CHAPTER 1
Preparation of Human Chromosomal Painting Probes From Somatic Cell Hybrids Nicoletta Antonino
Archidiacono, ...
23 downloads
1714 Views
38MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
CHAPTER 1
Preparation of Human Chromosomal Painting Probes From Somatic Cell Hybrids Nicoletta Antonino
Archidiacono, Forabosco,
Rachele Antonacci, and Mariano Rocchi
1. Introduction Chromosomal in situ suppression (CISS) hybridization with flow-sorted chromosome libraries (FSCL) has provided a very powerful tool in human cytogenetics. This technique allows the painting of specific chromosomes in metaphase spreads and in interphase nuclei (1-4). The usefulness of FSCL is particularly evident, for instance, in identifying the chromosomal origin of de ltovo unbalanced translocations and marker chromosomes, or, more generally, m characterizing those cytogenetic cases in which the conventional approach based on bandmg techniques fails to elucidate the chromosomal rearrangement under study (5,6). These situations are frequently experienced in cancer cytogenetics (7,8). Painting libraries of human origin have also been utilized to follow the chromosome evolution of primates (9-11). For example, studies where both chimpanzee chromosomes 12 and 13 were pamted by the human chromosome 2-specific library have confirmed the origin of this human chromosome from the fusion of two distinct ancestral chromosomes still separated in great apes (12). Biotmylated genomic DNA from hybrid cell lines retammg specific human chromosomes has been used directly as a source material for pamtmg purposes (I3,14). However, because human chromosomes represent only a minor component of a human-rodent somatic cell hybrid, the sensitivity of this technique is not always satisfactory (24). Nelson et al. (1.5) have achieved the selective amplification of human DNA present in human-rodent hybrids, using an Alu-derived primer in polymerase chain reaction (PCR) experiments under appropriate stringency conditions (IRS-PCR, or interspersed repetitive sequence-PCR). Labeled IRS-PCR products have been shown to be efficient for painting specific human chromosomes in in situ hybridization experiments (16,17). Ah and LINE sequences, however, are not evenly interspersed in the human genome; their primary distribution correlates with G-negative and G-positive bands respectively (18), so that A/u-PCR products will generate a From Edited
Methods in Molecular Bmlogy, Vol 39 In Sttu Hybrtd&abon Protocols by K H A Choo CopyrIght 01994 Humana Press Inc , Totowa. NJ
1
2
Archidiacono
et al.
banding pattern correspondmg to R-banding (19) The addition to the hybridization mixture of biotmylated IRS-PCR products obtained using Ll primer (20) do not completely elimmate the problem because most inter-L1 DNA segments are out of the amplification range of Taq polymerase. “Holes” produced by painting using these products are particularly evident m the centromerlc regions because of the extreme paucity of Ah or LINE sequences.However, in cases in which the centromeres are involved m rearrangements, centromerlc alphold probes can be successfully utilized instead. Very recently (21), the use of accurately designed dual-Alu primers m PCR amplification has allowed the achievement of more satisfactory painting efflciency and sensitivity of the IRS-PCR technique, which are comparable to the painting performances using FSCL. The IRS-PCR method, however, has an even wider spectrum of applications because it can be used to generate paintmg probes specific for discrete portions of chromosomes (“partial” libraries). Selected examples of these usages will be illustrated in this chapter. 2. Materials 2.1. PCR
1 Alu primers (21): 5’ GGATT ACAGG YRTGA GCCA 3’ (Y = C/T, R = A/G) 5’ RCCAY TGCAC TCCAG CCTG 3’
6 7 8 9.
Store frozen at 100 pmol/pL. Genomic DNA from hybrid (100 ng) in dlstilled water. Store frozen 0 5-mL Test tubes suitable for the thermal cycler. A set of micropipets (P20 and P200, GIlson, Vilhers-le-Bel, France) and stenle tips Reagents for PCR (store frozen). 10X dNTPs mix of 2 mM each, pH 7; 10X reaction buffer (usually comes with the Tuq polymerase); Tuq polymerase (5 U@L), DistIlled water (autoclaved and stored at room temperature); and Light mineral oil Programmable thermal cycler. Agarose, ethldium bromide, gel electrophoresls apparatus, and UV transilluminator Molecular weight marker (Lambda-Hi&III + PhzX-H&II, 50 ng/pL each). TBE buffer: 900 mM Tris-base, 900 mM boric acid, 1 mM EDTA
1 2 3 4 5 6. 7.
2.2. Nick Translation 10X Buffer. 0.5M Tns-HCl, pH 7.8-8.0, 50 mM MgCl*, 0.5 mg/mL BSA. dNTPs mix: 0.5 mM each of dATP, dCTP, and dGTP. Biotin-1 l-dUTP mix: 0 5 m&Z each of dTTP, and blo- 1 I-dUTP Enzymes: DNA polymerase I (5 U&L) and DNase I (2 U/mL). Other chemicals: O.lM P-mercaptoethanol, 0 5M EDTA, and 10% SDS 1-mL Syringes. TE* 10 mM Tns-HCl, pH 7.5, 1 mM EDTA.
2 3 4. 5.
Painting
Probes
From
Hybrids
3
8. G-50 fine Sephadex (Sigma, St. Louis, MO). Add 10 g of Sephadex to 300 mL distilled water. After at least 1 h, change the supernatant with TE. Let decant. Repeat three or four times.
2.3. In Situ Hybridization 1 2. 3 4. 5 6. 7 8 9. 10. 11. 12 13. 14. 15. 16. 17. 18 19 20 21. 22
Human Cot-l DNA (BRL, Bethesda, MD). 1 pg/pL salmon sperm DNA. 3M Na acetate 70, 90, and 100% Ethanol. Savant concentration centrifuge. Formamide and deiomzed formamide. 50% dextran sulfate, autoclaved. 20X SSC (1X SSC = 150 mM sodmm chloride, 15 mM sodmm citrate, pH 7.0). Vortex. Coplin jar. 24 x 24 mm and 24 x 60 mm coverslips. Rubber cement. Washing solution A: 50% formamlde/2X SSC Washing solution B* 0.1X SSC Blockmg solution 3% BSA/4X SSC/O. 1% Tween 20. Detection buffer, 1% BSA/lX SSC/O.l% Tween 20. 1 mg/mL Avidin-FITC (fluorescein rsothrocyanate, Vector Laboratories, Burlingame, CA) Solutron C: 4X SSC/O. 1% Tween 20. If signal amplification is performed: 0.5 mg/mL biotmylated antlbiotm antibody (Vector Laboratories) DAPI (4,6-diamldino-2-phenymdole, Sigma). Propidium iodide (Sigma) Antifade mounting medium. 10 mL: 0 233 g DABCO (1,4-diazabtcyclo-[2.2 21 octane, Sigma), 800 PL distilled water, 200 FL 1M Tris-HCI, pH 8.6, 9 mL glycerol
3. Methods 3.1. Generation of PCR Products from Somatic Cell Hybrids 1. In a 0.5-mL tube (smtable for a thermocycling machine), mix m this order: 1 l.tL DNA from hybrid; 37 2 pL Distilled water; 5 /.tL 10X PCR buffer, 5 PL 10X dNTPs mix; 0.8 l.rL Tuq Polymerase (5 U&L); and 0.5 FL of each primer (1 @Y final concentration), Adjust total volume to 50 pL. Overlay with a drop of light mineral 011. 2. In a second tube, add everythmg as described, except the DNA This serves as a negative control. (If more than one sample is amplified, a master mix can be prepared.)
4
Archidiacono
et al.
3 Run on the thermocycling machine as follows a. 5 min at 94°C. b. 30 cycles 1 min at 94”C, 1 mm at 65”C, 4 min at 72’C c. 10 min at 72°C. 4. Check the amplification products by loading 5+tL ahquots on a 1% agarose gel. Store at 4°C (see Fig. 1). 1.
2 3. 4. 5. 6. 1
2 3. 4.
3.2. Probe Biotinylation by Nick Translation Add to a microfuge tube, on ice. 2 l.rg of amplification products, 10 PL 10X mck translation buffer, 10 pL dNTPs mix; 5 l,tL Biotin mix (see Note 1); 10 pL 0 1M P-mercaptoethanol; Dilute (immediately before use) 1 pL of DNase I m 1 mL distilled water, add 20 lrL to the nick-translation mix. (The DNase I should be cahbrated to give fragments of 100-500 bp, see step 4), 1 5 ~.LLDNA polymerase I, and Sterile distilled water to 100 pL. Incubate at 15°C for 2 h. Place at 4°C until checked on gel Take 5+L aliquot of each sample, add 4 pL Hz0 and 1 pL of 10X gel loading buffer. Run on a 1% agarose gel to check fragment sizes (see Note 2). Stop reaction by adding 4 l.r.L 0.5M EDTA Purify the labeled probe through G-50 Sephadex (see Note 3) 3.3. Probe Denaturation Precipitate 20 ltL labeled DNA (400 ng, see Note 4) with 5 l.rg human Cot-l DNA (see Note 5), 3 pg salmon sperm DNA, 0.8 p.L 3M Na acetate, and 3 vol cold (-20°C) ethanol. Leave at -80°C for 15 min. Spin for 15 min (14,000 rpm) at 4°C Dry the pellet in a Savant centrifuge for a few minutes Prepare hybridization mrx (10 PL per slide). Add to a test tube. 5 ltL of deiomzed formamide, 2 l.tL 50% dextran sulfate, 2 pL disttlled water, and 1 pL 20X SSC If more shdes have to be hybridized, a master mix can be prepared. Resuspend pellet m 10 pL hybridizatton mix by vortexing. Denature DNA mix at 80°C for 8 min Transfer to 37°C for 20 min, then place on ice until use.
3.4. Slide Denaturation 1 Prepare 50 mL denaturing solution (70% deiomzed formamide/2X SSC) Pour mto a Coplin jar. Place m a water bath at 70°C. Check the temperature inside the jar. 2 Prewarm slides at 60°C in dry oven 3. Immerse the slides m the denaturation solution for exactly 2 min, two slides each time. 4 Dehydrate slides m 70,90, and 100% ethanol, 3 mm each time (70% ethanol at -2OT). 5. Dry slides after dehydration.
Painting
5
Probes From Hybrids 1234
567
8
91011
Fig. 1. Samples of Alu-PCR amplification products from 11 different hybrids. The PCR reaction was done in 50 pL vol. Five microliters were run on 1% agarose gel, at 100 V. The marker is lambda-Hid11 + PhiX-HueIII. Amplified fragments range from approx 2 kb to 300 bp. Discrete bands (as in lane 10) are frequently detected in amplified DNA from hybrids that retained a small amount of human cytogenetic material. The run is also informative for a quantitative evaluation of the PCR products, estimated by visual comparison with known amount of the marker. The quantitative evaluation can be better done by inspecting the gel after a few minutes of running, when both marker and the samples appear as compact bands.
3.5. Hybridization 1. Apply 10 pL hybridization mix to denatured slides, avoiding air bubbles. 2. Cover with 24 x 24 mm clean coverslip; seal with rubber cement. 3. Incubate in a moist chamber overnight at 37°C. 3.6. Posthybridization Washing and Detection Do not allow slides to dry at any stage. All washings are done in Coplin jar. 1. Remove coverslips and wash three times for 5 min in prewarmed solution A in a Coplin jar in a shaking water bath at 42°C. 2. Wash three times for 5 min in prewarmed solution B in a water bath at 6O’C. 3. Apply 200 l.tL of blocking solution per slide; cover with a 24 x 60 mm coverslip. Transfer the slides into a moist chamber and incubate for 30 min at 37°C. 4. Dilute stock solution of avidin-PITC (1 mg/mL) 1:300 in detection buffer. Let coverslips slide off; apply 200 p.L detection solution per slide. Cover with 24 x 60 mm coverslips. Transfer the slides into a dark moist chamber and incubate at 37’C for 30 min. 5. Remove the coverslips; rinse the slides three times for 5 min in prewarmed washing solution C in water bath at 42’C. 6. Counterstain with DAPI (200 ng/mL in 2X SSC) (see Note 6) or with propidium iodide (200 ng/mL in 2X SSC), or both.
6
Archidiacono
et al.
7. Rinse for 2 min m 2X SSC/O 05% Tween 20 at room temperature 8. Apply 30 uL of antifade-mounting medium and cover with a 24 x 60 mm coverslip. Slides can be stored for weeks in the dark at 4°C. 9. If necessary, the signals can be amplified as follows: After washing with solution C (as in step 5), dilute 1.100 the blotmylated antibrotin antibody in PBS (0 5 mg/mL). Apply 200 uL to the slide; cover wrth coverslip and incubate in a moist dark chamber at 37’C for 30 min. Repeat washes as in step 5. Then repeat steps 4 and 5 and proceed to step 6. 3.7. Fluorescence
Microscopy
Signals from painted chromosomes are visible usmg an epifluorescence microscope equipped with specific filters for the fluorochromes utihzed. A 50 or 100 W mercury high-pressure lamp is suitable. If a normal photographtc apparatus is used, dual or triple band pass filters are appropriate. Multiple band pass filters generally reduce the amount of light reaching the camera. If a blackand-white cooled CCD (charge coupled device) camera (Photometncs, Tucson, AZ) IS used, filters should be dtstmct for each fluorochrome and aligned, to guarantee an exact merge of images. Cooled CCD cameras are currently the most sensitive device. Signals from painting probes are usually strong enough to be recorded using a conventronal photographic camera. (See Note 7 and Figs. 2 and 3 for examples of the application of the present technique.)
4. Notes 1 Probe labeling can be performed usmg digoxigenm-11-dUTP (Boehringer Mannhetm, Mannhelm, Germany) instead of bto-1 l-dUTP, and revealed by antrdlgoxigenin anttbody conjugated with FITC or rhodamin fluorochromes. This allows the cohybrtdization of two different probes in the same experiment
Fig. 2 (oppostte page) Examplesof pamtmgwith IRS-PCRprobes Dtgnal imageswere obtamedusmga computer-controlledZeissAxioplan epifluorescencemicroscopeequipped with a cooledCCD camera(Photometrics)FITC andDAPI fluorescence,detectedusingspecific filter combmations,were recordedseparatelyas gray scaleimages Imageswere not mergedor pseudocoloredto better showhow they appearedon the microscopeMetaphase spreadswereobtainedfrom PHA-stimulatedperipherallymphocytes On the left (A,C,E) are theimagesobtainedwith DAPI, whichproducesa QM-like banding.Thecorrespondmg hybndtzation signalsof biotmylatedprobes,detectedby avidm-FITC, areon the right (B,D,F) A,B. CISShybridization usmgbiotmylatedAlu-PCRproductsfrom hybrid GM0115,contammgonly the humanchromosome 4 The arrowsmdicatethe chromosome 4 C,D. Hybrid HY 91E contaming the derivative chromosomeYpter + Yql 1 2 17q12+ 17qterthat stainsthe correspondingregionson chromosome 17qandY E,F Hybrid Y XY 8FT7 retainingtheintact human chromosomes 6, 10, and 11 17qter+ 17qll is alsopamtedasa resultof a deletedchromosome17 that wasalsopresentin the hybrid, probablyattachedto a hamsterchromosome
Painting
Probes From Hybrids
8
Archidiacono
et al.
Painting
Probes
From
Hybrids
9
2. Load also a suitable molecular weight marker (such as PhiX-H&II) on the gel Inspect the gel on UV transilluminator: Fragments should be between 100 and 500 bp. If fragments are larger, add more DNase I to the samples, incubate for an additional 30 min, and check again as described. 3. G-50 Sephadex spin columns Take a I-mL syringe, plug the tip with glass wool Place the syringe m a conical tube Fill the syringe with Sephadex Centrifuge at 2000 rpm on a benchtop centrifuge for 2 min Add Sephadex and repeat centrifugation until the Sephadex reach the 1 mL mark. Equilibrate the column by loading 100 PL TE and spmmng as before. The column is equilibrated when the flow through is 100 pL, as loaded. Columns can be sealed with parafdm and stored at +4”C When used after storage, equilibrate again Put a small reaction tube at the bottom of the syringe Add 1 PL 10% SDS to the nick-translation reactions and apply to the column (SDS prevents biotmylated probes from sticking to the column) Spin at 2000 rpm for 2 mm. The labeled probe can be stored frozen for several months 4. Sometimes a particular hybrid may contain many human chromosomes, or a human chromosome may be present only in a low percent of hybrid cells This will produce a famt signal on the desired chromosome(s) To raise the specific signals the amount of labeled IRS-PCR probe should be increased accordingly. 5. Cot- 1 DNA IS added to the hybndlzatlon mixture to suppress cross-hybrichzation of repetitive sequences. Too high level of background signals owing to madequate suppression may be reduced by Increasing the amount of Cot-l DNA m the hybrldizatlon reaction Nonspecific background IS probably a result of highmolecular-weight fragments or Inadequate probe purification 6. Note that DAPI fluorescence intensity correlates inversely with the degree of denaturation of the chromosomes 7 Apphcatlons. Pictures shown m Figs. 2 and 3 are some applications of the IRSPCR technique Figures 2A,B show a CISS hybrldlzatlon experiment of blotmyFig 3 (opposlle page) Further examples of pamtmg with IRS-PCR probes See Fig 2 legend for general explanation Metaphase spreads were from PHA-stimulated peripheral lymphocytes (A,B), or a lymphoblastold cell lme (C-F) A,B: Painting probes derived from hybrid TC4 9, retaining a small chromosomal fragment from Xq28 (see Sectlon 4 7 ) The large arrows point to the X chromosome The small arrows mdlcate an additIona slgnal on chromosome 4, at 4q12 C,D Metaphases were from a female patient carrymg a normal (large arrow) and an abnormal X chromosome (small arrow) A FSCL specific for the X chromosome (see Sectlon 1 ) painted the entlre abnormal chromosome (data not shown) IRS-PCR painting probes were from hybrid RJ 387 91T5 retaining, m addition to chromosome 2, the short arm of the X chromosome E,F Metaphases were from the same patlent as m C,D Probes used were obtained by Alu-PCR of hybrid RJ 83 lF, retammg the long arm of chromosome X and a chromosome 16 Only a small region, near the centromere, of the abnormal X (small arrow) was painted The region comcldes exactly with the region not recognized by hybrid RJ 387 91T5 Correspondmg Images of both normal and abnormal Xs are placed side by side III the Inset El to better show the locatlon of signals. In both metaphases (D,F), the normal X (large arrow) provided an Internal control
10
Archidiacono
et al.
lated PCR products from hybrid GM101 15 (Camden Cell Repository), containing chromosome 4 as the only human contribution. The primary result of the IRS-PCR technique here 1s the fine cytogenetic characterization of the hybrid itself. This is relevant in mapping experiments in which panels of somatic cell hybrids are utilized, .smce human-rodent hybrids are prone to rearrangements Results displayed in Figs. 2C-F were obtained in a search almed to generate chromosome-17 partial libraries that could elucidate the evolutionary origin of gorilla chromosomes 19 and 4, which have been shown to be homologous to human chromosomes 17 and 5 (10) Figures 2C,D show how pa&al painting libraries can be obtamed from hybrids m which a well-characterized derivative chromosome is present. Hybrid HY.91E was obtained by fusmg a TK- hamster cell line with lymphoblasts from a patient (GM6326, Camden Cell Repository) carrymg a balanced translocation t(Y,l7) The HAT selected HY.91E hybrid retained the derlvatlve chromosome Ypter + Yqll 2 17q12 + 17qter As expected, the IRS-PCR products pamted the Yp and 17q12 + 17qter regions (Fig. 2D) The addltional well-defined sIgna present at the tip of X demonstrates the high sensitivity of the technique The signal IS a result of the presence in Xp22 of sequences homologous to Yp. The experiment, m addition, proves that no additional human chromosome material was retained m this hybrid. Figures 2E-F show CISS hybrldlzation of biotmylated PCR products from hybrid Y.XY.8FT7. This hybrid retained human chromosomes 6, 10, and 11 (the characterlzatlon was based on QM-bandmg) Figure 2F shows that the 17qter + 17qll region was also retained in the hybrid, as a consequence of a rearrangement that occurred in vitro This result, however, was not surprising: The search for rearranged chromosomes 17 took advantage of dlscordant results obtained m mapping experiments using a probe that turned out to map on chromosome 17 Hybrid Y.XY 8FT7 was found positive for this probe, but the presence of an intact chromosome 17 was discounted on careful cytogenetlc analysis, therefore the presence of a rearranged chromosome 17 was expected The systematic characterlzatlon of tens of hybrids produced m our laboratory has provided us with several partial pamting libraries, depictmg specific human chromosome portions Figures 3A,B have been obtained using the hybrid TC4 9. Southern blot analysis using X-linked probes showed that only the G6PD and GCP-RCP gene clusters, spanning about 1 Mb, and located at Xq28, were retained (22). Figure 3B shows a clear signal at Xq28, in addition to a second unexpected signal located at 4ql2. The example proves that very small cytogenetlc segments can be easily detected by the IRS-PCR technique. Figures 3C-F report an example of a cytogenetlc case m which the use of partial painting libraries has been essential m the clarification of the rearrangement Classlcai cytogenetic analysis on a female patient with primary amenorrhea revealed an abnormal X chromosome, consistently inactlvated, with a shorter q-arm. The use of an X-specific painting library stained the entire abnormal chromosome X, but did not completely elucidate the nature of the rearrangement We then used two distinct partlal hbranes, specific for Xp and Xq, respectively
Painting
II
Probes From Hybrids C C
C C C C C c---------------------------------
22.33 22.3 22.3 22.3 22.1 22.1
11.2
11 c11.1 c---------------
we----------
----------------------------------c c11.1 -----------------------------
11
-------------------------13 --------------------------------_------__
13.1
21
-c -c
21 21.2 21.32
22.1
-c
C -----c-------------------c---------------
----c--------------
-------c---------------
25 --------------------c--------------26 ----------------------c 26 ----------------------c--------------26 ----------------------c------------------------
26 26 26
- 27 27 ----_------_---------
----------
HY.136C HY.ZZAZAl HY.94BTl HY.Zl.lFT6 HY.105E7 HY.90A HY.92F4 GM10501 HY.lZlBZT5 HY.122A RJ.83.1F HY.73DMT3 HY.llZF7 HY.19.16T3 HY.46BT3 HY.114YBTl HY.134ST3 HY.132H HY.70C3 Y.X6.8B2 Y.X9.15A4 GM10664
HY.129E HY.87Z4 C C C
11 -c
C
HY.85B3 HY.85D30TZ GM10662A GM11099 GM10663 TC4.8 Y.162AZA TC4.9
Fig. 4 A panelof somaticcell hybridsthat retaineda regionof chromosome X. Someof the chromosomes arerearrangedX previouslycharacterizedin the patientsfrom which they were derived. Others representrearrangements that have occurredm vitro and were detectedby chanceon a survey of hybrids generatedin our laboratory.The continuouslinesrepresentthe portionsof the X retamedm the hybrid, C standsfor centromere.
The results showed unequivocally that the abnormal X wascomposedof two Xp (Figs 3C,D) with a small portion of Xq between them (Figs. 3E,F), suggesting that the cytogenetic constitution of the abnormal chromosome was as follows. Xpter + Xql3::Xqll + Xpter. Such a result could not have been achieved using painting libraries that recognize an entire chromosome. A diagrammatic representation of a panel of somatic cell hybrids 1sshown in Fig. 4. In each hybrid, a portion of chromosome X was retained as a consequence of specific selection of a derivative chromosomeor as a consequenceof chromosome X rearrangement, which has occurred m vitro. Their characterization usmg the IRS-PCR technique matched perfectly with molecular characterization using X-linked probesof known locality. We believe that the availability of similar hybrid panels for each of the other human chromosomes will be of great utility m human cytogenetics
12
Archidiacono
et al.
Acknowledgments This work was supported Genetrca” and “Bioingegneria Telethon.
in part by “Progetto e Blostrumentazione”
Fmalizzato Ingegnerla (CNR), by AIRC, and
References 1. Pmkel, D , Landegent, J , Collins, C., Fuscoe, J , Segraves, R , Lucas, J , and Gray, J W (1988) Fluorescence m situ hybridlzatton with human chromosome-specific hbrarres Detection of trisomy 21 and translocatron of chromosome 4 Proc Nat1 Acad. Scr USA 85,9138-9142 2 Lrchter, P , Cremer,T , Borden,J , Manuehdrs,L , andWard, D C (1988)Dehneattonof individual humanchromosomes m metaphase andInterphasecellsby rn situ suppressron hybridization usingrecombinantDNA hbrartesHum Genet 80,224-234. 3 Collms,C., Lm Kuo, W , Segraves,R , Fuscoe,J , Pmkel, D , and Gray, J W (1991) Constructionandcharactertzatronof plasmrdlibrariesenrichedrn sequences from single humanchromosomes Genomrcs11,997-1006 4. VOOIJS,M , Yu, L -C , Tkachuk,D , Pinkel,D , Johnson,D , andGray,J W (1993)Lrbranes for each humanchromosome,constructedfrom sorted-enrrched chromosomes by using linker-adaptorPCR Am J Hum Genet 52,586-597 5. Jauch,A , Daumer,C , Lrchter,P , Murken, J., Schroeder-Kurth,T , andCremer,T (1990) Chromosomal m srtusuppression hybrtdrzattonof humangonosomes andautosomes and its usem climcal cytogenettcsHum Genet 85, 145-150 6. Weier, H U , Lucas,J N , Poggensee, M , Segraves,R., Pmkel,D., andGray, J W (1991) Two-color hybrldizatron with hrghcomplexrtychromosome-specific probesanda degeneratealphasatelliteprobeDNA allowsunambiguous drscrrmmation betweensymmetrical andasymmetricaltranslocattonsChromosoma 100,37I-376 7. Cremer,T., Ltchter, P., Borden,J., Ward, D C , andManuehdts,L. (1988)Detectronof chromosome aberrationsm metaphase andinterphasetumorcellsby m situ hybridrzatron usmgchromosome-spectfic library probesHum. Genet. 80,235-246 8. Gray, J. W and Pmkel, D. (1992) Molecular cytogenetrcsm humancancerdiagnosis Cancer 69,1536-1542
9. Wrenberg,J , Jauch,A, Stanyon,R., andCremer,T (1990)Molecularcytotaxonomy of primatesby chromosomalin situsuppressron hybrrdrzation Genomlcs k&347-350 10 Jauch,A., Wrenberg,J , Stanyon,R., Arnold, N ,Tofanelh, S., Ishrda,T , andCremer,T (1992)Reconstructronof genomtcrearrangements m greatapesandgibbonsby chromosomepamttng.Proc Natl. Acad Sci USA 89,861 I-8615 11. Wrenberg,J , Stanyon,R , Jauch,A, and Cremer,T (1992) Homologresm humanand Macacafuscatachromosomes revealedby m situ suppression hybridization with human chromosome specrftchbrartes Chromosoma 101,265-270 12 Luke, S andVerma, R S (1992)Origin of chromosome 2 Nat, Genet 2, 11,12. 13. Krevits, T , Devrlee, P , Wregant, J , Wapenaar,M. C., Cornelisse,C J , van Ommen, G. J B , and Pearson,P L (1990)Direct nonradroactrvem situ hybrrdrzatronof somattc cell hybridsDNA to humanlymphocytechromosomesCytometry 11, 105-109. 14. Boyle, A. L , Lrchter,P , andWard, D C (1990)Rapidanalystsof mouse-hamster hybnd cell linesby m situ hybrrdrzatron Genomrcs 7, 127-130. 15. Nelson,D. L , Ledbetter,S.A , Corbo,L , Vrctoria, M F , Ramirez-Solis,R , Webster,T D , Ledbetter,D H , andCaskey,C T (1989)Alu polymerasechamreaction.A method for rapid Isolationof humanspecrficsequences from complexDNA sourcesProc Nat1 Acad Scz. USA 86,6686-6690
Painting
Probes
From
Hybrids
I6 Llchter, P , Ledbetter, S , Ledbetter, D , and Ward, D C (1990) Fluorescence tn srtu hybrrdizatton with Alu and Ll polymerase chain reaction probes for raped characterization of human chromosomes m hybrid cell lines Proc Nat1 Acad. Scr USA 87,6634-6638 17 Lengauer,C , Riethman,H , andCremer,T (1990)Paintmgof humanchromosomes wtth probesgeneratedfrom hybrid cell linesby PCRwith Alu andLl primersHum Genet 86,
1-6 18 Korenberg,J R andRykowski, M. C (1989)Humangenomeorgamzatton.Am, LINES andthe molecularstructureof metaphase chromosome bands Cell 53,391-400 19 Baldim,A andWard, D C (1991)In sttuhybrtdrzattonof humanchromosomes wtth AluPCRproductsA simultaneous karyotypefor genemappingstudtesGenomlcs 9,770-774 20 Ledbetter,S. A , Nelson,D. L , Warren,S. T , andLedbetter,D H. (1990)Rapidisolatton of DNA probeswtthm specificchromosome regionsby Interspersed repetitive sequences (IRS) PCR Genomzcs 6,475-48 1 21 Liu, P , Sicihano,J , Seong,D , Craig,J , Zhao,Y , deJong,P J , andSicthano,M J (1993) Dual Alu PCRprimersandcondttionsfor tsolattonof humanchromosome pamtmgprobes from hybrid cell. Cancer Genet Cytogenet. 65,93-99 22 Maestrnn, E andTomolo, D (1992)An archipelagoof CpG islandsin Xq28* Identrfication and fme mappingof 20 newCpG islandsof the humanX chromosomeHum. Mel Genet 1,275280
CHAPTER 2
Fluorescent In Situ Hybridization Using Chromosome-Specific DNA Libraries William
G. Kearns
and Peter L. Pearson
1. Introduction Fluorescent in situ hybridization (FISH) IS a powerful tool to analyze structural chromosome aberrations. The identification of structural abnormalmes by routine and high resolution cytogenetic studies plays an important role in the diagnosis and treatment of disease. However, this analysis is relatively gross and only permits the visual diagnosis of aberrations of single chromosome bands on the order of seven million or so base pan-s. FISH using chromosomespecific DNA libraries (chromosome pamting) permits the identrfication of small chromosome aberrations, which are not readily detected by standard high resolution bandmg techniques. FISH may be used to identify marker chromosomes, clarify balanced or unbalanced translocations, define chromosome duplications, or analyze complex chromosome rearrangements. FISH may be used m prenatal and postnatal cytogenetic studies. This chapter provides a detailed description of the use of FISH to detect chromosome abnormahties, employing chromosome-specific libraries as probes and metaphase chromosomes as target DNA.
2. Materials 2.1. Fluorescent
iMicroscopy
1. Fluorescent microscope: Fluorescent signals produced by painted chromosomes are generally visible using a properly configured fluorescent mmroscope Fluorescent microscopes are designed to collect an optimal signal whtle minimizing background rllumination. Two types of rllummation exist for fluorescence microscopy: transmitted rllumination (1) and incident rllummation (epr-illumrnation) (1). Our laboratory uses an eprfluorescent microscope.
2. Light source: The light source of choice for fluorescence microscopy depends on the desired mode of illumination (e g., epifluorescent), the excitation spectrum of the fluorochromes used, and the sensitivity of the detector (1 e., film, human eye, or CCD camera) required. Tungsten halogen, mercury, and xenon lamps exist. Mercury lamps produce strong emission peaks and m general, are the light source of choice for epifluorescence illuminatton (1) From Edlted
M&hods N) Molecular Bology, by K H A Choo Copyrlght
Vol 33 In Situ Hybnd!zatron Profocols 01994 Humana Press Inc , Totowa, NJ
15
Kearns
16
and Pearson
3 Flourescent stains These are characterrzed by their absorption and emission spectra, which occur at different regions of the light spectrum. The most common fluorescent stains are visualized as blue (DAPI, AMCA), green (FITC, qumacrme), or red (propidium rodrde, rhodamine, Texas red) 4 Proper fluorochrome vtsualizatron requires approprrate obJectives and filter sets The mtcroscope objective acts as both a condenser and ObJective m epi-illummation (1) Oblecttves require a high numerical aperture and a relatively low magmfication. In general, the brrghtness of fluorescent signal is mversely related to the objective magnification (I) of the fluoro5 Filter choice depends primartly on the spectral characteristics chromes used. The mam filter types include excitation, barrier, and drchrorc mirrors (also called a chromatic beam splitter) Excitation filters Isolate a hmrted region of hght, which corresponds to the absorption peak of the fluorochrome Various sources exist for excitation filters that have high transmrssron narrow band characteristics wrth excellent suppressron of unwanted excitation hght (I) Double or triple band excitation filters exist from commercral sources. Barrier filters are used to block unwanted excitation hght Drchrolc mirrors reflect hght of shorter wavelengths and transmit light of longer wavelengths Drchroic murors are positioned wrthm the microscope at a 45” angle to the optical axis to reflect excitation rays mto the ObJeCtlVe in epr-rllummatlon (1). Drchrorc mirrors now exist for the simultaneous fluorescence of two or three fluorochromes Double or triple band pass filter sets combme into one cube an excitation filter, a barrier filter, and a drchroic mirror. This permits the simultaneous detection of multt-fluorochromes without the need of computer image overlay to correct for regtstration shift
2.2. Nick
Translation
1 Nucleotrde mix for brotm incorporation 0 5 mM dATP, 0 5 mM dGTP, 0 5 mM dCTP, 0.5 mM brotm 1 l-dUTP, 0 5M Tris-HCl, pH 8 0, 50 mM MgC12, 0 5 mg/ mL BSA 2 Nucleotide mix for drgoxigenm incorporation. 0.5 mMdATP, 0.5 mMdGTP, 0 5 rniW dCTP, 0 375 mM dTTP, 0.125 mM drgoxrgenin- 11-dUTP, 0 5M Trrs-HCI, pH 8 0,50 mM MgC12, 0 5 mg/mL BSA 3 DNase I. 4. DNA polymerase 5. 0.2M EDTA. 6. Spin column
2.3. In Situ 1. 2 3 4 5 6
Hybridization
and
Immunocytochemistry
A solution of 1 pg/pL of human Cot-l DNA (sonmated to 200-600 bp). A solutton of 1 pg/l.tL of total human placental DNA (sonmated to 200-600 bp) 3M Sodium acetate, pH 5 2. Hybridization mix 50% formamide, 2X SSC, pH 7 0, 10% dextran sulfate Chromosome denaturatlon solution 70% formamtde, 2X SSC, pH 7 0 Posthybridization washmg solutions 50% formamide, 2X SSC, pH 7 0 2X SSC, pH 7 0
FISH
7. 8. 9. 10. 11 12
Using
Chromosome-Specific
DNA
Libraries
17
0.5X SSC, pH 7.0 4X SSC, 0 05% Tween-20. 4X SSC,0 05% Tween-20, pH 7.0. PN buffer: 0 1M NaHzP04, O.lM NazHP04, 0.1% Nonidet P-40, pH 8 0 Nonfat dry mtlk (without vitamin H/biotm). Avrdin-DN FITC (1-5 pg/mL) m PN buffer, 5% nonfat dry milk (without vitamin Wbiotin). Biotmylated goat anti-avidin D (l-5 pg/mL) in PN buffer, 5% nonfat dry milk (without vitamin H/hiotm). Antifade medium: 0 23 g DABCO in 800 ~.LLwater, 200 p.L IMTrts-HCI, pH 8 0, 9000 pL glycerol, vortex and store m dark at -20°C. Add propidium iodide (0.5 pg/mL) and DAPI (0.5 j.tg/mL) to antifade working solution and store at -2O’C Phosphate buffered saline (PBS)
3. Methods 3.1. Preparation of Metaphase Chromosomes Amnlocyte, chorionlc ~1111,peripheral blood lymphocyte (PBL) WBC, or frbroblast cultures are established and slides prepared according to standard cytogenetlc methods (2,3). 1. Dehydrate slides through a series of me-cold (-20°C) ethanol washes for 3 mm each 50, 70, and 95% alcohol. 2. Air-dry slides at room temperature. 3 Store slides at 4’C for short-term use, or -70°C for long-term storage Slides need not age prior to FISH. 3.2. Labeling of DNA Probes Various methods exist that are commonly used to prepare hapten labeled DNA (see Note l), Nick translation is one method which synthesizes uniformly labeled double stranded DNA (4) (see Note 2). 3.2.1. Nick Translation Using Biotin Thrs protocol mcorporates brotin and permits long-term probe storage at -20°C without DNA degradation (5). Various commercial sources exist to obtarn brotin labelmg krts or mdivrdual reagents that are required for neck translation. Slight variations tn protocols exist. 1. To 1000 ng DNA (RNA free) add 5 pL nucleotide mix 2 Bring reaction volume to 45 @L with water 3 Add 5 pL enzyme mix (containing appropriate amount of DNase I for optimal fragment stze [see Note 31, and 20 U of DNA polymerase I) 4. Incubate for 1 h at 37°C. 5 Add 5 PL 0.2M EDTA to stop the reaction 6 Separate labeled DNA from unincorporated nucleottdes by gel filtration usmg a spm column (see Note 4) 7 Store labeled DNA at -20°C in the dark
Kearns
18
and Pearson
3.2.2. Nick Translatcon Using Digoxigenrn Digoxigenm, isolated from plants Digitalis purpurea and Digitalis lanata, IS another hapten used in FISH (see Note 5). Combining biotm and digoxigenm, simultaneous two-probe two-color FISH may be performed. Digoxigenm incorporation by nick translation is performed as described above except substitute 5 lt.L of the digoxigenm-contammg nucleotide mix (see Section 2.2.2.) for the biotm-containing nucleotide mix. 3.2.3. Prelabeled Chromosome-Specific DNA Probes Commercial sources exist to obtain chromosome-specific DNA already labeled with various fluorochromes.
libraries
3.2.4. Multiprobe Multicolor FISH Simultaneous three-probe three-color FISH can be performed using biotm, digoxigenin, and a prelabeled chromosome-specific DNA library. Three-color FISH signal visualization requires a triple band pass filter configuration. 3.3. Preparation of Probe and Unlabeled Competitor DNA for Hybridization See Note 6 for a general discussion of probe preparation and the use of competitor DNA. If using chromosome-specific DNA libraries already prelabeled with various fluorochromes, proceed directly to Section 3.4., step 1. 1 The amount of chromosome-specific follows: When vector.insert 100-500 ng;
plasmid library DNA used is estimated as
ratio 1s 1 1, the range of hbrary
DNA
used will
be
For chromosomes 1, 2, and 3 (A-group), use 500 ng,
2. 3. 4 5 6 7. 8 9 10.
Il.
For chromosomes 4 and 5 (B-group), use 300-450 ng, For chromosomes 6- 12, and X (C-group), use 250-350 ng, For chromosomes 13,14,15,21,22, and Y (D- and G-group), use 150-200 ng, For chromosomes 16-20 (E- and F-group), use 100-200 ng See Note 7 Combme labeled probe (100-500 ng) wrth the approprrate amount of competrtor DNA (l-5 pg of human Cot-l DNA, or 1-26 p-g of total human placental DNA) Add l/IO total vol3M sodium acetate, pH 5.2. Add 2.5 total vol alcohol (Ice cold) Vortex for 30 s. Place Eppendorf tube m ice bucket or -70°C freezer for 30 mm Spm in cold room for 30 min Drscard supernatant, wash pellets wrth 500 pL 70% ethanol (me cold) Spur for 5 mm m cold room. Discard supernatant and dry pellet using a SpeedVac (or lyophilize or au-dry pellet)
Resuspend pellet in 10 uL hybridization
mix.
12. Allow pellet to dissolve for approx 30 mm at 37°C.
FISH Using Chromosome-Specific 3.4. Metaphase
DNA Libraries
Chromosome
19
Denaturation
1. Prewarm slides to 42°C for 10 min. 2. Add 100 p,L of chromosome denaturatron solution to each slide and cover with a 24 x 50 mm coverglass 3 Denature slides by placing in 75°C oven for 2-5 mm 4 Dehydrate slides through a serves of ice cold (-20°C) ethanol washes for 3 min each: 50,70, and 95% alcohol. 5 Air-dry slides at room temperature. 3.5. Hybridization 1 Denature probe/competitor DNA by incubation at 75-80°C for 5 min. 2 Chill on ice bath for 1 mm. 3 Allow DNA to preanneal at 37°C for 30 min to 1 h (time range varies from a few minutes to 2 h maximum) 4 Prewarm denatured chromosome slides to 42°C. 5 Prepare moist chamber 2000-mL beaker with moist paper towels (formamide, SSC) and slide holder; seal chamber with aluminum foil 6. Prewarm hybridization chamber to 37°C. 7 Apply the preannealed DNA solution to denatured chromosome slides. 8. Cover hybridization mix with 18 x 18 mm coverglass, seal wrth rubber cement, and place in moist chamber. 9. Hybridize at 37°C for 16-24 h 3.6. Immunocytochemistry Immunocytochemistry uses fluorescent signal detection to identify haptenlabeled nucleic actd probes. The technique can be direct or indirect (see Note 8). The followmg steps will describe indirect signal detection using one chromosome-specific biotmylated plasmid DNA library as probe (8-10). If multiprobe FISH IS performed, variations are required. 1. Remove slides from hybridrzatron chamber and carefully remove rubber cement using pointed forceps 2. Perform all the following washes using Coplan Jars and apply gentle solution agitation Steps 3-5 are the strmgency
washing steps.
3 Wash three times for 5 min each m 50% formamtde, 2X SSC, pH 7.0, at 37°C (time varies from 2-10 min; temperature varies between 37-43’C). 4 Wash three times for 5 min each in 2X SSC, pH 7 0, at 37°C (trme varies from 210 min; temperature varies between 37-43’C). 5. Optional wash: Wash for 5 mm in 0.5X SSC, pH 7.0, at 37“C (time varies from 2-10 mm, temperature varies between 37-43”(Z). 6. Wash for 5 min m 4X SSC, 0.05% Tween-20, pH 7 0, at 37°C 7 Add 100 pL PN buffer, 5% nonfat dry milk, pH 7 0 to each slide Cover with a 24 x 50 mm coverslip and incubate for 10 min at room temperature m moist chamber 8 Wash twtce for 5 mm each m PN buffer at room temperature.
20
Kearns
and Pearson
9 Add 100 pL of Avidm-DN FITC to each slide. Cover with a 24 x 50 mm coverslip and incubate for 30 min at room temperature m moist chamber. 10 Wash three times for 5 mm each m PN buffer at room temperature. 11. Add 100 l.rL of biotinylated goat antlavidin D to each slide Cover with a 24 x 50 mm coverslip and Incubate for 30 mm at room temperature m moist chamber. 12 Repeat steps 9 and 10 13 Wash twice for 5 mm each in PN buffer at room temperature. 14 Wash for 5 mm m PBS, pH 7.2, at room temperature 15 Mount chromosome preparations in 15 pL antifade medium containmg propldium iodide (0 5 pg/mL) and/or DAPI (0 5 p.g/mL) 16 View slides usmg a properly configured epifluorescent microscope. 17 For photomicroscopy, use ASA 400 color slide film with exposure times rangmg from 15-60 s. See Note 9 for troubleshooting
hints.
4. Notes In our experience, it is not required to isolate DNA inserts from plasmid vector sequences prior to labeling. In fact, the presence of some vector sequences in the hybridization mixture may enhance the Intensity of the fluorescent signal observed In nick translation, DNase I nicks the DNA and polymerase I adds nucleotides to the 3’ termmal end. Polymerase I also has 5’+3’ exonucleolytic actrvrty, whtch removes nucleotides from the 5’ end of the nicked DNA One requirement for successful FISH usmg chromosome-specific libraries is that the labeled probe DNA fragments range in size between 200 and 800 nucleottdes The amount and activity of DNase within the nick translation reaction affects the size of labeled DNA fragments Different batches of commercial DNases are produced with varying activities. Therefore, one must adJust the optimal DNase concentration/batch m the tuck translation reaction. Polyacrylamlde gel electrophoresls IS performed to obtain DNA fragment sizes 4. Spm column separation is not always required since free biotm is water soluble and ethanol precipitation generally removes all unmcorporated biotm from the nick translation reaction mix. 5. The blossoms and leaves of Digltah purpurea and Dlgltalis Lanata are the only natural source of dlgoxigenm Therefore, no binding of antidigoxigenin-fluorochrome antibodies occurs to other biological material Digoxigenm is linked to uridme nucleotides at the number five position of the pyrlmidme ring vta an 11 carbon atom spacer arm (6) 6. Probe preparation and use of competitor DNA* Chromosome-specific plasmid DNA hbraries exist for all human chromosomes. The plasmids contain genomic inserts ranging m size from approx 0 1-6 kb (7). These genomic inserts contam sequences specific for mdivldual chromosomes and interspersed repetitive elements Successful hybridization usmg chromosome-specific plasmid DNA hbraries requires suppression of repetitive DNA without blockmg the smgle copy chromosome-specific sequences To achieve this, labeled probe fragments are denatured along with an excess of unlabeled competitor DNA, Sources for competitor DNA mclude either total human (placental) DNA or human Cot- 1 DNA
FLW
Using
Chromosome-Specific
DNA
Libraries
21
somcated to fragment sizes m the range of 200-600 bp. Immediately following denaturation, preannealing is performed at a lower temperature over a time range from a few min to 2 h During preannealing, repetitive elements of the probe rapidly hybridize to homologous sequences present In the competitor DNA. Our laboratory prefers to use human Cot-l DNA for suppression of repetitive elements. However, instances occur where midlevel repeats are not successfully blocked by Cot-l DNA. In these cases, total human DNA is used for suppression of repetitive DNA Titration studies must be performed when using total human DNA so as to not block the desired probes single copy sequences 7 If two or three chromosome-specific DNA libraries will be hybridized together, DNA mixtures of each library must remam separate from each other until the hybridization mix is added to appropriate slides 8. Direct vs indirect signal detection Direct signal detection uses one layer of fluorochrome and indirect detection uses more than one layer of fluorochrome. Indirect signal detection permits several cycles of amplification. However, while the probe srgnal intensity increases, background fluorescent Intensity also increases 9 Troubleshootmg Problem Solution Probe added’? a. No signal DNA denatured? Check hybridization and wash conditions Au bubbles under covershp? Using appropriate filter sets? Fluorescent microscope properly configured? b Weak signal Target DNA denatured? Probe DNA denatured? Check hybridization and wash conditions Probe DNA concentration correct? pH of strmgency wash correct? c. High background Using a broad band pass filter? Correct stringency washes used? Shdes cleaned prior to metaphase chromosome preparation? Cytoplasm around chromosomes? Cell debris on metaphase preparations? d Poor chromosome morphology Temperature during denaturation too high? Formamide concentration during denaturation too high? Glacial acetic acid percentage too high durmg dropping of slides? (60% glacial acetic acid is ideal to remove cytoplasm and spread chromosomes Higher concentrations may give chromosomes a “fried” appearance.)
22
Kearns
and Pearson
References 1 Ploem, J S. (1993) Fluorescence mrcroscopy, m Fluorescent and Luminescent Probesfor Biologtcal Activity (Mason,W T., ed ), Academic,London,pp l-l 1, 2. Gosden,C M , Davtdson,C., andRobertson,M. (1993)Lymphocyteculture, m Human Cytogenettcs: A Practtcal Approach (Rooney,D E. andCzepulkowski,B. H , eds.),IRL, Oxford UK, pp. 3l-54 3. Rooney,D E. and Czepulkowski,B H (1993)Prenataldtagnosrsand trssueculture, m Human Cytogenetlcs A Practical Approach (Rooney,D E and Czepulkowski,B H , eds), IRL, Oxford UK, pp. 55-90 4. Kelly, R. B., Cozzarelh,N. R , Deutscher,I R , Lehman,I R , andKornberg,A (1970) Enzymatrc synthesisof deoxyrrbonucleic acid. XXX11 Replication of duplex deoxyribonucleicactdby polymeraseat a singlestrandbreak J Biol Chem 245, 3945 5. Langer,P.R , Waldrop,A. A , andWard, D A. (1981)Enzymatrcsynthesisof bronylated polynucleotrdes* novel nucleicacid affuuty probesPYOC Nat1 Acad Scl USA 78,66636637. 6 Kessler,C (1991)Thedrgoxrgenmsystemanti-drgoxrgenmtechnology-a survey on the concept and reahzationof a novel btoanalytrcalmdtcator system Mel Cell Probes 5, 161-205. 7 Collms, C , Kuo, W L., Seagraves,R , Fuscoe,J , Pmkel, D., and Gray, J. W. (1991) Constructionandcharacterrsatron of plasmidhbrarresenrichedm sequences from single humanchromosomesGenomrcs 11,997-1006 8 Pinkel, D., Straume,T , andGray, J (1986)Cytogeneticanalystsusmgquantitatrve,hrgh sensitrvrty,fluorescencezn sttu hybridtzatron PYOC Nat1 Acad Set USA 83,2934-2938 9. Rosenberg,C., Blakemore,K. J., Kearns,W G., Grraldez,R , Escallion,C , Pearson,P. L , and Stetten,C (1992) Detectronof chromosomal rearrangements by fluorescencern situ hybridization Am. J Hum Genet 50,700-705. 10 Batrsta,D. A S , Tuck-Muller, C M , Martinez, J E , Kearns,W G , Pearson,P L., and Stetten,G. (1993)A complexchromosomalrearrangement detectedprenatallyand studied by fluorescencem situ hybridization Hum Genet. 92, 117-l 21,
CHAPTER 3
Reverse
Chromosome
Painting
S@ren Pedersen, Johnny Hind&r, Carsten A. Brandt, Lars Bolund, and Steen Kelvraa 1. Introduction Chromosome paintmg refers to the complete decoration of specific metaphase chromosomes with complex probe mixtures. The painting signal is obtained by fluorescence in situ hybridization (FISH) of such mixtures established from a number of different sources (1-4). This technique is a valuable supplemental method m the detailed analysis of specific chromosome aberrations, complex chromosome rearrangements, and chromosomes of poor quality, which have been unresolvable with the traditional chromosome banding techniques. In traditional chromosome painting, complex probe mixtures representing specific chromosomes are hybridized to metaphase spreads contaming the chromosome aberration in question. If the hybridized probe mixtures are fluorescence labeled, the composition of the aberrant chromosome is revealed by the distribution of the fluorescence signals obtained with the different probes. The combmation of different labeled probes and multicolor techniques simplifies the evaluation. This chapter describes a painting strategy called reverse chromosome painting. Here, a few aberrant chromosomes are first isolated by fluorescence-activated cell sorting (FACS) and used for the generation of a complex probe mixture by poIymerase chain reaction (PCR). The labeled PCR product is then used m chromosome painting by FISH to slides with normal metaphase chromosomes. In this way, the composition of the isolated aberrant chromosomes is directly reflected m the distribution of the fluorescence signals on the normal metaphase chromosomes. The advantage of this strategy is that no prior knowledge of the orlgm or the intrinsic components of the aberrant chromosomes is needed. Another advantage is that an optimized preparation of chromosome slides (e.g., prometaphase chromosomes) can be used m the analysts of the complex probe. One restriction of the technique is that it is only applicable when it is possible to isolate the aberrant chromosomes with flow sorting. However, m situations where this is not feasible, direct painting can be performed with complex probes established from flow-sorted normal chromosomes. From Edlted
Methods m Molecular Bology, by K Ii A Choo Copyright
Vol 33 In .!Mu tfybndtzafm Protocols 01994 Humana Press Inc , Totowa, NJ
23
24
Pedersen
et al.
In Sections 1.1.-l .3 ., we have outlmed the general strategy of the reverse chromosome painting technique. Sections 2.-4. then present the detailed protocol for chromosome preparation for sorting, and the method for degenerateolrgonucleotide-primed PCR of the sorted chromosomes to produce specific chromosome paints. Once these materials are prepared, standard FISH can be performed. The FISH techniques will not be described here since these protocols can be found in other chapters in this volume. 1.1. Chromosome Sorting A high frequency of cells are accumulated in the metaphase after colcemide treatment of the cell culture. The cells are resuspended m a hypotomc, chromosome-stabilizing buffer contaming Mg2+, where single chromosomes and nuclei are released mto suspension after removal of the cell membranes with detergent and mechanical treatment. Fmally, the chromosomes are stained in suspension with two different DNA-bmdmg fluorochromes. Each chromosome is individually analyzed in the cell sorter, with respect to the intensity of the blue fluorescence from the UV excitable Hoechst 33258, which shows AT basepatrbmding preference, and the yellow fluorescence from the violet excitable Chromomycin A3, whtch shows GC basepair-binding preference. The fluorescence signals therefore reflects both the size and the general base composttion of the individual chromosomes. When these signals are presented m graphtcal form as a bivariate dot plot, as shown m Fig. 1 (each dot represents the fluorescence intensity of the Hoechst 33258 plotted on the y-axis, and the mtensrty of the Chromomycin A3 plotted on the x-axis for a given chromosome), all chromosomes except the group 9, 10, 11, and 12 are resolved as dtstmct peaks. Because of the great normal variation in the centromeric heteromorphtsms found m many of our chromosomes, the exact distribution of the chromosomes in such flow karyograms differ among individuals. Such differences can also be seen among homologous chromosomes, which ~111sometimes be distributed as two distinct peaks m the flow karyogram. Sorting regions that define fluorescence intervals both of the Hoechst 33258and Chromomycin A3 fluorescence can be placed anywhere m the flow Frg. 1 (opposztepnge) Brvartate dot plots representmg flow cytometrtc analysis of lo4 suspenston chromosomes stained wtth Hoechst 33258 and Chromomycm A3 In dot plot A, a flow karyotype from a normal 46,XY cell lme is shown In dot plot B, the fluorescence distribution of chromosomes obtamed from a cell hne contammg a reciprocal 13,17 translocatron IS shown The normal chromosome 1 m dot plot A, located m the Indicated regron Rl, and the derivattve chromosome 17 m dot plot B, located m the peak contamed m the mdrcated regron R2, were sorted and used for the generatton of complex probe mrxtures by DOP-PCR These products were used rn the chromosome pamtmg expertments shown later m Fig 3.
25
Reverse Chromosome Painting
1
I..,
.I....
1
0
200
A
Chromomyan
r..
0
B
.I..
400
1,
200 Chromomycln
.
.
.
.
.
.
600 A3 fluorescence
I,.
400
,I,.
600 A3 fluorescence
.
.
.
.
.
.
.
800
..I
1000
intensity
I,,
800 lntenslty
..
I
1000
Pedersen et al.
26
karyogram. When such a window is set to contam a chromosome peak of interest m the flow karyogram, chromosomes from this peak are recognized and selected for sorting (Ftg. 1). 1.2. Amplification
of the Sorted
Chromosomes
A small number (500-2000) of flow-sorted chromosomes are used as template to generate a complex probe mixture by PCR using a degenerate primer developed by Telemus et al. (5). This primer, with the sequence S-CCG ACT CGA GNN NNN NAT GTG G-3’, is used in a reaction called degenerate-ohgonucleotide-primed PCR (DOP-PCR). The primer contains three short sequence motifs. In the 3’-end of the prtmer, 6 nucleottdes represent a unique sequence that ensures perfect match of the 3’-end at sites with appropriate average spacmg (46 = 4096). In the middle of the primer, a complete degenerate sequence of 6 nucleotides follows, which improve stabilization of the annealing complex during the first five cycles of the PCR. In the S-end of the primer, 10 nucleotides represent the recognition sequence of the restriction enzyme XhoI, which can be used m cloning protocols and which also increases the annealing stability during the later PCR cycles. Figure 2A shows an agarose gel separation of the probe mixture obtained by DOP-PCR of 1000 copies of chromosome 13 as described in the protocol given in Section 3.3. 1.3. Chromosome
Painting
Biotm-labeled DOP-PCR product from the relevant chromosome is finally hybridized to metaphase chromosomes in situ, and the hybridized probe is visualized after fluorescein-conjugated avidm staining. Crosshybndization of repeat DNA sequences common to many chromosomes is suppressed by preannealing the hybridization probe with unlabeled, fragmented total human DNA or COT1 DNA. Typical examples of such painting experiments are shown m Fig. 3. 2. Materials 2.1. FACS
For chromosome sorting, we use a FACStarPIUs(BDIS, San Jose, CA) with two argon-ion lasers. The first laser excites the Hoechst 33258 with 200 mW in the UV range (351.1 + 363.8 nm) and the fluorescence collection is through a 424/44-nm bandpass filter. The second laser excites the Chromomycm A3 with the 457.9-nm line, and the fluorescence collection is through a 490-nm longpass filter. We routinely run the sorter with a 70-pm nozzle, and as sheath liquid we use 0.9% NaCl. LYSYS II standard software is used for data analysis and for running the cell sorter. 2.2. Isolation
and
Staining
of Suspension
ug/mL Colcemid stock solution 2. 100 mM MgS04 Aliquot and storeat -2O’C. 1
10
Chromosomes
27
Reverse Chromosome Painting MlM2
1
2
3
4
M2
1
2
3
4
Fig. 2. Agarose testgel analysis of DOP-PCR products generated in two successive PCR reactions. The primary DOP-PCR product (not shown) was generated from lo3 flow sorted normal chromosome 13 as described in Section 3.3., and 1 pL (lane 3) or 2 pL (lane 4) of that product was biotin labeled in a second DOP-PCR as described in Section 3.4. DOP-PCR without biotin-dUTP of 1 pL (lane 1) or 2 pL (lane 2) of the primary product are also shown. In each lane, 5 pL DOP-PCR product was loaded. (A) Ethidium bromide stained agarose testgel. (B) Southern blot of the testgel shown in A after avidin-alkaline phosphatase staining of incorporated biotin-dUTP. Ml: l-Hi&III marker; M2: Pat 153~HinjI marker. 3. HEPES buffer: 6.25 mM HEPES, 50 mII4 KCI. Adjust to pH 8.0 with KOH and
4. 5. 6. 7. 8. 9. 10.
store at 4‘C for not more than 1 wk. 120 mM Dithiothreitol (DTT). Aliquot and store at -2O’C. 100 pg/mL Hoechst 33258 DNA stain. Store at 4’C. 2 mg/mL Chromomycin A3 DNA stain in absolute ethanol. Store at -2O’C. 100 mM Sodium citrate. 250 mM Sodium sulfite. 2% Sodium azide in water. 2.5% T&on X-100 stock solution. Filter through a disposable 0.22~pm sterile filter.
2.3. DOP-PCR 1. 10X Tuq buffer (without Mg2+): 500 mM KCl, 100 mM Tris-HCl, 0.1% gelatin, pH 8.3. Aliquot and store at -20°C. 2. 100 mM MgC12 stock solution. Aliquot and store at -2O’C. 3. dVTP: dATP, dCTP, dGTP, 10 mM each. Aliquot and store at -2O’C. 4. 10 mM dlTP. Aliquot and store at -2O’C. 5. 1 mM Biotin-1 l-dUTP (Sigma, St. Louis, MO). 6. Primer 6 Mw: S-CCG ACT CGA GNN NNN NAT GTG G-3’, 95 pmoVp.L.
Fig. 3 (see color plate number 5 after p. 172). Results of two typical chromosome painting experiments. (A) Reverse chromosome painting with a complex probe mixture generated from lo3 copies of the translocation chromosome sorted from the region shown in Fig. 1B. The painting signals on the normal metaphase chromosome spread clearly demonstrate that the isolated translocation chromosome was derived from chromosomes 17 and 13. All of chromosome 17 except the q terminal part, and approximately half the distal part of the acrocentric chromosome 13 are painted. (B) Direct painting with a probe mixture generated from IO3 normal chromosome 1, flow sorted from the region indicated in Fig. 1A. The slide contains chromosomes from a continuous T-cell line, established from a patient with SCzary syndrome (S), with a very complex karyotype.
Reverse 7. 8 9 10 11 12
Chromosome
29
5 U&L Tag DNA polymerase (Boehringer Mannhelm, Mannhelm, Paraffin oil. TE buffer 10 mM Tris-HCl, 1 mM EDTA, pH 7 5. 3M Sodium acetate, pH 5 2 Hybaid thermal reactor. Vacuum centrifuge
2.4. Agarose 1 2 3. 4 5 6
Painting
Testgels
and
Staining
of Southern
Germany).
Blots
Agarose (Litex) TBE buffer. 0.045M Tris (Sigma 7-9), 0.045M Borate, 0 OOlM EDTA, pH 8.0 Southern blotting transfer buffer* 2 5 mM NaH2P04, 2 5 mM Na,HPO, 2H,O Blocking buffer 0 5M NaCl, 0 1M Tris-HCl, pH 9.0 Developing buffer O.lM NaCl, 0 1M Tris-HCl, 10 mM MgCl,, pH 9 0 16 mg/mL BCIP (5-Bromo-4-Chloro-3-Indolyl-Phosphate) m 100% dlmethyl-
formamide 7. 37 5 mg/mL NBT (Nltro-Blue-Tetrazohum) 8 AvIdin-alkaline phosphatase.
in 70% dimethylformamlde
9. Hybond-N membrane (Amersham Int., Amersham, UK) 3. Methods 3.1. Culturing of Cells Lymphoblastold cell lines are established by Epstem-Barr vn-us (EBV) transformation. These are cultured in RPM1 1640 medium supplemented with 10% fetal calf serum, 2 mM L-glutamme, and antibiotics (see Note I) Block cells m metaphase by adding 100 PL colcemld stock solution to each 10 mL cell culture. After 17-20 h of colcemid treatment, suspension chromosomes are isolated by the method of Van-den-Engh (6,7) as described below. 3.2. Isolation and Staining of Suspension Chromosomes 1. Prepare 10 mL chromosome isolation buffer by mixing, 1 0 mL 100 mM MgS04, 8 0 mL HEPES buffer, 0 25 mL DTT stock solution, and 0 75 mL HZ0 Filter through a disposable 0.22~p.rn sterile filter. 2. Transfer colcemide blocked cell culture suspension to a 15-mL centrifuge tube, and centrifuge for 10 min at 800 rpm at room temperature
3 Decant supernatant completely, remove last drops of medium with a KleenexTM tissue, and loosen cell pellet by tapping. 4. Add 5 mL of chromosome Isolation buffer, and incubate the sample for 10 min at room temperature.
5. To each 5 mL sample, add 500 pL 2.5% Triton X-100 stock solution, and incubate for 10 min on ice. 6 Vortex sample for 20 s on a whirl mixer.
7. Add 125 PL Chromomycin
A3 and mix, then quickly add 125 p.L Hoechst 33258,
and mix. 8 Add 50 pL sodium azlde and incubate the sample overnight at 4°C m the dark
9. Add 100 JJL sodium citrate and 100 PL sodium sulfite to a new sample tube and transfer 800 FL chromosome
suspension with a 1-mL syringe to the tube, mix,
30
Pedersen
et al.
and disintegrate chromosome clumps by syringmg three times through a 22-gage needle. 10 After 15 mm of incubation, analyze the sample in the FACS, and after identification of the peak representing the relevant chromosome, sort 500-2000 directly into the PCR tube. 11, The PCR tubes are centrifuged m an Eppendorf centrifuge for approx 10 s, and the sorted chromosomes are stored at -20°C until use m the DOP-PCR. 3.3. DOP-PCR 1 Prepare DOP-PCR
rmxture:
dVTP dlTP 10X Tuq buffer (wlthout Mg2+) 100mA4MgCI, DOP Primer (Primer6MW) Tuq DNA polymerase H2O
pL pL 100 pL 45 pL 20 pL 025 pL 65 25 pL
Total
900
60 20
pL
2. To each PCR tube containing 1000 of the desired chromosomes in approx 10 PL sheath liquid, add 90 PL DOP-PCR truxture, and mix 3. Overlay with 60 PL paraffin oil. 4. Place the tubes in the PCR thermocycler and denature by heating for 10 min at 93°C. 5. Perform five identical cycles with denaturation at 94’C for 1 min, anneahng at 30°C for 1.5 mm, followed by increase m temperature to 72°C over a 2 mm period, then hold the temperature at 72’C for 3 min 6 Next perform 35 cycles with denaturatlon at 94°C for 1 mm, annealing at 55°C for 1 mm, extension at 72’C for 3 min, increasing the extension step by 1 s for each cycle The final extension was for 10 min. 7. Remove the paraffin 011 by placing the PCR mixture on a parafilm strip, which adsorbs the oil. Transfer the PCR mixture to an Eppendorf tube. 8 Add 10 I.LL sodium acetate and mix, then add 220 I.LL ice-cold absolute ethanol, and precipitate the DNA by incubating at -70°C for 1 h 9. Spin down the precipitate in a cooled Eppendorf centrifuge for 15 mm. 10. Remove supernatant Add 100 PL 70% ice-cold ethanol, and centrifuge agam 11 Decant the ethanol and dry the sample In a vacuum centrifuge for approx 10 mm 12. Dissolve the DNA pellet m 20 FL TE buffer and store at -20°C until use (see Note 2) The complex (see Note 3).
3.4. Probe Labeling with probe is labeled with biotin-dUTP
Biotin m a second round of PCR
Reverse
Chromosome
31
Painting
1, Prepare biotm DOP-PCR mixture: dVTP dlTP Blotm-1 l-dUTP 10X Taq buffer (wlthout Mg2+) 100 mM MgClz DOP primer (Primer 6 MW) Tuq polymerase
Hz0
FL pL 6.6 /.tL 100 pL 60 pL 20 j.kL 025 j.lL 66 15 J.lL
Total
99
60
1.4
0
fiL
2. Add 1 PL of the complex probe to 99 pL of the biotm DOP-PCR mixture 3 Perform 35 PCR cycles with denaturatton at 94’C for 1 mm, annealing at 55°C for 1 mm, extension at 72°C for 3 min. Final extension is for 10 min at 72°C. 4. Precipitate the PCR product as described in Section 3.3 , steps 7-l 1 5. Dissolve the biotm-labeled probe in 10 ltL TE buffer and store at -20°C until further use (see Note 4).
3.5. Chromosome
Painting
Chromosome parnttng IS performed essentially as described tn ref. 4, with l-2 PL btotm-labeled DOP-PCR product (see Section 3.4.), m a final hybridtzation vol of 12 FL. Hybrtdizatron 1s performed under a 18 x 18 mm coverslip.
4. Notes 1 The cell lines are propagated in 50-mL culture flasks placed m upright position Culture medium is changed by gently tilting the flasks, and after sedimentation of the large cell aggregates, which these cell lines form during prohferation, old culture medium is removed and fresh medium is added. For three successive days prior to chromosome isolation, the medium is changed and the cell suspension is split and transferred to two new flasks after dtsaggregation of cell clumps by shaking the culture flasks. This procedure removes most of the dead cells from the cell culture and selectively maintains a pool of rapidly prohferating cells 2. It is essential, in the painting reaction, that the PCR product is not enriched for repetitive DNA, since this will reduce the chromosome specificity of the complex probe. The composition of the PCR product can be evaluated using agarose testgel electrophoresis (Fig. 2A) A 2% agarose testgel m TBE buffer is used and 5-10 l.tL of the DOP-PCR product is run together with appropriate srze markers. After stammg of the gel with ethidmm bromide, the DOP-PCR products are easily recognizable on a UV transillummator. As shown m Fig 2A, the PCR products contain a smear of sequences with lengths of 150-1000 bp, and, since no discreet bands are found, the product seems not to be enriched for specific DNA repeat sequences. 3 Biotm-dUTP can be substrtuted with alternatively labeled nucleotides in the DOP-PCR labeling protocol. We have successfully used digoxigenm-1 l-dUTP, fluorescein-12-dUTP
(Boehrmger Mannheim), rhodamine-4-dUTP,
and AMCA-
Pedersen
et al.
4-dUTP (Amersham) m the same molar concentration as biotm-dUTP. The pamtmg srgnals are directly visible m the microscope when the DOP-PCR products are generated with the fluorochrome-labeled nucleotides, and m agarose testgels the DOP-PCR products can be seen wrthout ethrdium bromrde staming. In most situations, we prefer the use of biotin-dUTP because of the efficient enhancement of the pamtmg signal with the FITC-avrdm/antravidm antibody multilayermg technique 4 Biotm incorporatron of the DOP-PCR product can be verrfred by Southern blots according to the followmg procedure. a. Run the biotin-labeled DOP-PCR product on an agarose testgel as described in Note 2, and blot overnight on to a Hybond N membrane b. After blotting carefully wash the filter in fresh transfer buffer and air-dry c. Place the filter m a plastic cover Crosslink the DNA to the filter by UV rllummation for 5 min on the transilluminator normally used for visualizing ethidium bromide stained gels d Insert the filter in a 50-mL plastic tube, which IS constantly rotated throughout each of the subsequent steps e. Add blockmg buffer wrth 3% BSA and incubate at 37°C for 30 mm f Incubate the blocked filter at room temperature for 15-20 mm m blocking buffer with 1% BSA and 1 kg/mL avrdin-alkaline phosphatase. g. Wash the filter at 20°C for 5 mm m blocking buffer with 1% BSA, then incubate for 5 min in blockmg buffer (without BSA) and finally incubate for 5 mm in developing buffer h Incubate the filter in developing buffer with 10 kL/mL NBT and 10 pL/mL BCIP i. When the desired staining reaction has been obtained, stop the reaction by washing the filter in water. The stained filter can be stored in the dark A typical example is shown in Ag 2B.
Acknowledgments We thank H. Str@mkjar for expert technrcal assistance. This work was supported by grants from the Danish Centre for Human Genome Research and the Danish Cancer Society.
References 1 Carter, N P , Ferguson-Smrth, M A , Perryman, M T , Telenius, H , Pelmear, A H , Leversha, M A , Glancy, M T , Wood, S L , Cook, K , Dyson, H M , Ferguson-Smith, M E., and Wrllat, L R. (1992) Reverse chromosome pamtmg’ a method for the raprd analysis of aberrant chromosomes m chmcal cytogenetrcs .I Med Genet 29, 299-307 2 Lengauer, C , Eckelt, A , Welth, A , Endhch, N , Ponehes, N , Lrchter, P , Greullch, K 0 , and Cremer, T (1991) Pamtmg of defined chromosomal regrons by m situ suppression hybridization of librarres from laser-mrcrodissected chromosomes Cytogenet Cell Genet 56,27-30 3 Lengauer, C., Riethman, H , and Cremer, T (1990) Pamtmg of human chromosomes with probes generated from hybrid cell lures by PCR with Alu and Ll primers Hum Genet 86, l-6
Reverse Chromosome Painttng
33
4. Pmkel, D , Landegent, J , Collins, C., Fuscoe, J , Segraves, R , Lucas, J , and Gray, J (1988) Fluorescence in situ hybrrdizatton with human chromosome-specific libraries* detection of trtsomy 21 and translocations of chromosome 4 hoc. Nut1 Acad SCL USA 85,9138-9142. 5 Telenius, H , Carter, N P., Bebb, C E., NordenskJold, M , Ponder, B , and Tunnacliffe, A (1992) Degenerate ohgonucleotrde-prtmed PCR. general amplification of target DNA by a single degenerate primer Genomics 13,718-725 6. van-den-Engh, G., Trask, B , Lansdorp, P , and Gray, J (1988) Improved resolution of flow cytometric measurements of Hoechst- and chromomycm-A3-stained human chromosomes after addition of citrate and sulfite Cytometry 9,266-270 7 van-den-Engh, G. J , Trask, B J., Gray, J W , Langlois, R G , and Yu, L C (1985) Preparatron and bivarlate analysis of suspensions of human chromosomes Cytometry 6, 92-l 00 8 Kaltoft, K., Btsballe, S , Rasmussen, H. F , Thestrup-Pedersen, K , Thomsen, K , and Sterry, W (1987) A continuous T-cell lure from a patient with Sezary syndrome Arch. Dermatol Res 279,293-298
CHAPTER4 FISH Detection on DAPI-Banded Chromosomes Henry
H. Q. Heng
and LapChee
Dui
1. Introduction Fluorescence in situ hybridization (FISH) techniques are routinely used m physical mapping studies to determine the regional localization of gene and DNA sequences on human metaphase chromosomes (1). It is often dtfficult, however, to precisely position the hybridization signals with respect to the conventional chromosome bands. Various approaches have been introduced, including G banding before or after FISH detection (2,3), cohybridization with Alu or L 1 probes to generate R or G bands (4), use of a combination of various fluorescent dyes, such as qumacrine, Hoechst 33258, or DAPI, with FISH detecting reagents (5,6), and triple staining with chromomycin, distamycin A, and DAPI (7,8). Unfortunately, these procedures are not widely used because they are time-consummg and require extensive imaging equipment or careful quality control to be reproducible. In our FISH experiments, we occasionally obtained high quality DAPI bands, without the use of any pretreatments, such as distamycin A and chromomycin. This phenomenon encouraged us to search for conditions that give consistent DAPI banding patterns. Our study resulted in the development of a quick, simple, and inexpensive procedure for the generation of high-quality DAPI multibanded metaphase preparations that retam strong in situ hybridization signals (9). The critical step in obtainmg reproducible DAPI banding was apparently related to the degree of denaturation of the chromosome. With increasing denaturation time, three consecutive types of banding patterns could be observed on the same set of chromosomes: DAPI multibanding (equivalent to Q banding), partial C banding (including DA/DAPI banding pattern), and C banding. Although the progression through the above sequence could be interrupted at any stage, the change of chromosome morphology was irreversible and the pattern could not be restored by restainmg with DAPI. The conditions also varied with cell lines and chromosome preparations. In this chapter, we describe detailed protocols for the generation of FISH signals and high resolution DAPI banding on BrdU-mcorporated chromosomes. Using this protocol, we have mapped many yeastartificial chromosome (YAC), cosmid, and phage probes to specific regions on chromosomes (9-121, some examples of which are shown in Fig 1. From Methods tn Molecular Bo/ogy, Vol 33 In SW Hybridizafron Profoco/s Edlted by K H A Choo Copynght CD 1994 Humana Press Inc , Totowa, NJ
35
Heng and Tsui
36
Fig 1. Mapping of cosmid and YAC probes on DAPI banded chromosomes. A shows the FITC signals of probe CF14, whereas B shows the DAPI banding pattern of the same mitotic cell. C-F show the mapping results of YAC probes HSCE803 and 464, respectively. C and E are DAPI banded chromosomes, whereas D and F are the corresponding hybridization signals. Arrows point to the probe and band location.
2. Materials 2.1. Chromosome
Preparation
1. Lymphocytes: Isolated from healthy donors or human cord blood. 2. Lymphocyte culture medium: RPM1 1640 (Gibco, Grand Island, NY) supplemented with 10% (v/v) fetal calf serum (Gibco), 2% phytohemagglutinin (PHA)
FISH on DAPI-Banded
3. 4. 5. 6 7. 8. 9.
Chromosomes
37
(Gibco), and 5 U/mL heparin (Hepalean) (Organon Canada Ltd., Toronto, Ontario, Canada). This medium may be stored at 4’C for a few weeks 5-Bromodeoxyundine (BrdU) (Sigma, St. Louis, MO). Thymidine (Sigma). Potassium chloride (KCl) (Fisher Scientific, Pittsburgh, PA). Methanol (J. T. Baker, Phillipsburg, NJ). Acetic acid (Fisher Scientific). Microscope slides (Johns Scientific, Quebec, Canada). Glemsa staining solution (Fisher Diagnostics, Damstadt, Germany) 2.2. Probe
Preparation
1 Qiagen plasmid purification kit (Qiagen Inc , Chatsworth, CA). Buffers: PI: 50 mM Tris-HCl, 10 mM EDTA, pH 8, 0.1 mg/mL RNase. P2: 0 2M NaOH, 1% SDS P3. 3.OM potassium acetate, pH 5.5. Washing buffer 1M NaCl, 50 mM MOPS, pH 7, 15% ethanol Elution buffer 1 25M NaCl, 50 mM Tris-HCl, pH 8 5, 15% ethanol. 2 Solutions for phage DNA preparation* Absorption solution 10 mM MgC12, 10 mM CaC12. SM solution (1 L)* 5.8 g NaCl, 2 g MgS04 7H,O, 50 mL 1M Tns-HCl, pH 7.5, and 5 mL 2% gelatin 3. Solutions for YAC DNA preparation. YPD medium (1 L): 10 g Bacto yeast extract, 20 g Bacto peptone, and 20 g dextrose. GDIS: 2% Trlton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl, pH 7 4 1 mM EDTA. 4. Phenol. 5. Chloroform. 6 Isopropanol. 7. Ammonium acetate. 8. TE buffer (Tris-EDTA): 10 mM Tns-HCl, pH 7.4,O 1 mM EDTA 9 Blotin labeling nick translation kit (BRL, Gaithersburg, MD). 10 Nick column (Pharmacia, Uppsala, Sweden). 11 Salmon sperm DNA (100-500 bp fragments obtained by somcatmg)
1 2 3 4. 5. 6. 7.
2.3. Hybridization Hot plate (37-7O’C); water baths at 37,43, 46, and 70°C, 37’C Incubator. 25-mL Plastic slide mailers. Plastic slides chamber (slide holder). RNase A (Boehnnger Mannhelm, Mannheim, Germany) Ethanol. 75,90, and 100%. Denaturation solution. 70% deionized formamide (IBI) m 2X SSC (20X SSC stock solution: 3M NaCl, 300 mM sodium citrate) Hybridization solution I (for use with plasmid, phage, cosmid, or YAC probes) 50% deionized formanude (IBI) and 10% dextran sulfate m 2X SSC
38
Heng
and Tsui
8 Hybridization solution II (for use with repetitive DNA probes): 65% formamide and 10% Dextran sulfate in 2X SSC 9. Human Cot-l DNA (BRL) 10 Yeast DNA (S cereuuiae, W303-1A) sonicated into 100-500 bp fragments 11. Wash solution A (for nonrepetitive DNA probe). 50% formamide m 2X SSC. 12. Wash solution B (for repetitive DNA probes)* 65% formamide m 2X SSC. 13 Wash solution C: O.lM phosphate buffer, pH 8, 0 1% Nomdet P-40 (Boehringer Mannheim) 14 2X SSC (before and after DAPI staining wash).
2.4. Detection 1. 2 3.
4
and
Amplification
Blocking solution 3% BSA (bovine serum albumm, Sigma fraction V) m 4X SSC, 0.1% Tween-20. Detection solution* 1% BSA and 0 1% Tween-20 m 4X SSC. Store at 4°C. Avidm-FITC (fluorescem isothtocyanate, Vector, Burlmgame, CA) 500 kg/ mL stock solution. FITC detection workmg solution. Add 10 PL of avidinFITC stock solution to 990 l.rL detection mixture Store in the dark at 4°C. Good for up to 6 mo. Biotinylated goat antiavidm antibody (Vector). 500 l.tg/mL (stock solutton) Ahquots (50 PL each) can be kept at -20°C Workmg solution. Dilute stock solution wtth detection solution to a fmal concentration of 5 lg/mL.
2.5. Counter-staining
and
Antifade
4’, 6-diamidino-2-phenylmdole (DAPI, Sigma) 0 2 mg/mL stock solution in HzO. Store m the dark at 4°C. Propidmm iodide (PI, Sigma) 0 1 mg/mL stock solution m PBS (phosphate-buffered salme) (Gibco, BRL) Antifade solution. Dissolve 100 mg of P-phenylendiamine in 10 mL PBS Then add 90 mL glycerol Adjust pH to 9 0 by using Litmus paper Store at -20°C. 4 PI counterstammg mixture 50 I.LL propidmm iodide solutton (0 1 mg/mL) plus 1 mL antlfade solution
2.6. Microscopy
and
Photography
1 Epifluorescent
microscope (Leitz Aristoplan, Heerbrugg, Switzerland) with DAPI and FITC filters. For the DAPI filter, excitation filter BP 350-460, reflector RKP 510; emission: LP 520 For the FITC filter, excitation filter: BP 450490; reflector RKP 510, emission: LP 520. 2 Films Kodak Ectachrome P800/1600 E-6p and Kodak TMAX 400.
3. Methods 3.1. Chromosome Preparation 3.1.1. Lymphocyte Culture 2
Prepare the culture medium and distrtbute 20 mL into each flask (Falcon 3082) Isolate lymphocyte from 5-10 mL fresh human peripheral or cord blood by lowspeed centnfugation (500 rpm for 5 mm) Collect the whtte cell suspension
FISH
on DAPI-Banded
Chromosomes
39
3. Add 0.5-O 8 mL of blood cell suspension to each flask and mix well 4 Incubate m a CO2 incubator at 37°C for 68-72 h 1. 2. 3 4
3.1.2. BrdU and Thymidine Treatment Incubate cultured lymphocytes with BrdU (0 18 mg/mL) for an additional 16 h. Spin down the synchronized cells (1500 rpm, 7 min); wash them with serumfree medium; repeat three times to release block Reculture the cells at 37°C for 5.5 h m RPM1 1640 medium plus thymidme (2.5 l.tg/mL). Add colcemid (0.1 l.rgg/mL) to the cultures for 30 min before harvestmg
3.1.3. Harvesting and Slides Preparation by Routine Method (13) 1 Transfer cultured cells into 15-mL centrifuge tube (4-6 mL of cells per tube), collect cells by centrifuging at 1000 rpm for 7 min. 2 Hypotonic treatment. Gently resuspend the cell pellet in about 0.3 mL medium, add 5 mL 0.4% KCl, mix well, and incubate in a 37°C water bath for 10 mm. 3. At the end of the hypotomc treatment, add 0.1 mL of freshly made fixative (3’ I methanol,acetic acid) to each tube for prefixation at room temperature Mix gently by inverting the tubes a few times. Collect the cells by centrifugmg at 1000 rpm for 7 min 4 Discard the supernatant. Resuspend the pellet thoroughly by tapping the bottom of the tube with finger. Add 5 mL fixative (3 1 methanol acetic acid), mix well, and let stand for 20 min at room temperature. 5. After centrifugation, suspend the pellet m a small volume of fixative (about 0.5 mL) Place two drops on a prechilled slide (stand on ice for 15 mm). Dry the slide by waving it in the air. 6. Check the quality of the shdes under microscope after staming with 3% Giemsa solution, pH 6.8, for 10 min at room temperature 7. Adjust the concentration of the chromosome suspension to allow lo-30 metaphase spreads per field at 100x total magnification and continue to make more slides according to the established concentration (see Note 1) 3.1.4. Slides Storage Allow good quality slides to dry at room temperature for 1 d. Seal the slide contamer with parafilm. Slides may be stored at -20°C for a few months (see Note 2).
3.2. In Situ
Hybridization
3.2.1. Probe Preparation 3.2.1.1. PLASMID AND COSMID PROBE PREPARATION Plasmid and cosmid DNA is separated from E. co/i DNA with Qtagen column according to the supplier’s instruction. Briefly: 1. Harvest 5 mL of cultured cells by centrifuging 2. Resuspend cells in 0 3 mL Pl buffer, lyse by adding 0 3 mL P2 solutron and mcubating at room temperature for 5 min; neutralize by adding 0 3 mL P3 buffer
40
Heng
3. 4 5. 6 7
and Tsui
and centrifuge at 4°C for 30 mm (15,000 rpm) to pellet the bactertal chromosomal DNA. Load the suspension into the equilibrated column Wash the loaded column two times with wash solution. Elute the plasmid or cosmid DNA with elution buffer. Precipitate DNA wtth 0 7 vol of isopropanol and collect by centrifuging Wash DNA pellet with 70% ethanol, air-dry, and redissolve m TE buffer.
3.2.1.2.
PHAGE PROBES PREPARATION
The minipreparation
protocol
(14)
may be used to prepare
lambda
phage DNA. 1 Pick a plaque into a 15mL tube containing 0.3 mL adsorption solution and 0 2 mL of bacteria grown in L-broth with 0 4% maltose 2. After incubating the tube for 10 min at 37°C add 10 mL L broth contaming 10 mM MgC12 and 0.1% glucose, then culture overnight 3 Centrifuge at 2000 rpm for 10 mm to remove the bacterial debris from the lysed culture. 4. Collect the phage parttcles by centrifugation at 30,000 rpm for 30 min. 5. Suspend the pellet with 200 pL of SM solution m an Eppendorf tube Add 200 lt.L protemase K (1 mg/mL m SM) to the tube and Incubate at 37°C for 2 h. 6 Extract once with phenol and once with chloroform, and precipitate the DNA with 100 PL 7 5M ammonium acetate and 1 mL 100% ethanol. Wash the DNA with 70% ethanol, air-dry, and dissolve in 100 l.rL TE. 3.2.1.3.
YAC
PROBES PREPARATION
YAC DNA is isolated with total yeast DNA. The method of raped DNA preparation was adopted from published protocol (ll,12,15; see also Chapter 9). 1 Culture yeast cells at 30°C for 2 d m YPD medium 2. Collect cells by low speed centrrfugation, transfer into an Eppendorf tube, and wash with 500 l,tL of HZ0 3 Centrifuge the cells and resuspend in 200 pL of GDIS Together add 0 35 g of glass beads and 200 pL of phenol/chloroform/isoamyl alcohol (25.24: 1) Vortex for 3-4 min 4. Add 200 ltL of double-distilled HZ0 to the tube, mix well, and spin for 4 min m a mtcrofuge Transfer the aqueous layer to an Eppendorf tube. 5 Treat wtth 50 pg of RNase A (Sigma, DNase-free) at 37’C for 10 mm. 6. Phenol/chloroform extract twice and precipitate DNA by ethanol.
3.2.2. Probe Labelsng 1 For plasmid, phage, and cosmid probes* Label purified DNA (1 pg) with the BRL BioNick kit according to the suppher’s instructions (15’C for 60 min) Check the size of the nick translation products with a 1% agarose mmlgel. The optimal size of the labeled fragments IS 150-250 bp. 2. For YAC probes A longer nick translation time is usually necessary Generally, 2 h IS sufficient Check the size of mck translation products on a mimgel
FISH
on DAPI-Banded
Chromosomes
41
3 After labeling, remove the unincorporated nucleotldes using a Nick column (Pharmacia). Then add 60 pg of salmon sperm DNA and copreclpitate with the labeled probes in 40 pL 3M NaOAc and 880 pL ethanol After washing with 70% ethanol, resuspend the probes m 20 pL TE buffer 3.2.3. Probe Treatment
Before Hybridization
3.2.3.1. FOR REPETITIVE PROBES 1. Denature labeled repetitive probes m hybridization solution II. Add 20-50 ng labeled probes m 15 PL of denaturing solution and denature at 75’C for 5 mm, then place on ice immediately. 2. No prehybridlzation is needed for these probes.
3.2.3.2. FOR cDNA PROBES Use the same conditions as for the repetitive probes, but employ hybndlzation solution
I for hybridization.
3.2.3.3. FOR PHAGE, COSMID, AND YAC PROBES These probes generally contain repetitive sequences (e.g., Alu and L 1). It 1s therefore necessary to suppress potential signal from these elements with added genomlc DNA or Cot-l DNA. 1. For phage or cosmid probe, mix together 20-50 ng probes, 13 pL hybridization solution I, and 2 pg of Cot-l DNA or total human DNA. 2. For YAC probes Isolated with total yeast DNA, mix together 200-250 ng labeled probes, 13 l.tL of hybridization solution I, 2 pg of human Cot-l DNA, and 2 pg of total yeast DNA. 3. After 5 mm denaturatlon at 75”C, transfer the tube mto a 37’C water bath for 1530 min for prehybridlzatlon (prehybridization for YAC probe may be slightly longer, e.g., 20-60 min) 3.2.4. Slides
Treatment
Before Hybridization
3.2.4.1. SLIDE BAKING Bake slides (stored at -2OOC) at 55°C for 2 h (see Note 3). 3.2.4.2. RNASE TREATMENT 1. Incubate slides m the 25-mL plastic Jars containing RNase (100 pg/mL m 2X SSC) at 37’C for 1 h. 2 Wash the slides in 2X SSC for 2 min. 3 Dehydrate the slides by Incubating for 3 mm in each of 70,90, and 100% ethanol, and air-dry
3.2.4.3. SLIDE DENATURATION 1. Make fresh denaturation solution of 70% formamide by mixing 14 mL of formamide, 5 mL dlstllled HzO, and 2 mL 20X SSC. Put theJar filled with denaturmg solution mto a water bath and adjust the temperature to let the solution reach 70°C Meanwhile, heat the slides at 50°C to avoid droppmg the temperature of the denaturing solution
42
Heng
and Tsui
2 Immerse one to four prewarmed slides in the denaturation solution for l-l 5 min (see Note 4). 3 Quickly transfer the slides mto a plastic jar with cold 70% ethanol for 2 min, dehydrate the shdes in 95 and 100% ethanol for 3 min each, air-dry, and perform hybridization immediately. 3.2.5. Hybridization
1. Load 15 l.tL of denatured probe with hybridization solution on each slrde, and cover with a 22 x 22 mm coverslip. Gently remove air bubbles and seal the edges with rubber cement to minimize evaporation 2. Hybridize at 37°C in a moist chamber contammg absorbent paper soaked in water. For repetitive probes, hybridize for a few hours to overnight. For cosmid or YAC probes, hybrtdize for 12-36 h (see Note 5) 3.2.6. Posthybridization
Different 3.2.6.1.
wash conditions
Wash
are required depending
on the type of probe used.
FOR COSMID, PHAGE, OR YAC PROBES CONTAINING REPETITIVE ELEMENTS
1 Prewarm wash solution A to 46°C in three plastic jars 2. With forceps, carefully remove the rubber cement from the slides Allow the covershps to float off in 2X SSC solution Wash the slides a few times by agitating 3 Wash slides m wash solution A by gently agitating three times for 3 mm each. 4. Wash three times with prewarmed 2X SSC at 46°C 5 Place shdes in wash solution C and the shdes are ready for detection. If necessary, slides can be kept at 4°C in wash solution C for up to 2 d
3.2.6.2. FOR cDNA PROBES 1 2. 3. 4 5
Prewarm wash solution A to 43°C in three plastic ears. Remove rubber cement and coverslips as described in Section 3 2 6.1., step 2. Wash slides three times m wash solution A for 3 mm each. Wash three times with prewarmed 2X SSC at 43°C for 3 min each. Place slides in wash solution C and the shdes are ready for detection
3.2.6.3. FOR REPETITIVE DNA PROBES, SUCH As C&ATELLITE CENTROMERE DNA PROBES 1. 2. 3. 4 5.
Prewarm wash solution B to 43°C and 2X SSC to 37°C Remove rubber cement and coverslips as described m Section 3 2 6.1 , step 2 Wash slides in wash solution B for 20 mm by agitating. Wash two times wrth prewarmed 2X SSC at 37°C for 4 min each. Place slides m wash solution C and the slides are ready for detection
3.2.7. Detection
and Amplification
3.2.7.1. DETECTION WITH AMPLIFICATION 1. Remove slides from wash jar and blot excess liquid from the edge. 2 Quickly apply 30 l.tL of blocking solution to each slide. Cover with a plastic coverslip and incubate at room temperature for 5 mm
FISH
on DAPI-Banded
Chromosomes
43
3 Gently peel off plastic coverslips, tilt the slide, and allow fluid to dram. 4. Apply 30 pL FITC detection solution to each slide, and cover with a fresh plastic coverslip. Incubate for 20 mm at 37°C m a dark humidified chamber (from this step to observation with microscope, rt is very important to minimize exposure of the samples to light). 5 Remove coverslips and wash the shdes in wash solution C three times for 3 mm each in a new solution. 6 Apply 30 pL of blocking solution to each slide, cover with a plastic cover&p, and incubate at room temperature for 5 min. 7. Apply 30 pL of biotinylated goat antiavidin antrbody working solution to each slide and cover wrth a plasttc coverslip. Incubate at 37°C for 20 min 8 Remove the coverslips and wash the slides three times for 3 mm each in wash solution C. 9. Apply 30 pL of blocking solutron to each slide. Place a plastic coverslip over the solution and incubate at room temperature for 5 mm. 10 Peel off plastic coverslips, tilt the slide, and allow fluid to drain. 11. Apply 30 pL FITC detection solution to each slide and cover with a fresh plastic coverslip. Incubate 20 mm at 37°C. 12. Remove coverslips and wash the slides in wash solution C three times for 3 min each. 13. Stain with DAPI by immersing the slrdes in 0.2 pg/mL DAPI in 2X SSC for 5-10 mm at room temperature. Rinse in 2X SSC three times for 2 min each 14. Mount the slides with 10 pL of antifade solution. Cover with a 22 x 40 mm glass coverslrp. Apply gentle downward pressure to flatten coverslip before examining slide.
Propidium iodide (PI) staining may be applied to visualize the FISH signals and stained chromosomes. Before mounting the slides, mix antifade solution with PI counterstain solutron in the ratio of 3: 1. Mount slides with 10 pL of the mixed PI-antrfade solutron (see Note 6). 3.2.7.2. DETECTION WITHOUT AMPLIFICATION Signal amplificatron may not be necessary when YAC probes or a-satelhte probes are used for FISH detection. 1. Remove shdes from wash Jar and blot excess liquid from the edge. 2. Apply 30 yL of blocking solution to each slide. Cover with a plastic covershp and incubate at room temperature for 5 min 3. Gently peel off plastic coverslips, tilt the slide, and allow fluid to drain 4 Apply 30 yL FITC detectron solution to each slide and cover with a fresh plastic coverslip. Incubate for 20 min at 37°C in a dark humidified chamber (from this step to observation with microscope, it is very important to mimmize exposure of the samples to light) 5 Remove coverslips and wash the slides m wash solution C three times for 3 mm each 6. Stain with DAPI by rmmersmg the slrdes m 0.2 pg/mL DAPI m 2X SSC for 5-10 min at room temperature Rinse in 2X SSC three times for 2 min each
44
Heng
and Tsui
7. Mount the shdes with 10 pL of antrfade solution or 10 PL of mixed PI-antrfade solutton (see Section 3.2.7 1 , step 14) Cover with a 22 x 40 mm glass coverslip Apply gentle downward pressure to flatten coverslip before examining slide. If the signals need further amplification after the slide has been examined, carefully clean all the or1 from the coverslip, carefully remove the coverslip, place the slide in 2X SSC for a quick wash, and then wash slidesthree times for 5 min each in wash solutron C. Subsequentstepsare the sameas steps6-14 m Sectron 3 2.7.1.
3.3. Photography
and Localization on Banded Chromosome
of FISH
Signals
1. When taking photographs with Kodak Ectachrome P800/1600 film, push the exposure to 3200 ASA (exposure times about 1 s for DAPI, 4-7 s for PI and/or FITC) For Kodak 400 TMAX black/white films, the exposure time will be longer 2 Locate the FISH signal to the appropriate chromosomal band by superlmposmg two photographic slides of the same chromosome set-one slide taken of the FITC-PI image and another of the DAPI image (see Note 7).
3.4. Heating
to Enhance
the Banding
Differentiation
Heating after FISH detection is an additional way to get good quality bandmg differentiation. Usually, if the slide denaturation conditions are very well controlled before hybridization, good quality bands should appear. However, if the chromosome banding is not good enough, heating may be used to improve the DAPI banding pattern. To determine whether there is good differentiation, partial C band may be used as an index. If there are no partial C bands yet, more heating is needed. In contrast, if all C bands appear, it is not necessary to heat further, since C bandmg IS the final stage of the DAPI banding process (Fig. 2C-E) 1. Use DAPI filter to choosethe mitotic chromosomes 2. Check the FISH signals as well by switching to the FITC filter 3 If the FISH signalsare satisfactory but the DAPI banding drfferenttatron IS poor, take a photograph of FISH signalswith FITC filter and then locate and center the chromosomesm the field of view of a fluorescent microscope with the DAPI filter and expose to UV for at least 10-20 s 4 Remove the slide from the microscope without moving the stage and heat the slide on a hot plate to 55-70°C for IO-15 s (seeNote 8) 5. Check the DAPI banding differentiation under mrcroscope If the multiple banding drfferentration is stall uncompleted, the heating may be repeated until the desired result is achieved (seeNote 9)
See Note 10 for concludmg remarks on the above method. 4. Notes 1. Overcrowded chromosomespreadsusually result m higher background of FISH detection and should therefore be avoided
FISH
on DAPI-Banded
Chromosomes
Fig 2. (A) Abnormal nuclei generated by improper storage of the slide. This slide should therefore not be used for FISH. (B) Extended hybridization will destroy the chromosomes and nuclei on the slides. The picture shows the destroyed nuclei from which the DNA stained by DAPI has been lifted off the slide after prolonged hybridization. (C-E) Relationship between denaturation and the quality of the DAPI banding. (C) After less than 1 min denaturation at 70°C in 70% formamide, good banding pattern appeared. (D) After 2 min denaturation, only C banding pattern remained. (E) After 4-5 min, there is no strong DAPI staining on the majority of the chromosomes. 2. Proper slide storage is important to ensure strong FISH signals and low back-
ground. By using the suggested method, the slides can be stored for up to 3-6 mo. If the slides are kept at room temperature, the chromosomes or nuclei may dry out after a few weeks, resulting in abnormal morphology. The presence of nuclei like those shown in Fig. 2A indicates that the slides were improperly stored and should not be used for FISH detection.
Heng
and Tsui
3. Baking the shdes is important for good FISH detection. It seems that the function of the baking is not Just to ensure that the chromosomes remam attached to the slides, but it also improves the quality of the FISH signal by reducing the background. However, overbaking may destroy the higher order structure of the chromosomes, which will reduce the quality of the bandmg pattern as well as cause the looping out of the 300 A chromatm fiber, thus, misrepresenting its location relative to the naturally packaged chromosome. For example, overbakmg may result in the locahzatton of the FISH signals outside the chromosome at higher frequency (16). Therefore, we suggest that the temperature and the time of the baking should be carefully controlled. 4 Controllmg the denaturatlon conditions during the FISH process is the key element to obtain FISH signals as well as DAPI bandmg pattern Our previous experiments showed that the best DAPI banding differentlatton may be obtained within 30-40 s by using the routme denaturing buffer (7O”C, 70% formamide in 2X SSC) (9,16). Therefore, the standard denaturation protocol of 2 min or more is too long. However, smce the hybridization efficiency is also related to the denaturation time, it is not advisable to use only 30 s for denaturation (even though some repetitive probes, YAC probes, and phage probes give very good results). To ensure good hybrtdization as well as DAPI banding pattern, a compromise between the hybridization efficiency and the banding quality is therefore necessary Even though our experience indicates that the denaturatton time should be kept to a muumum (~1 min) and additional heating may be apphed to achieve the desirable DAPI bandmg after FISH detection, experimental variations must be considered To ensure the best results, we suggest that two slides be used m the same hybridtzation experiment, differing only m denaturation time, 1 min and 1 5 min. 5. Longer hybridization time may increase the efficiency of probe penetration and detection. Extended hybridization, however, will change the morphology of chromosomes as well as interphase nuclei For example, hybridization times of more than 1 wk will result m many chromosomes or nuclei becoming detached (Fig. 2B) 6. Our protocol produces Q banding after FISH detection and DAPI stammg. In contrast, PI stammg gives reversed banding (R bandmg). Even though the DAPI and PI can be used together to generate R or G bandmg on the same mttotic figure by simply using different filters, the relative proporttons of the two dyes must be controlled since they may interfere with each other Too much PI will decrease the contrast of the DAPI banding pattern. Since the DAPI Q banding is much more distmcttve than PI R banding, and since the PI counter staining makes it easy to locate FISH signals in a particular region of the chromosome, we suggest that DAPI and PI be used together with reduced proportions of PI The ratio we suggest is antifade solution. PI counterstaining solution of 3.1-5: 1 7 To locate the FISH signal to the DAPI banded chromosome, we have also developed a simple approach of double exposures of FISH images. Typically, we expose FITC signals for 4-5 s, then expose DAPI pattern on the same film for 1 s by double exposure. Two factors should be considered: First, the imaging of DAPI and FITC will not be perfectly aligned In order to get precise locahzatton, around 10 mitotic figures should be used for position determmation Second, when this
FISH on DAPI-Banded
Chromosomes
47
method is used, PI staining should be avoided, since the PI counterstainmg will reduce the DAPI banding differentiation after double exposure. 8. The heating temperature and time should be carefully watched during the heatmg process. Usually one needs a longer time to achieve the banding differentiation by using a lower temperature (55’C) than a hrgher one (6%7O’C). The advantage of using a lower temperature is that it allows easier control. We suggest trying lower temperature first. 9. Since the timing of the banding differentiation varies among chromosomes even in the same mitotic figure, it may be necessary to optimize the banding conditions just for the chromosome of mterest Other chromosomes may be over- or under-differentiated. 10. In conclusion, the rationale for the BrdU-mcorporation-related banding is that the early and late replicated chromosomal DNA can be distinguished by controlling the timing of BrdU mcorporation and subsequent BrdU-related detectron. The early replicating DNA is usually located in R bands, whereas the late repheating DNA is found in Q or G bands (17-19). The BrdU incorporation time and the DAPI detection method we use will generate Q bands, which are simrlar to G bands Similar protocols have been used to detect FISH signals on banded chromosomes (.5,6) However, the banding qualities were not ideal for either FISH detectron or just DAPI bandmg alone (20). During the study of DAPI banding and its transition, we found that BrdU-DAPI banding differentiation is largely dependent on the chromosomal denaturatlon step. By simply controlling the degree of denaturatlon of the chromosomal DNA by formamide treatment or heatmg, we are able to obtain high-quality DAPI multrbandmg (Q banding), partial C banding, and C banding These different types of banding can also be successfully used m conjunction with FISH detection (9-12). Our results demonstrate that the conventional denaturation conditions of FISH detection are too prolonged to generate hrgh-quality DAPI banding. The standard denaturation time can be reduced to give both good FISH signals and high-quality DAPI bandmg ~9~21).
It has been difficult to hybridize some probes derived from Giemsa dark bands to R-banded chromosome spreads (22). However, these probes could be successfully localized using DAPI-banding method (22,231. To explain this discrepancy, it was suggested that the unsuccessful hydridization might be due to the loss of target DNA durmg the R-bandmg process (23). Acknowledgments We thank P. Moens and B. Spyropoulos for their continued support and J. Squire for the discussion of the protocols. We also thank X. M. Shi for her excellent assistance and S. Scherer for YAC probes. This work was supported by funds from the Canadian Network of Centers of Excellence (Genetic Disease Network) and the Howard Hughes Medical Institute (International Scholarship Award). H. H. Q. Heng holds a student award from the Medical Research Council of Canada; L.-C. Tsui is the Sellers Chair in Cystic Fibrosis Research,
Heng
and Tsui
References 1 Ltchter, P , Tang, C -C , Gall, K , Hermanson, G , Evans, G , Housman, D , and Ward, D (1990) High-resolution mapping of human chromosome 11 by m situ hybrrdtzatron wtth cosmid clones. Scrence 247, 64-69. 2 Bhatt, B , Burns, J , Flannery, D , and McGee, J 0 (1988) Direct visuahzation of single copy genes on banded metaphase chromosomes by nonisotopic in situ hybridization Nuclerc Acid Res. 16,3951-3961
3 Klever, M , Grond-Gmshach,C , Scherthan,H , and Schroeder-Kurth,T M (1991) Chromosomalm situ suppression hybridtzatton after Giemsabanding Hum Genet 86, 484-486 4 Korenberg,J R and Rykowski, M C (1988) Humangenomeorgamzatron:Alu, hnes, and the molecularstructure of metaphasechromosomebands Cell 53, 391-400. 5 Lichter, P , Boyle, A , Cermer,T , andWard, D. (1991)Analystsof geneandchromosome by nonisotopicm sttu hybridization GATA 8,24-35. 6 Fan,Y -S , Davis,L M , andShows,T B (1990)MappmgsmallDNA sequences by fluorescencem situ hybridizationdirectly on bandedmetaphase chromosomes Proc Natl. Acad Scr USA 87,6223-6227
7 Dworzak, M , Stock, C , Strehl, S , Gadner,H , andAmbros,P F (1992)Ewing’stumor X mousehybridsexpressingthe MIC2 antigen.analysesusmgfluorescenceCDD-bandmg and non-isotoptcISH Hum Genet 88,273-278 8 Puckett, C , Gomez,C M , Korenberg,J R , Tung, H., Merer, T J., Chen,X-N , and Hood, L (1991) Molecular clomngandchromosomallocalrzattonof one of the human glutamatereceptorgenesProc Nut1 Acad Ser. USA S&7557-7561 9 Heng,H H Q andTsut, L -C (1993)Modesof DAPI bandingandstmultaneous m sttu hybridization Chromosoma 102,325-332 10 Heng, H H Q , Shi, X -M , and Tsui, L-C (1993) Fluorescencem situ hybrtdrzation mappingof the cystic fibrosis transmembrane conductanceregulator (CFTR) gene to 7q31.3 Cytogenet Cell Genet 62, 108,109 11. Heng,H H Q., Shi, X -M., Brunkow, M , Scherer,S , Moens,P., andTsur, L. C (1994) FISH detectionby usmggel purified total yeastDNA probe-a quackandreliablemethod to mapYAC cloneson humanandmousechromosomes (submitted) 12 Heng,H H. Q , Shr, X M , andTsui, L -C (1993)Refinedlocahzatronof the asparagme synthetasegenelocus(ASNS) to chromosome 7, regionq21 3, andcharacterizationof the somaticcell hybrid line 4AF/106/KO15 Cytogenet Cell Genet. 66, 135-138 13. Heng, H H. Q , Chen, W. Y , and Wang, Y. C (1988) Effects of pmgyanymycin on chromosomes.A possiblestructural bastsfor chromosomeaberratron Mutation Res 199,199-205
14. Grossberger,D (1987) Mmipreps of DNA from bacteriophagelambda.NuclercAcids Res 15,6737
15. Schere, S. and Tsui, L.-C (1991) Cloning and analysisof large DNA molecules,rn Advanced Technzques m Chromosome Research (Adolph, K , ed ), Marcel Dekker, New York, pp 35-72. 16 Heng,H H Q., Shi, X -M., andTsut, L -C. (1994)Unusuallocationof m situ hybridization signalsalong the chromosomeresultsfrom dtsruptmgits high-orderstructure (in preparation). 17 Dutrillaux, B , Couturier, J , Richter, C -L , andViegas-Pequignot,E (1976) Sequence of DNA replicationm 277R- andQ-bandsof humanchromosomes usingBrdU treatment Chromosoma
S&51-61
18. Camargo,M. and Cervenka,J (1982) Patternsof DNA rephcattonof humanchromosomesII. Replication mapand rephcatton model.Am. J Hum Genet 34, 757-780
FISH on DAPI-Banded
Chromosomes
19 Heng, H H Q , Chen, W Y , and Yoslda, T H (1986) Studies on amphibian chromosomes by the high resolution bandmg technique used for the high resolution R-bandmg m frogs Proc Jap. Acad. 62,53-56 (Ser B) 20. Sumner,A T (1990)Bandmgwith fluorochromesotherthanqumacrine,m Chromosome Bandmg (Sumner,A. T , ed ), UnwmHyman, London,pp 155-186 21 Heng,H H Q , Sqmre,J , andTsul, L -C (1992)High resolutionmappmgof mammalian genesby m situhybridizationto free chromatmProc Natl. Acad Scl USA 89,9509-95 13 22 Takahashi,E -1 , Yamauchl,M., TSUJI, H , Hltoml, A , Meuth, M , andHorl, T.-A (1991) Chromosome mappmgof the humancytldme-S-tnphosphatesynthetase(CTPS) geneto band 1~34I-~34.3 by fluorescence in situ hybrldrzatlon Hum Genet 88, 119-121 23 Nakashlma,H , Sakal,M , Inaba,R., andImamura,T (1994)Isolationandfluorescencem situ hybrldlzatlon mappingof 60 cosmldcloneson humanchromosome 18. Genomrcs 19, 577-580
CHAPTER 5
Generation of Alphoid DNA Probes for Fluorescence In Situ Hybridization (FISH) Using the Polymerase Chain Reaction Christoph Lengauer, Ian Dunham, Terry Featherstone, and Thomas Cremer 1. Introduction Alpha satellite DNA is a primate-specific family of tandemly repeated sequences present in the centromeric regions of all human chromosomes (I3). The basic unit is a monomer repeat of approx 170 basepair (bp) that contains both sequences conserved among the different chromosomes and variable regions. Blocks of consecutive monomers comprise a chromosome-specific higher-order repeat of up to several kilobases (kb) m size. For most human chromosomes, specific multimeric higher-order repeat units have been described (for review, see ref. 4). 1n situ hybridization of probes cloned from the conserved regions of the alphoid monomer has been applied to human metaphase spreads to pinpomt all centromeric regions simultaneously (5). Such a definition of centromeric regions of all chromosomes may provide marker signals helpful for automated chromosome analysis, in particular m the case of an automated evaluation of radiation-induced dicentric chromosomes (6). In clnncal cytogenetics, chromosome-specific alphoid probes have become an important aid for the detection of specific numerical chromosome aberrations at all stagesof the cell cycle (e.g., 7-11). In addition, such probes have been exploited in studies of chromosome topography m interphase nuclei and in nuclei of termmally differentiated cells (12-14). The generation of alphoid DNA probes by clonmg procedures is time-consuming and cannot easily be performed m all cytogenetic laboratories. The polymerase chain reaction (PCR) provides a more rapid and easy alternative to generate such probes. Two protocols are described below: The first protocol makes use of ohgonucleotide primers for conserved regions of the a-satellite monomer (15,16). In this approach, the specificity of the PCR-generated alphoid probes varies with the source of DNA used for amplification, Using From Edlted
Methods O-IMolecular Biology, Vol 33 In SIIU Hybrrdrzabon Protocols by K H A Choo CopyrIght 6 1994 Humana Press Inc , Totowa, NJ
51
52
Lengauer et al.
human genomrc DNA as a source, probes that hybridize to the centromeric regions of all chromosomes can be obtained, whtle DNA from somatic hybrid cell lines contaming smgle human chromosomes, or DNA prepared from flowsorted human chromosomes can be used to generate probes for the spectftc pertcentromertc stammg of mdivtdual chromosomes (I 7). The second protocol mcludes ohgonucleotide primers for chromosome-specific variable regions of the a-satellite monomer. Using human genomic DNA as a source for PCR, this latter protocol allows the generation of chromosome-specific probes (17) (see Note 1). 2. Materials 2.1. PCR
with
Primers
from
Conserved
Regions
of the Alphoid Monomer 1 Genomm DNA (100 ng) preparedfrom (a) male human blood, (b) somatic hybrrd
2. 3. 4 5 6.
7. 8
cell lmes contammg a certain human chromosome, and (c) hbrarres of flow-sorted human chromosomes, cloned m the Bluescribe vector (Stratagene, La Jolla, CA) and kindly provided by Joe Gray (Umversity of California, San Francisco). Disposable gloves. Set of mmrohter prpets (e.g , Gilson). Eppendorf tubes (2 2 mL) with a conical bottom and screw caps. 5X PCR-buffer. 50 mMTris-HCl, pH 8 4,250 mM KCl, 7 5 mM MgCl,, 0 005% gelatin This buffer is stable at -20°C for at least 3 mo dNTP-mix. Prepare stock solutron containing all four dNTPs at a concentratron of 1 mM from nucleotrdes purchased from Boehrmger Mannhelm (GmbH, Mannhelm, Germany) (100 rruI4 solutions) and store at -2O’C for several weeks Thermus aquatmu (Taq) DNA polymerase (Native Taq; Perkm-Elmer/Cetus, Norwalk, CT) Oligonucleotrde primers a27 and a30 directed to conserved regions located at the 5’ end of the human a-satellite monomer (17) a27.5’
CAT CAC AAA GAA GTT TCT GAG AAT GCT TC 3’
a30* 5’ TGC ATT CAA CTC ACA GAG TTG AAC CTT CC 3’
9 10 11 12 13 14. 15 16.
Dissolve prrmers m double dlstrlled water to yield a 100+&f solution each. MIX the two solutions 1.1 to give a final concentration of 50 pM for each primer Store at -20°C. Salmon sperm DNA sheared or DNase digested to a size of approx 500 bp (Sigma, St Louis, MO) 20X SSC. 1X SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7 0. Paraffin or1 (light mineral oil) Thermocycler. We use the Thermocycler 60 (BioMed, Theres, Germany) in all our experiments. Seakem ME agarose (FMC Broproducts, Rockland, ME) 50X TAE* 2M Tns-acetate, pH 8 O,O.O5M EDTA 1% Ethrdmm bromide DNA gel electrophoresis apparatus.
FISH Using PCR-Generated
Alphoid Probes
2.2. PCR with Primers from Chromosome-Specific Alphoid
53 Regions
1. 2. 3. 4. 5.
Genomrc DNA purified from human blood (500 ng) Disposable gloves. Set of microhter pipets (e g., Gilson). 0.6-mL Eppendorf tubes. 10X PCR-buffer 100 mM Tris-HCl, pH 8.4, 500 mM KCl, 25 m/14 MgC12, 1.7 mg/mL bovme serum albumm. 6. dNTP-mix Prepare stock solution containing all four dNTPs (Boehrmger Mannheim) at a concentratton of 5 mM and store at -2O’C for several weeks 7. Thermus aquaticus DNA polymerase (Native Taq; Perkin-Elmer/Cetus). 8. Oligonucleotide primers directed to chromosome-specific regions of alphotd monomers. The following primer pairs can be used to generate probes specific for the pericentromerrc heterochromatm of each of the chromosomes 1, 6, 7, 17, or X (see Note 2). a. chromosome l-specific primers (18): alE6: 5’ GGC CTA TGG CAG AGG ATA TAA CTG CC 3’ alA7.5’
GTG AGT TTT CTC CCG TAT CCA ACG AAA TCC 3’
The length of the amphfrcation product is 201 bp. b chromosome 6-spectftc primers (19): a6E* 5’ ACT GTG GGC TTC AAT GCC GC 3’ a6F: 5’ GCC TAC GGC AGA AAA AGA AAC C 3’ The length of the amplification product is 182 bp. c chromosome 7-spectftc primers (20). a7A 10.5’ TTC ATT GGA ATC GCG AAT AC 3’ a7A12: 5’ CAA GAA GGC TTC AAA GCA CC 3’ The length of the amphftcation product is 348 bp. d. chromosome 17-specific primers (18,21): a17Al:
5’ AAT TCG TTG GAA ACG GGA TAA TTT CAG CTG 3’
a17B2: 5’ CTT CTG AGG ATG CTT CTG TCT AGA TGG C 3’ The length of the ampliftcation product is 227 bp. e. chromosome X-specific primers (22): aXCl1:
5’ ATT TCT TTG GAA TCG GGA ATA TTT CCA CAG 3’
aXD 12: 5’ CTC TCG TCT TTC TGT GAA GAT AAA G 3’ The length of the amplification product is 212 bp. Dissolve primers in double distilled water to yield 25-w solution and store at -20°C. 9. Paraffin oil (light mineral oil). 10. Thermocylcer (Perkm-Elmer/Cetus).
54
Lengauer
et al.
3. Methods In this chapter, we have emphasized mainly the procedures for the generation of the alphoid probes and refer the readers to other chapters (e.g., Chapters 4 and 10) in this volume for a more detailed description of the FISH method. 3.1. PCR
with
Primers
from
Conserved Monomer 3.1.1, Performing the PCR
Regions
of the Alphoid
A PCR carried out in a final volume of 5 PL yields some 1 pg of amplified products sufflcent for 50 to 200 FISH experiments. Several identical PCRs are performed simultaneously and amplification products are pooled thereafter. For each PCR: 1 Prepare the following reaction mix m a 2 2-mL Eppendorf tube a. 1 PL of 5X PCR-buffer; b 1 yL of dNTP-mix (1 mM each); c. 1 PL of primer-mix (each primer 50 j04), and d. 100 ng of a DNA source (see above) e If necessary, double distilled water is added to adjust the volume of the reactlon mix to 4 FL. 2 Add 1 PL of Taq DNA polymerase (2.5 U&L) and mix gently 3. Overlay the reaction mix with about 50 PL paraffin oil This step can be omitted when using the Thermocyler 60 (BioMed). 4 Place the samples in the thermocyler. For the BioMed machine, perform PCR cycles as follows* a. 95°C for 3 mm; b 95°C for 50 s; c 64’C for 2 mm, d. 72°C for 3 min, e repeat steps b-d for a total of 30 cycles; and f. 72’C for 4 mm. 5. Store amplification products at +4”C (up to 1 mo) or at -20°C for more extended periods.
3.1.2. Analyzing
the Reactions
1. Prepare a 100 mL agarose gel (1.2%). Bring the solution to a boil in a microwave oven until all agarose has dissolved. Cool the solution to 55”C, add ethidium
bromide (final concentrationof 0.5 pg/mL) and pour onto a gel tray. 2. Remove the overlay of oil from the reaction mix. This is done by adding 50 PL of chloroform, mixing and cenhfuging for 10 s The oil dissolves m the CHC13 (bottom layer). Remove the reaction mix (top layer) with a mlcrohter pipet AlternatIvely, use a microliter pipet to directly take up the reactlon mix below the 011 layer. Remove oil adhering to the pipet tip with a Kimwipe tissue paper. Note that any remaining oil will interfere with the migration of the DNA through the gel 3. Load a 5-PL aliquot from a pool of several identical PCRs on the gel and electrophorese at 120 V for 1 h 4 Observe the gel on a UV transilluminator.
FISH Using PCR-Generated
Alphoid
Probes
55
ABC
Fig. 1. Agarose gel (1.2%) of alphoid DNA sequences obtained by PCR of DNA of the human-hamster hybrid cell line Cl21 containing the human X chromosome as the only human chromosome material (lane A) and male human genomic DNA (lane B) with the primer pair a27/a30 directed to the alphoid consensus region. Lane C: 123-bp ladder.
An appropriate gel shows a distinct band at approx 170 bp and a ladder of multimers which ends in a smear of up to 3 kb (Fig. 1). 3.1.3. Probe Labeling and FISH 1. Label PCR-products with an appropriate hapten, e.g., biotin-1 I-dUTP, by nick translation using, for example, the nick translation kit of GIBCO BRL/Life Technologies (Gaithersburg, MD), following the instructions of the supplier. 2. Separate labeled probe from unincorporated nucleotides by standard gel filtration such as using a spin column. 3. Perform fluorescence in situ hybridization and washing procedures as described (23). Prepare the following hybridization mix (sufficient for one slide using a 24 x 50 mm coverslip): a. 5-20 ng of labeled PCR amplified DNA; b. 5 pg Salmon sperm DNA; c. 5 l.tL 20x ssc; d. Deionized formamide to a final concentration of between 50% and 70% (see Note 3); and e. Double distilled water to a vol of 50 pL.
Lengauer
56
et al.
4 Add the 50 p.L hybridization mixture to a slide with methanol/acetic acid (3: 1 v/v) fixed human chromosome spreads 5 Put a 24 x 50 mm covershp on the hybridization mixture droplet and seal the edges of the coversllp with rubber cement. 6. For DNA denaturatlon, transfer the slide into a prewarmed metal box floating in a 73’C waterbath for exactly 10 min 7 Transfer the box containing the slides to a 42°C waterbath and incubate overmght. 8 Perform washing and detection steps as described in other chapters m this volume Some typlcal results are shown m Figs. 2A-C. 3.2. PCR with Primers Chromosome-Specific Alphoid Regions 3.2.1. Performing the PCR For each PCR, prepare the following reaction mix in a 0.6 mL Eppendorf tube. a 2.5 PL of 10X PCR-buffer; b. 1 PL of dNTP-mix (5 mM each), c. 1 PL of each of the two primers (25 PM each), and d 500 ng of human genomlc DNA. Add double dlstllled water to a vol of 25 PL Add 1 PL of Tuq DNA polymerase (1 25 U/pL). MIX gently. Add 25 PL of paraffin oil. Place samples m an automatic thermocyler. For the Perkm-ElmerKetus machine, perform PCR cycles as follows. a 94”C, for 2 mm; b. 94”C, for 1 mm, c. 65”C, for 2 min, d 72’C, for 2 min, e. Repeat steps b-d for a total of 25 cycles, and f 72”C, for 4 mm. Store amplification products at +4”C (up to 1 mo) or at -2O’C for more extended periods from
1
2. 3 4. 5.
6
3.2.2. Analyztng the Reactions, Probe Labeling, and FISH Analyze the PCR amplified products by gel electrophoresis and label the probe as described m Sections 3.1.2. and 3.1.3. As an alternative to nick translation, labeled nucleotides, e.g., blotin-l I-dUTP, can be incorporated durmg the PCR using dATP, dCTP, dGTP at a final concentration of 200 @4 each, and d’ITP as well as blotin-l I-dUTP at a final concentration of 100 PM each. In situ hybndizatlon, washing, and detectlon procedures are performed as described (23). An addltlonal washing step with 0.1X SSC at 60°C for 7 mm is routinely included. In case of cross-hybridization to the pericentromerlc heterochromatm of other chromosomes than the target chromosome the addition of 10 pg/ mL unlabeled total human DNA or 1 pg/mL alphold DNA amplified with the primer pair a27/a30 (see Section 2.1.) step 8) to the hybridization mixture, and more stringent washing steps can be tried to improve the specificity (Note 3).
FISH
Using
PCR-Generated
Alphoid
Probes
57
Figure 2D shows a normal human lymphocyte metaphase spread after FISH with a probe generated from human genomlc DNA with a chromosome 17specific primer pair. 4. Notes 1. The usefulness of the described protocols for PCR-generation of chromosomespecific alphoid probes depends on several factors. A major source of ambtguity which limits the usefulness of alphoid DNA probes for the identification of individual chromosomes stems from the fact that the alphoid sequences of some chromosomes are closely related (18). The construction of oligonucleotrde primers for defined subregions of alphoid monomers can be helpful to generate alphoid DNA probes with improved specificity for a given chromosome. The selection of such primers, however, can be drfficult and the results are sometimes not predictable in advance. 2 In addition to the primers presented here, primer sets allowing amphfrcation of subsets of a-satellite DNA specific for each of chromosomes 3 and Y have been published by Warburton et al. (24) a. chromosome 3-specific primers* 3-A. 5’ TCT GCA AGT GGA TAT TTA AA 3’ 3-B: 5’ TGA GTT GAA CAC ACA CGT AC 3’ The lengths of the amplification products are 1.28 and 0.95 kb b Y-chromosome-specific primers: Y-A: 5’ TGA AAA CTA CAC AGA AGC TG 3’ Y-B: 5’ ACA CAT CAC AAA GAA CTA TG 3’ The length of the amphftcation product is 1 0 kb For the amplification of alphoid regions specific for chromosomes 7, 17, and X, Warburton et al. (24) have described different primer pairs that are also very useful for in situ hybridization experiments a. chromosome 7-specific primers: 7-A: 5’ AGC GAT TTG AGG ACA ATT GC 3’ 7-B. 5’ CCA CCT GAA AAT GCC ACA GC 3’ The lengths of the amplificatron products are 1.O, 0 68, and 0.34 kb. b. chromosome 17-specific primers 17011.5’ AAT TTC AGC TGA CTA AAC A 3’ 17a2: 5’ TTT AGT TAG GTG CAG TTA T 3’ The length of the amplification product is 850 bp. c. X chromosome-specific primers: X-3A. 5’ ATA ATT TCC CAT AAC TAA ACA CA 3’ X-4A* 5’ TGT GAA GAT AAA GGA AAA GGC TT 3’
58
Lengauer
et al.
FISH Using PCR-Generated
Alphoid
Probes
59
Fig. 2 (beginning on opposite page). FISH of alphoid DNA probes to nomal human lymphocyte metaphase spreads (46,XY or 46,Xx). Probes are labeled with biotin-1 I-dUTP and detected with Avidin-PITC. Chromosomes are counterstained with propidium iodide. (A-C) Probes generated by PCR with the oligonucleotide primer pair a27/a30 directed to the alphoid consensus region. (A) FISH using an alphoid probe generated from male human genomic DNA. Note signals on the pericentromeric heterochromatin of all chromosomes of a male metaphase spread. (B) FISH using an alphoid probe generated from the human-hamster hybrid cell line Cl21 containing the human X chromosome as the only human chromosome material. The pericentromeric heterochromatin of the two X chromosomes contained in a female metaphase spread and adjacent interphase nuclei is delineated. (C) FISH using an alphoid probe generated from a plasmid DNA library of flow-sorted human chromosomes 8 selectively decorates the pericentromeric heterochromatin of the respective target chromosomes in a male metaphase spread (see Note 4). (D) Probe generated by PCR of total genomic human DNA with the chromosome 17-specific oligonucleotide primer pair a17Alla17B2. Signals are restricted to the pericentromeric heterochromatin of both chromosomes 17.
60
Lengauer
et al.
The length of the amplification product IS 850 bp. 3. The strmgency of m svu hybrichzation plays a crucial role in avolchng crosshybridization to other chromosomes (7) For example, the specificity of chromosome-specific PCR-amplified probes critically depends on the formamide concentration, the optimum level of which has to be tested empirically 4 Note that if chromosome-specific hbranes are used as PCR templates, the specsflcity of probes generated with primers directed to the conserved region of the alphoid satellite monomer may be llrmted by the presence of alphoid sequences from other chromosomes resulting from impurities during flow-sorting.
References 1. Manuehdis, L (1978) Chromosomal locations of complex and simple repeated human DNAs Chromosoma 66,23-32. 2 Rosenberg,H M , Singer,M F , andRosenberg,M (1978) Highly reiteratedsequences of Simian.Scrence 200,394-402 3 Willard, H F. (1985)Chromosome-speclflc organizationof humanalphasatelliteDNA Am J Hum Genet. 37,524-532
4 Choo,K H , Vessel,B., Nagy, A , Earle,E , andKalitsls,P (1991)A surveyof thegenomlc distribution of alphasatelliteDNA on all the humanchromosomes, and derivation of a new consensus sequenceNucl Acids Res 19, 1179-l 192. 5. Mitchell, A. R , Gosden,J R., and Miller, D A. (1985) A clonedsequence,pH82, of alpholdrepeatedDNA foundat thecentromeres of all humanchromosomes Chromosoma 92,369-377 6. Meyne, J., Littlefield, G , andMoyzls, R K (1989)Labelingof humancentromeres using
an alpholdDNA consensus sequenceapphcatlonto the scoringof chromosome aberrations Mut Res. 226,75-79. 7 Cremer,T , Landegent,J., Bruckner,A , Scholl,H P , Schardm,M , Hager,H. D , Devllee, P , Pearson,P , andvan der Ploeg,M (1986)Detectionof chromosome aberrationsm the humannucleusby visuallzattonof speclflctargetDNAs v&h radioactiveandnon-radloactlve in situ hybridization techniques.diagnosisof trlsomy 18 with probe Ll 84 Hum Genet 74,346-352.
8 Cremer,T ,Tesm,D , Hopman,A H N ,andManuehdls, L (1988)Rapidinterphase andmetaphaseassessment of specificchromosomal changesm neuroectodermal tumor cellsby m situ hybridization with chemicallymodifiedDNA probesExp Cell Res 176, 199-220 9 Hopman,A. H N., Poddighe,P J , Smeets,A W G B , Moesker,0, Beck, J L M., VooiJs,G P , and Ramaekers, F. C (1989) Detectionof numericalchromosome aberrationsm bladdercancerby m situ hybrldlzatlon Am. J Path 135, 1105-l 117 10 Anastasi,J , Le Beau,M. M , Vardlman,J W , andWestbrook,C A (1990)Detectionof numericalchromosomal abnormahtles m neoplastichematopoletlccellsby m situ hybndizatlon with a chromosome-specific probe.Am J Path 136, 13l-139 11 Poddlghe,P J., Moesker,0 , Smeets,D , Awwad, B H., Ramaekers, C S., andHopman, A H N (1991)Interphasecytogenetlcsof hematologlcalcancer’comparisonof classical karyotyping and in situ hybridizationusinga panelof elevenchromosome specificDNA probes.Cancer Res 51,1959-1967 12 Manuehdis,L. and Borden, J (1988) Reproduciblecompartmentahzatlon of mdlvldual chromosomedomainsin humanCNS cells revealedby m situ hybrldlzatlon and threedimensionalreconstructionChromosoma 96,397-410 13 Emmench,P , Loos,P., Jauch,A , Hopman,A. H N., Wlegant,J , Higgins,M , White, B N , van der Ploeg,M , Cremer,C., and Cremer,T (1989) Doublem situ hybrldlzatlon with digital imageanalysis.A newapproachto studyinterphasechromosome topography Exp. Cell Res 181, 126-140
FISH Using PCR-Generated
Alphoid
Probes
14 Popp, S., Scholl, H P., Loos, P , Jauch, A., Stelzer, E , Cremer, C , and Cremer, T (1990) Distribution of chromosome 18 and X centrtc heterochromatm in the interphase nucleus of cultured human cells Exp. Cell Res 189, 1-12 15 Koch, J. E , Kolvraa, S , Petersen,K B., Gregersen,N , and Bolund, L (1989) Oligonucleotide-primingmethodsfor thechromosome-specific labelhngof alphasatelhteDNA m situ. Chromosoma 98, 259-265. 16 Weier, H U , Kleine,H D., andGray, L. W (1991)Labelingof the centromertcregionon humanchromosome 8 by m situ hybrtdtzation. Hum. Genet. 87,489-494. 17 Dunham,I , Lengauer,C , Cremer,T., andFeatherstone,T (1992) Rapidgenerationof chromosome-specific alphoid DNA probesusmgthe polymerasecham reaction. Hum Genet g&457-462
18 Wtllard, H F andWaye,J S (1987)Chromosome-specific subsets of humanalphasatellite DNA: analysisof sequence dtvergencewithin andbetweenchromosomal subsetsand evidencefor an ancestralpentamencrepeat.J Mof Evol. 25,207-214 19.Jabs,E. W andPersico,M. G (1987)Charactenzattonof humancentromencregions of specificchromosomes by meansof alphoidsequences. Am. J. Hum. Genet. 41,374-390. 20 Waye, J S., England,S. B., and Willard, H. F (1987)Genomicorgamzatlonof alpha satelliteDNA on humanchromosome 7, evrdencefor two distinct alphotddomams.Mel Cell Blol. 7, 349-356
21 Waye,J S.andWtllard, H. F (1986)Structure,organizationandsequence of alphasatelhte DNA from humanchromosome 17 evtdencefor evolutionby unequalcrossmg-over andan ancestralpentamerrepeatwith the humanX chromosomeMol Cell Blol. 6, 3156-3165 22. Waye, J S andWtllard, H F. (1985)Chromosome-specrfrc alphasatelliteDNA* nucleotide sequenceanalystsof the 2 0 ktlobasepatrrepeat from the humanX chromosome Nuclecc Acids Res. 13, 273 l-2743
23. Ltchter,P.andCremer,T (1992)Chromosome analystsby non-rsotoptc m sttuhybrtdtzatron, m Human Cytogenetlcs. A Practical Approach, vol 1 (Rooney,D E. andCzepulkowskt, B. H , eds), IRL, Oxford University Press,Oxford 24 Warburton,P. E , Gretg, G. M , Haaf, T., andWtllard, H F (1991)PCR amplificationof chromosome-spectfic alphasatelliteDNA: defmitton of centromericSTS markersand polymorphicanalysisGenomlcs 11,324-333
CHAPTER 6 In Situ Hybridization
Using Synthetic Oligomers as Probes for Centromere and Telomere Repeats Julianne
Meyne and Robert
lit Moyzis
1. Introduction Telomeres and centromeres are critical structural and functional elements of eukaryotic chromosomes. Thus, they are important to our understanding of the organization and management of complex genomes. Termim of eukaryotic chromosomes are characterized by short, tandem repeats with a G-rich sequence on the 3’ end of the DNA strands. The telomeres of humans and all other vertebrates analyzed to date contain the same telomere repeat sequence, (TTAGGG), (1,2). In situ hybndrzation of telomere repeat probes has become a useful adjunct to the molecular analysts of eukaryotrc chromosome ends. Fluorescence in situ hybridization confirmed the presence of the (TTAGGG), sequence at the chromosomal ends and provided a visual documentatron that all telomeres m the genome have the same terminal repeat. During the last 5 years, in situ hybndizatton of the telomere sequence has been used for a vartety of studies (l-17). The integrity of the telomere as a structural and functional necessity for accurate chromosomal distribution during cell division has been supported by these studies. The centromere region of mammalian chromosomes is characterized by the presence of one or more satellite DNA famihes. The type and amount of repetitive DNA varies not only among chromosomes, but can also vary between homologs. In situ hybridization is a useful technique for mapping the chromosomal location of repetitive sequences in the pericentromenc regions of chromosomes and for visual analysis of polymorphrsms of these repeats. Chromosome-specific synthetic oligomer probes of alphoid DNA sequences are useful tools for clinical studies of aneuploidy, partrcularly for quantitatlon of chromosomes m interphase nuclei and analysis of marker chromosomes (18,19). Hybridization of synthetic probes of satellite DNA sequences are also being used as part of multrdisciplinary studies of the primary constriction or presumed functional centromere (20,21). Elucidation of the organization of the From Edited
Methods m Molecular Bology, Vol 33 In SIIU Hybrrdnatron Proloco/s by K H A Choo Copyright Q 1994 Humana Press Inc , Totowa, NJ
63
64
Meyne
and Moyzis
various repetitive sequences at or near the centromere may assist our understanding of this apparently complex structure. Synthetic oligomers are relatively small, single-stranded DNA probes, usually less than 50 nucleotldes in length (18-24). Synthetic DNA offers several advantages as probes for in situ hybridization of repetltlve DNA sequences. The exact sequence of the probe is known and controlled. Synthetic ohgomers can be constructed to specifications that: reproduce all or a segment of the sequence from any cloned repetitive DNA probe (18,19), reproduce all or a segment of a consensus sequence of a repeat family (20-24), or reproduce any modification of any sequence. The small size allows good penetration of the probe during the hybridization procedure. This is especially important for studies requiring analysis of interphase nuclei. Smgle-stranded probes do not selfanneal during hybridization, so not only can the probe concentration be easily controlled, but high concentrations of probe can be used without significant increases of background. Oligomers are readily available and a single synthesis will provide enough probe for several years of average laboratory use. Because they are very short, controlled sequence probes and the target DNA is abundant, synthetic ollgomers of repetitive sequences renature very rapidly during hybndizatlon. Thus, dextran sulfate or a similar hybridization enhancmg agent is not necessary m the hybrldlzation mix. Hybrldlzation time can be reduced to 3-5 h for many of the satellite sequences. On the other hand, hybndizmg for the more standard 16 h of most overnight mcubatlon procedures does not cause adetectable increase m nonspecific background. The probe contains only the sequence of interest, so there 1s no need for blocking with competitor DNA. The length restrictions for oligomer synthesis limit their usefulness as probes for single copy sequences. With the increased use of primed in situ labeling (PRINS) (25,26) and similar methods, however, the usage of synthetic ohgomers will become more common, especially as primers for the new methodologies. The Information presented here has been designed for synthetlc oligomers of repetitive sequences. The general prmclples, however, are apphcable to any type of hybrldlzatlon procedure usmg synthetic ohgomers.
2. Materials 1 Labeled telomere probes. These are synthesized as two separate 42-nucleotide oligomers having the sequences (GGGTTA)7 and (TAACCC)7 Oligomers can be prepared for Internal labelmg during automated synthesis (24). We prefer to enzymatically label ollgomer probes by tailing with a biotm-, digoxigenm-, or fluorochrome-labeled nucleotide using terminal deoxynucleotidyl transferase This enzyme can be purchased in kit form from a variety of sources. (See Notes 1,2, and 3.) 2. Labeled alphoid DNA centromerlc probes The 30-nucleotlde ohgomer sequence S-GTTTTGAAAC ACTCTTTTTG TAGAATCTGC-3’ hybridizes to the centromeric regions of all human chromosomes (23). Examples of alphold DNA
Synthetic Oligomers as Probes
3.
4.
9
10
11.
