distribution is shifted toward the higher wavelengths that are optimal for small-angle scattering experiments over spatial range subtended by biomolecules. The moderated neutron beam then passes through a beryllium filter which removes neutrons of wavelength less than 3.96 A. The neutron beam is transported by nickel-coated glass neutron guides to the monochromator cavity. Here, neutrons of a particular wavelength are selected by a synthetic multilayer monochromator, 15 which provides a beam with a wavelength spread (A2/2) of about 0.1. The beam is then collimated by a series of concentric cadmium slits, before impinging on the sample. Neutrons scattered by the sample pass through a helium-filled snout and are detected by a two-dimensional position-sensitive array. The detector, which is 50 × 50 cm in size, incorporates advanced electronics that combine high spatial resolution with high efficiency)6 A photograph of the instrument is shown in Fig. 3. z4D. K. Schneider and B. P. Schoenborn, in "Neutrons in Biology" (B. P. Schoenborn, ed.). Plenum, New York, 1984. ~5A. M. Saxena, J. Appl. Crystallogr. 19, 123 (1986). ~6B. P. Schoenborn, J. Sehefer, and D. K. Schneider, Nucl. Instrum. Methods Phys. Res., Sect. A 252, 180 (1986).
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
123
Flo. 3. Photograph of the H9 scattering spectrometer. The housing of the reactor vessel is visible to the right. The technician is standing next to the chamber containing the multilayer monochromator.
Several features of the H9B spectrometer combine to make it far superior to the H4S instrument. The cold source permits the use of longer wavelengths, which in turn relaxes the collimation requirements for a given experiment. Combined with the increased wavelength spread of the monochrometer, these changes result in a higher incident beam intensity at the sample. The physical dimensions of the H9 detector mean that a larger range o f q can be measured from a given detector position. The net effect of these improvements is a gain in flux by a factor of 5 - 10. An added result is that longer interprotein distances can be measured conveniently, and short ones can be measured more accurately than before. D a t a Collection and Analysis The strategy for data collection and analysis is shown schematically in Fig. 4. Scattered intensities and transmissions are measured for the various labeled samples, buffer, empty cell, and blocked-beam background. The raw data for each of these measurements exist as two-dimensional arrays representing the number of counts in each detector element. The raw data are then radially integrated, about the beam center, to give the scattered
124
OTHER BIOPHYSICALMETHODS (TRANSMISSIONS) + ERRORS
(INTENSITIES) + ERRORS
(
[7]
CONCENTRAT|ONq~ + ERROR~ /
DIFFERENCE PROGRAMS
( I
+ COVARIANCE MATRIX
+
)
INVERSION PROGRAM
+ Px(r ) ~'~ SECOND MOMENTS ) + ERRORS
MAPPING PROGRAM ADII OF GYRATION + ERRORS
//
FIo. 4. Schematic diagram of data collection and analysis for measurement of interprorein distances by neutron diffraction. Data inputs include transmission measurements, radially averaged scattered intensifies, and ribosome concentrations. Differenceprograms calculate interference functions. Sine-Fourier inversion of interference functions to obtain P(r) distribution functions follows.Finally, a large set of the P(r) second moments is used as input to mapping programs to obtain centroid coordinates and the radius of gyration of each small subunit protein. intensities as a function o f q [i.e., I(q)]. T h e next step in data analysis is to use these intensities to obtain the corrected Ix(q) signal for the protein pair under consideration (see below). The form o f Ix(q) is determined by the distance between the centers o f mass o f distribution o f hydrogen sites in the labeled pair o f proteins, as well as details the two distribution functions and their relative orientation. The Fourier sine transform o f Ix(q) function gives a function P(r), which is the distribution o f all vector lengths connecting nonexchangeable hydrogen sites between the labeled pair. The second m o m e n t o f P(r) is related to the interprotein distance as follows: 17 M o = Ri: + R f + d .2.,
~7P. B. Moore and E. Weinstein, J. Appl. Crystallogr. 12, 321 (1979).
(1)
[7]
SMALL S U B U N I T Q U A T E R N A R Y S T R U C T U R E
125
where M o is the second m o m e n t of P(r), Ri and Rj are the radii of gyration of the two labeled proteins, and d o is the distance between the centers of mass of the two proteins. Since the distance between the two proteins is related to the center of mass coordinates of the proteins by the relation d 2 = (xi - xi) 2 + ( Y i - yj)2 _ ( z i _ zj)2
(2)
Eq. (l) relates the second moments to the positions and radii of gyration of the proteins. Thus if one accumulates enough measured second moments, then it is possible to solve for the positions and radii of gyration using Eq. (l). This approach is rigorous as it does not involve any assumptions about the shapes of the proteins. Extraction o f the Interference Signal
The interference function is deconvoluted from the total scattered signal by one of two ways. In the first case, where both of the proteins of interest bind irreversibly to the 30S subunit, reconstituted 30S subunit preparations (1) and (2) are mixed in equimolar ratio to yield a "'signal" mixture, as are preparations (3) and (4) to produce a "noise" mixture. Ix(q) is obtained by subtracting the I(q) measured for noise mixture from that measured for signal mixture, after correlation for various systematic noise and background effects. Ix(q) = k j . ( q ) + kblb(q) + kele(q) + khlh(q) + /~Im(q) k~ = B J B . kb = -- C~ B J CbBb k, = - [ v d v , - ( C d C b ) ( V d V , ) l kh = - ( B J B , , , ) ( 1 - C J C b + k , ) k~=-(k.+kb+k¢+k,+kh)
(3)
where I, is the scattering function of the signal mixture, Ib is the scattering function of the noise mixture, I., Ih, and Im are the buffer, blocked beam, and empty cell scattering functions, respectively. B,, Bb, Be, Ba, and Bm are the corresponding transmitted intensities of signal, noise, buffer, blocked beam, and empty cell. The variables in V are volumes and those in C are the corresponding concentrations of 30S subunits determined by optical density, following intensity measurements. In the situation wherein one or both of the proteins of interest manifests reversible binding to the 30S subunit, the above procedure yields a null signal. In this case, I~(q) for the pair is obtained by separately measuring the I(q) for all four reconstituted 30S preparations mentioned above. I~(q) is then obtained by subtracting the sum of the corrected I(q) from
126
OTHER BIOPHYSICAL METHODS
[7]
preparations (3) and (4) from the sum of the I(q) of preparations (1) and (2).
I~(q) = kaI.(q) + kblb(q) + kclc(q) + kdld(q) + kele(q) + khlh(q) k a = gra/fag
a
k b = nm/Cbn b kc = - Bm/CoB~
(4)
kd = --B.,/CdBd ko = ( B J B . ) ( -
1/C~ + - 1/Cb + -- l / C ~ + -- 1/Cd)
kh=-(k,+lq,+k~+kd+k,) A problem arises in this method for obtaining Ix(q), in that it does not perfectly eliminate the interparticle interference term. !s,19 In order to help compensate for this fact, ribosomal subunit concentrations are reduced by a factor of 20 in all scattering measurements, in comparison to those operative in the first (mixed) method. With both the mixed and unmixed methods the errors in the parameters of Eqs. (3) and (4) are calculated with a first-order error propagation. 5
Fourier Inversion of the Interference Signal The distribution ofinterprotein distances, P(r) is related to the interference signal Ix(q) by the relation
P(r) = --~ 2r fo ®qI~(q) sin(qr) dq Ix(q) --
f
P(r) sin(qr) dr qr
(5) (6)
The problem is that I~(q) is not measured over the entire range of q but rather over some interval ql and o.2, so that the integral in Eq. (3) cannot be evaluated directly. For a given sample-to-detector distance, the lower limit is determined by the collimation conditions and the size of the beam stop, and the upper limit is determined by the size of the area detector used. When q is known over a limited range, it is still possible to determine P(r) accurately by indirect Fourier transformation methods. These methods rely on the fact that if the particle being studied has a maximum dimension d, then P(r) is nonzero only in the range 0 -< r -- d. One can assume that P(r) can be expanded in terms of independent is W. Hoppe,J. Mol. Biol. 78, 581 (1973). 19D. M. Engelman and P. B. Moore,Proc.NatL Acad. Sci. U.S.A.69, 1997(1972).
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
127
functions q~.(r) which are nonzero only in the range 0 -< r <-- d: nmax
P(r) =- 2~ a.q~.(r)
(7)
n--1
so that nml~t
Ix(q) = '~ a,,B,,(q)
(8)
n--I
where the functions B.(q) are the transforms of ~b.(r), given by B.(q) =
fo d
q~.(r)
sin(qr) dr qr
(9)
The best values of the coefficients a. can be determined by a linear least squares fit to the observed function Ix(q). This involves minimizing the residual R given by
l[
._
R = ~ . . a--~. 2 Ix(q,)-- .-rE anBn(q')
]
(10)
Minimization of R results in a system of linear equations which can be solved for the coefficients a,. Once the coefficients are known, the length distribution function P(r) can be calculated. Further, quantities such as the second moment of P(r) and its associated error can be calculated directly from the coefficients a.. The choice of ~bn(r) = 8zcr sin(nnr/d) is particularly appropriate both for ease of computation, and because these functions are related in a natural way to the information content present in the scattering curve (for a detailed discussion of the latter point, see Ref. 16). This method works well when the smallest q for which Ix(q) has been measured is less than zc/d. The number of functions nmx that are used in the expansion is related to the maximum value of q measured; n=~, = qm.xd/n. The second moment Mij is related directly to the coefficients by 8d4
M 0 - x2i(0)
~ 1 a , (z~2n2 _ 6 ) ( - 1)n+ 1 n3
(11)
The error in M 0 can also be evaluated from a. and the covariance matrix for an .20 Although this method works satisfactorily in the great majority of cases, there are occasionally data sets that do not behave well. In principle, P(r) 20 p. B. Moore, J.
Appl. Crystallogr. 13, 168 (1980).
128
OTHER BIOPHYSICAL METHODS
[7]
for these experiments must be nonnegative. Occasionally, a measured data set will produce a P(r) that has significant negative excursions, due to various systematic noise effects. In these cases, one can evaluate the best a, subject to the constraint that P(r) -> 0. 5 The algorithm that determines the locations of the individual proteins from the second moments of the length distribution function is very sensitive not only to the moments themselves, but also to the errors associated with them. For this reason, an error analysis on the second moment is absolutely crucial. The precision error in the second moment that is returned by the indirect Fourier transformation program does not reflect the true error for the following reasons. The analysis depends on the choice of d, the maximum length in the distribution of distances from points in one protein to points in the other. For a given measurement, d is not known a priori. What is done in practice is that the reduced x 2 and the second moment are determined for a range of d values. There is generally a range of d for which x 2 is about the same. In this region, the second moment M e has a range M1 to M2. The overall uncertainty in M Uis given by 5 o~ = tr,~ + (3//2 --M~)2/12 (12) Yet another uncertainty comes from the fact that, due to systematic errors, not all data sets give the same value of reduced x ~. Those data sets that contain such error are less reliable than those that do not, and this uncertainty should be reflected in the error for the second moment. This results in a modification of the error for the second moment as follows: oa = max(l, xa)t72 + (M 2 -- Mr) 2
(13)
The final estimates for the second moment and errors are used in the next step of the analysis, which is to determine actual positions and radii of gyration of the individual proteins. Model Building
Equations (1) and (2) provide the basis for model building based on the second moments, since they relate to second moments directly to the positions and radii of gyration of the proteins. A model can be found by determining the coordinates and radii of gyration that minimize So =
~
[ M o. - ( R 2 + R 2 + (xi -- xi) 2 + (Y~- yj)2 + (z, - zj)2}] (14)
U
This minimization, which involves a nonlinear least squares optimization, is done by the use of Marquardt's algorithm. 2~ One knows a p r i o r i that the 2t p. R. Bevington, "Data Reduction and Error Analysis for the Physical Sciences." McGrawHill, New York, 1969.
[7]
SMALL SUBUNIT QUATERNARY STRUCTURE
129
radii of gyration for the proteins cannot be smaller than those obtained under t h e assumption that the proteins are anhydrous spheres and given their known molecular weights. Accordingly, it is useful to prevent the model from converging on nonphysical values of radii of gyration by constraining the radii of gyration to be greater than the anhydrous sphere values. This is done b y adding penalty terms to the function to be minimized 5,2°,22 so that one now minimizes the function t~
S=S0 + ~ (Ri_goi),
a>0
(15)
where t~ is a positive constant, and R0t is the radius of gyration of the ith protein if it were an anhydrous sphere. We have also included a provisional upper-bound constraint on the radii of gyration equal to three times the lower bound constraint. Provided that one starts with initial guesses for the radii of gyration that are larger than Roi, the algorithm will always yield final estimates that are larger than the lower limit, and less than the upper-bound constraint. In the absence of constraints, nonphysical values for the radii of gyration are often obtained, owing to the fact that the radii of gyration are small compared to the distances between proteins, and their squares are usually of the same magnitude as the errors in the second moments. The errors in the coordinates and radii of gyrations would be obtained in a straightforward way from the minimization routine if no contraints were operative. In practice, about one-half of the radii of gyration are near the limits to which they are constrained. Thus the errors are evaluated by a Monte Carlo procedure, s The model that results from the analysis of the real second moments M o is used to calculate a set of ideal M o values. Then a large number of sets of M o values are generated, assuming that each of the second moments are normally distributed about the ideal with a standard deviation that equals the actual error estimates. Each of these trial data sets is then solved by the model building program, and the values of the parameters obtained for each are used to calculate a distribution mean and standard error. Current Model Figure 5 presents two views of the current model including all proteins except $2 l, contained within contours representing the shape of the 30S subunit, as interpreted by St6tiler and St6ftler-Meihcke.~ About 90 different interprotein distance measurements, made over a span of a decade, are involved in the construction of this map. The average of the uncertainties 22y. Bard, "Nonlinear Parameter Estimation." Academic Press, New York, 1974.
130
OTHER BIOPHYSICAL METHODS
[7]
FI6. 5. Two views of the current model of the structure of the 30S ribosomal subunit. Contours are the subunit shape as interpreted by the Berlin group.' Correlation between neutron map and the shape was obtained by reference to immunoelectron microscopic data and by maximizing the "containment" of ribosomal proteins by the shape contours.
in the coordinates of all proteins is around 10 .At along all three axes. The aggregate error of the map is well within the range of expected errors calculated by Monte Carlo modeling, given the precision of the individual measurements used in constructing the map. Individual proteins are represented as spheres whose volumes are determined by molecular weight, assuming a fixed partial specific volume (anhydrous) of 0.71. The neutron map was aligned with the shape contours by correlating it with the immunoelectron microscopy map.1 Note that all proteins are well confined by the shape contours. None of the calculated positions results in significant collision between different proteins (i.e., we do not map two different proteins into the same position). The calculated aggregate radius of gyration for 30S proteins is 71 A, which agrees exceptionally well with recent experimental measurements. 23 The neutron map is highly consistent with the mapping of surface-exposed antigenic determinants of ribosomal proteins constructed by both the Berlin ~ and UCLA 24 groups. Furthermore, interprotein spatial 23 V. Ramakrishnan, Science 231, 1562 (1986). 24 j. A. Lake, Annu. Rev. Biochem. 54, 507 (1985).
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
131
relationships within the map are congruent with the results of bifunctional chemical cross-linking studies, with the notable exception of cross-links involving protein S 13.a Acknowledgments We wish to express our deep appreciation to Drs. P. B. Moore and D. M. Engelman, in whose laboratories this work was carried out. This work was supported by NIH grants AI 09167 to P. B. Moore and A120466 to P. B. Moore and D. M. Engelman, and by the Office of Health and Environmental Research of the United States Department of Energy.
[8] P r e p a r a t i o n a n d A c t i v i t y M e a s u r e m e n t s o f Deuterated 50S Subunits for Neutron-Scattering Analysis
By
PETRA NOWOTNY, VOLKER NOWOTNY, HELGA Moss,
and KNUD H. NIERHAUS Ribosomes are heterogeneous particles with respect to the neutron scattering-length densities of their components. Because of the different proton contents of these components the scattering-length density of ribosomal proteins is less than that of RNA. In order to obtain ribosomal subparticles of like density we homogenized protein and RNA by means of differential deuteration. Both rRNA and protein fractions are prepared from cells grown under different 020 concentrations, so that both fractions adopt a scattering density of near 100% D20. From these deuterated fractions a 50S subunit is reconstituted which is now homogeneous for the neutron beam. If this homogeneous 50S subunit is transferred to a buffer of near 100% D20, it becomes "invisible" to the neutron beam ("glassy ribosome"). This system allows two kinds of measurements to be made using neutron scattering: (1) Integration of one protonated protein permits the measurement of shape parameters of this protein in situ. (2) The integration or binding of two protonated components enables us to measure the distance of mass centers of the respective components. A detailed discussion of the concept of the "glassy ribosome" can be found elsewhere, l V. Nowotny, R. P. May, and K. H. Nierhaus, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Verlag, Berlin, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All n4~htsof reproductionin any formr--,~ervcd.
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
131
relationships within the map are congruent with the results of bifunctional chemical cross-linking studies, with the notable exception of cross-links involving protein S 13.a Acknowledgments We wish to express our deep appreciation to Drs. P. B. Moore and D. M. Engelman, in whose laboratories this work was carried out. This work was supported by NIH grants AI 09167 to P. B. Moore and A120466 to P. B. Moore and D. M. Engelman, and by the Office of Health and Environmental Research of the United States Department of Energy.
[8] P r e p a r a t i o n a n d A c t i v i t y M e a s u r e m e n t s o f Deuterated 50S Subunits for Neutron-Scattering Analysis
By
PETRA NOWOTNY, VOLKER NOWOTNY, HELGA Moss,
and KNUD H. NIERHAUS Ribosomes are heterogeneous particles with respect to the neutron scattering-length densities of their components. Because of the different proton contents of these components the scattering-length density of ribosomal proteins is less than that of RNA. In order to obtain ribosomal subparticles of like density we homogenized protein and RNA by means of differential deuteration. Both rRNA and protein fractions are prepared from cells grown under different 020 concentrations, so that both fractions adopt a scattering density of near 100% D20. From these deuterated fractions a 50S subunit is reconstituted which is now homogeneous for the neutron beam. If this homogeneous 50S subunit is transferred to a buffer of near 100% D20, it becomes "invisible" to the neutron beam ("glassy ribosome"). This system allows two kinds of measurements to be made using neutron scattering: (1) Integration of one protonated protein permits the measurement of shape parameters of this protein in situ. (2) The integration or binding of two protonated components enables us to measure the distance of mass centers of the respective components. A detailed discussion of the concept of the "glassy ribosome" can be found elsewhere, l V. Nowotny, R. P. May, and K. H. Nierhaus, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Verlag, Berlin, Federal Republic of Germany, 1986. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All n4~htsof reproductionin any formr--,~ervcd.
132
OTHER BIOPHYSICAL METHODS
[8]
The preparation procedures and activity measurements are summarized in the tabulation below, and the methods are described accordingly. References are given for those techniques which have been previously described in detail. Preparation and Activity Measurement of the Ribosomal Components Protonated components Fermentation2 Isolation of ribosomal subunits2 Isolation2 and separation of rRNA (23S + 5S rRNA) Isolation of the total proteins of the 50S subunit (TP50) Isolation of single proteins Deuterated components Fermentation Isolation of ribosomal subunits Isolation and separation of (23S + 5S) rRNA Preparation of TP50 Determination of the concentration of isolated proteins Reconstitution procedure Activity measurements Poly(U)-dependent poly(Phe) synthesis assay Peptidyltransferase assay
Preparation of Protonated Components The fermentation of protonated Escherichia coli cells (D10; RNase I-, Met-, tel A-), the isolation of ribosomal subunits, and the isolation of the total rRNA fraction have been described elsewhere in this series. 2 Separation of 23S and 5S rRNA
Materials 70% (v/v) Phenol: freshly distilled phenol is stored at - 2 0 ° in 10-ml portions; before use 4.3 ml of glass-distilled water is added per portion Bentonite-SF (Serva, Heidelberg, FRG; Cat. No. 14515) 2 K. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443.
[8]
PREPARATION OF 5 0 S FOR NEUTRON SCATTERING
133
Sodium dodecyl sulfate (SDS; Bio-Rad, Richmond, CA; Cat. No. 161-0301) RNA buffer: 10 m M Tris-HC1, pH 7.6 (4°), 50 m M KCI, 1% (v/v) ethanol Sucrose (BRL, Bethesda, MD; Cat. No. 5503UB) 5% (w/v) sucrose in RNA buffer 20% (w/v) sucrose in RNA buffer Ethanol T~oM4 buffer: 10 m M Tris-HC1, pH 7.5 (4°), 4 m M magnesium acetate Procedure. The (23S + 5S) rRNA is isolated by phenol extraction from 50S subunits containing intact 23S RNA. Sterilized tubes and pipets are used in all steps, and the whole procedure is performed at 4 °. 0.1 volume of 10% (w/v) SDS, 0.05 volume of 2% (w/v) bentonite and 1.2 volume 70% phenol are added to 50S subunits (concentration up to 400 A26ounits/ml). The mixture is shaken vigorously for 8 min and centrifuged for 10 min at 10,000 g. The aqueous phase (upper phase) is mixed with 1 volume of 70% phenol, shaken for 5 min, and centrifuged. The aqueous phase is extracted a third time. One to 2 ml of the RNA-containing aqueous phase is layered onto a sucrose gradient (5-20% sucrose in RNA buffer, SW27 rotor). After centrifugation (17 hr at 20,000 rpm) the gradient is pumped out and the optical density is recorded at 290 rim. 23S and 5S rRNA-containing fractions are pooled and precipitated at - 2 0 * overnight by addition of 2 volumes ethanol. After centrifugation (30 min at 10,000 g) the RNA pellets are resuspended in Tt0M4 buffer at a concentration of about 200 A260 units/ml for the 23S rRNA and about 20 A26o units/ml for the 5S rRNA. The concentrations are measured and the rRNA solutions are stored at - 8 0 ° in small portions. Preparation of the Total Proteins (TP50) from the Large Subunit This method is a modification of that previously described. 3 Materials Magnesium acetate, 1 M Glacial acetic acid Bentonite-SF (Serva, Heidelberg, FRG; Cat. No. 14515) Dowex l-XS, 20-50 mesh Acetone
3 H. Schulze and K. H. Nierhaus, E M B O J . 1, 609 (1982).
134
OTHER BIOPHYSICAL METHODS
[8]
Rec4-6U buffer: 20 m M Tris-HC1, pH 7.5 (4°), 4 m M magnesium acetate, 400 m M NH4CI, 2 m M 2-mercaptoethanol, 6 M urea. The buffer is mixed with bentonite-SF (1 g per liter), stirred at 4 ° for 1 hr, and filtered through two layers of Selecta filters (Schleicher & Schuell, Dassel, FRG; 595 1/2, diameter 240 mm), and stored at 4 ° for up to 3 weeks. Alternatively, the 6 M urea solution may be passed through a Dowex ion-exchange column (5 × 30 cm) and then the salts are added Rec4 buffer: same as Rec4-6U but without urea. Therefore the washing procedure with bentonite is omitted
Procedure. Two volumes of glacial acetic acid are added to the 50S suspension (made 0.1 M Mg 2+ by addition of 0.1 volume of magnesium acetate). The mixture is stirred for 45 min at 0 ° and centrifuged at 10,000 g for l0 min at 4 °. Five volumes of acetone are added to the protein supernatant. The precipitated proteins are collected by centrifugation at 10,000 g for 10 min. The pellet is dried under vacuum and dissolved in Rec4-6U buffer to a final concentration of about 200 equivalent units per milliliter (1 equivalent unit of protein is the amount of protein extracted from 1 A26o unit of 50S subunits). The solution is dialyzed overnight against a 200-fold volume Rec4-6U buffer, and four times (each for 45 min) against a 200-fold volume Rec4 buffer. The solution is centrifuged at 6000 g for 5 min, the optical density at 230 nm is determined, and the solution is stored in small portions at - 8 0 °. The following relationships are an approximation: 1 A23o unit of a TP50 solution is equivalent to 220/zg and also to l0 equivalent units (eu) of TPS0.
P r e p a r a t i o n of Single Proteins The proteins of the large ribosomal subunit are separated by conventional chromatographic techniques. 4 We also apply an additional protocol for the protein isolation: the proteins are prefractionated with the LiCl-split technique,4 and we isolate proteins by ion-exchange and reversed-phase high-performance liquid chromatography (HPLC). Various buffer systems are applied. In all cases gradient systems are used. The isolated proteins 4 G. Wystup, H. Teraoka, H. Schulze, H. Hampl, and K. H. Nierhaus, Eur. Z Biochem. 100, 101 (1979).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
135
remain active with respect to their ability to assemble into active 50S subunits~ (total reconstitution). Materials Reversed-phase chromatography Trifluoroacetic acid (TFA; Fluka, Buchs, Switzerland) 2-propanol acetonitrile Buffer A: 0. 1% TFA in water Buffer B: 0.1% TFA in 2-propanol or acetonitrile. The organic solvents used for the HPLC separations are of LiChrosolv grade (Merck, Darmstadt, FRG). Reversed-phase separations are performed on a Nudeosil 300-C4 column (size 250 × 16 mm, pore size 300 A, particle size 7 #m). Guard column: size 30 )< 16 m m (packed with support from Macherey & Nagel, D~iren, FRG). Ion-exchange chromatography Buffer A: 20 m M HEPES, 5 M urea, 2 m M methylamine in water Buffer B: 1 M KC1 added to buffer A. The urea solution is passed through a Dowex ion-exchange column (see above). Ion-exchange chromatography separations were performed on an Ultropac TSK CM-3SW column (size 150 × 21.5mm, particle size 10/zm). Guard column: size 75X 21.5 mm (purchased from LKB, Munich, FRG).
Procedure. Aqueous buffers are filtered through a 0.45/zm type HAWP filter (Millipore, Molsheim, France). The proteins are eluted with a flow rate of 5 - 8 ml/min using gradients4b from 0% B to 100% B. The gradient shape is adapted to the separation problem. The absorption is measured at 230 nm. After HPLC separation, the following steps are performed: The pooled protein fractions obtained with urea-containing solvents are extensively dialyzed against double-distilled water and lyophilized. Protein fractions from the reversed-phase separation are dried directly. The dried proteins are dissolved in Rec4-6U buffer, dialyzed first against 100 volumes of that buffer for 12 hr, and then four times for 45 min against 100 volumes of Rec4 buffer. All dialysis steps are performed at 4 °. Handling of
4~p. Nowotny, H. Eckardt, V. Nowotny, and R. M. Kamp, Chromatographia, in press (1988). 4b R. M. Kamp, A. Bosserhoff, D. Karnp, and B. Wittman-Liebold, J. Chromatogr. 317, 181 (1984).
136
OTHER BIOPHYSICAL METHODS
[8]
the purified proteins with respect to purity check and characterization are described in detail in Ref. 4. Preparation of Deuterated Components Fermentation Materials M3 minimal medium: Glucose 40% (w/v) in 84% I)20 or 76% D20, respectively, sterilized at 120* for 20 rain in an autoclave Salt solution5 for a 100-liter fermenter: 150 g NaC1, 200 g (NH4)2SO4, 650 g KH2PO4, 1000 g K2HPO4, pH 7.2, sterilized as above MgC12 solution: 10 g/100 ml 100 liters 84% or 76% D20-water mixture. The exact D20 concentration has to be adjusted with pure I)20 and measurement is controlled with a density measurement. We use a Paar DMA 60 densitometer (Graz, Austria), which allows readings to at least 5 significant digits Procedure. Sterilized 40% glucose, 0.6 ml, in 84% or 76% D20 is added to 50 ml deuterated sterilizeql M3 medium and 0.12 ml 10% (w/v) MgC12 is added. The medium is inoculated with 4 ml solution ofE. coli strain MRE 600 in glycerol and shaken overnight at 37*. This ciJlture is then used to inoculate a deuterated M3 medium of 84% or 76% D20. The culture is added to 450 ml M3 medium with the respective D20 content after addition of 6 ml 40% glucose. The solution is supplemented with 1.2 ml 10% MgC12. The culture is grown for 8 hr and then poured into 100 liters D20 M3 medium with the respective D20 concentration supplemented with 100 ml 10% MgClz solution and 1 liter of 40% glucose. The solution is stirred (1000 ~ m ) and kept at 37 °. The fermenter (Bioengineering, Switzerland) is not aerated to reduce contamination of the I)20 with water vapor from air. The outlet is cooled to reduce a loss of I)20 vapor. Under these conditions the cells grow with generation times of about 1 - 1.5 hr. The fermentation is stopped at an optical density of 1.5 A~5o units per ml (usually reached after 8 - 1 0 hr). The medium is pumped through pipes surrounded by ice-water as a cooling device and the cells are pelleted with a Padberg centrifuge. The medium is collected and recycled. With this procedure 300-400 g (wet weight) cells is obtained with one
P. B. Moore, this series, Vol. 59, p. 639.
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
137
fermentation. The cells are collected in a plastic bag, shock frozen, and stored at - 80 °. Recycling of Used D20 Media The media are distilled with a 50-liter Buechi (Buechi, Switzerland) rotavapor and further purified by pumping them through a Millipore Super Q device several times until a resistance of 10,Mf~ is reached. The D20 concentration is reduced after one fermentation by less than 1% D20. This loss is compensated for by the addition of 100% D20 before the next fermentation. Preparation of Deuterated Ribosomal Subunits
Materials Dissociation buffer: 1 0 r a m K2HPO4-KH2PO4, pH 7.5, 1 m M MgCI2, 6 m M 2-mercaptoethanol 40% sucrose (w/v) in dissociation buffer 50% sucrose (w/v) in deionized water Aluminum oxide (Alcoa, Serva, Heidelberg, FRG; Cat. No. 12293) Tl0MloNi0oSH~ buffer: 10 m M Tris-HC1, pH 7.5, 10 m M MgC12, 100 m M NH4C1, 6 m M 2-mercaptoethanol
Procedure. The entire procedure is carded out at 4 °. For the preparation of 70S ribosomes the cells are washed with dissociation buffer (2 ml per gram of cells). The pelleted cells (10 rain at 10,000 g) are mixed with aluminum oxide (Alcoa, 2 g per gram of cells) and ground in a Retsch mill KM I (Retsch, Haar, FRG) for 45 min. One batch (300-400 g) of cells is used. Dissociation buffer is added (1.5 ml per gram of cells). The paste is homogenized for l0 min in the mill. Aluminum oxide is removed by centrifugation (10 min at 10,000 g), and the supernatant is withdrawn. The pelleted aluminum oxide is suspended in dissociation buffer (1.0 ml per gram of cells) and is ground for about 10 min in the Retsch mill until the paste becomes homogeneous. The aluminum oxide is again removed (10 min at 10,000 g). Both supernatants are combined and the cell debris is removed by low-speed centrifugation (60 min at 30,000 g). From the supernatant of this step (S-30) the ribosomes are collected via high-speed centrifugation (14 hr at 27,000 rpm; 45Ti). The ribosomes are suspended in dissociation buffer (0.3 ml per gram of cells). The ribosome solution is divided into portions of about 10,000 A260 units each and stored at - 80°. Usually 200- 300 A26o units of 70S ribosomes are obtained per gram of cells. The subunits are separated with a
138
OTHER BIOPHYSICAL METHODS
[8]
zonal run in a B15Ti zonal rotor containing a hyperbolic gradient6 (1600 ml from 6 to 38% sucrose) made from dissociation buffer and 40% sucrose in dissociation buffer. After centrifugation (17 hr at 23,000 rpm) the gradient is pumped out with 50% sucrose in deionized water. Fractions (about 18 ml) containing either small or large subunits are pooled. The subunits are collected via a centrifugation step (22 hr at 38,000 rpm; 45Ti). The pellet of each tube is suspended in 4 ml T~oM~oN10oSH6buffer for the 50S subunit and 2 ml of the same buffer for the 30S subunit by gently shaking in the cold room (4 °). The suspension is cleared by centrifugation (5 min at 10,000 g). Its optical density at 260 nm is measured. The subunit suspension is shock frozen in large portions (10 ml) and stored at - 8 0 °. Isolation of Deuterated (23S + 5S) rRNA The procedure follows the one described above for protonated material. However, special care is taken to obtain maximal yields. Thus, the phenol phase obtained after the first phenol extraction is washed with one volume of TtoM4 buffer which is also used to wash the phenol phases of the second and third phenol extractions. Both aqueous phases obtained after the third phenol extraction (plus washing step) are combined. This modification increases the yield significantly, which reaches 80-90% of the input amount of 50S material. Isolation of Deuterated T P 5 0 Escherichia coli strain KI 2 (D 10) is used for the isolation of protonated TP50. However, we have to use the strain MRE 600 for the isolation of the deuterated TP50, since it grows better in a D20-containing medium. 50S subunits derived from MRE 600 cells which were harvested at 1.5 A65o units per ml contain RNases which destroy the large rRNA during the reconstitution process. Therefore, the RNases have to be removed from the 50S subunits by washing with LiC1 as described below before the total proteins are extracted. Materials 5 M LiTloM~o buffer: 5 M LiC1, 10 m M magnesium acetate, 10 m M Tris-HCl, pH 7.5 (washed with bentonite as described above for Rec4-6U buffer) T~oM~0buffer: 10 m M magnesium acetate, 10 m M Tris-HC1, pH 7.5 6 E. F. Eickenberry, T. A. Biekle, R. R. Traut, and C. A. Price, Eur. J. Biochem. 12, 113 (1970).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
139
Procedure. 50S subunits in TloMtoN~0oSH6 buffer are diluted with TtoMl0 buffer and LiTtoMlo buffer to a final concentration of 100 A26o units/ml and a LiC1 concentration of 0.3 M. This solution is kept at 0 ° for 2 hr. A centrifugation step (7 hr at 40,000 rpm; 45Ti) at 0 ° collects the washed 50S subunits. The supernatant is discarded and the subunits are suspended to a final concentration of about 600 A26o units/ml. A 0.1 volume of 1 M magnesium acetate and 2.2 volumes of glacial acetic acid are added to this suspension. The rest of the procedure follows that described above for protonated material. The yield for the TP50 is (with the approximation 1 A23o unit of TP50 - 10 eu of TP50) in the range of 60-75% of the input amount of 50S subunits.
Determination of the Concentration of an Isolated Protein Two methods are employed: (1) determination of the total nitrogen content in small protein samples, 7 and (2) absorption measurement around 230 nm. 8 Materials
Phenol reagent: 2% phenol, 0.1% sodium nitroprusside in water (this solution can be kept for several weeks at 4 °) Alkaline hypochlorite: 20 m M NaOC1, 2.5 M NaOH (the titer of the hypochlorite solution is controlled iodometrically after preparation; this solution is stable at 4 °) Nitrogen standard: 10 m M (NH4)2SO4 in glass-distilled water is kept in tightly sealed glass bottles KPh buffer: 10 m M potassium phosphate, pH 7.5, 4 m M magnesium acetate, 400 m M KCI BSA standard: l0 mg bovine serum albumin in 100 ml KPh buffer HC104: 72% solution Procedure. Glassware and pipets have to be intensively cleaned. Wash them with hot tap water, immerse them in a solution of hot tap water (about 50 °) with solid K O H (1 M final concentration) for 1 hr, and rewash them with tap water, 10% acetic acid, and finally glass-distilled water at least six times. In order to remove traces of nitrogen-containing components, we extensively dialyze the protein solution against a 100-fold volume of KPh buffer at least four times for 45 min. The samples ( 1 0 - 5 0 p l protein solution with an optical density of about 1 A23o unit/ml) are diluted in 100 pl of KPh buffer, and 25 pl HC104 solution is added. The samples are heated at 215 ° for 1 hr in a thermostat-
L. Jaenicke, Anal. Biochem. 61, 623 0974). B. Ehresmann, P. Imbault, and J. H. Weil, Anal. Biochem. 54, 454 (1973).
140
OTHER BIOPHYSICAL METHODS
[8]
ted aluminum block with 4 cm deep holes which hold the Duran test tubes 0 4 × 100 mm). After cooling, 500al glass-distiUed water is added. To start the color reaction 450/~1 phenol reagent is added and then 200250 ]zl NaOCl solution (containing 320 ag NaOC1). After 20 min the absorption is recorded at 614 nm. A buffer sample is treated the same way and used as a control. To reduce error measure at least four different amounts of a given protein solution (for example 10, 25, 40, 55/~l). A nitrogen standard curve is determined from 5, 10, 15, 20, and 25 ]zl of the nitrogen standard solution (equivalent to 140, 280, 420, 560, and 700 ng nitrogen, respectively), and a BSA standard curve plotted from corresponding inputs of the BSA standard solution. The slopes (m) of the regression lines are calculated for the curves: the nitrogen standard curve (m~; A614 reading versus nanograms nitrogen input), the BSA standard c u r v e [ m 2 ; A614reading versus microliters BSA input; the relative nitrogen content of BSA is taken as 15.8% (w/w)], and the sample curve (m3; A614 reading versus microliters sample input), m 2 and m~ are used to calculate the recovery R (as percentage). The measured concentration of BSA is [BSA]= - -
m2 X 100
ml × 15.8 [ng/lzl]
Division by the input concentration [BSA]i multiplied by 100 gives the recovery R in percent. R = ([BSA]=/[BSA]i) × 100 Since m3/m I is the measured nitrogen content of the sample, the protein mass per milliliter (My) is obtained by Mp-
m a x 104 m~ X %N X R [/~g/ml]
The value %N from the ribosomal protein under observation is obtained from the sequence data (see Table I). The Mp values of a sample solution with a concentration of 1 A2aounit per ml (Mp/A230) are given in Table I. The method outlined above yielded absolute values which were compared to a simple absorption measurement. This method s was developed for measuring protein concentrations in protein-RNA mixtures. The protein content is determined by measuring the absorbances at 228.5 and 234.5 nm. The difference between these values (AA =A22a.5-A2u.5) is related to the protein concentration. We have determined that a AA of I is equivalent to 312 ag protein/ml in KPh buffer. The results of both methods are expressed as micrograms per A23o unit in Table I. Although the UV method yields reproducible results, we assume that the nitrogen
[8]
PREPARATION OF 508 FOR NEUTRON SCATTERING
141
determination gives the correct values. Therefore, the latter were used to calculate the molar extinction coefficient at 230 nm (E23o, see Table I). Since we use the term "equivalent unit" (eu) for the input estimates of proteins, we calculate the volume of a ribosomal protein solution which contains 1 eu. One equivalent unit is 36 × Mr × 10-6 gg, assuming that 1 A260 unit of 50S subunits corresponds to 36 pmol. The concentration of the ribosomal protein solution under observation is AA × 312 × 10-3 gg/#l. Therefore, 1 eu is present in 36 × 10-6 Mr 312)< AA X 10-3 X F
36 X 10 - 3 X M r
312XAAXF
K AA/tl
The factor F is the ratio of the results from the nitrogen determination and that of the UV measurement. F and K are presented in Table I for the individual ribosomal proteins. Reconstitution P r o c e d u r e The optimal molar ratio of rRNA to TP50 is determined for each preparation. Ratios of about 1:1.2 with protonated TP50 and ratios of 1:1.2 to 1:1.8 with deuterated TP50 are usually obtained. The slight overstoichiometry of the proteins in the latter case is due to the LiCl-washing procedure described above. Materials Rec4 buffer: 20 m M Tris-HCl, pH 7.5, 4 m M magnesium acetate, 0.2 m M ethylenediaminetetraaceticacid (EDTA), 400 m M NH4C1, 2 m M 2-mercaptoethanol Rec4 adaptation buffer: 110 mMTris-HC1, pH 7.5, 4 mMmagnesium acetate, 0.2 m M EDTA, 4 M NH4C1, 2 m M 2-mercaptoethanol T2oM4o0N4oo buffer: 400 m M magnesium acetate, 400 m M NH4CI, 20 m M Tris-HC1, pH 7.5 Rec20 buffer: same as Rec4, but with 20 m M magnesium acetate 40% sucrose in Rec20 buffer D-Rec20(K) buffer: 2 0 r a m Tris-DCl, pD 7.9, 20 m M MgC12, 400 m M KC1 in 100% D20
Procedure. RNA dissolved in the T~oM4 buffer has to be adapted to the reconstitution milieu with respect to the ion concentrations. For this purpose, 9 parts of RNA solution is mixed with l part of the Rec4-adaptation buffer. RNA solutions of concentrations exceeding 250 A26o units/ml tend to become very viscous under Rec4 ion milieu on ice and are thus stored during the assay preparation period at room temperature. For optimizing
,~
~
~
~
~
~i
--,,6--
~
--
(--i
--
..-;
~
w~
I"-
c~
0
v
~
~v+~
~+~
~ " ~ ~"
~
~
z
v ~'~
Z
oo
~1~
~
~
I" ~
~
~
~
~1~
~o
r-
~-
oo
~,~
',0
/~.
~'-
~'~
I~ -
oc~
(~
o~
t--
r~
~6
oo
~
~
o~
oo
o
Z L~ Z 0
i--
c,
v-;
o6
v
v
v
~.÷I~÷I~÷~÷I~
v
÷I~ v
v
0
A~
v~
144
OTHER BIOPHYSICAL METHODS
[8]
the amounts of TP50 a pilot reconstitution is performed. A single assay contains 2.5 A260 units (23S + 5S) RNA and various amounts of proteins (from 2.5 to 4 eu TP50) in 100/d of Rec4 buffer. For neutron experiments 1600A26o units of deuterated (23S + 5S) RNA are reconstituted with proteins in a volume of 60 ml. If one or both of the protonated proteins belong to the group of rRNA binding proteins 9,9a (Ll, L2, L3, L4, (L5), L7/L12, L9, Ll0, Ll l, L14, L15, Ll6, L17, LI8, L20, L22, L23, L24, L25, L28, L29), the following three-step procedure is applied. In the first step, 1600 A26o units of rRNA are mixed with optimal amounts of the rRNA binding protein(s) in a volume of 60 ml minus the volume containing the optimal amounts of deuterated TP50. If one (or both) of the protonated proteins is a nonbinding protein it is added in a 5to 10-fold molar excess over rRNA. The deuterated RNA and protonated protein mixture is incubated for 15 rain at 44 °. For the second step, the optimal amount of deuterated TP50 is added, yielding a total volume of 60 ml. The mixture is incubated for 15 rain at 37 ° which allows for a slow but ordered assembly, ~° and a further incubation follows (44 ° for 30 min), still under Rec4 conditions. For the third step, the Mg 2+ concentration is raised to 20 m M by the addition of 2.54 ml of T2oM~oN4oo buffer and an incubation is performed at 50 ° for 90 min. After the reconstitution process, the sample is layered on a zonal gradient made from 6 to 40% sucrose in Rec20 buffer and centrifuged (B 15Ti rotor, 17 hr at 20,000 rpm). The fractions containing the 50S material are pooled and the 50S subunits collected with a centrifugation step (24 hr at 38,000 rpm; 45Ti rotor). The pelleted material is suspended in about 700/zl D-Rec20(K) buffer. The tubes should be dried with pieces of filter paper to remove any remaining zonal buffer droplets before addition of the deuterated buffer. The samples are dialyzed four times against 20 ml of D-Rec20(K) buffer. The samples are transferred to 3-ml sample containers which are tightly closed to exclude water exchange, and shock-frozen in liquid nitrogen. Prior to the neutron measurements, D-Rec20(K) buffer is added to the samples in order to yield a volume of more than 1120/zl. The samples are centrifuged for 10 min in a table-top centrifuge to remove aggregated material. The supernatant is carefully withdrawn and 1100/zl is transferred into the measuring quartz cell. The remaining material is used for activity 9 R. Roehl and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 79, 729 (1982). 9a M. Herold and K. H. Nierhaus, J. BioL Chem. 262, 8826 (1987). io M. Herold, V. Nowotny, E. R. Dabbs, and K. H. Nierhaus, MoL Gen. Genet. 203, 281 (1986).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
145
measurements and the determination of concentration (A26o/ml). The neutron-scattering experiment is described elsewhere.H Activity Measurements The isolated native subunits are tested with the poly(U)-dependent poly(Phe) synthesis system, as are the reconstituted subunits from the pilot reconstitution experiments. The samples for neutron experiments are tested using the peptidyltransferase assay before and after exposure to the neutron beam. This assay is chosen because it is performed at 0 °, thus preventing a possible reactivation of the measured samples during the assay. Poly(U)-Dependent Poly(Phe) Synthesis
Materials Energy mix: 62.5 m M Tris-HC1, pH 7.8, 8.5 m M magnesium acetate, 160 m M NH4C1, 9 m M ATP, 0.3 m M G T P , 30 m M phosphoenolpyruvate, 24 m M 2-mercaptoethanol TloM~oSI-I6buffer: l0 m M Tris-HC1, pH 7.5, l0 m M magnesium acetate, 6 m M 2-mercaptoethanol Pyruvate kinase (Boehringer Mannheim, FRG; Cat. No. 128 163; 1 mg per milliliter of water) Bulk tRNA from E. coli, 20 mg per milliliter Poly(U)-[14C]Phe mix: 500/zM Phe with 100,000 clam [~4C]Phe (500 Ci/mol) and 100 #g poly(U) per 20/A S 150 enzymes in Tl0MtoSI-I6buffer2 30S subunits in T~0MtoNl0oSI-I6 (10 m M Tris-HC1, l0 m M magnesium acetate, 100 m M NH4C1, and 6 m M 2-mercaptoethanol) Glass filters No. 6, diameter 23 m m (Schleicher & Schuell, Dassel, FRG) BSA solution, l g/100 ml water Trichloroacetic acid (TCA), 5% (w/v) Ether-ethanol, 1 : 1 Scintillation cocktail Ready Solv EP (Beckman, Munich, FRG; Cat. No. 158 729)
Procedure. Poly(U) mix sufficient for all 30 assays of one experimental run is freshly prepared: Poly(U)- [14C]Phe mix Energy mix
600 pl 600/d
" K. H. Nierhaus, R. Lietzke, R. P. May, V. Nowotny, H. Schulze, K. Simpson, P. Wurmbach, and H. B. Stuhrmann, Proc. Natl. Acad. Sci. U.S.A. 80, 2889 (1983).
146
OTHER BIOPHYSICAL METHODS
S 150 enzymes (optimized for each preparation) plus T~0M~oSH6buffer Pyruvate kinase tRNA 30S subunits (30 A2~ounits) in TloMIoNIooSH6 buffer plus TioMloN10oSI-I~ Poly(U) mix
[8]
950/zl 90 pl 60 pl
100 #1 2400/A
To 80/zl poly(U) mix a 40/zl aliquot of the reconstitution assay solution containing 1 A2~o unit of reconstituted particles is added. The final concentrations are 20 m M Tris-HC1, pH 7.8, 11 m M magnesium acetate, 160 m M NH4C1, 5 m M 2-mercaptoethanol, 83.33/zM phenylalanine, 1.5 m M ATP, 0.05 m M GTP, and 5 m M phosphoenolpyruvate. In addition the 120/zl assay solution contains 100/zg poly(U), 3/zg pyruvate kinase, and 40/tg bulk tRNA from E. coll. After incubation (30 ° for 45 min) 1 drop of BSA solution and 2 ml 5% TCA are added. The samples are heated for 15 min at 90 °C. The polymerized material (longer than Phe4) is collected on glass filters. The filter-adsorbed material is washed twice with 5% TCA and with ether: ethanol (1 : 1). The filters are counted in 4 ml of Readi Solv EP scintillation cocktail. Peptidyltransferase Assay Materials
Ion mix: 1.5 M KC1, 160 m M Tris-HC1, pH 7.8, 40 m M magnesium acetate Ac[3H]Leu-tRNA: bulk tRNA is taken and charged with [3H]Leu. The tRNA mixture is then acetylated 12and stored in small portions (50/zl/tube) with 50,000 cpm//d Ethyl acetate 0.3 M sodium acetate in water saturated with MgSO4, pH 5.5 (at room temperature) Puromycin (Serva, Heidelberg, FRG; Cat. No. 33835) solution: 1 mg/ml in ethanol Ethanol Procedure. For each assay a mix is prepared of 40/tl ion mix, 40/zl H20 with 50,000 cpm Ac[3H]Leu-tRNA (about 1 #1) and 1 A26o unit of 50S particles diluted in 80/zl of Rec20 buffer. The reaction starts with the ~2A. L. Haenni and F. Chapcvill¢, Biochim. Biophys. Acta 114, 135 (1966).
[8]
PREPARATION OF 50S FOR NEUTRON SCATTERING
147
addition of 80/zl puromycin solution. The assay is incubated for 45 min at 0 °. The addition of 150#l of 0.3 M sodium acetate solution stops the reaction. The reaction product is extracted with ethyl acetate. One milliliter ethyl acetate is added to each sample and mixed vigorously (Vortex) for more than 30 sec. After 5 min at 0 ° (phase separation), 700/~l of the upper organic phase is carefully withdrawn, added to 5 ml of a scintillation cocktail, and counted. A sample with native 50S subunits serves as the 100% value; as a blank we take a sample of native 50S where 80 ~l ethanol was added instead of the puromycin solution. Usually, the native 50S subunits convert 40 to 50% of the input radiolabeled material to Ac[aH] Leu-puromycin. Yields and Etiiciencies
Escherichia coli cells are grown in a 100-liter fermenter containing deuterated medium. Each fermentation yields 300 to 400 g cell material. From l g of cells we isolate about 300 A2~o units of crude 70S ribosomes. The separation of the ribosomes is done via zonal centrifugation. Each zonal run is loaded with 10,000 A2~o units of the crude 70S and yields 2,400 A260units of 50S subunits and l, 100,4260 units of 30S. From the 50S subunits the (23S + 5S) rRNA yield is near 80%, whereas only 60 to 70% of the TPS0 can be recovered. The D 2 0 content of the 84% D20 medium is decreased to 83% after fermentation and recycling; it can be raised again to 84% by addition of 6.25 liters of 100% D20 per 100 liters. Likewise, the 76% medium falls to 75% and is raised to 76% again by addition of 4.2 liters of pure D20 per 100 liters. Nucleic acids from the 76% fermentation and proteins from the 84% fermentation batch show a match point at about 90% on the D20 scale. This value allows a contrast variation. 13 The D20 content in the measured sample can easily be varied above and below this 90% value, which would be impossible with buffer solutions, if the particles would match at 100% D20.
For the preparation of one particle, we start with deuterated 1600 `426o units of (23S + 5S) rRNA (67 mg) and the optimal amounts of TP50 (about 2000 eu TPS0; 200 .423o = 44 mg protein). After the separation of unbound material and the collection of reconstituted 50S subunits from the zonal purification run, we find recoveries of 500 to 700 -426o units of 50S subunits (30 to 45 mg), which are diluted to a volume of 1.1 ml and then measured with the camera D11 at the Institut von Laue-Langevin, Grenoble, France. The activities of the measured particles are between 50 and 100% that of native 50S subunits. 13K. Ibel and H. B. Stuhrmann, J. Mol. Biol. 93, 55 (1975).
148
OTHER BIOPHYSICAL METHODS
[9]
[9] Nuclear Magnetic Resonance Techniques for Studying Structure and Function of Ribosomes B y V. N. BUSHUEV and A. T. GUDKOV
The ribosome is a multicomponent ribonucleoprotein complex. Its importance in protein biosynthesis and its very complex structure have given rise to numerous studies of ribosomes using different techniques and approaches (see, for example, Refs. 1 and 2). Nonetheless, many details of the structure and function of the ribosome are not well understood and require further investigation. Although high-resolution nuclear magnetic resonance (NMR) spectroscopy finds increasing applications in biology,3,4 until recently it had not been used for studies of the ribosome. The physical principles on which NMR spectroscopy is based are given in numerous monographs and reviews3-6 and are outside the scope of this paper. It should be noted, however, that most progress has been reached in NMR studies of proteins with Mr up to 20,000. Such a situation is primarily due to the complicated interpretation of NMR spectra for large proteins. An increase in the mass (number of amino acid residues) leads to an increase in the number of signals with the result that peaks overlap and dipolar line broadening occurs because of the large correlation time for such proteins. Calculations have shown that, for proteins with Mr 500,000 (if considered to be in a compact spherical form), the linewidth must be more than 100 Hz. 4 Therefore narrow lines in NMR spectra of large proteins can indicate internally mobile protein segments or amino acid residues. The existence of such mobile segments in high-molecular-mass proteins and complexes including ribosomes has been shown. 7- l0 I G. Chambliss et al. (eds.), "Ribosomes: Structure, Function and Genetics." University Park Press, Baltimore,Maryland, 1980. 2This series, Vols. 29, 30, 59, 60, and elsewherein this volume. 3I. D. Campbelland C. M. Dobson,Methods Biochem. Anal. 25, 1 (1979). 40. Jardetzloland G. C. K. Roberts, "NMR in MolecularBiology."AcademicPress, New York, 1981. s K. Wfithrich,"NMR in BiologicalResearch:Peptidesand Protein." North-Holland,Amsterdam, 1976. 6G. Wagner,Q. Rev. Biophys. 16, 1 (1983). J. L. De Wit, M. A. Hemninga,and T. J. Schaafsma,J. Magn. Reson. 31, 97 (1978). s R. Perham, H. Duckworth,R. Jaenicke,and G. C. K. Roberts,Nature (London) 292, 474 (1981). 9T. R. Tritton,FEBS Lett. 120, 141 (1980). ,o V. N. Bushuev,M. L. Metsis, A. D. Morozkin, E. K. Ruuge, N. F. Sepetov, and V. E. Koteliansky,FEBSLett. 189, 276 (1985). METHODS 1N ENZYMOLOGY, VOL. 164
English translation copyright © 1988 by Academic Press, Inc.
[9]
N M R STUDIES OF RIBOSOMES
149
In the case of compact and very tight protein packing in ribosomes, it is impossible to use NMR for studies of such large ribonucleoprotein (RNP) complexes ( - 2.5 X 10*) due to the very broad fines in the NMR spectra. However, in ~H NMR spectra of ribosomes there are narrow lines which are attributed to ribosomal proteins and this permits the use of NMR techniques for the study of some proteins in the ribosome. Materials 70S ribosomes and their subunits were prepared from Escherichia coli MRE 600.~,~2 The L7/L12 proteins were isolated from 50S subunits.t3 50S particles deprived of L7/L12 proteins were obtained by treatment of intact subunits with 50% ethanol. ~4 The complex of L7/LI2 proteins with LI0 protein was isolated from the mixture of individual proteins ~5 by gel filtration using a Sephadex G-100 column. Elongation factor G (EF-G) was prepared from E. coli MRE 600 according to Rohrbach et al. ~6 Uncleavable GTP analogs, [3H] GMPPCP and [3H]GMPPNHP, were from Amersham (England). Buffer. Sodium phosphate, 1 or 2 raM, pH 7.4-7.6 (without correction for isotopic effect) with l0 m M MgC12 and 50 to 175 m M KC1 in heavy w a t e r (2H20).
Sample Preparation The association of ribosomal subunits (percentage of 70S ribosomes) in the samples was checked in an analytical ultracentrifuge UCA-10 (USSR) equipped with absorption optics. Samples where subunit association was less than 80% were not studied. Ribosomes and their subunits were transferred into heavy water either by dialysis or using small (1.5- 2 ml) columns of Sephadex G-25, the latter procedure being timesaving and more economical. The protein complex (LT/L12)4-L10 was transferred into heavy water by dialysis, or using Sephadex G-25 columns, or by dissolving in 2H20 after lyophilization from sodium phosphate buffer with 100-150 m M potassium chloride. In all three cases the NMR spectra were identical. *~ M. I. Lerman, A. S. Spirin, L. P. Gavrilova, and V. F. Golov, J. Mol. Biol. 15, 268 (1966). t2 L. P. Gavrilova, D. A. Ivanov, and A. S. Spirin, J. Mol. Biol. 16, 473 (1966). 13 W. M611er, A. Groene, C. Terhorst, and R. Amons, Eur. £ Biochem. 25, 5 (1972). t4 E. Hamel, H. Koka, and T. Nakamoto, J. Biol. Chem. 247, 805 (1972). 15 A. T. Gudkov, L. G. Tumanova, S. Y. Venyaminov, and N. N. Khechinashvili, FEBSLett. 93, 215 (1978). 16 M. S. Rohrbach, M. E. Demsey, and J. W. Bodley, J. Biol. Chem. 249, 5094 (1974).
150
OTHER BIOPHYSICALMETHODS
[9]
Ribosomal complexes with EF-G were obtained according to InoueYokosawa et al. ~7 and Lin et al. ~s The amount of ribosomal complexes with EF-G and the uncleavable GTP analog was determined by nitrocellulose filter binding techniques~8; the yield was about 50-60%. NMR Measurements ~H NMR spectra were recorded in Bruker WH-360 and Bruker WM-500 spectrometers operating at 360 and 500 MHz, respectively, in the Fourier transform mode, using standard 5-ram ampoules at 22"-27". Chemical shifts were measured in parts per million downfield from the internal reference. 2,2-dimethyl-2-silapentane sodium sulfate. Since the ribosomal ~H NMR spectrum exhibits broad resonance lines (more than 1 kHz), a wide spectral width from 20,000 up to 30,000 Hz was utilized to obtain qualitative spectra and the computer block size was 32K. A 70* flip angle was applied. The cross-saturation method was used to reveal sharp resonances of highly mobile components in the ribosomal spectra. ,9.2o The cross-saturation experiments were performed in the homonuelear gated decoupling mode. A presaturation pulse for 1 sec was applied at a frequency corresponding to the HDO solution signal. A 70* sampling pulse was applied after the saturation pulse. The concentration of 70S ribosomes and their subunits was between 5 and 20 mg/ml. Depending on the concentration, the number of scans was between 2,000 and 60,000. 1H N M R Spectra of Ribosomes and T h e i r Subunits The ~H NMR spectra of E. coli 30S and 50S subunits and 70S ribosomes (Fig. 1A-C) represent a superposition of sharp and broad (wider than 1 kHz) lines, indicating the difference between the mobilities of amino acid side chains of several proteins. Sharp resonance lines are due to the protons of the amino acids belonging to those parts of the polypeptide chain of the protein which exhibit a significantly higher mobility than the motion of the particle as a whole. A full set of spectra for all the individual ribosomal proteins facilitated a preliminary analysis of the ribosomal ~H NMR spectra and this, together with the known data on the structure of ribosomes, t permitted us to single 17 N. Inoue-Yokosawa, C. Ishikawa, and Y. Kaziro, J. Biol. Chem. 249, 4321 (1974). 18 L. Lin and J. W. Bodley, J. Biol. Chem. 251, 1795 (1976). 19K. Akasaka, M. Konrad, and K. Goody, FEBS Lett. 96, 287 (1978). 2o K. Akasaka, J. Magn. Reson. 51, 14 (1983).
[9]
N M R STUDIES OF RIBOSOMES
151
/ B
t
12
I0
8
6
4
1
• 2
~
1 0
i
_ l -2
J
~ -4
8 ppm) FIG. 1. 360-MHz IH NMR spectra of ribosomal subparticles at 22 °. (A) 30S subunits, 7 mg/ml, 5700 transients; (B) 50S subunits, 10 mg/ml, 3100 transients; (C) 70S ribosomes, 10 mg/ml, 3000 transients; (D) 50S subunits without LT/L12 proteins, 5.3 mg/ml, 55,000 transients. From Gudkov et al. n
out those proteins for which sharp signals in the ribosomal spectra are most probable. In the case of 30S subunits the sharp lines in their spectra, from a logical standpoint, may be due to S1 protein. The spectra of intact 30S subparticles and those of particles lacking S 1 protein testify in favor of this assumption. 2t Removal of this protein leads to a significant decrease of the intensity of sharp lines in the spectra of 30S subunits, though they do not disappear completely. Consequently, besides S1 protein in the 30S particle there must also be mobile parts in other proteins. The most mobile proteins of the 50S subunit are L7/L12 proteins, 22 four copies of which are present in the particles. 23 Removal of these proteins is readily performed and does not lead to a significant injury of the 50S subparticles. '4 In the spectrum of 50S particles lacking the LT/L12 proteins the intensity of sharp signals is essentially suppressed (cf. Fig. 1B and D) and the ratios between the intensities of different lines are changed. 21 C. A. Cowgill, B. G. Nickols, J. W. Kenny, P. Butler, E. M. Bradbury, and R. R. Traut, J. Biol. Chem. 259, 15257 (1984). 22A. T. Gudkov, G. M. Gongadze, V. N. Bushuev, and M. S. Okon, F E B S Lett. 138, 229 (1982). 23S. J. S. Hardy, Mol. Gen. Genet. 140, 253 (1975).
152
OTHER BIOPHYSICAL METHODS
[9]
This is a direct indication that these proteins are the most mobile in the subunit. It should be noted (Fig. 1 A and B) that the sharp signals in the spectra of 50S particles have a higher intensity than those in the spectrum of the small subunit. This is evidence that the 50S particle contains more amino acid residues exhibiting a higher independent mobility than the ribosomal particle as a whole. Comparison of the spectra of 70S ribosomes (Fig. 1C) with the spectra of 30S (Fig. 1A) and 50S (Fig. 1B) subunits reveals that the spectrum of 70S ribosomes virtually coincides with that of 50S particles. This is seen clearly from a comparison of the spectra of 50S particles and of 70S ribosomes (Fig. 2C and D) in which the broad component is suppressed by cross-saturation. Consequently, the principal contribution to the sharp resonance signals in the IH NMR spectrum of 70S ribosomes is from the same proteins as in the spectrum of 50S subunits, i.e., from L7/L12 proteins, while the contribution from S 1 protein of the small subunit is insignificant.
Phe
Phe 54 30
•
J 7.5
x8
I 6.5
I 3
I 2
I 1
J 0
8 (ppm) FIG. 2. 360-MHz ~H NMR spectraat 22 °. (A) L7/LI2 proteins, 3 mg/ml; (B) (L7)4-L10 complex, 2 mg/ml; (C) 50S subunits, I0 mg/ml; (D) 70S ribosomes, I0 mg/ml. Spectra C and D were obtained in a gated decoupling mode; the presaturation pulse was applied for 1 sec at a frequency (f2) corresponding to the tEK) signal. From Gudkov et a[.22
[9]
N M R STUDIES OF RIBOSOMES
153
Since the subunits are almost fully associated with each other (from sedimentation data), and signals from the 30S and 50S subunits must be present in the spectrum of 70S ribosomes, it may be asserted that interaction of the ribosomal subunits leads to no significant changes of the most mobile ribosomal protein component. This primarily concerns L7/L12 proteins, while S l protein as a mobile component of the 30S subunit may prove to be less mobile in the 70S ribosomes than in the subunlt. To understand the basis of such a high mobility of L7/LI2 proteins in the ribosomes there must be knowledge of their structural features. It is known that L7/L12 proteins in solution form a stable dimer 13 and that its structure is symmetric.24 Dimerization results from interaction of the Nterminal segment of L7/LI2 proteins,25 while the globular C-terminal moiety in the dimer is free and takes no part in the dimerization. L7/L12 proteins form a complex with L10 protein26 through which they are attached to the ribosome. Spectral analysis of the dimer of L7/LI 2 protein and of the pentameric complex (L7)4-L10 (Fig. 2A and B) reveals that only signals from L7 protein are present in the spectrum of the complex. This may be explained both by the lower molar concentration of L 10 protein in the complex and by broadening of all the signals from L10 protein in the complex. When protein L7/L12 is attached to L10 protein the signals from the amino acid residues in the N-terminal segment undergo the most changes. Signals from the ring protons of residue Phe 3° (7.3 ppm), from the methyl groups of residues Met 14, Me¢ 7, Met 26, and of the N-terminal Ac-Ser~(2 ppm) are broadened to such an extent that they are not observed in the spectrum of the complex. The least changed are signals of residues in the C-terminal globular segment, for example, Phe ~, high-field signals (0.63 and 0.72 ppm), and resonances from the e-CH2 (3 ppm) groups oflysine residues. Of the 13 lysine residues in the protein only two (Lys4 and Lys29)27 are in the N-terminal segment taking part in the dimerization. Thus, in the complex of L10 and L7/L12 the globular part of L7/LI 2 protein is mobile and does not participate in the interaction with L10. We arrive at the same conclusion from a comparison of the spectra of L7/L12 dimers, their complex with Ll0, the spectra of 50S particles and of 70S ribosomes. A comparison of the spectra (Fig. 2B-D) of the pentameric complex (L7)4-L10 with the spectra of 50S subunits and 70S ribosomes points to their extraordinary identity even in detail. Consequently, in the 24 V. N. Busheuv, N. F. Sepetov, and A. T. Gudkov, FEBSLett. 178, 101 (1984). 25 A. T. Gudkov and J. Behlke, Fur. J. Biochem. 90, 309 (1978). 26 A. T. Gudkov, L. G. Tumanova, G. M. Gongadze, and V. N. Bushuev, FEBSLett. 109, 34 (1980). 27 C. Terhorst, W. M611er, R. Laursen, and B. Wittmann-Liebold, FEBS Lett. 28, 325 (1972).
154
OTHER BIOPHYSICAL METHODS
[9]
spectra of 50S and 70S particles the C-terminal globular segment of L7 protein also represents a highly mobile domain. Since the spectra of the 50S subparticles and of the 70S ribosomes are almost identical, the conclusion may be drawn that L7/L12 proteins (at least their C-terminal segment) do not participate in association of the ribosome subunits and that in the absence of translation factors and of messenger RNA they exhibit a high mobility within the ribosomes. Effect of Elongation Factor on the Structure of Proteins L7/L12 in the Ribosome Since L7/L 12 proteins have a considerable intramolecular mobility in the ribosome (see above) and affect the function of the elongation factors (for a review, see Ref. 28), it would be interesting to follow the influence of the factors on the properties of L7/L 12 proteins in the ribosome. EF-G is the best suited for this task, since together with the uncleavable GTP analogs it forms quite a stable complex with the ribosome) 7 The spectrum of EF-G in solution (Fig. 3F) has broader and less well resolved lines than the L7/L 12 spectrum in the ribosome (Fig. 3A and Fig. 2C,D). The spectrum of the 50S subunit with added EF-G is an additive sum of their spectra. This is confirmed by the difference spectra (Fig. 3E) obtained by subtraction of the 50S subunit spectrum (Fig. 3A) from the spectrum of the 50S subunit with EF-G (Fig. 3B) which virtually coincides with the EF-G spectrum in solution (Fig. 3F). This result shows that there is no interaction of EF-G with the 50S subunits in the absence of GTP, and this is in line with the known data. There are some changes in the spectrum of 50S subunits as a result of addition of EF-G and GMPPNHP in the range of 0.6- 1.4 ppm. Most of the Val, Leu, lie, and Thr methyl group signals are located in this range. These changes are seen more distinctly in the difference spectrum (Fig. 3D). The positive signals in the spectrum (Fig. 3D) are from the contribution of EF-G. Some of the L7/L12 signals in the spectrum (Fig. 3D) became negative as the intensity of these signals decreased after the interaction of ribosomes with the EF-G and GMPPNHP. Consequently, the interaction of subunits with EF-G leads to immobilization of the proteins L7/L12. The binding of EF-G to the 70S ribosome exerts a much greater effect on the L7/L12 spectrum in situ (Fig. 4). The addition of EF-G to the 70S ribosomes, even without the uncleavable analog of GTP, leads to changes in the narrow signals of L7/L12 analogous to those occurring in the 50S 2sA. Liljas,Prog. Biophys. Mol. Biol. 40, 161 (1982).
[9]
N M R STUDIES OF RIBOSOMES
155
f
fi'// i i
[
9
]
I
7
I
I
I
5
L
3
I
\,
i
I
I
0
Ij
-
8 (ppm) FIG. 3. 500-MHz proton NMR spectra at 27 °. (A) 50S subunits, 7.2 mg/ml; (B) the same as A, but with EF-G; (C) the same as A, but with EF-G and GMPPNHP; (D) C minus A difference spectrum; (E) B minus A difference spectrum; (F) spectrum of EF-G. Spectra A - C are normalized to the same ribosomal subparticle concentration as that of the 50S.
particles with EF-G and the GTP analog (Fig. 4D, compare also with Fig. 3D). This indicates that the 70S ribosomes interact weakly with EF-G without GTP, whereas the 50S particles do not interact at all. Such an interaction of the 70S ribosome with EF-G has been shown also by other approaches.~S Addition of EF-G and the GTP analog to 70S ribosomes leads essentiaUy to a decrease in L7/L12 signal intensity in the NMR spectrum (Fig. 4C). This can be seen clearly from the difference spectrum (Fig. 4E) obtained by subtraction of the 70S ribosome spectrum (Fig. 4A) from that of the complex (Fig. 4C). After GMPPNHP addition, virtually all the lines become broader; this is expressed in reversed signals (they become negative) in the Fig. 4E difference spectrum. The positive component in the Fig. 4E spectrum is lower than that in the Fig. 4D spectrum. This can be explained by immobilization of not only L7/L 12 proteins but also of EF-G after formation of the complex between EF-G, ribosomes, and the uncleavable GTP analog.
156
OTHER BIOPHYSICAL METHODS
[9]
c
1
9
I
I
7
I
I
I
5
I
3
I
I
I
I
0
I
-I
8 (ppm) FIG. 4. 500-MHz proton NMR spectra. (A) 70S ribosomes, 18 mg/ml; (B) the same as A, but with EF-G; (C) the same as A, but with EF-G and GMPPNHP; (D) B minus A difference spectrum; (E) C minus A difference spectrum. Spectra A - C are normalized to the same ribosomal concentration as that of the 70S.
In the ternary complex of EF-G, ribosomes, and GMPPNHP, the L7/LI2 proteins are the first to change. This is seen from a comparison of the difference spectrum (Fig. 4E) and the spectrum of the L7 dimer (Fig. 2D). In the spectrum (Fig. 4E) there are signals characteristic for L7 protein, namely those from ring protons of Phe 54 (7.2 ppm), signals in the high field (0.63 and 0.72 ppm), and a number of resonances from methyl groups of apolar amino acids (1.4, 1.2, 0.9 ppm) and also the ~-CHz group of lysine (3 ppm). Immobilization of L7/L12 proteins in the ribosome cannot be explained by direct interaction of EF-G with these proteins. In such a case, the effect of EF-G on the mobility of L7/L12 in the 50S subunit as well as in the 70S ribosome would be equal. Neither is there any interaction of EF-G with the pentameric complex of (L7/L 12)4-L 10. It must be considered also that, despite the binding of EF-G in the proximity of the L7/L 12 stalk,z9 it is known that EF-G interacts with the ribosome (though not so well) without L7/L123° and even with 23S RNA. 31 29A. S. Girshovich, T. V. Kurtsldmlia, Y. A, Ovchinnikov, and V. D. Vasiliev, F E B S Lett. 130, 54 (1981). 3oV. E. Koteliansky, S. P. Domogatsky, A. T. Gudkov, and A. S. Spirin, F E B S Left. 73, 6 (1977). 3~A. S. Girshovich, E. S. Bochkareva, and A. T. Gudkov, FEBSLett. 159, 99 (1982).
[9]
N M R STUDIES OF RIBOSOMES
157
More probably the interaction of EF-G with L7/LI 2 and, as a result, their immobilization is a consequence of some essential eonformational changes in the ribosomal components after EF-G binding. It should be noted that a very distinct result of interaction was observed for the ternary complex, EF-G-ribosome-uncleavable GTP analog, i.e., this pertains to the functional state of L7/L12 in the ribosome after EF-G binding, but before GTP hydrolysis. There is a possibility of obtaining a complex of the ribosome with EF-G and GDP in the presence of fusidie acid, i.e., to study the complex after GTP hydrolysis. Unfortunately, the numerous resonance signals in the ~H NMR spectrum of fusidic acid prevent a reliable interpretation of the ribosomal ~H NMR spectra in the presence of fusidic acid. At the same time, limited proteolysis of the ribosomal complex with EF-G indicates that proteins L7/L 12 change their conformation in the complex with the uncleavable GTP analog and return to their initial state after GTP hydrolysis in the presence of fusidic acid and EF-G. 32 Since the studied complexes with GTP and EF-G are functional, it can be assumed, from the totality of data, that the ribosome and/or its components in the process of translocation undergo structural changes, at least in the L7/L12 domain, and after translocation and GTP hydrolysis the ribosome returns to the initial state.
Summary The following conclusions can be drawn from the use of NMR techniques for studies of ribosomes: 1. The majority of ribosomal proteins are rigidly fixed within the particles, and the most mobile components in the isolated ribosome are L7/L 12 proteins from the large subunit. 2. Interaction of EF-G with ribosomes results in some changes in ribosomal domains, and, particularly, immobilization of L7/L12 proteins takes place. The changes may pertain to the translocation reaction, since complexes with ribosomes, EF-G, and GTP are functional. The results of these studies using IH NMR show that structural studies with this technique are limited as only a few proteins express their resonances in the 1H NMR spectra (S 1, L7/L12). At the same time such studies are not exhaustive, since only the simplest samples were studied (ribosomes, the ribosomal complex with EF-G). Complexes with other ligands (tRNA, EF-Tu) have not yet been studied. It is also possible to enhance the resolution of ~H NMR techniques with the help of deuterated factors, 32 A. T. Gudkov and G. M. Gongadze, F E B S Left. 176, 32 (1984).
158
OTHER BIOPHYSICAL METHODS
[ 10]
ribosomes, and proteins, and to adapt the use of NMR to other nuclei (e.g., the use of fluorinated labels or incorporation of fluoroamino acids into the proteins). Many other approaches using NMR in biology have still to be explored. Therefore it is hoped that the use of NMR techniques will prove to be very useful in studies of the different functional steps of protein biosynthesis.
[10] P r e p a r a t i o n o f 5 S R N A - R e l a t e d M a t e r i a l s f o r Nuclear Magnetic Resonance and Crystallography Studies B y PETER B. MOORE, STEVEN ABO, BETTY FREEBORN, DANIEL T. GEWIRTH, NEOCLES B. LEONTIS, a n d GRACE SUN
For the past several years, we have been investigating the structure of 5S RNA and its protein complexes using NMR and crystallography. Both of these techniques are notorious for the rate at which they consume materials. A typical sample of 5S RNA for IH NMR, for example, contains 20 mg of RNA, and a serious investigation may require dozens of samples. The fact that NMR is nondestructive, and that samples can be reused is helpful, but the need for large amounts of material remains. In this context, bacterial strains capable of overproducing the materials of interest are more than a mere convenience. They make experiments possible which differ qualitatively from those an investigator with finite resources would seriously contemplate if dependent on wild-type strains only. Below are described the techniques we use for purifying and manipulating 5S RNA and its various nucleolytic fragments, taking advantage of the availability of 5S RNA-overproducing strains. (Those interested in preparing 5S RNA from wild-type strains may consult Refs. 1 and 2, which have appeared earlier in this series, or a recent publication from this laboratory. 3) All the preparations described yield NMR-scale quantities of end product.
i R. Monier and J. Feunteun, this series, Vol. 20, p. 494. 2 R. A. Zimmermann, this series, Vol. 59, p. 551. 3 M. J. Kime and P. B. Moore, Nucleic Acids Res. 10, 4973 (1982).
METHODSIN ENZYMOLOGY,VOL. 164
Copyrisht© 1988byAcademicPress,Inc. Allfightsofreproductionin any formreserved.
158
OTHER BIOPHYSICAL METHODS
[ 10]
ribosomes, and proteins, and to adapt the use of NMR to other nuclei (e.g., the use of fluorinated labels or incorporation of fluoroamino acids into the proteins). Many other approaches using NMR in biology have still to be explored. Therefore it is hoped that the use of NMR techniques will prove to be very useful in studies of the different functional steps of protein biosynthesis.
[10] P r e p a r a t i o n o f 5 S R N A - R e l a t e d M a t e r i a l s f o r Nuclear Magnetic Resonance and Crystallography Studies B y PETER B. MOORE, STEVEN ABO, BETTY FREEBORN, DANIEL T. GEWIRTH, NEOCLES B. LEONTIS, a n d GRACE SUN
For the past several years, we have been investigating the structure of 5S RNA and its protein complexes using NMR and crystallography. Both of these techniques are notorious for the rate at which they consume materials. A typical sample of 5S RNA for IH NMR, for example, contains 20 mg of RNA, and a serious investigation may require dozens of samples. The fact that NMR is nondestructive, and that samples can be reused is helpful, but the need for large amounts of material remains. In this context, bacterial strains capable of overproducing the materials of interest are more than a mere convenience. They make experiments possible which differ qualitatively from those an investigator with finite resources would seriously contemplate if dependent on wild-type strains only. Below are described the techniques we use for purifying and manipulating 5S RNA and its various nucleolytic fragments, taking advantage of the availability of 5S RNA-overproducing strains. (Those interested in preparing 5S RNA from wild-type strains may consult Refs. 1 and 2, which have appeared earlier in this series, or a recent publication from this laboratory. 3) All the preparations described yield NMR-scale quantities of end product.
i R. Monier and J. Feunteun, this series, Vol. 20, p. 494. 2 R. A. Zimmermann, this series, Vol. 59, p. 551. 3 M. J. Kime and P. B. Moore, Nucleic Acids Res. 10, 4973 (1982).
METHODSIN ENZYMOLOGY,VOL. 164
Copyrisht© 1988byAcademicPress,Inc. Allfightsofreproductionin any formreserved.
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
159
Growth of H B 101/pKK5-1 Most of the 5S RNA we use is the product of the overproducing plasmid pKK5-1 which carries the rrnB 5S cistron. 4 For routine production of 5S RNA it is grown in Escherichia coli HB101 using a supplemented L broth as the medium.
Medium (concentration/liter) Bactotryptone Yeast extract NaCI Glucose 1 N NaOH (to set medium to pH 7.4) Adenosine Uridine 0.2% amipicillin
10 g 5g 10 g 1g 1 ml 0.2 g 0.2 g 10 ml
Ampicillin hydrolyzes if autoclaved. Stock solutions are made up, sterilized by filtration, and can be stored for up to 1 week at 4*. AmpiciUin should be added to media only after they have cooled following autoclaving, and media containing ampicillin should not be stored for more than a day or two prior to use. The adenosine and uridine required are dissolved in a modest amount of water, sterilized by filtration, and, like the ampicillin, added to the medium after it has cooled. The medium includes ampicillin to maintain the plasmid in the host, the plasmid being a cartier of a gene for ampicillin resistance, a gene the host lacks. The supplementation with adenosine and uridine ensures that the ability of the cells to synthesize RNA during overproduction is not limited by the supply of precursors. Stocks of HB 101/pKK5-1 are maintained at - 80 ° as glycerol freezes. It is best to start cultures from single colonies picked from L broth-ampicillin plates inoculated with aliquots of the frozen stocks. Cells are grown at 37 ° until the optical density of the culture reaches 1.5 at 550 nm (about 10 9 cells/ml). At that point 50 mg/liter of chloramphenicol is added to stimulate overproduction. We find that 4 hr of"growth" following the addition of chloramphenicol gives the best yield of 5S RNA. These procedures work satisfactorily for production runs in a 2001 fermentor. tSN Labeling of 5S R N A The information extractable from the physical study of macromolecules can be increased substantially if the molecules of interest can be 4j. Brosius, Gene27, 161 (1984).
160
[ 10]
OTHER BIOPHYSICAL METHODS
labeled with stable isotopes such as 2H, ~3C,or ~SN. Since substitution levels often must exceed 50% at the locations of interest to be useful, and since heavily enriched precursors are costly, the expense of preparing labeled macromolecules is a major barrier to their use. The benefits of using overproducing strains in this context are obvious. A 10-fold overproducer makes a $500 experiment out of one which would otherwise cost $5000 in isotopes. We have done a number of experiments using 5S RNA uniformly labeled with ~SN. Cells are grown on a minimal medium where the sole source of nitrogen is a cheap, 'SN-containing compound. The one we use is 99% 15N-enriched NH4CI (MSD Isotopes, St. Louis, MO), which currently costs $80/g. The RNA derived from these cells is, of course, 99% 'SN labeled at all positions. HB101, the "normal" host for pKK5-1, does not grow on minimal media. In order to take advantage of pKK5-1 for 15N labeling, it must be transduced into a host which is prototrophic. The one we use is E. coli NG135 which carries the markers strA, gal-$165, and recA 56. 5 The recA trait is important since it reduces the probability that recombination will take place between the plasmid and the chromosome of the host. pKK5-1 DNA was purified from HBI01/pKK5-1 and transduced into NGI35 using standard methods? Transductants were selected on ampicillin-containing plates. The only difficulty in carrying out the transfer of pKK5-1 from HB 101 to NG135 arises from the fact that HB101-produced DNA is restricted by NG135. In order to get a reasonable number of transductants, about 100 times the amount of plasmid DNA called for in standard protocols is required. We have found that glycerol freezes of NG135/pKK5-1 made from cultures grown on minimal medium are not viable while those made with cells grown on broth are. The first step in growing this strain, therefore, is to plate the glycerol freeze material on minimal plates containing ampicillin. A single colony is then used to start the overnight culture.
lSN Medium (concentration~liter) KH2PO4 Na2HPO4 15NH4C1 NaC1 20% glucose
3g 6g 0.3 g 0.5 g 20 ml
5 N. D. F. Grindley and C. M. Joyce, Proc. Natl. acad. Sci. U.S.A. 77, 7176 (1980). 6 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloninig A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982.
[ 10]
5 S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
1 M MgSO4" 7H20 0.2% ampicillin 0.01 M CaCI2
161
1.0 ml 10 ml 10 ml
The glucose, MgSO4, and CaCI2 solutions must be autoclaved separately. Ampicillin solution is added to the medium after cooling, as usual. The pH of the medium should be about 7.5. The overnight culture is grown in the medium described above except that 1 g/liter of 14NH4C1 is used instead of ~SNH4C1. The day the full-scale culture is to be grown, the cells in the overnight culture are spun down and resuspended in the isotope-containing medium. The level of NH4C1 in this medium is just adequate to support the growth and overproduction required. Cells are allowed to grow at 37 ° until the optical density at 550 nm is 1.5. Chloramphenicol (50 mg/ liter) is then added to induce plasmid replication and overproduction. Two hours of incubation after chloramphenicol addition seems optimal in this case. We find that NG135 must be grown on a shaker. NG135 cells appear to be killed when they are.as vigorously aerated and agitated as they would be in a fermentor. We grow 10 to 20 liters at a time. Purification of 5S R N A The preparation of 5S RNA from chloramphenicol-treated pKK5-1containing cells is straightforward. The cells are broken open; any of the standard methods will do. The ribosomes and cell debris are removed by centrifugation, and the RNA in the supernatant is isolated by phenol extraction. The 5S component of the resulting RNA mixture is purified by chromatography. The protocol outlined below is the one we use for largescale preparations.
Cell Rupture Solutions 10× A: 1 M NH4C1, 0.1 M magnesium acetate, 5 × 10-3 M ethylenediaminetetraacetic acid (EDTA), 3 m M 2-mercaptoethanol, 0.2 M Tris-HC1, pH 7.5 A: the same as above diluted 10-fold with H20 , the pH reset to 7.4, and the mercaptoethanol concentration maintained at 3 m M A convenient tool for breaking bacteria is a device called a "Bead Beater" (Biospec Products, P.O. Box 722, Bartlesville, OK 74005). This instrument is a small, cheap, anaerobic ball mill which uses glass beads as the working abrasive. One hundred and fifty grams of frozen cell paste is thawed in 67 ml of
162
OTHER BIOPHYSICAL METHODS
[ 10]
10X A, 200 mg of lysozyme is added, and the mixture allowed to incubate at 4". The reaction is stopped after 30 rain by the addition of 2 ml of 10% sodium deoxycholate, and a few crystals (about 1 mg) of DNase are added, enough to reduce the viscosity to manageable proportions once the cells have ruptured. A single loading consists of the slurry plus 85 ml of 0.1to 0.11-mm diameter glass beads topped off with additional buffer if necessary to fill the chamber. (The chamber must be full to prevent protein denaturation due to foaming.) The jacket surrounding the chamber is filled with ice and five 30-see cycles of beating carded out. The cell suspension is rinsed out of the chamber using 60 ml of A and centrifuged at slow speed (8,000 rpm for 25 rain, at 4*) to remove the beads and cell debris. The pellets are resuspended in A, subjected to a second round of disruption in the Bead Beater, and centrifuged as before. The supernatants from the two cycles are pooled, and the ribosomes spun out in an ultracentrifuge. Two hours of centrifugation in a Ti60 rotor at 60,000 rpm (4°) suffices. The supernatant contains the products of overproduction. The ribosomal pellet is usually discarded because the amount of 5S RNA it represents is too small to be worth recovering. The glass beads can be reused. After extensive washing with water to remove cell debris, the beads are soaked in 1 N HC1 overnight, and then rinsed with water until the pH returns to neutrality. The beads are then put through an overnight soak in 1 N NaOH followed by a water rinse until the pH again returns to neutrality. They are stored after drying in an oven.
Phenol Extraction Solutions Phenol: "Liquified phenol," the standard commercial product, is redistilled to remove the water it contains, and a variety of colored oxidation products. We keep the fraction which distills between 178" and 182". (Boiling chips are essential to prevent bumping.) The redistilled material is a solid at room temperature, and can be stored in glass bottles at - 2 0 " . It is melted when needed in boiling water, or in a water bath. It must be equilibrated with the buffer to be used in the extraction procedure. A separatory funnel is useful for this purpose. Once equilibrated, and saturated with buffer it remains a liquid at room temperature. Equilibrated phenol is prepared fresh every time it is required. SSC-EDTA: 0.15 MNaC1, 15 m M s o d i u m citrate, 15 mMEDTA, pH 7.0. SDS: 10% (w/v) sodium dodecyl sulfate (Pierce) in SSC-EDTA.
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
163
The RNA contained in the centrifugal superuatant is isolated by phenol extraction. Any of the standard protocols for phenol extraction will work. We do it in the following manner. To the postribosomal supernatant is added 0.1 volumes of SDS solution, and a volume of phenol equal to the volume of the supernatant. The mixture is shaken vigorously for 1 min. We often do this in a l-liter glass bottle with a frosted glass stopper. The suspension is then centrifuged at a few thousand rpm for a minute or two to break the phenol-water emulsion. The upper, aqueous layer is removed, and saved in another bottle on ice. An equal volume of SSC-EDTA is added to the phenol layer, and the mixture shaken, centrifuged, and the water phase saved as before. The two water phases are pooled, and phenolextracted twice more. The nucleic acid in the resulting protein-free solution is recovered by adding 2 volumes of 95% ethanol. The ethanolic solution is allowed to stand for about 1 hr at - 2 0 ° to encourage complete precipitation of RNA. The precipitate is collected by centrifugation at 5000 g for 15 min at 4 °. The RNA pellet is taken up in S-200 buffer (see below), and can be stored indefinitely in that buffer at - 2 0 °. Chromatography Solutions
S-200 buffer: 0.15 M NaCI, 0.1 M sodium acetate, 1% (v/v) methanol, with the pH set to 5.0 using acetic acid The fractionation of crude, low-molecular-weight RNA is conveniently done by chromatography on columns packed with Sephacryl S-200 (Pharmacia). 7 A 5 × 100 cm column is poured and equilibrated with S-200 buffer. A sample in 20 ml or less is applied to the column, and the chromatography carried out at room temperature. We collect 100 16-ml fractions. The RNA elution profile can be monitored by reading the optical density of the undiluted fractions at 300 or 305 nm. A typical example is shown in Fig. 1. When running at rates of around 150 ml/hr, these columns will fractionate up to 10,000 A2~o,m of crude RNA without loss of performance. The resolving power of these S-200 columns degrades after a period of use. The degradation is particularly rapid if the samples being run contain the slightest amount of poorly solubilized material. Columns can be regenerated by washing the Sephacryl according to the manufacturer's instructions. The column is unpacked and the Sephacryl suspended in 0.2 N NaOH at room temperature. The column is then repacked in alkali, and a 7T. H. Kao and D. M. Crothers,Proc. Nate. Acad. Sci. U.S.A. 77, 3360 (1980).
164
[ 10]
OTHER BIOPHYSICAL METHODS
25
c
o
tO CM v
20
>,-
---- 15 Z
p0
5 / x . t / PO
,
I ~ " T ,~ I 40 60 FRACTION NUMBER
, 80
FIG. 1. Chromatography of low-molecular-weight RNAs from HBI01/pKK5-1 on Sephacryl S-200. Several thousand A2~o,m of low-molecular-weight RNA were applied to a 5 × 100 cm column of Sephacryl S-200 and eluted with S-200 buffer (see text). The RNA was derived from HB 10 I/pKK5-1 cells following overproduction as described elsewhere. Sixteenmilliliter fractions were collected. The peak at fraction 60 is 5S RNA. The peak at fraction 70 is tRNA.
bed volume or two of S-200 buffer run through it. The column can be used as soon as the pH returns to 5.0. The yield of 5S RNA at the end of the sequence of steps just outlined can be as high as 7.5 nag (150 A26om) per gram wet weight of cells, which is about 20 times the total amount of 5S RNA present in the ribosomes derived from same amount of starting material. (The yield from cells grown on minimal medium is substantially less, about 2.5 mg/liter of starting medium.) The column product is recovered by ethanol precipitation, and redissolved in S-200 buffer. 5S RNA is stored in this buffer at - 2 0 °. It is exclusively in the A form.
Preparation of Fragment 1
Buffers IX: 0.1 MKC1, 5 m M MgC12, 50 mMtris, 90 m M b o r i c acid, pH 7.8 Fragment buffer: 0.1 M NaCI, 3 m M MgCI2, 0.1 g/liter NAN3, 10 m M cacodylic acid, pH 6.0
[ 10]
5S MATERIALS FOR N M R ANI) CRYSTALLOGRAPHY
165
Limited digestion of 5S RNA with RNase A leads to the production of a fragment of the molecule consisting of bases (1- 11, 69-120) of the parent sequence,s The molecule is called fragment 1, and has a structure similar to that of the same sequences in the parent molecule? The protocol for making this material is as follows. 5S RNA is precipitated with ethanol, and brought up in 1X at a concentration of 20 A26om / m l (nominally 1 mg/ml). The solution is left on ice until the temperature is below 4 °. RNase A is then added at levels between 20 and 0.5 #g/ml. The mixture is allowed to incubate for 45 rain on ice. Digestion is terminated by making the solution 0.1% in SDS, and immediately extracting it with phenol. Three extractions are done to ensure complete removal of the enzyme. The main cleavage points in the 5S sequence under the conditions just described are after C-I 1, and C-68. What is controlled by variation of the RNase concentration is the degree to which the fragment produced is also cleaved at the 87- 89 loop. The lower the enzyme concentration, the larger the fraction of molecules in the preparation unclcaved in that loop. The "penalty" for reduced cleavage in the loop is the appearance of molecules in the population whose cleavage point is to the 5' side of C-68. One chooses the RNase level according to the needs of the experiment for which the preparation is being made. Fragment 1 is purified from other components in the digestion mixture by chromatography on Sephadex G-75 in fragment buffer (Fig. 2). The temperature of the column is critical for this purification. If it is too low, the resolution of the column will be poor. If it is too high the strands of the product will begin to dissociate. A reasonable compromise is 37 °. A 2.5 × 100cm (jacketed) column will suffice to purify the products of a 2000 A26onmdigestion. Fractions (5.5 ml) are collected. The buffers used in these columns must be degassed, and then maintained at or above the column temperature to prevent the destruction of the column bed due tO the formation of gas bubbles. The yield of fragment 1 is typically 250-300 A26om per 1000 A26onmof5S RNA digested. Preparation of Fragment 2
Buffer Fragment 2 buffer: 0.1 M KC1, 10 m M magnesium acetate, 50 m M Tris-HC1, 90 m M boric acid, pH 7.8 8 s S. Douthwaite, R. A. Garrett, R. Wagner, and J. Feunteun, Nucleic Acids Res. 6, 2453 (1979). 9 M. J. Kime and P. B. Moore, FEBSLett. 153, 199 (1983).
166
[ 1 O]
OTHER BIOPHYSICAL METHODS
Z5 otO 20 od >o~ Z t.tJ ~3
j
b-13.
°
--//
t
20
~"~
I
~
]
t
40 60 FRACTION NUMBER
I
80
FIG. 2. Chromatography of a fragment 1 digest on SephadexG-75. One thousand A26o.. of intact 5S was digested at a weight ratio of RNA to R_Nas¢A of 100:1 under the conditions described in the text for the production of fragment 1. The ethanol-precipitable products of this digestion were chromatographed on a 2.5 × 100 cm column of Sephadcx G-75 at 37" and 5.5 ml fractions were collected. The elution profile is shown. The peak at fraction 45 is
fragment 1. By careful adjustment of the conditions of RNase A digestion a second fragment of 5S RNA can be isolated in reasonable yield. It comprises bases 15- 36 and bases 4 4 - 6 5 of the parent sequence. We call this oligonucleotide fragment 2. It includes most of helix II and all of helix III of native 5S RNA. 10 5S RNA is precipitated with ethanol and brought up in Fragment 2 buffer at a concentration of 20 A ~ o , J m l . RNase A is added at a concentration of 1.1 gg/ml, and the mixture incubated at 0* for 45 rain. Digestion is then terminated by phenol extraction, and the product purified by Sephadex chromatography exactly as described for fragment 1. A typical elution profile is shown in Fig. 3. Both fragment 1 and fragment 2 are produced in such a digest. The fragment 1 component is only slightly nicked in the 87,88,89 loop. Partial Denaturation and Reconstitution of F r a g m e n t 1
Buffers EDTA buffer: 0.1 M NaCI, 2 m M EDTA, 10 m M 2-~r-morpholinoethanesulfonic acid (MES), pH 6 ~oN. B. Leontisand P. B. Moore,Biochemistry 25, 5736 (1986).
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
167
1
15 E ¢::: O cO ) - 10 I-Z LI.I C~
2
_J I-O_ 0
,,I
20
i l l
60 40 FRACTION NUMBER
I
80
Flo. 3. Chromatographyof a fragment2 digest on Sephadex(3-75. One thousand A2~o of intact 5S RNA was digestedat a weight ratio of RNA to RNase A of 1000:1 under the ionic conditions described for the preparation of fragment 2. The elution profile of the ethanol-precipitableproducts of this digestionare shown. The conditionsfor chromatography were those used for the purificationof fragment 1 (see text). The first (unnumbered)peak is a partial digestionproduct we have not yet characterized.The peak marked "1" is fragment 1. The peak marked "2" is fragment2 material. Reconstitution buffer: 0.1 M KC1, 5 m M MgClx, 10 mMN-2-hydroxyethylpiperazine-N'2-ethanesulfonic acid (HEPES), pH 7 Fragment 1 preparations contain four covalent species we call "strands." Strand I is bases 69-120. Strand II is bases 88 (or 89)-120. Strand III is bases 6 9 - 8 7 , and strand IV is bases 1-11. Fragment 1 preparations are mixtures of the complexes of strands I with IV, and of strands II, III, and IV. When fragment 1 is heated, especially in the absence of Mg 2+, strand III tends to dissociate from the (II,III,IV) complex. This fact can be taken advantage of in a number of ways. It can be used as a method of separating the (I,IV) form of the complex from the (II,III,IV) version. It can also be exploited as a means of producing partially labeled fragment by taking advantage of the fact that (II,IV) readily recombines with III to reconstitute fragment 1. Fragment 1 is precipitated with ethanol and taken up in EDTA buffer. It is then applied to a Sephadex G-100 column equilibrated with the same buffer. Chromatography is carried out at 300-35 ° using warm, degassed EDTA buffer as the eluant. Figure 4 shows a typical elution profile. The performance of this column is crucially dependent on the monovalent
168
OTHER BIOPHYSICAL METHODS
[ 1 0]
I+IX
0.5
"tI, l v I 0.4 E
c
O O ro
c3 o
0.3
0.2
tin)
O.1
~--4/
t
50 70 90 FRACTION NUMBER
Fro. 4. Chromatography of fragment 1 on Sephadex G-100 in EDTA. A preparation of fragment 1 obtained by digesting 5S RNA with RNase A at a weight ratio of 800:1 was applied to a 2.5 3< 100 cm column of Sephadex G-100 in 0.1 MNaCl, 2 m M EDTA, 10 m M MES, pH 6, at 35 °. Then 5-ml fractions were collected and read. The peak at fraction 62 is fragment uncleared at the 87,88,89 loop, i.e., the complex of strands I and IV. The peak at fraction 72 consists of molecules containing bases 1- 11, 89-120, strands IV and II, and the third peak, the one at fraction 90, is strand III, bases 69-87.
cation used in the buffer. Na + works; K + does not. The products are recovered by ethanol precipitation as usual. Samples of the (II,IV) complex and strand III are dialyzed (separately) into reconstitution buffer in the cold. They are then mixed to produce a solution which is 12.00D2e e m / m l in II,IV and 8.00D2~o nm/ml in strand III. The mixture is heated at 60 ° for 10 min, and then allowed to cool to room temperature for 45 min. The product is recovered by ethanol precipitation and purified by chromotography on Sephadex G-75 following the protocol prescribed for the initial purification of fragment 1. The material regenerated in this way has normal gel electrophoretic mobility, binds L25 normally, and gives a standard proton NMR spectrum, n 11 D. T. Gewirth, S. R. Abo, N. B. Leontis, and P. B. Moore,
Biochemistry26, 5213 (1987).
[10]
5S MATERIALS FOR N M R
A N D CRYSTALLOGRAPHY
I
I
I
[
L 40
I
I 60
169
I
I
0.4
m
0.3E
c 0 0
0.2-
0.1-
\ I
0
L 20
I
80
FRACTION NUMBER F]o. 5. Chromatography of fragment 1 on Sephadex G-75 in urea. A preparation of fragment 1 like the one used in the experiment depicted in Fig. 4 was dissolved in dissociation buffer, and chromatographed on a 2.5 × 100 em column of Sephadex G-75 at 50*. Then 5.5-ml fractions were collected and read. The oligonucleotide components of the fragment 1 preparation elute in order of molecular weight: strand I (bases 69-120), strand II (bases 89-120), strand III (bases 69-87), and strand IV (bases 1- 11). Reproduced with permission from M. J. Kime, D. T. Gewirth, and P. B. Moore [Biochemistry23, 3559 (1984). Copyright 1984 American Chemical Society.]
Total Dissociation of Fragment 1 Strands
Buffer Dissociation buffer: 8 M urea, 50 m M NaCI, 1 m M E D T A , 10 m M cacodylate, p H 6.0 F r a g m e n t 1 dissociates entirely in urea buffers at elevated temperatures.t2 F r a g m e n t 1 is precipitated with ethanol a n d taken up in dissociation buffer. T h e solution is e h r o m a t o g r a p h e d on Sephadex G-75 or (3-100 in the same buffer at 50*. A typical elution profile is shown in Fig. 5. T h e strands are recovered by ethanol precipitation. 12 M. J. Kime, D. T. Gewirth, a n d P. B. Moore,
Biochemistry23,
3559 (1984).
170
OTHER BIOPHYSICAL METHODS
[ 10]
Analytical Gels
Solutions Acrylamide-Bis: 20% (w/v) acrylamide, 1% (w/v) bisacrylamide 10× TBE: 25 m M EDTA, 500 m M Tris-HC1, 500 mMboric acid, pH 8.3 Persulfate: 10% (w/v) ammonium persulfate 10X 5S: 50 m M magnesium acetate, 1 M KC1, 500 m M Tris-HC1, 900 m M boric acid, pH 7.6 The standard method for examining the products of the manipulations described above is acrylamide gel electrophoresis. We run two kinds of gels for routine use, one which permits 5S and its protein complexes to run intact, and a second which is urea containing, and displays the oligonucleotides a sample contains. The native gel mixture contains 50 ml of acrylamide-Bis, 10 ml of 10X 5S, 80 #1 of tetramethylethylenediamine (TEMED), 0.5 ml of persulfate, and enough water to bring the total volume to 100 ml. We usually pour slab gels which are 170 × 170 X 1.5 ram. RNA, 0.1 to 0.3 OI:)26o m, is loaded per lane. The running buffer is 10× diluted 10-fold. Gels are run at 3 V/cm for 16 hr at room temperature using bromphenol blue as the marker dye. The current which runs through these gels is high. In order to keep the pH constant it is necessary to recirculate the running buffer. The composition of the denaturing gel mix is 60 ml of acrylamide-Bis, 10 ml of 10× TBE, 48 g urea, 80 #l of TEMED, and 0.5 ml of persulfate. (The volume of this mixture is about 100 ml.) The loading of these gels is the same as that of the native gels. We usually run them at 15 V/cm at room temperature using 10× TBE diluted l:10 as the running buffer. Bromphenol blue and xylene cyanole are good marker dyes. The electrophoresis is complete in 3 to 4 hr under these conditions. The results of the electrophoresis can be visualized in a number of ways. A gel can be quickly examined by placing it on a TLC plate containing fluorescent dye and illuminating the gel with a hand-held UV lamp which emits at 254 rim. The RNA-containing bands appear as shadows against a bright background. (Wear glasses to protect your eyes from UV light while inspecting your gel!) Gels can be stained for RNA using methylene blue. The gel is soaked in 10% acetic acid for l0 or 15 min, and then transferred into 0.4% methylene blue, 0.2 M acetate, pH 4.7. An hour of staining with agitation is sufficient. The gel is then destained in tap water by diffusion. Usually it can be read fairly well after a few hours of destaining with several changes of water. The stain solution can be reused many times. The sensitivity of methylene blue staining is quite high, higher than
[ 10]
5S MATERIALSFOR NMR AND CRYSTALLOGRAPHY
171
the shadowingmethod; 0.5/tg of RNA in a 1-cm wide band is easily detected. Methylene blue does not stain protein. A dye which will stain protein, but not RNA is Coomassie blue. We use a 0.025% solution of Coomassie blue in a 50: 50 mixture of 7% acetic acid and ethanol. The staining takes several hours, and destaining is by diffusion into ethanol-acetic acid solution. One microgram of protein is readily visualized. Ifa protein which binds to 5S RNA or one of its fragments is added to a lane with RNA in it, the electrophoretic mobility of the RNA on native gels is altered, a fact which provides a simple assay for this interaction. The presence of both protein and RNA in the complex is readily proven using the RNA and protein staining methods described here. 5S-Binding Ribosomal Proteins Fortunately, our work has consumed ribosomal proteins at a rate of less than 50 mg/species/year. The reason this fact is fortunate is that as far as we are aware there are no strains which overproduce any ribosomal protein to an appreciable degree. The techniques for preparing ribosomal proteins are in rapid flux today due to the introduction of high-performance liquid chromatography (HPLC) methods into the field. Below is described a more traditional ion-exchange approach to purifying the 5S-binding proteins from E. coli. It is slower than HPLC methods, if all that is needed is 10 mg of material. On the other hand, unlike HPLC, it is easy to scale up; 50 mg preparations of single proteins are readily accomplished. The three 5S binding proteins of E. coli, LS, L18, and L25, can be purified either from 50S subunit protein or from the protein of 70S particles. The ion-exchange procedures we use for purifying ribosomal proteins are detailed in Vol. 59 of this series, t3 and will be briefly summarized here. Protein is extracted from subunits or whole ribosomes by the LiC1-urea method, and the protein dialyzed exhaustively against 6 M urea, 30 m M methylamine, 6 m M 2-mercaptoethanol, adjusted to pH 5.6 with acetic acid ("Start 5.6"). In a recent run, the protein from 550,000 O D ~ o m of 70S ribosomes (about 12 g of protein) was loaded onto a 1-liter column of carboxymethyl-cellulose (CMC, Whatman CM-52) and eluted with a linear, 0.02 to 0.15 M NaC1 gradient whose total volume was 22 liters. By 0.15 M NaC1, all the 5S proteins are offthe column. Figure 6 shows the elution profile which results when a CMC column with lower loading (5 nag protein/ml of column volume) is run with a gradient of the same slope as described above extending past 0.25 M NaCI. The solid trace shows the elution of 70S protein (OD2ao nm), and the broken ,3 p. B. Moore,this series,Vol. 59, p. 639.
172
OTHER
--
BIOPHYSICAL
METHODS
[ 1 O]
00~0m
....... 3H-CP M
L1
'1
,.
L3
iil
°
o
L19 L22
L?4
•
~
|"
: ~
:,i
0
5o
)0o
,~o
2oo 250 30o FRACTION NUMBER
: . .
,,
55o
, ..........
4oo
45o
FIG. 6. The elution profiles of 70S protein and 50S protein from CMC compared. Nonradioactive 70S protein was mixed with a small amount of ~H-labeled 50S protein, and the mixture resolved by chromatography on CIVICat pH 5.6 in 6 M urea, as described in the text. The NaC! concentration was increased finearly during the elution, and ran from 0 to 0.25 M across the span represented in the figure. 70S protein was detected by its absorption at 230 nm. 50S protein was detected by its radioactivity. The identities of the 50S components in a number of peaks are indicated. 5S-binding proteins arc designated by numbers enclosed in a box.
line trace 50S protein (all counts). The identities of the 50S proteins contributing to a number of the peaks is given. L5 elutes free of all other proteins, as does L25. It is our practice to purify both fractions further by chromatography on Sephadex G-100 in Start 5.6. Following this step, both are sufficiently pure to use for physical studies. L 18 elutes in a mixture which includes three other 50S proteins and $4. $4 is enough larger than LI 8 and the other 50S protons in this fraction that Sephadcx G-100 chromatography will remove it cleanly from the mixture. The fractionation of the four 50S proteins is more tedious. The mixture is dialyzed into 6 M urea, 20 m M phosphoric acid-methylaminc, pH 7.0, 6 m M 2-mercaptoethanol ("Start 7"). It is then run on CMC in the same buffer system. The loading used is the same as that for the initial column. If the first step requires a l-liter column, the pH 7 step does as well. The elution is carded out using a linear gradient of NaC1 running from 0.075 to 0.15 M with about the same slope as the initial pH 5.6 column. Three peaks will be detected at 230 nm. The order of elution is L13 first, followed by L22, and then L18, and L19 as a single peak. The L 1 8 - L I 9 mixture can be resolved on phosphocellulose, but we prefer to do it using reversed-phase HPLC. We use a SynChropak RP-P column (Cl8). The solvent system is 0.1% trifluoroacetic acid in water: 0.1% triflu-
[ 10]
5S MATERIALS FOR N M R AND CRYSTALLOGRAPHY
17 3
oroacetic acid in acetonitrile. A full description of the application of HPLC methods to the purification of ribosomal proteins may be found elsewhere in this volume, t4 In order to make use of these proteins, they must first be renatured. L25 is dialyzed into 0.1 MKC1, 10 m M Tris-HC1, pH 7.5, at 4 °. Indeed, L25 recovers its native conformation upon dialysis into almost any physiological buffer, t5 (L25 denatures below pH 6.0.) The other two proteins are more difficult to handle. First they are dialyzed against 6 M guanidine, 6 m M 2-mercaptoethanol, 20 m M cacodylate, pH 7.0, and then dialyzed into 1 M KCI, 6 m M 2-mercaptoethanol, 10 m M cacodylate, pH 7.0. What appears to be important is that the proteins be kept at high ionic strength while the denaturant is removed. Following the second dialysis, the proteins can be transferred into any buffer one wishes by further dialysis. Renatured L5 is quite unstable. It cannot be frozen in physiological buffers unless it is made 50% in glycerol first. Renatured L 18 is more forgiving than renatured L5; it can be frozen and thawed in the absence of glycerol. Concentrated solutions of L 18, however, like similar solutions of L25, tend to form precipitates of (presumably) denatured protein at a slow rate upon incubation at room temperature. Using biuret as a means for estimating protein concentrations, we find that a 1 mg/ml solution of L18 has an optical density of 0.42 at 276 nm, and that a similar solution of L25 has an optical density of 0.38 at the same wavelength. Both these values are close to those one would estimate for these proteins on the basis of their amino acid compositions, taking standard values for the extinction coefficients of the aromatic amino acids, and using their known molecular weights. (We have not measured an extinction coefficient for L5, but calculation based on amino acid composition suggests that a 0.1% solution of L5 should have an extinction coefficient of about 0.7 at 280 nm.) The extinction coefficient of 5S RNA at 260 nm is 8.474 × 105 M - t cm-I. t6 For the smaller fragments of 5S RNA, we estimate concentrations form extinction at 260 nm using the extinction coefficient of the intact molecule multiplied by the ratio of the molecular weights of intact 5S RNA and the fragment in question. Preparation of Samples for N M R
and Crystallization
N M R samples for proton work are typically0.2 to 0.5 ml in volume, and the molecule of interestmust be present at a concentration around 14B. S. Cooperman, C. J. Weitzmann, and M. A. Buck,this volume [36]. 15M. J. Kime, R. G. Ratcliffe,P. B. Moore,and R. J. P. Williams, Eur. J. Biochem. 116, 269 (1981). 16R. Osterberg,B. Sjoberg,and R. A. Garrett, Eur. J. Biochem. 116, 481 (1976).
174
OTHER BIOPHYSICAL METHODS
[ 11 ]
1 mM. Since neither 5S RNA nor its proteins are particularly robust, we transfer them into the buffer in which we wish to study them by dialysis at a stage where the concentration is of the order of a tenth of that desired for the final sample. Concentration is achieved by ultrafdtration. A disposable, centrifugal ultrafdtration device has become available in the past few years which is well suited for this purpose. The device is called the Centricon and is manufactured by Amicon. It permits one to concentrate 3 ml down to less than 100 gl, if necessary, with acceptably low losses. Both fragment 1 and its complex with L25 crystallize readily under a wide range of conditions. 17 Samples suitable for crystallization are much less concentrated than those used in NMR. A typical preparation for crystallization has an RNA concentration of 100 OD260, J m l . The ionic conditions are varied to meet the particular purposes of the experimenter, but typically would be 0.1 M KCI, 4 m M magnesium acetate, 5 m M TrisHCI, pH 7.4. Again dialysis is the preferred way of establishing the ionic conditions in a sample. Acknowledgments This work has been supported by grants from the National Institutes of Health to P.B.M. (AI-09167, GM-22778, and GM-32206).
17 S. S. Abdel-Meguid, P. B. Moore, and T. A. Steitz, J. Mol. Biol. 171,207 (1983).
[ 11 ] F l u o r e s c e n c e L a b e l i n g a n d I s o l a t i o n o f L a b e l e d RNA and Ribosomal Proteins B y O . W . O D O M , H . - Y . D E N G , a n d BOYD H A R D E S T Y
The development of highly sensitive fluorimeters to measure steadystate intensity and lifetime of fluorescence coupled with computerized data analysis has vastly enhanced the utility of fluorescence techniques for investigation of systems of biological origin. Estimation of the distance between an energy donor fluorophore and an acceptor by nonradiative energy transfer has proven to be particularly useful. This technique has been used extensively to analyze the structure and function of ribosomes during the reaction steps of protein synthesis. The size of ribosomes, about 220 A in diameter, is well suited to the distances that can be measured by nonradiative energy transfer, about 20 to 80 A with commonly used METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress, Inc. Allfightsofreproductionin any formreserved.
174
OTHER BIOPHYSICAL METHODS
[ 11 ]
1 mM. Since neither 5S RNA nor its proteins are particularly robust, we transfer them into the buffer in which we wish to study them by dialysis at a stage where the concentration is of the order of a tenth of that desired for the final sample. Concentration is achieved by ultrafdtration. A disposable, centrifugal ultrafdtration device has become available in the past few years which is well suited for this purpose. The device is called the Centricon and is manufactured by Amicon. It permits one to concentrate 3 ml down to less than 100 gl, if necessary, with acceptably low losses. Both fragment 1 and its complex with L25 crystallize readily under a wide range of conditions. 17 Samples suitable for crystallization are much less concentrated than those used in NMR. A typical preparation for crystallization has an RNA concentration of 100 OD260, J m l . The ionic conditions are varied to meet the particular purposes of the experimenter, but typically would be 0.1 M KCI, 4 m M magnesium acetate, 5 m M TrisHCI, pH 7.4. Again dialysis is the preferred way of establishing the ionic conditions in a sample. Acknowledgments This work has been supported by grants from the National Institutes of Health to P.B.M. (AI-09167, GM-22778, and GM-32206).
17 S. S. Abdel-Meguid, P. B. Moore, and T. A. Steitz, J. Mol. Biol. 171,207 (1983).
[ 11 ] F l u o r e s c e n c e L a b e l i n g a n d I s o l a t i o n o f L a b e l e d RNA and Ribosomal Proteins B y O . W . O D O M , H . - Y . D E N G , a n d BOYD H A R D E S T Y
The development of highly sensitive fluorimeters to measure steadystate intensity and lifetime of fluorescence coupled with computerized data analysis has vastly enhanced the utility of fluorescence techniques for investigation of systems of biological origin. Estimation of the distance between an energy donor fluorophore and an acceptor by nonradiative energy transfer has proven to be particularly useful. This technique has been used extensively to analyze the structure and function of ribosomes during the reaction steps of protein synthesis. The size of ribosomes, about 220 A in diameter, is well suited to the distances that can be measured by nonradiative energy transfer, about 20 to 80 A with commonly used METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress, Inc. Allfightsofreproductionin any formreserved.
[11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
175
probes. Individual ribosomal proteins or rRNAs can be labeled, then reconstituted into active ribosomes, and probes can be covalently linked to tRNA at a number of specific sites. Several excellent articles 1-a describe in detail the instrumentation, techniques, and data analysis used for distance measurement by nonradiative energy transfer. These aspects will not be treated here. Rather, the focus will be directed toward what in most experimental situations is the most troublesome factor that may compromise the reliability of the measurements. This is incomplete pairing between donor and acceptor probes and spurious positioning of the probes. These conditions may be generated by incomplete or nonspecific labeling, respectively. In many experimental situations, incomplete pairing can be dealt with by determining energy transfer from fluorescence lifetime data. Under favorable circumstances, a two-exponential function can be fit to a fluorescence decay curve so that fluorescence lifetime of the quenched and unquenched species can be evaluated directly, and we have used this approach? Also, increased fluorescence from the energy acceptor can be used with the decrease in donor fluorescence intensity in some circumstances3 However, the most direct and generally the most satisfactory approach is to avoid the problem by using completely, and specifically, labeled components. Techniques for obtaining such ribosomal proteins and tRNAs are described below. Labeling P r o c e d u r e s Precautions must be taken throughout the labeling and isolation procedure to use reagents, solvents, and glassware that are as free as possible of contaminating fluorescent material and degradative enzymes. In this laboratory, distilled water is passed through a deionizing column and then a column of activated charcoal before it is redistilled in glass. Where possible, plastic containers are avoided for solution storage. Glassware washed with detergent is rinsed with hot ethanol before it is used. Eppendorf tips and tubes are never reused. Plastic gloves are worn throughout the labeling procedure to avoid both fluorescent and enzymatic contamination. When working with low concentrations oftRNA or 5S RNA and always with 16S RNA or 23S RNA, glassware is baked at 150 ° for 24 hr to reduce nuclease contamination. 1j. R. Lakowicz, "Principles of Fluorescence Spectroscopy." Plenum, New York, 1983. 2 C. R, Cantor and T. Tao, Proced. Nucleic Acid Res. 2, 31 (1971). 3 R. H. Fairclough and C. R. Cantor, this series, Vol. 48, p. 347. 4 D. Robbins, O. W. Odom, Jr., J. Lynch, G. Kramer, B. Hardesty, R. Liou, and J. Ofengand, Biochemistry 20, 5301 (1981). 5 B. Epe, K. G. Steinhliuser, and P. Woolley, Proc. Natl. Acad. Sci. U.S.A. 80, 2579 (1983).
176
[ 11 ]
OTHER BIOPHYSICALMETHODS TABLE I E. coli Ribosomal Proteins with Cysteine Residues* Large subunit
Small subunit
number
Cysteine position
Total amino acids
2 5 6 10 II b 14 17 27 b 28 b 31
5,187 86 124 70 38 21, 84 100 52 4 16,18,37,40
272 178 176 165 141 123 127 84 77 62
L
S
Cysteine
number
position
Total amino acids
Ib 2 4 8 11 12 13b 14 17b 18 21 b
292,349 86 31 126 69,120 26, 33, 52, 103 84 63 58,63 10 22
557 240 203 129 128 123 117 98 83 74 70
° Work of B. Wittmann-Liebold and co-workers, summarized in B. Wittmann-Liebold, Adv. Protein Chem. 36, 56 (1984). b Mutant E. coli strains have been isolated by Dabbs~4O with ribosomes lacking these proteins or
carrying a defective protein that can easily be removed from the ribosome, as described further in the text.
Labeling of Proteins Reaction of cysteine thiol with a maleimide derivative of a fluorescent probe provides a specific reaction for labeling a ribosomal protein. At pH 7.0 maleimides show a high degree of selectivity for sulfhydryl groups of proteins. 6 Alkyl halides such as iodoacetamide derivatives also can be used, but these provide lower sulfhydryl group specificity, n A number of Escherichia coli ribosomal proteins have one or a small number of cysteine residues as indicated in Table I and thus provide a basis for probe attachment at a specific site. 821, 7 L11, 8 81, 9 L27, and L28 have been successfully labeled in this laboratory. A typical labeling procedure involves incubation of 1 mg of the homogeneous ribosomal protein in 200/tl of 7 M guanidine-HC1, 10 m M N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)/KOH, pH 7.0, with 1 m M of the fluorogenic maleimide 6G. E. Means and R. E. Feeney, "Chemical Modification of Proteins," pp. 105-118. Holden-Day, San Francisco, California, 1964. O. W. Odom, E. R. Dabbs, C. Dionne, M. Mfiller, and B. Hardesty, Eur. J. Biochem. 142, 261 (1984). s H.-Y. Deng, O. W. Odom, and B. Hardesty, Fur. J. Biochem. 156, 497 (1986). 90. W. Odom, H.-Y. Denf, A. R. Subramanian, and B. Hardesty, Arch. Biochem. Biophys. 230, 178 (1984).
[ 1 1]
SEPARATION OF RIBOSOMAL PROTEINS AND tRNAs
177
derivative at 37 ° for 30 min. Excess labeling reagent is inactivated by adding glutathione to a final concentration of 10 raM, then the sample is passed over a Sephadex G-25 column equilibrated with 7 M urea, 20 m M HEPES/KOH, pH 7.5. Guanidine-HCl and inactivated excess labeling reagent are separated from the labeled protein. Finally, the protein is dialyzed against 30 m M Tris-HCl, pH 7.4, 500 m M KC1, 20 m M magnesium acetate, 1 m M dithiothreitol (30S proteins) or 20 m M Tris-HC1, pH 7.4, 400 m M NH4C1, 4 m M magnesium acetate, 4 m M 2-mercaptoethanol (50S proteins), and then frozen in small aliquots and stored at - 80 ° until used. If the labeled protein is to be purified by high-performance liquid chromatography (HPLC) it is dialyzed against 0.1% trifluoroacetic acid (TFA) in water. For determining stoichiometry of labeling, the protein is digested with proteinase K (50#g/ml in 10 m M Tris-HC1, pH 7.4, 100 m M NH4CI, 10 m M magnesium acetate, 5 m M 2-mercaptoethanol for 30 min at 37 °) and the absorbance due to the fluorophore is compared with that of a standard solution of the cysteine derivative of the probe, to obtain probe concentration. 7 Protein concentration is usually determined by the Amido Black method, ~° using bovine serum albumin as a standard.
Labeling of RNAs Ribosomal RNAs and tRNAs can be labeled at their Y-terminal ends by oxidation of the ribose with periodate, followed by reaction of the resulting dialdehyde with hydrazides or thiosemicarbazides, one molecule of which appears to add to both aldehydes to form a morpholine structure) ~Oxidation of 5S ribosomal RNA or tRNA with periodate is accomplished by incubation at a concentration of 50 A2~/ml or less with 0.09 M sodium periodate in 0.1 M sodium acetate, pH 5.0, for 90 rain at room temperature in the dark. t2 At the end of the incubation KC1 is added to a final concentration of 0.2 M, then the reaction solution is allowed to stand on ice for 10 min before the potassium periodate precipitate is removed by centrifugation for 5 min at 10,000 g. The supernatant is passed over a Sephadex G-25 column equilibrated with 0.1 M sodium acetate, pH 5.0, to remove remaining periodate. 16S or 23S ribosomal RNA is oxidized under somewhat milder conditions by incubating with 0.09 M sodium periodate in 0.1 M sodium phosphate, pH 7.0, for 2 hr at 0 ° in the dark at concentrations of no more than 200 or 400 A260 units/ml, respectively) 2 KC1 is then added and the precipitate of potassium periodate is removed as 10W. Schaffner and C. Weissmann, Anal. Biochem. 56, 502 (1973). 1~F. Hansske, M. Sprinzl, and F. Cramer, Bioorg. Chem. 3, 367 (1974). t20. W. Odom, D. J. Robbins, J. Lynch, D. Dottavio-Martin, G. Kramer, and B. Hardesty, Biochemistry 19, 5947 (1980).
178
OTHER BIOPHYSICAL METHODS
[ 1 1]
described for 5S RNA and tRNA, followed by passage over Sephadex G-25 equilibrated with 0.05 M sodium phosphate, pH 7.0, to remove remaining periodate. Labeling of the oxidized RNAs with fluorescein 5'-thiosemicarbazide (FTS) as an example is as follows, n Oxidized 5S RNA or tRNA in 0.1 M sodium acetate, pH 5.0, is incubated with 2 m M FTS in the dark for 2 hr at room temperature, followed by three extractions with equal volumes of 70% phenol to remove most of the unreacted labeling reagent. Then the sample is made 0.1 M in KC1 and precipitated with two volumes of 95% ethanol at - 2 0 °. The ethanol precipitation is repeated twice, after which the sample is dissolved in 10 m M Tris-HCl, pH 7.4, 4 m M magnesium acetate, and frozen at - 8 0 °. Oxidized 16S RNA, in 0.05 M sodium phosphate, pH 7.0, is incubated for 1 hr in the dark at room temperature with 2 m M FTS. Oxidized 23S RNA, in 0.05 M sodium phosphate, pH 7.0, is incubated in the dark for 2 hr at 0 ° with 2 m M F r S . The labeled 16S and 23S RNA samples are then treated as described for labeled 5S RNA and tRNA except that, just prior to ethanol precipitation, two volumes of 0.1 M KC1 is added. This dilution is necessary to prevent precipitation of sodium phosphate by the ethanol. After ethanol precipitation, 23S RNA is dissolved in l0 m M Tris-HC1, pH 7.4, 4 m M magnesium acetate, and 16S RNA in 30 m M Tris-HC1, pH 7.4; both are stored at - 80 °. In addition to the 3' end, tRNA can be specifically labeled at various other sites by reaction with, or removal of, modified bases that have unusual chemical reactivity. Procedures have been developed for replacing dihydrouracils of various tRNAs ta or the wybutine base adjacent to the anticodon of yeast t R N A ) TM for reacting the amino group of the X base in the extra loop of some E. coli tRNAs with isothiocyanates ~ and for reacting thiouridine and, in some cases, pseudouridine with fluorescent alkyl bromides ~6a7 or iodoacetamide derivatives. ~s The procedure for replacing dihydrouracil depends on the labilization of this base by NaBH4 reduction to ureidopropanol, ~9which is hydrolyzed from the tRNA under acidic conditions, as is the wybutine base. 13 The resulting aldehydic C-1 atom of the ribose can then react with amine or hydrazine derivatives. Yeast and E. coli tRNA ~e, which can be used with 13W. Wintermeyer, H.-G. Schleich, and H. G. Zachau, this series, Vol. 59, p. 110. 14O. W. Odom, B. B. Craig, and B. A. Hardesty,Biopolymers 17, 2909 (1978). 15j. A. Plumbridge, H. G. Btiumert, M. Ehrenberg, and R. Rigler, Nucleic Acids Res. 8, 827 (1980). 16C. H. Yang and D. $611,J. Biochem. (Tokyo) 73, 1243(1973). 17C. H. Yang and D. $611,Biochemistry 13, 3615 (1974). 18A. E. Johnson, H. J. Adkins, E. A. Matthews, and C. R. Cantor, J. Mol. Biol. 156, 113 (1982). 19p. Cerutti and N. Miller, J. Mol. Biol. 26, 55 (1967).
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
179
the convenient artificial messenger, polyuridylic acid, both contain two dihydrouracils, at positions 16 and 172o and 16 and 20, 2t respectively. The procedure used in this laboratorY for replacement of dihydrouracil is a modification of the published procedure. 13 tRNA (10-20 Az6o/ml) is reduced with 10mg/ml NaBH4 in 0 . 2 M Bicine [N,N-bis(2hydroxyethyl)glycine], pH 9.0, for 45 min at ambient temperature. During the reduction the pH is maintained at 9.0 by addition of small amounts of acetic acid. At the end of the incubation, excess NaBH4 is destroyed by adding acetic acid to a final pH of 5.0, followed by ethanol precipitation of the reduced tRNA. The labeling of reduced tRNA Pbcwith 7-diethylaminocoumarin-3-carbohydrazide (DCCH), as an example, is as follows. Deacylated tRNA Phc or AcPhe-tRNA in 0.1 M sodium acetate, pH 4.3, is incubated for 2 hr at 37 ° with 2 m M DCCH, added from a 50 m M stock solution in dimethylformamide. At the end of the incubation period, the solution is made 0.1 M in Tris-HCl, the pH is adjusted to 6.0-6.5 with KOH, and the sample is extracted twice with equal volumes of 70% phenol to remove excess DCCH, followed by three ethanol precipitations to remove residual phenol. The labeling with DCCH is usually incomplete, and unlabeled, singly labeled, and a small amount of the doubly labeled tRNA species are separated by reversed-phase chromatography, as described in the next section. Separation and Purification P r o c e d u r e s HPLC was carried out with a Beckman system which included a 421 controller unit for generating elution gradients and a 165 variable wavelength detector with which absorption was monitored at two wavelengths simultaneously. The reversed-phase column was #Bondapak C~s (3.9 m m × 30 cm) from Waters Associates, Milford, MA. R i b o s o m a l Proteins
The labeling of sulfhydryl groups of ribosomal proteins is frequently incomplete and it is desirable to remove unlabeled protein. Of the methods used in this laboratorY, the best involves HPLC in 0.1% trifluoroacetic acid (TFA) over a/tBondapak C18 reversed-phase column. This procedure also has been used to purify unlabeled ribosomal proteins) 2a3 The column is 20u. L. RajBhandaryand S. H. Chang, J. Biol. Chem. 243, 598 (1968). 21B. G. Bah'elland F. Sanger,FEBSLett. 3, 275 (1969). 22A. R. Kerlavage,C. J. Weitzmann,T. Hasan, and B. S. Cooperman,J. Chromatogr. 266, 225 (1983). ~3R. M. Kamp, A. Bosserhoff,D. Kamp, and B. Wittmann-Liebold,J. Chromatogr. 317, 181 (1984).
180
[ 11]
OTHER BIOPHYSICAL METHODS I
0.3
...............
._
1~02
,
~ . °.......
, "'"'"'""+"
u;ul ~ - z 0.1
t
""" ""
.°,*beled
1
O0
..... '......... "*........ '-430
I
2o
1'+
labeled
A
131111 {lg ¢~" O0 (Zl I111
0 o
8
16 24 ELUTION VOLUME, ml
32
40
T'
0
FIG. I. Separation o f E . coli ribosomal protein $21 labeled with fluorescein 5'-maleimide from unlabeled protein. Unlabeled $21 (25/Jg) was m i x e d with labeled S21 (25/Jg) a n d applied in 0.1% a q u e o u s T F A to the C~s c o l u m n described in the text. T h e c o l u m n h a d been equilibrated with the s a m e solution. Elution was with a nonlinear gradient o f aeetonitrile in a n a q u e o u s solution containing 0.1% TFA, as shown. Flow rate was 1 m l / m i n .
equilibrated with 0.1% TFA in water and the labeled protein is dialyzed against this same solution prior to loading. Elution is with a gradient of acetonitrile in an aqueous solution containing 0.1% TFA. Most ribosomal proteins elute between 25 and 50% acetonitrile.2z Labeled derivatives typically elute somewhat later than the unlabeled forms. Separation of unlabeled $21 from $21 labeled with fluorescein 5'-maleimide is shown in Fig. 1. The unlabeled species is eluted at about 25.5%, and the labeled species at about 29.5%, acetonitrile. Up to 0.5 mg of protein has been chromatographed under these conditions with little or no loss in resolution. The fractions from HPLC containing labeled protein are evaporated to dryness (Savant Speedvac concentrator), redissolved in 20 m M Tris-HC1, pH 7.5, 7 M urea, and finally dialyzed against 30 m M Tris-HC1, pH 7.4, 500 m M KC1, 20 m M magnesium acetate, 1 m M dithiothreitol (30S proteins) or 20 m M Tris-HC1, pH 7.4, 400 m M NH4CI, 4 m M magnesium acetate, 4 m M 2-mercaptoethanol (50S proteins). Ribosomal RNA
Labeling ratios approaching unity are usually obtained for 16S and 23S RNA, lessening the need for purification. However, 5S RNA often gives incomplete labeling. The procedure described below for tRNA probably would be applicable to 5S RNA but has not yet been tested with this material.
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
181
tRNA
To our knowledge, the use of Cls reversed-phase HPLC for separation of tRNAs has not been described previously, although it has been used for separating oligodeoxynucleotides,u It appears to represent a significant improvement over several other methods. Chromatography on benzoylated DEAE-cellulose (BD-cellulose) 25,26and RPC-5 chromatography13,~8-27 are frequently used. Although both of these methods involve hydrophobic interactions and the latter is referred to as reversed-phase chromatography, a large portion of the energy involved in binding of tRNA to such columns is due to ionic interactions of the negatively charged phosphate groups of tRNA with the positively charged nitrogen atoms of the BD-cellulose and RPC-5 material. The following procedure appears to separate tRNA species solely on the basis of hydrophobic interactions, presumably involving interaction with the bases of the RNA. Purines have more hydrophobic character than pyrimidines.28 Hartwick et aL 2s developed a procedure for separating ribonucleoside monophosphates on a Ci8 column, the order of elution being CMP, UMP, GMP, and AMP. This report prompted the investigation of the interaction of tRNA with C~8. A /zBondapak C~s column is equilibrated with 20 mM Tris-acetic acid (pH 5- 7 depending on the application), 10 mM magnesium acetate, and 0.4 M NaC1. tRNA samples are applied in the same solution. The column is developed with a methanol gradient between 0 and 60% in a solution containing the salt at the same concentrations. Figure 2 shows the elution profile of unlabeled deacylated yeast tRNA z*e and its acetylated aminoacylated form. Deacylated tRNA l~e elutes from the column at about 22% methanol and Ac[14C]Phe-tRNA at about 28% methanol. Both are eluted as relatively sharp peaks which are well separated. No radioactivity is detected in the first peak. Also shown in Fig. 2 by arrows 1 and 2 are the approximate positions at which E. coli deacylated tRNA ~ and AcPhe-tRNA elute. Unacetylated Phe-tRNA also can be separated from deacylated tRNA. It is eluted at a slightly lower methanol concentration than AcPhe-tRNA at approximately the position indicated by arrow 3. Although BD-cellulose has been used to separate E. coli Phe-tRNA from deacylated tRNAme,29 24 H.-J. Fritz, R. Belagaje, E. L. Brown, R. H. Fritz, R. A. Jones, R. G. Lees, and H. G. Khorana, Biochemistry 17, 1257 (1978). 25 I. C. Gillam, S. Milward, D. Blew, M. Von Tigerstrom, E. Wimmer, and G. M. Tener, Biochemistry 6, 3043 (1967). 26 W. Wintermeyer and H. G. Zaehau, FEBS Left. 18, 214 (1971). 27 R. L. Pearson, J. F. Weiss, and A. D. Kelmers, Biochim. Biophys. Acta 228, 770 (1971). 28 R. A. Hartwiek, S. P. Assenza, and P. R. Brown, J. Chromatogr. 186, 647 (1979). 29 K. L. Roy, A. Bloom, and D. $611, Proced. Nucleic Acid Res. 2, 524 (1971).
182
[ 11]
OTHER BIOPHYSICALMETHODS I
I
I
I
I
I
I
I
'
48,
ti
A
I
I
. . . . . . . . ..~ 4 4
0.8
I
2
i
t
3 ~
/:
0.6
24 d
12
o.,o 0
0
......J: . J ij 8
....... 16
24
32 40 ELUTION VOLUME.ml
48
56
64
FIG. 2. Separation of deacylatedyeast tRNA~ from Ac[14C]Phe-tRNA.Forty A2~ounits of Ac[14C]Phe-tRNA (specific activity 100 mCi/mmol) in 20 mM Tris-acetic acid, pH 5.0, 0.4 MNaCI, 10 mM magnesiumacetate were appliedto the C,8 column equilibratedwith the same solution. Elution was with a gradient of a solution containing 20 mM Tris-acetic acid, pH 5.0, 0.4 M NaCI, 10 mM magnesium acetate, 60% methanol. The gradient shown is expressed as final percentage of methanol. Absorbance of 290 nm was monitored continuously. Fractions of 4 ml were collectedand radioactivitywas determinedwith 10-#1aliquots by scintillationcounting in diphenyloxazole-toluenecounting fluid containing 5% Bio-Solve. Arrows 1 and 2 indicate the approximateelution positions of E. coil deacylatedtRNA~ and AcPhe-tRNA, respectively.Arrow 3 indicates the approximation elution position of yeast Phe-tRNA. separation by the procedure described here provides considerably cleaner resolution of the two species. Shown in Fig. 3 is the separation of deacylated DCCH-labeled tRNA ~ from DCCH-labeled AcPhe-tRNA. The tRNA was labeled with D C C H by the procedure indicated above, then chromatographed on the Cts column, followed by aminoacylation, acetylation, and finally rechromatography on the C~8 column. A small a m o u n t of unlabeled deacylated tRNA and unlabeled AcPhe-tRNA present in the preparation are eluted at about 22 and 28% methanol, respectively. The DCCH-labeled deacylated tRNA is eluted with 34% methanol whereas the DCCH-labeled AcPhe-tRNA is eluted with 37% methanol. BD-cellulose, by contrast, gave no resolution of this pair. The large peak of UV-absorbing material at the beginning of the gradient is ATP, which was coprecipitated with the tRNA by ethanol following the aminoacylation reaction. Figure 4A shows the separation of yeast tRNA Ph* species that are generated during the labeling procedure in which the wybutine base is replaced with proflavine. Yeast t R N A w was labeled with proflavine at
0
[11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s 0.36
0.32
;
i
i
,
!
•
I
'
I
'
I
I
183
I
!
48
-
40 0.28
-
.....................
...-"''"
~
"" ....
:-
32
A
0
0.20 o
24
)
t~w 0.16
>-
of,.) zz
I>
IZlm
(z: ~ 2
(2_
0
,6 ~
0,12
OO
I-
o,)¢n ~m < <
~
0.08
8 0.04 0
0
0
8
16
24
32 40 48 56 E L U T I O N V O L U M E , ml
64
72
80
8e
96
0
Flo. 3. Separation of yeast deacylated DCCH-labeled tRNA T M from Ac[t4C]Phe-tRNA labeled with DCCH. DCCH-labeled tRNA v~ that had been isolated by reversed-phase HPLC was aminoacylated, then aeetylated. A sample containing 7 A26o units of this DCCH-labeled AcPhe-tRNA in 20 m M Tris-acetic acid, pH 6.0, 0.4 M NaCI, 10 m M magnesium acetate was applied to the Cts column equilibrated with the same solution. Elution at a flow rate of 1 ml per minute was performed with the methanol gradient shown. Absorbance was monitored continously at 260 n m and at 430 nm, near the absorbance maximum of DCCH. Fractions of 4 ml were collected and 20-/d aliquots counted for radioactivity as described in the legend to Fig. 2.
position 37 by the procedure developed by Wintermeyer et al. 13 then loaded on the Cls column as described for Fig. 3. Four prominent peaks are detected by UV absorption due to the nucleic acid. Three of these (peaks 2, 3, and 4) contain proflavine at a stoichiometry of about 1 : 1 with the tRNA whereas peak 1 is unlabeled tRNA. Wintermeyer and Zachau3° used chromatography on RPC-5 to achieve partial separation of two proflavine-labeled species which they identified as a- and fl-anomers resulting from addition of proflavine to C-1 of the ribose residue at position 37. These correspond to peaks 2 and 3 in Fig. 4A. The identity of the fourth peak seen in Fig. 4A is not known. For use in fluorescence experiments peak 2 would have been collected separately; however, to demonstrate the separation that can be obtained with the system described here, peaks 2 and 3 were combined, aminoacylated with [~4C]phenylalanine, acetylated, and then rechromatographed on the Cts column. The results are shown in Fig. 3o W. Wintermeyer and H. G. Zachau, Eur. J. Biochem. 98, 465 (1979).
i.2
36
I
A
2
30
1.0
24
0.8
T
4
,8 ; EE_ o~ ~UJLU .04
•"
!
./
C,,~U
o
i
t
112 w
i
~m mm
\, li \
t
< <0.2
•
•
, O
I
J....
E}
J------,------L 16
i
I
. . . . . 24
I
..~ 32
I
I
| 40
I
I
I 48
I 56
I
|
I0
I 64
,
I
.
%% 0
I
72
I
/%
22.5
30
I
......... . . . . . . . . . . . . . . . . . . . . . . . . . ,....."
l8.0
i °f g
ii ............................
0.6
,
o_ 1 3 5 x
P
_~ 9o
• .0.4 ww |
<<
~: 4 5
I 0
.,/',
, O
16
24
32 ELUTION
40 VOLUME, ml
40
56
.
. .... '
?~0
FIG. 4. Separation of yeast deacylated t R N A ~ e. (A) Twenty-four A 2 ~ 0 units of t R N A ~ which had been labeled with proflavine were applied in 20 m M Tris-acetate acid, pH 7.2, 0.4 M NaCI, 10 m M magnesium acetate to the Cms column equilibrated with the same solution. Elution at a flow rate of I ml per minute was with the methanol gradient shown. Absorbance at 260 or 450 nm was monitored continuously. (B) Thirteen A260 units of the combined first two proflavine-labeled peaks (peaks 2 and 3) from A were aminoacylated, acetylated, and reapplied to the column under the same conditions as in A. Elution was with the methanol gradient shown. Absorbance was monitored continuously at 260 and at 450 nm. Fractions of 4 ml were collected and 20-gl aliquots of those indicated were counted for radioactivity as described in the legend to Fig. 2.
[ 11]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
185
4B. Complete separation of the two AcPhe-tRNA species (peaks 2B and 3B) from the deacylated forms (peaks 2A and 3A) is achieved, as indicated by association of radioactivity only with the second pair of peaks, 2B and 3B. Furthermore, the data appear to indicate that the peak 2 anomer is aminoacylated more efficiently than the peak 3 species. The slightly different methanol percentage at which the deacylated proflavine-labeled tRNA ~ elutes in Fig. 4A and B is due to the different shape of the methanol gradient in the two cases. For a given gradient the elution positions are very reproducible. General Comments about tRNA Separation Procedure
Up to 40 A26ounits of tRNA have been applied to the C~s column with no loss of resolution. At a flow rate of 1 ml per minute most separations require only 1-2 hr. Recoveries are generally in the range of 80-90%. Only slight dependence on pH is noted between pH 5.0 and 7.2. The columns used are readily available commercially, which apparently is not true of the RPC-5 columns. The methanol gradient can be continfied at least to 45%. Some doubly labeled tRNA species elute near this concentration (not shown). Labeled tRNAs not eluted by 45% methanol probably would chromatograph better on a less hydrophobic column such as C s, since the tRNA may precipitate at higher methanol concentrations. We have not tested the effectiveness of the chromatographic procedure for isolation of various naturally occurring species of tRNA; however, probably it would be useful for this purpose. For example, tRNA v~ from which the wybutine has been excised elutes around 16% methanol (Fig. 4A) while tRNA ~ containing wybutine elutes around 22% methanol (Fig. 2). This indicates that manipulation of the methanol concentration in the approximate range of 14-22% probably would allow significant fraetionation of many tRNAs. Reconstitution of Labeled Components into Ribosomes
Incorporation of labeled ribosomal RNAs into functional ribosomes is performed by the total reconstitution technique. For 30S total reconstitution, the procedure used is that of Traub and Nomura a~ as modified by Hardy et al. 32 and, for 50S total reconstitution, the procedure of Nierhaus and Dohme 33 as modified by Schulze and Nierhaus ~ is used. The only 31 p. Traub and M. Nomura, Proc. NatL Acad. Sci. U.S.A. 59, 777 (1968). 32 S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry& 2897 (1969). 33 K. Nierhaus and F. Dohme, this series, Vol. 59, p. 443. H. Schulze and K. H. Nierhaus, EMBOJ. 1,609 (1982).
186
OTHER BIOPHYSICAL METHODS
[ 11]
modification of these procedures is that labeled RNA is substituted for unlabeled RNA. Labeled proteins may be incorporated into ribosomal subunits either by total reconstitution or, in most cases, more efficiently by direct addition to subunits that lack the protein of interest. Efficient incorporation of the labeled protein usually does require that the subunits or total protein mixture be deficient in that protein, which can be accomplished by several strategies. In some cases, affinity chromatography using antibodies against the protein of interest may be useful. Because of the strong interaction between S 1 and RNA, it can be selectively removed from 30S subunits by passing them over a poly(U)-Sepharose column equilibrated with 20 m M Tris-HC1, pH 7.5, 1 M N H 4 C 1 , 20 ~ magnesium acetate, 5 m M 2-mercaptoethanol. 35 Dr. Eric Dabbs 36 has isolated a series ofE. coli K12, strain A l9, mutants a7-4° that either totally lack a single protein or contain the protein in altered form that can be readily removed from the ribosomal subunit. The normal proteins from these deficient ribosomes can be extracted and used with a labeled protein for total reconstitution. In most cases the labeled protein will bind directly to the ribosomal subunits that lack the mutant protein. This technique has been used for incorporation of labeled Sl, 9 S21, 7 and L11 s into 30S and 50S subunits, respectively. For example, labeled $21 can be incorporated by adding it to $2 l-deficient 30S subunits in 10 m M Tris-HCl, pH 7.4, 100 m M NH4C1, l0 m M magnesium acetate, 5 m M 2-mercaptoethanol, followed by a 10-min incubation at 37o. 7 30S missing both proteins S1 and S21 can be obtained by passing 30S(-$21) obtained from the S21 mutant over the poly(U)-Sepharose column. 7 Both S21 and Sl labeled with different fluorophores can be incorporated into the same 30S particle for energy transfer studies. Labeled deacylated tRNA I've or AcPhe-tRNA is bound specifically to the ribosomal P site and labeled AcPhe-tRNA is bound specifically to the ribosomal P or A site by the methods of Wurmbach and Nierhaus. 41 Enzymatic binding of Phe-tRNA with either GTP or its nonhydrolyzable analogs is performed as previously described.42 35 A. R. Subramanian, P. Rienhardt, M. Kimura, and T. Suryanarayana, Eur. J. Biochem. 119, 245 (1981). 36 E. R. Dabbs, Laboratory for Molecular and Cell Biology, P.O. Box 30947, Braamfontein 2017, South Africa. 37 E. R. Dabbs, J. Bacteriol. 140, 734 (1979). 3s E. R. Dabbs, R. Hasenbank, B. Kastner, K.-H. Rak, B. Wartusch, and G. St6ffier, Mol. Gen. Genet. 192, 301 (1983). 39 E. R. Dabbs, J. Bacteriol. 144, 603 (1980). 4o E. R. Dabbs, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kxamer, eds.), p. 733. Springer-Verlag, New York, 1986. 41 p. Wurmbach and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 20, 5301 (1981). 42 W. Rychlik, O. W. Odom~ and B. Hardesty, Biochemistry 22, 85 (1983).
[ 11 ]
SEPARATION OF RIBOSOMAL PROTEINS AND t R N A s
187
Materials and General M e t h o d s All fluorescent probes used were obtained from Molecular Probes, Inc., Junction City, OR. Proteinase K, a product of E. Merck, was purchased through Beckman Instruments, Irvine, CA. Ribosomal RNA was extracted with phenol from E. coli K12, strain A19, ribosomal subunits. 33 23S and 5S RNA were separated by chromatography on Sephadex G-100. 33 The growth of E. coli and preparation of ribosomal subunits have been described. 12 Purified ribosomal subunits $21, LI 1, L27, and L28 were a gift from Dr. H. G. Wittman. 43 In some cases, purified ribosomal proteins were obtained by HPLC on a pBondapak C~s reversed-phase column by the method of Keflavage et al. 22 Ribosomal protein S1 was obtained by passage of 30S subunits over a poly(U)-Sepharose column followed by DEAE-cellulose chromatography as previously described. 35 The total proteins from the 30S subunit were isolated as described by Traub and Nomura 3~ and those from the 50S subunit as described by Schulze and Nierhaus. 34 Total protein mixtures lacking $21 or L 11 were obtained from ribosomal subunits isolated from the strains provided by Dr. E. Dabbs. a6,4° The mutants are designated VT442 ($21), 39 and AM68 (L11). 37 The 50S subunit of the L 11 mutant is devoid of L 11 while $21 must be selectively removed from the 30S subunit of the $21 mutant by a high-salt wash as previously described. 7 50S subunits missing L27 and L28 were also obtained from mutants AM 105 as and AM81, 37 respectively. Purified tRNA ~ from yeast and E. coli were obtained from Sigma, St. Louis, MO. Yeast tRNA ~e was aminoacylated as previously described44 except that a 0.5 M KC1 salt wash of ribosomes was used as the source of synthetase instead of the postribosomal supernatant. E. coli tRNA Phe was aminoacylated as described previously. 4 Acetylation of Phe-tRNA was with acetic acid hydroxysuccinimide ester by the method of Rappoport and Lapidot. 45 Acknowledgment This work was supported by Grants No. PCM81-12248 and DMB84-10063 from the National Science Foundation.
43 H. G. Wittmann, Max-Planck-Institut ffir Molekulare Genetik, Ihnestrasse 63-73, D-1000 Berlin 33 (Dahlem), Federal Republic of Germany. 44 B. Hardesty, W. McKeehan, and W. Culp, this series, Vol. 20, p. 316. 45 S. Rappolaort and Y. Lapidot, this series, Vol. 29, p. 685.
188
OTHER
BIOPHYSICAL
METHODS
[ 12]
[1 2] I s o l a t i o n a n d C h a r a c t e r i z a t i o n of Colicin Fragments of Bacterial 16S Ribosomal RNA By PETER H. VAN KNIPPENBERG and HANS A. HEUS Ribosomal RNAs are complex molecules that elude detailed analysis of their structures by physical techniques. Nevertheless, by the method of comparative sequence analysis highly sophisticated models of their secondary structures have been proposed. 1 These models are dominated by a multitude of stem-loop structures (hairpins). We have chosen to study in detail a particular hairpin structure near the 3' end of bacterial 16S rRNA (Fig. 1). This region is of special interest because (1) it is supposed to bind m R N A during initiation of protein biosynthesis through base pairing) (2) two adjacent Nt,N~-dimethyladenosines, conserved throughout nature, 3 are unmodified in kasugamycin-resistant (ksgA) bacteria, 4 and (3) one can cleave the 16S rRNA molecule at the site indicated in Fig. 1 with the bacteriocins colicin E3 and cloacin DF 135,6 and isolate the resulting "colicin fragment." This paper describes the large-scale purification of the colicin fragment from Escherichia coli ribosomes and illustrates its usefulness for physical studies. Essentially the same procedure can be followed to isolate colicin fragments from other bacteria. Some of the properties of these fragments will be described. Materials Bacterial Cells Escherichia coli wild-type MRE600 cells were purchased from Public Health Service, UK. Kasugamycin-resistant strains (ksgA) were grown in LB medium containing per liter: 10 g tryptone, pH 7.0, 5 g yeast extract, 8 g NaCI, 100 mg kasugamycin (Sigma). Cells were harvested at an optical
R. R. Gutell, B. Weiser,C. R. Woese,and H. F. Noller,Prog. Nucleic Acid Res. MoL BioL 32, 155 (1985). 2j. Shine and L. Dalgarno, Proc. Natl. Acad. ScL U.S.A. 71, 1342(1974). 3p. H. van Knippenberg, J. M. A. van Kimmenade, and H. A. Heus,Nucleic Acids Res. 12, 2595 (1984). 4T. L. Helser,J. E. Davies,and J. E. Dahlberg, Nature (London), New Biol. 233, 12 (1971). s C. M. Bowman,J. E. Dahlberp,T. Ikemura, J. Konisky,and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 68, 964 (1971). 6F. K. De Graaf, H. G. D. Niekus, andJ. Klootwijk,FEBSLett. 35, 161 (1973). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, inc. All rights of reproduction in any form r~erved.
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
189
I
in eukaryotes U ~
1400 i
):8
1500 j
A-U C-
IACACACCGmCmCCGt~IA
?AAGUCC~UAACAAGGUI ~CUCCUUAo. 1'
cross-link to wobble bose
A-U A-
colicin E3 cloacin OF13
' ' Shine and Dalgarno (prokaryotes)
FIG. 1. The 3' end domain of E. coil 16S ribosomal RNA. Nucleotides in boxes are conserved. For other details, compare text and P. H. van Knippenberg, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Spdnger-Vedag, New York, 1986.
density of 0.7-0.9 at 620 nm, washed once with STB10, and stored at - 8 0 °.
Buffers Standard buffer (STBx): 10 m M Tris-HCl, pH 7.6, x m M magnesium acetate, 60 m M NH4CI, 7 m M 2-mercaptoethanol RNA buffer: 0.1 M sodium acetate, pH 5.5 HPLCx buffer: 20 m M NaH2PO+'H20, 20 m M Na2HPO4" 12H20, 10x m M KC1 To prevent RNA degradation by contaminating RNases, buffers and plastic materials were autoclaved. HPLC buffers were filtered through Millipore filters (pore size 0.45 #m) before autoclaving. Sucrose solutions were treated with 0.1 mg/ml bentonite. Tubing, rotors, cuvettes, etc. were immersed in a 0.6% diethyl pyrocarbonate (Sigma) solution for at least 20 min and rinsed with sterile water. Methods
Isolation of Ribosomes Escherichia coli cells were ground with alumina (alumina: ceils = 2 : 1 w/w) in the presence of 0.2 nag DNase I (Boehringer Mannheim) per 50 g
190
OTHER BIOPHYSICAL METHODS
[ 12]
cells at 4 °. An $30 extract was obtained by centrifugation at 30,000 g for 1 hr. Ribosomes were isolated from the $30 extract by centrifugation at 105,000 g for 3 hr, washed with 1 M NH4CI in STB10, and stored in STB10 at - 8 0 o.
Gel Electrophoresis Low-molecular-weight RNA was run on 0.8 × 9 cm cylindrical gels containing 12% acrylamide and N,N'-methylenebisacrylamide (19.5 : 0.5, w/w) in a buffer containing 40 m M Tris-acetate, pH 7.6, 20 m M sodium acetate, 2 m M ethylenediaminetetraacetic acid (EDTA), and 0.1% sodium dodecyl sulfate (SDS). Gels were preelectrophoresed at 4 ° for 30 min at 5 mA/gel in the same buffer and run at 9 mA/gel for 2.5-3 hr until the bromphenol blue marker reached the bottom of the gel. Gels were immersed in 7% acetic acid for several hours and scanned at 260 nm with a Gilford 2600 spectrometer.
Sephadex G-150 Column Chromatography Sephadex G-150 (Pharmacia) was preswollen in RNA buffer as recommended by the manufacturer and autoclaved at 110 °. Low-molecularweight RNA was fractionated on a 3 × 35 cm column at a speed of 25 ml/ hr with 30 cm H20 pressure.
5'-32p-Labeling of Colicin Fragment RNA samples containing 0.05 A260 units colicin fragment were lyophilized and dissolved in a labeling mix containing 1/zl 10× C buffer (500 m M Tris-HC1, pH 9.0, 10 m M MgC12, 50 m M dithiothreitol), 5 gl H 2 0 , 1 gl T4 polynucleotide kinase (BRL, 1 unit/gl), 3 gl [?-32p]ATP (Amersham, 10/~Ci//tl; 3000 Ci/mmol). Incubation was for 30 min at 37 °. Determination of the D e g r e e of 165 r R N A Cleavage Before the start of a large-scale purification, the degree of cleavage of 16S rRNA is determined in a pilot experiment. Five A2~ounits of high-saltwashed ribosomes in 20/zl STBI0 buffer are incubated with 0.05/zg cloacin DFI3 (heat-activated for 10 rain at 90*) for 45 min at 42 °. Note that bacteriocin cleavage requires intact 70S ribosomes7 and that the Mg 2+ concentration should be at least 10 mM. The sample is mixed with an equal volume of formamide and electrophoresed on cylindrical gels of 12% 7 T. Boon, Proc. Natl. Acad. Sci. U.S.A. 69, 549 (1972).
[ 12]
COLICIN FRAOMENTSOF 16S rRNA
E tO ~4
191
55 rRNA tRNA = colicin rogrnent
e43
.13
migration
FIG. 2. Scansat 260 nm of cylindricalgelscontainingthe RNA of ribosomestreatedwith cloacinDFI 3 (uppertracing)and of untreatedribosomes(lowertracing). polyacrylamide. A control sample of ribosomes incubated in the absence of bacteriocin is included. Figure 2 shows a scan (Gilford 2600 spectrophotometer) of the sample and control gel at 260 nm. The high-molecularweight RNAs have barely penetrated the gel and the peaks represent (from left to right), 5S rRNA, tRNA, and colicin fragment. The percentage cleavage is calculated as % Cleavage
surface colicin fragment peak 14~ surface 5S rRNA peak X --._ × 100%
In the experiment in Fig. 2 the percentage cleavage is 54%. In our hands this number may vary from 20 to 70% for E. coli, depending on the batch of ribosomes. Ribosomes from the ksgA mutant ofE. coli show a comparable sensitivity to cloacin DF13. Ribosomes from a batch of commercial Bacillus stearothermophilus were virtually uncleaved by the bacteriocin, but bacteria grown in our laboratory were good substrates (40-90% cleavage). During all steps of the isolation of the colicin fragment, an aliquot is used to check its presence and the yield by gel electrophoresis. Large-Scale Purification of Colicin F r a g m e n t Ribosomes, 40,000 to 65,000 A260 units (from 200-250 g E. coli), are subdivided into portions of approximately 12,000 A26o units (1,000 A26o units/ml). One portion at a time is incubated for 60 min at 42 ° with 0.6rag (60pl) cloacin DFI3. At the end of the incubation period an
192
OTHER BIOPHYSICAL METHODS
[ 12]
aliquot is saved for dectrophoretic determination of the extent of cleavage as above. The remainder is diluted with 48 ml of STB0 buffer to bring the final concentration of Mg2+ to 2 mM. Six milliliters of 45% sucrose in STBI is added and the sample is layered on a 10-45% sucrose gradient in STBI buffer in the BXV zonal rotor of a MSE superspeed centrifuge spinning at a speed of 3,000 rpm. Rotor speed is increased to 27,000 rpm and centrifugation is continued for 22 hr. After returning the speed to 3,000 rpm, the contents of the rotor is pumped out with 50% sucrose in STB1 and fractionated into 70 fractions of 20 ml each. The fractions containing 30S subunits (hatched area in Fig. 3) are pooled and precipitated with 2 volumes of ice-cold ethanol. The precipitate is collected by centrifugation and dissolved in 20 ml RNA buffer. Twenty milliliters of buffer-saturated phenol is added and the mixture is stored at - 8 0 °. All 30S preparations in phenol are combined and SDS is added to 1%. After shaking, the water layer is separated and extracted two more times with phenol in the presence of 1% SDS. Residual phenol is removed by chloroform extraction, whereafter the RNA is precipitated with ethanol. The precipitate is dissolved in 0.1 M sodium acetate, pH 5.5 (20 ml for 10,000 A26ounits of 30S subunits). The colicin fragment is separated from the bulk of the ribosomal RNA by centrifugation on 5 - 20% sucrose gradients in RNA buffer using either swinging bucket rotors (Spinco SW27, 200 A260units of RNA per bucket, 16 hr at 25,000 rpm) or a zonal rotor (MSE superspeed BXV rotor, 10,000
E
C 0 ¢JO
o
0 Jo .o o
i
10
30
510
i'
70
fraction number
FxG. 3. Optical density (at 260 nm) profile of a sucrose gradient run of cloacin-treated and dissociated ribosomes in a zonal rotor. The hatched region (30S particles) was pooled for further processing.
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
193
E tO tO
o tO JO =.. 0 e~ 0
-.~
sedimentation
FIG. 4. Sucrose gradient centrifugation in a swinging bucket rotor (SW27) of RNA obtained from cleaved 30S ribosomes. Fractions C and D were used for further purification.
A26o units of RNA per run, 48 hr at 27,000 rpm). A typical profile of a separation on a SW 27 rotor is shown in Fig. 4. Fractions C and D of the gradient are combined, the RNA is precipitated with ethanol as before, and dissolved in 4 ml RNA buffer. Each portion (approximately 160 A260units of RNA) is loaded separately on a Sephadex G-150 column (3 × 35 era), equilibrated with RNA buffer, and eluted. The separation profile is shown in Fig. 5. The colicin fragment peak is collected, concentrated by ethanol precipitation, and washed several times by ethanol precipitation. Gel electrophoretic analysis of the final product is shown in Fig. 6. Occasionally, total RNA from cloacin-treated 70S ribosomes was applied directly to a zonal sucrose gradient centrifugation without prior separation of the subunits. Figure 7 shows the optical density profile of such a gradient and indicates the positions of colicin fragment and 5S RNA as analyzed by gel electrophoresis. The further separation of colicin fragment and 5S RNA requires the application of HPLC (compare below). The yields in various steps during a typical preparation are shown in Table I. The percentage cleavage in this experiment was 55%. Theoretically this would mean that about 360 A2~ounits of colicin fragment was present
194
E t-
OTHER BIOPHYSICAL METHODS
[ 12]
0.6-
O
LO t~
0.4 u tO
e0
.I0 0
J
0.2
0
lb
2b
3b fraction
sb
number
FIG. 5. Sephadex G-I50 column chromatography of RNA from fractions C and D in Fig. 4. The left-most peak is high-molecular-weight RNA eluting with the void volume and the peak at fraction 36 is coliein fragment.
in the cleaved ribosomes and hence that the final recovery of pure fragment was roughly 22% in this experiment. This material is sufficient and suitable for one-dimensional IH NMR experiments in the imino proton and aromatic region (see Ref. 8 and below). However, contaminating material (probably polysaccharide) originating from the Sephadex G-150 column makes the RNA unsuitable for NMR in the sugar and methyl proton region. In our current method for
E o
~0 u £3
£3 O
migration
FIG. 6. Gel electrophoretic analysis of the colicin fragment obtained from the Sephadex G-150 column in Fig. 5. s H. A. Heus, J. M. A. van Kimmenade, P. H. van Knippenber~ C. A. G. Haasnoot, S. H. de Bruin, and C. W. Hilbers, £ Mol. Biol. 170, 939 (1983).
[ 12]
COLICIN FRAGMENTS OF 16S r R N A
12-
195
-120 e-
E
E
c O LD
8
80
~0
<
m c
J~ t~
I0
o L -
lb
'ab fraction
'
sb
'
7b
c
oII
number
FIG. 7. Sucrose gradient centrifugation in a zonal rotor of total RNA extracted from cloacin DFl3-treated 70S ribosomes. The positions of colicin fragment and 5S RNA, as analyzed by gel electrophoresis of the fractions is indicated. large-scale preparation, the Sephadex c o l u m n has therefore been replaced by preparative H P L C . Separation by Preparative HPLC Low-molecular-weight R N A is dissolved in 2 ml H P L C 0 buffer and 1 ml is loaded on a Macherey and Nagel D E A E 500-10 c o l u m n (run by a L K B H P L C 2 1 5 0 - 2 1 5 2 apparatus) with H P L C 0 buffer at a speed o f l m l / m i n . T h e R N A is separated b y running a H P L C 3 0 - H P L C 7 0 graTABLE I YIELDSAT VARIOUSSTEPSDURINGA TYPICAL ISOLATIONOF COLICINFRAGMENTFROM Escherichia coli
Step
Yield (/126ounits)
E. call cells (240 g)
Washed ribosomes 30S ribosomes after zonal separation RNA from phenol-extracted 30S RNA from sucrose gradient (fractions C and D, Fig. 4) Colicin fragment from Sephadex G- 150 column
65,000 11,770 9,350 232 80
196
OTHER BIOPHYSICAL METHODS
[ 12]
E tO ¢'4
U
E L..
0
.t~ 0
1'O
2'o frQction
3'o
number
Fx~. 8. HPLCpurificationof partiallypure colicinfragmentobtainedby zonal centrifugation (Fig. 7). dient for 1 hr at 1 ml/min, followed by a 20 min HPLC70-100-100 gradient to wash contaminating higher-molecular-weight RNA from the column. The colicin fragmem is resolved in one peak as can be seen in Fig. 8. Fractions of 2.5 ml are collected. Colicin fragment-containing fractions are precipitated with ethanol, dissolved in 500 gl H20, and dialyzed twice against 250 ml H20. Dialysis, like separation of low-molecular-weight RNA on HPLC, is crucial to obtaining pure fragment suitable for taking NMR spectra covering the entire spectral range. Analysis of the Purity of the Colicin F r a g m e n t Analysis of the final product is done by SDS-gel electrophoresis on cylindrical gels followed by scanning of the gel with UV light (Fig. 6). Although the purity of the colicin fragment may also be checked by gel electrophoresis and autoradiography of 5'-32p-labeled RNA, such an analysis is a hazardous criterion for purity since especially high-molecularweight RNA contaminants may escape detection (compare below).
[ 12]
COLICIN FRAGMENTS OF 16S rRNA
Isolation of 32p-Labeled Colicin
197
Fragment
For certain experiments (e.g., probing structure by enzymes or chemicals, or to determine the sequence) very small amounts of colicin fragment labeled with 32p suffice. Colicin fragment, 0.05 to 0.5 A26o units, can be isolated by running aliquots of cleaved ribosomes on 12% polyacrylamide gels and eluting the colicin fragment band with 1 M NaC1 (1 - 2 hr at room temperature). After phenol and chloroform extraction the RNA is precipi-
Fzo. 9. Autoradiogram of purified 5'-riP-labeled colicin fragments. Left lane, fragment from a ksgA mutant of E. coli. Right lane, fragment from wild.type E. coli. For an explanation of the difference in mobility, compare R. van Charldorp, H. A. Heus, and P. H. van Krdppenberg, Nucleic Acids Res. 9, 267 (1981), from which this figure is reproduced.
198
OTHER BIOPHYSICAL METHODS
[12]
tated twice with ethanol. Fragment, 0.05 A26o units, is labeled with [y-32p]ATP and T4 polynucleotide kinase. No prior phosphatase treatment is required since the fragment contains a free 5'-OH end. Labeling at the 3' end is done using 5'-[32P]pCp and T4 RNA ligase. Note that in this case the length of the fragment is extended by one nucleotide. Labeled RNA (either 3' or 5') is electrophoresed on a 20% polyacrylamide slab gel (20 × 20 × 0.1 cm) in 7 M urea at 300 V for 4 hr. The gel is briefly exposed to a Fuji X-ray film, locating the position of the fragment. The appropriate segment of the gel is cut out, eluted with 1 M NaC1 (60 min at room temperature), and precipitated with ethanol. Figure 9 gives an example of labeled RNA preparations obtained in this way. Such preparations may sometimes appear slightly degraded. Properties of Colicin Fragments
Melting Characteristics Colicin fragments display, as expected, a main melting transition corresponding to the 3' terminal helix shown in Fig. 1. In the past, w e 9'1°
Ox ,,, ~ . o -
0.0
~
1;
7
.
'
/\1~"\.1/" //~.
~
3'0
"
'
5'0
'
'
\
\
~'
7'0
'
9'0
Temp. (°C) 10. Differential optical melting curves of colicin fragments of wild-type Escherichia coli( ), Bacillus stearothermophilus ( - - - ) and Agrobacterium tumefaciens (--" ~). Reproduced from van Knippenberg and HeusJ 2 ~.
9 R. van Charldorp, H. A. Heus, and P. H. van Knippenberg, Nucleic Acids Res. 9, 4413
0980.
~oH. A. Heus, L M. A. van Kimmenade, and P. H. van Knippcnberg, Nucleic Acids Res. l l , 203 (1981).
[ 12]
COLICIN FRAGMENTSOF 16S rRNA
199
TABLE II MELTING TEMPERATURES (Tm) OF HAIRPINSa
Colicin fragment
E. coil wild type
E. coli mutant
B. stearothermophilus wild type
B. stearothermophilus mutant A. tumefaciens Bacillus subtilis
Na + concentration (M)
Technique
Tm (*C)
0.015 0.200 0.015 0.215 0.015 0.200 0.015 0.215 0.015 0.200 0.015 0.015 0.015 0.015
UV optics UV optics Calorimetry Calorimetry UV optics UV optics Calorimetry Calorimetry UV optics UV optics Calorimetry UV optics UV optics UV optics
52 73.5 55 74 57 76 60 76.5 69.5 77 70 71 60 60
a Reproduced from van Kippenberg and Heus.~2
published additional sharp transitions that could not readily be explained. We know that in those studies these transitions were caused by impurities in the sample. Erroneously we assumed that, when a preparation ofcolicin fragment displayed only one radioactive band after electrophoresis of a sample that was 5'-32p-labeled, the fragment was pure. Figure 10 illustrates the melting profiles (displayed as the first derivative, AA/ATversus 7) of preparations that were pure as determined by UV scanning of cylindrical gels. Table II shows Tm values obtained by UV melting and microcalorimetry with various colicin fragments from a number of bacterial strains. The destabilizing effect of adenosine dimethylation on the structure of the hairpin is clearly demonstrated.
High-Resolution IH NMR The use of IH NMR in the study of the structure and dynamics of RNA molecules is well established.~I The presence of a double-stranded region is evidenced by low-field resonances due to imino protons of the base pairs. Such studies require some 200- to 300-gl samples with a concentration of approximately 1 raM. For the colicin fragment, this means approximately 3 - 5 mg (75-125 A2~o units of RNA). Figure 11 illustrates the spectra at 500 MHz of fragments obtained from wild-type E. coli and from its kasugamycin-resistant derivative. The assignments of the peaks were H A. Heerschap, C. A. G. Haasnoot, and C. W. Hilbers, Nucleic Acids Res. 10, 6981 (1982).
200
OTHER BIOPHYSICAL METHODS
6-C 6 A-U 2 U -68/9
5 16
G-C~
0-6 3
.II
C-67 A - U 1? A - U
8
7
A
I
9
2 wild type
~ 1'5
[ 12]
14
. , ~mutant
1'3
12' '
li
ppm FIG. 11. Five hundred megahertz 'H NMR spectra of colicin fragments obtained from wild type and a ksgA strain of E. coll. Arrows indicate shifts of resonances due to absence of methyl groups on the two neighboring adenosines in the hairpin loop. Insert gives assignmerits based on NOE. Reproduced from Heus et aL8
based on nuclear Overhauser effects (NOEs). Details of these studies and of experiments with fragments from B. stearothermophilus have been reported elsewhere. 8,12 The use of the E. coli colicin fragment for studies of the interaction with the initiation factor 3 (IF3) has also been described. 13
12p. H. van KnippenberB and H. A. Heus, J. Biomol. Struct. Dynam. 1, 371 (1983). 1~E. Wickstrom, H. A, Heus, C. A. G. Haasnoot, and P. H. van Knippenberg, Biochemistry 25, 2770 (1986).
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
[ 13] P h y s i c a l S t u d i e s o f R i b o s o m a l Interactions By
203
Protein-RNA
DAVID E. DRAPER, INGRID C. DECKMAN, and
JAILAXMI V. VARTIKAR
Introduction Specific RNA-protein interactions have long been recognized as an essential feature of ribosome assembly and function. Molecular details of these interactions have been difficult to obtain, and studies of R N A protein complexes have lagged far behind analogous work on D N A protein interactions. The availability of synthetic RNA fragments from in vitro transcription I now makes it possible to ask how size or sequence variants of an RNA affect protein binding, and spectroscopic studies of relatively small ribosomal (r) protein 2- RNA complexes are feasible. To undertake physical studies of r-protein-RNA complexes, methods for measuring the thermodynamics of the interactions and for discriminating specific from nonspecific binding are essential. Typical binding constants are on the order of l0 7 M -1, which means that protein and RNA concentrations of less than - 1 pA4 must be used for binding constant measurements. Intrinsic tryptophan or tyrosine fluorescence of proteins is frequently useful in this range, but of the r-proteins we have tested so far, none shows an adequate change in fluorescence intensity upon binding rRNA. Therefore we have had to rely on methods which physically separate radioactively labeled r-protein-rRNA complex from the free components. In this article we discuss three such methods, and point out potential artifacts in detecting specific interactions. The work we describe deals with r-protein $4 binding a specific site on the a mRNA, 3 but should be applicable to other r-protein interactions with rRNA or mRNA fragments. Filter Assay for Binding The nitrocellulose filter assay is probably the most rapid and widely used method for detecting protein-nucleic acid interactions. Protein is incubated with radioactively labeled RNA, and rapidly filtered through a i D. E. Draper, S. A. White, and J. M. Kean, this volume [ 14]. 2 Abbreviations used: r-protein, ribosomal protein; TCA, trichloroacetic acid; D T r , dithiothreitol. 3 I. C. Deckman and D. E. Draper, Biochemistry24, 7860 (1985). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988 by AcademicPress,Inc. All fightsof reproductionin any formr~ervcd.
204
P R O T E I N - R N A INTERACTIONS
[ 13]
nitrocellulose membrane. In an ideal case, the protein binds tightly to the membrane, and any RNA bound to the protein is retained as well and detected by scintillation counting. The assay does not always work this way: complexes of r-proteins with large rRNAs, for instance, are not retained by the filter. 4's It should be emphasized that the assay is a nonequilibrium method. Protein and RNA-protein complex are physically removed from solution over a period of time, which has the potential of perturbing the position of the equilibrium. However, equilibrium binding constants have been obtained by this method for a number of D N A protein and RNA-protein complexes.6-9
Purification of r-Proteins We use the standard r-protein preparation developed by Kurland et al., l°,t~ with some modifications to adapt the chromatography step to high-performance liquid chromatography (HPLC). 70S ribosomes from 50-70 g of Escherichia coli MRE 600 are prepared as described, t° and extracted with acetic acid without separating subunits. H The protein is dialyzed first against 15% acetic acid, and then against column buffer [6 M urea (BRL Ultrapure), 20 mMdisodium phosphate, 0.5 mMdithiothreitol (DTT), adjusted to pH 5.6 with methylamine]. The protein is loaded onto a preparative cation-exchange HPLC column (Bio-Rad TSK SP-5-PW, 21.5 × 150 mm), and eluted with a 500-ml gradient from 0 to 0.4 M KC1 in column buffer. The gradient is pumped at 0.5 ml/min by two Bio-Rad HPLC pumps controlled by an Apple computer with software and hardware furnished by Interactive Microwave. Protein peaks are detected by absorbance at 230 nm in an Isco UA-5 flow monitor, equipped with a 2-mm HPLC flow cell. Proteins are identified by electrophoresis with authentic r-protein standards in two different acrylamide gel systems [SDS-urea (pH 8.0) and acetic acid-urea (pH 4.5)]. Fractions containing a desired protein are pooled, diluted by about a factor of two with column buffer containing no KC1, and rerun on a smaller version of the same cation-exchange HPLC column (7.5 × 75 mm) using a shallower gradient over the appropriate salt range. $4 obtained this way was better than 95% 4 j. Schwarzbauer and G. R. Craven, Nucleic Acids Res. 9, 2223 0981). 5 j. Schwarzbauer and G. R. Craven, this series, Vol. 59, p. 583. 6 M. Yams and P. Berg, J. Mol. Biol. 28, 479 (1967). 7 A. D. Riggs, H. Suzuki, and S. Bourg~is, J. Mol. Biol. 48, 67 (1970). 8 D. C. Hinlde and M. J. Chamberlin, J. Mol. Biol. 70, 157 (1972). 9 j. Carey, V. Cameron, P. deHaseth, and O. C. Uhlenbeck, Biochemistry 22, 2601 (1983). ~0C. G. Kurland, this series, Vol. 20, p. 379. H C. G. Kurland, S. J. S. Hardy, and G. Mora, this series, Vol. 20, p. 381.
[13]
RIBOSOMAL PROTEIN-RNA INTERACTIONS
205
pure as determined by a densitometer scan ofa Coomassie Blue stained gel. The protein is stored at - 7 0 ° in the column elution buffer. Two methods can be used to concentrate the protein, if necessary. The peak fractions from the ion-exchange column can again be diluted and loaded onto the same column, but eluted with column buffer containing 0.5 M KC1 to obtain a sharp, concentrated peak of protein. We have also used acetone precipitation to concentrate small volumes of $4 protein without loss of RNA binding activity. An aliquot of protein in column buffer (with or without KC1), kept on ice, is diluted with 5 volumes of ice cold acetone. After 15 rain at 0 ° the precipitate is centrifuged, dried, and resuspended in a small volume of column buffer. The precipitation is essentially quantitative.
Preparation opS S-Labeled RNA mRNA or rRNA fragments containing the r-protein binding site are prepared by T7 RNA polymerase transcription of cloned DNA. Preparation of T7 RNA polymerase and plasmid DNA containing a T7 promoter have been described) We have found asS to be a convenient isotope for labeling the RNA fragments. Sufficiently high specific activities are obtained without the problems with radiation damage associated with 32p. 35S-labeled RNA can be used for more than a month, where 32p-labeled RNA is badly degraded in less than 2 weeks. To carry out a transcription, add the following components in order to a 1.5-ml plastic centrifuge tube: H20 to make 100/~1 final volume 20~tl 5X buffer (200raM Tris, 4 0 r a M MgC12, 125raM NaC1, 25 m M DTT, pH 7.6) 10 #1 NTPs (from stock of 10 m M each ATP, CTP, UTP, GTP) 40 units placental RNase inhibitor (Promega Biotec) 3/~g linear DNA template 1 #Ci [ot-3~S]ATP (-400 Ci/mmol) 1.5/~g T7 RNA polymerase Incubation is for 1 hr at 37*. If adequate precautions are taken in preparing RNase-free, sterile solutions, the RNase inhibitor is not necessary. The efficiency of nucleotide incorporation into transcripts is checked by precipitating an aliquot of the reaction with tdchloroacetie acid (TCA). Dilute 3/A of the reaction into 50/~1 of 0.5 mg/ml tRNA, 0.1 M sodium pyrophosphate, 40 m M ethylenediaminetetraacetie acid (EDTA). Add 450/~1 of ice-cold 10% TCA. Let the mixture sit on ice for 10 rain, and then suction filter through a 2.4-cm glass fiber filter (Whatman GF/C)
206
PROTEIN- RNA INTERACTIONS
[ 13]
prewetted with a solution of 0.1 M sodium pyrophosphate and 1 M HC1. After filtering the sample, rinse the filter several times with 10% TCA, then once with the pyrophosphate-HC1 wetting solution, and finally with 95% ethanol. Dry for I 0 rain at 100 ° and count in 3 ml of scintillation fluid. For comparison, spot l/zl of reaction directly onto a glass filter, then dry and count as for the filtered samples. Typically, 50-70% of the ATP is incorporated into TCA-precipitable material. To purify the RNA easily and quickly, we use a disposable "NENSorb" reversed-phase column (New England Nuclear). Dilute the transcription reaction with 100/zl of 100 mMTris, l0 m M triethylamine, 1 m M E D T A ajusted to pH 7.6 with HCI (buffer A), and load onto a column which has been previously rinsed with 3 ml methanol followed by 1 ml buffer A. Rinse the column with 1 ml Buffer A, then 1 ml of water, and elute the RNA with 300/A 50% ethanol. Precipitate the RNA by adding 20/zl of 3 M sodium acetate and 400/A absolute ethanol, and leave the mixture on ice for I hr. Then centrifuge the RNA (3 min in a microcentrifuge), dry the pellet under vacuum, and resuspend in 100/d l0 m M Tris, 1 m M Na2EDTA, pH 7.6. The integrity of the RNA is checked by electrophoresis of the transcript on a 0.8 m m - 20 cm acrylamide-urea denaturing gel. 12 About 4/zl of a transcription reaction contains sufficient RNA to be seen by ethidium bromide staining. The gel can also be exposed directly to X-ray film; about 105 cpm of 35S are sufficient to expose preflashed film overnight. Generally the full-length transcript is the only product visible on the gel, and we usually make no attempt to purify the RNA further.
Filter-Binding Assay To carry out a tiltration using the filter-binding assay, the protein and RNA are renatured separately, incubated together under the desired conditions, and filtered. Plastic Eppendorf-type tubes are used for the incubations, and glass micropipets for making protein and RNA dilutions. Protein Renaturation. A series of protein dilutions is made into the 6 M urea protein column buffer. For each assay, 1/zl protein at the appropriate concentration is diluted into 20/zl of 350 m M KC1, 30 m M Tris, 10 m M 2-mercaptoethanol, pH 7.6, and incubated at 37 ° for 30 min. RNA Renaturation. The RNA transcript is diluted into TMK buffer (30 m M Tris, 350 m M KC1, 20 m M MgC12, pH 7.6) to a final concentration of 600- 1000 cpm//tl, and warmed to 65* for 5 rain. Complex Formation and Filtration. After letting the protein and RNA cool to room temperature for at least 5 rain, the binding assays are pre12A. Maxarnand W. Gilbert, this series,Vol. 65, p. 499.
[ 13]
RIBOSOMAL PROTEIN-RNA INTERACTIONS
207
I00 -
75 c ~D
< Z
50
g~
25
rr"
I
I
I
I
2
5
4
Is4], × ,o~M FIG. 1. Typical S 4 - R N A binding isotherms. Filler-binding assays were carried out in 2 m M MgC12, 350 m M KC1, 30 m M Tris, p H 7.6, at 4", using an ot m R N A fragment. The two curves were obtained with two different preparations o f the same RNA. (@) K = 1 × 107 M - t , rm = 0.75; (O) K = 1 × 107 M - t , rm = 0.56.
pared by adding 24 #1 buffer (adjusted to give the final desired concentrations of MgC12, KC1, and Tris) and 5 gl RNA to the protein. After a 10-min incubation at the assay temperature, 50 #1 of the reaction is removed and pipetted directly onto a 25-mm nitrocellulose membrane sitting on a fritted glass disk under suction (Millipore HAWP or S&S BA85 filters give similar results). Before filtration, the filters are degassed in buffer of the same final salt concentrations as the assay. The filter is dried at 100 ° for 20 min, and counted in 3 ml of scintillation fluid. For each group of assays performed under a particular set of conditions, two controls are run in duplicate. One is filtration of a complete reaction mix with the protein replaced by the 6 M urea protein column buffer; this gives the background level of RNA retention by the filter (usually 8 - 12%). The other control is to count 5 gl of the renatured RNA which has been pipetted directly onto a filter. Typical titrations are shown in Fig. 1.
Factors Affecting the Assay Under most conditions, less than 100% of the input RNA is retained on the filter at high protein concentrations; usually some lower value, referred to as the "retention efficiency," is attained. This is evident in the data shown in Fig. 1. The reason for this is not understood, but is commonly observed among both RNA and DNA binding proteins, s,9,~3 In our studies ~3 C. P. Woodbury, Jr., and P. H. von Hilapel,
Biochemistry22, 4730
(1983).
208
PROTEIN- RNA INTERACTIONS
[ 13]
of the S 4 - a m R N A complex, the efficiency ranges from 25 to 90%, depending on the conditions. For any one RNA preparation and set of binding conditions, the retention efficiency is quite reproducible from day to day. Different RNA preparations vary in retention efficiency, though the same binding constants are measured (Fig. 1). Others working with small synthetic RNA helices have also noted that retention efficiencies vary between preparations, and presume that trace impurities affect the assay. 9 We have looked at several variables which might influence the assay efficiency as follows. Filtration Volume and Filter Washes. With some protein- nucleic acid systems, it is possible to rinse the filter with buffer once or several times to reduce the background of nonspecifically bound RNA. In some cases the rinsing also affects the retention of complex and distorts the shape of the titration curve, s Table I shows the effect of successive 50-#1 aliquots of buffer applied to the filter after the initial 50-gl reaction. The complex is clearly very sensitive to washing. This observation suggested that the assay volume filtered might affect the retention; perhaps a large volume would have the same effect as a subsequent wash. Reactions from 25 to 150#1 were tested, all having the same concentration of protein and same total amount of RNA (Table I). Very little effect is seen. Filtration Rate. The rate at which the binding assay is pulled through the filter does not affect the retention efficiency at total filtration times up
TABLE I EFFECTS OF FILTRATION VOLUME AND FILTER RINSES ON COMPLEX R E T E N T I O N a
Number of 50-/zl rinses
Percent retention
Assay volume ~1)
Percent retention
0 1 2 4
33 17 14 8.5
25 50 75 100
24 31 30 34
a Filter-binding assays were carded out as described in the text, using $4 and a mRNA in TMK buffer. In the first group, filtration of the 50-/~1 incubation mix was followed by the indicated number of 50-/tl rinses of TMK buffer at 10-see intervals. In the second set, the same concentration of $4 and ~ e same total amount of RNA were filtered in different volumes.
[ 13]
RIBOSOMAL PROTEIN RNA INTERACTIONS -
209
TABLE II BUFFERCOMPOSITIONAND TEMPERATURE EFFECTS ON FILTER RETENTION EFFICIENCIESa Temperature (°C)
[KCII (raM)
[MgC12](mM)
rm
4 4 4 37 4
175 350 600 350 350
2 2 2 2 20
0.78 0.65 0.28 0.35 0.40
a Filter-binding assays were carded out as described in the text; all assays contained 30 m M "Iris, pH 7.6, besides the indicated salts. The maximum filter retention, rm, was found from a double reciprocal plot of the binding data as described.
to 15 sec. This observation also suggests that the position of the proteinRNA equilibrium does not shift significantly during filtration. Buffer Composition and Temperature. The retention efficiency depends on the temperature and composition of the buffer filtered. This is illustrated by the data in Table II. In general, increasing urea, increasing salt, and increasing temperature all decrease the retention. At very high salt (>0.6 M KC1) the retention starts to increase with salt concentration. There is no correlation between retention efficiency and equilibrium constant. Among protein-nucleic acid interactions which have been carefully studied by filter-binding assays, there is substantial variation in the filter retention efficiency and the sensitivity of the retained complex to subsequent buffer washes.S,9 This probably reflects the fact that each protein interacts with nucleic acids and nitrocellulose differently, and emphasizes that control experiments need to be done for each binding protein studied. Renaturation of Components. The standard protocol for renaturing r-proteins and rRNA from denaturing solvents has been to dilute into a high-salt buffer (such as TMK: 30 m M Tris, 20 m M MgC12, 350 m M KC1, pH 7.6) and warm to - 4 2 ° . 14,t5 We have performed a series of binding curves with $4, using different RNA and protein renaturation conditions but assaying for binding in TMK buffer at a low temperature (4 °) to trap any partially renatured components. The data are summarized in Table ~4p. Traub and M. Nomura, J. Mol. Biol. 40, 391 (1969). 15 S. H. Tindall and K. C. Aune, Biochemistry 20, 4861 (1981).
210
eROTEIN- RNA INTERACTIONS
[ 13]
TABLE III EFFECTS OF RENATURATION CONDITIONS ON COMPLEX FORMATION a
RNA [MgC12] (raM)
$4 protein [MgCI2I (raM)
KOuM-')
0 20 20
0 0 20
3.5 25 20
a Protein and RNA were renatured separately in 350 m n KCI, 30 m M Tris, pH 7.6, and the indicated MgCI2 concentration, at 37* for 30 min (protein) or 65* for 30 rain (RNA), and the filter-binding assay carried out in TMK buffer at 4".
III. We can omit M g 2+ from the protein renaturation buffer and still obtain identical binding results. However, Mg 2+ dearly aids RNA renaturation and recognition of $4. This requirement for Mg 2+ in renaturation may be peculiar to the a mRNA. Mg 2+ does not induce any new structures in tRNA,16 and monovalent salts and Mg 2+ are interchangeable in enhancing renaturation of 5S rRNA.17
Calculation of Binding Constants In calculating an equilibrium constant from a set of filter binding assays, there are two variables to fit to the data: the equilibrium constant and the filter retention efficiency. (A potential third variable is the stoichiometry of the complex, discussed below.) There are several well-known graphical methods for determining best-fit values. Here we describe the procedure we have found best suited to filter-binding data: (1) The cpm retained on the filter at each protein concentration is converted to the fractional retention, r, by first subtracting the background RNA retention, and then dividing by the total number of cpm applied to the filter. (2) The reciprocal of the fractional retention is plotted as a function of the reciprocal of the protein concentration, for the five or six titration points at highest protein concentration. This plot should give a straight line with an intercept at l/rm, where rm is the extrapolated retention at infinite protein concentration. (3) The double reciprocal plot can be used to determine the le p. E. Cole, S. K. Yang, and D. M. Crothers, Biochemistry 11, 4358 (1972). ,7 E. G. Richards, R. Lecanidou, and M. E. Geroch, Eur. J. Biochem. 34, 262 (1973).
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
21 1
equilibrium constant K as well as the maximum retention, but data obtained at low protein concentrations are heavily weighted in this kind of plot. Instead, we use a simple graphics program to display the titration data on a microcomputer. The program superimposes on the data a hyperbolic titration curve calculated from the equation: e = Ro(r/r,,) + (r/r,,)[K(1 - r/r,)]
The curve is generated by stepping through evenly spaced values of r between 0 and r,, to find the protein concentration, P, at each point. In most cases the total RNA concentration, Ro, is much less than the input protein concentration, and the first term can be neglected. The calculation assumes that only one protein binds per RNA molecule; the situation where the binding stoichiometry is to be determined as well is discussed below. A nonlinear least squares program is then used to fit a hyperbolic curve to the data. After an initial guess is made at the binding constant K, a small correction factor to be added to K, a, is calculated using the formula a~---
- E 4Ai (A0 2
where Ai = P#(I + KPi) 2 and Li = [r,,KP#(1 + KPi)] -'- ri. Pi and ri are the protein concentration and retention at each titration point. The procedure is repeated with the corrected value of K until a is suitably small. Visual inspection of how well the data fit the curve is important. As an alternative to using a double reciprocal plot to estimate rm, the least squares fitting can be repeated with a series of r,, values, and the value giving the smallest sum of squares, ~(Li)2, used. A program carrying out these calculations and graphics displays in Microsoft Basic on the Macintosh computer is available from the authors.
Binding Stoichiometry
The filter-binding assays described above use a large excess of protein over RNA, and calculations assume that only one protein binds per RNA molecule. This assumption should be tested, of course; higher protein-toRNA binding ratios may indicate nonspecific binding. Partially inactive preparations of protein or RNA may also affect the apparent binding stoiehiometry. To determine the RNA protein stoichiometry, the filterbinding assay already described is used, only with approximately stoiehiomettle concentrations of RNA relative to protein. For these titrations it is convenient to prepare RNA of 10- to 100-fold lower specific activity. The RNA specific activity is found from the specific activity of the ATP in the
PROTEIN- RNA INTERACTIONS
212
I00
[ 13]
-
.2 .rE O
E
50
O IE
*~
25-
0'.2 [ $ 4 ] , p.M
0,4
Fro. 2. Stoichiometry of the S4-cx mRNA complex. ¢x mRNA fragment, 2.9 X 10-7 M, was titrated with $4 protein. The upper curve was calculated with K ==2 X 107 M -~ (found in titrations with very low RNA concentrations) and assuming one $4 binds per RNA molecule. The lower curve was calculated with the same K but assuming 50% of the protein is inactive in binding. [Reprinted with permission from Deckman and D r a i n . 3 Colwright © 1985, American Chemical Society.]
transcription reaction and the number of A residues in the transcript. TM In superimposing a binding curve on the data, the RNA concentration must of course be inserted in the equation for Po. An example is shown in Fig. 2. If the data do not fit a single site binding isotherm, further interpretation can be difficult. For instance, filter-binding data cannot distinguish protein only 50% active in binding from the case of two binding sites on the RNA molecule. If there are multiple sites, RNA molecules with one, two, or more proteins bound may be retained on the filter at different (unknown) efficiencies. These complications, and methods for dealing with them, have been described in detail by Woodbury and von Hippel.m3
Does the Complex Exchange or Dissociate? It is useful to measure the complex association and dissociation rates as a check for irreversible aggregation of RNA and protein. Rates of the order ,s Under the RNA polylllerase reaction conditions recommended here, the incorporation of [O~-35S]ATP and [¢~-32PlATP into RNA transcripts is identical. ~5S incorporation can therefore be used in calculating the concentration of RNA transcripts.
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
213
of 0.1 sec-~ and slower can be measured in a filter-binding experiment. Association rates are measured by simply mixing the components and filtering aliquots at various times. Dissociation rates can be measured by a "concentration jump" experiment, i.e., diluting the binding assay rapidly, filtering aliquots at different times, and observing the approach to a new equilibrium. By choosing an initial protein concentration giving about half to two-thirds of the maximum retention, a five to tenfold dilution gives a new equilibrium value very close to the background retention. Alternatively, unlabeled competitor RNA can be added in large molar excess over the protein, so that once dissociation takes place reassociation with labeled RNA is unlikely. Because we have had problems with high background retention of RNA at the higher RNA concentrations required for competition, dilution has been the better method. Both the association and dissociation of the S 4 - m R N A complex are fast, and essentially complete in the time it takes to filter the first time point, - 10 sec. If the association rate is diffusion controlled (/q ~- 107 M sec- ~for a protein the size of $4 ~9) and the reaction is carried out at 10-7 M protein, the association will be 50% complete in less than 1 sec. Since the S 4 - m R N A equilibrium constant is 2 × l0 T M -~, the dissociation rate should be 0.5 sec-~, a factor of three to four faster than detectable by filter binding. Thus the association rate cannot be much slower than the diffusion controlled limit. Sucrose gradient sedimentation, gelpermeation chromatography, and gel electrophoresis have been commonly used to separate r-protein-rRNA complexes from free protein (see following discussions); these techniques require minutes to hours to perform. 2° If the rapid association and dissociation kinetics of $4 apply generally, determinations of r-protein binding stoichiometry or affinity by these methods will be biased by dissociation of the complex during the experiment.
Nonspecific Binding Artifacts In measuring the $4 affinity for a series of 16S rRNA fragments by the filter binding assay described here (i.e., the retention of a low concentration of labeled RNA by a large excess of protein), we found that the apparent affinity decreases as the fragment is lengthened in some cases. 16S rRNA, for instance, binds more weakly than an rRNA fragment containing bases 1 to 559, and the affinity is much lower than that measured by other techniques (Table IV). Others observed that complexes of $4 or other ~9R. A. Albcrtyand G. G. Hammes,J. Phys. Chem. 62, 154 (1958). 20R. A. Zimmermann,this series,Vol. 59, p. 551.
PROTEIN- R N A INTERACTIONS
214
[ 1 3]
TABLE IV S4-RNA BINDINGCONSTANTSDETERMINEDBYDIFFERENTMETHODSa Binding constant K (#M-l) RNA ct139 16S rRNA 5' 16S domain tRNA 23S fragment
Filter assay (labeled RNA)b 20 4 13 0.06 2.3
Filter assay (labeled $4)~
Sucrose gradient d
18
25 50
Competition e 38
a Binding constants were all determined in TMK buffer at 4°. The tRNA binding constant was measured at several lower salt concentrations and the affinity extrapolated to the ionic strength ofTMK, tx139 RNA is a 190 base RNA fragment containing the first 139 bases of the tx operon transcript. The 5' 16S domain contains bases 1-559 of the 16S rRNA, and the 23S fragment encompasses 844-1347 of the 23S rRNA. b Filter binding assays performed as described in the text and Fig. 1, looking for the retention of labeled RNA by an excess of protein. Binding constants are from I. C. Deckman and D. E. Draper, £ MoL Biol. 196, 313 (1987), and unpublished data ofJ. V. Vartikar and D. E. Deckman. c From Ref. 4. The measurement was of loss of pH]S4 from filters with increasing concentrations of 16S rRNA. d Sucrose gradient sedimentation of RNAs with [3H]$4, as described in the text and Fig. 4A. Competition between the ol mRNA fragment and "16S" rRNA, as shown in Fig. 4B. The calculation presumes 16S rRNA binding constant determined by sucrose gradient sedimentation.
r i b o s o m a l proteins with intact 16S r R N A are n o t retained o n filters, a n d b i n d i n g constants were estimated b y m e a s u r i n g the decrease in labeled protein b o u n d to filters with increasing r R N A concentrations. 4,5 ( N o t e that these assays required a p p r o x i m a t e l y stoichiometric a m o u n t s o f R N A a n d protein.) W e explain these results in the following way. W i t h relatively short R N A fragments, the specific S 4 - R N A c o m p l e x is retained o n the nitrocellulose filter a n d a hyperbolic titration is o b t a i n e d at protein concentrations t o o low to i n d u c e nonspecific R N A binding. W i t h very large fragments (or intact 16S r R N A ) the specific c o m p l e x does n o t b i n d to filters ( p e r h a p s because the R N A s u r r o u n d s the protein a n d prevents c o n t a c t with the filter). Therefore retention o f R N A is observed o n l y at higher c o n c e n t r a t i o n s o f protein, where a significant level o f nonspecific b i n d i n g takes place.
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
215
Gel Mobility Shift Assay Because of a suggestion that protein-nucleic acid complexes might have unusually slow dissociation rates when trapped in an acrylamide gel matrix) ~ we attempted to detect specific S 4 - m R N A complexes by gel electrophoresis. We started with basically the same protocol as originally used by Gardner and Revzin to detect CAP protein-DNA complexes.22 Renaturcd protein and RNA were equilibrated in TMK buffer as for a filter-binding assay, but including 10% glycerol. The sample was loaded onto a 10 cm × 0.8 mm, 6% acrylamide gel made either in 160 m M Tris, 10 m M sodium acetate, 1 m M EDTA (made pH 8.0 with acetic acid) or the same buffer diluted by a factor of four. Tracking dye was omitted from samples, but run in side lanes on the gel. Gels were run at 150 V; in some trials 300 V was used for 5 min to quickly separate bound and free RNA. A typical autoradiogram is shown in Fig. 3A. A second, slower moving RNA band was observed only at the higher protein concentrations. The band of free RNA steadily decreased in intensity with increasing protein concentration. Presumably the RNA-protein complex has dissociated during electrophoresis, leaving a smear of RNA through the gel. Using the amount of free RNA to estimate a binding constant consistently gave K ~ 3 × l0 s M -l, independent of the clectrophoresis conditions. This is nearly an order of magnitude lower than the specific binding affinity determined from filter binding experiments. In addition, the same experiment repeated with another mRNA fragment known to bind nonspecifically (Table IV) gave identical results (Fig. 3B). We conclude that the specific S 4 - a mRNA complex dissociates too rapidly to be detected by this technique, even if the complex is electrophoresed rapidly into the gel. Nonspecific binding is enhanced in the lower salt buffer used for the running buffer, which may account for its detection. Our results agree with those of Revzin et al., 23 who recently concluded that the gel matrix does not slow the dissociation of a protein-DNA complex. Sucrose Gradient Assay Sedimentation and gel permeation chromatography have also been used in the past to detect roprotein binding to rRNA. 2°34 These methods have advantages over electrophoresis in that a wider range of salt concenzl M. Fried and D. M. Crothcrs, Nucleic Acids Res. 9, 6505 (1981). 2z M. M. Gardner and A. Revzin, Nucleic Acids Res. 9, 3047 (1981). z3 A. Revzin, J. A. Ceglark, and M. M. Gardner, Anal. Biochem. 153, 172 (1986). 24 M. Moug¢l, B. Ehrcsmann, and C. Ehresmann, Biochemistry 25, 2756 (1986).
216
PROTEIN- RNA INTERACTIONS
I
2
[ 13]
3
4
5
6
7
2
3
4
5
6
A
I
B
Fro. 3. Gel electrophoresis of the S4-RNA complexes. (A) Complex with a mRNA. Lanes 1-7 contained 0, 0.07, 0.14, 0.23, 0.34, 0.51, and 0.68 gMS4, respectively. The RNA concentration was 0.23 #M. (B) Complex with LI7 RBS RNA (see Table IV). Lanes 1-6 contained 0, 0.031, 0.063, 0.28, 0.25, and 0.63 g M $4, respectively. The RNA concentration was 0.16 gM.
trations can be used, and the RNA or protein concentrations can be more readily estimated. (At the beginning of electrophoresis the protein and RNA are concentrated into a thin band of unknown concentration.) While the technique has been used to obtain qualitative evidence for specific interactions in the past, it should be possible to make quantitative measurements as well. Draper and von Hippel have demonstrated that the distribution of labeled binding protein in a sucrose gradient after sedimentation with various concentrations of a large DNA could be used to obtain a good estimate of the equilibrium binding constant. 25 Since the slower sedimenting protein is continually "shed" and left behind as the complex 25 D. E. Draper and P. H. yon Hippel, Biochemistry 18, 753 (1978).
[ 13]
RIBOSOMAL PROTEIN - R N A INTERACTIONS
217
moves through the gradient and reequilibrates with the lower concentrations of protein remaining, calculation of the binding constant must take into account not only the amount of protein remaining with the DNA peak at the end of the run, but also the distance of sedimentation. Sedimentation can be used as a binding assay only when the proteinRNA complex has a significantly greater S value than the protein alone; this limits its application to r-protein binding rRNA fragments larger than - 5S. However, once the binding constant for a large RNA is determined, the relative affinity of small fragments may be found in a competition type experiment. In this section, we show how the $4 affinities for 16S rRNA and a mRNA can be found by these techniques.
Preparation of [3H]-S4 [3H]$4 is prepared by reductive methylation of protein lysines with formaldehyde and [3H]sodium cyanoborohydride,u To label purified $4, dialyze 100/A of $4 ( - 50 gg, 2 nmol) overnight against 0.2 M boric acid, 0.25 M KC1, 6 m M p-mercaptoethanol, adjusted to pH 8.4 with NaOH. Add 5/ll ofa 1:3200 dilution of 37% formaldehyde into the same borateKCI buffer (about a 5 fold molar excess over protein lysines). Let sit for 5 rain at room temperature. Resuspend 1 mCi [3H]sodium cyanoborohydride (Amersham, 10 Ci/mm specific activity) in 30/zl of 0.5 M KOH. Add 15/A of this to the protein solution (a 2 - 3 molar excess over formaldehyde). After 20 rain at room temperature, the mixture is dialyzed against a number of changes of 0.35 M KC1, 20 m M Tris, 6 m M fl-mercaptoethanol, pH 7.6, to remove unreacted cyanoborohydride. (A microdialysis apparatus from Health Products, Inc., with - 1 0 0 gl wells, was used.) A 1/A sample of the protein is counted once or twice a day until no further change in the number of counts per minute is seen, about three days. This procedure methylates only one lysine per two to ten $4 molecules, but the specific activity is high enough that only 1- 10 n M protein need be used in the sedimentation experiments.
Large-Scale RNA Transcriptions To obtain sufficient RNA for the sucrose gradient, the transcription reaction mix is scaled up to 0.5 or 1.0 ml. The reaction is exactly the same as described above for preparing 35S-labeled RNA, only the [a-3SS]ATP is omitted. The reaction mix is loaded directly onto a 1.6 )< 50 cm Superose 12 column (Pharmacia), and the RNA eluted at 0.6 ml/min with 0.1 M NaC1, 20 m M Tris, pH 7.6) Pooled fractions from the RNA peak yield 8 A26ounits of transcript per milliliter of reaction.
218
PROTEIN- RNA INTERACTIONS
[ 13]
Determining the Absolute $4-16S rRNA Affinity First prepare 5.0 ml sucrose gradients, using a linear gradient of 5 -20% sucrose (Sigma, RNase-free grade), appropriate buffer (e.g., TMK buffer used in the filter binding assays), and 30 pg/ml BSA (to reduce loss of protein). Equilibrate at the desired temperature. Then prepare the protein-RNA complex, renaturing each component separately as described for a filter binding assay. A final concentration of about 1 p M RNA is appropriate if a final binding constant of about 107 M -~ is expected. BSA is added to 30/lg]ml in the final reaction mix. Renaturation of RNA at the higher concentrations required for these assays sometimes leads to aggregation; in particular we have noticed that 16S rRNA and some larger fragments tend to dimerize when heated at 65 ° in TMK buffer. Aggregation does not occur when renaturation is carried out at 40 ° in TMK. A pair of control gradients, comparing the sedimentation profiles of renatured and nonrenatured RNA, is a good idea. Equilibrated RNA-protein complex, (50-100/d) is layered on top of the sucrose gradient, and the gradient centrifuged until the RNA is about halfway down the tube. In a Beckman SW55 rotor, 40,000 rpm for 4.5 hr at 5 o is appropriate for 16S rRNA (see Fig. 4). The tube is punctured, 5 drop fractions collected into scintillation vials, and the sample counted in 3 ml of"Ready Gel" (Beckman) plus 0.2 ml water. The product of the equilibrium constant (K) and the concentration of protein binding sites on the RNA (L) is given by KL
-i]-']
where P/Po is the fraction of protein migrating with the RNA, and n is the number of fractions the RNA peak has migrated. (For the purposes of calculation, the volume of a fraction should be the same as the volume of the layered sample.) The formula was derived by supposing that each time the protein-RNA complex migrates one fraction further into the gradient, free and bound protein have equilibrated, leaving some of the protein behind. As the peak of RNA moves down the gradient it broadens, which affects protein binding in two ways: As the RNA is diluted it binds protein more weakly, but as the peak broadens free protein has a higher chance of rebinding RNA. The two effects tend to cancel over a wide range of sedimentation conditions. A much more detailed justification of this equation is given in Ref. 19. The method makes several assumptions. First, an excess of protein binding sites over the protein is assumed; using r-proteins labeled by reductive methylation, protein concentrations of 1 10 n M can be used to -
[ 13]
RIBOSOMAL PROTEIN- RNA INTERACTIONS
219
200
200
A
== 15°
~ 150
E ~ 100
~. 100
•-~ 5 0 oO
8
50
10
20
30
40
50
0
Fraction number
10
20
30
40
50
Fraction number
FIG. 4. Sucrose gradient sedimentation of [3H]$4 with ribosomal and messenger RNA. The protein-RNA complexes were prepared as described in the text, and sedimented for 4.5 hr at 40,000 rpm, 5 °. Sedimentation is from leit to right. (A) With 0.5 # M "16S" rRNA; (B) with 1.0 g M "16S" rRNA and 1.0 g M of a 190 base RNA fragment containing the first 139 bases of the a mRNA transcript. The "16S" RNA used in these experiments was made by T7 RNA polymerase transcription and covers bases 1- 1509 of the 16S rRNA.
measure binding constants greater than 108 M - L Second, equilibration of the protein-RNA complex must be rapid compared to the time of sedimentation. As shown by attempts to measure association and dissociation rates by the filter binding assay, this is true for $4 protein. Formation of the complex must not have a very large change in molar volume, or the position of the equilibrium will be influenced by the pressure developed during sedimentation. Again, this is usually not a problem for proteinnucleic acid complexes. Of course the binding constant calculated depends on how many protein binding sites per RNA are assumed. The sedimentation profile of $4 with 16S rRNA shown in Fig. 4A gives a binding affinity of 2.5 × 107 M -t, assuming one site per RNA (Table IV).
