Hemostasis and Thrombosis Protocols

Hemostasis

3

1 Hemostasis Components and Processes K. John Pasi 1. Introduction Hemostasis is a host defense mechanism that protects the integrity of the vascular system after tissue injury. It works in conjunction with other inflammatory, immune, and repair mechanisms to produce a coordinated response. Hemostatic systems are generally quiescent, but following tissue injury or damage these systems are rapidly activated. Hemostasis has evolved to accommodate the conflicting needs of maintaining vascular integrity and free flow of blood in the vascular tree. Given the high pressures that exists in arterial circulation, it is clearly important that procoagulant mechanisms exist that can minimize blood loss from a site of vascular damage as rapidly as possible. However, this powerful procoagulant response must be localized to prevent unwanted thrombosis and controlled to prevent thrombosis in the slower low-pressure venous circulation. As a result of these competing needs, hemostasis has evolved as a patchwork of interrelated activating and inhibiting pathways that can either promote or suppress other elements of the overall process. Hemostasis has therefore evolved to integrate five major components: vascular endothelium, platelets, coagulant proteins, anticoagulant proteins, and fibrinolytic proteins. The coordinated hemostatic response ultimately produces a platelet plug, fibrin-based clot, deposition of white cells at the point of injury and activation of inflammatory, and repair processes, maintenance of blood flow, and vascular integrity. 2. Overview of Hemostasis All components of the hemostatic mechanism exist under resting conditions in an inactive form. A diagrammatic representation of the overall hemostatic From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

3

4

Pasi

response is shown in Fig. 1. Following injury, there is immediate vasoconstriction and reflex constriction of adjacent small arteries. This slows blood flow into the damaged area. The reduced blood flow allows contact activation of platelets. On activation by tissue injury (or other agonists), platelets undergo a series of physical, biochemical, and morphological changes. Platelets adhere to exposed connective tissue, mediated in part by the von Willebrand factor (vWF). Collagen exposure and local thrombin generation (see Subheading 6.) lead to the release of platelet granule contents. Release of platelet granule contents, which include adenosine diphosphate (ADP), serotonin, and fibrinogen, further enhances platelet activation, formation of platelet aggregates, and interaction with other platelets and leukocytes. This process leads to the formation of the initial platelet plug. The vascular endothelium also undergoes a series of changes moving from its resting phase (with predominantly anticoagulant properties) to a more active procoagulant and repair phase. In concert with these cellular changes, inactive plasma coagulation factors are converted to their respective active species by cleavage of one or two internal peptide bonds. In sequence, these active factors generate thrombin, which leads to formation of fibrin from fibrinogen (to stabilize the platelet plug), crosslinking of the fibrin formed (via activation of factor XIII), further activation of platelets, and also activation of fibrinolytic pathways (to enable plasmin to dissolve fibrin strands in the course of wound healing). Additionally, thrombin interacts with other nonhemostatic systems to promote cellular chemotaxis, fibroblast growth, and wound repair. 3. Components of the Hemostatic System

3.1. Vascular Endothelium Vascular endothelium is the monolayer of cells that line the inner surface of blood vessels. Since an uninterrupted vascular tree is necessary for survival, the ability of the vasculature to maintain a nonleaking system is essential. If a vessel is disrupted and leakage occurs, the coagulation system and platelets close the defect temporarily until cellular repair of the defect takes place. If a vessel is occluded by thrombus, blood flow may be re-established by lysing the clot or recanalizing the occluded vessel. These properties are the main functional characteristics of the vascular endothelial cell. Endothelial cells are attached to and rest on the subendothelium, an extracelluar matrix secreted by the endothelial cells. Subendothelium is composed of collagen, elastin, mucopolysaccharides (including heparan sulfate, dermatan sulfate, chrondroitin sulfate), laminin, fibronectin, vWF, vitronectin, thrombospondin, and occasionally fibrin. All these components are synthesized by the endothelial cells. Together, endothelium and subendothelium form a

Hemostasis

5

Fig. 1. A flow diagram representing the major events in the process of overall hemostasis.

selectively impermeable layer, resistant to the passive transfer of fluid and cellular elements of blood, but permeable to gases. Cells may pass through the endothelium at sites of inflammation by a process of adherence and then migration between endothelial cells. Subendothelium can act as a physical barrier in the absence of endothelial cells. Endothelial cells have multiple functions as outlined below (1).

3.1.1. Maintenance of Blood Flow Endothelial cells influence vascular tone, blood pressure, and blood flow by induction of vasoconstriction and vasodilatation. This is achieved by secretion of renin, endothelin, endothelial-derived relaxing factor (EDRF) or nitrous oxide, adenosine, prostacyclin, and surface enzymes that convert or inactivate other vasoactive peptides, such as angiotensin and bradykinin.

3.1.2. Antiplatelet and Anticoagulant Properties Intact endothelial cells are intrinsically nonthrombogenic, exerting a powerful inhibitory influence on hemostasis by a range of factors that they either

6

Pasi

synthesize or express on their surface. For example, platelets adhere to subendothelium rather than endothelial cells. This is due to endothelial production of components that inhibit platelet aggregation, such as prostacylin, EDRF, and adenosine. Cell-surface heparan sulfate enhances the effect of antithrombin in forming thrombin–antithrombin complexes. Perhaps the major anticoagulant properties of endothelium are via the endothelial expression of thrombomodulin and tissue factor pathway inhibitor (TFPI). Thrombomodulin enhances the ability of thrombin to activate protein C. Enhancement of protein C activation leads to increased inactivation of factor Va and factor VIIIa. Endothelium also secretes protease nexin 1. This inactivates thrombin by covalent binding to the thrombin active site. This complex formation is enhanced by heparan sulfate.

3.1.3. Coagulant Properties In contrast to the above, in the setting of damage to blood vessels, the endothelium functions as an important component to coagulation pathways. Central to this role is endothelial cells production of tissue factor in response to injury. In addition, they bind factors IX, X, V, high-mol-wt kininogen (HMWK), contain factor XIII activity, and produce endothelin to induce vasoconstriction. Importantly, endothelial cells also produce the natural inhibitor of tissue factor mediated coagulation, TFPI.

3.1.4. Fibrinolytic Properties Endothelial cells secrete several components active in fibrinolysis. These include plasminogen activators and plasminogen activator inhibitor. These components are bound to the endothelial cell surface to enable assembly of active complexes.

3.1.5. Repair Properties Endothelial cells are capable of significant repair of blood vessels. Simple minor injuries are repaired by migration of adjacent cells and subsequent endothelial cell proliferation. More severe vessel wall injuries require migration and proliferation of smooth muscle cells and fibroblasts. Endothelium secretes components that are active in the repair process by enhancing smooth muscle migration and fibroblast function. These include a protein resembling platelet-derived growth factor, vascular permeability factor, and fibroblast growth factor. Endothelial cells are also responsive to platelet-derived endothelial growth factor and transforming growth factor β.

3.1.6. Interactive Properties The endothelium interacts with leukocytes. This is critical in the migration of leukocytes into area of inflammation. Adhesion molecules present on both endothelial cells and leukocytes mediate this interaction.

Hemostasis

7

4. Platelets Platelets are nonnucleated fragments of cytoplasm that have a crucial role in primary hemostasis. They are derived from bone marrow megakaryocytes and are smooth biconvex disks of approx 1–4 mm diameter. Normal circulating numbers are approx 140–400 × 109/L.

4.1. Production In the production of platelets, megakaryocytes undergo specialized cellular division. The megakaryocyte nucleus divides, but the cell itself does not divide (endomitosis) (2), although there is formation of new membrane and cytoplasmic maturation. This cytoplasmic maturation includes development of platelet-specific granules, membrane glycoproteins, and lysosomes. Mature megakaryocytes are therefore variably polyploid, with up to 64 N. They are large at approx 60 µm diameter. As a part of the endomitosis process, there is increased membrane. This excess membrane is accommodated by invagination. The invagination process continues, thereby clipping off individual platelets (cytoplasmic fragmentation) from the main megakaryocyte body. It is suggested that circulating megakaryocytes undergo cytoplasmic fragmentation in the pulmonary capillary bed. Megakaryocyte maturation is controlled in a simple negative feedback loop, under the influence of the growth factor thrombopoietin and cytokines, such as interleukin-3 (IL-3) and interleukin-11 (IL-11). When platelet production is increased, megakaryocytes undergo a more rapid cytoplasmic maturation than nuclear maturation. Under such circumstances, platelets may be produced from octaploid or even tetraploid cell megakaryocytes. Such platelets are often larger than normal and more metabolically active. Once released from the bone marrow, platelets are sequestered in the spleen for 24–48 h. The spleen may contain upto 30% of the normal circulating mass of platelets. Significant platelet pools may also exist in the lungs. The normal life-span of platelets is approx 8–14 d. Platelets are removed from the circulation by the reticuloendothelial system on the basis of senescence rather than by random utilization. However, there is a small fixed component that exists owing to random utilization of platelets that maintain vascular integrity.

4.2. Structure Stylized structural features are shown diagrammatically in Fig. 2. A range of glycoproteins molecules partially or completely penetrate cell-membrane lipid bilayer. These glycoprotein molecules function as receptors for different agonists, adhesive proteins, coagulation factors, and for other platelets. Important membrane glycoproteins are listed in Table 1 with their associated functions.

8

Pasi

Fig. 2. Stylized structural features of the platelet. See text for decription of individual components. Table 1 Important Platelet Membrane Glycoproteins Glycoprotein Ia IIa Ic Ib/IX IIb/IIIa IV V

103 copies/platelet

Receptors

2–4 5–10 3–6 25–30 40–50

Collagen Fibronectin, laminin Fibronectin, laminin vWF, thrombin Fibrinogen, vWF, Fibronectin, vitronectin Collagen, thrombospondin Thrombin

The most abundant glycoproteins on the platelet surface are glycoproteins IIb and IIIa. These two glycoproteins form a heterodimer and carry receptors for adhesive proteins (fibrinogen, vWF, fibronectin). The IIb-IIIa complex is a member of the integrin family of adhesion receptors. Glycoprotein Ib contains a receptor for vWF and thrombin. This receptor is essential in the platelet vessel wall interaction. The cell membrane also has importance as a source of phospholipid (prostaglandin synthesis), site of calcium mobilization, and localization of coagulant activity to the platelet surface.

Hemostasis

9

Platelet structure is complex (3). Below the plasma membrane lies a peripheral band of microtubules, which function as the cellular cytoskeleton. The microtubules maintain the discoid shape in the resting platelet, but disappear temporally (disassemble?) on platelet aggregation. The surface-connected canalicular system is an extensive system of plasma membrane invaginations. This system vastly increases the surface area across which membrane transport occurs and through which platelet granules discharge their contents during the secretory phase of platelet aggregation. The dense tubular system probably represents the smooth endoplasmic reticulum. It is thought to be the site of prostaglandin synthesis and sequestration/release of calcium ions. Platelets contain many organelles (mitochondria, glycogen granules, lysosomes, peroximsomes) and two types of platelet-specific storage granules: dense bodies (d-granules) or a-granules. The contents of the platelet-specific granules are released when platelets aggregate. Dense bodies contain 60% of the platelet storage pool of adenine nucleotides (such as adenosine diphosphate) and serotonin. Dense body adenine nucleotides do not readily exchange with other adenine nucleotides in the platelet metabolic pool. α-Granules contain multiple different proteins. These proteins may be platelet specific or proteins that are found in the plasma or other cell types (such as coagulation factors). The major contents of α-granules are vWF, platelet factor 4, β-thromboglobulin, thrombospondin, factor V, fibrinogen, fibronectin, platelet derived growth factor, high-mol-wt kininogen, and tissue plasminogen activator inhibitor-1.

4.3. Function Platelets are crucial components of the hemostatic system. When a vessel wall is damaged, platelets escaping from the circulation immediately come into contact with and adhere to collagen and subendothelial bound vWF (through glycoprotein Ib). Glycoprotein IIb-IIIa is then exposed, via the binding of vWF. This forms a second binding site for vWF. In addition with glycoprotein IIb– IIIa exposure, fibrinogen may be bound promoting platelet aggregation. Within seconds of adhesion to the vessel wall, platelets undergo a shape change, owing to ADP released from the damaged cells or other platelets exposed to the subendothelium. Platelets become more spherical and put out pseudopods, which enable platelet–platelet interaction. The peripheral microtubules become centrally apposed forcing the granules toward the surface and the surface-connected canalicular system. Platelets then undergo a specific release reaction of their granules, the intensity of the release reaction being dependent on the intensity of the stimulus. With the shape change, there is also further exposure of the glycoprotein IIb–IIIa complex and further fibrinogen binding. Since fi-

10

Pasi

brinogen is a dimer, it can form a direct bridge between platelets or act as a substrate for the lectin-like protein thrombospondin. With the enhancement of platelet–platelet interaction, platelet aggregation ensues. Platelet aggregation causes activation, secretion, and release from other platelets, so leading to a self-sustaining cycle that results in the formation of a platelet plug. The binding of agonists to also leads to a series of signal transduction events that mediate the platelet release reaction (see Fig. 3) (4). Agonist receptor interaction activates guanine nucleotide binding proteins (G-protein) and hydrolysis of plasma membrane phospholipids (phosphotidyl inositides) by phospholipase C (PLC). Inositol triphosphates that are formed act as ionophores, and mobilize calcium ions into the cytosol from the dense tubular system, and lead to an influx of calcium from outside. Diacylglycerol, also formed within the G-protein/PLC pathway, activates protein kinase C, which in turn phosphorylates a 47-kDa contractile protein. Together with the calciumdependent phosphorylation of myosin light chain, these reactions induce contraction and secretion of granule contents. Cyclic AMP/adenyl cyclase exert regulatory control over these reactions (high levels of cAMP reduce cytosol calcium concentration) and are in turn regulated by G-protein activity. In addition, prostaglandin (cyclic endoperoxides and thromboxane A2) synthesized from membrane phospholipids may bind to specific receptors and further stimulate these processes. Platelet α-granules contain several coagulation factors (such as factor V, fibrinogen, and high-mol-wt kininogen). On secretion from the α-granule, these factors reach high local concentrations. Platelets provide a local phospholipid surface for these factors to work on, particularly factor V. This procoagulant activity of platelets is not seen in resting platelets.

4.4. Antigens Platelets have a number of antigens on their surface specific to platelets. Many of the platelet-specific antigens are associated with platelet membrane glycoproteins (HPA IA—glycoprotein IIIa). Platelets also express HLA class I antigens and ABO blood group antigens. 5. Coagulation Factors 5.1. Thrombin Thrombin is the cornerstone of hemostasis. Prothrombin, its precursor, is a vitamin K dependent plasma of mol wt 71 kDa (579 amino acids). Thrombin is crucial to the conversion of fibrinogen to fibrin. It is the most potent physiological activator of platelets causing shape change, the generation of thromboxane A2, ADP release, and ultimately platelet aggregation. Thrombin also activates the cofactors of coagulation factor V, factor VIII, and factor XIII.

Hemostasis

11

Fig. 3. Signal transduction events that mediate the platelet-release reaction. The intermediate processes lead to the phosphorylation of 47kD protein and myosin light chain, which together contract and lead to secretion of platelet granule contents.

Thrombin bound to thrombomodulin is a potent activator of protein C. In addition to its procoagulant and anticoagulant activities, thrombin also has important roles in cellular growth, cellular activation, and the regulation of cellular migration.

5.2. Tissue Factor This is an integral transmembrane protein of mol wt 45 kDa (263 amino acids) coded for by a short gene of 12.4 kb on chromosome 1. It is found on the surface of vascular cells, but is also constitutively expressed by many nonvascular tissues. It can be upregulated on monocytes and vascular endothelium by inflammatory cytokines or endotoxin. Tissue factor (thromboplastin) binds and promotes activation of factor VII, and is required for the initiation of blood coagulation. It acts as a cofactor enhancing the proteolytic activity of factor VIIa toward factor IX and factor X. It binds factor VII via calcium ions.

5.3. Factor V This is a plasma glycoprotein of mol wt 330 kDa (2224 amino acids) coded for by a complex 25 exon 80-kb gene on chromosome 1. It is a critical cofactor

12

Pasi

in coagulation, which in its activated form facilities the conversion of prothrombin to thrombin. In Factor V, the rate of conversion of prothrombin to thrombin is 200,000- to 300,000-fold. Factor V circulates as a single-chain protein in a precursor inactive form. It is converted into an active two-chain form by thrombin or factor Xa. Thrombin cleaves factor V at three separate sites. Following cleavage, the two chains are linked via a divalent metal ion bridge. Binding to phospholipid surfaces occurs via the light chain. Factor V is inactivated by activated protein C and its cofactor protein S. Although it is predominantly synthesized in the liver (plasma factor V), megakaryocytes also synthesize factor V, which is stored in platelet α-granules (platelet factor V). Platelet factor V, which is released on platelet activation, accounts for approx 20% of total factor V. Factor V has a binding protein in platelets (multimerin), which is analogous to vWF for factor VIII. Plasma concentration of factor V is about 7–10 µg/mL with a half-life of approx 12 h.

5.4. Factor VII This is a vitamin K dependent plasma glycoprotein and serine protease of mol wt 50 kDa (406 amino acids) coded for by a 13-kb gene on chromosome 13. It has 10 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor VII are crucial to its normal function and biological activity. Factor VII is involved in the initiation of blood coagulation, forming a complex with tissue factor to generate an enzyme complex that activates factor X and factor IX. Factor VII is activated by cleavage of the Arg153–Ile153 peptide bond. Activators include thrombin, activated factor X, and activated factor IX. Activated factor VII has no catalytic activity until bound to tissue factor. It circulates at a concentration of 0.5 µg/mL and half-life of 4–6 h.

5.5. Factor VIII This is a plasma glycoprotein of approx mol wt 360 kDa (2351 amino acids) coded for by a complex 26 exon 186-kb gene on the X chromosome. It has a domain structure that is very similar to that of factor V and is related to the copper protein ceruloplamsin. However, unlike factor V, the large B domain is not required for coagulant activity. Factor VIII is one of the largest and least stable coagulation factors with a complex polypeptide composition, circulating in plasma in a noncovalent complex with vWF. vWF functions to protect factor VIII from premature proteolytic degradation and concentrate factor VIII at sites of vascular injury. Factor VIII functions as a cofactor for factor IX, facilitating the conversion of factor X to factor Xa. Factor VIII increases the rate of conversion of factor X to Xa by factor IX by 200,000-fold.

Hemostasis

13

Liver synthesized single-chain molecule factor VIII is cleaved shortly after synthesis, circulates as a heterodimer, and comprises an 80-kDa light chain linked through a divalent metal cation bridge to a heavy chain (90–200 kDa). Variable amounts of the B domain remain after this initial cleavage. On activation by thrombin (or factor Xa), factor VIII is cleaved at Arg372, Arg740, and Arg1689, the Arg740 cleavage removing residual B domain remnants. This cleavage yields a 90-kDa heavy chain. A rate-limiting Arg372 cleavage yields two smaller 50 and 40 kDa fragments, both of which are essential for factor VIII clotting activity. At the same time, a small fragment is cleaved that removes vWF from factor VIII. Activated factor VIII is very unstable and rapidly loses cofactor function, owing to subunit disassociation. Inactivation of factor VIII also occurs via activated protein C and its cofactor protein S, by cleavage at Arg336 and Arg562. Plasma concentration of factor VIII is about 100–200 ng/mL and half-life of approx 12 h.

5.6. Factor X This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 59,000 coded for by a 22-kb gene on chromosome 13. It has 11 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor X are crucial to its normal function and biological activity. It is a central component in the common pathway of blood coagulation. Factor X is synthesized as a single chain, but exists in plasma as a heavy and light chain linked by a single disulfide bond. It is activated by cleavage of the Arg51–Ile52 peptide bond. Activators include activated factor VII/tissue factor complex and activated factor IX/factor VIII complex in the presence of calcium ions. Factor Xa, in conjunction forms a complex on phospholipid surfaces with factor V to form the prothrombinase complex. This complex converts prothrombin to thrombin. Factor X is inhibited by antithrombin and α2macroglobulin. Factor X circulates at a concentration of 8–10 µg/mL and has a half-life of approx 36 h.

5.7. Factor IX This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 57,000 (415 amino acids) coded by a 34-kb gene on the long arm of the X chromosome. It is the largest of the family of vitamin K dependent proteins. Twelve N-terminal glutamic acid residues are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor IX are crucial to its normal function and biological activity.

14

Pasi

Factor IX circulates as a single-chain polypeptide. Activation occurs via cleavage of two peptide bonds, Arg145–Ala146 and Arg180–Val181, by either activated factor XI or activated factor VII, complexed to tissue factor. Arg180–Val181 cleavage is rate-limiting. Cleavage into factor IXa generates a heavy and light chain bound together via a single disulfide bond. A 24 amino acid activation peptide is removed during cleavage. Together with factor VIII, factor IXa can then proceed to activate factor X. In addition, factor IXa may also activate factor VII. The plasma factor IX concentration is about 5 µg/mL with a half-life of approx 24 h.

5.8. Factor XI This is plasma glycoprotein and serine protease of mol wt 160 kDa coded by a 23-kb gene on chromosome 4. Factor XI is a homodimer, comprising two identical subunits bound together by disulfide bond, that circulates bound to high-mol-wt kininogen. The plasma factor XI concentration is about 5 µg/mL with a half-life of approx 72 h. Factor XI is cleaved to active factor XIa by activated factor XII in the presence of high-mol-wt kininogen. Activation cleavage occurs within each subunit at Arg369–Ile370 in a region bounded by a disulfide linkage, so yielding two heavy chains and two light chains in the active molecule. Only the light chains possess catalytic activity. Factor XIa activates factor IX in the presence of calcium. No specific additional cofactors are required for this reaction. Both factor XI and factor XIa bind to platelets.

5.9. Factor XII This is a plasma glycoprotein and serine protease of mol wt 80 kDa (596 amino acids) coded for by a 12-kb gene located on chromosome 5. Factor XII has a half-life of approx 2 d and a plasma concentration of approx 30 µg/mL. In the process of contact activation factor XII is absorbed on to negatively charged surfaces and undergoes limited proteolysis at specific sites to yield active factor XII'. This slowly converts prekallikrein to kallikrein, which specifically cleaves factor XII to yield fully active factor XIIa. In addition, factor XIIa can autoactivate factor XII. Factor XIIa can activate factor XI to promote downstream activation of the coagulation cascade.

5.10. Factor XIII This is a tetramer of two a and b chains. The b chains function as the carrier for the a chains. On activation by thrombin, factor XIII crosslinks fibrin and other proteins involved in the clot via a transglutamase reaction. The factor XIIIa subunit has a plasma concentration of 15 µg/mL and the b subunit a concentration of 14 µg/mL.

Hemostasis

15

5.11. von Willebrand Factor (vWF) This is a multimeric glycoprotein of basic subunit of 400 kDa mol wt (2813 amino acids) coded for by a large complex gene of 178-kb on the short arm of chromosome 12. vWF is an important component in primary platelet hemostasis. Following translation, it undergoes extensive intracellular processing and exists as a series of multimers of the basic subunit, ranging from mol wt 800 to 20,000 kDa. It is produced in both endothelium and megakaryocytes. Endothelial cells secrete a vWF into the plasma constitutively, but store the majority of vWF synthesized (in Wieble Palade bodies) for regulated secretion. Platelet vWF is released from α-granules locally when they aggregate. vWF functions: as a carrier protein for coagulation factor VIII and as an adhesive protein involved in endothelial-platelet interaction, via platelet surface membrane glycoprotein Ib and IIb–IIIa complex. Its function as an adhesive protein is particularly important in situations of high shear stress. 6. Coagulation Cascade The classic “waterfall” hypothesis for coagulation proposes the intrinsic and extrinsic pathways (see Fig. 4) (5,6). The intrinsic system assumes that exposure of contact factors (factor XII, high-mol-wt kininogens, prekallikrein) to an abnormal/injured vascular surface leads to activation of factor XI, which in turn activates factor IX. Activated factor IX, in the presence of its cofactor factor VIII, then activates factor X to factor Xa in the presence of phospholipid. In turn, factor Xa, with its cofactor factor V, together form the prothrombinase complex, which converts prothrombin to thrombin. Thrombin then converts fibrinogen to fibrin. The extrinsic system assumes that factor VII and tissue factor, released from damaged vessels, directly activate factor X, and coagulation factor lying below factor X in the final common pathway. The division into extrinsic and intrinsic systems and the ability to test these two systems in the laboratory (the prothrombin time and activated partial thromboplastin time, respectively) have been valuable in understanding clinical bleeding problems, but fail to represent accurately what happens in in vivo hemostasis. This may be shown by considering the following points. First, patients who have an inherited deficiency of factor XII, prekallikrein or highmol-wt kininogen have no clinical bleeding problems, yet have extremely prolonged activated partial thromboplastin times. This clinical observation demonstrates that these proteins are probably not important components of blood coagulation in vivo and, therefore, should not be included in an in vivo consideration of blood coagulation. Similarly, factor XI deficiency is not always associated with bleeding and its role is therefore unclear, whereas patients with factor VII deficiency bleed abnormally, although they have an intact intrinsic system. Third, factor VII–tissue factor is known to activate not

16

Pasi

Fig. 4. Classic “waterfall” hypothesis for coagulation with the intrinsic, extrinsic, and final common pathways. Although useful in understanding coagulation pathways in in vitro clotting assays this schema does not accurately represent in vivo coagulation processes.

only factor X, but also factor IX. In the classic waterfall, this activation is not required. Fourth, tissue factor is a natural constituent of many nonvascular cells. Tissue factor on such cells is able to initiate blood coagulation. These points suggest a more central role for the tissue factor–factor VII complex. Additionally, the identification of an endogenous inhibitor of tissue factor-induced coagulation (tissue factor pathway inhibitor; TFRI) and an increased understanding of its properties have led to a questioning of traditional dogmas (7). The revised cascade is outlined in Fig. 5. This revised cascade is believed to represent more accurately the processes that occur in vivo (7–9). Coagulation is initiated when tissue damage at the site of the wound exposes blood to tissue factor, produced constitutively by cells beneath the endothelium. Factor VII binds tissue factor forming the tissue factor–factor VII complex. This complex directly activates factor X to factor Xa and some factor IX to factor IXa. It is not clear what proteases initially activate factor VII in this complex, but once coagulation is activated, other proteins are able in turn to activate factor VII, including factor Xa and VIIa. This provides a mechanism for further amplification and acceleration of coagulation.