65
synthetic oligomer probes that are specific for the centromeric regrons of individual chromosomes are the 42-nucleotide oligomer specific for the centromeric region of chromosome 17,5’-CATTCAAATC CCCGAGTTGA ACTTTCCTTT CAAAGTTCAC GT-3’ (18), the 42-nucleotide oligomer specific for the centromerit region of chromosome X, 5’-GACGATGGAG TTAACTCAGG GAGCTGAACA TTCGTTATGA TG-3’ (19); and the 30-nucleotide ohgomer specific for the centromeric region of chromosome 18, 5’-GTACTCACAC TAAGAGAATT GAACCACCGT-3’ (27). Because alphoid DNA 1s present m long tandem arrays in all human chromosomes, only a single-strand of these repeats is necessary for strong hybrrdtzatron signals. These olrgomers are labeled as described for the telomere probes above Labeled human satellite simple sequence repeats. The 5-nucleotide simple sequence repeat common to human satellites 2 and 3 (22,281 is synthesrzed as (CCATT)4 or (AATGG)4. We prefer using the C strand, as the thermal stability of the G strand indrcates tt can form foldbacks or other complexes (21). The consensus sequence satellite 1 simple sequence probe 1s synthesized as a 42nucleotide probe, 5’-ACATAAAATA TCAAAGTACA CAAAATATAT ATTATATACT GT-3’. These repeats each identify specific subsets of centromerit regions within the human karyotype. These ohgomers are labeled as described for the telomere probes above. Metaphase chromosome or interphase cell slide preparations Metaphase spreads are prepared using standard protocols for hypotonic swelling and fixation m methanol-acetic acid fixative. Interphase cells can be prepared by fixation m solution or by growing the cells dtrectly on microscope slides or coverslips and fixing them in situ using the same procedures as for other types of probes Coverslips Standard #l glass coverslips and plastic coverslips The latter can be cut from autoclave bags or other suitable flexible plastic (see Note 4) Coplin jars with covers. Standard size for 3 x 1 m. microscope slides or, if hybridizing to cells grown directly on coverslips, the appropriate size for the coverslips used (see Note 5). Water bath(s) One water bath 1ssufficient, but two or three are far more convenient. The temperatures used are 70 and 42°C (see Note 6). 20X SSC, 2X SSC. Make 1 L of stock solution of 20X SSC (1X = 0 15Msodmm chloride and 0.015M sodmm citrate) and adjust the pH to 7. Set aside an ahquot of 50-100 mL of this solution for making hybrid mix and denaturing solutton. The rest is used as a stock for makmg up the 2X SSC to be used for making the RNase solutron and for washing slides. 1 mg/mL RNase in 2X SSC Incubate at 100°C for 10 mm to mactivate any DNase present. Cool and store at 4’C for dilution as needed. Make a working solution of 100 mg/mL m 2X SSC and store at 4°C. This solution 1s very stable and can be used for several months. Formamide. The formamide must be suitable for nucleic acid hybridization. Most catalogues will specify the grades available Store at 4°C for use within 3 mo and at -2O’C for longer term storage. Using lower grade formamide will not be worth the savings. 70% formamide in 2X SSC* 5 mL 20X SSC, 10 mL HzO, 35 mL formamide.
66
Meyne
and Moyzis
12 Carrier E. coli DNA (see Note 7) Dissolve E. coli DNA in sterile water at 5 mg/mL and shear by sonicatron If sizing gel technology is not available to check the fragment length after shearing, simply somcateuntil the solution is the consistency of water when inverted. If sizing gels are available, sonicate to
3. Methods 3.1. Hybridization 1. Select a slide with a generousnumber of metaphasesand a mmimum amount of cytoplasm around the chromosomes(seeNote 8). 2. Apply 100-200 mL of RNase (100 pg/mL m 2X SSC) to each slide and cover with a large coverslip, e g., 24 x 60 mm (seeNote 9) 3 Place slides m a moist chamber at 37°C for about 1 h 4 Wash the slides m four changes of about 2 min each m 2X SSC at room temperature. 5 Dehydrate through an ethanol series(70, 85, and 100%)
Synthetic
Oligomers
as Probes
67
6. Either air dry or dry with an au jet. 7 Prepare the hybridization mixture. For most ohgomers the following mixture will provide an adequate balance of specific hybridization and good signal detection (see Note 10). Final Cone Reagent 9 uL of formamide (DNA grade) 30% 2x 3 uL of 20x ssc 13 uL of water 500ug/mL 3 uL of E colt DNA 0.4 ug/mL 2 uL of probeDNA 30 uL of total mix perslidefor a 22 x 50 mmcoverslip 8 Heat the hybridization mixture at 70°C for 5 min to denature the DNA and then cool quickly in an ice bath (see Note 11). 9. Denature the chromosomalDNA by immersing the slides(preferably prewarmed at 70°C for l-2 mm) in a Coplm jar containing a solution of 70% formamide m 2X SSC for 2 min at 70°C (seeNote 12). 10 Transfer immediately to a Coplin jar of chilled 70% ethanol in an ice bath for at least 2 min, with periodic agitation. 11 Continue the dehydration with an ethanol seriesat room temperature and air dry (see Note 13) 12. Place the hybridization mixture on the slidesand cover with a 22 x 50 mm glass coverslip 13. Seal the coverslip with rubber cement and place in a moist chamber at 37°C for 3-18 h (see Notes 14 and 15). 14 After hybridization, peel off the rubber cement and remove the coverslip, either by gently lifting rt off (without scratching the slide) or by soaking it off in the first wash step. 15. Wash the slides in three changesof lo-30% formamide in 2X SSC for 3 mm each and then five changesof 2X SSC for 2 min each, all at 40-42”C. Gently agitate the slidesperiodically during each of the wash steps(see Note 16). 16 See Notes 17-19 for discussionson hybridization using synthetic oligomers of the human telomere and centromeric sequence.
of Hybridization Site The following detection procedure IS a fluorescent method using FITClabeled avldin. 3.2. Detection
1. After the final posthybridrzation wash, transfer the slides to BTS buffer (or the buffer being used for the detection system of your choice; seeNote 20). Do not allow the slides to dry out at any time during this procedure. 2. Drain the excessBTS buffer from the slide and apply 75 pL of 5% BSA in BTS buffer. 3. Mount with a plastic coverslip cut from an autoclave bag. 4. Incubate the slide for 5 mm at room temperature. 5. Peel off the coverslip and shakeoff the excess solutron 6. Add 75 pL of avrdin (3 pL/mL) in 5% BSA in BTS buffer
Meyne
and Moyzis
7. Reapply the cover&p and mcubate the slide m a moist chamber for 30-60 min at 37°C. 8. Remove the coverslip. 9. Wash in three changes of BTS buffer at 40-42’C for 2 mm each Agitate periodically during each wash 10 Transfer to a fresh solution of BTS buffer at room temperature (At thts point one can view the slrdes or continue directly with the amplification step For most probes and most protocols, you ~111 want to go straight to the amphfrcation.) 11 Drain the excess BTS buffer and apply 75 pL of 5% goat serum in BTS buffer 12 Incubate for 5 min at room temperature. 13. Peel off the coverslip and shake off the excess solution 14. Add 75 pL of anti-avidin antibody (5 pg/mL) m 5% goat serum in BTS buffer 15 Reapply the coverslip and incubate m a moist chamber for 30-60 mm at 37°C. 16 Remove the coverslip and wash in three changes of BTS buffer at 40-42”C for 2 mm each Agitate the slides penodtcally durmg each wash 17. Transfer to BTS buffer at room temperature. 18. Add another layer of avidm by repeating steps 2-10 19 The slides are now ready for viewing, although they can be stored m BTS buffer at 4°C for several days at this point. When ready to view the slides, drain the excess buffer, add a drop of antifade containing PI and DAPI, and mount wtth a coverslip (see Note 2 1) 20 Vtew the slides through a fluorescence mtcroscope with the appropriate filter sets (see Note 22).
4. Notes 1 The amount of DNA required for synthettc ohgomer probes IS much less than for native DNA preparations, such as plasmrds and cosmtds. 2. Nick translation is the labeling method of choice for most double-stranded, native DNA probes, but this method will not work for single-stranded synthetic oligomer probes 3 Be careful not to confuse tailing and end-labelmg reactions or kits The former adds a tail several nucleotides long to the 3’ end of the ohgomer. The latter adds only one nucleotide to the ohgomer. The srgnal obtained after hybrrdization of a tailed probe will generally be much greater than that from an end-labeled probe. We have not had any problem with accessibility, spectficrty, reproducibility, or stability of hybridization using the tarled ohgomer repeat sequence probes 4 The object of the plastic coverslips is to have a soft pliable system that will not scratch the cytological material on the shde when it 1s removed and replaced during mcubatlon steps 5. The slides or coverslips will each be handled many ttmes during the procedure, so optimal-size jars for the type of preparation used are a wise investment. 6. The temperatures gtven are those of the soluttons instde the Coplm jars. The temperature of the water m the bath must be adjusted to maintain these temperatures, usually 2-3°C above the temperature needed for the incubation solution A circulating water bath is best for the 70°C steps, and a reciprocating or shaker bath is helpful for the 42°C wash steps. If the only bath available for the 70°C steps ts one that 1s much larger than needed, try floating some Styrofoam packing
Synthetic
7.
8
9 10.
11
12 13
14 15 16.
Oligomers
as Probes
69
“peanuts” or similar material on the surface of the water between the edges of the water bath and the Coplin jar to cut down on evaporation while preheating the bath. The rule of thumb is to not use a carrier DNA from a species that contains the sequence being hybridized. If carrier DNA is not readily available, the hybridlzatron can be run without any carrier DNA. We prefer to use E. coli DNA because it does not have any of the common repetitive DNA sequences found m the genomes of the vertebrate specres studied in our lab. This is partrcularly important for the telomere probe (see Note 17) Other carriers, such as salmon sperm or herring sperm DNA, are suitable for hybridizations of most human satellite DNA sequences. Slides seem to be best a few days to one month after being made. A l-4 h incubatron m a 55-6YC oven may be useful in some climates or for very fresh slides Slide storage is a matter of what works m your lab. The systems range from -20°C storage in ordinary shde boxes to -70°C storage under nitrogen atmosphere. When slides will be used within 3-4 wk, we prefer to store them at room temperature For longer storage we keep the slides m boxes at -70°C The RNase step can be omitted for most satellite DNA oligomer hybridizations rf the cell/metaphase preparations are relatively free of background cytoplasm. Some synthetic DNA probes constructed as all or part of a consensus sequence are best when hybridized at a lower stringency (10% formamide mrx; see also Note 18). A 10% formamide mix would contain 3 PL of formamide, 3 yL of 20X SSC, 19 uL of water, 3 yL of E toll DNA, and 2 PL of probe DNA Most of the ohgomer probes are single-stranded probes that should not require this denaturation step. We always use it, however, because rt will also remove any structures that may be formed wlthm the single strands themselves, e g , foldbacks A room temperature slide ~111lower the temperature of the solution m the Coplin jar l-2’C, so the temperature must be adjusted accordmgly if the slides are not prewarmed. Steps 7-11 should be coordinated so that neither the denatured slides nor the denatured hybridrzation solutions sit around for long periods of time This can be accomplished by preparing the 70% formamide solution and bringing it to temperature while preparing the hybridization mix. When the formamide solution is ready, denature the slides The hybridization mix can then be denatured and chilled while the slides are going through the ethanol series Sealing the coverslip does not have to be tidy, just effective We prefer to use a syringe or disposable plastic transfer pipet to control the flow Overnight mcubations are the most convenient and are acceptable for most probes Many repetitive probes, however, will hybridize m just a few hours The concentration of formamide used for the wash should be the same as used for hybridization Most hybridization procedures require these wash steps for reduction of nontarget site hybridization, but the formamide washes can be deleted when using oligomer probes. The benefit of these washes is often mmlmal and does not justify the expense Alternatively, one can reuse the formamide wash solutions for several runs by storing them at 4’C between runs. All other wash solutions should be fresh for each run.
70
Meyne
and Moyzis
Fig. 1. Human lymphocyte metaphase chromosomes hybridized with a synthetic oligomer probe for the telomeric repeat.
17. Telomeric sequences. Any of several types of telomere probe can be used, including synthetic oligomers, plasmid clones, and PCR-labeled probes. We prefer using synthetic oligomers for in situ hybridization (Fig. 1). The standard method in our laboratory is to synthesize both strands as 42-nucleotide oligomers having the sequence (GGGTTA)7 and (TAACCC)T, respectively. Each oligomer is labeled separately using terminal deoxynucleotidyl transferase tailing of either biotin11-dCTP or digoxigenin- 11 -dUTP (I). The strands are stored separately and are not mixed together until added to hybridization mix that has been precooled to 4°C. This prevents the two strands from forming large concatenates in solution. It is also important to rapidly cool the probe immediately after denaturation. The telomere repeat is only 6 nucleotides long, so the renaturation kinetics favor rapid hybridization. If the hybridization mix is not handled carefully, the two strands can hybridize in solution before they reach the denatured chromosomal DNA on the microscope slide. Because most, if not all, vertebrate species have the same telomere sequence, it is best to use E. coli DNA as the carrier DNA in the hybridization mix. After the slides have been denatured, dehydrated, and air dried, they may be treated with proteinase-K to improve penetration of the telomere probe. This is not necessary for most slides, but for some slides (especially human tissue culture preparations) results may be improved by this treatment. Most human chromosome preparations hybridized with synthetic oligomer telomere probes demonstrate definite improvement in fluorescence signal after use of mild proteinase-K digestion. Of the other lOO-plus vertebrate species we used for hybridization of the telomere probe, only 2-3 have required proteinase-K treatment. We use 0.6
Synthetic Oligomers as Probes
18.
19.
20.
21.
22
71
pg/mL of proteinase-K in 20 mM Tns-HCl, 2 mM calcium chloride, pH 7.5, for l-10 min at 40-42”C. The slides are then rinsed once in the Tris buffer, dehydrated with an ethanol series, and air dried before the hybridization solution is placed on the slides. Lymphocyte preparations usually are best after l-2 mm and fibroblast preparations usually require 3-5 mm. Tissue samples or squash preparations may require 10 mm or more of treatment. The proteinase-K step can be run at 37-5O”C, but for convenience we use the same 42°C water bath as for the hybridization washes. The times and/or concentration of proteinase-K will have to be varied if the temperature is changed. If the chromosomes look “washedout” or ragged after a hybridization procedure including protemase-K, the treatment was too harsh. Reduce either the time or the enzyme concentration Conserved centromeric sequences. An ohgomer synthesized with the sequence of a highly conserved segment of the consensus sequence for a repetitive DNA family can be an effective probe for mapping the chromosomal distribution of the repeat family (23). The conserved regions are usually clearly identified in published descripttons of consensus sequences. This type of probe takes advantage of the concept of a consensus sequence, which is an average of many known sequences of a repetitive DNA family. In this case the hybridization mixture would be modified to allow hybridization of repeats with lower homology, so all or most of the variants of the repeat family can serve as templates for hybridization The easiest modtficatton is to reduce the hybridization stringency by using a lower concentration of formamide (see Note 10). The first alpha satelhte probe shown in Section 2, item 2 and the simple satellite sequences shown m Section 2, item 3 are probes of this type. Diverged centromeric sequences. An oligomer synthesized with the sequence of a very divergent sequence, as compared with the consensus sequence for the repetitive DNA family, is used for hybridization to specific centromeric regions (18) No special computer programs are needed. Simply line up the sequence from a chromosome-specific recombinant DNA insert and the consensus sequence for the repeat family. Direct comparison will identify the regions of divergence from the average. Not all divergent regions will demonstrate chromosome-specificity. The chromosome specific alphoid probes shown in Section 2, item 2 are examples of this type of probe (Fig. 2). The procedure is not limited to alphoid probes Based on existing data, however, there are more chromosome-specific sequences m the alphotd family than for other repetitive DNA famihes. There are many published options for the detection procedure Most of these variations yield similar results, so use the variation most suited to your laboratory. The BTS method is given here as an example because it was one of the first methods used for detection of biotmylated probes. The amount of counterstain used depends on each batch of stain and how well it stores, as well as the brightness of the hybridization signal. The average amounts for a brightly fluorescent probe signal are 0.5 pg/mL of PI and 0 06 pg/mL for DAPI. Almost any type of fluorescence microscope will be adequate for viewing the signal generated by fluorescence detection/amplification methods, but the qual-
Meyne and Moyzis
72
Fig. 2. Human lymphocyte metaphase chromosomes hybridized with a synthetic oligomer of an alpha satellite DNA sequence specific for chromosome 18.
ity of photographs will directly reflect the quality of the microscope and camera. An epifluorescence microscope system is preferred by most investigators. The microscope should be equipped with a blue filter for viewing the FITC signal. Most blue filter sets will also allow detection of the PI counterstain. It is also helpful to have an ultraviolet filter set for screening slides. The DAPI stain is useful for finding metaphases under low power before switching to the blue filter to view the hybridization sites (yellow-green FITC fluorescence) on the chromosomes counterstained red by the PI. Standard films with an IS0 of about 400 are suitable for photography of fluorescence signals generated by the method described above. If the concentration of a counterstain is too high or too low, the coverslips can be removed, and the slides washed in fresh BTS buffer and remounted with a new stain concentration. Mounted slides can be kept at 4°C for at least 2 wk without loss of fluorescence intensity.
References 1. Moyzis, R. K., Buckingham, J. M., Cram, L. S., Dani, M., Deaven, L. L., Jones, M. D., Meyne, J., Ratliff, R. L., and Wu, J. R. (1988) A highly conserved repetitive DNA sequence (ITAGGG),, present at the telomeres of human chromosomes. Proc. N&l. Acud. Sci. USA 85,6622-6626.
2. Moyzis, R. K. (1991)The humantelomere.Sci. Am. 265,48-X 3. Wurster-Hill, D. H., Ward, 0. G., Davis, B. H., Moyzis, R. K., and Meyne, J. (1988) Fragile sites,telomericDNA sequences, B chromosomes and DNA content in raccoon dogs,Nyctereutesprocyonoides,with comparativenoteson foxes, coyote, wolf and raccoon. Cytogenet. Cell Genet. 49,278-28 1. 4. Cornforth, M. N., Meyne, J., Littlefield, L. G., Bailey, S. M., andMoyzis, R. K. (1989) Telomerestainingof humanchromosomes andthe mechanisms of radiation-induceddicentric formation.Rud. Res. 120,205-212.
Synthetic Oligomers as Probes
73
5 Meyne, .I., Baker, R J., Hobart, H. H., Hsu, T C., Ryder, 0 A , Ward, 0. G , Wiley, J. E , Wurster-Hill, D. H , Yates T. L , and Moyz~s, R K (1990) Distribution of non-telomerm sites of the (TTAGGG), telomere sequence m vertebrate chromosomes. Chromosoma 99, 3-10 6 Lin, C C., Meyne, I., Sast, R , and Moyz~s, R K. (1990) Apparent lack of telomere sequences on doubleminutechromosomesCancer Genet Cytogenet 48,27 l-274. 7 Lin, C. C , Meyne, J , Sasi,R , Bowen,T., Unger,T , Tamaka,T , Hadro,T. A , andHoo, J J. (1990) Determmmgthe originsand structuralaberrationof smallmarkerchromosomesm two casesof 45, X/46, X, +M by use of sex chromosomespecific DNA sequences.Am J. Med Genet 37,71-78 8 Meyne, J , Ratliff, R L , Buckingham,J M , Jones,M D , Wilson, J S , andMoyzrs, R K. (1990)The humantelomere,m Chromosomes Today, vol 10 (Fredga,K , Klhlman,B. A., andBennet,M. D , eds.),Unwin Hyman, London,pp 75-80. 9 Scherthan,H. (1990) Localization of the repetitive telomericsequence(‘ITAGGG), m two muntJacspecresand rmphcatronsfor then karyotyprc evolution Cytogenet Cell Genet 53, 115-l 17. 10 Praznovszky,T , Kereso,J., Tubak, V , Cserpan,I , Fatyol, K., andHadlaczky, G (1991) De novo chromosomeformation in rodent cells Proc. Nut1 Acad SCL USA 88, 11,042-l 1,046. 11 Bilha, F andDe Born,U (1991)Localizationof centromericsatelliteandtelomericDNA sequencesm dorsalroot ganglion neurons,in vitro. J Cell Scr 100, 219-226. 12 Miller, B. M., Werner, T , Weler, H -Il., and Nusse,M (1992) Analysis of radtatroninducedmrcronucletby fluorescencem situ hybrrdrzatron(FISH) srmultaneouslyusing telomerrcandcentromericDNA probesRad Res 131, 177-185 13 IJdo,J W., Wells, R A , Baldmi,A , andReeders,S T (1991)Improvedtelomeredetection usinga telomererepeatprobe(‘ITAGGG), generatedby PCR NucletcAcids Res 19,478O.
14 Wiley, J E, Meyne, J., Little, M L , andStout,J C (1992)lntersttttal hybridization sites of the (TI’AGGG), telomermsequenceon the chromosomes of someNorth American Hyhd frogs. Cytogenet. Cell Genet 61,55-57. 15 Ray, F A , Meyne, J., andKraemer,P. M (1992)SV40T-antigenInducedchromosomal changesreflect a processthat is both clastogenicand aneuplotdogemc and is ongoing throughoutneoplasticprogressionof humanftbroblasts.Mutut. Res. 284,265-273 16 Park, V M , Gustashaw,K M , and Wathen,T M (1992)The presenceof interstitial telomericsequences m constitutionalchromosome abnormalities. Am. J. Hum Genet. 50, 914-923. 17. Schubert,I., Schriever-Schwemmer, G , Werner, T., and Adler, I -D. (1992) Telomertc signalsin Robertsonianfusion and fissionchromosomesimplicationsfor the origin of pseudoaneuploidyCytogenet Cell Genet 59,6-9 18. Meyne, J. andMoyzis, R K. (1989)Humanchromosome-specific repetitive DNA probes targetingm situ hybridization to chromosome17with a 42 basepan alphoidDNA ohgomer. Genomlcs 4,472-478 19. Lm, C. C., Meyne,J , Sass,R , Bowen,P., Unger,T., Tainaka,T , Hadro,T., andHoo, J. J (1990)Determmmgtheongmsandstructuralaberrationof smallmarkerchromosomes m two casesof 45, X/46, X, +M by useof sexchromosome specificDNA sequences. Am J Med Genet. 37,71-78
20. Zmkowski,R. P., Meyne, J , andBrinkley, B R (1991)Thecentromere-kmetochore complex: a repeatsubunitmodel J Cell 3101. 113, 1091-l 110 21 Grady, D L., Ratliff, R L , Robinson,D L , McCanhes,E C , Meyne, J , andMoyz~s,R K , (1992)Highly conservedrepetitiveDNA sequences arepresentat humancentromeres Proc Natl. Acad See. USA 89,1695-1699
Meyne
and Moyzis
22 Moyz~s, R K., Torney, D , Meyne, J , Buckmgham, J. M , Wu, J R , Burks, C , Srrotkm, K. M , and Goad, W B (1989) The dtstrtbution of mterspersed repetrtrve DNA sequences m the human genome. Genomics 4,273-289. 23 Meyne, J , Littlefreld, L G , and Moyzis, R. K. (1989) Labehng of human centromeres usmg an alphoid DNA concensus sequence apphcatron to the scoring of chromosome aberrations. Mutat. Res. 226,75-79. 24 Matera, A. G and Ward, D C (1992) Ohgonucleottde probes for the analysis of spectftc repettttve DNA sequences by fluorescence rn situ hybridrzatron. Hum. Molec. Genet 1, 535-539
25. Koch, J E , Kolvraa, S , Petersen,K B , Gregersen,N , and Bolund, L. (1989) Ohgonucleotrde-primingmethodsfor thechromosome-specific labelhngof alphasatelliteDNA m situ. Chromosoma 98,259-265 26 Gosden,J., Hanratty, D., Starling, J., Fantes,J., Mitchell, A., and Porteous,D. (1991) Ohgonucleotide-pnmed msituDNA synthesis (PRINS) a methodfor chromosome mappmg, bandmg,andmvestrgatronof sequence orgamzatron.Cytogenet.Cell Genet 57, 100-104 27 Goodwin,E. H. andMeyne,J. (1993)Strand-specrftc FISH revealsorientationof chromosome18 alphordDNA Cytogenet.Cell Genet, m press 28 Prosser,J., Frommer,M , Paul, C., andVmcent, P. C (1986) Sequencerelatronshtpsof the three humansatelliteDNAs J Mol &ol 187, 145-155
CHAPTER 7
Mapping Human YAC Clones by Fluorescence In Situ Hybridization Using Ah-PCR from Single Yeast Colonies Antonio
Baldini
and Elizabeth
A. Lindsay
1. Introduction The yeast artificial chromosome (YAC) clomng system 1scapable of cloning large segments of DNA (50-2000 kb) from complex genomes (I). YAC genomic libraries have been constructed using DNA from human as well as other species and have been proven to be powerful tools for the analysis of the human genome. Chromosomal assignment of YAC clones can be assessedby different methods, for example, hybridization to somatic cell hybrid panels (2), polymerase chain reaction (2,3), and nonisotopic in situ hybridization (4-6). In situ hybndization can be performed using yeast genomic DNA containing the artiflclal chromosome. Owing to the relatively low content of human DNA, such a method usually leads to low hybridization efficiency. In practical terms, the number of metaphase spreads bearing a hybridization signal on both chromatids of both homologs may be as low as 5-10% (see ref. 7, and our unpublished results). This requires time-consummg analysis of a large number of mitoses. A much higher hybridization efficiency can be obtained by labeling gel-punfied YAC DNA (8). This procedure, however, is not smtable for mapping a large number of clones because it 1s lengthy, more expensive, and the DNA yield is low. To circumvent the problems inherent m these two methods, several research groups have proposed the use of Alu-PCR products from YACs as probes for fluorescence in situ hybridization (FISH) (4-6). Alu-PCR has been shown to amplify selectively human sequences from complex DNA sources, including yeast DNA contaming YAC clones (2,9). In this chapter we describe in detail a procedure for mappmg YACs by FISH using PCR products from a single yeast colony or agarose blocks. The method allows the chromosomal assignment of clones at a very early stage of their characterization. From Edlted
Methods m Molecular Bology, Vol 33 In Situ Hybrrdrrebon frofoco/s by K Ii A Choo CopyrIght Q 1994 Humana Press Inc , Totowa, NJ
75
Baldini
76
and Lindsay
2. Materials 2.1. Alu-PCR 1. Yeast colonies (contaming the YAC) on agar plate, or agarose block with yeast cells (prepared using standard methods). 2 Sterile toothpicks. 3 Lysis buffer: 1% Triton X-100, 20 mM Tris-HCl, pH 8.5,2mM EDTA 4. 10X dNTP mix: 2 mM each of dATP, dCTP, dGTP, and dTTP 5. 10X PCR buffer 15 mMMgC12, 100 mMTris-HCl, pH 8.3,500 mMKC1, 0 01% gelatm. 6. Thermus aquattcus (Tuq) DNA polymerase (AmphTaq, from Perkm-Elmer/ Cetus, Norwalk, CT). 7 Oligonucleotide primer AGK34 (sequence: S’GAGCCGAGATCG (C/T)GCCACTGCACTCCAGCCTGGG3’) deprotected, dried, and resuspended m water at a concentration of 50 ~IV 8 Light mineral oil. 9 Agarose. 10 Ethidmm bromide
2.2. Nonisotopic 1, 2 3 4. 5 6. 7. 8. 9
PCR products 10X NT buffer 0.5M Tris-HCl, pH 8, 50 mM MgCl,, 0.5 mg/mL BSA 10X Biotm mix* 0 5 mM each of dATP, dGTP, dCTP, and Blotin-l l-dUTP O.lM P-mercaptoethanol. 1 mg/mL stock DNase I. 10 U/pL DNA polymerase I from E cofi. TE* 50 mil4 Tns-HCl, pH 7 6,1 mM EDTA. Sephadex G-50. Hydrate and store m TE containing 0 1% SDS. Glass wool.
2.3. In Situ 1 2 3. 4. 5. 6 7 8
Hybridization
Chromosome preparation on microscope slides 50% w/v solutron of dextran sulfate in water, autoclaved Formamide. Deionized formamrde. 1 pg/pL sonicated salmon sperm DNA. 1 pg/pL human Cot-l DNA 3M Sodium acetate 20X SSC 3M NaCl, 0 3M sodium citrate, pH 7 0.
2.4. Posthybridization 1. 2. 3 4. 5. 6.
Labeling
Washing
and
Detection
Wash solution 1. 50% formamide, 2X SSC, heated at 42°C. Wash solution 2: 0.5 X SSC, heated at 6O’C. Wash solution 3. 4X SSC, 0 1% Tween-20, heated at 42’C Block buffer. 4X SSC, 3% BSA, 0 1% Tween-20. Detection buffer 4X SSC, 1% BSA, 0 1% Tween-20 DAPI solution’ 200 ng/mL in 2X SSC.
77
Single Colony PCR for YAC Mapping
---. 1
lysts buffer
Bolled
for
Pellet
cellular
-Single
yeast
colomes
1% Tnton Xl 00 20mM Tr1.s pH 8 5 2mM EDTA
10 mm
debris
by
centrlfugatlon
1 Supernatant
used
as template
1 PCR
reaction
using
a single
Alu-primer
1 Non-isotopic labellmg Nick translation
by
1 FISH
Fig. 1 Schematic representation of the procedure to obtain Alu-PCR probes suitable for FISH from single yeast colonies contaming human YAC clones. 7 Antifade mounting buffer: 200 mM DABCO, 90% (v/v) glycerol, 20 mM TrisHCl, pH 8 8 FITC-avldin and brotrnylated antiavidin antibody (Vector Laboratones, Burlmgame, CA).
3. Methods 3.1. Generation of PCR Products from a Single Yeast Colony (see Fig. 1) 1. Pick a colony from agar plate (under sterrle condlttons to avoid contammatlon of the plate). 2. Mix well in 20 pL of lysrs buffer. 3 Place in heat block set at 100°C (or in boiling water) for 10 min. 4 Spin in a microfuge for 10 min. 5. Without disturbing the pellet (cell debris), transfer the supernatant to a fresh tube The supernatant can be used immediately for the PCR reaction or stored at -2O’C.
Baldini
78
and Lindsay
6 In a OS-mL tube (suitable for a thermocycling
7
8
9 10. 11 12 13 14
machme) mrx m this order (total 50 pL). a. 33.2 l.tL H20; b 5 l.tL 10X PCR buffer, c 5 PL 10X PCR dNTPs mix; d 0 8 l.tL Tuq polymerase (SU&L); e. 1 l.tL Primer AGK (5Oj.tM stock); and f. 5 PL supernatant Overlay with a drop of light mineral 011. Run the followmg thermocycling: a 1 min at 94”C, b. 45 s at 55’C; c. 5 min at 68’C, and d Repeat 30 times. Run a ~-FL ahquot on a 1% agarose gel to check the products of amplification An example of such gel is shown in Fig 2 Note the large amount of RNA from the yeast cells (bottom of the gel). Precrpitate remainder of reactron m 10% 3M sodmm acetate and 3 vol of absolute ethanol mix, and incubate on dry ice for 15 mm or at -20°C overnight. Spin for 15 mm in a microfuge at 4°C. Discard the supernatant Add 500 l,tL of 70% ethanol (at -2O’C) Repeat steps 10 and 11 Dry and resuspend pellet in 10 pL distilled water Use half of this vol for each labelmg reaction
3.2. Generation
of Ah-PCR
Products
from
Agarose
Blocks
1 Wash agarose blocks containing YAC DNA separately three times m 10 mL TE, pH 8.0, at 5O’C for 10 mm. 2 Cut one-tenth of a block (equivalent to about 10 FL) with a blade or glass coverslip into a 1.5-mL tube Use a separate blade or coverslip for each block to prevent contamination of samples. 3 Add 90 pL of distilled water and melt the agarose block at 65°C for 5 min 4 Mix solution thoroughly. 5 Follow the PCR protocol described m Section 3 1. from step 6 onward, replacing the supernatant with 1 FL of the melted block and adJustmg the vol of drstilled water in the reaction mix (See Note 1 for problems associated wrth the A/u-PCR procedure )
3.3. Nonisotopic Labeling of Ah-PCR Products For a 50-pL reactlon, use the reagents listed in Section 2.2. as follows: 1 Mix on ice: a. 25 p.L distilled water; b 5 pL 10X NT buffer, c 5 pL 0.1 M P-mercaptoethanol, d 5 pL 0.5mM 10X biotm mix, and e 1 pL DNA polymerase I (total ~0141 pL) Multiply this vol according to the number of samples to be labeled.
Single Colony PCR for YAC Mapping
2.01.4l.lO.Q-
Fig. 2. Ethidium bromide-stained agarose gel showing Alu-PCR products from 10 yeast colonies containing different YACs. 5 pL (out of a 50-pL PCR reaction) were applied per lane. The first lane on the left contains 300 ng of the Lambda/Hi&III plus PhiX174IHueIII molecular weight marker (in kb). The intense smear at the bottom of the gel is the RNA contained in the yeast cells.
2. Add 41 pL of this mix to 1 pg DNA (in 5 l&L). 3. Immediately before use dilute 1 pL of stock DNase I (1 mg/mL) in 1 mL ice cold distilled water, mix thoroughly, and add 4 pL to the reaction mix. 4. Incubate reaction mix in a 15°C water bath for 2 h. (Prepare spin columns during this time; see step 7.) 5. Terminate the labeling reaction by incubating the reaction mix in a 65’C water bath for 5 min. 6. Add 4 pL of 0.5M EDTA, 1 pL of 10% SDS, and make vol up to 100 p,L with distilled water. 7. To prepare spin columns for the removal of unincorporated nucleotides, pack a small amount of glass wool into a I-mL syringe and fill with G50 Sephadex equilibrated in TE (pH 7.6). Spin at 900 rpm for 4 min, then rinse columns twice with 100 p.L TE (pH 7.6)/0.1% SDS. 8. After rinsing, apply labeled probe to the column and spin at 900 rpm for 4 min, collecting the reaction in a 1.5-mL tube. 9. Run a 1O+L aliquot of labeled probe on a 1% agarose gel with a PhiX 174IHaeIII marker. Probe size should be ~500 bp (optimum 200-300bp) (see Note 2).
Baldini
80
and Lindsay
3.4. In Situ Hybridization 3.4.1. Probe Denaturation 1 Preciprtate 20 FL of labeled DNA with 2 ltL human Cot-l DNA, 3 PL salmon sperm DNA, 2.5 lrL 3M sodium acetate, and 3 vol absolute ethanol. Leave on dry ice for 15 min or at -20°C overnight 2. Spin for 15 mm at 4T and allow pellet to dry. 3. Prepare hybridization mix (for 100 l.tL: mix 50 p,L of deionized formamide, 20 yL of dextran sulfate, 20 ltL of distilled water, and 10 ltL of 20X SSC). 4 Resuspend pellet in 10 l.t.L or 20 ltL of hybridization mix (for 22 x 22 mm or 24 x 50 mm coverslip). 5. Denature DNA mix at 80°C for 5 min, spin briefly to collect vapors. 6. Reanneal at 37°C for at least 15 mm. Leave at 37°C or place on ice until ready for use.
3.42.
Chromosome
Denaturation
1. Prewarm slides on a metal tray m a dry oven at 60°C 2 Prepare denaturing mix of 70% deionized formamide in 2X SSC (200 ltL per slide) 3 Pipet 200 l.tL of mix onto each slide and cover with 24 x 50 mm coverslip 4. Immediately put mto a dry oven at 80°C for 2 mm
Perform
steps 3 and 4 quickly,
as the denaturation
time is critical.
5. Dehydrate slides in 70,90, and 100% ethanol (5 mm each). Use 70% ethanol at -20°C (Standard grade mrcroscope slides will not break under these conditions.) 6. Air-dry
3.4.3. Hybridization 1 Warm slides to 37°C. 2. Pipet 10 or 20 p.L (see Section 3 4 1 , step 4) of denatured probe mix onto slide 3. Lower coverslip on top (try to avoid au bubbles as much as possrble) and when mix is evenly spread, seal edges of coverslip with rubber cement. 4. Incubate slides m a moist chamber at 37T overnight
3.4.4. Posthybridization Washes and Detection Do not allow slides to dry at any point during washing routine. 1. Remove coverslips 2. Wash three times for 5 mm each in wash solution 1 in a Coplin Jar m a shaking water bath 3. Wash three times for 5 min each in wash solution 2 4. Block using 200 ltL of blockmg buffer per slide. Apply large coverslip and mcubate in moist chamber at 37°C for 30 min 5. Detect with FITC-avldin by diluting stock solution 1:300 m detection buffer Use 200 ltL per slide Apply large coverslips and incubate m a motst chamber at 37T for 30 mm.
6. Wash three times for 5 mm each m wash solution 3 (keep 50 mL of this solution for final wash).
Single
Colony
PCR for YAC Mappmg
81
7. Amplification (optronal). Dilute a biotin-conjugated antiavidm antibody to a concentration of 2-4 I.tg/mL in detection buffer. Use 200 pL/slide Apply large coverslips and incubate in a moist chamber at 37°C for 30 mm. Wash as m step 6. Repeat step 5. Wash again as in step 6 and then go to step 8. 8. Counterstain with DAPI (200 ng/mL m 2X SSC) for 5 mm at room temperature. 9. Wash in 2X SSC, 0.05% Tween-20 for 2 mm at room temperature. 10 Mount slides using 24 x 50 mm coverslips and 30 yL of antrfade 11. Vrew under microscope (see Note 3). 12. Store slides at 4OC!in darkness. See Note 4 for troubleshooting.
4. Notes Problems arising from the in situ procedure may occur at various steps; thus it is important to check all the steps described in the protocol. In our laboratory, we have used this procedure to map several hundred YACs (see Fig. 3 for several examples; see also Note 5), and the successrate has been close to 100% using digital imaging systems. Some of the most common problems and ways to deal with them are detailed below. 1. Alu-PCR. Alu-poor YACs may fat1 to amplify or produce only a few amplified fragments. Alternative primers are available that have been used by other groups for FISH mapping of YACs (4,5). If no Alu-PCR products can be obtained, genomic yeast DNA can be labeled by nick translation (8) or, alternatively, YAC DNA can be purified by pulsed field gel elecrophoresis (PFGE) and the purified DNA labeled by nick translation (IO). It is our experience that FISH with AluPCR amplified YACs gives stronger signal than with nick translation of genomic yeast DNA. 2 DNA labeling. The nick-translation procedure should yield DNA fragments of 200-300 bp. High-molecular-weight fragments that remain after the labeling step may produce background that is not eliminated by suppression, and which may interfere with interpretation of FISH results. If high-molecular-weight fragments are found, it may be necessary to increase the amount of DNase I used and/or to increase the length of the DNase I incubation step 3 Fluorescence microscopy. We use a standard fluorescence microscope equipped with a 100 W mercury lamp and plan-neofluar objectives 63 and 100x A wide variety of filters is now available in the market (e g., from Chroma Technology, Brattleboro, VT) that can be mounted on virtually any brand-name microscope and are suitable for a number of different fluores and combinations of them. If using a regular photographic camera, dual or triple band-pass filters may be the best choice. However, these filters reduce the amount of light that reaches the
cameraand some low-intensity signalsmay not be detectable.High-speed color slide films are used successfully for FISH (e.g., Kodak HC400). The best results are obtained using digital imaging systems. We use a grayscale cool-CCD camera from Photometrics (Tucson, AZ) with sensor Kodak KAF 1400. The system offers the best sensitivity and very good resolutron; the dtsadvantages are its cost and the need to collect color-specific images (1 e , one image
Baldini
and Lindsay
Fig. 3. Partial metaphase spreads from FISH experiments using as probes (A-D) the PCh products shown in Fig. 2 (first four lanes from the left) after biotinylation, as described in Section 3.3. In B, hybridization is detected on two different chromosome pairs, indicating that the clone contains noncontiguous DNA segments.Chromosomes are counterstained with DAPI. Probe signals are indicated by a bar. Images wereobtained using a cool-CCD camera (seeNote 3); gray-scale images were pseudocolored and merged. for 4’,6-diamidin-2-phenylindol-dihydrochlorid (DAPI) and one image for fluoroscein isothiocyanate (FITC); these images are then pseudocolored and merged. It is important in these systems to obtain images in registration in order to position exactly the probe signal on the chromosome image. We use a triple bandpass emission/beam splitter filter set with separate exciters (specific for DAPI, FITC, and rhodamine), which are moved by a filter wheel located near the arc lamp. In this way there is no movement of filters between the sample and the camera, and images collected in sequence for DAPI, FITC, or rhodamine can be considered in perfect registration for this application. 4. In situ hybridization. The two main problems associated with this step are poor signal and high background. When no signal is seen, the first step is to increase the amount of DNA used in the hybridization reaction. If there is a visible but weak signal, this may be increased by an amplification step prior to counterstaining (see Section 3.4.4.).
Single Colony PCR for YAC Mapping Background usually comes in one of two forms. The first is background caused by inadequate Ah suppression. This IS easily recognized as it results in a characteristic banding pattern of the chromosomes. It can be eliminated by increasing the amount of Cot-l in the hybridization reaction but, as Cot-l may also reduce the probe slgnal intensity, oversuppression should be avoided. A more generalized background, which does not have this characteristic appearance, 1s likely to be caused by the presence of high-molecular-weight DNA fragments or inadequate probe purification. The best way to deal with this is by careful probe preparation and labeling prior to tn situ hybridization If background signal continues to be a problem, it may be necessary to increase the stringency of the hybridization step (by increasing the proportion of formamide in the probe denaturing step) or of the posthybrldlzation washes. 5 Chimerism detection. It has been suggested that FISH be used for chlmerism detection. At this point, the ability and efficiency of FISH to detect chimeras is not certain. Using the procedure described, we found that 30% of the YACs examined were chimeric (an example is shown m Fig. 3) However, this may be an underestimation of the true figure because, if the chimerlc portion of a clone is small, the resultant signal may fall below the limit of detection. Also, Alu-PCR selectively amplifies DNA sequences and may fall to amplify a chimeric sequence within a YAC. We think that because of its speed, FISH is a convenient way to detect chimeras, but its efficiency is likely to be low if the noncontiguous DNA segment is small.
Acknowledgments This work was supported m part by the Baylor Human Genome Center grant HG00210 and by the Keck Center for Computational Biology.
References 1. Burke, D T., Carle, G. F , and Olson, M V. (1987) Clonmg of large DNA segments of exgenous DNA into yeast by means of artificial chromosome vectors Scrence236,806812 2 Nelson, D L , Ballablo, A, Victoria, M. F , Pierettl, M., Bles, R. D , Gibbs, R A , Maley, J. A., Chinault, A. C , Webster, T. D , and Caskey, C. T (1991) Alu-primed polymerase
3 4 5 6
cham reaction for regional assignment of 110 yeast artificial chromosome clones from the human X chromosome ldentiflcation of clones associated with a disease locus, Proc Natl. Acad. Scl USA 88,6157-6161 Green, E D and Olson,M V (1990) Systematicscreeningof yeast artificial-chromosomehbrariesby useof the polymerasechain reaction.Proc. Nat1 Acad. Scr USA 87, 1213-1217 Lengauer,C , Green,E D , andCremer,T (1992) Fluorescence II?sttu hybridization of YAC clonesafter Alu-PCR amphficatlon.Genomlcs13, 826-828 Breen,M , Arveiler, B , Murray, I., Gosden,J R , andPorteus,D J (1992)YAC mappmg by FISH usingAlu-PCR-generatedprobes.Genomlcs13,726-730 Baldml, A., Ross,M , Nizetlc, D , Vatcheva, R , Lindsay, E A , Lehrach, H , and
Siniscalco, M. (1992) Chromosomal assignment of human YAC clones by fluorescence in sllu hybrrdization: useof smgle-yeast-colony PCR and multiple labeling Genomtcs 14, 181-184
Baldini
and Lindsay
7. Wada, M., Little, R D., Abtdt, F , Porta, G , Labella, T , Cooper, T., Della Valle, G , D’Urso, M , and Schlessmger, D. (1990) Human Xq24-Xq28 approaches to mappmg wtth yeast artrftctal chromosomes Am. J Hum. Genet. 46,95-106 8. Montanaro, V , Casamassimr, A, D’Urso, M., Yoon, J -Y , FretJe, D , Schlessmger, D , Muenke, M., Nussbaum, R. L., Saccone, S., Maugert, S , Santoro, A M., Motta, S , and Della Valle, G (1991) In situ hybridrzatron to cytogenetic bands of artiftcral chromosomes covering 50% of human Xq24-Xq28 DNA. Am. J. Hum. Genet. 48, 183-194. 9, Nelson, D. L , Ledbetter, S. A , Corbo, L , Vtctoria, M F , Ramirez-Sohs, R , Webster, T D., Ledbetter, D H , and Caskey, C. T (1989) Alu polymerase cham reactton a method for rapid isolatton of human-spectfic sequences from complex DNA sources Proc Natf Acad Scr USA 86,6686-6690 10. Sellen, C , Eubanks, J H., Gtovannnu, M., Hermanson, G. G , Romo, A , DJabah, M , Maurer, S , McElligott, Smith M W., and Evans, G. A (1992) Detection and characterization of chimerrc Yeast Arttftctal Chromosome clones by fluorescent in srtu suppressron hybrrdtzation Genomtcs 14,536-541
CHAPTER 8
FISH of Ah-PCR-Amplified and Applications in Tumor Christoph
YAC Clones Cytogenetics
Lengauer, Michael R. Speicher, and Thomas Cremer
1. Introduction Yeast artificial chromosomes (YACs) (I) containing human inserts of up to 1 megabase (Mb) length have been mapped by fluorescence in situ hybridrzation (FISH) (for review see ref. 2). If total yeast clone DNA is used as a probe, an excess of yeast DNA (approx 98%) is labeled m addition to the human sequences (approx 2%). This excess labeling not only leads to wastage of expensive labeling reagents, but contributes to background in in situ hybridization experiments. The hybridization efficiency 1soften less than satisfactory in metaphase spreads, whereas signals in Interphase nuclei generally cannot be evaluated. Cutting out the YAC band from a pulsed-field gel and purification of the DNA is time-consummg and yields only rather limited amounts of a probe. To overcome these problems an Alu-PCR approach (3) has been optimized for the selective generation of human DNA sequences from YAC-containing yeast strains with complexities sufficient for FISH experiments (4). Two ohgonucleotide primers, termed CL1 and CL2, have been established, which bind to the highly conserved 5’ and the 3’ ends of the approx 300-bp long, mterspersed Alu repeat DNA block ($5). Provided that the distance between two adjacent Alu blocks does not exceed a few kilobases (kb), this primer pair allows the amplification of DNA sequences located between any two ALUblocks independent of their orientation. Using this approach, we have tested more than 150 YAC clones containing some 100 kb up to 1 Mb of human inserts from various regions of the human genome, including both R- and G-bands. The large majority of these clones yielded specific, fluorescent signals both m metaphase spreads and interphase nuclei. Signal intensities are generally comparable with those observed using chromosome-specific repetitive DNA probes and can easily be detected using standard fluorescence microscopy. This approach factlitates the rapid mapping of YAC clones and is ideally suited for chromosome analysis at all stages of the cell cycle, e.g., in tumor cytogenetics (6) (see Notes 1 and 2). From Edlted
Methods m Molecular Btology, Vol 33 In SW Hybrrdrzatron Protocols by K H A Choo Copyrlght Q 1994 Humana Press Inc , Totowa, NJ
85
86
Lengauer, Speicher, and Cremer 2. Materials
1 For Alu-PCR, YAC DNA may be prepared by three different methods: a. Purified high-molecular-weight genomic yeast clone DNA (100 ng) This DNA is prepared as described by Green and Olson (7). b Agarose plugs containing yeast cell DNA with the YAC of interest. For the growth of yeast strains and the preparation of chromosome-sized DNA m agarose for pulsed-field gel electrophoresis, the protocols published by Brownstein et al. and Burke et al. are used (1,8) Low-melting-point agarose (ultrapure) purchased from Gibco-BRL/Life Technologies (Gaithersburg, MD) is recommended for plug preparation Note that agarose plugs are stored routinely in EDTA (OSM) at 4°C. However, since the presence of EDTA inhibits Taq polymerase and affects the Mg2+ concentrations, which are critical for primer specificity, EDTA should be carefully avoided in PCR assays. Plugs are therefore washed two times for 30 min each in 1M Tris-HCl, pH 8 0, and equilibrated in PCR-buffer (10 nuI4 Tris-HCl, pH 8.4, 50 mM KCl, 1.5 mM MgC12, 0 001% gelatin) for 30 mm at room temperature. Plugs are further equilibrated overnight m fresh PCR-buffer at 4’C After melting of the plug for 5 min at 75’C, approx 150 ng of genomrc yeast cell DNA is added to the Alu-PCR assay. Melted plug material can be stored at 4°C and reused for several months. c. For rapid testing, a very small amount of yeast cells (barely vrsible on a sterile pipet tip or a toothpick) can be picked directly from clones grown on plates or filters. The cells are diluted in 1 5 mL of distilled water, and aliquots of up to 20 pL are added to the PCR assay without any further treatment. This approach, however, provides less reproducible amplifrcatron yields than methods a and b. 2. Disposable gloves 3. Set of microliter pipets (e g., Gilson). 4 1.5-mL Eppendorf tubes with screw caps. 5. 10X PCR-buffer: 100 mMTris-HCI, pH 8 4,500 mM KCl, 15 mM MgC12, 0.01% gelatin. The buffer 1s stable for at least 3 mo at -20°C. 6. dNTP-mix. Stock solution containing all four dNTPs at a concentration of 25 nuI4 IS prepared from nucleotides (lOO-mA4 solutions) purchased from Boehringer Mannheim (Mannheim, Germany) and stored at -20°C for several weeks. 7. Thermus aquaticus DNA polymerase (Native Taq; Perkin-Elmer/Cetus, Norwalk, CT) 8 Oligonucleotide primers CL1 (5’ TCC CAA AGT GCT GGG ATT ACA G 3’) and CL2 (5’ CTG CAC TCC AGC CTG GG 3’) primers are dissolved in a vol sufficient to yield a 25-w solution, and stored at -20°C 9. Paraffin or1 (light mineral oil) 10 Thermocycler 60 (BioMed, Theres, Germany). 11. Seakem ME agarose (FMC Bioproducts, Rockland, ME). 12. 50X TAE: 2M Trrs-acetate, pH 8.0,O 05M EDTA. 13. 1% Ethidmm bromide. 14. DNA gel electrophoresrs apparatus 15. 0 5M MgC12, 5M NaCl, and 99% ethanol for precipitation of DNA
YAC Probes
in Tumor
Cytogenetics
87
16. 20 mg/mL RNase A Boil for 10 min and store at -2O’C. 17 10% Pepsin. Store at -20°C. 18. 1% Formaldehyde solution: Mix 2.7 mL of 37% acid-free, buffered formaldehyde (Merck, Rahway, NJ) with 97.3 mL of PBS containing 50 mM MgC12 19 Phospate buffered saline (PBS): 8 g NaCl, 0 2 g KCl, 0.2 g KH2P04, 1 g Na2HP04 2Hz0, 0 15 g NaH2P04*H20. Add distilled water to 1 L and adjust pH to 7 4 with HCI. 20. 20X SSC 3M NaCl, 0.3M sodium citrate, pH 7 0 21 Ethanol series. 70, 90, and 99% 22. Cot-l DNA (BRL/Life Technologies) with a size range of 200-500 bp 23. Salmon sperm DNA This should be sheared or DNase digested to an average size of approx 500 bp (Sigma, St. LOUIS, MO). 24. Hybridization buffer: 4X SSC, 20% dextran sulfate 25. 0.2 mg/mL DAPI (4,6-dlamidmo-2-phenylmdole-dihydrochloride). 26. 1 mg/mL Propidlum iodide. 27. Antlfade buffer. Mix 10 mL of p-phenylendlamine solution (100 mg pphenylendlamine-dihydrochloride m 10 mL of PBS), pH 8 0, and 90 mL of glycerine. Store at -20°C. 3. Methods In the following protocol, we have put a greater emphases on the generation of Alu-PCR probes and refer the readers to other chapters in this volume (e.g., Chapters 4, 7, and 10) for a detaded description of the in situ hybrldlzation procedure. I.
2 3
4.
3.1. Performing the Polymerase Chain Reaction (PCR) For each PCR, prepare the following reactlon mix in a 1 5-mL Eppendorf tube: a. 10 yL of 10X PCR-buffer; b. 1 FL of dNTP-mix; c. 1 pL of Alu-primer CL1 , d. 1 pL of Alu-primer CL2, e. Double dlstllled water to a fmal vol of 100 pL, taking mto account the calculated vol for 150 ng of genomic yeast clone DNA; f. 150 ng of genomlc yeast clone DNA, and g. 5 U of Tuq DNA polymerase. Mix gently Overlay the reaction mix with 50 p,L of paraffin oil Note that for most thermocyclers an overlay of paraffin oil is essential In the case of the Thermocyler 60 (BloMed), paraffin 011can be omitted. Using the BioMed machine, perform the following cycles a. 97°C for 3 min; b. 97°C for 1 mm; c 37°C for 30 s; d 72°C for 6 min; e. Repeat steps b-d for a total of 30 cycles; and f 72“C for 4 min Store amplified DNA until further use at 4°C (up to 1 mo) or at -20°C for more extended periods.
88 1 2.
3. 4
Lengauer,
Speicher,
and Cremer
3.2. Analyzing the Reactions Prepare a lOO-mL agarose gel (1 2%) Bring the solution to a boll in a microwave oven until all agarose has dissolved Cool the solution to 55”C, add ethldium bromide (final concentration of 0.5 pg/mL), and pour onto a gel tray Remove the overlay of oil from the reaction mix. This is done by adding 50 pL of chloroform, mlxmg and centrifuging for 10 s The oil dissolves in the CHCl, (bottom layer). Remove the reaction mix (top layer) with a microliter pipet. Alternatively, use a microliter pipet to directly take up the reaction mix below the 011layer. Remove oil adhering to the pipet tip with a Kimwipe tissue paper. Note that any remaining oil will interfere with the migration of the DNA through the gel. Load a lO+L aliquot from the PCR mixture on the gel and electrophorese at 120 V until sufficient separation of bands between 50 bp and 5 kb is achieved Watch the gel on a UV translllummator
An appropriate gel shows a series of distinct bands. Srze and Intensity of the indtvrdual bands are highly reproducible for each YAC clone. Beside distinct bands, a smear of amplrfication products ranging up to 8 kb can be detected. Overlapping YAC clones should show bands with apparently identical posltlons and intensities, while other bands are distinctly different (see Note 3). Figure 1 shows an example of a typical agarose gel with Alu-PCR-amplifled sequences of eight YAC clones containing human inserts between 150 and 790 kb that belong to a YAC contig prevtously established from the cystic fibrosis gene at band 7q31 (9). 3.3. Probe Labeling 1. Ethanol precipitate PCR products by adding l/25 vol 5M NaCl, l/50 vol 0 5M MgC12, and 2.5 vol 99% ethanol, Leave at -80°C for 30 mm. 2 Centrifuge in an Eppendorf centrifuge for 20 mm. 3 Resuspend the pellet m double distilled water The DNA can now be used for nick translation 4 Label the DNA probe with biotin-I l-dUTP or digoxigenin-1 l-dUTP by mck translation as described by Lichter and Cremer (10) Alternatively, for labeling with biotm-1 l-dUTP, use the nick translation kit of Gtbco-BRL/Life Technologies (Galthersburg, MD) following the mstructions of the supplier (see Note 4). 5 Separate labeled probe from unmcorporated nucleotides by standard gel filtration method such as using a spin column. 3.4. Pretreatment of Chromosome Preparations The quality and pretreatment of chromosome preparations 1s particularly Important for FISH of Alu-PCR-amplified YAC clone sequences. We follow a protocol established by J. Wlegant (Untversity of Letden, The Netherlands) (II), whrch involves pretreating chromosome preparations wrth RNase A (100 pg/mL 2X SSC; 37°C for 1 h) and pepsin (50 l.tg/mL O.OlM HCl; 37°C for 10 min), and postfixing m 1% formaldehyde at room temperature for 10 mm and dehydrating in an ethanol series of 70,90, and 99% for 3 mm each.
YAC Probes in Tumor Cytogenetics
89
12345AB678
Fig. 1. Agarose gel (1.2%) of Alu-PCR-amplified YAC clones of the CF contig (9). Lane 1:
Alu-PCR amplification of a melted agarose plug containing the YAC yCF-11715-R (790 kb). Lanes 2-8: Alu-PCR-amplified YAC clone DNA of yKM19-3 (150 kb), yCF-10 (240 kb), yCF-7 (240 kb), yCF-5 (280 kb), yW30-5 (260 kb), yJ31 l-3 (340 kb), and yJ31 l-l (350 kb), respectively. Marker lane A: hlHind III; markerlaneB: 123-bpladder.OverlappingYAC clonesshow
bands with apparently identical position and intensity, while other bands are distinctly different. Reproduced by permission from Genomics 13,827.
3.5. Hybridization and Probe Detection Chromosomal in situ suppression (CISS-) hybridization (12-14) is carried out as described in detail by Lichter and Cremer (ZO), with the following modifications: 1. For each slide (18 x 18 mm hybridization area), combine: a. 100-150 ng of labeled Alu-PCR-amplified DNA-probe; b. Between 5 and 50 j.tg of unlabeled Cot-l DNA (see Note 5); and c. 10 pg salmon sperm DNA. 2. Add 1/2Oth vol of 3M sodium acetate and 2 vol of ethanol. Mix well and leave at -80°C for 30 min. 3. Centrifuge in an Eppendorf centrifuge for 30 min at 4°C. 4. Discard the supernatant and wash the pellet by adding 400 PL of 70% ethanol. 5. Spin for 5 min. 6. Discard the supematant and lyophilize in a SpeedVac. 7. Resuspend the dried pellet in 5 pL of deionized formamide and 5 PL of hybridization buffer. Vortex vigorously for several minutes. 8. Refer to other chapters in this volume (e.g., Chapters 4, 7, and 10) for denaturation and preannealing of the probe, denaturation of the chromosome preparations, hybridization, washing, and detection procedures.
90
Lengauer, Speicher, and Cremer
YAC Probes in Tumor Cytogenetics
91
9 After CISS-hybridization and probe detection, counterstain chromosome preparations with 0.2 pg/mL DAPI and/or 1 pg/mL propidmm iodide (dependmg on the fluorochromes used for detection) and mount in fluorescence antifade buffer. Photomicrographs are taken with a Zeiss (Oberkochen, Germany) photomicroscope III equipped for epifluorescence, or a Zeiss Axrophot. Agfachrome 1000 RS color slide films are used. A typical result is shown in Fig. 2A.
4. Notes 1 Applications: A/u-PCR-generated probes from YAC clones containing inserts from unique sites of the human genome provide Ideal tools for the analysis of specific numerical and structural chromosome aberrations. They can be used with high reliability in patients with various hematologic diseases at all stages of the cell cycle. For example, YAC clones have been applied to visualize specrfic structural chromosome aberrations in peripheral blood cells from patients with myelodysplasla exhibiting the deletion del(5)(q13q34), and acute promyelocytm leukemia (ANLL M3) with the translocation t( 15;17)(q22;q21) (6). Figure 2C,D shows a metaphase spread (C) and interphase nuclei (D) from a patient with chronic myeloid leukemia (CML) exhibiting the translocation t(9,22)(q34;ql I) after FISH wrth the brotinylated Alu-PCR-amplified sequences of YAC clone D107F9. This clone spans the breakpoint cluster region (BCR) on chromosome 22 2. Large YACs and YAC contigs of increasing size (15), including YACs spanning and flanking tumor-specific breakpoints (6,16-19), are rapidly becommg available for each band of the human chromosome complement. While many YAC clones show signals restricted to one specific chromosome band, others show signals on different chromosome subregions, indicating that these subregtons contain sequence homologies or that a given YAC clone contains several YACs or (more likely) a chimeric YAC. 3. The yield of Alu-PCR amplificatron products that can be expected for a given YAC depends on the sequence, number, and distance of Ah elements in the human insert. The following procedure can be applied for YACs from Alu-poor Fig. 2 (opposrte page) (A) Normal humanlymphocyte metaphasespreadand adjacent interphasenucleusafter fluorescencem situ hybridizationof blotinylatedAlu-PCR productsof YAC cloneA168H4. Thus550-kbYAC containsthe protooncogene c-raf-1, Probedetectionis performedwith avidm-FITC Chromosomes are counterstainedwith propidmmIodide Specific signalsareseenon 3~25.Two specificsignalsarealsodetectedin theadjacentinterphase nucleus.One hundredconsecutrvelyevaluatedmetaphasespreadsshowedthe expectedsignals on both homologsand both chromatids.In addition, 96% of 400 evaluatedinterphase nucler showedtwo clearly separatedsignals.(B) Schemeshowingthe expectedoutcomeof a FISH experimentusingYAC cloneD107F9to chromosomes andmterphasenucleiof a normal patient(upperrow) andof a patientwith chronicmyeloidleukemia(CML) exhibttmg thetranslocattont(9,22) (q34;qll) (lower row) This 215kb YAC spansthebreakpointclusterregion (BCR) on chromosome 22 (C) Metaphasespreadof a patientwith CML exhibltmg thetranslocation t(9;22)(q34;qll) after FISH of blotinylated Alu-PCR productsof YAC clone D107F9. Probe detection IS performed with avidin-FITC Chromosomesare counterstainedwith propidmmiodrde.Signalscanbeseenon bothchromatidsof thenormalchromosome 22 (large arrow), the Philadelphia chromosome(small arrow), and the dertvative chromosome9 (9pter+gq34::22ql1+22qter) (arrowhead).(1)) Threeinterphasenucletof the samepatient.
92
Lengauer,
Speicher,
and Cremer
regions that give very httle Alu-PCR products and accordmgly yield only weak fluorescent signals after FISH The YAC is first separated from the yeast chromosomes by pulsed-field gel electrophorests (PFGE) in a low-melting-pomt agarose gel. After cutting out the respective band, umversal DNA ampllfrcatron protocols are apphed to overcome the problems of the limited YAC DNA amounts present in the PFGE band For this purpose, an aliquot (5-50 ng) of the melted agarose piece containing the YAC is applied to a PCR assay using the degenerate ohgonucleotrde primer MW-6 (DOP-PCR) (20) (see Chapter 3). This approach provides amplified YAC DNA probes that yield strong, specific stgnals on human metaphase spreads and m interphase nuclei (27). 4. The size of labeled probe should ideally be smaller than 500 bp and larger than 100 bp. A predominant probe size at 250-300 bp seems optimal m our hands for efficient FISH with low background. Biotm-1 l-dUTP or drgoxigenm-1 1-dUTP can also be incorporated directly during the PCR assay. However, many amplifrcation products are larger than required for optrmal FISH and should be posttreated with approprtate concentrations of DNase I 5 For each YAC clone, the optimal amount of unlabeled Cot-l DNA should be determined emprrrcally. Use of excessive amounts of Cot-l DNA do not impair the results of CISS-hybridization, but can create a financial burden. When simultaneously hybridrzing A/u-PCR products of multiple YAC clones m one experi-
ment (see Note 6), the amount of Cot-l DNA does not have to be increased proportronally
but can remain almost the same.
6. Alu-PCR-amplified
products from a series of YACs can be combined as a multi-
plex probe for FISH to yield reproducible signals on a number of chromosome bands simultaneously. Using various pools of Alu-PCR-amplified YACs, new
types of colored chromosome banding patterns, called chromosomal bar codes, can be obtained on human chromosomes (22). Owing to their high hybridization efficiency, such multiplex probes can be implemented for diagnostic applica-
tions as a complementary
tool to conventional banding Chromosomal
bar codes
can be tailored to specific diagnosttc goals in clinical and tumor cytogenetics can help to improve automated chromosome analysis
and
Acknowledgments We are grateful to H. C. Rtethman (The Wistar Institute, Philadelphia, PA), E. D. Green and M. V. Olson (Washington University School of Medicine, St. Louis, MO) for provtding various YAC clones and helpful discussions. This work was supported by a grant from the Deutsche Krebshilfe (W 23/90/Crl) and the European Community (GENO-CT91-0029, SSMA).
References 1 Burke, D. T., Carle, G F , and Olson, M V. (1987) Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors Sczence236,806-812 2 Selleri, L., Hermanson, G G , Eubanks, J H , and Evans, G A (1991) Chromosomal m srtu hybridization usmg yeast artrficral chromosomes. Genet Anal Tech Appl 8,59-66 3 Nelson,D. L., Ledbetter,S A , Corbo,L , Victoria, M F., Ramirez-Sohs,R., Webster,T , Ledbetter,D. H , and Caskey,C T (1989)Alu polymerasechain reaction:a methodfor
YAC Probes in Tumor Cytogenetics rapid isolation of human-specific sequences from complex DNA sources Proc. Nat1 Acad Scl USA 86,6686-6690.
4 Lengauer,C., Green,E. D , andCremer,T (1992)Fluorescencein situ hybrrdrzationof YAC clonesafter Alu-PCR ampbfication.Genomrcs 13,826-829 5 Kariya, Y , Kato, K., Hayashtzaki,Y., Hrmeno,S , Tarur, S., and Matsubara,K (1987) Revisionof consensus sequence of humanALU repeatsa revrew. Gene 53, l-10 6 Lengauer,C , Riethman,H C., Speicher,M R , Taniwakr,M , Koneckt,D., Green,E D , Becher,R , Olson,M V., andCremer,T (1992)Metaphaseandinterphasecytogenetics with Alu-PCR amplifiedYAC clonescontainingthe BCR-geneandthe protooncogenes craf-1, c-fms,c-erbB-2. Cancer Res. 52,2590-2596 7 Green, E. D and Olson,M. V. (1990) Systemattcscreeningof yeast artrfmral-chromosomeltbrarresby useof the polymerasechain reaction.Proc. Natl. Acad. Scr USA 87, 1213-1217 8 Brownstein,B. H Silverman,G., Little, R. D , Burke, D T , Schlessinger, D , andOlson, M. V (1989)Isolationof single-copyhumangenesfrom a library of yeastartrfrcratchromosomeclones.Science 244,1348-l 351 9 Green,E D. andOlson,M V. (1990)Chromosomal regionof the cystrc fibrosisgenem yeastartrfrcial chromosomes. a modelfor humangenomemapping.Science 250,94-98. 10 Lichter, P andCremer,T. (1992)Chromosome analysisby non-isotopicin situ hybrrdrzanon, in Human Cytogenetrcs A Practrcal Approach (Rooney,D E andCzepulkowskt,B H , eds), IRL, Oxford UmversrtyPress,Oxford, pp. 157-192 11 Rred,T., Lengauer,C , Cremer,T , Wregant,J , Raap,A K , vanderPloeg,M , Grortl, P , andLtpp, M. (1992)Specificmetaphase andinterphasedetectionof thebreakpomtregion in 8q24of Burkrtt lymphomacellsby triple color fluorescence in situhybrtdrzatron Genes Chrom. Cancer 4,69-74
12. Cremer,T , Lrchter, P , Borden,J , Ward, D C , andManuebdrsL. (1988)Detectionof chromosome aberrationsm metaphase andInterphasetumorcellsby in situ hybridtzation usmgchromosome-specificlibrary probes Hum Genet 80,235-246 13. Lrchter, P , Cremer,T , Borden,J., Manuelrdrs,L., andWard, D. C (1988)Delmeatronof mdivrdualhumanchromosomes in metaphase andinterphasecellsby m situ suppression hybrtdrzatronusingrecombinantDNA libraries,Hum. Genet 80, 224-234 14. Pinkel, D , Landegent,J , Collms,J., Fuscoe,J , Segraves,R , Lucas,J , andGray, J W. (1988)Fluorescencein srtuhybridtzation wrth humanchromosome specifichbrarres.detection of trisomy 21 andtranslocationof chromosome 4 Proc Nat1 Acnd Scr USA 85, 9138-9142. 15. Bellanne-Chantelot,C , Lacmx, B., Ougen,P , Brllault, A, Beaufils, S., Bertrand, S , Georges,I , Ghbert, F., Gros,I , Lucotte,G , Susim,L., Codam,J J., Gesnouin,P., Pook, S , Vaysserx,G , Lu-Kuo, J , Ried,T , Ward, D., Chumakov,I , Le Paslier,D., Banllot, E , andCohenD. (1992)Mappingthe wholehumangenomeby fingerprintingyeastartrfictal chromosomesCell 70,1059-l 068 16 Rowley, J. D., Dtaz,M O., Espmosa III, R., Patel,J. D , vanMelle, E., Ziemm,S , TarllonMiller, P , Lichter, P , Evans, G. A., Kersey, J H., Ward, D C., Domer,P. H , and Le Beau, M M. (1990) Mapping chromosomeband 1lq23 in humanacuteleukemiawith brotinylatedprobes,rdentrficationof 1lq23 translocattonbreakpoints with a yeastarnticial chromosome. Proc. Natl. Acad. Sci USA 87,9358-9362 17. Goa, J., Erickson,P , Gardiner,K , Le Beau,M M., Diaz, M 0 , Patterson,D., Rowley, J D., andDrabkin,H A. (1991)Isolattonof ayeastartificial chromosome spanningthe 8;21 translocatronbreakpointt(8;21)(q22;q22.3)m acutemyelogenousleukemia Proc. N&l. Acad. Set USA 88,4882-4886
18. Selleri, L., Hermanson,G. G., Eubanks,J. H., Lewis, K A., and Evans, G A. (1991) Molecular localrzatronof the t(l1,22)(q24;q12)translocationof Ewmg sarcomaby chromosomalin situ suppression hybridization Proc Nat1 Acad Set. USA 88,887-891
94
Lengauer,
Speicher,
and Cremer
19 Hertz, D., Rousseau, F , Devys, D., Saccone, S , Abderrahin, H., Le Paslier, D., Cohen, D , Vincent, A., Toniolo, D., Della Valle, G , Johnson, S , Schlessmger, D , Oberle, I , and Mandel, J. L. (1991) Isolation of sequences that span the fragile X and identification of a fragtle X-related CpG Island. Science 251, 1236-1239 20 Telenms, H , Carter, N P., Bebb, C E , Nordenskjold, M., Ponder, B A., and Tunnachffe, A (1992) Cytogenetrc analyzis by chromosome painting using DOP-PCR amplified flowsorted chromosomes. Genes Chrom. Cancer 4,257-263 21 Lengauer,C., Spetcher,M. R., Rred,T., andCremer,T. Unpubhshedresults. 22 Lengauer,C , Speicher,M R , Popp,S.,Jauch,A., Tamwaki,M., Nagaraja,R , Rtethman, H C., Donis-Keller,H , D’Urso, M , Schlessinger,D., and Cremer,T (1993) Chromosomalbarcodesconstructedby multicolorfluorescence in srtu hybndizatronwith multiple YAC clonesandwholechromosome paintingprobes.Hum Molec Genet 5,505-S 12
CHAPTER 9
Primed Johnny
In Situ (PRINS)
Labeling
of DNA
Hind&& J#rn Koch, Jens Mogensen, Steen K&vraa, and Lars Bolund
1. Introduction During the last two decades, techniques for the detection of specific DNA and RNA sequences in situ have been developed. In the beginning, only radioactive detection was possible, which to some extent made these techniques unsuited for routine purposes. Withm the last decade, a number of nonradroactlve detection methods have become available, resulting in a much more wldespread use of in situ hybridization. These methods have become of great value, e.g., as a supplement to traditional cytogenetlc analysis m the identlflcation and quantification of numerlcal and/or structural aberrations m both clinical genetics and cancer diagnosis. In this chapter, we present the primed in situ (PRINS) labeling technique, which we have developed as a fast and sensltlve alternatlve to the more traditional fluorescence in situ hybridization techniques. The strategy m PRINS (Fig. 1) is that an unlabeled probe is mixed with nucleotides (of which at least one 1shapten-labeled) and DNA polymerase. The mixture IS then applied to a slide with metaphase chromosomes. When the probe hybridizes to its target sequence in the chromatin, it functions as a primer for chain elongatton using the chromosomal DNA as a template. The cham elongation 1scatalysed by a DNA polymerase that mcorporates the nucleotides, and thus labels the site of hybridization (1‘2). A major difference between the PRINS technique and the traditional in situ hybridization methods is that the DNA probe m PRINS 1s unlabeled. This means that nonspecifically bound probe DNA will not give rise to background signals, as only probe DNA hybridized to its target sequence can be used as primer for chain elongation. As a consequence, high amounts of probe DNA can be used without background problems. This abihty to use high amounts of probe DNA makes the PRINS method very fast and thus mmlmlzes unnecessary damage to cell and chromosome structures. The relatively gentle nature of this technique means that subsequent high-quality Q-banding of prometaphase and metaphase chromosomes can be achieved, making evaluation of the results easier. Furthermore, since the length of the chain elongation 1smdependent of the length of the primer, good labeling can be achieved with both short oligonucleotides as well as longer, cloned DNA. From Methods m Molecular Btology, Vol 33 In SIIU Hybrrdrzat/oon Protocols Edlted by K H A Choo CopyrIght Q 1994 Humana Press Inc. Tolowa, NJ
95
Hindkjaer
96 primer
t-) +
dNTP
6 O(p
et al.
DNA polymerase
+
@
5’
3’
CHROMOSOMAL DNA Fig 1, A schematic PRINS reaction The probe DNA IS annealed to its target sequence on the chromosomal DNA The probe DNA then functrons as a prrmer In a cham elongatron reaction catalyzed by a DNA polymerase Durmg the cham elongatton, nucleottdes, of which one type is hapten-labeled (shown with a black dot), are incorporated into the chromosomal DNA, and thus label the site of hybrrdtzatlon m srtu
In this chapter, we describe a detailed protocol for PRINS labeling of repetrtive sequences using oligonucleotrdes and cloned DNA probes. In addition we present a method for multicolor PRINS m which two different probes are simultaneously visualized on the same metaphase preparation. Finally, a prellminary protocol for the PRINS labeling of single-copy genes is presented. 1.1. Detection of Repeated Sequences Using Oligonucleotides as Primers in a PRINS Reaction
Only 510% of the total human DNA is coding. A major proportion of the noncoding DNA is composed of repeated sequences, either orgamzed as dispersed repeats,where a single motrf is spread over the genome, or as tandem repeats, which are organized in blocks on specific regions of the chromosomes. All repeat families can be defined by a consensus sequence from which the various monomers deviate only slightly. By making a synthetic ohgonucleotide from the consensus sequence of a family of repeats, it is possible to obtain very good labelmg of the corresponding chromosomal regrons using PRINS. We illustrate this by labeling the human chromosome ends with an ohgonucleotide representing the telomeric sequences (Frg. 2A). A special advantage of oligonucleotide primers is their ability to differentiate between closely related sequences, This potential can be utilized for chromosome-specific staining using an oligonucleotide synthesized from a chromo-
PRINS Labeling
of DNA
97
some-specific motif within one of the monomers from the a-satellite DNA higher order repeat. This is illustrated in Fig. 2B, where chromosome-specific labeling of chromosome 18 is shown. Furthermore, we and others have obtained good labeling of satellites I, II, III, and IV, Alu repeat, and p-satellite DNA on human chromosomes (2,3). In addition, specific labeling of a characteristic repeat family on the Y chromosome, and labeling of dispersed dG-dT repeats, have been obtained on chromosomal preparations from pigs ($5). The detailed protocol for PRINS labeling with oligonucleotides is given in Section 3.1. 1.2. PRINS
Detection of a-Satellite DNA with Cloned Probes As an alternative to designed oligonucleotides, cloned probes, shortened by restriction enzyme digestion, can be used as primers for PRINS labeling. This approach will be demonstrated here with the a-satellite DNA repeat family. Alpha-satellite DNA consists of higher order repeats which are situated in the centromeric regions of the human chromosomes (6). These higher order repeats are made up of a specific number of monomers of approximately 171 bp in length, and are organized as a-satellite DNA subfamilies. The DNA sequences of the monomers deviate slightly among the different subfamilies and, therefore, give rise to chromosome-specific subfamilies. Alpha-satellite DNA subfamilies have been isolated and cloned from all human chromosomes, and unique ones for nearly all the chromosomes have been found (7). This means that chromosome-specific PRINS labeling can be performed at high stringency using primers generated from these chromosome-specific a-satellite DNA clones. The primers used for PRINS labeling should preferably be less than 200 bases long. The higher order repeats of the a-satellite DNA can be cleaved into the 171-bp monomers with the restriction enzyme Dde I. The monomers can then, after denaturation, be used as primers in a PRINS reaction, This method gives strong and chromosome-specific centromeric labeling, which can easily be evaluated on both metaphase chromosomes and interphase nuclei. The whole process of labeling and evaluation of the result can be achieved in less than 2 h. Figure 3A shows the result of a PRINS labeling of the centromere of the X chromosome with an X-specific cloned probe pBamX7 (8). Figure 3B shows the result of interphase nuclei labeling using a chromosome 7-specific probe. The protocol for these experiments is given in Section 3.2. 1.3. Multicolor PRINS It is often useful to be able to perform dual labeling with two probes m different colors on the same cell or metaphase spread. This is possible with the PRINS technique and involves doing two successive PRINS reactions on the same shde, using differently labeled dUTP in the two reactions. A major advan-
98
Hindkjaer
Figs. 246.
et al.
PRINS La be1ing of DNA
99
tage of the multicolor PRINS is that the two primers do not need to have the same melting temperature, since the annealing of the primers is performed m different steps. This means that a short ohgonucleotrde and a longer DNA fragment from a cloned probe can be evaluated in parallel. Normally, tt makes no difference which probe is used in the first PRINS reaction since the chain elongation reaction significantly extends the length of the hybrid DNA and, thus, prevents the first chain-elongated primer from dissociating from its target site on the chromatin even if the second probe requires annealing at a higher temperature. An example of PRINS labeling using an oligonucleotide specific for telomeric repeats and aDde I-digested X chromosome-specific a-satellite DNA probe is shown in Fig. 4. The detailed protocol for the experiment is described in Section 3.3. 1.4. Detection of Single-Copy Genes Using a Cocktail of Primers Encouraged by the fact that the small p-satellite repeat (consistmg only of 25-50 copies of a 68-bp sequence per chromosomal site) can readily be visualFigs. 2-4,6 (opposrtepage) (see color plate number 4 after p. 172). (Fig. 2) PRINS labelmg of human chromosomes using ohgonucleotide primers. (A) PRINS labelmg of the telomeres of chromosomes from a patient with a ring chromosome The PRINS reaction IS performed at 55°C usmg a 42-mer oligonucleottde (CCCTAA), representmg the telomeric sequences. All chromosomes show telomenc labeling except for the ring chromosome (arrow) which has apparently lost its telomeres. (B) PRINS labeling of the centromere of chromosome 18 using a 35mer oligonucleotide representing a chromosome 18-specific region m one of the monomers in the a-satellite DNA higher order repeat of this chromosome Reaction temperature is 55°C. (Fig. 3) PRINS labehng of human chromosomes using a Dde I restrictiondtgestedX chromosomeor chromosome 7-specificu-satelliteDNA probeasprimer, andbiotin-l l-dUTP asthe labeled nucleotide. (A) PRINS labeling of chromosomes from a normal female showing specificlabelingof the two X chromosomes in boththe Interphase nucleusandon the metaphase spread.The specificity of the labelingmeansthat aneuploidystudiescanbe performedin interphasenuclei (B) PRINS labelingof interphasenuclei from a patient with SBzarysyndrome. Tumorcells,whichareneartetraploid,havefour chromosomes 7 (arrow),andnormalcellshave two chromosomes 7 (arrowhead).Reactiontemperatureis 70°C (Fig. 4) Multicolor PRINS of chromosomes from a normalfemale.In the first PRINS reaction,an oligonucleotideof the telomericsequence(CCCTAA), is usedasprimer, anddtgoxtgemn-1l-dUTP is mcorporated This reactionISperformedat 55°C After washinganddehydration,3’-endsare blockedwith dtdeoxynucleohdes.A secondPRINS reactionis performedat 70°C usingDde I cleavedX chromosome-specific a-satellite DNA (pBamX7) asprimer, and biotm-1l-dUTP as labeled nucleotide.Digoxigenin-labeledDNA is detectedwith antidigoxigenin-fluorescent, Fab fragments,andbiotin-labeledDNA is detectedwith rhodamineavidm. Chromosomes arecounterstainedwith Hoechst33258.(Fig. 6) PRINS labelingof humanchromosomes from a normal personusing,asprimers,18oligonucleotides, derivedfrom exonsequences of thetumorsupressorgene~53.The oligonucleotidesare20-mers,eachwith a theoreticalmeltingtemperatureof about 61-64”C The PRINS reactionis performedat 58°C for 90 mm with digoxigenm-1IdUTP asthe labelednucleotide.LabeledDNA is detectedwith anttdigoxigenin-fluorescein, Fabfragments.Arrows showthe signalon the p-arm(the expectedlocationof the ~53gene)of two chromosomes, which werefound to bechromosome17with subsequent Q-banding
100
Hindkjaer
et al.
Fig 5 A schematic PRINS reactlon for the detectlon of single-copy genes The four arrows represent four different oligonucleotldes which function as primers Two are placed in each exon (hatched boxes) pomting away from each other, which offers the advantage that cham elongation from the two primers in each exon ~111not mutually Interfere The figure also shows how both the exons and introns (nonhatched box) are labeled in a PRINS reactlon.
ized with the PRINS technique (3), we are currently refining the technique for the detection of single-copy genes. As described below, an added incentive 1sthat the PRINS technique can potentially allow the labeling of a whole gene, mcluding introns, with probes representing only exon sequences. Another advantage of the PRINS technique 1s that It does not rely on the possession of a cloned probe for the target. As long as the sequence of the gene is known, a cocktail of ohgonucleotides can be synthesized for use as primers. The strategy for the detection of single-copy genes is shown m Fig. 5. Primers are preferentially chosen such that they are situated “back to back” in the middle of an exon, thus allowing chain elongation to proceed into the mtrons. If two such primers are placed m each exon, then all exons, and a substantial part of the introns, can, m principle, be labeled. This means that much higher amounts of labeling can be generated with PRINS compared to traditional in situ hybridlzatlon with a cDNA probe or a genomic DNA probe covering only part of a gene. In a one-step PRINS experiment, the primers should naturally be designed to have as similar a meltmg temperature as possible. Section 3.4 describesthe protocol for the labeling of the tumor suppressor gene ~53, which is situated on chromosome 17 (17~13). The ohgonucleotlde pnmers cover only 360 bp of the 1.7 kb coding region of the ~53 gene, while the entire gene covers 18.4 kb. The result of this PRINS labeling IS shown in Fig. 6. 2. Materials 1. Nucleotlde mixture 3.3 mM of each of the three nucleotldesdATP, dCTP, and dGTP (Boehrmger Mannheim, Mannhelm, Germany). 2. Labeled dUTP: Dlgoxigenin- 11 -dUTP (Boehringer Mannheim), fluorescem- 12dUTP (Boehringer Mannheim), and biotin-1 I-dUTP (Sigma, St. Louis, MO). 3 Dideoxy-nucleotide mixture: 2.5 mi14 of each of ddATP, ddCTP, ddGTP, and
ddTTP (Boehringer Mannheim). 4 Taq DNA polymerase (BoehringerMannheim or Perkin-Elmer/Cetus, Norwalk, CT) 5. 10X Taq polymerase buffer: 500 mA4 KCl, 100 mM Tris-HCl, pH 8.3, 15 mM MgC12, 0.1% (w/v) BSA (or gelatin)
6. Glycerol, 87% (Merck, Rahway, NJ).
PRINS Labeling
101
of DNA
7. Stop buffer 50 mM NaCl, 50 mM EDTA, pH 8 0. 8. Washing buffer: 4X SSC, pH 7.0,0.05% Tween 20. (1X SSC. 150 mM NaCl, 15 mM sodium citrate). 9. Blocking solution: 5% nonfat dry milk dissolved in washing buffer. Centrifuge for 2 min m an Eppendorf centrifuge and use supernatant. 10. Ethanol, 99%. 11. Fluorescein avidm DCS (Vector Laboratories, Burlmgame, CA) 12. Biotinylated Antiavidin D (Vector Labs) 13. Antidigoxigenin-fluorescein, Fab fragments (Boehrmger Mannheim). 14. Antrfluorescein, monoclonal antibodies produced in a mouse (Boehrmger Mannheim). 15. Fluorescein-conjugated rabbit antimouse antibodtes (F261, Dakopatts, Dako, Santa Barbara, CA) 16. Fluorescein-conjugated swine antirabbit anttbodies (F205, Dakopatts) 17. Antifade solutton: 10 mg/mL p-phenylenediamine dihydrochlortde in 80% glycerol (v/v), O.lM Tris-HCl, pH 9.0. 18. Propidium iodide 19. Hoechst 33258. 20. Staining jars. 2 1. Thermo-block. 22. Water bath with humtdtfied chamber. 23. Dde I, restriction enzyme (Boehringer Mannhelm). 24. DNA gel electrophorests apparatus. 25 Agarose. 26 10X TBE: 900 mM Tris-base, 900 mM boric acid, 1 mM EDTA. 27. Ethidium bromide.
3. Methods 3.1. PRINS
Labeling
with
Oligonucleotides
3.1.1. PRINS Reaction 1 Reaction mixture Mix 0 5 ug of oligonucleotide representing the target sequence (see Note l), 1.5 l.rL of nucleotide mixture (dATP, dCTP, dGTP, 3.3 mM each), 0 5 pL of digoxigenm-1 1-dUTP (1 mM) (see Note 2), 2.5 PL of glycerol (87%), and 5 PL of 10X Taq polymerase buffer. Add HZ0 to a final volume of 50 p.L. (It is often easier to add Hz0 first to ensure that the small volumes of the other reagents are totally dispensed into the reaction mixture.) 2 Add 1 U of Taq DNA polymerase (see Note 3) and mix gently by tapping a finger on the Eppendorf tube. 3. Preheat the slide with the metaphase chromosomes (see Note 4) on a thermoblock at 94’C for about 15 s. 4. Denaturation of chromosomal DNA: Apply the reaction mixture to the preheated slide, spread, and cover with a 25 x 50 mm coverslip. Denature the chromosomal DNA for 4 min at 94°C. 5. Probe annealing and chain elongation. Transfer the slide quickly to a humidified chamber m a water bath at the stringent temperature (see Notes 1, 5, and 6). Incubate for 30 mm.
102
Hindkjaer
et al.
6 Wash the slide in 100 mL of preheated stop buffer at reaction temperature (see step 5) for 1 mm to terminate PRINS labeling. 7. Transfer the slide to 50 mL of washing buffer in a stammg jar with screw cap, and wash for 3 mm at room temperature under gentle agitation 3.1.2. Visualization of Digoxigenin-Labeled DNA 1. Drain the slide and apply 100 l.rL of blocking solution. 2. Incubate for 5 min at room temperature under a plastic coverslip (see Note 7) in a humidified box. Perform all further incubations and washings at room temperature. 3. Wash the slide for 15 s m 50 mL of washing buffer. 4. Drain and add 50 PL of antldlgoxigenm-fluorescem, Fab fragments in blocking solution (2 ng/l.rL) to the slide. 5. Incubate for 30 min under a plastic covershp. 6 Wash three times for 5 min in 50 mL of washmg buffer under gentle agitation. 7. Mount the slide in 20 l.tL of antlfade solution containing propidium iodide (0 5 WmL). 8 Evaluate the result under a fluorescence microscope. If stainmg is too weak, apply additional layers of fluorescein-conJugated antibodies as described below. 9. Wash the slide twice for 5 mm m washmg buffer. Remove the coverslip after the first wash. 10. Add 100 l.rL of antifluorescein antibodies in blocking solution (5 ng&L), and incubate for 30 min. 11. Wash three times for 5 min in washing buffer. 12. Add 100 FL of fluorescein-conjugated rabbit antimouse antibodies (diluted 100X in blocking solution), and incubate for 30 min. 13 Mount in antifade solution containing propidium iodide, and evaluate under the microscope. If signal is still too weak, apply an additional layer of fluorescein-conjugated antibodies as described below. 14 Wash the slide twice for 5 min in washmg buffer. Remove the coverslip after the first wash 15 Add 100 pL of fluorescem-conjugated swine antirabbit antibodies (diluted 100X in blocking solution), and incubate for 30 min 16. Mount in antifade solution contammg propidmm iodide and evaluate under the microscope. If stammg is still too weak, repeat steps 9-16. 3.2. PRINS Labeling with Cloned MJatellite DNA Probes 3.2.1. Generatton of Primers from Cloned a-Satellite DNA 1. Cleave 100 pg of cloned a-satellite DNA with the restriction enzyme Dde I (1 U/ pg DNA) in a total volume of 100 pL for 2-3 h at 37°C 2 Run 1 ltg of the digested DNA on a 2% agarose gel prepared in 1X TBE to check that the DNA is totally cleaved. As a control, run 1 pg of the undigested DNA probe in parallel 3 Following electrophoresls, stain the gel in ethldium bromide (1 pg/mL) for 10 mm. Rinse the gel for 5 min in distilled water. Evaluate the result under UV hght.
PRINS
Labeling
103
of DNA
If the DNA probe is totally cleaved, it is now ready for use in a PRINS reaction (see Note 8)
3.2.2. PRINS
Reaction
1 Reaction mixture: Mix 2.0 pg (see Note 9) of Dde I restriction enzyme digested a-satellite DNA (see Note l), 1.5 pL of nucleotlde mixture (dATP, dCTP, dGTP, 3.3 mM each), 0.5 pL of blotm-l l-dUTP (1 mJt4) (see Note 2) 2 5 pL of glycerol (87%) and 5 l.tL of 10X Tuq polymerase buffer. Add HZ0 to a fmal volume of 50 pL (see note in Section 3 1 1 , step 1). 2 Add 1 U of Taq DNA polymerase (see Note 3) and mix gently. 3. Preheat the slide with the metaphase spread (see Note 4) on a 94°C thermo-block for about 15 s 4 Simultaneous denaturatlon of chromosomal DNA and probe DNA (see Note 3). Apply the reaction mixture to the preheated slide, spread, and cover the mixture with a 25 x 50 mm coverslip. Denature the chromosomal DNA and probe DNA for 4 mm at 94’C 5 Probe annealing and chain elongation Transfer the slide quickly to a humidified chamber in a water bath at stringent temperature (see Notes 1 and 5) Incubate for 30 mm. 6. Wash the slide m 100 mL of preheated stop buffer at reaction temperature (see step 5) for 1 min to terminate PRINS labeling. 7. Transfer the slide to 50 mL of washing buffer in a staining jar with screw cap, and wash for 3 min at room temperature under gentle agttatlon
3.2.3. Visualization
of Biotin-Labeled
DNA
1 Dram the slide and apply 100 pL of blocking solution 2 Incubate for 5 min at room temperature under a plastic coverslip (see Note 7) m a humidified box. Perform all subsequent mcubatlons and washings at room temperature. 3 Wash the slide for 15 s in 50 mL of washing buffer 4. Dram and add 100 pL of fluorescein avldm in blocking solution (2 ng/pL) 5 Incubate for 10 mm 6. Wash three times for 5 min in 50 mL of washing buffer under gentle agitation. 7. Mount the slide m 20 pL of antifade solution containing propldmm iodide (0.5 WmL) 8 Evaluate the result (see Note 10) under a fluorescence microscope. If staining is too weak, apply additional layers of fluorescein avtdin as described below. 9 Wash the slide twice for 5 min m washing buffer Remove the covershp after the first wash. 10. Add 100 p.L of antiavidm antibodies m blocking solution (2 ng/pL), and incubate for 30 min. 11 Wash three times for 5 min in washing buffer. 12. Add 100 pL of fluorescem avtdin m blockmg solution (2 ng/pL) and incubate for 10 min. 13. Wash three times for 5 min in washing buffer, 14 Mount in antlfade solution containing propidmm iodide and evaluate under the microscope. If stammg 1s still too weak, repeat steps 9-14
104 and
Hindkjaer 3.3. Multicolor a Cloned Probe
PRINS Using with Different
et al.
an Oligonucleotide Melting Temperatures
1 Oligonucleotide reaction mixture. Mix 0 5 pg of oligonucleotide DNA representing telomeric sequences, 1.5 pL of nucleotide mixture (dATP, dCTP, dGTP, 3.3 mM each), 0.5 pL of digoxigenm-1 l-dUTP (1 mA4) (see Note 2), 2 5 pL of glycerol (87%), and 5 pL of 10X Tug polymerase buffer. Add H,O to a final volume of 50 PL (see note in Section 3.1.1.) step 1) Add 1 U of Tuq DNA polymerase (see Note 3) and mix gently. Preheat the slide with the metaphase spread (see Note 4) on a 94°C thermo-block for 15 s. Denaturation of chromosomal DNA: Apply the reaction mtxture to the preheated slide, spread, and cover the mixture wtth a 25 x 50 mm covershp Denature the chromosomal DNA for 4 min at 94°C. Transfer the slide quickly to a humidified chamber (see Note 5) m a 55’C water bath, and incubate for 30 min. Wash the slide twice for 30 s at 55°C m 100 mL of preheated stop buffer. Dehydrate the shde in a 4°C ethanol series (70, 90, and 99%, 3 min each in 100 mL). Remove the slide from 99% ethanol, dram, and place it m the humidified chamber at 55’C Preheat the slide for about 1 min. Dideoxy reaction mixture. Mix 2 j.tL of dideoxy-nucleotide mixture (ddATP, ddCTP, ddGTP, ddTTP, 2 5 n&f each), 2.5 pL of glycerol (87%), and 5 p.L of 10X Tuq polymerase buffer. Add Hz0 to a final volume of 50 pL. 10 Add 1 U of Tuq DNA polymerase to the reaction mixture and mix gently. 11 Dideoxy blocking of 3’-ends: Apply the drdeoxy reaction mixture to the preheated slide and incubate in the 55°C humidified chamber for 15 mm. This reaction blocks the free 3’-ends and prevents cham elongation restarting from these ends in the second PRINS reaction. 12 Wash the slide twice for 30 s at 55’C in 100 mL of preheated stop buffer 13. Dehydrate the slide m a 4°C ethanol series (70,90, and 99%, 3 mm each m 100 mL). 14. Transfer the shde to a humidified chamber m a 70°C water bath and preheat for about 1 min. Preheatmg of the slide should occur while steps 17 and 18 are bemg performed. 15 Alpha-satellite DNA reaction mixture: Mix 2 /,tg (see Note 9) of Dde I restriction digested a-satellite DNA (see Section 3.2) of the human X chromosome, 1.5 j.tL of nucleotide mixture (dATP, dCTP, dGTP, 3.3 n&f each), 0.5 pL of biotin-l ldUTP (1 mM) (see Note 2), 2.5 pL of glycerol (87%), and 5 pL of 10X Tuq polymerase buffer. Add Hz0 to a final volume of 50 /.tL. 16. Boil the mixture for 5 mm to denature double-stranded probe DNA. 17 Spm evaporated water down m a microfuge for 10 s. 18 Add 1 U of Tuq DNA polymerase and mix gently 19 Annealing and cham elongation* Apply the reaction mtxture to the preheated shde (step 14). Incubate in a 70°C humidified chamber for 30 mm. 20. Wash the slide in 100 mL of preheated stop buffer for 1 min at 7O’C. 31 Wash the slide for 3 min at room temperature m 50 mL of washing buffer AI
PRINS Labeling
of DNA
105
22 Visualizatton. Perform the digoxrgenin detection procedure first (Section 3.1.2.) and then the biotm detection procedure (Section 3.2.3.). Follow both procedures strictly, except for steps 1 and 2 of Section 3 2 3. (these steps are unnecessary since blocking has already been performed in step 1 of Section 3 1.2. in the drgoxigenin detection procedure). Furthermore, rhodamine avidin is substituted for fluorescein avidin in subsequent steps. Normally, it is not necessary to enhance the telomeric signal by additional layers of FITC conjugated antibodies, whereas it may be necessary to enhance signals of the brotm-labeled a-satellite DNA by an additional layer of rhodamine avidin 23. Chromosomes (see Note 10) are counterstamed for 1 min with 0 5 pg/mL Hoechst in PBS. After counterstaining wash the slide twice for 30 s in PBS Drain the slide and mount in 20 pL of antifade solution, 1
2. 3. 4. 5 6 7. 8. 1
2
3.4. PRINS Labeling of a Single-Copy Gene (~53) Reaction mixture: Mix 0.25 pg of each oligonucleotrde (see Notes 11 and 12), 1.5 l.tL of nucleotrde mixture (dATP, dCTP, dGTP, 3 3 mM each), 0 5 PL of digoxigenin-11-dUTP (1 mM) (see Note 2), 2 5 pL of glycerol (87%), and 5 pL of 10X Tuq polymerase buffer. Add Hz0 to a final volume of 50 pL (see note m Section 3 l.l., step 1). Add 1 U of Tuq DNA polymerase (see Note 3). Mix gently Preheat the slide with the metaphase spread (see Note 4) on a 94°C thermo-block for about 15 s. Denaturation of chromosomal DNA. Apply the reaction mixture to the preheated slide, spread, and cover the mixture with a 25 x 50 mm coverslip. Denature chromosomal DNA for 4 mm at 94°C (see Note 3). Transfer the slide quickly to a humidified chamber (see Note 5) in a 58°C water bath and perform primer annealing and chain elongation for 90 min Wash the slide m 100 mL of stop buffer at 58’C for 1 min. Transfer the slide to 50 mL of washing buffer, and wash for 3 min at room temperature under gentle agitation. Visualization See Section 3.1.2 4. Notes When a new probe is used for the first time, it is advisable to try different hybridization temperatures, both higher and lower than the theoretical melting temperature, to obtam a strong and specific signal. Also the amount of probe DNA giving the best signal without cross-hybridization should be determined experimentally for each probe. For different probes we have used from 0 01-10 l.rg DNA Usually, 0.5-2 lr.g of probe DNA works well We have used digoxigenin-, biotin-, and fluorescein-labeled dUTP for PRINS labeling. It is our experience that the strongest signal is obtained using digoxigenin-labeled dUTP, closely followed by biotin-labeled dUTP. Fluorescein-labeled dUTP gives a somewhat weaker signal However, if a probe gives a very strong signal, it can be advantageous to use fluorescein-12-dUTP, as results can be obtained faster and in fewer steps (9). If fluorescem-12-dUTP 1s used and the signal is too weak, it can be enhanced by the procedure described m Section 3.1 2., omitting steps 3-9.
Hindkjaer 3
4
5
6.
10.
11.
et al.
Klenow polymerase can also be used for PRINS labelmg at temperatures below 50-55’C (1,3). However, when the Klenow polymerase is used, the chromosomal DNA and probe DNA (if double-stranded) must be denatured separately, as the Klenow polymerase is not thermostable. Chromosomal DNA is denatured m 70% formamide, 2X SSC, pH 7 0, at 70°C for 2 mm followed by dehydration m an ice-cold ethanol series Probe DNA mixture (if double-stranded) 1s denatured by boiling for 5 min Evaporated water IS recovered by centrifugation (this also cools the mixture), and 1 U of Klenow polymerase IS added. The DNA reaction mixture is then applied to the slide, which has been preheated for 1 mm at hybrtdization temperature It is preferable to use freshly spread metaphases, since chromosomes from older preparations may contain nicks that can give rise to background signals (see Note 10) This problem can be solved by repairing the nicks with T4 DNA hgase (1 U per slide in 50 PL of ligase buffer for 1 h at room temperature) (10) The ligation reaction is stopped by washing the slide in stop buffer for 1 min at room temperature followed by dehydration in an ethanol series After this, the PRINS reaction can be performed. If evaporation of the reaction mixture during incubation is a problem, this can be the result of an ineffective humidified chamber Alternattvely, glycerol, which decreases evaporation, may have been omitted from the reaction mtxture. The Tuq DNA polymerase has been successfully used m PRINS labeling employing a 16-mer ohgonucleotide at the relatively low temperature of 3O”C, and may work at even lower temperatures. The plastic coverslips used in the vtsualization procedures are cut from a “plastic pocket ” We use these because of their ease of handling When double-stranded probes are used, lack of signal can be the result of an incomplete restriction enzyme digestton of probe DNA The restriction enzyme digested probe DNA 1s used without extraction of the restriction buffer and enzyme. Therefore, to minimize interference m the PRINS reaction, the volume of probe DNA added to the PRINS reaction mixture must not exceed 10% If a banding pattern 1s seen on all chromosomes, this might be due to m situ nick translation by the Tuq DNA polymerase. This can occur if mcks are produced in the chromosomal DNA by the restriction enzyme, if it is thermostable and/or has not been properly macttvated m the denaturatton step If this is the case, the probe DNA mixture must be boiled for 5 mm prior to application to the slide After boiling, the DNA mixture is centrifuged to recover evaporated water Tuq DNA polymerase is then quickly added, and the reaction mixture 1s applied to the preheated slide The ohgonucleottdes (20-mers) for the detection of the single-copy gene ~53 are chosen from the cDNA sequence of the gene. These ohgonucleotides are found using a computer program (“oligo,” MedProbe, Oslo, Norway) that gives the theoretical melting temperature of an oligonucleotide. Wherever possible, two oligonucleotides are designed for each exon (see Section 1.4 ). However, if it is not possible to fmd oligonucleotides with matching meltmg temperatures m an exon, they are omitted. Also, to avoid false signals, ohgonucleotides that share homology with repeat sequences are discarded. The ohgonucleotides used for the
PRINS
Labeling
of DNA
detection of the tumor suppressor gene ~53 were checked for repeated sequences with a mismatch of 4 nucleotides The ~53 gene consists of 11 exons However, only 18 suitable oligonucleotides were found and used. 12. If a cDNA probe is available, it may not be necessary to synthesize oligonucleotides. The cDNA can be dlgested into primers of suitable lengths by cleaving the probe with several restriction enzymes (2) A good approach would be to choose restriction enzymes that cleave the cDNA in a way that generates primers within an exon This can be done with the help of a detailed restriction map of the cDNA probe.
References 1 Koch, J E., Kllvraa, S., Petersen, K. B , Gregersen, N., and Bolund, L (1989) Ohgonucleotide-priming methods for the chromosome-speafic labelling of alpha satellite DNA m situ Chromosoma 98,259-265. 2. HmdkJier,J., Koch, J , Mogensen,J , Pedersen,S., Rscher,H , Nygaard,M., Junker,S., Gregersen,N , Kolvraa, S., Therkelsen,A J., andBolund,L (1991)Prlmedm situ labellmg of nucletc acids Biotech Forum Eur. 12,752-756 3 Gosden,J., Hanratty, D , Starlmg, J., Fantes,J , Mitchell, A, and Porteous,D (1991) Oligonucleotide-primed m situDNA synthesis(PRINS), a methodfor chromosome mapping, bandmg,and investigationof sequenceorgamzatlon.Cytogenet Cell Genet. 57, 100-104 4 Thomsen,P. D , Hindkjrer,J , andChristensen, K (1992)Assignmentof a porcinemalespecificDNA repeatto Y-chromosomalheterochromatinCytogenet Cell Genet. 61,152154
5 Winter@,A. K , Fredholm,M., and Thomsen,P. D. (1992)Variable (dGdT), (dCdA), sequences m the porcinegenome.Genomux 12,281-288. 6. Wtllard, H F. andWaye, J. S (1987)Hierarchicalorderin chromosome-specific human alphasatelhteDNA Trends Genet. 3, 192-198 7. Choo, K H , Vessel,B., Nagy, A , andKalitsis,P. (1991)A survey of the genomlcdlstnbutton of alphasatelliteDNA on all the humanchromosomes, andderlvatlon of a new consensus sequenceNuclercAcids Res. 19, 1179-l 182 8 Waye, J S. andWillard, H F (1985)Chromosome-specific alphasatelliteDNA, nucleotide sequenceanalysisof the 2.0 kllobasepairrepeatfrom the humanX chromosome, Nucleic Acids Res 13,273 1-2743
9 Koch, J , Mogensen,J., Pedersen,S., Fischer,H., HmdkJrer,J , K@lvraa,S., andBolund, L (1992) Fast one-stepprocedurefor the detectionof nucleic acidsm situ by prlmerinducedsequence-speafic labelingwith fluorescein-1ZdUTPCytogenet. Cell Genet. 60, l-3. 10. Koch, J., HindkJaer,J., Mogensen,J., Kelvraa, S , andBolund, L. (1991) An Improved methodfor chromosome-specific labelingof c1satelliteDNA m situ by usingdenatured double-stranded DNA probesasprimersin a primedin situ labelmg(PRINS) procedure. GATA 8,171-178
CH~~PTER 10 Free Chromatin Henry
H. Q. Heng
Mapping
by FISH
and Lap-Chee
l?wi
1. Introduction Different strategies have been introduced to facilitate characterization of complex genomes; the techmques include molecular cloning, agarose gel electrophoresis and blot-hybridization analysis, DNA sequencing, construction of somatic cell hybrid lines, in situ hybridization, as well as genetic (linkage) analysis. Because of their wide application, numerous improvements have been made m each of these areas in recent years, for example, the use of pulsed-field gel electrophoresis (PFGE), yeast artificial chromosome (YAC), and fluorescence in situ hybridization (FISH) (1-4). Obviously, no single method can provide all the information required for detailed analysis of genomes with greater than several billion base parrs (bp) and each method has its limitation in range of resolution. A combmation of different techniques is therefore necessary for any large-scale gene mapping endeavors. FISH is probably the most versatile technique for physical mapping of mammalian genes (3-5). It combines the accuracy of molecular hybridization with fluorescence labeling, and the classical cytogenetic description of chromosomes to provide a rapid physical localization of genes and DNA segments of interest (5,6; see also Chapter 4). Besides its greater precision over radioactive labeling, which requires the use of photographic emulsion, FISH may be used to detect multiple gene segments simultaneously with different color labeling, and fluorescence signals may also be enhanced electronically. FISH mapping with metaphase or prometaphase chromosomes allows distinction of gene segments separated a few megabases (Mb) apart (7). With the increase of cloned genes and DNA segments, however, ordering of markers on individual chromosomes becomes an important aspect of physical mapping. Mapping with meiotic prophase chromosomes is one of the techniques being used in an effort to increase the resolution limits of FISH (8; see Chapter 12). The use of even less-condensedchromatins in the interphase nuclei or pronuclei further improves low-end resolution limits to around 50 kilobase (kb) pairs (9-11). As chromatin fibers assume a less condensed configuration, there is a concomitant loss of chromosome morphology. No banding pattern can be discerned with the highly extended chromatin fibers. Therefore, the high- resolution FISH techniques are mainly used for ordering genes that are known to be m close From Edtted
Methods m Molecular Bology, Vol 33 In Sttu /-fybnd/zatron by K H A Choo CopyrIght Q 1994 Humana Press Inc.
109
Protocols Totowa, NJ
Heng
110 CHROMOSOME
INTERPHASE NUCLEUS
and Tsui
FREE CHROMATIN
Fig. 1. Schematic diagram showing the prinicples of free chromatin mapping compared with FISH analysis using metaphase chromosome and interphase nucleus.
proximity. In addition, the convenience of FISH mapping with interphase nuclei or pronuclei is hampered by the three-dimensional organization of chromatin in the intact nucleus structure; a sophisticated imaging system is often required to trace the order of fluorescence signals. The data become even more difficult to interpret when the distance between markers increases. As for FISH mapping with pronuclei, sperm and animal eggs are cumbersome requirements for the procedure. We have recently developed a FISH mapping technique that proves to be an excellent solution to the above-mentioned problems associated with interphase nuclei and pronuclei. This technique, which we termed free chromatin mapping (12), employs the highly extended chromatin fibers (Figs. 1 and 2) released from the nuclei as the substrate for FISH mapping. When the chromatin fibers are well stretched and situated more or less flat on microscope slides, it is possible to obtain hybridization signals that are arranged linearly, reflecting the order and organization of target sequences in the genome. Although free chromatin structures are occasionally observed during routine metaphase chromosome preparations as spindle-shape or debris-like materials (23-IS), the frequency is too low to be practical for mapping studies. To improve the quality and reproducibility of free chromatin release, we have investigated various treatment conditions and found that some drugs are capable of inducing high-frequency free chromatin formation and that a
Free Chromatin
Mapping
by FISH
Fig. 2. Examples of free chromatin structures after DAPI or Giemsa staining. Panels A-C show the spindle-shape and rope-like free chromatin structures. Panel D shows one Giemsastained free chromatin.
high-pH buffer solution can also achieve the same results (22,15; unpublished data). Using the total human DNA sequence as a FISH probe, we showed that a single human chromosome could be easily identified in the background of hamster chromosomes of a somatic cell hybrid line (12). We also demonstrated
Heng
112
and Tsui
that hybridization signals from DNA sequences as close as 20 kb could be distinguished from one another and that sequences spread over 350 kb (and possibly over 2-3 Mb) of genomic DNA could be rehably ordered and mapped with respect to each other. In this chapter, we describe the detailed protocols for preparing free chromatin structures m high frequency and the methods for FISH detection. 2. Materials 2.1. Cells and Cell
Culture
1 Human lymphocytes (Isolated from healthy blood donors or cord blood) 2 Human and mouse frbroblastoid cell lines. 3 Human-hamster somatic cell hybrid lmes.
2.2. Media
and
Reagents
for
Cell
Culture
for lymphocyte culture, supplemented 1 RPM1 1640 with pemcillin/streptomycin with. 15% (v/v) fetal calf serum, 2% (v/v) phytohemagglutmm (PHA); and 5 U/mL heparin. 2 a-Minimal essential medium (a-MEM) for fibroblast cultures, supplemented with 10% fetal calf serum (biochemical selection may be used for somatic cell hybrid lines) 3 N-[4-(9-acrid~nylam~no)-3-methoxyphenyl]methanesulfonamide (m-AMSA, gift of the Drug Syntheses Branch, National Cancer Institute, Bethesda, MD). Prepare stock solutron by dissolvmg m-AMSA m dimethyl sulfoxrde at 10 mg/mL, dilutmg with equal vol of distilled water and filter-sterrhzmg. Store the solutron at 4°C (see Note 1). 4. 10 mg/mL Ethidium bromide (EtBr) (see Note 1). 5. 10 mg/mL 5-bromodeoxyuridme (BrdU) (see Note 1) 6. 10 mg/mL Hoechst-33258 (H-33258) (see Note 1). 7. 10 mg/mL Thymidine. 8. 10 pg/mL Colcemid
2.3. Alkaline
Lysis
Buffer
1. 1 mM sodium borate solution adjusted to pH 10-l 1 with NaOH 2. KC1 solutron, between 0 4% and 2%, determined empirically 3 Mix Parts 1 and 2 m 1 1 ratio before use
2.4. Microscope 1 2. 3 4. 5. 6
Slide
Preparation
Trypsin-EDTA solution. KC1 Methanol. Acetic acid. Microscope slides and covershps Giemsa stain solution.
2.5. Probes
Preparation
and
Fluorescence
1 Qragen plasmid purrfrcatron column (Qragen, Chatsworth, Buffers (may be attained from Qiagen)
Labeling CA).
Free Chromatin
2.
3. 4. 5 6. 7. 8. 9.
10
Mapping
Pl: 50 mM Tris-HCl, 10 mM EDTA, pH 8,O 1 mg/mL RNase, P2: 0.2M NaOH, 1% SDS; P3. 3.OM K acetate, pH 5.5, Washing buffer 1M NaCl, 50 mM MOPS, pH 7, 15% ethanol; and Elution buffer 1.25M NaCl, 50 mM Tris-HCl, pH 8.5, 15% ethanol. Solutions for YAC DNA preparation. YPD medium: 10 g Bacto yeast extract, 20 g Bacto peptone, and 20 g dextrose per liter of water. GDIS: 2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Trts-HCI, lmA4 EDTA. Phenol. Chloroform. Isopropanol. TE buffer. 10 mM Tris-HCl, pH 7.4,O.l mM EDTA. Bionick, brotin-labelmg tuck-translation kit (Gibco-BRL, Gaithersburg, MD) Nick column (Pharmacia, Uppsala, Sweden). Digoxigenin (DIG) labeling. 5X dNTP soluttons. 0.1 mA4 dATP, 0.1 mM dCTP, 0.1 mM dGTP, and 0.05 mM dTTP. 0 05 mA4 Dig-dUTP. 10X reaction buffer 500 mM Tris-HCl, pH 7 8, 50 mM MgCIP, 100 mM pmercaptoethanol, 100 l.tg/mL bovine serum albumin. Sonicated salmon sperm DNA (average fragment size 100-500 bp).
2.6. Prehybridization 1. 2. 3. 4. 5 6. 7. 8. 9 10. 11. 12
113
by FISH
and Hybridization
RNase A Human Cot-l DNA. Ethanol. Formamtde. 20X SSC: 3M NaCl, 300 mM sodium citrate. Denaturing solution: 70% (v/v) formamide, 2X SSC, adjusted to pH 7 with HCl Hybridization solution I (for suppression hybridtzatron): 50% formamtde, 2X SSC, 10% dextran sulfate. Hybridization solution II (for detection of satellite repeat sequences): 65% formamide, 2X SSC, 10% dextran sulfate. Sonicated yeast DNA (average fragment size 100-500 bp). Washing solution A (for cosmid and YAC probes). 2X SSC, 50% formamtde Washing solution B (for satellite sequence) 2X SSC, 65% formamide. Washing solution C 0 1M phosphate buffer, pH 8, with 0 1% Nonidet P-40.
2.7. Fluorescence
Detection
and Signal
Amplification
1 Blocking solution. 3% BSA, 4X SSC, 0.1% Tween-20 2. Detection solution: 1% BSA, 4X SSC, 0.1% Tween-20. 3. 500 pg/mL FITC avidin. Good for a few months rf stored at 4°C m dark. Dilute to 5 pg/mL wrth detection solution before use
114
Heng
and Tsui
4
500 pg/mL Biotmylated goat antiavtdin antibody. Store frozen at -20°C m 50FL portrons Dilute to 5 pg/mL with detection solutron before use. 5 200 pg/mL Antidigoxigemn-rhodamm Fab fragments Store at -20°C in lOO+L portions away from light. Dilute 1 10 wrth FITC detection solution before use Good for a few months if stored at 4°C m dark.
2.8. Chromosome
Counterstaining
1 4’, 6-dtamrdmo-2-phenylindole (DAPI): 0 2 mg/mL stock solution (1000X) in phosphate-buffered saline (PBS). Store in brown bottle at 4°C. 2 Propidmm iodide (PI) 0 1 mg/mL m PBS. 3. Antifade solution. 1 mg/mL p-phenylendiamme m glycerol PBS (9:l v/v), pH 9 0 Store at -20°C.
2.9. Microscope 1 Lertz Aristoplan eprfluorescent microscope wrth DAPI filter, FITC filter, and dual bandpass FITC/Texas red filter 2. DAPI excitation filter: BP 350460, reflector: RKP 510, emtsston filter. long pass 520 3. FITC excitation filter: BP 450-490, reflector: RKP 510; emission filter LP 520 4 Dual bandpass excitation filter: BP 480-505 + BP 560-595, reflector BP 505555 + BP 600-690, emission filter. BP 5 15-540 + BP 6 lo-690
2.10. Kodak Ektachrome black- and white-film.
Photographic
P800/1600
Films
E-6p color film and Kodak TMAX 400 ASA
2.11. Other Essential Items Plastic jars (25mL slide mailers), plastic slide holder, hot plate (WC), bator (37”C), and water baths (37-75°C).
mcu-
3. Methods 3.1. Free Chromatin Preparation 3.1.1. Preparation of Free Chromatin by Drug Treatment
(see Note 2) from Lymphocytes
1 Cell culture. Isolate lymphocytes from 10 mL of fresh human peripheral or cord blood by low-speed centrrfugatton (500 rpm for 5 mm m a clinical centrifuge) or unit-gravity sedrmentatton Collect the white cells by aspiration and transfer 0 50 8 mL of the isolated cells to 20 mL RPM1 1640 m a 50-mL culture flask (Falcon 3082 [Los Angeles, CA]) Keep the culture m COZ mcubator at 37°C without disturbance for 48-52 h before drug treatment (see Note 3) 2 Drug treatment. Treat the lymphocyte culture with various concentratton of mAMSA, EtBr, or H-33258 (between 1 and 20 /.tg/mL) for 2 h before harvesting (see Note 4). 3. Cell harvest and shde preparation a. Transfer 4 mL of the culture to a 15-mL disposable test-tube and collect the drug-treated cells by centrtfugatron at 1000 rpm for 7 mm. Resuspend the cell
Free Chromatin
Mapping
by FISH
115
pellet in 0 3 mL of culture medium, to which 5 mL of 0.4% KC1 solution is then added and mixed well Incubate the cell suspension at 37’C for 10 min b. At the end of the hypotomc treatment, add 0 l-O.2 mL of freshly prepared fixing solution (3:l methanol:acetlc acid) for prefixation. Mix the content gently by mvertmg the tube, then pellet the cells again by centrlfugation (1000 rpm for 7 min). c. Loosen the cell pellet by gently tapping at the bottom of the tube. Resuspend the cells m 5 mL of the fixing solution. Fix at room temperature for 20 mm. d Spin down the cells and resuspend in 0.5 mL of fixing solution. e. Allow 1 drop of the fixed cell suspension to fall onto the surface of a prechilled microscope slide (left on Ice for at least 1.5mm) Dry the slide in air by waving it back and forth. f. Stain the slide with 3% Giemsa solution (pH 6.8) for 5 min at room temperature, and examine the proportion of free chromatin structures under the mlcroscope The optimal drug concentration is then applied to the remainder of the cell culture for preparation of additional slides (see Notes 5 and 6). 4 Storage of slides Slides containing free chromatin preparations may be stored for several months at -20°C Once a good batch of slides is obtained, they should be dried at room temperature for 1 d and then sealed in slide containers with parafilm before transferring to the freezer. Overly dehydrated slides tend to damage the free chromatm structures irreversibly.
3.12. Release of Free Chromatin from Cultured Cells with Alkaline Buffer The rationale behind the use of alkaline buffer m the release of chromatm fibers from cultured cells is based on the observation that nuclear lamms could be disrupted by high-pH treatment (12,16). It is thought that the treatment destablizes the nuclear envelope, which can then be easily ruptured by the hypotonlc solution. Prolonged alkaline treatment, however, may break the nuclear envelope even without hypotonic shock. The following protocol is designed for fibroblastoid cell cultures. It may also be used for somatic cell hybrid lines or other cell types with modlflcations. 1. Cell culture. Grow fibroblasts in a-MEM for 2-4 d after reaching confluency m order to accumulate cells arrested at the Gl phase (see Note 7) 2. Cell harvesting. In general, add 1 mL of trypsin-EDTA (1X) solution to each 60-mm Petri dish. Incubate at 37°C for 30-60 s (see Note 8). Once the majority of the cells becomes detached from the dish, stop the reaction by adding 1 mL of culture medium with serum The next step should proceed quickly 3. Alkaline treatment. Since the optimal condltlon for each particular cell line has to be obtained empirically, a brief screening test 1s recommended: a. Prepare a series of tubes each containing 1 mL of alkaline buffer Transfer an aliquot (0.2-O 3 mL) of the trypsmized cell suspension into each of these tubes m drops and mix the content gently by tapping the tube At various time intervals (3-5 min), terminate the alkaline treatment by adding 5 mL of the fixing solutlon (methanol.acetlc acid, 3.1) (see Note 9)
116
Heng
and Tsui
b. Collect the alkaline-treated cell suspension by centrifugation (1000 rpm). Resuspend the cells in 5 mL of new fixmg solution. The remaming steps of slide preparation are as described in Section 3.1.1 , steps 3d-f (see Note 10). 3.1.3. Free Chromatin Preparation from Synchronized Lymphocyte Culture
Although free chromatm fibers may be obtained from different stages of the cell cycle by alkaline treatment, our unpublished studies show that chromatin fibers are most easily released from cells at the early Gl or late G2 phase. We reason that the nuclear envelopes are more fragile at these stages. To obtatn free chromatin from these stages,cell cycle synchronization by thyrmdme block is necessary. 1. Collect lymphocytes from 10 mL of heparmized blood and resuspend m 3-4 flasks with 20 mL of a-MEM (supplemented with PHA and 15% fetal calf serum) for 48-52 h m a COz incubator at 37°C 2 Add thymidine (0.3 mg/mL) to the culture and continue the mcubation for an additional 16 h. 3. Collect the cells by centrifugation Wash three times with warmed, serum-free medium (10 mL each), and resuspend m 20 mL of a-MEM. 4 Continue the culture for 10 h before harvest, and prepare the slides in the same manner as in Section 3 1 l., step 3. 3.1.4. Preparation of Free Chromatin Fibers from Uncultured Human Cord Blood
Since most of the cells in the human cord blood are arrested m the Go phase, near the Gl phase, they are excellent materials for free chromatin preparation, Good quality chromatin fibers may be obtained from these cells by a sample hypotonic shock; no drug treatment or alkaline buffer is required. As discussed above, the yield of free chromatm structures will decrease once the cells are transferred to RPMI 1640 and allowed to grow in culture. 1. Isolation of lymphocytes from cord blood The procedures are the same as described in Section 3.1.1., step 1. 2 Hypotomc treatment As the optimal condition varies depending on the indivrdual donor, the optimal condmon of the hypotonic treatment may be determined by controllmg the treatment time (10-120 mm) with 0 4% KC1 solution or by varying the KC1 concentration (0 l-OS%) with a 30-min treatment. a Divide 0.5 mL of isolated lymphocytes from 5-10 mL of blood equally into 5 tubes (15mL conical culture tubes) b. Add 4 mL of KC1 hypotonic solution (e g., 0.4% KCl) to each of the tubes; mix well. Incubate at 37’C. c. At 5, 10, 20, 40, and 60 min, add 0.5 mL of fixing solution (3:l methanol:acetic acid) to one of the tubes, mix well and collect the cells by centrifugation
Free Chromatin
Mapping
by FISH
117
d Prepare slides as described in Section 3 1.1.) step 3, except that the amount of time for fixing may be reduced to 5 min. Stain with Gremsa (3% solutron for 5 min), and check sample under the microscope (see Note 11) 3. Slide preparation and storage. same as in Section 3.1.1.) steps 3 and 4
3.2. In Situ Hybridization 3.2.1. Probe DNA Preparation 3.2.1.1.
and Labeling
DNA ISOLATION
1. Cosmid DNA is separatedfrom E. coli host DNA by using the Qiagen column (Qiagen, Inc.) according to the manufacturer’s recommendation (seeChapter 4) 2. YAC DNA is extracted along with total yeast DNA as described (17, see Chapter 4)
3.2.1.2.
PROBE LABELING
1 Biotinylated DNA probe is prepared by using the BRL BloNick kit (BRL). 1 pg of DNA is used per reaction. The size of the nick-translation products may be examined by agarosegel electrophoresls,successfullabeling usually gives fragments around 150-250 bp The reaction is performed at 15“C for 1 h for cosmid probes or 2 h for YAC probes 2. If a secondlabel is required, digoxigenin-dUTP may be used A .50-pL reaction is normally used to prepare 1 pg of probe DNA The cocktail contains 10 pL 5X dNTP, 5 pL of the 10X reaction buffer, DNA, and distilled water made to 45 JIL, and 5 p,L of BRL nick-translation enzyme solutron, which is the last ingredient to add. 3 Separatethe unmcorporated nucleotidesfrom the labeledprobe by using the Nick column (Pharmacia) 4. Add 60 pg of somcatedsalmonspermDNA to the labeledprobe along with 40 pL of 3M Na acetate and coprecipitate with the addrtion of 880 pL of cold ethanol Wash the pellet with 70% ethanol, air-dry, and resuspendin 20 l.tL of TE buffer.
3.2.2. Probe Prehybridization 1 For probes contammg dispersed repetitive DNA sequences(such as phage, cosmid, or YAC clones of genomic DNA), suppressionby prehybridlzation to total genomic DNA or Cot-l DNA is required Accordmgly, mix 20-50 ng of cosmid or phageDNA, or 200-250 ng of YAC DNA with 2 pg of Cot-l DNA (or total human DNA) in 13 p.L of hybridization buffer I After denaturatlon at 75°C for 5 min, incubate the mixture at 37’C for 15-30 min for probe prehybridization If total YAC DNA is usedasprobe, add 2 pg of yeast DNA to the prehybridization reaction. 2 No prehybridrzatlon is necessaryfor single-copy or a-satellite sequences.Heat 20-50 ng of probe DNA at 75’C for 5 mm m 15 pL of hybridization buffer II, and transfer to ice immediately.
3.2.3. Slide
Preparation
for Hybridization
1 Bake the free chromatm- (or metaphasechromosome-)containing slidesat 55’C for 2 h just before use
118
Heng
and Tsui
2. Treat the baked slides with RNase A (100 l,tg/mL m 2X SSC in a 25mL jar) at 37°C for 1 h; rinse once in 2X SSC; dehydrate by dipping in 70, 90, and 100% ethanol consecutively for 3 min each and then air-dry. 3 Briefly bake the slides at 55°C and then immerse them for 2 min in freshly prepared denaturatton solution preheated to 70°C. Several slides may be treated at the same time in a 25mL slide jar secured m a water bath. 4 Quickly transfer the slides mto a jar containing ice-cold 70% ethanol for 2 min Dehydrate the slides by going through 95 and 100% ethanol for 3 mm. Air-dry and hybridize immediately. 3.2.4. Hybridization 1. Transfer 15 uL of the probe solution to each slide. Cover the reaction with a 22 x 40 mm coverslip. Avoiding air bubbles, seal the edges with rubber cement to prevent evaporation. 2. Incubate the slides at 37°C in a moist chamber contaming absorbent paper soaked m water. For a-satellite (or other repetitive) probes, hybridize for 3-16 h For cosmid or YAC probes, the Incubation time should be 18-36 h. 3.2.5. Posthybridization Wash Different condltlons are used to wash the slides after hybridization, mg to the nature of the probes.
accord-
3.2.5.1. FOR COSMID AND YAC PROBE 1. Prepare three plastic ears filled with washing solution A, and 3 jars of 2X SSC prewarmed to 46’C. 2. Carefully remove the rubber cement from the slides by forceps. Dip the shde in 2X SSC and allow the covershps to float off. Agitate the shdes in the solution a few times. 3 Immerse the slides in the prewarmed washing solution A three times for 3 min each (agitating gently) and wash further m 2X SSC three times for 3 min each. 3.2.5.2. FOR OI-SATELLITE AND OTHER REPETITIVE DNA PROBES 1. Prewarm washing solution B to 43°C and 2X SSC at 37°C. 2. Remove rubber cement and coverslips 3 Gently agitate the slides in the prewarmed washing solution for 20 min. 4 Rinse the slides in prewarmed 2X SSC (at 37°C) three times for 3 min each 3.2.6. Detection
and Amplification
of Fluorescence
Signal
3.2.6.1. ONE-COLOR LABELING WITH SIGNAL AMPLIFICATION 1. Immerse the washed slides in 4X SSC, then m washing solution C for 3 mm each. 2 Blot excess liquid from the edges of the slides. 3. Quickly apply 30 u.L of blocking solution to each slide Place a plastic coverslip over the solutton, and incubate at room temperature for 5 mm 4. Gently peel off the plastic coverslip. 5. Apply 30 p,L of FITC-avidin to each slide. Cover the solution with a piece of new plastic coverslip. Incubate the slides at 37°C for 20 min in a humidified chamber
Free Chromatin
6. 7 8. 9 10 11. 12 13. 14 15.
Mapping
by FISH
119
with light-protected cover. (From this step onward, rt IS very important to keep the slides away from light ) Remove the covershps and rinse the slides m 4X SSC and washing solution C at room temperature three times for 3 min each Apply 30 ltL of blocking solution to each slide. Cover the solution with a plastic coverslip, and leave the slide at room temperature for 5 mm Add 30 pL of biotinylated goat antiavidin antibody to each slide. Replace the coverslip and incubate at 37’C for 20 min Remove the coverslip and transfer the slides consecutively into 4X SSC, washing solution C, three times for 3 min each Apply 30 l.tL of blocking solution to each slide. Place a plastic covershp over the solution and incubate at room temperature for 5 mm. Peel off the plastic coverslip Apply 30 pL of FITC-avidin to each slide Cover the solution by a piece of new plastic coverslip, and incubate the slides at 37’C for 20 min in a humidified chamber with light-protected cover. Remove the coverslips and rinse the slides in washing solution C, and then 2X SSC at room temperature for 3 mm each. DAPI-staining. Immerse the slides in a 0 2 pg/mL DAPI m 2X SSC at room temperature for 5 min and rinse them in 2X SSC three times for 1 mm each Overlay the sample with 10 l.rL of antrfade solution and cover with a 22 x 40 mm coverslip, gently press the coverslip to exclude excessive hquld. PI counterstaming of the free chromatin may be applied before this step or used together with the antifade solution by mixing them before loading.
3.2.6.2. ONE-COLOR LABELING WITHOUT SIGNAL AMPLIFICATION 1 Immerse the washed slides in 4X SSC, then in washing solution C for 3 min each. 2. Blot excess liquid from the edges of the slides. 3. Quickly apply 30 l.tL of blocking solution to each slide. Place a plastic coverslip over the solution and incubate at room temperature for 5 min 4. Gently peel off the plastic coverslip. 5. Apply 30 pL of FITC-avidin to each slide Cover the solution with a new plastic coverslrp. Incubate the shdes at 37°C for 20 mm in a humidified chamber with light-protected cover. (From this step onward, it is very important to keep the slides away from light ) 6. Remove the coverslrps and rinse the slides in 4X SSC and washing solution C at room temperature, three times for 3 mm each. 7. DAPI-stammg: Immerse the slides in a 0 2 pg/mL DAPI m 2X SSC at room temperature for 5 min and rinse them in 2X SSC, three times for 1 min each. 8. Overlay the sample with 10 pL of antifade solution and cover with a 22 x 40 mm coverslip; gently press the coverslip to exclude excessive liquid. PI counterstaming of the free chromatm may be applied before this step. 3.2.6.3. TWO-COLOR LABELING WITHOUT SIGNAL AMPLIFICATION 1 Follow all the steps as m Section 3 2.6.2., except that in step 5 add antr-drgoxigenin-rhodomin fragments together with FITC-avidin.
120
Heng and Tsui
2. Combine 100 PL of antidigoxigenm-rhodamin fragments, 10 p.L of FITC-avidin, and 890 j.tL of detectton buffer 3 Apply 30 pL of the above solution to each slide Incubate the slides at 37’C for 20 min with light protection. Wash them m washing solutron C and 2X SSC at room temperature. Mount slides as described m Section 3.2 6.2., step 8, except no proprdium todrde (PI) counterstainmg is used. 3.3. Microscopy and Photography The slides may be examined immediately after the addition of the antrfade solution. Frrst identify free chromatin structures under the microscope with the DAPI filter. Switch to the FITC filter to localize the FISH signals. To avoid signal fading, these steps should proceed quickly. For the Kodak Ektachrome P800/1600 color film, push the exposure to 3200 ASA (exposure times: < 1 s for DAPI fluorescence image, 4-7 s for PI and/or FITC, 30-100 s for rhodamm/ FITC or Texas red/FITC). Slightly longer exposure time is requrred for the Kodak 400 ASA black-and-white film.
4. Notes 1. EtBr, BrdU, and H-33258 are light-sensrtrve reagents; they and m-AMSA are toxic reagents. Careful handling 1s needed. 2. Three different protocols may be used to prepare free chromatm from late G2 or early Gl (Go) cells. The high pH buffer is recommended for obtaining free chromatm from cultured tibroblasts lines, while the Go phase hypotonic treatment may be used for the lymphocytes. The drug treatment 1sthe original method with which increased frequency of free chromatin was first observed, although the experimental steps are tedious, different drugs may be used to delineate the chromosome condensation process 3. Human cord blood 1s preferred as the source of lymphocytes because it is easier to obtain good free chromatm preparations with this material than with peripheral blood In addition, a large amount of cells may be obtained from the same individual for both optimization and test experiments. It is important that the cells should not be cultured longer than the recommended duration; the yield of free chromatin would decrease appreciably if the culture is allowed to continue for 68-72 h, which is the amount of ttme normally recommended for metaphase chromosome preparations. Our data (unpublished) show that the longer the cells are grown in culture, the fewer chromatm fibers can be obtained, regardless of the subsequent drug or other treatment regimes. 4 The concentration of drug required to achieve the desired results varies among different blood samples. The optrmal concentration may be titrated with 5, 10, or 20 l.tg/mL for portions of the culture at around 44-46 h of mcubatron. After determining the best results by examinatron of the slides (see text), the optrmrzed concentration is applied to the remaining cell culture at 48-50 h of incubation 5. For titration of optimal drug concentratron, the procedure is the same as described above (steps a-f), but the amount of time for methanol/acetic acrd fixing may be reduced to 5 min. 6 While free chromatins are useful for ordering DNA and gene segments, conventional metaphase chromosome spreads may be prepared on the same slide
Free Chromatin
7.
8
9.
10.