Determining the Relative Affinity of S4 for 16S rRNA and a mRNA In Fig. 4B the same sucrose gradient experiment as in Fig. 4A is repeated, except with the addition of ot mRNA as well as 16 S rRNA. The concentration of rRNA used is sufficient to carry along - 9 0 % of the $4 protein in the absence of the mRNA, so the slower moving peak of protein is due to competition [for $4 binding] by the more slowly sedimenting mRNA. From the mass action law, the ratio of the two binding constants is given by KdK
= (P,/P
)(RJRO
where (P~/Pz) is the ratio of protein bound to RNAs 1 and 2, and Rt and R2 are the initial concentrations of the two RNAs.
220
PROTEIN- R N A INTERACTIONS
[ 13]
Comparison of Different Methods The results we have presented here show that a good deal of caution is needed in developing an assay for specific r-protein-RNA binding. Since r-proteins tend to be basic, it is not surprising that promiscuous binding to a variety of RNAs is observed, and in some assays this binding may overwhelm the detection of specific complexes. Certainly the gel mobility shift assay is measuring nonspecific binding only. $4 affinities for five RNAs, measured by several different methods, are summarized in Table IV. Affinities measured by the sucrose gradient technique tend to be high, this is probably a systematic error reflecting approximations used in calculating the binding constant. 25 However, the 16S rRNA affinity measured by filter retention of labeled RNA by $4 is much too low and is comparable to nonspecific binding of other large RNA fragments. As discussed above, the specific comples of $4 with very large RNAs is apparently not retained by filters, while nonspecific S4-RNA complexes and specific $4 complexes with RNAs less than - 600 bases are retained. The apparent nonspecific binding affinity detected in the filter retention assay varies by over an order of magnitude depending on the RNA, the affinity is not a simple function of the RNA length (J. V. Vartikar, unpublished observations). We conclude that the filter retention assay is useful, but one has to be aware that (1) specific and nonspecific complexes of protein with the same RNA may be detected with widely different efficiencies, and (2) the level of competing nonspecific binding may change dramatically as the endpoints of the RNA fragment change. The sucrose gradient assay described here is probably easier to interpret, as it depends only on the reequilibration of protein and protein-RNA complexes during the time of the sedimentation run. Although the absolute affinities measured may be systematically off by a factory of two or three, changes in affinity with RNA sequence or buffer composition should be accurately detected. The relative affinity of a small RNA fragment and a large RNA for a protein should also be measured accurately in competition experiments. The simplicity of the sucrose gradient assays and the unambiguous interpretation of the results should make them a useful complement to filter binding asays for quantitative studies. Acknowledgments This work was supported by NIH grant GM29048, and D.E.D. acknowledges the support of a Research Career Development Award (CA 01081).
[ 14]
RIBOSOMALRNA FRAGMENTS
221
[ 14] P r e p a r a t i o n o f S p e c i f i c R i b o s o m a l R N A F r a g m e n t s By DAVID
E.
D R A P E R , SUSAN
A.
WHITE,
and JOANNE M.
KEAN
Introduction In recent years major advances have been made in delineating the secondary structures of the large ribosomal RNAs (rRNA), both by phylogenetic comparisons, ~,2 and by structure-mapping techniques.3 While this work is a major advance in defining the rRNA secondary structures, much remains to be done in understanding the RNA tertiary folding and the functional significance of different structures. Physical studies of rRNA fragments may be helpful in this regard. Series of fragments of different sizes can be used to define r-protein binding sites, and small fragments are more amenable to spectroscopic and thermodynamic techniques which can give specific information about structural features. Studies of the 49-base colicin fragment from the 3' end of the 16S rRNA, for instance, have been important in defining its RNA hydrogen bonding, stability, and interactions with proteins? We describe here two general techniques for preparing fragments of the large ribosomal RNAs. A hybridization selection scheme cuts the desired fragment out of purified rRNA. This method is inconvenient for preparing large amounts of RNA, but preserves modified bases in the sequence. The second method is in vitro transcription of the RNA from a DNA template. This method is suitable for preparing large quantifies of RNA, and can also be used to prepare a series of sequence variants. RNA fragments we have prepared for studies of the central domain of the 16S rRNA will be described. Hybrid Selection Principle This method is illustrated in Fig. 1. The rRNA sequence of interest is cloned into a single-stranded phage DNA, which is then used to protect that region of rRNA from nuclease digestion. The D N A - R N A fragment H. F. Noller and C. R. Woese, Science 212, 403 (1981). 2 R. R. Gutell, B. Weiser, C. R. Wocse, and H. F. Noller, Prog. Nucleic Acid Res. Mol. Biol. 32, 155(1985). 3 B. J. Van Stolk and H. F. Noller, this volume [32]; S. Stern, D. Moazed, and H. F. NoUer
[33]. 4p. H. van Knippenbergand H. A. Heus,this volume[12]. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
222
~
PROTEIN- RNA INTERACTIONS
T! RNosel, ~ - ~ " ~
IBSrRNA ~
ssoo
f
..-.--.~--
8-0 ' %HCONH~..__ t ÷
[ 14]
/3=P_AT
P
,,.0.
-N'
FIG.I. SchemeforpreparingrRNAfragmentsbyhybridizationselection.[Reprinted with permission from Rean et al. 8 Copyright © 1985, American Chemical Society.] See text for explanation.
hybrid is end-labeled and the strands separated. The possible end points of the fragment are limited only by the sequence of cloned DNA and the use of T~ nuclease (G-specific) for the digestion. Both phage DNA and rRNA are easy to purify, and in principle 1- 10 nmol preparations of almost any sequence should be possible. For reasons described below, the strand separation step must be done in relatively dilute volumes, which limits the convenient size of a preparation to ~ 1 nmol. Cloning in f d Phage DNA fragments containing appropriate rRNA sequences have been obtained from the plasmid pKK3535, containing the entire rrnB cistron2 Because of initial difficulties with the stability of cloned inserts in singlestranded DNA phage, we have used the fd cloning vectors containing antibiotic-resistance genes developed by Hemuann et al., 6 and propagated these by transformation into HB 101 or other bacterial strains resistant to filamentous phage infection. Preparation of DNA restriction fragments and their ligation into linearized phage RF DNA are carded out by standard cloning techniques.7 Candidate clones are screened by testing phage DNA for hybridization to [3H]rRNA. In the case of a 340-bp FnuDII DNA fragment covering bases 528-867 in the 16S rRNA sequence, the DNA could be cloned into the SmaI site of fdl06 only in the orientation giving hybridization (phage F61), and these clones deleted the inserted DNA very rapidly? Other fragments covering J. Brosius, T. Dull, D. D. Sleeter, and H. F. Noller, J. Mol. Biol. 148, 107 (1981). 6 R. Herrmann, IC Neugebauer, E. Pirkl, H. Zentgraf, and H. Schaller, Mol. Gen. Genet. 177, 231 (1980). T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982. s j. M. Kean and D. E. Draper, Biochemistry 24, 5052 (1985).
[ 14]
RIBOSOMAL R N A FRAGMENTS
223
the 16S rRNA cloned in either orientation with equal frequency (e.g., the HindlII fragment from 82-649) and were much more stable. We have also made stable clones of the 5' 614 base pairs of the 16S rRNA gene and a 500-base pair fragment of the 23S rRNA gene in M 13 derivatives. We do not know why the FnuDII fragment is deleterious to cell growth. To test phage for the insertion of DNA fragments, transformed cells are plated on agar, and individual colonies grown in 3 ml broth. A 0.5-ml aliquot of culture is extracted with an equal volume of phenol-chloroform (1 : 1), then with ether, and ethanol precipitated after adding sodium acetate to 0.3 M. The DNA pellet is resuspended in 50 gl TNE buffer (0.4 M NaCI, 20 m M Tris, 1 m M Na:EDTA, pH 8.0), 20,000 cpm of [3H]rRNA (prepared according to Dennis and Nordan 9) added, and incubated at 65 ° for 4 hr. Then 10gg of pancreatic RNase in 0.5 ml of TNE is added and incubated for 30 min at 37". The solution is filtered with suction through a 25-mm nitrocellulose membrane (Millipore. HAWP or S&S BA85). The filter is rinsed five times with 1-ml aliquots of TNE and then with 95% ethanol. Finally, the filter is counted in 3 ml of scintillation fluid and compared to a control hybridization to which no DNA was added.
Hybridization Selection Growth and Preparation of Phage DNA. We found that the ribosomal sequence inserted in phage F61 rapidly deleted when it was propagated in bacteria growing in broth. The problem was not as severe with clones of other rRNA sequences we constructed, but still bothersome, and phage yields were usually low. M9 medium, 7 with 0.4% glycerol substituted for the glucose, gave good yields of phage (> 10 ~ phage/ml) and deletions accumulated only very slowly. To prepare phage, Escherichia coli HB 101 is transformed with the phage replicative form + and plated on standard agar with the appropriate antibiotic (colonies do not form on minimal agar). The next day individual colonies are picked and grown in M 9 glycerol medium with vigorous aeration at 37 o. After ~ 24 hr of growth, the cells are pelleted and the supernatant is made 3% in polyethylene glycol (Sigma, MW 8000) and 3% in NaC1. The precipitated phage are pelleted (20 min at 10,000 rpm in 500-ml bottles) after sitting in the cold for several hours. Finally, the phage are resuspended in 50 m M "Iris (pH 8.0) and banded in a CsC1 step gradient prepared exactly as described by Yamamoto et al. 1oPhage from 2 liters of culture are layered in a 6-ml volume on 9 p. p. Dennis and D. H. Nordan, J. Bacteriol. 128, 28 (1976). to K. R. Yamamoto, B. M. Alberts, R. Benziger, L. Lawhorne, and G. Treiber, Virology 40, 732 (1970).
224
PROTEIN- RNA INTERACTIONS
[ 14]
top of 19 ml of CsC1 (density range 1.39-1.25 g/ml) and spun at 35,000 rpm and 8* in a Beckman type 55 rotor. The phage are precipitated from the CsCI by adding 0.1 volume of 30% polyethylene glycol, and resuspended in 50 m M "Iris, 2.5 m M Na2EDTA. The solution is extracted twice with phenol saturated with the same buffer; the first extraction is warmed to 65 ° , while the second is at room temperature. After extracting with ether twice, the phage DNA is precipitated with 0.1 volume 7.5 M ammonium acetate and 2.5 volumes ethanol. The yield is 2 - 5 mg DNA per liter of culture. Preparation ofrRNA. Crude ribosomal RNAs are obtained from preparations of ribosomal proteins, either by acetic acid 11or LiCit 2 extractions of ribosomes. The rRNA, in 50 m M sodium acetate, I m M E D T A , 1% SDS (pH 5.0) is phenol extracted twice and ethanol precipitated. The 16S and 23S rRNAs can be separated by chromatography on a DEAE column using a 0.3 to 0.5 MNaC1 gradient, in 0.1 M Tris, pH 7.6. Hybridization and Labeling Conditions. Phage DNA and rRNA are annealed in 0.4 M NaC1, 10 m M Tris, 1 m M Na2EDTA at 65". DNA concentrations o f - 1 p M are used, with a 1.2- to 1.5-fold excess ofrRNA. At these concentrations the hybridization is complete within 20 min. Unhybridized RNA is then degraded with 6000 units/ml of Tt RNase, incubated at 37 ° for 2 hr. The best yield of fragment is obtained if the RNase is inactivated by a further 1.5 hr digestion with 100/tg/ml proteinase K and 0.5% SDS. The entire reaction ( 1 - 2 ml) is then run over a 1.6 × 45 cm Sephacryl S-500 gel filtration column (Pharmacia) equilibrated with 10 m M Tris, 1 m M Na2EDTA, 0.2 Msodium acetate, pH 7.6. The D N A rRNA hybrid elutes near the void volume, and is precipitated with 3 volumes of ethanol. At this point the RNA is usually end-labeled with 32p for structure mapping or protein binding studies. The hybrid labels satisfactorily, but not as efficiently as tRNA or other small RNAs. This may be because the large amount of single-stranded DNA is inhibitory, and the RNA ends may not be very accessible in the hybrid. 5'- and 3'-end-labeling are accomplished according to standard RNA labeling protocols ([),-32p]ATP and polynucleotide kinase, or cytidine [32p]bisphosphate and T4 RNA ligase, respectively),t3 About 20 pmol is labeled in a 30-/tl volume. 3'-End-labeling requires prior dephosphorylation, using calf intestinal phosphatase (15 min at 55 ° in 50 m M Tris, pH 8.0) followed by heat inactivation t~ C. G. Kurland, S. J. S. Hardy, and G. Mora, this series,Vol. 20, p. 381. ~2 j. A. Litflechildand A. L. Malcolm, Biochemistry 17, 3363 (1978). t3 j. M. D'Alcssio, in "Gel Elcctrophoresis of Nucleic Acids" (D. Rickwood and B. D. Haines, cds.),p. 173. IRL Press, Oxford, England, 1981.
[ 14]
RIBOSOMALRNA FRAGMENTS
225
(45 min at 65 °, with 10 m M E D T A added), phenol extraction, and ethanol precipitation. After labeling the hybrid is precipitated with 15/zl ammonium acetate and 135/zl ethanol. Denaturing Gel Filtration of Hybrids. The dried precipitate is taken up in 40gl of 0.1 M HEPES, 2 m M Na2EDTA, pH 7.6, 10/zl of 10% SDS added, then 0.2 ml formamide (formamide is first stirred with Bio-Rad AG 501-X8 ion exchanger and filtered, to obtain a conductivity > l05 ohm/ cm). In this buffer the strand separation temperature is - 35 °, but once the hybrid is melted renaturation in the low salt is very slow at room temperature. Thus the hybrid is heated to 65 ° for 5 min, and then applied to a Sephacryl S-500 gel filtration column (1 X 25 cm) equilibrated with 80% formamide, l0 m M HEPES, 1 m M Na2EDTA, pH 7.6, run at room temperature. The DNA elutes in 8 - 9 ml followed by the labeled RNA in a broad peak at - 15 ml. The RNA is concentrated by precipitation with 0.1 volume 3 M sodium acetate, 3.5 volumes ethanol, and - 5 0 / t g carrier RNA. Much higher concentrations of hybrid can be kept denatured in the 80% formamide buffer for long times at room temperature, but a limiting factor is the capacity of the column. Under the low salt conditions required, the DNA concentration inside the column cannot exceed - 2 OD2so/ml. If higher concentrations are loaded, the peak broadens and resolution is lost. A 1 X 25 cm column can handle about 160 #g hybrid (50 pm of fd phage DNA), and the pooled RNA fragment fractions have a concentration less than l0/zg/ml for the 345-bp fragment (10 pmol/ml). The difficulty of recovering the RNA from such a dilute solution without added carrier makes optical studies of these RNA fragments only marginally practical. Denaturing Gel Electrophoresis of Hybrids. Better resolution of the full-length RNA fragment from the low background of degraded RNA is obtained by electrophoresis of the hybrid. After denaturing the hybrid in forrnamide, the solution is applied to a 4-cm slot in a 2-mm thick × 20-cm long acrylamide-urea gel (5% acrylamide, 50% urea, in 40 m M Tris, 40 m M sodium acetate, 1 m M Na2EDTA, to pH 8.0 with acetic acid). The gel is run at 150 V for 3 hr. Similar results have been obtained with acrylamide- formamide gels. ~4The labeled RNA can be autoradiographed, the band excised, and the RNA extracted by the "freeze and squeeze" technique) 3 Attempts to scale up the procedure to higher hybrid concentrations were unsuccessful. Only partial denaturation is obtained, probably because the hybrid initially concentrates into a thin band in the gel and renatures during electrophoresis. 14 T. Maniatis and A. Efstratiadis, this series, Vol. 65, p. 299.
226
PROTEIN- R N A INTERACTIONS
[ 1 4]
In Vitro Transcription Principle Cloning vectors containing promoters for SP6, T3, and T7 phage promoters, as well as the phage RNA polymerases, are commercially available. These systems were designed for the preparation of single-stranded hybridization probes, but they can equally well be used to make rRNA sequences for physical studies. The approach is to prepare plasmid DNA containing an rRNA sequence in between a phage promoter and a convenient restriction site. After the plasmid is linearized with the restriction enzyme, run-off transcription provides the rRNA fragment. Use of a phage promoter rather than an E. coli promoter has two advantages. First, the promoter is not expressed in vivo, avoiding the possible deleterious consequences of synthesizing ribosome fragments in the cell. Second, some of the phage polymerases are easy to purify in large quantities. Since the phage T7 RNA polymerase has been expressed at very high levels in E. coil it is currently the best choice when RNA is to be made for physical studies, and this article will deal only with it. Except for some minor changes in reaction conditions, we have obtained very similar results with the SP6 RNA polymerase. Sequence Constraints There are limitations on the 5' and 3' sequences which can be transcribed. All strong T7 promoters in T7 DNA begin transcription with the sequence pppGGGAGA. 15 Weaker promoters in the phage DNA show some variation from this sequence, though pyrimidines are found infrequently. Table I shows several variant T7 promoter sequences we have used. Sequences 1 through 4 all give 60-70% incorporation of triphosphates into RNA transcripts within 30 min, using an excess of RNA polymerase, 0.1 mg/ml linear DNA, 1 m M of each NTP, and the reaction conditions described below. Sequences 4 and 5 are poor promoters (< 20% incorporation under similar conditions), apparently because of an extremely high level of abortive initiation, producing short transcripts (the behavior of sequence 5 is further discussed below). It appears that base 6 of the transcript should be a purine to obtain a high level of nucleotide incorporation, while transcription is relatively insensitive to the bases at positions 3 through 5. The 3' end of the transcript is affected by the requirement for a restriction site to linearize the plasmid. Enzymes leaving a 3' overhang at the 15j. j. Dunn and F. W. Studier, £ Mol. Biol. 166, 477 (1983).
[ 14]
RIBOSOMALRNA FRAGMENTS
227
TABLE I 5' TRANSCRIPT SEQUENCES FROM T7 PROMOTERSa I. 2. 3. 4. 5.
pppGGGAGACC... ppLC,-~JCCUGGA... pppGGCAGAUC... pppGC.,-GUCUCG... pppGGGAUCUC ...
a T h e five sequences were transcribed using the s a m e strong T7 p r o m o t e r sequence at positions - 17 to -- 1. P r o m o t e r sequences 4 a n d 5
were significantly poorer than the consensus sequence 1 (see text). Underlining indicates positions of homology with sequence 1. Sequence 1 was obtainedfromthe plasmid pT7-1 (US Biochemicals),sequence2 from pAR2369 (kindly provided by F. W. Studier), and sequences 3 through 5 by insertion of synthetic DNA into the StuI site of pAR2369. DNA terminus should be avoided, as a significant level of spurious, very long transcripts is obtained, perhaps because the polymerase can initiate at such a terminus. In our experience, a 5' overhanging end gives clean transcription, but usually a mix of transcripts of length n and n - 1 nucleotides is obtained. This is a serious problem if the transcript is to be 3'-end-labeled for structure mapping experiments. Our experience with different restriction enzymes is summarized in Table II. Stable secondary structure in the transcribed RNA does not seem to affect transcription. The plasmid pBA21 codes for a very stable 23-base hairpin helix at the 5' terminus of the transcript (see below), but similar levels of nucleotide incorporation are obtained with a 16-nucleotide transcript lacking the hairpin, and 23 or 230 base transcripts containing it.
Cloning To illustrate the use of transcription for preparing rRNA fragments, we describe two series of fragments we have made to examine the role of a single-base bulge in 16S rRNA structure and protein recognition. The cloning strategies we used are shown in Fig. 2. Enzyme digestions and transformation of bacteria are standard techniques and described in detail elsewhere. 7 Plasmids Coding for an Extended Hairpin from 16S rRNA. We wished to study the structure and protein binding properties of the extended hairpin at bases 655-755 in the 16S rRNA sequence. We had previously
228
PROTEIN- RNA INTERACTIONS
[ 14]
TABLE II 3' TERMINI OF T7 RNA POLYMERASETRANSCRIPTSa
DNA 3' terminus 5' GGG 3' CCC 5' GGG 3' CCC 5' CGT 3' GCA 5' GAT 3' CTA 5" GC 3' CGAGT 5' GG 3' CCCTAG 5' GG 3' CCCTAG 5' CT 3' GAGATC a
Source
Transcdpt length (bases)
Abundance of n, n - 1 length transcripts
SmaI
23
1, <0.05
Sinai
143
1, <0.1
RsaI
110
1, 0.2
EcoRV
117
1, 0.1
DdeI
122
1, 0.1
BamI
200
1, 1.2
BamI
488
1, 1
XbaI
494
1, 2
Transcripts were prepared as described in the text, Y-end-labeled with cytidinep2P]bisphosphate and T4 RNA ligase, and partial digests with T~ RNase run on sequencing gels. The presence of multiple ends shows up as "shadow" bands in the sequence. Gel autoradiograms were scanned in a densitometer to measure intensities.
observed unusually high ethidium affinity at a sequence adjacent to a single-base bulge (base A747), and suspected that the bulged base might be responsible for the enhanced affinity. 16 Others have suggested that singlebase bulges may be important for protein-RNA recognition, 17 and the protein S15 probably recognizes the region surrounding this bulge. 18,~9 Thus we wanted to prepare this hairpin sequence with and without A747. The following steps gave us the desired plasmid clones: 1. A HindlII-SalI DNA fragment covering the region (bases 648826) was obtained from a plasmid carrying the rrnB operon, pKK3535, 5 and cloned into the polylinker of pT7-2, a plasmid carrying the phage T7 promoter followed by a set of unique restriction sites (US Biochemicals). 16j. M. Kean, S. A. White, and D. E. Draper, Biochemistry 24, 5062 (1985). 17 D. Peattie, S. Douthwaite, R. A. Garrett, and H. F. Noller, Proc. Natl. Acad. ScL U.S.A. 78, 7331 (1981). ,s R. MOiler, R. A. Gatrett, and H. F. Noller, J. Biol. Chem. 254, 3873 (1979). 19 R. A. Zimmermann and K. Singh-Bermann, Biochim. Biophys. Acta 563, 422 (1979).
[ 14]
229
RIBOSOMAL R N A FRAGMENTS
A
Hind lll-Hoe BI frogment Sinai rRNA bosee 649-734)[linker
l(,6s
PTZ .
~
[GGGAGACCGGAAGCTT .
. . .
#
GGCGGCCCCGGGCGAGCT~ Smo I Soc I
Hind TIT
cut with SmoI,SocI phosphotose ligote
with
pCTGGAcGAAGACTGATATCAGCT i
i
i
i
i
i
i
i
GACCTGC
PT7 •
~
I
. , . ~ . /
f6S
i
rRNA
'GGGAGACGGGAAGGTT. . . .
i
J i
i
i
i
0
i
i
TCTGACTATAGp
648-753 ~
Doses
I
CGCOGTGGACG(A)AGACTGAGG~Eco ATR AV TG
B PT7 I~IGGGGT
~
CGGGGG
Stul
Stool 9
cut with StuI, SmoZ phosphatose
ligote with p G T C T C G A G T T T T C G N A G A C C C
.............
~
CAGAGCTCAAAAG
.... ~
TCTG
p
PT7 I--'---~GG G T O TO GAG T T T T O G(N) A G A CG G G G G
(x.....
Xho~
SmoZj/)
cut withStagT transcription
GU
pppGGGUGUGGA i
i
i
i
i
L
i
i
i
GGGAGAGGU U U (N)
FIG. 2. Schemes for preparing clones ofrRNA fragments and variants. (A) Preparation of a piasmid coding for the S 15 binding region of 16S rRNA. (B) Preparation of an RNA hairpin reproducing a helix with a singly-base bulge in the S15 binding region of 16S rRNA. The vector shown is a derivative of pAR2369 (provided by F. W. Studier), a pBR322 derivative containing a T7 promoter immediately followed by a unique StuI restriction site. See text for a discussion of the cloning protocols.
230
PROTEIN- R N A INTERACTIONS
[ 14]
2. The pT7-2 derivative was then digested with HaelII (GG'CC) to give a large number of fragments. This collection of fragments was ligated with a 10 fold molar excess of a linker containing a SmaI restriction site (d(CCCC'~), obtained from New England Biolabs), and digested with SmaI. Subsequent digestion with HindlII, followed by ligation with the pT7-2 plasmid previously cut with HindlII and SmaI, should result in only two different DNA fragments cloned. The desired plasmid was obtained with low efficiency (1 out of 12 candidates tested). Subsequent experiments showed that much better efficiency is obtained with a 50100 tool ratio of linker to HaelII fragments, and a slight molar excess of dephosphorylated vector over fragments. 3. The new plasmid clone (priSM, see Fig. 2A) was digested with Sinai and Sad and a synthetic DNA fragment inserted. One strand of the synthetic DNA carried the complete rRNA sequence, while the other had a single base deletion ofA747. Replication of the ligated plasmid should give two different sequence plasmids. After transforming the ligation mixture, plasmid DNA was purified from the bacteria and retransformed, to ensure the isolation of bacteria containing only one plasmid sequence. DNA from individual colonies was screened for the presence or absence of an MboII site (GAAGA), indicating the presence or absence of A747. About equal numbers of both sequences were found.
Preparation of DNA Coding for a Small RNA Helix. To carry out more detailed studies of the effects of a single-base bulge on RNA helix conformation, we wished to prepare a short RNA molecule reproducing the sequence around A747. The easiest approach was to design an RNA hairpin and clone the appropriate synthetic DNA sequence. The desired hairpin is shown in Fig. 2B. The first and last three bases were chosen to give T7 RNA polymerase promoter activity and a restriction site, respectively. The remainder of the sequence duplicates 6 bp of the S 15 binding region and provides a hairpin loop. To investigate the role of the bulge base in altering helix structure, we wanted to prepare helices with different bulged bases, and with no bulge. Preparation of the appropriate DNA involved the following steps: 1. DNA sequences were prepared on an automated synthesizer. One of the two strands coded for the "bulgeless" helix, with the other had a mixture of all four bases at the bulge site. The two strands were separately phosphorylated with polynucleotide kinase and then hybridized. 2. The DNA fragment was ligated between the StuI and SmaI sites of a plasmid containing the T7 promoter. Notice that the two Gs of the StuI site are the first two bases of the transcript. 3. After transformation into bacteria, plasmid DNA was isolated and
[ 14]
RIBOSOMAL R N A FRAGMENTS
231
retransformed. Individual colonies were grown up and their plasmid DNA tested for the presence of SmaI and XhoI restriction sites. Plasmids having inserts were transcribed and the RNA sequenced, by the following protocol. Crude plasmid DNA is isolated from 1 ml of bacterial culture by a standard alkaline lysis protocol.2° The plasmid is digested with restriction enzyme (SmaI in this case) for 1 hr in 50/zl with 50 ng of pancreatic ribonuclease (previously boiled to denature DNases). The reaction is run over a "NENSorb" (New England Nuclear) reversed-phase column2~ to remove nucleases and other contaminants. After precipitating and drying the DNA the following components are added to the tube: 2/zl of 5 X buffer (200 m M Tris, 40 m M MgCI2, 125 m M NaCI, 25 m M DTT, pH 7.6) 2 pl H20 2 pl NTPs (5 m M each ATP, CTP, and UTP, and 1 m M GTP) 2 pl [y-32P]GTP ( - 8 #Ci; freshly made from 32PO4 and GTP enzymatically with the Promega Biotec "GammaPrep" system) 1 pl placental RNase inhibitor (Promega Biotec) 1 #1 (0.7/tg) T7 RNA polymerase (see purification below) After 30 min incubation at 37 ° the reaction is precipitated with ethanol. There is sufficient end-labeled transcript for five lanes on a sequencing gel, using an overnight exposure of the film. For unknown reasons, only plasmids with N -- C, N -- T, or N deleted were obtained. To prepare N -- A, the lower strand was synthesized with a T opposing "N," and this hybrid used. About half the colonies contained plasmid coding for the helix with a bulged A (pBA21).
Transcription Conditions For preparing large quantities of rRNA fragments for physical studies, we wanted to find optimum conditions for obtaining the maximum number of transcripts per DNA in a minimum volume. The following sections describe the factors we have found important. Preparation of DNA. The transcription reaction and subsequent purification proceed best if the DNA is very clean and free from contaminating RNA. The protocol we use avoids ribonucleases and includes steps to remove small RNAs:
20 H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979). 21 D. E. Draper, I. C. Deckman, and J. V. Vartikar, this volume [13].
232
PROTEIN- R N A INTERACTIONS
[14]
1. Bacteria are grown and lysed by the lysozyme-alkali procedure described in Maniatis et al. 7 Before the isopropanol precipitation a phenol-chloroform extraction is included (10 ml each per 200 ml solution). 2. The 2-propanol pellet is resuspended in 10 raM Tris, 1 m M Na2EDTA and made 0.5 M in NaC1. Material precipitating between 4 and 10% polyethylene glycol is saved (allowing at least 1 hr on ice after each addition of polyethylene glycol), resuspended in the same Tris-EDTA buffer, and made 2.5 M in ammonium acetate. After I hr on ice the precipitated RNA is pelleted, and the remaining nucleic acids precipitated with 2.5 volumes of ethanol. 3. Small RNAs are separated from the plasmid by gel filtration on a Sephacryl S-500 (Pharmacia) column equilibrated in 0.2 M sodium acetate, 20 raM Tris, 1 m M Na2EDTA, pH 7.6. A column 1.6 X 50 cm is adequate for - 4 mg plasmid. 4. Remaining large RNA and chromosomal DNA are removed by ion-exchange chromatography on RPC-5 resin. 22 We use a 1 X 10 cm column (HR10/10, Pharrnacia) pumped at 2 - 3 ml/min with HPLC pumps (Bio-Rad). The column buffer is 20 m M Tris, 1 m M Na2EDTA, pH 7.6, with either 0.4 (A) or 2.0 (B) M NaC1. The plasmid elutes in a 30-ml gradient between 10 and 15% buffer B. T7 R N A Polymerase. T7 RNA polymerase is purified from the overproducing strain BL21 (pAR1219), 23 kindly supplied to us by F. W. Studier. The purification protocol was provided to us by J. J. Dunn and F. W. Studier, and involved chromatography on SP-trisacryl (LKB) and a DEAE-HPLC column (Bio-Rad). To assay for RNA polymerase activity, add in order to a small plastic tube: 11 #1 H20 4 #1 5 X buffer (200 m M Tris, 40 mMMgC12, 125 m M NaC1, 25 m M DTT, pH 7.6) 2 pl NTPs (10 m M each GTP, ATP, CTP and UTP) I pl linear DNA with T7 promoter, 1 mg/ml [e.g., pT7-1 (US Biochemicals) cut with RsaI] 1 M1[a-35S]ATP (-0.01 MCi) 1 #1 fraction to be assayed
22 R. D. Wells, S. C. Hardies, G. T. Horn, B. Klein, J. E. Larson, S. K. Neuendorf, N. Panayotatos, R. K. Patient, and E. Selsing, this series, Vol. 65, p. 327. 23 p. Davanloo, A. H. Rosenberg, J. J. Dunn, and F. W. Studier, Proc. Natl. Acad. Sci. U.S.A. 81, 2035 (1984).
[14]
RIBOSOMAL RNA FRAGMENTS
233
Incubate for 30 min at 37 °, and then assay for trichloroacetic acid-precipitable radioactivity as described elsewhere. 21 Reaction Conditions. To find optimum conditions for carrying out transcriptions, we have measured incorporation of [a -35S] ATP into different RNA transcripts under various conditions. An excess of RNA polymerase was used in the reactions (0.36/~M), and the DNA, NTPs, and NaCI concentrations varied. The most important results are shown in Fig. 3A I
I
I
I
A
60-
•
pTT-I-Rso I
13_ I-<
g
40-
o o o. o c
20
t
2'o
pBA21-Smel,
[DNA] x I0
go
80
20
[DNA], /.tg/ml 60 13I-<
g
40
o
8
sat
20
r
i
i
I
2
3
NTPs, mM each
FIG. 3. Optimum conditions for transcription with T7 RNA polymerase. The DNA pT7-1-Rsal gives a 291-base transcript from the normal T7 promoter sequence; pBA21Sinai gives a 23-base transcript from a T7 promoter altered in the last three nuclcotides of the normal sequence (sequence 5 of Table I). All assays were carried out in 20 gl with 0.72 Mg T7 RNA polymerase. (A) Influence of DNA concentration on nueleotide incorporation. Note that pBA21-SrnaI DNA is 10 times more concentrated than pT7-l-RsaI DNA. NTP concentrations were 1 raM. (B) Influence of NTP concentrations on transcription. DNA concentrations were 20/zg/ml (pT7-1 -RsaI) or 1 mg/ml (pBA21-SmaI).
234
PROTEIN- R N A INTERACTIONS
[14]
and B. Using 1 m M of each NTP, the maximum incorporation obtained is 60-70% with the normal T7 promoter sequence. For the 291-base transcript shown, ~ 500 transcripts are made per DNA molecule. The plasmid pBA21, which contains a different sequence promoter (sequence 5 in Table I), is less efficiently transcribed and a maximum of 20% incorporation is obtained; this occurs when the DNA concentration is about equal to the RNA polymerase concentration. About 130 transcripts per DNA are obtained with this sequence. 24 Figure 3B shows that the optimum concentration of NTPs is about 1 m3~ each. Higher concentrations become quite inhibitory with both promoters tested; by 3 m M very little transcription is obtained. The inhibition is probably due to chelation of Mg 2+ by the NTPs. zs Raising the MgCl2 concentration to 12 m M allows 2 m M each NTP to be used in the reaction and still obtain - 50% incorporation. Higher concentrations of MgC!z and NTPs did not give significantly greater yields of transcripts. The transcription reaction is relatively insensitive to NaC1 concentration. We see only a small (~ 20%) decrease in transcription at salt concentrations greater than 100 m M or less than 25 m M (data not shown).
Purification of Fragments Transcribed RNA is easily purified from the transcription components by loading the transcription reaction directly onto a gel filtration column. A 1.6 X 50 cm Superose 12 column (Pharmacia)gives excellent resolution of RNA transcripts up to - 120 bases (Fig. 4A). RNA from this column usually shows a single band after electrophoresis on a denaturing acrylamide gel. Further purification is possible by chromatography on a DEAE column in the presence of 6 M urea (Fig. 4B). Transcripts differing in length by a single nucleotide can be resolved up to - 3 0 base lengths. Resolution declines substantially for longer RNAs. For the 117-base transcript shown in Fig. 4, overloaded gels did detect RNAs o f - 100 bases that were unresolved until the full-length molecule. 24Note that the pBA21-SmaI sequence contains four As, seven Gs, and six each of the pyrimidines. Thus, 20% incorporation of A in full-length transcripts requires 35% incorporation of G. HPLC analysis of transcription reactions with this promoter show that the polymerase incorporates more nucleotides into short oligonucleotides, two to five nucleotides in length, than into the full-length 23mer. Sequencing gels run with [a-35S]ATP-labeled transcripts show only 23mer. Thus, the oligonucleotides are probably the result of abortive initiation at the 5' end of the transcript (A first occurs at position 8). The overall consumption of GTP during the reaction must therefore be much higher than 3596, and may limit the total incorporation somewhat. The stability of the polymerase during the longer incubations required with this weak promoter may also be limiting. 2s j. F. Million, D. R. Groebe, G. W. Witherell, and O. C. Uhlenbeck, Nucleic Acids Res. 15, 8783 (1987).
[ 14]
RIBOSOMAL RNA FRAGMENTS
235
A
1.5
.7% anscript
e~ 1.0 c3 o
DNA
0.5
I
3 time, hours
1.5
B z
,~. 1.0 to
o
a o - 0 . 4 ~,~.=-,
0.5 -0.2
6b time, rain FIG. 4. Purification of 117-base RNA transcripts derived from bisulfite-generated sequence variants of the S15 binding region (C. Disimone and D.E. Draper, unpublished observations). (A) G-el filtration on a 1.6 X 50 cm Superose 12 column. Transcript, 0.5 ml, was loaded onto the column and eluted with 0.1 M NaCI, 20 m M Tris, pH 7.6, pumped at 0.6 ml/min. The plasmid DNA has been cut with DdeI, generating 8 fragments, which accounts for DNA eluting in two positions. (B) DEAE ion-exchange chromatography of RNA fractions pooled from a Sepharose 12 column. The column is a Bio-Rad DEAE-5-PW, 7.5 X 75 ram, pumped with a gradient of NaCl in 6 M urea, 20 m M Tris at 0.4 ml/min. The equivalent of 0.25 ml of transcription reaction was loaded.
Transcriptionfrom Single-Stranded Templates Uhlenbeck and co-workers have described the use of synthetic, partially single-stranded DNA for transcribing short RNA sequences with T7 RNA polymerase. 25 The synthesis from a single-stranded template is very efficient, and the sequence of the last few bases is not constrained by the need for a restriction site. The method generally works very well, but we have found a surprising artifact in transcribing very stable RNA hairpins. Figure
236
PROTEIN- R N A INTERACTIONS
[ 14]
uUucGRGCC Uu RGCUCGG
T uU UCGRGCC C UURGCUCG6 FIG. 5. Autoradiogram of RNA transcription using synthetic DNA. The RNA transcripts have been run out on a 20% acrylamide, 50% urea gel. Electrophoresis is from left to fight. See text for details of template sequence and reaction conditions; the top lane is transcription from a partially single-stranded template, and the bottom lane transcription from a fully double-stranded template. The arrows indicate transcription products which were sequenced and found to be the "bulgeless" and "bulged" hairpin helices (upper and lower structures, respectively).
5 shows transcription from the two synthetic DNA templates 5'TAATACGACTCACTATAG 3' 3'ATTATGCTGAGTGATATCCGAGCI'AAAAAGCq'GCGG5' 5 ' T A A T A C G A C T C A C T A T A ~ C G A T T I T I ' C G A C G C C 3' Y A T I ' A T ~ G A G T G A T A T C ' C G A G C q ' A A A A A G C q ' ~ 5'
The two templates both code for the same 19-base RNA hairpin containing a single base bulge, also shown in Fig. 5. Reaction conditions were the same as described for transcription of plasmid DNA, using 1/~M concentration of template, l / t M T7 RNA polymerase, and incubating for 1 hr at 37 °. [tz-32p]GTP was included in the reactions, samples were run on 50% urea, 20% polyacrylamide gels, and the gel autoradiographed. The partially single-stranded template clearly gives a great deal of spurious transcription. Similar "ladders" of longer transcripts are obtained when a completely single-stranded template is used (not shown). The double-stranded template gives a major product, indicated by the lower arrow in Fig. 5. Sequencing of this product shows that it is the expected hairpin with single base bulge. This product was also identified in the transcription from partially single-stranded DNA. The most abundant single product in this transcription, however, turns out to be an 18-base transcript in which base
[ 14]
RIBOSOMALRNA FRAGMENTS
237
16, the single base bulge in the hairpin structure, has been deleted (upper arrow in Fig. 5). We have repeated this observation with templates coding for the same hairpin with bulges in three different positions; in each case the major product is the hairpin with the bulged base deleted. Partially single-stranded DNA templates coding for RNAs with less stable secondary structures give predominantly the expected product, with much less of the spurious "ladder," as described by others. 25 These results suggest that very stable secondary structure in the DNA template affects the accuracy of T7 RNA polymerase transcription. If transcription were completely processive, the secondary structure of the template might affect the rate of transcription, but not its accuracy; once the polymerase reaches base 16 the DNA hairpin should be melted and there would be no reason for the polymerase to skip the "bulge" base in preference to others. We presume therefore that the polymerase frequently dissociates (at least partially) from the template during transcription, allowing the DNA hairpin to reform, and that reassociation of the polymerase-nascent transcript-template complex may take place at the wrong site. Multiple dissociations and reassociations may account for the "ladder" of transcripts longer than the template. Whatever the mechanism, it is clearly necessary to characterize the transcription products carefully. Precautions To Avoid RNase Contamination
In all the protocols described here, precautions should be taken to avoid RNase contamination. These include using autoclaved or sterile-filtered buffers, glassware baked at 180 °, and plasticware baked at 100 ° overnight. Very pure water (e.g., that obtained from a Millipore "MilliQ" system) also helps prevent metal ion contamination. With these precautions, RNAs of better than 90% purity can be prepared by T7 RNA polymerase transcription, and addition of RNase inhibitors is unnecessary. For transcription of 100-base RNAs, we have obtained a purified yield of about 8 A260units RNA per milliliter of transcription reaction. Very short transcripts are obtained in somewhat lower yield. Thus, milligram quantities of virtually any rRNA sequence or sequence variant can be prepared for physical studies.
Acknowledgments W e thank Chris Disimone and Sarah Morse for prodding some of the data on T7
transcription presented here, and Dr. F. W. Studier for generously providing us with bacteria strains. This work was supported by NIH grants GM29048 and GM37005, and D.E.D. is supported by a Research Center Development Award (CA01081).
238
PROTEIN- R N A INTERACTIONS
[ 15]
[15] P h y s i c a l S t u d i e s o f t h e I n t e r a c t i o n o f Escherichia coli T r a n s l a t i o n a l I n i t i a t i o n F a c t o r 3 P r o t e i n w i t h Ribosomal RNA B y ERIC WICKSTROM a n d LANCE G . LAING
Introduction Control of gene expression comprises the central problem of cancer, viral infection, hypertension, contraception, muscular dystrophy, developmental anomalies, arthritis, and other autoimmune diseases. Gene expression is controlled at the levels of transcription and translation. Proteinnucleic acid interactions are the agents of regulation, and Escherichia coli translational initiation factor 3 protein (IF3) is one of the simplest systems to study in order to obtain a detailed and fundamental understanding of protein-nucleic acid interactions in the regulation of translation. IF3 catalyzes the binding o f natural and synthetic mRNAs to 30S ribosomal subunits, accelerates the association and dissociation rates of aminoacyltRNAs and initiator tRNA to 30S ribosomal subunits, and promotes the dissociation of 70S ribosomes into 50S and 30S ribosomal subunits.t IF3 is an RNA helix-destabilizing protein, with sequence specificity for the initiation codon AUG, and a conserved sequence near the 3' end of 16S ribosomal RNA. 2 Hence, elucidating the mechanism of bacterial IF3 interaction with rRNA is a good model for studying the control of translation in higher organisms. Protein-protein cross-linking, RNA-protein cross-linking, and immunoelectron microscopy studies indicate that IF3 binds in the cleft of the 30S ribosomal subunit, bridging from the head of the subunit to the platform, in close proximity to the 3' end of 16S rRNA on the platform (Fig. 1). The 3' end of 16S rRNA appears to be essential for IF3 binding, but no 30S ribosomal protein has been identified as essential for IF3 binding) Filter-binding assays with IF3 and homopolynucleotides indicated no apparent sequence specificity at low ionic strength, and an RNA binding site size of 14 + 1 nucleotides,3 while at physiological ionic
1C. O. Gualerzi, C. L. Pon, R. T. Pawlik, M. A. Canonaco, M. Paci, and W. Wintermeyer, in "The Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.), p. 621. SpringerVerlag, Berlin, Federal Republic of Germany, 1986. 2 E. Wickstrom, Nucleic Acids Res. 11, 2035 (1983). 3 E. Wickstrom, R. W. Tyson, G. Newton, R. Obert, and E. E. Williams, Arch. Biochem. Biophys. 200. 296 (1980). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[ 15]
IF3 - RNA INTERACTIONS
239
1=-3
25 -
g:-IMD
FI~. 1. The bacterial small ribosomal subunit, showing the location of the 3' terminus of 16S rRNA and the binding domain of IF3.
strength or above, IF3 binds very weakly to homopolynucleotides:,5 However, equilibrium dialyses and filter-binding assays at physiological ionic strength or above demonstrated that IF3 binds specifically to the initiation codon AUG, 6 while nuclease mapping revealed that IF3 binds specifically to a 13-nucleotide sequence, 5'-GUCGUAACAAGGU-3', nucleotides 1492-1505 in the 3' terminal 49-nucleotide cloacin DR 13 fragment of 16S rRNA, 2 which is virtually conserved in all forms of life, from bacteria to humans, in both mitochondrial and cytoplasmic ribosomes. 7 The specificity of the latter interaction is underlined by the fact that IF3 protects the cloacin fragment from nucleases even in the presence of a large excess of tRNA; in contrast, ribosomal protein S1 does not protect the cloacin 4 E. Wickstrom, FEBSLett. 128, 154 (1981). s B. F. Schmidt, K. Twombly, L. J. Mengle, and T. Schleich, Arch. Biochem. Biophys. 290, 207 (1985). 6 E. Wickstrom, Biochim. Biophys. Acta 349, 125 (1974). 7 p. H. van Knippenberg, J. M. A. van Kimmenade, and H. A. Heus, Nucleic Acids Res. 12, 2595 (1984).
240
PROTEIN- R N A
INTERACTIONS
[ 15]
fragment from nucleases under the same conditions) Thus, IF3 binding to the cloacin fragment is consistent with the observed domain of IF3 binding on the 30S ribosomal subunit. Chemical probes of 16S rRNA secondary structure in low-salt-washed 30S ribosomal subunits, which still contain IF3,9 nuclease mapping of the cloacin fragment in the presence of IF3, 2 and spectroscopic studies of the cloacin fragment alone t° implied that Fig. 2A is the probable structure of the cloacin fragment at physiological ionic strength and temperature in the presence of IF3. On the other hand, nuclease mapping of the cloacin fragment alone, 2 and chemical probing at a variety of temperatures H agreed with Fig. 2B at lower temperatures. This discrepancy probably means that the extra four base pairs in Fig. 2B exchange too rapidly at room temperature to be detected spectroscopically. Physical studies of the IF3-cloacin fragment system, using the techniques described below, revealed interesting molecular details of the interaction. When combined with nuclease mapping and chemical probe results, the physical data made it possible to propose a simple model wherein IF3 interacts with the most highly conserved residues in the cloacin fragment.~2 Preparation of Ribosomes and IF3 All preparative steps were carried out at 4 °, and all lysis and chromatography solutions contained 50gg/ml phenylmethylsulfonyl fluoride (Sigma) to inhibit proteolysis, and 1.0 m M dithiothreitol to prevent oxidation of reduced cysteine side chains, unless otherwise stated. IF3 activity was assayed for stimulation of f[35S]Met-tRNA binding to 70S ribosomes programmed by AUG essentially as described by Hershey et al. ~3 IF3 concentrations were estimated by both the Coomassie Blue assay ~4and by i ~ _ 2 •013 The molecular weight of IF3, 20,530, and numbering of E28oamino acid residues were based on the.nucleotide sequence of the gene. 15 8 E. Wickstrom, Biochim. Biophys. Acta, 868, 265 (1986). 9 C. R. Woese, L. J. Magrum, R. Gupta, R. B. Siegel, D. A. Stahl, J. Kop, N. Crawford, J. Brosius, R. Gutell, J. J. Hogan, and H. F. Noller, Nuclei Acids Res. 8, 2275 (1980). 1o H. A. Heus, J. M. A. van Kimmenade, P. H. van Knippcnbcrg, C. A. G. Haasnoot, S. H. de Bruin, and C. W. Hilbcr, J. Mol. Biol. 170, 939 (1983). 11 H. A. Heus and P. H. van Knippcnberg, unpublished observations (1985). 12E. Wickstrom, H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippcnbcr~ Biochemistry 25, 2770 (1986). ~3j. W. B. Hershey, J. Yanov, and J. L. Fakunding, this series, Vol. 60, p. 3. 14M. M. Bradford, Anal. Biochem. 72, 248 (1976). is C. Sacerdot, G. Fayat, P. Dessen, M. Springer, J. A. Plumbridge, M. Grunberg-Manago, and S. Blanquet, EMBO J. 1, 311 ( 1982 ).
[ 15]
IF3- RNA INTERACTIONS
241
G-C 20-A-U U'G~.~O__] G-C C-G C-G A-U
m
10
1A_U~. ~ 40
A G
m~A m~A G-C G-C 20-A-U U.G-30 G-C C-G C-G A-U G A-U G A U-A C G-C ~U 40 G-C m 10 A-U 5' GUCGUAACA CCUUA 3' m2G
B FIG. 2. A and B are alternative structures of the 49-nucleotide 3' terminal cloacin DFI3 fragment of 16S rRNA (from Ref. 2). Nucleotides protected by IF3 from single-strand-specific nucleases are underlined in structure A; those attacked more readily by single-strand-specific nucleases in the presence of IF3 are indicated by arrows. Numbering starts at the 5' end of the fragment, which is residue 1494 of 16S rRNA? ° Boxed regions are evolutionarily conserved. 7
Tight couple ribosomes were prepared from E. coli RR 1 cells, freshly grown to mid-log phase in 1 liter of L broth at 37 °. The cells have sedimented for 10 min at 8 krpm in a Sorvall GS-3 rotor, then resuspended in 30 ml of 10 m M Tris-HCl, pH 7.4, 10 m M magnesium acetate, 100 m M NH4C1 (buffer A), and lysed by the addition of lysozyme to
242
PROTEIN- R N A INTERACTIONS
[ 15]
1.7 mg/ml, sodium deoxycholate to 0.5%, and DNase I to 0.2 mg/ml. The suspension was stirred for 10 min following each addition. The cell lysate was sedimented for 20 min at 15 krpm in a Sorvall SA-600 rotor, and the supernatant fraction was saved. The pellet was resuspended in 10 ml of buffer A and sedimented once more. The second supernatant fraction was combined with the first and the mixture was added to a pair of screwtop bottles for the Beckman 70 Ti rotor. Each 20-ml supernatant fraction was underlaid with 8 ml of buffer A containing 20% glycerol and sedimented for 8 hr at 50 krpm. The supernatant fraction was saved as a source of aminoacylating enzymes, and the ribosome pellet was resuspended in buffer A containing either 50% glycerol (for intact low-salt ribosomes at a source of cloacin fragment) or 1.0 M NH4C1 (to release initiation factors). The ribosomes resuspended in 50% glycerol were stored in 1.5-ml vials at - 80 °. The ribosomes resuspended in high salt were underlaid with buffer A containing 1.0 M NH4C1 and 30% glycerol, then sedimented for 8 hr at 50 krpm in a Beckman 70 Ti rotor. The supernatant fraction was used as a source of crude IF1 and IF2, prepared according to Hershey et aL, ~3 and the pellet of salt-washed ribosomes was resuspended in buffer A containing 50% glycerol and stored in 0.5-ml aliquots at - 8 0 °. IF3 is overproduced 10- to 50-fold in E. coli RR1 transformed by the plasmid pB5-57, which contains a 3.7 kb PstI fragment including the E. coli infC gene, inserted into the PstI site of pBR322) 6 The latter cell line was grown in 4-liter cultures of L broth containing 50/zg/ml ampicillin (Sigma) at 37 ° in a rotary incubator. When the culture reached an optical density of 0.8 at 600 nm, cells were harvested by sedimentation for 10 min at 8 krpm in a Sorvall GS-3 rotor. Cell pellets were resuspended in 120 ml of buffer A and lysed as described above, with the addition of 1.0 MNH4C1 to release IF3 from ribosomes at the time of cell lysis. Streptomycin-HC1 (Sigma) was immediately added to the lysate plus pellet wash to 1% (w/v) in order to precipitate all ribosomes and nucleic acids. The suspension was sedimented for 20 rain. at 15 krpm in a Sorvall SA-600 rotor, leaving cellular proteins in the supernatant fraction. At this point, IF3 is the second most distinct band of a 150/0polyacrylamide Laemmli 17gel of crude lysate, after the lysozyme used to lyse the cells. IF3 is then purified by ion-exchange chromatography on phosphocellulose. The 1 MNH4C1 present in the 150 ml oflysate was diluted to 0.3 M b y the addition of 350 ml of 10 m M Tris-HCl, pH 7.4, containing 10% glyc16p. Lestienne, J. Dondon, J. A. Plumbridge, J. G. Howe, J.-F. Mayaux, M. Springer, S. Blanquet, J. W. B. Hershey, and M. Grunberg-Manago, Eur. J. Biochem. 123, 483 (1982). t7 U. K. Laemmli, Nature (London) 227, 680 (1970).
[ 15]
IF3- RNA INTERACTIONS
243
erol (buffer B), in order to allow binding of the supernatant proteins to phosphocellulose (Whatman P-11). The diluted supernatant proteins were combined with a slurry of 200 ml preequilibrated P- 11, stirred for 15 min, and sedimented for 10 rain at 5 krpm in a Sorvall GS-3 rotor, after which the supernatant fraction was discarded. The P-I 1 was reslurried and packed into a 2.6 × 20 cm column, followed by 30 ml of centrifuge bottle rinses with buffer B. The column was washed with 1 liter of buffer B containing 0.3 M NH4CI, until the A2so returned to baseline. The column was then eluted with a l-liter gradient of 0.3- 1.0 M NH4C1 in buffer B. Lysozyme, the most prominent component, eluted in a broad peak between 0.5 and 0.7 M NH4CI, while IF3 eluted in a diffuse peak between 0.7 and 0.8 M NH4C1. Fractions containing IF3 activity and detectable bands on a polyacrylamide gel were diluted with two volumes of 10 mM TrisHC1, pH 7.4, 6.0 M urea, 1.0 m M ethylenediaminetetraacetic acid (EDTA), 10% glycerol (buffer C) to reduce the NH4CI concentration and partially denature the IF3. The dilute IF3 pool was applied to a 0.6 × 10 cm column of P- 11 equilibrated in buffer C containing 0.1 M NH4C1, and the column was washed with 25 ml of the same buffer. The column was then eluted with a 100-ml gradient of0.1-0.5 M NH4C1 in buffer C, yielding an IF3 peak which eluted between 0.16 and 0.22 M NH4C1. The IF3 peak fractions were diluted with two volumes of 10 m M Na2HPO4, pH 7.4, 1.0 mM EDTA, 5% glycerol (buffer D) and applied to a 0.6 × 2 cm column of P-11, which was then washed with 5 ml of buffer D, and the concentrated IF3 was eluted from the column with 1.0 M KCI in buffer D, yielding 5 mg IF3 in the first two 0.5-ml fractions. IF3 is essentially homogeneous at this point (Fig. 3). Rabbit polyclonal antiserum against IF3, ~athe kind gift of Dr. J. W. B. Hershey, cross-reacted with both an old IF3 standard isolated from E. coli MRE 60019 and with the overproduced recombinant IF3 described above, following Western blotting from a Laemmli ~7gel onto nitrocellulose and staining with horseradish peroxidase conjugated to goat anti-rabbit IgG (Bio-Rad Kit No. 170-6500) (Fig. 4). IF3 from E. coli MRE 600 was primarily the long form, while that from the recombinant overproducing strain was primarily the short form. Including phenylmethylsulfonyl fluoride in all the lysis and chromatography buffers did not lead to any greater yield of long form. It is possible that cloning the IF3 gene into an inducible, higher copy number plasmid might allow a greater yield of the long form. Samples which have been stored at --80 ° for several months after
msj. G. Howe and J. W. B. Hershey, J. Biol. Chem. 256, 836 (1981). 19 E. Wickstrom, FEBS Lett. 128, 154 (1981 ).
244
[ 15]
PROTEIN- RNA INTERACTIONS .50 .4O
.3G
g .20
.10 ._++
q " ~2
4
6
e
IO
12
Dislonee from top of gel, em FI~. 3. Denaturing polyacrylamide gel electrophoresis of purified IF3. A 2.0 #g sample of IF3 was analyzed on a 15% polyaerylamide-SDS gel, stained with Coomassie Blue, destalned, then scanned at 580 nm.
preparation should be assayed prior to use to ensure that experiments are not carried out with IF3 which has lost significant activity. P r e p a r a t i o n of the 3' Terminal Cloacin F r a g m e n t of 16S r R N A The 49-nucleotide 3' terminal of 16S rRNA, residues 1494-1542, 2° was prepared according to Baan et al. 21 Three thousand six hundred A260 units of salt-washed fight couple ribosomes in 2.5 ml of buffer A were cleaved by the addition of 0.5 ml of 0.3 mg/ml heat-activated cloacin DF13 in buffer A. 22 The solution was incubated for 45 rain at 43 °, then applied to a 0.2-0.8 M sucrose gradient in 10 m M Tris-HC1, pH 7.4, 10 m M magnesium acetate, 100 mMNH4C1 (buffer E) to separate 50S and 30S ribosomal subunits, and sedimented for 5 hr at 25 krpm in a Beckman SW 27 rotor. The gradients were fractionated, and the 30S ribosomal subunit peak was deproteinized with phenol to isolate digested 16S rRNA. The RNA in the aqueous phase was precipitated with ethanol, pelleted, redissolved in 0.1 M sodium acetate, pH 5.5, 1.0 m M EDTA, 0.5% SDS, applied to a 0.15-0.6 M sucrose gradient in the latter buffer, and sedimented for 40 hr at 25 krpm in a Beckman SW 27 rotor at 15 °. The 3S 20j. Brosius, M. L. Palmer, P. J. Kennedy, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 75, 4801 (1978). 21 R. A. Baan, R. van Charldorp, E. van Leerdam, P. H. van Knippenberg, L. Bosch, J. F. M. de Rooij, and J. H. van Boom, FEBSLett. 71, 351 (1976). 22 F. K. de Graffand P. Klaascn-Boor, Eur. J. Biochem. 73, 107 (1977).
[ 15]
I F 3 - RNA INTERACTIONS
245
FIG. 4. Western blot of purified IF3. Left lane, IF3 purified from E. coli MRE 600. ~9 Right lane, IF3 purified from E. coil RR1/pBS-57.
246
PROTEIN- RNA INTERACTIONS
[ 15]
RNA peak at the top of the gradient was pooled and precipitated with ethanol. Final purification was by preparative slab gel electrophoresis on a 0.15 × 12 X 14 cm slab gel of 12% acrylamide, 0.6% bisacrylamide in 7.0 M urea, 50 m M Tris-H3BO3, pH 8.3, 1.0 m M EDTA, which was run for 4 hr at 200 V. RNA bands were detected by ultraviolet fight shadowing over a fluorescent chromatography plate. In this system, the fragment travels slightly move slowly than xylene cyanole FF. The fragment was extracted into 0.5 M ammonium acetate, 10 m M EDTA, 0.5% SDS, then precipitated with three volumes of ethanol and redissolved in the latter buffer. Absorption spectra indicated a yield of 0.90 A~o units. Concentrations were determined spectrophotometrically using an extinction coefficient of 3.8 × 10S/Mcm at 260 nm. Equimolar Footprinting In order to estimate the association constant for IF3 binding to the cloacin fragment when only picomoles of sample were available, equimolar mixtures of IF3 and cloacin fragment were prepared at increasing dilution in a buffer of physiological ionic strength and pH, then digested with nudease S~ at 37 °. Parallel digests without IF3 were carried out at the same dilutions to control for concentration effects on nuclease S~ attack. The degree of protection or greater susceptibility of particular nucleotides due to bound IF3, which is called footprinting, was assumed to be due to the proportion of IF3/cloacin fragment complex, assuming one to one stoichiometry: IF3 + RNA ~ IF3. RNA
(1)
At equilibrium, the concentrations of product and reactants should give the association constant: K = [IF3- RNA]/[IF3][RNA]
(2)
For the case where IF3 and cloacin fragment RNA are equimolar, at an input concentration where the IF3 and the cloacin fragment are half bound and half dissociated, the complex concentration on the top of Eq. (2) cancels one of the terms on the bottom, yielding K = 1/[IF3] = 1/0.5[IF3]o---2/[IF3]o
(3)
The result is that the association constant is twice the inverse of the starting IF3 or RNA concentration, and the dissociation is half of the starting IF3 or RNA concentration. The cloacin DF13 cleavage leaves the 3' fragment with a 5'-OH. To obtain labeled fragment, the 5'-OH was phosphorylated with D,-31P]ATP (New England Nuclear) using 0.1 unit/ml polynucleotide kinase (BRL) in
[ 15]
IF3- RNA INTERACTIONS
247
10 mM Tris-HC1, pH 7.4, 15 m M magnesium acetate, 15 m M 2-mercaptoethanol, and incubating for 30 min at 37 °. Labeled fragment was purified by preparative slab gel electrophoresis as above, and eluted as above. Nuclease digests were done in 2.0 gl of 40 m M Tris-acetic acid, pH 7.4, 100 m M NaC1, 1.0 m M magnesium acetate, 1.0 m M ZnSO4 for 5 min at 37 °, unless otherwise indicated. Typically, 1-2 pmol of [5'-a2p]RNA, 1 - 2 X 105 dpm, plus 10ag mixed E. coli tRNA (Plenum) were digested with 20 units of nuclease Sl (BRL), or 0.02 units ofRNase Tl (Sankyo), or 10 pg of pancreatic RNase A (Pharmacia). For footprinting reactions including IF3, the protein was preincubated with the RNA for 5 min at 37 ° before adding the nuclease. Base hydrolysis reactions were done in 2.0 al of 25 m M Na2COa, pH 9.2, for 5 rain at 90 °, with the same amounts of cloacin fragment and tRNA as above. All reactions were terminated with one volume of 9.0 Murea, 10 mMEDTA, pH 8, 0.05% xylene cyanole FF, 0.05% bromphenol blue, and analyzed on a prerun 0.15 X 33 X 40 cm gel of 20% acrylamide, 0.67% bisacrylamide in 7.0 M urea, 50 mM TrisH3BOa, pH 8.3, 1.0 m M EDTA. The samples were electrophoresed for 4 - 5 hr at 900 V, then a second set of samples were applied, and the gel run for an additional 4 - 5 hr at 900 V. Following electrophoresis, gels were autoradiographed with Kodak XRP-5 film backed by du Pont Cronex Lightning-Plus screens at --70 ° for 1-2 days. Nuclease mapping with nuclease S~, RNase A, and RNase T1 confirmed the sequence and structure of the fragment.2 A typical equimolar footprinting analysis appears in Fig. 5. When IF3 and the eloacin fragment were both initially 0.7 aM, potentiation of nuclease S~ attack on some nucleotides was seen, and protection of others occurred. When IF3 and the cloacin fragment were both initially 0.14 aM, the footprinting effects were roughly half as strong as before, and when the reactants started out at 0.028 aM, only slight footprinting effects could be detected. From Eq. (3) then, the dissociation constant is thus close to half of 0.14aM, and the association constant is close to 1.4 X 107/M. The precision of this technique may be improved by using a larger number of concentrations, and by quantitating autoradiogram bands with a densitometer. Circular Dichroism Titrations In previous investigations, excellent agreement was observed between filter-binding assays and circular dichroism (CD) titration as independent measurements of IF3 binding to RNA. 3,4,23Both the cloacin fragment and 23T. Schleich, E. Wickstrom, K. Twombly, B. Schmidt, and R. W. Tyson, Biochemistry 19, 4486 (1980).
248
PROTEIN- R N A INTERACTIONS OH
T1
t
2
3
4
5
6
B OH
c
U
m
6A Z
T!
I
2
3
4
5
6
-
G 1530G
G G 1520C
[ 15]
_~
U G C ---0- --'C m ~ A
--
mX G G
1510
153o,
-
A U
-
G
-
C C
-
A
--
A
--
U
-
G
-
G
-
u
-
c
-
1520 c
-
m5~
A
-
m62A
A-
C-
1500. A ,a _
B
-
G
-
m2G
_
G
-
G
-
A
-
U
-
O
Oo
G_ O 1510 C
-
c
-
)tl
A
-
O
FIG. 5. Equimolar footprinting of IF3 on the cloacin fragment. Lane OH, base hydrolysis of 0.7 # M cloacin fragment; lane TI, RNase T= hydrolysis of 0.7 pMcloaein fragment; lane 1, nuclease S= hydrolysis of 0.7 # M cloacin fragment; lane 2, same as lane 1, plus 0.7 pM IF3; lane 3, same as lane 1, but diluted to 0.14/tM cloacin fragment; lane 4, same as lane 3, plus O.14 #M IF3; lane 5, same as lane 1, but diluted to 0.028 pM cloaein fragment; lane 6, same as lane 5, plus 0.028 pM IF3. (A) Second loading; (B) first loading.
IF3 have strong overlapping troughs and peaks below 250 nm, but only the cloacin fragment has a significant peak above 250 nm. Hence, one may independently observe the effect of IF3 addition on the RNA 268-nm peak, and reasonably expect that the observed decrease in circular
[ 15]
I F 3 - RNA INTERACTIONS
249
dichroism upon IF3 binding to an RNA is proportional to the amount of IF3 bound, if one continues the titration to a clear end point. Absorption spectra were recorded on an IBM 9420 spectrophotometer. CD spectra were recorded from 320 to 220 nm on a Jasco J-500A spectropolarimeter in a 0.6-ml, 1.0-cm pathlength cylindrical cell (NSG-Percision Cells) in a thermostatted cell holder. If the amount of sample available is less than 0.05 A26o units, the Jasco 90-/zl microcell may be used, since the cell holder includes focussing optics which send the entire fight beam through the microcell, rather than just losing most of the light beam by masking the microcell. CD measurements were made at 25 ° on 0.150.25/zM cloacin fragment solutions in buffers D and E, to which were added aliquots of IF3 for subsequent spectra, until well past the saturation point. All measurements were corrected for dilution; CD magnitudes are reported as Ae, per molar centimeter per residue. Titration curves of dilution-corrected RNA CD peak magnitudes versus total IF3 concentrations were fitted to models using the nonlinear least-squares multiparameter fit procedure of the SAS package (SAS Institute), run on an IBM 3081 mainframe. For hyberbolic CD titration curves, IF3 binding to the cloacin fragment was assumed to be noncooperative, and fitted to a Scatchard 24 plot; fitting was attempted for both one and two IF3 molcules per RNA. For sigmoid titration curves, cooperative as well as noncooperative models were tested. 25 Given the sensitivity of the instrument, CD titrations should give useful data for calculating association constants up to 10S/M. Buffer E is the standard assay buffer for ribosome and initiation factor activity, ~3except that the [Mg 2+] is 1 m M rather than 5 mM. Physiological [Mg 2+] is usually around 1 mM, 26 and we wished to minimize the likelihood of protein/RNA aggregation. This buffer is also very similar to the buffer used for equimolar footprinting of IF3 on the cloacin fragment, described above, except that NH4C1 was substituted for NaC1, and 1 m M ZnSO4 was left out. Buffer D is the same low-salt phosphate buffer used in measurements of IF3 binding to poly(A) by filter binding 3 and CD titration. 4 No peak flattening, large redshifts, or turbidity were observed in either buffer, which implies that aggregation did not occur. The shapes of the spectra in both buffers were virtually the same, but the spectra in the more physiological buffer E had a lower peak magnitude than the spectra in the low-salt buffer D lacking divalent metal cations. Although Mg 2+
24G. Scatchard,Ann. N.Y. Acad. Sci. 51,660 (1949). 25j. D. McGheeand P. H. von Hippel, J. Mol. Biol. 86, 469 (1974). 26R. K. Gupta and R. D. Moore,J. Biol. Chem. 255, 3987 (1980).
250
PROTEIN- RNA INTERACTIONS
[ 15]
stabilizes helical structures, it does not necessarily increase the CD magnitude. Titration of the peak CD of the cloacin fragment by addition of IF3 in the physiological Tris buffer E, where the interaction is primarily nonionic and sequence specific, is shown in Fig. 6. For comparison, raising the sample temperature to 37 ° decreased the peak CD magnitude by 13%, and at 50 ° the magnitude was reduced by 30%. The 19% reduction in CD magnitude at the end point correlates by interpolation to raising the temperature to about 41 ° in the absence of IF3, in which case the extra four base pairs of Fig. 2B would be fully melted, the nine base pairs of Fig. 2A would still be intact, and single-stranded regions would be less stacked. The titration displayed a hyperbolic decay curve with an apparent end point of one IF3 per RNA. The curve was best fit by assuming that only one IF3 bound per cloacin fragment, yielding an association constant of 1.80 + 0.05 X 107/M, corresponding to a free energy of binding of - 9 . 9 _+ 0.3 kcal/mol. The best fit association constant for this titration agreed well with the estimate of 1.4 × IOT/Mfrom equimolar footprinting, implying a lack of competition with tRNA for binding to IF3. The association constant was close to that for IF3 binding to 30S subunits, 5.8 X 10?/M, under
E 0
d <1 4.5
4q
o11 0:2 0'.3 o14 ols ole 0.7 [IF3], pM
FIG. 6. IF3 titrationof 0.15 #M cloacin fragmentRNA circulardichroismat 268 nm in 10 mM Tris-HC1,pH 7.4, 100 mM NH4CI, 1.0 mMmagnesiumacetate, 1.0 mM dithiothmitol, 596glycerol(physiologicalTris bufferE) at 25°. The smoothcurve representsthe best fit of the data to a hyperbolictitration curve whichassumesone IF3 bound per RNA, with an associationconstantof 1.8 × 10?/M.
[ 15]
IF3- RNA INTERACTIONS
25 1
~o\ 8
°\o •
¢J E
7
~ " ~ °"-
°
°
6
o o12 o14 0'.8 0'.8
1'.2
[IF3], pM FIG. 7. IF3 titration of 0.25 pM cloacin fragment RNA circular dichroism at 268 nm in 10 mM Na2HPO4, pH 7.4, 1.0 mM EDTA, 1.0 mM dithiothreitol, 5% glycerol (low-salt phosphate buffer D) at 25 °. The smooth curve represents the best fit of the data to a sigmoidal titration curve which assumes two IF3 molecules bound per RNA, with an intrinsic association constant of 1.7 × 106/Mfor each one, and a cooperativity constant of 33 for the binding of the second IF3 to an IF3-RNA complex. s i m i l a r c o n d i t i o n s . 27 A trial assumption of two IF3 molecules per cloacin
fragment, binding independently, gave a poorer fit, with an association constant for each IF3 of 8.10 _ 0.65 × 107/M. IF3 titration of the peak CD of the cloacin fragment by addition of IF3 in the low-salt phosphate buffer D, where the interaction is primarily ionic and nonspecific, appears in Fig. 7. The 35% reduction in CD magnitude, almost twice as much as in buffer E, implies complete disruption of secondary structure, as we have seen before for homopolynucleotides in low-salt phosphate buffer.4,23 At this low ionic strength, IF3 binding is not sequence specific, so IF3 molecules cover the entire oligonudeotide, resulting in thorough melting, as opposed to the partial destabilization seen in physiological Tris buffer, where only one IF3 binds per cloacin fragment. The peak CD declined sigmoidally, with an apparent end point of two IF3 molecules per RNA, unlike the in vivo situation, where only one IF3 binds per ribosome. The titration curve was best fit by assuming independent binding of one IF3 and cooperative binding of a second IF3 to 27j. Weiel and J. W. B. Hershey, Biochemistry20, 5859 (1981).
252
PROTEIN- RNA INTERACTIONS
[ 15]
each cloacin fragment. The fitting routine yielded an intrinsic association constant of 1.7 +_ 0.7 X 106/M for each IF3, correspondingto a free energy change of - 8 . 5 ___3.5 kcal/mol, and a cooperativity constant of 33 + 6, corresponding to a free energy change o f - 2 . 1 + 0.4 kcal/mol. These results agree well with IF3 titration of poly(rA) CD in the same low-salt phosphate buffer, which was fit by an intrinsic association constant of 1.3 + 0.8 X 106/M for each IF3 and a cooperativity constant of 25 + 7. 4 Proton Magnetic R e s o n a n c e M e a s u r e m e n t s High-field IH N M R spectra of IF3 elucidated some aspects of its tertiary structure. Tyr-71, Tyr-109, Lys-112, Arg-114, and His-139 are essential for function, and Cys-66 is very close to the RNA binding site. 2s High-field IH N~V[R spectra of the cloacin fragment hydrogen bonding imino protons characterized the stable bonds at 1 5 A - U 3 4 through 2 2 G C27) ° A study of their complex was expected to yield details of their interaction. Spectra at 500 MHz were recorded at 24 ° on a Bruker ~rM-500 spectrometer equipped with an Aspect 2000 minicomputer, operating in the Fourier transform mode. Chemical shifts were measured relative to the solvent water peak and converted to the 2,2-dimethyl-2-silapentane 5-sulfonate standard using temperature and salt calibration curves. To suppress excitation of the strong water peak in samples dissolved in IH20 , a semiselective pulse was used, in combination with an alternate delay acquisition. 29 Free induction decays were apodized by an exponential function causing extra line broadening of 8 Hz. For samples dissolved in 2H20 , the residual IHO2H signal was presaturated by a gated irradiation of 0.5 sec on the IHO2H resonance. These spectra were given a Gaussian-Lorentzian transformation for resolution enhancement, GB = 0.15 and LB = 7. The aromatic region of the IF3 2H20 spectrum in 25 r n ~ r Na2HPO4, pH 7.5, 100 mA/NaC1, 1.0 rn34EDTA, 1.0 m_Mdithioerythritol, a physiological phosphate buffer (Fig. 8A), was more complex than the spectrum one would obtain from an equimolar mixture of aromatic amino acids) ° For example, the resonances of Tyr-107 C-3,C-5 protons were shifted upfield to 6.7 ppm, indicating the ring current influence of a nearby aromatic residue. The methyl proton resonances of IF3 were shifted upfield) 2,29 The upfield shifts in the aromatic and methyl resonances are characteristic features of a extensively folded protein with a high degree of 2sM. Paci, C. Pon, M. Lammi, and C. Gualerzi, J. Biol. Chem. 259, 9628 (1984). 29C. A. G. Haasnootand C. W. Hilbers, Biopolymers 22, 1259(1983).
[ 15]
I F 3 - RNA INTERACTIONS
.
.
.
.
I
A
.
.
.
253
.
.
.
i
Tyr-75 I
HiS C-2
J
8;o
. . . . .
!
,Tyr.107 His Phe
p~m
Zb
.
.
.
.
.
.
~io
Fla. 8. Five-hundred megahertz IH NMR spectra in 2H20 at 24 ° of (A) 0.2 mM IF3 in 25 mM Na2HPO4, pH 7.5, 100 mM NaC1, 1.0 mM EDTA, 1.0 mM dithioerythdtol (physiological phosphate buffer) (312 scans); (B) 0.12 mM IF3 +0.12 mM cloacin fra_~,mentin 2.0 mM sodium cacodylate, 15 mM Na2HPO4, pH 7.3, 98 mM NaCl, 0.6 mM EDTA, 0.6 mM dithioerythdtol, prepared by mixing equimolar amounts of solutions in A and C (2000 scans); (C) 0.3 mM cloacin fragment in 5.0 mM sodium cacodylate, pH 5.5, 95 mM NaC1 (5580 scans). Assignments axe from Paci et al. 28 Arrow in B indicates location of position of missing Tyr- 107 resonances.
254
PROTEIN- RNA INTERACTIONS
[ 15]
secondary and tertiary structure. 3° During the course of this work, Paci et reported the 400 and 500 MHz ~H NMR spectra of IF3, which appear to be identical to the spectra in Fig. 8A. We have adopted their peak assignments, which are supported by pH titrations, chemical modification studies, and decoupling experiments, although assignment of tyrosine residues is still tentative. The aromatic region of the cloacin fragment 2H20 spectrum in 5.0 m M sodium cacodylate, pH 5.5, 95 m M NaC1, appears in Fig. 8C. There was significant overlap between cloacin fragment peaks and IF3 peaks. The samples from Fig. 8A and C were mixed in the appropriate proportions to yield an equimolar solution of cloacin fragment and IF3, 0.12 m M each in 2.0 m M sodium cacodylate, 15 m M Na2NPH4, pH 7.3, 98 m M NaC1, 0.6 m M EDTA, 0.6 m M dithioerythritol. At these concentrations, 98% of the RNA and protein molecules would be complexed with each other, assuming the IF3/cloacin fragment association constant of 1.8 × I 0 7 / M calculated above for the CD titration in physiological Tris buffer E. This was an approximation, since the buffer mixture in this experiment was similar to buffer E in ionic strength and pH, but was buffered by phosphate instead of Tris, had sodium for its major cation instead of ammonium, and lacked Mg2+. The aromatic region of the IF3/cloacin fragment 2H20 spectrum (Fig. 8B) did not show much broadening of either protein or RNA resonances. This indicates high mobility of the residues, which could be the result of a short lifetime for the complex. The resonances of the six Phe residues and Tyr-75, which do not seem to be essential for IF3 activity, seemed to be unaffected by complexing with the cloacin fragment. However, one of the doublets of Tyr-107, which is involved in IF3 binding to 30S ribosomal subunits, disappeared, either by shifting under the Phe resonances, or by broadening beyond recognition. These results were in excellent agreement with those of Paci et aL 3~ for IF3 binding to deuterated 30S ribosomal subunits, consistent with the specificity of IF3 binding to the cloacin fragment. Whether IF3 undergoes a major conformational change upon binding to the cloacin cannot be determined yet from these one-dimensional spectra. The low-field imino proton region of the cloacin fragment ~H20 spectrum in 1.0 ~ sodium cacodylate, 25 m M Na2HPO4, pH 7.0, 61.5 m M NaC1, 1.0 m M EDTA (Fig. 9A) showed nine resonances of water-exchangeable hydrogen-bonded protons, which were previously assigned by al. 2s
3oK. WtRhrich, in "NMR in Biological Research: Peptides and Proteins." Elsevier, Amsterdam, 1976. 3mM. Paci, C. Pon, and C. Gualerzi, J. Biol. Chem. 260, 887 (1985).
[ 15]
IF3 - RNA INTERACTIONS
i
T
I
I
r
i
i
t
I
~
t
i
I
r
255
T
T
I
r
i
I
18
21
A
19-
22
! I
1~t
r
19b
16
! 12
lt3
'
111
'
1'0
PPM
F]o. 9. Five-hundred megahertz IH NMR spectra in ~H20 at 24 ° of(A) 0.7 mM cloacin fragment in 1.0 mM sodium cacodylate, 25 mMNa2HPO4, pH 7.0, 61.5 mMNaCI, 1.0 mM EDTA containing 5% 2H20 (4100 scans), with peaks numbered according to base pairs in Fig. 1; (B) 0.12 mM IF3 + 0.12 mM cloacin fragment in 5.0 mM sodium cacodylate, pH 7.0, 95 mM NaCI containing 8% 2H20 (3800 scans);(C) same as B, but with 1.0 MNaCI (1500 scans).
nuclear Overhauser effects to eight of the base pairs, 1 5 A - U 3 4 through 22G-C27, in Fig. 2A) ° In the imino proton spectrum of the IF3/cloacin fragment complex in 5.0 m M sodium cacodylate, pH 7.0, 95 m M NaCI (Fig. 9B), most of the cloacin fragment resonances were still present, implying that the helix was still intact. All of the resonances showed some
256
PROTEIN- R N A INTERACTIONS
[ 1 S]
broadening, which was probably due both to the greater molecular weight of the IF3/cloacin fragment complex, more than twice that of the cloacin fragment, and to enhanced imino proton exchange. However, the 20AU29 resonance almost disappeared from the spectrum, while the peaks belonging to the 19U-G30 protons were substantially broadened, and the 22G-C27 resonance shifted upfield beneath the 18G-C31 resonance. These effects were also observed with the cloacin fragment alone upon raising the temperature. ~° There are two reasonable explanations for these observations. First, some part of the IF3 which comes in close contact with these base pairs might accelerate 19U-G30 and 20A-U29 imino proton exchange with water, and perturb the environment of 22G-C27. Second, IF3 binding to the cloacin fragment might destabilize the central and upper parts of the helix. At present we cannot distinguish between these two possibilities. Proton NMR studies of the binding of E. coli tRNA r~e to elongation factor Tu, its natural interaction partner, showed a similar effect on the U - G base pair in the amino acid acceptor stem oftRNAVhe. 32 When the NaCl concentration of the IF3/cloacin fragment mixture was raised to 1 M (Fig. 9C), the broadening of the 19U-G30 and 20A-U29 resonances was not reversed, nor was the upfield shift of the 22G-C27 resonance, as one would expect if IF3 binding to the cloacin fragment were primarily ionic and nonspecific, as it is at low ionic strength. The failure of 1 M NaC1 to reverse the effects of IF3 on the cloacin fragment resonances implies that IF3 interaction with the cloacin fragment is largely nonionic and sequence specific at physiological ionic strength and above, which was also found in the nuclease mapping s t u d y . 2 However, this interpretation must be considered tentative, since at this stage we lack detailed information on the influence of ionic strength on RNA imino proton resonances in the absence of protein. Elucidation of the tertiary structure of IF3, and the details of its interaction with the cloacin fragment will require two-dimensional NMR analysis, using COSY spectra to assign through-bond nearest neighbors, and NOESY spectra to assign through-space nearest neighbors. 33 Discussion The equimolar footprinting, CD titration, and NMR experiments implied that IF3 destabilizes the secondary structure of the cloacin fragment upon binding, and that IF3 binding to the cloacin fragment is probably one 32 C. W. Hilbers, A. Heerschap, J. A. L. I. Waiters, and C. A. G. Haasnoot, in "Nucleic Acids: The Vectors of Life" (B. Pullrnann and J. Jortner, eds.), p. 427. Reidel, New York, 1983. 33 A. D. Kline, W. Braun, and K. WOthdch, J. Mol. Biol. 189, 377 (1986).
[ 15]
IF3- RNA INTERACTIONS
257
of its predominant interactions with 30S ribosomal subunits. The existence of some other weak interactions was indicated in sedimentation studies of IF3 binding to 30S subunits lacking the colicin fragment, ~ and cross-linking experiments implied an additional IF3 interaction near nucleotide 800 of 16S rRNA. 35 Our observations suggest that IF3 binding alters secondary structure in the 3' terminus of 16S rRNA in 30S ribosomal subunits, thus changing the 30S subunit conformation, in accord with some models for IF3 function. Studies of IF3 binding to the mutant unmethylated cloacin fragment 36 and mutant 30S ribosomal subunits are underway. Preliminary probes of both the normal and unmethylated mutant cloacin fragment with diethyl pyrocarbonate, in the presence and absence of IF3, suggest that IF3 also sequesters A25 and A26 in the loop of the hairpin. 37 Taking account of the nuclease mapping, equimolar footprinting, CD, NMR, and chemical probe studies of IF3 binding to the cloacin fragment, a detailed model for the interaction was formulated. 2 IF3 appears to interact specifically with those residues conserved throughout evolution, namely G 1 - U l 3 , the base pairs 19U-G30 and 20A-U29, the hairpin loop residues m2G23-m62A26, and G36-A38. 7 Perhaps a eukaryotic ribosomal protein or protein exists which interacts with the same conserved residues and shares some of the functions of prokaryotic IF3. Many of these residues became more accessible to solvent upon IF3 binding, making some nucleotides, Gl, G3, C8, Gl l, Ul3, G24, G30, G36, and G37, more susceptible to single-strand-specific nucleases, or broadening the iminoproton resonances of the conserved base pairs. A few nucleotides, U2, A6, A7, A9, A10, U19, m62A25, and m~2A26, were sequested from nuclease or chemical attack. The intricacy and specificity of the interaction were indicated by the observation that a given residue may be sequestered by IF3 while its immediate neighbor or base pair partner is made more accessible. Assuming an A form structure for the cloacin fragment, the 13 nucleotides of the 5' leg are about 3.5 nm long, and the hairpin is about 3.0 nm high, adding up to 6.5 nm in the most extended form possible. With a radius a gyration of 1.5 nm and an axial ratio of 3.5, ! IF3 is at most 10.5 nm long and 3.0 nm wide. Hence, IF3 is most than large enough to bind to the conserved residues of the cloacin fragment, from the 5' end to the top of the 34 M. Laughrea, J. Dondon, and M. Grunberg-Manago, FEBSLett. 91, 265 (1978). 35 C. Ehresmann, H. Moine, M. Mougei, J. Dondon, M. Grunberg-Manago, J.-P. Ebel, and B. Ehresmann, Nucleic Acids Res. 14, 4803 (1986). 36 B. Poldermans, C. P. J. J. van Buul, and P. H. van Knippenberg, J. Biol. Chem. 254, 9090 (1979). 37 H. A. Heus, E. Wickstrom, and P. H. van Knippenberg, unpublished observations (1985).
25 8
PROTEIN- RNA INTERACTIONS
[ 16]
hairpin, with room left over to bridge the cleft of the 30S ribosomal subunit. Previous work led us to think that physical studies might reveal details of changes in the secondary structures of IF3 and the 16S rRNA 3' terminal cloacin fragment, and that such phenomena might be used to quantitate the strength of IF3 binding to the cloacin fragment. The results presented above verify these expectations, and encourage pursuit of the molecular details of this and other protein- nucleic acid interactions by the techniques described above. Acknowledgments We thank Drs. H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippenbergfor their collaborationon tH magneticresonancestudiesand Dr. MarianneGrunberg-Managofor the plasmidpB5-57. Thisworkwas supportedby NationalInstitutesof HealthgrantsGM-28408, GM32024, and RR-01554, a European MolecularBiologyOrganizationshort-term fellowship, and a USF FacultyResearchand CreativeScholarshipgrant to E. W.
[ 16] I s o l a t i o n o f F r a g m e n t s o f R i b o s o m a l Recognize rRNA
By L I - M I N G
CHANGCHIEN,
Proteins That
RICHARD CONRAD, and GARY R. CRAVEN
The bacterial ribosome can be viewed as an intricate network of intramolecular and intermolecular interactions which are involved in the process of self-assembly. The former is represented by the folding of the constituent protein and RNA moieties into their unique three-dimensional structure, and the latter is achieved by the recognition and bonding between these structures, which may be subdivided into three obvious classifications: protein- protein, protein- RNA, and R N A - RNA interactions. The 30S subunit contains 21 proteins and one molecule of RNA, while the 50S subunit contains 32 proteins and two molecules of RNA. ~ Studies on the interactions between ribosomal proteins (r-proteins) and rRNA, as well as specific roles of individual proteins in further assembly (especially their interactions with other proteins) and the functions of the complete ribosome, have become possible after the development of the in vitro reconstitution systems for 30S and 50S ribosomes. 2-4 About half of the ribosomal H. G. Wittmann,Annu. Rev. Biochem. 51, 155 (1982). 2 p. Traub and M. Nomura,J. Mol. Biol. 40, 391 (1969). 3M. Nomuraand V. A. Erdmann,Nature (London) 228, 744 (1970). 4 T. Dohmeand K. H. Nierhaus,J. Mol. Biol. 107, 585 (1976). METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All fightsof reproductionin any form reserved.
25 8
PROTEIN- RNA INTERACTIONS
[ 16]
hairpin, with room left over to bridge the cleft of the 30S ribosomal subunit. Previous work led us to think that physical studies might reveal details of changes in the secondary structures of IF3 and the 16S rRNA 3' terminal cloacin fragment, and that such phenomena might be used to quantitate the strength of IF3 binding to the cloacin fragment. The results presented above verify these expectations, and encourage pursuit of the molecular details of this and other protein- nucleic acid interactions by the techniques described above. Acknowledgments We thank Drs. H. A. Heus, C. A. G. Haasnoot, and P. H. van Knippenbergfor their collaborationon tH magneticresonancestudiesand Dr. MarianneGrunberg-Managofor the plasmidpB5-57. Thisworkwas supportedby NationalInstitutesof HealthgrantsGM-28408, GM32024, and RR-01554, a European MolecularBiologyOrganizationshort-term fellowship, and a USF FacultyResearchand CreativeScholarshipgrant to E. W.
[ 16] I s o l a t i o n o f F r a g m e n t s o f R i b o s o m a l Recognize rRNA
By L I - M I N G
CHANGCHIEN,
Proteins That
RICHARD CONRAD, and GARY R. CRAVEN
The bacterial ribosome can be viewed as an intricate network of intramolecular and intermolecular interactions which are involved in the process of self-assembly. The former is represented by the folding of the constituent protein and RNA moieties into their unique three-dimensional structure, and the latter is achieved by the recognition and bonding between these structures, which may be subdivided into three obvious classifications: protein- protein, protein- RNA, and R N A - RNA interactions. The 30S subunit contains 21 proteins and one molecule of RNA, while the 50S subunit contains 32 proteins and two molecules of RNA. ~ Studies on the interactions between ribosomal proteins (r-proteins) and rRNA, as well as specific roles of individual proteins in further assembly (especially their interactions with other proteins) and the functions of the complete ribosome, have become possible after the development of the in vitro reconstitution systems for 30S and 50S ribosomes. 2-4 About half of the ribosomal H. G. Wittmann,Annu. Rev. Biochem. 51, 155 (1982). 2 p. Traub and M. Nomura,J. Mol. Biol. 40, 391 (1969). 3M. Nomuraand V. A. Erdmann,Nature (London) 228, 744 (1970). 4 T. Dohmeand K. H. Nierhaus,J. Mol. Biol. 107, 585 (1976). METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All fightsof reproductionin any form reserved.
[16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
259
proteins have been shown to be capable of independent and specific recognition of different regions of the rRNA molecules, and many different approaches have been taken to identify the regions of the rRNAs which the individual ribosomal proteins bind. 5-s However, relatively little effort has been made to establish the domains of the proteins responsible for interactions with the rRNA. We have been working to develop chemical and enzymatic cleavage techniques to produce fragments of ribosomal proteins which retain specific binding activities for rRNA. Once these fragments are found, the question can be asked, "Are any further functional roles of these proteins lost with the cleaved-off portion?" Our investigationsT M and studies from other laboratories t5-17 have shown that individual ribosomal proteins can be cleaved to produce smaller polypeptides capable of specific RNA association, and that often further functional activities in assembly and translation are lost.
Generation of Ribosomal Protein Fragments by Proteolytic Digestion Solutions RB (reconstitution buffer): 30 m M Tris-HC1 (pH 8.0), 20 m M magnesium acetate, 335 m M KC1, 1 mMdithiothreitol (DTT) TU- 1: 30 m M Tris-HC1 (pH 8.0), 8 M urea, 1 m M DTT TU-2:30 m M Tris-HCl (pH 8.0), 6 M urea TM: 30 m M Tris-HCl (pH 7.4), 20 m M magnesium acetate, 1 m M DTT TMA-I: 10 m M Tris-HC1 (pH 7.4), 10 m M magnesium acetate, 30 m M NH4CI, 1 m M DTT 5 R. Zimmermann, in "Ribosomes: Structure, Function and Genetics" (G. Chambliss, G. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 135. University Park Press, Baltimore, Maryland, 1980. 6 R. A. Garrett and H. F. Noller, J. Mol. Biol. 132, 637 (1979). 7 C. Zweib and R. Bdmacombe, Nucleic Acids Res. 6, 1755 (1979). 8 D. Moazed, S. Stern, and H. F. Noller, J. Mol. Biol. 187, 399 (1986). 9 L.-M. Changchien and G. R. Craven, J. Mol. Biol. 108, 381 (1976). 10L.-M. Changchien and G. R. Craven, J. Mol. Biol. 125, 43 (1978). 11 L.-M. Changchien, J. Schwarzbauer, M. Cantrell, and G. R. Craven, Nucleic Acids Res. 5, 2789 (1978). 12L.-M. Changchien and G. R. Craven, Nucleic Acids Res. 13, 6343 (1985). ~ J. Schwarzbauer and G. R. Craven, Nucleic Acids Res. 13, 6767 (1985). 14L.-M. Changchien and G. R. Craven, Nucleic Acids Res. 14, 1957 (1986). 15V. Newberry, M. Yaguchi, and R. A. GarrY, Eur..I.. Biochem. 76, 51 (1977). 16j. Bruce, E. J. Firpo, and H. W. Schaup, Nucleic Acids Res. 4, 3327 (1977). 17 V. Newberry, J. Brosius, and R. Garrett, Nucleic Acids Res. 5, 1753 (1978).
260
PROTEIN- RNA INTERACTIONS
[ 16]
T M A - 2 : 1 0 m M Tris-HC1 (pH 7.4), 0.5 m M magnesium acetate, 50 m M NH4C1 TMK: 30 m M Tris-HC1 (pH 7.4), 20 m M magnesium acetate, 500 m M KC1, 1 m M DTT Fragments of ribosomal proteins can be obtained by digestion of either free proteins or rRNA-protein complexes with proteolytic enzymes in various buffers. The digestion of free proteins in RB (see above) usually requires much lower concentrations of enzymes (protein : enzyme ratio of 100- 200: 1) than that for digestion of r R N A - protein complexes (complex : enzyme ratio of 5 - 20: 1). However, we find it advisable to prepare fragments from rRNA-protein complexes, as most fragments of ribosomal proteins generated in free solution are inactive in their rRNA-binding ability. Preparation of 16S RNA - Protein Complexes
In order to obtain a sufficient amount of fragment for chemical characterization and functional studies, it is usually necessary to prepare large quantities of 16S RNA-protein complexes for digestion experiments. Preparation of these complexes is performed by a modification of the procedure of Held et al. 18 The purified ribosomal proteins are dialyzed overnight against TU-1 to ensure the pH is over 7, then for 12 to 16 hr against TMK. Routinely, 37.5 nmol (500 OD26o units) of 16S RNA in 8 ml of TM is preincubated at 42 ° for 10 min and then mixed with a twofold molar excess of protein(s) in 16 ml of TMK. This mixture is then incubated at 42 ° for 30 min, cooled to 4 °, and centrifuged at 30,000 g for 10 min to remove any precipitate which might have been present. R N A protein complexes are isolated by pelleting through a 10 to 15 ml cushion of 10% sucrose in RB or TMA-1 for 16 hr at 100,000 g in 25 ml capped tubes (50.2Ti rotor). The pelleted complexes are dissolved in TMA-2, then dialyzed into RB at 40. It has been our experience that the pellet does not readily dissolve directly in RB. Proteolytic Digestion of 16S RNA - Protein Complexes
We have conducted a survey of the effect of many commercially available proteolytic enzymes on 16S RNA-protein complexes and have found that three enzymes--trypsin, chymotrypsin, and proteinase K - consistently give us the most desirable results. In addition, inhibitors are available for these enzymes which lessen the complication for subsequent isolation of fragments from the complexes. Usually, a series of experiments ~s W. A. Held, S. Mizushima, and M. Nomura, J. Biol. Chem. 248, 5720 (1973).
[ 16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
261
is carried out for a particular r-protein complex with each enzyme to optimize the time and molar ratio of protease to complex for digestion in terms of fragment production. Occasionally a digestion will be allowed to proceed beyond the point at which the amount of fragment peaks or plateaus in order to eliminate intact protein present, greatly simplifying the subsequent purification process. The enzymes are added to the complex solution from a stock solution in RB. It is essential that the enzyme preparation used be completely free of other hydrolytic enzyme activities, especially RNases. The digestion reactions are usually carded out at room temperature in RB for 2 to 3 hr, at an enzyme : complex molar ratio of l : 5 - 20. The reactions are stopped by the addition of one of three inhibitors: soybean trypsin inhibitor for trypsin (a twofold molar excess over enzyme, in RB)~9; 2-nitro-4-carboxyphenyl-N, N-diphenyl carbamate for chymotrypsin (0.1 volume of a 5 m M solution in 30 m M Tris-HCl (pH 7.6), initially dissolved in a minimum amount of 0.4 M Tris-base)2°; and phenylmethylsulfonyl fluoride for proteinase K (0.1 volume of a l0 m M solution in RB-40% 2-propanol). 2~ Reaction mixtures are cooled and pelleted through sucrose cushions exactly as in the preparation of the original complex. Supernatant is removed by aspiration and the pellets are dissolved in TU-2. Protein is extracted by the method of Hardy et al. 22 Preparation of Fragments of Ribosomal Proteins by Chemical Cleavage We have experimented with several chemical techniques for the fragmentation of ribosomal proteins and have found four cleavage procedures that produce biochemically functional fragments.
Chemical Cleavage at the Peptide Bond of Cysteine after Cyanylation with 2-Nitro-5-thiocyanobenzoic Acid Reagent Solutions Protein Buffer: 0.2 M Tris-acetate (pH 8.0), 4 M guanidine-HC1, 1 m M DTT 2-Nitro-5-thiocyanobenzoic acid (NTCB, Eastman, MW224.19) stock: 5 mg/ml (22.3 mM) in 0.2 M Tris-acetate (pH 8.0), 4 M guanidine-HC1 19j. Kunitz, J. Gen. Physiol. 30, 291 (1947). 20 B. F. Erlanger and F. Edel, Biochemistry 3, 346 (1964). 2~ D. E. Farney and A. M. Gold, J. Am. Chem. Soc. 85, 997 (1963). 22 S. Y. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969).
262
PROTEIN- RNA INTERACTIONS
[ 16]
10 m M NaOH Cleavage buffer: 0.2 M Tris-HC1 (pH 9.0), 4 M guanidine-HC1 Storage buffer: 30 m M Tris-HC1 (pH 8.0), 6 M urea, 1 m M DTT Treatment of ribosomal proteins with NTCB is carried out according to the procedure of Jacobson et al. 23 with slight modifications. Purified ribosomal protein is first dialyzed against 5% acetic acid for 24 hr (3 changes) and lyophilized. Lyophilized protein is dissolved in protein buffer at a level of 1 - 1.2 mg/ml, and the protein solution is incubated at 37 ° for 30 rain to ensure elimination of aggregate formation. Cyanylation of protein is initiated by the addition of a 5-fold excess of NTCB over total thiol present in solution (the contribution of the protein is often negligible compared to that of the DTT) and the pH of the solution is maintained at 8.0 by the addition of the NaOH solution. The reaction is allowed to continue at room temperature for 15 rain and terminated by the addition of an equal volume of glacial acetic acid. The sample is diaiyzed against 5% acetic acid and lyophilized. Cleavage of the derivatized protein is carried out by resuspending the lyophilized protein, now cyanylated, in cleavage buffer at 37 ° for 14 hr or longer, and terminated by the addition of an excess of 2-mercaptoethanol, followed by dialysis against 5% acetic acid and lyophilization. In order to maximize cleavage of protein without damaging the biochemical activity of fragments, it is necessary to study the time course of the cleavage reaction for each protein as well as the binding activity of fragments from several time points before large quantities of fragments are prepared. Thus, initially the lyophilates from several points in a time course will be dissolved in the sample buffer for a particular analysis system (we often use acid-urea polyacrylamide electrophoresis) and analyzed. Once optimal conditions are determined, the final cleavage products are resuspended and stored frozen at - 7 0 ° in storage buffer.
Cleavage at the Tryptophanyl Peptide Bond with a Mixture of Dimethyl Sulfoxide and Hydrogen Bromide Reagent Solutions Protein solvent: 2 parts glacial acetic acid, 1 part 12 N HCI containing 3.33 mg/ml of phenol (as scavenger for tyrosine modification) Dimethyl sulfoxide (DMSO, obtained from Fluka) Hydrobromic acid (HBr, obtained from Fluka), 48% in water 23 G. R. Jacobson, M. H. Schaffer, G. R. Stark, and T. C. Vanaman, J. Biol. Chem. 248, 6583 (1973).
[16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
263
Reduction solution: 30 m M Tris-HCl (pH 8.0), 4 M guanidine-HC1, 2 m M DTT, 10% 2-mercaptoethanol Storage buffer, as in previous section Cleavage of the tryptophanyl peptide bond of ribosomal proteins can be achieved using the method of Savige and Fontana. 24 Lyophilized r-protein (-20 mg) is dissolved in 6 ml of the protein solvent and 50/tl of DMSO is added. The reaction mixture is allowed to stand for 30 rain at room temperature, after which 200 #l of 48% HBr and another 50/d of DMSO are added. The reaction is allowed to continue for another 30 min at room temperature. Cleavage is terminated by the addition of 4 ml of distilled water. The solution is then dialyzed against 5% acetic acid overnight and lyophilized. Exposure of the protein to the reaction mixture for this time usually gives optimal cleavage (40 to 60% depending on different proteins). The use of longer reaction time always results in nonspecific cleavage. The products of this cleavage reaction are inactive in the binding to rRNA, presumably due to oxidation of methionine in protein. 25 A long reduction with a relatively high concentration of 2-mercaptoethanol is found to be necessary to restore the rRNA binding activity of the DMSOHBr reaction products. Reduction of the DMSO-HBr cleaved protein is achieved by dissolving in reduction solution and incubating at 37 ° for 48 hr in a sealed test tube followed by dialysis against storage buffer. This can be frozen until further use.
Cleavage of the Asparaginylglycyl(Asn-Gly) Peptide Bond with Hydroxylamine Reagent Solutions 4.5 M LiOH (filtered to remove undissolved material) Reaction solution: 0.8 M Tris, 2 M hydroxylamine, 4 M guanidineHC1. Prepared as follows: 2.78 g of hydroxylamine and 7.64 g ofguanidineHC1 are weighed into a 25-ml beaker. About 5 ml of the 4.5 M LiOH solution is then added slowly with vigorous stirring. Tris, 1.94 g, is added after hydroxylamine and guanidine-HC1 have completely dissolved and stirring continues until the solution becomes clear. The pH of the solution is then adjusted to 9.0 with 4.5 M LiOH and water is added to bring a final volume to 20 ml. (The
24 W. E. Savige and A. Fontana, this series, Vol. 47, p. 459. 25 L. Daya-Grossjean, J. Reinbolt, O. Pongs, and R. A. Garrett, F E B S Lett. 44, 253 (1974).
264
PROTEIN-RNA INTERACTIONS
[ 16]
high concentration of Tris in the solution is required to maintain steady pH of the solution during the incubation period.) Storage buffer, as in previous sections Asn-Gly peptide bond cleavage by hydroxylamine is performed by a modification of the procedure of Bornstein and Balian36 The lyophilized protein is dissolved in the reaction solution and the cleavage reaction is carried out at 45 ° for 2 hr. A large liquid volume is used for convenience of monitoring the pH of the solution, which is checked with a pH meter at intervals of 30 min and maintained at 9 by the addition of the LiOH solution. The reaction is terminated by the addition of 0.1 volume of glacial acetic acid and the sample is dialyzed overnight against 5% acetic acid. The cleavage products are lyophilized, then dissolved in storage buffer, and frozen till used. We have found that incubation for 2 hr is optimal for generation of biochemically active fragments although longer incubation (up to 4 hr) increases the efficiency of cleavage without the noticeable occurrence of nonspecific fragmentation.
Cyanogen Bromide Cleavageof Proteins Reagent Solutions Reaction solvent: 70% formic acid (0.795 dilution of 88% reagent) Cyanogen bromide stock(s): 1- 10 mg/ml cyanogen bromide (CNBr, obtained from Aldrich) in reaction solvent The general technique is to dissolve the protein, which has been lyophilized out of 5% acetic acid, in the reaction solvent, then to add various levels of CNBr stock and let the mixture react at room temperature. The reaction is stopped at various times by diluting five times with water and freezing, then lyophilizing. We routinely use 12- or 40-ml conical Pyrex tubes for these purposes, using 0.5 or 2 ml as a rea~ion volume. These are very convenient in terms of durability for freezing before lyophilization. The lyophilates are dissolved in storage buffer or a buffer required for a subsequent analysis. Previous work utilizing the CNBr technique has usually had the goal of generating fragments of a fixed size for use as molecular weight standards or to generate peptides for fingerprinting or sequence analysisY These have had no need to preserve the biological activity of the fragments obtained. The classical procedure for this technique has been to incubate the protein with a 5 to 250 times excess of CNBr to methionine residues in 26 p. Bornstein and G. Balian, this series, Vol. 47, p. 132. 27 E. Gross, this series, Vol. 11, p. 238.
[ 16]
RIBOSOMALPROTEIN FRAGMENTS THAT BIND rRNA
265
acid (usually either 700/0 formic acid or 0.1 MHC1) at room temperature or above for - 24 hr, ending the reaction by dilution and freeze-drying. These conditions were found to be unsatisfactory in generating r-protein fragments with rRNA-binding activity, and so the concentration and time of reaction were varied, with the resultant products being tested for any binding ability by rebinding and pelleting RNA complexes as described earlier. A third variable, the concentration of the acid in the reaction solvent, which was lowered in a previous s t u d y , 28 w a s not tested by us. We have found that the conditions that favor generation of fragments retaining biological activity yield only partial digestion of the protein. A further conundrum is that optimal conditions for one protein are not the same as those for another--that 2 hr at a 500: l ratio works for one protein and 30 min at 10: 1 is best for another. Each individual protein must be tested through several time-dosage combinations. Purification of F r a g m e n t s Purification of fragments is required after fragmentation of ribosomal proteins to separate the fragments from each other and from intact protein. On occasion, some enzymatic digestions yield only a single fragment of any appreciable size; this makes for an optimistic outlook on isolation of pure fragment, as only two components are involved--the fragment and the intact protein. The complexity of the fragment mixture increases geometrically with the number of possible cut sites, as none of the cleavages is t00% efficient, and all possible partial cleavage products arc generated. This is especially true for chemical cleavage because relatively short incubation times are used to prevent nonspecific cleavage and inactivation of functional fragments. In the past we have employed ion-exchange (CMcellulose) and gel filtration (Sephacryl S-200) column chromatography to purify ribosomal protein fragments. The introduction of reversed-phase high-performance liquid chromatography (HPLC) has added a further capability for purification, and we have recently begun to use commercially available C~8 HPLC (Synchropak RP-P) columns for this purpose. We have also started to modernize our ion-exchange system in terms of speed and efficiency (Bio-Rad SP-5-PW column). Separations of protein fragments with these columns are rapid and very convenient. A typical separation is shown in Fig. l with $4 and its larger hydroxylamine fragment on a Sephacryl S-200 column. The smaller fragment was separable on a Ct8 RP-HPLC c o l u m n . 14
2s H. J. Cahnmann, R. Arnon, and M. Sela, J. Biol. Chem. 240, PC2762 (1965).
a
A
B
$4-
-$4 - $ 4 fragment (I-124) - $ 4 fragment (125- 205)
b 0.8
E 0,6 OJ
U.I Z ,~ 0 . 4 ¢n n," 0 O0
B
P
0.2
L_
,
20
40
I
6O
8O
I00
I
120
\
f --
140
I
160
i,,,
I
180
200
FRACTION NUMBER FIG. 1. (a) SDS-polyacrylamide gel electrophoresis of $4 before (lane A) and after (lane B) hydroxylamine cleavage. (b) Separation of protein $4 and its larger hydroxylamine fragment (1 - 124) by a Sephacryl S-200 column. The column dimensions were 2.5 X 125 cm. The flow rate was 19 ml/hr and the volume of each fraction was 3.0 ml. The volume of the applied sample was 5.5 ml. From Changchien and CravenJ 4
[ 16]
RIBOSOMALPROTEIN FRAGMENTS THAT BIND rRNA
267
R e p r e s e n t a t i v e Results Historically, our work began by isolating a fragment of r-protein S4 (203 aa residues) produced by trypsin digestion of an $ 4 - 16S RNA complex? This fragment, which was missing its 46 N-terminal amino acid residues, retained the ability to specificaUy bind 16S rRNA, but lost the ability to assemble proteins S 1, $2, S 10, S 18, and $21 into a ribonucleoprotein (RNP) particle. We next utilized NTCB cleavage to cut off a smaller section (1 - 30) from the N-terminus of $4; this larger fragment regained the ability to assemble all proteins, but the particle so assembled was still deficient in tRNA binding. ~° Further work with $4 has shown that removing residues 168-203 leaves enough activity for complete assembly, but that the RNP particle produced is slightly less compact, having a sedimentation coefficient slightly lower (28S) than a reconstituted 30S standard. 12 In additional cutting off of the C-terminus of $4, a hydroxylamine cleavage at residues 124- 125 yielded an actively binding fragment.14 Figure 2 shows the binding isotherms for this fragment to 16S and 23S RNA. Complete investigation of this fragment is still proceeding, as is investigation of an even smaller piece generated by CNBr cleavage. An interesting result stemming from one experiment involved cleavage of S13 (117 aa residues) at its Cys-84 residue. ~3 In this case, the smaller (84- 117) fragment retained 16S RNA-specific binding ability but lost its ability to interact specifically with ribosomal protein S 19. The use of proteolytic enzyme digestion has proved to be useful for the study of particular proteins by our group and others. 9,~5,16 Intuitively, it may seem that this approach would be much better in terms of defining the "minimum RNA-binding region," in much the same way nucleolytic enzymes can be used to define a protein "footprint" on bound RNA or DNA. The analogy is not strictly applicable, since the folding of polypeptide chains is not analogous to the base-pairing and hai~in-looping of nucleic acids. If the domains of various functions are folded from regions separated in the primary sequence, these domains can be cleaved from one another, but with some proteins it is possible that a cut away from the active site of that protein will destabilize the conformation of the rest. Because of this, digestion of accessible parts of a bound protein can destroy the binding ability of the remainder of that protein, releasing it to free solution. Upon isolation of the complex, no fragments are observable in the protein extract, even though the protein of interest is being digested away. In addition to this, occasionally the compactness of a particular protein- RNA complex sterically blocks the action of a particular protease. This problem can in some cases be alleviated by partially denaturing the complexes with urea at a low level. Figure 3 demonstrates some cleavages
268
PROTEIN- R N A INTERACTIONS
[ 16]
A
I/5 i 1.0 ~C
2
0.8
4
Z
tr O~
12
16x IOI M "l
V[A]
0.6
13
(D iii ..J
8
U
'"
0.4
0
0.2 E~ Z
0
m
B
Z UJ
1.0
0
rr a.
0.8
O0 uJ ..J
0.6
0
04 0.2
t
2
3
4
5
6
7
8
9
MOLES PROTEIN / MOLES RNA IN RECONSTITUTION FxG. 2. Binding isotherms of hydroxylamine cleavage products of protein $4 to 16S RNA and 23S RNA. The binding studies of protein $4 fragment 1 - 124 to 16S RNA (O) and to 23S RNA (A) are illustrated in A. The insert in A is a double reciprocal plot of the binding data to 16S RNA. (B) The binding data for protein $4 fragment 125-203. From Changchien and Craven. 14
generated by three enzymes on protein $4 in complex with 16S RNA, each for 90 and 180 min. As observed, the action of each protease is different from the other two, not only in terms of fragments generated, but in terms of the course of digestion as well, due to their widely varying specificities. All the major fragments (molecular weights range from 22,500 to 14,400) have strong binding activity for 16S RNA. The use of CNBr on several different proteins has yielded diverse conditions and results. For example, the cleavage of $7 with CNBr, using
[ 16]
RIBOSOMAL PROTEIN FRAGMENTS THAT BIND r R N A
269
ABCDEFGHI
FIG. 3. SDS-polyacrylamide gels of reconstituted 16S RNA-protein S4 complex after treatment with different proteolytic enzymes. 16S RNA-protein $4 complex (complex) was digested with trypsin (complex : enzyme -- 10: 1), chymotrypsin (complex: enzyme = 5: l), or proteinase K (complex: enzyme = 5 : 1) in reconstitution buffer for different periods of time at 28 °. The digestion was terminated by the addition of inhibitor, and complexes were isolated as described in the text. Lane A, mixture of marker proteins; Lane B, complex; Lane C, complex treated with trypsin for 90 rain; Lane D, complex treated with trypsin for 180 min; Lane E, complex treated with chymotrypsin for 90 rain; Lane F, complex treated with chymotrypsin for 180 rain; Lane G, complex treated with proteinase K for 90 rain; Lane H, complex treated with proteinase K for 180 rain; Lane I, marker proteins. Marker proteins are ovalbumin (MW 43,000), carbonate dehydratase (MW 29,000), soybean trypsin inhibitor (MW21,000), myoglobin (MWI7,200), lactalbumin (MWI4,200), and aprotinin (MW 6,512). an extremely short cleavage time, with a fairly low level o f C N B r : M e t residues (30 m i n at - 5 : 1) has p r o d u c e d several b i n d i n g fragments. L o n g e r exposure, even for 1 hr, does n o t increase the absolute yield o f " a c t i v e " fragments, a l t h o u g h it does reduce the a m o u n t o f larger fragments; while increasing the level o f C N B r 5- o r 1 0 - f o l d is disastrous, yielding n o active
270
PROTEIN- RNA INTERACTIONS
[ 17]
fragments. Application of this cleavage technique to protein $4 requires the use of a high ratio of CNBr : Met (> 500: 1) and a 2-hr reaction period to yield a high percentage of a complete cleavage product which is still active in binding. Activity is lost with the extension of reaction time beyond this point.
[ 17] I s o l a t i o n o f K i n e t i c I n t e r m e d i a t e s in in Vitro Assembly of the Escherichia coli Ribosome Using Cibacron Blue F3GA By DIPAK B. DATTA, LI-MING CHANGCHIEN, and GARY R. CRAVEN In vitro self-assembly of a functional subcellular structure from its dissociated components has been commonly used to elucidate the probable pathway by which the structure assembles in vivo. For a complex structure such as the Escherichia coli ribosome which contains 3 species of RNA and more than 50 different proteins, the study of such an assembly mechanism has been especially intriguing. To elucidate the details of the assembly process several different approaches have been taken. For example, single components have been omitted from the assembly mixture~; assembly with chemically modified proteins 2 or ribosomal RNAs 3 (rRNAs) has been attempted; accessibility of proteins in partially assembled particles to chemical modifying agents has been studied4; and thermodynamic intermediates in the assembly process have been isolatedJ ,5 In all these cases, the assembly intermediates are thermodynamically stable particles which do not provide any clear picture of the kinetic order of addition of the proteins to the growing particle. If we are to gain further insight into the mechanism of ribosome assembly, we must develop techniques which will permit the isolation of many more intermediate particles in the kinetic pathway of assembly. We have therefore sought chemical reagents that might block the addition of proteins to rRNA during in vitro ribosome assembly. We reasoned that, as
M. Nomura and W. A. Held, in "Ribosomes"(M. Nomura, A. Tissieres,and P. Lengyel, eds.), p. 193.Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2L. Daya-Grojean,J. Reinbolt, O. Pongs, and R. A. Crarr~, FEBSLett. 44, 253 (1974). 3p. L. Schendeland G. R. Craven, NucleicAcids Res. 3, 3001 (1976). 4L.-M. Changchien and G. R. Craven, J. Mol. Biol. 113, 103 (1977). 5K. H. Nierhaus, in "Ribosomes:Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, cds.), p. 267. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All fights ofteproducdon in any form reserved.
270
PROTEIN- RNA INTERACTIONS
[ 17]
fragments. Application of this cleavage technique to protein $4 requires the use of a high ratio of CNBr : Met (> 500: 1) and a 2-hr reaction period to yield a high percentage of a complete cleavage product which is still active in binding. Activity is lost with the extension of reaction time beyond this point.
[ 17] I s o l a t i o n o f K i n e t i c I n t e r m e d i a t e s in in Vitro Assembly of the Escherichia coli Ribosome Using Cibacron Blue F3GA By DIPAK B. DATTA, LI-MING CHANGCHIEN, and GARY R. CRAVEN In vitro self-assembly of a functional subcellular structure from its dissociated components has been commonly used to elucidate the probable pathway by which the structure assembles in vivo. For a complex structure such as the Escherichia coli ribosome which contains 3 species of RNA and more than 50 different proteins, the study of such an assembly mechanism has been especially intriguing. To elucidate the details of the assembly process several different approaches have been taken. For example, single components have been omitted from the assembly mixture~; assembly with chemically modified proteins 2 or ribosomal RNAs 3 (rRNAs) has been attempted; accessibility of proteins in partially assembled particles to chemical modifying agents has been studied4; and thermodynamic intermediates in the assembly process have been isolatedJ ,5 In all these cases, the assembly intermediates are thermodynamically stable particles which do not provide any clear picture of the kinetic order of addition of the proteins to the growing particle. If we are to gain further insight into the mechanism of ribosome assembly, we must develop techniques which will permit the isolation of many more intermediate particles in the kinetic pathway of assembly. We have therefore sought chemical reagents that might block the addition of proteins to rRNA during in vitro ribosome assembly. We reasoned that, as
M. Nomura and W. A. Held, in "Ribosomes"(M. Nomura, A. Tissieres,and P. Lengyel, eds.), p. 193.Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2L. Daya-Grojean,J. Reinbolt, O. Pongs, and R. A. Crarr~, FEBSLett. 44, 253 (1974). 3p. L. Schendeland G. R. Craven, NucleicAcids Res. 3, 3001 (1976). 4L.-M. Changchien and G. R. Craven, J. Mol. Biol. 113, 103 (1977). 5K. H. Nierhaus, in "Ribosomes:Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, cds.), p. 267. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All fights ofteproducdon in any form reserved.
[17]
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
271
S03H
~ L\
03H
'[
'1 0
.I HN
SO3H
N N
( CI
FIo. 1. A planar diagram of the molecular structure of Cibacron Blue F3GA. From left to right there are four parts in the molecule: the sulfonated anthraquinone, the sulfonated benzene, the triazine ring containing the active chlorine, and the terminal sulfonated benzene.
about half of the ribosomal proteins can directly bind the appropriate rRNA, there might be a set of rules followed by all or most of them for associating with the developing protein-RNA complex during assembly. We therefore looked for a generalized inhibitor of protein-RNA interactions. This search led us to investigate the triazine dye Cibacron Blue F3GA as a potential candidate for such an inhibitor. Cibacron Blue F3GA is a complex sulfonated aromatic dye (see Fig. l) that has been found to bind to a large number of nucleotide-binding enzymes.6 This observation has led to the development of the method of dye-ligand affinity chromatography for the purification of enzymes of the kinase, oxidoreductase, synthetase, and transferase classes. These enzymes will bind to a column of agarose or Sepharose that has been chemically bonded with Cibacron Blue; most of them can be eluted with a very low concentration of their respective nucleotide cofactors or with salts at high ionic strength. There is substantial evidence that the dye specifically binds to a domain on the protein called the "dinucleotide fold. ''7 The high flexibility of the structure of the dye molecule probably helps it mimic the structures of different nucleotides and reinforces its binding to the dinucleotide fold of the proteins. Using a column of Cibacron Blue-bound agarose, we have shown that all E. coli ribosomal proteins, when free in solution, bind to the column even in the presence of the high salt concentrations in the reconstitution buffers used in these experiments. We have also shown that when the proteins are part of ribosomes, they do not bind to the column under 6 p. Dean and D. Watson, J. Chromatogr. 165, 301 (1979). E. Stellwagon, R. Cass, S. Thompson, and M. Woody, Nature (London) 257, 716 (1975).
272
PROTEIN-RNA INTERACTIONS
[ 17]
comparable conditions--and that ribosomes are mostly excluded from such a column) In light of these observations, we correctly reasoned that the free dye might inhibit in vitro ribosome assembly if it were prebound to the proteins. Using the following methodology, we discovered some kinetic intermediates in the 30S and 50S ribosome assembly. Preparation of Materials Solutions RB-30 (reconstitution buffer for 30S ribosomal subunits): 30 m M Tris-HCl (pH7.6), 0.33M KC1, 20raM magnesium acetate, 0.5 m M dithiothreitol (DTT) RB-30K: 30 m M Tris-HCl (pH 7.6), 0.5 M KC1, 20 m M magnesium acetate, 0.5 m M DTT RB-30N: 30 m M Tris-HC1 (pH 7.6), 20 m M magnesium acetate, 0.5 m M DTT RB-50 (reconstitution buffer for 50S ribosomal subunits): 20 m M Tris-HC1 (pH 7.4), 0.4 M NH4C1, 4 m M magnesium acetate, 0.5 m M DTT TM: 10 m M Tris-HC1 (pH 7.5), 10 m M magnesium acetate TM-4:l0 m M Tris-HC1 (pH 7.5), 4 m M magnesium acetate Cibacron Blue Stock Solution. A 13.33 m M solution of Cibacron Blue F3GA (Pierce & Co.) is incubated with a 10-fold molar excess of lysine in 20 m M Tris-HC1 (pH 7.5) at 44 ° for l hr for covalent modification of the dye at the site of its C1- component. Unmodified dye may covalently react with lysine groups at its binding site in the proteins. Alternatively Cibacron Blue-C1 can be hydrolyzed to Cibacron Blue-OH by NaOH treatment at 60 ° as described by Moe and Piszkiewicz. 9 Free Cibacron Blue (-C1 or - O H ) , although soluble in water, is not dialyzable in purely aqueous solutions. To facilitate future studies on dye-protein-binding properties, we tested solutions of various organic solvents in water for their effects on dialyzability of the dye. A solution of 250/0 (v/v) dioxane in water was found to give a reasonably good rate of dialysis of the dye. Therefore the aqueous solution of the dye to be used as a stock solution is made 25% in dioxane. The stock solution contains 10 m M Cibacron Blue, 250/0(v/v)dioxane, 20 m M Tris-HC1 (pH 7.5)(and 100 m M lysine if applicable). The final concentration of dioxane in the a D. Datta, L.-M. Changchien, and G. R. Craven, Nucleic Acids Res. 14, 4095 (1986). 9 j. G. Moe and D. Hszkiewicz, Biochemistry 18, 2810 (1979).
[17]
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
273
reaction mixtures has no effect on ribosome rcconstitution? ° Freshly prepared dye solution is always used. Ribosomal Subunits. The 70S ribosomes and their subunits are prepared following the procedures of Craven and Gupta, ~ and stored in TM at --70 ° . 30S Proteins. Total protein (TP-30) is extracted from the 30S ribosomes with acetic acid, ~2 then dialyzed sequentially against solutions of 30 m M Tris (unneutralized), 3 M urea, 0.5 m M DTT and 20 m M TrisHC1 (pH 8), 6 M urea, 0.5 m M DTT. It is stored in the latter solution at - 7 0 °" 50S Proteins. Total protein (TP-50) is extracted from the 50S ribosomes with acetic acid as in the TP-30 preparation; the rest of the procedure of TP-50 preparation follows the method ofNowotny et al.13 Proteins are stored in RB-50 at - 7 0 ° in aliquots. Ribosomal RNAs. 16S RNA is prepared by phenol extraction of 30S ribosomes. ~4 For preparation of intact 23S RNA, it is necessary to deproteinize 70S ribosomes with phenol and to isolate the 23S RNA by two successive preparative bentonite-treated sucrose gradient centrifugations. Pure 23S RNA from the appropriate peak fractions of the second centrifugation is precipitated by ethanol and dissolved in TM-4. 5S RNA is prepared by the method of Erdmann and Doberer? 5 All RNA solutions are stored in TM-4 at - 7 0 °. Procedures
Method of Reconstitution Prior to reconstitution experiments, the TP-30 solution is dialyzed against RB-30K buffer. The high-salt concentration of this buffer prevents precipitation of proteins when urea is removed. The dialyzed TP-30 is then diluted with RB-30N buffer to bring the KC1 concentration down to the normal level of 0.33 M. The RNAs and proteins are taken separately in 1.5 ml each of the appropriate reconstitution buffer. The RNA solution is heated to 42 ° for 10 rain and cooled to 0 ° before use. For the 30S reconstitution system, 80D26o units of 16S RNA are taken against 2.40D23o units ~0M. A. Cantrell, Ph.D. thesis. University of Wisconsin, Madison, 1977. i1 G. R. Craven and V. Gupta, Proc. Natl. Acad. Sci. U.S.A. 63, 1329 (1970). ~2S. Y. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry 8, 2897 (1969). ~3V. Nowotny, H.-J. Rheinberger, K. Nierhans, B. Tesche, and R. Amils, Nucleic Acids Res. 8, 989 (1980). 14 p. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this series, Vol. 20, p. 391. 15 V. A. Erdmann and H. G. Doberer, Mol. Gen. Genet. 114, 89 (1971).
274
PROTEIN- RNA INTERACTIONS
[ 17]
of TP-30. For the 50S reconstitution system, 8 OD26o units of a 1 : 1 mixture of 23S and 5S RNAs are taken against 2 OI)23o units of TP-50. The RNA: protein ratio in both systems is 1 : 2. To slow down the rate of self-assembly all experiments are performed at 0 °. The mixtures are incubated for 1 hr and then cleared by centrifugation at 10,000 g for 20 min in a Beckman JA-20 rotor. The RNA-protein complexes are pelleted by ultracentrifugation through a 15-ml cushion of 12% sucrose in appropriate reconstitution buffer at 100,000 g for 17 hr in a Beckman Type 50.2 Ti rotor.
Electrophoretic Analysis RNA-protein pellets are taken up in 100/zl of a solution of 10 m M Tris-HC1 (pH 7.5), 1 m M etl~ylenediaminetetraacetic acid, 8 M Urea, 0.5 m M DTT, treated with RNase, and analyzed for proteins by polyacrylamide gel electrophoresis (PAGE). One-dimensional PAGE is performed following the method of Voynow and Kurland.~6 Two-dimensional PAGE is performed as previously reported ~7 except that a small-sized gel (0.2 i.d. × 12.7 cm) is used in the first dimension and the thickness of the second-dimensional gel is 0.15 cm. Is
Inhibitory Molar Ratio of Dye: Ribosomal Proteins A series of experiments was done with increasing ratios of dye: proteins. Cibacron Blue was added to a solution of proteins in reconstitution buffer in appropriate aliquots, immediately followed by addition of the appropriate RNAs. Reconstitution was allowed to proceed for 1 hr. Unassembled protein:dye complexes were found to tend to aggregate; the low-speed centrifugation (described above) was essential to remove these. Any remaining such complexes, especially at high concentrations of Cibacron Blue, formed a blue ring around the RNA-protein pellet following ultracentrifugation. This ring was carefully removed with a swab stick. The RNA-protein pellets were analyzed for proteins by one-dimensional PAGE. Some typical results are shown in Fig. 2. It clearly shows that at the moderate dye:protein molar ratios of 40:1 to 100:1, all proteins are prevented from incorporation into a ribonucleoprotein complex. The corresponding dye:RNA ratios are 80:1 to 200:1. The proteins with the highest affinity for their respective RNAs compared to their affinity for the dye are $8, L1, and L24. 16p. Voynow and C. G. Kurland, Biochemistry 10, 517 (1971). 17L.-M. Changchien and G. R. Craven, J. Mol. Biol. 125, 43 (1978). ~8A. Lin, E. Collatz, and I. G. Wool, Mol. Gen. Genet. 144, 1 (1976).
[17]
275
TEMPORAL SEQUENCE OF RIBOSOMAL ASSEMBLY
SS, S9, SI2, SI4,: SI6,
sfe~
TP-50
0
II
21
52
57
42
47
55
105
MOLES DYE / MOLES TP-50 PROTEIN FIG. 2. One-dimensional PAGE analysis of 30S reconstitution intermediates formed in the presence of Cibacron Blue. T P - 30 proteins were treated with the dye at the dye: protein
molar ratio shown, immediately followed by the addition of 16S RNA, all at 0". The RNA-protein complexeswere isolated and analyzed as describedin the text. From Datta et al.s
Temporal Sequence of Ribosome Assembly From the above experiments, the minimum dye:protein molar ratio required to inhibit most proteins from assembly into ribosomes is found to be 50: 1. Subsequently the dye is used at this ratio to inhibit assembly at desired time points. A series of reconstitution mixtures is made and the dye added to the mixtures at various times after R N A - p r o t e i n mixing. The R N A - p r o t e i n complexes are isolated as described above. (The R N A protein pellets have a faint blue coloration especially at longer times of incubation.) Typical two-dimensional analyses for the 50S reconstitution system are shown in Fig. 3. The gels clearly show a time-dependent appearance of proteins in the intermediate particles. From a large number of such analyses, a kinetic sequence of ribosome assembly can be constructed. Our construction of such assembly sequences for E. coli 30S and 50S ribosome reconstitutions is shown in Fig. 4.
Possible Protein-Stripping Effect on Preformed Particles A possible pitfall in the use of Cibacron Blue as the inhibitor of ribosome assembly is that at relatively high concentrations it may start strip-
276
[ 17]
PROTEIN- RNA INTERACTIONS
8M Urea, pH 4.5
)
SDS pH7.1
FIo. 3. Two-dimensional PAGE analysis of 50S reconstitution intermediates isolated following addition of Cibacron Blue at different times during assembly. For the 0 time experiment, the dye was added to the proteins immediately prior to the addition of the RNA. A dye: protein molar ratio of 50 : l was used. From Datta et al.S
[17]
TEMPORAL SEQUENCE OF RIBOSOMALASSEMBLY 30S
ASSEMBLY,(7'
[ S8 $4 S5 S6 SIS ]
50S ASSEMBLY,O* STAGE I
<2
[s7sg/sIIst3sIBs,7 SZOI
[LI L24L$ LIO LII L7 LI2 L23 I
<2
STAGE2
[L9 LIBLtSLm I
<2
<2
<2
<2
[s2s3s,os,,,2]
277
sTAoE4 [L'L"L,L91L22L2L2,L29L2]
Fro. 4. Proposedtemporal sequenceof 30S and 50S ribosomeassembly. From Datta et al. 8
ping some proteins off the ribonucleoprotein particles. To determine the extent of this effect, a series of experiments was done in which the ribosomes, or more appropriately the RI (reconstitution intermediate) particles, in their appropriate reconstitution buffers, were treated with increasing concentrations of the dye at the same dye: protein molar ratios as used to find the effective ratio for assembly inhibition. For 30S ribosomes a ratio up to 50:1 does not show any significant stripping effect. For 50S ribosomes much higher ratios have no stripping effect. The RI particles of both 30S and 50S systems show resistance to protein stripping up to ratios of greater than 50: I. Therefore a dye: protein molar ratio of about 50: 1 can be safely used to inhibit i n v i t r o ribosome assembly and isolate the kinetic intermediates. Concluding R e m a r k s A judicious use of Cibacron Blue F3GA can make it a simple and valuable tool in isolating kinetic intermediates in the assembly pathway of ribosomes and other systems where interactions between a nucleic acid and multiple proteins are involved. The isolation and analysis of such intermedimes should further our understanding of biological assembly mechanisms.
278
PROTEIN-RNA INTERACTIONS
[18]
[18] T o t a l R e c o n s t i t u t i o n o f 7 0 S R i b o s o m e s f r o m Escherichia coli B y R O L F LIETZKE a n d I ~ U D
H. NIERHAUS
Ribosomes consist of two subunits, both of which can be reconstituted from their separated ribosomal RNA and r-protein moieties to fully active subunits in vitro. 1,2 The conditions for the total reconstitution of the 30S and 50S subunits, respectively, are different despite the evidence from in vivo studies which favors cooperative processes 3 probably caused by common genetic control. However, at least the 50S assembly does not seem to be coupled to that of the 30S subunit via a feedback inhibition, since a severe assembly defect of the 50S subunit does not hamper the 30S assembly in vivo. 4 For the study of possible interdependences between the assemblies of both subunits as well as for structural and functional analyses (e.g., neutron scattering) a method is desirable which allows the total reconstitution of both subunits in one test tube. Here we describe the total reconstitution of the 70S ribosome from Escherichia coli. Assembly interdependences of the subunits could not be observed, but cannot yet be strictly excluded. In the two-step incubation procedure the assembly of the 30S subunit occurs completely in the first step, whereas the 50S reconstitution requires the conditions of the second step in addition. Two counteracting effects determined the reconstitution optimum for 70S ribosomes in the second step: On one hand the temperature sensitivity of the reconstituted 30S particles, on the other hand the temperature and Mg2+ requirements of the 50S reconstitution. The superposition of both effects yields the optimal conditions for the 70S reconstitution. The conditions are identical to those of the 50S reconstitution except that the incubation temperature of the second step is reduced from 50 ° to 47 °. Furthermore, TP70 (total protein from 70S ribosomes) from tightly coupled ribosomes should be used rather than a TP70 preparation derived from crude 70S ribosomes. The reconstitution efficiency for 70S ribosomes is 60 to 85%.
P. Traub and M. Nomura, J. MoL Biol. 40, 391 (1969). 2 F. Dohme and K. H. Nierhaus, J. MoL BioL 107, 585 (1976). 3 H. Nashimoto and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 67, 1440 (1970). 4 M. Herold, V. Nowotny, E. R. Dabbs, and K. H. Nierhaus, Mol. Gen. Genet. 203, 281 (1986). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress.Inc. All riots ofreproduedonin any form reserved.
[18]
TOTAL RECONSTITLITION OF 70S RIBOSOMES
279
P a r a m e t e r s Influencing Total Reconstitution of 70S Ribosomes The 50S reconstitution is studied in Table I (experiment l) in the presence of 30S components. Comparison of assay 1 with the control (assay 5) reveals that the additional presence of 16S rRNA does not affect the 50S reconstitution (78% activity in both cases). In contrast, equimolar amounts of TP70 derived from crude 70S ribosomes yielded only marginal activity (6%, assay 2), which could be increased to 36% by increasing the TP70 amounts (assay 3). A further increase in the amount of TP70 had a detrimental effect on the 50S reconstitution (not shown). Interestingly, the equivalent activity was found even when no native 30S subunits were added to the poly(Phe)-synthesizing system (34%, assay 4). This is a first indication that, in principle, the total reconstitution of 70S ribosomes is possible. Surprisingly, the total reconstitution of 70S ribosomes could be increased significantly if(TP50 + TP30) were used instead of TP70 (Table I, experiment 2; compare assays 1 and 2). The use of (23S + 5S + 16S) rRNA derived from subunits yields reconstitution efficiencies equivalent to that of the total rRNA (TrRNA). Furthermore, the reconstitution of 30S subunits already occurs in the first step of two-step procedure (assay 3). As in the 50S case, the 30S assembly is not affected by the additional presence of (23S + 5S) rRNA (compare assays 6 and 4), whereas the additional presence of TPS0 clearly impairs the 30S assembly (assays 6 and 5). The TP50-induced inhibition is nullified by the simultaneous presence of (23S + 5S) rRNA (assays 5 and 3). The improved reconstitution efficiency of (TPS0 + TP30) over crude TP70 could be due to impurities (RNases, etc.) in the crude TP70 preparation, since the 70S pellet obtained from the $30 crude extract 5 has a green color (membrane debris), whereas the pelleted subunits derived from the pooled fractions of a zonal run (sucrose gradient 6 to 37%) 5 are transparent and colorless. Therefore, we tried a TP70 preparation from tightly coupled ribosomes which had been subjected to two successive zonal runs. 6 Figure 1 demonstrates that excellent activities were obtained with TrRNA and TP70 from tightly coupled ribosomes, and equimolar amounts of TP70 to TrRNA are optimal. Finally, we determined the optimal Mg2+ concentration and incubation temperature in the second step for 70S reconstitution. Therefore, a mixture of TrRNA, TP30, and TPS0 was subjected to a standard 1-step incubation (4 m M M g 2+, 400 m M N H 4 +, 20 min at 44°). Then the Mg 2+ concentraK. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443. 6 H.-J. Rheinberger, U. Geigenmffller, and K. H. Nierhaus, this volume [45].
9~
C~
D~
÷
z
÷+1111
f~
÷
0
f-
E~
÷÷÷~÷
0
÷
÷
°° 0
.°
++1+1
..
,.
÷÷÷
÷
r~ ~Q t~ r~
Jr
÷
+~
+++
C3
~
8 Z
Jr
÷÷÷÷~
8
I.i
~f~ 8
<
~b
~J
[18]
TOTAL RECONSTITUTIONOF 70S RIBOSOMES
281
o
cx_ >.
I
,
1
0.5 1.5 TP70 (equivalentunits} FIo. 1. Optimization of TP70 for the total reconstitution of 70S ribosomes. The standard two-step procedure for 50S reeonstitution was used. 2 TrRNA, 3.75 A260 units, was incubated with the indicated amounts of TP70 and tested for poly(Phe)-synthesis activity as described. 7 Both TrRNA and TP70 were derived from tightly coupled ribosomes. One equivalent unit is the amount of TP70 extracted from 1 Azro unit of 70S ribosomes.
tion was increased to 10.5, 13.5, 17, or 20 m M and a second incubation followed at various temperatures from 37 to 55 ° for 90 min (Fig. 2). Before measuring the poly(Phe)-synthesizing activity at 20 ° for 60 min, all assays were adjusted to 20 m M Mg 2+. Figure 2A shows the eti~ciency of the 70S reconstitution. When an excess of native 50S subunits is added to the poly(Phe)-synthesizing system the 30S reconstitution is measured (Fig. 2B) and vice versa (Fig. 2C). Figure 2D depicts a control reconstitution of 50S subunits from TP50 and (23S + 5S) rRNA. All curves have a pronounced maximum except in Fig. 2B where the activity is independent of both the chosen Mg 2+ concentrations and the temperatures up to 44*. Above that temperature, the activity decreases thus showing the instability of the reconstituted 30S subunits at elevated temperatures. Between 13 and 20 m M the Mg 2+ concentrations hardly affect the 50S reconstitution (Fig. 2C). Here the temperature optimum is 50 °, the same as in the standard system (Fig. 2D). In contrast, the reconstitution of 70S ribosomes [Fig. 2A, no addition of native subunits to the poly(Phe)-synthesizing system] shows a marked optimum at 47 ° and a nearly symmetrical shape of the curve. The shape
282
PROTEIN- R N A INTERACTIONS
A 70S reconstitutJon
~
G N
B +50S:30S reconstJtution
i
i
L
I
[ 18]
C +30S:SOSreconstitution
I
~ control: SOSreconstitution F" measurecl/computecl 70S reconstitution
37
td
~/~ ~7 50
SS 37 td t~/~ /~7 SO SS tempePQture of the se¢0ndstep [°C]
FIG. 2. Mg2+ and temperature dependence of the total reconstitution of 70S ribosomes (A) and its subunits (B and C) in the second step. A 100-/d aliquot contained 3.75 A26ounits of TrRNA and equimolar amounts of (TP50 + TP30). After the two-step reconstitution, 2 × 40/tl [containing 1 A26o unit of (23S + 5S) rRNA and 0.5 ATx,o unit of 16S rRNA] were tested for poly(Phe) synthesis (60 rain at 20*). The Mg2+ concentrations in the second step were 10.5 (O), 13.5 (A), 17 ~ and 20 mM (0). (B) Test for the active 30S subunits formed; it is the same as A except that 1 A26ounit of native 50S subunits was added to the poly(Phe)synthesizing system. (C) Test for active 50S subunits formed; it is the same as A except that 1 A:6o unit of native 30S subunits was added to the poly(Ph¢)-synthesizing system. (D) Control reconstitution of 50S subunits from (23S + 5S) rRNA and TPS0. (E) 20 m M Mgz+ curve from A (It) and a 70S formation curve ((3) calculated from the 20 m M curves of B and C. For further details see text.
can be easily explained by superimposing the curves of Fig. 2B and C. The synthesis of a polypeptide requires both subunits. If, for example, only 40% of the input material of one subunit is assembled to native particles and 100% of that of the other, the measured activity cannot surmount 40%. Furthermore, if an inactive fraction of one subunit is formed which nevertheless can associate with the complementary one, then the relative amounts of the active subunits formed have to be multiplied in order to obtain the relative amount of protein-synthesizing 70S ribosomes. This has been done in Fig. 2E: The maximal value of the 30S curves is set at "1," and the smaller values are set at proportionally smaller numbers. These numbers are multiplied with the corresponding cpm values of the 20 m M Mg 2+ curve in Fig. 2C, and we obtain a curve (Fig. 2E, open circles) which is very similar to the measured one (closed circles).
[18]
TOTAL RECONSTITUTION OF 70S RIBOSOMES
283
Materials and Procedure for the Total Reconstitution of 70S Ribosomes
Materials Tightly coupled 70S ribosomes: Isolation from Escherichia coli K12, strain A 19 or D 10, as described6 30S and 50S ribosomal subunits: Isolation according to Nierhaus and Dohme5 16S rRNA, (23S + 5S) rRNA, and TrRNA in T~0M4 buffer: Isolation as described for (23S + 5S) rRNA 5 TP30, TP50, and TP70 in Rec4 buffer: Isolation as described for protonated TP507 T~oM4 buffer: 10 m M Tris-HC1, pH 7.5, 4 m M magnesium acetate Rec4 buffer: 20 m M Tris-HCl, pH 7.5, 4 m M magnesium acetate, 400 m M NH4CI, 2 mM 2-mercaptoethanol, 0.2 m M ethylenediaminetetraacetic acid (EDTA) Rec20 buffer: Same as Rec4 except 20 mM magnesium acetate and 1 mM EDTA Rec4 adaptation buffer: 110 mMTris-HC1, pH 7.5, 4 mMmagnesium acetate, 0.2 mM EDTA, 4 M NH4CI, 2 m M 2-mercaptoethanol
Procedure. The preparation procedures of the ribosomal materials used in this paper are referenced above. In the following we describe the reconstitution of 70S ribosomes from TrRNA and TP70. It is important to isolate TP70 from tightly coupled ribosomes which have been subjected twice to a zonal centrifugation.6 TrRNA, 3.75 A26ounits in TioM4 buffer, is mixed with 0.1 volume of the Rec4 adaptation buffer to achieve the ionic milieu of the Rec4 buffer. Then Rec4 buffer and optimal amounts of TP70 (usually equimolar amounts) in Rec4 buffer are added to a final volume of 100 pl. After the first-step incubation (20 min at 44°), 4/tl of 0.4 M magnesium acetate is added, which raises the Mg2+ concentration to 20 mM, and this is followed by the second-step incubation (at least 90 min at 47°). Two 40-pl aliquots per reconstitution assay are transferred to the poly(Phe)-synthesizing system 7 without adding native subunits (unless there are special reasons, e.g., Fig. 2B and C). In the experiment reported here, the incubation for the poly(Phe) synthesis was performed at 20 ° for 60 rain instead of the normal conditions of 37 ° for 45 min in order to prevent heat-dependent assembly events during the incubation for the poly(Phe) synthesis. The efficiency of the 70S reconstitution is 60 to 85%, i.e., 60 to 85% of the input material forms active 70S ribosomes as compared to native 70S ribosomes. 7 p. Nowotny, V. Nowotny, H. Voss, and K. H. Nierhaus, this volume [8].
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
[ 19] I n t r a - R N A Techniques
287
and RNA-Protein Cross-Linking i n E s c h e r i c h i a coli R i b o s o m e s
By R I C H A R D
BRIMACOMBE, W O L F G A N G STIEGE, APOSTOLOS KYRIATSOULIS, and PETER M A L Y
Cross-linking techniques offer a direct approach for the determination of neighborhoods between the various components of complex macromolecular systems. In our laboratory we have for some years been engaged in the development of such techniques for application to the study of Escherichia coli ribosome structure, and, in this article, we describe the methods which we are currently using both for the determination of neighborhoods between different regions of the ribosomal RNA (intra-RNA cross-linking) as well as for establishing contacts between the RNA and individual ribosomal proteins (RNA-protein cross-linking). Since the usefulness of the data is proportional to the degree of precision with which the sites of cross-linking can be localized, we set ourselves from the outset the goal of analyzing cross-link sites at the nucleotide level on the ribosomal RNA. In both types of cross-linking study (intra-RNA and RNA-protein), it was the development of techniques for the isolation of cross-linked complexes appropriate for this purpose which proved to be the most difficult problem far more time-consuming than for instance the search for suitable crosslinking reagents m and we will devote a corresponding amount of discussion to a description of these techniques. Before beginning, however, it is necessary to summarize very briefly some general considerations (see Refs. 1 and 2 for a more detailed discussion) which have a direct influence on the experimental strategies that can be applied in cross-linking studies of this nature. The analysis of a cross-link site on the ribosomal RNA involves at some stage a partial nuclease digestion procedure to generate RNA fragments containing the various cross-links, and this is followed by some kind of RNA sequence determination on the individual isolated cross-linked complexes. If the cross-link site analysis is to be pursued unambiguously to the nucleotide level, then the cross-links must be left intact throughout the whole experimental procedure. In other words, an irreversible cross-linking mR. Brimacombe, J. Atmadja, A. Kyriatsoulis, and W. Stiege, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 184. Springer-Verlag, Berlin, Federal Republic of Germany, 1986. 2 R. Brimacombe, in "3-D Structure and Dynamics of RNA" (P. H. van Knippenberg and C. W. Hilbers, eds.), p. 239. Plenum, London, 1986. METHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allrightsof reproductionin any formreserved.
288
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
agent is required. This in turn implies, however, that conventional end-labeling techniques for the subsequent analysis of the RNA are precluded, at least in the case of intra-RNA cross-linking experiments. Here, the isolated cross-linked complexes consist either of two distinct RNA fragments connected by the cross-link, or of a single RNA fragment in which the crosslink forms a closed loop. End labeling of the former type of complex would give rise to two labels, whereas the latter type of complex could not be sequenced within the closed loop. We therefore use ribosomes that are uniformly labeled with 32p, and the sequence determinations are made with classical fingerprinting techniques. In fact it is also more convenient to use the same uniformly labeled substrates for the RNA-protein cross-linking studies, since covalently linked RNA-protein complexes are often difficult to end-label satisfactorily. Uniform labeling has the added advantage that any impurities or cross-contaminations in the cross-linked complexes can be quantitatively assessed, and, since the nucleotide sequences of the E. coli ribosomal RNA molecules are known, 3,4 the RNA fingerprint data can be interpreted rapidly and unambiguously, provided that the RNA fragments in the isolated cross-linked complexes are of a suitable length (in practice approximately 30- 200 nucleotides). Finally, there is the question of the substrate used for the cross-linking reaction itself. Our objective is the study of the structure of the ribosomal RNA in situ in the ribosome, and we therefore use ribosomal subunits, ribosomes, or even growing E. coli cell cultures as substrates for the crosslinking reactions. This imposes restrictions on the type of cross-linking agents that can be usefully applied; in particular some intra-RNA crosslinking agents can only be used satisfactorily with isolated RNA as substrate (see [21] and [22], this volume). In the ensuing sections we begin with a description of our method for isolating 32p-labeled E. coli ribosomal subunits as substrates for both intraRNA and R N A - p r o t e i n cross-linking studies. Next, we deal with the intra-RNA cross-linking methodology, and describe the cross-linking reactions, the partial nuclease digestion conditions, the isolation of cross-linked complexes by gel electrophoresis, and the fingerprint analysis of the individual products. This is followed by a corresponding section on R N A protein cross-linking methodology, including in this case descriptions of the cross-linking reagents, assessment of the extent of reaction and identification of the proteins involved in the cross-linking, the partial nuclease 3 j. Brosius, M. L. Palmer, P. J. Kennedy, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 75, 4801 (1978). 4 j. Brosius, T. J. Dull, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 77, 201 (1980).
[19]
INTRA-RNA AND RNA-PROTEIN CROSS-LINKING
289
digestion conditions, isolation of the cross-linked complexes by a new stepwise procedure, and finally fingerprint analysis and protein identification with the individual isolated complexes. Preparation of 32p-Labeled Ribosomal Subunits s Twenty-five-milliliter cultures of E. coli MRE 600 are grown at 37 ° overnight in a shaker bath in a medium consisting of 20 m M Tris-HC1, pH 7.8, 20 m M NH4C1, 30 mMMgSO4, 0.3 mMCaCl2, 400 mMglycerol, and 0.2% vitamin-free casamino acids (Difco). A l-ml aliquot of this overnight culture is used to inoculate the labehng culture, which is made in 50 ml of the same medium containing 20 mCi of ortho [32p] phosphate (cartier free). It is important that the glassware used is first washed with chromic acid, to eliminate the phosphate residues left by commercial detergents. The culture is grown at 37 ° with shaking, and incorporation of the isotope is measured by taking 50-gl aliquots at intervals and centrifuging them in a table centrifuge; the 32p radioactivity in 5 gl of the supernatant is compared with that in 5 gl of the sample prior to centrifugation, which gives a direct measure of the fraction of the isotope still remaining in the medium. When 70-80% of the radioactivity has been incorporated (after 3 - 4 hr incubation), the cells are spun off by two successive centrifugations (10,000 rpm, l0 min, Sorvall HB4 rotor) into a single 30-ml plastic centrifuge tube. The pellet is washed with l0 m M Tris-HC1, pH 7.8 containing 1 m M magnesium acetate ("sonication buffer"), centrifuged again, and then suspended in 3.5 ml of sonication buffer. The centrifuge tube conraining the suspension is placed in a beaker of ice water and sonicated with a Branson sonifier. Five 30-sec pulses are given, with a l-min pause between each. Two microliters of deoxyribonuclease I (Sigma, 1 mg/ml)' is added, and the suspension immediately centrifuged (10,000 rpm, 15 min). The supernatant from this spin containing the ribosomes is loaded directly onto a 10-40% sucrose gradient in l0 mMTris-HC1, pH 7.8, 50 mMKC1, 0.3 m M magnesium acetate, 6 m M 2-mercaptoethanol, using a Beckman SW 25 or equivalent rotor (centrifuge tube volume 50-60 ml), and the gradient is centrifuged for 18 hr at 18,000 rpm and 4 °. The gradient is fractionated, the radioactivity measured, and fractions containing 30S and 50S subunits are respectively pooled. The subunits are precipitated by increasing the magnesium concentration to 5 m M followed by addition of 2 volumes of ethanol. After 2 hr at --20 ° the subunits are spun off (10,000 rpm, 30 min), and resuspended in 0.5 ml of "storage buffer," 5 W. Stiege, C. Zwieb, and R. Brimacombe, Nucleic Acids Res. 10, 7211 (1982).
290
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 1 9]
consisting of 25 m M triethanolamine-HC1, pH 7.8, 5 m M magnesium acetate, 50 m M KC1, and 6 m M 2-mercaptoethanol. The suspensions are dialyzed for 3 hr against high-salt buffer (20 m M triethanolamine-HC1, pH 7.8, 20 m M magnesium acetate, 400 m M NH4CI, 6 m M 2-mercaptoethanol), and the subunits are then activated6 by incubating them, still in their dialysis bags, at 37 ° for 15 min in a beaker containing the high-salt buffer. Finally, the dialysis is continued overnight against several changes of the storage buffer. This method of preparation is very rapid, gives well-separated subunits containing intact RNA, and involves a minimal exposure to radiation. The usual yield of 30S subunits from the procedure is - 3 A26ounits, containing 1.5 X 10 9 counts/min Cerenkov radioactivity, the corresponding yield of 50S subunits being about twice as much. Since the storage buffer is free of primary amines, the subunit preparations are suitable for use directly with any of our cross-linking reagents, with the exception of bis(2chloroethyl)methylamine (see below). In the latter case, the final dialysis is made against storage buffer in the absence of mercaptoethanol (for 50S subunits), or against 25 m M sodium cacodylate, pH 7.2, 5 m M magnesium acetate, and 50 m M KCI (for 30S subunits). Intra-RNA Cross-Linking The successive steps in an intra-RNA cross-link analysis are summarized schematically in Fig. 1, and are discussed in the following sections.
Cross-Linking Reactions The most effective methods that we have found for introducing intraRNA cross-links into ribosomes are (1) direct ultraviolet irradiation 7,s and (2) treatment with the bifunctional alkylating agent bis(2-chloroethyl)methylamine, "nitrogen mustard" (EGA Chemic).5,9 For ultraviolet irradiation the ribosomal subunits in storage buffer (see previous section) are diluted to a concentration of 5 A26o units/ml, and the solution is placed in a Petri dish or similar container so that it forms a layer approximately 1-mm thick. The irradiation is carried out at 4* for 2 to 6 min in an apparatus consisting of four horizontally parallel-mounted Sylvania G8T5 germicidal lamps, set 5 cm apart from each other. The 6 I. Ginzburg, R. Miskin, and A. Zamir, £ Mol. Biol. 79, 481 (1973). 7 W. Stiege, C. Glotz, and R. Brimacombe, Nucleic Acids Res. 11, 1687 (1983). s j. Atmadja, R. Brimacombe, H. BlOcker, and R. Frank, Nucleic Acids Res. 13, 6919 (1985). 9 j. Atmadja, W. Stiege, M. Zobawa, B. Greuer, M. Osswald, and R. Brimacombe, Nucleic Acids Res. 14, 659 (1986).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
291
32p-labeled E. eoli cells
Isolation of ribosomal subunits
C r o s s - l i n k i n g by in vivo i r r a d i a t i o n
Cross-linking by irradiation or
Isolation of cross-linked subunits
treatment with nitrogen mustard
[
P a r t i a l d i g e s t i o n with cobra venom n u c l e a s e
D i g e s t i o n of ribosomal p r o t e i n s with p r o t e i n a s e K
1 S e p a r a t i o n of int!a-RNA c r o s s - l i n k e d complexes by two-dimensional gel e l e c t r o p h o r e s i s
E x t r a c t i o n of i n d i v i d u a l complexes from gel
I Ribonuclease T 1 f i n g e r p r i n t
Ribonuclease A f i n g e r p r i n t
Secondary digestion with
Secondary dzgest • i on with
ribonuclease A
l
ribonuclease T I
,1 Position of cross-link site deduced from oligonucleotide data
FI~. 1. Experimental ~eps in an intra-RNA cross-~nk site analysis.
292
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
sample is held at a distance of 4 - 6 cm from the lamps, which at this distance deliver an energy o f - 2 5 Joules/m 2 sec. After irradiation the subunits are transferred to a centrifuge tube and precipitated with ethanol. [Ethanol precipitation is a "standard" procedure in this and the following sections; two volumes of ethanol are added, the solution is kept for 1.52 hr at - 2 0 °, and the precipitated subunits (or RNA) are collected by centrifugation at 10,000 rpm for 30 min in a swing-out rotor. Samples in salt-free buffers are made 100 m M in solution acetate before addition of ethanol.] The ultraviolet cross-linking can also be carried out "in vivo.-1o In this case a 32p-labeled E. coli cell culture (25 ml) is spun down (cf. previous section), and immediately resuspended in 2 ml or 1 m M magnesium chloride, l0 m M Tris-HCl, pH 7.8. The suspension is irradiated in a 2-ram thick layer for 6 min, as just described, and the cells are then disrupted by sonication and the ribosomal subunits isolated as in the previous section. Cross-linking with the nitrogen mustard reagent is effected simply by incubating the ribosomal subunit solution (5-10 A26o units/ml) with the reagent for 1 hr at 37°; a 100 m M solution of nitrogen mustard is freshly prepared in the same buffer as the subunits, and is added to the latter so as to give a final reagent concentration of 1 - 3 raM. The subunits must be in a buffer that is free of 2-mercaptoethanol, and, as noted in the previous section, we use sodium cacodylate buffer for 30S subunits and storage buffer for 50S subunits. (The cacodylate buffer gives marginally better results, but, for reasons which we have not been able to determine, the 50S subunits become hypersensitive to nuclease contamination in this buffer.) The cross-linking reaction is terminated by adding a solution of cysteamine (1 M) to a final concentration of 20 times that of the cross-linking reagent, and incubating for a further 15 min at 37 °. The subunits are then precipitated with ethanol. No subunit aggregation or dimer formation is observed under these cross-linking conditions. Estimation of the yield in an intra-RNA cross-linking procedure is very difficult. Although a gel system has been described ~ for separating certain classes of cross-linked molecules in intact 16S RNA, we know of no way of estimating the overall amount of cross-linking that has taken place. Choosing a suitable reagent concentration or irradiation time is therefore an empirical process, based on the results obtained in the subsequent steps (see below). The conditions just described are designed to give relatively low levels of cross-linking, in order both to simplify the patterns of digestion products, as well as to maximize the probability that each observed lo W. Stiege, J. Atmadja, M. Zobawa, and R. Brimacombe, J. MoL Biol. 191, 135 (1986). 1~p. L. Woilenzien and C. R. Cantor, J. Mol. Biol. 159, 151 (1982).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
293
cross-link is the first cross-linking event in any individual molecule. The possibility of introducing artifacts is thus kept to a minimum, although it must be remembered that artifacts can never be entirely excluded in any cross-linking or chemical modification study. As a corollary to this, it should be noted that it is inadvisable to try to "force" any cross-linking system; if the desired cross-link can only be obtained by drastically raising the reagent concentration (or irradiation time), then the resulting analysis will not only be complicated by many unwanted side reactions, but there will also be a high risk that conformational artifacts have been introduced.
Partial Nuclease Digestion The purpose of the partial nuclease digestion is to reduce the crosslinked RNA to fragments of a size suitable for analysis. That is to say, the fragments must be long enough to enable the sequence to be located unambiguously in the 16S or 23S RNA, but not so long that the position of the cross-link site is "lost." By far the most effective enzyme for this purpose is the double-strand specific nuclease from cobra venom, ~2used in conjunction with intact cross-linked ribosomal subunits as substrate. The enzyme is commercially available, or can be prepared from crude cobra (Naja naja oxiana) venom, and it gives a clear and reproducible pattern of RNA fragments) 3 The ethanol-precipitated cross-linked subunits (see previous section) are dried briefly under vacuum to remove traces of ethanol, and are taken up in 10 m M Tris-HC1, pH 7.8, 1 m M MgC12, 20 m M NH4CI (30 #1 per A260unit). A suitable quantity of enzyme (evaluated by a series of preliminary experiments with unlabeled ribosomal subunits) is added, and the solution is incubated at 37 ° for 60 min. Next, ethylenediaminetetraacetic acid (EDTA) is added to give a final concentration of 6 mM, together with a fresh solution of proteinase K (Merck) to a concentration of 1 mg/ml, and incubation is continued for 10 min at 37 °. The solution is then made 0.3% in SDS, incubated for a further 10 min, and loaded directly onto the polyacrylamide gel (see next section) for separation of the RNA fragments. This procedure avoids ethanol precipitation of the digested sample, in contrast to our older procedure, 5 a factor which improves the clarity of the gel separation, particularly in the case of samples cross-linked with nitrogen mustard. 9 Not more than about 2 A26ounits should be applied to a single gel slot, and the additions of EDTA, sodium dodecyl sulfate (SDS), and proteinase K should be made with small volumes from concentrated solutions, to keep the increase in sample volume to a minimum. 12 S. K. Vassilenko and V. C. Ryte, Biokhimiya (Moscow) 40, 578 (1975). ,3 S. K. Vassilenko, P. Carbon, J. P. Ebel, and C. Ehresmann, J. Mol. Biol. 152, 699 (1981).
294
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
Cross-linked complexes that are still inconveniently large after this procedure can, if present in sufficiently good yield, be subjected to a second partial digestion step after the gel electrophoresis (see below). Procedures for this type of digestion, involving the use of ribonucleases TI and H or cobra venom, have already been published in detail, 5,7,s and for reasons of space will not be repeated here. In general it is important to carry out these second digestions in the presence of a defined amount (e.g., 50 #g) of unlabeled carrier RNA, using an enzyme concentration that has been tested in preliminary experiments immediately beforehand. In contrast, in our experience, none of the three enzymes (T1, H, or cobra venom nuclease) is very suitable for the first partial digestion if deproteinized 16S or 23S RNA is used as substrate, since the products formed are either too heterogeneous (under mild conditions) or too selective (under harder conditions). Ribonuclease T~ for example was found in our earlier experiments ~4to digest everything away except for RNA fragments derived from the most stable hairpin loops in the ribosomal RNA. This has the consequence that the observed yield of any particular cross-link after electrophoretic isolation of the cross-linked fragments is strongly influenced by the digestion conditions used. 7,8
Gel Electrophoresis In all our experiments we routinely use slab gels that are 40 cm long, 15 cm wide, and 0.1 cm thick. Each gel has 12 sample wells 0.9 cm wide, and connection to the upper reservoir buffer is made with a 3 MM paper wick. All gel solutions are briefly degassed before addition of ammonium persulfate, and the gels are run at room temperature, except where otherwise indicated. For separation of partially digested intra-RNA cross-linked fragments we use a two-dimensional gel system, in which the first dimension contains both SDS and urea, whereas the second dimension contains urea but no SDS. The gel concentrations in each dimension can of course be varied to suit the requirements of a particular experiment as typified by the following procedure. 5 First Dimension. This is a 3 - 15% gradient gel, which is made using a simple linear gradient mixing device. The gel solutions are put together with aliquots from appropriate stock solutions, the "3%" gel solution consisting of 1 M Tris-HC1, pH 7.8 (5 ml), 10% SDS (2 ml), 200 m M EDTA (1.25 ml), dimethylaminopropionitrile (0.4 ml), urea (42 g), and a 38% acrylamide/2% methylenebisacrylamide solution (7.5 ml), made up to 98 ml with water. The "15°/o'' gel solution is the same, except that it 14C. Zwicb and R. Brimacomb¢, Nucleic Acids Res. 8, 2397 (1980).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
295
contains 37.5 ml of the acrylamide solution, together with sucrose (8 g) to stabilize the gradient. Thirty-three milliliters of each solution are placed in the gradient mixing chambers, and 0.7 ml of a 1.6% a m m o n i u m persulfate solution is added to each chamber. The gradient is gently run into the gel apparatus, the 15% gel solution being in the first chamber. The gel slot former is immediately placed on top of the gel, polymerization time being of the order of 10 min. The reservoir buffer consists of I M Tris-citric acid, pH 8.6 (150 ml), 10% SDS (30 ml), and 200 m M EDTA (37.5 ml), made up to 3 liters with water. The partially digested RNA samples (see previous section) are made dense by the addition of 0.5 volume of reservoir buffer containing - 6 M urea and a tittle bromphenol blue as marker, and are then pipetted into the gel slots. The samples are carefully overlaid with reservoir buffer, and electrophoresis is carded out at 300 V overnight, so that the dye marker runs - 2 5 cm into the gel. (Sucrose should not be used to make the samples dense for loading.) Second Dimension. After the first-dimension electrophoresis the bands are located by autoradiography, and a 30 cm X 1 cm strip is cut out from each gel lane. This strip is divided into two 15-cm portions, corresponding to the upper and lower regions of the first-dimension gel, and these strips are polymerized into 10 and 20% second-dimension gels, respectively. The second-dimension gels are run in the system of Maxam and Gilbert, 15 the gel solutions consisting of urea (42 g), 38% acrylamide/2% methylenebisacrylamide (25 ml for the 10% gel, 50 ml for the 200/0gel), and 1 MTris-boric acid, pH 7.3/20 m M EDTA buffer (5 ml), made up to 95 ml with water. N,N,N',N'-tetramethylethelenediamine (TEMED), (20/zl) and 1.6% amm o n i u m persulfate (5 ml) are added, and the solution is poured into the gel apparatus so as just to cover the first-dimension gel strip, which is held clamped between the gel plates. The reservoir consists of the Tris-boric acid/EDTA buffer (150 ml) made up to 3 liters with water. A little xylene cyanole dissolved in reservoir buffer containing urea is overlaid on the gel to act as dye marker, and electrophoresis is carded out at 600 V until this marker is about half-way down the gel. After the run, the gels are subjected to autoradiography (Fuji X-ray film, at room temperature), taking several exposures from - 1 0 min up to 2 hr. An example of a typical pair of two-dimensional gels (in this case from 50S subunits cross-linked by ultraviolet irradiation in vivo ~°) is shown in Fig. 2. In each gel the "diagonal" of free RNA fragments can be seen, with the cross-linked complexes (examples arrowed) lying above this diagonal. No spots above the diagonal are observed in control experiments where the cross-linking reaction is omitted, and in experiments where the proteinase is A. M. Maxam and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 74, 560 (1977).
296
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
FIG. 2. Two-dimensional polyacrylamide gel separation of partially digested intra-RNA cross-linked complexes. The top panel shows an autoradiogram of the 3-15% first-dimension gel strip (run from left to right). The lower panels show autoradiograms of the corresponding second-dimension gels (10% gel left, 20% gel fight) made from the two halves of the first-dimension gel strip. Direction of electrophoresis in the second dimension is from top to bottom, so that the "diagonal" of free RNA fragments runs from upper left to lower right in each case. The arrows indicate some of the intra-RNA cross-linked complexes that were successfully analysed from these gels.
K digestion (see previous section) is omitted the pattern of cross-linked spots is essentially the same, although not so well defined. This demonstrates that the spots above the diagonal do indeed correspond to crosslinked RNA complexes, and not to (for example) degradation products of R N A - p r o t e i n cross-links; the subsequent sequence analysis confirms this expectation. Radioactive spots of interest are cut out from the two-dimensional gels, and the gel pieces are crushed with a plastic spatula. The RNA complexes are extracted by shaking the crushed gel overnight with 400 gl of 10 m M Tris-HC1, pH 7.8, 1% SDS, 1 m M EDTA, 100 m M sodium acetate, to-
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
297
gether with 200gl of water-saturated phenolJ 6 After separation of the phases by a brief spin in a table centrifuge, the aqueous layer is pipetted off and the RNA collected by ethanol precipitation. The pellet is dried briefly under vacuum, and finally redissolved in a small volume (20-50 #1) of 10 m M Tris-HC1, pH 7.8, 0.1% SDS, ready for sequence analysis. The yields of cross-linked complexes vary from a few thousand to several million counts/min of [32P]RNA. If necessary the individual complexes can be purified by a further gel electrophoresis step, under second-dimension conditions.
Fingerprint Analysis The isolated intra-RNA cross-linked complexes are subjected to digestion with either ribonuclease T~ or ribonuclease A. Two microliters of unlabeled tRNA carder (10 mg/ml) is added to 10/tl of the isolated complex solution, together with 5 gl of ribonuclease TI (Sankyo, 1 mg/ml) or 5/zl of ribonuclease A (Sigma, 1 mg/ml). The solutions are incubated for 20 min at 37 °, and the water-bath temperature is then raised to 60 °, so that the samples slowly warm up to this temperature during a further 10 rain. After concentration by lyophilization, the samples are taken up in 10 gl of water, applied to polyethyleneimine cellulose thin-layer plates (Macherey & Nagel), and then chromatographed in two dimensions according to the "mini-fingerprint"method of Volckaert and FiersJ 7 The latter authors have described their system in detail, and the only variation which we have incorporated is that the wet plates are immediately washed with 70% ethanol instead of water after each chromatographic dimension. The Volckaert and Fiers system is well suited for the separation of both ribonuclease TI and ribonuclease A oligonucleotides (although the authors only describe its use for the latter), provided that the RNA fragment is not more than about 200 nucleotides in length. After autoradiography the radioactive spots are scratched from the thin-layer plates into drawn-out capillaries attached to a vacuum pump, and the Cerenkov radioactivity measured (for subsequent molarity estimation). The oligonucleotides are eluted with - 5 0 gl of 30% triethylamine adjusted to pH 9.5 with CO2, Is by attaching a syringe containing this solution to the capillary tube. The eluates are evaporated to dryness, redissolved in 100/ll water, and lyophilized. Each oligonucleotide is then subjected to a secondary digestion in 10gl of 10 m M Tris-HCl, pH 7.8, 0.1% SDS, in the presence of 5 gg unlabeled is A. Yuki and R. Brimacombe, Eur. J. Biochem. 56, 23 (1975). 17G. Volckaert and W. Fiers, Anal. Biochem. 83, 228 (1977). ,s G. G. Brownlee, "Determination of Sequences in RNA." North-Holland, Amsterdam, 1972.
298
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 19]
carrier RNA and 5/tg of ribonuclease A or T~ (oligonucleotides from ribonuclease T~ fingerprints being digested with ribonuclease A, and vice versa). These digests are lyopbilized and applied to polyethyleneimine cellulose plates, using the "double-digestion" two-dimensional chromatographic system, exactly as described by Volckaert and F i e f s . 17 After drying, the plates are subjected to autoradiography, which is carded out at - 8 0 °, using Kodak XAR 5 film with intensifying screens. Times of autoradiographic exposure are overnight for the fingerprints, and 1 week for the secondary digests. Six fingerprint plates, or 20 secondary digestion plates, can be accommodated under a single 35 × 43 cm film. The oligonucleotides in each spot on the fingerprints are identified by correlation with their corresponding secondary digestion products, and are fitted qualitatively and quantitatively into the 16Sa or 23S4 RNA sequence. The position of the cross-link site within the RNA fragment(s) is then deduced as described in detail in our publications, 5,7-~° each individual cross-link being a special case. In the current era of obsession with end-label sequencing techniques, the elegant fingerprint methods of Volckaert and Fiers for RNA analysis within a known sequence as outlined above deserve a special emphasis. The methods are extremely rapid and well adapted for the handling of large numbers of samples; our assistants think nothing of running 60-70 twodimensional fingerprints in a day, and two or three people working together have run as many as 800 two-dimensional secondary digestion chromatograms in a single day. Furthermore, the sensitivity is such that 3000-5000 counts/min of 32p in an RNA complex comprising - 1 5 0 nucleotides is sufficient for a complete analysis (including secondary digestions) of both a ribonuclease T~ and a ribonuclease A fingerprint. Last but not least, RNA complexes with "ragged ends," which are frequently found in this type of experiment, do not present any problem with these techniques. R N A - Protein Cross-Linking The original intention in our RNA-protein cross-linking studies was to establish sites of cross-linking on both protein and RNA, and this was achieved in two cases of simple ultraviolet-induced cross-linking, namely with protein $7 in the 30S subunit ~9and protein IA in the 50S. 2° However, with bifunctional chemical reagents, the problem of analyzing sites on the proteins has proved too complex, not least because many proteins often 19 K. M611er, C. Zweib, and R. Brimacombe, J. Mol. Biol. 126, 489 (1978). 2o p. Maly, J. Rinke, E. Ulmer, C. Zwieb, and R. Brimacombe, Biochemistry 19, 4179 (1980).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
299
exhibit multiple cross-linking sites on the RNA with any given cross-linking agent; this gives rise to the additional problem of sorting out which cross-link site on the particular protein corresponds to which cross-link site on the RNA. As a result, we have confined our attention to the analysis of the cross-linking sites on the RNA. The various steps in our RNA-protein cross-link site analysis are summarized schematically in Fig. 3, and are considered individually in the next sections. 32p-labeled ribosomal subunits
Cross-linking
Partial
with nitrogen mustard, 2-iminothioiane,
digestion
Removal of n o n - c r o s s - l i n k e d
or APAI
w i t h c o b r a venom n u c l e a s e
p r o t e i n by " s u c r o s e g r a d i e n t e i e c t r o p h o r e s i s "
Removal of f r e e RNA f r a g m e n t s by g l a s s - f i b e r
fiItration
Elution of RNA-protein complexes from glass filter with SDS
S e p a r a t i o n of c o m p l e x e s by two d i m e n s i o n a l g e l e l e c t r o p h o r e s i s
Extraction
of individual
J I
RNA-protein c o m p l e x e s from g e l
Protein identification
Proteinase K digestion
using antibodies
and phenol extraction
l ,
I
I Fingerprint
analysis
of c r o s s - l i n k
site,
of RNA and d e d u c t i o n as i n F i g .
1
FIG. 3. Experimental steps in an R N A - p r o t e i n cross-link site analysis.
300
CROSS-LINKING AND AFFINITY-LABELING METHODS
[ 1 9]
Cross-Linking Reactions The application of three bifunctional RNA-protein cross-linking reagents will be described here, namely (1) nitrogen mustard (cf. Ref. 2 1), (2) 2-iminothiolane (Pierce Chemical Co.)22 and (3) methyl p-azidophenylacetimidate ("APAI"). 2a In the case of nitrogen mustard, which is a symmetrical reagent, the RNA-protein cross-linking reaction occurs concomitantly with the intra-RNA cross-linking reaction described above, under precisely the same conditions. Since, as already discussed, the yields of cross-linking are deliberately kept low, the intra-RNA and RNA-protein cross-linked products can be handled independently without mutual interference. The other two reagents are heterobifunctional reagents, and the RNA-protein cross-linking is a two-step reaction. The first step involves reaction of lysine residues on the proteins with the imidoester function of the reagent, and the cross-linking to RNA is then achieved by a mild ultraviolet irradiation.22.24 2-Iminothiolane is dissolved in 0.5 M triethanolamine to a concentration of 0.5 M 25 and is immediately added to the subunit solution in storage buffer (see section on preparation of 32p-labeled ribosomes), so as to give a final reagent concentration of 20 raM. After incubating for 20 min at room temperature (-22°), the subunits are precipitated with ethanol to remove excess reagent, and resuspended in storage buffer (minus 2-mercaptoethanol) to a concentration of 5 A26o units/ml. The solution is irradiated for 2 min, exactly as described for ultraviolet intra-RNA cross-linking above, and is then made 3% in 2-mercaptoethanol and incubated at 37 ° for 30 min to destroy any S-S bridges. Finally, the subunits are precipitated with ethanol. The reaction with APAI is very similar. 24 The reagent is dissolved to a concentration of 2 mg/ml ( - 9 raM) in 100 m M triethanolamine-HC1, pH 9, 50 m M KC1, 5 m M magnesium acetate, and is immediately added to an equal volume of ribosomal subunits in storage buffer. After incubating for 30 min at 30 °, the subunits are precipitated with ethanol and subjected to irradiation as just described for 2-iminothiolane. The subunits are then precipitated again with ethanol, omitting the incubation step with 21E. Ulmer, M. Meinke, A. Ross, G. Fink, and R. Brimacombe, Mo[. Gen. Genet. 160, 183 (1978). 22I. Wower, J. Wower, M. Meinke, and R. Brimaeombe, Nucleic Acids Res. 9, 4285 (1981). 23G. Fink, H. Fasold, W. Rommel, and R. Brimacombe, Anal. Biochem. 108, 394 (1980). 24j. Rinke, M. Meinke, R. Brimacombe, G. Fink, W. Rommel, and H. Fasold, J. Mol. Biol. 137, 301 (1980). 23 R. R. Traut, A. BoUen, T. T. Sun, J. W. B. Hershey, J. Sundberg, and L. R. Pierce, Biochemistry 12, 3266 (1973).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
301
2-mercaptoethanol. Dimer formation or aggregation of the subunits is not observed with either reagent under these conditions.
Assessment of Cross-Linking Reaction Two parameters can be readily measured in an RNA-protein crosslinking reaction. These are (1) the extent of reaction, in terms of the percentage of total ribosomal protein cross-linked to RNA, and (2) the identities of the proteins that have been cross-linked. 1. To measure the extent of reaction, double-labeled subunits are used, prepared from E. coli cultures grown in minimal medium in the presence of [3H]uridine and [~4C]lysine.24The cross-linking reactions are carded out at initial subunit concentrations of not more than 20 A26o units/ml, either as just described or under any conditions which are required to be tested. After the final ethanol precipitation the cross-linked subunits (in 1 A26o unit aliquots) are dissolved in 50 gl of gel reservoir buffer, and applied to 3-8% acrylamide gradient gels containing SDS. The gel and reservoir recipes are essentially the same as those described above for the first-dimension gel in the separation of intra-RNA cross-linked complexes, with the exceptions that urea is omitted, and the concentration of acrylamide in the heavier gel solution is of course 8% instead of 15%. The gel is run until the bromphenol blue marker has traveled - 15 cm, and 0.6-cm wide strips from each gel lane are then fractionated into 0.25-cm slices. Each slice is placed in a scintillation vial with 6 ml of a scintillation cocktail containing PPO (0.4%) and Soluene 300 (Packard, 10%, v/v) in toluene, the vials are shaken gently overnight, and assayed for ~4C and 3H radioactivity. The gel profiles should show a peak of radioactivity corresponding to 16S or 23S RNA, and the amount of ['4C]protein radioactivity traveling with this peak gives a direct measure of the extent of cross-linking26; the [14C]: [3H] ratio in the RNA peak is simply compared with the corresponding [~4C]:[3H] ratio of the original ribosomal subunits. In our experience a cross-linking yield of 3 - 10% of the total protein is most suitable for the subsequent cross-link site analysis. This system not only gives a quantitative measure of the extent of reaction, but is also a qualitative test of the potential usefulness of the cross-linking reagent. A certain amount of aggregated protein is always observed at the origin of these gels, but if this aggregation is inordinately large, or if the protein radioactivity is smeared along the length of the gel together with an ill-defined peak of 16S or 23S RNA, then the reagent--or
56 K. MtUer and R. Brimacombe, Mol. Gen. Genet. 141, 343 (1975).
302
CROSS-LINKING AND AFFINITY-LABELING METHODS
[19]
at least the reaction condition u s e d - - i s unlikely to yield any worthwhile data. 2.To identify the proteins involved in the cross-linking reaction, 50 A2~o units of ribosomal subunits are subjected to the cross-linking procedure (for this purpose it is also convenient to use double-labeled subunits), and, after the final ethanol precipitation, the subunits are dissolved in 1.0 ml of 10 m M Tris-HC1, pH 7.8, 0.1% SDS, 2 raM EDTA, 6 m M 2-mercaptoethanol, and are loaded onto a 7.5- 30% sucrose gradient in the same buffer. The gradient is centrifuged for 20 hr at 25,000 rpm and 10*, using a Beckman SW 27 or equivalent rotor. The gradient is fractionated, and the peak of [3H]RNA containing also the R N A - p r o t e i n cross-links is collected and precipitated with ethanol. Care must be taken to avoid any contamination with the non-cross-linked [14C]protein which remains at the top of the gradient. The precipitated gradient fractions are dissolved in 0.2 ml of 10 m M Tris-HC1, pH 7.8, 0.1% SDS, 1 m M EDTA, and treated with 5 gg of ribonuclease A and 5 #g ribonuclease TI for 15 min at 37 °. Five volumes of ethanol are added, and after l0 rain at - 2 0 ° the precipitated proteins are spun off in a table centrifuge, the digested RNA remaining in the supernatant as small oligonucleotides. 2| The pelleted proteins are washed width 80% ethanol, spun down again, dried briefly under vacuum, and applied in appropriate buffer either to the one-dimensional SDS gel system of Laemmli and Favre, 27 or to any of the established two-dimensional protein gel systems. 2s-3~ After running, the gels are stained and the protein patterns examined. At a cross-linking level of 3 - 10% (see above), the gels will have been loaded with amounts of protein corresponding to ~ 1 - 3 A26o units of ribosomal subunits (allowing for losses during the procedure). Each protein on the gel will of course be slightly displaced from its normal running position as a result of the residual oligonucleotide attached, so that a precise identification is difficult among those proteins which run close together. 21'24As with the 3 - 8 % gel system described above, the protein gels also provide a searching test of the potential usefulness of the reagent. Large amounts of aggregated protein remaining at or near the gel origin are again in our experience a sure sign that the reagent is unlikely to yield any detailed cross-link site data. Many of the R N A - p r o t e i n crosslinking reagents reported in the literature (reviewed in Ref. 32) show this
27U. K. Laemmliand M. Favre, J. Mol. Biol. 80, 575 (1973). 28E. Kaltschmidt and H. G. Wittmann, Anal. Biochem. 36, 401 (1970). 29L. J. Mets and L. Bogorad,Anal. Biochem. 57, 200 (1974). 3oD. Geyl,A. B6ck, and K. Isono, Mol. Gen. Genet. 181, 309 (1981). 3t j. Wower,P. Maly, M. Zobawa,and R. Brimacombe,Biochemistry 22, 2339 (1983). 32R. Brimacombeand W. Stiege,Biochem. J. 229, 1 (1985).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
303
defect, which explains why the first enthusiastic publication of a new reagent is usually followed by an ominous silence.
Partial Nuclease Digestion As with the analysis of intra-RNA cross-link sites, the first step in determining the sites of RNA-protein cross-linking on the RNA is to subject the 32p-labeled cross-linked subunits to a partial nuclease digestion. Currently we use exclusively the digestion procedure with cobra venom nuclease, as already described for intra-RNA cross-linking, with of course the exception that the proteinase K digestion step after the reaction is omitted.
Isolation of Cross-Linked RNA-Protein Complexes Once the cross-linked subunits have been partially digested, it is important both to keep the RNA-protein complexes in solutions with high salt concentration, and also to avoid ethanol precipitations as far as possible. Otherwise there is a strong tendency for irreversible aggregation to occur. The methodology that we have developed was designed with these factors in mind, and proceeds in three stages, namely removal of non-cross-linked protein (Step 1), removal of non-cross-linked RNA fragments (Step 2), and finally electrophoretic separation of the cross-linked RNA-protein complexes (Step 3). This multistep procedure is made necessary by the fact that each individual cross-linked complex inevitably represents only a minute fraction of the total [32p]RNA. A protein cross-linked to the extent of 5% and linked to a 16S RNA fragment 50 nucleotides long would correspond to 0.15% of the RNA, if this fragment were the sole product in the partial digestion containing that particular region of the RNA sequence. Given the heterogeneity of the partial digestion, the actual figure is likely to be an order of magnitude less, i.e., -0.01% of the RNA, and this represents a difficult separation problem, particularly since the usual purification procedures such as phenol extraction are excluded in the case of R N A protein complexes. Step 1. The removal of non-cross-linked protein from the venom-digested subunits is achieved by electrophoresis through a sucrose gradient in the presence of urea, salt, and nonionic detergent. A glass tube 19 cm long and with 0.5 cm internal diameter is dosed at the bottom end by means of a piece of dialysis membrane held in place by a rubber O ring, and the gradient ( 10- 34% sucrose) is poured into this tube. The gradient solutions contain urea (25.2 g), 200 m M EDTA (0.75 ml), Triton X-100 (Merck, 0.1 ml), 1 M trisodium citrate (10.2 ml), 2-mercaptoethanol (0.03 ml), 1 M Tris-citric acid buffer, pH 8 (3.0 ml), and sucrose (6 g for the 10%
304
[ 19]
CROSS-LINKING AND AFFINITY-LABELING METHODS
gradient component and 20.4 g for the 34% component), made up to 60 ml with water. Of each solution 1.9 ml is placed in the gradient mixing chambers, and the gradient is poured gently into the glass tube, with the heavy solution leading. The prepared gradient tube is then placed in an ordinary disc. gel electrophoresis apparatus. The bottom reservoir compartment is filled with a solution containing urea (180 g), 200 m M EDTA (6.75 ml), 1 M trisodium citrate (85 ml), 1 M Tris-citric acid buffer, pH 8 (25 ml), and sucrose (175 g), made up to 500 ml with water. Next, the digested cross-linked subunit sample (see above) is diluted 1:1 with a solution made up of urea (0.96 g), 1% Triton X-100 (0.08 ml), and upper reservoir buffer (0.9 ml), and is layered on top of the gradient; the upper reservoir buffer is the same as the bottom buffer, except that urea and sucrose are both omitted. The sample is carefully overlaid with the upper reservoir buffer, and the gradient is subjected to electrophoresis at 4 ° overnight at 120 V, with the anode at the bottom. After electrophoresis the dialysis membrane is punctured with a needle, and the gradient dripped out. Radioactivity in 2-gl aliquots from each fraction is measured, and appropriate fractions containing RNA and crosslinked complexes are pooled. Figure 4 shows an example of such a graI
i
i
I
i
10000
5000 Cross-
Linked
S
4000 o
"~ 8000 Z
-ic
c
6000
3000
~J
o
~000
2000 o
I
2000
1000 I
I
I
L
z+
8
12
I
16
~:
I
20
Fraction No. FIo, 4. Separation by "sucrose gradient electrophoresis" (see text) of double-labeled cross-linked 30S subunits that have been partially digested with venom nuclease. Direction of electrophoresis is from right to left. The bar indicates the fractions that contain the R N A protein cross-linked complexes, freed from non-cross-linked protein.
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
305
dient, in this case made from nitrogen mustard cross-linked double-labeled subunits, so that the distribution of RNA and protein can be seen. Care should be taken to avoid contamination of the pooled fractions with the main peak of free protein at the top of the gradient. Step 2. This step is the separation of the RNA-protein cross-linked complexes from the bulk of the free RNA fragments. The pooled fractions from the sucrose gradient electrophoresis are diluted 20-fold with a buffer consisting of 500 m M NaCl, 1 m M EDTA, l0 m M Tris-citric acid buffer, pH 8, and 0.05% mercaptoethanol. This solution is warmed to 45 ° and is passed slowly over a Whatman GF/C glass fiber filter disk (25 m m diameter), and the filter is then washed with - 2 0 ml of the warm buffer. In this procedure the free RNA fragments (corresponding to about 90% of the radioactivity) pass through the filter, whereas the RNA-protein complexes are retained. 33,34The filter containing the complexes is rolled up and placed in a small (0.6 ml) Eppendorf tube containing a little cellulose powder (-50/d). The bottom of the tube is pierced with a needle, and this tube is placed in a larger (2.2 ml) Eppendorftube. The complexes are then eluted from the filter by wetting it with five 50-#1 aliquots of elution buffer, which consists of 0.1% SDS, 170 mMtrisodium citrate, 1 m M EDTA, 5 Murea, 1% 2-mercaptoethanol, and l0 m M Tris-citric acid buffer, pH 8, together with a little bromphenol blue dye. After addition of each 50-/d aliquot the filter is allowed to stand for l min, and the Eppendorf tubes are then quickly spun in a table centrifuge. The eluate passes from the filter through the cellulose plug into the large Eppendorf tube, each of the five aliquots being collected separately. The radioactivity of the eluate fractions is measured, and those containing the bulk of the activity (usually 20-50 million Cerenkov counts/min total in 150/tl, the elution efficiency being 70- 90%) are pooled, warmed to 75 ° for 5 min, and loaded directly onto the two-dimensional gel system (Step 3) for separating the cross-linked complexes. Step 3. The two-dimensional gel system has evolved from our earlier system2° in which a low percentage gel containing Triton X-100 was used as the first dimension (to separate the complexes from free RNA on a charge basis), with a high-percentage gel containing SDS as the second dimension (to separate all the components of the mixture on a size basis). In the new system, the dimensions are reversed, so that the greater dissociative power of the SDS is exploited in the first dimension. However, since the SDS dimension requires a higher acrylamide concentration, this has the consequence that the gel must be sliced into fractions, and each frac33C. A. Thomas, K. Saigo, E. McLeod, and J. Ito, Anal. Biochem. 93, 158 (1979). 34A. Kyriatsoulis, P. Maly, B. Greuer, R. Brimacombe, G. St6tner, R. Frank, and H. B16cker, Nucleic Acids Res. 14, 1171 (1986).
306
CROSS-LINKING A N D AFFINITY-LABELING METHODS
[ 19]
tion eluted for running on the low-percentage second-dimension gel, in which we have now substituted the zwitterionic detergent CHAPS (3-[(3cholamidopropyl) dimethyl ammonio]-l-propane sulfonate) (Serva) for Triton X-100. Further, both dimensions must be run in the presence of a high-salt concentration (500 m M Na+), which is electrophoretically very inconvenient, as only a low voltage can be applied, the electrophoresis takes several days, and the reservoir buffer becomes rapidly exhausted. The reservoir compartments on commercially available electrophoresis apparatus are totally inadequate for this system; we use reservoir compartments that hold 1.5 liters of buffer each, but even so it is necessary to replace the buffer every 24 hr during the runs. The first dimension is a 12% gel, overlaid with a short 6-12% gel gradient. The 12% gel solution contains 38% acrylamide/2% methylenebisacrylamide (36ml), dimethylaminopropionitrile (0.5 ml), 10% SDS (1.2 ml), 200 m M EDTA (1.5 ml), 1 M trisodium citrate (20 ml), 1 M Tris-citric acid buffer, pH 8 (12 ml), sucrose (10 g), and urea (49 g), made up to 117.5 ml with water. T h e 6% gel solution is the same, but without sucrose and with half the amount of acrylamide solution. To 58.75 ml of the 12% gel solution is added 1.25 ml of 1.6% a m m o n i u m persulfate solution which is then poured into the gel apparatus up to - 5 cm below the slot former. Before it has set, this gel is carefully overlaid with the 6 - 12% gradient gel, made from 5 ml each of the two gel solutions, together with 0.1 ml of 1.6% a m m o n i u m persulfate solution, in the linear gradient mixer. The slot former is immediately placed in the gel, which polymerizes within - 1 0 - 1 5 min. Since the sample volume is rather large, gels with 1.5-cm wide slots are used, instead of the usual width of 0.9 cm. The gel reservoir consists of 10% SDS (30 ml), 200 m M EDTA (37.5 ml), trisodium citrate (150 g), 1 MTris-citric acid buffer, pH 8 (300 ml), made up to 3 liters with water. Electrophoresis is for 48 hr at 150 V, 50 mA, with a buffer change after 24 hr. The bromphenol blue marker travels about 20 cm during this time. After autoradiography, a 1.5-cm strip is cut from the gel lane containing the sample, and this is sliced into 0.17-cm fractions. Radioactivity in each fraction is measured, and those fractions from the region of the gel likely to contain the most useful RNA-protein complexes (usually about 60 fractions, near the top of the gel) are crushed with a plastic spatula and eluted by shaking overnight at 4 ° with 70 #1 of a buffer consisting of 0.1% 2-mercaptoethanol, 300 m M sodium acetate, 1% CHAPS, 0.1% SDS, l m M EDTA, 6 M urea, and 25 m M Tris-acetate buffer, pH 8, together with a little xylene cyanole dye. The eluates are pipetted as quantitatively as possible into the slots of the second-dimension gels, the elution efficiency being of the order of 80%.
[19]
I N T R A - R N A A N D R N A - PROTEIN CROSS-LINKING
307
Each second-dimension gel is made from a solution containing 38% acrylamide/2% methylenebisacrylamide (12 ml), dimethylaminopropionitrile (0.3 ml), 3 M sodium acetate (13.6 ml), 2 0 0 r a M EDTA (1 ml), CHAPS (0.8 g), urea (34 g), and 1 M Tris-acetic acid buffer, pH 8.0 (8 ml), made up to 78 ml with water. 1.6°/0 a m m o n i u m persulfate (2 ml) is added to polymerize the gel. The reservoir buffer consists of sodium acetate (123 g), 200 m M EDTA (37.5 ml), and Tds-acetic acid buffer, pH 8.0 (300 ml), made up to 3 liters with water. The gels are run at 4 ° for 3 - 4 days at 150 V, 55 mA per gel, with a buffer change every 24 hr. At the end of this time, the gels are subjected to autoradiography with several exposures being taken ( - 2 to 12 hr, using Kodak XAR 5 film, at room temperature). Figure 5 shows an example of the results obtained with this isolation system, from 30S subunits cross-linked with APAI. Radioactive spots of interest are cut from the gels, and the gel pieces are
FIG. 5. Two-dimensional polyacrylamide gel separation of partiallydigested R N A protein cross-linkedcomplexes. The directionof the first-dimensionseparation0 2 % polyacrylarnidc,in the presence of SDS) isfrom leftto right,and the diagram shows autoradiograrns of three second-dimension gels (6% polyacrylamidc, in the presence of CHAPS) from the individuallyclutcd first-dimensiongel slices.Direction of second-dimension clcctrophoresis is from top to bottom, so that the diagonal of free R N A fragments stillremaining afterthe glass filterstep runs from upper Icflto lower right.Rows of RNA-protein complexes can be seen lyingabove thisdiagonal,and the gel spots are marked according to the identityof the proteins subsequently found in the individualcomplexes by antibody analysis.
308
CROSS-LINKING AND AFHNITY-LABELING METHODS
[ 19]
then crushed and extracted overnight at 4* w i t h - 0.4 ml of 1% SDS, 1 m M EDTA, 150 m M sodium acetate, 0.05% 2-mercaptoethanol, and 10 m M Tris-HC1, pH 7.8. The polyacrylamide residues are spun off, and the RNA-protein complexes are isolated from the eluates by ethanol precipitation. Finally, after drying briefly under vacuum, the pellets are resuspended in a small volume (20 #1) of 10 m M Tris-HC1, pH 7.8, 0.1% SDS. Yields of the individual complexes vary from 5,000 to 50,000 Cerenkov counts/min of [32p]RNA.
Fingerprint Analysis and Protein Identification Aliquots of each isolated cross-linked complex are taken for protein and RNA identification, and in view of the complexity of the gel patterns (cf. Fig. 5) it is obviously essential that both analyses are carded out on one and the same sample. The protein identification is made with the help of antibodies to the individual ribosomal proteins (in collaboration with Dr. G. St6ttler), either using the classical Ouchterlony double-diffusion test as previously described,22 or by a new method which is described in detail elsewhere,a5 In this latter method, antibodies against the proteins to be tested are "spotted" onto nitrocellulose sheets, and aliquots of the 32p-labeled cross-linked complex are then spotted onto the antibodies. After suitable washing procedures a positive reaction is detected by autoradiography. This method is very sensitive (100 Cerenkov counts/rain per spot is sufficient) and it avoids the problem often encountered in the Ouchtedony method, namely that the cross-linked complexes do not diffuse well due to aggregation. The low concentration of SDS present in the sample does not disturb the antibody reaction. For the fingerprint analysis of the RNA it is advisable first to digest the protein moiety of the complex with proteinase K. The appropriate aliquot of the isolated RNA-protein complex is diluted with -200 gl of 0.1% SDS, 500 m M NaCI and warmed to 60 ° for 5 min. Twenty microliters of proteinase K (10 mg/ml) is added and the mixture incubated for 15 min at 37 °, then phenol-extracted by shaking with an equal volume of water-saturated phenol for 1 hr at 4 °. After separation of the phases by a quick spin in a tabletop centrifuge, the RNA is recovered from the aqueous phase by ethanol precipitation in the presence of 40 gg of unlabeled carrier tRNA. The sample is then divided into two portions and subjected to ribonuclease Ti and ribonuclease A fingerprint analysis with subsequent secondary digestions, exactly as described above for the intra-RNA cross-linked complexes. The proteinase K digestion leaves a small peptide attached to the RNA, which in most cases allows the position of the cross-link site on the 35 H. Guile, G. St6fl]er, M. StOfller-Meilicke, and R. Brimacombe, J. Immunol. Methods 102, 183 (1987).
[ 19]
INTRA-RNA AND R N A - PROTEIN CROSS-LINKING
309
R N A to be deduced from the fingerprint data (cf. our earlier publications22,a4,ar). As noted at the beginning of the article, the use of uniformly labeled [32p]RNA allows any impurities or cross-contaminations to be quantitatively assessed, and cross-link sites are only considered to be established if both protein identification and R N A site analysis are clear-cut and unambiguous. Application of this criterion has the effect that nonspecific or otherwise suspect cross-link data are "filtered out" during the data evaluation process. Conclusion In this chapter we have described the methods currently in use in our laboratory for the analysis of R N A - p r o t e i n and intra-RNA cross-link sites in E. coli ribosomal RNA. The methods are still by no means ideal, and are continually being modified and improved. In particular, the resolution of the R N A - p r o t e i n cross-linked complexes on two-dimensional gels (Fig. 5) is not yet as sharp as that of the corresponding intra-RNA cross-linked complexes (Fig. 2). Nonetheless the system has enabled us to isolate a considerable number of individual complexes, and from the example shown in Fig. 5 eleven specific cross-link sites could be identified, involving nine of the 30S ribosomal proteins linked to RNA sequences comprising 3 0 - 150 nudeotides. The total data accumulated so far include nearly 40 intra-RNA cross-link sites identified to within two or three nucleotides in the E. coli 30S and 50S subunits, 5,7-1°,~4 as well as a similar number of R N A - p r o t e i n cross-link sites involving 19 different ribosomal proteins. The latter data (cf. Fig. 5, and see Ref. 32 for a review of earlier data), together with detailed models of the ribosomal subunits based on our combined cross-linking results, will be published elsewhere. Acknowledgment The authors are gratefulto Dr. H. G. Wittmann for his continual support and encouragement during the course of this work. Note A d d e d in Proof Since the submission of this article, our techniques for the isolation of intra-RNA and RNA-protein cross-linkedcomplexeshave been substantiallymodifiedand improved. The latest developments,togetherwith referencesto other relevantpapers, are describedelsewhere for intra-RNA37and RNA-protein 3scross-links. 36 I. Wowcrand R. Brimacombe,NudeicAcids Res. ll, 1419 (1983). 37W. Stiege, M. Kosack, K. Stade, and R. Brimacombe,NudeicAcids Res. 16 (10), in press (1988). 3s H. Guile, E. Hoppe, M. Osswald,B. Greuer, R. Brimacombe,and G. strttler, Nucleic Acids Res. 16, 815 (1988).
310
CROSS-LINKING
AND AFFINITY-LABELING
[20] R N A - P r o t e i n
METHODS
[20]
Cross-Linking
By A. EXPERT-BEZAN~ONand C. CHIARUTTINI How protein and RNA interact in complex ribonucleoprotein particles is a major and as yet unsolved biochemical problem which has to be solved in order to obtain a thorough analysis of their structures and for a clear understanding of their structure-function relationships. Numerous chemical or photochemical reagents have been developed for studying these complexes. 1-5 Most of them introduce a bridge between amino acids and bases thus providing neighborhood information which is indispensable for structural elucidation. No ideal cross-linker exists because each method is necessarily selective, identifying at best a few sites. Different methods must therefore be used in parallel. However, methods which cross-link an amino acid directly to a base are more informative because they give contact information identifying part of the interaction site of the two molecules, rather than those methods which introduce bridges. The method we describe here has been developed in studies of the structure of Escherichia coli 30S ribosomal s u b u n i t 6'7 but can be easily adapted to any nucleoprotein particle. A soluble carbodiimide, 1-ethyl-3(3-dimethylaminopropyl)carbodiimide(EDC) is used, at pH < 7, to selectively activate protein carboxyl groups forming transitory activated O-acylurea complexes (Fig. 1, reaction 1). Nucleophilic attack of these complexes by amino groups in protein or in nucleic acid bases (e.g., guanine, adenine, or cytosine in 16S rRNA) will result in the formation of stable amide bridges with elimination of 1-ethyl-3-(3-dimethylaminopropyl)urea (Fig. 1, reaction 2). Figure 2 schematizes the overall procedure as applied to the 30S ribosomal subunit. As indicated in Fig. 2, this cross-linking procedure leads to formation of significant amounts of 30S subunit dimers which must be removed before isolation and analysis of cross-linked J. Rinke, M. Meinke, R. Brimacombe, G. Fink, W. Rommel, and H. Fasold, J. MoL Biol. 137, 301 (1980). 2 R. Millon, M. Olomucki, J. Y. Le Gall, B. Golinska, J. P. Ebel, and B. Ehresmann, Eur. J. Biochem. 110, 485 (1980). 3 R. Brimacombe, P. Maly, and C. Zwieb, Prog. Nucleic Acids Res. Mol. Biol. 28, 1 (1983). 4 L. A. Brewer, S. Goelz, and H. F. Noller, Biochemistry 22, 4303 (1983). 5 L. A. Brewer and H. F. Noller, Biochemistry 22, 4310 (1983). 6 C. Chiaruttini and A. Expert-Bezan~on, FEBS Lett. 119, 145 (1980) and corrigendum 122, 156. C. Chiaruttini, A. Expert-Bezangon, D. Hayes, and B. Ehresmann, Nucleic Acids Res. 10, 7657 (1982). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[20]
RNACH 3
CH 3
16S rRNA
CH2
CH2
NH
I
16S rRNA Protein_C/2 +NIH + I \ // N O--C \ / H \H NH > I CH2
N O // + Protein--C \ O-
PROTEIN CROSS-LINKING
Q
C N CH2
I
C -- Protein
®
CH 2
I
H H
CH 2 +
~N/
I
I I
NH Protein
I
I
% C--Protein
I
CH2 Protein I+ H--N--CH 3
CH2 I+ H--N--CH 3
I
CH3
CH3
Flo. 1. Cross-linking reaction mechanism.
protein-RNA complexes. The cross-linking reaction is therefore followed by a preliminary purification step to obtain monomeric 30S subunits before stripping of non-cross-linked proteins from these monomers and isolation of 16S RNA-protein complexes for further analysis. Cross-Linking with EDC and Purification of P r o t e i n - R N A Complexes 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide can be obtained from Merck or Sigma 30S subunits Cross-linking reaction
÷ E DC
l
30S cross-linked subunits Purification
l
=
30S dimers
30S monomers Elimination of Noncross-I~nked proteins
Noncross-linked proteins
]bS RNA-protein Analysis
complexes
l FIG. 2. Scheme of the EDC cross-linking procedure.
312
CROSS=LINKING AND AFFINITY-LABELING METHODS
[9-0]
Buffers. The composition of buffers is as follows. Buffer 1 : l 0 m M triethanolamine-HC1, pH 7.5, 10 m M magnesium acetate, 50 m M KC1, 1 m M dithiothreitol Buffer 2 : 1 m M sodium cacodylate, 0.5 m M MgC12, 50 m M KC1 adjusted to pH 6.5 with HC1 (25 °) Buffer 3: l m M sodium cacodylate, 220 m M magnesium acetate, 1.74 M NH4C1 adjusted to pH 6.5 with HC1 (25 °) Buffer 4: l0 m M triethanolamine-HC1, pH 7.5, 400 m M NaC1, l0 m M magnesium acetate, 1 m M dithiothreitol Buffer 5 : l 0 m M triethanolamine-HCl, pH 7.5, 100 m M LiC1, 0.1% sodium dodecyl sulfate, l m M dithiothreitol
Procedure Ribonucleoprotein particles (e.g., 30S ribosomal subunits) are prepared according to standard methods3 One hundred A26o units of 30S ribosomal subunits in buffer 1 at a concentration of 100 A2t~/ml are dialyzed twice for 1 hr each time against 500 volumes of buffer 2 and the dialyzed solution is diluted to 5 A260 units/ml in buffer 2 (20 ml). EDC (500 m M in buffer 2 prepared just before use) is added to a final concentration of 50 mM. The pH is checked (pH meter) and adjusted to 6.5 by addition of 0.1 N HC1 with constant stirring. The reaction is continued for 30 min at 25 °. Then 0.1 volume of buffer 3 is added to stop the reaction and the mixture is left for 1 hr at 25 ° The subunits are then precipitated with 0.7 volume of ethanol at - 2 0 ° for 30 min and recovered by centrifugation (10,000 rpm, 30 min), resuspended in 2 ml of buffer 4 and purified from 30S dimers by centrifugation on two 33 ml 5-20% sucrose gradients in buffer 4 (20,000 rpm, 17 hr, 4 °, Spinco SW27 rotor). The 30S peak fractions are pooled and monomeric cross-linked subunits are precipitated by addition of 0.7 volume of ethanol and recovered by centrifugation, resuspended in 1 ml of buffer 5 and heated at 40 ° for 10 min. Released 16S RNA-protein complexes are separated from free proteins by centrifugation on a 5-20% sucrose gradient in buffer 5 (26,000 rpm, 19 hr, 10 °, Spinco SW27 rotor).
8 A. Expert-Bezan¢on, D. Barritault, M. Milet, M. F. Guerin, and D. H. Hayes, J. Mol. Biol. 112, 603 (1977).
[20]
R N A - PROTEIN CROSS-LINKING
313
Comments
The overall efficiency of the EDC cross-linking reaction depends on six parameters: EDC concentration, pH, and time, which are characteristics of the reaction per se; the concentrations of magnesium and monovalent ions; and finally subunit concentration. The effects of modifications of the main constituents of buffer 2 and EDC concentration on the efficiency of the cross-linking reaction are given in Figs. 3 to 5. For the analysis of different parameters, 3SS-labeled 30S particles are used. The duration of the reaction is 30 min, and after quenching and dialysis, the extent of cross-linking is determined by sedimentation of samples of reaction products on 5 ml sucrose gradients in buffer 5. The cross-linking efficiency response is linear over a wide range of EDC concentrations (Fig. 3). Above 50 m M EDC the gain in cross-linking yield is not significant because of the increased incidence of two undesirable side reactions, which are impossible to control, namely subunit dimer formation and creation of protein-protein cross-links; the latter can be checked only by two-dimensional gel analysis. Although very efficient in promoting RNA-protein cross-linking (Fig. 4), lowering the pH below 6.5 is not useful because its effect is more than compensated for by an increase in the formation of subunit dimers and the pH is displaced too far from pH 7 standard conditions.
m c
•-
20
-a
15
.g ¢-
10 to O o
~
5 I
I
I
10
50
100
EDC, mM FIo. 3. Effect o f E D C concentration o n efficiency o f cross-linking o f 3sS-labeled proteins to R N A in the 30S ribosomal particle. Duration o f reaction was 30 rain in buffer 2.