Hemostasis

17

Fig. 5. The revised coagulation pathway. See text for details. Note the central role of TFPI and absence of contact factors.

Once formed, the complex of the factor VIIa, tissue factor, and factor Xa binds TFPI forming a quaternary complex. This TFPI binding inhibits further generation of factor Xa and factor IXa by tissue factor–factor VIIa complex. Under these conditions, further factor Xa can only be generated by the factor IXa, factor VIIIa pathway. By this point in coagulation activation, enough thrombin usually exists to be able to activate factor VIII to factor VIIIa (generated by direct activation of factor Xa by factor VII–tissue factor). With activation of factor VIIIa and using the initial generation of factor IXa (by tissue factor–factor VIIa), the factor IXa, factor VIIIa route is able to move forward and allow further factor Xa generation to proceed. Further augmentation of factor IX activation is produced via thrombin activation of the factor XI pathway. This is proposed to be a process that occurs later in coagulation. The revised cascade assumes that tissue factor–factor VIIa is responsible for the initial generation of factor Xa and thrombin, sufficient to activate factor V, factor VIII, and platelet aggregation locally. Following inhibition by TFPI, the

18

Pasi

amount of factor Xa produced is insufficient to maintain coagulation, and therefore, factor Xa generation must be amplified using factor IXa and factor VIIIa to allow hemostasis to progress to completion. Unlike the waterfall hypothesis, the revised hypothesis does not assume that initial generation of factor Xa and thrombin is the end of the hemostatic process. Rather it assumes that following initial generation the hemostatic response must be reinforced and/or consolidated by a further progressive generation of factor Xa and thrombin. This allows the hypothesis to encompass the competing influences of inhibitors of coagulation, blood flow washing away activated coagulation factors, and also thrombin-activated fibrinolysis. Additionally, it does not all factor known to be involved in blood coagulation. The revised hypothesis also allows a better explanation of bleeding seen in hemophilia A and hemophilia B. In these two conditions, bleeding occurs both spontaneously (intrinsic system) and after trauma (extrinsic system), which cannot easily be reconciled on the classical waterfall hypothesis. Using the revised schema, it is clear that without factor VIII or factor IX, bleeding will ensue because the amplification and consolidating generation of factor Xa is insufficient to sustain hemostasis. 7. Anticoagulant Pathways Natural, physiological anticoagulants fall into two broad categories, serine protease inhibitors (SERPINS) and those that neutralize specific activated coagulation factors (protein C system). These systems are of major physiological significance. They are active from the very outset of the coagulation process and often brought fully into play before fibrin deposition has occurred.

7.1. Serine Protease Inhibitors (SERPINS) Serpins include many of the key inhibitors of coagulation, such as antithrombin, heparin cofactor II, protein C inhibitor, plasminogen inactivators, and α2antiplasmin. Of these, antithrombin is perhaps the most important (10). AT is a single-chain glycoprotein of mol wt 58,000 (432 amino acids) coded for on chromosome 1. It will inhibit all the coagulation serine proteases (II, VII, IX, X, XI, XII), but it is its antithrombin and anti-Xa activity that are physiologically important. AT activity/inhibition is increased 5- to 10,000-fold in the presence of heparin and other sulfated glycosaminoglycans. Heparin is not normally found in the circulation, and physiologically, antithrombin probably binds to heparan sulfate on the vascular endothelial cells.

7.2. Protein C System Factors Va and VIIIa are powerful cofactors in coagulation-enhancing activity of serine proteases. Both Va and VIIIa are specifically inactivated by

Hemostasis

19

components of the protein C pathway. Protein C is the key inactivating enzyme (11). It is a single-chain vitamin K-dependent protein synthesized by the liver. Together with its cofactor, protein S it inactivates factors Va and VIIIa. Thrombin generated during coagulation binds to thrombomodulin (Tm) on the surface of vascular endothelial cells. Thrombin/Tm complex is a potent activator of Protein C, Tm accelerating Protein C activation approx 20,000fold. Protein C is activated by cleavage at Arg169–Leu170. Activated protein C (APC) is inhibited by the specific inhibitor, protein C Inhibitor (PCI) and since it is a serine protease, it is inhibited by antithrombin. Protein S, the cofactor for protein C, is vitamin K-dependent. It circulates in plasma as a single-chain glycoprotein of mol wt 60,000 and is synthesized by the liver, endothelial cells, and megakaryocytes. Approximately 60% of protein S is complexed to C4b binding protein, Only the unbound or “free” protein S is physiologically active. 8. Fibrinolysis Fibrinolysis principally exists to ensure that fibrin deposition in excess of that which is required to prevent blood loss from damaged vessels is either prevented or degraded and removed (12). Plasminogen, the inactive form of the enzyme plasmin, has a mol wt of 92 kDa (790 amino acids), and is synthesized in the liver and coded on chromosome 6. Plasminogen contains five homologous looped structures called “kringles,” four of which contain lysine binding sites through which the molecule interacts with its substrates and its inhibitors. Internal autocatalytic cleavage occurs during activation of plasminogen with the release of an activation peptide. This changes the N-terminus from containing a glutamic acid residue (Glu-plasminogen) to a form that contains a lysine residue (Lys-plasminogen). Conversion of plasminogen to plasmin can occur via two routes. Most activators cleave plasminogen at Arg560 to generate a two-chain protein Glu-plasmin, the two chains linked by a single disulfide bridge. The light chain is derived from the C-terminus of the protein and contains the active serine catalytic site, whereas the heavy chain is derived from the N-terminus and contains the kringle domains. Glu-plasmin is functionally inactive, since its lysine binding sites are masked. It is activated when it is converted to Lys-plasmin by autocatalytic cleavage between Lys76–Lys77. This cleavage exposes the lysine binding sites on the kringle domains, dramatically increasing the affinity of the protease for fibrin. Both Glu-plasmin and Lys-plasmin attack the Lys76-Lys77 bond to form Lys-plasminogen. This is capable of binding to the fibrin clot before it develops protease activity, and it is, therefore brought into close proximity with the physiological activators. Plasminogen is activated by a number of endogenous proteins. Of these, tissue plasminogen activator (t-PA) is perhaps the most important. t-PA is synthe-

20

Pasi

sized primarily by vascular endothelial cells although many other cells, are capable of its synthesis. t-PA is synthesized as a single-chain glycoprotein (sctPA) and contains two kringle domains through which it binds fibrin. Although sct-PA has significant proteolytic activity, its biological activity is low until bound to fibrin. When bound, its affinity for plasminogen is increased approx 400-fold. Plasmin generated is capable of cleaving sct-PA into a two-chain tPA. Two-chain t-PA has more exposed binding sites and a significantly increased activity through increased binding of fibrin and plasminogen. t-PA has a short half-life (5 min) and is rapidly cleared from the circulation. sct-PA and tct-PA are inhibited by the SERPIN plasminogen activator inhibitor type 1 (PAI-1). A second inhibitor of t-PA, plasminogen activator inhibitor type 2 (PAI-2) is found in plasma in significant amounts during pregnancy. Normally free t-PA is rapidly inactivated because of an excess of PAI1 and any free plasmin generated is rapidly inactivated by α2-antiplasmin. A second endogenous activator of fibrinolysis is urokinase. Urokinase is synthesized as an essentially inactive single-chain protein (scu-PA/pro-urokinase). It must be converted to the two-chain form (tcu-PA or U-PA) before it is functionally active. scu-PA is converted to tcu-PA (U-PA) by plasmin and kallikrein. tcu-PA activates plasminogen to plasmin by a cleaving at Arg560– Val561. Inhibition of the active enzyme occurs via PAI-1, PAI-2, and also by protease nexin 1. Although urokinase can activate plasminogen in plasma it is thought that its major role is an extravascular activator of plasminogen, especially where tissue destruction or cell migration occurs. 9. Summary Hemostasis is clearly a complex interactive system involving numerous components. The revised hypothesis of coagulation has helped to unify the whole process. The recent improved understanding has in part been brought about by improved knowledge of the individual components of the different elements of the overall process of hemostasis and cellular repair. Although increasing by appreciated to be complex, attempts have been made to model and reproduce this system in vitro to validate research findings and increase understanding of the interactions. For all its complexity, many of these models of hemostasis, both laboratory and mathematical, have proven to be useful, and show that for all the interactions and complexity of different systems combined with flow and cellular interaction, we do have a considerable understanding of the processes of hemostasis. Suggested Reading Bloom, A. L., Forbes, C. D., Thomas, D. P., and Tuddenham, E. G. D. (1994) Haemostasis and Thrombosis, 3rd ed. Churchill Livingstone, Edinburgh, UK. Tuddenham, E. G. D. and Cooper, D. N. The Molecular Genetics of Haemostasis and its Inherited Disorders. Oxford Medical Publications, Oxford, UK.

Hemostasis

21

References 1. Cines, D. B., Pollak, E. S., Buck, C. A., Loscalzo, J., Zimmerman, G. A., McEver, R. P., Pober, J. S., Wick, T. M., Konkle, B. A., Schwartz, B. S., Barnathan, E. S., McCrae, E. R., Hug, B. A., Schmidt, A. S., and Stern, D. M. (1998) Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood 91, 3527–3561. 2. Gerwitz, A. (1995) Megakaryocytopoiesis: the state of the art. Thomb. Haemostasis 74, 204–209. 3. White, J. G. (1994) Anatomy and structural organisation of the platelet, in Hemostasis and Thrombosis: Basic Principles and Clinical Practice (Coleman, R. W., et al., eds.), 3rd ed., J. B. Lippencott Co., Philadelphia, PA. 4. Levy-Toledano, S., Gallet, C., Nadel, F., Bryckaert, M., Macloug, J., and Rosa, J.-P. (1997) Phosphorylation and dephosporylation mechanisms in platelet function: a tightly regulated balance. Thromb. Haemostasis 78, 226–233. 5. Macfarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism and its function as a biochemical amplifier. Nature 202, 498,499. 6. Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310–1312. 7. Broze, G. J. Jr., Warren, L. A., Novotny, W. F., Higuchi, D. A., Girrad, J. J., and Miletich, J. P. (1988) The lipoprotein associated coagulation inhibitor that inhibits the factor VII-tissue factor complex also inhibits factor Xa: insight into its possible mechanism of action. Blood 71, 335–343. 8. Furie, B. and Furie, B. C. (1992) Molecular and cellular biology of blood coagualtion. N. Engl. J. Med. 326, 800–806. 9. Rapaport, S. I. and Rao, L. V. (1995) The tissue factor pathway: how it has bevome a “prima ballerina.” Thromb. Haemostasis 74, 7–17. 10. Perry, D. J. (1994) Antithrombin and its inherited deficiencies. Blood Rev. 8, 35–37. 11. Dadhlback, B. (1995) New molecular insights into the genetivcs of thrombophilia: resistance to activated Protein C caused by the Arg506 to Gln mutation in factor V as a pathogenic risk factor for venous thrombosis. Thromb. Haemostasis 74, 139–148. 12. Collen, D. and Lijen, H. R. (1991) Basic and clinical aspects of fibrinolysis and thrombolysis. Blood 78, 3114–3124.

Isolation of DNA and RNA

25

2 Isolation of DNA and RNA David J. Perry 1. Introduction Blood samples for most coagulation tests are collected into 3.8% trisodium citrate in a ratio of 1 part anticoagulant to 9 parts blood. Whole-blood samples for DNA isolation can be stored at –50°C and the DNA prepared at a later stage. A more convenient method requiring less freezer space is to store buffy coats—the interface between the red cells and the plasma that is seen following centrifugation of whole blood. This latter method also allows isolation of the plasma fraction. There are numerous methods for isolating DNA. The methods described in this Chapter are routinely used to prepare high molecular weight DNA for Southern blot analysis or for amplification by the polymerase chain reaction (PCR) technique. The first method employs a phenol/chloroform step to denature proteins, whereas the second employs a salt precipitation step to precipitate proteins. Both methods can be readily adapted to processing small-volume samples (e.g., 100 µL). The first method has been successfully used to isolate DNA from a wide variety of cells, including whole blood, buffy coats, platelets, various cell lines, spleen, lymph nodes, and bone marrow. As with the isolation of DNA, there are many techniques for isolating RNA from a wide variety of cells, some of which can be adapted to allow the simultaneous isolation of both RNA and DNA. Many of the methods in current use employ strong chaotropic agents (e.g., guanidinium thiocyanate) to disrupt cellular membranes and inactivate intracellular RNases. The method described has been in routine use for several years and generates high-quality RNA suitable for a wide variety of uses. A number of commercial kits are now available for rapid RNA isolation, e.g, RNeasy™ kit (Qiagen Ltd, UK). Although often more expensive than “in-house” methods, these kits are capable of isolating highFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

25

26

Perry

quality RNA from a wide variety of cells, including whole-blood, leukocyte buffy coats, platelets, and tissue-culture cells. Methods are also included in this chapter for the isolation of lymphocytes and platelets from whole blood. 2. Materials Molecular-grade reagents should be used whenever possible. Sterile disposable polypropylene is used for most steps, but if glassware is used, it should be baked at 280°C for at least 3 h to inactivate any RNases.

2.1. Isolation of Mononuclear Cells from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. Density gradient medium, e.g., Histopaque 1077 (Sigma).

2.2. Isolation of Platelets from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. 38–40% Bovine serum albumin (BSA).

2.3. DNA Isolation Using the Phenol/Chloroform Method (1) 1. Sucrose lysis buffer: sucrose 0.32 M, 1% (v/v) Triton X-100, 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Autoclave before use. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulfate (LiDS), 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Store at room temperature. 4. Phenol: Equilibrated phenol for both DNA and RNA isolation can be purchased commercially (e.g., CamLabs, Cambridge, UK) and avoids many of the potential risks associated with its use. If crystalline phenol is used, 0.1% hydroxyquinoline should be added as an antioxidant and it should be extracted initially with 1 M Tris-HCl, pH 8.0, and then repeatedly with 0.1 M Tris-HCl, pH 8.0, until the pH of the aqueous phase is 8.0 (2). Phenol should be stored at 4°C. 5. Phenol:chloroform: A 1:1 mixture phenol and chloroform is made by mixing equal volumes of chloroform and equilibrated phenol. This may be purchased ready prepared from a number of manufacturers (e.g., CamLabs). Store at 4°C.

2.4. DNA Isolation Using the Salt-Precipitation Method (3) 1. Sucrose lysis buffer–see Subheading 2.3.1. 2. TKM 1: low-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 2 mM EDTA. 3. TKM 2: high-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 0.4 M NaCl, 2 mM EDTA. 4. 6 M NaCl: This is a supersaturated solution.

Isolation of DNA and RNA

27

5. 20% SDS: Dissolve 20 g SDS in 100 mL distilled water at 65°C. Store at room temperature.

2.5. Isolation of Total Cellular RNA (4) 1. Solution D: 50 g guanidinium thiocyanate (GTC), 58.6 mL of distilled water, 3.52 mL 0.75 M trisodium citrate, 5.28 mL 10% sarkosyl NL30. Incubate at 65°C to dissolve the GTC. Store at room temperature for up to 3 mo. Immediately before use, add 3 5 µL of β-mercaptoethanol to 5 mL of solution D. 2. 2 M NaOAC, pH 4.0. Store at 4°C. 3. Phenol:chloroform (4:1): water-saturated phenol, pH 4.0 chloroform (4:1). This can be purchased commercially (e.g., CamLabs). Store at 4° C.

3. Methods 3.1. Isolation of Mononuclear Cells from Whole Blood 1. Dilute 10–20 mL of whole blood 1:1 with ice-cold PBS. 2. Carefully layer onto an equal volume of the appropriate density gradient medium, e.g., Histopaque 1077, in a 30-mL sterile tube. 3. Centrifuge at 600g for 30 min at 22°C. 4. Carefully collect the cellular interface using a sterile Pasteur pipet and re-suspend the cells in 50 mL of ice-cold PBS. 5. Centrifuge at 800g for 30 min at 22°C to pellet the cells. 6. Re-suspend the cells in 1 mL of ice-cold PBS and store on ice until use.

3.2. Isolation of Platelets from Whole Blood (see Note 8) 1. Platelet rich plasma (PRP) is prepared from whole blood by centrifuging 10 mL of whole blood at 600g for 10 min at 22°C. (The leukocyte count of PRP is generally <0.2 × 109/L if carefully prepared.) 2. Carefully aspirate the PRP and layer onto 1 mL of 38% or 40% albumin. 3. Centrifuge at 1800g for 20 min at 22°C. The albumin acts as a cushion onto which the platelets will form a lawn. 4. Collect the platelet lawn and carefully resuspend in 10 mL of PBS. 5. Centrifuge at 1800g for 20 min at 22°C to pellet the platelets. 6. Carefully decant the supernatant and resuspend the platelet pellet in 1 mL of PBS.

3.3. DNA Isolation Using the Phenol/Chloroform Method (1) 1. Add 10 mL of anticoagulated whole blood to 90 mL of ice-cold sucrose lysis buffer, invert several times to mix and store on ice for 15 min. See Note 1 for use of smaller volumes. 2. Centrifuge the samples at 1000g for 10 min at 4°C. Decant the supernatant into a beaker and vigorously resuspend the pellet in 4.5 mL of TE, pH 8.0. The supernatant is potentially infectious and should be disposed of accordingly. 3. Lyse the cell pellet by adding 10 mL of nuclear lysis buffer and gently rotating the sample on a mechanical rotator at approx 250 rpm until a clear viscous solution is obtained. Samples can be frozen at this stage for processing at a later date.

28

Perry

4. Add 5 mL of buffer-saturated phenol/chloroform and mix on a mechanical rotator for 10 min (see Notes 2 and 3). 5. Centrifuge the samples at 1000g for 5 min at 20°C to separate the phases. Carefully remove the upper aqueous phase to a clean tube using a wide-bore pipet. Avoid aspirating any of the lower phase which contains phenol/chloroform and denatured proteins. 6. Add 5 mL of chloroform to the aqueous phase and mix on a mechanical rotator for 5 min. 7. Centrifuge the samples at 1000g for 5 min at 20°C to separate the phases. Carefully remove the upper aqueous phase to a clean tube using a wide-bore pipet. 8. Precipitate the DNA by adding 21/2 vol of ethanol and gently inverting the tube. Collect the DNA onto a sealed sterile glass Pasteur pipet, briefly rinse in 70% ethanol and re-suspend in 50 µL of sterile, distilled water or TE, pH 8.0. The DNA samples are stored at 4°C for 2–3 d to allow the DNA to go into solution and then stored at –20°C.

3.4. DNA Isolation Using the Salt-Precipitation Method (3) 1. Add 5 mL of whole blood to 20 mL of sucrose lysis buffer and mix by inverting several times. 2. Centrifuge the samples at 1000g for 10 min at 4°C. Decant the supernatant into a beaker and add 5 mL of TKM 1 to the pellet. Centrifuge the samples at 1000g for 10 min at 4°C. 3. Decant the supernatant and resuspend the pellet in 0.8 mL of TKM 2. Transfer the content into 2-mL labeled Eppendorf. Add 25 µL of 20% SDS to the tube and gently mix. Incubate at 57°C in a waterbath/heating block for 30 min. 4. Transfer the Eppendorf(s) into a benchtop rack and add 300 µL of 6 M NaCl, mix thoroughly. Centrifuge in a benchtop microfuge at maximum speed (13,000 rpm) for 10 min. 5. Transfer the supernatant into a clean 2-mL Eppendorf and add an equal volume of chloroform and mix by inversion. Centrifuge at 7,000 rpm for 5 min. 6. Transfer the supernatant into a sterile 20-mL tube and place on ice. Add an equal volume of ice-cold absolute ethanol and gently invert to precipitate the DNA. Collect the DNA onto a sealed sterile glass Pasteur pipette, rinse briefly in 70% ethanol and re-suspend in 500 µL of sterile, distilled water or TE, pH 8.0. The DNA samples are stored at 4°C for 2–3 d to allow the DNA to go into solution and then stored at –20°C.

3.5. Isolation of Total Cellular RNA (4) (see Notes 5 and 6) 1. Reusupend the mononuclear pellet from 10 mL of whole blood in 1.6 mL of solution D and vortex vigorously for 30 s. Split into 2 × 800 µL aliquots in 2-mL Eppendorfs (see Note 7). 2. To each tube add 80 µL of 2 M NaOAc, pH 4.0 and vortex briefly to mix. 3. Add 800 µL water-saturated phenol, pH 4.0 to each tube and vortex briefly to mix. 4. Add 160 µL chloroform:isoamyl alcohol (24:1) to each tube and vortex briefly to mix. Leave one ice for 15 min.

Isolation of DNA and RNA

29

5. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Collect the upper aqueous layer and transfer to a clean 2-mL Eppendorfs. 6. Add 800 µL of propan-2-ol to each tube and place at –20°C for 1–2 h (or overnight). 7. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Remove the supernatant and resuspend each pellet in 300 µL of solution D. Pool pairs of tubes. 8. Add 600 µL of propan-2-ol and place at –20°C for 1–2 h. 9. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Remove the supernatant and resuspend the pellet in 400 µL of TE, pH 8.0. 10. Check the yield and quality of the RNA by electrophoresing 5–10 µL in a 1.5% agarose gel in 1X Trios-Borate-EDTA (TBE). The 28S and 18S (and sometimes the 5S) ribosomal bands should be clearly visible.

For long-term storage, the RNA should be precipitated by adding 21⁄2 vol of ethanol and 1/10 vol of 3 M NaOAc and then placed at –70°C. 4. Notes 1. For packed cells, i.e., samples in which the plasma has been removed, 5 mL of packed cells is added to 45 mL of cell lysis buffer. Whole blood samples which have been frozen are thawed at 37°C and the tubes rinsed thoroughly with cell lysis buffer. For small volumes (100–200 µL) of blood, packed cells, leukocyte buffy coats, and so on, the cells should be lysed in 1.5 mL of cell lysis buffer, centrifuged in a benchtop microfuge at 12,000 rpm for 30 s, the supernatant carefully aspirated, and the lysis step repeated. The pellet should be resuspended is 100–200 µL of TE, pH 8.0 and the nuclei lysed by adding twice the volume of nuclear lysis buffer and vortexing the sample for 10–20 s. The lysed cells are then extracted once with 200 µL of phenol-chloroform and once with 200 µL of chloroform and the DNA precipitated by adding either 21/2 volume of ice-cold ethanol or an equal volume of prop-2-ol. The DNA is collected by centrifugation at 12,00 rpm in a microfuge for 30 s, washed carefully in 1 mL of 70% ethanol, allowed to dry at room temperature and then re-suspended in 50 µL of TE, pH 8.0. 2. Isoamyl alcohol (IAA) is commonly included in preparations of chloroform as a 24:1 (v/v) mixture to prevent foaming. However, this is not a problem using the techniques described and is not routinely included. 3. Phenol is extremely toxic and should be handled with care in a fume hood, wearing suitable protective clothing including goggles. 4. All solutions for RNA isolation must be treated with DEPC (diethylpyrocarbonate). Tris-containing solutions cannot be treated in the manner and should be made using DEPC-treated water and then autoclaved. 5. To make DEPC-treated water add 1 mL of DEPC to 1 L of distilled water. Incubate at 37°C overnight and then autoclave. Store at room temperature. 6. DEPC is a potential carcinogen and must be handled with care. 7. Cells may be lysed in Solution D and then stored at –70°C until convenient. We have combined with subsequent processing by the RNeasy™ kit, with great success.

30

Perry

8. Various commercial density gradient media, e.g., Nycodenz, which permit the isolation of a highly purified platelet fraction from whole blood.

References 1. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human inuslin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. 2. Maniatis, T., Fritsch E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 3. Lahiri, D. K. and Nurnberger, J. I. (1991) A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 19, 5444. 4. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.

Amplification of DNA and RNA by PCR

31

3 Amplification of DNA and RNA by PCR David J. Perry 1. Introduction The polymerase chain reaction (PCR) has revolutionized many areas of medicine, including hemostasis. Although this volume is not devoted to PCR, many of the chapters employ the technique at some point to amplify specific DNA or RNA sequences. This chapter, therefore, provides a brief outline of the techniques and methods for the amplification of both DNA and RNA. It should be remembered that no single protocol will be suitable for all PCR reactions and that optimization of the reaction is necessary whenever a new PCR reaction is undertaken. Further information on PCR can be found in one of the many textbooks on the subject that are available. PCR involves a complex series of chemical reactions in which a defined sequence of DNA (or a cDNA) is enzymatically amplified, resulting in the accumulation of many millions of copies of the original sequence. In each cycle, both strands are templates for the generation of two new duplex molecules. Repeated cycles of amplification, therefore, lead to a theoretical doubling of the number of target molecules in each round of synthesis. Each cycle of amplification is initiated by melting of the double-stranded DNA template (denaturation) to generate a single-stranded DNA template, followed by the annealing of short synthetic oligonucleotide primers that flank the sequence of interest. Finally, an in vitro DNA synthesis extension using a thermostable DNA polymerase, copies the DNA template, generating a double-stranded DNA molecule. For the amplification of RNA sequences, an additional step is required to convert the single-stranded RNA into a single-stranded cDNA, which is then suitable for amplification by PCR.

From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

31

32

Perry

2. Materials All materials/reagents should be prepared with sterile distilled water and reserved for PCR. Aerosol resistant tips and dedicated pipets minimize the risk of contamination.