11
Mapping
by FISH
for use as controls in FISH analysis. The procedures for cell culture and chromosome preparation for the latter purpose are simrlar to that described above except that the cells are treated with colcemid (0 1 pg/mL) for 2 h at 46 h postmcubatron One drop of free chromatin suspensron and 1 drop of chromosome suspension should fit on the different regions of the same slide. The two samples may be prepared at drfferent times, the suspension of free chromatin or chromosomes may be kept at 4°C for as long as 2 d before the other sample 1s ready. The hybridization pattern is often easier to interpret with free chromatins prepared from the Gl phase before DNA rephcation than those from the G2 phase, after DNA replication If nonfibroblastord cell types are used, cell cycle blockers may be used to synchronize the cell culture before harvest (see text). Since prolonged treatment with trypsm may overly sensitize the nuclear membrane (especially under shghtly alkalme pH), this step should be momtored carefully. Special attentron 1srequired for some cells that are particularly sensrtrve. It 1seasy to tell rf the cells are overtreated with trypsin, because the solution would then become very stocky upon additron of the alkaline buffer. In addition to the length of treatment, the pH of the buffer (10-l 1 S) and the concentration of KC1 (0 4-4%) also affect the yreld of free chromatin. In general, high pH promotes, and KC1 retards, lysis. A higher concentration of KCl, which however, requires a longer time of hypotomc treatment, and will produce longer free chromatins The conditrons can be varred systematrcally to find the optrmal combmation for a given cell line Whtle high percentage of free chromatin structures are desirable for slide preparation and FISH analysis, overtreatment will destroy the 300-A structure and lead to production of naked DNA strands, whrch are extremely drfficult to handle in subsequent steps. To obtain the best results, one should try to fix the chromatin fibers quickly before they are aggregated with each other after released from nuclei. The use of a small vol of alkaline buffer and a large vol of the prefixmg solution is a good way to avoid aggregatron of free chromatin fibers, High-pH solution alone (without buffer) may also be used to produce free chromatm but the timmg is more drfficult to control Once the optimal condrtron IS obtamed, repeat the steps for large-scale shde preparation. Metaphase chromosome spreads are recommended as FISH controls, as discussed above To obtain metaphase chromosomes from actrvely growing fibroblastoid cells, colcemid treatment (0.1 pg/mL, 30-60 mm) 1s applied to a subconfluent culture seeded 24 hr prior to harvest. The procedures used for microscope shde preparation and storage are the same as described above (see Note 6). Process each sample immediately, do not wart for the other samples that are still under the hypotoruc treatment The optimal condition is then used for large-scale slide preparation. 0.3-O 5 mL of isolated lymphocytes may be treated in the same tube; more tubes should be used for larger numbers of cells to avoid aggregation of free chromatins
Acknowledgments We thank P. Moens, B. Spyropoulos, and J. Squire for valuable dtscussrons. We also thank Xrao-Mel Sht for her excellent technical assistance. The re-
122
Heng
and Tsui
search was supported by grants from the Howard Hughes Medical Institute (International Scientist Award to L.-C. Tsui) and the Medical Research Council of Canada through a Studentship Award to H. H. Q. Heng, and the Canadian Genetic Disease Network to L.-C. Tsui. References 1 Schwarts, D C and Cantor, C. R. (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis Cell 37,67-75 2 Burke, D. T , Cark,Cl.F , andOlson,M. V (1987)Clonmgof largesegments of DNA mto yeastby meansof artrfrcralchromosome vectors Scrence236, 806-812 3 Trask, B. J. (1991) Fluorescencem srtu hybridization applicationsin cytogeneticsand genemappingTrends Genet 7,149-154 4 Lrchter, P.,Boyle, A., Cremer,T., andWard, D (1991)Analystsof geneandchromosome by nonisotopicin situ hybridization.Genet Anal Techn Appl 8,24-35 5 Heng,H H. Q. andTsui, L -C (1993)Modesof DAPI bandmgandsimultaneous in situ hybrtdtzatton Chromosoma 102,325-332 6 Heng, H H Q , Shi, X -M , and Tsui, L-C (1993) Fluorescencein situ hybrtdization mappmgof the cystic fibrosis transmembrane conductanceregulator (CFI’R) gene to 7q313 Cytogenet Cell Genet 62, 108,109 7 Lrchter, P , Tang, C C , Gall, K , Hermanson,G., Evans,G , Housman,D., andWard, D (1990) High-resolutronmappingof humanchromosome11by m situ hybrtdtzatton wrth cosmidclones Science 247,64-69 8 Moens,P and Pearlman,R E (1990) In srtu DNA mappmgwrth surface-spread mouse pachytenechromosomesCytogenet Cell Genet 53,219,220 9. Ferguson-Smrth, M. A (1991)Invtted edttorral.putting the genettcsback mto cytogenetits Am J Hum Genet 48,179-182 10 Trask, B., Pinkel, D., and Engh, G. V. D (1989) The proxtmity of DNA sequences in interphasecell nuclei is correlatedto genomtcdistanceand permitsorderingof cosmids spanning250ktlobasepairs Genomtcs 5,710-717 11. Brandriff, B., Gordon, L., andTrask, B. (1991) A new systemfor high-resolutionDNA sequencemappingin interphasepronucler.Genomics 10,75-82 12 Heng,H. H. Q,, Square,J., and Tsur,L.-C. (1992)High resoluttonmappingof mammalian genesby m sztu hybrrdrzatronto free chromatin.Proc Natl. Acad Scl USA 89, 95099513. 13 Heng,H H Q andChen,W Y (1985)The studyof the chromatinandthe chromosome structurefor Bufo gargarlzans by the light mrcroscope..I Stchuan Unrv. Natural Science 2,105-108
14 Heng,H H Q andChen,W Y (1986)Studieson the structureof the chromosome andtts formation,I A new method.Nucleus 29, 5-8 15 Heng, H H Q , Chen, W Y , and Wang, Y C (1988) Effects of pingyanymycm on chromosomes. a possiblestructuralbastsfor chromosome aberrationMutation Res. 199, 199-205
Raymond,Y. (1990)Differential effect of pH on solubrhzatronof nuclearlaminsA/C and B Cell &ol Int Rep 14, 165-171 17 Scherer, S. and Tsut, L.-C (1991) Clomng and analysrsof large DNA molecules,m Advanced Technrques w Chromosome Research (Adolph, K , ed ), Marcel Dekker, New York, pp 35-72 16
CHAPTER 11
Use of DNA-Halo Preparations for High-Resolution DNA In Situ Hybridization Anton
K: Raap
and Joop Wiegant
1. Introduction The past 10 years have witnessed an increasing application of in situ hybridization techniques in biomedical research. This is mainly a result of the development of nonradioisotopic nucleic acid hybridization detection formats. Such methods allow much better exploitation of the spatial resolution provided by light microscopy than radioisotopic detection formats such as microautoradiography (I,2). Also the spectral resolution of light microscopy can be used to advantage with such methods, because they readily enable the simultaneous detection of multiple nucleic acid sequence targets on the basis of dtfferent colors (3-5). In situ hybridization techniques are now accepted as powerful research tools in molecular cell biology and genetics (for reviews see refs. 6-8). In this chapter we address high-resolution in situ hybridization techniques for DNA mapping purposes. The resolutions that can be obtamed by in situ hybridization to (pro)metaphase and interphase nuclei are first discussed. This is followed by a detailed description of the protocols for producing so-called DNA-halo preparations from primary human fibroblasts. In such preparations, the DNA is expelled from the nuclei in large loops consisting of naked DNA (9). Multicolor in situ hybridization to such halo preparations permits rapid DNA ordering and mapping in the lo-200 kb range (10). 1.1. Chromatin Condensation and Resolution of In Situ Hybridization At the level of the isolated DNA double helix, the spatial distance between DNA sequencesmeasured, for example, in micrometers @m), is linearly related to their physical DNA distance (genomic distance) measured, for example, in kilobasepairs (kb). In genetically important biological structures such as mammalian chromosomes at metaphase or interphase, the DNA is present in chromatin of various degrees of condensation. The higher the degree of chromatm packing, the lower the DNA resolution of in situ hybridization (11). For in situ hybridization to (pro)metaphase chromosomes, the relatively high level of From E&ted
Methods m Molecular Brology, Vol. 33 In SIIU Hybnduatron Protocols by K t-l A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
123
Raap
124
and Wiegant
chromatm condensation limits the resolution at the lower end of the range to about 3 megabaseparrs (Mb) (i.e., the amount of DNA present in the smallest band that can be resolved by light microscopy), while at the upper end there are no technical and only biological limitations. Hence, with in situ hybrldlzation to (pro)metaphase chromosomes a given DNA clone can be assigned to a chromosomal band or sub-band. Combined in situ hybrldizatlon and banding procedures are available (12-14). For obtaining higher DNA resolutions by zn sztu hybndlzatlon, Lawrence and coworkers (2) have proposed to use interphase nuclei, which by their more relaxed chromatin condensation state, provide dramatically improved resolution (II). Extensive distance measurements between pairs of signals derived from cosmlds isolated from a number of genomic regions have shown that in the 50 kb-1 Mb range there is a lmear relation between the DNA distance and the measured spatial distance of the in situ hybridization signals (1516). Recently such experimental data have been given a theoretical basis by assuming a random walk model for DNA m interphase nuclei (I 7). Although exceptions to the rule of the linear relation between spatial and genomic distance in mterphase have been noted (Z??),Interphase mapping m combination with metaphase mappmg technique is very well suited for rapldly constructing chromosomal maps of lOO-kb resolution (17). To achieve higher resolutions by in situ hybridization, the use of a blological object possessmg a higher degree of chromatm decondensatlon has been proposed, namely human pronuclei produced by human sperm-hamster egg fusions (19). However, this IS impractical because the methodology is labonous, not widely available, and reqmres specific expertise. Furthermore, only few pronuclei are produced per fusion experiment. To circumvent this problem we have used a nuclear extraction technique that, by detergent- and high saltextractions and a DNA relaxation treatment, results m chromatin that IS decondensed to the level of the Watson-Crick DNA double helix (9). In sztu hybridization to such DNA-halo preparations may contribute to DNA mapping efforts at relatively short range (lo-200 kb) as well as to the characterization of breakpoints, mlcrodeletions, and small duplications. 2. Materials 2.1. Preparation of DNA
Halos
1 Cultured human foreskin fibroblasts 2. Microscope object slides (sterilized) 3. Dulbecco’s medium supplemented with fetal calf serum, pemclllm, streptomycin, and glutamine. 4. PBS: 8 g NaCl, 0 29 g KC& 1 449 g Na2HP04, 0 249 g KH,PO, per liter. 5. Extraction buffer 1.0 5% Nonidet NP-40, 10 mM MgCI,, 0 5 mM CaCl,, 25 mM Tris-HCI, pH 8.0, 1 rruV phenylmethylsulphonyl fluoride 6 Extraction buffer 2: 2M NaCl, 0.2 mA4 MgC12, 25 mA4 Tris-HCl, pH 8 0
High-Resolution 7. 8. 9. 10. 11. 12
125
DNA-ISH
Wash buffer 1’ 0.2M NaCl, 0 2 mA4 MgCl,, 25 mM Tris-HCl, pH 8.0 Wash buffer 2: 0.2 mM MgC12, 25 mM Tris-HCl, pH 8.0 Propidium iodide. 50-mL tubes. Glass plate on crunched me. UV lamp, 254 nm.
2.2. In Situ Hybridization 1. 2. 3. 4. 5. 6
7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17 18. 19. 20. 21.
Probe DNA DNA polymerase 1 from E. coEi (Promega, Madison, WI). DNase 1 (Boehringer-Mannheim, Mannheim, Germany). 10X nick-translation buffer: 0.5M Tris-HCl, 50 mM MgClz, 0.5 mg/mL BSA (nuclease free), pH 7.8 dNTPs (Boehringer). Prepare an unlabeled stock nucleotide mixture of 0.5 mM dATP, dGTP, dCTP, 0.1 mM dTTP. Hapten- or fluorochrome-modified dUTP Biotin-, digoxigenin-, fluorescem-, rhodamine-, and coumarin-modified dUTP are from Amersham (Arlmgton Heights, IL) or Boehringer. The present protocol focuses on biotin and drgoxigenin. Sephadex G-50. Deionized formamide for hybridization solutions. Formamide for posthybridization washings. 20x ssc. Biotin detection reagents* avidm-Cy3, biotinylated antiavidin (Vector, Laboratories, Burlingame, CA). Digoxigenm detection reagents: mouse antrdigoxigenin (Boehringer), rabbit antimouse Ig-FITC (Sigma, St. Louis, MO), goat anttrabbit-FITC (Sigma). Nonfat dry milk (Carnation). Herring sperm DNA, fragmented. Yeast RNA. Dextran sulfate. Human Cot-l DNA (Life Technologies, Gaithersburg, MD). TNT buffer: O.lM Trts-HCl, pH 7.4, 0.15M NaCl, 0.05% Tween-20. Mounting medium with antifading reagent. Originally we used diaza-bmyclooctane as antifadmg reagent, but recently better results have been obtained with Vectashreld from Vector Laboratories. Epifluorescence microscope equipped with high-transmisston dual bandpass filter sets 3M color slide film, 640 ASA.
3.1. Preparation
3. Methods of DNA Halos
(see Note 1)
1. Seed fibroblasts on the microscope object slides at a density of about 2500 cells/ mm2 and culture in Dulbecco’s medium at 37°C and 5% C02. The density of cells may be adapted to the investigator’s need. 2. Perform steps 3-6 at O’C. 3. Wash twice with PBS.
Raap
126
and Wiegant
4. Dip 45 s m extraction buffer 1 5. Dip 45 s in extraction buffer 2 6 Dip 45 s again in extr,tctlon buffer 2, which now contains 40 pg/mL propldmm iodide 7. Place the (wet) slides on an ice-cold glass plate and irradiate with 254-nm UV light (7000 pW/cm2) for 7 min. 8 Wash 45 s each with wash buffer 1, wash buffer 2, and twice with HZ0 at O’C. 9. Allow to air-dry at room temperature. 3.2. Labeling of Probe by Nick 1 Prepare the followmg labeling mixture at 0°C Filtered distilled water Nick-translation buffer (10X) DTT (0 1M) Nucleotide mix (0 5 mM dA,dG,dC; 0 1 mMdT) Btotin- 1 l-dUTP (1 mM) Probe DNA (1 g/L) DNA polymerase I (10 U/L) DNase I (1: 1000 of 1-mg/mL solution)
Translation
26 pL 5 PL 5PL 4PL w 1w
2
2PL
5w
For labeling with dlgoxigenm, replace the blotm-11-dUTP with 2 pL of dlgoxlgenin- 1 l-dUTP. 2. Incubate the labelmg mixture for 2 h m a 15°C water bath. 3 Add 5 pL 0.5M EDTA (pH 8) to the labeling mixture and put on ice. 4 Purify the labeled probe by gel filtration. Use for this purpose a Pasteur pipet (150 mm) filled with TE-equilibrated Sephadex G50 and previously flushed with 50 pg herring sperm DNA and 50 pg yeast RNA.
The remainder of this protocol is written for complex DNA probes that conelements and therefore require a preannealing step with unlabeled total genomic DNA or its Cot-l fraction to prevent the repeat sequences from participation in the in situ hybridization reactlon (20,21).
tain repetitive
1 2 3 4 5. 6.
7.
3.3. Preparation of Hybridization Solution Mix 50 p.g of herring sperm DNA, 50 pg of yeast RNA, and a 50-fold excess human COT1 DNA; Add 0 1 vol 3h4 sodmm acetate (pH 5 5), mix well Add 2.5 vol of 100% ethanol (-20”(Z), mix well. Keep for 30 mm on ice and spin down the DNA at 12,000g for 30 mm at 4°C Remove supernatant. Dissolve the pellet m 50% deiomzed formamide, 2X SSC, 50 mM sodium phosphate, 10% dextran sulfate, pH 7, preheated to 37*C, at a probe concentration of 10 ng/uL. Take care to fully dissolve the DNA, e.g., by mcubation for 15 mm at 37°C. This will be referred to as the probe stock solution Take the required amount of labeled probe DNA from the stock solution and adjust the volume to the desued concentratton of probe. For cosmid hybrid-
High-Resolution
DNA-ISH
127
ization we use 20 ng per probe per target area (10 pL hybridizatron mixture per 18 x 18 mm*). 8. Denature the probe DNA for 5 min at 75°C. 9 Put on me for 1 min, then spin briefly. 10. Preanneal for 15-30 min at 37°C.
3.4. Denaturation and In Situ Hybridization of the DNA-Halo Preparations 1, Apply 120 l.tL of 70% deionized formamide, 2X SSC, 50 mM sodium phosphate, pH 7, solution on the slide. 2. Cover the solution with a 24 x 60 mm* coverslip 3. Denature the DNA 2-3 mm on an 80°C hot plate 4. Remove the coverslip. 5 Place the slide drrectly in 70% ethanol (-20°C) Wash two times, 5 min each 6. Dehydrate the shde through a 90 and 100% ethanol serves, each for 5 mm. 7. Place the slide on a plate of 37”C, and leave it there to dry. 8. Apply 10 j.rL of the preannealed probe mrxture per target area on the denatured shde 9. Cover the probe mixture with a 18 x 18 mm2 coverslip. 10. Hybridize overnight at 37°C m a moist chamber (motstening medium. 50% formamide, 2X SSC, pH 7)
3.5. Posthybridization
Washings
1. Prewarm a 50% formamide/2X SSC, pH 7 solution, to 45°C. 2. Prewarm a 0.1X SSC solutton to 60°C 3. Immerse the slides in the formamide solution and remove the covershp by gently shaking 4. Wash the slide three ttmes for 5 min each in the formamide solution at 45’C 5. Wash the slide additionally three ttmes for 5 min each in 0.1X SSC at 60°C.
3.6. Immunofluorescen
t Detection
The followmg protocol permits simultaneous detection of biotm- and dlgoxigenin-labeled probes. It uses fluorescein as a green and Cy3 as a red fluorescent reporter molecule, respectively. 1. Wash brrefly with 4X SSC, 0 05% Tween-20 2. Block for 30 min at room temperature with 4X SSC, 5% nonfat dry milk, and wash briefly to remove coverslip 3 Incubate for 30 min with avidm-Cy3 (2 pg/mL) m 4X SSC, 0.05% Tween-20 at room temperature. 4. Wash three times for 5 min each with 4X SSC, 0.05% Tween-20, and once for another 5 min each with TNT buffer at room temperature for 30 min. 5. Incubate with biotmylated goat antravidin (5 pg/mL) and mouse antrdigoxrgenm (0.5 pg/mL) m TNT buffer at 37’C. 6. Wash three times for 5 mm with TNT buffer at room temperature. 7 Incubate with avidin-Cy3 (2 ttg/mL) and rabbit antimouse-FITC (1: 100) m TNT buffer at 37°C
Raap 8. 9 10. 11. 12. 13
and Wiegant
Wash three times for 5 mm each wtth TNT buffer at room temperature. Incubate with goat antirabbit-FITC (1.100) in TNT buffer at 37’C Wash three times for 5 min each with TNT buffer at room temperature. Dehydrate with a graded series of 70, 90, and 100% ethanol. Air-dry and embed in Vectashleld mounting medium. Inspect and photograph results with a modern eptfluorescence microscope equipped with a dual bandpass filter set. For the FITC-Cy3 fluorescent dye combination we have used the 51004 filter set from Chromatechnology (Brattleboro, VT) Use high numertcal aperture lenses, e g., 63x, N.A. 1 3 or 100x, N A. 1.3.
(See Notes 2-4 for discussrons on resolutton, the DNA-halo technique.)
limitation,
and application
of
4. Notes 1 Imperfect DNA-halo preparations are required for DNA mapping. Possibly as a consequence of the an-drying process, a large fraction of the nuclear matrix attachment sites are disrupted. For >90% of the cells, this leads to arrays of large DNA loops which are linear or near-to-linear for the larger part. Loop lengths of 200 pm and more are not uncommon. It IS this reproducible artifact that 1s used for ordering purposes. 2. Resolutton and efficiency. Thus far, most of our experience with in situ hybridizatton to DNA-halo preparations has been obtained with alphoid and cosmid DNA probes (Figs. 1 and 2, respecttvely). Cosmrd signals are seen as beads-ona-string, in which lo-15 beads can be seen on a string of about 10 pm m length for the fully decondensed chromatm. When two cosmids are physically separated more than 200 kb apart, it may become difficult to spatially relate two differently labeled cosmids to each other. Hence the upper limit of the resolution is about 200 kb. In the overlappmg common regton (e.g., lo-15 kb) of two differently labeled cosmlds, the red and green signals can be seen intermmgled, whrle the ends of the hybridized string show only red or green signals. Hence, at the lower end, the resolution range is about 10 kb. Recent experiments with a set of unique plasmlds isolated from a cosmid have indicated that the lower limrt can be as good as 1 kb Cosmids that have proven to give signals in metaphase- or interphase cells generally work well with halo preparations. In more than 90% of the cells, beadson-a-string-like signals can be obtained Gaps, overlaps, or probe order are usually apparent after screenmg about 10 cells. 3. Ordering and mapping For determining DNA order and spacing, the approaches for interphase mapping can be used in principle. These mvolve assessing distances between hybridization signals derived from pairs of DNA, or brcolor in situ hybridizations. Accurate determination of spacing by distance measurement can only be done when tt IS beyond doubt that the DNA separating the two signals is linear. When there is doubt about the spatial relationship between two signals, the problem may be solved by hybridizing the intervening DNA in another color using a yeast artificial chromosome (YAC) spanning the regton of interest. As this high-resolution in situ hybridization technique is relatively new, extensive quantitative data are lacking. Hence, a statement about the accuracy of mapping cannot be made at this time
Figs. 1 and 2 (see color plate number 1 after p. 172). (Fig. 1, left) In situ hybridization to DNA-halo preparations of human fibroblasts using biotinylated alphoid DNA specific for chromosome 17. Note the stretched-out signals, which cover up to several megabases of the tandemly repeated alphoid DNA on each chromosome 17. (Fig. 2, right) Redandgreenbicolor in situ hybridization with two cosmidDNA sequences, which havea gapof about20 kb. Note the beads-on-a-string-like signals,andthe labelingof both homologs. 4. Applications. We conclude that the resolution range provided by in situ hybridization to DNA-halo preparations (l&200 kb) complements that of interphase mapping (100 kb-1 Mb). Therefore, the technique may find application in shortrange DNA mapping and gap sizing as well as in the characterization of breakpoints, microdeletions, and small duplications.
Acknowledgments The authors wish to thank Wouter Kalle and Leon Mullenders for help and stimulating discussion about the preparation of DNA-halos; Jan Hoovers, Ed Schuuring, and Hans Dauwerse for providing us with probes; and Gert Jan van Ommen for his continuous interest and stimulating discussions. This work was supported in part by NWO-grants no. 534-060 and PGS 90-129.90. References 1. Landegent,J. E., Jansenin deWal, N., Van Ommen,G. J. B., Baas,F., de Vijlder, J. J. M., Van Duijn, P., andVan der Ploeg,M. (1985)Chromosomal localizationof a uniquegene by non-autoradiographic in situ hybridization. Nature 317, 175-177. 2. Lawrence,J. B., Villnave, C. A., andSinger,R. H. (1988)Interphasechromatinandchromosomegenemappingby fluorescencedetectionof in situ hybridization revealsthe presenceandorientationof two closely linked copiesof EBV in a humanlymphoblastoidcell line. Cell 52,51-61. 3. Dauwerse,J. G., Wiegant, J., Raap,A. K., Breuning,M. H., and van Ommen,G. J. B. (1992) Multiple colors by fluorescencein situ hybridization using ratio-labeledDNA probescreatea molecularkaryotype. Hum.Mol. Genet.1,593-598. 4. Nederlof, P. M., van der Flier, S., Wiegant, J., Raap,A. K., Tanke, H. J., Ploem,J. S., andVan der Ploeg,M. (1990)Multiple fluorescencein situ hybridization. Cytometry 11, 126-131. 5. Ried, T., Baldini, A., Rand,T., and Ward, D. C. (1992) Simultaneousvisualization of sevendifferent DNA probesby in situ hybridization usingcombinatorialfluorescence and digital imaging microscopy.Proc. Natl. Acad. Sci. USA 89, 1388-1392.
Raap
and Wiegant
6. Ltchter, P., Boyle, A. L., Cremer, T , and Ward, D. C. (1991) Analysts of genes and chromosomes by non-isotoptc m situ hybndrzation. Genet Anal. Techn. Appl 8,24-35. 7 McNeil, .I A., Johnson,C. V , Carter, K C , Singer,R. H., and Lawrence,J B (1991) LocahzmgDNA andRNA within nucletandchromosomes by fluorescencezn sztu hybrtdizatton. Genet Anal. Techn. Appl 8, 41-58 8. Raap,A. K , Nederlof,P M., Dirks, R. W , Wiegant, J C A. G , andVan derPloeg, M (1990)Useof haptenizednucleicacid probesin fluorescentzn sztuhybridizatton, m In Sztu Hybridizatzon: Applzcatzon to Developmental Biology and Medzcine (Harris,N andWillrams,D G., eds), CambridgeUmversrtyPress,Cambridge,MA, pp 33-41 9 Vogelstein,B., Pardoll,D. M , andCoffey, D. S.(1980)Supercooled loopsandeucaryotrc DNA replication Cell 22,79-85 10. Wtegant, J., Kalle, W , Mullenders,L , Brookes,S , Hoovers, J M N., Dauwerse, J G , Van Ommen,G. J. B , andRaap,A K. (1992)High-resoluttonin sztuhybridization using DNA halopreparationsHum. Mol Genet 1,587-591 11 Lawrence,J. B., Singer,R H , andMcNeil, J. A. (1990)Interphaseandmetaphase resolution of drfferent distancesw:thm the humandystrophingene Science249,928-931 12 Chertf, D , Juher,D , Delattre,O., Derre,J , Lathrop,G. M , andBerger,R (1990)Stmultaneouslocalizattonof cosmidsandchromosome R-bandingby fluorescencemicroscopy apphcattonto regtonalmappmgof chromosome 11 Proc Natl. Acad Set. USA 87,66396643 13 Takahasht,E , Hart, T , O’Connell,P , Leppert,M , andWhite, R. (1990)R-bandingand nonisotoplczn sztu hybrtdrzatton preciselocahzattonof the humantype II collagengene (Col2Al) Hum. Genet. 86, 14-16. 14 Wregant,J , GalJart,N., Raap,A. K., andd’Azzo, A. (1991)The geneencodinghuman protective proteinis on chromosome 20 Genomzcs 10,345-349 15. Trask, B., Pmkel, D , andVan denEngh,G (1989)The proximity of DNA sequences m interphasenucleiIScorrelatedto genomicdistanceandpermitsorderingof cosmidsspannmg250 kilobasepairs Genomics $710-717 16 Trask, B J , Massa,H , Kenwrick, S , andGitschier,J (1991)Mappingof humanchromosomeXq28 by 2-colourfluorescenceznsztuhybridizationof DNA sequences to interphase cell nuclei Am. J Hum. Genet 48, l-15 17 Van Den Engh,G , Sachs,R , andTrask,B J (1992)Estimatmggenomrcdistancefrom DNA sequence locationm cell nucleiby a randomwalk model Sczence 257,1410-1412 18 Den Dunnen,J. T , Grootscholten,P M , Dauwerse,J G , Walker, A P , Monaco, A P , Butler, R., Anand, R , Coffey, A J , Bentley, D R , Steensman, H Y , andVan Ommen, G. J. B (1992) Reconstructtonof the 2. 4 Mb humanDMD-gene by homologousYAC recombinatton.Hum. Mol. Genet. 1, 19-28 19 Brandrtff, B., Gordon, L , andTrask, B. (1991)A new systemfor high-resolutionDNA sequencemappingin interphasepronuclet Genomics 10,75-82. 20. Landegent,J E , Jansenm de Wal, N., Drrks, R. W , Baas,F , and van der Ploeg, M (1987)Useof wholecosmidclonedgenomrcsequences for chromosomallocalizattonby non-radioactivem situ hybrtdtzation.Hum Genet 77, 366-370 21. Ltchter, P , Tang,C C , Call, K , Hermanson, G., Evans,G , Housman,D , andWard, D C (1990) High-resolutionmappingof humanchromosome11 by cn sztu hybrtdtzatton with cosmid probes Sczence 247, 64-69
CHAPTER
12
In Situ Hybridization of Meiotic Prophase Chromosomes Barbara
Spyropoulos
and Peter
B. ikioens
1. Introduction In preparations of highly condensed metaphase chromosomes, it is often difficult to resolve in situ hybridization signals of probes to nearby regions. This 1s in part, a result of traditional fixation procedures that use alcohol, acetic acid, and/or relatively strong ionic conditions, all of which can cause chromosome condensation. The limit of resolution may be improved by using free chromatin or DNA-halo preparations as described m Chapters 10 and 11 of this volume. An alternative method of detecting proximal DNA sequences is to use whole-mount, surface spread meiotic prophase chromosomes (I,2), which have lesscondensed chromatin and a well defined axial core that is much longer than that of a metaphase chromosome. We have tested this system using two probes (3) agamst low-copy repeats, 5.5 map units apart on the X chromosome (4) as shown in Fig. 1, On metaphase chromosomes, these signals were close together and often overlapped. However, a distance of several micrometers separated the signals on pachytene chromosomes. This type of mapping is useful provided one keeps in mind that the chromatin is arranged in loops around a protein core, the synaptonemal complex (SC) (Fig. 2) (51, and that these loops are of considerable size relative to those of the metaphase chromosome. Thus, a sequence at the top of a 5+m loop could appear some distance from the SC loop attachment point, depending on how the loop settles during chromosome preparation. Therefore, the size of the loop limits the resolution of the probes a few pm apart. However, if the probes are very close together (a few megabases), the decondensed chromatin permits resolving signals from probes to adjacent loci or to cosmtd probes of different regions within the same gene. The loop arrangement can be further used to advantage since it is often possible to detect signals for each of the four chromatids, thereby allowing one to study the relative positions of the chromatids during chromosome pairing, recombination, and segregation. In addition, probes sometimes produce clusters rather than single signals, indicating some chromatm arrangement that may not have been previously suspected. From Edlted
Methods m Molecular Bmlogy, Vo/ 33 In SW Hybrrdrzafron Protocols by K H A Choo Copynght 8 1994 Humana Press Inc , Totowa, NJ
132
Spyropoulos
and Moens
Fig. 1. In situ hybridization of two probes against low-copy repeats. Probes 68-36 (68) and 70-38 (70) are located 5.5 map units apart on the X chromosome. A minor satellite probe highlights the centromere (C). The core of the X chromosome (X) appears as a dark line against a light background of chromatin loops. The scale bar represents 5 urn.
Fig. 2. The chromatin of a meiotic chromosome is arranged as a series of loops (L) around a protein core, the synaptonemal complex (SC). Each species has loops of a specific size. The scale bar represents 5 pm.
The spreading technique presented here was originally developed by Counce and Meyer (1) and later modified by Dresser and Moses (2). The in situ hybridization uses standard techniques. A similar description of these methods has previously been reported (6).
FISH with Meiotic Prophase Chromosomes
133
2. Materials 1. 2. 3 4 5 6 7 8. 9.
10
11.
2.1. Surface-Spreading Testicular Cells Drssectmg tray; sctssors; fine forceps (x2). 50-mL Beaker; dental wax; single edge razor; 15mL centrifuge tubes (x2); bench top centrifuge, Parafilm. Styrofoam container for ice-water bath; lo-mL Coplm Jars (x5) Coverslips, slide holders (x2); diamond pencil for marking coverslips (see Note 1). lo-pL pipetor and tips; wide-bore plastic transfer pipet. Phenol red indicator for monitoring pH of solutions 0.5% phenol red in distilled HzO. Filter. Store at room temperature. Lasts indefinitely. (Alkaline pH gives purple-red color, whereas acidic pH produces yellow color ) 0.05M Borate buffer stock solution: 1.9 1% (w/v) sodium borate in distilled H,O, pH to 9.2 with 0 5N NaOH Prepare a working solution of O.OlM by diluting stock 1:4 with distilled H20. Minimum Essential Medium (MEM)* This can be made from powder, 10X concentrate, or can be purchased ready-to-use from supplier (e.g , Gibco-BRL, Gaithersburg, MD) Paraformaldehyde solution* Mix 10 pL 0.5N NaOH, 100 mL of distilled H20, 30 pL phenol red indicator Add 1 g of paraformaldehyde (BDH, Poole, UK, JB EM, Montreal, Canada) and dissolve at 55’C on a hot plate in a fume hood Shut off the heat and place the Erlenmeyer flask into a contamer of cold water. Return it to the hot plate and continue stirring until all powder has dissolved. Temperature should not go higher than 60°C. If pH drops, add O.OlM borate buffer dropwise. Filter. Cool to room temperature, and adjust final pH to 8.2 with borate buffer. 60 mg/mL sodium dodecylsulfate (SDS) stock solution Prepare this and add 30 p.L phenol red indicator per 100 mL of solution. Adjust pH to 8 2 with borate buffer. Store at room temperature. Depending on the degree of the chromatm dispersion desired, anywhere from O-0.06% SDS m paraformaldehyde is used (see Note 2) CAUTION: Paraformaldehyde is harmful if ingested and can be absorbed through skin. Fine powder is easily dispersed through the air. 0.4% Photo-F10 200 (Kodak, Rochester, NY) in distilled H20. Add 30 pL of phenol red indicator per 100 mL of solution. Adjust pH to 8 0 with borate buffer
2.2. In Situ Hybridization 1. HEPES (N-2-hydroxypiperazme-N’2-ethanesulfonic acid) (Sigma, St. Louis, MO); random ohgonucleotide primer pd(N)s (Pharmacia, Uppsala, Sweden), dGTP, dCTP, dTTP (Boehringer-Mannheim, Mannheim, Germany); biotin-7dATP (Gibco-BRL); Large fragment (Klenow) of E. coli DNA polymerase I (Amersham, Arlington Heights, IL); Sephadex G25 or G50; 5% dmhlorosilane (Sigma) in carbon tetrachloride. 2. Phosphate buffered saline (PBS): 8 g NaCl, 0.2 g KCl, 1 44 g Na*HPO,, and 0.24 g KHzP04 in 800 mL distilled H20. Adjust pH to 7 4 with HCl. Add distilled H,O to 1 L 3. Antibleach mounting solution: Dissolve 100 mg of p-phenylenediamme in 10 mL of PBS. Add 90 mL of glycerol. Adjust pH to 9 0 with 1N NaOH (use litmus paper). Protect from light and store at -20°C.
Spyropoulos
134
and Moens
4. Alkaline phosphate (AP) buffer. 100 mM Tris-HCl, 100 mM NaCl, 50 mA4 MgC12, pH 9.0. 5 Color development solution. In a foil-wrapped flask, mix well 10 mL AP buffer, 66 l.tL nitroblue tetrazolium (NBT) substrate solution (Promega, Madison, WI, Gibco-BRL). Slowly add 33 ltL BCIP (5-bromo-4-chloro-3-indolyphosphate) Use within 1 h. 6. DAPI (4’,6-diamidino-2-phenylindole) solution* 0 1 mg/mL PBS Use 5-10 pL/ mL mounting solution 7 Deionized formamide: Stir formamide with analytical 20-50 mesh mixed bed ion-exchange resin (AG 501-X8) (BioRad, Richmond, CA) for 1 h at room temperature. Filter twice through Whatman #l paper. Store ahquots at -70°C under nitrogen (7). 8. TE buffer: 10 mM Tris-HCl, pH 8 0, 1 mM EDTA 9 1 mg/mL E. coli tRNA m TE buffer Use 20 pL/probe 10 20X Saline sodium citrate (SSC): 0.3M sodium citrate, 3M NaCl, pH 7 0 11 Fluorescem-conjugated avidin (Sigma): 2 pg/mL in 4X SSC, 1% BSA (bovine serum albumin). 12. High salt elutron buffer 0 1M NaCl, 0 1 mM EDTA, 0 02M Tris-HCl, pH 8.0 13 Hybrrdtzatron buffer. 4X SSC, 2% DNase-free BSA, 20% dextran sulfate 14. Propidium iodide (PI) solution: 0 1 mg/mL PBS Use 5-10 pL/mL of mounting solution 15 Components of reaction mixture: 200 mM HEPES, pH 6.6; 50 mM Tris-HCl, pH 7.4; 5 mM MgCl,, 0 8 mM 2-mercaptoethanol; 0 14 AZGOU of random ohgonucleotlde primer, 10 pM each of dGTP, dCTP, and dTTP; 25 pM biotin-7 or biotin-lCdATP, 10 pg BSA; 2-3 U of Klenow fragment; purified DNA insert of interest 16 1 mg/mL RNase A m 2X SSC. To use, dilute 1: 10 and boil for 30 min to inacttvate DNase contaminants 17. 1 mg/mL salmon sperm DNA m TE buffer. Somcate three times 10 s each, until viscosity is no longer apparent. Freeze m 20-pL aliquots. 18 Sodium Tris-EDTA (STE) buffer. 0.1 M NaCl in TE buffer.
3. Methods 3.1. Surface
Spreading 3.1.1. Cleaning
Testicular Coverslips
Material
1. 2. 3. 4
Rub coverslips with window cleaner (Windex) using a Kimwipe tissue paper Rinse under hot running water, then distilled H,O. Wipe dry with Klmwipe. Use forceps to handle the coverslips With a diamond pencil, scratch an identifying number m the top corner of the coverslip Make an asymmetrical cut in the diagonally opposite corner to identify up and down 5. Record the markings for future reference.
3.1.2. Preparation
of Tissue
1. Remove the testes of a relatively young male (about 25 d old for rats, mice, or hamsters where there will be few spermatozoa) For animals with few merotic nuclei, see Note 3.
FISH 2 3. 4. 5. 6. 7 8. 9 10 11 12 13 14. 15
with Mezotic
Prophase
Chromosomes
135
Remove all fat Rinse with MEM in 25-mL beaker. Hold the testis wrth forceps and cut the opposite srde. Extrude the semmrferous tubules into a drop of MEM on dental wax Transfer the tubules twtce to a fresh drop of MEM. Cut SIX times with a grease-free razor blade. Squeeze the tubules wrth clean forceps to extract the spermatocytes from the tubules. Transfer the cell suspension to a 15-mL plastic centrifuge tube Fill the tube wrth MEM, and draw the suspension up and down through a widebore plastic transfer pipet to separate the cells. Cap the tube with Parafilm and invert three times to mrx the contents Let stand until all the tubules have settled Transfer the supernatant with the spermatocytes to a clean 15-mL plastic centrifuge tube Spin for 5 min at 160g Drscard the supernatant and gently resuspend cells m the residual MEM
3.1.3. Surface Spreading 1, Fill a small Petri dash with 0 05% hypotonic NaCl solution such that the surface is convex. 2 Gently tap cell suspension to mix and draw up 10 pL with a prpetor 3 Wipe the tip clean, and carefully expel the cell suspension such that a drop hangs from the pipet tip. 4. Touch the lower edge of the drop to the surface of the NaCl solutton. Cells wrli spread out over the surface (see Note 4) 5. Allow to stabilize for 10 s, then pick up the cells by lowermg a coverslip onto the surface. 6. Let sit for 10 s, then roll the coverslip off the NaCl bath by lifting first one edge, then the rest 7 Place the coverslip in a Coplin jar with paraformaldehyde and SDS, rf required, for 3 mm at 4’C (Ice-water bath). 8 Move to a second Coplin jar with just paraformaldehyde at 4°C for an additional 3 mm 9 Wash twice for 1 mm each in Photo-F10 solution at 4’C, then once for 1 min m Photo-F10 solutron at room temperature 10. An-dry 11. While the coverslips are in the fixative and washing solutrons, additional spreads can be made: Rinse the spreading dish m distilled HzO, add fresh hypotomc solution, and spread the next 10 PL of cell suspension. 12. Let the coverslips an-dry overnight. Use them the next day or store dry at -70°C. 13 Nuclei and SCs are vrsrble with phase contrast mrcroscopy. 3.2. In Situ Hybridization 3.2.1. Probe Preparation To maxrmrze signal mtensrty and reproducibility, we use isolated inserts Instead of linearized plasmids. These are prepared by agarose gel electrophoresis (7) as follows:
Spyropoulos
136
and Moens
1. Use appropriate restriction endonucleases to release the DNA Inserts of interest from their plasmids (Plasmid DNA can be prepared from CsCl or mini-plasmid preparations provided the final amount of purified insert DNA is at least 100 ng ) 2 Electrophorese and electro-elute the Insert from the gel onto NA45 ion-exchange paper (Schleicher and Schuell, Keane, NH) 3 Elute from the paper in high salt elution buffer at 60°C for 1 h according to supplier’s directtons. 4. Precipitate the DNA with 2 vol of 95% ethanol and wash once with 70% ethanol. 5 Dry under vacuum at room temperature and dissolve in an appropriate volume of sterile distilled HzO. 6. Alternatively, excise the DNA insert from the gel with a razor blade and centrifuge through sterile siliconized glass wool (8) (First soak the glass wool for 5 min in 5% dichlorosilane m carbon tetrachloride, rinse extensively m distilled H,O, air-dry, and autoclave.) 7 Estimate the amount of purified DNA by visual comparison with standard amounts of DNA run on the same ethidium-bromide stained agarose gel 8 Biotinylate 20-50 ng of isolated DNA with the random priming reaction (9). (Up to 300 ng of DNA can be biotinylated.) 9. Denature the DNA Insert by heating in boilmg water for 5 mm and instantly cool on ice. 10 Make up to 25 ltL with reaction mixture and incubate at 37°C for 1 h. 11 Stop the reaction by adding 2.5 l.tL of IM EDTA and 72 5 l.tL of STE 12 Separate the unincorporated nucleotides from the biotmylated DNA by centrrfuging through Sephadex G25 or G50 (6). 13 Dot blot the btotinylated DNA as well as known amounts of biotinylated DNA (Gibco-BRL) on mtrocellulose paper and incubate with streptavtdm-conjugated alkalme phosphatase in the dark for 45 min at 37’C 14. Wash the paper three times m PBS, then incubate with color development solution at room temperature for 5 min or more The extent of biotmylation can be estimated by comparing the color development of the experimental DNA with the standard biotinylated DNA The length of smgle-stranded biotinylated DNA prepared by this protocol is approximately 50-100 nucleotides
3.2.2. Hybridization 1. Mix 5 pL of stock salmon sperm DNA, 20 pL of stock tRNA, and 10 ng of biotmylated probe m 20 l.tL STE 2 Precipitate by adding 0.1 vol of 3M sodium acetate, pH 5.5,2 vol of 95% ethanol, and freezing in dry ice or at -7O“C. 3. Centrifuge to collect the precipitate, wash once m 70% ethanol, and dry under vacuum at room temperature. 4 Mark the surface-spread coverslips with identifying marks using a diamond penCll.
5 Scan the coverslip with a phasecontrast microscope to determine which side the nuclei have adheredto, and make sure that this side 1sidentifiable by your markings. 6 Incubate the coverslips for 30 mm at 37°C m boiled RNase, then wash three times in 2X SSC
FISH
with
Meiotic
Prophase
Chromosomes
137
7. While the coverslips are incubating in the RNase, add 5 ~.LL100% formamide to the probe mixture. Denature for 10 min at 75°C and cool lmmedlately on ice. 8. Add 5 pL hybridization buffer to the probe mixture, stir well, and centrifuge for 5 s to bring down all the liquid. 9 Cover the bottom of a 75-mm Petri dish with Parafilm and place the lo-pL drop of probe cocktail on the Parafilm (may be spht in 2 x 5 pL drops for half coverslips) 10. Denature the nuclei in 70% formamide in 2X SSC for 2 min 11. Immediately dehydrate for 5 min each through cold 70,95, and 100% ethanol 12. Air-dry. 13. In a Petri dish, place covershp, cell side down, on a drop of probe Add some tissue paper soaked in 2X SSC (but not touching the coverslip) to create a hurrud chamber. 14. Cover the dish and seal with Parafilm. 15. Incubate at 37°C for 3 h or overnight. 16. Remove unhybridized probe by washing the covershps m 50% formamlde in 2X SSC at 37°C for 30 min, in 2X SSC at 37°C for 30 mm, and finally in 1X SSC at room temperature for 30 min (Use lower temperatures if lower stringency 1s required.) 1 2. 3. 4. 5.
4.23. Detectzon Incubate coverslips in avidin-FITC (fluorescein isothiocyanate) for 30 min at room temperature Wash for 10 min each m 4X SSC, 4X SSC with 0.1% Triton X-100, and 4X SSC. Rinse for 1 min m 4% Photo-F10 in water. Lower the cover&p, cell side down, on a drop of mountmg medium with either DAPI or PI on a clean glass shde. Blot with bibulous paper and seal the edges of the coverslip with a syrmge filled with rubber cement. The DNA stains are fully developed in about 1 h. FITC fading can be minimized by storing the slides at -20°C.
4.3. Microscopy and Photography 1 Unstained spread nuclei can be visualized by phase contrast microscopy. 2. Fluorescent probes are visualized with a fluorescent microscope with the appropriate filters. FITC 1s visualized with an epifluorescent exciter filter 450-490 nm, reflector filter 510 nm, and barrier short pass of 515-560 nm. DAPI filters are exciter filter 330-380 nm, reflector 420 nm, and barrier 420 nm. PI filters are exciter filter 450495 nm, reflector 510 nm, and barrier 515 nm. The latter will show FITC as well as PI. 3. Use Kodak T-Max 400 black-and-white film for photographs or Fuji Color 400 film for slides. With a 100x objective lens, expose for 15-30 s We recommend commercial development No filters are necessary when makmg prints with Cibachrome paper.
4, Notes 1. Coverslips or slides? We use coverslips for in situ hybridization to minimize the amount of probe required. However, since coversllps are delicate to
138
Spyropoulos
and Moens
handle, some workers prefer to use glass slides. The fixation procedure is the same as for coverslips except that SO-mL Coplin jars are used. The cleaning protocol 1s as follows. Use glass slides that are frosted on one side only (to be able to differentiate which stde holds the nuclei). Clean with a glass cleaner such as Windex, rinse m hot running water, then distilled water, and rub dry wrth a Kimwrpe. From then on, touch the slide only at the frosted end. Use 50-mL Coplm jars for the solutrons Prepare 100 mL of paraformaldehyde and 150 mL of PhotoFlo for each run of 10 slides 2 Adjusting the degree of spreading of chromosomes with SDS The degree of spreadmg of the chromatm can be controlled by adjusting the amount of SDS m the first paraformaldehyde fixation from O-0.06% The more SDS, the greater the spreading. For rats and mice, use 0 03% in 50 mL of paraformaldehyde, for hamsters, 0 015%; for humans, 0.06% 3 Variations of spreadmg technique for different species. In some species, a lack of materral precludes surface spreading on a NaCl bath as descrrbed below. An alternate method, which preserves all cells, is to place a drop (50 I.~L mmimum of liquid) of testicular material directly on a clean shde Lower a covershp on top and let sit for 10 min Remove the covershp by tmmersmg the slide in a Coplm Jar of paraformaldehyde and gently rock the slide until the coverslip falls off. If thts fails, let sit a few minutes more and try again. Transfer the covershp to a Coplin jar of fresh paraformaldehyde (with SDS, d necessary) and contmue the fixation as described in the Methods. If using slides for the in situ hybridrzation instead of coverslips, use a strip of Parafilm to cover the cell suspension on the glass shde instead of a coverslip, as rt 1s more easily removed and will not shear the nucler 4. Spreading problems. During surface spreading, the cell suspensron sometimes drops to the bottom of the dish rather than spreading out on the surface. This is the result either of grease in the preparation or of the cell concentratron being too low. Solution: change the spreading dish and/or prpet tips. Failing that, spm down the cells to concentrate them (Sometimes the situation 1s not as bad as it seems, so check the shdes before aborting what mrttally appears to be a bad run )
References 1 Counce, S. J and Meyer, G. F (1973) Differentration of the synaptonemal complex and the kmetochore in Locusta spermatocytes studied by whole-mount electron microscopy Chromosoma
44,231-253.
2 Dresser,M. E. andMoses,M. J (1980)Synaptonemal complexkaryotypmg m spermatocytes of the Chmesehamster(Crmetulusgriseus)IV. Light andelectronmrcroscopyof synapsisand nucleolardevelopmentby stlver stamingChromosoma 76, l-22. 3 Drsteche,C M., Trantravahr,U., Gandy,S , Ersenhard,M , Adler, D., and Kunkel, L M (1985) Isolatron and characterization of two repetitrve DNA fragmentslocatednear the centromereof the mouseX chromosomeCytogen Cell Genet 39,262-268 4 Moens, P. B and Pearlman,R. E. (1990)In situ DNA sequencemappingwith surfacespreadmousepachytenechromosomesCytogenet. Cell Genet 53,219,220 5 Moens, P. B and Pearlman,R E (1989) Satellrte DNA I m chromatm loops of rat pachytenechromatmandm spermatrdsChromosoma 98,287-294 6. Moens, P B andPearlman,R E (1991)DNA sequencelocalizatronm merotrcchromosomes,m Methods wz Cell Bzology, vol 35 (Hamkalo,B. A andElgrn, S. C R , eds), Academic,New York, pp 101-108
FISH
with
Meiotic
Prophase
Chromosomes
7. Sambrook, J., Fritsch, E. F , and Maniatis, T. (1989) Molecular Cloncng. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, pp. 1 102, 6.3-6 35 8. Heery, D M., Gannon,F., andPowell, R (1990)A simplemethodfor subcloningDNA fragmentsfrom gel slice.Trends Genet. 6, 173. 9 Feinberg, A. P. and Vogelstem,B. (1983) A techniquefor radiolabelmgDNA restriction endonucleasefragmentsto high specrfrcactivity Anal. Biochem 132, 6-13.
CHAPTER 13
Strand-Specific Fluorescence In Situ Hybridization for Determining Orientation and Direction of DNA Sequences Julianne
Meyne
and Edwin
H. Goodwin
1. Introduction An innovative variation of fluorescence in situ hybridization (FISH) allows preparation of single-stranded chromatids for determination of chromosomal orientation and strand direction of DNA sequences(I). Standard fluorescent in situ hybrtdization methods rely on nucleotide base pairing between a labeled probe and the complementary chromosomal target sequence. Both probe and target DNAs must be functionally single-stranded at the start of the procedure. Single-stranded probes can be constructed or prepared, but the chromosomal DNA must be made single-stranded by denaturation. Because both strands are present in both chromatids of each chromosome, even single-stranded probes will hybridize to both chromatids of the target chromosome. Selectively removing one strand of the DNA double helix from each chromatid makes strand-specific FISH possible. Single-stranded probes can be hybridized to single-stranded chromosomal DNA without denaturation. Probes of repetitive sequencesarranged head-to-tail in tandem arrays will hybridize to only one chromatid. In contrast, probes of ubiquitous repeat sequences,such as Ah, that are present m both directions on each DNA strand will hybridize to both chromatids. Thus, the method reveals the orientation of repetitive sequences and has been designated as CO-FISH for chromosome orientationFISH. This procedure is shown m Fig. 1. Slides prepared for the CO-FISH method can also be used to determine the direction of the DNA strand to which a single-stranded probe hybridizes. This procedure is referred to as chromosome orientation and direction FISH, or COD-FISH. The basis of this analysis is outlined in Fig. 2. Multiple color and sequential hybridizations can be used on CO-FISH slides. Two or more single-stranded probes with different molecular tags can be hybridized at once, Just as for standard FISH methods. Sequential hybridizations are very simple. After the first hybridization, simply rinse the slide in 2X SSC to remove any excessprobe from the slide, dram to remove excess2X SSC (but do not allow slide to dry), and then hybridize again with another probe. From Edlted
Med~ods m Molecular Bfology, Vol 33 In SW Hybrrdfzabon Protocols by K t-l A Choo CopyrIght Q 1994 Humana Press Inc , Totowa, NJ
141
Meyne and Goodwin
142
uv
BrdU
W ca
and Exe III
//I_ A
B
E
Fig. 1. An outline of the CO-FISH procedure. (A) Cell cultures are grown in medium containing the nucleotide analog bromodeoxyuridine (BrdU) for one round of replication. (B) BrdU is substituted for thymidine at many sites within the newly replicated DNA strands. Each replicated chromosome now contains sister chromatids that are singly substituted in opposite DNA strands. Metaphase chromosome spreads are prepared by standard methods. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to ultraviolet light. The UV exposure induces nicks in the BrdU-substituted DNA strands. Nicked DNA serves as a substrate for exonuclease III (Exo III), an enzyme that excises nucleotides from one strand of double-stranded DNA starting at the sites of nicks. (C) This method effectively removes the substituted strand of each chromatid, while leaving the unsubstituted strand relatively intact. It is important to note that the single strands remaining in each of the two chromatids are complementary. (D) Hybridization of a single-stranded probe of a tandem repeat arranged in a headto-tail orientation will result in hybridization only to the chromatid with the complementary strand present. (E) Detection of the hybridization site will demonstrate fluorescence on only one chromatid.
Sequential hybridization is preferred for two color hybridizations with complementary strands of repeat probes. We have done up to four sequential hybridizations on a single slide. The only limitation is the background hybridization after detection of the signal. This problem may be reduced by using probes labeled directly with fluorescent nucleotides, rather than immunofluorescence detection. Essentially any method used for in situ hybridization is applicable to the CO-FISH method described here. 2. Materials 1, Cell culture (see Note 1) and reagents,e.g., medium, trypsin, Colcemid. 2. 1W3M bromodeoxyuridine
(BrdU) in Dulbecco’s
3. 75 mM KC1hypotonic solution.
4. Fixative solution. Mix 3: 1 methanol:acetic before use.
phosphate buffered saline.
acid. Do not store for more than 1-2 h
Strand-Specify
143
FISH
A
B
Fig. 2. An outline of the procedure for COD-FISH. (A) The C-rich strand of the telomere probe is cohybridixed with a single-strand, sense or antisense, of the sequence of interest. Because the G-rich telomere sequence overhangs the 3’ end of the DNA helix, the C-rich strand probe will hybridize to the 3’ end of the DNA strands in each chromatid. The sequence of interest will hybridize to its complementary sequence. (B) The 5’40-3’ direction of each strand can be determined by the position of the telomere fluorescence. The direction of the sequence of interest can be inferred from this information. 5. Microscope slides and 22 x 50 mm glass coverslips. 6. 500 ccg/mL Hoechst 33258. 7. 2X SSC solution, pH 7 (1X SSC = 0.15M sodium chloride and 0.015M sodium
8. 9. 10. 11. 12.
citrate). Ultraviolet light source (see Note 2). Exonuclease III and buffer (see Note 3). Single-stranded nucleic acid probe (see Note 4). Standard materials for hybridization and detection. Fluorescence microscope with camera and/or image analysis system.
3. Methods 3.1. Bromocbo~uridine Incorporation 1. Subculture plateau phase fibroblasts into medium containing 10% BrdU (see Note 5). 2. Incubate for a period equal to one doubling time of the culture being used. 3. Add 0.1-0.2 @nL of Colcemid for 24 h (see Note 6).
Meyne
144
and Goodwin
4. Harvest the cell culture for metaphase chromosome preparations usmg standard methods. For human fibroblast cultures we use a 15-mm hypotomc treatment in 75 mM KC1 followed by fixation in 3: 1 methanol-acetic acid fixative. The suspension is dropped onto clean wet slides and allowed to air-dry (see Note 7) 3.2. Preparation of Single-Stranded Chromosomal DNA 1. Stain slides in 0.5 pg/mL Hoechst 33258 m 2X SSC for 15 min at room temperature (see Note 8) 2. Rinse slides briefly m distilled water 3. Air-dry the slides or drain off excess water. 4. Place two drops of 2X SSC on each slide and cover with a 22 x 50 mm coverslip. 5. Expose to long-wave UV light for 30 mm. 6 Remove the coverslips, rinse the slides briefly m distilled water, and au-dry. 7. Place 50 pL of exonuclease III solution (3 U&L m reaction buffer) on each slide 8. Cover with a 22 x 50 mm coverslip and incubate at room temperature for 5 min 9 Remove the coverslips and rinse the slides briefly in distilled water. 10. Allow the slides to air-dry. 3.3. Hybridization and Detection No denaturation step is necessary because the DNA is single-stranded after the BrdU/33258/UV/Exo III treatment. The hybridization mtx is directly applied to the treated slides and incubated overnight at 37°C. Single-stranded probes should be prepared in the same type of hybridizatton mix as would be used for double-stranded versions of the probe. For example, if a smglestranded probe contains ubiquitous repeats, tt should be blocked with repetitive DNA. If a synthetic oligomer probe is used, it should be hybridized without dextran sulfate or blocking DNA. The detection procedures used for CO-FISH are the same as for standard FISH methods. 3.4. Analysis Because the chromosomal target DNA is a single strand, the fluorescence signal is less intense than for standard FISH with double-stranded target DNA and probes. For repetitive DNA sequences, the fluorescence obtained ts adequate for standard fluorescence microscopy. For single-copy DNA or singlestranded probes made from inserts of recombinant vectors the signal may be too weak to clearly delmeate without additional amphfication or use of an image analysis system. Staining and analysis are otherwtse the same as for standard FISH protocols.
4. Notes 1. Any type of cell culture with a reasonable rate of growth can be used. For optimal numbers of singly substrtuted chromosomes, plateau phase fibroblasts are best It is also desirable to know the approximate doublmg time of the cell culture used 2 Long-wave UV is better than short-wave UV We use a Stratalmker 1800 UV irradiator equipped with 365-nm bulbs (Stratagene, La Jolla, CA). The length of
Strand-Specific
3. 4.
5. 6.
7.
8.
FISH
145
exposure will vary if a different wavelength is used. If a sunlamp is used, place a thin sheet of plastic between the UV source and the slides to protect the DNA from dimer formation It is also necessary to use caution to avoid optic exposure when using UV light An enclosed source is best. Alternately, use protective glasses or a face shield. We use reaction buffer A (International Btotechnologies, Inc., New Haven, CT), but any buffer recommended for use with exonuclease III can be used. The CO-FISH method can be used to prepare slides for hybridization of any type of probe, including synthetic oligomers and riboprobes Keep in mind, however, that double-stranded probes will not reveal orientation or direction because they will hybridize to both (complementary) chromatids. The concentratton of BrdU may need to be adjusted for other cell types or for cells from other species. The mitotic index is dependent upon the type of cell culture used, the passage number, and length of Colcemid treatment For early passage diploid human fibroblasts after 4 h of Colcemid, our typical mitotic index IS about 7%. For lesscondensedchromosomeswe use2 h Colcemid At this pomt, the number of first division cells after BrdU incorporation can be monitored by any of several methods* a DAPI fluorescence quenching, b. Differential Giemsa staining (sister chromatid exchange method), or c. Labeling wtth anti-BrdU antibody. We typically obtain greater than 95% first divbon, singly substitutedmetaphases when usingplateauphasediplotd human fibroblasts. If several slidesare stained at once, it 1ssimplestto prepare 50 mL of stain solution in a Coplin jar
Reference 1 Goodwin,E H andMeyne, J (1993)Strand-speaflcFISH revealsorientationof chromosome18alphoidDNA Cytogenet Cell Genet 63, 126,127
CHAPTER 14
Radioactive In Situ Hybridization to Replication-Banded Chromosomes Elizabeth
Earle
and K H. Andy
Choo
1. Introduction The technique of radioactive in situ hybridization of chromosomes is increasmgly being replaced by nomsotopic methods. Amongst the principal reasons for this are greater convenience, resolution, safety, and speed offered by the nonradioactive methods; and the computerization of digital imaging microscopy, which has allowed previously unachievable maneuvers such as complex multicolor chromosome painting. Such a swing in preference is attested by the disproportionate application and publication of new sophisticated protocols based on the nomsotopic methods m recent times. However, the “fossilizing” radioactive procedure stall holds a significant place m various chromosomal studies because of some of its unique features. For example, it offers an acceptable way of quantitating signal (and thus DNA sequence) distribution on different chromosomal sites (1-7) In laboratories where the more elaborate digital imagmg equrpment is not available, extended autoradiography offerred by radioactive in situ hybridization provides the sensitivity otherwise unattamable with nonradioactive approaches, especially when small probes or heterologous probes are used (see Chapter 15). Also, the hybridization slides and results obtained will form a permanent record that can be conveniently assessedor reassessedwithout any further treatment over a period of weeks, months, or even years. We describe here a protocol of in situ hybridization to replication-banded human chromosomes using 3H-labeled DNA probes. The method IS based on that of Buckle and Craig (8) as previously described (9). A brief discussion on the application of the basic protocol to mouse chromosomes is also presented. 2. Materials 2.1. 3H-Labeling of Probe 1. Tntiated nucleotides.Deoxy ( 1’,2’,5-3H)cytidme 5’-triphosphate,ammonium salt (3H-dCTP; Amersham, Arlington Heights, IL; approx 50 Ci/mmol), deoxy (1’,2’,2,G3H)adenosineS-triphosphate,ammoniumsalt(3H-dATP) (Amersham), approx 60 Ci/mmol); (methyl, 1’,2’-3H) thymldme 5’-triphosphate, salt (3H-dTTP, Amersham;approx 120 Ci/mmol). From Edlted
Methods R Molecular &o/ogy, Vol 33 In SW Hybndrzabon Protoco/s by K H A Choo Copynght Q 1994 Humana Press Inc , Totowa, NJ
147
ammonium
Earle
148
and Choo
2 Desiccator and vacuum pump 3. Random priming labeling kit or mck-translation krt for use with any labeled dNTP (Amersham or Boehrmger Mannhelm, Mannham, Germany). 4 G50 medium Sephadex. 5 g m 100 mL of pure water. Autoclave and store at room temperature. 5. Scintillation p-counter 6 Scintillation fluid. 1 L: 5.5 g (2,5-dlphenyloxazole PPO, Packard), 0.1 g POPOP (Packard)(l,Cbis[2-(5-phenyloxazolyl)]-benzene), 667 mL toluene, 333 mL Triton X-100. Star m lightproof container in fume cupboard for l-2 h Store m brown bottle at room temperature. 7. Lyophilizer (e.g., DynavacrM freeze-drying unit).
2.2. Brd U Incorporation
and
Chromosome
Preparation
1 Whole blood (2-5 mL) collected in a sterile heparimzed tube 2 Tissue-culture-quality plastic centrrfuge tubes (10 mL). 3 Phytohemagglutinin (PHA) (Wellcome Diagnostics, Dartford, UK): Reconstttute in 5 mL of distilled water as duected. Store at 4“C for 2-3 wk only. 4. Culture medium 199 (e.g., Flow Laboratones, McLean, VA, Gtbco-BRL, Garthersburg, MD). Medium 199 (with Hanks’ salts containing bicarbonate) Fetal calf serum t,-Glutamine, 200 n-&I Penicillm Streptomycin PHA HEPES, lM, pH 7.4 5
100 16 0.3 10,000 10 2.4 2
mL mL mL u 1: mL
10 mg/mL 5-Bromo-2-deoxyundme (BrdU) (Sigma, St Louis, MO) Mtllipore filter (0 22 p.M). Dtspense in l-2-mL aliquots Store wrapped m foil at -20°C Use at 200 pg/mL (1 e , 0.1 mL of 10 mg/mL stock/5 mL of blood culture)
CAUTION: This chemical is mutagenic. inhale powder.
Therefore, wear gloves and do not
6. 0.25 mg/mL Thymidine (I.e., 10e3w, cell-culture reagent, Sigma). Milhpore filter. Store m 2-mL aliquots at -20°C Use at a final concentration of 10e5M in culture medmm. 7 Phosphate-buffered salme/Dulbecco (PBS), pH 7 2 (calcmm- and magnesmmfree) Autoclave to stenhze. 8. 20 pg/mL Colchicine (BDH) or colcemid (Stgma or Gtbco-BRL) Store wrapped in foil m l-mL ahquots at -20°C (hght- and temperature-sensittve; will detertorate over several years). For use, dilute 1:50 to give a final concentration of 0.4 pg/mL m culture medium. 9. 0 56% Potasstum chloride m water. Store at room temperature. 10 Cell frxattve: 3/l (v/v) analar methanol/glactal acetic actd. Prepare fresh for each harvest 11 Glass dishes and shde carriers Horizontal staining dish with dish cover, removable glass slide rack wrth handle.
Radioactive
In Situ Hybridization
of Chromosomes
149
12 Good quality glass shdes with frosted end and 22 x 50 mm covershps* Soak overnight m detergent (2% Decon-90 or Lipsol), rinse well in distilled water, soak in two rinses of ethanol, and air-dry. Store in dust-free container. 13. Lightproof slide box. Include a perforated tube contammg silica gel as a desiccant. 14. Darkened alcove. Reserve a corner of the laboratory that can be isolated with a heavy floor-to-ceiling curtain. Facilities in the alcove should include a work bench, benchtop centrifuge (2OOg), water bath, and a table with lamp with yellow-green darkroom lightbulb (e.g., Phillips, 240-250V PF71OB)
2.3. Slide Treatment 1. 1 mg/mL RNase stock (Boehringer Mannheim or Sigma) m TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4). Boil for 10 mm to remove DNase contamination Dilute to 100 l.tg/mL in 2X SSC Mtllipore filter and store m 2-mL aliquots at -20°C. Stable to freeze-thawmg. 2. Ethanol (AR) series: 10,50, 75,95, and 100% ethanol 3. 20X SSC. 1L 175 g sodium chloride and 88 g tri-sodium citrate. Store at room temperature. 4. Formamide (Merck AR, Darmstadt, Mannhelm, Germany). For each experiment, freshly deionize 200 mL of formamtde by addmg 20 g of BioRad mixed-bed resin. Stir at room temperature for at least 2 h or overnight Filter and store at 4°C in a dark bottle. CAUTION: Formamide is toxic. Therefore, wear gloves and handle in a fume hood. 5 DNAdenaturauon solution. Mix 140 mL of deionized formanude, 0.1 mL of 0.25M EDTA, and 60 mL of 2X SSC Adjust to pH 7.0 with 5MHCl Make up fresh pnor to use. 6. Moist chamber Any autight box with a sheet of Whatman filter paper moistened with 2X SSC. 7 Black plastic hghtproof bags to protect slides during various procedures
2.4. Hybridization
and Washing
1. 0.2% Sodium dodecylsulfate (SDS), 10 mM EDTA. Store at room temperature 2 50% Dextran sulfate (Pharmacia, Ptscataway, NJ). Boil to dissolve Cool slowly. Store in 1-mL ahquots at -20°C. Stable to freeze/thawmg. 3. 10 mg/mL Salmon sperm DNA (Boehringer Mannheim) Cut threads of dehydrated DNA into small pieces with clean scissors. Add 500 mg to 50 mL of distilled water and dissolve in a 65’C water bath for several hours. Shear by passmg through three successive hypodermic needles (19,21, then 25 g) using a 50-mL syringe. Boil for 10 min. Store at -2O’C. 4. 20X SSPE solution: Dissolve 17.4 g NaCl and 2.8 g NaH,P04.2H,0 in 80 mL of dtstilled water. Add 10 mL of 200-mM EDTA (final cone 20 mM) AdJust to pH 7.4 with cone NaOH and make up to a final vol of 100 mL wtth distilled water Store at room temperature. 5. Hybridization buffer: 1 mL Final cont. 50% Deionized formamide 500 I.LL 50% Dextran sulfate 200 l.lL 10% Salmon sperm DNA (10 mg/mL) 20 l.tL 0.2 mg/mL 20X SSPE 250 l.tL 5X Distilled water 30 l.tL Prepare fresh for each experiment.
Earle
150 6 Coverslip rubber-seal solutton (e.g., “Earth” brand [Marumi Japan] rubber solution for tube repairing) 7 Dry incubator or water bath, 42’C.
and Choo
Industry Co Ltd.,
2.5. Autoradiography 1. Emulsion (Ilford nuclear emulsion L4 [crystal diameter 0.13 pm], Amersham RPN 41 [crystal dtameter, 0.13 pm] or Kodak TM NTB-2 [crystal dtameter 0.26 pm]) Prepare according to the directtons of the manufacturer, in total darkness, and use the approprtate safelight only when necessary Store in a glass jar in a lightproof box at 4°C (do not freeze). Prepare a 1.1 solution of L4 emulsion by melting, for example, 50 g of mousse at 46’C and mixing with 50 mL of pure water at 46’C (avoid forming air bubbles). Stir gently with a glass rod or plastic spoon (avoid contact of emulsion wtth any metal to minimize formation of background latent image). Stand for 10 min at 46°C. Dispense mto smaller ahquots in slide mailers, enough for an average-size experiment, or store whole at 4’C and remelt for multiple use until background becomes unacceptable. It is important to ensure complete equihbratron and melting of emulsion at 46°C to avoid a heavy granular appearance on slides 2. Wheaton glass dishes and slide holder. 3. D19 developer (also available commercially from Kodak). 2 g Metol @methylaminophenol sulfate) (BDH Pharmaceuttcals, London, UK), 90 g anhydrous sodium sulfite, 45 g sodium carbonate, 5 g anhydrous potassium bromtde, 8 g Quinol (hydroquinone) (BDH). Dissolve in the order shown above and make up to 1 L with distilled water Store in a brown bottle in the dark at room temperature Remove an aliquot for each experiment and discard after each use. Wear gloves. 4. Stop solution. 1% glacial acettc actd in water. 5. Fixative: 200 mL of Ilford Hypam, 800 mL of distilled water. While sturing constantly, slowly add 25 mL of Ilford Hypam hardener Store m a brown glass bottle m the dark at room temperature (see Note 1) The fixative can be reused for several experiments. Wear gloves 6 Darkroom. This should be equipped with a 46’C water bath and a safehght filter Ilford 904 (dark brown), for example, is suitable for both, Ilford L4 and Amersham RPN41 emulsions, or use a red safelight for KodakrM emulsions
2.6. Chromosome
Staining
and Analysis
1. 1 mg/mL Hoechst 33258 (Sigma) Bisbenzimide trihydrochloride. Aliquot m 2-mL vol, wrap m foil, and store at -2O’C. This can be thawed and refrozen several times, and IS hght-sensitive. Avoid inhaling or contact with skm 2. Phosphate-buffered saline (PBS) (BDH Pharmaceuticals): Gurr buffer tablets, pH 6.8 3 Glemsa Gut-r’s improved R66 (BDH Pharmaceuticals) Immediately before use, dilute Giemsa to 10% in PBS, pH 6 8. Filter into a Coplin staining jar. 4. Table lamp with a long-wavelength UV light tube (Sylvania; Blackltte blue, 15 W). 5. High resolution hght microscope fitted with 12 5x eyepteces and 10x and 100x objectives, green filter (546 nm) or blue-green interference filter
Radioactive
In Situ Hybridization
of Chromosomes
151
6. Films for black-and-white photography. Agfa CopexTM rapid AHU TRI 13 gives good results.
3. Methods 1
2. 3. 4. 5.
3.1. %-Labeling of Probe Label 100-200 ng of DNA by random-priming or nick translation usmg 50-100 p.Ci of a cocktail of 3H-nucleotides (e.g., -20 p.Ci 3H-dCTP, -20 pCi 3H-dATP, and -40 pCi 3H-dTTP, based on the spectftc activities given in Section 2.1.) according to instructions wtth labeling krts (see Note 2). Remove unincorporated nucleotides by passing the reaction mixture through a G50 Sephadex column (made up in a Pasteur pipet or 1:mL disposable pipet) and collect 100 pL fractions. Add 2 pL from each fraction to an aliquot of scintillation flmd and count in a pcounter. Pool the fractions from the first peak of radioactivity, which will contam the labeled probe (see Note 3). Divtde into aliquots suttable for one experiment, lyophillze, and store at -20°C 3.2. BrdU
Incorporation
and
Chromosome
Preparation
Use full safety precautions when handling blood samples. Wear protective gloves and work in a class II biohazard hood. Discard waste mto hypochlorite or autoclave. The protocol described below is the replication G-banding method of Zabel et al. (IO), which yields banded chromosome preparations of high quality. 1. Add 0.2 mL of sterile heparmrzed whole blood to a lo-mL culture tube containing 5 mL of medium 199 (Section 2.2., step 4). (0.2 mL of whole blood in one culture tube should generate 5-10 slides.) 2. Place tubes in a sloping rack and culture for 72 h at 37’C. 3. Add 0 1 mL of BrdU to the blood culture to give a final concentration of 200 pg/ mL and mcubate inside a black plasttc bag at 37°C for a further 16-17 h (see Note 4). 4 In darkened alcove, remove BrdU by centrifuging the cells at 200g for 5 min, drscarding the supernatant into hypochlorite, and resuspendmg the cells in medium prewarmed at 37°C. 5. Repeat centrifugatron and resuspend the cells in 5 mL of prewarmed medium 199 containing 10m5M thymidme. (This releases the block m the cell cycle.) 6. Remcubate at 37°C for 6-7 h to reinitiate DNA synthesis and allow mitosis to proceed. 7. Add 0.1 mL of colchicine to a final concentration of 0 4 pg/mL and incubate for 15-30 min at 37°C (see Note 5). 8. Remove the medium by centrifugation at 200g for 5 min and resuspend in 7 mL of 37°C prewarmed hypotonic solution (0.56% KCl) 9. Incubate at 37°C for 15 min to achieve sufficient swelling of the cells. 10. Add 3 mL of cell fixative and mix thoroughly 11. Centrifuge the cells for 10 min and discard supernatant.
152
Earle
and Choo
12 Resuspend the pellet and slowly add a further 7 mL of cold (4’C) cell fixative, mixing well throughout 13. Stand on ice for 20 min before centrifuging. 14. Repeat steps 11 and 12 three times At this stage, cells can be stored in fixative (wrapped in foil) at -20°C for a few days If stored, the fixative should be changed before the slides are made 15. After the final fixative wash, resuspend the cells in a small vol (e g , 0 5 mL) of cold fixative and put 2-3 drops of cold cell suspension onto a slopmg dry glass slide 16. Air-dry, then check the slide under a phase contrast microscope and adJUst the cell concentration accordmgly for subsequent slides. 17. Store slides at -20°C in an airtight, dark slide box containing desiccant, and seal with black tape Slides should be stored for a few days before use and can be kept in this manner for at least 6 mo. Perform
m darkened
3.3. Slide alcove.
Treatment
1 Equilibrate the slide box to room temperature before openmg to avotd condensation on the slides 2. Destroy cellular RNA (which causes nonspeciftc hybridization background around cells) by adding 80 l.t.L of 100 pg/mL RNase to each slide. 3 Apply a 22 x 50 mm coverslip and incubate m a moist chamber at 37’C for 1 h 4 Remove the coverslip carefully by vertically floating off m 2X SSC. 5. Wash the slides in three changes of 2X SSC 6 Dehydrate for 30 s m each of lo%, 50%, 75%, 95%, and 100% ethanol, then air-dry. 7 Denature the chromosomal DNA into single strands by mcubatmg the slides for 4 mm at 65°C m prewarmed denaturation solution (see Section 2 3 , step 5), or at 70°C for 2 min. 8 Immediately plunge the slides into 75% ethanol precooled at 4’C 9. Dehydrate in 95% ethanol, followed by absolute alcohol at 4“C At this stage, slides can be stored m desiccant at 4°C for a few hours if necessary. The quantities
3.4. Hybridization and Washing used are suitable for 10 slides.
1. Add 5 ~.LLof 0.2% SDS, 10 mM EDTA, and 300 pL of hybridization buffer to 50 ng of 3H-labeled, lyophlltzed probe DNA (5 ng of labeled DNA/slide) Mix well. 2 Boil for 5 min to denature the probe, Chill on ice immediately Perform the following steps in darkened alcove. 3 Add 30 pL of hybridization/probe mix to each slide. 4 With forceps, carefully lower a 22 x 50 mm coverslip from one end and avoid trapping any au bubbles. 5. Seal the edge of the coverslip with rubber solution and place slides inside a sealed moist chamber on a dampened filter paper.
Radioactive
In Situ Hybridization
of Chromosomes
I53
6. Wrap the chamber in black plastic and hybridize overnight in a 42°C dry oven (or float in a water bath) 7 To wash the slides, peel off the rubber seal with forceps and carefully remove the coverslip by vertically floating off in 5X SSC. 8 Wash in 5X SSC for 5 min. 9 Irrespective of the stringency requirements (see steps 10 and 11, below) first wash slides in three changes of 2X SSC at room temperature for 20 mm each to remove excess probe. 10 For the detection of chromosomal sequences highly homologous to the probe, use a subsequent wash of 0.5X SSC at 6O“C for l/2 h, followed by two changes of 0 1X SSC at 60°C for l/2 h each (i.e., high-strmgency condrtions) (Fig 1) (see Note 6). 11 For the detection of related sequences, use a lower stringency wash of 1X SSC at 60°C for l/2 h followed by 0 5X SSC at 60°C for two 112-h washes (Fig 2) 12. Equilibrate the slides to room temperature in the same SSC concentration as the last wash for 15-60 min. 13. Dehydrate in ethanol as in Section 3.3., step 6, and store with desiccant at room temperature until ready for dipping in emulsion
3.5. Autoradiography Perform in total darkness in the darkroom only when necessary.
and use the prescribed
safelight
1. Set the water bath at 46°C. 2 Remelt 1: 1 diluted L4 emulsion m a 46°C water bath for 15-30 min. 3. Stir gently with a plastic spoon (avoid bubbles) and stand for 10 min at 46°C to allow air bubbles to disperse. 4. Dip a control (blank, clean) slide by slowly lowering in and raising out of the emulsion. 5. Stand it vertically to drain and check the evenness of emulsion under the safelight. 6 Dip hybridized slides individually and stand them in a vertical position in a lightproof box for about 1 h, until hardened and dry. 7. Transfer the slides to a lightproof slide box containing desiccant, seal with tape, and leave them to expose at 4°C for an appropriate length of time (see Section 3 6.). 8 To develop slides, equihbrate the slide box to room temperature before opening. (This avoids condensation on slides, which affects the latent image.) 9 Develop slides in D19 developer diluted 1: 1 in distilled water for exactly 5 min at 20°C (without agitation). 10 Rinse in 1% acetic acid stop solution for 30 s, and fix for 10 min m Ilford Hypam fixative with hardener. 11. Wash gently in slow running tap water for 1 h and proceed to stainmg. (The blank slide should be included to serve as a control for the presence of background grains in the emulsion )
Earle and Choo
Fig. 1. Detection of a silver grain (arrow) following 3H in situ hybridization of a unique sequence (pyruvate dehydrogenase) to the ~22.1-22.2 region of the human X chromosome (11,12). Reproduced with the permission of Ruth M. Brown.
3.6. Chromosome Staining and Analysis Do not allow slides to dry during the staining procedure. 1. Stain slides in Hoechst 33258 diluted to 15 pg/mL in 2X 2. Rinse in 2X SSC.
SSCfor 30 min.
3. Submerge slides horizontally and completely in a flat dish by covering with fresh 2X SSC to a depth of 2-3 mm. 4. Expose the slides for 1 h to a long-wave UV light by placing the light source 20 cm above the SSC level. (Avoid using excessive 2X SSC, since the increased depth will block penetration of the W light.) 5. Rinse the slides in PBS, pH 6.8. 6. Stain vertically for 20-30 min in 10% Giemsa. 7. Rinse in PBS, pH 6.8, and air-dry vertically. 8. Check the background grains on the blank slide. 9. Analyze the distribution of silver grains over karyotype to identify the chromosome or chromosomes that give a significant accumulation of probe signal (see Note 7). This involves finding cells with well-spread chromosomes and recording individual grains on a cumulative ideogram (see Note 8).
See Notes 9-l 1 for a discussion on the application of the present procedure to nonreplication banded chromosomes, metaphase preparations of different cell types, and mouse chromosomes.
Radioactive
In Situ Hybridization
of Chromosomes
Fig. 2. 3H detection of tandemly repeated satellite I DNA on different human chromosomes (indicated by numbers) under relaxed hybridization stringency (7).
4. Notes 1. The hardener is necessary to prevent the emulsion from swelling and lifting off slides. 2. 3H-nucleotides are supplied in 50% alcohol, so they have to be dried before use, using a desiccator and vacuum pump. 3. Incorporation of 20-50% and a specific activity of 3-5 x lo8 dpm&g probe DNA should be achieved. For probe DNA, either whole plasmid or eluted insert can be used, although we have found that the former sometimes gives unacceptably high background for unknown reasons. We have also used a single 3H-nucleotide with satisfactory results, but use of three labeled nucleotides offers higher specific activity and greater sensitivity. Four labeled nucleotides can also be used. Multipriming gives better incorporation than nick translation, especially when the probe is small or small amounts of DNA are used. 4. BrdU blocks DNA synthesis in the middle of the S phase and is therefore incorporated only into early replicating bands. After the addition of the BrdU and in
Earle
5. 6.
7. 8.
9
10. 11.
and Choo
subsequent steps, protect the cultures in black plastic bags and work in the darkened alcove. In these steps, absolute darkness is not essential, but using a darkened alcove is important to minimize nicking the BrdU-incorporated DNA by light Other workers who have omitted this precaution have produced less than satisfactory chromosome banding results. This arrangement is more convenient than the use of a standard darkroom throughout the entire experiment. Although the cells are already synchromzed by the BrdU, colchicme helps to disrupt the mitotrc spindle and gives better chromosome spreading and morphology It is important to preheat all washing solutions in a water bath to the selected temperature to ensure attainment of the desired stringency. If greater stringency IS necessary, the chromosome preparations will withstand a temperature of up to 68°C for 1 h An alternative washing schedule using a solution containing formamide can also be used, but this involves the handling of a toxic chemical and is therefore less convenient. A blue-green interference filter or a green filter allows good vtsuahzation of the banding pattern, but the silver grains are more easily identified in white light without a filter. Only grains on or touching a chromosome should be counted. Once a positive chromosome is identified, more grams can be scored to achieve a precise subregional localization using less well spread metaphases, as long as the essential chromosome is clear. For a tandemly repeated probe (see Fig 2) or a mixture of unique sequence probes, many grains may be present at one site, so a good signal should be seen on most cells. Vary the exposure time (e.g , overnight to many days) to give an optimal signal to permit either gram counting or direct visuahzation and photographic presentation of results For a single copy sequence, many cells will need to be scored to accumulate a significant signal, and a much longer exposure time of 10-30 d may be required. Nonreplicatron G-banding of chromosomes In some situations, hve cells are not available for rephcatron banding of the chromosomes (e g , cells without BrdU incorporation stored in fixative after routine cytogenetic analysis). Use of these cells necessitates the following additional steps, which are very tedious and which make accurate localization difficult The efficiency of hybridization may also be affected by the pretreatment of the chromosomes before hybridization. a. G-banding of chromosomes; b Prephotographmg selected metaphases; c. Destammg, d. Hybridization with labeled probe and autoradiography, e. Counterstainmg with Gremsa; and f Rephotographing the same cells to allow silver grams to be localized to bands on relevant chromosomes. Metaphase preparations of different cell types. With very minimal modifications, the replication banding method can be used for cultured fibroblasts, somatic cell hybrids, continuous lymphoblasts, and other cell hnes. Replication banding of mouse chromosomes. Since the study of human and mouse genetics very often complement each other, mapping mouse chromosomes
Radioactive
In Situ Hybridization
of Chromosomes
157
is an important application of the in situ hybridization technique. A method (13) suitable for this purpose 1soutlined below Dissect out the mousespleen using aseptic techniques. Cut up the tissue and passthrough a sieve into me&urn. Set up culturesfrom thesespleenlymphocytes at 4 x 106cells/ml (one spleenhasapprox lo8 cells) in RPMI 1640/10%FCS/HEPES/ antibiotics and concanavalmA (Sigma) at 3 pg/mL to induce mitotic activity. After culturing for 2-3 d at 37”C, add 400 pg/mL of BrdU and continue incubation for a further 17 h Wash cells asin Section 3.2., step4, and incubate for a further 4-5 h at 37°C in the presenceof 10e5A4 thymiclme Add Colcenud (0 5 pg/mL) 15-30mm before harvesting asdescribedin Section 3.2 , steps8-17. All proceduresafter the addition of BrdU shouldbe carried out m the darkenedalcove
Acknowledgments This work was supported by the Nattonal Health and Medical Research Council of Australia and the Jack Brockhoff Foundation.
References 1 Choo, K. H. Vissel B , Brown R , Fllby R. G., and Earle E. (1988) Homologousalpha satellitesequences on humanacrocentrlcchromosomes with selectivity for chromosomes 13, 14and21. Imphcatronsfor recombmatlonbetweennonhomologues andRobertsoman translocatlonsNucleicActds Res 16, 1273-l 284 2 Choo,K H , Vessel,B., andEarle, E. (1989)Evolution of alphasatelliteDNA on human acrocentrlcchromosomesGenomrcs $332-344. 3. Choo,K H , Brown, R., Webb, G , Craig, I , andRlby, R G (1987)Genomlcorgamsatlon of humancentromerlcalphasatelhteDNA: Characterlzatlonof a chromosome17 alphasatellitesequenceDNA. J. Molec Btol. 6,297-305 4 Choo,K H , Earle,E., andMcQulllan, C. (1990)A homologoussubfamilyof satellite III DNA on humanchromosomes14 and22. Nucleic Actds. Res 18,5641-5648 5. Choo, K. H A , Earle,E , Vessel,B , and Kahtsis,P (1992)A chromosome16specific humansatellite III DNA subfamilythat showsvariable presenceon different chromosomes14 Am J. Hum. Gene& 50,706-716. 6 Earle, E , Shaffer, L. G , Kalitsls,P , McQuillan, C , Dale,S , andChooK H A (1992) Identlficatlonof DNA sequences flankingthebreakpointof humant(14q21q)Robertsoman translocationsAm J Hum. Genet 50,717-724. 7. Kahtsis,P., Earle,E , Vessel,B., Shaffer,L G , McQuillan, C , andChooK. H A. (1993) A chromosome13specifichumansatelliteI DNA subfamilywith mmorpresence on chromosome21 Further studieson Robertsoman translocationsGenomrcs 17, 104-l 12. 8 Buckle, V. J andCraig, I. W (1986).In situ hybridization, m Human Genetic Diseases* A Practical Approach (Davies,K., ed.), IRL, Oxford, UK, pp. 85-100 9. Choo,K. H. A., Brown, R., andEarle,E. (1991)In situ hybrldlzatlonof chromosomes, m Methods in Molecular Btology, vol 9: Protocols in Human Molecular Genetics (Mathew, C , ed.), Humana,Clifton, NJ, pp. 233-254 10 Zabel, B. U , Naylor, S L., Sakaguchl,A Y , Bell, G I , and Shows,T B. (1983)High resolutionchromosomallocahzatlonof humangenesfor amylase,prooplomelanocortm, somatostatin,anda DNA fragment(D351)by In situ hybridization.Proc. Nat1 Acad. Scr USA 80,6932-6936
Earle
and Choo
11. Brown, R. M., Dahl, H -H M , and Brown, G K. (1989) X-chromosome locahsatron of the functronal gene for the El alpha subunit of the human pyruvate dehydrogenase complex. Genomics 4, 174-18 1. 12 Brown, G K., Brown, R M , Scholem, R D , Kirby, D. M., and Dahl, H.-H M (1989) The clnucal and biochemrcal spectrum of human pyruvate dehydrogenase deficiency. Ann NYAcad. Sci 573,360-368. 13 Webb, G. C., Lee, J. F , Campbell, H. D , and Young, I G (1989) Haemopoietic growth factor gene IL3 and IL4 mapped to the same locus on mouse chromosome 11, Cytogenet Cell Genet. 50, 107-l 10
CHAPTER 15
Gene Mapping Using 3H-Labeled Heterologous Probes Pino Maccarone, Stephen A. Wilcox, Jaclyn M. Watson, and Jennifer A. Marshall-Graves 1. Introduction In situ hybridization is a technique whereby a labeled DNA probe is hybridized directly to denaturated metaphase chromosomes fixed on a microscope slide. The cloned probe, labeled by a radioactive or fluorescent tag, hybridizes specifically to the single-stranded sequence(s) in the genome, and the location of the gene or sequence of interest on the chromosome is visualized by autoradiography or fluorography. Here we will discuss only radioactive in situ hybridization. The method has been used extensively m conlunction with Southern analysis of hybrid panels and linkage analysis to both confirm and construct physical maps of human and mouse chromosomes, using cloned human or mouse genes homologous to the target sequence. However, much comparative mapping may be accomplished without the necessity of cloning each gene. Thus it is possible to construct physical genetic maps for any mammalian species without the time-consuming process of cloning the homologous sequences. The DNA coding sequences of homologous genes in different species, as defined by O’Brien and Graves (I), are frequently highly conserved between both closely and even distantly related mammalian speciesas a consequence of a) functional constraints on sequence divergence, and b) the time elapsed since the species diverged. The degree of sequence conservation of a specific gene of interest between different species can be assessedby probing Southern blots containing genomic DNA from the various species (zoo blots) with a cDNA probe cloned from one of the species. Many cDNA clones from human and mouse are currently available for gene mapping studies. If the sequence is demonstrated to be highly or moderately conserved between species, it is possible to use the heterologous DNA clone to map the sequence to the chromosomes of even distantly related species.We have routinely used human and mouse probes to localize genes m marsupial (metatherian) and monotreme (prototherians) From Ed&d
Mefhods N) Molecular S!o/ogy, Vol 33 In Situ Hybr~dmtron Protocols by K H A Choo Copynght Q 1994 Humana Press Inc , Totowa, NJ
159
Maccarone
160
et al.
mammals (which diverged from the Eutheria 130 and 170 million years ago, respectively). The comparison of genetic maps between eutherian, marsupial, and monotreme mammals has already permitted us to test a number of hypotheses concerning the evolution of mammalian sex chromosomes (2) and autosomes during mammalian evolution (3). Thus chapter provides a detailed description of a radroactive in situ hybrtd-
lzation procedure using heterologous DNA probes to marsupial chromosomes. The procedure can be readily adapted to map homologous gene loci to the chromosomes
of any mammalran
species. Problems
that may be encountered,
and their solution, will be discussed. 2. Materials 2.1. Chromosome Preparations 1. Phosphate buffered saline (PBS). 0.14M sodium chloride (NaCl), 3mM potassium chloride (KCl), 1 mM calcium chloride (CaC12), 2 mM magnesium sulfate (MgSOJ, 2 mM potassium drhydrogen orthophosphate (KHzPOJ, 3mM drsodrum hydrogen orthophosphate (Na,HP04), and 0.002% phenol red 2. Trypsin versine (TV)* 0.1% trypsm powder and 0.1% ethylenediaminetetraacetrc acid tetrasodium salt (EDTA), m PBS. 3. Colcemrd (Sigma, St. Louis, MO): 10 mg/mL in PBS Store at 4’C 4. Fixative. 3: 1 mix of methanol and glacial acetic acid. Make fresh on the day of use. 5 0.05MKCl 6. 0. IM hydrochlorrc acid (HCl). 7. Ethanol (50, 70, and 100%). 8. RNase A. Remove contaminating DNase by heatmg at 100°C for 15 mm and allowing to cool prror to storage at -20°C 9. 2X SSC. 20X SSC stock comprises 3M sodium chloride and 0 3M sodium citrate, pH 7.0 10. Slide rack holders. 11. Gauze pads. 12 Diamond tipped pencil. 13. lo-mL (2X) and 50-mL (IX) centrifuge tubes. 14. 37°C incubator. 15. Slides and coverslips. Grease, dust, and residual chemicals present on both slides and coverslips are capable of mterfermg with the hybridization of the cDNA probe(s) to the chromosomes, resulting m either a lack of signal or false-positive. Soak the slides and coverslips in O.lM HCl for 48 h, rinse under running tap water for 2 h, air-dry, then dehydrate in 70% ethanol for 5 min followed by 5 min in 100% ethanol. Store the slides in a dust-free environment at room temperature, and the coverslips in absolute ethanol at 4°C. Prior to use, wipe the slides with gauze to remove any residual oily films that may be present. Siltcomze the coverslips by dipping in Coatasrl (Ajax Chemicals, Auburn, Australia) and leaving uprrght to dry at room temperature (Warning: Coatasil contams dimethyldrchlorosrlane, which is a toxic and highly volatrle compound. Avoid breathing m the vapors. Use only m a fume hood.)
Gene Mapping
1 2. 3. 4. 5. 6 1. 2.
3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.
in Divergent
161
Mammals
2.2. Removal of Endogenous RNA 100 l.tg/mL of RNase A. 2X SSC, pH 7.0. Ethanol (50, 70, and 100%). Decor box. These are plastic containers with tight-fitting lids that prevent any significant loss of moisture from the atmosphere within the container. Larger contamers (- 250 mm x 200 mm x 100 mm) are more manageable than smaller ones. Paper towelling. 37°C incubator. 2.3. Preparation of Radioactive Probes [3H]d-CTP, 50-85Ci/mmol, [3H]d-GTP, 25-50 Ci/mmol, [3H]d-ATP, 50-100 Ci/ mmol; dTTP 300 mM. Enzyme solution, 10 pg/ul DNaseI and 0.5U DNA polymerase I. All the tritiated nucleottdes and enzyme solution components may be bought Individually, however, various nick-translation ktts (e.g., Amersham, Arlington Herghts, IL) have proven highly reliable in their ability to label cDNA probes. Distilled HzO. 0.5M Ethylenediaminetetra-acetic acid disodmm salt (EDTA), pH 8 0. 10% Sodium dodecyl sulfate (SDS). 10 mg/mL Bovine serum albumin (BSA) 10% Trichloroacetic acid (TCA). Scintillation liquid number 5. Prepare by dissolving 15 g PPO, 1 5 g POPOP in 2 5 L of toluene in a fume hood. 2 mg/mL of sonicated salmon sperm DNA. 3M Sodium acetate. Ethanol (100%). Eppendorf tubes (2). Wasserman tubes (2). Pasteur pipets (2) Scmtillation vials (8). Glass-fiber filter-GFK (Whatman). Scintillation counter. Sephadex G50. Prepare by hydrating 1 g of Sephadex G50 m 20 mL of 10 mM Tris-HCV0.1 mM EDTA, pH 7.5. Autoclave and store at 4’C. 2.4. Chromosome
Denaturation
1. Dry ice. 2. Ethanol (70 and 100%) 3. 70% Formamide. Deionize ultra-pure formamide with a mixed-bed ion exchange resin (5 g/100 mL) in a beaker completely covered m aluminum foil. Stir overnight. The following day, filter the formamide twtce through Whatman number 1 filter paper and either use it that same day or store it overnight at -20°C (Warning: Formamide is a known carcinogen Carry out all steps involving formamtde in a fume hood ) 4. Water bath 5. Coplin staining Jars (2).
Maccarone et al.
162
2.5. Hybridization 1 Probe cocktail mixture: 50% (purified) formamide, 10% dextran sulfate, and a final concentration of 2X SSCP. Make in bulk and store at -20°C. Stable for at least 12 mo. 10X SSCP comprises 1.2MNaCl,O.l5M trisodium citrate, and 0.2M sodium phosphate (approx 4 vol of 0.2M Na2HP04, and 1 vol of 0 2M NaH,PO,.2H,O), pH 8 0. 2. 2X SSC, pH 7 0 3 37°C incubator 4. Heating block. 5. Rubber cement. 6. Decor boxes. 7. Paper towelling. 1.
2 3. 4 5
2.6. Posthybridization 50% (purified) formamide 2X SSC, pH 7 0. Ethanol (70 and 100%). Water bath. Slide rack holders
Treatment
2.7. Autoradiography 1. Amersham LM 1 nuclear track emulsion. Each batch of emulston should be carefully screened on at least two test shdes containmg metaphase chromosome preparations (see Section 3.7.) to ascertain whether the emulsion produces a sufficiently low background that is acceptable to allow the labeled chromosome preparations to be coated. Store at 4°C 2. Glycerol. 3 Distilled Hz0 4. Ilford Phenisol developer (Ilford Ltd., Mt Waverly, Australia) (diluted accordmg to the manufacturer’s instructions) 5 Ilford Rapid fixative (diluted accordmg to the manufacturer’s instructions) 6 3% Glacial acetic acid. 7 Giemsa stain (BDH Pharmaceuticals, London, UK) 8 Gurr’s buffer (BDH Chemicals). 9 Whatman number 54 filter paper (Whatman International, Maidstone, UK). 10 Darkroom, with red safehght 11. Water bath. Any indicator lights present on the water bath are to be completely sealed over with alummum foil to prevent any light from bemg emitted. Any light that is emitted will adversely affect the LM 1 nuclear track emulsion, rendering rt unsuitable for use.
3. Methods 3.1. Chromosome
Preparations
In order to locate cloned genes to metaphase chromosomes by in situ hybridization it is essential to have: a) a high mltotic index, thus requiring fewer slides, less emulsion, and permitting less tedious scoring; b) no background
Gene Mapping
in Divergent
Mammals
163
cytoplasm; and c) well-spaced chromosomes with clear morphology. In our laboratory we use diploid fibroblast cell lines derived from embryos or adult skin, or cell hybrids contammg the chromosome of interest. Marsupial (and, to a lesser extent, monotreme) karyotypes are ideal for in situ hybridization, owing to their low diploid number and to the fact that their individual chromosomes are easily identifiable, without the necessity for them to be banded (Fig. 1). 1. Grow cells until flasks are approx 70-80% confluent 2 Add Colcemid to a final concentration of 0 0002-0.0005% to the cells, for a period ranging from 30 min to 16 h depending on the rate of cell growth. 3 Mitotic cells may be concentrated by washing off the monolayer as follows. a. After gentle tapping of the flask, remove the media from the cell culture flasks and place it in a IO-mL centrifuge tube. b. Wash the cells once with 1 mL of PBS, by pipetmg the PBS over the cells several times. c. Remove the PBS and place it in the centrifuge tube, with the media Cells that are arrested at metaphase will be dislodged from the cell culture flask, while cells that remain attached are still viable and may still be mamtained and reused in culture by the addition of the appropriate media d. Centrifuge for 10 min at 1000 rpm to pellet the cells. e. Discard the supernatant, wash the cells twice with PBS, and pellet as above 4. Resuspend the cells in 2 mL of 0.05M KCl, added dropwise from a Pasteur pipet. The optimal time for hypotonic treatment is dependent upon the cell lme used. Generally we have found that 12 to 18 min at 37°C IS sufficient. 5. Add 2 mL of fixative to the suspension and centrifuge for 10 mm at 1500 rpm. 6 Resuspend the cells m 2 mL of fixative and centrifuge; repeat this step 7. Resuspend the cells in 1 mL of fixative and allow 1 drop to fall from a Pasteur pipet onto a cleaned mmroscope slide from a height of approx 10 cm 8. Stain the chromosome preparations wtth 10% filtered Giemsa stain and examine under the microscope (see Note 1). 9. Store the chromosome preparations, either by placing in the fixative at -20°C (see Note 2) or dropping them onto microscope slides. 10. Mark the positron of the drop on the mrcroscope slides with a diamond-tipped pencil, in order to locate the cells during the hybridization procedure.
3.2. Removal of Endogenous RNA RNA effectively competes with the chromosomal DNA for the binding sites of the labeled probe, resultmg in an increase m the noise level and a significant reduction or elimination of any signal that may have been detected. Native RNA present within the chromosome preparations therefore needs to be removed prior to hybridization with the labeled probe. 1 Add 200 pL of a 100 pg/mL solution of RNase A to each &de, duectly over the marked position of the drop of the cell suspension 2. Cover the chromosome preparations with a cleaned coverslip (40 x 22 mm). 3. Place absorbent paper towelling at the bottom of a decor box and saturate rt with distilled HzO. Drain off any excess distilled H,O.
164
Maccarone et al.
Fig. 1. The karyotype of the marsupial Sminthopsis macroura is well suited to in situ hybridization owing to its low diploid number (2n = 14), and chromosomes which are easily identifiable without the necessity for banding. Chromosome 3q (arrow) is labeled after in situ hybridization with a probe for the mouse interferon a receptor gene (INFAR). 4. For the remainder of the procedure the slides can be handled with gloved fingers.
Place the slides in the decor box, close the box and make sure it is airtight, and place it at 37°C for 1 h. 5. Remove the slides from the incubator, and displace the coverslips by dipping the slides in a Coplin jar containing 2X SSC. 6. Place the slides in a slide rack, and place in 2X SSC at room temperature for 2 min with slight agitation. 7. Treat the slides a further three times with 2X SSC as described above.
Gene Mapping
in Divergent
Mammals
165
8. After the final wash m 2X SSC, rinse the shdes in 50% ethanol. 9. Place the shdes in 70% ethanol for 2 mm and then in 100% ethanol for a further 2 mm. 10 Allow the slides to air-dry.
of Probes The labeling of cDNA probes by nick translation produces randomly cleaved, radioactively labeled DNA molecules. Once these molecules are denatured, a portion of one DNA molecule is capable of reannealing with the complementary region of another DNA molecule; thereby a network composed of DNA molecules that contain partial single-stranded regions that reanneal with the complementary sequencesof other DNA molecules is created (4). The larger the DNA molecule to be labeled, the more extensive the netwoking. By labeling the cloned DNA fragment together with the vector that it has been cloned into, a more extensive network is created, generating a more intense signal at the sateof hybridization on the chromosomes (5). 3.3. Labeling
1 Ahquot 20 l.rL of [3H]d-CTP, 20 PL of [3H]d-GTP, and 40 PL of [3H]d-ATP into a 1.5mL Eppendorf tube and dry down m a SpeedVac for approx 2 h. 2. In order to redissolve the nucleotides, add to the dried nucleotides a vol of distilled Hz0 that will produce a final vol of 25 pL, vortex, and centrifuge at maxrmum speed for 5 s. 3. Add 5 PL of d-TTP, vortex, and centrifuge as before. 4. Add 250 ng of probe DNA, vortex, and centrifuge as before. 5. Add 5 l.tL of enzyme solution and stir with the end of the mmropipet. Do not vortex. 6. Incubate the reaction at 15°C for 2 l/2 h. 7 Add 2.5 pL of 0 5M EDTA (pH 8.0) and 1 0 PL of 10% SDS to stop the reaction, vortex, centrifuge for 5 s, and place on ice. 8. TCA assay (see Note 3): a. Add 1 l.tL of the stopped reaction to a Wasserman tube b. Add 1 drop of 10 mg/mL solution of BSA from a Pasteur ptpet. c. Add 2 mL of me-cold 10% trichloroacetic acid (TCA), vortex for 5 s, and leave standing on ice for 10 min. d Filter the solution through a GF/C glass-fiber filter. Add a further 2 mL of TCA to the sides of the filter apparatus to wash through any radroacttve material that has attached to the filter apparatus. e. Dry the GFK glass-fiber filter m a 160°C oven for 15 min and place it in 5 mL of scintillation liquid number 5 f. Take a second l+tL sample from the the stopped reaction and spot it directly onto a second GF/C glass-fiber filter, allow to dry, and place it in 5 mL of scmtillation liquid number 5. g. Count both samples on a scintillation counter The sample that is spotted directly onto the GF/C glass-fiber filter will give the total radioactivity for the whole reactron,while the sample from the TCA assay will give the amount of label that has been incorporated into the probe.
166
Maccarone
et al.
9. Spm the remainder of the stopped reaction through a Sephadex G50 column: a Plug the base of a 1-mL syrmge with glass wool and fill it with Sephadex G50 b Add 100 pL of 2 mg/mL of somcated salmon sperm DNA to the column, as a preblockmg measure, to prevent any nucleic acids from bindmg to the Sephadexbeads c Wash the sonicated salmon sperm through the column with 200 l.tL of 10 mM Tris-HCl/O. 1 mM EDTA, pH 7 5, to remove any unbound DNA. d Place the column in a 10-r& centrifuge tube and centrifuge at 1000 rpm for 1 min. e. Discard the centrifuge tube and add the stopped reaction to the column. f. Add 200 l.tL of 10 mM Tris-HCl, 0.1 n-&f EDTA, pH 7 5, to the column. Place it in a new centrifuge tube and centrifuge at 1000 rpm for 1 mm 10 TCA assay the sample as previously described to determme the yield 11 Store at -20°C. 3.4. Chromosome
Denaturation
To allow hybrtdrzatron of the probe to its complementary sequences present m the chromosomes, the chromosomes are denatured m the presence of formamide. The formamide effectively lowers the temperature that IS required to denature the chromosomes (see Note 4). 1. Heat 45 mL of denaturation solution comprising 70% formamide in 2X SSC (pH 7 0 ) in a 70°C water bath. Cover completely with aluminum foil 2. Place the chromosome preparations in the denaturation solution and leave for 2 mm (or the optimal time determined, see Note 4) 3 Place the chromosome preparations in 70% ethanol and then 100% ethanol for 1 mm each. Encase the Coplm jars in dry-ice to maintain the the temperature at approx -2O’C 4 Place the chromosome preparations in a shde rack and allow to an-dry. 3.5. Hybridization
The annealmg of the probe DNA to the chromosomal DNA 1s dependent on the salt concentration of the hybridization solution, the temperature at which the annealing process occurs, and the concentration of the probe DNA (see Note 5). 1 Add 14 pL of the probe cocktail solution to an Eppendorf tube for each shde that is to be hybridized This should comprise 70% of the final hybridization solution (When preparing the hybridization mix solution, allow for 20 l.rL to be applied to each slide of chromosome preparations, see step 7, below.) 2 Add the labeled probe DNA so that the final probe concentrations will range from 0.05 ng&L to 0.3 ng/l.tL. 3 Add distilled Hz0 to give the correct probe concentrations. 4. Puncture a hole in the lid of the Eppendorf tube and heat at 100°C for 5 mm. 5. Immediately place the Eppendorf tubes on ice until the hybridization solution is ready to be applied to the chromosome preparations. 6 Immediately prior to application, vortex the hybridization solution briefly and centrifuge at 12,000 rpm for 5 s
Gene Mapprng
in Divergent
167
Mammals
7. Add 20 pL of the hybrrdrzatton solution to each slide, in the marked region 8 Gently lower the silrconized coverslips onto the hybridtzation solution, over the chromosome prepartrons 9. Seal the coverslips with an abundance of rubber cement. Applying a large excess of the rubber cement allows the coverslips to be removed with mmtmum effort after the hybridization 10. Place absorbent paper towelling at the bottom of a decor box and saturate it with distilled HzO. Drain off any excess distilled HZ0 11 Place the slides m the decor box, close the box, and ensure that it 1s airtight. 12 Incubate the slides at 37°C for 16 h. We have found that increasing the time of hybridization above this only increases the noise level.
3.6. Posthybridization
Treatment
1 Remove the rubber cement and the coverslips from the slides with a pair of forceps and discard them in a tritium waste bin, as the coverslips will be radroacttve. 2. Place the slides in a slrde rack 3. Wash the slides, with stirring, in 2 L of a 2X SSC solution for 10 min at room temperature. 4 Wash the slides in three changes of 50% purified formamide/2X SSC at 41 ‘C for 10 mm each. 5. Wash the slides, with stirring, in 2 L of 2X SSC at room temperature for 10 min. 6. Dehydrate the chromosome preparations by placing the slides in 70% and then 100% ethanol at room temperature for 2 mm each 7. Allow the slides to air-dry Slides can be tmmedtately autoradrographed, or may be stored for up to several weeks in a dust-free environment at room temperature, with no loss of signal (due to the relatively long half-life of trttium)
3.7. Autoradiography Though the LM 1 nuclear track emulsion has proven a suitable emulsion for the use in in situ hybrrdizatton, different batches of emulsron produce drffermg degrees of background. Therefore, each new batch of emulsion should be tested on two test slides containing unhybridized chromosome preparations. If the emulsion is not suitable for use, it should be returned immediately to the manufacturer (see Note 6). Testing of the emulsion and procedure for autoradiography are as follows: 1. In a darkroom containing a red safelight, set the temperature of the water bath to 43OC. 2. Place the bottle of Amersham LM 1 nuclear track emulsion m the water bath and leave for 30 mm until the emulsion has melted. Any emulston that is not used is to be stored at 4’C, m the dark 3. Add glycerol to a 50-mL Corning tube, calculated to make a final concentration of 0 5%. 4. Add 31.5 mL of distilled Hz0 5. Add 18 mL of the melted emulsion and mix gently by inverting three times. 6. Dip a test slide into the emulsion for several seconds and allow to dry for 1 h
Maccarone
et al.
a. b. c. d.
7
8.
9.
10.
11. 12.
13
Place the slides in Ilford Phenisol developer for 4 min at room temperature. Rinse the shdes in 3% glactal acetic acid for 10 s. Place the slides in Ilford Rapid fixative for 4 min Place the slides m a water bath under running tap water for 10 to 15 min and allow to air-dry. To stain the chromosomes, make up a solution of 10% Gtemsa stain diluted in Gurr’s buffer. Filter through a Whatman number 1 filter, and with the aide of a Pasteur pipet, apply 2 mL of the stain directly to the drted test slides After 8 min, wash the stain off the slides with tap water, allow to atrdry, and then examine Once the suitability of the emulsion has been ascertained, dip the hybridized slides into the Corning tube containing the emulsion mixture For convenience, handle the slides with gloved fingers Allow the slides to dry m darkness, by placing them in a cupboard in the darkroom for approx 1 h. This ensures that the emulsion is not exposed to any light when one is entering and leaving the darkroom. Once dry, place the slides in a black slide box with desiccant, seal all the sides of the box with black electric tape, and store tn a black plastic film bag. Store the slides for 4 to 6 wk at 4°C. Develop one slide and stain as described for the test slides. If there 1s sufficient label, that is, if silver grams are present on individual chromosomes, develop and stain all the slides. Score and analyze distribution of grains on chromosomes (see Note 7)
See Notes 8-10 for a discussion of a number of practical problems that can lead to the nonlocalizatlon of various genes. 4. Notes 1. Examine the slides under 100x magnification for the cell denstty, under 400x magnification for the mitotic index, and under 4000x for the absence of cytoplasm and the morphology of the chromosomes. Contracted chromosome preparations that make it difficult to dtstinguish individual chromosomes should be avoided, as well as chromosomes that overlay one another, since a single gram located on or near this overlay will not be able to be assigned to an individual chromosome. Ideally, there should be approx 3 chromosome preparations visible in the field of view under the 100x magmfication. It is possible to adJUst the cell density accordmgly, as follows. a. Centrifuge the cells for 10 mm at 15OOg, b. Discard the supernatant, and add an amount of fixative that will either concentrate or dilute the cell density, as estimated from the test slide; and c. Place a single drop of the cell suspension onto a shde, stain, and examine as described above. 2. Although the chromosome preparations may be stored at -2O”C, background cytoplasm and cell clumpmg tend to mcrease during storage, possibly owing to the level of water in the fixative. Therefore, it is best to avoid storing the cells in IL.. I?..._^.___^c----.. - __._..2-J -_..:--I -c I...-
Gene Mapping
in Divergent
Mammals
169
3 This step mvolves determining the amount of radioactivity that has been mcorporated into the probe by performing a trichloroacetic acid (TCA) assay The TCA assay allows the separation of the radioactive oligomerrc nucleic acids from the radioactive nucleotrdes and nucleosides. Oligonucleottdes greater than 20 nucleottdes in length are collected on a GF/C glass-fiber filter, while those of a shorter length are washed through. 4. Each batch of formamrde needs to be tested prior to use to determine a) the time the chromosome preparations are left in the formamide (denaturatron) solution, and b) its abrlity to allow the chromosomes to be stained. The testing is carried out by taking 2 test shdes through the denaturation procedure and then stammg them with Giemsa The time the chromosome preparations are left m the denaturation solution is critical. Too short a pertod will not allow sufficient time for the chromosomes to be denatured, whereas too long a period will adversely affect the morphology of the chromosomes, thus preventing the probe DNA from annealing The optrmal time the chromosomes are left in the denaturatron solutron may vary between different species; however, we have found that 2 min IS generally adequate for a wide range of eutherran, marsupial, and monotreme species. The optimal time IS just prior to when the denaturatton solution adversely affects the morphology of the chromosomes. As the denaturation solution consists of formamrde, which contains ammonmm compounds that are capable of adversely affecting the morphology of the chromosomes, it is essential that the denaturation solution is mamtamed at pH 7.0, to overcome the effects of the ammonium compounds (6) 5. The presence of low salt and high temperatures favors accurate base parrmg, and IS applied when usmg homologous probes. With heterologous probes, the strmgency of the hybridrzation conditions is relaxed, to compensate for the differences between the sequences of the probe DNA and the chromosomal DNA. As less accurate base pairing is favored by the conditions applied to the heterologous probes, the stgnal that IS obtained is weak in comparison to homologous probes (Fig. 2). This means that the labeled chromosome preparations are exposed to the nuclear track emulsion for an extended perrod of time, thereby also elevating the noise level. The requirement for high temperatures for hybridization is offset by the use of formamide, which effectively lowers the annealing temperature. The addition of dextran sulfate to the hybridization solution also increases the annealing rate between the probe and chromosomal DNAs by reducing the effective volume available to the probe DNA in solution, therefore increasing the concentration of the probe DNA (4). The concentration of DNA at which the optimal signal-to-noise ratio IS obtained varies from probe to probe for various reasons, such as the type and size of the gene probe and the specific activity of the probe; thus a series of probe concentrations, rangmg from 0 05 ng/pL to 0.3 ng/pL, are applied to different chromosomal preparations. Generally, 2 to 3 slides at the separate concentrations are sufficient to obtain enough chromosome preparatrons that will generate a signal. 6. As the emulsion has a tendency to spoil over time, tt should also be tested on 2 test slides, on each occasion prior to slides being coated. The test shdes are exam-
170
Maccarone
IA ml ::i.. ... :. ... 3 : :: .:...... ...... .......... Ez-
3
1P
lq
et al.
I
.:: ::: ::: ::: .. . .:.. ::: : ::::::::. ... .. .. .. .. .. .. .. .. .. .. 1 LX 3P 3q
:. ::::i.:: . . . . . . . . :.::!I .. . . . .
cx
l
:
::...
. : . 00
:::::
J
4P 49 SP 5q 6q 6~ XY
3 3
: B :. &:,:.-:i* : :ii :g**: ii;* : ‘: ‘**** .. .. .. .. .. .. .. .. .. . . .::...............::::::.::. ..* . . . . . . . . . -~oooo s-m 6p 6q 3/4p3/4q sp sq IP lq 2P 2q CHROMOSOMES
,:
:
i::
7 XpXq Y
Fig. 2. Grain distrlbutlonover the chromosomes of the marsupialspeciesS naacroura (A) andMacropus eugenrr (B), after tn situhybrldlzation with the mouseinterferona receptorgene (INFAR) probe The useof heterologousprobesgenerateshigh noiselevelsm relation to the signalobtamed,whencomparedwith homologousprobesThe high noiselevels are directly attributableto the differencesm the basecomposltlonof the probeDNA andthe chromosomal DNA ined under 4000x magnification for the presenceof sliver grains. If an average of fewer than 3 gramsare visible in the field of view, then the emulsion 1ssuitable If background is too high, do not use the emulsion. A fresh batch should be opened and its quality examined 7. The major inherent problem when using heterologousprobes for in situ hybndization is the signal-to-noise ratio that results from the moderation of the stringency conditions. The useof radioactive probes and the liquid emulsion to detect its disintegration also leadsto the presenceof background radiation that exposes the emulsion, thereby lowermg the signal-to-noise ratio. To overcome this problem, a statistical analysis was devised to detect if any region of a chromosome was significantly overlabeled The test comprises the one-tailed Z,, test (7), which allows the target genometo be broken down to any number of segments.It then tests the overall distribution of grains for departure from randomnessand identifies any significantly overlabeled segment.The Z,, test can then be usedto determine whether there are any minor sitesof hybridization within the genome 8. Excessive noise level. This is the major problem encountered its effect is to dramatlcally decreasethe probability of obtaining a signal, as the signal becomes diminished amid the noise. There are a number of causesfor excessive noise level: a. The emulsion usedmay be a source of noise. On occasions,a batch of emulsion that is of a substandardquality may be obtained, whereby silver grains develop through a nonradioactive process that are indistinguishable from
Gene Mapping
in Dtvergent
Mammals
171
those that develop through the release of energy from the radiolabeled probe. The problem with such emulsions is avoidable by examining the quality of the emulsion prtor to use, as described in Section 3.7. b. Failure to properly clean or store the slides allows residual chemicals and dust particles to remain and further accumulate on the slides During the period that the probe and chromosomal DNA are allowed to hybridize, the probe is able to stick to the dust particles on the slide, thus increasing the relative noise level. c. Improper autoradiographic technique tends to result m the productton of silver grains caused by a nonradioactive process This is due to exposure of the emulsion to reducing agents, heat, or light that react with the srlver hahde withm the emulsion, resulting m the development of silver grains (8). All equipment that is used for autoradiographic purposes should be thoroughly cleaned prior to use and should only be used for the specific purpose of autoradiography, so as to avoid contamination by products that may interfere with the autoradiographic process. Adherence to correct autoradtographic technique will keep the noise generated from nonradioactive processes to a mimmum. d. Only a limited number of sites are available for the probe to hybridize to the chromosomal DNA. These sites are filled within the first few hours of hybridtzauon, though the process 1sallowed to continue for several hours more, with no adverse effects (6). However, we have have found that extending the time beyond that recommended in Section 3 5 results in a clustermg of the silver grains throughout the chromosome preparations, making analysis impractical. e. Native RNA located within a cell is able to reduce the efficiency with which the probe is able to hybridtze with the chromosomal DNA. Thts is due to the native RNA competing with the chromosomal DNA for the binding sites of the probe. The effictency IS further reduced if the gene being localized is transcriptionally active. Therefore, failure to effectively remove the native RNA from the chromosome preparations will inhibit efforts to localize genes The main cause of not removing the native RNA is a loss of activity of the RNase A over time. This is caused through continued freezing and thawing of the enzyme 9 Overstainmg of the chromosomes can result in those silver grains overlying a chromosome not being detected, as the intensity of the stain will mask the grains The recommended time of 8 min, as stated in Section 3.7., should only be used as a starting point, as different chromosome preparations will stain with varying degrees of intensity. Therefore, after each batch of slides has been developed, a single slide should be stained for the 8 min and the remaining slides stained for the appropriate duration, as determined by the intensity of the stammg of the test slide. Understaming of chromosomes does not necessarily create a problem, as individual chromosomes can still be identified. 10 The degree of conservation of the DNA sequence of the gene of interest and that of the probe being used to detect it will determine whether a signal will be obtamed through the in situ hybridization process. If a probe 1sable to produce a signal on a Southern blot, with the appropriate genomic DNA, then that probe can be used to localize the homolog in the species being examined If a probe is unable to produce a signal on a Southern blot, then that probe ~111not be suttable for in SW
172
Maccarone et al. hybridization purposes. Owing to differences in the DNA sequences that exist between the probe and its homolog in separate species from which the gene is cloned, the stringency of the hybridization process and those of the washes are reduced, in comparrson to that when homologous probes are used. As a result of these relaxations, whtch favor less accurate base patrmg, the overall signal-tonoise ratro is weaker in comparison to the use of homologous probes. In many cases, increasing the stringency of the hybrrdizatron and washing conditions will not yield a srgnal rf the level of divergence between the probe DNA and chromosomal DNA 1s sufficiently high.
References 1 O’Brien, S J and Graves, J A M. (1991) Report of the committee on comparative gene mapping. Cyrogenet Cell Genet 58, 1124-l 151 2. Graves,J. A M. andWatson,J. M. (1991)Mammaliansex chromosomes: Evolution of organizationandfunctton. Chromosoma 101,3-68 3 Maccarone,P , Watson,J M , Francrs,D , Selwood,L , Kola, I , and Graves,J A. M. (1992)The evolution of humanchromosome 21 Evidencefrom m situ hybridizatton m marsupialsanda monotremeGenomlcs 13, 1119-I 124 4. Wahl, G. M , Stern,M , andStark,G. R (1979)Efficient transferof largeDNA fragments from agarosegelsto diazobenzyloxymethyl-paperandrapid hybridization by usingdextran sulfate Proc. Nat1 Acad Ser. 76,3683-3689. 5. Buckle, V J. andCraig,I W (1986)In situ hybridization, in HumanGenetcc Drseases* A Practical Approach (Davies,K , ed ), IRL, Oxford, UK, pp 85-100 6. Henderson,A. (1982) Cytological hybridization to mammalianchromosomes. Int Rev Cytol 76, 146
7. Ewens,W. J , Griffiths, R. C , Ethier, S N , Wilcox, S A , andGraves,J. A M. (1992) Statistical analysisof m situ hybridizatiom data*Dertvatton and useof the Z,,, test Genomics 12,675-682. 8 Rogers,W. (1982) Practical autoradtography Revrew 20, AmershamInternational, Buckinghamshire, England
CHAPTER 16
Dual-Label Fluorescence In Situ Hybridization Detection of Individual Chromosomes in Sperm Using Ejaculated Semen Judith H. Ford, Tie Lan Han, and Graham C. Webb 1. Introduction The development of chromosome-specific DNA a-satellite probes, chromosome paints and contigs, together with the refinement of fluorescence in situ hybridization (FISH) techniques, has added much to the power of the technique for the detectton of specific chromosomes in sperm. The technique has many uses, for example, screening for aneuploidy either at the base rate in untreated individuals or m those who have been exposed to cytotoxic chemicals and/or radtatton, exammmg the possible association between poor sperm morphology and chromosome abnormahty, observmg frequenctes of X and Y chromosomes to detect biases in sex chromosome frequency that might be naturally or artificially Induced. Previous studies of the risks of compromised reproductive outcome in mdividuals who have been accidentally or clmically exposed to cytotoxic agents, have used somatic tissues, especially peripheral blood, because of accesstbtlity and the capacity to induce cells to divide in vitro. However, it 1shighly desirable to perform such genetic analyses on the gametes themselves. Oocytes still present a problem of accessibility for routine assessment,but sperm are easily obtained and are present in very large numbers. The limitattons of sperm are that the cells are not dividing and the chromatm is in a highly condensed state. The hamster egg penetration technique was first described by Rudak et al. (I) as a means of observing sperm chromosomes. This technique has been used by several laboratories but is severely hmtted by its labor Intensiveness, the inability to score large numbers of cells, and the hkehhood that the results are biased by selectton of sperm that have the capacity to fertihze the hamster egg. This paper will describe the preparative steps for sperm and the subsequent FISH procedures that are necessary to achieve consistent labeling of single and From Edlted
Methods m Molecular Salogy, Vol 33 In SIIU Hybndrzalron Protocols by K H A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
173
174
Ford, Han, and Webb
multiple chromosomes in sperm. All experiments described for sperm are controlled by applying the same probes to spreads of metaphase chromosomes. The techniques we used to make our metaphase control slides are quite standard and will not be described here. 2. Materials 1. Semen samples: Produced by masturbation, allowed to liquify at room temperature for at least 20 min 2. PBS* Phosphate buffered saline without Ca2+ and Mg2+ One liter contains 8 g NaCl, 200 mg KCl, 11.50 mg Na2HP04, 200 mg KH2P04, pH 7.4. 3 EDTA: Ethylenediaminetetraacetic acid. 4 DTT Dithiothreitol. 5 Carnoy fixative: methanol*glacial acetic acid (3: 1, v/v), freshly mixed. 6. Slides: With frosted end. Clean by soaking in 5% Decon-90 for at least 2 h, but no longer than 16 h Rinse well in flowing tap water, rinse once in distilled water, then three times m ethanol and dry. 7 HEPES-HTFM. HEPES buffered human tubal fluid medium (2) One liter contains 5080 mg NaCl, 320 mg KCl, 40 mg MgS04*7H20, 40 mg KH2P04, 280 mg CaC12+2H20, 2000 mg NaHCOs, 500 mg glucose, 30 mg Na pyruvate, 2035 mg Na lactate. Before using, add 100 U/mL Penicillin and 50 pg/mL streptomycin SO, 8. Graduated Pasteur pipet. Attach a I-mL syringe to a Pasteur pipet by means of plastic tubing 9. TRX probe: An X-chromosome specific probe, a gift from K. H A. Choo (3,4). TRX belongs to the a-satellite DNA family and was incorporated into pUC 9 plasmid. It is 400-bp long and recognizes 5000 copies of a sequence located m the centromeric region of the X chromosome. 10. TR17 probe: A chromosome 17-specific probe, a gift from K H. A. Choo (3-5) This probe belongs to the a-satellite DNA family and was incorporated into a pUC 9 plasmid. It is 1600-bp long and recognizes a sequence with 3000 copies located in the centromertc region of chromosome 17. 11 HRY probe. A Y-chromosome specific probe was the gift of K. Reed and K. Mattel who renamed it HRY after recloning from Amprobe RPN 1305X (Amersham, Arlington Hetghts, IL) mto pTZ 18m (BioRad, Richmond,CA). The sequence is identical to the HaeIII repeat in pHY2.1 orgmally isolated by Cooke et al (6) and described in detail by him (7). It is a 2.1-kb long sequence inserted mto PGEM2 plasmid and hybridizes to the Yq12 heterochromatic region on the long arm of the Y chromosome 12 Blotin-dATP: Biotm-7-deoxyadenosme triphosphate (BRL) 13. Nick-translation system (BRL). 14. BioNick labeling system: This would now supercede 12 and 13 above (BRL). 15. 3H-dATP (Amersham). 16 Dig-dUTP: Digoxygenm- 11 -deoxyuridine triphosphate included in a kit and incorporated into probes using random priming (Boehringer Mannheim, Mannheim, Germany). 17. 3H-dTTP (Amersham). 18 100 mg/mL RNase A in 2X SSC. Any reliable brand. Heat solutions to 100°C to inactivate contaminating DNases if necessary
Detection
of Chromosomes
in Sperm
175
19. 20X SSC: 3M NaCl, 0.3M sodium citrate, pH 7.0. Dilute to n X SSC accordingly; always maintain pH 7.0. 20. Ethanol. Analytical reagent (AR) grade, variously diluted wtth distilled HzO. 21. Deionized formamide: Mix approx 10 g of mixed bed resin beads (Bio-Rad, AR grade) with 500 mL of formamide, AR, for at least 2 h. Add more beads if the blue indicator color is lost. Store at -2O’C. 22. Slide denaturing solution: 70% formamide in 2X SSC: 28 mL of deionized formamide, 4 mL of 20X SSC, 8 mL of HzO, pH to 7.0. 23. Salmon sperm DNA: Any reliable brand, sheared or sonicated. 24 10X SSCP: 0.12M NaCl, 0.15M sodium citrate, 0 1M NaH2P04, 0 1M Na2HP04, pH 6.0. 25. Dextran sulfate (Pharmacra, Uppsala, Sweden). 26. Rubber cement: “Earth” brand (Marumi Industry Co. Ltd., Japan). 27. NFDM: Nonfat dried milk (any brand) 28. Tris-HCI: Tris[hydroxymethyl] aminomethane hydrochloride. 29. Tween-20: Polyoxyethylenesorbitan monolaurate. 30. Wash solution: 0 1M Tris-HCl, 0 15M NaCl, 0.05% Tween-20, pH 7 5 3 1. FITC-avidin: Fluorescein isothiocyanate conjugated avidin, cell sorter grade (DCS) (2 mg/mL; Vector Laboratories. Burlingame, CA). 32. Biotinylated goat antiavidin (0.5 mg/mL, Vector Laboratories). 33. Blocking reagent: Specially purified fraction of dry milk powder (Boehringer Mannheim). 34. DAPI: 4’, 6-diamtdino-2-phenylindole; UV-fluorescing stain (Sigma, St. Louis, MO). 35. DABCO: 1,4-diazo bicylo-(2,2,2) octane; antifade reagent (Stgma). 36. Nail varnish: Colorless, acetone-based solvent. 37. Mouse antidigoxigenm (0.1 mg antibody/ml; Boehringer Mannheim) 38 Goat serum (Sigma Immune Chemicals, Sigma-Alldrich) 39. Rabbit antimouse-TRITC (tetramethylrhodamine isothiocyanate isomer R)-conjugated rabbit antimouse immunoglobulins (DAKO, Santa Barbara, CA). 40 Rabbit serum (Sigma) 41 Swine antirabbit-TRITC. TRITC-conjugated swine antirabbit immunoglobulins (DAKO). 42. Swine serum: (Sigma). 43. Fluorescence microscope: Leitz Dtaplan (Wetzlar, Germany) equipped with epifluorescence and the filter blocks: a, UV; I-2/3, blue; N-2, green, Fitted with MPS 45 camera system. 44. Color slide film: Color-positive Fugichrome DX 400 film
3. Methods 3.1. Preparation of Sperm 3.1.1. Semen Analysis Analyze semen accordmg to standard procedures (8). The samples we used
exhibit a vol of >2 mL (range: 2-4), concentration of A0 x lo6 sperm/ml (range: 80-240), ~50% progressive motility (range: SO-60), and ~45% normal morphology.
176
Ford,
Han,
and Webb
3.1.2. Sperm Decondensation and Slide Preparation Pretreat sperm to allow the chromatm to decondense and to provide access to the DNA probe. Sperm decondensatton is achteved wtth a modification of the method of West et al. (9). 1. Mix the semen sample with PBS containing 6 mM EDTA so as to obtain a final sperm concentration of 10-20 x lo6 sperm/ml 2 Settle the sperm by centrifugation at 160g for 5 min and remove the supernatant by suction. 3. Resuspend the pellet by pipeting in PBS containing 2 mMDTT at the same sperm concentration as above. 4 Incubate at room temperature for 45 mm with regular mtxmg 5 Recentrifuge the sample, remove the supernatant, and resuspend m 1 mL of PBS. 6. Mix thoroughly and then recentrifuge. 7 Remove the supernatant and add 1 mL of fixative drop by drop while vortexing. 8. Allow the sample to remain m the fixative at room temperature for 30 min before recentrifuging. 9. Resuspend in fresh fixative and then recentrifuge. 10 Add 10-14 drops of fresh fixattve to the sperm pellet to form a milky suspenston. 11. Drop the sperm suspension onto clean microscope slides and air-dry at room temperature. 3.1.3. Selection of Motile Sperm Using a “Swim-Up” Technique If the mvesttgator does not wish to study the chromosome constitutton of the whole semen sample but wishes to confine observations to the motile sperm,
these should be selected prior to decondensation. The separation technique uses the motile ability of the sperm to swim away from the nonmotile components of the semen. 1 Place 1 mL of liquefied semen mto each of two graduated centrifuge tubes 2 Add 2 mL of HEPES-HTFM to each tube and gently mix with the semen usmg a Pasteur pipet. Then cap the tubes. 3. Centrifuge the tubes at 300g for 10 min. 4. Remove the supernatant from each tube until 0.5 mL remains. 5 Make up to 2 mL with HEPES-HTFM and resuspend the loose pellet 6. Repeat the centrifugatton step and carefully remove most of the supernatant, leavmg the pellet suspended in 0.5 mL 7. Use a graduated Pasteur pipet to overlay the suspension with 0.5 mL of HEPESHTFM Make sure not to disturb the loose pellet. 8. Incubate the tubes upright m a rack at 37°C for 15-45 mm. 9. Remove 0.25 mL of the cloudy upper layer from each of the two tubes with a graduated Pasteur pipet and combme the contents of the two tubes in a new tube. This is the washed motile sample 10. Analyze and prepare the swtm-up fractton as m Sections 3.1.1. and 3.1.2.
Detection
of Chromosomes
zn Sperm
177
3.2. Labeling
of Probes for Nonradioactive In Situ Hybridization Typically, the TRX and TR17 probes have been labeled with brotin and the HRY probe with dlgoxygenm. 1. Nick translation: Incorporate brotin-dATP into the probes using a nick-translation system or its successor, the BioNrck labeling system Add a trace of 3HdATP (1 pCr) to allow determmation, by appropriate scintillation counting, of the degree of biotin incorporation, which should not be less than 10% (see Note 1). 2. Random priming, Incorporate Dig-dUTP into probes by random priming using the Boehringer Mannheim kit. Use a trace of 3H-dTTP (1 ~CI) to indicate, by scintillation countmg, the amount of drgoxigenin incorporated. 3. Commercially labeled probes. Many paints and probes are now sold rn a prelabeled condrtron We have achieved some good results by following the manufacturers’ instructions.
3.3. In Situ Hybridization to Decondensed Sperm Cells In situ hybndization usesa modification of the method of Arnoldus et al. (10). 3.3.1. RNase Pretreatment of Slides 1. Treat the slides with 150-200 PL RNase A under a coverslip for 1 h at 37’C. 2. Wash four times in 2X SSC, 2 mm each at room temperature 3. Dehydrate the slides through an ethanol series (2 mm each m 35, 70, 95, and 100% ethanol). Air-dry. 3.3.2. Denaturation of Cells on Slides 1. Preheat the slides to 70°C for 2 mm and denature them m slide denaturing solution for 2 min at 70°C 2. Cool immediately in 70% ethanol at -20°C for 2 mm 3. Dehydrate m 80, 95, and 100% ethanol at room temperature. Au-dry. 3.3.3. Denaturation of Probes 1. Make up for each slide, a hybridization mixture contaming 10 pL of labeled probe (20-40 ng), 5 p,L of salmon sperm DNA (2 mg/mL), 10 pL of 10X SSCP, and 25 pL of deionized formamide with 20% dextran sulfate 2 Denature the mix at 75“C for 10 min, then cool on ice for 10 min. 3.3.4. Hybridization 1 Apply 50 l,tL of the hybridization mixture to each slide 2. Seal under a coverslip with rubber cement. 3. Hybridize overnight (16-18 h) at 37’C in a motst chamber. 3.3.5. Washing at High Stringency 1. Wash the slides three times for 5 mm each at 45°C in 50% deionized formamide in 2X SSC, pH 7.0. 2 Wash another three times for 5 min each at 60°C in 0 1X SSC.
178
Ford,
Han,
and
Webb
3.3.6. Visualization of a Biotinylated Probe A sandwich labeling method consisting of three mcubation steps, each for
30 min at 37°C is used. Between each of the three steps wash the slides three times for 5 min each with wash solution. 1. Preincubate the slides with 5% NFDM m 4X SSC for 20 min at room temperature. 2. Incubate the slides with 0 8 mg FITC-avldin, 100 PL of 4X SSC, and 5% NFDM per slide. 3. Rinse three times for S min each m 4X SSC contammg 0.05% Tween-20 4. Wash three times with wash solution 5. Incubate the cells with biotmylated goat antiavidin, 2.5 ng diluted in SO PL of O.lM Tns-HCI, and 0 1SM NaCl, pH 7 5, containing 0 OS% blockmg reagent. 6 Wash three times with wash solution 7. Incubate the cells with 0.8 pg of FITC-avldm, again diluted m 100 PL of 0.2M Tris-HCl, and O.lSM NaCl, pH 7 5, containing 0.05% blocking reagent 8. Wash three times with wash solution. 3.3.7. Mounting 1 Dehydrate the slides through an ethanol series. 2. Dry and mount with a 9:l mix of glycerol and PBS that contams 1 pg/mL propldmm iodide as a counterstain and 20 pg/mL Dabco antifade reagent 3. Seal the slides with nail varnish and store in the dark at 4°C.
3.4. Simultaneous Hybridization with Multiple Probes The hybridization mixture IS the same as above m all respects except the probe concentration. The exact concentrations will depend on both the labelmg efficiency of the individual probes and their affinity to the target DNA. For simultaneous use of two probes, we have routinely used 40 ng of the shorter TRX (biotin labeled) and 20 ng of the longer HRY (digoxlgenin labeled) per 50 p,L of hybridization mix. We have not varied the concentration of salmon sperm DNA, but it IS probably advisable to maintain it at 1000X the concentratlon of the probes. As with a biotmylated probe, for the immunocytochemical detection of two differently labeled probes, consecutive steps are used, each of 30 min at 37°C with intervening washes with wash solution. 1. Preincubate the slides with 5% NFDM in 4X SSC for 20 mm at room temperature 2. Incubate with 0 8 ng per slide of FITC-avidin, m 100 PL of 4X SSC and 5% NFDM. 3. Wash three times with 4X SSC containing 0.05% Tween-20 4 Wash three times with wash solution. 5. Incubate with 2.5 ng per shde of biotmylated antlavidm, plus 0 1 pg mouse antidlgoxigenin, diluted with SOFL of O.lMTns-HCI, O.lSM NaCl, pH 7.5, contaming 0.5% blocking reagent and 5% goat serum
Detection of Chromosomes in Sperm
179
6. Wash three times with wash solution. 7. Incubate with 0.8 1.18per slide of FITC-avidin, plus rabbit antimouse-TRITC (0.1 mg antibody/ml), 1:40, diluted in 100 l.tL as for step 5, but with rabbit serum 8. Wash three times with wash solution, 9. Incubate with I:40 per slide swme antirabbit-TRITC (0.2 mg antibody/ml), the dilution 100 PL is as in step 5 but with swine serum. 10. Wash three times with wash solution. 11 Dehydrate the shdes through an ethanol series and dry. 12. Mount and store as in Section 3.3.7. above, but with DAPI counterstam.
3.5. Visualization and Photography of Three-Color Emissions Using a Basic Fluorescent Microscope Slides are examined at x1250 with a Fluorescence Microscope using UV, blue and green excitation. Examine each cell under the three different filters and score the results (see Note 2). Take photographs on color slide film, using triple exposure (II). Exposure times were usually lo-30 s for TRITC (red emission under green excitation), 2 min for FITC (green emission under blue excitation), and lo-30 s for DAPI (pale-blue emission under UV). Photograph TRITC and FITC first to diminish the effect of fading that occurs with these two dyes. Figures l-7 show some examples of results. In these examples, biotin-TRX is labeled green and digoxtgenin-HRY is labeled red. In black and white, the biotin appears as a bright spot and the digoxtgenin as a dull spot. Since the HRY binds to the flourescent long arm q12 region of the Y, this spot is larger than the centromerit specific TRX. See Notes 3-6 for a discussion on scoring labeled sperm cells. 4. Notes 1. Insufficient nick translation Two major factors influence the efficiency of nick translation, the first is the enzyme and the second is the probe Make sure that the enzyme is not exposed to temperature variation and is never removed from the freezer unnecessarily. The enzyme is often stable past its “expiration date,” but this should be momtored carefully. Dtfferent probes are labeled with different efficiencies. 2. Antibody interaction. Some species of immunochemtcal reagents form avid antibody mteractions The effect of this IS to produce “leaky” staining such that one probe will be detected under two filters, even though it has been stained with only one anttbody. To solve this problem rt is necessary to discover which antibody is giving the crossreactivity and to adsorb with this serum at the preincubation stages 3. Scoring labeled sperm cells Before scoring is undertaken, tt 1s Important to examine the slides to ensure that the background DAPI staining is not so bright that it Interferes with the hybridization signals. Should this be the case, the concentration of DAPI m the mountant should be reduced. Notes 4-6 descrtbe methods for scoring and the elimination of potential pitfalls.