314
CROSS-LINKING AND AFFINITY-LABELING METHODS
[20]
A 15
O.
10 0
. -c
0
0
1'o
2'0
5 o~
' 5.0
'
' 6.0 pH
'
' 7.0
0 5
' 1
5' MgCI2,mM
FIo. 4. Effects of pH (A) and magnesium concentration (B) on the efficiency of crosslinking of 3SS-labeled proteins to RNA in the 305 ribosomal particle. Reaction time was 30 min at 50 m M EDC in buffer 2.
The ionic strength of the reaction system can be widely varied. Figure 4 shows that the cross-linking yield is highly sensitive to magnesium concentration: between 20 and - 3 m M the overall cross-linking efficiency is about 3%; below 3 m M a sharp transition occurs with an increase in efficiency which is probably due to new sites becoming accessible to the reagent. RNA-protein cross-linking efficiency does not depend on the concentration of 30S subunits but the reaction is sufficiently slow to permit the introduction of intersubunit cross-links leading to formation of 30S dimers and this side reaction is strongly concentration dependent. An example of the separation of monomers and dimers by sucrose gradient sedimentation (step 2, Fig. 2) is shown in Fig. 5. In this case, the concentration of 30S subunits in the cross-linking reaction is 5 A26o units per milliliter and the yield of dimers is 30%. When the initial subunit concentration is raised to 10 and 15 A26ounits per milliliter, the yield of dimers increases to 40% and 50%, respectively. The efficiency of EDC-induced protein-RNA cross-linking is very dependent on the proximity and availability ofcarboxyl and amino groups of proteins and nucleic acid bases and can vary greatly from protein to protein. For each protein of the E. coli 30S subunit at 10% overall crosslinking efficiency, it was found to vary by a factor of 10 from protein to protein. 6
[20]
RNA - PROTEIN CROSS-LINKING
315
30S 0.3
0.2
e,i
( 0.1
I
I
5
10 fract
15 ion
20
25
number
FIG. 5. Sucrose gradient separation of EDC cross-linked 30S monomers and dimers. Cross-linking was performed in buffer 2 at 50 m M EDC and a 30S concentration of 5 A26o units/ml. See text for details.
EDC also induces formation of protein-protein cross-links. This reaction can compete with the formation of RNA-protein cross-links and, in some cases when it is more efficient than RNA-protein cross-linking, it may prevent or render very difficult the identification of a cross-link of the latter type. Analysis of the Cross-Linked Products
Labeling of Proteins in Cross-Linked RNA-Protein Complexes with Iodine-125 The most convenient technique for identifying cross-linked proteins is to label the purified complexes after thorough elimination of non-crosslinked proteins. Use of ~2sI yields labeled products with high specific activity and permits detection of very small amounts of cross-linked proteins. This method suffers, however, from several drawbacks. Some proteins have no tyrosine and therefore cannot be labeled. Labeling efficiency
316
CROSS-LINKING AND AFFINITY-LABELING METHODS
[20]
depends not only on the number of tyrosines per protein, but also on their availability and can differ greatly from one protein to another (a factor of l0 is not unusual). To evaluate the labeling efficiency for each protein species, we have found it necessary to label a small amount of the nontreated particle and to measure the radioactivity of the proteins in twodimensional gels. Solutions 1. 2. 3. 4. 5. 6.
Sodium phosphate, 500 raM, pH 7.5 KI, I m M Na125I (Amersham IMS 30), 92.5 M Bequerels (25/A) Chloramine-T, 100 m M Sodium metabisulfite, 1 M - s o d i u m phosphate, 50 raM, pH 7.5 5-20% sucrose gradient in triethanolamine-HC1, 10 mM, pH 7.5; 0.1% (w/v) SDS; Na2 EDTA, 2.5 raM; 2-mercaptoethanol, l0 m M
Labeling Procedure. (Use a glove box, or closed hood with an efficient extractor fan and activated charcoal filters in the exhaust line.) This method is very close to the original paper of Greenwood et al.9 Solution 1 (100/ll) plus 225/11 water and 10 pl of solution 2 (10 nmol KI) are mixed and added to the Na125I solution. The RNA-protein complex to be labeled (20 A2~o units in 100/A of 50 m M sodium phosphate buffer, pH 7.5) and 40/11 of solution 4 are then added in succession and the reaction is allowed to proceed for 1 min at room temperature, after which it is stopped by addition of 10/A of solution 5. Under these conditions, more than 90% of the iodine is complexed to the proteins. Noncomplexed iodide is usually eliminated by centdfugation on a 5-20% sucrose gradient (solution 6, SW28 rotor, 26,000 rpm for 17 hr at 10°). The gradient also serves to eliminate a variable proportion of material which sediments faster than 16S. Material sedimenting at 16S is then precipitated from pooled gradient fractions by addition of NaC1 (0.1 M final) and 2 volumes of ethanol. Iodine also reacts with imidazole groups, but the adducts formed are unstable and result in a rapid decrease of specific activity. Preparation of Protein Samples for Two-Dimensional Gel Analysis Cross-linked proteins are most easily identified by comparing their positions with those of control proteins on two-dimensional gels. For this purpose, complete hydrolysis and elimination of the RNA component of cross-linked complexes is necessary. The low yields of cross-linked corn9 F. C. Greenwood, W. M. Hunter, and J. S. Glover, Biochem. J. 89, 114 (1963).
[20]
R N A - PROTEIN CROSS-LINKING
317
plexes usually obtained in protein-RNA cross-linking experiments imply that large amounts of RNA hydrolysis products must be separated from minute amounts of protein. We have repeatedly observed that small amounts of contaminating nucleosides or nucleotides significantly disturb the migration of proteins on gels. The chromatographic fractionation of hydrolysis products on BioGel P-2 as described below has the advantage of high efficiency and reproducibility even for very low yields of cross-linked proteins. Proteins are eluted in the void volume and nucleotides or nucleosides produced by hydrolysis of RNA are retained. The solvent (60% acetic acid) eliminates any nonspecific protein adsorption. Digestion of RNA in RNA - Protein Complexes
RNA in RNA-protein complexes is eliminated either by alkaline hydrolysis or by digestion with RNase T2 plus alkaline phosphatase. Both of these methods are equally efficient for sample preparation. Alkaline digestion will systematically leave one nucleotide attached to the protein which will slightly modify its migration on gel. Since RNase T2 and alkaline phosphatase do not necessarily have access to all nucleotides attached to the protein, a slightly larger decrease of the isoelectric point of the protein may be observed when this RNA degradation method is used. RNase Digestion. RNA-protein complexes (0.02 to 1/lg of RNA) dissolved in 100 ~tl of 0.1% (w/v) SDS, 50 m M a m m o n i u m acetate, pH 4.5, are treated with RNase "1"2(enzyme/RNA = 2 units//~g) for 1 hr at 37 °. One hundred micrograms of cold cartier control proteins in 8 M urea (10 mg/ml) is added and proteins are precipitated (5 min) by addition of 5 volumes of acetone and recovered by centrifugation (5 min, 10,000 rpm), then dried and resuspended in 100gl of 50 m M Tris-HC1, pH 8.0, 0.1% (w/v) SDS. Bacterial alkaline phosphatase is added (enzyme/RNA-0.5 unit/gg), and the solution is incubated for 1 hr at 37 ° and then loaded directly onto the BioGel P-2 column. Alkaline Digestion. RNA-protein complexes (0.02-1/zg RNA) are resuspended in 50/~1 of 0.1% (w/v) SDS, 1 m M dithiothreitol by heating at 40°; 5/A of 4 M NaOH is added and the mixture is incubated at 37 ° for 1 hr. At the end of the incubation, the sample is cooled, and carrier proteins are added as above. One hundred microliters of acetic acid followed by 10/tl of magnesium acetate (1 M) are added and the mixture is immediately loaded on the BioGel P-2 column. Alkaline hydrolysis of protein-RNA complexes in urea is not satisfactory since it yields proteins which systematically appear as blurred spots on two-dimensional gels. This is probably due to the decomposition of urea to
318
CROSS-LINKING AND AFFINITY-LABELING METHODS
[9.0]
cyanate, which subsequently reacts with protein amino groups with random modification of their charge.
Separation of Proteins from Hydrolyzed RNA BioGel P-2 (50- 100 mesh), preswoUen in water, is equilibrated in 60% acetic acid for 30 min with slow constant stirring to eliminate air bubbles completely. This equilibration should be carded out before column preparation because BioGel expands in acetic acid. Columns are prepared in 25-cm long, 0.6-cm diameter plastic pipets. A P5000 Gilson polypropylene pipet tip, joined to the column with a short piece of Tygon tubing, is used as the upper column reservoir. Polypropylene tubing also connected to the column with Tygon tubing is used as the column outlet. The two junctions are made so as to avoid any contact between the Tygon and acetic acid. (Tygon releases impurities in acetic acid.) Two hundred-microliter fractions are collected and those containing proteins are pooled and lyophilized in a Speed Vac concentrator. With the procedure as described, protein recovery is between 75 and 80% from starting samples containing 17 to 100 #g of protein (>70% recovery is obtained from a starting sample containing 1 #g protein by using a 3-mm diameter column).
Identification of Cross-Linked Proteins Cross-linked proteins dissolved in 8 M urea, 1 m M dithiothreitol are identified by two-dimensional polyacrylamide gel electrophoresis. As already mentioned in the section on digestion of RNA in RNA-protein complexes, alkaline or enzymatic hydrolysis of RNA yields proteins with slightly lowered isoelectric points. In order to minimize the effect of this modification on their electrophoretic properties, two-dimensional electrophoresis is carded out at acid pH in the first dimension and in the presence of SDS in the second dimension. We have found the electrophoretic conditions described by Lutter et al.~° to be satisfactory, but other twodimensional systems of this type ~,~2 would probably give similar results. Acknowledgments The authors are grateful to Dr. D. H. Hayes (Institut de Biologic Physicochimique Paris) in whose laboratory this work was carried out. They also acknowledge his careful reading of the manuscript.
io L. C. LuRer, F. Ortanderl, and M. Fasold, FEBS Lett. 48, 288 (1974). it j. j. Madjar, S. Michel, A. J. Cozzone, and J. P. Reboud, Anal. Biochem. 92, 174 (1979). 12A. R. Subramanian, Eur. J. Biochem. 45, 541 (1974).
[21]
IDENTIFICATION OF R N A CROSS-LINKS
319
[21] Isolation and Identification of RNA Cross-Links B y PAUL L. WOLLENZIEN
Introduction Changes in the topography o f the 16S rRNA are likely to be essential features in the various steps o f protein synthesis. ~ Methods that form intramolecular cross-links in the 16S r R N A are an important device to reveal details o f its arrangement. 2-4 F r o m this type o f information it should be possible to construct physical models o f the rRNA, and hopefully these models will give ideas about the actual molecular mechanisms that are involved, s-7 The various methods that have been used to accomplish intramolecular cross-linking result in mixtures o f different types o f molecules. Moreover, since the a m o u n t o f cross-linking is usually kept at low levels in order to avoid artifacts involving the appearance o f unusual induced structures, the yield o f a particular cross-link in a large molecule is usually low. There are some exceptions to this condition, and in those cases it is possible to solve the site o f the cross-link by direct R N A sequencing techniques. 8,9 A frequently used approach is to fragment the molecule by partial enzymatic hydrolysis and then isolate and characterize the crosslinked oligonucleotides. 4,~°-~2 In a heterogeneous mixture it is difficult to determine the frequency at which the different cross-links are made. 13 This leaves open the possibility that other important but unidentified cross-links 1See "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.). Springer-Verlag, New York, 1986. 2 R. Brimacombe, P. Maly, and C. Zwieb, Prog. Nucleic Acid Res. 28, 1 (1983). 3j. E. Thompson andJ. E. Hearst, Cel132, 1355 (1983). 4 p. L. Wollenzien, R. F. Murphy, C. R. Cantor, A. Expert-Bezan¢on,and D. H. Hayes, J. Mol. Biol. 184, 67 (1985). 5j. F. Thompson and J. E. Hearst, Cell33, 19 (1983). 6 A. Expert-Bezan¢onand P. L. WoUenzien,J. Mol. Biol. 184, 53 (1985). 7R. Brimacombe, J. Atmadja, A. Kyriatsoulis, and W. Stiege, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), pp. 184-202. s j. B. Prince, B. H. Taylor, D. L. Thurlow, J. Ofengand, and R. Zimmermann, Proc. Natl. Acad. Sci. U.S.A. 79, 5450 (1982). 9 j. Ofengand, P. Gornicki, K. Chakraburtty, and K. Nurse, Proc. Natl. Acad. Sci. U.S.A. 79, 2817 (1982). to C. Zwieb and R. Brimacombe, Nucleic Acids Res. 8, 2397 (1980). 11j. Atmadja, W. Stiege, M. Zobawa, B. Greuer, M. Osswald, and R. Brimacombe, Nucleic Acids Res. 14, 659 (1986). 12A. Expert-Bezan¢on,M. Milet, and P. Carbon, Fur. J. Biochem. 136, 267-274 (1983). 13j. Atmadja, R. Brimacombe,H. Blocker,and R. Frank, Nucleic Acids Res. 13, 6919 (1985). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
320
CROSS-LINKING AND AFFINITY-LABELING METHODS
[2 I ]
occur in the molecule. This article describes a technique that helps to circumvent some of these difficulties. This is a gel electrophoresis technique used on intact cross-linked molecules that separates them on the basis of the location of their cross-links. 14The main emphasis is to identify cross-links between residues distant in the primary sequence (> 150 nucleotides), since this information will be the most valuable in learning about the overall structure of the molecule. It is possible to gain information about the number and frequency of these cross-links and to obtain purifications of specific cross-linked molecules from a mixture. Two methods for the identification of the cross-links will be described: electron microscopy to estimate the location of the cross-link and analysis by reverse transcription to identify the location of the cross-link at high resolution very rapidly. Principal of the M e t h o d Electrophoresis of cross-linked 16S rRNA in polyacrylamide gels made in 96% formamide is able to separate the molecules into bands of different mobilities that depend on the location of the covalent cross-link within the molecule. So far the types of cross-linking for which we see this effect include psoralen photochemical cross-linking4,~4bisglyoxylylbenzoylcystamine acetate chemical cross-linking,4 and direct short wavelength UV-induced photo-cross-linking, so it is likely that the effect will be general for any reagent that produces cross-links between residues distant in the primary sequence. The reason for choosing this particular gel electrophoresis system is that the molecules are examined under denaturing conditions in order to reveal differences between them. However, glyoxylated crosslinked 16S rRNA electrophoresed on agarose gels or 16S rRNA electrophoresed on formaldehyde-agarose gels or formamide-agarose gels does not show this separation into bands, so in addition, the pore size of the gel matrix must be important. This indicates that an unusual sieving process separates the molecules during the electrophoresis. Polyacrylamide gels made with 9 M urea have been shown to separate UV cross-linked 16S rRNA into a set of distinct bands ~5but the identity of those bands was not determined and in our hands, for cross-linked molecules, there is a large amount of the sample that does not enter the gel. Cross-linked 16S rRNA enters 5 M urea, 90% formamide, polyacrylamide gels but there is a large band of RNA close to the top of the pattern that contains many different types of cross-links. The polyacrylamide formamide gel therefore seems to be the optimum system for separating cross-linked 16S rRNA into distinct ~4p. L. Wollenzien and C. R. Cantor, J. Mol. Biol. 159, 151 (1982). t5 S. A. Quarless and C. R. Cantor, Anal. Biochem. 147, 296 (1985).
IDENTIFICATION OF RNA CROSS-LINKS
[21 ]
321
species. This gel system has been described in the literature for the molecular weight determination of linear RNA molecules, ~6 so there is useful information for successfully making and running the gels; additional procedures that optimize the use of slab gels are presented here. Materials and Reagents For the preparation of the formamide polyacrylamide gels, the purity of the reagents is critically important. Five hundred grams of formamide (EM Science) is deionized by stirring with 30 g of mixed cation- and anion-exchange resin (AG 50 l-X8, Bio Rad) for 3 hr in the cold and then filtered through a fritted glass filter and recrystallized at - I 0 °. The deionized and recrystallized formamide is stored at - 2 0 ° until use. Acrylamide and methylenebisacrylamide (Amresco) at a ratio of 6:1 are dissolved in deionized recrystallized formamide at a final total concentration of 35% w/v, then deionized by stirring for 3 hr in the cold with mixed ion-exchange resin (4 g resin per 70 ml acrylamide solution), and are then filtered through a fritted glass filter. Ammonium persulfate 36% w/v in water is made for use each day. All reagents should be used at room temperature (20-250) since the temperature affects the polymerization. A gel electrophoresis apparatus (Pharmacia) is used in which the slab gels are held vertically and are cooled by a circulating buffer solution. The slab gels for this apparatus are made ahead of time in sets of four and stored in the refrigerator until they are needed. The important aspect of this system with respect to the polyacrylamide formamide gel system is that the gels are made in a gel casting box so that an overlay solution can be placed on top of the acrylamide solution, and the acrylamide solution itself can be formed having a density gradient. These two features allow complete polymerization on the top of the gel and allow formation of a uniform gel without polymerization artifacts. The protocols that are described here can be adopted to other apparatuses, but these features should be taken into consideration. Methods
Preparation of the Formamide-Polyacrylamide Gel 35% acrylamide: Dissolve 21 g acrylamide and 3.5 g methylenebisacrylamide in - 5 0 ml formamide and then add 5 g deionizing resin
~6j. C. Pinder, D. Z. Staynow, and W. B. Gratzer,
Biochemistry13, 5373 (1974).
322
CROSS-LINKING AND AFFINITY-LABELING METHODS
[21]
(AG 501-X8, Bio-Rad). Deionize for 3 hr in the cold and filter. Adjust final volume to 70 ml with formamide Top phase: 70 ml formamide, 14 ml 35% acrylamide solution, 6 ml ethanol, 0.36 ml H20, 0.36 ml 0.5 M NaPO4, pH 7.5 Bottom phase: 76 ml formamide, 14 ml 35% acrylamide solution, 0.36 ml H20, 0.36 ml 0.5 M NaPO4, pH 7.5 Four gel cassettes (8 × 14 cm) are placed in the gel casting box in which the dead space in the bottom of the box is first filled with glass beads. The overlay solution (10 ml of 20% ethanol, 80% H20) is placed in the bottom of the box. Both phases are degassed and then 120 #1 tetramethylethylenediamire (TEMED) and 240/tl 36% ammonium persulfate are added to each. The gel solutions are mixed in a gradient mixer such that the light phase enters the bottom of the gel casting box first. The gradient is stopped when the top of the overlay solution reaches 4 m m below the top of the gel cassettes. When the gels are polymerized, this will leave the correct amount of space for the placement of the comb. The gels should begin polymerizing at least by 30 min and are left for 1 hr before being removed from the box. They are wrapped in plastic wrap for storage in the refrigerator and are left for at least 6 hr before use to allow diffusion of the extra H20 from the overlay solution in the top of the gel.
Electrophoresis in the Formamide-Polyacrylamide Gels The gel is run immersed in the reservoir buffer which is 2 m M NaPO4, pH 7.5. Without any precautions to prevent diffusion of water into the gel, current in the gel would continue for only 2 to 3 hr before decreasing dramatically. To prevent this, the top and bottom of the gel are isolated from the reservoir buffer; this allows electrophoresis for at least 6 hr. For the bottom of the gel, a small 6% polyacr~lamide foot gel is formed around the bottom of the gel cassette. This is accompfished by cutting a slot through a 17 × 100 mm polypropylene test tube with cap, inserting it around the bottom of the gel cassette that contains the formamide gel, pouring the 6% gel into it, and then removing the test tube after the foot gel is polymerized. The foot gel consists of 5.7% acrylamide, 0.3% methylenebisacrylamide, 2.0 m M NaPO4, pH 7.5; the total volume is 15 ml and it is polymerized after degassing with 30/tl TEMED and 30 #l of 36% ammonium persulfate. For the top of the gel, 50% formamide/50% water is pipetted into the top of the gel cassette and a plastic well-forming comb is used to load the samples. The samples (usually 2 to 4 gg/#l) are prepared by mixing RNA in H20 with an equal volume of a loading solution consisting of formamide saturated with sucrose and 0.1% bromphenol blue. This combination makes the samples more dense than the 50% formamide overlay solution. For
[2 1]
IDENTIFICATION OF R N A CROSS-LINKS
323
analytical gels, the total volume of each sample is 2 pl loaded into a well that is 1 × 3 mm; for preparative gels, up to 50/zg of RNA in 20 pl is loaded onto an area of 1 × 50 mm. Note that neither the samples nor the overlay solution contain any added electrolyte. The gels are usually run for 6 hr at 250 V (8.9 V/cm). After the electrophoresis, the gels are stained by gently shaking them in 1 liter of 10 m M NaPO4 containing 0.5 mg ethidium bromide for 45 min. They are photographed on a standard shortwavelength illumination box (see Fig. 1). In the case where the gels are run for the purpose of preparative
C
1
4
10 2 0
1
4
10 2 0
P
ml
4°
37 °
FIC. 1. Formamide-polyacrylamide gel electrophoresis of 16S rRNA from 30S subunits cross-linked with 310 nm UV fight. Samples at 4 ° or 37 ° were irradiated for 1 to 20 rain with stirring. For each sample, 1 A26ounit of 30S subunits in 200 #1 of TMK buffer (0.33 M KCI, 0.02 M magnesium acetate, 0.02 M triethanolamine-HC1, pH 7.2) was placed in a quartz cuvette 1 cm from the front of a 300 nm transilluminator (Fotodyne, Inc.). The samples were digested with proteinase K (l mg/ml) in the presence of 0.5% SDS, phenol extracted, and ethanol precipitated. Four micrograms of RNA was used for each lane. Lane C is 1/zg non-cross-linked 16 rRNA; lane P is 2.5 /zg of 16S rRNA psoralen cross-linked in 30S subunit. Electrophoresis was for 5 hr at 8.9 V/cm.
324
CROSS-LINKING AND AFFINITY-LABELING METHODS
[9.1]
separation, they are viewed with a long wavelength UV mineral light covered with a clear glass filter to avoid exposing the samples to light that might cause photoreversal. Sometimes only the parent band will be seen by the long-wavelength light, so the remainder of the gel is cut out blind. RNA is eluted from the gels by diffusion. The gel slices, transferred to clean glass plates, are sliced into very thin sections (but are not completely pulverized) with a clean sterile razor blade and are transferred to 5-ml syringe barrels which contain plugs of siliconized glass wool and have been closed by a cut-off 26 ½ gauge needle. Three milliliters of elution buffer17 [500 m M ammonium acetate, 10 m M magnesium acetate, 1 m M ethylenediaminetetraacetic acid (EDTA), 0.1% sodium dodecyl sulfate (SDS)] is added and the sample is eluted overnight at 37* without agitation. The sample is recovered by .placing the opened syringe in a test tube and centrifuging in a low-speed centrifuge. To remove the large amount of water-soluble gel material which would be evident if the sample were ethanol precipitated at this point, a purification over a Sep-Pak column (Waters Associates) is performed. Each sample is adsorbed to the activated column, washed with 10 ml water, then washed with 10 ml of a solution of 20% methanol and 80% 100 m M triethylammonium carbonate, pH 7.5, and then eluted from the column with 3 ml of 60% methanol, 40% 100 m M triethylammonium carbonate, pH 7.5. The column can be recycled for additional fractions. Each fraction is precipitated with 0.2 volume of 5 M ammonium acetate and 2.5 volumes of ethanol. The precipitates are redissolved in 100/tl TE (10 m M Tris-HC1, pH 8.5, 1 m M EDTA), and are phenol extracted; the phenol phase is back extracted with 100 #1 TE and the combined aqueous phases are ethanol precipitated. The precipitate is washed once with 70% ethanol before being dried and redissolved in 10/ll H20. One microliter is taken and electrophoresed on an agarose gel along with total rRNA and known amounts of 16S rRNA to estimate the purity and amount of RNA in the fraction.
Electron Microscopy of Cross-Linked RNA That Has Been Fractionated on the Formamide-Polyacrylamide Gels One method that rapidly can give an estimate of the identity of the cross-links in the fractionated 16S rRNA molecules is electron microscopy. '4 The samples are prepared by a monolayer technique using a combination of cytochrome C and a detergent,4 are adsorbed to Parlodion-covered grids, and then are stained and shadowed before viewing. Under the conditions for spreading described here, non-cross-linked molecules usually do not cross back over themselves whereas the cross-linked molecules ,7 A. M. Maxam and W. Gilbert, this series, Vol. 65, p. 499.
[21 ]
IDENTIFICATION OF RNA CROSS-LINKS
325
contain crossover points that form open loops. These loops can be attributed to the presence of covalent intramolecular cross-finks; by measuring the location of the crossover points, the location of the cross-hnk is estimated? A method for modifying the molecules so that their polarity is known when they are viewed in the electron microscope has been described. ~s The electron microscopy analysis can be performed with fractions that contain a mixture of different types of molecules. In this case, the crossover point for each molecule is encoded into two data, and a two-dimensional histogram showing their distribution is constructed to determine the number of different types of molecules that are present in each fraction and their frequencies.4 The molecules are prepared first by denaturation with formaldehyde. Each RNA sample, 0.5 #1 containing 0.05/zg RNA, is mixed with 3.5/tl formamide and is heated at 57 ° for 5 min. Then 0.5/zl of a mixture of formalin and 60 m M Na2HPO4 (6:5, v/v) is added and the solution is heated for 10 min more at 57 ° and then cooled to ice temperature. The hyperphases are made by adding to the denaturation mixture: 17.5/~1 of formamide/BAC (formamide/BAC is 135/zl of formamide that contains 1/zl of a 4.5 mg/ml solution of benzyldialkylammonium chloride~9), 2.5/zl of EM buffer ( 100 m M triethanolamine-HC1, pH 8.6, 10 m M EDTA), and 2.5/d of 1 mg cytochrome c/ml (equine heart, Calbiochem). The formamide (Em Science) for these reactions is deionized with a mixed ion-exchange resin (AG 501-X8, Bio-Rad) and is then vacuum distilled and stored at - 20 ° until use. The hypophase is distilled deionized water held in a 9-era-square polystyrene Petri dish. The surface is cleaned with a pair of Teflon bars (10 × 13 × 150 mm) and a ramp is formed with a clean microscope slide propped against one of the bars. The hyperphase is applied with Teflon microbore tubing (0.022 inch, Cole Parmer) to the slide just above the water line; it should run down the slide without any large drops forming. The monolayer is allowed to equilibrate for 1 min, and then two grids are touched to it at symmetrical positions about 2 cm from the point of application. The grids are washed for 1 min in 50% ethanol to remove residual gel material that may be present in the fractionated RNA, and are then stained in 90% ethanol containing 0.25 m M uranyl acetate and 0.25 m M HC1 and destained for 2 sec in 90% ethanol. They are blotted dry and then shadowed with Pt/Pd before viewing.
Reverse Transcription of the Fractionated Cross-Linked Molecules In the scheme presented here the molecules are cross-linked to a very low extent and are separated on the formamide-polyacrylamide gels on the ,s p. L. Wollenzien and C. R. Cantor, Proc. NatL Acad. Sci. U.S.A. 79, 3940 (1982). ~9H. J. Voilenweider, J. M. Sogo, and T. Koller, Proc. Natl. Acad. Sci. U.S.A. 72, 83 (1975).
326
CROSS-LINKING AND AFFINITY-LABELING METHODS
[21]
basis of their topology; therefore in different fractions there should be a great enrichment of modified nucleotides at specific locations. For psoralen photochemical cross-links, these can be detected by reverse transcription, since it is not possible to transcribe through a base that has a psoralen adduct. 2° Psoralen monoadducts may be present in all fractions and they will also be seen as termination points. Both cross-links and monoadducts seem to be absolute stops since they persist as termination points even at long times of reverse transcription. It is not yet determined which types of UV-induced cross-links or chemical cross-links will stop reverse transcriptase. Prefractionation on formamide gels should be a valuable first step for analyzing the point of cross-linking by methods of direct RNA sequencing. 1o-~2 Presently, electron microscopy is performed on the fractionated crosslinked molecules to estimate their locations and then synthetic oligonucleotides are synthesized so that they are a short distance (less than 200 nucleotides) downstream from the anticipated site of the cross-link. These act as primers for reverse transcription. Since only one cross-linking site of each pair can be determined at a time, the electron microscopy result gives the correlation between pairs of sites. The extreme 3' terminal region of the 16S rRNA molecule cannot be read by reverse transcription since a primer of at least 10 nucleotides is needed and since two dimethyladenine residues, which are absolute stops for reverse transcription, 2! are located 24 nucleotides from the 3' terminus. Some other method must be employed for the identification of cross-linking points distal to the position 1510. The oligonucleotide primer is kinased with [7 -32p]ATP to a high specific activity (at least 500,000 cpm/pmol). A volume of each crosslinked RNA fraction containing at least 100 ng is mixed with 2 pmol of primer, and the mixture is dried and redissolved in l/tl of 80% formamide, 0.4 M NaCl, 40 m M piperazine-N, N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.8, and 1 m M E D T A . Hybridization is for 15 min at 45*. The hybridization mixes are cooled and to them is added 20/11 of reverse transcription mix [40 m M KCI, 6 m M MgCl2, 50 m M Tris-HC1, pH 8.3, l0 m M dithiothreitol, 5 units RNasin (Promega), 0.5 m M of each deoxynucleotide (Pharmacia P-L), and 7 units of reverse transcriptase (Life Science)]. The reverse transcription is done for 1 hr at 42 °. A set of five reactions is performed with non-cross-linked 16S rRNA; four of these contain all four deoxynucleotides at 0.5 m M each and one each of the dideoxynucleotides at molar ratios of l0 deoxy:l dideoxy. These five reactions show the pattern of nicked sites in the RNA molecule and show the sequence ladder. 2o D. C. Youvan and J. E. Hearst, Anal. Biochem. 119, 86 (1982). 2~ O. Hagenbuehle, M. Santer, J. A. Steitz, and R. Marts, Cell 13, 551 (1978).
[21]
IDENTIFICATION OF R N A CROSS-LINKS
327
The purification of the cDNA follows Qu et aL 22 The reactions are stopped with 10pl of 100 m M EDTA, 0.3% SDS and then are phenol extracted. The phenol phase is back extracted with 20 pl TE and the aqueous phases are combined and are extracted with ether and the residual ether is removed. Two microliters of 4 M NaOH is added to each and the RNA is
P 1 2 34
5 67
F1o. 2. Fractionation of psoralen cross-linked 16S rRNA by formamide-polyacrylamide gel electrophoresis. 30S ribosomal subunits in inactivation buffer (100 m M NH4CI, 0.5 m M magnesium acetate, 10 m M Tris-Hcl, pH 7.2) were cross-linked with hydroxymethyltrimethylpsoralen (HMT) to an incorporation of 2.2 HMT/16S RNA. Fifty micrograms was electrophoresed on one formamide-polyacrylamide gel and separated into seven fractions. These were purified and one-tenth of each was reelectrophoresed to determine the purity of the fractions. Lane P is the starting material. 22 L. H. Qu, B. Michot, and J. P. Bachellerie, Nucleic Acids Res. 11, 5903 (1983).
M
OAGCU1234567
0AGCU
1234
530
Ug. o
A
G~ A C"~
C G G
G
G G G
A
~o
C930
G U G C A A
C
a
567
b
FIG. 3. Gel electrophoresis of reverse transcripts made from control 16S rRNA and fractions of the cross-linked 16S rRNA. In both experiments shown here, the lanes labeled O,A,G,C, and U resulted from reverse transcriptions on control 16S rRNA performed with all four deoxynucleotide tdphosphates and no dideoxynudeotide tfiphosphates (0), and with ddT, ddC, ddG, and ddA, respectively. The lanes marked l to 7 resulted from reverse transcriptions performed on cross-linked 16S rRNA from fractions l to 7 (see Fig. 2). Lane M contains molecular weight markers (HpaII-pBR322). In panel (a), an oligonu¢leotide primer complementary to residues 949-964 was used in order to determine the exact location of a cross-link at approximately 920 ± 20 that is present in fraction 4 as determined previously by electron microscopyJ 4 In fraction 4, strong stops at G925 and C924and lesser stops at (;922 and U92~ are seen and correspond to the site of this cross-rink. In panel (b), an oligonuclcotide primer complementary to residues 559-575 was used to determine the location of cross-finks at approximately 510 ± 20 and 450 ± 20 present in fractions 6 and 7 as determined previously by electron microscopy. ~4In fractions 6 and 7, a stop at As35 is seen and a second stop at C422 (not shown) also occurs; these two stops correspond to the sites of the two cross-links.
[21 ]
IDENTIFICATION OF RNA CROSS-LINKS
329
hydrolyzed for 1 hr at 45 °. The samples are neutralized with 2 #1 of 5 M ammonium acetate, pH 5.5, 2/zg o f t R N A is added, and then 2.5 volumes of ethanol is added for precipitation at - 20 ° for at least 1 hr. The precipitate is washed with cold 70% ethanol, dried, and redissolved in 5 #l H20. The samples are analyzed on an 8% polyacrylamide urea gel.17 One microliter of each sample is mixed with 2/zl of formamide, 10 m M N a O H , 0.2% xylene, 0.2% bromphenol blue and is heated in a boiling water bath for 3 min and cooled before electrophoresis. Comments Reverse transcription of the fractionated psoralen cross-linked 16S rRNA indicates stops that occur in specific fractions and stops that occur in all fractions but not in the control reverse transcripts. These are interpreted to be the sites of psoralen cross-linking and the sites of psoralen monoaddition. In Figs. 2 and 3, the molecules in fraction 4 were previously characterized by electron microscopy and were designated EPs 920 X 3' to indicate that they contained a cross-link between nucleotide 920 _ 20 and somewhere within the terminal 50 nucleotides. These molecules were also studied by Hui and Cantor, 23 who hybridized the molecules to end-labeled DNA restriction fragments and challenged the imperfect hybrids with mung bean nuclease. From the digestion pattern they concluded that the base-pairing interaction that was the site of the cross-link was either (919921) • (1530-1532) or (921-923) • (1532-1534). The reverse transcription result shown here indicates strong stops at 925 and lower intensity stops at 924, 922, and 921. These experiments indicate that the second base-pairing interaction (921 - 923) • (1532-1534) is the site of the crosslinks. Reverse transcriptase is stopping one nucleotide before the nucleotide that contains the cross-link and, to a lower extent, is able to incorporate a nucleotide to the nucleotide that contains the psoralen adduct but is not able to proceed beyond that point. This technique provides a rapid method for finding the sites of the cross-links in fractionated cross-linked molecules. These results can be confirmed by additional RNA sequencing experiments performed on the fractionated material. Acknowledgment This work is supported by NIH grant G M 35410.
23 C. F. Hui and C. R. Cantor, Proc. Natl. Acad. Sci. U.S.A. 82, 1381 (1985).
330
CROSS-LINKING AND AFFINITY-LABELING METHODS
[22]
[22] P s o r a l e n C r o s s - L i n k i n g o f R i b o s o m a l R N A B y S A M U E L E. LIpsoN and JOHN E. H E A R S T
Psoralens as Photo-Cross-Linking Reagents Psoralens are linear, bifunctional, tricyclic furocoumarins which photoreact with double-stranded nucleic acids to form cyclobutane adducts with pyrimidine bases. This reaction proceeds in the forward direction in the presence of long-wavelength ultraviolet light (320-380 nm) and can be reversed by irradiating with short-wavelength ultraviolet light (254 nm) (for a review, see Ref. 1). Figure l schematically outlines the psoralen/nucleic acid photoreaction. The forward reaction is a three-step process. First the psoralen intercalates between stacked base pairs in a double helical region. Then a photon can be absorbed and, if the psoralen is adjacent to a pyrimidine base, a cyclobutane ring can be formed between the 5,6 double bond of the pyrimidine base and either the 4',5' or 3,4 double bond of the psoralen. If the reaction is with the 4",5' double bond of the psoralen, the product is called a furan-side monadduct. If the reaction is with the 3,4 double bond of the psoralen, the product is a pyrone-side monoadduct. If the unreacted double bond of the psoralen is also adjacent to a pyrimidine, a second photon absorption can yield a pyrimidine-psoralen-pyrimidine diadduct which cross-links the nucleic acid helix. The pyrone-side monoadduct cannot absorb light above 320 nm so if the pyrone side monoadduct is formed first, it cannot react further to form the cross-link under long-wavelength irradiation conditions. The cross-link and both monoadducts can be photoreversed by irradiation in their absorption bands typically at 254 nm. Figure 2 show the psoralen-uracil adducts. Psoralens, both natural and synthetic, have been shown to be useful in the laboratory (for a review, see Ref. 1). The chemical properties of different psoralen derivatives allows one to perform cross-linking studies under many different buffer, temperature, and ionic strength conditions.2,3 The nucleic acid being studied can be investigated under conditions where the results will be biologically relevant. The procedure presented here takes advantage of the selectivity of the psoralen/nucleic acid reactions to obtain information about helical regions in ribosomal RNA molecules. t G. D. Cimino, H. B. Gamper, S. T. Isaccs, and J. E. Hearst, Annu. Rev. Biochem. 54, 1151 (1985). 2 j. E. Hyde and J. E. Hearst, Biochemistry 17, 1251 (1978). 3 j. F. Thompson, M. R. Wegnez, and J. E. Hearst, J. MoL Biol. 147, 417 (1981). METHODS IN ENZYMOLOGY, VOL. 164
Copyrisht@ 1988by AcademicPress,Inc. All fightsof reproductionin any formrt~rved.
[22]
PSORALEN CROSS-LINKING OF RIBOSOMAL R N A
Light
intercalation
Monoodduct Formation
331
Light
Cross-link Formation
FIG. 1. Schematic of the psoralen reaction with double-stranded nucleic acids. The first step is an equilibrium intercalation of the psoralen between base pairs in the helix. If the psoralen is intercalated adjacent to a pyrimidine, a monoadduct can be formed upon the absorption of a photon (320-380 rim). A second photon can then be absorbed to form a cross-link between the strands of the helix if the unreacted end of the psoralen is also adjacent to a pyrimidine. The reaction can be photoreversed at either of the photoaddifion steps with short-wavelength ultraviolet light (254 nm).
Principle of the Method The following is a brief description of the method originally described by Thompson and HearstJ Figure 3 schematically outlines the method used to cross-hnk rRNA and identify cross-linked regions of the molecule. The RNA is cross-linked with psoralen under appropriate conditions (reconstitution buffer, activity buffer, etc.) with a low level of psoralen incorporation. The RNA is purified from unreacted psoralen and protein (if reacted as an RNA/protein panicle) by extraction and precipitation. The RNA is then partially digested with RNase T,. This digestion produces RNA oligonucleotides up to
a
0
b
c
R
FIG. 2. Psoralen-uracil photoadducts. (a) A furan-side psoralen-uracil monoadduct, (b) a pyrone-side psoralen-uracil monoaddnct, (c) uracil-psoralen-uracil diadduct. 4 j. F. Thompson and J. E. Hearst, Cell32, 1355 (1983).
332
[22]
CROSS-LINKING AND AFFINITY-LABELING METHODS HMT,36Ontobu
. ~ - " ~ I I [ [ I I I[ ~
oorliol TIRNose
~
]
~
I} 95° RPC-5
ISl
~ )
Dimenslon
BND cellulose
[T-3Zp] ATP Polynuc)eofide
12"/o gel
no ure~
2)
--'~.
O*
(--
2nd Dimenslon
gel 7M ureo
20*/*
--i,i
e u.
260nm h~
I
~
20% qel
I--I
[l
sequence
FIG. 3. Schematic outline of protocol used to isolate psoralen cross-linked RNA fragments to determine secondary structure (see text for details).
about 60 nucleotides in length terminated at the 3' end with a guanidine (G). Most of these oligonucleotides will have either no psoralen incorporated or just psoralen monoadducts. Some of the oligomers will be hairpins that are cross-linked with psoralens, and others may be two oligomer strands cross-linked together with psoralens. When many cross-links are expected, separation by either RPC-5 or BND-celluose chromatography will separate the nucleic acid into fractions which are more easily analyzed. This mixture of oligonucleotides is then 5'-end-labeled with [7~2P]ATP and T4 polynucleotide kinase. Just prior to loading the sample onto a native gel, these oligomers are heat denatured and then quick cooled producing single-stranded oligomers, snap-back hairpins, cross-linked hairpins, and two-strand crosslinks; only psoralen cross-linked material and snap-back hairpins will be double stranded. Upon running the gel, a series of closely spaced (possibly
[22]
PSORALEN CROSS-LINKING OF RIBOSOMAL R N A
333
overlapping) bands is produced. This lane of RNA is cut from the gel and placed at the top of a second gel, which is denaturing. This second-dimension gel is run perpendicular to the first-dimension gel. In this dimension single-stranded material will migrate with the same relative mobility as in the first dimension. This material forms a diagonal across the denaturing gel. Non-cross-linked snap-back hairpins will have a reduced effective hydrodynamic radius when denatured and will run faster than they did in the native dimension. These molecules run below the diagonal. Crosslinked molecules (both hairpins and two-strand cross-links) will be denatured in the second gel but will still be cross-linked by the psoralen and will have a larger effective hydrodynamic radius (migrating as an "X" in a denaturing gel). These fragments will run slower in the denaturing dimension; this material is the above diagonal material. The above diagonal material is excised (spot by spot) from the gel, eluted into an elution solvent, precipitated, and further purified on a one-dimensional denaturing polyacrylamide gel. These purified fragments are subjected to photoreversal under short-wavelength UV light and electrophoresed on another denaturing polyacrylamide gel to isolate the photoreversed products. Hairpins which contained psoralen cross-links and were photoreversed will migrate as one band with a greater mobility than its unphotoreversed counterpart. This is due to the reduction of the hydrodynamic radius upon reversal of the cross-link in a denaturing gel. Two strands that were cross-linked together Will produce two shorter singlestranded RNA fragments upon photoreversal. These two photoreversed fragments will again migrate faster than their cross-linked counterpart. These changes in mobility upon photoreversal allow one to isolate fragments of RNA that were cross-linked together. Each photoreversal product is then subjected to sequence analysis; assignment of the cross-link location in the original RNA is now possible. Occasionally, photodamage to the RNA during photoreversal is evidenced by multiple bands after photoreversal. Relative intensities can not be used to match pairs of bands as the two halves of a cross-link are not equally labeled. These ambiguous crosslinks are discarded. Small molecules, such as 5S rRNA, can be analyzed using a one-dimensional gel system/Psoralen-modified RNA is digested to completion with an RNase (RNase T~ has been successfully used) and run on a 20% denaturing polyacrylamide gel. The banding pattern is compared to the total RNase digestion of unmodified rRNA. Bands in the psoralen-conraining lanes which migrate more slowly than the bands in the control lane are excised, eluted, photoreversed, and sequenced as described above for the diagonal fragments in the two-dimensional gel system in order to locate the cross-linked regions.
334
CROSS-LINKING AND AFFINITY-LABELING METHODS
[22]
Variations Original studies on rRNA using psoralen cross-linking involved visualizing the cross-links in individual molecules using EMS-7; this work is still in progress) This method locates large loops corresponding to long-range interactions. Psoralen-cross-linked small hairpins are not visible using this method. The polarity of the rRNA as seen by EM can be determined by hybridizing a short restriction fragment, complementary to a portion of the molecule, and then interpreting the micrograph knowing where the complementarity exists? Several other methods have been developed to analyze psoralen adducts in rRNA. Youvan and Hearst l° identified psoralen photoreactive sites in 16S rRNA by using reverse transcriptase to determine the lengths of abbreviated cDNA transcripts which correspond to lesions caused by psoralen adducts. This method also identifies psoralen monoadducts which also stop reverse transcriptase. Wollenzien and Cantor H characterized the separation of cross-linked, full-length 16S rRNA into different bands corresponding to different families of cross-links. This allows one to separate RNA containing psoralen cross-links from non-cross-linked RNA prior to any analysis. They completed their analysis by EM as described above. Chu et a l l 2 investigated differences between inactive and active 30S ribosomes by irradiating inactive 30S particles in the presence of AMT with 390 nm light to produce psoralen monoadducts. Some of the ribosomes were activated and then the monoadducts were subjected to crosslinking light (360 nm) and the products formed in the active and inactive 30S ribosomes were analyzed by EM. Turner et al. ~3 performed experiments similar to the two-dimensional gel experiments described in this article, except that the photoreversal was performed in the gel just prior to running the second-dimension gel. This yields below-diagonal fragments corresponding to reversed cross-links. 5 p. L. Wollenzien, D. C. Youvan, and J. E. Hearst, Proc. Natl. Acad. Sci. U.S.A. 75, 1642 (1978). e p. Wollenzien, J. E. Hearst, P. Thammana, and C. R. Cantor, J. Mol. Biol. 135, 255 (1979). 7 p. Thammana, C. R. Cantor, P. L. Wollenzien, and J. E. Hearst, J. Mol. Biol. 135, 271 (1979). 8 p. L. Wollenzien, R. F. Murphy, C. R. Cantor, A. Expert-Bezan¢on, and D. H. Hayes, J. Mol. Biol. 184, 67 (1985). 9 p. L. Wollenzien, J. E. Hearst, C. Squires, and C. Squires, J. Mol. Biol. 135, 285 (1979). ~0D. C. Youvan and J. E. Hearst, Anal, Biochem. 119, 86 (1982). " P. L. Wollenzien and C. R. Cantor, J. Mol. Biol. 159, 151 (1982). ~2y. G. Chu, P. L. Wollenzien, and C. R. Cantor, J. Biol. Struct. Dyn. 1, 647 (1983). t3 S. Turner, J. F. Thompson, J. E. Hearst, and H. F. Noller, Nucleic Acids Res. 9, 2839 (1982).
[22]
PSORALEN CROSS-LINKING OF RIBOSOMAL R N A
335
Materials and Reagents The listing of product names and suppliers does not endorse one product over another, but rather are the products we have used successfully in our laboratory. All glassware used (with the exception of gel plates) should be baked at 250 ° for 12 hr before use to remove any RNase contamination. All other vessels (plastic, etc.) should be rinsed with a 1% solution of diethyl pyrocarbonate (v/v) followed by three rinses with doubly distilled H20 prior to use (also to remove any RNase contamination). All buffers and solutions are made with doubly distilled H20. Urea for gel electrophoresis is ultrapure (Schwarz Mann, Clevelend, OH); all other reagents for electrophoresis are electrophoresis grade (Bio-Rad, Richmond, CA). Enzymes for sequencing and partial digestion are sequencing grade.
A utoradiography Film and Intensifying Screens Film: Kodak XAR-5 or similar Intensifying screens: Dupont Lightning Plus or similar
Buffers and Solutions Reconstitution buffer: 10 m M MgC1, 100 m M NH4C1, 10 m M TrisHC1, pH 7.2, 14 m M 2-mercaptoethanol Phenol: Distilled phenol equilibrated with 50 m M Tris-HC1, pH 8.5 Ethanol: 100% (Gold Shield) Partial digestion buffer: 50 m M Tris-HC1, pH 8.5, 10 m M MgC12 RPC-5 elution buffers: Low salt: 0.1 M KCI, 2 m M sodium thiosulfate, 10 m M ethylenediaminetetraacetic acid (EDTA), 0.06% sodium azide, 10 m M Tris-HC1, pH 6.8 High salt: 2.0 M KC1, 2 m M sodium thiosulfate, 10 m M EDTA, 0.06% sodium azide, 10 m M Tris-HC1, pH 6.8 BND-cellulose elution buffers: Low salt: 0.3 M NaCI high salt: 0.65 M NaC1 25% dimethyl sulfoxide (DMSO) Kinase buffer (10×): 500 m M Tris-HC1, pH 8.5, 100 m M MgCI2, 130 m M 2-mercaptoethanol, 20 m M spermine Gel running buffer (10×): 500 m M Tris base, 500 m M boric acid, 10 m M EDTA Denaturing gel loading buffer (1.0 ml): 0.5 mg xylene cyanol FF, 0.5 mg bromphenol blue, 0.42 g ultrapure urea, 100/A gel running buffer, double-distilled H20 to 1.0 ml LES (10X): 1 M LiC1, 100 m M EDTA, 1.0% w/v sodium dodecyl sulfate
336
CROSS-LINKING AND AFFINITY-LABELING METHODS
[22]
Sequencing buffers: RNase Tt, RNase Phy M: 20 mM sodium citrate, pH 5.0, 1 mM EDTA, 7 M urea, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanole RNase Bacillus cereus: 20 mM sodium citrate, pH 5.0, 1 mM EDTA, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanole RNase U2:20 mM sodium citrate, pH 3.5, 1 mMEDTA, 7 Murea, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanole Alkaline hydrolysis buffer: 50 mM sodium carbonate, pH 9.0, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanole Enzymes
Sequencing grade enzymes (1 unit/#l): Pharmacia RNA sequencing kit (27-0997-01,Piscataway, NJ), RNase Tt, RNase U2, RNase Phy M, and RNase B. cereus Polynucleotide kinase: New England Biolabs, Beverly, MA Gels
12% native polyacrylamide gel solution: 11.3 g acrylamide, 0.7 g bisacrylamide, 10 ml 10× gel running buffer, doubly distilled H20 to 100 ml 20% denaturing polyacrylamide gel solution: 19 g acrylamide, 1.0 g bisacrylamide, 42 g ultrapure urea, 10 ml 10× gel running buffer, doubly distilled H20 to 100 ml To polymerize gels, add 75 nag ammonium persulfate/100 ml gel solution and stir until dissolved. Add 75/zl N,N,N',N'-tetramethylethylerediamine (TEMED)/100 ml gel solution and immediately pour gel. Radioactive Compounds [?-23p]ATP: > 7000 Ci/mmol, ICN, Irvine, CA [3H]4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT): HRI Associates, Emeryville, CA Procedures The detailed protocols of this method will be described for 16S rRNA in solution4 adapted to our current light source. Other adaptations such as different irradiation buffers can also be made to suit the needs of particular experiments. For each two-dimensional gel procedure, at least 25 #g of RNA is required, because material is lost during the multiple gel purifications and only 5- 10% of the radiolabel is incorporated into psoralen-con-
[22]
PSORALEN CROSS-LINKING OF RIBOSOMAL R N A
337
taining fragments, yielding a small number of counts in the fragments that are sequenced.
Cross-Linking of the rRNA Purified 16S rRNA is preincubated in reconstitution buffer at a concentration of 200/zg/ml. Psoralen is added to a concentration of 20/zg/ml from a stock solution of psoralen in DMSO or ethanol at 2 mg/ml. The sample is irradiated in a 1.5-ml Eppendorf microcentrifuge tube for 3 min at 10 °. The light source (320-380 nm) is a 2500 W Xe-Hg lamp (ConradHanovia), filtered through a series of filters, as previously described t4 (light intensity at the sample is - 1 W/cm2). The addition of psoralen and irradiation is repeated two more times. The RNA is then phenol extracted and ethanol precipitated to remove unreacted psoralen and psoralen photo by-products.
Quantification of Psoralen Incorporation into rRNA The photoreacted RNA is quantified by UV absorption spectroscopy. A small aliquot of the sample is counted by liquid scintillation and a ratio of psoralen to RNA is determined.
Partial Digestion of rRNA The photoreacted RNA is dissolved to a concentration of 10 OD260/ml in partial digestion buffer and is digested at 37 ° for 2 hr with 100 units/ml RNase T t. Following digestion, the RNA is phenol extracted and ethanol precipitated.
Chromatography of Digested RNA (Optional Step) In larger RNA molecules (e.g., 16S rRNA) a separation step is needed to separate different classes of cross-links before gel analysis. Typically, 500/tg to 1 mg RNA is used when separation by chromatography is employed. This reduces the total number of cross-links analyzed on each two-dimensional gel, thus simplifying the analysis procedure. Two different methods of separation have been used successfully. Either one may be used if deemed necessary. RPC-5 chromatography is performed on a 0.4 × 20 cm column. The RNA is dissolved in 1.0 ml RPC-5 low-salt buffer and loaded onto the top of the column. The RNA is eluted from the column using an 80-ml
14G. D. Cimino, Y.-B. Shi, and J. E. Hearst, Biochemistry 25, 3013 (1986).
338
CROSS-LINKING A N D AFFINITY-LABELING METHODS
[22]
gradient of the RPCo5 low-salt buffer to the RPC-5 high-salt buffer. Onemillilites fractions are collected and the RNA is precipitated. BND-cellulose chromatography is performed on a 0.5-ml column poured in a 3-ml syringe. The RNA is loaded onto the column in 1.0-ml BND low-salt solution and is eluted over a 15-ml gradient of the BND-cellulose low-salt solution to the high-salt solution. One-millilites fractions are collected and the RNA is precipitated.
Labeling of Digested RNA The purified RNA is dissolved in 1.0 mCi [7-32p]ATP, 2.5/zl 10X kinase buffer, 2 units of polynucleotide kinase, and water to 25/A and incubated overnight at 37 ° to label the Y-end of the digested fragments.
First-Dimension Gel The labeled RNA solution is made 1 M in urea, heated at 90-95 ° for 1 min, fast cooled on ice, and loaded onto a 0.08 × 15 × 40 cm 12% native polyacrylamide gel. The gel is run at room temperature until the bromphenol blue has migrated to the bottom of the gel (about 7 hr at 800 V).
Second-Dimension Gel The upper glass plate from the first-dimension gel is removed and the gel is covered with plastic wrap. The bottom 30 cm of the lane(s) containing RNA is cut using a razor blade and straight edge. This lane is placed near the top of a 34 X 40 cm glass plate and the plastic wrap is removed. The cover plate is placed over the gel slice and a 0.08 × 34 × 40 cm 20% denaturing polyacrylamide gel is polymerized around the gel strip. The second-dimension gel is run warm until the xylene cyanole marker has migrated to the bottom of the gel (about 8 hr at 40-50 W). The top plate is removed and the gel is covered with plastic wrap and autoradiographed with Kodak XAR-5 film.
Extraction and Purification of Above Diagonal Material Each above diagonal spot, located by autoradiography, is cut from the second-dimension gel and placed in an Eppendorf tube. Two hundred and fifty microliters of LES solution (1 ×) is added to each gel slice and the tubes are shaken at 37 ° for 6 to 16 hr. The eluant from each slice is removed to a new Eppendorf tube and the gel slice is washed twice with 50 pl LES solution, adding the washes to the eluant. Carder tRNA, 10 #g, is added to each tube followed by 900/zl 100% ethanol. The samples are vortexed and the RNA is precipitated either overnight at - 2 0 * or 30 min
[22]
PSORALEN CROSS-LINKING OF RIBOSOMAL R N A
339
at - 7 0 °. After cooling, the samples are spun for 5 to 15 min in an Eppendorf microcentrifuge (12,500 g) and the supernatants are removed. The precipitates are suspended in 10 #1 denaturing loading buffer and run down a 20% denaturing polyacrylamide gel until the xylene cyanole has migrated to the bottom of the gel. The top plate of the gel is removed and the gel is covered with plastic wrap and autoradiographed as described above. Single bands are cut from the gel and eluted as above but no tRNA is added nor are the samples precipitated.
Photoreversal of RNA The samples from the purification gels are photoreversed from the top in open Eppendorf tubes covered with plastic wrap under a 40 W germicidal lamp (254 nm) for 2 hr at a distance of 10 cm. tRNA, 10/zg~ is added to each sample followed by ethanol precipitation with 2.5 volumes 100% ethanol as previously described.
Isolation of the Photoreversed Fragments The precipitated photoreversal samples are dissolved in 10/zl denaturing loading buffer and run down a denaturing 20% polyacrylamide gel until the bromphenol blue has run two-thirds down the gel. The gel is autoradiographed as above and the photoreversal products are excised and purified as above.
Preparation for Sequencing Each photoreversal product is counted to determine the number of counts per minute available for the sequencing reactions. We have found that less than 1000 cpm is impractical to attempt to sequence. For complete sequencing (four enzymes plus alkaline hydrolysis), more than 2000 cpm per sample is recommended. Sequencing with two of the enzymes (RNase TI and RNase U2) and alkaline hydrolysis produce ladders which can be used to determine the sequence of the fragment. The eluant is divided equally between three and five tubes, 3/tg tRNA is added to each tube, and the samples are precipitated with 2.5 volumes of ethanol.
Sequencing of Photoreversed Fragments ~5 Segregate the samples such that tubes of relatively equal counts per minute will be loaded onto the same gels. We have found that tubes containing about 300 cpm each will require 7 weeks at - 7 0 ° with two ~5H. Donis-Keller, A. M. Maxam, and W. Gilbert, Nucleic Acids Res. 4, 2527 (1977).
340
CROSS-LINKING AND AFFINITY-LABELING METHODS
[22]
intensifying screens for visible bands on the autoradiogram. More than 7 weeks of autoradiography produces very dark backgrounds on the autoradiograms, making them unreadable. Proportionally shorter periods are used for tubes with a larger number of counts per minute. While on ice, add 9 #1 of the appropriate sequencing buffer and 1 #1 of the enzyme (1 unit//tl), or 10 ~1 alkaline hydrolysis buffer, to each tube. Incubate the tubes containing enzymes at 55 ° and do alkaline hydrolysis at 90 ° for 15 min. Immediately put the samples back on ice and load on a 20% denaturing polyacrylamide gel. Run the gel until the bromphenol blue has migrated two-thirds down the gel. Autoradiograph the gels for the appropriate amount of time with two intensifying screens to determine the sequences of each fragment. F u t u r e Directions One major limitation of the procedure described is that 90% of the label goes into RNA that contains no psoralen. This limits the ability to isolate all cross-links formed in the RNA molecule due to the low percentage of label incorporated into those fragments of RNA containing psoralen. A method to isolate all psoralen-containing material from material without psoralen prior to labeling would greatly enhance the ability to find all of the cross-links. Santella et al. ~6 have generated antibodies to AMT monoadducts in DNA and shown that these antibodies specifically recognize the desired adduct. Similar antibodies could be grown to psoralen/RNA crosslinks and then be employed to selectively retain psoralen cross-link-containing material from material without psoralen. Analysis of each of the fragments isolated from the antibodies would yield more data about seeondary and tertiary interactions within the RNA being investigated. The specificity of the psoralen photoreaction also limits the amount of data that can be extracted from experiments as described. Specifically, there are apparent hot spots for psoralen photoreaction ~7 and these hot spots are easily found with this method. With the evolution of three-dimensional models for the ribosome, a need is developing to validate the predictions of these models. One such possible method would be to sitespecifically place a cross-linkable psoralen monoadduct at the region of interest and then attempt to cross-link it to whatever it is interacting with. By isolating the cross-link formed, one would be able to confirm the interaction predicted by the model. m6R. M. Santella, N. Dharmaraja, F. P. Gasparro, and R. L. Edelson, Nucleic Acids Res. 13, 2533 (1985). 17 H. G. Gamper, J. Piette, and J. E. Hearst, Photochem. Photobiol. 40, 29 (1984).
[23]
A F F I N I T Y LABELING OF RIBOSOMES
341
Summary This method allows one to isolate helical interactions in RNA molecules under numerous conditions. The cross-linking of RNA with psoralen followed by isolation and sequencing of the cross-linked fragments is a powerful method for determining interactions within the RNA that elude chemical and enzymatic mapping techniques. With the data produced by this method and its variations, features of the secondary structure of the rRNAs have been confirmed and some long-range interactions have given insight into tertiary interactions within rRNAs. Limitations of the method include the specificity of the psoralen photoreaction. This limits the method described to those sites in the folded RNA molecule where psoralens photoreact best.
[23] A f f i n i t y L a b e l i n g o f R i b o s o m e s By B A R R Y
S. C O O P E R M A N
Affinity-labeling studies on the ribosome have as their common goal the identification of components of functionally important ligand-binding sites. By components we generally mean individual ribosomal proteins or limited regions of rRNA, although occasionally identifications have been made at the peptide or amino acid level, or at the oligonucleotide or individual base level. The ligands whose binding sites have been explored by affinity labeling include peptidyl-, aminoacyl-, and uncharged tRNA, oligo- and polyribonucleotides directed to the mRNA-binding locus, protein factors involved in initiation, elongation, and translocation, and a large number of antibiotics. Published work in this area through mid-1979 has been previously reviewed1-4 with a strong emphasis on experiments on Escherichia coli ribosomes. In this chapter we present a brief overview, emphasizing results obtained more recently and including results obtained B. S. Cooperman, Bioorg. Chem. Suppl. 4, 81 (1978). 2 B. S. Cooperman, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 531. University Park Press, Baltimore, Maryland, 1980. 3 E. Kuechler and J. Ofengand, in "Transfer RNA: Structure, Properties, and Recognition'" (P. Sehimmel, D. $611, and P. Schimmel, eds.), p. 431. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1979. 4 j. Ofengand, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 497. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copydght© 1988by AcademicPress,Inc. All rightsof reproductionin any form reserved.
[23]
A F F I N I T Y LABELING OF RIBOSOMES
341
Summary This method allows one to isolate helical interactions in RNA molecules under numerous conditions. The cross-linking of RNA with psoralen followed by isolation and sequencing of the cross-linked fragments is a powerful method for determining interactions within the RNA that elude chemical and enzymatic mapping techniques. With the data produced by this method and its variations, features of the secondary structure of the rRNAs have been confirmed and some long-range interactions have given insight into tertiary interactions within rRNAs. Limitations of the method include the specificity of the psoralen photoreaction. This limits the method described to those sites in the folded RNA molecule where psoralens photoreact best.
[23] A f f i n i t y L a b e l i n g o f R i b o s o m e s By B A R R Y
S. C O O P E R M A N
Affinity-labeling studies on the ribosome have as their common goal the identification of components of functionally important ligand-binding sites. By components we generally mean individual ribosomal proteins or limited regions of rRNA, although occasionally identifications have been made at the peptide or amino acid level, or at the oligonucleotide or individual base level. The ligands whose binding sites have been explored by affinity labeling include peptidyl-, aminoacyl-, and uncharged tRNA, oligo- and polyribonucleotides directed to the mRNA-binding locus, protein factors involved in initiation, elongation, and translocation, and a large number of antibiotics. Published work in this area through mid-1979 has been previously reviewed1-4 with a strong emphasis on experiments on Escherichia coli ribosomes. In this chapter we present a brief overview, emphasizing results obtained more recently and including results obtained B. S. Cooperman, Bioorg. Chem. Suppl. 4, 81 (1978). 2 B. S. Cooperman, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 531. University Park Press, Baltimore, Maryland, 1980. 3 E. Kuechler and J. Ofengand, in "Transfer RNA: Structure, Properties, and Recognition'" (P. Sehimmel, D. $611, and P. Schimmel, eds.), p. 431. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1979. 4 j. Ofengand, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), p. 497. University Park Press, Baltimore, Maryland, 1980. METHODS IN ENZYMOLOGY, VOL. 164
Copydght© 1988by AcademicPress,Inc. All rightsof reproductionin any form reserved.
342
CROSS-LINKING
AND AFFINITY-LABELING
[23]
METHODS
TABLE I REFERENCES FOR AFFINITY LABELING AND CROSS-LINKING EXPERIMENTS
Experiment
Y-end tRNA
Ai~nity Labels Electrophilic lodoacetyl or iodoacetamidyl Bromoacetyl or bromoacetamidyl p-Nitrophenylcari~myl Nitrogen mustard Phenyl glyoxal Mercury derivative Photolabile or Photo-Induced Azidophenyl Nitro~ or dinitroazidophenyl Direct photolysis FMN photosensitization Nitro- or dinitrophenyl Diazomalonyl Benzophenonyl 4-Thio(U) 5-Bromo(U) Cross-Linkers Elcctrophilic Bisimidat~ Water-soluble carbodiimide Imino~iolane p-Nitrophenylchloroor thoformate Diepoxybutane Tartaryl diazide Platinum chloride Phenylene dimaleimide 12-inducedS-S formation Phenyl diglyoxal Difluorodinitrobcnzcne Mixed-Function or Photo-Labile Atyl azide, imidate p-Nitrobcnzylmalvimide Psoralen
Other specific sites in IRNA
Unmodified or randomly derivatized tRNA
Oligonucleotides
Polynucleotides
1,2 1,7,8 1,6, 11, 12 1,8-10
1,2 1, 47- 54 1
13, 14 1, 3, 15 1, 16-18
20 21-26 27-33
34-37 38-44
2,55 3, 57-62
45 1
1,19 33a
3 1
56
46
63
64
with eukaryotic ribosomes. A detailed review of photoaffinity-labeling experiments on E. eoli ribosomes has also been prepared recently? Both photolabile and electrophilie derivatives of ribosomal ligands have been used in afffinity-labeling experiments on ribosomes. The relative merits of these approaches have been considered in detail elsewhere. 2 In addition, covalent incorporation of ligands into ribosomes has been induced by direct or sensitized photolysis of ligand ribosome complexes, as 5 B. S. C o o p e r m a n ,
Pharmacol. Ther., 3 4 ,
271 (1987).
[23]
EF-G, EF-TU GTP, GDP
AFFINITY LABELING OF RIBOSOMES
IF-2, IF-3
elF-2, eIF-3, eEF-2
1, 2, 65, 66 75, 76 77 77
Puromycin
Chloramphenicol
1 92-94
I 1, 104
95-98 99, 100 1, 2, 101-103
105
Tetracyclincs
343
Macrofides
Streptomycin
Other antibiotics
1 116, 117
107
118 1
106
107-109
110, 112
119 2, 113 2, 120
67,68,69
78-81
86, 87
70 71 72
82
88,89
83 84 80
73 114, 115 68
90, 91
74
77
well as by treatment of such complexes with bifunctional cross-linking reagents. Reagents have been employed that contain two electrophilic centers, or one electrophilic and one photolabile center (so-called heterobifunctional reagents), or, in the case of psoralen, two photolabile centers. A comprehensive summary of the affinity labels and cross-linking agents used in studies on ribosomes is presented in Table I. 6-~2° In this and 6 M. Perez-Gonsalbez,D. Vazquez, and J. P. G. Ballesta, Mol. Gen. Genet. 163, 29 (1978). 7 A. E. Johnson and C. R. Cantor, J. Mol. Biol. 138, 273 (1980). s V. V. Vlasov and P. Westermann, Mol. Biol. (Engl. Transl.) 10, 550 (1976).
344
CROSS-LINKING AND AFFINITY-LABELING METHODS
[23]
succeeding tables, studies on E. coli ribosomes published prior to 1979 are referenced to earlier review articles. ~-4 Below we consider the approaches that have been used for identifying
9 E. Wickstrom, K. K. Parker, D. Hursh, and R. L. Newton, FEBSLett. 123, 273 (1981). ~0K. K. Parker and E. Wickstrom, Nucleic Acids Res. 11, 515 (1983). II A. P. Czernilofsky, E. CoUatz, A. M. Gressner, and I. G. Wool, Mol. Gen. Genet. 153, 231 (1977). 12 M. Perez-Gosalbez, G. L. Rivera, and J. P. G. Ballesta, Biochem. Biophys. Res. Commun. 113, 941 (1983). t3 S. Fabijanski and M. Pdlegrini, Biochemistry 18, 5674 (1979). 14S. Fabijanski and M. Pellegdni, MoL Gen. Genet. 184, 551 (1981). is M. Leitner, M. Wilchek, and A. Zamir, Eur. J. Biochem. 125, 49 (1982). ~6C. C. Hall, J. E. Smith, and B. S. Cooperman, Biochemistry 24, 5702 (1985). ~7j. Stahl, H. B6hm, V. A. Pozdnyakov, and A. S. Girshovich, FEBSLett. 102, 273 (1979). ~s j. Stahl, H. B6hm, and H. Bielka, Acta Biol. Med. Germ. 40, 1101 (1981). 19A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 (1984). 2o J.-K. Chen, L. A. Franke, S. S. Hixson, and R. A. Zimmermann, Biochemistry 24, 4777 (1985). 2~j. Ciesiolka, P. Gornicki, and J. Ofengand, Biochemistry 24, 4931 (1985). 22 p. Gornicki, J. Ciesiolka, and J. Ofengand, Biochemistry 24, 4924 (1985). 23 F.-W. Lin, L. Kahan, andJ. Ofengand, J. Mol. Biol. 172, 77 (1984). 24 L. M. Hsu, F.-W. Lin, K. Nurse, and J. Ofengand, J. Mol. Biol. 172, 57 (1984). 25 J.-K. Chen, J. H. Krauss, S. S. Hixson, and R. A. Zimmerman, Biochim. Biophys. Acta 825, 161 (1985). 26 I. Schwartz and J. Ofengand, Biochim. Biophys. Acta 697, 330 (1982). 27 A. J. M. Matzke, A. Barta, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 77, 5110 (1980). 2s j. Ofengand and R. Liou, Biochemistry 20, 552 (1981). 29 j. B. Prince, B. H. Taylor, D. L. Thudow, J. Ofengand, and R. A. Zimmermann, Proc. Natl. Acad. Sci. U.S.A. 79, 5450 (1982). 3o G. Steiner, R. Luhrmann, and E. Kuechler, Nucleic Acids Res. 12, 8181 (1984). 31 j. Ciesiolka, K. Nurse, J. Klein, and J. Ofengand, Biochemistry 24, 3233 (1985). 32 C. Ehl~smann, B. Ehresmann, R. Millon, J.-P. Ebel, K. Nurse, and J. Ofcngand, Biochemistry 23, 429 (1984). 33 j. Ofengand, P. Gomicki, K. Chakraburtty, and K. Nurse, Proc. Natl. Acad. Sci. U.S.A. 79, 2817 0982). 3~ N. Riehl, P. Remy, J.-P. Ebel, and B. Ehresmann, Eur. J. Biochem. 128, 427 (1982). 34G. T. Babkina, G. G. Karpova, and N. B. Matasova, Mol. Biol. (Engl. Transl.) 18, 1045 (1984). 35 G. T. Babkina, E. V. Bausk, G. G. Karpova, N. B. Matasova, and D. M. Graifer, Mol. Biol. (Engl. Transl.) 18, 1062 (1984). 36 G. T. Babkina, E. V. Bausk, D. M. Graifer, G. G. Karpova, and N. B. Matasova, FEBS Lett. 170, 290 (1984). 37 E. V. Bausk, D. M. Graifer, and G. G. Karpova, Mol. Biol. (Engl. Transl.) 19, 452 (1985). 38 G. G. Abdurashidova, M. F. Turchinsky, K. A. Aslanov, and E. I. Budowsky, Nucleic Acids Res. 6, 3891 (1979). 39 G. G. Abdurashidova, M. F. Turchinsky, and E. I. Budowsky, FEBSLett. 129, 59 (1981).
[23]
AFFINITY LABELING OF RIBOSOMES
345
affinity labeled ribosomal components and the criteria that have been employed in deciding whether the labeled component is at a functional site. We conclude with a series of tables summarizing the contributions of
40 G. G. Abdurashidova, M. G. Nargizyan, N. V. Rudenko, M. F. Turchinsky, and E. I. Budowsky, Mol. Biol. (Engl. Transl.) 19, 459 (1985). 41 G. G. Abdurashidova, V. A. Ovsepyan, Ao A. Chernii, L. B. Kaminir, and E. I. Budowsky, Mol. Biol. (Engl. Transl.) 19, 667 (1985). 42 G. G. Abdurashidova, V. A. Ovespyan, and E. I. Budowsky, Mol. Biol. (Engl. Transl.) 19, 947 (1985). 43 N. E. Broude, N. I. Medvedeva, K. S. Kussova, and E. I. Budowsky, Mol. Biol. (Engl. Transl.) 19, 1040 (1985). 4~ G. G. Abdurashidova, I. D. Baskayeva, A. A. Chernyi, L. B. Kaminir, and E. I. Budowsky, Eur. J. Biochem. 159, 103 (1986). 44A. M. Reboud, S. Dubost, andJ. P. Reboud, FEBSLett. 158, 285 (1983). 45 T. A. Kruse, G. E. Siboska, and B. F. C. Clark, Biochimie64, 279 (1982). 46 p. Westermann, O. Nygard, and H. Bielka, Nucleic Acids Res. 9, 2387 (1981). 47 j. Stahl and N. D. Kobets, Mol. Biol. Rep. 9, 219 (1984). 48 O. I. Gimautdinova, G. G. Karpova, and N. D. Kobets, Mol. Biol. (Engl. Transl.) 15, 797 (1981). 49 O. I. Gimautdinova, G. G. Karpova, D. G. Knorre, and N. D. Kobets, Nucleic Acids Res. 9, 3465 (1981). 50 j. Stahl and N. D. Kobets, FEBSLett. 123, 269 (1981). 51 V. G. Budker, N. D. Kobets, I. E. KoUekstionok, G. G. Karpova, and N. I. Grineva, Mol. Biol. 14, 507 (1980). 52 O. I. Gimautdinova, G. G. Karpova, and N. A. Kozyreva, Mol. Biol. (Engl. Transl.) 16, 594 (1984). 53 G. T. Babkina, G. G. Karpova, N. B. Matasova, V. M. Berzin, E. Ya Gren, and I. E. Tsielens, Mol. Biol. (Engl. Transl.) 19, 890 (1986). 54 G. T. Babkina, A. G. Veniaminova, S. N. Vladimorov, G. G. Karpova, V. L Yamkovoy, V. A. Berzin, E. J. Gren, and I. E. Cielens, FEBSLett. 202, 340 (1986). 55 O. I. Gimautdinova, M. A. Zenkova, G. G. Karpova, and L. M. Podust, Mol. Biol. (Engl. Transl.) 18, 734 (1984). 56 O. I. Gimautdinova, G. G. Karpova, D. G. Knorre, and S. B. Frolova, FEBS Lett. 185, 221 (1985). 57 N. E. Broude, K. S. Kussova, N. I. Medvedeva, and E. I. Budowsky, Bioorg. Khim. (Moscow) 6, 1303 (1980). 5s N. E. Broude, K. S. Kussova, N. I. Medvedeva, and E. I. Budowsky, Eur. J. Biochem. 132, 139 (1983). 59 A. M. Reboud, S. Dubost, M. Buisson, and J.-P. Reboud, Biochem. Biophys. Res. Commun. 93, 974 (1980). 60 j. R. Greenberg, Nucleic Acids Res. 8, 5685 (1980). 61 K. Terao and K. Ogata, J. Biochem. (Tokyo) 86, 605 (1979). 62 y. Takahashi and K. Ogata, J. Biochem. (Tokyo) 90, 1549 (1981). 63 p. Westermann and O. Nygard, Nucleic Acids Res. 12, 8887 (1984). S. Yokoe, M. Tanaka, H. Hibasami, J. Nagai, and K. Nakashima, J. Biochem. (Tokyo) 94, 1803 (1983). 65 A. S. Girshovich, E. S. Bochkareva, and A. T. Gudkov, FEBSLett. 150, 99 (1982).
346
CROSS-LINKING AND AFFINITY-LABELING METHODS
[2~]
affinity-labeling experiments in defining functional domains on both E. coli and rat liver ribosomes.
66 A. S. Girshovich, T. V. Kurtskhalia, Y. A. Ovchinnikov, and V. D. Vasifiev, FEBS Lett. 130, 54 (1981). 67 S.-E. Skold, Eur. J. Biochem. 127, 225 (1982). 6s A. S. Achary, P. B. Moore, and F. M. Richards, Biochemistry 12, 3108 (1973). 69 A. S. Girshovich, E. S. Bochkareva, and V. D. Vasiliev, FEBSLett. 197, 192 (1986). 7o U. Fabian, FEBSLett. 71, 256 (1976). 7, C. San Jos6, C. G. Kurland, and G. St6fller, FEBS Lett. 71, 133 (1976). 72 S.-E. Skold, Nucleic Acids Res. 11, 4923 (1983). 73 A. S. Girshovich, E. S. Bochkareva, and Yu. A. Ovchinnikov, J. Mol. Biol. 151, 229 (1981). 74j. A. Maasen and W. Moiler, Eur. J. Biochem. 115, 279 (1981). 75 L. A. Mackeen, L. Kahan, A. J. Wahba, and I. Schwartz, J. Biol. Chem. 255, 10526 (1980). 76 I. Schwartz, M. Vincent, W. A. Strycharz, and L. Kahan, Biochemistry 22, 1483 (1983). 77 B. S. Cooperman, A. Expert-Bezanc~on, L. Kahan, J. Dondon, and M. Grunberg-Manago, Arch. Biochem. Biophys. 208, 554 (1981). 7s C. L. Pon, R. T. Pawlik, and C. Gualerzi, FEBSLett. 137, 163 (1982). 79 D. A. Hawley, L. I. Slobin, and A. I. Wahba, Biochem. Biophys. Res. Commun. 61, 544 (1974). so R. L. Heimark, L. Kahan, K. Johnston, J. W. B. Hershey, and R. R. Traut, J. Mol. Biol. 105, 219 (1976). s~ R. L. Heimark, J. W. B. Hershey, and R. R. Traut, J. Biol. Chem. 251, 7779 (1976). s2 j. B. Chaires, D. A. Hawley, and A. J. Wahba, Nucleic Acids Res. 10, 5681 (1982). s3 j. van Duin, C. G. Kudand, J. Dondon, and M. Grunberg-Manago, FEBS Lett. 59, 287 (1975). s4 C. Ehresrnann, H. Moine, M. Mougel, J. Dondon, M. Grunberg-Manago, J.-P. Ebel, and B. Ehresmann, Nucleic Acids Res. 14, 4803 (1986). s5 S. Douthwaite, A. Christensen, and R. A. Garrett, Biochemistry 21, 2313 (1982). s6 p. Westermann and O. Nygard, Biochim. Biophys. Acta 741, 103 (1983). s7 p. Westermann, W. Heumann, U.-A. Bommer, H. Bielka, O. Nygard, and T. Hultin, FEBSLett. 97, 101 (1979). s8 D. R. Tolan, J. W. B. Hershey, and R. A. Traut, Biochimie65, 427 (1983). 89 T. Uchiumi, M. Kikuchi, K. Terao, K. Iwasaki, and K. Of,am, Eur. J. Biochem. 156, 37 (1986). 9o p. Westermann, O. Nygard, and H. Bielka, Nucleic Acids Res. 8, 3065 (1980). 91 O. Nygard and P. Westermann, Nucleic Acids Res. 10, 1327 (1982). 92 R. Luhrmann, R. Bald, M. St6fller-Meilicke, and G. St6fller, Proc. Natl. Acad. Sci. U.S.A. 78, 7276 (1981). 93 j. Stahl, K. Dressier, and H. Bielka, FEBSLett. 47, 167 (1974). 94 D. J. Eckermann and R. H. Symons, Eur. J. Biochem. 82, 225 (1978). 9~A. W. Nicholson, C. C. Hall, W. A. Strycharz, and B. S. Coolaerman, Biochemistry 21, 3797 (1982). 96 A. W. Nieholson, C. C. Hall, W. A. Stryeharz, and B. S. COOlaerman, Biochemistry 21, 3809 (1982). 97 F. Krassnigg, V. A. Erdmann, and H. Fasold, Eur. J. Biochem. 87, 439 (1978).
[23]
AFFINITY LABELING OF RIBOSOMES
347
Identification of Affinity-Labeled Ribosomal Components Proteins
In the large majority of reported experiments, affinity-labeled proteins have been detected through use of radioactive affinity labels. Three methods have been used in performing the requisite protein separations: one-, two- or three-dimensional polyacrylamide gel electrophoresis (PAGE);m~,12~,m22immunological analysis, using purified antisera to specific ribosomal proteins in conjunction either with immunoditfusion analysis, t23 SpeCific immunoprecipitationf124 or cosedimentation; ~25 and, most recently, high-performance liquid chromatography (HPLC).l°I,t26
9s R. H. Symons, R. J. Harris, P. Greenwell, D. J. Eckermann, and E. F. Vanin, Bioorgan. Chem. Suppl. 4, 409 (1978). 99 H. B6hm, J. Stahl, and H. Bielka, Acta Biol. Med. Get. 38, 1447 (1979). too R. Vince, J. Brownell, and K.-L. Lau Fon~ Biochemistry 17, 5489 (1978). ,o~ C. J. Weitzmann and B. S. Cooperman, Biochemistry 24, 2268 (1985). to2 M. Gully and M. PeUegrini, Biochemistry 24, 5781 (1985). ,o3 A. M. Reboud, S. Dubost, M. Buisson, and J. P. Reboud, Biochemistry 20, 5281 (1981). 1°4C. Bouthier de la Tour, M.-L. Capmau, and F. LeGoflic, Eur. J. Med. Chem. 20, 213 (1985). lO5p. E. Nielsen, V. Leick, and O. Buchardt, FEBSLett. 94, 287 (1978). 106F. LeGoflic, M.-L. Capmau, L. Chausson, and D. Bonnet, Eur. J. Biochem. 106, 667 (1980). ,o7 T. Hasan, R. A. Goldman, and B. S. Cooperman, Biochem. Pharma¢ol. 34, 1065 (1985). ,o8 R. A. Goldman, T. Hasan, C. C. Hall, W. A. Strycharz, and B. S. Cooperman, Biochemistry 22, 359 (1983). ,09 A. M. Reboud, S. Dubost, and J.-P. Reboud, Fur. J. Biochem. 124, 389 (1982). ,~o S. Siegrist, N. Moreau, and F. LeGoflic, Eur. J. Biochem. 153, 131 (1985). ,tt F. Tejedor and J. P. G. Ballesta, Biochemistry 24, 467 (1985). o2 F. Tejedor and J. P. G. Ballesta, J. Antimicrob. Chemother. 16 (Suppl. A.), 53 (1985). ~,3 M. A. Luddy, Ph.D. Thesis. University of Pennsylvania, Philadelphia, 1982. t,4 p. Melancon, G. Boileau, and L. Brakier-Gingras, Biochemistry 23, 6697 (1984). t,5 p. Melancon, G. Boileau, and L. Brakier-Gingras, Biochemistry 24, 6089 (1985). ~,6 G. Hogenauer, H. Egger, C. Ruf, and B. Stumper, Biochemistry 20, 546 (1981). ,,7 M. Gilly, N. R. Benson, and M. Pellegrini, Biochemistry 24, 5787 (1985). ,~s F. Tangy, M.-L. Capmau, and F. LeGoitic, Eur. J. Biochem. 131, 581 (1983). ,,9 F. Tejedor, R. Amils, and J. P. G. Ballesta, Biochemistry 24, 3667 (1985). ~2oA. Minnella, W. A. Strycharz, and B. S. Cooperman, unpublished observations (1980). ,21 E. Kalschmidt and H. G. Wittmann, Anal. Biochem. 36, 401 (1970). ,22 j. W. Kenny, J. M. Lambert, and R. R. Traut, this series, Vol. 59, p. 534. ,23 O. Pongs, G. St6tiler, and E. Lanka, J. Mol. Biol. 99, 301 (1975). ~24p. G. Grant, W. A. Strycharz, E. N. Jaynes, Jr., and B. S. Cooperman, Biochemistry 18, 2149 (1979). ,25 I. Fiser, K. M. Scheit, G. St6tiler, and E. Kuechler, FEBSLett. 56, 226 (1975). ,26 B. S. Cooperman, C. J. Weitzmann, and M. A. Buck, this volume [36].
348
CROSS-LINKING AND AFFINITY-LABELING METHODS
[23]
Elsewhere we have discussed the overwhelming superiority of HPLC versus PAGE for the analysis of afffinity-labeled proteins in terms of ease and rapidity of use, protein yield, precision, and reproducibility of results and at least equivalent resolution. ~°1 In cases where an affinity label with a suitable chromophore is employed, HPLC analysis also permits straightforward optical detection of an affinity-labeled protein. 127 An inherent problem in the use of either HPLC or PAGE analysis is that the labeled protein may elute (or migrate) sufficiently differently from native protein that its elution volume (or location in a gel) may not suffice for its unambiguous identification. This can be particularly problematic in crowded regions of a chromatogram or gel. Three approaches may be employed in confronting this problem. The first is to use immunological analysis, if the appropriate antisera are available. Although the use of such analysis is difficult when precise quantitation of incorporation is required, it is well suited for the purpose of protein identification. The second is to prepare the affinity-labeled protein free from contamination with other ribosomal proteins and to identify it by classical methods, such as tryptic fingerprints ~2s or partial N-terminal sequence determination. The third is to analyze a sample by two high-resolution methods that each have a different physical basis for separation, the underlying idea being that the cohort of proteins close to which a labeled protein elutes (or migrates) will be different for the two different methods. Examples of suitable pairs would be ion-exchange and reversed-phase HPLC, or reversed-phase HPLC and two-dimensional PAGE. R NA
Two quite different approaches have been used to identify sites of affinity labeling within RNA. The first consists of purifying and sequencing labeled oligonucleotides produced on full ribonuclease (usually TI) digestion of affinity-labeled RNA. Although it has been applied s u c c e s s f u l l y , 29 it suffers from the drawback that an isolated, labeled oligonucleotide may be too small to be placed uniquely in the primary structure of the long RNA chains found in ribosomal subunits, i5,94 In addition, the procedures employed for the purification and analysis of labeled oligonucleotides are quite tedious, making it difficult to carry out the large number of control experiments that are often needed to assess the significance of an affinitylabeling result. 127B. S. Cooperman, C. C. Hall, A. R. Kerlavage, C. J. Weitzmann, J. Smith, T. Hasan, and J. D. Friedlander, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 362. Springer-Verlag, New York, 1986. 12sA. R. Kerlavage and B. S. Cooperman, Biochemistry 25, 8002 (1986).
[23]
AFFINITY LABELING OF RIBOSOMES
349
The second approach is based on two steps. In the fLrst, restriction fragments of rRNA genes are used as hybridization probes of affinitylabeled rRNA. ~6,~9Use of several different restriction enzymes allows fairly rapid localization of RNA labeling to sequences of 100-200 bases in a quite general manner. Thus this step is quite suitable for the routine analysis of control experiments. In the second step, the affinity-labeled RNA is hybridized with a deoxyoligonucleotide complementary to a region of rRNA that is downstream to the 3' side of the region of rRNA labeling found to be labeled in the first step. The heteroduplex then serves as a substrate for reverse transcriptase.19 A position where reverse transcription is found to pause or halt (as determined using sequencing gels) when affinity-labeled rRNA (but not unmodified rRNA) is analyzed is considered to be a site of affinity labeling. Although this step is both conceptually more elegant and easier to perform than earlier techniques for localizing sites of affinity labeling to the individual base level, it suffers from three limitations: first, it is essentially blind at those sites of unmodified rRNA at which reverse transcriptase either halts or pauses; second, it fails to distinguish between direct and indirect effects of affinity labeling on reverse transcriptase; and third, it remains to be established that affinity labeling always leads to an inhibition of reverse transcriptase activity. An alternative second step would be to carry out total nuclease digestion analysis on the labeled rRNA of an R N A - D N A hybrid identified in the first step, since in this case both the purification and identification of the resulting labeled oligonucleotide should be straightforward.
Assessing the Significance of an Affinity-Labeling Result An affinity label may incorporate into a ribosomal component at a functionally important ligand-binding site, so that identification of that component results in a successful experiment. However, it is also possible that incorporation arises from ligand binding to nonfunctional sites on the ribosome, or to second-order reactions of portions of the ribosome with the affinity label coming from solution. Given this multiplicity of potential reactions leading to incorporation, it is clear that interpretation of the results of an affinity-labeling experiment depends critically on the outcome of experiments designed to test the functional significance of the labeling obtained. Unfortunately, insufficient attention to this point is a weakness of many of the published studies of affinity labeling on ribosomes. Two common criteria used to test for the functional significance of affinity labeling of a ribosomal component are whether such labeling proceeds via formation of an affinity label-ribosome complex, and further, whether the properties of that complex parallel those of the corre-
350
CROSS-LINKING AND AFFINITY-LABELING METHODS
[23]
sponding functional ligand-ribosome complex. For example, we determined that puromycin photoincorporation into protein L23 of E. coli ribosomes reaches a saturating value as a function of puromycin concentration and further that the KD value describing the saturation curve was similar to the KM value for puromycin in the peptidyltransferase a s s a y ) 29 In addition, we showed that structural analogs of puromycin that inhibit the peptidyl transfer to puromycin also inhibit puromycin (or an aryl azide analog of puromycin) photoincorporation into L23, and with the same relative affinity. 96:°~ Similarly, the ability of natural or synthetic poly- and oligonucleotides to inhibit the incorporation of oligonucleotide affinity labels is commonly used as a test that labeling is occurring at a functional site), 2 Another indication that affinity labeling proceeds from a functional complex can be its dependence on the presence of a third component necessary for ternary complex function. Thus, the incorporation of tRNA affinity labels has been found to be stimulated in the presence of cognate mRNA, and reciprocally, incorporation of m R N A affinity labels has been found to be stimulated by cognate tRNA.I-4 Similarly, photoincorporation of an aryl azide derivative of GTP into E. coli protein L 11 depends on the presence of EF-G) 3° Many ribosomal ligands contain one or more asymmetric centers, and it is often the case, particularly for many antibiotics, that one stereoisomer has much tighter binding to the ribosome than any other. Such stereospecifity in a ribosome-binding site can be exploited to provide evidence for functional site labeling. For example, tetracycline has a much higher quantum yield for photoincorporation into several E. coli ribosomal proteins than does its 4-epimer, and this is paralleled by its higher binding affinity to ribosomes and its higher activity as an antibiotic, l°s Similarly, the biologically active threo form of chloramphenicol is more effective at inhibiting the affinity labeling of ribosomal proteins by bromamphenicol than is the less active erythro isomer.t°4 Ribosomes isolated from antibiotic-resistant strains have also been used to test for labeling of functional sites. Thus, a bromoacetyl derivative of the antibiotic tiamulin has been shown to label proteins L27 and S 18 in ribosomes isolated from a tiamulin-sensitive strain of E. coli but not in those isolated from a resistant strain. H6 Similarly, a diazo derivative of lincomycin shows lower incorporation into ribosomes derived from a ~29E. N. Jaynes, Jr., P. G. Grant, G. Giangrande, R. Wieder, and B. S. Cooperman, Biochemistry 17, 561 (1978). tao j. A. Maasen and W. Mrller, J. Biol. Chem. 253, 2777 (1978).
[23]
AFFINITY LABELING OF RIBOSOMES
351
lincomycin-resistant strain than those derived from wild type, 2,t2° and, in a negative but unambiguous experiment, ribosomes derived from a streptomycin-resistant strain that lacks the high-affinity streptomycin site are labeled by a photolabile streptomycin derivative to the same extent as wild-type ribosomes. 2,t 13 A gain in ribosomal function as a direct result of affinity labeling provides powerful evidence that functional labeling has been achieved. Results of this kind have been reported for tRNAs cross-linked to the P-site that are still capable of donating a peptidyl (or N-acylated aminoacyl) group to a peptide acceptor such as puromycin or aminoacyl-tRNA, and for covalently bound mRNA affinity labels that stimulate cognate tRNA binding to the ribosome, t-4 A loss of function resulting from affinity labeling can alSO provide evidence for functional site labeling, although this approach is subject to the intrinsic difficulty that inhibition of function may reflect an allosteric rather than a direct effect. In addition, affinity labeling often proceeds in low yield and detection of a small population of inhibited ribosomes in the midst of a dominant population of active ribosomes can be problematic. Experiments designed to demonstrate either gain or loss of function have two further potential problems in common. First, it is not always straightforward to demonstrate unambiguously that a gain or loss in function is due to covalently incorporated affinity label rather than to material that is tightly bound noncovalenfly. For example, the procedure employed to remove a noncovalently bound affinity label, such as a high-salt wash, might result in unacceptable losses of the functional activity under investigation. Second, affinity labeling often results in the labeling of more than one component, and it may be difficult to sort out the contribution of the labeling of each component to overall effects on function. Recent advances in the application of reversed-phase high-performance liquid chromatography (RP-HPLC) to the purification of ribosomal proteins have made possible an approach that circumvents many of these problems. Thus, through use of this technique it is possible to resolve on a preparative scale an affinity-labeled protein from the corresponding unmodified protein, and to reconstitute a ribosomal subunit in which that protein is labeled stoichiometrically and all other ribosomal components are present in unmodified form. A change in the functional properties of such a subunit can thus clearly be shown to be a direct consequence of the affinity labeling of a single ribosomal protein. An example of this approach is provided by the recent work of Kerlavage et aL showing that ribosomes reconstituted with puromycin-labeled S 14 lack Phe-tRNA r~e binding activity. 128
352
CROSS-LINKING AND AFFINITY-LABELING METHODS
[23]
T h e Definition of Functional Domains
The E. coli Ribosome." The Peptidyltransferase Center The proteins most strongly implicated as being within the peptidyltransferase center of the E. coli 50S subunit are listed in Table II. As previously,2 we employ letter codes to describe the data obtained. A oneletter code identifies the method(s) of protein identification utilized, with G referring to gel electrophoresis, H to HPLC, and I to immunological. SSP refers to a demonstration of site specificity by saturation of labeling as a function of photoaffinity label concentration, with incorporation measured at the individual protein level. SSO refers to such a demonstration measured by overall labeling. Triplets beginning with F refers to evidence for functional site labeling as described by the middle letter. K refers to binding constant measurement, C to competition, T to ternary complex formation, and G or L to gain or loss of ribosomal function on affinity labeling. The third letter, O or P again describes whether evaluation is at the overall or individual protein level. Evidence obtained at the individual protein level is obviously more cogent for directly implicating a particular protein as being part of a functional center. Affinity labels directed toward the peptidyltransferase center include those containing reactive groups at the Y-end of tRNA, as well as those derived from antibiotic inhibitors of peptidyltransferase. Results with macrolide affinity labels are also included in Table II, because of the data suggesting that these antibiotics may act in the general vicinity of the peptidyltransferase center. From the collected results it is clear that of the seven proteins most strongly implicated, the strength of the evidence falls roughly in the order, LI8, L l l > L2, L15, L27 > LI6, L23. Support for the notion that this group of proteins are clustered comes from the work of Traut and colleagues TM showing there to be numerous cross-linking relationships among them, in particular L 2 - L 11, L16- L23, and L16-L27. Furthermore, protein L5, which is known to neighbor L18 (both bind to 5S RNA and their footprints on 5S RNA are proximalSS), forms cross-links with proteins L2, L11, and L23, and both L18 and L23 cross-link to L32. Immunoelectron microscopy results are also consistent in showing the mutual proximity of proteins L16, L18, and L27, of 5S RNA, and of binding sites for puromycin and chloramphenicol. 132-~35 The sites of incorporation into 23S RNA both of N"-derivatives of 13t R. R. Traut, J. M. Lambert, G. Boileau, and J. W. Kenny, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, ~s.), p. 89. University Park Press, Baltimore, Maryland, 1980. 132G. St6fller and M. St6ffier-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984).
,# B
o
=I 0 =~' ==
"~'K
o"
o
z
.I 0
;Z
o
.<
o
0
0
c#} {#,}
~4
d
0 {.. Z
0
0
0
o
~5
~4
Z
"~ 0
-
,.,,.1
E
0
0
la
ul
.~d
0 I-
d
#. .I
~8
Z 0 [.,.
e~ U3
0
0
o
o
ul 0 .1
354
CROSS-LINKING AND AFFINITY-LABELING METHODS
[23]
aminoacyl-tRNA16,'9 and of p-azidopuromycin ~27,~s have recently been localized to a limited region of 23S RNA (bases 2445-2668) and more specifically to bases 2584 and 2585 .9 and bases 2502 and 2504. ~36 Thus, affinity-labeling studies have led to the definition of a specific region of the 50S subunit that includes the peptidyltransferase center and to the identification of proteins and an RNA segment falling in that region. m R N A I n t e r a c t i o n Z o n e on 3 0 S S u b u n i t s
Experiments showing that mRNA fragments up to 40 bases long are protected from RNase digestion on complexation of mRNA with ribosomes indicate a rather large zone of interaction of mRNA and 30S subunits. The nine proteins most clearly implicated by affinity-labeling studies as lying within this zone are listed in Table III. Also included in this table for the sake of comparison are overlapping results obtained with antibiotic affinity labels having some connection with mRNA binding. Comparison of these results with those obtained using three other mapping approaches, protein-protein cross-linking, TM neutron diffraction,~37 and immunoelectron microscopy,'32 shows that while eight of the nine proteins fall within the neck portion of the 30S subunit that connects the head and body (the exception is S 14 which is clearly in the head region) they are widely spread out within this zone. The simplest interpretation of these results is that, taken as a group, the oligonudeotide and polynudeotide affinity labels incorporate into the 30S subunit over much of the 30SmRNA interaction zone. Photoaffinity-labeling studies carried out either by exploiting the natural photoreactivity of 5-carboxyrnethoxyuridine-34 of tRNA~VaP ,2s,29 or by introducing an aryl azide at this position2~,22 have led to the identification of C-1400 in 16S rRNA as being close to the anticodon loop of ribosome-bound tRNA. Furthermore, two related electron microscopy studies '3s,'39 agree in showing C- 1400 to be in the same vicinity as S18, one of the proteins listed in Table III. Thus, these two ribosomal components 133H. M. Olson, P. G. Grant, B. S. Cooperman,and D. G. G~ltz, J. Biol. Chem. 257, 2649 (1982). ~ H. M. Olson, A. W. Nicholson,B. S. Cooperman,and D. G. Glitz,J. Biol. Chem. 260, 10326 (1985). 135V. D. Vasilievand I. N. Shatsky,Soy. Sci. Rev., Sect. D 5, 141 (1984). t36C. C. Hall, D. Johnson,and B. S. Cooperman,Biochemistry 27, 3983 (1988). ,aTp. B. Moore,M. Capel,M. Kjeldgaard,and D. M. Engelman,Biophys. £ 49, 13 (1986). t3s p. Gornicki, K. Nurse, W. Hellmann,M. Boublik,and J. Ofengand,J. Biol. Chem. 259, 10493 (1984). 139M. I. Oakes,M. W. Clark,and E. Henderson,andJ. A. Lake,Proc. Natl. Acad. Sci. U.S.A. 83, 275 (1986).
[23]
AFFINITY LABELING OF RIBOSOMES
355
are prime candidates for being at the site of codon-anticodon interaction within the mRNA interaction zone. It is worth noting that C-1400 falls in an oligonudeotide that is highly conserved through evolution, and that the corresponding cytosine nucleotide is the site of native tRNA photocrosslinking in small subunit RNA from yeast, 32 Artemia salina, 3~ and spinach chloroplasts. 33 Overall tRNA Binding
Two sets of experiments directed toward determining the ribosomal proteins coming into contact with bound tRNA (in the A, P, R, or E sites 14°,~4~)have been carried out using either direct photolysis or t R N A ribosome complexes,aS-43" or photolysis of complexes derivatized at guanosine residues of tRNA with an aryl azide-containing reagent. ~-a7 The results so far obtained are not easily summarized. While each set of results is promising in the sense that different labeling patterns are obtained from tRNAs bound in different sites, taken together the two sets are disappointing in showing very little overlap with each other. Furthermore, a very large number of proteins are labeled (virtually all of the S proteins and over half of the L proteins) between the two sets of experiments. Among the least equivocal results are that $9 and L27 are in contact with tRNAs in both the A and P sites and that S 11 is in contact with tRNA in the P site. More easily interpretable results have been obtained with tRNAs made photolabile at a specific position. Thus, S 19 has been shown to be close to the 8-position o f a tRNA bound in the A site, 23,24and there is evidence that Sl0 is close to either the 32-position or the 60-position ofa tRNA bound in the P site. TM Also relevant is the finding that tetracycline, an antibiotic that specifically inhibits tRNA binding to the A site, photoincorporates in a functionally specific manner into protein $7. ~°s Protein Factors
A variety of cross-linking experiments have been carried out on 70S complexes with the translocation factor EF-G and on 30S and 50S complexes with the initiation factor IF-3. The EF-G experiments provide clear evidence that this factor binds at the subunit interface to a region including proteins L1174 and L7/L1267,6s and bases 1055- 1081 in 23S RNA 72 from the 50S subunit, and proteins $3, $4, and S1272-74 from the 30S subunit. These results are in very good accord with immunoelectron microscopic localization of the sites of EF-G binding to the 30S and 50S subunits. 66 A ~4oK. H. Nierhaus, Mol. Cell. Biol. 61, 63 (1984). ~4~A. S. Spirin, Prog. Nucleic Acid Res. Mol. Biol. 32, 75 (1985).
E
d 0
-d
•- "g~ i "S ~
r~
ga"
(~ la., 0 la.,
d [,.
! z
^~
III
g I
m
,.d <
.!
m,q
<
+ "~ ,-. la., _1 0
t5
t-
o
0
m
356
0
0
d
d
d
d
"1:I 0
,ff
d
0
o gl
0
0
o
8
o
o
d
d
d
d
d
d
d
d
d~,oo" d
o
o
o
o
o
o
o
o
o I ~ , . ~~
0
.,.Q
0
0
0
0
0
d
d
d
d
d ~m
d
d r~
{,~
o ea¢~
~
r~
357
358
CROSS-LINKING AND AFFINITY-LABELING METHODS
[(23]
total of 10 30S proteins have been found cross-linked to I F - 3 , 75,77-80,$2,83 perhaps indicating more than one site of IF-3 binding on the 30S p a r t i c l e , 77 with proteins S 11 and S 12 found in almost every study (the other proteins found are S 1- 3, 7, 13, 18, 19, 21). Recent work has also shown two sites of IF-3 cross-linking to 16S RNA, a major one falling within bases 819-859, and a minor one within bases 1506-1529. s4 Two studies have appeared describing IF-3 cross-linking to 50S subunits 76,82 and agree in identifying L2 as a cross-linked protein. The other cross-linked proteins identified by one or the other study include L5, L7/L12, L11, L17, and L27. These results have led to the suggestion that IF-3 also binds at the subunit interface,82 forming a bridge between the peptidyltransferase center of the 50S subunit and the codon-anticodon region of the 30S subunit 76 [note the overlap between the proteins cross-linked in IF-3 and those implicated in peptidyltransferase (Table I) and in mRNA binding (Table II)]. The suggested site for IF-3 binding to 30S subunits is consistent with immunoelectron microscopy results. ~a2 Work with other protein factors is much less extensive, although there is evidence that both EF-Tu 69,7~ and IF-2 s° cross-link to L7/L12. Rat Liver Ribosome
Although isolated att~nity-labeling and cross-linking experiments have been reported on ribosomes isolated from a variety of eukaryotes, including yeast,6,9,32 Drosophila, 13,~°2,m rabbit reticulocytes,63,ss hen and trout liver, ~° wheat germ, 64 Artemia salina, 3~ spinach chloroplasts, 33 and mouse L cells,6° the only eukaryotic ribosomes that have been studied extensively by these techniques are those from rat liver. Studies directed toward identification of proteins at the rat liver ribosome peptidyltransferase center have paralleled those on the E. coli ribosome in employing tRNAs derivatived at the Y-end and puromycin. The results of these studies are summarized in Table IV. ~42 Of the proteins listed in Table IV, the most strongly implicated at the peptidyltransferase center are Ll0, L23/23a, L28/29, and L36/36a. L10 is also the major protein photoattinity labeled by tetracycline)°9 which recalls the specific photosensitization of puromycin photoattinity labeling of E. coli L23 by tetracycline, n4 Some suggestion that the proteins listed in Table IV are clustered comes from the work of Ogata and his colleages~43,~44who have 142E. H. McConkey, H. Bielka, J. Gordon, S. M. Lastiek, A. Lin, K. Ogata, J.-P. Reboud, J. A. Traugh, R. R. Traut, J. R. Warner, H. Welfle, and I. G. Wool, Mol. Gen. Genet. 169, 1 (1979). ,43 T. Uchiumi, M. Kikuchi, K. Terao, and K. Ogata, J. Biol. Chem. 260, 5669 (1985). 144T. Uchiumi, M. Kikuchi, K. Terao, and IC Ogata, J. Biol. Chem. 260, 5675 (1985).
[23]
AFFINITY LABELING OF RIBOSOMES
359
TABLE IV PROTEINS MOST STRONGLY IMPLICATED AT THE PEPTIDYLTRANSFERASE CENTER OF RAT LIVER RIBOSOMESa
Ligand Y-end tRNA
L proteinb L5 L7/7a L 10 L21 L23/23a L28/29 L32/33 L36/36a
Electrophilic (8, 11, 14) +, FCO +, FCO (+), FCO +, FTP +, FTP (+), FTP +, FTP +, FTP, FCO
Puromycin
Photolabile (17)
Electrophilic (93)
Photolabile or photoinduced (99, 103)
(+), FCO +, FLO, FKP
+, F'TP (+), FTP +
+, FCO
°Abbreviations used are the same as in Table II. +, major labeled protein, (+) minor labeled protein. Reference numbers given in parentheses. bAccording to proposed standard numbering systems, 142 which does not correspond to that used for E. coli ribosomal proteins. All identifications are by PAGE analysis.
found the following cross-links: L5-L10, L7/7a-L23a, L7/7a-L28, L7/ 7a-L29, L7/7a-L32, L7/7a-L36, L21-L29, L28/L32, and L29/L32. In addition, both L7/7a and L5 form cross-hnks with L3. Several affinity-labeling and cross-linking studies have been directed toward sites on the 40S subunit, as summarized in Table V. These and related protein-protein cross-linking studies 145 have led Bielka l~s to propose a model in which mRNA and the initiation factors are closely associated with proteins $3, S3a, $6, and $26 in a limited region shown by immunoelectron microscopy studies to lie in the cleft between the head and body of the 40S subunit. Other studies also indicate that this region forms part of the interface between the 40S and 60S subunits. There is thus a striking similarity between the general location of the mRNA interaction zone on the 40S subunit of rat liver ribosomes and on the 30S subunit of E. coli ribosomes. Another apparent similarity between E. coli and rat liver ribosomes concerns the binding site for the protein factor catalyzing translocation. m4sD. R. Tolan and R. R. Traut, J. Biol. Chem. 256, 10129 (1981). 146H. Bielka, Prog. Nucleic Acid Res. Mol. Biol. 32, 267 (1985).
÷ + + + + +
+
~c
+
o
+
o ~Q r~
-I-+ [..
+-I-
+
+
!°
go
o=± +
-o
J~
(J
z ~Q ~Q
o U~
,t
<
~
~÷
~
÷+
÷
÷
~Q
++~++÷
"o
~
0
~
~
.,.~
0
~'~,
o
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
361
Like the prokaryotic factor EF-G, the eukaryotic factor EF-2 has been shown to cross-link to both large and small subunit proteins, thus providing evidence for its location at the subunit interface. Further strengthening the case for similarity are the identities of the cross-linked proteins, s9 Thus, EF-2 cross-links to P2, a large subunit protein that is structurally homologous to E. coli L7/LI2, as well as to $6 and $23/24, which are small subunit proteins that are strongly implicated in mRNA and/or initiation factor binding (Table V). As noted above, EF-G cross-links to E. coli proteins L7/L12 as well as to $3, $4, and S12, three proteins that are likewise implicated in mRNA (Table III) and/or initiation factor binding.
[24] Photoaflinity Labeling of Peptidyltransferase By ERNST KUECHLER, GONTER STEINER, and ANDREA BARTA Introduction Peptidyltransferase - - the enzyme catalyzing peptide bond formation - - i s located on the large subunit of the ribosome. Various approaches have been used to identify components of the peptidyltransferase. One of the most widely used techniques is affinity labeling, a method frequently applied to characterize the active site of an enzyme. Substances known to have high affinities for the peptidyltransferase such as tRNAs or some antibiotics are chemically modified. Following binding to the ribosome a covalent bond can be formed to a nearby ribosomal component. In photoaffinity labeling, residues are employed which are converted into a photoreactive form upon irradiation. The advantage of this technique is the fact that the derivative is bound in an unreactive form. Photoactivation is carried out after completion of the binding step. Therefore no side reactions can take place during intermediate stages of the binding process. Since the photoactivated state is usually short-lived, the duration of the reaction is determined by the time of irradiation. Previously, we were able to show that the photoreactive aromatic ketone derivative 3-(4'-benzoylphenyl)propionyl-Phe-tRNA (BP-Phe-tRNA) can react both with proteins and with nucleotides.l-3 Irradiation at 320 nm A. Barta, E. Kuechler, C. Branlant, J. Sri Widada, A. Krol, and J. P. Ebel, FEBS Lett. 56, 170 (1975). 2 A. Barta and E. Kuechler, FEBSLett. 163, 319 (1983). 3 A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 0984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by A,-~4emicPress,Inc. All rightsof reproductionin any formret~rved.
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
361
Like the prokaryotic factor EF-G, the eukaryotic factor EF-2 has been shown to cross-link to both large and small subunit proteins, thus providing evidence for its location at the subunit interface. Further strengthening the case for similarity are the identities of the cross-linked proteins, s9 Thus, EF-2 cross-links to P2, a large subunit protein that is structurally homologous to E. coli L7/LI2, as well as to $6 and $23/24, which are small subunit proteins that are strongly implicated in mRNA and/or initiation factor binding (Table V). As noted above, EF-G cross-links to E. coli proteins L7/L12 as well as to $3, $4, and S12, three proteins that are likewise implicated in mRNA (Table III) and/or initiation factor binding.
[24] Photoaflinity Labeling of Peptidyltransferase By ERNST KUECHLER, GONTER STEINER, and ANDREA BARTA Introduction Peptidyltransferase - - the enzyme catalyzing peptide bond formation - - i s located on the large subunit of the ribosome. Various approaches have been used to identify components of the peptidyltransferase. One of the most widely used techniques is affinity labeling, a method frequently applied to characterize the active site of an enzyme. Substances known to have high affinities for the peptidyltransferase such as tRNAs or some antibiotics are chemically modified. Following binding to the ribosome a covalent bond can be formed to a nearby ribosomal component. In photoaffinity labeling, residues are employed which are converted into a photoreactive form upon irradiation. The advantage of this technique is the fact that the derivative is bound in an unreactive form. Photoactivation is carried out after completion of the binding step. Therefore no side reactions can take place during intermediate stages of the binding process. Since the photoactivated state is usually short-lived, the duration of the reaction is determined by the time of irradiation. Previously, we were able to show that the photoreactive aromatic ketone derivative 3-(4'-benzoylphenyl)propionyl-Phe-tRNA (BP-Phe-tRNA) can react both with proteins and with nucleotides.l-3 Irradiation at 320 nm A. Barta, E. Kuechler, C. Branlant, J. Sri Widada, A. Krol, and J. P. Ebel, FEBS Lett. 56, 170 (1975). 2 A. Barta and E. Kuechler, FEBSLett. 163, 319 (1983). 3 A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 0984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by A,-~4emicPress,Inc. All rightsof reproductionin any formret~rved.
362
CROSS-LINKING AND AFFINITY-LABELINGMETHODS
[24]
activates the lone electron pair of the carbonyl group which subsequently is converted into an intermediate triplet state. The mechanism of reaction of the photoactivated aromatic carbonyl group as well as the details of the synthesis of BP-Phe-tRNA have been described in detail. 4 BP-Phe-tRNA binds to the ribosome-labeled 23S RNA with high yield as compared to various other photoreactive derivatives of aminoacyl-tRNA described in the literature. ~ Since 23S RNA was the primary target of correctly bound BP-Phe-tRNA, it was concluded that the labeled region of 23S RNA constitutes an important component of the peptidyltransferase. Support for this hypothesis came from experiments of other authors, who showed that aminoacyl-tRNAs modified in a similar manner with other highly reactive photoreagents also preferentially labeled 23S RNA. 5 However, in none of these experiments has the site of labeling on 23S RNA been identified unambiguously. In our case, fragmentation of photoaffinity-labeled 23S RNA using limited digestion with ribonuclease A localized the site of reaction to an 11S fragment comprising the 3'-proximal 1100 nucleotides of 23S RNA. 2 All attempts to identify the site of reaction directly by further digestion of the labeled 23S RNA and by subsequent isolation of smaller oligonucleotides have failed. It was therefore necessary to develop an alternative strategy in order to characterize the nucleotide sequence(s) involved. The first approach uses hybridization of labeled 23S RNA to isolated rDNA fragments. Specific restriction fragments are obtained from plasmid pKK123, which contains the 3' two-thirds of the 23S RNA gene from the rrnB operon (kindly provided by H. Noller, USC, Santa Cruz, CA). These fragments are separated electrophoretically on an agarose gel, blotted onto nitrocellulose, and hybridized to 23S RNA photoaffinity-labeled with Bp-[3H]Phe-tRNA. After digestion of the unhybridized parts of the RNA with ribonuclease, only hybrids with affinity-labeled radioactive RNA are visible on an autoradiograph. By this method it was possible to localize the site of reaction within an 183-base fragment. The second approach makes use of the fact that reverse transcriptase pauses or stops one base before a modified nudeotide. 6 The photoaflinity probe cross-linked to a nucleotide of 23S RNA can be expected to act as a barrier for the enzyme. The site of reaction can therefore be determined exactly from the size of the reverse transcription products. Using this 4 E. Kuechlerand A. Barta, this series, Vol. 46, p. 676. 5E. Kuechler and J. Ofengand, in "Transfer RNA: Structure, Properties and Recognition" (P. R. Schimmel, D. $611,and J. N. Abelson,eds.), p. 413. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1979. 6 D. C. Youvan and J. E. Hearst, Proc. Natl. Acad. Sci. U.S.A. 76, 3751 (1979).
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
363
reverse transcription assay, we were able to identify the nucleotides involved in the photoreaction within the 183-base region. Photoattinity Labeling of 23S R N A Preparation and Purification of 3-(4'-Benzoylphenyl)propionyl-[3H]Phe tRNA tRNA ~e from yeast (Boehringer, Mannheim) is charged with [3H]phenylalanine (70- 110 Ci/mmol, Amersham) and the reaction with 3-(4'-benzoylphenyl)propionic acid-N-hydroxysuccinimide ester is carried out as described previously.4 The yield of the reaction is checked by hydrolysis of a small aliquot in 0.35 M triethylamine for 1 hr at 37 ° followed by thin-layer chromatography on a silica plate (Polygram SIL G, Macherey & Nagel, Diiren) using benzene-pyridine-glacial acetic acid (70/30/3, v/v) as a solvent. Rf of 3-(4'-benzoylphenyl)propionylphenylalanine is 0.4; phenylalanine does not migrate in this system. BP-Phe-tRNA is further purified by chromatography on BD-cellulose. BP-Phe-tRNA is dissolved in 0.3 MNaC1, 10 mMsodium acetate, pH 5, 10 mMMgC12 and layered on to a small BD-cellulose column. Stepwise elution is carried out in buffer containing 1 M NaC1, followed by 1 M NaC1, 10% ethanol, and finally 1 M NaC1, 30% ethanol. Purified BP-Phe-tRNA is eluted in the last step andis precipitated with ethanol. Specific Binding of BP-Phe-tRNA to the Ribosomal P- and A-sites 70S ribosomes obtained from E. coli strain MRE 600 are prepared according to the procedure of Noll et al. 7 Incubations are carded out in volumes of 0.5 - 1 ml. For specific P-site binding the total mixture contains in 1 ml: 250pmol E. coli ribosomes, 0.1 mg poly(U), 100pmol Bp-[aH]Phe-tRNA in buffer containing 100 m M KC1, 20 m M Tris-HC1, pH 7.4, 6 m M MgC12, 0.2 m M ethylenediaminetetraacetic acid (EDTA), and 1 m M dithioerythritol. Incubation is for 10 min at 25 °. The incubation mixture for A-site binding contains in 1 ml: 250 pmol E. coli ribosomes, 0.1 mg poly(U), 750 pmol tRNA ~ in buffer containing 100 m M KC1, 20 mMTris-HC1, pH 7.4, 10 mMMgC12, 0.2 mMEDTA, and 1 m M dithioerythritol. The solution is preincubated for 3 min at 37 °. Subsequently, 100 pmol of BP-[3H]Phe-tRNA is added and the solution is incubated for 10 min at 25*. Correct binding to either P- or A-site is checked by incubation with 1 m M puromyein for 20 min at 25 °. In order 7 M. Noll, B. Hapke, M. H. Schreier, and H. Noll, J. Mol. Biol. 75, 281 (1973).
364
CROSS-LINKING AND AFFINITY-LABELING METHODS
[24]
TABLE I BINDINGOF BP-[3H]Phe-tRNA TO RIBOSOMESa
Nucleotide -- Poly(U) +Poly(U) +Poly(U), + puromycin
P-site conditions (cpm)
A-site conditions (clam)
21,000 195,000
52,000 167,000
45,000
125,000
This assay was carried out with 10 pmol ribosomes and 4 pmol BP-[3H]Phe-tRNA (360,000 clam).
to determine the extent of binding of BP-[3H]Phe-tRNA to ribosomes, chromatography on Sepharose 6B is carried out. The falter assay usually employed cannot be used in this system because of the high background due to the intrinsically high affinity of BP-Phe-tRNA for binding to nitrocellulose filters. Twenty microliters of the incubation mixture is layered on an 8 X 0.5 cm Sepharose-6B column and eluted with the binding buffer. Fractions are collected and the radioactivity is determined in a scintillation counter. Fifty to 60% of the BP-[3H]Phe-tRNA is found to be bound to ribosomal complexes eluted with the void volume. Under P-site conditions about 80% of the bound BP-[3H]Phe-tRNA reacts with puromycin; under A-site conditions less than 20% reacts (Table I).
Conditions of the Photoreaction The UV apparatus as well as the conditions of irradiation have been described in detail before.4 A super-high-pressure mercury lamp, Philips Type SP 500 watt, is used as a light source. Light below 300 nm is removed by use ofa WG 320 cutoff filter, thickness 2 mm, diameter 50 mm (Sehott & Gen., Mainz, GFR). High-quality safety goggles must be worn during irradiation. The yield of the photoreaction is determined by phenol extraction of the RNA followed by chromatography on a Sepharose 6B column. Usually 10- 15% of the 23S RNA is found to contain the label, incorporated after 20 min of irradiation. The kinetics of the photoreaction are shown in Fig. 1.
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
100 800 ~3 0 n"
604020
•
365
.L
f I
2o
I
;o "rime
I
6'o
I
8'o
(rain)
Fla. 1. Kinetics of the photoreaction. Aliquots of the incubation mixture were taken alter 1, 2, 5, 10, 20, 40, and 80 rain, extracted twice w i ~ phenol, and the yield o f ~ e photoreaetion determined by Sepharose 6B column chromatography as described in the text. The maximum value is arbitrarily taken as 100%.
Identification of the Affinity-Labeled Nucleotides
Preparation of Plasmid DNA Plasmid pKK123 was used to transform E. coli HB 101. The plasmid contains part of the 23S rRNA gene integrated between an EcoRI and a BamHI site and an ampicillin-resistance gene serving as a genetic marker3 Transformation is carried out as described. 9 Briefly, competent E. coli HBI01 are incubated with up to 40 ng plasmid DNA in 200/zl of buffer containing 150 m M KCI, 1 m M TrisHC1, pH 7.5, 50 m M CaCI2, 2.5 m M MgC12 for 1 hr at 0 °. After heating for 90 sec to 42 °, 2 ml of the same buffer is added and the incubation continued for 1 hr at 37 °. The bacteria are subsequently plated on agar plates containing 100/zg/ml of ampicillin. Amp R colonies are isolated and minipreps are prepared to check for positive transformants. Transformants are allowed to grow in LB-medium containing 100/zg/ml of ampicillin to mid-log phase. Chloramphenicol, 100/zg/ml, is added and incubation continued overnight at 37 °. The bacteria are harvested and plasmid DNA is S j. Brosius, A. Ullrich, M. A. Raker, A. Gray, T. J. Dull, R. R. Gutell, and H. F. Noller, Plasmid6, 112 (1981). 9 T. Maniatis, E. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982.
366
CROSS-LINKING AND AFFINITY-LABELING METHODS
[24]
prepared? Following precipitation with 2-propanol, the DNA pellet (containing contaminating cellular RNA) is washed several times with 100 m M Tris-HC1, pH 7.5, 70% ethanol and dried briefly in a desiccator. The pellet is then dissolved in 10 m M Tris-HC1, pH 7.4, 1 mMEDTA. Thirty micrograms of ribonuclease A and 20 #g ribonuclease T~ are added and the mixture is incubated for 1 hr at 37 °. It is subsequently extracted twice with phenol-chloroform. After precipitation with ethanol, the plasmid DNA is purified by gel chromatography on a Sephacryl S-1000 column. The yield is up to 1 mg of DNA per liter of culture.
Southern Blotting The DNA fragment of pKK123 containing the region of 23S RNA corresponding to the sequence between nucleotide 843 and the Y-terminus of 23S RNA together with the 5S RNA gene can be isolated on a 3-kb fragment by digestion with EcoRI and BamHI. Following digestion of 1 mg of plasmid DNA with 1000 units of EcoRI and 300 units of BamHI in 4 ml of buffer containing 150 m M NaC1, 10 m M Tris-HCl, pH 7.5, 6 m M MgC12, and 1 m M dithioerythritol, the DNA is precipitated with ethanol, redissolved in 0.4 ml of 10 m M Tris-HC1, pH 7.4, 1 m M EDTA, and centrifuged in a SW40 Beckman rotor on a 5-20% sucrose gradient containing 1 M NaCI, 25 m M Tris-HC1, pH 8, 1 m M EDTA at 36,000 rpm for 17 hr. The fractions corresponding to the 3-kb fragment are pooled, precipitated with ethanol, washed, dried in a desiccator, and stored at - 2 0 ° . The EcoRI-BamHI fragment is further digested separately with surfable restriction enzymes, e.g., HinfI, HaeIII, HpaII, and CfoI, using 10 gg of DNA in each incubation, and the resulting fragments are separated on a 2% agarose gel. Transfer of the DNA bands on to a nitrocellulose filter is performed as described by Southern. ~° The filter is then incubated in a buffer containing 50% formamide, 5 × SSC (1 × SSC: 150 m M NaCI, 15 m M sodium citrate, pH 7), 50 m M sodium phosphate, pH 6.5, 0.2% sodium dodecyl-sulfate (SDS), 5 × Denhardt's solution, 0.1 mg/ml of tRNA, and 0.05 mg/ml of denatured salmon sperm DNA with 80 #g (1.25 × 106 cpm) of photoaffinity 3H-labeled 23S RNA (heated briefly at 96 °) for 2 days at 42 °. The filter is washed three times with 2X SSC and twice with 0.1 X SSC for 20 min each, and subsequently incubated for 30 min at 37 ° with 100 gg/ml ribonuclease A in 2 × SSC in order to release unhybridized RNA. The filter is then washed successively twice with 0.1 × SSC, 0.1% SDS, once with 0.1× SSC, and twice with 0.1× SSC, 25% to E. M. Southern, J. Mol. Biol. 58, 503 (1975).
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
367
ethanol and dried. In order to visualize the 3H-labeled bands, the filter is placed for a few minutes in 1 M sodium salicylate, dried, and exposed for approximately 4 weeks at - 7 0 * to a preflashed Kodak XAR-5 film. From the size of the hybridizing fragments and from the known sequence of 23S RNA the position of the labeled region within 23S RNA can be deduced. The site of the photoaflinity labeling is therefore located between nucleotides 2442 and 2625 of the 23S RNA (Fig. 2). m
.--
Q.
w u
® OI
1821 --- i
431 •e . -
b
264 --
1821 bp 431 o r 4 2 4 b p
"i
Hinf I
- - 224
)
2004
24~14
Hae 1111983
224 bp
Hpa II
2 6 4 bp
Cfo I
23S RNA
or
424
2838
244?4
238,
!
2688
F62,
1I . " . ! l 24421 1 2 6 2 6
_32904
SITE OF CROSS-LINK FIG. 2. Southern blot analysis of 23S RNA afffinity-labeled with BP-[3H]Phe-tRNA. In the upper part of Fig. 2 the autoradiograph of a Southern blot is shown. The sizes of the DNA fragments hybridized to affinity-labeled 23S RNA are indicated. The site of the cross-link can be localized by comparing the 3H-labeled D N A - R N A hybrids as demonstrated in the diagram in the lower part of Fig. 2.
368
CROSS*LINKING AND AFFINITY-LABELING METHODS
[24]
Primer Extension with Reverse Transcriptase In order to identify the precise position of the photoaffinity-labeled nucleotide, a short restriction fragment downstream of nucleotide 2625 is used as a primer for reverse transcription. At first a 1821-bp HinfI fragment is isolated from pKK123. This fragment comprises 900 nucleotides from the Y-end of the 23S rRNA gene (see Fig. 2). One milligram of plasmid DNA is digested with 60 units HinfI in 1 ml of buffer containing 100 mMNaC1, 10 mMTris-HC1, pH 7.5, 6 mMMgC12, and 1 mMdithioerythritol. Following digestion, the longest fragment is isolated by electrophoresis on a 1.5% agarose gel in 200 m M NaC1, 40 m M Tris-acetate, pH 8.2, 2 m M EDTA for 1.5 hr at 60 V. The slowest migrating band as visualized by staining with ethidium bromide is cut out and the DNA recovered by electroelution. The solution is extracted with phenol and the DNA is precipitated. In order to remove gel material completely, chromatography on a BioGel P-30 column (8 × 0.5 cm) in 10 m M Tris-HC1, pH 7.4, 1 m M EDTA is performed. From the 1821-bp HinfI fragment, a 124-bp HpalI fragment corresponding to positions 2715 to 2839 is isolated. It is treated with bacterial alkaline phosphatase in 100 m M Tris-HC1, pH 8, and the mixture is incubated for 2 hr at 65 °. After phenol extraction, the DNA is precipitated with ethanol. The restriction fragment is then purified by electrophoresis on a 10% polyacrylamide gel in 50 m M Tris-borate, pH 8.3, 0.5 m M EDTA at 150 V for 1.5 hr. After staining with ethidium bromide (1/zg/ ml), the DNA is electroeluted and precipitated with ethanol. The fragment is subsequently 5'-labeled using polynudeotide kinase and [7-32p]ATP (5000 Ci/mmol).U The DNA fragment is further purified by chromatography on a BioGel P-30 column. Similarly, a 56-bp AvaII fragment corresponding to nucleotides 2607 to 2663 of 23S RNA can be isolated and 5'-labeled with [7-32p]ATP. In order to prepare single-stranded DNA, the 5'-32p-labeled restriction fragments are dissolved in 30 #1 of a solution containing 30% dimethyl sulfoxide, 1 m M EDTA and heated for 1 min at 96 °. After rapid cooling to 0 °, strand separation is carried out on a 10% polyacrylamide gel for the 124-nucleotide HpalI fragment and on a 16% polyacrylamide gel for the 56-nucleotide Avail fragment (acrylamide/ bisacrylamide--59/1). Electrophoresis is carried out on 30-em gels at 150 V in 100 m M Tris-borate, pH 8.3, 1 m M EDTA until the xylene cyanole marker has reached the bottom of the gel (about 15 hr). The gel is exposed to an X-ray film for a few minutes, the bands are cut out, and the " P. K. Gosh, V. B. Reddy, M. Piatak, P. Lebowitz, and S. M. Weissman, this series, Vol. 65, p. 580.
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
369
DNA is extracted by diffusion, because single-stranded DNA adsorbs to dialysis bags during electroelution.~2 Complementary strands are identified by their ability to prime transcription on 23S RNA. Photoaffinity-labeled 23S RNA, 0.6 pg, is incubated with an equimolar amount of 5'-a2p-labeled single-stranded primer in 10 pl of 40 m M KCI, 25 m M Tris-HC1, pH 8.3, 5 m M MgCI2 for 15 min at 65 °. The solution is allowed to cool to room temperature. Subsequently 10 gl of the same buffer containing 1 m M each of dATP, dGTP, dCTP, and dTTP and 10 units of aviam myeloblastosis virsus (AMV) reverse transcriptase (provided by J. Beard, Life Sciences, St. Petersburg, FL) is added and the mixture is incubated for 1 hr at 42 °. Twenty microliters of 0.2 M NaOH, 0.025 M EDTA is added, the mixture is incubated for 5 min at 96 °, cooled, and neutralized by addition of 0.2 M HC1. After precipitation with ethanol for 30 min at - 7 0 °, the pellet is washed once with 70% ethanol and dried briefly. It is dissolved in 5 gl of sequencing buffer containing 100 m M Tris-borate, pH 8.3, 1 m M EDTA, 80% formamide, and 0.05% each of xylene cyanole and bromphenol blue, heated for 2 min at 96 °, and cooled on ice. Three microliters is layered on to a 7% denaturing sequencing gel. Electrophoresis is carried out in sequencing buffer at 50 W for 2 hr 20 min when using the 56-nucleotide AvaII primer. Electrophoresis time is increased to 4 hr when the 124-nucleotide HpaII primer is employed. In order to identify bands obtained in the primer extension experiment, dideoxynucleotide sequencing reactions are run in parallel. ~3 The same 32p-labeled primers are used on unmodified 23S. RNA as template. A reaction mixture is prepared as described above except that reverse transcriptase and the four dNTPs are mixed in the cold and the mixture is divided into five aliquots. To each of four aliquots one of the four ddNTPs is added, respectively, the fifth aliquot serving as a control. The concentrations are 0.5 m M for ddATP, ddGTP, and ddTTP and 0.25 m M for ddCTP. The final volume of the incubation mixture is 20 pl. Samples are incubated and subjected to gel electrophoresis as described above. Gels are fixed by soaking in 10% methanol, 10% acetic acid for 30 rain, carefully transferred from the glass plate to a large sheet of Whatman 3 MM filter paper, dried for 40 min at 80 ° on a gel drier, and exposed to Kodak XAR-5 film. As shown in Fig. 3, bands obtained in a primer extension experiment using photoaffinity-labeled 23S RNA as a template can be correlated with bands in the sequencing tracks. According to the sequence the bands are caused by stops at uridine (U)-2585 and U-2586. The sites of photoalfinity z2 A. Maxam and W. Gilbert, this series, Vol. 65, p. 499. 13 F. Sanger, S. Nicklen, and A. R. Coulsen, Proc. Natl. Acad. Sci. U.S.A. 74, 5463 (1977).
370
CROSS-LINKING AND AFFINITY-LABELING METHODS
[24]
>>
CUA
G
, +
...U-2585 "U-2586
--Primer FIG. 3. Primer extension analysis and sequencing of 23S RNA. Lanes labeled C, U, A, and G refer to the 23S RNA sequence, - U V designates the control reverse transcription on nonirradiated RNA, ÷ UV reverse transcription on alfinity-labeled RNA. Stops due to at~nity labeling occurred at the nucleotides indicated. A 56-base Avail fragment corresponding to positions 2607-2663 on 23S RNA was used as a primer.
[24]
PHOTOAFFINITY LABELINGOF 23S RNA
371
labeling are therefore assigned to U-2584 and U-2585. Bands also visible in the nonirradiated control are presumably due to stops of reverse transcription caused by higher order structures of 23S RNA. Comments Oligonucleotide analysis is usually employed for identifying regions of RNA which have been modified in cross-linking experiments. However, the peculiar properties of the nucleotides modified by the aromatic ketone derivative made it impossible to isolate an oligonucleotide of sufficient length in pure form. As an alternative, we used the method of D N A - RNA hybridization for Southern blot analysis. From the pattern of hybridizing fragments we were able to localize the site of reaction to a 183-nucleotide sequence. The technique of primer extension as a way of identifying the site of reaction on a RNA molecule is based on the observation that reverse transcriptase stops one nucleotide before encountering a modified base on the RNA template. 6 An aminoacyl-tRNA attached to 23S RNA via a benzophenone-propionic acid residue will act as a barrier for reverse transcriptase, thereby generating cDNA strands of defined length. Stops in reverse transcription caused by regions of high secondary and/or tertiary structure can be corrected for by a control experiment using unmodified 23S RNA as a template. The site of cross-linking is determined by comparison with the pattern obtained in dideoxynucleotide-sequencing reactions run in parallel. Since the template RNA is read in the 3' to 5' direction during reverse transcription, the nucleotide in 23S RNA immediately preceding the stop position should be the site of reaction of the photoaffinity label. In this way U-2584 and U-2585 of 23S RNA were identified as being located at the peptidyltransferase. According to the secondary structure model of 23S RNA these residues are located within the central loop of domain V) 4 The sequence around this site has been strongly conserved in evolution. It is close to the sites of several point mutations leading to chloramphenicol and erythromycin resistance in 23S-like rRNAs. 3 Taken together, these data provide strong evidence that this region of 23S RNA is an integral component of the peptidyltransferase. The method described is generally useful for identifying sites of modifications on RNAs. These include chemical and UV cross-links between R N A - R N A and RNA-protein as well as sites of attachment of various affinity and photoaflinity probes. Furthermore, the method can be ex~4H. F. Noller,Annu.
Rev. Biochem.
53, 119 (1984).
372
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
tended to investigate the secondary and tertiary structures of RNAs employing chemicals known to modify nucleotides, e.g., kethoxal, dimethyl sulfate or diethyl pyrocarbonate. If a suitable set of primers is available, even very large RNA molecules can be screened in a short time.
[25] Affinity Labeling of tRNA-Binding Ribosomes
Sites on
B y JAMES OFENGAND, ROBERT DENMAN, KELVIN NURSE, ARNOLD LIEBMAN, DAVID MALAREK, ANTONINO FOCELLA, and GLADYS ZENCHOFF
I. Principle The use of tRNA derivatized with a chemically or photochemicaUy reactive group to study the topography of tRNA-binding sites on ribosomes is a logical outgrowth of the use of modified small substrate ligands to label proteins. However, the tRNA-ribosome system has several advantages. First, tRNA is about one-third the size of its receptor ribosome. Consequently, varying the location of the probe on the tRNA molecule can provide considerably more insight about its orientation with respect to the ribosomal surface than when small ligands are bound to receptors. Second, in contrast to small-molecule affinity probes where changes in orientation or flexibility of the reactive group are important, tRNA because of its larger size is less susceptible to movement of the attached probe. Indeed, mobility of the probe attached to the firmly bound tRNA may be beneficial in that a more complete survey of the ribosomal surface within range may be obtained. Third, since binding o f t R N A to the ribosome requires mRNA, and in the case of the A site, EF-Tu or EF-1 as well, the dependence of cross-linking on these added components readily controls for nonspecific and nonphysiological cross-links. The presence of a variety of naturally occurring modified bases at defined sites in tRNA makes it possible to place affinity probes at single specific sites in almost any part of the tRNA three-dimensional structure. The reactive groups available include the carboxyl group (3-(3-amino-3carboxypropyl)uridine (acp3U), uridine 5-oxyacetic acid (cmoSU), N-[(9fl-D-ribofuranosylpurin-6-yl)carbamoyl]threonine (teA), and derivatives), the aliphatic amino group (acp3U), and thiol groups from thioketones [4-thiouridine (s4U), 2-thiocytidine (s2C), 2-thiouridine (s2U), and derivatives]. In addition, vicinal hydroxyl groups present at the Y-end of unaMETHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by A~ldemicPress,Inc. Allrightsofreprodu~ionin any formreserved.
372
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
tended to investigate the secondary and tertiary structures of RNAs employing chemicals known to modify nucleotides, e.g., kethoxal, dimethyl sulfate or diethyl pyrocarbonate. If a suitable set of primers is available, even very large RNA molecules can be screened in a short time.
[25] Affinity Labeling of tRNA-Binding Ribosomes
Sites on
B y JAMES OFENGAND, ROBERT DENMAN, KELVIN NURSE, ARNOLD LIEBMAN, DAVID MALAREK, ANTONINO FOCELLA, and GLADYS ZENCHOFF
I. Principle The use of tRNA derivatized with a chemically or photochemicaUy reactive group to study the topography of tRNA-binding sites on ribosomes is a logical outgrowth of the use of modified small substrate ligands to label proteins. However, the tRNA-ribosome system has several advantages. First, tRNA is about one-third the size of its receptor ribosome. Consequently, varying the location of the probe on the tRNA molecule can provide considerably more insight about its orientation with respect to the ribosomal surface than when small ligands are bound to receptors. Second, in contrast to small-molecule affinity probes where changes in orientation or flexibility of the reactive group are important, tRNA because of its larger size is less susceptible to movement of the attached probe. Indeed, mobility of the probe attached to the firmly bound tRNA may be beneficial in that a more complete survey of the ribosomal surface within range may be obtained. Third, since binding o f t R N A to the ribosome requires mRNA, and in the case of the A site, EF-Tu or EF-1 as well, the dependence of cross-linking on these added components readily controls for nonspecific and nonphysiological cross-links. The presence of a variety of naturally occurring modified bases at defined sites in tRNA makes it possible to place affinity probes at single specific sites in almost any part of the tRNA three-dimensional structure. The reactive groups available include the carboxyl group (3-(3-amino-3carboxypropyl)uridine (acp3U), uridine 5-oxyacetic acid (cmoSU), N-[(9fl-D-ribofuranosylpurin-6-yl)carbamoyl]threonine (teA), and derivatives), the aliphatic amino group (acp3U), and thiol groups from thioketones [4-thiouridine (s4U), 2-thiocytidine (s2C), 2-thiouridine (s2U), and derivatives]. In addition, vicinal hydroxyl groups present at the Y-end of unaMETHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by A~ldemicPress,Inc. Allrightsofreprodu~ionin any formreserved.
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
373
minoacylated tRNA or in queuosine and its derivatives are available for modification after periodate cleavage. The focus of this article will be on methods for attaching affinity probes to carboxyl, amino, and mercapto groups using as archetypical examples, s4U-8 in Escherichia coli tRNA v*', and tRNA l~e, acp3U-47 in E. coli tRNA ~ , and uridine 5-oxyacetic acid (cmoSU)-34 in E. coli tRNA v*'~. In addition, procedures for the covalent cross-linking of cmoSU-34 to C-1400 of 16S rRNA via cyclobutane dimer formation will be described. For ribosome affinity labeling, it is desirable to have a way to visualize the site of cross-linking by electron microscopy. Use of the 2,4-dinitrophenyl (DNP) or biotin groups for this purpose will be described. These groups can be visualized after complexation with anti-DNP antibody or streptavidin, respectively. They also make possible, by dimer formation, the purification of cross-linked complexes from non-cross-linked ones. Since photoaffinity labeling with aryl azides typically gives yields in the 5 - 15% range, the availability of such a purification step is a major advantage. II. The Affinity Probes
A. Thioketone Reagents The structures of the probes after reaction with s4U are shown in Fig. 1A. 1. p-Azidophenacyl Bromide (APA-Br). The unlabeled form is available commercially (Pierce Chemical Co., Cat. #20106). Preparation of the 14C-labeled version has been described in a previous volume of this series) 2. p-Azidophenacyl Bromoacetate (APAA-Br) and Its Iodo Analog (APAA-I). Preparation of unlabeled, carbonyl-~4C, and 2-~4C-labeled versions have been described previously.
B. Amino Group Reagents The structures of NAK and NAG after reaction with acpaU are shown in Fig. lB. 1. N-Hydroxysuccinimide Ester of N-(4-Azido-2-nitrophenyl)glycine (NAG-SuNO). The preparation of both labeled and unlabeled versions of this compound has been described previously) 2. N-Hydroxysuccinimide Ester of 6-(2-Nitro-4-azidophenylamino) caproate (NAK-SuNO). The unlabeled form is available commercially J. Ofengand, I. Schwartz, G. Chinali, S. S. Hixson, and S. H. Hixson, this series, Vol. 46, p. 683.
374
CROSS-LINKING AND AFFINITY-LABELING METHODS
/
/1:;"
A
,]
B
[ .~.\. "J',:
o
~'-N~ '° 0
/
o c/o
<xJ
:
0
o<
/ 3."
o o*'\./
1,
0 NAK- ocp3U
0
[25]
5
20
-'
I
Ri
FI~. 1. Structures of some at~nity probes derivatized with minor bases. (A) APA-s4U (solid line) and APAA-¢U (dashed line); (B) NAK and NAG derivatives ofacp3U. The arrow shows the point of binding of the probe m the pyrimidine base.
(Pierce Chemical Co., Cat. #22588). The radioactive form is prepared as follows, using sodium p4C]cyanide as the source of label. 5-[cyano-14C]Pentanoic acid. 2 A 234 mg (4.6 mmol) sample of sodium [14C]cyanide (58 mCi/mmol, 266 mCi) is placed in a small-volume stainless-steel autoclave along with 690 mg (6.9 mmol) of ~-valerolactone. The autoclave is purged with nitrogen gas, sealed, and placed in an oven maintained at 300 ° for 90 min. After cooling, the contents of the autoclave are washed with a total of 100 ml water through a coarse sintered glass funnel into a separatory funnel. The pH is raised to 8.5 by the addition of 0.5 ml of 1 N sodium hydroxide solution and 10 ml of brine (saturated NaCI solution) is added. The resulting solution is extracted with two 50-ml portions of ether, acidified with 2 ml of 6 N hydrochloric acid to pH 2, and extracted with four 25-ml portions of dichloromethane which are combined, washed with 25 ml of brine, dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo to a residual oil. Partial purification by molecular distillation at 150"/0.01 m m yields 230 mg (1.8 2 W. Reppe, Annalen 596, 91 (1955).
[2S]
AFFINITY LABELING OF RIBOSOMES BY t R N A
375
mmol) of product containing 84.6 mCi of radioactivity (47 mCi/mmol). The reduction in specific activity of the product may be due to production of some nonlabeled cyanide due to reaction under nitrogen pressure at an elevated temperature. 6-Amino[6-14C]hexanoic acid hydrochloride The 5-[cyano-14C]pentanoic acid obtained above is dissolved in 10 ml of 95% ethanol. To the solution, 2.5 ml of 1 N hydrochloric acid is added along with 50 mg of 10% palladium on carbon catalyst. With magnetic stirring, this mixture is kept at room temperature under an atmosphere of hydrogen for 20 hr, when uptake ceases. The mixture is filtered through a bed of Celite which is then thoroughly washed with 95% ethanol. The combined ethanol filtrates are concentrated in vacuo to a residual oil, dissolved in absolute ethanol, and again concentrated in vacuo. This sequence is repeated twice more to yield 305 mg (1.8 mmol) of crystalline product containing 79.5 mCi of carbon14 radioactivity (44.2 mCi/mmol). 1-(6-[(4-Azido-2-nitrophenyl) amino]- 1-oxohexyloxyl }-2, 5-pyrrolidinedione-6-14C (alternative name for NAK-SuNO). The preparation of this compound is carried out under subdued light. A 102 mg (0.6 mmol) sample of 6-amino[6-14C]hexanoic acid hydrochloride (26.5 mCi) is mixed with 254 mg (2.4 mmol) of anhydrous sodium carbonate and 327 mg (1.8 mmol) of 4-fluoro-3-nitrophenylazide. This mixture is stirred in 75 ml of 80% dimethyl sulfoxide at 35 o for 28 hr after which time it is diluted with 75 ml of water. The solution is extracted with three 300-ml portions of ether, backwashing the first two of these with 5 ml of water each. The combined aqueous phase is next acidified to pH 3 by the addition of 6 ml of 1 N hydrochloric acid and extracted with backwashing as above with three 300-ml portions of ether. These latter ether extracts are combined, washed with 75 ml of brine, dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo to a residue of 198 mg. By silica gel thin-layer radiochromatography (TLRC), in chloroform:ethyl acetate :acetic acid (50: 50: 1), all of the radioactivity is associated with the product of Rf 0.47. This material is combined with 85 mg (0.74 mmol) of N-hydroxysuccinimide (SuNO), 206 mg (1 mmol) of redistilled dicyclohexylcarbodiimide, and 15 ml of ethylene glycol dimethyl ether purified by chromatography through an aluminum oxide activity I column. The mixture is stirred for 16 hr at room temperature, filtered, and the filtrate concentrated in vacuo. The residue is dissolved in 3 ml of chloroform, filtered, and chromatographed over an E. Merck Lobar 'B' column (silica gel 60) with 500 ml of ethyl acetate containing 2% acetic acid in a gradient versus chloroform. Fifteen-milliliter fractions are taken at a rate of 10 ml/ min. Appropriate fractions are combined and concentrated in vacuo to a residue of 82.2 mg (0.21 mmol, 10.7 mCi). By silica gel TLRC, in chloro-
376
CROSS=LINKING AND AFFINITY=LABELING METHODS
[25]
form: ethyl acetate:acetic acid (50: 50: 1), the material is homogeneous at Rf 0.68 and is at least 98% radiochemically pure.
3. N-Hydroxysuccinimide Ester of N-(2,4-Dinitrophenyl)-),-aminobutyric Acid (DNP-Abu-SuNO). The free acid is available from Sigma Chemical Co. (Cat. #D7504). The SuNO ester is made by coupling of SuNO with N,N'-dicyclohexylcarbodiimide (DCC) in dimethylformamide (DMF). 2a Mix 1.3 mmol DCC in 2 ml of dry DMF with 1.3 mmol of SuNO and 1.0 mmol of DNP-Abu in 2 ml dry DMF. The mixture is incubated at room temperature for approximately 24 hr. Silica gel TLC with ethyl acetate:methanol (10:1) showed almost complete conversion of DNPAbu (Rf 0.1) to DNP-Abu-SuNO (Rf 0.9). Excess DCC was removed by addition of 50 ~1 of H20 and incubation for 1 hr. The precipitate of N,N'-dicyclohexylurea was removed after chilling to - 2 0 ° C for 30 min. The DNP-Abu-SuNO product was recovered by precipitation from the filtrate with an equal volume of H20, and used without further purification.
4. N-Hydroxysuccinimide Ester of 3-[(2-Nitro-4-azidophenyl)-2-aminoethyldithio]propionate (SNAP-SuNO). This compound is available commercially in labeled form only (Amersham, Cat. #SJ270). No commercial source is currently known for the unlabeled form but a synthesis has been described. 3 A more successful synthesis is given here. Bis-N-(2-Nitro-4-azidophenyl)cystamine (I). All reactions were kept in the dark as much as possible and all manipulations carried out in dim light. Five hundred and sixty milligrams (2.5 mmol) of cystamine dihydrochloride (Fluka) was reacted with 1.44 ml (0.10 mmol) triethylamine (Eastman, treated with succinic anhydride and distilled under argon), and 1.0 g (5.5 mmol) of 4-fluoro-3-nitrophenylazide (Fluka) in 20 ml of dimethyl sulfoxide (dried over molecular sieves). The resulting solution was stoppered and allowed to stand in the dark at room temperature for 3 days. One hundred and twenty milliliters of water was added and the red-brown product was allowed to stand for 2 hr, filtered, and the ester washed with 20 ml of deionized water and then with 20 ml of diethyl ether. The title compound, protected from light, was dried at room temperature over P205 under vacuum, to yield 1.05 g (89%) of an orange solid, mp 143- 145 °. This compound was used without further purification: silica gel TLC, chloroform: pyridine ( 1 : 1) Rf 0.80. Dithiobis(sticcinimidylpropionate)-S,S-dioxide (II). 0.97 g (2.32 mmol) of dithiobissuccinimidyl propionate (Sigma) in 350 ml of dichloroM. Keren-Zur, M. Boublik, and J. Ofengand, Proc. Natl. Acad. Sci. U.S.A. 76, 1054 (1979). 3 M. A. Schwartz, O. P. Das, and R. O. Hynes, J. Biol. Chem. 257, 2343 (1982).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
377
methane4 was stirred under argon at 0 - 5 ° while a solution of 0.91 g (4.5 mmol) 85% m-chloroperbenzoic acid (Aldrich) in 50 ml of dichloromethane was added dropwise over a l-hr period. Stirring was continued for 4 hr longer and then at 23 o for l hr. The reaction mixture was distilled under reduced pressure and the residue triturated with 40 ml of benzene. The precipitate was filtered and resuspended in 60 ml of dioxane. 4 The resulting suspension was filtered. To the filtrate an amount of hexane was added that just induced permanent turbidity. The mixture was kept in the refrigerator overnight. The white precipitate was filtered to yield 350 mg (35%) of a solid with mp 145-147 °. Conditions: silica gel TLC, ethyl acetate, R f 0.5 with slight residue at the origin.
3-[(2-Nitro-4-azidophenyl)-2-aminoethyldithio]-N-succinimidyl propiohate (III). 1.2 g (2.52 mmol) of compound I, 90 ml of chloroform, 621 mg (4.0 mmol) of dithiothreitol (DTT), and 660 mg (6.5 mol) of triethylamine4 were magnetically stirred at room temperature for 2 hr, and 3.6 g (0.2 mmol) of compound II was added and the mixture stirred for 2.5 hr longer. The reaction mixture was concentrated under reduced pressure, keeping the water-bath temperature below 40 °, and the residue extracted with 190 ml of toluene. The toluene solution was separated from some immiscible oil and purged through a column containing 200 ml of a silicic acid (Fluka, 100 mesh) suspension in toluene. The column was eluted with more toluene, until all unreacted I was removed. The column was then eluted with 1000 ml of dichloromethane and collected in 25 fractions. All the fractions containing the pure product (assayed by TLC) were combined and the solvent removed under reduced pressure to provide 0.38 g of a waxy residue. This residue was triturated with a 1 : l ether-hexane mixture to yield 0.23 g (21%) of III as a reddish solid, mp l 10- 112 o. Analysis by silica gel TLC (dichloromethane, Rf 0.25) yielded a single reddish spot. The compound is quite unstable to light, heat, and moisture, and could not be sufficiently dried for analysis without decomposition. It must be kept in the dark under inert gas at low temperature (-20°).
5. N-Hydroxysuccinimide Ester of N-(2-Nitro-4-azidophenyl)glycyl-flalanine (N.4L-SuNO). This compound is prepared by condensing a fl-alanine and NAG-SuNO. fl-[3H]Alanine, 1.15 nmol (87 Ci/mmol, New England Nuclear, Cat. #NET383), 480 nmol of unlabeled ~alanine, 1/~mol NaC1, 2/~mol triethanolamine, pH 8.1, and 600 nmol NAG-NOS are reacted in 220/~l of 45% aqueous dioxane at 23 o for 15 min with occasional stirring. After acidification with 4/~mol of HC1, the product is 4 The chloroform, dichloromethane, and dioxane used in this step were filtered through a short column packed with activated alumina and bubbled with argon immediately before USe.
378
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
extracted two times with an equal volume of ethyl acetate. The ethyl acetate layer is washed with water, evaporated to dryness, and redissolved in 200/tl of dioxane. Dicyclohexylcarbodiimide (2.5/tmol) and SuNO (5/tmol) are added in two aliquots at 0 and 20 min of the reaction at 23" for a total time of 60 min. The product is purified by silica gel TLC in ethyl acetate: CHC13 (6: 4). 6. N-Hydroxysulfosuccinimide Ester of Biotin Compounds. The SSuNO ester of biotin, 6-(biotinamido)hexanoate (LC-biotin), and 2-(biotinamido)ethyl-1,3'-dithiopropionate (SS-biotin) are available from Pierce Chemical Co., (Cat. Nos. 21217, 21335, and 21331, respectively).
III. Reaction of Probes with tRNA A. Thioketone Modification 1. Reaction. A detailed discussion of the reaction of APA-Br and APAA-Br with s4U, W, and s4U in tRNA is provided in Vol. 46 of this series. ~ The only modification is use of a 20-fold higher concentration (10 mmol) of APAA-Br. 5 2. Yield. The extent of reaction, usually 90-95%, can be monitored by the loss of photochemical cross-linking of s4U-8 to C-I 3 in tRNAs in which this can occur, measured by the fluorescence (F) of the reduced s4U-8 : C13 binucleotide.6 The percent derivatization was calculated as Ftmmoai~ (after irradiation) -- F.,odin~ (after irradiation) X 100 divided by F~,mo~i~ (after irradiation) -- F~,moa~a (before irradiation). 7 Alternatively, when labeled probes are used, the extent of modification can be measured by trichloroacetic acid (TCA) precipitation. A useful procedure which avoids the high background obtained with Millipore membranes is given by Ofengand et aL ~and illustrated by Hsu et aL 5 3. Site of Modification. Verification of the site of labeling was achieved by digestion of [~4C]APA-modified tRNA TM to nucleosides and TLC analysis, which showed only APA-s4U,s and also by complete blockage of [~4C]APA incorporation by prior conversion of s4U-8 to either the crosslinked binucleotide s4U-8 :C-13 or to U-8. 5
5 L. Hsu, F.-L. Lin, K. Nurse, and J. Ofengand, J. Mol. Biol. 172, 57 (1984). 6 j. Ofengand, P. Delaney, and J. Bierbaum, this series, Vol. 29, p. 673. 7 j. Ofengand and R. Liou, Nucleic Acids Res. 5, 1325 (1978). s I. Schwartz, E. Gordon, and J. Ofengand, Biochemistry 14, 2907 (1975).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
379
B. Modification of the NH2 Group of acp 3 U 1. Reaction. Several protocols for the reaction of this group with various SuNO esters have been described by us previously.~.9-1~ The current procedure described for NAK-NOS, but generally applicable, is as follows. All light sources, including daylight, are shielded with 3-mm thick amber plastic (Rohm and Haas, No. 2422) which provides a 1% transmittance cutoff at 536.5 nm. 1° E. coli tRNA ~ (Subriden RNA, P.O. Box 121, Rolling Bay, WA 98061) is precipitated from 0.2 M potassium acetate, pH 5.0, with 2 volumes of ethanol and redissolved in 1-120. Reaction of 30/zM tRNA T M with 360 # M [14C]NAK-SuNO is performed in 20 mM triethanolamine, pH 8.2, 70% dimethyl sulfoxide or dimethylformamide (DMF) at 23 ° for a total of 16 hr. The NAK-SuNO in 100% dimethyl sulfoxide or DMF is added in four equal portions at 0, 2, 4, and 6 hr of reaction to the tRNA-triethanolamine aqueous solution so that the solvent is 70% dimethyl sulfoxide or DMF only after the last addition. Thus, both the percent water and the concentration of tRNA and buffer decreases after each addition of reagent. Reaction is terminated by addition of an equal volume of 0.4 M potassium acetate, pH 5.0, and 2.5 volumes of ethanol. After precipitation at --20* for 1 hr, the pellet is dissolved in water and treated with an equal volume of 10% TCA at 0 ° for 1 hr. The pellet is redissolved in 0.2 M potassium acetate, pH 5.0, and assayed for Azto absorbance and TCA-precipitable cpm. Cyclic solution in 0.2 Mpotassium acetate, pH 5.0, and precipitation with 2.5 volumes ethanol are repeated until a constant specific activity is obtained. With this procedure, values ranging from 1.0 to 1.5 nmol NAK/A260 unit oftRNA are obtained. Renaturation of the tRNA is performed by heating to 65 ° for 2 min in 2 m M ethylenediaminetetraaceticacid (EDTA), pH 7.0, followed by slow cooling ( - 30 min) to room temperature in the presence of 7 mM MgC12.to 2. Yield. The degree of modification can be estimated in several ways. For unlabeled NAK, NAG, NAL, and SNAP, the ratio of absorbance at 470 and 260 nm can be used with an ~470of 4300 for the nitrophenylazide groupJ For DNP addition, the absorbance at 350 nm in 1% NaHCO3 can be used (~-- 15,500) after correction for the tRNA contribution to the 350 nm absorption. The extent of modification can also be determined by selective binding of the modified tRNA to immobilized anti-DNP m°,Hsince the 2-nitro-4-azidophenyl-containing probes cross-react with anti-DNPJ 2 9 I. Schwartz and J. Ofengand, Biochim. Biophys. Acta 697, 330 (1982). to T.-H. Kao, D. L. Miller, M. Abo, and J. Ofengand, J. Mol. Biol. 16, 383 (1983). H F.-L. Lin, M. Boublik, and J. Ofengand, J. Mol. Biol. 172, 41 (1984). ~2C. E. Fisher and E. M. Press, Biochem. J. 139, 135 (1974).
380
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
More than 95% of NAK- or NAG-modified tRNA vh" can be bound in this way, whereas more than 95% of unmodified AcPhe-tRNA is not retained. ~3 An alternative separation method which depends on the additional hydrophobicity of the probe is benzoylated DEAE (BD)-cellulose chromatography (Section III,B,3). ~4-~6 The fraction of recovered tRNA eluting with 1.5 M NaC1-30% ethanol gives the fractional derivatization. The percent modification obtained in this way for six preparations made by the procedure described in Section III,B, l ranged from 45 to 76% with an average value of 57%. If the tRNA is labeled by aminoacylation or in some other way, a solution anti-DNP binding assay can be used. ~6This assay can also be used to test for the intactness of the 2-nitro-4-azidophenyl moiety. Three different amounts (1- 4 pmol) of modified, radioactive tRNA are incubated with a 6- to 30-fold excess of anti-DNP antibody (Gateway Immunosera, P.O. Box 15135, St. Louis, MO 63110, Cat. #211-01) in 0.1 ml of 10 m M potassium phosphate, pH 6.5, 100 m M NaC1 (buffer S) at 37 ° for 10 min, followed by 20 min at 0 °. After an equal volume of buffer S or 0.6 m M DNP-lysine in buffer S is added, the mixture is incubated for another l0 min at 37 °, chilled to 0 °, and filtered through cellulose nitrate membranes. Washing is with cold buffer S. The difference in radioactivity bound to the filter with and without DNP-lysine is taken as the amount of tRNA specifically bound to antibody due to the added probe. The intactness of the probe is determined by cross-linking to the antibody by irradiation with visible light (Section V,A,2) before addition of the DNP-lysine solution. The amount of tRNA cross-linked is taken as the difference between the irradiated and unirradiated DNP-lysine-treated samples. If radioactive probes are used, the yield is simply determined as the specific radioactivity after reprecipitation to a constant value (Section III,B, 1). The yield obtained in each case varies with the probe. For example, NAG addition to acp3U-47 of tRNA vh~ proceeds with a 60-90% yield.9,t° NAK addition to the same residue is 57% (average of six preparations by the current procedure) and DNP-Abu addition gave a 76% yield. H Although not studied carefully, the main variable appears to be the tRNA. We suspect that small amounts of polyamine contaminants in some batches of tRNA compete for the reagent. Sometimes a large excess of reagent will improve the yield but this does not always help. 3. Purification. Although purification on an anti-DNP column has been used (Section III,B,2), the preferred method is BD-cellulose chroma~3F.-L. Lin and J. Ofcngand, unpublished observations (1980). ~4E. Hansske, F. Seela, IC Watanabe, and F. Cramer, this series, Vol. 59, p. 166. ~5p. Gornicki, K. Nurse, W. Hellmann, M. Boublik, and J. Ofengand, J. Biol. Chem. 259, 10493 (1984). ~6p. Gornicki, J. Cicsiolka, and J. Ofengand, Biochemistry 24, 4924 (1985).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
381
tography because of its high capacity and commercial availability. The method is as follows. Buffer A: 0.4 MNaC1, l0 mMsodium acetate, pH 4.5, l0 mMMgC12 Buffer B: 1.0 MNaC1, l0 mMsodium acetate, pH 4.5, 10 mMMgC12 Buffer C: 1.0 M NaC1, 2.5% ethanol, 10 m M sodium acetate, pH 4.5, 10 mM MgC12 Buffer D: 1.5 M NaC1, 30% ethanol, l0 mM sodium acetate, pH 4.5, 10 mM MgC12 BD-cellulose: Boehringer-Mannheim, Cat. #102989 Up to l0 A26o units of renatured tRNA can be loaded per milliliter of BD-cellulose equilibrated with buffer A. The dimensions of the column are not critical. After washing with buffer A (all the tRNA should be bound), buffer B is used for elution of underivatized tRNA. When the A26o reading is less than 20% of the peak value, elution with buffer C is begun. This accelerates the removal of unmodified tRNA but also elutes a small fraction, - 10%, of the modified material. When the A26ovalue has decreased to a stable plateau, buffer D is applied to bring offthe modified tRNA in a sharp peak. Any NAK which was not removed during the repeated ethanol precipitations remains bound to the resin under these elution conditions. Consequently, it is not advisable to attempt regeneration of the resin. The eluted modified tRNA is precipitated by adjustment of the pooled tRNA in buffer D to 67% ethanol and chilling to 0 ° for 15 min or longer. The usual recovery of total tRNA is 70-80%. There appears to be a preferential loss of modified tRNA on the BD-cellulose since the percent modification calculated from the ratio of tRNA eluted with buffer D to the total eluted tRNA ranges from 0.7 to 0.9 of that directly determined from the specific activity before chromatography. In all cases, however, the purified tRNA contains 1.6- 1.9 nmol of NAK residues per A26o unit of tRNA. When aminoacylated, more than 90% of the [3H]Phe can be bound to anti-DNP antibody (Section III,B,2). 4. Site of Modification. Localization of the site of modification exclusively to the acp3U residue was proved in several ways. RNase T~ digestion of [3H]NAG tRNA P~ yielded only one radioactive band. When this band was further digested, only one radioactive spot was found which was coincident with a marker of NAG-acp3Urd. Direct digestion of the tRNA to mononucleotides also generated a single radioactive spot with a mobility in two dimensions consistent with its putative structure? Sequencing gel analysis of an RNase T~ digest of [14C]NAK-modified tRNA ~ showed only a single radioactive band with an appropriate mobility. ~7 RNase T~ t7 M. Abo and J. Ofengand, unpublished observations (1983).
382
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
digestion of SNAP-modified tRNA ~ , 5'-32p-labeling, and sequencing gel analysis showed only one band with a shifted mobility. That band, when isolated, could be bound (88%) to anti-DNP in the soluble antibody test, whereas < 1% of its unshifted partner from unmodified tRNA was bound. Finally, sequence analysis of the shifted band confirmed that it was the expected oligonucleotide.~S C. Modification of the Carboxyl Group of cmo 5U-34 of tRNA v'u, and acp 3U-47 of tRNA eh~ 1. Reaction. The reaction scheme and some of the adducts formed are illustrated in Figs. 2-4. The first step in the modification of the carboxyl group is the conversion to an aliphatic amine by condensation with a diamine? 9 We have found ethylenediamine (EDA) to be the most useful although longer probes can also be prepared using higher homologs of EDA. Limited experience with 1,4-diaminobutane indicates that reasonable yields can be obtained, 68% with cmoSU and 53% with aep3U. Results with 1,6-diaminohexane were more variable, less than 10% reaction being obtained with cmoSU but 60% with acp3U? 5,1stRNAs were obtained from Subdden RNA and used without further purification. The coupling to tRNA v', has been described? 5 Essentially the same procedure is used for the acp3U-47 residue of tRNA ~ already dedvatized at the amino group with NAK. The amino group can also be blocked by acetylation with acetic anhydride.5 NAK-tRNAv~ or tRNA v',, 30-60/zM, is treated at room temperature f~r 30 rain with 250 m M EDA, 50 m M l-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), 100 raM NaC1, 25 m M MgC12, adjusted to pH 4.5 with HC1. The pH is adjusted before addition of the tRNA and maintained in the range of pH 4.4-4.6 by titration. Reaction is terminated by precipitation with 0.2 M potassium acetate, pH 5.0, 67% ethanol at - 2 0 ° for 30 rain. This cycle of solution-precipitation is repeated three times to ensure removal of by-products. Figure 5 shows a typical kinetic time course of the EDA reaction. In this experiment, 400pmol aliquots of the reaction mixture were taken at the indicated times and placed at - 8 0 ° until they could be applied to an HPLC gel filtration column coupled to a fluorescamine detection system. 2° The increase in fluorescence of the high-molecular-weight peak (inset) represents a measure of incorporation of EDA into NAK-tRNAw . A second addition of an ~s R. Denman and J. Ofengand, unpublished observations (1985). 19W. Krzyzosiak, J. Biernat, J. Ciesiolka, P. Gornicki, and M. Wiewiorowski, Nucleic Acids Res. 7, 1663 (1979). 2o p. Bohlen, S. Stein, W. Dairman, and S. Udenfriend, Arch. Biochem. Biophys. 155, 213 (1973).
I "T'--:~~ ~
Z
o~
Z--I
~ >
0
z
o~z_,, ~ I
~>_ o~ Z-I
0
Z-I
g w
o~
o
_
0 Z
/
I-Z
el
°.~ 0
<,.4
..../. ~
'~,,, /
Z
.-6v-
-r-Z
(.3
Z--I
0
Z
o~z_\ ~ "1"
~e
0
N
Z--'t"
/c
o=I? Z_.-r
~
0
~1 ~, ~
-~
0:~
0 Z
=1-
~
I
%_~ "r--z
0
o1 0
o
o
i
Z Z
< t%
Z
384
CROSS-LINKING AND AFFINITY-LABELING METHODS
i "~/~"~"~
SNAP
Hz
~
H~,
,, I
I H2
HI
C H2
H
NO'Z
S
H2
N
C IN H~, I H I
H2
C
,0,!
C
Cv
C H2
H-
I~ " ~
C
Hz
]N/",,~/"
C
C
IN
Hz
Hz
,,~.2
,,,,-,
0
H
C
23
!
NI
23
"'I I
C
I
,,I
0
~
Hz
H H2,.
I
I-~
HI
22 iN\ i ~ lC\ !% rf~
c
IN
,,,.Lt..JJ.v " I "
NAG
24
NI
C
IH
'-'z N C C CI ~ i t / \ l \ l ~ . l t i \ rF',-r C N C i N
IC I I-
L(~)
HI
C~
.,J~-j\ i \ i \ i ~ / \ i r,-~T
J ~ ~)J
NAL
HZ
/ \ 2 \ /c\ /c.L T \ ..,.L/c\ 2~.~ . N H
NAK
Ri
[25]
18
C
"~'
I
FXG. 3. Additional aryl azides condensed with cmoSU according to the scheme in Fig. 2. The probes are to the left of the first dashed line. EDA is between the lines, and the crnoSU residue is to the fight of the second dashed line. The length (L) is given for the most extended conformation. A@
S ~ , ~~ |1
o?LJtc/ j y to, W Hi
Hi
Hi
o
H
0
Hi
H
x
0
../J
FIG. 4. Structure of the adduct of LC-biotin with NAK-modified tRNA ~'. The most extended conformation is shown. The depth of the avidin binding site is according to N. M. Green, L. Konieezny, E. J. Toms, and R. C. Valentine [Biochem. J. 125, 781 (1971)]. It fully surrounds LC-biotin so that only the EDA spacer is between the avidin surface and the COOH ofacp3U. When biotin is used, the binding site should extend to the COOH of acp3U.
[]25]
A F F I N I T Y L A B E L I N G O F R I B O S O M E S BY t R N A
o
385
• .........
100 s S
o
I"1" O ILl "1"
o
U.I ct I.U
50
I-.-I
LU 0C
E L U T I O N VOLUME
I
I 20
I 40 MIN.
I 60
REACTION
FIG. 5. Rate of addition of EDA to the COOH of aep3U-47 of NAK-tRNA r~e. Analysis
was by fluorescamine detection of amino groups in the excluded volume of the column due to the addition of EDA to the tRNA (inset). See text for details. Dashed line, after second addition of EDA/EDC as indicated.
equivalent amount of EDA and EDC at 30 min led to only a 10% increase of the relative fluorescence. In order to remove all traces of EDA before the next coupling step, the EDA- and NAK-modified tRNA is chromatographed on Sephadex G-50 in 2 mMpotassium acetate, pH 5.0, 1 MNaC1. The tRNA peak fractions are pooled, precipitated, and redissolved in H20. Condensation of EDA-modified cmo5-34 with DNP-Abu, NAK, NAG, or SNAP (Figs. 2 and 3) is done essentially as described in Section III,B,1 except that the triethanolamine buffer is 80 mM, the probes are used at 100- 1400 times the tRNA, and they are added in two equal portions at 0 and 1 hr for a total reaction time of 2 hr. For these experiments, the dimethyl sulfoxide concentration is 65% at 0 time, increasing to 71% after all the reagent is added. ~5,~6 Reaction of the EDA-modified carboxyl of NAK-modified acpaU-47 with biotin and LC-biotin (Fig. 4) follows the protocol of Section III,B,I more exactly except that a 90-fold excess of probe was used and additions are at 0, 0.5, 1, and 1.5 hr of reaction. The degree of modification is measured by the loss of fluorescamine-reactive material (see above). Three cycles of biotinylation are needed to achieve > 90% reaction. Modified tRNA is isolated by ethanolic precipitation and
386
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
freed of residual underivatized probe by G-50 gel filtration in 2 m M potassium acetate, pH 5.0 2. Yield. For the cmoSU-34 reactions, an 80-90% yield is usually obtained, as assayed by BD-cellulose chromatography (Section III,B,3). The other assay procedures described in Section III,B,2 can also be used. For the biotin derivatives of NAK-modified acp3U-47, the BD-cellulose assay cannot be used due to the prior attachment of the NAK group. As the probes are not available in radioactive form, the degree of modification is assessed by the percent of fluorescamine-reactive amino groups remaining (< 10%) and by a specific complexing assay using streptavidin. Complexes of biotinylated tRNA with streptavidin (Amersham, Cat. #RPN 104 l) are retarded relative to unbound tRNA when electrophoresed in 1.7% agarose gels in the presence of ethidium bromide. The complexed tRNA was found as a broad band with a mobility 0.55-0.75 that of free tRNA. As shown in Table I, appearance of the complex band is dependent on streptavidin, can be blocked'by a large excess of free biotin, and does not occur when tRNA is biotinylated without prior reaction with EDA. Since the tRNAs were previously derivatized with [14C]NAK on acp3U-47 (see Fig. 3), the amount of tRNA in each band can be quantitated. As shown in Table I, at least 80% modification is obtained. 3. Purification. The DNP-Abu-, NAK-, NAG-, NAL-, and SNAPmodified tRNAs are purified by BD-cellulose chromatography as indicated in Section III,C,2. The biotinylated tRNA cannot be purified in this way because it already has a NAK group attached and the biotinyl group does not add sufficient hydrophobicity to make the separation straightforward. Since the yield obtained was 80-90%, the tRNA can be used without further purification. 4. Site of Reaction. For cmoSU-34 modification by NAK and SNAP, the site of reaction was proved by 5'-32p-sequencing analysis of the crosslinked RNase T~ oligonudeotide. 21 For modification with DNP-Abu, a single shifted RNase TI oligonucleotide which corresponded to the appropriate size was found on denaturing gels. When a radioactive probe analog was used, all of the label was found in the same band. ~5 For acp3U-47 modification with biotin and LC-biotin, prior treatment with EDA is required, as shown in Table I. The only carboxyl group in tRNA v~ is found at residue 47. Similarly, Gornicki et al. have shown that the analogous reaction with aniline is specific for the carboxyl group of t6A, mt6A, and acp3U. 22 2~j. Ciesiolka, P. Gornicki, and J. Ofengand, Biochemistry 24, 4931 (1985). P. Gornicki, M. Judek, A. Wolanski, and W. J. Krzyzosiak, Eur. J. Biochem. 135, 371 (1986).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
387
TABLE I ASSAY OF PERCENT BIOTINYLATIONOF [~4C]NAK-tRNAe*~ AND [t4C]Val-tRNA BY COUPLING WITH STREPTAVIDINa 100XC
tRNA
Streptavidin
Biotin
C
144 144 144
(pmoladded) 332 332 0
0 4,950 0
(dpm) 13,300 254 0
82 3 0
NH 2: + NAK COOH: - EDA b + biotinJ
79
332
0
0
0
NH2: + NAK COOH: + E D A + LC-biotinJ
30 30 30
125 125 0
0 2,650 0
2,850 0 0
81 0 0
22 22 22 22
0 165 165 165
0 3,300 0 0
0 0 5,685 3,717 c
0 0 78 51 c
Reacted group acp3U NH2: + NAK COOH: + E D A + biotinJ
a-NI-I2 of amino acid NH2: + SS-biotin
[ C + T]
a The reaction mixture contained tRNA, streptavidin, and biotin as indicated in 20/tl of 2.0 m M N-2-hydroxyethylpiperazin~N'-2-ethanesulfonic acid (HEPES), pH 7.5, 2.5 m M MgCI2, 7 m M NaC1. Incubation was at 37* for 15 rain. Electrophoresis on 1.7% agarose containing 0.5 mg/ml ethidium bromide in 85 m M Tfis-borate, pH 8.0, 2 m M EDTA was at 60 V for 60 rain. Bands were visualized under UV fight and cut out for quantitation by dissolving in 1 ml of Soluene 350 (Beckman) at 23* for 16-23 hr. Ten milliliters of Bray's solution was then added for counting. C, complex band; T, free tRNA. b Condensation reaction of EDA with acl#U was carried out in the absence of EDA. c After complex formation, 2-mereaptoethanol was added to a final concentration of 50 m M and the mixture incubated an additional 60 rain before eleetrophoresis.
5. Conversion of C O O H to SH. In a reaction analogous to the EDA condensation, the COOH group can be converted into the more reactive SH group in one step by reaction with cystamine. This was demonstrated with E. coli tRNA v', pretreated with H202 to convert s4U-8 to U-8, 5 but should be applicable to any COOH group in tRNA. To a 0.95-ml solution containing 400 m M cystamine-HC1 (Sigma), 80 m M EDC, 100 m M NaC1, and 40 m M MgCI2 adjusted to pH 4.1 with HC1 is added 0.55 ml of 50/tM tRNA. The pH is maintained at 4.0-4.2 for 45 rain at room temperature. The tRNA is recovered by precipitation from 0.2 Mpotassium acetate, pH 5.0, 67% ethanol three times, dissolved in 0.3 ml of 10 m M D T T , 50 m M HEPES, pH 7.5, and incubated at 37 ° for 30 min to cleave the S--S link. Chromatography on Sephadex G-50 in 2 m M potassium acetate, pH 5.0,
388
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
removed low Mr by-products. The presence of the new SH group was proved by reaction with iodo-[~4C]acetamide (IAM, Amersham). Approximately 0.7 nmol of tRNA and 210 nmol of IAM in 100~tl of 50 m M borate buffer, pH 9.0, 10 m M EDTA are reacted at 37 °. Samples, 30/~1, are taken at 1, 2, and 2.5 hr, diluted 10-fold with 2 m M unlabeled IAM and treated with 5 ml of 5% cold TCA. After 15 min at 0 o, the precipitates are washed through cellulose nitrate filters and counted. Unmodified H202-treated tRNA serves as the blank. Seventy-eight percent of the cystamine-treated tRNA reacted with IAM, assuming 1.5 nmol/A26o unit for the tRNA, compared to 84% reaction for normal s4U-8-containing tRNA TM.
D. Modification of the a-NH2 Group of Aminoacyl-tRNA 1. Reaction. The a-amino group of aminoacyl-tRNAs can be selectively acylated with SuNO esters in species that do not contain aep3U or in tRNAs which have had these groups blocked prior to enzymatic aminoacylation. Conditions for the condensation of the a-amino group with DNP-Abu are similar to both the reaction of the amino group of acpaU-47 (Section Ill,B, 1), and EDA modified cmoSU-34 (Section Ill,C, 1) with the following changes: 5.0 a M aa-tRNA is incubated with 15 m M DNP-AbuSuNO in 50 m M triethanolamine, pH 8.2, 74% DMF for 2.5 hr at 23 °. The DNP-Abu-SuNO is added in a single step rather than batchwise over time. The reaction is terminated by the addition of glucosamine to a final concentration of 5 raM. After 15 min at 23 °, the modified tRNA is precipitated from the reaction mixture by addition of 0.1 volume of 2 M potassium acetate, pH 5.0, and 2.5 volumes of ethanol, - 2 0 °, overnight. The tRNA pellet, dissolved in 74% DMF, is reprecipitated as above. The final pellet, in water, is chromatographed on Sephadex G-50 in 2 m M potassium acetate, pH 5.0, to remove all traces of unreacted DNP-Abu. Ethanol (10%) has also been used as eluant. Reactions employing SS-biotin-SSuNO are performed identically to those using DNP-Abu-SuNO except that the final concentration of the ester is 8.25 m M and 65% DMF is used. 2. Yield and Purification. The yield of DNP modified aa-tRNA, measured by solution reaction with anti-DNP antibody as described previously in Section III,B,2, ranged between 70 and 80%. SS-biotin-aa-tRNA modification is measured using the streptavidin gel retardation assay described in Section III,C,2 and summarized in Table I. 3. Site of Reaction. DNP-Abu was shown to be on the a-amino group of aa-tRNA by monitoring the kinetics of Cu2+-Tris catalyzed hydrolysis of the amino acid as previously described. 2z~ 22. I. Schwartz and J. Ofengand,
Biochemistry 17, 2524 (1978).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
389
( %
a
b
c
FI~. 6. Location of the affinityprobes on the three-dimensionalstructure oftRNA. Three views of the yeast tRNAT M structure [S.-H. Kim, in "Transfer RNA" (S. Altman, ed.), p. 438. MIT Press, Cambridge, Massachusetts, 1978] with NAG-aclPU in place of U-47 and APA-s4U in place of U-8. In views(a) and (b), APA-s4Uis on the fight, and in view(c) it is the upper structure. The arrow indicates the position occupied by Gin-34 which is replaced by cmoSU-34 in tRNAV'LThe continuous double line denotes the dbose-phosphate backbone. The APA and NAG groups are shown maximally extended. Other less extended conformation can be obtained by bond rotations. The azide group is shown as an oversizedsolid ball.
E. Location of the Affinity Probes Figure 6 shows the three major sites o f attachment o f the affinity probes discussed above. The thioketone reagents reacting with s4U-8 m o n i t o r one face o f the tRNA, while the acp3U-47 derivatives probe the opposite face. Even with bond rotations, it is not possible for the s4U probe to reach the opposite face o f the tRNA, or vice versa. Thus these two residues serve as convenient sites for probes to m o n i t o r both sides o f the t R N A when it is b o u n d to the ribosome, t R N A r~, containing both s4U-8 and acp3U-47, is a particularly useful t R N A for this purpose. Unfortunately, it does not have a cmoSU-34 residue at the anticodon, t R N A v*' is the tRNA o f choice for affinity labeling from this latter site. IV. F u n c t i o n a l Activity o f M o d i f i e d t R N A
A. Assays Used to Measure Ribosomal Functions 1. Aminoacylation. Although not a ribosomal function, it is necessary to aminoacylate tRNA in order to obtain a physiological substrate. In all
390
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
cases studied, no major inhibition of aminoacylation due to probe addition has been encountered. Although s4U-modified tRNA phc is only poorly recognized by its cognate synthetase23, under mischarging conditions (20% dimethyl sulfoxide- 40 m M Mg2+)5,7 it can be aminoacylated. Data for the various probes are listed in Table II. 2. Synthesis of ppGpp. Only two modified tRNAs, APAA-tRNA ph~ and NAG-tRNA phi, have been studied for the effect of modification on the stringent factor and ribosome-dependent synthesis of ppGpp. In neither case was there any appreciable effect. An approximately 2-fold decrease in the apparent K, for tRNA was found for the APAA modification but only at high-salt concentration.7 3. Ribosomal A-Site Binding. Operationally, A-site binding is defined as ribosomal binding that is dependent on EF-Tu or EF-1. When the P site is filled with unaminoacylated tRNA, the elongation factor-independent binding is reduced to a low value but factor-dependent binding is unaffected. The reaction mixture containing 50 m M HEPES, pH 7.5, 75 m M NH4C1, 75 m M KC1, 5 (or 7) m M magnesium acetate, 0.25 m M GTP, 100-400 nM EFTu 24,25 (adjusted for the amount of tRNA added so that recycling of EFTu was unnecessary), 20 #g/ml of poly(U) [or poly(U2,G)] and 100 nM Phe-tRNA (or Val-tRNA) is incubated at 30* for 5 min (or 37 ° for 10 min). The values in parentheses apply to Val-tRNA. A 50-fold excess of unacylated tRNA is added, and lastly, 150 nM ofE. coli 70S tight couple ribosomes.26 Incubation is at 30* for 10-20 min or until maximum binding is obtained. At the end of the reaction, the samples (usually 25-50gl) are chilled to 0 °, diluted with 5 ml cold wash buffer (50 m M Tris, pH 7.4, 50 m M KC1, 20 m M MgC12) and immediately filtered through cellulose nitrate membranes (Schleicher and Schuell, BA 85, 25 mm, 0.45 gin). After three 5 ml washes with cold buffer, the filters are sucked dry and counted. It is important that the filters not be allowed to suck dry until the end of the washing procedure. Mercaptans are not necessary for this assay and should be removed from the ribosome and EFTu preparations if cross-linking of modified tRNAs is planned. Low concentrations of SH groups ( - 0.1 mM) can markedly quench cross-linking with aryl azides. 16 Ribosomes have been stored in the absence of mercaptans in 50% glycerol at --20 ° for at least 6 months without loss of binding activity. The specificity of A-site binding is assessed by its dependence on EF-Tu and on mRNA. Rather than omitting mRNA, a noncog23 D. S. Carre, G. Thomas, and A. Favre, Biochimie56, 1089 (1974). 24 D. L. Miller and H. Weissbaeh, this series, Vol. 30, p. 219. 2s p. Wurmbach and K. H. Nierhaus, this series, Vol. 60, p. 593. 2~j. Ofengand, R. Liou, J. Kohut, I. Schwartz, and R. A. Ziramermann, Biochemistry 18, 4322 (1979).
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
391
TABLE II FUNCTIONAL ACTIVITY OF THE VARIOUS PROBE-MODIFIED t R N A s
Percent of unmodified Ribosome binding tRNA Phe Val Phe Val Phe Phe Phe Phe Val Val Val Val Val Phe Phe
Probe
Residue
APA APA APAA APAA [APA LDNPabu NAK NAG SNAP DNPabu NAK NAG SNAP NAL FNAK /biotin
s4U-8 s4U-8 s4U-8 s4U-8 s4U-8 ] acp3U-47J acp3U-47 acp3U-47 acp3U-47 cmoSU-34 cmoSU-34 cmoSU-34 cmoSU-34 cmoSU-34 acp3U-47] acp3U-47J
[NAK LLC-biotin
acp3U-47] acp3U-47J
Aminoacylation 91d 87 80d 99 81d, 29 67 69 73 100 89 81 75
A site~
P siteb
Translocation ~
Ref.
50 67 72 73
75
15
e e e, f e g
90-100 90-100
87 100 99 96 114 96
h-j
47
77
f, k i l m, n m, n m, n m, n i
45
66
i
90 60 147 47
a Assayed as described in Section IV,A,3. b Assayed as described in Section IV,A,4. c Assayed as described in Section IV,A,5. d Aminoacylation under dimethyl sulfoxide conditions. See text. e L. Hsu, F.-L. Lin, K. Nurse, and J. Ofengand, J. MoL Biol. 172, 57 (1984). / J. Ofengand and R. Liou, Nucleic Acids Res. 5, 1325 (1978). g F.-L. Lin, M. Boublik, and J. Ofengand, J. Mol. Biol. 172, 41 (1984). h F.-L. Lin and J. Ofengand, unpublished observations (1980). R. Denman and J. Ofengand, unpublished observations (1985). J J. Ofengand, F.-L. Lin, L. Hsu, M. Keren-Zur, and M. Boublik, Ann. N.Y. Acad. Sci. 346, 324 (1980). k I. Schwartz and J. Ofengand, Biochim. Biophys. Acta 697, 330 (1982). t p. Gornicki, K. Nurse, W. Hellmann, M. Boublik, and J. Ofengand, J. Biol. Chem. 259, 10493 (1984). rap. Gomicki, J. Ciesiolka, and J. Ofengand, Biochemistry 24, 4924 (1985). n j. Ciesiolka, P. Gornicki, and J. Ofengand, Biochemistry 24, 4931 (1985). hate p o l y n u c l e o t i d e such as p o l y ( A ) or p o l y ( C 2,A) is u s e d b e c a u s e this results i n lower b l a n k values. T y p i c a l d e p e n d e n c i e s for V a l - t R N A t6 a n d P h e - t R N A 5 are b e t t e r t h a n 10-fold. 4. Ribosomal P-site Binding. O p e r a t i o n a l l y , this site is d e f i n e d as n o n enzymatic polynucleotide-dependent binding of N-acetylaminoacyl-tRNA
392
CROSS-LINKING AND AFFINITY-LABELING METHODS
[25]
at relatively low Mg 2+ concentrations which is reactive with puromycin when incubated at 0 ° to prevent translocation. E. coli. The reaction mixture contains 50 m M HEPES, pH 7.5, 50 m M NH4C1, 7 - 9 m M magnesium acetate, 20/~g/ml of poly(U) [or poly(U2,G)], 150 n M E. coli 70S tight couple ribosomes, and 100 n M AcPhe- (or AcVal-) tRNA. Since the ribosomes are usually about 50% active for both A- and P-site binding, these values yield a 1.3-fold excess of tRNA and are suitable when maximum cross-linking to ribosomes is desired. When the trinucleotide p G U U is used as a codon, the Mg 2+ concentration is increased to 20 mM. Reactions are stopped by chilling to k0 o, and assayed as in Section IV,A,3. The same comments about mercaptans and cognate codon dependence apply here also. Yeast and Artemia salina. The reaction mixture containing 50 m M HEPES, pH 7.5, 50 m M potassium acetate, 2 m M spermidine, 2 m M DTT, 80/~g/ml poly(U2,G), 100 n M AcVal tRNA, and 120-240 n M ribosomes is incubated at 37 ° for 20 min and assayed as in Section IV,A,3. When 60/~M p G U U is used, the Mg 2+ concentration is increased to 15mM. 5. Translocation. The assay used here is based on the EFG-dependent linear increase with time of ribosome-bound Phe-tRNA after the initial A-site bound plateau is reached. 5 The A-site binding reaction described in Section IV,A,3 is used with 60 n M ribosomes and a 6- to 10-fold excess of Phe-tRNA. After the plateau of A-site binding is reached, two different amounts of EFG 27 are added and samples taken at intervals for the measurement of ribosome-bound Phe-tRNA. A linear rate of increase is observed following EFG addition which is also proportional to the amount of EFG added, so long as translocation remains the rate-limiting step.
B. Ribosomal Activity of Modified tRNAs Activity of the variously modified tRNAs in aminoacylation, ribosomal P-site binding, and translocation is summarized in Table II. Note the three cases where doubly modified tRNAs (in brackets) were used. V. Cross-Linking to Ribosomes
A. Irradiation Conditions 1. General Conditions. The samples are placed in small Pyrex glass test tubes each of which is individually stirred by a magnetic flea during irradiation. Cooling to 0*-2* is achieved in a Pyrex-jacketted vessel con27 M. S. Rohrbach and J. W. Bodley, this series, Vol. 60, p. 606.
[25]
AFFINITY LABELINGOF RIBOSOMESBY tRNA
393
taining water in which the reaction tubes are immersed. When solution filters are desired, either a double-jacketted container is used or the cooling water is replaced by the appropriate filter solution. Both methods are satisfactory. 2. A P A / A P A A Class. TM Irradiation is performed in a Rayonet RPR-100 reactor (Southern New England Ultraviolet Co., P.O. Box 4134, Hamden CT 06514) equipped with 16 300-nm lamps, and a Mylar plastic sheet (DuPont, 92 gauge, Type S) formed into a cylinder to shield the lamps. This filter removes all light below 310 nm. 26 Under these conditions, cross-linking is complete after 10 min and is stable for at least 60 min. When the DNP group is also present, as in doubly modified tRNA t~e (Section VI,A), a 1-cm solution filter of 1.7 M NiSO4 (10% transmittance at 350 nm) is used to protect the DNP group ( 2 ~ , 360 nm) from stray radiation. When this filter is used, the irradiation time should be increased to 20 min. 3. N A K / N A G Class. ~° Irradiation is performed with a 650 W tungsten lamp placed 4 cm from the samples which are maintained at 00. A solution filter of 2 cm of fresh 1 M NaNO2 is used to block light of < 397 nm. Irradiation under these conditions for 20 min is sufficient for maximum cross-linking. 4. Cyclobutane Dimer Formation. A special class of cross-link is formed when certain tRNAs which contain cmo~U-34 or moSU-34 are irradiated with 300 nm light. As detailed in a series of publications and summarized in Ofengand eta/., 2s~9 the cross-link is a cyclobutane dimer between the cmoSU-34 residue and C-1400 of 16S ribosomal RNA (Fig. 7). This cross-link is quite specific since it only occurs at the ribosomal P site, and only to a given residue, yet is as widespread in nature as the extensive conserved sequence surrounding the cross-link site. Thus, the same crosslink occurs in E coli, yeast, A. salina, and Tetrahymena thermophila. 29 Irradiation is performed as described in Section V,A, 1. In earlier studies, the Mylar filter was used to block short-wavelength-induced damage to the RNAs. Under these conditions, and with the P-site binding mixture described in Section IV,A,4, 180 min are needed to reach maximum crosslinking. More recent experience shows that the Mylar filter is unnecessary, and consequently a 4-fold more rapid reaction can be obtained. 26,s° In 28j. Ofengand, J. Ciesiolka,R. Denman, and K. Nurse, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 473. Springer-Vcrlag, New York, 1986. 29j. Ofengand, J. Ciesiolka, and K. Nurse, NATO Adv. Study Inst. Ser., Set. A 110, 273 (1986). 3oC. Ehresmann, B. Ehresmann, R. Millon, J.-P. El)el, K. Nurse, and J. Ofengand,Biochemistry 23, 429 (1984).
394
CROSS-LINKING AND AFFINITY-LABELING METHODS tRNA-
0
[9-5]
(C)moSUro~ Cyt-rRNA NH2
HN " ~ V ~ N R= CH3 0'~"....N/1~1 i~l, N...~O =CH2COOH H H FIG. 7. Structure of the tRNA- 16S RNA eyclobutane dimer cross-link. The tRNA base, cmoSU-34, is on the left, and the rRNA base, C-1400, is on the right. Reprinted with permission from Ofengand et al. 29
addition, the 1.7 M NiSO4 filter is now routinely used to block stray longer-wavelength light (> 350 nm) as a general precaution.
B. Assay of Cross-Linking to Ribosomes Two methods are used to assess cross-Inking. When the cross-linking yield is high, a filter-binding assay is used. When the yield is low (10% or less) and/or the tRNA is derivatized with hydrophobic probes, the blank values are too high for reliable filter assays. ~6In such cases, sucrose velocity gradient centrifugation is used. In the filter-binding assay, the sample (usually 25 - 50 pl) is diluted with 50 m M Tris, pH 7.4, 50 m M KC1 to a final Mg2+ concentration of 0.1 raM. For a typical P-site assay, this is usually a 70-fold dilution. Wash buffer (50 m M Tris, pH 7.4, 50 m M KCI, 0.1 m M MgC12) is added to make 5 ml. After 10 min at 0", the samples are filtered through cellulose nitrate membranes (Section IV,A,3) washed three times with 5-ml portions of wash buffer, sucked dry, and counted. The percent cross-linking is the amount oftRNA bound in this assay divided by the amount noncovalently bound, after suitable correction for light and codon-independent binding. In the sucrose gradient assay, the irradiated sample is directly layered on a 10-30% sucrose gradient in 20 m M HEPES, pH 7.5, 100 m M NH4C1, and 0.5-2.0 m M magnesium acetate. Centrifugation is in an SW40 rotor at 4 °, usually at 27,000 rpm for 17 hr, or the equivalent. The choice of Mg2+ concentration is dependent on further plans for the material. If activity or morphology is to be studied, 1 - 2 m M Mg2+ must be used. If only an analysis of cross-linking is desired, 0.5 m M is best. In general, the lower the Mg 2+, the lower the unirradiated blank value. Specific cross-linking is assessed as moles of tRNA under the ribosomal subunit peak per mole of subunit recovered. Recovery of A26o units is usually about 50%. The specific cross-linking divided by the specific noncovalent binding (from a separate assay as in Section IV,A,3 or IV,A,4) gives the percent cross-linking. In this calculation, it is assumed that the fractional
[9.5]
AFFINITY LABELING OF RIBOSOMES BY t R N A
395
loss of cross-linked and non-cross-linked ribosomal species during sucrose gradient centrifugation is the same.
C. Cross-Linking Results The results of using the various probe-modified tRNAs to explore the ribosome-binding sites for tRNA can be summarized as follows:2s 1. APA-s4U-8-modified Phe-tRNA in the A site cross-links almost exclusively to the 30S protein, S 19. 2. NAK-acpaU-47-modified Phe-tRNA in the P site cross-links to 23S rRNA, to 50S proteins including L5 and L27, and to 30S proteins including S19. 3. cmoSU-34 of Val-tRNA in the P site cross-links exclusively to C-1400 of 16S rRNA. 4. NAK- and SNAP-modified cmoSU-34 of Val-tRNA in the A site cross-links primarily to C-1400 of 16S RNA. These results, in conjunction with other data, have made it possible to propose a preliminary model for the arrangement of tRNA on the ribosome. 2s VI. P r e p a r a t i o n and Use of D o u b l y Modified t R N A For visualization of the site of cross-linking in the electron microscope, it would be desirable to have a suitable marker group on the tRNA near to the probe. If suitably chosen, such a marker could also be used to select out cross-linked ribosomes from the total population. When cross-linking yields are low, this is a decided advantage. Both the D N P - a n t i - D N P and biotin-streptavidin systems can be used for these purposes.
A. DNP-anti-DNP The DNP group of doubly modified tRNA r~, APA on s4U-8, and DNP-Abu on acp3U-47, was used for purification of cross-linked ribosomes by binding to anti-DNP attached to a solid support. After elution, the antibody was also used to visualize the site of cross-linking in the electron microscope.' ' Another combination is illustrated in Fig. 2A. Here the DNP group was placed near the site of cyclobutane dimer formation and served as a useful high-resolution marker for the location of C-1400 on the 30S ribosome. '5 An attempt to use this modified tRNA to purify the cross-linked complex with A. salina 40S subunits 3~ for electron microscopy gave the surprising results summarized in Table III. Table III shows that 3~j. Ciesiolka, K. Nurse, J. Klein, and J. Ofengand, Biochemistry 24, 3233 (1985).
396
RIBOSOME
CROSS-LINrONG AND AFFINITY-LABELING METHODS TABLE III BINDING,CROss-LINKING,ANDDIMERFORMATION
[25]
WITH DNP-MOD1FIEDtRNA"
pGUU-dependent tRNA (pmol/pmol ribosomes) tRNA
Ribosome
Binding
Cross-linking
% Cross-linking
%Dimers
DNP-Val-tRNA
E. coli A. salina
0.30 0.24
0.30 0.15
100 64
47 22
AcVal-tRNAED~'-t~Np
E. coli A. safina
0.28 0.11
0.35 0.08
125 72
15 <2
"Ribosomal P-site binding, cross-linking, and subunit separation were performed and assayed as described by P. Gornicki, J. Ciesiolka, and J. Ofengand [Biochemistry 24, 4924 (1985)] and J. Ciesiolka, K. Nurse, J. Klein, and J. Ofengand [Biochemistry 24, 3233 (1985)]. 30S-anti-DNP- 30S complex formation and sucrose gradient centrifngation were modified from M. Keren-Zur, M. Boublik, and J. Ofengand [Proc. Natl. Acad. Sci. U.S.A. 76, 1054(1979)]. Incubation with anti-DNP was in 20 mM HEPES, pH 7.5, 100 mM KC1, 2 rnM Mg2+for 10 rain at 37" followedby 20 rain at 0". Sucrose gradient separation of 30S dimers from monomers was done in the same buffer. DNP-Val-tRNA is N-(2,4-dinitrophenyl)valyl-tRNA(see Section III,D,1); AcVal-tRNA~A'Drce is N-(acetyl)valyl-tRNAwhose cmoSU-34is derivatized as shown in Fig. 2A.
while the E. coli 30S subunit cross-linked to the t R N A shown in Fig. 2A could form dimers (15%o), the analogous A. salina 40S subunits could not (<2%). The equivalent pair where the D N P group was attached to the a - a m i n o group o f valine (Section III,D, 1) did not show such differences. Thus, in addition to serving as a purification tool and an electron microscopy marker, anti-DNP is also useful as a stereochemical probe.
B. B i o t i n - S t r e p t a v i d i n
The doubly modified t R N A ~*e o f Fig. 4 was designed for similar purposes o f purification and electron microscopic visualization. After crosslinking via the N A K probe (Section V,C,2) and separation o f the subunits by sucrose gradient centfifugation (see Section V,B), the presence o f the biotinyl group on the 50S could be demonstrated by addition o f ~25I-labeled streptavidin (Amersham) and subsequent separation from u n b o u n d streptavidin by sucrose gradient centrifugation at 10 m M M g 2+. Using the LC-biotin probe illustrated in Fig. 4, 45% o f the cross-linked molecules could bind strcptavidin. However, when biotin was used in place o f LCbiotin, only 16% o f the complexes could bind streptavidin. TM This was not the case for free biotinylated N A K - t R N A s (Table I). Thus, as in the D N P
[25]
AFFINITY LABELING OF RIBOSOMES BY t R N A
397
example of Table III, streptavidin binding can also reveal stereochemical constraints due to the structure of the ribosome surrounding the cross-link site. Although all attempts to form 50S dimers via a streptavidin bridge have failed, it should be possible to purify ribosome-tRNA-streptavidin complexes by suitable manipulation of the biotin-streptavidin system, possibly using insoluble supports. Such complexes where streptavidin is bound close to the site of cross-linking should be amenable to electron microscopic visualization of the site of attachment. 32,33
32 K. Sutoh, K. Yamamoto, and T. Wakabayashi, J. Mol. Biol. 178, 323 (1984). 33 M. I. Oakes, M. W. Clark, E. Henderson, and J. Lake, Proc. Natl. Acad. Sci. U.S.A. 83, 275 (1986).
[26]
P R O B I N G RIBOSOME S T R U C T U R E A N D F U N C T I O N
401
[26] Probing Ribosome Structure and Function Using Short Oligodeoxyribonucleotides By WALTER E. HILL, DAVID G. CAMP, WILLIAM E. TAPPRICH, and ANCHALEE TASSANAKAJOHN
Introduction In order to be useful in ribosomal function, ribosomal RNA (rRNA) must be exposed on the surface of the ribosome and is likely to be single stranded in the functional regions. The results of the many studies providing the primary and secondary structures of rRNA persuasively show that many such regions may occur in ribosomal RNAJ Many methods, more fully discussed elsewhere in this volume, have provided solid evidence that various portions of the rRNA are indeed exposed on the ribosomal subunits and are accessible to chemical modification or enzymatic cleavage. In addition, some regions have been shown to have variable exposure, depending on whether the subunits were associated and whether translation was occurring.2,3 In particular, the results of phylogenetic comparisons lead one to believe that certain regions of the rRNA are of paramount importance, having been conserved in all species studied thus far. 4 It would seem that these sites must fulfill a central role in the ribosome function. In order to probe the function of these regions, small complementary oligodeoxyribonucleotides (cDNA probes) have been used to hybridize specific regions of the ribosomal RNA in the ribosomal subunits after which various functions of the ribosome are checked with the probe in place. The methods used to perform these studies will be discussed below. Materials Ribosomes and Ribosomal Subunits
Ribosomes are isolated from RNase I-deficient Escherichia coli, strain MRE 600 (obtained from Grain Processing Corp., Muscatine, IA) essentially as described by Hill et aL 5 Ribosomal subunits are separated and H. F. Noller, "Annu. Rev. Biochem. 53, 119 (1984). 2 W. Herr and H. F. NoUer, J. Mol. Biol. 130, 421 (1979). 3 N. Meier and R. Wagner, Nucleic Acids Res. 12, 1473 (1984). 4 C. R. Woese, R. Gutell, R. Gupta, and H. F. Noller, Microbiol. Rev. 47, 621 (1983). 5 W. E. Hill, G. P. Rossetti, and K. E. van Holde, J. Mol. Biol. 44, 263 (1969). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
402
CHEMICAL AND ENZYMATIC PROBING METHODS
[26]
purified by the zonal centrifugation procedure outlined by Tam and Hill.6 To prepare tight-couple 70S (TC70S) ribosomes,7 isolated 70S ribosomes are dialyzed against 10 mM Tris, pH 7.4, 100 mM KC1, 5 mM MgC12 to dissociate the loose-couple ribosomes (LC70S) into subunits. Using a modification of the procedure outlined by Herr and Noller,2 the TC70S particles are then purified by sucrose gradient centrifugation in a Ti-15 zonal rotor spun at 31,000 for 12 hr.
DNA Oligonucleotides Complementary DNA probes can be readily synthesized chemically using any of the recently developed instruments. In this laboratory, the probes have been synthesized using phosphotriester chemistry on a manual Bachem (San Francisco, CA) DNA synthesizer. Fully deblocked oligomers are separated from low-molecular-weight blocking groups by chromatography on a 2 cm X 40 crn Sephadex G-25 column (Pharmacia, Piscataway, N J). The homogeneity of the probe preparation can be monitored by electrophoresis of a 25- 30 #g DNA sample on a 20% polyacrylamide gel (19% acrylamide, 1% bisacrylamide) at 40 mA for 50 min at 4" in TBE running buffer [89 mM Tris-borate, pH 8.3, 1 mM ethylenediaminetetraacetic acid (EDTA)]. The DNA is stained using methylene blue. Heterogeneous DNA samples are further purified by preparative gel electrophoresis. Purified cDNA probes are labeled at the 5' end with [~-32P]ATP (New England Nuclear) and T4 polynucleotide kinase (Pharmacia) using the method outlined by Chaconas and Van de Sande.8 The labeled DNA probe is then isolated by phenol extraction and purified by the NACS PREPAC mini column (Bethesda Research Laboratories) and eluted using 1 M NaC1.
Transfer RNA Transfer RNA has been purchased from Boehringer Mannheim as lyophilized residues which are resuspended and dialyzed against a buffer containing 10 mM Tris-acetate, pH 7.8, 14 mM magnesium acetate, 60 mM potassium acetate, and 0.1 mM dithiothreitol (DTT).
6 M. F. Tam and W. E. Hill, FEBSLett. 120, 230 (1980). 7 M. NoD, B. Hapke, and H. Noll, .1",Mol. Biol. 80, 519 (1973). s G. Chaeonas and J. H. Van de Sande, this series, Vol. 65, p. 75.