2.1. Amplification of DNA 1. Genomic DNA: 100–500 ng (see Note 1). 2. 20 mM dNTP mix: A mix of dNTPs (dATP, dCTP, dGTP, and dTTP) is prepared in distilled water and stored at –40°C. The initial concentration of each dNTP in the reaction mix (assuming a 100 µL reaction) is 200 µM, i.e., 20 mM diluted 100-fold. Ready prepared stocks of dNTPs are available from many sources and are convenient and reliable. These must be diluted and mixed before use to generate a master mix. 3. 10X PCR buffer (see Note 2): There are a numbers of buffers for use in PCR and many of these are dependent upon the specific thermostable DNA polymerase. Buffers are generally made up as a 10X stock, divided into 500-µL aliquots and stored at –20°C to –70°C until required. Buffers are frequently supplied by the manufacturer with a specific DNA polymerase. In general we find that one of the following buffers generates excellent results: Buffer 1 (10X): 100 mM Tris-HCl, pH 8.4, 500 mM KCl, 1% Triton X-100 Buffer 2 (10X): 160 mM (NH4)2SO4, 670 mM Tris-HCl, pH 8.8, 0.1% Tween-20 4. 25 mM MgCl2: Many 10X buffers include MgCl2 at a concentration of 15 mM (final concentration 1.5 mM). However, in some cases adjustment of the Mg concentration may increase the yield and/or specificity of the final PCR product. We therefore routinely add the Mg separately (see Notes 3 and 4). 5. Synthetic oligonucleotide primers: Diluted in water to 100 pmoles/µL (see Note 5). 6. Thermostable DNA polymerase diluted to 1 U/µL in 1X PCR buffer (see Note 6). 8. DMSO: DMSO to a final concentration of 10% is included in some amplification reactions (see Note 7). 7. Mineral oil (Sigma). 9. Thermal cycler, e.g., Perkin-Elmer.

2.2. Reverse Transcription and Amplification of RNA 2.2.1. Reverse Transcription of RNA Molecular biology grade reagents and RNAse-free sterile disposable plasticware should be used wherever possible. All chemicals/reagents should be reserved for RNA use only. All solutions should be DEPC-treated or made from DEPC-treated solutions. Disposable gloves should be worn at all times. 1. 5–50 ng of total cellular RNA or X-Xng of mRNA (see Note 8). 2. Reverse transcription primer: 50 pmoles/µL. This may be the downstream amplification primer for the subsequent PCR or an Oligo (dT)15-17 primer (see Note 9). 3. 20 mM dNTPs (dATP, dCTP, dGTP, dTTP): Make up at a 20 mM stock solution and store at –20°C to –70°C.

Amplification of DNA and RNA by PCR 4. 5. 6. 7. 8.

33

10X PCR buffer: 100 mM Tris-HCl, pH 8.4, 500 mM KCl (see Note 10). 25 mM MgCl2. AMV (Avian myeloblastosis virus) reverse transcriptase: 25 U/µL. RNAse inhibitor: RNAsin 5 U/µL (Promega). DEPC-treated water (see Note 11).

3. Methods 3.1. PCR Amplification of DNA Many PCR reactions require optimization to ensure efficient and specific amplification of the target DNA sequence. The following protocol provides a starting point that has proven successful in our hands for the amplification of many target sequences. Modifications and optimization of the reactions are covered in the notes section. In a 0.5-mL sterile, thin-walled PCR tube, combine: 1. 10 µL of 10X PCR buffer. 2. 6 µL 25 mM MgCl2. This results in a final concentration of magnesium in a 100 µL PCR reaction volume of 1.5 mM. If a magnesium-containing PCR buffer is used, this step should be omitted. 3. 1 µL of 20 mM dNTP stock: Final concentration of each dNTP is 200 µM. 4. 2 µL of primer mix containing 100 pmoles of each amplification primer (see Note 5). 5. XX µL of sterile, distilled water. The precise volume is dependent upon the actual concentration of the DNA, dNTPs and primers but the final volume of the entire reaction will be 100 µL. The water should be added prior to step 6. 6. Place on the surface of a UV transilluminator for 10 min. 7. Add X µL of DNA (~500 ng–1 µg). The precise volume is dependent on the DNA concentration. 8. Add 1–2 U of a thermostable DNA polymerase. 9. Mix gently and spin briefly in a microcentrifuge to pellet any drops of fluid that may be adherent to the sides of the tube. 10. Overlay with 100 µL of mineral oil and place in a programmable heating block preheated to 94°C. In some PCR blocks, the use of a heated lid prevents evaporation and therefore eliminates the need for oil. 11. Amplification: An initial denaturation is usually carried out at 94°C for 5 min (see Note 12). This ensures that all the double-stranded DNA is single-stranded prior to amplification. The reaction is then cooled as rapidly as possible to the annealing temperature, which allows the single-stranded DNA template to bind to the amplification primers. The annealing temperature is dependent on many variables, including the length and sequence of the amplification primers, but a useful starting point if using 20-mer amplification primers is 50°C. The tubes should remain at this temperature for 5 s. The temperature is then raised to the extension temperature usually 72–74°C. The extension times depend on the size of the fragment being amplified, but a useful starting point is to assume an exten-

34

Perry

sion rate of 1 kb/min. In practice, much shorter extension times can be used without any problem. Finally the temperature is raised to 94°C to denature the doublestranded DNA. The cycle is then repeated. Most templates will require 30–40 rounds of amplification. 12. Following amplification, the PCR reaction is carefully removed to a clean tube, taking care not to carry over any oil. 5–10 µL of each amplification is then run on an agarose gel to check the efficiency and specificity of the reaction.

3.2. Amplification of Total Cellular RNA The amplification of RNA is preceded by a reverse transcription step, which generates a single-stranded DNA molecule that is complementary to the original RNA. In the subsequent amplification reaction, the single-stranded DNA is converted to a double-stranded DNA molecule by the action of the DNA polymerase.

3.2.1. cDNA Synthesis In a sterile, 0.5-mL Eppendorf, combine: 1. 100–500 ng of total cellular RNA. The precise volume will depend on the concentration of the RNA. 2. 20 pmoles of the downstream amplification primer or 50 pmoles of an oligo (dT)15–17 primer. If the downstream amplification primer is used as a primer for the reverse transcription, it should be purified before use either by HPLC or by gel electrophoresis (see Note 13). 3. 200 µmoles of each dNTP (dATP, dCTP, dGTP, dTTP). 4. 2 µL of 10X PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl). 5. 6 µL of 25 mM MgCl2. 6. Incubate at 65°C for 10 min, then place on ice and add 20 U of RNAsin and 20 U of AMV reverse transcriptase. 7. DEPC-treated sterile water to 20 µL. 8. Incubate at 20°C for 10 min, 42°C for 60 min, and finally at 95°C for 10 min to inactivate the reverse transcriptase. 9. Following reverse transcription, samples are stored on ice until required or frozen at –80°C.

3.2.2. PCR Amplification of Single-Stranded cDNA Combine the following in a 0.5-mL thin-walled, sterile Eppendorf: 1. 2–20 µL of the reverse transcription reaction. The precise volume depends on the frequency of the particular RNA species that is being amplified. For rare RNA species, the entire reverse transcription reaction may be required. 2. 8 µL of 10X PCR buffer (see Note 14). 3. 2 µL 25 mM MgCl2. 4. 100 pmoles of each amplification primer.

Amplification of DNA and RNA by PCR

35

5. Sterile water to 100 µL. 6. The amplification reactions are heated to 100°C for 5 min and then allowed to cool to 20°C for 2 min to allow the primer to anneal to the single-stranded DNA. This is conveniently performed in the PCR block. 2.5 U of a thermostable DNA polymerase is then added to each tube, e.g., Amplitaq, and the samples overlaid with 100 µK of light mineral oil. The samples are then incubated at 70°C for 10 min to allow the generation of a double-stranded DNA molecule, followed by 40 cycles of PCR. 7. Following amplification 8–10 µL of each reaction is run on agarose gel to check the efficiency and specificity of the reaction.

4. Notes 1. a. PCR can be used to amplify DNA from many sources, e.g., genomic DNA, plasmid DNA, bacterial DNA, and so on. For the amplification of cloned DNA as little as 10–20 ng may be sufficient. As a general guide, the amount of DNA used as a template should be increased as the complexity of the source increases. b. The fidelity of an amplification reaction is dependent on a number of variables including the DNA concentration. Any errors introduced in the first few cycles will be amplified in subsequent cycles. The fraction of the final product that contains a mutation is inversely proportional to the number of initial DNA molecules. If the number of starting DNA molecules is small, it may be advisable to use a DNA polymerase with proofreading ability. 2. a. When all else fails, the following buffer is often useful: 670 mM Tris-HCl pH 8.8, 166 mM (NH4)2SO4, 67 mM MgCl2, 1.5 mg/mL bovine serum albumin and 100 mM b-mercaptoethanol. Store the inorganic solution at room temperature and add the BSA and b-ME immediately before use. The high concentration of Mg2+ often results in nonspecific products. b. Many manufacturers include gelatin (final concentration 0.01%) or Triton X100 (final concentration 0.1%) in the buffer to stabilize the enzyme during thermal cycling. Inclusion of such components may increase the efficiency of the amplification reaction. 3. a. dNTPs bind to Mg2+ in a 1:1 molar ratio, i.e., 0.8 mM dNTPs will bind 0.8 mM Mg2+. Therefore, in an amplification mix containing a final Mg2+ concentration of 1.5 mM, only 0.7 mM Mg2+ (1.5–0.8 mM) is “free” and active as a cofactor for the DNA polymerase. If the concentration of dNTPs is increased, e.g., in long-range PCR, then the amount of bound Mg2+ increases and the functionally active free Mg2+ decreases. In such cases there may be insufficient Mg2+ for the enzyme to function. It is important, therefore, that if the concentration of dNTPs in a reaction mix is increased, the concentration of Mg2+ is also increased. b. To prevent misincorporation of nucleotides, it is important the all four dNTPs are present in equal concentration. 4. The concentration of Mg2+ in the PCR mix is one of the key variables affecting both yield and specificity. High Mg2+ concentrations lead to nonspecific

36

Perry

amplification by stabilizing priming at incorrect template sites. Furthermore, high Mg2+ concentrations may also stabilize double-stranded DNA therefore reducing the yield of the final PCR product. Low Mg2+ concentrations may also affect the yield of the final PCR product as Mg2+ is required as a cofactor for the DNA polymerase (see Note 3). 5. a. Primer design has become greatly simplified by development of various computer programmes, e.g., Lasergene and Oligo 4. and in our experience very few primer pairs fail to work having been designed using such programmes. b. The length of a primer can vary between 17–26mers. For PCR from complex sources such as genomic DNA, 20–26mers allow amplification of specific sequences. In contrast if the template is simpler then shorter primers, e.g., 17mers may suffice. There are a number of rules that should be observed when designing primers, e.g., GC content, avoiding 3' complementary ends, and so on. For a guide to the design of primers, the reader is referred to one of the many excellent PCR primers available. c. The concentration of primers in the PCR mix should be similar unless asymmetric PCR is being performed. Primers are usually received resuspended in distilled water and their concentration is given. If primers are received freeze dried they should be resuspended in 100–500 µL of distilled water. If the concentration of the primers is unknown this can be calculated by measuring their optical density (OD) at 260nm (1 OD260 = 40 µg of single-stranded oligonucleotide). We routinely mix relevant primer pairs, such that 2 µL of the mix contain 100 pmoles of each primer and scale up the mix so that we have enough of the primer mix for 50 or 100 amplifications, e.g.: Primer A: Concentration = 400 µM (= 400 pmol/µL) Primer B: Concentration = 500 µM (= 500 pmol/µL) Therefore, a mix comprising 0.25 µL of Primer A + 0.2 µL of Primer B + 1.55 µL of distilled water will contain 100 pmol of each primer in a final volume of 2 µL. To make sufficient primer mix for 100 separate amplifications these volumes are multiplied by 100, i.e., 25 µL of Primer A + 20 µL of Primer B + 155 µL of water. 6. Thermostable DNA polymerases isolated from a variety of bacteria are now available for use in the PCR process. In many cases the choice is dictated by availability and price. However, some DNA polymerases, e.g., “Vent” and “Pfu,” have a 3'–5' proofreading exonuclease activity that can significantly reduce the number of misincorporation errors that occur during PCR. Such enzymes are, extremely useful if the number of starting template molecules are small or if the final PCR product is to be cloned and expressed. Enzymes with 3'–5' proofreading exonuclease activity should not be used for allele-specific amplification and similarly they cannot be used (without modification of the final PCR product) if the amplified product is to be cloned using a T-vector, e.g., “TA Cloning System” (Invitrogen) as the product contains no overhangs. 7. DMSO to a final concentration of 10% may increase the efficiency and/or specificity of some DNA polymerases. However, there are some reports that DMSO

Amplification of DNA and RNA by PCR

8.

9.

10.

11.

12.

13.

37

may be inhibitory to certain DNA polymerases and it is not, therefore, routinely included in our amplification reactions. The quality of the RNA is crucial in RT-PCR. Techniques for isolating RNA from a wide variety of cells are now available. Total cellular RNA is adequate for the vast majority of experiments and rarely do we find any necessity to isolate mRNA species. Reverse transcription of RNA using the downstream amplification primer used subsequently for the PCR is routinely used and generates excellent results for a wide variety of templates. However, Oligo(dT)15–17 (50 pmol) can also be used with similar results. We do not routinely use an RT-specific buffer but instead the KCl-based PCR buffer. For most situations this appears to work satisfactorily. For some experiments it may be necessary to use an RT-specific buffer. Such buffers are frequently supplied with the reverse transcriptase enzyme Diethyl pyrocarbonate (DEPC) is a suspected carcinogen and should be used with care in a fume hood. DEPC should not be used directly in Tris-based solutions but such solutions can be made with DEPC-treated water (see Chapter 1). The efficiency and specificity of the PCR can often be improved by the use of a “hot start.” A “hot start” involves omitting a key component from the PCR mix, e.g., DNA polymerase, and denaturing the sample at 94–100°C for 5 minutes. The missing component is then added directly to the tube and then overlaid with mineral oil or the heated lid lowered. Oligonucleotides for use in reverse transcription experiments are purified before use. This is most easily achieved by HPLC purification but an alternative approach involves electrophoresis in 20% denaturing polyacrylamide gels followed by elution. 50 cm × 20 cm × 1 mm 20% polyacrylamide gels are cast using 72 g urea, 75 mL of 40% acrylamide (19:1 acrylamide/bisacrylamide) and polymerized with 150 µL of TEMED and 150 µL of 25% ammonium persulphate (gel volume = 150 mL). A 5-well comb with 200 µL wells is used. Gels are pre-run at 60 W for 30 min before use. Approximately 0.02 µmol of crude oligonucleotide is mixed with 0.5 vol of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanole) in a final volume of 100–150 µL, incubated at 100°C for 5 min, and loaded onto the gel. Gels are run at 60 W constant power in 1X TBE until the bromophenol blue dye front has reached the end of the gel. The plates are then separated and the DNA visualized by UV shadowing. Bands of the correct size are excised, placed in a 2-mL Eppendorf, and crushed with a pipet tip. 1.5 mL of water is added and the DNA eluted into the distilled water by vigorous shaking (in an orbital shaker at 250 rpm) at 37°C for 24 h. The DNA is then placed in dialysis tubing (SpectraPor No. 6 dialysis tubing) and dialyzed against distilled water for 48 h at 4° C, changing the water every 12 h. The oligonucleotide is then freeze-dried, re-suspended in 50–100 µL of distilled water, and quantitated by measuring its OD260. From the formula: (OD260 × dilution × 40/309 × mer) × 103

38

Perry

where “mer” is the length of the oligonucleotide and “dilution” the dilution of the oligonucleotide prior to measuring its OD260, the concentration of the oligonucleotide can be established. So, for example, if 20 µL of a 26-mer oligonucleotide is diluted to 1 mL and its OD260 is 0.449 then the concentration of the oligonucleotide is 118 µM (0.118 mM), which equals 118 pmol/µL. 14. This is usually the same buffer used in the reverse transcription reaction, unless a reverse transcriptase specific buffer has been used.

Suggested Reading Erlich, H. A. (1989) PCR Technology: Principles and Applications for DNA Amplification. Stockton Press, London. McPherson, M. J., Hames, B. D., and Taylor, G. R (1995) PCR 2: A Practical Approach. IRL, Oxford, UK. White, B. A. (1993) PCR Protocols. Humana Press, Totowa, NJ.

Direct Sequencing

39

4 Direct Sequencing of PCR Products David J. Perry 1. Introduction Sequencing is an increasingly important part of the analysis of a polymerase chain reaction (PCR) product and is used in many areas of hemostasis. The protocols described in this chapter have been used to sequence many different PCR templates and provide high-quality, reproducible sequence data. In general, the most important part of sequencing a PCR product is the quality of the DNA template and in particular ensuring that it is free from any contaminating amplification primers or dNTPs. Residual amplification primers that may be present in a sequencing reaction can act as sequencing primers, making the final sequence unreadable. A number of approaches have been taken to try to overcome this problem. Initially, PCR products were cloned and then sequenced. However, cloning is time-consuming even with the use of PCR-specific cloning vectors, and furthermore, a single clone provides sequence data on only a single DNA molecule. Subsequent developments allowed “direct” sequencing of amplified DNA following purification of the PCR products. There are countless physical methods for purifying a PCR product prior to sequencing, e.g., GeneClean™, Sephadex G50 chromatography, agarose gel electrophoresis, and so on. To some extent the success of these methods is dependent on the size of the PCR product. GeneClean, for example is ideal for purifying PCR products that are greater than 500 bp in length but is of little value for products that are less than 400 bp. An entirely different approach to generating single-stranded DNA involves the use of asymmetric PCR in which one of the amplification primers is present in limited amounts, such that one primer is exhausted and linear amplification then takes place or alternatively the PCR product forms the basis of a second PCR in which only one amplification primer is present. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

39

40

Perry

Two different protocols are covered in this chapter. The first involves radiolabeling a “nested” sequencing primer, i.e., one that is internal to the amplification primers, with either [γ32P]-dATP or [γ33P]-dATP and which is then used to sequence a purified PCR template. The advantage of this technique is that it allows sequence data to be derived up to the sequencing primer, which may be of value when sequencing short PCR products. The second method involves [α35S]-dATP rather [γ-32P]-dATP and nested sequencing primers. However, in contrast to the first method, the primer is not radio-labelled but instead [35S]-dATP is incorporated during the sequencing reaction. Direct solid-phase sequencing of PCR products using biotinylated primers is covered in a separate chapter. 2. Materials All reagents are molecular grade of equivalent. Many of the sequencing reagents are available commercially in kit form, e.g., Sequenase v2 (Amersham Life Sciences). Although the method described is for sequencing using a labeled oligonucleotide sequencing primer, methods are also included for the use of a nonlabeled primer and the incorporation of the radioisotope during the sequencing reaction.

2.1. Direct Sequencing of PCR Generated Templates Using 5'-Labeled Oligonucleotide Primers Direct sequencing of PCR products using a 5'-labeled oligonucleotide primer involves five separate steps: 1. 2. 3. 4. 5.

5'-labeling of the oligonucleotide primer. Purification of the PCR product to provide a template for sequencing. Annealing of the primer to the template. Extension-termination reactions. Casting, running, fixing, and drying the sequencing gel.

2.1.1. 5'-Labeling of Oligonucleotide Sequencing Primers Using T4 Polynucleotide Kinase Synthetic oligonucleotides for use as sequencing primers can be labeled at their 5'-terminus using T4 polynucleotide kinase: 1. Synthetic oligonucleotide primer: 25 pmol/µL in water (see Note 1). 2. 10 X T4 polynucleotide kinase (T4 PNK) buffer: 700 mM Tris-HCl, pH 7.6, 100 mM MgCl2, 5 mM dithiothreitol (DTT). Store at –20°C. 3. Bovine serum albumin at 10 mg/ mL. 4. [γ32P]-dATP (5000 Ci/mmol) (see Note 2). Available from a variety of sources, e.g., Amersham Life Sciences. 5. T4 polynucleotide kinase: 10 U/µL. 6. Distilled water.

Direct Sequencing

41

2.2. Purification of PCR Products for Sequencing A variety of methods are available for the purification of PCR products prior to sequencing. The methods listed below have all been used with great success. For products greater than 500 bp, GeneClean (or similar) is the method of choice.

2.2.1. Purification of PCR Products by Sephadex G50 Chromatography 1. Sephadex G50 (Pharmacia): Preswollen and stored at 4°C in TE, pH 8.0. 2. TE, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 3. 1-mL syringe in which the plunger has been removed and the end of the syringe plugged with glass wool 4. 100 µL of crude PCR product.

2.2.2. Purification of PCR Products Using GeneClean II DNA is bound to a glass matrix, washed, and then eluted. Any small DNA fragments, e.g., primers, remain bound to the glass matrix and only the larger DNA fragments are eluted. 1. GeneClean II Kit (BIO 101 Inc, La Jolla, California). GeneClean contains “Glass Milk”–a DNA binding matrix, 6 M sodium iodide (NaI) and a concentrated “wash solution.” Before use, the wash solution must be reconstituted by mixing 14 mL of the provided concentrate with 280 mL of distilled water and then adding 310 mL of 100% ethanol. This should be stored at –20°C.

2.2.3. Purification of PCR Products by Agarose Gel Electrophoresis PCR products are run in low gelling (melting) temperature agarose. The band of interest is excised and purified either by GeneClean II or by a “freezethaw” method. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

Low gelling temperature agarose (available from many laboratories). 1X Tris-Acetate-EDTA (1X TAE): 0.04 M Tris-acetate, 0.001 M EDTA (see Note 3). TE, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. TE-saturated phenol (see Note 4). Chloroform. Ethidium bromide 0.5 µg/mL (see Note 5). 7.5 M Ammonium acetate. Absolute ethanol. Sterile, distilled water. Sucrose loading buffer: 40% sucrose (w/v), 0.25% bromophenol blue (w/v), and 0.25% xylene cyanole (w/v).

2.2.4. Purification of PCR Products by Selective Precipitation In this method large DNA fragments are selectively precipitated and then purified, whereas free primers and dNTPs remain in solution.

42 1. 2. 3. 4.

Perry 7.5 M Sodium acetate. Absolute ethanol. 70% ethanol. Sterile, distilled water.

2.3. Annealing Primer to Template and Sequencing of the PCR Product Sequencing of the purified PCR template involves annealing the 5'-labeled primer to the purified single-stranded DNA template and then performing the extension-termination reactions. 1. Sequencing primer (concentration 1 pmol/µL) labeled at its 5'-end with [γ32P]dATP. 2. 5X Reaction buffer: 200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 250 mM NaCl. Store at –20°C. Thaw before use and keep on ice. 3. Purified DNA template–at least 150 ng. 4. 0.1 M Dithiothreitol (DTT). Store at –20°C. Thaw before use and keep on ice. 5. T7 DNA Polymerase (e.g., Sequenase v2.0; 14 U/µL). Store at –20°C. Do not remove from the freezer—aliquots should be removed as required directly into the prechilled sequencing master mix. 6. Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. 7. Termination mixes (see Note 6). Store at –20°C. Thaw before use and keep on ice until required. ddGTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddGTP ddATP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddATP ddTTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddTTP ddCTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddCTP 8. 5X dGTP Labeling mix: 7.5 µM dGTP, 7.5 µM dCTP, 7.5 µM dTTP. 9. Stop solution: 95% formamide (v/v), 20 mM EDTA, 0.05% bromophenol blue (w/v), 0.05% xylene cyanol (w/v).

2.4. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. 40% premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 2. Urea. 3. 25% Ammonium persulphate freshly prepared. 4. N,N,N',N'-tetramethylethylenediamine (TEMED). 5. Distilled water.

Direct Sequencing 6. 7. 8. 9. 10. 11. 12.

43

10X Tris-Borate-EDTA (TBE). Duck-billed tips for loading the gel Sequencing plates (40/50 cm × 20 cm). Silanizing solution, e.g., dimethylchlorosilane (Sigma). 2 L of 5% methanol/5% acetic acid in water. Whatman 3MM paper. Autoradiograph film, e.g., Kodak.

3. Methods 3.1. Direct Sequencing of PCR Generated Templates Using 5'-Labeled Oligonucleotide Primers

3.1.1. 5'-Labeling of Oligonucleotide Sequencing Primers Using T4 Polynucleotide Kinase Twenty-five pmol of sequencing primer is labeled in a final volume of 25 µL. This is sufficient for 25 separate sequencing reactions. 1. Place a 1.5-mL sterile Eppendorf on ice and add: X µL of water [the exact volume will vary depending upon the concentration of the oligonucleotide but the final volume of the reaction should be 25 µL], 25 pmol of sequencing primer in a volume of X µL, 2.5 µL of 10X T4-PNK buffer, 1 µL of bovine serum albumin, 7.5 µL (75 µCi) of [γ32P]-dATP. Add 1 µL (10 U) of T4-polynucleotide kinase. 2. Incubate at 37°C for 60 min and then at 85°C for 15 min to inactivate the T4 PNK. 3. Use 1 µL (1 pmol) of the labeled oligonucleotide per template. The labeled primer may be safely stored at –20°C for 7–10 d but its usable life-span is limited by the short half-life of the [32P]-dATP. Purification of the labeled template away from the unincorporated radio-nucleotide is unnecessary.

3.2. Purification of PCR Products for Sequencing 3.2.1. Purification of PCR Products by Sephadex G50 Chromatography 1. Plug the end of a 1-mL disposable plastic syringe with glass wool and pack with Sephadex G50 (Pharmacia-LKB Ltd.) preswollen with TE, pH 8.0. 2. Place the syringe into a 15-mL tube (e.g., Falcon) and centrifuge at 200g for 3 min. 3. Apply the crude PCR product to the top of the syringe. 4. Centrifuge at 200g for 3 min. 5. Collect the eluate which contains the purified PCR product. 6. Evaporate under vacuum to reduce the volume, e.g., in a Speedivac. Final volume should be ~7 µL.

3.2.2. Purification of PCR Products for Sequencing Using GeneClean II (see Note 7) 1. Add 3 vol of 7 M NaI to the crude PCR product. This is generally 540 µL of NaI for 80 µL of the PCR product.

44

Perry

2. Vortex the Glass Milk until all the contents are in suspension and then add10 µL to the NaI-PCR solution and place on ice for 20 min. The samples should be inverted several times during this period to keep the Glass Milk in suspension. 3. Pellet the Glass Milk by spinning in a microcentrifuge at 12,000 rpm for 5 s. 4. Carefully aspirate the supernatant and discard. 5. Add 500 µL of cold wash solution to the Glass Milk and vortex to resuspend the Glass Milk. Efficient re-suspension of the Glass Milk is extremely important 6. Pellet the Glass Milk by spinning in a microcentrifuge at 12,000 rpm for 5 s. Carefully aspirate the supernatant and discard. 7. Repeat the wash/spin step twice. After the second spin, spin the tube again to pellet any remaining wash solution, carefully aspirate and discard. 8. Add 20 µL of distilled water to the Glass Milk and resuspend the pellet. 9. Incubate at 55°C for 20 min. Spin at 12,000 rpm for 30 s. Carefully remove the supernatant to a clean tube. A second elution can be performed but in practise the additional yield of DNA is very small.