180
Ford, Han, and Webb
Figs. l-7. (Fig. 1) Biotin-TRX and digoxigenin-HRY labeling of decondensed human sperm nuclei. Three of the sperm with each showing a bright FITC spot are X-bearing (top arrow indicates an example), and three of the sperm with each showing a dull TRITC spot are Ybearing (lower arrow indicates an example). (Fig. 2) DisomicX sperm(arrow).Two distinctive bright FITC spotsare seenin a nucleusof normalsize. (Fig. 3) Diploid X sperm(arrow) has two distinctive bright FITC spotsin a nucleusthat is larger than the haploid size. (Fig. 4) DisomicY sperm(arrow). Two distinctive TRITC spotsare seenin a nucleusof normalsize (seeNote 4). (Fig. 5) Diploid Y sperm(arrow) hastwo distinctive TRITC spotsin a nucleus that is larger thanthe haploidsize. (Fig. 6) Diploid cell (arrow) containingone X and one Y chromosome.The mirroredappearance of the adjacentcell suggests that thesearenuclei that have recently divided. (Fig. 7) Tetraploidcell. Two pairsof bright anddull spotsin one large cell, which is four timesthe sizeof a normalspermhead. 4. Definition of positive signals. Examine the slides carefully so that the observer is
sure of the difference between hybridization signals and background debris. Some probes, especially centromeric DNA, e.g., TRX and TR17, often give a double signal, presumably on either side of the centromere. Take care to distinguish
Detection
of Chromosomes
in Sperm
181
between the double slgnal of a single probe and two independent signals. This distmctlon is achieved by scoring, as two signals, only those signals that are separated by a distance that is greater than the size of each signal (see Fig. 4). 5. Characterization of cells. Sperm size is measured with an eye-piece micrometer. Haploid sperm have a diameter of 6-8 p., diploid cells have a diameter of 9-20 l.~, and tetraploid have a diameter of 21-35 l.~ Sperm tails can sometimes be seen under phase-contrast, but not all sperm retain their tails and this 1snot a reliable means of distinguishing sperm from contaminating somatic and spermatocytic cells (12) Scoring can be inaccurate if overlapping cells are included It 1slmportant to exclude any overlapping cells from the analysis. 6. Scoring methodology It is our practice to score in a very precise manner Before scoring is commenced, a scoring sheet is made that lists all the possible cell types and results. Scanning is commenced at one corner of the slide and continued in full scans across (preferably) or down the slide. Each cell that meets the above criteria is recorded. The position of each aneuploid cell, and of any other cell that evokes suspicion, is identified by the microscope vernier reading and recorded (see Note 7). All abnormal cells are rechecked later and photographed. 7 Fading bias. Fluorescence has a well-known tendency to fade under long UV exposure, Since this fading affects not only the particular cell under observation but also the surrounding cells, it is important that scormg is performed as quickly as possible without undue exposure of any “interesting” cells. These cells should be quickly identified, located with the vernier readings (with the beam filtered out during the process of location), and examined at length after the whole analySIS is completed.
References 1 Rudak, E , Jacobs, P A , and Yanagimachl, R (1978) Direct analysis of the chromosome constitutton of human spermatozoa. Nature 274,91 I-913. 2 Quinn, P., Kenn, J F., andWarnes,G. M (1985)Improvedpregnancyrate m humanm vitro fertilization with theuseof a mediumbasedon thecompositionof humantubal fluld. Fertd
Stenl 44,493-498.
3. Willard, H F., Waye,J , Skolnick,M H., Schwarts,C E , Powers,V E , andEngland,S B (1986)Detecttonof restrictionfragmentlengthpolymorphismsat the centromeresof humanchromosome spectftcsatellite-DNAprobes.implicationsfor developmentof centromerebasedgenetichnkagemapsProc. Natl. Acad. Scl USA 83,561 l-5615. 4. Choo, K H., Brown, R., Webb, G. C., Graig, I. W , and Alby, R (1987) Genomic organizationof humancentromericalpha satelltteDNA. characterizationof a chromosomal17 alphasatellitesequenceDNA 6,297-305. 5. Jabs,E. W andPerslco,M. G (1987) Characterizationof humancentromerlc regions of specificchromosomes by meansof DNA sequencesAm J. Hum Genet 47,374-390 6. Cooke, H. J (1976) Repeatedsequencespecific humanmales.Nature 262, 182-186. 7. Cooke,H J., Schmldke,J., andGosden,J R. (1982)Characterizationof a humanY chromosomerepeatedsequenceand relatedsequences tn higherprimates Chromosoma 87, 491-502. 8. World HealthOrganization(1987)WHO Laboratory Manual for the Exammatron of Human Semen and Semen Cervtcal Mucus Interactrons 2nded , CambrIdgeUmversltyPress, New York, pp. 3-10. 9. West,J. D , West,K M., andAitken, R J (1989)Detecttonof Y-bearmgspermatozoa by DNA-DNA rn situ hybrtdtzatlon. Mol Repro Dev 1,201-207
Ford, Han, and Webb 10 Arnoldus, E. P J., Wiegant, J , Noordermeer, I. A., Wessels, J. W , Beverstock, G C , Grosveld, G. C., Ploeg, M V., and Raap, A K. (1990) Detectron of the Philadelphia chromosome in interphase nucler Cytogenet Cell Genet 54, 108-l 11 11 Nederlof, P. M , Robmson,D., Abuknesha,R , Wtegant,J., Hopman,A H , Tanke, H J , and Raap,A. K (1989) Three-colourfluorescencein situ hybrrdrzatronfor the srmultaneousdetectionof multiplenuclercacrdsequences. Cytometry 10, 20-27. 12 Han, T. L, Ford, J H , Webb, G. C , Flaherty, S P, Correll, A, andMatthews, C D (1993)Simultaneous detectionof chromosome X- andY-bearmghumanspermby double fluorescencein situ hybridrzation Mel Repro Dev 34,308-3 13
CHAPTER 17
In Situ Hybridization to Drosophila Polytene Chromosomes Robert
D. C. Saunders
1. Introduction Since its development by Pardue and Gall (I), the technique of in situ hybridization to polytene chromosomes has played a central role m the molecular genetic analysis of Drosophila melanogaster. The power of in situ hybridization is due largely to the scale of polytene chromosomes and consequently the high degree of resolution they offer the researcher. The use of radiolabeled probes has now been largely superseded by nonradioactive signal detection systems, generally using biotin or digoxygenin substituted probes that offer greater resolution, since there is less scatter of signal with immunochemical and immunofluorescent detection than with silver grains. The utilization of in situ hybridization technology is of particular interest to those engaged in chromosome walking or genome mapping projects. It is essential to check all clones along a chromosome walk by in situ hybridization, in order to identify clones containing repetitive DNA, and to avoid the isolation of clones derived from regions outside that of interest. It is also useful when orienting a chromosome walk, and when determining if a particular clone is derived from DNA uncovered by a deficiency. At least one Drosophila genome mapping project (2) relies on in situ hybridization to accurately map sets of overlapping cosmids (contigs) to the polytene chromosome map, whereas another (3) used in situ hybridization as the sole means of ordering yeast artificial chromosome (YAC) clones along the genome. In this chapter I shall describe the use of biotin labeled probes for in situ hybridization to polytene chromosomes. These protocols are, of course, applicable to polytene chromosomes from other Diptera (see Note 1).
2. Materials 1. 2. 3. 4 5. 6.
Clean microscope slides (see Note 2). Clean siliconized coverslips, 24 mm square (see Note 2). Clean sihconrzed coverslips, 22 x 50 mm (see Note 2). 0.7% NaCl. 45% Acetic acid l-2.3 Fix: one part lactic acid, two parts distilled water, three parts acetic acid From Edlted
Methods m Molecular Bmlogy, Vol 33 In SW by K H A Choo CopyrIght Q 1994 Humana
183
Hybrfdmtron Protocols Press Inc , Totowa, NJ
184 7. 8. 9. 10. 11, 12
13 14. 15 16 17. 18.
19. 20 21.
22 23 24 25. 26.
Saunders 2X SSC: 1X SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7 0 70 mM Sodium hydroxide, freshly prepared. 70% Ethanol 96% Ethanol. Coplin jars, or similar, for incubatmg slides Oligolabeling buffer. Prepare this by mixing the following solutions A, B, and C in the proportion 2 5.3 Store this buffer and its constituents at -2O’C Solution 0. 1.25M Tris-HCI, pH 8 0. Solution A. To 0.47 pL of solution 0, add 9 pL of P-mercaptoethanol, 12 5 pL of 20 l,W dATP, 12.5 pL of 20 l&W dCTP, and 12 5 pL of 20 /.tM dGTP. Solution B* 2M HEPES, pH 6.6 Solution C: 90 Ap6a U/mL of random priming ohgonucleotides. TE 10 rniW Tris-HCl, pH 8 0, 1 mM EDTA 1 mM Biotin-16-dUTP Store at -20°C (See Note 3) Fluorescein-12-dUTP Store in the dark, at -2O’C (See Note 3) 2X Hybridization solution. 8X SSC, 2X Denhardt’s, 20% dextran sulfate, 0 8% sonicated salmon sperm DNA Store at -20°C. Plastic box with tightly fitting lid, lmed with moist tissue paper. Detek-1 streptavidin-horseradish peroxidase detection kit (Enzo Diagnostics, New York), or Extravidin-horseradish peroxidase conjugate (Sigma, St. Louis, MO) The Enzo dilution buffer is PBS supplemented with 1% BSA, 5 n-&f EDTA (see Note 3). PBS: 8 g NaCl, 0.2 g KCI, 1.44 g Na,HP04, 0.24 g KH,PO,, to 1 L PBS-TX. PBS containing 0.1% Triton X-100 DAB solution. 0 5 mg/mL diaminobenzidme m PBS, supplemented with 0 01% H202 (see Note 3). DAB is a potent mutagen. Care should be taken at all times when working with solutions containmg DAB. Gloves should be worn, and DAB should be dispensed in the fume hood. DAB should be inactivated m 50% bleach before disposal. 0 89% Glemsa’s staining solution m methanol/glycerol (Gurrs/BDH, Lutterworth, UK). Use as a 1.20 dilution in 10 mM sodium phosphate buffer, pH 6.8. DPX mountant (Fluka, Buchs, Switzerland). Avidin-fluorescem D (FITC) (Vector Laboratories, Burlmghame, CA) Store at 4°C m the dark (see Note 3). Glycerol mounting medium: 85% glycerol, 2 5% n-propyl gallate, 1 pg/mL propidium iodide. Store at 4°C m the dark. Polytene chromosome maps of the Drosophila species of interest (see Note 1)
3. Methods 3.1. Preparation of Polytene Chromosomes Drosophila stocks should be maintained on a medium suitable for the species m use. The best larvae are collected from well yeasted,uncrowded cultures. Select large third instar larvae that are still crawling, and have not everted their anterior spiracles.
Hybridization
to Polytene Chromosomes
185
1 Dissect out the salivary glands in a drop of 0 7% NaCI, and transfer them to a drop of 45% acetic acid. Allow to fix for approx 30 s. 2. Transfer the glands to a drop of 1:2.3 fixative on a clean srliconized covershp Fix for 3 min 3 Pick up the covershp with a clean slide, by touching it to the drop. The slide does not have to be coated or “subbed” before use. 4 Spread the chromosomes by tapping the covershp with a pencil m a circular motion. Check the chromosomes using phase contrast 5. When the chromosomes are suitably spread, fold the slide in blotting paper, and press gently to remove excess fix. Leave the slide at room temperature for 1 h to overnight. This step squashes the chromosomes as the fix evaporates, and the coverslip sinks toward the surface of the slide. Alternatively, the slide can be squashed firmly between blotting paper, and frozen immediately Take care not to allow the coverslip to slide sideways, or the chromosomes ~111 be overstretched. 6 Freeze the slide in liquid nitrogen. While the slide is still frozen, flip off the coverslip with a scalpel blade and proceed to step 7 7. Place the slide in 70% ethanol for 5 min. 8 Transfer the preparation through two 5 min changes of 96% ethanol, and airdry. 9. Mark the region of the slide where the chromosomes are located with a diamond pencil on the reverse side of the slide. This region should be visible when the slide is dry. 10. Store the chromosomes desiccated at room temperature (see Note 4)
3.2. Pretreatment and Denaturation of Chromosomes I will describe two protocols used to denature polytene chromosomes prior to hybridization. The first uses alkali treatment, and the second heat, to denature the chromosomes. The latter is a quicker method, but some probes can give a rather dispersed signal compared with chromosomes prepared using alkali denaturation (see Note 2). 3.2.1. Alkali Denaturation 1. Incubate the slides in 2X SSC at 65°C for 30 min. This step is intended to help preserve the morphology of the chromosomes. 2. Transfer the slides to 2X SSC at room temperature for 10 min. 3. Denature the chromosomes by incubating the slides in 70 mM NaOH for 2 min. The 70 mM NaOH must be freshly made. 4. Rinse the slides m 2X SSC. 5. Dehydrate through ethanol as described m Section 3.1 , steps 7 and 8, above, and air-dry. The slides should be used the same day.
3.2.2. Heat Denaturation 1. Place the slides directly in gently boiling 5 mM Tris-HCl, pH 7.5, for 2 min. 2. Quickly transfer the slides to 70% ethanol, and dehydrate through alcohol as described in Section 3.1 , steps 7 and 8 above.
Saunders
186 3.3. Preparation
of Probes
Probes are most conveniently prepared by the random priming method of Femberg and Vogelstein (45). The DNA can be m the form of intact plasmid, lambda, cosmid, or YAC clones, or a restriction fragment isolated by agarose gel electrophoresis (see Note 5). 1. 2 3 4 5 6.
3.3.1. Preparation of Biotinylated Probes Place 5 pL,oligolabelingbuffer and 1 pL 1 mM brotin-16dUTP in a microcentrifuge tube. Boil 100-500 ng probe DNA m 20 pL distilled water or TE for 3 mm, then add 18 pL to the microcentrifuge tube. Add 1 pL (5 U) Klenow fragment of DNA polymerase I, and incubate the reaction at room temperature for 1 h to overnight. Ethanol precipitate the labeled DNA. Resuspend the DNA in 50 pL sterile distilled water. Add 50 PL 2X hybridization solution to the DNA solution 3.3.2. Preparation
of Fluoresceinated
Probes
The use of fluorescem-1 l-dUTP for direct labeling of DNA probes for in situ hybridization to metaphase chromosomes has been described by Wiegant et al. (6). In situ hybridization to polytene chromosomes can also be carried out using such probes, though with much greater sensitivity than can be achieved with metaphase chromosomes. Probes are labeled as described rn Section 3.3.1.) except that fluorescem-l ldUTP is used as the labeled nucleotide, instead of biotm-16-dUTP. 3.3.3. Synthesis
of Probes from PCR Amplified
DNA
Probes can be made from DNA amplified by the polymerase chain reaction (PCR), using additional PCR cycles m the presence of biotinylated nucleotide. 1 Remove unmcorporated nucleotides from the amplified DNA, for example, by gel electrophoresis. 2 Set up the PCR reaction, as used to amplify the DNA. Substitute 10 p.M biotin16dUTP for the dTTP in the PCR reaction. Five cycles of synthesis are usually sufficient. Increasing the length of the polymerization step to 10 mm is advised, since the concentratton of biotin- 16dUTP is low. 1 2. 3. 4.
3.4. Hybridization Boil the probe for three mm, then quench on ice. Check the volume after boiling, and restore to the irutial volume with sterile distilled water Pipet 20 PL of the probe onto the chromosomes. Cover the chromosomes and probe with a clean siliconized coverslip. There is no need to seal the coverslip. Place the slides in a plastic box lmed with moist tissue to prevent evaporation from the preparation. Seal the lid, and place m a 58°C incubator overnight.
Hybridization
to Polytene
Chromosomes
187
5. Remove the slides from the humid box. Dip them in 2X SSC to allow the coverslip to slide off, then wash them in 2X SSC, 53°C for 1 h. Three changes of wash solution should be made. 3.5. Signal 1. 2 3. 4. 5. 6. 7. 8. 9.
10. 11. 12. 13. 14.
15. 16. 17.
Detection
3.5.1. Signal Detection Using Streptavidin-HRP Take the slides from the final wash, and pass them through two 5 min washes m PBS. Wash the slides for two min in PBS-TX. Rinse in PBS. Do not allow the slides to dry out during signal detection. Make a 1.250 dilution of streptavidin-horseradish peroxidase conjugate in the buffer supplied with the Enzo kit. Alternatively, Extravidin-horseradish peroxidase conjugate (Sigma) can be used, at the same dilution. Apply 50 p.L to the chromosomes and cover with a 22 x 50 mm coverslip. Replace the slides in the humid box, and incubate at 37°C for 30 min Wash off unbound streptavidin conjugate by passing the shdes through the PBS and PBS-TX washes described in steps l-3 above. Drain the slides, but do not allow them to dry. Place 50 l.tL DAB solution onto the chromosomes, and cover with a 22 x 50 mm coverslip. This solution should be made up fresh since hydrogen peroxide decays rapidly. Take care when working with diammobenzidme, as it 1s a potent carcinogen. Follow the guidelines for use and disposal described in Section 2.2.1. above. Incubate at room temperature for lo-15 min in the humid box. Rinse the slides in PBS and examine under phase contrast. The signal appears blackish-brown, sometimes quite refractile in strong cases If the signal seems weak, add more DAB solution, and incubate for longer. If the signal is strong enough, rinse the slide well with distilled water. Stain in Giemsa’s stain for 1 min. Rinse off excess stain in running water for a few seconds, and allow the slides to air-dry. Check that the staining 1ssufficiently intense. Overstained chromosomes can be destained in 10 mM sodium phosphate buffer, pH 6.8, and understained chromosomes can be restained. Mount the preparation under a siliconized covershp with DPX mountmg medium. DPX is a xylene soluble mountant, which does not affect either the Giemsa stain or DAB deposit, and the slides should last for many years. Seal the edges of the coverslip with nail varnish to prevent immersion 011 from seeping under the coverslip Examine the preparations under phase contrast. Some results are shown in Fig 1. Photographic reproduction is best with color film.
3.5.2. Signal Detection Using Avidin-Fluorescein Biotin labeled probes can be detected using avidin-fluorochrome
conjugates.
1. Wash the slides in PBS and PBS-TX, as described m Section 3.5 l., steps 1-3. 2. Make a 1:SO dilution of avtdin-fluorescem in PBS.
Saunders
Fig. 1. In situ hybridization of biotin labeled probe DNA to D. melanogaster polytene chromosomes. The signals have been detected using streptavidin-horseradish peroxidase conjugate, with DAB as the substrate, and the chromosomes are counterstained with Giemsa’s stain. (A) Mapping a cosmid clone, using a 2.8 kb restriction fragment as a probe. The signal is indicated by the arrow, and lies in bands 96A21-25. (B) Mapping a clone relative to a chromosome rearrangement. The probe is a cosmid/phage containing an insert derived from bands 96Bl-10, hybridized to T(Y;3)B197/+ chromosomes. The signal lies on chromosome 3, in bands 96Bl-10, proximal to the breakpoint. (C) Hybridization of PCR amplified DNA derived from microdissection of division l(10). (D) Hybridization of PCR amplified DNA derived from microdissection of subdivision 25A (IO). Scale bar: 20 pm.
Hybridization
to Polytene
189
Chromosomes
3 4. 5. 6.
Pipet 50 l,tL onto the chromosomes and cover wrth a 22 x 50 mm coverslip. Incubate in a dark humid box at room temperature for 30 min. Pass the slide through the PBS and PBS-TX washes as step 1 above. Dram the slide and mount m glycerol mounting medium (Section 2.25.), under a siliconized coverslip. The mountmg medium contains propidtum iodide to stain the chromosomes. 7. Seal the coverslip with nail varnish These preparations do not last as long as those described in Section 3.5.1., but will keep for several weeks at 4°C m the dark, if sealed as described. They are best examined using a microscope with facility for image merging A confocal microscope is ideal.
3.5.3. Signal Detection
Using Fluoresceinated Probes and washing steps are performed as described in Section 3 4.,
1 The hybridization steps l-5. 2 Mount the preparation directly in mounting 3.5.2., steps 5-7.
medtum as descrtbed in Section
See Notes 6-8 for discussions on common problems. 4. Notes 1. Polytene chromosome maps are available for most Drosophila species, and, indeed, most Drpterans wrth useable polytene chromosomes. Sorsa (7) has comprled a list of all maps of drosophilid polytene chromosomes. For Drosophila melanogaster, the 1935 Bridges map (8) and the Lefevre (9) photomap are indtspensrble. These are available from Academic Press, in a folder together with the Bridges’ revised maps 2. One of the most important factors in the quahty of an m situ preparation is the quality of the polytene chromosomes. There are many ways m which polytene chromosomes can be prepared, differing mostly m the manner by which the chromosomes are spread and squashed. Allowmg the coverslip to slip sideways when spreading causes the chromosome arms to stretch Overstretched chromosomes can make analysts of the in situ hybridization difficult. Make sure the slides and coverslips are clean, especially of lint from tissue paper used to clean them, thus only lint-free tissue paper should be used. Poor chromosome morphology can result from denaturmg chromosomes for too long in alkali, and from poorly understood fixation problems. If the chromosome morphology IS repeatedly found to be puffy and swollen, try the alternative denaturatron method of boiling, whtch often preserves the morphology better than alkah denaturation. 3. The two methods of probe labeling described are not the only methods available to the researcher, digoxygenin (Boehringer) labeling can be used, and alternatives to random priming for incorporation of label, such as photobiotin labelmg can be used. When selectmg a detection system for an experiment, several factors must be borne in mind. First, the durability of the specimen is important. Signals visualised with horseradish peroxidase and DAB as described above offer the advantage of long term stability, compared with the fluorescent methods, an important feature when engaged in long range chromosome walking or genome mapping. Second, one should assessthe degree of sensitivity required for a given
Saunders
4.
5
6
7.
8
experiment. For example, the direct fluorescein labeling method, although quicker, does not offer the same degree of sensitivity as do the two-step detection systems. Third, when choosing a method that employs an enzymatic reaction for detection, such as alkaline phosphatase or horseradish peroxidase, care should be taken to select a substrate whose reaction product is stable and insoluble m the mountant in use, and which contrasts well with the chromosome counterstain. Use only slides with good quality chromosomes, those which appear flat and gray, with clear banding. Chromosomes that appear bright and reflective under dry phase examination will have poor morphology, hindering accurate mterpretation. To isolate restriction fragment by agarose gel electrophoresis, the gel used should be cast using low melting point agarose, and the band excised m a mimmum volume of gel. Three volumes of sterile distilled water are then added, and the mixture boiled for 7 min before adding it to the labeling reaction Alternatively, the DNA can be extracted from the gel, usmg a variety of other methods. Repetitive DNA. The presence of repetitive DNA within a cloned segment of DNA can prevent easy determmation of the chromosomal site of origin of the clone. The use of sibling species can resolve this problem. For example, Drosophila simulans and Drosophila mauritiana polytene chromosomes have been used (2) in mapping cosmids containing cloned segments of D. melanogaster DNA. This is possible because the sibling species have different amounts of repetitive DNA, and different populations of transposable elements Lack of signal. If no signal is seen when using a biotinylated probe, test it by filter hybridization. A systemic problem where no signals are obtained with a variety of probes may indicate that the DAB solution has decayed. Generally this can be rectified by using fresh hydrogen peroxide. Stocks of hydrogen peroxide should be replaced regularly. High background. This is generally associated with poor incorporation of biotinylated nucleotide, and inefficient removal of unincorporated nucleotides prior to hybridization. However, background can be exacerbated by the nature of the salivary gland, for example Rhynchosciara amerzcana salivary gland polytene chromosomes can show high background as a consequence of the large amount of cocoon protein present in the gland
References 1. Pardue, M L., Gerbi, S. A., Eckhardt, R. A , and Gall, J. G (1969) Cytological Iocalization of DNA complementary to ribosomal RNA in polytene chromosomes of Diptera Chromosoma 29,268-290
2 &den-Kiamos, I., Saunders, R. D C., Spanos, L., Majerus, T , Trenear, J., Savakis, C., Louis, C., Glover, D M , Ashburner, M , and Kafatos, F. C. (1990) Towards a physlcal map of the Drosophzlamelanogastergenome. mapping of cosmld clones within defined genomic divisions. Nuclezc Acids Res. l&6261-6270. 3. AJioka, J W., Smoller, D A., Jones, R W , Carulli, J P , Vellek, A. E. C., Garza, D , Link, A. J., Duncan, I., W , and Hartl, D. L (1991) Drosophzla genome project. one-hit coverage in yeast artificial chromosomes. Chromosoma 100,495509. 4 Femberg, A. P. and Vogelstein, B. (1984) Addendum to Femberg and Vogelstein (1983) Analytzcal Biochem
137,266-267
Hybridization
to Polytene
Chromosomes
191
5. Femberg, A P. and Vogelstein, B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytrcal Btochem. 132,6-l 3 6. Wiegant, J., Ried, T., Nederlof, P. M., vanderPloeg,M., Tanke, H. J., andRaap,A. K (1991)In situ hybridizationwith fluoresceinated DNA. NuclercAcids Res. 19,3237-3241 7. Sorsa,V (1988) Chromosome Maps of Drosophllu (2 vols ), CRC, Boca Raton, FL, pp. 149,200. 8. Bridges,C. B (1935)Salrvary Chromosome mapswith a key to the bandingof the chromosomes of Drosophila melanogaster, J. Hered. 26,60-64 9. Lefevre, G. Jr (1976)A photographicrepresentationand interpretationof the polytene chromosomes of Drosophilamelanogaster salivary glands,in The Genetrcs and Biology ofDrosoph&z, vol. la (Ashburner,M. andNovitskt, E , eds.),Academic,New York, pp 31-66. 10. Saunders,R. D. C., Glover, D. M., Ashburner, M., StdCn-Ktamos,I , Louts, C., Monasttriotl, M., Savakis,C., andKafatos,F C (1989)PCRamphficationof DNA microdissectedfrom a smglepolytene chromosomeband: a compartsonwith conventional microcloning Nucleic Acids Res 19, 9027-9037.
CHAPTER 18
In Situ Hybridization to Polytene Chromosomes of Drosophila melanogaster and Other Dipteran Species A Marie Phillips, and Daniel
Jon Martin, G. Bedo
1. Introduction In situ hybridization of nucleotide sequence to Drosophila melanogaster interphase polytene chromosomes is a well established procedure. The method was initially developed using radioactively labeled probes by Pardue, who has recently published an extensive account of Drosophila polytene chromosomes and hybridization to these chromosomes (I). The original method was later adapted to allow the use of the more sensitive and safer nonradioactive labeling methods (2). The method has been used widely for gene mapping and identification of transposable element insertion sites. In situ hybridization to chromosomes has also been performed in cross-species studies within Diptera to give valuable evolutionary information, including conservation of linkage groups, and to identify homologous genes in related species (3-5). In addition, there have been recent advances that extend this technique to salivary gland preparations from stored fixed specimens (6). In this chapter, we describe in detail a method, derived from that of Engels et al. (2), for the in situ hybridization of biotinylated DNA probes to D. melanogaster salivary gland polytene chromosomes (see Fig. l., and Section 3.). This method has been found to be suitable for use at all levels of expertise, from undergraduate teaching to the research laboratory. We have successfully used the outlined procedure for gene mapping (7,8), orientation of chromosomal walks (9), location of transposable elements (IO), and investigations of structural abnormahties in mutant flies (11). The probes used include single locus probes of 400 bp to 14 kb and repeat sequence probes including RNA genes. In situ hybridization has been valuable during gene cloning in the identification of chimeric clones. This may be particularly advantageous where yeast artificial chromosome (YAC) libraries containing a high proportion of chimeric clones, must be screened. The method is reliable but we will discuss From Methods ~1 Molecular Biology, Vol 33 In 611~ Hybndmarron Protocols Edlted by K H A Choo Copynght Q 1994 Humana Press Inc., Totowa, NJ
193
Phillips,
194
I
Establish
Martin,
and Bedo
Fly Cultures 5 day
7 Remove Adults (add yeast paste) 2-4 day v Make Polytene Chromosome Spreads
24-48
h
24-48
h
A4-48
h
d Prepare Blotlnylated Probes
w
Fig 1, Flow diagram of method
potential problems and how they may be avoided. Considerable information IS given on the preparation of good chromosome spreads as the success of the experiment is largely dependent on this step. As there are other Dipteran species that are less well characterized genetltally but are of scientific interest and/or great Importance as pest species, in Section 4.1.) we have also presented information on in situ hybridization to polytene chromosomes from Chironomus, Lucilia cuprina, Chrysomya bezziana, and Ceritatis capitata. 2. Materials 2.1. Chromosome Spreads 1. Microscope slides: Thesemust be of good quality. Check under phase contrast for microscopicchips in the glassthatcan makeanalysisof dataandphotography difficult when phase optics are used. Clean slides are essential. A convement and safe cleaning method is to soak racks of slides overnight in a 5% solution of Decon 90 or similar laboratory cleaning agent. This is followed by a 1 h rinse in running tap water. To ensure that there IS good circulation between the slides
Hybridization
2.
3.
4. 5. 6. 7. 8. 9. 10.
11. 12. 13.
of Dipteran
Species
195
during rinsing, the rack is suspended above the bottom of the container The slides are then rinsed twice, 5 mm each, in distilled water and au dried m a dust-free environment. The cleaned slides are then coated in Denhardt’s solution ([12] 1% polyvinylpyrrolidone [Eastman Kodak, Rochester, NY], 1% ficoll, 1% bovine serum albumin-nuclease free [Sigma, St. Louis, MO, A79061) diluted 1 m 50 with 3X SSC (see Section 2.1.14.). Incubate the slides in this solution at 65°C for 2.5 h, rinse briefly in distilled water at room temperature and fix in acetic acid. ethanol (3 vol glacial acetic acid: 1 vol ethanol) for 30 min The shdes can then be air-dried in a dust-free environment (a laminar flow cabinet is useful, if available) and stored in a closed container at 4°C until required. Alternatively, chromic acid can be used to clean the slides As chromic acid is very corrosive care must be taken to protect skin and clothing from exposure and eye protection (safety glasses or head shield) is essential. Gelatm/chrom alum can be used to coat slides (1) Coverslips: 22 x 22 mm glass coverslips. These should be sihcomzed by dipping in a commercial compound, e.g., Sihclad (Sigma). We dip 100 coverslips at a time using a slotted perspex grid. The coverslips are immersed brrefly in the siliconizing solution, then allowed to air-dry. Immediately before use wipe the coverslips with ethanol using a lint-free tissue. Larvae: Wandering third instar larvae are obtained from well yeasted stocks established at low density (12 females, 6 males per 250 mL cream bottle) on a sugar/semolma food. We maintam these stocks at 22’C with a 12 h light/dark cycle. Five days after establishing the cross the adult flies are removed and a teaspoon of thick yeast paste is added to the bottle. Moistening the food with water after 7 d will induce the larvae to seek sites for pupation on the sides of the bottle, and increases their ease of capture (see Note 4.2 1 ). Dissecting needles and fine forceps. 150-mm Diameter plastic Petri dish with lid. Small soft paint brush. Paper tissues, lint-free lens type. Dissecting medium: The larvae are dissected in a 1:5 dilution m water of the fixing solution (see below). Tap water or Ringers solution can also be used as dissecting medmm. 1:2:3 fixing solution: 1 part lactic acid, 2 parts water, 3 parts glacial acetic acid. One kilogram brass weights for flattening chromosome spreads. There are many other different methods that can be used to apply constant even vertical pressure to the preparations. Included in these are the use of “C” clamps, or of glass/metal plates weighted to give the desired pressure The chromosome squashes must be flat, well adhered to the slide, and ribbonlike under phase contrast for optimal results. The werghtmg added should be determined empirically. Liquid nitrogen in a wide-necked flask or dry ice in the form of a flat block is used as a freezing agent. 6X Coplin jars, plastic slide mailers, or other containers suitable for submerging slides, while keepmg them apart If more than five slides are to be prepared at a time, use a slide tank. Ethanol (reagent grade): Keep 100 mL of ethanol at -2O’C!, and 100 mL at 4’C, in addition to a supply at room temperature.
196
Phillips,
Martin,
and Bedo
14. 20X SSC stock: 3M NaCl, 300 mM Na citrate, pH 7.4. Dilute to 2X SSC as reqmred. 15. IM Sodmm hydroxrde: Prepare freshly.
2.2. Probes and Hybridization 1. 2 3 4 5 6 7.
8. 9 10. 11 12. 13. 14 15. 16.
DNA. 400-500ng of the probe DNA to be hybridrzed Commercial nick-translation kit (BRL, Gaithersburg, MD). Biotm-1 1 dUTP (Sigma) 3M Sodium acetate, pH 4.8. Absolute ethanol (analytical grade) 10% Sodium dodecyl sulfate (SDS) solution in water 20 mg/mL salmon/herring sperm DNA in sterile water. Shear the DNA by sonication at 20 microns peak to peak, in 30 s bursts with 30 s rests on ice, until solution is nonviscous Alternatively, shear DNA by repeatedly passing the solution through an 18-gage syringe needle until no longer VISCOUS. Plastic coverslips, 22 x 22 mm. 50% Dextran sulfate solutron m water Formamide (analytical grade). Detonize the formamide prior to use by adding mixed bed resin beads, and stirring for 30 mm. Filter before use. Rubber cement for sealing coverslip to slide, e g., Earth Rubber Cement, Marum, Japan, or other transparent rubber cement. Not all rubber cements are suitable so test before use Carrier mix: To make 500 pL, mix 150 FL of 50% dextran sulfate (warm to reduce vlsconty, and aliquot using a sterile disposable plastic tip cut to increase the bore size), 250 PL of 20X SSC, and 100 pL of 20 mg/mL sheared salmon sperm DNA. Microliter plpets (Gllson, Pans, France) 20 pL, 200 pL, and 1000 PL. 1.5-mL Microfuge tubes, sterilized by autoclavmg Plastic tips for the mrcroplpets, sterilized by autoclavmg. TE buffer: 10 mM Tns-HCl, 1 mM EDTA, pH 8.0
2.3. Staining 1. Commercially available staining kit using conjugated alkaline phosphatasestreptavadin (BRL Blue Gene krt). 2 Buffers. These are as specified in the notes accompanymg the staining kit. Buffer 1: 150 n-&f NaCl, 100 mA4 Trts HCl, pH 7 5. This is the same as a 1.10 dilution of the neutralizing solution used m preparing gels for Southern blotting. Buffer 2: 2% Solution of nuclease free bovine serum albumin (BSA) m buffer 1 Prepare this buffer on the day rt 1sto be used Buffer 3. 100 mMTns-HCl, pH 9.5, 100 mMNaC1, 10 mMMgC1, This buffer can be made well in advance, and stored at 4’C
3.1. Preparing
3. Methods the Chromosome
Spreads
1 Wipe siliconized coverslips free of dust with lint-free tissues and arrange about six coverslips m a single layer on the bottom of a large plastic Petri dish Cover to keep them dust-free.
Hybridization
of Dipteran
Species
197
2 Dissect salivary glands from third instar larvae (see Note 4.2 1.) m a small drop of a 1.5 dilution of fixative (dissecting solution) in water on a clean noncoated shde on a dark background. Visualize the dissectton using a bmocular microscope 3. Clean the slide of all nonsalivary gland material and check the size of the dissected glands. Discard all except large glands with clearly visible polytene cells. 4. Remove any fat adhering to the glands usmg the point of a syringe needle as a knife. A dissecting needle can be used if a syringe needle is not available It is important not to rupture the glands while cleaning. Keep the glands well moistened with dissecting solution until transfer. 5 Transfer one gland from each pair to a 10 pL drop of 1:2.3 fixative on a silicomzed coverslip 6. Check, using the dtssecting microscope, that no nonglandular material has been transferred and remove any contaminating material 7 Leave the gland to fix for 2-3 min 8 Pick up the coverslip using a dust-free Denhardts’ treated shde. Position the coverslip on the lower half of the slide but with several millimeters of uncovered slide left at the bottom to allow adequate room for sealing later. 9. Using the blunt end of dissecting forceps, “write” gently across the coverslip to disperse the tissue and break open the nuclei (the word “write” gives an indication of the pressure that should be applied). 10 View the preparation under phase contrast with magnification x40. 11 If the chromosome arms are well spread, press to flatten, using even vertical thumb pressure or pressure applied using a “C” clamp. 12 If the preparation is not well spread repeat the “writmg” and/or move the coverslip 1 mm sideways, and up and down 13 When the spread of chromosome arms is satisfactory, flatten the chromosomes until they are almost transparent and ribbonlike, that is, well-adhered to the coated slide (see Note 4 2 2 ). Place under weights for approx 15 min, then store flat at 4°C until all slides have been prepared. The slides may be stored at 4°C overnight, and this is our normal practice. The slides are stored uncovered on a flat surface. It has been suggested that further flattening occurs during this period as the fixative evaporates (2). 14. Remove the coverslips by dipping the slides into hquid nitrogen until boiling of the Nz stops. 15. Hold m the air and allow to warm until clouded with condensation (a few seconds) 16. Lift one corner of the covershp and fhp it off using a razor blade or scapel blade The coverslip comes off Intact and there is no loss of the chromosomes. 17. Plunge the slides into a Coplin Jar of cold ethanol (-20”(Z), and allow to come to room temperature. 18. Air-dry m a dust-free environment. 19. If treatmg slides in batches, place the slides into -20°C ethanol for 15 mm, 4’C ethanol for 15 mm, and then in room temperature ethanol for 15 mm The slides can then be air dried Dried slides can be kept, at 4°C in a slide storage box with dessicant, for weeks before use, however, we routinely progress to the next stage within 1 wk. 20 Heat one slide tank containing 2X SSC, two slide tanks containing 70% ethanol, and one containing 95% ethanol to 65”C, in a water bath.
198
Phillips,
Martin,
and Bedo
21. Leave all four tanks m the water bath at 65”C, and incubate the slides m the 2X SSC tank for 30 min 22. Remove all four tanks to the bench (room temperature), and rinse the slides m one 70% ethanol tank. 23. Transfer the slides to the second 70% ethanol tank and let stand 20 min. 24. Place the slides m 95% ethanol tank for 10 min 25. Remove and allow the slides to au-dry The chromosome preparations can now be stored, dry, m a slide box at 4°C for months Slides can also be stored long term in 100% propanol-2.
3.2. Preparing the Biotinylated Probe Biotinylated probes are routinely made using a commercial nick-translation kit with biotin-11dUTP (or other label of choice; see Note 4.2.3.) replacmg the radioactively labeled nucleotide. All buffers, microfuge tubes, and prpet tips should be sterilized by autoclavmg. It 1s essential to wear gloves for steps involvmg the use of formamrde and dimethylformamide. 1. Nick-translate 1 pg DNA from a genomlc clone (including lambda arms), or 500 ng of the purified insert DNA m a microfuge tube in a 50 pL reaction contammg 5 pL of dATP, dCTP, dGTP nucleotide mix, 2.5 p.L of btotm-1 1dUTP (4 mM), and 5 l.tL of enzyme The reaction is carried out for 90 min at 14°C. Stop with 5 l.tL stop buffer (in kit) 2 Add 0.75 pL of 10% SDS, 3M sodmm acetate, pH 5.2, to 0.3M in final reaction volume, 1 p.L sheared salmon sperm DNA, and 2 vol of cold absolute ethanol 3 Precipitate the probe at -70°C 15 mm or longer 4 Spin the mlcrofuge tube at lO,OOOg, for 15 min to pellet the DNA 5. Wash the pellet with 70% ethanol. 6. Dry the DNA. 7 Resuspendm 20 pL TE buffer. 8 Repreclpitate the DNA with sodium acetate and ethanol, and repeat steps3-7. 9 Store the probe at 4°C We have successfullyusedprobesstoredfor more than 2 yr
3.3. Prehybridization Carry out all dipping and washing steps in Coplin jars or slide tanks. 1 Denature the DNA in situ by dipping the slides in 0 07M NaOH (made from a freshly prepared 1M NaOH stock) for 2 min The time should be accurately measured Two minutes is usually optimal for Drosophila melanogaster chromosomesprobed with DNA from this species (a series of time points between 1 75-2 5 min can be tested), but a longer denaturation time is necessaryfor crossspeciesstudies(3) 2. Immediately rinse the slidestwice m 2X SSC, 5 min each rinse. 3. Dehydrate the spreadsby tmmersmgm 70% ethanol twice for 5 mm, then in 95% ethanol for 5 min 4 Air-dry the slides in a dust-free environment. 5 Check the slidesby viewing under phasecontrast (x40) and mark the sidesof the slide with a pencil to indicate the position of the chromosomes
Hybridization 1
2.
3. 4. 5. 6.
7 8. 9. 1 2 3. 4 5. 6 7. 8. 9. 10.
of Dipteran
Spectes
199
3.4. Hybridization Freshly prepare a hybridization mixture of 270 pL of deionized formamide and 258 PL of carrier mix (Section 2.2.12 ) The carrier mix may have to be warmed for accurate pipetmg, and to ensure a homogeneous mixture with the formamide. Place 26.4 ltL of hybridizatton mixture and 3.6 j,tL of btotinylated probe m a microfuge tube. Mix by pipeting. This is enough probe solution for 4-5 shdes. The formamide concentration in the probe solution is 45%. Smaller volumes of probe solution can be made providing that aliquots can be measured with sufficient accuracy to ensure that the formamide concentration is not significantly changed. Lower formamide concentrations are used for cross-species studies (see Note 4.1.) Denature the probe by heating to 80°C for 10 min. Immediately place the tube on ice, cool, and touch spm m a microcentrifuge to bring down condensation The probe should be kept ice-cold until used to prevent reannealing. Place clean plastic coverslips on a flat surface, and pipet 6 pL of the denatured probe onto the center of each coverslip. Lower the region of the shde containing the denatured chromosomes (as indicated by the pencil markings) on to the coverslip. It is important to avoid introducing air bubbles. Ensure that sufficient room is left around the coverslrp to enable adequate sealing. The probe solution should spread to completely cover the area beneath the coverslip If necessary apply a little gentle vertical pressure Turn the slide over so that the coverslip is now facing upward, and seal the edges of the covershp with rubber cement. Place the slides in a box, or other flat container, and hybridize overnight at 37°C. 3.5. Posthybridization Place two Coplm Jars or slide tanks contammg 2X SSC at 37°C. Set another waterbath at 60°C Take the hybridized slides from the container and peel off the rubber cement by holding one corner with fine forceps and lifting. The rubber cement and the coverslip should come off together. Rub off any remaining cement, being careful not to touch the chromosomes. Place the slides m one slide tank of 2X SSC at 37°C for 10 mm. Transfer to the second tank for a further 10 min Wash the slides twice in 2X SSC at room temperature Briefly rinse the slides in buffer 1. Transfer the slides to buffer 2, and incubate at 60°C for 1 h. Rinse the slides briefly in buffer 2 at room temperature.
3.6. Staining the Biotin ProbelChromosomad DNA Hybrid This is an adaptation of the BRL Blue-Gene Kit method used for staining biotin labeled probes applied to Southern DNA blots
Phillips,
200
Martin,
and Redo
1 Place the slides on a flat surface 2 Dilute the commercial stock of streptavadin-alkaline phosphate (sv-ap) solution 1: 1000 in buffer 1 (1 pL in 1 mL) 3 Pipet this solution over the hybridized chromosomes on the slide, using approx *< 100 pL/slide. After 10 mm, add an additional 100 pL sv-ap solution The chromosomes should be exposed to the conjugate for 15-20 mm. 4. Wash the slides twice in buffer 1, for 15 min each wash. 5 Wash the slide in buffer 3 for 15 mm. 6 During the buffer 3 wash make up a staining mix of 4 4 pL NBT, and 3 3 p.L BCIP (in kit) m 1 mL buffer 3. 7. Clean a plastic covershp for each hybridized slide. 8 Place 50 pL of fresh NBT/BCIP dye mix on each plastic coverslip. 9. Pick up each coverslip with a slide, using the pencil marks to ensure that the dye mix covers the chromosome spreads. Do not seal 10. Place the slides in a tightly closed box in the dark for at least 2 h (2-4 h is usually sufficient for complete staining) 11. Monitor the starnmg by viewing the chromosomes under phase contrast optics. 12 When a blue band is clearly vrsrble, stop the reaction by rinsing the slide with water 13 Allow the slides to dry 3.7. Visualization The stained dry slides ~111 store for at least a year if kept m a slide storage box at room temperature. Care must be taken to exclude dust and to prevent scratching. It 1s wise to obtain a permanent photographic record as soon as possible and we routinely photograph slides within 24 h of staining. To visualize the stained band, place a drop of water on the slide and add a clean glass coverslip. View under phase contrast. A clear signal should be visible at the same chromosomal locatton/(s) m all labeled cells (see Note 4.2.5.) In our experience the chromosome banding pattern is clearly distmgmshable m most cells and the chromosomes can be photographed under phase contrast without Giemsa or Orcein staining. Indeed, d the staining of the hybrid band is relatively light, more mauve than blue, then staining the chromosomes can make the hybrid band mdistingutshable from the background. If you wish to stain the chromosomes it is important to understam rather than overstain. If the nonhybrid bands are dark the hybrid band can be distinguished readily by switching from phase to light optics without moving the microscope stage. Where Nomarski optics are available the hybrid band can be readily distinguished from the background and we fmd that photographing the preparations under both phase and Nomarski optics gives excellent results (8) (Fig. 2).
Hybridization
of Dipteran
201
Species
Fig. 2. A cDNA sequence for a single copy gene is labeled with biotin by nick-translation and is shown hybridized (arrow) to a polytene chromosome from Drosophila melanogaster salivary gland.Phasecontrastoptics(X40) areusedto visualisethe stainedbiotin probe/chromosomalDNA hybrid (larger photograph).The bandson the chromosomeare clear and the chromosome is identified aschromosome 2 by comparisonwith publishedphotographicmaps, with the probehybridizing to band46A. In the inset,the samechromosomehasbeenphotographedusingNomarskioptics, and illustratesthe usefulnessof this methodof chromosome visualizationfor distinguishingthe hybrid signalfrom a backgroundof dark bands.
4. Notes 4.1. In Situ Hybridization to Other and to Stored, Fixed Samples
Diptera
4.1.1. In Situ Hybridization to Polytene Chromosomes From Fresh and Stored Fixed Samples of Chironomus The basic technique outlined for preparing Drosophila chromosomes can be used for salivary gland chromosomes of Chironomus but problems may be encountered with the large amounts of salivary secretion in the glands of the late fourth instar larvae required for in situ hybridization. This secretion can cover the chromosomes in a squash preparation and prevent binding of the probe or the chemicals of the staining reaction. Therefore it is preferable to use a preparative technique that reduces the secretion, or to use glands from prefixed larvae in which the hardened salivary secretion can be easily separated from the cells. These procedures are described below.
Phillips,
202 4.1.1.1.
REDUCTION OF
Martin,
and Bedo
SALIVARYSECRETION IN LMNG LARVAE
This can be achieved by pretreatment with Pilocarpme (modified from Kato et al. [131) (0.04% pilocarpinium chloride [Merck, Darmstadt, Germany] made up m Walter’s solution: 5 mg NaHCOs, 35 mg NaCl, 27 mg CaCl,, 2 mg KH2P04, 30 mg MgS04, 10 mL 1% FeCls solution, make up to 1 L in distilled water [Z41). For Australian species it has been found necessary to use 0.08% pilocarpme made up m 1X Martin’s solution (15), as these species appear relatively more refractive to the effects of pilocarpine than do European or North American species. Larvae may be left at room temperature for about 3-5 h or at 4°C overnight. Following this pretreatment salivary chromosome squashesmay be prepared using the same technique outlined for Drosophila larvae. 4.1.1.2. USE OF PREFIXED CHROMOSOMES It has been standard practice in our laboratory to place larvae that were not required for immediate cytological analysis into modified Carnoy fixative (3 parts absolute ethanol: 1 part glacial acetic acid) for storage at -2OOC.We have not found it necessary to open the thorax of these larvae, since the fixative readily enters through the larval cuticle. The fixative should be replaced after 24 h and, although it may be advisable to replace it again following prolonged storage, this does not appear to be essential. Larvae stored m this way for over 15 yr have been found to produce good in situ hybridization of both multiple (6) and single-copy probe DNA (Fig. 3). When chromosomes are required, the larvae are transferred to a drop of 45% acetic acid on a slide, slit along the dorsal thorax and the sahvary glands lifted out. Next, move the glands to a fresh drop of 45% acettc acid and leave there for about 2 min, while a freshly siliconized coverglass is prepared. Place a drop of 1:2:3 fixing solution (see Section 2.1.9.) on the coverglass and transfer the glands mto this drop. Using fine needles, tease the cells away from the salivary secretion and remove the mass of secretion. Squash the cells as for Drosophila material. It is recommended that the chromosomes be photographed before in mu hybridization, as these prefixed chromosomes tend to be more subject to loss of band resolution (Fig. 3a) than do fresh chromosomes. Using the modification of the Engels et al. technique suggested by Whiting et al. (4), it is possible to use probes on different species and different genera (Fig. 3). The extent to which a signal can be obtained on chromosomes from different genera will, of course, be dependent on the degree to which the probe is conserved and the phylogenetic separation of the taxa. We routmely use a formamide concentration of 42% to facilitate hybridization of heterologous probes.
Hybridization
of Dipteran
Species
203
Fig. 3. In situ hybridization of a single copy probe (pSF#13) from a hemolymph protein of North American Chironomus tentans to prefixed polytene chromosomes of the Australian species: (A) Chironomus nepeanensis, and (B) Kiefferulus intertinctus. Arrows point to hybridization signals. The probe is biotin-labeled by nick-translation, and stained with alkaline phosphatase. In A the chromosomes have been counter-stained with 1% giemsa and photographed using a yellow filter, whereas in B the chromosomes are unstained and have been photographed under phase contrast. Chironomus and Kiefferulus are closely related, sistergenera. It should be noted that the terminal location of the gene in both genera may be fortuitous, since pSF#13 binds to an interstitial location in at least seven other Chironomus species examined (Martin, unpublished data).
4.1.2. In Situ Hybridization to Polytene Chromosomes From Trichogen Cells of Calliphoridae and Tephritidae These notes apply to in situ hybridization of trichogen polytene chromosomes of the Australian sheep blowfly Lucilia cuprina, the Old World screw-worm, Chrysomya bezziunu, and the Mediterranean fruit fly, Cerutitis cupitutu. In these species, trichogen cells contain excellent quality polytene chromosomes. Salivary gland chromosomes are unsuited to cytological study in L. cuprinu and C. bezziunu, because of their poor banding and fragmented morphology. In C. cupitutu the salivary glands yield good polytene chromo-
Phillips,
Martin,
and Bedo
somes (16), which have been recently used for in situ studies (I 7). The method described is for the study of euchromatic portions of the karyotype in polytene chromosomes, but the same in situ methodology can be used to analyze heterochromatin m mitotic chromosomes. When compared to Drosophila melanogaster salivary glands, trichogen preparations yield very few usable cells. In L. cuprina and C. bezzlana, where trichogen cells from the posterior scutellar margin are used, a good preparation will have g-10 large cells with optimal chromosomes. Ceratltis capitata has only two large trichogen cells beneath the spatulate orbital bristles of male pupae (18). Working with this material therefore requires extra care and patience. The method outlined uses trttmm-labeled, nick-translated DNA, or RNA probes, and has been successfully used m the detection of repeated sequences (19), ribosomal genes (20) (Fig. 4), and single copy genes (21). Nonradioactive probes have proved more difficult to apply to trichogen polytene chromosomes but good results were obtained using salivary gland chromosomes of C. capitata (17). The genome structure of L. cuprina makes it essential that probes are checked prior to use for possible contaminating dispersed repeated sequences.This can be carried out using Southern blots of whole genomic DNA (see Note 4.2.6.). 4.1.2.1.
PREPARATION OF CHROMOSOME SPREADS
Methods for dissecting the posterior scutellar margin of L. cuprina and C. bezziana pupae and preparing the slides are as previously published (22). At the optimal stage (6 d) pupae are fully formed with orange eyes and unpigmented or faintly pigmented bristles. After removal of the puparium, the pupae are kept in a freshly prepared fixing solution 3:l ethanol/acetic acid solution, overnight at 5°C. The fixed pupae are placed in alcohol and the posterior scutellar margin is dissected as a U-shaped piece into which the large bristles insert. Transfer the tissue mto a drop of 45% acetic acid on a clean microscope slide and separate the cuticle from the tissue containmg the trichogen cells. Discard the cuticle. Macerate the remaining tissue with dissecting needles and, if the polytene cells are visible, remove as much unwanted tissue as possible. Cover the tissue with a sihcomzed coverslip and apply gentle pressure with a dissecting needle to spread the chromosomes. Monitor chromosome spreading using a phase contrast microscope. When further spreading cannot be achieved place blotting paper over the slide and apply gentle vertical pressure to flatten the chromosomes. The coverslip must not move laterally during flattening. The procedure for preparation of orbital bristle cells in C. capitata has also been outlmed (I 7). Remove the puparium from 5-6 d male pupae (recognized from the large spatulate orbital bristles) and detach the heads. Fix the heads m freshly prepared 3:l ethanol/acetic acid solutton overnight at 5°C. Dissect a
Hybridization
of Dipteran
Species
205
Fig. 4. In situ hybridization of a 3H-labeledribosomalprobeto anucleolarfragment(arrow) adjacentto an unlabeledautosome.The nucleolarfragmentis connectedto the autosomeby ectopic pairing(shownasa weakly labeledthread).The chromosome is part of a trichogencell preparationfrom Luciliu cuprinu. The bandingon the autosomeis quite well preservedand of sufficient clarity to allow the bandto be identifiedwhenrelatedto the standardpolytenechromosomemap.
segment of cuticle containing the orbital bristles from the dorsal third of the head including a narrow margin of eye tissue. Remove internal tissues from the segment so that a layer of fat remains next to the cuticle. Transfer the segment to a drop of 45% acetic acid on a clean slide then separate and discard the cuticle. Apply a siliconized coverslip. Spread and flatten the chromosomes as above, while monitoring the process with phase optics. The low number of suitable cells present means that loss of material during preparation of the chromosome spreads is a common cause of experimental failure. To minimise cell loss all slides used must be thoroughly cleaned (see Section 2.1.1.), and coverslips should be freshly siliconized (old coatings tend to increase the risk of tissue tearing). For best results the polytene cells should be separated from as much surrounding tissue as possible, and cellular debris should be reduced to a minimum. In favorable material the polytene cells can be seen during dissection as translucent spheres. The dissection must be done on a dark background and with bright incident illumination. Individual cells can then be isolated using a finely drawn out glass needle and transferred to a new slide (23). Chromosomes should be well-flattened, and no birefringence should be seen when the spreads are examined under phase contrast.
Phillips,
206
Martin,
and Bedo
4.1.2.2. IN SITU HYBRIDIZATION
The most important difference between the method outlined below, which IS based on that of Board and Webb (24), and the method described above for Drosophila is the denaturation step. Heat denaturatton tn the presence of 70% formamide 1s the preferred method for trichogen polytene chromosomes. This preserves the banding morphology while allowing good levels of hybridization. This protocol can be used with both radioacttve and nonradtoactive probes. 1. Pretreat the slides in 2X SSC at 65°C for 1 h. Wash three times with tap water and once with distilled water Dehydrate the slides through a 50, 75, 95, and 100% ethanol series (5 min at each concentration) Air-dry the slides 2. Photograph the chromosomes under phase contrast. 3. Denature the chromosomal DNA. Pour 70% formamide/2X SSC at 73’C into a preheated Coplin jar contammg the slides. Incubate for 3 mm, shaking the slides intermittently Immediately transfer the slides to 70% ethanol at 0°C leave for 3 mm with shaking. Dehydrate the slides through a 75,95, and 100% alcohol series and an-dry. 4 Prepare the probe m a hybridizatton mix contammg 40% deionized formamide, 10% dextran sulfate, 3X SSC, 0.3 ng/mL probe DNA and 3 pg/mL carrier DNA. 5 Denature the probe by incubating at 70°C for 15 mm and cool quickly on ice Apply 12 pL of probe mix per slide if using 22 x 22 mm coverslips, or 24 p.L for 22 x 50 mm coverslips. Gently lower a coverslip onto the slide to obtain even spreading of the probe with a minimum of au bubbles Seal the coverslip to the slide with rubber cement. 6 Incubate the slides overnight at 37°C m a moist chamber (made by placing a tissue moistened with 3X SSC into a box with a tight fitting lid, or into a large Petri dish) 7. Peel off the rubber cement and rinse off the coverslips in 50% formamide. Wash the slides (with shaking) three times in 50% formamide/2X SSC at 40°C for 5 min each wash Wash five times in 2X SSC at 40°C for 5 min each wash. Hold the slides in 2X SSC at room temperature. 8 Make a solution of 50 pg/mL RNase m 2X SSC. Apply 22 pL per slide and add a large coverslip. Incubate the slides for 2 h at 37°C in a moist chamber. Rinse off the coverslips in 2X SSC and wash three times m 2X SSC for 5 mm each wash. Dehydrate and au-dry as above 9 Apply Ilford L4 autoradiographic emulsion, diluted 1: 1 with 2% glycerol, to the slides using standard methods Polytene chromosomes hybridized with repeated sequence probes are well labeled after 11 d exposure, while single-copy probes require about 22 d exposure. 10. Allow the slides to dry thoroughly before applying stain. Stain the slides with 2% Giemsa stain for 5-15 mm. The staining trme varies between slides and the best staining time should be determined emputcally by monitoring the staining process.
4.2. Common
Problems
1 Larval age: If the larvae are at the wrong developmental stage, isolation of good chromosomes is impossible. As larvae approach pupation, resolution of the increasingly fuzzy bands becomes more difficult, disruption of the nuclear membrane may be impossible, and eventually the salivary glands are lost. It is therefore important to ensure that any problems associated with obtaining good
Hybridization
2.
3.
4.
5
of Dipteran
Species
preparations are not a result of larval age. Establish fly cultures on a number of consecutive days and test larvae from each bottle. A bottle with third Instar wandering larvae should yield a good chromosome spread from the majority of larvae sampled Poor chromosome spread: The most common problem among inexperienced workers is failure to obtain flat, well-adhered chromosome spreads. This causes a loss of the chromosomes during processing and/or birefringence (resulting m the chromosomes having a beaded appearance, and in poor band resolution) To prevent this it is necessary to take great care in the original cleaning and coating of slides and to monitor all stages of chromosome preparation with the microscope. If the chromosomes are not clearly banded, well spread, and rrbbon-like (flattened), be ruthless and discard the slide early in the experrment. Different labeling methods: The protocols outlined can be readily modified to suit different labeling methods and problems arismg from the individual experiment. For example, biotin- 16 dUTP can be used instead of biotin- 11 dUTP Biotin labeled dATP and dCTP are now also available, the latter bemg partrcularly useful where short G-C rich sequences are used as probes. Digoxigenin is an alternative nonradioactrve method of labeling. Where fluorescence microscopy is available, fluorescem- and/or rhodamme-labeled antibodies can be used with nonradioactive labels to identify the hybrid. These are partrcularly useful for double labeling experiments (see Note 4 2.4.). Hybridization to a dark chromosomal band with a short probe may be more easily detected with fluorescent labeling Reprobing chromosomes: The chromosomes can be photographed and then reprobed with another probe (II). This is useful when orientating chromosome walks or identifying the nature of chromosomal abnormalnies. Prior to reprobing, the slides are again denatured (for 2 min) and all steps subsequent to denaturation are repeated. There will be some loss of band resolution Failure to obtain a hybridization signal. a. Insufficient denaturation of the chromosomes may result in farlure to obtam hybridization. It is important to use freshly prepared NaOH. A range of denaturation times can be tested. Alternatively, try the formamide denaturation method described rn Note 4.1.2.2. In cross-species studies, the trme required for adequate denaturation is increased and may lead to considerable loss of band resolution. This problem can be overcome by photographing the spreads before denaturation (4), and this approach should be considered whenever loss of band resolution is a problem. It is necessary to take clear and exact records of the location of each photographed cell. b. Deterioration of reagents: The alkalme phosphatase may become mactrve The problem occurs when the enzyme used is not conjugated to the streptavidin. Conjugated streptavidm-alkalme phosphatase IS commercially available and in our hands is stable for more than a year when stored at 4°C. The BCIP can degrade if improperly stored with consequent failure of the staining reaction. BCIP can give a positive result on mtrocellulose when tested, but be unsuitable for staining chromosome preparations, and probes that hybridize well to nitrocellulose do not necessarily hybridize to chromosomes As biotinylated probes are stable for long periods, probing slides with previously used probes is a useful positive control for the hybridization and staining processes
Phillips,
Martin,
and Bedo
c. Weak probes: In the method outlmed, the probe is separated from unincorporated label by ethanol precipttation Many laboratortes use nick-translated probes without any purification. Chromatography should not be used to isolate the DNA from other reactants as it results in substantial loss of probe As mentioned m b above, a prevtously used probe can act as a control If it is known that the control and experimental probes will not hybridize to the same locus, both probes can be applied to the same shde. This allows the identtfication of failure of the nick-translation procedure, or loss of probe DNA If control experiments suggest that failure to see a signal is owing to a probe fault it is often useful to concentrate the probe by ethanol precipitation and to rescreen The sensmvity can also be increased by lowermg the hybridization strmgency, for example, by hybrtdtzmg at room temperature. 6. Repeat sequences Cloned genomic DNA that is to be used for mapping should be hybridized to Southern blots of whole genome DNA prior to use on chromosomes to determine if the clone contams repeat sequence or transposable elements. It may be necessary to subclone unique restriction fragments prior to attempting in situ hybridization.
References 1 Pardue,M. L (1986)In sttu hybrtdtzatton to DNA of chromosomes andnuclei,m Drosophtlu A Practical Approach (Roberts,D B , ed ), IRL, Washington,DC , pp 11l-l 37 2. Engels,W. R , Preston,C. R., Thompson,P., andEggleston,W B (1985)In sttu hybridization to Drosophtlu sahvarychromosomes with biotmylatedDNA probesandalkalme phosphatase. Focus 8,6-8 3. Whiting, J. H. Jr, Farmer,J. L., andJeffrey, D. E (1987)Improvedrn sm hyrbrtdrzatron anddetectionof blotm-labelledD melunoguster DNA probeshybridizedto D. vtrrlts sahvary glandchromosomes. Dros Info. Serv 66, 170,171 4 Whiting, J H. Jr, Pliley, M .D , Farmer,J. L., and Jeffrey, D E (1989) In sttu hybridization analystsof chromosomal homologiesin Drosophila melunoguster andDrosophtlu virilis. Genetrcs 122,99-l 09. 5. Schmidt, E R , Keyl, H-G , and Hankeln,T (1988) In sttu localizatronof two haemoglobmgeneclustersm the chromosomes of 13 speciesof Chtronomus. Chromosoma 96, 353-3.59.
6 Martin, J. (1990) In sttu hybrtdtzatron to pre-fixed polytene chromosomesTrends Genetics 6,238
7 Delbrtdge,M L andKelly, L E. (1990)Sequenceanalysisandchromosomal localizatton of a geneencodinga cystatm-likeproteinfrom Drosophrla melanoguster. FEBS Lett. 247, 141-145. 8. Philhps,A M., Bull, A , andKelly, L. E. (1992)Identrfrcattonof a Drosophila geneencoding a Calmodulin-bindmgprotein with homologyto the trp phototransductrongene. Neuron 8,63 l-642 9 Morgan, M. M. (1991) The cloning and nutial characterlzattonof the Shrbrregeneof Drosophila melunoguster PhD ThesisThe University of Melbourne 10. Davies,A. G. andBatterham,P. (1991)Analystsof an unstablePelementmserttonmutation at the lozengelocusin Drosophrlu melanoguster Dros. Info Serv. 70,60 11 Petrovtch,T. Z. (1990)Molecular andgenetmstudiesof the Suppressor of Stoned locusm Drosophtla melanogastrer PhD ThesesThe University of Melbourne 12 Denhardt,D T (1966)A membrane-filtertechniquefor the detectionof complementary DNA Btochem Brophys. Res Commun. 23,641-646.
Hybridization
of Dipteran
Species
209
13. Kato, K -L., Perkowska, E , and Sirlm, J L (1963) Electra- and tmmuno-electrophoretic patterns m larval sahvary secretion of Chironomus thummr. .I Htstochem. Cytochem. 11, 485-488.
14 Walter, L. (1973) Syntheseprozesse an den Riesenchromosomen von Glyptotendtpes Chromosoma
41,327-360
15 Martin, J., Kuvangkadilok,C., Peart,D H., andLee, B. T 0 (1980)Multtple sexdetermining regions in a group of related Chironomus species(Diptera. Chrronomidae) Heredtty 44,367-382
16 Zacharopoulou,A. (1990)Polytenechromosome mapsm the Medfly Ceratatts capttata Genome 33,184-197.
17 Zacharopoulou,A , Frrsardi,M., Savakis,C , Robinson,A 8, Tohas,P , Konsolaki,M , Komitopoulo, K , and Kafatos,F. C (1992) The genomeof the Mediterraneanfruit fly Ceratatis caprtata: Localizationof molecularmarkersby m srtu hybridization to salivary glandchromosomes. Chromosoma 101,448-455. 18 Bedo, D. G. (1987) Polytene chromosomemapping m Ceratatts captata (Dtptera Tephrittdae).Genome 29,598-612. 19 Perkins,H D., Bedo,D G., andHowells,A J (1992)Characterrsatron andchromosomal distribution of a tandemly repeatedDNA sequencefrom the sheepblowfly, Lucrlra cuprina. Chromosoma
101,358-364
20. Bedo, D G and Webb, G. C (1990) Locahsattonof the 5.8 RNA genesto arm 2R m polytenechromosomes of Luctlta cuprina (Drptera.Calhphoridae).Genome 33,941-943 21. Bedo, D. G and Howells,A. J (1987) Chromosomallocalization of the white geneof Luciha cuprtna (Diptera’ Calhphorrdae)by m situ hybndtzatron. Genome 29, 72-75 22 Bedo D G (1982) Differential sex chromosome replicationanddosagecompensation m polytenetrichogencellsof Lucdla cuprma (DtpteraCalhphorrdae) Chromosoma 87,21-32. 23 Bedo, D. G. (1992)Nucleolarfragmentationin polytenetrtchogencellsof Lucrlra cuprrna andChrysomya bezztana (Dtptera. Calltphorrdae) Genome 35283-293 24 Board,P. G. andWebb,G. C. (1989) Isolatronof a cDNA cloneandlocahzationof human glutathroneS-transferase-2 genesto chromosome band6~12 Proc Nat1 Acad Scr USA 84,2377-2381
CHAPTER 19
Microsurgical Isolation of Native Polytene Chromosomes of Drosophila melanogaster for In Situ Molecular Observation Ronald
J. Hill
1. Introduction In the 193Os,the discovery of a simple method for the isolation and detailed microscopic observation of the banded structures that lie within the nuclei of salivary gland cells of Drosophila melanogaster was soon followed by the realization that these structures were in fact a highly amplified form of interphase chromosomes (1). The method involved squashing the salivary gland, immersed m 45% acetic acid, between a coverslip and microscope slide. Aqueous acetic acid dissolves the cell and nuclear membranes and generally disperses cellular contents except for the chromosomes that are toughened by “acid fixation,” The acid-squashing procedure has, in general, served as the basis for the isolation of D. melanogaster polytene chromosomes for cytological study since that time. It is ideal for the rapid preparation of salivary gland chromosomes for morphological observation m the light microscope and as targets for in situ hybridization (see, however, Note 1). However, when it comes to studtes that require more than morphological mtegrity at the level of chromomeres (bands) in the light or electron microscope, or that require integrity of higher levels and orders of macromolecular organization, exposure to 45% acetic acid (apparent pH 1.6) can obviously lead to unwanted complications. For example, at such a low pH nucleosomes are disrupted (2), the strands of DNA separate (31, chromosomal proteins are extracted (4-6), and chemical changes can occur in both proteins (7) and DNA (8). Although protein extractron can be countered by crosslmking with aldehydes (9,lO), it may not always be a simple matter to balance two opposmg chemical and physical influences to maintain the m viva protein distribution without, e.g., perturbing equilibrium distributions between nucleoplasm and chromosomes (I I). We have found that aspects of chromosome ultrastructure involving the organization of nascent ribonucleoprotein particles appear to be damaged in acid fixed chromosomes (I2,13). Moreover, it is clearly advantageous to avoid extremes of pH if one wishes to detect biological activity of From EdIted
Methods m Molecular Bfology, Vol 33 In Situ Hybrrdmtron Protoco/s by K H A Choo Copynghl Q 1994 Humana Press Inc , Totowa. NJ
211
212
Hill
native proteins or examine such processes as chromatm decondensatron and gene activatron in vitro. This chapter describes in detail a microsurgical procedure that has been under development for some years (14). It now allows the routme isolation of cytologrcally mappable spreads of D. melunogaster salivary gland polytene chromosomes as native chromatin, in which higher order molecular conformations have not been disrupted by exposure to low pH. Some examples of the use of such native polytene chromosome preparations are given and possible future applications considered.
2. Materials 2.1. Culturing of D. melanogaster Ethanol/acetic acid agar. 400 mL water, 9 g agar, 15 g treacle, 23 mL absolute ethanol, 2 7 mL glacial acetic acid Yeast glucose medrum* 130 g compressed yeast, 100 g glucose, 17 g agar, 30 mL 10% mpagen m ethanol, and 1000 mL water tmted faintly green with food coloring. Fresh yeast paste: Slowly star approx 10 mL water into 30 g of fresh compressed baker’s yeast, and allow to equilibrate at room temperature. The consistency of the paste should be firm enough to not run, but be at the pomt where an additional drop of water noticeably lowers the viscocity. 2.2. Equipment, Tools, and Solutions for Microsurgery Tungsten needles* Prepare these by sealing a 5-cm length of 0 4-mm diameter tungsten wire into a length of 7-mm diameter Pyrex@ glass capillary tubing by briefly melting the glass m an oxygen-natural gas flame. Sharpen the needles by dipping repeatedly into molten sodium nitrite in a nickel crucible until observatron under the dissecting microscope at 16x magnification reveals a fme needleshaped tip, as seen in Fig. 1. Glass needles: Prepare these on a David Kopf needle puller or equivalent from Pyrex@ melting-point capillaries. Affix the needles to pulled out Pyrexcrod “handles” (diameter 5 mm attenuated to 2 mm near the trp) by heating the tip to a red heat in a Bunsen burner, removing it for a few seconds, and then touching it to the needle approx 8 mm from the point to produce the configuration shown in Fig 2 Needles employed for transport of nuclei are prepared in the usual fashion except that their points are subsequently rounded on a mrcroforge or by brief exposure to the proximity of a microflame. “Well-slide” for microsurgery (Fig 3). This is a modiftcatton of a chamber onginally designed by J G. Gall for observation of lampbrush chromosomes, as described m reference (16), and consrsts of a 76 x 25 mm microscope slide through which a central 6- or lo-mm diameter hole has been bored Such slides are cleaned in chromtc acid and stlicomzed lightly. Seal a 22-mm diameter No 1 round covershp, previously cleaned m 95% ethanol, across the central hole on the bottom of the slide with paraffin wax to provide a floor to the well Seal the edge of the coverslip with rubber cement to prevent leakage during washing and long-term
Native Polytene Chromosomes
213
Fig. 1. Sharpened tungsten wire needle set in a Pyrex@glass handle.
Fig. 2. Fine glass needle affixed to attenuated Pyrex@rod for mounting in micromanipulator. storage of chromosome preparations. Heat-seal with the aid of a small flame a border of Parafilm, to the top surface of the slide to prevent spillage of fluid during microdissection. 4. Micromanipulation apparatus (Fig. 4A): Mount two Leitz mechanical micromanipulators on blocks on a vibration resistant table to access a Zeiss inverted microscope with 16,25,40, and 60x phase-contrast objectives, a long working distance condenser as used for examination of tissue-culture flasks, and both 10 and 16x eyepieces. The configuration of needle-holders and needles relative to the well-slide in place on the microscope stage is illustrated in Fig. 4B.
214
Hill
Fig. 3 Obhque view of well-slide modified for dlssection of sahvary gland nuclei. The floor of the well is provided by a round coverslrp attached to the lower surface of the shde with paraffin wax and sealed around the circumference wrth rubber cement (stippling). A Parafrlm
border on the upper surfaceof the shde IS indicated by hatching. See Sectron 2 2 3. for details 5 Medium of Cohen and Gotchel(17) 25 mM Na glycerophosphate, 10 mM KHz P04, 3 miI4 KCl, 10 mM MgC12, 3 mikf CaC12, 160 mM sucrose, pH 6 8 6. Saline D (based on D’Angelo’s saline; ref. 18): 90 mM KCl, 60 mM NaCI, 1 rmV CaC12, 5 nuI4 sodium phosphate, pH 7 0 7 Buffer A (Hewish and Burgoyne; ref. 19): 60 mikf KCl, 15 mM NaCI, 0 15 mA4 spermine, 0 15 mM spermidine, 15 mI14 Tris-HCl, pH 7.4.
3. Methods 3.1. Culturing of D. melanogaster 1 Maintain Oregon R flies in 300 mL well-yeasted cornmeal-agar culture bottles. 2 Transfer, approx one hundred 3 to 4-d-old flies, to fresh bottles on a Monday, and leave there unttl the following Wednesday, when they are transferred to a “minipopulation cage,” consisting of a disposable plastic bottle, whose bottom has been cut off in order to allow attachment of a 6-cm diameter culture dish, half-filled with freshly yeasted ethanol/acetrc actd agar to stimulate egg production. The original fly bottles, at this pomt, contain sufficrent eggs to produce a new population of flies, suitable for continumg the cycle on Monday, 2 wk later. 3. Change the mimcage laying plates twice on Thursday. 4. Transfer the flies into glass bottles contaming yeast-glucose medium on Friday Allow the flies to lay eggs in the dark for 1 h and trp the flies out. 5 Count a total of 100 eggs distributed between four quadrants on the central part of the agar surface, and remove the remainder carefully. 6. Apply a layer of fresh baker’s yeast, approx 6-mm high, around the periphery of the bottle. Avoid covering the eggs. Place the bottle in an incubator at 23 5°C 8. On the following Monday, feed the larvae with a paste of fresh baker’s yeast to build up a layer some 8-mm thick, covermg the agar surface except for four symmetrrcally posrtroned holes, approx 6-mm in diameter. Add the paste to the bottle in three portions at IO-mm intervals to prevent smothering the young larvae. 9. Place the bottles back m the incubator until the following Wednesday. 10. Take the bottles out m a small Styrofoam box containing 100 mL of water to maintain humidity 11. Generally, take larvae that have crawled to near the top of the bottle for mtcrosurgery.
Native Polytene Chromosomes
215
Fig. 4. (A) Overall view of the apparatus for nuclear microsurgery. Left- and right-hand operated Leitz micromanipulators are mounted on a vibration-free table to access the stage of a Zeiss inverted microscope. (B) Close-up view of the configuration of instrument-holders, needles, and well-slide on the stage of the microscope.
3.2. The Microsurgical Procedure 1. Dissect salivary glands out of third instar larvae into the medium of Cohen and Gotchel (see Note 2). 2. Perform subsequent microdissection steps in solutions based on saline D. 3. Place pairs of glands in a drop of 1% TritonX-100 in saline D for 25-30 s. 4. Pass them through three drops of 0.25% TritonX-100 in saline D, and allow to remain in a fourth drop of 0.25% TritonX-100 in saline D for 5-6 min, before transfer into a drop of 0.01% TritonX- 100 in saline D.
216
Hill
Fig. 5. The transport of a nucleus on a blunted glass needle. See Section 2.2.2. for details. Two chromosome sets, isolated by micromanipulation, can be seen in the background. The bar = 50 urn. 5. Tear the distal end of the glands slightly to allow glue in the lumens to leak out. 6. Transfer to a 3+L drop of 0.01% TritonX-100,0.5 mM MgC12, in saline D on the lightly siliconized surface of a well-slide some distance from the well. 7. Employ a sharp tungsten needle freehand to make an incision in the gland, usually approx */s of a gland’s length from the duct to release nuclei. 8. Immediately place a 5 x 5 mm siliconized coverslip over the drop to aid microscopic observation, and the release of nuclei. 9. Gently add another 3 pL of 0.01% TritonX-100, 0.5 mM MgCl*, in saline D under the edge of the coverslip 10. Examine very briefly under the microscope and immediately add 40 pL of 0.05% formaldehyde in saline D, or of buffer A (29). 11. Flood the well and surface of the slide with 0.05% (w/v) formaldehyde in saline D, or with buffer A. 12. Pick up individual nuclei on a glass needle whose tip has been rounded in a microforge as illustrated in Fig. 5, transport on the needle to the well, and transfer to the well floor by gently touching to the coverslip and withdrawal of the needle (see Note 3). 13. Puncture the nuclear envelope with two sharp glass needles whose tips are maintained in close proximity and make an incision in the envelope by drawing the needles apart. 14. Withdraw the chromosome mass through the incision with one needle, while the other serves to hold the incision open (see Note 4). 15. Use both needles to unravel the chromosomes and spread them out in an optical plane immediately above the floor of the well (see Note 5). 16. Light microscopy: After completion of micromanipulation, strip the parafilm border from the slide, draw off excess fluid and cover the well with a coverslip, taking care to avoid trapping a bubble. Invert the slide and examine the prepa-
217
Native Polytene Chromosomes
Fig. 6. Phase-contrast micrograph depicting portion of a native chromosome preparation isolated by microsurgery from a salivary gland at puffing stage 6 of the ecdysone response. Early ecdysone puffs are apparent on chromosome arm 3 L and a general high degree of preservation of the banding pattern may be discerned. The bar = 10 pm. ration under phase contrast on a Zeiss Universal microscope. Phase-contrast micrographs are recorded on Ilford Pan F film. Immunofluorescence is photographed on Ilford HPY or Fujichrome 400 film.
3.3. Applications
of D. melanogaster
of Native Polytene
Preparations Chromosomes
Figure 6 depicts part of a preparation of salivary gland chromosomes isolated as native chromatin by microsurgery. This phase-contrast micrograph of unstained native chromosomes records the proximal region of chromosome arm 3 L bearing two obvious early ecdysone puffs, the base of 3R, and the chromocenter. It can be seen that fine details of the banding pattern are maintained in the isolated chromosomes. Such preparations are suitable for a number of applications including the localization of proteins by immuno-fluorescence in the light microscope and by gold-labeled antibodies at an ultrastructural level in the electron microscope, the examination of molecular conformations in situ, the localization of biological activities of native proteins and possibly the future activation of specific chromosomal loci in vitro. Here we shall illustrate such applications with just two specific examples. 3.4. The Investigation
of DNA
Conformation
In Situ
Pohl and Jovin (20) detected a structural change occurring in a synthetic alternating dG-dC copolymer as the ionic strength is raised. The remarkable
218
Hill
structure of the high-salt form of the polymer, termed Z-DNA, was determined by groups at the Massachusetts Institute of Technology and the California Institute of Technology (21,22). It is a left-handed double helix in contrast with the classical right-handed double-helical form as originally modeled by Watson and Crick in 1953. The pitch of the Z-DNA double helix is 45 8, and the phosphate groups along the backbone trace out a zigzag path m contrast to the smoother contour along the phosphates of B-DNA. Z-DNA is strongly immunogenic, allowing the production of highly specific antibodies (23). However, such antibodies exhibit strong immunofluorescence with classically isolated and fixed chromosomes. These findings initially caused much excitement since they suggested that readily detectable levels of Z-DNA occurred, not just in crystals of synthetic copolymers, but in chromosomes. However, on comparison of the immunofluorescence patterns obtained by different laboratories, paradoxical qualitative dtfferences became apparent. Some investigators found immunofluorescence primarily over bands (24), and others observed that the major fluorescence occurred over mterbands and puffs (23). On treatment of chromosome preparations isolated by microsurgery at neutral pH with Z-DNA antibodies, only low levels of fluorescence, close to background, were observed (Ftg. 7B). However, if such preparations were exposed to the classical acid fixative, 45% acetic acid, for 5 s then immunoreactivity started to appear, primarily over the less condensed mterbands and puffs (Fig. 7C). Exposure to 45% acettc acid for 30 s led to masstve enhancement of immunoreactrvlty, which now followed the mass distribution of the chromosomes, i.e., resided predommantly over bands (Fig. 7D). Clearly, the solvent was having a major effect on the tmmunoreactivlty and this effect occurred first m regions that are most accessible, and subsequently in more highly compacted structures. Experiments suggested that a major driving force for the unwinding of the right-handed double helix and rewinding mto a left-handed double helix derives from the liberation of the free energy of deformation of the DNA associated with its left-handed superhelical path on the surface of nucleosomes (25). Nucleosomes are disrupted on exposure to acid fixatives (2). When the DNA is freed from the constramts imposed by mteractions with the nucleosome core, the molecules extend out and writhing mto a left-handed superhelix transduces into a left-handed twist. It is likely that the underwinding of DNA associated with nucleosome drsruption in classical acid-fixed and denatured chromosome preparations tends to prevent the “snap-back” renaturation of strand-separated regions keeping them available for in situ hybridization. 3.5. Observation of In Situ Protein Distribution The apparent distribution of proteins on polytene chromosomes can be influenced by the method of isolation. Exposure to acid can lead to extraction of proteins, an effect that may be countered by crosslinkmg with formaldehyde or
Native Polytene Chromosomes
Fig. 7. Phase-contrast (A) and Z-DNA antibody-stained fluorescence micrographs (B-D) of the X-chromosome of D. mefunoguster. The chromosome was isolated by the microsurgical procedure described in this chapter. In B it was treated directly by Z-DNA antibodies. In C it was treated with antibody after a 5-s exposure to 45% acetic acid and return to pH 7. In D it was antibody treated after a 30-s exposure to acid. The bar represents 10 pm. Reproduced from Hill and Stollar (25).
glutaraldehyde. Such crosslinking agents may also cause accretion by the chromosomes of components of the nucleoplasm and even the precipitation of nucleoplasmic material. The apparent chromosomal distribution of the protein Dl as a function of the parameters of chromosome preparation was carefully studied by Alfageme et al. (26). These investigators found that the distribution of immunofluorescence produced by antiserum against Dl varied from background to general strong fluorescence depending on the relative exposure of the chromosomes to 50% acetic acid and formaldehyde during isolation. An intermediate distribution was passed through with antibody binding at just a small number of discrete sites. Treatment of native chromosome preparations isolated by microsurgery with Dl antiserum immediately gave the discrete distribution as illustrated by Fig. 8. 4. Notes 1. There have been reports of in situ hybridization to acid squash chromosome preparations that have been treated with RNase but not subjected to a defined “denaturation” step (27,28). Such hybridization appears to correlate with intense transcriptional
activity and may directly reflect differences in DNA underwinding
Fig. 8. Phase-contrast(A) and immunofluorescence pattern (B) induced by antiserum against chromosomal protein Dl. The native chromosome preparation was isolated by microsurgery. The bar = 10 urn. and/or conformation in vivo or simply more open chromatin structure permitting some denaturation by the acid fixatives employed. In situ hybridization to native chromosomes isolated without exposure to low pH fixation could distinguish between these two possibilities. 2. In some instances it is useful to culture isolated glands in Schneider’s medium diluted with a t/s volume of 10% ethanol in water (15) to which 20hydroxyecdysone may be added if it is desired to initiate a puffing response in vitro. 3. The overall distribution of the chromosomes within nuclei isolated from third instar salivary glands is found to vary between the two extremes shown in Fig. 9. These observed chromosomal configurations within nuclei are stage- or physiology-related properties of the glands. It is possible to dissect chromosomal material out of nuclei exhibiting configurations throughout this range. However, complete spreads can most readily be obtained from nuclei exhibiting intermediate distributions, i.e., when the chromosomes are not too tightly bunched together on the one hand or too closely associated with the nuclear envelope on the other. Glands in which the chromosomes are clumped into a tight ball in the center of
Native Polytene Chromosomes
Fig. 9. Nuclei dissected out of third instar D. melunogaster salivary glands. (A) Nucleus containing chromosomes dispersed through the nuclear space. (B) Nucleus in which the chromosomes are condensed into a central mass. Bar = 20 pm. the nucleus can be converted into those with chromosomes more dispersed through the nucleus by simply incubating in Schneider’s medium for 5-15 min. 4. In some glands the chromosomes are found to be too “soft” and fragile for micromanipulation. These almost certainly correspond to glands that do not give good squashes by classical techniques. Usually the same culture will provide glands suitable for microsurgery a few hours later. 5. Once attached to the coverslip in this manner, their configuration is usually quite stable. Alternatively, nuclei or isolated chromosomes may be transferred to the surface of an electron microscope grid for examination of nuclear envelopes or chromosomes, respectively.
Acknowledgments I wish to thank the late Professor H. G. Callan FRS for introducing me to nuclear microsurgery, Garth Watson, Zhong Yuan Jiang, and Kenie Medveczky for technical assistance, and Louise Lockley for help with photography; References 1. Painter, T. S. (1934) A new method for the study of chromosome aberrations and the plotting of chromosomal maps in Drosophila melanogaster. Genetics 19, 175-188. 2. Cole, R. D. and Lawson,G. M. (1979)Selectivedisplacementof histoneHl from whole HeLa nuclei: effect on chromatinstructurein situ as probedby micrococcalnuclease. Biochemistryl&2160-2166. 3. Peacocke,A. R. (1957) The dissociationand molecularstructureof the nucleic acids. Spec.Publ. Chem.Sot. Land.8,139-164. 4. Baker, J. R. (1958)Principlesof Biological Microtechnique.Methuen,London. 5. Hancock,J. M. andSummer,A. T. (1982)The role of proteinsin the productionof different types of chromosome bands.Cytobios35,37-46. 6. Hill, R. J., Watt, F., and Stollar, B. D. (1984)Z-DNA immunoreactivityof Drosophila polytenechromosomes. Major effectsof 45% aceticacid, 95%ethanolandDNAse I nicking. Exp. Cell Res.153,469-482.
222 7 Chen, C C., Bruegger, B B , Kern, C. W., Lm, Y. C , Halpem, R. M , and Smith, R. A (1977) Phosphorylatton of nuclear protems m regenerating liver. Bzochemistry 16,48524855 8 Chargaff, E. (1955)Isolation andcompositionof the deoxypentosenucletc acidsand of the correspondmg nucleoprotems, m The Nucleic Aczds (Chargaff,E andDavidson,J N., eds), Academrc,NY, pp. 307-371. 9. Szlver,L M andElgm, S.C R (1976)A methodfor determinationof the m sttu distrzbunon of chromosomalprotems.Proc. Natl. Acad Sci. USA 73,423427. 10 Zink, B. andParo, R (1989) In vzvo binding of a trans-regulatorof homoeoticgenesin Drosophila
melanogaster
Nature 337,468-471
11 Alfageme,C R , Rudkin,G. T , andCohen,L. H. (1980)Isolatzon,propertiesandcellular dtstnbuttonof Dl, a chromosomal protemof Drosophila. Chromosoma 78, l-3 1. 12 Mott, M R , Burnett, E. J , andHill, R. J, (1980)Ultrastructureof polytenechromosomes of Drosophila isolatedby microdissectzonJ Cell Scz. 45, 15-30 13. Mott, M R. andHill, R. J. (1986)The ultrastructuralmorphologyof natzvesalivary gland chromosomes of Drosophzla melanogaster The band-interbandquestzonChromosoma 94,403-4 11 14 Hill, R J. andWatt, F (1978)Native sahvarychromosomes of Drosophzla melanogaster Cold Spring Harb Symp. Quant. Biol XLII, 859-865 15 Ashburner,M. (1972) Patternsof puffing activity m the sahvary glandchromosomes of Drosophzla. VI. Inductionby ecdysonem salzvaryglandsof D. melanogaster culturedzn vztro. Chromosoma
38,255-281.
16 Callan, H. and Lloyd, L (1960) Lampbrushchromosomes of crestednewts Trzturus crzstatus (Laurentz). Phzl. Trans Roy. Sot. Lond. B 243, 135-219 17. Cohen,L H. and Gotchel, B. V. (1971)Htstonesof polyteneandnonpolytenenuclei of Drosophzla melanogaster. J. Bzol Chem 246, 1841-1848 18 D’Angelo, E G. (1946) Mzcrosurgicalstudteson Chironomus salivary gland chromosomesBiol. Bull. 90,71-87 19 Hewish, D R. and Burgoyne, L. A. (1973) Chromatinsub-structure.The digestionof chromatin DNA at regularly spacedsitesby a nuclear deoxyrtbonuclease.Bzochem Bzophys. Res Commun S2,504-510
20. Pohl, F. M. andJovm, T. M. (1972)Salt-inducedcooperattveconformatzonalchangeof a syntheticDNA equilibriumandkineticstudieswith Poly (dG-dC) J Mel Bzol. 67,375-396 21 Wang, A. H-J , Quigley, G J., Kolpak, F. J., Crawford, J. L., van Boom, J. H., van der Marel, G , and Rich, A (1979)Molecular structureof a left-handeddouble-hehcalDNA fragmentat atomicresolution.Nature 282,680-686 22 Drew, H., Takano, T , Tanaka, S , Itakura, K., and Dickerson, R.E (1980) High-salt d(CpGpCpG),a left-handedZ-DNA doublehelix Nature 299, 312-316 23 Nordheim,A , Pardue,M. L , Lafer, E. M., Moller, A , Stollar,B D , andRich, A (1981). Antibodiesto left-handedZ-DNA bind to mterbandregionsof Drosophzla polytenechromosomes. Nature 294,4 17-422 24. Arndt-Jovm, D. J., Robert-Nicoud,M., Zarlmg, D. A., Gretder,C , Welmer,E., andJovm, T M. (1983)Left-handedZ-DNA in bandsof acid fixed chromosomes. Proc Natl. Acad Scz. USA 80,4344-4348
25 H111, R. J. andStollar, B. D (1983)Dependence of Z-DNA antibodybmdingto polytene chromosomes on acedfixation andDNA torsionalstram Nature 305,338-340 26 Alfageme,C R , Rudkm,G T., andCohen,L H. (1980)Isolation,propertzesandcellular distributionof Dl, a chromosomal protemof Drosophzla Chromosoma 78, l-3 1, 27 Artavams-Tsakonas, S , Schedl,P., Mnault, M.-E., andMoran, L. (1979) Genesfor the 70,000Daltonheatshockproteinm two clonedD. melanogaster DNA segments. Cell 17, 9-18. 28 Henikoff, S (1981)Posztton-effectvarzegattonandchromosome structureof a heatshock puff rn Drosophila. Chromosoma 83,381-393.
CHAPTER 20
PCR In Situ Hybridization Gerard
J. Nuovo
1. Introduction In situ hybrldizatlon 1sthe only molecular biology based test that allows for the direct correlation of the results with the histologic and cytologic features of the sample. The DNA/RNA extraction that precedes filter hybridization (slot blot or Southern blot) and PCR precludes this analysis. The relative sensitivlties of the three different assays are presented in Table 1. It is evident that in situ hybridization is a relatively insensitive test. A reflection of this relative insensitivity is seen in occult or latent infection by a virus where the copy number is low. In such situations, the virus 1srarely detected by in situ hybridization even though it was detected by either PCR or filter hybridization (l-6). This is not to say that the technique of in situ hybridization has remained static. The detection threshold of this assay has improved substantially m the last 5 yr. Another point worth emphasizing about in situ hybrldlzatlon 1s that one does not need to use radiolabeled probes (usually 35Sor 3H) in order to maximize its sensitivity. Although true 5 yr ago, recent and dramatic advances in nonisotopic labeling and, more Importantly, detection systems has greatly enhanced the sensitivity when using such common labels as blotin and digoxigenin (7-12). Still, only the most aggressive salesperson would claim (and incorrectly at that) that any given in situ system can routinely detect one DNA or RNA copy per cell. Figure 1showsthat the 1copy of HPV 16 DNA present in SiHa cells can not be routinely detected by in situ hybridization without prior PCR-amplification, whereas the 20 copies of HPV 18 present in HeLa cells are detectable. Despite the widespread use of both PCR and in situ hybridization in the last several years, it has proved difficult to combine the two. If this combination could be accomplished DNA would be amplified in intact cells and then visualized with in situ hybridization. The ability to accomplish PCR in situ hybridization in paraffin embedded tissue has been difficult for several reasons. One must expose the target DNA without destroying tissue morphology. Optimal concentrations of the essential reagents, such as the primers, Mg2+, and the DNA polymerase must be determined. Further, and perhaps most importantly, if the reaction is to be carried out directly on glass slides, loss of tissue adherence and tissue drying would have to be circumvented. These problems have From Edited
M&hods m Molecular Bology, Vol 33 In Situ Hybndrzefwn Proloco/s by K H A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
223
224
Nuovo Table 1 Sensltlvltles of Different Molecular-Based Assays Assay
Detection threshold
In srtu hybrldlzatlon
Southernblot hybrldizatlon Slot blot hybridization PCR (standard) PCR (with hot start modlflcatlon)
lo-20 copies/cell 1 copy/50 cells 1 copy/100cells 1 copy/1000cells 1 copy/l ,OOO,OOO cells
been overcome to the point that one may reliably amplify both DNA and, for RNA, cDNA in paraffin-embedded, fixed tissues. The purpose of this chapter is to provide readers with the protocols this laboratory has developed for the in situ localization of PCR-amplified DNA and cDNA (see Fig. 2 for a summary of the procedure). This will be preceded by a discussion of the key components of successful in situ hybridization as, of course, an in-depth knowledge of the mechanics of in situ hybridization are essential for performing PCR in situ hybridization.
2. Materials 1. &lane coated slides (see Note 1). We purchase ours from ONCOR Corp (Gaithersburg, MD). 2. Fixative: 10% buffered formalin, pH 7 0 FIX the cells or tissue for 15-24 h (see Note 2) 3. Protease: 2 mg/mL of pepsin or trypsin. Use at room temperature for 4-30 mm (seeNote 3)
4. Probe cocktail: 50 pL deionized formamlde (use 10 pL for ollgoprobes and add 40 PL water), 30 pL 25% dextran sulfate, 10 PL 20X SCC (20X SCC = 3M NaCl, 0.3M sodium citrate, pH 7.0), 10 pL of the probe (stock solution of 5-10 pg/mL) (see Note 4). 5 Posthybrldization wash solution 0.2% bovine serum albumin in 1X SCC (or 30 mM sodium chloride). Heat to 45°C. (see Note 5.) 6. Detection systems (see Note 6): a For blotin system, use a streptavldm-alkaline phosphatase(AP) conjugate (ONCOR); for digoxlgenin useantidigoxlgenin-AP conjugate (1.50 dilution); b. After using the AP conjugate, place the shdesin a solution of 0 1M Trls HCl, pH 9-9 5,O.lM NaCl (detectlon reagent solution);
c. NBT/BCIP is the chromagen added to the detection reagent; and d. Nuclear fast red (ONCOR) is the counterstain. 7 The amplifying solution for the PCR step of PCR in situ hybridization. 4.5 mM MgC12, 1 pM primer, 2.5 U/12.5 pL of Tuq polymerase, and 200 pM of the dNTPs, and the GeneAmp kit buffer (Perkm-Elmer, Norwalk, CT) (see Note 7).
3. Methods 1 Place several 4 k paraffin embedded sections, or two cytospins on a silane coated glass slide.
B
C Fig. 1, Detection of HPV DNA by in situ hybridization. The 20 copiesof HPV 18 DNA is detectablein HeLacellsusingstandardin siruhybridization (A), whereasthe 1 copy of HPV 16 DNA in SiHa cellsis not (B). unlessamplifiedfirst by PCR(C).
Nuovo
226 1. Pa&fin-embedded tissue or cytospin on silane-coated glass slide ; digest with protease solution
2. Add amplifying solution, plastic coverslip and anchor with nail polish
3. Place in aluminum
boat, then on Thermal
4. Add Taq DNA at 60C by lifting mineral oil, denature, cycle
coverslip,
Cycler
overlay with
5. Standard in situ hybridization Frg 2 A graphic representation for the procedure of PCR m srtu hybrldlzation.
2. 3 4. 5 6 7.
Wash shdes in xylene for 5 min for ttssue sections only. Wash in 100% ethanol for 5 min Au-dry. Digest in pepsm. Inactivate protease by washing in O.lM Tn.+HCl, pH 7 50 IM NaCl for 3 mm Wash slides m 95% ethanol for 3 mm, 100% ethanol for 5 mm, then air-dry
FOR PCR STEP (if not, proceed to step 18). 8 Add 2.5 pL GeneAmp buffer, 4.5 pL MgCl2 (25 nuI4 stock), 4 PL dNTPs (2.5 nuI4 stock), 1 pL primer 1,l pL primer 2 (each 20 /.uV stock), 1 pL 2% BSA, and 10.2 j.tL sterile water. (Remove 4 PL and keep on ice for hot start ) 9 Place solution on two separate sections.
227
PCR In Situ Hybridization
10. Add plastic covet-slip and anchor with nail polish. 11. Time delay file* 82°C for 7 min. 12. At the onset of this file add 0 8 pL of Taq polymerase to tube on ice from step 8 (final vol is 4.8 pL). 13 At 55”C, lift one edge of the coverslip gently and add 2 4 I.LL to each section. 14. Overlay with preheated mineral oil. 15. Switch to time delay tile-94°C for 3 mm. 16. Link this time delay file to a cycling file of 55°C for 2 mm, and 94°C for 1 min, for 30 cycles; at conclusion link to soak file of 4°C. 17. Remove mineral oil with xylene and ethanol washes, then air-dry. 18. Add 5-10 j,tL of the probe cocktail to a given tissue section. 19. Overlay with plastic coverslip cut slightly larger than tissue section. 20. Place slide on hot plate-95-lOO’C-for 5 mm 21 Remove bubbles gently over tissue with a toothpick. 22. Place slides in humidity chamber at 37°C for 2 h. 23. Remove coverslips by holding down one end with fingernail and lifting off with toothpick. 24. Place m wash solution for 10 min at 45°C 25 Wipe off excess wash solution and put slides in a humidity chamber-do not let slides dry out. 26. Add appropriate alkaline phosphatase conjugate in humidity chamber 27. Incubate for 20 min at 37°C. 28. Wash slides at room temperature for 3 min in a solution of O.lM Tris-HCl, pH 99.5,O.M NaCl (detection reagent solution). 29. Place slides m detection reagent solution to which NBT/BCIP has been added (ONCOR kit) 30 Incubate slides for 30 mm to 2 h, checking results periodically under microscope. 31. Counterstain with nuclear fast red, and coverslip. 32 View under microscope See Notes 8-14 for a discussion on specific aspects of the above procedure, including a brief outline of the method of reverse transcriptase-medrated PCR in situ hybridization.
4. Notes 1 Perhaps the major technical advancement in the field dealt simply with the preparation of the glass slide. About 5 yr ago, it was routine to pretreat the slides with materials, such as poly+lysine, glue, or other adhesives to improve adherence (13-16). Although such pretreatments certainly worked better than untreated slides where most sections would fall off, in my experience the sections would, at best, remain on about 75% of the time. These problems were circumvented by the use of organosilane, a chemical used in industry to treat glass. I have stored silane coated slides at room temperature in closed boxes and used these slides successfully as much as 3 yr after pretreatment. If ttssue sections fall off at a rate greater than 5% and one is using commercially prepared silane slides, the problem is probably air bubbles under the tissue which usually reflects inexperience of the technician placing the sections on the slides.
Nuovo 2. I do not recommend using frozen tissues for in situ hybridization. The morphology is at best poor, which defeats the purpose of the test. Further, some claim that protease digestion is still required with in situ hybridization with the use of frozen tissues so even this step cannot necessarily be omitted (10,17). There are many different fixatives that various laboratories use to process tissues In my own experience, I have seen buffered formalin, unbuffered formalin, Bourn’s solution, and B5 (each of which contams picric acid), Zenker’s solution (which contains mercury), and 95% ethanol used for a variety of purposes Buffered formalm, pH 7 0, is the best fixative for in situ hybridization and PCR in sztu hybridization, although other crosslmkmg fixatives, such as glutaraldehyde and paraformaldehyde are acceptable Fixatives that contain either picrtc acid or heavy metals may allow for successful in situ hybrtdization, but thts IS dependent on the length of time of fixation (15,18-22). Two hours fixation in Bouin’s solution has minimal effect on the intensity of the hybridization signal, which may be completely eradicated after overnight (15 h) fixation; intermediate results are seen after 8 h of Boums fixation (15,20) However, fixation in a solution that contams a heavy metal or picric acid wtll not permit either PCR or PCR in sztu hybridization (19,23) If only tissues fixed in either picric acid or a heavy metal 1s available with frozen tissue, it 1s recommended that the frozen tissue be slowly thawed and then fixed m 10% buffered formalin overnight. Although some freezing artifact will be evident, both in situ hybridization and PCR in situ hybridization may be done with good results (G. J. Nuovo, submitted for pubhcation) 3 Fixatives, espectally those whose primary mode of action is crosslmking, such as formalin, hinder penetration of the probe to the target nucleic acid molecule (15,22-24). Different methods have been used to facilitate probe entry, including treatment with various chemicals, such as HCl, photofluor, detergents, heating (microwave), and sodium sulfite (12), to name a few However, most of the interest has focused on pretreatment with proteases There are many different proteases that have been used for in atu hybridization, and immunohistochemistry. These include trypsm, pepsm, proteinase K, and pronase. We have found that these are equivalent for in situ hybndizatton but each requires determining the optimal time and concentration, which may vary considerably for different tissues For example, tissues, such as biopstes of kidney, liver, and lymph nodes are relatively sensitive to protease digestion, whereas cervical tissue and, espectally, autopsy material often requires relatively more stringent digestion (22). Insufficient protease treatment is recognizable as a dimmished or completely absent hybridization signal (Fig. 3) Too much protease treatment is easy to recognize, as the tissue morphology will be destroyed (Fig. 4). It IS important to emphasize that in my experience overprotease treatment is the only cause of poor morphology for in sztu hybridization and PCR in situ hybridization. If poor tissue morphology is a problem, then decrease the time of protease digestion (decrease by intervals of 10 min) or decreasing the protease concentration tenfold ~111solve this problem. To determine if the protease time was adequate, it 1s strongly recommend that one uses one of several biotin labeled human DNA probes that are
PCR In Situ Hybridization
B Fig. 3. Effect of protease digestion on the intensity of the hybridization signal. With no protease pretreatment, a hybridization signal was not evident in this low grade cervical squamous intraepithelial lesion @IL), which contained HPV 51 (A). A signal was evident in the serial section when the hybridization was preceded by treatment of the tissue in trypsin for 13 min (B).
currently available (e.g., ONCOR). When the protease time is correct, all the cells should give an intense hybridization signal with the use of these probes; many of these probes use repetitive alu sequences, which are present in numbers much greater than 10,000 copies per cell.
230
Nuovo
Fig. 4. Effect of proteasedigestion on tissue morpho.logy. This liver biopsy was overdigested in pepsin, as evidenced by the lack of nuclear detail toward the center and concomitant loss of the hybridization signal. Note the signal in a few of the cells toward the periphery that apparently are more resistant to protease digestion.
4. The function of the formamide and relatively low-salt concentration is to facilitate denaturing of the probe and target DNA at 100°C, about 4O“C above the T,,, of homologous hybridized DNA. Bromley et al. have done extensive work correlating the concentration of the probe and the intensity of the hybridization signal under a wide variety of conditions (25). As noted in the “Probe Cocktail” in Section 2., the probe concentration is listed as 1 pg/mL. This amount is rarely associated with background problems for the nonisotopic labeled probes. However, if background is a problem the concentration of the probe may be decreased lo-fold with minimal sacrifice of the hybridization signal (25). 5. Background is easily corrected with the most common nonisotopic systemsbiotin and digoxigenin (Fig. 5). The conditions listed above usually readily disallow the relatively few hydrogen bonds between the large (100-200 bp) probe and nontarget molecules, but still maintain the probe-target complex. However, it is important to emphasize that for oligoprobes (20-40 bp), one needs to decrease the stringency by increasing the salt concentration to MI-300 mM or risk losing the entire signal. 6. After the posthybridization wash one is left with a target/probe complex. Labeled nucleotides are incorporated into the probe. A key component of the biotin or digoxigenin systems is the enzyme alkaline phosphatase, which will be attached to the probe-target complex. For biotin this is readily accomplished with a streptavidin-alkaline phosphatase conjugate. An advantage of this system is that
PCR In Situ Hybridization
231
Fig. 5. Background noise and the importance of the posthybridization wash. A large amount of nonspecific staining is seen with the HPV 6/l 1 probe (A) if the posthybridization wash was done for 15 min at 20°C in a solution with 1.5M NaCl. Note how the background is primarily cytoplasmic; HPV DNA typically localizes to the nucleus. The background is eradicated if the posthybrldization wash is 15 min at 50°C in a solution that contains 150 nM NaCl (B); this lesion actually contained HPV 33. any immunohistochemistry laboratory will have extensive experience with such conjugates and thus be aware of the nuances of its use. For the digoxigenin system one employs an antibody against digoxigenin that is conjugated to the alkaline phosphatase. Although a wide variety of chromagens are available, I recommend Sbromo-4-chloro-3-indolylphosphate, which, in the presence of nitroblue tetrazolium (NBT/BCIP), yields a blue precipitate. The counterstain, which stains nuclei pale pink, and does not stain cytoplasm, is nuclear fast red.
232
Nuovo
7 Note that the optimal concentrations of the Mg2+ and 7’uq polymerase are greater than those for standard PCR. This may reflect dtfliculty in entry of these reagents to the site of DNA amplification and, m part, sequestration of the Mg2+ by cellular components. Consistent with this hypothesis is our observation that one may use lO-fold less Taq polymerase with the addition of 1 mg/mL of bovine serum albumin (BSA) to the amplifying solution in PCR in situ hybridization; BSA can block absorption of the enzyme to the glass slide or plastic coverslip (23). 8 Background: This is a most common problem encountered with zn situ hybridizatton. Background may be defined as the presence of a hybridtzatton signal with a specific probe in areas of the tissue where the signal should not be present (e g , in normal endocervical cells or basal cells with HPV) Of course, m some mstances one may not be sure where the in srtu signal should localize A more strict defimtion of background would be a hybridization signal when the labeled plasmid vector is employed (the plasmid is the vehicle used to clone the probe of Interest). Background is the result of nonspecific bmdmg of the probe to nontarget molecules Two simple and logtcal ways to deal with background are to decrease the concentration of the probe and/or to mcrease the strmgency of the posthybridization wash The result of doing the latter is depicted in Fig. 5 If background is a problem, first try increasing the temperature of the wash by 10 degree increments. 9 Absence of a hybridization signal. This is an obvious potential problem with in situ hybridization. I recommend following a flowchart type of problem solvmg tree, which is presented in Ftg. 6. 10. Use of oligonucleottde probes* The probe size for standard in situ hybridization is from 100 to 250 bp in stze However, one may want to use much smaller (2040 bp) probes called oligoprobes. There are two main reasons to use ohgoprobes. First, they are more readily available than the larger probes, which requtre a cloned sequence of DNA, whereas one only needs to know the sequence of the target of interest, readily available in the literature, to generate an ohgoprobe. Second, one is obliged to use an ohgoprobe internal to the sequence being amplified m PCR in situ hybridization in order to be assured that the signal IS indeed the PCR product. Because oligoprobes are much shorter than a “standard” probe, there is a substantial reduction m the number of base pan matches, and thus the strength of the hybridized complex, compared to the larger probes. The practical consequence is that the wash conditions must be carefully chosen so as to mimmize background but not to lose the signal In practical terms, I have seen the signal lost for a 20-mer oligoprobe wtth a posthybridization wash m 30 mM salt at 4YC; under these conditions the signal for a larger homologous probe would remain intact. Hence, for oltgoprobes, I use different probe cocktail and posthybridization wash conditions compared to those used for genomic probes 11 Direct incorporation of reporter molecules This is possible with in sztu PCR, but only under defined condttions. The mclusion of a labeled nucleottde in the amphfying solutton is the major modification m this technique compared to PCR wz situ hybridizatton, where the PCR product is not directly labeled, but rather detected with a labeled internal ohgoprobe. Most of our work with zn situ PCR has focused on the labeled nucleottde digoxigenm dUTP (dig dUTP-Boehrmger Mannheim, Indianapolis, IN) (26-30) There are only two modificattons to the
PCR In Situ
Hybridization
233 h&v hybndizabon obtatnable7
UseDNA probewrist repeatinghumanDNA sequence /
\
1 Chzck tissue diagnosis 2 Check probe with known
Adequate protease time?
poslhve
1 Poor Ussue morphology 2 Good ttssue morphology
3 If probe is okay, check for presence of target by PCR
/
\
PCR pos~ttve
PCR negative
Copy * below mutu threshold
target not present
no
- OVERPROTEASED
If good morphology, mcrease protease time and use repeahng human sequence probe
/ Signal
\ no sqnal 1 Proper fmative? (no heavy metals or picrlc acid) 2 Check alkaline phosphatase conpgak 3 Check chromagen 4 Check denaturrng temperature (195C) 5 Check that tissue was deparaffuuzed
Fig. 6. Flow chart detailing a step-by-step approach to follow if a hybrldizatlon signal IS not evident with m situ analysis
protocol listed for PCR in situ hybridization. First, 10 j.kV dig dUTP 1sadded to the amplifying mixture. Second, after completing the amplifying reaction and removing of the coverslip and mineral oil, we wash the slides for 10 min at 45°C in a solution of 0 2% bovine serum albumin and 0.1X SCC to remove unincorporated dig dUTP. After this wash, the digoxigenin that has been incorporated into the amplified DNA may be detected according to the manufacturer’s protocol (Boehringer Mannheim, Mannheim, Germany; I use a 1.50 dilution of the antibody). Note that the sensltivlty of this procedure is dependent on the exact fixation, protease digestion, and reagent conditions listed above (Fig. 7). 12. Specificity of in situ PCR: With regard to specificity, in any PCR reactlon, two pathways compete with target-specific DNA synthesis. These are mlspriming and primer oligomerlzation (30). If the hot start modiflcatlon is not employed, the mispriming and primer oligomerization pathways can easily overwhelm target specific DNA synthesis such that a large amount of DNA is synthesized but it is mostly nonspecific! This 1s not surprising when one considers that there is far more nontarget and primer DNA m a reaction mixture relative to target DNA. It has been shown that under non hot start conditions that the detection threshold for the target of interest may be greater than several thousand copies, not the I100 copies most articles quote (30,31). However, nonspeclflc incorporation is greatly curtailed by the hot start modification. The end result 1s that one can
234
Nuovo
B Fig. 7. Effect of fixation and protease digestion on detection of amplified bcl-2 DNA in peripheral blood leukocytes (PBMs). A signal was evident in about 25% of the cells after PCR in situ with direct incorporationof digoxigenindUTP for cellsfixed in acetonefor 5 min with no digestion(A). If the PBMs werefixed for 15h in buffered formalin AND pretreatedwith trypsin, thenan intensesignalis evident in eachcell (B).
reliably detect one copy per tissue DNA extract with the hot start modification (30,31). 13. Demonstration of the specificity of hot start in situ PCR: Two different approaches may be used. First, different cell populations can be mixed and a primer pair is used that is able to amplify a target in only one of the two populations. Second,
PCR In Situ
Hybridszatron
235
one may use “nonsense primers,” primer pairs that could not possibly find targets in the cells being studied. The latter is simply accomplished by making primers based on the cDNA of an RNA virus, such as measles, which can not make its cDNA in vivo. To demonstrate these approaches, we used the SiHa human cervical cancer cell line that, as expected, contam HPV DNA although only one viral copy per cell. The cells were mixed with peripheral blood leukocytes (PBMs) from an infected individual. For the following descriptions, standard conditions refer to experiments where all reagents were added, the sample with reagents covered with a plastic coverslip, and then overlaid with mineral oil before raismg the temperature of the heating block Whereas SlHa cells might give specific or nonspecific product, amplified DNA from PBMs must be nonspecific when using HPV 16 specific primer. The digoxigenin would become mcorporated into both target-specific and nonspecific amplified DNA. Under hot start conditions with a single HPV 16 primer pair only some of the cells incorporated digoxigenin. The negative cells proved to be the leukocytes, as they reacted with an antibody against leukocyte common antigen in a double labeling technique. Under standard conditions, all of the cells, includmg the leukocytes Incorporated digoxigenm (30). These results provided reassurance that the hot start modification greatly inhibited nonspeclfic pathways (30). In an analogous experiment, measles infected HeLa cells were mixed with the PBMs of a noninfected individual. The measles infected HeLa cells are multinucleated and thus easily differentiated cytologically from leukocytes. These mixing experiments proved that only the measles infected HeLa cells had a detectable signal with direct incorporation and measles specific primers if the hot start modification was employed with the reverse transcriptase (RT) in situ PCR technique (Fig. 8) (see Note 14) (32,331. If the hot start modification was ormtted then both the HeLa cells and PBMs had detectable signal. In experiments with nonsense primers, we analyzed two different cellular samples-PBMs and a cervical swab. HIV-I DNA was routmely found in CD4 positive PBMs from patients with AIDS (26) Similarly, HPV DNA was regularly detected m dysplastic cells from patients with squamous intraeplthehal le.slons (29,33). Thus far we have analyzed about 10,000 PBMs from people who are HIV-l negative by PCR and who lack any of the risk factors for AIDS. Further, we have analyzed about 5000 PBMs from AIDS patients by in situ PCR using primers for measles cDNA In either instance, any positive cell would presumably represent nonspecific uptake of dUTP. All of the 15,000 PBMs were negative Of the 3000 cervical epithelial cells analyzed by in situ PCR with primers for measles cDNA, 4 (0.1%) have been positive. Whether the higher rate of nonspecific uptake reflects the longer fixation time and/or different cell type is unclear. We have obtained similar results using measles specific primers on PBMs fixed for 15 h and protease digested. Recall that the rate of nonspecific incorporation under these conditions for standard in situ PCR approaches is 100%. Clearly, nonspecific uptake is a rare event with the hot start modification although very common under standard conditions (23) However, a false positive signal inevltably occurs during in situ PCR in tissue sectlons, as dlscussed below
236
Nuovo
Fig. 8. Cytological and molecular analysis of measles-infected HeLa cells. The multinucleation and nuclear inclusions characteristic of measles infected cells are evident on routine H and E stain (A). Only the measles-infected HeLa cells were positive using direct incorporation when these cells were mixed with peripheral blood leukocytes; note the cytoplasmic signal (arrow, B) demonstrating the specificity of direct incorporation using the hot start modification in cytospin preparations. 14. Reverse transcriptase-mediated PCR in situ hybridization: Brief mention will be made of our RT PCR in situ hybridization protocol and results. More detailed information is available elsewhere (32,33). Tbe model system I will describe is with tbe RNA virus hepatitis C. All of the reactions were performed directly on glass
PCR In Situ Hybridization
237
B Fig. 9. Direct incorporation in situ PCR; effect of DNase pretreatment on tissue sections. This liver biopsy did not contain hepatitis C RNA, yet a signal is evident with hot start in situ PCR usinghepatitisC-specificprimersif the DNasestepis omitted (A). The signalis eradicatedif DNasepretreatmentis done(B). slides.The key point to emphasizeabout our protocol is the overnight pretreatment in FWase-freeDNase. First, it is important to realize that one must use long term digestion. The end point of determining the proper DNase digestion time is: the inability to amplify native DNA with either target specific or nonsenseprimers.
238
Nuovo
B Fig. 10. Detection of hepatitis C in a liver biopsy. Hepatitis C was detected in this liver biopsy after DNase pretreatment using RT in situ PCR (A); the signal was lost if the RT step wasomitted (It); omission of the RT is an important negative control in RT in situ PCR. The inability to amplify the native DNA in the liver tissue after DNase digestion was shown before doing the RT in situ PCR reaction (Fig. 9). Note that I state that even nonsense primers can cause nonspecific DNA synthesis in the PCR step. It is essential to emphasize that this is true only in tissue sections and not in cytospin preparations. Recall that the experiments above with nonsense primers and the very low detection rates were done with cytospins. It is not clear why tissue sections behave so differently in this regard; one possible explanation
PCR In Situ Hybridization
239
is that far greater nontarget is exposed in tissue sections than in cytospins but that at best is an incomplete hypothesis Whatever the explanation, one may exploit this fact by using a nonDNased section on the glass slide as a positive control for the PCR and subsequent dig dUTP detection steps and the DNase nonRT section as the negative control (Fig 9). In the RT step, the solution 1scovered with a plastic covershp, anchored with nail polish, and overlaid with mineral oil as described above for PCR m situ hybridization. We use the same reagent concentrations for RT as listed m the RT PCR kit (Perkin Elmer, Norwalk, CT). After RT, we usually do in srtu PCR (32,33). Amplified hepatitis C cDNA was detectable in several of the liver biopsies, mostly from patients with serological evidence of the infection. The specrfrcrty was demonstrated by omitting the direct incorporation of dig d-UTP m the PCR step and using a labeled internal oligoprobe and demonstrating m serial sections that the same cells were positive (Fig. 10).
Acknowledgments The author greatly appreciates the technical and material assistance of John Atwood, Will Bloch, Deborah French, Dennis Groff, Larry Haff, Brian Holaway, John Snmsky, and Eric Spitzer. Angella Forde, Frances Gallery, Michele Margiotta, and Kim Rhatigan provided expert technical assistance. Phyllis MacConnell has been especially helpful with the technrcal aspects of the in situ PCR procedures. I am especially indebted to S. B. Lewis for hts financial support. This work was supported by a grant from the Lewis Foundation and Perkin-Elmer Corporation to G. J. N.
References 1, deVtlhers, E M., Schneider, A , and Mrklaw, H. (1987) Human paprllomavrrus rnfectrons tn women with and without abnormal cervical cytology Lancet i, 703-706 2 Nuovo, G J. and Cottral, S (1989) Occult infection of the uterine cervrx by human papillomavnusin postmenopausal women.Am. J. Obstet Gynecol 160,340-344 3 Nuovo, G J , Darfler, M M., Impratm,C C., and Bromley, S E. (1991)Occurrenceof multiple types of humanpaptllomavirusm genital tract lesions*Analysrsby WISW hybridization and the polymerasechain reaction. Am J Pathol 58, 518-523 4 Nuovo, G. J , Hochman,H , Ehezrr, Y D , Comrte,S , Lastama,D , and Silvers, D N (1990)Detectionof humanpapillomavtrusDNA m penilelessons hrstologicallynegatrve for condylomata*analystsby wzsuuhybridizationandthepoly-merasechamreaction Am J Surg Path01 14,829-836 5 Nuovo, G J (1990) HumanpaptllomavirusDNA in genital tract lessons htstologrcally negativefor condylomata,analysisby m situ, Southernblot hybrrdizatlon and the polymerasechamreaction.Am J Surg. Pathol. 14,643-651 6 Nuovo, G J. (1989)A comparison of different methodologres (brotmbasedand35Sbased) for the detection of humanpaptllomavirusDNA. Lab. Invest 61,471-476 7. Crum, C P., Nuovo, G J., Friedman,D , and Srlverstem,S J (1988) A comparrsonof biotin and isotopelabeledrlbonuclercacid probesfor rn situ detectionof HPV 16, ribonucletcacid in genitalprecancers.Lab. Invest.58,354-359 8. Nuovo, G J. (1989) A comparisonof slot blot, Southernblot andrn sztuhybrrdrzatron analyzesfor humanpapillomavirusDNA m gemtaltract lesions Obsret Gynecol 74, 673-677.
Nuovo 9 Ostrow, R S , Mamas, D A, Clark, B A, Okagakt, T., Twtggs, L B , and Faras, A J (1987) Detection of human papillomavuus DNA m mvastve carcmomas of the cervix by m situ hybridization Cancer Res 47,649-653 10 Walboomers, J M M , Melchers, W. J. G., and Mullmk, H. (1988) Sensitivity of rn situ detection with biotinylated probes of human paptllomavtrus type 16 DNA in frozen ttssue sections of squamous cell carcmoma of the cervix. Am J. Pathol 131,587-594. 11 Crum,C P , Symbula,M , andWard, B E (1989)Topographyof early HPV 16transcrtpnon m high-gradegenitalprecancers. Am. J. Pathol. 134, 1183-l 188 12 Nagat,N , Nuovo, G. J., Friedman,D , andCrum,C P (1987)Detectionof papillomavtrus nucleicacidsin gemtalprecancerswith the rn srtuhybridization technique,A review fnt J. Gynecol.Path016,366-379 13. Crum,C. P , Nuovo, G , Frtedman,D., andStlverstein,S J (1988)Accumulationof RNA homologousto humanpaptllomavuustype 16openreadingframesin gemtalprecancers J Vwol 62,84-90 14 Crum, C P , Nagai,N , Levine, R. U , andStlverstem,S J (1986)In srtu hybrtdtzatton analysisof humanpaptllomavnus16 DNA sequences m early cervical neoplastaAm. J Pathol. 123, 174-182 15. Nuovo, G J , and Stlverstem,S. J (1988)Compansonof formalm,buffered formalm, andBourn’sftxatton on the detecttonof humanpaptllomavtrusDNA from genitallesions Lab Invest 59,720-724 16. Nuovo, G. J , Friedman,D , Silverstem,S J , and Crum, C P. (1987) Transcrtphonof humanpaprllomavnustype 16in genitalprecancersCancerCells5,337-343 17 Lebargy,F , Bulle, F., Stegrist,S , Guellaen,G , andBernaudm,J (1990)Localizattonby rn situ hybridization of glutamyl transpepttdase mRNA m the rat kidney usmg35S-labeled RNA probes.Lab Znvest62,73 l-735. 18 McAlltster, H A , and Rock, D L (1985) Comparattveusefulnessof ttssueftxattves for tn sttu viral nucleicacidhybrrdizatton.J. HistochemCytochem.33, 1026-1032. 19 Greer, C E , Peterson,S. L , Kivtat, N B , andManos,M M (1991)PCR amphftcation from paraffin-embedded ttssuesEffectsof fixative andfixative ttmesAm J Clrn Pathol 95,117-124.
20 Nuovo, G J. (1989)Buffered formalmISthe superiorfixative for the detecttonof human paptllomavirusDNA by m situ hybridization analysrsAm. J. Pathol 134,837-842 21 Tourmer,I., Bernuau,D , Pollard,A., Schoevaert,D , andFeldmann,G (1987)Detection of albuminmRNAsm rat liver by in srtuhybndtzatton, usefulness of paraffin embedding andcomparisonof variousfixation proceduresJ HtstochemCytochem 35,453-459 22 Nuovo, G J (1991)Comparisonof Bourn’sSoluttonandBuffered FormalmFixation on the DetecttonRate by rn situ hybrtdizatton of HumanPaptllomavtrusDNA m Gemtal Tract Lesions.J Hrstotech.14, 13-18 23. Nuovo, G J , Gallery, F., Horn,R , MacConnell,P , andBloch, W (1993)Importanceof different variablesfor opttmtzing rn situ detectionof PCR-amphftedDNA. PCR Meth Appl. 2,305-3 12 24. Goelz, S E., Hamilton, S R , and Vogelstein, B. (1985) Purificatron of DNA from fomraldehydefixed and paraffin embeddedtissue Blochem Blophys Res Comm 130, 118-124 25 Bromley, S. E , Darfler, M. M., Hammer,M. L , Jones-Trower,A., Prtmus,M A., and Krerder,J W (1990)In srtu hybrrdrzatronto humanpaprllomavnusDNA m fixed tissue samplesComparisonof detectionmethodsPapillomavwuses, Wiley-Ltss, Inc , Phtladelphia, pp 3249. 26. Nuovo, G. J., Margiotta, M , MacConnell,P , andBecker,J (1992)Rapidrnsitu detection of PCR-amplifiedHIV-l DNA Dlagn Mel Pathol 1,98-102
PCR In Situ Hybridmation 27 Nuovo, G J , Gallery, F., and MacConnell, P. (1992) Analysis of the dlstrlbutlon pattern of PCR-amphfled HPV 6 DNA m vulvar warts by m suu hybridization. Mod Path& 5, 444-448 28 Nuovo, G J , Becker, J , MacConnell,P., Marglotta, M , Comite, S., and Hochman,H
(1992)Histologicaldlstrlbutionof PCR-amplifiedHPV 6 and 11 DNA in pemlelesions Am J Surg. Puthol. 16,269-275 29 Nuovo, G. J , MacConnell,P , Forde, A., and Delvenne,P. (1991) Detectionof human papillomavn-us DNA m formalmfixed tissuesby m situ hybridization after ampllflcatlon by PCR.Am J. Pathol 139,847-854 30. Nuovo, G. J., Gallery, F , MacConnell,P , Becker,J , andBloch, W (1991)An improved techniquefor the detectionof DNA by m situ hybrtdlzatlon after PCR-amphflcationAm J. Pathol. 139, 1239-1244. 31 Chou, Q., Russell,M., Birch, D E., Raymond,J , andBloch, W (1992) Preventlonof prePCRmls-pnmmgandprimerdlmerizatlonimproveslow-copy-numberamphficatlons Nucltw Acids Res 20, 1717-1723 32 Nuovo, G J , Gorgone,G , MacConnell,P., andGoravlc, P. (1992)In situ localizationof humanandviral cDNAs after PCR-amplificationPCRMeth. Appl 2, 117-l 23 33 Nuovo, G J (1992)PCR m situ hybridization, Protocolsand Applications Raven,New York, p, 264
CHAPTER 21
Detection of Virus Nucleic Acids by Radioactive and Nonisotopic In Situ Hybridization Eric J. Gowans, Keril Jane Arthur, and Geofiey
Blight, D. Higgins
1. Introduction Unlike other applications of in situ hybridization (ISH),where the target is likely to be chromosomal DNA or RNA transcrtpts, the target in studies to detect viral nucleic acids may represent double- or single-stranded (ds or ss) DNA or RNA (representative of viral genomes), nucleic acid repllcative mtermediates or mRNA. Consequently, the sample may reqmre an opttonal denaturation step to distinguish ds and ss nucleic acids, and/or a prior nuclease digestion step. Furthermore, because different viruses appear to replicate with different efficiency, or because the rephcation efficiency may differ in acute and chronic infection, the target for ISH may vary between several hundred to thousands of genome copies (e.g., hepatitis D virus [HDV], herpes simplex virus [HSV], human papillomavirus [HPV]), m individual cells supporting active virus replication, to single genome copies in cells associated with viral DNA integration. The above features may Influence the fixative chosen for the study and, although it is often most convement to use routinely processed formalm fixed wax-embedded &sue, there 1slittle doubt that fresh frozen tissue will result in higher sensitivity. On the other hand, the improved histological detail in formalin fixed tissue may be an equally important parameter. Thus it is unlikely that any one particular protocol will cover each of the above possibilities, and mdividual workers should be prepared to experiment with a number of different protocols before making extensive use of one. In a sense,one should “choose horses for courses.” Consequently, the protocols in this chapter are diverse and reflect our range of Interests. ISH was developed mitially using radiolabeled probes and previous reviews from our group have concentrated on the use of such probes for the detection of hepatitis viruses (I,2). In recent years there has been a move toward the use of nomsotopic methods. Biotm, digoxigenm (DIG) and fluorochrome-labeled From Edlted
Methods m Molecular Bmlogy, Vol 33 In SI!U Hybrfduabon Profocols by K H A Choo Copynght Q 1994 Humana Press Inc , Totowa, NJ
243
244
Gowans
et al.
probes provide a rapid means to detect virus nucleic acids at high resolution, without many of the problems associated with the use of radtorsotopes. For these reasons, we have included m this chapter protocols for ISH usmg both radioactive and nomsotopic probes. Some of the practical applications of the described protocols for the detection of vu-al nucleic acids are reviewed in Chapter 30 m this volume. 2, Materials 1. Potassmm dichromate (LabChem) 2. 3-Ammopropytrrethoxysrlane (APES, Sigma, St Louis, MO) Add this to 100% ethanol in a glass staining dish to a final concentration of 2% 3 Glutaraldehyde (TAAB Laboratories, Reading, UK) 4 Prosil (PCR Inc , Gamesville, FL) 5 Ascending ethanol series: 40, 70, 90, and 100% ethanol solutions in .500-mL stammg dishes. 6 Phosphate buffered saline (PBS) 0.15M NaCl, 0 006M K,HPOd, 0 002M KH2P04. 7. 4% Paraformaldehyde, 5 mM MgCl,: This fixative is prepared by heating 500 mL of sterile PBS to 56°C and adding 20 g paraformaldehyde (TAAB Laboratories), and heating at 65°C until the paraformaldehyde is completely dissolved Cool, and add MgC12 to a final concentration of 5 mM. Filter Use within 1 wk 8. Ethanol acetic acid (EAA): 3 parts ethanol to 1 part glacial acetic acid. 9. 10% buffered formalm m PBS 10 RNase A (Boehrmger, Mannheim, Germany) 11 SSC 0 15M NaCl, 0 015M Nas citrate 12. Protemase K (Boehringer) 13 Protemase K reaction buffer 20 mM Tris-HCl, pH 7 4, 2 mM CaCl,, 10 rr&f EDTA. 14 Acetylating solution+ 0. 1M trrethanolamme, pH 8.0,O 25% acetic anhydrrde (4). 15. RNasin (Promega, Maduon, WI) 16 Diammobenzrdme (DAB, Boehringer) Dissolve m 100 mM Trrs-HCl, pH 7.6, and add H,O, to a final concentration of 0 03%. 17. Periodate-lysme-paraformaldehyde (PLP) (9). Dissolve 1 5 g paraformaldehyde in 50 mL sterile water, and 20 PL 10M NaOH. Once drssolved add 20 pL concentrated HCl, 0 146 g NaID4, 0 9 g L-lysme, 1.46 g Na2HP04, and 100 mL distilled Hz0 Stir until dissolved. PLP must be used within 24 h 18. DNase 1 (Boehringer) 19 Hexadeoxynucleotide mixture (90 Az6a U; Pharmacia, Uppsala, Sweden) 20. 10X random priming reaction buffer: 500 mM Tris-HCl, pH 7.2, 50 mM MgC12, 10 mM DTT, 20 mg/mL BSA. 2 1 dNTP stock solution 1 mM dATP, dGTP, dTTP, 0.1 mM dCTP 22. Klenow (Boehringer) 23. TE8: 10 mM Tris-HCl, pH 8 0, 1 mM EDTA, pH 8.0. 24. 5X Transcription reaction buffer 200 mM Tris-HCl, pH 7 5, 30 mM MgCl,, 10 mM spermidme. 25. FITC-12-UTP (Boehringer).
245
Methods to Detect Virus Nucleic Acids
26. DIG- 11-UTP (Boehringer) 27. RQl DNase (Promega). 28. 10X Kinase reaction buffer 100 n-&f Tns-HCl, pH 7.5, 100 mMMgCl*, 100 mM K acetate. 29. T4 polynucleotide kinase (Promega). 30. 1.5X FDST: 75% deionized formamide, 15% dextran sulfate, 750 i.tg/mL sheared salmon sperm DNA, 750 l,tg/mL tRNA. 3 1. 5X hybridization mix: 10X SSC, 250 mM Tris-HCl, pH 7 6, 50 mM Naz HP04, 50 mM NaHz P04, 0.1% Ficoll, 0.1% PVP. 32. TN buffer: 100 mil4 Tris-HCl, pH7.5, 150 mM NaCl. 33. 1% blocking reagent (Boehringer). 34. Alkaline phosphatase-conjugated sheep antiDIG (Boehringer). 35. DIG substrate solution. 175 pg/mL 5-bromo 4-chloro 3-indolyl phosphate, 250 l.t.g/mL nitroblue tetrazolium chloride. 36 Hematoxylin. Fully dissolve each component in 11 mL of distilled water in the following order: 50 g aluminum ammonium sulfate, 4 g hematoxylin, 0 3 g sodium iodate, 1.5 g citric acid, 75 g chloral hydrate. The solutton is stable for up to 1 yr. 37. Eosin: Mix well the following: 2750 mL 95% alcohol, 500 mL 1% aqueous eosin, 35 mL 1% aqueous phloxine, 14 mL glacial acetic acid. Store at 4°C 38. DPX mounting medium (Gurr; BDH, Kilsyth, Victoria, Australia)
3. Methods 3.1. Slide and Coverslip
Preparation
1. Acid washing of slides: Dissolve 100 g of potassmm dichromate in 850 mL of double-distilled water and add 100 mL of concentrated sulfuric acid slowly in a fume hood with constant stirring. Separate and add glass microscope slides individually to the wash, and leave for at least 16 h. Wash the slides m tap water for at least 2 h in slide racks. Wash again in four changes of double-distilled water for a further total of 2 h before drying. 2. Alternatively, soak slides in 2% Decon overnight, rinse in tap water, and then three times in distilled water, and air-dry. 3 APES coating of slides: Dip the dried slides into a 2% APES solution for 30 s Rinse three times for 30 s each in 100% ethanol, three times for 30 s each in double-distilled water, then dry in a vacuum oven at 80°C overnight. Wrap m aluminum foil, and store at room temperature for up to 1 mo. If the tissue sections show poor adherence, then the APES coated slides may need to be activated by glutaraldehyde (3) (see Note 1). 4. Coverslips: Dip acid washed 13-mm diameter glass coverslips individually (without drying) in a 1% Prosil solution in double-distilled water. Rinse twice in double-distilled water, dry at 80°C for 2 h, then sterilize at 160°C for 2-3 h. 5 Alternatively, coverslips can be washed as follows. Drop coverslips into a l-2% Prosil solution in double-distilled water Up to 1000 coverslips can be added to 300 mL of solution. Star for 2-3 min until no air pockets remam between the coverslips. Drain the Prosil, and wash the coverslips m three changes of doubledistilled water Since persisting air bubbles between the coverslips prevent adequate washing, thts is followed by washes in mcreasmg concentrations of ethanol
246
Gowans
et al.
at 40, 70, 90, and 100% for 30 s each. Dry coverslips by baking in a hot air oven at 160°C for 2 h.
1. 2 3. 4. 5. 6. 7.
3.2. Sample Preparation 3.2.1 Preparation of Cell Lines for ISH Soak APES coated slides in 100% ethanol for 30 mm. Air-dry in a laminar flowhood, and place in alcohol-washed, air-drted plastic lunch boxes Place ahquots of 100 p.L of a trypsinized cell suspension on the APES coated microscope shdes, and allow the cells to adhere for 1 h. Flood with growth medium, and incubate overnight Remove the shdes, place m stammg racks, and rinse m PBS. Ftx in 4% paraformaldehyde, 5 n-&f MgC12 for 5 mm. Wash two times for 5 mm each m PBS, and air-dry for 20 min. Either use immediately for ISH, or store in 70% ethanol at -20°C for no more than 48 h prior to use. 3.2.2. Preparation
of Tissue and Sections
for ISH
A number of protocols for the detection of different virus genomes are described below. Although much of our work is directed toward the detection of virus nucleic acids in naturally infected human tissue samples, the use of ISH has been extended to the study of HSV m the mouse. Owing to its specialized nature, we will also present detailed protocols for the detection of HSV nucleic acids in infected murine dorsal root ganglia. 3.2.2.1. DETECTION OF DNA AND RNA IN WAX-EMBEDDED TISSUE Routinely processed formalm fixed paraffin wax-embedded tissue provides an excellent substrate for the detection of HPV RNA. Alternatively, EAA fixed tissue has proved more suitable for the detection of hepatitis B vu-us (HBV) DNA, presumably because the sensitivity in formalin fixed tissue is reduced. Both methods provide good histological preservation and convenient tissue storage. 1. Fix biopsy size samples m 10% buffered formalm for 12-24 h, or in fresh EAA (3: 1) for 15-30 mm. 2 Dehydrate samples and process into paraffin wax. 3. Cut 5-km sections and mount on APES coated slides. 4. Heat at 60-70°C for 3 min, then at 37’C overnight to ensure section adherence 5 Dewax and rehydrate. 6. Fix sections in 4% paraformaldehyde, 5 rrUt4 MgCl, in PBS for 5 min at room temperature. 7. Wash sections two times m sterile PBS for 5 min each.