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
403
Methods
Hybridization Assays To hybridize cDNA probes to rRNA in situ, an excess of labeled oligonucleotide probe is incubated with ribosomal subunits at 4* for 2 24 hr in binding buffer (10 mMTris, pH 7.4, 60 mMKCI, 10 mMMgCI2). The level of probe binding to the ribosome is assayed by separating probesubunit complexes from unbound probe and assaying the radioactivity in the complexes. We have found two techniques useful for separating cDNA-subunit complexes from unbound probe: sucrose gradient centrifugation and nitrocellulose filtration. Gradient-Binding Assay. In the sucrose gradient assay, 200 pmol of ribosomal subunits in 100/tl of binding buffer is incubated with a 20 molar excess of labeled eDNA. Following incubation (for various lengths of time and at different temperatures, depending upon the experiment being run), the binding mixture is layered onto a 4.0-ml, 5-20% sucrose gradient and centrifuged for 1.75 hr (50S) or 2.2 hr (30S) at 54,000 rpm in a Beckman SW60 rotor. Migration of 32p-labeled probe and ribosomal subunits is monitored by determining the radioactivity and A2~oof gradient fractions. Probes that hybridize to rRNA in situ comigrate with the ribosomal subunits (Fig. l). Although eDNA binding is evident using this technique, we consistently find that less than 1% of the ribosomal subunits remains bound with probe in the sucrose gradient. Presumably, the nonequilibrium conditions present as the subunits sediment through the gradient cause the low level of binding. Filter-Binding Assay. Higher levels of binding are observed when the hybrids are assayed on nitrocellulose filters. In this technique, 50 #l binding mixtures containing 25 pmol of ribosomal subunits and increasing concentrations of eDNA are applied to nitrocellulose filters and washed with five 1-ml aliquots of binding buffer. We have recently found that fewer washes may give more reproducible results and are now using just one 1.5-ml wash for this assay. The filters are counted to determine the fraction of subunits bound by probe (Fig. 2). Using the filter-binding assay, we typically see eDNA binding increase over background with increasing concentrations of probe until 40-60% of the ribosomal subunits is complexed. The eDNA binding begins to saturate when the probe:subunit ratio reaches about 24" 1. This number varies depending upon the size of probe used and the availability and type of the target site. However, in some cases, significantly less binding has been observed, suggesting that the site may not be entirely exposed or available. For
404
CHEMICAL AND ENZYMATIC PROBING METHODS
[26]
3.0
2.$
i
~L0
i
1.0
I ! ! ! I ! !
Y
/ t
fly "al~
: B.S L0 2
II
6
0
10
12
ltl
F~IC:TIOI~ FIG. 1. Gradient-binding assay. A 150-/tl solution containing 200 #g ribosomal subunits (111 pmol 50S or 220 pmol 30S) was incubated with a 20-fold molar excess of 32p-labeled eDNA probe at 4* for 5 hr. The buffer in the solution contained 10 mMTris, pH 7.4, 60 m M KCI, 10 m M MgCI2 (binding buffer). Following incubation, the binding mixtures were layered onto a 4-ml 5-20% sucrose gradient in binding buffer and centrifuged at 54,000 rpm for 1.75 hr (30S) or 2.5 hr (50S) in a Beckman SW60 rotor at 4". Fractions of 280/zl were collected and diluted to 780/tl with water. Each fraction was monitored for absorbanee at 260 nm and radioactivity. Symbols:*, 30S subunits; ~7, labeled probe.
instance, it may be involved in other interactions, such as long-range interactions with rRNA or with ribosomal proteins. In some cases, more than 60% binding was observed, suggesting multiple binding sites may be available. A computer-assisted search for homologous RNA regions provides data on additional probe-binding sites.
Binding Specificity Assays Saturation Assay. Inasmuch as there may be multiple rRNA sites on the intact subunit which can base pair with a portion of a given eDNA probe, it is essential to determine the binding site(s) which are involved. We have used three sets of experiments to assess these sites. First, we have assured ourselves that the probe is binding in a specific rather than nonspecific fashion by increasing the amount of probe present until saturation occurs as outlined in the nitrocellulose filter-binding assay above. If the binding is nonspecific, it would be expected that eDNA probe binding would continue to increase with probe concentration. However, if there is a single site, or a limited number of sites, saturation will occur wherein the
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
405
tt0
o~
Im
l0
0 0
t 10
! 30
Iq01.fll¢ ICl:l'[10 [ P I R I ~ 3 1 ~
I ll0
W
~etINl'[)
FIG. 2. Filter-binding assay. Increasing amounts of 32P-labeled DNA were incubated with 25 pmol of 30S subunits in 10 m M Tris, pH 7.4, 10 m M MgCI2, and 60 m M K C I at 4 ° for 2 hr. Reactions were filtered under vacuum through nitrocellulose filters and washed with five I-ml portions of the above buffer. After the filters were dried, the radioactivity retained was monitored by liquid scintillation.
number of subunits with attached probe will not increase with increasing probe concentration. These saturation studies are merely indicative of binding specificity. Competition Assay. An additional test of binding specificity is to add unlabeled probe to a probe-subunit complex and look for dilution of the binding by the labeled probe. Binding mixtures containing 25 pmol of ribosomal subunits and a saturating quantity of labeled cDNA (typically 600 pmol) are incubated at 4 ° in 50/zl of binding buffer. Increasing concentrations of unlabeled cDNA of the same sequence are added to the mixture and the incubation is continued. The binding of labeled cDNA is assayed on nitrocellulose filters. For probes that bind to a specific site(s), increasing the concentration of unlabeled probe decreases the amount of labeled probe bound to the subunit (Fig. 3). As with the saturation of binding, the competition experiment is merely indicative of a specific site or sites interacting with the probe. RNase H Assay. Although saturation experiments and competition results provide indirect evidence for specific interaction of the probe with the target site, we have observed that probes will hybridize to partially complementary rRNA regions, albeit with much lower affinity. This can be seen by binding probes specific for a region in one subunit to the
406
CHEMICAL AND ENZYMATIC PROBING METHODS
3OOO
[26]
I
i 20oo
o
~_ jooo
.-J
o
I 20
I
I
I
I10
60
gO
100
I UNI.FIBELEOPROBE FIDITr.D FIG. 3. Competition assay. Approximately 25 pmol of subunits was incubated with 32p-labeled eDNA probe in binding buffer for 5 hr at 4". Increasing concentrations of unlabeled probe of the same sequence were then added and the mixtures incubated for an additional 5 hr. Binding of labeled probe was determined by filtering through nitrocellulose filters, drying the filters, and determining the radioactivity retained on the filters using liquid scintillation counting.
alternate subunit (see Fig. 2). Only a direct assay of the hybridized complex can supply prima facie evidence for the specific hybrid. One such method is to use RNase H and clip the hybridized region. The exact site of eDNA binding is determined by digesting the rRNA under the eDNA probe using the heteroduplex-specific enzyme RNase H and characterizing the resulting rRNA fragments. The conditions for in situ RNase H digestion are adapted from Donis-Keller9 and Mankin et al. 1° The digestion reactions contain 20- 25 #g of ribosomal subunits and 20-30 gg of cDNA probe in 20 #1 of 40 m M Tris-HCl, pH 7.9, 10 m M MgCI2, 60 m M KC1, and 1 m M DTT. These mixtures are incubated for 18 hr at 4 ° with 2 - 4 units of RNase H (Pharmacia). The rRNA products are isolated by phenol extraction and recovered by ethanol precipitation. The ribosomal RNA fragments are then characterized by gel electrophoresis (Fig. 4). Since potential rRNA binding sites for the probes are known, determining the size of the RNase H fragments by 9 H. Donis-Keiler, Nucleic Acids Res. 7, 179 (1979). ~oA. S. Mankin, E. A. Skripkin, N. V. Chichkova, A. M. Kopylov, and A. A. Bogdanov, FEBSLett. 131,253 (1981).
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
A
B
407
C
Flo. 4. Ribonuclease H assay. Twenty micrograms of DNA probe (5'-dGC~TGCTGG) complementary to bases 518-526 of 16S rRNA was incubated with 25 #g of 30S subunits with and without RNaso H (as described below) in 40 m M "Iris, pH 7.9, 10 m M MgCI2, 60 m M KC1, and 1 m M DTF at 4" for 20 hr. Proteins were removed by buffer-equilibrated phenol extraction and the resulting RNA and RNA fragments were precapitated with 3 volumes of 95% ethanol, pelleted, and resuspended in 10 M urea, 0.025% bromphenol blue, and 0.025% xylene cyanol. The RNA was run on a 5% polyacrylamide/7 M urea/89 m M Tris-borate (pH 8.3)/2 m M EDTA gel for 6 hr at 12.5 mA and stained with methylene blue. In lane A, 3 units of RNase H were incubated with the DNA probe and 30S subunits. Lane B is a control containing 30S ribosomal subunits only. Lane C shows 30S ribosomal subunits with probe without added RNase H.
408
CHEMICAL AND ENZYMATIC PROBING METHODS
[26]
electrophoresis localizes the region of probe hybridization and may be sufficient to provide assurance of probe specificity. Isolating and sequencing the RNase H fragments precisely identifies the bases involved in eDNA hybridization. The sequence of bases surrounding the hybrid is determined by chemical sequencing from the 3' end I~ or enzymatic sequencing from the 5' end. 9 We have sequenced the RNase H fragments derived from hybridization of eDNA 5'-dGTATCTAAT to 30S subunits to show that this probe binds specifically to bases 787-795 of 16S rRNA.~2 It should be noted that RNase H is not specific for a given base in the R N A - e D N A complex. The resulting fragments have staggered ends, with one site generally predominating. This method is limited by the ability of RNase H to access the hybridized regions in situ. In some cases, notably stem-loop structures, we have found excellent RNase H degradation, suggesting that the sites are quite available to RNase H. In other cases, we have shown it to be most difficult to obtain fragments using RNase H, suggesting that the sites in question are not readily accessible to the 19,000-Da RNase H. If there is a single site that is hybridized to the eDNA probe, but is not available to RNase H, no fragments will appear. In the case of multiple binding sites, the number and intensity of the fragment bands on the gel may well be much more indicative of target site availability to RNase H than of the amount of eDNA binding.
Subunit Binding Assay The association of the 30S and 50S subunits to form active 70S ribosomes is performed by the method of Herr and Noller2 with slight modifications. Equimolar quantities of 30S and 50S subunits are incubated in 20 m M Tris-HCl, pH 7.4, 60 m M KC1, 10 m M MgCI2 for 50 min at 37 °. Samples are chilled and centrifuged through 5-20% sucrose gradients in the same buffer. The 70S, 50S, and 30S peaks are located using spectrophotometry at 260 nm.
tRNA Binding Assays A-Site Binding. [~4C]Phe-tRNAPhCis prepared according to the protocol outlined by Wurmbach and Nierhaus ~3 in which 50 A2~0 units of tRNA l ~ in 7.5 ml of reaction volume (50 m M Tris-HCl, pH 7.3, 10 m M magnesium acetate, 100 m M KCI, 3.2 m M ATP-Na2 and 6 m M 2-mereaptoeth~1 D. A. Peattie, Proc. Natl. Acad. Sci. U.S.A. 76, 1760 (1979). ~2W. Tapprich and W. Hill, Proc. Natl. Acad. Sci. U.S.A. 83, 556 (1986). 13 p. Wurmbach and K. H. Nierhaus, this series, Vol. 60, p. 593.
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
409
anol) are mixed with 0.25 mCi [14C]phenylalanine (Amersham). After checking that the pH is 7.5, S 150 enzyme fraction (1 ml) is added and the reaction mixture incubated for 15 min at 37 °. The reaction is stopped by chilling in an ice bath, and 0.375 ml of 20% (w/v) sodium acetate, pH 5.4, is added. The nucleic acid fraction is then extracted with 75% ethanol/ water and precipitated with 2 volumes of cold ethanol. After low-speed centrifugation (10 min at 10,000 rpm), the pellet is washed with ethanol, dried, and dissolved in 1 ml of distilled water. The specific activity of the radiolabeled, acylated tRNA is determined by monitoring the absorption at 260 nm and measuring the radioactivity of the product. The EF-Tu-GTP-Phe-tRNA 1~ ternary complex is formed and bound to the ribosome following the protocol outlined by Douthwaite et al. ~4One hundred micrograms of EF-Tu is preincubated in a 200-#1 aqueous solution of 50 m M sodium cacodylate, pH 7.2, 10 m M MgCl2, 0.5 m M DTT, and l m M GTP at 37 ° for 15 min prior to addition of 0.3 A260 unit of Phe-tRNA l~c, and is then incubated for another 5 min. The ternary complex is then bound to the ribosome by adding the ternary complex mixture (containing approximately 15 pmol of Phe-tRNA 1~) to the reaction mixture of 50 m M sodium cacodylate, pH 7.2, 150 m M KC1, 5 m M MgCI2, 1 m M DTT, 30/zg poly(U), and 45-50 pmol ribosomes. The reaction mixture (total volume of 100 gl) is then incubated at 4 ° for 2 hr. This will give binding to both the A site and the P site of the ribosome. There is no protocol for binding tRNA to the A site only. P-Site Binding Assay. There are two different methods of binding tRNA to the P site. One is to use deacylated tRNA and bind it to the ribosome. Using this method, tRNA v~c is 5'-end-labeled with [32p]ATP according to the method outlined by Chaconas and Van de Sande. s Binding the tRNA to 70S tight-couple ribosomes follows the protocol given by Douthwaite et al.14 except that the volume of the mixture can be reduced to 100/zl. Twenty to 100 pmol of [32p]tRNA~ is incubated in 100/zl of 50 m M sodium cacodylate, pH 7.2, 16 m M MgC12, 120 m M KC1, and 1 m M DTT with 50 pmol ribosomes and 40/zg poly(U) for 2 hr at 4 °. The amount of binding can then be monitored by measuring the radioactivity of the [32p]tRNA- ribosome complex. A more definitive method is to use N-Ac-Phe-tRNAphe, which can be prepared using the method of Haenni and Chapeville. ~5An equal volume of saturated potassium acetate buffer (pH 5) is added to 5 mg of [14C]PhetRNA ehe. A total volume of 0.1 ml of redistilled acetic anhydride is then added to the mixture and maintained at 4 ° over a period of 60 min. After 14S. Douthwaite, J. Christensen, and R. A. Garrett, J. Mol. Biol. 169, 249 (1983). 15A. L. Haenni, and F. Chapeville, Biochim. Biophys. Acta 114, 135 (1966).
410
CHEMICAL AND ENZYMATIC PROBING METHODS
[26]
the incubation, 1.62 ml of water is added, followed by 3.5 ml of cold ethanol. The mixture is maintained for 2 hr at - 20°, then centrifuged. The RNA is dissolved in water. The acetylation by this method approaches 100%. The product, N-Ac-Phe-tRNAr~, can then be bound to the ribosomes using the binding conditions for the deacylated tRNA described above. Puromycin Assay. The classical method for distinguishing between A-site and P-site binding is by the use of puromycin. Among several existing protocols for this method, a recent one described by Wurmbach and Nierhaus t3 is that which is followed in this laboratory. In this protocol, binding buffer containing 0.6 m M GTP, 6 mM phosphoenolpyruvate, and 4 gg of pyruvate kinase is incubated with the tRNA-ribosome complex for 10 min at 37 °. Ten microliters of a 10 m M puromycin solution in binding buffer is added to the aliquot and the mixture then incubated for 30 min at 4 °. The reaction is stopped with 0:2 M sodium acetate, pH 5.5, in saturated MgSO4. Ethyl acetate is then added and, after vigorous shaking and phase separation, the upper phase is removed and assayed for radioactivity.
Initiation Complex Assay Three different methods can be utilized to assay the formation of the initiation complex between bacteriophage mRNA and ribosomes. The filter-binding assay outlined by Baan et al.16 can be used to demonstrate the binding of natural mRNA by 70S ribosomes. Gradient-binding assays using isotope-labeled mRNA and 70S ribosomes will show complex formation using 16 or not using 17 glutaraldehyde fixation. The method of Jay and Kaempfer~s using glutaraldehyde fixation will also allow observation of the complex formation between the 30S subunits, fMet-tRNA, IF-2, and mRNA. Using short cDNA oligomers in these assays allows us to assay the effective competition of the probe for single-stranded rRNA regions involved in the initiation process. It is sometimes necessary to use two (or more) probes to detect the subtle mRNA-30S subunit interactions--one probe for the rRNA and the other for the Shine-Dalgarno region of the mRNA.tT,19 16 R. A. Baan, J. J. Duijijes, E. van Lecrdam, P. H. van Knippenberg, and L. Bosch, Proc. Natl. Acad. Sci. U.S.A. 73, 702 (1976). 17 T. Taniguchi and C. Weissrnann, Nature (London) 275, 770 (1978). is G. Jay and R. Kacmpfer, J. Biol. Chem. 250, 5749 (1975). 19C. Backendorf, G. P. Overbeek, J. H. van Boom, G. van Der Marel, G. Veeneman, and J. van Duin, Eur. J. Biochem. 110, 599 (1980).
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
411
Protein Synthes& Assay The translational activity of the ribosomes can be assayed by measuring the poly(U)-direeted [~4C]phenylalanine incorporation or R17-direeted [~4C]valine incorporation. In vitro protein synthesis protocol has been adapted from Traub et al. 2° In the procedure, a 150-/A reaction mixture contains 140/~g 50S subunits, 70/tg 30S subunits, 3/tg pyruvate kinase, messenger RNA [40 #g of poly(U) or 150/tg of R17 RNA], 800/tg tRNA, aliquots of S 100 and crude initiation factor fractions (titrated for optimal activity), 33 m M Tris-HC1, pH 7.4, 33 m M magnesium acetate, 136 m M NH4CI, 0.33 m M of each amino acid, 7 m M ATP, 0.2 m M GTP, 24 m M 2-mercaptoethanol, 7 m M DTT, 3 3 m M phosphoenolpyruvate, and 0 . 0 5 m M [~4C]phenylalanine (10 Ci/mol) for poly(U) template or 0.05 m M [~4C]valine for R17 RNA template. Probes will either be complexed with the subunits before the assay is begun or added to the assay mixture while it is incubating, depending upon the information that is needed. Limitation of the cDNA Probing Technique Resolution of this Technique Can the probes discriminate between functionalities of single nucleotides in rRNA? In order to probe the function of a region it would be very useful to make probes of various lengths which cover varying portions of the region being studied. This would allow information to be obtained about the activity of individual nueleotides on the rRNA. We have obtained preliminary results from two rRNA regions which lead us to believe that the activity of a region can be assessed down to a single nucleotide. In the ease of the region of the C-1400 of 16S rRNA, which has been shown to be close to the anticodon loop of tRNA in both the P site and A site,2~a2 we have observed the following. When a probe complementary to bases 1393- 1401 was hybridized to the 70S ribosomes, deaeylated tRNA was able to readily bind at the P site, displacing the bound eDNA probe (Fig. 5). Conversely, the eDNA probe could not displace the bound tRNA (Fig. 6). However, probes complementary to bases 1393-1399 and 1401- 1406 could readily hybridize with rRNA in 2o p. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this series, Vol. 20, p. 391. 21 j. B. Prince, B. H. Taylor, D. L. Thurlow, J. Ofengand, and R. Zimmermann, Proc. Natl. Acad. Sci. U.S.A. 79, 5450 (1982). 22 p. Gornicki, J. Ciesiolka, and J. Ofengand, Biochemistry 24, 4924 0985).
412
CHEMICAL AND ENZYMATIC PROBING METHODS
[26]
60
50 i
qO 30
u') o no
20
k4
lO
q
6
tRN@/RIBOSOH( INOL/MOL]
FI6. 5. Competitive displacement of bound probes. Fifty picomoles of tight-couple 70S ribosomes was preincubated with 1000 pmol of a2p-labeled probe complementary to the 1393-1401 region of 16S rRNA. The reaction was carried out in buffer containing 50 mM sodium cacodylate, pH 7.2, 16 mM MgCl2, 120 mM KCI, I mM DTT, and 20/zg poly(U) at 4 ° overnight. After the preincubation, increasing amounts of deacylated tRNA ~¢ were added and the incubation was allowed to p r c ~ l for 2 hr at 4°. Following the incubation, the reaction mixture was filtered through nitrocellulose, the filters dried, and the retained radioactivity monitored using liquid scintillation.
the presence or absence of bound tRNA. In turn, the tRNA could readily bind to the P site without displacing the probe when the probe had been previously hybridized to either of these regions. All of these results point to the fact that C-1400 is in close proximity to tRNA in the P site and that a variation of one base in the probe alters the competition with tRNA markedly. Similar experiments have been carried out on the 803-811 region of the 23S rRNA. It has been suggested23 that bases 807-809 in the 23S rRNA may be base paired with the terminal Y-CCA on tRNA. In order to check this possibility, we have made a number of probes complementary to various portions of this region (801-806, 802-807, 803-808, and 803811) which gradually cover bases in the 807-809 region. There is no competition with tRNA when the 801-806 probe is added. With the 802-807 and 803- 808 probes we see increasing competition with tRNA binding. When the 803- 811 probe is used we see a marked decrease in the 23A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 (1984).
[26]
PROBING
RIBOSOME
STRUCTURE
AND
FUNCTION
413
30
20
W 0 u'J m, n,.-
lO
N
O
i
I
I
|
PRflBE/RIBflSOHE [HOk/HOL) FIG. 6. Competitive displacement of bound tRNA. Fifty picomoles of tight-couple 70S ribosomes was preincubated for 2 hr at 4 ° with 100 pmol labeled, deacylated tRNA TM in binding buffer [50 m M sodium cacodylatc, pH 7.2, 16 m M MgCI2, 120 m M KCI, 1 m M DTT, and 20 #g poly(U)]. Increasing m o u n t s of eDNA probes complementary to bases 1393-1401 of 16S rRNA were then added and the reaction mixture was further incubated at 4 ° overnight. The reaction mixture was then filtered through a nitrocellulose filter, the filter was dried, and the radioactivity retained by the filter was counted using liquid scintillation.
ability of tRNA to bind to the ribosome, suggesting that bases 807-809 may indeed be involved in tRNA binding. We have also seen marked differences between the binding of probes to the two sides of the 518-533 loop in 16S rRNA. This study shows that probes made to the 518-526 region of this loop bind well and specifically, resulting in the generation of appropriate-sized RNA fragments by RNase H. However, probes made to the 526-534 region of the loop bind very poorly, if at all, and show essentially no RNase H clipping in unwashed 30S subunits. These results suggest that portions of the 526-534 region may be involved in protein-RNA interactions or in tertiary structure interactions with other rRNA regions. Preliminary results suggest that it might be the latter, since probes do not appear to bind well to the 526- 534 region of naked 16S rRNA nor is RNase H clipping present under these circumstances. All of the above examples dearly show that variation of the probe length tells us much about the reactivity of particular bases or regions in the rRNA. It is imperative, however, to continually monitor the binding to assure specificity of interaction, for there are normally multiple sites with partial complementarity.
414
CHEMICAL AND ENZYMATIC PROBING METHODS
[9-6]
Secondary Interactions It is virtually impossible to discriminate between effects caused by the positioning of the cDNA probe on the ribosomal RNA and those that may be caused by slight structural alterations or environmental changes that may have been induced by the presence of the probe. For instance, as mentioned above, hybridizing a cDNA probe to the loop of a stem-loop structure may strain the stem helix sufficiently to cause it to dissociate to a degree. Other changes of a more remarkable nature have been reported. Henderson and Lake 24 have reported the virtual disruption of the 50S subunit as a result of binding a biotinylated probe to the ot-sarcin region. However, this may be entirely due to the ionic conditions under which their experiment was made, rather than a direct effect of the binding of the probe. In order to assay for gross morphological changes that may occur as a result of hybridizing probes to rRNA, we have checked many of our samples using quasi-elastic light scattering. This method utilizes laser scattering to provide the translational diffusion coefficient for a macromolecule. The diffusion coefficient is inversely related to the frictional coefficient of the particle. We have observed that in most cases there was no observable change in the diffusion coefficient of the subunit(s) with or without bound probe. However, in a few cases, notably when binding a probe to the 820 region (bases 815-823) of 16S rRNA, a substantial structural change was observed. In this particular case we found that upon binding the 16S-820 probe to the 30S subunit, there was a marked decrease in the diffusion coefficient of the particle. Composite agarose/acrylamide gel electrophoresis showed that the complexed 30S subunits migrated substantially more slowly than their uncomplexed counterparts (Fig. 7). Both results suggest that the subunit itself is loosening to a substantial degree. It is intriguing that a similar loosening of the subunit is observed when protein S 1 is bound to the 30S subunit. In this case, S 1 is either causing a loosening or substantially changing the hydrodynamic parameters of the subunit. It is of interest that one of the S1 binding sites is suspected to be in the region of bases 820- 825 of the 16S rRNA. 25 Although quasi-elastic light-scattering measurements are excellent determinants of large structural changes, small modifications in the structure will not be accessible to this method of analysis. 24 E. Henderson and J. A. lake, Proc. FEBS Congr., 16th p. 219 (1985). 25 T. Suryanarayana and A. R. Subramanian, Biochemistry 23, 1047 (1984).
[26]
PROBING RIBOSOME STRUCTURE AND FUNCTION
415
Fro. 7. Composite gel pattern of 30S ribosomes with and without bound probe complementary to bases 813-821. Various concentrations of 16S(2) were incubated with 50gg of 30S subunits after which the subunits were run for 4 hr at 200 V in a 396 polyacrylamide/ 0.5% agarose composite gel. Lane 1, no 16S(2); lane 2, 220 pmol 16S(2); lane 3, 440 pmoi 16S(2); lane 4, 880 pmol 16S(2). The positions of 30S forms corresponding to 30S ribosomal subunits containing SI (+S1) and without S1 ( - S I ) are indicated beside the gel. Although it is not readily apparent from the photograph of the gel, there is marked decrease of intensity of the upper (+ S 1) band and an increase in the lower ( - S 1) band as the amount of 16S(2) probe is increased.
416
CHEMICAL A N D E N Z Y M A T I C PROBING METHODS
[26]
Specific Applications Subunit Association Sites
That certain rRNA regions may be involved in subunit association has been suggested by several different studies. 2,3a~a7 In order to test whether a region is involved in subunit association, cDNA-subunit complexes are assayed for their ability to prevent the formation of 70S ribosomes. The subunit association mixtures contain 100 pmol of each subunit and 2400 pmol of eDNA probe in 100/zl binding buffer. The mixtures are incubated at 37* for 50 min to promote 70S ribosome formation. A 12-ml, 5 - 2 0 % sucrose gradient, centrifuged for 4.5 hr at 37,000 in a Beckman SW41 rotor, separates the 70S ribosomes from the unassociated subunits. Probes complementary to 16S rRNA bases 787-795 and 23S rRNA bases 2750-2758 significantly inhibit subunit association.llaS These rRNA regions appear to be directly involved in the mechanism of subunit association. Hybridizing a eDNA probe to bases 2306-2313 of 23S rRNA partially inhibits subunit association, indicating this rRNA region may be involved in subunit association to some degree. Several other probes have no effect on subunit association. Among these are probes complementary to 16S rRNA regions around bases 530 and 815- 823 and to the 23S rRNA region around base 2606. It should be noted that previous investigation suggests that the 820 region of 16S rRNA may be important for subunit association. 26 Regions of rRNA are shown to be located at the subunit interface when eDNA probes hybridize to isolated subunits but not to 70S ribosomes. Sucrose gradient assays and nitrocellulose filter-binding assays are used to test the binding of probe to 70S ribosomes and the isolated subunits? 2 In addition to the regions mentioned above, we have shown that 16S rRNA regions 518- 530 and 815 - 823 and 23S rRNA regions 2448-2454, 24972505, and 2306-2313 may be located at the subunit interface. tRNA Binding Sites
Recent evidence suggested that the 807-809 region of the 23S rRNA might base-pair with the CCA Y-terminus of tRNA. 23 A probe was made to this region and the binding assay gave solid evidence that this site was 26W. Herr, M. N. Chapman, and H. F. Noller,J. Mol. Biol. 130, 433 (1979). 27 D. Burma, D. Tewari, and A. Srivastava,Arch. Biochem. Biophys. 239, 427 (1985). 2s W. Hill, W. Tapprich, and A. Tassanakajohn, in "The Structure, Function and Geneticsof Ribosomes"(B. Hardesty,ed.), p. 233. Springer-Vedag, New York, 1986.
[26]
PROBING
RIBOSOME
STRUCTURE
AND
FUNCTION
417
involved in tRNA binding to the P site. In this experiment, 30 pmol of 70S ribosomes was preincubated at 4 ° overnight with 600 pmol of cDNA in 100 pl of reaction mixture containing 50 m M sodium cacodylate, pH 7.2, 16 m M MgC12, 120 ~ KC1, and 1 m M DTT (tRNA binding buffer). Increasing concentrations of tRNA ~ and 20 pg poly(U) were added and the incubation was allowed to proceed for 2 hr at 4 °. Following the incubation, the reaction mixtures were filtered through nitrocellulose and the filters washed, dried, and the radioactivity determined using liquid scintillation. These results clearly show that tRNA can compete with the cDNA probe bound to the 8 0 3 - 811 region (see Fig. 8). The 803- 811 probe can also compete with bound tRNA as shown in Fig. 9. Further results using the shorter probes around and including the 807-809 region, as mentioned earlier, show that the 807-809 region is implicated in P-site tRNA binding. Another region of interest for tRNA binding is the region surrounding C-1400 in 16S rRNA. It has been shown that the anticodon loops o f t R N A bound to both the A site and the P site are in close proximity to this region of the rRNA. Probes were made complementary to bases 1393-1399, 1393- 1401, 1401- 1406, and 1394- 1406. When the 1393- 1401 probe was hybridized to the 16S rRNA, tRNA added to the complex could readily displace the probe. When tRNA was present, this probe would not
8O 7O
tn
So
uJ
~o ~us
ID 0 0.0
I
1
I
i
o.q
0.8
].2
],6
7.0
t RNR/RI BOSONF.. (HflL/NflL)
Fro. 8. Competitivedisplacement of bound probe. Displacement of bound probe complementary to bases 803-811 in the 23S rRNA as the amount of deacylated tRNA is increased. See legend to Fig. 5 for conditions.
418
CHEMICAL
AND
ENZYMATIC
PROBING
METHODS
[26]
60
W
30
fD m b,e lO
0 --
I
i
!
I
PROSE/RIBO$~ (~OL/NOL) FIG. 9. Competitivedisplacement of bound, deacylatedtRNA. Displacement of tRNA remaining bound to tight-couple 70S ribosomesas the amount of probe complementaryto bases 803-811 in the 23S rRNA is added. See Fig. 6 for conditions.
bind. When the 1394-1406 probe was hybridized to 16S rRNA, tRNA could not readily displace it, but it could easily displace bound tRNA. However, when the probe complementary to the 1393-1399 region was used, tRNA could readily bind to the P site without displacing the probe. In turn, the probe could readily bind to the 1393- 1399 region with tRNA present in the P site. The probe complementary to 1401 - 1406 binds readily to the target site and is not inhibited by tRNA either. These results clearly indicate that base C-1400 is in close proximity to the tRNA as the cross-linking studies have indicated. It is interesting to note that the probe complementary to bases 13931399 showed two discrete bands when incubated with RNase H. Upon carefully perusing the sequence of 16S rRNA, it appears that the CACAC sequence found in the 1395 - 1399 region occurs once again in the region of bases 1407- 141 l, a portion of which is supposed to be base paired with regions 1489- 1491. Our initial results suggest that if this base pairing exists at all, it is very labile, since the probe apparently can bind both sites equally well.
Other Sites There are many other assays that can be used to determine the function of various regions of the rRNA. Clearly, binding of mRNA can be assayed
[2 7]
EXTENSION INHIBITION ANALYSIS
419
as it comes in juxtaposition with the ribosome. Specifically, the ShineDalgarno region can be checked an additional time to show its efficacy in binding mRNA. In addition, probes complementary to the message itself can be made to ascertain the exposed regions of the mRNA at various times in the translational process. The binding of translation factors to the ribosomes has long been of significant interest. For instance, IF-3 has been implicated in binding a region of 16S rRNA around bases 1495- 1512) 6 Probes to this site can be made to test this suggestion. It is also possible that some of the binding sites of ribosomal proteins themselves can be ascertained by using reconstituted subunits deficient in a single protein. One of the limitations here is that many of the putative protein-binding sites are base paired. All in all it appears that this technique offers a way of providing substantive insight into the structure and function of regions of rRNA in the ribosome. Acknowledgments We are most grateful for the useful comments and discussions by our colleagues in various laboratories. Of special note is our appreciation to the late Dr. Gary Craven whose enthusiastic support and insight were of major importance in this work. This study was supported in part by a grant from the National Science Foundation, DMB 84-17297.
[27] Extension
Inhibition Analysis of Translation Initiation Complexes 1
B y D I E T E R H A R T Z , D A V I D S. M C P H E E T E R S , R O B E R T T R A U T , and LARRY GOLD
Introduction Primer extension analysis of RNA has become a popular method for the study of RNA sequence, 2 structure, 3'4 and protein- RNA interactions. 5 i This work was supported by National Institutes of Health Research Grants GM28685 and GM 19963. 2 M. Belfort, J. Pedersen-Lane, K. Ehrenman, F. K. Chu, G. F. Maley, F. Maley, D. S. McPheeters, and L. Gold, Gene 41, 93 (1986). a T. Inoue and T. R. Cech, Proc. Natl. Acad. Sci. U.S.A. 82, 648 (1985). 4 D. Moazed, S. Stern, and H. F. Noller, £ Mol. Biol. 187, 399 (1986). S. Stem, R. C. Wilson, and H. F. Noller, £ MoL BioL 192, 101 (1986). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formre.fred.
[2 7]
EXTENSION INHIBITION ANALYSIS
419
as it comes in juxtaposition with the ribosome. Specifically, the ShineDalgarno region can be checked an additional time to show its efficacy in binding mRNA. In addition, probes complementary to the message itself can be made to ascertain the exposed regions of the mRNA at various times in the translational process. The binding of translation factors to the ribosomes has long been of significant interest. For instance, IF-3 has been implicated in binding a region of 16S rRNA around bases 1495- 1512) 6 Probes to this site can be made to test this suggestion. It is also possible that some of the binding sites of ribosomal proteins themselves can be ascertained by using reconstituted subunits deficient in a single protein. One of the limitations here is that many of the putative protein-binding sites are base paired. All in all it appears that this technique offers a way of providing substantive insight into the structure and function of regions of rRNA in the ribosome. Acknowledgments We are most grateful for the useful comments and discussions by our colleagues in various laboratories. Of special note is our appreciation to the late Dr. Gary Craven whose enthusiastic support and insight were of major importance in this work. This study was supported in part by a grant from the National Science Foundation, DMB 84-17297.
[27] Extension
Inhibition Analysis of Translation Initiation Complexes 1
B y D I E T E R H A R T Z , D A V I D S. M C P H E E T E R S , R O B E R T T R A U T , and LARRY GOLD
Introduction Primer extension analysis of RNA has become a popular method for the study of RNA sequence, 2 structure, 3'4 and protein- RNA interactions. 5 i This work was supported by National Institutes of Health Research Grants GM28685 and GM 19963. 2 M. Belfort, J. Pedersen-Lane, K. Ehrenman, F. K. Chu, G. F. Maley, F. Maley, D. S. McPheeters, and L. Gold, Gene 41, 93 (1986). a T. Inoue and T. R. Cech, Proc. Natl. Acad. Sci. U.S.A. 82, 648 (1985). 4 D. Moazed, S. Stern, and H. F. Noller, £ Mol. Biol. 187, 399 (1986). S. Stem, R. C. Wilson, and H. F. Noller, £ MoL BioL 192, 101 (1986). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formre.fred.
420
CHEMICAL AND ENZYMATIC PROBING METHODS
[27]
We have applied a variation of this method, which we term extension inhibition (also known as toeprinting), to the study of translation initiation complexes. In this paper we describe the method using the bacteriophage T4 gene 32 mRNA. Early experiments showed that ribosomes, in the presence of fMettRNA~ '~, could properly select translation initiation regions of bacteriophage RNA and protect these regions from ribonuclease digestion.~ Kolakofsky and Weissman7 subsequently demonstrated that a 70S-fMettRNA}~n complex, bound to the coat protein initiation site on Qfl plus strand RNA, cannot be dislodged by Qfl replicase engaged in negative strand synthesis. We reasoned that specific binding of ribosomes (30S or 70S) to mRNA might lead to pausing or termination of reverse transcriptase when a bound ribosome is encountered. In extension inhibition, a 5'-32p-end-labeled oligodeoxyribonucleotide, complementary to a region on the mRNA that is 3' to the initiation codon, is annealed to either total cellular RNA or to a purified transcript. This [32p]oligonucleotide-mRNA hybrid is then incubated with ribosomes, and the complexes analyzed by primer extension. Materials Avian myeloblastosis virus (AMV) reverse transcriptase and T4 polynucleotide kinase were obtained from Life Sciences and United States Biochemical Corporation, respectively. Uncharged Escherichia coli tRNAfM~t and tRNA ehe were obtained from Boehringer Mannheim Biochemicals. [7-32P]ATP (1000-3000 Ci/mmol) and dideoxy- and deoxyribonudeotide triphosphates were obtained from New England Nuclear and PL-Pharmacia, respectively. High-salt-washed E. coli 30S ribosomes were prepared according to Kenny et al. s These 30S ribosomes are substantially free of initiation factors and tRNA. The synthetic oligonucleotide primer, complementary to nucleotides + 110 to + 128 of the bacteriophage T4 gene 32 coding sequence,9 was made on an Applied Biosystems Model 380A DNA synthesizer and purified by preparative gel electrophoresis. Standard buffer (SB) contains 60 m M NH4C1, l0 m M Tris-acetate, pH 7.4, 6 m M 2-mercaptoethanol, and, where indicated, l0 m M magnesium acetate. Loading buffer contains 94% (v/v) deionized formamide, 36 m M 6For a review, see J. A. Steitz, in "RNA Phages" (N. Zinder, ed.), p. 319. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1975. D. Kolakofsky and C. Weissman, Nature (London), New Biol. 231, 42 (1971 ). 8 j. W. Kenny, T. G. Fanning, J. M. Lambert, and R. R. Traut, Jr. Mol. Biol. 135, 151 (1979). 9 H. Krisch and B. Allet, Proc. Natl. Acad. Sci. U.S.A. 79, 4937 0982).
[27]
EXTENSION INHIBITION ANALYSIS
421
Tris-borate, pH 8.0, 36 m M boric acid, 0.8 m M ethylenediaminetetraacetic acid (EDTA). Methods 5'-End-Labeling Ten picomoles of the synthetic oligonucleotide primer was 5'-endlabeled with 10 pmol of [7-32p]ATP in a 10/A reaction using T4 polynucleotide kinase under standard conditions) ° The reaction mixture was sequentially extracted with phenol, chloroform, and ether, and dried in a Speed Vac Concentrator. The labeled primer was resuspended in 20 gl H20. RNA A l-liter culture ofE. coli NaplV H at 2.4 × l0 s cells/ml was infected with T4-33amN134-55amBL292 (multiplicity of infection = 10) at 30 °. Rifampicin was added to a final concentration of 200 gg]ml at 12 rain postinfection. At 30 rain postinfection the cells were harvested into ice and RNA extracted according to McPheeters et al.t2 After ethanol precipitation, the crude RNA was dissolved in 10 ml of 10 m M Tris-C1, pH 7.4, 1 m M EDTA. Solid CsC1 was added to a final concentration of 7.5 molal and the solution layered on top of four tubes each containing 2 ml of 9.5 molal CsC1. The RNA was pelleted by centrifugation at 30,000 rpm for 14 hr at 7 °, using an SW51 rotor. The RNA was dialyzed against 10 m M Tris-C1, pH 7.4, 1 m M E D T A and phenol extracted. The RNA was ethanol precipitated at - 2 0 °, collected by centrifugation, dried, resuspended in H20 at about 10 mg/ml, and stored at --20 °. E. coli infected by this T4 strain under the above conditions is enriched for the gene 32 mRNA and is depleted of most other (less stable) mRNAs. ~3 Initiation Complex Formation and Extension Inhibition Annealing mixtures for extension inhibition reactions contained 0.6 pmol of 5'-32p-end-labeled oligonucleotide and 10 gg of total RNA from T4 infected cells in 10 gl SB(-Mg). Ifa purified transcript is used (from an 10T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual," p. 122. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982. H M. A. Nelson, M. Ericson, L. Gold, and J. F. Pulitzer, Mot. Gen. Genet. 188, 60 (1982). L2D. S. McPheeters, A. Christensen, E. T. Young, G. Stormo, and L. Gold, Nucleic Acids Res., 14, 5813 (1986). 13 M. Russel, L. Gold, H. Morrissett, and P. Z. O'Farrell, J. Biol. Chem. 251, 7263 (1976).
422
CHEMICAL AND ENZYMATIC PROBING METHODS
[27]
SP6 or T7 polymerase reaction, for example), 0.2 pmol of the purified transcript may be used per 10/zl annealing mixture. The annealing mixtures were heated to 60 ° for 3 min, placed into dry ice-ethanol for 1 min, and allowed to thaw on ice. The annealing mixtures were centrifuged briefly and 2/zl SB containing 60 m M magnesium acetate was added. All components added subsequently to extension inhibition reactions (below) were diluted in SB ( + Mg). Extension inhibition reactions contained 4/zl annealing mixture plus 1/zl 3.75 m M dATP, dCTP, dGTP, dTTP, plus 2/~1 of 0.125 # M 30S ribosomes. After preincubation at 37 ° for 5 min, 2/zl of 5.0 #M uncharged tRNA was added, followed by incubation at 37 ° for 5 min. The reaction was initiated by the addition of 1/zl (0.5 unit) reverse transcriptase. Incubation of the extension inhibition reaction was continued at 37 ° for 15 min. Reactions were terminated by heating to 95 ° for 2 min and addition of 20/zl of loading dye; 5.0/zl of the reactions was analyzed on 8% sequencing gels. 14 Sequencing reactions were done as described above using dideoxynucleotide triphosphates at a final concentration of 200 #M, without preincubation or the addition of ribosomes and tRNA to the reactions. Results and Discussion Incubation of 3.3/zg total RNA from T4-infected cells with 0.025 p.M 30S ribosomes causes a slight inhibition in the production of fuU-length extension products and the concurrent appearance of faint stops at positions T-15, T-17, and A-18 (Fig. 1, lane 1). We estimate that 1% of the RNA is gene 32 message, which corresponds to a final concentration of 0.008 p314. Incubation of the RNA with 0.025 # M 30S ribosomes and 1.0 a M uncharged tRNA~ n causes the appearance of a single strong stop at position T-15 and a strong inhibition of production of full-length transcripts (lane 2). Higher concentrations of 30S ribosomes and tRNA~t'~ can completely inhibit production of full-length transcripts. 15 If the incubation mixture (30S ribosomes + tRNAftn) is phenol extracted and ethanol precipitated before subsequent primer extension, the strong stop at position T-15 completely disappears and production of full-length transcripts is restored (data not shown). The second codon of the gene 32 mRNA is UUU. If the RNA from T4-infected cells is incubated with 0.025/zM 30S ribosomes and 1.0 #M u n c h a r g e d t R N A Phe (instead of tRNA}4'~), the position of the strong stop is shifted by exactly three nucleotides to position A-18 (lane 3). We suggest ~4A. Maxam and W. Gilbert, this series, Vol. 65, p. 499. t5 D. McPheeters, D. Hartz, and L. Gold, manuscript in preparation.
¥ Z O~ +
EL
EL
(3_
EL
"~
"o
"~
"o
t
G
T
0
Z 0:~ -p u3
0 4-
..k
v
v
A
C
1
Z
3
TICS} TilT) A(t8)
FIo. 1. Extension inhibition analysis of the T4 gene 32 mRNA using total RNA from T4 infected cells. The sequence surrounding the gene 32 initiation eodon is shown at left with the initiation codon and Shine and Dalgarno sequence bracketed. The four sequencing lanes (lanes A,C,G,T) are taken from a darker exposure of the same gel used for lanes 0 - 3. For details see text.
424
CHEMICAL AND ENZYMATIC PROBING METHODS
[27]
1
tRNA FIG. 2. Information content of E. coli ribosome binding sites (the graph is redrawn and extended from the version shown in Ref. 21) and model for inhibition of reverse transcriptase (RVT) by 30S-tRNA~aa and 30S-tRNA TM complexes bound to the gene 32 mRNA. The arrows above the upper and lower sequences indicate the positions of the strong stops seen when mRNA and 30S particles are incubated with tRNA~a~ and tRNA TM, respectively. The tRNA is shown residing in the anticodon stem/loop binding portion of the ribosomal P site. For details see text.
that tRNA P~ can fill the same tRNA binding site of the 30S ribosome as t R N A ~ ~t, and has repositioned the m R N A with respect to the ribosome. The tRNA binding site of the 30S particle contributes to the ribosomal P site. Other uncharged tRNAs can also be used to shift the relative position of the m R N A and ribosome; in each case, the stop is located at a distance 15 nucleotides from the 5'-nucleotide of the codon read by the tRNA.15,~6 16The 5'-nucleotide of the codon read by the tRNA used is designated zero.
[27]
EXTENSION INHIBITION ANALYSIS
425
Preliminary results, utilizing gene 32 mRNA synthesized in vitro using T7 RNA polymerase, have failed to detect any inhibition of primer extension using 30S ribosomes alone. 17 When tRNA~ n is added to the reaction with purified gene 32 mRNA, the strong stop at position T-15 is again seen. Extension inhibition by ribosomes without added tRNA (lane l) must be due to endogenous tRNA in the crude mRNA preparations. Although we do not see 30S-mRNA complexes on gene 32 mRNA, it is possible that with other mRNAs we may find inhibition of primer extension using 30S ribosomes alone. Likely candidates for such mRNAs might be ones with greater complementarity to the 3' end of 16S rRNA, or mRNAs with sequences that interact with other domains of 16S rRNA.IS-20 In a statistical analysis of E. coli ribosome binding sites, Schneider et al. 2t found that the information in these sites extends from position - 2 0 to + 13 (Fig. 2). This agrees well with our extension inhibition results and closely matches the length of several mRNA fragments resulting from nuclease digestion of 70S-fMet-tRNA~ ra- mRNA complexes.6 We believe that, during initiation, the entire region of mRNA from --20 to + 13 is contacted by the ribosome, and that the results of extension inhibition analysis coincide with the statistical analysis because of the collision event diagrammed in Fig. 2. Extension inhibition has been used successfully with plasmid-encoded transcripts and other T4 mRNAs. Extension inhibition has also provided an assay for translation repressors that act to prevent ribosome binding at specific initiation domains.22~3 We are currently examining the effects of aminoacylated tRNA, 50S ribosomes, and initiation factors on the signal obtained using extension inhibition analysis.
~7R. Saunders, D. S. McPheeters, and L. Gold, unpublished observations (1986). ~s For a review, see L. Gold, D. Pribnow, T. Schneider, S. Shinedling, B. S. Singer, and G. Stormo, Annu. Rev. Microbiol. 35, 365 0981). m9L. Gold, G. Stormo, and R. Saunders, Proc. Natl. Acad. Sci. U.S.A. 81, 7061 (1984). 20H. Noller and L. Gold, manuscript in preparation. 2~T. D. Schneider, G. D. Stormo, L. Gold, and A. Ehrenfeucht, J. Mol. Biol. 188, 415 0986). 22 D. S. McPheeters, G. D. Stormo, and L. Gold, J. Mol. Biol., in press (1988). 23 R. B. Winter, L. Morfissey, P. Gauss, L. Gold, T. Hsu, and J. Karam,/'roc. Natl. Acad. Sci. U.S.A. 84, 7822 (1987).
426
CHEMICAL AND ENZYMATIC PROBING METHODS
[28]
[28] H o t T r i t i u m B o m b a r d m e n t T e c h n i q u e f o r Ribosome Surface Topography
By M. M. YusuPov and A. S. SPIRIN Studies of ribosome surface topography are aimed at localizing ribosomal proteins and ribosomal RNA sequences on ribosomes and determining the exposure of these proteins and RNA sections. The degree of exposure of ribosomal proteins on the ribosome surface can be determined by uniform marking of the ribosome surface. For this purpose the marker must have the following features. First, the marker must keep the ribosomal particles intact. Second, the marker must label only the ribosome surface and not penetrate into the ribosomal particles. Third, the modification must be nonspecific, i.e., it must mark all the surface amino acid residues equally. If these requirements are met, the degree of modification of individual ribosomal proteins will indicate their degree of exposure on the ribosome surface. In 1976 a simple technique was reported that allowed the introduction of tritium label into amino acids and peptides.l This method is based on the thermal catalytic dissociation of molecular gaseous 3H2 on hot tungsten. 2 The bombardment of polypeptides and proteins with the hot tritium atoms results in the incorporation of the label into the amino acid residues) The energy of the hot tritium atoms is selected so that the substitution of 3H for IH in the CH group of amino acid residues of proteins is achieved without destruction of the polypeptide structure.4 The reaction begins with the first collision of tn~tium atoms with the target. The directness of the flow of tritium atoms and the small depth of penetration of the reactive atoms (3 to 5 A) causes only an exposed surface of proteins to be labeled) Using the N-terminus fragment of myoglobin as an example it was shown that distribution of the label between amino acid residues depends on the tertiary structure of the polypeptide chain.4,5 Thus, hot tritium bombardment can label protein surfaces without injury to their structure and we have used this technique to study the A. V. Shishkov, E. S. Filatov, E. F. Simonov, M. S. Unukovich, V. I. Goldansky, and A. N. Nesrneyanov, Dokl. Akad. Nauk SSSR 228, 1237 (1976). 2 R. Klein and M. Scheer, J. Phys. Chem. 62, 1011 (1958). 3 A. V. Shishkov, L. A. Neiman, and V. S. Smolyakov, Usp. Khim. 7, 1125 (1984). 4 V. I. Goldansky, Y. M. Rumyantsev, A. V. Shishkov, L. A. Baratova, and L. P. Belyanova, Mol. Biol. 16, 528 (1982). 5 L. A. Baratova, V. I. Goldansky, Y. V. Rumyantsev, M. S. Unukovich, and A. V. Shishkov, Mol. Biol. 16, 117 (1982). METHODS IN ENZYMOLOGY, VOL. 164
English translationcopyright © 1988 by Academic Press, Inc.
[28]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
427
ribosome surface. It is evident that the degree of tritium labeling of different ribosomal proteins within the ribosome (in situ) must be proportional to the accessibility of the proteins to the tritium atom flow, i.e., to the degree of exposure of the proteins on the ribosome surface. Hot Tritium B o m b a r d m e n t T e c h n i q u e
Equipment The device shown in Fig. 1 is employed for hot tritium bombardment experiments. A cylindrical reactor (see Fig. 2)6 200 m m in length and
Fie. 1. Device for bombardment of hot tritium atoms: (1) cylindrical reactor, (2) soldered electrodes, (3) ampoule with tritium gas, (4) vacuum pump exit, (5) diffusion pump, (6) ionization and thermocouple vacuum meter, (7) thermostat.
6 M. M. Yusupov and A. S. Spirin, FEBSLett. 197, 229 (1986).
428
CHEMICAL AND ENZYMATIC PROBING METHODS
[9-8]
VOCUUm
3H 2
k__
---
~---3 ~4
FIG.2. Diagram of the cylindricalreactor:(1) solderedelectrodes,(2) tungstenwire,(3) thermostat,(4) target.ReproducedfromRef. 6. 70 mm in diameter is used. A coiled tungsten wire with a diameter of 0.1 mm and a length of 300 mm is placed along 0ae axis ofth~ reactor; the diameter of the spiral coil is about 2 to 3 mm. The vacuum system provides a residual pressure of 10-4 tort in the reactor.
Buffersfor Preparation of Ribosomes and Ribosomal Subunits A: 20 mM MgC12, 200 mM NH4C1, 6 mM 2-mereaptoethanol (2-ME), 0.1 mM ethylenediaminetetraaeetic acid disodium salt (Na2EDTA), 10 mM tds(hydroxymethyl)aminomethane (Tris)HC1, pH 7.4 B: 10 mM MgCI2, 500 mMNH4CI, 6 mM 2-ME, 0.1 mMNa2EDTA, 10 raM Tris-HC1, pH 7.4 C: 10 mM MgC12, 50 mM NI-~C1, 6 mM 2-ME, 0.1 mM Na2EDTA, 10 m M Tris-HCl, pH 7.4 D: 20 mM MgC12, 50 mM NH4C1, 6 rnM 2-ME, 10 mM Tris-HCl, pH 7.4 E: 20 raM MgC12, 100 mM NH4CI, 6 mM 2-ME, 10 mM Tris-HC1, pH 7.4 F: 1 mM MgC12, 500 mM NH4CI, 6 mM 2-ME, 10 mM Tris-HC1, pH 7.4 G: 20 mM MgCI2, 100 raM NH4CI, 1 mM dithiothreitol (DTT), 20 mM Tris-HC1, pH 7.4
[28]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
429
Preparation of Ribosomal Particles and Total Ribosomal Protein 6" Nondissociated ribosomes are prepared from Escherichia coli MRE 600 by the method of Staehelin et al. 7 with minor modifications. One hundred and fifty grams of frozen bacterial cells are thawed, suspended in 150 ml of buffer A, and disrupted in a French press. DNase (0.5 - 1.0/tg/ml suspension) is added to the cell homogenate. The suspension is centrifuged for 30 min at 30,000 g to remove debris. Ribosomes are pelleted from the cell extract (S-30) by centrifugation for 4 hr at 105,000 g, resuspended in buffer A, and additionally purified by centrifugation through a sucrose solution in a Ti-45 rotor: 32 ml of 30% sucrose in buffer B and a 33-ml ribosome suspension are added to every tube and then the tubes are centrifuged for 19 hr at 34,000 rpm. The ribosomes are suspended in buffer C, clarified by centrifugation for 30 min at 20,000 g, and stored in a 50-100 mg/ml concentration at - 70 °. Ribosomes for preparation of isolated subunits are also isolated from E. coli MRE 600. One hundred and fifty grams of frozen cells are melted, suspended in 150 ml of buffer D, and disrupted in a French press. DNase solution (0.5- 1.0/tg/ml suspension) is added to the cell homogenate. The suspension is centrifuged for 30 min at 30,000 g to remove debris. The ribosomes are pelleted from the supernatant (S-30) by centrifugation for 4 hr at 105,000 g, resuspended in the same buffer, clarified by centrifugation for 30 min at 20,000 g, and pelleted again by centrifugation for 4 hr at 105,000 g. The ribosomes are resuspended in the same buffer, clarified for 30 min at 20,000 g, and precipitated from the solution by addition of ammonium sulfate (49 g of solid ammonium sulfate per 100 ml of ribosome suspension with a concentration of about 1 mg/ml), s The ribosome precipitate is stored at 4 °. Isolated ribosomal subunits are prepared by the method described by Gavrilova et al. 9 The ribosome precipitate (1.0-1.5 g) under ammonium sulfate is collected by centrifugation for 1 hr at 30,000 g. The ribosomes are suspended in buffer E, dialyzed against the same buffer and then against buffer F, where the ribosomes dissociate into subunits. This suspension is centrifuged for 30 min at 30,000 g for clarification and the ribosomal subunits are isolated by centrifugation in a B-15 zonal rotor in a 7-30% sucrose gradient in buffer F for 14 hr at 27,000 rpm, 6 °. The ribosomal subunit fractions (30S and 50S) are collected, the concentration 6, All procedures are done at 4" unless stated otherwise. 7 T. Staehelin,.D. Maglott, and R. E. Monro, Cold Spring Harbor Syrup. Quant. Biol. 34, 39 (1969). s L. P. Gavrilova and V. V. Smolyaninov, Mol. Biol. 5, 883 (1971). 9 L. P. Gavrilova, O. E. Kostyashkina, V. E. Koteliansky, N. M. Rutkevich, and A. S. Spirin, J. Mol. Biol. 101, 537 (1976).
430
CHEMICAL AND ENZYMATIC PROBING METHODS
[9-8]
of magnesium ions is adjusted to 20 mM, and ammonium sulfate is added as described above for ribosomes. The ribosomal subunit precipitates are stored at 4 ° . Ammonium sulfate and sucrose are removed by dialysis against buffer G and the suspension is centrifuged for 30 min at 20,000 g to remove aggregates. Ribosomal subunit suspensions at concentrations from 10 to 30 mg/ml are stored at - 7 0 ° in the presence of 10% glycerol. Total ribosomal protein is prepared from an equimolar mixture of ribosomal subunits by extraction with 67% acetic acid in the presence of 0.1 M MgCl2.1° After removal of RNA the proteins are dialyzed against 5% acetic acid. The protein solution is clarified by centrifugation for 1 hr at 20,000 g and stored at - 70 °.
Preparation of Samples for Tritium Bombardment Samples for tritium bombardment experiments are prepared by two methods. In the first method, the sample suspensions are layered on the inner wall of the glass reactor as a thin film and frozen by immersing the reactor in liquid nitrogen. In the second method, the sample suspensions are first frozen and ground in liquid nitrogen. The sample is poured out drop by drop into liquid nitrogen in a cooled mortar and ground with a cooled pestle. The frozen powder is deposited on the inner wall of a horizontally manipulated revolving glass reactor. For hot tritium bombardment experiments, the following concentrations are used: for nondissociated ribosomes, 1 mg/ml; for 30S subunits, 1 mg/ml; for 50S subunits, 2 mg/ml; for ribosomes prepared from an equimolar mixture of isolated ribosomal subunits, 3 mg/ml; and for total ribosomal protein, 0.5 mg/ml. The volume of these samples is from 1 to 2 ml.
Tritium Bombardment Procedure The cylindrical reactor with the frozen sample is attached to the device and immersed in a thermostat with liquid nitrogen (Fig. 2). A vacuum, with a residual pressure of 10-4 torr, is produced in the reactor, and then tritium gas (3H2) is injected to adjust the pressure to 10-2 torr. Tritium is injected in doses using an ampoule with a total radioactivity of 0.1 Ci. Tritium atoms are generated in the reactor by heating the tungsten wire to 1000 K with an alternating current. The bombardment time is 3 min. These conditions of hot tritium bombardment ensure a direct flow of tritium atoms from the heated wire to the target 3 and provide labeled lo S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry8, 2897 (1969).
[28]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
431
ribosomal particles and labeled total ribosomal protein with a specific radioactivity of 6 X 107 to 30 X l0 T disintegrations/min (dpm) per millig_ram of protein. Analysis of Labeled Ribosomal Protein
Determination of Protein Radioactivity Solutions 5% and 10% trichloroacetic acid 0.2% bovine serum albumin in water PPO- POPOP- toluene: 0.4% 2,5-diphenyloxazrle (PPO) and 0.01% 4,4-bis(2,5-phenyl)oxazolylbenzene (POPOP) in toluene Triton X-100/PPO-POPOP-toluene: one volume of Triton X-100 and two volumes of PPO - POPOP- toluene
Procedure. Trichloroacetic acid to 5% and 100/~g of bovine serum albumin are added to an aliquot of labeled ribosome suspension (or ribosomal subunits, or total ribosomal protein) for determination of the radioactivity residing in ribosomal proteins. After hydrolysis of ribosomal RNA for 20 min at 90 °, the samples are filtered through GF/F filters (Whatman). The filters are washed additionally with 20 ml 5% trichloroacetic acid. This procedure also allows removal of exchangeable tritium from proteins. The radioactivity of ribosome precipitates on the filters is measured in a PPO-POPOP-toluene mixture. Two-Dimensional Electrophoresis of Labeled Ribosomal Protein Solutions A: 8 Murea, 1% 2-ME, 10 m M Bis-Tris-acetate, pH 4.2 B: 8 M urea, 4% acrylamide, 0.066% N,N'-methylenebisacrylamide (MBA), 40 m M Bis-Tris-acetate, pH 5.5 C: 10 m M Bis-Tris-acetate, pH 3.8 D: 10 mM Bis-Tris-acetate, pH 6.0 E: 6 M urea, 18% acrylamide, 0.5% MBA, 4 8 m M KOH-acetate, pH 4.6, 0.58% N,N,N',N'-tetramethyleneethylene (TEMED) F: 6 M urea, 4.5% acrylamide, 0.125% MBA, 12 m M KOH-acetate, pH 4.6, 0.58% TEMED G: 186 mMglycine-acetate, pH 4.0 H: 0.0125% Coomassie Blue G-250 in 10% trichloroacetic acid I: saturated water solution of basic fuchsin
432
CHEMICAL AND ENZYMATIC PROBING METHODS
[28]
Flo. 3. Two-dimensional electrophoresis of total ribosomal protein: 0.1 #g of total ribosomal protein in one slab. The proteins were stained for 12 hr in solution H.
Procedure. Ribosomal proteins are separated by two-dimensional polyacrylamide/urea gel electrophoresis as described by Kanny et al." with minor modifications. Total ribosomal protein is extracted from ribosomal particles with 67% acetic acid in the presence of 0.1 M MgC12 and precipitated with acetone. The ribosomal protein precipitate is incubated in buffer A at 37 ° for 1 hr to dissolve the protein and the proteins are purified by column chromatography on Sephadex G-25 in the same buffer. This procedure removes exchangeable tritium from the solution of labeled ribosomal proteins. Protein, 50- 150/zg in 30/zl of buffer A, is used for separation of total ribosomal protein by two-dimensional electrophoresis. Before loading, 1 #1 of basic fuchsin is added to the sample. 11 j. W. Kanny, J. M. Lambert, and R. R. Traut, this series, Vol. 59, p. 539.
[9.8]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
433
The first-dimension electrophoretic separation is made in glass tubes with a gel length of 7 cm and a 2 m m diameter. TEMED to 0.1% and ammonium persulfate to 0.03% are added to degassed solution B for gel polymerization. Electrophoresis is performed in a Bio-Rad instrument with a direct current of 1 mA/gel for 2 hr. The upper-electrode buffer C and the lower-electrode buffer D are used. Electrophoresis proceeds for about 2 hr. For the second electrophoretic separation the gel is polymerized between glass slabs of 80 × 80 × 0.1 mm. Ammonium persulfate to 0.2% is added to the degassed solution E and the slab is filled with the mixture to a height of about 70 mm. The gels for the first and the second dimensions are joined together by polymerization of solution F. For this, ammonium persulfate to 0.2% is added to the degassed solution F. Electrophoresis is done on a GE-4 instrument (Pharmacia Fine Chemicals) using a direct current of 10 mA/gel for 6 hr, using electrode buffer G. The slabs are stained for 1 to 12 hr in solution H and the gels washed with water. In our studies only proteins $9/S1 l, SI2/L20 and L32/L33 are not separated by two-dimensional electrophoresis (Fig. 3). The degree of labeling of individual ribosomal proteins in the samples is determined by fluorographic analysis.~2 Kodak KT-59T film is used. Control of Integrity of Labeled Ribosomes
Buffers A: l0 m M MgC12, 100 m M NH4CI, 0.1 m M Na2EDTA, 1 M DTT, 20 m M Tris-HC1, pH 7.4 B: buffer A but containing 1 m M MgC12 instead of l0 m M MgC12 In these experiments the nondissociated ribosomes in buffer A are used. The first method of sample preparation is utilized to reproduce the bombarded surface of the samples in repeated experiments. It has been shown that the degree of ribosome labeling depends on the tungsten wire temperature during bombardment (Fig. 4). The amount of unexchangeable tritium in ribosomal proteins and the total radioactivity of the samples increase linearly with wire temperature (at temperatures higher than 850 K). However, examination of the integrity of the labeled ribosomes has shown that the ribosomes can be destroyed at wire temperatures higher than 1100 K. In further experiments a tungsten wire at a temperature of 1000 K can be used. The integrity of the labeled ribosomes is examined by centrifugation of ~2W. M. Bonner and R. A. Laskey, Eur. J. Biochem. 46, 83 (1974).
434
CHEMICAL A N D ENZYMATIC PROBING METHODS
O.D
E
[28]
A
4x107
4x109
E
"~
E
a.
Q.
3x 107
3x 109
2w10 7
2x109 "~
u
> 0
0 0 "10
0 "0 0
t x 10 7
1 xlO 9
C
0
b--
8
I1
5 O0
I 100q
I 1500
I 2 000
Tungsten wire temperature (K) Fro. 4. Dependenceof the degree of labeling of ribosomal protein in ribosomes on tungsten wire temperature.(0) Total radioactivityin the sample;(O) radioactivityincorporated into ribosomalproteins. the ribosomes in sucrose gradients (Fig. 5). It is found that ribosomes labeled at a wire temperature of 1000 K retain their original integrity: the radioactivity profile corresponds to the UV adsorption profile in the ribosome region (Fig. 5a) or to that of the ribosomal subunits (Fig. 5b); only the exchangeable tritium, unattached to the proteins, is present in the upper part of the sucrose gradient. Ribosomes labeled at 2000 K aggregate, probably as a consequence of destruction, and radioactivity is observed at the bottom of the tube (Fig. 5b). Identification of Proteins Exposed on the Ribosome Surface
Solutions and Buffers 5% acetic acid Buffer A: 10 m M MgC12, 10 m M NH4C1, 0.1 m M Na2EDTA, 1 m M DTT, 20 m M Tris-HC1, pH 7.4 Buffer B: buffer A without MgC12 containing 1 m M Na2EDTA
Tritium Bombardment of Total Ribosomal Proteins The fluorogram of two-dimensional electrophoresis of the total ribosomal protein labeled under denaturing conditions in 5% acetic acid is
[28]
Az6o 1.0
0.5
435
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
a
cpm
b
_L 5
10
15
C 2x 10 5
1~I0 5
2O
5
~0
Fraction
15
20
5
10
15
20
number
Fie. 5. Sedimentation analysis of ribosomes labeled with hot tritium atoms. Sucrose gradient 4-20%, SW-41 rotor, centrifuged for 12 hr at 20,000 rpm at 4 ° for (b) and (c); 14 hr at 16,000 at 4 ° for (a). Ribosomes labeled at a tungsten wire temperature of 1000 K: (a) sucrose gradient in buffer A (10 m M MgClz), (b) sucrose gradient in buffer B (1 m M MgC12). Ribosomes labeled at a tungsten wire temperature of 2000 K: (c) sucrose gradient in buffer B (l raM"MgCl2). (0) 260 nm absorbance, (O) total radioactivity, (A) radioactivity incorporated into ribosomal proteins.
shown in Fig. 6a. It can be seen that all of the ribosomal proteins are labeled. The majority of proteins are labeled roughly proportionally to their molecular masses. However, there are several exceptions, probably explained either by lower amounts of these proteins on the slab or by their incomplete denaturation. There are no spots on the fluorogram corresponding to degradation products of labeled ribosomal proteins. All of the radioactive spots strictly correspond in mobility to the spots of proteins on the stained slab (cf. Fig. 6a with Fig. 3).
b
!
b FIG. 6. Two-dimensional ele~:trophoresis of ribosomal proteins. Fluorograms of [3H]TP70: (a) labeled in isolated state in 5% acetic acid (150 gg of protein, 3.6 X 106 dpm); (b) labeled in unfolded ribosomal subunits (150 gg of protein, 5 X l06 dpm); (c) labeled in 70S ribosomes (150gg of protein, 0.5 X 106 dpm). (a, b) Reproduced from Ref. 6.
436
CHEMICAL AND ENZYMATIC PROBING METHODS
[9-8]
Tritium Bombardment of Unfolded Ribosomal Subunits Unfolded ribosomal subunits are prepared from nondissociated ribosomes in buffer B. Sedimentation analysis has shown that the particles prepared in this way sediment with sedimentation coefficients of 17S and 25S, indicating a partial unfolding of the ribosomal subunits. ~3,~4All of the proteins are found to be labeled in this sample of unfolded ribosomal subunits (Fig. 6b). However, the distribution of the label between the ribosomal proteins in this case is not proportional to their molecular masses. Differential labeling of proteins in unfolded ribosomal subunits seems to be the result of their different degrees of exposure, which may be the result of protein-protein and RNA-protein interactions within the nucleoprotein.
Tritium Bombardment of Nondissociated Ribosomes The fluorograms of two-dimensional electrophoresis of ribosomal proteins labeled by tritium bombardment of 70S ribosomes are shown in Fig. 6c and 8a. It can be seen that a significant number of the proteins in this case are labeled to a still lesser degree or virtually unlabeled. The decrease in accessibility of ribosomal proteins to tritium atoms in compact 70S ribosomes, in comparison with that of unfolded ribosomal subunits, is likely the result of an increase of protein-protein and RNA-protein interactions and of shielding by folding of the particle. The more exposed proteins in the 70S ribosomes are S1, $4, $7, $9 and/or S11, S12 and/or L20, S13, S18, $20, $21, LI, L5, L6, L7/L12, L9, L10, L11, L16, L17, L24, L26, and L27. The degree of labeling for proteins $7, S13, $9 and/or S11, $20 (L26), $21, L1, L2, L5, L6, L7/L12, L9, L17, L25, and L27 varies somewhat in different ribosome samples (cf. Fig. 6c and Fig. 8a). From the results presented it can be concluded that the most exposed proteins on the surface of the 70S ribosomes comprise about half of the 30S subunit proteins and about one-third of the 50S subunit proteins. The remaining ribosomal proteins are more buried in the ribosome structure. D e p e n d e n c e of Protein Exposure on the Structural State of
Ribosomes
Buffers A: 100 m M NH4C1, 0.1 m M Na2EDTA, 1 m M DTT, 20 m M TrisHC1, pH 7.4, where the concentration of MgCI2 varies from 0 to 10mM ~3L. P. Gavrilova, D. A. Ivanov, and A. S. Spirin, J. Mol. Biol. 16, 473 (1966). ~4R. F. Gesteland, J. Mol. Biol. 18, 356 (1966).
[28]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
437
B: 20 m M MgC12, 100 m M KC1, 1 m M DTT, 20 m M Tris-HC1, pH 7.4
Tritium Bombardment of Ribosomal Particles in Buffers with Different Concentrations of Magnesium Ions The dependence of ribosome dissociation on magnesium ion concentration in buffer A as measured by light scattering is shown in Fig. 7. The state of ribosomes in the sample was controlled also by sedimentation in an analytical ultracentrifuge. It has been shown that in the range of magnesium ion concentrations from 10 to 4 mM in the buffer, the samples contain only 70S ribosomes. At concentrations of magnesium ions of 1 mM and below, the samples consist only of ribosomal 30S and 50S subunits. Decreasing the magnesium ion concentration in the buffer to 0.3 m M leads to a decrease of the sedimentation coefficient of 30S subunits to 20S, while that of the 50S subunits does not change. Comparison of surface protein labeling in nondissociated ribosomes (in buffer A with I0 mM MgClz) and in a mixture of ribosomal subunits (in buffer A with 1 m M MgC12) is the main purpose of these experiments. Analysis of fluorograms of several independent experiments has shown that dissociation of ribosomes into subunits is accompanied neither by exposure of additional ribosomal proteins to hot tritium bombardment, nor by a reproducible increase in labeling of the accessible proteins (Fig. 8a,b). It can be concluded that, upon dissociation of 70S ribosomes into subunits, no additional ribosomal proteins become exposed and, hence, there are no proteins on the contacting surfaces of the ribosomal subunits.
o~ c
=
1.5
o~-
1.0
~
0.5
_.J
I
1
I
I
3
I
I
I
5
I
7
I
I
9
Mg 2., mM FIG. 7. D e p e n d e n c e o f ribosome dissociation o n M g 2+ concentration. Measured by light scattering at 400 n m . R i b o s o m e concentration 1 m g / m l . Reproduced from Ref. 6.
438
CHEMICAL AND ENZYMATIC PROBING METHODS
[28]
Fxo. 8. Two-dimensional clcctrophorcsis of ribosomal proteins. Fluorograms of [3H]TP70 (150/Lg of protein,0.5 to 1.5 × I06 dpm) labeledin ribosomes in bufferscontaining (a) 10 m M MgCI~, (b) I m M MgCI2, (c) 0.5 m M MgCl2, (d) 0.3 m M MgCl 2. (a, b) Reproduced from Ref. 6.
It should be noted, however, that in some samples of ribosomes dissociated into subunits an additional radioactive spot Y is observed (see Fig. 8b,c,d) which has not been identified as a ribosomal protein; this unknown protein may be a novel component located between the ribosomal subunits. Further decrease of magnesium ion concentration to 0.5 m M leads to exposure of proteins $3, $5, $7, and S16 on the surface of the 30S subunits (Fig. 8c). This effect seems to be the consequence of shght changes of subunit structure (though the sedimentation coefficient of the particles remains the same). Decrease of magnesium ion concentration to 0.3 mM results in additional exposure of ribosomal proteins $3, $4, $5, $7, $9 and/or S 11, S 14, and S 18 (Fig. 8d); in these conditions the sedimentation coefficient of 30S subunits decreases to 20S. It is likely that in the latter case the increased exposure of the proteins is caused by partialunfolding of the 30S subunits.
[28]
HOT TRITIUM BOMBARDMENT OF RIBOSOMES
439
q
SO
o
FIG. 9. Two-dimensionalelectrophoresisof ribosomal proteins. Fluorograms:(a) [3H] TP30, (b) [;H]TPS0, (c) [~H]TP70labeled in the isolated 30S subunits, 50S subunits, and their 70S couples,respectively.
Tritium Bombardment of Isolated Ribosomal Subunits and Their Couples Analysis of fluorograms of two-dimensional electrophoresis of ribosomal proteins labeled in isolated 30S and 50S ribosomal subunits in buffer B shows that the most exposed proteins are S1, $3, $4, $5, $6, $7, $9 and/or SI 1, S13, S14, S18, $20, $21, L1, L5, L7/L12, L9, L10, L11, LI6, L24, L25, and L26 (Fig. 9a,b). The considerable difference in the exposure of several proteins in nonisolated (Fig. 8a) and isolated (Fig. 9a,b) subunits can be explained by some alteration ofsubunit structure during isolation of subunits by zonal centrifugation under conditions of high ionic strength (0.5 M NH4C1) with low Mg2+. 9 A reverse shielding of proteins $3, $5, $7, S14, and S18 occurs upon interaction of isolated 30S and 50S subunits to form 70S ribosomes in buffer B (Fig. 9c). These same proteins become exposed in nonisolated 30S subunits in response to a decrease of magnesium ion concentration in buffer A (see the previous section). Thus, it seems likely that protein shielding upon association of isolated subunits is directly coupled with restoration of the altered 30S subunit structure.
440
CHEMICAL AND ENZYMATIC PROBING METHODS
[29] Surface
Topography
of Ribosomal
[29]
RNA
B y ALEXEY A. BOGDANOV, NINA V. CHICHKOVA, ALEXEY M. KOPYLOV, ALEXANDER S. MANKIN, and EVGENY A. SKRIPKIN
Ribosomal ribonucleic acids (rRNA) form the very compact central core o f ribosomal subunits, whereas both ribosomal proteins and rRNA segments have been found on their surface (see Ref. 1 for a review). Since there is scarcely any doubt now that rRNA is directly involved in ribosome functioning, investigation o f these exposed r R N A regions is o f great interest. Hence they are likely to be involved in the interactions o f ribosome functional centers with tRNA, m R N A , and i n i f i a t o n factors, as well as in subunit association. In this chapter, we will concentrate on the methods which have been developed in our laboratory for identification o f R N A regions located on the surface o f r R N A both in the isolated state and in ribosomal subunits. I. Site-Specific H y d r o l y s i s o f r R N A - O l i g o d e o x y r i b o n u c l e o t i d e C o m p l e x e s with R N a s e H A. Principle
The idea o f site-specific cleavage o f R N A with RNase H was first formulated by Smirnov. 2 The corresponding experimental procedure for MS2 phage R N A was developed in our laboratory in 1978 as the joint work o f three groups. 3,4 Donis-Keller has described a similar approach for fragmentation o f 5.8S rRNA. 5 Subsequently we have shown that this m e t h o d is very useful for s t r u c t u r e - f u n c t i o n studies o f ribosomes. 6-8 A. A. Bogdanov, A. M. Kopylov, a n d I. N. Shatsky, in "Subcellular Biochemistry" (D.
Roodyn, ed.), Vol. 7, p. 81. Plenum, New York, 1980. 2 V. D. Smimov, personal communication (1976). 3 V. G. Metelev, O. B. Stepanova, N. V. Chiehkova, N. P. Rodionova, V. D. Smirnov, S. L. Bogdanova, N. F. Sergeeva,K. I. Ratmanova, A. A. Bogdanov,Z. A. Shabarova, and J. G. Atabekov, Biol. Nauki (Moscow) 8, 27 (1978). "O. B. Stepanova, V. G. Metelev, N. V. Chiehkova, V. D. Smimov, N. P. Rodionova, J. G. Atabekov, A. A. Bogdanov,and Z. A. Shabarova, FEBS Lett. 103, 197 (1979). 5H. Donis-Keller,Nucleic Acids Res. 7, 179 (1979). 6 A. S. Mankin, E. A. Skripkin, N. V. Chiehkova, A. M. Kopylov, and A. A. Bogdanov, FEBS Lett. 131, 253 (1981). 7 E. A. Skripkin, V. K. Kagramanova, N. V. Chiehkova, A. M. Kopylov, and A. A. Bogdanov, Biokhimiya (Moscow)46, 2250 (198I). 8 G. Z. Gaida, A. Y. Spunde, E. A. Skripkin, V. K. Kagramanova, V. P. Veiko, N. V. Chiehkova, and A. A. Bogdanov,Bioorg. Khim., 8, 1952 (1982). METHODS IN ENZYMOLOGY, VOL. 164
English translation copyright © 1988 by Academic Press, Inc.
[29]
SURFACE TOPOGRAPHY OF rRNA
441
The approach is to select oligodeoxyribonucleotides 6 - 1 0 nucleotides in length that are complementary to given RNA regions, form the corresponding heteroduplexes, and treat them with RNase H, which is the enzyme which specifically cleaves the RNA chain in R N A - D N A hybrids. In many cases, estimation of the chain length of fragments formed by polyacrylamide gel electrophoresis under denaturating conditions is enough to prove that the RNA chain is hydrolyzed at the selected site. For precise localization of cleavage sites, however, direct sequencing of terminal segments of RNA fragments must be performed. It is important that RNase H cleaves R N A - D N A hybrids, leaving Y-terminal hydroxyls and 5'-terminal phosphates which can be labeled in the usual way.
B. Ribonuclease H from Escherichia coli Escherichia coli RNase H is a basic protein with a molecular weight of 17,559. 9
1. Assay. [14C]poly(rA)" poly(dT) in which the specific radioactivity of [~4C]poly(rA) is 105 cpm per microgram is used as a substrate. The standard assay mixture (200 gl) for measuring RNase H activity contains 40 m M Tris-HC1 (pH 7.5), 4 m M MgC12, 1 m M dithiothreitol, 30/tg of nuclease-free BSA per milliliter, 5% glycerol, 20 #g of substrate per milliliter, and aliquots (1-25/tl) of RNase H. After incubation for 20 min at 37 ° the mixture is cooled in ice. The samples (5-10 gl) are mixed with 20 gl of cold BSA solution (4 mg/ml) and 100 gl of 7% trichloroacetic acid (TCA). The precipitates are removed by centrifugation and the radioactivity of the supernatants is measured. One unit of RNase H activity is the amount of enzyme producing 1 nmol of acid-soluble nucleotides in 20 min at 37 ° under these assay conditions. 2. Enzyme Preparation. E. coli RNase H is now available from a number of commercial sources. An E. coli strain which carries cloned RNase H gene and overproduces this enzyme has also been d e s c r i b e d . 9 However, in this study, we have used the enzyme isolated from E. coli MRE 600 according to the method of Darlix. ~° In contrast to the original procedure, in our hands, the major part of the RNase H activity is retained on the DEAE column and the enzyme is eluted from DE52 (Whatman) with a linear gradient of NaCI (0-0.4 M ) in a buffer containing 20 m M Tris-HC1 (pH 7.9), 0.1 m M dithiothreitol, 0.1 m M ethylenediaminetetraacetic acid (EDTA), 10% glycerol. RNase H is stored at - 2 0 * in the same buffer containing 0.1 M NaC1, 0.05M KCI and mixed with an equal vol9 S. Kanaya and R. J. Crouch, J. Biol. Chem. 258, 1276 (1983). 1oj. L. Darlix, Eur. J. Biochem. 51, 369 (1975).
442
CHEMICAL AND ENZYMATIC PROBING METHODS
[29]
ume of glycerol. The enzyme in this storage buffer is stable for more than a year. Usually, the specific activity of the enzyme is about 2500 units/ml. The enzyme is sufficiently free of DNase and other RNase activities. The RNase H activity falls 5-fold when the NaCI concentration is increased from 0.05 to 0.5 M. Mg 2+ ions are necessary for activity; maxim u m activity is obtained in the presence of 10 m M MgC12; SH reagent must also be present. H
C. Site-Specific Cleavage of rRNA 1. Oligodeoxyribonucleotides. Most of the oligodeoxyribonucleotides used in this study are synthesized by a solid-phase phosphotriester procedure ~2 and carefully purified by ion-exchange and Cls reversed-phase HPLC. They are sequenced according to the method of Maxam and Gilbert. ~3 2. Ribosomal Subunits and rRNA. 70S ribosomes, ribosomal subunits, and rRNA are isolated from E. coli MRE 600 according to conventional techniques. ~4 In addition to SDS-phenol extraction, the 16S rRNA is isolated by treatment of 30S subunits with acetic acid and urea in the presence of high Mg 2+ concentrations. ~5In all cases the rRNA solutions are treated with bentonite. 3. Heteroduplex Formation and RNase H Treatment. The following conditions give a good yield of RNA fragments for most oligodeoxyribonucleotides complementary to accessible rRNA regions. 6/tl H buffer (10 m M Tris-HC1, pH 7.6, 10 m M MgC12, 0.2 MKCI, 0.1 m M dithiothreitol) 2/zl rRNA (2- 5 mg/ml in H buffer) 1 pl oligodeoxyribonucleotide ( 1 - 2 A26o/ml in buffer H) 1 pl RNase H ( 2 - 3 units) Incubation for 1 hr at 4 °. In the case of ribosomal subunits, the RNase H and oligonucleotide concentrations should be increased at least 10-fold. The temperature of the reaction could be raised up to 20* to facilitate the hydrolysis. To stop the reaction, 10/zl of phenol saturated with buffer H is added. t l V. G. Metelev, O. B. Stepanova, N. V. Chichkova, V. D. Smirnov, N. P. Rodionova, I. M. Berzin, N. V. Jansone, E. J. Gren, A. A. Bogdanov, Z. A. Shabarova, and J. G. Atabekov, Mol. Biol. (Engl. Transl.) 14, 200 (1980). 12 A. Rosenthal, D. Ccch, V. P. Veiko, T. S. Orezkaja, E. A. Kuprijanova, and Z. A. Shaharova, Tetrahedron Lett. 24, 1691 (1983). 13 A. M. Maxam and W. Gilbert, this series, Vol. 65, p. 499. 14 R. A. Zimmerman, this series, Vol. 59, p. 551. 15 H.-K. Hochkeppel, E. Spicer, and G. R. Craven, J. Mol. Biol. 101, 155 (1976).
[29]
SURFACE TOPOGRAPHYOF rRNA
443
After phenol extraction, RNA fragments are precipitated with 96% ethanol at - 7 0 °, centrifuged, washed with 80% ethanol, and dissolved in 1/A of water. In some particular cases, due to the lower ability of a given RNA region to form oligodeoxyribonucleotide-RNA hybrids, the optimal conditions for RNase H hydrolysis can be selected by changing the RNA/oligonucleotide ratio, temperature, and reaction time. Alterations in reaction conditions (decreasing oligonucleotide content and increasing temperature, for example are also important if one wishes to get a single break in the RNA chain. This can help to avoid RNA cleavages at sites with a partial oligonucleotide- RNA complementarity. 4. Separation and Isolation of rRNA Fragments. Electrophoresis in a denaturating polyacrylamide gel is used for characterization of products of the rRNA cleavage reaction. One microliter of an rRNA fragment solution in water is mixed with 5/ll of loading buffer (10 m M Tris-borate, pH 8.3, 7 M urea, 0.2 m M EDTA, 0.03% bromphenol blue, 0.03% xylene cyanole). In the case of large fragments, samples are loaded onto 4% polyacrylamide- 7 M urea slab gels and electrophoresed as described by Maxam and Gilbert. 13 For separation of smaller (usually 32P-labeled) fragments, 14- 20% polyacrylamide- 7 M urea gels are used) 6 rRNA fragments have been localized on gels by ultraviolet shadowing or autoradiography and then eluted with 0.3 ml of 0.5 M ammonium acetate, 0.1% SDS, 0.1 m M EDTA, and 50/tl phenol by a crush and soak procedure. 13 For isolation of large amounts of rRNA fragments, ultracentrifugation in appropriate sucrose gradients is used. 5. Identification of Cleavage Sites Procedure A: Sites located near rRNA termini. If the selected regions of rRNA are in close proximity to either 5' or 3' ends one can expect the appearance of rather short oligonucleotides as a result of RNase H treatment. In this case it is reasonable to perform preliminary labeling of the corresponding terminal group of the RNA molecule. However, in the case of ribosomal subunits it is more convenient to label the 3' ends of the released oligonucleotides with [ 5 ' - 3 2 p ] p C p and T4 RNA ligase. The following procedure gives an example of localization of RNase cleavage sites near the 5' end ofE. coli 16S RNA both in the isolated state and in 30S subunits, s The octamer dCAAACTCT complementary to the segment 8 - 15 of 16S RNA is used. 16S RNA ( 15/lg in 15/~1 of 30 m M Tris-HCl, pH 8.0) is incubated with 0.03/~g of alkaline phosphatase (Sigma) for 20 min at 37 o and then, after ,6 D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980).
444
CHEMICAL A N D ENZYMATIC PROBING METHODS
TABLE I SITE-SPECIFIC CLEAVAGE OF E. coil 16S RNA
Sample
16SRNAC
Complementary complexes and cleavage sites°
5, lO l i pA~OAAOAOU~UOAU
Activity of reconstituted 30S subunits (%)b
N~
TCTCAAAC 5,
5, 30S subunits
l! ° l
pAAAUUGAAGAGUUUGAU
ND
TCTCAAAC 5,
16SRNA°
5' 3~ l C~C~OAOA~A~A
6O
A G T T T C C T T 5, 520 16S RNAc
7 AGCAGCCmGCGGUAAUAC
ND
UCGG C| GCCATTAs, 5' 770
h q
16S RNAc
780 v
AGCGU~AGCAAACA (rA)CCCCTCGTT 5, 5' 770
30S subunits
40 50e
780
AGCGU~AGC~CAf
ND
(rA)CCCCTCGTTT 5,
,6SRNAC
5' l !o5o CO~CA~ACA~O
60
TCTGTCC 5,
16S RNAg
GAACUCAAAGGAGAC AGTTTCCTT 5,
h
[29]
[29]
SURFACE TOPOGRAPHY OF r R N A
445
addition o f E D T A up to 6 raM, heated for 3 rain at 90 °. R N A is phosphorylated at the 5' end with [7-32p]ATP ( > 1000 C i / m m o l , A m e r s h a n ~ a n d T4 p o l y n u d e o t i d e kinase.~7 The radiolabeled R N A is deproteinized twice, precipitated with ethanol, dissolved in buffer H and treated with the oct a m e r a n d R N a s e H as described above (see Section I,C,3). After 1 hr incubation at 20 °, an equal v o l u m e o f formamide, containing 0.05% xylene cyanole a n d b r o m p h e n o l blue is added, and the samples are heated for 1 m i n at 90 ° and layered o n t o a 20% polyacrylamide, 7 M urea, 50 m M Tris-borate ( p H 8.3), l r a M E D T A gel, 1 m m thick. After electrophoresis (40 V / c m ) and radioautography, 16S r R N A fragments are cut out and eluted f r o m the gel. ~3 R N A sequences o f 5'-end-labeled fragments are determined according to the procedure o f Donis-Keller et al. ~7 Nine m i c r o g r a m s o f 30S subunits in 5/11 o f buffer H is preheated for 20 m i n at 37 °, then m i x e d with 2 / d o f a d C A A A C T C T aqueous solution (27-fold m o l a r excess) and 5/11 R N a s e H (12 units), and incubated for 14 hr at 4 °. The reaction mixture is treated with phenol and precipitated with ethanol. 3 ' - T e r m i n i o f 16S R N A fragments are labeled with [5'-32p]pCp a n d T4 R N A ligase ~s and the R N A fragments are subjected to
m7H. Donis-Keller, A. Maxam, and W. Gilbert, Nucleic,4cidsRes. 4, 2527 (1977). is T. E. England, A. G. Bruce, and O. C. Uhlenbeck, this series, Vol. 65, p. 65. a The arrows show the cleavage sites. The forked arrows show the cleavage sites which were determined with an accuracy of-+ 1 nucleotide residue. b The activity of 30S subunits in polyphenylalanine synthesis. 30S subunits were reconstituted from ] 6S RNA with single breaks (see text for details). The activity is expressed as a percentage of that of 30S subunits reconstituted from intact 16S RNA. c 16S RNA isolated by the acetic acid-urea procedure. a ND, not determined. e 30S subunits were reconstituted from cleaved 16S RNA preheated for 3 rain at 50 ° (i.e., after separation of the two halves of 16S RNA). /The exact position of a cleavagesite was not determined. s 16S RNA isolated by the phenol-SDS procedure. h Particles with sedimentation parameters characteristic of 30S subunits cannot be reconstituted from 16S RNA isolated by this procedure.
446
CHEMICAL AND ENZYMATIC PROBING METHODS
[29]
electrophoresis in a 20% polyacrylamide gel as above. The nucleotide sequences of the RNA fragments are determined according to the method of Peattie.19 The results are shown in Table I. Procedure B: Sites which are 50-300 nucleotides away from rRNA termini. In this case, fragments with free Y-terminal hydroxyls and of the appropriate size for direct RNA sequencing are formed. In the following example the nonanucleotide dTTCCTTTGA, which is partially complementary to several regions in E. coli 16S RNA, is used. We have found that RNase H treatment of 16S RNA isolated by the acetic acid-urea procedure in the presence of this oligodeoxyribonucleotide produces two RNA fragments of about 300 and 1150 nucleofides long, respectively (Fig. l). 16S RNA, 140 #g, extracted from 30S subunits with acetic acid-urea 15 is treated under standard conditions (see Section I,C,3) with RNase H (70 units) in the presence of 2.5 #g of dTTCCTTTGA. After electrophoresis in an 8% polyacrylamide-7 M urea gel, the polynucleotide (about 300 nucleotides long) is isolated from the corresponding band and 32p-labeled with [ 5 ' - 3 2 p ] p C p and T4 RNA ligase. TM The 32p-labeled RNA fragments formed during the ligation reaction are purified by 14% polyacrylamide7 M urea gel electrophoresis and sequenced according to the method of Peattie. ~9 The results (Table I) demonstrate that RNase H cleaved the single phosphodiester bond between nucleotides 301 and 302. Procedure C: Sites located in the middle of rRNA chains. In this case, fragments with nonphosphorylated 3' ends are too large to be sequenced directly, and it is convenient to use a combination of two oligodeoxyribonucleotides, the cleavage site of one of which has been identified independently. Fragments 50-250 nucleotides long can be obtained and their sequences can be determined in the usual way. For example, to identify the cleavage site produced in E. coli 16S RNA with RNase H in the presence of the oligonucleotide dTTTGCTCCCCrA (see Table I) complementary to the region 772-782, the 16S RNA is complexed with this undecanucleotide and the dodecanucleotide dATTACCGCGC~rU complementary to the region 523-524. 2o The complex is treated with RNase H under standard conditions and a fragment about 250 nucleotides long is isolated, labeled with [5'-32p]pCp and T4 RNA ligase, and sequenced according to the method of Peattie. 19 Procedure D: Fragmentation of rRNA in the presence of oligonucleotides with random nucleotide sequences. This approach provides informa19D. A. Peattie, Proc. Natl. Acad. Sci. U.S.A. 76, 1760 (1979). A. S. Mankin, unpubfished results.
[29]
1
SURFACE TOPOGRAPHY OF r R N A
2
3
4
5
G
l
447
8
9
FIG. 1. RNase H cleavage ofE. coli 16S RNA. Reaction conditions arc described in the text. Samples were subjc~'tedto ele~trophoresis in 4% polyacrylamide-7 M urea gels. Lane 1, 16S RNA treated with RNas¢ H in the absence of oligonucleotides (control). Lanes 2-4, 8, and 9 show 16S RNA treated with RNase H in the presence of oligonucleotide: lane 2, dCCTGTCT; 3, dTTCCTTTGA; 4, dTTTGCTCCCCA; 8, dCGTCAATTCATTT(complementary to the 16S region (913-925); 9, dATTACCGCGC,CrU. Lane 5 shows RNA size markers (obtained by treatment of 30S subunits with cobra venom endonuclease as described by S. K. Vasilenko, P. Carbon, J.-P. Ebel, and C. E. Ehresmann [J. Mol. Biol. 152, 699 (1981)]. Lane 6, 30S subunits treated with RNase H in the presence of d'I'TTG~CCCA. Lane 7, 30S subunits treated with RNase H in the absence of oligonuclcotides. (See also Table I for cleavage sites.)
448
CHEMICAL AND ENZYMATIC PROBING METHODS
[29]
tion about the distribution of the most exposed regions of an RNA molecule. After RNase H cleavage, rRNA fragments are labeled, separated, and sequenced as described above. We have studied the fragmentation of E. coli 16S RNA in the presence of a hexadeoxyribonucleotide mixture with the following nucleotide composition: A, 36%; G, 14.9%; C, 27.4%; T, 21.7%. 21 16S RNA is cleaved under standard conditions, the fragments are separated on a 14% polyacrylamide-7M urea gel, labeled with [5'-32P]pCp and T4 RNA ligase, and sequenced according to the Peattie method) 9 Thirty-two fragments have been localized in the 16S RNA polynucleotide chain.21
D. Reconstitution, Purification, and Biological Activity of 30S Subunits Containing Fragmented 16S rRNA 16S rRNA containing a unique nick (see Table I) is reprecipitated with 3 volumes of ethanol from TM buffer (30 m M Tris-HCl, pH 7.6, 20 m M MgC12, 6 m M 2-mercaptoethanol) at least 5 times to eliminate traces of phenol and is resuspended finally in TM buffer to a concentration of 30 A2t~/ml. Before reconstitution, the RNA solution is heated at 37* for 10 min and then cooled to 4 °. Total protein from 30S subunits is dialyzed for 6 hr against 3 changes (100 volumes) of 0.5 TMK buffer (TM buffer containing 0.5 M KC1). For reconstitution, 2 volumes of dialyzed proteins in 0.5 TMK buffer is slowly added to 1 volume of 16S RNA solution (30 A2~/ml) in TM buffer. The final concentration of KC1 is 0.33 M (0.33 TMK) and the concentration of 16S RNA is 10 A26o/ml. The 16S RNA to individual protein ratio is 1 : 1.5. The reconstitution mixture is incubated at 40* for 45 min, then cooled on ice and the reconstituted 30S subunits are precipitated with 0.65 volume of ethanol. After centrifugation, the pellet is dried and resuspended in 0.33 TMK buffer. The solution of 30S subunits is incubated at 40 ° for 20 min, cleared by centrifugation (3 min, 16,000 rpm), and centrifuged through a sucrose gradient (10-30%) in 0.33 TMK buffer at 31,000 rpm for 13 hr in a SW41 rotor (Beckman) or 50,000 rpm for 3.5 hr in a SW 50.1 rotor (Beckman). The gradient is fractionated and the fractions corresponding to 30S subunits are collected and precipitated with 0.65 volume of ethanol. The sedimentation coefficient of reconstituted subunits is determined by analytical centrifugation in a Beckman E ultracentrifuge (AnIT rotor). Poly(U)-directed [3H]polyphenylalanine synthesis is used to assay reconstituted 30S subunit activity. Each assay mixture of 50 #1 contains a 21 G. Z. Gaida, M. I. Kolosov, N. V. Chichkova, and A. A. Bogdanov, Bioorg. Khim. 9, 678 (1983).
[29]
SURFACETOPOGRAPHYOF rRNA
449
solution of 20 mMTris-HC1, pH 7.3, 10 mMMgC12, 0.1 MNH4C1, 1 m M dithiothreitol, 0.1 m M EDTA; 0.03 A260of 30S subunits; 0.06 A26oof 50S subunits; 50/lg [3H]Phe-tRNA with specific activity 9.7 Ci/mmol; 6 #g of protein factors (EF-Tu, EF-G, aminoacyl-tRNA synthetases); 0.4 m M GTP (Fluka); 6/~g of poly(U) (Calbiochem); 2 #l of phosphoenolpyruvate (50 m M solution, Boehringer); 1/tl of phosphoenolpyruvate kinase (10 mg/ml, Boehringer). The mixture is incubated for 5-40 min at 37 °. Aliquots (10/~l) are mixed with l0 ml 5% TCA and 50/A BSA (2 mg/ml), heated for 20 min at 90 °, and filtered through glass fiber filters (Whatman GFF). After washing and drying, the filters are placed in 5 ml of scintillation fluid and counted. E. Comments
The selectivity of fragmentation of RNA with RNase H is comparable with that of DNA hydrolysis with restriction enzymes. This approach works, however, only if the selected RNA region is in single-stranded (or weak double-stranded) conformation and exposed enough to bind with a complementary oligonucleotide. In addition the oligodeoxyribonucleotide-RNA hybrid must be accessible to the enzyme. These limitations turn out to be an advantage for topographical studies of the rRNA surface: since the substrates and effectors of protein biosynthesis reactions are also large in size, the method allows one to identify selectively RNA regions potentially involved in ribosome functioning. We have found that oligonucleotide binding followed by RNase H hydrolysis is quite sensitive to conformational changes of rRNA (compare binding dTTCCTTTGA to two 16S RNA samples isolated by different methods, Table I). Selective formation of hidden breaks in the rRNA chain can be useful for chemical modification of these sites with haptens and their subsequent localization by immune electron microscopy.22 It has to be noted that the method described here is the only approach for direct localization of oligodeoxyribonucleotide binding sites on RNA molecules. II. Determination of Apparent Association Constants for Binding of Oligonucleotides to rRNA by Nonequilibrium Gel Filtration Quantitative estimation of oligonucleotide binding to complementary sites in rRNA may provide valuable information on rRNA conformational changes resulting from interaction with ribosomal proteins, i.e., during reconstitution of ribosomal subunits, as well as on alterations in accessibility of certain regions of rRNA at different stages of ribosome functioning. 22 I. N. Shatsky and V. D. Vasiliev, this volume [5].
450
CHEMICAL AND ENZYMATIC PROBING METHODS
[29]
A. Principle of the Method and Calculation of Binding Parameters Conventional methods are not applicable to quantitative analysis of binding of oligonueleotides 7 - I 0 nucleotides long to rRNA: we have found that equilibrium cannot be attained after a reasonable time of dialysis through standard membranes. Moreover, equilibrium gel filtration requires a large amount of oligonueleotide. Among the non-equilibrium methods we have tested, such as sucrose gradient ultracentrifugation, filtration through nitrocellulose membranes, and gel filtration, the last approach turned out to be the most convenient. Its key point is the proper selection of filtration conditions (column size, elution rate, and column size to volume ratio) for the separation of the complex and unbound oligonueleotide. Separation should be good enough to permit measurement of the amount of the complex, and at the same time allow the complex to be in contact with the free oligonucleotide as long as possible. Under these conditions, the following method of calculation of the apparent association constant for oligonucleotide binding to rRNA (K') and the number of apparent binding sites (n) can be used. 23 The expression for the binding of oligonucleotide (L) to RNA (R) with n binding sites is R + nL~-RL.
(1)
The dissociation constant (K') will be K " = [R][L]. [RE.]
(2)
Because of possible complex dissociation during gel filtration the following relation is valid: RL. = t¢ RL.* where RL* is the measured amount of the complex in a gel filtration experiment and K is a nonequilibrium eoetiicient. The initial amount of RNA is Ro = R + RL. Thus, from F-xl. (2) it follows that Ro/RL* = ~cK'(1/[L].) + lc
(3)
Plotting Ro/RL* versus 1/[L]., it is possible to determine the tc as value of the ordinate after the extrapolation of 1/[L]. to zero (see Fig. 3). 23 E. A. Skripkin, A. M. Kopylov, A. A. Bogdanov, S. V. Vinogradov, and Y. A. Berlin, Mol. Biol. Rep. 5, 221 0979).
[29]
SURFACE TOPOGRAPHYOF rRNA
451
In logarithmic form Eq. (3) is log[(Ro/RL*) -- l] = --n log[L] + log K" By definition log K " = - n log K ' where K ' is the apparent association constant, log[(Ro/RL*) - 1] -- - n log[L] - n log K '
(4)
Linearization of Eq. (4) gives a straight line (see Fig. 4b). n is the tangent of the slope angle, and the intersection with the abscissa corresponds to log K'. B. An Example: A Comparison of the Accessibility of the 5'-Terminal Region of l 6 S rRNA in Free 16S rRNA, 30S Subunits, and 70S Ribosomes The synthetic oligodeoxyribonucleotide dCAAACTCT which is complementary to the 5'-terminal region 8 - 15 o f E . coli 16S rRNA has been used in this study. It has been shown in separate experiments with RNase H that this oligonucleotide binds to the targeted sequence of 16S rRNA (see Section I,C,6 in this chapter). The oligonucleotide is 32p-labeled at its 5'-end in the usual manner, Is to give a specific radioactivity in the range 5 - 150 X 106 cpm/A26 o. The complementary binding assay is done in a volume of 55/ll. Free 16S rRNA is incubated with the oligonucleotide in 10 m M Tris-HC1 (pH 7.5), 1 MNaC1, and l m M EDTA for 3 min at 60 °, for 10 min at 20 °, and for 3 0 - 4 0 min at 5 °, successively. Gel filtration is then performed on a Sephadex G-50 column (0.27 X 6.9 cm) at 5 ° with an elution rate of 3 ml/hr. For subunits and ribosomes the binding buffer is l0 m.M Tris-HC1 (pH 7.5), 10 m M MgC12, and 100 m M KC1. Two series of binding experiments are done: either incubation of subunits or ribosomes with the oligomer at 37 o for 20 min, then at 5 ° for 40 rain (preheating procedure) or incubation at 5 ° for 40 min. In all cases, ribosomal particles are preactivated at 37 ° for 20 min for subunits, and at 20* for 30 rain for ribosomes in the binding buffer. Gel filtration is performed under the same conditions as for 16S rRNA. The 32p radioactivity of the samples is determined by measuring Cerenkov radiation. The following values are used to calculate the solution molarity: A26o corresponds to 75 pmol of 16S rRNA, to 67 pmol of 30S subunit, to 39 pmol of 50S subunit, to 25 pmol of 70S ribosome, and to 12.5 nmol of octanucleotide.
452
CHEMICAL AND ENZYMATIC PROBING METHODS
,6
[29]
;
% x
B
a:
4
i
5
10
15
FRACTION NO. FIG. 2. Gel filtration of the complex of dCAAACTCT with 30S subunits. One hundred and sixty picomoles of30S subunits and 65 pmol of octanucleotide were incubated at 37 ° for 20 min and then at 5 ° for 40 min. Gel filtration was done at 50. The yield of the complex was 0.87 pmol. The dotted line represents the result of substraction of the curves corresponding to gel filtration of the octanucleotide with and without 30S subunits.
¢,0 0
-8 E Q,,
8
"0 e--
" 0
< I~ o E
e~
4
2 t
I
I
I 0.1
L
J
I
I
[.OJ
I
OCTAMER TO 30S RATIO IN MIXTURE F]G. 3. Binding curves for the dCAAACTCT-30S subunit interaction at 5 °. (1) 160 pmol subunits, preheating of the mixture at 37 °, and (2) 117 pmol subunits, without preheating. The molar ratio was varied by changing the oligonuclcotide concentration.
[29]
SURFACE TOPOGRAPHY OF r R N A
453
10
"7o
t// "f/
/t /'-°,'f i o
t
,4
8
42
I~ I
s.o -1=
t
l
s.5
-2
rT]2~t° (M)
I
6.o -tg[L~]
I
I
6.5
I
7.o
FIG. 4. Binding curve lineadzation for 30S subunits under preheating: (a) According to Eq. (3), assuming either one (1) or two (2) binding sites, r ~ - 110 was determined from extrapolation. (b) According to Eq. (4); the number of apparent binding sites (n == 1.6) and the average apparent association constant (K = 1.3 X 106 M -~) were calculated.
Figures 2 - 4 show the calculations for the preheating procedure for oligonucleotide binding, and the results of binding at 5 o are summarized in Table II. The results show equal accessibility of the 5'-terminal region of 16S rRNA alone, of 30S subunits, and of ribosomes. Separate binding experiments confirmed the specificity of binding: 50S subunits bind the oligonucleotide at least l0 times weaker. The number of apparent binding sites for 16S rRNA in all cases is more than one; this means that other binding sites, TABLE II OCTANUCLEOTIDE BINDING PARAMETERS
Sample 16S rRNA Binding at 5 ° 30S subunit 70S ribosome
Average apparent association constant K ' × 10-~ ( M - t ) a
Number of apparent binding sites n a
2.0
1.6
1.8 1.4
1.6 1.5
a Linearization of Eq. (4) was done by the least squares method; correlation coefficients exceed 0.92.
454
CHEMICAL AND ENZYMATIC PROBING METHODS
[29]
beside the 5'-terminal region, may exist with partial complementarity. This binding will increase the number n of the apparent binding sites and simultaneously reduce the average apparent association constant K'. C. Comments The method described here, as in the case of all nonequilibrium methods, provides for semiquantitative estimation of parameters of oligonucleotide binding to rRNA. For this reason, comparison of the accessibility of rRNA regions in different states should be done under precisely controlled and equivalent conditions (temperature, column size, oligonucleotide to rRNA ratio, oligonucleotide specific radioactivity, etc.). III. Specific Cleavage of rRNA at 7-Methylguanine Residue The rRNA regions with methylated guanine residues (mTG) occur at very specific locations on the surface of ribosomal subunits. One can assume that they are important for the biological activity of ribosomes. Here we describe the procedure for specific fragmentation of rRNA at mTG. A. Principle The chemistry of the cleavage of tRNA at 7-methylguanine was developed by Wintermeyer and Zachau. 24 It was based on reducing the 7-methylguanine residue with sodium borohydride and subsequent splitting of the polynucleotide chain at the reduced residue with aniline. The same reaction is used as a component of the guanine-specific cleavage reaction in the protocol for chemical sequencing of RNA. 19 However, it was found that this reaction critically depends on the concentration of the 7-methylguanine in the reaction mixture as well as the molar ratio of 7-methylguanine to the other nucleotides at the reduction stage. 25 This finding has explained why large RNA molecules, such as 16S rRNA, could not be cleaved at 7-methylguanine by the original procedure of Wintermeyer and Zachau. To overcome this obstacle, we have modified this procedure by the addition of exogenous 7-methylguanine in the form of carder RNA heavily methylated with dimethyl sulfate.26
24 W. Wintermeyer and H. G. Zachau, FEBS Left. 58, 306 (1975). 25 V. S. Zueva and A. S. Mankin, Biokhimiya (Moscow) 49, 160 (1984). 26 V. S. Zueva, A. S. Mankin, A. A. Bogdanov, and L. A. Baratova, Eur. J. Biochem. 146, 679 (1985).
[29]
SURFACE TOPOGRAPHY OF rRNA
455
B. Procedure 1. Preparing methylated RNA Carrier (Methyl-RNA). One milligram of RNA carrier is dissolved in 300/tl of 50 m M sodium cacodylate, pH 5.5, containing 1 m M EDTA, and 5 gl dimethyl sulfate is added. The mixture is incubated for 5 min at 90 °, and then quickly chilled on ice. Seventy-five microliters of cold 1.0 M Tris-acetate, pH 5.5, containing 1.5 M sodium acetate and 1.0 M 2-mercaptoethanol is added and RNA is precipitated by the addition of 900 gl of ethanol. The RNA pellet is reprecipitated from 0.3 M sodium acetate, pH 5.5, washed with ethanol, dried, and dissolved in water to a final concentration of 10 mg/ml. The methyl-RNA solution is distributed in 20-#1 aliquots and stored at - 2 0 °. 2. Cleavage of E. coli 16S rRNA at 7-Methylguanine. Forty micrograms of 16S rRNA is dissolved in 10 #1 of 0.5 M Tris-HC1, pH 8.0, and 2 gl of the methyl-RNA solution (20 #g) is added and vigorously mixed. Ten microliters of freshly prepared 1 M sodium borohydride solution is added and the reaction mixture incubated for 5 min at 20 ° in darkness. The reaction is stopped with 200/tl of 0.3 M sodium acetate, pH 5.5, and RNA is precipitated with 600 #1 of 96% ethanol. The ethanol-washed pellet is dried and dissolved in 80/A of water. Twenty microliters of aniline/acetic acid mixture (1:3, v/v) is added and incubated for 2 hr at 20 ° in darkness. The addition of the aniline/acetic acid mixture to the RNA solution sometimes leads to formation of a suspension. This does not influence the results of the procedure. RNA is precipitated by addition of 200 gl of 0.3 M sodium acetate, pH 5.5, and 900 gl of ethanol; the RNA pellet is washed with 1 ml of ethanol, dried, and dissolved in 90% formamide containing electrophoresis dyes. 27 The sample is denatured by heating for 1 min at 90 °, chilled on ice, and loaded onto a standard polyacrylamide gel (see Section I,C). Comments The protocol for analytical cleavage of 16S rRNA at m7G can easily be converted to large-scale use by proportionally increasing the amounts of all the reagents, keeping the concentrations unchanged. In the course of RNA cleavage, the methyl-RNA is degraded to rather short fragments which do not interfere with the 16S rRNA fragments either in the context of analytical electrophoresis, or preparative sucrose gradient fractionation. 27 The "postaniline" pellet of the cleaved RNA is not readily dissolved in aqueous solutions. The solubility of the RNA pellet can be increased by ethanol reprecipitation from 90% formamide or 7 M urea solutions.
456
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
Acknowledgments The authors are indebted to Drs. N. Sergeeva,V. Veiko, E. Volkov,S. Vinogradov, and V. Zaritova for synthesisof the oligodeoxyribonucleotidesused in this work.
[30] Enzymatic and Chemical Probing of Ribosomal R N A - Protein Interactions By JAN CHRISTIANSEN and ROGER GARRETT
About one third of the eubacterial ribosomal proteins have strong binding sites on the rRNAs and these primary binding proteins appear to have a special role in assembling, organizing, stabilizing, and/or reversibly altering the structure of the RNAs so as to generate a functionally active ribosome. Although the binding sites of many of these proteins have been mapped on the rRNAs, our understanding of their interactions is still rudimentary, and few principles have emerged regarding common structural motifs and/or sequence elements. However, double helices exhibiting irregularities, such as unpaired nucleotides or purine-purine juxtapositions, appear to be a common feature of most binding sites.l The protein-binding sites were first characterized partially by digesting complexes formed with in vivo 32p-labeled RNA with dbonucleases. More recently, various enzymatic and chemical probes, in combination with rapid gel electrophoretic analyses, have been employed to examine these complexes at nucleotide level. The following sections provide a guide to the various problems and pitfalls involved in such experiments and, also, to the type of structural information that can be obtained from them. Detailed experimental procedures for the isolation of ribosomal RNA, proteins, and complexes were described by Zimmermann in Vol. 59 of this series, 2 together with standard methods for testing the specificity, or "nativity," of a given complex. Isolation of Complexes Most studies, to date, have been performed on reconstituted complexes of ribosomal components of Escherichia coll. Table I lists the primary i R. A. Garrett, B. Vester, H. Leffers,P. M. Szrensen, J. Kjems,S. O. Olesen,A. Christensen, J. Christiansen, and S. Douthwait¢, in "Gene Expression" (B. Clark and H. U. Petcl~n, eds.), Alfred Benzon Symla. 19, p. 331. Munksgaard, Col~nhagen, Denmark, 1984. 2R. A. Zimmermann, this series, Vol. 59 [44]. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproduction in any form reserved.
456
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
Acknowledgments The authors are indebted to Drs. N. Sergeeva,V. Veiko, E. Volkov,S. Vinogradov, and V. Zaritova for synthesisof the oligodeoxyribonucleotidesused in this work.
[30] Enzymatic and Chemical Probing of Ribosomal R N A - Protein Interactions By JAN CHRISTIANSEN and ROGER GARRETT
About one third of the eubacterial ribosomal proteins have strong binding sites on the rRNAs and these primary binding proteins appear to have a special role in assembling, organizing, stabilizing, and/or reversibly altering the structure of the RNAs so as to generate a functionally active ribosome. Although the binding sites of many of these proteins have been mapped on the rRNAs, our understanding of their interactions is still rudimentary, and few principles have emerged regarding common structural motifs and/or sequence elements. However, double helices exhibiting irregularities, such as unpaired nucleotides or purine-purine juxtapositions, appear to be a common feature of most binding sites.l The protein-binding sites were first characterized partially by digesting complexes formed with in vivo 32p-labeled RNA with dbonucleases. More recently, various enzymatic and chemical probes, in combination with rapid gel electrophoretic analyses, have been employed to examine these complexes at nucleotide level. The following sections provide a guide to the various problems and pitfalls involved in such experiments and, also, to the type of structural information that can be obtained from them. Detailed experimental procedures for the isolation of ribosomal RNA, proteins, and complexes were described by Zimmermann in Vol. 59 of this series, 2 together with standard methods for testing the specificity, or "nativity," of a given complex. Isolation of Complexes Most studies, to date, have been performed on reconstituted complexes of ribosomal components of Escherichia coll. Table I lists the primary i R. A. Garrett, B. Vester, H. Leffers,P. M. Szrensen, J. Kjems,S. O. Olesen,A. Christensen, J. Christiansen, and S. Douthwait¢, in "Gene Expression" (B. Clark and H. U. Petcl~n, eds.), Alfred Benzon Symla. 19, p. 331. Munksgaard, Col~nhagen, Denmark, 1984. 2R. A. Zimmermann, this series, Vol. 59 [44]. METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproduction in any form reserved.
[30]
PROBING OF r R N A - P R O T E I N
INTERACTIONS
457
TABLE I RNA FRAGMENTSPROTECTEDAGAINSTRIBONUCLEASEDIGESTIONBY RIBOSOMAL PROTEINSa
Protein 16S RNA ES4 ES8 ES15 ES20 23S RNA EL1 EL10 (L12)4 EL 11 EL23 EL24 5S RNA EL25
Ribonuclease
Approximate size
Ref.
A/T t A A Tl
470 35 65 280
3- 5 3, 4 3, 4 3, 4
Tt Tl Tl Tt TI
100 100 60 160 480
6, 7 8 9 6, 10 11, 12
A
40
13
a Those protein- RNA complexes from E. coli that yield ribonuclease-resistant fragments are included and literature references that include experimental conditions are listed. The approximate sizes of the RNA fragments are given (number of nucleotides). With the possible exception of the LI 1 site, they all exhibit internal cuts and yield multiple subfragments on denaturing gels. Primary binding proteins which have so far failed to protect RNA sites are $7, L2, L3, and L4. l The very basic protein L20 has yielded a protected fragment, 6 but since it tends to bind unspecifically to RNA (like LI5) further work is required to establish its significance, t Protein L18 protects almost all of the 5S RNA against RNAse A and Tt digestion. 13
binding proteins that yield protected fragment complexes together with the ribonuclease used. 3- ~3An appropriate literature reference giving the experimental conditions is also presented for each complex. Those proteinRNA complexes which have so far failed to yield ribonuclease-resistant a E. Ungewickell, R. Garrett, C. Ehresmann, P. Stiegler, and P. Fellner, Eur. J. Biochem. 51, 165 (1975). 4 R. A. Zimmermann, G. A. Mackie, A. Muto, R. A. Garrett, E. Ungewickell, C. Ehresmann, P. Stiegler, J. P. Ebel, and P. Fellner, Nucleic Acids Res. 2, 279 (1975). 5 R. A. Garrett, E. Ungewickell, V. Newberry, J. Hunter, and R. Wagner, Cell BioL Int. Rep. 1,487 (1977). 6 C. Branlant, A. Krol, J. Sriwidada, J. P. Ebel, P. Sloof, and R. A. Garrett, F E B S Lett. 52, 195 (1975). 7 p. Sloof, R. Garrett, A. Krol, and C. Branlant, Eur. J. Biochem. 70, 447 (1976). s A. Beauclerk, E. Cundliffe, and J. Dijk, £ Biol. Chem. 259, 6559 (1984). 9 F. J. Schmidt, J. Thompson, K. Lee, J. Dijk, and E. Cundliffe, J. Biol. Chem. 256, 12301 (1981). to B. Vester and R. A. Garrett, J. Mol. Biol. 179, 431 (1984).
458
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
complexes are indicated in the footnote to Table I; protein L18 protects most of the 5S RNA. ~3 The protein-RNA fragment complexes are purified under nonequilibrium conditions on sucrose density gradients, by gel filtration, or on polyacrylamide gels. This requires that the dissociation rate constant is below 0.03 hr -~ (hi2 -- 23 hr) to avoid appreciable loss of complex. However, the less stable complexes formed between 23S RNA and proteins L11 and Ll0 (L12)4 have been isolated on nitrocellulose filters. 8'9 A step for renaturing the RNA, before adding the protein, will generally improve the yield of complex. This is particularly important for complexes where the protein recognizes a large and compact RNA structure as occurs, for example, for proteins $4 and L24 that bind within domain I of 16S and 23S RNA, respectively. A recommended general procedure is to heat the RNA component at 50 o for l0 min followed by slow cooling to room temperature, and then add the protein and heat at 33 ° for 40 min. ~4 The importance of monovalent and divalent ions, as well as pH and temperature, has been investigated in detail for $4 and $8-16S RNA, ~5,~6 L24-23S RNA, ~6 and L18 and L25-5S RNA. 17 Each of these complexes requires different optimal binding conditions but all will form in the ribosomal reconstitution buffer containing 30 m M Tris-HC1, 20 m M MgCl 2, 300 m M KC1, 6 m M 2-mercaptoethanol at pH 7.8 and 37 ° . A few complexes containing 5S RNA have been isolated directly from the ribosome or cell with no dissociation step. These include ribosomal protein complexes from Bacillus stearothermophilus, ~a E. coli, ~9 yeast,2° rat, 2~ and the transcription factor TF IIIA-5S RNA complex from Xenopus laevis. 22 However, some of these preparative procedures involve denaturing steps, including EDTA treatment, that are known to cause unspecific complex formation. 23,24 II C. Branlant, J. Sriwidada,A. Krol, and J. P. Ebel, Eur. J. Biochem. 74, 155 (1977). t2 p. Sloof, J. Hunter, R. A. Garrett, and C. Branlant, Nucleic Acids Res. 5, 5303 (1978). ~3S. Douthwaite, R. A. Garrett, R. Wagner, and J. Feunteun, Nucleic Acids Res. 6, 2453 (1979). ~4E. Ungewickell, R. A. Garrett, and M. Le Bret, FEBSLett. 84, 37 (1977). ~5C. Schulte and R. A. GarteR, Mol. Gen. Genet. 119, 345 (1972). ~6C. Schulte, C. A. Morrison, and R. A. Garrett, Biochemistry 13, 1032 (1974). ~7p. Spierer and R. A. Zimmermann, Biochemistry 17, 2474 0978). ~s j. Home and V. A. Erdmann, Mol. Gen. Genet. 119, 337 (1972). ~9U. Chen-Schmeisser and R. A. Garrett, FEBS Lett. 74, 287 (1977). 2o R. N. Nazar, M. Yaguehi, G. E. WiUick, C. F. Rollin, and C. Roy, Eur. J. Biochem. 102, 573 (1979). 2t j. Behlke, H. Weltle, I. Wendel, and H. Bielka, Acta Biol. Meal. Germ. 39, 33 (1980). 22 B. Picard and M. Wegnez, Proc. Natl. Acad. Sci. U.S.A. 76, 241 (1979). 23 U. Chen-Sehmeisser and R. Garrett, Eur. J. Biochem. 69, 401 (1976). 24 I. Newton, J. Rinke, and R. Bdmacombe, FEBSLett. 51, 215 (1975).
[30]
PROBING OF r R N A - PROTEIN INTERACTIONS
459
Analysis of Binding Sites The usual strategy for characterizing a protein site on an RNA molecule is to analyze the reactivity of both free and complexed RNA, treated under the same conditions with various enzymes and chemicals, on denaturing polyacrylamide gels. The reactive nucleotides are deduced by aligning the sample bands with those of coelectrophoresed sequencing tracks. The classical approach is to end label the RNA and monitor strand scissions, 25 but use of reverse transcription to detect reactive sites is undoubtedly superior for examining large RNA fragments and molecules.26,27
In Vivo Labeling Method Most of the protein binding sites on the large RNAs were characterized using in vivo a2p-labeled RNA and the standard Sanger RNA sequencing methods. Relevant references to these methods are included in Table I. This approach now has the disadvantages that it is both laborious and requires large amounts of radioactive isotope. Moreover, often the amount of radioactivity in the purified protein-RNA fragment complex, isolated in a given experiment, was too low for complete analysis. It has an advantage, however, over the more recently developed methods when examining large RNA sites that have incurred multiple internal cuts during preparation, because it eventually yields a complete analysis of the RNA moiety. With the end-labeling methods described below, the molar yields of the subfragments are ditticult to estimate and there is always the possibility that one or more subfragments will exhibit heterogeneous ends or not label.
End Labeling Methods These methods are best suited to naturally occurring RNAs such as 5S RNA or 5.8S RNA that have homogeneous ends. For example, 5S RNA complexes with EL18 and EL25 have been characterized in detail by this approach. 2s-3° However, the techniques have been applied successfully to the analysis of protein-RNA fragment complexes isolated from the large RNAs, in particular the L23 site on 23S RNA. 1° 25 D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980). 26 D. C. Youvan and J. E. Hearst, Proc. Natl. Acad. Sci. U.S.A. 76, 3751 (1979). 27 A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 (1984). 2s D. A. Peattie, S. Douthwaite, R. A. Garrett, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 78, 7331 (1981). 29 S. Douthwaite, A. Christensen, and R. A. Garrett, Biochemistry 21, 2313 (1982). 3oj. Christiansen and R. A. Garrett, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 397. Springer-Verlag, New York, 1986.
460
CHEMICAL AND ENZYMATIC PROBING METHODS
32p 5'
A ~
B ~
A
B
[30]
Gel I ~ result
I'-I
FIG. 1. A primary cut (A) is distinguished from a secondary cut (B) by the presence of the former in autoradiograms of both 5'- and Y-end-labeled RNA; the latter is always absent from one of the autoradiograms.
Samples to be probed with ribonucleases should be end labeled before digestion whereas samples to be chemically modified can be labeled before or after modification. The advantage of prelabeling is that it is easier to monitor purification of the complex, or RNA, after modification, whereas the advantage of postlabeling is that the sample may be stored for long periods without deterioration. 3'-End labeling of RNA molecules can be performed directly with [a2p]pCp and RNA ligase, a~ while efficient 5'-end labeling with [7-32p]ATP and polynucleotide kinase requires a prior alkaline phosphatase treatment. However, RNA fragments obtained by partial digestion with RNase T~ or A can be 5'-end labeled directly, while the 3'-end labeling requires a prior phosphatase treatment. Phosphatasetreated RNA should always be purified on a denaturing polyacrylamide gel to prevent labeling at nicked positions. Most laboratories use only one type of end labeling but it should be emphasized that the parallel use of 3'- and 5'-end labeling is a powerful way of distinguishing between primary and secondary effects in enzymatic probing experiments.32,33 This principle is illustrated diagrammatically in Fig. 1 and an example is depicted in Fig. 2 for yeast 5S RNA treated with RNase T 2. Moreover, it is unnecessary to purchase two kinds of radioactive substrate, since it is straightforward to produce [32p]pCp from [7-32p]ATP and Cp; after heat-inactivating the polynucleotide kinase at 65 ° for 10 min and adjusting the buffer. This mixture can be employed for 3'-end labeling of RNA with no further purification step. It is recommended to select for a conformationally homogeneous complex29 and RNA 32 on a nondenaturing gel immediately after probing. The advantages of this are twofold. First, complexes that have altered conformationally as a result of secondary cutting effects, particularly with singlestrand specific ribonucleases, can be eliminated from further analysis. Second, RNA that has dissociated during treatment with, for example, 3t A. G. Bruce and O. G. Uhlenbeck, Nucleic Acids Res. 5, 3665 (1978). 32 S. Douthwaite and R. A. Garrett, Biochemistry 20, 7301 (1981). 33 R. A. Garrett and S. O. Olesen, Biochemistry 21, 4823 (1982).
[30]
PROBING OF r R N A - P R O T E I N INTERACTIONS
51 A
461
3I B C
D E F
T
W
B
C E
G
-'-50
-.-G37 .--40
-G41
----G37 ---30 --,-G52 ~25
....
--20 FIG. 2. Five micrograms of yeast 5S RNA was 5'- or 3'-end labeled, renatured, and digested with RNase T 2. The autoradiogram demonstrates clearly the occurrence of secondary cuts in the regions 22-24 and 32-36 on the 5'-end-labeled sample and at positions 42-44 on the 3'-end-labeled sample. Digestions were performed in 10/tl of TMK buffer for 20 rain at 0* with (A) no ribonuclease, (B) 0.005 unit, (C) 0.01 unit, (D) 0.05 unit, (E) 0.1 unit, and (F) 0.5 unit. The intact RNA band was purified by polyacrylamide gel electrophoresis prior to running the sequencing gel. Ribonuclease T 1 (T) and water hydrolysis (W) tracks are shown for the 5'-end-labeled sample, and a guanosine ((3) chemical sequencing track is given for the 3'-end-labeled sample.
diethyl p y r o c a r b o n a t e (see below) c a n be r e m o v e d . H o w e v e r , r u n n i n g a n o n d e n a t u r i n g gel can also lead to a loss o f i n f o r m a t i o n if a c o n f o r m a tional change, a n d a c o n s e q u e n t alteration in electrophoretic mobility, results f r o m p r i m a r y cutting o r modification effects. C h e m i c a l l y modified c o m p l e x e s or free R N A c a n be subjected to an
462
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
additional selection for full-length molecules, on denaturing gels, prior to analysis on sequencing gels. This step is particularly important for the reverse transcriptase method because the primer preferentially anneals to the smaller degradation products. Exchange Reaction
If reconstitution of a specific complex is difficult or end labeling of a native complex is unsatisfactory, it is worth trying to exchange end labeled RNA with the unlabeled RNA in the complex. This approach has been applied successfully to protein-5S RNA complexes from yeast~ and other eukaryotes in 25 m M ethylenediaminetetraacetic acid (EDTA) at pH 7.0. Although the labeled complex is selected, the "nativity" of the resulting interaction is uncertain since multi-contact proteins may attach to a few high-affinity, and Mg2+-independent, sites on 5S RNA while weaker Mg2+dependent interactions are irreversibly lost. EDTA is known to produce unspecific interactions in ribosomal protein-RNA interactions. 23,24 A safer approach, if the protein remains soluble, is to raise the KC1 concentration and subsequently reduce it. This has recently been done successfully, in the presence of a nonionic detergent, for the Xenopus TF IIIA- 5S RNA complex; the specificity of this complex was confirmed by ribonuclease probing studies.35 Modification - Selection
The experiment can be applied to both reconstituted complexes and to those produced by exchange and it is the only appropriate option if the complex dissociates during chemical treatment. The RNA component is modified, complexed with protein, and then the distribution of modified nucleotides between free and complexed RNA is analyzed. 28 If RNA molecules exhibiting a particular modified nucleotide are excluded from the complex, then it is inferred that this nucleotide is involved, directly or indirectly, in binding. When renatured RNA is modified the structural interpretation is fairly straightforward, but difficulties arise when denatured RNA is modified and then renatured, since many modifications will be selected against simply because they inhibit renaturation of the RNA structure. This problem is particularly acute for the diethyl pyrocarbonate reaction that is normally used to probe for accessible N-7 atoms on adenosines; first, because reaction at the N-7 position destroys the imidazole ring 34 R. N. Nazar and A. G. Wildeman, Nucleic Acids Res. 11, 3155 (1984). 35 j. Christiansen, R. S. Brown, B. S. Sproat, and R. A. Garrett, EMBOJ., 6, 453 (1987).
[30]
PROBING OF r R N A - P R O T E I N
INTERACTIONS
463
and, second, because the reagent can also modify the exocyclic amino group at position 6. So far, the method has been applied only to 5S RNA 2s where the main experimental problem has been to cleanly separate the complex containing modified RNA from the unbound RNA. This problem arises because RNA that has been partially modified may bind less strongly to the protein and will tend to dissociate during electrophoresis. However, by coelectrophoresing unmodified complex and RNA as markers, the bands can be excised fairly accurately. Examination of the RNA material migrating between the modified complex and unbound RNA can also, of course, yield additional useful information on the binding site.
Hybridization Method This procedure involves hybridizing a restriction fragment of DNA to an RNA region that is known to constitute a protein binding site after it has been modified in the free and complexed state. Nonhybridized RNA is then removed by ribonuclease treatment and the hybridized RNA is subsequently isolated, end labeled, and analyzed as described above. This method, which is described in detail in this volume by Van Stolk and Noller [32], has so far only been applied to the large rRNAs. 36,37 The method is laborious and sometimes it is difficult to end label the hybrids. However, it has a potential advantage over the above-mentioned methods in that a whole protein binding region can be isolated from a large RNA with no internal cuts. Moreover, there are fewer problems with control bands than occur with the reverse transcriptase method described below.
Reverse Transcriptase Method This approach exploits the property of the reverse transcriptase to pause, or terminate, at a modified base or a break in the ribose-phosphate backbone. 26,27,38 For smaller RNAs (< 300 nucleotides) the reverse transcriptase method provides an excellent alternative to those described above. Moveover, the additional inclusion of an aniline/acid-catalyzed strand scission provides the reverse transcriptase procedure with the ability to monitor N-7 modifications in addition to modifications of the pyrimidine nucleus and ribonuclease-generated cuts. 36 B. J. Van Stolk and H. F. Noller, J. Mol. Biol. 180, 151 (1984). 37 A. Andersen, N. Larsen, H. Leffers, J. Kjems, and R. A. Garrett, in "Structure and Dynamics of RNA" (C. Hilbers and P. van Knippenberg, eds.), p. 221. Plenum, New York, 1986. 38 D. Moazed, S. Stem, and H. F. Noller, J. Mol. Biol. 187, 399 (1986).
464
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
The method has several advantages over the end-labeling procedures. First,it is unnecessary to label the complex. Second, it is appropriate for probing internal regions of large R N A s (see chapter by Noller et al. [33]) since the end-labeling techniques combined with high-resolutiongels have a practical limit of only about 300 nuclcotidcs from the termini.39 The major disadvantages of the procedure arc that strong termination may occur at naturally occurring modifications within the R N A and that it is necessary to synthesize primers or prepare restrictionfragments so the R N A under study can be covered; however, the combination of t~-[35S]dNTPs and wedge-shaped gels allows the analysis of up to 500 nuclcotidcs per loading.4° W h e n the reverse transcriptaseprocedure is used for small R N A molecules such as 5S R N A , it is preferable to 5'-end label the primer with [~,-a2p]ATP rather than to use ix-labeleddNTPs. Loss of information at the 3'-end of the R N A , where the primer anneals, is unavoidable. Data obtained from the reverse transcriptascprocedure and end-labeling methods should be identical. However, occasionally the former approach revealed double bands particularlyat Kethoxal modification sites and cobra venom (CV) RNase cutting sites;the lattermay be duc to the presence of a 5'-phosphate at the cutting site. R ib o n u cleas e and Chemical P r o b e s
The quality of the selectedprobes is very important. Commercial preparations of ribonuclcases often exhibit protcase activity,so itis essentialto establishthe integrityof the protein component in a complex afterribonuclcase treatment. Highly purified chemical reagents should also be used, invariably. It is also important to check the effectof the reagents on the stabilityof the complex since some of them willmodify the protein component. Thus, kethoxal modifies the guanidino group of argininc, dicthyl pyrocarbonate attacks the imidazolc side chain of histidinc,and dimcthyl sulfate may attack cystcincs;both of the latterreactions have been shown to dissociatecomplexes. A few examples from each group of probes arc listed in Table II together with their spccificiticsand conditions for use. Regardless of the type of probe employed, itis important to use conditions given in Table II that produce single hits per molecule in order to minimize secondary effects.The problem of secondary effectsis greater for ribonuclcascs, and 39 R. A. Crarrett, A. Christensen, and S. Douthwaite, J. Mol. Biol. 179, 689 (1984). 4o j. Egebjerg, H. Leffers, A. Christensen, H. D. Andersen, and R. A. Garrett, J. Mol. Biol. 196, 125 (1987).
[30]
PROBING OF rRNA-PROTEIN INTERACTIONS
465
TABLE II EXPERIMENTALCONDITIONSFOR ENZYMATICAND CHEMICALPROBESa
Probe Ribonucleases T~ T2 A CV Chemicals DMS DEPC Kethoxal CMCT
Amount
Buffer
Volume (/tl)
Time (rain)
Gp~ Ap~, > Np~ Yp~ N~p in helix
0.005 U 0.02 U 0.01 U 0.1 U
TMK TMK TMK TMK
20 20 20 20
30 30 30 30
G(N-7) > A(N-I) > C(N-3) A(N-7) G(N- I,N-2) U(N-3) > G(N-2)
0.3 gl 5 gl I gmol 2.5/zmol
HMK HMK HMK BMK
50 50 50 50
10-30 240 180 150
Specificity
a In all experiments 5 #g of free or complexed RNA is treated at 0". TMK is the ribosomal reconstitution buffer without 2-mercaptoethanol (see text), and HMK and BMK are corresponding buffers where Tris has been replaced by 70 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES) (pH 7.6) and 50 mM potassium borate (pH 8.0), respectively. CV, cobra venom; DMS, dimethyl sulfate; DEPC, diethyl pyrocarbonate; CMCT, 1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-toluene sulfonate.
especially single-strand-specific ones, since they effect strand scission as the primary event. A good rule of thumb is to obtain gel analysis tracks where more than 50% of the RNA molecules is unaffected. However, for certain reactions this may be insufficient. For example, the N-3 on cytidine reacts weakly with dimethyl sulfate so, although gel analyses (after hydrazine treatment and strand scission) may indicate less than one hit per molecule, this could be erroneous due to the concurrent methylation of N-7 on guanosines and N-1 on adenosines. Generally, reactions are performed at 0 ° where the protein-RNA complexes are most stable. However, some chemical reactions are too slow at 0 ° and require a higher temperature; a rough guide is to halve the reaction time for each temperature increase of 10 °. Dimethyl sulfate and diethyl pyrocarbonate modifications are generally performed in 200 #1 cacodylate buffer.25 HEPES is suggested as an alternative buffer (Table II) because it has a higher pK (7.5) and is insufficiently nucleophilic to interfere with the dimethyl sulfate reaction. Although HEPES has a greater buffer capacity than cacodylate at neutral pH, it is nevertheless prudent to check the pH after adding dimethyl sulfate, since the latter invariably contains some sulfuric acid. The reaction volumes given in Table II have also been reduced to facilitate preparation of sampies for nondenaturing polyacrylamide gels.
466
CHEMICAL AND ENZYMATIC PROBING METHODS
[30]
When dimethyl sulfate is used to probe N-7 positions on guanosines, the modified imidazole ring is reduced with sodium borohydride prior to the aniline/acid-catalyzed strand scission. The reduction reaction is critically dependent on the concentration of N-7 methylated guanosines and their ratio to nonmethylated nucleotides, so the inclusion of a heavily methylated cartier RNA will ensure extensive reduction.4l Additional Probes
The above-mentioned ribonucleases and chemicals are those we have employed extensively in studies of various RNAs and their complexes. However, owing to the high affinity of RNase A for pyrimidine-adenosine linkages, this enzyme tends also to cut in double-helical regions. More useful alternatives, with greater single-strand specificity, may be the cyfidine-specific ribonuclease CL3 from chicken liver and the pyrimidine-specific Bacillus cereus enzyme (R. Nazar, personal communication). Singlestrand-specific enzymes such as RNase S~ and the adenosine-specific RNase U2 are less useful for studying complexes owing to their low pH optima. The purine-specific ot-sarcin enzyme cuts both helices and loops and is potentially useful as an universal probe with a minimum of "blind spots" (see Huber and Wool [3 1]). Its major drawback, however, is its inhibition by Mg2+ which is required for the stability of many complexes. Ethyl nitrosourea ethylates accessible phosphates, and is useful for localizing phosphates involved in higher-order interactions, and for investigating protein-rRNA complexes.42 The advantage of this reagent is its unique specificity, but its low reactivity is a disadvantage (an order of magnitude slower than methylation by dimethyl sulfate) which can lead to RNA degradation problems.-43 Recently, a highly water-soluble psoralen derivative, 8-[(3-(4-methyl-1piperazinyl)propyl)oxy] psoralen, has been employed as a mono-addition reagent."-4~ Psoralen mono-addition is a two-step process: intercalation followed by near UV-induced cyclobutane formation. The derivative 4mV. S. Zueva, A. S. Mankin, A. A. Bogdanov, and L. A. Baratova, Eur. J. Biochem. 146, 679 (1985). 42 j. McDougall and R. N. Nazar, J. Biol. Chem. 258, 5256-5259 (1983). 43 V. V. Vlassov, R. Giege, and J. P. Ebel, FEBSLett. 120, 12 (1980). 44 j. B. Hansen, P. Bjerring, O. Buchardt, P. Ebbesen, A. Kanstup, G. Karup, P. Nielsen, B. Norden, and B. Ygge, J. Med. Chem. 28, 1001 (1985). 4s H. Leffers, J. Egebjerg, A. Andersen, T. Christensen, and R. A. Garrett, J. Mol. Biol., submitted for publication, 4~j. Christensen, Nucleic Acids Res., submitted for publication.
[30]
PROBING OF r R N A - P R O T E I N
INTERACTIONS
467
reacts strongly with uridines at or near internal loops but not with regular double helices. The advantage of this probe is that it recognizes flexible RNA regions which can undergo the necessary axial rise per residue; such features often constitute protein-binding sites. 35,4°,4s,~ Interpretation of Polyacrylamide Gel Analyses Establishing which nucleotides have reacted in free RNA and complexes is usually straightforward if sequencing tracks are coelectrophoresed with the samples. In the 3'-end labeling procedure, denatured RNA can be treated with enzymes or chemicals to yield sequencing tracks; with the exception of RNase St and the CV RNase-generated fragments, ribonuclease cuts align with enzyme tracks, while chemically induced sequence tracks align with those produced by chemicals and by RNase S~ and CV RNase. In the reverse transcriptase procedure, sequencing tracks obtained by using dideoxynucleoside triphosphates47 are displaced by one nucleotide relative to the modified positions. It is difficult to quantify digestion and modification data on autoradiograms accurately, and, generally, a semiquantitative + / - system is used for band intensities. A picture of a protein-binding site emerges when the "fragmentation" patterns of the free and complexed RNA are compared for the various probes. Usually, multiple protection effects occur with occasional enhancements. Interpretation of the protection of a ribonuclease cut is less straightforward than for chemical modification owing to the sheer bulk of the ribonucleases. However, free RNA is more flexible conformationally than complexed RNA and some protection effects will result from proteininduced tightening of conformation; enhanced reactivities may reflect an increase in local conformational homogeneity. Most probes exhibit single-strand specificity and the data inevitably have a bias toward loop regions. It is important, therefore, not to dismiss double-helical regions that are "blind spots." Dimethyl sulfate reacts weakly with double helices in the major groove at the N-7 position while the mechanism of recognition of double helices by the CV RNase remains uncertain. The CV RNase employed in our studies was isolated by Vassilenko and Babkina~ and appears to attack double helices primarily while the commercially available RNase Vt from cobra venom may have an additional strong specificity for helical single strands. 49,5° 47 F. Sanger, S. Nieldcn, and A. R. Coulson, Proc. NatL Acad. Sci. U.S.A. 74, 5463 (1977). 4s S. Vassilenko and V. Babkina, Biokhimiya (Moscow) 341, 705 (1965). 49 R. E. Lockard and A. Kumar, Nucleic Acids Res. 9, 5125 (1981). 50 H. B. Lowman and D. E. Draper, J. Biol. Chem. 261, 5396 (1986).
468
C H E M I C A L A N D E N Z Y M A T I C PROBING M E T H O D S
[31]
Concluding R e m a r k s Many protein-binding sites on ribosomal RNA have now been mapped by enzymatic and chemical methods. These approaches have suggested possible protein attachment sites, some of which have been investigated in greater detail by site-directed mutagenesis. 5~,s2 Moreover, previously unidentified sites, such as those of E. coli proteins L2 and L3, have recently been characterized by synthesizing RNA domains using the T7 polymerase system, selectively binding the protein from total ribosomal proteins, and then probing the binding site. 45 What is lacking now is more information on the conserved sequences and structure of the ribosomal proteins. Acknowledgments We thank all current and previous members of this laboratory for their experimental contributions, and SolveigKjaer for her help with the manuscript. 51j. Christiansen, S. Douthwaite, A. Christensen, and R. A. Garrett, EMBO J. 4, 1019 (1985). 52R. J. Gregoryand R. A. Zimmerrnann, NucleicAcids Res. 14, 5761 (1986).
[31] Use of ct-Sarcin to Analyze Ribosomal R N A - Protein Interactions By PAUL W. HUBER and IRA G. WOOL
Galas and Schmitz devised a relatively rapid and precise method to identify a protein-binding domain on a molecule of DNA that they named footprinting. 1 The procedure requires and exploits the placement of a radioactive label at the end of a segment of DNA, the digestion of this DNA to generate a nested set of oligonucleotide fragments (from the free DNA and from the protein-nucleic acid complex), and the analysis of the digestion products alongside sequencing lanes on a polyacrylamide gel. The hydrolysis of the nucleic acid must be carded out in specific circumstances. All, or nearly all, positions must be equally susceptible to the action of the nuclease, and the digestion must be limited, on the average, to no more than one cut per molecule (i.e., "one-hit-kinetics"). This, of course, requires that not all of the molecules be hydrolyzed. If these two conditions are met, a broad distribution of fragment sizes is generated by single cuts of the nucleic acid. Comparison of the digestion ladders of protein-bound nucleic acid and protein-free nucleic acid reveals the site of I D. J. Galas and A. Schmitz, Nucleic Acids Res. 5, 3157 (1978). METHODS IN ENZYMOLOGY, VOL. 164
Copyfisht© 1988by Academic Press,Inc. All fightsof reproduction in any form reserved.
468
C H E M I C A L A N D E N Z Y M A T I C PROBING M E T H O D S
[31]
Concluding R e m a r k s Many protein-binding sites on ribosomal RNA have now been mapped by enzymatic and chemical methods. These approaches have suggested possible protein attachment sites, some of which have been investigated in greater detail by site-directed mutagenesis. 5~,s2 Moreover, previously unidentified sites, such as those of E. coli proteins L2 and L3, have recently been characterized by synthesizing RNA domains using the T7 polymerase system, selectively binding the protein from total ribosomal proteins, and then probing the binding site. 45 What is lacking now is more information on the conserved sequences and structure of the ribosomal proteins. Acknowledgments We thank all current and previous members of this laboratory for their experimental contributions, and SolveigKjaer for her help with the manuscript. 51j. Christiansen, S. Douthwaite, A. Christensen, and R. A. Garrett, EMBO J. 4, 1019 (1985). 52R. J. Gregoryand R. A. Zimmerrnann, NucleicAcids Res. 14, 5761 (1986).
[31] Use of ct-Sarcin to Analyze Ribosomal R N A - Protein Interactions By PAUL W. HUBER and IRA G. WOOL
Galas and Schmitz devised a relatively rapid and precise method to identify a protein-binding domain on a molecule of DNA that they named footprinting. 1 The procedure requires and exploits the placement of a radioactive label at the end of a segment of DNA, the digestion of this DNA to generate a nested set of oligonucleotide fragments (from the free DNA and from the protein-nucleic acid complex), and the analysis of the digestion products alongside sequencing lanes on a polyacrylamide gel. The hydrolysis of the nucleic acid must be carded out in specific circumstances. All, or nearly all, positions must be equally susceptible to the action of the nuclease, and the digestion must be limited, on the average, to no more than one cut per molecule (i.e., "one-hit-kinetics"). This, of course, requires that not all of the molecules be hydrolyzed. If these two conditions are met, a broad distribution of fragment sizes is generated by single cuts of the nucleic acid. Comparison of the digestion ladders of protein-bound nucleic acid and protein-free nucleic acid reveals the site of I D. J. Galas and A. Schmitz, Nucleic Acids Res. 5, 3157 (1978). METHODS IN ENZYMOLOGY, VOL. 164
Copyfisht© 1988by Academic Press,Inc. All fightsof reproduction in any form reserved.
[31]
USE OF O/-SARCINTO FOOTPRINT rRNP COMPLEXES
469
association. This method depends on the physical protection of the DNA by a protein. The successful adaptation of this technique to ribonucleoprotein (RNP) complexes has been thwarted by the unavailability of ribonucleases that can generate an extensive population of oligonucleotide fragments of different lengths. Ribonucleic acids have a great deal of secondary and tertiary structure and most ribonucleases are structure specific, cleaving only single-stranded or, in a small number of cases, only double-stranded RNA. In nondenaturing conditions hydrolysis by a particular ribonuclease is confined to a relatively few sensitive positions in the structure. Thus, neither condition for proper hydrolysis is met: positions are not equally hydrolyzed and secondary cuts occur. t~-Sarcin is a cytotoxic ribonuclease that blocks protein synthesis by inactivating ribosomes. 2-4 The cause of this inactivation is a single cleavage at a position within a highly conserved sequence of the large (23-28S) rRNA. 5 However, a-sarcin can hydrolyze on the 3' side of purines in both single- and double-stranded regions of naked RNA. 6 Moreover, this nuclease is fully active at neutral pH and has no unusual cofactor requirements. These properties suggested to us that c~-sarcin might be a valuable reagent for footprinting protein-RNA complexes. We established the suitability of a-sarcin for this purpose by determining the association site for the three ribosomal proteins (L5, Ll 8, and L25) that bind to Escherichia coli 5S rRNA (Fig. 1).7 Our definition of the L18 and L25 binding sites is in good agreement with several earlier studies; moreover, we succeeded in determining the L5 attachment site which had not been identified before. We have gone on to locate the regions of association of Xenopus transcription factor IIIAs and of rat ribosomal protein L59 on their cognate 5S rRNAs, thus providing an extensive analysis of protein- 5S rRNA interactions. Materials a-Sarcin is produced by a mold, Aspergillusgiganteus MDH 18894; the protein can be purified in high yield directly from the extracellular culture 2 C. Fernandez-Puentes and D. Vazquez, F E B S Lett. 78, 143 (I 977). 3 F. P. Conde, C. Fernandez-Puentes, M. T. V. Montero, and D. Vazquez, FEMSMicrobiol. Lett. 4, 349 (1978). 4 A. N. Hobden and E. Cundliffe, Biochem. J. 170, 57 (1978). s y. Endo and I. G. Wool, J. Biol. Chem. 257, 9054 (1982). 6 y. Endo, P. W. Huber, and I. G. Wool, J. Biol. Chem. 258, 2662 (1983). 7 p. W. Huber and I. G. Wool, Proc. Natl. Acad. Sci. U.S.A. 81, 322 (1984). s p. W. Huber and I. G. Wool, Proc. Natl. Acad. Sci. U.S.A. 83, 1593 (1986). 9 p. W. Huber and I. G. Wool, J. Biol. Chem. 261, 3002 (1986).
I 2
3
4
5
6
78
I
2
3
4
5
6
7
8
Fxo. 1. Protection of5S rRNA from digestion with c~-sarcinby ribosomal protein LIB.7 E. ¢oli ribosomal protein L18 (10 pM) was incubated with renatured radioactive 5S rRNA
(0.4 #M) in buffer (50 mM Tris-HC1, pH 7.6, 285 mM KCI, 6 mM MgCl2) for 30-45 min at 33 °. The mixture was diluted (to 50 mM Tris-HC1, pH 7.6, 95 mM KC1, 2 mM MgC12)and digested with a-sarcin for 15 min at 30 °. Lanes: 1, alkaline hydrolyzate of 5S rRNA; 2, T~ ribonuclease digest of 5S rRNA; 3, 8 #M~-sarcin digest of a LI8-5S rRNA complex; 4, 8 #Ma-sarcin digest of 5S rRNA; 5, 4 p.Ma-sarcin digest o f a L18-5S rRNA complex; 6, 4 #Ma-sarcin digest of5S rRNA; 7, 0.8/~M¢-sarcin digest of5S rRNA in the absence of KCl and MgCl2; 8, 5S rRNA that was not treated with a-sarcin. The 5S rRNA was labeled at the 5' end and the digests were analyzed by electrophoresis on 10% polyacrylamide gels. Brackets enclose regions of 5S rRNA protected by ribosomal protein Ll 8.
[31 ]
USE OF OL-SARCINTO FOOTPRINT rRNP COMPLEXES
471
filtrate.'° Fermentation conditions for optimal production ofa-sarcin have been described.l' The lyophilized product is stable, and solutions of small amounts of the protein dissolved in water at a concentration of 10 mg/ml retain full activity for several months if kept at 5 °. In agreement with Olson and Goerned ° (but in contrast to Schindler and Davies '2) we find that slow freezing at - 2 0 ° causes inactivation of the nuclease; therefore, solutions of ot-sarcin should not be frozen. Methods The concentration of a-sarcin that will generate a broad distribution of oligonucleotides of different lengths in the conditions of a particular experiment must be determined empirically. The range of concentrations of the toxin that are effective is usually quite narrow, spanning only a two- to threefold difference. This determination is complicated by the fact that a-sarcin is inhibited by the very cations that are frequently necessary to stabilize protein-nucleic acid complexes3 ,7 The enzyme is inhibited by monovalent cation in excess of 100 raM, and by divalent cation in excess of 2 mM. This inhibition can be overcome to some extent by increasing the concentration ofa-sarcin. For example, the digestion ofE. coli 5S rRNA in 50 m M Tris-HC1 alone required only 0.8/tM ot-sarcin, whereas in 50 m M Tris-HCl, pH 7.6, 95 m M KC1, 2 m M MgC12, 4 to 8 pal//ct-sarcin was needed (Fig. 1, compare lanes 4, 6, 7). The higher concentrations of a-sarcin do not alter the specificity of the nuclease. It is imperative that most of the nucleic acid be associated with the specific binding protein in order to minimize background interference. We have satisfied this requirement in two ways. In the first, the RNA was carefully renatured and the RNP particles were reconstituted in the presence of concentrations of cations optimal for binding and with a 6- to 20-fold molar excess of protein over RNA to ensure efficient complex formation, i.e., the absence of free RNA. The samples were then diluted to decrease the cation concentrations to levels just sufficient to maintain the stability of the complexes, but low enough to allow efficient hydrolysis by a-sarcin. The second procedure was used where reconstitution was not required. The stable RNP complexes were separated from free nucleic acid by preparative electrophoresis through cylindrical, nondenaturing polyacrylamide gels. s,9 Elution was into a small volume (<300/zl) of dialysis lOB. H. Olson and G. L. Goerner, Appl. Microbiol. 13, 314 (1965). 11 B. H. Olson, J. C. Jennings, V. Rosa, A. J. Junek, and D. M. Schuurmans, Appl. Microbiol. 13, 322 (1965). 12D. G. Schindler and J. E. Davies, Nucleic Acids Res. 4, 1097 (1977).
472
CHEMICAL AND ENZYMATIC PROBING METHODS
[31 ]
tubing. Migration and recovery of the sample was monitored with a Geiger counter. Immediately after complex formation, or isolation by preparative dectrophoresis, the substrate was divided into aliquots and treated with the predetermined concentrations of a-sarcin. Digestion is most efficient in 50 m M Tris-HC1, pH 7.0, without ions. Unfortunately, this is ordinarily not the best condition for either formation of RNP complexes or for isolation of stable particles. However, suitable digestion can be achieved in suboptimal conditions, if the concentration of t~-sarcin is increased (see above), a-Sarcin is not strongly effected by pH, but is clearly more active at pH 7 than at pH 8. Olson and Goerner have reported that a-sarcin is not stable in alkaline solution.~° Digestions are at 30 ° for 15 min. Although we have not studied the temperature dependence of ot-sarcin activity rigorously, we have shown that the nuclease is virtually inactive at 0 °.6 The turnover number for a-sarcin when the substrate is ribosomes, the apparent target of the cytotoxin's action in vivo, is 55 min -~, similar in magnitude to that of many restriction endonucleases.6 When free RNA is the substrate, hydrolysis is much more sluggish. In comparable conditions and at comparable concentrations of substrate the amount of a-sarcin required for nonspecific partial hydrolysis of free total rRNA is at least 300-fold higher than that required for site-specific hydrolysis of 28S rRNA in ribosomes. 6 We calculate that, during the course of digestion of free RNA (at 30 ° for 15 min), ot-sarcin turns over only once or twice. Our observations suggest that it is the release of t~-sarcin after hydrolysis that is rate-limiting. In accordance with this we note that the extent of hydrolysis is about the same for shorter reaction times (e.g., 5 min). It appears possible then to substantially reduce the time of digestion in cases where the substrate complex is not stable. The absence of activity at low temperatures and the slow turnover of t~-sarcin allows one to stop the hydrolysis by any of several means, including addition of excess unlabeled RNA followed by phenol extraction, or by addition of 10 M urea and freezing. The products of the digestion are analyzed on polyacrylamide sequencing gels containing 7 M urea la (Fig. 1). If the digestion volume is small and the reaction is stopped by the addition of urea, then the samples can usually be loaded directly onto the gel. If the concentration of protein is high (> 0.2 mg/ml) the samples are extracted with phenol, phenol/chloroform, chloroform, and ether followed by either lyophilization or precipitation with ethanol. These samples are dissolved in 10 M urea before they are t3 H. Donis-KeUer, A. M. Maxam, and W. Gilbert, Nucleic Acids Res. 4, 2527 (1977).
[31]
USE OF OL-SARCIN TO FOOTPRINT r R N P
COMPLEXES
473
loaded onto the gel. Early on, the sequencing gels contained a good deal of streaking and the bands were not well resolved. These faults were aggravated when the amount of a-sarcin was increased. We discovered that the problem was ameliorated by adding 0.1 volume of 0.2 M EDTA prior to loading the sample on the gel. Apparently the difficulty was due to oligonucleotides that were tightly bound to a-sarcin. a-Sarcin generates Y-phosphates at cleavage sites, 5,6 so digests can be analyzed alongside either chemical or enzymatic sequencing reaction products (which are also Y-phosphates) in order to identify the protected nucleotides. Comments We have been able to generate, with the ribonuclease a-sarcin, digestion ladders of 5S rRNA in conditions that maintain the integrity of RNP complexes containing this nucleic acid. The properties that make a-sarcin useful are, first and foremost, its ability to cleave purines in both singleand double-stranded regions of RNA and, second, its optimal activity at neutral pH and its lack of cofactor requirements. However, there are some limitations to the procedure that need to be mentioned. The inhibition by relatively low concentrations of magnesium (no greater than 2 mM) is a serious problem since this cation is generally required for formation of stable RNP complexes. The inhibition by monovalent cations in concentrations above 100 m M i s less of a difficulty. In the analysis of complexes between E. coli ribosomal proteins and 5S rRNA it was possible to overcome this complication by forming the RNP particle in optimum conditions, then reducing the concentration of cations to the minimum that would maintain stability, and finally, using higher concentrations of a-sarcin in the digestion reaction. 7 We cannot emphasize too strongly the necessity to determine empirically the optimal concentration of a-sarcin required for the digestion of the nucleic acid in the RNP complex at the concentration of ions necessary to maintain the integrity and specificity of the interaction of the protein and the RNA. This is the most essential and the most time consuming aspect of the use of a-sarcin in footprinting experiments. Unless one is willing to make this commitment in time and effort the analysis is not likely to succeed. a-Sarcin cleaves only after purines6; thus, complete hydrolysis is not obtained. Although, a long stretch of pyrimidine residues can create a "blind spot," in practice that has not jeopardized determination of the location of protein attachment sites. On the other hand, the sequence specificity of a-sarcin is not absolute and occasionally et-sarcin will cleave
474
CHEMICAL AND ENZYMATIC PROBING METHODS
[31]
after a pyrimidine, especially if it is flanked on both sides by purines. This slip in specificity is actually helpful in experiments of this sort since it increases the number of positions on the digestion ladder. A more perplexing observation is the resistance of some purine residues to hydrolysis by a-sarcin. E. coli, rat, and Xenopus 5S rRNA all possess purines that are not cleaved. For example, guanosine-41 of E. coli 5S rRNA is the nucleotide most susceptible to chemical modification even in the ribosome, yet it is not hydrolyzed by a-sarcin. 7 In both rat and Xenopus 5S rRNA guanosine-116 is cleaved, although the adjacent guanosine at position 117 is not. 8,9 Resistant residues include adenosine and guanosine nucleotides in single- and double-stranded regions of the molecule, so neither primary nor secondary structure appears to be the basis for the resistance. Several observations suggest that the resistance may be the result of tertiary interactions that block access of the toxin to phosphodiester bonds. tRNA molecules have an extensive network of tertiary interactions and several are particularly resistant to hydrolysis by a-sarcin. We compared the hydrolysis of yeast tRNA n~ and tRNA~Met in the native, "semidenatured," and denatured conditions described by Peattie find Gilbert. ~4 For both nucleic acids, particularly tRNAiM~t, most of the resistant purine residues become susceptible to a-sarcin hydrolysis in "semidenatured" conditions (i.e., conditions presumed to disrupt tertiary, but not secondary, structure). Only a few of the remaining resistant purines become sensitive when tRNA is denatured. It is difficult to be certain how to interpret this result, since there is magnesium in the native buffer and EDTA in the buffer for "semidenaturation." However, in native conditions the tRNAs remain resistant to extremely high concentrations of a-sarcin, suggesting that the absence of hydrolysis may not result solely from an inhibition of the enzymatic activity of ot-sarcin by magnesium. During our attempt to identify the binding site for transcription factor IIIA on Xenopus 5S rRNA, we made an observation that again suggests that a-sarcin activity is sensitive to higher-order structure. 8 Preparations of the factor IIIA-5S rRNA complex (7S RNP complex) invariably contain some free 5S rRNA. We compared simultaneously, and in identical conditions, the digestion o f ( l ) free 5S rRNA that was purified with the 7S RNP particle, (2) 5S rRNA that was extracted from the 7S particle, (3) and 5S rRNA that was in the particle. There were two regions of decreased hydrolysis (nucleotides 23-25 and 47-59) within the free rRNA relative to the 5S rRNA extracted from the complex or to the 5S rRNA bound to the protein. If free 5S rRNA and the 5S rRNA extracted from the particle were 14 D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980).
[32]
RNA-DNA
HYBRIDIZATION IN CHEMICAL PROBING
475
denatured, their digestion profiles after a-sarcin treatment were identical, suggesting again that the differences in hydrolysis are a reflection of some aspect of higher-order structure. These results are similar to those in which two conformational forms of Xenopus 5S rRNA were identified by use of either structure-specific nucleases ts or a chemical probe.16 Conclusion a-Sarcin has proved to be a valuable reagent for the identification of protein-binding sites on 5S rRNA. We expect that the nuclease will be useful in work with complexes containing other ribonucleic acids.t7 ~5j. Andersen, N. Delihas, J. S. Hanas, and C.-W. Wu, Biochemistry 23, 5759 (1984). ~6T. Pieler and V. A. Erdmann, FEBSLett. 157, 283 (1983). 17V. Siegel and P. Walter, Proc. Natl. Acad. Sci. U.S.A. 85, 1801 (1988).
[32] U s e o f R N A - D N A H y b r i d i z a t i o n in C h e m i c a l Probing of Large RNA Molecules B y BARBARA J. VAN STOLK a n d HARRY F. NOLLER
Structure-specific chemical probes are useful for testing structural models for RNA, for monitoring conformational changes in RNA, or for localizing ligand-binding sites on RNA. Peattie and Gilbert ! described a method for localization of sites of attack by such probes in which the modified positions are "read" directly from autoradiographs of sequencetype polyacrylamide gels. Their method exploits the fact that certain probes labilize the glycosyl linkage connecting base to sugar. Following base removal, aniline-induced fl-elimination leads to strand scission. If this chemistry is performed on end-labeled RNA, the sites of attack can be identified from the electrophoretic mobility of their respective end-labeled fragments. This approach is limited by the resolution of gel electrophoresis, in that individual bases can be resolved only to about 200- 300 nucleotides from the labeled end. For large RNA molecules such as ribosomal RNA or messenger RNA, this limitation prevents analysis of internal positions of the polynucleotide chain. The method presented here allows the PeattieGilbert approach to be extended to analysis of RNA molecules of any length. It also provides a means of preparing specific end-labeled fragments D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Pre~, Inc. All rights of reproduction in any form reserved.
[32]
RNA-DNA
HYBRIDIZATION IN CHEMICAL PROBING
475
denatured, their digestion profiles after a-sarcin treatment were identical, suggesting again that the differences in hydrolysis are a reflection of some aspect of higher-order structure. These results are similar to those in which two conformational forms of Xenopus 5S rRNA were identified by use of either structure-specific nucleases ts or a chemical probe.16 Conclusion a-Sarcin has proved to be a valuable reagent for the identification of protein-binding sites on 5S rRNA. We expect that the nuclease will be useful in work with complexes containing other ribonucleic acids.t7 ~5j. Andersen, N. Delihas, J. S. Hanas, and C.-W. Wu, Biochemistry 23, 5759 (1984). ~6T. Pieler and V. A. Erdmann, FEBSLett. 157, 283 (1983). 17V. Siegel and P. Walter, Proc. Natl. Acad. Sci. U.S.A. 85, 1801 (1988).
[32] U s e o f R N A - D N A H y b r i d i z a t i o n in C h e m i c a l Probing of Large RNA Molecules B y BARBARA J. VAN STOLK a n d HARRY F. NOLLER
Structure-specific chemical probes are useful for testing structural models for RNA, for monitoring conformational changes in RNA, or for localizing ligand-binding sites on RNA. Peattie and Gilbert ! described a method for localization of sites of attack by such probes in which the modified positions are "read" directly from autoradiographs of sequencetype polyacrylamide gels. Their method exploits the fact that certain probes labilize the glycosyl linkage connecting base to sugar. Following base removal, aniline-induced fl-elimination leads to strand scission. If this chemistry is performed on end-labeled RNA, the sites of attack can be identified from the electrophoretic mobility of their respective end-labeled fragments. This approach is limited by the resolution of gel electrophoresis, in that individual bases can be resolved only to about 200- 300 nucleotides from the labeled end. For large RNA molecules such as ribosomal RNA or messenger RNA, this limitation prevents analysis of internal positions of the polynucleotide chain. The method presented here allows the PeattieGilbert approach to be extended to analysis of RNA molecules of any length. It also provides a means of preparing specific end-labeled fragments D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Pre~, Inc. All rights of reproduction in any form reserved.
476
CHEMICAL AND ENZYMATIC PROBING METHODS
[32]
of any RNA molecule. The only special requirement is for the availability of a DNA clone of the RNA molecule of interest. Our experience has been with applications to ribosomal RNA, 2 but there is no reason to believe that the procedures outlined here cannot be applied to large RNA molecules from any source. Summary of the Method An RNA sample is reacted with the chemical probes dimethyl sulfate or diethyl pyrocarbonate as described by Peattie and Gilbert. ~ The RNA is then hybridized to a restriction digest of plasmid DNA, specifying the RNA sequence. Nonhybridized RNA is trimmed away with RNase T1, leaving overhanging RNA ends that can be labeled at the 5' or (after phosphatase treatment) 3' termini. Oligonucleotides are removed by gel filtration to increase the efficiency of the end-labeling reaction. Labeled hybrids are separated by gel electrophoresis under nondenaturing conditions. End-labeled RNA fragments are then stripped from their complementary DNAs and purified by gel electrophoresis under denaturing conditions. Finally, the strand-scission chemistry generates cuts at the modified sites, which are then identified by running a denaturing gel. Chemical Probing Localization of the sites of modification depends on labilization of the base-ribose glycosyl linkage, due to derivatization of the base. As reported by Peattie and Gilbert, dimethyl sulfate (DMS) and diethyl pyrocarbonate (DEP) are useful structure-specific probes that fulfill this requirement. DMS attacks single-stranded cytosines at N-3, albeit slowly, and guanines (either single- or double-stranded) at N-7. Base removal of N-7-substituted guanines depends on a subsequent reduction with borohydride. Reaction of adenines with DEP is highly conformation dependent. This reagent appears to react only with unstacked adenine residues. At high ionic strength (->0.3 M salt concentrations), we have observed reaction of DEP with certain cytosine residues as well.2 The nature of this reaction and its conformational specificity are not yet understood. Because of the strong reactivity of DEP toward proteins, 3 use of this reagent to probe ribonucleoprotein complexes can be problematic. Modification of 16S ribosomal RNA with DEP under conditions similar to those used for ribosome reconstitution4 illustrates application of this method to probe higher-order structure in a large RNA molecule.2 Anneal2 B. J. Van Stolk and H. F. Noller, J. Mol. Biol. 180, 151 (1984). 3 W. B. Melchior and D. Fahmey, Biochemistry g, 251 (1970). 4 p. Traub, S. Mizushima, C. V. Lowry, and M. Nomura, this seres, Vol. 20, p. 391.
[32]
RNA-DNA
HYBRIDIZATION IN CHEMICAL PROBING
477
ing of the RNA is accomplished by heating 15/tg of 16S rRNA in 200/tl of CMK buffer (80 m M potassium cacodylate, pH 7.0, 20 m M MgC12, 300 m M KC1) for 1 hour at 42 °. The RNA is then cooled on ice, 5/tl of DEP (Eastman) is added, and the reaction mixture is incubated for 30 min at 37 °, with occasional mixing. The mixture is chilled, and the RNA precipitated by addition of 200/,1 of 1.5 M sodium acetate and 1 ml of 95% ethanol. The pellet is redissolved in 200/,1 of 0.3 M sodium acetate and reprecipitated with 0.8 ml of 95% ethanol. The final pellet is washed with 80% ethanol to remove any traces of salt and dried under vacuum. The RNA is now ready for hybridization.
Hybridization and RNase TI Digestion Hybridization conditions are derived from those used to generate R loops, 5,6 where R N A - D N A hybrids are marginally more stable than the corresponding DNA duplexes. DNA containing sequences complementary to the RNA of interest (in this case pKK35357 or pJN532 plasmid DNA) is cut with the appropriate restriction endonucleases, extracted 3 times with phenol and 3 times with ether, ethanol precipitated, washed with 80% ethanol, and dried under vacuum. We have used 3- to 6-fold molar excess of RNA to DNA to minimize formation of"tandem hybrids" (see below). This corresponds to about 35-40/zg of plasmid DNA per 10- 15 #g of 16S rRNA, for each hybridization. The dried DNA pellet is dissolved in l 0 / d of hybridization buffer (0.9 ml deionized formamide, 90/zl NaC1, 20/~l 1 M sodium HEPES, pH 7.0) and incubated at 67 ° for 10- 15 min. The hot DNA solution is added directly to the dried RNA pellet, and the solution is then incubated at 50 o for 30 min, vortexing to ensure that the RNA is completely dissolved. Hybridization is terminated abruptly by adding 290/zl of cold 0.3 M sodium acetate, 20 m M Tris-HC1, pH 7.8, with thorough mixing. It is important that the hybridization mixture is cooled and diluted quickly. Immediately following the hybridization step, 2/ll of a solution of RNase TI (Sankyo; 2.5 mg/ml in l0 m M Tris-HC1, pH 7.4, 1 mMEDTA) is added and incubated at 37 ° for 30 rain. Under these conditions, the nonhybridized RNA is trimmed away, leaving the R N A - D N A hybrid duplex, usually with 5' and 3' overhanging RNA ends, corresponding to the positions of the first exposed guanines. RNase digestion is terminated
5 M. Thomas, R. L. White, and R. W. Davis, Proc. Natl. Acad. Sci. U.S.A. 73, 2294 (1976). 6 j. Casey and N. Davidson, Nucleic Acids Res. 4, 1539 (1977). 7 j. Brosius, A. Ullrich, M. A. Raker, A. Gray, T. J. Dull, R. R. Gutell, and H. F. Noller, Plasmid6, 112 (1981).
478
CHEMICAL AND ENZYMATIC PROBING METHODS
[32]
by chilling the mixture on ice and addition of sodium dodecyl sulfate to a final concentration of 0.5%. Protein is removed by two phenol extractions, ether extraction to remove phenol, followed by ethanol precipitation of the hybrids, an 80% ethanol wash, and drying of the pellet under vacuum.
Phosphatase T r e a t m e n t If nonradioactive RNA is used as starting material, it is convenient to end label it at the hybrid stage, to facilitate its final purification as well as to permit sequencing and identification of modified sites. In our hands, 3'-end labeling is most effective (see below), and this requires prior removal of the 3'-phosphate left by the action of RNase T~. Calf intestinal phosphatase (Sigma) is dialyzed against 20 m M TrisHC1, pH 8.6, 0.01 m M ZnC12, and stored at - 2 0 ° at a concentration of 900- 1000 units/ml. The hybrid pellet is redissolved in 20 pl of 20 rnM Tris-HC1, pH 8.6, and 1 pl of calf intestinal phosphatase is added. After incubation at 37 ° for 30 rain, the volume is brought to 0.3 ml by addition of 0.3 M sodium acetate. 0.5% sodium dodecyl sulfate. After removal of protein by two phenol and one chloroform extractions, the dephosphorylated hybrids are precipitated by addition of 1 ml of 95% ethanol, and dried under vacuum.
Gel Filtration Oligonucleotides released by RNase treatment are efficient substrates for the end-labeling reaction, and so drastically reduce the efficiency of the labeling of hybrid RNA. For this reason, it is essential to remove free oligonucleotides from the hybrid mixture prior to the next step. We find that this can be accomplished by gel filtration. Sephadex (3-50 (fine) is swollen in 0.3 M sodium acetate by standing overnight at room temperature or by a 2-hr incubation at 67 °. The slurry is poured into a l-ml disposable pipet (Falcon #7511) plugged at its narrow end with cotton wool, and filled to the double line, about 4 cm from the top (total bed volume is - 1 . 5 ml). Columns are prewashed with about two column volumes of 0.3 M sodium acetate. The dephosphorylated hybrid is redissolved in 40 pl of 20% sucrose, 0.3 M sodium acetate, and eluted with 0.3 M sodium acetate. The void volume (-0.55 ml) is discarded, and the next 0.2-0.3 ml contains the hybrids. These volumes are best calibrated experimentally using a mixture of a2p-labeled intact RNA and oligonucleotides. Hybrids are precipitated with 1 ml of 95% ethanol, washed with 80% ethanol, and dried.
[32]
RNA-DNA
HYBRIDIZATION IN CHEMICAL PROBING
479
E n d Labeling In our experience, 3'-end labeling of the hybrid RNA is preferable to 5'-end labeling. The advantages are that small amounts of material are more efficiently labeled, labeling of the DNA strand is minimized, and the Peattie-Gilbert strand-cleavage chemistry~ appears to be better suited to 3'-end-labeled RNA. Nevertheless, 5'-end labeling using [7-32p]ATP and polynucleotide kinases can also be utilized, if necessary. In this case, omitting the phosphatase step results in preferential labeling of the RNA strand (which has a 5'-OH) over the DNA strand (which has a 5'-phosphate). Here, we describe the 3'-end labeling procedure. Following gel filtration, the hybrids are labeled using [32p]pCp and RNA ligase. 9 The hybrid is dissolved in 9/tl of ligation buffer (50 m M sodium HEPES, pH 7.5, 3.3 m M dithiothreitol, 15 m M MgCl2, 10% DMSO, 0.01 mg/ml bovine serum albumin) and added to 30 /~Ci of [32p]pCp (Amersham, 3000 Ci/mmol) that had been dried down in an Eppendorf tube just prior to use. To this solution are added 1 #l of a 0.5 mg/ml solution of neutralized ATP and 0.5 to 1/tl o f T 4 RNA ligase (P-L). The reaction mixture is incubated on ice for 6 hr, or overnight. Purification of Hybrids and RNA Fragments Following ligation, 10#l of a solution containing 0.1XTBE, 0.4% sodium dodecyl sulfate, 50o/0 glycerol, 0.05% xylene cyanol, and 0.05% bromphenol blue is added, and the mixture is vortexed and centrifuged briefly. The sample is loaded on to a 40-cm nondenaturing 8% polyacrylamide (l :30 bisacrylamide: acrylamide) gel in TBE (89 m M Tris-borate, 5 m M EDTA, pH 8.3). Sample wells about 1 cm wide, with a gel about 1.5 mm thick, accommodate the amount of material described here. After electrophoresis of the bromphenol blue dye marker has gone about twothirds of the length of the gel ( - 2 5 - 30 cm), electrophoresis is stopped and the labeled hybrid bands are located by autoradiography. This usually takes on the order of an hour to several hours using Kodak XAR-5 film. Bands are excised, covered with 0.35 ml of elution buffer (0.3M sodium acetate, 0.2% sodium dodecyl sulfate, 0.05 mg/ml carrier tRNA) in an Eppendorf tube, and agitated overnight at room temperature to elute the hybrids from the gel slices. Hybrids are then recovered by ethanol precipitation, washed, and dried. Hybrids can be tentatively identified by their electrophoretic mobilities, which are similar to the mobilities of the corres A. M. Maxam and W. Gilbert, this series, Vol. 65, p. 499. 9 A. G. Bruce and O. C. Uhlenbeck, Nucleic Acids Res. 5, 3665 0978).
480
CHEMICAL AND ENZYMATIC PROBING METHODS
[32]
sponding DNA restriction fragments. Unambiguous identification can be accomplished by chemical 1° or enzymatic H sequencing of the purified RNA. RNA fragments are recovered, free of DNA, by denaturation followed by a final gel electrophoresis step. The purified hybrid pellet is dissolved in 10 gl of a solution containing 0.1 × TBE, 8 M urea, heated to 90 ° for 3 min, and chilled rapidly in an ice bath. The denatured sample is then loaded onto an 8% polyacrylamide (1 : 30 bisacrylamide: acrylamide), 8 M urea, TBE gel (1.5 m m thick, 4 0 - 5 0 cm long), run very hot to prevent reannealing of the hybrids. RNA bands are visualized by autoradiography, cut out and eluted as before, except that elution is carried out at 4*. The RNA fragments are recovered by ethanol precipitation. Potential Problems Occasionally, two adjacent restriction fragments will hybridize to the same RNA strand with higher than random frequency. In this event, the protected RNA fragment will be the sum of the length of the two restriction fragments, generating what we term a "tandem hybrid." Tandem hybrids will appear as hybrids of anomalous size2 and their identities can be confirmed by sequencing a few nucleotides near the end of the resulting RNA, if the sequence is known. If this presents a serious problem, using a higher ratio of RNA to DNA can help to overcome it. Another difficulty that can arise is inefficient labeling, making the autoradiographic exposures unduly long. The most likely problems are incomplete removal of Y-phosphate, or contamination with oligonucleotides. The latter can be diagnosed by the presence of highly labeled material with high electrophoretic mobility that is distinct from pCp and its breakdown products. This problem can be overcome by careful exclusion of low-molecular-weight material in the gel-filtration step. Incomplete dephosphorylation is often caused by inhibition of the phosphatase by contaminating ions, such as phosphate or ammonium. This kind of contamination can be minimized by repeated ethanol precipitations and washes prior to the phosphatase step. Another problem that we have seen is multiple hybrid or RNA bands obtained from the same restriction fragment. This is usually due to "frayed ends" left by the RNase treatment. Here, a suggested remedy is to adjust the strength of the RNase digestion, either by changing the RNase concentration, or the time or temperature of the digest. to D. A. Peattie, Proc. Natl. Acad. Sci. U.S.A. 76, 1760 (1979). i~ H. Donis-Keller, A. M. Maxam, and W. Gilbert, Nucleic Acids Res. 4, 2527 (1977).
[33]
P R O B I N G M O N I T O R E D BY P R I M E R E X T E N S I O N
48 1
Applications This method has been used to probe higher-order (i.e., secondary and tertiary) structure in 16S ribosomal RNA using DEP, 2 and to study thermal denaturation of specific regions of 16S rRNA.~2 Another application is in the preparation of defined fragments of large RNA molecules for biochemical or physical studies. Draper and co-workers ~a have developed a related method, in which a specific restriction fragment cloned into an M 13 vector is used as a source of the complementary DNA strand. With the availability of large quantities of synthetic DNA oligomers, preparation of specific RNA fragments in milligram amounts for physical studies should also be possible. 12 B. J. Van Stolk, Ph.D. thesis. University of California, Santa Cruz, California. la D. E. Draper, S. A. White, andJ. M. Kean, this volume [14].
[33] S t r u c t u r a l A n a l y s i s o f R N A U s i n g C h e m i c a l a n d Enzymatic Probing Monitored by Primer Extension By SETH STERN, DANESH MOAZED, and HARRY F. NOLLER
Chemical and enzymatic probing, monitored by primer extension, has become a powerful tool for the analysis of RNA structure. The reactivities of individual nucleotides composing large RNA molecules may be determined rapidly by utilizing a series of primers spaced at approximately 200 nucleotide intervals. In addition, numerous chemical reagents and nucleases may be employed as probes, since the only requirement is that they modify the template so as to produce pauses or stops in the progress of reverse transcriptase) -3 When the eDNA products of primer extension reactions are separated on a DNA sequencing gel, the positions of stops or pauses in eDNA synthesis are visualized as a series of bands, each of which corresponds to a particular nucleotide in the modified RNA template. The positions of the stops are determined by reference to dideoxy sequencing reactions run in parallel. Because the extent of the probing reactions is very limited, the relative quantity of truncated eDNA in a given band is propori D. C. Youvan and J. E. Hearst, Proc. NatL Acad. Sci. U.S.A. 76, 3751 (1979). 20. Hagenbuchle, M. Santer, J. A. Steitz, and R. J. Mans, Cell 13, 551 (1978). 3 A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 (1984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any form reserved.
[33]
P R O B I N G M O N I T O R E D BY P R I M E R E X T E N S I O N
48 1
Applications This method has been used to probe higher-order (i.e., secondary and tertiary) structure in 16S ribosomal RNA using DEP, 2 and to study thermal denaturation of specific regions of 16S rRNA.~2 Another application is in the preparation of defined fragments of large RNA molecules for biochemical or physical studies. Draper and co-workers ~a have developed a related method, in which a specific restriction fragment cloned into an M 13 vector is used as a source of the complementary DNA strand. With the availability of large quantities of synthetic DNA oligomers, preparation of specific RNA fragments in milligram amounts for physical studies should also be possible. 12 B. J. Van Stolk, Ph.D. thesis. University of California, Santa Cruz, California. la D. E. Draper, S. A. White, andJ. M. Kean, this volume [14].
[33] S t r u c t u r a l A n a l y s i s o f R N A U s i n g C h e m i c a l a n d Enzymatic Probing Monitored by Primer Extension By SETH STERN, DANESH MOAZED, and HARRY F. NOLLER
Chemical and enzymatic probing, monitored by primer extension, has become a powerful tool for the analysis of RNA structure. The reactivities of individual nucleotides composing large RNA molecules may be determined rapidly by utilizing a series of primers spaced at approximately 200 nucleotide intervals. In addition, numerous chemical reagents and nucleases may be employed as probes, since the only requirement is that they modify the template so as to produce pauses or stops in the progress of reverse transcriptase) -3 When the eDNA products of primer extension reactions are separated on a DNA sequencing gel, the positions of stops or pauses in eDNA synthesis are visualized as a series of bands, each of which corresponds to a particular nucleotide in the modified RNA template. The positions of the stops are determined by reference to dideoxy sequencing reactions run in parallel. Because the extent of the probing reactions is very limited, the relative quantity of truncated eDNA in a given band is propori D. C. Youvan and J. E. Hearst, Proc. NatL Acad. Sci. U.S.A. 76, 3751 (1979). 20. Hagenbuchle, M. Santer, J. A. Steitz, and R. J. Mans, Cell 13, 551 (1978). 3 A. Barta, G. Steiner, J. Brosius, H. F. Noller, and E. Kuechler, Proc. Natl. Acad. Sci. U.S.A. 81, 3607 (1984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any form reserved.
482
CHEMICAL AND ENZYMATIC PROBING METHODS
[33]
tional to the reactivity of the nucleotide responsible for that band. Reactivity is thus monitored as band density on the gel autoradiograph. Nucleotides whose reactivities change in response to the interaction of the RNA with other molecules may be detected by comparing the band densities produced by primer extension of RNAs probed under appropriate conditions. For example, by comparing the pattern of cDNAs produced by primer extension of probed naked (uncomplexed) RNA with the pattern produced by extension of RNA probed in a protein-RNA complex, the nucleotides participating in the binding interaction may be identified by their reduced reactivities (protection) in the complex. S u m m a r y of the M e t h o d The RNA, either alone or complexed with proteins and/or ligands, is incubated under suitable conditions with chemical or enzymatic probes. Dimethyl sulfate (DMS), kethoxal (KE) and l-cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-toluene sulfonate (CMCT) are employed for chemical probing, while ribonucleases A and TI, and Vl nuclease are employed as enzymatic probes.4-6 The extent of the reactions is limited so that no more than a few stops are present within 300 nucleotide stretches in a given RNA molecule. This ensures that synthesis of long cDNAs (200-300 nucleotides) will be efficient and uniform among various RNA samples. Probed and control (untreated) RNAs are then hybridized to a synthetic DNA oligomer, which is complementary to a site downstream of the target sequence, and the primer is extended in the presence of a radioactively labeled deoxynucleoside triphosphate. Sequencing reactions, utilizing dideoxy nucleotides and untreated RNA, are carried out in parallel and the transcripts are analyzed on a DNA sequencing gel which is autoradiographed. The cDNA band patterns produced by primer extension of probed uncomplexed RNA and probed complexed RNA are compared, and nucleotides exhibiting reduced or enhanced reactivities in the complex are identified. Chemical and Enzymatic Probing Pauses or stops in reverse transcription may be induced by either (1) chemical modification of the nucleotide base moiety in a way that inhibits Watson-Crick hydrogen bonding, or (2) scission of the phosphodiester 4 G. S. Shelness and D. L. Williams, J. Biol. Chem. 260, 8637 (1985). 5 D. Moazed, S. Stem, and H. F. Noller, J. Mol. Biol. 187, 399 (1986). 6 T. Inoue and T. R. Cech, Proc. Natl. Acad. Sci. U.S.A. 82, 648 (1985).
[33]
PROBING MONITORED BY PRIMER EXTENSION
483
backbone of the RNA. In the first case, the progress of the polymerase is impaired by the inability of the template nudeotide to base pair; in the second case, cDNA synthesis stops when the polymerase falls off the template RNA. The chemical probes DMS, KE, and CMCT modify adenine, cytosine, guanine, and uracil in this manner. DMS methylates adenine at N-l, guanine at N-7, and cytosine at N-3. Only the adenine and cytosine methylations inhibit the progress of reverse transcriptase. However, methylation of guanine at N-7 may be detected by treatment with sodium borohydride and aniline to induce strand scission.7 KE reacts with guanine at N-l and N-2, and CMCT reacts with uracil at N-3. 8 These reagents are active under pH and salt conditions considered optimal for physiological processes, including protein-RNA interaction. Reagents that react at Watson-Crick hydrogen-bonding sites are useful only for probing single-stranded regions of RNA. The enzymatic probes RNases A and T1 are also single-strand specific, and may conveniently be combined in a double digest. Double-stranded regions may be probed with VI nuclease. These three enzymes are also active under physiological buffer conditions. (This is not the case for probes such as S~ nuclease.) Typical final buffer conditions for probing of protein-RNA complexes are 80 m M potassium N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (K-HEPES), 20 m M MgCl2, 300 m M KC1, 6 m M 2-mercaptoethanol (BME), 0.01% Nikkol detergent (Nikko Chemical Co. LTD., octaethylene glycol mono-n-dodecyl ether), pH 7.8. Reactions contain 10/zg 16S RNA with various combinations of ribosomal proteins (in molar excess) in 50-/zl volumes. Probing with CMCT requires the substitution of potassium borate buffer, pH 8.0, for K-HEPES. Protein-RNA complexes are formed by incubation of this mixture for 1 hr at 42 ° followed by chilling on ice for at least l0 min. Chemical and enzymatic probing reactions are carried out at 4 ° and 0 o, respectively. Typically, 1 - 5/zl of reagent (50/zl CMCT stock) is added to each 50-~1 volume and incubated for 30 min to 2 hr. DMS (Aldrich) is diluted with 95% ethanol (typically l : 12 v/v) immediately before use. KE (Upjohn) stock is 37 mg/ml in water and CMCT (Aldrich) stock is 42 mg/ ml in BMK buffer (50 m M potassium borate, 20 m M MgC12, 350 m M KC1, pH 8.0). RNase A and T~ are typically combined to produce a double digest. RNase A stock [Worthington, 0.1 mg/ml and 1 mg/ml carrier RNA in 10 m M Tris-HC1, l m M ethylenediaminetetraacetic acid (EDTA), pH 7.7] is diluted 1 : 20 with l × buffer (80 m M K-HEPES, 20 m M MgCl2, 7 D. A. Peattie and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 77, 4679 (1980). 8 R. Hall, "The Modified Nucleosides in Nucleic Acids." Columbia University Press, New York, 1971.
484
CHEMICAL AND ENZYMATIC PROBING METHODS
[33]
300 m M KCI, 6 m M BME, pH 7.8) and combined 1 : 1 with RNase T~ stock (Sankyo, 0.1 mg/ml in l0 mMTris-HC1, 1 m M E D T A , pH 7.7). The combined A/T I stock is typically diluted 1 : 2 with 1 X buffer immediately before use. V 1 nuclease (Pharmacia) is also diluted, typically 1:20 (to 0.35 U/#I), with 1 × buffer immediately before use. Incubation times and reagent concentrations are optimized empirically by inspection of primer extension results. The reactions are stopped by ethanol precipitation (for chemical probing) or phenol extraction (enzymatic probing). For DMS and CMCT reactions, ethanol precipitation is accomplished by the addition of 50/zg carrier RNA and 4.5 volumes of 95% ethanol followed by incubation at - 7 0 ° for at least 15 min. KE reactions are stopped similarly, except that the mixture is brought to 25 m M in potassium borate, pH 7.0, to stabilize the KE adduct. The tubes are centrifuged for 15 min at 14,000 g (at 4°), the supernatant is drawn off, and the pellets are washed with 100/~1 of 70% ethanol which is then drawn off. The pellets are dried under vacuum for 5 min and resuspended in 200/tl of 0.3 M sodium acetate, 2.5 m M EDTA buffer (brought to 25 m M in potassium borate, pH 7.0, for KE-modified samples) for phenol extraction. The samples are brought to 0.5% in sodium dodecyl sulfate (SDS) and an equal volume of water-saturated phenol is added. A total of three phenol and two chloroform extractions are performed. The samples are vortexed for 5 min (on an Eppendorf Mixer 5432) and spun for 20 sec at 14,000 g to separate the phases. The RNA is then precipitated with the addition of 2.5 volumes of 95% ethanol followed by incubation at - 20 ° for at least 1 hr. The RNA is pelleted by centrifugation at 14,000 g for 15 min at 4°; the pellets are washed and dried as above, resuspended at 0.4 mg/ml in water (or 25 m M potassium borate, pH 7.0, for KE samples), and quick frozen. Enzyme digestions are stopped by the addition of 150/tl cold enzyme stop (0.3 M sodium acetate, l0 m M EDTA, 50 #g carder RNA), followed immediately by the addition of 5/~l SDS and 200/zl phenol. The tubes are immediately placed on a vortex shaker at 4 °. After vortexing for at least 5 min, the tubes are centrifuged for 25 sec at 14,000 g at 4 ° to separate the phases and the phenol phase is drawn off. Two more phenol extractions followed by two chloroform extractions are performed at room temperature. The RNA is precipitated and resuspended in water as above. P r i m e r Extension Primers are synthetic DNA oligomers, containing free 3'-hydroxyls. They are typically 17-mers, which give sufficiently high priming specificity such that, at low primer: RNA ratios (-- 1 : 1), n o false priming is detected. Primer sequences should have one or more C or G residues at the 3'
[33]
PROBING MONITORED BY PRIMER EXTENSION
485
(priming) end, so that the primer "lays down" properly on the RNA template. G/C contents higher than 50% are desirable, so that they compete well with the innate secondary and/or tertiary structure of the RNA. Once an oligomer sequence is chosen, the template sequence is searched by computer to see if any competing sites are present. Sequence matches of less than 13 out of 17 bases at competing sites are considered acceptable. Primers are purified by gel electrophoresis and stored in water at - 20°.
Hybridization Working primer stocks are diluted from 1 #g/50/A stocks (in water) to yield concentrations empirically determined to be optimal; typically, 1 : 20 to 1 : 100 dilutions are employed. Diluted primer stock is combined 1 : 1 with hybrid buffer (250 m M K-HEPES, 500 m M KC1, pH 7.0) and 2-/A aliquots of this mixture are dispensed to each hybridization Eppendorf tube. Probed and control (untreated) RNAs are thawed and placed on ice and a 2.5-/d aliquot of RNA solution (0.4 mg/ml) is then added to the 2-/d drop at the bottom of the appropriate tube. The tubes are placed in an "open" aluminum test tube rack at room temperature. This is then placed in a small aluminum tray containing water (approximately 14in. deep) in a water bath at 80-85 ° for 1 min. The tray containing the rack of tubes is then lifted out of the water bath and placed on the bench to cool (to approximately 45 ° in 10 min). The tubes are then briefly centrifuged to spin down condensate on the cap and sides.
Extension Sufficient extension mix for all extension reactions is prepared from (1) 10X extension buffer [1.3 M Tris-HC1, pH 8.4, 100 mM MgCI2, 100 m M dithiothreitol (DTT)], (2) dNTP stock (110 # M dGTP, dCTP, dATP, 6 g M dTTP, Pharmacia), and (3) diluted label (see below). Each extension reaction requires the addition of 2 ~1 of extension mix to the cooled hybrid solution. Extension mix is 2/6 volume extension buffer, 1/6 volume dNTP stock and 3/6 volume water containing sufficient label (400 Ci/mmol at 10/zCi//A [ot-a2p]dTTP, Amersham) so that each 2-/A aliquot of extension mix contains 6/zCi label. (For example, for 10 reactions 0.6/zl × 10 -- 6/zl of label is used.) It is convenient to premix (1)-(3) above before hybridization, and store the mixture on ice. While the hybrids are cooling, diluted reverse transcriptase may be added to the premixed extension mix. Each extension reaction utilizes 1/zl of 1 : 10 diluted reverse transcriptase (Seikagaku, diluted with 50 m M Tris-HC1, pH 8.4, 2 rnM DTT, 50% (v/v) glycerol buffer to 2 U//ll). Thus for 10 extension reactions, 10/zl of 1 : 10 diluted reverse transcriptase is added to 20/zl of premixed extension mix.
486
CHEMICAL AND ENZYMATIC PROBING METHODS
[33]
Efficient mixing of the enzyme may be achieved with gentle vortexing. Extension is initiated by the addition of 3 gl of extension mix + enzyme mixture to each cooled hybrid. Sequencing reactions receive 1 gl of dideoxynudeotide stock (Pharmacia, 2.5 # M ddNTPs). The reactions are incubated for 30 min at 37 °, at which time 1 #1 of chase stock (1 m M dATP, dGTP, dCTP, dTTP) is added, and the incubation continued for 15 min more. Reactions are stopped by the addition of 30 #1 of 0.3 M sodium acetate, 1 m M EDTA buffer, and 90/zl of 95% ethanol. The tubes are gently vortexed and incubated at 0 ° for at least 1 hr. The labeled DNA is then pelleted by centrifugation at 14,000 g for 15 min and the radioactive supernatant, containing unincorporated label, is drawn off. Pellets are dried under vacuum for 5 min and dissolved in 10 gl of loading buffer [8 M urea, 0.1 × TBE (TBE is 89 m M Tris-borate, 2.4 m M EDTA, pH 8.3), 0.03% bromphenol blue, and xylene eyanol dyes]. (Care should be taken that the vacuum-dried eDNA pellets are fully dissolved in loading buffer. This typically requires vortexing and incubation for at least 30 min at room temperature before loading. In addition, the time spent under vacuum should be the minimum required to dry the pellets, and may vary with different vacuum systems.) Finally, note that the relatively high temperature and extended time required for hybridization may occasionally lead to extensive degradation of the RNA template. This possibility is minimized by the washing and autoclaving of Eppendorf tubes, and the autoclaving of pipet tips. In addition, all glassware used in the preparation of buffers and reagents is baked at 200 ° .
Polyacrylamide Gel Electrophoresis Wedge gels are 60 × 20 era, and are 0.25-ram thick at the top and 0.75-mm thick at the bottom. They are constructed with 0.25-ram thick spacers running the 60-cm length of the gel, and additional 0.5-mm and 0.25-mm thick (2-em long) spacers placed at the bottom and 15 em up from the bottom, respectively. The sandwich is taped and clamped over the additional spacers (at the bottom and 15 em up from the bottom) before the gel is poured. After pouring, the blunt end of the 32-well sawtooth comb is inserted to a depth of about 3 ram, and damps are applied at each side of the comb. Aerylamide is 6%, 1:20 bisaerylamide, 7.5 M urea, 1 X TBE and gels are run with a 3-mm thick aluminum cooling plate at 50-60 W. (The gel apparatus may be purchased from Aladin Enterprises, 1255-23rd Avenue, San Francisco, CA 94122.) After the temperature of the gel has stabilized (typically 1 hr), the resuspended cDNAs are heated to 100 ° for 2.5 min, cooled on ice for 1 rain, and 1.5/A/well is rapidly loaded
[33]
PROBING MONITORED BY PRIMER EXTENSION
487
onto the gel. After running, the gels are transferred to Whatman 3MM paper, dried, and autoradiographed for 12-48 hr at room temperature with Kodak XAR-5 film. Discussion Figure 1 is a typical gel autoradiograph produced by priming at position 480 of 16S RNA. Four dideoxy sequencing lanes, a control lane derived from untreated RNA, and 11 lanes derived from chemically probed RNA are present on this gel. The first 6 of these 11 lanes were probed with DMS; lane 1 as naked RNA and lanes 2 - 6 as protein-RNA complexes of various compositions. The last 5 lanes were probed with KE; lane 1 again as naked RNA, and lanes 2 - 5 as protein-RNA complexes. This region of 16S RNA is thought to possess a highly stable structure 9'1° and provides a good test of the ability of reverse transcriptase to traverse such regions. Strong, spontaneous termination is visible at positions 388, 350, 335, 287, and 226. Inspection of the secondary structure of this region of 16S rRNA reveals that positions 388, 350, and 335 are all within the stems of short stem-loop structures (hairpin loops), and that these stems have a high G-C base pair content. Such structures probably tend to "snap-back" as they are traversed by the enzyme, leading to the observed termination. Stops 287 and 226 also occur in regions of high G-C content. Position 287 is at the 3' end of a long compound helix (240-259/ 267-286) that begins with three G-C base pairs, and position 226 is within a 7 base pair helix (221-227/136- 142) containing 3 G-C base pairs. We have attempted to minimize stops due to secondary structure by (1) reducing or eliminating salt (KC1) from the extension reaction buffer, (2) incubating extension reactions at 42 °, (3) varying the hybrid/enzyme ratio, (4) introducing fresh enzyme during chase, and (5) increasing/decreasing dNTP concentration. No significant and consistent differences have yet been observed. Detection of reduced or enhanced reactivity toward the chemical and enzymatic probes depends on uniform overall eDNA synthesis among the probed RNAs. Comparison of band densities on the autoradiograph becomes problematic if this is not the case. Overall eDNA synthesis is strongly dependent on the concentrations of primer and RNA present during hybridization. For this reason, care should be taken to treat each reaction identically. Uniformity of eDNA synthesis also requires that the 9 B. J. Van Stolk and H. F. Noller, J. MoL Biol. 180, 151 (1984). ~oR. A. Garrett, E. Ungewickell, V. Newberry, J. Hunter, and R. Wagner, Cell Biol. Int. Rep. 1,487 (1977).
488
CHEMICAL AND ENZYMATIC PROBING METHODS ~S
C UA
G K 1 23
[33]
KE
4561
2345
.=~
3804~
FIG. 1. Primer extension results for DMS- and KE-modified p r o t e i n - R N A complexes primed at position 480 of 16S rRNA. See the text for details.
[33]
PROBING MONITORED BY PRIMER EXTENSION
489
extent of reaction with the chemical and enzymatic probes be very limited. In fact, efficient cDNA synthesis downstream of a stop is possible only because a fraction of the RNA molecules are in fact modified at that position. Since 200-300 nucleotides are routinely read in each primer extension reaction, less than 1 stop (or equivalently, a few pauses) per RNA template per 300 nucleotides should be present. Several instances of reduced and enhanced reactivities toward the chemical probes DMS and KE are indicated in Fig. 1. Inspection of DMS lanes l - 6 reveals that relative to lane 1 (naked RNA) (1) the stop corresponding to A-325 is enhanced in lanes 4 and 5 and reduced in lane 6, (2) the stops corresponding to AC 279- 280 and AAC 262-264 are reduced in lanes 2 and 3, and (3) the stop corresponding to A-228 is enhanced in lanes 5 and 6. Similarly, inspection of KE lanes 1-5 reveals that the stops corresponding to G-28 l, GG 265-266, and G-251 are all reduced in lanes 2 and 3. (The nucleotide responsible for a stop is one position up in the dideoxy sequencing lanes from the stop itself. This is because the modified nucleotide itself cannot base pair, and the corresponding cDNA fragment extends up to, but does not include, the complement to the modified position.) From these results we may conclude that (1) ACG 279-281, AACGG 262-266, and G-251 are protected in complexes 2 and 3, (2) A-325 exhibits enhanced reactivity in complexes 4 and 5 and is protected in complex 6, and (3) A-228 exhibits enhanced reactivity in complexes 5 and 6.
[34]
ANTIBODY PROBES OF RIBOSOMAL R N A
493
[34] A n t i b o d y P r o b e s o f R i b o s o m a l R N A 1
By
DOHN
G.
A. CANN, LINDA HELEN McKuSrdE OLSON
GLITZ, PAULINE
S. LASATER,
and
RNA components are responsible for approximately two-thirds of the mass of a prokaryotic ribosome. The overall size and shape of each ribosomal subunit is primarily determined by the folding of the large RNA molecules, and elements of the RNA participate directly in the binding of the many ribosomal and nonribosomal protein and RNA molecules involved in each aspect of protein biosynthesis. There are significant difficulties in probing the structure of the RNA within the ribosome; the secondary structure of the RNA is extensive, and a considerable portion of each sequence is likely to be buried within the subunits and unavailable to probes. A limited number of natural targets--modified nucleotides or chemically unique sites--occur in each subunit, but most of the RNA is lacking in distinct markers. Our laboratory has been studying RNA structure in the ribosome with an emphasis on immunoelectron microscopy. We have used antibody probes to naturally occurring modified nucleotides, to reagents used in the site-specific modification of ribosomal RNA, and to chemically synthesized modified oligodeoxynucleotides that complement and bind specific ribosomal RNA sequences. In this chapter we detail methods for the production and characterization of these antibodies and for their use in the study of ribosome structure. Preparation of Immunogens Nucleosides, nucleotides, or small organic molecules such as dinitrophenol (DNP) are not suitable for immunization unless they are first coupled to an immunogenic carrier. The procedures detailed below have proved successful in our hands. Nucleoside-protein conjugates are prepared by a modification2 of the method of Erlanger and Beisera; periodate oxidation of the ribose at positions 2' and 3' generates the dialdehyde which is then allowed to condense with primary amino groups of a protein carrier, and the conjugate is i Supported by grants from the National Science Foundation and the National Institutes of Health. 2 D. C. Eichler and D. G. Glitz, Biochim. Biophys. Acta 335, 303 (1974). 3 B. F. Edanger and S. M. Beiser, Proc. Natl. Acad. Sci. U.S.A. 52, 68 (1964). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, inc. All rights of reproduction in any form r~t~erved.
494
IMMUNOLOGICALMETHODS
[34]
stabilized by borohydride reduction. Reagents containing a m m o n i u m salts, amines, and Tris buffers must be avoided. We have used this approach to prepare conjugates of all of the c o m m o n ribonucleosides and 5'-ribonucleotides 2 as well as N%methyladenosine, N ~, N~-dimethyladenosine, 4 N6-isopentenyladenosine, 5 1,N6-ethenoadenosine,6 7-methylguanosine, 7 5-methylcytidine, ribothymidine, dihydrouridine, and pseudouridine. One millimole of nucleoside or 5'-nucleotide (as the sodium or potassium salt) is dissolved in - 10 ml of H20; if necessary the preparation can be warmed briefly. Exactly 1 mmol of sodium metapedodate is added, and the mixture is gently mixed for 20 min at room temperature in the dark (or subdued light). Five hundred milligrams of carrier protein (crystalline bovine or rabbit albumin or ovalbumin) in a 250-ml beaker is dissolved in 20 ml of water and the pH is adjusted to 9.2 using. 50/0 Na2CO3. The oxidized nucleoside solution is added dropwise to the protein solution with gentle stirring; the pH is maintained above 9 by Na2CO3 addition. After 45 min, 200 mg of solid NaBI-L is added to the preparation, and stirring is continued until the borohydride is dissolved. The reaction mixture is then refrigerated overnight; gas evolution will result in some foaming of the solution. The pH of the preparation is carefully adjusted to 6 by the dropwise addition of 5% acetic acid. After 1 hr the pH is adjusted to 7.5 by the dropwise addition of 1 M NH3 solution. The preparation is then transferred to dialysis tubing and dialyzed against several l-liter changes of distilled water. When the A260 of the solution outside the bag remains below 0.01, the preparation is lyophilized and stored at - 2 0 ° as the dry solid. In the case of the alkali-labile nucleoside 7-methylguanosine, the method above yields a modified (ring opened) c o m p o u n d ) The base structure is maintained if the oxidation and protein condensation steps of the reaction are done in 0.2 M potassium phosphate buffer, pH 6, and reduction is brought about by addition of a 5- to 10-fold molar excess of solid sodium cyanoborohydride. ~ The preparation is then purified by dialysis against several changes of distilled water. The extent of carrier modification is determined spectrophotometrically. A 1% (w/v) solution of the conjugate in 0.9% NaCI is adjusted to pH 7 with 1 M Tris. The protein content of the solution is measured using, 4 S. M. Politz and D. G. Glitz, Proc. Natl. Acad. Sci. U.S.A.74, 1468 (1977). 5 D. S. Milstone, B. S. Vold, D. G. Glitz, and N. Shutt, NudeicAcidsRes. 5, 3439 (1978). 6 R. J. Frink, D. Eisenberg, and D. G. Glitz, Proc. Natl. Acad. Sci. U.S.A.75, 5778 (1978). M. R. Tremp¢, K. Ohgi, and D. G. Glitz, J. Biol. Chem. 257, 9822 (1982). s L. Rainen and B. D. Stollar, Nucleic Acids Res. 5, 4877 (1978).