3.2.3. Purification of PCR Products by Agarose Gel Electrophoresis 1. Pour a 10 × 5 × 0.5 cm, 1% low gelling temperature agarose gel in 1X TAE containing ethidium bromide 0.5 µg/mL. Use a comb or well former that creates wells capable of holding 50–60 µL. 2. Submerge the gel in chilled 1X TAE. 3. Add 10 µL of sucrose loading buffer to 100 µL PCR product and load into the wells of the gel. 4. Electrophoresis is performed at no more than 5–10 V/cm otherwise the gel will melt!

Electrophoresis can be performed at room temperature but the electrophoresis times can be shortened either by running the gel at 4°C or by placing the electrophoresis apparatus onto a bed of ice. 5. When the xylene cyanole dye has migrated to the end of the gel, place the gel onto the surface of a UV transilluminator, the surface of which has been previously covered with Saran Wrap™. Visualize and excise the band of interest under low power UV light and place into a sterile Eppendorf. 6. To denature the gel matrix and release the DNA, place the gel slice at –80°C for 5 min and then at 37°C for 10 min. Repeat this step once. 7. Centrifuge the gel slice in a benchtop microfuge at 12,000 rpm for 20 min. 8. Collect the supernatant, extract once with an equal volume of TE-saturated phenol and once with equal volume of chloroform. 9. Precipitate the DNA by adding 1/10 vol of 7.5 M ammonium acetate, 2 1/2 vol of ethanol, and place the sample at –80°C for 20–30 min in a microfuge. 10. Collect the DNA by centrifugation at 12,000 rpm for 10 min, wash the DNA pellet in 400 µL 70% ethanol and finally resuspend in 20 µL of sterile distilled water. Use 7 µL for the sequencing reaction.

Direct Sequencing

45

3.2.4. Purification of PCR Products by Selective Precipitation 1. In a sterile 1.5-mL Eppendorf, add 100 µL of the PCR reaction to 50 µL of 7.5 M sodium acetate and 100 µL of absolute ethanol. 2. Incubate at 20°C for 5 min then centrifuge in a benchtop microfuge at 12,000 rpm for 15 min. It is important that the precipitation is carried out at 20°C (room temperature) but not at 4°C. Lower temperatures will allow some of the primers to precipitate. 3. Carefully aspirate the supernatant leaving the DNA pellet on the side of the Eppendorf. 4. Add 400 µL of 70% ethanol to the pellet, vortex briefly, and then centrifuge in a benchtop microfuge at 12,000 rpm for 5 min. Carefully aspirate the supernatant. 5. Dry the pellet under vacuum, e.g., Speedivac, and resuspend in 20 µL of distilled water.

3.3. Annealing Template and Primer 1. To anneal the labeled primer to the purified double-stranded DNA template, combine: 1 pmol (1 µL) of the radiolabeled sequencing primer (see Note 8), 7 µL of the purified DNA template (at least 150 ng) is required and 2 µL of 5X reaction buffer. 2. Heat to 100°C for 5 min and then rapidly chill in liquid nitrogen or a dry-ice/ methanol bath. 3. Allow to thaw on ice, briefly spin to pellet any condensation, and keep on ice until required.

3.4. The Sequencing Reactions There are two methods described here. The first involves the use of a radiolabeled primer (32P) and the other an unlabeled primer but the isotope (35S) is incorporated during the sequencing reaction.

3.4.1. Sequencing Using a Radiolabeled Primer 1. Prepare a sequencing master mix on ice (total volume = 5.5 µL × the number of reactions) comprising: 1 µL 0.1 M DTT, 2.5 µL of sterile water and 2 µL (3 U) of diluted Sequenase (diluted 1+7 in enzyme dilution buffer). Add 5.5 µL to each annealed template-primer. 2. Aliquot 2.5 µL of each termination mix in either 0.5–1.5-mL Eppendorfs or more conveniently into the wells of a sequencing microtiter plate. Keep at 4°C but prior to use warm to 37°C for 3–5 min. 3. Add 3.5 µL of the annealed template-primer (step 1) to each of the four termination mixes. Incubate at 37°C for 5 min. 4. Add 4 µL of stop solution to each well or Eppendorf and place at 4°C until ready to load.

3.4.2. Sequencing Using a Nonlabeled Primer and [α-35S]-dATP 1. Prepare a sequencing master mix on ice (total volume = 5.5 µL × the number of reactions) comprising: 1 µL 0.1 M DTT, 2 µL of diluted dGTP labeling mix (diluted

46

2. 3.

4. 5.

Perry 1+4 in sterile water (see Note 9), 0.5 µL [α-35S]-dATP (1000-1500 Ci/mmol), and 2 µL (3 U) of diluted Sequenase (diluted 1+7 in enzyme dilution buffer). Incubate at room temperature for 5 min. While step 2 is incubating, aliquot 2.5 µL of each termination mix in either 0.5– 1.5-mL Eppendorfs or more conveniently into the wells of a sequencing microtitre plate and place at 37°C for 3–5 min. Add 3.5 µL of the annealed template-primer (step 1) to each of the four termination mixes. Incubate at 37°C for 5 min. Add 4 µL of stop solution to each well or Eppendorf and place at 4°C until ready to load.

3.5. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. Wash the gel plates carefully with detergent, rinse in deionized water, and dry with lint-free tissues. 2. To remove any grease, wipe each plate with an alcohol-moistened tissue and allow to dry. 3. Apply 1–2 mL of silanizing solution to one of the plates (commonly the “eared” plate) and allow to dry in a fume cupboard. 4. Assemble the plates according to the manufacturer’s instructions and place on one side. 0.4 mm spacers are generally used. 5. To prepare a 100 mL 6% denaturing gel, combine 15 mL of 40% acrylamide (19:1 acrylamide:bisacrylamide), 10 mL of 10X TBE, 42 g of urea and water to 100 mL (see Note 10). Cover with cling film and place on a magnetic stirrer until the urea has dissolved. 6. To initiate polymerization, add 140 µL of 25% ammonium persulfate and 140 µL of TEMED. Aspirate the solution into a 50-mL syringe, attach a 0.4-µm filter and slowly inject the gel mix between the gel plates. Insert a comb between the gel plates and allow the gel to polymerize for at least 60 min. 7. Carefully remove the comb and assemble the sequencing apparatus. 8. Fill the buffer reservoirs with 1X TBE and flush out the wells of the gel with buffer. 9. Prerun the gel at 35–50 W for 30 min. 10. Denature the sequencing reactions by heating to 100°C for 3 min and then place on ice (see Note 11). 11. Flush the wells of the gel and load the samples. It is convenient to load the first and second lanes with an identical sample, e.g., the “A” mix of reaction 1, or to miss a lane after the first four lanes have been loaded. In this way the autoradiograph can be easily orientated. 12. Run the gel for as long as needed then stop. Carefully separate the plates and immerse the gel, still attached to one of the glass plates into 2 L of fixing solution (see Note 12). 13. Transfer the gel onto 3MM paper, cover with Saran Wrap and dry under vacuum at 80°C. 14. Autoradiograph overnight.

Direct Sequencing

47

4. Notes 1. Crude oligonucleotides may be used without purification and frequently provide excellent results. Many suppliers of oligonucleotides frequently offer a facility for purification of the crude oligonucleotide either by HPLC or occasionally by polyacrylamide gel electrophoresis (PAGE). It is probably worthwhile using this facility if a particular oligonucleotide is to be used as a sequencing primer. The following method using 20% denaturing polyacrylamide gels has been used with great success in our laboratory for the purification of synthetic oligonucleotides and is included for those who are interested in purifying the own oligonucleotides. 50 cm × 20 cm × 1 mm 20% polyacrylamide gels are cast using 72 g urea, 75 mL of 40% acrylamide (19:1 acrylamide/bisacrylamide) and polymerized with 150 µL of TEMED and 150 µL of 25% ammonium persulphate. A 5-well comb with 200 µL wells is used. Gels are pre-run at 60 W for 30 min before use. Approximately 0.02 µmol of crude oligonucleotide is mixed with 0.5 vol of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanole) in a final volume of 100–150 µL, incubated at 100°C for 5 min and loaded onto the gel. Gels are run at 60 W constant power in 1X TBE (0.045 M Tris-Borate, 0.001 M EDTA) until the bromophenol blue dye front reaches the end of the gel. The plates are then separated, and the DNA visualized by UV shadowing. Bands of the correct size are excised, crushed in an Eppendorf and the DNA eluted into distilled water by vigorous shaking at 37°C for 24 h followed by dialysis (Spectra/Por No. 6 dialysis tubing) in distilled water for 48 h at 4°C. Oligonucleotides are then freeze-dried, re-suspended in 50–100 µL of distilled water and quantitated by measuring their OD260. 2. [γ32P]ATP is a high energy β emitter and appropriate safety measures must be taken. 3. TAE is routinely used both to prepare agarose gels and as a running buffer if DNA is to be isolated from a gel. TBE gels should be avoided. 4. Phenol is extremely toxic and must be handled with great care. Gloves, masks and safety glasses must be worn. Phenol must be handled in a fume hood. 5. Ethidium bromide is a potent carcinogen and teratogen and must be handled with great care. 6. Although termination mixes can be prepared from the solid reagents it is much easier to purchase them ready made, usually as part of a kit. 7. “GeneCleaning”of PCR products can also be used to prepare a template for sequencing using [α-35S]-ATP. 8. If using [α-35S]-ATP to sequence then the primer is not labelled but the isotope is incorporated during the sequencing reactions. In this case increasing the primer concentration to 10 pmol/µL yields optimal results. 9. The precise dilution of the dGTP labelling mix is dependent upon how close to or away from the primer, sequence data is required. For sequences close to the primer, the labelling mix may be diluted 1+10 or 1+20. For sequences far from the primer the volume of the labelling mix should be increased or a Sequence Extending Mix included (see manufacturer’s recommendations).

48

Perry

10. The amounts of sequence data that can be read on a single gel can be increased by a variety of methods, e.g., wedge gels, buffer gradient gels, etc. The easiest is the wedge gel. For this a small additional spacer is placed at the bottom of the two gel plates to force the plates apart. Many manufacturers provide wedge shaped spacers. The volume of gel mix must be increased if using a wedge gel, e.g., 150 mL instead of 100 mL and similarly the volumes of TEMED and ammonium persulphate must also be increased. 11. If microtiter sequencing plates are used to perform the sequencing reactions rather than Eppendorfs, the plate can be floated on a thin film of water to denature the samples and then placed on ice. 12. Gels are generally soaked for 30–45 min but wedge gels may require longer, e.g., 60 min. Inadequate fixing leads to poor drying and the gel is often sticky and adheres to the autoradiographic film.

Suggested Reading Griffin, H. G. and Griffin, A. M. (1993) DNA Sequencing Protocols. Humana Press, Totowa, New Jersey. McPherson, M. J., Hames, B. D., and Taylor, G. R. (1994) PCR 2: A Practical Approach. IRL, Oxford, UK.

Solid-Phase Sequencing

49

5 Solid-Phase Sequencing of Biotinylated PCR Products with Streptavidin-Coated Magnetic Beads David J. Perry 1. Introduction A novel approach to generating high-quality single-stranded DNA involves solid-phase sequencing. A biotin group is incorporated at the 5'-end of one of the amplification primers and as a result becomes incorporated into PCR product during the amplification reaction. The DNA can then be immobilized onto streptavidin-coated paramagnetic beads, simultaneously removing buffers, dNTPs, and unincorporated PCR primers. By alkali denaturation, the immobilized double-stranded DNA is converted into a single-stranded template, which can then be purified away from its complementary strand, avoiding any competition in the subsequent sequencing reaction. Although the protocol detailed in this chapter is designed to purify and sequence PCR products, the method is broadly applicable to the solid-phase sequencing of many other templates, e.g., plasmid DNA. Solid-phase sequencing can be used with many types of DNA polymerase including T7 DNA polymerase, e.g., Sequenase, and is also readily adaptable to automated sequencing using a variety of different formats, e.g., Dye primers and dye terminators. As a result it is now the method of choice in many laboratories for generating high-quality sequence data from PCR amplified templates (see Note 1). 2. Materials Direct sequencing of a biotinylated PCR product involves 5 stages: 1. Biotinylation of the PCR product (see Note 2). 2. Purification of the biotinylated PCR product. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

49

50 3. 4. 5. 6.

Perry Alkali denaturation of the double-stranded PCR product. Annealing of the single-stranded template and sequencing primer. Sequencing of the single-stranded DNA template. Gel electrophoresis.

2.1. Purification of the Biotinylated PCR Product 1. 100 µL biotinylated PCR product. 2. 1X and 2X Binding and washing buffer (BWB). 2X BWB 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. 3. TE pH8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 4. Streptavidin-coated magnetic beads (e.g., Dynal). 5. Magnetic separation unit, e.g., Dynal MPC® magnet.

2.2. Generation and Purification of Single-Stranded DNA 1. 2. 3. 4.

0.1 M NaOH: Freshly prepared immediately before use. Distilled water 1X and 2X Binding and washing buffer (BWB). TE pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA.

2.3. Annealing of Template and Primer 1. Purified, single-stranded template bound to streptavidin-coated beads. 2. 10–20 pmol of a “nested” sequencing primer (see Note 3). 3. 5X reaction buffer: 200 mM Tris-HC,l pH 7.5, 100 mM MgCl2, 250 mM NaCl (see Note 4).

2.4. Labeling and Sequencing Reaction 1. 2. 3. 4.

5. 6. 7. 8. 9. 10.

Annealed template-primer 10 µL. 0.1 M DTT. [α-35S]-dATP 1000–1500 Ci/mmol (e.g., Amersham). T7 DNA Polymerase (e.g., Sequenase v2.0 14 U/µL). Store at –20°C. Do not remove from the freezer—aliquots should be removed as required directly into the prechilled sequencing master mix. Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. dGTP labelling mix: 5X 7.5 µM dGTP, 7.5 µM dCTP, 7.5 µM dTTP diluted “1+5” in distilled water prior to use (see Note 5). ddA termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddATP, 50 mM NaCl. ddC termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddCTP, 50 mM NaCl. ddG termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddGTP, 50 mM NaCl. ddT termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddTTP, 50 mM NaCl.

Solid-Phase Sequencing

51

11. Stop solution: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol.

2.5. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. 40% premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 2. Urea. 3. 25% Ammonium persulphate freshly prepared. 4. N,N,N’,N’-tetramethylethylenediamine (TEMED). 5. Distilled water. 6. 10X Tris-Borate-EDTA. 7. Duck-billed tips for loading the gel 8. Sequencing plates (40/50 × 20 cm). 9. Silanizing solution, e.g., dimethylchlorosilane (Sigma). 10. 2 L of 5% methanol/5% acetic acid in water. 11. Whatman 3MM paper. 12. Autoradiograph film, e.g., Kodak.

3. Methods 3.1. Purification of the Biotinylated PCR Product Twenty microliters of streptavidin-coated magnetic beads are sufficient to generate enough single-stranded DNA template for 3–5 sequencing reactions from a 50 µL PCR amplification. 1. To prepare the magnetic beads for use vortex the stock of beads to ensure they are thoroughly resuspended. Remove 20 µL into a 1.5-mL Eppendorf and place in the magnetic separation unit for 30 s. The volumes should be scaled up depending upon how many PCR templates are to be prepared. 2. Carefully remove the supernatant using a micro-pipet and then add 50 µL of 1X BWB. Vortex very briefly to mix (2–3 s) and then place in the magnet for 30 s.

Remove the supernatant and add 50 µL of 2X BWB. Vortex briefly to mix. 3. Add the resuspended beads to 50 µL of the (100 µL) PCR reaction and place on a rotator (to keep the beads suspended) for 15–20 min at room temperature (see Note 6). During this time the biotinylated PCR product will bind to the streptavidin-coated magnetic beads (and also to any free biotin or free biotinylated primer; see Note 7). 4. Place the Eppendorf in the magnetic separation unit for 30 s and carefully remove the supernatant. 5. Add 10 µL of freshly made 0.1 M NaOH and briefly vortex to mix. Incubate at room temperature for 15 min without shaking. 6. Place the Eppendorf in the magnetic separation unit for 30 s, remove the supernatant and transfer to a clean tube. The supernatant contains the nonbiotinylated single-stranded DNA and should be kept (see Note 8).

52

Perry

7. Add 100 µL of 0.1 M NaOH to the beads, vortex briefly, place in the magnetic separation unit for 30 s. Carefully remove the supernatant and pool with that from step 5. 8. Add 100 µL of 1X BWB to the beads. Vortex briefly to mix and then place the Eppendorf in the magnetic separation unit for 30 s. Carefully remove the supernatant and discard. 9. Repeat step 8 but using 100 µL of TE, pH 8.0. 10. Finally re-suspend the beads in 20 µL of distilled water. Store at 4°C. Do not freeze. Use 4–7 µL for each sequencing reaction.

3.2. Annealing of Template and Primer 1. Mix 4–7 µL of single-stranded template DNA, 2 µL of 5X reaction buffer, 1 µL (5–10 pmol) of a purified “nested” sequencing primer (see Note 9) and X µL of distilled water. The final volume should be 10 µL. 2. Heat to 60°C for 5 min and cool to 30°C at 2°C/min. This is conveniently performed in a PCR block using a programable ramp time. Briefly spin to pellet any condensation and place on ice.

3.3. Extension/Termination Reactions 1. Aliquot 2.5 µL of each termination-reaction mix into a microtitre sequencing tray (or 0.5–1.5-mL Eppendorfs) and store at 4°C. Prewarm at 37°C for 5 min before use. 2. Prepare a “Master Mix”on ice for the number of templates to be sequenced and store on ice. The master mix comprises 1 µL 0.1 M DTT, 0.5 µL [α-35S]-dATP, 2 µL diluted dGTP labeling mix and 2 µL of Sequenase v2 diluted “1+7” in ice-cold dilution buffer. 3. Add 5.5 µL of the master mix to each of the annealed template-primers on ice. Incubate at room temperature for 3–5 min. 4. Add 3.5 µL from step 3 to each of the termination mixes and place at 37°C for 5 min. 5. Add 4 µL of the formamide-dye stop mix to each well (or Eppendorf). Sequencing reactions may be frozen at this stage at –20°C or run immediately.

3.4. Casting and Running the Sequencing Gel/Fixing and Drying the Gel Sequencing reactions are run in 6% denaturing polyacrylamide gels at 40– 50°C. This minimizes any secondary structure and ensures the DNA remains single-stranded. 1. Wash the gel plates carefully with detergent, rinse in deionized water, and dry with lint-free tissues. 2. To remove any grease, wipe each plate with an alcohol-moistened tissue and allow to dry. 3. Apply 1–2 mL of silanizing solution to one of the plates (commonly the“eared” plate) and allow to dry in a fume cupboard. 4. Assemble the plates according to the manufacturer’s instructions and place on one side. 0.4 mm spacers are generally used.

Solid-Phase Sequencing

53

5. To prepare a 100 mL 6% denaturing gel, combine 15 mLof 40% acrylamide (19:1 acrylamide:bisacrylamide), 10 mL of 10X TBE, 42 g of urea and water to 100 mL (see Note 10). Cover with cling film and place on a magnetic stirrer until the urea has dissolved. 6. To initiate polymerisation add 140 µL of 25% ammonium persulfate and 140 µL of TEMED. Aspirate the solution into a 50-mL syringe, attach a 0.4-µm filter and slowly inject the gel mix between the gel plates. Insert a comb between the gel plates and allow the gel to polymerise for at least 60 min. 7. Carefully remove the comb and assemble the sequencing apparatus. 8. Fill the buffer reservoirs with 1X TBE and flush out the wells of the gel with buffer. 9. Prerun the gel at 35–50 W for 30 min. 10. Denature the sequencing reactions by heating to 100°C for 3 min and then place on ice (see Note 11). 11. Flush the wells of the gel and load the samples. It is convenient to load the first and second lanes with an identical sample, e.g.. the “A” mix of reaction 1, or to miss a lane after the first four lanes have been loaded. In this way the autoradiograph can be easily orientated. 12. Run the gel for as long as required. Carefully separate the plates and immerse the gel, still attached to one of the glass plates into 2 L of fixing solution (see Note 12). 13. Transfer the gel onto 3MM paper, cover with SaranWrap and dry under vacuum at 80°C. 14. Autoradiograph overnight.

4. Notes 1. This and previous chapters have concentrated upon direct sequencing of PCR products. Sequencing is frequently used to obtain data from genetic material that has been cloned, for example, M13 or a plasmid vector. We sometimes find the necessity to clone and sequence PCR products, e.g., to separate two alleles to obtain their individual sequence data. There are numerous methods for cloning PCR products and we routinely use a commercial cloning kit “TA Cloning– Invitrogen.” Sequencing of cloned materials is often easier than sequencing PCR products and the reader is encouraged to read one of the many volumes that are available and which address this subject. 2. Biotinylation of the amplification primers is carried out during their synthesis. 3. Sequencing primers may require purification before us especially if the synthesis has been inefficient and there are a lot of contaminating small sequences. 4. Although sequencing reagents can be purchased individually it is considerably easier to purchase a kit. The methods outlined in this chapter are based on Sequenase v2 and the Sequenase Sequencing Kit. 5. The precise dilution varies upon how close to or how far from the sequencing primer data is required. To read close to the primer increase the dilution, e.g., 1+9 or 1+14, 1+19. To read further from the primer, use the labeling mix undiluted. 6. The optimal incubation time depends upon the length of the nucleic acid to be bound. Short DNA fragments (<30 bases) bind very quickly (<10 min), whereas longer fragments (1 kb+) may require longer (up to 60 min) at 43°C or 25°C overnight.

54

Perry

7. PCR reactions (100 µL) should be performed using 50 pmol of each amplification primer. The biotinylated primer may require purification before use on a NAP-10 column to remove any free biotin. This can be performed as follows: resuspend the freeze-dried biotinylated oligonucleotide in 1ml of sterile water and dilute a 100 µL aliquot to 1 mL with distilled water. Remove the top of a NAP-10 column (Pharmacia) and pour off the fluid. Remove the lower cap and clamp the column in a stand. Wash the column with 3 × 5 mL of 10 mM sodium phosphate buffer pH 6.8. After the third wash add the oligonucleotide and allow it to enter the column matrix. Elute the purified oligonucleotide using 4 × 1 mL of 10 mM sodium phosphate buffer pH 6.8, collecting 1 mL fractions into 1.5-mL Eppendorfs. Freeze dry and resuspend each fraction in 100 µL of sterile water. Run 5 µL of each fraction in a 1.5% agarose gel in 1X TBE containing ethidium bromide 0.5 µg/mL. Pool aliquots which contain oligo-nucleotide (usually fractions 2 + 3) and measure the OD260. Calculate their concentration from: Concentration = (OD260 × 40 × dilution/309 × mer) × 103 µM 8. To sequence the non-biotinylated strand, neutralise the alkali supernatant with 1/10 vol of 3 M sodium acetate, pH 5.2, and 21/2 vol of ethanol. Incubate at –20°C for 2 h. Centrifuge at 12,000 rpm in a benchtop microfuge. Wash the pellets twice with 70% ethanol, dry, and finally redissolve in 5 µL of sterile water. 9. If the upstream primer is biotinylated then sequence using a reverse sequencing primer. DMSO 1–2 µL may be included in the annealing reaction for sequencing templates with strong secondary structure. 10. The amount of sequence data that can be read on a single gel can be increased by a variety of methods, e.g., wedge gels, buffer gradient gels, etc. The easiest is the wedge gel. For this a small additional spacer is placed at the bottom of the two gel plates to force the plates apart. Many manufacturers provide wedge shaped spacers. The volume of gel mix must be increased if using a wedge gel, e.g., 150 mL instead of 100 mL and similarly the volumes of TEMED and ammonium persulphate must also be increased. 11. If microtiter sequencing plates are used to perform the sequencing reactions rather than Eppendorfs, the plate can be floated on a thin film of water to denature the samples and then placed on ice. 12. Gels are generally soaked for 30–45 min but wedge gels may require longer, e.g., 60 min. Inadequate fixing leads to poor drying and the gel is often sticky and adheres to the autoradiographic film.

Suggested Reading Biomagnetic Techniques in Molecular Biology. Technical Handbook, 2nd ed. Dynal, Oslo, Norway. Griffin, H. G. and Griffin, A. M. (1993) DNA Sequencing Protocols. Humana Press, Totowa, New Jersey. McPherson, M. J., Hames, B. D., and Taylor, G. R. (1994) PCR 2: A Practical Approach. IRL, Oxford, UK.

Automated DNA Sequencing

55

6 Automated DNA Sequencing Helen L. Devereux 1. Introduction The polymerase chain reaction (PCR), first published by Mullis and Faloona in 1987 (1), has become an invaluable molecular biology tool in both research and routine applications. The combination of PCR with the chain-termination sequencing technique developed by Sanger et al. in 1977 (2) and the automation of both these techniques, has enabled DNA sequencing to also become widely used in a variety of research areas. Automated DNA sequencing involves cycle sequencing using a DNA thermal cycler which incorporates four different fluorescent dye labels (for A, C, T, and G) into DNA extension products using either 5'-dye labeled primers (dye primers) or 3'-dye labeled dideoxynucleotide triphosphates (dye terminators). Briefly, a cycle sequencing protocol will consist of a denaturation step; a primer annealing step and an extension step (extension of second strand until incorporation of dideoxynucleotide triphosphate [ddNTP] halts extension). This will result in DNA fragments of one, two, three, etc. nucleotide bases in length, each labeled with the corresponding dye for the specific nucleotide. For example, a sequence of ACTAAG will yield fragments of: A1 AC2 ACT3 ACTA1 ACTAA1 ACTAAG 4

1

= dye label for A = dye label for C 3 = dye label for T 2

4

= dye label for G

These fragments are then run on a polyacrylamide gel and, due to the mobility of DNA through polyacrylamide gels, the smaller fragments will run faster From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

55

56

Devereux

and so be detected first by an argon-ion laser, which detects fluorescence from the four different dyes. Each dye emits light at a different wavelength when excited by the laser, so that all four colors can be detected in one gel lane. Two types of chemistry can be used for automated sequencing—dye primer and dye terminator. With dye terminators, each of the ddNTPs is labeled with a different fluorescent dye. The main advantages are that all sequencing reactions are performed in one tube and an unlabeled primer can be used. With dye primers, extension products are identified by using the same primer labeled with the four different dyes in four separate reactions. The products from these four reactions are then combined and loaded into one gel lane. The main advantages are slightly longer read lengths and more even signal intensities among the bases. However, with the development of the new BigDye™ terminators it is currently considered that dye terminator chemistry is now reasonably comparable to dye primer chemistry for read length and signal intensities. The type of chemistry chosen depends on the sequencing application, but, in general, BigDye™ terminators are more useful for low to high sequencing throughput and detection of 50:50 mutations, and BigDye primers are more useful for the detection of smaller percentages of mutations. 2. Materials All reagents should be prepared with sterile distilled water and molecular biology grade reagents should be used.