8. If RNasepretreatmentis required, incubatethe sectionsin 100-200 ug/mL RNase A in 2X SSC for 1 h at 37T 9 Wash in PBS, as m step 7 10. Digest in 50 pg/mL Proteinase K diluted in protemase K buffer for 15 min at 37°C (see Note 2).
Methods to Detect Virus Nucleic Acids 11. 12. 13. 14. 15. 16. 17.
247
Wash sections two times m sterile PBS for 5 min each. Postfix in 4% paraformaldehyde as step 6. Wash in sterile PBS as step 7. Wash in acetylatmg solution for 10 min at room temperature. Wash in PBS. Dehydrate through ascending ethanol solutions Air-dry.
3.2.2.2. FROZEN SECTIONS In our experience, the use of formalin-fixed tissue can reduce the sensrtrvity of ISH, and the detection of HBV DNA (for example), is less consistent. Furthermore, tf formalin-fixed tissue IS unsuitable and not every laboratory has access to EAA-fixed samples, then the only alternative is to use fresh frozen tissue. The following protocols have been used to detect HBV DNA and HDV RNA, respectively. For the detection of DNA in frozen sections: 1. 2. 3 4. 5. 6. 7. 8. 9. 10 11 12. 13. 14.
Air-dry 5-pm sections for 30-60 min at room temperature Fix in 0.1% glutaraldehyde in PBS for 30 mm at 4T Wash two times m PBS for 5 min each Digest in 50 pg/mL RNaseA in 2X SSC for 30 min at 37°C Wash two times in PBS for 5 min each. Digest in 0.5-l 0 pg/mL Proteinase K diluted in protemase K buffer for 15 min at 37T. Wash in PBS Denature in 0.1X SSC for 5 min at 100°C. Plunge into ice cold 0.1X SSC. Refix in 0 1% glutaraldehyde for 10 min at 4°C Rinse two times in 0.1X SSC for 5 min each. Acetylate for IO min at room temperature Wash m PBS Dehydrate and dry.
For the detection of RNA m frozen sections: 1 2. 3. 4. 5 6.
An-dry 5-pm sections for 30-60 min at room temperature. Fix m 4% paraformaldehyde, 5 n-&f MgClz in PBS for 5 min at room temperature Wash two times in PBS for 5 min each. Acetylate for 10 min at room temperature Wash two times in PBS for 5 min each Dehydrate and dry.
3.2.2.3. COLOCALIZATION OF VIRAL ANTIGEN AND NUCLEIC ACID It is often useful to determine if viral antigens detected intracellularly by immunohistochemistry represent de novo synthesis or passive accumulation. Alternatively tt may be useful to determine if viral antigens or nucleic acids are more sensitive markers of infection and replication. The following protocol IS
248
Gowans
et al.
designed to colocalize viral antigen and RNA (5), but it may be adapted from the above protocols to detect DNA if necessary (6). It is possible to use formalin-fixed or frozen sections, and the concentratton of the antibodies used m the immunohtstochemistry should be adjusted accordingly. 1. Air-dry sections. 2. Treat dewaxed or frozen sections with 3% H,Oz m PBS for 10 min. 3. Fix in 4% paraformaldehyde, 5 mMMgC12 in PBS for 5 min at room temperature (see Note 3). 4 Wash two times in PBS for 5 min each. 5 Incubate with primary antibody m PBS, 1 mM DTT, 1 U&L RNasm for 30 mm, at 37°C. 6 Wash two times m PBS for 5 min each. 7 Incubate m peroxidase conjugated species-specific antibody in PBS, 1 mM DTT, 1 U&L RNasin for 30 min at 37°C. 8. Wash two times in PBS for 5 min each 9. Incubate in 500 pg/mL DAB, 0.03% HZ02 in 100 mM Tris-HCI, pH 7 6, for 2-5 mm at room temperature 10 Wash two times in PBS for 5 mm each 11 Treat sections m 0 2% Triton-X 100 m PBS for 5 mm at room temperature. 12 Wash two times m PBS for 5 mm each 13. Wash m acetylating solution for 10 mm at room temperature 14. Wash two times in PBS for 5 min each. 15. Dehydrate and dry (see Note 4). 3.3. The Zosteriform Model of HSV Infection Preparation of tissues latently infected with HSV- 1. The zosteriform model of HSV infection used to generate latently infected murine dorsal root ganglia has been descrrbed previously (7,s). Briefly, after depilation wrth Natr (CarterWallace, Frenchs Forest, New South Wales, Australia), scarify a small area on the left flank, within the tenth thoracic dermatome, with a 27-gage needle through a 10 l.tL drop of virus suspension containing 3 x 104-1 .5 x lo5 plaque forming units. Collect latently mfected ganglia and immediately fix m PLP for 60 mm. Transfer to 50% ethanol and embed in paraffin. 3.3.1. Tissue Section
Treatment
1 Cut 5 pm wax-embedded sections, heat at 60-70°C for 3 min to ensure adherence. 2 Dewax and rehydrate 3 Rx in 0.1% glutaraldehyde
4 5. 6. 7. 8. 9
in PBS for 30 min at 4’C
Wash in PBS for 5 mm. Digest with 100 ug/mL DNase 1, or 200 pg/mL RNase A for 30 mm at 37°C. Wash in PBS for 5 min. Treat with 100 p.g/mL Proteinase K, 20 mM CaClz for 15 min at 37°C. Fix in 0.1% glutaraldehyde for 15 mm at 4’C. Rinse in 0.1X SSC.
Methods
to Detect
Virus
Nucleic
249
Acids
10. Acetylate for 10 min at room temperature. 11 Wash in 2X SSC. 12. Dram the slides, and apply probe directly. 3.4. Probe
Preparation
Although there are a number of factors, the major one that influences the sensitivity of ISH 1s probe specific activity. Thus, probe specific activities should be around 5 x 10*-l x log dpmlyg d radiolabeled probes are used, and show a corresponding level of nonradioactive tracer if nonisotopic procedures are used. It 1s a simple matter to calculate the specific activity of radiolabeled probes, and some effort should be made to ensure that nonradiolabeled probes are equally well labeled. In this section, we describe protocols to label DNA, RNA, or oligonucleotide probes with radioisotopes, digoxigenin (DIG) or FITC. 3.4.1. DNA Probe Preparation-Random
Priming
The random primed DNA labeling procedure permits the production of high specific activity probes, particularly from linear DNA molecules. The procedure will incorporate radioisotopes, DIG, FITC, or Biotm into the probe. 1. Prepare the following mixture: 1 pL of denatured DNA (25 ng/pL), 2 w of hexadeoxynucleotide mixture; 2 pL of 10X random priming reaction buffer, 2 pL of dNTP stock solution, 2.5 pL of a32P-dCTP (10 pCi/pL), 1 pL of Klenow (2 U/pL), and Double-distilled water to 20 pL. 2. Incubate at 37’C for 1 h, or overnight at room temperature. 3. Determine probe specific activity from acid-preclpitable Note 5). 4. Ethanol precipitate the probes at -20°C overnight 5. Wash three times m 70% ethanol 6. Dry and dissolve in TE8 3.42. RNA
counts (see
Probe Preparation
RNA probes are labeled m a transcription reaction using the Riboprobe Gemini System (Promega), or pBluescript (Stratagene, La Jolla, CA), that contam both SP6 and ‘IT, or T3 and T7 RNA promoters, respectively. 1. Lmearlze plasmlds contammg the desired inserts by digestion within the multiple clonmg site using restriction enzymes that would cut the plasmid once only. After confirming the digestions as complete by agarose gel electrophoresis, phenol extract and ethanol precipitate the DNA. Dissolve in TE8, to a concentration of 1 pg/pL.
Gowans
250
et al.
2. Prepare the followmg transcrrption reaction mix. This transcription reaction mrxture has been modified slightly to yield higher specific activity probes. 4 pL of 5X transcription reaction buffer; 2 pL of 100 mM DTT; 0 5 pL of RNasin, 40 U&L, 1.0 pL of 10 mM ATP; 1 .OPL of 10 mM GTP; 1 .O pL of 10 mM CTP, 2.4 pL of 100 @4 UTP, 1 .O j.tL of DNA template, 1 pg/uL; 1.5 j.tL of T7, T3, SP6 RNA polymerase (i.e., 20-30 U), 0.5 pL of either FTTC-UTP (250 pM), or DIG-UTP (250 p&f) or 5 j.tL of 32PUTP, or ‘251-CTP (see Note 6); 0.5 yL 32P-UTP (optional for trace labeling, see Note 7), and Double-distilled water to 20 pL. 3. Incubate at 37°C for 75 mm 4. Monitor the efficiency of the reaction by acid-precipitable counts from a 1 pL sample (see Note 5). 5 Add 1 U of RQl DNase, and incubate for 15 min at 37°C. 6 If shorter probes are needed, digest in 50 mM NaHC03, 50 mM Na2C03, pH 12.0 (final volume = 100 pL) for 5-15 min at 60°C. This time is determined empirically. Alkaline hydrolysis is stopped by the addition of 15 yL of 3M NaOAc, pH 4.6 7. Ethanol precipitate the probes at -70°C for 15 min (or overnight at -20°C) 8. Centrifuge at 22,000g 9. Wash the pellet three times with 70% ethanol to remove unmcorporated nucleotrdes. 10 Drssolve the dried pellet m 20 pL of TE8, and store at -70°C until use 3.4.3. Oligonucleotide
Probes
Oligonucleotide probes are convenient to use and provide raprd results, but suffer from lack of sensitivity. Ohgonucleotides can be labeled at the 5’ or 3’ end with a variety of recorder molecules including 32P,FITC, DIG and Biotm, either during or after synthesis. In this example, we describe the procedure to end label with 32Pusing T4 polynucleotlde kinase. 1. Prepare the following reaction mixture 1 pL of oligonucleotrde (0.15 pg/pL); 2 pL of 1OX kinase reaction buffer; 1 pL of T4 polynucleotide kinase; 5 pL of y-32P dATP; and llpLofH20. 2. Incubate at 37°C for 1 h 3. Check 32P incorporation by TCA preciprtation (see Note 5) 4. Ethanol precrprtate probe 5. Wash three times m 70% ethanol. 6. Dry and dissolve in TE8
Methods
1.
2. 3. 4. 5. 6.
to Detect
Virus Nucleic
Acids
251
3.5. Hybridization 3.5.1. DNA and RNA Probes Prepare the following probe mixture: 2-5 l.tL of concentrated stock probe (see Note 8), 67 PL of 1.5X FDST; Vortex, heat to 1OO’C for 5 min or 80°C for 2 min for DNA and RNA probes respectively, snap cool, then add; 20 ltL of 5X hybridization mix, 2.5 PL of 40 U&L RNasin; 1.O PL of 300 mM potassium iodide; 2.5 VL of 50 mg/mL nuclease-free BSA; 2.5 j,&L of 800 mM DTT; and Double-distilled water to 100 l.tL (see Notes 9 and 10). Prior to application of the hybridization mix to the tissue section, gently blow a stream of air to remove dust from the coverslip or the section. Pipet 2.5 yL of the above probe mixture onto the surface of the section Gently position a 13-mm sterile siliconized coverslip to prevent the formatton of air bubbles. Place the slides in a tray under paraffin oil for 1640 h at the optimal temperature. As a guide, 37°C is typical for DNA-DNA hybridizations, 42’C for RNADNA, and 50°C for RNA-RNA (see Note 11 for calculations). If the target and/or probe requires denaturation, then this can be achieved independently during probe and tissue preparation as described in Section 3 2.2., or at this stage by floating the tray on a boiling waterbath for 5 mm, then cooling to room temperature in the same manner prior to hybridization. If the target is RNA, then heating the tray to 60°C for 10 min is likely to increase the hybrtdization signal by melting the secondary structure.
3.5.2. Oligonucleotide Probes 1. Prepare the following probe mixture: 2-5 p,L of concentrated probe; 67 l.tL of 1.5 x FDST; Vortex, heat to 1OO’C for 5 min, snap cool, then add; 20 l.tL of 5X hybridization mix; 2.5 l.tL of SOmg/mL nuclease free BSA; 10 PL of 20x ssc; 2.5 PL of 800 mM DTT; and Double-distilled water to 100 l.t.L (see Note 12) 2. The assembled mixture is applied to the tissue section as described in Section 3 5.1., and hybridized under paraffin oil for 3-16 h. 3.6. Post Hybridization Washing 3.6.1. RNA and DNA Probes 1. Place the slides m slide racks to drain off oil for 5-10 min. 2. Remove excess oil by washing for two times for 10 min each in chloroform. 3. Air-dry the slides for 10-15 min (see Note 13).
252
Gowans
et al.
4 Transfer the slides to a large volume of 2X SSC (2-4 L/30 slides), and wash at room temperature until the coverslips come off (see Note 14). 5. Transfer the slides to fresh washing solutions. 2X SSC for two times for 1 h each, then 0.1X SSC for two ttmes for 1 h each (see Note 15) 6 Dehydrate the slides for autoradiography to detect radiolabeled probes or treat appropriately to detect bound nonradiolabeled probes. 3.6.2. Oligonucleotide
Probes
Treat sections hybridized prevrously with ohgonucleotide probes in a srmrlar manner to that described in Section 3.6.1., using modified wash solutions. Wash shdestwo times in 6X SSC for 1 h each, 2X SSC for 15 nun at 55”C, or at other appropriate stringency,then two times rn 2X SSC at room temperature for 1 h each. 3.7. Detection of Bound Probe 3.7.1. Radtolabeled
Probes
Autoradrography using nuclear emulsion is the usual method to detect bound radiolabeled probes. Detailed protocols for autoradiography have been published previously (1,2), and the theoretical aspects of the subject are covered comprehensively by Rogers (14). Briefly: 1 2. 3 4. 5. 6 7 8. 1. 2 3. 4 5. 6. 7 8.
Dilute Ilford K, emulston 1: 1 with 2% glycerol m disttlled water Melt at 45°C for 30 mm DIP the slides. Gel emulsion immediately by placing the slides on a cold plate for 15 mm. Dry flat on the bench for 2 h. Expose the slides at 4°C in a light-tight box. Develop and fix using commerctally available photographic reagents Counterstain (Section 3 7 4.). 3.7.2. DIG-Labeled Probes Transfer the slides from the final post hybridization washing step (steps l-5, Section 3.6 1 ) to TN m stammg dish for 5 min Remove the sltdes and incubate in TN containing 1% blocking reagent for 30 mm at room temperature Incubate the sections m alkaline phosphatase-conlugated sheep antIDIG (Fab fragment) m TN contammg 0 5% blocking reagent, for 30 mm at 37’C Remove unbound Fab fragments by washmg two ttmes for 15 min each tn TN Rinse the sections in 100 mM Tris-HCl, pH 9 5, 100 mM NaCl, 50 rnA4 MgCl*, for 5 min. Transfer to the DIG substrate solution for color development (see Note 16) Wash the slides thoroughly in tap water to stop color development. Counterstain with rapid hematoxylm (Sectron 3 7.4.) and view under aqueous mount. 3.7.3. FITC-Labeled
Probes
After the final post-hybrrdizatron wash (Section 3.6.1.), mount the slides in 90% glycerol-saline, 25 rnMTns-HCI, pH 8.8, and view with a UV microscope.
Methods
to Detect
Virus
Nucleic
Acids
253
3.7.4. Staining
Giemsa, methylene blue, or hematoxylin and eosin (H and E) can all be used to stain the tissue section after detection of the bound probe. We prefer to use H and E, but it is most important to avoid general hematoxylin solutions that can often lead to loss of silver grains after autoradiography. For DIG probes detected with DIG substrate solution as described in Section 3.7.2., or in experiments to detect viral antigen using DAB (Section 3.2.2.), the sections should be stained with hematoxylin only. The protocol for H and E staining is as follows: 1. Hematoxylin for 1 mm. 2. 3. 4. 5. 6. 7. 8 9.
Rinse in 0.1X SSC with agitation for 30 s Wash in 2X SSC for 15 mm. Dehydrate through ascending ethanol solutions to 100%. Dip in alcoholic eosin for 1 min. Rinse in 100% alcohol. Wash two times m 100% ethanol for 2 min each. Soak two times in xylene for 10 min each. Mount in DPX.
See Notes 17 and 18, for a brief discussion on types of controls, and on quantitation of the ISH experiments. 4. Notes 1. Glutaraldehyde activation of slides involves soakmg APES coated slides for 30 min in a 10% glutaraldehyde solution in double-distilled water, rinse twice in double-distilled water, and air-dry. 2. The concentration of proteinase K should be optimized and may depend on the length of time of formalm fixation 3 Paraformaldehyde may not be suitable for all viral antigens Suitable alternatives may be substituted (e.g , glutaraldehyde and methyl carnoys). 4. Viral antrgen appears as a brown DAB reaction product, and viral RNA is detected by autoradrography after ISH with 1251-labeled probes 5. The efficiency of all radiolabeled reactions can be determined by measuring the incorporation of radiolabeled nucleotides by trichloroacetic acid (TCA) precipitation. This is carried out by spotting 1 lrL samples of the reactron mix onto two pieces of Whatman 542 filter paper. One filter is washed for 5 min in ice-cold TCA in double-distilled water. The second filter is allowed to air-dry Both filters are counted and the reaction efficiency calculated 6. When ‘251-CTP 1s used, then the concentration of cold UTP and CTP should be reversed. 7. “Specific activity” of nonisotopic probes: It is vital to ensure that nonisotopic probes are actually labeled This can be determined by making a series of dilutions of the probe and assaying the level of the label, e.g., DIG, FITC m these dilutions. Although this will provide the required data, the procedure is mconvenient and time-consuming. For this reason, we prefer to add a trace amount of
254
8. 9.
10.
Il.
12
13 14.
Gowans et al. 32P-UTP to reactions in which FITC-UTP or DIG-UTP is used to label the RNA. In the reaction described above, the ratio of FITC-UTP: 32P-UTP is approx 3000: 1. Consequently, by calculation, each microgram of synthesized RNA will contain 8.5 x lo4 dpm if FITC-and 32P-labeled UTP are mcorporated with equal efficiency, and the level of 32P-UTP alone is sufficient for the synthesis of -2 ng RNA. Since a level of 32P incorporation of -50% can be achteved after 75 min at 37”C, it can be determined that -3 ltg of RNA is synthesized. Therefore, tt follows that a high proportion of the available FITC-UTP has been incorporated This mtxture should contain 40,000 cpm@L (32P, t251-labeled probes) or lo-50 ng@L of FITC or DIG-labeled probes. The final probe mix contains 50% deionized formamide, 2X SSC, 50 mM TrisHCl, pH 7.6, 10 mM NaH2P04, 10 mM Na2HP04, 0.02% Ficoll, 0.02% polyvinyl pyrrolidine (PVP), 10% dextran sulfate, 500 pg/mL sheared denatured salmon sperm DNA, 500 pg/mL tRNA, 3 mA4 potassium iodide, 20 mM DTT, 1.25 mg/ mL nuclease free BSA, and 1 U@L RNasm. RNasin IS omitted from the DNA probe mixtures and potassium iodide is only necessary if ‘251-labeled probes are used. Unless 35S-labeled probes are used, DTT is not absolutely necessary. DTT may lead to loss of the tissue section from the slide, although this is less likely to occur with formalin-fixed tissue sections than with frozen sections or cell cultures. The optimum temperature for hybrtdization has been determined to be approx Tm-25’C (see ref. 20 for review) Although this can be determined empirically for each probe/target, a theoretical calculation can be made based on the nucleic actd sequence. The figures are calculated as follows: For DNA: DNA hybrids (ref II), T, = 16 6 log [Na’] + 0.41 [%G + C] + 8 1.5 - 0.72 [%FA]; For RNA: RNA hybrids (ref. Z2), T, = 18 5 log [Na+] + 0.584 [%G + C] + 79.8 + 0 0012 [%G + Cl2 - 0.35 [%FA]; For Oligonucleotide hybrids (13), T, = 16.6 log [Na+] + 81.5 + 0 41 [%G + Cl-% of mismatches - 675/probelength (bp) - 0.65 [%FA]; [Na+] = sodium ion concentration, where 2X SSC = 0.33M, %G+C = percentage guanosine + cytosme residues in nucleic acid; %FA = percentage formamide m hybridization mix; and T ,,, = temperature at which half of the hybrid dissociates The final probe mix contains 4X SSC, 50 mM Tris-HCl, pH 7.6, 10 mM Na2HP04, 10 mM NaH,PO,, 500 l.tg/mL sheared denatured salmon sperm DNA, 500 l.rg/mL tRNA, 0.02% Ficoll, 0.02% PVP, 1.25 mg/mL nuclease free BSA and 10,000 cprn&L of radiolabeled oligonucleotide probe. At this stage, the covershps should still be firmly m position. A few coverslips are lost occasionally, and if the losses become unacceptable, it is likely that the volume of hybridization probe mix applied to the section was too high. If ‘251-labeled probes are used then 100 p&f potassium iodide should be included in the wash, and for 35S-probes, 1% sodium thiosulfate and 14 mM 2-mercaptoethanol are included. The addition of these reagents has been shown to reduce the level of background
Methods
to Detect
Virus
Nucleic
Acids
15. A high stringency wash should be included in 0.1X SSC at temperatures between 50-70°C depending on the type of probe and the target G + C content (see Note 11 for calculations). 16. The rate of color development depends on the amount of alkaline phosphatase bound to the section and development times should be optimized for individual systems 17. Controls: ISH is a powerful technique to detect nucleic acid molecules at the level of the single cell. However, the method has a high potential for artefacts and nonspecific signals, and great care should be taken to ensure that adequate controls are used (I). Some key controls are: uninfected tissue sectlons, control probes, nuclease digestions prior to hybridization (RNase or DNase), post-hybridization melt curve, and saturation of the probe with specific viral nucleic acid sequences prior to hybridization. 18. Quantitation: We have not discussed aspects of quantitation, since these topics have been discussed previously (1) However, since most proponents of the technique still agree that radiolabeled probes are most sensitive, then If nonradiolabeled probes are used to detect low genome copy numbers, some consideration should be given to prove the sensitivity in a known or model system, m order to maintain credibility
Acknowledgments Much of this work was supported by grants from the National Health and Medical Research Council of Australia. Keril Blight and Jane Arthur are Dawes Scholars supported by the Royal Adelaide Hospital. We are most grateful to Charli Bayley for the preparation of the manuscript. References 1. Gowans, E J., Jllbert, A R , and Burrell, C J (1989) DetectIon of specific DNA and RNA sequencesIn tissuesand cells by m srtu hybridlzatlon, In Nuclerc Aad Probes (Symons,R H., ed ), CRC, Boca Raton, FL, pp, 130-158. 2 Gowans, E. J (1992) Autoradiographic detection of radiolabeled probes by rnsitu hybridization Liver 12,238-242 3. Maples, J A. (1985) A methodfor the covalent attachmentof cells to glassslidesfor immunohistochemlstry assays.Am. J. Clin. Puthol. 83,356-363. 4 Hayashi,S., Gillam, I. C , Delaney,A. D., andTener,G M. (1978)Acetylatlon of chromosomesquashes of drosophilamelanogaster decreasesthe backgroundrn autoradlographsfrom hybrldlzatlon with ‘251-labeled RNA. J. Hlstochem. Cytochem 26,677-679 5 Gowans,E. J , Baroudy, B. M , Negro,F., Ponzetto,A , Purcell, R. H , and Gerin, J L (1988)Evidencefor replicationof hepatltlsdeltavirus RNA m hepatocytenuclei after rn vlvo mfectlon. Vwology 167, 274-278, 6 Gowans,E. J., Burrell, C. J , Jilbert, A. R., andMarmion, B. P (1985)Cytoplasmic(but not nuclear)hepatitisB virus (HBV) coreantigenreflectsHBV DNA synthesisat the level of the infectedhepatocyte.Intervwology 24,220-225. 7 Simmons,A. and Nash,A A. (1984) Zosteriformspreadof herpessimplex virus asa modelof recrudescence andits use to investigatethe role of immunecellsm preventionof recurrentdiseaseJ Vlrol 53,944-948. 8 Speck,P. andSimmons,A, (1991)Divergentmolecularpathwaysof productiveandlatent infection with a virulent strainof herpessimplexvirus type 1 J. Vlrol 65,4OOlAOO5
Gowans
et al.
9 McLean, I W and Nakane, P K (1974) Periodate-lysme-paraformaldehyde frxatrve. A new frxatrve for rmmunoselection microscopy. J Histochem Cytochem 22, 1077-1083 10 Britton, R J. andDavrdson,E. H (1986)Hybridization strategy,m Nuclerc Acid Hybndrzatlon. A Pructuzl Approach (Rtckwood,D andHomes,B D , eds), IRL, Oxford, UK, pp. 3-15 11. Howley, P M , Israel, M A, Law, M., and Martin, M. A (1979) A rapid methodfor detectmgandmappmghomologybetweenheterologous DNAs J. Bzol. Chem. 254,48764883 12 Bodkm, D. K. andKnudson,D. L. (1985)Sequencerelatedness of Palyamvuus genesto cognatesof thePalyamserogroupvirusesby RNA-RNA blot hybridrzatlon.Vwology 143, 55-62. 13 Davrs, L G., Dibner, M D , and Battey, J F. (1986) Hybrrdrzation wrth synthetrcendlabelledprobes,m Basic Methods rn Molecular Biology, Elsevrer, New York, pp 7578. 14 Rogers,A. W (1979)Techmquesfor Autorudrogruphy, 3rd ed , Elsevrer,North Holland.
CHAPTER 22
Sensitive Immunocytochemical Detection of Viral Genomes Alison
Boulter
and Chong
Gee Teo
1. Introduction Detecting viral infections depends largely on serological methods to demonstrate the presence of viral circulating antibodies and molecular techniques to identify viral genomes in tissue extracts. Although sensitive, none of these provides the simultaneous morphological information that is unique to techniques related to in situ hybridization (ISH) for locating viral genomes or immunocytochemistry for locating viral antigens (1-3). Rapid advances in the methods of viral probe preparation and probe labeling allow the routine use of ISH m laboratories of many specialties. The technique is further facilitated by the commercial availability of nonradioisotoprc labeling kits and prelabeled viral probes. One potential drawback of nonisotopic ISH has been the relative lack of sensitivity; until recently, it was only possible to detect multiple copies of viral genomes. Nomsotopic ISH can, however, be made as sensitive as isotopic ISH if immunocytochemical amplification systems are used. The following protocol is based on biotm-labeled DNA probes for the detection of small copy numbers of double stranded viral DNA genomes m cytospun cell chromosome preparations and frozen tissue sections. Adaptions to the protocol for detecting other forms of viral genomes and demonstrating viral genes in routmely fixed archival tissue sections are also discussed. 2. Materials 2.1. Equipment 1 2. 3. 4 5. 6. 7.
Magnetic stirrer and flea. Glasscoverslips. Parafilm Hot air oven. Hot water bath. Damp incubation chamber. Rubber solution (e g., Vulcanizing rubber solution, Weldite Products, South Humberside, UK). 8. Slide forceps and blunt endedforceps. From Edlted
Methods II) Molecular Biology, Vol 33 In SW Hybnduallon Protocols by K H A Choo CopyrIght Q 1994 Humana Press Inc , Totowa, NJ
257
Bouher
258
and Teo
9. Slide rack. 10 Glassware* Coplin jars, staining troughs, Il. Cytospin centrifuge All organic chemicals otherwtse stated.
2.2. Reagents are purchased from Sigma (St. Louis,
MO) unless
1. Avidm biotin complex (ABC) (Vector, Burlingame, CA). Prepare as kit instructions. 2 Bovine serum albumin (BSA). Store at 4°C. Make the following solutions Just before use: a 1% BSA solution* 1% BSA in 0 1% Triton-X lOO/PBS, b. 3% BSA solution and dilutmg solutton for rabbit antrgoat IgG and goat antibiotin antiserum: 3% BSA in 0.1% Tnton-X loo/PBS. 3 Btotinylated rabbit antigoat IgG antiserum (DAKO). Store neat at 4°C and dilute Just before applicatton. Dilute 1500 in 3% BSA/O.l% Triton-X loo/PBS. 4. 20 l.tg/mL Biotmylated viral DNA probe Store at -20°C Use 2-20 pL/lOO pL hybridization mixture (see Section 2.4.). 5. Chrome alum 6. 10 mg/mL 3’,3’-Diaminobenzidme (DAB). Store at -20°C. Just prior to use, dilute to 1 mg DAB/mL in 0.05M Tris-HCl, pH 7 4, and activate DAB solutton with hydrogen peroxide (1 pL/mL DAB) 7. 50X Denhardt’s solution 1% Polyvmylpyrrolidone, 1% Ficol, 1% BSA. Aliquot, and store at -20°C 8. Dextran sulfate: 50% (w/v) m distilled water. Store at 4°C. 9 DP-X 10 Ethanol serves: 35, 70, and 100% ethanol 11. Formamide: Deionize and use neat. Aliquot, and store at -20°C. 12 Gelatin. 13. Glycine: 2 mg glycme/mL PBS Make just prior to use. 14 Goat antibiotm antiserum. Aliquot, and store at -20°C. Dilute to 1.5000 in 3% BSA/O.l% Triton-X lOO/PBS 15. Harris hematoxylin. Use at half strength, filter before use. 16 1M HCl Dilute to 0.02M just before use. 17. 10 ng/mL Sonicated Herring sperm DNA Store at 4°C. 18. Hexamme 19. Hydrogen peroxtde 20 Methanol 21. 4% Paraformaldehyde in PBS Make fresh, solution will remam stable for 1 wk 22 4 mg/mL Pepsin in 0 OlM HCl Aliquot, and store at -2O’C 23 Phosphate buffered salme (PBS) 24 Potassium dichromate. 25. Pronase. 2 5 mg/mL in 0 05M Tris-HCl, pH 7.6, 5 mM EDTA. Store at -20°C Dilute to 0.25 mg/mL in same buffer prior to use. 1 mL of pronase at working concentration is sufficient for 10 dual spot slides when spotted using a Pasteur pipet
Detection
of Viral
259
Genome
26. 1 mg/mL RNase A Store at -20°C. Dilute to 100 pg/mL m drstilled water JUSt before use. One milliliter of RNase A at working concentration IS sufficient to cover 10 dual spot slides when applied usmg a Pasteur prpet. 27. Silver nitrate 28 0.02% Sodium gold chloride 29 Sodium phosphate 30. Sodium tetraborate. 31. 5% Sodium thiosulfate. 32. Sulfuric acid. 33. 20X SSC. 3M NaCl, 0.3M sodium citrate, pH 7.0. Store at room temperature. 34. Triton X-100 35. Xylene.
2.3. Solutions
for Gelatin-Chromealum-Coated
1. Solution A: Potassium dichromate Distilled water Sulfur-m acid
Slides
5og 425 mL 50 mL
Make fresh. Dissolve drchromate in water at 30°C Carefully add acrd Raise mixed solution to 60°C. 2. Solution B. Gelatin 2.5 g 500 mL Distilled water Chrome alum 1.25 g Dissolve with gentle heat (37°C)
2.4, Hybridization
Mixture
Stock concentration Deronized formamide ssc NaH,P04 Denhardt’s solution Herring sperm DNA Dextran sulfate Probe Distilled water-Add
100% 20x 1M 50 x 20 vg/mL 50% (w/v) 20 pg/mL
Final concentration
100 p.L 20 PL 5w 8 PL 2.5 PL 40 PL 2-20 /JL
50% 2x 25 mA4 2x 250 pg/mL 10% w/v 0.2-2 pg/mL
to make final volume 200 j.tL
2.5. Methenamine Stock solution: Silver nitrate Hexamine Distilled water
Volume
0 125g 1.5 g 100 mL
Store at 4°C. Protect from hght.
Silver
Solution
Boulter
260
and Teo
3. Methods 3.1. Preparation and Cytospun
of Frozen
Sections
Preparations
1. Coat slides to be used for secttons and cytospun cells with gelatin-chrome alum as follows a. Place cleaned, frosted slides in staining racks. Rinse in tap water. b. Make solutions A and B, as described m Section 2.3 c. Agitate shdes in solution A at 60°C for 1 min. d. Wash in running tap water for 2 min e Rinse m distilled water. f. Agitate in solution B at 37°C for 10 s. g Shake slides hard of excess solution and drain at an angle of approx 45” h Dry at 37OC overnight, or 60°C for about 1 h. Ensure that the slides are stacked with frosted end down so excess solution drams toward the labeling area rather than area to which the section/cells will be applied. 2 Fix cut frozen sections, chromosome spreads, or cytospun preparations in paraformaldehyde for 30 min. 3 Wash twice in PBS for 5 min each. 4. Dehydrate through an ethanol series, i.e., successively at 35, 70, and 100% ethanol
3.2. Endogenous 1. 2. 3 4
A11 washes
6. 7. 8 9. 10. 11 12.
Blocking
Place dehydrated slides in 0.3% hydrogen peroxide m methanol for 30 mm. Wash in 100% ethanol for 5 min. Rehydrate through ethanol series (as above) Wash in distilled water for 5 mm.
3.3. Unmasking 1. 2. 3. 4. 5.
Peroxide
are performed
of Nucleic
m a magnetic
Acids
stirrer.
Wash in 0 02M HCl for 10 min. Wash twice in PBS for 5 min each (see Note 1). Soak in 0.01% Triton X-100 in PBS for 1 min Wash twice in PBS for 5 min each. Drain and remove excess PBS (see Note 2) Spot Pronase onto slides using a Pasteur pipet (one drop/section), and incubate for 3-4 min at room temperature (see Note 3) Wash twice in glycine/PBS for 5 min each Spot RNase A onto slides using a Pasteur ptpet, cover with parafilm, and incubate in damp chamber for 1 h at 37’C (see Note 4) Wash slides twice in PBS for 5 min each (Parafilm will float free from slides during the first PBS wash.) Fix m 4% paraformaldehyde for 5 mm. Wash twice in glycine/PBS for 5 mm each. Dehydrate through ethanol series Allow slides to dry at room temperature, and prepare hybridtzation mixture (see Sectton 2 4.)
Detection
1. 2. 3. 4. 5. 6 7. 1 2 3. 4. 5. 6 7.
of Viral
Genome
261
3.5. Hybridization Apply hybrldlzatlon mixture to each cell spot/section. (10 PL is adequate for an area under a 22 x 22-mm coverslip.) Cover with coverslip. (Bubbles in the mixture may first be pricked with a corner of the coverslip before placement ) Seal edges with rubber solution Allow to dry for l-2 min Place slides on a metal tray. Place in an hot air oven preset at 95-100°C. Incubate for 10 mm (see Note 5). Cool slides rapidly by taking metal tray from the oven and placing immediately on ice Incubate overnight at 37-42”C m a damp chamber (see Note 6) 3.6. Posthybridization Washing (see Note 1) Peel off rubber from coverslips using a pair of blunt-ended forceps. Soak slides in 2X SSC to allow coverslips to detach. Wash in 2X SSC for 10 mm at room temperature. Repeat twice Preheat 2X SSC to 60°C on a hot plate. Maintain temperature on a heated magnetic stirrer Wash slides for 30 min. Preheat 0 2X SSC to 42°C on a hot plate. Maintain temperature on a heated magnetic stirrer Wash slides for 30 min. Wash m 1% BSA solution for 5 min. Block with 3% BSA solution for 15 min Dram and dry off excess solution.
3.7. Detection of Biotinylated Probes (see Note 7) 1. Dilute goat antlbiotin antlserum spot onto slides (one drop/section) using a Pasteur plpet (1 mL 1ssufficient for 10 dual spot slides), cover with parafllm, and incubate at 37°C for 1 h m a damp chamber 2. Wash two times in 1% BSA solution for 5 min each 3 Dilute biotinylated antigoat IgG spot onto slides using a Pasteur plpet, cover with parafilm, and Incubate at 37°C for 30 mm in a damp chamber 4 Prepare ABC for use 30 min later. 5 Wash slides two times in 1% BSA solution for 5 min each. 6 Spot ABC onto slides, cover with parafilm, and incubate at 37°C for 1 h m a damp chamber. 7. Wash twice in PBS for 10 mm each. 8 Dilute DAB, and activate by adding hydrogen peroxide. 9 Incubate slides for 5 min 10. Stop reaction by washing twice in PBS for 5 mm each 3.8. Methenamine Silver Intensification 1. Heat stock solution (see Section 2.5.) in a Coplin Jar to 60°C in water bath (Protect from strong light). 2. Wash slides two times in dlstilled water for 5 mm each 3 Add 2 mL of 5% sodium tetraborate to every 50 mL of stock solution Mix. 4 Incubate slides in above solution for 3-5 mm (Intensification can be monitored under a microscope, but wash slide thoroughly in dlstllled water before replacing m solution) (see Note 8).
262
Boulter
and Teo
5 Rinse in distilled water. 6. Ax m 5% sodium thiosulfate 7 Wash twice in distilled water for 5 mm each.
3.9. Counterstaining
and
Mounting
1. Counterstain with half strength Harris hematoxylin (filter before use) for 15-20 s. (Chromosome spreads may need other staining methods--see other chapters ) 2. Rmse m tap water 3. Dehydrate, clear, and mount in DP-X.
3.10. ISH on Formalin-Fixed Archival Tissue Sections Below is a brief protocol, after Burns et al. (5), of prehybridization treatment formalin-fixed, paraffin-embedded trssue sections (see Note 9). 1 2 3 4. 5. 6
for
Deparaffinize three times in xylene for 10 mm each Wash m absolute ethanol for 10 min. Block endogenous peroxidase as before. Digest with pepsin for 60 mm at 37T. Wash twice m PBS for 5 min each. Proceed with the RNase step as before, and continue with the protocol previously described.
3.11. Automation The many steps required for nonisotopic, immunochemrcal detection of very small copy numbers of viral genomes can be tedious, as this chapter shows. It is nevertheless feasible to automate such a process. Several machines for automating immunohistochemistry are commercially available, and it is possible to adapt these to ISH. More recently, mechanical systems dedicated to automatmg the entire ISH process have also been described (9,IO)
4. Notes 1. Washing is time-consuming but necessary, in order to keep background staining to a minimum. Although we use a heated magnetic stirrer, any gentle form of mechamcal agitation can be substituted However, a shaking hot water bath is recommended for the posthybridization washes By preheating the SSC to 60 and 42T on a hotplate, we are able to maintain the temperature quite satisfactorily on the heated magnetic stirrer. It 1s important that the magnetic flea is not spun at too high a speed as the secttons are easily dislodged from the slides, parttcularly during the 60 and 42°C posthybrtdization washes 2 After washing and before the application of the next enzyme/blockmg agent/ antibody, excess fluid should be removed from the shde by gently wiping around the sections with ttssue. Location of the section can be difficult when wet and it 1s helpful to mark out where the section is on the underside of the slide with a diamond or wax marker-this avoids inadvertent removal of the section and ensures that a small amount of solution remains to prevent drying of the section. Usmg a diamond marker on the top surface of the slides causes minute particles
Detection of Viral Genome
3
4.
5.
6.
7.
8. 9.
of glass to get caught in the section resulting in an embarrassingly “dirty” field when viewed through the microscope. To obtain high levels of sensitivity, It is necessary to optimise tissue digestion to reveal all hybridization sites The duratton of digestion is related to the extent of tissue fixation, which in archival tissue will vary substantially. A range of digestion times or concentrations needs to be pretested. When incubating with reagents, ensure that it occurs in a moist environment. We fmd reduced signal when slides are incubated in dry heat despite being covered in parafilm, and placed m a covered chamber. The denaturation temperature is crucial We have found hot air ovens the most reliable and controllable It is advisable to preheat the metal tray in the oven before placing the slides so that the desired temperature is reached almost instantaneously. Slides on a cold tray in a noncirculating oven may not reach 951OO’C during the first few minutes, thereby reducing the actual denaturation time. The denaturation step is, of course, not required if the targets are smglestranded RNA genomes or viral mRNAs, and if single stranded RNA or DNA probes are used. Hybridization need not be done overnight. Some successful protocols hybridize for only 2-3 h. We find an overnight hybridization convenient when a multitude of posthybridization washing and immunochemical detection steps is required In this protocol, a three-layer immunoperoxidase amplification system is used, which is followed by silver intensification. The concentrattons of the antibodies used are variable and a range of concentrations should first be tried to gain maximum sensitivity and minimum background. The methenamine-silver technique of intensifying polymerized DAB (4) is far simpler than commercially available kits and produced in the authors’ hands less background staining even with high concentrations of primary and secondary antibodies. If slides are overstained, “tone” m 0.2% sodmm gold chloride for 30 s before fixing in sodium thtosulfate Formalin fixation can prevent the full unmasking of target genomes for subsequent ISH detection, which presumably occurs because of the formation of methylene cross bridges in nucleic acids and nucleoproteins (6). This effect can be partially offset in the case of double-stranded DNA targets by mtroducmg microwave irradiation in the denaturation step. Domestic microwave ovens can be used (7), but ovens dedicated to histological work are also available (8) and these, too, may be utilized.
References 1 Haase, A., Brahic, M., Stowring, L , and Blum, H. (1984) Detection of viral nucleic acids by w situ hybridization Meth Virol 7, 189-226. 2. Haase, A. T. and Oldstone, M. B A. (eds.) (1989) In situ hybridization Curr Topics Microbial
Immunol. 143, l-87.
3. Teo, C. G (1990) In sztuhybridization in virology, in In Situ Hybrtdizatlon. Pnnclples and Practwe (Polak, J M. and McGee, J. O’D , eds ), Oxford University Press, Oxford, Oxford, pp. 125-148
Boulter and Teo 4 Peacock, C. S , Thompson, I W , and van Noorden, S (1991) Srlver enhancement of polymerised drammobenzidme increased sensitrvity for rmmunoperoxidase stammg J Clm Pathol. 44,756-758 5. Burns, J , Redfern, D R M , Esrrr, M. M , and McGee, J. O’D (1986) Human and viral gene detection m routme paraffin embedded tissue by m sttu hybrrdizatron wrth brotmylated probes vrral locahzatron in herpes encephalitis. .l Clm. Path01 39, 1066-1073 6 Feldman, M. Ya. (1973) Reactions of formaldehyde wrth bases, nucleosrdes and nucleotrdes Prog. Nuclerc Acids Res Mol. Bzol. 13, l-48 7 Teo, C G and Grrffin, B. E (1990) Vrsuahzatronof singlecopiesof the Epstem-Barr virus genomeby tn situ hybridrzation.Analyt. Biochem.186, 78-85. 8 Boom,M. E and Kok, L P (1987)Microwave CookbookofPathology CoulombPress Leyden, Leiden,pp 132-142 9. Unger, E R. andBrigati, D J (1989)Colorrmetricrn situ hybridization in chnical vrrology* developmentof automatedtechnology Curr Top Mtcrobrol. Immunol.143,21-32 10. Takahasht,T andIshrguro,K. (1991)Developmentof an automatedmachmefor in srtu hybridization andimmunohrstochemistry. Analyt. Blochem 196,390-402.
CHAPTER 23
Primed
In Situ (PRINS)
Labeling
of RNA
Jens Mogensen, Seren Pedersen, Johnny HindIqjzw, Steen K#lvraa, and Lars Bolund 1. Introduction It has been possible for a number of years to detect RNA in situ in fixed cells or whole tissue-sections by the use of cloned probes (14). The probes are labeled either with radioactive nucleotides or modified nonradioactive nucleotides, such as biotinylated dUTP, which can be visualized by fluoresceinconjugated avtdin. RNA-studies by this strategy have the advantage of being very sensitive, and give a quantitative impression of the variations in RNA contents in the cells/tissue sections studied. However, it is not possible to study closely related RNA populations by these methods because the probes used are generally long and do not allow the detectron of small differences, such as single base mutations or minor splicing-errors. Such a detection is made possible by the recently described “in situ transcription” (IST) method involving the direct synthesis of a first strand cDNA in situ (7-10). In this method, labeling IS achieved by annealing unlabeled short oligonucleotides to the target RNA and using these as primers for chain elongation in a reaction catalyzed by AMV-reverse-transcriptase in the presence of radioactive nucleotides. The principle of the PRimed IN Situ method of labeling RNA (RNA-PRINS) described in this chapter is similar to IST except for the use of nonradioactive nucleotides as substrate for AMV-reverse-transcriptase (5). We have found by chance that biotin-labeled nucleotides can serve as very good substrates for this enzyme when the usual reverse transcriptase buffer is replaced by a nicktranslation buffer. We have also shown that the recently developed fluorescein-conjugated nucleotrdes can be used as an alternative substrate which allows direct visualization and thus offers a simpler procedure (6). One major advantage of RNA-PRINS over IST is the better resolution obtained, which makes it possible to study signal localization and cell structure at the same time. Furthermore, the method is faster, more gentle to the cell structures, and abolishes any health hazards associated with the use of radioactive nucleotides.
From Edited
Methods UI Molecular Biology, Vol 33 In S~tu Hybrrdrzafron Protocols by K H A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
265
266
Mogensen
et al.
For use on cells fixed on slides, we have developed our method m a homogeneous mouse myeloma cell system with posrtrve and negative control cells differing only by one well characterized genetic trait. Initially, a general staming of all polyadenylated mRNA present in the cells is made using a poly-Tprimer in a one-step procedure. The purpose of this step is to optimrse the technique, and to ensure that cellular mRNA is present in the cells and not lost during preparation. To obtain a specific labeling, a two-step procedure is necessary, because AMV-reverse-transcriptase is a thermolabile enzyme with an optimum reaction temperature of 42°C. In this two-step procedure the primer is first hybridised at a high designated temperature to achieve specific annealing, followed by a stringent wash. After this, cham elongation is performed at a temperature of 42°C. Protocols for the one- and two-step procedures are given in Section 3.1,) and the results of a typical experiment are depicted in Fig. 1 (poly-T) and Fig. 2 (specific primer). The PRINS technique has also been applied to cells in suspension, and opens up the possibility for flow cytometric detection of specific mRNA signals. In this application, single cells m suspension are fixed with paraformaldehyde and ethanol, in order to preserve mRNA species m the cells and srmultaneously make them permeable to the reagents used in the PRINS and staining reactions. After denaturation and quenching of the target mRNA the cells are ready for the RNA-PRINS procedure. As with cells fixed on slides, total polyadenylated mRNA species are labeled in a one-step procedure, whereas a specific mRNA (here illustrated with mouse kappa light chain mRNA) is labeled in a two-step procedure. Both drrect (fluorescein-1ZdUTP) and indirect (bio- 1l-dUTP) labeling are used in conjunction with the flow cytometric technique. A mouse myeloma cell line (X63Ag8), known to express the kappa light chain mRNA is used as a positive control, whereas a mouse T-cell lymphoma cell line (BW 5147), is used as a negative control. The detailed protocols for both the one-step and two-step procedures are given in Section 3.2. and typical examples of the resulting separation of flowsorted cell populations are shown m Figs. 3 and 4. The results indicate a clear separation between cells labeled with the poly-T-primer and cells labeled m the absence of this primer. Furthermore, although a clear separation is not seen between cells labeled with a specific primer and control cells labeled with nonspecific primer’ a significant shift in the fluorescence peaks is apparent. 2. Materials 1. Cell lines. In the shde technique, a mouse myeloma cell line (X63Ag8) (12) is used as the negative control whereas the same cell lme transfected with a stably integrated Nk globm plasmrd construct is used as the positrve control (X63Ag82-59) (13) The mRNA of the /3-globin gene in the construct serves as a marker for the transfected cells and is identified in a two-step procedure using a specific
PRINS Labeling
of RNA
267
Figs. 1 and 2. (Fig. 1) Standard UV-fluorescence microscopy pictures of slides containing fixed X63Ag8 cells stained by a one-step RNA-PRINS with poly-T primer and bio-1 I-dUTP as substrate. Nuclei are counterstained with propidium iodide (a) Incubation for 90 min, in the standard reaction mixture. (b) Is identical to a except that the unlabeled deoxynucleotides are replaced by di-deoxy-nucleotides. Refer to Section 2. for definition of the cell line and various reagents. Reproduced from Mogensen et al. Exp. Cell Res. 196 (1991) 92-98, Academic Press, Inc. (Fig. 2) Confocal laser scanning pictures of cells fixed on slides and stained in a two-step RNA-PRINS procedure using specific primer and bio-1 I-dUTP as substrate. Nuclear counterstaining is not performed. The pictures are in artificial colors depicting the intensity of fluorescein labeled avidin fluorescence. (a) Transfected cells, X63Ag8-2-59, hybridized with primer 114 at 70°C. (b) Untransfected cells, X63Ag8. hybridized with primer 114 at 70°C. Refer to Section 2. for definition of cell lines and reagents. Reproduced from Mogensen et al. Exp. Cell Res. 196 (1991) 92-98. Academic Press, Inc.
268
Mogensen et al.
131 Fig.
3
X63Ag8 - poly-T
-pr~aer
primer
Figs 3 and 4 (Fig. 3) Flow cytometrm fluorescence detectron after one-step poly-T primed mRNA labelmg Two histograms representing the fluorescence drstrrbutron of two different samples of X63Ag8 cells are shown In the posrtrve control (+ poly-T primer) a clear increase in the fluorescence mtenstty is seen, when compared to the control sample (- poly-T primer) where the primer has been excluded from the reactron mixture (Fig. 4) Flow cytometric detection of speclfm kappa light chain labeling The two-step RNA-PRINS procedure IS used in the labeling of X63Ag8 cells, known to express the kappa light chain mRNA (+ primer). Two controls are used here In one, the same cells are used in a labeling reaction where the primer has been excluded (X63Ag8 - primer) In the second control, a cell type known not to express kappa light chain mRNA IS subjected to RNA-PRINS with the kappa light chain primer (BW 5147 + primer)
2. 3. 4
5.
6
primer. Cells are grown m RPM1 1640 medium supplemented with 10% fetal calf serum (13). Slides: Flow multitest slides, 10 wells (Flow Labs, McLean, VA) The slides are supphed with a teflon coatmg which surrounds the wells where the cells are applied Coverslips for mcubatlon: These are cut out from a “plastic-pocket” and the inside to be used face down to the cells (see Note 1). Primers: A poly-T primer with a length of 37 nucleotides, is used for the general staining of mRNA in the one-step procedure, both on cells fixed on slides and on cells in suspension The specific primer no 114 (S-TTG TGA GCC AGG GCA TTG GCC ACA CCA GCC-3’) used m the two-step procedure to detect the NK globin mRNA m cells fixed on slides corresponds to a sequence downstream of the beta-globin coding sequence in the transfected cells (X63Ag-8-2-59) and gives a cDNA of the expected length upon primer extension. The mouse kappa light chain primer (S-ATG GGT GAA GTT GAT GTC TTG TGA GTG GCC) 1s used to detect mRNA in cells in suspension. All primers are synthesized with an Applied Btosystem DNA synthesis machine l-cyclohexyl-3-(2-morphol~noethyl)-carbod~im~demetho-~-toluenesulfonate (WSC, Sigma) and concanavalin A (Con A, Sigma, St Louts, MO) are used for coating the slides
PRINS
Labeling
of RNA
269
7. Bio-1 I-dUTP (Sigma) (14) 8. Unlabeled dATP, dCTP, dGTP, and dTTP (Boehringer Mannheim, Mannheim, Germany). 9 Fluorescein-labeled avidin DCS (Vector Laboratories, Burlingame, CA) 10. Fluorescein-12-dUTP (Boehringer Mannhelm). 11. RNase inhtbrtor RNase block II ribonuclease mhtbttor (Stratagene, LaJolla, CA). 12. AMV reverse transcriptase (Boehringer Mannhelm). 13 Paraformaldehyde. 14. Propidium iodide. 15. Antifade solution* 1 l.rg/ltL p-phenylenediamme dihydrochloride m glycerol/ PBS (9/l) 16. Deionized formamide. 17 Absolute alcohol 18. Demineralized water. 19. Detergent, such as deconex for cleaning slides. 20. Tween 20. 21. 0.2M Tris-HCl, 0.1M glycine, pH 7.4. 22. 1X SSC: 150 mM NaCl, 15 nuI4 sodium crtrate, pH 7.0. 23 Hanks balanced salt sol&on (HBSS), pH 7.2 (Gibco BRL, Garthersburg, MD) 24. Nick-translation (NT) buffer 50 mM Tris-HCl, pH 7.2, 10 mM MgS04, 100 pM dithrotrettol, 150 l.tg/mL bovine serum albumin. 25. BN-buffer: 100 mM NaHCOa, pH 8.0, 0.01% Nonidet P-40. 26. Blocking solution. 5% powdered milk in BN-buffer (centrifuge for 15 min and use only the supernatant) 27 Equipment. waterbath, heat mcubator, and humidified chambers
3. Methods
1
2
3. 4 5. 6. 7 8
3.1. RNA-PRINS of Cells Fixed on Slides 3.1.1. Preparation of Slides Coated with Cells Cleaning of slides Before use, wash slides in boiling water with detergent for 5 min, rinse in cold water for 10 min, then rinse in demineralized water for 10 mm, and briefly in absolute alcohol. Finally, bake the slides at 160°C for 4 h. These steps are carried out to eliminate RNase contammation (see Note 2). Coatmg of slides: Drssolve WSC in 0.9% NaCl to 75 mg/mL and Con A m 0.9% NaCl to 15 mg/mL. Mix WSC and Con A in the ratio 1: 1 and apply 15 l.rL to each well. Incubate slides in a humidified chamber for 2 h at room temperature. Then wash brtefly twice in PBS (15). The best adherence of cells 1s obtained if the coated slides are used the same day as they are made Cell harvest. Centrifuge cells at 1200 rpm for 5 mm at 8°C (see Note 3). Suspend cell pellet in 5 mL me-cold PBS. Centrifuge cells as in step 3. Suspend cell pellet m ice-cold PBS to final concentration of 8 x lo6 cells/ml. Apply 15 PL of cell suspension to each well on the slide at 8’C in a humidified box and let stand for 30 min. Rinse the slides brrefly in PBS, twice at 8’C
Mogensen
270
et al.
9. Fixation of cells. Incubate slides in 4% paraformaldehyde m PBS for 15 min at room temperature, then rmse briefly in PBS twice. 10. Storage: Slides stored in PBS at 4’C are usable for at least 2 wk.
3.1.2. Pretreatment 1 Wash the slides coated with cells three times for 2 mm each in PBS at room temperature 2 Transfer the slides to 0 2M Trts-HCl-0. 1M glycine, pH 7 4, for 10 min at room temperature. 3. Denature the RNA by transferring the slides to 2X SSC, 50% deiomzed formamide for 10 mm at room temperature, followed by further denaturatron m a simrlar solution preheated to 65’C for 10 mm. 4. Quench the RNA m 1X NT-buffer precooled to O”C, two times for 5 min each (see Note 4)
3.1.3. One-Step
Procedure
1. Reaction mixture: Mix m an Eppendorf tube 5 nmol each of dATP, dCTP, dGTP, and 0.5 nmol of dTTP. Add 0.78 nmol bra-1 l-dUTP or 0 078 nmol fluorescem1ZdUTP. Add 0 5 U AMV-reverse transcrptase, 0 25 U RNase inhibitor and 2 l.tg ohgo-dT-primer in a total volume of 10 l.rL 1X NT-buffer (see Notes 5 and 6) 2. Incubation: Place the slides in a humtdtfied chamber preheated to 42’C, and apply 10 l.tL reaction-mixture to each cell spot. Cover with a plastic coverslip. Incubate at 42“C for 90 min in an incubator (see Note 7) 3 End of reaction. Wash the slides at 42°C in 0 5X SSC, two times for 30 min each, followed by 0.1X SSC, two times for 30 mm each. 4. Visualization: If fluorescem-1ZdUTP is used, apply 20 ltL of antifade solution before covering with a glass coverslip. Slides are now ready for microscopy. 5. If bra-1 l-dUTP is used, equrhbrate the slides m BN-buffer for 15 mm at room temperature. 6 Apply 15 lrL of blocking solution to each cell spot, cover with a plastic coverslip and incubate for 5 min at room temperature. 7. Wash the slides m BN-buffer, three times for 5 min each at 42°C. 8. Apply 15 lrL fluorescein-avidm diluted in blockmg solution, 5 ng@L, to each cell spot, cover with a plastic-covershp, and incubate for 10 min at room temperature 9 Wash the slides three times in BN-buffer for 5 min at 42’C. 10. Apply 20 l.tL antifade solution before covering with a glass coverslip Slides are now ready for microscopy. 3.1.4.
Two-Step
Procedure
1 Primer annealing Mix m an Eppendorf tube 2 ltg specific primer and 0.25 U RNase mhibitor m a total volume of 10 pL 1X NT-buffer (see Note 8) 2. Place the slides in a humidified chamber preheated to the required stringent temperature and apply 10 p,L reaction mixture to each cell spot. Cover with a plastic coverslip. Incubate at the stringent temperature for 90 mm (see Notes 7 and 9). 3 Stop the annealing by washing the slides m 1X NT-buffer, two times for 15 mm at the stringent temperature.
PRINS Labeling
of RNA
271
4. Reaction mixture: Mix in an Eppendorf tube 5 nmol each of dATP, dCTP, dGTP, and 0.5 nmol dTTP. Add 0.78 nmol bio-1 l-dUTP or 0.078 nmol fluorescein-12dUTP. Add 0.5 U AMV reverse transciptase, 0.25 U RNase inhibitor m a total volume of 10 l,tL 1X NT-buffer (see Notes 5 and 6). 5. Incubation: Place the slides in a humidified chamber preheated to 42’C, and apply 10 p,L reaction mixture to each cell spot. Cover with a plastic coverslip. Incubate at 42’C for 90 min m an incubator. 6. End of reaction: Wash the slides two times m 0.5X SSC, for 30 min, followed by two times in 0.1X SSC, for 30 min at 42°C. 7. Visualize fluorescem-1ZdUTP and bio-1 I-dUTP labeling as described in the one-step procedure, Section 3.1.3., steps 4-10.
3.2. RNA-PRINS 1. 2. 3. 4. 5. 6.
1, 2. 3. 4. 5. 6
of Cells in Suspension
3.2.1. Cell Fixation Wash single cells ( 107) suspended in growth medium twice in ice-cold HBSS. Loosen the cell pellet and resuspend the cells in 1 mL HBSS Add 1 mL freshly prepared 2% paraformaldehyde in HBSS (see Note 1 l), and fix the cells for 5 min at room temperature. Centrifuge the sample at 4’C and resuspend pellet m 1.5 mL ice-cold HBSS. During whirl mixing, slowly add 3.5 mL of absolute ethanol. Centrifuge agam and resuspend the pellet m 5 mL 70% ethanol. Store samples of 2 x lo6 cells/ml at -20°C until use. 3.2.2. mRNA Denaturation and Quenching Transfer 500 PL cell suspension in 70% ethanol to an Eppendorf tube and centrrfuge (see Note 12) Loosen cell pellet and during whirl mixing resuspend m 100 pL 5X SSC, 0 5% Tween 20. Add 100 pL (1 vol) 20X SSC. Add 200 pL (2 vol) deionized formamide. Denature by heating for 30 min at 50°C. Centrifuge, discard supernatant, and quench by quickly adding 500 pL me-cold 5X SSC, 0.5% Tween 20. Centrifuge and wash cell pellet twice m 500 pL me-cold 1X NT-buffer. Before the last centrifugation, transfer 100 pL of the samples to five new Eppendorf tubes Each tube will now contain approx 2 x lo5 denatured and quenched cells.
3.2.3. One-Step Flow RNA-PRINS 1. Reaction mixture (see Note 13): 3Ol.lL dATP, dCTP, dGTP, 10 nu’kf each 3.0 PL dTTP, 0.1 mM Bio-1 l-dUTP, 1 mM 4.7 p,L 6.0 l.rL 1OX NT-buffer lOl.rL RNase inhibitor PolyT-primer, 1.65 pg/pL 5.0 pL 1.0 FL AMV, 2.5 U&L 35.3 pL H2O Total 60.0 FL
Mogensen
272
et al.
2 Add 60 l.tL reactton mtxture to each prevtously denatured and quenched cell pellet 3 After 1 h at 42’C, wash the sample twice in 2X SSC, 0.5% Tween 20, and then stain
3.2.4. Two-Step Kappa Light
Flow RNA-PRINS, Chain Detection
1. Reaction mrxture (see Note 13): 3.0 I.LL 3OltL 47l.LL 6Oj.tL 1.0 l.tL l.OpL 40.3 l.tL 6OOl.tL
dATP,dCTP,dGTP, 10 mM each dTTP, 0.1 rml4 Bto-ll-dUTP, 1 mM 1OX NT-buffer RNase inhibitor AMV, 2.5 U/pL HZ0 Total
2 Mix 1 PL RNase block II, 5 p.L Kappa ltght chain primer, and 54 l.tL 1X NT-buffer 3. Add this primer mixture to previously denatured and quenched cell pellet, incubate for 1 h at room temperature (see Note 14). 4 Remove nonannealed primers by washing the sample twice in 1X NT-buffer at room temperature. 5. Add reaction mixture (without prtmer), and incubate for 2 h at 42°C. 6. Wash the sample twice m 2X SSC, 0 5% Tween 20 and then stain
3.2.5. Biotin
Staining
1 Resuspend the cell pellet m 100 FL 2X SSC with 5% BSA and 0 5% Tween 20, and incubate for 10 mm at room temperature. 2. MIX 1 FL fluorescem-avidin m 500 l.tL 2X SSC contammg 5% BSA, and 0 5% Tween 20, and add 100 PL of this fluorescem-avidm solution to the sample. Incubate for 20 mm at room temperature (see Note 15) 3. Wash the sample twice in 2X SSC, 0.5% Tween 20. Resuspend m Tris-buffered salme with 0 5% Tween 20, pH 8.0. The sample is now ready for FACS analysis.
3.2.6. Flow Cytometric
Analysis
For flow cytometric detection, we use a FACStar Plus (Becton Dlckmson). Fluorescein is excitated with the 488 nm lme from an argon laser, and the emission is detected with the recommended standard filter, i.e., a bandpass filter (DF530) with optimum transmission at 530 nm. 4. Notes 4.1. RNA-PRINS
to Cells
Fixed
on Slides
1 Coverslips for mcubattons: Although sillconized glass coverslips can be used, plastic coverslips are much easier to handle and gave the same result 2 Minimization of RNase contamination All chemicals, solvents, and components used for RNA work should be set aside for thts purpose only These should be appropriately autoclaved, filter sterrhzed, or baked. Always wear gloves.
PRINS
Labeling
of RNA
273
3. Fixing procedure: It is very important to keep the cells cold during harvest and application. This results m a significant decrease in autofluorescence and gives a better signal-to-noise ratio. 4. Pretreatment: Self-priming has been implicated to cause background noise in the IST-method (7-10). This is not a problem with RNA-PRINS presumably owing to the quenching step. 5. Enzyme concentration: Various amounts of AMV-reverse transcriptase have been tested in a one-step procedure using poly-T primer. In the range between 0.5 and 8 U/IO pL reaction mixture, no difference in nucleotide incorporation is apparent. 6. Nucleotides: The optimal concentration of bio-1 l-dUTP is found to be 0.78 nmol/ 10 lrL reaction-mixture. A significant increase in labeling is obtained by including dTTP in a concentration of 0.5 nmol/lO pL. The optimal concentration of fluorescein-12-dUTP was found to be tenfold less than bio-1 l-dUTP. At these concentrations, the signal to noise ratio was found to be equal (approx 35: 1) using either bio-1 l-dUTP or fluorescein-12-dUTP. However, the background level is 2.5 times higher with bio-1 l-dUTP (6). From experiments in other cell systems, tt is our experience that the optimal concentration of bio- 11 -dUTP/fluorescein- 12-dUTP has to be determined empirically. It is therefore recommended to always perform a titration with different concentrations of bio-1 l-dUTP/fluorescein- 12-dUTP 7. Incubation time: We have found that the reaction proceeds linearly for at least 90 mm and have chosen to use this mcubation time 8. Annealing mixture. Although most in situ hybridization experiments use dextran-sulfate and carrier-DNA (salmon-sperm) to optimize the annealing step, this is not recommended here since dextran-sulfate strongly inhibits enzyme activity, whereas carrier-DNA increases background unacceptably. 9 Specific signal: To achieve a specific signal, the annealing temperature has to be raised until the difference in signal appears between positive and negative cells. Although it is possible to calculate a theoretical melting temperature, it is our observation that the optimal temperature has to be found by empirical means As mentioned earlier, the method is developed m a homogeneous cell system with well defined positive and negative control cells In heterogeneous cell systems with positive and negative cells intermingled with each other, further negative controls may be needed to ensure that the signal obtained reflects a true labeling of the specific RNA (see Note 10). Control evaluation of the transcripts made m the cells by the RNA-PRINS or IST method could be performed and identified by traditional molecular methods (7-10). As a further support for specific mRNA staining a simultaneous staming of the correspondmg protein could be performed with monoclonal antibodies 10. Negative controls: It is important to have proper negative controls We run the following reaction mixtures in parallel with the test reaction: a. Exclusion of primer to establish if any self-priming is occurring b. Exclusion of enzyme to be sure no endogenous enzyme activity is present, c Substitution of deoxy-nucleotides with dideoxy-nucleotides to ascertain that only true 5’ -+ 3’-chain elongation is detected.
274
Mogensen 4.2. RNA-PRINS
to Cells
et al.
in Suspension
11 Paraformaldehyde dissolves in HBSS at 80-90°C. 12. Eppendorf tubes and short centrifugations (5 s) at maximum speed in an Eppendorf centrrfuge are used in all the following preparative steps. This reduces cell clumping and cell loss, and keeps the PRINS reaction volume at a mmtmum. 13. Fluorescein-1ZdUTP can be used to substitute bra-11-dUTP in the reaction, in which case the avrdin staining step is excluded. When doing this, use 3 PL of a 0.1 mM fluorescein-12- dUTP stock solution, and increase the Hz0 added by 1.7 PL 14. Although primer annealing is traditionally performed in SSC buffer, only weak signals are obtained using this buffer system rn the present reaction A number of different annealing and chain elongation temperatures have been tried, and to our surprise, the chosen temperatures turn out to be necessary to obtain a clear but still specific signal. 15. Appropriate staining controls are. reactions without the primer and/or labeled dUTP, or inclusion of dideoxynucleotides to terminate the polymerization reaction. In specific mRNA detectton, cells known not to express the mRNA can be used as negative controls.
References 1 Harrison, P. R., Co&e, D , Affara, N , and Paul, J (1974) In srtu localization of globm messenger RNA formation J Cell Blol. 63,401-413 2 Cox, K. H , DeLeon,D V , Angerer, L M , and Angeler, R C (1984) Detection of mRNA’s in seaurchin embryosby ln srtu hybridrzation usmgasymmetricRNA probes Dev. Btol 101,485-502.
3 Lawrence,J B and Singer,R. H (1985) Quantitative analysisof In alto hybridization methodsfor detectionof actin geneexpression.Nucleic Acids Res. 13, 1777-1799. 4. Lawrence,J B., TaneJa,K., andSinger,R H (1989)Temporalresolutionandsequential expressionof muscle-specificgenesrevealedby ln alto hybridization Dev Blol. 133, 235-246
5. Mogensen,J., Kelvraa, S., Hmdkjaer,J , Petersen,8, Koch, J., Nygaard,M , Jensen,T , Gregersen,N., Junker,S , andBolund, L. (1990)Nonradioactive,sequence-specific detection of RNA m ~rtuby primedin situ labeling(PRINS). Exp Cell Res 196,92-98 6 Koch, J , Mogensen,J., Petersen,S.,Fischer,H , Hindkjcr, J., Kolvraa, S , andBolund, L (1992)Fastone-stepprocedurefor the detectionof nucleicacidsin situ by primer-Induced sequence-specific labelingwith fluorescem-12-dUTP. Cytogenet. Cell Genet. 60, l-3. 7. Tecott, L H., Barchas,J D., and Eberwine,J H. (1988) In sttu transcnpuon.specific synthesisof complementaryDNA in fixed tissue sectionsScience240, 1661-1664 8. Longley,J. L., Merchant,M A., andKacmski,B M. (1989)In sttu transcriptionanddetection of CDla mRNA m epidermal cells An alternativeto standard m srtu hybndlzatrontechniques J Invest Dematol
93,432-435.
9 Van Gelder, R N , Von Zastrow,M. E., Yool, A, Dement,W C., Barchas,J D., and Eberwine,J. H (1990) Amplified RNA synthesizedfrom limited quantitiesof heterogeneouscDNA. Proc. Nat1 Acad. SCL USA 87,1663-1667. 10 Mocharla, H., Mocharla, R , andHodes,M E. (1990)Alfa-amylasegenetranscriptionm tissuesof a normaldog Nucleic Acids Res 18, 1031-1036 11 Gopalakrishnan,T. V and Thompson,E B. (1975) A methodfor enucleatingcultured mammaliancells Exp Cell Res. 96,435439
PRINS Labeling of RNA
275
12. Kdhler, G. and M&em, C (1975) Contmuous cultures of fused cells secreting antibody of predefined specificrty. Nature 256,495-497 13 Junker, S , Pedersen, S., Schretber, E., and Matthias, P. (1990) Extmctron of an immunoglobuhn kappa promoter in cell hybrids is mediated by the octamer motif and correlates with suppression of act-2 expression Cell 61,467-474 14 Gregersen, N , Koch, J , Kolvraa, S , Petersen, K. B , and Bolund, L (1987) Improved methods for detection of unique sequences m Southern blots of mammalian DNA by nonradioactive biotmylated DNA hybridization probes Clrn Chim. Acta 169,267-280.
CHAPTER 24
Hybridization Histochemistry Using Radiolabeled Oligodeoxyribonucleotide Probes Jennifer
D. Penschow
and John
l? Coghlan
1. Introduction The technique of hybridization histochemistry (1) was developed as a means of locating specific mRNA populations in tissue sections using radiolabeled recombinant DNA probes with a complementary nucleotide sequence to the target mRNA. The original method used frozen sections fixed with an ethanolbased fixative and hybridized with cDNA probes. There have been few necessary modifications to thrs technique, apart from the change to an aldehyde fixative and an expanded range of probes and labels to choose from. Since these initial experiments, manjl methods for hybridization hlstochemistry have been published. These are often encumbered by additional procedures, usually aimed at reducing background, many of which are unnecessary or of llmited use. In the method we describe here using radlolabeled oligodeoxyribonucleotide probes on frozen sections, we have always endeavoured to “keep it simple.” Ours is a rapid technique that is applicable to a range of tissues from small human surgical specimens (2) to large specimens, such as whole mice (3). Tissue can be frozen, sectioned, and hybridized on the same day, washed the next day, and an X-ray film autoradiograph obtained the following day. This compares favourably for speed with the nonradioactivelylabeled probe methods for which the detection system generally requires an overnight color development (4). Radioactive labels have the added advantage of superior sensitivity, and resolution IS obtamable at different levels by selection of the appropriate isotopic label and autoradiography technique. Hybridization signals as images on X-ray film are ideal for mapping sites of gene expression throughout a whole organism (3) or tissue, such as bram, and autoradiographs of the same specimen with liquid emulsion can provide resolution to whole cells or subcellular organelles (5). Although we describe speciftcally the use of radiolabeled oligodeoxyrlbonucleotide probes in frozen sections, few modifications are needed for adaptation of the method to other types of probes or to sectlons of embedded tissue. The following method 1sa simple, reliable, widely applicable means for the detection of specific mRNA in tissue sections, cell smearsor cell cultures (6,7) using radiolabeled DNA probes. From Edlted
Methods in Molecular B/o/ogy, Vol 33 In SW Hybr/duat/on Protocols by K H A Choo CopyrIght Q 1994 Humana Press Inc , Totowa, NJ
277
278
Penschow
and Coghlan
2. Materials 2.1. Equipment 1. 2. 3 4. 5. 6. 7 8. 9. 10.
Fume hood. Cryomicrotome and sharpened or disposable knife. Micropipets covering the range 5-1000 pL. Vortex mixer. Minifuge. Water bath adjustable from 70-90°C with rack to hold Eppendorf tubes Water bath, adjustable from 30-6O”C (for use with isotopes). Incubator, adjustable from 30-60°C (for use with isotopes) Water bath at 40°C without thermostat indicator light (for autoradiography) Small oven at 37-45”C uncontammated with isotopes (for autoradiography).
2.2. Tissue Freezing 1 2 3. 4. 5. 6 7. 8.
Hexane. Dry ice. Metal container of 2-4 L capactty as freezing bath Insulated gloves for handling dry ice. Heavy-duty aluminum foil OCT compound (Miles Laboratories, Naperville, IL). Plastic bags, labels, and bag ties. Dissecting gear: scissors, forceps, razor blades, cork board, or wax sheet.
2.3. Sectioning, Fixation, and Prehybridization 1. Glass shdes subbed with 1% gelatine, hardened with 0.25% formaldehyde, and oven-dried or subbed with aminoalkylsilane (8). 2 Coplin jar containing rapid fixative 10% formaldehyde in ethanol. 3. Glutaraldehyde fixative: 3% glutaraldehyde (Merck, Darmstadt, Germany) m 0.1 M phosphate buffer, and 20% ethylene glycol. Store at 4°C for no more than 5 d, or paraformaldehyde fixative: 4% paraformaldehyde in 0 1M phosphate buffer, pH 7.2. Prepare fresh and leave at 4°C. 4. Histological staining setup suitable for tissue or cells under mvestigation. 5. Slide racks made of solvent-resistant, noncorrosive material (preferably plastic or glass). 6. Glass or plastic dishes large enough to hold slide racks immersed in solutions. 7. A plastic rack/box assembly for slide storage. 8. Hybridization buffer 600 mM sodium chloride, 50 mM sodium phosphate, pH 7.0, 5.0 mM EDTA, 0 02% Ficoll, 0.02% Bovine serum albumin, 0.02% poly(vinylpyrrolidone), 0.1% DNA (“degraded free acid,” Sigma, St Lotus, MO), 40% formamide (Merck) deionized by adding 3g/L ion exchange resin (Bio-Rad, Richmond, CA, Cat#142-6425), and filtered. 9 4X SSC (20X SSC stock solution is 3M sodium chloride and 300 mM sodium citrate). 10 Absolute ethanol (analytical grade).
Hybridization
279
Histochemistry
2.4. 5’-End-Labeling
of Oligodeoxyribonucleotide
Probes
1. Oligodeoxyribonucleotide l&100-mer, appropriately purified (9). 2. Perspex shields for personal protection from P-emission of 32P, if this isotope is used. 3. Choice of [Y-~~P]ATP or [Y-~~P]ATP (Amersham [Arlington Heights, IL] or NEN/ DuPont [Boston, MA]) 4. T4 polynucleotide kinase (Pharmacia, Uppsala, Sweden) 5. 10X Denaturation buffer for T4 kinase labeling: 200 mM Tris-HCl, pH 9 5, 10 mM spermldine, 1 mM EDTA. 6. 10X Kmase buffer for T4 kmase labeling: 500 mM Tris-HCl, pH 9.5, 100 mM MgC12, 50 mM dithiothreitol (DTT), 50% glycerol. 7. PNKDilution buffer: 50mMTris-HCl, pH 7.5, 10tiZmercaptoethanol,O.O5% DNase-free BSA.
2.5. 3’-Tailing
of Oligodeoxyribonucleotide
Probes
1. Choice of [a-32P]dATP, [a-3SS]dATP, [3H]dATP, or [a-33P]dATP (Amersham or NEN/Dupont) 2. Termmal deoxynucleotidyl transferase (TdT) (lOU/pL, Amersham). 3 10X Tailing buffer for TdT 1abelmg:lM potassmm cacodylate, 250 mM TrisHCI, pH 7 6, 10 mM CoCl,, 2 mM dithiothreitol (DTT) 4. Unlabeled deoxynucleotide triphosphates (dGTP, dCTP, dTTP) (Boehringer, Mannherm, Germany).
2.6. Purification 1. 2. 3. 4. 5. 6. 7.
of Labeled
Probe
Sephadex G-25 fine (Pharmacia) column (5 x 0.5 cm), or spin columns (9). Column buffer. 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, O.lM NaCl. tRNA (Sigma) Ethanol (AR grade) 3M sodium acetate. 10% denaturing (7M urea) polyacrylamide gel. Hybridization buffer (filtered).
2.7. Hybridization
and Washing
1. 2. 3. 4
Hybridization buffer and SSC as described for prehybridization (Sectton 2 3 ). Eppendorf tubes. Glass coverslips of various sizes. Sealable plastic “lunch-boxes” with plastic inserts on which slides can be laid flat, but not m contact with humidifying solution, and incubated. 5. “Glad-Wrap,” or other thm plastic film. 6. Ribonuclease A (Sigma); for treatment of control sections.
2.8, Autoradiography 1 2 3 4.
X-ray film cassette. XAR-5 film (Kodak, Rochester, NY) to fit cassette. Blottmg paper cut to fit cassette. High resolution X-ray film, if required, MRP-34 (DuPont)
280
Penschow
and Coghlan
Table 1 Flow Chart For a Simple, Reliable Hybrtdizatton Histochemistry Method Freeze-embed tissue in OCT compound at -70°C, using hexane/dry me Cut cryosectrons onto gelatmized sltdes. Fix sections m 3% glutaraldehyde or 4% paraformaldehyde m phosphate buffer. Rmse secttons in 4X SSC. Prehybrtdize at 40°C m hybrtdizatton buffer Rinse sections m three changes of ethanol. Apply radiolabeled probe m hybridization buffer and cover-shp Incubate sectrons in hunudttied chamber, at a temperature appropriate for experiment Rinse off probe and dtslodge coverslip m 2X SSC at room temperature Rmse in 1X SSC at room temperature Wash m 1X SSC at 50°C for 45 mm Rinse m three changes of ethanol Apply X-ray film, leave for 1 d (for 32P)to 3 d (for 35Sor 33P) Develop and fix film, evaluate result Perform hqutd emulston autoradiography, usmg X-ray film result as a gurde to exposure ttme
5. X-ray film holders or machine for developing and fixmg films 6 “Liquid X-ray developer” and “liquid X-ray fixer” (Kodak). 7 Liquid photographic emulsions* K5 (Ilford, Essex, UK), or NTB-2 (Kodak) are suitable for most isotopes and applicattons. 8. Correct safelighting for the type of X-ray film and/or liquid emulston used. 9 An isotope-free refrigerator for storing stock emulsion, and incubator for melting an aliquot at 40°C prior to dipping 10 A light-proof box for transportation, and incubation of the emulsion aliquot 11 A chemically clean glass or plastic container in which to dip slides, which will hold enough emulsion to cover secttons. 12 A waterbath without thermostat indicator light (which may expose emulsion) for maintaining emulsion at correct temperature (4O”C), while slides are dipped. 13 Light-proof slide boxes or relatively air-tight containers to hold slide racks while exposing. 14 Silica gel. 15 D19 developer (Kodak). 16. Hypam fixer (Ilford), diluted 1:4. 17. 4% Formaldehyde in water for hardening emulsion
3. Methods The rationale for certam steps in the procedure will be outlmed in the Notes section. Variations on this method, such as the use of paraffin sections, will also be explained tn the Notes. For a simplified flow diagram of the method, see Table 1, 3.1. Tissue Preparation 3.1.1. Freezing Tissue 1. Prepare molds of aluminum foil a btt larger than the tissue to be frozen 2. Add enough OCT compound at 4°C to cover the bottom of the mold.
Hybridization
Histochemistry
3. Prepare a metal beaker of hexane m fume hood, add “dry” ice and wait until the rapid boiling ceases before freezing tissue (hexane is at -70°C). 4. Place tissue in the mold with the correct orientation for subsequent secttonmg of the undersurface. 5. Cover the tissue with OCT compound at 4’C and hold the mold in the hexane bath with forceps so that the surface of the OCT compound is not covered by the solution and the specimen is freezing from the bottom and sides. 6 When frozen, drain off excess hexane, place the specimen in a plastic bag with the label on the inside, seal with a tie, and store frozen at -20°C. 3.12. Sectioning 1 Unmold the specimen, and mount onto a cryomicrotome chuck. If possible, positive and negative control tissues and other specimens for comparison should be mounted together so that they all appear in the same section. 2. Glue the pieces onto the chuck with OCT compound at 4”C, using small amounts at a time, and using dry ice to freeze the OCT quickly so that the tissue does not thaw. 3. Cut sections at 5-7 pM at a temperature appropriate for the tissue (usually -12 to -18°C). 4. Collect sections onto gelatinized or aminoalkylstlane-treated slides (8) and freeze rapidly on dry ice. A rough idea of tissue structures can be obtained by viewing sections quickly on a dissecting microscope, under dark-field, prior to freezing on dry ice For more accurate detail, extra sections can be fixed in formaldehyde/ ethanol for 10 s, rinsed, stained with hematoxylm, or alternative stain, rinsed, and viewed immediately. 5. See Note 1 for a discussion on frozen sections vs sections of embedded tissue 1. 2. 3 4. 5. 6 7. 8. 9.
3.2. Fixation and Prehybridization Transfer slides from dry ice into fixative at 4°C. Glutaraldehyde provides superior morphology, and does not appear to hinder the penetration of short probes, but paraformaldehyde is recommended where long probes are used (see Note 1) After 5 min, rinse m 2 changes of 4X SSC at room temperature. Protease treatment should be undertaken prior to step 3, if required (see Note 2) followed by thorough rinsing m protease diluting buffer. Transfer slides into hybridization buffer at 40°C, and leave for 30 min to 4 h (see Note 3). Rinse slides in three changes of 100% ethanol (AR grade) with constant agitation and allow to dry at room temperature. Hybrrdize within 1 h or transfer to sealable plastic boxes containing a small vol of ethanol for storage. Seal boxes and store at 4°C (up to 4 wk) or at -20°C for longer periods (see Note 1) Prior to hybridization, select sections for hybridization, and adjacent sections for treatment with ribonuclease A as controls. Treat controls for 30 min at 37°C in 20 pg/mL ribonuclease A m O.lM phosphate buffer, pH 7.2. A buffer-only control should also be mcluded. Following the mcubatron, rinse treated slides in phosphate buffer, then m 4X SSC and ethanol. To avoid problems with ribonuclease contammation, take care to use separate glassware and solutions for ribonuclease-treated slides For the preparation of cell smears or cell cultures, see Note 4.
282
1. 2 3. 4 5 6.
1.
2 3 4
1. 2. 3. 4. 5 6.
Penschow
and Coghlan
3.3. Probe Labeling 3.3.1. 5’-End-Labeling with T4 Polynucleotide Kinase Combine the followmg in an Eppendorf tube. 1 pL ollgonucleotide stock (at 50 ng/pL), 4 pL of 10X denaturation buffer, and distilled water to 40 pL. Heat the tube to 70°C for 5 min, then chill immediately on ice. Add 5 pL of 10X kinase buffer, and 1 pL (1OU) T4 polynucleotlde kinase (PNK). Mix by vortex. Add two molar equivalents of labeled nucleotide, I.e., 5 PL (50 pCi) of a 10 mCl/ mL solution of [T-~~P]ATP (5000 Wmmol), or [Y-~~P]ATP (l-3000 Ci/mmol) for each 50 ng (5 pmol) of a 30-mer ohgonucleotide (average mol wt 1s9207) Centrifuge the tube briefly, and Incubate at 37°C for 1 h 3.3.2. 3’-Labeling with Terminal Deoxynucleotidyl Transferase (3’-Tailing) Combine the following In an Eppendorf tube: 1 pL of ollgonucleotlde stock solution (50 ng/pL), distilled water to a final vol of 50 pL, and 2.5 pL of each of two a-deoxyribonucleotide triphosphates (usually dATP and dCTP labeled with 35S or 3H). The cold nucleotides dTTP and dGTP can be added to a final concentration of 1 p.M each to minimize background. MIX by vortex, then add 5 FL of the tailing buffer (see Note 5), followed by 1 PL (1OU) of terminal deoxynucleotidyl transferase (TdT) Mix by vortex and centrifuge briefly. Incubate at 37°C for 1 h (see Note 6 ) See Notes 7 and 8 for discussion on choice of probe, isotope, and labeling method. 3.4. Purification of Labeled Oligodeoxyribonucleotide Probes Prepare a Sephadex G-25 (fine) column (5 x 0.5 cm) Equilibrate with column buffer, and after incubation, elute the reaction mixture. The free label remains m the column Alternatively, purify using a Sephadex G-25 spin-column (9) (spin columns are prepared in advance and are particularly useful where several ollgonucleotldes have been labeled). Precipitate the labeled probe with ethanol, using 50 pg of tRNA to each fraction (8 drops each) containing the labeled product. Dry the mixture under vacuum and dilute to 400 ng/mL (for a 30-mer) in hybridization buffer. Check a small amount of the probe on a 10% denaturing polyacrylamide gel (see Note 9). The specific activity of a 32P end-labeled 30 mer is of the order 3 x lo* cpm/pg (3 x lo6 cpm/pmol)
3.5. Hybridization 1. Remove slides from ethanol storage and place under vacuum in a desiccator until they reach room temperature. 2 Select a size of coverslip that will cover the sections and note the vol of probe required (see Note 9). rule of thumb is 1 pL for each 22 mm2 of covershp area, although this varies with section size and thickness.
Hybridization
Histochemistry
283
3. Prepare a sealable hybridization chamber with a small vol of hybridization buffer in the bottom. 4. Heat the labeled probe to 90-lOO”C, mix by vortex, and centrifuge. 5. Place a coverslip near the edge OFa raised platform, such as an inverted sandwich box. 6 Apply an appropriate vol of probe to the coverslip and touch it onto the sections by holding the slide horizontally, with the sections in apposition to the coverslip The raised platform facihtates this manipulation. 7. Place the slide flat m the hybridization chamber. 8. Cover groups of slides with plastic: film (Glad-Wrap), avoiclmg cross-contamination of probes by ensuring that the plastic film does not overlap slides bearing different probes. 9. Seal the chamber and incubate overmght at a temperature appropriate for the probe length and homology with the target mRNA (4O’C for a 30-mer matching sequence) (see Note 10).
3.6. Posthybridization
Washing
1. Prepare sufficient 2X SSC for one wash (minimum 250 mL) and sufficient 1X SSC to wash all slides twice, the volume of which depends on the container, but we recommend at least 12 mL per slide per wash. 2. Heat half of the 1X SSC to 40°C (or suitable alternatlve temperature, depending on the experiment) (see Note 10). 3. Remove plastic film from the hybridized slides with forceps and discard. 4. Also using forceps, transfer slides individually to a beaker of 2X SSC (a 250-mL beaker IS convenient as slides cannot fall to the bottom). 5. Agitate gently until the coverslip is dislodged. 6. Drain slides on the edge of the beaker and transfer to a slide rack in a container of 1X SSC at room temperature. 7. Agitate the rack gently and transfer to 1X SSC in a water bath at 40°C (or selected alternative temperature). 8. Leave for 45-60 min with constant or occasional agitation 9. Rinse slides in three changes of absolute ethanol with constant agitation and allow to dry at room temperature.
3.7. Autoradiography 3.7.1 With Fast X-ray Film This is a prelimmary procedure to obtain an overview of the result at low resolutton and is followed by a subsequent exposure to high-resolution X-ray
film or liquid emulsion to obtain finer details. The degree of exposure of the low resolution fast film is used as a guide to estimate exposure times for subsequent autoradiographs. 1. Check the size of X-ray film to be used and lay slides side-by-side on blotting paper in an X-ray cassette such that the film will cover all of them. Intensifying screens are not generally used for hybridization tustochemistry, as the signal IS usually so distorted that it is chfficult to Interpret.
Penschow
and Coghlan
2. Place blank shdes at the ends of rows, to ensure that the film will lie flat over all slides, and tape the ends of all of the slides to the paper. 3 Place the X-ray film over the slides and expose for 20-24 h (for 32P) It 1s best always to use the same exposure time, so that the image intensity can be used as a consistent guide to the exposure required for subsequent autoradiography with high resolution film or liquid emulsion. 4 For 35Sor 33P, 3-4 d exposure may be required for XAR-5 film. Short exposures to conventional X-ray films are not beneficial for 3H as the P-particle energy is not sufficient to penetrate the protective coating covermg the emulsion. 5. Develop film for 2-3 min at room temperature, rinse in water, and fix for l-5 mm (until cleared) 6. Rinse thoroughly and allow to dry. 7 When the film is dry, realign over slides to identify labeled tissues. 3.7.2. Use of Fast X-Ray Film Result to Estimate Exposure Times 1. Select slides for which liquid emulston autoradiography will be beneficial, avotdmg those that obviously have a high background. Slides that show no signal on film should also be selected for dipping in emulsion, m case too few cells have hybridized to be visible on the film. For some applications, such as mapping or quantitation, a high-resolution X-ray film overview of hybridized tissues may be preferable to cellular resolution with liquid emulsion. MRF-34 high resolution film requires approximately 6 times the exposure time of XAR-5 (for 32P). 2. Estimate exposure times for subsequent autoradtography using the images on the low resolution film as a guide For 32P, a section which produced a black image after 24 h on XAR-5 and is dipped in emulsion soon after should be developed after 1 d, and a section that produced a dark-grey image developed after 5 d Develop only 1 slide m each instance and Judge subsequent exposure times from the developed slides A light image or no image on X-ray film with 32P indicates a maximum exposure time for liquid emulsion, which is approximately one halflife (14 d for 32P). 3 For lower-energy isotopes with a long half-life, it is preferable to divide the slides into groups before dipping, to be developed at intervals The slide showing the strongest signal on X-ray film should be the first developed after coatmg with liquid emulsion and its exposure time used as a guide for the other slides, with reference also to the signal intensity on the X-ray film As X-ray film autoradiography with low-energy isotopes is less efficient than liquid emulsion autoradiography, a light image on XAR-5 film does not necessarily indicate a long exposure time. 3.7.3. Liquid Emulsion Autoradiography Do not transport emulsion through 32Pareas or use tn a darkroom habitually used for 32P gels, and so on, as rt readrly accumulates background under these condttions. The dark-room must be completely light-tight and have correct safelighting. 1. Estimate the volume of emulsion required in the selected dipping container so that sections will be covered.
Hybridization
285
Histochemistry
2. Transfer a small amount of stock emulsion mto a preweighed Jar in a light-proof box 3 Weigh again, thereby obtaining emulsion weight, and dilute 1:1 with distilled water. 4. Leave at 37-4S’C (maximum) for 3 h, to equilibrate. 5. Stir emulsion and transfer to the dipping container m the water bath, avoiding bubbles. 6. Dip slides, allow to drain for a few seconds on absorbent tissue and transfer to slide racks. 7. Transfer racks to light-proof containers (tins) with a dish of dry sihca gel covered with filter paper. 8. Leave to expose at room temperature. Using this method, racks of slides can be developed and fixed without the need to transfer slides (see Note 11). 9. Develop autoradiographs in D19 for 2 min at 20°C. 10. Rinse in distilled water, fix in diluted Hypam fixer at room temperature, and rinse in running filtered tap water for 10 min Il. Immerse in 4% formaldehyde solution, to harden gelatine-based emulsion. 12 Rinse slides in water and stain with1a suitable histological stain (hematoxylin and eosin is a good genera1 stain but is not universally applicable, e.g., brain regions are ill-defined unless appropriate stains are used). See Notes Directions.
12-14 for discussions
on Controls,
Quantitatron,
and Future
4. Notes 1. Frozen sections vs sections of embedded tissue: Frozen sections can be prepared much more rapidly than other types of sections and the simphcity of this type of preparation guarantees that the mRNA will not be lost if the procedure is executed correctly. However, it is essenttal to have positive control tissues in every experiment to monitor any method used Frozen sections of good quality can be obtained with a sharp microtome knife and good sectioning technique. Occurrences that are disastrous for the quality of the result include delayed or slow freezing after excision, thawing of the tissue prior to sectioning or desiccation of tissue, which can occur with long term storage and IS exacerbated by storage in low-temperature freezers. There is not the need for low-temperature storage of tissue pieces as there is with tissue homogenates, as ribonucleases are compartmentalized and not in contact with the cellular mRNA in pieces of tissue frozen correctly. We have found -20°C quite adequate for storage of tissue specimens over long periods (years), the problem not being loss of mRNA but deterioration of the sectioning properties of the tissue. For long-term storage, tissue is best preserved in liquid nitrogen. Immersion-fixation of tissue may enable mRNA to leach from autolyzed cells prior to the fixative reaching the center of the specimen Where possible, perfusion-fixation is recommended, otherwise it is preferable to use small specimens and a relatively rapidly penetrating cross-lmking fixative, such as 4% paraformaldehyde in 0.1 M phosphate buffer, pH7.2. Prolonged fixation with cross-linking fixatives can mask mRNA and hinder penetration of the probe through the tissue, therefore fixation should be limited to a maximum of 18 h.
Penschow
and Coghlan
2 Treatment of sections with protease: Although protease treatment IS not usually required for frozen sectrons, rt is often necessary to treat sections of immersron-fixed embedded tissue with protease (12) to facilitate penetrahon of the probe through the ttssue This step is best carrred out after fixation and prior to step 3 in Section 3 2. The optimal enzyme concentration and duratron for protease treatment depends on the type and thickness of sections, the type of &sue, the specificity of the enzyme used, and the temperature of the reaction Treatment parameters should be established by the user for each batch of enzyme, as overtreatment results in disruption of the tissue and leaching of mRNA, whereas undertreatment may not facilitate probe penetration. A range of treatment protocols which may be used is given, however, the top of the range is quite severe and may only be necessary to “unmask” mRNAs in archival specimens, which have undergone prolonged fixation. Use Pronase E at 125-500 pg/mL for lo-30 min at 37°C or proteinase K at S-20 p.g/mL for 15-60 mm at 37°C. Pepsin is used for hybridization of viral genomrc DNA or RNA to facilitate probe penetration through a viral capstd and IS used at 0.001-0.25% in O.OlM HCl on sections that have been hydrolyzed for 15 min in 0. IM HCl. Although rt is not necessary to protease-treat frozen sections used with radiolabeled ohgonucleotrde probes, whrch are short and can penetrate the tissue easily, treatment may be necessary for short probes bearing nonradroactive labels, to enable large detection systems to access the probe. After protease treatment, the tissue 1s fixed with paraformaldehyde to inactrvate the protease and cross-link reactive groups 3. Prehybridization treatments for background reduction. There are several potential background-reducing procedures that are often mcorporated mto the procedure. We have found that the majority of these are ineffective and only serve to make the technique unnecessarily cumbersome, whereas the major sources of background remain, Most background is introduced by probes that are poorly prepared, impure, or partially degraded, or probes that are too concentrated or have dried out during hybridization. Other common sources of background come from posthybridizatton washing m inadequate volumes of SSC or from sections over-treated with protease or inadequately frozen or fixed so that the mRNA IS disseminated throughout the tissue. Thick or contammated slide subbing or sections that are too thick cause background by binding excessive amounts of probe nonspecifically, and photographic emulsion that is too thick amplifies the problem Also m this vein, 3sS label has an affinity for proteins in tissue, a problem which is exacerbated if decay products are present. We try to avoid these problems and include the prehybridization soaking in hybridization buffer as the only step specifically designed to prevent background, by “mopping up” sites in the tissue that may otherwise bind the probe nonspecifically 4 Preparation of cell smears or cell cultures: Grow cells on coverslips, or alternatively remove ahquots of cells from cultures mto centrifuge tubes. Rinse coverslips or cell suspensions in isotonic buffer to remove protein-contammg culture medium. For smears, resuspend cells in a minimum volume of buffer and deposit 1 pL onto a clean glass slide. Using an Eppendorf tip, smear cells around and outward m a spiral and allow smear to dry. Mark the limits of the spiral on the reverse side of the slide with a diamond marker.
Hybridization
S
6.
7
8.
Histochemistry
287
For smears and cells grown on coverslips. Fix in acetone for 30 s and freeze on dry ice Transfer to glutaraldehyde fixative at 4“C while still frozen and follow prehybridrzatron and subsequent procedures described for sections. As cells are often grown on only one side of a coverslrp, be sure to add the probe to the correct side. Preparation of “tailmg buffer”: Care is needed in preparing the tatling buffer, as the cobalt ions can preciprtate. The method of Roychoudhury and Wu (10) can be used: suspend 1.38 g cacodylic acid and 0.3 g Tris base in 3.5 mL of distilled water. Adjust the pH to 7.6, by addition of solid KOH with constant mrxmg. Make the solutron up to 8.8 mL with distilled water and chill on ice. Mix m 200 I.IL of O.lM dithiothreitol, then add dropwise 1 mL of O.lM CoCl, with constant mixing. Length of “tails” produced by “3’-tailing” procedure: The duration of this mcubation period, the concentration of the enzyme and the relative amounts of dNTPs to oligonucleotide all contribute to the resulting length of the “tall” that IS attached to the probe. Pyrophosphate, a product of the transferase reaction, forms an msoluble precipitate with the cobalt cofactor. Depletion of the cofactor can therefore stop the reaction at high substrate concentrations. Probes: There are several types of probes that can be used effectively for hybrtdtzation histochemistry. The most usual are cDNA, single-stranded RNA, ohgodeoxyribonucleotide, and probes generated by the polymerase chain reaction The various types of probes have particular advantages and disadvantages, which we have discussed in previous articles (7,9). With respect to oligonucleotides, they can be designed to discriminate closely homologous mRNAs, prepared tmmediately on a DNA synthesizer and quickly and effectively S-end-labeled with [$*P] or [Y-~~P] deoxyribonucleotide triphosphates (dNTP) or 3’-tailed with [cx-~*P], [cG~~P], [cG~~S] or [3H]-labeled dNTPs As they are single-stranded, oligonucleotide probes maintain their effective probe concentration without self-annealing, as occurs with cDNA probes and other types of double-stranded probes. “Riboprobes” are the probes of choice where a hrgh degree of sensitivity IS required. These are single-stranded RNA probes (13), which can theoretically be prepared with every nucleotide labeled, although this is not usual as such a “hot” probe is difficult and expensive to prepare and is liable to radiolyze. Special precautions are needed to avoid degradation of RNA probes by ribonuclease, which itself is an important ingredient for hybridization histochemrstry wrth riboprobes. A rrbonuclease-A posthybridization wash is used to remove unhybridized RNA probe, which otherwise constitutes background. Thts creates rrbonuclease-contammated glassware and other equipment that can be a major source of problems if not treated appropriately (decontaminate by autoclaving). Probe labels and resolution: There are several isotopic and nomsotoprc probe labels now available, which are summarized in Table 2. Nonisotopic probe labeling and detection systems will not be discussed in this chapter, however an example of the resolution obtainable with a nonisotopic system, compared with various tsotoprc probe labels, IS shown in Fig. 1 The selection of a probe label should be made with a view to the speed, sensttivity, and resolution required from the experiment 32P is the isotope with the shortest half-life (14 d) and therefore produces the most rapid autoradlographtc
288
Penschow
and Coghlan
Table 2 Labels and Detection Systems Commonly Used For Hybridzation Histochemistry Isotopic labels Isotope 3lP 33P 3% 3H 12.51
Particle/energy p/l 6 meV p/O.249 meV p/O 167 meV p/O.0185 meV 1 Auger/O 3-3 4 meV
Half-life 142d 25.4 d 87 d 12.4 yr 60 d
Detection X-ray film and emulston X-ray film and/or em&ton X-ray film and/or emulsion Emulsion (or X-ray film t3H]) X-ray film or emulsion
Nomsotoptc labels Probe label
Detection system
Btotm
Streptavidm conjugated to an enzyme, fluorophore, or gold, visualized approprtately. May be followed by appropriately labeled anti-avtdm IgG Labeled or unlabeled antibody to biotm followed by btotmylated second antibody May be followed by labeled avidm Anttbody to digoxtgenm Various labels available. May be followed by approprtately labeled second antibody. Labeled antibody to BUDR NBT/BCIP or naphthol-AS-MX-fast red. Direct detection by fluorescence microscopy Fluorescent antibody to probe label followed by fluorescent second antibody, if required
Dlgoxtgenin 5-Bromo-2-deoxyuridme Alkaline phosphatase Fluorescent labels
(BUDR)
image. 32P has the highest energy (P-particle, 1.6 MeV) and therefore the lowest resolution of the isotopes commonly used for probe labeling. However, 32P can provide resolutton at the level of a single cell if the section and emulsion layer
are sufficrently thin (5,6). 3H IS the classical htgh resolution P-emitting isotope (18.5 keV) and can provtde resolutton of subcellular organelles (5). However, the trade-off for the hrgh resolution 1s long autoradiographtc exposure times owing to the long half-life (12.4 yr), compared to 32P, 35S, or 33P-exposures with the same probe and tissue. X-ray film previews of 3H-labeled hybrids are not useful owing to the special (expensive) films necessary to record the weak P-particles of this isotope and the long exposure times required. 35S has been the isotope of choice for many laboratories owing to its convenient half-life (87 d) and emission characterlstrcs (P-particle of 0.17 MeV). However, it can produce high backgrounds on tissues, even in the presence of strong reducing agents, owmg mainly to its reactivrty and strong affinity for proteins. A new isotope for probe labeling has been recently introduced by New England Nuclear (Boston, MA), which has an ideal set of characteristics for hybndizatlon histochemistry (Fig. 1) This IS 33P, which is a P-emittmg isotope with an E,,, of 0 2.5 MeV, 50% greater
Hybridization
Histochemistry
Fig. 1. Autoradiographs of frozen sections of mouse kidney (A-D) or paraffin section (E) after hybridization with an oligonucleotide probe corresponding to the mouse glandular kallikrein gene, mGK-6, labeled in various ways. Labeled cortical distal tubules are shown at various levels of resolution, depending on the label employed. A, 32P, B, 33P,C, %; D. 3H; E, digoxigenin. detected using an alkaline phosphatase-conjugated antibody to digoxigenin, and the substrate/chromogen 5-bromo-4-chloro-3-indolyl-phosphate (BCIP)/ nitro blue tetrazolium (NBT), which produces a dark blue precipitate at labeled sites. Stain: hematoxylin and eosin (A-D). E is unstained. Bar = 100 pm (A-E are the same magnification). than for 35S. The low energy of 33P permits good resolution and its short halflife (25 d) offers maximum sensitivity with short autoradiographic exposures (up to one half-life). 9. Evaluating labeled probes: A measured aliquot of the probe should be retained so that the probe may be checked by polyacrylamide gel electrophoresis for length, purity, and signal intensity and counted for estimation of probe specific activity. This knowledge can be valuable when interpreting results and is particularly useful for troubleshooting. 10. Hybridization with oligodeoxyribonucleotide probes: The probes used are usually between 18-90 nucleotides long, with the preferred size around 30 mer. For homologous interactions, a 30-mer of any sequence can be hybridized at 40°C in 40% formamide and 300 mA4 NaCI. We prefer to maintain a constant salt and formamide concentration and to vary the hybridization temperature for probes of different lengths or for nonhomologous interactions. We have found that
Penschow
and Coghlan
hybridization conditions must be carefully selected for optimal results but that washing conditions are not critical (7) Although mRNA-DNA hybrids in sections or cells seem to be remarkably stable to high temperature/low salt washmg, it is best to avoid temperatures above 60°C, as these can be detrimental to tissue morphology, 11. Drying autoradiographs. Usual methods recommend drying slides and transferring to small boxes with a small amount of silica gel This can lead to inadvertent exposure of slides while drying and to background owing to stresses in the emulsion from raprd drying (1 I) and from transfers. 12 Controls. It is essential to have adequate controls in order to recognize artifacts. There are several types of controls that are appropriate for use with oligonucleotrde probes and more than one should be used for interpretation of results, especially for “fishing” expeditions. a. Controls using antisense or nonspecific probes: Application of a sense-strand or nonspecific probe to a section adjacent to the one hybridized with the specific probe can be a very good test of artefact. Although sense-strand probes are ideally preferred, unfortunately by its very nature, a sense-strand probe cannot be tested for its effectiveness as a hybrtdization probe, control, or otherwise. Thus, we choose to use a probe specific for a different part of the tissue from the test probe, as this demonstrates that the control probe is an effective probe and not one that has not labeled or has other major faults An apparent hybridization signal that appears in the same area of both the test and control sections is artefact This can also be confirmed by additional controls. A common artefact in sections of mammalian tissue is the nonspecific binding of probe to eosmophils (14). This occurs with most probes used at an effective concentration and survives ribonuclease pretreatment of sections, which is a useful additional control b. Pretreatment with ribonuclease for controls: Sections adJacent to the test section, which have been treated with ribonuclease A (9) prior to hybridization, should show a reduced or absent hybridization signal, depending on the abundance of the particular mRNA and the duration of the ribonuclease treatment. c. Dilution of labeled probe with unlabeled probe as specificity test. This type of control is easy to include where synthetic ohgonucleotide probes are used, as there is usually adequate probe available in a synthesis batch and the quantity that is labeled can be measured accurately. The hybridization signal in the tissue sections should diminish m proportion to the amount of unlabeled homologous probe added to labeled probe mixture (6) If this is not so, either mRNA levels are very high, the amount of unlabeled probe added is too small, both of the above, or the signal is due to artefact, which can be tested with other controls. The hybridization signal should not diminish if nonhomologous unlabeled probe is added to the labeled probe mixture. d. Immunostained adjacent sections as controls. This 1sa useful way to confirm a hybridization signal, where an antibody is available which is specific for the translation product of the target mRNA. Positive immunostainmg of the same tissue region which has hybridized is a useful confirmation of the specificity of the hybridization. However, if the protein antigen is constitutively secreted and not stored, there may not be sufficient mtracellular antigen to lmmuno-
Hybridization
Histochemistry
stain. Thus, a negative result with immunostaming does not necessarily mean that the precursor mRNA is not present. 13. Quantitation of mRNA in tissue sections: Hybridization signals obtained m autoradiographs of tissue sections can be quantitated in order to assessrelative levels of mRNA. This may be undertaken by image analysis of X-ray film (15) or liquid emulsion autoradiographs (16). Data generated in this way can be used in conjunction with morphometric techniques, such as 3D reconstruction to determme the spatial arrangement of a functionally discrete cell population within a tissue (17). As with morphometric techniques, a large number of secttons needs to be analyzed to obtain statistically accurate results. There are many sources of error that can affect quantitative analysis of autoradiographs. These tend to be more numerous with higher energy isotopes, as the signal intensity will vary with the thickness of sections or liquid emulsion layers (28). These differences in hybridization signals can be Interpreted incorrectly as differences in mRNA levels. 14. Future directions. Most technical innovations in hybrrdization histochemistry are aimed at improvements m sensitivity and avordance of isotopic probe labels. At present these aims seem to be incompatible, as the nonradioactive probe labeling systems that have been developed have not yet achieved the same level of sensitivity as optimized Isotopic methods. Furthermore, in the search for a sensitive nonradioactive system, the inherent specificity of DNA-mRNA mteractlons 1s often compromised by the use of endogenous substances as probe labels or mgredients of the detection system These are hable to cross-react with components of the tissue section to give false positives. Adaptation of polymerase chain reaction (PCR) technology for amplification of intracellular mRNAs in tissue sections is of particular interest and would solve the problem of sensitivity. The amplifrcation of viral DNA in fixed intact cells by PCR (19) has been achieved but a rehable means of amplifying intracellular mRNA m tissue sections has yet to be described.
Acknowledgments We are grateful to Jrm Haralambidis for oligonucleotide synthesis. This work was the National Health and Medical Research Family Trusts, The Ian Potter Foundatron, cal Foundation.
his continuing advice concerning supported by grants-in-aid from Council of Australia, the Myer and the Howard Florey Bromedi-
References 1. Hudson, P., Penschow, J , Shine, J , Ryan, G , Nrall, H , and Coghlan, J P. (1981) Hybridization hrstochemrstry Use of recombinant DNA as a ‘homing probe’ for tissue localisation of specific mRNA populations. Endocrinology 108, 353-356 2 Zajac, J. D , Penschow,J. D , Mason,T., Tregear,G W., Coghlan,J P., andMartin, T. J (1986) Identification of calcitonin and calcitonin gene-relatedpeptidemessenger ribonucleic acid in medullarythyroid carcinomas.J. Clin. Endocr Metab. 62, 1037-1043. 3. Rall, L. B , Scott,J , Bell, G. I., Crawford,R. J , Penschow, J. D , Niall, H D., andCoghlan, J. P (1985)Mouseprepro-epidermalgrowthfactor synthesisby the kidney andother trssues.Nature 313, 228-23 1,
292
Penschow
and Coghlan
4 Klyama, H and Emson, P. C. (1991) An m sttu hybrldlzatlon htstochemlstry method for the use of alkaline phosphatase-labeled ohgonucleotlde probes m small intestine J. Hlstochem Cytochem. 39,1377-1384 5 Penschow, J D., Haralambidls, J , and Coghlan, J. P (1991) Location of glandular kallikrem mRNAs in mouse submandibular gland at the cellular and ultrastructural level by hybridization hlstochemlstry using 32P-and 3H-labeled ohgodeoxyribonucleotlde probes J Histochem Cytochem. 39,835-842. 6. Coghlan, J. P., Penschow, J. D , Tregear, G W., and Nlall, H D. (1985) Hybrldlzatlon histochennstry Analyt Btochem. 149, l-28 7 Penschow,J D., Haralambldis,J , Darling,P E., Darby, I A , Wmtour,E. M , Tregear,G. W , andCoghlan,J P (1987)Hybndization histochemlstryExpenentia43,741-750. 8. Rentrop,M., Knapp,B., Winter, H., and Schwelzer,J (1986)Aminoalkylsdane-treated glassslidesassupportfor m-situhybridization of keratincDNAs to frozen tissuesections undervarying fixation andpretreatmentconditions.HtstochemJ 18,271-276. 9. Penschow,J D., Haralambidls,J ,Pownall,S , andCoghlan,J. P (1989)Locationof gene expression m tissue sections by hybridization hlstochemistry usmg ohgodeoxyribonucleotideprobes.Meth. Neurosci 1,222-238 10 Roychoudhury,R andWu, R. (1980)Terminaltransferase-catalyzed addition of nucleotidesto the 3’ termimof DNA Meth Enzymol 65,43-62. 11. Rogers,A. W (1979) Technrquesof Autoradiography. Elsener, Amsterdam,pp. 201284
12 Pringle,J H , Rupral, A K , Primrose,L , Keyte, J., Potter, L , Close,P , andLauder,I (1990) In situ hybridization of lmmunoglobulinlight chain mRNA m paraffin sections usmgbiotmylatedor hapten-labeled ohgonucleotldeprobes.J Puthol 162, 197-207 13 Melton, D A , Krieg, P A., Rebaghati,M R., Mamatls,T , Zmn, K , andGreen,M R (1984) Efficient in vitro synthesisof biologically active RNA and RNA hybridization probesfrom plasmidscontammga bacteriophageSP-6promoter NucleicAcids Res.12, 7035-7056.
14. Patterson,S., Gross,J., andWebster,A. D. B. (1989)DNA probesbmdnonspecifically during in srtuhybridization: carbolchromotropeblocksbmdmgto eosinophllsbut does not mhlblt hybridization to specificnucleotldesequences. J Vwol Methods23, 105-109 15 Burgm,K. E , Waxham,M N., Rlckhng,S , Westgate,S A., Mobley, W C , andKelly, P T. (1990)In situ hybrldizatlon hlstochemlstryof Ca*+/calmodulm-dependent protein klnasem developingrat brain. J. Neuroscr10, 1788-1798 16. Gerfen,C. R (1989)Quantificationof rn situ hybridization hlstochemlstryfor analysisof brainfunction MethodsNeurosci 1,79-97. 17 Lyons, K M., Pelton,R. W , andHogan,B. L (1990)Organogenesls andpatternformation m the mouseRNA distributionpatternssuggesta rolefor bonemorphogenetrc protein-2A (BMP-2A). Development109,833-844 18. Ada, G L., Humphrey,J H., Askonas,B. A , McDevltt, H. 0 , andNossal,J G V. (1966) Correlationof gramcountswith radloactlvlty (i25Iandtntium) m autoradlography.Exp Cell Res 41,557-572. 19. Haase,A. T., Retzel, E. F, and Staskus,K A. (1990) Amphficatlon and detectionof lentlvlral DNA insidecells Proc Nat1 Acad SCLUSA87,4971-4975
CHAPTER 25
mRNA In Situ Hybridization to In Vitro Cultured Cells Anton
K Raap, Frans M. van de Rgke, and Roeland W. Dirks
1. Introduction In basic and applied biomedical research there is a considerable interest in having reliable RNA in situ hybridization techniques, since these allow the detection of RNA expression in a morphological context at the individual cell level, Conventional molecular biology techniques for RNA analysis such as Northern hybridizations, RNase protection assays, and reverse transcription polymerase chain reactions (RT-PCR) demand the homogenization of the tissue or cell sample, In these casesthe possibility of relating (changes in) RNA expression to histo- and cytomorphological information is lost to a very large extent. Several direct and indirect nonradioisotopic nucleic acid labeling formats are now available (for reviews, see refs. Z-3). In conjunction with advanced molecular cloning, PCR, and automated DNA synthesis methods, they provide excellent tools for DNA and RNA in situ hybridization studies. Improved labeling, immunocytochemical detection, and microscopic imagmg procedures, in conjunctton with optimization of chromatin preparation, have already resulted in reproducible DNA in situ hybridization protocols that permit sensitive and high resolution mapping of small unique DNA (461, as well as large genomic clones by incorporating the principle of suppresston hybridization (7-9). The ability of nonradioisotopic methods to discriminate, within one and the same preparation, multiple DNA sequences simultaneously has contributed significantly to these developments (I&14). Although significant progress has been made in the methodology of RNA in situ hybridization, its nonradioisotopic counterpart has not reached the level of sensitivity and reproducibility that has currently been achieved for DNA in situ hybridization protocols for molecular cytogenettc and clmical applications, such as gene mapping and interphase diagnosis. Here we describe a protocol for fluorescence RNA in situ hybridization using double stranded (ds) DNA probes to m vitro cultured, adherent cells such as HeLa. The protocol permits the detection of abundantly expressed housekeepmg gene transcripts like human elongation factor (HEF) and glyceraldehyde phosphate dehydrogenase From Edlted
Methods fn Molecular Salogy, VoI 33 In SW by K H A Choo CopyrIght (D 1994 Humana
293
Hybflduatron Protocols Press Inc , Totowa, NJ
294
Raap,
van de Rijke,
and Dirks
(GAPDH) mRNA with high signal-to-noise ratios. It is estimated that transcripts that have an abundancy that is about lo-fold less, should also be detectable.
2. Materials 1. Cell culture media and disposables. 2. Sterihzed microscope object slides coated with gelatin/chrome alum or polylysme 3. Fixatives: 4% formaldehyde, 5% acetic acid in 0.9% NaCl, and 1% formaldehyde in PBS. 4. 0.1% Pepsin (Sigma, St. Louis, MO) in O.OlMHCl, freshly prepared from a 10% stock in H,O. 5. Biotin-, drgoxigenin-, fluorescem-, or rhodamine-labeled cDNA probes. 6. Formamide 7. 20X SSC: 3M NaCl, 0.3M Na-citrate, pH 7.0 8. Dextran sulfate (Pharmacia, Uppsala, Sweden) 9. Herrmg sperm DNA (Sigma). 10. Yeast RNA (Sigma). 11 Biotin- and dlgoxigenm detection reagents* avidin-FITC, and -TRITC (Vector, Burlingame, CA) biotinylated goat antravidin (Vector); sheep antrdigoxigeninFITC, and -TRITC (Fab fragments; Boehringer Mannheim, Mannheim, Germany), mouse monoclonal antidigoxlgenin (Boehringer), digoxrgeninylated-sheep antimouse-Ig (Boehringer). 12. 10X PBS: 80 g NaCI, 2 g KCI, 14 49 g Na2HP04, 2 49 g KH,PO&. 13. Immunology buffer (TNT): 0 1M Tns-HCI, pH 7 4,O. 15M NaCl, 0 05% Tween-20 14 Blocking reagent (Boehringer). 15. 4’,6-Diamldmo-2-phenylindole (DAPI) 16. Vectashteld embedding medrum (Vector). 17. Modern epifluorescence microscope equipped with appropriate filter sets. 18. Graded series of ethanol: 70,90, and 100%. 19. Hybridization buffer: 60% deionized formamide, 2X SSC, 50 mil4 sodium phosphate, 5% dextran sulfate, pH 7.4
3. Methods 1. 2 3 4 5. 6. 7 8. 9. 10 11.
3.1. CeLl Culture and Fixation Culture cells in the appropriate medium and CO;! atmosphere. For convenience of subsequent handling, seed the cells in a Petri dish containing gelatin/chrome alum or poly-L-lysine coated glass object slides. Rinse briefly with PBS Fix with 4% formaldehyde, 5% acetic acid in 0 9% NaCl for 20 mm at room temperature (see Note 1). Wash m PBS for 5 mm. Dehydrate through a graded series of ethanol, 5 mm each. Immerse slides in 100% xylene, or Hlstoclear for 10 mm to remove lipids. Dehydrate in PBS for 5 min. Incubate in 0.1% pepsin in O.OlM HCl at 37°C for 10 min (see Note 2). Rinse in PBS. Postfix in 1% formaldehyde m PBS for 10 min. Dehydrate as in step 5
mRNA-ISH
to Cultured
295
Cells
3.2. Probe
Preparation
Procedures for labeling DNA with haptenized (e.g., biotm or digoxigenm) or fluorochromized (e.g., fluorescem or rhodamrne) labeled dUTPs are described in detail elsewhere in this book (Chapter 11) (see also Notes 3 and 4). 1, Purify the labeled probes by gel filtration. 2. Add 50-fold excess of sheared herring sperm DNA and ethanol precipitate. 3 Dissolve the pellet m hybridization buffer at a stock probe concentration of 20 ng/pL. Final probe concentrations for in situ hybridrzatron are 5 ng/pL. 3.3. RNA In Situ Hybridization 1. Denature the probe at 80°C for 10 min. 2. Apply the denatured probe solution to the target area, e g., 5 PL under a 18 x 18 mm2 coverslip. (Optionally, probe and target RNA can be denatured simultaneously at 80°C for 10 min.) 3. Hybridize overnight at 37°C m a humidified atmosphere (humidifier is 60% formamide, 2X SSC). 4. Wash twice for 10 min each in 60% formamide12X SSC at 42”C, and twice for 10 min each in the same solution at room temperature 5 Rinse in TNT buffer. 1. 2. 3. 4 5
3.4. Immunocytochemical Detection and Embedding Incubate for 15 min at 37°C in TNT buffer containing 0 5% blockmg reagent Wash with TNT buffer three times for 5 min each. For all antibody incubations, supplement the TNT buffer with 0.5% blocking reagent. Incubate with antibodies at 37°C for 30-45 mm Perform all washing steps with TNT buffer three times for 15 mm each
In the following sectrons, we describe one-, two-, and three-step procedures for biotin- and digoxigenin-labeled probes. Recommended dilutions are indicated for the reconstitutton volume suggested by the suppliers. 6. In the one-step procedure: For drgoxigenin-labefed probes, incubate wtth 1:200 of sheep antidrgoxtgenin-FITC or -TRITC (Fab fragments). For biotin-labeled probes, incubate with 1: 1000 dilution of avidin-FITC or -TRITC 7 In the two-step procedure for drgoxigenin-labeled probes* Incubate with 1.200 dilution of mouse monoclonal antidigoxigenm, followed by 1.500 dilution of rabbit-antimouse-FITC or -TRITC. 8. In the three-step procedure* For biotin-labeled probes, incubate with 1: 1000 dilution of avidin-FITC or -TRITC, followed by 1: 100 dilution of biotinylated goat-anuavidm, followed by 1:lOOO dilution of avidin-FITC or TRITC. For digoxigenin-labeled probes, incubate with I:200 dilution of mouse monoclonal antrdigoxigenin, followed by 1:200 dilution of digoxigeninylated sheep antimouse-Ig, followed by 1:200 dilution of sheep antidigoxigenin-FITC or -TRITC (Fab fragments). 9. After the last wash, dehydrate, air-dry, and embed in Vectashield containing 75 ng/pL DAPI. Slides hybridized with fluorochrome-labeled probes can be embedded directly after the posthybndization washings
See Notes 5-10 for discusstons on procedural variattons.
296
Raap,
van de Rijke,
and Dirks
4. Notes We have previously described many variations in the specific steps of this general protocol (see refs. 15-18). Objecttve evaluation of the effects of these procedural variations on the final signal-to-noise ratios requires cytofluoro- or photometric analyses. Such studies are still scarce. Hence, only qualitative statements can generally be made. In the followmg notes, we describe our experience with a number of these variations in such qualitative terms. 1. Fixation. Fixation by crosslinking with formaldehyde for limited time periods IS traditionally used for mRNA in situ hybridization of cultured cells possibly because it provides, in conjunction with limited protease digestions, a workable balance between the retention of RNA and cell morphology, and accessibility of macromolecular reagents (19,20). In our studies, we found a beneficial effect of adding 5-20% acetic acid to the 4% formaldehyde. The optimal concentration may vary for different cell lines (18). 2. Protease pretreatment. A positive effect of protease treatment IS beyond doubt, although the optimal concentration and/or time of treatment should be opttmtzed for each application (15,21). We prefer pepsin over protemase K because it results in better preservation of cell morphology, and is less critical in terms of the intensity of the treatment than it is with proteinase K (22) 3. dsDNA or ssRNA probes. Although the protocol is written for standard nicktranslated dsDNA probes, purified cDNA plasmid inserts, or PCR products thereof, we have used in vitro transcribed ss antisense RNA probes (23) and have obtained somewhat better results in terms of intensity of signal However, critical tttration of the ssRNA probe concentration, and high stringency hybridization conditions are recommended to prevent cross hybridization with rRNA. Also, probe lengths are critical and should not exceed 500 bp. 4. Direct and indirect methods: Although the protocol describes indirect detection procedures, we have obtained good results with rhodamine- or fluorescemlabeled probes for such abundantly expressed transcripts as elongation factor mRNA (18) The three-step procedure yields the strongest signals 5 Heat treatment of the cells. This has been shown to be a useful step Since such a treatment may lead to DNA denaturation, in studies dealing with the spatial relationship of genomic DNA and nuclear RNA, drscrimination between the gene and its primary transcript may become difficult (18,24-26). Lower temperatures of denaturation as recommended in the protocol have been proven to yield the same beneficial effect on RNA detection without obtainmg genomic DNA signals (P. Lichter, personal communication). 6. Preventing exo- and endogenous RNase activity. In initial studies, we have investigated measures to prevent RNase activity For the PBS solutions used before the immunocytochemical detection steps, we have performed autoclaving m the presence or absence of diethyl pyrocarbonate (DEPC). For the targets under study, we saw no difference between the two treatments With the exception of the short PBS wash shortly before fixation and hybridization, the successive solutions used can in fact be considered as mactivatmg for RNases (e g., ethanol for dehydration, xylene, pepsine in HCl acid, formamide contammg solutions).
mRNA-ISH
7.
8.
9.
10.
to Cultured
Cells
297
After hybridization the target is in duplex and therefore protected from RNase action. However, sttuations may be envrsaged in which RNases hydrolyze RNA sequences flanking the hybrid leading to dissociation of the m situ hybrid. However, comparison of incubations with and without vanadylribonucleoside complex present as an RNase inhibitor during immunocytochemical incubations showed no difference in srgnal intensities. We therefore conclude that it is sufficient to work with stertle solution without DEPC or specrfic RNase inhibitors Controls. As a positive procedural control, we frequently use rtbosomal RNA as a target (I&27). Very bright signals should be obtained, before proceeding with in situ hybridization for less abundant targets. To ascertain penetration of probes, in situ hybridization of nonexpressed probes (e.g , alphoid DNA in human cells) to denatured cells IS recommended. As specificity controls, several irrelevant probes should be brought through the same procedure. Trivial controls such as RNase treatment and omission of one or more of the key reagents in the rmmunological detection steps should also be performed. The issue of specificrty of RNA in situ hybridization should not be underestimated because supportive proof of speciftcrty can not be obtained on the basis of molecular weight of the target, as is offered by Northern hybridizations. Spurious in sctu hybrldizatron of probes to rRNA may be obvious from nucleolar localization of signals. Sensitivity. Figures 1A and B give typical results of in situ hybridization of a HEF-mRNA to pepsin- and heat-pretreated HeLa cells, and of a control hybridization, respectively. The specific hybridization gives rise to numerous dot-like signals, whereas in the control the number of signals drop to a few per cell. On the basis of such results, we estimate that RNAs present in a lo-fold less copy number should be detectable by the method. As an illustrative comparison, the HEF mRNA was detected as a strong band with standard Northern hybridization using 32P as the label, 10 pg of total cytoplasmic RNA as input material, and 2-6 h of autoradiographrc exposure. Further research is necessary to more objectively determine the lower limits of the present protocol. Brightfield detection. As an alternative to fluorescence detection, brightfield detection of enzyme labels instead of fluorescent labels can be used. For that purpose, the flurochrome-conjugated antibodies used in the indirect procedures are substituted by peroxidase or alkaline phosphatase conjugates. The enzyme labels are visualized, for example, using the diammebenzidine reaction for peroxidase, or the nitroblue tetrazolium reaction/bromo-chloro indolyl phosphate reaction for alkaline phosphatase (see Fig 2 for an example of rRNA detection using peroxidase as the final label). For other enzyme cytochemrcal reactions, see ref. 28 With these enzymes, bicolor detection of mRNAs can also be achieved. However, for multicolor detection of different RNA species that reside in the same cell, fluorescence in situ hybridization is recommended (1617) Potential remedres for the autofluorescence problem. A factor limiting sensitrvtty of fluorescence in srtu hybridization is undoubtedly autofluorescence of the cells (29). Such autofluorescence 1scomposed of natural fluorescence of the cells as well as fixation-induced fluorescence Glutaraldehyde, for example, IS well known for its induction of high autofluorescence levels and IS therefore not recommended for fluorescence m situ hybrtdizatlon. Limited formaldehyde frxa-
298
Raap, van de R(jke, and Dirks
Fig. 1 (see color plate number 2 after p. 172). Fluorescence in situ hybridization to human elongation factor mRNA in pepsin- and heat-pretreated HeLa cells. (A) Specific hybridization with digoxigenin-labeled 1.4 kb cDNA (31) using the three-step detection procedure and fluorescein as the reporter molecule. (B) Control hybridization with digoxigenin-labeled heterologous probe (pSS-DNA, see ref. 26) and identical detection procedure. Nuclear counterstain was DAPI.
Fig. 2 (see color plate number 3 after p. 172). In situ hybridization to rRNA in pepsin-and heat-pretreatedHeLa cells. Hybridization waswith a digoxigenin-labeled2.1 kb 28S-rDNA fragment(27). One-step-detectionwaswith peroxidase-conjugated antidigoxigeninand the diaminebenzidinereaction. tions give reasonably low levels of autofluorescence, but for small and low copy number targets it may still be too high to permit genuine in situ hybridization signalsto reach the detection level. A potential remedy for this fundamental problem may be the use of final reporter molecules that possesslong luminescence decay times so that the generally short-lived autofluorescencecan be gated out in time using time-resolved microscopy. Encouraging resultswith such time-resolvable luminescent reporter molecules have recently been described (30).
Acknowledgments The authors wish to thank Mels van der Ploeg for valuable discussions,and Ton Maassen and Jan Bauman for the HEF and rDNA probes, respectively, and interest in our work. This work was supported in part by NWO-grant no. 534-060.
mRNA-ISH
to Cultured
Cells References
1. Lichter, P., Boyle, A. L., Cremer, T., and Ward, D. C (1991) Analysis of genes and chromosomes by non-isotopic m situ hybrtdization. Genet. Anal Techn Appl 8,24-35. 2. McNeil, J. A, Johnson,C. V , Carter, K. C , Singer,R H., andLawrence,J. B (1991) LocalizmgDNA andRNA within nucleiandchromosomes by fluorescencem sztu hybrrdizatron Genet. Anal. Techn. Appl. 8,41-58. 3. Raap,A. K., Nederlof,P M., Dirks, R. W , Wlegant,J C A G , andVan der Ploeg,M (1990) Useof haptemzednucleic acid probesin fluorescentm situ hybrrdization, in In Situ Hybrtdlzation* Application to Developmental Biology and Medicine (Harris, N and Williams,D. G., eds), CambridgeUniversity Press,Cambridge,pp 33-41. 4 Landegent,J. E., Jansenmde Wal, N., Van Ommen,G. J B., Baas,F , De Vijlder, J. J. M , Van Duijn, P., andVan der Ploeg,M. (1985)Chromosomal localrzationof a uniquegene by non-autoradiographrc in srtu hybridization. Nature 317, 175-177 5. Lawrence,J. B., Vrllnave, C. A., andSinger,R. H. (1988)Sensitivehigh-resolutionchromatinandchromosome mappingin situ: presenceandorrentatronof two closelymtgrated copiesof EBV in a lymphomaline. Cell 52,51-56. 6. Wiegant,J., Galjart, N. J , Raap,A K., andd’Azzo, A. (1991)The geneencodinghuman protective protein (PPGD)ISon chromosome 20 Genomrcs 10, 345-349. 7 Landegent,J. E , Jansenin de Wal, N., Drrks, R. W , Baas,F., and Van der Ploeg,M (1987)Useof wholecosmidclonedgenomicsequences for chromosomal locahzationby non-radioactivem situ hybridrzation.Hum. Genet 77, 366-370 8 Lmhter,P., Tang, C C., Call, K , Hermanson, G., Evans,G A., Housman,D , andWard, D. C (1990)High resolutionmappingof humanchromosome11by m situ hybridization with cosmrdprobes.Science247,64-69. 9 Trask, B , Pinkel, D , andVan denEngh,G. (1989) The proximity of DNA sequences in interphasecell nuclei is correlatedto genomicdistanceandpermitsorderingof cosmids spanning250krlobasepairsGenomics 5, 710-717. 10. Dauwerse,J G., Wtegant, J , Raap,A. K., Breunmg,M. H , andVan Ommen,G. J. B (1992) Multiple colors by fluorescencem srtu hybndizatron using ratio-labeledDNA probescreatea molecularkaryotype. Hum. Mol. Genet. 1,593-598. 11 Nederlof,P. M , Van derFlier, S.,Wiegant,J., Raap,A K., Tanke, H. J., Ploem,J S., and Van der Ploeg,M (1990) Multiple fluorescencem situ hybridization procedures.Cytometry 11,126-131.
12. Ried, T., Balduu, A., Rand,T. C., andWard, D. C. (1992)Simultaneous vtsualizatronof sevendifferent DNA probesby in situ hybridization usingcombinatorialfluorescenceand digital imagingmicroscopyProc Natl. Acad. Scl USA 89, 1388-1392 13. Wregant, J , Ried, T., Nederlof, P. M., Van der Ploeg, M , Tanke, H J , and Raap,A. K. (1991) In situ hybridization wtth fluorescematedDNA Nucleic Acids Res 19, 3237-3241. 14.Wiegant, J , Kalle, W., Mullenders,L., Brookes,S., Hoovers,J. M N., Dauwerse,J G., and Van Ommen,G. J. B. (1992)High-resoluttonzn situ hybridization usingDNA halo preparationsHum Mol. Genet 1, 587-591. 15 Dirks, R. W , Raap,A K., Van Minnen, J , Vreugdenhil,E., Smit, A B., and Van der Ploeg,M. (1989)Detectionof mRNA moleculescodingfor neuropeptidehormonesof the pond snarlLymnaeastagnalisby radioactiveandnon-radroactivezn situ hybridizatron a modelsystemfor mRNA detechonJ, Histochem Cytochem. 37,7-14. 16 Dirks, R. W., Van GrJlswijk,R. P. M , Tulhs, R. H., Smut,A. B., Van Mmnen, J , Van der Ploeg,M , andRaap,A. K (1990)Simultaneous detectionof drfferent mRNA sequences codingfor neuropeptrdehormonesby doublein snu hybrrdrzatlonusingFITC- andbrotrnlabeledoligonucleotidesJ Hlstochem Cytochem 38467-473.
Raap,
van de Rijke,
and Dirks
17 Dirks, R. W , Van GijlswtJk, R P. M , VOOIJS, M. A., Smit, A B., Bogerd,J., Van Mmnen, J , Raap, A K , and Van der Ploeg, M. (1991) 3’-endfluorochromlzedand haptemzed oligonucleotidesasin situ hybridizatron probesfor multiple, simultaneous RNA detection Exp. Cell Res. 194, 3 1O-3 15 18 Dirks R W., Van deRijke, F. M , Fujlshita,S , Van derPloeg,M , andRaap,A. K. (1993) Methodology for specificmtron- andexon RNA detectionin culturedcellsby haptemzed andfluorochromtzedprobes.J CellScr 104,1187-l 197 19. Angerer, L. M. andAngerer, R C. (1981)Detectionof poly A+ RNA in seaurchin eggs andembryosby quantitativein situ hybridtzatton NucleicAcids Res. 9,2819-2840. 20. Lawrence,J. B and Singer, R. H (1985)Quantitative analysisof in srtu hybridization methodsfor the detectionof actmgeneexpressionNucleic Actds Res. 5, 1777-1799. 21 Larsson,L.-I. andHougaard,D M. (1990)Optimrzationof non-radtoactrvein situ hybndizatton. imageanalysisof varying pretreatment,hybridization andprobelabelingcondtttons.Htstochemrstry 93,347-354. 22 Burns,J., Graham,A K , Frank, C , Fleming,K A., Evans,M F , andMcGee, J 0 D. (1987)Detectionof low copy humanpaprllomavuus DNA andmRNA m routineparaffin sectionsof cervix by non-tsotoprcin sttu hybridization .I Clm. Pathol 40,858-864 23 Cox, K. H , DeLeon,D. V , Angerer, L. M., and Angerer, R. C. (1984) Detection of mRNAs in seaurchin embryosby rn srtu hybrrdrzattonusingasymmetricRNA probes Dev Biol. 101,485-502
24. Huang,S. andSpector,D L. (1991) Nascentpre-mRNA transcriptsare associated with nuclearregionsenrichedin sphcmgfactors.Gene Dev. 5, 2288-2302 25 Lawrence,J. B , Singer, R H., and Marselle,L. M (1989) Highly localized tracks of specifictranscriptswtthm interphasenuclei visualizedby m srtu hybndtzation. Cell 57, 493402.