[34]
ANTIBODY PROBES OF RIBOSOMAL R N A
495
e.g., the Lowry determination with unmodified protein as standard. The A26o of a l : 20 or l : 50 dilution of the conjugate is measured, and the A26o of an equivalent concentration of unmodified protein is subtracted; the difference is the absorbance due to the bound nucleoside. Using the molar extinction coefficient of the nucleoside this value can then be expressed as moles of bound nucleoside per mole carrier protein. In most instances 16-25 tool of nucleoside are bound per mole bovine or rabbit albumin, or 10- 15 mol of nucleoside per mole ovalbumin. Dinitrophenol-protein conjugates are prepared as described by Porter. 9 We have used bovine albumin conjugates substituted with 8 - 1 0 DNP residues per protein molecule. Antibody Induction, Purification, and Characterization
Immunization and blood collection follow common procedures. Five milligrams of conjugate is dissolved in 0.5 ml of sterile 0.9% NaC1 solution, and 4.5 ml of Freund's complete adjuvant (Difco Laboratories) is added. The mixture is emulsified by vigorous agitation with a vortex mixer or by repeated uptake and expulsion with a small syringe. One-milliliter portions are injected into at least three 2 - 3 kg male New Zealand white rabbits using a 1-ml insulin syringe (B-D, U-100, 28-gauge X 1/2 inch needle). Because the emulsion is very viscous, it is most easily loaded directly into the barrel of the syringe (with the plunger removed) by Pasteur pipet. Injection may be either into the footpads or at multiple intradermal sites on the back of the rabbit; the latter is much less stressful to the animal and is therefore preferable. Two weeks after the initial injection, each rabbit is given a booster injection of 0.5 ml of the same preparation (0.5 mg of conjugate). Additional booster injections may be required after a further 1 or 2 weeks, or later in the course of immunization if the antibody titer becomes low; adjuvant is omitted in these later injections. Blood is collected weekly starting 3 weeks after the initial injection. It is allowed to clot for 1 - 2 hr at room temperature, followed by overnight storage in the cold. Serum is removed with a Pasteur pipet and clarified by centrifugation at 4 ° for 10 min at 2000 g. Serum from each rabbit and bleeding is kept separate and stored frozen. Immunodiffusion is used to qualitatively evaluate individual antisera. Plates are prepared using 1% agarose in 0.1 M NaC1, 0.01 M Tris-HC1, pH 7.2. Antiserum is placed in the central well, and 1 mg/ml solutions of test preparations are added to peripheral wells. A useful antiserum will show a 9 R. R. Porter, this series, Vol. 4, p. 221.
496
IMMUNOLOGICALMETHODS
[34]
strong precipitin reaction with the original immunogen, and usually also precipitates other conjugates of the same protein carrier as well as unconjugated carder. Precipitation of a rabbit albumin conjugate of the immunizing nucleoside indicates a nucleoside-specific reaction. The level of nucleoside-specific antibody can be approximated using successive dilutions of the rabbit albumin conjugate in peripheral wells; visible precipitin lines should be detected at conjugate levels below 0.1 mg/ml. Quantitative antibody characterization is done using a nitrocellulose membrane filter-binding assay modified from that of Humayun and Jacob) ° Proteins are bound nonspecifically to the filters; this allows rapid and quantitative separation of antibody-bound radioligand from uncomplexed ligand in assay mixtures. Antibody specificity can be evaluated through competition assays using unlabeled ligands. Many tritium-labeled modified nucleosides can be purchased from Moravek Biochemicals, 577 Mercury Lane, Brea, CA, or custom labeled by other suppliers of radiochemicals. Alternatively, any ribonucleoside can be tritiated by periodate oxidation of the ribose at positions 2' and Y, followed by reduction with sodium boro[3H]hydride to generate the nucleoside trialcohol. The nucleoside to be radiolabeled (0.02 mmol) is dissolved in a minimal volume of 0.05 M potassium phosphate buffer, pH 6.0, and 40/zl of 0.5 M NaIO4 is added. After 20 min in the dark, one drop of 5% Na2CO3 is added to the solution; 25 mCi of tritiated sodium borohydride (Amersham, 500 mCi/mmol) in 0.5 ml of 0.05 M N a O H is then added (under a hood) and the reaction is allowed to proceed overnight.H The reaction mixture is then adjusted to pH 6 with - 300/zl of 0.1 M acetic acid and left in the hood for at least 1 hr. The product is then lyophilized and dissolved in 1 ml of water. The tritiated nucleoside trialcohol is purified by reversed-phase HPLC on a Supelco 5-/zm LC-18 column (4.6 × 250 mm). The column is equilibrated with 0.01 M ammonium phosphate buffer, pH 5.1, containing 1% methanol. The sample is applied and the column is washed for 5 min (1.5 ml/min) with starting buffer, followed by a linear gradient to 50% methanol over 45 min. Nucleoside trialcohol is eluted a few minutes before the unmodified parent compound. The yield of tritiated trialcohol is usually greater than 95%. A radiolabeled (mono) dinitrophenyl derivative of ethylenediamine, used in both assay and ribosome modification,~2is prepared as follows: 4.8 #mol of l-fluoro-2,4-dinitro[3H]benzene (Dupont NEN Research Prod1oM. Z. Humayun and T. M. Jacob, Biochirn. Biophys. Acta 331, 41 (1973). 11 Reduction of 7-methylguanosine or other base-labile nucleosides is done at pH 6 - 7 ; the Na2CO3 addition is deleted and the tritiated borohydride is dissolved in a minimal volume of 0.01 M NaOH. 12 H. M. Olson and D. G. Glitz, ProcoNatl. Acad. Sci. U.S.A. 76, 3769 (1979).
[34]
ANTIBODY PROBES OF RIBOSOMAL R N A
497
ucts, diluted with unlabeled reagent to 200 mCi/mmol) is dissolved in 100/zl of absolute ethanol. One hundred microliters of 0.37 M NaHCO3 and 390 #mol of ethylenediamine in 150/zl of water are added, and the mixture is shaken overnight at 37 ° in the dark. The mixture is then dried by rotary evaporation, dissolved in 1 ml of water, and purified by reversedphase HPLC as described above; the derivative is eluted with about 30% methanol. Ligand binding assays are done in 250/zl of 0.01M Tris-HCl, pH 7.5, 0.15 M NaCI (Tris-NaCI buffer). The assay mixtures include - 2 . 5 X 104 cpm of nucleoside or DNP-ethylenediamine radioligand (diluted with unlabeled material if necessary), nonradioactive competing ligand at up to 10-2 M if desired, and up to 2 gl of serum or an eqt:ivalent quantity of purified antibody (added last). The mixtures are incubated for 30 min at 37 °, chilled, and kept in the cold for at least I hr and overnight if possible. Millipore type HA 0.45-am nitrocellulose filters mounted in an appropriate manifold are prewet with 2 ml of ice-cold Tris-NaC1 buffer. All positions of the manifold except the first are sealed with rubber stoppers and a vacuum is applied. (Sealing of other positions until they are to be used prevents the filters from drying and adsorbing protein poorly.) The first sample is then diluted with 2 ml of cold Tris-NaCl and immediately poured through the filter. The assay tube and filter are immediately rinsed with four 2-ml portions of buffer, and the first manifold position sealed with the stopper from position 2. Successive samples are filtered in the same manner until all have been processed. The filters are then transferred to scintillation vials, covered with liquid scintillation cocktail, and allowed to stand for at least 4 hr at room temperature before measuring filterbound radioactivity. In most instances nonspecific (background) binding of ligand, estimated using an equivalent level of nonimmune IgG in place of antibody, is less than 1% of the total. The ligand-binding capacity of the antibody preparation is approximated from the initial slope of the binding curve generated when a fixed amount of radioligand is titrated with varying amounts of antibody. For the evaluation of antibody specificity, levels of antibody and radioligand that result in binding of about 50% of the added radioligand are used, and varying levels of unlabed competitor are included in the reaction mixture. Figure 1 illustrates a typical result using antibodies to N~,Nn-dimethyladenosine and competing adenine nucleosides; the midpoint of each curve provides a relative measure of antibody affinity for each nucleoside. Individual serum samples are first screened in order to select several preparations with a high titer of the desired antibody. These preparations are then further examined in order to evaluate their relative affinity for the ligand. The best preparations are then selected for purification and use.
498
IMMUNOLOGICAL METHODS
[34]
[ m
g
&
!
I
iO-e
10-7
10-6 iO-a 10-4 INHIBITOR CONCENTRATION (M)
iO-a
I0-=
FIG. 1. Binding specificity of antibodies to Nn,N~-dimethyladenosine. Each mixture contained purified IgG and [3H]dimethyladenosine. Inhibitors were O, N6,NS-dimethyladenosine; 0, N6,N6-dimethyladenine; A, NS-monomethyladenosine; &, adenosine. From data published in Ref. 4.
Antibody purification is needed for two reasons: excess proteins such as albumin and IgM interfere in sample preparation and electron microscopy, and contaminating serum nucleases or proteases can degrade the ribosomes to be studied. To 10-20 ml of serum (on ice, gently mixed with a magnetic stirrer) solid ammonium sulfate is slowly added to a final level of 250 mg/ml serum. Stirring is continued for 60 min, ~3 and the precipitate is recovered by centrifugation (Sorvall SS34 rotor, 12,000 rpm for 20 min). The precipitate is dissolved in 10 ml Tris-NaC1 buffer and ammonium sulfate precipitation is repeated. The second precipitate is dissolved in 1 ml of TrisNaCl and applied to a 60 X 2 cm diameter column of Ultrogel AcA 22 (LKB) equilibrated with Tris-NaC1 buffer [alternatively, a similar column of Sepharose 6B (Pharmacia) may be used]. The column is eluted with Tris-NaCl and fractions are monitored by absorbance at 280 nm; a small leading peak of IgM is usually followed by the major peak fractions of IgG, which are pooled. The protein is precipitated with ammonium sulfate and redissolved in 2 - 3 ml of 0.01 M sodium phosphate, pH 7.2, 0.015 M NaC1. The protein is then passed through a column made up of 5 ml of DEAE-cellulose overlaid with 5 ml of carboxymethyl (CM)-cellulose ~4and equilibrated with the same buffer. The column is eluted with the buffer until the A2so of the eluate returns to the background value; the immunoglobulins are precipitated with ammonium sulfate as before, and dissolved in - 2 ml of Tris-NaC1 or another appropriate buffer. 13Sometimes the suspension is then allowed to stand in the cold overnight, in order to improve the yield of immunoglobulins. 14R. Palacios, R. D. Palmiter, and R. D. Sehimke, J. Biol. Chem. 247, 2316 (1972).
[34]
ANTIBODY PROBES OF RIBOSOMAL R N A
499
Modification of the 3'-End of Ribosomal RNA Targeted chemical modification of ribosomal RNA within the ribosome is possible through use of a modification of the chemistry used to derivatize and radiolabel nudeosides. The 3'-end of the RNA carries the only ribose residue whose Y-hydroxyl is free and not involved in an internucleotide bond. Hence the Y-terminus is sensitive to periodate oxidation and condensation with the unsubstituted amino group of (mono) dinitrophenylethylenediamine.The resulting DNP moiety then provides a unique target for anti-DNP antibodies.12 Purified 30S ribosomal subunits (1.2 nmol) are dissolved in 250/11 of cold buffer (10 m M HEPES, 40 mM NaC1, 0.1 #M EDTA, 3 m M magnesium acetate, pH 7.35) containing 600 nmol of [3H]DNP-ethylenediamine of specific activity - 10 mCi/mmol. Twenty five microliters of cold 0.1 M sodium periodate is added, and the mixture is incubated on ice in the dark for 15 min. Then 30 #1 of 0.1 M sodium borohydride dissolved in 0.01 M sodium hydroxide is added, and incubation is continued for 10 rain. Ribosomal subunits are purified by sedimentation in 5 - 20% sucrose gradients in a buffer containing 10 m M Tris-HC1, pH 7.5, 30 m M NH4C1, 1 mM MgCl2, and 6 mM 2-mercaptoethanol; a Spinco SW 27 rotor is used at 26,000 rpm for 10.5 hr. Subunits are then recovered by overnight centrifugation at 60,000 rpm in a Spinco Type 65 rotor. The DNP derivative is incorporated at a level of 0.8- 1.2 mol per mole of 30S subunits. Synthesis and Modification of rRNA-Complementary Oligodeoxynucleotides The large RNA molecules of the ribosome have few easily recognizable landmarks for antibody interaction. One solution to this problem is to prepare sequence specific probes in the form of short oligodeoxynucleotides that complement single-stranded segments of RNA within the ribosomal subunits.'5-17 Chemical or enzymatic modification of the oligonucleotide allows incorporation of antibody-recognizable markers that allow targeting of the subunit-bound complementary sequence. Oligodeoxynucleotide synthesis is beyond the scope of this section, but has been described in detail previously. 18 Oligonucleotides that are appro~ D. G. Glitz, H. M. Olson, and L. S. Lasater, Biophys. J. 49, 11 (1986). ,6 W. E. Tapprieh and W. Hill, Proc. Natl. Aead. Sci. U.S.A. 83, 556 (1986). 17M. I. Oakes, M. W. Clark, E. Henderson, and J. A. Lake, Proc. Natl. Acad. S¢i. U.S.A. 83, 275 (1986). ,s M. J. Gait (ed.), "Oligonucleotide Synthesis: A Practical Approach." IRL Press, Oxford, England, 1984.
500
IMMUNOLOGICAL METHODS
[34]
pilate for these experiments can be synthesized manually or with an automated synthesizer using either triester or phosphoramidite chemistry. Custom synthesis of specific oligodeoxynucleotide sequences is also available commercially. In our laboratory, oligodeoxynucleotides of 8-20 residues in length are routinely prepared using a Dupont/Vega Coder 300 synthesizer and the phosphoramidite methodology. Fully deblocked oligonucleotides are purified by ion-exchange HPLC (see below). Modification of the 5'-end of an oligodeoxynucleotide allows recognition by antibodies to DNE The approach has been modified from that of Chu et al.19; the 5'-hydroxyl group is phosphorylated by polynucleotide kinase, and the resulting phosphomonoester is chemically activated with a water-soluble carbodiimide and imidazole. Reaction with ethylenediamine followed by fluorodinitrobenzene modification of the terminal NH2 group results in the incorporation of a DNP moiety at the modified 5'-terminus. Enzymatic phosphorylation of the 5'-end of the oligonucleotide is done in 100ill of a buffer containing 50 m M Tris-HC1, pH 7.5, l0 mA/MgC12, 5 m M dithiothreitol, 1 m M ATP, and up to 0.2 m M oligomer. The oligonucleotide is heated to 70 ° for 2 min, and cooled to 37 ° prior to its addition to the reaction mixture; the reaction is started by addition of 20 units2° of enzyme (Pharmacia, polynucleotide kinase from T4-infected E. coli), and the mixture is incubated for 30 min at 37 °. The mixture is then heated to 70 ° for 2 min, cooled to 37 °, and a further 20 units of enzyme is added for a further 30-min incubation. When desired, [7-32P]ATP is used to incorporate a radioactive marker. The phosphorylated oligonucleotide is then purified by ion-exchange HPLC, dialyzed21 to remove salts, and dried by rotary evaporation or in a Speed-Vac centrifugal evaporator (Savant Instruments). The oligonucleotide is dissolved in 400#1 of 0 . 2 M imidazole, pH 6 (with HC1), and 16 mg of solid EDAC [1-ethyl-3-(3-dimethylaminopropyl)carbodiimide-HCl, Bio-Rad Laboratories] is added. After 90 rain at room temperature, an additional 5 mg of EDAC is added, and the reaction is allowed to continue for a further 2.5 hr. Then 1 ml of 1.5 M ethylenediamine (adjusted to pH 8.1 with HC1) is added, and the mixture is incubated at 37 ° for 90 min. The preparation is then dialyzed overnight in the cold against three l-liter portions of distilled water.
~9C. F. Chu, G. Wahl, and L. Orgel, Nucleic Acids Res. 11, 6513 (1983). 20 C. C. Richardson, Proced. Nucleic Acid Res. 2, 815 (1971). 21 Dialysis is routinely used to desalt oligonucleotides as short as 8 - 1 0 residues in length. Spectrapor dialysis tubing (Spectrum Medical Industries) with nominal molecular weight cut-off values of 2,000, 3,500, or 6,000-8,000 are all used with these oligomers; dialysis is overnight in the cold against distilled water, and losses are usually too small to measure.
[34]
ANTIBODY PROBES OF RIBOSOMAL R N A
501
The contents of the dialysis bag are dried on a rotary evaporator, redissolved in 1 ml of water, and 21 mg of NaHCOa is added. Thirty microliters of 1-fluoro-2,4-dinitrobenzene dissolved in 2 ml of absolute ethanol is added, and the reaction tube is protected from light by wrapping in aluminum foil. The mixture is gently agitated (in the hood) overnight at room temperature; the preparation is then dried by rotary evaporation, dissolved in 5 ml of water, and extracted - 5 times with 2- to 3-ml portions of ethyl acetate. The aqueous layer is dialyzed against two l-liter portions of distilled water, dried, redissolved in a small volume of water, and purified by ion-exchange HPLC. The yield of modified oligonucleotide normally exceeds 80%. Modification of the 3'-end of an oligonucleotide by addition of one or two residues of 1,Nr-ethenoadenosine also yields an antibody-recognizable derivative. Our method is derived directly from that of Roychoudhury.22 The reaction is carded out in 50/zl of solution containing 40 m M sodium cacodylate, pH 6.8, 8 mMMgCI2, 0.2 m M dithiothreitol, 0.12 m M oligonucleotide (-0.5 A260 unit), and 1.25 m M 1,Nr-ethenoadenosine triphosphate (Pharmacia). The reaction is started by the addition of at least 250 units of deoxynucleotidyl terminal transferase (Dupont-NEN Research Products). Incubation at 37 ° is continued for 3.5-4 hr, and the product is purified by ion-exchange HPLC. The yield of mono- and diaddition product ranges from 50 to 75%, depending on the oligonucleotide.23 Purification of oligodeoxynucleotides by ion-exchange HPLC employs a Bio-Rad Laboratories BioGel TSK DEAE-5-PW column (7.5 × 75 mm) operated at 0.8 ml/min. In the most common and generally applicable program, the sample (usually up to 5 A260units) is applied to the column in buffer A (0.02 M Tris-HCl, pH 7.5), and the column is washed with the same buffer for 5 min. Oligonucleotide elution is accomplished with a gradient of buffer B (0.02 M Tris-HC1, pH 7.5, 1.0 M NaC1) as follows: 5-10 min, linear gradient to 15% B, 10-70 min, hyperbolic gradient (Waters Associates, curve 7) to 70% B, 70- 75 min, linear gradient to 100% B; 75-85 min, constant 100% B; 85-90 min, linear gradient to 100% A. Oligonucleotide elution is size dependent and predictable; oligomers of 10-18 nucleotides are eluted at 45-60 min and are usually cleanly separated from products that are one or more nucleotides longer or shorter. For oligomers longer than 20 the NaC1 concentration of buffer B is increased to
22 R. Roychoudhury, J. Biol. Chem. 247, 3910 (1972). 23 The yield of 3'-modified nucleotide obtained by this method is considerably greater than we have been able to obtain using RNA ligase or poly (A) polymerase modification with ethenoadenosine derivatives.
502
IMMUNOLOGICALMETHODS
[34]
1.6 M. Product peaks are pooled and concentrated by rotary evaporation; if necessary, salts are removed by dialysis against distilled water. Oligodeoxynucleotide-ribosome interactions are monitored by an assay modified from the aminoacyl-tRNA binding measurement of Zamir et aL24; nitrocellulose membrane filters adsorb ribosomes and ribosomal subunits and so retain radioactive oligomer bound by the ribosomes, while unbound oligonucleotide passes through the filter. The assay is especially useful in the determination of optimal conditions for binding of a given oligomer?5 Important variables are ribosome or subunit pretreatment or activation, ionic strength, divalent cation concentration, oligonucleotide pretreatment and concentration, and time and temperature of the binding reaction. Normal conditions of the assay employ 15 pmol of ribosomal subunits and 30 pmol of [5'-32P]oligodeoxynudeotide ( - 3 × 104 cpm) in 50/tl of buffer (0.01 M Tris-HC1, pH 7.5, 0.15 M NH4C1, 10 m M MgCI2). The mixtures (sometimes preincubated at 37 ° for 10 min) are chilled on ice and kept for at least 1 hr and preferably overnight in the cold. Millipore type HA 0.45-/zm filters in an appropriate manifold are prewet with 2 ml of the same buffer, and the samples are individually filtered as described under quantitative antibody characterization; each sample is diluted with 1 ml of cold buffer, and three 2-ml washes are used. Oligonucleotide retained by the filters is quantitated by liquid scintillation counting. Nonspecific binding is approximated using unrelated (noncomplementary) ribosomal subunits (e.g., E. coli 50S or wheat germ 40S subunits are used as controls for E. coli 30S particles). Formation of A n t i b o d y - Subunit and A n t i b o d y - O l i g o n u c l e o t i d e S u b u n i t Complexes
-
Complex formation and preparation for electron microscopy involve both optimization of conditions for complex formation and the rapid separation of complexes from excess or nonspecific IgG molecules that would interfere in staining and confuse micrograph interpretation. A typical reaction mixture contains 30 pmol of ribosomal subunits (or subunit-oligonucleotide complex, usually involving a 2-fold excess of oligonucleotide) plus 15-120 ligand-binding equivalents (i.e., 7.5-60 pmol of IgG) of antibody in the smallest convenient volume (usually 20-80/21) of a buffer containing 10 m M Tris-HC1, pH 7.5, 150 m M NH4CI, and 1 - 10 m M MgClz. The mixture, sometimes incubated for 5 min at 37 °, is chilled and kept on ice for at least 1 hr and preferably 24 A. Zamir, R. Miskin, and D. Elson, this series, Vol. 30, p. 406.
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
503
overnight. Excess globulins are removed by gel filtration through a 5-ml column of Sepharose 6B equilibrated in the same buffer; subunits and subunit-antibody complexes are eluted as a partially resolved peak or a leading shoulder on the major immunoglobulin peak. As a preferable alternative, the incubation mixture is fractionated by HPLC on a 7.5 × 300 mm Spherogel TSK-3000 size exclusion column (Beckman Instruments) operated at 1 ml/min. Elution with the reaction buffer cleanly separates subunits and complexes (6-7 min) from free antibody (9-10 min) and oligonucleotide ( 13- 15 min). The buffers and HPLC column are sometimes packed in ice to stabilize the complexes and increase their recovery. Samples are prepared for electron microscopy by negative staining with 1% uranyl acetate, using the double carbon technique.25,z6 25 R. C. Valentine, B. M. Shapiro, and E. R. Stadtman, Biochemistry7, 2143 (1968). 26 j. A. Lake, in "Advanced Techniques in Biological Electron Microscopy II" (J. Koehler, ed.), p. 173. Springer-Verlag, New York, 1978.
[35] L o c a l i z a t i o n o f R i b o s o m a l P r o t e i n s o n t h e S u r f a c e o f R i b o s o m a l S u b u n i t s f r o m Escherichia coli U s i n g Immunoelectron Microscopy
By M A R I N A
STOFFLER°MEILICKE AND G E O R G STOFFLER
Introduction Immunoelectron microscopy (IEM) is one of several techniques that have proved useful for the elucidation of the structural organization of the ribosome, and has provided considerable information on the topography of the proteins on the ribosomal surface. The principle of IEM is to bind a purified IgG antibody, specific to a single ribosomal protein, to the appropriate ribosomal subunit; the bivalent antibody dimerizes two subunits which can then be examined under the electron microscope. The location of the bound antibody on the antigenic determinant of a particular protein can thus be made visible. The first ribosomal proteins were localized on the surface of the 50S subunit ofEscherichia coli by IEM in our laboratory in 1973.1,2Since then, t M. R. Wabl, Ph.D. thesis. Freie Universit~t Berlin, Berlin, Federal Republic of Germany, 1973. 2 M. R. Wabl, J. Mol. Biol. 84, 241 0974). METHODS IN ENZYMOLOGY, V O L 164
Copy~ght ~ 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
503
overnight. Excess globulins are removed by gel filtration through a 5-ml column of Sepharose 6B equilibrated in the same buffer; subunits and subunit-antibody complexes are eluted as a partially resolved peak or a leading shoulder on the major immunoglobulin peak. As a preferable alternative, the incubation mixture is fractionated by HPLC on a 7.5 × 300 mm Spherogel TSK-3000 size exclusion column (Beckman Instruments) operated at 1 ml/min. Elution with the reaction buffer cleanly separates subunits and complexes (6-7 min) from free antibody (9-10 min) and oligonucleotide ( 13- 15 min). The buffers and HPLC column are sometimes packed in ice to stabilize the complexes and increase their recovery. Samples are prepared for electron microscopy by negative staining with 1% uranyl acetate, using the double carbon technique.25,z6 25 R. C. Valentine, B. M. Shapiro, and E. R. Stadtman, Biochemistry7, 2143 (1968). 26 j. A. Lake, in "Advanced Techniques in Biological Electron Microscopy II" (J. Koehler, ed.), p. 173. Springer-Verlag, New York, 1978.
[35] L o c a l i z a t i o n o f R i b o s o m a l P r o t e i n s o n t h e S u r f a c e o f R i b o s o m a l S u b u n i t s f r o m Escherichia coli U s i n g Immunoelectron Microscopy
By M A R I N A
STOFFLER°MEILICKE AND G E O R G STOFFLER
Introduction Immunoelectron microscopy (IEM) is one of several techniques that have proved useful for the elucidation of the structural organization of the ribosome, and has provided considerable information on the topography of the proteins on the ribosomal surface. The principle of IEM is to bind a purified IgG antibody, specific to a single ribosomal protein, to the appropriate ribosomal subunit; the bivalent antibody dimerizes two subunits which can then be examined under the electron microscope. The location of the bound antibody on the antigenic determinant of a particular protein can thus be made visible. The first ribosomal proteins were localized on the surface of the 50S subunit ofEscherichia coli by IEM in our laboratory in 1973.1,2Since then, t M. R. Wabl, Ph.D. thesis. Freie Universit~t Berlin, Berlin, Federal Republic of Germany, 1973. 2 M. R. Wabl, J. Mol. Biol. 84, 241 0974). METHODS IN ENZYMOLOGY, V O L 164
Copy~ght ~ 1988 by Academic Press, Inc. All rights of reproduction in any form reserved.
504
IMMUNOLOGICALMETHODS
[35]
we have continued this work,3,4 and other research groups5,6 have also studied the localization of ribosomal components. Most of the ribosomal protein localizations on the ribosomal surface have been made 'using polyclonal antibodies. More recently, monoclonal antibodies have been successfully used to localize proteins $2, $3, and $7 on the surface of the 30S subunit from E. coli. 7,s Yet another possibility for the localization of specific sites on the ribosomal surface is the use of haptens and hapten-specific antibodies. This approach was first used for the localization of specific RNA sites9 (for references, see Ref. 10) and has more recently been applied to the localization of ribosomal proteins. 1',12 The use of monovalent Fab fragments instead of divalent IgG antibodies may contribute to the resolution of the technique, and could serve as additional markers. Here we describe all these different approaches for the three-dimensional localization of ribosomal proteins of E. coli. Electron Microscopy of Ribosomal Subunits and the 70S Monosome of E. coli Materials and Solutions
Buffer 1:50 m M Tris-HC1 (pH 7.5), 5 m M MgC12, 200 m M NH,CI, 6 m M 2-mercaptoethanol Buffer 2:50 m M Tris-HC1 (pH 7.5), 20 m M MgC12, 200 m M NH4CI, 6 m M 2-mercaptoethanol Uranyl formate is purchased from TAAB Laboratories Equipment Limited (Reading, England) and mica is from Balzers Union, Balzers, Liechtenstein 3 G. W. Tischendorf, H. Zeichhardt, and G. Stt~tiler, Mol. Gen. Genet. 134, 187 (1974). 4 G. W. Tischendorf, H. Zeiehhardt, and G. St6tiler, Mol. Gen. Genet. 134, 209 (1974). J. A. Lake, M. Pendergast, L. Kahan, and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 71, 4688 (1974). 6 M. Boublik, W. Hellmann, and H. E. Roth, J. Mol. Biol. 107, 479 (1976). G. Breitenreuter, M. Lotti, M. St6ttler-Meilicke, and G. StOmer, Mol. Gen. Genet. 197, 189 0984). s G. Schwedler-Breitenreuter, M. Lotti, M. St6fller-Meilicke, and G. St6fller, E M B O J. 4, 2109 (1985). 9 S. M. Politz and D. G. Glitz, Proc. Natl. Acad. Sci. U.S.A. 74, 1468 (1977). to G. St6ttler and M. Sttiflfler-Meilicke, in "Modern Methods in Protein Chemistry" (H. Tschesche, ed.), p. 409. de Grnyter Veda~ Berlin, 1983. '~ M. StOffler-Meilicke, B. Epe, K. G. Steinhauser, P. Woolley, and G. St6mer, F E B S Lett. 163, 94 (1983). ,2 M. St6ttler-Meilicke, B. Epe, P. WooUey, M. Lotti, J. Littleehild, and G. Strainer, Mol. Gen. Genet. 197, 8 (1984).
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
505
For electron microscopy, 0.5 ml of ribosome solution containing --0.1 A2~o unit 30S or -0.25 A~0 unit 50S in buffer I or - 0 . 4 A26o unit 70S in buffer 2 is prepared in the double-layer carbon technique as shown in Fig. 1. The buffers given above are those we routinely use for E. coli ribosomes, but any buffer can be used for specimen preparation and should be chosen according to the ribosomes to be examined. One problem in the preparation can be the ultrathin carbon film one uses. We prepare our carbon films by indirect evaporation of the carbon on
Mico
I. Corbon film
i 8
~o '~" '~Ribosome Solution
6rid-~'-
lemmmmm" _ v .
vv~¥¥
~
Single ioyer
b'V VVV VVV Urony[ Formote
Uronyl Formoht
r///////////////l
6rid~ r "//HH~///////J
(nw~wVVVV~ , Uronyi Formohl e
J
[ ~ w n v VV V ¥
Oouble layer
v///////////////J
Single Ioyer
2.~rbon film
DoubleIoyer
f
FI~. 1. Diagram of the preparation techniques used for negatively contrasted ribosomes. (a) Adsorption of the ribosomes to the carbon film for 1-2 rain, (b) withdrawal of the ribosomes by trapping them between the mica and the carbon film, (c) floating the carbon film offthe mica and onto the surface of the negative stain. After 2 min, grids covered with a carbon-backed film of collodion are placed on top of the film with the adsorbed particles. The grids are picked up immediately (d), blotted with wet filter paper, and can be air dried (single carbon layer). Accidental (partial) double carbon layer is obtained if the mica is plunged into the solution (e). Double layer regions prevail, if after blottin& the grid is submerged under a second carbon film, which has been directly floated onto the negative stain (f).
506
IMMUNOLOGICALMETHODS
[35]
FIG. 2. Electron micrographs and the corresponding views of the three-dimensional models of the 30S and 50S ribosornal subunits and the 70S monosome of E. coli. The 30S subunit (a-c) is shown in the (a) quasi-symmetric projection, (b) the cloven asymmetric projection, and (c) the angled asymmetric projection. The enantiomorph projections are also observed. The three-dimensional model is shown (a) at + 15", (b) at +60", and (c) at - 4 5 ° (for further details see Ref. 12). The 50S subunit is shown in the (d) crown view and the (e) kidney view; the 70S monosome (f) is shown in one projection only, the nonoverlap view.
freshly cleaved mica in an Edwards Coating System (Model E I2E), according to the method of Whiting and Ottensmeyer. t3 We have observed that ribosomes adsorb poorly to carbon films that have been prepared in newer coating systems, especially if the vacuum is very high. Another problem can be the reproducibility of the negative stain. In our laboratory, freshly prepared 2.5% uranyl formate (pH not adjusted) from TAAB Laboratories Equipment Limited has given fairly reproducible resuits over the past 3 years, but we have observed differences between different batches. As an alternative, 0.5% uranyl acetate (pH 4.4) has also been used. 3 The grids are inserted into the microscope with the specimen side oriented away from the electron source. Electron microscopy is done at an instrumental magnification of 110,000 and an accelerating voltage of 80 kV in a Philips EM 301 instrument; any comparable electron microscope will be adequate. Printing is done with the plate emulsion facing the paper emulsion. A prerequisite for the localization of antibody-binding sites on the ribosomal surface is the knowledge of ribosome structure, as seen in the electron microscope. 70S ribosomes and 30S and 50S ribosomal subunits from E. coli, negatively stained with uranyl acetate, are shown in Fig. 2. 30S subunits show contours that are elongated and have a one-third/twothirds partition. They appear in different orientations on the carbon film 13R. F. Whiting and F. P. Ottensmeyer, J. Mol. Biol. 67, 173 (1972).
[35]
I M M U N O E L E C T R O N MICROSCOPY OF RIBOSOMAL SUBUNITS
507
CENTRAL L7/12STALK PROTUBERANCE
N E C K ~
BACK Llt-D BASE b
BLUNTED END c
Fro. 3. Diagrammaticrepresentationof the 30S subunit (a) and the crown form (b) and the kidney form (c) of the 50S subunit. The nomenclature of the characteristic features as used in the text is given. with respect to their long axis. The three main projectional forms are shown in Fig. 2 a - c . 50S subunits are observed in two characteristic views, the crown view and the kidney view (Fig. 2d,e) The nomenclature used for the typical structural features of the ribosomal subunits is given in Fig. 3. Since the irregular projections of the ribosomal subunits provide a number of characteristic features as orientation points, they are ideally suited for the unambiguous determination of an antibody attachment site. In contrast to ribosomal subunits, electron micrographs of 70S ribosomes lack highly distinctive structural features (Fig. 2f). Double antibody-labeling experiments, which have been performed to determine the structure of the 70S monosome, have been described elsewhere. 14- t6 In order to obtain a three-dimensional arrangement of the ribosomal proteins, it is necessary to interpret the two-dimensional electron micrographs in three dimensions. By assuming that the different views of the ribosomal subunits seen on the electron micrographs are projections of a unique three-dimensional structure, three-dimensional models can be derived from the electron microscopic images. Below the representative views of the electron micrographs in Fig. 2, the corresponding views of the three-dimensional models are shown, as derived by our group. Three-dimensional models have also been proposed by others and are discussed elsewhere. ~7 ~4B. Kastner, M. StOifler-Meilieke,and G. StOffler,Proc. Natl. Acad. Sci. U.S.A. 78, 6652 (1981). ~5B. Kastner, Ph.D. thesis. TechnischeUniversit~t Berlin, Berlin, Federal Republic of Germany. ~6B. Kasmer, M. Strfller-Meilieke,and G. Strffier,Proc. Int. Congr. Electron Microsc., lOth 3, 105 (1982). ~7H. G. Wittmann, Annu. Rev. Biochem. 52, 35 (1983).
508
IMMUNOLOGICAL METHODS
[35]
P r e p a r a t i o n of I m m u n o c o m p l e x e s Using Polyvalent Antibodies Antisera against purified single ribosomal protein are raised in rabbits or sheep. The antisera are characterized by double immunodiffusion, ~s,~9 by modified immunoelectrophoresis, 2° and by immunoblotting. 2~ IgG is prepared from the antisera by first precipitating the immunoglobulins at 40% saturation with ammonium sulfate (pH 8.0). Sheep IgG is then further purified by ion-exchange chromatography on DEAE-cellulose, ~2 whereas IgG from rabbit is purified by affinity chromatography on protein A-Sepharose. 22 Occasionally, specific IgG were prepared by immunoaffinity chromatography after conjugating the corresponding purified ribosomal protein to CNBr-activated Sepharose CL-4B. 23 The IgG is then used for the preparation of immunocomplexes. Solutions
Buffer 3:50 m M Tris-HC1 (pH 7.8), 20 m M MgC12, 500 m M NI-I4C1, 2 m M dithiothreitol Buffer 4 : 5 0 m M Tris-HC1 (pH 7.8), 5 m M MgCI,, 200 m M NH4C1, 6 m M 2-mercaptoethanol Purified IgG is dissolved in buffer 3 at a concentration of 12- 14 mg/ ml. 0.5, 1.5, and 3.0 A2so units o f l g G are routinely added to 1 A26ounit of 30S or 2 A26ounits of 50S subunits. Each mixture is layered onto a sucrose density gradient (10-30% sucrose in buffer 4) and centrifuged in an SW40 rotor for 16 hr at 19,000 rpm for 50S subunits and at 23,000 rpm for 30S subunits. The ribosomal subunits are heat-activated for 30 min at 37 ° prior to use. 24,25Ribosomal subunits, functionally active in protein synthesis, have generally been used, although we have never seen any difference in structure between active and inactive ribosomes. The sedimentation profiles are determined by continuously monitoring the transmission at 254 nm. Typical gradient profiles obtained with different antibody concentrations are shown in Fig. 4 a - d . The extent of reactivity of antibodies, specific for one and the same ribosomal protein but obtained from the sera of different animals, can vary greatly (Fig. 4e). If an ~sG. St6tilerand H. G. Wittmann, Proc. Natl. Acad. Sci. U.S.A. 68, 2283 (1971). t9 G. St6ffierand H. G. Wittman, J. Mol. Biol. 62, 407 (1971). 2oW. Zubke, H. Stadler, R. Ehrlich, G. St6ttler, H. G. Wittmann, and D. Apirion, Mol. Gen. Genet. 158, 129 (1977). 21H. Towbin, T. Staehelin, and J. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4350 (1979). 22H. Hjelm, K. Hjelm, andJ. Sj6quist, FEBSLett. 28, 73 (1972). 23G. W. Tischendorfand G. St6ffier,Mol. Gen. Genet. 142, 193 (1975). 24A. Zamir, R. Miskin, and D. Elson, J. Mol. Biol. 60, 347 (1971). 25R. Miskin, A. Zamir, and D. Elson, J. Mol. Biol. 54, 355 (1970).
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
b
Cl
509
d 3 2
j
JL
&
]
4
Sedimentotion 100
f
I
o~
, I
t
I
I
$. I
5 10 PO$P Lll n-L11 loft [A280] 50 100 pg TPT0 Fro. 4. Antibody-ribosome complex formation in sucrose gradients. Gradient profiles obtained with (a) 170-fold molar excess of preimmune IgG, (b-d) 30- to 170-fold molar excess of anti-Ll 1. Peak 1, IgG; peak 2, 50S subunits; peak 3, 50S-IgG-50S complexes. (e) Reactivity of anti-Ll I IgG preparations obtained from different animals, plotted against antibody concentrations. (f) Inhibition of anti-L11-ribosome complex formation by preincubation of the antibody with increasing amounts of (ll) single protein Lll, (O) total ribosomal proteins, and (&) total ribosomal proteins which lack protein L11. Reactivity of 50S subunits was determined by planimetry as described by G. StOflier, R. Hasenbank, M. L(itgehaus, R. Maschler, C. A. Morrison, H. Zeichhardt, and R. A. Garrett [Mol. Gen. Genet. 127, 89 (1973)]. antibody specific for a particular protein a n d obtained f r o m one animal does not react with the protein in situ, it can only be concluded that the antibodies are directed against antigenic determinants that are not exposed on the ribosomal surface. Such observations do not i m p l y that the entire protein m u s t be inaccessible for antibody binding: if the same protein is injected into an animal with a different genetic background, there is a good chance o f obtaining an antibody that will react with intact subunits (for a detailed discussion o f this problem, see Ref. 12).
510
IMMUNOLOGICALMETHODS
[35]
The characterization of the antisera as described above is not sufficient to prove the specificity of the antibody that reacts with the intact subunit upon sucrose gradient centrifugation. Only a minority of the antibodies contained in an antiserum against a purified ribosomal protein will react with antigenic determinants of this protein in the intact particle. If this antibody fraction contains contaminating antibodies in small amounts with a high reactivity toward intact ribosomes, then these antibodies are likely to escape detection by the standard immunochemical techniques used to assess the purity of the various antisera. The lack of appropriate control experiments has, in the past, led to more mistakes in the localization of ribosomal proteins on the surface of the ribosomal subunits than any other factor. 5,23 Thus it is important to carry out control experiments to eliminate effects of contaminating and cross-reacting antibodies. We have developed such controls, which use preabsorption of the antibody with isolated protein(s) in the dimer-forming reaction. This is exemplified in Fig. 4c for antibodies specific for protein L11 (anti-L11): Dimer formation, which is observed when 50S subunits are incubated with anti-L1 l, is completely abolished if the antibody is preincubated with stoichiometric amounts of protein L 11. Preincubation of the antibody with total ribosomal proteins from 70S ribosomes (TP70) has the same effect. In contrast, incubation of anti-L11 with TP70 lacking protein Ll 1 does not inhibit dimer formation. These control experiments, taken together, demonstrate that dimer formation depends exclusively on the reaction of L11-specific antibodies with epitopes of protein L11 that are exposed on the surface of intact 50S subunits and a cross-reaction with a similar or identical epitope of another ribosomal protein can be excluded. For preabsorption experiments, the ribosomal protein(s) are dissolved in 8 M urea and preincubation of the antibody is carded out for 30 min at 37 ° and 1 hr at 0 ° in buffer 3. The final urea concentration should be below 1 M, in order not to interfere with the antibody-antigen reaction. For preabsorption of anti-L 1 l, total ribosomal proteins minus protein L11 have been obtained from a mutant which lacks protein L11. 26 A number of mutants lacking different ribosomal proteins have been isolated. 27 Alternatively, such mixtures have been obtained by mixing purified individual ribosomal proteins in stoichiometric amounts, but omitting the protein in question. 12 For some proteins, the mixtures were made by passing total ribosomal proteins over an 26 G. St0ttler, E. Cundliffe, M. St6ftler-Meilicke, and E. R. Dabbs, J. Biol. Chem. 255, 10517 (1980). 27 E. R. Dabbs, R. Hasenbank, B. Kastner, K.-H. Rak, B. Wartusch, and G. StOttler, Mol. Gen. Genet. 192, 301 (1983).
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
511
immunoaltinity column to which an antibody against the particular protein had been bound, s The fractions containing the immunocomplexes are taken directly from the sucrose gradient and prepared for electron microscopy as described above. Good results are obtained if approximately one-third of the subunits are dimerized: in this case the adsorption time to the carbon film is 1 to 2 rain. Examples of overall views, showing immunocomplexes obtained with polyclonal IgG antibodies, are shown in Fig. 5a,b,d,f. Evaluation of the I E M Data In order to determine the three-dimensional location of a given protein, it is necessary to locate the antibody attachment site on subunits seen in different orientations. Thus on 50S subunits, antibody binding to both the crown and the kidney projection has to be determined as shown for proteins L17 and L19 (Fig. 6). In the crown form, both anti-L17 and anti-L19 bind at the base of the 50S subunit, below the rod-like appendage (Fig. 6a,d). However, in the kidney projection, anti-L17 binds at the back of the 50S subunit (Fig. 6b), while anti-Ll9 binds at the opposite side of the particle, just below the notch (Fig. 6e). Pairs of subunits, in which a crown form is connected by one and the same IgG molecule to a kidney form, prove that the two antibody-binding sites observed on the two views correspond to a single site in the three-dimensional structure (Fig. 6c,f). For the three-dimensional localization of the proteins of the 30S ribosomal subunit, the antibody attachment site is determined on the three projections shown in Fig. 2a-c. This procedure is illustrated for proteins S 16 and S 17 (Fig. 7). The three-dimensional locations of all the ribosomal proteins that have been determined in our laboratory are shown in Fig. 8. The limit of resolution of IEM is given by the size of the combining site of the antibody molecule, or more roughly, by the diameter of the Fab arm (-40 A). Thus the resolution can generally not be improved by the use of monoclonal antibodies. There are other factors that may lower the resolution of the three-dimensional localization of the antibody attachment site: (l) The visibility of the Fab arm in the immunocomplexes has to be taken into account for the interpretation of the data (see Fig. 7). If, for example, the connecting Fab arm is poorly visible in both the crown view and the kidney view, as has been observed with anti-Ll5, the region which is deduced for the antibody binding site is relatively large.2s (2) In immunocomplexes obtained with some antibodies, certain projections are rarely 2s M. Lotti, E. R. Dabbs, R. Hasenbank, M. St6fller-Meilicke, and G. St6tiler, Mol. Gen. Genet. 192, 295 (1983).
512
IMMUNOLOGICAL METHODS
[35]
FI~. 5. Electron micrographs of 30S a~d 50S immunocomplexes. 30S subunits were reacted with IgG obtained from (a) polyclonal anti-S5 and (d) anti-S7, and with (c) monoclonal anti-S7.50S subunits were reacted with IgG obtained from (b) polyclonal anti-LIB and (f) anti-L6, and with (g) 0.1 A~o and (h) 0.6 A~o of monovalent Fab fragment obtained from polyclonal anti-L7/L12-specific IgG. In (e), 50S subunits, which had been labeled at the single cysteine residue of protein L6 with 5-iodoacetamidofluorescein, were reacted with fluorescein-specific antibody.
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
a - L17
513
a- L19
FIG. 6. Electron micrographs of 50S subunits, reacted with anti-Ll7 (left) and anti-Ll9 (right). The 50S subunits are seen (a) in the crown view and (b) in the kidney view. In (c) a crown view is connected by one and the same IgG molecule to a kidney view. For further details see text. The localization of the two proteins is given by the hatched areas on the three-dimensional 50S models.
observed. For example, the kidney projection was very rare in immunocomplexes obtained with anti-L129 and anti-Ll8: ° On electron micrographs obtained with anti-S2 and anti-S3, one projectional form, the angled asymmetric projection was not seen at all: ,s In this latter case, the three-dimensional localization is unavoidedly less precise. (3) Antibodies against a number of proteins frequently lead to the formation of dimeric complexes, in which the two subunits are linked simultaneously by two antibody molecules (see insert in Fig. 5d). Although in all these cases the two sites are close to each other, the two epitopes must be at least 40 apart (given the width of an Fab arm to be 40 ,~) and thus the area describing the location of the ribosomal protein becomes larger. (4) Needless to say, the three-dimensional location of a protein differs, depending 29 E. R. Dabbs, R. Ehrlich, R. Hasenbank, B. H. Schroeter, M. StOltler-Meilicke, and G. StOitler, J. Mol. Biol. 149, 553 (1981). 3o M. StOitter-Meilicke, M. Noah, and G. Strflier, Proc. Natl. Acad. Sci+ U.S.A. 80, 6780 (1983).
514
IMMUNOLOGICAL METHODS
[35]
t
FIG. 7. Electron micrographs and interpretative diagrams, illustrating the three-dimensional localization of proteins S17 (a-d) and S16 (e-h). Binding of anti-S17 to the quasi-symmetric projection (a) appears to be at the lower pole of the 30S subunit, but it must be some 30-50 A away from it, since the Fab arm of the connecting IgG molecule is only partly visible. In the cloven asymmetric projection (b) as well as in the angled asymmetric projection (c), anti-Sl7 binds to the subunlt body, on the side of the large lobe, 40 A from the lower pole. Binding of anti-S16 to the quasi-symmetric projection (e) is some 30-50 A away from the lower pole of the 30S subunit. In the cloven asymmetric (f,h) and in the angled asymmetric projection (g), antibody binding appears to be closer to the lower pole, but again, the bound Fab arm is only partly visible. On all three projections, anti-S 16 binds on the side opposite the large lobe. The localization of proteins S16 and S17 is indicated by the hatched areas on the three-dimensional 30S models.
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
515
Fro. 8. Three-dimensional model of the 30S (a-d) and 50S (e-f) subunits of E. coli giving the locations of antibody-binding sites for individual ribosomal proteins, as determined in our laboratory. In a comparative study, proteins $3 and $7 have been localized using monoclonal and conventional antibodies, v Protein S2 has been mapped exclusively with monoclonal antibody, s Proteins $4, S17, and L6 have also been selectively labeled at their cysteine residues with fluorescein; subsequent mapping with fluorescein-specific antibodies allowed a refined statement as to the exposure of antigenic determinants of these proteins on the ribosomal surface, n,12
516
IMMUNOLOGICALMETHODS
[35]
on the three-dimensional model of the ribosomal subunit which is used for the localization. However, the IEM data themselves remain valid, provided that the specificity of the antibody has been shown, and it should be possible in the future to transfer these data to a three-dimensional model derived from X-ray crystallography. In order to determine the antibody binding site on the different projections precisely, a large number of immunocomplexes needs to be evaluated. Normally, we analyze 100-500 immunocomplexes, in which the antibody attachment site can be clearly discerned. With some IgG preparations, e.g., with anti-L18, the antibody attachment site can be clearly seen in more than 90% of the immunocomplexes present on an electron micrograph (see Fig. 5b). With other IgG preparations, the antibody binding site can only be determined on a minority of the dimers; this especially concerns antibodies that bind at the interface region of the 50S subunit, e.g., anti-L5 and anti-L27. From this observation it may be concluded that the 50S subunit is more hollow at the interface region than most of the 50S models would suggest. Use of Monoclonal Antibodies If we now ask the question which part of a protein is accessible on the ribosomal surface, we may obtain an answer by using monoclonal antibodies or by specific labeling of ribosomal proteins with haptens and subsequent localization of the hapten with haptcn-specific antibodies. If monoclonal antibodies are to be used for the localization of ribosomal proteins by IEM, it is important to select for antibodies with high affinity for the antigen in situ. The enzyme-linked immunosorbent assay, which is routinely used for the detection of reactive monoclonal antibodies, is not sufficient for this purpose. In our studies we have in addition screened by sucrose gradient centrifugation for antibodies that are reactive with intact ribosomal subunits. 7,8 For monoclonal antibodies, sucrose gradient centrifugation is performed as described above, except that hybridoma supernatant is being used instead of the purified IgG. For routine screening, we use 600 pl of hybridoma supernatant (this is the maximum volume which can readily be layered onto sucrose gradients in an SW 40 rotor). It is important to adjust the Mg 2+ concentration of the hybridoma supernatants to 20 m M and to start centrifugation as quickly as possible after adding the ribosomal subunits to the supernatant, since otherwise the ribosomes are readily degraded due to the presence of enzymes in the culture medium. This latter precaution is no longer necessary if purified monoclonal IgGs are being used. The fractions containing the immunocomplexes are again directly
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
517
used for specimen preparation (Fig. 5c) and the electron micrographs are evaluated as described above. It is important to note that the specificity controls described for polyclonal antibodies also need to be performed for monodonal antibodies. This is exemplified by a monoclonal antibody that has been isolated in our laboratory. This antibody reacted exclusively with protein $2 from E. coli, as judged from immunoblots, but dimer formation could not be inhibited by preincubation of this antibody with protein $2. 3~ It was thus not proven that the reacting epitope in the ribosome is contained in protein $2, and indeed the monclonal antibody bound to a region of the 30S subunit other than where $2 has been localized, s Use of Haptens and Hapten-Specific Antibodies for the Localization of Ribosomal Proteins The rationale of this approach is specifically to label one ribosomal protein, to incorporate this labeled protein into intact ribosomal subunits, and subsequently to localize the label on the ribosomal surface by haptenspecific antibodies. This method eliminates from the outset problems due to antibody contamination, and a further advantage is that the same hapten-specific antibody can be used for the localization of different proteins. In principle, a large variety of different haptens can be used. The use of fluorophores as specific label does have the advantage that IEM results, obtained on dehydrated particles, can be compared with distances measured on ribosomal particles in solution by energy transfer between the same two fluorophores. 32,33 Again, it is important that the hapten-specific antibody being used has a high affinity for the antigen, so that it is able to form stable immunocomplexes that can be used for IEM. The most critical step in this approach is the correct labeling of one ribosomal protein and the incorporation of this protein into the ribosomal subunit. We have localized proteins $4, S 17, and L6, using 5-iodoacctamidofluorescein as specific label. H,12 As an example, the labeling of protein L6 at its single cysteine residue and its subsequent incorporation into intact 50S subunits will be given in detail. 34 In this case 0.8 M LiCl 50S core particles are prepared, which altogether lack 14 proteins, one of which is protein L6. Intact 50S subunits are then reconstituted from the core parti3l G. Schwedler-Breitenreutcr, unpublished observations. 32 B. Epe, P. Woolley, K. G. Steinh~user, and J. Littlechild, Eur. J. Biochem. 129 211 (1982). 33 O. W. Odom, E. R. Dabbs, C. Dionne, M. MOiler, and B. Hardesty, Eur. J. Biochern. 142,
261 (1984). 34K. G. Steinh~luser,P. WooUey,B. Epe, and J. Dijk, Eur. J. Biochem. 127, 587 (1982).
518
IMMUNOLOGICAL METHODS
[35]
des and the split proteins, together with an excess of labeled protein L6. For proteins that cannot easily be removed from the subunit it may, however, be necessary to reconstitute the intact subunits from its single components, and the procedure will have to be modified accordingly.~2 Materials and Solutions
Buffer 5:350 mM NaC1, 20 mM PO]-, pH 7.0, 0.5 mM dithiothreitol, 0.1 mM benzamidine, 0.1 mM phenylmethylsulfonyl fluoride Buffer 6 : 1 5 mM HEPES, pH 7.5, 350 mM KCI, 20 mM MgC12, 0.5 mM dithiothreitol Buffer 7:10 mM HEPES, pH 7.9, 100 mM NaCI, 10 mM EDTA, 6 mM 2-mercaptoethanol Buffer 8:5 mM K2HPO4, pH 7.5, 95 m M KCI, 5 mM NI-I4C1, 5 mM MgCI2, 0.5 mMCaC12, 8 mMputrescine, 1 mMspermidine, 1 mM dithiothreitol 5-Iodoacetamidofluorescein (IAFI) is from Molecular Probes Inc.; Ficoll 400, BioGel A0.5, and Sephadex G-50 superfine are from Pharmacia; N,N-bis(2-hydroxyethyl)glycine (Bicine) is from Sigma Ribosomal subunits and protein L6 are purified by the method of Dijk and Littlechild35 avoiding denaturing conditions. LiC1 (0.8 M) cores are prepared by the method given by Homann and Nierhaus. 36 The cores are pelleted, dissolved in buffer 6, and dialyzed against the same buffer for 5 hr. The protein content of the 50S cores (and of TP50 from reconstituted ribosomes, see below) is checked by two-dimensional gel electrophoresis. Total ribosomal proteins are prepared from 30 ml of a solution conmining 1000 A260 of 50S subunits which are dialyzed against buffer 7 and then adjusted to 4 M LiCI by the addition of 10 M LiC1. After centrifugation (20 hr, 20,000 rpm/min in a Ti75 rotor) the supernatant is dialyzed against buffer 6 and concentrated with dry FicoU 400. The solution is clarified by centrifugation (1 hr, 10,000 rpm/min). Protein L6 is labeled by adding 0.15 mg solid IAFI to 0.2 nag L6 in 100/~1 of buffer 5, followed by the addition of 10/zl Bicine (250 raM, pH 8.0). The solution is incubated at 0 ° for 10 hr, after which the excess dye is removed by gel filtration (1 × 10 cm column, Sephadex G-50 superfine, elution with buffer 5). If necessary, the protein is concentrated by dialysis against dry Ficoll 400. Protein concentrated is measured by amino acid analysis. 50S subunits are reconstituted by incubating 10 A260units of 50S cores
35 j. Dijk and J. Littlechild, this series, Vol. 59, p, 481. H. E. Homann and K. H. Nierhaus, Eur. J. Biochem. 20, 249 (1971).
[35]
IMMUNOELECTRON MICROSCOPY OF RIBOSOMAL SUBUNITS
519
with about 7 pg of fluorescent-labeled L6, in 510/~1 of buffer 6, for 30 min at 37 °. TPS0 equivalent to 14 A26o in 90 gl buffer 6 is then added and the mixture allowed to stand for 30 rain at 0°. After centrifugation (2 rain, 6000 rpm/min), the solution is applied to a column of BioGel A0.5 0.5 X 1.5 cm) and eluted with buffer 8. The reconstituted 50S particles appear in the exclusion peak. Sucrose density gradient centrifugation is performed exactly as described above for polyclonal antibodies. If a fluorescent dye is used as specific label, the binding of the antibody to the labeled subunits can also be followed by measuring the fluorescence intensity. As a control, haptenspecific antibodies are reacted with subunits containing no label. In the experiments performed in our laboratory, in some cases dimer formation was rather low, H probably due to a low incorporation of labeled protein into the subunits. Incorporation of the labeled protein into the subunits could be improved if the corresponding unlabeled protein was omitted from the reconstitution mixture. Electron microscopy is performed as described above. As an example, electron micrographs of 50S subunits, containing a fluorescein-labeled ribosomal protein L6 and reacted with fluorescein-specific antibody are shown in Fig. 5e. Use of Monovalent Fab Fragments for IEM Monovalent Fab fragments bound to ribosomal subunits can also be visualized by electron microscopy, provided that the antibody-binding site is close enough to the contour line of the ribosomal particle. We have used monovalent Fab fragments specific for proteins WLI2in order to define the epitopes of these proteins along the rodlike appendage of the 50S subunit more precisely. 37 Since the monovalent Fab fragments are clearly distinguishable from bivalent IgG molecules, they can also be used as additional marker on the ribosomal surface. 3s Ribosomal subunits carrying a monovalent Fab fragment are prepared for electron microscopy in the following way: 1 A26ounit of 30S subunits or 2 A26ounits of 50S subunits are incubated with increasing amounts of Fab fragments and layered onto a l 0-30% sucrose density gradient. The optimal Fab concentration has to be determined by electron microscopy, but the amount of Fab to be used can be roughly calculated from the amount of IgG that was needed to dimerize the subunits. Centrifugation time and the buffers used are the same as described above for polydonal IgG. Since with Fab fragments no dimer peak is being formed, the monomer peaks are 37 E. Schaber, B. Kastner, M. St6itler-Meilick¢, and G. St6itler, Proc. Eur. Congr. Electron Microsc., 8th 2, 1555 (1984). as G. St6ffler and M. St6fller-Meilicke, Annu. Rev. Biophys. Bioeng. 13, 303 (1984).
520
IMMUNOLOGICALMETHODS
[35]
used for specimen preparation. For illustration, electron micrographs of 50S subunits reacted with two different concentrations of Fab specific for proteins L7/L12 are shown in Fig. 5g,h. In Fig. 5g, the 50S subunits have one to two Fab fragments bound, whereas in Fig. 5h they have two to four Fab fragments attached. By these experiments we could clearly demonstrate that L7/L12 specific antibodies bind along the whole length of the rod-like appendage, with preference for the tip. Conclusion Application of the different IEM methods described above for the localization of the ribosomal proteins on the surface of the ribosomal subunits from E. coli has led to the current model of the arrangement of the ribosomal proteins, as shown in Fig. 8. So far, 16 proteins from the small subunit and 17 proteins from the large subunit have been localized. The IEM data obtained for both the 30S and the 50S proteins agree extremely well with the assembly maps derived for the two s u b u n i t s , 39,4° suggesting that a functional interrelationship reflects a structural neighborhood. There is also an excellent agreement between the IEM results and the topographical data obtained by neutron scattering for the 30S subunit. 4t If all the topographical data are taken together, the location of the remaining five proteins of the 30S subunit still to be mapped by IEM can be deduced.42 At the moment we have no antibodies against the remaining proteins available that are reactive with intact ribosomal subunits. Such negative immunological results do, however, not allow the conclusion that these proteins are buried within the ribosome and therefore not accessible for antibody binding (for a detailed discussion, see Ref. 12). It may be that in the future the approach of specific labeling with haptens or the use of monoclonal antibodies will enable us to localize most, if not all of the remaining proteins on the ribosomal surface. Acknowledgments We thank R. Brimacombe and I. G. Wool for critically reading the manuscript, R. Albrecht-Ehrlich, U. Liebing~ and I. Popella for their help in preparation of the figures, and R. Hasenbank for typing the manuscript. The constant interest and support of H.-G. Wittmann is gratefully acknowledged. 39 S. Mizushima and M. Nomura, Nature (London) 27,6, 1214 (1970). 40 R. RShl and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 79, 729 (1982). 4t V. Ramakrishnan, M. Capel, M. Kjielgaard, D. M. Engelmann, and P. B. Moore, J. Mol. Biol. 174, 265 (1984). 42G. St6ffier and M. St6filer-Meilieke, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 28. Springer-Verlag, Heidelberg, Federal Republic of Germany, 1986.
[36]
R P - H P L C OF RIBOSOMAL PROTEINS
523
[36] Reversed-Phase High-Performance Liquid Chromatography of Ribosomal Proteins B y BARRY S. COOPERMAN, C A R L J. WEITZMANN, a n d MELISSA A . B U C K
Introduction Since the d e m o n s t r a t i o n o f its potential in 1982,1 high-performance liquid c h r o m a t o g r a p h y ( H P L C ) has been adopted by an increasing n u m b e r o f laboratories as the m e t h o d o f choice for both the analysis and preparation o f ribosomal proteins. By c o m p a r i s o n with the techniques previously e m p l o y e d for these purposes, one- and two-dimensional polyacrylamide gel electrophoresis (PAGE) for analysis and classical ion-exchange and size-exclusion c h r o m a t o g r a p h y for preparation, H P L C offers at least equivalent resolution and reproducibility a n d is clearly superior with respect to rapidity, recovery yields, a n d sensitivity. Although c h r o m a t o g r a m s have been published using size-exclusion (SE), 2-5 ion-exchange (IE), 3-9 and reversed-phase (RP) H P L C , I-S,s-15 only the latter two offer sufficient resolution to be o f general utility. Higher resolution and sensitivity are obtainable with R P - H P L C , but I E - H P L C provides higher capacity. Because the bases for separation are quite different, the order o f ribosomal protein elution differs m a r k e d l y for R P - H P L C vs. I E - H P L C . As a result, the t A. R. Kerlavage, L. Kahan, and B. S. Cooperman, Anal. Biochem. 123, 342 (1982). 2 A. R. Kerlavage, C. J. Weitzmann, T. Hasan, and B. S. Cooperman, J. Chromatogr. 266, 225 (1983). 3 R. M. Kamp, A. Bosserhoff,D. Kamp, and B. Wittmann-Liebold, J. Chromatogr. 317, 181 (1984). 4 R. M. Kamp, Z. Y. Yao, A. Bosserhoff, and B. Wittmann-Liebold, Hoppe-Seyler's Z. Physiol. Chem. 364, 1777 0983). s R. M. Kamp and B. Wittmann-Liebold, FEBSLett. 167, 59 0984). 6 p. N. Dalrymple, S. Gupta, F. Regnier, and L. L. Houston, Biochim. Biophys. Acta 755, 157 (1983). 7 p. j. Flamion and J.-P. Schreiber, Anal. Biochem. 147, 458 0985). s M. F. Tam and L. Giri, Biochem. Int. 11, 709 (1985). 9 M. Opel, D. Datta, C. R. Nierras, and G. R. Craven, Anal. Biochem. 158, 179 (1986). to A. R. Kerlavage, T. Hasan, and B. S. Cooperman, J. Biol. Chem. 258, 6313 (1983). 11A. R. Kerlavage, C. J. Weitzmann, and B. S. Cooperman, J. Chromatogr. 317, 201 (1984). 12A. R. Kerlavage, C. J. Weitzmann, M. Cannon, T. Hasan, K. M. Giangiacomo, J. Smith, and B. S. Cooperman, Biotechniques 3, 26 0985). t3 R. J. Ferds, C. A. Cowgill, and R. R. Trout, Biochemistry 23, 3434 (1984). ,4 H. P. Nick, R. E. H. Wettenhall, M. T. W. Hearn, and F. J. Morgan, Anal. Biochem. 148, 93 (1985). 15p. Stiegler, M.-L. Hartmann, and J.-P. Ebel, Biochimie68, 587 0986). METHODS IN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsofreprodu~ionin any formreserved.
524
ISOLATION OF RIBOSOMAL PROTEINS
[36]
availability of both kinds of column allows straightforward solutions to problems that can arise with the use of a single column, such as the separation of coeluting proteins, or the definitive identification of a modified protein that elutes slightly differently than the unmodified protein. Our focus in this chapter will be on RP-HPLC of ribosomal proteins. IE-HPLC of ribosomal proteins is considered in detail elsewhere in this volume.~6 Practical Considerations
Column Packings and Eluting Solvents A variety of organic phases bonded to silicas have been used to successfully resolve ribosomal proteins. The most widely used bonded phases are Ci8 [RP-P (Synchrom2.9,1°; TP-RP (Vydac)a-5], C8 [PRO-RPC HR 5/10 (PharmaciaS'ts; Cs (Altex)'3], Ca or a mixture of short alkyl chains [RPSC (Altex)~3; RPSC (Ultrapore)a,5], diphenyl [Bakerbond RP-710-6-0 (Baker)~4], and cyanoprop.yl (Altex). ~3 There is general agreement that large-pore packings (300 A) give better resolution and higher yields of ribosomal proteins when compared with small-pore packings (60- 125 b,) of the same type.4,~°,~aThe most common eluting solvent is a gradient of acetonitrile (ACN) in aqueous 0.1% trifluoroacetic acid (TFA). This solvent system is similar to that which had previously been developed for peptide separations, except that higher ACN percentages (up to 60%) are required for protein elution. It provides high resolution (Fig. 1) and is especially useful for ribosomal protein preparation since each of its components is volatile and removable by lyophilization or through use of a Speed-Vac (Savant) evaporator. Two groups have reported that slightly higher resolution is obtainable when triethylammonium phosphate, pH 2.2 (in water) and 0.1% phosphoric acid (in ACN) replace 0.1% TFA. s,'3 The disadvantage of this replacement is that an additional, desalting step is required when RP-HPLC is used as a preparative method, although it is true that rapid desalting is possible using small reversedphase columns and volatile solvents. 8,13 Propanol has also been examined in place ofACN, a,5 but presents no significant advantage and, according to one group, is actually less desirable. 13
Detection Eluting proteins are typically detected by their absorbance at either 280 nm, reflecting primarily the tryptophan and tyrosine chromophores, ,6 M. S. Capel, D. Datta, C. R. Nierras, and G. R. Craven, this volume [37].
[36]
RP-HPLC OF RIBOSOMAL PROTEINS
0.24
f
0.16
525
t.3.17
A
14 3O Q,I 15,111
4 I0
31 33 21'
S
2O
100
120
l
0.08
<-
e~
0.-qT
0.06
0 0
20
40
60
80
140
ELUTION TIME (min) FIG. 1. RP-HPLC ofTP50 (A) and TP30 (B).2 Samples were injected onto a SynChropak RP-P column. Solvents used were (A) 0.1% (w/v) TFA in water; (B) 0.1% (w/v) TFA in ACN. In (A) TP50 (217 #g) was eluted with a convex gradient of 15 to 45% solvent B in 120 rain followed by a 10-min isocratic elution at 45% B and a 30-rain linear gradient from 45 to 72.5%. In (B) TP30 (84 #g) was eluted with a convex gradient (as above) for 120 min followed by an additional isocratic elution at 45% B.
or at 214 nm, which corresponds to the peptide bond absorption maximum. Detection at the latter wavelength is preferable, both because it affords much higher sensitivity (with the most sensitive detectors now available, as little as 0.2/tg of a protein can be quantitatively detected) and because all proteins absorb at this wavelength. By contrast, several ribosomal proteins lack both tryptophan and tyrosine and are virtually transparent at 280 nm. Besides their volatility, the solvents used for RP-HPLC (ACN or propanol) have the additional advantage of being essentially transparent at 214 nm, although it is true that only highly purified (and therefore expensive) grades are suitable for RP-HPLC work. By contrast,
526
ISOLATION OF RIBOSOMAL PROTEINS
[36]
all of the IE-HPLC work on ribosomal proteins reported to date makes use of urea-based solvents and detection is only feasible above 230 nm, where peptide absorption is weaker and sensitivity correspondingly less. Although detection at 214 nm is preferable to detection at 280 nm, dual-wavelength detection can be very helpful in identifying proteins, since the observed A2ao/A214ratiO can be compared to what is expected on the basis of the tyrosine and tryptophan content of the protein. The recent advent of diode array detectors, capable of taking a full spectrum of a protein as it elutes, allows such analysis to be performed in greater detail. Resolution, Sample Size, and Flow Rate The published chromatograms for TP30 and TP50 of highest resolution show a total of 18 peaks (not all baseline resolved) for the 21 30S proteins and 28 peaks (again not all baseline resolved) for the 33 50S proteins. As is typical for chromatographic procedures, peak resolution is dependent on sample size and flow rate. For the analytical RP-P column (4.1 mm X 250 mm) used extensively in our work, there is little change in resolution for samples of 50-500/zg of total protein. Protein peaks do broaden (while remaining fairly well-resolved) for samples exceeding 1 mg, although the column still provides useful resolution when as much as 5 nag of protein is applied. Correspondingly higher amounts of protein can be applied with retention of resolution when larger bore, preparative columns are used. On the other hand, decreasing the flow rate (thus increasing the time required per chromatographic run) increases resolution, as has been dearly shown by Fen'is et al. ~3This trade-offbetween resolution on the one hand and the amount of sample that can be chromatographed and the time required per chromatogram on the other must be taken into account in selecting conditions for a specific application. Increased resolution, exceeding that typically available even by two-dimensional PAGE, can often be obtained by using a shallower gradient in a chromatographic region of interest. Thus, the chromatogram shown in Fig. 2 was designed to resolve proteins L 18/L22/L23/L29 (compare with Fig. 1) by introducing a shallow gradient of 35 - 36% acetonitrile. This approach is generalizable to any region of the chromatogram. Protein Preparation, Multiple Peaks, and Denaturation Analysis of the increasing literature on RP-HPLC of proteins makes it abundantly clear that the elution behavior of proteins depends not only on their bulk polarities, but also on the secondary and tertiary structures. 17 ~ G. E. Katzenstein, S. A. Vrona, R. J. Wechster, B. L. Steadman, R. Y. Lewis, and C. R. Middaugh, Proc. Natl. Acad. Sci. U.S.A. 83, 4268 (1986).
[36]
RP-HPLC OF R I B O S O M A L
527
PROTEINS
2,3 15,17
4,10
21
14 I
6
15 20
'<~1 3327
[:5 182225
,o
5'0
ELUTIONTIME(mln)
FIG. 2. RP-HPLC of TP50.~ ~A solution of TP50 (400 #g) in 60 #10.1% TFA was applied to a SynChropak RP-P column and eluted with the following gradient: 17-34.9% ACN in 20 min (curve .2); 34.9-36% ACN in 10 rain (linear); 36% for 10 min; 36-45% ACN in 10 min (linear); 45-50% ACN in 5 min (linear); 50-75% ACN in 5 rain (linear); 75% ACN for 5 min. Proteins L7 and LI2 were present in low amounts in the 50S subunits from which these proteins were extracted and are not shown.
This phenomenon is not without interest, since it can lead to the use of RP-HPLC as a probe of protein structure. However, it is rather a nuisance for the routine analysis and preparation of ribosomal proteins, because it can lead to the appearance of multiple peaks in the elution of a single protein. We have found that dissolving protein in a standard denaturing solvent prior to injection leads to fully reproducible results and single elution peaks for virtually all ribosomal proteins. Such solvents include buffer B [6 M urea, 15 m M LiC1, 10 m M HaPO4 (adjusted to pH 8.0 with methylamine), 3 m M 2-mercaptoethanol; the presence of the 2-mercaptoethanol prevents oxidation of ribosomal proteins that can lead to altered elution volume, e.g., for L27 ~°] or Rec20U [6 M urea, 30 m M Tris-HC1 (pH 7.4 at room temperature), 20 m M magnesium acetate, 500 m M NH4C1]. We have also obtained satisfactory results using 0.1% TFA or 40-67% acetic acid. With the latter solvent proteins can be extracted from ribosomes ~8,~9and applied directly onto an RP-HPLC column, without the need for the intermediate steps of precipitation and redissolution. ~8S. J. S. Hardy, C. G. Kurland, P. Voynow, and G. Mora, Biochemistry8, 2897 (1969). ~9A. R. Kerlavage and B. S. Cooperman, Biochemistry25, 8002 (1986).
528
ISOLATION OF RIBOSOMAL PROTEINS
[36]
Protein Recovery and "Ghost" Peaks Data on protein recoveries are available for the RP-P (Cls, Synchrom),2 RP-TP (Cls, Vydac)4'5 Altex RPSC (C3),13 and Ultrapore RPSC4,5 (short chain) columns. The results with the RP-P and Altex RPSC columns are most similar, both giving overall protein recoveries of 75- 85%. By contrast the recoveries reported for the RP-TP and Ultrapore columns are distinctly lower, averaging about 50%. The recovery data for the RP-P column are most extensive, and show only six proteins having recoveries of<60%: SI (53%), $2 (50%), L4 (58%), L7 (27%), L10 (58%--unresolved from L4), and LI2 (43%). Significantly these proteins are the latest eluting in the TP50 and TP30 chromatograms (Fig. 1). More generally, there is a clear linkage between the percent recovery and the percent ACN needed for protein elution, with lower recovery correlated with higher percent ACN. Proteins S 1, $2, L7, and L 12 are also recovered in low yield from the Altex RPSC column, as are, in addition, proteins $8, S10, L9, and L27. Recoveries of some of these proteins are increased when cyanopropyl or diphenyl columns are used in place of the RPSC column. In addition, the recoveries of both L7 and L 12 are increased when these proteins are eluted with steeper gradients and higher flow rates. ~3 This observation contrasts with that of Kamp and Wittmann-Liebold,5 who report higher recoveries when shallower gradients are used. "Ghost" peaks are defined as those peaks which are seen when, following a normal chromatographic run, a second chromatogram is performed without further injection of protein. 2 Such peaks are typically most intense following chromatography of a large amount of ribosomal protein (> 1 mg for the RP-P analytical column), although they are each considerably less intense (< 10%) than the corresponding peaks in the original run. The most intense ghost peaks come in the latter part of the gradient, at the higher acetonitrile percentages, and account, at least in part, for the lower recoveries of the late eluting proteins. From a practical standpoint, the observation of "ghost" peaks makes clear the importance of column washing to avoid contamination of subsequent chromatograms. This is rapidly accomplished using steep gradients with high (60-70%) final percentages of ACN. Here it is important to note that too high a percentage (> 75%) of ACN causes many proteins to remain bound to the column. Gradients containing propanol in place of ACN can also be used for column washing.
Reproducibility and Order of Protein Elution In addition to resolution, an important criterion for the utility of an analytical method for protein separation is that the results obtained be
[36]
RP-HPLC OF RIBOSOMAL PROTEINS
529
highly reproducible. In our own work using RP-P columns, this criterion has been satisfied. 2 Relative retention values of each ribosomal protein are generally reproducible to + 1% (and do not exceed + 2%) so that the order of protein elution is highly conserved. As a consequence, once a chromatoTABLE I ORDER OF S PROTEIN ELUTION FROM R P - H P L C COLUMNS a
Column elution order RP-P S protein groups
C3d
C,se
C/
12 21
12 21
12 21
12 21
12 21
14 19
14 19
14 19
12 21 11" 14 19
14 19
14 19
El0 B
E
E
C20
II 15 18
ll 15 18
17
17
17
16 4 8
10 16 4 3
O__ 4 [--10 3 16
13
13
5*
5 9 6 7
9 5 6 7
EIO * 7 9 6
2
2
2
1
1
1
13 Gr~oup C
HR 5/10
C,sc
Gr~oup A
E
RP-TP
C,sb
20
Group
RPSC
5 9 6 7
E
E E
F--15 18 11
L_
20 V-" 15
16 1-13 4 3
2 -
-
19 15 18 I1
II 15 18
17
17
~10
4 3 F-- 16
. E
Css
1 6
10 4 8
13
8
13
5 9 6 7
5 m-- 9 L 7 6
2 1
--
-
a S12 is first and S1 is last. Brackets link unresolved proteins. b From Ref. 10. c From Ref. 9. Run at 40°; all other runs at room temperature. d From Ref. 13. e From Ref. 3. Proteins marked with asterisks do not fall in standard groups. It is worth noting that of the six chromatograms described in this Table, this is the only one that used 2-propanol as the organic solvent. f From Ref. 8. g From Ref. 15.
530
ISOLATION OF RIBOSOMAL PROTEINS
[36]
gram has been standardized, the relative elution position of a protein peak can be used to identify it, in much the same way that proteins are identified by their migrations on two-dimensional PAGE analysis. There are some qualifications to this statement: first, new columns often have to be conditioned (usually by chromatographing a small amount of ribosomal protein with the standard gradient and repeating this procedure two to three times) before they give a highly reproducible elution pattern; second, the elution pattern changes somewhat on older columns as they become increasingly coated with irreversibly denatured protein and as hydroxyl groups on the silica become exposed--with suitable care, several hundred runs can be performed on a single column before this becomes a problem; third, in crowded regions of the chromatogram, small changes in relative retention can lead to changes in the order of protein elution. Such changes can result from changes in protein loading, flow rate, and method of protein preparation, and these factors must be controlled for maximum reproducibility to be obtained. It is also of interest to compare the order of elution obtained when different research groups use the same (or a very similar) protocol, or when different protocols are used but with similar columns. The most complete set of data is available for TP30 from Escherichia coli and is listed in Table I. From the results shown in Fig. 1, we can divide the 30S proteins into four groups: a group of seven very well-resolved proteins (S12, S21, Sl4, S21, $17, $2, and Sl) and three groups of clustered proteins, group A ($20, S11, S15, and Sl8), group B ($10, Sl6, $4, $8, $3, and S13), and group C ($5, $9, $6, and $7). The data in Table I allow the striking conclusion that changes in the order of elution take place only within groups A, B, and C (with the three minor exceptions in the work of Kamp et aL noted in Table I), despite the differences in column type and gradient shape employed, and the lack of standardization in the preparation of proteins. A similar conclusion may be reached for the elution order of TPS0, again with minor exceptions, based on the results summarized in Table II. Here there are once again three groups of clustered proteins, A', B', and C'. The important practical consequence of these conclusions is that a laboratory beginning work with a reversed-phase column can use the results of Tables I and II to tentatively assign the identities of the proteins in the eluted peaks. Applications As already mentioned, RP-HPLC has proved to be extraordinarily useful for both the analysis and preparation of ribosomal proteins. Analytically, it has been used to compare the protein composition of native and
[36]
RP-HPLC OF RIBOSOMAL PROTEINS
531
TABLE II ORDER OF L PROTEIN ELUT1ON FROM R P - H P L C COLUMNS a
Column elution order L protein
RP-P b
group
C,s
RPSC c C3
RP-TP a Cls
34 32 33 27
34 32 33 27
34 33 32 27
--
Group A'
t
Group B'
t Group C'
31
24 28 26 25 19 14 30 13 21
E E E /
24 28 -25 19 ~14 30 1~
--
24 28 -25 19 [___2 2 18 30
17 3 18
17 3 18
22 23 29
22 23 29
~22
6 9 15 16 11
6 15 16
["-" 9 ~ 15 16
["-'- 1 L...._ 5
6
!
11
1
5 20 4 10 12 7
20 10 ~ 4 L__ 9* 12 7
2
23 29
5 20 I'-'-- 4 L____10 12 7
a L34 is first and L7 is last. b From Ref. 10. c From Ref. 13. As noted, protein L9 comes in a non-standard position. d From Ref. 5. Only in this chromatogram is 2-propanol used as the eluting solvent.
532
[37]
ISOLATION OF RIBOSOMAL PROTEINS
reconstituted ribosomal subunits, 9,H to compare ribosomal proteins obtained from different bacterial strains, 12 and to identify covalently modified proteins, derivatized either in an enzyme-catalyzed process (methylation ~2 or phosphorylation~4) or via affinity labeling) a,H,2° In general, the modified protein is identified by a radioactive label in the modifying group. However, when the modifying group contains a good chromophore, it is also possible to detect the modified protein optically.2~ From a preparative standpoint, the two most interesting results are first, that 30S and 50S subunits can be reconstituted from RP-HPLC-prepared proteins~O,~~,19and second, that RP-HPLC can resolve modified ribosomal proteins from unmodified proteins. H,~9These results make it quite feasible to perform reconstitution experiments testing the effects of the elimination of one or more proteins, or the replacement of native with modified protein, 19on many aspects of ribosomal structure and function. RP-HPLC has also been used to prepare ribosomal proteins for microsequencing3-5,~4 and to prepare cross-linked proteins for identification by two-dimensional diagonal PAGE analysis.~3 20 C. Weitzmann and B. S. Cooperman, Biochemistry 24, 2268 (1985). 21 B. S. Cooperman, C. C. Hall, A. R. Kedavage, C. J. Weitzmann, J. Smith, T. Hasan, and J. D. Friedlander, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), pp. 362-378. Spdnger-Verlag, New York, 1986.
[37] I o n - E x c h a n g e H i g h - P e r f o r m a n c e L i q u i d Chromatographic Separation of Ribosomal Proteins
By M A L C O L M
S. CAPEL, D I P A K B. D A T T A , CONCEPCION and GARY R. CRAVEN
R.
NIERRAS,
Until recently, the method of choice for large-scale separation of ribosomal proteins was carboxymethyl (CM)-cellulose 1 or phosphocellulose2 ion-exchange, in the presence of urea. Although these procedures gave very good resolution of small and large subunit proteins in high yield, purification of gram quantifies of 30S or 50S protein usually required very long separation times (weeks) and large volumes of eluant (tens of liters). Furthermore, the large number of relatively dilute fractions produced by the procedure presented real logistical problems for the user. In addition, the long times involved meant that proteins were exposed to the risk of oxidaP. B. Moore, this series, Vol. 59, p. 639. 2 S. J. S. Hardy, C. J. Kurland, P. Voynow, and G. Mora, Biochemistry8, 2897 (1969). METHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allfightsof reproductionin any formreserved.
532
[37]
ISOLATION OF RIBOSOMAL PROTEINS
reconstituted ribosomal subunits, 9,H to compare ribosomal proteins obtained from different bacterial strains, 12 and to identify covalently modified proteins, derivatized either in an enzyme-catalyzed process (methylation ~2 or phosphorylation~4) or via affinity labeling) a,H,2° In general, the modified protein is identified by a radioactive label in the modifying group. However, when the modifying group contains a good chromophore, it is also possible to detect the modified protein optically.2~ From a preparative standpoint, the two most interesting results are first, that 30S and 50S subunits can be reconstituted from RP-HPLC-prepared proteins~O,~~,19and second, that RP-HPLC can resolve modified ribosomal proteins from unmodified proteins. H,~9These results make it quite feasible to perform reconstitution experiments testing the effects of the elimination of one or more proteins, or the replacement of native with modified protein, 19on many aspects of ribosomal structure and function. RP-HPLC has also been used to prepare ribosomal proteins for microsequencing3-5,~4 and to prepare cross-linked proteins for identification by two-dimensional diagonal PAGE analysis.~3 20 C. Weitzmann and B. S. Cooperman, Biochemistry 24, 2268 (1985). 21 B. S. Cooperman, C. C. Hall, A. R. Kedavage, C. J. Weitzmann, J. Smith, T. Hasan, and J. D. Friedlander, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), pp. 362-378. Spdnger-Verlag, New York, 1986.
[37] I o n - E x c h a n g e H i g h - P e r f o r m a n c e L i q u i d Chromatographic Separation of Ribosomal Proteins
By M A L C O L M
S. CAPEL, D I P A K B. D A T T A , CONCEPCION and GARY R. CRAVEN
R.
NIERRAS,
Until recently, the method of choice for large-scale separation of ribosomal proteins was carboxymethyl (CM)-cellulose 1 or phosphocellulose2 ion-exchange, in the presence of urea. Although these procedures gave very good resolution of small and large subunit proteins in high yield, purification of gram quantifies of 30S or 50S protein usually required very long separation times (weeks) and large volumes of eluant (tens of liters). Furthermore, the large number of relatively dilute fractions produced by the procedure presented real logistical problems for the user. In addition, the long times involved meant that proteins were exposed to the risk of oxidaP. B. Moore, this series, Vol. 59, p. 639. 2 S. J. S. Hardy, C. J. Kurland, P. Voynow, and G. Mora, Biochemistry8, 2897 (1969). METHODSIN ENZYMOLOGY,VOL. 164
Copyright© 1988by AcademicPress,Inc. Allfightsof reproductionin any formreserved.
[37]
ION-EXCHANGE OF RIBOSOMAL PROTEINS
533
tion of sulfhydryl groups or irreversible chemical modification by cyanate, produced by the decomposition of urea present in the eluants. The biochemical community, at large, has benefited greatly from recent developments in high-performance liquid chromatography (HPLC) for protein and nucleic acid separation. HPLC methods are typically very efficient, in terms of both speed and resolution. In addition, HPLC methods are intrinsically automated, a feature which greatly improves their reproducibility and reduces their time investment. Reversed-phase HPLC methods for separation of bacterial ribosomal proteins have been reported by two groups. 3-5 Both methods provide rapid and highly efficient separations of Escherichia coli 30S and 50S ribosomal subunit proteins. However, the resolution achieved by both of these protocols deteriorates markedly at total protein loads of a few tens of milligrams (1 cm diameter columns). Upward scaling of the method cannot be effected without substantial increases in column cross section, which mandates large increases in eluant volume. A recently introduced sulfopropyl cation-exchange support has made possible the development of HPLC methods for very large-scale separations of ribosomal proteins. 6 The protocols described below permit the separation of hundreds of milligrams of 30S or 50S proteins in a matter of hours, in volumes less than 1 liter. Individual protein fractions are recoverable in a few milliliters, with nearly 100% recovery efficiency. Proteins are separated in the presence of 8 M urea, but are as competent in ribosomal subunit reconstitution as proteins separated by the conventional CM-cellulose chromatography. Subunit Purification, Protein Extraction Ribosomes were obtained from E. coli cells (strains MRE-600 or HPR-13) harvested in log phasef1,7 30S and 50S subunits were purified on hyperbolics or equivolumetdc9 gradients in a TI- 15 zonal rotor. Ribosomal proteins were extracted from purified subunits by LiCl-urea ~° or acetic acid 2 precipitation ribosomal RNA. 3 A. R. Kerlavage, L. Kahan, and B. S. Cooperman, Anal Biochem. 123, 342 (1982). 4 R. J. Ferris, C. A. Cowgill, and R. R. Traut, Biochemistry 23, 3434 (1984). 5 A. R. Kedavage, C. J. Weitzmann, T. Hasan, and B. S. Cooperman, J. Chromatog. 266, 255 (1983). 6 M. S. Capel, D. Datta, C. R. Nierras, and G. R. Craven, AnaL Biochem., 158, 179 (1986). 7 G. R. Craven and V. Gupta, Proc. Natl. Acad. Sci. U.S.A. 63, 1329 (1970). a p. S. Sypherd and J. W. Wireman, this series, Vol. 30, p. 349. 9E. F. Eikenberry, T. A. Bickle, R. R. Traut, and C. A. Price, Eur. J. Biochem. 12, 113 (1970). ,o p. Spitnik-Elson, Biochem. Biophys. Res. Commun. 18, 557 (1965).
534
ISOLATION OF RIBOSOMAL PROTEINS
[37]
Ion-Exchange High Performance Liquid Chromatography Solutions Eluant A: 8 M urea (Ultrapure, Schwarz-Mann), 100 m M KH2PO4, 6 m M 2-mercaptoethanol, pH 5.6 (adjusted with 400/0 methylamine) Eluant B: 8 Murea, 1.0 Murea, 1.0 MKC1, 100 mMKH2PO4, 6 m M 2-mercaptoethanol, pH 5.6 All solutions for HPLC were formulated using deionized water (18 Mf~ resistance), supplied by a Milli-Q deionizer (Millipore). Solutions were carefully filtered through 0.45-/tm nylon filters into dust-free glass vessels. After filtration pH was readjusted to 5.6 with either phosphoric acid or 400/0 methylamine.
HPLC System TSK SP-5-PW ion-exchange column (21.5 mm diameter, 150 mm length, from Bio-Rad or Beckman)
HPLC Fluidics Pump and plumbing must be capable of delivering an eluant flow of 1.5 ml/min and tolerate prolonged exposure to 8 M urea, and 1 M KC1. HPLC components whose solvent-exposed elements are made from titanium are preferable to those employing 316 stainless steel. HPLC pumps are available with a system that actively washes the air side of the pump piston, thereby preventing erosion of pump seals by urea and salt crystals that build up on the piston. These specifications exact higher initial cost for the HPLC fluidics but result in much lower maintenance. SP-5-PW columns are shipped containing 2-propanol. New columns are eluted with a gradient starting at 100% 2-propanol and ending with 100% deionized water. After conversion to water, columns are washed with a minimum of 20 column volumes of water (2- 5 ml/min). The mobile phase is then converted to eluant A, using a gradient starting at 100% deionized water, ending in 100% Eluant A. Immediately following all separations, SP-5-PW columns are converted back to deionized water (via a gradient), as are all HPLC fluidics and plumbing. Gradients are employed in all radical changes of mobile phase composition in order to minimize osmotic effects on the packing of the column support. Columns are stored in 80% deionized water, 20% HPLC-grade methanol. The manufacturer strongly recommends that the SP-5-PW not be exposed to concentrations of halide salts greater than 0.7 M. An in-line 0.5-/zm filter is
[37]
I O N - E X C H A N G E O F RIBOSOMAL P R O T E I N S
535
installed immediately upstream of the column to protect against particulates. Columns are fitted with a water jacket to permit temperature regulation.
Separation Procedure Lithium chloride-Urea solutions of small or large ribosomal proteins are dialyzed exhaustively against eluant A. Dialyzates are concentrated to 10 mg protein/ml using a YM2 (exclusion limit 2000 Da) ultrafiltration membrane (Amicon). Supernatants from acetic acid extracts of ribosomal subunits are first dialyzed against 5% acetic acid and then lyophilized. Dry powders were then dissolved in a sufficient volume of eluant A to yield a final concentration of 10 mg total protein/ml. Particulate material was removed from final protein mixtures by sedimentation at 25,000 g for 30 min at 4 °. SP-5-PW columns were equilibrated for a minimum of 20 min against eluant A, with a flow of 1.5 ml/min, at ambient temperature or 6 °. Sample was loaded onto the column in one of two ways. In the first, the eluant A pump-inlet line was fitted with a three-way valve that permitted selection between the eluant A reservoir or a line connected to a small sample reservoir. Sample injection in this case was effected by simply connecting the pump to the sample reservoir during sample loading. In the second method of injection, a single piston pump (Eldex A-30-s) was connected downstream of the main eluant pump via a high-pressure three-way valve (SSI 02-125). Sample was loaded on the column by mixing the output of the sample pump with that of the eluant pump. The advantage of the second method of injection is that the eluant pump is not exposed to the risk of check valve damage or fouling from particulates present in the sample. In either case, an arbitrary volume of sample may be loaded onto the column, but typical sample volumes were 20-50 ml, loaded at 0.5 ml/ min. Total protein loads varied from 50 to 300 mg. After introduction of the sample, eluant A was pumped through the column until an absorbance increase was detected ("breakthrough," at approximately 35 ml). At this point the gradient program was initiated. For separation of 30S protein, the gradient program consisted of a linear ramp from 100% eluant A to 35% eluant B in 600 min. For separation of 50S subunit proteins the ramp was extended to 53% eluant B, with a duration of 900 min. The gradient was followed by a ramp to 70% eluant B, held for 20 min, and then ramped back to 100% eluant A in 20 min. A flow rate of 1.5 ml/min was employed throughout. The eluant was continuously monitored at 230 nm using a variable-wavelength detector with l-cm pathlength.
536
[37]
ISOLATION OF RIBOSOMAL PROTEINS
3.0 3,7
6
A23o 1.5
0
o
do
'
~io
~o
2~o
'
aoo
FRACTION NO.
FIG. 1. Absorbance trace (230 nm) of the elution of 100 mg total E. coli 30S ribosomal subunit proteins from the SP-5-PW ion-exchange column. Numbers identify small subunit proteins in the standard nomenclature. Fractions were collected over 2-rain intervals. Gradient program: 0% eluant B to 35% eluant B, in 600 rain, initiated at fraction number 0 (breakthrough). Flow rate, 1.5 ml/min; temperature, 25 °.
Separation of 30S Ribosomal Proteins Figure 1 shows the absorbance trace of an SP-5-PW separation of 100 mg of total E. coli 30S ribosomal subunit proteins. Table I presents the order of elution for 30S and 50S proteins. The identities of proteins contained in absorbance peaks were ascertained by a combination of oneTABLE I ELUTIONORDER OF 30S AND 50S RIBOSOMALPROTEINSFROMTHE SP-5-PW ION EXCHANGERAT pH 5.6 Protein mix
Elution order
30S
Sla, $8, $6, Slb, $5, SI0, S17, $2, S16, $7+$3, $4, Sl5, S19, Sll, S18 + $9, Sl4, S12, $21, Sl3, $20 L7 + Ll2 + L9, LI0 + L11, L9, L29, L6, LS, L3 + L4 + L23 + L25, L3, L1, L24 + L14, Ll3, L4 + L30, L19, L24, L27, L32 + L33, L27 + L28, L18, LI5, L22, L2, L16 + L17, L20, L34
50S
[37]
ION-EXCHANGE OF RIBOSOMAL PROTEINS
537
and two-dimensional gel electrophoresisH and reversed-phase HPLC. 3,6 The 21 small subunit proteins were resolved into 18 peaks. Peak volumes were typically about 5 - l0 ml. The large absorbance peak that occurred at breakthrough did not contain ribosomal protein. Somewhat surprisingly, the elution order of 30S proteins separated by the SP-5-PW is very nearly identical to that obtained with CM-cellulose ion-exchange chromatography at the same pH. Separations carried out at 6 ° had the same elution order as separations run at ambient temperature, although some narrowing of peak widths was observed at lower temperature. The method of protein extraction had no effect on elution order. A protein electrophoretically identical to S 1 was found to elute in two peaks, before and after $8 and $6. At pH 5.6 $3 coelutes with $7, and $9 coelutes with S 18. Both of these two pairs of proteins are readily resolved, at good yield, by preparative-scale reversed-phase HPLC, using a procedure based on that described by Kerlavage et al. (see below). 3,5 We have separated as much as 400 mg of total 30S protein in a single run, with the SP-5-PW and the elution system described above. Substantial peak broadening was encountered with such loads, causing loss of resolution, but the elution order remained invariant. Peak fractions, containing more than one protein were subjected to reversed-phase HPLC, as explained above, or by SP-5-PW ion-exchange HPLC following dialysis against eluant A.
Recovery Efficiency of Ribosomal Proteins Recovery efficiencies are estimated by separating a 50-mg quantity of total 30S protein with the SP-5-PW column. The entire eluted volume is collected, concentrated to 50 ml with a YM2 ultrafiltration membrane, dialyzed against eluant A, and separated again, by ion-exchange HPLC. The elution traces of both runs are digitized and the resultant data are deconvoluted as a sum of Gaussians, using a Marquardt nonlinear parameter fitting algorithm. 12 The areas of Gaussians representing individual proteins are normalized to the aggregate area and the ratios of the normalized areas from the second and first runs are used to estimate recovery. The average of the apparent recovery of all 21 30S proteins is 100%. The lowest apparent recovery is 80%. Variability of recovery efficiency measurements between three replicates is between l0 and 15%. There is no correlation between molecular weight or retention time of 30S proteins, and their apparent recovery. In contrast, for reversed-phase separations of ribosomal 11 E. Kaltschmidt and H. G. Wittman, Anal. Biochem. 36, 401 (1970). 12 p. R. Bevington, "Data Reduction and Error Analysis for the Physical Sciences," McGrawHill, New York, 1969.
538
ISOLATION OF RIBOSOMAL PROTEINS
[37]
proteins, recovery is found to be inversely correlated with both molecular weight and retention time of separated components. Obviously, the method used to measure recovery cannot distinguish between losses due to inefficient recovery from the column or losses incurred during ultrafiltration, prior to rechromatography.
Reversed-Phase Repurification of Ion-Exchange Fractions Solutions RP-eluant A: 0.1% (w/v) trifluoroacetic acid (Pierce, Sequanol grade), in 18 Mf~ deionized water RP-eluant B: 0.1% trifluoroacetic acid in acetonitrile (Baker or Aldrich, HPLC grade) Fractions from ion-exchange HPLC containing more than one protein are purified by reversed-phase HPLC using a modified version of the elution system described by Kerlavage? ,5 Peak fractions containing $3 + $7 or $9 + S18 are loaded directly onto 1.0-cm diameter Synchropak RPP Cm (Synchrome), using either of the sample injection schemes described above, and eluted with a gradient of RP-eluant A against RP-eluant B. Prior to sample injection, the RPP C~8 column is exhaustively equilibrated against RP-eluant A. Two to three mililiters of eluant A is then injected on the column, followed by the SP-5-PW fraction undergoing repurification. Finally, another 2 - 3 ml of eluant A is injected. The RPP C m column is then washed with RP-eluant A until eluant A breakthrough is detected. Two gradient programs are used to elute Cm columns. The first consists of a gradient from 100% RP-eluant A to 45% RP-eluant B, with the rate of change of acetonitrile versus water depending on the proteins being separated (maximum ramp rate 0.1% acetonitrile/min). The second elution system is a modified version of the convex gradient described by Kerlavage et al. ~3A flow rate of 2.5 ml/min is used. Peak fractions from reversed-phase separations are consolidated and protein recovered by lyophilization. Figure 2 shows the absorbance trace of a reversed-phase separation of an $3 + $7 fraction obtained by SP-5-PW ion exchange.
Reassembly of 30S Subunits from Proteins Separated by Ion-Exchange HPLC Solutions Buffer A: 6 M guanidinium HCI, 20 m M MgCI2, 10 m M Tris-HCl, 6 m M 2-mercaptoethanol, pH 7.5
[37]
ION=EXCHANGE OF RIBOSOMAL PROTEINS
539
1.o,
A23o 0.5
o
~ 0
50 TIME (rain)
100
Fio. 2. Absorbance profile of preparative reversed-phase purification of $3 + $7 fraction obtained by ion-exchange HPLC of total 30S protein. Elution parameters: concave gradient from 100% RP-eluant A to 45% RP-eluant B, in 100 min; flow rate, 2.5 ml/min; ambient temperature.
Buffer B: 1 MNH4CI, 20 mMMgC12, 10 mMTris-HC1, 6 mM2-mercaptoethanol, pH 7.5 Buffer C: 0.1 M NH4C1, 20 mM MgC12, 10 m M Tris-HC1, pH 7.5 30S proteins separated by SP-5-PW ion-exchange HPLC are tested for their ability to participate in reassembly of active 30S ribosomal subunits. Proteins are extracted from 30S ribosomal subunits isolated from cultures grown on 100% D20, I and resolved by ion-exchange HPLC. Separated proteins are concentrated to 15 mg/ml by ultrafiltration and dialyzed exhaustively against buffer A. The dialysate is then equilibrated against buffer B. Equilibration with buffer A must be complete before the changeover to buffer B or precipitation of MgNH4PO 4 will occur, causing occlusion of the pores of the dialysis membrane. Dialyzed proteins are mixed with 3.4 volumes of buffer C, containing 16S ribosomal RNA at 10 A2eo units/ml (2 equivalents of protein/equivalent rRNA). Mixtures are incubated for 4 hr with constant agitation at 40 °. Reconstituted subunits are pelleted and purified on 10% isokinetic sucrose
540
[37]
ISOLATION OF RIBOSOMAL PROTEINS
-r o (D
I
co
o !
Fro. 3. Sucrose gradient analysis of 30S subunits reconstituted from perdeuterated ribosomal proteins separated by SP-5-PW ion-exchange HPLC. A trace quantity of tritium-labeled native 30S subunits from cultures grown on H20 was added as a sedimentation marker. Solid fine: absorbance at 260 nm, arbitrary units; dots: counts/min tritium, arbitrary units. Offset between absorbance and radioactivity is due to the greater density of deuterated 30S subunits.
gradients 13 containing 0.5 m M MgC12, 10 m M KC1, 10 m M Tris-HCl, pH 7.5, 6 m M 2-mercaptoethanol. Figure 3 shows the absorbance trace of such a gradient. Reconstituted subunits are mixed with a trace amount of tritiated native 30S ribosomal subunit as internal standard. In this analysis, reconstituted 30S particles sediment ahead of marker subunits due to the fact that deuterated 30S particles are substantially more dense than hydrogenated subunits. Reconstituted 30S particles have activities in poly(U) directed polyphenylalanine synthesis similar to that of particles reconstituted from proteins isolated via CM-cellulose ion exchange. 30S subunits reconstituted from proteins separated by CM-cellulose ion-exchange show 50% of the activity of native subunits. 30S subunits reconstituted from proteins obtained from ion-exchange HPLC are 47% (range: 32-65%) as active as native subunits. 13K. S. MeCarty, Jr., R. T. Vollmer, and K. S. McCarty, Anal Biochem. 61, 165 (1974).
[37]
ION-EXCHANGE OF RIBOSOMAL PROTEINS
541
Separation of 50S Subunit Proteins Figure 4 shows the separation of 100 mg of total protein extracted from 50S ribosomal subunits by the SP-5-PW column. The total separation time was 900 min. the gradient program consisted of a hnear ramp from 0 to 53% eluant A, using the same rate of change of eluant composition as employed in 30S protein separations. The elution order of 50S proteins is listed in Table I. The 33 proteins of the E. coli 50S subunit are resolved into 25 major peaks. All proteins have been identified in the elution by reversed-phase HPLC and gel electrophoresis, with the exception of L21 and L31. Proteins with electrophoretic mobilities equal to those of L3, L4, L9, L24, and L27 are identified in more than one absorbance peak. It is not clear whether interprotein interactions, differences in the degree of denaturation or chemical heterogeneity (e.g., differences in posttranslational modification or partial proteolysis) are responsible for this behavior. Recovery efficiencies for 50S proteins from the SP-5-PW are determined by the same method used for 30S proteins. Again, the apparent recovery efficiency for most proteins is 100% to within measurement error, with a low of 80%. There is no correlation between recovery efficiency and either molecular weight or retention time.
F~7,
12,9
"5
13
qll J l~'WllI
23
2
A230
k
,
24
14 9 29
27 22/11 24 3 2 / ~ 18
1.5.
27
34
5
o 0
60
120 FRACTION
180 NO.
240
300
FIG. 4. Absorbance trace of SP-5-PW separation of 100 mg total protein extracted from 50S ribosomal subunits. Fraction interval was 3 rain, flow rate 1.5 ml/min. A linear ramp from 0% eluant B to 53% eluant B was initiated at fraction 0, with a duration of 900 min.
542
ISOLATION OF RIBOSOMAL PROTEINS
[38]
[38] R i b o s o m a l P r o t e i n s f r o m A r c h a e b a c t e r i a : H i g h Performance Liquid Chromatographic Purification for Microsequence Analysis B y ROZA MARIA K.AMP a n d BRIGITTE WITTMANN-LIEBOLD
Introduction The first amino acid sequence determinations of ribosomal (r) proteins were begun in the early 1970s. At that time it was only possible to investigate ribosomal constituents from organisms that could be grown in sufficient amounts for ribosome purification. For example, 100 g of Escherichia coli cells corresponding to 1.8 g of 70S ribosomes yielded only a few milligrams of purified protein after column chromatography on carboxymethyl (CM)-cellulose and gel filtration in 6 M urea, with final desalting steps.I Several weeks were required for these purifications; identification of the proteins was done by a two-dimensional polyacrylamide gel electrophoresis procedure developed for this purpose. 2 Sequence analysis of these proteins was only possible with systematic improvements of the methodology of the liquid-phase sequencer performance for N-terminal microsequence analysis, 3 the development of thinlayer techniques for peptide purification,4 attachment of small peptides to solid support for sequencing,5 and availability of amino acid analysis in the nanomole range,6 all of which facilitated extended or complete sequence analysis of E. coli r-proteins. 7 However, these methods were still inadequate for structural analyses of r-proteins derived from other sources; accordingly, only a few sequences of r-proteins other than those of E. coli were determined, whereas the 52 proteins from E. coli ribosomes were sequenced completely using these H. G. Wittmann, in "Ribosomes" (M. Nomura, A. Tissi~es, and P. Lengyel, ¢ds.), p. 93. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1974. 2 E. Kaltschmidt and H. G. Wittmann, Anal. Biochem. 36, 401 (1970). 3 B. Wittmann-Liebold,in "Polypeptide Hormones" (R. F. Beers and E. G. Bassett, eds.), p. 87. Raven, New York, 1980. 4 B. Wittmann-Liebold, D. Brauer, and J. M. Dognin, in "Solid Phase Methods in Protein Sequence Analysis" (A. Previero and M. Previero-Coletti, exis.), p. 219. Elsevier, Amsterdam, 1977. s R. A. Laursen, Fur. J. Biochem. 20, 89 (1971). 6 j. R. Benson, in "Instrumentation in Amino Acid Sequence Analysis" (R. N. Perham, cd.), p. 1. Academic Press, London, 1973. 7 L. Giri, W. E. Hill, H. G. Wittmann, and B. Wittmann-Liebold, Adv. Protein Chem. 36, 1 0984). I
METHODS IN ENZYMOLOGY, VOL. 164
Col~'ight © 1988 by Academic Press, inc. All rights of reproduction in any form l~'served.
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
543
techniques (for a review, see Ref. 7). This situation has been changed radically with the development of sensitive high-performance liquid chromatography (HPLC) techniques which separate proteins and peptides in short times and with high resolutionS; HPLC is now the method of choice for purification of r-proteins for microsequence analysis if the source of ribosomes is limited. HPLC methods initially were applied to separate r-proteins from E. coil, a-13 but more recently also to those of eukaryotic ribosomes.~4,~5These purifications were done exclusively on an analytical scale. For sequence analysis, r-proteins derived from Bacillus stearothermophilus and Halobacterium marismortui were separated by analytical reversed-phase HPLC ~3,~6and by semipreparative HPLC.~7 Here we describe the application of HPLC methods for the separation of Methanococcus vannielii r-proteins and r-proteins of other archaebacteria. Ribosomes from archaebacteria are only available in scarce amounts and hence, HPLC techniques are the method of choice to separate their protein components. N-Terminal sequence analysis of these proteins facilitated the synthesis of oligonucleotide probes for location and isolation of the respective genes; such as M. vannielii protein Ll2 ~s as described in this chapter. Complete sequences were obtained using DNA sequence determination as a complementary technique to amino acid sequencing (Ref. 18 and unpublished results). It is anticipated that sequence data from archaebacterial organisms will help to answer questions about the evolution of these bacteria and their relationship to eubacteria and eukaryotes. As yet, the evolutionary status of this class of organisms is not clear; these organisms share some properties with the eubacterial kingdom, others with that of eukaryotes. Since ribosomes occur in all organisms and perform a s F. E. Regnier, this series, Vol. 91, p. 137. 9 R. M. Kamp, Z. Y. Yao, A. Bosserhoff, and B. Wittmann-Liebold, Hoppe-Seyler's Z. Physiol. Chem. 364, 1777 (1983). lo R. M. Kamp and B. Wittmann-Liebold, FEBS Lett. 167, 59 (1984). 11 A. R. Kedavage, L. Kahan, and B. S. Cooperman, Anal. Biochem. 123, 342 (1982). 12A. R. Kedavage, C. J. Weitzmann, T. Hasan, and B. S. Cooperman, J. Chromatogr. 266, 225 (1983). 13 R. M. Kamp, A. Bosserhoff, D. Kamp, and B. Wittmann-Liebold, J. Chromatogr. 317, 181 (1984). 14 R. J. Ferris, C. A. Cowgill, and R. R. Traut, Biochemistry 23, 3434 (1984). 15 A. R. Kerlavage, C. J. Weitzmann, M. Cannon, T. Hasan, K. M. Giangiacomo, J. Smith, and B. S. Coopermann, Biotechniques 3, 26 0985). 16 R. M. Kamp, J. Brockm611er, and B. Wittmann-Liebold, Chromatographia 22, 249 (1986). 17 H. Hirano, K. Eckart, M. Kimura, and B. Wittmann-Liebold, Eur. J. Biochem. 170, 149 (1987). 18 O. Strobel, A. K6pke, R. M. Kamp, A. Bfck, and B. Wittmann-Liebold, J. Biol. Chem., in press.
544
ISOLATION OF RIBOSOMAL PROTEINS
[38]
central role in protein biosynthesis, comparative structural investigations on ribosomal constituents will shed light on the organization and function of the central domains of these organelles. For sequence determinations of archaebacterial r-proteins, HPLC isolation procedures were supplemented by microgel polyacrylamide electrophoresis for identification of specific proteins in eluates from HPLC columns. Peptide purification and analysis methods must be sensitive and of high resolution and manual and automated sequencing techniques applicable to small quantities of material. Recently, this combined approach was used to isolate peptide fragments from several E. coli and B. stearothermophilus r-proteins that proved difficult to purify by recent methods; as a result, reversed-phase HPLC facilitated the completion of the sequence analysis of these r-proteins. 7,~7,19,2° In this chapter, we report the application of HPLC methods to the separation of peptide mixtures from the L12 homolog from the large subunit of M. vannielii ribosomes. Further, different HPLC techniques, namely size exclusion, reversed-phase, and ion-exchange chromatography are discussed for their ability to resolve different archaebacterial r-protein mixtures. For the identification of proteins after HPLC fractionation, a gel system suitable for archaebacterial protein mixtures21 was miniaturized so that particular proteins could easily be identified using only small aliquots of the peaks (nanogram amounts) in order to conserve valuable materials for other purposes.22,23Yields of proteins were calculated by amino acid analysis using precolumn derivatization with o-phthaldialdehyde and reversedphase HPLC. 24 Microsequencing of achaebacterial r-proteins was performed by liquidphase sequencing in a Berlin sequencer25 designed with an isocratic on-line
19j. Reinbolt, N. Hounwanou, Y. Boulanger, B. Wittmann-Liebold, and A. Bosserhoff, J. Chromatogr. 259, 121 (1983). 2o R. M. Kamp, Z. Y. Yao, and B. Wittmann-Liebold, Hoppe-Seyler's Z. Physiol. Chem. 364, 141 (1983). 2t D. Geyl, A. B6ck, and K. Isono, Mol. Gen. Genet. 181, 309 (1981). J. Brockm611erand R. M. Kamp, Biol. Chem. Hoppe-Seyler 366, 901 (1985). 23j. Brockm611er and R. M. Kamp, in "Advanced Methods in Protein Microsequence Analysis" (B. Wittmann-Liebold, J. Salnikow, and V. A. Erdmann, eds.), p.34. SpringerVerlag, Berlin, Federal Republic of Germany, 1986. u K. Ashman and A. Bosserhoff, in "Modern Methods in Protein Chemistry" (H. Tschesche, ed.), Vol. 2, p. 155. de Gruyter, Berlin, Federal Republic of Germany, 1985. 25B. Wittmann-Liebold, in "Modern Methods in Protein Chemistry" (H. Tschesche, ed.), p. 229. de Gruyter, Berlin, Republic of Germany, 1983.
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
545
HPLC detection system for the identification and quantitative determination of the released amino acid derivatives. 26,27 In addition, manual and solid-phase degradation employing the sensitive 4 - N , N ' - d i m e t h y l a m i n o a z o b e n z e n e 4'-phenyl isothiocyanate/phenyl isothiocyanate (DABITC/PITC) double-coupling method 2s-31 were used for purity control on the isolated proteins, for N-terminal sequencing, and peptide sequence determinations. Using the HPLC methods for archaebacterial protein and peptide separations described in this chapter, it is possible to arrive at new sequence data of proteins that would not be feasible without the advanced methodology. The applied methods are suitable not only to structural investigations on r-proteins but also to studies of other proteins of limited sources e.g., multienzyme complexes, receptor proteins, or protein constituents of other cell organdies. Experimental P r o c e d u r e s Materials
30S and 50S subunit proteins and protein A from M. vannielii DSM 1224 were a gift from Dr. A. B6ck and O. Strobel (University of Munich, FRG), Sulfolobus acidocaldarius ribosomes or r-proteins were obtained from Dr. R. Reinhardt, and H. marismortui proteins were from Dr. M. Kimura, both from this institute. The organic solvents of the mobile phases for the HPLC separations are Uvasol or LiChrosolv grade (Merck, Darmstadt, FRG); trifluoroacetic acid (TFA) (Fluka, Buchs, Switzerland) is redistilled from CaSO4-0.SH20 (dried at 500 °) over a 30-cm column filled with glass rings, bp 7 2 - 7 3 °. All other chemicals are analysis grade (Merck). Methods
The aqueous buffers are prepared with deionized water from a MiI1-Q water purification system (equipped with ION-EX and Super C carbon 26B. Wittmann-Liebold and K. Ashman, in "Modem Methods in Protein Chemistry" (H. Tschesche,ed.), Vol. 2, p. 303. de Gruyter, Berlin, FederalRepublicof Germany, 1985. 27K. Ashman and B. Wittmann-Liebold, FEBS Left. 190, 129 (1985). 28j. y. Chang, D. Brauer, and B. Wittmann-Liebold,FEBS Lett. 93, 205 (1978). 29B. Wittmann-Lieboldand M. Kimura, in "Methodsin MolecularBiology"(J. M. Walker, ed.), p. 221. Humana, 1984. 3oj. Salnikow,A. Lehmann, and B. Wittmann-Liebold,Anal. Biochem. 117, 433 (1981). 3t A. Lehmann and B. Wittmann-Liebold, FEBS Lett. 173, 360 (1984).
546
ISOLATION OF RIBOSOMAL PROTEINS
[38]
cartridges) purchased from millipore (Bedford, MA). All buffers containing salt or urea are filtered through a 0.45-gm filter type HA placed in a sintered glass vacuum filter (Millipore). The aqueous buffers are degassed carefully employing a water pump vacuum, and the organic modifiers are degassed by sonification prior to use. The buffers in each reversed-phase system are continuously degassed using a degasser (ERMA Optical Works, Tokyo, Japan). All aqueous buffers contain sodium azide at a concentration of I mg per liter to inhibit microbial growth. Ammonium acetate buffer, 0.1 M, pH 4.1, is made from aqueous ammonia solution and acetic acid, and ammonium formate buffer from aqueous ammonia and formic acid. The buffer reservoirs are equipped with 2.0-gin steel filters (Knauer, Berlin). Tables I-III list the HPLC columns employed, the suppliers of the columns and supports, and other properties. The columns filled in our laboratory are packed with a Shandon packing apparatus (Cheshire, UK) in a slurry of heptane as described. 19 Empty Vertex steel columns are purchased from Knauer.
Size Exclusion Chromatography The size exclusion HPLC system consists of a HPLC pump, model 6000A (Waters Assoc., Milford, MA) equipped with a microflow head, a Rheodyne injection valve, no. 7120 (Rheodyne, Berkeley, CA) and the variable wavelength detector Jasco Uvidec-100-II (Biotronik, Munich, FRG). A precolumn filled with reflux beads (Kristall Dragon Werk, Bayreuth, FRG) is installed between pump and injection valve to trap contaminants from the pump. The separation is performed on a TSK 2000SW column purchased from Bio-Rad, Richmond, CA, particle size 10,/zm, pore size 125 A, column size 300 × 7.5 mm id). The eluant is 0.1 M ammonium acetate buffer, pH 4.1.
Reversed-Phase Chromatography Chromatography with reversed-phase columns is carried out on a Liquid Chromatograph 850 (Dupont, Wilmington, DE) equipped with a variable wavelength spectrophotometer (Dupont 852) and an automatic sampler (Wisp 710A, Waters Assoc., Milford, MA) as well as a solvent degasser from ERMA Optical Works (Tokyo, Japan) and a chart recorder BD9 or BD41 (Kipp and Zonen, Sch6nberg, Taunus, FRG). The flow rate is set between 0.5 and 1.0 ml/min and the column temperature is kept at 35 °. Proteins are eluted at 35 ° with gradients made from buffer A (0.1%
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
547
TFA in water) and buffer B (0.1% TFA in 2-propanol). Large peptides are eluted under the same conditions as proteins in gradients made from 0.05% TFA in water at pH 2.0 and 0.05% TFA in acetonitrile; alternatively they are made from ammonium formate, pH 7.5 (as starting buffer), and 80% methanol containing 20% aqueous buffer as organic modifier. For more details, see Ref. 19.
Ion-Exchange Chromatography The experiments with ion-exchange columns are performed using a gradient Liquid Chromatograph, model 324 (Beckman, Palo Alto, CA) equipped with two HPLC pumps (Altex 110A) and a variable wavelength UV detector, model 165, all purchased from Beckman (Munich, FRG). The aqueous buffers are prepared with deionized water from a MilI-Q water purification system in glass containers and filtered through a 0.45-/tm filter type HAWP from MiUipore. Proteins are eluted at 35 ° and flow rates of 1.0 ml/min for analytical runs and 5 ml/min for preparative runs.
Gel Electrophoresis Samples are dried in a Speed Vac Concentrator (Savant, Hicksville, NY) and then dissolved in sample buffer containing 8 M urea. Two-dimensional polyacrylamide gel electrophoresis is carried out in l0 X l0 cm sized gels2~ or, for nanogram range sensitivity, in 3 × 3 c m gels. 22,23 Coomassie Brilliant Blue R-250 is used to stain the gels.
Amino Acid Analysis The samples are hydrolyzed in ampoules sealed under vacuum in twice-distilled 5.7 M HC1 containing 0.02% mercaptoethanol at 110 ° for 20 hr. Amino acid analyses are performed in an OPA-precolumn derivatization HPLC system as described in Ref. 24.
Microsequencing Sequencing of small proteins is performed manually employing the DABITC/PITC double-coupling method28 as detailed in Ref. 29. Alternatively, the degradations are made by solid-phase sequencing, after attachment ofp-phenylene diisothiocyanate-activated aminopropyl glass, by the DABITC/PITC double-coupling method.3° The released red-colored amino acid derivatives are identified by thin-layer chromatography or isocratic HPLC. ~ Large proteins are subjected to automatic degradation in a Berlin liq-
548
[38]
ISOLATION OF RIBOSOMAL PROTEINS
uid-phase sequencer using a program with repeated coupling and cleavage at each degradation cycle.25 On-line detection of the phenylthiohydantoin derivatives of the amino acids is performed by injecting one-half to onequarter of the total amounts released by the degradation onto a Hypersil MOS-C8 coated silica column thermostated at 580.26 More recently, we have packed the column with 3/am Ca material (Spherisorb, Phase Sep., Queensferry, UK, purchased through Knauer, Berlin) or a LiChrospher Cs, 5/am column (Merck, Darmstadt) was used. The isocratic HPLC buffer contains 19.5% 2-propanol in water, 1% tetrahydrofuran, 10- 15 mM sodium acetate, pH 4.6, 0.05% SDS, and 10 mg dithioerythritol or C~s SH reagent per liter, for the separation of the PTH-amino acid derivatives. 27 This on-line system works in a recycling mode and 1 liter of HPLC buffer suffices for several weeks sequencer performance. Column life in the sequencers is more than 8 months in permanent use and up to 1.5 years, for several columns. Results of Ribosomal Protein Purification by HPLC
Size Exclusion Chromatography In general, size exclusion chromatography is the simplest separation technique for complex protein mixtures. The molecules are separated on a hydrophilic column support according to their molecular masses. Smaller proteins penetrate the pores of the support and will be retarded longer than larger proteins. The best commereiaUy available columns for separation of r-proteins are from Toyo Soda Corporation (Japan): TSK gel SW type, which is spherical porous silica with bonded hydrophilic polar groups stable in the range from pH 2.0 to pH 8.0; TSK gel PW type, which carries hydroxylated ether groups and is stable in the pH range of 2 to 12. The resolution on silica-based columns is generally higher than on organic-based material. Table I lists properties of different types of TSK columns. Usually, size exclusion columns are applied for prefractionation or isolation of proteins of different sizes. Figure 1 shows the group separaTABLE I PROPERTIES OF SIZE EXCLUSION TSK COLUMNSa TSK gel
Molecular mass (Da)
Pore size (A,)
Particle size (/zm)
G2000 SW G3000 SW G4000 SW
500-60,000 1,000-300,000 5,000 - 1,000,000
125 250 400
10 10 13
" F r o m Toyo Soda (Japan).
[38]
549
H P L C PURIFICATIONFOR MICROSEQUENCE ANALYSIS
P1
P2 P3 P4 P5
J .
0
. 30
.
.
. 60
90
RETENTION TIME (MIN)
P3
pl
9+
i"
•
-
z
: ""
-
"
[
"
]~;
"
FIG. 1. (a) Separation of 50S ribosomal proteins from M. vannielii on TSK 2000SW column (10/zm particle size, 125 A pore size, column size 300 X 7.5 ram). Approximately 1 mg total protein mixture was injected in 50/~1 of 2% acetic acid. The proteins were eluted with 0.1 M ammonium acetate buffer, pH 4.1, and a flow rate of 0.1 ml/min at ambient temperature. Absorbance was measured at 280 nm, the range was 0.32 absorption units full-scale (aufs). (b) Identification of pooled fractions corresponding to the different peaks of (a) by two-dimensional polyacrylamide gel electrophoresis.
550
[38]
ISOLATION OF RIBOSOMAL PROTEINS
tion of 50S r-proteins from M. vannielii and the corresponding two-dimensional electropherograms. The 36 proteins of that subunit are only separated into seven peaks. These peaks were pooled and rechromatographed on reversed-phase or ion-exchange columns (not shown). As the molecular mass of the r-proteins from this organism ranges from 7,000 to 30,000 Da, the TSK 2000SW column with pore size of 125 A and particle size of 10/zm was chosen. Ammonium acetate buffer, 0.1 M, pH 4.1, was used as eluant. The proteins eluted with this buffer were sufficiently low in salt to permit direct N-terminal sequencing after drying in a Speed Vac concentrator. Higher concentrations of salt in the buffer did not improve the resolution but prevented direct microsequencing. As revealed by the separations with r-proteins, the elution on silicabased columns not only depends on the molecular masses of the proteins but also on their net charges,s,'3 In this case free silanol groups repel acidic proteins but tend to adsorb the basic proteins more strongly. High salt concentrations can be used to suppress the ionic interaction between the support and the proteins. The recoveries of most of the r-proteins on TSK 2000SW were higher than 90%.
Reversed-Phase Chromatography Reversed-phase chromatography is the HPLC technique most widely applied for the separation of macromolecules. As shown for r-proteins of different sources it is a powerful technique for resolving complex protein mixtures. The proteins are well separated on hydrocarbonaceous (C4, Cs, C,s-alkylated or diphenyl) silica-based supports. Table II lists the properties TABLE II HIGH-PERFORMANCE REVERSED-PHASE SUPPORTSa FOR PROTEIN SEPARATION
Name Vydac TP-RP C4 Vydac TP-RP Cn Nucleosil 300-5 C4 Nucleosil 300-10 Ca TSK ODS- 120 T Baker diphenyl
Supplier The Separation Group, Hesperia, CA The Separation Group, Hesperia, CA Macherey-Nagel DOren, FRG Macherey-Nagel, Dflren, FRG Toyo Soda, Tokyo, Japan Baker, Phillipsburg, NJ
Support material in all cases is silica.
Bonded phase Hydrocarbon butyl phase Hydrocarbon octadecyl phase Hydrocarbon butyl phase Hydrocarbon butyl phase Hydrocarbon octadecyl phase Diphenyl
Particle size (#m)
Pore size (A)
5, 10
300
5, 10
300
5
300
10
300
5, l0
120
5
330
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
55 1
of some good spherical reversed-phase supports. We prefer to use spherical material that allows easy self-packing of columns to obtain reproducible separations (for more details, see Ref. 9). The use of silica derivatized with short alkyl side chains yields higher recoveries of the proteins. The use of small-sized particles in the support (5 g m instead of 10 gm) improves the resolution and sharpens the peaks in the chromatogram. Recent experiencea2,3a shows that the pore size diameter of the support must be 300 .~, or more to achieve protein separation. The same observations were made in separating E. coli r-protein mixtures. 13 Various aqueous buffers can be applied as eluants for reversed-phase HPLC. We prefer volatile buffers of low salt concentrations for elution of proteins. These allow direct microsequencing or identification of proteins by gel electrophoresis. The use of 0.1% aqueous TFA as buffer A of the gradient to separate r-proteins derived from different organisms gives sufficient resolution. Experience with r-proteins from E. coli ~3 shows that gradients made with 2-propanol are superior to those made with acetonitrile or methanol. Acetonitrile causes partial denaturation of proteins; this results in the migration of one protein in multiple peaks. We proposed the use of 2-propanol as an organic modifier for such complex protein mixtures which circumvents this problem. Ribosomal proteins separated on reversedphase wide pore columns are fully active as tested by reconstitution assays, s4 These results demonstrate that reversed-phase HPLC is suitable for the isolation of proteins not only for structural but even for functional studies. Figure 2 shows the separation of total proteins extracted from 50S and 30S ribosomal subunits (TP50 and TP30) ofM. vannielii by reversedphase HPLC on an analytical self-packed Vydac column (size 4.6 id × 250 mm). Thirty micrograms of ribosomal protein mixture was injected for analytical runs and 2 mg for preparative separations. Eighteen proteins of TP30 and 22 proteins of TP50 were purified to sequencer grade quality as checked by two-dimensional polyacrylamide gel electrophoresis. For this purpose, two different polyacrylamide gel electrophoresis methods were used. One was according to Ref. 21, with gel sizes of 10 × 10 cm and sample loads of 3 - 5 #g per protein; the other method was a microgel electrophoresis recently developed in our laboratory for gel sizes of 3 × 3 cm and sample loads of 300 ng per protein. 22,2a The two-dimensional gel electrophoresis systems allow identification of the proteins and control of their purity. The use of the microgels speeds up the time for electrophoresis 32 j. D. Pearson, W. C. Mahoney, M. A. Hermodson, and F. E. Regnier, J. Chromatogr. 207, 325 (1981). 33 R. V. Levis, A. FaUon, S. Stein, K. D. Gibson, and S. Udenfdend, Anal. Biochem. 104, 153 (1980). 34 p. Nowotny, V. Nowotny, H. Eckardt, and R. M. Kamp, submitted for publication.
~) II lll~Jnl ( ~ 9 U].J~nO r
.D
| | lu
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
553
from 2 days to about 2 hr and requires only a small portion o f analytical protein fractions for this purpose. This micromethod complements other microtechniques in protein analysis such as sensitive H P L C separations o f proteins and peptides, amino acid analysis at the picomole level, and microsequencing. Reversed-phase H P L C with volatile gradient buffers such as 0.1% TFA and 2-propanol allows the direct sequencing o f proteins. If the fractions obtained are dried in the reaction chamber o f a sequencer (e.g., the spinning cup) or after Speed Vac concentration loaded onto a filter o f the cartridge, losses that might occur due to precipitation or transfer steps can be minimized. Different r-protein mixtures from archaebacteria were separated on reversed-phase columns employing these eluants. Figure 3 shows the separation o f TP30 and TP50 from Sulfolobus acidocaldarius. It was possible to separate and purify most o f these proteins in one run. The separation o f r-proteins from H. marismortui on reversed-phase columns is more complicated. These proteins are m u c h more acidic (95% acidic proteins) than the proteins from other organisms and thus not soluble in buffers with low pH, such as 0.1% aqueous TFA at p H 2.0. For that reason another buffer was chosen. The aqueous buffer at p H 7.5 contained 0.5 M NH4C1, 0.05 M KC1, 0.02 M Tris-HC1, p H 8.0, and 0.3 m M Mg2Cl. 2-Propanol was used as organic modifier. Figure 4 shows the separation o f H. marismortui 30S proteins on an analytical Vydac T P - R P (C~s) c o l u m n (4.6 m m id) under these conditions. These proteins are eluted later than those o f M . vannielii ribosomes. This shift is caused by the acidity of/-/, marismortui proteins, since they bind more strongly to the support and are eluted in lower yields than their basic counterparts.
1on-Exchange Chromatography The separation o f proteins on ion-exchange H P L C columns depends on their charges and the ion-exchange matrix employed. The ion-exchange columns are based on silica or on an organic gel coated with different functional groups such as sulfonic acid, carboxyl groups, or primary or quaternary amines. Fxo. 2. Separation of TP30 (a) and TP50 (b) ribosomal proteins ofM. vannieliion Vydac TP-RP (C~8).One milligram of TP30 was injected in 100/~l 2% acetic acid in water and 2 mg TPS0 was injected in 200/zl 2% acetic acid. The eluants were buffer A, 0.1% aqueous TFA; buffer B, 0.1% TFA in 2-propanol. The linear gradient used for TP30 was 20% B to 30% B in 30 min, 30% B to 33% B in 30 rain, 33% B to 40% B in 50 rain, 40~ B to 10% B in 5 rain. The linear gradient used for TP50 was 10% B to 25% B in 60 rain, 25% B to 30% B in 30 rain, 30% B to 35% B in 40 rain, 35% B to 55% B in 60 rain, 55% B to 10% B in 5 rain. The eluate was monitored at 220 nm, 0.64 aufs; flow rate 0.5 ml/min, temperature 35".
80
60
Retention
time
(rain)
b -8o
2O
Retention tim (rain)
FzG. 3. Purification of 30S (a) and 50S (b) ribosomal proteins from Sulfolobus acidocaldarius on Vydac TP-RP. Five hundred micrograms of TP30 and 1 mg of TPS0 in 0.1% aqueous TFA were injected. The eluants were A, 0.1% aqueous TFA and B, 0.1% TFA in 2-propanol. The gradient used for TP30 was 10% B to 30o/o B in 200 rain (curve-3, DuPont 850 controller), and a linear gradient of 30o/o B to 35% B in 100 rain, 35% B to 10% B in 5 min. The gradient used for TPS0 was 10% B to 26% B in 140 rain (curve-3, DuPont 850 controller), and a linear gradient of 26% B to 30% B in 40 rain, 30% B to 40% B in 200 rain, 40% B to 10% B in 5 rain. The measurements were made at 220 nm, 0.16 aufs; flow rate was 0.5 ml/min at 35 °.
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
555
$3
e~
-20
20
40
60
80
100
120
1/.0
Retentmn time (rain)
FIG. 4. Separation of 30S ribosomal proteins from H. marismortui on the reversed-phase column Vydac TP-RP (C~s). One milh'gram of TP30 was injected in 200/zl starting buffer A. Buffer A was 0.5 M NH(CI, 0.05 MKCI, 0.02 M Tds-HCI, pH 8.0, 0.3 mM MgC12, pH 7.5; buffer B was 2-propanol. The linear gradient was hold at 0% B for 5 rain, 0% B to 20% B in 60 rain, 20% B to 35% B in l0 rain, 35% B to 53% B in 70 rain, 53% B to 0% B in 5 rain. The eluate was monitored at 220 nm, 0.32 aufs; flow rate was 1.0 ml/min at ambient temperature.
TABLE III HIGH-PERFORMANCEIoN-EXCHANGESUPPORTSFOR PROTEINSEPARATION
Name TSK 530 CM-SW TSK 535 CM-SW TSK 540 DEAE-SW TSK 545 DEAE-SW TSK SP-PW Mono Q
Mono S
Supplier Toyo S o d a , Japan Toyo S o d a , Japan Toyo S o d a , Japan Toyo S o d a , Japan Toyo S o d a , Japan Pharmacia Fine Chemicals, Sweden Pharmacia, Fine Chemical Sweden
Bonded phase
Support material
Particle size (gin)
Pore size (A)
Carboxylmethyl
Silica
5
130
Carboxylmethyl
Silica
10
240
Diethylaminoethyl
Silica
5
130
Diethylaminoethyl
Silica
10
240
Sulfopropyl
Organic
10
130
Quaternary amine
Organic
10
Not available
Sulfonic acid
Organic
10
Not available
(%i O u].J:dnil i~ i
lli ~ i l c i e g
II
oO
\ \
\
\
< \
]
a
|
'i
W
\
J
\
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
557
Fl~. 5. Purification of 30S (a) and 50S (b) ribosomal proteins from M. vannielii on TSK cation-exchange column IEX-530 CM (pore size 125 ,~, particle size 15 Hm, column size 300 X 4 mm). Two milligrams of TPS0 and 1 nag of TP30 were injected in 200/tl 2% acetic acid. The eluants were buffer A, 0.01 M sodium phosphate, 5 M urea, 10 m M methylamine, pH 6.5; buffer B: l M KCI in buffer A. The linear gradient used for TP30 was hold at 0% B for 30 min, 0% B to 50% B in 250 rain, 50% B to 0% B in 5 rain. The linear gradient used for TPS0 was hold at 0% B for 30 rain, 0% B to 10% B in 30 rain, hold at 10% B for 20 rain, 10% B to 25% B in 60 rain, hold at 25% B for 20 rain, 25% B to 30% B in 30 rain, hold at 30% B for 20 min, 30% B to 50% B in 60 rain, hold at 50% B for 20 rain, 50% B to 75% B in 55 rain, 75% B to 0% B in 5 rain. Measurements were made at 230 nm, 0.08 aufs; flow rate was 1.0 ml/min at 35*. (c) Examples of protein fractions from (b) purified by ion-exchange chromatography as identified by two-dimensional microgel eleetrophoresis.
Table III lists the properties of different commercially available ion-exchange supports. The best separations of r-proteins were obtained on CM-TSK or DEAE-TSK columns. The mobile phases used for these separations are similar to those used in conventional ion-exchange chromatography. Optimal ionic strength gradients have been determined for r-protein purification. Phosphate buffer 0.01 Mwas used in a gradient with 0 to 1 M KC1. Figure 5 shows the separation of r-proteins extracted from 30S and 50S subunits of M. vannielii. In both buffers of the gradient 5 M urea is necessary to guarantee high recoveries of protein. Those proteins that
558
[38]
ISOLATION OF RIBOSOMAL PROTEINS
o~ tl3
'~ilf20 50
160 Retention
1~0
200
time (min)
FIo. 6. Separation of 50S ribosomal proteins from H. marismortui on TSK ion-exchange column IEX-530 DEAE (pore size 125 A, particle size 5 #m, column size 300 X 4 ram). One milligram of TP50 was injected in 400/zl buffer A. Buffer A was 0.01 M sodium phosphate (NaH2PO4) and 1 m M MgC12, pH 7.5; buffer B was 1 MKCI in buffer A. The linear gradient used was hold at 0% B for 50 rain, 0% B to 50% B in 180 rain, 50% B to 0% B in 5 rain. The eluate was measured at 230 nm, 0.08 aufs; flow rate was 1.0 ml/min at ambient temperature.
could not be purified by reversed-phase chromatography often could be purified by ion-exchange chromatography. The application of anion-exchange chromatography for the separation of r-proteins from H. marismortui is shown in Fig. 6. The proteins were isolated in 0.01 M sodium phosphate at pH 6.5 and 1 m M MgCI2 as buffer A, and buffer B contained 1 M KC1 as ionic strength eluant. Recovery on the ion-exchange column depends on the pK of the proteins, their hydrophobic interactions with the support, their solubility in the mobile phases, and the accumulation of aggregates during the separation. A limitation of this method is the need to use high salt and urea concentrations which prevents direct microsequencing and protein identification by two-dimensional gel electrophoresis.
Desalting of Proteins after Ion-Exchange Chromatography Reversed-phase chromatography was applied for desalting samples obtained after salt gradient ion-exchange HPLC. The desalting technique which we developed recently35 is easy to apply and allows the preparation of salt-free samples in a few minutes. The proteins can directly be used for microsequencing or gel electrophoresis. The loss of protein is negligible, 35 T. Pohl and R. M. Kamp, Anal. Biochem. 160, 388 (1987).
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
559
and usually less t h a n 10% as tested with standard and r-proteins. 35 This m e t h o d allows simultaneous desalting a n d concentration o f dilute protein samples (1 - 5 #g/ml). Very dilute fractions o f up to 1 liter v o l u m e can be concentrated and desalted in a short time. C o m m o n l y used desalting techniques, such as dialysis, c h l o r o f o r m - m e t h a n o l , 36 trichloroacetic acid precipitation, 37 or open c o l u m n c h r o m a t o g r a p h y can cause the precipitation o f proteins or its adsorption to the m e m b r a n e , respectively. Generally, these methods d e m a n d sample concentrations o f m o r e than l0 #g/ml. T h e e q u i p m e n t for desalting on reversed phase is shown in Fig. 7a. It consists o f two buffer vessels, one H P L C p u m p ( B e c k m a n n 1 10A), one U V 0.1% TFA m Propano[
01% TFA ~n Wafer
3-wQy valve
t
I
Gloss mpltiary
Pump
Injecfor Rheodyne valve
Reversed- phase column
CoLtecfor Recorder
Flo. 7. (a) Equipment for desalting and concentrating protein solutions. Reversed-phase columns were packed in our laboratory with Nucleosil (24 support (pore size 300 ]~, column size 4 × 40 mm). (b) Chromatogram of the desalting procedure. One milligram of ribosomal protein mixture in 5 ml 5 M urea after ion-exchange chromatography was applied on the reversed-phase column (Nucleosil, 4 × 40 ram). The absorbance was measured at 230 rim, i.28 aufs. Buffer A was 0.1% aqueous TFA; buffer B was 0.1% TFA in 2-propanol. (Figure continues.)
36D. Wessel and U. J. Fltigge,Anal. Biochem. 138, 141 (1984). 37K. C. Retz and W. J. Steele, Anal. Biochem. 79, 457 (1977).
560
ISOLATION OF RIBOSOMAL PROTEINS
0
l.
~'Buffer A
[38]
8
?Buffer B
Retention time (min) FIG. 7 (Continued)
detector (Pye Unicam, Phillips), an injection valve (Rheodyne 7125), a three-way valve (Whitey), and a recorder (Kipp and Zonen BD41). Nucleosil columns from Macherey and Nagel (FRG) (300 A pore size, 5/tm particle size) in sizes of 0.4 X 4 cm and 1.6 X 4 cm were used. The maximal capacity of the analytical column (40 × 4 m m id) is about 8 rag of protein and the capacity of the preparative column (40 × 16 mm id) is 34 mg. A chromatogram of a desalting procedure is shown in Fig. 7b. The first peak corresponds to salt and urea eluted with 0.1% aqueous TFA, and the second corresponds to the protein fraction eluted subsequently with 2-propanol. If many protein fractions require desalting or concentration, this method can be automated using a sampler and a controller.
[38]
HPLC PURIFICATIONFOR MICROSEOUENCEANALYSIS
561
Sequence Determination of Ribosomal Proteins, Protein A of Methanocoecus vannielii The strategy applied for sequence analysis of r-proteins from archaebacteria is to determine the N-terminal sequences for protein comparison and correlation and to select a few fragmentations for peptide isolation and microsequencing. We demonstrate the methods employed for the sequence determination of protein A derived from M. vannielii ribosomes as an example of the recent sequencing approaches. ~8 Ribosomal protein A is the most acidic protein of the E. coli ribosome and is present in four copies of identical sequences: two copies carrying free N-terminal serine (protein LI2) and two copies N-terminal acetylated serine (protein L7). 3s This protein constitutes the stalk region of the large subunit and has been extensively studied in structural, immunological, and functional respects. 39,4° It is the only r-protein where sequence data from many different organisms are presently available.4~
Correlation of Protein A to Other r-Protein Sequences by N- Terminal Sequence Analysis In order to compare M. vannielii with other bacteria we determined the amino acid sequence of the A protein homology of this organism. We established that M. vannielii L8 (recent nomenclature MVA L12, see Ref. 18), one of the 35% acidic proteins in the ribosomes of that organism (see Fig. 2b), is the counterpart to the E. coli L7/L12 proteins (see Fig. 8).
Sequence Homology of the N-Terminal Region of r-Protein A Derived from Different Organisms The comparison of the M. vannielii sequence of protein A with the corresponding sequences of the organisms of the three kingdoms, the archaebacteria, eubacteria, and eukaryotes, is presented in Fig. 8. The homology of M. vannielii with the other three archaebacterial A-protein sequences known is unequivocal; the N-terminal region is strongly conserved. Twenty-nine out of 38 N-terminal residues of M. vannielii are 3s C. Terhorst, W. MOiler, R. Laursen, and B. Wittmann-Liebold, Eur. J. Biochem. 34, 138 (1973). 39 M. Yagushi, A. T. Matheson, L. P. Visentin, and M. Zuker, in "Genetics and Evolution of RNA Polymerase, tRNA and Ribosomes" (S. Osawa, H. Ozeki, H. Uchida, and T. Yure, eds.), p. 585. University of Tokyo Press, Tokyo, 1980. 4o A. T. Gudkov, J. Behlke, N. N. Otiurin, and V. J. Lira, FEBSLett. 82, 125 (1977). 41 B. Wittmann-Liebold, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and G. Kramer, eds.), p. 326. Spdnger-Verlag, New York, 1986.
562
[38]
ISOLATION OF RIBOSOMAL PROTEINS
ARCHAFRACTERIA
MVA .CU MTH SAC
~° S ~ N i~iii~ . A ~i~i A i~iiii~::V :~ Gi~iii~::i~ilA N ::~::~ii~i~iV :::::::::::|:::::::::::::::::::::::::::::::::,~.: V ~iiii~iii.~.:::: i~ii~ii!~iVi~iii~ii~iiii~i"i"i~ii!i~iE ~ D E~I L ~I:!:DN T Gi~i~iE i~iA ii~-VD V E E Sii~iA !:i~ii~ii~iii~ii~ii~ii~i:Mi~ii~:H T T G:!~:i~:I N"i~iii!~iiN ~ili~i Sii~ii~ilE i~i~A ~ Alibi V Dii~iii~iii~ili~ !i~!i!i~ii!~iii!iiiiiii~ili~Si~i:::ii!~!ii~:~H A ~K i~i~E I S i~ii~i~N i~N i~i!iii~S ::A ~ii i~!:~"TV D :E::V::i~;L . . . . . . .
2'°
EUKARYOTES
MVA ii~:: E i~!!iii~iiY ~i A i~:iii~iiii~°iN S A - :N K E V T ~E ° E Aii~iiii~iiii~iii~iii~ilV i~ :::::::::::::::::::::::::::::::::::::: YSC ii~iK i~ii"L:A ~ Y i~ii!!~ili~iiV Q G G N A A P S A A D I i~ii~ii~i'V' E SV ~i~ii'A'~iV'D"E"i~i~ WGE ii~K F'ii~iiA ~ Y i~ii~i~i'A Y L G G i~S - P S A A D i~!!ii~!"'D""i'"i~i~N ~iV i~ii A ~iii~ii#i E EK RL,
~:~ R!~iV A S Y i~!ii~iA A L G G N S N P S A K D T A K I ~:~:D S V i~iiiiiiiiii~iii~iilD
EUBACTERIA, GRJMq-
MVA
I~ E Y I y A A:L L
,Lo
,o N S ~ N K E V T E - ~ A ~ i ~ i V L V A ~o~ I E A:N D.~ R
A,sv,
v
s i:i:!:
ii!ill
:i:~:
i:
VCO
S I T N E Q I L D A I A D M S V M Q V Vi!~i: L I E ~ M E E K Fi~.; V S ~: A A AV
DVU
S S I T K E Q V V E F I A N M T V L E L S!~F I I~:E L E E K F;(~ V S;IA A PA • :::::: ::: .i?
NRCC
A L T Q E D I I N A V A E M S V M E V AI~ L ~ S!~iM E E K F ~ V S ~ A AA V
EUBACTERIA, GRAM + ,1o
20
MVA
M E Y I Y A Ai~ii::::~L N S A !!i K E ~iT t;E A V K A V L V A G3G'li~iA N D~iR V
SBR
A K L S Q D D:i~iiiiiiA Q F E E M T L I ~::L S E F V K A F E E K F D V T A~iA A >>:+:.:+ k::: <.:.:: A K L T T E E:i~i~i~i~;AA F E E L l" L I ~ L S E F I K A F E E K F D V T A;~!A P ....,.
AKLSXE i ; EQFKGLTLZe:LSEFVKAFEETF VGAi:AP :<+>>:.:.
MLY 3 RLY I
....
M N K E Q I ~E A I K A M T ~:L~:L N D L V K A I E E E F G V T A~iA P
RsP
A D L N K - -::i~A E D I V G L T L L i:.:
BSU
A - L N I E E I I A S V K E A T i ~ L ~ i L N D L V KA I E E E F GVTAii~iiA P
CPA
MSKEOIIQAIKGMTViiLI~LNELVKSIEEEFGVSAii~.iAV
BST
MT K E O I I O A V KiNM T ~ I L I ~ L " E L V KA I E E E F G V T A ! ~ i A
FIG. 8. Compari~n of ~ e A pro~in from different organisms. Abbreviations: A ~ , Artemia salina; A~ A ~ h o b a ~ gl~ia~s; Bst, B~i#us ~earotherm~hil~; B~, Baci#~
P
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
563
identical for these archaebacterial L I2 sequences (residues shaded in Fig. 8), which amounts to 50-65% homology for the first 38 residues of these four organisms. Further, the sequence from M. vannielii shows higher homology with eukaryotes than with eubacteria. Twenty-two out of 38 residues are highly conserved in comparison to the eukaryotic A sequences, 10 residues of which are conserved in four or five proteins examined, namely the N-terminal methionine residue, tyrosine-3, alanine-6, three leucines in positions 8, 9, and 27, asparagine-15, glycine-31, and glutamic acid-33. Notable is a replacement of alanine-5 of the eukaryotic sequences by an additional tyrosine residue found in all archaebacterial proteins so far, and a shift from a basic amino acid residue toward an acidic residue in position 2 of the N-terminal region, whereas the only arginine residue in this sequence area is found in position 38, similar to that in yeast and rat liver A proteins. The presence of several tyrosines at the N-terminal end is characteristic only for two of the kingdoms; no tyrosine is present in the N-terminal eubacterial L7/L 12 sequences. The archaebacterial A proteins have the following amino acids in common with gram-negative eubacteria: leucine in position 8, glutamic acid-21, valine-23, lysine-24, glycine-31, and alanine residues in positions 13, 25, 34, and 37. In comparison to gram-positive A protein sequences only a few positions are highly conserved, e.g., the leucines in positions 8 and 9, valine-17, glutamic acid-19, and alanine-36. The homology between eukaryotes and archaebacteria as celculated according to the amino acid residues conserved in all known L7/L12 sequences is 16°/0 (6 out of 38 residues) and is distinctly higher than the homology between archaebacteria and eubacteria with only 5 to 8%. The results suggest that the eukaryotes have coevolved more closely with archaebacterial ancestors. Sequence data from 5S RNAs also indicate the possibility of a closer relationship between archaebacterial 5S RNAs and eukaryotic 5S RNA. 42,43 42A. T. Matheson, M. Yagushi, R. N. Nazar, L. P. Visenfin, and G. E. Willick, in "Energetics and Structure of Halophilic Microorganisms" (S. R. Caplan and M. Ginzburg, eds.), p. 481. Elsevier, Amsterdam, 1978. 43H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76, 380 (1979).
subtilis; Cp, Clostridium pasteurianum; Dvu, Desulfovibrio vulgaris; Eco, Escherichia coli; Hcu, Halobacterium cutirubrum; Mly, Micrococcus lysodeikticus; Mth Methanobacterium thermoautotrophicum; Mva, Methanococcus vannieliL NRCC strain 71227; Rsp, Rhodopseudomonas spheroides; RFI, rat liver; Sac, Sulfolobus acidocaldarius; Sgr, Streptomyces griseus; Vco, Vibrio costicola, strain NRCC 37001; Wge, wheat germ; Yse, Saccharornyces cerevisiae. For references, see Ref. 41.
564
ISOLATION OF RIBOSOMAL PROTEINS
[38]
Strategy of Peptide Fragmentation and Sequence Analysis Protein A ofM. vannielii was isolated following the usual route for the preparation of ribosomal L7/L12 proteins, i.e., ammonium chloride extraction. 44 It was further isolated by reversed-phase HPLC (see Fig. 2b) and eluted from ion-exchange HPLC columns together with other acidic proteins in the first peak (see Fig. 5b). Enzymatic and chemical cleavages of the protein were selected which yield peptide mixtures that are well resolved by reversed-phase HPLC (see below). This strategy allowed these peptide fractions to be subjected directly to amino acid analysis and microsequencing. The amino acid analyses were carried out after precolumn derivatization with o-phthaldialdehyde on reversed-phase HPLC as detailed elsewhere.24 Microsequencing was done manually by the DABITC/PITC double-coupling method using l to 5 nmol of peptide29 or, more recently, with 500 pmo117,4~; larger peptides were degraded by the DABITC/PITC method in a solid-phase sequencer after attachment of the C-amino groups of the lysines to DITCactivated aminopropyl glass or through the carboxyl groups to aminopropyl glass. 3°,~
Reversed-Phase Chromatography of Peptides Reversed-phase chromatography was applied to peptide mapping of protein A from M. vannielii. This is a very useful technique for the structural characterization of proteins and allows quick separations and high resolution and is the method of choice for the purification of hydrophobic peptides. Peptide separation by HPLC requires only a fifth of the starting material necessary compared with thin-layer fingerprinting, and about 30 times less compared to the combination of conventional column and thin-layer chromatography as employed earlier. 2° The use of volatile and UV-transparent HPLC buffers allows high sensitivity runs, direct amino acid analysis, and microsequencing of the isolated peptides. We used different buffer systems, at pH 2.0 or at pH 7.5, taking into account the different solubilities of the proteins and constituent peptides. Figure 9 shows the separation of a tryptic digest of protein A from M. vannielii on a Hypersil ODS column (Shandon, England). The peptides were separated by a gradient of 0.05% aqueous TFA and 0.05% TFA in " E . Ham¢l, M. Koka, and T. Nakamoto, J. Biol. Chem. 247, 805 (1972). 45B. Wittmann-Liebold, H. Hirano, and M. Kimura, in "Advanced Methods in Protein Microsequence Analysis" (B. Wittmann-Liebold,J. Salnikow, and V. A. Erdmann, eds.), p. 77. Springcr-Veflag, (1986). B. Wittmann-Liebold, in "Practical Protein Chemistry - - A Handbook" (A. Darbre, ed.), p. 375. Wiley, London, 1986.
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
565
80
-60
,.J~
20
,
J
~0
6O
80
100
g
120
Reter~ion time (rain)
FIG. 9. Separation of tryptic peptides of ribosomal protein A from M. vannielii on Hypersil ODS (particle size 5/tin, pore size 100 .~,, column size 250 X 4.6 mm). Two hundred micrograms of protein hydrolyzate was injected. Buffer A was 0.05% aqueous TFA; buffer B was 0.05% TFA in acetonitrile. The linear gradient used was hold at 0% B for 20 min, 0% B to 20% B in 40 rain, 20% B to 40% B in 80 rain, 40% B to 0% B in 5 min. Measurements were made at 220 nm, 0.32 aufs; flow rate was 1.0 ml/min at 35".
acetonitrile. The use of small pore size columns (100 A) allows good resolution of the peptides. Even dipeptides of different hydropliobicity are resolved. Table IV lists several commercially available spherical supports for the separation of small peptides. TABLE IV HIGH-PERFORMANCE REVERSED-PHASE SUPPORTS a FOR PEPTIDE SEPARATION
Name
Supplier
Hypersil ODS
Shandon, Cheshire, UK
Spherisorb ODS Lichrospher-C8
Phase sep Queensferry, U K
a
Merck, Darmstadt, FRG
Support material is silica.
Bonded phase Hydrocarbon octadecyl phase Hydrocarbon octadecyl phase Hydrocarbon octyl phase
Particle size (gm)
Pore size (A)
5
100
5
100
5
100
566
ISOLATION OF RIBOSOMAL PROTEINS
[38]
80
"//
/
/ / /
/
I
I
~.o~
/
/// /"
2O
///
J Retent~n time (rain)
Fxo. 10. Separation of Staphylococcus protease pepfides of ribosomal protein A derived from M. vannielii on a self-packed column of Hypcrsil ODS. Two hundred micrograms of protein hydrolyzate was injected. The eluants were buffer A, 3 m M ammonium formate at pH 7.5; buffer B, 80% methanol and 200/0buffer A. The linear gradient used was hold at 096 B for 20 rain, 0% B to 50% B in 60 rain, 50°5 B to 70°5 B in 35 rain, 70% B to 0% B in 5 rain. The eluate was measured at 230 nm, 0.08 aufs; flow rate was 1.0 ml/min at 35 °.
Peptides that were not soluble at low pH, e.g., from Staphylococcus protease digestion of protein A, were separated using buffers at higher pH such as a m m o n i u m formate at pH 7.5 in a gradient with methanol (Fig. 10). We used a m m o n i u m formate prepared from aqueous ammonia and formic acid to obtain eluants of high purity. The buffer is transparent at 220 nm and also enables direct sequencing of the peptides after HPLC separation. The gradient with methanol results in fractions that dry very quickly. Large peptides were separated on columns with wide pore size (300 A) such as Vydac C~8 or Vydac C4. The separation of large peptides after dilute acetic acid cleavage is presented in Fig. 11. The peptides were chromatographed in a gradient of 0. l°/o aqueous TFA and 2-propanol. 2-Propanol is the most suitable eluant in the separation of large peptides, but it is too strong an eluant for the separation of small molecules. An example of a separation of chymotryptic peptides of protein A is given in Fig. 12. The peptides were separated in a gradient of 1 l0 rain.
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
567
8O
/// i ///
/ ~//
!
~0 L 20
//
o
is
~ Retention
~
~o
time (rain)
FIG. 11. Purification of peptides of ribosomal protein A from M. vannielii after dilute acid hydrolysis. The separation was performed on a self-packed Vydac C4 column (particle size 5/zm, pore size 300 nm, column size 250 X 4 ram) at 35* and a flow rate of 0.5 ml/min. The eluants were buffer A, 0.1% aqueous TFA at pH 2.0; buffer B, 0.1% TFA in 2-propanol. Two hundred micrograms of protein hydrolyzate was injected in 50/zl 2% acetic acid. The linear gradient used was 0% B to 50% B in 100 min, 50% B to 0% B in 5 rain. Measurements were made at 220 nm, 0.32 aufs.
The quality of the peptides after HPLC for microsequencing was high. Salts that can obscure the identification of the degraded 4-N,N'-dimethylaminoazobenzene 4'-thiohydantoin (DABTH)-amino acid derivatives did not interfere with sequence analysis. One to 2 nmol of purified peptide was sufficient for the complete sequence analysis. Aliquots of the fractions were also sequenced after attachment to aminopropyl glass beads. The attachment and sequencing yields were excellent and difficulties caused by contaminating salts were not encountered. The results show that 10-20 nmol of protein A suffice to purify and sequence most of the diverse sorts of peptides after one gradient separation on reversed-phase HPLC.
Reversed-Phase Chromatography of Oligonucleotide Probes Synthetic oligonucleotides have found wide application in molecular biology as probes for the identification and isolation of specific genes. The determination of the N-terminal and other partial sequences of ribosomal
568
[38]
ISOLATION OF RIBOSOMAL PROTEINS
80
//////~/
i
//1//
~0,~
/j
i5
s0 Retention
time {rain)
FiG. 12. Separation of chymotryptic peptides of ribosomal protein A from M. vannielii on a Vydac C4 column (particle size 5/zm, pore size 300 nm, column size 250 X 4 ram). Three hundred micrograms of protein hydrolyzate was injected and separated at 35* with a flow rate of 0.5 ml/min. The linear gradient used was hold at 0% B for 10 rain, 0% B to 20% B in 40 min, 20% B to 40% B in 80 rain, 40% B to 0% B in 5 rain. The eluate was monitored at 220 nra, 0.32 aufs.
protein A from M. vannielii as described above allowed us to synthesize two oligonucleotides, a 17-mer and a 20-mer complementary to the N-terminal (5') end and C-terminal (3') part of the gene, using the phosphoramidite method. 47 The synthesized oligonucleotides were purified using reversed-phase HPLC on a Nucleosil C4 column (250 X 4 m m id) (Fig. 13) with isopropanol as organic modifier instead of health-hazardous acetonitrile. High recoveries of synthesized oligonucleotides were obtained in runs of only a few minutes. After hybridization of the purified oligonucleotides against different chromosomal digests of M. vannielii DNA, a 0.9 kb ClaI fragment was cloned into the vector pUCI8. Recombinant clones were screened with the oligonucleotides and the recombinant plasmid was sequenced by the Sanger dideoxy method~ yielding the sequence of the gene coding for M. vannielii ribosomal protein LI2. TM 47 M. H. Caruthersand and L. J. McBrid, Tetrahedron Lett. 24, 245 (1985). F. Sanger and A. R. Coulson, FEBSLett. 87, 107 (1978).
[38]
H P L C PURIFICATION FOR MICROSEQUENCE ANALYSIS
569
90 o ...J
o 70
r~
5O
30
I I I I
10 -+-----
0
3
6
9
'12
Retention time (rain)
FIO. 13. Purification of an oligonucleotideprobe for protein A from M. vannielii. The length of the oligonucleotidewas 17 bases. Three hundred picomoles were injected in 100/zl of TEAA buffer. Buffer A was 0.1 M triethylammonium acetate (TEAA) at pH 7.0 made from 0.1 M acetic acid and triethylamine; buffer B was 2-propanol. The gradient used was 15% B to 40% B in 25 rain, 40% B to 096 B in 5 min. The measurements were made at 260 nm and 0.08 aufs. Discussion a n d F u t u r e P e r s p e c t i v e s In this chapter we demonstrate various separation techniques for proteins and peptides by H P L C and show its use for resolving complex protein mixtures, such as r-proteins. Ribosomes from different organisms vary considerably; they contain quite different sets o f proteins, differing in total numbers, sizes, amino acid compositions, and net charges. Accordingly, appropriate separation methods have to be adapted for each o f the mixtures derived from the different organisms. This chapter shows examples o f protein purifications with small a m o u n t s o f protein isolated from different archaebacterial ribosomes. The proteins derived from individual archaebacteria vary, depending on whether the bacteria grow under extreme or moderate salt conditions or at higher temperatures. Accordingly, the range o f the proteins varies from rather acidic to very basic, and increased contents o f hydrophobic amino acids are often observed, e.g., in thermophilic organisms.
570
ISOLATION OF RIBOSOMAL PROTEINS
[38]
Purification to sequencer grade purity of the proteins is a prerequisite for their structural and functional investigations. Since only limited amounts of ribosomes can be prepared from these organisms, HPLC techniques are at present the only means to isolate and purify these proteins. Different HPLC methods were applied, such as size exclusion chromatography, reversed-phase and ion-exchange HPLC. Examples of separating different archaebacterial r-protein mixtures are shown employing these techniques and the limitations and advantages of the different techniques are discussed. In general, separations on reversed-phase supports are most suitable, and the protein fractions obtained can easily be subjected to sequence analysis. On the other hand, some proteins can be purified more rapidly avoiding any rechromatography, on ion-exchange columns. However, in these cases, the eluates have to be desalted prior to sequence analysis. For the detection and identification of the proteins in analytical HPLC fractions we developed a fast and simple microgel electrophoresis system, applicable for up to 20 samples in a microgel chamber. Only portions of the HPLC fractions, e.g., nanogram amounts, are necessary for this technique. To extend the microtechniques to protein fractions obtained after ion-exchange or size exclusion chromatography, a simple desalting method is applied which simultaneously desalts and concentrates dilute samples. Therefore, a complete set of micromethods for isolation and detection of proteins is now available which makes structural investigations of complex protein mixtures possible, and reduces considerably time and effort for their purification and identification. In addition, modem microsequencing methods, such as the gas-phase techniques not described in this chapter, facilitate microsequence analysis of proteins and peptides in the picomole range.49 However, automated sequencers presently available can only degrade a single protein or peptide at one time; therefore, sensitive manual techniques which allow the degradation of many samples simultaneously are quite valuable. Recently, further modification of the DABITC/PITC double-coupling method using smaller reagent and solvent volumes and the simultaneous degradation of up to 30 samples in shortened dansyl glass tubes has been described.17,45In addition, new sensitive phenyl isothiocyanate homologs were synthesized; one of these, dansylaminophenyl isothiocyanate,5° yields fluorescent phenylthiohydantoins of the amino acids which can be detected in femtomole
49 R. M. Hewick, M. W. Hunkapiller, L. E. Hood, and W. J. Dreyer, J. Biol. Chem. 15, 7990 (1981). so S.-W. Jin, G.-X. Chen, Z. Palacz, and B. Wittmann-Liebokl, F E B S Lett. 198, 150 (1986).
[38]
HPLC PURIFICATION FOR MICROSEQUENCEANALYSIS
571
quantities by reversed-phase HPLC. 5~ At present such fluorescent Edmantype reagents are being studied for their application in microsequence analysis of r-proteins and peptides. With the new microisolation and microsequencing techniques, the structural investigation of proteins of limited sources, e.g., of archaebacterial ribosomes is now possible. This will facilitate structural comparisons and investigations of evolutionary aspects to an extent which was not envisioned some years ago. Further applications of the HPLC methods described here are topographical investigations on the ribosome. It was possible to use these methods for purification of cross-linked r-protein pairs that are only obtainable in yields of about 1% after mild reaction of the intact ribosome or its subunits with cross-linking reagents. Rapid purification of the crosslinked protein pairs S 13-S 19 from 30S subunits of E. coli and B. stearothermophilus in amounts suitable for microsequence analysis was possible. 52,53 Finally, appropriate peptides which carried the cross-link covalently attached were purified by HPLC, and the amino acids involved in the cross-link were determined by microsequence analysis. 54.55 As shown for protein A ofM. vannielii, the partial sequences obtainable by direct amino acid sequencing of archaebacterial r-proteins can be used for synthesis of oligonucleotide probes in order to isolate r-protein genes. Studies to find the genes of r-proteins derived from Halobacterium cutirubruin and Sulfolobus, 56 of Halobacterium marismortui (M. Kimura, unpublished observations), and of other M. vannielii r-proteins (A. Ktpke, B. Wittmann-Liebold, and A. B6ck, unpublished observations) are in progress. The methods described here can be applied to protein investigations in many different fields of basic molecular biology and medicine. For this purpose it is of special interest to establish that the proteins can be isolated under mild conditions that maintain their structure. For some of the HPLC methods described here, this has been investigated and active ribosomes could be reconstituted from proteins isolated with propanol gradients on reversed-phases as discussed in this chapter. HPLC methods which circumvent protein denaturation may also have applications in diverse areas, such as enzymology and receptor biochemistry. 5~ j. Sainikow, Z. Palacz, and B. Wittmann-Liebold: in "Methods in Protein Sequence Analysis" (K. Walsh, ed.), p. 247. 1986. 52 j. Broekm6Uer and R. M. Kamp, Biol. Chem. Hoppe-Seyler 367, 925 (1986). 53 T. Pohl, J. Brockm611er, and R. M. Kamp, in "Methods in Protein Sequence Analysis" (K. Walsh, ed.), p. 601. 1986. 54 j. Brockm611er and R. M. Kamp, Biochem. (1988), in press. 55 T. Pohl and B. Wittmann-Liebold, J. Biol. Chem. (1988), in press. 56 A. T. Matheson, FEBSMeet., 17th, August 1986 (Abstr.)
[39]
ISOLATION AND ANALYSIS OF 40S r-PROTEINS
575
[39] A n a l y s i s o f 4 0 S R i b o s o m a l P r o t e i n $ 6 Phosphorylation during the Mitogenic Response
By
J O A C H I M K R I E G , ANDRf:-E R . O L I V I E R , a n d G E O R G E T H O M A S
Introduction The finding that ribosomal protein $6 becomes multiply phosphorylated during tissue regeneration, development, cell growth, and transformation has focused a great deal of attention on this event and, more recently, on the signaling systems involved in its regulation.~ In an earlier volume in this series, we described two methods used in our laboratory for analyzing the phosphorylation state of $6 in culture cells. The first article dealt with the measurement of the extent of $6 phosphorylation on two-dimensional polyacrylamide gels,2 and the second with separation and analysis of $6 tryptic phosphopeptides by two-dimensional thin-layer electrophoresis. 3 Since then, we have made a number of significant changes in the preparation of 40S ribosomal subunits and $6 that result in procedures for sample preparation which are less expensive, much more rapid, and give higher resolution than those outlined in the original articles. The methods and techniques used to either separate $6 by gel electrophoresis or its tryptic phosphopeptides by thin-layer electrophoresis remain largely unchanged. Recently, we have set out to isolate and sequence the $6 phosphopeptides and to search for the kinase responsible for controlling the level of $6 phosphorylation. During these studies we found that those 40S ribosomes containing intact 18S rRNA serve as a much better substrate than those in which the 18S rRNA is partially degraded. Here we describe the changes we have made in the analysis of $6 and describe how we are preparing 40S ribosomes from rat liver to use as a substrate for the in vitro phosphorylation of $6. Solutions Hypotonic buffer contains 1.5 m M KC1, 2.5 m M MgC12, and 5 m M Tris-HC1, pH 7.4, at 0 ° Lysis buffer is identical to hypotonic buffer, except it is made 1% in Triton X-100 (Serva) and 1% in sodium deoxycholate (Merck). i G. Thomas, in "Oncogenes and Growth Control" (T. Graf and P. Kahn, eds.), p. 177. Springer-Veflag, New York, 1986. 2 M. Siegmann and G. Thomas, this series, Vol. 146, p. 362. 3 j. Martin-P6rez and G. Thomas, this series, Vol. 146, p. 369. METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any form reserved.
576
RIBOSOME FUNCTION AND KINETICS
[39]
Buffer A contains 500 m M KC1, 2.5 m M MgCI2, 0.5 M sucrose, 1% Triton X-100, 1% sodium deoxycholate, 1 m M dithiothreitol (DTT), and 5 m M Tris-HC1, pH 7.4, at 0* Buffer B is identical to buffer A except that the sucrose concentration is 1.0M Buffer C contains 100 m M KCI, 5 m M MgC12, 1 m M DTT, and 20 m M Tris-HC1, pH 7.4, at 0 ° Homogenization buffer is identical to buffer C, except it contains 1% Triton X-100 and 1% sodium deoxycholate Dissociation buffer consists of 500 m M KCI, 3 m M MgC12, 4 mM DTT, and 50 m M Tris-HC1, pH 7.4 MS buffer contains 6 M urea, 6 m M 2-mercaptoethanol (2-ME), 50 m M ammonium acetate pH 5.6, at 22 o SDS sample buffer contains 10% SDS, 25% 2-ME and 50 m M TrisHC1, pH 6.8 Preparation of Ribosomal Proteins for Two-Dimensional Polyacrylamide Gel Electrophoresis Earlier we resorted to radioactive labels and fluorography to analyze ribosomal proteins by two-dimensional polyacrylamide gel electrophoresis.TM This was necessary because of the small amount of ribosomes present in 3T3 cells and losses suffered during their preparation. Recently we have been able to circumvent the use of radioactive labels by (1) doubling the number of cells used for each gel, (2) using smaller tubes in the high-speed centrifugation step (which reduces losses due to wall effects), (3) including detergents in all the centrifugation buffers (resulting in higher recovery of ribosomes and better resolution of proteins on two-dimensional polyacrylamide gels),6 and (4) lowering the sucrose concentrations in buffers A and B (resulting in higher yields of ribosomes). As compared to earlier protocols, the method outlined below has the advantages that it is less expensive to carry out, the five phosphorylated derivatives of $6 are better resolved, and the proteins are visualized more rapidly. Swiss mouse 3T3 cells are seeded at 3 × l05 cells per 15-cm tissue culture plate (Falcon) in 30 ml of Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing 10% (v/v) fetal calf serum (FCS) (Gibeo). After 72 hr, cultures were refed with a medium containing DMEMWaymouth's (Gibco)-FCS in a ratio of 63:31:6. Cultures become con4 G. Thomas, J. Martin-Ptrez, M. Siegmann, and A. Otto, Cell30, 235 (1982). 5 I. Novak-Hofer and G. Thomas, J. Biol. Chem. 260, 10314 (1985). 6 K.-D. Scharf and L. Nover, Cell30, 427 (1982).
[39]
ISOLATION AND ANALYSIS OF 40S r-PROTEINS
577
fluent within an additional 48 hr and are judged quiescent on the eighth day following seeding. At this time no mitotic cells are visible and each plate contains 5 - 6 × 106 cells. After mitogenic stimulation the cell culture is transferred to ice, rinsed two times with 10 ml of hypotonic buffer, and lysed with 1 ml of the lysis buffer. The lysate is scraped to one edge of the plate, the material from five plates is pooled, transferred to a 15-ml Corex tube, and centrifuged at 0 ° for 5 min at 5000 rpm (SS-34 rotor, RC-2B Sorvall centrifuge).7 The nuclear pellets are discarded, the supernatant transferred to a 12-ml Quick Seal Tube (Beckman), brought to 8 ml final volume with lysis buffer, and underlayed first with 2 ml of buffer A and then 2 ml of buffer B. The tubes are then sealed and centrifuged at 56,000 rpm for 16 hr at 0 - 2 ° in a Ti 70.1 rotor (Beckman). Following centrifugation the supernatant is discarded, the ribosomal pellets resuspended in 1 ml of buffer C, and the ribosomes are used either immediately or stored at - 7 0 °. The isolation of ribosomal proteins and their separation by two-dimensional polyacrylamide gel electrophoresis is carried out essentially as described previously,2 except with the following changes. After resuspension of the ribosomal proteins in 60 gl of gel sample buffer,2 5 gl of the same buffer containing 5% glycerol and 0.04% pyronin G (Serva) tracking dye is added to each sample. The length of the first-dimensional gel has been increased from 150 to 200 mm, so that the separating gel can be poured to a height of 180 mm. 6 The electrophoresis time in this dimension is 30 min at I00 V and then 19 hr at 225 V. The increased length of the gel allows for higher resolution of the phosphorylated derivatives of $6. To mount the longer gel in the second dimension, 6 cm must be trimmed from the cathode end of the first-dimensional gel. Finally, two-dimensional polyacrylamide gels are stained for 1 hr at 40* in a solution containing 50% methanol, 10% acetic acid, and 0.1% Serva Blue R. An example of such a gel derived from 2.5-3 X 107 cells stimulated with epidermal growth factor and insulin for 1 hr is shown in Fig. I. Isolation of S6 for Two-Dimensional Tryptic Phosphopeptide Analysis The earlier method used for isolating $6 employed electroelution of the protein from one- or two-dimensional polyacrylamide gels. 3,s The time required to carry out this step, including electrophoresing the gel and preparing the sample for trypsin digestion, was from 3 to 4 days, with recoveries in the range of 50%. Recently we have taken advantage of FPLC 7 M. Noli and M. Burger, J. Mol. Biol. 90, 215 (1974).
578
RIBOSOME FUNCTION AND KINETICS
[39]
FIG. 1. Two-dimensional polyacrylamide gel of 40S ribosomal protein $6. Quiescent Swiss 3T3 cells were stimulated with 5 X 10-9 M epidermal growth factor and 10-9 M insulin for 1 hr and total ribosomal proteins were analyzed as described in the text. S6a through S6e represent increasingly phosphorylated derivatives of the protein, each derivative containing an additional mole of phosphate.
and HPLC techniques to develop a two-step purification procedure which requires only 1 day and results in yields on the order of 60 to 70%. Ribosomes labeled with 32p either in culture, as described previously,s or in vitro 9,1° are mixed with 1 mg of 40S rat liver ribosomal subunits (see next section). The ribosomes are then concentrated by ethanol precipitation 2 and the ribosomal proteins extracted with acetic acid. 2 The RNA pellet is discarded, the supernatant is diluted 1 : l0 with MS buffer and filtered through a Millex-GV 0.22-#m filter. The sample is then applied at a flow rate of 0.5 ml per minute to a 1-ml Mono S column (Pharmacia) equilibrated in MS buffer at 22 °. The column is washed for 5 min with MS buffer and the ribosomal proteins are eluted from the column with a linear NaC1 gradient from 0 to 0.5 M in MS buffer. $6 emerges from the column at 0.5 M NaC1 (Fig. 2). Fractions containing radioactively labeled $6 are pooled, made 0.1% in trifluoroacetic acid (TFA), centrifuged for 10 min in s j. Martin-P~rez and G. Thomas, Proc. Natl. Acad. Sci. U.S.A. 80, 926 (1983). 9 j. Martin-P6rez, M. Siegmann, and G. Thomas, Cell 36, 287 (1984). ~oI. Novak-Hofer and G. Thomas, J. Biol. Chem. 259, 5995 (1984).
[39]
ISOLATION AND ANALYSIS OF 40S r-PROTEINS
579
-18 O.1L, -
0.5
o.12-
E
0 "0 8 I
c o co .<
/i"
,/iii
~
o -12~
//I i! II
[
I
Oz.
LU I-0.3 ~_g~
l#i'
0 Q_
o z
-6° zrr f0.2 I~. E 0.1 -3
u
0 ,
0
10 20 FRACTION N U M B E R
0
3(]
FIG. 2. Elution of 40S ribosomal proteins from a Mono S cation-exchange column. Total rat liver 40S ribosomal proteins were appfied to a Mono S column and eluted with a linear gradient of NaCl (see text). The column was monitored for protein at 280 nm ( ) and $6 was followed by a2p (__).
an Eppendorf centrifuge (model 5412), and the supernatant is applied to a C4 reversed-phase (Vydac) column at 1.0 ml per minute. $6 is then eluted with a linear gradient from 0 to 50% acetonitrile in 0. 1% TFA. Radioactively labeled $6 elutes from the column at 37% acetonitrile (Fig. 3), in the same position as unphosphorylated $6 from rat liver. A second protein also elutes at this position, but does not interfere with subsequent phosphopeptide analysis. The samples containing $6 are pooled and dried in a Speed Vac Concentrator (Savant). Samples are then digested with trypsin and analyzed by two-dimensional thin-layer electrophoresis as previously described. 3 P r e p a r a t i o n of 40S Ribosomes from R a t Liver Rat liver 40S ribosomes are used either as a substrate to follow the purification of the $6 kinase or as a radioactive tracer to locate the $6 tryptic phosphopeptides. The ability of 40S ribosomes to serve as a substrate for the $6 kinase in vitro is dependent on the integrity of 18S rRNA. Here we describe the procedure presently employed for the isolation of 40S ribosomal subunits from rat liver. Prior to use, all glassware is treated with
580
[39]
RIBOSOME FUNCTION A N D KINETICS -7
1.0 ~,
6,'P (~
iI
0.8
',./
×
',re EO.6c -4 <{
0./-,-
LO - '
S~
""
2
7
Z
0 ~
.L ~
-30 uJ
Z
(-)
/
o o
-20 ~
-2 °
7
O_ rr
0.2.
0 <{ I--
Z
UJ
~
-10 a:
a_
-1
0.0
, , LO
50
60
70
80
,
,
90
100
0
O
F R A C T I O N NUMBER
Fro. 3. Purification of ribosomal protein S6 by reversed-phase HPLC. The radioactive fractions were pooled, made 0.1% in TFA, and applied to a Vydac C4 reversed-phase column. The column was developed with gradient of acetonitrile from 0 to 50% and total protein was monitored at 214 n m ( ) a n d $6 by ~2p (____).
0.01% diethylpyrocarbonate, rinsed in double distilled H20, and heated at 180" for 3 hr. Adult male Wistar rats (250- 350 g body weight) are starved for 24 hr before sacrificing by decapitation. Livers are removed, rinsed in phosphate-buffered saline; and frozen in liquid nitrogen. If the livers are not used immediately, they are placed in l-liter plastic bottles with small holes punctured in the top and stored in liquid nitrogen. Frozen liver, in 100 g batches, is ground to a fine powder in a precooled (-70*) Sunbeam XPBA Blender set at high speed. The tissue, which at this point is a fine frozen powder, is suspended in 2 volumes of homogenization buffer, disrupted with a Polytron (Kinematica, Luzern) set at speed 5 until a homogeneous suspension is formed (approximately 20 see), and centrifuged for 20 min at 10,000 rpm (SS34 rotor; RC-2B Sorvall Centrifuge) at 0-2*. The pellets are discarded, the supernatant is distributed in 29.5-ml aliquots into 38.5-ml Quick Seal Tubes (Beckman) and underlayed with 4 ml of buffer A followed by 5 ml of buffer B. The tubes are sealed and centrifuged for 16 hr at 56,000 rpm (Ti 70 rotor; L5-65 Beckman Centrifuge) at 0-2". Following centrifugation, the tops of tubes are removed with a sharp scalpel and the supernatant discarded. Overlaying the ribosome
[40]
TRANSLOCATION KINETICS
581
pellets is a clear jellylike material that can easily be removed by inverting the tubes and centrifuging them at 3000 rpm for 10 s in a table-top clinical centrifuge. The ribosome pellets remain firmly fixed to the bottom of the tube and the gelatinous material slides to the top where it can be removed with a paper towel wrapped around a glass rod. Following removal of this material, 1 ml of buffer C and three glass beads (3 m m diameter) are added to each tube. The tubes are then placed on a table-top shaker and rotated at 100 rpm at 0 - 4 °. When the pellets are resuspended (approximately 12 hr), the 80S ribosomes are pooled, frozen in liquid nitrogen, and stored at - 7 0 °" Ribosomal subunits are prepared by bringing the KCI concentration of 10,000 A26o units of 80S ribosomes in 50 ml of buffer C to 500 mM, followed by incubation at 37 ° in the presence of 2 m M puromycin for 20 min. The ribosomes are then applied to a 7.5 to 37.5% hyperbolic sucrose gradient made up in dissociation buffer and centrifuged essentially as described by Eikenberry et aL,tl except that the centrifugation step is carried out at 4 ° for 3.5 hr at 32,000 rpm (Ti 15 rotor; L5-65 Beckman centrifuge). The 40S ribosomal peak is collected and centrifuged for 14 hr at 30,000 rpm (Ti 45 rotor; L5-65 Beckman centrifuge). The pellets are resuspended in buffer C at 20 mg/ml, frozen in liquid nitrogen, and stored at - 7 0 o. The integrity of 18S rRNA is analyzed on SDS-sucrose gradients as previously described.12,13 Acknowledgments The authors would like to thank Drs. L. Ballou, P. Jen6, and J. Knesel for their critical reading of the manuscript. " E. F. Eikenberry, T. A. Bickle, R. R. Traut, and C. A. Price, Eur. £ Biochem, 12, 113 (1970). 12 G. Thomas, P. Bowman, M. Siegmann, and J. Gordon, Exp. CellRes. 108, 253 (1977). 13 G. Thomas, J. Gordon, and H. Rogg, J. Biol. Chem. 253, 1101 (1978).
[40] Pre-Steady-State Kinetic Studies on Ribosomal Translocation B y JAMES M. ROBERTSON, H A R A L D PAULSEN, and W O L F G A N G WINTERMEYER
After the formation of a peptide bond, the ribosome carries deacylated tRNA in the P site and peptidyl-tRNA in the A site, both being bound to METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formr~-~erved.
[40]
TRANSLOCATION KINETICS
581
pellets is a clear jellylike material that can easily be removed by inverting the tubes and centrifuging them at 3000 rpm for 10 s in a table-top clinical centrifuge. The ribosome pellets remain firmly fixed to the bottom of the tube and the gelatinous material slides to the top where it can be removed with a paper towel wrapped around a glass rod. Following removal of this material, 1 ml of buffer C and three glass beads (3 m m diameter) are added to each tube. The tubes are then placed on a table-top shaker and rotated at 100 rpm at 0 - 4 °. When the pellets are resuspended (approximately 12 hr), the 80S ribosomes are pooled, frozen in liquid nitrogen, and stored at - 7 0 °" Ribosomal subunits are prepared by bringing the KCI concentration of 10,000 A26o units of 80S ribosomes in 50 ml of buffer C to 500 mM, followed by incubation at 37 ° in the presence of 2 m M puromycin for 20 min. The ribosomes are then applied to a 7.5 to 37.5% hyperbolic sucrose gradient made up in dissociation buffer and centrifuged essentially as described by Eikenberry et aL,tl except that the centrifugation step is carried out at 4 ° for 3.5 hr at 32,000 rpm (Ti 15 rotor; L5-65 Beckman centrifuge). The 40S ribosomal peak is collected and centrifuged for 14 hr at 30,000 rpm (Ti 45 rotor; L5-65 Beckman centrifuge). The pellets are resuspended in buffer C at 20 mg/ml, frozen in liquid nitrogen, and stored at - 7 0 o. The integrity of 18S rRNA is analyzed on SDS-sucrose gradients as previously described.12,13 Acknowledgments The authors would like to thank Drs. L. Ballou, P. Jen6, and J. Knesel for their critical reading of the manuscript. " E. F. Eikenberry, T. A. Bickle, R. R. Traut, and C. A. Price, Eur. £ Biochem, 12, 113 (1970). 12 G. Thomas, P. Bowman, M. Siegmann, and J. Gordon, Exp. CellRes. 108, 253 (1977). 13 G. Thomas, J. Gordon, and H. Rogg, J. Biol. Chem. 253, 1101 (1978).
[40] Pre-Steady-State Kinetic Studies on Ribosomal Translocation B y JAMES M. ROBERTSON, H A R A L D PAULSEN, and W O L F G A N G WINTERMEYER
After the formation of a peptide bond, the ribosome carries deacylated tRNA in the P site and peptidyl-tRNA in the A site, both being bound to METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formr~-~erved.
582
RIBOSOME FUNCTION AND KINETICS
[40]
the mRNA by codon-anticodon interaction (pretranslocation complex). In the translocation reaction, which is catalyzed by an elongation factor (EF-G in Escherichia coh) and requires GTP, the deacylated tRNA is released from the P site and, at the same time, the peptidyl-tRNA is displaced from the A site to the P site, carrying the mRNA along. In the classical two-site model, the deacylated tRNA dissociates from the ribosome immediately following release from the P site. However, according to recent results, the mechanism of tRNA release during translocation involves transient binding of the leaving tRNA to another binding site (E site) ~-3 from which it spontaneously leaves the ribosome? For a mechanistic understanding of the translocation reaction, the biochemical information has to be complemented with structural, thermodynamic, and kinetic data characterizing the states of the ribosome before, during, and after translocation, as well as the transitions between them. For the kinetic characterization of individual reactions, pre-steady-state kinetic studies have to be performed. Given the fact that elongation in E. coli proceeds at a rate of 10-20 amino acids incorporated per ribosome per second, i.e., that one round of the elongation cycle takes only about 50-100 msec, it follows that the partial reactions of the cycle have to be studied by fast kinetic techniques. The present contribution describes the approach taken in our laboratory for studying the kinetics of partial reactions of translocation using the fluorescence stopped-flow technique. Principle Translocation is followed by monitoring the signal of ribosome-bound fluorescent tRNA P~ derivatives taking part in the reaction. The fluorescent tRNAs are placed into the ribosomal binding sites in such a way that either the release of deacylated tRNA r~ from the P site or the displacement of N-AcPhe-tRNAP~c from the A site to the P site can be studied. Complementary information is obtained (l) by using different fluorophores, (2) by placing fluorophores at different locations in the tRNA molecule, (3) by monitoring both fluorescence intensity and polarization, and (4) by measuring the fluorescence energy transfer changes between fluorophores in the P and A site-bound tRNA molecules. Fluorescent probes include wybutine, a hypermodified weakly fluorescent base naturally occurring 3' to the anticodon (position 37) of yeast tRNA P~, proflavine replacing H.-J. Rheinberger,H. Sternbach,and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 78, 5310 (1981). 2 S. V. Kirillov,E. M. Makarov,and Y. P. Semenkov,FEBSLett. 157, 91 (1983). 3R. Lill, J. M. Robertson,and W. Wintetmeyer,Biochemistry 23, 6710 (1984). 4 j. M. Robertson, H. Paulsen, and W. Wintermeyer, J. Mol. Biol. 192, 351 (1986).
[40]
TRANSLOCATION KINETICS
583
wybutine in the same position, and proflavine replacing dihydrouracil (positions 16/17) in the D loop. Pretranslocation complexes are prepared by first binding deacylated tRNA ~c to the P site and, subsequently, N-AcPhe-tRNAv~ to the A site of poly(U)-programmed ribosomes (see Procedures). Due to the extremely high stability of tRNA binding to both sites, exchange is not a problem. The translocation reaction is initiated by rapidly mixing the pretranslocation complex with EF-G in the stopped-flow apparatus. Materials The application of physical techniques for studying biochemical systems requires a very high purity and homogeneity of all components of the system. Otherwise, the mechanistic interpretation of multistep kinetics, as observed in the present studies, is very difficult or impossible. Thus, great care must be taken to use ribosomes, tRNAs, and EF-G of the highest purity and activity attainable. Ribosomes
Tight-couple 70S ribosomes are isolated form E. coli MRE 600 according to a published procedure which involves washing with buffer containing 0.5 M NH4C1 and zonal centrigation;5 care is taken to avoid mechanical damage during pelleting and resuspending the ribosomes. The ribosomes are free of elongation factors and endogenous GTPase activity. With respect to tRNA binding, the activity of different preparations according to this protocol varies between 60 atad 80% for all three tRNA binding sites, as determined by a two-step indicator binding assay) Ribosomes active in tRNA binding are at least 90% active in translocation and exhibit a high rate (5 sec-~ at 25 °) of polyphenylalanine synthesis (buffer A), when primed with N-AcPhe-tRNAv~ in the P site. 6 Ribosome concentrations are calculated from absorption measurements on the basis of 23 pmol/A26o unit and corrected for the actual tRNA binding activity of the particular ribosome preparation. tRNA
Yeast tRNA z*c is isolated from brewer's yeast tRNA (Boehringer Mannheim, FRG) by successive column chromatography on BD cellulose (Boehringer Mannheim) and Sepharose 4B (Pharmacia) as previously de5 j. M. Robertson, H. Paulsen, and W. Wintermeyer, J. Mol. Biol. 151, 57 (1981). 6 E. G. H. Wagner, P. Jelenc, M. Ehrenberg, and C. Kurland, Eur. J. Biochem. 122, 193 (1982).
584
RIBOSOME FUNCTION AND KINETICS
[40]
scribed;5 the charging capacity is 1.5 nmol Phe/A~o unit or better. E. coli tRNA TM is purchased from Boehringer Mannheim (charging capacity 1.3 nmol Phe/A26o unit) or from Subriden RNA, Rollingbay, WA (1.5 nmol Phe/A26o unit). N-AcPhe-tRNAz** was prepared by acetylation of Phe-tRNA ~ (charged with [14C]phenylalanine, specific activity 504 Ci/mol, Amersham) with acetic anhydride7 (yeast tRNA ~ ) or with the N-hydroxysuccinimide ester of acetic acids (E. coli tRNAW). Purification by BD-cellulose chromatography,5 involving elution with an ethanol gradient, yields N-AcPhe-tRNA~ containing 1.5- 1.7 nmol N-AcPhe/A26o unit. Concentrations of charged and uncharged tRNA ~ are calculated from absorption measurements in Mg2+-containing buffers on the basis of 1.8 nmol/A26o unit. 9
Fluorescent tRNA Derivatives Proflavine (Prf) is incorporated into either the anticodon loop or the D loop of yeast tRNA r~ by replacing wybutine (tRNApr~7) or dihydrouracil (tRNAv~6/~7), respectively, as previously described. I°,xl The charging capacity of both tRNAr*e-proflavine derivatives after isolation by RPC-5 chromatography, ~2is 1.3 nmol/A260 unit or better. N-AcPhe-tRNAvr~6/17 (1.6 nmol N-AcPhe/A260 unit) is prepared as described previously.5
Elongation Factor G EF-G is purified from EJcoli B to electrophoretic homogeneity.13,~4The concentration is determined colorimetrically15 on the basis of 12.9 pmol/#g.
Buffers Buffer A: 25 mMTris-HC1, pH 7.8, 50 mMNH4C1, 1 mMdithioerythritol, and 10 m M MgCI2; buffer B: 50 m M Tris-HC1, pH 7.6, 30 m M 7 A.-L. Haenni and F. Chapeville, Biochim. Biophys. Acta, 114, 135 (1966). s S. Rappoport and Y. Lapidot, this series, Vol. 29, p. 685. 9 M. Gu~ron and J. L. Leroy, Anal. Biochem. 91, 691 (1978). 10W. Wintermeyer, H.-G. Schleich, and H. G. Zachau, this series, Vol. 59, p. 110. 11 W. Wintermeyer and H. G. Zachau, Eur. J. Biochem. 98, 465 (1979). ~2R. L. Pearson, J. F. Weiss, and A. D. Kelmers, Biochim. Biophys. Acta 228, 770 (1971). 13 R. C. Marsh and A. Parrneggiani, Biochemistry 16, 1278 (1977). 14j. M. Robertson, C. Urbanke, (3. Chinali, W. Wintermeyer, and A. Parmeggiani, J. Mol. Biol. 189, 653 (1986). is M. M. Bradford, Anal. Biochem. 72, 248 (1976).
[40]
TRANSLOCATION KINETICS
585
NH4C1, 30 m M KCI, 1 m M dithioerythritol, and 10 m M magnesium acetate. Buffers of low ionic strength are chosen to achieve a high occupancy of the A site in the pretranslocation complexes, a vital requirement for the present experiments. Buffer A is used for the single-label experiments, buffer B is used for the fluorescence energy transfer experiments for historical reasons only; virtually identical results are obtained with the two buffers.
Stopped-Flow Apparatus Light from a mercury xenon lamp (200 W, Hanovia) is passed through two grating monochromators (stray light level about 10-6) and focused on the cuvette. Excitation is at 311 nm and 436 nm for wybutine and proflavine, respectively. Emitted light, after passing filters [proflavine: cut-off filter Schott KV 500; wybutine alone: cut-off filter Schott KV 399; wybutine in the presence of proflavine: band filter Schott SFK 20, 435 (___15) nm], is measured by two photomultipliers (EMI 9824B) placed at right angles to the excitation beam. For fluorescence polarization measurements, polarizing foils (4P W44, Kaesemann, Oberaudorf, FRG) are placed in the excitation and the two emission beams next to the cuvette. The degree of polarization P = ( A - B)/(A + B) is calculated from the vertically (A) and horizontally (B) polarized emission components by means of an analog computer. The signal is stored in a transient recorder (Biomation model 805; 2048 data points of 8 bits each), which is connected to a Tektronix 4052 computer. The solutions of the reactants are driven from two reservoirs through a four-jet mixing chamber (5/~1 volume) into the cuvette (a quartz capillary of 3 m m inner diameter and a volume of about 100/11) by nitrogen at a pressure of about 5 bar, the flow being controlled by an electromagnetically operated pneumatic valve at the outlet of the cuvette (Union Giken, Tokyo). The duration of the flow (for 80/zl of each solution) is about 30 msec and the average age of the reaction mixture in the cuvette after valve closure is about 10 msec. Procedures
Biochemical Assays of Translocation The amount of N-AcPhe-tRNAF*e (N-AcPhe-tRNApa~6/~7) bound to the A site before and to the P site after translocation is measured by adsorption of the complex on nitrocellulose filters3 (SM 11306, Sartorius). The fraction of P site-bound N-AcPhe-tRNAn~ is routinely determined by
586
RIBOSOME
FUNCTION AND KINETICS
[40]
the puromycin assay, 5 and the enhancement of the p u r o m y c i n reactivity after incubation o f the pretranslocation complex with EF-G and G T P is taken to represent the extent o f translocation o f N-AcPhe-tRNA Phi. During the kinetic experiments, these assays are run in parallel, using aliquots taken from the reactant solutions before the kinetic experiment or, in some experiments, from the outlet o f the stopped-flow cell. In the experiments shown below, at least 85% o f the initially A site-bound material is found in the P site following translocation. U n d e r certain conditions (e.g., in the presence o f an excess o f NAcPhe-tRNAPh~), more than the initially P site-bound N-AcPhe-tRNA Ph~ may react with puromycin, thus giving rise to artificially high values) This overreaction considerably limits the use o f the p u r o m y c i n reaction for the localization o f charged t R N A in the ribosomal binding sites. An alternative assay measured the extent o f translocation by the a m o u n t o f subsequently added N-AcPhe-tRNA ~c or ternary complex Phe-tRNA ~ - E F - T u - G T P , both of which bind to the A sites made available by translocation (Fig. 1).
LL
s
Phe-t
s
r-i o
4
EF-Tu-GTP
o.O~O~o
0
E c~
RNAPhe'-
0
,¢ z
9~ d
N-AcPhe-tRNA
Phe
°~o-o'°-°-°
3 z 4-"
o/
d ¢o
0
, 0
i
i
30
i
I
I
60
I
i
i
90
i
i
I
120
min
FIG. 1. Determining the extent of translocation by measuring A-site availability. To 0.9 ml of 0.16 pM puly(U)-programmed ribosomes (buffer A; 0.5 mMGTP) carrying E. coil tRNAph~in the P site was added 0.1 ml of 2.4 pM N-AePhe-tRNA~6/I 7 to bind to the A site (see Procedures). After the pretranslocation complex was formed, 1.0 ml of 1.6 ~ EF-G (0.5 mM GTP) was added, and translocation was allowed to proceed for some minutes. To measure the amount of A sites made available by translocation, 0.1 mi of either 0.6 pM N-AcPhe-tRNAT M or 0.12 ~ Phe-tRNA~'-EF~Tu-GTP was added (third arrow) and the incubation continued. The amount of ribosome-bound N-Ac(m4C)Phe((3)and N-Ac(a4C)Phe plus (~4C)Phe(Q) was determined by nitrocellulosefiltration. Experimental points represent 3.6 pmol of active ribosomes each. From Robertson et al.4
[40]
TRANSLOCATIONKINETICS
587
Preparation of Pretranslocation Complexes For the experiments on the displacement reaction, ribosomal complexes are used which contain nonfluorescent E. coli tRNA ~ in the P site and N-AcPhe-tRNA~e carrying the fluorophor in the A site. The complexes are prepared by a two-step incubation procedure. 5 To block the P site, ribosomes (1 nmol) are incubated with poly(U) (1.2 A260 unit/ml) in 0.8 ml buffer A for 5 min at 37 °, whereupon 1.3 nmol (0.1 ml) E. coli tRNA me is added, and the incubation continued at 25 ° for another 20 min. To the P site-blocked ribosomes is added 1 nmol (0.1 ml) of N-AcPhe-tRNA~ (N-AcPhe-tRNAt~6/~7), and the incubation is continued for 1 hr at 25 °. Usually, the complexes are purified from unbound fluorescent N-AcPhe-tRNA~ by ultracentrifugation (see below). Pretranslocation complexes used for the release experiments are prepared in an analogous manner with the following modifications. The P site binding reaction is performed with a one-to-one stoichiometric amount of fluorescent tRNA v*', and nonfluorescent E. coli N-AcPhe-tRNA~ is added in 1.3-fold molar excess in the second incubation. The centrifugation step is omitted, since under these conditions there is virtually no unbound deacylated tRNA ~ present in the complex preparation. For the energy transfer experiments, pretranslocation complexes containing fluorescent tRNAs in both A and P sites are prepared in a similar fashion, ~6 except that buffer B is used and that stoichiometric ratios, relative to ribosomes, of fluorescent deacylated tRNA w and fluorescent NAcPhe-tRNA ~ are maintained in the two binding steps. The centrifugation is omitted.
Purification of Pretranslocation Complexes by Centrifugation The solution of the complex (1 ml) is layered over 1 ml of buffer A containing 20% (w/v) sucrose and 1 A26ounit of poly(U). After centrifugation for 3 hr at 30,000 rpm in the Beckman Ti 50 rotor (7°), the sucrose buffer is removed and the pellets are washed with 1 ml buffer A and gently resuspended in about 0.2 ml of buffer A containing 1 A26o unit poly(U)/ ml, the whole procedure taking not more than 5 min. This solution is used for the stopped-flow experiments, after adjusting the concentration of ribosomal complexes to 0.16 # M and adding GTP.
Stopped-Flow Experiments Translocation is initiated by rapidly mixing equal volumes (about 80/tl each) of the solutions containing the pretranslocation complex and ~6H. Paulsen, J. M. Robertson, and W. Wintermeyer, Nucleic Acids Res. 10, 2651 (1982).
588
RIBOSOME FUNCTION AND KINETICS
[40]
EF-G with GTP, respectively. If not stated otherwise, the final concentrations, after mixing, are 0.08 # M ribosomes, 0.8 g M EF-G, 0.5 m M GTP, and 0.5 A2~ounits/ml of poly(U). All experiments are performed at 20 °.
Data Evaluation The kinetic curves are evaluated by fitting of two or three exponential terms, yielding amplitudes (A) and apparent first-order rate constants (kin,). Fast and slow reactions are evaluated from measurements in at least two time ranges. In some experiments, the time constants obtained for the slower reaction step are used as a fixed parameter in the evaluation of the faster one. Two fitting procedures are used. First, electronically generated exponential functions are visually fitted to the experimental curves displayed on an oscilloscope. These parameters are then used as starting values for a least-squares exponential fitting program run on a Tektronix 4052 computer. The accuracy of the time constants and amplitudes, estimated from the variation of at least five determinations, is better than + 15% and _+ 10%, respectively. I
A 1.10
oc~ o Ii
1.05
1.00
I
I
I
I
0
10
20
30 sec
FIG. 2. Time course of the displacement of N-AcPhe-tRNA~ derivatives from the A site of pretranslocative ribosomes. (A) Fluorescence intensityand (B) fluorescence polarization of proflavine in N-AcPhe-tRNAF,~6/mT,(C) wybutine fluorescence of N-AcPhe-tRNA~ . See Procedures for the preparation of the pretranslocation complexes and the performance of the stopped-flow experiments. The kinetic curves were evaluated by either two-exponential (A, B) or three-exponential (C) fitting (smooth lines); the resulting kinetic parameters are given in Table II. According to the puromycin assay, performed in parallel with portions of the reaction mixtures, translocation was at least 85% efficient in all three experiments. From Robertson et al. 4
[40]
TRANSLOCATION KINETICS I
I
I
589 I
0.40
0.39
g N
0.38
CI O-
0 37
0,36 I
I
50
I
100
150
200 sec
I
i
i
i
!
i
C
1.00 t-
0.98 o LL
0
0.96
0.9/, 0.92 0.90 I
I
t
I
I
i
0
20
40
60
80
100 sec
Results The fluorescence properties of the tRNA ~c and N-AcPhe-tRNA T M derivatives exhibit characteristic differences between the unbound and the ribosome-bound states and also between the different ribosomal binding sites? ,'6 The differences are utilized to follow either the displacement of the N-AcPheotRNA ~ derivatives from the A site to the P site (Fig. 2) or the
590
RIBOSOME FUNCTION AND KINETICS
[40]
I
I
I
I
I
I
I
1
I
I
I
1
l
I
I
E 0
-I 0
2
4
6 sec
FXG. 3. Time course of the release of tRNA~--~6/17 from the P site of pretranslocative ribosomes. Upon mixing with EF-G of the pretranslocation complex carrying tRNAI~6/t7in the P site and E. coil N-AcPhe-tRNAT M in the A site (see Procedures for the preparation of the complex), the fluorescence intensity of proflavine was monitored. The parameters obtained by two-exponential fitting (smooth line) arc listed in Table III. From Robertson et al.4
i
,
i
/°
0.2
~n
01
e~
O 2¢ O
/ O
/
O
I
0
I
0.5 1.0 EF-G concentration ( pM )
I
1.5
FIG. 4. Dependence on the concentration of EF-G of the rate of the displacement of N-AcPhe-tRNAp~6/17 from the A site. The fluorescence change associated with the displacement on N-AcPhetRNAI~6/17 (cf. Fig. 2A) was measured upon addition of increasing amounts of EF-G to the pretranslocation complex (0.08 #M) (O, k,~ l; O, k,pp2)- For experimental details see Procedures. The estimation of the binding constant of EF-G-GTP from the titration curve of k.~l is described in the text. From Robertson et al.4
[40]
TRANSLOCATIONKINETICS
591
release of the tRNA z*e derivatives from the P site into the E site as well as their dissociation from the E site into solution (Fig. 3). The rate of the displacement reaction, which depends on the concentration of EF-G, can be employed as an indicator to follow the titration of the pretranslocation complex with EF-G and to determine the binding constant of this short-lived complex (Fig. 4). In another set of experiments, the decrease of the efficiency of fluorescence energy transfer between A site-bound proflavine-labeled N-AcPhetRNA Phe and P site-bound wybutine-containing tRNA TM taking place upon translocation is monitored to follow the distance changes between the anticodon loops of the two tRNAs during the reaction (Fig. 5).
Displacement Flowing EF-G against a pretranslocation complex containing NAcPhe-tRNA~6/~7 in the A site results in biphasic changes of both intensity and polarization of proflavine fluorescence, taking place in different time ranges (Fig. 2A,B). Two-exponential fitting of the data yields the apparent first-order rate constants summarized in Table I. The two observables provide complementary information, in that the fluorescence intensity monitors a fast (2-3 sec-~) and an intermediate (0. 1-0.3 sec-~) step, while the polarization shows the intermediate and an additional slow step (0.01 -0.02 sec-~). All three steps are reported in the analogous experiment monitored by the fluorescence changes ofwybutine (Fig. 2C; Table I). This result is quite important by showing that the signal change observed with the proflavine label is not an artifact. Control experiments without EF-G or GTP, and with Phe-tRNA~16/~7 (which is not translocated at all) instead of N-AcPhe-tRNA~6/~7 in the A site, showed no effect. Furthermore, in the presence of fusidic acid, which is known to inhibit the dissociation of EF-G after GTP hydrolysis) 7 the same three kinetic steps were observed, whereas with viomycin, an inhibitor of translocation, TM all three reactions were suppressed. These results show that the observed signal changes are due to the displacement of the N-AcPhe-tRNAr~ derivative from the A site to the P site and not caused by the binding or dissociation of EF-G.
Release The release of deacylated tRNA ~ from the P site of the pretranslocation complex, induced by EF-G, was also studied with both fluorophores ~7j. W. Bodley, F. J. Zieve, and L. Lin, J. Biol. Chem. 245, 5662 (1970). 18 M. Misumi and N. Tanaka, Biochim. Biophys. Acta 92, 647 (1980).
592
[40]
RIBOSOME FUNCTION AND KINETICS
A 1.3 8 c (J
o
1.2
cO
1.t
0._
1.0
I
i
0
50
i
I
100
I
I
I
t50
200
I
sec
I
1.00
c:
0.99
u
g
0.98
=~ 0.97
~" 0.96 0,95
0
I
I
I
I
20
/,0
60
80
I
100 sec
FtO. 5. Time course of tnmslocation as followed by the fluorescence energy transfer bctwcen N-AcPhe-tRNA v~ and tRNAv~7, initially bound to the A and P sites, respectively.
(A) Emission above 500 nm, mainly due to sensitized proflavine emission (with proflavine
alone the fluorescencedecreasewas only 6%);(B) wybutineemissionaround435 nm (forthe fluorescence change in the absence of acceptor, see Fig. IC). From Paulsen and Wintermeyer. 19
employing as observables both intensity and polarization of fluorescence. An example with tRNA~6/17 is shown in Fig. 2, the results of several experiments are summarized in Table II. Thus, the release reaction of translocation also gives rise to three kinetically distinguishable steps, fast, intermediate, and slow, the respective time rates of which are similar to the ones observed in the displacement experiments.