2.1. Purification of DNA Templates Before Cycle Sequencing Single-stranded and double-stranded DNA templates and PCR products can all be sequenced using this technology (see Note 1). There are various methods available for the purification of DNA. For single-stranded DNA, high quality DNA can be prepared using paramagnetic beads (Dynabeads®) or Qiagen QIAprep® M13 spin columns. For double-stranded DNA suitable templates can be prepared by caesium banding methods or Qiagen QIAprep® Spin Miniprep spin columns. For PCR products, Qiagen QIAquick® Spin Purification spin columns or Amicon Microcon 100 microconcentrators provide high quality templates.

2.2. Cycle Sequencing 1. PE Applied Biosystems BigDye™ Terminator/Primer Ready Reaction Kit with AmpliTaq® DNA Polymerase, FS; Terminator/Primer premix, pGEM-3Zf(+) double-stranded DNA control template, 0.2 µg/µL and -21 M13 sequencing primer (forward), 0.8 pmol/µL. 2. Sequencing primer (see Note 2). 3. Purified template DNA.

Automated DNA Sequencing

57

4. Distilled water. 5. Mineral oil (see Note 3).

2.3. Purification of Extension Products After Cycle Sequencing 1. 3 M Sodium acetate, pH 4.6 (see Note 4). 2. 95% Ethanol. 3. 70% Ethanol.

2.4. Loading Buffer 1. Deionized formamide. 2. 25 mM EDTA (pH 8.0). 3. Blue dextran (see Note 5).

2.5. Polyacrylamide Sequencing Gels Polyacrylamide gels can be made from their basic chemical constituents but because of the hazards of solid acrylamide, it is usually preferable to use one of the many ready-prepared solutions now available. 1. 40% Acrylamide FMC BioProducts Accugel™ 29:1 (acrylamide-bisacrylamide) (see Note 6). 2. Urea. 3. 10X TBE buffer. 4. Distilled water. 5. 10% Ammonium persulphate (APS). 6. TEMED.

Alternatively a commercially available sequencing pack can be used, e.g., FMC BioProducts Long Ranger Singel™ Pack. This is a self-contained pack with clip dividers which contains Long Ranger gel solution (see Note 7), 1X TBE buffer, APS, TEMED, urea, and a filter. 3. Methods 3.1. Purification of Template DNA (see Note 8) This is done according to manufacturer’s instructions. The recommended final concentrations prior to sequencing are: Single-stranded DNA Double-stranded DNA PCR product

0.1 µg/µL 0.2 µg/µL 10–30 ng/µL

0.5–1.0 µL/sequencing reaction 1.5–2.5 µL/sequencing reaction 3.0–6.0 µL/sequencing reaction

3.2. Cycle Sequencing 3.2.1. BigDye™ Terminators 1. Thaw premix stock and other reagents on ice and protect terminators from light as much as possible.

58

Devereux

2. Mix the following reagents in a thin-walled 0.2-mL microcentrifuge tube (see Note 9): 8 µL of BigDye™ Terminator Ready Reaction mix, 0.5–6.0 µL DNA Template (precise volume dependant on concentration), 1 µL of primer (3.2 pmol/µL) and distilled water to 20 µL (see Note 10). 3. Mix well and spin briefly. 4. If using the 480 thermal cycler, or similar, overlay the reaction mixture with one drop of light mineral oil (see Note 3). 5. To cycle sequence DNA on the GeneAmp 2400, 9600 or 9700: Place the tubes in the cycler and set the volume to 20 µL. Rapid thermal ramp to 96°C, 96°C for 10 s, rapid thermal ramp to 50°C, 50°C for 5 s. Rapid thermal ramp to 60°C, 60°C for 4 min. Repeat for 25 cycles and hold at 4°C. 6. To cycle sequence DNA on the 480 or similar: Place the tubes in the cycler preheated to 96°C. Rapid thermal ramp to 96°C then 96°C for 30 s. Rapid thermal ramp to 50°C then 50°C for 15 s. Rapid thermal ramp to 60°C then 60°C for 4 min. Repeat for 25 cycles. Hold at 4°C.

3.2.2. BigDye™ Primers 1. Thaw premix stocks and other reagents on ice. 2. Aliquot the following volumes into microcentrifuge tubes appropriate for the thermal cycler being used (see Note 9): Ready Reaction Premix DNA template Total volume

A (µL) C (µL) 4 4 1 1 5 5

G (µL) T (µL) 8 8 2 2 10 10

(See Note 11). 3. If using the 480 thermal cycler, or similar, overlay the reaction mixture with one drop of light mineral oil (see Note 3). 4. To cycle sequence DNA on the GeneAmp 2400, 9600 or 9700: Place the tubes in the cycler and set the volume to 10 µL. 5. Rapid thermal ramp to 96°C for 10 s. Rapid thermal ramp to 55°C for 5 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Then rapid thermal ramp to 96°C for 10 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Hold at 4°C. 6. To cycle sequence DNA on the 480 or similar: Place the tubes in the cycler preheated to 95°C. Rapid thermal ramp to 95°C for 30 s. Rapid thermal ramp to 55°C for 30 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Then rapid thermal ramp to 95°C for 30 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Hold at 4°C.

3.3. Purification of Extension Products After Cycle Sequencing 3.3.1. BigDye™ Terminators 1. Spin down extension products in a microcentrifuge. 2. For each reaction prepare a 1.5-mL microcentrifuge tube by adding: 2 µL 3 M NaOAc, pH 4.6 (see Note 4), and 50 µL 95% ethanol.

Automated DNA Sequencing

59

3. Transfer the entire 20µL extension product to the ethanol solution. If using mineral oil, this must be removed first (see Note 12). 4. Vortex and place on ice for 10 min. 5. Centrifuge at maximum speed in a microcentrifuge (13,000 rpm) for 15–30 min. 6. Carefully remove the ethanol with a pipet (see Note 13). 7. Add 250 µL 70% ethanol to the pellet (see Note 14). 8. Do not vortex, but just remove ethanol with a pipet (see Note 13). 9. Dry the pellet so that no ethanol remains (see Notes 15 and 16).

3.3.2. BigDye™ Primers 1. To a 1.5-mL microcentrifuge tube add 80 µL of 95% ethanol. 2. Add the extension products from each of the four tubes (A, C, T, and G) to the ethanol. Any mineral oil must be removed first (see Note 12). 3. Place on ice for 10–15 min. 4. Centrifuge at maximum speed in a microcentrifuge (13,000 rpm) for 15–30 min. 5. Carefully remove the ethanol with a pipet (see Note 13). 6. Add 250 µL 70% ethanol to the pellet (see Note 14). 7. Spin for 5 min in a microcentrifuge at 13,000 rpm 8. Carefully remove the ethanol with a pipet (see Note 13). 9. Dry the pellet (see Notes 15 and 16).

3.4. Loading the Samples 1. Prepare a loading buffer by combining deionised formamide and 25 mM EDTA, pH 8.0, containing 50 mg/mL Blue dextran in a ratio of 5:1 formamide to EDTA/ Blue dextran. 2. Resuspend the sample in 6 µL of the loading buffer. 3. Vortex and spin briefly. 4. Heat the samples at 95°C for 2 min to denature. Place on ice until ready to load. 5. Load 0.75–1.5 µL into a each lane of the gel (see Notes 17 and 18).

3.5. Polyacrylamide Sequencing Gel Preparation 3.5.1. 40% 29:1 Acrylamide (see Note 6) 1. Prepare 10X TBE buffer by dissolving 540 g Tris-base, 275 g orthoboric acid, and 37 g disodium EDTA in 3.5 L of water. Adjust the pH to 8.3 and make up the volume to 5 L. 2. In a class II cabinet, combine 18 g urea, 5.625 mL 40% acrylamide stock (to prepare a 4.5% sequencing gel), 5 mL 10X TBE buffer and 25 mL distilled water 3. Stir until all urea has dissolved. 4. Adjust the volume to 50 mL with distilled water. 5. Filter the solution through a 0.2-µm filter and degas for a minimum of 5 min. 6. Clean and assemble glass plates according to manufacturer’s instructions (see Note 19). 7. Add 250 µL of freshly made 10% APS (see Note 20).

60

Devereux

8. Add 30 µL TEMED and mix gently. 9. Pour the gel and leave for a minimum of two hours to polymerize. 10. Assemble gel in automated DNA sequencer and run and analyse sequence according to manufacturer’s instructions.

3.5.2. FMC BioProducts Long Ranger Singel™ Pack 1. Mix according to manufacturer’s instructions and pour through the filter directly from the pack.

4. Notes 1. The quality of the sequencing results will be directly proportional to the quality of the starting DNA. It is essential to purify all templates before cycle sequencing in order to generate good quality sequence. 2. The sequencing primer should be at least an 18-mer. Avoid primers with long runs of single bases. Melting temperatures above 45°C are recommended. Avoid primers which have secondary structure or that can form dimers. Universal primers can be used for cloned products. 3. If the DNA thermal cycler is not a Perkin Elmer GeneAmp 2400, 9600, 9700, or similar then mineral oil will have to be added to the cycle sequencing reaction to prevent evaporation. The newer type of cyclers listed above have heated lids, which eliminate the need for mineral oil. 4. Magnesium chloride can also be used instead of sodium acetate, but sodium acetate seems to be more effective at removing the excess dye terminators which can cause a large “dye blob” at the start of the sequence. Sodium acetate is not necessary for the purification of dye primers after cycle sequencing. 5. Blue dextran is added to aid loading of the sample. 6. 29:1 Acrylamide to bisacrylamide has been found to give better automated sequencing results than 19:1 acrylamide to bisacrylamide. 7. This polyacrylamide can provide a longer read length than other polyacrylamides, up to approx 700 bases as compared to approx 500 bases. 8. Purified DNA concentration estimations can be done using a spectrophotometer. However, estimation by running the product on an agarose gel next to a standard of known concentration is suitable for automated DNA sequencing applications. 9. For the PE GeneAmp 2400, 9600, and 9700 or similar thermal cyclers use 0.2mL thin-walled microcentrifuge tubes. For other cyclers, including the PE 480 thermal cycler, use 0.5-mL thin-walled microcentrifuge tubes. Thin-walled tubes must be used as the reactions will not work in normal microcentrifuge tubes. 10. Always include the control DNA template in each kit with every set of samples to be sequenced: 8 µL BigDye™ Terminator Ready Reaction Mix, 2 µL pGEM3Zf(+) double-stranded DNA control template at 0.2 µg/µL, 4 µL of -21 M13 primer (forward) sequencing primer at 0.8 pmol/µL and 6 µL of distilled water. 11. Prelabeled universal primers can be used with the BigDye™ Primer Ready Reaction Kits or specific PCR primers can be sent to PE Applied Biosystems to be labeled with their four dyes. Each Ready Reaction Premix used here contains the relevant labeled primer.

Automated DNA Sequencing

61

12. An effective way to remove mineral oil from cycle sequence extension products is as follows: Pipet the entire contents of the microcentrifuge tube (extension products and oil) onto a piece of parafilm (approx 10 cm in length). Lift parafilm slightly so that solution rolls gently down the film. The solution containing extension products will separate from the mineral oil and can be added to the ethanol solution. 13. Extra care should be taken when removing ethanol from the pellet as it is unstable and may be lost. 14. This step is not usually necessary, but sequence quality appears to be improved when it is included. 15. The pellet may or may not be visible at this stage. This seems to have no effect on sequence quality. 16. The pellet may be stored for a number of weeks at –20°C or colder, but after the loading buffer has been added it is recommended that it is used within a few hours. 17. If loading more than approx 20 samples it is recommended that all odd lanes are loaded first, the samples allowed to run into the gel for 5 min, and then the even lanes are loaded. The sequencing run can then be started. 18. The control DNA template (pGEM-3Zf(+)) included in the kit should always be loaded in lane 1. This ensures that the analysis software package always has a good quality sequence to start to track the gel with. 19. In order to prevent background fluorescence it is essential that glass plates are cleaned only with a mild solution of Alconox and distilled water and rinsed thoroughly with distilled water. If background fluorescence becomes a problem or if a sequence appears “smeared” in certain regions of the plate or if “red rain” (when longer runs cause the bottom of the gel to begin to break down) becomes a problem, then the following wash is recommended: Wash in 1 M nitric acid and rinse with large quantities of distilled water. Soak in 0.2 M sodium hydroxide (NaOH) for 15 min and rinse with large quantities of distilled water. This wash should not be used frequently as it may affect the quality of the plates. 20. 10% APS is 0.1 g APS dissolved 0.9 mL distilled water. This solution can be stored for a number of weeks at 4°C, but for automated DNA sequencing it is recommended that it is prepared fresh each day.

Acknowledgments The author would like to thank PE Applied Biosystems and Ms. L. Huckett for their continued, and valuable assistance. References 1. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods Enzymol. 155, 335–350. 2. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467.

Silver Staining

63

7 Detection of DNA by Silver Staining David J. Perry and Flora Peyvandi 1. Introduction Silver stains are widely used for the detection of both proteins and nucleic acids in acrylamide gels or on various membranes. They have several advantages over conventional staining methods, including the ability to detect very small amounts of material, while avoiding the hazards of other detection systems, such as ethidium bromide or radio-isotopes. The method described in this chapter has been used extensively in combination with both single-stranded conformation polymorphism analysis (SSCP) and Heteroduplex analysis to screen DNA for mutations. 2. Materials All reagents must be prepared with deionised water (see Note 1). All solutions should be at room temperature other than the developer which should be at 4°C. To stain a standard 50 cm × 20 cm sequencing gel requires 1.5–2 L of each solution. Gel bonding solution, e.g., Bind Silane (3 µL in 1 mL of 0.5% acetic acid in 95% ethanol). Dimethylchlorosilane. Fix/stop solution: 10% acetic acid. Silver nitrate staining solution: 2g AgNO3 (silver nitrate), 3 mL 37% formaldehyde (H2CO). Deionized water to 2 L. 5. Developer: 60 g anhydrous Na2CO3 (sodium carbonate), 3 mL 37% formaldehyde (H2CO), 400 µL Na2S2O3:5H2O (sodium thiosulfate). Deionized water to 2 L. Chill to 4°C. 6. Stop solution: 5% acetic acid (v/v). 1. 2. 3. 4.

3. Methods 1. Prior to casting the acrylamide gel, one of the plates should be silanized by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

63

64

2. 3.

4. 5.

6.

7. 8.

9.

Perry and Peyvandi with a lint-free tissue and then allowing it to dry at room temperature in a fume hood. To encourage the gel to adhere to the other plate apply 1 mL of “Bind Silane” to the plate and wipe over the entire surface. Allow to dry at room temperature and then wipe the plate 4× with 95% ethanol to remove any excess solution. Allow to dry. Carry out the electrophoresis, e.g., SSCP analysis. Separate the gel plates and place the gel adherent to one plate in a developing tank. Cover the gel with fix/stop solution for 20 min. The gel may be left in this indefinitely if processing is delayed. Solutions should not be poured directly onto the gel but into a corner of the tray. Remove the fix/stop solution but do not discard. This is required again in a later step. Wash the gel 3× in distilled water using the same volume as the fixative, i.e., 1.5–2 L. Gently pour in the silver nitrate solution and allow the gel to stain for 30 min. Remove the gel and briefly rinse (<10 s) in distilled water to remove any silver nitrate on the surface of the gel (see Note 2). Gently pour in half of the pre-chilled developer solution and slowly agitate. Observe carefully and as soon as the solution loses some of its clarity or the bands begin to appear, replace it with fresh solution. Repeat this until the DNA bands become visible after 2–5 min or background staining become too intense. As soon as the desired intensity of bands is achieved, stop development by pouring in the fix/stop solution (see step 4 and Note 3). Fix/stop for 5 min. The solutions will foam because of the interaction between the acetic acid and sodium carbonate. Rinse the gel in deionized water. Allow to drain and photograph on a light box. To reuse the glass plates and to remove any trace of the bound gel, immerse the gel in 10% sodium hydroxide overnight. Rinse carefully in deionized water. Wash with detergent and rinse thoroughly. The quality of silver staining is dependent on many variables including the purity of the reagents and the quality of the water (see Note 4).

4. Notes 1. The water used in silver staining must be ultrapure. Any contaminants will affect the quality of the final result. 2. The duration of the rinse step is critical. The total time from immersion of the gel to immersion in developer solution should not exceed 20 s. If the rinse step exceeds 20 s, then the staining procedure should be repeated. 3. Pour in the fix/stop solution directly into the developer. 4. If the gel appears very yellow after staining, then it was probably in the developer too long. As soon as the developer loses its clarity, replacing it with fresh significantly improves the quality of the final result. If no bands are visible, this may be a problem with the original electrophoresis, the quality of the water, or inadequate rinsing following staining. If the background staining is excessive, this is usually because excess silver nitrate is present (therefore, rinse the gel for longer prior to adding the developer solution) or development is too long (stop the reaction as soon as the bands of interest appear).

Promoter Studies in Hemostasis

65

8 Promoter Studies in Hemostasis Peter R. Winship and Jonathan R. K. Spray 1. Introduction In recent years the technique of gene cloning, coupled with the application of polymerase chain reaction (PCR)-based procedures, has greatly facilitated the production of cloned genomic material encompassing the putative promoter regions of genes involved in the hemostatic process. These recombinant vectors provide the raw material for reporter gene studies and DNA footprinting analysis; two of the three most frequently used in vitro procedures to study promoter function. The third of these methods to be described in this chapter, band shift or electrophoretic mobility shift assay (EMSA), normally uses synthetically produced double-stranded oligonucleotide sequences corresponding to specific areas of interest within the promoter region. Reporter gene analysis (Fig. 1) exploits the extreme ease and sensitivity of detection of certain proteins, which, although stable in mammalian cells, are not endogenously expressed. Recombinant vectors containing putative promoter regions cloned upstream of the genes encoding such proteins (e.g., Firefly luciferase, Chloramphenicol Acetyl Transferase and β Galactosidase; 1–3) are constructed and transfected into an appropriate cell line. If the putative promoter sequence under investigation possesses transcriptional activity it will drive the production of reporter gene mRNA and ultimately of the reporter protein itself. This protein accumulates within the cells and levels can then be measured in the cell lysate following harvesting and cell lysis. Quantitative analysis and comparison of reporter gene protein levels produced under a number of different conditions is therefore made possible. Using a panel of recombinant vectors containing test promoter sequences with common 3' ends (between the natural transcriptional and translational start-points) but progressively deleted from a common progenitor 5'-end allows areas of potential tranFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

65

66

Winship and Spray

Fig. 1. Reporter gene assay.

scriptional importance to be defined. These studies can be further refined to assess the effect of specific transcription factors by transfection of the reporter gene constructs in the presence or absence of expression vectors encoding the

Promoter Studies in Hemostasis

67

appropriate transactivator and noting the differential change (if any) in level of accumulated reporter protein. In contrast, DNaseI footprinting and EMSAs give more precise positional information about the nature of any DNA protein interactions in the promoter under investigation. The two methods rely initially on the specific binding of a DNA probe radiolabeled at one end (Probe sizes: 200–800 bp in DNase I footprinting; 20–100 bp in EMSAs) to proteins present in a nuclear extract prepared from an appropriate tissue or cell line. In DNase I footprinting (Fig. 2), the bound probe is subjected to a limiting digestion with the endonuclease DNaseI such that in a given population of DNA molecules a high proportion will be cleaved just once. Regions of DNA bound with a protein present in the nuclear extract are, however, protected from this endonucleolytic cleavage. The digested samples are then size-fractionated by polyacrylamide gel electrophoresis (PAGE) under denaturing conditions. Comparison with control samples not incubated with nuclear extract then allows the identification of DNA sequences bound with protein (and therefore protected from endonucleolytic cleavage), which are characterized by a gap or “footprint” in the ladder of bands. Following the incubation of radiolabelled EMSA probes with nuclear extract and subsequent size fractionation by PAGE, the presence of a DNA protein complex is indicated by a retarded or “shifted” band on the autoradiograph relative to the faster migrating DNA fragment on it’s own (Fig. 3). A reduced intensity of the “shifted” band in the presence of a molar excess of a homologous, double stranded but unlabelled competitor probe in the binding reaction helps eliminate the possibility that the observed complex is not simply the result of a non-specific interaction. The precise nature of the bound protein may then be elucidated by the technique known as “supershifting” (4). Briefly, in addition to binding with nuclear extract the EMSA probe is also incubated with an antibody to a known transcription factor. If the antibody recognizes and binds to the protein bound to the DNA probe, then this larger tripartite complex will be further retarded in mobility relative to the bipartite DNA-protein complex and can be visualized as a “supershifted” band by PAGE and autoradiography. Purified recombinant or fusion proteins can also be used to identify the protein component of a specific DNA–protein complex. In the absence of a suitable antibody or purified protein , additional information about the precise nature of the DNA protein interaction can still be obtained by attempting to “compete off” the specific signal with a cold competitor probe corresponding to the binding site consensus sequence of a candidate transcription factor. 2. Materials All reagents should be prepared in deionized or distilled water using chemicals of Analar grade or its equivalent unless otherwise stated, and stored at room temperature.

68

Winship and Spray

Fig. 2. DNaseI footprinting.

2.1. Reporter Gene Assays 1. Plasmids: Vectors containing appropriate regions of the promoter under investigation (see Note 1) are first constructed in a plasmid encoding a suitable reporter

Promoter Studies in Hemostasis

69

Fig. 3. Electrophoretic mobility shift assay. gene, in this instance Luciferase (a range of these vectors are available commercially). Reporter gene constructs to be used for the calcium phosphate transfection procedure described below must be purified from caesium chloride gradients

70

2.

3. 4.

5. 6.

7.

Winship and Spray or to an equivalent degree of purity by alternative methods. Preparations of expression vectors encoding transcription factors and any plasmids used as nonspecific DNA must be of a similar purity. Store at 4°C. Cell lines and media: The mammalian liver carcinoma cell line HepG2 is maintained in minimum essential medium supplemented with 10% bovine fetal serum, 2 mM L-glutamine, 1X nonessential amino acids and 100 iu/mL-100 µg/mL penicillin-streptomycin. Complete media is stored at 4°C but must be supplemented with additional L-glutamine every 3–4 wk. See Note 2 for choice of cell line. 0.25 M CaCl2: Filter sterilize through 0.22-µm filter. 2X BBS: 50 mM NN’-Bis-(2-hydroxyethyl)-2-amino-ethane sulphonic acid, 280 mM NaCl, 1.5 mM Na2HPO4. Adjust pH to 7.02 with NaOH. Sterilize using a 0.22-µm filter and store in aliquots at –20°C. Phosphate buffered saline (PBSE)/EDTA: 137 mM NaCl, 2. 7 mM KCl, 4.3 mM Na2HPO4, 1.4 5 mM KH2PO4, 0.5 mM EDTA pH 7.4. Cell Lysis buffer: 25 mM Tris-phosphate pH 7.8, 2 mM DTT, 2 mM 1,2diaminocyclohexane-N,N,N,N’-tetraacetic acid, 10% glycerol, 1% triton X-100. Available from Promega as a 5X stock solution; store at –20°C. Luciferase Assay Reagent: 20 mM tricine, 1.07 mM (MgCO3)4Mg(OH)2, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 270 µM coenzyme A, 470 µM luciferin, 530 µM ATP, pH 7.8. Available from Promega. Stable in solution at – 20°C for 1 mo and –70°C for 1 yr.

2.2. Preparation of Nuclear Extract 1. Homogenization buffer: 0.25 M sucrose, 15 mM Tris-HCl, pH 7.9, 60 mM KCl, 15 mM NaCl, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 1 mM DTT, 5 µg/mL aprotinin (5 mg/mL stock in H2O; store at –20°C), 0.4 mM PMSF (120 mM stock in ethanol; store at –20°C), 5 µg/mL pepstatin A (5 mg/mL stock in ethanol; store at –20°C), 2 mM benzamidine (320 mM stock in H2O; store at –20°C). Use solution (chilled to 4°C) immediately. 2. 2.6 M Sucrose buffer: as homogenization buffer except 2.6 M sucrose. 3. 2.1 M Sucrose buffer as homogenization buffer except 2.1 M sucrose. 4. Nuclear lysis buffer: 10 mM HEPES pH 7.6, 100 mM KCl, 3 mM MgCl2, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF, 2 mM benzamidine, 5 µg/mL aprotinin, 5 µg/mL pepstatin A. Add the protease inhibitors and DTT just before use; the remaining components are stable in solution at 4°C. 5. Dialysis buffer: 25 mM HEPES pH 7.6, 40 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% glycerol, 0.1 mM PMSF, 2 mM benzamidine, 5 µg/mL aprotinin. Add the protease inhibitors and DTT just before use; the remaining components are stable in solution at 4°C.

2.3. DNase I Footprinting 2.3.1. Preparation of Radiolabeled Probe 1. Oligonucleotides: Oligonucleotides are synthesized on an Applied Biosystems Model 394 DNA/RNA synthesizer (Perkin Elmer Applied Biosystems,

Promoter Studies in Hemostasis

2. 3. 4. 5.