26 Raap,A K., Van de RiJke,F. M , Dtrks, R W., Sol, C J., Boom,R , andVan der Ploeg, M (1991)Brcolor fluorescencetn situ hybrtdizatronto mtronandexon mRNA sequences Exp Cell Res. 197,319-322
27 Bauman,J G J andBentvelzen,P. (1988)Flow cytometric detectionof rrbosomalRNA in suspended cellsby fluorescentm situ hybridization Cytometry 9,517-524 28 De Jong,A S H., Van Kessel-VanVark, M , andRaap,A. K (1985)Sensttrvrtyof varrous visualization methods for peroxrdase and alkaline phosphataseactivity in tmmunoenzymecytochemtstry Hlstochem. J. 17, 1119-l 130 29 Tanke, H. J (1989)Doeshght microscopyhavea future?j Mrcrosc. 155,405-418. 30. Beverloo, H. B , van SchadewiJk,A., Van Gelderen-Boele,S, andTanke, H. J (1990) Inorganicphosphors asnewlummescent labelsfor tmmunocytochennstry andtime-resolved microscopy Cytometry 11,784-792. 31. Brands,J. H G. M., MaassenJ. A , Van Hemert,F J , Amons,R , andMoller, W (1986) The primary structureof the a subunitof humanelongationfactor 1, Structuralaspectsof guanme-nucleotrde-bmdmg sites Eur J Blochem 155, 167-171
CHAPTER
26
Quantitative In Situ Hybridization Using Radioactive Probes in the Study of Gene Expression in Heterocellular Systems Catherine
Le Moine, Vkronique and Bertrand Bloch
Bernard,
1. Introduction Quantrtattve in situ hybridization has emerged as a powerful technique for the study of gene expression withm complex heterocellular systems, such as the central nervous system, by allowing the measurement of the relative levels of mRNA and their variations under experimental or physiological conditions. When compared with other quantitative techniques, such as Northern blot or dot blot, this approach enables the analysis of gene expression not only at the regional level but also at the cellular level, and is partrcularly useful for the study of heterogeneous cellular populations (Z-6). Quantitative in situ hybrtdtzation has been widely developed during the past 10 years, especially in the area of Image analyzer systems,and has reached a very htgh level of sensitivity by using appropriate standardization and methods of measurement (Z,2,5-9). For quantitative in situ hybridization, two levels of analysis yield different and complementary mformatton: (1) macroscopic study using densttometry on Xray films, which measures vartations of mRNA at the anatomical level, and (2) microscoprc study, which measures mRNA at the cellular level. For several years, our group has worked on gene expression in the central nervous system, which will be the source of the examples used in this chapter. Particularly, we have investigated the dopaminergic control in the nigrostrtatal complex, with specific emphasis on the interactions between dopaminergic neurons and striatal target neurons (5,10). Using pharmacologrcal treatments, we have explored how changes in the dopaminergic environment may lead to the modification of the expression of genes coding for neuropeptides, biosynthetic enzymes, and neuroreceptors that are present in the striatum. Given the anatomical complextty and heterogeneity of this structure, the analysts of alterations in gene expression and the study of cellular subpopulattons and/or the number of cells expressing a given gene have required us to develop a procedure of quantitattve in situ hybridization that would allow us to measure mRNA From Edlted
Methods UI Molecular Bfology, Vol 33 In Situ Hybnduatron Profocols by K H A Choo Copyright Q 1994 Humana Press Inc , Totowa, NJ
301
302
Le Moine,
Bernard,
and Bloch
levels not only at the anatomical level, but also at the level of smgle cells. This chapter provides a detailed description of such a procedure that, with minimal modrfications, should be readily applicable to the study of gene expression in other heterocellular systems.
2. Materials 1. 2. 3. 4. 5. 6 7. 8 9. 10. 11. 12. 13. 14 15. 16. 17. 18 19. 20
Chloral hydrate. 1% Paraformaldehyde, pH 7.2, m O.lM phosphate buffer. 15% Sucrose, O.lM phosphate buffer, pH 7.2. Liquid nitrogen. Gelatin-coated slides. Cryostat sections of 1% paraformaldehyde-fixed tissue Saline buffer. 0 1M Phosphate buffer, pH 7 2 35S-labeled radioisotope: 35S-dATP, NEN Biotechnology (Boston, MA) 8X SSC stock: 1.2M sodmm chloride, 0.12M trisodium citrate. Denhardt: 2% bovine serum albumin, 2% ficoll, 2% polyvinylpyrrolidone. 4X SSC, 0.1% Denhardt. 4X SSC, 1.33% triethanolamine, 0.25% acetic anhydride, pH 8.0. Hybridization buffer: 2X SSC, 50% formamide, 10% dextran sulfate, 500 wg/mL salmon sperm DNA, 1% Denhardt, 5% sarcosyl, 250 l.tg/mL yeast tRNA, 200 mM DTT, 20 tnM NaH2P04. Humidified chamber and incubator. X-ray films (Kodak X OMAT AR5 [Bridgeport, NJ] or Amersham [Arlington Heights, IL] PMAX) and photographic emulsion (Ilford, Polysciences, Warrington, PA, K5) Toluidine blue. Optical table and microscope fitted out with epifluorescence. Image analyzer system (Biocom, Les Ulis, France) allowmg densltometric analysis and silver grain counting. Statistical analysis program.
3. Methods Before the start of the experiment,
tt 1s necessary to define clearly the vari-
ous parameters to be measured, and to choose an appropriate number of samples and animal groups for quantitative analysis. The latter is particularly important to ensure that results can be analyzed statistically, especially for small variations m gene expression. In a standard pharmacological experiment that we perform, 6-8 animals per group appear to be a suitable number. It is also important to adhere to a good standardized protocol as we will describe, from tissue preparation to statistical analysis of the results. In the present protocol, in situ hybridization on brain sections is performed using oligonucleotide or cDNA probes labeled with 35S-dATP. Relative varratrons in mRNA levels are measured against radioactive standards. Quantification is performed
Quantitative
In Situ Hybridtzation
303
with an image analyzer system (Biocom) at the macroscopic and microscopic
levels (see Note 1). 3.1. Tissue Preparation 1. Maintain adult male rats (Wistar, 150-200 g) in standard housing conditions, and perform pharmacological treatments on different animal groups according to the requirement of the experiments. 2. At 24 h following the last inlection, anesthetize the rats with chloral hydrate and perfuse through the heart with 1% paraformaldehyde, pH 7.2, m 0 1M phosphate buffer. 3. Dissect out the brains and immet se for 1 h in the same fixative 4. Next, immerse in 15% sucrose, O.lM phosphate buffer for 16 h. 5. Freeze in liquid nitrogen, pH 7.2. 6. Cut the brains into lO+m-thick frontal cryostat sections. Collect on gelatmcoated slides and store at -80°C until use
3.2. Generation ofRadioactive Standards Radioactive standards are generated using brain paste and allow the conversion of optical densities (OD) on X-ray film, or the silver gram densities in tissue sections, mto quantities of radioacttvtty that are a function of the mRNA levels (see Note 2). These standards are prepared as follows: 1 Homogenize rat brains, previously perfused with saline buffer, m O.lM phosphate buffer, pH 7.2 2. Concentrate the brain paste by centrifugatlon for 20 min at 10,OOOg 3. Freeze in lo-mL aliquots and store at -80°C until use. These aliquots may be stored for several years. 4. Prepare 16 dilutions of 35S-labeled nucleotide in distilled water (from approx 3500-1,500,000 cpm/pL). 5. Thaw an aliquot of brain paste 6. Incorporate and homogenize 40 p.L of each radioactive dilution mto 500 pL of brain paste. 7. Transfer the paste mto a straw and flash-freeze m liquid nitrogen. 8. When frozen, cut the brain paste cylinders into lo-pm-thick cryostat sections, and collect them on gelatm-coated slides 9. Take 10 sections from each serial radioactive dilution, collect them m scmtillant cocktail, and count them to get the radioactive value for each “spot.”
The radioactivity concentratton is expressed in nCi/mg of &sue. For the macroscopic analysis, a slide bearmg all the 16 dilutions IS exposed on X-ray film with the hybrtdtzed brain sections (Figs. 1 and 2). For mrcroscopic analysis, four sections of each dilution are collected on slides (Fig. 2). These are dipped in photographic emulsion, exposed, and developed in parallel with the hybridized brain sections. All the slides bearing the radioacttve standards are kept in a box at room temperature.
304
L+eMoine, Bernard,
and Bloch
Fig. 1. X-ray film showing autoradiograms of the hybridized sections from control (C) and treated (‘I) animals and the radioactive standards (bottom two rows). Measurement of optical densities is done for each standard and a calibration curve is generated. The signal on each section is then delineated, and the optical densities are measured and converted into concentration of radioactivity using the calibration curve.
3.3. In Situ Hybridization 3.3.1. Labeling of the Probes All the probes are labeled using standard protocols, as previously described (5,10). Oligonucleotide probes are labeled with 35S-dATP by “tailing,” i.e., addition of nucleotides at the 3’-end. Nick-translation is used to label cDNA probes (see Note 3). 3.3.2. In Situ Hybridization In situ hybridization is performed with the three usual steps of prehybridization treatment, hybridization of the probe, and posthybridization washes.
Quantitative
305
In Situ Hybridmation Radloactivity concentration nCi/mg of tissue Id
12
2d
4d
6d
10 .
0
OptIcal density (OD)
B
Radloactivity concentration nCl/mg of tissue
3 weeks
2 weeks
0 6
0 1
02
03
0.4
0.6
06
0.7
0 8
Silver grain density
Fig. 2. (A) Relationbetweentheradroactivityconcentrationandtheopticaldensrty(OD) measuredon X-ray film Exposuretimesfor the samefilm are 1,2,4, and6 d (B) Relattonbetween the radtoactivtty concentratronand the silver gram densrty on radtoacttve standardsafter microautoradiography. Exposurettmesfor the samestandards are2 and3 wk
The standardization of these steps is necessaryto provide hybrldlzatlon signals suitable for quantification. Within the same experiment, all the slides must be treated identically, especially with the same buffers and dilutions of the probe during the hybridization.
306
Le Moine,
Bernard,
and Bloch
3.3.2.1. PREHYBRIDIZATION TREATMENT 1 Thaw the slides. 2. Wash twrce for 30 min m 4X SK/O 1% Denhardt 3 For oligonucleotide probes, wash the slides twice for 10 mm in 4X SSC, then incubate for 10 min in 4X SSC/l 33% triethanolamme/0.25% acetic anhydride, pH 8. This step decreases the background by acetylation of free-radicals 4. Dehydrate twice in 100% ethanol and air-dry. 3.3.2.2. HYBRIDIZATION 1. Centrrfuge the labeled probe (stored m ethanol/acetate) for 1 h at 10,OOOg. 2. Remove the supernatant and dry the pellet under vacuum 3. Resuspend the pellet in hybrrdrzatron buffer to a concentration of 30 pg/pL for cDNA probes or 3 pg/pL for ohgonucleotide probes Some 20-50 pL of probe IS sufficient for use wtth coverslips. For a better homogenetty of the hybridization signal, hquid-phase hybridizatron m vertical glassware gives excellent results, but this approach may be constrained by the use of much larger quantities of probe (1 O-20 mL of hybridization buffer for approx 16 shdes) (see Note 4) 4 Hybridize overnight at 40°C in a humidified chamber. 3.3.2.3. POSTHYBRIDIZATION WASHES 1. Wash the slides briefly in cold 4X SSC 2. Wash twrce for 30 mm each m 1X SSC at room temperature with agitation. 3 Wash twice for 30 min each m 1X SSC at 40°C with agrtatron. 4 For oligonucleotide probes, wash twice for 30 mm each in 0.1X SSC at 40°C with agitation. 5 Dehydrate twice in 100% ethanol and air-dry. 6 Expose the hybridized sections on the same X-ray film at the same time as the radioactive standards for macroscopic analysis (Fig. 1) Note that the radioactive standards are counted for each experiment to take mto account radioactrvrty decay in the constructron of the calrbration curve. 7. After exposure on film, dip the hybridized sections and the standards (4 “spots” of each dilution) m emulsion and expose for 3-8 wk at 4°C in the dark. 8 Develop Stain in Tolurdme blue, and mount. The quantitative microscopic analySIS 1s then done on these stained sections 3.4. Procedure of Measurement and mRNA Quantitation Quantitative measurements of changes in gene expresston can be performed in two different ways: 1 Macroscopic analysis using densitometry on X-ray film Thts provides information at the regional level 2. Mrcroscoptc analysts by silver gram counting. This provtdes information at the cellular level This step is necessary for the study of cellular subpopulattons and/ or cells whose density does not allow a macroscoprc analysts. The quantitatrve analyses are performed using an image analyzer system fitted with a densitometric image system and a microscope with epr-illummatron. A CCD camera provides a computerrzed image on a video monitor on which the regrons of interest are delineated.
Quantitative
307
In Situ Hybridization 3.4.1. Macroscopic
1 2
3. 4
Analysis Place the X-ray film (Fig. 1) on the optical table, and use the camera to record the image on the video monitor Measure the optlcal den&es of the standards withm a square area, and construct a calibration curve representing optical densities as a function of the radloactivity concentration (Fig 2A). It is important that the probe concentration and the exposure time be determined before the experiment in order to stay within the linear part of the cahbratlon curve. Delineate the areas of interest on the video screen. Measure the optical densities, and convert these into radioactlvity using the calibration curve. These values are representative of the quantity of probe hybridIzed, and therefore correspond to the relative mRNA level m the area 3.4.2. Microscopic
Analysis
The microscopic study is performed at x50 magnification under fluorescent epi-illumination and normal illummation. Silver grain counting is based on the
procedure described by Bisconte et al. (II) with the number of grains expressed as a function of the quantity of reflected light. The image analyzer system provides a rapld estimation of the gram number over single cells, thus provldmg information on the quantity of the hybridized probe and the mRNA level. The measurements are performed as follows: 1 Construct an internal calibration curve for each section to be analyzed under eplillummation only, and measure the mean quantity of light reflected by a known number of grains (0, 1, or 2) within a constant square area 2. Construct a calibration curve and memorize the number of grains as a function of the amount of reflected light. 3. Identify labeled cells under normal lighting (Fig. 3A) and delineate on the video monitor (Fig. 3B). 4. Measure the quantity of light reflected in the area under epi-illumination only (Fig. 3C), and convert this into number of grains, then rnto grain density (grain number/km2) using the calibration curve 5. Measure the gram density of the background over randomly chosen areas outside the labeled cells. 6. Subtract the mean background value from the grain density measured on each cell 7 Convert the final data for each cell mto concentration of radioactivity usmg the calibration curve generated by the measurement of silver grain densities over the brain paste standards (Fig 2B). This value gives an index of the cellular mRNA level. 3.4.3. Statistical
Analysis
of the Results
The variation of mRNA expression, at the macroscopic and microscopic levels, are assessed using a multifactorial analysis of variance (multlfactor ANOVA). For the microscopic studies, the distribution of the grain densities over single cells is plotted for the experimental
and the control groups, and com-
pared using a two-tailed Kolmogorov-Srmmov sample test (see Notes 5 and 6).
Le Moine, Bernard,
and Bloch
Fig. 3. Protocol for measurement of silver grain densities at the cellular level after hybridization with a 35S-labeled probe. (A) Bright-field image showing two types of cells containing the same mRNA: single arrows, medium-sized neurons, and double arrow, large-sized neuron. (B) The same image after combined illumination (regular bright-field and epi-illumination), where each labeled cell is delineated on the screen. (C) Observation under epi-illumination only. Once the cells are delineated, the regular illumination is suppressedso that only silver grains are visible. The number and density of these grains are then measured for each cell directly by the image analyzer system.
4. Notes 1. Advantages and disadvantages of the described quantitative in situ hybridization protocol: As compared to other quantitative approaches, such as Northern blot or dot blot, this procedure provides information at the regional and cellular level, a necessity for the study of gene expression in heterocellular systems. Macroscopic analysis on X-ray films is relatively simple and allows the testing of several experimental conditions, such as different pharmacological treatments, within a time frame of several days. Such an analysis, however, provides no data at the cellular level, and does not allow, for example, the detection of cellular subpopulations. In addition, the density of labeled cells has to be high enough to give a signal detectable on X-ray films. The procedure for microscopic analysis, although requiring more effort to develop, is absolutely necessary for the study of dispersed single cells. 2. Radioactive standards and calibration: We have chosen to use brain paste instead of commercial standards (35S or “‘C-converted standards) because its consistency and thickness are similar to the sections that we use, thereby optimizing comparison between hybridized sections and standards. Although it takes 4-5 d to prepare them, the same standards can be satisfactorily used for up to one year. Despite the difficulties associated with quantification of the absolute number of mRNA copies, calibration of the radioactivity using standards is still necessary to ensure that the in situ hybridization signals do not fall within the saturation part of the curve. In our own experiments, we measure relative variations of radioactivity (i.e., mRNA levels) between experimental and control groups, in order to appreciate variations in gene expression. Other groups have compared hybridized mRNA to total mRNA level using a poly-U labeled probe (I), or using internal radioactive standards with competitive hybridization between labeled
Quantitative
3
4.
5.
6.
In Situ Hybridizataon
and nonlabeled probes (2,6). However, given the lack of accuracy in these procedures and the number of steps that need to be standardized, the method we have described here for relative mRNA quantification appears to offer a more reasonable index of changes in gene expresnon. Choice of radioisotope: We consider 35S as the radioisotope of choice for the quantitation experiments for the following reasons: a. 3sS Can be manipulated without enormous radioprotection and provides good cellular resolution (e g., compared with 32P) and reasonable exposure times (e g., compared with 3H). b. Its half-life (87 d) allows use of the radioactive standards for several months if these are made with a wide range of dilutions. c. There is no quenching problems (e.g., compared with 3H) Note that the recent development of a new radlolsotope 33P may provide an interesting marker with higher cellular resolution and shorter exposure times In situ hybridization procedure: Although the present protocol is routinely used in our laboratory for oligonucleotide and cDNA probes, it can be readily modified for use with other types of probes (e.g , nboprobes) or on different histological materials. To ensure accurate measurement, it is necessary to get a homogeneous signal at both the macroscopic and microscopic levels In situ hybridization in “liqmd phase” gives good homogeneity for the macroscopic analysis, as compared with the more standard hybridization procedure using covershps, but it requires slgmficantly more probes and radioisotopes because of the larger volumes of hybrldlzatlon buffer involved. Synthetic oligonucleotide probes may allow such quantities to be used. Homogeneity of signals for mlcroscoplc analysis 1sless easy to obtain smce the sections are dipped vertically, resulting in the emulsion thickness being different from one section to another. This shortfall can be minimized by always comparing measurements made at the same level of the slides. Quantification and image analysis: To realize a macroscopic analysis, the density of cells expressmg the gene of interest has to be high enough inside the analyzed area to give a homogeneous slgnal on X-ray film. If the labeled cells are widely dispersed over the area of interest, microscopic analysis will have to be used. Nevertheless, even after a densitometric analysis, a detailed study at the cellular level is often necessary to allow a better understanding of the reasons for the observed changes in gene expression, for example: a. Variation in the number of cells expressing an mRNA; b. Variation of mRNA level for individual cells; and c. Variation between distinct cell populations expressing the same gene For macroscopic study, an even and constant Illumination of the optical table 1s necessary to get reproducible and accurate measurements Depending on the analyzer system, the optical table generally needs to be turned on 1 or 2 h before making the measurements. For microscopic analysis, it is necessary to make a good calibration of the silver grams and to check that the counting 1saccurate on each analyzed sectlon. Applications: As an example of the application of the procedure of quantitative in situ hybridization, we describe here the expression of preproenkephalm A (PPA) and D, dopamine receptor genes m the rat striatum followmg haloperidol
Le Moine, Bernard,
and Bloch
Fig. 4. Detection of PPA and D, mRNA in neurons of the rat striatum. Microautoradiographic analysis. (A,B) Dark-field views of rat brain sections after in situ hybridization with PPA (A) and Da (B) probes showing intense labeling in the caudate-putamen (cp), accumbens nucleus (ac), and olfactory tubercle (ot). B delineates the quadrants used to count silver grain and neuronal densities. (1) dorsomedial; (2) dorsolateral; (3) ventromedial; (4) ventrolateral. (C-E) Bright-field views of neurons after hybridization with a PPA probe on control (C) and haloperidol-treated (D) rats, and with a Da probe (E). From C to D, the increase in labeling is obvious after haloperidol treatment. With the D, probe (E), labeling is observed in two types of neurons: medium-sized neurons (single arrow) and large-sized neurons (double arrow). Some large-sized neurons are not labeled (triple arrow). Scale bars = 1 mm (A,B), and 10 pm (C-E). Note that with powerful image analyzer systems, all these populations of neurons can be identified, and that mRNA quantification may be done separately and in relation to their distribution within each quadrant. treatment that blocks dopamine receptors (Fig. 4) (5,Z2). Quantitative analysis at the macroscopic level has demonstrated that haloperidol treatment provokes an increase of both PPA and Dz receptor mRNA levels in the rat striatum. For PPA, the microscopic analysis shows that this variation is not the result of an increase in the number of labeled cells, but is owing to an increase of mRNA level in all the neurons expressing the PPA gene. For the D2 receptor, as shown in Fig. 4E, there exist two types of neurons containing the Dz mRNA in the striatum: medium-sized neurons (i.e., enkephalin neurons), and large-sized neurons (i.e., actylcholine neurons). In this case, quantitative in situ hybridization has allowed the demonstration that the increase in D2 mRNA occurs in both these neurons, but with a different amplitude (54 vs 119%). This result shows that these two
Quantitative
In Situ Hybridization
311
neuronal populations can respond differently to modifications of the dopamme environment. Additionally, the microscopic analysis has allowed the study of these populations inside the same structure in relation to their subregional localization, as illustrated m Fig. 4 The same kmd of cellular analysis of gene expression has been described by Gerfen et al. (6) using a different quantitative procedure
Acknowledgments We thank C. Vidauporte for photographic artwork, and Biocom for their help in the development of the quantification procedure with the image analyzer system. This work was supported by funds from the Region d’Aqultaine, the Fondation de France, and INSERM. References 1 Griffin, W. S T. (1987) Methods for hybridization and quantlficatlon of mRNA m indlvidual brain cells, m In Situ Hybndlzation, Apphcatrons to Neurobrology (Valentmo,K. L., Eberwlse,J. H , andBarchas,J D., eds.),Oxford UniversityPress,NewYork, pp 97-l 10 2 Gerfen, C. R. (1989)Quantlflcationof in srluhybridization hlstochemistryfor analysisof bram function. Methods Neurosci 1,79-97. 3 Sahn,P , Mercughano,M , andChesselet, M F. (1990)Differentialeffectsof chrometreatment with haloperldoland clozapmeon the level of preprosomatostatm mRNA in the striatum,nucleusaccumbens, andfrontalcortexof therat Cell Mol Neuroblol. 10,127-143 4 Young, W. S III (1990)In situ hybrldlzatlon histochemlstry,m Handbook of Chenucal Neuroanatomy: Analyszs of Neuronal Mlcrocrrcurls and Synaptic Inreractcons (BJorklund, A , HGkfelt,T , Wouterlood,F. G , andvandenPol, A. N , eds), Elsevler,Amsterdam,pp 481-512 5 Bernard,V., Le Moine, C , andBloch, B. (1991)Strlatal neuronsexpressincreasedlevel of dopamineD2 receptormRNA in responseto haloperldoltreatment a quantltatlve In situ hybrldizatlon study Neuroscience 45, 117-126. 6 Gerfen, C. R , McGmty, J. F., andYoung,W. S., III (1991)Dopaminedifferentially regulatesdynorphin,substance P,andenkephalinexpressron In striatalneurons’in situ hybridization hlstochemicalanalysis.J. Neurosci 11, 1016-1031. 7 Baskm,D. G , Filuk, P E , andStahl, W. L (1989)Standardizationof tntlum-sensitive film for quantitative autoradiography.J. Histochem. Cylochem. 37, 1337-1344 8. Miller, J A. (1991)The calibrationof 35Sor 32Pwith 14C-labeled brain paste,or 14Cplastic standardsfor quantitative autoradiographyusing LKB Ultrofllm or Amersham Hyperfllm Neuroscl. Lett. 121, 211-214. 9. Smolen,A J. andBeaston-Wimmer,P. (1990) Quantitatrve analysisof m srlu hybndlzation usingimageanalysis,tn In Situ Hybrrdtzation Hzstochemzstry (Chesselet,M. F , ed ), CRC, Boca Raton, FL, pp. 175-188. 10 Le Moine, C , Normand,E , Gmtteny, A. F , FouquB,B., Teoule,R., andBloch, B. (1990) Dopaminereceptorgeneexpressionby enkephalinneuronsm rat forebram.Proc Nurl Acad. Scz USA 87,230-234
1I. Bisconte, J C., Fulcrand,J., and Marty, R (1968) Analyse autoradiographlque dansle systBmenerveux central par photom&rieet cartographrecombin6es.C. r ScCanc Sot. Biol. 161,2178-2182
12 Normand,E., Popovlc~,T., Fellmann,D., andBloch, B (1987) Anatomicalstudy of enkephalmgeneexpressionin the rat forebrainfollowing haloperldoltreatment Neurosci Lett. 83,232-236
CHAPTER 27
Tissue Distribution in Mammalian Felix
Beck,
of Gene Expression Development
Joe lbcci,
and Paul
I? Senior
1. Introduction The biochemical processes underlying development are ultimately dependent on accurately timed and regionally specific expression of particular genes. The latter fall mto many categories, rangmg from those specifying nuclear transcription factors through those coding for extracellular srgnaling molecules and their receptors to genes that determine structural and enzyme molecules that form the basis of morphology. Hybridization histochemistry has proved particularly valuable in defining at cellular levels the sites at which moderate or high concentrations of relevant mRNAs are to be found. The methods have been widely applied to delineating the areas of expression of control genes that define the “address” of cells as belonging to particular regions of the body (e.g., the Hox genes). There is also an extensive literature describing the use of in situ techniques m demonstrating the onset of transcription of genes coding for specific structural proteins, as well as for paracrme or endocrine secretions of hormones and growth factors important during development. Topographical delineation of message allows us to distmgutsh the cells in which functionally important peptides are synthesized from those on which they exert their physiological effect. Indeed, the additional demonstration of receptor mRNA often makes it possible to define cellular interactions m precise topographical terms, partrcularly when supportrve immunocytochemrcal evidence of the relevant proteins is available. Besides their important use in momtoring normal developmental processes, techniques of hybridization histochemistry have been widely applied to investigating the expression of transcriptionally active transgenes and, in particular situations, to gain further insight mto the phenomenon of imprinting. In its optimal application, the demonstration of mRNA m a tissue section should be accompanied by supportrve biochemical evidence, such as Northern blotting, dot blotting, or solution hybridization. These methods make it possible to obtain a measure of the level of transcription and to assesswhether alternative splrcing of the gene of interest presents a complicatmg factor. Further information at the protein level consisting of Western blotting and From Edlted
Methods IR Molecular Biology, Vol 33 In S~tu Hybrrduatron Profoco/s by K H A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
313
314
Beck,
Tucci,
and Senior
lmmunocytochemical evidence of translation can very often be obtained and, when this is available, a comprehensive picture of gene function is to hand. In this chapter, we shall review the technical procedures associated with tissue preparation, sectioning, and serial reconstruction; describe the vanous probes used and the methods employed for their detection; and give some examples of the applications of hybrldizatlon histochemistry to developmental biology drawn from the general literature, as well as from our own work.
2. Materials 2.1. Enzymes The following enzymes are available in ready to use form from a range of suppliers (e.g., Amersham [Arlington Heights, IL], Promega [Madison, WI], Sigma [St. Louis, MO], Boehrmger [Mannhelm, Germany]). The protocols outlined are based on the enzyme concentrations supplied by most manufacturers. 1 2. 3 4 5
Restriction endonucleases T3, T7, and SP6 RNA polymerases. Human placental ribonuclease inhibitor (HPRI, RNasin) RNase free DNase I RNase A: Store powder form desiccated at -20°C. Weigh out each batch into smgle-use aliquots on receipt, as repeated freezing and thawing seems to reduce Its potency. 6. Pronase E: Prepare 40 mg/mL stocks in water and autodigest for 2-4 h at 37°C Dry down in single use aliquots and store at -20°C. 7. Protemase K: Dissolve in water at 20 mg/mL. The enzyme does not generally require autodigeshon. Store at -2O’C in single-use ahquots.
2.2. Enzyme Buffers and Ribonucleotides for Transcribing cRNA Probes 1. 10X RestrIction enzyme buffers: Supplied by most manufacturers. 2 5X Transcription buffer: 200 mM Tns-HCl, pH 8.0; 40 mA4 MgC12, 10 mM Spermldme; 250 mM NaCl, 150 mM DTT. Store at -20°C, or use commercial buffers 3 100 mM Stock solutions of transcription grade ATP, CTP, GTP, and UTP. Dilute to 10 mM for use in transcriptions. 2.3. Radionucleotides 32P-UTP for cRNA probes is available commercially at several different specific activities. If using specific activities of -800 Cl mmol-I, then it should not be necessary to add cold UTP to the reaction. With the higher specific actlvity nucleotides -3000 Cl mmol-‘, we routinely used a 1: 1 ratio of cold to hot UTP; more if the template is >l kb. 35S-UTP 1s available at a specific activity of 1500 Ci mmol-’ and we generally use a ratio of 1:l cold to hot UTP m the transcriptions.
Tissue Distribution
315
of Gene Expression
2.4. Other Buffer8
and Solutions
1. Phosphate buffer 0 2M (pH 7.2): 1 L: 180 mL of 3 1 2 g/L NaH2P04, 820 mL 28.4 g/L Na2HP04. (Dilute 1: 1 for 0.1&f.) 2. PBT: 0 1% Tween20 m O.lM phosphate buffer. 3. TE. 10 n&f Tris-HCl, pH 8.0, 1 mM EDTA, pH 8 0 4. TEN: 100 mM NaCl m TE buffer. 5. 10X TBST: 100 mL = 8 g NaCl, 0.2 g KCl, 25 mL 1M Tris-HCl, pH 7 5, 10 mL 10% Tween20. On day of use, dilute to 1X and add 2 mM levinasole 6. NTMT: 100 mM NaCl, 100 mM Trrs-HCl, pH 9.5, 50 mM Mg Clz, 0.1% Tween20. On day of use, add 2 mM levinasole. 7. 3M Sodium acetate Adjust pH to 5.2 with glacial acetic acid Autoclave. 8. 100 mM and 10 mM DTT. Diluted from a stock solution of 1M dtthiothreitol (molecular biology grade) Store at -2O’C. 9 0.3M Ammonium formate’ Dissolve in water 10. 20 mg/mL E. coli tRNA (molecular biology grade RNase free): Drssolve in sterile water. Store at -20°C. 11. 20X SSC. 1 L: 175 g NaCI, 88 g Na citrate. Adjust pH to 7.0, wtth HCl. Does not require autoclaving. Dilute as appropriate. 12. 20X SSPE: 175 g NaCl, 27.6 g NaH,P0,.H20, 7.4 g EDTA. Dissolve in 800 mL H,O. Adjust pH to 7.4 with 1OM NaOH. Make to 1 L. 13. Phenol/choroform/isoamyl alcohol (PCI): Melt crystalline phenol at 60°C or use liquid phenol. Add 1M Tris-HCl, pH 8.0, and mix. Allow phases to separate, remove aqueous phase, repeat this procedure but with 0 1M Trts-HCl, pH 8.0, until the pH of the aqueous layer is >7.5. Add P-mercaptoethanol and phydroxyquinoline to 0.1%. Store at -20°C Make up PC1 by mixing 25 parts phenol solutron, 24 parts chloroform, and 1 part rsoamyl alcohol. Store at 4°C. 14. Deionized formamide: Use the highest purity grade. Stir 1 g of Biorad AG501X8 (D) mixed bed resm/lOO mL formamide for 1 h m an airtight vessel. Carefully decant or filter to remove the resin. Store at -20°C m small vol 15. Digoxigenin antibody = Antidigoxigenm-AP, Fab fragments. 16. Sheep serum: Heat treat at 70°C for 30 min before use. 17. Alkaline hydrolysis buffer (pH 10.2): 80 mM NaHCOs, 120 mM Na.$O,. Make up in 80% of the final vol, autoclave, add P-mercaptoethanol to 20 mM, then make up to correct vol with sterile water. Store in small ahquots at -20°C 18. Stop buffer: 0.2M sodium acetate, pH 6, 1% glacial acetic acid, 10 mM DTT 19. “P” buffer, 50 mM Trrs-HCl, pH 7.5, 5 mM EDTA, pH 8. Autoclave 20. 50% Dextran sulfate: Dissolve 50 g in HZ0 at 90°C (takes several hours). Make up to 100 mL. Store in small aliquots at -20°C.
2.5. Hybridization
Buffer
1. 10X salts: 3M NaCl, 100 mM NaH2P04, pH 6.8, 100 mM Tris-HCl, pH 7 5, 50 mM EDTA, pH 8.0, 0.2% Ficoll400, 0.2% PVP (polyvmyl pyrrolidone), 0.2% BSA (bovme serum albumin). For hybrrdrzation buffer, make up in lOO-mL lots as above and filter (0.4 pm). Store at -20°C in small ahquots. For washing buffers, make up m liter batches, and store at room temperature (-4 wk)
Beck,
316
Tucci,
and Senior
2 cRNA hybridization buffer (for use with radlolabeled probes). For 1 mL, mix 100 pL 10X salts, 500 FL deionized formamide, 50 WL E. colz tRNA, 200 PL 50% dextran sulfate 10 pL 1M DTT (this can be omitted for 32Pprobes), water to 1 mL. 3. cRNA hybridization buffer (for use on whole embryo preparations using digoxygemn): 50% deionized formamlde in 5X SSC, pH 4 5 (use citric acid to adjust pH), 50 pg/pL yeast RNA, 1% SDS, 50 pg/mL heparin 2.6. Wash Buffers for Radioactive cRNA Histochemistry on Tissue Sections 1. 50% Formamlde buffer is 1X salts (as m cRNA hybridization buffer above) in nondeionized 50% formamide (prepare 2 L). 2. RNase buffer 0.5M NaCl, 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, pH 8 0 (prepare 5 L). 3. 2X SSC: Prepare 2 L from 20X SSC stock. 2.7. Embryo Powder Mount Hybridization Histochemistry) Homogenize 12-14 d mouse embryos m a minimum vol of O.lM phosphate buffer. Add 4 vol of ice cold acetone, mix, and incubate on ice for 30 mm. Spin at 103g for 10 min, and remove supernatant. Wash pellet with ice cold acetone
(for Whole
and spin again. Grmd pellet mto a fme powder, and allow It to ax-dry. Store at 4°C in an airtight tube. 2.8. Tissue Processing 2.8.1. Paraffin Sections 1 4% Paraformaldehyde in O.lM phosphate buffer pH 7.2 Prepare freshly on day of use: heat phosphate buffer to 6O”C, add paraformaldehyde, and stir vigorously. Allow to cool and filter. 2 0.5M Sucrose m O.lM phosphate buffer, pH 7 2. 2.8.2. Slide 1. Ammopropyl-triethoxysllane 2. Acetone. 3 180°C Oven. 1 2. 3. 4. 5.
Preparation
2.9. X-Ray Autoradiography Equipment and Film cassette (Kodak [Rochester, NY] X-Omatic cassette) Film (Kodak X-Omat AR). Darkroom fitted with Kodak GBX-2 filtered safelight. Developer (Kodak liquid X-ray developer). Fixer (Kodak liquid X-ray fixer).
Reagents
2.10. Nuclear Emulsion Autoradiography 1 Glycerol solution: Dissolve 1 mL glycerol in 59 mL water Autoclave for longterm storage 2 Nuclear emulsion (Ilford [Mobberley, Cheshire, UK] K5 or G5)
Tissue
Distribution
of Gene Expression
317
3. Darkroom with 40-W safe light fitted with Kodak No 2 filter (152 1525) or equivalent. (This IS the only illumination that should be used when handling nuclear emulsion.) 4. Balance that can be adequately read with above illumination. 5. 40°C Oven (if sttuated in darkroom, remove indicator lights). 6. Small 40°C water bath (with indicator lights removed). 7. Dipping chamber: Specific liquid nuclear emulsion dipping chambers (Amersham) are optimal as they allow slide coating in a minimal vol of emulsion. Small slide mailing cassettes may be used, but are less efficient as they require greater vol of emulsion. 8 Slide racks. 9. Light-tight tin, or suitable light-tight chamber for holding slide rack. 10 Petri dish with silica gel, self-indicating (Ajax Chemicals, Sydney, Australia). 11 Developer (Kodak D- 19 liquid developer). 12. Fixer (Ilford Hypam rapid fixer). 13. 4% Formaldehyde: Dilute 40% formaldehyde stock m distilled water. 14. Standard solutions as necessary for hemotoxylin and eosin histologtcal staining and mounting.
3. Methods 3.1. Slide Preparation Pretreatment of slides with ammopropyl-trtethoxysilane is necessary to ensure adherence of sections to slides during hybridization histochemistry experiments. It is the preferred adhesive compound when using RNA probes because sections continue to adhere to the slide during the high temperature hybridization, and posthybridization conditions used. The following protocol for treating slides is modified from Rentrop et al. (I). Slides prepared in this manner can be used for both paraffin and frozen tissue. 1 2. 3. 4
5. 6. 7. 8.
Immerse slides overnight in Decon or similar detergent Wash m running tap water for 2 h. Place slides in 18O“C oven for 4 h. Allow slides to cool, and dip in freshly prepared 2% solution of 3-aminopropyltriethoxysilane in acetone for 30 s. (As aminopropyl-triethoxysllane adheres to glass and plastic, and is difficult to remove, it IS advisable to allocate specific glassware or plasticware, to be solely used for this step and steps 5 and 6 below.) Rinse quickly in acetone. Wash twice in Mrllipore (Bedford, MA) filtered distilled water. Air-dry at 40°C overnight Store slides at room temperature in a dust-free environment.
3.2. Tissue Preparation 3.2.1. Frozen Sections
Fresh tissue can be embedded, cut, and hybrtdized on the same day, Proteolytic pretreatment of sections is not necessary prior to hybridization be-
Beck, Tucci,
318
and Senior
cause the tissue does not recerve extenstve fixatron. However, serial sectronmg of frozen tissue is very drffrcult, and the morphology of frozen sections IS often not as consistent as that of sections cut from paraffin-embedded trssue. The method employed is exactly as descrrbed in Chapter 24 in this volume. For olrgonucleotide probes, 4% gluteraldehyde may be used as a fixatrve. For cRNA probes, 4% paraformaldehyde should be used, as significant artifacts occur with gluteraldehyde fixation. 3.22.
Paraffin
Sections
Crosslinkmg fixatives, such as paraformaldehyde, introduce chemical bonds between nucleic acids and proteins. The result is that target mRNA sequences are retained within the tissue and are quite stable, even tf sectioned trssues are stored for long periods. The technique provides good hrstologtcal morphology and allows serial sectroning of tissue. This last factor is important when applying hybridizatton histochemistry to embryonic tissues,because many developing embryomc organs are relatively small and do not cover many sections. The disadvantages of the technique are that it requires relattvely protracted preparation. Because of the crosslinking caused by fixation, controlled digestton of sectioned tissue with a proteolytic enzyme is often required when cRNA probes are used in order to increase accessrbility of the probe to the target mRNA sequence. 1. Fix tissuein freshly prepared 4% paraformaldehydem 0. 1M phosphatebuffer, pH 7.2 for 24 h at room temperature. 2. Rinse in O.lM phosphatebuffer, andtransfer to 0.94 sucrosein 0. 1M phosphate buffer, pH 7 2 Leave for a minimum of 24 h at room temperature. 3. Processthrough gradedalcohols and wax embed. 4. Cut paraffin secnons at 5 pm and mount onto ammopropyl-trrethoxysilanetreated slides. 3.3. Hybridization
Histochemistty
3.3. I. Hybridization Histochemistry with Radiolabeled Synthetic Oligonucleotides
Synthettc oligonucleotrdes labeled with 32Poffer one of the srmplest and most reliable methods for the detection of mRNA in tissue sections.The chemistry of the synthesis and deprotection of oligonucleotides is beyond the scope of this chapter-for details see refs. (2,3). Whereas ohgonucleotrde probes offer by far the simplest methods for performing hybndzation histochemistry, there are a number of issuesto be borne in mmd, as discussed in Notes l-3. The synthesized oligonucleotrde IS predommantly full length, but a small proportion of shorter products from each round of the sequential synthesesreaction are often present. The full length oligonucleottde is best purified free of these shorter products as follows:
Tissue
Distribution
of Gene Expression
319
1. Run 7-15 l.tg of oligonucleotide on a 10% polyacrylamide gel (4). 2. Transfer the gel to UV transparent film (Saran Wrap, Gladwrap, and so on) and place on top of a thin layer chromatography (TLC) plate in a darkroom. Shine a UV light on the gel; the oligonucleotide shows up as a dark band that is then cut out. 3. Elute the oligonucleotide from the gel slice by placing it in 400 pL of TE buffer. Freeze and thaw several times. Incubate overnight at 4°C 4. Pipet off the buffer into a fresh tube, and add to it 40 fiL of 3M NaAc and 1 mL of absolute ethanol. Incubate at -20°C for 20 min. 5. Centrifuge at 13,000 rpm for 15 min, carefully remove and discard the fluid, then wash the pellet with 70% ethanol and dry. 6 Resuspend the pellet m -100 l.tL hybridization buffer, then adjust the final concentration to 25 ng/pL usmg a spectrophotometer (an optical density of 1.0 is equivalent to a concentration of -30 kg/mL). 7. The methods we use for 5’ end labeling of oligonucleotide probes with 32P-ATP, and hybridization to tissue mRNA using oligonucleotide probes are essentially those described in Chapter 24 in this volume (see also Notes 4-6). 3.3.2. Hybridization
Histochemistry
with Radiolabeled
cRNA
Probes
This technique, which employs a single-stranded RNA probe generated from a cDNA template, has become the most widely used method of demonstrating mRNA in tissue sections and has found particular utility in developmental biology. Although technically more complex, it offers greater sensitivity than oligonucleotide probes (see Notes 7 and 8). The procedure is reliable and enables the expression pattern of newly isolated genes to be quickly analyzed at the tissue level, thus giving insights into possible roles that a gene may play even before it has been fully characterized at the molecular level, The method is now almost a prerequisite step in the initial studies of newly isolated genes. To generate single-stranded RNA probes, the cDNA must be cloned into a plasmid vector that contains the promoter sequence of a bacteriophage RNA polymerase. A number of such vectors are available commercially (see Section 3.3.2.1.). When the plasmid is linearized downstream of the cDNA with respect to the promoter and a mixture of ribonucleotides added m the appropriate buffer, addition of the appropriate bacteriophage RNA polymerase results in smgle-stranded copies of one strand of the cDNA being generated. If one of the nucleotrdes is labeled (e.g., with 32P or 35S), then these transcripts can be used as probes. 3.3.2.1. CLONING OF cDNA INTO RNA TRANSCRIPTION VECTORS The cDNA should be cloned into a plasmid RNA transcription vector, such as Bluescript (Stratagene, La Jolla, CA), which has a T7 promoter and a T3 promoter, or pGEM (Promega) which has T7 and SP6 promoters. In each case, these promoters are located at opposite ends of the multiple cloning site, thus by utilizing either promoter, sense or antisense transcripts can be generated from a cDNA mserted mto a single orientation. The DNA should be purified by the CsCl method (4).
320 3.3.2.2.
Beck,
Tucci,
and Senior
PREPARATION OF TEMPLATE FOR RNA PROBE TRANSCRIPTION (LINEARIZATION
OF PLASMID) (SEE
NOTE9)
1 Choose a restriction site m the multiple cloning site (polylinker) downstream of the inserted cDNA with respect to the RNA polymerase promoter to be used. In a sterile 1.5-mL microfuge tube, mix* 20 pL 10X restriction enzyme buffer, 15 l.rg plasmid DNA, sterile water to 200 l.tL, 3 l.tL restriction enzyme Incubate at 37’C for 3 h or overnight 2 Add 200 lrL phenol/chloroform/isoamyl alcohol, vortex for 30 s, then centrifuge at 13,000 rpm for 4 min. Carefully take off the aqueous (upper) layer into a fresh tube, and repeat this procedure once more. 3 Add 200 yL chloroform/isoamyl alcohol, vortex for 10 s, then centrifuge at 13,000 rpm for 1 min. Take off the upper layer into a fresh tube. 4. Add 200 ltL 3M NaAc and 500 l,tL ethanol, mix and centrifuge at 13,000 rpm for 15 min. Then wash the pellet twice with 70% ethanol Resuspend the pellet in sterile water at 1 l.rg@L (10 l.rL sterile Hz0 because of -30% loss during purification.) 5. Check that the plasmid is fully linearized by agarose gel electrophoresis (4) of a small sample (-200 ng) against uncut plasmid bearing the insert, which runs at a different size.
3.3.2.3. cRNA
TRANSCRIPTION (SEE NOTE
10)
1. In a 1 5-mL microfuge tube, at room temperature, mix: 4 i,tL 5X transcription buffer, 1.5 l,tL 100 mM DTT, 1 ltL each of 10 mM ATP, CTP, and GTP (or ATP, GTP, and UTP if using labeled CTP) together with 1 ltL appropriately diluted 10 mM UTP if required, 10 pL 35S-UTP or 32P-UTP (100 pCi), 1 pL of template DNA (-1 l.rg/@), 1 pL of the appropriate polymerase 10 U@L Incubate for 35 min at 37°C. Add 1 l.rL more of the same polymerase (10 U&L). Incubate for 40 mm at 37°C. To protect from any RNase present, an RNase inhibitor (HPRI, RNasm) can be added prior to the template DNA. Care must be taken to add no more than 0.5 l..tL or the excess glycerol present will inhibit the polymerase. 2 To digest the DNA template, add. 1 PL RNasm, 2 pL E. coli tRNA, 0.5 PL DNase 1. Incubate at 37’C for no more than 10 mm, then add 10 mM DTT to give a final vol of 100 PL. 3 At this stage, samples for assessment of yield and for electrophoresis must be taken (Sections 3 3 2.4 and 3.3 2 5 ) 4. Add 100 l.tL of phenol/chloroform/isoamylalcohol (PCI), vortex and centrifuge -3 min at 13,000 ‘pm. Carefully pipet the aqueous (upper) layer into a new 1 5mL microfuge tube and add 10 l.rL 3M NaAc and 0.3 mL absolute ethanol (the lower, PCI, layer should be disposed of as radioactive waste). Store at -70°C or on dry ice for at least 1 h. Centrifuge at full speed for at least 15 min, decant off fluid and dry pellet, resuspend in 100 l.tL 10 mM DTT.
3.3.2.4. QUANTITATION
OF PROBE YIELD (SEE NOTE 11) The yield of probe is assessed by measuring the amount of radioactivity incorporated using sctntillation counting. The sample of probe can be purified free of unincorporated nucleotides by precipitation with trrchloroacetrc acid (4) or by the DE8 1 paper chromatography method outlined below.
Tissue
Distribution
321
of Gene Expression
1, Spot 1 pL of the reaction mix (I.e., l/100 of transcription mixture, equivalent to 1 /,tCi) onto a small piece of DE81 paper and allow to dry, then scintillation count. 2. Spot 1 p,L (l/100 of the labeling reaction) -1 cm from the bottom of a 10 cm long strip of DE81 cellulose chromatography paper, and allow to dry for -1 min. Perform chromatography, using 0.3M ammonium formate as the running buffer (the bottom of the strip must dip no more than 0 5 cm into the buffer) The transcript remains bound to the paper, but the unincorporated nucelotides migrate with the solvent. (This can be confirmed by autoradiography on fast X-ray film, -lo-mm exposure ) The region where the probe was spotted is cut out and scintillation counted. 3. To calculate the yield of probe: a. Spotting 1 l.tL of the total reaction mixture gives the count for a known amount of radioactivity added (i.e., 1% of the PC is added) From this, calculate the true dpms 1 pCi = 2.2 x lo6 dpm b. The counts from the sample run on the DE8 1 chromatograph gives the amount of radioactivity incorporated into RNA in 1% of your reaction mixture From these two figures, calculate the number of PCi incorporated. l.rC!i inc = [counts from (2) x PCi added to transcription mix]/[counts from (l)] c. The manufacturers’ data gives the specific acttvlty of the labeled nucleotide in Ci mmol-t From this, the number of mols of UTP in 1 ~CI can be calculated and, from this, the weight of UTP in grams in 1 l&i and, thus, the weight of UTP incorporated: Weight of UTP (or CTP) incorporated = [pCi incorporated (from b) x mol wt UTP (or CTP)]/(Specific activity* of labeled nucleotide) d. Then multiply by 4 13 (mean mol wt of all four nucleotrdes) to give grams of probe synthesrzed. If cold UTP was added to the reaction mix, then multiply by the ratio of cold to hot nucleotides present. Incorporation of -90% of the labeled nucleotlde can be routinely achieved giving yields of 40-90 ng, depending on the specific activity of the nucleotide used; yields will be higher if cold UTP is added.
3.3.2.5. ASSESSMENT OF TRANSCRIPT QUALITY BY GEL ELECTROPHORESIS (SEE NOTE 12)
The quality of the transcript can be assessed by polyacrylamrde gel electrophoresls of a l-p,L sample. Use a 4% gel and >30 cm plate (4). The majority of the transcript should be full length with a “tall” of shorter sequences.
3.3.2.6. CONTROLLED ALKALINE HYDROLYSIS (SEE NOTE 13) This is recommended to reduce the mean size of the probe to aid tissue penetration (5). Calculate hydrolysis time T min from: T=(Lo-Lj)l(O.ll
*Convert from Clmmol-l to ~CI mol-I
XLOXLJ)
322
Beck,
Tucci,
and Senior
where Lo = Original length of transcript = length of cDNA template Lf = Required length (kb), usually 0.1-0.2 kb.
(kb), and
1 To the resuspended probe, add 100 yL of hydrolysis buffer. Incubate for T min at 60°C 2. Add 200 pL of stop buffer, 1 pL E. co11tRNA, 40 pL 3M NaAc, and 1 mL ethanol, precipitate at -70°C or on dry ice for at least 2 h Centrifuge at full speed for 15 min, decant off fluid, and dry pellet. Resuspend at -5 ng/pL. There 1ssome loss of probe dunng these steps, so an aliquot can be scintillation counted and the amount of probe remaining estimated by proportIon The probe 1snow ready for use.
3.3.2.7. HYBRIDIZATION OF TISSUE MRNA WITH cRNA
PROBES
3.3.2.7.1. Pretreatment for Tissue Sections (see Notes 14-16) 1. Fresh frozen tissue sections fixed with paraformaldehyde should require no pretreatment. Proceed lmmechately with hybridization. 2 Wax embedded sections must be thoroughly dewaxed in xylene, histoclear or smular agent, rehydrated through a descending series of ethanol/water solutions and rinsed in “P” buffer Following this, some enzyme digestion 1srecommended 3. Enzyme digestion a Wax embedded tissue (fixed with paraformaldehyde as outlined in the section on fixation) should be incubated for 10 min at 37’C in “P” buffer containing 125 p.g/mL Pronase E. b. In the case of wax embedded tissue that has been formalin fixed and where the length and quality of fixation is not known, a range of dlgestions must be done to determine optimum for each new block Digest for 30 min at 37°C with +g/mL Protease K m “P” buffer where x is usually in the range of l-40 for most routinely processed tissue 4 Rinse m 0.2M phosphate buffer, then postfix m fresh 4% paraformaldehyde for 10 min at room temperature. 5. Rinse in phosphate buffer 6 Dehydrate by sequential immersion in water, then 30, 60, 80, and 100% ethanol (2 min each) Air-dry. 1.
2. 3. 4
3.3.2.7.2. Hybridization Heat 50% dextran sulfate solution to 80°C m a water bath (which makes it more tractable). For each 1 mL of hybridizaton buffer, mix 100 PL 10X salt mix, 500 FL formamide (deionized), 50 FL E. colz tRNA, 200 pL 50% dextran sulfate, 10 PL 1M DTT (this can be omitted for 32P probes), y pL probe (to make a final concentration of 50-100 ng/mL), and Hz0 to 1 mL (see Notes 17 and 18). Mark the area bounded by the section on the back of each slide with a felt tip marker, and lay them tissue side up on racks in sandwich boxes Heat the whole hybrrchzation buffer with probe added to 80°C m a water bath for 30 s to 1 min Mix thoroughly and pulse spin at 13,000 rpm Pipet onto the area of the slide containing the tissue an appropriate vol of hybridizaton mix, e.g , -20-50 PL depending on coverslip size. Gently lower a coverslip onto the slide until It makes contact with the hybridlzatlon buffer, then allow the buffer to spread under the weight of the coverslip ensuring the tissue
Tissue
Distribution
of Gene Expression
323
section is fully covered. Never drop the coverslip onto the section as this causes air bubbles to form in the buffer Always allow plenty of “land” between the border of the section and the edge of the coverslip. 5. Incubate slides for at least 4 h (usually overnight) at 50-55°C humidified with 1X salts, 50% formamide. Caution: formamide vapor is extremely toxic, so ensure that the chamber containing the slides is fully sealed, open only in a fume hood. 3.3.2.7.3. Posthybridization Washes (see Note 19) 1. Prepare wash buffers (Section 2.6.): 2 L 50% formamide buffer m 1X salts preheat to 50°C (formamide does not need to be delomzed); 5 L RNase buffer, preheat to 37°C; 2 L salt wash = 2X SSC preheat to 65°C 2. In a fume hood, open the chamber containing the slides 3. Immerse slides mdividually in 50% formamide buffer in a beaker at 50°C. Remove the coverslips by slrding off sideways with a pair of blunt nosed forceps. 4. Place the slides m racks in 50% formamide buffer at 50°C 5. Wash with shaking in three -650 mL changes of 50% formamide buffer over a total of 3-4 h. 3.3.2.7.4. RNase Wash (see Note 19) 6 Remove the slides from the 50°C water bath and remove the formamlde buffer by dunking into several changes of RNase buffer 7. Incubate slides in 500 mL RNase buffer containing RNase A at - 150 pg/mL for 1 h at 37°C. (The RNase stock should be boiled for 5 min prior to use to destroy any contaminating nucleases.) 8. Wash at 65°C m two 1 L changes of 2X SSC (30 mm each). 9. Dunk m water to remove salts, then dehydrate through 30, 60, 80, 95, and 2X 100% ethanol (2 mm each) and air-dry. 10. Some indication of the strength of ugnal, and the gross tissue distribution of hybridization can be gained by exposure to fast X-ray film. 32P gives a signal after overnight exposure, 35Stakes 2-3 d.
3.4. Autoradiography Autoradiography is used to detect the spatial distribution of radioisotope labeled probes bound to specific targets within sections of the specimen tissue. The energy emitted by the radioisotopes causes minute sensitivity specks of silver ions in an applied photographic emulsion of silver halide to acquire electrons and form a latent image that is reduced to metallic silver by the action of developing agents. In hybridization histochemistry, two forms of autoradiography are used: X-ray films and liquid nuclear emulsion. 3.4.1. Autoradiography Using X-Ray Film (see Note 20) 1. Expose hybridized slides to Kodak X Omat AR film in a lightlght X-ray film cassette (24 h when using 32P; 48 h when using 35S). 2. In the darkroom, under appropriate safelight conditions, develop the film for 2 min in Kodak liquid X-ray developer 3. Rinse m water.
324
Beck,
Tucci,
and Senior
4. Fix the film for 2 mm in Kodak liquid X-ray fixer. 5. Rinse in water, and dry. 3.4.2. Autoradiography Using Liquid Nuclear Emulsion Resolution at the light microscope level 1sattained by coating the slide bearing the hybridized section with a photographic emulsion. The almost umversally used technique involves dipping the slide m diluted emulsion in order to deposrt a layer over the specimen. After sufficient exposure, the slide is developed, fixed, and stained for histological detail. Although the technique described below is relatively simple, varrous practical considerations that need to be taken into account are dtscussed m Notes 21-23. 3.4.2.1. PREPARATION OF EMULSION 1. Dilute glycerol in Millipore filtered distilled water at a ratio of 1.60. Mix and autoclave. 2 In the darkroom, with appropriate safelighting, weigh out emulsion and mix thoroughly with glycerol/water (usually m w/v range of 1: 1). 3. Place the diluted emulsion in lighttght container, and allow it to melt in an oven at 40°C for 2-3.5 h 4. In the darkroom, set up a dipping chamber or slide mailer in a small 40°C water bath. (Steps 5-9 must be performed
in a darkroom
with appropriate
safelighting.)
5. Gently agttate the melted emulston with a swirling motion and pour mto the dtppmg chamber 3.4.2.2.
DIPPING AND EXPOSING
6 Dip the slides in emulsion so that they are evenly coated. During the dipping process the dipping chamber should remam in the 40°C water bath so as to maintain the emulsion at an even temperature. Allow the excess emulsion to drip back into dtpping chamber and place the shde on a rack. 7 When all slides have been dipped, place the rack in a hghtight chamber. If a container with a lid is used, seal the lid with electrical insulation tape Leave overmght to dry. 8. The following mornmg, open the chamber and place a Petri dish with dried sihca gel on the bottom. Replace the slide rack m the chamber, reseal, and allow the
slides to expose for 4-l 0 d. 3.4.2.3. DEVELOPING AND STAINING 9. Develop the positive control slide and an extra “test” slide first as follows: a 2-4 min in developer (Kodak Dl9 liquid developer) b. 1 min in water. c. 4 mm in fixer (Ilford Hypam rapid fixer).
d. 10 min in running water (to wash out all fixer). e. 5 mm in 4% formaldehyde.
10 Stain with hemotoxylm and eosm by standard methods, but omit the acid alcohol step. (Slides need to be maintained at a neutral pH, since acidic compounds may dissolve the silver grains.)
Tissue
Distribution
of Gene Expression
325
3.5. Hybridization Histochemistry Using Nonradioactive Techniques Although hybridization histochemistry with radiolabeled probes remains the preeminent method, nonradioactive methods have more recently been developed (6). Such methods are safer and do not require prolonged exposure to X-ray film or film emulsion. A number of haptens can be mcorporated into probe molecules and the probes subsequently can be detected by chemical or immunological means. Great effort has been put into this area, since successwould offer the single cell resolution and speed of conventional immunocytochemistry. These methods are also used for whole mount hybridization histochemistry. Their utility may be further enhanced by confocal microscopy, with its potential for optical sectioning and computerized three-dimensional reconstruction. Two haptens have received the most attention and experiments with fluorescent probes have also been performed (see Notes 24-26). Methods for using nonradioactive probes are essentially similar to those outlined for radioactive probes, however, in general, nonradioactive probes are used at higher concentration than radioactive ones, e.g., a 35S-labeled RNA probe would generally be used at aconcentration of 50-l 00 ng/mL of hybrrdrzation buffer, however, a similar biotinylated or digoxygenin labeled probe would be used at concentrations up to 2 yg/mL. Followmg hybridization and washing, the detection of the probes is by immunological methods and the problems and controls necessary for hybridization histochemrstry are similar to those for immunocytochemtstry. With biotin, there are problems with endogenous biotm in certain tissues. It is also necessary to block endogenous peroxidases or alkaline phosphatases depending on the detection system used. 3.6. Serial Reconstructions The complex and rapidly changing anatomy of the mammaltan embryo often makes precise structural identification difficult in single sections, especially when the basic morphology is somewhat distorted by the hybridrzatron process and special staming procedures are contraindicated by the demands of the autoradiographic process, Furthermore, the localization of gene expression to a tissue in a single section gives no indication of the geographical extent of expression within the organ in question. In order to overcome these difficulties, it is necessary to make serial reconstructions based on the results of hybridizing a number of slides at known intervals along an embryo. The recent introduction of fast speed personal computers with memories of 40 MB and over have greatly facilitated image analysis and a large number of programs are available for computer-aided reconstruction of serial sections. (For examples, see refs. [7,8] and Note 27).
326
Beck, 3.7. Whole
Mount
Tucci,
and Senior
Preparations
Hybridization hrstochemtstry on whole mount preparations 1s being used mcreastngly (and very effectively) to determine the dtstrrbution of gene expression in small specimens. In practice, embryos of up to 30 somites can easily be processed by thus method. The digoxigenm technique 1s used for the hybridtzatton and staining procedure and larger embryos are usually “cleared” in glycerol to make examination easier. The method described was supplied by Prof. Paul Sharpe (personal communrcatton, Unrversrty of London) and is modified from the method of Wtlkmson (9). It 1s described below wtth reference to cRNA probes, but may be used with mtnrmal modrfrcation with olrgonucleotides. 3.7.1. Transcription of Probe Clontng of cDNA into RNA transcrtptton vectors, their purtftcatton, and the preparation of linearized template 1sdescribed m the section dealing with radiolabeled cRNA probes. 3.7.2. Preparation of cRNA Probe 1 MIX the following reagents at room temperature: a. 13 ltL Sterile distilled water b 2 l.tL 10X Transcription buffer, 1 i.tL 0 2M DTT (The original protocol used for 10X transcription buffers was: 400 mMTris-HCl, pH 8.25,60 mA4 MgCl,, 20 mM spermidme. However, 4 l.tL of the 5X transcriptton buffer given m the Materials section may also be used.) c. 2 ltL Nucleotide mix at pH 8 0 (10 mM GTP, 10 mM ATP, 10 mM CTP, 6 5 mM UTP, and 3.5 mA4 digoxygenm-UTP) (This is the Boehringer Mannheim 10X DIG RNA labeling mixture.) d. 1 ltL Linearized plasmid (1 l.tg/pL). e. 0.5 ltL Placental ribonuclease inhibitor (HPRI, RNasm) (100 U/pL) f 1 pL SP6, T7, or T3 RNA polymerase (10 U@L) 2. Incubate at 37°C for 2 h. 3. Remove a 1-l.tL ahquot and run on 1% agarose/TBE gel (3) The RNA band should be about 10 ttmes more Intense than the plasmid band. This indicates that about 10 pg of probe has been synthesized. 4 Add 2 l.tL of ribonuclease free DNase I. 5. Incubate at 37°C for 15 min. 6 Add 100 l.tL TE, 10 JJL 4M LiCl, 300 pL ethanol, mtx and store at -2O’C or on dry ice for 30 mm 7. Spin in microfuge for 10 min, wash the pellet with 70% ethanol, and air-dry, 8. Redissolve in TE at circa 0.1 l.tg/pL and store at -20°C. Use 10 PL for each hybrtdization mix. 3.7.3. Prehybridization and Hybridization 1. Dissect out embryos m phystological saline and fix in 4% paraformaldehyde m 0 1M phosphate buffer at 4°C overnight Specimens may then be stored in 0 5M sucrose in 0 1M phosphate buffer (pH 7.2) at 4’C for a few days.
Tissue Distribution
of Gene Expression
327
2. Wash twice in 0 lit4 phosphate buffer containing 0.1% Tween20 (PBT) at 4°C (5 min each). 3. Wash in 25,50, and 75, and then twice m 100% methanol/PBT (5 min each step). Rehydrate by taking embryos through methanol/PBT in reverse, finally washing twice in PBT. 4. Bleach with 6% hydrogen peroxide in PBT 1 h. 5. Wash in PBT three times (5 min each). 6. Digest with 10 p.g/mL proteinase K in PBT for 15 min-the embryo is very tragile after this procedure. 7. Wash with freshly prepared 2 mg/mL glycerine in PBT (5 min). 8. Wash twice in PBT (5 min each). 9. Refix in 0.2% glutaraldehyde, 4% paraformaldehyde m PBT for 20 mm at room temperature 10. Wash twice in PBT (5 min each). 11. Immerse in hybridizaton buffer 12. Replace with fresh hybridization buffer, and incubate at 70°C for a minimum of 3 h 13 Replace with hybridization buffer with the addition of 1 yLlmL of digoxigenm labeled RNA probe. Incubate overnight at 70°C. 1. 2. 3. 4. 5. 6. 7. 8. 9.
1 2. 3. 4.
3.7.4. Posthybridization Washes Wash twice with solution 1 (recipe: 5X SSC, pH 4 5, 50% formamide and 1% sodium dodecyl sulfate [SDS]) 15 min each at 70°C. Wash with 1 1 mixture of solution 1 and solution 2 (recipe. 0.5M NaCl, 10 mM Tris-HCl, pH 7.5; 0 1% Tween20) for 10 mm at 70°C. Wash three times in solution 2 for 5 mm each wash at room temperature. Wash twice with 100 pg/mL RNase A in solution 2 at 37°C for 15 min each. Wash with solution 2, then with solution 3 (recipe: 50% formamide, 2X SSC, pH 4.5) for 15 min each at room temperature. Wash twice with solution 3 at 65°C for 15 min each. Wash three times with TBST at room temperature for 5 min each. Preblock with 10% sheep serum in TBST at room temperature for 60-90 min Remove 10% serum and rock overnight at 4’C with preabsorbed antibody prepared as follows* Add 0.5 mL TBST to 3 mg embryo powder in a microtube and heat to 70°C for 30 mm. Cool on ice and add 5 pL sheep serum and 1 pL antidigoxigenm antibody. Shake gently at 4°C for 1 h to preabsorb the antibody, then spin in a microfuge for 10 min Dilute the supernatant to 2 mL with 1% sheep serum in TBST 3.7.5. Postantibody Washes and Histochemistry Wash three times rn TBST at room temperature for 5 min each. Wash five times m TBST at room temperature for 1 h each. (Alternatively, replace steps 1 and 2 with overnight incubation in TBST at room temperature ) Wash three times in NTMT (5 min each) Incubate in NTMT including 4.5 pL nitro blue tetrazolmm (NBT) and 3.5 uL BCIP (x-phosphate)/mL. Rock for 20 min and then observe in a glass (not plastic) Petri dish until the desired color has developed Keep in the dark as much as
328
Beck,
Tucci,
and Senior
possible. The specific signal usually begms to develop after 2 h and may require overnight exposure to achieve optimum
5. Wash twice with PBT. Small embryos can now be examined under a dissecting microscope. It may be necessary to clear larger specimens by immersion in 50% glycerol in PBT, followed by 80% glycerol in PBT. The blue reaction product is soluble m nonpolar solvents; exposure to alcohols and some clearing agents must, therefore, be avoided. 3.8. Conclusions
Over the last few years, hybridization histochemistry has changed from an esoteric technique performed only in a very few laboratories to an essential method widely applied m the field of developmental biology. It IS as reliable and reproducible as immunocytochemistry or structural histochemistry. In settmg up hybridization htstochemistry, as with any complex technique, it is essential to establish the optimum conditions using published protocols as a guide rather than as gospel. Critical areas that affect successare: 1 Fixation: This must be optimal to retain mRNA m the tissue. When using paraffin embedded material use only crosslmkmg fixattves. It is better to overfix rather than underfix. 2. Enzyme digestion. Optimizing this step IS vital for success. The type, concentration of enzyme, and the digestion time have to be established for the method that is in use. 3. Probe quality: The quahty, quantity, and specific activity of the probes used wtll affect the result obtained. Time spent m quantitation 1s well worth the effort, 4. Radtoactive vs nonradioactive methods: At the time of writing, radioacttve probes offer greater reliability and the resolution 1s adequate for most needs. We strongly suggest, even if it essential to use nonradroactive techniques, that experience of hybridization histochemistry with radioactive probes is first obtained If it is impossible to detect the target mRNA with radioactive probes, rt IS unlikely that nonradtoactive ones will prove successful
of the Application to Mammalian
3.9. Some Examples of Hybridization Developmental
Histochemistry Biology
3.9.1. Hox Genes
The early development of body form depends to a large extent on the expression of so-called developmental control genes. These code for transcription factors that regulate the expression of further sets of gene and are, therefore, fundamentally important in basic pattern formation. The processes involved have been most extensively worked out in Drosophila, where body pattern depends on sequential expression of numerous control genes culmmating with the activatton of two major gene clusters (the antennapedia complex
Tissue
Distribution
of Gene Expression
329
and the blthorax complex) known as homeotic selector genes. The products of these genes provide cells with a degree of positional information and are, therefore, important m the regional determination of the general body plan. The homeotic selector genes, as well as numerous other developmental control genes, contain a conserved sequence of about 180 nucleotides called the homeobox. One of the most exciting observations of contemporary developmental biology has been the demonstration of close homology between the Drosophila homeotic selector gene clusters and four setsof similar complexes in the mouse, The latter are known as Hox cluster a, b, c, and d (HoxA-D m the human), and each contams representatives of most of the constituent genes of the Drosophila antennapaedia and bithorax complexes. It seems,therefore, that these homeobox genes have been highly conserved during evolutton and that they have undergone reduplication to produce so-called paralogous gene loci (e.g., Hoxa9, b9, c9, and d9 are paralogous genes homologous with the abdominal B gene of the Drosophila bithorux complex). Establishing the precise location of Hox gene expression during mammalian development is of importance in studying their function, which (as m lower forms) is postulated as constituting the molecular means of determining positional value along the embryonic axis. When analyzed by hybridization hrstochemistry, the characteristic feature of expression of the various Hox genes is their sharp boundary along the anterior-posterior axis. There is overlap between successive members of the Hox clusters, suggesting that different combmations of the Hox genes provide the molecular code for regional specification. Clearly, investigations m this field depend on effective histochemical demonstration of gene expressron. Figure 1 1s a dragram summarizmg the expression of the Hoxb gene cluster in the 9.5d-old mouse hmd brain, and Fig. 2 shows the contrastmg and sharply demarcated expression sites of two members of this cluster (Hoxb-1 and Hoxb-3) m the neural tube demonstrated by hybridization histochemrstry. 3.9.2. Insulin-Like
Growth
Factors
A number of growth factor genes, including transformmg growth factors a and p, insulm-like growth factors I and II (IGF I and II), platelet derived growth factor, fibroblast growth factors, nerve growth factor, and various hematopoietic growth factors are expressed during development. Interestingly, experiments that produce gene ablation by homologous recombinatron often result in viable homozygous offsprmg with distinct but relatively mmor physiological disturbances when compared with the lethal effects produced by disabling the Hox genes that are responsible for regulating basic body patterns. Growth factors often act in an autocrine or paracrine manner, particularly early in gestation when the vascular system is not fully developed. Consequently, the demonstration of a growth factor mRNA m a particular tissue, especially when correlated with expression of its specific receptor, can be of
330
Beck, Tucci, and Senior
MB.
-r
_--_--
fP
rl -l
gVII-gVIII
k
r3 r4
Hoxb-1
r7 ---r6 -_ --._-
Fig 1 Summary of Hoxb cluster gene expression m 9 5-d-old mouse hind brain The rhombomeres (rl-r8), the ottc vesicle (OV), and the cramal gangha gV, gVIINII1, gIX, and gX are represented on the left and the domams of the Hoxb gene expresston are shown on the right. MB, mid brain; HB, hind brain; SC, spinal cord, fp, floor plate (Modified and reprinted wtth permission of Macmillan Magazines Ltd.)
value in helping to define its developmental role. Figure 3 shows the expression of IGF II mRNA in the sclerotome of a 14.5-d rat embryo, but its absence in the adjacent neural tube. Nevertheless, both Type I and II IGF receptors are demonstrable in the CNS and further exploration indicates that IGF II mRNA is present in the choroid plexus and leptomeninges (Fig. 4). It seems likely, therefore, that IGF II acts as a paracrine growth promoter in the developing vertebral column and that any role it might play m the growth and differentiation of the nervous system may result from its secretion by the chorold plexus
Tissue Distribution
of Gene Expression
Fig. 2. Expression of Hoxb-3 (A) and Hoxb-1 (B) genes in a 9.5d-old mouse hind brain visualized by hybridization histochemistry with %-labeled cRNA probes. The sections run horizontally through the dorsal part of the neural tube. Gene expression corresponds to that illustrated in Fig. 1, r4, r5. r6 rhombomere 4. and so on; gVIWIII, ganglia complex of the facial/acoustic nerve. (Modified and reprinted with permission of the Company of Biologists.)
Fig. 3. Oblique section through neural tube and sclerotome of a rat embryo at 14.5 d of gestation hybridized with 32P-labeledoligonucleotide probe for IGF-II. There is strong hybridization to the tissues of the sclerotome and in the wall of the dorsal aorta but only background signal is detectable over the neural tube. (A) Bright field. (B) Dark field. Ao, aorta; NT, neural tube; SC, sclerotome; Ch, notochord.
332
Beck, Tucci, and Senior
Fig. 4. Section through the choroid plexus of a 1Zd-old rat neonate hybridized with 32Plabeled oligonucleotide probe for IGF-II. There is strong hybridization in the choroid plexus but none in the adjacent brain tissue. (A) Bright field. (B) Dark field. CP. choroidplexus;B, brain.
into the cerebrospinal fluid. Definitive experiments to confirm such a hypothesis remain to be done. 3.9.3. The Localization of Transgene Expression The sites at which appropriate constructs are expressed in transgenic mice may depend on the nature of the promoter used, the characteristics of the gene transcribed, and the type of cell in which it is expressed. For example, Russo et al. (10) analyzed the expression in mice of the rat growth hormone gene coupled to the mouse metallothionine promoter. They found that the transgene was expressed in numerous ectopic sites within the CNS. Furthermore, they showed that the ectopic expression pattern was not specific to the metallothionine promoter, since other heterologous promoters resulted in expression in overlapping subsets of neurons. They concluded that these apparently unrelated neuronal subsetsshare a common developmental regulatory machinery for gene transcription. Such an experiment could only be performed because critical delineation of the transgene at cellular level was possible.
Tissue
Distribution
of Gene Expresszon
333
3.9.4. Differential
Imprinting In 1991, De Chtara et al. (II) successfully disabled the IGF II gene and showed that heterozygous animals derived from a male germ lme chimera had the same phenotype as homozygous animals in which the IGF II gene derived from both parents was inactive. The explanatton was that the gene was maternally imprinted (i.e., only the IGF II gene of paternal orrgm was expressed). Further studies using hybridizatron histochemrstry produced the surprising result that the gene was imprinted in all tissues of the body except for the choroid plexus and leptomeninges. In these tissues, the gene was expressed in mice derived from IGF IIVe males. This is the only example of differential imprinting so far demonstrated; tts significance is obscure since inacttvatton of the gene m the meninges (i.e., in homozygous IGF IIve mice) produces no obvrous phenotyprc change compared to heterozygous paternal IGF IImve animals. Nevertheless, the process is of great btological interest in mvestrgations concerning the nature of imprmting. Further examples will be keenly searched for and are most likely to be uncovered, as m thus case, by hybridization histochemtstry.
4. Notes 1. Advantages of ohgonucleotide probes: a. Probes can be designed to published sequences and, thus, access to the appropriate cDNA is not required (3,12). b Probes can be designed to specific regions of the mRNA, for example, IO detect alternatively spliced products or to distinguish closely related members of a gene family (12). c A corresponding sense probe to the antisense (hybridizing) probe can be synthesized and used as a negative control on parallel tissue sections. d. Probes can be reliably labeled to a high specific activity by a simple enzymatic reaction e. Probes are small and penetrate the tissue easily, obviating the need for elaborate pretreatments in most instances. f. Hybridization and washing techniques are relatively simple. 2 Disadvantages of oligonucleotide probes. a Only a single 32P atom is incorporated per ohgonucleotide, so sensitivity is limited b. Not all oligonucleotide probes work for hybridization histochemistry, possibly owing to the secondary structure of the target mRNA in the tissues However, despite these limitations, the use of oligonucleotide probes IS the method of choice for demonstrating abundant mRNA in tissue sections. 3 Design of oligonucleotides a. GC base pairings have three hydrogen bonds, as opposed to the two formed by AT. Therefore, as the GC content of the oligonucleotide increases, s,o does the stability of the duplex formed between the olignonucleotide and its target sequence. This means that high GC content duplexes melt at higher temperatures and require higher hybridization and washing temperatures than
334
4
5.
6 7.
8
Beck,
Tucci,
and Senior
those with lower GC content. The methods outlmed here are based on GC contents of -50%. Although formulae exist for the calculation of appropriate hybridrzation temperatures for various levels of GC content (4), in practice, optimum conditions may need to be determined empirically. b. Secondary structure m the mRNA in tissue section may render some parts of the molecule inaccessible to the probe This means that, even if the probe recognizes denatured RNA in a Northern blot, there IS no guarantee that it will work on a tissue section. It is advisable to design several ohgonucleotides and test them on sections of tissue known to express the RNA at a high level. c. If the gene structure 1sknown, it is advisable to try ohgonucleotides that span the junctions between exons. d. Generally, for hybridization histochemistry, ohgonucleotides between 25-35 bases long are used Shorter oligonucleotides work well also, but the risk of spurious binding owing to homology with other sequences is increased. Longer ohgonucleotides can be employed, but are more expensive to synthesize. Other labeling methods have been used for ohgonucleotides (see Chapter 24). The 5’ end labeling methods is very reliable and labels the oligonucleotide to a high specific activity, however, it is limited to 32P and results in the addition of only a single labeled atom. This restricts the sensitivity of the technique. It is possible to use the enzyme terminal deoxynucleotide transferase (TdT) to add a “tail” of labeled nucleotides to the 3’ end of the ohgonucleotide. In theory, this should not affect the hybridization kinetics. This method has been used successfully for hybridization histochemistry (13-15), but has not found widespread application Setting up the slides for hybridization: In many of the early papers, covershps were sealed with nail varnish or rubber cement to prevent evaporation. Provided the hybridization chamber is adequately humidified and the sections are not too near the edge of the covershp where drying artifacts may occur, this is not necessary. The intensity of signal shown by the X-ray film can be used to give some idea of the exposure necessary after dipping the slides. Generally, for 32P 3-10 d are used. Advantages of cRNA Probes. a They can be generated from any cDNA subcloned into an RNA transcription vector. The cDNA can be subcloned into, e.g., Bluescript (Stratagene) and be both sequenced and used for RNA probe generation without further manipulation b. The probes are single stranded, in contrast to directly labeled cDNA probes where both the sense and antisense strand are present during hybridization and there is competition between the hybridization of the antisense strand to the target mRNA m the tissue section and reannealing of the probe. This leads to poor sensitivity and high backgrounds, problems that are overcome by a probe that is single-stranded c Both antisense (hybridizing) and sense (negative control) probes of the same specific activity and GC composition can be generated. d After hybridization, sections can be treated with RNase A, an enzyme that degradessingle-stranded RNA but leaves RNA-RNA duplexes intact. This helps reduce nonspecific background. Disadvantages of cRNA probes*
Tissue
Distribution
of Gene Expression
335
a. Preparation of probes requires access to cDNA and some molecular biology expertise. b. Probe generation IS time consuming and expensive. c. Probes are RNA, so precautions against RNase contamination are necessary. d. The RNA polymerases used require nucleotlde concentrations of -400 J,LMto give an optimal yield of full length transcripts. However, with high specific activity radionucleotldes, the concentrations that can be achieved in a typical reaction are
336
Beck,
Tucci,
and Senior
graphic efficiency is also greater, giving exposure times that are about 2-3 times those for 32P. 35S has an mtrinsrcally higher background in the tissue section that lowers the signal-to-noise ratio. Resolutron at the single cell level can be obtained with trrtmm (5) and tritiated nucleotides are available. Tritium has a very low emission energy and the particles form latent Images in areas restricted to a few microns from the source. However, trrtmm has a very long half-life and, although its autoradiographic efficiency IS very high, exposure times of several weeks may be necessary. Recently, both Amersham (UK) and DuPont (Boston, MA) have started to make available nucleotides labeled with 33P-thrs has a half-life of 25 d and an emission energy between that of 32P and 35S, initial results with this isotope suggest it gives acceptable resolution and exposure times (comparable with 35S) and has cleaner backgrounds than 35S (B. Jones, personal commumcation). b. All solutions for RNA transcriptions must be made up in double autoclaved sterrle water. Do not use DEP (drethyl pyrocarbonate) treated water It may mhrbrt RNA polymerases. c. The specific activity of the probe generated is determined by the specific actrvity of the radionucleotide used and the proportion of radionucleotide incorporated (i e., U*A,C,G) Therefore, the specific activity of probe generated during transcriptron is fixed. The yield of probe (in ng) is determined by the efficiency of the transcription reaction. High specific activity nucleotides are used at very low concentration in the transcription mix, well below the concentration that is optimum for producing high yields of full length transcript. The concentration of nucleottde and, therefore, the quality of the transcript can be increased by increasing the concentration of the hmrtmg nucleotide This can be done by reducing the reaction vol by drying down the radionucleotide prror to transcription By this method the reaction vol can be cut from 20 to 5 l.rL, in our experience, this 1s not very reliable The alternative is to add cold nucleotrde to increase the effective concentration at the expense of reduced specific activity We use a 1.1 ratio of cold to hot nucleotide for templates cl kb and increase this for templates >l kb. In the standard 20 p.L reactron, in the absence of cold nucleotide, using 32P-UTP at 3000 Crmmol-‘, the final concentratton of UTP is only -2 /.rLM,and, with 35S-UTP at 1500 Cimmol-‘, it is -5 @4 d. Incubation temperature of transcription is usually 37”C, but it IS clarmed that lowering the incubation to 8°C produces more full length transcript (16) 11 Quantitation of transcript: It is very important to estimate the yield of transcript from each reaction as the amount (m ng) of probe added to the hybridtzation mixture has a great effect on results (see text). Also, as it is usual to use sense probes as negative controls, it 1s essential to ensure that they are at equal concentrations. 12. Gel electrophoresrs It 1s a good idea to check the transcript m this way, occasionally we have obtained very high incorporation of label but on electrophresis most of the transcripts were very small and, therefore, useless for hybridization hrstochemrstry.
Tissue Distrrbution
of Gene Expression
337
13. Controlled alkaline hydrolysis. Although unhydrolyzed probes work well (at least from templates cl kb), in our experience lower backgrounds result using probes hydrolyzed to a mean size of -100 bases. 14. Tissue fixation: Virtually all our work on both cryostat and paraffin embedded material has been with 4% paraformaldehyde. This seems to give the best RNA retention and good morphology. We have tried other fixatives. Gluteraldehyde (4%) in phosphate/polyethylene glycol buffer works well on cryostat sections with ohgonucleottdes, but when used m conjunction with cRNA probes, it gives spurious labeling together with artifacts and should be avoided We have successfully performed hybridization histochemistry on freeze-dried cryostat sections without fixation. However, severe chemographic artifacts are induced in the dipping film autoradiograph. For frozen sections, acetic acid ethanol and Carnoys’ fluid work well as fixatives, as does 10% formol-methanol, but they give poor morphological preservation. Acetic acid-ethanol and Carnoys’ fluid and other precipitating fixatives should not be used for wax embedded tit,sues, as there is variable loss of RNA during processing. Bouin’s fixative works well with both frozen and wax embedded tissue. There is no need to extract the picric acid. 15 Pretreatment for tissue sections: The only pretreatment that we have found to be necessary to increase the signal in hybrrdrzatron histochemistry is protease digestion. As crosslinkmg fixatives chemically bind RNA to protein, it is necessary to partially digest the section in order to allow the probe molecule access to the target sequence However, care must be taken not to overdigest the section so that protein and, therefore, mRNA is lost. In our experience, the optimum protease digestion for mRNA detection is below the level that produces recognizable morphological damage to the tissue. The degree of digestion will depend on the extent of fixation. Heavily fixed tissues, 1.e , pathologrcal specimens fixed m formalm for weeks or months are very resistant to digestion because of the excessive crosslinkage induced by prolonged fixation. Thus, digestion with high concentration of protemase K may be required. By contrast, lightly fixed frozen sections generally do not require any digestion prior to hybridization. For wax embedded tissue which has been fixed by the controlled paraformaldehyde method, we find pronase E to be an ideal enzyme. At a concentration of 125 pg/mL, it usually gives the optimum signal if used for 10 min at 37°C but different digestion times and concentrations should be tried mitially to establish the optimum conditions. Blocks that have been fixed in formalm for lengthy periods present more of a problem. However, provided the fixation has been prompt and adequate to preserve the RNA, good results can be obtained but the optrmum digestion must be determined empirically for each block We use protemase K; in most instances, we try concentrations of 1, 5, 10, 20, and 40 pg/mL (30 min at 37’C) and fmd one of these is optimum. Tissues that have been exce,ssively fixed may require longer digestion. 16 Other pretreatments for tissue sections: In the hybridization histochemistry hterature, particularly in the early papers, elaborate pretreatments of the tissue sections to improve labeling and reduce background due to nonspecific binding were advocated.
Beck,
Tucci,
and Senior
a. HCl wash: It is claimed that HCl treatment improves probe penetratton (I 7). Slides are incubated m 0.2M HCl for 20 min at room temperature to block basic proteins There is a report of loss of RNA after HCl treatment (18) b. Salt wash: It is claimed that this increases probe diffusion (17). Slrdes are incubated in 2X SSC at 7O“C for 30 min. c Acetylation (19): Shdes are incubated m freshly prepared O.lM triethanolamine to which acetic anhydride (1:400) is added immediately prtor to use. Incubate for 20 min at room temperature. This step IS supposed to reduce background and binding of probe to glass slides. d. 0.3% Triton-X 100, 15 min at room temperature: Use of detergent as a solublizmg agent has been claimed to improve hybrrdrzation (20) and we use it in whole mount preparations. In a series of experiments on secttoned tissue, we have examined the effects of omitting each of the pretreatments listed above smgly or in combmation. No effect on hybridization or background was seen when compared to the standard protocol in either formalin or paraformaldehyde fixed preparations. e Several groups have reported specific problems with the cRNA probes and have suggested methods to remedy them. i. Cold a-thio-UTP: Bandtlow et al. (21) reported problems with nonspecific binding of 35S-labeled UTP to the &sue they were using. They claimed that this was due to nonspecific bmdmg of probe and unincorporated UTP mediated by the a-thiol group. They advocated prehybridizatron wtth cold a-thio-UTP to block this effect ii. Iodoacetamide. Incubation of the slides with iodoacetamide has been claimed to reduce background by trreversrbly blocking sulfhydryl groups thus reducing nonspecific mteractton of 35S-labeled probes wtth the tissue section (22). iii. Carbol chromotrope: Nonspecific binding of probes to eosinophillic cells has been reported. Pretreatment of slides with carbol chromotrope has been advocated as a blocking agent (23). We have only found this artifact to be a problem in the tissues we have used tf dextran sulfate is omitted from the hybrldizatton mtxture. 17 Hybridization buffer: We have investigated a number of different formulations of the hybridization buffer. Buffers based on 5X SSC or 5X SSPE work well. The addmon of blockmg RNA or DNA and the presence of bovme serum albumin (BSA), polyvinyl pyrrolidone (PVP), and Ficoll has a small but beneficial effect Dextran sulfate is a vital component of the hybridizatron mixture, rt functions to increase the effectrve probe concentration (24) If it 1s omitted, hybridtzation 1s weak. It also has important blocking actrvity. If polyethylene glycol (PEG 6000) is substituted, an equal level of hybridization is seen. However, with PEG, reproducible, tissue specific artifacts are apparent. Probes, whether sense or antisense, convincingly label small eosmophillic cells m a number of tissues, most notably the spleen and lamina propria of the mtestme. Thus artifact is much reduced or absent in the presence of dextran sulfate 18. Probe concentration during hybridtzation In a number of experiments, we assessed the effect of probe concentrations of 10, 100, and 500 ng/mL. 500 ng/ mL gave the highest labeling, but also higher background and some artifacts m
Tissue Distribution
19.
20.
21.
22.
of Gene Expression
the negative control slides, so -100 ng/mL seems to be a reasonable and economically feasible level, but, with abundant messages, even 10 ng/mL gives a signal. Experiences with radioactive and nonradroactive probes show that there is a point beyond which increasing the probe concentration leads to nonspecifxc unremovable background. With radioactive probes, this also is related to specifvc activity. Higher specific acttvrty probes produce the trreversrble background problem at lower probe concentrattons. Posthybridization treatment: We have found initial washing in 50% formamide gives the lowest backgrounds, and attempts to wash in hrgh molarrty salt solutions, i.e., 2X SSC at 65OC, seems to cause the dextran sulfate to come out of solution, irreversibly binding the probe to the section. Washing in lower molaricy salts or at lower temperature overcomes this problem, but still gives marginally worse backgrounds. RNase A digestion 1sindispensable in controlling background. We find concentratrons of 50-200 pg/mL of the type we use to be optimum. X-ray film autoradiography: X-ray films consist of a polyester base coated with emulsion. The emulsion may either form a smgle coating on one side of the base (as in Kodak SB film) or a double coating on both sides of the base (as m Kodak X-Omat AR film). Single-coated films provide high definmon with low background (particularly with high energy emitting isotopes, e.g , 32P), but doublecoated films are generally more versatile, providing high sensitivity m most applications. The inclusion of a positive control slide m a hybrtdization histochemtstry experiment allows determination of the success or failure of the expertment after slides have been exposed to an X-ray film. X-ray films are used to estimate the strength of signal from the radiolabeled probe. According to the signal strength and signal to background ratio, the length of time that the slides need to be exposed to the subsequent coating of liquid emulston can be roughly assessed Background levels: If, during storage, the emulsion is exposed to excesstve heat, or extraneous sources of radiation, then an increase in background will result. To minimize this, the emulsion should be stored in lead lined bags at 4°C. Once applied to the slide, the emulsion should be allowed to dry slowly for several hours or overnight and then exposed m the presence of dessmant for the remainder of the exposure period. Too rapid drying of emulsion may result m stress and cracking of the emulston, with subsequent artifact formation. Sensitivity and resolution: When using liquid emulsions, sensitivity can be increased m various ways, e g.. a. Using nuclear emulsion with large halide crystals (e.g., Ilford G5) b. Using thicker (less dilute) emulsion c. Hybridizing thicker secttons (up to 10 l.trn). However, the increase in sensrtrvity is usually associated with higher background and decreased resolution, The choice of isotope will affect resolutron in that an increase in the energy of the particles emitted from the source will result in the production of silver grams at greater distances from the source and, consequently, m poorer resolution Therefore, isotopes with lower partrcle energy values (35S, 3H) tend to give better resolution than those with higher energy (32P). For a full discussion of this subject see ref 25.
340
Beck,
Tucci,
and Senior
Although ultimately dependent on the spectficity of bindmg of the radiolabeled probe, resolution can be improved by using Ilford K5 emulston and decreasmg the thickness of the emulsion coatmg. For comparability of results, it is desirable to apply a similar amount of emulsion to each slide. This can be achieved by gentle agitation of the emulsion prior to dipping, so as to assure an even consistency, and by mamtaming the emulsion at the meltmg temperature during the dipping process 23 Controls* a Sense probe Nonspecific interraction between the probe and material other than target nucleic acids can be monitored by using a “sense” negative control probe. These will not hybridize with the target and so give an mdmation of inherent background b Positive and negative control tissue: A slide contaming tissue that is known to express the gene of Interest should be included in the protocol so as to give an Indication of the success or failure of the experimental technique. Tissue that is known not to express the gene should also be added as a negative control c Chemography: Chemography is the chemical mterraction between specimen and emulsion, that may result in the production (+ve chemography) or loss (-ve chemography) of silver grams. Tissue that has been paraffin embedded is less likely to be affected by this type of arttfact than freshly frozen tissue However, chemography is unpredictable and may occur in tissue prepared in either of the above ways Controls for chemography are possible: i. For positive chemography: Inclusion of extra slide that is treated identically to other experimental slides, except that it is not exposed to the radioactive probe. ii. For negative chemography. Followmg dipping in emulsion, one expertmental slide is exposed to light, then returned to the container holding the rest of the slides, so that exposure and development can proceed under identical conditions. d Exposure time. An extra slide should be included in hybridization histochemistry experiments wherever possible This can be developed prior to the other experimental shdes, and so gives an indication as to whether exposure time to the emulsion has been sufficient, or whether a longer exposure is necessary to obtain an optimum signal 24. Blotin This is a small vitamin that can be readily mcorporated into nucleottde analogues, usually via a 11-carbon spacer. Biotm- 1 l-dUTP can be incorporated into cDNA probes in the conventtonal random primer or nick-translation reactions (4), or added to the 3’ end of oligonucleotides using TdT (terminal deoxynucleotide transferase) Biotm-l l-UTP can be mcorporated mto RNA probes by the methods outlined m Section 3.3 2.3. Biotm has a very high binding affinity for the protein avidin (which is found in egg white) Avidin, usually as streptavidin, can be comugated to peroxidase or alkaline phosphatase, thus producing detection systems for biotmyled probes. These same systems have found wide use m immunocytochemistry In theory, therefore, biotmylated probes should offer high sensitivity and high resolutton, together with the same signalto-noise ration as obtained m immunocytochemistry However, the results m most hands have been less reliable than those using radiochemicals and, although a
Tissue Distribution
of Gene Expression
341
number of successful studies have been reported (26-30), these methods have not succeeded in supplanting radioactive methods where high sensitivity, low backgrounds, and freedom from artifacts are required. The reasons for the poor performance of btotinylated probes in hybridization histochemistry are not fully understood. Studies suggest that the probes can penetrate the tissue section and hybridize as effectively as radiolabeled probes, but the detection system does not appear to detect the probe on a tissue section with reproducible efficiency. 25. Digoxigenin: This compound, extracted from the foxglove, 1s a relative newcomer to the nonradioactive field, but has already attracted considerable attention as a method of labeling probes for hybridization htstochemistry It can be incorporated into nucleotide analogs in the same manner as biotin. Digoxigenm can be detected directly using antidigoxygenin antibodies. Inmal reports with both labeled cDNA, cRNA, and oligonucleotides are encouraging (31-34). A detailed protocol using digoxigenin is given in Section 3.7. on whole mount preparation. Reliable commercial labeling kits are available (e g., Boehringer Mannheim [6]). 26. Fluorescent probes: Methods exist for tagging probes with fluorescent markets. These methods have great utility in hybridization to chromosomes and interpharse nuclei. They have also been successfully used in cell cultures (29), but the technical difficulties associated wrth fluorescent studies on tissue sections renders them suboptimal for most mRNAs in hybridization histochemistry. 27. Computer programs for serial reconstructions: We use the Magellan program (35). This enables us to work at various magnifications as we pass through the embryo. The program stores each section as a series of xy coordinates and the interval between sections (the z coordinate) can be set independently at any desired figure Thus, it 1s possible to make reconstructions using successtve sections in important areas and to use step serials in others When viewed or printed, the synthesized data can be rotated m the x, y, or z plane to obtain the greatest information; various methods of presentation are available and a large number of structures can be superimposed if necessary. The mechanical setup utilizes a Leitz “Microvid” which superimposes the xy grid and the program menu over the section when viewed under the microscope. Using the mouse driven cursor, desired areas can then be traced directly over the section without loss of information resulting from video imaging or the preparation of camera lucida reproductions. The preparation of material for graphic reconstruction must be carefully performed. Serial paraffin sections of known thickness must be prepared and the section numbers used m the reconstructions recorded in the z axis of the software program. At least two external markers, e.g., fine cactus needles, should be embedded with the experimental material to serve as reference points for lining up successive sections The accuracy of the reconstruction will depend on the spacing of the sections used, the minimization of shrinkage artifact by careful dehydration and embedding, and the accuracy of alignment of the section images Baldock et al. (36) have developed a program that enables serial sections to be aligned without the use of external markers. Numerous “tie points” linking complementary positions in sequential sections are carefully selected and the software determines the optimal relative position of the sections usmg a least squares method to determine goodness of fit. Though this method is probably not
342
Beck,
Tucci,
and Senior
as accurate as that obtainable by using external reference points, it has the advantage of easier preparation and may m the future prove to be of considerable general value.
Acknowledgment This work was supported by a National Health and Medical Research Counc11block grant to the Howard Florey Institute of Experimental Physiology and Medicine. References 1. Rentrop, M , Knapp, B , Winter, H , and Schwetzer, J. (1986) Ammoalkylsrlane treated glass slides as support for rn situ hybrtdtzatton of keratincDNAs to frozen tissuesections undervarying ftxatton and pretreatmentcondtttons Hzstochem .t 18,271-276. 2 Gait, M. J (1984) Oligonucleotide Synthesu: A Practrcal Approach, IRL, Oxford. 3. Coghlan,J. P , Aldred, P.,Haralambrdts, J., Nrall, H. D., Penschow,J. D , andTregear,G W (1985)Review Hybridization histochemtstry.Anal Blochem 149, l-28. 4 Sambrook,J , Fritsch, E F , and Mamatis,T (1989)Molecular Clonmg: A Laboratory Manual, 2nd Ed , Cold SpringHarborLaboratory,Cold SpringHarbor,NY 5 Cox, K H , DeLeon,D. V., Angerer, L M , and Angerer, R C (1984) Detection of mRNAs m seaurchmembryosby m sttu hybridization usingasymmetricRNA probes Dev. Blol
101,485-502.
6 Nonradroactive rn srtu hybridization applrcattons manual, Boehrmger Mannhetm, Mannhelm,Germany(1992). 7 Wilkmson, D. G. and Green, J (1990) In situ hybridization and the three dtmenstonal reconstructionof serialsections,m Post-Implantation Mammalian Embryos A Practrcal Approach (Copp,A J andCockroft, D. L , eds), IRL, Oxford, pp. 155-171. 8. Jones,C. M., Lyons, K. M , and Hogan,B. L. M (1991) Involvement of bonemorphogenie protein-4 (BMP-4) and Vgr-1 m morphogenesis and neurogenesis m the mouse. Development
111,531-552
9. Wilkinson, D G (1992)Whole mount m situ hybrrdrsationof vertebrateembryos,m In Situ Hybridisatlon A Practical Approach, IRL, Oxford, pp 155-l 7 1 10 Russo,A. F., Crenshaw,E B., Llra, S A., Summons,D M , Swanson,L W , and Rosenfeld,M.G. (1988)Neuronalexpressionof chtmertcgenesm transgemcmice.Neuron 1,3 1 l-320
Il. De Chiara,T. M , Robertson,E. J , andEfstratadts,A. (1991)Parentaltmprintmgof the mouseinsulin-likegrowth factor II gene.Cell 64,849-859 12. Penschow,J. D , Drmkwater,C. C , Haralambtdis,J., andCoghlan,J P (1991) Sitesof expressionand induction of glandular kalikrem geneexpressionm mice Mol Cell Endocrmol.
81, 135-146
13. Lewis, M. E., Arentzen, R., and Baldino,F , Jr (1986)Rapid,high-resolutionm situ hybridization with radtotodinatedsyntheticohgonucleottdes. J. Neuroscr. Res 16, 117-124 14. Lewis,M E., Sherman,T. G., Burke, S , Aktl, H., Davis,L G , Arentzen,R., andWatson, S J. (1986) Detection of proopiomelanocortm mRNA by rn situ hybrtdtzatton with an oligonucleotideprobe Proc. Nat1 Acad. Scl USA. 83,5419-5423 15. Scott-Young, W , III, Mezey, E., and Siegel,R E. (1986)Quantitative m sztu hybrtdizatton histochemistryrevealsmcreased levelsof corttcotropm-releasing factor mRNA after adrenalectomym rats.Neurosci. Lett 70, 198-203. 16 Krteg, P. A (1990)Improved synthesisof full-length RNA probeat reducedmcubatron temperatures. Nucleic Acids Res. 18,6463
Tissue Distribution
of Gene Expression
17 Haase, A., Brahlc, M., Stowrmg, L., and Blum, H. (1984) Detection of viral nucleic acids by in srtuhybridizatton, m Methods in Virology, vol. VII, Academic,NY, pp 189-226 18 Godard,C. andJones,K. W. (1979)Detectionof MULV-specific RNA in AVR mottse cellsby m srtu hybrtdizatton Nucleic Acids Res. 6,2849-2861. 19. Hayashi, S., Grllam, I. C., Delaney, A. D , and Tener, G. M. (1978) Acetylation of chromosomesquashes of Drosophila melanogasterdecreases the backgroundin autoradiographsfrom hybridization with (1251)-labeled RNA. J. Histochem. Cytochem. 26, 677-679. 20. Branks,P L. and Wilson, M C. (1986)Patternsof geneexpressionm the murmebrain revealedby m situ hybridization of brain-specificmRNAs Mol. Bram Res 1, l-16 21 Bandtlow,C E., Heumann,R., Schwab,M. E , andThoenen,H. (1987)Cellularlocalization of nerve growth factor synthesisby zn situ hybrtdization. EMBO J 6,891-899. 22 Zeller, R., Bloch, K D., Wtlhams,B. S , Arceci, R. J , andSeidman,C. E (1987)Localized expressionof the atria1natrmretrcfactor duringcardiacembryogenesrs. Genes Dev 1,693-698.
23 Patterson,S., Gross,J , andWebster,A. D B. (1989)DNA probesbind nonspecificallyto eosinophrls duringin sztu hybridization: carbolchromotropeblocksbmdmgto eosinophtls but doesnot inhibit hybridlzatron to specific nucleotrdesequences. J. Vwol Meth. 23, 105-109. 24. Wetmur, J G. (1975) Acceleration of DNA renaturationrates.Bzopolymers 14, 251’72524 25. Rogers,A W. (1979)Technrques ofAutoradiography.
Elsevrer,Amsterdam,pp. 3-l 1I. 26 Kabisch,H , Heinsohn,S, Milde, K , Loning, T , Bartl, S , andErttmann,R (1986) Detection of neuroblastoma cells in bonemarrowby In situ hybridization. Eur. J. Pediatr. 145, 324,325 27 Lawrence,J. B , Singer,R. H , and Marselle, L M. (1989) Highly localized tracks of specific transcriptswithin interphasenuclei vtsualizedby in sttu hybrtdtzation Cell 57, 493-502. 28 Liest, P , Juhen,J. P., Villa, P , Grosveld,F., andRechardt,L. (1986)Spectftcdetectionof
neuronalcell bodies tn situ hybridization with a btotm-labeledneurofilamentcDNA probe.J. Histochem Cytochem. 34,923-926. 29 Smger,R H., Lawrence,J. B , andVillnave, C. (1986)Opttmtzationof m wu hybrrdtzabon usingtsotoptcandnonisotoptcdetectionmethods.Btotechmques 4,230-250 30. Singer,R. H. andWard, D C. (1982)Actin geneexpressionvisualizedin chickenmuscle tissueculture by usingznsitu hybridization with a biotinylated nucleottdeanalog.Prac. Natl Acad SCL USA 79,7331-7335.
31. Farquaharson, M., Harvie, R , andMcNlcol, A. M (1990)Detectionof messenger RNA usinga digoxygeninendlabeledoligonucleotideprobe J. Cbn. Pathol. 43,424-428. 32. Htllan, K. H , Farquaharson,M., Harvie, R., McKee, T A , McSween,R. N. M., and Nicol, A. M. (1990)Detectionof messenger RNA in formalin-fixed rat tissuesusingRNA probeslabeledwith a newnucleotrdeanalogue,digoxygemn-II-CTP.J. Pathol. 160,164A. 33. Samoszuk,M. andNansen,L. (1990)Detectionof interleukm-5messenger RNA m ReedSternbergcellsof Hodgkmsdiseasewith eosinophiliaBlood 75, 12-16 34. Tantz, D. and Pfeifle, C. (1989) A nonradioactiveznsitu hybridization methodfor the localization of specificRNAs in Drosophtla emybrosrevealstranslateralcontrol of the segmentation genehunchback.Chromosoma 98,81-85. 35 Halasz,P andMartm, P. (1985)Magellan Programme for Quantuatwe Analyszs of Htstological Sections. University of New SouthWales,Kensington,Australia 36. Baldock,R., Bard, J., Kaufman,M., andDavidson,D. (1992)A realmousefor your computer. BioEssays 14,501,502
CHAPTER 28
Subcellular Location of mRNA by Electron Microscope Hybridization Histochemistry Jennifer
D. Penschow
and John
I? Coghlan
1. Introduction Hybridization histochemistry can be used at the light microscope level to determine the cellular site of gene expression in heterogeneous cell populations in tissue sectlons. However, the question often arises as to exactly which cell in a heterogeneous population is labeled and how this cell differs from unlabeled neighboring cells. The region of a cell in which mRNA transcripts of a particular gene are located IS also of interest, particularly in polarized cells, such as neurons or epithelium. The adaptation of hybridization histochemistry to the electron microscope (EM) enables these questions to be answered and can also provide useful information about subcellular processes. The distribution of normal mRNA transcripts within a cell can relate to the nature of the translation product (I-3). This has been demonstrated with mRNAs encoding cytoskeletal proteins, which associate predommantly with cytoskeletal structures. Where mRNA transcripts are abnormal, their cellular distribution may differ from that of normal transcripts, shown by a comparison of the subcellular location of normal and mutant transcripts in Drosophila neurons (4) and of normal and truncated transcripts in rat neurons (5). The altered distribution of abnormal mRNAs may correspond to an altered distribution of translation products (4). Location by EM of subpopulations of cells expressing a particular gene also permits analysis of the morphological characteristics of both the expressing and nonexpressing cell populations (67). The initial adaptation of in situ hybridization to the electron mlcroscope was for the detection of an abundant target nucleic acid, satellite DNA, on chromosomes (8,9). These early studies were performed using RNA probes transcribed from purified DNA. Subsequently, using recombinant DNA probes, Drmophilu mitochondrial genes were located at the subcellular level (10) and then some of the more abundant mammalian mRNAs (l-3,5-7,1 I, Z2). Techniques for EM hybridization histochemistry utilize a variety of methods for tissue preparation and for hybridization and probe detection, some favoring isotopitally labeled probes and some favoring nonisotopic systems.However, despite From EdIted
Methods II) Molecular Sio/ogy, Vol 33 In SW Hybr/drzabon by K H A Choo Copynght Q 1994 Humana Press Inc.
345
Protocols Totowa, NJ
346
Penschow
and Coghlan
the variety of established techniques which are now available, the transition from light microscope to EM hybridization histochemistry is still rare. The mam reason for the limited use of this specialized technology is the low abundance of mRNA m thm preparations suitable for EM. Only relatively abundant mRNAs can be detected by this technology at present (see Note 1). In this chapter we describe in detail a method of hybridization htstochemistry for EM, which provides excellent resolution of tissue structures and can be used for probes labeled with several different isotopes (7). A brief flowsheet of the method is shown in Table 1. 2. Materials 2.1. Mcljor Equipment 1. Apparatus for perfusion fixation 2 Vibratome (Lancer, St. LOUIS, MO).
3. Shaking water bath. 4. 5. 6 7. 8 9
Oven for polymerization of epoxy resin (60°C). Ultramicrotome. Oven for warming emulsion (37AO“C). Water bath for autoradtography (37”(Z), without thermostat indicator light Transmitted light stereomicroscope with dark-field attachment. Electron microscope
2.2. Fixation, Prehybridization,
Vibratome Sectioning, Hybridization, Washing
1. Glutaraldehyde; electron microscope grade (Merck, Darmstadt, Germany). 2 Fixative for perfusion: 0.2% glutaraldehyde and 4% paraformaldehyde (Merck) in 0 1M phosphate buffer, pH 7.3 (3.6 g/L NaH2P04.2Hz0 and 10 9 g/L Na2HP0,). Prepare fresh 3. Fixative posthybridtzation: 2 5% glutaraldehyde m O.lM phosphate buffer, pH 7.3 (see Section 2.2., step 2) Prepare fresh. 4. “Superglue” for attaching specimen to vibratome chuck. 5. 20X SSC stock 3M sodium chloride, 300 mM sodium citrate. 6. Hybrrdizatron buffer 600 miI4 sodium chloride, 50 n-t&! sodium phosphate, pH 7.0, 5.0 mM EDTA, 0 02% ficoll, 0.02% bovine serum albumin, 0.02% poly(vinylpyrrohdone), 0 1% DNA (“degraded free actd,” Srgma, St. Louis, MO), and 40% formamide (Merck), deionized by adding 3 g/L ion exchange resin (BioRad, Richmond, CA, Cat.# 142-6425), and filtered. 7. Ribonuclease A (Sigma). 8. Probe labeled to a high specific acttvity, ideally with 3H, 35S, or 33P rsotopes (Amersham, Bucks, UK or NENIDupont, Boston, MA) of the highest available specific activity.
2.3. Celloidin-Coating 1 Celloidm (Merck) 2. Amy1 acetate.
Slides
Subcellular
Hybridization
Histochemistry
347
Table 1 Flow Chart for Hybridization Histochemistry on Tissue Sections for EM 1. Perfuse tissue with 0 2% glutaraldehyde and 4% paraformaldehyde in 0 1M phosphate buffer. 2 Postfix for 1 h m the above fixative
3 Slice tissue at 100 urn, using a vibratome or tissue chopper. 4 Rinse slices in 4X SSC. 5. Prehybrrdize at 40°C for l-2 h in hybridization buffer (rtbonuclease-treat some slices for controls) 6. Transfer slices to vials containing radiolabeled probes in hybridization buffer. (Addrttonal vials should be prepared for nbonuclease-treated slices and for shces hybndtzed with the negative control probe ) 7. Incubate for 24 h, with agitation, at 40°C (or appropriate alternative).
8. Rinse tissue in 2X SSC at room temperature 9. 10. 11 12. 13. 14. 15 16 17. 18 19. 20 21. 22
Wash tissue in two changes of 1X SSC at 40°C for 30 mm each. Postfix tissue in 2.5% glutaraldehyde in O.lM phosphate buffer, pH 7.3. Postfix tissue in 1% osmium tetroxide m drsttlled water Rinse tissue and process through increasing concentrattons of acetone, with 10 mm in each of the final changes of dry acetone. Infiltrate for 2 h with equal parts of acetone and araldite/epon. Infiltrate with araldrte/epon for 20 h (3 changes) then flat-embed Attach embedded tissue slices to araldite/epon mounts Cut semithin sections onto subbed slides for light microscope autoradiography, Cut ultrathin sections onto cellordin-coated slides Dip semithm sections and some ultrathins in K5 emulsion Dip most ultrathins m L4 emulsion, for high resolutton Expose autoradtographs at room temperature, away from radiation sources. Develop sections at intervals, until the exposure is correct, then develop remainder. Float off celloidin films and mount sections on grids. Stain ultrathin sections with uranyl acetate/lead citrate and view with EM.
3. 25-50 mL 1% Celloidin m amyl acetate (in glass bottle, capped tightly). Prepare and use only m fume hood. 4. Clean slides. 5. Sealable boxes for storing slides under silica1 gel. 6. Sltde racks (a suitable multipurpose slide rack and box assembly 1s available from Pelco, Redding, CA). 7. Silica gel. 8. Diamond marking pen (Pelco). 9. “Parafilm” or equivalent. 2.4. Embedding 1. 2. 3. 4. 5. 6.
and
Sectioning
Acetone. Molecular sieve 3A (BDH, Poole, UK). Araldite (Ciba-Geigy, Geneva, Switzerland) Epon (Resin LX1 12, Ladd, Burlington, VT). Accelerator for epoxy resin (DMP 30, Ladd). Hardener for epoxy resin (HY964, Ciba-Geigy)
348
Penschow
and Coghlan
7. Araldrte/epon embedding mixture: 40 mL Araldite, 10 mL Epon, 50 mL hardener, 1.0 mL accelerator, thoroughly mixed. Store sealed at -20°C Wear gloves and use these resms only m a well-ventilated area. 8 Small sheets of glass (approx 100 x 50 x 4-5 mm). 9. Size 00 gelatine capsules (Pelco), filled with araldite/epon and polymerized (for mounting flat-embedded tissues). 10. Araldite glue. 11. 4% Osmium tetroxrde (Aldrich, Milwaukee, WI) stock solutron in water. Use at 1% Osmium is very toxic. Use with gloves, only m fume hood, and discard appropriately for heavy metals. 12. Platinum loop, approx 3 mm diameter (Pelco). 13. Slide subbing solution: 0.5% gelatine and 0.1% chrome alum in distilled water. 1 2. 3. 4. 5. 6 7 8. 9. 10. 11.
2.5. Autoradiography and Staining Photographic emulsions Ilford L4 (for high resolution), Ilford K5 (for low resolution) Glass container slightly larger than a slide for dipping slides in emulsion (Pelco) D19 developer (Kodak, Rochester, NY) Hypam fixer (Ilford, Essex, UK). Slide racks and boxes for exposing autoradiographs (Pelco) Black adhesive tape. Stain 0.2% Toluidine blue (BDH, Poole, UK) in 2.5% sodium carbonate Filter before use DePeX mountant (BDH) 10% Uranyl acetate in 75% methanol. Prepare approx 2 mL freshly. Dissolve with gentle heat This and the lead stain should be used with care and disposed of as heavy metals. Reynolds alkalme lead curate: Dissolve 1.33 g lead nitrate and 1.76 g sodium citrate in 42 mL distilled water. Add 8 mL 1M sodium hydroxide Copper grids, 200-400 mesh (Pelco).
3. Methods of Celloidin-Coated
3.1. Preparation Slides The object is to prepare electron-lucent celloldm films which can be floated off on water. (Procedure adapted from ref. 13.) 1. Prepare stock solution of 1% celloidin m amyl acetate. 2. Dip clean glass slides into this solution to approx two-thirds of their length and allow to dry by standing vertically. 3 Score lightly around the edges of the celloidin film with a diamond marker 4. Prepare a dish of dlstllled water at least 15 x 10 cm and no less than 6 cm deep. The dish should be m a dust-free environment. 5. Set up a portable lamp so that light is reflected from the surface of the water. 6 Hold the cellordin-coated slide vertrcally with the surface of the water touching the score mark at the end of the film. 7 Tilt the slide slightly and slowly push the slide down mto the water The film should start to lift and float on the surface of the water (13) 8. Adjust the lamp so that the film can be seen by the reflection of incident light.
Subcellular
Hybridization
Histochemistry
349
9. Continue to push the slide beneath the surface until the film has floated off calmpletely. The incident light should show the interference colors of the film, providing an indication of its thickness, in a similar manner to the estimation of thickness of ultrathin and semithin sections floating on water. If the film is thicker than pale silver (gold-purple), dilute the celloidin further with amyl acetate until pale silver films are obtained 10 To test film electron-density and quality, place 200-400 mesh copper grids on the film while it is floating (13) and then place a sheet of clean “parafilm” a bit wider than the celloldin film and 3 cm longer on top of the floating celloidin film bearing the grids, while holding one end of the parafilm sheet. 11. Lift the parafilm out of the water and the celloidin film should adhere to it, with the grids sandwrched between the celloidin and parafilm 12 Lift grids off the parafilm carefully, without drslodgmg the celloidin film and place on filter paper to dry. 13. View with the electron microscope. If the film quality is good, having mastered this procedure, repeat with grids bearing silver ultrathin sections, to ensure that the film is sufficiently thin to obtain good resolutron. The final approved celloidin solution should be sealed tightly to prevent evaporation and kept for coating slides for subsequent autoradiography of hybridized sections. 14. A further test which should be conducted is to dip a celloidm-coated slide in Ilford L4 emulsion as described in Sectron 3 7., allow it to dry for a day, develop it, score around circles of 5-8 mm with a diamond marker and float these cucles off on water. A grid deposited on one of these celloidin/emulslon circles, collected with parafilm and viewed with the electron microscope, will test the thrc kness, evenness, and background of the emulsion (see Note 2). 1.
2. 3. 4.
3.2. Fixation and Vibratome Sectioning of Tissue Fix tissue (see Note 3) by perfusion with 0.2% glutaraldehyde and 4% paraformaldehyde in 0.1 M phosphate buffer, ensuring that the perfusron pressure is maintained at 200 mm mercury. The route of perfusion should be determined by the organs required. Dissect tissue as soon asperfusion is complete and leave for 1 h immersed in fixatrve. For tissue less than l-mm thick, slice into fine strips with a razor blade, rinse, and collect specimens in 4X SSC. For tissue thicker than 1 mm, rinse with 4X SSC, attach wet tissue to a Vibratome specimen block wrth “Superglue” and section at 100 microns, collecting sectrons in 4X SSC
3.3. Prehybridixation and Hybridization 1. Divide specimens into three groups: a. Controls for RNase treatment prior to hybridization with antrsense probe. b Untreated specimens for hybridization with antisense probe. c. Controls for hybridrzation with sense-strand or nonspecific probe. 2. Transfer specimens to vials containing hybridization buffer and incubate, with shaking, at 4O’C. for l-4 h. 3. Meantime for group a, RNase-treated controls, incubate some tissue slices in 40 pg/mL RNase A in O.lM phosphate buffered saline, pH 7.3, at 37°C for 90 mm, with agitation (this 1s twice the concentratron used for 5-pm sectrons [14]).
Penschow
350
and Coghlan
4 Rinse three times in hybridization buffer. Be careful to use separate instruments, for handling RNase-treated specimens so as not to contaminate the other vials of tissue 5. Label antisense and control probe to a high specific activity according to standard procedures (see Notes 4-6). 6. Dilute labeled antisense probe in hybridization buffer to an appropriate concentration for the type of probe used (see Note 7) 7. Add labeled anttsense probe and specimens to two fresh vials. one for group a, RNase-treated control specimens, and one for group b, untreated tissues. 8. To a third vial, add the group c tissues and the control sense-strand or nonspecific probe, labeled identically and at the same concentration as the antisense probe. 9. Incubate all specimens for 24 h, with agrtatton, at 40°C (or alternative temperature necessary for specific hybridization).
3.4. Posthybridization
Washing
and Fixation
1 Rinse specimens in 200 mL 1X SSC at room temperature, then wash m 150-200 mL 1X SSC at 45°C for 1 h with agttation. 2 Postfix specimens for 10 min in 2.5% glutaraldehyde in O.lM phosphate buffer. 3. Rinse in distilled water then postfix for 5 mm in 1% osmium tetroxide. 4. Rinse m three changes of distilled water.
3.5. Tissue Processing
and Embedding
1. Dehydrate tissues for 2 min m each of the following solutions containing mcreasing concentrations of acetone: 30,40,50,60,70, 80,90, and 95% acetone in water. 2. Immerse trssues for 5 mm in each of three changes of dry acetone (analytical grade acetone stored over molecular sieve 3A) 3. Add equal volumes of dry acetone and araldite/epon embedding mixture, mix well, and leave for 1 h. 4. Replace with araldrte/epon and leave for a further 1 h 5. Repeat with fresh araldite/epon. 6. For embedding tissue pieces, orientate in embedding moulds and embed by conventional procedures 7 For embedding vrbratome slices, flat-embed as follows: Change slices into fresh araldite/epon and he flat on a plastic sheet situated on a glass sheet (plastic with a dull sheen, such as heavy-duty freezer bag plastic is preferable to transparent or glossy plastic, as polymerized resin is less likely to adhere). Sandwrch tissue slices between another sheet of plastic and another sheet of glass. Apply weights and leave specimens to polymerize at 60°C for 48 h 8. After polymerization, peel the specimens off the plastic. 9 Depending on the emission energy and half-life of the isotopic label employed, it may be useful to expose embedded tissue slices to X-ray film for l-2 d to evaluate the hybridization signal. In this way, the controls may be evaluated for background and the experiment discarded if this is excessive. If the background is acceptable, the “hottest” tissue slices may be selected for sectionmg, thereby optimizing the chance of detecting labeled hybrids in ultrathin sections
Subcellular
Hybridization
Histochemistry
Fig. 1. An autoradiograph of an aralditelepon semithin section of a vibratome slice of mouse submandibular gland, hybridized with a 3H-labeled oligonucleotide ptobe complementaty to mRNA for the mouse glandular katlikmin encoded by the gene, mGK-6. Acinar tissue is marked (a) and the lumen of a granular duct is marked (1). A duct cell with an extensive basolateral border is clearly labeled (arrowhead). Another cell in an adjacent duct has also labeled (arrow). Stain: methylene blue. Bar = 80 pm.
10. If the isotopic label does not have sufftcient half-life to permit such a delay (see Note 8). select a few extra embedded tissue slices for X-ray exposure, so that a preview of the labeling intensity of test and control specimens may be obtained as a guide to whether the experiment was successful. 11. Embedded vibratome slices may be viewed at low magnification with a stereomicroscope, which can reveal tissue structures and thereby facilitate the selection of regions for sectioning. 12. Cut out selected areas, orientate specimens, and glue with instant araldite to araldite/epon mounts prepared in gelatine capsules, which can be fastened in microtome chuck.
3.6. Cutting
and Mounting
Sections
1. Cut semithin sections and mount on glass slides subbed with 0.5% gelath&O.l% chrome alum. 2. Coat some of these sections with L4 emulsion (high resolution) and some with K5 emulsion (low resolution) at the same time as ultrathin sections are coated, as controls for autoradiographic exposures (Fig. 1). 3. Cut ultrathin sections onto distilled water, flatten with xylene vapor, group together, and collect with a platinum loop. 4. Deposit the sections in a drop of water on a celloidincoated slide, taking care not to damage the film by touching it with the loop.
Penschow
352
and Coghlan
5 While depositing the sections, aspire the water from the slide with a fme glass capillary. 6 Score the bottom of the slide to mark the location of the sections Two groups of sections may be placed 2-3-cm apart, near the middle of each slide. 7. Store slides in a dust-free, dry box until all sections are prepared. 3.7. Autoradiography 1 2. 3. 4.
(see Note
8)
3.7.1. Dipping Slides Weigh a clean jar m a light-proof box. In the darkroom, add approx 6 g of Ilford L4 emulsion to the jar. Weigh the jar in the box again to obtam emulsion weight Add twice the emulsion weight of distilled water and leave emulsion to melt at
37-4OT. 5. Repeat for K5 emulsion 6 Divide slides into batches to be developed at intervals. 7 Prepare one batch of semithin sections for coating with K5, one for coating with
8. 9
10. 11. 12. 13.
L4 and two batches of ultrathin sections for coating with L4 (some ultrathin sections may also be coated with K5 emulsion, which can provide a useful result in the event that the L4-coated autoradiographs fail) Prepare for each batch of slides, one light-proof, airtight tin or box that can hold a rack of slides. Place an open Petri dish of dry silica gel, covered by a filter paper, in the bottom of each tin. If smaller black boxes are used, include a large parcel of dry silica gel sealed in filter paper to each box Stir emulsion and pour into dipping container in water bath at 37°C. Dip slides in emulsion and allow to dram briefly on the side of the dipping container. Place slides in a slide-staining rack until the batch is complete. Place the rack of slides into one of the prepared exposure containers and seal with black tape Leave autoradiographs at room temperature to expose. One of the batches of L4coated ultrathin sections should be left undisturbed until control autoradiographs indicate that they are exposed sufficiently. 3.7.2. Developing
Autoradiographs
After an appropriate exposure (determined by the isotope used, the mtensity of the hybridizatton signal, and so on), develop one or two of the shdes bearing KS-coated semithm sections. If these are exposed sufficiently, develop one or two of the slides with L4-coated semithin sections. These will need to be viewed under oil immersion to judge the density of silver grains. When these are exposed sufficiently, develop one batch of ultrathin sections, leaving the other undisturbed. After opening a box of autoradtographs, the silica gel should be replaced with a freshly dried batch. Developing procedures may be varied from the following in order to obtain a smaller size of silver grains (13).
Subcellular
Hybridization
Histochemistry
353
1. 2. 3. 4 5
Develop autoradiographs for 1.5 min at 20°C in D19 developer. Rinse in distilled water. Fix for 5 min in Hypam fixer, diluted 1 in 5. Rinse in running filtered water for 10 min. For semithin sections, Immerse in 4% formaldehyde solution to harden emulsion Omit this step for ultrathin sections. 6 Rinse in running filtered water for 10 min, allow to dry. 7. Stain semithm sections with filtered Toluidine blue at 30°C for 5 mm 8 Allow slides to dry, then mount with DePeEx 1. 2 3.
4. 5
3.8. Mounting Autoradiographs on Grids for EM To locate ultrathin sections on slides, view autoradiographs of sections under dark-field on a transmitted hght stereomicroscope Score a circle of 5-8 mm diameter around each group of sections with a diamond marker. Prepare a dish of clean distilled water with incident lighting for floating films, as described in Section 3 1. The celloidin/emulsion film should be almost dry when attempting to float it off the slide, so dip the slide m water and leave rt untrl almost dry. Float off on water the delineated circles of film bearing the sections, as described in Section 3.1. Deposit a cleaned 200-400 mesh copper grid over the sections on each circle, and pick up with parafrlm, noting which side of the grid is m contact wtth the parafilm. Grids may be placed on a glass slide and viewed with the light mrcroscope to ascertam the quality of the film layers and sections prior to stammg
3.9. Contrast Staining and Electron Microscopy It is important to deposit the grid on drops of stain with the celloidin film layer uppermost, so that the stain is in contact wrth the emulsion layer, through which it can diffuse. If the grid is deposited on the stain the wrong way up, the celloidin film will prevent the stain from reaching the sectlon. 1 Stain sections for 5 min in 10% uranyl 2 Rinse thoroughly, then stain in alkaline for 5 min. 3. For viewing with the EM, take care to films have stabilized, as they are fragile is too intense.
acetate in 75% methanol lead citrate (for recipe, see Section 2.5 ) begin with a low light intensity until the and may disintegrate if the electron beam
See Note 9 for discussions on future directions. 4. Notes 1 Limitations of EM hybridization histochemistry: The main limitation of IEM hybridization histochemistry is the problem of detecting a relatively small number of specific mRNA transcripts m an ultrathin section, while not causing undue tissue damage in improving sensitivity. The quantity of mRNA is 50-fold less m
Penschow
2.
3.
4
5.
and Coghlan
an ultrathin section of 0 08-O 1 pm than in sections of 5 pm, which are used routinely for hybridization at the light microscope level. Therefore, the deciston to progress from light microscope to EM hybridization of tissue sections should be based on the intensity of hybridization signal m a 5-pm section relative to that remaining in an 0.08~p.m ultrathin section. The sensitivity of hybrid detection at the ultrastructural level is further reduced by the decreased sensitivity of tine-grain, high resolutron photographic emulsions compared to coarser emulsions designed for light microscopy. Other factors that affect the sensitivity of the technique are the type of probe, type of label, and detection system employed. Thickness of celloidin films: If a grad bearing silver ultrathin sections 1sused, the thickness of the preparation (section + emulsion + celloidin) ~111be similar to the thickness of hybridized sections after autoradtography This test gives an indication of the electron-density and resolution that will be obtained from autoradiographs. If the preparation is too electron-dense, make thmner celloidin films and/ or thinner sections. Methods of tissue preparation* Frozen ultrathin sections have been shown to provide greater sensitivity than embedded trssues for biotin-labeled probes, but the morphology is relattvely poor (15). Tissue morphology can also be damaged by inappropriate fixatton, freeze-thawing, or protease treatment of tissue that can facilitate probe penetration (12). With the perfusion-fixation and preembeddmg method we have descrtbed, short radiolabeled probes (oligonucleotides or dlgested probes) penetrate the trssue without these harsh treatments, and consequently the tissue structures are optimally fixed and undamaged. There are alternative methods that utilize Lowrcryl-embedded tissue (10, 11,15) or frozen ultrathin sections (4,12,15) hybridized on gnds. There are advantages and disadvantages with each of the methods, and unfortunately maximal sensitivity and resolution do not appear to coincide m any one of the methods described to date, at least not for biotin-labeled probes (15). Choice of probe: Probes with high specificity are recommended for EM hybridization hlstochemistry, particularly for detection of mammalian mRNAs, which are generally in lower abundance than mRNAs of nonmammalian species. Radrolabeled cDNA probes (4, I I, 12) and 3’-tailed oligonucleotide probes (5,7,J have been used successfully for subcellular location of mRNA. Single-stranded RNA probes, which can be prepared to a very high specific activity, should also be suitable for EM hybridization hrstochemistry. However, as hybridrzatron and washing procedures with RNA probes are generally performed at higher temperatures than with DNA probes, temperatures may need to be reduced to avoid damage to cell ultrastructure Choice of probe label a. Isotopic labels: The choice of label depends on the resolution required from the experiment and on the level of specific mRNA m the specimen. 35S 1s the isotope most commonly employed for EM hybridization histochemistry (5,6,12). The features of 35S that make it so popular are its relatively low P-particle energy (167keV) and moderate half-life (87 d). 33Pis now available for labeling nucleic acids (NEN/Dupont or Amersham) and Its ermssion characteristics (pparticle, 250 keV) and Its half-life of 25 d are well suited to hybridization his-
Subcellular
Hybridization
Histochemistry
355
Fig. 2. Electronmicroscope autoradiographs of sections of mouse submandibular gland, taken from vibratome slices hybridized with a 3H-labeled probe complementary to mRNA for the mouse glandular kallikrein encoded by the gene, mGK-6. (A) Labeled areas are evident in the cytoplasm and at the edges of nuclei (n) of striated duct cells, with very few silver grains in areas of tissue adjacent to these cells. The basolateral surfaces of the duct cells are marked by arrowheads. (B) An area of a striated duct cell at higher magnification, showing that silver grains are located on the endoplasmic reticulum, closely associated with mitochondria. Stain: uranyl acetate and alkaline lead citrate. Bars = 1.5 pm (A), 0.5 t.trn (B).
tochemistry at the light and electron microscope level. 3H requires longer exposures than the above-mentioned isotopes (half-life 12.4 yr), however its low pparticle energy (18.5 keV) provides excellent resolution and can be used to pinpoint the location of hybrids to subcellular organelles (7) (Fig. 2). b. Nonisotopic labels: Nonisotopic probe labeling systems for EM, using biotinlabeled probes, were pioneered for the location of satellite DNA on chromosomes (9). There are several subsequent reports of their use for subcellular location of Drosophila (4) and mammalian mRNAs (Z-3,15,Z6). Immunogold or peroxidase detection systems, such as those used for immunocytochemistry with biotin-labeled antibodies, are used to locate biotin-labeled hybrids. Because of familiarity with these well-established immunocytochemical techniques, together with the reputed difficulty of EM autoradiography, immunogold detection of a biotin probe label has now become a popular nonisotopic system for EM hybridization histochemistry. 6. Comparison of isotopic and nonisotopic labeling and detection systems: The main features of the two methodologies for using isotopic vs nonisotopic probe labels
Penschow
and Coghlan
differ considerably, and the advantages and disadvantages of each should be understood when making a decision as to which type of technology to adopt The main drsadvantage of isotopic probe labeling systems for EM is the wait for autoradiographs to expose and the need to master the technique of EM autoradiography, although thts is not too drffrcult accordmg to the technique we have described here. Nonradioactive probe labeling systems are generally less sensitive than optimized tsotopic methods (5,16) and drsruptron of cell structures results from the treatment of tissue with protease, freeze-thawing, or extractron with detergent (12), which is required to enable nonisotopic detection systems to access the probe (1,3,10) Although the use of a multilayered detection system provides improved sensittvity (15) frxatron of the ttssue with paraformaldehyde for this method results m poor preservation of subcellular structures. By companson, the tissue preservation obtainable with rsotoprc EM hybridization htstochemistry using a glutaraldehyde-containing fixative (6,7) (Fig. 2), without subsequent detergent or protease treatment of tissue 1s superior to that which has been published to date for nonisotopic methods. The resolution of nonisotopically labeled hybrids at the subcellular level is theoretically superior to that of isotoprcally labeled hybrids m autoradiographs. However, where trssue morphology IS poor owing to inadequate ftxatron or there IS other damage to subcellular structures, the accurate resolution of the probe label is severely compromrsed. 7. Optimal probe concentratron: 500 ng/mL IS recommended for a 30 mer oligodeoxyribonucleotide for the technique described here for EM or 400 ng/mL for hybrrdlzation of sections for light microscopy The appropriate probe concentration differs according to the type of probe used. Double-stranded probes need to be used at a higher concentratron than single-stranded probes, to compensate for the nonhybridizmg sequences and self-annealing that occurs. Higher probe concentrations can be used for preembeddrng methods, such as we describe here than for hybridization of sections, however too high a probe concentration should be avoided as this can induce artifacts and/or high background. 8. Consideration of half-life of rsotopes: The half-life of the tsotopic label should be considered when plannmg the duration of experiments. Where isotopic labels with a short half-life are employed, such as 33P, autoradiographs should be prepared with minimum delay. 9 Future directions: As the mam difficulty of EM hybridization hrstochemrstry is obtaining sufficient sensitivity to detect mRNA in ultrathin sections, the techtuque will follow any direction that promises an rmprovement in the detection rate. The greatest potential improvement in sensitivity may come from “in situ PCR,” which has already been used for detection of viral DNA m tissue sections at the light microscope level (17) However, for the successful adaptation of this technology to EM, it will be necessary to protect subcellular structures from the ravages of the high temperature cycles. As high resolutron can only be achieved rf the morphological mtegrrty of the tissue is preserved, the tradeoff between sensitivity and resolution seems likely to continue.
Subcellular
Hybridization
Histochemistry
357
Acknowledgments We are grateful to Jim Haralambidis for expert advice and the Anatorny Department, University of Melbourne, for the use of EM facilities. This work was supported by grants-in-aid from the National Health and Medical Research Council of Australia, the Myer Family Trusts, the Ian Potter Foundation, and the Howard Florey Blomedlcal Foundation. References 1, Singer, R. H., Langevm, G L , and Lawrence, J. B (1989) Ultrastructural vlsuahzatlon of cytoskeletal mRNAs and their associated protems using double-label in alto hybridization J Cell Blol
108,2343-2353
2 Webster,H de F , Lamperth,L., Favllla, J T , Lemke,G , Tesm,D., andManuehdis,L (1987)Useof a biotinylated probeandin situ hybridization for light andelectronmlcroscop~clocahzatlonof POmRNA in myehn-formingSchwanncells. Hlstochemrstry136, 441-444. 3 Pomeroy,M. E , Lawrence,J B , Singer,R. H., andBillings-Gagliardl,S (1991) Distnbution of myosinheavychainmRNA in embryonicmuscletissuevisualizedby ultrastructural in situ hybridization Dev. Biol. 143,58-67. 4 Pollock, J A , Elhsman,M H , andBenzer, S (1990) Subcellularlocahzattonof transcriptsin Drosoph~ln photoreceptorneuronschaopt~ mutantshave an aberrantdistribution. Genes Dev 4,806-821 5 Guitteny, A -F andBloch, B (1989)Ultrastructuraldetectionof the vasopressm messenger RNA m the normalandBrattelbororat. Histochemlstry 92,277-281 6 Pelletler, G., Tong, Y., Simard,J , Zhao, H -F , and Labne, F (1989) Localization of peptidegeneexpressionby rn situ hybridization at electronmlcroscoplclevel Methods Neuroscr. 1, 197-208.
7 Penschow,J D , Haralambidls,J , andCoghlan,J. P. (1991) Locationof glandularkallikrem mRNAs m mousesubmandibular glandat the cellularand ultrastructurallevel by hybrldlzatlon hlstochemlstryusing32Pand3H-labeledohgodeoxyribonucleotldeprobes J Histochem. Cytochem 39,835-842.
8. Jacob,J K., Gillies, D., MacLeod, D., andJones,K. (1974)Molecular hybridization of mousesatelliteDNA complementaryRNA in ultrathin sectionspreparedfor electronmicroscopy J Cell Scl 14,253-261 9. Hutchtson,N J , Langer-Safer,P. R., Ward, D. C., and Hamkalo,B. A (1982) In situ hybridization at the electronmicroscopelevel: hybrid detectionby autoradiographyand colloidal gold. J. Cell Blol 95,609-618. 10. Binder, M., Tourmente,S , Roth,J , Renaud,M., andGehrmg,W. J (1986)In situ hybrtdrzation at the electronmicroscopelevel: localizationof transcriptson ultrathin sectionsof Lowlcryl K4M-embeddedtissueusmgblotmylatedprobesand protein A complexesJ Cell Biol. 102, 1646-1653. 11. Morel, G andGossard,F. (1989)Ultrastructuraldlstrlbutlonof GH mRNA andGH mtron I sequences in rat pituitary gland*effects of GH releasingfactor andsomatostatmMel Cell Endocnnol
65,81-89
12. Tong, Y , Zhao,H F , Slmard,J , Labne,F , andPelletler,G. (1989)Electronmlcroscoplc autoradlographlclocalizationof prolactmmRNA mrat pituitary J Hlstochem. Cytochem 37,567-57 1 13. Kopriwa, B M. (1973)A reliable,standardizedmethodfor ultrastructuralelectronmlcloscoplcradioautographyHtstochenne 37, 1-17.
Penschow
and Coghlan
14 Penschow, J. D., Haralambldrs, J., Pownall, S., and Coghlan, J P (1989) Locatton of gene expression m tissue secttons by hybrtdizatron histochemrstry using ohgodeoxyribonucleotide probes Methods Neuroscr 1,222-238 15 Le Guellec, D , Trembleau,A., Pechoux,C., Gossard,F., and Morel, G (1992) Ultrastructuralnon-radloactrvem situ hybridization of GH mRNA in rat prtuttary gland: preembeddingvs ultra-thin frozen sectronsvs post-embeddingJ. Hzstochetn Cytochem 40, 979-986.