[40]
TRANSLOCATION KINETICS
593
TABLE I KINETIC PARAMETERS OF THE DISPLACEMENT OF N - A e P h e - t R N A ~
DERIVATIVESa
% o f final signal
Fluorophore Prfl 6/17 (Fluo) P r f l 6 / 1 7 (Pol) Wye37 (Fluo)
(see-1)
(sec-i)
(sot-')
AI
A2
.43
2.9 -1.7
0.2 0.1 0.3
-0.013 0.018
4.0 --2.3
4.3 -3.3 -- 1.7
--3.9 -2.2
a Apparent first-order rate constants were determined with ± 15% accuracy. The signs of the relative amplitudes (accuracy _+0.5) indicate an increase (+) or a decrease ( - ) o f the signal. Fluorescence intensity (Fluo) or polarization (Pol) were measured as described in Procedures. Experiments performed in buffer A at 20* as in Fig. 2.
Complexes with unoccupied A sites, which in filtration experiments do not exhibit EF-G-induced release of P site-bound tRNA t~, did not show any signal change, although EF-G does bind to such complexes. This indicates that the signal changes seen in the release experiments indeed are due to EF-G-induced tRNA release from the P site.
tRNA Dissociation from the Ribosome After translocation, one fraction of the tRNA released from the P site dissociates from the ribosome while another remains bound. The latter complexes contain the tRNA bound to the E site in a labile fashion, and the tRNA can be chased from the E site very rapidly and efficiently by adding an excess of unlabeled tRNA. To determine the dissociation rate, such experiments are performed by flowing posttranslocative ribosomes containing N-AcPhe-tRNA Pt~ in the P site and tRNA~6/I 7 (or tRNAprr~7) in the E site against an excess of nonfluorescent tRNA ~ from E. coli in the T A B L E II KINETIC PARAMETERS OF THE RELEASE OF t R N A pt~ DERIVATIVES FROM THE P SITE DURING TRANSLOCATIONa
% of final signal Fluorophore P r f l 6 / 1 7 (Fluo) Wye37 (Fluo) Prf37 (Pol)
ka~ (see- i)
k.~2
kay3
(sec- l)
(see- l)
At
A2
A3
4.5 1.5 --
0.18 0.15 0.10
--0.014
3.9 -- 1.4 --
-2.1 -2.9 -4.6
m
a For explanations see Table I.
-4.3
594
[40]
RIBOSOME FUNCTION AND KINETICS TABLE III KINETIC PARAMETERSOF tRNA l'~ DISSOCIATIONFROM THE E
SITEa
E site occupied by
~ (sec- t)
~ (sec- 1)
AI (%)
A2 (%)
Tmnslocation Binding
0.40 0.53
0.07 0.07
7 8
10 20
° tRNA~6/I 7 was bound to the E site either by translocation from the P site (see Procedures) or by adding a stoiehiometric amount to ribosomes carrying nonfluorescent N-AcPhe-tRNA~* in both P and A sites. The dissociation was initiated by rapidly mixing the complex with a 10-fold excess of tRNA ~e from E. coli in the stopped-flow apparatus, and the decrease of proflavine fluorescence was monitored. Dissociation rate constants ( ~ , 2 ) were determined from the kinetic curves by two-exponential parameter fitting. Buffer A, 15 raM Mg2+.
stopped-flow apparatus. In these experiments, a biphasic decay of both the fluorescence intensity and polarization is observed (Table III), indicating that the E site complex exists in at least two states, characterized by different stabilities against dissociation.
Kinetic Titration of EF-G-GTP Binding to the Pretranslocation Complex The affinity of EF-G- GTP to the pretranslocation complex, due to the rapid translocation followed by GTP hydrolysis, cannot be measured by equilibrium titrations. A binding constant has been measured only with a nonhydrolyzable GTP analog. To determine the binding constant in the presence of GTP, we have utilized the dependence of the rates measured for the partial reactions of translocation by the stopped-flow technique upon the concentration of EF-G (Fig. 3). The saturation curve obtained for k~,~ was evaluated by fitting a two-step model, in which the binding of EF-G (G) to the pretranslocation complex (R) is followed by a rearrangement of the complex R. G, i.e., the displacement of the two tRNAs, to form an intermediate complex R. G*; due to the very rapid hydrolysis of GTP, the back reaction (k-l) can be neglected, and, at saturation, k . , , l = k,. Ko kl R + G~R.G---* R'G* kar~l = k,K, co/(1 + K, co)
Fitting this model to the data yields an association constant for the binding of EF-G-GTP to the pretranslocation complex of K, = 2 × 10 7 M -1 (20*).
[40]
TRANSLOCATION KINETICS
595
TABLE IV FLUORESCENCE ENERGY TRANSFER CHANGES DURING TRANSLOCATION a
Relative emission after the reaction steps
Reaction step Initial Fast In~rmediate Slow
Acceptor + donor 1
Acceptor alone 2
Donor + acceptor 3
Sensitized acceptor 4
Energy transfer
171 165 142 127
104 103 102 100
11 13 18 18
56 49 22 9
0.88 0.78 0.35 0.15
a The three-step fluorescence changes (emission above 500 nm) of Fig. 5 are normalized to the
emission of unbound t R N A ~ 7 , set to 100. The contribution of the wybutine fluorescence to the total emission above 500 nm was calculated from the emission measured at 435 n m in the presence of the acceptor proflavine, which does not significantly emit at this wavelength. The fraction of proflavine fluorescence due to energy transfer (4) was calculated as the difference 1 minus 2 minus 3. From the sensitized emission of proflavine the efficiency of energy transfer was calculated as previously described. 2°
Kinetic FluorescenceEnergy Transfer Measurements Steady-state energy transfer data show that, after translocation, the distances between the anticodon loops of the tRNAs remaining bound to the P and E sites are significantly larger than the one between A and P sites. '9a° Thus, not only the dissociation of the leaving tRNA, but also its transition from the P site to the E site, as well as any separation of the two tRNA molecules during the displacement step, are reflected in a lowering of the energy transfer efficiency in a kinetic translocation experiment. We have performed such experiments with pretranslocation complexes carrying the acceptor-containing tRNAv~7 in the P site and the donorcontaining N-AcPhe-tRNA~ in the A site. The decrease of the energy transfer efficiency could be monitored by the increase of the fluorescence of the donor (wybutine) or by the decrease in the fluorescence of the acceptor (proflavine) (Fig. 4). The major part of the signal changes is due to energy transfer changes, as is evident from the control experiments with the individual labels which show much smaller amplitudes. The decrease of the sensitized fluorescence of proflavine was triphasic (Table IV), the time constants being similar to the ones obtained in the single-label dis,9 H. Paulsen and W. Wintermeyer, Biochemistry 25, 2749 (1986). 2o H. Paulsen, J. M. Robertson, and W. Wintermeyer, J. Mol. Biol. 167, 411 (1983).
596
RIBOSOME FUNCTION AND KINETICS
[40]
placement or release experiments. The major effect occurred during the intermediate step, while the fast step had only a small amplitude. Provided the reaction under study is homogeneous, a change of the efficiency of energy transfer may be evaluated in terms of a distance change. ~9,2°Of the three steps of Fig. 3, the condition is fulfilled for the fast step. Relating the transfer efficiency after the fast step, 0.78, to that in the pretranslocation complex, 0.88, which corresponds to a distance of 23 + 6 between the anticodons of P and A site-bound tRNAs, 2° a distance of 25 + 6 A is obtained. This results suggests that, during the fast displacement step of translocation, the anticodons of the two tRNAs do not come apart significantly. In contrast, the large amplitude of the intermediate step indicates that the tRNAs are separated to a large extent. The distance cannot be specified, however, since, as discussed below, during that step, E site binding and dissociation from the ribosomes of the leaving tRNA take place in parallel.
Conclusions The results of the kinetic experiments allow several conclusions to be reached regarding the mechanism of translocation as studied with pretranslocation complexes with deacylated tRNA ~ in the P site and NAcPhe-tRNAn~ in the A site. 1. Both the release of the tRNA r~ from the P site and the displacement of the N-AcPhe-tRNA~ from the A site to the P site are resolved into the same three steps. The fast step ( 3 - 5 sec-~) is due to the concomitant displacement of both tRNAs (together with the mRNA) from their respective binding sites. After this step, an intermediate posttranslocation complex has formed which carries N-AcPhe-tRNAr~ in the P site and tRNA r~e in a state which differs from, but is probably related to, the E site-bound state. In the intermediate, short-lived state, the leaving tRNA most likely is still in contact with the mRNA. 2. During the following step (0.1-0.3 sec-m), the intermediate posttranslocation complex reacts further in two ways: (i) It loses tRNA to form the classical posttranslocation complex carrying only peptidyl-tRNA (NAcPhe-tRNAw ) in the P site; (ii) it rearranges to form a posttranslocation complex which has tRNA ~ bound to the E site. In the latter state, there is no longer any codon-anticodon interaction in the E site. 3. In the E site, the tRNA z*e is bound in at least two different ways. In both of them it is bound in a labile fashion and dissociates spontaneously, albeit at different rates.
[41]
tRNA BINDING ASSAY
597
Remarks The fluorescence stopped-flow technique has proved to be a sensitive method which allows one to work with concentrations around 1 0 - 7 M , even with fluorophores with relatively low quantum yields (e.g., wybutine below 10%); in favorable cases, such as proflavine (quantum yield 3050%), at least 10-fold lower concentrations are attainable at reasonable signal-to-noise ratios. The parallel measurement of both intensity and polarization of fluorescence in many cases provides complementary information. In addition, the polarization values contain valuable structural information. The use of energy transfer-modulated fluorescence as an observable in kinetic measurements offers several advantages as compared to singlechromophore experiments. First of all, the amplitudes of the signal changes are larger. Furthermore, the amplitudes, which usually do not yield much information, can in the case of energy transfer changes be interpreted in terms of changes of distances between donor and acceptor fluorophores in the particular reaction steps. Finally, due to the dependence of the energy transfer efficiency on both separation and orientation of the fluorophores, structural transitions, which may not show up in the signals of the individual fluorophores, will in the double-label experiment be reported by energy transfer changes with high probability.
[41] Q u a n t i t a t i v e I n d i c a t o r A s s a y o f t R N A B i n d i n g t o the Ribosomal P and A Sites B y R O L A N D LILL a n d W O L F G A N G W I N T E R M E Y E R
The capacity of tRNA binding is an important criterion to characterize the quality of ribosomes. In particular, any quantitative study of tRNAribosome interactions presupposes an exact knowledge of the concentration of those ribosomes (and tRNA molecules) which are capable of taking part in the interaction. Generally, the tRNA-binding activity of ribosomes has been determined by saturation titrations. The interpretation of saturation levels is complicated, however, by the fact that there are two (P and A sites) or three (P, A, and E sites i-a) ribosomal binding sites for aminoacyli H.-J. Rheinberger, H. Sternbach, and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 78, 5310 (1981). 2 S. V. Kirillov, E. M. Makarov, and Y. P. Semenkov, FEBSLett. 157, 91 (1983). 3 R. Lill, J. M. Robertson, and W. Wintermeyer, Biochemistry 23, 6710 (1984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
[41]
tRNA BINDING ASSAY
597
Remarks The fluorescence stopped-flow technique has proved to be a sensitive method which allows one to work with concentrations around 1 0 - 7 M , even with fluorophores with relatively low quantum yields (e.g., wybutine below 10%); in favorable cases, such as proflavine (quantum yield 3050%), at least 10-fold lower concentrations are attainable at reasonable signal-to-noise ratios. The parallel measurement of both intensity and polarization of fluorescence in many cases provides complementary information. In addition, the polarization values contain valuable structural information. The use of energy transfer-modulated fluorescence as an observable in kinetic measurements offers several advantages as compared to singlechromophore experiments. First of all, the amplitudes of the signal changes are larger. Furthermore, the amplitudes, which usually do not yield much information, can in the case of energy transfer changes be interpreted in terms of changes of distances between donor and acceptor fluorophores in the particular reaction steps. Finally, due to the dependence of the energy transfer efficiency on both separation and orientation of the fluorophores, structural transitions, which may not show up in the signals of the individual fluorophores, will in the double-label experiment be reported by energy transfer changes with high probability.
[41] Q u a n t i t a t i v e I n d i c a t o r A s s a y o f t R N A B i n d i n g t o the Ribosomal P and A Sites B y R O L A N D LILL a n d W O L F G A N G W I N T E R M E Y E R
The capacity of tRNA binding is an important criterion to characterize the quality of ribosomes. In particular, any quantitative study of tRNAribosome interactions presupposes an exact knowledge of the concentration of those ribosomes (and tRNA molecules) which are capable of taking part in the interaction. Generally, the tRNA-binding activity of ribosomes has been determined by saturation titrations. The interpretation of saturation levels is complicated, however, by the fact that there are two (P and A sites) or three (P, A, and E sites i-a) ribosomal binding sites for aminoacyli H.-J. Rheinberger, H. Sternbach, and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 78, 5310 (1981). 2 S. V. Kirillov, E. M. Makarov, and Y. P. Semenkov, FEBSLett. 157, 91 (1983). 3 R. Lill, J. M. Robertson, and W. Wintermeyer, Biochemistry 23, 6710 (1984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
598
RIBOSOME FUNCTION AND KINETICS
[41]
ated or deacylated tRNA, respectively. Thus, in addition to the overall stoichiometry, the saturation of each site has to be determined separately. This requires the localization of the tRNA in the respective site by biochemical means. For deacylated tRNA the location cannot be determined directly. It can be inferred, however, from the inhibition of the subsequent binding of aminoacylated tRNA (cf. below). The site location of aminoacylated tRNAs, particularly N-blocked ones such as N-AcPhe-tRNA abe, usually is defined by the ability, or inability, of the ribosome-bound material to react with puromycin. Reactivity toward puromycin is thought to indicate P-site location, while nonreactive material is thought to be bound to the A site. Under conditions of ribosome excess the assay provides valid results. However, when N-AcPhe-tRNA ph~ is in excess relative to ribosomes, as is the case at saturation, the yield of the puromycin reaction does not necessarily reflect only the amount of P-sitebound charged tRNA, but tends to be higher. 3,4 Under those conditions, the puromycin reactivity alone must not be taken as evidence indicating P site location. Another problem of saturation titrations with aminoacylated tRNA is the fact that charged and uncharged tRNAs bind to P and A sites with comparable affinities and stabilities. Thus, the attainable saturation level, as measured by the amount of ribosome-bound aminoacylated tRNA, is lowered by any deacylated tRNA being present in the aminoacyl-tRNA preparation; additional difficulties are created by the different specificity of the ribosomal sites for charged and uncharged tRNA. 3 To escape potential misinterpretations of saturation binding plateaus, we have developed a two-step indicator binding assay. The assay allows one to monitor tRNA binding to the ribosomal P and A sites separately. Additional advantages are that the tRNA under study does not need to be labeled, and that the charging level of the indicator tRNA is not critical. Principle The assay is based on the fact that upon fitrating poly(U)-programmed ribosomes with tRNA z*~ (or N-AcPhe-tRNA ~ac) the P and A sites are filled sequentially, the P site being occupied first. 5 The decrease of the number of unoccupied P rites during the titration can be determined from the puromycin reactivity of a small amount, relative to ribosomes, of 4 The overreactionis too fast to be attributed to the dissociationof discharged tRNAT M from the P site and subsequent binding of N-AcPhe-tRNAw. It probably reflects a transient binding of excessN-AcPhe-tRNAT M to the ribosomes,during which it reactswith puromycin. The binding site is not known. s S. Watanabe, J. Mol. Biol. 67, 443 (1972).
[4 1]
tRNA BINDING ASSAY
599
N-Ac[~4C]Phe-tRNA ~ added in a subsequent incubation ("indicator reaction"). In an analogous manner, unoccupied A sites can be measured by using the ternary complex [t4C]Phe-tRNAn~-EF-Tu-GTP, which specifically binds to the A site, as an indicator. Owing to the high stability of the t R N A - r i b o s o m e complexes, 6 an appreciable exchange of the tRNA bound in the first step with the indicator tRNA during the (relatively short) second incubation is precluded, and the two incubation steps can be treated as independent reactions. The assay has been used for the determination of binding stoichiometries, i.e., of the tRNA-binding capacities of P and A sites. On the other hand, the assay can be used to characterize tRNAs with respect to their efficiency of ribosome interaction. Under appropriate reaction conditions, the indicator assay is also suitable for the determination of binding constants. In the following, examples are provided illustrating those applications of the assay. Materials Buffers Buffer A: 50 m M Tris-HC1, pH 7.5, 50 m M KC1, 90 m M NH4CI, 1 m M dithioerythritol, 20 m M magnesium acetate; buffer B: 50 m M TrisHC1, pH 7.5, 30 mMKC1, 30 mMNH4C1, 1 mMdithioerythritol, 10 m M magnesium acetate. Ribosomes Tight-couple 70S ribosomes are isolated from Escherichia coli M R E 600 according to a published procedure. 7 The tRNA-binding activity of different preparations varies between 65 and 80%, as determined by the indicator binding assay described here. Ribosome concentrations are calculated from absorption measurements on the basis of 23 pmol/A26o unit; where indicated the figures given are corrected for the actual RNA-binding activity. tRNA Yeast tRNA ~e is isolated from brewer's yeast tRNA (Boehringer Mannheim, FRG) as previously described; 7 the charging capacity is 1.5 6The half-lives of dissociation of deacylated tRNA~ at 20(10) mM Mg2+ are 10(8)hr for the P site and 2(1) hr for the A site. Similar numbers, but reversed for P and A sites, were found for N-AcPhe-tRNApt~. 7j. M. Robertsonand W. Wintermeyer,J. Mol. Biol. 151, 57 (1981).
600
RIBOSOME FUNCTION AND KINETICS
[41 ]
nmol Phe/A26o unit or better. E. coli tRNA v~ is purchased from Boehringer Mannheim (charging capacity 1.3 nmol Phe/A26o unit) or from Subriden RNA, Rollingbay, WA (1.5 nmol Phe/A26o unit). Phe-tRNA ~c is prepared by incubating yeast tRNA ~ (up to 5/zM) for 30 min at 37 ° in buffer A (or B) containing 50/~/L-[14C]phenylalanine (10 or 504 Ci/mol; Amersham), 8 3 m M ATP, 0.3 m M GTP, 6 m M phosphoenol pyruvate, pyruvate kinase (10/tg/ml), and either purified phenylalanyl-tRNA synthetase from yeast (1.5 mU/ml) 9 or 0.5 A2a0 unit/ml o f a DEAE-cellulose-purified yeast extract. For the aminoacylation of E. coli tRNA v~, the enzyme is partially purified from an extract of E. coli M R E 600 by successive chromatography on DEAE-Sepharose CL-6B (Pharmacia) and hydroxyapatite. N-AcPhe-tRNA n~ is prepared by acetylation of Phe-tRNA n~ with the N-hydroxysuccinimide ester of acetic acid.l° The material usually contains 1.4 nmol N-AcPhe/A26o unit, which is sufficient for use as an indicator. Purification by BD-cellulose chromatography, 7 involving elution with an ethanol gradient, yields N-AcPhe-tRNA n~ containing 1.5-1.7 nmol NAcPhe/A26o unit. Concentrations of charged and uncharged tRNA 1~ are calculated from absorption measurements in Mg2+-containing buffers on the basis of 1.8 nmol/A26o unit. H Elongation Factor Tu
EF-Tu is isolated from E. coli MRE 600 following a published procedure, 12 except that cells are opened by alumina grinding, and that 10 G D P is present throughout the preparation. The protein is further purified by crystallization m3and appears at least 99% pure on SDS-polyacrylamide gel electrophoresis. Concentrations on EF-Tu are determined by quantitating the stimulation of A-site binding of Phe-tRNA l~. Ternary Complex
The complex [14C]Phe-tRNAW-EF-Tu-GTP is formed by adding a twofold excess of EF-Tu, relative to Phe-tRNA ~ , to the aminoacylation mixture given above and incubating for 10 min at 20 °. s The indication of the 14C label is omitted for the material charged with low specific radioactivity. 9R. Hirseh and H. G. Zaehau, Hoppe-Seyler's Z. Physiol. Chem. 357, 509 (1976). ,o S. Rappoportand Y. Lapidot, this series, Vol. 29, p. 685. 1, M. Gutron and J. L. Leroy,Anal. Biochem. 91, 691 (1978). ~ R. Leberman, B. Antonsson, R. Giovanelli, R. Guariguata, R. Schumann, and A. Wittinghofer, Anal Biochem. 104, 29 (1980). 13G. Chinali, H. Wolf,and A. Parmeggiani, Eur. J. Biochem. 75, 55 (1977).
[41]
tRNA
BINDING ASSAY
601
Procedures
Determination of Binding Stoichiometries To ensure stoichiometric uptake of added tRNA, the concentration of ribosomes is kept around 0.5 #M, i.e., well above the dissociation constants of the complexes to be studied. The titrations (Fig. 1) are performed by incubating, in a final volume of 50 ~tl, up to 1 # M (P-site titrations) or 2 / I M (A-site titrations) tRNA ~ or N-AcPhe-tRNA n~ with the ribosomes in buffer A (or B, which for the P site yields equivalent results) containing 1 A26o unit/ml of poly(U). The mixtures are incubated at 20 ° for 30 min (buffer A) or 90 min (buffer B). Subsequently, the indicator reactions are started by the addition (5/~1) of 15% (relative to ribosomes) of either N-Ac[14C]Phe-tRNAZ*" (P site) or [14C]Phe-tRNAr~-EF-Tu-GTP (A
i
1.0
>=
" Z ~ ~ ~.,
i
i
i
0
~O
•
o
U
";<0.8
c:
Z
E o ~, $ 9O6
~7
i
\ °Po~RNAPhe-E-TFu-GTP
i
z~
E .a "-
0.2
-
" " ' ~ ' ~ : A ......_ A _ _ I t
~'
N-AcPhe
- t R N A Phe
I
I
I
2
3
/~
Input of tRNA Phe per ribosome FIG. 1. Indicator titrations of the ribosomal P and A sites. Increasing amounts of either yeast tRNA T M (A), N-AcPhe-tRNAT M (B), or E. coli [32p]tRNA ~ (C) were incubated with ribosomes in buffer A and the indicator reactions performed with N-Ac[t4C]Phe-tRNA ~ for the P site and with [~4C]Phe-tRNAP~-EF-Tu-GTP for the A site as described under Procedures. Amounts of puromycin-reactive N-Ac[14C]Phe-tRNA~ (A) and of [14C]Phe-tRNA~ adsorbed to nitrocellulose filters (O) are given relative to the respective input amounts. The solid lines represent the fits obtained by the procedure described under Evaluation. The resulting fractions of active P sites (0.65), P plus A sites (1.3), or P plus E plus A sites (1.9) are indicated by dotted lines. Also shown in (C) is the amount of s2P-labeled E. coli tRNA ~ bound to the active fraction of ribosomes (Q), as measured by adsorption to nitrocellulose filters. From Lill et at.a Copyright 1984 American Chemical Society. (Figure continues.)
602
[41 ]
RIBOSOME F U N C T I O N A N D KINETICS
s
1.0
\ o ~\
*d i
B
E S
0.6
& c
"oc 0.4
t
°~he
- tRNAPhe--EF-Tu--GTP
0 o
°
0.2 &
~o
°
o
o
&
N - A c P h e - t R N A Phe
1 2 3 Input of N - A c - P h e - t R N A Phe per ribosome
4
3
[32p] tRNAPhe
,-
i "°,~,
Z
/
c
'~
C
¢0
E o o L.
-,~
2
o
7
~o.5
/
o
,
\
r
E .-.
• ~
Z o¢"
Phe - t RNAPhe--EF-Tu-GTP
o
/
c~
0
2
z~-
N - A c P h e - t R N A Phe
~ 6 8 Input of [32p]tRNAPhe per ribosome
10
FIO. 1 (Continued)
site) in the respective titration buffer, and the incubation continued for 15 min or 30 sec, respectively. To measure the amount of P-site-bound N-Ac[14C]Phe-tRNA ~ , 5 gl of 10 m M puromycin in buffer is added and the mixture incubated for
[41 ]
tRNA BINDING ASSAY
603
another 7 min at 37 °. N-Ac[~4C]Phe-puromycin is extracted and measured as previously described. 7 A site-bound [14C]Phe-tRNA~ is determined by adsorbing the ribosome complexes on nitrocellulose filters (Sartorius SM 11306). 7
Determination of Binding Constants The above procedure is applied with some alterations. To achieve equilibrium conditions, the concentration of ribosomes is chosen around the dissociation constant of the complex to be studied. In addition, to increase the sensitivity of the assay, a higher amount of indicator relative to ribosomes (up to stoichiometric) is used. See Fig. 2 for a protocol used for A-site titrations and Fig. 3 for an example of nonstoichiometric P-site binding of a low-affinity tRNA ~e derivative.
i
1.0
Q. Z i fl_
0.s
so
g 0.~
E o
0.2 O--
0 0
t
t
I
I
I
1
2
3
/,
5
tRNA added (IJM}
FIG. 2. Indicator titration of the A rite. P-site-blocked ribosomes (0.3 #M; arrow) were titrated with N-AcPhe-tRNAphe (dosed symbols) or with yeast tRNA ~ (open symbols) in buffer B and incubated for 90 rain. Then [Iq~]Phe-tRNAP~-EF-Tu-GTP (final concentration 0.1 gM) was added and ribosome-bound [1~C]Phe-tRNAph~ isolated by nitrocellulose filtration after 30 see. From the titration curves the binding constants of the A site were estimated by computer fitting (see Evaluation) (solid lines). The figures obtained correspond to binding constants measured by other methods (Table I). From Lill et a l l 7 Copyright 1986 American Chemical Society.
604
RIBOSOME FUNCTION AND KINETICS i
;
i
0.6
.~
0~
i
-
-.
i
-
.- -,-
_
;
.....
0.8 :o
\o\
g
0.6
i
\o.\-
o\
T~
o~
0.L,
:
0.2
c
0.2 ®
A 0
L0 ¢I z
\
0.8
~
,
--"-~,-._ :-~" -
1.0
i ,c
i
[41]
1
i
I
I
I
I
2
3
,',
1
2
Input
of
tRNA
per
active
3
I
I
I
i
/,
5
6
7
ribosome
FIG. 3. Interaction of modified tRNA T M derivatives with the ribosomal P site (A) and A site (B) as followed by indicator titrations. Experiments were performed in buffer A; for details see Procedures. Puromycin-reactive N-Ac[~4C]Phe-tRNA P" (open symbols) and A site-bound ['4C]Phe-tRNAV~ (closed symbols) are plotted relative to the respective input amounts. (0,0) E. coli tRNA T M , (A,A) E. coli tRNAp,~6rzo prepared following a published procedure (W. Wintermeyer, H. G. Schleich, and H. G. Zachau, this series, Vol. 59, p. 110), ([:],ll) yeast tRNA..P~w~prepared as previously described. Is The solid lines indicate the result of the fitting procedure, the dotted lines the stoichiometry of filling the P or A sites.
Examples
Stoichiometric Indicator Titrations
The data of Fig. 1 clearly show that the P site, as evident from the inhibition Of subsequent binding of N-Ac(~4C)Phe-tRNA ~ , is the first site to be occupied, and that A-site binding becomes s~nificant only after the P site is filled completely. From the sigmoidal titration curves the concentration of ribosomes which are active in P-site binding oftRNA v~ (Fig. 1A,C) or N-AcPhe-tRNA ~ (Fig. IB) was estimated by fitting a sequential binding model. The model and the procedure used for the calculation are described below (see Evaluation). The analysis revealed that 65% of the ribosomes were active in binding t R N A ) 4 Activities found for different ribosome preparations, using this assay, ranged from 55 ~s to 90%./~ 14The stoichiometry of complex formation is, of course, also influenced by the activity of the tRNA. The N-AcPhe-tRNA T M used for the present experiments was fully active in ribosome binding, as evident from Fig. 1, which shows that with excess vacant ribosomes all the input N-AcPhe-tRNA T M was bound and puromycin reactive. The same is true for deacylated tRNA, since at least 95% 3"P-labeled tRNA T M was bound to the ribosomes in both
[41 ]
tRNA BINDING ASSAY
605
The A-site-binding curves revealed an interesting difference between yeast tRNA w (Fig. IA) and N-AcPhe-tRNA r~ (Fig. IB) on the one hand and E. coli tRNA z*" (Fig. IC) on the other hand. With the former two, an A-site-binding stoichiometry of 1.3 was found, indicating that the A site was the second site to be filled after the P site, and that the activity of the A site was comparable to the one of the P site. In contrast, with E. coli tRNA r~ a stoichiometry of 1.9 was obtained by the indicator assay, consistent with the amount of bound [32p]tRNA~ measured directly. Given the 65% activity of the ribosomes, this result demonstrates the existence of three binding sites (P, A, and E) with 65% activity each; it also shows that E. coli tRNA ~ binds to the E site prior to or concomitantly with the A site? The different binding sequence, with respect to A and E sites, of tRNA l'~ from yeast and E. coli reflects the higher affinity of the E site for the homologous tRNA ~" compared to tRNA ~ from yeast? 7
Binding Constants from Indicator Titrations This application of the assay is restricted to cases where the tRNA under study may be bound at nonstoichiometric conditions (i.e., concentrations of ribosomes and tRNA comparable to the dissociation constant of the complex) while, at the same time, the indicator tRNA is bound in a stoichiometric fashion. This condition is fulfilled for the~A site: deacylated tRNA ~e or N-AcPhe-tRNA nae binds to the A site with moderate affinity, whereas the ternary complex, used as indicator, binds with extremely high affinity. 17 As an example, Fig. 2 shows the progressive binding of either deacylated tRNA Phe or N-AcPhe-tRNA ~ to the A site of P-site-blocked ribosomes, as monitored by the inhibition of the subsequent binding of the ternary complex p 4 C ] P h e - t R N A ~ - E F - T u - G T P . Another example, shown below (Fig. 3), is the P-site titration with a low-affinity derivative of yeast tRNA Phi.
Ribosome Interaction of Modified tRNA Chemically or otherwise modified tRNAs may be impaired in their ability to bind to ribosomes. Since labeling of the tRNA is not required, the indicator test is particularly useful to assay modified tRNAs with respect to
indicator titrations and nitrocellulose filtration, and consistent results were obtained with nonlabeled tRNA T M in indicator titrations with ribosomes of known binding activity. ~s Low-salt-washed ribosomes according to H.-J. Rheinberger and K. H. Nierhaus, Biochem. Int. 1,297 (1980). ~6Ribosomes provided by S. V. Kirillov. ~7R. Lill, J. M. Robertson, and W. Wintermeyer, Biochemistry 25, 3245 (1986).
606
RIBOSOME FUNCTION AND KINETICS
[41]
the interaction with the ribosomal P and A sites. Figure 3 shows two illustrative examples. One is a fluorescent derivative of E. coli tRNA w which has been prepared by replacing the dihydrouracils in positions 16 and 20 with proflavine. The second is yeast tRNA r~ modified by excision of wybutine from the anticodon loop, which was shown previously to be impaired in ribosome interaction) 8 Clearly, tRNA~6/20 bound to both P and A sites with the same affinity as unmodified tRNA l~. In contrast, excision of wybutine considerably lowers the affinity of tRNA ~ for binding to the P site (about 10-fold), while A-site binding is not detectable anymore. Theory From the indicator titrations, either the concentration of ribosomes that are active in tRNA binding or their binding constants are estimated by computer fitting. The models used are based on the fact that there is no significant binding to other sites unless the P site is occupied. Thus, P-site binding is evaluated with the premise that the tRNA-binding sites are occupied in a sequential manner. Similarly, binding to the A site, since it becomes significant only after the P site has been filled, can be treated as a single-site problem, provided the complication created by the E site is avoided. For this reason, the A-site titrations preferably are performed with N-AcPhe-tRNAP~, which does not detectably bind to the E site. Indicator Titration of the P Site The titration of poly(U)-programmed vacant ribosomes (R) with tRNA (T) (denoting either deacylated tRNA l ~ or N-AcPhe-tRNAr~ of relatively low specific radioactivity) and the determination of unoccupied P sites by the puromycin reactivity of subsequently bound indicator NAcPhe-tRNA~ (I) are depicted in Eq. (1) (Ka, and Kn, are equilibrium constants of P-site binding of tRNA ~e or indicator N-AcPhe-tRNAr~, respectively; see Table I). gp R + T ~ RTp + I
RIp
is R. Thiebe and H. G. Zachau, Eur. J. Biochem. 5, 546 (1968).
[41 ]
tRNA BINDING ASSAY
607
TABLE I BINDING CONSTANTS OF THE RIBOSOMAL P A SITESa
AND
Binding constants (10 7 M - l ) tRNA
P Site
A Site
t R N A Phe N-AcPhe-tRNA ~e Phe-tRNA T M EF-Tu-GTP
18 (14) 60 (500) ~
1.5 (0.5) 3.0 (2.2) > 104 (> 104)
a
Bindingof E. coli or yeasttRNA~e derivatives to poly(U)-programmed ribosomes was measured in buffer A (values in brackets in buffer B) at 20°. Data from Lill et all 7
Provided the second incubation is short relative to the exchange rate of the prebound tRNA, 6 the binding of the indicator N-AcPhe-tRNA ~ is restricted to P sites unoccupied in the first incubation. The fractional saturation of the P sites, np, of a given concentration of ribosomes, CRo, at a particular tRNA concentration, cro, is given by np(cro) = [L -- (L 2 -- 4CroCRo)i/2]/(2CRo)
(2)
with L = cro + cm + 1/Kp
The concentration of unoccupied P sites, cop, available for binding the indicator tRNA, is given by Ctw( CTo) = [ 1 -- np( c.ro)lCRo
(3)
For the binding of the indicator tRNA, present at a total concentration cio, the fractional saturation of the P sites with indicator, nw, is calculated from Eq. (4): nw( CTo) = ( M -- [M 2 -- 4Ctm( CTo)Clo)] l/2} / ( 2Cio)
(4)
with M = Cio + ctw(CTo) + 1/Kw nip is related to the a m o u n t of puromycin-reactive indicator N-AcPhetRNA vae, Ip, according to Ip(cro) = I=~xnn,(cro) + IB
(5)
608
RIBOSOME FUNCTION I
.~
1.0
i
0.8
c "~.
I
I
1
I
I
I
I
I
AND KINETICS I
I
I
1
I
I
[41] I
I
t
1.0
:t ooooooooo 0.8
06
z~ u ~
0.4
0.4
o ~
0.2
0,2
:; A 0
:: I
0
io
I
0.2
I
2o ~u
I
[
0.4
0.6
I
[
0.8
I
I
B I
1.0
I
I
0
I
0.2
'
0,4
-
0.6
0.8
0
1.0
tRNA added (pM)
FIG. 4. Influence of binding constants (A) and indicator concentration (B) on the indicator titration of the P site. Theoretical curves were calculated from Eq. (5) for a fixed concentration of active ribosomes (0.5/zM). In (A) the binding constant of the tRNA bound in the first step was varied from 2 to 50 × 107 M -I at an indicator-to-ribosome ratio of 0.15. In (B) the indicator-to-ribosome ratio was varied from 0.01 to 1.0, assuming K p - 5 × 10s M -I for the first binding equilibrium. Kip = 6 × l0 s M --~ was used for the indicator (N-AePhe-tRNAr~). The theoretical equivalence points are indicated by dotted lines.
where/max denotes the signal observed when all indicator tRNA is bound to the P site, offset by a blank value, Is, measured when no indicator is bound.
Evaluation of P-Site Indicator Titrations Equation (5) containing all the variables as developed above, serves to estimate the concentration of ribosomes active in binding tRNA n" to the P sites by nonlinear least-squares fitting using a Gauss-Newton iteration procedure, ~9 with the binding constants to tRNA r~ and indicator NAcPhe-tRNA v~ given in Table I. Best fits are obtained when the parameters Im~ and IB are also fitted. In theory, the evaluation of the indicator titrations could be simplified by establishing conditions of true stoichiometric uptake to both the varied tRNA and the indicator N-AcPhe-tRNA r~. This is illustrated in Fig. 4, in which theoretical titration curves, calculated from Eq. (5), are depicted. The titration curves become steeper with increasing binding constant of the varied tRNA (Fig. 4A); nearly the same increase in steepness results ~9The program was written for a Tektronix 4052 computer, which uses a BASIC differing somewhat from other dialects. The program listing is available from the authors on request.
[41 ]
tRNA BINDING ASSAY
609
from increasing the concentration of ribosomes at constant indicator/ribosome ratio (not shown). In practice, however, the ribosome concentration required (> 2 aM) to avoid the fitting procedure and evaluate the curves by simple extrapolation is prohibitively high. Increasing the relative amount of indicator yields theoretical titration curves, which should be easily extrapolatable to the equivalence point on the abscissa, i.e., the concentration of active ribosomes (Fig. 4B). Unfortunately, this approach is not feasible for the P site either, since the relatively large amount of N-AcPhe-tRNA~ creates the problems with the puromycin reaction discussed above. 4 Indicator Titration o f the A Site
A model is derived for the case where the A site is the second site to be filled after the P site, e.g., for a titration with N-AcPhe-tRNAl~. Titrations in which the A site is occupied subsequently or concomitantly with the E site, as with E. coli tRNA m', can be treated in an analogous, although somewhat more involved manner. According to the sequential binding model, the calculation of the actual concentration of tRNA (N-AcPhe-tRNA~ ) available for binding to the A site has to account for P-site binding, which precedes A-site binding: Kr
K^
R + T.~--RTp.~RTrTA +T
+ I
(6)
RTpIA The fractional saturation of the P site is calculated from Eq. (2). The concentration of tRNA remaining for A-site binding, CT^, is given by the difference of total and P-site-bound tRNA: Ca'A(Cro)= Cro -- np(CTo)CRo
(7)
The fractional saturation of the A site, nA, for a given tRNA concentration, Cro, is calculated from nA(cx~) ----( N -
IN 2 - 4C.rA(C.ro)CRo]|/2)/(2CRo)
with N = CTA(Cro)+ CRO+ 1/KA
(8)
610
RIBOSOME FUNCTION A N D KINETICS
[41 ]
In analogy to the treatment of P-site binding, the concentration of A sites,
co^, which at a given tRNA concentration, Cxo, remain unoccupied, and the fractional saturation, nv,, of A sites with the indicator, which now is the ternary complex Phe-tRNA~C-EF-Tu-GTP, are given by Eqs. (9) and (10). CuA(C~o)= [1 -- n^(Cxo)]CRo
(9)
niA(cro) = { Q - [ (22 - 4cu^(Cro)qo]'a}/(2qo)
( 1 O)
with Q = Cro+ cu^(cxo) + 1/KIA Finally, as discussed above for the P site, nt~ is related to the amount of bound indicator, I^, according to I^(cro) ----I=~nu,(cxo) + Is
(11)
Evaluation of A-Site Titrations Fitting of Eq. (11) to the titration data (see above), using the appropriate binding constants of Table I, yields the concentration of ribosomes with active A sites. i
i
,
i
i
i
i
i
i
i
i
1
1
i
I
i
i
1.0
0.8 0.6 .o i
0.4
0.2
0.2
0
l
0.5
I
I
1.0
l
1.5
I
I
2.0
05 10 2.0 1 5"0 1
I
2.5 tRNA
0.5 added
1.0
1.5
2.0
2.5
(~M)
FIo. 5. Influence of the concentrations of ribosomes (A) and indicator (B) on the indicator titration of the A site. The curves were calculated from Eq. (11), assuming K^ = 3 × l0 TM -1 for the first binding equilibrium and K ~ = 10 n M -I for the binding of the indicator ( P h e - t R N A ~ - E F - T u - G T P ) . In (A) the concentration of ribosomes was varied from 0.2 to 0.5/tM, at an indicator-to-ribosome ratio of 0.15. In (B) the indicator-to-ribosome ratio was varied from 0.05 to 1.0 at a ribosome concentration of 0.5/tM. The theoretical equivalence points are indicated by dotted lines.
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
611
Theoretical curves for A-site titrations are depicted in Fig. 5. The curves are calculated from Eq. (11), assuming stoichiometric P-site binding. As discussed above for the P site, also for the A site the steepness of the curves increases with increasing ribosome concentration (Fig. 5A) or binding constant (not shown). However, because of the generally weaker binding to the A site, the concentration required to approach stoichiometric binding is rather high (about 5/tM) and barely attainable experimentally. On the other hand, by increasing the relative concentration of the ternary complex, used as indicator, a titration curve is obtained which may be extrapolated without resorting to the fitting procedure, albeit with limited accuracy (Fig. 5B). It is important to note from Fig. 5B that, at low concentrations of indicator relative to ribosomes, a simple extrapolation of the curves, without using the model derived above, leads to erroneous conclusions as to the activity of the A site.
Estimation of Binding Constants from Indicator Titrations On the basis of the appropriate values from Table I, binding constants (Kp, KA) were estimated from Eq. (5) [Eq. (11)] by fitting Kp (K^), Imp, and IB, using the concentration of active ribosomes, determined before, as a known parameter.
[42] M e a s u r e m e n t
of Translational Kinetic Parameters
By MANS EHRENBERG and C. G. KURLAND Introduction The average rate of translation in E. coli growing at doubling times between 100 and 24 min varies between 12 and 22 peptide bonds per second.~ The missense error rate in vivo also varies with codon, and mRNA context from more than 0.001 to less than 0 . 0 0 0 1 . 2-5 A l t h o u g h these in vivo ribosome performance characteristics are distributed rather than unique, the distributions define the range of values that should be approxiG. Churchward, H. Bremer, and R. Young, J. Theor. Biol. 94, 651 (1982). 2 F. Bouadloun, D. Donner, and C. G. Kurtand, EMBO J. 21, 351 (1983). 3 j. Parker, T. C. Johnston, P. T. Borgia, G. Holtz, E. Remant, and W. Fiefs, J. Biol. Chem. 258, 10007 (1983). 4 j. Parker and G. Holtz, Biochem. Biophys. Res. Commun. 121, 487 (1984). s p. F_Adman and J. Gallant, Cell 10, 131 (1977). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsofrel)roducfion in any formreserved.
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
611
Theoretical curves for A-site titrations are depicted in Fig. 5. The curves are calculated from Eq. (11), assuming stoichiometric P-site binding. As discussed above for the P site, also for the A site the steepness of the curves increases with increasing ribosome concentration (Fig. 5A) or binding constant (not shown). However, because of the generally weaker binding to the A site, the concentration required to approach stoichiometric binding is rather high (about 5/tM) and barely attainable experimentally. On the other hand, by increasing the relative concentration of the ternary complex, used as indicator, a titration curve is obtained which may be extrapolated without resorting to the fitting procedure, albeit with limited accuracy (Fig. 5B). It is important to note from Fig. 5B that, at low concentrations of indicator relative to ribosomes, a simple extrapolation of the curves, without using the model derived above, leads to erroneous conclusions as to the activity of the A site.
Estimation of Binding Constants from Indicator Titrations On the basis of the appropriate values from Table I, binding constants (Kp, KA) were estimated from Eq. (5) [Eq. (11)] by fitting Kp (K^), Imp, and IB, using the concentration of active ribosomes, determined before, as a known parameter.
[42] M e a s u r e m e n t
of Translational Kinetic Parameters
By MANS EHRENBERG and C. G. KURLAND Introduction The average rate of translation in E. coli growing at doubling times between 100 and 24 min varies between 12 and 22 peptide bonds per second.~ The missense error rate in vivo also varies with codon, and mRNA context from more than 0.001 to less than 0 . 0 0 0 1 . 2-5 A l t h o u g h these in vivo ribosome performance characteristics are distributed rather than unique, the distributions define the range of values that should be approxiG. Churchward, H. Bremer, and R. Young, J. Theor. Biol. 94, 651 (1982). 2 F. Bouadloun, D. Donner, and C. G. Kurtand, EMBO J. 21, 351 (1983). 3 j. Parker, T. C. Johnston, P. T. Borgia, G. Holtz, E. Remant, and W. Fiefs, J. Biol. Chem. 258, 10007 (1983). 4 j. Parker and G. Holtz, Biochem. Biophys. Res. Commun. 121, 487 (1984). s p. F_Adman and J. Gallant, Cell 10, 131 (1977). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,Inc. All rightsofrel)roducfion in any formreserved.
612
RIBOSOME FUNCTION AND KINETICS
[42]
mated in vitro in order to validate the relevance of quantitative information obtained from reconstituted systems to the in vivo situation. One illustration from the literature should suffice to convince the skeptic of the need for such explicit guidelines. Experiments have recently been reported that attempt to show that a guanine nucleotide analog called "magic spot" enhances the accuracy of translation by preferentially stimulating the dissipative loss of ternary complexes containing noncognate aminoacyl-tRNA relative to those containing cognate aminoacyl-tRNA. 6 The evidence offered is a measurement showing that in 5 m M Mg 2+ the ratio of GTP hydrolyzed to peptide bond formed with cognate amino acid is l, in both the presence and absence of magic spot. However, in the same type of experiment with noncognate amino acid at 10 m M Mg 2+ the ratios are 6 and 9 in the absence and presence of magic spot, respectively. There is much that might be said about this experiment, but we will restrict ourselves to two general points. First, conditions that provide a meaningful measure of the effects of magic spot on the accuracy of translation should have been used. Second, the quantitative scale of these results is incommensurate with the scale of the phenomena to be described. Thus, the magic spots seem to influence the error rates by at least an order of magnitude both in vivo and in vitro, 4,7-9 not by the insignificant extent of 30%. In this chapter, methods are described that are intended to provide kinetic data from reconstituted systems that can be used to analyze the characteristics of living bacteria. That is the intention, but because these characteristics are not always fully realized, we will indicate the limitations of our methods as we describe them. Assay Conditions: Polymix Burst The internal milieu of E. coli bacteria growing at 37 ° is very remote from the conditions of conventional systems for in vitro protein synthesis in Tris-magnesium buffer and with elongation rates several orders of magnitude below the 15 sec-~ typical in bacteria. One difference between the interior ofE. coli and conventional in vitro systems for translation is that bacteria have a more complex composition of ions. In addition to magnesium, potassium, and ammonium ions the cytosol of bacteria contains high concentrations of calcium ions and poly6 D. B. Dix and R. C. Thompson, Proc. Natl. Acad. Sci. U.S.A. 83, 2027 (1986). E. G. H. Wagner and C. G. Kurland, Mol. Gen. Genet. 180, 139 (1980). 8 E. G. H. Wagner, M. Ehrcnberg, and C. G. Kurland, Mol. Gen. Genet. 185, 269 (1982). 9 A.-M. Rojas, M. Ehrenberg, and C. G. Kudand, Mol. Gen. Genet. 197, 36 (1984).
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
613
amines, l° Another difference is that bacteria use energy-converting pathways which regcncratc A T P and G T P and kccp them displaced a factor of 101° or I08 above equilibrium with their respective hydrolytic products.11 Thc ionic conditions and the nucleoside triphosphatc displacements strongly influence the rate as well as accuracy of in vitro protein synthcsis.l° Jelenc and Kurland l° designed an in vitro system with energy regeneration and with ionic conditions similar to those in E. coli. Their initialchoice of ionic conditions was based on estimates of the ionic content of the cytosol of E. coli. The concentrations of all ions were varied until a maximal rate of in vitro translation was obtained. The accuracy of this polymix system approached in vivo levels but the elongation rate was still far below in vivo translation rates. Polymix buffer has final ion concentrations as follows: 95 m M KC1, 5 m M NH4C1, 5 m M magnesium acetate, 5 m M CaC12, 8 m M putrescine, l m M spermidine, 1 m M dithioerythritol (DTE), and 5 m M potassium phosphate. The buffer is adjusted to pH 7.5 and stored as l0 × concentrated mix without DTE and potassium phosphate. DTE is added with A/P (see below) and potassium phosphate is prepared separately to avoid precipitation, and kept at a concentration of 100 mM. The correct working strength of polymix is obtained in the incubation mixture. Poly(Phe)synthesis on poly(U)-programmed ribosomes is not preceded by proper initiation. The artificial initiation in poly(U)translation influences the apparent protein synthesis rate. Wagner et al.,12 following LucasLenard and Lipman 13 found that addition of high concentrations of ternary complex and other translation factors to ribosomes, preincubated with poly(U) and N-acetyl-Phe-tRNA~e, leads to a "burst" of rapid poly(Phe)synthesis. The burst elongation rate is about l0 amino acids per second per ribosome, which by far exceeds the rates of systems lacking a preactivation step. Wagner et al. 12observed that not more than between l0 and 35% of the ribosomes were able to participate in the fast elongation burst. Poly(U) has a finite length and therefore the poly(Phe) burst lasts only a short time. Poly(U) molecules, consisting of 600 nucleotides, can translate a maximum of 200 amino acids each. A ribosome starting at the beginning of such a messenger and elongating with a rate of 10 amino acids per second will reach the end of the polynucleotide in 20 sec. The useful time window for measuring elongation rates in a burst is therefore only a couple of seconds. 1op. C. Jelenc and C. G. Kurland, Proc. Natl. Acad. Sci. U.S.A. 76, 3174 (1979). ,1C. Blomberg, M. Ehrenberg, and C. G. Kurland, Q. Rev. Biophys. 13, 231 (1980). 12E. G. H. Wagner, M. Ehrenberg, and C. G. Kurland, Eur. J. Biochem. 122, 193 (1982). 13j. Lucas-Lenard, and F. Lipman, Proc. Natl. Acad. Sci. U.S.A. 57, 1050 (1967).
614
[42]
RIBOSOME FUNCTION AND KINETICS
The activity of ribosomes that start with uniform frequency along the poly(U) molecules and elongate with constant velocity (v) decreases with time. The reason is that ribosomes continuously reach the end of poly(U) and stop. The fraction of elongating ribosomes [R(t)/Ro] decreases with time as follows: R(t)/Ro -- l - (v/L)t
t <--L / v
g(t)/Ro = 0
t > L/v
(l)
Ro and R(t) are the numbers of elongating ribosomes at times zero and t, respectively. L is the maximum number of amino acids that can be synthesized on the poly(U) message when the ribosome starts at the Y-end. The measured elongation rate [v(T)] decreases with the incubation time (T) of the burst according to the following expression: v(T) = 1/T v ( T ) = L/(2 T )
[1 - (v/L)tlv dt = v[1 - (vr)/(2L)l T >- L / v
r ~ L/v (2)
Equation (2) is useful to describe the initial phases of a burst, n,14 Deviations from this simple behavior are observed at longer times. Here protein synthesis continues at a very slow rate although Eq. (2) predicts that there is no remaining poly(Phe)synthesis at the time 1/v after the start of a burst. At longer times there is also an increase in the number of hot trichloroacetic acid (TCA)-precipitable poly(Phe) chains. These observations indicate that the ribosomes have heterogeneous in vitro elongation rates. There seems to be one class of fast ribosomes. When the members of this have reached the 3'-end of poly(U) the slow ribosomes continue protein synthesis until they too have come to the end of their messages. One way to obtain the real elongation rate (v) is to measure v ( T ) at different values o f ( T ) and extrapolate to zero time according to Eq. (2). 14 The burst assays are performed as follows: For mix A with a total volume of 40/zl one adds H20, 10 X polymix and 20 X phosphate, 10 pmol of active ribosomes, 20/zg poly(U), and N-acetyl-Phe-tRNAv~" at a concentration 1.2 times the total concentration of ribosomes. The polymix components are added to balance the final mix A to proper working strength. Mix A is incubated for 10 min at 37 °. For mix B, with a total volume of 60/zl, one adds H20, 10 X polymix, 20 X phosphate, 10/zl A/P (containing 10 m M ATP, 60 m M PEP, and 10 m M DTE), Pyruvate kinase, 0.5/zl at I0 mg/ml, 0.1/zl myokinase (adenylate kinase) at 3 mg/ml, 1/zl 100 m M GTP, 250 pmol tRNA we, 100 units of Phe-tRNA synthetase ~4 N. Bilgin,
Biochimie, in press.
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
615
(1 unit of Phe-synthetase charges 1 pmol of tRNA per second under the standard conditions of a burst), 10/zl phenylalanine (3 mM), 300 pmol EF-Tu, 40 pmol EF-Ts, 250 pmol EF-G. Mix B is also incubated at 37" for 10 min. At time zero B (60/zl) is mixed with A (40/zl) with a prewarmed pipet tip. 12 The reaction is stopped by addition of 5% TCA to a total volume of 5 ml at 5, 10, 15, and 20 sec. The tubes are subsequently boiled for 10 min and hot TCA-precipitable material is filtered through glass fiber filters. The filters are rinsed, first with TCA, then with 2-propanol, and dried. A scintillation tissue solubilizer mix (0.5% PPO, 0.0125% bis MSB, 10% NCS tissue solubilizer; Amersham, France) in toluene is added and the vials with the filters are shaken on a rotary shaker for 5 min before counting. As standards are used 10/zl 30 m M 14C-labeled Phe ( - 1 cpm/pmol) and 10 ~1 of the 3H-labeled phenylalanine ( - 2 0 0 cpm/pmol) used to make N-AcPhe-tRNA l~. The standards are put on glass fiber filters, dried, and subsequently treated as the rest of the samples. The number of elongating chains is obtained from the number of 3H counts, and the number of Phe incorporated into chains is obtained from the number of 14C counts as described by Wagner et aL ~2 The elongation rate [v(T)] of poly(Phe) synthesis in ribosomes is obtained by dividing the total amount of poly(Phe) by the, approximately constant, amount of N-Ac-Phe at different time points (T). Ribosomes behave like ordinary enzymes and follow MichaelisMenten kinetics in burst experiments provided that certain requirements are fulfilled. Thus the time to elongate one peptide in a nascent poly(Phe)chain (zcl) contains one constant term (l/k~t) and concentration-dependent terms for ternary complex (T3) as well as for EF-G. ~ci = 1/k~,, ~
1
R'[T3]
t
1
R"[EF-G-GTP]
(3)
R' is k ~ d K , for the interaction between ternary complex and ribosomes. R" is k,~t/Km for the E F - G - G T P interaction with ribosomes. R' is about 3 X 1 0 7 M - t s e c - l , 15 and recent estimates of R" are about 8 X 107 M - I s e c - l . 14 The estimates of the maximum rate (k~t) vary between 6 and 15 amino acids per second. 14-17 It is possible to use conventional Eadie-Hofstee analysis to obtain estimates of the maximal translation rate (k~t) as well as the K , values for the two elongation factors in the following way.
~5K. Bohman, T. Ruusala, P. C. Jelenc, and C. G. Kurland, Mol. Gen. Genet. 198, 90 (1984). ~6T. Ruusala, D. Andersson, M. Ehrenberg, and C. G. Kurland, E M B O J. 3, 2575 (1984). ~7I. Diaz, M. Ehrenberg, and C. G. Kurland, Mol. Gen. Genet. 202, 207 (1986).
616
RIBOSOME FUNCTION AND KINETICS
[42]
Factor Titrations Titrations with EF-G and EF-Tu are performed as described for the burst above with the modification that mix B now has a volume per sample of 50 gl with the factor (EF-Tu or EF-G) to be titrated excluded from it. The varying factor is diluted in polymix and introduced as 10 #1 in the reaction tubes. To each of these tubes is added 50 gl of mix B. All tubes are subsequently incubated for 10 min at 37 °. At time zero 40 gl from mix A is added and the reaction is stopped with TCA as above. As explained above, the number of elongating ribosomes decreases with the incubation time. In order for a poly(Phe) chain to be hot TCA-precipitable and detectable on filter, it must be longer than five amino acids. Therefore, poly(U) chains that are too short as well as those that are too long may lead to distorted kinetic measurements. These problems are avoided by an adjustment of the burst incubation times so that the chain length is a constant independent of the factor concentration. In this way the average number of elongating ribosomes is the same at all titration points and the chain length can be kept safely above the hot TCA-precipitation limit at all factor concentrations. The true elongation rate (v) is given by the following expression: v --
[EFo]kc~t K m + [EFo]
(4)
The experimental incubation times (T) are subsequently chosen as follows:
T= To(l + KJ[EFo])
(5)
According to Eq. (2), the measured rates [v(T)] are related to the true rates (v) by the same factor as long as Eq. (5) is approximately true:
v(To) = v(l - k,~tTo/2L)
(6)
Using, for example, Eadie-Hofstee analysis, 14,~5an apparent maximal rate [kc~t(To)] can be obtained which is related to the true maximal rate (k~t) extrapolated to zero incubation time [or infinite poly(U)-length] according to kcat(To) = kcat(l - k~t TO/2L) Since the equivalent aminoacid length (L) of poly(U) can be obtained from an experiment as described by Eq. (2) and To is known, the true kc~t can be determined according to k,~t = L/To( 1 -- [ 1 -- k,~t(To)2 To~L]'/2} In the limit of a very small
(7)
TO/L ratio k~t = k~t(To) as should be. The
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
617
k , t value in such a factor titration depends on the constant concentration of the other factor [Eq. (3)]. Since the (k,~dKm) for one elongation factor can be obtained without knowledge of the fixed concentration of the other one, the maximal rate (k~t) extrapolated to infinite concentrations of both factors is easily obtained as follows. First, calculate k~dKg for EF-G from an Eadie-Hofstee plot and correct the value according to Eq. (7). Then calculate a corrected maximal rate (k't) for EF-Tu. The maximal elongation rate with both factors at infinite concentrations (k~t) is given by the expression
1/k,~t = 1 / k ~ t - 1/([EF-G]k~K~ c)
(8a)
Since the two elongation factors appear symmetrically, k&t can be obtained also from the expression
l/k&t = 1 / k ~ t - 1/([EF-Tu]k~t/K~)
(Sb)
Example: From a titration with EF-G with T o - - 5 sec, one obtains k"~t/K~ - 2 × l07 M -1 sec- l and k~t = 5 sec-1. t/
It
--
The equivalent amino acid length of poly(U) (L) is 60 amino acids so that the corrected maximal rate is k ~ = 60/511 - (1 - 5 X 2 X 5/60) u2] 7.1 sec-l. The corrected value of k~JK~ is given by k~dK~ ~--- k~t/K~ × 7.1/5.0 = 2.84 X 1 0 7 M -1 sec-1. From an EF-Tu titration with [EF-G] = 2 X 1 0 - 6 M one obtains k'~t = 5.44 sec-t for To = 5 sec and L = 60 as before. The corrected k~t according to Eq. (7) is k~t = 60/5[1 - (l - 5 × 44 X 2 X 5/60) 1/2] = 8.33 sec-~. From Eq. (8a) one obtains k,~t = 9.8 sec-~. Complementary information about the kinetics of EF-Tu and EF-G interactions with the ribosome can be obtained if the ribosome concentration is varied instead of the concentration of an elongation factor. In what follows it is assumed that relevant corrections for the finite length of poly(U) are used. Factor Limitations When EF-Tu is kept at a small, rate-limiting concentration the ribosomes have their A-site open most of the time ready to accept a ternary complex. When EF-G is rate limiting, the ribosomes spend most of their time in a pretranslocational state, ready to accept an E F - G - G T P binary complex. In a factor-limited experiment the ribosome can formally be viewed as substrate and the limiting factor as enzyme. When the ribosome concentration is varied the rate of protein synthesis normalized to the limiting factor concentration follows Michaelis-Menten kinetics. The k,t/ Km values have the same meaning as in the factor titrations described above. However, the maximal rates (k~t) and Km values are in this case not
618
RIBOSOME, FUNCTION AND KINETICS
[42]
identical to the rate of the total ribosomal elongation cycle. Instead, the k~t value describes the maximal rate by which a factor (EF-G or EF-Tu) runs through its whole cycle in the limit of very high ribosome concentrations. The time (z') for EF-Tu to make peptide bonds in the steady state may conveniently be written as a sum of three times. The first (l/R'[Ro]) is the average time for a ternary complex to be efficiently associated with a ribosome so that a peptide bond is made. This time is inversely proportional to the concentration of active ribosomes ([ROD and goes to zero at infinite ribosome concentration. R' is k ' ~ / K " for ternary complex interactions with ribosomes that lead to peptide bonds and is discussed in connection with Eq. (3). The second (zJ) is the time that an EF-Tu-molecule spends on the ribosome. The third (z~) is the time to regenerate a ternary complex (T3) from a binary complex (EF-Tu-GDP). The rate (v') normalized to the amount of EF-Tu is inversely proportional to z': 1/v' = z ' - - -
1
R'[Ro]
4- (z'l 4- z~g)f"
(9)
where f" is the number of cycles of EF-Tu necessary to make one peptide bond.laa 9 This assay is most sensitive to the time (z~) when EF-Tu is in complex with ribosomes, which is of particular interest for us, if the regeneration time (z~) of ternary complex is as small as possible. The limit of minimal z ~ is approached when the concentrations of GTP, aminoacyl-tRNA, and EF-Ts are titrated to sufficiently high values and the GTP/GDP ratio is high enough .9,14.~8 A similar expression holds for the cycling rate (v") for EF-G: 1 1/v" = z " -- R,,[Ro-------~]4- ('c 7 4-
z~flc"
(10)
z~' is the time EF-G is in complex with a ribosome and z ~ is the time to regenerate E F - G - G T P from EF-G-GDP. f " is the number of cycles of EF-G per translocation (see Kurland and Ehrenbergl9). Experimentally determined R factors (kcat]Km) are the same in 70S or elongation factor titrations for EF-Tu and EF-G? 4 However, the k.t values for both factor cycle titrations are higher than the maximal elongation rate of ribosomes.14 The R factors for EF-Tu and EF-G are near 3 × 107 M - i sec- ~ and 6 × 107 M -~ sec-~, respectively. The k.t value for EF-Tu is about 20 see-~ ~5
Ruusala, M. Ehrenberg, and C. G. Kurland, EMBO Z 1, 75 (1982). 19C. G. Kurland, and M. Ehrenberg, (2. Rev. Biophys. 18, 423 (1985). m8 T.
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
619
and, according to Eq. (8), it can be written 1
k~,, -~r'~-'o,,+ r ~
(l l)
f~ is near 1.1,~5,~6,2°so that the whole cycle of EF-Tu at excess concentrations of ribosomes, aminoacyl-tRNA, GTP, and EF-Ts takes about 50 msec. According to Ruusala et al., ~s EF-Tu stays in complex with EF-Ts for 30 msec. The time EF-Tu stays on the ribosome is therefore not more than 20 msec. This time is obtained by subtracting two numbers of similar magnitude and is therefore not very precise. However, it seems to be significantly shorter than the time to make a peptide bond at saturing ternary complex concentration, which is about 30 msec.2~ The cycling rate of EF-G at excess ribosome and GTP concentrations is about 40 sec-~, ~4 and according to Eq. (10) it can be written k~t -
l
f"(z~' + r~ s)
(12)
The number of cycles of EF-G (f") per transloeation is not known.19
Assay Conditions for 70S Titrations A ribosome titration with an elongation factor (EF) limiting is done as the "burst" described above with some modifications. The Km values for both factors are high in these assays and the final concentration of active ribosomes must therefore be high as well since otherwise the precision with which estimates of km and Km values for these interactions are made will be low. For wild-type ribosomes this means typically 200 pmol of active ribosomes in 100/zl (2 X 10-6 M). The fraction of active ribosomes is usually around 25%. Thus about 800 pmol (8 X 10-6M) of total ribosomes is introduced at the end of the 70S titration. N-Acetyl-Phe-tRNAPh~is kept at 1000 pmol and poly(U) at 120/zg. The poly(U) concentration is chosen so that the ratio of nucleotide/ribosome is also sufficiently high at the highest 70S concentrations. The factor mix is modified so that the rate-limiting factor is kept between 1 and 5 pmol instead of at around 300 pmol as in an ordinary burst. Since ribosomes that are inactive in elongation are able to bind aminoacyl-tRNA m2it is essential that the concentration of Phe-tRNA Phe is larger than the highest 70S concentration. A choice of 2o M. Ehrenberg, C. G. Kurland, and T. Ruusala, Biochimie 68, 261 (1986). 2~ H. Pahverk, manuscript in preparation.
620
RIBOSOME FUNCTION AND KINETICS
[42]
1000pmol (10-SM) or more of total Phe-tRNA v~ leaves at least 200 pmol of Phe-tRNA ~e outside the ribosomes at the end of the 70S titration. The choice of Phe-tRNA ~e concentration is most critical when EF-Tu is rate limiting since aminoacyl-tRNA associates with EF-Tu at one step in its cycle. When EF-Tu is rate limiting the concentration of EF-Ts is critical. Ruusala et aL t8 found that k , t for the EF-Ts-catalyzed G D P / G T P exchange on EF-Tu is 30 sec-t and that the K,, value is about 3 × 10-6 M. When [EF-Ts] is 3 X l0 -6 M the release rate of GDP from EF-Tu is not more than 17 sec-1. In order for the assay to be more sensitive to what is happening on the ribosome, considerably more EF-Ts is required and a concentration around 10-5 M (1000 pmol) of EF-Ts is therefore used. It is important that the charging rate of tRNA is higher than the rate by which amino acids are consumed in protein synthesis under the relatively extreme conditions of these assays. At 4 pmol of EF-G and 2 X 10-6 M active ribosomes with k=t = 40 sec-1 and K m = 2 × 10-6 M t h e consumption of charged tRNA is 80 pmol sec-1. The Phe-synthetase activity must accordingly be above 80 units in order for the charging step not to be rate limiting. These conditions are checked by determinations of k=t and Km values at different factor concentrations. If these kinetic parameters remain the same, it is the cycling of the investigated factor and not something else, such as the charging rate, that is rate limiting.
T h e Role of EF-Ts in in Vitro Translation The amount of EF-Ts that is necessary for an ordinary burst in steady state is a matter of choice. If, to give an example, k~t for ribosomal elongation is 8 sec-I and poly(Phe) synthesis proceeds at a fraction a of its true m a x i m u m rate (v = k~x) then the following expression follows from
~ . (3): 1
1
1
1
or8 -- 8 4 [T312 × 107 "~ [EF-G-GTP]2 × 107 If, for simplicity, [T3] = [EF-G-GTP], the concentration of ternary complex, and E F - G - G T P are determined by the parameter a: Ot
[T3] -----[EF-G-GTP] - 1 ~
(8 × 10-7) M
The amount of EF-Ts that is necessary to keep the ribosomes elongating at this speed depends on the number of active ribosomes (Ro) as well as on the total amount of EF-Tu (Tuo). The EF-Ts-catalyzed exchange rate (J) of G D P from EF-Tu- GDP is related to the total amount ofEF-Ts (Tso)
[42]
MEASUREMENTOF TRANSLATIONAL KINETIC PARAMETERS
621
that is present as follows. Is [ T u - GDP] Tsok~ _ [ T u - GDP] Tso30 J = [ T u - G D P ] + K'm" [ T u - G D P ] + 3 × 10-6
(13)
In steady state the flow (J) in Eq. (13) must equal the flow of poly(Phe) synthesis and, provided that there is approximately a one-to-one stoichiometry between dissipated ternary complexes and peptide bonds, 18,2° this conservation condition leads to the following expression [Tu-GDP]Tso30 Roak~t = [ T u - G D P ] + 3 × 10-6
(14)
From Eq. (14) it follows that for assay volumes of 100/zl the amount of EF-Ts in picomoles to meet this requirement is given by Tso--R°o~k~at(lq - 3 X 1 0 - 6 ~ 30 [Tuo] -- [Ts]/
(15)
In Eq. (15) Ro is in picomoles and Tuo and T3 are in molar units. The approximate relation [Tuo] + [Ts] -- [ T u - G D P ] has been used to obtain Eq. (15). To get 80% of k~t (a = 0.8) when there are 10 pmol of actively elongating ribosomes (Ro = 8) and k~ffi= 8 sec- i there must be 320 pmol of ternary complex. From Eq. (15) it follows that an input amount (Tuo) of EF-Tu of 360 pmol (3.6 X 10-6 M ) corresponds to 18 pmoles of EF-Ts. The larger the values of Tuo are, the smaller is the amount of EF-Ts that is necessary to keep the ribosomes near saturation with ternary complex. Reoptimization of Polymix The discovery that conventional protein synthesis in vitro is not limited by slow elongation but by an artificially slow activation of ribosomes i2 necessitated a reevaluation of the rationale behind the polymix buffer system. Jelenc and Kurlandl° had designed the ion composition of polymix to reach maximal rate in an otherwise conventional in vitro system. Since the rate-limiting step in such a system is the activation of ribosomes and not peptide elongation, the optimization might be irrelevant for the rate of protein synthesis in vivo. However, when the buffer system was reoptimized with respect to ion composition to obtain maximal rate, now with the ribosomes in elongation mode, the same optimal ion composition as before was obtained. In other words, it turned out that the same composition of ions that maximizes the rate of the N-Ac-Phe-tRNA~-directed activation of ribosomes also maximizes the elongation rate) 2 It was there22T. Ruusala, unpublished observations.
622
RIBOSOME FUNCTION AND KINETICS
[42]
fore not necessary to change the composition of polymix buffer for the burst experiments. Another important parameter is the accuracy. It is conceivable that a different selection of ribosomes occurs in a short time window as compared with a long one. A possible reason is that only those ribosomes that are fast enough to make hot TCA-precipitable chains in 5 sec will contribute to the error in a burst. In contrast, in experiments with considerably longer incubation times, much slower ribosomes can contribute to the error level. However, a careful examination of the Leu-missense levels in the two experimental modes revealed no difference between them. 12 In what follows only error measurements in burst mode will therefore be discussed.
High R a t e and Optimized Accuracy The error levels of the two isoacceptors tRNA~-~ and tRNA4T M arc extremely sensitive to the composition of ions. 22 In polymix the error level is l × l0 -4 for t R N A ~ u and 6 × l0 -4 for tRNA4x~'uat equal concentrations of correct and incorrect ternary complexes. When the concentration of Mg 2+ is shifted from its optimal value, which in the presence of 1 m M GTP and l m M ATP is 5 mM, the error level responds by decreasing dramatically. If [Mg 2+] is increased instead, the error levels increase. The accuracy is thus not maximized in an in vitro system which is optimized for the highest possible elongation rate. There is increasing evidence that a similar situation exists in vivo and that the accuracy also in living bacteria is optimized rather than maximized) 5.16,23 One convenient way to make precise measurements of errors as low as l0 -4 is to vary the concentrations of incorrect tRNA in a titration where the concentration of correct tRNA is constant. When the error ratio (i.e., Lcu flow divided by Phe flow) is plotted as a function of the ratio between correct (T~) and incorrect ( T ~ ternary complexes a straight line is obtained. The slope of this line corresponds to the normalized error level of the system. The sensitivity of the error measurements depends critically on the level of contaminating ribonuclcotidcs other than U in the poly(U) messenger. New batches of poly(U) arc therefore investigated with respect to how the error ratio behaves when the ratio between incorrect and correct ternary complex goes to zero. If the error ratio vanishes in this limit, poly(U) is not significantly contaminated with other nuclcotides. 23 D. I. Andersson, H. van Verseveld, A. H. Stouthammer, and C. G. Kurland, Arch. Microbiol. 144, 96 (1986).
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
623
Assay Condition for Burst E r r o r M e a s u r e m e n t s In error measurements the factor mix (A) is split into a poly(U)-containing (A+) and a poly(U)-lacking (A-) part. The N-Ac-[3H]Phe-tRNA1~, used for the elongation rate determinations above, is here replaced by N-Ac-[14C]Phe-tRNAwe. The N-acetylated 14C-labeled Phe has the same specific activity (~ 1 cpm/pmol) as the ~4C-Phe used to charge tRNA l~e in the factor mix (B). In addition to the components described above, mix B also contains Leu-synthetase (20 units), [3H]leucine (20 #M, 1000 clam/ pmol), and varying amounts (150- 1000 pmol) of tRNA2L~ or tRNA4x~u. At time zero, 40 gl of mix A + or A- is mixed into 60 gl of mix B and the reaction is quenched after 15 sec. Samples are treated as described above. After spillover corrections for 3H and ~4C counts, the background Leu content in A-B mixes is subtracted from the corresponding points in A+B mixes. Reversible Initial Selection and Irreversible Proofreading The low steady-state error levels observed for the translation ofpoly(U) in vitro are caused by repeated selections of tRNA on the r i b o s o m e . 2°,24 There is one selection step of ternary complex before hydrolysis of GTP, where the discard reaction is dissociation of either correct or incorrect ternary complex without an accompanying hydrolysis o f a GTP molecule. This first, reversible, selection step is followed by another, where the discard reaction is driven by hydrolysis of GTP on EF-Tu so that a correct or incorrect substrate dissociation is associated with an extra futile cycle of EF-Tu. There are many more cycles of EF-Tu connected with incorrect peptide bonds (f~) than with correct ones (f~). To simplify the formalities, entities related to EF-Tu are here and in what follows unprimed since no confusion with EF-G can occur. Proofreading amplifies the initial discrimination (I) of tRNAs by a factor (F) which is the ratio betweenfw andf¢
F=fw/f~
(16)
This relation is quite general. It is true when the proofreading discard reaction is driven by hydrolysis of GTP in ternary complex. Equation (16) is thus independent of any mechanistic details. Furthermore, measurement of proofreading of ternary complexes requires a sorting out of those GTPs that are hydrolyzed on EF-Tu from all other GTPase activities in the 24 T. Ruusala, M. Ehrenberg, and C. G. Kudand, E M B O J. 1, 741 (1982).
624
RIBOSOME FUNCTION AND KINETICS
[42]
system. There are obvious technical problems connected with this since there are high background levels of GTP hydrolysis in steady-state translation systems with all elongation factors present. EF-G at saturating concentrations dissipates GTP extensively in reactions which are coupled as well as uncoupled to polypeptide synthesis. 2s In an attempt to solve ~[hese problems, Thompson and co-workers6,26 studied, not whole elongation cycles in steady state, but the formation of the first peptide bond in the absence of EF-G and without subsequent translocation. By combining this reduction of the translation system to one of its partial reactions with low temperatures near or at 0 ° they obtained low background levels of GTP hydrolysis. There are several methodological drawbacks with this approach. First, one has to assume that EF-G, normally present in in vivo translation, has nothing to do with the proofreading of ternary complexes.27 Second, one must assume that selection of ternary complexes for the first peptide bond on the N-acetyl-Phe-tRNAr~c has the same characteristics as subsequent amino acid selections for internal positions of the nascent poly(Phe)-chain. Third, one has to assume that temperature has no significant influence on the proofreading properties of ribosomes although the elongation rates are changing by orders of magnitude when the temperature is varied between 0 ° and 37 °. These, and other, difficulties in relating studies on partial reactions to the in vivo situation made it necessary to investigate the proofreading properties of ribosomes when they were elongating in steady state under optimal conditions. It is conceivable that background GTPase activities, including the uncoupled EF-G-catalyzed GTP hydrolysis on ribosomes, can also be reduced to insignificant levels in a full system with all factors present. However, measurements of the GTPase activity associated with translation score dissipation of ternary complex as well as of EF-G-catalyzed translocation of the messenger. Although it is generally believed2s,29 that there is one GTP molecule hydrolyzed per translocation, this may be a dangerous assumption. It is thus possible that there is excess hydrolysis of GTP associated with translocation and that the stoichiometry of this reaction may be different for different ribosomal or elongation factor phenotypes. 19 A method to measure proofreading in translation has been developed, where only those GTP molecules that are hydrolyzed on EF-Tu are 22 G. Chinali and A. Parmeggiani, J. Biol. Chem. 255, 7455 (1980). 26 R. C. Thompson and P. J. Stone, Proc. Natl. Acad. Sci. U.S.A. 74, 198 (1977). 27 C. G. Kurland, in "Nonsense Mutations and tRNA Suppressors" (J. E. Cellis and J. D. Smith, eds.), p. 98. Academic Press, New York, 1979. 28 A. S. Spirin, Prog. Nucleic Acid Res. Mol. Biol. 32, 75 (1985). 29 L. P. Gavrilova, D. G. Kakhniashvili, and S. K. Smailov, FEBSLett. 178, 283 (1984).
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
625
taken into account. 2°,24 This technique eliminates problems of uncoupled GTPase activities in the system as well as that of ambiguities regarding the number of GTPs that are required per translocation. This method to "count the number of EF-Tu cycles per peptide bond" takes advantage of the fact that the release rate of GDP from EF-Tu is very slow in the absence (ki) = 0.011 sec-1) but very fast in the presence of EF-Ts. Is The fact that it takes about 90 sec for GDP to leave EF-Tu spontaneously makes it feasible to arrange the experimental system in such a way that the rate-limiting step in protein synthesis is the dissociation rate kD. When this can be done for correct as well as for incorrect ternary complex the total rate of GTP hydrolysis is the same in both cases and equal to TuokD. However, the rate of polypeptide synthesis is different for correct (J~ and incorrect (J7) ternary complex since many more cycles of EF-Tu are required in the latter case (J~ = TuokD/f,) than in the former (J~-= TuokD/fc). The ratio between the number of correct peptide bonds (J~ and the number of incorrect ones (JT,) is the proofreading factor ( F - J ~ / J ~ , =fw/f~). In what follows we describe how to design experiments where these conditions for accurate proofreading measurements are fulfilled to a good approximation. One requirement is that the rate by which ternary complexes pass the initial selection step is much faster than the release rate of GDP from EF-Tu. The rate of GTP hydrolysis in ternary complex is the product between an R factor (k,~t/Km) and the concentration of ribosomes with an open A-site ([R^]). We put R~av for correct and R ~ for incorrect R factors, which are defined by the following scheme: k~,* kS•* TS," + R A ~ Rl ,
k~'wk~'w
(17) (18)
The rate constants for the transition from ternary complex to T u - GDP are given by the following expressions k~rv
= [RA]R~Ia,
k~av -- [RA]R~,rp
(1 9a) (19b)
The initial selectivity (I) of ternary complexes before hydrolysis of GTP is given by the following ratio
I = R~av/R~rv
(20)
From Eq. (20) it follows that the R factor for incorrect ternary complex hydrolysis of GTP is a factor ! smaller than the correct one. The release rate of GDP is rate limiting in protein synthesis when the following two
626
RIBOSOME FUNCTION AND KINETICS
[42]
inequalities are fulfilled. [RA]R~5~ > > k D
(2 la)
[RA]R~av -----[R^]R~av/I > > kD
(2 lb)
This inequality is easily fulfilled for correct ternary complexes. In factor titrations with EF-Tu, as described above, k,~t/K m values of about 2 × 10 7 M - 1 s e c - I for the EF-Tu-dependent rate of peptide bond formation were obtained. The R factor for peptide bond formation is related to the R factor for GTP hydrolysis by the parameterf~ according to: R~rl, = f~(k=JKm)c
(22)
f~ for wild-type ribosomes is near 1.115,tna° so that R~a~ is about 2 × 107 M -t sec-~. Thirty picomoles of active ribosomes is present in 100/tl, so that [R^] = 3 × 10-7 M and [RA]Rc = 6 see-~. This is more than 500 times larger than kv. The steady-state amount of EF-Tu in ternary complex will thus be more than 500 times less than the amount of E F - T u GDP binary complex. If, furthermore, these two states are the most populated ones (see Ehrenberg et al. 2°) about 99.8% of all EF-Tu will be E F - T u - G D P . For incorrect ternary complexes it may be more ditticult to obtain the required predominance of E F - T u - G D P . With an initial selection (I) of 100, as observed for tRNA2t ~ then JR^JRw = 3 X 10-7 × 2 × 107/100 = 0.06 see-1. This is about five times kv (--0.011 see-l) and thus about 85% of EF-Tu is E F - T u - G D P in this case. I f / = 1000 instead there will be more ternary complex than E F - T u - G D P , and the experiment would, as a consequence of this, be insensitive to how the accuracy is partitioned between proofreading and initial selection. 2° In the absence of EF-Ts, EF-Tu is mainly E F - T u - G D P or incorrect ternary complex (T3). 2°,24 When there is a correct (arc) as well as an incorrect (Jw) flow into polypeptide then the total GTP turnover of EF-Tu (JGav) is given by J~av = f,,av~ +f~J~
(23)
The superscripts + and -- signify the presence (+) or the absence ( - ) of EF-Ts. The GTP-hydrolysis on EF-Tu is in the steady state equal to the release rate of G D P from EF-Tu. In the absence of EF-Ts the following relation holds Joav -- T u - G D P k D
(24)
The fraction of EF-Tu that is in correct ternary complex can be neglected here. 2° The incorrect flow into polypeptide (Jw) can be written as follows in the presence as well as in absence of EF-Ts. J~ = [R^]T~'±R "
(25)
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
627
Since release of GDP from EF-Tu is very fast in the presence of EF-Ts, ~8 one can arrange the experimental conditions such that the only significantly populated state in this case is T]'. The following relation is then a good approximation: T] '+ = Tuo
(26)
Eq. (26) can subsequently be used in Eq. (25) to estimate [RA]R w experimentally from the following relation [RA]R w = J+/Tuo
(27)
The amount of incorrect ternary complex in the absence of EF-Tu now follows from Eqs. (25)-(27): T ~ - = (J~,/J++,)Tuo
(28)
As long as most EF-Tu is E F - T u - G D P or T]', conservation of mass leads to the following approximation Tuo -- T u - G D P - + T]'-
(29)
The amount of Tu-GDP- in the system can be written with the help of Eqs. (28)-(29) T u - GDP- = (1 - J~,/J+)Yuo
(30)
Eq. (30) can be put into Eq. (24) and the resulting expression used in Eq. (23) to obtain the following important relation. (1 -- J~,/J+)TuokD =fwJ~, + f c J ;
(3 I)
Ribosomes continously reach the end of poly(U) during the incubation time of a measurement and the rate by which this occurs depenas primarily on the correct peptide flow (j¢).2o It is therefore important that J~, and J+ are measured at the same correct flow (J~- = J+ = Jc) of Phe into polypeptide in the "Phe-Leu" plot 2°,24 to be described next. T h e P h e - L e u Plot Here Eq. (31) is used to obtain information about the proofreading factor (F). Division by f j ~ , at both sides in Eq. (3 l) and rearrangement of terms give a useful relation for experimental data evaluation. 15,16,2°,24,3° J~/J~, = TuokD/f~( l/J~, - 1/J +)
(32)
The correct flow into polypeptide (J~-) is varied in the experiment by 30 D. I. Andersson and C. G. Kurland, Mol. Gen. Genet. 191, 378 (1983).
628
RIBOSOME FUNCTION AND KINETICS
[42]
titrating with correct synthetase under conditions where the aminoacylation of correct tRNA is the rate-limiting step for correct polypeptide synthesis. At the same time incorrect aminoacyl-tRNA is kept fully charged. In this way small levels of correct ternary complex (T]) are combined with substantial variations of J~- and JT,. It is important for the precision of the experiment that 1/JT, > > 1/J+. If these flows are similar, their difference will have a large, relative uncertainty. This inequality is fulfilled when most EF-Tu is T u - G D P in the absence of EF-Ts for all values of Jc as can be seen from Eq. (30). This becomes especially critical at the highest concentrations of Jc where the tendency for ribosomes to come to the end of the mRNA and stop during the incubation time is most accentuated. It is therefore also important that the highest values of J¢ give a total polypeptide synthesis during the incubation time that leaves most of the ribosomes still elongating at the end of the measurement. When these experimental conditions are met, a plot of J-JJ~, as a function of 1 / J ~ , - l / J + gives a straight line which intercepts with the y-axis at - F. Assay Conditions for P h e - L e u Plot When the total activity of ribosomes is high they drive ternary complexes to E F - T u - G D P with high efficiency. Mix A therefore contains more ribosomes than normally used in ~thc burst experiments dcscribcd above. Typical values are 30 pmol of active ribosomes with N-Ac-[~+C]Phe-tRNA 1.2 times the total amount of ribosomes and poly(U) calculated to be about 300 nuclcotides per total ribosome. In these experiments E F - T u - G D P is in mix A, where no energy pump regenerates GTP from GDP. Therefore EF-Tu is an E F - T u - G D P complex when the incubation begins; a condition which comes close to the steady state in the absence of EF-Ts, where almost all EF-Tu is EF-Tu-GDP. The factor mix (B) is divided in two parts; one with (B +) and the other without (B-) EF-Ts. The amount of Phe-tRNA l ~ in the assay is kept well above the total amount of ribosomes. The final concentration of incorrect tRNA isoacceptor [mostly tRNAzTM, tRNA+L~" on poly(U)] is kept well above the total EF-Tu concentration. The Phe-synthetasc concentration is varied so that the poly(Phe) synthesis, in the absence of EF-Ts, ranges from small values near zero to values near the maximum possible ( P h e ~ ) in a given incubation time iT), EF-Tu concentration (Tuo), and f~ value ( P h c ~ = Tuokv T/f~). It is important to coordinate the choice of EF-Tu concentration (Tuo), incubation timc (T), and concentration of active ribosomes ([Ro]) for a given size of the mRNA so that the maximal total
[42]
MEASUREMENT OF TRANSLATIONAL KINETIC PARAMETERS
629
synthesis in the absence of EF-Ts ( P h e ~ ) is significantly below the maximal synthesis in the presence of EF-Ts (Phe+m~). This condition is equivalent to the statement above that most ribosomes should still be elongating at the end of the incubation time in the absence of EF-Ts. Phe+~ depends on number of active ribosomes (Ro) and the equivalent aminoacid length (L) of poly(U) (Phe+m~ = RoL/2). With L -- 200, Tuo = 200 pmol, R0 = 30 pmol, f~ -- 1.1, and an incubation time of 10 min one gets: Phe~aa~ = 200 × 0.011 × 600/1.1 -- 1200 pmol Phe+m~ = 30 X 200/2 = 3000 pmol With these choices of incubation time and concentrations of ribosomes and EF-Tu, the required condition that Phem~ ÷ > > P h e ~ is reasonably well fulfilled.
T h e Split-Factor Titration Here the proofreading of correct and incorrect ternary complexes is investigated separately. When Jw is equal to zero, Eq. (31) reduces to a relation for correct substrate only
f~-- TuokD/J-~
(33)
With no correct Phe flow in the system (J~- = 0), Eq. (31) simplifies to a relation solely for incorrect proofreading fw = (1 -
Jw/J+w)TUokD/J~,
(34)
Experimental conditions corresponding to Eq. (33) are easy to accomplish. To obtain reliable estimates Offw is more demanding. One reason is that in order to get hot TCA-precipitable chains, more than five incorrect aminoacids must be present in the nascent chain. For substrates with high values off,, it might take a very long time to obtain oligopeptide chains that are long enough to precipitate. One way to solve this problem is to use "primer" chains of the correct amino acid. The ribosomes are started with nonlabeled chains of Phe which are long enough so that precipitability is already achieved for the first missense amino acid. If there is a limited amount of correct amino acid when the incubation starts, this will rapidly be consumed in a transient poly(Phe) synthesis. After this Phe burst, only missense amino acids are left andfw can subsequently be determined from the slope of a plot of Jw versus the input concentration (Tuo) of EF-Tu. The split-factor titration is technically simpler than the Phe-Leu plot described above.
630
RIBOSOME FUNCTION AND KINETICS
[42]
The requirements for long messengers are not as critical here. There are, however, objections that can be raised against the split-factor method (see Ehrenberg et al.2°). First, the proofreading parameter for incorrect substrate (Jew)is studied in a missense context where the neighboring peptidyl-tRNA in the P-site is mismatched to its UUU-codon. The correct proofreading parameter (f~) is, in contrast, measured in the context of a properly matched peptidyl-tRNAph~in the P-site. In the Phe-Leu plot, both correct (fe) and incorrect (f~) proofreading parameters are jointly measured in a predominantly sense context, with a correctly matched peptidyltRNA l'h~in the P-site. Here the correct Phe flow always dominates over the flow of incorrect amino acid into the polypeptide. 2°,2+ Second, in split-factor titrations there is a covariation of ternary complex and T u - G D P . Since T u - G D P can also stimulate peptide bond formation, the proofreading parameters (f~ or f,,) may be underestimated. 31 In the Phe-Leu plot the amount of T u - G D P is approximately constant throughout the whole Phe-synthetase titration. Any contribution to the missense incorporation stimulated by T u - G D P is therefore also constant and can be subtracted as background. More detailed investigations of the Tu-GDP-stimulated flow into polypeptide31 indicate that this backflow is relatively small. Careful comparisons between F factor estimates obtained from PheLeu plots and split-factor titrations reveal no difference between the two methods for the tRNA~" and tRNA+L~ isoacceptors. 2° Conditions of Split-Factor Assay The 70S mixture (A) is prepared as in the Phe-Leu plot with one exception. The concentration of EF-Tu is not kept constant but is varied. The modifications in the factor mix (B) in relation to the Phe-Leu plot are as follows. The ratio between the number of phenylalanines in B and the number of active ribosomes in A is adjusted to roughly 15. For 30 pmol of active ribosomes in A, 450 pmol of phenylalanine is typically used in B. About 80% of these phenylalanines appear finally as poly(Phe) and this corresponds to an average primer length of 12 phenylalanines. It is important that the primer length is well above 5 arninoacids per ribosome, since this is the limit of hot TCA precipitability. It is also important that the primers are not too long in relation to the number of triplets in poly(U). Too-long primers lead to a reduction of the number of ribosomes which can elongate incorrect amino acids after the initial Phe burst.
31A.-M. Rojas, manuscript in preparation.
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
631
The concentration of Phe-synthetase must be kept sufficiently high to allow rapid primer formation. As in the Phe-Leu plot described above, the concentration of tRNA 1~ must be well above the total input concentration of ribosomes. In the absence of EF-Ts the amount of EF-Tu is varied in the range of 40-300 pmol when the incubation time is 15 min and the total Phe primer synthesis 400 amino acids. In the absence of EF-Ts 50 pmol of EF-Tu can give a maximum of about 500 pmol ofPhe peptide bonds in 15 minutes [50 (pmol × 0.011 (sec-l) X 900 (sec)]. At the lowest EF-Tu concentration, therefore, the amount of EF-Tu is just enough for the primer synthesis to reach completion. If 14C-Phe is used for the primers and the incorrect amino acid is 3H-labeled, a proper correction for the influence of the primer synthesis on the incorrect amino acid incorporation can be made from the known amount of incorporated correct amino acid. 2° The range of EF-Tu used plus EF-Ts is generally smaller than the range in the presence of EF-Ts. This makes the concentration range of ternary complex more similar in the two cases.
[43] R i b o s o m a l S y n t h e s i s o f P o l y p e p t i d e s f r o m Aminoacyl-tRNA without Polynucleotide Template
By A. S. SPIRIN, N. V. BELITSINA,and G. Z. YUSUPOVA(TNALINA) It has been demonstrated that the ribosomes ofEscherichia coli can use certain aminoacyl-tRNAs for polypeptide synthesis without a polynucleotide template.l-3 The best substrate for the ribosomal template-free peptide synthesis was lysyl-tRNA. I-4 It has been shown that it is the structure of the tRNA and not the nature of the amino acid residue that determines the ability of the aminoacyl-tRNAL~ to participate in peptide elongation on ribosomes.5 Other aminoacyl-tRNAs that were studied as substrates for the ribosomal peptide synthesis in the absence of the template include seryltRNA, threonyl-tRNA, and aspartyl-tRNA.2,3 Template-free synthesis of N. V. Belitsina, G. Z. Tnalina, a n d A . S. Spirin, FEBSLett. 131, 289 (1981). 2 G. Z. Tnalina, N. V, Bclitsina, and A. S. Spifin, Dokl. Akad. Nauk S.S.S.R. 266, 741 (1982). 3 N. V. Belitsina, G. Z. Tnalina, and A. S. Spirin, BioSystems 15, 233 (1982). 4 G. Z. Yusupova (Tnalina), Y. L. Remme, N. V. Belitsina, and A. S. Spirin, Dokl. Akad. Nauk S.S.S.R. 286, 725 (1986). s G. Z. Yusupova (Tnalina), N. V. Belitsina, and A. S. Spirin, FEBSLett. 206, 142 (1986). METHODS IN ENZYMOL(~Y, VOL. 164
English translationcopyright © 1988 by Academic Press, Inc.
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
631
The concentration of Phe-synthetase must be kept sufficiently high to allow rapid primer formation. As in the Phe-Leu plot described above, the concentration of tRNA 1~ must be well above the total input concentration of ribosomes. In the absence of EF-Ts the amount of EF-Tu is varied in the range of 40-300 pmol when the incubation time is 15 min and the total Phe primer synthesis 400 amino acids. In the absence of EF-Ts 50 pmol of EF-Tu can give a maximum of about 500 pmol ofPhe peptide bonds in 15 minutes [50 (pmol × 0.011 (sec-l) X 900 (sec)]. At the lowest EF-Tu concentration, therefore, the amount of EF-Tu is just enough for the primer synthesis to reach completion. If 14C-Phe is used for the primers and the incorrect amino acid is 3H-labeled, a proper correction for the influence of the primer synthesis on the incorrect amino acid incorporation can be made from the known amount of incorporated correct amino acid. 2° The range of EF-Tu used plus EF-Ts is generally smaller than the range in the presence of EF-Ts. This makes the concentration range of ternary complex more similar in the two cases.
[43] R i b o s o m a l S y n t h e s i s o f P o l y p e p t i d e s f r o m Aminoacyl-tRNA without Polynucleotide Template
By A. S. SPIRIN, N. V. BELITSINA,and G. Z. YUSUPOVA(TNALINA) It has been demonstrated that the ribosomes ofEscherichia coli can use certain aminoacyl-tRNAs for polypeptide synthesis without a polynucleotide template.l-3 The best substrate for the ribosomal template-free peptide synthesis was lysyl-tRNA. I-4 It has been shown that it is the structure of the tRNA and not the nature of the amino acid residue that determines the ability of the aminoacyl-tRNAL~ to participate in peptide elongation on ribosomes.5 Other aminoacyl-tRNAs that were studied as substrates for the ribosomal peptide synthesis in the absence of the template include seryltRNA, threonyl-tRNA, and aspartyl-tRNA.2,3 Template-free synthesis of N. V. Belitsina, G. Z. Tnalina, a n d A . S. Spirin, FEBSLett. 131, 289 (1981). 2 G. Z. Tnalina, N. V, Bclitsina, and A. S. Spifin, Dokl. Akad. Nauk S.S.S.R. 266, 741 (1982). 3 N. V. Belitsina, G. Z. Tnalina, and A. S. Spirin, BioSystems 15, 233 (1982). 4 G. Z. Yusupova (Tnalina), Y. L. Remme, N. V. Belitsina, and A. S. Spirin, Dokl. Akad. Nauk S.S.S.R. 286, 725 (1986). s G. Z. Yusupova (Tnalina), N. V. Belitsina, and A. S. Spirin, FEBSLett. 206, 142 (1986). METHODS IN ENZYMOL(~Y, VOL. 164
English translationcopyright © 1988 by Academic Press, Inc.
632
RIBOSOME FUNCTION AND KINETICS
[43]
polypeptides was strongly dependent on the two elongation factors (EF-Tu and EF-G) and GTP) -3 Materials Escherichia coli MRE 600 ribosomes are washed four times with 1 M purified ribosomes are stored in a buffer containing 20 mM, Tris-HCl, 100 mM NH4C1, l0 mM MgCI2, 0.1 mM ethylenediaminetetraaceticacid (EDTA), and 10% glycerol, pH 7.6 (at 37 °) at --70 °. The purified elongation factors, EF-Tu and EF-G, are also isolated from E. coli MRE 600. 8,9 Preparations of total E. coli tRNA (Boehringer-Mannheim), aminoacylated enzymatically with one of ~4C-labeledamino acids, t° are stored at 4* in the lyophilized state. Specific activities of the t4C-labeled amino acids and the ~4C-labeledaminoacyl-tRNAs used are given in Table I. Individual [t4C]lysyl-tRNAL~ is prepared from the total E. coli tRNA acylated with [t4C]lysine by the procedure of affinity chromatography on immobilized EF-Tu of Thermus thermophilus HB8 H (EF-Tu we used was a gift from Dr. M. Garber, Institute of Protein Research, Pushchino); specific activity of [14C]lysyl-tRNAL~ is 1000- 1100 pmol [~4C]lysine/A26o unit. Individual [3H]phenylalanyl-tRNATM is prepared by misacylation of the tRNA TM from E. coli with [3H]phenylalanine (Amersham, 50 Ci/ mmol) using phenylalanyl-tRNA synthetase (ligase) from yeast t2 (this enzyme was a gift from Dr. P. Remy, Institute of Molecular and Cellular Biology, Strasbourg, France); specific activity of [3H]phenylalanyl-tRNAL~ is 750 pmol [3H]phenylalanine/A26o unit. The samples of purified individual aminoacyl-tRNAs are stored in l0 mM NaCH3COO buffer, pH 4.5, at -70*. NH4C1. 6'7 The
Reagents
CM-cellulose (Whatman) Poly(U) (Calbiochem) Poly(A) (Calbiochem)
S. Pestka, J. Biol. Chem. 243, 2810 (1968). 7 R. W. Erbe, M. M. Nau, and P. Leder, J. Mol. Biol. 39, 441 (1969). 8 K. Arai, M. Kawakita, and Y. Kaziro, J. Biol. Chem. 247, 7029 (1972). 9 y. Kaziro, N. Ynoue-Yokosawa, and M. Kawakita, J. Biochem. (Tokyo) 72, 853 (1972). 10L. P. Gavrilova and V. V. Smolyaninov, Mol. Biol. (USSR) 5, 883 (1971). t~ W. Fischer, K.-H. Derwenskus, and M. Sprinzl, Eur. J. Biochem. 125, 143 (1982). t2 j. Wagner and M. Sprinzl, Eur. J. Biochem. 108, 213 (1980).
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
633
TABLE 1 SPECIFIC ACTIVITIESOF 14C=LABELEDAMINO ACIDS AND t4C-LABELED AMINOACYL-tRNAs
Amino acid Lysine Arginin~ Glutamic acid Aspartic acida Glutamine Asparaglne Threonine Serine Glycine Methionine Phenylalanine Proline Isoleucine Leucine Valine Alanine
Specific activity of 14C-labeled amino acid (Ci/mol)
[~'C] Aminoacyl-tRNA content per 1 mg of total tRNA (pmol)
336 210 285 140 48 151 228 170 l 18 285 486 280 354 342 280 171
1481 2597 1027 1769 1349 1295 1237 1037 1494 2056 954 813 1943 2056 1737 1276
a "C-Labeled amino acids were from the Institute for Research, Production and Uses of Radioisotopes, Prague, Czechoslovakia; other m~-Iabeled amino acids were from Amersham, England.
Poly(C) (Department for Production of Biologically Active Substances, Novosibirsk, USSR) GTP, Nasalt (Fluka) Tetracycline, chloramphenicol (Department for Production of Biologically Active Substances, Novosibirsk, USSR) Phosphoenolpyruvate (Fluka) Phosphoenolpyruvate kinase (Boehringer-Mannheim) Guanyl-5'-ylmethylene diphosphonate (synthesized by Dr. K. K. Zikherman, Institute of Protein Research, Pushchino) Fusidic acid (Sigma) Phenylboric acid (synthesized by Dr. K. K. Zikherman, Institute of Protein Research, Pushchino) Glass filters GF/F (Whatman) Nitrocellulose filters Synpor No. 6 (Chemapol)
634
RIBOSOME FUNCTION AND KINETICS
[43]
POPOP (Serva) PPO (Serva) Bovine serum albumin (Reanal) Triton X- 100 (Serva) Buffers
Standard buffer for cell-free elongation systems: 10 m M or 12 m M MgCI2, 100 m M NH4CI, 0.1 m M EDTA, 1 m M dithiothreitol, 20 m M Tris-HC1, pH 7.6 (at 37*). In studies of the dependence of polypeptide synthesis on Mg2+ concentrations, MgC12 in the buffer varies from 5 to 20 mM.
Solutions 3 m M pyridine-Acetate buffer, pH 5.2 1 M pyridine-acetate buffer, pH 5.2 Phenol Toluene 96% ethanol Trichloroacetic acid (TCA), 30% and 5% 5% TCA with 0.25% Na2WO4, pH 2.0 NaOH, 1 M and 0.2 M CH3COOH, 1 M Triton X- 100 (Serva) Template-Free Ribosomal Synthesis of Polylysine from Lysyl-tRNA
Use of Total tRNA Aminoacylated with Lysine The mixture containing 20 pmol of ribosomes, 100/~g of total tRNA aminoacylated with [14C]lysine (148 pmol of [14C]lysyl-tRNA), 170 pmol of EF-Tu, 37 pmol of EF-G, 8 - 16 nmol of GTP, 100 nmol of phosphoenolpyruvate, and 1/tg of phosphoenolpyruvate kinase in 50/tl of the standard buffer is incubated at 37 °. The reaction is stopped by adding 2 ml of 5% trichloroacetic acid with 0.25% Na2WO41~; 100 #g of bovine serum albumin is added as a carrier and the suspension is hydrolyzed at 90* for 20 min. The hot acid-insoluble precipitates are collected on GF/F glass filters and their radioaetivities are measured in the standard toluenePPO-POPOP mixture using the Beckman LS-100 or LS-9800 seintillaiton 13 R. S. Gardner, A. J. Wahba, C. Basilio, R. S. Miller, P. Lengyel, and J. F. Speyer, Proc. Natl. Acad, Sci. U.S.A. 48, 2087 (1962).
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES I
635
!
COMPLETE E t~
/
N
E O
_J
Z/
'-5' ,1" 0
-EF-G 10
20
Time, min
FIG. 1. Kinetics of [14C]lysineincorporation into TCA-Na2WO4-insoluble product in the template-free ribosomal system. (0) Complete: +EF-Tu, +EF-G, -I-GTP; ~1) +EF-Tu, -EF-G, +GTP. Incubation at 37 °, 10 mM MgCl2.
spectrometer. Under these conditions dilysines are not precipitated and short oligolysines are not precipitated quantitatively.~4 About 3 - 4 pmol of [~4C]lysine is incorporated into the TCA-Na2WO4-insoluble product after l 0 - 2 0 min of incubation under the conditions described. The kinetic curve of poly[~4C]lysine synthesis is represented in Fig. l as an example. 'Fable II shows that the template-free system under investigation is completely dependent on ribosomes. Two elongation factors, EF-Tu and EF-G, are strictly required for the template-free polylysine synthesis, suggesting the participation of enzymatic binding of lysyl-tRNA and EF-Gpromoted translocation of oligolysyl-tRNA in the process, just as in the normal translation system. The ribosomal template-free system of polypeptide synthesis depends on temperature and stops in the cold. It is noteworthy that this system is much more dependent on GTP regeneration than the usual template-dependent translation system: exclusion of phosphoenolpyruvate from the system blocks polylysine synthesis. This could be an indication that EF-Tu-promoted aminoacyl-tRNA binding to ribosomes without template polynucleotide is less efficient, and more molecules of GTP are expended per one molecule of the aminoacyl-tRNA bound, as compared with template-dependent binding (the :same situation 14M. A. Smith and M. A. Stahmann, Biochem. Biophys. Res. Commun. 13, 251 (1963).
636
[43]
RIBOSOME FUNCTION AND KINETICS TABLE II POLY[14C]LYSINE SYNTHESIS IN THE TEMPLATE-FREE RIBOSOMAL SYSTEMa
No. 1
2 3
a
System of polypff2]lysine synthesis
[14C]Lysine, polymerized (pmol)
Complete, 37 ° -EF-G -EF-Tu -Ribosomes Complete, 37 ° -Phosphoenolpyruvate Complete, 37 ° Complete, 4 °
2.8 0.5 0.2 0.05 3.9 0.45 4.2 0.3
Incubation for 20 rain, 10 m M MgCl2.
is seemingly observed when ribosomes carrying polynueleotide templates bind noncognate aminoacyl-tRNAs 15). Table III shows that polylysine synthesis in the template-free system is very strongly inhibited by all of the same agents which specifically inhibit the natural process of translation: tetracycline, chloramphenicol, phenylTABLE III EFFECT OF SOME INHIBITOR$ ON TEMPLATE-FREE RIBOSOMAL SYNTHESIS OF POLy[laC]LYSlNE
Inhibitor Tetracycline (TC)
Chloramphenicol (CM) Phenylboric acid (PBA) Fusidic acid (FA) Guanyl-5'-ylmethylene diphosphonate (GMPPCP) Poly(U) Poly(C)
Concentration of inhibitor (raM)
Inhibition of polyp4C]lysine synthesis (%)
0.03 0.16 0.25 0.01 0.02 15.0 80.0 0.4 0.4
50.0 83.7 87.5 50.0 86.2 50.0 91.0 95.0 96.8
4.0~ 4.0~
87.2 65.6
a Values given as/zg per 50 #1. ~5D. G. Kakhniashvili, S. K. Smallov, and L. P. Cravrilova, F E B S L e t t . 193, 103 (1986).
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
637
boric acid, fusidic acid, and guanyl-5'-ylmethylene diphosphonate. Moreover, it is seen that the template-free system is much more sensitive to some antibiotics, for example, tetracycline, than the template-directed system) ,3 Polylysine synthesis is significantly inhibited by noncognate template polynucleotides, such as poly(U) and poly(C).t The Mg2+-dependence of template-free polylysine synthesis was determined in comparison with poly(A)-directed synthesis by variations of the Mg2+ concentrations in the standard buffer. The results are presented in Fig. 2. The Mg2+ optimum of template-free polylysine synthesis is lower than that of poly(A)-directed synthesis. High Mg2+ concentrations strongly inhibit template-independent synthesis; the latter is completely blocked in the region of 15- 18 mM Mg2+ where the poly(A)-directed synthesis is optimal. It is noteworthy that the curve of the Mg2+ dependence ofpolylysine synthesis in the poly(A)-directed system has a shoulder in the region of low (about 10 mM) Mg2÷ concentration; this can be explained by the concomitant template-free lysine incorporation in the ribosome-synthesized product. Sedimentation analysis of the template-free incubation mixture in the sucrose gradient shows that the ribosomal zone contains newly synthesized
+ Poly(A) -5 E 0,.
N
E 0 Q.
y(A)
._1
(
I
0
I
I
I0
20
[M gZ+], mM FIG. 2. Dependence of poly[t4C]lysine synthesis on Mg2+ concentration. (A) Poly(A)-directed system [+20 gg poly(A)]: (0) poly(A)-independent (template-free) system. Incubation at 37 ° for 30 min.
638
[43]
RIBOSOME FUNCTION AND KINETICS
0.15 70S
-6 E 0.10
N
_E
E
O
<~
0
0.05
I
I
I
I0
20
30
Froction number
FIG. 3. Sucrose gradient sedimentation analysis of the incubation mixture of the poly(A)independent ribosomal system for poly[14C]lysine synthesis. A 280-ld reaction mixture with 112 pmol of ribosomes was used. Incubation at 37* for 30 rain, 13 mM MgCI2. (A) Ultraviolet absorption at 260 rim; (0) hot TCA-Na2WO4-insoluble [14C]lysine. Centrifugation at 40,000 rpm for 2 hr, 4", Spineo L5-50, SW-41 rotor.
TCA-Na2WO4-precipitable [~4C]polylysine (Fig. 3). At the same time, a portion of the TCA-Na2WO4-precipitable ~4C-labeled product is revealed as free polylysine or polylysyl-tRNA at the top of the gradient; this may be the result of partial dissociation of the synthesized product from ribosomes during template-free elongation (some of the polylysyl-tRNA dissociates from the ribosomes also during the poly(A)-directed elongation process).
Identification of the Ribosomal Product Synthesized from Lysyl-tRNA A CM-cellulose column preequilibrated with 3 mM pyridine-acetate buffer (pH 5.2) is used to identify p4C]lysine peptides. Monolysines are not adsorbed on CM-ceUulose under these conditions. 16 A 600/zl incubation mixture containing 240 pmol of ribosomes and corresponding amounts of the other components necessary for poly[~4C]lysine synthesis is prepared as t6 p. Pulkr~bek and I. Rychlik, Biochim. Biophys. Acta 155, 219 (1968).
[43]
639
T E M P L A T E - F R E E SYNTHESIS OF P O L Y P E F T I D E S
described above. After incubation for 30 min at 37 °, the mixture is extracted with phenol and the RNA fraction is precipitated with ethanol. The precipitate is dissolved in 50/A of 0.2 N NaOH and incubated for 15 min at 37 °. Under these conditions, lysine and oligolysine residues are split off from tRNA. After incubation the solution is diluted to 5 ml with distilled water, adjusted to pH 5.0, and applied to a CM-cellulose column (0.25 cm X 33 cm). Lysine peptides are eluted by an exponential gradient of pyridine-acetate buffer (pH 5.2) from 3 m M to 1 M. Fractions (l ml) are collected and their radioactivities counted in a mixture of tolueneP P O - P O P O P and Triton X-100 in a 2 : 1 ratio. Figure 4A demonstrates that oligolysines up to seven lysine residues in length are synthesized in the system without poly(A). If EF-G is omitted, T C A - Na2WO4-insoluble material is not observed, and only peptides of two lysine residues in length are synthesized (see Fig. 4B and Table II). Thus, EF-G-dependent translocation seems to be an obligatory prerequisite for template-free elongation on the ribosome. (This follows also from Table III: EF-G inhibitors such as guanyl-5'-ylmethylene diphosphonate and fusidic acid block template-free polylysine elongation.)
T
Lys z
-
Lys 3
-
m
-
-
T
Lys 4
I"
Lys 5
LYS6
T - -
Lys7
40
E 2o N
E '~ 200 Q.
B ~L)
-EF-G
I00
20
40
60
Fraction number
FIG. 4. CM-cellulosecolumn chromatography analysis of the poly(A)-independentribosomal system of polyp4C]lysinesynthesis: elution profile of oligop4C]lysine.(A) Complete: +EF-Tu, +EF-G, -t-GTP,(B) +EF-Tu, - EF-G, +GTP. Incubation at 37° for 30 min, 10 mM MgCI2.From Belitsina e t aL ~
640
RIBOSOME FUNCTIONAND KINETICS
[43]
Use of Purified L ysyl-tRNA Lr" A mixture containing 4 pmol of ribosomes, 50 pmol of [~4C]lysyltRNA TM, 75 pmol of EF-Tu, 1.5 pmol of EF-G, 15 pmol of GTP, 0.1/zmol of phosphoenolpyruvate, and 1 #g of phosphoenolpyruvate kinase in 50/zl of standard buffer is incubated at 37*. The reaction is stopped by 50/zl 1 M NaOH and the suspension is hydrolyzed for 10 min at 37 °. After cooling, the suspension is neutralized with 50/zl 1 M CH3COOH, then 2 ml 5% TCA-0.25% Na2WO4 (pH 2.0) is added, and the mixture kept for 10 min at 4 °.~7 The precipitate is collected on GF/F glass filters and the radioactivity is measured as indicated above. Figure 5 presents the kinetics of [~4C]lysine incorporation into the TCA-Na2WO4-insoluble material from [~4C]lysyl-tRNAL~ during incubation of the ribosomal cell-free system in the absence of poly(A). It is seen that E. coli ribosomes can utilize purified lysyl-tRNATM as a substrate for lysyl polymerization without any polynucleotide template. This process is completely dependent on the presence of EF-G in the system. The Mg2+ dependence of template-free polylysine synthesis from purified lysyl-tRNA (Fig. 6) is also the same as for total tRNA acylated with lysine (cf. Fig. 2). Thus, template-free elongation does not depend on the presence or absence of the other deacylated tRNAs in the system.
"° E
COMPLETE
o
o
.'2_ E 0
_J
_,H
/_~
-EF-G 30
60
Time, rain F]o. 5. Kinetics of [14C]lysineincorporation into the TCA-Na2WO4-insoluble product in the poly(A)-independent ribosomal system with individual [14C]Iysyl-tRNAL~.(0) Complete: +EF-Tu, +EF-G, +GTP; (A) +EF-Tu, -EF-G, +GTP. Incubation at 37", 12 mM MgCI2. 17M. E. Gottesman, J. Biol. Chem. 242, 5564 (1967).
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES I
I
641
I
LETE E
Q.
-o" N
0 CL {$)
./
i~
-EF-Gx I
I
I
5
10
15
20
[Mg2+1, F]o. 6. Dependence of poly[~4C]lysine synthesis of Mg2÷ concentration in the templatefree ribosomal system with individual [~4C]Iysyl-tRNAL-. (O) Complete: +EF-Tu, +EF-G, +GTP; (×) +EF-Tu, -EF-G, +GTP. Incubation at 37 ° for 30 min.
Template-Free Ribosomal Synthesis of Homopeptides from other Aminoacyl-tRNAs Template-free synthesis of polypeptides from different aminoacyltRNAs is studied in standard buffer with various Mg2+ concentrations from 5 mM to 20 mM. The 50/tl incubation mixture contained 20 pmol of ribosomes, 220 pmol of ~4C-labeled aminoacyl-tRNA (total tRNA acylated with one of the amino acids), 170 pmol of EF-Tu, 37 pmol of EF-G, 8 - 1 6 nmol ofGTP, 100 nmol of phosphoenopyruvate, and l pg of phosphoenolpyruvate kinase. Incubation is conducted at 37 °. Since conditions of TCA precipitation for different polypeptides vary, a less direct but more universal technique to estimate ribosomal activity in polypeptide synthesis from aminoacyl-tRNA, based on the binding of ribosomes to nitrocellulose filters, is used. ~8 Peptide synthesis is performed ~s M. W. Nirenberg and P. Leder, Science 145, 1399 (1964).
642
[43]
RIBOSOME FUNCTION AND KINETICS
as indicated above, and is stopped by a 50-fold excess of the cold buffer used in the experiment. The solution is then filtered through a nitrocellulose Synpor membrane No. 6. The filter with the adsorbed ribosomes is washed with cold buffer with a corresponding Mg 2+ concentration. The radioactivity of the filter is counted as described above. Ribosomes adsorbed on the filter contain both bound '4C-labeled aminoacyl-tRNA and newly synthesized '4C-labeled polypeptide. To determine the amount of synthesized '4C-labeled polypeptide, a control system of EF-Tu-dependent binding of '4C-labeled aminoacyl-tRNA with ribosomes is used in parallel. This control system contains all the same components as that of polypeptide synthesis but without EF-G. The '4C-labeled aminoacyl of the ribosomes in the binding system is subtracted from the total amount of label in the system of polypeptide synthesis. Figures 7 to 10 represent values of the ribosome-bound label when [14C]lysyl-, [14C]seryl-, and ['4C]phenylalanyl-tRNAs are used as substrates both for the template-free binding reaction and the template-free synthesis reaction in kinetic and Mg2+-dependence experiments. From a comparison of the kinetic curves of the reactions in Fig. 7 it is
IO
IO
o
D
0.)
-.'P c '1~
/ 5
/
f
/
O
0
U3
COMPETE .,r,
.
J~
-E -G
I
I
I0
20
5 c-
=
Time, min FIG. 7. Kinetics of 14C-labeled aminoacyl-tRNA binding and 14C-labeled polypeptide synthesis in the template-free ribosomal system. The technique of ribosome adsorption on nitrocellulose filters was used. (b and A) EF-Tu-dependent ['4C]Iysyl-tRNA and ['4C]seryltRNA binding (without EF-G), respectively; (@) poly[i4C]lysine and ((3) poly[14C]serine synthesis (in the presence of EF-Tu, EF-G and GTP). Incubation at 37 °, 10 mM MgCI2.
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
643
15
COMPLETE
I0
E _1
"{:3 c3
5
0
rn
-EF-Tu
0
f
T EF's
5
I0
\\
I
15
•
^--xI 20
[Mg2+], m M FIG. 8. Dependence of [~4C]Iysyl-tRNA binding and poly[t4C]lysine synthesis in the template-free ribosomal system on Mg 2+ concentration. The technique of ribosome adsorption on nitrocellulose filters was used. (0) Poly[14C]lysine synthesis (in the presence of EF-Tu, EF-G, and GTP); (&) EF-Tu-dependent [~4C]lysyl-tRNAbinding (without EF-G); (ll) EF-Tuindependent [~4C]lysyl-tRNA binding (in the presence of EF-G and GTP); (×) factor-free [m4C]lysyl-tRNAbinding (without EF-Tu, EF-G, and GTP). The dotted curve represents the difference between curves (0) and (A) (net polylysine synthesis). Incubation at 37* for 30 rain. From Belitsina et aL 3
seen that the presence of EF-G in the incubation mixture results in a significant increase of the amounts of [14C]lysine and [14C]serine bound with the ribosomes. This means that the ribosome can use not only the lysyl-tRNA but the seryl-tRNA also as a substrate for template-free polypeptide synthesis. In comparison to polylysine synthesis from lysyl-tRNA, the yield of the synthesis of polyserine from seryl-tRNA is about half. From Figs. 8 and 9 it is seen that the dependence on Mg 2+ concentration of the amount of ~4C-labeled amino acid bound to ribosomes in the polypeptide synthesis system has a definite optimum, in contrast to the 14C-labeled amino acyl-tRNA binding system. This indicates that the overall process in the peptide synthesis system includes the stage of translocation which is known to be inhibited by high Mg 2+ concentrationJ 9~° ~9N. V. Befitsina, L. P. Gavrilova, and A. S. Spirin, Dokl. Akad. Nauk S.S.S.R. 224, 1205 (1975). 2o N. V. Belitsina and A. S. Spirin, Eur. J. Biochem. 94, 315 (1979).
644
RIBOSOME FUNCTION AND KINETICS
[43]
8
m
C
o
E Q. k. (,0 (D
B "O t-O rn
J~ .S/ - E F/ ' ~.....~ s ~......~__,.~:_.xv 0
5
10
15
20
[Mq2+ ], FIG. 9. Dependence of [t4C]seryl-tRNA binding and poly[t4C]serine synthesis in the template-free ribosomal system on Mg 2+ concentration. The technique of ribosomal adsorption on nitrocellulose filters was used. (O) Poly[t4C]serine synthesis (in the presence of EF-Tu, EF-G, and GTP); 02) EF-Tu-dependent [t4C]seryl-tRNA binding (without EF-G); (×) factorfree [t4C]seryl-tRNA binding (without EF-Tu, EF-G, and GTP). The dotted curve represents the difference between curves (O) and 02) (net polysedne synthesis). Incubation at 37 ° for 30 min. From Belitsina et aL 3
In contrast, phenylalanyl-tRNA is found to be an ineffective substrate for template-free synthesis of peptides. It can be seen from the curves in Fig. l0 that codon-independent binding of [~4C]phenylalanyl-tRNA with the ribosome takes place, but the presence of EF-G gives virtually no increase in the level of radioactivity in the ribosomes at any Mg2+ concentration. Thus, the ribosomes do not polymerize phenylalanyl residues under these experimental conditions. A summary of the results of the experiments mentioned above and those with 13 other aminoacyl-tRNAs in the same binding and polymerization systems under optimal Mg2+ concentration is presented in Table IV. A comparison of optimal Mg 2+ concentrations for polymerization of aminoacyl residues on ribosomes without template polynucleotides has shown that they lie in the range from l0 to 15 mM MgClv Table IV shows that lysyl-tRNA, glycyl-tRNA, methionyl-tRNA, leucyl-tRNA, and valyl-tRNA are the best substrates for ribosomal binding without template polynucleotides, while glutaminyl-tRNA, glutamyl-
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES I
I
645
I
o
E
O.
COMPLETE
o
(0
o
o
t:D 0
rn
/
~
X
-
EF's
x -
I
5
fl
I
I0
15
20
Time, min FIG. 10. Dependence of [~4C]phenylalanyl-tRNA binding and poly[~4C]phenylalanine synthesis in the template-free ribosomal system on the Mg2+ concentration. The technique of ribosome adsorption on nitrocellulose filters was used. (O) [~4C]Polyphenylalanine synthesis (in the presence of EF-Tu, EF-G, and GTP); (l'q) EF-Tu-dependent [~4C]phenylalanyl-tRNA binding (without EF-G); (×) factor-free [~4C]phenylalanyl-tRNA binding (without EF-Tu, EF-G, and GTP). The dotted curve represents the difference between curves (O) and (El) (net polyphenylalanine synthesis). Incubation at 37* for 30 min. From Belitsina et al. 3
tRNA, aspartyl-tRNA, threonyl-tRNA, prolyl-tRNA, isoleucyl-tRNA, and alanyl-tRNA are weakly bound with ribosomes in the absence of template polynucleotide. No correlation was found between aminoacyl4RNA binding with nonprogrammed ribosomes and their activity in the polymerization reaction. Lysyl-tRNA, aspartyl-tRNA, threonyl-tRNA, and seryltRNA were the best substrates for homopeptide synthesis without templates (lysyl-tRNA > seryl-tRNA > threonyl-tRNA ~- aspartyl-tRNA). Polypeptide synthesis was low or virtually absent when it was done from glutaminyl-tRNA, isoleucyl-tRNA, methionyl-tRNA, asparaginyl-tRNA, phenylalanyl-tRNA, or prolyl-tRNA. Template-Free Ribosomal Synthesis of a Polypeptide from Misacylated tRNA
Use of Phenylalanyl-tRNALysfor Template-Free Polyphenylalanine Synthesis A mixture containing 4 pmol of ribosomes, 50 pmol of [3H]phenylalanyl-tRNALy~[phenylalanyl-tRNA synthetase (ligase) from yeast is used
646
[43]
RIBOSOME FUNCTION AND KINETICS TABLE IV
AMINOACYL-tRNA BINDING AND POLYPEPTIDE SYNTHESIS IN THE TEMPLATE-FREE RIBOSOMAL SYSTEM
~4C-Labeledaminoacyl residues bound on ribosomes (pmol)
Amino acid
Lysine Serine Threonine Aspartic acid Glycine Valine Glutamic acid Arginine Leucine Alanine Proline Phenylalanine Asparaginc Methionine Isoleucine Glutarnine
+EF--Tu (aminoacyl-tRNA binding system)
+EF-Tu, +EF--G (polypeptide synthesis system)
~4C-Labeledaminoacyl residues incorporated into peptide (pmol)
3.0 2.0 1.3 1.5 2.6 3.2 1.4 1.6 2.6 1.5 1.0 2.2 2.0 2.7 1.4 0.1
10.2 6.5 4.0 4.0 4.5 5.0 3.2 3.2 4.1 3.0 2.0 3.0 2.8 3.0 1.5 0.1
7.2 4.5 2.7 2.5 1.9 1.8 1.8 1.6 1.5 1.5 1.0 0.8 0.8 0.3 0.1 0
for misacylation], 75 pmol of EF-Tu, 1.5 pmol of EF-G, 15 pmol of GTP, 0.1/zmol of phosphoenolpyruvate, and 1/~g of phosphocnolpyruvate kinasc in 50/~1 of standard buffer is incubated at 37 °. The reaction is stopped with 3 ml 5% TCA, and the mixture is hydrolyzed for 20 rain at 90 ° and cooled. The precipitates arc collected on GF/F glass filters and washed with 5% TCA; the filters are dried and the radioactivities counted as described above. Figure 11 shows that E. coli ribosomes can polymerize phenylalanyl residues using [3H]phenylalanyl-tRNATM as a substrate in the absence of poly(A) and any other template polynucleotide. Peptide elongation depends strictly on the presence of EF-G in the system. The rates of polyphenylalanine and polylysine syntheses without the template are similar when phenylalanyl-tRNATM and lysyl-tRNATM are used as substrates, respectively (cfi Fig. 5 and Fig. 11). This suggests that the rate of templatefree peptide elongation is determined primarily by the structure of t R N A TM.
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES I
647
I
COMPLETE,[3H]Phe.tRNAL)'s 4.0 N
7, i 2.0
/
I-
/ 0
.tRNAPhe EF-G, [3_HJPhe4RN"P"e
/
-EF-G,I=H]Phe-tRN~'s
30 60 Time, rain
Fla. 11. Kinetics of [3H]phenylalanine incorporation into hot TCA-insoluble product in the template-free ribosomal system using [3H]phenylalanyl-tRNA ph~ and [3H]phenylalanyltRNA Lye. Complete system (+EF-Tu, +EF-G, -t-GTP): (O) [3H]Phenylalanyl-tRNALy" and (O) [3H]phenylalanyl-tRNAPhe; EF-Tu-dependent binding (without EF-G): (1) [3H]phenylalanyl-tRNATM and (A) [3H]phenylalanyl-tRNA~. Incubation at 37", 12 mM MgCI2.
As shown in Fig. 11, ribosomes without poly(U) do not use the phenylalanyl residue for polymerization if it is coupled to tRNA phi. Figure 12 represents the Mg2+-dependence of poly[3H]phenylalanine synthesis from [3H]phenylalanyl-tRNAL~. It is seen that polypcptidc synthesis has a Mg 2+ optimum near I 1 m M which is characteristic of the polylysine synthesis from lysyl-tRNA L~ (cf. Fig. 12 and Fig. 6). Discussion Experiments on ribosomal synthesis of polypeptides in the absence of template polynucleotides lead to the conclusion that ribosomes can elongate polypeptide using certain aminoacyl-tRNAs (such as lysyl-tRNA) as substratcs. This means that (1) these aminoacyl-tRNAs, with the participation of EF-Tu and GTP, can occupy the ribosomal A-site correctly in the absence ofcodon-anticodon interactions, and (2) the newly formed peptidyl-tRNA can be subjected to EF-G-GTP-catalyzed translocation without template. The latter indicates that the driving act of the transloeation process is the shift of the tRNA molecule, while the template seems to be driven through the codon-anticodon interaction.
648
RIBOSOME FUNCTION AND KINETICS
[43]
1.5
-° E
1.0
E o
0.5 13.. "-r -EF-G •
•
•
I
1
5
I0
•
•
I
15
•
±
I
20
[M~+], mM
Fro. 12. Dependence of poly[3H]phenylalanine synthesis of Mg2+ concentration using [3H]phenylalanyl-tRNALy' in the template-free ribosomal system. (@) Complete: +EF-Tu, +EF-G, +GTP; (A) +EF-Tu, -EF-G, +GTP. Incubation at 37* for 30 rain.
However, not all the aminoacyl-tRNAs can serve as substrates for ribosomal template-free polypeptide synthesis. For example, phenylalanyltRNA ~ is incapable of incorporating its amino acid residue into polypeptide without a template. In this case c o d o n - anticodon interaction seems to be an obligatory prerequisite for peptide synthesis. The results of experiments with misacylated tRNA TM (phenylalanyltRNA TM) have shown that it is not the nature of the aminoacyl residues, but the structure of the tRNA itself that determines whether an aminoacyl-tRNA can serve as a substrate in ribosomal polypeptide elongation in the absence of polynucleotide template. The structures of some tRNAs do not permit this. The crystallographic structures of two elongator tRNAs, yeast tRNA ~ and yeast tRNA '~, are known. 21,22The difference between them is that the angle between the two limbs of the L-shaped molecule in tRNA ~ ° is 10 ° 21 j. L. Sussman, S. R. Holbrook, R. W. Warrant, G. M. Church, and S. H. Kim, J. Mol. Biol. 123, 607 (1978). 22D. Moras, M. B. Comarmond, J. Fischer, R. Weiss, and J. C. Thierry, Nature (London)
288, 669 (1980).
[43]
TEMPLATE-FREE SYNTHESIS OF POLYPEPTIDES
649
wider than that in tRNAW; correspondingly, the distance between the anticodon and the acceptor end in the first is 5 A greater than in the second. Stereochemical analysis shows that, if two tRNA molecules interact with two adjacent codons of the template polynucleotide (as in the case of the donor peptidyl-tRNA and the acceptor aminoacyl-tRNA on the ribosome), the distance between the anticodon and the acceptor end of the aminoacyl-tRNA must be 5 A greater than that in the peptidyl-tRNA to allow approach of the attacking NH2 group to the attacked ester g r o u p . 23'24 Hence, it can be inferred that the crystal structure of tRNA ~ ' reflects the structure of tRNA in the A-site, whereas the crystal structure of tRNA l~¢ corresponds to that of tRNA in the P-site of the ribosome. Indeed, recently it has been shown experimentally that tRNAs in the A- and P-sites have different conformations. 25 Proceeding from the above, the following hypothetical explanation is proposed as to why some aminoacyl-tRNAs can serve as substrates for ribosomal synthesis of peptides in the absence of codon-anticodon interaction whereas others cannot do so. A fraction of such tRNAs as tRNA L~, tRNAS% tRNA TM, and tRNA A~v, both in the free state and when complexed with EF-Tu, exists in an "open" structure (of the yeast crystalline tRNA A~ptype) which is ready for fitting into the A-site of the ribosome. Other tRNAs, e.g., tRNA °y, tRNA n~, tRNA M~t,tRNA A~, and tRNA l~e, in the free state have a structure suitable for the P-site (of the type of yeast tRNA r~e and initiator tRNAM~t), and its transformation into a more "open" state necessary for a correct fitting in the A-site is achieved only as a result of the codon-anticodon interaction.
23 V. I. Lim, A. V. Kayava, and A. S. Spirin, Dokl. Akad. NaukS.S.S.R. 282, 1502 (1985). 24 A. S. Spirin and V. I. Lim, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty and F. Kramer, eds.). Spdnger-Vedag, New York, 1986. 25 T. Jorgensen, G. E. Siboska, F. P. Wikman, and B. F. C. Clark, Fur. J. Biochem. 153, 203 (1985).
650
RIBOSOME FUNCTION AND KINETICS
[44]
[44] M g 2 + / N H 4 + / P o l y a m i n e S y s t e m f o r P o l y u r i d i n e D e p e n d e n t P o l y p h e n y l a l a n i n e S y n t h e s i s w i t h N e a r in Vivo Characteristics By ANDREAS BARTETZKO and KNUD H. NIERHAUS
The polymix systemt-3 represents a poly(U)-dependent poly(Phe) synthesis where protein synthesis with Escherichia coli ribosomes approaches in vivo levels concerning rate and accuracy. The system has been successfully applied to both the determination of some parameters of the ribosomal fidelity and the analyses of mutants with an altered ribosomal accuracy. 4 However, the system has some limitations. Its complex composition and subtle ionic milieu can easily lead to precipitation of, e.g., Mg(NH4)PO4 which inactivates ribosomes and enzymes. Furthermore, usually 5 to 15% but not more than 25% of the ribosomes participate in poly(Phe) synthesis in the polymix system. The fact that the system is not compatible to standard conditions of tRNA binding with respect to the ionic milieu is of particular importance for us. The tRNA-binding sites of the ribosome can be saturated at Mg2+ concentrations of at least 12 to 15 m M using simple Mg2+/NH4+ systems, and it would be of interest to study ribosomes quantitatively occupied with tRNA under conditions where ribosomes synthesize proteins as etficiently as in the cell. Therefore, we developed and introduce here a simple Mg2+/NH4+/ polyamine system which is comparable to the polymix system with respect to accuracy and rate of protein synthesis and exceeds it in the following points: (1) 25 to 50% of the ribosomes participate in protein synthesis; (2) poly(Phe) synthesis is linear for more than 60 see (10 to 15 see in the polymix system); (3) poly(Phe) is synthesized with the same performance regardless of whether purified isolates or unfractionated preparations (S-100 as source for enzymes and factors, bulk tRNA) are used. M g 2+ Dependence of Extent and Rate of Poly(Phe) Synthesis
A two-step procedure was performed. In the first binding step poly(U)programmed ribosomes were mixed with equimolar amounts of t p. C. Jelenc and C. G. Kurland, Proc. Natl. Acad. Sci. U.S.A. 76, 3174 (1979). 2 E. G. H. Wagner, P. C. Jelene, M. Ehrenberg, and C. G. Kurland, Eur. J. Biochem. 122, 193 (1982). 3 M. Ehrenberg, C. G. Kurland, and T. Ruusala, Biochimie 68, 261 (1986). 4 M. Ehrenberg and C. G. Kurland, Q. Rev. Biophys. 17, 45 (1984). METHODS IN ENZYMOLOGY, VOL. 164
Copyright© 1988by AcademicPress,inc. All rightsof reproduction in any form i~erved.
[44]
POcY(Phe)SYNTHESIS
WITH NEAR ill Vivo FEATURES
651
Ac[3H]Phe-tRNA at various Mg 2+ concentrations between 3 and 25 mM (150 m M NH4CI, no polyamines). After an incubation for 30 rain at 37", an aliquot was withdrawn and the Ac[aH]Phe-tRNA binding determined (Fig. 1A, solid line). Maximal binding was observed between 18 and 20 mM. In the second step the remaining sample of poly(U) programmed
A o l~foresynthesis
0.51 Ck¢,~
"c~.~
.c{ c~
I
_ _
0flers)~nthesis .4~..~_.° I
.__.L~
30
B
I c Br'u,.J
¢._ __
I
10
. . . . . . . . . . . . .
20 mM Mgz°
I
30
F]o. 1. Mg2+ dependence of poly(U)-dependent Ac[3H]Phe-tRNA binding and poly(Phe) synthesis. For tRNA binding 1! pmol 70S ribosomes was incubated (30 min/37 °) with 11 pmol Ac[3H]Phe-tRNA (2430 ~ m per pmol) and 400#g poly(U) in 100/d containing 10 mM HEPES, pH 7.5, 150 mM NI~CI, 4 mM 2-mercaptoethanol, and the indicated ]VI~2+ concentration. For poly(Phe) synthesis, I00/~1 of a mix (preincubated 5 min at 37 °) was added containing the same ionic concentrations and 25 nmol [t4C]Phe (8 cpm per pmol), 120 pmol tRNA TM, optimal amounts of S150 enzymes (270/tg), 2 mM ATP, 0.2 mM GTP, 10 mM PEP, and 3/tg pyruvate kinase. Incubation for poly(Phe) synthesis was performed at 37 ° for 1 rain. The binding of Ac[~H]Phe residues (A) was determined after the binding (O) and the synthesis incubation ([3), the extent of [ " ~ P h e incorporation is shown in (B), and the rate of [m4C]Phe incorporation/sec per active ribosome in (C).
652
RIBOSOME FUNCTION AND KINETICS
[44]
ribosomes received a "charging" mix which had been preincubated at 37 ° for 5 min in order to "charge" tRNA and contained the corresponding Mg2+ concentration and the components necessary for poly ([~4C]Phe) synthesis (for composition of the charging mix, see assay description below). An incubation (37 °/1 rain) followed and the still bound Ac[3H]Phe residues (broken line in Fig. 1A) and the extent of [14C]Phe-incorporation (Fig. 1B) were measured. During poly(Phe) synthesis, some ribosomes lose the Ac[3H]Phe residues at Mg2+ concentrations above 13 m M and below 9 m M (Fig. IA, broken line). This is due to a partial loss of AcPhe2-tRNA from the ribosome (H.-J. Rheinberger and K. H. Nierhaus, unpublished observations). Ribosomes carrying a Phe-tRNA instead of an AcPhe-tRNA are significantly slower during the early poly(Phe) synthesis.2 The extent of poly(Phe) synthesis shows a clear peak around 9 m M (Fig. 1B) in agreement with the observations of many laboratories. The peak coincides with the somewhat broader peak of Ac[3H]Phe residues present on the ribosomes during synthesis. Since poly(Phe) synthesis was measured for only 1 min and since ribosomes primed with AcPhe-tRNA synthesize poly(Phe) by at least an order of magnitude quicker than nonprimed ribosomes, the number of Ac[aH]Phe residues bound during poly(Phe) synthesis reflects the active fraction of ribosomes engaged in poly(Phe) synthesis. With both parameters, namely active fraction and extent of poly(Phe) synthesis, we can calculate the rate of poly(Phe) synthesis of an active ribosome (Fig. 1C). Surprisingly, the rate of an active ribosome increases monotonically with decreasing Mg2+ concentrations and has not yet reached its maximum at 5 m M Mg2+. The rate at 3 m M Mg2+ could not be calculated since the amount of Ac[aH]Phe-tRNA bound during poly(Phe) synthesis at this Mg 2+ concentration was negligibly small. It appears that binding of AcPhe-tRNA, extent of poly(Phe) synthesis, and synthesis rate of an active ribosome depend differently on the Mg2+ concentration under the applied conditions: The Mg2+ optimum for AcPhe-tRNA binding is -> 15 mM, that for the extent of poly(Phe) synthesis around 9 mM, and that for the rate of poly(Phe) synthesis below 5 raM. In order to determine the optimal Mg2+ concentration for the rate of poly(Phe) synthesis, we tried to reduce the loss of Ac[3H]Phe residues during poly(Phe) synthesis. A systematic analysis revealed that this could be achieved by (1) the introduction of polyamines (0.6 m M spermine and 0.4 m M spermidine), and (2) a modification of the binding procedure: 70S ribosomes, poly(U), and AcPhe-tRNA are incubated in the presence of 6 m M M g 2+ and polyamines for l0 min at 37", then the mixture is diluted
[44]
POLY(Phe) SYNTHESISWITH NEAR in Vivo FEATURES
653
twofold with a buffer containing the same ion concentrations, and a second incubation followed (30 min at 37 °) before the mix for the poly(Phe) synthesis was added. With this mix the final Mg 2+ concentration for poly(Phe) synthesis was adjusted, the other ion concentrations were not changed. Control experiments revealed that the ligase reaction producing Phe-tRNA was not significantly affected by a change of the Mg 2+ concentration in the range of 1 to 10 mM. Figure 2 demonstrates that with the above-mentioned alterations a significant binding of Ac[3H]Phe residues (0.2 to 0.35 per ribosome, dashed line) was indeed found in the range of 2.25 to 6 m M M g 2+. Furthermore, the optimal Mg 2÷ concentration for the rate of [~4C]Phe incorporation is found between 3 and 3.75 mM. A further analysis revealed no significant difference between 3 and 3.5 raM; therefore the Mg 2+ concentration was adjusted to 3 m M for optimal poly(Phe) synthesis. For the final system, to be described in the next section, each of the components was optimized, and concentrations or amounts were chosen to yield maximal rates of Phe incorporation. After optimization, the poly(U)-dependent misincorporation of Leu was determined and an error (misincorporated Leu divided by total amino acid incorporated) was found in the range of the known in vivo values.
I g ------I]
~02 ~
oJ.~ 2
I
2
I__
I
4 mM Mg 2+
I
I
6
FIG. 2. Mg2+ dependence of the number of bound Ac[aH]Phe residues after poly(Phe) synthesis and of the rate of [14C]Phe incorporation per active 70S ribosome. In the binding reaction one aliquot contained 5 pmol 70S, 8 pmol Ac[3H]pbe-tRNA, and 100/zg poly(U) in the presence of 6 mM Mg2+, 0.6 mM spermine, and 0.4 mM spermidine. The binding of Ac[3H]Phe-tRNA amounted to 0.60 molecules per ribosome. The addition of the poly(Phe) mix adjusted the Mg2+concentrations to the indicated values. The rate of [~4C]Pheincorporation (solid line) was determined from kinetics performed for up to 60 sec. The number of bound Ac[3H]pbe residues represents the values found after a 60-see synthesis. For further details, see the procedure described in the section "A Mg2+/NH4÷/Polyamine System for Highest Rate and Accuracy of Poly(Pbe) Synthesis."
654
RIBOSOME FUNCTION AND KINETICS
[44]
A Mg2+/NH4+/Polyamine System for Highest Rate and Accuracy of Poly(Phe) Synthesis Materials
For the binding reaction Mix 1:30 m M HEPES-KOH, pH 7.5, 10 m M magnesium acetate, 700 m M NH4CI, 14 m M 2-mercaptoethanol, 3 m M spermine, 2 m M spermidine Mix 2:12.5 m M H E P E S - K O H , pH 7.5, 7.5 mMmagnesium acetate, 188 m M NH4C1, 5 m M 2-mercaptoethanol, 0.75 m M spermine, 0.5 m M spermidine HIoMloN3oS4 buffer: 10 m M HEPES-KOH, pH 7.5, 10 m M magnesium acetate, 30 m M NH4C1, 4 r a M 2-mercaptoethanol Poly(U) solution: 20 mg/ml in H20; stored at - 2 0 * in 1-ml portions AcPhe-tRNA solution: about 50 pmol/pl H20; either nonlabeled ([3H]Leu misincorporation) or as Ac[aH]Phe-tRNA with about 2000 cpm/pmol (active fraction). The preparation was made following the method of Rheinberger and Nierhaus 5 70S ribosomes: tightly coupled ribosomes in HloMtoN3oS4 (500 to 700 A26oper ml) isolated as described5 For the poly(Phe) synthesis Energy mix: 40 m M H E P E S - K O H , pH 7.5,750 mMNH4C1, 16 m M 2-mercaptoethanol, 3 m M spermine, 2 m M spermidine, l0 m M ATP, 1 m M GTP, 50 m M phosphoenolpyruvate, adjusted with KOH to pH 7.5 and stored in l-ml portions at - 2 0 * [14C]Phe solution: 5000 pmol/pl H20 with about 10 cpm/pmol, stored in 250-pl portions at - 2 0 ° [3H]Leu solution: 170 pmol/pl H20 with about 2000 cpm/pmol, stored in 250-/11 portions at - 2 0 * tRNA b~ solution: total tRNA from E. coli (Boehringer-Mannheim, Cat. No. 109550), 25 pg/pl H20, stored in 250-pl portions at --20* Pyruvate kinase: l ltg/pl H20, stored in 100-pl portions at - 2 0 °; thaw only once S150 enzymes: in 10 m M H E P E S - K O H , pH 7.5, 10 mMmagnesium acetate, 4 m M 2-mercaptoethanol, prepared as described6 TCA solution: 5% trichloroacetic acid (w/v) containing 0.5% (w/v) of both phenylalanine and leucine s H. J. Rheinbergerand IC H. Nierhaus,J. Biol. Chem. 261, 9133(1986). K. H. Nierhausand F. Dohme,this series,Vol. 59, p. 443.
[44]
POLV(Phe)SYNTHESISWITHNEAR in Vivo FEATURES
655
95% ethanol Glass filters No. 6 (Schleicher-SchiiU, Dassel, Germany; cat. no. 370021 ) Soluene 350 (Packard) Ready Solv NA (Beckman) Procedure
An outline of the precedure for the determination of rate and accuracy of poly(Phe) synthesis is shown in Fig. 3. The rate of [~4C]Phe incorporation is derived from kinetics performed from 10 to 60 sec, the accuracy from the total incorporation of [~4C]Phe and [3H]Leu after 5 min. Initiation poly(U),
step
C h a r g i n g of t R N A s
70S,
nonlabeled
S150 e n z y m e s , b u l k t R N A E . c o l i [14C]Phe (10 c p m / p m o l e )
AcPhe-tRNA
250(I00)~i/I0 500(200)~i/25
m i n / 3 7 ° / 6 m M M g 2+
[3H]Leu
;
1425(525)~i/2
(2000 c p m / p m o l e ) m i n / 3 7 ° / 2 m M Mg 2+
m i n / 3 7 ° / 6 mM_ M g 2÷
l 475
(175)
~i
t = 0
kinetics
at 37°/3 m M Mg 2+
t = 10/20/30/40/50/60
sec a n d
3 x 5 min
(3 x 5 min)
200 ~i e a c h
+ 3 ml T e A s o l u t i o n 15 min
/ 100 °
glass filter
washing:
9 x 6 ml of T C A s o l u t i o n 3 x 2 ml of 95% e t h a n o l
60 m i n at 90 °
+ scintillation
c o c k t a i l :count
FIO. 3. Outline of the procedure for the determination of rate and accuracy ofpoly(Phe) synthesis (the values in parentheses are for the minus-poly(U) control).
656
RIBOSOME FUNCTION AND KINETICS
[44]
Binding. A mixture for 10 aliquots was prepared. Two hundred and fifty microliters containing 50/~1 mix 1, 100 #1 H20 with 70 pmol nonlabeled AcPhe-tRNA and 1 mg poly(U), and 100/11 HIoMIoN3oS4 with 50 pmol 70S ribosomes was incubated for 10 min at 37 °. The ion concentrations were 10 m M HEPES-KOH, pH 7.5, 6 m M magnesium acetate, 150 m M NH4C1, 0.6 m M spermine, 0.4 m M spermidine, and 4 m M 2mercaptoethanol. Then the volume was increased twofold keeping the ion concentrations constant by adding 200/11 mix 2 and 50 #1 H20. A second incubation for 25 min at 37 ° followed. Poly(Phe) Synthesis. Nine and a half aliquots (9.5 × 50/tl -- 475/~1, 37 °) of the binding mixture were transferred to 1425 #1 (= 9.5 × 150/~1) of a charging mix which was composed of 285/~1 energy mix, 855 ~tl H20 containing 240 nmol [14C]Phe (about 10 cpm per pmol), 100 nmol [3H]Leu (about 2000 cpm per pmol), 20 A260 units tRNA bark from E. coli and 30#g pyruvate kinase, and 285 #1 S150 enzymes. The charging mix contained the same ion concentrations as the binding mixture except that the Mg 2+ concentration was 2 raM. The mix was prewarmed for 2 min at 37 ° before it received the 475/~1 of the binding mixture. The combination of both mixtures adjusted the Mg 2+ concentration to 3 m M and started the poly(Phe) synthesis. Aliquots of 200/tl were withdrawn at 10-sec intervals from 10 to 60 sec, the last three aliquots (triple determination) were taken after 5 min. The reaction was stopped by mixing each aliquot with 3 ml of the TCA solution. The remainder of the procedure followed Jelenc and Kurland.~ The sample was incubated for 15 min at 100 ° and the resulting precipitates collected on a glass filter. Filters were washed nine times with 6 ml of the TCA solution, three times with 2 ml of 95% ethanol, and dried (60 min at 90°). Filters were counted after addition of 0.5 ml Soluene 350 and 7 ml Ready Solv. Three minus-poly(U) controls were processed in the same way. In this case 175/zl (3.5 aliquots) binding mixture was transferred to 525 #1 charging mix, and three aliquots of 200/tl were taken after 5 min. If the active fraction of ribosomes and the rate of Phe incorporation per active ribosome are to be determined, nonlabeled AcPhe-tRNA is replaced by Ac[3H]Phe-tRNA in the binding mixture, [3H]Leu by nonlabeled Leu in the charging mix, and the binding incubations and kinetics performed as described above. An example of a poly(Phe) synthesis in this system is shown in Fig. 4. Phe incorporation is linear for 60 see; after 60 sec each ribosome had statistically incorporated 58 Phe residues. The active fraction of ribosomes ranged from 0.27 to 0.37, resulting in an incorporation rate of at least four Phe/sec per active ribosome within the first 10 see, thereafter in a constant rate of 2.2 Phe/sec per active ribosome. In a parallel experiment the
[44]
POLY(Phe) SYNTHESIS WITH NEAR in Vivo FEATURES
657
150 I0C / .
rt
~,0.2 ~_ ~ 1 V
I
20
I
40
I
60
time Isec )
FIG. 4. Kinetics of poly(Phe) synthesis in the Mg2+/NH4+polyamine system. (13) Ac[3H]Phe residues per ribosome found in the TCA precipitable material; these values are a measure for the corresponding active fractions. (O) [t4C]Phe incorporation per 70S ribosome; (0) [l~C]Phe incorporation per active 70S ribosome.
accuracy (misincorporation of [3H]Leu) was determined to be (3.4 + 1) × 10-'4, the active fraction from 0.2 to 0.5, and the rate of Phe incorporation per active ribosome from 2 to 5 Phe/sec. Comparison with the polymix system according to Ruusala and Kurland 7 showed equivalent values for rate and accuracy, the Phe incorporation in the polymix system was linear with time only for 10 to 15 sec, and the active fraction ranged from 0.05 to 0.15.
Concluding R e m a r k s A poly(U)-dependent poly(Phe) synthesis of simple composition is introduced which synthesizes poly(Phe) with a rate and accuracy near to the corresponding in vivo values. Up to 50% of the ribosomes participate in 7 T. Ruusala and C. G. Kurland, Mol. Gen. Genet. 198, 100 (1984).
658
RIBOSOME FUNCTION AND KINETICS
[45]
protein synthesis, which is linear with time for at least 60 sec. The assay is performed in two steps. In the first step AcPhe-tRNA is bound to ribosomes at 6 m M Mg 2+, taking into account that tRNA binding requires higher Mg 2+ concentrations than optimal poly(Phe) synthesis. The two incubations at 6 m M Mg 2+ during the first step improve AcPhe-tRNA binding for unknown reasons. For poly(Phe) synthesis the Mg 2+ concentration is decreased to 3 mM, which is required for an optimal rate of Phe incorporation under the applied conditions. It is important to use HEPES buffer instead of Tris, since HEPES has its maximal buffer capacity at pH 7.55 (Tris at pH 8.3) and hence shows fewer changes during temperature shifts. For example, a 10 m M HEPES (Tris) solution adjusted to pH 7.5 at roomtemperature (21 °) measures at 37 ° 7.3 (Tris, 7.1) and at 0 ° 7.7 (Tris, 8.1). In this system the accuracy is impaired at a pH above 7.8 and below 7.3.
[ 4 5 ] P a r a m e t e r s f o r t h e P r e p a r a t i o n o f Escherichia coli Ribosomes and Ribosomal Subunits Active in tRNA Binding
By HANS-JORG RHEINBERGER, UTE
GEIGENMOLLER, MARKUS WEDDE,
and KNUD H. NIERHAUS Highly active ribosomes are a prerequisite in order to characterize quantitatively the interactions between transfer RNA, messenger RNA, and ribosomal particles. Preparation procedures as well as the binding capacities of ribosomal particles for all three kinds oftRNA involved in the elongation cyde--peptidyl-tRNA, aminoacyl-tRNA, and deacylated t R N A m h a v e remained a matter of controversy until recently) -5 Much of the controversy is not only due to the fact that there are considerable differences in the ribosomal saturation levels for tRNA binding, but that, in addition, a correct interpretation of the results relies on an unequivocal site determination test. Further difficulties in evaluating ribosomal activity are based on the fact that: (1) There may be functional heterogeneity 1H. J. Rheinberger, H. Sternbach, and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 78, 5310(1981). 2 M. Schmitt, A. M6Uer, D. Riesner, and H. G. Gassen, Fur. J. Biochem. 119, 61 (1981). 3 R. A. Grajevskaja, Y. V. Ivanov, and E. M. Saminsky, Eur. J. Biochem. 128, 47 (1982). 4 S. V. Kirillov and Y. P. Semenkov, FEBSLett. 148, 235 (1982). s R. Lill, J. M. Robertson, and W. Wintermeyer, Biochemistry 23, 6710 (1984). METHODS IN ENZYMOLOGY, V OL. 164
Copyright © 1988 by Academic Press, Inc. All fights of reproduction in any form reserved.
658
RIBOSOME FUNCTION AND KINETICS
[45]
protein synthesis, which is linear with time for at least 60 sec. The assay is performed in two steps. In the first step AcPhe-tRNA is bound to ribosomes at 6 m M Mg 2+, taking into account that tRNA binding requires higher Mg 2+ concentrations than optimal poly(Phe) synthesis. The two incubations at 6 m M Mg 2+ during the first step improve AcPhe-tRNA binding for unknown reasons. For poly(Phe) synthesis the Mg 2+ concentration is decreased to 3 mM, which is required for an optimal rate of Phe incorporation under the applied conditions. It is important to use HEPES buffer instead of Tris, since HEPES has its maximal buffer capacity at pH 7.55 (Tris at pH 8.3) and hence shows fewer changes during temperature shifts. For example, a 10 m M HEPES (Tris) solution adjusted to pH 7.5 at roomtemperature (21 °) measures at 37 ° 7.3 (Tris, 7.1) and at 0 ° 7.7 (Tris, 8.1). In this system the accuracy is impaired at a pH above 7.8 and below 7.3.
[ 4 5 ] P a r a m e t e r s f o r t h e P r e p a r a t i o n o f Escherichia coli Ribosomes and Ribosomal Subunits Active in tRNA Binding
By HANS-JORG RHEINBERGER, UTE
GEIGENMOLLER, MARKUS WEDDE,
and KNUD H. NIERHAUS Highly active ribosomes are a prerequisite in order to characterize quantitatively the interactions between transfer RNA, messenger RNA, and ribosomal particles. Preparation procedures as well as the binding capacities of ribosomal particles for all three kinds oftRNA involved in the elongation cyde--peptidyl-tRNA, aminoacyl-tRNA, and deacylated t R N A m h a v e remained a matter of controversy until recently) -5 Much of the controversy is not only due to the fact that there are considerable differences in the ribosomal saturation levels for tRNA binding, but that, in addition, a correct interpretation of the results relies on an unequivocal site determination test. Further difficulties in evaluating ribosomal activity are based on the fact that: (1) There may be functional heterogeneity 1H. J. Rheinberger, H. Sternbach, and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 78, 5310(1981). 2 M. Schmitt, A. M6Uer, D. Riesner, and H. G. Gassen, Fur. J. Biochem. 119, 61 (1981). 3 R. A. Grajevskaja, Y. V. Ivanov, and E. M. Saminsky, Eur. J. Biochem. 128, 47 (1982). 4 S. V. Kirillov and Y. P. Semenkov, FEBSLett. 148, 235 (1982). s R. Lill, J. M. Robertson, and W. Wintermeyer, Biochemistry 23, 6710 (1984). METHODS IN ENZYMOLOGY, V OL. 164
Copyright © 1988 by Academic Press, Inc. All fights of reproduction in any form reserved.
[45]
PREPARATION OF ACTIVE E. coli RIBOSOMES
659
within a ribosomal population carrying a tRNA in a distinct site. Such heterogeneity would not be reflected in the mere binding numbers. (2) tRNA-binding capacity and overall elongation activity need not necessarily coincide. In this chapter, first we report in detail a preparation procedure for tightly coupled 70S ribosomes of Escherichia coli, as well as for 30S and 50S subunits derived from tight couples. The preparation procedure has been developed by modifying a protocol of Hapke and Noll 6 and it reproducibly yields a high level of active ribosomes. Second, an in vitro system is described which allows the site-specific ribosomal tRNA-binding activity to be tested.
Preparation of Ribosomes Materials In order to minimize damage by RNases, strain DI0 derived from E. coli K12 is used, which is deficient in RNase 1.7 Bacto-Tryptone and yeast extract: Oxoid (Hamburg, FRG) Alcoa A-305: Serva (Heidelberg, FRG) Sucrose (ultrapure): BRL (Cambridge, UK) All other chemicals mentioned are from Merck (Darmstadt, FRG) and Boehringer (Mannheim, FRG) Buffers TIoM6N3oSI-I4:10 m M Tris-HCl, pH 7.5 (4*), 6 m M MgCl2, 30 m M NH4C1, and 4 m M 2-mercaptoethanol T~oMIoN3oSH4: same as TIoM~N3oSI-I4except that the M g 2+ c o n c e n t r a t i o n is l0 m M TIoM3NI0oSH4:l0 mMTris-HCl, pH 7.5 (4*), 3 mMMgC12, 100 m M NH4C1, and 4 m M 2-mercaptoethanol TloMloNtooSI-L,:same as TloM3NiooSH 4 except that the M g 2+ c o n c e n t r a t i o n is 10 m M Growth of Bacteria Cells are grown in a 100-liter fermenter inoculated with 2.5 liters of an overnight culture of E. coli D 10. The growth medium contains 1 kg Bacto6 B. Hapke and H. Noll, J. Mol. BioL 105, 97 (1976). 7 R. F. Gesteland, J. Mol. Biol. 16, 67 (1966).
660
RIBOSOME FUNCTION AND KINETICS
[45]
tryptone, 0.5 kg NaCI, 0.5 kg yeast extract, and 1 liter of a 20% (w/v) glucose solution per 100 liters. Fermentation is performed under continuous aeration at 37 °. Cell growth is stopped at 0.5 A65o units/ml, making sure that mid-log phase had not been passed. The activity of ribosomes depends considerably on the time at which cells are harvested. Early mid-log phase ribosomes have proved to be optimal in tRNA binding and elongation. After centrifugation for 15 min at 20,000 rpm, wet cells (usually 100- 150 g per 100 liters) are shock-frozen and stored at - 8 0 °.
Isolation of Tight Couples Three hundred grams of frozen cells are thawed in 600 ml of TIoM6N30SH4 buffer. After resuspending, cells are centrifuged for 10 min at 10,000 rpm in a Sorvall GSA rotor, mixed with Alcoa A-305 (twofold cell weight), and ground in a Retsch mill for 25 min. The cell paste is homogenized with T10MrN3oSH4 buffer (100 ml per 100g cells) for 15 min. The homogenized cell paste is subjected to two low-speed centrifugations (10 min at 10,000 rpm in a Sorvall GSA rotor to remove Alcoa and 45 min at 15,000 rpm in a Sorvall SS34 rotor to remove cell debris). The resulting supernatant is centrifuged for 18 hr at 20,000 rpm in a 45 Ti rotor. Ribosomal pellets are rinsed with TtoM6N3oSH4 buffer and then resuspended in the same buffer with continuous gentle stirring for about 2 hr. The resuspended crude ribosomes are clarified (5 min at 5,000 rpm) and their concentration is determined. Usually, the yield amounts to 30,000 A26o units per 100 g of cells (concentration range 400 to 700 A26o units/ml). The whole procedure is performed on ice and/or at 4 °, and sterilized glassware and tubes are used. If possible, crude ribosomes are immediately subjected to a zonal centrifugation in a gradient of 0 to 40% sucrose in T~oM6N3oSH4 buffer for 18 hr at 21,000 rpm (about 7000 A26o units per run, Fig. IA). In the first zonal centrifugation, 70S tightly coupled monosomes are separated from 30S and 50S subunits and (usually small amounts of) polyribosomes. 70S peaks are pooled and ribosomes pelleted out of the sucrose solution in a 45 Ti rotor for 24 hr at 22,000 to 24,000 rpm. The use of higher centrifugation speeds is not recommended in order to avoid pressure-induced dissociation of the ribosomes. Ribosomal pellets are resuspended in T~oM6N3oSH4 (1 ml per tube) by gentle shaking for about 30 to 60 min, and then the resuspended particles are clarified by a low-speed centrifugation, and their concentration measured at A26o. Resuspended ribosomes are (again, if possible, without prior freezing and storing) subjected to a second zonal run under the conditions of the first run, except that the centrifugation speed is now 18,000 rpm (Fig. 1B). The 70S peak is separated from 50S
PREPARATION OF ACTIVE E. coli RIBOSOMES
[45]
661
70S A 50S
70S 70S
g
30S
5os
direction 0f seflimentoti0n
P
FIG. 1. Sucrose gradient profiles of tightly coupled ribosomes. A, First zonal run of crude tightly coupled 70S. The shaded area indicates the pooled 70S fractions subjected to a second zonal run (B). C, Control run of isolated tightly coupled 70S ribosomes in an SW 40 rotor.
contamination and the pooled material pelleted as described. The pellets are resuspended in TIoMIoN3oSH4, which is the storage buffer for tightly coupled ribosomes. The particles are clarified and their concentration adjusted to 500-700 A26o units/ml. Small aliquots of 200/zl each are shockfrozen in liquid nitrogen and stored at - 8 0 " . Routinely, the quality of the preparation is checked by three tests. (1) An SW 40 run was performed (gradient of 10 to 30% sucrose in TtoMIoN3oSH4, 18 hr at 18,000 rpm and 4 °) in order to test the intactness of the tight couples. They contain barely detectable amounts of 30S and less than 5% 50S (Fig. 1C). (2) RNA gels were run in order to test the intactness of the ribosomal RNA. 16S and 23S RNA have to be free from breaks. (3) A poly(U)-dependent poly(Phe) synthesis assay was performed under standard conditions, s There are some critical points which have to be carefully observed during preparation: 1. Cells should not be harvested as late as possible, in order to maximize the amount of ribosomes. Concerning the activity of ribosomes the optimal harvesting point is early mid-log phase. s K. H. Nierhaus, K. Bordasch, and H. E. Homann, J. Mol. Biol. 74, 587 (1973).
662
RIBOSOME F U N C T I O N A N D KINETICS
[45]
2. Any RNase contamination has to be strictly avoided (e.g., it is not recommended to add DNase before or during the grinding procedure, because trace amounts of RNase can spoil the preparation). 3. All work should be done preferentially on ice, but by no means at temperatures higher than 4 °. 4. Ribosomes should be passed through the two zonal cycles as fast as possible (optimally without freezing between the zonal runs). 5. Ribosomes must not be salt washed (e.g., with 500 m M or higher concentrations of NH4C1), since the salt washing procedure removes ribosomal proteins and generates functional heterogeneity. 6. TloM6N3oSH4 buffer should be used during the 70S isolation procedure, since 30 m M NH4C1 is the optimal monovalent ion concentration for both the stability of tightly coupled ribosomes and the association of the subunits in the presence of 6 to 10 m M Mg2+.
Isolation of 30S and 50S Subunits The most active ribosomal subunits are obtained from tight couple preparations. For subunit isolation, the pellets after the first zonal run containing the 70S peak material are resuspended in the dissociation buffer TIoM3NIooSH4 and subjected to a second zonal run under the same ionic conditions. The separated subunits are pelleted for 24 hr at 24,000 rpm in a 45 Ti rotor, resuspended in TIoMIoN~0oSH4,clarified, and stored in small portions at - 8 0 °. In order to get optimal activity, it is essential to avoid precipitation of subunits either with polyethylene glycol or with ethanol. The former spoils some ribosomal activities (e.g., EF-G-dependent GTPase activity), the latter removes some ribosomal proteins and alters the ribosomal conformation drastically.
Preparation and Purification of Ac[14C]Phe-tRNA
Materials tRNA l~ from E. coli: Boehringer (Mannheim, FRG), Cat. No. 109681, Phe acceptance 1150 to 1600 pmol/A2~o unit [14C]Phe: Amersham (UK), Cat. No. CFB 70, specific activity > 450 mCi/mmol (> 16.6 GBq/mmol) ATP: Boehringer (Mannheim, FRG), 0.2 M, dissolved in H20 S 150: prepared and freed from endogenous RNA as described below Benzoylated DEAE cellulose: Boehringer (Mannheim, FRG)
[45]
PREPARATION OF ACTIVE g. COil RIBOSOMES
663
Buffer 1:50 m M sodium acetate, pH 5.0, 10 m M MgC12, 500 m M NaC1 Buffer 2 : 5 0 m M sodium acetate, pH 5.0, 10 m M MgCI2, 800 m M NaC1 Buffer 3:50 m M sodium acetate, pH 5.0, l0 m M MgC12, 2 M NaC1, 20O/o(v/v) ethanol
Procedure Fifty A26o units of tRNA ~ , dissolved in 500/tl H20, are mixed with 150/gCi [14C]Phe (= 300 nmol) in 3 ml H20 containing 2% ethanol, 375/d I M Tris-HCl (pH 7.5 at 4"), 750/tl 1 M KC1, 75/d 1 M magnesium acetate, 120/zl 0.2 MATP, and 30/~1 1.4 M 2-mercaptoethanol. The pH of the solution is adjusted at 7.5 using 1 M KOH, then 1-120 and optimized amounts (usually about 1 ml) of S150 enzymes (in 10 m M Tris-HCl, pH 7.5 at 4 °, 10 m M MgC12, 6 m M 2-mercaptoethanol) are pipetted into the reaction mixture to a final volume of 7.5 ml. After 15 min incubation at 37 °, the mixture is cooled on ice and made acidic with 375 gl of 20% sodium acetate, pH 5.5. Then 7.5 ml of phenol (25% v/v H20) is added and after vigorous shaking (10 min) and phase separation (10 min, 7,000 rpm, HB4 Sorvall rotor), the upper water phase is withdrawn and kept at 0 °. The phenol phase is washed with 7.5 ml 20% sodium acetate, pH 5.5, and 1 ml H20 as described above. Both water phases are combined and tRNA is precipitated by the addition of 2 volumes ethanol. After 3 hr at - 2 0 °, tRNA is pelleted (15 min, 7,000 rpm), dried in a lyophilizer, and resolved in 1 ml H20. Acetylation is essentially according to Haenni and Chapeville.9 Two hundred and eighty microliters of 1 M sodium acetate, pH 5.5, is added, followed by four 28-/zl aliquots of acetic acid anhydride every 15 min at 0 °. Then the tRNA is precipitated again with 2 volumes ethanol and kept at - 2 0 ° overnight. After centrifugation (15 min, 7,000 rpm) the pellet is washed once with ethanol, dried in a lyophilizer, and resuspended in 1 ml H20. Acetylation is 100% as judged by thin-layer chromatography. The charging degree is usually 70% (about 1100 pmol/A2~o unit). Ac[14C]Phe-tRNA is freed from deacylated tRNA by BD-ceUulose chromatography. A column (1 X 15 cm) of benzoylated DEAE-cellulose is equilibrated with buffer 1 (500 m M NaC1) until the absorbance of the eluate at 260 nm is below 0.03. Up to 100 A26ounits of charged tRNA are applied, the column is washed with 50 ml of the same buffer, then with 9 A.-L. Haenni and F. Chapeville, Biochim. Biophys, Acta 114, 135 (1966).
664
RIBOSOME FUNCTION AND KINETICS
[45]
150 ml of buffer 2 (800 m M NaCI) in order to remove deacylated tRNA. The charged tRNA is eluted with buffer 3 (2 M NaC1, 20% v/v ethanol) and appears in 4 - 5 fractions (fraction size 50 drops; elution rate 30 ml/hr). AcPhe-tRNA is precipitated with 2 volumes ethanol ( - 2 0 °, overnight), pelleted by low-speed centrifugation, washed twice with 70% ethanol and once with 100% ethanol, dried (1 min) in a lyophilizer, and resuspended in 1 ml H20. The concentration is adjusted to about 30 pmol/gl and the preparation stored in small portions at - 8 0 °. The preparations usually contain 1400 to 1500 pmol phenylalanine per A26ounit. Preparation of tRNA-Free S150 Enzymes
Materials DEAE-cellulose: DE-52, Whatman (Maidstone, Kent, UK) TloMtoKlw: 10 m M Tris-HC1, pH 7.5 (4°), 10 m M MgC12, 150 m.M KCI TloMloK2oo: 10 m M Tris-HCl, pH 7.5 (4°), 10 m M MgCI2, 200 m M KC1 TtoMloKsoo: 10 m M Tris-HCl, pH 7.5 (4°), 10 m_M MgC12, 500 m M KC1 TtoMioSH6:10 m M Tris-HC1, pH 7.5 (4°), 10 m M magnesium acetate, 6 m M 2-mercaptoethanol
Procedure Fifteen grams of DEAE-cellulose is dissolved in 300 ml T~oM~oK~ooand incubated for 30 rain at 90 °. After cooling down to 4 ° the matrix is washed 4 times with 300 ml T~oMloK~5o. After the last washing step, 150 ml of S 150 enzymes ~° is added to the cellulose and thoroughly mixed. The mixture is added to centrifuge tubes, kept for 2 hr at 4 ° and then centrifuged for 30 rain at 8000 rpm. Supernatant I is withdrawn and the procedure is repeated three times, adding 20 ml T~oM~oK~5o(supernatant II), T~oM~oK~o(supernatant III), and T~oM~oKsoo(supernatant IV), respectively. The supernatants are dialyzed overnight against T~oM~0SH6. The absorption is measured at 230, 260, and 280 nm and the supernatants are tested for their tRNA content in a ligase assay under the ionic conditions described for tRNA charging in the preceding section. Supernatants II and III are essentially free from tRNA and stored in small portions at - 8 0 °. 1oK. H. Nierhaus and F. Dohme, this series, Vol. 59, p. 443.
[45]
PREPARATION OF ACTIVE E. coli RIBOSOMES
665
Testing the Binding Activity of the Ribosome Preparations Materials
Mix 1:230 mM Tris-HCl, pH 7.5 (4"), 30 mM magnesium acetate, 740 mM NH4C1, and 14 mM 2-mercaptoethanol Mix 2:62 mM Tris-HCl, pH 7.5 (4°), 25 mM magnesium acetate, 200 mM NH4CI, and 6 mM 2-mercaptoethanol Mix 3:210 mM Tris-HC1, pH 7.5 (4°), 53 mM magnesium acetate, 720 m M NH4C1, and 21 mM 2-mercaptoethanol TsoMIsNI6oSH4 (binding buffer): 5 0 m M Tris-HC1, pH7.5 (4°), 15 mM magnesium acetate, 160 mM NH4C1, 4 mM 2-mercaptoethanol Poly(U): Boehringer (Mannheim, FRG); 3.75 mg/ml H 2 0 Energy mix: GTP (Boehringer, Mannheim, FRG), 2 rnM; phosphoenolpyruvate (Boehringer, Mannheim, FRG), 20 mM, solved in mix 3 and adjusted to pH 7.5 at 4 ° (1 volume), plus pyruvate kinase (Boehringer, Mannheim, FRG), 0.1 mg/ml H 2 0 (2 volumes) Puromycin: Serva (Heidelberg, FRG); 10mM, dissolved in T5oMIsMI6oSH4 (binding buffer), adjusted to pH 7.5 at 4 ° with unbuffered Tris tRNA p~ from E. coli: Boehringer (Mannheim, FRG); Phe acceptance 1150 to 1600 pmol/A26 o units, dissolved in H 2 0 tO a suitable concentration (usually 75 pmol//tl) Ac[~4C]Phe-tRNA: prepared as described above, charging degree 1400 to 1500 pmol [14C]Phe/A26o unit, dissolved in H 2 0 to a concentration of 30 to 60 pmol/gl Elongation factor G (EF-G): prepared according to Leberman et al., n stored in a buffer containing 10 mM Tris-HC1 pH 7.5 (4°), 10 mM magnesium acetate, 100 mM KC1, 10 mM 2-mercaptoethanol, and 20% v/v glycerol Sodium acetate, 0.3 M, pH 5.5/MgSO4 saturated Ethyl acetate Nitrocellulose filters: Sartorius No. 11 306 (G0ttingen, FRG) All buffers, poly(U), energy mix, tRNA ~e, EF-G are stored at --20 °, Ac[~4C]Phe-tRNA and ribosomes are stored at - 8 0 °. Puromycin was prepared immediately before use.
" R. Leberman, B. Antonsson, R. Giovanelli, R. Guafiguata, R. Schumann, and A. Wittinghofer, Anal. Biochem. 104, 29 (1980).
666
RIBOSOME FUNCTION AND KINETICS
[45]
Procedure We use an in vitro system based on Watanabe ~2which allows--in the absence of any factors--the binding of peptidyl-tRNA specifically either to the P site or the A site of programmed ribosomes. The test is performed in four steps. Step 1. In a normal assay comprising nine aliquots, 45/tl mix l, 45/zl poly(U), 45/zl H 2 0 , and 90/zl of TloMl0N3oSH4 buffer containing 90 to 450 pmol 70S ribosomes are preincubated for l0 min at 37*. The final ion concentrations at this step are 50 m M Tris-HC1, 10 m M Mg2+, 160 m M NH4+, and 4 m M 2-mercaptoethanol. If subsequent A-site binding of peptidyl-tRNA is to be achieved, deacylated tRNA w dissolved in H20 is added in addition in a molar ratio of 1.5 to 2.0 per 70S. Step 2. In the second step, 180/zl mix 2 is added. In order to test the binding capacity of the 70S particles, 45/zl H20 containing N-acetylated Phe-tRNA in increasing amounts is added either under P-site or A-site binding conditions. The final ion concentrations are the same as in step l, except that Mg2+ is raised to 15 raM. Samples are incubated for 30 min at 37 °. After incubation, two 50-/zl aliquots of the nine-aliquot sample are removed, diluted with 2 ml of ice-cold binding buffer (TsoM~sN~SI-h), filtered through nitrocellulose filters, rinsed two times with 2 ml of the same buffer, dried under an infrared lamp, and counted. Step 3. In order to test the site location of the Ac[~4C]Phe-tRNA bound in the second step, the remaining 350 #l is supplied with 70/zl of an energy regeneration mix containing GTP, phosphoenol pyruvate, and pyruvate kinase (final concentrations 0.1 mM, 1 mM, and 10/zg/ml, respectively) and then divided into six 60-/zl aliquots. Four aliquots receive 5/zl EF-G storage buffer, the remaining two substoichiometric amounts of EF-G (ratio of EF-G to 70S -- 0.2) in EF-G storage buffer. Samples are incubated for 10 min at 37*. P-site bound Ac[~4C]Phe-tRNA is expected not to be affected by the addition of EF-G, whereas A-site bound Ac[~4C]Phe-tRNA undergoes translocation. Step 4. In the last incubation step, two aliquots without and two aliquots with EF-G receive 5/zl of a puromycin solution (final concentration 0.7 raM), and two aliquots receive 5 gl TsoMl~NleoSH4buffer without puromycin serving as a background control for the subsequent extraction procedure. Puromycin exclusively reacts with P-site bound Ac[~4C]PhetRNA and forms Ac[~4C]Phe-puromycin. After 30 to 90 min incubation at 0 °, 65 gl of 0.3 M sodium acetate MgSO4 saturated is added to the sampies, and the product is separated from the unreacted material by extrac~2S. Watanabe, J. Mol. Biol. 67, 443 (1972).
[45]
PREPARATION OF ACTIVE E. coli RIBOSOMES
667
tion with 1 ml of ethyl acetate. Samples are vigorously shaken for 1 min. Phase separation is allowed to take place for 15 min at 0 °, and then the upper 0.7 ml of the organic phase is withdrawn, mixed with scintillation cocktail, and counted. Usually, incubation at 0 ° for 30 min yields no quantitative puromycin reaction. The site location of the Ac[t4C]PhetRNA bound to the ribosome is estimated in the following way: the values of the puromycin reaction in the absence of EF-G (originally P-site bound material) are divided by the values of the puromycin reaction in the presence of EF-G (originally P-site bound material plus translocated material). A ratio of 1 indicates 100% P-site location, whereas a ratio of 0 indicates 0% P-site (-- 100% A-site) location in the binding reaction (second step).
Cautions Concerning the Puromycin Reaction The puromycin reaction only gives a reliable picture of the site location of bound peptidyl-tRNA, if certain restrictions are observed.~3 1. It is not recommended to perform the puromycin reaction at room temperature or even at 37 °, if a significant pool of free peptidyl-tRNA is present in solution, as is usually the case under saturation conditions. Under such conditions, even in the absence of EF-G, the puromycin reaction will become repetitive due to spontaneous translocation, the extent being dependent on the incubation time. The repetitive reaction is even more pronounced if EF-G is present. Therefore, the ratio of the puromycin values in the absence and presence of EF-G no longer indicates the site location of the originally bound peptidyl-tRNA. 2. Under saturation conditions, the puromycin reaction will become repetitive even at 0 ° in the presence of stoichiometric excess of EF-G at longer incubation times. Therefore the translocation reaction should be performed with catalytic amounts of EF-G. Quantitative translocation can be achieved at a ratio of EF-G to ribosomes not larger than 0.2: 1. 3. For the puromycin incubation, the pH should be adjusted to between 7.5 and 8.0. At pH values lower than 7.0 the puromycin reaction becomes very slow at 0 °. To avoid the difficulties mentioned, the puromycin reaction should, as a rule, be carried out at 0 °. For substoichiometric amounts of peptidyltRNA bound, 30 to 90 min of incubation will suffice to get a near quantitative reaction. Under saturation conditions, a quantitative reaction requires up to 50 hr of incubation. Nevertheless, a reliable picture of the site 13U. Geigenmiiller, Th. P. Hausner, and K. H. Nierhaus, Eur. J. Bh~chem. 161, 715 (1986).
A
A-site Conditions
P- site condilions
8°I
A-i'e 1 P-site
--->
,-~---, . . . . . i ~
I
u :I
i o O,y .
_.a
J 12
......
C
•
2
I 8
L
4
~
8
!
moLor rotio Ac ItS'C] Phe-tRNA: ?0S
FIo. 2. Saturation of tight couples under P-site (A) and A-site conditions (B); (0) Binding curves. The inserts show the relative site location of AcPhe-tRNA as measured by the puromycin reaction (30 rain at 0°). (m) P-site location; (A) A-site location. Aliquots contained 13.8 pmol 70S.
A 1.0 .o.--. o
~:. 0.5
215
50
8
z B '~ 1.0
,=o
n _ _
0.5 I
50 time [ h ]
100
FIo. 3. Quantitative puromycin reaction of A-site bound (A) and P-site bound (B) AcPhe-tRNA (ratio of added AcPhe-tRNA to 70S = 8 and 3, respectively). (O) binding of AcPhe,tRNA; (A) puromycin reaction. After the binding reaction bad been performed, one half of the sample was used for the puromycin reaction (incubation time at 0 ° as indicated), the other half was kept at 0 ° and the binding controlled at the indicated times. Aliquots contained 6.15 pmol 70S. From Geigenmfiller et aL'3
PREPARATION OF ACTIVE E. coli RIBOSOMES
[45] A
669
A
1.0 "0 tO
Z r~
.,,..
0.5
l-
t%
< I
B >
I
1 2 m t i o A c [ l ~ C ] P h e - t R N A :70S
I
3
l.O
t-
< 7
' 05 o IE ~J
_.--.O
I
2
4
8 14 ratio f[l~ C ] M e t - t R N A : 7 0 5
2O
FIG. 4. (A) AcPhe-tRNA binding to poly(U)-programmed 70S ribosomes. Aliquots conrained 8.9 pmol 70S ribosomes. (O) Ac[=4C]Phc-tRNA (1400 pmol per A260unit) pufitied by BD-cellulos¢ chromatography as described in this paper. (O) Ac[=4C]Phe-tRNA (1750 pmol per A2~ounit) purified according to Odom et a l l 4 on an HPLC column. (B) Initiation-factor dependent binding of i~14C]Met-tRNAfM~t to 70S ribosomes in the presence of MS2 RNA. One aliquot (100/~1) contained 12pmol 70S, 144pmol MS2 RNA, 12 to 240pmol f[~4C]Met-tRNAfM= (150cpm/pmol), and 5/zl of a crude initiation-factor preparation (142 A2ao/ml) where indicated. The ionic conditions were 12 mM Mg2+, 50 mM NH + and 30 mM K+. The MS2-directed translation system has been described in Funatsu et a l ) 5 f[~4C]Met-tRNAfM= has been prepared according to Kahn et al.~6 The preparation of initiation factors was according to Noll et al.? 7 except that the final precipitation step was omitted. Initiation factors were stored in a buffer containing 20 mM HEPES.KOH, pH 7.5, 1 mM EDTA, 0.5 mM DTE, 10 mM NI-I4CI and 10% glycerol. (O) binding in the absence of initiation factors, and (e) binding in the presence of initiation factors.
670
RIBOSOME FUNCTION AND KINETICS
[45]
location (percentage of P-site and A-site bound material) equivalent to a quantitative reaction is obtained also with a short incubation time, if the precautions listed above are observed.
Results of the Activity Test Site-Specific Saturation. Figure 2 shows site-specific saturation of 70S tight couples with Ac[14C]Phe-tRNA. Under P-site conditions (Fig. 2A), exactly one Ac[~4C]Phe-tRNA molecule per 70S can be bound, whereas under A-site binding conditions (P site blocked with deacylated tRNA, Fig. 2B) the saturation level is somewhat lower (0.75 for the concentration range tested). The site specificity of the bound Ac[~4C]Phe-tRNA is better than 80% over the whole concentration range (see the puromycin reaction depicted in the inserts of Figs. 2A and B). Figure 3 demonstrates that all material bound under P-site conditions can react with puromycin, provided the incubation time is long enough (Fig. 3A), whereas A-site bound material remains essentially puromycin-insensitive during the same time of incubation at 0 ° (Fig. 3B). For comparison, AcPhe-tRNA was purified on a HPLC column 14 (instead of by BD-column chromatography as described in this paper) yielding AcPhe-tRNA essentially free of contaminating deacylated tRNA (1750 pmol/A26o versus 1400 pmol/A260 of the BD-purified AcPhe-tRNA, see Fig. 4A). The same saturation level of about one AcPhe-tRNA per poly(U)-programmed 70S ribosome is obtained. This finding indicates that the content of contaminating deacylated tRNA (at least up to a contamination of 20%) does not affect the saturation level of AcPhe-tRNA in accordance with the exclusion principle for AcPhe-tRNA binding. ~3 The initiation-factor dependent binding of fMet-tRNA to 70S ribosomes in the presence of the natural mRNA MS2 also levels off at 0.9 fMet-tRNA per 70S ribosome (Fig. 4B). 15-17 The binding results clearly demonstrate that 90- 100% of the ribosomes prepared observing the precautions described here participate in tRNA binding to the P site.
~40. W. Odom, H. Y. Deng, and B. Hardesty, this volume, [11]. ~5G. Funatsu, K. H. Nierhaus, and B. Wittmann-Liebold, J. Mol. Biol. 64, 201 (1972). ~6D. Kahn, M. Fromant, G. Fayat, P. Dessen, and S. Blanquet, Eur. J. Biochem. 105, 489 (1980). ~7M. Noll, B. Hapke, M. H. Schreier, and H. Noll, J. Mol. Biol. 75, 281 (1973).
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
673
[46] A n t i b i o t i c R e s i s t a n c e M u t a t i o n s in R i b o s o m a l R N A G e n e s o f E s c h e r i c h i a coli B y CURT
D. SIGMUND, MOHAMED ETTAYEBI, ANGELA BORDEN, and EDWARD A. MORGAN
Dominant or codominant selectable mutations in rRNA genes can identify regions of rRNA involved in specific ribosome functions, provide useful genetic tools for the study of rRNA structure and regulation, and help determine how important antibiotics work. However, selectable mutations in rRNA genes of Escherichia coli had eluded identification until recently because mutations in only one of the seven E. coli rRNA operons provide at best very weak phenotypes. I Our experience with antibiotic resistance mutations in rRNA genes suggests that strong, stable phenotypes are obtained only when approximately 50% of the rRNA in ribosomes is of the mutant type. This requirement can be fulfilled when the mutations are isolated in an rRNA operon on a multicopy plasmid.l-6 In this chapter we outline our strategies for selecting mutants. We describe procedures to map the mutations to small regions of rRNA operons, facilitating identification of the mutations by DNA sequencing. We also describe a primer extension method using rRNA templates and DNA oligonucleotide primers that permits convenient and accurate quantitation of the percent mutant rRNA in an rRNA preparation. This primer extension method is useful for determining the structural and functional capabilities of ribosomes synthesized from a single mutant rRNA operon (e.g., by analysis of total cellular ribosomes or ribosomes on polysomes) and provides a convenient way to determine if newly isolated mutations have base changes at the same position as previously isolated mutations. We also describe how a similar primer extension method can be used to accurately determine the copy number of mutant rRNA genes (e.g., plasmid copy number), permitting reliable quantitative analysis of rRNA gene expression. 1C. D. Sigmund, M. Ettayebi, S. M. Prasad, B. M. Flatow, and E. A. Morgan, in "Sequence Specificity in Transcription and Translation" (R. Calender and L. Gold, eds.), p. 409. Liss, New York, 1985. 2 C. D. Sigmund and E. A. Morgan, Proc. Natl. Acad. Sci. U.S.A. 79, 5602 (1982). 3 L. G. Mark, C. D. Sigmund, and E. A. Morgan, J. Bacteriol. 155, 989 (1983). 4 C. D. Sigmund, M. Ettayebi, and E. A. Morgan, Nucleic Acids Res. 12, 4653 (1984). 5 M. Ettaybei, S. M. Prasad, and E. A. Morgan, J. Bacteriol. 162, 551 (1985). 6 S. Douthwaite, J. B. Prince, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 82, 8330 (1985). METHODS IN ENZYMOLOGY, V O L 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form ret~rved.
674
GENETICS
[46]
Materials Media
For selection of antibiotic resistance mutations we have arbitrarily used LB medium, which consists of 10 g tryptone, 5 g yeast extract, and 5 g NaC1 per liter. For LB agar, 15 g agar is added per liter. Media differences can result in substantial differences in antibiotic sensitivity. Selection of other types of mutants may of course require different media. Colicin E l
Colicin E 1 is a bactericidal protein made by E. coli strains containing the CoE 1 plasmid. Colicin E 1 can be used for selection of plasmids conmining an rRNA operon in a CoE 1 vector because Cole 1 vectors confer immunity to colicin E 1. Colicin E 1 is slightly more difficult to obtain and use than conventional antibiotics, but its use soon becomes routine and problem-free. Colicin E 1 is produced in our laboratory by mitomyein C induction of W3110(ColE1), followed by a simple partial purification scheme involving salt extraction of a cell pellet and ammonium sulfate precipitation. 7 The ammonium sulfate pellet is resuspended in 0.1 M potassium phosphate, pH 7.4, 50% glycerol, and stored over chloroform at - 2 0 °. Typically, 20 ml of colicin E 1 is prepared from 24 liters of culture. Colicin E 1 can also be obtained from Sigma Chemical Company. The amount of coliein E 1 to use is determined by putting a measured drop of colicin E 1 on the agar surface of a petri dish and rapidly mixing in 0.1 ml of an overnight culture of one of the bacterial strains used in the experiment, then spreading the mixture over the surface of the dish. When the appropriate amount of colicin El is used, less than 100 colonies are obtained, and these test as colicin E1 resistant when cross-streaked with colicin E1 and the phage BF23. A resistant mutant lacks the receptor shared by colicin E1 and BF23, a sensitive cell is killed by both agents, and an immune cell (which produces an immunity protein from a CoE1 plasmid) is immune to eolicin E1 but sensitive to BF23. Typically, 75 #1 of colicin E 1 prepared in our laboratory as described above is used per petri dish. Large excesses of colicin E l should not be used, as immunity protein can be overwhelmed by excess colicin E 1. Plasmids
All plasmids used in our procedures are described in Fig. 1. We have successfully isolated mutations in rRNA genes in vivo using the plasmid 7 S. A. Schwartz and D, R. Helinski, J. Biol. Chem. 20, 6318 (1971).
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
675
I lkbl
Pvu I
Ps! I
C
pBR322
Hint lr
t I
Hind= ~ S i n a i / " I "Who I CIo I
pACYC~77
Eco RI Pvu Sca I ~ / ~ r~
~
polylinker
~V~ ~ (O~ i" pUCe) EGO RI
Nru Z_ _ _ ~ ' - - - H m d Wl ~ / I I "Born HI Xma If SolI Sph I
pACYCt84
pME 2t
FIG. 1. Plasmid structures. In these drawings, shaded regions represent rRNA operons, white regions indicate flanking E. coli DNA, and black regions indicate vector sequences. pLC7-21 contains rrnH cloned in a ColE1 vector, pRR-1 contains rrnC cloned in a portion of pBR322. The rrnC operon of pRR-1 was derived from pLC22-36, pLC7-21 and pLC22-36 have been previously described [M. E. Kenerley, E. A. Morgan, L. Post, L. Lindahl, and M. Nomura, J. Bacteriol. 132, 931 (1977)]. Small internal segments of the 16S and 23S rRNA genes of pRR- l have been replaced by gene segments of rrnH that include the spectinomycin and erythromycin resistance mutations present in pSPC-I and pERY-1. 4 pACYC177 and pACYC 184 have been previously described [A. C. Y. Chang and S. N. Cohen. J. Bacteriol. 134, 1141 ( 1978)]. pME21 is an approximately 1500-bp HaeIII origin-containing fragment of pRK-6 [D. M. Stalker, R. Kolter, and D. R. Helinski, J. Mol. Biol. 161, 33 (1982)] ligated to a 1345-bp RsaI fragment that contains the alpha-complementing lacZ fragment and polylinker of pUC8 [C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985)]. A HincII cartridge containing a chloramphenicol resistance gene [T. J. Close and R. L. Rodriquez, Gene 20, 305 (1982)] was then ligated into a PvuII site within a region of lacZ not required for alpha complementation, completing the construction of pME21.
p L C 7 - 2 1 , w h i c h c o n t a i n s a c o m p l e t e r r n H operon. 2 This p l a s m i d can be mobilized b y the E . coli F fertility factor, a p r o p e r t y essential to the success o f o u r procedures. A n o t h e r favorable p r o p e r t y o f p L C 7 - 2 1 is its nearly ideal c o p y n u m b e r (nearly as great as a n y available p l a s m i d c o n t a i n i n g a n rrn o p e r o n , b u t n o t so high as to reduce cell g r o w t h to a n extent where faster growing derivatives c o n t a i n i n g deletion plasmids rapidly a c c u m u late). U n f a v o r a b l e aspects o f the p l a s m i d are its s o m e w h a t large size a n d the fact that it can o n l y be selected using colicin E 1. H o w e v e r , the use o f
676
GENETICS
[46]
colicin E 1 does have the significant advantage of not directly affecting the ribosome. All ribosome-active antibiotics we have tested seem to act synergistically with other ribosome-active antibiotics, making the design of experiments difficult. Of the antibiotic resistance genes commonly present in plasmids, only ampicillin resistance seems to be a suitable alternative to colicin E1 immunity.
Bacterial Strains Donor bacterial strains should not have chromosomal mutations affecting the ribosome (because these mutations might interfere with phenotypic expression of the desired rRNA mutation), be F + so they can mobilize the plasmid with rRNA genes, be RecA ÷ so that they can be mutagenized, and not have lysogenic prophages lacked by the recipient strain. We have used EM2(F, pLC7-21). EM2 is ilv-1, his-29, pro-2, tsx, trpA-9605, trpR, ara. Recipient strains must be F - and RecA+ so they can be efficient recipients in the mating, and must contain a nonribosomal mutation with a low forward mutation rate to allow selection against the donor strain after mating events. We have used W3110 Nal r, a spontaneous mutant of the prototrophic strain W3110 that is resistant to 100/tg/ml of nalidixic acid. Nalidixic acid-resistant derivatives can be obtained from most strains by plating the cells from 10 ml of overnight culture onto LB agar containing 100/~g/ml of nalidixic acid. Several precautions are advised due to the instability of large recombinant plasmids containing rRNA operons. Culture stocks should be stored at - 70 ° after addition of glycerol to 20%. To prevent the accumulation of deletion and mutant plasmids, experiments should always begin from single-colony isolates obtained by streaking out scrapings from frozen stocks.
M u t a n t Isolation and Characterization We describe below a procedure for the isolation of erythromycin resistance mutations in rRNA genes on pLC7-21. Careful modification of the procedure allows other types of mutations to be isolated. Our procedure has many details that have explicit purposes and are essential to the success of the procedure. These details can best be understood if it is recognized that the procedure must: (1) enable the isolation of mutants that are usually infrequent, (2) enable the isolation of mutants with weak phenotypes, (3) permit phenotypic expression of mutations before strong selective pressure is applied (phenotypic expression requires several cell generations because of the nature of the mutations), and (4) cause the enrichment
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
677
of mutations on a plasmid relative to mutations on the chromosome (a feature that is desirable due to the fact that unwanted chromosomal mutations can be much more frequent than plasmid rRNA gene mutations).
Antibiotic Sensitivity Levels The use of antibiotic concentrations near the threshold sensitivity level can assist in the enrichment for mutations and allow recovery of mutants with weak phenotypes. Therefore, it is necessary to carefully test the antibiotic sensitivity of both donor [EM2(F, pLC7-21)] and recipient (W3110 Nal r) strains by plating 0.1 ml of overnight cultures onto different, closely spaced, concentrations of antibiotic. Three concentrations of antibiotic are chosen for subsequent use. The "low" concentration is a concentration that is only partially inhibitory to cell growth, and is the lowest concentration that permits mutant bacteria to form detectable papillae visible on the lawn of partially inhibited cells. For erythromycin, the low concentration is 100/zg/ml, and 1,000 to 10,000 papillae are observed per petri dish. Most of these papillae are the result of cell envelope mutants resistant to this low concentration of erythromycin. An "intermediate" concentration of antibiotic is also chosen, and is a concentration that allows detectable growth of the background lawn of wild-type bacteria, but inhibits lawn formation sufficiently to enable mutant bacteria to form prominent, easily recognized colonies. For erythromycin, this concentration is 200 gg/ml and there are 100 to 1,000 prominent colonies on the weak lawn. A "high" concentration of antibiotic is also chosen, and is a concentration just sufficient to completely prevent growth of the background lawn. For erythromycin, this concentration is 300 gg/ml, and from 0 to 10 mutant colonies appear per petri dish, most or all of which have mutations affecting ribosomal components.
Mutagenesis Portions (0.2 ml) of overnight cultures of EM2(F, pLC7-21) are plated on petri dishes containing colicin E 1 and low and intermediate concentrations of erythromycin. Only the low and intermediate concentrations are used at this stage because the high concentration does not allow sufficient growth for phenotypic expression of new mutations. Immediately after spreading bacteria on the plate, a l-cm diameter filter paper disk saturated with mutagen is placed in the center of the dish. We have used 100/d of ethylmethane sulfonate per dish. Because individual mutagens cause mutations at preferred sites, it may be advantageous in some instances to use other mutagens. Optimal amounts of mutagen should cause a 1 to 2 cm zone of killing around the filter paper disk. We mutagenize on a petri dish
678
GENETICS
[46]
only because this method has been convenient and effective. Mutagenesis of suspensions of cells just prior to plating on selective agent is probably at least as effective when selecting mutants resistant to bacteristatic antibiotics. Mutagenesis in the presence of the "low" or "intermediate" concentrations of a bacteristatic antibiotic or mutagenesis immediately followed by exposure to "low" or "intermediate" concentrations of antibiotic does not completely prevent cell growth after mutagenesis and therefore does not prevent phenotypic expression of mutations. However, in the presence of "low" or "intermediate" concentrations of antibiotic, mutants grow faster. These procedures therefore enable mutagenesis and enrichment for mutations in a single step. However, when selecting mutants using nutritional selections or bactericidal antibiotics, or when seeking mutants that can only be identified by screening procedures, partially inhibitory concentrations of selective agent cannot be used because they do not exist. In these cases, mutagenesis should b~ followed by five or more cell doublings to allow phenotypic expression of mutations before the addition of selective agents.
Mating The mutagenized cells are then washed off the petri dishes and resuspended at an OD55o of 0.2 in LB medium containing the same concentration of erythromycin used in the mutagenesis plate. After growth overnight in this medium to further enrich for erythromycin resistance mutants, the cells are washed with LB medium several times by centrifugation to remove all traces of antibiotics that might otherwise interfere with the mating. The cells are then resuspended in LB medium to an ODss0 of 0.05, grown to an OD550 of 0.2, and 5 ml of this culture is mixed with 5 ml of a growing broth culture of W3110 NaF (also at an OD550 of 0.2) in a 500-ml Erlenmeyer flask. To permit efficient mating, the resulting thin culture layer is incubated overnight at 37 ° without shaking. The resulting transconjugants must then be allowed to phenotypically express mutations present on newly acquired plasmids. Therefore, the two mating mixtures derived from mutagenesis on low and intermediate erythromycin concentrations are each diluted l : 20 in LB containing 20 #g/ml of nalidixic acid and colicin E l, followed by growth overnight at 37 °. For reasons outlined in the above section on mutagenesis, the agent selective for rRNA mutations should be omitted from the culture if the selective agent is not truly bacteristatic. The amount of colicin E1 per 50 ml of liquid culture should be the amount previously determined to be appropriate to use on a single petri dish. Cells from each of the two resulting cultures are then plated on LB agar containing 20 #g/ml nalidixic acid, colicin E 1, and the low, inter-
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
679
mediate, and high concentrations of erythromycin. Controls consisting of unmutagenized overnight broth cultures of W3110 Nal r (pLC7-21) and EM2(F, pLC7-21) are also plated on identical media. In the case of erythromycin resistance, the success of the mutagenesis, enrichment, and mating procedures is obvious, as the cultures obtained after mating yield 10 to 100 times more colonies on the intermediate and high concentrations of erythromycin than either control culture. However, a clear enrichment for plasmid mutants at this stage has not been evident in two other cases where mutations causing resistance to antibiotics were nevertheless identified by the following screening procedures.
Colony Screening Numerous individual mutant colonies growing on all three concentrations of erythromycin are picked and restreaked on LB agar containing nalidixic acid, colicin E 1, and the respective concentration of erythromycin. All size classes of colonies should be picked, as the phenotype of rRNA gene mutations cannot be predicted. After restreaking, 1-ml overnight LB cultures are made from single-colony isolates and are tested by a series of simple streak and cross-streak tests. Transconjugants that pass these tests should test as prototrophic, colicin El immune, and BF23 sensitive, and should grow better than W3110 Nal r (pLC7-21) on at least one erythromycin concentration (when tested on the low, intermediate, and high concentrations of erythromycin). Mutants that pass these tests are candidates for having mutant rRNA genes in pLC7-21, and are then directly tested for erythromycin resistance mutations in pLC7-21 as described below.
Plasmid Screening Fresh l-ml LB broth cultures are grown starting with the l-ml LB cultures described above, which have been saved at room temperature for this purpose. Of each culture, 0.5 ml is used to prepare plasmids by a NaOH minilysate procedure. 8 Care is taken to carefully wash the DNA pellet obtained by the first ethanol precipitation step of the minilysate procedure, but all subsequent steps in this DNA preparation procedure can be omitted. The ethanol precipitate is then dried in vacuo, resuspended in 10/zl of water, and used to transform W3110 Nal', selecting colicin immunity on LB agar containing colicin E1 and nalidixic acid. The resulting colonies are then restreaked on the same media. Single colonies are then used to start 1-ml overnight broth cultures. The broth cultures and control cultures of W3110 Nal r (pLC7-21) are tested by streak tests for colicin 8 H. C. Birnboim and J. Doily, Nucleic Acids Res. 7, 1513 (1979).
680
GENETICS
[46]
immunity, BF23 sensitivity, and for erythromycin resistance on low, medium, and high erythromycin concentrations. Once it is confirmed by this method that a mutant plasmid has been isolated, the remaining portions of the 1-ml cultures used for these tests are used to inoculate 10-ml cultures, from which frozen glycerol stocks are prepared. The frozen stocks are the source of inoculums for all subsequent cultures. The antibiotic sensitivity thresholds of mutants should be carefully tested using the antibiotic used in the selection procedure (erythromycin in this example). In addition, any structurally or functionally similar antibiotics and several dissimilar ribosome-active antibiotics should be tested. It is not unusual to isolate mutations that confer very strong resistance to antibiotics structurally dissimilar to the antibiotic used in the selection procedures.4,5 The knowledge resulting from these sensitivity tests assists subsequent genetic manipulation of the mutations, can often clearly distinguish between mutants with different base changes, and can provide a wealth of useful information on the ways that antibiotics interact with ribosomes and affect ribosome function. 4-6 The key features of our selection procedures are the efficient enrichment of plasmid mutations and proper provisions for phenotypic lag. However, certain mutations are not easily obtained by our procedures because the background of unwanted chromosomal mutants is very high and the available selective regimens do not allow efficient enrichment for plasmid mutants. For example, efficient enrichment is prevented by procedural modifications necessary when selecting mutants resistant to bactericidal antibiotics, when using nutritional selections, when seeking mutations that can be detected by a screening procedure but cannot be selected, or when cells with mutant rRNA operons grow much slower under selective pressure than cells with chromosomal mutations. In the absence of favorable enrichment procedures, larger culture sizes and extensive mutant screening procedures may be required to isolate plasmid mutations. In the absence of enrichment steps, we estimate that upward of 109 cells must in some cases be plated on selective media to obtain rRNA gene mutations in plasmids and that unwanted chromosomal mutants can be over 1000 times more frequent than plasmid rRNA gene mutants. Mapping and Sequencing Mutations The identification of point mutations by sequencing the DNA from large regions of rRNA operons is unnecessarily time-consuming and prone to error, whereas sequencing only regions where the mutation is guessed to be located can lead to unreliable conclusions or failure to identify all sequence alterations required for the phenotFpe. It is therefore advantageous to map mutations to small regions prior to sequencing DNA.
[46]
ANTIBIOTICRESISTANCEMUTATIONS
681
Fragment Exchange The most straightforward method used for mapping mutations to smaller regions is the careful reciprocal exchange of restriction nuclease fragments between pLC7-21 and its mutant derivative. The resolution and difficulty of mapping by this method depends on the distribution of restriction nuclease recognition sites. The most significant problem with this method results from the fact that the starting plasmids and the final plasmids resulting from fragment switching have structures that are indistinguishable when analyzed by restriction nucleases. Because of the nature of recombinant DNA methods, the source of all fragments in the final constructions will therefore be ambiguous unless the switching of fragments proceeds through clonally purified intermediate plasmids (deletions or subclones) that are structurally different from the plasmids obtained in each immediately preceding and subsequent step. Because of the need to construct intermediate plasmids, this mapping method is not as fast as marker rescue mapping methods. However, fragment switching methods are the only mapping method that can be used if the mutation does not confer a strong selectable phenotype.
Marker Rescue If a mutation confers a strong selectable phenotype, mapping can proceed using marker rescue methods. In these methods, restriction nuclease fragments of mutant pLC7-21 derivatives are cloned into a plasmid (pACYC 177, pACYC184, or pME21) that can stably replicate in cells also containing pLC7-21. The cloned restriction nuclease fragments must not express a complete mutant rRNA species. If the cloned restriction fragment carries the mutation, the mutation usually can be transferred to pLC7-21 by recombination and cause a selectable phenotype several generations after the recombination event. The presence of a mutation on a cloned restriction fragment is therefore indicated when 0.1 ml of an overnight culture of cells containing both pLC7-21 and the pACYC177, pACYC 184, or pME21 plasmid with the cloned fragment results in many more colonies on LB agar plus erythromycin than does 0.1 ml of a culture of cells containing pLC7-21 and a pACYC177, pACYC184, or pME21 plasmid without an inserted fragment.
Shotgun Marker Rescue As an alternative to the one-by-one cloning of individual restriction fragments and testing of each by marker rescue methods, restriction nuclease fragments generated by restriction enzymes that recognize four or six bases can be shotgun cloned into either pACYC177, pACYC184, or
682
~EN~rICS
[46]
pME21, the resulting plasmids transformed into W3110(pLC7-21), and transformants containing both types of plasmid selected on agar. To facilitate the subsequent identification of cloned fragments, fragments generated by restriction enzymes are usually cloned into sites on the vector that allow precise excision of the cloned fragment. Subsequently, colonies on a petri dish containing 100 to 5,000 colonies resulting from a shotgun cloning experiment are replica plated using velvet pads to a petri dish containing LB agar plus intermediate and high concentrations of erythromycin. On LB agar plus erythromycin, only those colonies in which frequent recombinational transfer of the erythromycin resistance mutation to pLC7-2 l has occurred will grow. After replica plating, irregular patches therefore result from replica-plating colonies containing many erythromycin-resistant recombinants. Therefore, patches growing on petri dishes containing erythromycin usually contain a mutation-bearing fragment cloned in pACYC177, pACYC184, or pME21. Pure cultures are then obtained by restreaking from patches of cells growing on petri dishes containing erythromycin, and are used to prepare plasmid DNA by the minilysate procedure. To obtain cells containing only one plasmid, the DNA is used to transform W3110 Nal r (or JM83 in the case of pME21), selecting only the antibiotic resistance markers of the pACYC177, pACYC184, or pME21 vectors. Transformants are then purified by restreaking and confirmed to lack the colicin immunity conferred by pLC7-21 and to have a gene on the vector inactivated by an insertion. Plasmid DNA is then prepared from cultures of these transformants using the minilysate procedure. To be sure that the purified plasmid DNA contains the erythromycin resistance mutation on the cloned fragment, the pure plasmid is transformed into W3110 Nal r (pLCT-2 l) and analyzed by the marker rescue method appropriate to single cloned restriction fragments, as described above. The pure DNA is also analyzed by restriction nuclease digestion. The size of the cloned DNA fragment and its internal restriction enzyme recognition sites, together with sequence information on rRNA genes,9 allow identification of the cloned fragment. The cloned DNA fragment can then serve as a convenient source of DNA for DNA sequencing.