71

Warrington, Cheshire, UK). After deprotection the oligonucleotides are resuspended in approx 400 µL deionized water. The addition of 0.1 vol, 5 M LiCl, and 2–2.5 vol ethanol facilitates precipitation from the aqueous solution. Resuspend the resultant precipitate in deionized water at a concentration of approx 2 mg/mL. Store at -20°C. T4 Polynucleotide kinase and buffer (10X stock): 700 mM Tris-HCl, 100 mM MgCl2, 5 mM DTT, pH 7.6 (available from New England Biolabs). Taq Polymerase (e.g., Bioline, UK): use an experimentally determined optimal buffer for the specific PCR reaction being performed. Store at –20°C. Radiochemical and deoxynucleotides: [γ-32P]dATP 3000 ci/ mMol, 10 mci/mL. e.g., Amersham. Use within 14 d of activity date. dATP, dCTP, dGTP, dTTP: 100 mM stock solutions (available from many manufacturers, e.g., Pharmacia). Store at –20°C.

2.3.2. Gel Purification and Elution of Probe 1. Native polyacrylamide gel: 6% polyacrylamide (19:1 acrylamide: N, N’ methylene bisacrylamide). 20 cm × 20 cm × 1 mm thick. 2. Gel running buffer (1X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 5 mM EDTA pH 8.3. 3. Sample loading buffer: 30% Ficoll-400, 1X TBE, 0.05% bromophenol blue, 0.05% xylene cyanol FF. 4. Elution buffer: 0.5 M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, 0.1% SDS.

2.3.3. Binding Reaction and DNaseI Digestion 1. 5X Binding Buffer: 125 mM HEPES, pH 7.6, 200 mM KCl, 5 mM DTT, 50% Glycerol. Store at–20°C. 2. Poly dI-dC. 1 mg/mL stock solution (Pharmacia). Store at –20°C. 3. RQ1 RNase free DNaseI (Promega).

2.3.4. Denaturing Polyacrylamide Gel Electrophoresis 1. Denaturing polyacrylamide gel: 6% polyacrylamide, (19:1 acrylamide: N, N’ methylene-bis-acrylamide), 7 M urea. 50 cm × 20 cm, 0.4 mm thick. 2. Gel running buffer (1X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 25 mM EDTA, pH 8.3. 3. Denaturing gel loading buffer: 95% (v/v) formamide, 20 mM EDTA, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol FF.

2.4. Electrophoretic Mobility Shift Assay 1. Oligonucleotides: Oligonucleotides are synthesized on an Applied Biosystems Model 394 DNA/RNA synthesizer. After deprotection the oligonucleotides are resuspended in approx 400 µL deionized water. The addition of 0.1 vol, 5 M LiCl, and 2–2.5 vol ethanol facilitates precipitation from the aqueous solution. Resuspend the resultant precipitate in deionized water at a concentration of approx 2 mg/mL. Store at –20°C.

72

Winship and Spray

2. Radiolabel: [γ-32P]dATP 3000 ci/mMol, 10 mci/mL, e.g., Amersham. Use within 14 d of activity date. 3. T4 Polynucleotide Kinase and buffer (10X stock): 700 mM Tris-HCl, 100 mM MgCl2, 5 mM DTT pH 7.6 (available from New England Biolabs). 4. 20X Annealing Buffer: 1 M KCl. 5. 5X EMSA Binding Buffer: 50 mM Tris-HCl pH 7.5, 20% v/v glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 0.25 mg/mL poly dI-dC. Store in aliquots at –20°C. Add DTT from a 1 M stock solution (stored at –20°C) immediately before use.

2.5. Polyacrylamide Gel Electrophoresis 1. Native polyacrylamide gel: 4% acrylamide (80:1 acrylamide: N, N’ methylenebis-acrylamide), 20 cm × 20 cm, 1-mm thick. 2. Gel running buffer (0.5X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 25 mM EDTA pH 8.3.

3. Methods 3.1. Reporter Gene Analysis It is extremely difficult to provide a definitive method for this type of analysis given the dependency on cell line and the activity of the promoter under investigation. The method described below, modified from previously described procedures (5,6), is that which we use for analyzing the promoters of a number of genes encoding proteins which participate in the hemostatic process.

3.1.1. Calcium Phosphate Transfection 1. Twenty-four hours prior to transfection, HepG2 cells from an approx 80% confluent culture are seeded into 6-well plates (9.6 cm2 wells) such that at the time of transfection each well will be approx 25% confluent. Use 2 mL of complete medium per well. 2. To 100 µL of 0.25 M CaCl2, add 2.5–3.5 µg reporter gene plasmid, 1.25–1.5 µg expression plasmid of a specific transactivator (if appropriate) and make the total amount of nucleic acid up to 5 µg with a carrier plasmid (see Note 3). Add dropwise an equal volume of 2X BBS (equilibrated to room temperature), mix briefly and allow to stand for precisely 1 min. Add dropwise to the cells. Immediately return to either a 3% (for optimal transfection efficiency) or 5% humidified CO2 incubator at 36–38°C for 15–20 h (see Note 4). 3. Remove the transfection solution and wash three times with 1–2 mL of PBSE. Add 2 mL of complete medium and incubate (5% humidified CO2 incubator; 36–38°C) for 48–60 h.

3.1.2. Harvesting 1. Remove media and wash once with 1–2 mL PBSE. Add 1 mL PBSE and scrape cells off the well surface using a rubber policeman.

Promoter Studies in Hemostasis

73

2. Transfer the suspended cells into a 1.5-mL Eppendorf tube and centrifuge in a microfuge (11,600g; 13,000 rpm) for 2 min. 3. Resuspend the cell pellet in 100 µL cell lysis buffer. Incubate at room temperature for 60 min. 4. Centrifuge (11,600g; 5–10 min) and retain cell supernatant. Store extract (in microtiter plates for convenience if 96-well format luciferase assays are to be carried out) at –70°C.

3.1.3. Luciferase Assay 1. Thaw cell extract and luciferase assay reagent; equilibrate both to room temperature. 2. Add 20 µL of each cell extract under investigation to a well of a white polystyrene flat bottomed microtiter plate (e.g., Microlite 1™). Add 100 µL luciferase assay reagent, measure peak output in an appropriate luminometer (e.g., Dynatech ML3000) and derive a mean value for light output (in relative light units) over the peak period (normally in the range 30–90 s). Although automatic injection facilities are not required for monitoring the reaction it is advisable to simultaneously add the luciferase assay reagent and measure the light output. 3. Cell extracts can be normalized for transfection efficiency although certain problems may be experienced with some procedures (see Note 5).

3.2. Preparation of Nuclear Extract We have successfully used the following method, a slight modification of those originally described by Graves et al. (7) and Gorski et al. (8), to prepare nuclear extract from either freshly prepared rat liver or material stored at –70°C for one month. See Note 6 for an alternative procedure which we have used for preparing material from cultured mammalian cell lines. 1. The liver sample (5 g; we normally process two samples simultaneously and pool prior to the dialysis step) is finely minced using a sharp razor blade, rinsed with TBS and the liquid removed by filtering through sterile gauze. 2. Add 15 mL of chilled homogenisation buffer and homogenise the resultant suspension (10 strokes in a 10 mL Dounce Homogenizer). Filter the homogenate through sterile gauze and add NP40 to a final concentration of 0.5% (v/v). 3. The homogenization and filtration procedure is then repeated and the final homogenate resuspended (by vortexing) in an equal volume of prechilled 2.6 M sucrose buffer. 4. A nuclear pellet is obtained by layering this homogenate over 10 mL of 2.1 M sucrose buffer in a 38.5 mL polyallomer centrifuge tube and centrifuging at 100,000g, 0°C for 45 min (Beckman SW27 or SW28 swing bucket rotor; 27,000 rpm). 5. Resuspend the nuclear pellet in 4 mL prechilled nuclear lysis buffer and determine the OD260 content (U/mL) by assaying a 1:200 dilution in 0.5% SDS (w/v). Additional nuclear lysis buffer is then added to dilute the sample down to 20 OD260 U/mL. 6. Nuclear lysis is achieved by the gradual addition of 0.1 vol 4 M (NH4)2SO4 with constant stirring for 30 min at 4°C.

74

Winship and Spray

7. Nuclear debris is then removed by centrifugation at 100,000g at 0°C for 30 min in 26.3 mL polycarbonate tubes with cap assemblies using a Beckman 70Ti rotor (45,000 rpm). 8. Nuclear proteins are precipitated by the gradual addition (over approx 15 min) of sufficient solid (NH4)2SO4 to raise the concentration by a further 0.3 g/mL. The solution is then incubated on ice for a further 30 min to facilitate complete precipitation of proteins. 9. Centrifuge the precipitated nuclear proteins (100,000g at 0°C for 30 min. Beckman 70Ti fixed angle rotor; 45,000 rpm). Resuspend the protein pellet in dialysis buffer (use 1 mL per 10 mL of nuclear lysis buffer originally used). At this stage material can be pooled if two (or more) liver samples have been prepared in parallel (see step 1 above). 10. Dialyse against two changes of 250 mL dialysis buffer for a total of 4 h at 4°C. Alternatively, we find that the sample can be dialysed overnight and then for a further two hours once the buffer solution has been changed 11. Transfer the dialyzed solution to 1.5-mL Eppendorf tubes and centrifuge in a microfuge (11,600g, 5 min) to remove any precipitate which may have formed during dialysis. 12. Divide the supernatant into 50-mL aliquots, snap-freeze in liquid nitrogen and store long-term in liquid nitrogen or at –70°C. 13. The extract can be quantified by either the Lowry or Bradford protein assay methods (9,10) using 5, 10, and 20 µL of extract. Typically, 2–4 mL of extract derived from 10 g liver tissue would have a protein concentration in the range 1–3 mg/mL.

3.3. DNaseI Footprinting A number of methods have been described that differ in the precise composition of the binding buffer, incubation time of, and temperature at which binding (of protein to DNA probe) takes place. Alternative methods for achieving limited DNaseI digestion of the probe following incubation with nuclear extract have also been described. We will present a footprinting protocol that we have found to be both robust and reproducible.

3.3.1. Preparation of Radiolabeled Probe 1. One of the two oligonucleotide primers to be used in the PCR reaction is 5' end labeled using T4 polynucleotide kinase in a 10 µL reaction volume comprising: 0.1 vol 10X buffer, 5 pmol primer, 1.5 µL γ32P ATP, 5–10 U T4 Kinase. Incubate at 37°C for 15–30 min. 2. The PCR reaction is set up in a total volume of 50 µL containing 0.1 vol 10X PCR buffer, 5 pmol labeled primer in the 10 µL kinase reaction buffer (see above), 5 pmol unlabeled primer in the previously optimized buffer and reaction conditions for the chosen primer and template combination. It should be noted that the addition of the radiolabeled primer in kinase reaction buffer automatically makes the final PCR buffer 2 mM in MgCl2. This must be taken into account when

Promoter Studies in Hemostasis

75

optimizing the PCR conditions. See Note 7 for a set of PCR conditions we use which appear to be widely applicable when amplifying from plasmid templates.

3.3.2. Gel Purification and Elution of Probe 1. Add 0.1–0.2 vols sample loading buffer to the PCR product and size fractionate on a 20 cm × 20 cm (1-mm thick) 4–6% native polyacrylamide gel in 1X TBE at 200 V for an appropriate amount of time depending on the expected fragment size (see Note 8). Use 1-cm wide square-tooth wells. 2. Dismantle the gel apparatus, cover gel with cling film and expose to x-ray film for 5–10 min. Locate the position of the PCR fragment on the gel by overlaying the autoradiograph and excise the appropriate gel fragment with a scalpel blade. 3. Determine the approximate volume of the gel slice by weighing (assume a density of 1 g/mL for these purposes), add 2 vol elution buffer and incubate at 37°C overnight on a rotating platform. For convenience the gel slice should have a volume of no more than approximately 200 µL; this then allows the entire procedure to be carried out in a single 1.5-mL or 2-mL Eppendorf tube. Transfer the acrylamide/elution buffer mixture to the barrel of a 1-mL syringe plugged with siliconised glass wool. Place the syringe into a 15-mL tube such that it rests on the rim and recover the eluant following centrifugation at 1,600g for 2 min. 4. Transfer the eluant to a 1.5-mL Eppendorf tube. Add 0.1 vol 3 M sodium acetate and 2.5 vol ethanol; precipitate the DNA by incubation at –70°C for 30 min. Centrifuge in a microfuge (11,600g, 10 min), remove supernatant, add 200 µL 70% ethanol and recentrifuge (11,600g, 5 min) after vortexing briefly. It is convenient at this stage to check both pellet and supernatant with a mini monitor to ensure reasonable yield and efficient precipitation of the radiolabeled probe. 5. Resuspend initially in 50 µL distilled water. Adjust concentration to 20,000 cpm/µL as measured either in a scintillation counter or by holding 1 µL in a pipet tip immediately in front of the window of a hand-held mini monitor. The probe can be stored in this state at –20°C for up to 2 wk.

3.3.3. Binding Reaction and DNaseI Digestion We will present a method which we find reproducible; alternative reaction conditions which may be required in some circumstances are discussed in Note 9. 1. Into a 1.5-mL Eppendorf tube add 18 µL 5X binding buffer, 3 µg poly dI-dC, 30 µg nuclear extract (or an equivalent volume of dialysis buffer in the negative control) and distilled water to make the final volume 89 µL. Incubate at room temperature for 5–10 min. 2. Add 1 µL probe (20,000 cpm/µL) incubate at room temperature for 30 min. 3. Dilute RNase free DNaseI in 100 mM CaCl2. 4. We find it appropriate at this stage to optimize conditions by titrating four amounts of DNaseI: 0, 0.01, 0.1, and 1.0 U. To each 90 µL sample add appropriate amounts of DNaseI (diluted in 100 mM CaCl2 immediately before use) and/or 100 mM CaCl2 solution to give a final volume of 100 µL and final concentration

76

Winship and Spray

of 10 mM CaCl2 containing either 0, 0.01, 0.1, or 1 U of DNaseI. Mix by pipetting and incubate at room temperature for 30 s. Stop the reaction by the addition of an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1 v/v). Vortex immediately and ensure complete mixing. 5. Centrifuge for 5 min in a microfuge (11,600g) and transfer the top (aqueous) phase to a fresh Eppendorf tube. Ethanol precipitate by adding 0.1 vol 3 M sodium acetate plus 2 vols., ethanol and incubating at –70°C for 30 min. Centrifuge (11,600g; 10 min), discard the supernatant and wash the DNA pellet with 400 µL 70% ethanol. Recentrifuge (11,600g; 5 min) and air dry the pellet.

3.3.4. Preparation of A+G Marker Track We find that the most reliable method of preparing a suitable marker track to allow the position of footprints to be determined is to follow a rapid method used for cleaving at A and G residues in Maxam-Gilbert sequencing (11). We routinely prepare sufficient material for four marker tracks. 1. To 4 µL (80,000 cpm) of probe in a 1.5-mL Eppendorf tube add 4 µL 1 mg/mL poly dI-dC and 6 mL distilled water. 2. Add 3 µL 8.8% formic acid and incubate at 37°C for 7 min. Stop the reaction by chilling to 0°C. 3. Add 150 µL 1 M piperidine at 0°C and incubate at 90°C for 30 min. 4. Add 1.2 mL 1-butanol, mix by vortexing for 30 s and then pellet the DNA by centrifugation in a microfuge (11,600g for 2 min). 5. Ensure complete removal of supernatant prior to resuspending the DNA pellet in 150 µL 1% SDS. Add 1–2 mL 1-butanol, mix by vortexing for 30 s, and centrifuge for 2 min at 11,600g. 6. Remove supernatant completely and allow the pellet to air dry. Store for up to 2 wk at –20°C.

3.3.5. Denaturing Polyacrylamide Gel Electrophoresis 1. Prepare a 20 cm × 50 cm (0.4-mm thick) 6% denaturing polyacrylamide gel using a 16 well square-toothed comb. 2. Resuspend each individual DNA pellet in 3 µL of denaturing gel loading buffer (use 12 µL for the marker) and denature by incubating at 90°C for 5–10 min. 3. Load 3 µL of each sample (including marker) on the gel and size fractionate at 38 W (1200–1500V) for an appropriate amount of time according to the region of interest (see Note 10). 4. Dismantle the gel apparatus. Fix the gel in an aqueous solution of 10% (v/v) methanol, 10% (v/v) acetic acid for 10–20 min. Transfer the gel onto 3MM filter paper (Whatman), cover with Saran Wrap™ and dry down at 80°C under vacuum. Autoradiograph at –70°C with intensifying screen and preflashed film.

3.4. Electrophoretic Mobility Shift Assay We will present the basic method for EMSA indicating the stage at which either unlabeled competitor oligonucleotide or antibody should be added when carrying out competition band shift and supershift assays respectively.

Promoter Studies in Hemostasis

77

3.4.1. Preparation of Radiolabeled Probe We will describe the method we normally use for making radiolabeled double-stranded probes from complementary oligonucleotides (20–40 bp in length). Larger probes can be made essentially by the same method described for the production of probes used in DNA footprinting (see Subheadings 3.3.1., 3.3.2., and Notes 7 and 11). 1. 5'-end label 12–15 pmol (approx 100 ng of a 20 bp oligonucleotide) of one of the 2 complementary oligonucleotide primers in a 10 µL final reaction volume containing 1 µL 10X Kinase buffer, 3 µL γ32P ATP and 5–10 U T4 polynucleotide kinase. 2. Incubate at 37°C for 20 min. 3. Heat denature the enzyme at 90°C for 10 min.

3.4.2. Annealing and Gel Purification of Probe 1. To the kinased oligonucleotide (or an equivalent amount of unlabeled oligonucleotide if a double-stranded competitor oligonucleotide is required) add 1 µL 20X annealing buffer, a fivefold molar excess of unlabeled complementary oligonucleotide and sufficient distilled water to give a final volume of 20 µL. 2. Incubate at 90°C for 10 min and then allow annealing to take place as the solution cools down to room temperature. 3. The annealed probe is now purified exactly as described in Subheading 3.3.2., except that to allow for the difference in size of the probes for footprinting and EMSA an 8 or 10% native polyacrylamide gel is used and the samples size fractionated for approx 1 h at 200V. The eluted probe is resuspended in distilled water at a final concentration of 10,000 cpm/µL. The position of an unlabeled fragment can be determined either by UV shadowing or in relation to the position of it’s homologous radiolabeled counterpart in an adjacent track. As a rough guide, 20 bp double-stranded DNA fragments migrate at approximately the same rate as bromophenol blue under these conditions.

3.4.3. Binding Reaction The components of the binding reaction and conditions under which binding takes place together with the conditions of electrophoresis have a profound effect on whether or not particular components of the nuclear extract are able to bind (see Notes 12 and 13). We present the most robust set of conditions which we have found for the binding of liver-specific transcription factors but some degree of experimental optimization for specific applications must be anticipated. 1. In a final volume of 19 µL, mix together 4 µL 5X EMSA binding buffer, 2 µg poly dI-dC and 10–20 µg nuclear extract. If required, NaCl should be added at this stage to adjust the final concentration to 50 mM. Incubate at room temperature for 10 min.

78

Winship and Spray

2. Add 1 µL (10,000 cpm) of probe and incubate at room temperature for 30 min. When competition or supershift assays are being performed, a 10- to 200-fold molar excess of cold competitor oligonucleotide or antibody respectively should be added at this stage. In the case of supershift assays increase the pre-incubation time to 2– 6 h. The final volume should remain at 20 µL; lower the volume in which prebinding takes place, but aim, if possible, to reduce this to no less than 18 µL.

3.4.4. Polyacrylamide Gel Electrophoresis As previously stated the composition of the size-fractionation gel will determine whether specific DNA-Protein complexes can be visualized (see Note 13). 1. Prepare a 20 cm × 20 cm, 1-mm thick 4% acrylamide (80:1 acrylamide:N, N’ methylene-bisacrylamide) gel containing 2.5% v/v glycerol in 0.5X TBE. Use a 16-well square-tooth comb. 2. Prerun the gel for 20 min at 200 V. 3. Load samples (do not add any loading buffer) and size-fractionate at 200 V for 90 min. 4. Dismantle the gel plates, transfer the gel onto 3MM paper (Whatman), cover with Saran Wrap™ and dry down at 80°C under vacuum. 5. Autoradiograph overnight using pre-flashed film and intensifying screen at –70°C if necessary.

4. Notes 1. Cloning promoter fragments into the reporter gene vector: a. We always ensure that the 3'-end of the cloned promoter fragment is located between the start sites of transcription and translation of the gene under investigation. This allows the production of reporter gene protein from the intended translation start site in the reporter vector while eliminating the risk of any incorrect translational initiation from within the cloned promoter fragment itself. b. A panel of reporter gene constructs is produced in which the promoter fragments have 3'-ends conforming to the conditions outlined in item a above and a series of different 5' boundaries. In this way, comparisons can be made between the different constructs and regions of potential regulatory importance defined. 2. Factors influencing choice of cell type include ease of transfection and maintenance together with the tissue of origin in relation to known tissue expression sites of the gene under investigation. HepG2 conforms to the above criteria and with it’s liver epithelial cell origin is probably the most commonly used cell line for the study of genes encoding proteins involved in the haemostatic process. 3. Carrier plasmid is used to both equalize the total amount of DNA in each transfection and adjust the overall DNA concentration to a level previously determined to give optimal transfection efficiency. Carrier plasmid should ideally be completely “neutral” and not contain sequences showing homology to known binding sites for mammalian transcription factors. Sonicated herring testes DNA

Promoter Studies in Hemostasis

4.

5.

6.

7.

79

can be used in place of plasmid but the relatively impure commercially available preparations may adversely affect transfection efficiencies. The calcium phosphate precipitation transfection procedure we use is based on an optimized method for HepG2 cells described by O’Mahoney and Adams (6). This method recommends the use of a low (3%) CO2 atmosphere during transfection originally described by Chen and Okajama (5). In our experience use of the standard 5% CO2 level at this stage does not severely compromise the transfection resulting in an approximate twofold reduction in efficiency. A number of options are available for normalizing reporter gene assays, each of which have relative advantages and disadvantages depending on the specific circumstances under which they are used. Determination of the total protein content in the cell lysates using the Lowry assay (9) essentially normalises for cell number, i.e., for a combination of starting cell number and harvesting efficiency. It should be stressed that this method will not of course control for transfection efficiency in each test sample. The most commonly used procedure to normalize for both cell number and transfection efficiency involves co-transfecting each test sample with an identical amount of a second reporter gene plasmid (e.g., β-galactosidase). The amount of this second reporter gene construct accumulated in the cell lysate is then measured by standard procedures (12). Unfortunately, this procedure is invalid in experiments assessing the effects of specific transactivators on the test promoter if the promoter driving expression of the second reporter gene is itself transactivated by the same factor(s). Furthermore, it has recently been reported that the cotransfection of a β-galactosidase expression vector together with the Luciferase test construct inhibited luciferase activity in a dose dependent manner, presumably owing to competition for the recruitment of limiting amounts of transcription factors (6). The only currently available procedure to overcome the limitations of the above method involves determining the amount of reporter gene plasmid DNA present in the cell lysate by dot blotting and hybridisation with a suitable radiolabeled probe. If transfection efficiencies are extremely low, then a more sensitive, quantitative PCR-based procedure may be required instead. The method we describe is suitable for the preparation of nuclear extract from both whole tissue and cultured mammalian cells. However, we find that the alternative, and much more rapid procedure described by Andrews and Faller (13) gives comparable results for nuclear extract prepared from cultured mammalian cells. We find the following PCR method to be widely applicable for the purposes of amplification with one radiolabeled primer: In a final volume of 50 µL add 1 ng plasmid template (or 1 µg genomic DNA can be tried if cloned sequences are not available), 10 µL radiolabeled primer (5 pmol) in kinase reaction buffer, 5 pmol unlabeled second primer, 200 µM final dNTPs 0.1 vol 10X buffer (166 mM ammonium sulfate, 670 mM Tris-HCl, pH 8.8, 100 mM 2-mercaptoethanol, 1 mg/mL bovine serum albumin—add the 2-mercaptoethanol and bovine serum albumin just before use) and 1 U Taq polymerase (Bioline). Overlay the samples with liquid paraffin. In a Perkin Elmer DNA synthesizer model 480 the samples are

80

8.

9.

10.

11. 12.

13.

Winship and Spray amplified under the following conditions: The DNA is initially denatured by heating at 95°C for 7 min followed by 30 rounds of primer initiated DNA synthesis comprising a 1 min, denaturation step at 94°C, annealing at 55°C for 1 min and finally a 2 min elongation stage at 72°C. To help determine the appropriate gel percentage and duration of electrophoresis the following information may prove useful: xylene cyanol FF comigrates with DNA fragment sizes of 460 and 260 bp on 3.5 and 5% native polyacrylamide gels respectively; the corresponding figures for bromophenol blue being 100 and 65 bp. An alternative binding buffer which we have also used successfully was originally described by Eul et al. (14) and has the following composition: 20 mM HEPES, pH 7.9, 50 mM KCl, 3.5 mM MgCl2, 2 mM DTT, 15% glycerol. Reactions are carried out in a 10 µL volume and incubated for 25 min at either 0, 20, or 37°C. The length of time for which the samples are size-fractionated is dependent on which region of the probe is being analyzed. By way of guidance, on a 6% denaturing polyacrylamide gel the bromophenol blue and xylene cyanol FF marker dyes comigrate with DNA fragments of approx 26 and 106 bp, respectively. We have successfully prepared and used probes up to approx 100 bp in length. Larger probes than this are not in our experience suitable for use in band shift assays. Alternative EMSA binding reaction conditions include: a) The Eul et al. footprinting buffer described in Note 8; b) 10 mM HEPES pH 7.8, 4% Ficoll400, 40 mM KCl, 2 mM MgCl2, 0.5 mM DTT; and c) 20 mM HEPES pH 7.9 at 40C, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT. An alternative and widely used gel running buffer for EMSAs is a low ionic strength buffer comprising 6.7 mM Tris, pH 7.9, 3.3 mM sodium acetate, 1 mM EDTA. The gel itself is 4% polyacrylamide (80:1 acrylamide: N, N’ methylenebis-acrylamide), 2.5% (v/v) glycerol in the above buffer.