16 Guitteny, A -F , Fouque,B., Teoule,R , and Bloch, B (1989)Vasopressingeneexpressionin the normalandBrattelbororat a hrstologrcalanalystsm semr-thmsectionswrth brotinylatedohgonucletrdeprobesJ Htstochem Cytochem 37, 1479-1487 17 Chm, K.-P., Cohen,S. H., Morns, D W , andJordan,G W (1992) Intracellularamphfrcatron of provtral DNA m tissue sectionsusmgthe polymerasechain reactron. J Histochem
Cytochem. 40,333-341.
CHAPTER 29
Principle
of Digital
Imaging
Microscopy
Ma%6 Coppey-Moisan, Jozo Delic, Henri Magdelenat, and Jacques Coppey 1. Introduction A challenging problem of in situ hybridization is to visualize then localize genes or specific sequences within the interphase nuclei or on chromosomes, as we now have at our disposal a large panel of probes. In addition, methods for probe labeling are continuously being improved to allow increased efficiency of in situ hybridization. A considerable advance was recently achieved in chromosome and chromatin mapping by takmg advantage of chromatm decondensation (1,2) and multicolor fluorescence labeling (34). Sequences separated by less than 10 kb could be resolved in that way (1,2). The two main goals of in situ hybridization are indeed to construct physical maps of chromosomes and to get insight into the organization of nuclear domains that are maintained by DNA interactions involving structures like the nucleoskeleton. In chromosomes, the high degree of chromatin compaction can lead to symmetrical position acrossthe chromatid width for sequencesfrom 500 kb to 1 Mb apart (5). The packaging ratio, which gives a coarse estimate of a certain level of chromatin compaction, constitutes a preliminary result in that way (2,s). Studies on the different levels of nuclear organization require adequate optical microscopy, such as digital imaging microscopy (7-I3), which has, over the last few years, received major improvements with regard to sensitivity (1418), spatial resolution (19-23), and the possibility of 3D imaging (24-31). This microscopy allows the precise study of nuclear organization (632-37). We describe here the basic principles of digital imaging microscopy. In particular, we describe conditions for optimizing contrast enhancement, namely, optical selection of luminance of the probe, sensitivity of the electronic detectors and specific digital image processmg. Because of our specific experience, we deal principally with imaging in two dimensions. 2. Strategy 2.1. Method
Based
On Light
Emission
Detection
Radioisotopic labeling of probes has been widely used to detect small amounts of specific sequencesextracted from tissues and cells or immobilized From Edlted
Mefhods m Molecular Emlogy, Vol 33 In S11u Hybrrdrzehon Protocols by K H A Choo CopyrIght 0 1994 Humana Press Inc , Totowa, NJ
359
Coppey-Moisan
et al.
on a membrane. However, an imaging approach is needed for gene mapping on chromosomes or interphase nuclei. Thus, spatial resolution and sensitivity of detection are the two critical parameters to consider. As we will show, they are related to each other in the imaging approach. Nonisotopic labeling of probes has been primarily developed to improve handling and safety in routine research. Among nonisotopic labeled probes, those based on light emission constitute the basis for the strategy we develop here. Indeed, the photophysical and optical advantages afforded by light emission render high-performance detection of such probes for the followmg reasons: 1 Stimulated emission 1s inherently more sensitive than light absorption because the workmg concentration ranges are weaker in the former than in the latter case. 2 A luminescent image possesses intrinsic contrast which is higher than an absorption image, owing to the visualization of an absolute signal in the former case instead of a relative signal in the latter. Moreover, the emitted photons can be further amplified, independently of any contrast enhancement processing. 3. Contrary to the detection of radioactive isotope, the resolution of which is hmited by the scattering distance in the emulsion (l-2 pm for tntium) (38), emitted light subsequent to either an excitation process (fluorescence or phosphorescence), or an oxidation reaction (bio- or chemiluminescence) arises from molecules directly attached or close (less than a few hundred Angstriims in indirect labeling methods) to the nucleic acid probe Localization of a light emitting probe is consequently much more precise than locahzation of a radioactive probe. 4. The spatial distrlbutlon of emission can be envisaged as a chstribution of incoherent point light sources This property allows super resolution to be obtained when processing the image by deconvolution (20,23,39,40). 5. The fluorescence light exhibits spectral properties of excitation as well as of errusslon. Thus a large variety of fluorescent molecules can be used when the aim is to simultaneously detect several probes and to determine their relative localization inside a given cell (multiparametric detection). 6. Long-lived light emission (such as phosphorescence) or spontaneous light etmssion (bio- or chemiluminescence) provide the possibility to ehmmate background light which otherwlse comes from residual excitation light or from short-hved fluorescence emission (13,41). With chemduminescent probes, excitation hght is not required. Thus the emitted hght arises only from the probe With long-lived fluorophores, time resolved fluorescence allows the elimination of background light. 2.2. Imaging
Systems
There are two main strategies to build up an image. In conventional microscopy, the whole microscopic field is homogeneously illummated. The fluorescent image is directly projected on the face plate of a spatially resolvmg detector. In scanning confocal microscopy, both illumination and detection optics are focused down on a single volume element of the specimen. A complete image can be reconstructed by sequentially sampling all volumic elements wlthm the focal plane. In conventional microscopy, 2D images are
Digital
Imaging
Microscopy
361
created; they are carried by photographic plates or by electronic detector arrays. They can be stored in computer memory. In confocal microscopy, the 3D object field, obtained from several focal planes acquired by optical sectioning, is stored in a 3D array residing in the computer memory. We briefly explain the principle of image formation, with some theoretical considerations and description of optical microscopy and digital imaging. Our main focus is on the application of these techniques to in situ hybridization problems. 2.3. Inherent Limitations to t?te Optical Techniques With the improvement of optical microscopy afforded by contrast enhancement (aberrations corrected lenses, video, intensifier detector, image processmg, and so on), very small objects (whose dimensions are far below the resolution limits) can be visualized, such as lo-nm diameter actm filaments (42,#3) or single microtubules (4447). However, the resolution, expressed as the abrlity to separate images of two neighboring object points, is more difficult to improve. Indeed, the methodology based on light emission detection possesses two main limitations for resolving very weak in situ hybridization signals: 1. Because of the ondulatory nature of light, the spatial resolution IS limited by diffraction, about 0.2 urn for blue light. This dimension, being large with regard to the spacing of genes on chromosomes, can limit high-resolution (expressed in basepair) gene mapping. However, in certain cases, this limitation can be overcome using multicolor fluorescence labeling. 2 The nature of the second limitation is different, namely the high cost of these techniques. For multicopy genes or genes of large size (>lO kb), the fluorescence intensity of the hybridization signal is high enough to be easily aetected. However, for single-copy DNA sequences of small size (~5 kb), the fluorescence intensity of the hybridization signal is hard to detect This raises problems of contrast, hence of degradation in the resolution, as we discuss later. Procedures are now available to enhance the contrast but the cameras and digital hardT I re required are still expensive 2.4. Main
Strategy
Visualizing an object can be defined as the ability to discriminate luminance differences from adjacent fields. The leading aim of digital imaging microscopy applied to stationary samples is to optimize the contrast. The higher the contrast, the better will be the visualization. The minimum extent of contrast that can be detected is about 2% when the average luminance of the field is relatively high. Contrast discrimmation decreases with decreasing average luminance of the field and also with decreasing size of the object (Fig. 1). As pointed out by S. InouC (20), “the major reason for which very small objects cannot be vrsualized IS not because their diameters are below the resolution limit of the microscope but because their diffraction images possess low con-
362
Coppey-Moisan AI I
I+AI Adof
et al.
I
B l 2 940
LuminanceI
(Ft. Larnberts)
Fig 1 Contrastsensitivity AM 1sthe thresholdcontrast(I e., the minimumcontrastthat canbe detectedby the eye), The threshold1shigher(discnmmationof luminancedifference1s moredifficult) for lower (or very high) backgroundluminanceandfor smallertestobjects.
trast.” Increase in the contrast can be achieved at different levels. The precise nature of these levels dictates the required devices. We later focus on the dlfferent steps that allow enhancement of the contrast. These are: 1. At the optical level, i e , by spectral filtering (fluorescence selection) and by out-
of-focus filtering (confocal microscopy or optical serial sectlonning microscopy); 2 At the detection level, i e , by using very sensitive cameras (photon counting sensitivity) and intensifiers (electronic amplification); 3. At the level of image sampling, 4 At the level of agnal-to-noise ratio by temporal filtering; 5. At the level of digital processing (gray-level stretching and high-pass filtering)
3. Principles Principles of Fluorescence
3.1. Basic 3.1.1. Jablonski Diagram Luminescence designs the emission of photons from electromcally excited states. As for phosphorescence, the fluorescence emission takes place after absorption of light. Fluorescence results from the return of excited electrons to their lower orbital state with a lifetime close to lo-* s (48). The llfetlme 1s the average period of time a fluorophore remams in excited state. Phosphorescence is the emission that results from transition between states of different multiplicities, generally a triplet excited state returning to a singlet ground state. Typical phosphorescent hfetimes range from milhseconds to seconds, depending primarily on the importance of deactivation process other than emission. The fluorescent molecules can be deactivated by photooxldatlon in the presence of oxygen (photobleachmg). The absorption and emission of light are illustrated by an energy-level diagram, as suggested by Jablonski (Fig. 2).
Digital
Imaging Excited s2 States s1
363
Microscopy
lntelnal conversion
lntmystem crossmg
A.
I-
t----
kg-
fluorescence
absorptionhVA Ground States Sg
\
photobleachtng
hVP \
phosphorescence
&
Fig 2 Jablonskl’s diagram The ground,first, and secondelectrorucstates(singlet states) are depicted by So, S,, and SZ.The absorptionoccursIn about lo-l5 s. Excited molecules relax to the lowestvIbratIona level of S, In about lo-l2 s (Internalconvernon), thento S, either by radiationlessprocess(rate constant= k) or by the emissionof photon(rate constant= I’). Moleculesin S, statecanalsoundergoconversionto the first triplet stateT,. Emlsslonfrom T, 1sphosphorescence Moleculesin theexcited statescanalsoreactwith 02 (photobleaching)A variety of other processes (not shownhere)canalsoinfluencethe fluorescenceemission,e g., solventeffects, solventrelaxation,quenching,andotherexcited slatereactions
3.1.2. Stokes’ Shift A fluorescence emission spectrum is established by plotting the fluorescence mtensity vs the wavelength (in nanometers) or wave number (in cm-l). A general characteristtc of fluorescence (as of phosphorescence) IS a shift to longer wavelength, i.e., a loss of energy, of the emitted hght relative to the absorbed one, i.e., the Stokes’ shift (Fig. 3). Epifluorescence microscopy takes advantage of this shift to cut off the excitation light in the direction of fluorescence emlssion by a dichroic mirror (Fig. 4). 3.1.3. Parameters Controlling the Fluorescence The fluorescence intensity increases with (48):
Intensity
1. The extinction coefficient, E, which measuresthe probability of absorption: If the probability of absorption of fluorescent moleculesIShigh, then the probability Iof
emission is high and the intrinsic lrfetlme of the excited state 1s short. 2. The quantum yield* As illustrated in Jablonski diagram (Fig. 2), followmg light absorption, several processesusually occur. The fluorescence quantum yield is the ratio of the number of photons emitted to that of photons absorbed. The rate constants r and k both characterize the kinetics of depopulation from the excited state The fraction of fluorophores that decay through emission IS given by* Q = l-/(l-+ k)
The quantum yield can be close to 1 if the radiationless rate, k, of deactivation is much smaller than the rate, r, of radiation decay, that is k CCr The quantulm yield of phosphorescence is small at room temperature (-10e6),
364
Coppey-Moisan
400
500
et al.
600
wavelength (nm) Fig. 3. Stokes’ shift. Normalized absorption (- - -) and emission (-) labeled antibody.
spectra of FITC-
fluorescence
excitation above cutoff Excitation Source
/I+ -4 chroic
Fig. 4. Diagram of epifluorescence microscope. Epifluorescence is based on the use of dichroic mirror. The dichroic mirror is a chromatic beam splitter characterized by a cutoff wavelength: For wavelengths below this cutoff, light is reflected by the mirror, and for wavelengths above the cutoff, light is transmitted through the mirror. Depending on the fluorescence characteristics of the probe, the dichroic mirror is chosen on the basis of the Stokes’ shift, i.e., the excitation light has to be reflected by the dichroic mirror and the fluorescence light (collected by the objective lenses) has to pass through the dichroic mirror to the detector.
Digital
Imaging
Microscopy
Table 1 Spectroscopic Properties of Probes Employed in In Situ Hybrldlzatlon DetectIon
Probe FITC FITC-antibody TRITC-amines XRITC-amines TR-amines EITC Phycoerythnn-R Allophycocyanme Bodipy CY5 CRF 492 CR 110
Absorption maximum, nm 490 490 554 582 596 522 480-565 650 505 646 492 498
Extinction maximum* 67 85 79 85 83 1960 700 84 200 75 75
Emlsslon maximum, nm
Quantum yield
Refs -
520 520 573 601 620 540 578 660 520 663 521 525
071 0.1-0.4** 0.28 026 051 019 0.68 0.68 -0.70 -0 30 -070 -0.70
9, MI’ 9 9, MP 9 9, MI’ 9 9 9, MT’ 49 50 49 49
Abbrevlatlons FITC, fluorescem Isotluocyanate, TRITC, tetramethylrhodamme Isotluocyanate, XRITC, xanthene analog rhodamine Isotluocyanate, TR, Texas Red, EITC, eosm lsothlocyanate, CY5, pentamethme cyanine dye lsothlocyanate, Bodipy, bora dipyrromethene difluonde, CR1 10, carboxyrhodanune 110, CRF492, carboxyrhodafluor 492, (*), multiply value listed by 1000 to get Llmol cm, (**), dye/antibody ratio of 2.5, MP, Molecular Probes, Inc , catalog For steady state measurements (continuous excitation), the convenient fluorophores have to be photostable with high quantum yield. Fluorescent probes that present such properties are now available as Bodipy (Molecular Probe, Eugene, OR) (49) and carbocyanide derivatives (BDS, Pittsburgh, PA) (50) (Table 1). Note that the quantum yield and the lifetime can be modified by all factors that affect either of the rate constants, most notable of which is quenchmg. A variety of processes can give quenching. excited state reaction, energy transfer, complex formation, and collision. For example, fluorescence quenching occurs when the fluorophores are physically close enough to form dimers or larger aggregates (at high concentration). This situation can be encountered m immunofluorescence: The number of fluorescent molecules per antibody molecule therefore has to be optimized. 3. The fluorophore concentration: The fluorescence intensity KSdirectly proportional to the number of fluorescent molecules. Fluorescence reabsorption can occur at high fluorophore concentration owing to partial overlapping between absorption and emission spectra. This can take place in confocal microscopy for the fluorescent image corresponding to the deepest focal plane. 3.2. Microscope Design 3.2.1. Spectral Selection The image contrast critically depends on the rejection of excitation light. This is done m eplfluorescence by a dichrolc mirror (DM) (Fig. 4). However, dichroic beamsplitters are poor signal purifiers. It is therefore necessary to use
366
Coppey-Moisan
Hoechst
33342 +DNA
300
et al.
400
FluoresceIn
XRITC
600
500
CY 5
CY 7
700
a
)O
NANOMETERS
Ftg. 5. Profiles of absorptton and emtssron spectra of typical fluorescent probes Hoechst 33342 exhtbtts a strong fluorescence (wtth a large Stokes’ shaft) only when bound to doublestranded DNA* It 1sused to counterstam chromosomes and nuclei FITC and XRITC are commonly used to label antibody for mdtrect nucleic acid labeling, and more recently to label nucleottdes drrectly (Amersham, Buckmghamshtre, UK) to avotd tmmunodetectton. CY5 and CY7 (BDS) are new fluorophores absorbing and emtttmg at longer wavelengths They can be coupled easily to antibodies, being very convenient probes (highly fluorescent and photostable) m multtparametrtc detections. Reprinted from ref. 9 wrth permtssion.
them m conlunction wtth bandpass or barrier filters. Residual excitation light can significantly contribute to background as the fluorescence is usually several orders of magnitude less intense than the intensity of excitation. Spectral overlap describes the degree to which light of any wavelength passesthrough both excitation and emission filters. Discriminating the fluorescence light from the excitation light is easier for fluorophores with a large Stokes’ shift (Fig. 5), which explains why the contrast of Hoechst fluorescence image IS better than that of fluorescem or rhodamme fluorescences, when using conventional filters. Thus, bandpass, longpass, and shortpass filters with sharply defined edges (Fig. 6) and narrow “full bandwidth at half maxtmum” transmission (FWHM) matching the maximum of excitation and emission of the dye, can provide important contrast enhancement (9,51). The lasers have only a few wavelengths that more or less match the maximum excitation of the used fluorophores. The line at 488 nm of an Argon laser corresponds to the maximum of fluorescem isothiocyanate (FITC) excitation. With other standard light sources, a compromise must be found between the selection, from Tungsten lamp or Xenon arc, of the right maximum excitation wavelength with narrow
Digital
Imaging
367
Microscopy
80
20
0
gig. 6. Contrast enhancement by spectral selection of fluorescence light using optimized filters. (A) The high performance longpass filter (EF series, Omega Optical, Inc., Brattleboro, VT) cuts more sharply and blocks more deeply than the conventional filter (DF series, Omega Optical) (transmission on a logarithmic scale). (B) An optimized pair of excitation and emission bandpass filters for FITC on a linear percent transmission scale (DF series, Omega Optical). Reprinted from “Omega working paper #l,” with permission.
FWHM filter and relatively low excitation intensity, and the selection of the strong lines of mercury arc differing from the maximum excitation of commonly used fluorophores (unless for Hoechst dye). However, contrast amelioration afforded by strong selective filters and maximum fluorescence excitation must usually be chosen above the intensity decrease, especially if we can use intensifiers. Indeed these devices can amplify photons (some have single photon sensitivity, i.e., light level is not a limiting factor), but without discriminating their energy (no wavelength selection at this level). 3.2.2. Out-of-Focus Removal The depth of field (DF) of an optical system (objective) defines the distance along the optical axis through the object which is in focus at the image plane. The DF can be calculated from the expression: DF = [ 1000/(7NA x M)] + (U2NA2)
NA being the numerical aperture of the objective and M the magnification. The numerical aperture measures the light collected by the lens. It is defined by: NA = n sin@
where n is the refractive index sample/objective and 0 is the half-angle of the cone of rays entering the objective. For example, with an oil objective having M = 100 and NA = 1.3 and assuming a wavelength of 500 nm, the depth of field is 0.26 pm.
368
Coppey-Moisan
et al.
In 2D microscopy, the out-of-focus light emanating from regions outside the depth of field that is recovered m the plane of focus constitutes a glare. In interphase nuclei, out-of-focus information significantly contributes to the image background, thus altering the contrast. Out-of-focus removal can be accomplished by optical section microscopy coupled to digital image processing methods as described by Agard et al. (24,27,3I), or by confocal microscopy (12,21,28,52-54). In a confocal imaging system, both illummation and detection optics are focused down on a single volumic element of the sample. This 1sobtained by inserting a pinhole (aperture) on the excitation and emission focal plane conjugated with the focal plane containing the volume element. The resulting effect is to block rays of light emanating from above and below the plane of focus and to Increase the cut-off spatial frequency (21,23). The improvement concerns the resolution along the optical axis as well as over the x-y lateral plane (54,55). A full image is built up by sequentially sampling all volumic elements within the focal plane. The sampling is carried out by either of the followmg possibtlities: 1. The sample is scanned under a stationary beam (on-axis system) (21,28, 37,54,55) 2 The illumination beam is scanned itself, while the object stage remams fixed (off-axis system) (22). 3 Apertures in the lllummatlon and detectlon beam paths are scanned in tandem (30,56).
The last procedure uses a multiaperture configuration and a conventional white light illumination. The other two scanning microscopies use emission lines of laser for illumination. 3.2.3.
Objective
Lenses
Whatever the applied digital processmg, the image is formed by the objective lenses. Thus, the qualities of these lenses are critical. Remember that the contrast threshold AUZdepends on the average luminance, I, of the field (Fig. 1). The image brightness is governed by the light gathering power of the objective lens. In epifluorescence, the image brightness 1sas follows: - NA4/M2
A superior quality image can be obtained using high-NA (1.3 or 1.4) objective and oil immersion with correct refractive index. High quality objectives are now available, corrected for chromatic and spherical aberrations. To increase the brightness, we can decrease the magmficatton. However, the contrast is also a function of the object size, being lower for an object of small dimension (Fig. 1). For very small objects, we must keep the magtnfication at a relatively high level (> x100). For example, to visualize fluorescent
Digital
Imaging
Microscopy
369
beads of 60-nm diameter, the image has to be projected onto the face plate of the detector with an ocular of power x6. To experimentally optimize the contrast, the final magnification of the projected image can be fine tuned by slicimg the detector along the optical axis. of Digital Imaging Microscopy It is out of the scope of this review to discuss the complete theory of linear systems and of Fourier representation (39,57-59; for reviews, we recommend refs. 20,60,61). However, important properties of digital imaging can be readily understood from the few theoretical considerations that we will describe. We will limit these to 2D representation, although they can be extrapolated to 31). However, for 3D, many other physical considerations (residual lenses aberrations, off-axis posltlon, and so on) have to be taken into account. 3.3. Basic
Principles
3.3.1. Point
Spread
Function
Let us consider, in an (x,,y,) plane, a pinpoint of light on a black background and define it as a unit impulse &(~,,y,). What we see through our imaging system is the point image spread mto a finite-size distribution of intensity, primarily owing to the diffraction aperture of the lenses: The point image is dlstorted by the “point spread function” (PSF), which simply defines the image of a point object given by this system. This PSF appears, in an (x,y) plane, as a series of concentrlc rings, called the Auy pattern (Fig. 7). A fluorescent scene can be represented by a certain dlstributlon of light in a plane perpendicular to the optical axis: a 2D light intensity function, denoted ZO(xo,yO), where the value or amplitude of Z, at spatial coordinate (x,,y,) gives the intensity (brightness) of the scene at this point. In fluorescence emission, the distribution of light can be considered as a spatial distribution of incoherent point sources. Through diffraction limited imaging system, each point source gives its own diffraction pattern without interfering with each other, owing to the incoherence of the sources. Thus each input fluorescence distribution can be represented as a weighted set of impulses (point sources); each weighted impulse generates a weighted PSF; the sum of the weighted PSFs is the resulting output image: I(x,Y) = U.GY,) * PSF(x,y) i.e., any arbitrary image acquired with an imaging system is the convolution of the ideal image with the PSF. Conversely, the ideal image can be recovered by deconvolution of the actual image with the PSF. 3.3.2. Rayleigh
Criterion
The Raylelgh criterion IS based on the narrowness of the PSF. Two adjacent points in a scene are spread by the optics into two PSF. The two points can be resolved if the distance between the maximum of each PSF 1sequal or greater
370
Coppey-Moisan
et al.
Fig 7 DIffractton pattern of a point of light by an tmagmg system. The Point Spread Function A lummous impulse 6(x,y,) m a plane (q,,yJ perpendicular to the z axis, 1sImaged through the system S. Here we consider only the dtstnbutton of the point Image mtensrty m a plane (.~,y) perpendtcular to the z axis (A) This dtstrrbutron IS characterized by concentric white and black rmgs, the Atry Pattern (B), rf the lenses of the imaging system are aberration-free and have circular apertures In this case, the PSF is circularly symmetric and thus depends only on the radtal distance r from the center of the PSF (B)
than r, r, being the distance of the first dark ring of Airy pattern from the center position (Fig. 7B). For a lens with a crrcular aperture: r,, = 0.61 hlNA for green light h - 0.5 pm and NA = 1.3, then r, -h/2 = 0.25 j.tm. 3.3.3. Modulation Transfert Function and Contrast Modulation Transfert Function
An input image can be represented as a weighted sum of smusords as the most physical signals. For the sake of clarity, let us consider a lummous scene with only one sinusoidal spatial variation of intensity I&,) along the X, axis. This smusord is characterized by a spatial period T (or spatial frequency co, expressed in cycles per millimeter) (Fig. 8A). This scene is imaged with unity magnification, producmg a sinusoidal image intensity Z(X). The amplitude and phase of the smusord may change through the imaging system, but the frequency will stay unchanged. The amplitude decrease of the sinusoid afforded by the diffraction limited imaging system depends on spatial frequency, w. Varying this quanttty as a functton of CIIvalues constttutes the Modulation
Digital
Imaging
Microscopy
371
Rg 8 Modulation Transfert Function. (A) Through an Imaging system (magmfication = L), the modulation, (I,,- &,,,)/(I,, + I,,,,“), is less in the image (I) than in the object (I,). The spatial frequency of the Image IS the same as that of the ObJect(w) MTF = image modulatlon/obJ& modulation (B) Relatlonshlp between r,, of the PSF, and w, of the MTF (circular aperture and incoherent llluminatlon).
Transfert Function (MTF) of the system (Fig. 8B). In the Fourier theory, the MTF represents the magnitude of Optical Transfert Function (OTF); OTF being the counterpart of the PSF in spatial frequency domain. To monitor how an imaging system affects the contrast, usually test patterns are used. The test patterns are charts of alternating light and dark rectangular bars m place of sinusoid. The size of bars per unit length can be viewed as the frequency of the smusoid, bemg therefore expressed in line-pairs per millimeter or micrometer. The contrast of output pattern will decrease as the size and spacing of the input bars become smaller (Fig. 9A). The contrast modulation transfer-t function (CMTF) is the variation of contrast of the output pattern as a function of spacing (spatial frequency) (Fig. 9). The image contrast is highest for low spatial frequencies, and declines to zero with increasing spatial frequency. The spatial frequency at which the contrast reaches zero is called cutoff frequency, o, (Fig. 8B). This value depends on NA of the lens (objective) and on the light wavelength: o,=2NA/k If the optical system is circularly symmetric, the cutoff frequency 1s then related to r, (Rayleigh criterion) as follows: 0, = 2.44 &-,
Coppey-Moisan
372
CMTF
= - w-B
A
et al.
,I
B 60
0
0
10
20
30
spatial frequency (lp/mm) Fig. 9 Contrast Modulation Transfert Function (A) CMTF definition (B) Typlcal CMTF for Image intensifier tube (mlcrochanel plate)
In Fourier transform theory, this means that the highest spatial frequencies that are found remote from the optical axis compared to the lower spatial frequencies, are cutoff by the aperture function of the objective. The Fourier transform of Z&y) vamshes for values of spatial frequencies outside the interval (-0, + o,). A function whose transform has this property is called a bandlimited function. The MTF and CMTF apply to either part, optics, electronics, or digital device of an imaging system. However, in contrast to the MTF, the final CMTF resulting from several system components cannot be calculated by multiplying the CMTF of each component. 3.3.4. Sampling
the Image
For computer processing, an image function Z(x,y) must be digitized both spatially and in amplitude. Digitization of the spatial coordmates (x,y) will be referred to as image sampling, and amplitude digitization to as gray-level quan-
Digital
Imaging
Microscopy
373
tization. A continuous image I(x,y) IS approximized by evenly spacing sample arranged in the form of an N x M array where each element of the array is a discrete quantity. Sampling process does not alter the CMTF of the imaging system per se. However, to establish under what sampling conditions a continuous image can be fully recovered from a set of sample values constitutes a problem. One advantage of an image that has been filtered through a system of finite bandwidth (0,) is that it allows the sampling of the image with a finite frequency and the derivation of a set of numbers that completely represent the presampled continuous image. The Nyquist sampling theorem says that a signal limited to a bandwidth o,, can be completely represented by the collection of samples obtained by periodic sampling at a frequency higher than Zo,, i.e., co, > 20,. For an objective x100, NA = 1.3, with the green light, the cutoff frequency is: o, = 2NA/h, thus w, = 5.6 cycles/pm In this case, the sampling frequency must be greater than 11,200 cycles/mm (or 11,200 line-pairs/mm), the corresponding spacing between two lines bemg -0.09 l,tm. In order not to lose image information, sampling the fluorescent image given by this objective must correspond to points, at the specimen plane, closer than 0.09 pm. Knowing the cutoff frequency (or MTF) of the detector will give the magnification at which the image has to be projected onto the face plate of the detector. 3.3.5. Sensitivity and Resolution of Spatially Resolving Detectors
The sensitivity can be defined as the detectability of light coming from an object. The detectability of a fluorescent object depends not only on the light level (function of the concentration of fluorescent molecules, of the quantum yield of fluorophore, of the excitation intensity, and of light collection from the objective lenses) but also on the contrast of the scene.The spatial resolution of an image-forming system corresponds to the ability to separate images from two neighboring object points. We have shown that the spatial resolution can also be expressed as the cutoff frequency of the CMTF curve. With photoelectrical devices, contrast and resolution degradation comes from noise, primarily electronic. Thus, with spatially resolving devices, contrast amelioration concerns the signal-to-noise ratio (SNR). After having maximized the contrast at optical level, contrast boosting may be achieved with appropriate detectors and is an important requirement to enhance sensitivity and simultaneous spatial resolution. There are two main types of spatially resolving detectors that can be used at low light level: cooled CCD (Charge Coupled Device) camera and intensified video camera. We will not give an exhaustive description of these detectors:
Coppey-Moisan
374
et al.
Output Node
1b
512 Pixels (10.25 mm) 41
Fig. 10. Diagram of a CCD array image intensifier. Reprinted from ref. 18 with permission. They are well described in other articles (7,14,17-19,62). We will just focus on properties critical to the detection and resolution of very small fluorescent signals. 1. Solid-state camera (CCD): The sensor of the camera constitutes a 2D-array of independent potential wells. A device of 5 12 x 512 pixels CCD is schematized in Fig. 10. A total of 262,144 independent sites are capable of storing photoninduced electronic charges. Each square element of the array measures 20 x 20 pm. An image focused on this array produces a pattern of charges proportional to the total integrated flux incident on each photosite. Readout of the CCD is achieved by charge transfert, row by row, to a serial register. Charge packets in the serial register are individually shifted toward an output amplifier. The image sampling with the highest frequency that we can obtain using the CCD chip example chosen here corresponds to the size of one pixel, i.e., 20 pm. When matching this value to that determined from the Nyquist theorem applied to an objective with xl00 magnification and NA = 1.3 (co, = 0.09 pm), we deduce that the projected image onto the CCD chip must have a final magnification of 20/0.09, i.e., 220 times. However, at low light level, noise is the source of contrast degradation. Photon noise is the primary CCD noise source. Under low light conditions, preamplifier noise exceeds photon shot noise. When the signal level is high enough, the preamplifier noise is no more relevant. Thus the available light level determines the integration time required to get an acceptable SNR. The presence of dark
Digital
Imaging
Microscopy
375 MIcrochannel
photocathode
anode
mput
plate
output
phosphor screen
Fig 11 Diagram of the TH9304 image mtenstfier (LhBsa Clectromque)
current constitutes an addltional concern to low hght level applicattons To decrease the dark current, CCD must be chilled to -60°C. Usually this is done by thermoelectric
cooling (Peltier effect)
The dynamic range of an imager is defined as the ratio of the device saturatton charge to the system noise level. One characteristic advantage of the cooled CCD camera is its high dynamic range. This property is important to simultaneously visualize two objects possessing greatly different fluorescent intensities in a given scene. The electronic image corresponding to a frame, i.e , a complete readout of the CCD array, can be digitized and stored m computer memory with a precision up to 12-14 bits. Associated with slow scan readout to decrease the background noise from charge transfert, this device can give very good contrast. However, for extremely low hght flux, it can happen that the time of integration to attain a correct SNR is too long, giving rise to fluorescence photobleachmg. The image acquisition time for very weak fluorescent object is the only limiting factor for this type of solid-state device. 2. Intensified vrdeo camera: When the fluorescence level is very low, the mtegration time of CCD rmager to get a significant SNR may be too long because of photobleaching, as mentioned above, although antroxidants, such as propylgallate can be added mto the mounting medium of the shde Solving this problem requires the use of an image intensifier, such as a microchannel plate (MCP) (15) coupled to a video camera (or a CCD camera) (14,16,62). From our own experience, when the goal IS to detect very weak fluorescent signals from tiny objects, as those originating from in srtu hybridization of single-copy DNA probes of c5 kb, two intensifier stages are requrred. The setup for this IS more elaborate than those for a cooled CCD, and the intensifying detector device cannot be directly mounted onto the microscope. We have to fix the drfferent elements on a solid support to allow accurate optic alignment with the microscope output. A complete intensifier tube (Thomson TH 9304, Lhtsa tlectromque, CergyPontoise, France) containing the MCP is represented in Fig. 11. MCP is a device which consists of a btdimensional array (Fig. 12C) of several milhons of tiny independent electron multiplicators. Each multiplicator corresponds to an image
376
Coppey-Moisan
et al.
electron beam
output
B C Fig 12 Schematic diagram of microchannel plate Microchannel plate (C) IS formed from an array of multlplicator fibers. One fiber (stretched glass fiber) is schematized in (A), the fibers are arranged in hexagonal fashton (B), and cut to form a plate of -l-mm height (C)
element or pixel. One multiplicator of the array is schematized in Fig. 12A. The input photocathode converts the photons of fluorescent image to electrons. Each spatially resolved electron is amplified by secondary electronic emission through the MCP channels. At their output, a phosphor screen transforms the amplified electrons into photons. Image is intensified by this device The spectral sensitivity of the photocathode is enhanced in red wavelength domain, resulting m similar sensitivity between 400 and 700 nm (Fig. 13). The dimension of each mlcrochannel is 15+m diameter, the distance between neighboring microchannels being 15 pm Thus, a sampling of the fluorescent image at the detector plate every 15 pm corresponds to the limited sampling frequency of the intensifier. Here again we can determine the magnification at which the fluorescent image has to be proJected onto the face plate of the detector to keep a diffraction limited spatial resolution (the sampling has to correspond to points in the object plane separated by at least 0.09 pm, with the objective and the conditions described above; the magnification of the projected image must be superior to x170). The MCP can be either fiberoptically coupled to a sensitive Newvicon pickup tube, as in the case of the Lhesa 4336 camera used in our studies, or coupled by relay lenses to video or CCD cameras. The detection system we use to detect very low hght level consists of a MCP (TH 9304) coupled by relay lenses to another MCP, itself fiberoptically coupled to a Newvlcon camera (Fig. 14). Intensification by a factor of lo6 can be attained with this configuration. However, the raw image obtained for this maximal intensification is not exploitable because of the high electronic noise of the MCPs. The use of this mtensification type m real time, at high gain,
Digital
Imaging
377
Microscopy
400
600 800 wavelength (MI)
Fig 13. S20 ER photocathode radiant sensitivity of the TH9304 image intensifier (extended red sensitivity).
must be complemented by image averaging to increase the SNR. This is done by frame summation at video rate (i.e., 25 images/s) m the digital image processor buffer. This temporal filtering, which is a critical step for lmprovmg the contt ast has a consequence: Although Image intensification is carried out m real time, the final contrast optimized image is not acquired in real time We observed that for maximum gam of both MCP, summation over 500 images is sufficient to obtain a good SNR for a scene with very weak fluorescent signal. This takes less than 20 s, a time at least five times shorter than the integration time to obtain about the same SNR with a cooled CCD. We thus arrive at the same conclusion as K Jacobson and coworkers (14), namely, at very low light level, MCP intensified video or CCD cameras, coupled to temporal averaging by digital processing, are more sensitive detectors than slow scan-cooled CCD cameras. 3.3.6. Digital Image Processing
It is not our aim to detail the complex domain of digital image processing. Several books can be consulted on this (7,61,63). We will only deal with the following points: 1. Digital image processing is an absolute requirement for the visualization of weak fluorescent signals, following their intensrficatlon with MCP 2. There are different types of digital processing. Some of them are strictly required They have to be applied m a defined sequential order.
The digital image processor (Crystal or Sapphire processor,Quantel, Montignyle-Bretonneux, France) we used, coupled to a camera intensified with two MCP stages, to visualize chromosomes with in situ hybridization signals corresponding to fluorescent probes of single-copy DNA sequences (srze <5 kb), is schematized in Fig. 14.
MICROSCOPE
IMAGE
SLIDE
PROCESSING
1
6 ---- -
FLUORESCENCE
EXCITATION (SIDE
VIEW)
I
I
-
FLUORESCENCE
PROCESSOR
EMISSION (FRONT
VIEW)
CONTROL PROCESSOR
11
LH
AMPLIFICATION
AND
4336
DETECTION
Rg 14 Low-light-level image mtensrfmatton applied to fluorescence mtcroscopy Components 1, hrgh pressure mercury lamp, 2, shutter, 3, neutral denstty filter; 4a and 4b, excrtatron filters (bandpass and cutoff filters), 5, drchrotc mirror, 6, objecttve lens (x100/1 3 NA), 7, emission bandpass filter, 8, magmficatron lens (xl S), 9, mfimty focahzmg lens, 10, removable muror, 11, mterferential filter (Ah= +3 nm), 12, stzed stops; 13, ophcal couplmg between the two mtensrfier stages (two 50-mm objectives mounted head to foot), MCP, TH9304 image intensifier tube (mtcrochannel plate), LH 4336, intensified Newvtcon camera, GC gam control (from ref 32)
Digital
Imaging
Microscopy
379
The digitization process requtres a certain amount of bits to store the entire drgitized image. For an image sampled on P x Q image elements (pixels) and with gray level quantization spread over G values (prxels), the number of bits, b, required to store a digitized image is given by: b=PxQxm
wrth G = 2”‘, a common practice in digital image processing to express the digitized quantities by integer powers of two. Thus a 515 x 512 pixels array with 256 gray levels requires 2,097,152 bits of storage. 1. Temporal filtering: The first step, after digitization, 1stemporal filtermg. Following electronic ampliftcation, the resultant image is hazy owmg to outstanding noise. At every pair of coordinates (x,y), the noise, which predominantly comes from the MCP workmg at high gain, is uncorrelated and has a null average value. By summmg, on a pixel per pixel basis, the digitized values of N frames, at video rate, we increase the SNR by a factor of 2’2N-1. To do such frame summation without losing gray scale resolution, the capacity of frame buffer memory must be quite large. A frame buffer memory of 16 bits (whtch exists in Sapphire processor) may sum, prxel by ptxel, over the 520 x 576 pixel array, the gray levels of 1024 successive video frames. In the Sapphire processor, another 16 brts frarne buffer can function to have a 32 bits frame buffer. The number of summed images with a 256 gray level resolution, can reach 2048 images. However, summatron of about 500 images is sufficient to get a comfortable increase of SNR with the intensifier devices functioning at highest gain. We insist on the fact that the other digital image processings (for instance, those that utilize low spatial frequency filters to smooth the image) are not convenient for increasing the SNR 2. Shading correction. It is employed to correct spatial intensity distortion of an image obtained over a uniform field. The spatial inhomogeneity of the field image arises predominantly from the geometry of the irradiation source. Thus, the mask image used for shading correction has to be acquired in conditions of geometrical illumination similar to those used for the sample image same aperture, same dlaphram opening, and same focus. For a fluorescent image, the information needed for shading correctron is the dark current image D(x,y), acquired with the excitation shutter closed and a shading correction mask M(x,y), i.e., the image obtained from a uniformly fluorescent object, for example, an uranyl crystal The corrected image C(x,y) after shading correction of an original image O(x,y) corresponds to Cfx,yl = EOfx,y) - Dfx,yAlMx~)
- Dfx,yA x K
where K is the mean intensity of the shading mask. With a Sapphire processor, the shading correctton can be preprogramed and activated in real time However, as the shading correction decreases the mean gray level of the image, we must pay attention to the fact that an image visualized in real time with the shading correction activated, could not correspond to an original image that would be saturating at the “white” level (owing to the occurrence of pixels whose gray value is higher than 255).
380
Coppey-Moisan
0
et al.
x temporal filtering
stretching
Rg. 15. Basrc digital image processing required to enhance the contrast Drawing of mtensity profile along the x direction after temporal filtering (frame summation) and gray level stretching. 3 Gray level stretching. The third important step consrsts of enhancing the contrast of the temporal filtered image by gray level stretching (Fig 15) The arithmetrc processors used by the Sapphire system to carry out this operatron function with a good gray level precisron since they process, in a linear fashion, the gray levels of the image stored m 32 bits frame buffer. This allows enhancement of the image contrast by visualizing over 256 gray levels (8 bits) any intensity range of integrated image “picked-up” from the 32 bits memory frame buffer. 4 Image sharpening: As noticed above, an image can be represented by a weighted sum of sinusoids. In the application of Fourier analysis to imaging system, Fourier transform converts the digital image, i.e., a function that varies wtth the space dimension (sum of sinusoids) into a function that varies with frequency (spatial frequencies). The Fourier transform contains all informatron of the original image. This helps to explain the modrfications produced by the optical system: The highest spatial frequenctes of the original image are located furthest away from the origin (center of the obJective aperture) in the Fourier transform; thus, through an imaging system characterized by an aperture functton, some of the spatial frequencies, i.e., those that are too far to enter the aperture of the system are eliminated. “Spatial filtering” occurs and the resulting image is devoid of higher spatial frequencies corresponding to the finest details. Such a spatial filtering can be realized by digital processing. Fourier filters are used in optrcal sectioning microscopy to remove information that comes from outof-focus regions (7,24,62) while retaming the in-focus information More generally, “artificial” (digital) spatial filtering can be realized and applied to any digital image (7,61,63). In our case, since we have suppressed the noise (which represents a wide range of htgh spatial frequencies) by temporal filtering, we need to restore the high spatial frequencies of the ongmal image lost by the imagmg system. Since edges and others abrupt changes in gray level are associated with highfrequency components, image sharpening can be achieved by high spatial filtering This spatial filtering can be applied in the space domain by spatial convolution. The convolution masks (kernels) contain 3 x 3, 5 x 5,... values, dependent on the filter function. The convolution mask is sequentrally centered
Digital
Imaging
Microscopy
381
highpass
filter
y,, = 5x,, - (b+d+e+g)
Rg. 16. Convolution operation using spatral digttal filter on each pixel of the drgitized unfiltered image (Fig. 16). For each position of the mask, the gray values of the image pixels selected by superimpositton of the centered mask, are point-by-point multiplied by the corresponding values of the mask. The results of these multiplications are then summed; the value of the central pixel of the input image is replaced by the sum (Fig. 16). To perform a convolution mask on an entire image, this operation must be repeated for each pixel value in Ihe original image. Usually we use the following 7 x 7 sharpening filter. 0 0 0 -1 0 0 0
0 -1 -2 -2 -2
-1 0
-1
-1
-1
-2
-2
-2
1
5
1
5
25 5
5
1 -2 -1
-2 -1
1 -2 -1
0 -1 -2 -2 -2
-1 0
0 0 -1 -1 -1 0 0
It is important to note that if the original image remains noisy, the htghpas\ filtering will accentuate the residual notse.
382
Coppey-Moisan
et al.
4. Practical Examples To illustrate the usefulness of the different steps m digital image processmg drscussed, we present here the results obtained when dealing with some of the crittcal parameters (Ftg. 17). We have chosen 60-nm diameter beads labeled with fluorescem. These beads were tmmobrlized by endocytosis into livmg cells, followed by paraformaldehyde fixation. The cell nucleus was labeled with ethidmm bromide. This situation mtmrcks that which we encounter m in very small green fluorescent signals (fluorescein situ hybridization: fluorophore) above a red background (ethidmm bromide labeled nuclear chromatin). The system and the process used to visualize, then to resolve, endocytosed fluorescein-labeled beads are similar to those used to visualize and to resolve a weak fluorescent spot on each sister chromatrd following in situ hybridization of single-copy DNA sequenceson human chromosomes (32) (see below). These can be dtvtded into different stages: 1. Fluorescence Image formation with a planapo, x100 ObJective of NA = 1 3, a projective ocular of power x6 and a htgh pressure mercury lamp as the source of fluorescence excrtation (Olympus IMT2 microscope, Optech, Rungis, France). 2 Fluorescein fluorescence selection usmg conventronal excitatron filter and dtchroic beamsplitter plus m the emisston path, a sharp bandpass interferential filter wtth very low transmission outside bandpass (~0.01%). In the case of zn situ hybrrdization on chromosome, the filter used had another bandpass in the red, which allows vrsuahzation of chromosomes counterstammg (proprdium iodide) 3. Two microchannel plates, one being a fiberoptic coupled to a newvicon camera (Lhtsa Blectronique). 4 Digital image processmg using a Sapphire processor (Quantel), and consisting of a. temporal filtering (summation of 250 frames), b. shading correction; c gray level stretching; d. spatial highpass filtering. The centers of the two bead images (Fig. 17C, b; arrows) are 9 pixels apart. In the horizontal direction, one pixel corresponds to 0.092 pm in the adopted configuration (m vertical directton, one pixel corresponds to 0.108 pm; this drfference of pixel dimension between the horizontal and the vertical directrons 1s owing to the procedure of readout of the video camera target /7]) We can deduce that the two beads visualtzed m Fig 17 are 0 8 pm apart inside the cell The intensity profile that crosses the center of one bead (Fig 18), allows the estrmanon of the PSF along one direction (since the dimension of the bead is smaller than the conventional limiting resolutron). Thus beads as close to each other as 0 4 l.trn can still be resolved if they have the same intensity level (Fig. 18). In the example presented here, the resultant MTF calculated from the product of the various standard MTF curves from the microchannel plates and the video camera, is 500 points (i.e., active scan lines) per target diameter (14 line pairs/ mm) at a modulation value of 4%. If the target scan is modified m order to zoom the image (electronic zoom at the level of video camera), the resultant MTF
Digital
Imaging
383
Microscopy raw image
A temporal filtering
stretching and spatial filtering (highpass)
x Fig. 17. Illustration of contrast enhancement achieved by digital imaging processes. Left: images of fluorescein-labeled beads (60-nm diameter) endocytosed in a Vero cell. Images were taken directly from the black and white monitor, at different steps of digital image processing. Right: 2D intensity profiles of the region inside the white box in the middle of the upper image (a) or of the region containing only the two beads that are hidden by the two other large spots (b). (The larger spots could correspond either to bead aggregates or to more intensely labeled individual beads). (A) The green fluorescence was filtered by an interferential filter centered at 520 nm + 3 nm: the red fluorescence arising from the nucleus labeled with ethidium bromide was cutoff. Intensification was xlOs (two microchannel plates coupled to a Newvicon camera). (B) Image after summation of 250 raw images. This takes 10 s and increases the signal-to-noise ratio by a factor of -22. (C) Image after shading correction, gray level stretching, and spatial filtering. The digital spatial filter was applied by using a convolution mask containing 7 x 7 values (see text). The function of this highpass filter is to increase the details and the edges. With the stretching value chosen here to correctly visualize the two weakly labeled beads, the strongest one has intensity values which are out of the display gray levels. Bar in the upper image = 54 pixels = 5 i.trn (horizontally: x).
384
Coppey-Moisan +
et al.
A
Fig. 18 Estimated hmiting resolution of the drgital imagmg system descrrbed in Fig. 17 (A) An mtenslty profile in the horizontal dtrectton that crosses the center of the beads 0 8 urn apart This represents a display (for one bead) of the one-dimensional PSF, as the dimension of the bead is smaller (0.06 urn) than the conventional hmtt of resolution (-0.2 urn) (B) Drawmg of intensity profiles of the two beads separated by 0 4 urn decreases to 7 line pairs/mm (250 points/target diameter, i.e., actrve scan lures) at the same modulation value. The final resolution obtained is shown in Ag. 19 Figure 20C shows the effect of lowpass digital filtering. This kind of spatial filter nicely smoothes the image if applied after sharpening. However, it cannot be used in place of the other processing required to increase the SNR, which consists of temporal filtering followed by gray level stretching (Fig. 20B). With this imaging system, and the same steps in digital processmg, we can correctly visualize the fluorescent signals arising from ur situ hybridization of small single-copy DNA probes. A 6-kb probe (Fig. 21, Fig. 22A) as well as a 2.3-kb probe (Fig. 22B) can be mapped on human chromosomes Visualization of chromosomes in these digitized images arises from the amphficatlon of the contamination of propidmm iodide fluorescence owing to a bandpass in the red (h - 700 nm) of the interferential filter used to select the fluorescem fluorescence (I= 529 nm). The two spots, corresponding to the 6-kb probe hybridizing to each chromatrd, are well mdlvrdualized (-0.6 pm apart). This confirms that the spatial resolution attained, m spite of the weak light level of the signals, IS good enough for the mapping (with -0.4 pm resolutron) of a very small probe on chromosomes.
6. Discussion and Perspectives 5.1. Comparison of the Performances of 20 and 30 Imaging We have seen that if the image contrast can be sufficiently optimized, there is no limit for visualizing tmy objects by optical microscopy. However, practical points remain that limit the resolution we can obtain by this optical technique. The effectiveness of contrast enhancement depends on the properties of the specimen (thickness, topological refractive index variation, absorbance, and so on). In case of in situ hybridization on chromosome spreading, where out-
Digital
Imaging
385
Microscopy Eleclromc
zoom
raw image
temporal
filtering
DIgital zoom
D Fig. 19. Resolutiondrop with decreasingMTF of the video camera.The scanningof the video cameratarget can be modified: only central areaof the target is readoutproviding a twofold magnification,but with half tbe numberof linesper height of the scannedtarget area. The effect of this electroniczoom is to decreasethe MTF of the video camera.(A, B, C) Left: Imagesof the sameobjectsasthosein Fig. 17,but acquiredwith the electroniczoomactivated; right: 2D intensityprofilesof the two weakly labeledbeads(arrows).(D) Left: Imageacquired without electronic zoom, processedas in Fig. 17 and then digitally zoomed(x2); right: 2D intensity profilesof the two weakly labeledbeads(arrows).Magnification andimageprocessing arethe samein C andin D, but the two beads(arrows)arelesswell resolvedin C than in D owing to decrease of MTF of video cameratarget by modifying scanningof the target. Bar in the upper image= 54 pixels = 2.5 urn (horizontally).
Coppey-Moisan
386
et al.
raw Image electromc zoom
image sharpening temporal tiltermg, stretchmg and hrghpass filtermg 44
B 44
Image smoothmg lowpass filtering 44
C Fig. 20 Image sharpenmg and Image smoothmg. 2D intensity profiles of the same beads Images as m Fig 17
of-focus fluorescence light is relatively weak (owing to the thinness of the sample), contrast enhancement can be easrly optimized with very low lrght detector and digital image processing, as described above. For a thick object, such as a big nucleus (ovocyte), the hght coming from above and below the focus plane, which cannot be completely eliminated by spectral selection, will srgnificantly decrease the contrast. In this case,conventronal low light fluorescence microscopy is not of any use. The fluorescent probe detection then requires out-of-focus removal, either by scanning confocal microscopy or by optical serial sectionning microscopy. In scanning confocal microscopy, the light that reaches the detector is spatially filtered by the confocal detector aperture to ltmit the depth of field. Out-of-focus light removal 1sreached at the expense of light collection efficiency. To compensate this very low light efficiency, the highest fluorescence excitation intensity (excitation by laser ray) 1s needed. However, when focusmg a laser beam with -1.5 mW of exciting laser power,
Digital
Imaging
Microscopy
387
Fig. 21 (see color plate number 6 after p. 172). Pseudocolor representation of the fluorescence detection of a single-copy DNA sequence (6 kb). This image was acquired with light amplification and was digitally processed. (Bar = 1 pm).
through high NA objective, fluorescence saturation can occur with the most commonly used fluorophoms that limit the fluorescence photon rate (55). Another photodynamic effect, photobleaching, limits the total amount of photons that serves fluorescence excitation. Therefore, the excitation light level cannot exceed certain values. On the other hand, the fluorophore concentration cannot exceed a certain range. It may therefore be necessary to use a larger detector aperture to increase the amount of light collected. The width of the detector aperture determines the degree of out-of-focus removal and thus the contrast of the image (64). The limitation of scanning confocal microscopy is that, in practice, opening the detector aperture will not be sufficient to allow the detection of very weak fluorescent signal owing to too low a contrast enhancement. An alternative approach could be to couple confocal optics with very low light detector (30). In optical serial sectionning microscopy, a set of 2D images, along the optical axis, is recorded in whole microscopic field illumination mode. Very low light detector can be used here. The out-of-focus information that blurs 2D image of the object in the focus plane, is removed by digital filtering with the knowledge of the 3D point spread function of the imaging system (24). The digital processes have been simplified: Minimal computational treatment allows a substantial improvement of contrast enhancement
388
Coppey-Moisan
et al.
Fig. 22. Fluorescence detection of single-copy DNA biotinylated probes on chromosomes. (A) A 6-kb sequence. Each spot represents hybridization of the probe to a single-copy sequence on each sister chromatid of a human chromosome 18. The weaker spot (arrow) could not be detected without fluorescence intensification and frame integration. (B) A 2%kb sequence. The spot (arrow) represents hybridization of the probe to a single-copy sequence on one chromatid of a human chromosome 22. Images were acquired with the electronic zoom (video camera, x2) and displayed after digital zoom (x2). Bar in A = 1 pm (from ref. 32).
Digital
Imaging
3139
Microscopy
(27). Unfortunately, although high-quality objective lenses minimize image distortion, residual chromatic and spherical aberrations are the main sources of the discrepancies found between theoretical and measured 3D PSF values (65)). Moreover, because of these residual aberrations, the actual 3D PSF depends Ion the object position relative to the optical axis, and on the amount of defocus. These experimental difficulties limit the resolution along the optical axis (66). Another parameter that limits the possibilities of 3D optical techniques is that, not only in optical serial sectionnmg microscopy but also in laser scanning confocal microscopy (54,55), objective lenses aberrations (especially chromatic and curvature of field) affect image intensity and fidelity principally in off-axis positions (55,67). Hence, in 3D imaging, resolution, image restoration, and colocalization are all strongly limited by optical problems. Very careful experimental 3D PSF measurements are required to correct images for these aberrations. 5.2. Lateral Setting Accuracy in 20 Imaging One aim of the in situ hybridization is to colocahze genes with regard to the subnuclear structure, and to determine the relative position of different genes along a chromosome or within the nucleus. These problems are related to image resolution as well as to the precision with which we can determine the position of small objects. It appears that, although the images of two close point sources cannot be resolved because of the diffraction size of the Airy pattern, it is nevertheless possible in some conditions (contrast enhancement of the image) to determine the center of the two diffraction Airy patterns (20,40) with extremely high precision (l-2 nm) (68). This precision can be achieved through the use of digital image processing involving crosscorrelation of the entire object image and of the “kernel” (equivalent to spatial digital filter deriving from the PSF). This precision has been attamed m video-enhanced dlifferential interference contrast (DIC) microscopy (68), but, to our knowledge, not yet in fluorescence microscopy, although there are no theoretical restrictions to this. In the near future, an experimental approach for localizing in situ hybridization signals may mvolve the use of specific probes labeled with gold particles and DIC microscopy, or improving the accuracy in positioning fluorescent objects. Acknowledgments This work was supported by a grant from Electricite De France to MCM. References 1. Lawrence, J B., Carter, K. C , and Gerdes, M J (1992) Extendmg the capabdltles of interphase chromatm mapping Nut. Gene. 2, 171,172 2. Heng, H. H , Squire, J., and Tsui, L.-C. (1992) High-resolutionmappingof mammalian genesby in sctu hybrldtzatlon to free chromatm.Proc. Natl. Acad. Scr USA 89, 9509-9513
Coppey-Moisan
et al.
3 Trask, B., Massa, M , Kenwnck, S., and Dttschier, J. (1991) Mappmg of human chromosome Xq28 by two-color fluorescence m sztu hybridization of DNA sequences to mterphasecell nuclei Am. J. Hum. Genet. 48, l-15. 4 Ltchter, P , Tang, C -J C , Call, K , Hermanson,G., Evans, G A, Housman,D , and Ward, D C. (1990)High-resolutionmappmgof humanchromosome 11by zn situ hybrtdtzatton with cosmtdclones Scrence247,64-69. 5. Lawrence,J B., Singer,R H , andMcNeil, J A. (1992)Interphaseandmetaphase resolution of different distanceswithin the humanDystrophingene Scrence249, 928-932. 6 Nederlof, M , vander Flter, S , Wtegant, J , Raap,A K., Tanke, H J., Ploem,J S , and van der Ploeg, M (1990) Multiple fluorescence zn sztu hybridtzatton Cytometry 11, 126-131. 7 InouB,S (1986) Vzdeo Mzcroscopy, Plenum,New York 8 Dtgutseppi,J , Inman,R T., Ishthara,A , Jacobson,K A., andHerman,B (1985)Apphcattonsof dtgitized fluorescencemtcroscopyto problemm cell biology Biotechniques 3, 394-403. 9. Waggoner,A., De Btasio,R , Conrad,P , Bright, G R., Ernst,L , Ryan, K , Nederlof, M., andTaylor, D. (1989) Multiple spectralparametertmagmg,in Methods zn Cell Bzology, vol 30 (Wang Y.-L. andTaylor, D. L. eds), Academic,New York, pp 449-478. 10 Taylor, D L. andSalmon,E. D. (1989)Basicfluorescencemtcroscopy,m Methods zn Cell Bzology, vol 29 (Wang,Y -L. andTaylor D L., eds.),Academic,New York, pp 207-237 11 Bright, G R andTaylor, D L (1986)Imagingat low light level m flourescencemlcroscopy, in Applzcatzon of Fluorescence zn the Bzomedzcal Sciences (Taylor, D L., Waggoner, A. S., Murphy, R F., Lanm,F , andBilge, R. R., eds.),Ltss,New York, pp. 257-288 12 Ploem,J. S (1987)Laserscanningfluorescencemicroscopy Appl. Opt 26,3226-323 1 13. Jovm, T M., Amdt-Jovm, D J , Marrottt, G , Clegg, R. M , Robert-Ntcoud,M , and Schormann,T (1990)Distance,wavelengthandtime. the versatile3rd dimensionm light emissionmicroscopy,m Optical Microscopy for Bzology (Herman,B andJacobson,K., eds), Wiley-Liss, New York, pp 575-602 14 Tsay, T.-T., Inman,R., Wray, B., Herman,B , andJacobson,K. (1990)Charactertzatton of low-light-level camerasfor digitized video mtcroscopy.J. Mzcroscop 160, 141-159. 15 Wick, R. A. (1987)Quantum-hmttedtmagmgusingmtcrochannelplatetechnology Appl Opt. 26,3210-3218
16 Hayakawa,T., Kmoshita,K , Miyakt, S , FuJiwake,H , andOhsaka,S (1986)Ultra-lowlight level camerafor photoncountmgImaging.Photochem Photobzol. 43,95-97 17 Hlraoka,Y., Sedat, J W , andAgard, D A (1987)The useof a charge-coupled devtcefor quantitativeoptical microscopyof btologicalstructure.Science 238,36-41 18. Atkens, R S., Agard, D A , andSedat,J W (1989) Soled-state tmagersfor microscopy, m Methods zn Cell Biology, vol 29 (Wang, Y -L andTaylor D L , eds), Academtc,New York, pp. 291-313. 19. Castleman,K. R (1987)Spatialandphotometricresoluttonandcalibrationrequirements for cell imageanalysisinstruments.Appl Opt 26,3338-3342 20 Inoub, S.(1989)Imagingof unresolvedobJects,superresolution, andpreclstonof distance measurement with video microscopy,m Methods zn Cell Bzology, vol. 30 (Wang, Y -L andTaylor D L., eds), Academic,New York, pp. 85-112 21 Brakenhoff, G J., Blom, P., andBarends,P (1979)Confocalscanninglight microscopy with hrgh apertureimmersionlenses.J Mzcroscop 117,219-232 22. White, J. G , Amos, W. B , and Fordham,M (1987) An evaluationof confocal versus conventionalimagmgof btological structuresby fluorescencelight microscopy J. Cell. Bzol 105,4148
23 Dudgeon, D. E and Mersereau,R M (1984) Multzdzmentzonal cesszng, Prentice-Hall,EnglewoodCliffs, NJ
Dzgztal Signal
Pro-
Digital
Imaging
Microscopy
24. Agard, D. A (1984) Optical sectioning microscopy: cellular architecture in three drmension. Annu. Rev. Btophys Btoeng. 13, 191-219. 25. Belmont, A A., Braunfeld, M. B , Sedat,J. W., and Agard, D. A (1989) Large-scale chromatinstructuraldomainswithin mttotrc andinterphasechromosomes in vtvo and rn vitro. Chromosoma 98,129-143. 26 Mathog, D., Hochstrasser, M., Gruenbaum,Y., Saumweber,H., and Sedat,J. W. (1984) Characteristrcfolding pattern of polytene chomosomesIII drosophilasalivary gland nuclei. Nature 308,414-421 27 Agard, D. A , Hiraoka,Y , Shaw,P., andSedat,J W (1989)Fluorescence microscopym threedimensions,in Methods m CellBtology, vol 30 (WangY.-L andTaylor, D L eds), Academm,New York, pp. 353-377. 28 Robert-Nrcoud,M , Arndt-Jovin, D. J., Schormann,T., andJovin, T M (1989)3D-rmaging of cellsandtissuesusingconfocallaserscannmgmtcroscopyanddigital processmg Eur. J. Cell. Biol (suppl. 25), 49-54 29 Agard, D A. andSedat,J. W (1984)Three-drmensional archrtectureof a polytenenucleus Nature 302,676-68 1. 30 Wright, S. J., Schatten,H., Simerly, C., and Schatten,G. (1990)Three-drmensronal fluorescenceimagingwith the tandemscanningconfocalmicroscope,in Optrcal Mtcroscopy for Btology (Herman,B. andJacobson, K., eds.),Wiley-Ltss, New York, pp. 29-43 3 1. Rykowski, M. C. (1991) Optical sectionmgand three-dimensional reconstructionof dtploid andpolytenenuclei,in Methods tn Cell Biology, vol 35. Functtonal Organizatton of the Nucleus (Hamkalo, B. A. and Elgm, S C R., eds), Academrc, New York, pp 253-286. 32. V&gas-Pequignot,E , Dutrillaux, B., Magdelenat,H., and Coppey-Motsan,M. (1989) Mapping of smgle-copyDNA sequences on humanchromosomes by in situ hybridtzation with biotinylatedprobes,enhancement of detectionsensitivityby intensified-fluorescence drgttal-imagmgmtcroscopy,Proc Nat1 Acad Scr USA 86,582-586 33. Hiraoka,Y , Rykowski, M. C., Lefstin,J A., Agard, D. A., andSedat,J W (1990)Threedimensionalorganizationof chromosomes studiedby tn sttu hybridization and opttcal sectionmgmicroscopy,Proc. SPIE Int. Sot. Opt. Eng. 1205, 11-19 34. Mathog, D. andSedat,J W. (1989)The three-dimensional organizationof polytenenuclei in maleDrosophtla melanogaster with compoundxy or ring x chromosomes. Genetrcs 121,293-3
11,
3.5.Rykowskt, M. C., Parmelee,S. J., Agard, D. A., andSedat,J W. (1988)Precisedeterminationof the molecularlimits of a polytenechromosome band.Regulatorysequences 1or the notch genearem the mterband.Cell 54,461-472 36. Harders,J., Luckacs,N., Robert-Nrcoud,M., Jovin, T. M., andRiesner,D (1989)Imagmg of vrroids m nucleifrom tomatoleaf tissueby in situ hybridization andconfocallaser scanningmicroscopy.EMBO J. 8, 3941-3949. 37. Brakenhoff,G. J , vanderVoort, H. T M , van Spousen, E A , Lmnemons,W A. M , and Nanninga,N (1985) Threedimensionalchromatmdlstributton m neuroblastoma nuclei shownby confocallaserscanningmrcroscopyNature 317,748-749. 38 Rogers,A. W. (1979) Techntques in Autoradrography, Elsevter,New York. 39. Papoulis,A. (1968)Systems and Transforms with Appltcattons tn Opttcs, MC Graw-Hill, New York. 40 Harris, J. L. (1964)ResolvmgpoweranddecisronJ. Opt. Sot Am 54,931-936. 41 Jovin, T. M. and Arndt-Jovin, D. J. (1989) Luminescencedigital rmagmgmicroscopy (LDIM). Annu. Rev. Btophys. Btophys. Chem. l&271-308. 42. Yanagida,T., Nakase,M., Nishiyama,K., andOosawa,F (1984) Direct observatronof motionof singleF-actmfilamentsm the presenceof myosm.Nature 307, 58-60.
Coppey-Moisan
et al.
43 Toyoshima, Y., Krone, S , McNally, E., Niebling, K., Toyoshima, C , and Spudmh, J. A. (1987) Myosin subfragment-l is sufficient to move actm filaments in vitro Nature 328, 536-539. 44 Schnapp,B J., Vale, R D., Sheetz,M. P , and Reese,T. S (1985) Smglemicrotubules from squidaxoplasmsupportbrdirecttonalmovementof organellesCell 40,455-462. 45 Koonce, M P and Schliwa,M (1986) Reactivationof organellemovementsalong the cytoskeletalframeworkof giant freshwaterameba.J Cell Blol 103, 605-612. 46 Casstmeris, L., InouC,S , andSalmon,E. D (1988)Microtubule dynamicsin the chromosomalspindlefiber analysisby fluorescenceandhigh-resolutron polarrzationmicroscopy Cell. Motrl. Cytoskel. 10, 1-12 47 Allen, R. D , Weiss,D. G , Hayden,J H , Brown, D. T, FuJiwake,H., and Simpson,M (1985)Gliding movementof andbidirectionaltransportalongsinglenative microtubules from squidaxoplasm:evidencefor an active role of mmrotubulesin cytoplasmrctransport. J. Cell. Brol. 100, 1736-1752 48 Lakowmz,J R. (1983)Prmciples of Fluorescence Spectroscopy, Plenum,New York 49 Haugland,R. P. (1990) Fluorescemsubstitutesfor microscopyandimaging,in Optical Mcroscopy for Biology (Herman,B. andJacobson,K , eds.),Wiley-Lrss, New York, pp 143-157. 50 MuJumdar,R. B., Ernst,L. A , Mujumdar,S. R , andWaggoner,A S. (1989)Cyanmedye labelingreagentscontammgtsothrocyanategroups.Cytometry 10, 11-19 51 Marcus, D A (1988) High-performanceoptical filters for fluorescenceanalysis.Cell Motel. Cytoskel 10,62-70. 52 Inoue, S. (1990) Foundationsof confocal scannedimagingm light mrcroscopy,m The Handbook of Biological Confocal Microscopy (Pawley,J , ed), Plenum,NewYork, pp l-44 53. Wilson, T. and Sheppard,C J. R (1984)Theory and Practrce of Scannwg Optical Mlcroscopy, Academic,New York. 54 Brakenhoff,G. J , vander Voort, H T. M., Oud, J. L., andMans,A. (1990)Potentralittes and hmrtationsof confocal mrcroscopyfor the study of 3 dtmenstonalbtologtcal structures,in Optical Mzcroscopyfor Btology (Herman,B. andJacobson,K., eds.),Wiley-Liss, New York, pp. 19-28. 55. Webb,W W., Wells, K. S , Sandison,D R., andStrickler, J. (1990)Criteria for quantrtative dynamical confocal fluorescenceimaging, m Optrcal Microscopy for Biology (Herman,B. andJacobson,K , eds), Wiley-Liss, New York, pp. 73-108 56 P&ran, M , Hadravsky, M., Egger, M. D , and Galambos,R. (1968) Tandem-scanning reflected light microscope.J. Opt. Sot Am 58,661-664 57 Oppenheim,A. V , Willsky, A S.,andYoung, I. T (1983)Systems and Signals, PrentrceHall, EnglewoodCliffs, NJ 58. Goodman,J. W (1968)Introduction to Fourier Optics, McGraw-Hill, New York. 59 Bracewell, R (1965) The Fourier Transform and Its Appltcatrons, McGraw-Hill, New York 60. Young, I. T. (1989)Imagefidelity. characterizingthe imagingtransfertfunction, in Methods in Cell Biology, vol 30 (Wang, Y -L. andTaylor D L , eds), Academic,New York, pp. l-45. 61 Castleman,K. R (1979)Dtgltal Image Processing, Prentice-Hall,EnglewoodCliffs, NJ. 62 Torr, M. R and Devlm, J. (1982) Intensified charge coupled devices for use as a spaceborne spectrographtcimage-plane detectorsystemAppl Opt. 21,3091-3108. 63 Gonzalez,R. C andWintz, P (1977)Digital Image Processing, Addison-Wesley,Readmg, MA 64 Wilson,T (1990)The role of the pmholein confocalimagingsystems,m The Handbook of Biological Confocal Microscopy (Pawley, P., ed ), Plenum,New York, pp. 113-126
Digital
Imaging
Microscopy
65. Gibson, S. F. and Lanm, F. (1990) Measured and analytrcal point spread functtons of the optical microscope for use m 3-D optical serial sectioning microscopy, in Opttcal Microscopy for Biology (Herman,B andJacobson,K., eds), Wiley-Ltss, New York, pp. 109-l 18. 66. Hiraoka, Y., Sedat,J. W , andAgard, D. A. (1990) Determinationof three-drmenstonal imaging properties of a light microscope system: partial confocal behavior in epifluorescencemicroscopyBiophys J. 57,325-333 67. Keller, H. E (1990)Objective lensesfor confocalmicroscopy,in The Handbook of Btological Confocal Microscopy (Pawley, P., ed), Plenum,New York, pp 77-86 68. Gelles,J., Schnapp,B J , and Sheetz,M. P. (1987)Tracking kinesm-drivenmovements with nanometer-scale precision.Nature 331,450-453
CHAPTER 30
Application of In Situ Hybridization for the Detection of Virus Nucleic Acids Eric J. Gowans, Jane Arthur, Keril and Geomey D. Higgins
Blight,
1. Introduction This chapter reviews data from in situ hybridization (ISH) experiments to determine the distribution, frequency, and intracellular localization of virus nucleic acids in tissue samples infected naturally with hepatitis viruses 13, C, and D, and with human papillomaviruses. We have also included data from experiments using herpes simplex virus-infected murine tissue, as this represents a good model for latent infection in humans. 2. Hepatitis Viruses Our laboratory has had a long interest in hepatitis B virus (HBV) and hepatitis D virus (HDV), and a more recent interest in hepatitis C virus (HCV). These viruses cause acute hepatitis, and persistent mfections develop in a proportion of individuals resulting in a spectrum of diseases. These hepatotropic viruses are difficult to culture in vitro and consequently, much of our knowledge (particularly related to HBV and HDV) of vtral replication and pathogenesis was generated from the study of naturally infected liver samples. We have used in situ hybridization extensively in these studies, and in tbis report we will review the results of these studies. 2.1. Hepatitis
B Virus
Prior to the seminal studies of Summers and Mason (I) that suggested a novel replication strategy for hepatitis B-like viruses, our laboratory had reported the detection by ISH of HBV DNA m the cytoplasm of hepatocytes m samples of HBV-infected liver taken at autopsy (2). This was a surprising fmdmg not only because most DNA viruses replicate in the nucleus of the infected cell but also because high levels of the HBV capsid (HBcAg) protein were detected m the nucleus of hepatocytes in liver samples. Since the intracelhtlar site of virus genome replication and capsid expression are usually closely From Edlted
Methods m Molecular Bology, Vol 33 In Situ Hybrrdzatron Protocols by K Ii A Choo Copynght 0 1994 Humana Press Inc , Totowa, NJ
395
396
Gowans
et al.
lmked, our findings were highly unusual. Furthermore, we also determined that the cytoplasm of mfected cells contained viral DNA replicative intermedlates, thus proving that this was the site for HBV DNA synthesis (3). The detection of viral rephcative mtermedlates was (and is) an important issue because the detection of virus genomic DNA or RNA in particular cells or sites per se does not prove replication. A similar HCV-related issue is currently under mvestigation, and this is discussed m Section 2.3. The dichotomy m the intracellular sites of HBcAg and HBV DNA was soon resolved; only a minority of HBV-infected cells contammg detectable HBV DNA contained nuclear HBcAg (3) and with the use of a newly available hyperimmune anti-HBc it was apparent that nuclear HBcAg was present in only a proportion of cells that were positive for cytoplasmic HBcAg (4). Thus, cytoplasmic rather than nuclear HBcAg is a marker for HBV DNA replication m individual cells (5), and this is consistent with studies of other hepadnaviruses (6,7). Quite apart from the above studies, ISH to detect HBV DNA has proved most useful in studies of HBV pathogenesis. There is general acceptance of the original hypothesis (8) that HBV is not cytopathic per se, and that HBV-related liver diseaseis associatedwith the host unmune response. Thus it was surprismg that the results of our studies showed a direct relattonship between HBV replication and hepatocyte injury (9). However, studies by other workers suggested that HBcAg or the closely related hepatitis B e antigen (HBeAg) is expressed on the surface of infected hepatocytes and constitutes a target for cytotoxic T lymphocytes (10). Since HBcAg 1sa marker for HBV replication, then this is a likely explanation. Our studies have also divided hepatitis B surface antigen (or HBsAg)-positive liver samples into two groups, viz., patients who are positive- or negativefor cytoplasmic (rephcative) HBV DNA and HBcAg. This is consistent with the recognition of two general groups of HBsAg carriers (II): those with markers of vuus replication and high levels of viremia, and those with low levels of viremia who lack markers of virus replication (Table 1). 2.2. Hepatitis
Delta
Virus
HDV is a small defective virus which relies on HBV for its replication and expression. HDV has a 1.7 kb circular RNA genome and thus is a unique animal virus. The genome is considered to be negative sense and bears a number of structural resemblances to the viroids, pathogens of plants. As a result of the HBV helper function, there are two major recognized settings for HDV transmission: coinfection with HBV to susceptible individuals, and supermfection of pre-existing HBV carriers. HDV is considered to be highly pathogemc, at least m the acute phase, but can cause persistent infections in a high proportion of mdividuals, particularly
Virus Nucleic Acid Detection
39’7
Table 1 HBV-Specific Markers m Two Groups of HBsAg-Positive Carriers Marker Serum HBsAg HBeAg HBV DNA0 Liver HBsAg HBcAg Cytoplasmic HBV DNA
Group 1
Group 2
+ + or +
+
+ +
+
+
-
9etectable by dot blot hybndmbon, group 2 patlents are poswe by PCR HBsAg Hepatltts B surface antigen HBcAg Hepatitis B core antigen HBeAg Hepatltls B e anttgen
after superinfection. Like HBV, it is very difficult to culture HDV m vitro, and much of our knowledge of vuus replication has been generated from cDNA transfectlon studies and from the study of naturally infected liver biopsy samples. ISH examination of primary hepatocyte cultures infected in vitro and of liver biopsy samples showed that the bulk of HDV RNA was detected in the nucleus of infected cells (12,Z3). Furthermore, antlgenomic RNA was detected in the nucleus indicating that this was the site of replication. This is highly unusual for an RNA virus, and until the discovery of HDV, the Orthomyxovlridae (Influenza viruses) were thought to represent the only RNA viruses with this characteristic. HDV-infected hepatocytes were estimated to contain approx 5 x lo5 genome copies per cell, and the ratio of genomic to antigenomic RNA was shown to be approx 30: 1, In liver biopsy samples, HDV infection was limited to hepatocytes and infected cells were often distributed evenly throughout the parenchyma. In elegant double-labeling studies using the protocol described in Chapter 21, it was noted that HDV RNA and HDAg colocalized in hepatocytes during chronic infection, whereas HDV RNA was a more sensitive marker for virus replication in acute phase samples (I#, 25). The latter study also showed that cytoplasmic eosinophilia was unrelated to HDV replication at the level of mdivldual cells, and it was suggested that cells which display signs of cytotoxlclty were no longer able to support vuus replication. Despite this observation, in vilro studies showed that HDAg can induce a cytopathic effect (16). We have recently extended the above studies to examine formalin-fixed liver samples for HDV RNA with FITC-labeled RNA probes. The aims of these studies were twofold: to investigate a suitable alternative to radiolabeled probes, and to extend the studies of the intracellular localization of HDV RNA,
398
Gowans et al.
Fig. 1. Intranuclear distributions of genomic sense RNA in HDV-infected liver samples detected by FITC-labeled riboprobes. (A) Intensestainingof the majority of infectedheptocyte nuclei. (B) Foci of HDV RNA within hepatocytenuclei. (C) Sparedcentral nuclearregion (arrow).
as the resolution of FITC-labeled probes may be expected to be higher than that of radiolabeled probes. The results were striking: Use of FITC-labeled probes to detect genomic senseHDV RNA showed a similar distribution of HDV RNA-positive cells to that observed previously with i251-labeled probes, but in addition showed intranuclear distribution patterns that were not previously detected (Fig. 1). Very few nuclei showed homogeneous distribution patterns, although generally nucleoli were not stained. In a majority of nuclei, a central region of varying size was negative, suggesting that these nuclei had marginated HDV RNA. These results are not necessarily reflected in Fig. 1, but instead the figure shows a range of different intranuclear distribution patterns. These are exciting preliminary results, and it is likely that FITC-labeled probes coupled with the use of confocal microscopy will generate quite novel data. These, and other experiments to examine the sensitivity of FITC-RNA probe systems, are currently ongoing in our laboratory. 2.3. Hepatitis C Virus HCV is a major cause of posttransfusion and sporadic non-A, non-B hepatitis. The virus is a small enveloped RNA virus with a positive sense genome of approx 9.4 kb that has some similarities with the Pestiviruses (17). The Pestiviruses have recently been reclassified in the Flaviviridae and it has been proposed that HCV should also be classified in this group. HCV causes acute and persistent infections and although the acute infection is often mild, the longterm sequelae of persistent infection includes chronic persistent- and chronic active-hepatitis, liver cirrhosis, and hepatocellular carcinoma. The pathogenetic mechanisms are still unclear at present and markers of virus replication in
Virus Nucleic Acid Detection
Fig. 2. Detection of HCV RNA by 12SI-labeledcDNA probes in peripheral blood lymphocytes isolated from (A) HCV-positive carrier, (B) HCV-negative patient.
individual cells have not been clearly determined. Nevertheless, viremia can be detected by polymerase chain reaction (PCR) and it is clear that the levels of circulating virus are very low. Consequently, one might predict that either the level of HCV RNA in infected hepatocytes or the proportion of infected cells is likely to be correspondingly low. Given the difficulty that a number of workers have had in the detection of HCV RNA by ISH, then these predictions are likely to be correct. Nevertheless, two groups have detected HCV RNA using nonisotopic methods with oligonucleotide probes in formalin-fixed tissue. In one study, virus RNA was detected in a widespread number of hepatocytes in acute-phase chimpanzee samples (28), and in the other, a few randomly distributed hepatocytes were positive in samples from chronic carriers (19). Although the signal was cytoplasmic in both cases, consistent with the replication strategy of Flaviviruses, these results should be confirmed. Studies in our own laboratory reflect the general difficulties encountered by others. Initially, we used random-primed DNA probes in attempts to create probe “networks” (20) over specific target sequences.Using this procedure we were able to detect HCV RNA in peripheral blood lymphocytes from a chronic carrier (Fig. 2), but owing to inconsistencies in the method (21) we have changed to strand-specific RNA probes. These provide a number of advantages (21,22). Using 1251-labeledRNA probes that represent approx 35% of the HCV genome, we were able to detect HCV RNA in small round cells, likely to be lymphocytes or monocytes, in liver samples from two HCV carriers taken at
400
Gowans
et al.
autopsy (23). Only a few positive cells were detected but in keeping with comments made above, it was unclear if HCV replication was actually ongoing in these cells, because we were unable to detect antigenomic HCV RNA. HCV RNA m thesecells may simply representphagocytosis,or since we have estimated the genomic copy number to be approx 50, our assay may be unable to detect antigenomic RNA that is likely to be present at one-tenth that of genomic RNA. Ongoing work in our laboratory has resulted in the availability of riboprobes to the complete HCV genome, and these probes will be used to study fresh frozen biopsy samples, because we believe that this combination is most likely to result in the sensitivity required. 3. Human
Papillomavirus Studies 3.1. Introduction Human papillomaviruses (HPV), double stranded circular DNA viruses of approx 8 kb in size, have been linked causally to the development of anogenital intraepithelial and invasive carcinomas. In vitro studtes have localized cell transformation genes in HPV types associated with genital cancer to the E6 and E7 open reading frames (ORFs). Proteins derived from these ORFs are able to bmd to and inactivate the p53 and Rb tumor suppressor gene products as well as binding to other cellular proteins. The functions of the remaining HPV ORFs have also been examined and possible functions ascribed, e.g., El may regulate DNA replication, E2 may be mvolved in transcriptional regulation, E4 in the production of vtrtons and Ll and L2 encoded capsid protems. Expression of these genes is regulated by the degree of cell differentiation. Numerous studies have examined the prevalence of HPV DNA in genital tissue, but fewer studies have looked for HPV RNA, and only occasional studies have attempted to apply the same techmque to the examination of a wide variety of gemtal lesions from a smgle population, In addition, ltttle clinical follow up data examining the significance of the presence (and type) and absence of HPV RNA has been published. We set out to use 1251-CTPlabeled riboprobes to examine the prevalence, distribution, and significance of HPV RNA in formalin fixed archival tissues of anogemtal biopsies. Using the published sequences HPV genomes of types 6, 11, 16, 18, 31, and 33 were recloned mto riboprobe vectors. In addition, for HPV 16 and 18, subgenomic rtboprobes corresponding to each ORF were constructed. Two separate studtes were performed: Riboprobes correspondmg to the whole genome for HPVs 6, 11, 31, and 33 and to the E6 and E7 regions for HPV 16 and 18 were used to examine the prevalence and significance of the presence of human paptllomavnus RNA in anogemtal lesions; and ORF specific subgenomic HPV 16 and HPV 18 riboprobes were used to examine the expression of differing HPV ORFs within differenttating tissue.
Virus Nucleic Acid Detection Table 2 Prevalence and Type of Human Papillomavirus RNA m Anogenital Lessons Diagnosis Cervical CIN 3 CIGN see AIASC see + ACIASC Anal AIN 3 SCC + Basaloid Carcmomas AC Vulva1 see Penile PIN 3 see
No. of cases
6/11
Positwe for HPV type 16 18 31/33
Total, percent Positive Negative
50 42 171 41 212
-
70.0 31.0 62.6 24.4 55 2
4.0 66.7 11.1 439 17.5
180 88 24 75
92.0 95 2 82.5 70.7 80 2
8.0 4.8 17.5 29.3 19 8
6 41
16.7 -
50 0 68 3
16.7 2.4
2.4
83 3 73 2
167 26 8
17
-
-
-
-
62
-
274
-
3.2
30 6
69 4
10 31
-
80.0 29.0
-
20.0 -
1000 29 0
71 0
-
1000
Abbrevtatlons. CIN 3, cervical mtraepithelial neoplasta grade 3 (severe dysplasia), CIGN, cervxal mtraeplthehal glandularneoplasla (all grades), SCC, squamous cell carcmoma, AC, adenocarmoma, AX, adenosquamous carcmoma, AIN 3, anal mtraeplthehal neoplasta grade 3, PIN 3, penile mtraepttheltal dysplasta grade 3
3.2. Epidemiological
Studies
The prevalence of HPV RNA was examined in approx 500 biopsies of anal, penile, vulval, and cervical carcinomas and preinvasive anal, penile, and cervical lesions. These results (summarized m Table 2) suggested the presence of two distinct subsets of genital cancer separable on the basis of the presence or absence of HPV RNA. HPV RNA was detectable in 80.2% of cervical (24,25) and 73.7% of anal carcinomas (26) but in only 29.0% of penile (27) and 30.6% of vulva1 carcinomas (‘28). In all four sites, patients with HPV RNA-positive carcinomas were consistently diagnosed at an earlier age than patients with HPV RNA negative carcinomas, although this reached statistical significance only for anal (7.5 yr difference; p = 0.04, t-test) and cervical carcinomas (11.9 yr difference; 1’ < 0.001). Similarly, HPV RNA positive cervical intraepithehal neoplasia (CIN) grade three (28) and cervical intraepithelial glandular neoplasla (CIGN) (29) also occurred in a significantly younger population than the respective HPV RNA negative CIN and CIGN lesions. Survival data from a 5-yr followup period for the 212 patients with cervical cancer was analyzed by multivariate analysis using the Cox proportional haz-
402
Gowans
et al.
ards model. Patients with HPV RNA positive cervical carcmomas had a significantly smaller risk (RR = 0.34) of dying from their disease than did patients with HPV RNA negative cervical carcinomas. This effect was unrelated to HPV type, HPV age, or stage or grade of disease. The differing genetrc mechanisms underlymg these two groups may relate m part to the high prevalence of p53 and Rb mutations other authors have found in HPV DNA negative gemtal tumors. HPV E6 and E7 gene products are known to interact with the p53 and Rb proteins, and may therefore produce a cellular phenotype equivalent to inactivatron of these alleles. These steps appear important in the resultmg cell transformation and the subsequent development of malignancy but are almost certainly not the only cellular mutations required. However, HPV infection and expression may substitute for some of the cellular mutations required before development of the malignant phenotype and lead to the development of histologically similar lesions at an earlier age. 3.3. Use of Subgenomic Probes for Mapping of HPV Transcripts in Differentiating Epithelia Subgenomic probes corresponding to each open reading frame in HPV 16 and 3 sets of open reading frames rn HPV 18 were used m a detailed ISH analysis of the RNA transcript patterns in HPV 16 (30) or 18 (28) posrtrve cervical lesions and in cervical carcinoma-derived cell lines. The significant findmgs of these studies included: 1 The uniform presenceof E6/E7 transcriptsin the basal layers of HPV 16 or 18 positive lesionsconsistentwith the key role E6 and E7 proteins play in the mamtenance of cell transformation. In some well differentiated squamous epithelial lesions, HPV transcription was limrted to the basallayer, suggestingthe presence of some differentiation related cell regulation of HPV early gene transcription.
2. Differential transcriptionof the E6 andE7 ORFsin HPV 16lesionsin which late gene expression occurred. Previous reports had suggested E6 and E7 transcription was upregulated m terminally differentiated epithelial m which viral replication was taking place. However, we demonstrated that only E7 RNA was upregulated and this from the 3’ end of the E7 ORF. This signal was seen only m lesions m which late gene RNA expression was detectable m superficial cells and the distribution of the 3’ E7 signal corresponded exactly to that seen when an E4 ORF probe was used. This findmg was thought to represent detection of the 5’ end of a transcript encoding and E4 protem similar to transcripts described in HPV 6 and HPV 11 condylomata but not being derived from conventional promoters. Neither differentially increased E7 expression (relative to E6 expression) nor cytoplasmic late gene expression and capsid antigen production were seen in invasive carcinomas 3. Nuclear antisense HPV RNA transcripts in HPV 16 positive carcinomas and glandular dysplasias These were expressed at high level m discrete areas m a minority of carcinomas (2/8 SCCs) examined, were susceptible to RNase pretreatment, and were confirmed independently by RNAse protection assays The sigmficance of this transcription pattern is not clear
Virus Nucleic Acid Detection
403
RL Putative
3.3kb LA,’
-----------------*) 2 Okb LAT
,
Fig. 3. Partof thelongrepeatregion(R3 of the HSV type 1genome(top) showingthe relative positionsof the LAT promoter(solidbox), the majorLAT locus(stippledbox) andrestriction enzyme sites(vertical arrows)usedto constructthe four templates(bottom) from which riboprobesweregenerated(P, S, H, X, andB representPslI, SphI, HpuI, XhoI, andBumHI, respectively). Major LAT (solid lines) andminor LAT (broken line) RNAs are positionedbeneath the appropriateregionsof the LAT transcription unit. A truncated probe, pSLAT4lE. was generatedfrom pSLAT4 templateslinearizedprior to transcriptionwith EcoS2I(E).
4. Nuclear HPV 18 Ll transcripts associatedmore commonly in HPV 18 positive glandular than squamous carcinomas, but were not translated to detectable late gene capsid proteins. Similarly, nuclear Ll gene transcripts were detectable in HeLa cells (derived from an HPV 18 positive cervical adenocarcinoma), but not in C4-1 cells derived from an HPV 18 positive squamous cell carcinoma. The significance of this finding is also unclear.
4. Detection
of IISV RNA in Latently
Infected
Neurons
4.1. Introduction Herpes simplex virus (HSV) commonly causes lesions of the skin and mucous membranes and is typified by intermittent recurrence of disease long after the primary infection is cleared. Recurrences result from reactivation of latent virus harbored in neurons of the sensory ganglia that innervate the site of primary infection. Between recurrences no infectious viral particles or viral pro-
teins can be detected in latently infected ganglia. Further, viral transcription during latency is limited to a -10 kb region within the genomic repeats giving rise to a set of colinear RNAs termed the latency associated transcripts (LATs) (see ref. 31 for review). Latency associated transcription is directed by a single neuron-specific promoter (32) and generates two abundant poly A- transcripts (major LATs) of -1.5 and 2 kb (Fig. 3). ISH analysis of latently infected ganglia has shown that the major LATs localize to neuronal nuclei (33) and furthermore, that the sequences flanking the major LAT locus also give rise to nuclear RNA. These flanking RNAs, termed minor LATs, are not of sufficient abundance in latent ganglia to be characterized by Northern blot (34). It has been proposed that the major LATs may be stable introns derived from a larger, less stable primary transcript (35,36). However, the putative fully processed spliced product has not been identified in latently infected tissues.
404
Gowans
et al.
The function of LATs is not known. Viral deletion mutants that cannot synthesize LATs retain the ability to establish and maintain latency but recovery of these mutant viruses from latent ganglia by m vitro reactivation is poor, suggesting LATs may play a role in reactivation (37). The nuclear localization of LATs was of interest to us. Recent studies on the distribution of nuclear factors associatedwith DNA replication, RNA transcription, and splicing indicate that such processes are localized to compartments within nuclei (for review, see ref. 38). In addition, analysis of the subnuclear distribution of various small nuclear RNAs mvolved m sphcing and poly A+ RNA indicate that these also localize to foci, which may be sites of transcription and/or RNA processing (39,40). Followmg such precedents we have used high resolution, nomsotopic ISH to examme the intranuclear distribution of the LATs. of HSV RNA in Dorsal Root Ganglia ISH analysts of experimentally infected murine dorsal root ganglia (see Chapter 21) using digoxigenm (DIG) labeled RNA probes complementary to the major LATs (pSLAT4/E, pSLAT 7; Figs. 3 and 4, A and B) detected RNA distributed diffusely throughout neuronal nucleoplasms, often with prominent sparing of nucleolar regions (Fig. 4b). In contrast to this diffuse pattern, probes complementary to minor LAT sequencesbetween the LAT promoter and the 5’ end of the major LATs (pSLAT6; Fig. 3) detected foci of nuclear RNA that were approx l-3 l.trn m diameter (Fig. 4C). Similarly, foci were detected with RNA probes complementary to minor LAT sequencesdownstream of the major LAT region (pSLAT5; Figs. 3 and 4D). These foci were mdistmguishable with respect to size, distribution, and number of foci per positive neuronal profile, suggesting that these minor LAT sequences were present m the same subnuclear foci (42). To determine if the diffuse pattern observed with the major LAT probe masked similar foci, we decreased the intensity of the reaction product by reducing the probe concentration and, although the resultmg pattern was punctate and often patchy, the distinct foci obtained with minor LAT probes were not observed Thus, if major LATs are present m these foci, the concentration must be stmrlar to that in the surrounding nucleoplasm. Furthermore, when a mixture of major and minor LAT probes (pSLAT7 and pSLAT5) was applied, positive foci were readily discernable on a diffuse nucleoplasmic pattern consistent with the superimposition of two patterns of hybridization (Fig. 4E). This is the first demonstration that the major and mmor LATs are coexpressed m latently infected neurons (41). No evidence of hybridization was observed when probes were applied to uninfected tissues nor, when RNA probes of the same senseas the LATs were applied to latently infected tissues (Fig. 4F). 4.2. Distribution
Virus Nucleic Acid Detection
L
Fig. 4. The detection of LATs by ISH in dorsal root ganglia from Balb/c mice latently infected with HSV type 1. (A) Ganglionic section (x160) probed with RNA complementary to major LAT sequences (pSLAT7) showing intense staining of neuronal nuclei (arrow). (B) A LAT’ neuronal profile (x800) detected with major LAT probe pSLAT4/E showing diffuse nuclear staining and lack of hybridization to a nucleolar region (arrow), a hybridization pattern commonly observed with major LAT probes. (C) A LAY neuronal profile (x800) detected with a minor LAT probe complementary to sequences between the LAT promoter and the 5’ end of the major LATs (pSLAT6), showing the focal pattern of hybridization (arrow) typical of minor LAT probes. (D) A LAT+ neuronal profile (x800) detected with a minor LAT probe complementary to sequences showing foci of hybridization 3’ of the major LAT region (pSLAT5). (E) A LAT+ neuronal profile (x800) detected with a mixture of a major LAT and a minor LAT probe (pSLAT7 and pSLAT5). Foci of hybridization (arrow) are detected on a background of diffuse nucleoplasmic staining. (F) Ganglionic section from an uninfected Balb/c mouse (x160) probed with minor LAT specific probe pSLAT6 showing lack of hybridization.
406
Gowans
et al.
Acknowledgments Much of this work was supported by grants from the National Health and Medical Research Council of Australia. Jane Arthur and Keril Blight are Dawes Scholars supported by the Royal Adelaide Hospital. We thank Charli Bayley for typing and organization of the manuscript, and the staff of the IMVS Photographic Service. References 1. Summers, J. and Mason, W S. (1982) Replication of the genome of a hepatrtrs B-like virus by reverse transcrrptron of an RNA intermediate Cell 29,403-415 2 Gowans, E. J., Burrell, C J., Jilbert, A. R , and Marmron, B P. (1981) Detection of hepatitis B virus DNA sequences m infected hepatocytes by rn sztu hybridrzatron.J Med. Vzrol 8,67-78 3 Gowans,E. J., Burrell, C J , Jrlbert,A. R , andMarmion, B P (1983)Patternsof smgle-
and double-stranded hepatitisB vnus DNA and vrral antigenaccumulationtn infected liver cells.J. Gen. Vzrol. 64, 1229-1239 4. Gowans,E J. andBurrell, C J (1985)Widespreadpresenceof cytoplasmlcHBcAg m hepatitisB Infectedhver detectedby improvedtmmunochemical methodsJ. Clzn.Pathol 38,393-398.
5. Gowans,E J., Burrell, C. J , Jrlbert, A R., andMarmton, B. P (1985)Cytoplasmic(but not nuclear)hepattttsB virus (HBV) coreantigenreflectsHBV DNA synthesisat the level of the Infected hepatocytelntervzrology 24,220-225 6 Jrlbert, A R., Freeman,J S., Gowans,E J , Holmes,M., Cossart,Y E , andBurrell, C. J (1987) Duck hepatitisB virus DNA in liver, spleenandpancreasanalysisby znsitu and Southernblot-hybridtzatron, Vzrology 158,330-338. 7. Korba, B. E , Gowans,E. J , Wells, F. V , Tennant,B. C , Clarke, R , and Germ, J L (1988)Systemicdrstrtbuttonof woodchuckhepatitrsVINS in the trssuesof experimentally infected woodchucksVirology 165,172-l 81 8. Dudley, F J., Fox, R. A., andSherlock,S (1972)Cellulartmmumtyandhepatrtisassocrated, Australiaantigenhver drseaseLancet i, 723-736. 9 Burrell, C. J , Gowans,E J, Rowland,R., Hall, P , Jilbert, A R., and Marmion, B P. (1984)Correlatronbetweenliver htstology andmarkersof hepatitisB virus replicationin infected patrentsa study by zn sztu hybridtzatton Hepatology 4, 20-24 10 Mondelh,M V., Bottdoth,F , Pontrsso, P.,Rondanelli, E. G., Wrlhams,R , Rialdi,G., Albertr, A , andBddleston, A L. W F (1987)Definitronof hepatitisB vuus(HBV)-specrfictargetantrgensrecognizedby cytotoxtcT cellsin acuteHBV mfechonClzn Exp Immunol 68,242-250 11. Hoofnagle,J. H , Shafrrtz, D. A , andPopper,H. (1987)Chrometype B hepatrtrsandthe “healthy” HBsAg carrier state Hepatology 7,758-763 12. Taylor, J , Mason, W , Summers,J , Goldberg,J , Aldrich, C , Coates,L , Germ, J L , Gowans,E. J (1987)Replicatronof humanhepatrtisdelta virus m prrmary culturesof woodchuckhepatocytesJ. Vzrol 61,2891-2895. 13. Gowans,E J., Baroudy, B. M , Negro,F , Ponzetto,A, Purcell, R H , andGerm, J L (1988)Evidencefor replicattonof hepatmsdeltavirus RNA m hepatocytenucleiafter m vtvo mfectton. Vzrology167,274-278 14. Gowans,E. J., Negro,F , Baroudy,B M., Korba, B E , Bonino,F., Ponzetto,A., Purcell, R H., and Germ, J. L (1987)Molecular markersof WHV and HDV m smglecells, in Hepadnavrruses. UCLA Symposza on Mol Cell. Bzol. New Serzes 70,591-600 15 Negro, F., Bonmo, F., Di Brsceghe,A , Hoofnagle,J. H , andGerm, J L. (1989) Intrahepatrc markersof hepatrtrsdelta vrrus infection a study by zn situ hybridtzation Hepatology
10,916-920
Virus
Nucleic
Acid Detection
16 Cole, S M , Gowans, E J , Macnaughton, T. B., Hall, P. De La M , and Burrell, C 3 (1991) Direct evidence for cytotoxictty associated with expresston of hepatrtls delta virus antigen. Hepatology 13,845-851. 17 Houghton,M , Weiner,A , Han,J., Kuo, G., andChoo,Q -L (1991)Molecular biology of the hepatitisC viruses:lmplicattonsfor diagnosis,developmentandcontrol of vrral disease.Hepatology 14,381-388. 18 Negro, F., Pacchtoni,D , Shrmuzu,Y., Miller, R. H , Bussolatt,G , Purcell, R H , and Bonmo, F. (1992) Detectronof intrahepattcreplication of hepatitisC vu-usRNA by In situ hybridization andcompartsonwith htstopathology.Proc Nat1 Acad Scl USA 89, 2247-2251, 19 Yamada,S , KOJI, T , Nazawa,M , Kryosawa,K , andNakane,P K. (1992)Detectionof hepatitisC vnus(HCV) RNA mparaffin-embedded hssuesectionsof humanliver of non-A, non-B hepatitispatientsby in srtu hybridization. J Clzn Lab. Anal 6,4046 20 Gerhardt,D S , Kawasaki,E. S , Bancroft, F. C., andSzabo,P (1981)Locahzattonof a uniquegeneby direct hybrtdtzatton m situ. Proc. Natl. Acad Ser. USA 78,3755-3759 21 Gowans,E J., Jilbert, A. R., andBurrell, C. J. (1989)Detectionof specificDNA andRNA sequences in tissuesandcellsby in situ hybrtdtzation,m Nucleic Acid Probes (Symons,R H., ed ), CRC, BocaRaton,FL, pp 129-158 22. Cox, K , De Leon, D. V , Angerer, L M., andAngerer, R C. (1984)Detectionof mRNAs m seaurchin embryosby in srtu hybridization usingasymmetricRNA probesDev &of 101,485-502. 23. Blight, K., Trowbrtdge,R., Rowland,R., andGowans,E. J. (1992)Detectionof hepatitis C vtrus RNA by rn situ hybrtdization.Lwer 12,238-241. 24 Higgms,G D , Davy, M , Roder,D , Phillips, G E , Uzehn, D. M , and Burrell, C J (1991)Increasedageandmortality associated with cervicalcarcinomas negativefor human papillomavirusRNA. Luncet 338,910-913 25. Higgins,G D., Uzehn,D. M , Phtlhps,G , andBurrell, C J (1991)Presenceanddtstrtbutton of humanpaptllomavtrussenseandantrsense RNA transcriptsm gemtalcancersJ Gen. Vwol 72,885-895
26. Higgins,G. D., Uzelm, D M , Phillips, G E , Pteterse,A S., and Burrell, C J (1991) Differing characteristicsof humanpapillomavnusRNA-positive andRNA negattveanal carcinomas.Cancer 68,561-567. 27. Higgins,G. D , Uzehn,D M., Philhps,G E , Villa, L L , andBurrell, C. J (1992)Drffermg prevalencesof humanpapillomavirusRNA in peniledysplastasandcarcmomasmay reflect diffenng aetrologtesAm J Clan. Path 97,222-228 28. Higgins,G D. (1991)Human Papillomavirus Transcripts tn Genital Neoplasla PhDThesis,University of Adelaide,SouthAustralia. 29 Higgins,G D., Phillips,G E , Smith,L A , Uzelin, D M , andBurrell, C J (1992)Hugh prevalenceof humanpaptllomavirustranscriptsm all gradesof cervical mtraepithehal glandularneoplasiaCancer 70, 136-146. 30. Higgins, G D., Uzelm, D M , Phillips, G , McEvoy, P , Marin, R , and Burrell, C J (1992) Transcriptionpatternsof humanpapillomavuustype 16 m genital mtraeptthelial neoplasia,evidencefor useof apromoterwithin the E7 ORFduringeptthellaldifferenttatton. J. Gen Vwol. 73,2047-2057 31 Ho, D. Y. (1992)Herpesviruslatency*molecularaspects,m Progress m Medical Vwology, vol. 39 (Melnick, J. L , ed.), Karger,Basel,pp 76-116. 32 Batchelor,A andO’Hare, P (1990)Regulahonandcell-type specificacttvrty of a promoterlocatedupstreamof the latency-associated transcriptof herpessimplexvirus type 1, J. Virol. 64,3269-3279
33. Stevens,J. G , Wagner,E. K , Devi-Rao,G. B., Cook, M. L., and Feldman,L T (1987) RNA complementaryto a herpesvirus genemRNA is prominentm latently mfectedneurons.Science 235, 1056-1059.
408
Gowans
et al.
34 Mitchell, W. J., Lmette, R. P , and Fraser, N W. (1990) Mapping of low abundance latency-associated RNA m the trigemmal ganglia of mice latently infected with herpes simplex VUIB type 1. J. Gen Vml 71, 125-132 35. Devi-Rao,G., Goodart,S.A, Hecht,L M , Rochford,R., Rice,M. K., andWagner,E. K (1991)Relationshipbetweenpolyadenylatedandnonpolyadenylated herpessimplexvirus type 1 latency-associated transcripts.J Vwoi 65,2179-2190 36 Farrell,M J., Dobson, A. T , andFeldman, L T (1991)Herpessimplex~uuslatency-associated transcriptis a stableintron Proc. Natl. Acad. Sci USA 88,790-794 37 Leib, D A , Bogard,C L , Kosz-Vnenchak,M , Hicks, K A, Coen,D M , Knipe, D M , andSchaffer,P. A (1989)A deletionmutantof thelatency-associated transcriptof herpes simplexvirus type 1 reactivatesfrom the latentstatewith reducedfrequency.J Vzrol. 63, 2893-2900
38 Carter, K. L and Lawrence,J. B (1991)DNA andRNA wlthm the nucleus.how much sequence-specific spatialorganization J Cell Blochem 47, 124-129 39 Carmo-Fonseca, M , Pepperkok,R., Sproat, B. S , Ansorge, W , Swanson,M S , and Lamond,A I (1991)In vivo detectionof snRNP-richorganellesm the nucleiof mammahan cells.EM30 J. 10, 1863-1873. 40 Carter, K C., TaneJa,K. L , and Lawrence,J B (1991) Discretenucleardomainsof poly(A) RNA andtheir relationshipto the functionalorgamzatlonof the nucleusJ Cell Biol. 115,1191-1202 41 Arthur, J., Efstathlou,S , andSimmons,A. (1993)Intranuclearfoci contammglow abundanceherpessimplexvirus latencyassociated transcriptsvisualizedby nonisotopicIn situ hybndlzation. J. Gen. Vwol 74, 1363-1370
CHAPTI~R31
Positional Cloning and Multicolor In Situ Hybridization Principles
Roger
and Protocols
I? Lebo and Ying Su
1. Introduction The first part of this chapter (Sections 1,1.-l .6.) describes the complete positional cloning process with an emphasis on how multicolor in situ hybridization expedites these studres. Multrcolor in situ hybridization 1svery useful in positional cloning because it maps cloned DNA quickly and is the easiest means to solve posrtional cloning problems. Applications and insights suggested in this chapter are based on published and ongoing posrtional cloning projects. In the second part of this chapter (Sections 2. and 3.), we describe a multicolor in situ hybridization protocol that we have successfully used to detect very short cloned DNA fragments in interphase nuclei as well as on banded chromosomes. Furthermore, multicolor in situ hybridization to DAPI-banded metaphase chromosomes with fluorescein- and Texas red-labeled cloned DNAs allows the mapping and ordering of loci on umque chromosome bands, and the determination of locus copy number in interphase nuclei. 1.1. Overview
1.1.1. Positional Cloning Defined Positional cloning first maps a disease phenotype to a subchromosomal region and then isolates the gene and studies its function (disease + map + gene + function). In contrast, functional cloning identifies the abnormally functioning protein and isolates the transcribed gene sequence prior to mapping (disease -+ function -+ gene + map). Thus positional cloning, previously called reverse genetics, was named because this reverse process maps the disease gene phenotype prior to identifymg the abnormal gene and discovering its function. When an abnormal gene product cannot be isolated, positional cloning may be the only means to identify the disease gene. Positional cloning is a complex, labor intensive series of complementary studies that has successfully identified at least 16 disease gene loci, including From Edlted
Methods m Molecular Btology, Vol 33 In S11u Hybndrzaflon Profocols by K H A Choo Copynght Q 1994 Homana Press Inc , Totowa. NJ
409
Lebo and 5%
410
cystic fibrosis transmembrane factor (I-5). The complete process includes mapping the segregating disease phenotype to a linked polymorphic locus, saturating the region with additional polymorphic loci to sublocalize the gene to about 1 Mb, isolating the entire disease gene region m overlapping YAC or cosmid clones, identifying gene(s) m these clones expressed in affected patient tissue, and demonstrating concordant segregation of abnormal gene sequences with abnormal phenotypes. On occasion this lengthy process has been shortened dramatically by identifying the disease-causmg gene m the same chromosome region as a linked polymorphism (3,4), or by identifying disease-related gene deletions or rearrangements that further sublocalize the abnormal gene region prior to candidate gene isolation and sequencing ($6). 1.1.2. Linkage,
Cytogenetic,
PFGE,
and Contig
Maps
Positional clomng progress is optimally defined by four interrelated maps: 1. Linkage, 2. Cytogenetic; 3 Pulsedfield gel electrophoresis(PFGE); and 4. Overlapping yeastartificial chromosome(YAC) or cosmid maps. The reliability of each is increased by comparison to the others. Linkage analysis first locates the disease gene region. In situ hybridization cytogenetitally maps flanking clones to a unique chromosome band and identifies and orders additional clones in the disease gene region. Pulsed field gel fragment lengths define the maximum distance spanned by flankmg gene markers and serve as a framework to fill in the subsequently isolated YAC or cosmid contig. Because mapping is central to positional cloning and any cloned DNA fragment can be rearranged, cross verification by complementary maps is very useful. 1.1.3. In Situ Hybridization Investigators working in our laboratory have demonstrated the broad appltcability of in situ hybridization to several ongoing positional cloning studies over the last 5 yr. This chapter describes the successful synthesis of this technique with other available methods and includes protocols that any laboratory can use to map multicolored cloned gene targets from 300 bp to 40 kb (7-12). For instance, in situ hybridization mapped the 1.5kb keratin 5 gene, a candidate gene for epidermolysis bullosa, within 250 kb on the same metaphase chromosome band as a 2.0 kb polymorphic locus lurked to epidermolysis bullosa (Fig. 1; ref. 3) prior to finding abnormal keratm 5 gene sequences in epidermolysis bullosa patients (4). Furthermore, in situ hybridization is the most straightforward means to map and order cloned DNAs withm a unique chromosome band. Multicolor in situ hybridization ordered two fragments withm 1 Mb on the same chromosome band m the CMTlB gene region (7,8).
Positional
Cloning
Fig. 1 (see color plate number 7 after p. 172). Close linkage of D12S14 locus to epidermolysis bullosa gene on chromosome 12. (A) DAPI-stained metaphase and interphase nuclei delineate the location of total cellular DNA. (B) Texas red-labeled KRTS clone hybridizes specifically to the proximal long arm of chromosome 12 on metaphase chromosomes. (C) DAPI-stained interphase chromosomal DNA delineates the nuclear domain. (D) Texas red labeled KRTS is found in two unique locations in the nucleus. (E) Fluorescein-stained 3.1-kb D12S14 locus is located in the same nuclear region. (F) Texas red-labeled KRTS and fluorescein-labeled D12S14 are resolved in adjacent but unique interphase domains by a dual-color filter set that simultaneously excites and passes both colors. Routine photo-micrography of a 3.1-kb D12S14 probe labeled in fluorescein and a cosmid isolated using keratin 5 cDNA labeled in Texas red. Previously a Texas red-labeled 2.1-kb keratin 5 cDNA (spanning 632143 bp of the cDNA) gave excellent Texas red signal that was too dim to be photographed with standard optics along with the 3.1-kb fluorescein-labeled signal. Then a cosmid was hybridized to record a publishable photo with standard optics without computer image enhancement. Reprinted with permission from Bonifas et al. (3).
Subsequently, in siru hybridization ordered five 0.3-40.0 kb clones spanning the CMTlA gene region on a single chromosome band (9) within 1150 kb (13,14). Chromosomal loci within 250 kb have been ordered readily by scoring fluorescent signal order in interphase nuclei and more distant sequences have been ordered by scoring more interphase nuclei (15,26). Mapping cloned fragments by in situ hybridization to chromosomes from multiple normal individuals is preferable to testing abnormal derivative chromosomes or chromosome fragments in radiation hybrids where undetected rearrangements can occur. Furthermore, in situ hybridization simultaneously resolves and maps multiple homologous genes and pseudogenes as well as low copy homologous sequen-
412
Lebo and Su
ces (8). This expedites fme mapping and linkage studies by characterrzmg the number of locations from which homologous clones may be isolated. In situ hybridization also characterizes rearranged cloned DNA (9). Any clone can be chimeric or undergo rearrangement during propagation, a srgnificant fraction of YAC library clones (17) harbor rearrangements. In situ hybridization of labeled cloned DNA to normal metaphase chromosome complements is the most direct means to detect and characterize clone rearrangements. In situ hybridization can also expedite positional cloning by characterizmg variable size subchromosomal rearrangements like the CMTlA duplications that result in the disease phenotype (II). Fluorescence in situ hybridizatron also detects visible numerical and structural chromosome rearrangements (18-20) including the most clinically important aneuploidies (10,21). In situ hybridization detected normal and abnormal gene copy number at the human myophosphorylase, erythrocyte ankyrin, and steroid sulfatase gene loci m interphase nuclei (12,22,23). Existence of a 1.5-Mb CMTlA duplication was confirmed by in situ hybridization to three unique CMTlA gene regions (24). Our laboratory used in situ hybridization with probes spanning the CMTlA region (9) to demonstrate three different size duplications with variable terminal breakpoints (II). These studies further sublocahzed the CMTlA gene and identified a probe m the most commonly duplicated subchromosomal region that can be used to rapidly diagnose a larger fraction of subjects prenatally, with amniocytes or chorionic villus cells (11; see Section 3.) or presymptomatically. In situ hybridization to disease-related chromosome rearrangements accurately reflects unique locus order, whereas abnormal fragments resolved by pulsed field gel electrophoresis do not distinguish tandem and inverted duplications without complicated restriction maps (13,14). 1.2. Locate
Gene
by Linkage
1.2.1. Collect Patient Pedigrees Positional cloning begins by identifymg families with a large number of mdividuals afflicted by the same genetic disease. After obtainmg Human Experimentation Committee approval, families are contacted and blood samples obtained confidentially from all informative members with informed consent. The collected pedigrees should include about 40 informative meioses so that partially informative polymorphisms (PIC = 0.3) characterize enough informative meioses to identify linkage. Collectmg sufficient pedigrees with an autosomal dominant genetic disease 1seasrer because these pedigrees generally have affected individuals m multiple generations. Furthermore, autosomal dominant pedigrees have more mformative meioses than autosomal recessive pedigrees of the same size because both normal and affected offspring are fully informative when cosegregating RFLPs are informative. For instance, a three-generation autosomal dominant
Positional
Cloning
413
pedigree with five affected individuals would be expected to have four mformative meioses and 10 such pedigrees would have 40 informative meloses. Alternatively, one or two very large autosomal dominant pedigrees may be sufficient (2.5). A genealogy search may convert a small autosomal dominant genetic disease family mto an extended family with many additional affected individuals. Genealogy searches collect data through distant living relatives and from birth, marriage, and death dates and locations recorded in the Family Library, Salt Lake City, UT, United States National Archives, United States Social Security Administration, foreign and domestic national census repositories, courthouses, churches, and cemeteries. In contrast, 20 pedigrees with 2 siblings affected by the same autosomal recessive genetic disease (40 informative meioses) would be a reasonable number of pedigrees to map a disease phenotype linked to a single chromosome locus. However, numerous pedigrees with only one affected child would probably not be screened for linkage because heterozygous normal children are at best only partially informative. One exception to this requirement is the study of very rare genetic diseases that result in a large percentage of cases from homozygosity of the same mutant allele in children of parents who are related genetically. Population geneticists estimate as few as 6 unrelated autosomal recessive genetic disease patients with related parents would be sufficient to find a diseasegene locus by studying polymorphisms at linkage disequilibrium. In these inbred pedigrees, recombinatron has occurred between flanking polymorphic markers and the propositus’ homozygous mutant alleles in many meioses since the mutation occurred. Thus only the immediately flanking polymorphic loci on both sides of the same mutant gene have not recombined since it arose and was passed through both related parents to the homozygous affected child (26). 1.2.2. Polymorphic
Linkage
Analysis
to 5 Centimorgans
In addition to collecting samples from multiple patient pedigrees, all available probes with reasonably informative polymorphisms are selected to span as much of the human chromosome complement as possible at 5-10 CM (CM) intervals. Polymorphisms ideal for linkage analysis have many commonly occurring alleles so that 90% of matings are informative (polymorphic information content [PIC] = 0.9; ref. 27). For instance, restriction enzyme analysis identifies multiple RFLPs at the mucin locus on chromosome lq21 and the St-14 locus on Xq28. Alternatively, highly informative sequence tagged repeats (STRs) with multiple repeats of 2 or more oligonucleotldes can be characterized easily by PCR and sequencing gels. A useful STR can be found m most cosmid clones (average insert size = 40 kb) studied with a full battery of common nucleotide repeats. In contrast, most RFLPs are informative in about 30% of matings (PIC = 0.3). Probes with lower PICs require more informative
414
Lebo and Su
matings in affected pedigrees to establish linkage and subsequently rdentrfy a disease gene locus. An Ideal polymorphic screening panel would consist of about 300 evenly spaced clones that span the estimated 3000 CM in the 24 human chromosome types at about lo-CM Intervals. Furthermore, each polymorphic site would have a locus with a PIC of 0.9 so that 90% of all matings would be informative. Until recently only an estimated 80% of genes could be identified by lmkage to all available mapped RFLPs. A major milestone was reached when 814 (C-A)n repeats were mapped to 23 linked groups corresponding to the 22 autosomes and the X chromosome together spanning about 90% of the human genome (28). Of these, 605 were very informative with heterozygosity above 0.7 and 553 were ordered with odds’ ratios exceeding 1OOO:l. Now two of these published primer loci can be synthesized and used to screen all members of a disease pedigree cohort within 2 d. Furthermore, lymphocytes no longer need to be transformed from each donor because enough DNA can be Isolated from 30 mL of blood to screen all loct for linkage to all PCR amplified polymorphisms. This approach is becoming the method of choice for linkage screening of disease gene loci. Because testing hundreds of polymorphisms to identify a linked drsease gene locus is labor-intensive, studying chromosome rearrangements in patients with genetic diseases can be very worthwhile because characterized chromosome breakpoints may sublocalize a disease gene locus. Then a few well chosen polymorphic loct can establish linkage. Deletions generate contiguous gene syndromes like the Xp21 deletion syndrome (29-31), whereas duplicatrons can also generate multiple phenotypic abnormalities. Thus an Xp21.2 chromosome deletion that resulted m Duchenne muscular dystrophy, chronic granulomatous disease, retinitrs pigmentosa and McLeod syndrome sublocahzed all four drseases simultaneously (29). Hence the chronic granulomatous disease gene locus was cloned immediately after the Duchenne muscular dystrophy locus (32). Recrprocal translocattons also sublocallzed Duchenne muscular dystrophy and Menkes disease loci because the disease gene or its promoter was disrupted by the chromosome breakpoint (5,33). As the human disease gene map becomes more saturated, future disease gene searches are more likely to be facilitated by identifying patients wrth one or more genetic drseasesresulting from a detectable chromosome deletion, duplication, mversron, or translocation. Karyotyping and in situ hybridrzation identify larger chromosome rearrangements, whereas in situ hybridization and PFGE characterize submicroscopic rearrangements. By convention, linkage estimates are calculated in terms of likelihood ratios that compare the probability a phenotype and genotype are linked to the probability that these events are not linked. Genetrcists use the log,, of the odds ratio (LOD score) so that scores from different pedigrees can be added. By
Positional
Cloning
415
convention, linkage is considered proven when the ratio of the odds of linkage/ odds of nonlinkage is at least 1000/l (LOD = loglo = 3.0). If the ratio is no greater than 1:lOO odds of linkage/odds of nonlinkage (LOD = log,, 0.01 = -2.O), linkage is rejected. Once linkage is established, the recombination fraction (q) at which the ratio IS largest gives an estimate of the map distance in CM (percent recombination) between the loci. For polymorphisms that do not recombine with a disease gene phenotype, linkage may be obvtous. For instance, a polymorphic locus that cosegregates with an autosomal domtnant disease phenotype in 10 of 10 informative meioses is said to be linked because the LOD > 3.0 (odds of linkage/nonlinkage = 2’O/l = 1024/l). Usually recombination occurs between a linked marker and the disease locus so that additional informative meioses are required to prove linkage. LOD scores are usually calculated by computer programs that analyze polymorphic segregation in any pedigree structure (34). Disease heterogeneity, variable phenocopy, diagnostic uncertainty, nonpenetrance, new mutations, and variable age at onset are all confounding issuesthat can complicate analysesand increase the effort required to map a disease gene locus. Nowhere are these problems more evident than m the psychiatric disorders where disease characterization and environmental modificatton confound linkage analysis. Even common diseases like the late onset Charcot-Marie-Tooth disease cannot be detected m all at-risk patients because variable penetrance and expressivity of at least six disease genes generate the CMT phenotype. After the diseasegene has been linked to a polymorphic locus, the next step is to generate a multipoint linkage map of the disease gene region including all available closely linked polymorphisms by testing the pedigree cohort. Because recombinations occur between polymorphic loci in multipoint maps, the disease gene locus is further defined and the LOD score increases because additional evidence exists that the phenotype has cosegregated with these additional flanking markers and becausedouble recombinations have not excluded linkage m the disease gene region. Multipomt linkage analysis involves more complex computer programs. At this point the average distance between available polymorphisms may be 5 CM, which corresponds to a physical distance of about 5 Mb. We have found multicolor in situ hybridization easily orders closely lurked polymorphic probes that have been linked but not ordered unambiguously (Figs. 2-4; Table 1; refs. 7,8). For instance, the order of polymorphic locus 1054 and the FcyRII loci had not been tested in the CEPH family cohort and order was not resolved unambiguously in the large CMTlB family we tested. Therefore we mapped and ordered these loci on chromosome band lq22 by multicolor in situ hybridtzation and assigned both loci to the same 900-kb fragment by PFGE. After this order had been determined, the probable location of the CMTlB locus could then be placed proximal to locus 1054 in the FcyRII gene region (8). In a related study, the lOE4 cosmid (mapped to the
416
Lebo and Su
Fig. 2 (see color plate number 8 after p. 172). Multicolor in situ hybridization. (A) DAPIbanded early metaphase chromosomes distinguish the cytogenetic bands including band lq22 to which the FcyRII gene probes hybridize in (B). Note the brightly staining 1qH region between the chromosome 1 centromere and band lq21 that varies considerably in normal subjects. (B) Rhodamine-stained FcyRIIA hybridizes specifically to Fe11 genes on band lq22 at high stringency as determined from the orange-red signal position on dimly stained red metaphase chromosomes. Note that the upper chromosome has one spot on each chromatid because all the genes in a haploid complement are present on each chromatid. The lower chromosome with unfolded DNA reveals hybridization to two different gene-specific regions on the upper chromatid as found on numerous metaphase chromatids, whereas the longer chromatid has three hybridizing spots consistent with three resolved FcyRII gene loci. Although the two separate adjacent signals may reflect two different hybridizing chromosome regions within the 40 kb spanned by the FCpII cosmid probe, we have also observed other chromatids with three well separated signals too distant to be within 40 kb. (C) DAPI-banded chromosomes hybridized simultaneously to FcyRII and 1054. (D) Fluorescein-specific FcyRII signal labels each of the four chromatids on both homologous chromosomes 1. (E) Simultaneous identification of the proximal fluorescein-labeled FcyRII is resolved from the distal rhodamine-
Positional
Cloning
417
distal 17~11.2 CMTlA gene region) detected polymorphtsms segregatmg at this location as well as at another locus. In situ hybridization explamed the unusual linkage results because the cosmid carries fragments from bands 17~11.2 and 17q12 (Fig. 4; ref. 9). 1.3. Delimit Disease Gene Within 1 Mb Using Linkage, In Situ, and PFGE Maps For diseasesonly mapped to linked polymorphtc loci, the next best step is to cytogenetically localize the clearly flanking polymorphtsms by multicolor in situ hybridization to DAPI-banded chromosomes (Figs. 2-4; refs. 8,9). The order of the flanking clones on the chromosome 1sdetermmed stmultaneously by labeling one flanking marker with fluorescein and the second with Texas red. Furthermore, wzsitu hybrtdtzatton can confirm the order of addrttonal flanking markers in the multipoint linkage map. When necessary, chtmertc clones can be subcloned to isolate a fragment that hybridizes only to the disease gene region. From this point on, candidate genes based on known function or expression m the affected tissue can be tested by in situ hybridization with the closest disease gene flanking markers. Even if the candidate gene 1snot the disease gene, candidate genes mapped to the disease gene region will become additional polymorphic sites that further sublocalize the abnormal gene. At the best, finding the correct gene as for epidermolysis bullosa (3,#) saved many years of labor so that disease gene function and therapy can now be addressed. If the candidate gene is outside the closest flanking markers, no further effort 1sexpended on that locus. A good strategy 1sto isolate a cosmid clone with a 40 kb insert by screening a genomic cosmid hbrary with candidate gene probe. Then in situ hybrtdizatton comparmg the isolated cosmid location to the closest linked flanking markers identifies all candidate genes in the intervening disease gene region and excludes genes outside the flanking markers. Intervening cosmtd clones are screened for olrgonucleottde repeats by hybridtzmg Southern blots to all available di-, tri-, and tetra-nucleottde repeat primers like (GAAA),. Searching for STRs 1sthe most rapid means to identify useful polymorphisms at any locus. Nearly every cosmtd clone has a polymorphic nucleotide repeat. Identified di-, trt-, or tetra-nucleottde repeat flanking regions are sequenced from cosmid subclones, PCR primers selected by computer analysis (Primer v. OS), and the pedigree cohort tested for cosegregation of the STR polymorphism with the labeled 1054 probe on the bottom chromosome 1. (F-H) AddItIonal DAPI-stained metaphase chromosomes that resolve the distal tRITC-labeled 1054 signal from the proximal FITChRITC labeled FcyRII slgnal Chromosomes that resolve these two chromosome sites typlcally have poorer DAPI chromosome bandmg Reprinted with permlsslon from Lebo et al (8).
m
a
\
!c
121 E
Z
1 .\-v .^ \ am
Fig. 3 (on p. 418) Summary of cytogenetic, linkage, and pulsed field gel maps Thus map has about one-thud of the mapped loci reqmred to sublocabzl a drsease gene to 1 Mb. (A) Chromosome 1 early metaphase rdiogram on which the zn szzzzderived a-spectrm, (SPTAl), FcyRII genes (FcyRIIA, FcyRIIB) and clone 1054 positions are m~cated. The IqH region vanes m size and is stained intensely wrth DAPI The most rmportant common gene loci m eacl map are mdrcated by a dot (B) The 464 CM sex-averaged genetic map (71) wrth the gene loci most closely lmked to the CMTlB gene locus indicate the most likely order and genetic distances Sodmm-potassmm ATPase isozyme 2 (ATPlA2) 1s between FcyRII and a-spectrin (SPTAl) but it posttron wzth respect to Duffy (Fy) is unknown (C) Pulsed field gel restnctron map mdrcates the Not1 (NT) and MluI (M) restriction sites and fragmen lengths The 240-kb Not1 fragment (*) carrymg the ATPlA2 locus was denved from Kmgsmore et al (72). Reprmted with permrssron from Lebo et al (8)
lOE4 (Dl7S460) VAW412 10175125~ 4All (Dlk459) ’ 6Gl (Dl7S457) 5G7 (Dl75456) VAW 409 (0175122) 5H5 (0178455)/6A9 (D17S456)
13 p
12
CMTI
A/1041
(Dl7S71)
I
112 11 1 112 12 q
lG6
(Dl7S451)/3FlO
(Dl7S452)ILEW301
(Dl7S56)
$1: 21 3 22 23 24
I/ -00
*
I
,
I
I
I
25
1357911
CMTI A LOCATION
SCORE
17
‘Patlents
with NF-1 and CMT
Fig 4 Genetic and physzcal map of CMTlA gene region Left Locatzon scores (log& for CMTlA from a multrpomt hnkage analysrs with 8Bll and lOE4 as fixed pomts These data place the disease gene locus between these flankmg polymorphrsms The 8 ~-CM regzon 1s drawn to fit mto th distal 17~11 2 band to which the flankmg markers have been mapped by zn sztu hybndzzanon to banded early metaphase chromosomes Center: Earl metaphase chromosome 17 rdiogram Rzght- Physzcal locatzons of polymorphzc clones mapped by zn sztu hybridizatzon. lOE4’ 1s a homologous locatio of clone lOE4 on the long arm of chromosome 17. The primary polymorphic sequence cosegregates with short arm markers, whereas a dzfferen polymorphic site cosegregates with long arm locr The posstbrhty of pericentnc inversion was excluded in chromosomes from two unrelated patzent wrth NF-1 and CMTl by zn sztu hybridization to 8B10, THH32, and C2-Cl1 probes Repnnted from Lebo et al (8)
Lebo and Su
420 Table 1 In Situ Pairwise Comparisons
8BlO
8BlO
5H5
6A9
409b
same
1:9:9
2:5:10
0:2: 12
same
4.10.5 same
3.4.18 2-8-21 same
5H5 6A9 409 5G7 4All
(Distal 17~11.2)” 5G7
4All
13:22 17c 1 1 10 0.2.11 2:6*17 1*10*30 O-3.17 5:9:25 5*7:21 3: 10:9 same 4 IO.26 same
412 lOE4 8BlO
6Gl
412b
10E4
0:2:12
0.0:21
0:4:14 0:2:5 No data 4:5:21 5:21:37
0*6:27 0:3: 16 3:9:21 4:8*27 12 17*13c 0:31*8 3:8:20 same
same 1G6 11:2:1
3FlO 19:6.3
EW301 17:7.0
1041 0:38-12
8BlO 8 7 5c 53:20: 1
5H5 23.10.1
5G7 28 11:8
4All 4.7-l lC 2.11.33
412 5:12*19
aPauwlse comparison of multiple 10~1generates a multlpomt phys& map that IS completely consistent even though occasIona chromosomes showed the oppostte order These data were obtamed by studying chromosomes from at least 30 unrelated mdividuals who were found to be karyotyplcally normal bWe were unable to compare 409 and 412 because both probes are about 2-kb long and probably carry repetltlve sequences In every Instance, these 2-kb probes could be mapped with respect to a probe at least IO-kb long CResult with shorter metaphase chromosomes that chd not order probes unambiguously Longer chromosomes resolved order (next hne)
disease phenotype. If a recombination is detected between the disease phenotype and the candidate gene locus, the disease locus has been sublocalized further. If no recombmatlon 1s detected and Northern analysis finds the gene 1s expressed in the tissue affected by the disease, the gene IS sequenced. If an abnormal sequence is discovered m patients, many patients and normal subjects are tested to confirm that the abnormal gene sequence only cosegregates with the disease phenotype. Assuming no candidate genes correspond to the disease gene, additional polymorphic probes are characterized and added to an ordered map in the disease gene region until the immediately flanking disease gene markers span about 1 Mb. Although available resources vary according to the chromosome region of interest, several clone sources exist: 1 Collecting all available clones sublocalized to the candldate disease gene region as well as clones mapped only to the same whole chromosome (Internatlonal Human
Gene Mapping
Conferences
1 e , refs. 3.5,36),
2. Isolating additional clones from a sorted chromosome-specific cloned
inserts (37,38),
library with large
Positional
Cloning
421
3. Cloning PCR-amplified DNA segments from mlcrodlssected chromosome regions (39-41) and screening larger insert genomic libraries for more useful probes;
4. Making or using an available radiation hybrid library and isolating human-specific sequences by screeningwith alu (42,43); and 5. Using the first generatlon mapped overlapping YAC contlgs spanning most of the humangenome (Accessthrough E-mail password: ion ceph.1.map. genethon fr; ref. 44.)
Some chromosomes have many subchromosomally localized clones. For instance, many overlapping cosmids spanning nearly all of chromosome 19 facilitated identifying the myotomc dystrophy disease locus. Several approaches have effectively identified addltional clones between the most proximal linked disease gene flanking markers. One approach 1s to screen sorted chromosome-specific libraries to isolate many clones from the chromosome carrying the disease gene. In situ hybridization with control dlsease gene flanking probes easily identifies which clones are m the same subchromosomal region. Even though in situ hybrldtzation is relatively easy and straightforward, a sigmficant number of clones must be screened to identify loci separated by an average of 1 Mb. On the other hand, microdissection of a subchromosomal disease region quickly identifies 15-20 small fragments between linked flanking polymorphic sites at a disease gene locus. Uwe Claussen’s laboratory has developed dissected subchromosomal libraries for over a dozen positional cloning projects of the most significant genetic diseases. However, these PCR amplification hbraries have small inserts so that a genomlc library with larger DNA inserts is generally screened to isolate longer sequences for additional studies. Another approach uses radiation hybrids constructed by X-ray radiation of a rodent-human somatic cell hybrid carrying a single human chromosome. The human genetic mutant cell repository has cell lmes deposlted with almost every unique human chromosome carried by a different hybrid. Severe hybrid cell radiation breaks the chromosomes so that viable daughter cells lose large segments of the human chromosome to enrich the remaining human chromosome segments. These hybrids are then screened for cells carrying the subchromosomal region of interest with minimal other human chromosomal material. In situ hybrldlzation can monitor whether the gene region remains in the irradiated hybrid cell strain and how much flankmg chromosomal material remains. In this fashion hybrids can be screened quickly for the cell strain with the smallest subchromosomal region carrying both disease gene flanking loci. Then a cosmld library is constructed of total hybrid cell DNA from which the human DNA clones are identified and isolated by hybridization to repetitive human-specific alu sequences.
422
Lebo and Su
Collected clones mapped to a single chromosome or subchromosomal region can be sublocalized further by in situ hybridization to banded early metaphase chromosomes (8,9), hybridization to sorted derivative chromosomes (7,37), hybridization to DNAs from somatic cell hybrids with derivative chromosomes, or hybridization to DNA from radiation somatic cell hybrids carrying only a single small chromosome region. Although each method has laudable attributes, multicolor in situ hybridization is the easiest means for the average laboratory to characterize all clones quickly with respect to the closest flanking gene markers (Figs. 2-4; refs. 89). Simultaneously mapping a fluoresceinlabeled clone and one control Texas red-labeled flanking marker establishes whether a clone is derived from the correct side of the flanking marker and close to it in the candidate gene region. Clones meeting these criteria are retested with the other flanking marker to quickly identify only those clones between both flanking markers (9). Clones between the current closest flankmg markers are screened for polymorphic STRs and if necessary RFLPs. After intervening clones between the disease gene flankmg markers are identified, the relative order of each is most easily determined by in situ hybridization to early metaphase chromosomes of normal mdividuals (9). Alternatively, polymorphisms can be identified and ordered by linkage analysis in many large CEPH families. For instance, multicolor in situ hybridization to early metaphase banded chromosomes has been used to order cloned sequences m the CMTlB and CMTlA gene regions (Figs. 2-4; refs. 8,9). Nme cosmid clones were mapped m pairs of two to determine which was distal. When each locus was scored, comparison was recorded to generate a consistent table of eight ordered locations in the CMTlA gene region. The order of 5 of these 8 loci was confirmed prior to publication by multipoint linkage analysis in CEPH families (8). Two of these CMTl A loci VAW409 and VAW412 were mapped to the same 1150-kb Not1 fragment (13,24). Thus, these two flanking loci and three ordered interstitial loci are separated by an average distance of 225 kb (8). When a high resolution physical map has been constructed for the polymorphic loci, the pedigree cohort is tested to further sublocalize the disease gene locus by multipomt linkage analysis. This will raise the LOD score, further sublocalize the disease gene locus, and identify the informative meloses m the pedigrees for further testing with subsequently isolated polymorphic loci. 1.4. Isolate 1 Megabase Region in Overlapping Clone Contig with In Situ, YAC, and PFGE Maps When the gene region is defined to about 1 Mb by linkage analysis m the pedigree cohort, the region between the closest flanking markers is isolated in YACs or cosmids (44-46). Screening the first generation overlappmg YAC
Positional
Cloning
423
contigs map spanning most of the human genome (46) has already provided a major boost to positional cloning projects that have sublocalized a disease gene to a chromosome region spanning about 1 Mb. Nevertheless, these first generation YAC contigs may be incomplete or have clones with large deleted segments spanning the dtsease gene. Isolating additional YAC library clones would then complete the isolation of all genes in the disease gene region. This section will outline the isolation of a 1 Mb disease gene-containing chromosome region that is flanked by two characterized clones but has not been isolated in the firts generation genomic YAC map. Isolating smaller chromosome regions lost or rearranged by recombination m YAC library clones (17) would involve slight modification to this general strategy. Screening YAC libraries requires sequencing cloned DNA to define sequence tagged sites (STSs) at both flanking loci. Each pair of STS primers must be tested on total human DNA to confirm that only a single length fragment is amplified. To date all primers chosen by the PRIMER computer program (47) have been suitable to PCR amplify a unique chromosome region m 10,000 cell equivalents of DNA. Raising annealing and elongation temperatures can often Increase the specificity of primer pan amplification to generate a single size fragment amplified from a single genomic locus. Primer pairs that amplify unique genomic fragments are used to screen pools of YAC clones. Positive YAC clone pools are subdivided with multiple additional screens until the single positive YAC clone is isolated. The msertion sites of isolated YAC cloned DNAs derived from both disease gene flanking sites are then sequenced and new unique STS primers defined. Assuming that no YACs are chimeric, half these new sites are closer to the disease gene and half are farther away. These STS primers are again used to screen the library for more YAC clones. Again new YAC clone insertion sites are sequenced and more STSs defined and tested. Now some of these sites will be carried by the original YAC clones and the orientation of the YAC clone can be established with respect to the single original STS. The other insertion site wtll be even farther from the original STS. These YAC library walking steps are continued for about 6 rounds until the entire intervening l-Mb region between the flanking markers has been isolated. A jumping and lmkmg Not1 YAC library has been very useful not only for walking, but also because linking clones located about every 300kb generally reside in CpG islands. Depending on the length of the isolated YAC clones, YAC walking can be monitored after 2-3 steps by multicolor in situ hybridization to prometaphase banded chromosomes, In situ hybridization not only identifies chimeric clones to prevent jumping to other chromosome regions, but also orients the walk toward the disease gene region. In situ hybridization with YAC clones often gives unique, intense, specific signals after prehybridization of labeled YAC
424
Lebo and Su
sequences to total human DNA. Unlabeled total DNA hybridizes rapidly to repetitive YAC sequences leaving unique labeled sequences single-stranded for subsequent hybridization to unique chromosome targets (48). We use this same protocol routmely to map whole cosmids without isolating subclones of unique sequences for hybridization. However, occasional cosmids do not have sufficient unique sequences to give strong signal on metaphase chromosomes. About one-third of cosmids give poor signal on interphase nuclei because substantial regions of large intervening repetitive sequences give multiple spots. Others find that amphfying YACs that are difficult to map with multiple pairs of primers to common repetitive sequences generates many different size fragments from amplified unique regions. When hybridized to metaphase chromosomes,these enriched unique sequencesoften give strong, specific fluorescence signals. For instance, alu primers made to amplify away from the center of the alu sequence have a chance of meeting another alu primer if DNA polymerase moves far enough along the chromosome to reach the next homologous primer binding site. After PCR amplification of the whole YAC clone in different reaction tubes for each primer sequence, the amplified fragments are pooled and precipitated prior to labeling for fluorescence in situ hybridization (Eric Lynch, personal commumcation). 1.5. Identifjr
and
Sequence
Candidate
Genes
Several techniques have been used to identify transcribed gene sequences m genomic clones. Although no single method identifies all transcribed genes, a combination of methods identifies most expressed sequences. Remember that some genes like the neurofibromatosis-1 gene also have additional gene(s) in mtrons (49,50). 1.5.1. Zoo and Northern
Blot Hybridization
Candidate genes can be identified by subcloning YAC or cosmid contigs spanning the disease gene region into plasmids and hybridizing to blots of restriction enzyme digested DNA from different mammalian orders (zoo blots; 51,52) and Northern blots to detect any conserved, expressed sequences. Because gene exons are under the most selective pressure, these methods detect conserved genes. DNA from different species can be derived from cell lines available through the ATCC from different mammalian orders like carmvore (dog), rodent (mouse), and artiodactyl (cow). Any positive clones can be sequenced and exons identified using the “grail” program (53) accessed by modem to the Oak Ridge National Laboratory computer, Oak Ridge, TN. Labeled fragments can also be hybridized to northern blots of normal RNAs isolated from multiple tissue types, including the tissue type affected in patients. In general, detectable gene expression in normal tissue indicates an abnormal gene could produce the abnormal tissue-specific phenotype.