Sequencing the Mutations Overlapping restriction nuclease fragments containing the mutation can be identified by the mapping methods described above. The region of overlap maps the mutation to a region that can be less than 50 base pairs in length.4-6 Both strands of the entire region containing a mutation, as well 9 j. Brosius, T. J. Dull, D. D. Sleeter, and H. F. Noller, J. Mol. Biol. 148, 107 (1981).
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
683
as the corresponding region of the wild-type rRNA operon, should then be sequenced. Other Uses of rRNA Gene Mutations The presently available spectinomycin and erythromycin resistance mutations in 16S and 23S rRNA genes4 can be employed in the analysis of mutations at other positions. For example, the resistance phenotypes are obviously very useful for determining if mutations at other positions in rRNA genes affect ribosome function. These antibiotic resistance mutations may also allow the isolation of informative second site revertants of mutations in rRNA genes that affect ribosome function. In addition, primer extension methods designed around the available antibiotic resistance mutations (see below) can be used to help determine if mutations elsewhere in rRNA operons affect rRNA synthesis, affect the ability of rRNA to participate in ribosome assembly, or affect the functional abilities of properly assembled ribosomes. To facilitate the use of selectable rRNA mutations in other studies, we have constructed pRR-1 (Fig. 1), which contains an rrnC operon with a spectinomycin resistance mutation in the 16S rRNA gene and an erythromycin resistance mutation in the 23S rRNA gene. The spectinomycin resistance mutation is a C to U change at position 1192 in 16S rRNA, whereas the erythromycin resistance mutation is an A to U change at position 2058 in 23S rRNA. 4 Several restriction nuclease fragments of pRR-1, with end points generated by restriction enzymes that cleave pRR-1 only once, have been cloned into M13 phages. Together, these cloned fragments encompass the entire rrnC operon and facilitate oligonucleotide-directed mutagenesis of this plasmid. Primer Extension for Quantitative Measurement We have developed a primer extension method capable of measuring the fraction of 16S or 23S rRNA in crude RNA preparations that is synthesized from rRNA genes with the spectinomycin or erythromycin resistance mutations. The essence of this method is that, with the proper design of synthetic DNA primers and the use of proper reaction conditions, primer extension stops efficiently at one position when the primer is annealed to wild-type rRNA, and stops efficiently at a different position when antibiotic resistant mutant rRNA is the template. As a result, primer extension products of two lengths are generated in proportion to the relative abundance of the two types of templates. Using this primer extension method, single-lane electrophoresis can be used to determine if base
684
GENETICS
[46]
changes anywhere in an rRNA operon affect the abundance of mutant rRNA in total cellular RNA, total ribosomes, or subfractions of ribosomes that have been fractionated on the basis of functional activities (for example, subfractions of ribosomes capable of association with mRNA can be obtained from isolated polysomes, and subfractions of ribosomes capable of peptidyl transfer can be obtained from ribosomes released from polysomes by puromycin). The spectinomycin and erythromycin resistance mutations can therefore serve as "marker" base changes to assess the structural and functional consequences of mutations at known or unknown locations elsewhere in the rRNA operon. These antibiotic resistance mutations provide ideal marker base changes for this purpose because they do not prevent any essential ribosome function (the mutant rRNA permits cell growth in the presence of antibiotics) and because these mutations probably do not cause mutant rRNA to be discriminated against during ribosome assembly (see below). The strongly terminated primer extension method also allows rapid determination of whether newly isolated mutants are identical to previously isolated mutants, as the primer extension products of two mutants will be identical only if they have the same base change.
Primer Extension Design To illustrate the primer extension method, we have used as template RNA total cellular RNA prepared from EM2(pRR-1) growing exponentiaUy in LB broth containing 10/tg/ml of tetracyline. The RNA was extracted from the cells by hot phenol: SDS: EDTA extractiont° followed by two conventional phenol extractions and high-salt precipitation. ~i The design of primers and the resulting primer extension products are shown in Fig. 2. Typical primer extension products are shown in Fig. 3. Using this procedure, termination caused by addition of dideoxyadenosine triphosphate (ddATP) indicates that erythromycin-resistant 23S rRNA is 69% of the total 23S rRNA. Termination caused by ddGTP reveals that spectinomycin-resistant rRNA is 71% of the total 16S rRNA. In good agreement, termination caused by ddATP indicates spectinomycin-resistant rRNA is 74% of the total 16S rRNA. The consistency of the results obtained by this primer extension method indicates that the method is reliable and that there is probably little or no preferential degradation of rRNA due to these antibiotic resistance mutations. ~o R. J. Siehnel and E. A. Morgan, J. Bacteriol. 163, 476 (1985). ~t D. J. Lane, B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace, Proc. Natl. Acad. Sci. U.S.A. 82, 6955 0985).
[46]
ANTIBIOTIC
RESISTANCE
MUTATIONS
685
ANALYSIS OF E r r r MUTANT
't
U (in Ery r Mutant) PRIMER 23S rRNA
3 ' -AC'r'I~TGATATCG.~ff~-5 ' 5'-GCAGUGUACCCGCGGCAAOACGGAAAGACCCCOUGAACCUUUACDAUAGCUUGACACUGA-3'
PRIMER EXTENSION PRODUCTS
WILD TYPE S r y r MUTANT
3'-ddATGGGCGCCGTTCTGCCTTTCTGGGGCACTTGGAAATGATATCGAACTG-5t 7 + ddATP, dCTP 3f-ddATTCTGGGGCACTTGGAAATCATATCCAACTG-5 ' ~ dTTP, dGTP
ANALYSIS OF Spcr MUTANT U (in Spe r Mutant) PRIMER I6S rRNA
3' T-AGTTCAGTACTACCC~GAATGC-5' 5'-CCAGUGAUAAACUGGACGAAGGUGGGGAUGACGUCAAGUCAUCAUGGCCCUUACGACCAC-3'
PRIMER
WILD TYPE Spc r MUTANT WILD TYPE Spe r M U T A N T
EXTENSION PRODUCTS
3 ' -ddACTCCAGTTCAGTAGTACCC~CAATCC-5 ' "7 + ddATP, dCTP 3 ' -ddACACTTCAGTAGTACCGGGAATCC-5' ] dTTP, dGTP 3 ' -ddGCAGTTCAGTAGTACCGGGAATGC-5' 7 + ddGTP, dCTT 3'-ddGACCTCCTTCCTCCCCTACTACAGTTCACTACTACCGCCAATCC-5' ] dTTP, dATP
FIG. 2. The sequence of primers for strongly ternfinated primer extension and the regions of 16S and 2 3 S r R N A they hybridize to are shown. When the indicated dideoxynucleotides and deoxynueleotides are included in primer extension reactions, the primer extension products shown are observed when analyzed as described in Fig. 3.
Primer Extension Method
Our primer extension methods are similar, but not identical, to those of Pace and co-workers H Besides obvious strategic differences unique to our strongly terminated primer extension reactions, important modifications include the use of an end-labeled primer to facilitate labeling and quantitation of short primer extension products, differences in other reactants required by this alteration in labeling method, and a higher incubation temperature to reduce the synthesis of artifactual premature termination products. We have used gel-purified primers 22 nucleotides in length (Fig, 2) that were 5'-end-labeled to maximum specific activity using T4 polynucleotide kinase.t2 For sequencing ladders or strongly terminated primer extension ,2 T. Maniatis, E. F. Fritseh,and J. Sambrook,"MolecularCloning:A LaboratoryManual." Cold
Spring Harbor L a b . C o l d Spring Harbor, New York, 1982.
686
GENETICS
[46]
t23ACTG
AC GT CA
Wild Type rRNA - Templote
CA
U
G
W W
G G
W
t ~II1~
g •
Templote
G C C G T
T
Q G
| gw
C
T C
U
Ery r rRNA m
T
•
C
u
T+A
U¸
T
•
T
•
c •
T U
G
•
G
e
G G C
Primer
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
687
reactions electrophoresed without adjacent sequencing ladders we use 1.5 × 104 dpm (about 15 ng) of primer per annealing. However, we used only 7% as much primer for the strongly terminated extension products electrophoresed next to the RNA sequencing ladders in Fig. 3 to cause the band intensity of the strongly terminated primer extension products to approximate the band intensity of sequencing ladders. In each annealing reaction, 9 ag of RNA is annealed to primer in 7.5 al reactions containing 100 mM KC1, 50 mM Tris-Cl, pH 8.5. Annealing is accomplished by placing a 0.5-ml microfuge tube containing the annealing mixture in a 5-ml plastic tube full of water preheated to 90 °. After 1 min at 90 o, the entire 5-ml tube and its contents are allowed to slowly air cool at room temperature for 1 hr. Primer extension reactions yielding sequence ladders are obtained using a strategy similar to that used for dideoxynucleotide DNA sequencing. Primer extension is carried out in 5-al reactions containing 1 al of annealing mixture and 4 al of a solution that brings the final concentration of reagents to 25 mM Tris-C1, pH 8.5, 25 mM KC1, 5 mM dithiothreitol, 5 mM MgC12, 100 pM each of all four deoxynucleoside triphosphates, and one didoxynucleoside triphosphate per primer extension reaction, ddATP is used at a final concentration of 10 aM, ddCTP at 25 aM, ddGTP at 12.5 aM, and ddTTP at 20 aM. Each reaction also contains 1 unit of avian myeloblastosis virus (AMV) reverse transcriptase added prior to the addi-
FIo. 3. Autoradiograms of gel-separated primer extension products obtained using rRNA templates prepared from EM2(pRR- 1) and the primer hybridizing near the Eryr mutation in 23S rRNA (see Fig. 2) are shown. The four lanes on the right are conventional primer extension sequencing lanes obtained using this primer-template hybrid. Lane 1 is the primer subjected to ddA-terminated, strongly terminated primer extension conditions in the absence of template RNA. Lane 2 is the same amount of primer as in lane 1, subjected to ddA-terminated, strongly terminated primer extension after annealing to EM2(pRR-1) RNA. Lane 3 has no sample. Two primer extension products are apparent in lane 2, resulting from priming on the two types of templates. Note that the sequencing lanes also detect the base heterogeneity cause by the Eryr mutation, but that sequencing lanes are less suitable for detection and quantitation of mutant rRNA due to spurious termination at certain positions and large sequence-dependent variations in termination efficiency. Sequence-dependent variations in termination efficiency result from the effects of local sequence on the competition between deoxy and dideoxynucleotides for incorporation into DNA. Competition is prevented in strongly terminated primer extension reactions because a didcoxynudeotide is added in the absence of the corresponding deoxynucleotide. When RNA is prepared from strains containing pSS-1, which is a variant of pRR-I that does not possess the Eryr mutation, or from cells containing variants of pRR-1 that do not synthesize rRNA because they lack the rrnC promoter, ddA-terminated, strongly terminated reactions yield only a single primer extension product migrating at the wild-type position, and the sequence ladders read only T at the position of the Eryr mutation.
688
GENETICS
[46]
tion of nucleotides but subsequent to all other reagents. For our strongly terminated primer extension reactions, identical conditions are used except that one deoxynucleotide is completely omitted and 100 # M of the corresponding dideoxynucleotide is added. The reaction mixtures are then incubated for 5 rain at room temperature followed by 30 min at 42 °. Reactions yielding sequencing ladders are then incubated for 15 additional min at 42 ° after addition of 1/zl of 10 m M Tris-C1, pH 8.5, containing 1 m M o f a l l four deoxynucleotide triphosphates and 1 unit of AMV reverse transcriptase. Strongly terminated reactions are incubated for 15 additional min at 42 ° after addition of I/A of 10 m M Tris-C1, pH 8.5, containing 1 m M of three deoxynucleotide triphosphates, 1 m M of a single dideoxynueleotide triphosphate, and 1 unit of AMV reverse transcriptase. After all incubation is completed, 6/tl of 86% deionized formamide, 10 m M EDTA, 0.08% xylene cyanol, 0.08% bromphenol blue is added, the reactions heated for 2 min at 90 °, and a portion of each sample electrophoresed on standard 20% polyacrylamide-urea DNA sequencing gels until the xylene cyanol nears the bottom of the gel. The 22 nucleotide primers migrate 95% as fast as the xylene cyanol dye.
Mutant rRNA Gene Number The primer extension method described above allows a point mutation to be used to accurately determine the percentage of mutant rRNA in the cell. If a similar method is applied to total single-stranded rDNA isolated from a cell population, the percent of mutant rDNA can be measured. The seven nonmutant rRNA genes present in the bacterial chromosome thereby provide an internal copy number reference by which the number of mutant copies can be judged. Thus, if a plasmid contains an rRNA gene with a point mutation, the plasmid copy number can be determined from the relative number of mutant and nonmutant rRNA genes. Measurements of mutant rRNA gene number, coupled with measurements of mutant rRNA, are all that is necessary for most investigations of the effects of cis-acting mutations on rRNA gene regulation or rRNA stability. To measure the copy number of mutant rRNA genes, it is first necessary to prepare total cellular DNA. Generally, we split a single culture and simultaneously prepare DNA and RNA for primer extension analysis, as it is not safe to assume that culture-to-culture variation in plasmid copy number is insignificant. Cells from 50 ml of culture are collected by centrifugation, resuspended in l ml of 10% sucrose, 50 raM Tris-C1, pH 8.0. Then, 0.2 ml of 100 mg/ml lysozyme freshly dissolved in 0.25 M Tris-C1, pH 8.0 is added, and the cell suspension incubated on ice for 10 min. Then, 0.6 ml of 5 M NaCI is added and 0.4 ml of 10% sodium dodeeyl
[46]
ANTIBIOTIC RESISTANCE MUTATIONS
689
sulfate quickly and completely mixed in. The resulting mixture is incubated overnight on ice. Then, without removal of cell debris by centrifugation, 0.08 ml of 10 mg/ml ethidium bromide and 1 g of CsCl are added per milliliter oflysate, and the density is adjusted to 1.55 g/ml (refractive index
BstXI + $ma I t
2
3
Ss t X
Ora I
t23
~ 2 3
E
S E
$
FIG. 4. Ethidium bromide-stained agarose gels of total cellular DNA digested with the indicated restriction nucleases. The lanes marked 1 contain 1 #g of pRR-1 DNA, lanes marked 2 contain 10 gg of DNA from the strain EM22 without a plasmid, and lanes marked 3 contain 10 gg of DNA from the strain EM22(pRR-I). S indicates the restriction fragments of pRR-I which contain the Spc" mutation at position 1192 of the 16S rRNA gene, and E indicates the fragments which contain the erythromycin resistance mutation at position 2058 in the 23S rRNA gene. All of the indicated fragments of pRR-I, with the exception of the large fragment produced by Sinai, comigrate with chromosomal rRNA gene fragments. Thus, the mutant rRNA gene copy number is proportional to the percentage of mutant rRNA genes in the comigrating restriction nuclease fragments.
690
GENETICS
[46]
of 1.3860) by the addition of solid CsC1 or water. The resulting viscous mixture is then centrifuged at 45,000 rpm at 15 ° for 60 hr in either a swinging bucket or fixed angle rotor. The DNA is visualized by the use of a long-wave ultraviolet light and is removed through the side of the centrifuge tube using a single syringe. Care is taken to remove all plasmid and chromosomal DNA without losing any DNA. Generally, we remove the entire contents of the tube with the exception of the pellet and pellicle. The ethidium bromide is then removed from the DNA by repeated extraction with water-saturated N-butanol and the CsC1 subsequently removed by dialysis against l0 m M Tris-C1, pH 7.4, 1 m M EDTA. To analyze the copy number of rRNA genes containing the Spc r (position 1192 in 16S rRNA) or the Ery r (position 2058 in 23S rRNA) mutations, the DNA is digested with Sinai, DraI, or BstXI and SstII. The restriction nuclease digests should contain 20 gg/ml of RNase A to prevent contaminating RNA from obscuring restriction nuclease fragments after gel electrophoresis. As a result of these digestions, restriction fragments are produced which contain entirely rDNA sequences from within 16S or 23S rRNA genes. These fragments are therefore uniform in size for all mutant and nonmutant rRNA genes. Ten to 50 #g of digested DNA is then electrophoresed on a 1.2% agarose gel. As can be seen in Fig. 4, restriction fragments from rRNA genes are visible above the background distribution of restriction fragments, even when the cell contains only the seven chromosomal rRNA operons. To determine the percentage of rRNA operons which are mutant, it is then only necessary to purify the restriction fragments which span the region containing the mutations, denature them, and perform primer extension analysis on the single-stranded DNA using the methods described above for rRNA templates. The fragments needed for determining the copy number of rRNA genes containing the Spc ~ and Ery" mutations are identified in Fig. 4. We denature the DNA by heating the annealing mixture to 100 ° immediately prior to annealing. It is likely that any of the commonly used methods for extracting restriction nuclease fragments from agarose gels will work. We have found that the desired fragments can be obtained in good yield and purity by electroeluting the DNA from excised gel pieces using an ISCO model 1750 sample concentrator and the methods recommended by the manufacturer.
[47]
MAXlCELL ANALYSISOF PLASMID-CODEDrRNA
[47] Analysis of Plasmid-Coded Ribosomal Maxicell Techniques
691
RNA
B y DAVID K . JEMIOLO, ROLF STEEN, MICHAEL J. R. STARK,
and
ALBERT E. DAHLBERG
Introduction It is now apparent from numerous studies that the rRNAs have important functional roles in the process of protein synthesis. Studies of mutations in cloned rRNA operons of E. coli have begun to define specific regions involved in particular steps of translation. These mutants have been produced by a variety of methods including deletion, 1 bisulfite, 2 ethylmethane sulfonate, 3 and synthetic oligonucleotide directed mutagenesis. 4 The initial mutants were made in plasmid pKK3535, which contains the rrnB operon cloned into plasmid pBR322. 5 A number of different plasmids are now available, 3,6 including two plasmids which contain inducible promoters PL (pNO2680) 7 and T7 (pAR3056) s that permit the isolation and characterization of lethal mutants. While rRNA mutations in the plasmids often result in altered phenotypes (growth rate or colony morphology), it is important to study the gene products directly, namely the rRNAs. To do this, plasmid gene transcripts have to be distinguished from chromosomal gene transcripts. In this chapter we describe a maxicell technique to accomplish specific labeling of rRNA transcribed from plasmid-borne cloned genes. Also, we discuss an alternate method for specific labeling of plasmid-coded rRNA transcripts in vivo that is based on the use of T7 RNA polymerase and a plasmid-borne T7 late promoter.
R. Gourse, M. Stark, and A. Dahlberg £ Mol. Biol. 159, 397 (1982). 2 C. Zwieb and A. Dahlberg, Nucleic Acids Res. 12, 436 (1984). 3 L. Mark, C. Sigmund, and E. Morgan, £ Bacteriol. 155, 989 (1983). 4 H. Goeringer, R. Wagner, W. Jacob, A. Dahlberg, and C. Zwieb, Nucleic Acids Res. 12, 6935 (1984). 5 j. Brosius, T. Dull, D. Sleeter, and H. Noller, J. Mol. Biol. 148, 107 (1981). 6 R. Steen, D. Jemiolo, R. Skinner, J. Dunn, and A. Dahlberg, Prog. Nucleic Acid Res. MoL BioL 33, 1 (1986). 7 R. Gourse, Y. Takebe, R. Sharrock, and M. Nomura, Proc. NatL Acad. Sci. U.S.A. 82, 1069 (1985). s R. Steen, A. Dahlberg, B. Lade, F. Studier, and J. Dunn, EMBO J. 5, 1099 (1986). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form reserved
692
GENETICS
[47]
Maxicells
The original maxicell technique developed by Sancar and co-workers9 was designed to specifically radiolabel plasmid-coded proteins. Transcription from the host chromosome was abolished by destroying the host DNA with ultraviolet (UV) irradiation. In order to specifically label rRNA instead of protein we found it necessary to modify this procedure. 1° Several factors made this necessary. There are seven rRNA operons distributed throughout the chromosome in E. coli. These operons are transcribed as primary transcripts containing single copies of the 16S, 23S, and 5S rRNAs and one or more tRNAs. The primary transcript is processed into mature products in a series of steps involving specific ribonucleases, ribosomal proteins, and various RNA-modifying enzymes. These proteins must be present for processing to occur and thus levels of ultraviolet irradiation sufficient to abolish production of these proteins cannot be used. On the other hand, sufficient irradiation is required to stop transcription of host chromosomal rRNA operons. By varying the level of irradiation we have found conditions that block host chromosomal transcription of rRNA operons while allowing plasmid-borne genes to be transcribed. Under these conditions, cells continue to produce proteins and to process the primary transcripts into mature rRNA.
Repair Mechanisms The principle products of ultraviolet irradiation (220 to 300 nm) of DNA are pyrimidine dimers. Escherichia coli has three ways of repairing these lesions. In the process known as photoreactivation the enzyme DNA photolyase, the product of the phr gene, binds to the pyrimidine dimer and catalyses a light-dependent (300 to 500 nm) reversal. The second repair mechanism is based on excision of a strand of DNA containing the dimer by the UVRABC nuclease, the product of the uvrA, uvrB, and uvrC genes. Finally, there is recombinational repair involving genes whose products are known to play roles in homologous recombination such as recA, recB, recC, recF, recJ, recN, and ruv. In order to use ultraviolet irradiation to achieve differential expression of genes, the repair mechanisms discussed above must be inoperative. Because DNA photolyase is light dependent, repair of pyrimidine dimers by photoreactivation can be avoided by keeping cells in the dark. (For cells with mutations in phr, normal lighting can be used.) To avoid excision repair, cells harboring mutations in the genes coding for the UVRABC 9 A. Sancar, A. Hack, and W. Rupp, J. Bacteriol. 137, 692 (1979). l0 M. Stark, R. Goursc, and A. Dahlberg, J. Mol. Biol. 159, 417 (1982).
[47]
MAXICELL ANALYSIS OF PLASMID-CODED
rRNA
693
nuclease can be used. The uvrA and uvrB genes code for two of the proteins that make up the UVRABC nuclease and expression from these genes is controlled by the SOS regulatory system. In this system, a protein repressor, the product of the lex gene, blocks expression of uvrA and uvrB. The LexA protein is in turn controlled by the RecA protein. SOS-inducing treatments such as ultraviolet irradiation result in activation of the RecA protein, a protease, that cleaves and inactivates the LecA repressor protein. Thus excision repair is activated by the ReeA protein and cells that are recA- cannot induce production of the UVRABC nuclease. It is known that the LexA protein also regulates several of the genes involved in recombinational repair. Thus recA- cells cannot repair damaged DNA by recombination. Cell Strain Requirements (Table I)
The minimum requirement for maxicells is a strain that is recA- such as HBI01. H This strain is phr + and must be kept in the dark after irradiation. Cells that are phr'-, such as CSR6039 can be used in normal lighting. CSR603 is recA- and uvrA- and is very sensitive to ultraviolet radiation, requiring only low levels of irradiation to induce chromosomal degradation. However, this cell strain has some undesirable characteristics. First, it is hsdR + and will therefore restrict plasmid DNA from cells that are hsdMsuch as HB 101. ~ (In order to avoid restriction damage, plasmids should be passed through a cell strain that is hsdR- and hsdM + such as MC1061? 2 Alternatively one may use UNC1085, a strain derived by Sancar from CSR603 but deficient in host restriction.) Second, CSR603 cells form colonies that are loose and tend to spread on plates, thus readily coalescing if plated as a dense culture. Third, it is difficult to isolate large amounts of plasmid DNA from CSR603 by standard minilysis techniques. Cell Growth
Cells harboring plasmids are plated from - 2 0 ° glycerol stocks onto LB (Luria broth) ~3 agar with 200 gg/ml ampicillin and incubated at 37 ° overnight. The plates should produce well-separated colonies of uniform size. Irregular-sized colonies should be removed. In addition to being antibiotic-resistant, cells harboring a plasmid with the rRNA operon grow slower than cells with a plasmid lacking the rRNA operon. Mutations in the Bolivarand K. Baekman, this series, Vol. 68, p. 245. ~2M. Casadaban and S. Cohen, J. Mol. Biol. 138, 179 (1980). ~3j. Miller,/n "Experiments in MolecularGenetics," p. 431, Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1972. H F.
694
GENETICS
[47]
TABLE I CELL STRAINREQUIREMENTS E. coli strains HBI01: recA- and F-, pro-, leu-, thi-, lacY-, str', hsdM-, hsdR-, endol- ara-14, galK2, xyl-5, mtl-1, sup44° MCI061: araD139, A (ara leu) 7697, A lacX74, galU-, hsdR-, hsdM +, strAb CSR603: recA1, uvrA6, phr-1, thr-1, leuB6, proA2, argE3, thi-1, ara-14, lacY1, gal-K2, xyl-5, mtl-1, rpsL31, tsx-33, ,~-, supE44, nalA98, F -c BL21(DE3): hsdM-, hsdR-, r/fl, 2 lysogend Plasmids pBR322 is a multicopy ColE1 plasmid,e tet~, amp" pKK3535 is a derivative of pBR322. It carries the rrnB operon cloned into the tetracycline gene at a unique BamHI restriction endonuclease recognition site, amp"/ pNO2680 is a derivative of pKK3535 constructed by Gourse and co-workers.s It has the 2 promoter PL in place of the ribosomal promoters PI and P2. amp" pEJM007 is a low-copy vector derived from pDPT487 and NRI. ~t It carries the rrnB operon of E. coli. cam; str'/spc r pCI857 is a multicopy plasmid derived from miniplasmid PISA/This plasmid is compatible with ColE1 plasmids. It codes for the temperature-sensitive 2 repressor protein CI857. kam" pAR3056 is a high-copy number plasmid (pBR322 derivative) carrying the rrnB operon fused to a T7 late promoter, amp"k aF. Bolivar and K. Backman, this seres, Vol. 68, p. 245. bM. Casadaban and S. Cohen, J. Mol. Biol. 138, 179 (1980) cA. Sancar, A. Hack, and W. Rupp, J. Bacteriol. 137, 692 (1979). aF. Studier and B. Moffatt, J. Mol. Biol. 189, 113 0986). ej. Suttcliife, Cold Spring Harbor Symp. Quant. Biol, 43, 77 (1978). fJ. Brosius, T. Dull, D. Sleeter, and H. Noller, J. Mol. Biol. 148, 107 0981). gR. Gourse, Y. Takebe, R. Sharrock, and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 82, 1069 (1985). hR. Steen, D. Jemiolo, R. Skinner, J. Dunn, and A. Dahlberg, Prog. Nucleic Acid Res. Mol. Biol. 33, 1 0986). i D. Taylor and S. Cohen, J. Bacteriol. 137, 92 (1979). J E. Remaut, H. Tsao, and W. Hers, Gene 22, 103 (1983). kR. Steen, A. Dahlberg, B. Lade, F. Studier, and J. Dunn, EMBO J. 5, 1099 (1986).
cloned rRNA gene often cause further reduction in cell growth rate. Thus fast-growing clones may be the result of spontaneous alterations in the plasmid. We avoid propagating cells in liquid culture because fast-growing cells are not as easily detected in liquid as on plates. When colonies are about 1 to 2 mm in diameter, the cells are scraped from the plates in 1.5 ml LB and used to inoculate 25 ml of LB with 200 #g/ml ampicillin at a final A~0o of between 0.18 and 0.25. The cells are then grown at 37 ° with good aeration to a final A600 of 0.5. Because the cell density will attenuate ultraviolet radiation, it is important to irradiate cells
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
695
at a fixed cell density. In the event that cells have overgrown slightly, they can be diluted with broth to the appropriate density. Cells can also be grown in defined medium such as M9 with casamino acids and glucose. ~3
Irradiation of Cultures Transfer 12.5 ml of the culture to a 100 m m × 15 m m sterile, plastic petri dish, add a 1.25 in. stir bar, cover the dish with a cardboard disk to shield the cells, and place it on a magnetic stirrer positioned 25 cm beneath the ultraviolet light source (G15T8 germicidal lamp, Sylvania). Start the culture stirring gently. The stir rate should be sufficient to keep the cells from collecting at the perimeter of the plate yet gently enough to avoid frothing. With the culture stirring, expose the cells directly to the ultraviolet irradiation for the appropriate length of time by removing both the cardboard cover and the top lid of the petri dish. After irradiation, 10 ml of cells is transferred to an 125-ml Erlenmeyer flask and allowed to recover for 2 hr at 37 ° with shaking. For cell strains that are wild type at the phr locus (e.g., HB 101), cells must be kept in the dark after irradiation. This can be accomplished by covering the flask with aluminum foil.
Recovery After 2 hr, D-cycloserine is added (final concentration of 200/~g/ml, freshly prepared in water), and the cells are allowed to recover for an additional 3 hr. D-Cycloserine is a cell wall inhibitor and any cells that have escaped irradiation damage will lyse as they continue to grow. Without cylcoserine, these cells would produce a high background of radiolabeled rRNA from the host chromosome. In cultures that have not been irradiated sufficiently, the ceils will lyse several hours after addition of cycloserine. This fact can be used to determine an approximate exposure time. Cells that have been irradiated for sufficient lengths of time will not be lysed when treated with cycloserine. The exposure times are strain specific and also depend on the media since certain media components absorb ultraviolet radiation. As examples, HB101 in M9 with casamino acids requires approximately 73 see of exposure and CSR603 in LB medium requires about a 10-sec exposure. Throughout the recovery period, background transcription from chromosomal operons decreases. While a 5-hr recovery is sufficient for most purposes, longer times may be required. To monitor background, cells with plasmids lacking a rRNA operon are used. As an example, we use cells with pBR322 because it is the parent plasmid of pKK3535 (pKK3535 contains the rrnB operon of E. coli cloned in a unique BamHI restriction
696
GENETICS
[47]
E Ut~ ..go 0..
0
t-
1
~
O.
2
"~
O.
3
0 IZ
tr) v v
Q..
2
-90.0 p23Sm23S-
-67.0 "ql
-43.0
x 0
-30.0
17S16S-
I
- 20.0 - 14.4 a
b
FI~. 1. (a) Plasmid-dependent rRNA production in maxicells. E. coli cells (strain CSR603) containing either no plasmid (lane 1), pKK3535 (lane 2), or pBR322 (lane 3) were irradiated for 10 sec and labeled with ortho[32P]phosphate for 10 hr as described in the text. rRNA was extracted from lysates and separated by electrophoresis on 3.0%/0.5%acrylamide/ agarose composite gels. Labeled rRNA was located by autoradiography. The labeled bands of 23S and 16S rRNA are present only in cells containing plasmid-borne rRNA genes (pKK3535, lane 2) and not present in cells with either no plasmid (lane 1) or with pBR322 (lane 3). Thus the rRNA transcripts in lane 2 are from plasmid-borne genes. In addition the results show processing of the primary transcripts into mature 16S and 23S rRNAs. (b) Protein synthesis in modified maxiceUs. Aliquots of the irradiated cultures of CSR603, described in (a), containing either no plasmid (lane 1) or pKK3535 0ane 2) were labeled with [3SS]methionine.3sS-Labeledproteins were separated by el~rophoresis on 12.5% acrylamide gels [U. Laemmli, Nature (London) 227, 680 (1970)] and visualiTed by fluorography. The results show that modified maxicells continue to produce proteins coded by host genes.l°
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
697
endonuclease recognition site located in the tetracycline gene in pBR322) 5 (see Fig. I a). Alternatively, background transcription can be detected using the mutants STU 1 or SMA 1- 6 with deletions of 371 and 770 bases, respectively, within the structural gene for 16S rRNA in pKK3535. These deletion mutants are transcribed and processed into RNAs that are smaller than 16S rRNA and migrate faster than 16S rRNA in agarose/acrylamide composite gels.~° While the occurrence of these mutant products indicates plasmid gene transcription, the absence of labeled RNA in the region of 16S rRNA indicated lack of chromosomal rDNA transcription. If there is
12345 23S-
A371 FIG. 2. Analysis of ribosomal RNA genes cloned on a low-copy-number vector. The rrnB operon was cloned into a low-copy-number plasmid (pDPT487) to produce pEJM007. Deletion mutations within the structural gene for 16S rRNA of eitber 371 bases (STUI-I) or 53 bases (SALI-72) were then constructed. E. coli strain HB101 was transformed with these plasmids and analyzed. In lane 1, "cells harboring the 371-base deletion, STUI-1, were pulse labeled with ortho[a2p]phosphate for 30 rain and then analyzed for RNA. In the remaining lanes, maxicells were prepared from cells with either STUI-I (lane 2), pEMJ007 (lane 3), pDPT487, parent of pEJM007 without the rmB operon (lane 4), or SALI-72 (lane 5) and labeled for 10 hr as described in the text. Pulse labeling (lane 1), yields bands at 23S rRNA (coded by both host and plasmid genes), 17S and 16S rRNA (coded by host genes), and A371 (coded by plasmid genes). Specific labeling of plasmid borne genes in maxicells is shown in lane 2 where the plasmid-derived A371 transcript is observed in the absence of 17S and 16S rRNA labeling. The presence of labeled rRNA in cells with a cloned rrnB (lane 3) and the absence of labeled rRNA in cells harboring only the plasmid vector (lane 4) again show that only plasmid-borne genes are labeled in maxiceUs.Maxicell analysis of the 53-base deletion in SALI-72 (lane 5) shows that the deletion effects processing of precursor small subunit RNA.6
698
GENETICS
[47]
evidence o f host r D N A transcription then the U V exposure time is increased slightly until this disappears. (See Fig. 2; here a low-copy-number plasmid, pEJM007, is used in place o f p K K 3 5 3 5 . )
Labeling of rRNA After the recovery period, cells are collected by gentle centrifugation at 5000 rpm for 1 rain in the Sorvall SS34 rotor at 3 °. The cells are washed twice with 5 ml o f zero phosphate m e d i u m (ZPM) containing 0.2% phosphate-free casamino acids (see Appendix), 0.2% glucose, and 1.0/zg/ml thiamine, resuspended in 2.0 ml o f the same solution, and transferred to a 30-ml Corex tube. The cell suspension is adjusted to 200/tg/ml D-cycloserine and 50 # M KH2PO 4. Radiolabel is added (50/tCi o f carrier-free ortho[32p]phosphate) and the cells are incubated at 37* with shaking (see Table II). The length o f time o f labeling can be from 20 min to 16 hr. We have observed that processing o f a primary transcript in maxicells is slow. ~° For short label times, less than 1 or 2 hr, most o f the label is found in precursors to 16S r R N A and 23S rRNA. For this reason, we routinely label for 10 to 16 hr.
Lysate Preparation The radiolabeled cells are pelleted and washed at 4 ° with 1.0 ml o f a solution containing 25 m M Tris, p H 7.6, 60 m M KC1, 10 m M MgCI2, 20% (w/v) RNase-free sucrose, and 150/zg/ml lysozyme. The wash steps are carried out in a 1.5-ml E p p e n d o r f centrifuge tube. The cells are resuspended in 25/zl o f this solution and lysed by three cycles o f freezing and thawing. (Samples should be kept at a low temperature during the thaw, i.e., 4°.) Add 175/zl o f a solution containing 25 m M Tris, p H 8.0, 30 m M TABLE II MAXICELL PROTOCOL
1. Dilute cells into 25 ml of media with antibiotic to an At00of 0.2 and grow to final A~00of 0.5 2. Transfer 12.5 ml of the culture to a petri dish, irradiate while stirring 3. Place 10 ml of the irradiated culture into a 25-ml flask and incubate at 37° for 2 hr 4. Add cydoserine to a final concentration of 200/~g/ml and incubate at 37° for 3 hr 5. In a Corex tube collect cells by centrifugation, rinse twice with 5.0 ml of ZPM with 0.2% phosphate-freecasamino acids, 0.2%glucose, and 1.0/zg/mlthiamine and resuspend in 2.0 ml of this solution 6. Add cycloserine(to 200/zg/ml), KI-I2PO4(to 50/zM), and add 50 #Ci of ortho[32p]phosphate. Label at 37° with shaking 7. Collect cells by centrifugation, rinse, and lyse as described in Table IV
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
699
KC1, 10 m M MgCI2, 0.2% (w/v) sodium deoxycholate, 0.6% (w/v) Brij 58, and 60 gg/ml DNase I. (The sodium deoxycholate should be from a fresh 1% stock solution.) The samples are kept on ice for 10 rain and then centrifuged in an Eppendorf centrifuge at full speed for 10 rain at 4 ° to pellet the cellular debris. The supernatant is carefully transferred to fresh tubes. Samples are usually divided into 25-/tl aliquots and stored at - 80 o.
Extracting RNA A portion of the sample is diluted 1:4 with a solution containing 25 m M Tris, pH 8.0, 30 m M KC1, and 10 m M MgC12 and adjusted to 0.2% in sodium dodecyl sulfate. An equal volume of a 1:1 mixture of phenol and chloroform is added and the solution is vortexed briefly. The samples are centrifuged in an Eppendorf microcentrifuge for 10 min at room temperature. (Use tubes with screw-top caps and O tings to avoid radioactive spills.) The aqueous layer is carefully removed and analyzed by electrophoresis after being mixed with an equal volume of 40% sucrose with either xylene cyanole or bromphenol blue. Alternatively, the samples can be concentrated by precipitation with ethanol, resuspended in a solution containing 10 m M Tris, pH 8.0, and 1.0 m M EDTA, mixed with sucrose and dye, and electrophoresed.
Electrophoresis Ribosomal RNAs are analyzed by electrophoresis in agarose/acrylamide composite gels using a Tris/borate/EDTA running buffer (see Figs. 1 and 2). To study 70S ribosomes and subunits a Tris/potassium/magnesium chloride-containing buffer is used. 14 In the latter case, maxicell lysates are electrophoresed directly into the gel. In the presence of 10 m M magnesium ion, normal subunits associate to form 70S particles. Some rRNA mutations, however, prevent subunit association) ° Radiolabel in 70S ribosomes may be due to the presence of either labeled 16S rRNA or 23 rRNA or both. This can be determined by a two-dimensional gel method where the first dimension separates ribosomes from subunits and the second dimension separates rRNA, after first deproteinizing the samples within the gel by soaking in SDS (see Fig. 3). Samples can be compared by loading either equal volumes of lysates or equal numbers of counts. Normalization by equal volumes of lysates assumes that the efficiency of lysis of the samples is constant. The normalization by counts assumes that equal counts con'e-
14A. Dahlberg, in "Gel Electrophoresis of Nucleic Acids--A Practical Approach" (D. Richwood and B. Haines, eds.), p. 213. IRL Press, Oxford, England, 1982.
700
GENETICS
[47]
000
J[~k
vv
,
B
23S"
1 7 S ,16S
"-
v ~'
..........~
FIG. 3. Two-dimensionalanalysisof ribosomal particles in maxicell lysates. Cells carrying wild-type plasmid pKK3535 or an uncharacterized mutant derivative defective in processing 17S to 16S rRNA were grown and labeled with 32p as described in the text. After labelinf, aliquots of lysates were electrophoresed in the first-dimension gel of 3%/0.5% acylamide/ agarose, 25 h i m Tris, pH 8.0, 10 m M MgC12, 30 m M KCI (from left to right) to separate 70S
ribosomes and subunits.~° To analyze the RNA content of the ribosomalparticles, the gel was sliced into strips and incubated at room temperature for 1 hr in Tris/borate/EDTA buffer, and then for an additional hour in the same buffer containing 0.2% SDS. The gel strip was then polymerized into a second gel of 3%/0.5% acrylamide/agarose, in Tris/borate/EDTA and electrophoresed (from top to bottom) for 10 hr at 100 V and 3°. Ribosomal particles (70S, 50S and 30S) are identified by the presence of mature 23S and 16S rRNA. (A) pKK3535, (B) mutant plasmid. Note the reduced level of radiolabel present in mutant rRNA (unstable?). Label is present in the 17S form (in the second-dimension gel) and in particles migrating faster than 30S subunits (in the first-dimension gel). spond to an equal n u m b e r o f cells. Only a small fraction o f the total counts are actually incorporated into r R N A . C h e m i c a l l y I n d u c e d Maxicells Plasmid-encoded r R N A transcripts can be specifically labeled by a second m e t h o d that is based on the use o f a T7 late p r o m o t e r and a cloned T7 R N A polymerase gene under control o f the lac UV5 p r o m o t e r ? In the plasmid pAR3056, promoters P1 and P2 have been replaced by a T7 late promoter. This p r o m o t e r is not recognized by the E. coli R N A polymerase but rather by the T7 R N A polymerase, and, in cells lacking T7 R N A polymerase, transcription from the T7 p r o m o t e r does not occur.
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
701
An E. coli strain BL21 (DE3) is available that contains one copy of the T7 RNA polymerase gene integrated into the chromosome under control of a lac UV5 promoter. ~5Thus production of T7 RNA polymerase can be chemically induced by addition of IPTG (Isopropyl fl-o-thiogalactopyranoside). Transformation of BL2 I(DE3) with pAR3056 produces a system capable of conditional expression of a cloned rRNA gene. Treating cells with IPTG causes T7 RNA polymerase to be produced which, in turn, transcribes rRNA from the T7 late promoter. The characteristic that makes this system particularly useful for radiolabeling plasmid-coded rRNA is the fact that T7 RNA polymerase is resistant to rifampicin, an inhibitor of E. coli RNA polymerase. In the presence of rifampicin, the only genes that are transcribed are those controlled by a T7 late promoter. The T7 promoter/RNA polymerase system has been successfully employed to label rRNA transcripts. This is accomplished by first inducing the production of RNA polymerase using IPTG. Cells are then treated with rifampicin to block transcription of host genes. Upon addition of ortho[a2p]phosphate, rRNA transcribed from plasmid-borne genes is specifically labeled. To our surprise, processing of the transcripts to mature 16S and 23S rRNA continues even in the presence of rifampicin for up to 35 min. We suggest that, under the condition of overproduction of plasmid-coded rRNA, the mRNAs coding for ribosomal proteins and ribosomal processing enzymes are stable and continue to be translated) Cell Growth
To achieve effective processing of plasmid-coded rRNA the cells must be in late log phase of growth at the time of induction by IPTG (Fig. 4). A culture ofBD2 I(DE3) harboring plasmids derived from pAR3056 is grown overnight to stationary phase in 10 ml of ZPM containing 10% LB ~a and 200 ~tg/ml ampicillin at 37 °. This culture is diluted 1:3 with a medium containing ZPM, 10% LB, 0.2% casamino acids, 0.2% glucose, and 200 #g/ml ampicillin and grown for 2.5 hr at 37 ° with good aeration. Growth is monitored carefully. Under these conditions, cells begin to grow without a lag phase and by 2.5 hr the culture should be in late log phase growth (Aroo=1.2, Klett = 200). It is important to keep the level of glucose low (0.2%) or, alternatively, use glycerol or succinate (0.5%) since excess glucose will inhibit induction by IPTG. ~6
~5F. Studier and B. Moffatt, J. Mol. Biol. 189, i 13 (1986). ~6W. Gilbert and B. Mfiller-Hill, Proc. Natl. Acad. Sci. U.S.A. 56, 1891 (1966).
702
GENETICS
[47]
b
400--
a
O R I --,,- ~
200--
b
--
KLETT
p 2 3 S..~ :!~ W m2 3 S ' "
tO0_ 8O
6040-
1 7 S-,,. Q 1 6S "~
I 2O
I
I 60
I
I 100
I
I 140
I
I 180
I
I 220
I
MINUTES
FIG. 4. Synthesisof rRNA by T7 RNA polymerasein vivo;effectof growthconditions on processing of rRNA. BL21(DE3)/pAR3056 cells were induced with IPTG for 45 rain at mid and late log phases of growth (at points a and b of the growthcurve, respectively).Rifampicin (150/tg/ml) was added, and after 5 rain the cells were radiolabeled for 20 rain with 32p. The RNA was extracted and separated by eleetrophoresis as in Fig. 1. Lanes a and b in the autoradiogramat the fight showrRNAs of cellsinduced at points a and b in the growthcurve.
Induction of T7 RNA Polymerase T7 RNA polymerase production is induced by the addition of IPTG (0.5 m M final concentration) (see Table III). The cells are allowed to continue for 45 min at 37". After this time, rifampicin is added (150/lg/ml final concentration) to inhibit transcription by E. coil R N A polymerase. (Rifampicin is made up as a 10 mg/ml stock in DMSO and stored at -20*.)
Labeling of rt~VA Five minutes after addition of rifampidn, ortho[32p]phosphate is added to a final level of 2 #Ci/ml and the culture is incubated at 37" for 20 rain. The culture is then chilled rapidly to just above the freezing point by transferring the sample to a centrifuge tube at - 70". Cells are harvested by centrifugation at 5,000 rpm for 5 min at 3", washed in ice-cold Z P M (1 ml ZPM per 10 ml original culture), respun, resuspcnded in 25 ~1 Tris/potasslum/magnesium buffer, and lyscd (Table IV). Ribosomes and RNA are analyzed by gel dectrophoresis as described above for maxiceUs.
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
703
TABLE III CHEMICALLYINDUCEDMAXICELL
1. Grow cells overnightin ZPM containing 1096LB and 200/zg/ml ampieillin 2. Dilute culture with 3 volumes of ZPM containing 10% LB, 0.2% casamino adds, 0.2% glucose, and 200/zg/ml ampicillin 3. Shake at 37" for 2.5 hr (to late log phase) 4. Add IPTG to 0.5 mM (to induce production of T7 RNA polymemse) and continue to shake at 37* for 45 rain 5. Add rifampicin to 150/zg/mland, after 5 min, add ortho[32p]phosphateto a concentration of 2/zCi/ml and shake for 20 rain at 37* 6. Rapidly cool to just above the freezingpoint by transferring the culture to a centrifugetube at --70" 7. Collect cells by centrifugation, rinse, and lyse as described in Table IV
Discussion The maxicell m e t h o d introduced by Sancar and co-workers9 is a technique designed to specifically label proteins in vivo which are coded by plasmid-borne genes. It represents an alternative to the so-called minicell technique in which labeling occurs in portions o f a cell lacking chromosomal D N A , formed by uneven cell division. The basis o f the maxicell technique is the use o f U V irradiation to damage c h r o m o s o m a l D N A in cells that are unable to repair the damage. While plasmid D N A largely escapes damage due to its small target size, c h r o m o s o m a l D N A is damaged and is eventually degraded. We have modified the maxicell technique to label r R N A coded by plasmid-borne genes. Modifications were necessary for several reasons. Ribosomal R N A is coded by operons that contain a single copy o f each o f the r R N A s (16S, 23S, and 5S) and one or more tRNAs. The opcrons are
TABLE IV CELLLYSlS 1. Wash cells at 4 ° with 1.0 ml of a solution containing 25 mMTris, pH 7.6, 60 mMKCI, 10 mM MgCl2,20% (w/v) RNase-freesucrose, and 150/zg/mllysozymeand resuspend cells in 25/Jl of this solution 2. Lysecells by three cyclesof freezing/thawing 3. Add 175/11 of a solution containing 25 mM Tris, pH 8.0, 30 mM KCI, Ill mM MgCI2, 0.2% (w/v) sodium deoxycholate, 0.6% (w/v) Brij 58, and 60/~g/ml DNase I. (The sodium deoxycholate should be from a fresh 1% stock solution.) Incubate at 4 ° for 10 min 4. Pellet the cellular debris in an Eppendorf centrifuge at full speed for 10 rain. Freeze aliquots at -70* 5. For RNA, extract lysate with 0.1% SDS and phenol/chloroform
704
6F.NETICS
[47]
transcribed as a single primary transcript that must undergo extensive processing to become the mature products. Processing requires all of the ribosomal proteins and various ribonucleases and RNA modification enzymes. The high level of UV irradiation required for analysis of translation products of plasmid-borne genes in maxicells would prevent rRNA processing since the required proteins would not be synthesized. Fortunately, low UV fluency (e.g., 10 sec for CSR603) is sufficient to prevent host rRNA transcription but not production of host mRNAs coding for proteins required for rRNA processing. The reason for this is that the host chromosome is probably not extensively degraded following the relatively moderate UV treatment. However, transcription of rDNA in vitro and in vivo is particularly sensitive to inhibition of DNA gyrase, ~7,~8and superhelicity of rDNA is probably required for it to be expressed efficiently. Therefore it is possible that treatment of plasmid-containing strains with low UV fluency causes preferential relaxation (rather than degradation) of the host chromosome, thereby accounting for the specificity of rRNA transcription of the plasmid-coded rDNA while maintaining the ability to synthesize host-coded proteins. The maxicell system described here has been used successfully to specifically label plasmid-coded rRNA and study the effects of mutations on processing of rRNA and assembly into subunits. While much of our research has been on plasmid systems derived from the multicopy plasmid pBR322, the maxicell technique is also applicable to lower-copy-number vector systems. For example, we are using a low-copy-number plasmid, pEJM007, derived from pDPT487 and NRI, 6,s9 and have no difficulty in specifically labeling the rRNA using the maxicell technique as described here (see Fig. 2). The vectors pKK3535 and pEJM007 have rrnB operons with the wildtype promoters P l and P2. Conditional expression systems are also available in which these promoters are replaced by the 2 promoter, PL,7 or the T7 promoters as described above. Using the PL promoter, expression can be controlled by the temperature-sensitive 2 repressor protein, CI857. At 30 °, the permissive temperature for repression, transcription of the gene is blocked by the repressor while at elevated temperatures (e.g., 42 °) thermal denaturation of the repressor allows transcription to occur. We have used the maxicell technique to label transcripts whose production is controlled b y PL. One may use an E. coli strain (e.g., K5637, M5219, or N4830) in which the gene for CI857 is integrated into the host chromosome and the J7 H. Yang, K. Heller, M. Gellert, and G. Zubay, Proc. Natl. Acad. Sci. U.S.A. 76, 3304 (1979). ~8B. Oostra, A. Van Vliet, G. Ab, and M. Gruber, J. Bacteriol. 148, 782 (1981). ~9D. Taylor and S. Cohen, J. Bacteriol. 137, 92 (1979).
[47]
MAXICELL ANALYSIS OF PLASMID-CODED r R N A
705
cells produce repressor protein at the level of a single-gene dose. Alternatively, the repressor gene may be introduced into cells such as HB101 on the multicopy plasmid pCI857. 2° This plasmid is compatible with the rrnB-containing plasmids described above and may be maintained stably in the same cell. In this construction the plasmid-coded repressor protein is produced in larger quantities and repression is very effective. The maxicell procedure is as described above. The cells are propagated, irradiated, and allowed to recover at 30 °, the permissive temperature for repression. After the recovery period, however, the cells are shifted to 42 ° and radioisotope is added. At 42 ° the repressor is no longer active, thus allowing transcription to occur from the PL promoter. The T7 maxicell system described here has several advantages over the UV maxicell system. It requires only the addition of chemicals (IPTG and rifampicin) rather than UV irradiation. It is much faster: 1.5 rather than 15 hr. It gives a greater yield of plasmid-coded rRNA; liters ofT7 maxicells may be used in contrast to UV irradiation of 10 ml. Also significant is the high level of transcription by T7 RNA polymerase. The one negative aspect of the T7 system is the reliance on stable mRNA to provide ribosomal proteins for processing and assembly of the rRNA. However, this appears to be quite adequate for the first 30 to 40 min after addition of rifampicin,s While we point out differences between the two maxicell systems with conditional expression plasmids (T7 and PL), they are both equally valuable techniques for providing important information about the processing and assembly of rRNA mutants which, in nonrepressed plasmid systems, would be lethal to the cell. In summary, we have described a modified maxicell technique which accomplishes specific labeling of transcripts of rDNA cloned on plasmid vectors. The transcripts are processed normally and incorporated into ribosomal subunits. The modified maxicell technique may also be used in a vector-host system that allows controlled expression using the PL promoter and a temperature-sensitive repressor protein. A second technique, the chemically induced maxicell system, is also described which uses a T7 late promoter and a cloned T7 RNA polymerase gene controlled by IPTG. The advantages of each system have been discussed. Appendix
Culture Media I. ZPM: 6.06g Tris base, 0.5g sodium citrate, 0.15g KC1, 0.1 g MgSO4" 7H20 per liter and 2/gM FeC13, pH 7.4, with HC1. 20 E. Remaut, H. Tsao, and W. Fiefs, Gene 22, 103 (1983).
706
GENETICS
[48]
II. Phosphate-free casamino acids, 10% stock solution: Add 100 g casamino acids to 500 ml H20, and add MgCI2 to 50 mM. Adjust the pH to 8.4 with ammonium hydroxide and place the solution on ice for 1 to 2 hr. The resulting precipitate is filtered and the pH adjusted to 7.2 with HC1. The solution is adjusted to 1 liter and sterilized by autoclaving. Solutions of 10% casamino acids may have phosphate concentrations around 20 m M before treatment and 20/zM after treatment.
[48] T e m p e r a t u r e - S e n s i t i v e M u t a n t s w i t h A l t e r a t i o n s in Ribosomal Protein L24 and Isolation of Intra- and Extragenic Suppressor Mutants By JOACHIM SCHNIER and KAYOgO NISHI Ribosomal protein L24 has been shown to be one of the first proteins involved in the assembly of 50S subunits in vitro. ~ It binds to the 5'-end of 23S rRNA. 2 However, not very much is known about important domains of the protein nor its precise interaction with ribosomal RNA or other proteins in vivo. Here we describe an approach for the analysis of mutants in the gene rplX for ribosomal protein L24 in vivo. It should be also applicable to other ribosomal proteins. A Nonsense Mutant in rp/X Two different mutants in the gene rplX for ribosomal protein L24 were characterized and used for further mutant isolations. They had been isolated as spontaneous independent mutants from antibiotic-dependent strains. 3,4 Mutant TAI09 has a nonsense codon which alters a codon AAA for lysine at position 20 to the stop codon TAA, resulting in the complete lack of a functional protein. 5 This mutant grows very slowly and gives rise to temperature-sensitive growth. The other mutant, KNS 19, shows an alteration of a ~ codon for glycine to a GAC codon for aspartic acid at position 84 in the protein. This mutant is temperature sensitive in growth.6 1 V. Nowotny and K. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 79, 7238 (1982). 2 p. Sloof, J. B. Hunter, R. A. Garrett, and C. Branlant, Nucleic Acids Res. 5, 3503 (1978). 3 E. R. Dabbs, J. Bacteriol. 140, 734 (1979). 4 E. R. Dabbs, Mol. Gen. Genet. 187, 453 (1982). s K. Nishi, E. R. Dabbs, and J. Schnler, J. Bacteriol. 163, 890 (1985). 6 K. Nishi and J. Schnier, E M B O J., in press (1986). METHODS IN ENZYMOIA3GY, VOL. 164
Copyright © 1988 by Academic Pr¢~ Inc. All rights of reproduction in any form reserved.
706
GENETICS
[48]
II. Phosphate-free casamino acids, 10% stock solution: Add 100 g casamino acids to 500 ml H20, and add MgCI2 to 50 mM. Adjust the pH to 8.4 with ammonium hydroxide and place the solution on ice for 1 to 2 hr. The resulting precipitate is filtered and the pH adjusted to 7.2 with HC1. The solution is adjusted to 1 liter and sterilized by autoclaving. Solutions of 10% casamino acids may have phosphate concentrations around 20 m M before treatment and 20/zM after treatment.
[48] T e m p e r a t u r e - S e n s i t i v e M u t a n t s w i t h A l t e r a t i o n s in Ribosomal Protein L24 and Isolation of Intra- and Extragenic Suppressor Mutants By JOACHIM SCHNIER and KAYOgO NISHI Ribosomal protein L24 has been shown to be one of the first proteins involved in the assembly of 50S subunits in vitro. ~ It binds to the 5'-end of 23S rRNA. 2 However, not very much is known about important domains of the protein nor its precise interaction with ribosomal RNA or other proteins in vivo. Here we describe an approach for the analysis of mutants in the gene rplX for ribosomal protein L24 in vivo. It should be also applicable to other ribosomal proteins. A Nonsense Mutant in rp/X Two different mutants in the gene rplX for ribosomal protein L24 were characterized and used for further mutant isolations. They had been isolated as spontaneous independent mutants from antibiotic-dependent strains. 3,4 Mutant TAI09 has a nonsense codon which alters a codon AAA for lysine at position 20 to the stop codon TAA, resulting in the complete lack of a functional protein. 5 This mutant grows very slowly and gives rise to temperature-sensitive growth. The other mutant, KNS 19, shows an alteration of a ~ codon for glycine to a GAC codon for aspartic acid at position 84 in the protein. This mutant is temperature sensitive in growth.6 1 V. Nowotny and K. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 79, 7238 (1982). 2 p. Sloof, J. B. Hunter, R. A. Garrett, and C. Branlant, Nucleic Acids Res. 5, 3503 (1978). 3 E. R. Dabbs, J. Bacteriol. 140, 734 (1979). 4 E. R. Dabbs, Mol. Gen. Genet. 187, 453 (1982). s K. Nishi, E. R. Dabbs, and J. Schnler, J. Bacteriol. 163, 890 (1985). 6 K. Nishi and J. Schnier, E M B O J., in press (1986). METHODS IN ENZYMOIA3GY, VOL. 164
Copyright © 1988 by Academic Pr¢~ Inc. All rights of reproduction in any form reserved.
[48]
TEMPERATURE-SENSITIVE MUTANTS 20 AAA (K)
ATGI
56 GGC (G)
aAC (D) GAA TCA TTA (E)
(S)
(L)
84 ,,GGC (G)
707
ITAA
la-XCI (D) GAG (E)
FIG. 1. Mutations in the gene rplX for ribosomal protein L24.
A mutant with a similar alteration as KNS 19 at position 56 did not show any apparent phenotype and was not used further. All mutations are summarized in Fig. 1. Various temperature-resistant mutants were isolated from the nonsense mutant TA 109 and analyzed. All of them had the common feature that an L24 protein was again detectable in two-dimensional gels. In most of the cases, the migration of these L24 proteins was different from wild type, indicating a variety of pseudorevertants. Revertants which grew slowly at 42 ° had acquired a mutation which was mapped at a different locus from the gene rplX for protein L24. 4 It was suggested that these may be located in genes suppressing nonsense codons, since the original mutation was still maintained. Other fast-growing revertants were mapped within the gene rplX. In order to see the alteration, it was necessary to clone the mutant genes in a simple and fast way. Cloning Strategy for rp/X Missense M u t a n t Genes As mentioned above, the nonsense mutant, TA109, grew very slowly (240 min for the mutant versus 40 min for wild type). Complementation analysis had revealed that faster-growing transformants could be obtained by plasmids containing the wild-type gene for protein L24 that is located on a 1.9-kb DNA fragment. As a vector we used either the mini-F-plasmid pRE4327 with a low copy number or plasmid pACYC184. 8 The doubling time of TA 109 decreased to 90 min using plasmids containing the wildtype gene for protein L24. We, therefore, tried to clone several missense mutants in rp/X by positive selection using faster growth as a phenotype. In fact, when chromosomal DNA fragments from several rplX mutants were cloned into one of the above-mentioned plasmids and TA109 was transformed, we observed some fast-growing colonies. All of these contained 7 R. Eichenlaub, in "Recombinant DNA Research and Virus" (Y. Becker, ed.), p. 39. Martinus Nijhoff, Boston, 1985. s A. C. Y. Chang and S. N. Cohen, J. Bacteriol. 134, 1141 (1978).
708
GENETICS
[48]
plasmids with the corresponding rplX missense mutant fragments. Sequence analysis showed mutations as they are summarized in Fig. 1. This method was also successfully applied to isolate the L24 gene of the missense mutant KNS 19 which showed a temperature-sensitive phenotype. In turn, this mutant was used for cloning various other missense mutant genes for L24 by selecting temperature-resistant growth. Since the L24 gene is located within a number of other ribosomal protein genes, 9 the mutants TA109 and KNS 19 could also be used to isolate mutant genes for other ribosomal proteins by a similar approach. Isolation of Spontaneous r R N A M u t a n t s In contrast to the nonsense mutant, the ts- missense mutant KNS 19 (C,C_~ to GAC at position 84) gave rise to not only intragenic revertants but also a number of extragenic suppressor mutants whose isolation will be described now. A similar missense mutant with a ts- phenotype was described l° which showed a defect in the 50S subunit assembly at 42 °. At the same time, the altered protein L24 showed a decreased affinity to 23S rRNA at all temperatures. We, therefore, thought that it might be possible to isolate temperature-resistant suppressor mutants in an rRNA gene. We made use of the fact that a plasmid, pKK3535, H containing the rrnB operon represses the synthesis of rRNA coded by chromosomal genes, 12 so that most of the rRNA in newly synthesized ribosomes is derived from the plasmid. We transformed mutant KNS 19 with plasmid pKK3535 and selected clones which grew at the nonpermissive temperature 42 °. It turned out to be important to select directly on agar plates containing ampicillin and at the same time at 42 °. By this way, chromosomal mutants which usually occurred at a high frequency could be largely excluded, since only clones containing plasmids could grow on ampicillin plates. After incubation overnight, we obtained two clones from which we isolated plasmid DNA. We retransformed mutant KNS 19 with both plasmids and examined the number of transformants at 30 ° and at 42 °. Both plasmids gave rise to a similar number of transformants at both temperatures. We concluded that the mutation(s) had occurred in the plasmids. The mutations were then localized in the Y-end of the 23S rRNA by DNA sequence and complementation analysis. From the location of the mutations a model was 9 S. R. Jaskunas, A. M. Fallon, and M. Nomura, J. Biol. Chem. 252, 7323 (1977). 1oT. Cabezon, A. Herzog, J. Petre, M. Yaguchi, and A. Bollen, J. Mol. Biol. 116, 361 (1977). 1~j. Brosius, T. J. Dull, D. D. Sleetgr, and H. F. Noller, J. Mol. Biol. 148,107 (1981). t2 S. Jinks-Robertson, R. L. Gourd, and M. Nomura, Cell 33, 865 (1983).
[48]
TEMPERATURE-SENSITIVE MUTANTS
709
deduced. 6 For the first time, a protein-rRNA interaction could be shown genetically. Isolation of Other Extragenic Suppressor M u t a n t s We further isolated and localized extragenic chromosomal suppressor mutants from mutant KNS 19 which showed temperature-resistant growth. For isolation we used two different media. One type of agar plates was rich medium containing L Broth (per liter: l0 g tryptone, 5 g yeast extract, 5 g NaC1) and the other type was minimal medium containing AN salts without NaCl) 3 In this way, we obtained three different extragenic suppressor mutants which were distinguished by their location on the Escherichia coli chromosome. The two mutants selected on the rich medium grew on both media and the one mutant selected on minimal medium grew only on the selection medium. The latter mutant gave rise to mucoid growth and showed UV sensitivity. The mutation was located in or close to the Ion gene coding for protease LA. It could be shown that this mutant is unable to induce the lon gene product at high temperature. We could further confirm that another lon mutation which was introduced into the mutant showed suppressor activity only on plates with minimal medium (K. Nishi and J. Schnier, unpublished observations). We have not yet characterized the other suppressor mutants, so their identity, apart from the map position, is still unknown. In summary, we have shown three ways of isolating mutant genes in ribosomal proteins, rRNA genes, and genes coding for proteins which are functionally correlated with ribosomal proteins. (1) A simple cloning system for cloning ribosomal protein genes was developed. This system can be used for the fast isolation of a number of mutant genes for ribosomal proteins in the neighborhood of the rplX gene for protein L24, like the S 10 or spc operon. (2) A new approach to isolate specific mutations in the ribosomal RNA was introduced. This system is based on a positive selection and could also be used in combination with mutagens. (3) We were able to obtain a number of suppressor mutants of a temperature-sensitive ribosomal mutant that map in genes other than ribosomal protein genes. This method is based on a simple selection using different media. Acknowledgments We thank Dr. H. G. Wittmann for support and thank Dr. E. R. Dabbs for some of the mutants as well as stimulating discussions. ~3B. D. Davis and E. S. Mingioli, J. Bacteriol. 60, 17 (1950).
7 10
GENETICS
[49] P r i m e r - D i r e c t e d
By BIRTE
[49]
Deletions in 5S Ribosomal RNA
VESTER, J A N EGEBJERG, R O G E R G A R R E T T , J A N CHRISTIANSEN
and
Structural and functional studies of 5S RNA, and of its protein complexes, are both important and topical, because of a wide general interest both in mechanisms of protein-RNA recognition and in RNA structurefunction relationships. 5S RNA and its protein complexes are essential for ribosomal function. Parts of the RNA molecule are very accessible on the ribosomal surface and the molecule contains universally conserved nucleotides that may have critical structural and/or functional importance. However, the precise role of the RNA remains to be clarified.1 At present, we have good minimal secondary structural models for eubactefial, archaebacterial, and eukaryotic 5S RNAs based on both phylogenetic and experimental evidence.2 All probably exhibit five main double-helical segments but their tertiary structure remains undetermined. The RNAs show some kingdom-specific features in their secondary structures2 and, also, in their patterns of conserved nucleotides that may be of functional importance. Only the protein-binding sites on the eubactedal 5S RNAs have been mapped in detail1,3; those of the eukaryotic ribosomal proteins and also of the transcription factor TF IIIA have been mapped partially.4,5 In summary, we are left with resolving the RNA tertiary structure, the chemical basis of protein-RNA interactions, and the details of structure-function relationships at a nucleotide level. Site-directed mutagenesis offers an important approach to such problems. For example, the effects of mutations on the conformation of the RNA may yield important insight into the higher-order structure of the RNA, and nucleotides thought to be involved in protein recognition can be altered, or deleted, and their effects on protein binding investigated. Moreover, conserved nucleotides that may be important functionally can be changed or eliminated and their effect on function examined. It is important though to choose your deletion carefully since the amount of work involved in producing and characterizing the mutant RNA is considerable. i R. A. Garrett, S. Douthwaite, and H. F. NoUer, Trends Biochem. Sci. 6, 137 (1981). 2 G. E. Fox, in "The Bacteria" (C. Woese and R. Wolfe, eds.), Vol. 8, p. 257. Academic Press, Orlando, Florida, 1985. 3 j. Christiansen and R. A. Garrett, in "Structure, Function and Genetics of Ribosomes" (B. Hardesty, ed.), p. 253. Springer-Verlag, New York, 1986. 4 p. W. Huber and I. G. Wool, J. Biol. Chem. 261, 3002 (1986). s j. Christiansen, R. S. Brown, B. S. Sproat and R. A. Garrett, E M B O J . 6, 453 (1987). METHODSIN ENZY'MOLOGY,VOL. 164
C o p ~ t © 1988by AcademicPr¢~, Inc. Allright5ofreproductionin any formreserved.
~ I
Sou3A 5SRNA Sou 3A
ISOLATE SAU3A FRAGMENT I
5s ~ ~
DIGEST, BAMHI LIGATE, TRANSFECT SCREEN FOR ORIENTATION
Isolate ssM13 DNA
I ANNEAL PRIMER
EXTEND WITH KLENOWFRAGMENT LIGATE 12-15 °, 16 H
0I
IGEST HINDIII / EC_O_ORI ISOLATE FRAGMENT
5S ~ T2
~ LIGATE
(( pKK 3535 "i
P,
,>
'P2~-'.---.'J'
H i.._.n.nd TIT
0:
S RNA
TRANSFORM SCREEN BY COLONY HYBRIDIZATION SEGREGATE MUTANT PLASMID
Sequence (DNA or RNA) FIG. l. General strategy for effecting primer-directed deletions in 5S RNA. pKK3535 contains the rrnB operon of E. coil as constructed by Brosius et al. 2°
712
GENETICS
[49]
Below we present a detailed procedure (illustrated in Fig. 1) for generating and characterizing deletion mutants in Escherichia coli 5S RNA. There follows a more detailed appraisal of the 5S RNA expression system in plasmids, deletion repair mechanisms in the cell, the possible occurrence of DNA rearrangements, and methods for determining structural and functional effects of the mutations. We conclude with a section on special problems associated with producing mutations in the large rRNAs of
E. coli. Experimental Procedure
Phosphorylation of the Oligonucleotide Hybridization Probe 1. Dry down 20 #1 [?-32p]ATP (3000 Ci/mmol). 2. Dissolve in 10/zl buffer A [50 mMTris-HCl, pH 9.5, 10 mMMgCI2, 5 m M dithiothreitol (DTT), 0.4% glycerol] containing 7 pmol oligonucleotide and 1 unit T4 polynucleotide kinase (P-L Biochemicals). 3. Incubate at 37 ° for 35 min.
Mutagenic Primer 1. Dissolve 200 pmol oligonueleotide in 20/tl buffer A containing 0.1 m M ATP and 3.5 units T4 polynucleotide kinase. 2. Incubate at 37 ° for 35 min.
Isolation of Phosphorylated Oligonucleotide The mutagenic primer is phosphorylated prior to ligation. This also has the advantage that the difference in mobility between the phosphorylated and nonphosphorylated form in polyacrylamide gels can be exploited during purification of the former. An aliquot of labeled probe is added, prior to electrophoresis, to facilitate detection and the remainder can be run in the same gel to remove [~,-32p]ATPand thus the background in the screening procedure: 1. Add an aliquot (0.5 pl) of the labeled hybridization probe to the solution of phosphorylated mutagenic primer. 2. Electrophorese the samples (mutagenic primer and labeled probe) on a 20% polyacrylamide-7 M urea gel (50 m M Tris-borate, pH 8.3, 1 m M EDTA). 3. Autoradiograph for 2 - 5 rain. 4. Excise bands and soak each in 200/tl H20 overnight to extract the oligonucleotide. Care should be taken not to excise the nonphosphorylated oligonucleotide.
[49]
PRIMER-DIRECTED DELETIONS IN 5S RIBOSOMAL R N A
713
Purification of the M13 Template 1. Innoculate 1.5 ml LB medium (10 g tryptone, 5 g yeast extract, 5 g NaC1 per liter) in a 10-ml tube with 15/tl fresh overnight culture of JM 101 cells. Incubate for 30 min. 2. Toothpick a single plaque into the 1.5 ml of innoculated medium and incubate by shaking vigorously at 37 ° for 5 hr. 3. Spin for 5 min at 8000 rpm and room temperature and transfer 1.2 ml of the supernatant to an Eppendorf tube. 4. Add 150/zl 25% PEG-6000, 3 M NaC1, and mix by inverting the tube several times. 5. Leave for 10 min at room temperature. Spin for 5 min in a microfuge and discard the supernatant. 6. Dissolve the pellet in 100/~1 T2oE~ buffer (20 m M Tris-HCl, pH 7.5, 1 m M EDTA). 7. Extract twice with phenol (saturated in TE) and twice with chloroform. 8. Add sodium acetate to 0.25 M, precipitate with 2.5 volumes ethanol, wash, and dry. 9. Dissolve the pellet in 25/tl T~0Eo.~buffer, pH 7.5, quick-freeze, and store at - 80 °.
Primer Anneafing 1. Mix 3/A M13 template (-0.4 pmol), 20#1 phosphorylated mutagenic primer (-20 pmol), and 2/tl 3 M sodium acetate followed by 68/zl ethanol. (This step also removes urea from the primer.) 2. Precipitate, wash, and dry. 3. Dissolve the pellet in 20/~1 annealing buffer (10 m M Tris-HCl, pH 8.0, 10 m M MgCI2, 50 mMNaC1). 4. Place the Eppendorf tube in a small beaker of hot water (70°), and cool slowly to room temperature ( - 3 0 - 4 5 min).
Extension and Ligation To the annealing solution, add 1. 7.5/11 4X extension/ligation buffer (13 m M Tris-HC1, pH 8.0, 13 m M MgCI2, 20 m M DTT, 0.7 m M dNTPs, 4 m M ATP). 2. 5 Weiss units DNA ligase (2/A 2.5 U//d, Amersham). 3. One unit Klenow fragment (0.3/tl 3 U/ld, Amersham). Then mix and incubate at 12- 15 ° for 16 hr.
714
GENETICS
[49]
Isolation of Heteroduplex Fragment 1. Add 70/~1 T2oEl0 buffer, pH 8.0. 2. Extract twice with phenol, once with chloroform, and precipitate with ethanol. 3. Redissolve the dried pellet in 20/d of the appropriate restriction enzyme buffer. 4. Add 1-5 units of restriction enzymes (e.g., HindlII and Eco RI; see Fig. 1). Digest for 1- 2 hr. 5. Add 2/tl 20% Ficoll loading buffer and electrophorese in 0.8-1.0% agarose gel containing 0.5 #g/ml ethidium bromide. 6. Excise fragment, crush gel piece, and freeze at -70* for 5 min, thaw at 37°; add one-third volume phenol and shake for 2.5 hr. 7. Centrifuge and extract the aqueous phase twice with chloroform to remove ethidium bromide. 8. Ethanol precipitate and redissolve in 20/zl TloEo.l buffer, pH 7.5.
Ligation into pKK 3535-Derived Expression System The 5S RNA expression system is considered in detail in a separate section below. 1. Mix 4/A of fragment and 50 ng vector in a total volume of 10/tl ligase buffer (50 m M Tris-HC1, pH 7.4, 10 m M MgC12, 10 m M DTT, 1 m M spermidine, 1 m M ATP). 2. Add 0.2 Weiss unit DNA ligase. 3. Ligate at 8 - 10* for 5 - 12 hr.
Transformation Any transformation procedure is probably adequate, but owing to the ease of using frozen competent cells we recommend the method described by Hanahan. 6 The transformed cells are plated on agar containing 50/~g/ ml ampicillin.
Colony Immobilization on a Filter 1. When colonies are 0.5-1 m m in diameter, place a filter (Gene Screen) on the surface of the agar plate and avoid trapping bubbles. 2. Transfer the filter with colony-side up to an agar plate containing chloramphenicol (150/tg/ml) and incubate at 37 ° overnight. 3. Incubate the master plate at 37* until colonies reappear. 6 D. Hanahan, in "DNA Cloning" (D. M. Glover, ed.), Vol. 1, p. 109. IRL Press, Oxford, England, 1985.
[49]
PRIMER-DIRECTEDDELETIONS IN 5S RIBOSOMAL R N A
715
4. Place the replica filter with colony-side up on Whatman 3 MM paper saturated with 0.5 M NaOH, 1.5 M NaCI, and leave for 15 min at room temperature. 5. Transfer filter to Whatman 3 M M paper saturated with 1 M TrisHC1, pH 7.0, 1.5 MNaC1 for 2 - 3 min. 6. Immerse filter in 2 × SSC buffer, pH 7.2 (20 × SSC: 3 M NaC1, 0.3 M sodium citrate) for 15 sec. 7. Air-dry and bake filter at 80 ° for 2 hr. 8. To remove bacterial debris, wash the filter in 3 × SSC containing 0.1% sodium dodecyl sulfate (SDS) using 50 ml/filter at 65* for 1 hr. 9. Change solution twice and wash at 65 ° for 0.75 hr both times (eventually rub filters with fingers, wear gloves). 10. Rinse the filter with 200 ml 2 X SSC. The filter can be stored dry at 4 ° .
Screening by Hybridization 1. Use 2 ml of hybridization solution per filter. The solution can be made up from 0.2 ml 50 × Denhardt's solution (1% Ficoll, 1% polyvinylpyrrolidone, 1% bovine serum albumin), 0.4 ml 30× TSE buffer (0.45 M Tris-HC1, pH 7.5, 4.5 M NaCI, 0.3 M EDTA), 1 ml 20% dextran sulfate, 0.2 ml 5% SDS, and 0.2 ml hybridization probe. 2. Hybridize overnight ( 14-18 hr) at an appropriate temperature. Hybridization temperature (T) = (number of G-C bp) X 4 ° + (number of A-T bp) X 2 ° - 4 °. If the calculated temperature is higher than 55 °, then hybridize at 50 ° . 3. Wash the filter at room temperature with 150 ml of 6 × SSC three times for a total of 20 min. 4. Air-dry and mark the filter. 5. Autoradiograph the filter for 2 - 6 hr using an intensifying screen. 6. The positive colonies should appear as dark spots on the film. If there are no clear differences in the spot intensities, wash the filter with 6× SSC at Td = (numbers of G-C bp) X 4 * + (numbers of A-T bp) × 2 °. (The dissociation temperature is not, as stated in the "Wallace Rule," a simple function of base content, but also a function of sequence.) If there are still no differences then wash at increasing temperatures. 7. Pick out positive colonies and isolate plasmid DNA.
Segregation of Mutant Plasmid The segregation step is important because ~50% of the plasmids are wild-type.
716
GENETICS
[49]
1. Transform competent cells under dilute DNA conditions to avoid more than one plasmid entering the same cell. 7 2. Either screen the colonies as described above or pick 10-20 colonies onto a master plate and use this for screening. Isolation o f 5 S R N A
1. Grow to a cell density of A650 -- 0.5 in LB medium. 2. Add adenosine + uridine (300 #g/ml) and thiamin (6/zg/ml), chloramphenicol (100 #g/ml). 3. Amplify while vigorously shaking for 8 hr. 4. Harvest cells, wash in 100 m M sodium acetate, pH 5.0, 10 m M magnesium acetate, and resuspend in washing buffer (one-fortieth of a volume of growth medium). 5. Add one volume phenol saturated in 0.3 M sodium acetate, pH 6.0, vortex for 1 min, and spin for 5 min at 5000 rpm. 6. Reextract the aqueous layer three times with phenol and once with chloroform and precipitate with ethanol. 7. Purify the 5S RNA on a 10% polyacrylamide-7 M u r e a gel containing 50 m M Tris-borate, pH 8.3, 1 m M E D T A . Sequencing
The mutation can be verified either by sequencing the DNA s,9 or the RNA.l°,ll Expression Plasmid for 5S R N A Figure 2 depicts the coding region and flanking sequences of the 5S RNA expression plasmid that employs the promoters and terminators of the rrnB operon of E. coli. This construction yields about 2 mg of mutant 5S RNA per liter of culture, in the presence of chloramphenicol, after extraction and polyacrylamide gel purification. Excision of the 16S RNA and most of the 23S RNA genes eliminates regulation by ribosome feedback, ~2 thus allowing expression to occur according to the gene dosage. A similar expression plasmid was developed by Brosius and Noller (unpub7D. Hanahan,J. Mol. Biol. 166, 557 (1983). s F. Sanger,A. R. Coulson,B. G. Barrell,A. J. H. Smith, and B. A. Roe, .1. Mol. Biol. 143, 161 (1980). 9A. M. Maxamand W. Gilbert,this series, Vol. 65 [57]. loD. A. Peattieand W. Gilbert, Proc. NatL Acad. Sci. U.S.A, 77, 4679 (1980). HH. Donis-Keller,A. M. Maxam,and W. Gilbert,Nucleic Acids Res. 4, 2527 (1977). 12S. Jinks-Robertson,R. L. Gourse, and M. Nomura,Ce1133, 865 (1983).
[49]
PRIMER-DIRECTED DELETIONS IN 5S RIBOSOMAL R N A
100bp
HindlTl B o m H I
Sau3A
V/A V / / / / / / / / / / / / / / / / / / / , ' ~ P1
P2
16S
t
M13 t i n k e r
23S
717
EcoRI
[////,4 SS
T1
T2
t
pBR 322
M13 l i n k e r
FIG. 2. Map of the coding region and flanking sequences in the 5S RNA expression plasmid. Ps and Ts indicate the promoters and terminators, respectively, that occur in the rrnB operon ofE. coli.
lished results). The distance between promoters and the 5S RNA gene is not critical as long as the primary transcript is able to adopt a structure recognized by RNase E. ~3 Thus, the 80 bp in front of the 5S RNA gene should be intact, otherwise 5'-end processing may prove dit~cult. 5S RNA expressed on this plasmid exhibits a dinucleotide extension at the Y-end and a heterogeneous 5'-end. This incomplete processing results from chloramphenicol inhibition of protein synthesis. The terminal extensions are absent if 5S RNA is isolated from nonamplified cells, but then the proportion of wild-type RNA will increase. The amount of chromosomecoded wild-type RNA in the mutant RNA, isolated from amplified cells, is about 10%. Primary transcripts are processed by RNase E in the absence of protein synthesis. Therefore, a particular mutant RNA will be produced even if it has lost its ribosomal protein-binding ability. Thus a low yield of mutant RNA probably reflects a decreased stability in vivo. Some desired mutations may seriously impede ribosomal function and, therefore, cell growth. Then it will be necessary to back-clone the heteroduplex that is constructed in vitro, as nonexpressed DNA and, subsequently, to express the mutant DNA after a second cloning step and establish whether, indeed, the mutation has adverse effects in vivo. If a mutation is deleterious in vivo or, alternatively, if it is very important to obtain pure and mature 5S RNA, it may be an advantage to employ an inducible promoter based on the T7 RNA polymerase system ~4 or the temperature-inducible PL system from phage 2.15 Thus even unstable 5S RNA deletion mutants, which cannot be purified in the expression system based on ribosomal promotors, can be transcribed in the in vivo T7 polymerase system. They can be purified in 5-10-fold higher amounts than stable 5S RNA from the above mentioned system. The purity of the mutant 5S RNA from the T7 promotor system is also higher (> 95-98%). 13 M. K. Roy, B. Singh, B. K. Ray, and D. Apirion, Eur. J. Biochem. 131, 119 (1983). ~4F. W. Studier and B. A. Moffatt, J. Mol. Biol. 189, 113 (1986). t5 R. L. Goursc, Y. Takebe, R. A. Sharrock, and M. Nomura, Proc. Natl. Acad. Sci. U.S.A. 82, 1069 (1985).
718
GENETICS
[49]
The ends of the mutated 5S RNAs are extended as occurs for chloroamphenicol-amplified cells (unpublished observations). Efficiency of Mutagenesis and Mismatch Repair Although several procedures have been described that yield high mutation frequencies for nucleotide substitutions, we have always observed very low frequencies when they are applied to nucleotide deletions. To obviate this problem we employed the back-cloning procedure (Fig. l) that reduces the methylation bias caused by dam mcthylation of the template strand.t6 In addition, it both prevents incorrect primer annealing to the M 13 vector and enables nonlethal mutations to be introduced directly into the expression system. Nevertheless, there seem to be differences between the repair of the template and of the in vitro synthesized strand, probably because GATC sites occur within the back-cloned fragment. After back-cloning into an M 13 vector we obtained substitution frequencies (using a 17-mer) in mutL strains of about 50%, while deletion frequencies (also using a 17-mer) were less than 1%. The substitution frequency in mutL + strains was 3 - 5%. Therefore, the mutL product must play a role in the repair of substitutions but not deletions. Back-cloning into a pKK3535 derivative and transforming into HB101 (recA-) cells gave a higher deletion frequency of about 3%; this suggests that there may be an advantage in back-cloning into plasmids rather than M 13 vectors.17 A general back-cloning procedure has been described that employs double primersJ s In our hands, this yields substitution frequencies of less than 1% for 5S RNA, which probably reflects poor annealing of the primer to the rDNA part of the M 13 ssDNA. This in turn is probably caused by the formation of very stable secondary structure in the single-stranded rDNA. DNA R e a r r a n g e m e n t Artifacts After constructing a desired mutant and expressing the mutant RNA, the altered DNA or RNA sequence-- preferably both - - should be verified. Reliance on the initial hybridization screening, especially for deletions, is inadequate because such mutational events can lead to gross DNA rearrangements. For example, an attempt to remove nucleotide G69 resulted ~6B. Kramer, W. Kramer, and H. J. Fritz, Cell 38, 879 (1984). ~7There are now commercially available mu~genesis kits which circumvent the mismatchrepair systems. ~s K. Norris, F. Norris, L. Christiansen, and N. Fiil, Nucleic Acids Res. 1 I, 5103 (I 983).
[49]
PRIMER-DIRECTED DELETIONS IN 5S RIBOSOMAL R N A
719
in a large deletion of both the 3'-end of the 5S RNA gene and the terminators. Cells expressing this plamid grew very slowly, probably due to runaway transcription that interfered with plasmid replication. Another mutagenesis experiment, designed to delete A66, yielded a 50-bp insertion. A partially duplicated 5S RNA was produced that was stable in vivo; its sequence and putative secondary structure are depicted in Fig. 3. Structure- Function Effects of Mutations Two general approaches can be invoked to investigate changes in structure or function caused by a particular mutation. The in vitro approach includes gel electrophoresis to examine conformational changes that will
~ so c c CAC c
C C
C C A /,o UG C
u G,A,u
5'
3,u PUcc
t
~
/ A "GP'--'C, U G 120 I"1 A (y
~c
Gu~
r,G
U
,
~ ~°
c
CAAG
A
, ~C ',..C~/A.
'~ C " I ° C A G U A c G ' ~ ' ."o G , GG ~ GUc, cG~ 11o" A ./G..~ C A- -~.yyG c .~o
AC
G ~o '~AG u
G - C ~as
G- C AG- C loo
U- A
5o I
A G AG'c-3o G CU
UA c C "
90
C
uCAGA
A
G~
, U - uG" .Gcc c.,",,•
U G' G eo ~" A u'G,C,c~ u G U'A~ AGc GC CG 70
FIG. 3. Sequence and putative secondary structure of a partially duplicated 5S RNA containing one A66 deletion (A) and one nondelction (~). Numbers refer to the 5S RNA sequence and nucleotides 2 5 - 7 2 (except A66) are duplicated. Two noncoded uridines that occur between the two repeated sequences are boxed. Helices I, II, and III of the general 5S RNA structure can form. The secondary structure is supported by probing data with ribonu-
cleases.
720
GENETICS
[49]
be reflected in mobility shifts, followed by probing of the RNA with chemicals and/or ribonucleases. Mutant RNA conformers can also be examined by spectroscopic methods such as nuclear magnetic resonance, infrared spectroscopy, and circular dichroism. A simple development of such studies would be to test the mutant's ability to interact with ribosomal proteins LS, L18, and L25 and to draw inferences concerning the modes of protein-RNA interaction. A straightforward in vivo approach is to examine the effect of the mutation on growth rate, preferably in both rich and minimal media. This could then lead on to elucidating any functional effects of the mutant RNA after assembly into polysomes. Mutations in Large rRNAs We have also made mutations in the large ribosomal RNAs of E. coli, in particular nucleotide substitutions, within the central part of domain V of 23S RNA that is associated with peptidyl transfer. Apart from the general problems of site-directed mutagenesis these studies also revealed an additional problem, specific to the large RNA genes, that relates to the back-cloning of a mutagenized DNA fragment. Owing to the lack of appropriate unique restriction sites it is difficult to back-clone the fragment into its exact position in the rRNA operon. This problem can be overcome by making the mutations directly in a gapped-duplex form of the plasmid. ~9 pKK35352° is digested with a restriction enzyme (PvulI) to yield two unequal fragments. The smaller one is religated to form a small plasmid containing the origin of replication, the Amp gene, and the last 2 kb of the rrnB operon. A 773-bp fragment containing the site to be mutagenized is then removed from the smaller plasmid. The remainder of the plasmid is heated and renatured with the same plasmid that has been linearized at a unique PstI site within the Amp gene. After establishing that the gapped-duplex is formed, the mutation is induced in the singlestranded area using the procedure described above for 5S RNA. After screening for mutants the plasmid is linearized and then cloned back into the rRNA operon using either a constitutive, or an inducible, expression system. Substitution frequencies within the 23S RNA gene of the rrnB operon are about 10%. If there are suitable restriction enzyme sites to generate the singlestranded region in pKK3535, and if the mutations are not lethal, then this ~9S. Inouyc and M. Inouye, in "Synthesis and Applications of DNA and RNA" (S. Narang, ed.). Academic Press, San Diego, 1987. 20j. Brosius, A. Ulldch, M. A. Raker, A. Gray, T. J. Dull, R. R. Gutell, and H. F. Noller, Plasmid6, 112 (1981).
[50]
5S RNA STRUCTUREAND FUNCTION
721
plasmid method has the considerable advantage that no cloning step is necessary. The method involving construction of a small plasmid involves some cloning but still avoids problems associated with back-cloning from the M 13 vector. Acknowledgments We thank SolveigKjaer and Arne Lindahl for their help with the manuscript.
[50] 5S RNA Structure
and Function
By H. U. GORIN6ER and R. WA6~ER Introduction 5S RNA from Escherichia coli has been the target of intensive research for more than a decade. Consequently, a number of reviews have appeared in the past summarizing the early findings on the structure and function of this molecule? -4 Due to the development of new techniques, more information about this interesting RNA species has been accumulated and some of our views on the structure and especially on the function have to be revised, although we are still far from a complete understanding of the molecule. The studies performed so far have been concentrated on two aspects, structural and functional. The structural predictions, starting from the comparison of evolutionary conserved elements, 5 which were verified and extended by biochemical data, have merged into a reasonable secondary structure, widely accepted today. In contrast, attempts to explore the functional participation of 5S RNA in the process of translation have been a matter of much more controversy. According to an early hypothesis, 6 the highly conserved 5S RNA sequence CGAAC was considered to interact i V. A. Erdmann, Prog. Nucleic Acid Res. Mol. Biol. 18, 45 (1976). 2 R. A. Garrett, S. Douthwaite, and H. F. Noller, Trends Biochem. Sci. 6, 137 (1981). 3 R. Monier, in "Ribosomes" (M. Nomura, A. Tissieres, and P. Lengyel, eds.), pp. 141 - 168. Cold Spring Harbor Lab. Cold Spring Harbor, New York, 1974. 4 R. A. Zimmermann, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 135-170. University Park Press, Baltimore, Maryland, 1979. 5 G. E. Fox and C. R. Woese, Nature (London) 256, 505 (1975). 6 B. G. Forget and S. N. Weissman, Science 158, 1695 (1967). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form r-~erved.
[50]
5S RNA STRUCTUREAND FUNCTION
721
plasmid method has the considerable advantage that no cloning step is necessary. The method involving construction of a small plasmid involves some cloning but still avoids problems associated with back-cloning from the M 13 vector. Acknowledgments We thank SolveigKjaer and Arne Lindahl for their help with the manuscript.
[50] 5S RNA Structure
and Function
By H. U. GORIN6ER and R. WA6~ER Introduction 5S RNA from Escherichia coli has been the target of intensive research for more than a decade. Consequently, a number of reviews have appeared in the past summarizing the early findings on the structure and function of this molecule? -4 Due to the development of new techniques, more information about this interesting RNA species has been accumulated and some of our views on the structure and especially on the function have to be revised, although we are still far from a complete understanding of the molecule. The studies performed so far have been concentrated on two aspects, structural and functional. The structural predictions, starting from the comparison of evolutionary conserved elements, 5 which were verified and extended by biochemical data, have merged into a reasonable secondary structure, widely accepted today. In contrast, attempts to explore the functional participation of 5S RNA in the process of translation have been a matter of much more controversy. According to an early hypothesis, 6 the highly conserved 5S RNA sequence CGAAC was considered to interact i V. A. Erdmann, Prog. Nucleic Acid Res. Mol. Biol. 18, 45 (1976). 2 R. A. Garrett, S. Douthwaite, and H. F. Noller, Trends Biochem. Sci. 6, 137 (1981). 3 R. Monier, in "Ribosomes" (M. Nomura, A. Tissieres, and P. Lengyel, eds.), pp. 141 - 168. Cold Spring Harbor Lab. Cold Spring Harbor, New York, 1974. 4 R. A. Zimmermann, in "Ribosomes: Their Structure, Function and Genetics" (G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura, eds.), pp. 135-170. University Park Press, Baltimore, Maryland, 1979. 5 G. E. Fox and C. R. Woese, Nature (London) 256, 505 (1975). 6 B. G. Forget and S. N. Weissman, Science 158, 1695 (1967). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988 by Academic Press, Inc. All rights of reproduction in any form r-~erved.
722
GENETICS
[50]
directly with the constant sequence GT~K~G found in tRNA. 7,8 Experiments where the corresponding 5S RNA sequence has been deleted clearly disprove such an interaction as an obligate step in translation. 9,~° A direct involvement of the 5S RNA in ribosomal function might nevertheless, be anticipated due to the following notions: (1) The presence of 5S RNA and the direct binding proteins is a prerequisite for in vitro reconstruction of functional ribosomes. H (2) An exposed nucleotide sequence of 5S RNA is strongly shielded from chemical modification when ribosomes contain bound tRNA, demonstrating either a close spatial neighborhood to the tRNA-binding site or a direct participation in the binding process. (3) 5S RNA undergoes a structural alteration when tRNA is bound to the ribosome. ~2 The structural and functional studies overlap at this point. The notion that 5S RNA exists in a number of different conformers which are interconvertible, and most probably related to different functional states,~3-~5 demonstrates the intrinsic relation of the structure and function of this molecule, two aspects which cannot be regarded separately. Here we describe the use of some earlier and some more recently developed approaches which we have employed for the investigation of the 5S RNA molecule. The studies have helped to add new and important facts regarding structure and also to understand more about the functional implications of 5S RNA for the ribosome and'the mechanism of translation. The first part of this chapter is divided into biochemical approaches, including limited enzymatic digestion and chemical modification studies as well as cross-linking. The second part describes genetic approaches, where we report on the construction, expression, and structural as well as functional characterization of 5S RNA mutants. We would like to draw the attention of the reader to a similar approach described in this volume [49].
M. Sprinzl, T. Wagner, S. Lorenz, and V. A. Erdmann, Biochemistry 15, 3031 (1976). 8 V. A. Erdmann, M. Sprinzl, and O. Pongs, Biochem. Biophys. Res. Commun. 54, 942 (1973). 9 B. Pace, E. A. Matthews, K. D. Johnson, C. R. Cantor, and N. R. Pace, Proc. Natl. Acad. Sci. U.S.A. 79, 36 (1982). ~oL. Zagorska, J. Van Duin, H. F. Noller, B. Pace, K. D. Johnson, and N. R. Pace, J. Biol. Chem. 259, 2798 (1984). H F. Dohme and K. H. Nierhaus, Proc. Natl. Acad. Sci. U.S.A. 73, 2221 (1976). ~2H. U. GOringer, S. Bertram, and R. Wagner, J. Biol. Chem. 259, 491 (1984). t3 T. Kao and D. M. Crothers, Proc. Natl. Acad. Sci. U.S.A. 77, 3360 (1980). t4 M. J. Kime and P. B. Moore, Nucleic Acids Res. 10, 4973 (1982). t5 D. Rabin, T. Kao, and D. M. Crothers, J. Biol. Chem. 258, 10813 (1983).
[50]
5S RNA STRUCTUREAND FUNCTION
723
Biochemical Approaches
Preparation of 5S RNA Both large- and small-scale preparations of 5S RNA from E. coli are begun either from alumina-ground cells or isolated 70S ribosomes. The samples are deproteinized by three consecutive phenol extractions using phenol saturated with 100 m M ammonium acetate, pH 5.5, 20 m M sodium borate, 10 m M ethylenediaminetetraacetic acid (EDTA), and 0.1% sodium dodecyl sulfate (SDS). The optical density of the solution to be extracted should not exceed 100 A~0 units per milliliter. Residual phenol is extracted by two ether extractions. The RNA is concentrated by precipitation with 2.5 volumes ethanol and separated on 5 to 30% sucrose gradients (SW 27 rotor, 25,000 rpm, 16 hr, 15"). After gradient separation, the 5S RNA is further purified from tRNA and breakdown products by preparative gel electrophoresis on 12% polyacrylamide gels in the presence of 8 M urea (40 V/cm; xylene cyanole marker dye: 10 cm). The 5S RNA is visualized by UV shadowing and extracted from the gel with 250 m M ammonium acetate, 20 m M sodium borate, 1 m M EDTA in the presence of an equal volume of phenol, equilibrated with the same buffer. Preparations exceeding 20 A26ounits of 5S RNA are alternatively separated on Sephadex G-75 columns using 150 m M sodium chloride, 15 m M sodium citrate, pH 7.5, and 5 m M E D T A as equilibration and elution buffer. The 5S RNA is concentrated by ethanol precipitation and dissolved at concentrations of 0.1 mg/ml in either 10 m M Tris-HC1, pH 6.9, 10 m M magnesium chloride, 20 m M sodium borate, or 250 m M Tris-HC1, pH 7.8, 7 M urea, 20 m M sodium borate, depending on whether the A- or B-conformer is to be investigated.
Isolation of 5S RNA A- and B-Conformers For structural investigations it is important that the material in question is homogeneous and not a mixture of different conformers. Although this is an important prerequisite, it can not normally be achieved completely. In case of the 5S RNA from E. coli, however, two stable conformers can be separated and investigated independently,~6-1s although they are probably not completely homogeneous. Both conformers can be obtained in high yields by renaturation and denaturation procedures. They ,6 M. Aubert, G. Bellemare, and R. Monier, Biochimie 55, 135 (1973). 17 H. F. Noller and R. A. Garrett, J. Mol. Biol. 132, 621 (1979). msH. U. G6ringer, C. Szymkowiak, and R. Wagner, Eur. J. Biochem. 144, 25 (1984).
AT~ L
KA .
~,
BT1 .
KB.-~.~-~.
L
G41 _jG54 ~-G56 ~-G61 ~- G64 --G69 ~-G72 ---G75 ~-G76
XC--~
i
I
".~--XC
I
w
u
I
U89--
w4w
Wm qD It ill
--C93
--G96 --G98
lIB
+-- I l l - - G l o o
EB
~
i--Glo
2
lib
qJ UIO3 - --GIo 5
lip
I l l - - Glos 6
- - G~o7
Ii FIG. 1. Limited RNase Tt and nuclease St digestion of 5S RNA A- and B-forms. RNA fragments were separated on 12% acrylamide, 8 M urea gels. For the St experiment, results obtained with 3'- and 5'-labeled RNA are shown and the corresponding patterns are labeled a and b, respectively. A and B denote 5S RNA A- or B-forms. The T, concentrations for the experiments shown were from left to right: 0.32, 0.64, and 1.3 X 10-3 units; the corresponding St concentrations in (a) are 0.4 and 0.9 units and in (b) 0.2 units. K stands for unhydro-
KAAS1
K BS,
b
KA
--XC
XC ..~
--
U95
U 103----
C 110-BPB'-~
-BPB
lyzed control samples. L shows a random alkali ladder. Nucleotide numbers are indicated at the margin. XC and BPB denote the marker dyes xylene cyanole and bromphenol blue. Bands labeled with an asterisk are either caused by secondary cuts or show cuts in the control. Published in similar form in Ref. 18.
726
GENETICS
[50]
can be separated electrophoretically and are relatively stable at room temperature. Pure 5S RNA A-conformer is obtained by incubating the 5S RNA samples in l0 m M Tris-HC1, pH 6.9, 10 m M magnesium chloride, 20 m M sodium borate at 57 ° for 5 rain followed by slow cooling to room temperature (1 ° per minute). To obtain pure B-form, the 5S RNA is incubated in 250 m M Tris-HC1, pH 7.8, 7 M urea, 20 m M sodium borate for 45 rain at 23 ° followed by quick cooling to - 15 °. The efficiency of the interconversion of the two conformers can be analyzed by nondenaturating gel electrophoresis on 8% polyacrylamide gels in 40 m M Tris-acetate buffer, pH 8.3.12
Radioactive End Labeling of 5S RNA 3'-End Labeling. 5S RNA is labeled at the Y-end with [5'-32p]pCp and polynucleotide ligase according to Bruce and Uhlenbeck? 9 The reaction is performed in the presence of 20 m M sodium borate and an ATP concentration adjusted to 50/zM. Y-End Labeling. The 5'-termini of 5S RNA are labeled with [7-32p]ATP and phage T4 polynucleotide kinase after removing the 5'phosphate with alkaline phosphatase. 2° Limited Enzymatic Digestion For structural studies employing limited enzymatic digestion between 1 and 2 × 105 cpm of 3'- or 5'-end-labeled 5S RNA (specific activity 400 TBq/mol) together with 3/tg carrier tRNA are incubated with the different enzymes (see Fig. 1) under the following conditions.
RNase 7"1Digestion Enzyme range: 0.3- 1.3 × 10-3 units Incubation buffer: 100 m M ammonium acetate, pH 5.5, 20 m M sodium borate Incubation time: 10 rain Incubation temperature: 0 ° Reaction volume: 10/tl
Nuclease St Digestion Enzyme range: 0.2-2 units Incubation buffer: 30 m M sodium acetate, pH 4.6, 50 mM sodium chloride, 1 m M zinc chloride, 50/0(v/v) glycerol m9A. G. Bruce and O. G. Uhlenbeck, Nucleic Acids Res. 5, 3665 (1978). 2o S. Douthwaite and R. A. Garrett, Biochemistry 20, 7301 (1981).
[50]
5S RNA STRUCTURE AND FUNCTION
727
Incubation time: 15 min Incubation temperature: 37 ° Reaction volume: 23 #1
Nuclease V~RNase Digestion Enzyme range: 0.1 - 1 unit 2~ Incubation buffer: 50 m M Tris-HC1, pH 6.9, 5 m M magnesium chloride, 50 m M sodium chloride Incubation time: 30 min Incubation temperature: 25 ° Reaction volume: 35 #l
Chemical Modification The same amounts of radioactive 5S RNA and tRNA carrier are employed for the chemical modifications as for the limited enzymatic digestion studies (see Fig. 2).
Diethyl PyrocarbonateReaction Reagent concentration: 5/tl DEP Reaction buffer: I00 m M ammonium acetate, pH 5.5, 20 m M sodium borate Reaction times: 10, 30, and 60 min Reaction temperature: 37 ° Reaction volume: 50/tl The reaction is stopped by the addition of 20/tl of 1.5 M sodium acetate and precipitation of the RNA with 2.5 volumes ethanol. The modification is followed by an aniline-catalyzed chain scission reaction according to Peattie. 22
Dimethyl Sulfate Reaction Reagent concentrations: 0.1, 0.2, and 1/tl DMS Reaction buffer: 100 m M ammonium acetate, pH 5.5, 20 m M sodium borate Reaction times: 3, 5, and 10 min Reaction temperature: 37 ° Reaction volume: 50/~1 The reaction is stopped by adding 30/~1 1 M Tris-acetate, pH 7.5, 2 M 2-mercaptoethanol, 1.5 M sodium acetate and precipitation with 2.5 vol21 M. Digweed, T. Pieler, D. Kluwe, L. Schuster, R. Walker, and V. A. Erdmann, Eur. J. Biochem. 154, 31 (1986). 2: D. A. Peattie, Biochemistry 76, 1760 (1979).
728
GENETICS
KA A.CVE
L
[50]
KB BCVE
C27 C37 G54
tGse ~C 70 C71 U77 -4-, XC
U87
- C92 " C93 - A94
- G98
- UlO 3
-.,li
BPB
FIG. 2. Limited V~ nuclease digestion and DEP and DMS modifications of 5S RNA Aand B-forms. (a) Modification of adenosines with DEP; (b) DMS modifications under condi-
[50]
5S R N A STRUCTURE AND FUNCTION
a
KA ~
A-DEP
KS.
729
B~,DEP .
A39 - -
A66--
A73 .
A78--
.
.
.
• .....
-,*.-- XC
--A94
A99-AlO1- -
A~04~
AIO 9 - -
~"
BPIB
IPB
tions specific for cytidines. DEP reaction times were from left to right: 10, 30, and 60 rain. The C modification reaction was performed for 3 min. The V~ nuclease hydrolysis shown in the right panel was performed with 0.4 and 1 unit of enzyme, respectively. The RNA for all experiments shown was labeled at the 3'-end. Separation was the same as in Fig. 1. Published in similar form in Ref. 18.
730
GENETICS
[50]
umes ethanol. The RNA pellet is washed with 100 #1 0.3 M sodium acetate and precipitated again. The modification is followed by a hydrazine reaction and an aniline-catalyzed chain cleavage as described by Peattie 22 and Douthwaite and Garrett. 2° Separation of Reaction Products. The RNA fragments from the limited enzymatic hydrolysis and chemical modification reactions are separated on 12% polyacrylamide, 8 M urea gels as described ~s and autoradiographed (see Table I).
Inter- and Intramolecular Cross-Linking Topographical information can be obtained by intramolecular crosslinking of 5S RNA or intermolecular cross-linking of 5S RNA and neighboring proteins, using for instance the bifunctionai reagent phenyldiglyoxal (PDG). Reactions can be performed with isolated 5S RNA, 5S RNA-protein complexes, or intact ribosomes. Reaction conditions have been established where the structure of the reacted components are not noticeably affected, and the different conformers are not interconverted.
TABLE I REACTIONS SPECIFIC FOR A- OR ]3- FORM
Reactivity Position
A-form
C12
A15
(+)
GI6 C19 G20 U22 C27 A34 C36 C37 A39 U40 G41 C42 C43 A46 A50 A52 A53
(+)
B-form (+)
SI
(+)
s,
(+) ++ ++ ++ "4-/ ++ +++ J J | / ~ ', J
(+) ++/++ -H'/++ +-1-/-I-4++ /"~"
+++ +++ +++
+/
Cut
+ (+) ++/(+)
V~ V~ VI S~ V,/DMS V1 V~/DMS V I/DMS DEP St TI/S I
DMS DMS St DEP DEP $1/DEP
Remarks
nd/
nd/
[50]
5S R N A STRUCTURE AND FUNCTION TABLE I
731
(Continued)
REACTIONS SPECIFIC FOR A- OR ]3- FORM
Reactivity Position G54 G56 A57 A58 A59 G61 C63 G64 U65 A66 G69 C70 C71 G72 U74 G75 G76 U77 U82 U87 C88 U89 C92 C93 A94 U95 G96 G98 A99 G 100 A101 GI02 U 103 AI04 GI05 G106 G107
A-form
+/ + ++
+
B-form +/+ + + ++/+ ++ ++ ++ + 4"+ ++ +/+ + + (+) ++ + + +
4-+ + -I+/+ + (+) /+ (+)
+ (+)
+ +/4-++ +/+ +/+ +/+ +/++ + +/+ + ++ ++ ++ + + +
Cut T l/V 1 Tl DEP S~/DEP Sl Tl V t/DMS T, Sl $1 V,/T l V, V1 Tl Sl TI T1 Vt Vi Vl S~/DMS * V~ */V~ V~/DEP Si/Vt TI/Vi TI/VI Sl T t/Vi Sl Tl Vl SI Tl Ti Tl
Remarks /nd
A:V l ; B:DMS
nd nd nd
Control Control
nd
a The relative reactivities are given as (+), very weak; +, weak; ++, medium; and + + + , strong. They are based on the band intensities as revealed by densitometer scanning. If more than one intensity symbol is given it refers to different enzymes which are given in the same order in the next line. nd, not double stranded. An asterisk indicates that the cut is found reproducibly in the control RNA showing a strong A or B form specificity.
732
GENETICS
[50]
The cross-linking results are therefore not falsified by the presence of several conformers.23-25 Cross-Linking Reaction. Isolated 5S RNA, 5S RNA-protein complexes, or intact ribosomes can be used for the cross-linking reaction where the RNA is either unlabeled, in vivo 32p-labeled, or end-labeled employing polynucleotide kinase or ligase. Reagent concentration: 2.4 m M PDG, freshly dissolved in 70 m M sodium cacodylate, pH 7.2, 20 m M magnesium chloride, 20 m M sodium borate, 0.3 M KC1 Reagent buffer: 70 m M sodium cacodylate, pH 7.2, 20 m M magnesium chloride, 20 m M sodium borate, 0.3 M KCI Reaction time: 2 to 4 hr Reaction temperature: 37 ° Reaction volume: 25/tl per A260unit of RNA or ribosomes RNA sequence analysis of the cross-linked components is performed according to Wagner and Garrett, 23 Hancock and Wagner, 24 or Szymkowiak and Wagner, 25 where detailed descriptions are given. Results and Discussion
5S RNA Secondary Structure Examples showing the results of the limited enzymatic digestion studies and the chemical modification of the 5S RNA A- and B-conformers are presented in Figs. 1 and 2. A summary of the data obtained from a series of such experiments is given in Table I. To avoid artifacts due to secondary cutting and structural alterations as a consequence of early modification or hydrolysis events, two precautions are followed: (1) All limited enzymatic hydrolysis experiments are performed with 3'- and 5'-end-labeled 5S RNA samples and only those results obtained in both types of experiments are considered as valid. (2) Enzyme ranges or modification kinetics are chosen keeping the number of hits per 5S RNA molecule close to one. The structural conclusions drawn from these results have led to detailed secondary structural models of the 5S RNA A- and B-forms (see Fig. 3).
5S RNA Tertiary Structure In addition to secondary structural information a number of nucleotides can be inferred from the data presented in Table I which are probably 23 R. Wagner and R. A. Garret't, Nucleic Acids Res. 5, 4065 (1978). 24j. Hancock and R. Wagner, Nucleic Acids Res. 10, 1257 (1982). 2s C. Szymkowiak and R. Wagner, Nucleic Acids Res. 13, 3953 (1985).
[50]
5S RNA STRUCTURE AND FUNCTION
733
involved in tertiary interactions. Evidence for such a notion is obtained if one takes into account the different specifieities of the structural probes. In particular, the reaction of the V~ enzyme in combination with the action of single-strand-specific probes point to the fact that the corresponding nucleotides are involved in tertiary interactions V~ recognizes base-paired stem regions and certain tertiary base-base hydrogen-bonded regions. 26 Examples are C27 (DMS reactive and V~ cut in the B-form) or G54, G69, and G98 (T~ cuts and Vi cuts in the B-form). The results from intramolecular cross-linking studies are especially helpful for the construction of any tertiary structural model. Isolated 5S RNA in the A-form results specifically in the high-yield cross-link between bases G41 and G72. 24 The same cross-link is not found in the B-form of the molecule. The spatial neighborhood of these two nucleotides should be accounted for in any 5S RNA tertiary structural model. The combination of the structural data presented in Table I, the crosslinking results, and the application of a recently discovered folding principle for RNA has led to the proposal of pseudoknotted tertiary structural models for the 5S RNA A- and B-forms (see Fig. 4). The arguments in favor of such structures are outlined in detail by Grringer and Wagner. 27 5 S R N A - Protein Interactions
Most of our knowledge of the RNA-protein contact sites between 5S RNA and the direct binding proteins L5, L18, and L25 is based on limited enzymatic digestion and chemical modification studies of isolated 5S RNA-protein complexes. These data have been described and reviewed extensively in the past. 28-3° The methods of investigation outlined here are well suited for such studies because under the limited enzymatic digestion, chemical modification, as well as the cross-linking conditions, no noticeable structural alterations can be observed for the components to be investigated. As an example, we would like to mention the results of an in situ cross-linking experiment where a contact region of the ribosomal protein L25 is identified within the 5S RNA structure. A fragment comprising the sequence region U103 to Ul20 was covalently linked to the protein, demonstrating a close spatial neighborhood between the corresponding nucleotides and the protein L25 within the ribosome. Two other fragments (U89 to G106 and A34 to G51) showed marked alterations in the chemical modification pattern but no evidence for a direct protein contact was 26 R. E. Lockard and A. Kumar, Nucleic Acids Res. 9, 5125 (1981). 27 H. U. Grringer and R. Wagner, Nucleic Acids Res. 14, 7473 (1986). 2s S. Douthwaite, R. A. Garrett, R. Wagner, and J. Feunteun, Nucleic Acids Res. 7, 2453 (1979). 29 R. A. Garrett and H. F. Noller, J. Mol. Biol. 132, 637 (1979). 3o S. R. Douthwaite, A. Christensen, and R. A. Garrett, Biochemistry 21, 2313 (1982).
A-U-G ~--
A
C
C
/
40 C<~-
C
C
G
/
/
~c
A~ I A
/
C-C-A \
I
I\I*I
C
U
30 \ G
C
A */\ G 50 \ 60 A \ C
I*I\ G 20\fig *I C
\
c
'<[
/ C
1
C
I
II
AA/ / I
G I G /
G I
---4>A
!
C
\ G
A A
U
7\
c
@
I
~\
/
/ A-G
1 U
I
C-G-C-C-G\ I
A <~
70
I
G-A-U-G-G/ *\I>
A
@
*
A
G - A <~-*
U-G-C-C- U-G-G-C-G-G • * * * * * * * * *\ A-C-G-G-A-C-C-G-U-C i0 120-U
/ C
G \
I
*
/
U-C
U
I*I
G
A
•
C
\ G
U
I
/
G
I
/~C)
U
°®
I , * , / G G i \ , \ .A~,,-, A /A~ U U \ , \ G A G I \ ~ \ , \ A i00 W" C G G
@
/
/
\C* \G
," '<
®
C
90
/
\
U I
t"
U-C
FIG. 3. Secondary structural models of 5S RNA A- and B-forms. Secondary structures of the A- and B-conformers, where the different aocessibilities for the single- and double-strandspecific probes have been considered in a folding program according to Stfiber [K. StQber, Nucleic Acids Res. 14, 317 0986)]. A and B indicate the different conformers. The helical
~ d
¢l-U-6
B
"~
6-U-CI\ G
/
@
C
,
\
---~U
C 13
\ / G \
2O
A
U A /
C
~
G
II
\<
I
°
',
I
I
/x A/ 'i iI /
.I.
~/
°
\~',/
/"71
C' \G Q
A
C
G
\/
G
U
/ ~ ~G U G Ut G A I ~o .i-/
A
\
" ~ L~
O \
I A
c
I
d\
G
A
~v'~ C
90
I""~ u ~,G\
70 E;O
, -+,,, D;A
\G \
°
~
/ ~
~C-C-G-~-U-G\A--
A i
@ G
~
/ix , \
/G
U-C
50
G4
'//
*'
A C G G ~ C C G U C 10
I
A
\ A
// \C \t~/ / / \ / / \
U-G-C-C-U-G-G-C-G-G
120-U
G
\C
G U
i
/
~ I \
Q
~.~1/ \
<©
G/
C
/ \ / 30
I
A
A
/ ~ /
\
'
I
40 C ~ I
C/
C
G
\ C
C
--
/
,< I
®
Q
C
C-G-C-G0
t
U~ I ' ' 4
u-c
G
/ A G
/too
T1
$1 CVE DEP
t>
DMS structures arc indicated by encircled roman numerals (I to IV). Single-stranded regions are characterized by encircled letters (A to G). The sites of accessibility of the various structurespecific probes are indicated by arrows. Symbols arc explained at the bottom of the fight panel; CVE is V r
736
GENETICS
A
8
3' ,
[50]
I 5'
S'
3'
8
3' 3' Ill
'v U t ,,l
~ ~v
FIG. 4. Proposal of pseudoknotted tertiary structures for the 5S RNA A- and B-forms. The secondary and tertiary structural information obtained with the different stru~ural probes is compatible with and suggestive of tertiary models containing pseudoknots. The upper panels show schematic models of the A- and B-form structures while the lower panels show the schematic base pairing of these structures. The 3'- and Y-ends of the RNA chains and the helical domains I to IV are indicated. Arrows point to the tertiary interactions that lead to pseudoknot formation. The pseudoknot for the A-form arises by parallel tertiary base pairing of nucleotides C35-C37 with Gl05-G107. Thereby, helix Ill is extended by coaxial stacking. Pseudoknot formation for the B-form can be described by a coaxial stack of a helix formed by the interaction of C37-U40 with A94-G98 (C97 being unpaired) and the truncated helix IV. This structure is extended by an additional base pair between C35 and G100 and thereby connected with helix III.
[50]
5S RNA STRUCTUREAND FUNCTION
737
obtained. Details of the analysis are presented by Szymkowiak and Wagner. 25 Genetic Approaches The structural studies described above (see Biochemical Approaches) have provided a catalogue of nucleotides, potentially playing a key role for the maintenance of the structure and for a proper interaction of 5S RNA and the binding proteins L5, L18, and L25. In addition, chemical modification of ribosomes in the absence and presence of bound tRNA has helped to identify nucleotideswithin the 5S RNA sequence with possible implications for tRNA-binding activity.12 To explore whether and how the various nucleotides exhibit their influence on the structure and function of the molecule, we decided to construct a number of base change mutations within the gene for E. coli 5S RNA. After expression of the mutated RNAs, we were able to test the effects of the base changes for structural and functional impairments of the molecule. Oligonucleotide-Directed Mutagenesis of 5S RNA
The method of in vitro mutagenesis using small synthetic oligodeoxynucleotides has been described in several detailed reviews. 3~,32We followed the strategy published by Norris et ai. 33 using two primers. The mutagenic oligonucleotides and sequencing primers are synthesized according to the phosphite triester method. ~4 Host strains used: HB 10135; JM 101, JM 10336,37; CSR 6033s; WM 1 151. 39
Vectors used: MI3 mpl0, mpl8, m p l 9 (BRL Inc.); pKK35354°; pKK223-34~ ; pLSK 34-1, a pK-01 derivative,42 was kindly provided by R. K611ing. 31 M. J. Zoller and M. Smith, this series, Vol. 100, p. 468. 32M. Smith, Trends Biochem. Sci. 7, 440 (1982). 33 K. Norris, F. Norris, L. Christiansen, and N. Fiil, Nucleic Acids Res. 11, 5103 (1983). UM. D. Matteucci and M. H. Caruthers, J. Am. Chem. Soc. 103, 3185 (1981). 35 F. Bolivar and K. Backmann, this series, Vol. 68, p. 245. 36j. Messing, Recomb. DNA Tech. Bull. 2, 43 (1979). 37j. Messing, R. Crea, and P. A. Seeburg, Nucleic Acids Res. 9, 309 (1981). 3s A. Sancar, A. M. Hack, and W. D. Rupp, J. Bacteriol. 137, 692 (1979). 39R. Brent and M. Ptashne, Proc. Natl. Acad. Sci. U.S.A. 78, 4204 (1981). 4oj. Brosius, T. J. Dull, D. D. Sleeter, and H. F. Noller, J. Mol. Biol. 148, 107 (1981). 41 j. Brosius and A. Holy, Proc. Natl. Acad. Sci. U.S.A. 81, 6929 (1981). 42 K. McKenny, H. Shimatake, D. Court, U. Schmeissner, C. Brady, and M. Rosenberg, in "Gene Amplification and Analysis" (J. G. Chinikjian and T. S. Papas, eds.), Vol. 2, pp. 383- 415. Elsevier/North-Holland, Amsterdam, 1982.
738
GENETICS
[50]
Enzymes: DNA polymerase (large fragment) and T4 polynucleotide kinase are available from BRL Inc. T4 DNA ligase and all restriction enzymes are available from New England Biolabs. Radiochemicals: [a2p]orthophosphate, [~,-32p]ATP, [a2p]pCp and [7-35S]dATP are obtainable from Amersham Buchler. The 5S RNA positions G41, A66, and UI03 are selected for directed mutagenesis. They are altered by the following transversions: G41 to C, A66 to C, U103 to G. Construction of the point mutants is summarized schematically in Fig. 5. Hybridization of Mutagenic Oligonucleotides. To obtain the desired base changes, the mutagenic oligonucleotides with a single mismatch are hybridized together with a universal M 13 primer oligonucleotide to M 13 single-stranded DNA (ssDNA). The ssDNA contains an insert with the coding sequence for the 5S RNA (SalI-BamHI fragment, isolated from the plasmid pKK3535). Twenty picomoles of either one of the 5'-phosphorylated oligonucleotides 5'A-C-C-C-C-A-T-C-C-C-G-A-A-C-T-C-A-G-3', 5'A-C-G-C-C-G-T-C-G-C-G-C-C-G-A-T-G-3', or 5'A-T-G-C-G-A-G-AG-G-A-G-G-G-A-A-C-T-3' (mismatched nucleotides are underlined) are annealed together with 20 pmol of M 13 sequencing primer in 20 m M Tris-HC1, pH 7.5, 10 m M magnesium chloride, 50 m M sodium chloride, l m M D T T in a total volume of 10/zl by heating for 5 min at 55 ° followed by 5 min incubation at 23 °. Extension-Ligation Reaction. To l0/zl of the hybridization mixture an equal volume of 20 m M Tris-HC1, pH 7.5, 10 m M magnesium chloride, l0 m M DTT, 1 m M each of the four dNTPs, 1 m M ribo-ATP, 4 units E. coli DNA polymerase, and 400 units T4 DNA ligase are added. The mixture is incubated at 15 ° for 8 hr and directly used to transform competent JM 101 cells. 43 Screening and Characterization of Mutations. ssDNA is isolated from single plaq~es and the radioactively labeled mutagenic oligonucleotides are used for dot blot hybridization according to ZoUer and Smith*~ to identify positive mutants. The discrimination temperatures are 54 ° for the C41, 60 ° for the C66, and 62 ° for the G103 mutation. The C66 mutants can additionally be identified by the loss of a HaeII restriction enzyme recognition site. The mutations are finally verified by DNA and, in the case of the C41 mutation, by RNA sequencing.4~,~s 43 M. Dagert and S. D. Ehrlich, Gene6, 23 (1979). M. J. ZoUer and M, Smith, Nucleic Acids Res. 10, 6487 (1982). 45 H. U. G6ringer, R. Wagner, W. F. Jacob, A. E. Dahlberg, and C. Zwieb, Nucleic Acids Res. 12, 6935 (1984). • s H. U. Grdnger and R. Wagner, Biol. Chem. Hoppe Seyler 367, 769 (1986).
[50]
5S R N A STRUCTURE AND FUNCTION
739
f~ ~ISOLATE \ S A L I I BAMHI ~RAF.C.IENT
CUT SAL]/BAMHI
i
LIGATE
5S RNA
TRANSFORM
TWOPRIMER MUTAGENESIS ANNEAL
a4~z
m
•
t
.,,SALJ
P HO
ISOLATE ZLEARPLAQUES ( INSERT)
t ,¢,,}
~ EXTEND LIGATE
TRANSFORM
b
PLAQUES
ISOLATE BAMHII SALI FRAGMENT
LIGATE / TRANSFORM
ISOLATE MUTANTS
FIG. 5. Scheme for the construction of ofigonucleotide-directed point mutations. From Ref. 45.
740
GENETICS
[50]
Cloning of Mutated 5S RNA Genes in the Expression Vector pKK3535. M 13 RF DNA from mutant clones is cut with the restriction enzymes SalI and BamHI and the corresponding fragment which contains the mutated 5S RNA gene is isolated. The linear DNA from the plasmid pKK3535, lacking the above SaII-BamHI fragment, is obtained by two partial digestions as described by G6ringer et al. 45 and ligated to the fragment containing the mutated 5S RNA gene. The resulting plasmids are used to transform HB 101 or CSR 603 cells. The mutated 5S RNA genes are transcribed in these systems from the normal ribosomal RNA promoters. For selective expression and labeling of the mutated 5S RNAs encoded on the plasmids, without transcription of the chromosomally encoded wild-type 5S RNAs, the maxicell procedure according to Stark et aL47 is used. Bisulfite-Catalyzed Transition Mutations within the 5S RNA Gene. Bisulfite catalyzes the deamination of cytosine to uracil in single-stranded DNA and can therefore be used for the construction of random C to U or G to A transition mutations within a target sequence, depending whether the coding or noncoding DNA strand is exposed. 4s To obtain the 5S RNA gene in single-stranded form, the heteroduplex DNA with the singlestranded 5S DNA either on the coding or noncoding strand is constructed according to the scheme in Fig. 6. Construction of Heteroduplex DNA. A 86 l-base pair DNA fragment encoding the ribosomal 5S RNA and the two ribosomal RNA transcription terminator structures is cut from the plasmid pKK223-3 with the restriction enzymes RsaI and EcoRI. The fragment is cloned into the EcoRI/ Sinai sites of either M 13 mp 18 or mpl 9 RF DNA, yielding 5S RNA inserts in both orientations. The heteroduplex DNA is obtained by mixing the ssDNA of M 13 mp 18 or mpl 9 which contains the 5S RNA insert together with EcoRI/SmaI linearized M 13 wild-type RF DNA. The mixture containing 5/~g linearized M 13 RF DNA and 2.5/~g ssDNA with the 5S DNA insert is heated in 0.1 ml 150 m M phosphate buffer, pH 6.8, for 3 min at 98 °. After incubation for another l0 min at 60 °, the samples are chilled rapidly on ice. Sodium Bisulfite Reaction. The bisulfite-catalyzed deamination reaction is performed as described by Shortle and Botstein. 4s Three hundred microliters of a freshly prepared 4 M sodium bisulfite solution, pH 6 (136 mg sodium bisulfite, 64 mg sodium sulfite in 430/~l water) is added together with 16/~l of a 50 m M hydroquinone solution to 100/A heteroduplex DNA at 0 °. The samples are incubated in the dark at 37 ° for 15, 60, or 140 min, respectively. The reaction is stopped by three consecutive dialysis 47 M. J. R. St,~rk, R. L. Gourse, and A. E. Dahlberg, J. Mol. Biol. 159, 417 (1982). 4s D. Shortle and D. Botstein, this series, Vol. 100, p. 457.
[50]
5S R N A STRUCTURE AND FUNCTION
741
EcoRI ~sa ]
EcoRIIRsal DIBEST
ISOLATE EcoRI/RsoI FRAGMENT( 861bp) ~ CLONEINTO M13mp1B/mp19 EcoRIss T1T2 SmaI
!SOLATESS DNA 5S
Eco R I
Sma
,,< DENATUREI RENATURE
EcoRI
5S
EcoRI
Smal
5S
Smol
BISULFITE
MUTAGE~_v
~ FILLING REACTION
E c o ~
TRANSFORMATION (JMI03)
I
~ - -
FIG. 6. Scheme for the construction of bisulflte-catalyzed transition mutations.
742
GENETICS
[50]
steps against 1000 volumes 5 m M phosphate buffer, pH 8.0, 3 m M hydroquinone for several hours. The dialysis is followed by a 12-hr incubation with 100 m M Tris base at 37 °. The DNA is subsequently precipitated with ethanol. Strand Filling Reaction. The bisulfite-modified heteroduplex DNA molecules are converted to double-stranded DNA by an in vitro polymerase reaction. The DNA samples are dissolved in 48 #l 7 raM Tris-HC1, pH 7.5, 7 mM magnesium chloride, 50 mMsodium chloride, 1 mMDTT. One microliter of 2.5 m M dNTPs mixture and 5 units ofDNA polymerase (Klenow fragment) are added, and the samples are incubated at 37 ° for 80 rain. Aliquots from this mixture are used to transform competent JM 103 cells. Identification of Mutants. For the identification of mutants ssDNA from different clones is isolated and subjected to single base sequencing (A-track) according to Sanger et al.49 Mutations can be recognized by a change in the number of A bands. Clones where mutations can be verified are finally characterized by a complete DNA sequencing of the total 5S RNA gene. Cloning of Bisulfite-Mutagenized 5S RNA Genes in the Expression Vector pLSK 34-1. The RF DNA from mutant clones is cut with HindII and HindIII, and a 768-base pair DNA fragment containing the 5S RNA gene is isolated. It is ligated into the EcoRV/HindIII opened vector pLSK34-1. Transcription of the 5S RNA gene is thus under the control of the inducible tac promoter,s° The resulting vectors are used to transform WM 1151 cells where the 5S RNA gene can now be conditionally expressed by the addition of isopropylthio-fl-D-galactoside (IPTG). Protein-Binding Assay. Radioactive 5S RNA is isolated after maxicell labeling and renatured according to G6ringer et al.t2 Due to a difference in the electrophoretic mobility, 5S RNA from the bisulfite mutants can be separated from wild-type 5S RNA and radioactively labeled at the 3'-end using [32p]pCp and polyrmcleotide ligase. The molecules are then renatured to obtain the A-conformer. The ribosomal proteins L5, L 18, and L25 were a generous gift of Dr. J. Dijk. They had been isolated under nondenaturing conditions which ensured high RNA-protein binding. The nitrocellulose filter-binding method according to Spierer et al. 5t is employed to determine the apparent binding constants between the mutant 5S RNAs and the binding proteins. 49F. Sanger, S. Nicklen, and A. R. Coulson, Proc Natl. Acad. Sci. U.S.A. 84, 5463 (1977). S°H. A, DeBoer, L. J. Comstock, and M. Vasser, Proc. Natl. Acad. Sci. U.S.A. 80, 21-25 (1983). 51p. Spierer, A. A. Bogdanov, and R. A. Zimmermann, Biochemistry 17, 5394 (1978).
[50]
5S RNA STRUCTUREAND FUNCTION
743
tRNA and mRNA Affinity of Ribosomes Containing Mutated 5S RNAs. Radioactive 70S ribosomes are isolated after maxicell labeling. Their affinity for poly(U) is measured in the presence and absence of Phe-tRNA by determining the absorption of the ribosomes to poly(U) which has been covalently linked to agarose. One to 30 pmol of 70S ribosomes is incubated with 100 to 250/sg poly(U) coupled to agarose [AG poly(U) TM, PL Biochemicals] in 10 mM Tris-HCl, pH 7.8, 10 m M magnesium chloride, 6 mM 2-mereaptoethanol. The incubation is performed in the presence or absence of 20 to 200 pmol Phe-tRNA for 20 rain at 37 ° with gentle mixing. The mixture is washed through a siliconized 1-ml Eppendorf pipet tip, blocked with siliconized glass wool. The agarose is washed with 10 m M Tris-HCl, pH 7.8, 160 m M ammonium chloride, 10 m M magnesium chloride, 6 m M 2-mereaptoethanol until the wash is free of radioactive material. Ribosomes still bound to the poly(U)-agarose are released by washing with 10raM Tris-HC1, pH 7.8, 30 m M ammonium chloride, 15 rnM EDTA, 6 mM 2-mercaptoethanol and quantified by (~erenkov counting. Results and Discussion
In vitro mutagenesis methods have made it possible to obtain a number of base change mutations in the gene for the ribosomal 5S RNA. Oligonucleotide-directed mutagenesis has yielded three point mutants. These transversions have been placed at crucial sites within the 5S RNA structure: G41 (G to C), A66 (A to C), and U103 (U to G). Random bisulfitecatalyzed mutations within the gene for the 5S RNA have, on the other hand, provided a catalog of single, double, and multiple transition mutations. Table II lists a series of G to A mutants which have been characterized by sequencing the complete 5S RNA gene. Structural Effects of Base Change Mutations within the 5S RNA The point mutants at positions 41, 66, and 103 were either expressed in normal HB 101 cells or, after radioactive labeling, in CSR 603 maxicells. In all three cases the mutant RNAs were transcribed from the normal ribosomal RNA promoters and processed normally. They were furthermore incorporated into ribosomes and the isolated RNAs could be interconverted between A- and B-form as the wild-type 5S RNA. For one of the mutants (G41 to C41), a detailed structural analysis employing limited enzymatic digestion and chemical modification studies was performed. No noticeable structural difference w a s d e t e c t e d . 45 A detailed structural characterization of the C66 and GI03 mutant RNAs has not yet been performed. The bisulfite-catalyzed transition mutants were transcribed after induc-
0
m
r~
g _
tO ~J
o-~
: : : : ; Z Z : Z : :
~J
t~
L)
: : : : :~:
: : :~
t~ ~J ~J
: Z : : : : Z : : : :
N
&
~-~
iiiiiiiii?i ~J
:
:
Z :
:
Z :
:
:
:
:
!?!ii!iiiii o ~J
~-~ [...i ~J
0-8 [.-i
S-~ : : : : : : : ~ rj
L I I I I I I I I I I
•
[50]
5S RNA STRUCTURE AND FUNCTION
745
tion with IPTG. Due to defective processing (the mutant RNAs were 1 to 2 bases longer than the wild-type 5S molecules), the mutant RNAs could be separated from the wild-type on polyacrylamide gels. Normal interconversion between A- and B-conformers of the different mutants was taken as a minimal structural requirement for the further investigation of impairments in the recognition of the direct binding proteins L5, LI8, and L25. This criterion was fulfilled by all the mutants presented in Table II.
M u t a n t R N A - Protein Interactions
The apparent association constants for the various RNA mutants and the different binding proteins were determined by the filter-binding assay. Striking results are obtained for some of the mutants where nucleotides in the putative binding sites for the proteins L18 and L25 are changed. The base change UI03 to G, for instance, which is localized in the direct contact site to the protein L25, does not alter the RNA-protein association constant significantly. In contrast, the L25-5S RNA interaction is markedly increased when A66 is changed to a C. This base change is located in helix II, for which we had until now no evidence for a direct interaction with L25. The base change A66 to C was expected, on the other hand, to have a pronounced effect on the binding of the protein L 18. From the chemical modification experiments, 52 it was concluded that the unpaired and highly conserved nucleotide A66 must be directly involved in the binding of L18. The binding constants obtained with 5S RNA containing the base change A66 to C, however, do not support the conclusion that this particular base is indispensable for protein recognition. However, a similar mutation constructed by Christiansen et aL, 53 where A66 had been deleted, showed a 7- to 8-fold decrease in the LI 8 binding constant. Table III summarizes some of the binding data obtained with different mutants. It is apparent that the binding constants for LI8 and L25 exhibit some relation to the stability of helix II of the 5S RNA. An increasing number of mutations with destabilizing effects on helix II have only a limited effect on the association constants for L18, although helix II is considered to be in direct contact with the protein. However, the binding of L25 seems to be directly related to the stability of this RNA domain (Note for instance that an increase in the helix II stability also leads to an increase in the binding constant.)
52 D. A. Peattie, S. R. Douthwaite, R. A. Garrett, and H. F. Noller, Proc. Natl. Acad. Sci. U.S.A. 78, 7331 (1981). 53 j. Christiansne, S. R. Douthwaite, A. Christensen, and R. A, Garrett, E M B O J. 4, 1019 (1985).
746
[50]
GENETICS
×
×
×
X oo
O
×
X
×
×
e~
c~
z<
I
I
z o o z
I q
z
L
N z<
oi
I
I
I
[
DI
N --I
I
I
I I h
I I I
J
I
I
I
t~ 0
I I
I
<
z
I
.<
/
o
I
I
I
I
I
L
I
I
I 1
I I
D <
I b
"O
I
c~
I I I
[50]
5S RNA STRUCTUREAND FUNCTION
747
TABLE IV AFFINITY OF RIBOSOMES CONTAINING MUTATED 5S RNA FOR poly(U) AND Phe-tRNA a 5S RNA mutant
Poly(U)
Poly(U) + Pbe-tRNA
Wild type pC41 pC66 pG103
11.9 4.6 7.2 14.2
17.9 5.9 7.0 14.0
Difference 6.0 1.3
a The numbers indicate the percentage of ribosomes retained on the affinity supports. Values are averaged from three independent experiments.
Effect of 5S RNA Point Mutations on the tRNA and mRNA Affinity of 70S Ribosomes The affinity of ribosomes containing the 5S RNA point mutations C41, C66, and G103 for poly(U) and Phe-tRNA was investigated. The binding assays were performed with 32p-labeled ribosomes isolated from maxicells. Table IV shows the relative tRNA- and poly(U)-binding activities of the mutants compared to wild-type ribosomes. It is apparent that all three mutants show significantly reduced tRNA-binding activities in the in vitro assay, while for the mutants C41 and C66 the low binding oftRNA can be explained by a strongly reduced affinity for poly(U); the mutant G103 shows the same affinity for the synthetic message as the wild-type ribosomes. These results have also been confirmed with nonradioactive ribosomes isolated from normal cells, where about 50% wild-type ribosomes must be considered as background. These types of experiments may be very helpful in the future, especially if more point mutants are assayed, to assess the functional importance of 5S RNA for protein synthesis in greater detail.
748
GENETICS
[S 1] C l o n i n g a n d I d e n t i f i c a t i o n o f R i b o s o m a l Genes in Chloroplast DNA B y ANASTASIA PROMBONA, Y A S U N A R I O G I H A R A , A L A P R . SUBRAMANIAN
[51]
Protein and
A distinct 70S class of ribosome in the chloroplasts of higher plants was first reported in 1962.~ Work thereafter has shown that these ribosomes are constructed from 4 rRNAs (23S, 16S, 5S, and 4.5S) and approximately 58 ribosomal proteins (r-proteins). 2 The rRNA and about 20 of the r-proteins are encoded in the DNA of the organelle but the remaining r-proteins necessary to complete ribosome assembly are encoded in the nuclear genome. Therefore, eft]dent synthesis and assembly of the chloroplast ribosome require a regulatory step connecting two genomes in two different cellular compartments. The chloroplast DNA of higher plants is composed of between 1.2 and 1.6 X 105 nucleotide base pairs (depending on the plant family) and it occurs in the form of covalently closed supercoiled circles (Mr 8 0 100 X 106). Several hundred chloroplast DNA molecules (identical in sequence but not necessarily in conformation) occur in a chloroplast, and a leaf cell contains many chloroplasts. 3 Hence the content of chloroplast DNA is an appreciable part (15 - 20% generally) of the total leaf cell DNA. Chloroplast DNA is a convenient source for isolating clones of ribosomal protein genes. Many restriction enzymes cut chloroplast DNA into a relatively small number (-20) of fragments of suitable length for cloning. 4.5 Nearly all the chloroplast-encoded r-protein genes have been identified in several plants (see Appendix) and, therefore, a newcomer to the field can obtain clones from other laboratories for use as gene probes. Because of their relatively conserved nucleotide sequence, such gene probes from one plant are suitable for isolating the corresponding genes from any other plant. Finally, chloroplast DNA is a rich source of r-protein genes: there is, on the average, one r-protein gene per 7 kilobase (kb) of chloroplast DNA, as compared to one r-protein gene/100 kb ofEscherichia coli DNA. In this article, we describe methods which are suitable for isolating chloroplast DNA, cloning it into commercially available plasmid vectors, J. W. Lyttleton, Exp. CellRes. 26, 312 (1962). 2 A. R. Subramanian, Essays Biochem. 21, 45 (1985). 3 j. K. Hoober, "'Chloroplasts." Plenum, New York, 1984. 4 j. R. Bedbrook and L. Bogorad, Proc. Natl. Acad. Sci. U.S.A. 73, 4309 (1976). s j. D. Palmer, this series, Vol. 118, p. 167. Copyright© 1988by Aca~'mi¢Press,Inc. METHODS IN ENZYMOLOGY, VOL. 164 All fightsof reproductionin any formreserved.
[51 ]
CHLOROPLAST RIBOSOMALPROTEINGENES
749
and for screening, identification, and fine mapping of clones which carry r-protein genes. A wider treatment of the cloning and physical mapping problem with respect to plastid DNA is given in Vol. 97 of this series. 6 Isolation of Chloroplast DNA and Restriction Analysis The method described below involves breaking leaf cells in the presence of an osmoticum and isolating intact chloroplasts by sedimenting them to a Percoll interphase. The chloroplasts are then lysed, and the supercoiled DNA is banded (away from any chromosomal DNA) in a CsC1/ethidium bromide gradient in an ultracentrifuge.
Plant Source Leaves generally available in the market, e.g., spinach (Spinacia oleracea) and lettuce (Lactuca sativa), are suitable material for chloroplast DNA isolation, but for most other plants and for year-round availability, it is more convenient to grow them in a growth chamber where temperature, light, and humidity are regulated (e.g., Puffer-Hubbard Environmental, Weaverville, NC; Weiss Technik, West Berlin, FRG). Seeds are planted in water-soaked vermiculite contained in plastic trays or dishpans (25- 30* for maize, 16-22" for rye or spinach) under 16-hr-day white light (5000 lux) illumination. To avoid fungal attack, it is preferable to buy seeds pretreated with a fungicide, but if necessary, seeds can be disinfected by a short (5-10 min) soaking in 3% calcium hypochlorite. Two to four hundred grams of seeds (e.g., maize, pea) grown for 8-12 days will yield enough green tissue for a chloroplast DNA isolation.
Materials Fresh leaves: 100-200 g Buffer A: 0.5 M sorbitol, 50 m M Tris-C1 (pH 8.0), 3 m M Na2EDTA (pH 8.0), 0.1% BSA, 1 m M 2-mercaptoethanol Buffer A': 0.44 M sorbitol, all other components as in buffer A Buffer B: 0.44 M sorbitol, 50 m M Tris-C1 (pH 8.0), 3 m M Na2EDTA (oH 8.0) Lysis buffer: 50 m M Tris-Cl (pH 8.0), 20 m M Na2EDTA (pH 8.0) Dialysis buffer: l0 m M Tris-Cl (pH 8.0), l0 m M KCI, 1 m M Na~EDTA (pH 8.0) L. Bogorad, E. J. Gubbins, E. Krebbers, I. M. Larrimm, B. J. Mulligan, IC M. T. Muskafitch, E. A. Orr, S. R. Rodermel, R. Schantz, A. A. Steinmetz, G. de Vos, and Y. K. Ye, this series, Vol. 97, p. 524.
750
GENETICS
[51 ]
TE buffer: 10 m M Tris-Cl (pH 8.0), 0.1 mMNa2EDTA (pH 8.0) 10X Restriction enzyme buffer: Follow instructions in the enzyme data sheet, or see pp. 53-57 of Davis et al. 7 20× TBE buffer: 1 M Tris base, 1 M boric acid, 20 m M Na2EDTA 6X Loading dye: 0.5% bromphenol blue, 0.5% xylene eyanole, 50% glycerol All buffers should be autoclaved (120 °, 15 min). BSA and mercaptoethanol are added after autoclaving. Other Materials. Percoll (Pharmacia), Sarkosyl, proteinase K, CsC1, ethidium bromide (10 mg/ml; H~O + drops of 0.1 N HC1), n-butanol (saturated with water), ethanol (absolute), 3 M sodium acetate (pH 5.2), cheese cloth, Miracloth (Calbiochem-Behring), Sorvall centrifuge (GSA and SA-600 rotors), ultracentrifuge (Beckman 50Ti or 60Ti rotor; quickseal polyallomer tubes), Waring blender, restriction enzymes SalI and PstI (Boehringer, BRL, or other suppliers), agarose, 2 Mr marker, horizontal submerged gel electrophoresis apparatus (normal 24 cm; minigel 10 cm), power supply, microwave oven, UV transilluminator, Polaroid camera.
Procedure
1. Remove stem and clean leaves thoroughly (cold tap water and 1× cold deionized water). For leaves from the market, 3 - 4 × tap water washing may be necessary. Keep leaves for 1 - 2 hr in a cold room to drain. Do steps 2 - 10 in the cold. 2. Add to each 100 g leaves 200 ml of buffer A. Chop leaves at the lower speed in a Waring blender for a few seconds. Then blend at the higher speed for 3 × 3 sec. 3. Pass the homogenate through 4 layers of cheese cloth and 2 layers of Miracloth. 4. Centrifuge the filtrate for 5 min at 170 g in a Sorvall GSA rotor a t 4 °. 5. Take out four-fifths of the supernatant and centrifuge it at 2000 g for l0 min (GSA rotor). Pour off the supernatant. 6. Add to the pellet 4.5 ml of buffer A' per 100 g of leaf. Suspend gently (use a small, sterile paint brush). 7. Apply 2.5-ml portions of the suspension, carefully, over a Percoll discontinuous gradient in Sorvall SAo600 tubes. The gradient consists of 11 ml each of 75, 40, and 10% Percoll, all in buffer A'. They are kept ready in the coldroom. 8. Centrifuge the gradients at 6700 g for 15 min at 4 °. L. G. Davis, M. D. Dibner, and J. F. Battcy, "Basic Methods in Molecular Biology." Elsevier, Amsterdam, 1986.
[51 ]
CHLOROPLAST RIBOSOMAL PROTEIN GENES
751
9. Remove the 10% and half of the 40% layers by aspiration. Take out the 40-75% PercoU interface band containing intact chloroplasts using a wide-mouthed pipet. Dilute it with two volumes of buffer B. 10. Centrifuge at 1500 g for l0 min in an SA-600 rotor at 4 °. 11. Suspend the pellet in 7.5 ml lysis buffer per 100 g leaves. Add Sarkosyl to 2% final concentration, and proteinase K to 200 #g/ml. Incubate at 37 ° for 1 hr with gentle shaking. At this point the digest may be stored at - 80 °, if necessary. 12. Add 1 g CsC1 per milliliter of the chloroplast suspension and ethidium bromide (10 mg/ml stock) to a final concentration of 600/zg/ml. 13. Transfer to 50 Ti (or 60 Ti) quick-seal ultracentrifuge tubes and centrifuge at 20 °, 97,000 g for 4 0 - 4 2 hr. 14. Examine the centrifuge tube quickly with an UV lamp. Two orange bands should be visible. Pierce the top of the tube (to admit air) and remove the lower (thicker) band, which contains supercoiled DNA, with a 5-ml sterile syringe ( 18-gauge needle) by piercing 2 - 3 m m below the band. 15. Extract ethidium bromide with water-~aturated butanol, 5 - 6 × (until the pink color totally disappears). 16. Dialyze the DNA solution (protected from light) against 1000× volume of dialysis buffer overnight at 4 °. 17. Precipitate the DNA by adding 0.1 volume of 3 M sodium acetate and 2.5 volumes of cold ( - 2 0 °) ethanol and keep at --20 ° overnight. 18. Centrifuge at 14,500 g for 15 min in a Sorvall SA-600 rotor (4°). 19. Dry the pellet(s) in a vacuum for 1 - 2 rain and dissolve in 0.1 ml of TE buffer per 100 g leaves. 20. Measure 0026 o n m and 0028 o nm (15 gl diluted to 300/tl with TE buffer). A2so/A26o ratio of 0.5 is expected. At the dilution used, the A260 reading is equal to the DNA concentration in micrograms per microliter. Expected yield is - 4 0 / t g DNA per 100 g of leaves (e.g., spinach).
Restriction Analysis of Chloroplast DNA The DNA preparation should be restriction analyzed to evaluate its quality (e.g., suitability for cloning) and the actual content of chloroplast DNA. This is done by digesting 1- 2/tg of the material with a restriction enzyme (e.g., Sail, PstI) that yields a limited number of fragments, separating the resultant fragments by agarose gel electrophoresis, and photographing the ethidium bromide-intercalated DNA fragments in UV light. Prepare the following reaction mix: 2/tl of appropriate 10× RE buffer 1 #g ofcpDNA 1 #1 of SalI or PstI (10 units) H20 to make 20/d
752
GENETICS
[51]
Incubate for 1.5 hr at 37 °. At this time, prepare a 0.8% agarose gel, containing 0.5/tg/ml ethidium bromide, in TBE buffer (see Davis et al., 7 pp. 58-61, for details). Add 4/tl of loading dye to the incubation mix and apply it carefully to a well in the gel. To an adjoining well apply 1 #g of M~ marker (e.g., 2 H i n d l I I E c o R I digest). Run overnight (room temperature) at 40 V. Photograph the gel (ethidium bromide-stained bands) using an UV transilluminator and camera (see Davis et al., 7 pp. 58-61 and 329-330, or Maniatis et al., s pp. 150- 162). The absence of a smeary background and the appearance of sharp distinct bands are criteria for the good quality of chloroplast DNA. Digestion of rye chloroplast DNA by S a i l produces 16 fragments (which are, however, resolved into only 12 bands) of Mr from 24 kb to less than 1 kb; digestion by PstI produces 13 fragments (12 bands) of Mr 30 kb to 1.5 kb. 9 Similar number of fragments are reported from other chloroplast DNAs when digested with these enzymes (e.g., maize, 1° wheat).'1 Cloning of Chloroplast DNA for Ribosomal Protein G e n e s Three approaches can be used to isolate clones of specific chloroplast r-protein genes. (l) Prepare a chloroplast DNA library with a limited number of clones and identify those that carry the r-protein genes of interest by means of colony-, dot-, or Southern blot hybridization. (2) Use a specific r-protein gene probe for colony hybridization on a shot-gun library. Here, restriction enzymes that cut chloroplast DNA into a large number of fragments can be used. (3) Identify a chloroplast DNA fragment on a Southern blot by using the available r-protein gene probe, this fragment can then be electroeluted out from a gel and cloned. Experimental methods for all three of these approaches are described below. Materials
Restriction enzymes and recommended 10X incubation buffers, T4 DNA ligase, vector DNA (e.g., pAT 153), calf intestinal phosphatase (CIP) (Boehringer), redistilled phenol containing 0.1% 8-hydroxyquinoline and equilibrated with Tris buffer, pH 8.0 (for details, see Maniatis et al., s p. 438; omit 2-mercaptoethanol), chloroform as 24:1 (v/v) mixture of chlos T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982. 9 A. Prombona and A. R. Subramanian, unpublished observations. ,o I. M. Larrinua, K. M. T. Muskavitch, E. J. Gubbins, and L. Bogorad, Plant Mol. Biol. 2, 129 (1983). ~ L. M. Bowman, B. Koller, H. Delius, and T. A. Dyer, Mol. Gen. Genet. 183, 93 (1981).
[51]
CHLOROPLAST RIBOSOMAL PROTEIN GENES
753
roform and isoamyl alcohol, 10X CIP buffer [500 m M Tris-C1 (pH 8.0) and I m M Na2EDTA], 10× Ligation buffer [500 m M Tris-C1 (pH 7.4), 100 m M MgC12, 100 m M dithiothreitol, 10 m M spermidine, I mg/ml BSA (nuclease-free; e.g., from BRL)], 10raM ATP (neutralized to p H - 7 . 0 ) , LB medium and LB agar,plates with appropriate antibiotics (100/tg/ml ampicillin, 15#g/ml tetracycline; see Maniatis et al., 8 (pp. 440-444), 1 M Tris-Cl (pH 8.0), nitrocellulose (Schleicher & Schuell BA85), Biodyne (1.2/zm pore size, Pall) or Colony/Plaque screen (New England Nuclear), X-ray film (Fuji RX, Kodak RX-5), Eppendorf centrifuge, Biotrap (Schleicher & Schuell), vacuum oven. Procedure
1. Digest 2/tg of chloroplast DNA with 10 units of PstI or 20 units of Sail in a total volume of 30- 50/zl at 37 ° for 2 hr. After digestion, heat at 65 ° for 15 min and place on ice. Dilute the reaction mixture with TE buffer to 100/zl and extract with an equal volume of 1 : 1 phenol:chloroform. Take the upper aqueous phase and precipitate the DNA with 0.1 volume of 3 M sodium acetate (pH 5.0) and 2.5 volumes of cold absolute ethanol at - 20 ° overnight. Centrifuge (Eppendor0 at 15,000 g for 20 min and discard the supernatant. Wash the pellet by adding 0.5 ml of cold ( - 2 0 °) 70% ethanol and centrifuging (15 min). Remove the supernatant carefully and dry the pellet in a vacuum for 2 - 3 min. Dissolve it in 15/zl of TE buffer (DNA concentration -0.1/zg//zl). Check the fragment profile and recovery by running 0.1 volume of the DNA solution on a 0.8 or 1.0% mini-agarose gel (2 hr, 50-100 V). 2. Digest 2/tg of vector DNA (i.e., pATI53) with 10 units of PstI or 20 units of SalI in 30- 50/zl total volume for 2 hr at 370. Check completion of digestion with 0.1 volume as in step 1. If digestion is complete (i.e., no visible bands of supercoiled or nicked circular vector molecules), isolate the DNA as in step 1. Dephosphorylate it with CIP (0.1 unit of CIP for 2/zg DNA; 30 rain at 37°). For vector digested with PstI (recessed 5'-termini) incubation with CIP must be repeated. The phenol-extracted and ethanolprecipitated DNA is dissolved in 15/zl TE buffer (check the yield on a 1% mini-agarose gel with 0.1 volume and comparing with a 2 marker band). 3. Mix together 100 ng of vector DNA and 500 ng of fragmented cpDNA. Heat to 65 ° for 10 min and chill to 0 °. Then add 2 #1 of 10X ligation buffer, 2/zl of 10 m M ATP, 0.5 to 1 unit o f T 4 DNA h'gase, and sterile H20 to 20/tl. Incubate overnight at 14 °. After reaction, heat the ligation mixture at 65 ° for 15 min and dilute to 100/zl with sterile H20. 4. E. coli (HB 101, DH5 etc.) is made competent according to Maniatis
754
GENETICS
[51 ]
et a l ) (p. 250) or Davis et al. 7 (p. 91). Competent cells can also be bought
from companies (e.g., BRL, Stratagene). Twenty microliters of the ligation mixture is used for transforming 200 #1 of competent cells. The remainder is stored a t - 20 ° in case a second transformation is necessary. Follow the transformation procedure supplied with competent cells or Maniatis et a l ) (p. 250). After transformation, 1 ml of LB medium is added and the cells are grown for 40 min at 37 °, and 100-200 #1 of the culture is plated out per Petri dish on appropriate antibiotic plates (ampicillin plates for Sail transformants and tetracycline for PstI transformants). The plates are incubated overnight at 37 °. 5. Using sterile toothpicks transfer - 2 0 0 colonies from the original plates to a tet plate and to an a m p plate, both marked underneath with an identical grid of numbers (1 to 50 or 1 to 100). Incubate overnight at 37 °. Insertion of a DNA fragment into the Sail cloning site of pAT153 inactivates its tet gene while insertion into the PstI site inactivates its a m p gene. Therefore, clones carrying insert DNA will grow only on one of the two antibiotic plates whereas those without inserts (from religated vector) will grow on both. 6. Pick up 2 0 - 50 recombinants (Sal clones from a m p plates, Pst clones from tet plates) and inoculate each into 5 ml of LB medium containing the appropriate antibiotic. Grow cells at 37 ° in a shaking water bath for 16-20 hr. Of the culture 1.5 ml is used for plasmid DNA isolation by a rapid method (see Maniatis et aL, s p. 368, or Davis et aL, 7 p. 102). The isolated DNA is digested with the appropriate restriction enzyme and analyzed on an agarose gel. Cultures of clones with fragments of interest are stored at - 20 ° (and at - 80 °) after making them 30% in sterile glycerol. If larger amounts of the insert DNA are to be used later (e.g., hybridization experiments), large-scale preparation and purification of the plasmid is made in a CsCI gradient (see Maniatis et al., 8 p. 86, or Davis et al., 7 p. 93). Comments
Enzymes that cleave chloroplast DNA into 15- 20 fragments are practical for the construction of chloroplast DNA libraries. Advantages are (1) fragments are large and are not lost during agarose electrophoresis, and (2) it is sufficient to analyze a small number of colonies for the expected 10- 15 distinct clones. The pUC family of vectors 12 can also be used for constructing chloroplast DNA libraries. In this case, recombinant clones form white colonies whereas the religated vector gives blue colonies; therefore step 5 above is
[51]
CHLOROPLAST RIBOSOMAL PROTEIN GENES
755
omitted. In cases where the restriction of the chloroplast DNA gives multiple fragments of the same size (inferred from the much greater intensity of some bands), clones containing these fragments can be recognized by their differing restriction pattern when digested with two or more restriction enzymes.
Colony Hybridization Clones carrying a chloroplast r-protein gene or gene cluster can be detected among a large number of other clones on a Petri dish by colony hybridization. 1. Prepare restriction fragments of chloroplast DNA (use BamH1 which generally yields 40-60 fragments) and linearized vector and carry out ligation and transformation as described in steps 3 and 4 above. The cells are then plated out on appropriate antibiotic plates and incubated at 37 ° for 8 - 1 2 hr. Autoclave and dry filter circles (Biodyne or Colony/ Plaque Screen, size slightly smaller than the Petri dish) by placing between folds of Whatman 3 MM paper, wrapped in aluminum foil. 2. Make two replicas from each original plate. For this purpose, place the membrane (handling it with forceps) carefully over the colonies. Mark using a syringe needle with India ink three positions identical on the filter and agar plate. Remove filters after 2 min and place them, colony side up, on fresh LB plates. Incubate for 6 - 1 6 hr at 37 °. Keep the master plate tightly sealed with Parafilm, in the coldroom. 3. Remove the filters with amplified cells from the Petri dishes and place them, colony side up, on 3 layers of 3 MM paper soaked with several milliliters of 10% SDS. Let lysis of the bacteria proceed for 3 min. The released DNA is then denatured and neutralized by placing the filters first on 3 MM paper soaked with 0.5 MNaOH/1.5 MNaCI and then on 3 MM paper soaked with 1.0 MTris-Cl (pH 7.4)/1.5 MNaC1, 5 min on each. The filters are then dried at room temperature and baked at 80 ° in a vacuum (see Maniatis et aL, 8 p. 314). 4. Hybridize the filters with radiolabeled ribosomal protein gene probe and autoradiograph (see below). Colonies which give strong signals (over a light background outline of nonhybridizing colonies) on both the duplicate filters are identified and picked from the master plate. Plasmid DNA from these clones is isolated and characterized by restriction analysis (step 6, above). 12C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985).
756
GENt.TICS
[51]
Cloning a Specific Chloroplast DNA Fragment The third approach to obtain a chloroplast ribosomal protein gene is to isolate a DNA fragment that hybridizes with a chloroplast r-protein gene probe and clone it. In some cases, e.g., when the probe is a synthetic oligonucleotide, this approach may be preferable to that of colony hybridization. (Recently we used this approach ~3 to isolate the exon-1 of maize chloroplast r-protein S 12.) 1. Digest chloroplast DNA (1 #g) with a restriction enzyme that gives a reasonably large number of fragments (e.g., BamHI, EcoRI). Make digests with 2 or 3 such enzymes and separate the fragments by electrophoresis on 1.2% agarose gel. Transfer the DNA to a nitrocellulose or nylon filter and hybridize it with the radiolabeled probe and autoradiograph (see below). The hybridizing band is identified by comparing the autoradiogram with a photograph of the gel. The enzyme which gives the lowest Mr single band is selected for cloning. 2. Digest 2 #g of chloroplast DNA with the selected restriction enzyme and electrophorese overnight. Stain with ethidium bromide (0.5/lg/ml in sterile H20), cut out the previously identified hybridizing band, and elute the DNA (see above). The isolated fragment is then cloned in a plasmid vector (see above). Identification of Ribosomal Protein Genes
Materials Denaturing solution: 0.5 M NaOH/1.5 M NaC1 Neutralizing solution: 1 M Tris-C1 (pH 7.2)/1.5 M NaC1 20>< SSPE: 3 M NaC1, 0.2 M NaH2PO4, 0.02 M Na2EDTA (pH 7.4, adjusted with 40% NaOH) 10× Nick translation buffer: 0.5 M Tris-C1 (pH 7.2), 0.1 M MgSO4, 1 m M dithiothreitol, 500/tg/ml BSA (nuclease-free) Autoclave solutions at 120" for 15 min (BSA and DTT are added afterward). Other Materials. Restriction enzymes, E. coli DNA polymerase I, DNase I (RNase-free), Sephadex G-50, formamide, calf thymus DNA (10 mg/ml stock prepared by dissolving in sterile H 2 0 and sonicating three times for 10 sec), dATP, dCTP, dGTP, and dTTP (10 m M stocks in sterile ~3K. Gicse, A. R. Subramanian, I. M. Larrinua, and L. Bogorad, J. Biol. Chem. 262, 15251 (1987).
[51]
C H L O R O P L A S T RIBOSOMAL PROTEIN GENES
757
H20 neutralized to pH -7.0), [ot-32p]dCTP or [ot-a2p]dATP of 3 Ci//tmol specific activity, sealable plastic bags, nitrocellulose, or Biodyne filter (0.2/zm pore, Pall), X-ray film, plastic bag sealer, shaking water bath, radioactive ink (e.g., 1 ml India ink + 0.1/~Ci t4C-labeled compound). Preparation of Probe DNA The probe DNA of known chloroplast ribosomal protein gene is normally obtained as a recombinant plasmid or M 13mp phage. If only a small amount of plasmid DNA is available, it is first used to transform E. coli (e.g., HB101, DH5, JM107), and after transformation 4 - 5 colonies are analyzed for the correct insert size. From the right clone prepare 2 - 5 #g of plasmid DNA (see Maniatis et al., 8 p. 368, or Davis et al., 7 p. 102). Digest an amount of plasmid DNA that contains 0.2 pg of insert DNA. Load the digest on a preparative gel, run overnight, and electroelute the insert band (see above). The DNA is finally dissolved in 10/tl of TE buffer. If the probe is obtained as an M13mp done, the replicative form (RF DNA) ~2 may be isolated and the insert recloned into a pUC vector and used as described above. Preparation of Filters 1. Digest 1/zg plasmid DNA from each of the chloroplast DNA clones that are to be examined for r-protein genes using appropriate restriction enzymes. 2. Apply the samples on agarose gel and electrophorese overnight. Photograph the gel with a ruler alongside it. 3. Denature DNA in 300 ml of 0.5 M NaOH/1.5 M N a C I (1 b_r) and neutralize in 300 ml of 1 M Tris-Cl (pH 7.4)/1.5 M NaCI (1 hr) by gentle shaking. Southern transfer the DNA from the gel to nitrocellulose or Biodyne filter (see Davis et al., 7 p. 64) using 20× SSPE buffer. The filter is finally baked at 80 ° in a vacuum oven and kept in a sealed plastic bag until use. 32P-Labeling of Ribosomal Protein Gene Probe 1. Set up a reaction mixture (on ice) as follows: 5/zl of DNA solution (-100 ng DNA), 5 pl of 10× nick translation buffer, 1/ll each of three 1 m M unlabeled dNTPs (made fresh from 10 m M stocks), 20-50/tCi of [ot-32P]dCTP or [ot-32P]dATP, 5 units ofE. coli DNA polymerase I, 0.05 ng DNase I (freshly diluted in chilled water), water up to 50/zl. 2. Mix and spin down (Eppendorf, 2 sec). Incubate at 16 ° for 1 hr. Stop the reaction by adding 2/tl of 0.5 M Na2EDTA (pH 8.0). Dilute to
758
GENETICS
[51 ]
100/A with TE buffer. Separate the labeled DNA from unincorporated dNTPs by centrifugation through a 1-ml Sephadex G-50 column in a disposable 2-ml syringe. The labeled DNA is collected from the bottom of the centrifuge tube (see Maniatis et aL,8 p. 466). 3. Denature the probe by adding 10 #1 of 1 M N a O H at room temperature for 15 min and neutralize with 20/tl of 1 M Tris-C1 (pH 7.2) just before use.
Hybridization and Autoradiography We have found hybridization in the following buffer at 37 ° (equivalent to 58 ° in water) very satisfactory with chloroplast ribosomal protein gene probes: 5× SSPE (use 20X SSPE stock), 0.5% SDS (use 10% stock), 100/tg/ml denatured calf thymus DNA (denatured just before use by keeping in boiling water both for 5 min and chilling in ice water), and 30% formamide. 1. The Southern or colony filter (see above) is first prehybridized by placing it in a sealable plastic bag, adding 5 ml of hybridization buffer, and sealing after removing air and incubating at 37 ° for 2 - 4 hr. 2. The bag is then cut open at a corner and the denatured radioactive probe is added. Reseal the bag after removing air and keep it at 37* (shaking water bath) overnight. 3. After overnight hybridization the filter is taken out and washed three times at 55-58 ° in 5X SSPE/0.5% SDS (each wash 300 ml, 30 min). It is then dried at room temperature on Whatman 3 MM filter and marked at 3 or 4 positions with radioactive ink. 4. The filter is autoradiographed on X-ray film for 1 hr or longer (several days), depending on the intensity of the signal. To prevent the filter from sticking to the film it is pasted on a suitable size Whatman 3 MM paper and wrapped in clear plastic. By comparing the autoradiogram with the agarose gel photograph the fragment(s) carrying the r-protein gene is identified.
Fine Mapping Normally the r-protein gene (or gene duster) is obtained on a chloroplast DNA fragment that is much larger than the gene itself. In this case the following procedure can be used to precisely localize the gene. 1. Digest the plasmid DNA from the clone with several restriction enzymes that have 6-nucleotide sequence recognition sites ("6-cutters"). Select enzymes that have only one or no cutting site in the vector. To distinguish the inner fragments of the insert, carry out two digestions: one
[5 1 ]
C H L O R O P L A S T RIBOSOMAL P R O T E I N GENES
759
with the 6-cutter alone, and a double digestion including the cloning enzyme. The bands belonging to inner fragments will be identical in both digestions. (Restriction is done with 400-600 ng DNA in 20 #1 reaction volume with the recommended incubation buffer and conditions.) 2. Transfer the DNA to nitrocellulose or nylon filter and hybridize with the radiolabeled r-protein probe, and autoradiograph. Based on the restriction map from the restriction patterns and the hybridization data, the gene is localized to a smaller segment. The subfragment that contains the r-protein gene can now be subcloned and used for nucleotide sequence determination, analysis of transcription in vivo and in vitro (by Northern blot analysis), and for the isolation of mature mRNA (by "hybrid selection") for identifying the translation product in vitro, etc. Experimental details of these procedures are beyond the scope of this chapter.
TABLE 1 IDENTIFIED AND SEQUENCED CHLOROPLAST RIBOSOMAL PROTEIN GENES Ribosomal protein S2 $3 $4 $7
Plant Pea (Pisum sativum)? 9 tobacco (Nicotiana tabacum)/4 Marchantia (Marchantia polymorpha)? s spinach (Spinacia oleracea) 2° Tobacco, 21 Marchantia,15 maize (Zea mays) 22 Maize, 23 tobacco,14 Marchantia, 15spinach25 Euglena (Euglena gracilis),25 tobacco, t4 Marchantia, 15maize,13
soybean (Glycine max) 26 $8 SII S12 S14 S15 S16 S18 S19 L2 LI4 L16 L20 L21 L22 L23 L33 L36
Tobacco, 21 Marchantia,15 maize27 Spinach, 2s, tobacco, 14 Marchantia, t5 maize)6 pea29 Euglena, 2~Marchantia, 3° tobacco, a~.32 maize, 13 soybean 26 Marchantia, 33 tobacco) 4 maize, 34 spinach, 35 pea ~ Tobacco) 4 Marchant ia, t5 maize, 16 rye (Secale cereale) 9 Tobacco, 37 maize 16 Tobacco, 14 Marchantia/5 Tobacco, 3s Nicotiana debneyi) 9 spinach, 39 maize, 4° Marchantia, 15 Tobacco, 21 Nicotiana debneyi) 9 spinach, 39 Marchantia,15 Tobacco, 21 Marchantia,15 maize27 Spirodela (Spirodela oligorhiza), 41 tobacco, 21 Marchantia,15 maize, 4~43 Chlamydomonas reinhardtii 44 Tobacco, 14 Marchantia, 15 Euglena, 45 maize 16
Marchantia, 15 Maize, 46 tobacco, 21 Marchantia, ~5 Tobacco, 21 Marchantia,15 Tobacco, 14 Marchantia/5 maize 16 Maize 17
760
OENETICS
[51]
Appendix In 1986 the complete nucleotide sequences of two chloroplast genomes (from tobacco and the lower plant Marchantia polymorpha) were published together with analyses of the number of proteins they may encode. 14,15Identities of the r-protein genes were inferred from similarities of decoded amino acid sequences to the known amino acid sequences of E. coli r-proteins. Such analysis showed that the genes for 18 r-proteins were present in both the genomes while genes for 2 r-proteins were present in one of the genomes but not in the other (L21 only in Marchantia~5; S16 in tobacco ~4 and in maizeS6). Recently, another open reading frame in the chloroplast genome, previously designated secX, has been identified to encode a ribosomal protein, namely L36) 7,n Thus the total number of the chloroplast r-proteins which are encoded in the organelle genome now stands at 20. Whether all these inferred genes (Table p9-~) are truly functioning entities of whether some of them are pseudogene sequences whose functional couterparts are actually in the nuclear genome is still an open question. In the case of L247 and L36, ~7 however, protein sequence data have added support to their functional nature. 14K. Shinozaki, M. Ohme, M. Tanaka, T. Wakasugi, N. Hayashida, T. Matsubayashi, N. Zaita, J. Chunwongse, J. Obokata, K. Yamaguchi-Shinozaki, C. Ohto, K. Torazawa, B. Y. Meng, M. Sugita, H. Deno, T. Kamogashira, K. Yamada, J. Kusuda, F. Takaiwa, A. Kato, N. Tohdoh, H. Shimada, and M. Sugiura, EMBO J. 5, 2043 (1986). 15K. Ohyama, H. Fukuzawa, T. Kohchi, H. Shirai, T. Sano, S. Sano, K. Umesono, Y. Shiki, M. Takeuchi, Z. Chang, S. Aota, H. Inokuchi, and H. Ozeld, Nature (London) 322, 572 (1986). 16A. R. Subramanian, G. Timmler, U. Markmann-Mulisch, and K. von Knoblauch, unpublishod observations. 17U. Markmann-Mulisch, K. von Knoblauch, A. Lehmann, and A. R. Subramanian, Biochem. Int. 15, 1057 (1987). isA. W a d a and T. Sako, J. Biochem. (Japan) 101, 817 (1987). t9A. L. Cozens and J. E. Walker, Biochem. J. 236, 453 (1986). 2o G. S. Hudson, J. G. Mason, T. A. Holton, B. Kollcr, G. B. Cox, P. R. Whitfeld, and W. Bottomlcy, J. Mol. Biol. 196, 283 (1987). 21 M. Tanaka, T. Wak.asugi, M. Sugita,K. Shinozaki, and M. Sugiura, Proc. Natl. Acad. Sci. U.S.A. 83, 6030 (1986). 22 W. E. McLaughlin and I. M. Larrinua, Nucleic Acids Res. 15, 4689 (1987). 23 A. R. Subramanian, A. Steinmetz, and L. Bogorad, Nucleic Acids Res. 11, 5277 (1983). 24 S. B. Tahar, W. Bottomley, and P. R. Whitfeld, Plant Mol. Biol. 7, 63 (1986). 25 P.-E. Montandon and E. Stutz, Nucleic Acids Res. 12, 2851 (1984). 26J.-M. von Allmen and E. Stutz, Nucleic Acids Res. 15, 2387 (1987). 2~K. Markmann-Mulisch and A. R. Subramanian, Eur. J. Biochem. 170, 507 (1988). 2s G. Sijben-MiiUer, R. B. Hallick, J. Alt, P. Westhoff, and R. G. Herrmann, Nucleic Acids Res. 14, 1029 (1986). 29 S. Purton and J. C. Gray, Nucleic Acids Res. 15, 1873 (1987).
[5 1 ]
CHLOROPLAST RIBOSOMAL PROTEIN GENES
761
30 H. Fukuzawa, T. Kohchi, H. Shirai, K. Ohyama, K. Umezono, H. Inokuchi, and H. Ozeki, FEBSLett. 198, 11 (1986). 31 H. Fromm, M. Edelman, B. Koller, P. Goloubinoff, and E. Galun, Nucleic Acids Res. 14, 883 (1986). 32 K. Torazawa, N. Hayashida, J. Obokada, K. Shinozald, and M. Sugiura, Nucleic Acids Res. 14, 3143 (1986). 33 K. Umesono, H. Inokuchi, K. Ohyama, and H. Ozeki, Nucleic Acids Res. 12, 9551 (1984). 34 B. R. Srinivasa and A. R. Subramanian, Biochemistry 26, 3188 (1987). 3s W. Kirsch, P. Seyer, and R. G. Herrmann, Curt. Genet. 10, 843 (1986). 36j. Lehmbeck, B. M. Stummann, and K. W. Henningsen, Nucleic Acids Res. 15, 3630 (1987). 37 K. Shinozaki, H. Deno, M. Sugita, S. Kuramitsu, and M. Sugiura, Mol. Gen. Genet. 202, 1 (1986). 3s M. Sugita and M. Sugiura, Nucleic Acids Res. 11, 1913 (1983). 39 G. Zuravc'ski, W. Bottomlcy, and P. R. Whitfeld, Nucleic Acids Res. 12, 6547 (1984). ~oW. E. McLaughlin and I. M. Larrinua, Nucleic Acids Res. 15, 3932 (1987). 4~ M. Posno, A. van Vliet, and G. S. P. Groot, Nucleic Acids Res. 14, 3181 (1986). 42 B. Gold, N. Carrillo, K. K. Tewari, and L. Bogorad, Proc. Natl. Acad. Sci. U.S.A. 84, 194 (1987). 43 W. E. McLaughlin and I. M. Larrinua, Nucleic Acids Res. 15, 5896 (1987). 44 j. K. Lou, M. Wu, C. H. Chang. and A. J. Cuticchia, Curt. Genet. 11, 537 (1987). 45 T. Manzara and R. B. Halfick, Nucleic Acids Res. 15, 3927 (1987). 46 W. E. McLaughlin and I. M. Larrinua, Nucleic Acids Res. 15, 4356 (1987). 47 R. M. Kamp, B. R. Srinivasa, K, yon Knoblauch, and A. R. Subramanian, Biochemistry 26, 5866 (1987).
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
[52] Computer
765
Analysis of Nucleic Acid Sequences B y M I C H A E L S. W A T E R M A N
Introduction The increasing body of nucleic acid sequence data has created interest among many scientists in computational aspects of data storage and data processing. In fact GenBank and other data bases have been created in order to store the data in a useful format, both for archival and analysis purposes. (See Burks et al. I for a review of GenBank activities.) The value of simply have easy access to all ribosomal RNAs, for example, is not to be underestimated. The purpose of this article is to examine some of the array of tools that have been created in order to look at sequences in a rigorous, systematic way, utilizing the power of modern computers. These analyses began in the early 1970s and are now becoming more focused on specific problems such as consensus patterns in regulatory sequences or RNA folding. The sections below will outline some methods of computer analysis of sequence data. The intent is to describe the analyses and to give emphasis to the possible utility of the analysis, not to present detailed mathematics or computer science of the techniques. Reference is made to papers where more technical details of equations, pointers, and data structures are to be found. A great many algorithms have been proposed in recent years. See the issues of Nucleic Acids Research 2-4 and the Bulletin of Mathematical Biology 5 devoted to computer methods for a good sample of this literature. Frequently ideas such as open reading frame analysis or dot matrices are rediscovered and reimplemented over and over. For this reason I make no attempt to survey the literature. Instead I try to describe some useful and interesting methods of sequence analysis that utilize the power of computers. Several different questions might be asked about a sequence. One concerns unexpected relationships with other sequences; these discoveries are sometimes made by screening a data base with the sequence. Wilbur i C. Burks, J. W. Fickett, W. B. Goad, M. Kanehisa, F. I. Lewitter, W. P. Rindone, C. D. Swindell, C.-S. Tung, and H. S. Bilofsky, CABIOS 1, 225 (1985). 2 D. Soll and R. J. Roberts, Nucleic Acids Res. 10 0982). 3 D. Soll and R. J. Roberts, Nucleic Acids Res. 12 0984). 4 D. Soll and R. J. Roberts, Nucleic Acids Res. 14 (1986). 5 H. M. Martinez, Bull. Math. Biol. 46 (1984). METHODS IN ENZYMOLOGY, VOL 164
Copyright© 1988by AcademicPress,Inc. All rightsof reproductionin any formreserved.
766
MATHEMATICAL AND COMPUTER ANALYSIS
[5 9`]
and Lipman 6 devised a search algorithm based on the computer science technique of hashing and theirs is the m e ~ o d of choice for such questions. Several groups have implemented versions of their technique. Essentially the search looks for exactly matching k-mers (usually k - - 4 to 6) and reports regions where the test sequence has a high density of matches with the data base. There is no further discussion of data base searches in this article but they should not be overlooked. Sequence alignment is a popular computer activity. The computer alignments are often based on some explicit optimization function, rewarding matches and penalizing mismatches and insertions and deletions. Sequence alignment can give useful information about evolutionary or functional relationships between sequences. I distinguish two types of alignment: (1) alignment of full sequences and (2) finding segments of sequence that can be well aligned. Full sequence alignment should only be attempted when it is believed that the sequences are related, from one end to the other. If this is not the case, the sequences can be forced into incorrect relationships due to the necessity of matching the "dissimilar" segments. I feel much easier about running a maximum segments analysis, that only finds those segments of the sequences matching at or above some preset level. Consensus sequence analysis is usually done by "eye" and experiment. Of course we only believe a protein-binding site when it is verified by experiment, but analysis by eye can be biased. So it is useful to have computer methods that can find consensus patterns best fitting explicitly stated criteria. Some algorithms have been developed along these lines, 7,s and they are described here, along with example output. Consensus repeats and consensus palindromes within a single sequence and among a set of several sequences are analyzed. Secondary structure of single-stranded nucleic acids is another popular computer analysis. For one sequence, the minimum energy algorithms which employ dynamic programming are the usual method, and I briefly describe them below. For sets of several sequences which fold into a common structure, the comparative or consensus method is very useful. The methods that Woese, Noller, and collaborators%1° have so powerfully employed are now included in an explicit algorithm that is described and illustrated on a set of 5S sequences. 6 W. J. Wilbur and D. J. Lipman, Proc. Natl. Acad. Sci. U.S.A. 80, 726 (1983). 7 M. S. Waterman, R. Arratia, and D. J. Galas, Bull. Math. Biol. 46, 515 (1984). s D. J. Galas, M. E~dgert,and M. S. Waterman, J. Mol. Biol. 186, 117 (1985). 9 H. F. Noller and C. R. Woese, Science 212, 403 (1981). I°H. F. Noller, Annu. Rev. Biochem. 53, 119 (1984).
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
767
Computer analysis of sequences has some distinct advantages over analysis by "eye." The computer analysis must be well defined, explicitly, so that the same search can be duplicated elsewhere. Many more cases can be examined by computer, and the calculations are done correctly. Inherent in these advantages are some important disadvantages. The computer will only do exactly what it is programmed to do. If the task is the "wrong" one, massive and correct calculations do not help. In addition, a machine will not notice a pattern it has not been programmed to notice, something at which humans excel. The sequence analyst should be aware of what the computer is and is not doing. Computation might be useful but it should not stand alone. Sequence Comparisons The majority of mathematical effort on sequence analysis has been in the area of sequence alignment. One of the reasons for this is the appeal of the basic problem that can be described as follows: Given two sequences a -- ala2 • • • an and b = b~b2 • • . b=, what is the minimum number of substitutions, insertions, and deletions needed to transform a into b? The obvious application in molecular biology is to find minimal evolutionary pathways between sequences. The correspondences between a and b are usually displayed as alignments where it is easy to see highly conserved regions of sequence. Applications to many other areas exist and a book has been written on the topic of sequence comparisons. H In computer science there is the problem of recognizing mistyped words as well as file comparisons, and a large literature exists in that field on the so-called string matching problem. Some of that literature is parallel to and largely independent of the biological literature. Transpositions of adjacent letters are considered in computer science; in biology inversions pose related problems. Recognizing the relationships between groups of birds is sometimes studied via bird song comparisons, as is the manner in which younger birds acquire vocalization. In geology, an important class of problems relating stratigraphic sequences can best be approached by sequence comparison methods. These and other applications require careful algorithm development, with attention paid to the specifics of the problem settings. In 1970 Ncedleman and Wunsch ~2 wrote a landmark paper that apIID. Sankoffand J. B. Kruskal (cds.), "Time Warps, String Edits, and Macromolecules: The Theory and Practice of String Comparison." Addison-Wesley, London, 1983. ,2 S. B. Needleman and Wunsch, J. Mol. Biol. 48, 444 (1970).
768
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
proached sequence comparison (alignment) through a dynamic programming algorithm. Their algorithm finds maximum similarity between two sequences, where matches receive positive weight and mismatches and insertions and deletions receive nonpositive weight. Some mathematicians begin to attempt to define a distance between sequences and so to construct a metric space. This search culminated with Sellers, ~3who obtained the desired results for single insertions and deletions, and with later workers who extended his work to multiple insertions and deletions. ~4 While it has been proven that similarity and distance are equivalent concepts when matching full sequences, 15for certain other problems similarity is superior, and I concentrate on similarity here. Sellers x6 wrote the first articles on finding the best matching pieces (segments) between two sequences and has continued those efforts. A much simpler approach through similarity was taken by Smith and Waterman, ~7and an extension ts of that technique is presented below. Matching or aligning entire sequences should be attempted when the sequences are known or suspected to be closely related. Even when this is the case, an extraordinary number of optimal alignments can result; many of these will differ only slightly from one another. I illustrate this below with some recommendations on how to deal with the situation. Most sequence comparisons will, however, involve sequences only significantly related in pieces, if at all. In those cases a full alignment is not informative and the maximum segments algorithm is the most appropriate. These algorithms can produce segment matchings which are best, second best, and so on; this is shown in examples.
Aligning Full Sequences As explained above, what is to be presented is a similarity method for sequence alignment. The function s(a, b) is to define similarity between the letters a and b. In the examples below matches receive weight 1 and mismatches receive - 1, so that
s(a,b) =
+ 1,
ifa = b
-1,
ifa~ b
t3 p. Sellers, SIAMJ. Appl. Math. 26, 787 (1974). t4 M. S. Waterman, T. F. Smith, and W. A. Beyer, Adv. Math. 20, 367 (1976). t5 M. S. Waterman, Bull. Math. Biol. 46, 473 (1984). t6 p. Sellers, J. Algorithms 1, 359 (1980). a7 T. F. Smith and M. S. Waterman, J. Mol. Biol. 147, 195 (1981). is M. S. Waterman and M. Eggert, J. Mol. Biol. 197, 723 (1987).
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
769
Deletions of length k receive weight - - X k and below only xl is used. The algorithm is based on recursively computing a matrix S. First SO.o = 0, Si, o = - X i ,
l <- i <- n
Sod ---- - - x j ,
1 <-j <- m
Then Si,y = max(Si_l.j_, + s(ai,bj), m a x k ~ . , ( & y _ k -- Xk}, maxk~.l{St-~/-- Xk}) For single insertions and deletions only, S i j = max(S/_,j_~ + s(ai, by), S i _ l , j -- X l , & j - i
--
X1}
The idea of these calculations is that S~j is the maximum similarity of ala2 • • • ai and bib2 • • . by. This is why for example, Soj = - x y . The
recursion is based on the ways an alignment can end: ai
•
.
.
•
•
•
by
•
.
.
bj
corresponds to Si- l.y- l + s(ai, bj)
and corresponds to St, j - l - x~ and so on. When n = m, the multiple insertion and deletion program runs in time proportional to n 3, while the single insertion and deletion program runs in the much preferred time n z. Fortunately, when the function Xk is linear in k, Xk = a + t ' k , the running time Is can still be made n 2. Multiple insertions and deletions are important as adjacent bases are deleted orinserted by one event and should be weighted accordingly. Alignments can be produced from the matrix by two methods. One is accomplished by saving pointers at each matrix entry that indicate what events were necessary to calculate St,j. Then beginning at Sn, m pointers are followed to So,o, producing the optimal alignments. The second technique is, at each matrix entry beginning at S,~m, to recompute to see which events produced the entry. Both methods take little time in comparison with the matrix construction. For the examples, I first align 5S E s c h e r i c h i a coli ( r r n B operon) 19 with 19V. A. Erdmann, E. Huysman, A. Vandenbe, and R. De Wachter, Nucleic Acids Res. 11, r105 (1983).
770
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
the closely related 5S Beneckia harveyi. 2° As mentioned above, s(a,b) =
+1,
if a - - b
-1,
ifa~b
and xi = 2. (Xk = 0% k --- 2, so that only single insertions and deletions are allowed.) The two sequences have similarity of 76 with alignment UGCCUC_K]CC_,-GCAGUAGCGCGGUC.vGUCCCACCUGACC-CCAUGCCGAACUCAGAAGUGAAACGC UGCUUGGCGACCAUAGCGAUUUGGACCCACCUGACUUCCAUUCCGAACUCAGAAGUGAAACGA CGUAGCGCCGAUCdSUAGUGU~UCUCCCCAUGCGAGAGUAGC--I~AACUGCCAGGCAU AUUAGCGCCGAUGGUAGUGU~CUUCCCCAUGUGAGAGUAGGACAUCGCCAC-d3CUU
There is a second optimal alignment, which results from simply changing CUU
to
-C UU
For a second example, I align 5S E. coli with the more distantly related 5S Mycoplasma capricolum. 21 Here the similarity is 22, with 52,020 different but optimal alignments. One of these 52,020 is given next with the portions common to all alignments in boxes. UGCCUGGCGGCAGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCC U---UGGUCd3UA-UAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCU GUAGCGCCGAUGGUAGUGU~UCUCCCCAUGCGAGA-G-UAGC_K~AACUGCCAGGCAU AUUACG--G-UGAAAAUAU---UACUU---AUGUGAGAAGAUAGCAAGCUGCCAGU--U
Obviously 52,020 alignments are too many to look at individually. The idea of displaying features common to all alignments is a minimal approach for dealing with these difficulties. As will be seen in the next section, a maximum segments algorithm will produce much of the same information. M a x i m u m Segments
This is a preferred method for exploring sequence relationships if computer time is available. 17 See Smith et al. 22 for a data base search with the algorithm. It consists of a simple alteration of the preceding method. The 2o K. R. Luehrsen and G. E. Fox, J. Mol. Evol. 17, 52 (1981). 21 H. Hori, M. Sawada, S. Osawa, K. Murao, and H. Ishikura, Nucleic Acids Res. 9, 5407 (1981). 22 T. F. Smith, M. S. Waterman, and C. Burks, Nucleic Acids Res. 13, 645 (1985).
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
771
recursively defined matrix here is H and recursion begins with Ho,o = O,
Hi.o=O, Hoj=O,
1 <-i<-n 1 <-j<-rn
and Hi,j = max(Hi-Lj-i + s(ai, by), maxk~.l{Hij-k- Xk), maxk~.~ {Hi-kj -- Xk}, 0} For single insertions and deletions only, Hi, j "~
max(Hi-l.j-I + s(ai, bj), Hi-Lj -- xl,
Hi, j - i -- x l , 0}
Notice that a simple addition of 0s in the boundary conditions and recursion is the only change from the definition of S. These simple changes have the pleasant effect of causing Hij to be the maximum similarity of all possible segments ending in ai and bj. After the 1981 Smith- Waterman algorithm 17much work has gone into finding second, third, . . . best segment matches. 23 Fortunately there is also a simple, useful solution to this question. There is no problem with the observation that the best segment matching is associated with the entries where max~jH~j is achieved. Since large entries influence the entries nearby, it is not clear whether or not the second-best matching is near the first or not. One way to make certain of finding the second best is to recalculate the matrix, only this time no match, mismatch, insertion, or deletion from the maximum segment can be used. With single or linear insertion and deletion functions, only a small part of the matrix need be recomputed. To illustrate the algorithm, ~s I compare the sequences 5S E. coli and 5S Mycoplasma capricolum as above. There the similarity was 22, with 52,020 different but optimal alignments. Asking for all nonintersecting segment alignments with score 10 or larger produces two alignments, the first with score 29 and the second with score 11: JGGCGGCAGUAGCGCCKiUC_~UCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAAUGCGAGAJGGUGGUA-UAGCAUAGAC_,-GUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAAUGUGAGAA 3-UAGC-GAACUGCCAG ~AUAGCAAGCUGCCAG 23p. Sellers, Bull. Math. Biol. 46, 501 (1984).
772
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
These two segment matches comprise most of the alignment that is common to all 52,020 optimal full sequence alignments. A portion of the first matrix calculation is given in Table I. No recalculation has been done so that the reader can check understanding of the method. As a final example, 5S E. coli is compared to E. coli Phe-tRNA. This second sequence (from GenBank) is C C C G G A U A G C U C A G U C G G UAGAGCAGGGGAUUGAAAAUCCCCGUGUCCUUGGUUCGAUU CCGAUCCGC~CACCA. There are five segment matches with scores greater than or equal to 6. Each is shown, 5S on top, with sequence position numbers indicated. Two segment matches have score 8: 99 AGAGUAGCK3AACUG 20 AGAGCAGGGGAUUG 65 UAGCGCCGAUGGUAGUGUGGGG 07 UAGCUCAGUCGGUAGAGCAGGG The remaining three segments have score 6: 89 UCCCCAUG 38 UCCCCGUG 13 GUAGCGCGGUCK3 18 G U A G A G C A ~ 14 UAGCGCGGU-GGU 07 UAGCUCAGUCGGU
Consensus Patterns Perhaps the most important, certainly one of the most difficult, tasks of genetic sequence analysis is that of finding unknown patterns that occur imperfectly among a set of sequences or within a single sequence. Usually these searches are for approximately conserved regions that have functional significance. If the patterns are exactly conserved they are easily found; this is frequently not the case. These conserved patterns include the famous boxes such as TATAAT in bacterial promoters and CAAT in eukaryotic promoters, as well as enhancer and other sequences. Generally, gene regulation seems to involve some repeated protein binding sites. The question treated in this section is how to search for these unknown patterns. When the problem is to locate shorter unknown patterns that occur imperfectly among a set of several sequences, the task seems hopeless due to the combinatorial nature of aligning many sequences. Aligning 10 sequences with 10 possible positions or shifts per sequence gives a total of
[52]
773
COMPUTERANALYSIS OF N U C L E I C A C I D SEQUENCES TABLE I MAXIMUM SEGMENTS MATRIX FOR 5S E. coli AND 5S Mycoplasma capricolum
U U G G U G G U A U A G C A U A G A G G U C A C A C U G C C U G G C G G C A G U A G C G C G G U G G U C C C A C C U G A C C C C A U
1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 I 0 0 0 0 0 0 l 0 0 0 0 0 0 0 1
1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1
0 2 0 0 0 2 1 0 1 1 0 0 1 0 0 1 0 1 0 1 1 0 2 l 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0
0 1 1 0 0 1 3 1 1 2 0 0 1 0 0 l 0 1 0 l 2 0 1 3 1 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0
1 0 0 0 1 0 1 2 0 0 1 0 0 2 0 0 0 0 0 0 0 3 1 1 4 2 0 0 0 0 0 1 0 0 0 0 0 0 0 1
0 2 0 0 0 2 1 0 3 1 0 0 1 0 1 1 0 1 0 1 1 1 4 2 2 3 1 0 0 0 0 0 2 0 0 0 0 0 0 0
0 1 1 0 0 1 3 1 1 4 2 0 1 0 0 2 0 1 0 1 2 0 2 5 3 1 2 0 0 0 0 0 1 1 0 0 0 0 0 0
1 0 0 0 1 0 1 2 0 2 3 1 0 2 0 0 1 0 0 0 0 3 1 3 6 4 2 1 0 0 0 1 0 0 0 0 0 0 0 1
0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 4 2 2 3 0 3 3 1 I 2 0 0 0 0 0 0 0 0 0 0 11 2 0 1 1 4 2 5 3 3 4 1 2 2 0 0 1 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 2
0 0 0 0 0 0 0 0 0 0 0 1 1 2 4 2 1 0 0 0 0 0 0 0 0 I 2 3 3 1 0 0 0 1 0 0 0 0 1 0
0 1 0 0 0 1 1 0 1 1 0 0 2 0 2 5 3 2 0 l 1 0 1 1 0 0 0 1 2 2 0 0 l 0 0 0 0 0 0 0
0 0 2 1 0 0 0 2 0 0 2 0 0 1 0 3 6 4 3 1 0 0 0 0 0 1 1 1 0 3 3 i 0 0 1 1 i 1 0 0
0 0 0 1 0 0 0 0 1 0 0 3 1 0 2 1 4 5 3 2 0 0 0 0 0 0 0 0 2 1 2 2 0 1 0 0 0 0 2 0
1 0 0 0 2 0 0 0 0 0 0 1 2 2 0 1 2 3 4 2 1 1 0 0 1 0 0 0 0 1 0 3 1 0 0 0 0 0 0 3
0 0 0 0 0 1 0 0 0 0 0 1 0 1 3 1 0 1 2 3 1 0 0 0 0 0 0 0 1 0 0 1 2 2 0 0 0 0 1 1
0 1 0 0 0 l 2 0 1 1 0 0 2 0 1 4 2 1 0 3 4 2 1 1 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0
0 0 0 0 0 0 0 1 0 0 0 1 0 1 1 2 3 1 0 1 2 3 1 0 0 0 0 0 1 0 0 0 0 3 l 0 0 0 1 0
0 1 0 0 0 1 I 0 2 1 0 0 2 0 0 2 l 4 2 1 2 1 4 2 0 0 0 0 0 0 0 0 1 1 2 0 0 0 0 0
0 1 0 0 0 1 2 0 1 3 1 0 1 1 0 1 1 2 3 3 2 1 2 5 3 1 0 0 0 0 0 0 1 0 0 1 0 0 0 0
1 0 0 0 ! 0 0 1 0 1 2 0 0 2 0 0 0 0 1 2 2 3 1 3 6 4 2 0 0 0 0 1 0 0 0 0 0 0 0 1
0 0 0 0 1 0 1 0 0 0 0 0 0 0 l 0 0 0 0 0 2 0 1 3 0 1 0 0 1 1 0 0 1 0 0 0 1 0 0 0 l 0 1 0 2 0 11 4 2 7 5 5 6 3 4 1 4 1 2 l 0 0 0 0 0 0 1 1 0 1 0 1 0 1 0 0 2 0 0
0 0 1 1 0 0 0 1 0 0 1 1 2 0 0 0 l 0 1 0 0 0 0 0 0 3 6 7 5 5 3 1 0 0 2 1 1 1 0 1
C 0 0 0 0 0 0 0 0 0 0 0 2 0 I 1 0 0 0 0 0 0 0 0 0 0 1 4 5 8 6 4 2 0 1 0 1 0 0 2 0
U
G
0 0 1 0 0 0 0 2 1 1 0 0 1 2 0 0 0 0 3 1 0 0 1 4 0 0 0 2 1 1 0 0 0 0 0 1 0 0 0 1 1 1 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 1 1 1 0 0 0 0 0 1 0 0 0 1 0 0 1 0 0 0 0 2 0 0 0 1 0 0 1 0 1 1 0 0 2 2 0 0 5 3 1 0 6 4 2 0 9 7 5 3 7 10 8 6 5 8 11 9 3 6 9 12 1 4 7 10 2 2 5 8 1 3 3 6 2 2 2 4 1 3 1 2 0 1 2 0 1 0 2 1
774
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
10 i° possible alignments. This is at the limits of computability of modern computers with no consideration given to sequence length or to analysis of the alignments themselves for consensus patterns; any larger problem is clearly impossible. This is an instance of a so-called combinatorial explosion. Fortunately, recently developed methods 8 are able to find these consensus patterns in reasonable time for large data sets. The first problem type considered is consensus patterns in a single sequence. Solutions are available for the "best" consensus repeat or palindrome. The found patterns are not allowed to overlap, and all patterns of a chosen word size (k) are considered. Mismatches, insertions, and deletions are allowed; the algorithm can locate a consensus word not actually occurring in the sequence itself. The second problem type is repeating words or palindromes between a set of sequences. In either case the analysis is more often limited by storage than by computation time. All 4 k words (patterns) of length k are stored for DNA and RNA; in proteins the storage is 20 k. Thus this analysis is suitable for smaller patterns.
Single Sequence Patterns Under consideration first is finding a given length consensus palindrome in a single sequence. The procedure described here will locate the best nonoverlapping palindrome. If overlapping patterns are of interest, an easy modification will allow that option. Actually there are two problems of interest: (a) that of finding nonoverlapping palindromes of some given length, regardless of composition, and (b) that of finding a specific (but unknown) palindrome of given length. It is important to allow some amount of mismatch in these patterns. Examples are GA~GTTTATATGAGTGCTACCAATGG
(a)
CAACGTTGATACGTTCTTAAACCTTTATCT
(b)
where in (a) three nonidentical palindromes (allowing one mismatch) are marked and where in (b) three versions of AACGTT are marked. The second problem is more difficult and is discussed here. The following method seems natural but has serious flaws: take each word of the fixed length actually occurring in the sequence and, if it is an approximate palindrome, use it as a template along the entire sequence to see if it has any other approximate nonoverlapping occurrences. There are two difficulties with this naive procedure. (1) Such a method takes computing time proportional to the square of the length of the sequence times the pattern length. (2) It is frequently the case that the best consensus palindrome never exactly occurs in the sequence. While (2) is the most important objection, it is overcome by an algorithm which has computer time linear with sequence length.
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
775
Initially the length of palindrome of interest must be chosen. Oddlength palindromes of length 2 k + 1 are of the form x, x2
. . . XkNYk
. . .
Y2Y
where -~l = Ym(A = T, etc.), N-----{A, T, G, C}, while even lengths of 2k do not have the N in the center. Therefore all length 2k + 1 or length 2 k palindromes can be encoded by 4 k patterns. Now the word w = ATTCCGAT is considered to illustrate the ideas. If up to three mismatches (mm) are allowed, the following palindromes are within the neighborhood of w. Length 6 Palindromes
m m from w--- ATTCCGAT
ATTCGAAT ATTGCAAT ATCCGGAT ATCGCGAT
2 2 2 2
ATTATAAT ATTTAAAT ATCATGAT ATCTAGAT ATAGCTAT ATGC~CAT ATACGTAT ATGCGCAT ATACGTAT
3 3 3 3 3 3 3 3 3
Obviously the situation is more complex if for example the mismatch level is raised to 5. Here, for example, the pair Xl * YI = A * T can be altered, for example to G * C, giving an additional two mismatches. This general idea of finding a neighborhood of exact palindromes within mm mismatches of an existing word of the sequence is the basis on which the palindrome algorithms are built. Consider the problem of finding the palindrome pattern of length 2k (or 2k + l) that occurs most frequently, nonoverlapping, in the given sequence. Of course none of these occurrences needs be exact so a weight 2w (v) can be introduced for a word v that is a fixed number of mismatches from a given palindrome w. Here if there are mm mismatches, 2 = m m / (word length). Let S w ( i ) be defined by S w ( i ) = max{Xo2~(v)}
when the sum is over nonoverlapping words v of the sequence a~a2 . . . an. Suppose S ~ ( j ) is known for I -<j -< i and all w. Then to find
776
MATHEMATICAL AND COMPUTER ANALYSIS
[ 5 `) ]
palindromes of length 2k Sw(i +
1) = max(Sw(i);
Sw(i -
2k) +
;tw(ai--2k+lai--2k+2
• • • ai))
The consensus word has the maximum value of S ~ ( n ) . This formula shows that the calculation is linear with sequence length, an extremely valuable feature. If an overabundance of palindromes (not a
GUAGUG 4.33 120 110 188 90 80 70 2109876543210987654321098765432189876543210987854321098765432
58 50 40 38 28 18 1098765432109878543210987654321098765432109876543210987654321 ~guagc~guagu~ ...... ~ u a g g g ~
b GCCA 5.25 120 110 100 90 80 78 21098785432109876543210987654321898765432_10987654321898765432 u g c c u g g c E g c a g u o g c g c g g u g g u ~ c c c a u g c~c
60 50 48 30 20 10 189876543210987654321098765432189876543210~876543210987654321
Igocgoog4ccgoogg
coooogc
gccog
ooI
GGCA 5.38
12o
llo
9o
8o
78
21088765432109876543210EI8765432109876543210987654321888765432
ogocIggcogoogcIggoggocoIccccooocc
50 50 40 38 28 10 189876543210987654321098765432 i 09878543210987854321098765432 l
IcgoogogooIggoogogoggggocoooo
ogoocog°oI
l~o. 1. Consensus patterns in E. coli 5S RNA. Base number 120 is the 5'-end of the sequence. (a) The result of a search for 6-letter repeats, allowing one mismatch. The pattern G U A G U G occurs five times with a score of 4.33, and the versions of the pattern are shown in lower case letters. (b) The result of a search for 8-letter palindromes, allowing up to three mismatches. The palindrome G C C A U G C ~ occurs eight times within the mismatches allowed. (c) The result of a search for 9-letter palindromes, allowing up to three mismatches. The palindrome C~oCANUGCC is found seven times.
[52]
COMPUTERANALYSIS OF NUCLEIC ACID SEQUENCES
777
necessarily identical) is of interest, the above procedure is easily applicable. The neighborhood calculations need not be done, only counting of complementary pairs in the word. Very similar, although somewhat simpler, concepts can be applied for an algorithm that finds consensus fixed-length repeats in a single sequence. This completes discussion of concepts for a single sequence and these algorithms are now applied to 5S E. coli. See Fig. 1.
Multiple Sequence Patterns Much the same ideas from the tingle-sequence case are employed to study consensus patterns in a set of sequences. 7,8 The basic parameters of the method are a window width W, word size k, and the level of mismatches allowed. (Insertions and deletions can be included in the method.) With the window positioned on the sequences, the search finds the highest scoring word where each word w is given its highest score 2i(w), occurring within window W i n sequence i. The score of w is
s(w)
---
and the object is to find the winning word w*
S(w*) = maxwS(w) For each window position, S(w*) is plotted, and the resulting data can be graphed and examined for features of interest. Patterns in the sequences that correspond to the score S(w*) can be displayed.
Window Position
Flo. 2. Consensus pattern scores for a set of 30 E. coli promoter sequences aligned on start sites, with window size 9, word size k ffi6, and up to 2 mismatchesallowed. The graph givesscore versusposition of right edgeof window. The position,scores,and patterns creating the scorescan be directlyrelatedto the sequencesthemselves,and the graph givesdirectionto directlystudyingthe sequences. See Fig. 3.
778
MATHEMATICAL A N D COMPUTER ANALYSIS
[52]
@ 70 60 5~ 40 38 20 10 ~98~6~432~98~65~32~98~65~321B98~65~32~098~5~32~098?~432~098~5432~098~65~32] < > RECA
LEXA AMFC LPP HIS] (s. t.