References 1. De Wet J. R., Wood K. V., DeLuca M., Helinski D. R., and Subramami, S. (1987) Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7, 725–737. 2. Gorman C. M., Moffat L. F., and Howard B. H. (1982) Recombinant genomes which express chloramphenicol acetyl transferase in mammalian cells. Mol. Cell. Biol. 2, 1044–1051. 3. Alam J. and Cook J. L. (1990) Reporter genes: application to the study of mammalian gene transcription. Anal. Biochem. 188, 245–254. 4. Kristie T. M. and Roizman B. (1986) α4, the major regulatory protein of herpes simplex virus type 1, is stably and specifically associated with promoter-regulatory domains of alpha genes and of selected other viral genes. Proc. Natl. Acad. Sci. USA 83, 3218–3222. 5. Chen C. and Okayama H. (1987) High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745–2752. 6. O’Mahoney J. V. and Adams T. E. (1994) Optimisation of experimental variables influencing reporter gene expression in hepatoma cells following calcium phosphate transfection. DNA Cell Biol. 13, 1227–1232.

Promoter Studies in Hemostasis

81

7. Graves B. J., Johnson P. F., and McKnight S. L (1986) Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44, 565–576. 8. Gorski K., Carnerio M., and Schibler U. (1986) Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47, 767–776. 9. Lowry O. H., Rosebrough N. J., Farr A. L., and Randall R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. 10. Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein dye binding. Anal. Biochem. 72, 248–254. 11. Maniatis T., Fritsch E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY, pp. 13.96–13.97. 12. Herbomel P., Bourachot B., and Yaniv M. (1984) Two distinct enhancers with different cell specificities co-exist in the regulatory region of polyoma. Cell 39, 653–662. 13. Andrews N. C. and Faller D. V. (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19, 2499. 14. Eul J., Meyer M. E., Tora L., Bocquel M. T., Quirin-Stricker C., Chambon P., and Gronemeyer H. (1989) Expression of active hormone and DNA-binding domains of the chicken progesterone receptor in E.coli. EMBO J. 8, 83–90.

Clotting Factors

85

9 Detection of Mutations and Polymorphisms in Clotting Factors by Denaturing Gradient Gel Electrophoresis Rainer Schwaab and Winfried Schmidt 1. Introduction In the last few years a number of methods have been developed that, in combination with the PCR method (1), have vastly improved the detection of mutations and polymorphisms. The most frequently used screening methods for mutation hunting in bleeding disorders are denaturing gradient gel electrophoresis (DGGE) (2), single-strand conformation polymorphism (SSCP) (3), and chemical mismatch cleavage (4). This chapter gives an introduction to the theory and practice of DGGE that facilitates the establishment of this mutation screening method. The DGGE method is generally able to detect point mutations, small deletions, and insertions by melting PCR amplified DNA fragments into single strands at different positions in a denaturing gradient gel. Every DNA fragment consists of one or more sequence areas that melt into single strands cooperative at a specific temperature (Tm). According to this phenomenon, these sequence areas are also called melting domains. The specific melting temperature of such a domain is influenced by interactions between the complementary strands and between adjacent bases of one strand. Based on this network of interaction, a single base pair change not only increases or decreases the melting temperature at this base position, but also changes the cooperative melting behavior of the whole melting domain. The neighboring melting domains are distinctly separated from each other by a rapid temperature change occurring within a few base pairs. In addition, melting domains in general vary in length between 25 and several hundred From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

85

86

Schwaab and Schmidt

base pairs and normally melt into single strands at a temperature of 65°C to 80°C (5). Within the electrophoresis, these melting temperatures can be achieved by a combination of a constant temperature (60°C) and by a linearly increasing denaturing gradient. Based on this knowledge, Lerman and Fischer developed the DGGE method, which allows the identification of mutations by comparing the different melting behaviors of wild-type DNA and a patient’s DNA on a denaturing gradient gel (5). Since the practical conditions of an optimum separation of DNA fragments can only be found by practice—which takes time and money—Lerman and Fischer then started to develop calculation programs (MELT87; SQHTX) for DGGE (6), which relied on the work of Poland (7), Fixman and Freire (8), and Gotoh and Tagashira (9). These programs allow one to find theoretically the optimum melting domain for a DNA fragment and also help to calculate whether any mutation within this DNA fragment can be identified under specific running conditions (gel running time, voltage, the scope of denaturing gradient). The results of the programs can be influenced by varying the amplification primers’ position. One further advantage of the DGGE method is the introduction of a GC-clamp on one site of the amplification product during the PCR reaction (10). This additional GC-attachment very often helps to unite two or more melting domains to a large one, with the consequence that the whole fragment can now confidently be screened for a sequence variation at one time. If this does not work, it might be that the mutations in the higher melting domain are not detectable during DGGE. Like the DGGE without a GC-clamp, the primers’ position, and additionally the effect of the GC-clamp attached to the 5'-site or the 3'-site of the amplification product, influences the results of the MELT87 and the SQHTX program (6). As we mentioned above, DGGE begins with preliminary theoretical work. While the MELT87 program assists in calculating a single melting temperature for a DNA region (exon), which is to be screened for mutations (Fig. 1) (10), the SQHTX program compares the melting temperature (running distance) of the wild-type with any mutated DNA fragment on a gradient gel in this region (11) (Fig. 1). According to these theoretical results, specific amplification primers (of which one bears a GC-clamp on its 5'-end) are synthesized flanking this DNAregion. After PCR reaction of a wild-type DNA, the double-stranded amplification products are composed of two different melting regions: a GC-region with a very high melting point and a lower melting domain, which is to be screened for mutations (10) (Figs. 1 and 2). The optimal running conditions of these products are then tested by running several so-called “travel schedule gels” (Fig. 3). At 2-h intervals, a sample is

Clotting Factors

87

Fig. 1. Schematic representation of DGGE. The first lane shows the heteroduplex results of a wild-type and a mutated DNA separated on a denaturing gradient gel, the second lane represents the separation of two mixed wild-type DNAs (homoduplexes). Comparing both results shows that the wild-type mixture melts at one position, because only homoduplexes of the same kind are formed. In contrast to this, the mixture of wild-type and mutated DNA show four different bands: the two different heteroduplexes and the original homoduplexes. The position of the two heteroduplexes always lies above the melting point of the homoduplexes. The mutated original homoduplex may be positioned above or below the wild-type homduplexes. At their melting point, the single strands are still held together by the GC-clamp, shown as a thick line.

loaded onto a travel schedule gel, which consists of a linearly increasing denaturing (urea/formamide) gradient. Electrophoresis runs under constant voltage

88

Schwaab and Schmidt

Fig. 2. Graphic demonstration of the melt map (MELT87) and the displacement map (SQHTX-program) of the factor VIII gene exon 16. MELT87: While the X-axis indicates the base position in the PCR fragment, the Y-axis left indicates the melting temperature (Tm [°C]) of each of these bases calculated by MELT87. The thin line represents the heterogenous melting behavior of the amplification product (composed of exon 16) and the flanking intron sequences, but without any GC-clamp. The solid line represents changes in the fragment’s melting behavior when a GC-clamp is connected to its 5'-site. As a consequence of this, the melting temperature of the first 40 bases, representing the GC-clamp, shows values of about 95°C, which then drop to a melting temperature of 69°C. This value keeps the rest of the amplification product and the exon 16 constant. SQHTX: The y-axis on the right site gives the displacement temperature (deltaT°C) for each base position of the same exon 16 PCR-fragment, including the GC-clamp. The dashed line shows that the displacement temperature goes from delta T 0°C (GC-clamp) up to about delta T 0.4°C, which exists in the whole exon 16 region. Since we know that under practical conditions the lower limit of displacement is deltaT = 0.1°C (= delta 0.3% denaturing concentration = 0.1 cm running distance in the gel), we can now detect all possible (point) mutations within the fragment of interest. The arrows show the position of three mutations detected in an analytical gel under these conditions (Fig. 4).

for 24 h. Under the right running conditions, one of the loaded wild-type DNA sample starts retarding to the gel. Its position is determined by a specific urea concentration which melts the lower melting domain of the double-stranded DNA into single strands all at once (Fig. 3, lanes 5 and 6, with an optimal running time of 20–22 h). Both strands are still connected by the high melting

Clotting Factors

89

Fig. 3. Results of a travel schedule gel showing the optimum running conditions of an amplification product, including exon 16 of the factor VIII gene. PCR products amplified from one wild-type DNA have in part successively been loaded onto gel from the right to the left 6 times at 2 h intervals (lane 2–7). According to the length of the running time, bands reach a denaturing concentration, which then causes the lower melting domain to melt into single strands. At this concentration, bands begin to focus and adhere in the gel (lane 4–7). However, the optimum running time (20–22 h) is represented by lane 5 and 6. In these lanes, bands are shown the first time to be most retarded and most distinctive. To demonstrate that a running time of 20–22 h is correct, an exon 16 amplification product with a point mutation was loaded successively (lanes 14–19) along with the normal amplification product - from left to right. In contrast to the wild-type PCR product, the best difference in running behavior can be observed after 20–22 h (lanes 5, 6 compared to lanes 15, 16). Lanes 8–13 show the advantage of analyzing heteroduplex formation between a wild-type and a mutant DNA fragment. Samples loaded from left to right separate on gel in 4 different bands representing two different homoduplexes and two different heteroduplexes. The heteroduplex bands differ very soon from homoduplexes, thus allowing a better mutation identification in critical cases.

GC-clamp, which allows the staining of the amplification product with ethidium bromide, making it visible on an UV transilluminator. When the running conditions (the gel gradient, the voltage and the running time) have been correctly established for a DNA fragment spanning a specific

90

Schwaab and Schmidt

Fig. 4. Analytical gel of the factor VIII gene exon 16 after heteroduplex formation of mutated patients’ DNA samples with a wild-type band. Mutations can be identified by any additional bands above the normal band (lanes 3–9). Controls, that is heteroduplex formation of two different wild-type PCR products, can be seen in lanes 2 and 10. Lanes 1 and 11 show a size marker produced by an HindIII digest of phiX174 DNA.

gene region, these conditions can now be used to run analytical gels for mutation screening (Fig. 4). Before loading the analytical gel, we form heteroduplexes between two patients’ PCR fragments or between a wild-type and a patient’s PCR product. As a control, heteroduplex formation between two wildtype PCR fragments is carried out. When gel electrophoresis and staining are completed, mutations can now be seen by identifying bands in addition to the normal control band (Fig. 4). The motive of the heteroduplex formation is to increase the sensitivity of the DGGE system. It produces two additional (heteroduplex) bands and therefore, allows detection of mutations that do not change the melting behavior of the wild-type and the mutant homoduplexes (Fig. 4). Although it takes some initial effort to establish the optimum electrophoresis conditions for every DNA fragment that has to be analyzed, once the method has been established, DGGE is a very fast, reliable, and sensitive method for identifying sequence variations.

Clotting Factors

91

Besides the chemical mismatch cleavage (CMC) (4) and the single-strand conformation polymorphism (SSCP) (3), the DGGE method described in this chapter is one of the most routine techniques for the analysis of inherited diseases or in a search for polymorphic sequences in linkage studies. It also shows the same, or almost the same, highly reliable sequence variation detection as the CMC, which is supposed to be the most accurate screening method. Once a mutation is identified, carrier diagnosis and prenatal diagnosis can be carried out by DGGE instead of by direct sequencing of the PCR products (12,13). The accuracy of the DGGE method can also be used by its ability to detect heterozygotes as well as mosaicisms. Since the efficiency of mosaicism detection has already been improved by many different applications, that are, e.g., detecting dominant TCR-gamma gene rearrangements at tumor clone densities that are as low as 0.1% (14), chimerism study after allogenic bone marrow transplantation with a detection limit of 1% (15) and mitchondrial mutation research (16), the method can also be used now to find mosaicisms in coagulation disorders. The routine application of DGGE is simple, with no radioactive labelling for signal detection needed. Once the method is established, the analysis is rapid and many samples can easily be screened at the same time, which has not only been the case for hemophilia A (17,18), but also for mutations in the factor IX-gene (hemophilia B) (19), the von Willebrand gene (20), the protein C gene (21), the protein S gene (22), and the factor V gene (23). However, in spite of all these advantages, this method is not optimal for every case of mutation screening. DGGE demands a substantial amount of theoretical and practical work for each DNA fragment, it should only be used if the same gene in many DNA samples is screened for mutations. DGGE only shows sufficient accuracy when the fragments in mutation detection are no larger than 350 bp. As a consequence, exons larger than 350 bp must be divided into two small overlapping amplifications. There are also some genes with a high GC-content, a factor that prevents melting of the double-stranded DNA into single strands in the gradient gel. Again, an alternative screening procedure must be selected. Another possibility besides CMC is SSCP. However, since this method is probably the least accurate in detecting sequence variations (24) and this method should only be used in our opinion if no other screening method is available, or if it is not important to find all possible mutations, or if finding the mutation in the shortest time (e.g., carrier diagnosis) is the priority. 2. Materials 2.1. PCR: Equipment 1. A thermal cycler. 2. Gilson or Eppendorf pipets with tips. If tips are only touched with gloves, autoclaving is not necessary. Filter tips are now also available. 3. 0.5 mL or 0.2 mL microcentrifuge tubes.

92

Schwaab and Schmidt

2.2. PCR: Reagents 1. A Taq DNA polymerase without any specific modifications (Pharmacia, Boehringer, etc.). If other Taq polymerases are used, the manufacturer should be asked which buffer conditions are applicable. Store polymerase at –20°C. 2. A 10X PCR buffer is normally included with the Taq polymerase. If this is not available a suitable 10X buffer comprises: 100 mM Tris-HCl, pH 8.8, 500 mM KCl, 15 mM MgCl2, 0.1% Triton X-100. Aliquot into 1 mL volumes and store at –20°C. 3. dNTP mix: 2 mM of dATP, dGTP, dCTP, dTTP in distilled water. Liquid stocks of single dNTPs are sold by many companies (e.g., Pharmacia, Boehringer). Aliquot and store at –20°C. 4. Mineral oil (e.g., Sigma molecular biology grade M5904) if using a thermocycler without a heated lid. 5. 300 ng/µL specific oligonucleotide primer without GC-clamp, 19–22 bp in length. 6. 900 ng/µL specific oligonucleotide primer (19–22 bp) with GC-clamp (39 bp: CGCCCGCCCCGCCCGCCGCCCGCCCCGCCCGCCGCCCGC). 7. Genomic DNA dissolved in TE (10 mM Tris, 1 mM EDTA, pH 8.0). A suitable dilution is 500 ng/mL. Store at 4°C. 8. 10X TAE buffer for agarose gels: 0.4 M Tris-HCl, 0.2 M sodium acetate, 10 mM EDTA, pH 7.4.

2.3. DGGE Equipment 1. An electrophoresis apparatus (Hoefer SE 600; glass plates 180 mm × 160 mm; spacer thickness 0.75 mm). The Hoefer SE 600 was originally developed to separate proteins, but can also perform DNA gel runs. 2. Power supply. 3. A coil to heat a water bath and a circulation pump to keep a constant gel temperature of 60°C during gel run. 4. A gradient mixer together with a magnetic stirrer and a butterfly intravenous infusion set for pouring the denaturing gradient gel. (The needle should have an outside diameter of 1.9 mm and be connected to a tube). 5. A microsyringe for loading the samples onto the gel. 6. A peristaltic pump for circulating the buffer between the upper and the lower tanks of the electrophoresis unit to prevent significant pH shifting during electrophoresis. 7. An UV transilluminator. 8. A gel documentation system to photograph gels (e.g., Polaroid camera). 9. A personal computer loaded with Lerman’s calculation programs MELT87 and SQHTX. The SQHTX program requires a personal computer with a mathematical coprocessor or with a Pentium processor. 10. MELT87 (10). 11. SQHTX (11).

2.4. DGGE Solutions 1. 10X TAE buffer, pH 7.4. 2. 40% formamide deionized with a mixed-bed resin that is afterwards filtered through a normal solution filter (Schleicher and Schüll).

Clotting Factors

93

3. 1X loading buffer: 20% Ficoll 400, 10 mM Tris-HCl, pH 7.8, 1 mM EDTA, pH 8.0, 0.1% orange G. 4. 40% polyacrylamide stock solution (acrylamide:bisacrylamide = 37.5:1). 5. 100% denaturing polyacrylamide stock solution: 7.0% polyacrylamide (using the 40% polyacrylamide stock), 7.0 M urea, 40% formamide dissolved in 1X TAE buffer, pH 7.4. 6. 0% denaturing polyacrylamide stock solution: 7.0% polyacrylamide (using the 40% polyacrylamide stock) dissolved in 1X TAE buffer, pH 7.4. 7. 10% ammonium persulphate stock solution. 8. TEMED. 9. Ethidium bromide stock solution (10 mg/mL).

All stock solutions should be prepared with deionized or distilled water and stored at 4°C. Ammonium persulfate stock solution should be stored at –20°C. 3. Methods 3.1. Amplification Amplification primers determined by the computer programs are synthesized on an oligonucleotide synthesizer (ABI) or ordered from a company. In either case primers are purified over high-pressure liquid chromatography (HPLC). 1. Prepare on ice the following: 10 µL 10X PCR buffer, 10 µL dNTP mix, 500 ng genomic DNA, 50 pmol oligonucleotide primer, 50 pmol oligonucleotide primer with GC-clamp, 2.5 U Taq DNA polymerase and add distilled water to a volume of 100 µL. 2. After mixing, overlay the PCR solution with mineral oil, and carry out the amplification on a thermocycler (Cetus or Biometra; without a heatable lid) according to the following conditions: an initial denaturation at 94°C for 420 s, followed by denaturing 94°C for 35 s, annealing at 50–57°C for 120 s and extending at 72°C for 60 s + 3 s/cycles. On the final step the extension time should be extended to 600 s. 3. After amplification check the specificity of the reaction by running 1/10th of the PCR product on a 2% agarose gel.

3.2.Travel Schedule Gel After amplification, the theoretical DGGE running conditions found by the computer programs need to be adapted to the practical running conditions. To do this, several denaturing gradient gels (travel schedule gel), which differ as to variation in the urea gradient, the voltage and the running time, need to be carried out respectively for several different amplification products. Since a strong correlation between theoretical and practical values exists, one could try to run analytical gels directly according to the theoretical data. Denaturing gradient gels can be run successfully in a Hoefer SE 600 electrophoresis unit

94

Schwaab and Schmidt

which is attached to a circulating water bath set to a constant temperature of 60°C (Fig. 5). This temperature is always used for travel schedule and analytical gels. To prepare the gel: 1. Clean the glass plates of the gel apparatus scrupulously, first with warm water then with iso-propanol and finally with distilled water. 2. Fix the glass plates within the fixation equipment by slightly greasing the bottom of the glass plates. 3. Take 10 mL of the 0% and of the 100% polyacrylamide stock solution and prepare the required solutions for the gradient gel (for instance: prepare a 40% and a 60% denaturing solution for a denaturing gradient gel that ranges between 40% and 60%). 4. Add 5.0 µL TEMED and 100 µL of 10% ammonium persulphate solution to each of the prepared solutions. Then pour the solution of the higher concentration into the anterior chamber of the gradient mixer (characterized by an output channel) and that of lower concentration into the posterior chamber. Place the gradient on a magnetic stirrer with a stirring bar inside the anterior chamber. Stir bar rapidly, while taking care that no air bubbles are produced. To avoid the use of a peristaltic pump, it is very important that the gradient mixer be positioned on a higher level than the glass plates within the fixation equipment. For the connection between gradient mixer and glass plates, use a butterfly intravenous infusion set consisting of a needle with a 1.9 mm outside diameter connected to a tube of 1.9 mm. The free end of the tube is connected to the output channel; the butterfly needle is placed between the glass plates. 5. Start pouring the gel: first open the channel between both mixer chambers and then the output channel. 6. When finished, put the sample comb between the glass plates and allow the gel to polymerize for about 2 h. 7. In the meantime mix 1/5 of the PCR products (amplified from one isolated wildtype DNA) with the loading buffer. 8. At the end of the 2 h, remove the sample comb from the polymerized gel and fix the glass plates in the electrophoresis unit. 9. Fill the buffer tanks with running buffer (1X TAE, pH 7.4), put gel into the electrophoresis unit and start a prerun to heat the buffer to 60°C. 10. When the buffer has reached 60°C, stop the prerun and load one wild-type sample onto the gel by a microsyringe and start electrophoresis again (e.g., 25 V for a 25–45% urea/formamide gradient gel). This and all other samples should be denatured (by heating on a thermocycler using a two step cycle: denature at 96°C for 10 min, then keep at 55°C for 10 min) before loading onto the gel. 11. Load additional PCR samples of the same probe five times at 2 h intervals. 12. After 24 h running time, stop the gel run. 13. Stain the gel with the ethidium bromide solution (stock solution diluted 1:10.000) for 1 h and evaluate the gel on a UV transilluminator.

Clotting Factors

95

Fig. 5. Assembled equipment for DGGE. Top left, pump that circulates buffer from lower to upper buffer tank of the gel electrophoresis. Bottom left, water bath set at 60°C that circulates water from bath through electrophoresis tank. Top right, power supply. Center right, gel electrophoresis (Hoefer SE 600). Bottom right, magnetic stirrer. 14. If the amplification products loaded at different times onto the gel shows neither a distinct pattern nor a retarded running behaviour, then start another travel schedule gel using a slightly different denaturing gradient and/or voltage. If the right running time has been found, the bands change from a diffuse to a distinct pattern due to a focus on the gradient and a conspicuous retardation. In the example shown in Fig. 3, the optimum running time is 20–22 h (lanes 5 and 6). These running conditions can now be used to run analytical gels for mutation screening.

3.3. Heteroduplex Formation and Analytical Gel 1. Pour the gel as noted for the travel schedule gel. Prior to loading the amplification product, form heteroduplexes between one wild-type PCR product and the patient’s PCR product or, sometimes better, between two different patients’ products (see Subheading 4.3., Notes 25 and 26).

96

Schwaab and Schmidt

2. To create the heteroduplex, mix: 10 µL (80 ng) of a PCR-fragment amplified from wild-type DNA with 10 µL (80 ng) of a patient’s PCR product. Use the same amplification primers for both products. Add sample buffer equal to onethird of this volume. 3. Heat the samples on a thermocycler using a two step cycle: denature at 96°C for 10 min, then keep at 55°C for 10 min. 4. Load the heteroduplex samples onto the analytical gel and start the gel run, using the running conditions optimized by the travel schedule gel. 5. After the gel run is completed, stain and evaluate gel as noted for the travel schedule gel.

4. Notes 4.1. Programs and PCR 1. If no single melting domain of one PCR fragment can be created—for instance the 5' or 3' DNA sequence is unknown or the DNA fragment melts in two or more domains in spite of testing all possible primers’ positions—then only (single) nucleotide changes in the lowest melting can be identified with any accuracy. As the wild-type and the mutated DNA fragments migrate through the gradient gel, they reach a position where the concentration of the denaturing agent equals the melting temperature (Tm) of their lowest melting domain. As a result, the two different fragments separate into single strands due to the difference in base sequences at different denaturing concentrations. If a single nucleotide change lies in the second melting domain, the lowest melting domain will melt at the same gel position for both wild-type and mutated DNA. If the gel run continues, DNA fragments slowly continue to migrate within the gel until they reach a second specific denaturing concentration, which results in melting in the higher melting domain. However, since migration of wild-type and mutated DNA is very slow and it takes a long time before the second melting occurs, differences in the melting of wild-type and mutated DNA are difficult to detect. If there is no chance of getting a single melting domain within one amplification product and DGGE needs to be performed, the original PCR product must be divided into two PCR fragments. Alternatively, DNA fragments can be screened with a different mutation screening method, e.g., the chemical mismatch cleavage. 2. If many DNA samples need to be amplified routinely, amplification primers (particularly the primer with the GC-clamp) should be ordered in large amounts (minimum scale 0.2 µmol). In addition new primers should be ordered before the old ones are used, because the quality of the primers sometimes vary and you may need to reject the first shipment. 3. An effective amplification primer should be 19–23 bp long (minus the GC-clamp) with a well-balanced composition of bases. 4. A primer should not be able to hybridize with itself or with its partners over a distance longer than 4 bases. 5. The 5' and the 3' external ends of one primer should not be complementary to more than one base of the external end of the other primer.

Clotting Factors

97

6. The Tm of each amplification primer optimally lies between 56°C and 60°C. Programs are available for determinating primers’ Tm. However, we have found that a rough calculation according to Tm of bases (A and T = 2°C; C and G = 4°C) may suffice. 7. We have found that the same basic amplification conditions can be used for each amplification reaction. To optimise the different reactions, it is sufficient to change the annealing temperature. 8. Amplification reactions with a GC-clamp on one of the amplification primers’ end give better results when the time of each annealing reaction is longer than an ordinary amplification reaction. We found an annealing time of 2 min to be sufficient. 9. If different thermocyclers are used, the annealing time often has to be changed to achieve the same amplification reaction. 10. You can also try to use smaller amounts of amplification primers and of DNA template. In any case DGGE results also depend on having a PCR product without any background bands or high background smear.

4.2. Travel Schedule and Analytical Gel 11. Acrylamide stock solutions (0% and the 100% denaturing solution) should be prepared in large amounts, because every new preparation varies slightly from the original one. When new solutions need to be prepared, running parameters must be checked with reference samples or with travel schedule gels. This is also very important for the analytical gel runs. 12. When opening the output channel of the gradient mixer to pour the gel, the gel sometimes sticks in the tube. In this case tap the tube. 13. Pour the gel slowly (about 5 min). This helps to prevent air bubbles in the gel and results in an even gradient. 14. When gel has been poured in the evening, but will not be used until the next morning, polymerized gel should be covered by cling film to prevent drying. 15. Instead of Orange G, other dyes can be used for the loading buffer, e.g., bromphenol blue or xylene cyanol 16. The temperature of the electrophoresis puffer should be controlled before every gel run. Optimally, a thermometer will show the buffer’s temperature during the whole electrophoresis process. 17. The recommended buffer temperature is 60°C, since this temperature is close to the melting temperature of the melting domains. 18. To determine the running time of the travel schedule gel, always use constant voltage. In our experience, more distinct bands are obtained when a longer running time rather than a higher voltage is used. For best results use a voltage range between 25–60 V. 19. We found that a 20% difference in the denaturing gradient between the gel’s top and bottom seems to be reasonable. 20. The variables in the travel schedule gel - voltage, running time, and gradient are dependent upon the size and base content of the amplification products. 21. If available, a PCR sample whose mutation has already been identified should be loaded onto every analytical gel as a positive control.