Positional
Cloning
425 1.5.2. CpG Islands
Another standard approach is to search for CpG islands often found in 5’ gene regions (54). A cytosine 5’ to a guanosine IS enzymatrcally methylated m DNA regions between genes more often than at active gene sites. Methylated cytosines are occasionally misread as thymidine during DNA synthesis, which results in a basepair change. Through evolutionary time this phenomenon has erased many CpG sequences so that enzymes with a CpG in the recognition site like BssHII, EugI, and Sac11generally cut DNA much less often than predicted in intergemc regions. YAC clones digested with these enzymes are analyzed by pulsed field gel electrophoresis to search for restriction enzyme digestion sites that are cut by more than one rare cutting enzyme (CpG islands). Sequences from the ends of digested YAC inserts are isolated by ligating to plasmid vectors, digesting with a common cutting restriction enzyme that does not cut the vector, and transforming bacteria that require vector with inserted DNA to grow. Isolated transformed plasmids are hybridized to zoo blots, Northern blots, and cDNA libraries to identify clones with transcribed gene sequences 1.5.3. Tissue-Specific
cDNA Library
Screening
A different means to detect coding regions within a large genomrc region is to use YAC or cosmid conttg clones or subclones (45,46) to screen tissuespecific cDNA libraries for chromosome region-specific transcribed sequences (55). This approach is only occasionally successful following blocking with unlabeled genomic DNA (55), because not all cDNA clones are detected. Alternatively YAC or cosmid DNA can be immobilized on filters, hybridized to an amplifiable cDNA population blocked for repeats, the nonspecific cDNAs removed by washing, and the specifically hybridizing cDNAs eluted (56,57). Then the eluted cDNAs are amplified, cloned, and screened with YAC or cosmid probe. This procedure was used to enrich clone-specific cDNAs 2000fold for the erythropoietin gene (56) and to isolate several nonmajor htstocompatibility complex class I clones (57). If necessary, YAC fragments can be subcloned, preannealed to total unlabeled human DNA, and used to screen tissue-specific cDNA libraries. One commercial source sells many tissue-specific cDNA libraries in a lambda ZAP vector (Stratagene, La Jolla, CA) for immediate screening. Lambda ZAP vectors have T3 and l7 promoters flanking each insert that can be used to generate end-specific RNA transcripts. 1.5.4. Exon Trapping
If the disease gene has not been found, “exon trapping” is another means to identify expressed gene sequencesm overlappmg YACs or cosmtds (58). YAC or cosmid cloned sequencesare digested and shotgun cloned into the retrovual vector pETV-SD carrying an exon trapping cassette.This exon trap vector iden-
426
Lebo and Su
tifies functional splice acceptor sites encoded in cloned genomic DNA fragments. Since most genes undergo RNA splicing, such sites serve as gene identifiers. Pooled plasmid DNA from this shotgun clonmg is transfected into an ecotropic retroviral packaging cell line that provides proteins required for vector propagation as a retrovirus. Retroviral DNA is transcribed in vivo and transcripts with functional splice sites may undergo splicing with loss of the marked intervening sequence in the cassette.Spliced and unsphced viral RNAs are packaged into virions, harvested from this culture, and used to infect COS cells. This second replication increases the splicing frequency. Viruses isolated from the second culture are used to infect COS cells that constitutively produce SV40 antigen. Thus, the shuttle vector is reverse transcribed and amphfied as a circular DNA episome with an SV40 ortgm of rephcation in the vector. The beta-galactosidase indicator gene is excised by splicing and results in a whtte colony, whereas colonies that are not spliced are usually blue. Splicmg events are verified in whtte colonies by DNA sequencing primed from withm the spliced donor exon. These candidate exons can be used to screen zoo blots, cDNA libraries, and Northern blots to identify genes. Another technique transfects shotgun cloned fragments mto COS cells and identifies the spliced products following reverse transcription and PCR amplification of spliced cytoplasmic RNA (59). 1.5.5. Sequence
Candidate
Genes
After expressed gene sequencesare identified, considerable effort is required to compare normal and patient sequences by cloning and sequencing each basepair. A strategy that worked for the 24 exons in the three FcgRII genes was to construct primers from mtron sequences immedtately flanking each exon and sequence PCR amplified exons from both patient chromosomes stmultaneously. Another strategy, “Exon scannmg” (60), uses RNA probes derived from cDNA templates (cRNAs) to detect lesions in suspect genes. The cRNA probes form heteroduplexes with target gene exons, whereas the mtrons loop out as single-stranded DNA. RNase A removes all sequences not hybridized perfectly to DNA to retain only sequences perfectly hybridized to exons. A point mutation will result m a single basepair mismatch that is cleaved by RNase A to give two exon fragments instead of one. In a test system of 12point mutations m the human beta-globm gene, this system identified each point mutation. Chemical mismatch cleavage has been an effective substttute for RNase A cleavage (61) If an abnormal sequence is found only in abnormal subjects, many more normal and patient DNAs are tested Cosegregation of the disease phenotype and the abnormal gene sequence only in patients helps confirm that the disease gene has been Identified. Because linkage disequihbrmm can occur in the region of the disease gene locus in a single family, as many unrelated probands as possible are tested for abnormal gene
Positional
Cloning
427 Table 2 Mapping Protocol Deficiencies
Problem
YAC
4-a
In situ 2. e
+a +/Ad
+a.e +/-bad
l
-c more
Linkage
Physically separate homologous sequences Chimerlc clone Clone with interstitial deletion Recombinant chromosome Relative effort required
+”
Radiationhybrids +I-W
+a
+/?i d
-c
-c
+a
less
more
more
a+ Is a problem b+/- May be a problem c- No anticipated problems dMay be a problem depending on mtervenmg distance eAntlc!pated to resolve other mconslstent data by characterlzmg homologous sequence locatIons
sequences to confirm the disease gene assignment. Sequencing the gene may identify homologous genes with similar functions that provide clues to the disease abnormality. 1.6. Anticipating
Problems
and
Solutions
This section describes the most common mapping and posItiona cloning pitfalls (Table 2) and concludes that in situ hybridization often resolves apparently contradictory data. Positional cloning includes constructing: 1. 2. 3. 4.
Linkage maps; In situ hybridization maps, Pulsed field gel maps; and Overlapping YAC or cosmid maps.
These maps can be used to check each other to detect and correct mconsistencies. During the life of a positional cloning project, these maps need only be reliable enough to identify the disease gene; categorize scores of disease gene mutations; and develop closely linked polymorphisms and common allele specific oligonucleotide (ASO) tests to diagnose nearly every at risk fetus (62). Within the broader goals of the human genome project, map reliability depends on whether each clone has a single DNA segment derived without rearrangement from its original location, and on the frequency and genomic distribution of homologous sequences to which the cloned fragment hybridizes.
428
Lebo and Su
Of the first 37 well-characterized genes mapped by spot blot analysis, 35 had homologous gene sequenceson other chromosomes (63). In addition, some genes are found as part of a homologous gene family m the same chromosome region, like the Fcyreceptor gene family in the centromeric region of chromosome 1 (7,8,25). Homologous genes and pseudogenes can generate apparently conflicting maps until genes like the five FcyRII and FcyRIII genes m band lq22 were characterized (8,6#). Characterization strategy included raising hybridization and washing stringency so that sequence differences of 5% could be distinguished by in situ hybridization (8). Although highly repetitive sequences, like alu, and moderately repetitive sequences will probably not cause interpretation problems after preannealmg probe to human placental DNA, homologous sequences with 2-10 copies can confound results. High resolution chromosome region maps are constructed with overlappmg YAC or cosmid library clones. Even when chromosome regions do not have homologous low copy sequencesthat cause confusion, isolating and characterizing a chimeric clone early in the construction of an overlappmg YAC or cosmid map can unknowingly move one to a distant or unlinked chromosome region. Clones to be mapped have been derived from sorted chromosome-specific cosmid libraries, cosmid libraries of radiation hybrids carrying a subchromosomal region, total genomic YAC libraries, and microdissected subchromosomal region clones developed by PCR-amplification with repetitive primers (37-39,42,46). All clones can be chimeric and any larger clone screened by a microdissected PCR amplified library fragment can also be chimerit. All cloned DNAs may become chimeric during cloning if two unlinked DNA sequences are spliced together at the same time the DNA was spliced to vector. To minimize chimeric clones, DNA fragments are dephosphorylated prior to ligation to vector. However, a fraction of DNA fragments escape dephosphorylation and can ligate to each other and the same vector. The very useful St. Louis YAC library has about 30% chimeric clones. For example, 14 chrmeric clones were reported among the 56 used to construct the CMTlA region YAC map (65). Additional caution is suggested when testing MegaYACs (I 7). Sorted chromosome-specific libraries have lO-30% of clones derived from other chromosomes in addition to chimenc clones. Some radiation hybrids carry reannealed, rearranged chromosome segments and constructed libraries have additional chimeric clones. Even the most meticulous library construction protocols generate some chimeric clones. The larger the cloned insert, the greater the problem. In situ hybridization provides a simple means to map library clones and detect chimeric clones. For instance, even though most fragments in a radiation somatic cell hybrid are rodent sequences and most chimeric human clones constructed from this source are anticipated to have both human and rodent
Positional
Cloning
429
sequences,at least two of nine cosmid clones (D175458 and D175460) derived from a radiation somatic cell hybrid carrying the human pericentromeric chromosome 17 region were mapped to two different human chromosome 17 regions (9,66). Physically mapping clone D175460 to distal band 17~11.2 and to band 17q12 by in situ hybridization (Fig. 4) explained why different D175460 RFLPs segregated independently at meiosis. After all available library clones have been isolated and mapped, some map regions will only be spanned by a single clone. If the only clone spanning a chromosome region has an interstitial deletion or duplication, the entire map will have missing or extra intervening space. Missing regions may delete the disease gene. Duplicated disease gene regions may confuse the map. After a clone has been constructed, interstitial recombmation can occur in daughter cells so that a region between the two insertion sitesof the cloned human sequence is deleted. In our experience, about one-tenth of all plasmid clones isolated for prenatal restriction enzyme analysis have undergone interstitial deletion during shipment and propagation. Larger cloned inserts with homologous sequences are anticipated to recombine more easily. Recombined clones are shorter and have a selective growth advantage over vectors with larger DNA inserts. Although host strains are improving as more recombmation enhancing functions are deleted and alternative clonmg systemsare bemg developed (17), YAC clones with interstitial deletions like clone A56D6 (65) are still a problem. If no other isolated clones span thts chromosome region, the missing segment of a YAC map may only be detected if two separatedomains are resolved by in situ hybridization of the YAC clone to interphase nuclei or if unusual DNA fragment lengths are defined by PFGE. If the disease gene has yet to be cloned from a YAC contig, a missing intervening YAC region may have to be isolated in overlapping cosmids. On the other hand, many other clones derived from the YAC contig (65) are now available for further CMTlA studies and the CMTlA gene (PMP-22) has been reported (67-70). In conclusion, the central messageof this chapter is the previously unappreciated usefulness of multicolor in situ hybridization in positional cloning studies. Multicolor in situ hybridization subchromosomally localizes and orders linked disease gene markers at any distance greater than 100 kb, identifies clones between the closest known disease gene flanking markers at any stage of the positional cloning project, orders closely lurked clones more rapidly and easily than multipoint linkage analysis, and quickly excludes a majority of candidate genes outside defined flanking gene markers. When abnormal chromosome rearrangements generate disease phenotypes, in situ hybridization characterizes the type and extent of these rearrangements with higher resolution than chromosome banding and more easily than reconstructing a restriction map
430
Lebo and Su
of smaller chromosome rearrangements by PFGE. In situ hybridization also detects and maps homologous gene sequences and chimeric clones and chimerlc chromosome segments. These can be the most vexing results to interpret when studying Southern and PFGE blots. Furthermore, when distances between locations on YAC maps do not coincide with PFGE fragment lengths, in situ hybridization may help resolve the inconsistency by detecting interstitial deletions of large cloned DNA segments or chimerlc clones from any source. Finally, published in situ hybridization protocols like those in this chapter provide a means for any laboratory to add this approach to other routme recombinant DNA techniques. Overall, multicolor in situ hybridization truly deserves a place among the useful protocols available to investigators doing positional gene cloning. 2. Materials 1. Fish skin gelatin (FSG) (Sigma, St. Louis, MO). 2 3. 4. 5. 6 7.
Human placental DNA (Sigma) sonicated to 200-500 bp Size range. Blo-1 l-dUTP (Enzo Diagnostics, Farmingdale, NY). Dlgoxygenin- 11-dUTP (Boehringer-Mannheim, Mannheim, Germany) Nick translation kit (Enzo Diagnostics) 50% Dextran sulfate (Sigma) Autoclave for 30 min RNase A (Sigma). Boil for 15 min to inactivate DNase, chill quickly on Ice, and store in aliquots at -20%
8. Tween 40 (Sigma) 9. Avidin-Texas red (Vector, Burlmgame, CA). 10. Biotmylated goat antiavidin (Vector). 11. Mouse antidigoxygemn (Sigma); rabbit-antimouse-FITC (Sigma), goatantirabbit-FITC (Sigma) 12 McIlvane’s buffer: 50 mM sodium phosphate titrated to pH 7.0 with citric acid (Sigma). 13. DAPI: 4’,6-diamidino-2-phenylindole 14. 1X SSC, diluted from 20X SSC stock. 20X SSC = 3.OM NaCl and 0.3M sodium citrate adjusted to pH 7.0 with ION NaOH Autoclave. 15 PBS: Mix 36 mL of 0 5M Na2HP04 (dibaslc), 20 mL of 1.OM NaH,PO, (monobaSIC), and 35 7 mL of 5.OM NaCl to a final vol of 1 L. 16 Hank’s PBS. 1 L 0 4 g KCl, 0.06 g KH2P04, 8 g NaCl, 0.35 g NaHC03, 0.09 g NazHP0,.7H20, 1.O g glucose, 0.01 g phenol red. 17 Fluorescence photomicroscope with 100 W mercury arc lamp. 18 Excitation, dichroic, and emission filter sets for individual DAPI, fluorescein, Texas red observation, and dual fluorescem/Texas red images have been developed m cooperation with Paul Millman (Chroma, Brattleboro, VT). Individual filter sets for Hoechst (used for DAPI) (excitation: 360 WB50 #9008, dlchrolc 470 DCLP #8902, emission 470 DF65 #8902), FITC (excitation 480 DF30 #8902, dichroic 505DRLP #8902, emission DK45 #8902), and Texas red (excitation. 560 DF40 #8902, dichroic 595 DRLP) FITC/rhodamine filter set distributed by Omega Optical Co. (Brattleboro, VT) 19 100X Fluorescence objective (Nikon Inc.)
Positional
Cloning
431
3. Methods With optimal slides and conditions, these protocols uniquely detected a fluorescein-labeled 3.1 kb genomic probe and a Texas red-labeled 2.3 kb cDNA keratin 5 probe (Fig. 1; ref. 3).
3.1. Preparing
Probes
1. Nick translate clean tested probe (1.5 yg of each) with bra- 1 I-dUTP or digoxygenin-1 l-dUTP and 0.5 pCi 3H-dATP or 3H-dGTP tracer 2. After 1.75 h, run check gel and use DNA between 200-500 bp Separate labeled DNAs from unincorporated nucleotides by column chromatography through a G50 Sephadex column equilibrated in 150 mM NaCl, 15 mM sodium citrate, 0.1% sodium dodecyl sulfate (SDS), pH 7.0. 3. Tritium incorporatron of 30-70% is optimal for unique probes and 20-60% for repetitive probes. 4. To well-labeled moderately repetitive probe like the chromosome specific alphasatellite sequences, add 5 pg yeast RNA and 150 pg salmon sperm DNA sonicated to 200-800 bp. To unique, single copy probe add an additional 100-500X human placental DNA somcated to 200-800 bp or 20-500X sonicated human Cot-l DNA (Bethesda Research Labs, Bethesda, MD). 5 Ethanol precipitate the mixed DNAs, wash in 70% ethanol and dry completely Redissolve in 100% deionized formamide at 37°C to 10 ng/pL labeled DNA. 6. Mix with 4X SSC, 100 mIt4 NaPO, (pH 7 0) plus 20% dextran sulfate to a final concentration of 50-60% formamlde (1.5 kg/250 pL for 10 slides) Denature for 10 min at 95’C, and prehybridize to human placental DNA or Cot-l DNA for 3-6 h at 37°C.
3.2. Preparing 1 2.
3. 4 5. 6. 7.
Slides
3.2.1. Lymphocyte Interphase Nuclei Centrifuge blood drawn in anticoagulant at 5OOg for 10 min. Remove 0 l-O.2 mL buffy coat and dilute with 15 mL of 75nuV KC1 prewarmed to 37°C added gradually down the side of the tube Incubate at 37’C for 20-30 min. Centrifuge at 200g for 7 min. Remove nearly all supernatant, leaving an equal vol of supernatant as pellet. Resuspend pellet by tapping, and add fresh fixative (3: 1::methanol:glactal acetic acid) dropwise with constant, rapid agitation to a vol of about 4 mL. Leave at room temperature for 15-30 min Centrifuge at 200g for 7 mm, and fix pellet as above. Leave at room temperature for 15 min. Repeat centrifugation and fixation. Prepare desired slides immediately or store fixed cells at -20°C For fixed cell suspensions stored at -2O’C, recentrifuge and resuspend the cells m 0 2-l mL fresh fixative. Chill slides washed in 100% methanol in an ice slurry, prior to dropping 2-3 drops of fixed cell suspension from 18 in. Examine dried slides by 160X phase microscopy to assure only small quantrties of cytoplasm surround the nuclear DNA.
432
Lebo and Su
8. Bake the slides at 60°C for 2 h and use within 2 wk. 1. 2 3 4.
3.2.2. Fibroblast Interphase Nuclei Grow fibroblasts to confluence Harvest the cells by trypsinizing and pellet by centrifuging at 2OOg for 7 min Resuspend the pellet gently and swell by addmg about 2 mL of hypotonic solution (1.1:.0.4% KC1 0.4% sodium citrate, prewarmed to 37°C) for 8-10 min. FIX cells in fixative (3.l::methanol*glacial acetic acid) and make slides as for lymphocytes.
3.2.3. Amniocyte Interphase Nuclei 1. Centrrfuge 15 mL amniotic fluid at 200s for 7 min. Remove the supematant, resuspend the pellet gently, and swell in hypotomc solution (1:l::O 2%KCl:0.2% sodium curate, prewarmed to 37°C) for 8 mm. Centrifuge at 5Og for 10Jmm to remove as much debris as possible. Remove supernatant and resuspend by tapping. 2. Fix, prepare shdes, and bake as for lymphocytes. 3.2.4. CVS Interphase Nuclei 1 Dissect at least 5 mg chorionic villi (10 mg is optimal) from the maternal decrdua. 2 Mince dissected villi in very little medium in a Petri dish by rocking a large rounded scalpel blade back and fourth over the vi111mamtammg contact with the Petri dish 3. Dissociate single cells with 1% pronase (85 U/mL) in PBS at room temperature After about 15 s when cells begm to dissociate, aspu-ate the suspension forcefully in and out of a transfer pipet (Fisher, Pittsburgh, PA) until a large number of individual cells are suspended but before a substantial proportion of cells lyze. 4. Add hypotonic solution (1:3 Hanks’ PBS:H,O) to the Petri dish for 20 min. 5. Transfer cell suspenston to 15 mL Corning #253 19- 15 polypropylene centrifuge tube and centrifuge at 15Og for 7 min. 6. Remove supernatant. Resuspend pellet by tapping. Add fixative slowly, and allow to stand on wet ice at least 15 mm prior to collectmg by centrifugatron at 15Og for 7 min. 7 Repeat fix three times and drop slides. 1 2. 3. 4 5.
3.3. Hybridization and Washing Treat baked slides wrth RNase (100 pg/mL; 100 pL/sllde) m 2X SSC at 37’C for 60 min. Wash three times for 5 mm each at room temperature m 2X SSC. Dehydrate by dipping slides mto 70,90, and 100% ethanol for 5 mm each at room temperature, and au-dry. Rehydrate the slides m 0 2 miI4 CaC12, 2 mM Tris-HCl, pH 7.5, for 20 s, then transfer to the same buffer plus 100 pg/mL protemase K (stock proteinase K [ 10 pg/mL] aged at 37°C for 3 h and stored m frozen aliquots) for 8 min at 37°C. Wash 5 min at room temperature with PBS, then wash 5 mm in PBS plus 50 rruI4 MgC12. Fix 5 min at room temperature m 1% formaldehyde in PBS plus 50 mM M&l,. Wash twrce for 3 min m PBS, dehydrate in an ethanol serves, and am-dry.
Positional
Cloning
433
6. Denature DNA by placmg the slides at 70°C for 5 min in 2X SSC, 70% formamide Chill in 70% ethanol at O”C, then dehydrate in an ethanol series and air-dry 7. For dual color hybridization, mix 20 ltL of each prepared probe and add the 40 p.L hybridization solution to each 25 x 50 mm coverslip. Gently lower air-dried slide onto coverslip. Place in sealed moist chamber at 37°C overnight. 8. Wash slides twice for 15 min each in 50-65% formamide in 2X SSC at 37°C. 9. Wash twice for 15 min in 2X SSC at 37”C, and once in 1X SSC for 5-30 mm at room temperature, prior to washing three times at high stringency for 5 min each in 0.1X SSC at 60°C in a water bath shaking at 60 revolutions/min 10 Block nonspecific binding of avidin and antibodies by adding 200 l.tL/coverslip of 10% FSG in 4X SSC. Add inverted slide to coverslip and place at 37°C for 30 min m a moist chamber. Pull off coverslips, place slides onto coverslips with 100 pL/coverslip avidin-Texas red diluted 1’1000 in 4X SSC plus 2% FSG, and mcubate for 30 min at 37°C in a moist chamber 11. Transfer slides to another slide dish with washing solution, remove coverslips, and wash three times for 5 min each in 4X SSC, 0.1% Tween 40 prewarmed to 37°C on a benchtop shaker at 60 cycles/min. 12. Block again by adding 200 l,tL/coverslip of 10% FSG in 4X SSC, add inverted slide to coverslip as before, and place m glass slide rack for 10 mm at 37°C in a moist chamber. 13. Pull off coverslips individually, and place slides onto coverslrps with 100 pL/ coverslip goat antiavidin 1:lOO dilution in 4X SSC plus 2% FSG for 30 min at 37°C in a moist chamber. 14. Repeat washing step 11. 15. Repeat blocking step 12 16. Incubate with 100 pL/coverslip avidm-Texas red diluted 1 1000 and mouse antrdigoxygenin diluted 1.500 m 4X SSC plus 2% FSG for 30 mm at 37°C m a moist chamber. 17. Repeat washing step 11. 18. Repeat blocking step 12. 19. Incubate with 100 pL/coverslrp goat antiavidin diluted 1:lOO and rabbit antimouse-FITC antibody diluted 1: 1000 in 4X SSC plus 2% FSG for 30 mm at 37°C m a moist chamber. 20. Repeat washing step 11. 21. Repeat blocking step 12. 22. Incubate with 100 l,tL/coverslip avidin-Texas red diluted 1.lOOO and goat antirabbit-FITC diluted 1: 1000 in 4X SSC plus 2% FSG for 30 min at 37’C in a moist chamber. 23 Repeat washing step 11 24. Wash in PBS at room temperature twice for 3 mm each. 25. To improve metaphase and prometaphase chromosome banding, dehydrate slides in an ethanol series at room temperature, and au-dry completely 26. Stain slides in 750 ng/mL DAPI in McIlvane’s buffer at room temperature for 3 min on a benchtop shaker at 60 cycles/min. 27. Rinse by immersing 10 times in each of two jars with McIlvane’s buffer and au-dry 28. Mount onto 25 x 50 mm No. 1 coverslrps with 10 PL antrfade
Lebo and Su 3.4. Photomicrography 1. Study fluorescent signals through a 100X Nikkon objective and individual filter sets for Hoechst (used for DAPI), FITC, and Texas red, or simultaneously through FITC/TX Red or FITC/rhodamme filter sets. 2. To minimize photographic generations, record images of Texas red, Texas red/ fluorescein, fluorescein, and DAPI m that order on Kodacolor 400 ASA print film or Ektachrome 400 ASA slide film. Exposure times for Texas red and fluorescein vary according to signal intensity, and DAPI images are exposed automatically at 400 ASA. 3 Localize probe-specific slgnal to a unique chromosome band by photographing early metaphase chromosomes stained with 0.44 Fg/mL DAPI and counterstained with 0 125 pg/mL propidium iodide. Take photographs with the dual color filter for propidium iodide and fluorescein and subsequently record DAPI bandmg with the Hoechst filter set Because propidium iodide obscures Texas red-specific signals, score multicolor experiments for gene order before assigning FITClabeled probes to unique chromosome bands. For investigators unfamiliar with banded chromosomes, chromosome-specific alpha satellite repetitive sequences can be hybridized simultaneously to map unique probes to single chromosomes unambiguously (IO).
Acknowledgment This work was supported by a Muscular on Genetics grant to RVL.
Dystrophy
Association
Task Force
References 1 Collins, F S (1992) Positional cloning let’s not call It reverse anymore Nature Genettcs 1,3-6
2 Berger, W , Memdl, A., van dee Pal, D , Cremers, F P. M., Ropers, H. H., Doerner, C., Monaco, A., Bergen,A A B., Lebo,R., Warburg,M., Zergollern,L., Lorenz,B , Gal, A , Bleeker-Wagemakers, E , andMettmger,T. (1992)Isolationof a candldategenefor Norne &ease by positionalcloning Nature Genetics 1, 199-203. 3. Bomfas,J. M , Bare, J W , Lynch, E. D., Lebo, R. V., and Epstem,E. H , Jr (1992) Regional asstgnmentof the humankeratm 5 (KRTS) geneto chromosome12q near D12S14by PCR analysisof somaticcell hybrids and multlcolor in situ hybridization Genomrcs 13,452-454
4. Bomfas,J. M, Rothman,A L., andEpstem,E H , Jr. (1991)Epldermolysisbullosaslmplex: evidencem two famlhesfor keratmgeneabnormahtlesScience 254, 1202-1205. 5 Vulpe, C , Levinson,B , Whitney, S , PackmanS , andGitschler,J (1993)Isolationof a candldategenefor Menkes diseaseand evidencethat It encodesa copper-transporting ATPase.Nature Genet 3,7-l 3. 6 Monaco,A P , Neve,R. L., Colette-Feener, C , Bertelson,C. J , Kumlt, D M , andKunkel, L M (1986)Isolationof candrdatecDNAs for portionsof theDuchennemusculardystrophy gene.Nature 323,646-650. 7. Lebo, R. V , Chance,P. F., Dyck, P. J., Redlla-Flares,M., Lynch, E D., Golbus,M S , Bird, T D , King, M C , Anderson,L. A , Hall, J., Wiegant, J , Jiang, Z , Dazm, P , Punnett, H. H , Schonberg,S A , Moore K., Shull, M. M , Gendler, S , Hurko, O., Lovelace, R E , Latov, N , Trofatter, J , and Conneally,P M (1991) Chromosome1 Charcot-Marie-Toothdisease(HMSNlB) locusin Fc gammareceptorgeneregion.Hum Genet 8&l-12.
Positional
Cloning
8 Lebo, R. V., Lynch, E D , Wregant, J., Moore, K., Trounstine, M , and van der Ploeg, M (1991) Multicolor fluorescence in srtu hybridization dissects CMTlB gene region Hum. Genet. 88,13-20. 9 Lebo, R. V., Lynch, E. D , Bird, T D., Golbus,M S , Barker, D. F , O’Connell, P , and Chance,P. F (1992) Multicolor fluorescencein S~Uhybrtdization and linkage analysis cytogenetlcallyorder CMTlA generegionloci Am. J. Hum.Genet.50,42-55 10. Lebo, R V., Flandermeyer,R. R , Lynch, E D , Diukman,R , and Golbus, M (1992) Prenataldiagnosiswith repetitive in situ hybridization probes.Am .I Med. Genet 43, 848-854
11 Lebo, R. V., Martellt, L., Su, Y., Li, L.-Y., Lynch, E , Mansfield, E., Pua,K , Watson, D., Chueh,J , andHurko, 0. (1993) Prenatalandpresymptomaticdiagnosisof CharcotMarie-Tooth diseasetype 1A by multicolor m situ hybridization. Am J Med. Genet.47, 441-450. 12. Lebo, R. V., Lynch, E D , Golbus, M. S , Yen, P H , and Shapiro, L. (1991, 1993) Multicolor in srtu hybrrdtzatron prenatally diagnosesX-linked tchthyosis 29th Am. Cytogenet Conf.TahoeCity, California, p. 16;Am. J. Med Genet 46,652-658. 13 Hoogendtjk,J. E , Hensels,G. W., Zorn, I , Valentijn, L., Janssen,E. A , de Vtsser, M , Barker, D. F., Ongerboerde Visser,B. W , Baas,F., andBolhuts,P A (1991)The duphcation m Charcot-Mane-Toothdiseasetype 1A spansat least1lOO-kbon chromosome 17~112. Hum.Genet.88,215-218. 14. Raeymaekers, P.,Ttmmerman,V., Nehs,E , Van Hul, W., DeJonghe,P., Martin, J. J , and Van Broeckhoven,C. (1992)Estimationof the sizeof the chromosome17~112 duphcation in Charcot-Marie-Toothneuropathytype la (CMTIA). J. Med.Genet 29,5-l 1. 15. Trask, B , Pinkel, D., and van den Engh, G (1989) The proximity of DNA sequences in interphasecell nucleiiscorrelatedto genomlcdistanceandpermitsorderingof cosmids spanning250 kilobasepairs Genumlcs$710-717. 16. Trask,B. J , Massa,H., Kenwrick, S , andGrtschierJ (1991)Mappingof humanchromosomeXq28 by two-color fluorescencein situ hybridization of DNA sequences to interphasecell nuclei.Am J. Hum Genet.48, 1-15 17. Anderson,C (1993)Genomeshortcutleadsto problems;YAC troublesrun deep;BAC to the future? Scrence259, 1684-1687 18 Van Dekken,H. andBauman,J. G. J (1988) A new apphcatronof znsrtu hybrtdtzatton: detectionof numericalandstructuralchromosome aberrationswith a combinationcentromertc-telomertcDNA probe.Cytogenet.Cell Genet 48, 188,189 19. Pinkel, D , Landegent,J., Collins, C., Fuscoe,J , Segraves,R , Lucas,J., and Gray, J (1988) Fluorescencern srtu hybridization with humanchromosome-specificlibraries detectionof trtsomy 21 andtranslocations of chromosome 4 Proc. Nat1 Acad. Ser., USA t&9138-9142 20 Cremer,T , Ltchter, P , Borden,J., Ward, D C., andManuehdts,L. (1988) Detectionof chromosome aberrattonsm metaphase andinterphasetumorcellsby in situ hybridization using chromosome-specificlibrary probes.Hum. Genet 80,235-246 21. Khnger, K , Landes, G., Shook, D., Harvey, R , Lopez, L , Locke, P , Lerner, T , Osathanondh, R , Leverone,B., Houseal,T., Pavelka,K., andDackowskr,W. (1992)Rapid detectionof chromosome aneuploidies in unculturedamniocytesby usingfluorescencem situ hybridization Am. J Hum.Genet 51, 55-65 22. Lebo,R. V , Anderson,L A , DrMauro,S.,Lynch, E., Hwang,P., andFletterick, R (1990) Rare McArdle diseaselocuspolymorphicsite on llq13 containsCpG sequence,Hum Genet.86, 17-24. 23. Lux, S. E., Tse,W T , Menninger,J C., John,K. M , Hams,P , Shalev,0, Chtlcote,R. R., Marchest,S L., Watkins,P. C , Bennett,V , McIntosh, S., Collms,F S., Francke,U , Ward, D. C., andForget, B G. (1990) Hereditaryspherocytosisassociated with deletion of humanerythrocyte ankyrin geneon chromosome 8 Nature345,736-739
Lebo and Su 24. Lupsky, J R , de Oca-Luna, R M., Slaugenhaupt, S., Pentao, L , Guzzetta, V , Trask, B J., Saucedo-Cardenas, O., Barker, D. F., Killian, J. M., Garcta, C. A., Chakravartr, A., and Patel, P I. (1991) DNA duplicatton assocrated with Charcot-Marie-Tooth disease type 1A Cell 66,219-232. 25 Su, Y., Brooks,D. G., Li, L., Lepercq,I , Trofatter, J. A., Ravetch,J. V., andLebo, R. V. (1993)Myehn proteinzero genemutatedm Charcot-Mane-Toothdiseasetype 1B Proc Natl. Acad Sci. 90,10,856-10,860
26 Lander,E andBotstem,D (1987)Homozygosrtymappinga way to maphumanrecessive traits wrth the DNA of inbredchildren Scrence236, 1567-1570 27 Chakravarti, A and Buetow, K (1985)A strategyfor usmgmultrplelurked markersfor genetrccounseling.Am J Hum Genet 37,984-997 28 Weissenbach, J , Gyapay,B., Drb, C , Vignal, A., Monssette,J., Mrllasseau,P.,Vaysseix, G., andLathrop, M. (1992)A second-generation linkagemapof the humangenome.Nature 359,794-801
29. Francke, U., Ochs, H. D , deMartmvtlle, B., Grancolone,J., Lmdren,V , Dieteche,C , Pagon,R A , Hofker, M H , vanOmmen,G J B , Pearson,P L., andWedgewood,R J (1985) Minor Xp21 chromosomedeletion tn a male assoctatedwith expressronof Duchennemusculardystrophy, chronicgranulomatous disease,retinitis prgmentosa,and McLeod syndrome.Am J Hum Genet 37,25O-267 30 Francke,U., Harper,J. F., Darras,B T , Cowan,J. M , McCabe,E. R B , Kohlk-Schutter, A., Seltzer, W. K., Saito, F , Goto, J., Harpey, J. P., and Wise, J. E. (1987)Congenital adrenalhypoplasra,myopathy,andglycerol kmasedeficiency moleculargeneticevidence for deletions.Am. J Hum. Genet. 40,212-227. 31, Fries, M. H., Lebo,R V , Schonberg,S , Golabi, M., Seltzer,W. K., Gitelman,S. E , and Golbus,M S. (1993)Mental retardationmcarriersof complexglycerol kinasedeficiency Am. J. Med. Genet. 46,363-368
32. Royer-Pokora,B., Kunkel, L M., Monaco,P A, Goff, S C , Newburger,P E., Baehner, R. L., Cole, F. S., Curnutte,J. T., andOrkm, S. H. (1986)Cloningthe genefor the mherited disorderchronic granulomatousdrseaseon the basisof its chromosomallocatron. Cold Spring Harbor Symp LI, 177-183 33 Bodrug,S. E., Holden,J. J., Ray,P.N., andWorton, R. G. (1991)Molecular analysisof Xautosometranslocatronsin femaleswith Duchennemusculardystrophy. EMBO J. 10, 3931-3939. 34 Ott, J. (1985)Analysis ofHuman
Genetzc Lmkage JohnsHopkinsUmverstty Press,Baltrmore,MD, pp. 1-223. 35. HumanGeneMapping 10(1989) Cytogenet. Cell Genet. 51, l-l 147. 36. Genome Data Base includtng Onltne Mendeban Inherrtance m Man, JohnsHopkinsUmversrty, Baltimore,MD. 37 Lebo,R. V , Anderson,L A , Lau, Y -F , Flandermeyer,R., andKan, Y W. (1986)Flow sortinganalysisof normalandabnormalhumangenomesCold Spring Harbor Symp LI, 169-176 38. Wood, S , Schertzer,M., Drabkin, H., Patterson,D , Longmrre,J L., andDeaven,L L (1992)Charactenzatronof a humanchromosome 8 cosmtdlibrary constructedfrom flowsortedchromosomes. Cytogenet. Cell Genet 59,243-247 39. Ludecke,H J., Senger,G , Claussen, U , andHorsthemke, B (1989)Cloningdefinedregions of thehumangenomeby mrcrodrssectron of bandedchromosomes andenzymaticamplification. Nature 338, 348-350. 40. Ludecke,H. J., Senger,G., Claussen.U., and Horsthemke,B (1990) Constructionand characterizationof band-specrfm DNA libraries.Hum. Genet 84,5 12-516 41. Claussen, U., Ludecke,H. J., Senger,G., andHorsthemke,B (1991)Constructionof bandspectftcDNA-librariesby microdtssection of GTG-bandedhumanchromosomes andumversa1enzymaticDNA amplification Bull. de L’ Associatron des Anatom. 75, 133-136
Positional
Cloning
42. Cox, D. R. (1992) Radiatron hybrid mappmg. Cytogenet Cell Genet 59,80-81 43. Chance,P. F., Bard,R. D , O’Connell,P., Lipe, H., Lalouel,J.-M., andLeppert,M. (1990) Geneticlinkageandheterogeneitym type I Charcot-Marie-Toothdisease(heredrtarymotor and sensoryneuropathytype I). Am J Hum Genet 47,915-925. 44. Cohen,D., Chumakov,I., andWeissenbach, J. (1993)A first-generationphysicalmapof the humangenomeNature366,698-701. 45. Burke, D. T. (1990) YAC cloning. options and problems.Genet Anal Tech Appl 7, 94-99. 46 Burke, D. T and Olson, M V. (1991) Preparationof clone librariesin yeast arttfrcialchromosome vectors.Methods Enzymol. 194,251-270. 47. Primer,version0. 5 (1991)WhiteheadInstitute for BiomedtcalResearch 48. Sellerr,L , Hermanson,G G., Eubanks,J. H , andEvans,G. A. (1991)Chromosomalm situ hybridization usingyeastartificial chromosomes. GATA 8(2), 59-66 49. Cawthon,R. M., Andersen,L. B., Buchberg,A M., Xu, G. F., O’Connell,P., Vtskochtl, D., Weiss,R. B., Wallace,M. R., Marchuk, D. A., andCulver, M. (1991)cDNA sequence andgenomtcstructureof EVIZB, a genelying within an mtron of the neurofrbromatosis type I gene.Genomics 9,446-460. 50. Marchuk, D. A., Saulmo,A M., Tavakkol, R , Swaroop,M , Wallace, M R., Anderson, L. B., Mitchell, A. L , Gutmann,D H , Boguskt,M., and Collins, F. S (1991) cDNA cloningof the type I neurofibromatosis gene.completesequence of the NFl geneproduct Genomics 11,93 l-940.
51, Rommens,J M., Iannuzzr, M. C , Kerem,B , Drumm,M. L , Melmer, G , Dean, M , Rozmahel,R., Cole, J L , Kennedy,D., Htdaka,N., Buchwald,M , Rrordan,J. R , TSUI, L.-C., and Collms, F. S. (1989) Identrfrcattonof the cystic frbrosrsgene chromosome walking andJumping Sctence 245,1059-1065 52. Call, K. M., Glaser,T , Ito, C. Y , Buckler, A J., Pelletrer,J., Haber,D A., Rose,E A , Kral, A, Yeger, H , and Lewis, W. H. (1990) Isolation and characterizationof a zmc finger polypeptide geneat the humanchromosome11 Wtlms’ tumor locus Cell 60, 509-520. 53. Uberbacher,E. C andMural, R. J. (1991)Locatingprotein-codingregionsin humanDNA sequences by a multiple sensor-neural network approach.Proc. Natl. Acad Scr USA 88, 11,261-11,265. 54 Boyes,J. andBird, A. (1992)Repression of genesby DNA methylationdependson CpG density andpromoterstrength*evidencefor involvement of a methyl-CpGbinding protein. EMBO J 11, 327-333 55 Elvm, P , Slynn,G., Black, D., Graham,A., Butler, R , Riley, J , Anand, R , andMarkham, A. F. (1990)Isolationof cDNA clonesusingyeastartificial chromosome probesNucleic Acid Res. l&3913-3917.
56 Lovett, M., Kere,J., andHinton, L M. (1991)Direct selection:a methodfor the rsolatron of cDNAs encodedby largegenomicregionsProc Natl. Acad. Ser. USA 88,9628-9632 57 Parimoo, S., Patanjab,S R., Shukla,H., Chaplin, D. D , andWeissman,S M (1991) cDNA selection:Efficient PCR approachfor the selectionof cDNAs encodedin large chromosomalDNA fragmentsProc. Nat1 Acad Set. USA 88,9623-9627 58 Duyk, G M., Kim, S , Myers, R. M , and Cox, D R (1990) Exon trappmg a genetic screento identify candtdatetranscribedsequences m clonedmammaliangenomrcDNA Proc. Natl. Acad. Set. USA 87,8995-8999.
59 Buckler, A. J , Chang,D. D , Graw, S. L., Brook, J D., Haber,D. A., Sharp,P A., and Housman,D. E. (1991)Exon amplification.a strategyto isolatemammaliangenesbasel’ on RNA sphcmg.Proc. Natl. Acad. Scl USA 88,4005-4009 60. Kaufman,D L., Ramesh,V., McClatchey, A. I., Menkes,J. H , andTobm, A J. (1990 Detectionof pomt mutatronsassociated with genetrcdiseases by an exon scanningtech mque.Genomics 8, 656-663.
Lebo and Su 6 1. Grompe, M., Muzny, D. M., and Caskey, C. T. (1989) Scanning detection of mutations m human ormthme transcarbamylase by chemical mismatch cleavage. Proc N&l. Acad. Scz , USA, 86,5888-5892.
62. Lebo, R V., Cunningham,G , Srmons,M J., and Shapiro,L. J. (1990) DefmmgDNA dragnostrctestsappropriatefor standardclmical care Am .? Hum. Genet. 47,583-590 63. Lebo,R V. (1989)Genemappmgstrategiesandflow cytogenetics,in Flow Cytogenetzcs (Gray, J W ed ), Academic,New York, pp 225-242 64 Qiu, W Q , de Bruin, D , Brownstein,B. H , Pearse,R., andRavetch,J V (1990)Organization of the humanandmouselow-affinity FcyR genesduphcatronandrecombmation Science 248,732-735
65 Nreuwenhuijsen,B. W., Chen, K L., Chmault, A. C , Wang, S., Valmiki, V H., Meershoek,E J , van Ommen,G. J. B , and Fischbeck,K H. (1992) A yeast artificial chromosomecontrg spanningthe Charcot-Mane-Toothdiseasetype 1A duphcationregion Hum Molec Genet 1,605-612 66 Patel,P.I., Roa,B B , Welcher,A. A., Schoener-Scott,R ,Trask,B. J., Pentao,L., Sntpes, G J , Garcia,C A , Francke,U , Shooter,E M , Lupsky, J R , andSuter,U (1992)The genefor the peripheralmyelm protein PMP-22is a candtdatefor Charcot-Marie-Tooth diseasetype 1A. Nature Genetzcs 1, 159-165. 67 Timmerman,V., Nehs,E , van Hul, W , Nieuwenhurjsen, B W , Chen,K. L , Wang, S , Valentqn, L J., Bolhms,P A , Zorn, I , Hoogendqk,J E , van denBosch,N , Hensels,G W , Stanton,V P , Housman,D E , Rschbeck,K. H , Ross,D. A , Nicholson,G A , Meershoek,E. J., Dauwerse,H. G , van Ommen,G J B , andBaas,F (1992)The penphera1myelm genePMP-22/GAS-3 is duphcatedin Charcot-Marie-Toothdiseasetype 1A Nature Genetzcs 1, 166-170. 68. Othman,K. B., Cullen,B., Leach,R. J., Hanemann,C0, DeJonghe,P , Raeymaekers, P, vanOmmen,G. J. B., Martin, J. J., Muller, H. W., Vance,J. M., Rschbeck,K H , andvan Broeckhoven,C. (1992)The peripheralmyelin proteingene PMP-221scontainedwithin the Charcot-Marie-Toothdiseasetype 1A duplication.Nature Genetzcs 1, 171-175 69 Matsunamr,N , Smith, B , Ballard, L , Lensch,M W , Robertson,M., Albertsen, H , Hanemann,C. 0 , Muller, H. W , Bird, T D , White, R., andChance,P F. (1992)Penphera1myelin protein-22genemapsm the duplmationm chromosome17~112 associated with Charcot-Mane-Tooth1A Nature Genetzcs 1, 176-179 70. Vaientijn, L. J., Baas,F , Wolterman,R A, HoogendiJk,J. E., van denBosch,N. H A , Zorn, I., Gabreels-Festen, A A. W. M , de Visser,M , andBolhurs,P. A. (1992)Identrcal point mutationsof PMP22 m Trembler-JmouseandCharcot-Mane-Toothtype 1A Nature Genet. 2,288-291.
71 O’Connell, P., Lathrop,G. M., Nakamura,Y , Leppert,M L , Ardmger,R. H., Murray, J L , Lalouel,J.-M., andWhite, R (1989)Twenty-eight loci form acontmuouslmkagemap of markersfor humanchromosome1 Genomzcs 4, 12-20. 72 Kingsmore,S.F.,Watson,M. L , Howard,T A , andSelsm,M F (1989)A 6000kb segment of chromosome1 is conservedm humanand mouse EMBO J 8,4073-4080
CHAPTER 32
Characterization of Constitutive Chromosomes in Humans David
Marker
E Callen
1. Introduction A marker chromosome is one that is morphologically different from any normal chromosome with its origin not being readily discernible by classical cytogenetrc techniques. Marker chromosomes in neoplasra often represent the products of complex rearrangements and will not be discussed in this chapter. From a large series of 377,357 karyotyped amniocentesis specimens m a multicenter survey, an unbiased estimate of the frequency of de ~OVOconstitutional marker chromosomes was 1 in 2500 (I). The overall population frequency will be higher than this since markers identified as i( 18p) or i( 12p), and markers that were familial, were excluded. Since the proportion of familial markers is in the vicinity of 40% (2), the actual population frequency of marker chromosomes is about 1 in 1200. In the clinical cytogenetics laboratory the finding of a marker chromosome m the neonate or at prenatal diagnosis requires detailed cytogenetic study to assessits significance. The usual first step is to karyotype the parents, if the marker is familial and the parents are normal, then the presence of the marker is unlikely to be associated with any phenotypic abnormalities. There have been occasional exceptions where a normal parent is a mosaic for a marker (karyotype 46/47+mar) and has a nonmosatc (all cells 47+mar) abnormal child (for example, patient 8, ref. 3). Whether this is chance ascertainment or attrtbuted to the effects of tissue specific mosaicism is not clear. Another possible origin for a marker chromosome is from 3: 1 meiotic segregation of a parental translocation. If the extra chromosome has no phenotypic effect then it may be inherited for several generations. For example, an accessory small marker chromosome at amniocentesis was found to be a der(15) from a t(9;15)(p24;qll.2), with the translocation being present m the grandparents rather than the parents (4). The normal parent also had the der( 15) as an extra chromosome. For de ~tovo marker chromosomes, the overall rate of major abnormality has been estimated at 13% (I). This will be an underestimate since not all live-born caseshad long term follow-up, and one third of the normal caseswere elective From Edlted
Methods n Molecu/ar Biology, Vol 33 In SW Hybrrdrzatron Protocols by K H A Choo Copynght 0 1994 Humana Press Inc , Tolowa, NJ
439
440
Callen
abortions. A common problem in patients with marker chromosomes is developmental delay, with absent or minor malformations, and these would not be ascertained at termination, and indeed may not be evident at birth. For example, a child born with an accessoryidic( 15) was apparently normal at birth but severe developmental delay was recorded at 16 mo of age (5). Detailed information on prognosis of a particular marker chromosome can only be determined with information on marker origm and structure. Molecular cytogenetics is the technology that can generate this information. Characterization of marker chromosomes by classical cytogenetic procedures allows for a classification on the basis of size, shape, position, and number of centromeres, and the presence of C-banding heterochromatm and of chromosomal satellites associated with the nucleolar organizmg regions. DistamycinA/DAPI stammg is another useful basis for classification. This fluorescence staining procedure is speciftc for the centric heterochromatin of chromosomes 1,9, 15,16, and the long arm heterochromatm of the Y chromosome. The following discussion will be based on an untial grouping of accessory marker chromosomes by presence and absence of satellites and distamycin A/DAPI banding. A variety of molecular techniques have been used to investigate the structure and origin of markers. There will be some discussion of these techniques, but the main emphaseswill be m the use of in situ hybridization. Marker chromosomes can also be found replacing a sex chromosome, that 1s the karyotype has 46 chromosomes, rather than the marker being accessory to the normal chromosome complement. The 46,X,+mar karyotype can be associated with a Turner phenotype and will be discussed separately. 2. The 46,X,+mar Karyotype Patients with Turner syndrome can possessa 46,X,+mar karyotype, frequently in conjunction with a 45,X cell line, with the marker derived from etther the X or Y chromosome. Individuals with dysgenic gonads whom are otherwise phenotypically female are at risk of gonadoblastoma if a Y chromosome is present-the karyotype is usually 46,XY or 45,X/46,XY. Gonadoblastomas also develop in dysgenic gonads associated with structurally abnormal Y chromosomes, and this has allowed mapping of the presumed gene critical for development of this tumor near to the centromere or in the long arm euchromatm of the Y chromosome (6). Therefore, in any Turner patient with a 46,X,+mar cell line, determination of marker origm is Important. A Y chromosome origin of the marker is an mdication for prophalactic removal of the gonads. For small markers that do not possessthe long arm heterochromatin of the Y chromosome conventronal cytogenetic methods are not informative. Inmally, a molecular analysis was seen as the only way to identify the chromosomal origm of these markers. Southern blot analysis of DNA using single copy probes for the short arm of the Y chromosome, and a repeat probe for the major
Constitutional
Marker Chromosomes
441
long arm of the Y chromosome, enabled identification of markers dertved from the Y chromosome (7). Isolatton of Y97, an alphotd repeat probe specific for the Y chromosome (8), provided a sensitive reagent. As a measure of this sensitivity, the probe could detect an admixture of 1% of DNA from a male wrth DNA from a female (9). Southern analysis also provides an accurate procedure for determining precise breakpoints on Y chromosomes by using a variety of mapped single copy probes (IO). For cytogenetic laboratories without accessto molecular techniques, in situ hybridization provides an ideal method for analysis of these markers. Use of metaphase spreads from conventional cytogenetic preparations avoids the necessity for molecular studies, or collection of additional blood from the patient. Initial studies used tritium labeled chromosomes X and Y specific centromeric alphoid probes with detection of signal by autoradiography (II). The nonisotopic in situ hybridization techniques using these probes now provides a simple and rapid procedure for determining the origm of these marker chromosomes (11-16) (Fig. 1). In some casesthe small marker chromosomes are rings, as shown by an absence of hybridization to a probe specific for the telomere (15). It has been suggested that additional phenotypic abnormalities found in a Turner syndrome patient with a small ring X chromosome are the result of lack of inactivation of the ring, and thus partial disomy for a portion of the X chromosome (16). Similar partial disomy of active X chromosome material may also account for the abnormal phenotype in a 46,XY/47,XY,+mar patient, where the mar was small and chromosome X-derived (17). The Y chromosome location of the critical region involved in the development of gonadoblastomas is thought to map near the centromere or be on the long arm euchromatin (6). It is possible that some small Y chromosome markers may be deleted for this critical region and thus be of no clinical significance. However, until this region has been cloned, and suitable DNA probes to it are available, it is appropriate to detect the Y chromosome by use of the specific alphoid probe and recommend prophalactic removal of gonads whenever a Y chromosome derivative is present. 3. Distamycin ALDAPI Positive Markers with Satellites It is possible to determine that bisatellited markers originate from chromosome 15 by classical cytogenetic procedures owing to the specific chromosome repeat present on the short arm. In 1979, Wisniewski et al. (18) reviewed 24 cases, and used distamycin A/DAPI banding to demonstrate the chromosome 15 origin. Those patients were ascertamed m institutions and there was a consistent phenotype of developmental delay, setzure disorder, hypotonia, and strabismus, without other major phenotypic abnormalities. Markers in these patients contained two chromosome 15 short arms and centromeres, with a portion of long arm euchromatin in between. These were mi-
442
Callen
B Fig. 1. Marker chromosomes derived from X and Y chromosomes in 46,X,+mar karyotype. (A) Patient with Turner syndrome and 45$/46,X,+mar karyotype. Marker identified as chromosome X derived by alphoid repeat probe. Panel on left, G-banded partial metaphase. Panel on right, in situ hybridization using biotin labeled, chromosome X specific alphoid probe TRX.
Constitutional
Marker Chromosomes
443
tially termed mv dup (15~) but idic( 15) has been suggested as a more appropriate terminology (19). Since these original reports, a number of markers derived from chromosome 15 have been identified at prenatal diagnosis, a source of unbiased ascertainment. It is evident that by far the most frequent class of Idic( 15)s are small bisatellited, monocentric, or dicentric chromosomes which have an absence, or only a very small region, of interstitial euchromatin. These markers are often familial and seem to be harmless. There are exceptions however, for example a de novo submetacentric ldic(l5) associated with growth retardation and mild dysmorphlsm has been reported (20), whether the phenotype ISassoclated with the presence of the marker or due to ascertainment bias 1simpossible to evaluate. Use of fluorescence in situ hybridization (FISH) with a chromosome specific centromerlc alphoid repeat probe has allowed confirmation of the chromosome 15 origin of these markers (3,21,22) (Fig. 2). It has been estimated that about half of all satellited markers are derived from chromosome 15 (23). The phenotype associated with the presence of these derived chromosome 15 markers 1ssomewhat unpredictable. This may arise from variation m the genetic content of the euchromatin, the occurrence of marker mosalclsm, and the known effect of imprinting on this region of the chromosome (24). As molecular cloning of the proximal portion of 15q progresses, probes wdl become avallable to further evaluate the genetlc content of these markers. Accessory chromosome 15 markers have also been reported m Prader-Will1 syndrome (25). In a recent series of 39 patients (26) and 29 patients (27) whom fulfilled the diagnostic crlterla for the syndrome there were no patients reported with an accessory chromosome. However, in another reported series of 27 patients (28), one had a karyotype with an extra marker chromosome derived from chromosome 15. There was no cytogenetic or molecular deletion detected, and the parental origin of the chromosomes 15 could not be determined. Thus a possible explanation for the presence of Prader-Will1 in this patient is heterodlsomy or lsodisomy for a maternal chromosome 15, with the presence of the marker being of no clmical significance. The association of an accessory derived chromosome 15 with this syndrome is unconvincmg. It would be useful to re-evaluate the earlier reported patients based on the present clmlcal diagnostic criteria, and then to examine the possibility of parental orlgm effects for chromosome 15 m any patients with a confirmed diagnosis Signal is amplified and detected by an antibody/peroxldase system with gold/silver amphflcatlon (48) Large arrow, marker, small arrow, X chromosome (B) Prenatal dlagnosls of marker identified as derived Y chromosome Metaphases are from cultured ammocytes. Left panel, Gbanded partial metaphase, right panel, marker identlfled by chromosome Y speclflc alphold probe, pPD97
Callen
Fig. 2. DistamycitMDAPI, satellited marker chromosomes identified as idic( 15). (A) Normal patient with marker identified as idic( 15). Left panel, partial G-banded metaphase showing bisatellited marker. Right panel, in situ hybridization (see Fig. 1 for techniques) with alphoid probe pTRA20 specific for chromosome 15. The marker is indicated by the large arrow, the normal chromosome 15 by the small arrow, patient 1 in (3). (B) Larger acrocentric marker
Constitutional
Marker
Chromosomes
445
4. Satellited Markers That Are Distamycin ALDAPI Negative These markers are derived from the acrocentric chromosomes other than 15, I.e., chromosomes 13, 14, 21, or 22. These may be either monosatellited or bisatellited and either monocentric or dicentric. Unfortunately, the similarity of the alphoid pericentric repeats on these chromosomes does not allow isolation of alphoid probes which can easily distinguish between chromosomes 1321 or between chromosomes 14-22. Other strategies can be used, for example the probe pHOM48 (29), when used with appropriate in situ hybridization conditions, is usually specific for chromosome 22 and probe L1.26 (30), when used at conditions of low stringency, detects chromosomes 13, 14, 18, and 21, but not 22. This allows marker origin from chromosomes 14 or 22 to be distmguished. An alternative approach is by FISH with chromosome specific libraries as the probe (chromosome painting). This procedure has been used to determine the origin of two markers derived from chromosome 21 (17). Small satellited markers have now been characterized by in situ hybridization and reported for chromosomes 13, 21, (or either 13 or 21), 14, and 22 (or either 14 or 22) (3,27,21,23,31,32) (Fig. 3). With respect to clmical outcome, the critical factor is the presence of long arm euchromatm m a marker chromosome. This is exemplified by markers derived from chromosome 22, where the small bisatellited markers are in persons with a normal phenotype (23,31), whereas the larger markers derived from this chromosome are associated with the cat eye syndrome (33). These markers are often acrocentric, dicentric with one suppressed centromere, and have a similar structure to the larger of the idic( 15) chromosomes. Analysis by in situ hybridization, and Southern blot utilismg single copy probes located in the proximal portion of the long arm of chromosome 22, has allowed a more detailed molecular characterization of the regions mvolved (33,341. Presumably the other acrocentric chromosomes will also form similar tdic chromosomes containing appreciable euchromatin, although no recognized pattern of abnormalities have been associated with such markers from chromosome 13, 14, or 21. It IS possible that these will be recognized when further patients are characterized by FISH studies. A frequent origin of bisatelhted marker chromosomes may be expected as a consequence of the formation of a monocentric Robertsoman translocation. A patient has been described (35) whose karyotype mcluded both a bisatelbted marker and a Robertsonian translocation, a t(14;21), and the origin of the identified as idlc(l5). Patients with karyotype 46,XY/47,XY+mar and with developmental delay and behavior problems, patlent 6 m (3). Left panel, solid stamed partial metaphase showing acrocentric structure, right panel, in situ hybridization with probe pTRA20 Note two regions of hybridlzatlon on the marker (large arrow). The two normal chromosomes 15 are indicated by the small arrow
446
Callen
Fig. 3. Identification of satellited marker chromosome. Marker derived from chromosome 22 detected at prenatal diagnosis, patient 15 (3). The pregnancy was terminated, autopsy not performed. Left panel, solid stained partial metaphase showing marker (arrowed). Right panel, after in situ hybridization with alphoid repeat probe alphaXT that detects both chromosomes 14 and 22. Subsequent hybridization with probe pHOM48 was negative showing origin from chromosome 14. Techniques of in situ hybridization as in Fig. 1.
marker was determined. The marker was in fact a derived chromosome 15, unexpectantly demonstrating an independent origin of the two abnormalities. Since the marker and the t(14;21) were not shown to be de nova, it is unlikely they were generated in the same cell. This example does demonstrate the need for careful evaluation of such interesting abnormalities. Evidence suggeststhe existence of mechanisms of formation other than as a byproduct of Robertsonian translocations. Satellited markers are most frequently derived from chromosome 15, whereas Robertsonian translocations involving chromosome 15 are relatively rare. No satellited markers derived from more than one acrocentric chromosome have been reported. This evidence, together with the observation of idic markers suggeststhat they are generated from some event involving homologous chromosomes. Individuals with multiple small ring chromosomes have been reported (see Section 5.), but no examples of both ring and satellited markers occurring together in the same patient have been reported, suggesting an independent origin for these two groups of marker chromosomes.
Constitutional
Marker Chromosomes
447
5. Supernumerary, Autosomal Nonsatellited Markers 5.1. Markers That Are Isochromosomes Small metacentric markers can be isochromosomes of the short arms of the submetacentric chromosomes. Determining the chromosomal ongin by classlcal cytogenetics can be considered tentative because of their small size and lack of definitive banding pattern. Therefore confirmation is necessary by other studies, for example gene dosage or in situ hybridlzatlon studies. In situ studies that only determine the origin are insufficient, since other structural rearrangements may generate a metacentnc chromosome and therefore resemble an isochromosome. Examples of such rearrangements are an interstitial deletion of the long arm, or an unbalanced de nova translocation. A marker described as an 1(18~) has been ascertained a number of times and has been associated with a specific syndrome (3637). In situ hybridization studies using an alphold repeat probe specific for the chromosome 18 centromere has been used to determine the origin (32,37,38) (Fig. 4). Further confirmation 1s required to demonstrate that the marker is an actual i( 18~) and contains two short arms. In situ hybridization with a smgle copy probe located near the short arm telomere has been used for this purpose (37,39,40). The probes in these studies were tritium labeled, and the results demonstrate the difficulties with autoradiography owing to background noise. Ideally, an 1(18~) can be confirmed by scoring doubly-labeled markers, but when a tritlum labeled probe is used It is necessary to allow for those signals owing to background noise. Alternative strategies can be used, such as examining the ratio of signal on the marker to that on the normal chromosome 18 homologs (37). The procedures now available for FISH with smgle copy probes are associated with a very low background signal. Thus identification of the I( 18~) by the presence of double label will be a simple procedure. In addition to the i( 18p), lsochromosomes for the short arms of chromosomes 5, 8,9, and 12 have been reported. Several patients with an i(9p) have been dlagnosed by cytogenetics and m one patient this diagnosis was confirmed by the abnormal dosage of the GALT gene, which maps to the short arm of this chromosome (4Z). Three patients mosaicfor i(8p) have also been reported (42,43,43u) but confirmation by molecular cytogeneticshas not beendone, A more frequent isochromosome 1sthe I( 12~) that 1sassociatedwith the Pallister-Iolhan syndrome and 1s restricted to fibroblast cells and only found transiently in fetal blood (44) The origin has been confirmed by FISH utilismg specific chromosome 12 centromeric alphoid repeat probes (44,45). Recently, an i(5p) has been reported and confirmed with similar FISH studies(46). In a remarkable similarity to the I( 12p), the i(5p) is restricted to fibroblast cultures and is absent from lymphocytes. In any chnical study of a dysmorphlc child where chromosome abnormality 1sstrongly suspected, and lymphocyte chromosome studies are normal, fibroblast cultures could be karyotyped to look for a tissue-restncted chromosome abnormality.
448
Callen
Fig. 4. Marker chromosome identified as i(18p). Left panel, G-banded partial metaphase. Right panel, after in situ hybridization with alphoid repeat probe L1.84. The normal chromosomes 18 are indicated by the small arrows and the i( 18p) by the large arrow (37).
FISH provides a rapid technique for identifying the origin of presumptive isochromosomes. This is essential since a diagnosis cannot be based purely on classical cytogenetics. Further confirmation should then involve FISH with a probe located on the distal short arm to confirm that the marker is doublelabeled, as expected from an isochromosome. This eliminates a possible origin from a translocation or long arm deletion. The future development of chromosomal painting probes for single chromosome arms, e.g., 18p, would provide an alternative, and more direct approach. All marker chromosomes which are autosomal isochromosomes are associated with major clinical problems, developmental delay, and malformations, as would be expected from the presence of four doses of short arm euchromatin. 5.2. Small
Ring-Like
Markers
These markers are often quite small, being less than half the size of chromosome 21, and have been called “rings” or “ring-like.” The ring structure is supported by the occasional appearance of markers appearing as doublets, presumably from interlocking rings generated at cell division. Further confirmation of their ring structure is from FISH studies using a probe for the specific
Constitutional
Marker Chromosomes
449
telomere repeat, There 1san absence of telomere signal on these small markers (47, and unpublished data of the author). A small proportion of these rmg chromosomes are distamycin A/DAPI positlve and would therefore be expected to be derived from chromosomes 1,9,15, or 16. This is indeed found, with markers being shown to be derived from each of these chromosomes, Table 1, Using in situ hybridization, such markers are posltlve with probes specific for either the alphoid or the major satellite DNA of that chromosome. Since these markers do not seem to contain euchromatin they would be expected to be harmless. Those that have been reported have a normal phenotype and are often familial (3,48), although only small numbers have been reported. Those small ring markers that are dlstamycin A/DAPI negative could be derived from any of the autosomes, and this 1sfound to occur. A compilation of the reported cases1sgiven in Table 1 and examples are presented in Ag. 5. For each marker wzsm hybridization with centromeric repeat probes provides confirmation of origin. All chromosomes except 5,7, and 10 are represented. Markers derived from chromosomes 13 or 21 and 14 or 22 cannot be distinguished using alphold repeat probes. Clinically, these rmg chromosomes are of some slgmficance since of 17 patients evaluated approx two-thirds were phenotypltally abnormal, although the extent to which ascertainment bias contributed to this is not clear. It has been suggested that small rmg chromosomes of the same origin may show similar chmcal features, and thus allow new chromosomal syndromes to be delineated (49). Additional patients where there has been documentation of both marker origin and clinical features will be necessary before this can be confirmed. Establishing the origin of a ring marker chromosome would appear to present a tedious undertaking, since the marker can potentially be derived from any chromosome. Thus it may be necessary to sequentially use each of the chromosome specific alphoid probes until the marker is identified. An alternative approach 1s to utilize the shared similarity in alphoid sequences from different chromosomes. This is demonstrated by the observation that an alphoid probe that 1s specific for a particular chromosome will often detect a subset of the chromosome complement if there is a change in the hybridization conditions. This change in conditions requires a lowering of the stringency of hybridization and this can be achieved by reducing the concentration of formamide, together with an increase m the concentration of SSC, m the hybridlzation mix (32). Alternatively, this can be achieved by lowering the stringency of posthybrldizatlon wash conditions, from 65°C to 42°C (3), or an increase in the concentration of probe used in the hybridization, It can be difficult to achieve a consistent pattern of hybridization from experiment to experiment. Differences in chromosome preparations, for example
Callen
450 Table 1 Supernumerary, Autosomal Nonsatellited Markers Where Orlgm Has Been Determined Chrom 1 1 1 2 3 3 3 4 4 4 6 8 8 9 9 9 11 11 12 12 12 12 12 13or21 13 or 21 13or21 13 or 21 14 14 14 14 or 22 14 or 22 15 15 16 16 16 17 18 18 19 19 20
DA/DAPI DA/DAPI
Comments
Phenotype
positive positive
NAn NRb Abnormal NRb Abnormal NA” Normal Normal NAa Abnormal Abnormal NRb NRb Normal Normal Abnormal NAG Abnormal NA”
2 markers (X,6) 4 markers (X,8,14,15, DA/DAPI positwe DA/DAPI positive
or 22)
Reference 48 22 49 22 49 17 17 31 31 3 49 22 22 48 3
50
51 17 49 49 2 markers (12,13, or 21) NRb 22 2 markers (12,13, or 21) NRb 22 Normal 31 Normal 3 2 markers (18,13, or 21) NRb 22 2 markers (12,13, or 21) NRb 22 2 markers (12,13, or 21) NRb 22 NAa 49 Abnormal 31 NAa 31 4 markers (X,8,14,15, or 22) NRb 22 NRb 22 DA/DAPI positive Normal 3 4 markers (X,8,14,15, or 22) NRb 22 DA/DAPI posItwe Normal 48 Normal 31 NAa 49 del( 17)(cenq 11 2),+r Abnormal 47 Normal 49 2 markers (13,18, or 21) NRb 22 Abnormal 31 Abnormal 31 Abnormal 49 “NA, not accessable Phenotype effect of marker chromosome could not be adequately assessed bNR, Phenotype not reported
Constitutional
Marker Chromosomes
451
whether originating from fibroblast cultures or lymphocyte cultures, will result m variation in hybridization. This variation can often be observed wtthm dtfferent regtons of a slide. However, withm any one metaphase the hybridization of the marker can be readily interpreted since hybridization to the normal chromosome homologs act as controls for that particular metaphase. Allowing alphoid probes to detect a subset of the chromosomes by alteration in the stringency of hybridization has been used as a basis for a simpler strategy for the classtficatton of these marker chromosomes (32). The mittal stepinvolves three hybridizations, eachwith a different alphoid probe at low stringency. Choice of probes allows grouping of chromosomes mto three different alphoid suprafamrlies. Each of these suprafamilies can then be further subdivided by increasing the stringency of the hybridization to the probe to which the marker was posittve at low stringency. Finally, mdrvidual alphold probes can be used at high stringency to identify the origin. Thts procedure enables the origin of any marker to be determmed with relatively few sequential hybridizations. The origin of these small ring chromosomes is mtriguing. A small rmg has been described that was derived from chromosome 17 and that coexists with a deletion of the complementary proximal portion of the long arm of this chromosome (47). The marker has apparently been generated by misdtviston of the centromere in conjunction with a more distal breakage and reunion event. Neurofibromatosis was present m this patient without any other major abnormalities, suggesting that there was no significant loss of genettc matenal but with disruption or inactivation of the NFI gene. Small rmg chromosomes are found that are either distamycinA/DAPI positive or negative, but derived from the same chromosome (e.g., chromosome 1,9, 16, Table 1). Molecular cloning of a small marker derived from chromosome 9 showed that DNA was only derived from the proximal short arm of the originating chromosome (50). These observations support the concept of two events, one of which mvolves rmsdivision of the centromere and the other involving a breakage and reunion event that can occur either in the long arm or m the short arm (49). If this is a common mechanism of origin then markers from each chromosome will be composed of two groups, those that contain genetic material derived from the short arm only and those derived from the long arm only. A further interesting group are patients wtth multiple small ring chromosomes, Table 1. Since these pattents do not have other karyotypic abnormalities, for example translocations or inversions, there must be a specific mechanism for generating these markers. These small marker chromosomes provide a defined source of DNA that includes the centromere, and depending on the choice of marker, adjacent unique DNA. Cloning of a marker chromosome has been achieved by fluorescence activated sorting and subsequent cloning of the sorted maternal (50). This cloned DNA was used for wz situ hybridization to metaphase chromosomes to
452
A
Constitutional
Marker Chromosomes
C Fig. 5. Identification of origin of small ring markers. (A) DistamycinA/DAPI positive small ring chromosome derived from chromosome 9. This marker was diagnosed prenatally and the child is notmal (patient 2 1&j). Left panel, G-banded partial metaphase; right panel, after in situ hybridization (see Fig. 1 for techniques) with alphoid probe RR17. Large arrow indicates the marker, small anows indicate the normal chromosomes 9. (II) Small ring chromosome derived from chromosome 18 in a normal patient (Case 9 [49j). Left panel, G-banded partial metaphase; right panel after in situ hybridization with alphoid probe L1.84. Large arrows indicate the marker, small arrows the normal chromosome 18s. (C) Small ring chromosome derived from chromosomes 13 or 21 in normal patient (patient 6 [49j). Left panel, solid-stained partial metaphase; right panel after in sihc hybridization with probe L1.26 which detects both chromosomes 13and21.
demonstrate that the marker was derived from chromosome 9. Recently, the procedure of chromosome microdissection has been dramatically simplified by use of PCR primers that can directly amplify DNA from dissected chromatin (52). Previously it was necessary to perform DNA extraction, restriction, and ligation in microdroplets, an exacting task. This new procedure allows rapid preparation of probes suitable for FISH or library construction from microdissected material. This will be particularly suitable for molecular studies of marker chromosomes. 5. Conclusion Small marker chromosomes are a diagnostic dilemma when ascertained at prenatal diagnosis or in the newborn since accurate prognostic data cannot be
454
Callen
provided. In situ hybridtzatton provides the methodology for a clmtcal cytogenetics laboratory to determine the ortgm of these marker chromosomes. Since chromosome specific pericentric repeat probes are now commercially avatlable, FISH can be successfully implemented without the necessity of accessto molecular genetic facilities and techniques. The advantage of the FISH approach is the ability to use standard metaphase spreads avoiding any further specimens from the patient. If a fluorescent mtcroscope is not available then nonfluorescent nonisotopic techniques are available. There will need to be substantial numbers of additional patients with their marker chromosomes documented before accurate prognosttc mformation can be obtained. Such studies require both detailed molecular cytogenettc characterization of the markers and detailed clmical studies. An unbiased prospective study using ascertainment at prenatal diagnosis is unlikely to provide the clmical detail required. If euchromatin is present in a supernumerary marker chromosome termination of the pregnancy is likely, and the typical subtle malformattons and developmental delay associated with marker chromosomes are unlikely to manifest and be detected at autopsy. Therefore, the most valuable source of material, although subject to ascertainment bias, will be from patients referred with clinical problems. This is likely to be a rewarding area of research with the potential of establishing new chromosomal syndromes. A more detailed understanding of the structure of marker chromosomes will require FISH studies using probes that have good cytogenetic localization. Such probes are now becoming available as the Human Genome Project continues apace. Alternative strategies are to prepare DNA libraries from the marker chromosome, a technique that has now become a simpler procedure with the refinement of PCR procedures (52). There are little data that relate to the mechanism of origin of marker chromosomes. There 1sobviously instability associated with the centromere and the surroundmg tracts of tandem repeats,but how this contributes to the generation of the small marker chromosomes is unknown. This may be elucidated with detailed molecular characterization of marker chromosomes. Marker chromosomes present considerable challengesto the cytogeneticist,and the new arsenal of molecular cytogenetics that is now available, provides the methods for then analysts. Acknowledgments I would like to thank John Crolla, Rma Plattner, Catherine Palmer, and Wayne Stanely for generously commumcatmg results prior to publication. I thank Grant Sutherland and Eric Haan for their comments and discussions and Helen Eyre for her technical expertise. References 1 Warburton, D (1991) De novo balanced chromosome rearrangements and extra marker chromosomes identified at prenatal diagnosis climcal slgrnflcance and distribution of breakpoints Am .I Hum. Genet. 49,995-1013
Constitutional
Marker Chromosomes
455
2. Sachs, E. S., Van Hemel, J. 0 , Den Hollander, J. C., and Jahoda, M. G. J (1987) Marker chromosomes m a series of 10 000 prenatal diagnoses. Cytogenettc and follow-up studies. Prenat
Diagn
7,81-89
3. Callen, D. F., Eyre, H , Yip, M.-Y , Freemantle,J , and Haan,E. A (1992) Molecular cytogenetic and clinical studiesof 42 patientswith markerchromosomesAm J. Med Genet 43,709-715.
4 Winsor, E J. T and Van Allen, M. I. (1989) Famrhalmarker chromosomedue to 3.1 disJunctionof t(9;15) in a grandparent.Prenat. Diagn. 9,851-855 5. Miny, P., Basaran,S , Kuwertz, E., Holzgreve,W , andPawlowttzkt, I -H (1986)Inv dup (15). prenataldiagnosis andpostnatalfollow-up.Prenat. Dlagn. 6,303-306. 6. Page, D. C. (1987) Hypothesis a Y-chromosomalgene causesgonadoblastomain dysgeneticgonadsDevelopment 101, Suppl. 151-155. 7. Ostrer, H., Henderson,A L., and Stringer,L. C (1987) Charactertzatronof Y chromosomaldeoxyribonucleicacid fragmentsandtranslocattonsby Southernblot analysts.J Pedlatr. 111,678-683
8 Wolfe, J , Darling, S., Erickson, R., Craig, I., Buckle, V , Rigby, P , Willard, H , and Goodfellow,P. (1985)Isolattonandcharacterizationof analpholdcentromericrepeatfamily from the humanY chromosomeJ. Mol Jhol 182,477-485 9. Tho, S. P. T., Behzadlan,A , Byrd, J. R., and McDonough,P G (1988)Useof humanasatellitedeoxyribonucleicacid to detectY-specific centromertcsequences. Am J Obstet Gynecol 159, 1553-1557 10. Pohlschmidt,M., Rappold,G., Krause,M., Ahlert, D , Hosenfeld,D , and Wetssenbach, J , Gal, A (1991) Ring Y chromosome:molecularcharacterizationby DNA probes. Cytogenet
Cell Genet. 56,65-68
11. Crolla, J A. andLlerenaJr , J C (1988)A mosaic45,X/46,X,r(?) karyotype investigated with X and Y centromere-specific probesusinga nonautoradtographm rn sttu hybrrdlzanon technique.Hum Genet. 81,81-84. 12. Koch, J , Kolvraa, S., Hobolt, N , Petersen,G B , Wrllard, H F , Waye, J S , Gregersen, N., andBolund,L. (1990)A caseof 46,XX,r(X)(plql) dragnosed by m situ hybndrzation. Clm. Genet. 37,2 16-220 13 Jacobs,P A., Betts,P. R , Cockwell,A E., Crolla, J A , MacKenzie, M J , Robinson,D 0 , andYoumgs,S.A. (1990)A cytogeneticandmolecularreappraisalof a seriesof patients with Turner’ssyndromeAnn. Hum Genet 54,209-223. 14. Lin, C. C., Meyne, J., Sast,R., Bowen,P., Unger,T , Tamaka,T., Hadro,T. A, and Hoo, J J (1990) Determiningthe originsandthe structuralaberrattonsof smallmarkerchromosomes in two casesof 45,X/46,X,+mar by useof chromosome-specific DNA probes Am. J. Med. Genet 37,71-78.
15 Johnson,V. P., McDonough,P.G., Cheung,S W., andSun, L. (1991)Sexchromosome marker:clnucal stgmfrcanceandDNA characterizationAm. J Med. Genet 39,97-101 16 Lmdgren,V , Chen,C , Bryke, C R., Lmhter,P , Page,D C , andYang-Feng,T L. (1992) Cytogenetlcandmolecularcharacterizationof markerchromosomes in patientswith mosaic45,X karyotypes Hum. Genet. 88,393-398 17 Rauch,A., Pfeiffer, R A , Trautmann,U., Ltehr, T , Rott, H. D , andUlmer, R. (1992)A study of ten small supernumerary(marker)chromosomes nlentrfiedby fluorescencem situ hybrrdrzation(FISH). Clm. Genet 42,84-90. 18. Wisniewski,L , Hassold,T., Heffelfinger, J , and Higgins,J. V (1979)Cytogeneticand clinical studiesin five casesof inv dup(15) Hum. Genet. 50,259-270 19 Schmzel,A (1990)Letter to theeditor:autisticdrsorderandadditionalinv dup(l5)(pter + q13) chromosomeAm. J. Med. Genet 35,447 20. Wrsniewskt,L. P andDoherty,R A (1985)Supernumerary microchromosomes identifiedas invertedduplicationsof chromosome 15:a reportof threecases. Hum Genet 69,161-163
21 Bartsch, 0. and Schwmger, E (1991) A simplified protocol for fluorescence in srtu hybrrdization with repetrttve DNA probes and rts use in climcal cytogenetics. Clm Genet. 40, 47-56. 22 Plattner, R., Heerema, N A., Patil, S. R , Howard-Peebles, P N , and Palmer, C G. (1991) Characterizatron of seven DA/DAPI-posrtrve brsatellited marker chromosomes by rn situ hybridization. Hum Genet. 87,290-296 23. Stetten, G , Blakemore, K. J , Courter, A M , Goss, C A , and Jabs, E. W (1992) Prenatal identification of small mosaic markers of drfferent chromosomal origins. Prenat Duzgn 12,83-91.
24 Dahoun-Hadorn,S.andDelozier-Blanchet,C. (1990)Reflectronson smallsupernumerary (marker) chromosomes: could rmprmtmgand rsodisomyplay a role m the phenotyptc expressionof hyperdrplordy?Ann GbCt 33, 241,242 25. Ledbetter, D. H., Mascarello,J. T , Rrccardr,V M , Harper,V D , Arrhart, S D., and Strobel, R. J. (1982) Chromosome15 abnormahtiesand the Prader-Wrlh syndrome a follow-up report of 40 cases.Am J Hum Genet.34, 278-285. 26. Butler, M. G., Meaney,F. J., andPalmer,C G. (1986)Clinical andcytogenetrcsurvey of 39 indrvrdualswith Prader-Labhart-Wrlhsyndrome.Am. J. Med. Genet.23,793-809. 27. Robinson,W. P., Bottani, A , Yagang, X., Balakrrshman,J., Binkert, F., Machler, M , Prader,A , andSchmzel,A (1991)Molecular,cytogenetic,andchmcalinvestrgationsof Prader-Wrlli syndromepatientsAm. J Hum Genet.49, 1219-1234 28 Trent, R J , Volpato, F., Smith,A , Lmdeman,R., Wong, M.-K, Warne,G., andHaan,E (1991) Molecular andcytogeneticstudresof the Prader-Will1syndromeJ Med. Genet 28,649-654.
29 Metzdorf, R., Gottert, E , andBlur, N (1988) A novel centromericrepetitive DNA from humanchromosome 22 Chromosoma (Berl) 97, 154-158 30. Devrlee,P., Cremer,T., Slagboom,P., Bakker,E., Scholl,H. P., Hager,H. D., Stevenson, A F. G., Cornehsse, C. J., andPearson,P. L. (1986)Two subsets of humanalphordrepetrtive DNA showdrstmctpreferentiallocalizationin thepericentrrcregionsof chromosomes 13, 18,and 21 Cytogenet.Cell Genet 41,193-201 31 Crolla, J A , Dennis,N R , andJacobs,P A (1992)A nonisotoprcin situ hybridizatron study of the chromosomalorigin of 15 supernumerarymarkerchromosomes in man.J Med Genet 29,699-703 32 Plattner,R , Heerema,N A , Yurov, Y B , andPalmer,C G (1993)Efficient identrfrcation of markerchromosomes m twenty-sevenpatientsby stepwisehybrrdrzationwith alphasatelliteDNA probes.Hum Genet.91, 131-140 33 McDermid, H E , Duncan,A M V., Brasch,K R , Holden,J J A , Magems,E., Sheehy, R., Burn, J , Kardon, N , Noel, B , Schmzel,A., Teshrma,I., and Whrte, B N (1986) Characterrzatronof the supernumerarychromosomem cat eye syndrome.Science232, 646-648 34. Magenis,R. E., Sheehy,R. R., Brown, M. G., McDermrd,H. E , Whrte, B. N , Zonana,J ,
andWeleber,R (1988)Parentalorigin of the extra chromosome m the cat eyesyndrome* evidencefrom heteromorphism andw situ hybridizatronanalystsAm. J. Med Genet 29, 9-19 35. Heppell-Parton,A. C. andWaters,J. J (1991) Robertsoman translocationand an extra mrcrochromosome Independent orrgmidentifiedby m situ hybridrzatron.Clrn Genet 39, 93-96 36. Rivera, H , Mtiller, M., Hernandez,A., Enriquez-Guerra,M. A,, Arreola, R., andCant&J. M. (1984)Tetrasomy18~:a drstmctivesyndromeAnn. G&t 27, 187-l 89 37 Callen, D F , Freemantle,C. J., Rmgenbergs, M L , Baker, E , Eyre, H J , Romain,D , andHaan,E. A. (1990)The rsochromosome 18psyndrome:confirmationof cytogenetrc diagnosisin runecasesby m situ hybridrzatron.Am J Hum Genet 47,493-498
Constitutional
Marker Chromosomes
38 Blennow, E and Nielsen, K B (1991) Molecular identtfmatton of a small supernumerary marker chromosome by in situ hybridization* diagnoses of an isochromosome 18p with probeL1.84. Clan.Genet 39,429-433 39. Mattei, M G., Phihp,N., Passage, E., Moisan,J. P., Mandel,J. L., andMattei, J. F. (1985) DNA probelocalizatton at 18~113band by rn srtu hybndtzatton andtdentlfrcation of a smallsupernumerary chromosome. Hum. Genet. 69,268-27 1. 40. Park, V. M., Gustashaw,K M , Btlenker,R. M., andGolden,W L (1991)Dragnostsof tetrasomy18p usingm situ hybridtzation of a DNA probeto metaphase chromosomes. Am. J. Med Genet. 41,180-183.
41. Balestrazzi,P., Croci, G , Frasst,C , Francht,F , andGiovannelli,G. (1983)Tetrasomy9p confirmedby GALT J Med. Genet. 20,396-399. 42. Kristoffersson,U , Lagergren,J., Heim,S., andMandahl,N (1988)Four copresof 8p in a mentally retardedboy with the mosaickaryotype 47,XY,+i(8p)/46,XY Clan. Genet. 34, 201-203. 43 Fisher,A M , Barber,J. C. K , Crolla, J A , Lestas,A N , Jennings,I , andDenms,N. R. (1993) Mosaic tetrasomy8p. Molecular cytogenetic confirmation andmeasurement of glutathionereductaseandtissueplasminogen activator levels Am J Med. Genet 47, 100-105 44 Speleman,F., Leroy, J. G , Van Roy, N., De Paepe,A., SutJkerbutjk,R., Brunner, H , LooiJenga,L., Verschraegen-Spae, M.-R , andOrye, E (1991)Palhster-Ktlhansyndrome Characterizationof the tsochromosome 12pby fluorescentin situ hybrtdtzatton Am. J Med Genet. 41,381-387
45 Reeser,S.L T andWenger,S. L. (1992)Fatlureof PHA-stimulatedt(12p) lymphocytes to divide m Palhster-KtlhansyndromeAm. J. Med. Genet. 42,815-819. 46. Stanley, W. S., Powell, C. M , Devme, G C , Ellmgham,T., Samango-Sprouse, C. A, Vaught, D. R., Murphy, B. A , andRosenbaum, K. N. (1993)Mosaic5p tetrasomyAm. J. Human Genet. 45774-776
47. Andersen,L. B., Tommerup,N , andKoch, J. (1990)Formationof a muuchromosome by exctstonof the proxtmal regionof 17qin a pattent wtth von Recklinghausen neurofrbromatosisCytogenet. Cell Genet. 53,206-210. 48. Callen, D F., Ringenbergs,M. L , Fowler, J. C S , Freemantle,C J., and Haan,E A (1990) Small markerchromosomes m man:ortgm from pertcentric heterochromatmof chromosomes 1,9, and 16 .I. Med. Genet. 27, 155-159 49. Callen,D F., Eyre, H J , Rmgenbergs, M. L., Freemantle,C. J , Woodroffe, P , andHaan, E. A (1991) Chromosomal orrgmof smallrmg markerchromosomes in man characterization by moleculargenetics.Am. J. Hum. Genet. 48,769-782. 50. Raimondt,E., Ferretti, L., Young, B. D., Sgaramella,V., and De Carh, L (1991) The origin of a morphologtcallyunidentifiablehumansupernumerary mmrchromosome traced throughsorting,molecularclonmg,andin srtu hybridtzatton J Med. Genet 28,92-96. 51 Haaf, T., Summer, A. T., Kohler, J., Wtllard, H. F , and Schmtd, M (1992) A mtcrochromosome dertved from chromosome11m a patientwtth the CRESTsyndrome of scleroderma.Cytogenet Cell Genet 60, 12-17 52 Meltzer, P, S., Guan, X.-Y, Burgess,A., and Trent, J. M (1992) Raptdgenerationof region specific probesby chromosomemlcrodtssecttonand thetr application Nature Genet. 1,24-28
CHAPTER 33
Detection of Chromosomal Aberrations in Interphase and Metaphase Cells in Prenatal and Postnatal Studies William
G. Kearns
and Peter L. Pearson
1. Introduction The identification of numerical and structural chromosome abnormahties by routine and high resolution cytogenetic studies plays an important role in the diagnosis and treatment of various diseases.The analysis of structural aberrations is relatively gross and only permits the visual diagnosis of aberrations of single chromosome bands on the order of about seven million base pairs. Chromosome aberrations involving less than five million or so base pairs or those with indistinct banding patterns are difficult or impossible to detect using routine or high resolution cytogenetic studies. Standard cytogenetic techniques also require that the cells to be analyzed must be actively dividing and that they may be arrested during metaphase, thus requirmg a substantial amount of time for sample preparation and analysis. Fluorescent in situ hybridization (FISH) is a powerful tool that permits one to directly study the chromosomal localization of DNA sequences at a level of resolution of approx 100 kb using interphase nuclei and l-2 Mb when using metaphase chromosome preparations. This permits one to determine the number and location of specific DNA sequences m cells and makes feasible its moIecular application to the characterization of cytogenetic aberrations, Target DNA for hybridization includes interphase nuclei, metaphase chromosome preparations, uncultured or cultured ammocytes, cultured or uncultured chononic villi, or bone marrow cells. Hybridization of single copy probes, satellite DNA probes, and chromosome-specific libraries permits one to Identify chromosomal aneuploidy, examme the copy number of specific chromosomal regions such as seen in duphcations or deletions, determine the identification of unknown or derivative chromosomes, and to study structural chromosome rearrangements in more detail vs standard cytogenetlc or high resolution banding techniques. FISH may be used in prenatal and postnatal cytogenetic studies. Women who have an increased risk of carrying chromosomally abnormal fetuses are routinely offered standard cytogenetic analysis of fetal cells to rule out chromosomal aberrations. This analysis of banded metaphase chromosomes From Edlted
Methods m Molecular Bology, Vol 33 In SW Hybndzalron Protocols by K H A Choo Copynght Q 1994 Humana Press Inc , Totowa, NJ
459
460
Kearns
and Pearson
detects chromosomal aneuploidies and structural rearrangements with great accuracy. However, its primary disadvantage is that ammocytes or choriomc villi must be cultured for several days prior to microscopic exammation, presenting a time problem m certain clinical situations. Approximately 80% of all prenatal studies are performed becauseof the mothers’ increased risk for having a fetus with one of the common autosomal trisomies involving chromosomes 13, 18, or 21. These common autosomal aneuploidies account for over 60% of all chromosomal aberrations identified during prenatal genetic studies (1,2). FISH can provide a rapid and accurate identification for the most common autosomal trisomies, trisomy 13,18, or 21, and sex chromosome abnormalittes X0, XXX, XXY, or XYY, using single copy or satellite DNA probes (3-5). In contrast, whole chromosome-specific libraries can rapidly identify chromosomal translocations (6), determine the origin of extra chromatin on unbalanced chromosomal aberrations (7), and be used to evaluate and further characterize complex chromosomal rearrangements (CCR) (8). 2. Trisomies Recently, FISH was successfully used for the rapid diagnosis of trisomy 18 and dizygosity determination in twins using uncultured amniocytes (9). The diagnosis of chromosomally abnormal third trimester fetuses prior to birth permits optimal medical management of pregnancy and psychological support for the parents when the child is born. Trisomy 18 occurs m approx 1:3500 livebirths (10) and is characterized by mtrauterme growth retardation and multiple congenital anomalies. In utero demise occurs m the majority of fetuses with Edward syndrome, and median and mean postnatal survival are 5 and 48 d, respectively (II). For fetuses that survive to the third trimester, this diagnosis carrtes a high risk for fetal distress during labor. Although ultrasound findings may lead to suspicion of Edward syndrome, confirmatton requires a cytogenetic diagnosis (9). 2.1. Case Report (9) A 23-yr-old female GsPOll 1 was referred at 32 wk 5 d with a twin gestation rn preterm labor. Evaluation at admission revealed twin A with an estimated fetal weight of 2080 g with no identifiable anomalies. However, moderate to severe ohgohydramnios were present. Twin B had a left-sided diaphragmatic hernia, showed marked polyhydramnios, and severe symmetric intrauterine growth retardation. Twm B had an estimated fetal weight of 1170 g, representing a 43% size discordance to twin A. Twm B appeared female but the external genitalia of twin A was not observed. These ultrasonic findings led to the strong suspicion of trlsomy 18 for twm B. The patient and husband were extensively counseled regarding the sonographic findings and thetr potential significance regarding trisomy 18. The risk of a cytogenettc abnormality for twm B was estimated to be approx 10%
Chromosomal
Aberrations
in Prenatal
IPostnatal
Studies
461
and the possibility of identical twinnmg was discussed.The parents were informed that twin B had a poor prognosis if delivery occurred at the current estimated fetal weight. The couple elected to undergo diagnostic fetal blood sampling and amniocentesis for cytogenetic analysis. Chorionic villus samplmg was not offered because of the deep posterior locatron of the placenta and the fact that separatetwin identity of villus sampling could not beassured.The couple requested no heroic measures for twm B if trisomy 18 was confirmed but requested mtensive care for both twins if their karyotypes were normal. Samples of amniotic fluid were drawn for twins A and B and spht for standard cloned amniocyte cytogenetic analysis and FISH. Conventional cytogenetic diagnosis on cultured amniocytes requires 8 d to completion. However, rapid aneuplold diagnosis using FISH on uncultured amniocytes permits interphase cytogenetic diagnosis within 24 h. FISH analysis was performed using minor modifications of that previously described (3). Uncultured amniocytes were used as target DNA, and satellite DNA specific for chromosomes 18 (L1.84), X (DXZl), and Y (DYZl) were used as probe. Fresh amniotic fluid samples from second trimester, normal appearing, fetuses were used as coded controls. FISH analysis using uncultured amniocytes presents some technical difficulties, such as efficiency of hybridization, signal to noise ratio, accessto target chromatin, and the quality of ammocyte slide preparation. Data collection consisted of three independent scorers analyzing coded slides from twins A and B, and control preparations. A minimum of 44 interphase nuclei were analyzed for ploidy levels. All nuclei were analyzed using either a Nikon or Leitz epifluorescent microscope equipped with a x63 fluorescent objective. Nuclei were scored as 0, 1, 2,3, or 4+ signals observed. Clumped nuclei, nuclei exhibiting extensive overlap, or nuclei resembling polymorphonuclear cells (representing possible maternal contamination) were excluded from the analysis. Nuclei were considered monosomrc when one hybridization signal was observed, disomic nuclei consisted of two signals, and trisomic nuclei showed three hybridization signals. Hybridization signals were detected using FITC and the slides were counterstained with propidium iodide and DAPI. Probes L1.84, X satellite DNA, and Y satellite DNA were first hybridized to normal interphase nuclei and metaphase chromosome preparations to determine the specificity and signal intensity of each probe. The final analysis showed that 81% of the cells scored on twin B demonstrated three signals when hybridized with the satellite DNA probe specific for chromosome 18, whereas 79% of the cells scored on twin A showed two signals. The results using probes specific for chromosomes X and Y showed twin A to be XY and twin B to be XX. Ninety-six percent of the cells scored on twin A showed one signal when hybridized with the satellite probe specific for the X chromosome, whereas 88% of the cells scored on twin B showed two sig-
462
Kearns
and Pearson
nals. Twin A showed 100% of the nuclei analyzed with one signal, whereas twin B exhibited no hybridization signal m any cell examined when using a satellite DNA probe specific for the Y chromosome. Control data showed a dtsomic hybridization pattern for chromosomes 18 (81%) and X (100%) for the female sample and a disomic pattern for chromosome 18 (79%) and monosomic for chromosomes X (100%) and Y (100%) for the male sample. These results suggested a FISH interphase cytogenetics diagnosis of trisomy 18 for twin B. The results also showed a difference in sex between the twins, which permitted us to rule out the possibility of monozygotic twins. Giemsa banded metaphase spreads from cultured amniocytes confirmed the FISH dtagnosis of trisomy 18 for twin B with a karyotype of 47,Xx,+1 8. As occasionally happens with third trimester ammottc fluid, the sample from twin A failed to grow m culture. Followmg delivery at 37 wk 2 d, cytogenetic analysis of cord blood revealed a 46,XY karyotype for twm A. Twin B weighed 994 g at birth with multiple features of trisomy 18. She was given compasstonate care and died 4.5 h after birth. Twin A weighed 2137 g at birth and was normal on physical examination. In this case,a lethal trisomy was suspectedbecause of abnormal sonographic findings. Coupled with a high risk of preterm delivery and twms of unknown zygosity, a rapid cytogenetic dtagnosts was required for optimal pregnancy supervrsion. Medical management decisions were clarified and simplified by the knowledge that one twm had trtsomy 18, and the other twin was discordant for sex and therefore not at risk for the same lethal trtsomy. FISH is a powerful tool for the rapid identification of suspectedaneuploidies for chromosomes 13, 18, 21, X, and Y when using cultured or dtrect preparations of ammocytes or chortonic villi. However, using satellite DNA as probe only permits the identification of free trisomtes. Structural abnormalities, such as trisomies involved in chromosome translocations or trisomies involving Robertsonian translocattons, may not be observed. For example, a partial trisomy for chromosome 18, although much less frequent, may not be detected. Nevertheless, the ability to rapidly obtain specific cytogenetic information from uncultured ammocytes is very valuable for medical management. 3. Large-Scale Clinical Study The first large scale clmical study uttltzing FISH for the rapid detection of chromosome aneuploidies m uncultured amniocytes was recently reported. This study compared FISH aneuploid identification to results obtained from standard cytogenetic prenatal studies (22). Forty-five hundred specimens were analyzed usmg probe setsdeveloped from smgle copy sequences within chromosomes 13,18, and 21. Using these noncentromeric markers permits the identification of free trtsomies, trisomtes involved in chromosome translocations, and trisomies involvmg Robertsoman translocations. The chromosome 21
Chromosomal
Aberrations
in Prenatal
IPostnatal
Studies
463
probe set consisted of a cosmid contig from region q22.3. The chromosome 18 probe set consisted of a cosmid contig within region q23. Three cosmids of nonoverlapping DNA within region 13q12.3 comprised the chromosome 13 probe set. The X chromosome probe consisted of a cosmid that hybridized to the paracentromeric region and the Y chromosome-specific probe consisted of an alpha satellite repeat. Their experimental design required 18 n-L of amniotic fluid. One 5-mL aliquot of uncultured amniottc fluid was used for FISH. Five separatehybridizations using single probe sets for chromosomes 13, 18,21, X, and Y were analyzed. Data collection consisted of analyzing a minimum of 50 interphase nuclei per probe set. Clumped or overlapping nuclei, nuclei surrounded by excess cytoplasm, or polymorphic nuclei representing possible maternal cell contamination were eliminated from the analysis. Two independent scorers tabulated data from coded slides. Three different outcomes were possible: informative, unmformative, or no result becauseof inadequate volume or specimen contamination. An informative disomic result consisted of 280% of all nuclei analyzed showing a disomtc autosomal pattern along with a normal sex chromosome pattern. Informative aneuploid samples included those m which 270% of nuclei scored, using one probe set, exhibited a nondisomic pattern, whereas other probe setsmet the 280% criteria considered to be an informative disomic sample. Uninformative samples were identified when any of the five independent hybridizations failed to meet the 80% rule for disomic cells or the 70% rule for aneuplotd detection. Potential maternal cell contamination consisting of the presence of polymorphonuclear cells or the presence of a FISH-identified mosaic XX/XY were considered unmformative. Final FISH reports were generated within 24 h. Standard cytogenetic karyotypes were completed within 7-10 d after receipt of sample. Of the 4500 samplessubmitted for evaluation, FISH analysiswas not attempted on 3.8% because of the presence of contaminating blood or insufficient volume. Of the remaining samples, 90.2% of the analyses were successful, and a final report was produced. Their results reported 3782 mformative disomtc samples for chromosomes 13, 18,21, X, and Y. These results were confirmed by standard cytogenetics. Autosomal trisomy was identified by FISH and confirmed karyotypically m 87 samples. No false positives were noted. However, FISH results identified seven false negatives, all disomic for chromosomes 13, 18, and 21, but were identified as trisomic by standard cytogenetic analysis. These trtsomies included one trisomy 13 male fetus, one trisomy 18 male fetus, and five trisomy 21 female fetuses. Sex chromosome abnormalities were detected by FISH and confirmed karyotypically in 20 informative samples with no instances of false negatives. Monosomy X fetuses showed one signal using the X chromosome probe set and no signal using the Y probe in over 96% of the cells analyzed. XXX females
464
Kearns
and Pearson
showed a hybridization pattern of three X signals in over 90% of the cells analyzed. Seven triploid samples and four XXY fetuses were successfully identified by FISH. However, one false positive was reported; a 45,X whose ultrasound identified a male fetus. Repeated FISH analysis identified an XY male. Four cases were reported by FISH to be a disomic female fetus. However, cytogenetic analysis reported a 46,XY karyotype. This was attributed to undetected maternal cell contammation. The final FISH analysis of this study reported an mformative result rn over 90% of the specimens analyzed. Disomic patterns for chromosomes 13, 18, and 21 were reported with a 99.8% accuracy vs standard cytogenetic analysis. Using rigorous scoring criteria, FISH successfully identified 73.2% (107/146) of all karyotypically confirmed aneuploidies. The authors stated that if the 80% scoring criteria were altered to mclude all samples where >50% of hybridized nuclei were trisomic, the aneuplord detection rate increased to 82.9% (121/ 146). Furthermore, this alteration in reporting criteria did not alter the falsepositive or false-negative results. This large-scale clinical study using FISH to identify the most common autosome and sex chromosome aneuploidies provides convmcmg evidence that FISH analysis using uncultured amniotic fluid cells can successfully be used as a rapid screening protocol for aneuploid detection. However, this study does not address the issue of identifying low grade mosaicism or rare aneuploidies by FISH. Using single copy probe sets, FISH can be used to detect monosomies, free trisomies, trisomies involved in chromosome translocations, and trisomies involving Robertsonian translocations. However, single copy probe sets requires a longer hybridization time vs satellite DNA probes. 4. Use of Chromosome-Specific Libraries as Paints Prenatal cytogenetic studies of fetal cells following choironic villi sampling or amrnocentests requires specialized techniques to identify various chromosome abnormalities. These techniques include classical cytogenetic analysis and molecular cytogenetics. High resolution banding permits the identification of most chromosome abnormalities. However, many chromosome aberrations still cannot be adequately determined. As discussed, the most common autosoma1and sex chromosome aneuploidies can rapidly be identified using single copy chromosome-specific probes. However, chromosome aberrations mvolvmg marker chromosomes, unbalanced de nova translocations, those with duplicated material, or those with abnormal banding patterns may be difficult to identify by standard cytogenetics. FISH, using composite DNA probes specific for whole chromosomes (chromosome painting), is a molecular cytogenetic tool that permits the identification of smaller chromosomal aberrations that are not readily detected by standard high resolution banding techniques. FISH may be used to identify marker chromosomes, describe unbalanced de
Chromosomal
Aberrations
in Prenatal IPostnatal
Studies
465
nova translocations, or clarify duplications. Therefore, FISH analysis usmg chromosome-specific libraries as probe and cultured metaphase chromosomes as target DNA increases the level of resolution of standard cytogenetics so that it is now possible to detect a few kilobases of misplaced DNA anywhere in the genome. Two familial translocations, one ascertained after birth of a child with an unbalanced translocation and the other referred after abnormal findings in an ultrasound examination were analyzed by chromosome painting and standard cytogenetics (13). Metaphase chromosomes were prepared from samples of both direct and cultured choriomc villa, ammocyte clones, skin fibroblasts, and peripheral blood lymphocytes. Chromosome banding was by standard trypsinGiemsa. Composite DNA probes specific for whole chromosomes 3 (pBS3), 13 (pBS13), 14 (pBS14), 15 (pBS15) (J. W. Gray, Lawrence Livermore National Laboratory, CA) and satellite DNA specific for chromosomes 13/21 (L1.26) were used as probes for FISH analysis. Data collection consisted of analyzing a minimum of 30 metaphase spreads using each chromosome-specific library. (13) The first case was a healthy 28-yr-old gravtda 3 para 1-0-1-O (one elective abortion) whose first child was a full-term male who died at 3 mo of age with multiple major and minor abnormalities. The infant was small for gestational age. Chromosome analysis identified an unbalanced reciprocal translocatron. The parents’ chromosomes were analyzed and the infant’s mother was found to be a balanced translocation carrier; 46,XX,t (13; 14) (q12;q24). During her next pregnancy, chorionic villus sampling was performed at 12 wk gestation. G-band analysis of the mother’s karyotype confirmed the balanced translocation. The direct chorionic villi chromosome preparation identified an unbalanced reciprocal translocation: 46,XY ,- 13,+der( 14)t (13;14) (q12;q24)mat. The fetus was trisomic for most of chromosome 14 and monosomic for a small region of chromosome 13. The parents elected to terminate the pregnancy and cytogenetic findings were confirmed using both cultured chorionic villi and skin fibroblasts. Composite DNA specific for chromosomes 13 (pBS13) and 14 (pBS14) were used as probe and metaphase chromosome preparations from mother (PHA-stimulated peripheral blood lymphocytes) and fetus (cultured chorionic vilh) were used as target DNA to analyze these translocations by FISH. Using pBS14, metaphase chromosomes from the mother pamted one chromosome 14, the proximal region of the der(l4), and most of the der(13). In the fetus, pBS14 painted two copies of chromosome 14 and the proximal region of the der(14). In contrast, pBS13 pamted one chromosome 13 and the distal region of the der(14) for both mother and fetus metaphase spreads. However, the 4.1. Case Report
466
Kearns
and Pearson
der( 13) of the mother was not painted using the chromosome 13 specific library. Satellite DNA for chromosomes 13/21 (L1.26) was used as probe to identify the maternal der( 13) chromosome. Case two was a 27-yr-old gravida 5 para l-O-3-1 referred for genetics consult at 33.5 wk gestation. A sonogram performed at 31 wk gestation noted intrauterine growth retardation, right sided displacement of the fetal heart, and a two vessel umbilical cord. Subsequent sonograms identified additional anomalies as well as complex congenital heart disease. Family history identified two 8-wk spontaneousabortions and one 20-wk stillbirth. The mother had one healthy son. The patient delivered at 39 wk gestation a 1280 g female who expired 20 mm after birth. Postmortem examination revealed additional anomalies. High resolution G-band analysis of cultured amuiocytes identified a small deletion of the distal long arm of one chromosome 15. Parental studies showed the mother carried the same del(15). However, since the mother was phenotypically normal, her karyotype was assumed to be balanced. Molecular cytogenetic analysis was required to further clarify the mother’s karyotype. FISH using a chromosome 15 specific library (pBS15) identified two chromosomes 15 in the fetus. Whereas in the mother, pBSl5 painted two chromosomes 15 and the distal region of one chromosome 3, the der(3). However, no chromosome 3 material could be detected on the der(15) of the mother when using a chromosome 3 specific library (pBS3). pBS3 did paint two copies of chromosome 3 in both the mother and fetus. Furthermore, while using pBS3, no nonfluorescent region was seen on the terminal end of one der(3) of the mother. Additional high resolution G-band analysis was performed on metaphase chromosomes from the mother. Combining this information and FISH analysis, the mother’s karyotype was redefined to include a balanced translocation between chromosomes 3 and 15: 46,XX,t (3;15) (q29;q26). Case two demonstrates both the power of FISH as an adjunctive tool m the clinical cytogenetics laboratory but also suggests some hmitatrons of the technique. The reciprocal translocation noted in the mother involved a small band of chromosome material. Painting with the chromosome 15 DNA library (pBS15) identified the balanced translocation in the mother by painting two chromosomes 15 and the distal region of the der(3). However, painting with pBS3 did not identify the reciprocal translocation of chromosome 3 material onto the der( 15), possibly because this rearrangement was below the level of resolution using pBS3. The failure to detect a nonfluorescent region on the terminal end of the der(3) of the mother using pBS3 may be explained by the fact that positive stammg detection has greater sensitivity than negative ones. These casesdemonstrate that not all libraries have equal sensitivity or specificity m detecting different chromosomal regions. The uneven representation of DNA from different areas of the chromosome, as seen using pBS3 in case two, may be owing to an artifact of cloning or of subsequent amplification of
Chromosomal
Aberrations
in Prenatal IPostnatal
Studies
467
the DNA library. In case one, the inability of pBS13 to detect the der(13) may be a result of the library’s original complexity or that the library may have lost these sequences during subsequent amplification steps. It also may be the result of preferential suppression of certain chromosome regions during the hybridization step. This data suggests that whenever possible, the balanced translocation carrier should be studied by FISH m order to estimate the utility that a given library has in characterizing an unbalanced translocation. One should also recognize that various sources exist for obtaining whole chromosome-specific libraries. Libraries obtained from one source may have greater sensitivity or specificity in detecting different chromosomal regions vs other libraries. 5. Aberrant Chromosomes with Indistinct Banding Pattern Aberrant chromosomes with an indistinct banding pattern pose a distinct challenge to the clinical cytogenetics laboratory. FISH may be used to determine the origin of extra chromatin m unbalanced chromosome aberrations. Using chromosome-specific libraries in two caseswith multiple birth defects, FISH was used to identify the origin of material m unbalanced chromosome abnormalities (14). 5.1. Case Report (14) The first case was a full-term female infant who weighed 3.29 kg at birth, had dysmorphic features including pterygium coli, low set ears, clinodactyly, short proximal limbs, hypertelorism, triangular facres, and macrocephaly with a flattened occiput. The anterior fontanelle was flat and the posterior fontanelles were large. The infant fed poorly, had frequent episodes of apnea, frequent seizures, endocrine dysfunction, idiopathic neonatal hepatitis, and recurrent urinary tract infections. The patient exhibited gross motor delay and short stature at 11 mo of age. Chromosomal studies were indicated and performed on PHA-stimulated peripheral blood lymphocytes immediately after birth. All metaphase spreads examined showed extra chromatin on the short arm of one chromosome 18: 46,xX,-l 8,+der( 18)t (18;?) (pl 1,l ;?). GTL-banding using Giemsa, trypsm, and Leishman’s stain and QFQ-banding using quinacrine mustard failed to identify this extra chromatin material. Parental studies showed a paternal karyotype of 46,XY and a maternal karyotype with an apparently balanced translocation; 46,XX,t (9; 18) (pll.1;pll.l). FISH using chromosome-specific DNA for chromosomes 1,2,3,4,6,7, 8, 9, and 12 were used as probe on metaphase chromosome preparations from the patient. Composite DNA specific for chromosome 9 hybridized to the extra
468
Kearns
and Pearson
material on the short arm of chromosome 18. No chromosome 18 material was noted on any chromosome 9 using a pBSl8 specific library as probe. FISH confirmed the translocation between chromosomes 9 and 18 on maternal metaphase chromosomes. The chromosome 9 specific library pamted the normal chromosome 9 and identified those chromosomes involved m the t (9; 18). This suggests the patient is trisomic for portions of chromosome 9 and possibly monosomic for a small portion of 18~. However, chromosome pamtmg using the chromosome 9 specific library as probe can only identify the extra chromatin on the der( 18) as originating from chromosome 9, not from 9p or 9q. Some of the phenotypic features described for the patient have previously been reported for isolated trisomy 9p or monosomy 18~ (1516). Combmmg standard cytogenetic information, family studies, the patient’s phenotype, and molecular cytogenetic data, the patient’s karyotype was redefined as 46,Xx,18,+der(18)t (9;18) (pll.l;pll.l)mat. The second casewas a 19-yr-old male evaluated for mental retardation. Birth was at 42 wk gestation to a 30-yr-old mother. The pregnancy was noted by decreased fetal movement and occasional fetal tremors. The patient requires special education courses and is currently in the tenth grade. Physical examination noted mild dysmorphism. Results of the physical examination and evaluation of the patient’s history suggested a possible diagnosis of fragile X. Cytogenetic studies were negative for the presence of a fragile X chromosome. However, an unbalanced chromosome abnormahty was noted. Extra chromatm was present on the most distal part of the short arm of one chromosome 5. The cytogenetic diagnosis was 46,XY,-5,+der(5)t (5;?) (p1?5;?). Family studies reported normal karyotypes for the patients parents and brother. Owing to the presence of this extra chromatin with an mdistinct banding pattern, molecular cytogenetic studies were required to identify the ?5p+ material from the patient. FISH using chromosome-specific libraries for chromosomes 1, 2, 3,4,6,7, 8,9, and 12 were used as probe and metaphase chromosomes from the patient used as target DNA. The chromosome 12 library painted two chromosomes 12 and identified the extra material at distal 5p as originating from chromosome 12. Owing to the unavailability of a composite probe specific for chromosome 5, the possibility of a reciprocal translocation could not be analyzed by FISH. This suggests the patient is trisomic for portions of chromosome 12 and possibly monosomic for a small portion of distal 5p. However, this patient did not exhibit any features of the cri-du-chat syndrome, suggesting that only a small part of distal 5p may be missing. The phenotype of the patient is consistent with several features of those reported with a partial trisomy for a portion of the long arm of chromosome 12, specifically 12q24+qter (17). One phenotypic feature of trisomy 12q24+qter is moderate to severe mental retardation. However, this patient presents with mild mental retardation, suggesting a different or smaller
Chromosomal
Aberrations
in Prenatal IPostnatal
Studies
469
region of 12q24+qter may be involved in his chromosome abnormality. Based on the clinical evaluation of this patient, family studies, and case reports, a partial trisomy of 12q may be responsible for this phenotype. However, chromosome painting using the chromosome 12 specific library as probe can only identify the extra chromatin on the der(5) as originating from chromosome 12, not from 12p or 12q. Further FISH studies using probes specific for regions of 12p or 12q are required to more precisely identify the extra chromatm on the der(5) chromosome. The patient’s karyotype was redefined as 46,XY,5,+der(5)t (5;12) (p1?5;?). 6. Duplicated Chromosome Materials The identification of duplicated chromosome material is an important fmding in the clinical cytogenetics laboratory. Isolated duplications of the short arm of the X chromosome are rare. Structurally abnormal X chromosomes are usually preferentially inactivated (18) in females, minimizing the occurrence of genetic imbalances that may result from the structural abnormality. One recently reported casepresented a mother and daughter with short stature, mild dysmorphrc features, and mental retardation (19). 6.1. Case Report (19) An 11-yr-old white female was evaluated because of motor and speech delay, seizures, and short stature. The proband was born to a 26-yr-old mentally retarded mother who is short and has occastonal seizures. The patient’s father is short, has seizures, and is slow. Family history was negative for phenotypic abnormalities and short stature. Cytogenetic analysis was indtcated and chromosome preparations were prepared from skin fibroblasts and synchronized PBL cultures. G-, Q-, and C-banding were used according to standard cytogenetic protocols. Standard cytogenetics for the proband and mother revealed a chromosome number of 46, with one apparently normal X. However, the other X chromosome had what appeared to be an inverted duplication of most of Xp. C-banding identified one region of constitutive heterochromatin at the primary constriction site and a very faint signal located at the termmus of the apparently duplicated short arm of the aberrant chromosome, but the results were inconclusive. Family members studied were karyotypically normal. FISH analysis was performed to confirm that the mother and proband carried an isolated duplication of Xp, with no other chromosomal aberrations, FISH using a composite DNA probe specific for the X chromosome (pBSX) painted the normal and aberrant X chromosomes in both the proband and mother, showing hybridization signal along the entire length of each long and short arm. No hybridization signal was observed anywhere else in the genome. This confirms, at least at this level of resolution, that no evidence exists for an X;autosome translocation. To further clarify the presence of alpha satellite
470
Kearns
and Pearson
DNA at the two sites noted by C-banding on the aberrant X chromosome, FISH was performed using an X chromosome-specific alpha satelhte DNA probe (pBAMX5). Two fluorescent signals were observed on the aberrant X chromosome, one at the primary constriction site and another at the same region noted by the faint C-band signal. FISH analysis using telomere specific probes was performed on the proband and mother’s metaphase chromosome preparations. Telomere sequences were observed at both ends of the duplicated X chromosome and no internal signals were noted. X mactivation studies were performed by R-banding using acridine orange following BrdU incorporation (20) to determine if the abnormal X chromosome was preferentially inactivated. The X inactivation pattern was determined and the dup (X) was found to be late replicating (inactive) in the proband’s fibroblasts and the mother’s lymphocytes. However, m 11% of the lymphocytes exammed from the proband, the dup (X) was early rephcatmg and transcrlptlonally active, whereas the normal X chromosome was late replicating. One possible explanation for the phenotypic abnormalities observed m the mother and daughter 1sthat this inactlvatlon pattern may be the result of initial random mactivatlon followed by incomplete selection against those cells with an active aberrant X chromosome. The resultant transcrlptlonal activity of the duplicated X chromosome would lead to functional disomy for many genes located within the duplicated region of Xp. This functlonal imbalance may play a role m the phenotyplc abnormallties observed m the proband and mother. However, no evidence of early replication of the dup (X) chromosome was found in the mother’s lymphocytes. One possible explanation for this discrepancy is the age difference between mother and daughter. Wilson et al. (21) suggested that in females carrying abnormal X chromosomes, X inactivation may mitlally be random, followed over time, by selection favoring genettc balance. Perhaps the mother initially carried a small percentage of active dup (X) chromosomes, but over time, complete selection against those cells occurred. The karyotype of the proband and daughter was clarified by FISH. The X chromosome satellite specific DNA probe (pBAMX5) clarified the presence of centromere related sequences at the distal end of the short arm of the dup (X). The G-banding pattern on the p arm of the dup (X) suggested an mverted duphcatlon comprising most of the short arm. FISH analysis using an X chromosome-specific library (pBSX) confirmed that the aberrant X chromosome mcluded only X material and provided evidence that no X;autosome translocation existed, at this level of resolution. FISH also provided evidence that no internal telomere sequences existed on the dup (X) chromosome. Therefore, the karyotype of the proband and mother was interpreted as: 46,X,dic mv dup (X) (qter+p22.3::p22.3+cen:). The aforementioned case demonstrates that FISH can be used to resolve the composition of unbalanced chromosome aberrations. More complex chro-
Chromosomal
Aberrations
in Prenatal
IPostnatal
Studies
471
mosome abnormalities may present cytogenetics laboratories with special challenges in analysis and interpretation as a result of the complexity of the chromosomal pattern. 7, Complex Chromosomal Rearrangements Complex chromosomal rearrangements (CCR) are a relatively common finding in tumor cells but may present, although rarely, as a constitutional abnormality. In general, CCRs involve translocations among three or more chromosomes. The translocation segments may include distal or interstitial segments. Rearrangements with up to eight breakpoints and seven derivative chromosomes have been described (22). Two major categories of CCRs exist, types I and II. Type I has three or four breaks and type II has more than four breaks (22). Most CCRs are type I, familial, and usually transmitted through the mother. Type II CCRs may exist in a variety of complex rearrangements, however, only a few cases have been reported (22-26). Most type II CCRs are de novo chromosome rearrangements. Individuals with CCRs and an apparently balanced karyotype may present with a normal or abnormal phenotype. Phenotypically normal mdividuals are assumed to be balanced. In phenotypically abnormal individuals, an undetected submicroscopic aberration must exist. These cases are thought to always involve a de ltovo chromosome anomaly. Genetic counseling for complex chromosomal rearrangements is compltcated and accuracy requires the most complete cytogenetic diagnosis. Fertile heterozygous females or males having a conceptus with a normal chromosome constitution, or the same balanced CCR as the parent, are expected to produce a normal child. However, a high proportion of these conceptions have an unbalanced karyotype. Through 1988, the accumulated data from 25 families suggested that half of all recognized pregnancies had abnormal outcomes; three-quarters miscarried and one-quarter resulted in the birth of a child with multiple malformations (27). Therefore, the risk of having an abnormal child, expressed as a proportion of all livebirths, 1sapprox 20%. “Apparently” balanced translocations represent a diagnostic problem to the clinical cytogenetics laboratory. Reciprocal translocations or inversions with a balanced karyotype occur approx once in every 1000 amniocenteses (28). However, it is important to recognize that even with high resolution chromosome banding, an undetected submicroscopic abnormality may exist. Analysis of “apparently” balanced translocations suggest that the rearrangement is truly balanced in approx 90% of casesexamined (29,30). However, the risk for malformation or mental retardation may approach 10%. The risk for mtellectual impairment and malformation increases dramatically when a patient carries an apparently balanced de novo CCR. Patients carrying an apparently balanced de ylovo CCR may have a risk >90% for mtellectual impairment or physical mal-
472
Kearns
and Pearson
formation (31). Only a few casesof de novo CCRs have been ascertained prenatally by classical cytogenetics (32,33). Recently, we reported a CCR detected prenatally and studied by FISH. To our knowledge, this is the first CCR detected in ammocytes studied by FISH (34). 7.1. Case Report
(34)
A 2%yr-old woman gravida 2 para 1 was referred for ammocentesis at 19 wk gestation because of a low maternal serum alpha fetoprotein. Cytogenetic studies identified an apparently balanced complex chromosomal rearrangement involving chromosomes 1, 3, and 9. In addition, one derivative chromosome had a pericentric inversion and a second derivative chromosome had a partial inversion of the heterochromatic region. The karyotype was interpreted as 46,XX,t (1;3;9) (p13;pl1.2;~24), inv der(1) (p13q25). The pregnancy was terminated at 22 wk gestation and the cytogenetic findings were confirmed in fetal fibroblasts. Autopsy findings revealed no gross external or internal macroscopic abnormalities. Family history for congenital abnormalities was unremarkable. Parental karyotypes were normal. The partial inversion of the heterochromatic region of chromosome 9, present m the der(9) of the fetus, was also present m the father. The complexity of this rearrangement made characterization by classical cytogenetics very difficult. High resolution banding studies using cultured ammocyte and fibroblast cultures confirmed the karyotype described. However, it is important to recognize that even with high resolution chromosome banding, an undetected submicroscopic chromosome abnormality may exist. FISH was used to confirm the cytogenetic findings. FISH results confirmed the translocations involving the three derivative chromosomes 1, 3, and 9. However, pBS1, in addition to identifying a normal chromosome 1, and two derived chromosomes, inv der( 1) and der(3), also pamted a small fluorescent band within the middle of the long arm of one B group chromosome and another fluorescent band within a chromosome similar in size and shape to chromosome 2. Control slides hybridized using pBS1 showed two normal chromosomes 1 without any cross-hybridization to any other chromosome within the genome. Employing the same slides used for FISH, C-banding was performed and identified the chromosome 2-like chromosome as being the der(9). This suggests an insertion of chromosome 1 material to the der(9) chromosome. The PBS 1 library also identified a fluorescent band within a B group chromosome. G-banded metaphasepreparations were re-examined and a small abnormal pale band located within the q arm of one chromosome 4 was suggested. Therefore, a specific library for chromosome 4 (pBS4) was used for FISH analysis. FISH painted both chromosomes 4. However, m one chromosome 4, a gap existed within the q arm. This gap of fluorescent signal was in the same region as the fluorescent band detected in the B group chromosome
Chromosomal
Aberrations
in Prenatal JPostnatal
Studies
473
using a composite DNA library specific for chromosome 1. Hybridization with pBS4 also showed a fluorescent band within an A group chromosome and a fluorescent band within the inv der(1) at the terminal region of the p arm. Control slides hybridized using pBS4 painted two normal chromosomes 4 without any cross-hybridization to any other chromosomes. C-banding on the same slides identified these two chromosomes as the der(9) and the inv der( 1). Combining this molecular cytogenetic information, we propose the der(9) mcludes regions of chromosomes 9 and 3, as well as small adjacent segments from chromosomes 1 and 4. To order the segments from chromosomes 1 and 4 on the der(9), two probe/two color FISH was used on metaphase chromosome preparations. The results were inconclusive. Furthermore, the der(4) not only received an insertion of a segment of chromosome 1, but also translocated segments to two other chromosomes, the der(9) and the mv der(1). FISH analysis using chromosome-specific libraries pBS1, pBS3, pBS4, and PBS 9 to chromosome preparations from the proband’s parents showed no structural abnormalities. Usmg classical cytogenetics, family studies, and FISH analysis, we suggest the CCR described mvolves four different chromosomes and requires at least nine different breakpoints to explain the cytogenettc and molecular data. The karyotype of the fetus was redefined as 46,XX,t (inv (1);3;4;9)(lqter+lq25:: lp13.3~1q25::4q26~4q27::3qter~3p13::1p22.1~1pter;4pter~4q25:: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 3pter). The order of chromosome 1 and 4 segmentson the der(9) was provisional. 8. Conclusion It 1s clear that FISH should play a role in the clinical cytogenetics laboratory. FISH has applications in the identification of numerical and structural chromosome abnormalities using DNA probes for satellite, unique sequence, or whole chromosome-specific libraries. Chromosome-specific satellite DNA probes produce very strong signals in interphase nuclei and on metaphase chromosomes. However, chromosome-specific satellite DNA does not exist for every chromosome. In addition, sequence homology exists between centromeric regions of chromosomes 13 and 21, producing cross-hybridization to both chromosomes during hybridization experiments. Polymorphisms exist in satellite DNA sequences,which may lead to an individual having a smaller array of satellite DNA on a specific chromosome. This chromosome may go undetected by FISH analysis. Our laboratory (35) and others (36) have identified one such region located m satellite DNA present on chromosome 21. However, using chromosome-specific single copy DNA probes permits the identification of individual chromosomes, shows distinct strong signals, and reduces the potential problem of population polymorphisms. Presently, convincing data exists showing great sensitivity and
Kearns
and Pearson
specificity for chromosomes 13, 18, 21, X, and Y using cosmid contig probe sets hybridized to various types of cultured or uncultured target DNA. FISH using chromosome-specific DNA libraries permits the identification of small chromosome aberrations, which are not readily detected by standard high resolution banding techniques. FISH may be used to identify marker chromosomes, clarify balanced or unbalanced translocations, define chromosome duplications, or analyze complex chromosome rearrangements. In the near future, criteria for acceptable performance must be defined for using FISH m the clinical cytogenetics laboratories. References 1. Rhoads, G. G , Jackson, L G., Schlesselman, S. E, De la Cruz, F. F, Desmck, R J., Golbus, M S , Ledbetta, D H , Lubs, H A , Mahoney, M J., Pergament, E , Simpson, J L , Carpenter, R. J., Elias, S., Ginsberg, N. A., Goldberg, J D , Hobbins, J C., Lynch, C., Shiono, P. H., Wapner, R. J , and Zachary, J M (1989) The safety and efficacy of chortomc villus sampling for early prenatal dtagnosis of cytogenetrc abnormahttes. N. Engl J Med. 320,609-6 17 2 Robmson,A , Bender,B , andLinden, M (1991)Prognoses of prenatallydiagnosedchildren with sex chromosome abnormalitiesBtrth Defects l&203-241 3 Cremer,T., Landegent,J , BrucknerA , School,H P , Schardm,M , Hager,H D., Devtlee, P , Pearson,P , andvanderPloeg,M (1986)Detectionof chromosome aberrationsm the humaninterphasenucleusby visuahzattonof specifictargetDNAs with radtoactrveand nonradroacttvezn situ hybridizationtechmques.diagnosisof trtsomy 18with probeLl 84 Hum. Genet 74,346-352
4. Klmger, K. W., Dakowskt, W., Leverone,B , Locke, P , Nass,S. G , Lerner, T , and Landes,G (1990)Prenataldetecttonof aneuploidyof 21, 18, 13,X, or Y by interphasezn situ hybridizatton. Am J. Hum. Genet. (Suppl. 47), A224 5 Klinger, K., Landes,G., Shook, D., Harvey, R., Lopez, L , Locke, P , Lerner, T , Osathanondh, R , Leverone,B , Houseal,T., Pavelka,K , andDackowskt,W (1992)Rapid detectionof chromosome aneuplotdies in unculturedammocytesby usingfluorescencem situ hybridization (FISH) Am. J. Hum Genet 51,55-65 6 Rosenberg,C , Blakemore,K. J , Kearns,W G , Giraldez,R A , Escallon,C. S., Pearson, P. L., andStetten,G (1992)Analystsof reciprocaltranslocatronby chromosome painting applicationsandlimttatronsof the technique.Am. J Hum. Genet 50,700-705. 7 Rosenberg,C., Stetten,G., Kearns,W G , Ltttlefield, J W , Thomas,G , andPearson,P L (1991)Useof DNA librariesandfluorescentzn situ hybrtdtzattonto identify translocationsandduplicattons.Am. J Hum Genet (Supp1.)49,306 8. Battsta, D. A.S , Tuck-Muller, C. M., Martinez, J E , Kearns,W G , Pearson,P L , and Stetten,G. (1993)A complexchromosomalrearrangement detectedprenatallyand studted by fluorescencem sttu hybrtdtzation Hum Genet. 92, 117-121. 9. Blakemore,K J , Rosenberg, C., Jaswaney,V. L , Pressman, E. K , Kearns,W G., Pearson, P L , andStetten,G (1993)Raprddragnosrs of tnsomy 18 anddrzygosrtym twins using fluorescence w situ hybndizationon unculturedamniocytesJ Mat-Fet Med. 2, 197-200 10 Smith,D W (1964)Autosomalabnormahties Am. J. Obstet. Gynecol 90,1055-1077. 11 Carter, P E., Pearn,J. H., Bell, J , Martin, N , and Anderson,N G (1985) Survival m trisomy 18. Clin. Genet. 27,59-61. 12 Ward, B. E., Gersen,S.L , Carelh,M P , McGutre, N. M., Dackowskt,W R., Wemstem, M , Sandlin,C , Warren,R , andKlinger, K W (1993)Rapidprenataldiagnosisof chro-
Chromosomal
Aberrations
in Prenatal IPostnatal
Studies
475
mosomal aneuplotdres by fluorescence in situ hybridization. clmrcalexperiencewrth 4500 specimens. Am. J Hum. Genet. 52,854-865. 13 Rosenberg, C , Blakemore,K J , Kearns,W G , Gtraldez,R A., Escallon,C. S , Pearson, P. L., andStetten,G. (1992)Analystsof reciprocaltranslocattonsby chromosomepamtmg. applicationsandhmitattonsof the technique.Am. J Hum. Genet. 50,700-705 14. Kraker, W. J , Borell, T. .I., Schad,C. R , Pennmgton,M. J., Karnes,P. S., Dewald,G. W , andJenkins,R B. (1992)Fluorescenttn situ hybrtdtzatton:useof wholechromosome paint probesto identify unbalancedchromosome translocations. Mayo Clm. Proc 67,658-662. 15. Stembach,P. and Benz, R. (1983) Demonstrattonof genedosageeffects for AK3 and GALT in ftbroblastsfrom a fetus with 9p trisomy.Hum. Genet 63,290,291 16. Ebbin,A., J , Wilson,M G ,Towner,J W , andSlaughter,J P.(1973)Prenataldtagnosts of an inheritedtranslocattonbetweenchromosomes no.9 and18 J Med. Genet. 10,65-69. 17 Melnyk, A , R., Wetss,L , Van Dyke, D L., andJarvi, P (1981)Malformatton syndrome of duphcatlon12q24l+qter. Am J. Med. Genet 10,357-365 18 Therman,E andPatau,K (1974)AbnormalX chromosomes m man:origin, behaviorand effects.Humangenettk 25, l-l 6 19. Tuck-Miller, C M., Martinez, J. E., Battsta, D AS., Kearns,W. G., andWerteleckt, W (1993) Duplicationof the shortarm of the X chromosomein motheranddaughter Hum Genet. 91,395-400. 20. Pai, G S andThomas,G. H (1980)A newR-bandingtechmquein clinical cytogenetics Hum. Genet 54,41-45
21. Wilson, M. G., Modebe,O., Towner,J. W., Frasier,S. D., andLm, M. S. (1983)UllrtchTurner syndromeassociatedwith interstitial deletronof Xpll 2+p22 31 Am J Med Genet. 14,567-576. 22. Kousseff,B. G , Nichols,P.,Esstg,Y P., Miller, K , Weiss,A., andTedesco,T. A. (1987) Complexchromosome rearrangements andcongenitalanomaliesAm J Med Genet. 26, 77l-782 23 Bass,H N , Sparkes,R. S , Lessner,M. M , Fox, M , Phoenix,B , andBernar,J. (1985) A family with threeindependentautosomaltranslocattons associated wrth 7q32+7qter syndrome J Med Genet. 22,59-63 24. Meer, B., Wolff, G., and Back, E. (1981) Segregationof a complex rearrangementof chromosomes 6,7,8, and12throughthreegenerations. Hum Genet. 58,221-225 25. Kleczkowska, A , Fryns, J. P., and van den Berghe,H (1982) Complexchromosomal rearrangements (CCR) andtheir geneticconsequences. J Genet. Hum. 30,199-214 26 Walker, A., P. and Boctan, M. (1987)Partial duplication8q12+q21 2 in two sibswith maternallyderived msertionaland reciprocaltranslocattonscasereportsand review of partial duplicattonsof chromosome 8. Am. J. Med Genet. 27,3-22 27 Gorskt, J L , Kistenmacher,M L, Punnet&H H , Zackai, E. H., and Emanuel,B S (1988)Reproductiverisksfor carriersof complexchromosomal rearrangementsanalysts of 25 families Am J. Med. Genet 29,247-261. 28. Hook, E. B. andCross,P. K (1987)Ratesof mutantandinherttedstructuralcytogenettc abnormalitiesdetectedat ammocentesis. resultson about63,000fetuses.Ann. Hum Genet 51,27-55. 29 Willey, A. M., Carter, T. P , Kelly, S., and Porter, I H., eds.(1982) Clmrcal Genetrcs Problems tn Diagnosis and Counselmg. Academic,New York, pp 63-75. 30 Warburton,D. (1984)Outcomeof casesof denovo structuralrearrangements diagnosedat amniocentesis. Prenat Dlagn. (Spec. Iss ) 4,69-80 31 Bogart, M H , Bradshaw,C L , Jones,0 W , and Schanberger,J E (1986) Prenatal diagnosisandfollow up of a child with a complexchromosomerearrangementJ Med Genet. 23,180-183
Kearns
476
and Pearson
32. Stoll, C , Flori, E., MacLear, J , and Renaud, R. (1979) Prenat,al diagnosis and postnatal follow-up of an abnormal child with two de nova apparentlybalancedtranslocationsHum Genet. 47,221-224
33 Kim, H. J., Perle,M A , Bogosian,V., andGreco, A (1986)Prenat.aldragnostsof a de nova complexchromosomal rearrangement mvolvmg four chromosomes. Prenat. Duzgn. 6,211-216. 34. Battsta,D A. S., Tuck-Muller, C. M., Martinez, J. E., Kearns,W. G , Pearson,P. L , and Stetten,G. (1993)A complexchromosomalrearrangement detectedprenatallyand studied by fluorescencern situ hybrtdrzatton.Hum. Genet. 92, 117-121 35 Kearns,W. G. andPearson,P L (1992)Unpublisheddata 36. Mizunoe, T. andYoung, S R (1992)Low fluorescencealphasatelliteregtonyields negative result.Prenat. Dlagn 12,549,550