PORI-r £ORI- [ SPOT 42 RN HI RNA ALAS TRY3
GL~S TUFB
TYRT
LEUL t R N A SUPB-E RRNABPI RRNGPI RRNDPI RRNEPI RRNXP1 RRNABP2 RRNGP2 RRNDE~P2
STR SR3 Si~ RF~)A RPLJ RPOB
TTTCTACAAAAC~tt gata TGTGCAGTTTATGgt cca4 TGCTATCCTGAC~ttgt c4 C T G A ~ a CCATCAAAAAAATAttct c a l ~ I CAAGGTAGAATGCTtt c ~
GAC ~ c A T ~ ATI"ACAAAAA~ ATGCT(~ZAA~t g a ~ AAOGCATACGG-T ' At t1 ~
ta CA CAGAACA1 t act~ACAGCATAACIGTAI
~atmAACGCATCGCCAATC {~G'ICGCATOG'GAIL-TI~tao~c{{GTAACGC~fACAT(I(~'
~ A T ~ ct~CXXZAGCrFfATACGGI T&~AOAAAAAAG~{ta a g ~ A G ' D 3 T A C ~ GI]GCGCAAAC~a act~GC ' IEZ~GAAGL-qI~AOC CCAGTCAAGAAAA~t t ctt~FFfO]CA~CAG-q
AGCCAGCCFCGA~ IAG~fl]~'_ _ATAAA~IIA~ TAAAAAACTAAC~tt gtca (L~G'TOCCGCTfAtaa a t c a t A ~ A T A C G T I ATGCAATFITITAGttgcat~ CTCGCATGTC~ta aat~ACTTGATGCC C'fAOIGCXIA~
TCTCAACGTAAC/~tt t acai GGCGCGTCATTT~ta ~ a ~ ( ~ ]
TCGATAATTAACTAt tg a c ~ A/~AAAACCACt ag I t U m ~ A G I ] A ~ ~AAAAAGAGGt t g a c ~ CAAGI~ATAq~ca a a ~ ] O ] C ~ A k ~ f TTITAAATI'IIIL'TC t t gtc~ CGGAATAACTCCCtat BtmECCACCACTGACACG( T'I~ATA'I"I-II-I(]C~t t g t c a1 C6~AATAACTCCCtataat~CCACCACTGACACI% GA~AAAAAAATAC~gt gcaa AAA~A11]C~ t at Bat~TTGAGACG~ CTGCAAI-I-I-I-IL%At t gcg ~ GCGGAGAACTCCCtataat~CCTCCATCGACACGC ATG~AI il-l-it.XI~t tgtctn TGAGCCGACTCCCtat aat~CCTCCATCGACACL-'C ' G-G ' GAAGG~tat t a ~ A C A ~ ( ] C G C GCAAAAATAAAII~t tgact TGTAGC AAGCAAAGAAAII~ttgact TGTAG(]GGGAAC~t attat ~ A C A C C ~ C ~ CL'I~AAA2"I'CA~t gact~ &~AAGA~A A A ~ a tatIGCCA _C~C~]G~I~GACAG TCGq'I~TATATI~ttgac~ Ul-iq-it.~GCATC(Imtaaaat~ T C L ~ C A T A I CCGTTTAITTTII~taccca ATCCTTGAAGO~tat aat~ T C G A T ~ TACTAGCAAT/~tt~c~ ~ A A G ~ t ataatGL-GCGI]~CTTGTCGI GT'IIZIGGTTGAG~tagat t AGO]AGCCAATCIT '~ TI~Z!C~]ATA~ {IG{]GGq~;A~ acaat~TTA~ACGTAT~ ~-TAAAC'TAA~ CGACTTAATATA(~ A O I I ~ A ~ A A A T G G T I ' I ~ A ~
FIO. 3. The sequences and patterns creating the two major peaks in Fig. 2. T h e f i g h t - h a n d p a t t e r n has score 2 1 . 8 3 and is the famous - 10 c o n s e n s u s , T A T A A T . The leit-hand pattern h a s s c o r e 1 7 . 1 7 and is the - 3 5 consensus p a t t e r n .
It is convenient to understand these methods with an example. A subset of 30 E. coli promoter sequences 24 is aligned on known m R N A start sites. The sequences are approximately 60 bases long. They are analyzed with W = 9, k = 6, and maximum mismatches m m = 2. The resulting plot appears in Fig. 2. The sequences, their descriptions, and the patterns causing the highest peak appear in Fig. 3. The rightmost pattern is TATAAT (the famous - l 0 pattern) which has 8 exact occurrences, 11 with l mm, and 7 with 2 mm. The leftmost pattern is the - 3 5 pattern, which has its strongest representation in these data as TTGCCA; it has 7 occurrences with l m m and 17 with 2 mm. It is possible to analyze the sequences with the sequences written in the RY, or any other alphabet. There are no patterns found in the RY alphabet which are not found in the usual four-letter alphabet. Finally, similar ideas can be used to find consensus palindromes in a set of sequences. Since protein-binding sites sometimes are palindromes, this is a useful tool. 24 D. K. Hawley and W. R. McClure, Nucleic Acids Res. 11, 2237 (1983).
[52]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
779
Secondary Structure The firstt R N A sequence by Holley et al.2~ in 1965 was published with a secondary structure inferred from the sequence. Since that time many other secondary structureshave been presented and the problem of how to estimate structure by experimental as well as theoretical techniques has frequently been addressed. The current structures of 16S and 23S R N A were found by a combination of both approaches.9,1°Here of course I restrictdiscussion of computer methods for prediction of secondary structure. Two major approaches have emerged for the computer analysis. The first employs dynamic programming, in an algorithm closely related to the sequence comparison algorithms presented above. Tinoco et al.26 presented a base pair matrix [with (i,j) entry = l if base i will pair base j] which led them to consideration of minimum energy structures. Dynamic programming algorithms came later and are the current method of choice for a single sequence. The second class of methods employs consensus ideas, tracing back to early deduction of a common tRNA structure. 27 Woese, Noller, and colleagues have advanced and refined these methods, and I discuss a mathematical version of this consensus analysis below. If the data consist of a single sequence then the dynamic programming approach is recommended. On the other hand, if the data are a set of sequences suspected to have common structural elements, then the consensus method can succeed in cases when dynamic programming cannot.
Folding by Dynamic Programming The application of dynamic programming to secondary structure prediction was begun by two groups. The approach of one group had the advantage of incorporating general loop, bulge, and base pairing free energy functions; the disadvantage was the building up of complex structures from simpler ones. 2s,29 The other group did optimization in one pass but only found structures with maximum base pairing. 3° Since the presentation of the first algorithms, Zuker has become the 25 R. W. Holley, J. Apgar, G. A. Everett, J. T. Madison, M. Marquisee, S. H. Merrill, J. R. Penswick, and A. Zamir, Science 147, 1462 (1965). 26 I. Tinoco, O. C. Uhlenbeck, and M. D. Levine, Nature (London) 230, 362 (1971). 27 M. Levitt, Nature (London) 224, 759 (1969). 28M. S. Waterman, Adv. Math. Suppl. Studies 1, 167 (1978). 29 M. S. Waterman and T. F. Smith, Math. Biosci. 42, 257 (1978). 3°R. Nussinov, G. Pieczenik, J. R. Griggs, and D. J. Kleitman, SIAMJ. Appl. Math. 35, 68 (1978).
780
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
leading figure with his useful dynamic programming codes (see Zuker and Sankoff for a review), al He has combined realistic energy functions into a single pass algorithm that is quite efficient. His program runs in time proportional to n 3, where n = sequence length, and it requires storage n 2. Fully rigorous prediction takes exponential time (which is unacceptable) and n2 storage. Recently it was shown 32 that, by increasing storage to n 3, the exponential time can be reduced to n 4. None of this should deeply concern someone with a sequence to fold. Zuker's efficient and useful code is recommended. To understand why complicated programs are needed to study RNA folding, I briefly consider the number of candidate structures. 33 If F(n) is the number of secondary structures for a sequence of length n, it is required that F(0) = F(1) = F(2) = F(3) = 1; that is, there must be at least 2 bases in an end loop. Since secondary structures do not include knotted structures, a recursion is obtained:
F(n + l ) = F(n) +
~
F ( j --1)F(n - j),
n>3
1 ~j'~n--2
This formula counts all possible structures, forcing pairs between base j and base n + 1. The recursion can be shown 33 for large n to behave like F(n)-[(1 + 42)/rOt/2n-3/2(1 +
42P
For n = 150, F(n) --- 1.2 X 1054. Even with all allowances for the overcount as compared to real sequences, these large numbers show that an algorithm is needed. Surprisingly, the dynamic programming algorithms are based on logic similar to that for the counting. The maximum number of base pairs algorithm goes like this: let M~j = maximum number of base pairs in the sequence segment from base i to base j. Take Mi,j known for 0 - i,j < n. Then add base n + 1. If, in the optimal structure base n + 1 is unpaired, M~.n+ ~ = Mr,,. Otherwise, base n + 1 is paired to j , where 1 -< j - n - 2. Then Ml.n+l = M i j - i + 1 + Mj+l, n Here the 1 counts the new base pair between j and n + 1, while the other two terms are optimal for the other two pieces of sequence. To collect this into a recursion, let ~ij = 1 if bases i and j can pair and 0 otherwise. Then Mij = max{Mi,n; maxl.~j~n_2{Mld_l + 1 + gj+l,n}(~i,j} 3t M. Zuker and D. Sankoff, Bull. Math. Biol. 46, 591 (1984). 32 M. S. Waterman and T. F. Smith, Adv. Appl. Math., 7, 455 (1986). 33 p. R. Stein and M. S. Waterman, Discrete Math. 26, 261 (1978).
[59-]
COMPUTER ANALYSIS OF NUCLEIC ACID SEQUENCES
781
5' U
u
/G C/
C G~
C
G/
u
A/
I G
C/
G C/
C
G" G A
C
c
GU A
G
C
II
vC
U~ G C G G G AAC j G C G G UG
CA
G
III
C
CU
mJllll
A C~
G U
C% G G C% '~G U G C U
U
C G
A U
o
G A C U A A A G
C C
A
A
G
C
U G
G G
C
c c c
IIII
G A G A G C~ U G C C G C G% G A A U~, U A G A IV
C G A
C U
C AG
Fro. 4. A secondary structure for E. coli 5S RNA.
All the complication of algorithms, coding, and running times comes in converting this simple, elegant idea to handle the various free energy functions associated with base pairs, bulges, interior looos, and multibranch loops. This is a difficult task!
Folding by Consensus The consensus methods of folding are sometimes referred to as comparative methods. Levitt 27 in 1969 gave an analysis of the known tRNA sequences by this approach. In contrast with his impressive results, the dynamic programming codes currently fold about 50% of tRNAs into a cloverleaf. More recently, comparative methods were used by Woese, Noller, and colleagues 9,m to solve 16S and 23S structures. I now describe programs and mathematics to fold a set of RNAs. The ideas are based on the insights of Woese and Noller but differ from their methods by being able to perform systematic, complete, and explicitly defined searches. The algorithms will be illustrated by 34 5S sequences from E. coli and related sequences that were obtained from a collection of Olsen and Pace and which can be found in GenBank. A 5S model for E. coli is taken from the literature ~ and is shown in Fig. 4 for reference. 34 B. Lewin, "Genes," 3rd Ed. Wiley, New York, 1987.
782
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
This analysis is very different from dynamic programming: here it is desired to find many "common" helices of a certain size and quality. No minimum energy calculations are made. The base pairs A * U, G * C, and G * U are allowed. These helices are allowed to shift in location with reference to the sequences in some fixed alignment. Two windows are placed on the sequences and it is these windows which determine the shifting. For example with WINDOW 1 • **AUGG******
WINDOW 2 *********CCGU
the 4-base pair helix UoccAUCis -~ formed and the patterns could appear anywhere in their windows. Window positions determine approximate helix position while window width determines the amount of shifting allowed. It is not required that the helices in the various sequences be composed of the same base pairs. These features will be illustrated with the 5S sequence set. The sequences must be aligned initially. Obvious features to align on are the right and left ends of the sequences. This can be done in three ways: (1) align on left ends, (2) align on right ends, and (3) align on both ends, leaving gaps in the center of the shorter sequences. Other features to align on include known biological features or highly significant long patterns common to all the sequences. In our sequences such a pattern (cgaac) will prove useful. These various alignments are explored for common patterns of folding. In Fig. 5, the longest common pattern is seen to be cga, shown in lowercase letters in the figure. The pattern cgaac is in 32 of 34 sequence while ccgaac is in 31 of 34. Notice the small amount of shifting to achieve the alignment. The expected length E common to 32 of 34 random sequences 15 is given by E = log
-~
* 12032 + log
+ 0.577 log(e) - ~ = 2.77
and tr = 0.29 with all logs to the base 4. a~ Therefore cgaac occurs almost 8 as above expected. The first analysis of secondary structure now takes place. There are many ways to place two windows on the sequences. To organize the analysis, first fix the separation of the windows. First with no (0) separation, i.e., adjacent windows, move the two windows across the sequence set. Then increase the separation, moving across the set at each fixed separation until the windows are at the maximum separation. In each position the number of helices found is plotted. Mispairs are allowed. Thus each separation produces a graph. All these graphs are superimposed so that interesting peaks, representing a larger number of helices, can be
II I1"¸1
.+ i
i i i
0
~
g
<
®~.
=
--oxl+,.+
= < < <.
+ 3 o c . :
.
.
..+.l=l'o+c...,:,.+
o ~ o ,,., ~ :,. L u . . o 0".2 > , . = . o
,., , , . . - > . o
.
o.*.
.==
-
*
8"o.o.g
+
o-~.
-m::~
~,
1:1:
~++
rJ ::s,l# Q~ .Q g ::i 4 l l , . t + * J U ::l~+"t'ft,) " "IPLIIL. O0£. 0 411 " " l l l i l . ~ U :I'OC41.,OIII,. £, " - I O O l ~ l l e t l O O l . . O 0 . + O 0 0 1 . O.O0. * .Ill - .J~Q N -el *J~J~l~l. . . . . ellll.I * -O.~I-+~tPI,'I.I.CJB~ 0 - I i J O . I ~ C l 0.41~ 0 . 0 . ~ ' I . - J-- 4 1 0 . 1 0 1 0 1 0 lO.J.JIO d~lO~l'm ~ ~ ~ In S S~'PI" 0 "l
784
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
located. As is seen below, this is an overwhelming amount of information. To handle these data, then, it is possible to move between graphs and the sequences to observe which sequence patterns produced the peaks. With the 34 sequences in the alignment of Fig. 5, the algorithm is run with a window of 8, a helix size of 4, and no mispairings (mm = 0). The superimposed graphs are shown in Fig. 6a and several interesting peaks show up. The leftmost of these peaks is the result of helix III (see Fig. 4), and one of the graphs with separation 9 is shown in Fig. 6b. A sequence pattern or set of helices producing the highest peak in this graph has score 3 l, so that all but three of the sequences have this pattern. By allowing two mispairings, the alignment shown in Fig. 7 is produced. This method of representing helices in secondary structure by
8 c/) tion W i n d P oos iw
b
Window Position
l~o. 6. Graphs of folding scores with window sizes 8, helix size 4, and no mi~airing allowed. In a, all separations are plotted; in b, one of these graphs with sel~-'ation 9 is shown. Sequence patterns causing these scores can be viewed.
~v
~
TO
-------°°°°°°°-°°°°°°°°°-°°-°-°°-°
~
~
SNNNNNNNNN~N~NN~NN~N~N~NNNNNNN
N
~
~
•
~
~
.
~
.
~
.
~
.
~
~
.
~
°°-°-----'---°°'°°---°"°~"'"°-°
g~
°~^°'"" ' " ' " °
"
° |!
hdl;;~;;~;;'"" ° °°°
i
,i iiiiiilli iiiliiiliiil!Iiliii!
"i ,~ UiiUiliii!!iiilUlii-~W]i!!llli ~*
'!,:,,:iiiii'iiiiNiiiiiliii____, ! "i iiliIIilII!IiIIIIIItlIIII~i~'iIIi~
=~
'!!!!iiiiiiiiilliiiil!ii!iii!o" I:l
8
!Hlfll~il|H~||||!lH!lil!l.ll~~ ~,~U~
~ ~ =
~
"
~
:~==ii!~
~
788
MATHEMATICAL AND COMPUTER ANALYSIS
[52]
parentheses is unambiguous: for example,
5'
(
((
))
(
)
)
3'
represents the 5S structure of Fig. 4. The highest peak of Fig. 6a corresponds to helix II and this helix is added to the alignment in Fig. 8. Actually a helix of 6 base pairs fits best and m m = 1 is allowed. Three of the sequences do not obtain a helix according to these criteria and consequently do not have parentheses inserted. The peaks of Fig. 6a which are the third highest group, those at the rightmost of the plot, correspond to helix I, while the fourth highest group corresponds to helix IV. Helix IV has 8 base pairs and all but one sequence has a helix with three or less mispairs. The final folding is shown in Fig. 9. The folding is achieved in an iterative manner: longest common pattern, helix III, helix II, helix IV, and finally helix I. Frequently finding one pattern assists in finding another. It must be emphasized that the main concern here has been consensus helices and not simultaneous folding and alignment. These activities should properly be done together or iteratively as Woese and Noller do. Whenever there were multiple choices for a folding pattern the choice here is that giving the "best" consensus alignment. Clearly, additional work is needed to make the criteria more explicit. What about additional folding patterns? This can be approached using the folded sequences. For a brief look, set W--- 10 and helix size 4 with no mispairs allowed. The major helices I - I V already discussed are labeled in Fig. 10 and some other interesting patterns are labeled A, B, and C. These
Window Position
FIG. 10. Graphs of folding scores versus window position on the sequences aligned as in Fig. 9, with window size 10, helix length 4, and no mispairs. Peaks I - I V correspond to the found helices while A, B, and C were not observed earlier in this analysis.
~
~ ~ o o 0 0 0 0
~
~
~
~ o ~ 0 0
0
(...)
~
0
o ~ o 0 0 ~
~
0
o o l o ~ 0 ~ 0
(.-~(,.~¢...)(.) ¢..)t.1 ,~t
o o m ~ o l o ~ o ~ 0 ~ 0 0 0 0 ~
0
o o o o
~ i ~ i O N
v v v v v v v v v v v v v v v v v v v v v v v v v v v v v v v v v v
N
r~ cr~
®I
g
~
~
V
~
o u,
v
v
v
~
v
v
v
,.., u o , , ~ : ,
v
~
W
v
V
V
~
V
V
~
V
~
V
a~a,~m,,~,~.,mmem,.~:,
V
V
V
~
V
V
V
V
~
V
V
V
V
•
V
V
V
V
:, o-,:~ma,,om,~mm
..
0')
L~ co co
LZ~ ¢0 CO
CO G~ e~
g
qt
G') G)~-I
v
~
v
v
~
~
w
v
v
~
0
0
~
~ < < < < < <
< = < <
< < < < < < < ~ < <
< <
< <
~ <
_
~
0
792
M A T H E M A T I C A L A N D C O M P U T E R ANALYSIS
[52]
three peaks are all produced from interactions with the 5' part of helix I (see Figs. I 1- 13). While I do not take the space to do so, an extremely detailed study of tertiary structure is possible. Conclusions I have by no means discussed all the topics that are important to computer analysis of sequences. Several others come to mind: statistical approaches to significance, consensus repeats for large patterns, and alignment of many sequences. I will give some thoughts on these topics in this section. The issue of biological versus statistical significance frequently comes up. Biological significance is the goal here; all that statistics can do is provide hints about what might be taken seriously. Sequences can be viewed as satisfying some model of randomness, such as uniform and independent bases, and the analyst might ask whether some observed pattern is the result of sequence conservation or simply is to be expected from sequences satisfying the model of randomness. Since each person doing the analysis might view randomness differently, there is a proliferation of different simulation techniques. I prefer simple assumptions of randomness, since for maximum segments problems they have been shown to model the matching of unrelated real sequences. 22 There are two theoretical approaches that are useful. The first is the theory of large deviations, which is extensively discussed by Galas et al. s This theory is appropriate when there are a large number of short sequences. When long sequences are matched, the recently developed extreme value theory provides excellent information about longest matchings between the sequences. 22 This so-caUed log(n) theory is discussed in WatermanJ s While these theoretical approaches can be very useful, simulation is often resorted to because of sequence complications. For example, the E. coli promoter sequences have varying sequence composition and this complicates the large deviation theory. Fortunately, the distributions of the quantities of interest, such as highest peak or maximum segment score, do not have large variation, and a few simulations can give a good picture of the maximum expected from random sequences. The algorithms that produce the consensus repeats analysis reported in this article depend on storing all patterns of interest. The methods do not generalize, for example, to finding 72-base pair repeats. What I can suggest is along the lines of a study in progress with I. Wool, J. McNally, and R. Jones that is concerned with 15- to 25-letter repeats in a large set of ribosomal protein sequences. We use each pattern of appropriate length actually occurring in the sequence set. Then we find the most often repeat-
[53]
rRNA-BASED PHYLOGENY
793
ing sequence word. We use the found occurrences to modify the pattern and iterate. While this can hardly be said to be a highly efficient search, it is effective and much more informative than the usual approaches that try to analyze many pairwise comparisons. Finally, I bring up the old problem of the alignment of many sequences. In the realm of dynamic programming, the usual combinatorial explosion sets in, and even three sequences are almost beyond reach. A solution can be based on the consensus word between many sequences, and an algorithm can be constructed to give the maximum sum of scores of consensus words. This practical algorithm35 is very useful for multiple sequence alignment. The computer analysis of nucleic acid sequences has produced some interesting mathematics, and some algorithms and programs useful for sequence analysis. As biology continues to gather sequence data at increasing rates and to find new, fundamental questions of interest, the mathematics and computer science to solve related questions will also progress. Acknowledgments I appreciate receiving the 5S collection from Gary Olsen and Norm Pace. Much assistance from Mark Eggert and Peter Sugiono is gratefully acknowledged. This work was supported by the System Development Foundation and the National Institutes of Health. 3s M. S. Waterman, Nucleic Acids Res. 14, 9095 (1986).
[53] P h y l o g e n e t i c A n a l y s i s U s i n g R i b o s o m a l R N A
By GAXY J. OLSEN The inference of phylogenetic relationships from molecular data (i.e., the field of molecular evolution) I is contributing greatly to our understanding of the evolution of life on Earth. Although the discussion that follows is directed toward analyses based on rRNA sequences, nearly all of the concepts, and many of the details, are equally applicable to the other DNA, RNA, or protein sequences. The rRNAs will be identified by their typical prokaryotic sedimentation values: 5S, 16S, and 23S. No issue will be made of the fragmentations of these RNAs in some organisms (giving rise to the 5.8S, 4.5S, 2S, etc. rRNAs) or of the absence of 5S rRNA in some mitochondria. The merits of rRNA for phylogenetic inference have been extensively E. Zuckerkandl and L. Pauling J. Theor. Biol. 8, 357 (1965). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988by AcademicPress,Inc. All rightsof reproductionin any formr'-~erved.
[53]
rRNA-BASED PHYLOGENY
793
ing sequence word. We use the found occurrences to modify the pattern and iterate. While this can hardly be said to be a highly efficient search, it is effective and much more informative than the usual approaches that try to analyze many pairwise comparisons. Finally, I bring up the old problem of the alignment of many sequences. In the realm of dynamic programming, the usual combinatorial explosion sets in, and even three sequences are almost beyond reach. A solution can be based on the consensus word between many sequences, and an algorithm can be constructed to give the maximum sum of scores of consensus words. This practical algorithm35 is very useful for multiple sequence alignment. The computer analysis of nucleic acid sequences has produced some interesting mathematics, and some algorithms and programs useful for sequence analysis. As biology continues to gather sequence data at increasing rates and to find new, fundamental questions of interest, the mathematics and computer science to solve related questions will also progress. Acknowledgments I appreciate receiving the 5S collection from Gary Olsen and Norm Pace. Much assistance from Mark Eggert and Peter Sugiono is gratefully acknowledged. This work was supported by the System Development Foundation and the National Institutes of Health. 3s M. S. Waterman, Nucleic Acids Res. 14, 9095 (1986).
[53] P h y l o g e n e t i c A n a l y s i s U s i n g R i b o s o m a l R N A
By GAXY J. OLSEN The inference of phylogenetic relationships from molecular data (i.e., the field of molecular evolution) I is contributing greatly to our understanding of the evolution of life on Earth. Although the discussion that follows is directed toward analyses based on rRNA sequences, nearly all of the concepts, and many of the details, are equally applicable to the other DNA, RNA, or protein sequences. The rRNAs will be identified by their typical prokaryotic sedimentation values: 5S, 16S, and 23S. No issue will be made of the fragmentations of these RNAs in some organisms (giving rise to the 5.8S, 4.5S, 2S, etc. rRNAs) or of the absence of 5S rRNA in some mitochondria. The merits of rRNA for phylogenetic inference have been extensively E. Zuckerkandl and L. Pauling J. Theor. Biol. 8, 357 (1965). METHODS IN ENZYMOLOGY, VOL. 164
Copyright © 1988by AcademicPress,Inc. All rightsof reproductionin any formr'-~erved.
794
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
discussed. 2-4 They include universality, functional constancy, ease of identification and isolation, and apparent lack of lateral gene transfer. Also, the technologies of RNA and DNA sequencing have progressed to the point that determining the complete, or nearly complete, nucleotide sequence of an rRNA is within the reach of most laboratories. A less emphasized issue is "why sequences?" Zuckerkandi and Pauling 1 pointed out that there is more evolutionary information available by directly studying a macromolecule than by studying its biochemical (or morphological) effects. The analysis of sequences also helps to ensure that the evolutionary inferences are based on homologous features; the interspersion of conserved with more variable sequences permits the more slowly changing sequence features to provide landmarks for identifying homologous positions in adjacent, more variable, sequences. Finally, sequence data accumulate and are constantly available for further comparisons and analyses. This contrasts with types of data that require pairwise laboratory compari'sons of all the species considered. In essense, the value of a sequence increases as data from additional organisms and molecules become available.
Availability of Ribosomal RNA Sequences Preexisting sequences provide a framework within which new sequence data can be analyzed. The availability of sequences of homologous molecules from many species is one of the greatest assets of rRNA-based phylogenies. 5S rRNA has been used extensively for phylogenetic analyses, but it is ultimately limited in the precision of the inferences because of the relatively small number of sequence positions (120). We are aware of 400 5S rRNA sequences, most of which are in the compilation by Erdmann and Wolters? 5.8S rRNA has received relatively little attention for the inference of phylogenies. The molecule is not much larger than 5S rRNA, and its distribution is limited to the eukaryotes (few sequences are available for the prokaryotic equivalent, the 5'-terminal region of the 23S rRNA). Erdmann and Wolters provide a compilation of 35 5.8S rRNA sequences.5 2 S. J. Sogin, M. L. Sogin, and C. R. Woes¢, J. Mol. Evol. 1, 173 (1972). 3 E. Stackebrandt and C. R. Woese, in "Molecular and Cellular Aspects of Microbial Evolution" (M. J. Carlile, J. R. Collins, and B. E. B. Moseley, eds.), Soc. Gen. Microbiol. Syrup. 32, p. 1. Cambridge University Press, Cambridge, England, 1981. 4 D. J. Lane, B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace, Proc. Natl. Acad. Sci. U.S.A. 82, 6955 (1985). 5 V. A. Erdmann and J. Wolters, Nucleic Acids Res. (Suppl.) 14, rl (1986).
[53]
rRNA-BASED PHYLOGENY
795
The situation with 16S rRNA sequence data is more complex. The RNase T1 oligonucleotides of about 400 prokaryotic 16S rRNAs have been "cataloged," 6 providing fragmentary data covering 25% of each sequence. The most generally useful form of these data are compilations of "signature" oligonucleotides that are indicative of membership in various major prokaryotic groups. 7 The development of "universal" (applicable to most or all species), rRNA-specific primers +,8-to has revolutionized the process of 16S and 23S rRNA sequence determination by permitting the selective sequencing of the desired region of an rRNA or its cloned gene, virtually regardless of context. The universal primers can be used either for the complete sequencing of cloned geness,9 or for the partial sequencing of the rRNA itself with reverse transcriptase. 4,1° Complete 16S rRNA gene sequences provide much more information than 5S rRNA sequences or oligonucleotide catalogs, hence they permit the inference of more precise phylogenies. Huysmans and De Wachter have compiled 57 complete 16S rRNA sequences) ~ Although the published sequences represent many diverse groups of organisms, new sequences continue to reveal novel groups. Although partial 16S rRNA sequences provide less information than complete sequences, they can be determined in less time and do not require gene cloning. The data cover 50-80% of the molecule, but it is always the same parts, so they can be analyzed in much the same manner as complete sequence data. As of June 1986, there are over 100 partial sequences, but there is as yet no formal mechanism for sharing them. Because a 23S rRNA is twice the size of a 16S rRNA, there are far fewer sequences available. However, their size does provide a greater amount of phylogenetic information, making them an excellent supplement to 16S rRNA data for resolving closely spaced evolutionary branchings. Sequence Alignment
Just as one does not infer the evolution of species by comparing the forelimb of one species with the hindlimb of another, one does not corn6 E. Stackebrandt, W. Ludwig, and G. E. Fox, Methods Microbiol. 18, 75 (1985). 7 C. R. Woes¢, E. Stackebrandt, T. J. Macke, and G. E. Fox, Syst. Appl. MicrobioL 6, 143
(1985). 8 D. Yang, Y. Oyaizu, H. Oyaizu, G. J. Olsen, and C. R. Woese, Proc. Natl. Acad. Sci. U.S.A. 82, 4443 (1985). 9 H. J. Elwood, G. J. Olsen, and M. L. So#n, Mol. Biol. Evol. 2, 399 (1985). 1oL. H. Qu, B. Michot, and J.-P. Bach¢llede, Nucleic Acids Res. 11, 5903 (1983). IIE. Huysmans and R. De Wachter, Nucleic Acids Res. (Suppl.) 14, r73 (1986).
796
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
pare a nucleotide in one sequence with an arbitrary nucleotide in a second sequence. Rather, in both instances one must compare homologous features, that is, features that are derived from same feature of the common ancestral organism. Therefore, comparing sequences requires the definition of a one-to-one correspondence of the sequence positions in each of the different molecules, a process called sequence alignment. Given two homologous sequences, alignment begins by seeking obvious sequence similarities and then juxtaposing the corresponding regions of the two sequences. Where it is necessary, "alignment gaps" ~2 are introduced to correspond to nucleotides in one sequence that lack a counterpart in some other sequence. For example, to juxtapose homologous regions throughout the length of the Bacillus subtilis and Bacillus stearothermophilus 5S rRNAs, it is necessary to insert an alignment gap about 90 nucleotides from the 5' end of the B. subtilis sequence. This is illustrated in Fig. 1. We prefer hyphens (-) to indicate alignment gaps, as opposed to blanks (which look like missing data) or periods (which often look like ellipses indicating omitted material). The guiding principle of sequence alignment is that the increase in sequence similarity due to the introduction of alignment gaps must be greater than that which would be expected at random. Because the secondary structures of the rRNAs are largely known, it is frequently possible to fit sequence regions that have little primary structural similarity into their common secondary structure, and thereby align them with each other. The rRNA sequence compilations TM provide useful information regarding sequence alignments and the features that they are based on. Gutell et al. ~3 provide additional information for 16S rRNA alignment based on secondary structure. An example of using secondary structure in sequence alignment is provided by a region of substantial length and sequence variation in 5S rRNA. In Fig. 1 it can be seen that the Acholeplasma modicum 5S rRNA is much shorter than the other sequences, and the Micrococcus luteus primary structure bears little similarity to the other sequences in the region around position 90. The alignment of sequences in this region is based on the pairing of position 78 with 97, 79 with 96, etc. In this manner, the base pairing can be maintained in all sequences (with one "noncanonical" pair ~2Alignment gaps are a h u m a n creation used to adjust for differences in sequence lengths. It is important to distinguish them from insertions and deletions, which are mutational events. Also, it is generally not known if a given sequence length difference is the result of an insertion or of a deletion, hence the explicit avoidance of these terms in the alignment of sequences. ~3 R. R. Gutell, B. Weiser, C. R. Woese, and H. F. NoUer, Prog. Nucleic Acid Res. Mol. Biol. 32, 155 (1985).
[53]
rRNA-BASED PHYLOGENY
Bacillus subtilis (Bsu) Bacillus stearothermophilus (Bst) Lactobacillus viridescens (l_vi) Acholeplasma modicum (Amo) Micrococcus luteus (M/u) weighting mask (wei)
797
10
20
30
40
50
I
I
I
I
I
UUUGGUGGCGAUAGCGAAGAGGUCACACCCGUUCCCAUACCGAACACGG CCUAGUGACAAUAGCGGAGAGGAAACACCCGUUCCCAUCCCGAACACGG UGUUGUGAUGAUGGCAUUGAGGUCACACCUGUUCCCAUACCGAACACAG UUGGUGACGAUGGCGAAGUGGAUCCACCUGUUCCCAUCUCGAACACAG GUCUGGCGGCCAUAGCGUGGGGGAAACGCCCGGUCCCAUCCCGAACCCGG 111111122222111111112222211111122222222222221111
60
70
80
90
I
I
I
I
I00
110
I
I
Bst Lvi Amo Mlu
AAGUUAAGCUCUUCAGCGCCGAUGGUAGUCGGGGGUU-UCCCCCUGUGAGAGUAGGACGCCGCCAAGC AAGUUAAGCUCUCCAGCGCCGAUGGUAGUUGGGGCCAGCGCCCCUGCAAGAGUAGGUCGUUGCUAGGC AAGUUAAGCUCAAUAGCGCCGAAAGUAGUUGGAGGAUCUCUUCCUGCGAGGAUAGGACGUCGCAAUGC AAGUUAAGCACUUCAGCGUCGAAAAUAGUCCUA. . . . . . . . AGGGGCGAAGAUAGAACGUUGCCAGGC AAGCUAAGCCCCAUAGCGCCGAUGGUACUGCAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGGACA
wei
2211222211111121•2•122222221111
11112222222112221111111
Flo. 1. Alignment of 5S rRNA sequences. Five 5S rRNA sequences are aligned so that
corresponding nucleotides are in columns. Correspondence is defined on the basis of similarity of primary and secondary structures. Also shown is a "weighting mask" that defines the relative weights assigned to each position in the evaluation of sequence similarities (the actual position-specific weight is the mask value in the given column divided by the maximum value appearing in the mask). Positions involved in base pairing are assigned half the weight of unpaired positions. The terminal regions are truncated in to the first base pair present in all of the sequences. The region including alignment positions 82-93 has been excluded because of variations in sequence length and secondary structure. Sequences are from Erdmann and Wolters. 5
in the top three sequences) until the hairpin loop is reduced to three or four nucleotides. The exact position of the length difference remains somewhat uncertain, but placing it at the end of the hairpin maximizes the structural similarity of the various molecules. As a sequence alignment progresses, it becomes possible to recognize shorter regions of similarity. This is especially true when several sequences are being aligned and there is a sequence region that, although short, is present in all of the sequences and is thus dearly nonrandom. On the whole, insertions and deletions are rare in regions of conserved function. This should be borne in mind while aligning sequences, since liberal use of gaps can almost always match up a few more nucleotides. Ultimately, if the alignment of a region remains in doubt, then it should be excluded from the analysis (below). Quantitation of S e q u e n c e Similarities The similarity of two sequences is generally defined as the fraction of corresponding sequence positions that contain identical nucleotides. Two
798
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
identical sequences have a similarity of 1.0; two random RNA sequences that each contain equal amounts of each of the four bases and no alignment gaps have a similarity of 0.25 (on average). Alignment gaps are not really a fifth type of nucleotide, therefore their treatment in the calculation of sequence similarity tends to be somewhat arbitrary. Most treatments can be described by S = M/L
( 1)
L = M + U + w~G
(2)
where S is the sequence similarity, L is the effective sequence length, M is the number of aligned sequence positions with matching (identical) nucleotides, U is the number of positions with mismatched (nonidentical) nucleotides, w~ is the weight given to positions that contain a gap, and G is the number of positions with a gap in one sequence juxtaposed with a nucleotide in the other. Typical values of wo range from zero to one; we use a value of one-half. Since gaps are rare in the regions of unambiguous sequence alignment (this is almost a definition), the exact choice of wo tends not to affect the inferred branching order. Regions of an alignment in which there are large sequence-to-sequence variations in length require special consideration. For example, 10 consecutive alignment gaps are almost certainly not equivalent to 10 separate gaps scattered throughout a sequence alignment; the former might well represent a single mutational event, while the later are much more likely to be 10 independent events. To limit this discrepancy, we generally limit our counting of consecutive alignment gaps to five. There is, however, an overriding factor that limits the role played by the preceding paragraph. The inference of phylogeny from sequences is wholly dependent on the assumption that the nucleotides compared are evolutionary homologs. When this homology is in doubt, due either to uncertainties in the alignment or to the absence of a homolog, as in the case of a large gap, then it is not meaningful to include the questionable regions in the analysis. The elimination of problematic data from a phylogenetic analysis cannot be overemphasized. We sometimes also consider rRNA secondary structure when quantitating sequence similarities. 14 Maintenance of secondary structure constrains the primary structures of rRNAs; the two positions that constitute a base pair cannot vary independently (this covariance is the basis of phylogenetic "proof" of secondary structure). Therefore, if paired positions are treated the same as unpaired positions, the identity (or nonidentity) of base pairs will be counted twice in the calculation of sequence similarities. ,4 D. A. Stahl, D. J. Lane, G. J. Olsen, and N. R. Pace, Science 224, 409 (1984).
[53]
rRNA-BASED PHYLOGENY
799
TABLE I ESTIMATION OF EVOLUTIONARY DISTANCES BETWEEN 58 r R N A s
Sequence pair ~
Weighted matches b
Weighted mismatches ~
Weighted gapsd
Net similarity¢
Estimated evolutionary distancef
Estimated uncertainty of distance#
B s u - Bst B s u - Lvi Bsu-Amo B s u - Mlu Bst- Lvi Bst-Amo B s t - Mlu Lvi-Amo Lvi-Mlu Amo-Mlu
63.5 61.0 56.0 60.0 56.5 54.5 61.5 57.5 52.0 50.5
11.5 14.0 19.0 15.0 18.5 20.5 13.5 17.5 23.0 24.5
0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
0.847 0.813 0.747 0.800 0.753 0.727 0.820 0.767 0.693 0.673
0.1715 0.2147 0.3091 0.2326 0.2991 0.3399 0.2058 0.2795 0.3943 0.4289
0.0522 0.0600 0.0758 0.0630 0.0743 0.0809 0.0584 0.0708 0.0902 0.0960
a Abbreviations are as in Fig. 1. b Weighted number of sequence alignment (Fig. 1) positions containing identical nucleotides in the given pair of sequences. As above, but containing nonidentical nucleotides. d As above, but with a nucleotide juxtaposed to an alignment gap. e Sequence similarity defined by Eq. (1). Y Evolutionary distance as average number of accepted point mutations per sequence position from Eq. (3). z Square root of variance of evolutionary distance estimates, Eq. (9).
When comparing 5S rRNA sequences, we frequently assign half as much significance to nucleotide comparisons at known base-paired sequence positions as to comparisons at unpaired positions. This operation is conveniently combined with the exclusion of regions of dubious homology by including a position-specific weighting factor in the sequence similarity calculation, as illustrated by the "weighting mask" in Fig. 1. Nucleotides that are generally base paired in the 5S rRNA are indicated by a 1, while unpaired positions are marked by a 2? 5 The mask assigns zero weight (blanks) to regions of questionable structural homology among these sequences. Table I gives the number of weighted matches, mismatches, and gaps for each sequence pair, and the resulting sequence similarities. Sequence similarities provide a simple method for recognizing closely related species. However, with the exception of identical or nearly identical sequences, it is generally more informative to infer an evolutionary tree (i.e., branching order) from the sequence data. ,5 Some of the assignments are subject to debate because 5S rRNA contains several "paired" positions that do not display nucleotide covariation with their presumptive partner, and other positions that seem to reflect non-Watson-Crick pairing rules.
800
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
Phylogenetic Trees
Nomenclature A classical phylogenetic tree begins at a "root" and through a series of branchings (bifurcations) gives rise to a set of contemporary organisms. Each branch point represents the most recent common ancestor of the lineages that derive from it. The root of the tree is the most recent common ancestor of all the organisms in the phylogeny. The branching order, without regard to the length of the segments, is the "topology" of the tree (to a cladist, a rooted topology is a "cladogram"). ~6 In a molecular phylogeny, branch lengths do not indicate time per se, but rather an extent of evolution. This difference is critical to drawing valid conclusions from molecular phylogenies because not all lineages evolve at the same rate. An additional property of molecular phylogenies is that the location of the root node is generally not determined, instead one deduces an "unrooted phylogenetic tree," also called a "network." Although the term "branching order" has temporal connotations, it is also used more loosely to refer to the topology of networks. There is a special sense in which molecular phylogenies provide information about the root of a tree. If a phylogeny is inferred for a limited group of sequences, but also includes an "outgroup" (one or more sequences that are assumed to lie entirely outside of the group of interest), then the node that joins the outgroup to the group of interest is the root of the more limited tree. There is no outgroup for a universal phylogeny, so multikingdom trees are more problematic (although gene duplications in the universal common ancestor provide at least the possibility of solving this problem, too).
Cluster Analysis A simple method of inferring a phylogenetic tree from sequence data is cluster analysis (also called phenetic analysis). Cluster analysis determines the branching order of the tree based on a table of similarities of all pairs of molecules by sequentially building groups of the most similar molecules.~7 Cluster analysis is very general, any measure of similarity (or difference) can be used. Types of data to which cluster analysis is frequently applied 16Other terms in the literature: branch points in the tree are sometimes referred to as "vertices," "internal nodes," or simply "nodes"; the lines that join nodes (or nodes to organisms)are "branches,""tree segments,"or "edges";and the ends of segmentsleading to organismsare also called"tips," "terminalnodes,"or "leaves." 1~p. H. A. Sheath and R. R. Sokal, "Numerical Taxonomy."Freeman, San Francisco, California, 1973.
[53]
rRNA-BASED PHYLOGENY
801
include pairwise sequence similarities, antibody cross-reactivity, DNA/ DNA hybridization, or the 16S rRNA oligonucleotide catalog similarities. The method is, however, relatively sensitive to lineage-to-lineage differences in evolution rate. ~8 Ways to minimize this difficulty have been suggested. ~9
Parsimony The principle of parsimony is the basis of another common method of phylogenetic tree inferenceY° The method seeks the phylogenetic tree that can accommodate the sequence data with a minimal number of nucleotide substitutions. In doing so, an ancestral sequence is derived for each branch point in the inferred tree, hence this is also referred to as the ancestral sequence method. Parsimony is subject to systematic errors when large lineage-to-lineage differences in evolution rate are combined with large amounts of sequence change. 2~
Approximate Additive Evolutionary Trees An approximate additive evolutionary tree is based upon estimates of the total evolutionary separation between pairs of contemporary sequences. 22 The method finds the tree for which the distances separating pairs of sequences in the tree best match the estimates of their evolutionary separations from the sequence data. This is the method of tree inference that we use, and is described below. 23 Inference of an Approximate Additive Evolutionary T r e e
Evolutionary Distance and Additive Trees Figure 2 shows the evolution of two contemporary sequences, B and C, from their most recent common ancestral sequence, A. The "evolutionary ~s D. H. Colless, Syst. Zool. 19, 352 (1970). 19W.-H. Li, Proc. Natl. Acad. Sci. U.S.A. 78, 1085 (1981); L. C. Klotz and R. L. Blanken, J. Theor. Biol. 91, 261 (1981). 2o W. M. Fitch, Syst. Zool. 20, 406 (1971). 21 j. Felsenstein, Syst. Zool. 27, 401 (1978). 22 W. M. Fitch and E. Margnliash, Science 155, 279 (1967). 23 We have written computer programs to facilitate seqtaence comparisons and phylogenetic tree inference. One program is a screen-oriented editor for manipulating and analyzing collections of aligned sequences. A second program is used for the inference of approximate additive evolutionary trees. Both programs are written in FORTRAN-77 for use with the VAX/VMS operating system. The editor requires a terminal with the capabilities of a Digital VT100. These programs are available from the author.
802
[53]
MATHEMATICAL AND COMPUTER ANALYSIS B
C FIG. 2. Schematic representation of the evolution of sequences B and C from their most recent common ancestor A.
distance" for A to B, xna, is defined as the average number of fixed-point mutations per sequence position that accumulated in the lineage linking them. Note that the number of fixed mutations (a full accounting of events) may be greater than the number of observed sequence differences (see below). Similarly, the evolutionary distance from A to C, XAc, is the average number of fixed-point mutations per sequence position in that lineage. Because evolutionary distances are based on events, they are addifive. Hence, the evolutionary distance separating B and C is the sum of their distances from their most recent common ancestor, or Xac = XAn + XAC.
The additivity of evolutionary distances has a profound consequence: if all of the pairwise evolutionary distances separating contemporary sequences are known, then it is possible to derive a unique evolutionary tree that accommodates the data. Figure 3 gives a simple example of pairwise distance data (a) and the corresponding phylogeny (b). The phylogeny is drawn as a network, or unrooted tree. Identifying the root of the tree (the location of the common ancestor) would require additional assumptions.
Estimating Evolutionary Distances As mentioned above, the observed number of sequence differences is not synonymous with the number of fixed mutations. This is primarily a consequence of the occurrence of multiple mutations at a sequence position. Jukes and Cantor ~ derived an equation for estimating evolutionary distances from observed sequence similarities: x = - 3/4 1n[4/3(S - 1/4)]
(3)
where x is the estimated evolutionary distance, S is the observed sequence similarity, and In is the natural logarithm. The derivation of Eq. (3) 24 T. H. Jukes and C. R. Cantor, in "Mammalian Protein Metabolism" (H. N. Munro, ed.), p. 21. Academic Press, New York, 1969.
[53]
rRNA-BASED PHYLOGENY a Sequence Evolutionary pair distance
A-C A-D 8-C B-D C-D
803
b C o.2/~/
0.5 0.7 0.6 0.8 0.6
o.2 Bj
FIG. 3. Example of an additive evolutionary tree. (a) A set of pairwise distances between four hypothetical sequences, A, B, C, and D. (b) The corresponding unrooted phylogenetic tree. The tree segments are labeled with their lengths. Summing the lengths of the segments connecting any pair of sequences precisely reconstructs the appropriate pairwise distance in the original data table (a). For example, the distance from A to B is 0.1 + 0.2 = 1).3.
assumes that all sites are equally and independently mutable, mutations to each of the alternative nucleotides are equally likely, and there are no inserts or deletions. Because of the simplifications introduced by these assumptions, the correction for superimposed mutations is conservative. The consequences of this will be discussed below (see Systematic Errors). Although numerous alternative corrections have been proposed, we routinely use Eq. (3). Fitting Evolutionary Distances to a Tree Topology
Equations (1)-(3) reduce the aligned sequence data to a set of pairwise evolutionary distance estimates. Because these are only estimates of the evolutionary distances, they will not, in general, precisely fit any additive tree. Thus it is necessary to find the additive tree that "best fits" the distance estimates. We have chosen to define the "best gee" as that which minimizes the weighted mean square difference between the evolutionary distance estimates and the corresponding sequence-to-sequence distances in the tree. Specifically, E = 1 / P ~ Wa(Xo - x'a)2
(4)
a
P = N(N-
1)/2
(5)
where E is the "weighted mean square error" in the tree representation of the distance data, P is the number of pairwise distances in an N sequence tree, a is an index over all pairwise combinations of sequences, x= is the estimated evolutionary distance separating the ath pair of sequences, x'. is the tree representation of that distance, and wo is the weight assigned to the the ath pairwise distance (see below). The tree representation of the ath
804
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
pairwise distance is the sum of the lengths of the tree segments joining the two sequences. That is,
x" = ~ Toisi
(6)
i
where i is an index over the 2N-- 3 segments in an N sequence tree, st is the length of the ith tree segment, and T~ is zero unless the ith segment is in the path connecting the ath pair of sequences, in which case its value is one. Thus the matrix T contains the information about the tree topology, and the vector s contains the tree branch lengths. Combining Eqs. (4)-(6) yields
E--N(N--
1) ~ wa x . -
~ s, Ta,
(7)
i
Because the certainty of an evolutionary distance estimate is a function of the distance value and the amount of sequence data analyzed, we weight the corresponding error term by the reciprical of its variance: w, = 1/t72
(8)
where a2~ is the variance of the determination of xa. Kimura and Ohta 25 calculated this value: 16La(S~- 1/4)2
(9)
where S~ is the similarity of the a th sequence pair and La is the number of independent nucleotides compared in determining S a. For La, we use the effective sequence length from Eq. (2); in this manner we can avoid double-counting base-paired nucleotides and obtain a treatment of gaps that is consistent with that used in determining So. Equation (9) explicity indicates the merit of analyzing larger molecules. The least-square formulation of the tree error has the merit of permitting analytic solution for the optimal tree branch lengths for any given topology, assuming that the wa values do not explicitly depend on the si values. The branch lengths that minimize the tree error are found by equating the partial derivatives of the error with respect to the branch lengths to zero:
OF. ----0
osj
25 M. Kimura and T. Ohta, J. Mol. Evol. 2, 87 (1972).
(10)
[53]
r R N A - B A S E D PHYLOGENY
805
where j is any tree segment number. The optimal s1 values are found by substituting Eq. (7) into Eq. (10), taking the partial derivatives, and solving for s;. Defining y as a 2N-- 3 element vector and A as a 2 N - 3 by 2N - 3 element matrix such that yj =
wj',x.
(l l)
a
A o = ~ waTaiT,#
(12)
si = ]~ A~' yj
(13a)
Then, it can be shown that J
where A-~ is the inverse of matrix A. In summary, given the pairwise distance estimates (x), their corresponding weights (w), and a specific tree topology (in the form of T), then Eqs. (11) and (12) are used to find y and A, the matrix A is inverted by any standard technique, ~ and the optimal s~ values are then given by Eq. (13a). There is, however, one catch: these equations can give negative s; values. Because a negative number of evolutionary events is nonsensical, the definition of the optimal phylogenetic tree should have explicitly required nonnegative tree branch lengths. We work around this difficulty by assigning zero length to any segment for which Eq. (13a) gives a negative value. That is, we replace Eq. (13a) with
si=max(~ A~l yj, O)
(13b)
-j
Because all the branch lengths in the "best tree" are usually greater than zero, the details of this treatment can be somewhat arbitrary. 27 Ultimately the error for the given tree branching order is found by substituting the values of si from Eq. (13b) into Eq. (7). 26 The inversion of matrix A consumes the majority of the computational time in our program. Therefore effort devoted to locating a fast matrix inversion routine for a given computer will be rewarded. For large trees, eificiently evaluating the fight side of Eq. (12) is also important since brute force solutions require time proportional to N 4. Because most of the elements in T are zero, it is faster to work from a list of nonzero elements than to multiply the matrices directly. 27 When Eq. (13a) gives only nonnegative st values, then Eq. (13b) is a rigorous solution. Because this generally includes the "'best tree," the use of Eq. (13b), rather than a more time-consuming linear programming solution, primarily affects the evaluation of some suboptimal trees, Equation (l 3b) leads to overstatement of the tree error whenever negative values are suppressed (set to zero). When the magnitude of the negative value is small, then this effect is also small, and so Eq. (13b) provides at least a relative measure of how good the given branching order is.
806
MATHEMATICAL A N D
COMPUTER ANALYSIS
[53]
Finding the Optimal Branching Order For a given topology, the preceding methods suffice to find the optimal branch lengths and the corresponding tree error. They do not, however, include a prescription for finding the best branching order. No method is known for "deriving" the best branching order of a tree of this type (this is true of parsimony methods as well).2s Instead, it is necessary to systematically search for the best tree. The number of distinct branching orders of N sequences is ( 2 N - 5)! 2N-3(N - 3)1
(14)
where ! is the factorial operator. Table II gives values of this expression for a variety of tree sizes. It is clearly impossible to evaluate all the possible branching orders of a larg~etree in order to find the best tree. We use an approach that is based on repeated improvements to a preexisting tree. Each cycle has a starting tree (the lowest error tree found to that point). A specific set of rearrangements of the starting tree is evaluated as alternative topologies. Of the alternatives evaluated, the best is taken as a new starting tree and the process is repeated. If none of the alternatives tested has a lower error than the starting tree, then the starting tree is taken to be the best tree. The types of tree rearrangements examined define the "vicinity" around the starting tree that is searched for improved branching orders. As alternatives, the program considers all phylogenetic trees that can be achieved by either of two classes of rearrangements of the starting tree. 29 First, a portion (subtree) of the starting tree is removed, and then reattached at an alternative location. This is carded out for every possible subtree and every possible point of reattachment. Second, each subtree is successively exchanged with every other subtree. Although it varies somewhat with the details of the starting tree, the number of independent rearrangements examined by the procedure is approximately 6N 2 - 4 2 N + 74
(15)
Table II gives values of this expression for various tree sizes. It can be seen that only a miniscule fraction of the unique tree topologies is examined. 2s The method of De Soete [G. De Soete, Z. Naturforsch., C: Biochem., Biophys., Biol., Virol. 38, 156 (1983)] might be said to "derive" the optimal tree topology. By minimizing an expression containing on the order of N4/24 terms, a perfectly additive pairwise distance matrix is derived. A unique branching order is deducible from this distance matrix. 29G. J. Olsen, Ph.D. the°As. University of Colorado Health Science Center, Denver, Colorado, 1983.
[53]
rRNA-BASED PHYLOGENY
807
TABLE II NUMBERS OF EVOLUTIONARYTREES
Number of sequences
Unique tree topologiesa
Unique alternatives tested b
5 10 15 20 25 30
15 2.0 × 106 7.9 X 1012 2.2 × 1020 2.5 × 102s 8.7 X 1036
14 254 794 1634 2774 4214
a Number of unique topologies of an N organism tree [from Eq. (14)]. b Approximate number of variations of the starting tree tested in search of a better tree during a "cycle" of tree optimization [from Eq.
(15)]. The tree optimization process is time consuming for trees containing many sequences. The determination of the tree error requires a period of time proportional to N ~. Since the number of trees examined in a tingle cycle of searching for an improved tree rises as N 2, cycles of optimization require time proportional to N s. For a 32-organism tree, approximately 3 hr o f V A X 11/780 CPU time are required for a single cycle, and several cycles of improvement might be required before the program converges at the presumptive optimal tree) ° On the other hand, because of fifth power law, smaller trees can be inferred much more rapidly. The unrooted phylogenetic tree that optimally fits [by Eq. (13b)] the 5S rRNA pairwise distances in Table I is presented in Fig. 4A. Table III summarizes the estimated evolutionary distances and their tree representations. The weighted mean square distance error for this reconstruction is 0.0262 (typical values for larger trees are 0.1 to 0.3). The Micrococcus luteus 5S rRNA sequence was included in the tree to serve as an outgroup to the other organisms (see Fig. 4 legend). A rooted form of the tree is presented in Fig. 4B. A dramatic feature of this tree is the variation in the extent to which the contemporary sequences have diverged from their common ancestor. The rapid evolution of mycoplasma rRNAs has been noted previously) ~ 3o For a random starting tree, the number of cycles of optimization is much larger; it is on the order of the number of sequences. 31 C. R. Woese, E. Stackebrandt, and W. Ludwi& J. Mol. Evol. 21, 305 (1985).
808
[53]
MATHEMATICAL AND COMPUTER ANALYSIS
A
[ B subtilis 10.048
8. s t e o r o t h e r m o p h l ~
luteus "
B
L vl?idescens
\
A modicum
o,o~ B. subtilis 0.171
• A. modicum
o1~steKothermopNlus
~- M. luteus FIG. 4. Evolutionary tree of 5S rRNA sequences. (A) Unrooted representation of the optimal tree relating the 5S rRNA sequencesfrom Fig. 1, Tree segmentsare labeled with their lengths. (B) Same tree with a root placed in the segment joining the 5S rRNA of Micrococcus luteus, a "high G + C gram-positive" bacterium, to the sequences from "low G + C grampositive" bacteria.
TABLE III ERROR IN 55 rRNA TREE REPRESENTATION OF PAIRWISE DISTANCE ESTIMATES
Sequence pair* Bsu - Bst B s u - L vi Bsu-Amo B s u - Mlu B s t - Lvi Bst- Amo Bst Mlu Lvi-Amo Lvi-Mlu A m o - Mlu -
Contributing segrnentsb 0.0483 + 0.0522 0.0483 + 0.0701 0.0483 + 0.0701 0.0483 + 0.0522 0.0522 + 0.0650 0.0522 + 0.0650 0.0650 + O. 1409 0.1084+0.1711 0.0522 + 0.0701 0.0522 + 0.0701
+ + + + + +
0.0650 0.1084 0.1711 0.1409 0.0701 + 0.1084 0.0701 + 0.1711
+ 0.1084 + 0.1409 + 0.1711 + 0.1409
Tree distance ~
Estimated distance d
Pair weight"
Error contribution f
0.1655 0.2269 0.2895 0.2414 0.2958 0.3584 0.2058 0.2795 0.3716 0.4343
0.1715 0.2147 0.3091 0.2326 0.2991 0.3399 0.2058 0.2795 0.3943 0.4289
366.7 251.7 174.3 252.1 181.4 152.9 293.5 199.4 123.0 108.4
0.00133 0.00415 0.00667 0.00194 0.00020 0.00521 0.00000 0.00000 0.00633 0.00031
= Abbreviations as in Fig. 1. b Lengths of the tree branches (see Fig. 4) in the path connecting the sequences in each pair. c Total length of tree segments in column 2. d Estimated separation for given sequence pair from Table I. e Weight assigned to the given sequence pair from Eqs. (8) and (9). r Contribution to tree error, Eq. (7), of the given sequence pair.
[53]
rRNA-BASED PHYLOGENY
809
Because this method of finding the optimal tree examines such a small fraction of all branching orders, it is necessary to consider the possibility that the optimal tree is overlooked (i.e., that the presumptively optimal tree is just a "local optimum"). This is most usefully addressed empirically. We have sought, but have not encountered, a phylogeny in which different starting trees led to different "optimal trees." In addition, we sometimes examine a larger vicinity around a presumptively optimal tree, but have never found additional improvement as a result of doing so. In spite of this performance record, it would be unwise to become overly confident. Although failures of the procedure might be rare, it is definitely possible to have data and a starting tree for which this optimization procedure identifies the wrong tree as optimal. The likelihood of this depends on the nature of the true phylogeny, the quantity and quality of the data, and the way in which the tree error is defined. One generalization that can be made is that the likelihood of finding the optimum tree decreases as the number of nearly optimal solutions increases. The occurrence of many nearly optimal solutions is characteristic of a phylogeny that includes many closely spaced branch points, where "close" is relative to the intrinsic resolution of the data. Thus, the use of longer sequences not only increases the statistical significance of the optimal branching order, but it also helps find the branching order. This method of finding the optimal tree does not lock in "known" (or "obvious," "self-evident," etc.) relationships. The program might waste substantial time testing "ridiculous" tree topologies, but it does not build in preconceived ideas. If the inferred tree should seem biologically nonsensical, then one can ask, "why?"
A First Guess at the Branching Order The preceding discussion assumes the existence of a starting tree. This initial topology can be entered manually or it can be an "educated guess" by the phylogeny inference program. There are several methods of constructing a reasonable guess of the tree topology; we have chosen to use a method that is similar to the optimization described above, and that is not limited to additive evolutionary trees, but can be used with any definition of tree error. The initial tree is built one sequence at a time. With three sequences, there is only one possible topology, so the starting point is a tree with three sequences connected to a single node. It is possible to add the fourth sequences to any of the three segments in this tree. The error corresponding to each of these four-sequence trees is determined, and the best is retained. The process is repeated, adding sequences one at a time. Thus, to
810
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
add the Nth sequence to the tree, the effect of inserting the branch point to the new sequence into each of the 2 N - 5 segments of the N - - 1 sequence tree is evaluated, and the best of these alternatives is selected. Validity of Inferred T r e e s
Random Errors The advantage of analyzing longer versus shorter sequences was pointed out above. Because of the element of randomness in the accumulation of fixed mutations, large amounts of sequence information are required to assure an adequate sample of the evolutionary progression under study. If one examines a small number of highly conserved sequence positions, then there is a significant chance that no mutations were fixed at these positions during the interval separating two branch points of interest. If one attempts to avoid this difficulty by examining a small number of more variable sequence positions, then there is a substantial risk that the small number of changes that occurred during the evolutionary interval of interest will be diluted beyond recognition by the other changes that occurred during other intervals. This is a signal-to-noise problem, and the solution lies in averaging over sufficient numbers of sequence positions. The exact relationship between the amount of sequence information used in its inference and the precision of a phylogeny is not easily determined. The variance of the evolutionary distance estimates, Eq. (9), provides one indicator. However, a substantial fraction of the uncertainty applies only to the lengths of the longest tree branches. An empirical confidence test of the branching order is discussed below.
Systematic Errors Departures from the assumptions that underlie a given tree inference technique can lead to systematic errors in the inferred tree. Golding 32 has shown that the assumption that all sequence positions evolve at equal rates, used to derive Eq. (3), results in substantial underestimation of large evolutionary distances. This tends to cause rapidly evolving lineages to branch too early in the inferred tree (too close to the center of a network). Errors of this type are most likely when the tree includes very distant sequences (such as a representative of a different kingdom serving as an outgroup) and when the rapidly evolving sequence has no moderately evolving, close relative in the tree) Although there are alternatives to Eq. 32G. B. Golding, Mol. Biol. Evol. 1, 125 (1983).
[53]
rRNA-BASED PHYLOGENY
811
(3) for estimating evolutionary distances,33 many of them are internally inconsistent when applied to multiple sequences. Generally, we attempt to identify specific difficulties in the inferred topology by varying the sequences included in the tree (below). Consistency Checks
There are simple consistency checks that can be applied to phylogenetic trees. The branching orders inferred separately from different molecules, or from nonoverlapping portions of a single molecule, should be in agreement to within the limits of their statistical uncertainties. If the inferred trees are unreasonably different, then there is some other problem with the analysis (e.g., alignment errors, systematic errors in the methodology, or lateral gene transfer). If the inferred trees are similar, then this operation serves as an empirical examination of the statistical uncertainties. This technique is particularly applicable to 16S rRNA, which is large enough to provide several independent similarity values. 29'34 It is also possible to randomly sample positions in the sequence alignment; this is called boatstrapping 3s or jackknifing36 depending on whether the sampling of positions from the alignment is with or without replacement. A second type of consistency check examines trees that are inferred with partially overlapping collections of sequences: congruent branching patterns should result for the sequences that are common to the trees. This test is particularly relevant in detecting systematic errors when the tree contains sequences with widely varying evolution rates (a factor that is evidenced by substantial differences in evolutionary distances between contemporary sequences and their most recent common ancestor) because there is an increasing tendency for erroneous topologies to be inferred as very distant sequences are added to the tree. A common, but not universal, property of trees with large systematic errors is an unusually high error value. In particular, if the addition of one or two sequences to a tree greatly increases the mean error, then there is a problem with the placement of these sequences (or they create a problem with the placement of sequences already in the tree). One special case of the influence of organism content 33In one alternative treatment it is assumed that there is a log-normal distribution of substitution rates over the sequence positions [G. J. Olsen, Cold Spring Harbor Syrnp. Quant. Biol. 52, 825 (1987)]. The inferredbranchingorders were foundto be much more consistentthan whenall sequencepositionswereassumedto haveequalsubstitutionrates. 34R. McCarroll,G. J. Olsen, Y. D. Staid, C. R. Wocse,and M. L. Sogin,Biochemistry 22, 5858 (1983). 35j. Felsenstein,Evolution (Lawrence, Kans.)39, 783 (1985). D. Pennyand M. Hendy,Mol. Biol. Evol. 3, 403 (1986).
812
MATHEMATICAL AND COMPUTER ANALYSIS
[53]
on tree topology occurs during the "building" o f the tree (above). I f the tree is insensitive to the addition a n d r e m o v a l o f sequences, then the tree inferred by sequentially adding sequences will be the optimal tree. Acknowledgments Special thanks to Norman Pace for comments and suggestions on the manuscript. This work was supported by NIH grant GM34527 to N. R. Pace and ONR grant NI4-86-K-0268 to G.J.O.
AUTHOR INDEX
813
Author Index Numbers in parentheses are footnote reference numbers and indicate that an author's work is referred to although the name is not cited in the text. A
Ab, G., 704 Abad-Zapatero, C., 104 Abdel-Meguid, S. S., 174 Abdurashidova, G. G., 344, 345, 355(38, 39, 40, 41, 42, 43a) Abel-Maguid, S. S., 104 Abo, M., 379, 380(10), 381,393(10) Abo, S. R., 168 Achary, A. S., 346, 355(68) Adkins, H. J., 178, 181(18) Adrian, M., 34 Agalarov, S. C., 105 Aita, S., 760 Akasaka, K., 150 Alberts, B. M., 223 Alberty, R. A., 213, 218(19) Allet, B., 420 Alt, J., 760 Altbauer, A., 30 Amils, R., 273, 347 Amons, R., 149, 153(13) Amos, L. A., 3, 4(6), 5(6), 97 Andersen, A., 463, 466 Andersen, H. D., 464, 467(40) Anderson, J. E., 104 Anderson, J., 475 Andersson, D., 615, 619(16), 622(16), 626(16) Andrews, D. W., 7 Antonsson, B., 600, 665 Apgar, J., 779 Apirion, D., 508, 717 Arad, T., 98, 100, 103(18), 105, 107(55) Aria, K., 632 Armadja, J., 287, 290, 292, 294(8), 298(8, 9, 10) Arnon, R., 265 Arratia, R., 766
Ashman, K., 544, 545, 547(24), 54~26, 27), 564(24) Aslanov, K. A., 344, 355(38, 39) Assenza, S. P., 181 Atabekov, J. G., 440, 442 Atmadja, J., 319, 326(11) Aubert, M., 723 Aune, K. C., 209 B
Baan, R. A., 244, 410 Babkina, G. T., 344, 345, 355(35, 36) Babkina, V., 467 Bacheilerie, J.-P., 327, 795 Backendorf, C., 410 Backman, K., 693, 694, 737 Baker, T. S., 3, 5, 8(1), 9(1), 21(27), 22(1), 36 Bald, R., 346 Balian, G., 264 Ballesta, J. P. G., 78, 343, 344, 347, 358(6) Baratova, L. A., 426, 454, 466 Barbieri, M., 99, 105(24) Bard, Y., 129 Barrantes, F., J., i i, 14 Barrell, B. G., 179, 716 Barritault, D., 64, 87, 312 Barta, A., 344, 349(19), 354(19), 361, 362, 363(4), 364(4), 371(3), 412, 459, 463(27), 481 Bands, K. S., 105 Bartunik, H. D., 105 Basilio, C., 634 Baskayeva, I. D., 345, 355(43a) Battey, J. F., 750, 754(7), 757(7) B~iumert, H. G., 178 Baumiester, W., 12 Bausk, E. V., 344, 355(35, 36, 37) Beauclerk, A., 457, 458(8)
814
AUTHOR INDEX
Bedbrook, J. R., 748 Behlke, J., 153, 458 Beiser, S. M., 493 Belagafe, R., 181 Belfort, M., 419 Belitsina, N. V., 631, 6320, 2, 3), 636(1), 638(1), 643, 644(3), 645(3) Bellemare, G., 723 Belyanova, L. P., 426 Benson, J. R., 542 Benson, N. R., 347, 358(117) Bentley, G. A., 116 Benzecri, J. P., 15, 16(59) Benziger, R., 223 Bere~ P., 204 Bergland, G. D., 10 Berlin, Y. A., 450 Bemabeu, C., 78 Bertram, S., 722 Berzin, I. M., 442 Berzin, V. A., 345 Bevington, P. R., 128, 537 Beyer, W. A., 768 Bibner, M. D., 750, 754(7), 757(7) Biclde, T. A., 64, 138, 533, 581 Bielka, H., 344, 345, 346, 347, 358, 359, 360(142), 458 Bierbaum, J., 378 Biernat, J., 382 Bijholt, M. M. C., 42 Bilgin, N., 614, 615(14), 618(14), 619(14) Bilofsky, H. S., 765 Bimboim, H. C., 23 l, 679 Bjerring, P., 466 Bladimorov, S. N., 345 Blanquet, S., 242, 670 Blew, D., 181 BlOcker, H., 290, 294(8), 298(8), 305, 309(8), 319 Blomberg, C., 613 Bloom, A., 181 Blundell, T. L., 104 Bochkareva, E. S., 156, 345, 346, 355(73) BOCk, A., 73, 75(23), 96, 302, 543, 544, 547(21), 561(18), 56808) Bode, U., 64, 65 Bodley, J. W., 149, 150, 155(18), 392, 591, 592(17) Bogdanov, A. A., 82, 84(9), 85, 86, 87(17), 90, 91,406, 440, 454, 466, 742 Bogdanova, S. L., 440, 442, 443(8), 448
Bogorad, L., 73, 302, 748, 749, 752, 760 Bohlen, P., 382 Bfhm, H., 344, 347 Bohman, K., 615, 619(15), 622(15), 626(15) Boileau, G., 347, 352, 693, 694, 737 Bollen, A., 300, 708 Bommer, U.-A., 346 Bonner, W. M., 433 Bonnet, D., 347 Boon, T., 190 Bordasch, K., 661 Bordash, K., 97 Borgia, P. T., 611 Borleau, G., 117 Bornstein, P., 264 Bosch, L., 244, 410 Bosserhoff, A., 135, 179, 523, 524(3, 4), 528(4, 5), 531(5), 543, 550(13), 551(13), 544, 546(19), 547(19, 24), 564(24) Botstein, D., 740 Bottomley, W., 760, 761 Bouadloun, F., 611 Boublik, M., 3, 4, 8(2), 17, 20, 21(2), 36, 42, 48(28), 52, 56, 59(8), 61(8), 63, 80, 354, 376, 379, 380, 385(15), 386(15), 391, 393(1 l), 395(11, 15), 504 Boulanger, Y., 544, 546(19), 547(19) Bourgeois, S., 204 Bouthier de la Tour, C., 347, 350(104) Bowman, C. M., 188 Bowman, L. M., 752 Bowman, P., 581 Bradbury, E. M., 15 l Bradford, M. M., 240, 584 Brady, C., 737 Brakier-Gingras, L., 347 Branlant, C., 361,457, 458, 706 Brauer, D., 542, 545, 547(28) Braun, W., 256 Breitenreuter, G., 504, 515(7), 516(7) Bremer, H., 611,612(1) Brent, R., 737 Bretaudiere, J.-P., 9, 17, 18(60), 20 Brewer, L. A., 3 l0 Brimacombe, R., 259, 287, 289, 290, 292, 293(5), 294, 297, 298, 300, 301, 302, 305, 308, 309, 310, 319, 326(10, 11), 458 Bdsson, A., 98, 99(16) Brockm611er, J., 543, 544, 547(22, 23), 551 (22, 23)
AUTHOR INDEX
Brosius, J., 159, 222, 228(5), 240, 244, 259, 288, 344, 349(19), 354(19), 361, 365, 371(3), 412, 477, 481, 682, 691, 694, 697(5), 708, 720, 737 Brot, N., 51 Brothers, 163 Broude, N. E., 345, 355(43) Brown, E. L., 181 Brown, G. E., 51 Brown, P. R., 181 Brown, R. S., 116, 462, 467(35), 710 Brownell, J., 347 Brownlee, G. G., 297 Bruce, A. G., 445, 446(18), 460, 479, 726 Bruce, J., 259, 267(16) Buchardt, O., 466 Buck, M. A., 173, 347, 533, 537(5), 538(5) Budker, V. G., 345 Budowsky, E. I., 344, 345, 355(38, 39, 40, 41, 42, 43, 43a) Buisson, M., 345, 347 Burger, M., 577 Burks, C., 765, 770 Burma, D., 416 Bushuev, V. N., 148, 151,153 Butler, P., 151 Byers, B., 99 Bystrova, T. F., 90
C Cabezon, T., 708 Cahnmann, H. F., 265 Cameron, V., 204, 207(9), 208(9), 209(9) Campbell, I. D., 148 Cannon, M., 523, 543 Canonaco, M. A., 238, 257(1) Cantor, C. R., 104, 117, 175, 178, 181(18), 292, 293, 319, 320, 324(4), 325, 328(14), 329, 334, 343, 722, 802 Cantreil, M. A., 273 Capel, M. S., 117, 119, 131(8), 524, 533, 537(6) Capel, M., 64, 354, 520, 523, 524(9), 528(9) Capmau, M.-L., 347, 350(104) Carazo, J.-M., 20 Carbon, P., 319, 326(12) Carey, J., 204, 207(9), 208(9), 209(9) Carre, D. S., 390 Carrillo, N., 761
815
Caruthers, M. H., 737 Caruthersand, M. H., 568 Casadaban, M., 693, 694 Casey, J., 477 Cass, R., 271 Cech, D., 442 Cech, T. R., 419, 482 Ceglark, J. A., 215 Cerutti, P., 178 Chaconas, G., 402, 409(8) Chair,s, J. B., 346, 358(82) Chakraburtty, K., 344, 355(33), 358(33) Chambedin, M. J., 204, 207(8), 208(8), 209(8) Chambliss, G., 101,148 Chang A. C. Y., 675, 707 Chang, C. H., 761 Chang, J. Y., 545, 547(28) Chang, S. H., 179 Chang, Z., 760 Changchien, L.-M., 259, 265(14), 266(14), 267(9, 10, 12, 13), 268(14), 270, 272, 274, 276(8), 277(8) Chapeville, F., 146, 409, 584, 663 Chapman, M. N., 416 Chen, G.-X., 570 Chert, J.-K., 344 Chen-Sehmeisser, U., 458 Chernii, A. A., 345, 355(41, 43a) Chianali, G., 584 Chiaruttini, C., 310, 314(6) Chichkova, N. V., 91,406, 440, 442, 443(8), 448 Chinali, G., 373, 600, 624 Chow, C., 96 Christensen, A., 346, 421,456, 457(1), 459, 464, 467(40), 468, 733, 745 Christensen, J., 409, 456, 457(1), 459, 462, 466, 468, 710, 718, 737, 745 Chu, C. F., 500 Chu, F. K., 419 Chu, Y. G., 334 Chung, K., 52, 59(7) Chunwongse, J., 760 Church, G. M., 648 Churchward, G., 611,612(1) Cielens, I. E., 345 Ciesiolka, J., 344, 354(21, 22), 355(31), 358(31), 380, 382, 385(15, 16), 386, 391,393, 394(16, 29), 395(28), 396, 411 Cimino, G. D., 330, 337
816
AUTHOR INDEX
Clark, B. F. C., 345, 649 Clark, M. W., 100, 354, 397, 499 Clegg, C., 64 Cohen, S. N., 675, 707 Cohen, S., 693, 694, 695(13), 704 Cole, P. E., 210 CoUatz, E., 274, 344 Colless, D. H., 801 Comarmond, M. B., 648 Comstock, L. J., 742 Conde, F. P., 469 Cooperman, B. S., 118, 173, 179, 187(22), 341, 342, 344, 346, 347, 348, 349(16), 350(I, 2, 96, 101, 108, 124, 127), 351, 352(2), 354, 358(77, 124), 523, 524(2, 10), 527, 528(2, 10), 531(10), 532, 533, 537(3, 5), 543 Coulsen, A. R., 369, 467, 568, 716, 742 Court, D., 737 Cover, J. A., 117 Cowgill, C. A., 151, 523, 524(13), 526(13), 528(13), 531(13), 532(13), 533, 543 Cox, G. B., 760 Cozens, A. L., 760 Cozzone, A. J., 318 Craig, B. B., 178 Cramer, F., 177, 380 Craven, G. R., 101, 204, 214(4), 259, 265(14), 266(14), 267(9, 10, 12), 268(14), 270, 272, 273, 274, 276(8), 277(8), 442, 523, 524, 528(9), 533, 537(6) Craven, R., 119 Crawford, N., 240 Crea, R., 737 Crothers, D. M., 163, 210, 215, 722 Crouch, R. J., 441 Crowther, R. A., 10, 26 Culp, W., 187 Cundliffe, E., 457, 458(8, 9), 469, 510 Cuticchia, A. J., 761 Czernilofsky, A. P., 344
D D'Alessio, J. M., 224, 225(13) Dabbs, E. R., 68, 144, 176, 186, 187(36, 37, 39, 40), 278, 510, 511, 513, 517, 706, 707(4)
Dagert, M., 738 Dahlberg, A., 691,692, 694, 696(10), 697(6, 10), 698(10), 699, 700(8, 10), 701(8), 704(6, 8), 708(6), 738, 739(45), 740, 742(45) Dahlberg, J. E., 188 Dairman, W., 382 Dalgarno, L., 188 Dalrymple, P. N., 523 Darlix, J. L., 441 Das, O. P., 376 Datta, D., 119, 272, 276(8), 277(8), 523, 524, 528(9), 533, 537(6) Davanloo, P., 232 Davidson, N., 477 Davies, D. R., 105 Davies, J. E., 188,471 Davies, J., 101 Davies, K., 101 Davis, B. D., 709 Davis, L. G., 750, 754(7), 757(7) Davis, R. W., 477 Daya-Grossjean, L., 263, 270 de Bruin, S. H., 194, 200(8), 240, 255(10), 256(10) De Graaf, F. K., 188, 244 de Rooij, J. F. M., 244 de Vos, G., 749 De Wachter, R., 769, 795 De Wit, J. L., 148 Dean, P., 271 DeBoer, H. A., 742 Deckman, I. C., 203, 212(3), 231,233(21) deHaseth, P., 204, 207(9), 208(9), 209(9) Deisenhofer, J., 104 Delaney, P., 378 Delihas, N., 88,475 Delius, H., 752 Demsey, M. E., 149 Deng, H. Y., 670 Deng, H.-Y., 176 Denman, R., 382, 391, 393, 395(28), 396(18) Dennis, P. P., 223 Deno, H., 760, 761 DeRosier, D. J., 26, 28 Derwenskus, K.-H., 632 Desmond, E., 53, 55(9) Dessen, P., 240, 670 Dharmaraja, N., 340
AUTHOR INDEX Diaz, I., 615 Diday, E., 20 Digweed, M., 727 Dijk, J., 457, 458(8, 9), 517, 518 Dionne, C., 176, 517 Disimone, C., 237 Dix, D. B., 612, 624(6) Doberer, H. G., 273 Dobson, C. M., 148 Dognin, J. M., 542 Dohme, F., 84, 132, 185, 187(33), 278, 279, 280(5), 283(5), 654, 663, 722 Dohme, T., 258 Doly, J., 231,679 Domogatsky, S. P., 156 Dondon, J., 242, 257, 346, 358(77, 83) Donis-Keller, H., 339, 406, 408(9), 440, 445, 472, 480, 716 Donner, D., 611 Dottavio-Martin, D., 115, 177, 178(12), 187(12) Douthwaite, S., 165, 228, 346, 409, 456, 457(1), 459, 460,-462(28), 463(27, 28), 464, 468, 673, 680(6), 682(6), 710, 721, 726, 730(20), 733, 745 Downing, K. H., 6 Dowse, H., 30 Draper, D. E., 203, 205(1), 212(3), 216, 217(i), 222, 228, 231,233(21), 467, 481 Dressier, K., 346 Dreyer, W. J., 570 Dubochet, J., 34 Dubost, S., 345, 347, 355(44), 358(109) Duckworth, H., 148 Duijfjes, J. J., 410 Dull, T. J., 288, 365,477, 682, 708, 720, 737 Dull, T., 222, 228(5), 691,694, 697(5) Dunn, J. J., 226, 232 Dunn, J., 88, 691, 694, 697(6), 700(8), 704(8) Dwek, R. A., 383 Dyer, T. A., 752
E
Ebbesen, P., 466 Ebel, J.-P., 257, 293, 310, 344, 346, 355(32, 33a), 358(32, 84), 361, 393, 457, 458, 466, 523, 524(15), 528(15)
817
Eckardt, H., 135, 551,564(17), 570(17) Eckart, K., 543, 544(17) Eckermann, D. J., 346, 347, 348(94) Edel, F., 261 Edelman, M., 761 Edelman, P., 611 Edelson, R. L., 340 Efstratiadis, A., 225 Egebjerg, J., 464, 466, 467(40) Egger, H., 347, 350(116) Eggert, M., 766, 768, 774(8) Ehrenberg M., 178, 583, 612, 613, 615, 618, 619, 621(18), 622(12, 16), 623, 624(19), 625(18, 20, 24), 626(16, 18, 20, 24), 630(20, 24), 650, 651(2) Ehrenfeucht, A., 425 Ehrenman, K., 419 Ehresmann, B., 139, 140(8), 215, 257, 310, 344, 346, 355(32, 33a), 358(32, 84), 393 Ehresmann, C., 215, 257, 293, 344, 346, 355(32), 358(32, 84), 393, 457 Ehrlich, R., 508, 513 Eichenlaub, R., 707 Eichler, D. C., 493 Eikenberry, E. F., 138, 533, 581 Eisenberg, D., 3, 8(1), 9(1), 22(1), 36, 96, 494 Elson, D., 35, 64, 83, 502, 508 Elwood, H. J., 795 Endo, Y., 469, 471(6), 472(6), 473(5, 6, 7) Engelman, D. M., 64, 117, 118, 120, 126, 131(8), 354, 520 England, T. E., 445, 446(18) Else, B., 91, 504, 508(12), 509(12), 515(11, 12), 517, 518 Epe, V., 175 Epp, O., 104 Erbe, R. W., 632 Erdmann, V. A., 88, 96, 98, 103(18), 105, 106, I07(59), 109(59), 258, 273, 346, 458, 475, 721, 722, 727, 769, 794, 797(5) Erickson, H. P., 3 Ericson, M., 421 Erlanger, B. F., 261,493 Ettayebi, M., 673, 675(4), 680(4, 5), 682(4, 5), 683(4) Everett, G. A., 779 Evstafieva, A. G., 90 Expert-Bezan~on, A., 64, 76, 310, 312,
818
AUTHOR INDEX
314(6), 319, 320(4), 324(4), 325(4), 326(12), 334, 346, 358(77)
F Fabian, U., 346 Fabijanski, S., 344, 358(13) Fahnestoek, S., 96 Fahrney, D., 476 Fairclough, R. H., 117, 175 Fakunding, J. L., 240, 242(13), 249(13) Fallon, A. M., 708 Fallon, A., 551 Fanning, T. G., 420 Farney, D. E., 261 Fasold, H., 64, 300, 301(24), 310, 346 Fasold, M., 318 Favre, A., 390 Favre, M., 302 Fayat, G., 240, 670 Feeney, R. E., 176 Feher, G., 109 Fellner, P., 457 Felsenstein, J., 801, 811 Feltynowski, A., 7 Fernandez-Pruentes, C., 469 Ferris, R. J., 523, 524(13), 526(13), 528(13), 531(13), 532(13), 533, 543 Feunteun, J., 158, 165, 733 Fickett, J. W., 765 Fiefs, W., 297, 611,694, 705 Fiil, N., 718, 737 Filatov, E. S., 426 Finch, J. T., 104, 113, 116 Fink, G., 300, 301(24), 310 Firpo, E. J., 259, 267(16) Fischer, J., 648 Fischer, W., 632 Fiser, I., 347 Fisher, C. E., 379 Fitch, W. M., 801 Flamion, P. J., 523 Flatow, B. M., 673 Fl~gge, U. J., 559 Foget, B. G., 721 Fontana, A., 263 Fox, G. E., 710, 721,770, 795 Frank, J., 3, 4, 5, 6, 7, 8, 9, 10(44), 11, 14, 15, 17, 20, 21(2), 22(1, 11, 12, 13), 26,
28, 29(11), 30, 34, 36, 38, 39, 42, 48(28), 49, 63 Frank, R., 290, 294(8), 298(8), 305, 319 Franke, L. A., 344 Frankland, B., 63 Frey, P. A., 115 Fridborg, K., 104 Fried, M., 215 Friedlander, D., 532 Friedlander, J. D., 348, 354(127) Frink, R. J., 494 Fritsch, E. F., 160, 222, 223(7), 232(7), 421, 685, 752, 753(8), 755(8), 757(8), 758(8) Fritsch, E., 365, 366(24) Fritz, H.-J., 181,718 Fritz, R. H., 181 Frolova, S. B., 345 Frolow, F., 116 ' Frolow, J., 105, 107(54) Fromant, M., 670 Fromm, H., 761 Fukuzawa, H., 760, 76 l Funatsu, G., 670
41(21), 309(8),
227(7), 754(8),
G Gaida, G. Z., 440, 443(8), 448 Gait, M. J., 499 Galas, D. J., 468, 766, 774(8) Gallant, J., 61 I Galun, E., 761 Gamper, H. B., 330 Gamper, H. G., 340 Garber, M. B., 105 Gardner, M. M., 215 Gardner, R. S., 634 Garrett, R. A., 77, 165, 173, 228, 259, 263, 267(15), 270, 346, 409, 456, 457, 458, 459, 460, 462, 463, 464, 466, 467(35, 40), 468, 487, 509, 706, 710, 721,723, 726, 730(20), 732, 733, 745 Gasparro, F. P., 340 Gassen, H. G., 658 Gassmann, J., 3 Gauss, P., 425 Gavino, G. R., 64 Gavrilova, L. P., 149, 429, 436, 624, 632, 636, 643
AUTHOR INDEX
Gayda, G. Z., 91 Gehlke, J., 561 Geigenmtiller, U., 279, 283(6), 667, 668(13), 670(13) Gellert, M., 704 Geroch, M. E., 210 Gesteland, R. F., 436, 659 Gewirth, D. T., 168, 169 Gewitz, H. S., 96, 100, 104, 105, 107(5, 55) Geyl, D., 73, 75(23), 96, 302, 544, 547(21) Giangiacomo, K. M., 523, 543 Giangrande, G., 351 Gibbs, J. W., 109 Gibson, K. D., 551 Giege, R., 466 Giese, K., 756 Gilbert, P. F. C., 24, 26(72) Gilbert, W., 206, 295, 324, 339, 369, 422, 442, 443, 445, 459, 465(25), 472, 474, 475, 479, 480, 483, 701,716 Gillam, I. C., ! 81 Gilly, M., 347, 358(117) Gimautdinova, O. I., 345 Ginzberg, B. Z., 96 Ginzberg, M., 96 Ginzburg, I., 290 Giovanelli, R., 600, 665 Gift, L., 523, 524(8), 528(8), 542, 544(7) Girshovich, A. S., 156, 345, 346, 355(66, 73) Givol, D., 383 Glaser, R. M., 34 Glitz, D. G., 64, 82, 354, 493, 494, 496, 499, 504, 513(9) Glotz, C., 290, 294(7), 298(7), 309(7) Glover, J. S., 316 Glusker, J. P., 104 Goad, W. B., 765 Goelz, S., 3 i 0 Goeringer, H., 691 Goerner, G. L., 471 Gold, A. M., 261 Gold, B., 761 Gold, L., 419, 421,422, 424(15), 425 Goldansky, V. I., 426 Goidfarb, W., 3, 6, 8(1), 9(1), 22(1), 36 Golding, G. B., 810 Goldman, R. A., 347, 350(108), 355(108) Golinska, B., 310 Goloubinotf, P., 761 Golov, V. F., 149 Gongadze, G. M., 151,153, 157
819
Goodenough, D. A., 5, 21(27) Goody, K., 150 Gordon, E., 378 Gordon, G., 67 Gordon, J., 358, 359(142), 360(142), 508, 581 Gfringcr, H. U., 722, 723, 725(18), 729(18), 733, 738, 739(45), 742(45) Gornicki, P., 319, 344, 354, 355(32, 33), 358(33), 380, 382, 385(16), 386, 391, 394(16), 395(15), 396, 411 Gosh, P. K., 368 Gottesman, M. E., 640 Gourard, H., 28 Gourse, R., 691,692, 694, 696(10), 697(10), 698(10), 699(10), 700(10), 704(7), 708, 716, 717, 740 Graifer, D. M., 344, 355(35, 37) Grajevskaja, R. A., 658 Grano, D. A., 6 Grant, P. G., 347, 351,354, 358(124) Grassucci, R., 34 Gratzer, W. B., 321 Graub, G., 51 Gray, A., 365,477, 720 Gray, J. C., 760 Green, M., 4 Green, N. M., 384 Greenberg, J. R., 345, 358(60) Greenwall, P., 347 Greenwood, F. C., 316 Gregory, R. J., 468 Gren, E. J., 345, 442 Gressner, A. M., 344 Greuer, B., 290, 298(9), 305, 309(9), 319, 326(11) Griggs, J. R., 779 Grindley, N. D. F., 160 Gftneva, N. I., 345 Groebe, D. R., 234, 237(25) Groene, A., 149 Groot, G. S. P., 761 Gross, E., 264 Gruber, M., 704 Grunberg-Manago, M., 242, 257, 346, 358(77, 83) Gualerzi, C., 238, 252, 253(28), 254, 257(1), 346, 358(78) Guariguata, R., 600, 665 Gubbins, E. J., 749, 752 Guckenberger, P., 23
820
AUTHOR INDEX
Gudkov, A. T., 64, 76, 149, 151, 153, 156, 157, 312, 345, 561 Gu6rin, M. F., 87 Gu6ron, M., 584, 600 Guile, H., 308 Gully, M., 347, 358(102) Gupta, R. K., 249 Gupta, R., 240, 40 1 Gupta, S., 523 Gupta, V., 273, 533 Gutell, R. R., 77, 188, 221,240, 365, 401, 477, 720, 796
H
Haasnoot, C. A. G., 194, 199, 200, 240, 252, 255(10), 256 Hack, A., 692, 694, 703(9), 737 Haenni, A.-L., 146, 409, 584, 663 Hagenbuchle, O., 326, 481 Hahn, M., 7 Hainfeld, J. F., 50, 52, 53, 54(2), 55(9), 59(7, 8), 61(8), 63 Hall, C. C., 344, 346, 347, 348, 349(16), 350(96, 108), 354, 355(108), 532 Hall, R., 483 Hallick, R. B., 760, 761 Hamel, E., 149, 151(14), 564 Hammes, G. G., 213, 218(19) Hammons, M., 100 Hampl, H., 134, 136(4) Hanagan, D., 714, 716 Hanas, J. S., 475 Hancock, J., 732 Hitnicke, W., 14, 15 Hansen, J. B., 466 Hansske, E., 380 Hansske, F., 177 Hapka, B., 402 Hapke, B., 65, 363,402, 659, 670 Harauz, G., 4, 49 Hardesty, B., 82, 115, 175, 176, 177, 178(12), 186, 187(4, 12), 517, 670 Hardies, S. C., 232 Hardy, S. I. S., 65, 79, 151, 152(22), 185, 204, 261,273, 430, 527, 532 Harris, R. J., 347 Harrison, S. C., 104 Hartmann, M.-L, 523, 524(15), 528(15)
Hartwick, R. A., 181 Hartz, D., 422, 424(15) Hasan, T., 179, 187(22), 347, 348, 350(108), 354(127), 355(108), 523, 524(2, 10), 528(2, 10), 531(10), 532, 533, 543 Hasenbank, R., 68, 186, 509, 510, 511,513 Hausner, Th. P., 667, 668(13), 670(13) Hawley, D. A., 346, 358(79, 82) Hawley, D. K., 778 Hayashida, N., 760, 761 Hayes, D. H., 64, 87, 312, 319, 320(4), 324(4), 325(4), 334 Hayes, D., 64, 310 Hearn, M. T. W., 523, 524(14) Hearst, J. E., 319, 326, 330, 331,333(3), 334, 336(4), 337, 340, 362, 371(6), 459, 463(26), 481 Heerschap, A., 199, 256 Hegerl, R., 3, 5, 30 Heimark, R. L., 346, 358(80, 81) Held, W. A., 260, 270 Helinski, D. R., 674, 675 Heller, K., 704 Hellman, W., 4, 80, 354, 380, 385(15), 386(15), 391,395(15), 504 Hemninga, M. A., 148 Henderson, E., 354, 397, 414, 499 Henderson, R., 3, 4, 5(6), 36, 97 Hendy, M., 811 Hennemann, B., 96, 100, 105, 107(5, 55) Henningsen, M., 761 Herman, G. T., 24, 28 Hermodson, M. A., 551 Herold, M., 144, 278 Herr, W., 401,402(2), 408(2), 416 Herrmann, K. W., 761 Herrmann, R. G., 760 Herrmann, R., 222, 223(6) Hershey, J. W. B., 64, 240, 242, 243, 251, 300, 346, 358(80, 81, 88) Herzog, A., 708 Hesler, T. L., 188 Heumann, W., 346 Heus, H. A., 188, 194, 197, 198, 200, 221, 239, 240, 241(7), 252(12), 255(10), 256(10), 257 Hewick, R. M., 570 Hibasami, H., 345, 358(64) Higo, K., 96 Hilber, C. W., 240, 255(10), 256
AUTHOR INDEX Hilbers, C. W., 194, 190,200(8), 252 Hill, W., 408, 416, 49S Hill, W. E., 115,401,402, 542, 544(7) Hindennach, I., 65 Hinkle, D. C., 204, 207(8), 208(8), 209(8) Hirano, H., 543, 544(17), 564, 570(17, 45) Hirs, C. H. W., 104 Hirsch, R., 600 Hixson, S. H., 373 Hixson, S. S., 344, 373 Hjelm, H., 508 Hjelm, K., 508 Hobden, A. N., 469 Hochkeppel, H.-K., 442 Hogan, J. J., 240 Hogenauer, G., 347, 350(116) Hogle, J. M., 104 Holbrook, S. R., 648 Holley, R. W., 779 Hollingshead, C., 116 Holmes, K. C., 113 Holton, T. A., 760 Holtz, G., 611,612(4) Holy, A., 737 Homann, H. E., 97, 518, 661 Hoober, J. K., 748 Hood, L. E., 570 Hoppe, W., 3, 5, 7, 8, 25, 26, 27(77), 126 Hori, H., 563, 770 Horn, G. T., 232 Home J., 458 Homer, M., 30 Hounwanou, N., 544, 546(19), 547(19) Houston, L. L., 523 Howe, J. G., 242, 243 Hsu, L. M., 344, 355(24) Hsu, L., 378, 390(5), 391, 392(5), 393(5), 395(5) Hsu, T., 425 Huang, K. H., 117 Huber, P. W., 469, 471(6, 7, 8, 9), 472(6), 473(6, 7), 474(8, 9), 710 Huber, R., 104 Hudson, G. S., 760 Hui, C. F., 329 Hultin, T., 346 Humayun, M. Z., 496 Hunkapiller, M. W., 570 Hunsmann, N., 3 Hunter, J. B., 706
821
Hunter, J., 457, 458, 487 Hunter, W. M., 316 Hursh, D., 344, 358(9) Huysman, E., 769 Huysmans, E., 795 Hyde, J. E., 330 Hynes, R. O., 376 I
Ibel, K., 147 lkemura, T., 188 Imbault, P., 139, 140(8) Inokuchi, H., 760, 761 Inoue, T., 419, 482 lnoue-Yokosawa, N., 150, 154(17) Inouye, M., 720 Inouye, S., 720 Isaccs, S. T., 330 Ishikawa, C., 150, 154(17) Ishikura, H., 770 Isono, K., 73, 75(23), 96, 302, 544, 547(21) lto, J., 305 Ivanov, D. A., 149, 436 Ivanov, Y. V., 658 Iwasaki, K., 346, 360(89)
J Jacob, T. M., 496 Jacob, W. F., 738, 739(45), 742(45) Jacob, W., 691 Jacobson, G. R., 262 Jaenicke, L., 139 Jaenicke, R., 148 Jahn, W., I 15 Jansone, N. V., 442 Jardetzky, O., 148 Jaskunas, S. R., 708 Jay, G., 410 Jaynes, E. N., Jr., 347, 350, 358(124) Jelenc, P. C., 583, 613, 615, 619(15), 622(15), 626(15), 650, 651(2), 656(1) Jemiolo, Do, 691,694, 697(6), 704(6), 708(6) Jennings, J. C., 471 Jin, S.-W., 570 Jinks-Robertson, S., 708, 716 Johnsen, B. V., 7 Johnson, A. E., 178, 181(18), 343
822
A U T H O R INDEX
Kearney, K. R., 59 Keegstra, W., 12, 30, 38, 40(18), 43(18) Kelmers, A. D., 181,584 Kennedy, P. J., 244, 288 Kenny, J. W., 64, 151,347, 352, 420 Keren-Zur, M., 376, 391 Kerlavage, A. R., 118, 179, 187(22), 348, 354(127), 523, 524(2, 10), 527, 528(2, 10), 531(10), 532, 533, 537(3), 543 Kessel, M., 6 Khavitch, G., 106, 107(59), 109(59) Khechinashvili, N. N., 149 Khorana, H. G., 181 Kikuchi, M., 346, 358, 360(89) Kim, S. H., 648 Kime, M. J., 158, 165, 169, 173, 722 K Kimura, M., 116, 186, 187(35), 543, 544(17), 545, 564, 570(17, 45), 804 Kaempfer, R., 410 Kirichuk, V. S., 35 Kagramanova, V. K., 91,440, 443(8) Kahan, L., 101, 344, 346, 355(23), 358(75, KiriUov, S. V., 582, 597, 605, 658 76, 77, 80), 504, 510(5), 523, 533, Kirsch, H., 420 Kiselev, N. A., 35 537(3), 538(3), 543 Kjeldgaard, M., 64, 117, 131(8), 354, 520 Kahn, D., 670 Kjems, J., 456, 457(1), 463 Kakhniashvili, D. G., 624, 636 Klaasen-Boor, P., 244 Kaltsehmidt, E., 302, 347, 537, 542 Klein, B., 232 Kam, Z., 109 Klein, J., 344, 355(31), 358(31) Kaminir, L. B., 345, 355(41, 43a) Klein, R., 426 Kamogashira, T., 760 Kamp, D., 135, 179, 523, 524(3), 528(3), Kleinschmidt, A. K., 4, 61 Kleitman, D. J., 779 543, 550(13), 551(13) Kamp, R. M., 135, 179, 523, 524(3, 4, 5), Klen, J., 396 528(4, 5), 531(5), 543, 544, 547(22, 23), Kline, A. D., 256 550(13), 551, 558, 559(35), 561(18), Klootwijk, J., 188 Klug, A., 3, 26, 12,28, 104, 113, 116 564(20), 761 Kluwe, D., 727 Kanaya, S., 441 Knorre, D. G., 345 Kanehisa, M., 765 Kobets, N. D., 345 Kanny, J. W., 432 Kohchi, T., 760, 761 Kanstup, A., 466 Kohut, J., 390 Kao, T., 722 Kojouharova, M. S., 82, 84(9), 90(9) Kao, T.-H., 163, 379, 380(10), 393(10) Koka, H., 149, 151(14) Karpova, G. G., 344, 345, 355(35, 36, 37) Koka, M., 564 Karup, G., 466 Kolakofsky, D., 420 Kastner, B., 186, 510, 519 Kolb, A. J., 51 Kastner, V., 507 Kollekstionok, I. E., 345 Kato, A., 760 KoUer, T., 61,325, 752, 760, 761 Katzenstein, G. E., 526 Kolosov, M. I., 448 Kawakita, M., 632 Kolter, R., 675 Kayava, A. V., 649 Konieezny, L., 384 Kaziro, Y., 150, 154(17), 632 Kean, J. M., 203, 205(1), 217(1), 222, 228, Konisky, J., 188 Konrad, M., 150 481
Johnson, D., 354 Johnson, J. E., 104, 116 Johnson, K. D., 88, 722 Johnson, L. N., 104 Johnson, S. C., 20 Johnston, K., 346, 358(80) Johnston, T. C., 611 Jones, A., 104 Jones, R. A., 181 Jorgensen, T., 649 Joy, D. C., 63 Joyce, C. M., 160 Judek, M., 386 Jukes, T. H., 802
AUTHOR INDEX Kop, J., 240 K6pke, A., 543, 561(18), 568(18) Kopylov, A. M., 406, 440 Korn, A. P., 35 Kosykh, V. P., 35 Koteliansky, V. E., 77, 79(4), 148, 156, 429 Kozyreva, N. A., 345 Kppylov, A. M., 450 Kramer, B., 718 Kramer, G., 82, 115, 175, 177, 178(12), 187(4, 12) Kramer, W., 718 Krassnigg, F., 346 Krauss, J. S., 344 Krebbers, E., 749 Kress, Y., 99 Krol, A., 361,457, 458 Kruse, T. A., 345 Kruskal, J. B., 767 Krzyzosiak, W. J., 382, 386 Kfibler, O., 7 Kuechler, E., 341, 344, 347, 350(3), 361, 362, 363(4), 364(4), 371(3), 412, 459, 481 Kuechler, K., 344, 349(19), 354(19) Kfihlbrandt, W., 4, 98, 99(17), 100(17) Kumar, A., 467, 733 Kunitz, J., 261 Kuprijanova, E. A., 442 Kuramitsu, S., 761 Kudand, C. G., 64, 65, 79, 185, 204, 224, 261, 273, 274, 346, 358(83), 430, 527, 611, 612, 613, 615, 618, 619, 621(18), 622, 623, 624, 625(18, 20, 24), 626(18, 20, 24), 627(18, 20, 24), 630(20, 24), 631(20), 650, 651(2), 656(1), 657 Kurland, C. J., 532 Kudand, C., 583 Kursch, W., 761 Kurtskhalia, T. V., 156, 346, 355(66) Kussova, K. S., 345, 355(43) Kuster, H., 67 Kusuda, J., 760 Kyriatsoulis, A., 287, 305, 319 L Lade, B., 691,694, 700(8), 701(8), 704(8) Laemmli, U. K., 67, 242, 243(17), 302 Lake, J. A., 4, 33, 89, 98, 99(13), 130, 354, 414, 499, 503, 504, 510(5)
823
Lake, J., 35, 48(6, 7), 397 Lakowicz, J. R., 175 Lambert, J. M., 117, 347, 352, 420, 432 Lammi, M., 252, 253(28) Lamy, J., 34 Lane, D. J., 684, 685(13), 794, 798 Langer, J. A., 100 Langer, R., 7 Langridge, R., 113 Lanka, E., 347 Lapidot, J. L., 600 Lapidot, Y., 187, 584 Larrinua, I. M., 749, 752, 756, 760, 761 Larsen, N., 463 Larson, J. E., 232 Lasater, L. S., 499 Laskey, R. A., 433 Lastick, S. M., 358, 359(142), 360(142) Lattman, E., 7 Lau Fong, K.-L., 347 Laughrea, M., 257 Laursen, R., 153, 542, 561 Lawhorne, L., 223 Le Bret, M., 458 Le Gall, J. Y., 310 Lebart, L., 15, 33 Leberman, R., 665 Lecanidou, R., 210 Leder, P., 632, 641 Lee, K., 457, 458(9) Lees, R. G., 181 Leffers, H., 456, 457(1), 463, 464, 466, 467(40) LeGottic, F., 347, 350(104) Lehmann, A., 545, 547(30, 31), 564(30), 760 Lehmbeck, J., 761 Leitner, M., 344, 348(15) Lengyel, P., 634 Lenz, F., 7 Leonard, K. R., 97, 98, 100, 101(12), 103(18) Leontis, N. B., 166, 168 Lepauit, J., 34 Lerman, M. I., 149 Leroy, J. L., 584, 600 Leslie, A. G. W., 104 Lesteinne, P., 242 Leverman, R., 600 Levine, M. D., 779 Levis, R. V., 551 Levitt, M., 116, 779
824
AUTHOR INDEX
Levowitz, P., 368 Lewin, B., 781 Lewis, R. Y., 526 Lewit-Bently, A., 116 Lewitter, F. I., 765 Li, W.-H., 801 Lietzke, R., 145 Liljas, A., 105, 154 Liljas, L., 104 Lill, R., 582, 583(3), 585(3), 586(3), 597, 598(3), 601(3), 605, 607(17), 658 Lim, V. I., 649 Lim, V. J., 561 Lin, A., 274, 358, 359(142), 360(142) Lin, F.-L., 378, 379, 380, 390(5), 391, 392(5), 393(5, 11), 395(5, 15) Lin, F.-W., 344, 355(23, 24) Lin, L., 150, 155(18), 591,592(17) Liou, R., 175, 187(4), 344, 354(28), 378, 390, 391 Lipman, D. J., 766 Lipman, F., 613 Lishnevskaya, E. B., 78 Littlechild, J., 91, 224, 504, 508(12), 509(12), 515(12), 517, 518 Liu, H. K., 28 Liverani, D., 67 Lockard, R. E., 467, 733 Lorenz, S., 96, 105, 106, 107(59), 109(59), 722 Lotti, M., 91, 504, 508(12), 511, 515(7, 8), 516(7, 8), 517(8), 518 Lou, J. K., 761 Lovgren, S., 104 Lowman, H. B., 467 Lowry, C. V., 51, 83, 273, 411,476 Lucas-Lenard, J., 613 Luddy, M. A., 347 Ludwig, W., 795, 807 Luehrsen, K. R., 770 Luhrrnann, R., 344, 346 Lunch, J., 177, 178(12), 187(12) Liitgehaus, M., 509 LuRer, L. C., 64, 65, 116, 318 Lynch, J., 115, 175, 187(4) Lyttleton, J. W., 748 M
Maasen, J. A., 346, 351,355(74) Maeke, T. J., 795
Mackeen, L. A., 346, 358(75) Mackie, G. A., 457 Madison, J. T., 779 Madjar, J. J., 318 Maglott, D., 429 Magrum, L. J., 240 Mahoney, W. C., 551 Makarov, E. M. 597 Makowski, I., 100, 105, 107(54), 116 Malcolm, A. L., 224 Maley, F., 419 Maley, G. F., 419 Maly, P., 298, 302, 305, 310, 319 Maniatis, T., 160, 222, 223(7), 225, 227(7), 232(7), 365, 366(24), 421, 685, 752, 753(8), 754(8), 755(8), 757(8), 758(8) Mankin, A. S., 406, 440, 446, 454, 466 Mannela, C. A., 14 Mans, R. J., 481 Marts, R., 326 Manzara, T., 761 Mararov, E. M., 582 Margoliash, E., 801 Mark, L. G., 673 Mark, L., 691 Markmann-Mulisch, U., 760 Marquisee, M., 779 Marsh, D., 383 Marsh, R. C., 584 Martin-P6rez, J., 575, 576, 578, 579(3) Martinez, H. M., 765 Maschler, R., 509 Maskin, R., 83 Mason, J. G., 760 Matasova, N. B., 344, 355(34, 35, 36) Matheson, A. T., 96, 561,563 MaReucci, M. D., 737 Matthews, E. A., 178, 181(18), 722 Matzke, A. J. M., 344 Maxam, A. M., 295, 324, 339, 442, 443(13), 445,472, 479, 480, 716 Maxam, A., 206, 369, 422 May, R. P., 131, 145 Mayaux, J.-F., 242 McBrid, L. J., 568 McCarroll, R., 811 McCarty, K. S., 540 McCarty, K. S., Jr., 540 McClure, W. R., 778 McConkey, E. H., 358, 359(142), 360(142) McDougall, J., 466
AUTHOR INDEX McDowall, A. D., 34 McGhee, J. D., 249 MeKeehan, W., 187 McKenny, K., 737 McLaughlin, W. E., 760, 761 McLeod, E., 305 McPearson, A., 105 McPheeters, D. S., 419, 421 McPheeters, D., 422, 424(15), 425 McPherson, A., 98 Means, G. E., 176 Medvedeva, N. I., 345, 355(43) Meier, N., 401 Meinke, M., 300, 301(24), 308(22), 310 Meisenberger, O., 35 Melancon, P., 347 Melchior, W. B., 476 Meng, B. Y., 760 Mengle, L. J., 239 Merrill, S. H., 779 Messing, J., 737, 755, 757(12) Metelev, V. G., 440, 442 Mets, L. J., 73, 302 Metsis, M. L., 148 Mevarech, M., 96 Michel, H., 104 Michot, B., 327, 795 Middaugh, C. R., 526 Miki, K., 104 Milet, M., 64, 312, 319, 326(12) Miller, D. L., 379, 380(10), 390, 393(10) Miller, J., 693 Miller, N., 178 Miller, R. S., 634 Milligan, J. F., 234, 237(25) Milligan, R. A., 97, 98, 99(11, 14, 15, 16), I00(I I, 14), 103(11, 15) MilIon, R., 310, 344, 355(32),358(32),393 Milward, S., 18 l Mingioli,E. S., 709 Minnella, A., 347 Misell,D. L., 36 Mishenina, G. F., 85 Miskin, R., 290, 502, 508 Misumi, M., 591 Mizushima, S., 51, 83, 260, 273, 411,476, 52O Moazed, D., 221,259, 419, 463, 482 Mochalova, L. V., 82, 84(9),85, 86, 87(17), 90(9) Moe, J. G., 272
825
Moffatt, B., 694, 701,717 Moine, H., 257, 346, 358(84) Moller, A., 658 M611er, K., 298, 301 M611er, W., 149, 153, 346, 351,355(74), 561 Monier, R., 88, 158, 723 Monro, R. E., 429 Montandon, P.-E., 760 Montero, M. T. V., 469 Monura, M., 273 Moore, P. B., 59, 64, 117, 118, 121(10), 124, 126, 127, 128(5), 129(5), 131(8), 136, 158, 165, 166, 168, 169, 171, 173, 174, 346, 354, 355(68), 520, 532, 533(1), 539(1), 722 Moore, R. D., 249 Mora, G., 65, 79, 185, 204, 224, 261,273, 430, 527, 532 Moras, D., 648 Moreau, N., 347 Morgan, E. A., 673, 675(2, 4), 680(4, 5), 682(4, 5), 683(4), 684 Morgan, E., 691 Morgan, F. J., 523, 524(14) Morineau, A., 15, 33 Morozkin, A. D., 148 Morrison, C. A., 458, 509 Morrissett, H., 421 Morrissey, L., 425 Morse, S., 237 Mougel, M., 215, 257, 346, 358(84) MOiler, M., 176, 517 MOiler, R., 228 MOiler-Hill, B., 701 Mulligan, B. J., 749 Murao, K., 770 Murphy, R. F., 319, 320(4), 324(4), 325(4), 334 Muskavitch, K. M. T., 752 Muskavitch, Y. K., 749 MOssig, J., 96, 104, 105, 106, 107(55, 59), 109(59) Muto, A., 457
N Nagai, J., 345, 358(64) Nakamoto, T., 149, 151(14), 564 Nakashima, K., 345, 358(64) Nargizyan, M. G., 345, 355(40)
826
AUTHOR
Nashimoto, H., 278 Nau, M. M., 632 Nazar, R. N., 458, 462, 466, 563 Needleman, S. B., 767 Nelson, M. A., 421 Nesmeyanov, A. N., 426 Neuendorf, S. K., 232 Neugbauer, D. C., 11, 14 Neugebauer, K., 222, 223(6) Neumann, E., 96 Newberry, V., 259, 267(15), 457, 487 Newton, G., 238, 247(3), 249(3) Newton, I., 458 Newton, R. L., 344, 358(9) Nicholson, A. W., 346, 350(96), 354 Nick, H. P., 523, 524(14) Nicklen, S., 369, 467, 742 Nichols, B. G., 151 Niekus, H. G. D., 188 Nielsen, P., 466 Nieman, L. A., 426 Nierhaus, K. H., 84, 97, 115, 131, 132, 133, 134, 136(4), 144, 145, 185, 186, 187(33), 258, 270, 273, 278, 279, 280(5), 283, 355, 390, 408, 518, 520, 582, 597, 605, 654, 658, 661,664, 667, 668(13), 670, 706, 722 Nierras, C. R., 119, 523, 524, 528(9), 533, 537(6) Nirenberg, M. W., 641 Nishi, K., 706 Noah, M., 513 Noll, H., 65, 363, 402, 659 Noll, M., 65, 363, 402, 577, 670 Noller, H. F., 88, 188, 221, 222, 228, 240, 244, 259, 288, 310, 334, 344, 349(19), 354(19), 361, 365, 371, 401, 402(2), 408(2), 412, 416, 419, 425, 459, 462(28), 463, 476, 477, 481,482, 487, 673, 680(6), 682, 691,694, 697(5), 708, 710 720, 721,722, 723, 733, 737, 745, 766 779(9, 10), 781(9, 10), 796 Nomura M., 51, 83, 96, 101, 185, 187(31), 188 209, 258, 260, 270, 278, 411,476, 504 510(5), 520, 691,694, 704(7), 708, 716 717 Nordan D. H., 223 Norden B., 466 Norris, F., 718, 737 Norris, K., 718, 737 Novak-Hofer, I., 576, 578
INDEX
Nover, L., 576, 577(6) Nowotny, P., 135, 283, 551 Nowotny, V., 131, 135, 144, 145, 273, 278, 283, 551,706 Nurse, K., 319, 344, 354, 355(31, 33, 24, 32), 358(31, 32, 33), 378, 380, 385(15), 396(15), 390(5), 391, 392(5), 393, 394(29), 395(5, 28), 396 Nussunov, R., 779 Nygard, O., 345, 346, 358(63)
O O'Brien, L., 98 O'Farrell, P. Z., 421 Oakes, M. I., 354, 397, 499 Obert, R., 238, 247(3), 249(3) Obokada, J., 760, 761 Odom, O. W., 82, 177, 178, 186, 517,670 Odom, O. W., Jr., 115, 175, 176, 187(4) Oettl, H., 4 Ofengand, J., 175, 187(4), 319, 341, 344, 348(29), 350(3, 4), 354, 355(31, 23, 24, 32, 33), 358(31, 32, 33), 362, 373, 376, 378, 379, 380, 381, 382, 385(15, 16), 386, 388, 390, 391, 393, 394(16, 29), 395(1 l, 15, 28), 396, 411 Ogata, K., 345, 346, 358, 359(142), 360(89, 142) Ogrel, L., 500 Ohgi, K., 494 Ohme, M., 760 Ohta, T., 804 Ohto, C., 760 Ohyama, K., 760, 761 Okon, M. S., 151 Olesen, S. O., 456, 457(1), 460 Olomucki, M., 310 Olsen, G. J., 684, 685(13), 794, 795, 798, 806, 811 Olson, B. H., 471 Olson, H. M., 64, 354, 496, 499 Olson, H., 82 Oostergetel, G. T., 52, 59(8), 61(8), 63 Oostra, B., 704 Orezkaja, T. S., 442 Orlova, E. V., 35 Orr, E. A., 749 Ortanded, F., 64, 318
AUTHOR INDEX Osawa, S., 563, 770 Osborne, M., 69 Osswald, M., 290, 298(9), 309(9), 319, 326(11) Osterberg, R., 173 Ottensmeyer, F. P., 4, 7, 49, 63, 506 Otto, A., 576 Ovchinnikov, Y. A., 156, 346, 355(66) Ovchinnikov, Yu. A., 346, 355(73) Overbeek, G. P., 410 Ovespyan, V. A., 345, 355(41, 42) Oyaizu, H., 795 Oyaizu, Y., 795 Ozeki, H., 760, 761
P Pace, B., 88, 684, 685(13), 722, 794 Pace, N. R., 88, 684, 685(13), 722, 794, 798 Paci, M., 238,252, 253(28), 254, 257(1) Pahverk, H., 619 Palacios, R., 498 Palacz, Z., 570 Palmer, J. D., 748 Palmer, M. L., 244, 288 Palmiter, R. D., 498 Panayotatos, N., 232 Parker, J., 611, 612(4) Parker, K. K., 344, 358(9, 10) Parmeggiani, A., 584, 600, 624 Patient, R. K., 232 Pauling, L., 793 Paulsen, H., 582, 583, 584(5), 586(4, 5), 587, 588(4), 589(5, 16), 590(4), 595, 596(20) Pawlik, R. T., 238, 257(1), 346, 358(78) Pearson, J. D., 551 Pearson, R. L., 181,584 Peattie, D. A., 228, 408, 443, 446, 448(19), 454(19), 459, 462(28), 463(28), 465(25), 474, 475, 480, 483, 716, 727, 745 Pedersen-Lane, J., 419 Pellegrini, M., 344, 347, 358(13, 102, 117) Pendergast, M., 504, 510(5) Penny, D., 811 Penswick, J. R., 779 Peretz, H., 64 Perez-Gonsalbez, M., 343, 344, 358(6) Perham, R., 148 Pestka, S., 632 Petre, J., 708
827
Piatak, M., 368 Picard, B., 458 Pieczenik, G., 779 Piefke, J., 100, 104, 105, 107(55) Pieler, T., 475, 727 Pierce, L. R., 300 Pierre, J., 340 Pilz, I., 35 Pinder, J. C., 321 Pirld, E., 222, 223(6) Piszkiewicz, D., 272 Pitt, T. J., 30 Plumbridge, J. A., 178, 240, 242 Podjarny, A. D., 116 Podust, L. M., 345 Pohl, T., 558, 559(35) Poldermans, B., 257 Politz, S. M., 494, 504, 513(9) Pon, C. L., 238, 346, 358(78) Pon, C., 252, 253(28), 254, 257(1) Pongs, O., 263, 270, 347, 722 Porter, R. R., 495 Posno, M., 761 Pozdnyakov, V. A., 344 Prasad, S. M., 673, 680(5), 682(5) Pratt, W. K., 36 Press, E. M., 379 Pribnow, D., 425 Price, C. A., 138, 533, 581 Prince, J. B., 77, 319, 344, 348(29), 354(29), 411,673, 680(6), 682(6) Prombona, I. M., 752 Ptashne, M., 104, 737 Pulitzer, J. F., 421 Pulkrhbek, P., 638 Purton, S., 760 Pustovskikh, A. I., 35
Q Qu, L. H., 327, 795 Quarless, S. A., 320
R
Rabin, D., 722 Radermacher, M., 4, 8(13), 14, 20, 22(11, 12, 13), 25, 26, 27(77), 28, 29(11), 30(12, 13), 49, 63
828
AUTHOR
Rainen, L., 494 RajBhandary, U. L., 179 Rak, K.-H., 68, 186, 510 Raker, M. A., 365,477, 720 Ramakrishnan, V. R., 117, 126(5), 128(5), 129(5), 130, 520 Ramjou6, H. P., 67 Rappoport, S., 187, 584, 600 Rateliffe, R. G., 173 Ratmanova, K. I., 440 Ray, B. K., 717 Rayment, I., 104 Reboud, A. M., 345, 347, 355(44), 358(109) Reboud, J.-P., 318, 345, 347, 355(44), 358, 359(142), 360(142) Reddy, V. B., 368 Regnier, F. E., 543, 550(8), 551 Regnier, F., 523 Reinbolt, J., 263, 270, 544, 546(19), 547(19) Remant, E., 611,694, 705 Remme, Y. L., 631 Remy, P., 344, 355(33a) Reppe, W., 374 Retz, K. C., 559 Revzin, A., 215 Rheinberger, H.-J., 273, 279, 283(6), 582, 597, 605, 654, 658 Rhodes, D., 104, 116 Richards, E. G., 210 Richards, F. M., 346, 355(68) Richardson, C. C., 500 Richmond, T., 104 Riehl, N., 344, 355(33a) Rienhardt, P., 186, 187(35) Riesner, D., 658 Riggs, A. D., 204 Rigler, R., 178 Rike, J., 458 Rindone, W. P., 765 Rinke, J., 298, 301(24), 305(20), 310 Rivera, G. L., 344 Robakis, N., 56, 80 Robbins, D. J., 177, 178(12), 187(12) Robbins, D. R., 115 Robbins, D., 175, 187(4) Roberts, G. C. K., 148 Roberts, R. J., 765 Robertson, J. M., 582, 583, 584, 585(3), 586(3, 4, 5), 587, 588(4), 589(5, 16),
INDEX
590(4), 595, 596(20), 597, 598(3), 599, 601(3), 603(7), 605, 607(17), 658 Rodermel, S. R., 749 Rodionova, N. P., 440, 442 Roe, B. A., 716 Roehl, R., 144 Rogg, H., 581 Rohl, R., 520 Rohrbaeh, M. S., 149, 392 Rojas, A.-M., 612, 618(9), 630 Rollin, C. F., 458 RoUin, F., 96 Rommel, W., 300, 301(24), 310 Rosa, V., 471 Rosenbaum, R. M., 99 Rosenberg, A. H., 232 Rosenberg, M., 737 Rosenthal, A., 442 Rosetti, G. P., 401 Ross, A., 300 Rossmann, M. G., 104, 116 Roth, H. E., 504 Roth, M., 116 Roy, C., 458 Roy, K. L., 181 Roy, M. K., 717 Roychoudhury, R., 501 Rudenko, N. V., 345, 355(40) Ruf, C., 347, 350(116) Rumyantsev, Y. M., 426 Rupp, W., 692, 694, 703(9), 737 Rushton, B., 104, 116 Russel, M., 421 Rutkevich, N. M., 429 Ruuge, E. K., 148 Ruusala, T., 615, 618, 619, 621,622(12, 15, 16), 623, 625(18, 20, 24), 626(18, 20, 24), 627(15, 16, 18, 20, 24), 630(20, 24), 631(20), 650, 657 Ryazantsev, S. N., 35, 105 Rychlik, I., 638 Rychlik, W., 186 Ryte, V. C., 293
S
Sacerdot, C., 240 Sachs, L., 96 Saenger, W., 58
AUTHOR INDEX Saigo, K., 305 Salnikow, J., 545, 547(30), 564(30) Sambrook, J., 160, 222, 223(7), 227(7), 232(7), 365, 366(24), 421, 685, 752, 753(8), 754(8), 755(8), 757(8), 758(8) Saminsky, E. M., 658 Samukov, V. V., 85 San Jos6, C., 346, 358(71) Sancar, A., 692, 694, 703(9), 737 Sanger, F., 179, 369, 467, 568, 716, 742 Sankoff, D., 780, 782(31) Sano, K., 760 Sano, T., 760 Sanoff, D., 767 SanteUa, R. M., 340 Santer, M., 326, 481 Saoer, M. A., 100, 103(31), 105, 107(5, 31, 54), 116 Saruyama, H., 97 Saunders, R., 425 Savige, W. E., 263 Sawada, M., 770 Saxena, A. M., 122 Saxton, W. O., 12, 30, 39, 41(21) Scatchard, G., 249 Schaafsma, T. J., 148 Schaber, E., 519 Schaffer, M. H., 262 Schaffner, W., 177 Schaller, H., 222, 223(6) Schantz, R., 749 Scharf, K.-D., 576, 577(6) Schaup, H. W., 259, 267(16) Scheer, M., 426 Schefer, J., 122 Scheit, K. M., 347 Schendel, P. L., 270 Schimke, R. D., 498 Schimmel, P. R., 104 Schindler, D. G., 117, 471 Schleich, H.-G., 178, 179(13), 181(13), 182(13), 584 Schleich, T., 239, 247, 251(23) Schmeissner, U., 737 Schmidt, B. F., 239 Schmidt, B., 247, 251(23) Schmidt, F. J., 457, 458(9) Schmitt, M., 658 Schmitz, A., 468 Schneider, D. K., 122
829
Schneider, T., 425 Schnier, J., 706 Schoenbom, B. P., 122 Schramm, H. J., 9, 39, 41(23) Schramm, J., 3 Schreiber, J.-P., 523 Schreier, M. H., 65, 363, 670 Schroeter, B. H., 513 Schulte, C., 458 Schulz¢, H., 133, 134, 136(4), 145, 185 Schumann, R., 600, 665 Schuster, L., 727 Schutter, W., 12 Schuurmans, D. M., 471 Schwartz, I., 344, 346, 358(75, 76), 373, 378, 379, 380(% 381(9), 388, 390 Schwartz, M. A., 376, 391 Schwartz, S. A., 674 Schwarzbauer, J., 204, 214(4), 259, 267(13) Schwedler-Breitenreuter, G., 504, 511(8), 515(8), 516(8), 517 Seeburg, P. A., 737 Seela, F., 380 Segal, D. M., 105 Sela, M., 265 Selivanova, O. M., 35 Sellers, P., 768, 771 Selsing, E., 232 Semenkov, V. P., 90, 582, 597, 658 Sepetov, N. F., 148, 153 Serdyuk, I. N., 76 Seredynski, J., 7 Sergeeva, N. F., 440 Seyer, P., 761 Shabarova, N. P., 440, 442 Shabarova, Z. A., 442 Shapiro, B. M., 38, 503 Sharrock, R., 691,694, 704(7), 717 Shatsky, I. N., 82, 84(9), 85, 86, 87(17), 90, 354, 440, 449 Shelley, K., 98 Shelness, G. S., 482 Shevack, A., 96, 107(5) Shi, Y.-B., 337 Shiki, Y., 760 Shimada, H., 760 Shimatake, H., 737 Shimkin, B., 30 Shine, J., 188 Shinedling, S., 425
830
AUTHOR INDEX
Shinozaki, K., 760, 761 Shirai, H., 760, 761 Shishkov, A. V., 426 Shoham, M., 105, 107(55) Shore, H. B., 109 Shortle, D., 740 Shrlich, S. D., 738 Shubina, T. N., 85 Shutt, N., 494 Siboska, G. E., 345, 649 Siegel, R. B., 240 Siegel, V., 475 Siegmann, M., 575, 576, 578 Siegrist, S., 347 Siehnel, R. J., 684 Sigmund, C. D., 673, 675(2, 4), 680(4), 682(4), 683(4), 691 Sijben-Muller, G., 760 Sillers, I.-Y., 117 Simonov, E. F., 426 Simpson, K., 145 Singer, B. S., 425 Singh, B., 717 Singh-Bermann, K., 228 Sirschovich, A. S., 344 Sizaret, P.-Y., 34 Sjoberg, B., 173 Sj&luist, J., 508 Skehel, J. J., 104 Skinner, R., 691,694, 697(6), 704(6), 708(6) Skirokov, V. A., 105 Skoglund, U., 104 Skold, S.-E., 346, 355(67, 72) Skripkin, E. A., 91,406, 440, 449 Slayter, H. S., 98, 99(13) Sleeter, D. D., 222, 228(5), 682, 691, 694, 697(5), 708, 737 Slobin, L. E., 346, 358(79) SIoof, P., 457, 458, 706 Smailov, S. K., 624, 636 Smirnov, V. D., 440, 442 Smith, A. J. H., 716 Smith, J. E., 344, 349(16), 354(16) Smith, J., 348, 354(127), 523, 532, 543 Smith, M. A., 635 Smith, M., 737, 738 Smith, T. F., 768, 770, 779, 780 Smolyakov, A. V., 426 Smolyaninov, V. V., 429, 632 Sneath, P. H. A., 800
Sogin, M. L., 684, 685(13), 794, 795, 811 Sogin, S. J., 794 Sogo, J. M., 325 Sogo, M. J., 61 Sokal, R. R., 800 $611, D., 178, 181,765 Sommer, A., 64, 70 Sorensen, P. M., 456, 457(1) Southern, E. M., 366 Speyer, J. F., 634 Spicer, E., 442 Spierer, P., 458, 742 Spirin, A. C., 624 Spirin, A. S., 76, 78, 149, 156, 355,427, 429, 436, 631, 632(1, 2, 3), 636(1), 638(1), 643, 644(3), 645(3), 649 Spitnik-Elson, P., 35, 533 Spounde, A. Y., 91 Springer, M., 240, 242 Sprinzl, M., 177, 632, 722 Sproat, B. S., 462, 467(35), 710 Spunde, A. Y., 440, 443(8) Squires, C., 334 Sri Widada, J., 361 Srinivasa, B. R., 761 Srivastava, A., 416 Sriwidada, J., 457, 458 Staekebrandt, E., 794, 795, 807 Stadler, H., 508 Stadtman, E. R., 503 Staehelin, R., 508 Staehelin, T., 67, 429 Stahl, D. A., 240, 684, 685(13), 794, 798 Stahl, J., 344, 345, 346 Stahl, Y. D., 811 Stahmann, M. A., 635 Stalker, D. M., 675 Standmann, E. R., 38 Stanley, W. M., Jr., 51 Stark, G. R., 262 Stark, M. J. R., 740 Stark, M., 691, 692, 696(10), 697(10), 698(10), 699(10), 700(10) Staynow, D. Z., 321 Steadman, B. L., 526 Steele, W. J., 559 Steen, R., 691,694, 697(6), 700(8), 701(8), 704(6, 8), 708(6) Stein, P. R., 780 Stein, S., 382, 551
AUTHOR INDEX Steiner, G., 344, 349(19), 354(19), 361, 371(3), 412, 459, 481 Steinert, P. M., 53 Steinh~iuser, K. G., 91, 175, 504, 515(11), 517 Steinkilberg, M., 9 Steinmetz, A. A., 749 Steitz, J. A., 326, 420, 481 Steitz, T. A., 174 Stel'mashchuk, V. Ya., 35 SteUwagon, E., 271 Stepanova, O. B., 440, 442 Stern, S., 221,259, 419, 463, 482 Sternbach, H., 582, 597, 658 Steven, A. C., 53 Stiege, W., 287, 289, 290, 292, 293(5), 294(5), 298(5, 7, 9, 10), 309(5, 7, 9, 10), 319, 326(11) Stiegler, P., 457, 523, 524(15), 528(15) St6fller, G., 4, 35, 64, 65, 68, 82, 91, 117, 129(1), 130(1), 186, 305, 308, 346, 347, 352, 504, 506(3), 507, 508, 509, 510, 511, 513, 515(7, 8, 11, 12), 516(7, 8), 517(8), 519, 520 StOttler-Meilicke, M., 4, 20, 35, 36, 38(16), 39(16), 64, 82, 91, 117, 129(1), 130(1), 308, 346, 352, 504, 507, 508(12), 509(12), 510, 511, 513, 515(7, 8, 11, 12), 516(7, 8), 517(8, 11, 12), 518, 519, 520 Stoller, B. D., 494 Stone, P. J., 624 Stormo, G., 421,425 Stouthammer, A. H., 622 Strandberg, B., 104 Streinkelberg, M., 39, 41(23) Strobel, O., 543, 561(18), 568(18) Strycharz, W. A., 346, 347, 350(96, 108), 355(108), 358(76, 124) Studier, F., 226, 232, 691,694, 700(8), 701, 704(8), 717 Stuhrmann, H. B., 145, 147 Stummann, B. M., 761 Stumper, B., 347, 350(116) Sturm, M., 3 Stutz, E., 760 Subramanian, A. R., 176, 186, 187(35), 318, 414, 748, 752, 756, 760, 761 Suck, D., 104 Sugita, M., 760, 761
831
Sugiura, M., 760, 761 Sun, T. T., 300 Sundberg, J., 300 Sunderland, C. A., 383 Suryanarayana, T., 186, 187(35), 414 Sussman, J. L., 648 Sutoh, K., 397 Suttcliffe, J., 694 Sutton, B. J., 383 Suzuki, H., 204 Swindell, C. D., 765 Symons, R. H., 346, 347, 348(94) Sypherd, P. S., 533 Szymkowiak, C., 723, 725(18), 729(18), 732, 737(25)
T Tabard, N., 33 Taddei, C., 99 Tahar, S. B., 760 Takahashi, Y., 345 Takauwa, F., 760 Takebe, Y., 691,694, 704(7), 717 Takeuchi, M., 760 Tam, M. F., 402, 523, 524(8), 528(8) Tanaka, M., 345, 358(64), 760 Tanaka, N., 591 Tangy, F., 347 Taniguchi, T., 410 Tao, T., 175 Tapprich, B. E., 115 Tapprich, W., 408, 416, 499 Tassanakajohn, A., 416 Tassanakajohn, B., 115 Taylor, B. H., 319, 344, 348(29), 354(29), 411 Taylor, D., 694, 704 Taylor, K. A., 34 Tedfield, B., 51 Tejedor, F., 347 Tener, G. M., 181 Terao, K., 345, 346, 358, 360(89) Teraoka, H., 134, 136(4) Terhorst, C., 149, 153, 561 Tesche, B., 96, 98, 103(18), 105, 106, 107(59), 109(59), 273 Tewari, D. S., 64 Tewari, D., 416
832
AUTHOR INDEX
Tewari, K. K., 761 Thammana, P., 334 Theinberger, H. J., 104 Thiebe, R., 606 Thierry, J. C., 648 Thomas, C. A., 305 Thomas, G., 390, 575, 576, 578, 579(3) Thomas, M., 477 Thompson, J. E., 319 Thompson, J. F., 330, 331, 333(3), 334, 336(4) Thompson, J., 457, 458(9) Thompson, R. C., 612, 624 Thompson, S., 271 Thon, F., 6 Thurlow, D. L., 319, 344, 348(29), 354(29), 411 Timasheff, S. N., 104 Timmler, G., 760 Tindall, S. H., 209 Tinoco, I., 779 Tischendorf, G. W., 4, 504, 506(3), 508, 510(23) Tischenko, S. V., 105 Tnalina, G. Z., 631, 632(1, 2, 3), 636(1), 638(1), 644(3), 645(3) Tohdoh, N., 760 Tolan, D. R., 346, 358(88), 359 Toms, E. J., 384 Torazawa, K., 760, 761 Towbin, H., 64, 67, 508 Towfighi, J., 98 Trakhanov, S. D., 105 Traub, P., 83, 185, 187(31), 209, 258, 273, 278, 411,476 Trangh, J. A., 358, 359(142), 360(142) Traut, R. R., 64, 70, 117, 138, 151,300, 346, 347, 352, 358, 359, 360(142), 420, 432, 523, 524(13), 526(13), 528(13), 531(13), 532(13), 533, 543, 581 Trempe, M. R., 494 Trieber, G., 223 Tritton, T. R., 148 Trueblood, K. N., 104 Trus, B. L., 53 Tsao, H., 694, 705 Tsielens, I. E., 345 Tumanova, L. G., 149, 153 Tung, C.-S., 765 Turehinsky, M. F., 344, 345, 355 (38, 39, 40)
Turner, S., 334 Twombly, K., 239, 247, 251(23) Tyson, R. W., 238, 247, 249(3), 251(23) U Uchiumi, T., 346, 358, 360(89) Udenfriend, S., 382, 551 Uhlenbeck, O. C., 204, 207(9), 208(9), 209(9), 234, 237(25), 445, 446(18), 479, 779 Uhlenbeck, O. G., 460, 726 Ulldch, A., 365, 477, 720 Ulmer, E., 298, 300, 305(20) Umesono, K., 760, 761 Unge, T., 104 UngewickeU, E., 457, 458, 487 Unukovich, M. S., 426 Unwin, P. N. T., 3, 4, 5, 12, 21(26), 36, 97, 98, 99(11, 14, 15, 16, 17), 100(11, 14, 17), 103(11, 15) Urbanke, C., 584 Utiurin, N. N., 561 V Valentine, R. C., 4, 38, 384, 503 van Boom, J. H., 244, 410 van Bruggen, E. F. J., 12, 42 van Buul, C. P. J. J., 257 van Charldorp, R., 197, 198, 244 Van de Sande, J. H., 402, 409(8) van Der Marel, G., 410 van Duin, J., 88, 346, 358(83), 410, 722 van Heel, M., 3, 7, 9, 12, 17, 20, 28, 30, 36, 38, 39(16), 40(18), 42, 43(10, 18), 49 van Hippel, P. H., 249 van Holde, K. E., 401 van Kimmenade, J. M. A., 188, 194, 198, 200(8), 239, 240, 241(7), 255(10), 256(10) van Knippenberg, P. H., 188, 194, 197, 198, 200, 221, 239, 240, 241(7), 244, 252(12), 255(10), 256(10), 257, 410 van Leerdam, E., 244, 410 Van Stolk, B. J., 221,463, 476, 481,487 van Versseveld, H., 622 Van Vliet, A., 704, 761 Vanaman, T. C., 262
AUTHOR INDEX Vandenbe, A., 769 Vaniaminova, A. G., 345 Vanin, E. F., 347 Vanyaminov, S. Y., 149 Vartikar, J. V., 231,233(21) Vasiliev, V. D., 35, 76, 77, 79(4), 82, 84(9), 86, 87(17), 89, 90, 156, 346, 354, 355(66), 449 Vasser, M., 742 Vassilenko, S. K., 293 Vassilenko, S., 467 Vazquez, D., 78, 343, 358(6), 469 Veeneman, G., 410 Veiko, V. P., 440, 442, 443(8) Veniaminova, A. G., 345 Verschoor, A., 3, 4, 8(2, 13), 14, 17, 20, 21(2), 22(11, 12, 13), 29(11), 30(3, 12, 13), 34, 36, 42, 48(28), 49, 63 Vester, B., 456, 457, 459(10) Veyko, V. D., 91 Vieira, J., 755, 757(12) Vince, R., 347 Vincent, M., 346, 358(76) Vinogradov, S. V., 450 Visentin, L. P., 96, 561,563 Vladimorov, S. N., 345 Vlasov, V. V., 343 Vlassov, V. V., 466 Voickaet, G., 297 Void, B. S., 494 Vollenweider, H. J., 61,325 Volimer, R. T., 540 von Allmen, J.-M., 760 von Hippel, P. H., 207, 212(13), 216 von Knoblauch, K., 760, 761 Von Tigerstrom, M., 181 Voss, H., 283 Voynow, P., 65, 79, 185, 261,273, 274, 430, 527, 532 Vrona, S. A., 526 Vrosius, J., 459
W Wahl, M. R., 503 Wada, A., 760 Wagenknecht, T., 3, 4, 7, 8(13), 14, 15, 20, 22(11, 12, 13), 29(11), 30(3, 12, 13), 34, 38, 49, 63
833
Wagner, E. G. H., 583, 612, 613, 619(12), 622(22), 650, 651(2) Wagner, G., 148 Wagner, J., 632 Wagner, R., 165, 401, 457, 487, 691, 722, 723, 725(18), 729(18), 732, 733, 737(25), 738, 739(45), 742(45) Wagner, T., 722 Wahba, A. J., 346, 358(75, 79, 82), 634 Wahl, G., 500 Wain-Hobson, S., 383 Wakabayashi, T., 397 Wakasugi, T., 760 Walker, J. E., 760 Walker, R., 727 Wall, J. S., 49, 50, 52, 53, 54(2), 55(9), 56, 59(7, 8), 61(8), 63 Walter, P., 475 Waiters, J. A. L. I., 256 Warner, J. R., 358, 359(142), 360(142) Warrant, R. W., 648 Wartusch, B., 68, 186, 510 Warwick, K. M., 15, 33(58) Watanabe, K., 380 Watanabe, S., 598, 666 Waterman, M. S., 766, 768, 770, 774(8), 779, 780, 793 Watson, D., 271 Weber, K., 69 Wechster, R. J., 526 Wegnez, M. R., 330, 333(3) Wegnez, M., 458 Weiel, J., 251 Weil, J. G., 139, 140(8) Weinstein, E., 124 Weinstein, S., 100, 115, 116 Weiser, B., 188, 221,796 Weiss, F. J., 584 Weiss, J. F., 181 Weiss, R., 648 Weissbach, H., 51,390 Weissman, C., 420 Weissman, S. M., 368 Weissman, S. N., 721 Weissmann, C., 177,410 Weitzmann, C. J., 173, 179, 187(22), 347, 348, 350(101), 354(127), 523, 524(2), 528(2), 532, 533, 537(5), 543 Welfle, H., 358, 359(142), 360(142), 458 Wells, R. D., 232
834
AUTHOR INDEX
Welton, T. A., 7 Wendel, I., 458 Wessel, D., 559 Westermann, P., 343, 345, 346, 358(63) Westhoff, P., 760 Wettenhall, R. E. H., 523, 524(14) White, R. L., 477 White, S. A., 203, 205(1), 217(1), 228, 481 Whitfeld, P. R., 760, 761 Whiting, R. F., 506 Wiekstrom, E., 200, 238, 239, 240, 243, 245(19), 247, 249(3, 4), 251(4, 23), 252(4, 12), 257, 344, 358(9, 10) Wieder, R., 351 Wiewiorowski, M., 382 Wikman, F. P., 649 Wilbur, W. J., 766 Wilehek, M., 344, 348(15) Wildeman, A. G., 462 Wiley, D. C., 104 Wilkins, M. H. F., 113 Willan, K. J., 383 Williams, D. L., 482 Williams, E. E., 238, 247(3), 249(3) Williams, R. J. P., 173 Williek, G. E., 458, 563 Wilson, I. A., 104 Wilson, R., 419 Wimmer, E., 181 Winter, R., 425 Wintermeyer, W., 178, 179(13), 181, 182, 238, 257(1), 454, 582, 583, 584, 585(3), 586(3, 4, 5), 587, 588(4), 589(5, 16), 590(4), 595, 596(20), 597, 598(3), 599, 601(3), 603(7), 605, 607(17), 658 Wireman, J. W., 533 Witherell, G. W., 234, 237(25) Withrieh, K., 256 Wittinghofer, A., 600, 665 Wittman, H. G., 537 Wittmann, H. G., 35, 65, 96, 97, 98, 100, 101, 103(18, 31), 104, 105, 106, 107(31, 54, 55, 59), 109(59), 115, 116, 187, 258, 302, 347, 507, 508, 542, 544(7) Wittmann-Liebold, B., 135, 153, 179, 523, 524(3, 4, 5), 528(4, 5), 531(5), 542, 543, 544, 545, 546(19), 547(19, 28, 30, 31), 548(25, 26, 27), 550(13), 551(13), 561, 564, 568(18), 570, 670 Wittner, M., 99
Woese, C. R., 188, 221,240, 401,721,766, 779(9), 781(9), 794, 795, 796, 807, 811 Wolanski, A., 386 Wolf, H., 600 Wollenzien, D. C., 334 Wollenzien, P. L., 76, 292, 319, 320, 324(4), 325, 328(14) Wolters, J., 794, 797(5) Woodbury, C. P., Jr., 206, 212(13) Woody, M., 271 Wool, I. G., 274, 344, 358, 359(142), 360(142), 469, 471(6, 7, 8, 9), 472(6), 473(5, 6), 474(8, 9), 710 Woolley, P., 91, 175, 504, 508(12), 509(12), 515(11, 12), 517, 518 Wower, I., 300, 308(22), 309 Wower, J., 300, 302, 308(22) Wu, C.-W., 475 Wu, M., 761 Wunsch, 767 Wurmbach, P., 145, 186, 390, 408 WiRhdeh, K., 148, 254 Wyckoff, H. W., 104 Wystup, G., 134, 136(4)
Y Ya Gren, E., 345 Yabuki, S., 117 Yaguehi, M., 96, 259, 267(15), 458, 561, 563, 708 Yamada, K., 760 Yamaguchi-Shinozaki, K., 760 Yamarnoto, K. R., 223 Yamamoto, K., 397 Yamasaki, E., 51 Yamkovoy, V. I., 345 Yang, C. H., 178 Yang, D., 795 Yang, H., 115, 704 Yang, S. K., 210 Yanisch-Perron, C., 755, 757(12) Yanov, J., 240, 242(13), 249(13) Yao, Z. Y., 523, 524(4), 528(4), 543, 544, 564(20) Yarus, M., 204 Ye, Y. K., 749 Ygge, B., 466 Ynoue-Yokosawa, N., 632
AUTHOR INDEX Yokoe, S., 345, 358(64) Yonath, A., 4, 96, 97, 98, 100, 101(12), 103(18, 31), 104, 105, 106, 107(5, 31, 54, 59), 109(59), 116 Young, E. T., 421 Young, R., 611,612(1) Youvan, D. C., 326, 334, 362, 371(6), 459, 463(26), 481 Ysukihar, T., 104 Yu, A. H. C., 7 Yuki, A., 297 Yusupov, M. M., 105,427 Yusupova (Tnalina), G. Z., 631
Z
Zachau, H. G., 178, 179(13), 181, 182, 454, 584, 600, 606 Zagorska, L., 88, 722 Zaita, N., 760 Zamir, A., 83, 290, 344, 348(15), 502, 508, 779 Zeichhardt, H., 4, 504, 506(3), 509
835
Zenkova, M. A., 345 Zentgraf, H., 222, 223(6) Zettlemoyer, A. C., 109 Zieve, F. J., 591,592(17) Zimmerman, R. A., 344, 348(29), 354(29), 442 Zimmerman, R., 259 Zimmermann, R. A., 51,158, 213, 228, 390, 456, 457, 458, 468, 721,742 Zimmermann, R., 319, 411 Zingsheim, H. P., 11, 14, 15 Zinn, A., 82 Zobawa, M., 290, 292, 298(9, 10), 302, 309(9, 10), 319, 326(11) ZoUer, M. J., 737, 738 Zubay, G., 113, 704 Zubke, W., 508 Zuckerkandl, E., 793 Zueva, V. S., 466 Zuker, M., 561,780, 782(31) Zurawski, G., 761 Zweib, C., 259, 289, 290(5), 293(5), 294, 298, 305(20), 309(5, 14), 310, 319, 326(10), 691,738, 739(45), 742(45)
SUBJECT INDEX
837
Subject Index A Ac[3H]Phc-tRNA binding, Mg2+ dependence of, 650-653 AcPhe-tRNA binding to poly(U)-programmed 70S ribosomes, 669-670 p4C]-labeled preparation, 662-663 purification, 662-663 Affinity-labeledproteins identification of, 347- 35 l separation of, 347 Affinity labeling of ribosomes, 341 - 36 l functional significance of, test for, 349- 351 goals, 341 identification of ligand-binding sites by, 341 reagents for, 342- 344 results, 341 - 342 assessing significance of, 349-351 of tRNA-binding sites on ribosomes, 372-397 Affinity labels, 342- 344 Affinity probes, 373- 378 derivatized with minor bases, structures, 374 tRNA reactive groups available for, 372-373 a-sarcin, 466 activity, sensitivity to higher-order structure, 474-475 for footprinting protein-RNA complexes, 469-475 materials, 469-471 methods, 471-473 inhibition by magnesium, 473 properties, 469 resistance of purine residues to hydrolysis by, 474 specificity of, 473- 474 use in analysis of ribosomal RNAprotein interactions, 468-475
Amino acid, m4C-labeled,specific activity, 633 AminoacylotRNA. See also Transfer RNA, aminoacylated ~4C-labeled,specific activity, 633 binding, in template-free ribosomal system, 644- 646 in elongation cycle, 658 modification ofa-NH 2 group of, 388 occupation of A-site, 647 ribosomal template-fr¢~ synthesis of polypeptides from, 631-649 buffers for, 634 kinetics, 642-643 magnesium ion dependence of, 642-645 materials, 632 reagents, 632-634 solutions for, 634 Amino group affinity probes, 373-374 6-Amino[6-14C]hexanoic acid hydrochloride, 375 Antibiotic resistance mutations, 673-690 antibiotic sensitivity levels, 677 bacterial strains for, 676 colony screening, 679 mapping, 680-682 fragment exchange, 681 marker rescue, 681 shotgun marker rescue, 681 - 682 mating, 678-679 mutagenesis, 677-678 mutant characterization, 676-680 mutant isolation, 676- 677 plasmid screening, 679-680 precautions, 676 selection of, media, 674 sequencing, 682-683 uses of, 683 Antibodies. See also Monoclonal antibodies to AMT monoadducts in DNA, 340 hapten-specific, for localization of ribosomal proteins, 504, 517- 519 induction, 495
838
SUBJECT INDEX
ligand-binding capacity of, 497-498 polyvalent, preparation of immunocomplexes using, 508- 51 l as probes of ribosomal RNA, 493- 503 immunogen preparation for, 493-495 to psoralen/RNA cross-links, 340 purification, 495-498 Antibody- oligonucleotide- subunit complexes, formation, 502-503 Antibody-ribosomal subunit complexes, formation, 502-503 Antibody-ribosome complex, formation in sucrose gradients, 508- 510 Antisera, immunoditfusion, 495-496 Approximate additive evolutionary trees, 801 best tree, 803-805 evolutionary distances, 801-802 estimating, 802- 803 fitting to tree topology, 803-805 example, 802-803 inference of, 801-810 Archaebacteria, ribosomal proteins HPLC, 542- 571 range of, 569-570 A site, 597 binding of peptidyl-tRNA to, 666- 670 indicator titration of binding to, 603, 607, 609-610 evaluation of, 610-611 occupation of with aminoacyl-tRNA, in absence of codon-anticodon interactions, 647 quantitation, 599 A-site binding assay, 390-391,408-409 Aspartyl-tRNA, as substrate for ribosomal peptide synthesis in absence of template, 631 1-(6-[(4-Azido-2-nitrophenyl)amino]- 1-oxohexyloxyl)-2,5-pyrrolidinedione-6-t4C, 375-376 N-(4-Azido-2-nitrophenyl)glycine, N-hydroxysuccinimide ester, 373 p-Azidophenacyl bromide, 373 p-Azidophenacyl bromoaeetate, 373 iodo analog, 373 B
Bacillus stearothermophilus ribosomal proteins, HPLC, 543
ribosomal subunits from. See specific subunit Back-cloning procedure, 718 Bacteriophage mRNA, formation of initiation complex with ribosomes, assay, 410 Bacteriophage T4 gene 32 mRNA, extension inhibition analysis, 420-425 Bead Beater, 161 3-(4'-Benzoylphenyl)propionyl-Phe-tRNA binding to ribosomes, 364 photoattinity labeling of 23S RNA, 362-363 purification, 363 specific binding to ribosomal P- and A-sites, 363-364 tritiated, preparation, 363 2-(Biotinamido)ethyl-1,Y-dithiopropionate. See SS-biotin 6-(Biotinamido)hexanoate. See LC-biotin Biotin compounds, N-hydroxysulfosuccinimide ester, 378 Bis(2-chloroethyl)methylamine,as cross-linkiog reagent, 290 Bis.N-(2-nitro-4-azidophenyl)cystamine, 376 Blind spots, 466, 467, 473
C cDNA probes binding to ribosomal RNA binding specificity assays, 404-408 competition assay, 405-406 RNase H assay, 405-408 saturation assay, 404-405 subunit binding assay, 408 bound, competitive displacement of, 411, 412 hybridization to ribosomal RNA, 403 -404 filter binding assay, 403-405 gradient-binding assay, 403-404 limitations of, 411 - 415 preparation, 402 of ribosomal RNA, 401-419 materials for, 40 1- 402 methods for use, 403-411 for ribosome structure and function resolution of technique, 411-413 secondary interactions, 414-415
SUBJECT INDEX cDNA- subunit complexes, separation from unbound probe, 403-404 eDNA synthesis, 483, 487-489 patterns of, 481-482 stops or pauses in, 481 Chloroplast DNA cloning for ribosomal protein genes, 752-756 colony hybridization, 755- 756 of higher plants, 748 isolation, 749-751 plant source, 749 restriction analysis, 751 - 752 specific fragment, cloning of, 756 Chloroplast ribosomal protein genes, 748-761 fine mapping, 758-759 identification of, 756- 759 identified and sequenced, 759-760 Cibacron Blue inhibitory molar ratio of dye:ribosomal proteins, 274-275 in isolation of ribosome assembly intermediates, 270-277 molecular structure, 271 stock solution, 272-273 Cladogram, 800 Cluster analysis, 800- 801 CMCT as probe of protein-RNA complexes, 465 as probe of RNA structure, 482-484 Codon-anticodon interactions, in peptide synthesis, 647- 649 Colicin El, 674 Colicin fragments, 221 5'-32P-labeling of, 190 from A. tumefaciens, properties, 198- 199 from B. stearothermophilus, properties, 198-199 from B. subtilis, properties, 199 of bacterial 16S ribosomal RNA, 188-200 from E. coli, properties, 198- 199 gel electrophoresis, 190 high-resolution ~H NMR, 199-200 isolation, methods, 189-190 large-scale purification, 191 - 195 materials for, 188-189 melting characteristics, 198-199 one-dimensional IH NMR, 194 32P-labeled autoradiography, 196-197
839
isolation, 197-198 properties, 198-199 purity, analysis of, 196 separation by preparative HPLC, 195-196 Sephadex G-150 column chromatography, 190 Complementary DNA. See eDNA Cross-linked complexes labeling, 288 protein- RNA digestion of RNA in, 317 - 318 labeling of proteins in, with iodine-125, 315-316 preparation of protein samples for two-dimensional gel analysis, 316-317 separation of proteins from hydrolyzed RNA, 318 Cross-linking. See also RNA cross-links bifunctional, chemical, 117 intramolecular, 319 intra-RNA, 287-289 fingerprint analysis of complexes, 297-298 gel electrophoresis of fragments, 294-297 method, 290-298 partial nuclease digestion of RNA, 293-294 reactions, 290- 293 sites, 309 yield, 292-293 protein-protein, 238 EDC procedure, 315 protein-RNA, 238, 287-289, 310-318, 371 assessment of reaction, 301 - 303 EDC procedure, 310-315 analysis of products, 315- 318 effect of magnesium concentration, 314 effect ofpH, 313-314 effect of proximity and availability of carboxyl and amino groups of proteins and nucleic adds, 314-315 efficiency of, 313- 315 formation of 30S dimers during, 314-315 scheme of, 311
840
SUBJECT INDEX
extent of reaction, 301 - 402 fingerprint analysis of complexes, 308- 309 identification of proteins cross-linked, 301-303, 308-309, 318 isolation of complexes, 303- 308 method, 298- 309 partial nuclease digestion of complexes, 303 reaction mechanism, 311 reactions, 300- 301 sites, 309 RNA-RNA, 371 substrate used for, 288 techniques, 287 with ultraviolet light as reagent, 290-292 Cross-linking reagents, 288, 342-344 Crystallization of ribosomal subunits, 4 of ribosomes, 4 using vapor diffusion, 105 Crystallography, 4, 35, 95-117 materials for, sources, 96 preparation of 5S-related materials for, 158-174 progress of, 110-114 of ribosomal particles, 103-117 l-Cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-toluene sulfonate. See CMCT D-Cycloserine, 695
4'-phenyl isothiocyanate/phenyl isothiocyanate. See DABITC/PITC double-coupling method Dimethyl suberimidate, as cross-linking reagent, 65 Dimetliyl sulfate as probe of protein-RNA complexes, 465 -467 as probe of RNA structure, 476, 482-484, 488-489 as structural probe of 5S RNA, 727-730 Dinitroplienol- protein conjugates, preparation, 495 N-(2,4-Dinitrophenyl)-~-aminobutyricacid, N-hydroxysuccinimide ester, 376 N-( ~,-2,4-Dinitrophenyl)aminobutyric acid hydrazide, 82 2,4-Dinitrophenylethylenediamine. See DNP-ethylenediamine Dinucleotide fold, dye binding to, 271 Dithiobis(succinimidylpropionate) S,S-dioxide, 376-377 DNA. See also cDNA; Chloroplast DNA restriction fragment hybridization to RNA protein-binding site, 463 DNA footprintinf, 468 DNA photolyase, 692 DNP-ethylenediamine, 82, 85 D20 media, recycling of, 137 Double helices, recognition of, by RNase, 466, 467 Dye-ligand affinity chromatography, 271
D
E
DABITC/PITC double-coupling method, 545, 547, 570 Dansylaminophenyl isothiocyanate, 570- 571 DCCH, 179 Deoxyribonucleic acid. See DNA 7-Diethylaminocoumarin-3-carbohydrazide. See DCCH Diethyl pyrocarbonate as probe of protein- RNA complexes, 465 -466 as structural probe of 5S RNA, 727-729 as structure-specific probe of RNA, 476 Diffraction techniques, 95, 103 4-N,N'-Dimethylaminoazobenzene
Eadie-Hofstee analysis, for estimation of maximal translation rate and kinetics of elongation factors, 615-617 EDC protein-RNA cross-linking procedure with, 310-315 source, 31 l Electron crystallographictechniques, 4 Electron microscopy, 3. See also Immunoelectron microscopy; Negative staining; Ribosomal subunits, image analysis; Scanning transmission electron microscopy; Three-dimensional reconstruction of cross-linked rRNA fractionated on
SUBJECT INDEX
formamide-polyacrylamidegel, 324325 cross-resolution, 11 - 12 for evaluation and refinement of crystallization conditions, 95 frozen-hydrated, 34 future prospects, 33- 35 for identification of RNA cross-links, 320 optimal electron dose for negatively stained specimens, 5 - 6 particle orientation, 37- 38 of ribosomal RNA, 76-91 of ribosomal subunits, image analysis, 35 -49 of ribosomes, 4 - 6 rocking movements, 15 signal-to-noise ratio, improving, 36-38 specimen drift, 5, 7 transfer bands, 6 - 7 visualization of cross-linking sites with, 334, 373, 395 Elongation factor effect on ribosomal translocation kinetics, 590 - 591 effect on structure of LT/L 12 proteins of ribosome, 154-157 in transloeation reaction, 582 Elongation factor EF-2, 361 Elongation factor EF-G binding to ribosome, 361 preparation, 584 role in ribosomal translation, 616- 619 in template-frce synthesis of polypeptides, 632 Elongation factor EF-Ts, in ribosomal translation, 618- 621 Elongation factor EF-Tu, 358 isolation, 600 role in ribosomal translation, 616-619 in template-free synthesis of polypeptides, 632 EM software, 30 Equivalent unit, 141 Escherichia coli antibiotic resistance mutations, 673-690 antibiotic-resistant strains, ribosomes isolated from, labeling of functional sites, 350-351 cell growth, 693-695 elongation in, 582 HBI01/pKK5-1, growth of, 159
841
internal milieu, vs. in vitro protein synthesis, 612-613 irradiation of cultures, 695 large ribosomal RNA of, mutations in, 720 promoter sequences, computer analysis of, 777-778, 792 protonated cell components, preparation, 132 ribosomal mutants, 187, 673-691 ribosomal subunits from. See specific subunit ribosome binding sites, 424-425 RNase I-deficient strain MRE 600, 401 rRNA operons, 692 5S-binding proteins from, 171 - 173 5S RNA, mutations, 737-743 strain BL21(DE3), 694, 701 strain CSR603, 693, 694 strain DI0, growth of, 659-660 strain HBI01, 693, 694 transfer ofpKK5-1 from, to NGI35, 160 transformation with plasmid pKK 123, 365-366 strain MC1061, 693, 694 strain MRE 600, 70S ribosomes isolated from, 583, 599 strain UNC1085, 693 temporal sequence of ribosomal assembly, 270-277 ultraviolet irradiation, repair mechanisms of, 692-693 wild-type MRE600, 188 E site, 582, 596, 597 1-Ethyl-3-( 3-dimethylaminopropyl)carbodiimide. See EDC Ethyl nitrosurea, 466 Extension inhibition analysis applications, 425 materials, 420- 421 methods, 421-422 results, 422-425 Extragenic suppressor mutants, isolation of, 709 F Fab fragments, monovalent, bound to ribosomal subunits, immunoelectron microscopy of, 519- 520
842
SUBJECT INDEX
fd cloning vectors, 222-223 Fluorescence energy transfer, 117 Fluorescence labeling incomplete, 175 nonspecific, 175 procedures, 175-179 of proteins, 176-177 Fluorescent probes, sources, 187 Formamide-polyacrylamidegel preparation, 321 - 322 separation of cross-linked 16S RNA in, 320- 324 materials, 321 methods, 321-324 reagents, 321 Fourier ring correlation, 12-14 Fuorescein 5'-thiosemicarbazide, labeling of oxidized RNAs with, 178
G Gen Bank, 765 Gene expression, control of, 238 Glassy ribosome, 131 Glutarnine synthetase, molecular image analysis, 42 Gold cluster, as monofunctional labeling reagent, 115
High-performance liquid chromatography of afffinity-labeledproteins, 347- 348 applications of, 571 ion-exchange, 523-524 for separation of ribosomal proteins, 532-541 reversed-phase of affinity-labeled protein, 351 in preparation of cross-linked proteins for identification by 2-D diagonal PAGE, 532 in preparation of ribosomal proteins for microsequencing, 532 purification of fractions from ion-exchange HPLC, 538-539 to resolve modified ribosomal proteins from unmodified proteins, 532 of ribosomal proteins, 523-532 for separation of bacterial ribosomal proteins, 533 ribosomal protein purification by, results, 548 - 560 size-exclusion, 523 Hot tritium bombardment, 426-439 equipment, 427-428 sample preparation for, 430 in study of ribosome surface, 426-427 technique, 427-431 HPLC. See High-performance liquid chromatography
H
H9B spectrometer, 122-123 Hairpin loops, 487 Halobacterium cutirubrum, isolation of genes of ribosomal proteins derived from, 571 Halobacterium marismortui isolation of genes of ribosomal proteins derived from, 571 ribosomal proteins HPLC, 543 separation on reversed-phase columns, 553, 555, 558 ribosomal subunits from. See specific subunit Haptens, for localization of ribosomal proteins on ribosomal surface, 504 High Flux Beam Reactor, Brookhaven National Laboratory, 121 - 123
IF3. See Translation initiation factor 3 IMAGIC software, 30 2-Iminothiolane, as cross-linking reagent, 65, 70 Immunoblotting from diagonal SDS-polyacrylamidegels, 70 - 73 for identification of protein- protein cross-links, 64-76 within 50S ribosomal subunits of E. coli, 65-76 advantages of, 75- 76 evaluation of, 68- 70 of two-dimensional polyacrylamide gels, 73-75 Immunoelectron microscopy, 4, 76- 91, 117, 493
SUBJECT INDEX hapten approach to, 76-91 advantages of, 90- 91 of naked rRNAs, 77-81 of ribosomal subunits, 503- 520 evaluation of data, 511 - 516 shadow casting, 77 volatile salts and alcohol requirements, 77-78 technique, 89-90 three-dimensional, 33-34 Immunological analysis, of attinity-labeled proteins, 347 Initiation complex formation, between bacteriophage mRNA and ribosomes, assay for, 410 Initiation factor. See Translation initiation factor
K Kethoxal as probe of protein-RNA complexes, 465 as probe of RNA structure, 482, 488-489
L L24, analysis of mutants in gene rplX for, in vivo, 706-709 1-N-[p-(fl-o-Lactosyl)benzyl]-6-aminobexylamine. See LBA LBA, 82 synthesis of, 82 LC-biotin, source, 378 LexA protein, 693 Log(n) theory, 792 L protein implicated at peptidyltransferase center of rat liver ribosome, 358-359 order of elution from RP-HPLC columns, 530-531 Lysyl-tRNA [~4C]-labeled,as substrate for templatefree ribosomal synthesis of polypeptides from, 642-645 template-free ribosomal synthesis of polylysine from, 634-641 identification of product synthesized, 638-639 use of purified lysyl-tRNALys,640-641
843
use of total tRNA aminoacylated with lysine, 634-638
M Magic spot, 612 Maxiceli analysis of plasmid-coded rRNA, 691 - 706 electrophoresis, 699- 700 lysate preparation, 698-699 RNA extraction, 699 Maxicells, 692 cell strain requirements, 693-694 chemically induced, 700-703, 705 cell growth for, 701 induction of T7 RNA polymerase, 702 labeling of rRNA for, 702- 703 modified, 703-704 protein synthesis in, 696 plasmid-dependent rRNA production in, 696-697 recovery from, 695-698 Messenger RNA binding assay, 418-419 binding to ribosomes, 420 Messenger RNA interaction zone, on ribosome, codon- anticodon interaction within, 354-355 Methanococcus vannielii isolation of genes of ribosomal proteins derived from, 571 protein extraction from ribosomal subunits, 551-552 ribosomal proteins, HPLC, 543- 571 separation of ribosomal proteins on reversed-phase columns, 557 8-[(3-(4-Methyl-i-piperazinyl)propyl)oxy] psoralen, as monoaddition reagent, 466 Methyl-RNA, preparation, 455 Molecular evolution, 793 Monoclonal antibodies, for localization of ribosomal proteins, 504, 516-517 Multivariate statistical analysis, in image analysis of ribosomal subunits, 15- 19, 37-38, 42-44
N N-AcPhe-tRNAr~c binding to A site, 583
844
SUBJECT
determining extent of translocation by measuring binding sites of, 585-586 displacement from A site to P site, in monitoring ribosomal translocation kinetics, 582, 591-593 fluorescence energy transfer with tRNA ~ , time of translocation monitored by, 591-592 preparation, 584, 600 site location of, 598 N-AcPhe-tRNAn~ derivatives, displacement from A site of pretranslocative ribosomes, 588-591 effect of EF-G concentration on, 590-591 Negative staining, 4, 7, 505 double-carbon layer techniques, 4, 89-90, 505 droplet method, 89-90 in immunoelectron microscopy, 89 radiation dose with, 21 single carbon layer, 4-5, 89-90, 505 Neutron diffraction, 116 Neutron scattering current model for 30S ribosomal subunit, 129-131 deuterated 50S subunits for analysis with, 131-147 experiment data collection and analysis, 123-129 instrumentation, 121 - 123 neutron source, 121 - 123 procedure, 119-120 sample handling, 120-121 scheme for, 118 interference function, 119 extraction of, 125-126 interference signal, Fourier inversion of, 126-128 model building, 128-129 3-[(2Nitro-4-azidophenyl)-2-aminoethyldithio]propionate, hydroxysuccinimide ester, 376-377 6-(2-Nitro-4-azidophenylamino)caproate, N-hydroxysuccinimide ester, 373374 N-(2-Nitro-4-azidophenyl)glycyl-/$-alanine, N-hydroxysuccinimide ester, 377- 378 Nitrocellulose filter assay, for protein-RNA binding, 203- 214
INDEX
Nitrogen mustard, as cross-linking reagent, 290, 292 Nuclear magnetic resonance approaches using, 157-158 limitations of, 157 physical principles of, 148-149 preparation of 5S-related materials for, 158-174 of ribosomes, 148-158 materials, 149 measurements, 150 sample preparation for, 149-150 Nucleic acid sequences. See also Ribosomal RNA sequences biological versus statistical significance, 792-793 computer analysis of, 765- 793 advantages over analysis by eye, 766-767 algorithms, 765 aligning full sequences, 768-770 alignment of many sequences, 793 consensus patterns, 772-778 for consensus repeats for large patterns, 792-793 consensus sequence analysis, 766 maximum segments, 770-773, 792 multiple sequence patterns, 777-778 palindromes, 774- 775 search algorithm, 766 secondary structure prediction, 779-792 folding by consensus, 781 - 792 folding by dynamic programming, 779-781 sequence alignment, 766- 767 sequence comparisons, 767- 772 single sequence patterns, 774-777 string matching problem, 767 Nucleoside- protein conjugates, preparation, 493-494
O Oligodeoxynucleotide- ribosome interactions, 502 Oligodeoxynucleotides Y-end, modification of, 501 Y-end, modification of, 500-501
SUBJECT INDEX purification, by ion-exchange HPLC, 501 - 502 synthesis, 499- 500 Oligodeoxyribonucleotides,short, probing ribosomal structure and function with, 401-419 Oligonucleotide probes, for isolation of ribosomal protein genes, 543, 571 Oligonucleotides, reversed-phase chromatography of, 567-568 Optical density, 6
P 5-[cyanoJ4C]Pentanoic acid, 374- 375 Peptidyltransferase components, 371 identification of, 361 photoaflinity labeling of, 361-372 Peptidyltransferase assay, of ribosomal subunits, 145-147 Peptidyltransferase center, of E. coil ribosome, 352-354 Peptidyl-tRNA binding to P site or A site, test for, 666-670 in elongation cycle, 658 Phe-Leu plot, 627-628, 630 assay conditions for, 628-629 Phenetic analysis, 800 - 801 Phenylalanyl-tRNA, [~4C]-labeled,as substrate for template-free ribosomal synthesis of polypeptides from, 642-645 PhenylalanylqRNATM,template-free ribosomal synthesis of polyphenylalanine synthesis from, 645-647 Phenyl-fl-D-lactosides, 82 Phenyldiglyoxal, 730 Phe-tRNA, from E. coli, computer analysis of sequences, 772 Phe-tRNAT M - EF-Tu-GTP [t4C]-labeled, as quantitative indicator of tRNA binding, 599-611 in measuring A-site availability, 586 Phosphate-free casamino acids, 706 Photoaflinity labelinf~ 361,373
845
advantages of, 361 of peptidyltransferase, 361-372 reverse transcription a~ay of, 362-363 of 23S RNA identification of affinity-labeled nucleotides, 365- 371 method, 363-365 Phylogenetic trees, 800- 801. See also Approximate additive evolutionary trees branching order, 800 first guess at, 809-810 optimal, finding, 806-809 cluster analysis, 800- 801 consistency checks, 811 - 812 inferred, validity of, 810-812 nomenclature, 800 outgroup, 800 parsimony, 801 random errors in, 810 systematic errors in, 810-811 topology, 800 Phylogeny, rRNA-based, 793-812 Plasmid for antibiotic resistance mutations of, E. coli, 674-676 pAR3056, 691,694, 700 pBR322, 691,694, 695, 704 pCI857, 694, 705 pEJM007, 694, 698, 704 pKK3535, 691,694, 695, 704, 711,720 cloning of mutated 5S RNA genes in, 740 pLSK 34- I, cloning 5S RNA bisulfite mutants in, 742 pN2680, 694 pNO2680, 691 structures, 675 Poly(Phe) synthesis Mg2+ dependence of, 650-653 Mg2+/NH4/polyamine system for highest rate and accuracy of, 654-657 with near in vivo features, 650-658 poly(U)-dependent, 145-146, 650-658 on poly(U)-programmed ribosomes, 613 Poly[~4C]lysine,template-free ribosomal synthesis of, 635-636 effect of inhibitors on, 636- 637 kinetic curve for, 635 magnesium ion dependence of, 637
846
SUBJECT
sucrose gradient sedimentation of incubation mixture for, 637-638 Polyacrylamide gel electrophoresis of afflnity-labeled proteins, 347- 348 for analysis of ribosomal proteins, 523 Polymix, 650 reoptimization of, 621 - 622 Polymix burst, 612-615 Primer-directed deletions in 5S ribosomal RNA DNA rearrangement artifacts, 718- 719 efficiency of mutagenesis, 718 mismatch repair, 718 structure- function effects of mutations, 719-720 Primer extension, 484-487 design, 684-685 for determination of copy number of mutant rRNA genes, 673 for determination of percentage of mutant rRNA in cell, 688-690 for determination of structural and functional capabilities of ribosomes synthesized from single mutant rRNA operon, 673 method, 685-688 for quantitative measurement of rRNA in antibiotic resistance mutations, 683-690 with reverse transcriptas¢, to identify photoaffinity-labeled nucleotide site, 368-371 structural probing of RNA monitored by, 481 - 489 Primer extension analysis of RNA, 4 1 9 - 425 Primers, 484 Protein crystallization, 105 isolated, determination of concentration of, 139-143 sites of cross-linking on, 298- 299 Protein-5S RNA interactions, 469 Proteinase K, source, 187 Protein crystallography, 105 multiple isomorphous replacement method, 115 seeding in, 107 vapor diffusion technique, 105 - 106, 108 Protein-nucleic acid interactions filter assay for, 203
INDEX
in regulation of translation, 238 Protein- protein cross-linking, of ribosomal proteins, 64-76 Protein- RNA complexes binding sites analysis, 459 end labeling methods for, 459-462 in vivo labeling, 459 chemical and enzymatic probing, 481-489 buffers for, 483 chemical probes for, 464-466 exchange of end-labeled RNA with unlabeled RNA, 462 isolation, 456-458 modified and primed, polyacrylamide gel electrophoresis, 486-488 polyacrylamide gel analyses, interpretation of, 467 reverse transcfiptase as probe of, 463-464 ribonuclease probe, 464- 466 P site, 597 binding of peptidyl-tRNA to, 666- 670 indicator titration of binding to, 606-609 evaluation of, 608-609 occupation, quantitation, 598-599 tRNA binding to, 581-582 P-site binding assay, 409-410 Psoralen cross-linked 16S RNA fractionation by formamide-polyacrylamide gel electrophoresis, 326-327 reverse transcription of, 325- 329 Psoralen cross-linked RNA fragments, isolation to determine secondary structure, 332-333 Psoralen cross-linking of ribosomal RNA, 330-341 chromatography of digested RNA, 337-338 extraction and purification of above diagonal material, 338- 339 first-dimension gel electrophoresis, 338 labeling of digested RNA, 338 materials, 335- 336 partial digestion of rRNA, 337 photoreversal of RNA, 339 photoreversed fragments isolation of, 339 preparation for sequencing, 339 sequencing, 339-340
SUBJECT INDEX principle of, 331 - 333 procedures, 336-340 quantification of psoralen incorporation into rRNA, 337 reagents, 335-336 second-dimension gel, 338 variations, 334 Psoralen mono-addition, 466-467 Psoralen/nucleic acid photoreaction, 330- 331 Psoralen photoreaction hot spots for, 340 specificity, 340-341 Psoralens, as photocross-linking reagents, 330 Psoralen - uracil photoadducts, 330- 331 Puromycin assay, for distinguishing between A-site and P-site binding 4 l0 Puromycin reactivity, as indicator of ribosomal binding site location, 598, 666-670 Pyrimidine dimers, 692 R
Reversed-phase chromatography of oligonucleotide probes, 567-568 of peptides from ribosomal protein A from M. vannielii, 564-567 Reverse transcriptase effect of bound ribosome on, 371,420, 424, 481-482 photoaflinity probe as barrier to, 362-363 primer extension with, to identify photoaffinity-labelednucleotide site, 368-371 as probe of rRNA-protein interactions, 463-464 Reverse transcription of fractionated cross-linked RNA molecules, 325-329 pauses or stops in, 482 Ribonuclease cytidine-specific, from chicken liver, 466 as probe of protein-RNA complexes, 464-466 pyrimidine-specific,from B. cereus, 466 as structural probe of RNA, 482 Ribonuclease H assay, 441
847
from E. coil, 441 molecular weight, 441 preparation, 441 - 442 site-specific cleavage of RNA with, 440-449 identification of cleavage sites, 443-448 selectivity of, 449 unit of activity, 441 Ribonuclease H assay, of eDNA probe binding to ribosomal RNA, 405-406 Ribonucleie acid. See RNA Ribosomal activity, evaluation, problems in, 658-659 Ribosomal A-site binding, assay, 390- 391, 408 -409 Ribosomal complexes, pretranslocation kinetic titration of EF-G-GTP binding to, 594 preparation, 587 purification by centrifugation, 587 Ribosomal components, affinity labeled, identification of, 347- 351 Ribosomal functions, assays used for measurement of, 389- 392 Ribosomal particles biological activity, 96 in buffers with different magnesium-ion concentrations, tritium bombardment of, 437-438 crystal growth, 104-110 embedded three-dimensional crystals of, thin sections of, 102-103 eukaryotic, in vivo growth of two-dimensional sheets of, 99-100 integrity, 96 preparation, 429-430 prokaryotic, in vitro growth of two-dimensional sheets of, 100-101 structure of, 34 Ribosomal protein A from E. coli, sequence determination of, 561-563 from M. vannielii, 571 peptide mapping of, 564-567 sequence determination of, 561-563 N-terminal region of, sequence homology among different organisms, 561 - 563 Ribosomal protein-RNA complexes, binding constants, 203 Ribosomal protein-RNA interactions
848
SUEJEC'r INDEX
comparison of different assay methods, 220 complex association and disassociation rates, 212-213 filter-binding assay, 203- 214, 220 binding stoichiometry, 211-212 buffer composition, 209 buffer temperature, 209 calculation of binding constants, 210-211 factors affecting, 207- 210 filter washes, 208 filtration rate, 208-209 filtration volume, 208 protocol, 206-207 renaturation of components, 209- 210 retention efficiency, 207-208 gel mobility shift assay, 215-216, 220 nonspeeific binding artifacts, 213-214 permeation chromatography, 215 - 217 physical studies of, 203- 220 sedimentation chromatography, 215 - 217 sucrose gradient assay, 215-220 Ribosomal proteins amino acid sequence determinations, 542 archaebacterial HPLC purification for microsequencing, 542- 571 microsequencing of, 544- 545 sequence analysis of, 561 binding sites, 419 chemical cleavage of asparaginylglycyl peptide bond with hyclroxylamine, 263-264 at peptide bond of cysteine after cyanylation with 2-nitro-5-thioeyanobenzoic acid, 261 - 262 at tryptophanyl peptide bond with mixture of dimethyl sulfoxide and hydrogen bromide, 262-263 cross-linked pairs, purification, 571 cyanogen bromide cleavage, 264-265, 268-270 from E. coli with eysteine residues, 176 sequence analysis, 542-543 fluorescence intensity, upon binding ribosomal RNA, 203 fluorescence labeling, 176-177
fragments generation by proteolytic digestion, 259-261 preparation by chemical cleavage, 261-265 purifications, 265-266 that recognize rRNA, 258- 270 HPLC purification for microsequence analysis amino acid analysis, 547 desalting of proteins after ion-exchange chromatography, 558- 560 gel eleetrophoresis, 547 ion-exchange chromatography, 547, 553-558, 570 materials, 545 methods, 545- 546 microsequencing method, 547- 548, 570 procedures, 545- 548 reversed-phase chromatography, 546-547, 550-553, 570 size-exclusion chromatography, 546, 548-550, 570 supports, 550, 555, 557 identification of, after HPLC fraetionation, 544 ion-exchange HPLC separation of, 532-541 fluidics, 534-535 protein extraction, 533 protocol, 534-535 recovery efficiency of proteins, 537-538 reversed-phase repurificatiou of ion-exchange fractions, 538-539 subunit purification, 533 localization on surface of ribosomal subunit, 503-504 preparation, for two-dimensional PAGE, 576-578 purification, 204-205 removal of unlabeled proteins after fluorescence labeling, 179-180 reversed-phase HPLC, 523-532 applications, 530- 532 column packing, 524 denaturation, 526-527 detection, 524- 526
SUBJECT INDEX
eluting solvents, 524 flow rate, 526 ghost peaks, 528 multiple peaks, 526-527 order of protein elution, 528-531 protein preparation, 526-527 protein recovery, 528 reproducibility, 528- 530 resolution, 526-527 sample size, 526 total preparation, 429-430 tritium bombardment of, 434-435 tritium-labeled analysis of, 431-435 control of integrity of, 433-434 determination of radioactivity, 431 two-dimensional electrophoresis, 431 - 435 and tRNAs, separation and purification procedures, 179-186 5S-binding, 171 - 173 30S, separation by ion-exchange HPLC, 536-537 Ribosomal RNA Y-end, modification of, 499 affinity labels, 91 antibody probes, 493-503 binding of oligonucleotides apparent association constants for, determination by nonequilibrium gel filtration, 449-454 parameters, 450-451 cleavage, at 7-methylguanine residue, 454-455 colicin fragments. See Colicin fragments conformational changes monitoring with STEM, 59-61 resulting from interaction with ribosomal proteins, 449 cross-linked, fractionated on formamidepolyacrylamide gel, electron microscopy of, 324- 325 cross-link site analysis, 287-288 deuterated (23S + 5S), isolation of, 138 electron microscopy of, 76-91 electrophoresis in agarose/acrylamide, 699-700 exposed on ribosomal subunits, 401
849
fluorescence labeling, 177-179 fluorescent labels, 91 fragments, preparation, 221-237 hairpin structure, 188-189 hybridization selection cloning in fd phage, 222-223 principle, 221 - 222 procedure, 221-225 protocol, 223-225 interactions with ribosomal proteins, STEM images of, 61-63 internal modification, 80, 91 isolation, 79 labeled, incorporation into functional ribosomes, 185-186 labeling, 698 large, mutations in, 720-721 mass distribution within molecule, determination of, 57- 58 mass per unit length, determination of, 57-58 modification of Y-terminal ribose, 83 modification of selected points in, by reagents containing hapten residue, 80 naked, immunoelectron microscopy studies of, 77-81 phylogenctic analysis using, 793-812 merits of, 793-794 plasmid-coded, maxicell analysis, 691-706 preparation, 5 I protein-binding sites, 456 psoralen cross-linking of, 330- 341 radius of gyration, 59 regions involved in subunit association, 416 removal of unlabeled RNA after fluorescence labeling, 180-185 role in organization of ribosomal structure, 76 role in protein synthesis, 691 5S 3'-end labeling, 726 5'-end labeling, 726 A- and B-conformers, isolation of, 723-726 ct-sarcin digestion ladders of, 469-473
850
SUBJECT INDEX
A- or B-form, reactions specific for, 730- 731 from .4. modicum, sequence alignment, 796-797 association site for ribosomal proteins, 469 -470 base change mutations within, structural effects, 743-745 from B. harveyi, computer analysis of sequences, 770 biochemical studies, 723- 737 bisulfite mutants cloning in pLSK 34- l, 742 identification of, 742 protein-binding assay, 742 from B. stearothermophilus, sequence alignment, 796-797 from B. subtilis, sequence alignment, 796-797 chemical modification, 727-730 cross-linking" inter- and intramolecular, 730-732 diethyl pyrocarbonate reaction, 727-729 dimethyl sulfate reaction, 727-730 double-helical segments, 710 from E. coli, 721 computer analysis of sequences, 769-773 consensus patterns in, 776 secondary structure, 781 estimation of evolutionary differences between, 799 expression plasmid for, 716- 718 function, 721 - 747 gene, bisulfite-catalyzedtransition mutations in, 740- 742 genetic studies of, 737-743 kingdom-specific features, 710 labeled by hapten at internal position of its polynucleotide chain, preparation, 87-89 limited enzymatic digestion, 724-726 from M. capricolum, computer analysis of sequences, 770-773 from M. luteus, sequence alignment, 796-797 mutant, protein interactions, 745-746 mutated, tRNA and mRNA affinity of ribosomes containing. 743
nuclease $1 digestion, 724-726 nuclcase V, RNase digestion, 727 oligonucleotide-directedmutagenesis, 737-739 extension-ligation reaction, 738 hybridization of mutagenic oligonucleotides, 738 screening and characterization of mutations, 738 in phylogenetic analyses, 794- 795 point mutations, effect on tRNA and mRNA affinity of 70S ribosomes, 747 preparation of, 723 primer-directed deletions, 710- 721 colony immobilization on filter, 714715 experimental procedure, 712 - 716 extension and ligation, 713 isolation of5S RNA, 716 isolation of hetcroduplex fragment, 714 isolation of phosphorylated oligonucleotide, 712 ligation into pKK3535-derived expression system, 714 phosphorylation of oligonuclcotide, 712 primer annealing, 713 purification of M 13 templated, 713 screening by hybridization, 715 segregation of mutant plasmid, 715 716 sequencing. 716 strategy for, 711 transformation, 714 protein-binding sites, 7 l0 protein interactions with, 733- 737 regions of association of rat ribosomal protein L5, 469 regions of association of Xenopus transcription factor IIIA, 469 in ribosomal function, 722 RNase TI digestion, 724-726 secondary structure, 710, 732, 734-735 sequences comparison of, 799 evolutionary tree of, 808 structure, 721-747 tertiary structure, 710, 732-733, 736
SUBJECT INDEX tree representation of pairwise distance estimates, error in, 807-808 5.8S, in phylogenetic analyses, 794 16S Y end, 188-189, 221 3' terminal cloacin fragment, 240-241 preparation, 240, 244-246 accessibilityof 5' terminal region, in free 16S rRNA, 30S subunits, and 70S ribosomes, 451-454 C-1400 region, 354-355, 411-412, 417-418 cleavage, determination of degree of, 190-191 cross-linked, electrophoresis in polyacrylamide gels, 320- 324 formamide-polyacrylamidegel electrophoresis, 320-324 separation into bands of families of cross-links, 334 from E. coli 3' end, 188-189 cleavage at 7-methylguanine, 455 interaction with protein $4, 61-62 extended hairpin from, plasmids coding for, 227-230 IF3 binding, 238 molecular weight, 56 in phylogenetic analyses, 795 psoralen cross-linking procedure, 336-340 psoralen photoreactive sites, identification of, 334 sequence data, 795 single-base bulge in, 227-230 structure, 76 tertiary structure model, 76 thermal denaturation of specific regions of, 481 23S molecular weight, 56 and 5S, separation of, 132-133 sequence data, 795 structure, 76 28S conformationai changes in, STEM images of, 60-61 mass distribution within molecule, 57, 58
851
molecular weight, 56 samples for immunoelectron microscopy, preparation, 79 secondary structures, 188, 221 source, 187 spontaneous mutants, isolation of, 708-709 structure, 401 surface topography of, 440-455 topography, immunoelectron microscopic studies of, 80 Ribosomal RNA-complementary oligodeoxynucleotides modification of, 499-502 synthesis, 499- 500 Ribosomal RNA genes cloned in low-copy-number vector, analysis of, 697-698 of E. coli, antibiotic resistance mutations in, 673-690 Ribosomal RNA- oligodeoxyribonucleotide complexes, site-specific hydrolysis, with RNase H, 440-449 Ribosomal RNA-protein interaction probing, 456-468 use of a-sarcin in analysis of, 468-475 Ribosomal RNA sequences alignment gaps, 796-797, 798 availability of, 794-795 sequence alignment, 795-797 similarities, quantitation of, 797-799 weighting mask, 797, 799 Ribosomal subunit, 30S containing Y-modified 16S RNA bound by hapten-specific antibody, electron microscopy of, 89-90 containing fragmented 16S rRNA biological activity, 448-449 purification, 448-449 reconstitution, 448-449 from E. coil assembly, 278 crystallization, 96 ~H NMR spectra, 150-154 molecular weight, 56 neutron-scattering topography of proteins of, 117- 131 preparation from tight couples, 659 radius of gyration, 59
852
SUBJECT INDEX
ribosomal protein arrangement within, 64 structural studies, 310 three-dimensional reconstruction of, 29 total reconstitution of, 278 isolation of, 662 labeled by DNP-hapten at 5'-end of 16S RNA, preparation, 85-87 localization of P site, 34 mRNA interaction zone on, 354-357 reassembly from proteins separated by ion-exchange HPLC, 538- 540 reconstitution and purification of, from modified 16S RNA, 83-84 reconstitution from RP-HPLC-prepared proteins, 532 site for IF-3 binding, 358 sites of EF-G binding, 355 three-dimensional investigation of, 34 three-dimensional location of protein on, 511 from T. thermophilus crystal growth, 104- I I l crystallization, 96 crystallographic studies of, I 11 - 114 Ribosomal subunit, 40S, affinity labeling and cross-linking studies of, 359-360 Ribosomal subunit, 50S from B. stearothermophilus crystal growth, 104-111 crystallization, 96-97 crystallographic studies of, 111 - 114 three-dimensional reconstruction of, 97-100 crown view, 511 deuterated, neutron scattering analysis, 131-147 from E. coli cross-linking, 65 crown view, 39-40 deuterated activity measurements, 145 efficiencies, 147 reconstitution procedure, 141 - 145 yield, 147 deuterated components, preparation, 136-137 electron microscopy, 12 ~H NMR spectra, 150-154 image analysis, 38-49
classification, 47 - 48 correspondence analysis map, 45-46 kidney view, 39 L7/LI 2 proteins, 151 - 154 effect of elongation factor on structure of, 154-157 localization of ribosomal proteins on surface of, 503-504 molecular mass, 55 peptidyltransferase center, 352- 354 poly(U)-dependent poly(Phe) synthesis, 145-146 preparation from tight couples, 659 protein pairs cross-linked within, analysis of, with one-dimensional S D S - P A G E and immunoblotting, 65 -68 single proteins from, preparation, 134-136 three-dimensional reconstruction of, 29 total proteins from deuterated, isolation of, 138-139 preparation, 133-134 total reconstitution of, 278 electron microscopy, 37- 38 from H. marismortui crystal growth, 104-111 crystallization, 96-97 crystallographic studies of, 111 - 114 IF-3 cross-linking to, 358 isolation of, 662 kidney projection, 511 proteins, separation of, 541 reconstitution and purification of, from hapten-modified RNA, 84 reconstitution from RP-HPLC-prepared proteins, 532 sites of EF-G binding, 355 three-dimensional location of protein on, 511 Ribosomal subunit, 60S, STEM image, 60 Ribosomal subunit, 70S from B. stearothermophilus, crystallographic studies of, 111 - 114 from E. coli crystallographic studies of, 111 - 114 ~H NMR spectra, 150-154 Ribosomal subunits couples, tritium bombardment of, 439 deuterated, preparation, 137-138
SUBJECT INDEX from E. coli active in tRNA binding, preparation of, 658-670 isolation, 401-402 localization of ribosomal proteins on surface of, 503- 520 preparation, 51 protein-protein cross-finks, 64-76 hapten-modified, formation of immunocomplexes with, 84- 85 IH NMR spectra, 150-154 image analysis, 35-49, 53 classification, 44-45 computerized alignment algorithm, 39, 40 cross-correlation coefficient, 41 cross-correlation function, 41 data preparation, 38 image alignment within plane, 39-41 molecular projections pretreatment of, 38- 39 selection of, 38-39 multireference alignment, 45-48 multivariate statistical analysis of mixed populations, 42-44 refinement of alignments, 41-42 rotational correlation function, 40-41 image analysis aligned particle projections, correspondence analysis of, 16 alignment of images, 8-11 averaged image, statistical significance of structural features in, 14-15 averaged projections reproducibility of, 11 - 14 resolution of, 11 - 14 averaging, 11 axial astigmatism, 7 cluster analysis, classification, 17-20 clustering, about moving centers, 18-20, 33 clusters identification of, 17- 20 stable, 33 computerized, 35-49 correspondence analysis, 15 data processing software, 29-33 digitization, 6 - 7 direct rotational alignment, 9 error sum, minimization of, 8
853
factor maps, 16-18 factors, 16 hierarchical ascendant classification of data, 18-20, 33 multireference alignment, 9 multivariate statistical analysis, 15-19, 37-38, 42-44 nonlinear mapping, 20- 21 optimal alignment, 8-9 point cloud, structure of, 15 - 17 resolution determination, by phase residual analysis, 11 - 13 rotational search, 8-11 scaling procedure, 7 selection of images, 6 - 7 translational search, 8-10 two-dimensional cross-correlation function, 8-10 variance map, 11 image profiles, 16 immune,electron microscopy of, 503-520 isolated, tritium bombardment of, 439 labeled by hapten at 3'-end of RNA, preparation, 82-85 large from B. stearothermophilus crystallographic studies, 110-111 three-dimensional crystals of, 103 from 1t. marismortui, crystallographic studies, 110-111 32P-labeled, preparation, 289-290 small neutron-scattering topography of proteins of, 117-131 quarternary structure, 117-131 from T. thermophilus, crystallographic studies, 110-111 unfolded, tritium bombardment of, 436 Ribosomal translocation biochemical assays, 585-586 fluorescent energy transfer changes during, 591-593, 595-596 mechanism, 596 pre-steady-state kinetic studies on, 581 - 597 pretranslocation complex, 582-583 Ribosomal translocation kinetics principle of study, 582- 583 study buffers, 584-585
854
SUBJECT I N D E X
data evaluation, 588 double-label experiments, advantages of, 597 materials, 583 procedures, 585-589 results, 589-596 stopped-flow apparatus, 585 stopped-flow experiments, 587-588 Ribosome, 30S assembly kinetic intermediates, 272-277 temporal sequence of, 275-277 with and without bound cDNA probe, structural differences, 414-415 inactive and active, comparison of psoralen cross-linking, 334 Ribosome, 40S preparation of, 575 from rat liver, preparation, 579-581 Ribosome, 50S, assembly kinetic intermediates, 272-277 temporal sequence of, 275-277 Ribosome, 70S B. stearothermophilus crystallization, 96 three-dimensional reconstruction of, 101 in chloroplast, 748 from E. coli crystal growth, 104-111 crystallization, 96 electron microscopy, 18-19, 504-507 tightly coupled, preparation of, 659-662 total reconstitution of, 278-283 materials, 283 optimal Mg2+ concentration and incubation temperature, 279-282 optimization of TP70 for, 279-281 parameters affecting, 278-282 procedure, 283 translational kinetic parameters, measurement, 619- 620 Ribosome, 80S, three-dimensional reconstruction of, 97 Ribosomes affinity labeling of, 341 - 361 assembly, 63 intermediates, 270
mechanism, 270 study of, 76 temporal sequence in E. coli, 270-277 binding activity, testing, 665-670 binding site for protein factor catalyzing translocation, 359-361 from E. coli active in tRNA binding, preparation of, 658-670 intra-RNA cross-linking, 287- 289 isolation, 401-402 peptidyltransferase center, 352- 354 photoaffinity labeling experiments on, 342 preparation of, protocol, 659-660 RNA-protein cross-linking, 287-289 structure, 287 eukaryotic, crystallization, 95- 96 fluorescence techniques for, 174-187 ~H NMR spectra, 150-154 hot tritium bombardment of, 426-439 interkingdom comparisons of, 33 internally mobile segments or amino acid residues, 148 in vivo performance characteristics, in E. coli, 611-612 nondissociated, tritium bombardment of, 436 preparation, 240-245 prokaryotic, crystallization, 95-96 proofreading properties of, during elongation, 623-627 from rat liver affinity labeling and cross-linking experiments with, 358-361 peptidyltransferase center, 358- 359 reconstitution, from fluorescently labeled components, 185-186 structural state of, dependence of protein exposure on, 436-439 surface, identification of proteins exposed on, 434-436 surface topography, studies, 426 synthesis of ppGpp, assay, 390 topography of tRNA-binding sites, 372-397 translational activity, protein synthesis assay, 411 tRNA-binding activity, 597 tRNA binding sites, 416-418
SUBJECT INDEX RNA. See also Ribosomal RNA; Transfer RNA; affinity labeling sites within, identification of, 348- 349 chemical probes, localization of sites of attack, 475 chemical probing of, 476-477 fluorescence labeling, 177-179 fragments, purification, 234-235 5S acrylamide gel electrophoresis, 170 analytical gels for, 170-171 fragment I partial denaturation and reconstitution of, 166-168 preparation of, 164-166 strands, total dissociation of, 169 fragment 2, preparation of, 165-167 methylene blue staining, 170-171 overproducing strains for, 158 preparation for ~H NMR, 158 protein interactions with, probing, 458-468 purification, 161 - 164 cell rupture, 161 - 162 chromatography, 163-164 phenol extraction, 162-163 yield, 164 samples for NMR and crystallography, 173-174 ~N labeling of, 159-161 16S from E. coil, site-specific cleavage with RNase H, 443-448 priming at position 480 of, 487-488 protein complexes preparation, 260 proteolytic digestion of, 260-261 protein $4 complex, reconstituted after proteolysis, 267-269 structural probing monitored by primer extension, 487-488 structure, 487 23S peptidyltransferase, labeling of components, 362 photoaffinity-labeled,localization of site of reaction, by hybridization, 362- 371 photoaffinity labeling
855
conditions of photoreaction, 364-365 method, 363-365 photoreaction kinetics, 364- 365 primer extension analysis and sequencing of, 369- 371 site ofphotoaffinity labeling on, 362 3sS-labeled, preparation, 205-206 sites of cross-linking on, 298-299 structural analysis, 481-489 structure chemical and enzymatic probing, 482-484 chemical probes, 475 RNA cross-links, 319- 329 electrophoresis in polyacrylamidegels, 320 - 324 RNA-DNA hybridization applications, 481 in chemical probing of large RNA molecules, 475-48 l end labeling, 479 gel filtration step, 478 inefficient labeling in, 480 for localization of site of photoaffinity labeling reaction, 363- 37 l method, summary, 476 multiple hybrid or RNA bands from same restriction fragment, 480 phosphatase treatment step, 478 potential problems, 480 procedure, 477 purification of hybrids, 479- 480 purification of RNA fragments, 479480 removal of free oligonucleotides from hybrid mixture, 478 RNase T~ digestion step, 477-478 RNA-protein interactions, 61-63 inhibitor, 271 RNA transcription in vitro, 226-237 cloning, 227- 231 conditions, 231 - 234 from DNA template, 22 l preparation of DNA, 231-232 preparation of DNA coding for small RNA helix, 230-231 principle, 226
856
SUBJECT INDEX
reaction conditions, 233-234 sequence constraints, 226-227 ladders, 236-237 large-scale, 217 precautions to avoid RNase contamination, 237 from single-stranded templates, 235-237 rpIX gene missense mutant genes, cloning strategy, 707- 708 nonsense mutant in, 706-707
S
$4 fragment binding isotherms for 16S and 23S RNA, 267-268 isolation, 265-270 relative affinity for 16S ribosomal RNA and amRNA, determination, 219 tdtiated, preparation, 217 S4-16S ribosomal RNA affinity, absolute, determination, 218- 219 S4-amRNA complex, stoiehiometry of, 211-212 $4- mRNA complex association and disassociation of, 212-213 gel electrophoresis, 215 - 216 $4- RNA binding isotherms, 206- 207 $4-RNA complex, binding constants, determined by different methods, 214, 220 $6 isolation of, for two-dimensional tryptic phospbopeptide analysis, 577- 579 phosphorylation state, analysis, 575 two-dimensional polyacrylamide gel of, 578 S13, cleavage at Cys-84 residue, 267 S 150 enzymes, tRNA-free, preparation of, 664 Scanning transmission electron microscopy, 49-63 advantages of, 49- 50 applications, 53 - 63 to mass distribution within rRNA molecule, 57-58
to mass per unit length of rRNA, 57-58 computer image analysis, 53 freeze-drying step, 52 image-forming system in, 49-50 of interactions of rRNAs with ribosomal proteins, 61 - 63 mass measurement with, 53- 56 arbitrary area subroutine, 56 circle subroutine, 54- 55 mass standard for, 52 materials, 51 methods, 51 - 53 for monitoring conformational changes in rRNAs, 59-61 protocol, 53 radius of gyration determination, 58-59 specimen deposition, 51 - 52 specimen preparation for, 51-52 SEMPER software, 30 Seryl-tRNA [t4C]-labeled, as substrate for templatefree ribosomal synthesis of polypeptides from, 642-645 as substrate for ribosomal peptide synthesis in absence of template, 631 Shannon's sampling theorem, 26 Shine-Delgarno region, 419 Single-particle averaging, 3-5 Single-stranded nucleic acids, secondary structure, computer analysis of, 766 Site-directed mutagenesis, 7 l0 Southern blot analysis, of afffinity-labeled 23S RNA, 366-367 SPIDER software, 30-32 QCUCENT procedure, 32 S protein implicated in mRNA binding to E. coli 30S subunit by affinity labeling studies, 356-357 labeled in affinity labeling and cross-linking studies of rat liver ribosome, 360 order of elution from RP-HPLC columns, 529-530 SS-biotin, source, 378 Sulfolobus, isolation of genes of ribosomal proteins derived from, 571 Sulfolobus acidocaldarius, separation of ribosomal proteins on reversed-phase columns, 553, 555 Synchrotron radiation, 1l0
SUBJECT INDEX T T7 promoter/RNA polymerase system, for labeling rRNA transcripts, 691, 700-702, 705 T7 promoters, 226 5' transcript sequences from, 227 T7 RNA polymerase, 702 assay, 232 inducible promoter based on, 717 purification, 232 RNA transcription.with, 231 234 transcription of small RNA sequences with, 235-237 T7 RNA polymerase transcripts, 3' termini of, 227, 228 Tandem hybrid, 480 Temperature-sensitive mutants with alterations in ribosomal protein L24, 706- 709 suppressor mutants of, mapping in genes other than ribosomal protein genes, selection, 709 Thermus thermophilus, ribosomal subunits from. See specific subunit Thioketone reagents, 373 Three-dimensional reconstruction, 3-4, 95, 97-103 computer-generated solid modeling, 28-30 conical geometry, weighting function for, 25 conical tilting, 26-27 conical-tilt series, 22-24 data collection for, 21-22 physical model building, 28 procedure for, 24 reconstructed particles, representation of, 28-29 reconstructed volume, representation, 28-29 resolution determination, phase residual calculation, 28 single-axis tilting, 26-27 2-D weighting function for, 26 single-axis tilt series, 22-23 theoretical resolution of, 26-28 tilt axis determination, 22-23 tilt series, alignment of, 23-24
857
weighting functions for various geometries, 24-26 Threonyl-tRNA, as substrate for ribosomal peptide synthesis in absence of template, 631 Toeprinting. See Extension inhibition analysis Transcription factor IIIA, 710 binding site on 5S rRNA, 469, 474 Transfer RNA acetylation, 187 afffinity-labeled,in study of ribosomal tRNA-binding sites, 372-397 affinity probe-modified cross-linking to ribosomes, 392- 395 functional activity of, 389- 392 ribosomal activity of, 391 -392 translocation assay for, 391,392 aminoacylated saturation titrations with, 598 site location of, 598 aminoacylation assay, 389- 390 binding to A and P sites, 583 quantitative indicator assay, 597611 binding to ribosomes, 355, 581-582 bound, competitive displacement of, 411, 413 Cts reversed-phase HPLC for separation of, 181-185 general comments on, 185 deacetylated in elongation cycle, 658 site location of, 598 dissociation from ribosome, in monitoring ribosomal translocation kinetics, 593-594 doubly modified with biotin-streptavidin, 396- 397 with DNP-anti-DNP, 395-396 preparation, 395-396 use of, 395-397 in elongation cycle, 658 fluorescence labeling, 177-179 fluorescent, for monitoring ribosomal translocation, 582 fluorescent derivatives, 584 isolation, 583-584, 599-600 labeled deacetylated, 186 misacylated, template-free ribosomal
858
SUBJECT INDEX
synthesis of polypeptides from, 645647 modification of NH 2 group of acp3U, 379-382 modified, ribosome interaction of, 605-606 naturally occurring species, isolation, 185 reaction of affinity probes with, 378-389 reactive groups available for affinity probes, 372-373 removal of unlabeled RNA after fluorescence labeling, 181 - 185 replacement of dihydrouracil, 178-179 resistance to hydrolysis by c~-sarcin, 474 sites of attachment of affinity probes, 389 source, 187, 402 thioketone modification, 378 Transfer R N A - 16S RNA cyclobutane dimer cross-link, 393-394 Transfer RNA ^lp, yeast, crystallographic structure, 648-649 Transfer RNA TM binding to P site, 583 deacetylated, release from P site, 582 displacement reaction, 589- 591 isolation, 599-600 modification of carboxyl group of acp3U-47, 382-388 release from binding site, in monitoring ribosomal translocation kinetics, 591-593 yeast, 583-584 crystallographic structure, 648-649 Transfer RNA TM derivatives displacement from P site of pretranslocafive ribosomes, time course of, 590-591 in monitoring ribosomal translocation kinetics, 582 Transfer RNA v~,, modification of carboxyl group of cmoSU-34 of, 382-388 Transfer RNA binding assay, 408-409, 597-61 l binding constants for indicator titrations, 605 buffers, 599 computer fitting estimations of active ribosomes or binding constants, 606611 determination of binding constants, 603-604
determination of binding stoichiometries, 601 - 603 estimation of binding constants from indicator titrations, 611 materials, 599 principle, 598-599 procedures, 601 - 604 stoichiometric indicator titrations, 603-605 Translation, of poly(U) in vitro, 623 Translational kinetic parameters irreversible proofreading, 623-627 measurement of, 611-631 assay condition for burst error measurement, 623 assay conditions, 612- 615 factor limitations, 617- 619 factor titrations, 616- 617 high rate, 622 for investigation of proofreading of correct and incorrect ternary complexes, 629-630 optimized accuracy, 622 reversible initial selection, 623 split-factor assay, conditions for, 630- 631 split-factor titration, 629-630 Translation initiation complexes, extension inhibition analysis of, 419-425 Translation initiation factor binding to rat liver ribosome, 360-361 binding to ribosomes, 419 Translation initiation factor 2, 358 Translation initiation factor 3 binding domain, 238- 239 binding to mutant 30S ribosomal subunits, 257 binding to mutant unmethylated cloacin fragment, 257 binding to ribosomes, 419 filter-binding assays with, 238 interaction with ribosomal RNA, 238-258 preparation, 240-245 properties, 238-239 30S and 50S complexes with, cross-linking experiments with, 355-358 Translation initiation factor 3 - R N A interactions circular dichroism titrations, 247- 252, 256-257
859
SUBJECT INDEX
cross-linking experiments, 257 equimolar footprinting, 246-248, 256-257 high-field IH NMR spectra of, 252-256 model for, 257-258 proton magnetic resonance measuremerits, 252- 256 sedimentation studies, 257 Translocation, shift oftRNA molecule in, 647 Translocation factor EF-G, 70S complexes with, cross-linking experiments with, 355 Transmission electron microscopy, 49. See also Scanning transmission electron microscopy U UVRABC nuclease, 692-693
V V~ nuclease, as structural probe of RNA, 482
W Watson-Crick hydrogen-bonding sites, reagents that react at, 482-483 Wybutine, as fluorescent probe of ribosomal translocation kinetics, 582
X X-ray crystallography, 95 of ribosomal particles, 103-117
Z
Zero phosphate medium, 698, 705-706