98

Schwaab and Schmidt

22. The ethidium bromide solution used for staining the gels is known to be carcinogenic. Always use gloves when handling the solution. In addition, safety glasses are recommended when stock solutions are prepared.

4.3. Heteroduplex Formation 23. Heteroduplexes can also be formed overnight. Heat samples for 5 min at 96°C in a closed water bath, switch the power off, and let water cool down to room temperature overnight. 24. When two different patients’ PCR products are used to form heteroduplexes and this sample has a deviating band pattern, we must still determine which PCR product bears the mutation. This mutation can be localized by directly sequencing both PCR products or by forming two new heteroduplexes in which each patients’ DNA is mixed with a wild- type DNA and run with a new analytical gel. 25. Heteroduplex formation improves the detection of mutations: a. It allows the simultaneous analysis of two amplification products from two patients. b. It produces two additional bands, by allowing the detection of mutations that do not change the melting behavior of wild-type or mutated homoduplexes. Sometimes the running behavior of a mutated DNA fragment cannot be distinguished from the wild-type DNA. One possible situation could be a (point) mutation, which results in an identical, but reversed, base pairing (A/T->T/A) that has no influence on the melting behavior of its adjacent bases. In case of heteroduplex formation, the formed heteroduplexes, which now present a T/T and A/A mismatch base pair, respectively, differ much more in melting behavior than the original double-stranded DNA. This results in a completely different melting behavior of the heteroduplexes to the homoduplexes. An example of the different melting behaviors of hetero- and homoduplexes (representing exon 16 of the factor VIII gene and originating from several patients) is shown in Fig. 4. When one of the DNAs used for heteroduplex formation resulted in a completely different base pairing, we were able to identify four different bands in the analytical gel: two homoduplexes and two heteroduplexes (lanes 3, 4, 6, 7, and 8). When the wild-type and the mutated homoduplexes were similiar in melting behavior, we were able to identify only three different bands, one homoduplex and two heteroduplexes (lanes 5 and 9). 26. Genes or polymorphims exist that only show a respective small spectrum of mutations (e.g., Factor V Leiden only has one mutation) or alleles. In these cases you must form heteroduplexes between a patient and a wild-type DNA and not between two patients’ samples, otherwise the mutation or polymorphism remain undetectable.

4.4. Modifications of DGGE 4.4.1. Constant Denaturant Gel Electrophoresis (CDGE) Another modification in the DGGE protocol is a denaturant gel electrophoresis that is constant (CDGE) (25). Mutant and wild-type DNA fragments are

Clotting Factors

99

separated in a constant urea/formamide concentration that must at least be optimized by running a perpendicular gel or a travel schedule gel. Up until now, this method has not been used to identify sequence variations in coagulation disorders. 27. CDGE avoids the routine use of a gradient by selecting a denaturant concentration at which maximum separation between the wild-type and mutated fragments can be achieved. 28. Like DDGE, the use of CDGE requires a careful selection of optimum conditions, which not only comprises the determination of the denaturant concentration by a perpendicular gel or a travel schedule gel but also the theoretical data (melting behaviour and the displacement [delta T°C]) calculated on the computer programs MELT87 and SQHTX. 29. Screening is fast, requiring 2–4 h of electrophoresis after PCR. The running time needed will depend on the band resolution required. A wide separation between wild-type and mutated DNA can be achieved by longer running times. In addition, bands seem to show a more diffuse pattern than in DGGE. 30. We personally favor DGGE over CDGE method. If the melting profile of a PCR fragment is not optimal, it seems more likely that differences in running behavior are more easily detected in a denaturing gradient than under constant gel conditions.

4.4.2. Temperature Gradient Gel Electrophoresis (TGGE) Temperature gradient gel electrophoresis (TGGE) is a temperature-based variation of DGGE (26). Instead of a chemical gradient, denaturation is performed on an apparatus especially made for this purpose. TGGE is also in use now for mutation screening in protein C deficiency (27). 31. Compared to DGGE and CDGE, TGGE eliminates complex chemical interactions in the gel matrix. The great advantage of this technique is that separated bands can be isolated from a nondenaturing gel, which facilitates further work, such as recloning, reamplification or direct sequencing. 32. Like DGGE and CDGE, the optimum melting conditions of the TGGE-method for any DNA fragment are only found by both the calculation programs and practice. 33. A further disadvantage of this system is that it is not possible to run several gels per run.

4.4.3. GC-Clamp The efficiency of DGGE is greatly enhanced by attaching a GC-clamp to a DNA fragment. This section of the chapter describes some alternative methods for the synthesis of a high melting domain. Since the synthesis of GC-primers, 60–70 bp in length, is costly, a simple method has been developed by Top (28) that allows the incorporation of a universal 50-bp GC-clamp in any amplified DNA fragment during PCR. To do this, PCR is carried out with the specific primers A and B, which are comple-

100

Schwaab and Schmidt

mentary to the target sequence to be amplified. In addition, primer B contains a 15-bp linker sequence at the 5' end, which is incorporated into the amplified fragment. Then a second PCR is carried out, using primer A and a third primer C composed of the 15-bp linker sequence at its 3' end and the conventional GC-clamp. The combination of both PCRs results in the amplification of the original genomic DNA and the 50-bp GC-clamp. The advantage of this method is that the universal primer (primer C) can be used for every PCR reaction. An alternative to GC-clamps is the use of psoralen derivative primers called “ChemiClamp” primers (29). Besides the specific sequence, one amplification primer is modified by adding two additional adenines at its 5' site and by attaching a 5-(w-hexyloxyl)-psoralen to them. After amplification, the (doublestranded) PCR products are placed directly on an UV source (UV transilluminator, 365 nm) at room temperature for 15 min. During exposure time, both strands of the PCR product will be firmly crosslinked. Psoralens react by forming covalent bonds with the pyrimidine bases of nucleic acids. 34. Although the Top method does at least reduce the costs of amplification primers, the introduction of the GC-clamp in conjunction with a second amplification reaction seems too laborious for routine DGGE use. 35. As an alternative to adding additional adenines to the 5' site of one primer as cited in Costes et al. (29), one could try varying primer positions to get sequence specific adenines on this position. 36. Compared to the GC-tailed primers, amplification with psoralen-clamped primers reduces the background smear in the analytical gel significantly. 37. However, the crosslinking between the single-stranded DNAs of the PCR product is not complete. For, when separating psoralen-crosslinked DNA fragment on a denaturant gradient gel, two bands are visible: the crosslinked PCR product and the single strands. This effect may hinder the correct interpretation of the bands, especially when using multiplex PCR.

4.4.4. Multiplex Analysis Multiplex PCR cannot only be used for CMC and SSCP, but also for DGGE as already demonstrated for cystic fibrosis (30). Since the procedure is very difficult, it has not yet been applied to analyze coagulation disorders. 38. It is very difficult to carry out multiplex PCR combined with DGGE as a mutation screening method. Simultaneous amplification and DGGE analysis of pools of exon fragments require that the annealing temperature of the primers in the PCR reaction, the range of denaturants in the gradient and the running time are in harmony. In addition, the Tm of the fragments analysed under these conditions must differ sufficiently for them to separate during electrophoresis.

Clotting Factors

101

4.4.5. Staining of Gels Beside the ethidium bromide solution there are several other less-carcinogenic chemicals available now for staining polyacrylamide gels. One very sensitive method is the silver-staining method, originally developed for PCR-SSCP (31). However, since the method is laborious and its sensitivity is not always required, a good alternative is the use of SYBR (sold by FMC or Biozyme Germany). Staining DNA bands with SYBR is not as sensitive as silver-staining, but using UV-light at 254 nm and a special photographic filter (SYBR Green Gel Stain Photographic Filter; Bio-Rad), this method is more sensitive than ethidium bromide. In contrast to ethidum bromide, the application of SYBR also results in a more uniform stain of the gels. 39. Although silver staining is laborious to handle, it is a useful method in identifying minute traces of a mutated DNA mixed with wild-type PCR products. This is a situation found in haemophilia A, in which mosaicism can occur (32). Others applications in which tiny amounts of mutant DNA must be detected admist wildtype DNA are, for instance, in the case of chimerism studies after allogenic bone marrow transplantation (12) and mutations in the mitochondrial genome (16).

4.4.6. Bio-Rad System An alternative to the DGGE electrophoresis unit descibed above is the electrophoresis system D-GENE, available from Bio-Rad. This sytem specifically constructed only for DGGE and CDGE, is a compact system that offers all the necessary components. Figure 6 gives a survey of the complete electrophoresis system. In combination with the computer program MacMELT (MELT87) adapted to MacIntosh computers, this compact DGGE system is a simple and easy way to perform DGGE rapidly in the laboratory. 36. If additional accessories (a larger gradient mixer and a casting stands which allows pouring of 10 gels at the same time) are bought for this electrophoresis, many samples can be screened in a relatively short time. 37. The gradient mixer of the D-GENE system is unusual in handling. If another gradient mixer has been used up to now, it may be a good idea to stay with the same gradient mixer. If a change in the system is preferred, conditions have to be adapted accordingly. 38. This system does not come with a SQHTX program. However, to get optimum separation of amplification products, the SQHTX program should be used first in any case.

Acknowledgments Figures 1–5 were produced from ref. 33 with permission of Oxford University Press. Figure 6 was produced with permission of Bio-Rad.

102

Schwaab and Schmidt

Fig. 6. Description of major components of the D-GENE electrophoresis unit BioRad. 1. Lower buffer tank. 2. Lid with temperature controller. 3. Core. 4. Comb gasket holder. 5. Sandwich clamps. 6. Casting stand with sponge. 7. Stopcock. 8. Combs and spacer set. 9. Alignment card. 10. Gradient delivery system. 11. Filler spacer.

References 1. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 144, 335–350. 2. Myers, R. M., Maniatis, T., and Lerman, L. S. (1987) Detection and localisation of single base changes by denaturing gradient gel elctrophoresis. Methods Enzymol. 155, 501–527. 3. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766–2770. 4. Cotton, R. G., Rodrigues, N. R., and Campbell, R. D. (1988) Reactivity of cytosine and thymine in single-base pair mismatches with hydroxylamine and osmiumtetroxyde and its application to the study of mutations. Proc. Natl. Acad. Sci. USA 85, 4397–4401. 5. Fischer, S. G. and Lerman, L. S. (1983) DNA fragments differing by single basepair substitutions are separated in denaturing gradient gels: correspondence with melting theory. Proc. Natl. Acad. Sci. USA 80, 1579–1583. 6. Lerman, L. and Silverstein, K. (1987) Computational simulation of DNA melting and its application to denaturing gradient gel electrophoresis. Methods Enzymol. 155, 482–501. 7. Poland, D. (1974) Recursion relation generation of probability profiles for specific-sequence macromolecules with long-range correlations. Biopolymers 13, 1859–1871. 8. Fixman, M. and Freire, J. J. (1977) Theory of melting curves. Biopolymers 16, 2693–2704.

Clotting Factors

103

9. Gotoh, O. and Tagashira, Y. (1981) Stabilities of nearest-neighbour doublets in double-helical DNA determined by fitting calculated melting profiles to observed profiles. Biopolymers, 20, 1033-1042. 10. Sheffield, V. C., Cox, D. R., Lerman, L. S., and Myers, R. M. (1989) Attachment of a 40-base- pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc. Natl. Acad. Sci. USA 86, 232–236. 11. Abrams, E. S., Murdaugh, S. E., and Lerman, L. S. (1990) Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp. Genomics 7, 463–475. 12. Rosatelli, M. C., Dozy, A., Faa, V., Meloni, A., Sardo, R., Saba, L., Kan, Y. W., and Cao, A. (1992) Molecular characterization of beta-thalassemia in the Sardinian population Am. J. Human Genet. 50, 422–426. 13. Attre, O., Vidaud, D., Vidaud, M., Amselem, S., Lavergne J. M. and Goossens, M. (1989) Mutations in the catalytic domain of human coagulation factor IX: rapid characterization by direct genomic seuqencing of DNA fragments displaying an altered melting behaviour. Genomics 4, 266–272. 14. Wood, G. S., Crooks, C. F., and Uluer, A. Z. (1995) Lymphomadoid papulosis and associated cutaneous lymphoproliferative disorders exhibit a common clonal origin. J. Invest. Dermatol. 105, 51–55. 15. Muniz, E. S., Plassa, F., Amselem, S., Goossens, M., and Vernant, J. P. (1994) Molecular analysis of polymorphic loci to study chimerism after allogeneic bone marrow transplantation. Heteroduplex analysis in denaturing gradient gel electrophoresis: a new approach to detecting residual host cells. Transplantation 57, 451–456. 16. Lombes, A., Diaz, C., Romero, N. B., Ziegler, F., and Fordeaum, M. (1992) Analysis of the tissue distribution and inheritance of heteroplasmic mitochondrial DNA point mutations by denaturing gradient gel electrophoresis in MERRF syndrome. Neuromuscul. Disord. 2, 323–330. 17. Higuchi, M., Antonarakis, S. E., Kasch, L., Oldenburg, J., Economou-Petersen, E., Olek, K., Arai, M., Inaba, H., and Kazazian, H. H., Jr. (1991) Molecular characterization of mild- to-moderate hemophilia A: detection of the mutation in 25 of 29 patients by denaturing gradient gel electrophoresis. Proc. Natl. Acad. Sci. USA 88, 8307–8311. 18. Kogan, S. and Gitschier, J. (1990) Mutations and a polymorphism in the factor VIII gene discovered by denaturing gradient gel electrophoresis. Proc. Natl. Acad. Sci. USA 87, 2092–2096. 19. Satoh, C., Takahashi, N., Asakawa, J., Hiyama, K., and Kodaira, M. (1993) Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis. Am. J. Hum. Genet. 52, 167–175. 20. Lavergne, J. M., De Paillette, L., Bahnak, B. R., Ribba, A. S., Fressinaud, E., Meyer, D., and Pietu, G. (1992) Defects in type IIA von Willebrand disease: a cysteine 509 to arginine substitution in the mature von Willebrand factor disrupts a disulphide loop involved in the interaction with platelet glycoprotein Ib-IX. Brit. J. Haematol. 82, 66–72.

104

Schwaab and Schmidt

21. Gandrille, S., Alhenc-Gelas, M., Gaussem, P., Aillaud, M. F., Dupuy, E., JuhanVague, I., and Aiach, M. (1993) Five novel mutations located in exons III and IX of the protein C gene in patients presenting with defective protein C anticoagulant activity. Blood 82, 159–168. 22. Gandrille, S., Borgel, D., Eschwege-Gufflet, V., Aillaud, M., Dreyfus, M., Matheron, C., Gaussem, P., Abgrall, J. F., Jude, B., Sie, P. Toulon, P., and Aiach, M. (1995) Identification of 15 different candidate causal point mutations and three polymorphisms in 19 patients with protein S deficiency using a scanning method for the analysis of the protein S active gene. Blood 85, 130–138. 23. Emmerich, J., Alhenc-Gelas, M., Gondrille, S., Fiessinger, J. N., and Aiach, M. (1994) A new case of familial thrombofilia: resistance to the effect of activated protein C. Presse Med. 23, 1285–1287. 24. Dianzani, I., Camaschella, C., Ponzone, A., and Cotton R. G. H. (1993) Dilemmas and progress in mutation detection. TIG 9, 403–405. 25. Borresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T. I., Nesland, J. M., Isselbacher, K. J., and Friend, S. H. (1991) Constant denaturant gel electrophoresis as a rapid screening technique for p53 mutations. Proc. Natl. Acad. Sci. USA 88, 8405–8409. 26. Riesner, D., Steger, G., Zimmat, R., Owens, R. A., Wagenhöfer, M., Hillen, W., Vollbach, S., Henco, K., and Steger, G. (1989) Temperature-gradient gel electrophoresis of nucleic acids: analyses of conformations transitions sequence variations and protein-nucleic acid interaction. Electrophoresis 10, 377–389. 27. Hernandez, A., Uhrberg, M., Enczmann, J., Witt, I., Reitsma, P. H., and Wernet, P. (1995) Rapid identification of gene defects in protein C defiency by temperature gradient gel electrophoresis. Blood Coagul. Fibrinolysis 6, 23–30. 28. Top, B. (1992) A simple method to attach a universal 50-bp GC-clamp to PCR fragments used for mutation analysis by DGGE. PCR Methods Appl. 2, 83–85. 29. Costes, B., Girodon, E., Ghanem N., Chassignol, M., Thuong, N. T., Dupret, D., and Goossens, M. (1993) Psoralen-modified olignonucleotide primers improve detection of mutations by denaturing gradient gel electrophoresis and provide an alternative to GC clamping. Human Mol. Genet. 2, 393–397. 30. Costes, B., Fanen, P., Goossens, M., and Ghanem N (1993) A rapid, efficient, and sensitive assay for simultaneous detection of multiple cystic fibrosis. Human Mut. 2, 185–191. 31. Dockhorn-Dworniczak, B., Dworniczak., B., Brömmelkamp, L., Bülles, J., Horst, J., and Böckler, W. W. (1991) Non-isotopic detection of single strand conformation polymorphism (PCR-SSCP): a rapid and sensitive technique in diagnosis of phenylketonuria. Nucleic Acid. Res. 19, 2500. 32. Higuchi, M., Kochan, L., and Olek, K. (1988) A somatic mosaic for hemophilia A detected at the DNA-level. Mol. Biol. Med. 5, 23–27. 33. Michaelides, K., Schwaab, R., Lalloz, M. R. A., Schmidt, W., and Tuddenham, E. G. D. (1995) Mutational analysis: new mutations, in PCR II: A Practical Approach (Taylor, G. R., McPherson, M. J., and Hames, B. D., eds.), IRL, Oxford, UK, pp. 255–288.

Screening for DNA Mutations by SSCP

105

10 Screening for Mutations in DNA by Single-Stranded Conformation Polymorphism (SSCP) Analysis David J. Perry 1. Introduction A single-stranded DNA fragment may adopt several different conformations (conformers) which affect its electrophoretic mobility. The mobility of singlestranded DNA in a nondenaturing gel is dependent on both fragment length and secondary structure, which is sequence-dependent. As a result, changes in sequence may affect the conformation of the single-stranded DNA and under appropriate conditions, the differing conformations can be resolved from each other, thereby allowing an underlying sequence variation to be detected. The detection of sequence variations/mutations by studying the mobility of singlestranded DNA was first described by Orita in 1989 (1) and the technique is known as single-stranded conformation polymorphism (SSCP) analysis. There are countless modifications of the original technique, all of which attempt to increase the number of sequence variations that can be detected. One such modification, included in this chapter, involves the use of Mutation Detection Enhancement (MDE) gels. SSCP is useful for the detection of mutations/polymorphisms in PCR fragments of between 150 and 400 bp. To detect large fragments by SSCP analysis, it may be necessary to digest the fragment with a series of restriction enzymes to generate smaller fragments. Alternatively, additional primers may be used to generate a series of smaller but overlapping PCR fragments. An interesting modification of the SSCP technique involves biotinylation of one the amplification primers, which allows the subsequent purification of the PCR product by binding to streptavidin-coated magnetic beads. The purified fragment can then be digested sequentially with a series of restriction enzymes. In each case From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

105

106

Perry

the undigested fragment remains bound to the magnetic beads, but the digested fragment is “free” and can be screened for mutations (2). Following electrophoresis the DNA fragments must be visualized. Two protocols are included, one of which uses radiolabeled PCR products followed by autoradiography of the dried gel and the other involves silver-staining of the wet gel (see Chapter 7). 2. Materials 2.1. Radiolabeling of PCR Products with [γ-32P]dCTP Enzymatic amplification by PCR is a well-established technique and there are many books available that cover the method and its variations in some detail. An introduction to PCR and some of the ways in which the reaction can be optimized is included in this volume. The protocol for radiolabeling PCR products included here assumes some knowledge of PCR. Some methods for labeling PCR products involve end-labeling the amplification primers with polynucleotide kinase and [γ-32P]ATP. However, this is a more labor-intensive method and unsuitable for large PCR products, which are subsequently to be digested prior to electrophoresis as internal digestion products are not labeled. The method described involves incorporation of a radionucleotide into the PCR product during the amplification reaction. 1. PCR reagents: see Chapter 2. 2. [32P]dCTP (1000–3000 Ci/mmol) (Amersham plc) (see Note 1). 3. Light mineral oil (e.g., Sigma).

2.2. Standard Polyacrylamide-Based SSCP Gels 1. 50% Acrylamide—N,N’-Methylenebisacrylamide (99:1) stock solution. Make by dissolving 99g of acrylamide and 1g of N,N’-Methylenebisacrylamide in 150 ml of distilled water at 65°C. When the acrylamide has dissolved make the volume of the solution up to 200 ml with distilled water. Store at 4°C (see Notes 2 and 3). 2. 10X TBE (Tris-Borate-EDTA): 108 g Tris base, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Loading buffer/Stop solution: 95% formamide (v/v), 10 mM NaOH, 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). 4. TEMED. 5. 10% Ammonium persulfate, freshly prepared immediately before use.

2.3. MDE-Based SSCP Gels 1. MDE gel solution (AT Biochem). Comes as a 2X solution. 2. 10X Tris-Borate-EDTA. 3. Loading buffer/stop solution: 95% formamide (v/v), 10 mM NaOH, 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v).

Screening for DNA Mutations by SSCP

107

4. TEMED. 5. 10% Ammonium persulfate, freshly prepared immediately before use.

3. Methods 3.1. Radiolabeling PCR Products with [γ-32P]dCTP Twenty microliters amplification reactions or less are ideal for labeling PCR products with [32P]dCTP as only a small fraction of the reaction is subsequently run on a gel. 1. Prepare a master PCR mix equal to the number of amplification reactions required containing all the reagents required for the amplification reaction. This should include water, primers, buffer, dNTPs, the appropriate concentration of Mg and the DNA polymerase. An example of a 100 µL master mix suitable for 5 × 20 µL amplification reactions contains: 100 pmoles of each amplification primer, 200 µM of each dNTP, 10 µL of 10X PCR buffer (15 mM MgCl2, 100 mM Tris-HCl pH 8.8, 500 mM KCl, 1% Triton X-100 [v/v]), 2.5 U of a thermostable DNA polymerase, e.g., Amplitaq and water to 90–95 µL, the precise volume of water depending upon the DNA concentration. 2. Add 1 µL of [32P]dCTP for every 100 µL of the master mix and then carefully pipet into 20-µL aliquots (see Note 1). 3. Add 1–2 µL of DNA (100–250 ng) to each tube and then overlay with 20 µL of light mineral oil. 4. Place the samples in the PCR block and carry out 35–40 rounds of amplification. 5. Following amplification, place the samples at –20°C until the fluid phase but not the oil is frozen. The oil can then be carefully removed and disposed of. As the latter is radioactive it must be disposed of accordingly.

3.2. “Standard” SSCP Gels (see Note 4) 1. 40 cm × 20 cm glass gel plates are washed with detergent, rinsed in deionized water and wiped dried with lint free tissues. Any grease is removed by wiping each plate with an ethanol-soaked tissue and then allowing it to dry. 2. Siliconize the “eared” plate by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate with a lint-free tissue and then allowing it to dry at room temperature in a fume hood 3. Assemble the plates using 0.4 mm spacers according to the manufacturer’s instructions. 4. Mix together in a beaker 12 mL of 50% acrylamide solution, 10 mL of 10X TBE and water to 100 mL (see Note 4). Add 130 µL of TEMED and 130 µL of 25% ammonium persulphate and mix quickly. Aspirate the solution into a 50-mL syringe, attach a 0.45-µm filter and pour the gel into the assembled plates. 5. Insert a 0.4-mm gel comb containing 24-wells and allow the gel to polymerize for at least 60 min. 6. Assemble the gel plates and the electrophoresis apparatus according to the manufacturer’s instructions and pre-run the gel for 30 min in 1X TBE at a constant voltage of 500 V (see Notes 4 and 5).

108

Perry

7. Add 2 µL of the radiolabeled PCR product to 8 µL of loading buffer and heat at 95°C for 5 min and then rapidly cool by placing on ice for 2–3 min. Load 2 µL onto the gel using disposable “Duck billed” tips. A radiolabeled marker should be included in lane 1; this allows the orientation of the subsequent autoradiograph to be determined. A nondenatured PCR product should be run in lane 2 (see Note 6). 8. Carry out the electrophoresis at room temperature at constant voltage (500 V). 9. Following electrophoresis, allow the pates to cool then carefully separate the gel plates and transfer the gel to Whatman 3MM paper by carefully placing a sheet of the paper on top of the gel and smoothing it over the surface of the gel. Carefully lift the paper starting at one corner and the gel will adhere to the paper. Cover the gel with a sheet of Saran Wrap™ and dry under vacuum at 80°C for 1–2 h. 10. Expose the dried gel to a sheet of X-ray film for 2–5 d in an appropriate cassette.

3.3. MDE-SSCP Gels 1. Wash 40 cm × 20 cm glass gel plates with detergent, rinse in deionized water and wipe dried with lint free tissues. Remove any grease by wiping each plate with an ethanol-soaked tissue and allow to dry. Siliconize one of the two plates (the “eared” plate) by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate with a lint-free tissue, and then allowing it to dry at room temperature in a fume hood. 2. Electrophoresis is carried out in a vertical fashion. Assemble the gel plates using 0.4-mm spacers according to the manufacturer’s instructions. 3. For 100 mL MDE gel mix: combine 25 mL of 2X MDE gel solution with 6 mL of 10X TBE and make up to 100 mL with deionized water (see Note 7). 4. Add 40 µL of TEMED and 400 µL of 10% ammonium persulphate and mix thoroughly. 5. Pour the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.45-µm filter. Insert a 20-well comb with 0.5-cm teeth and clamp the top of the gel plates around the comb with bulldog clips. Place the gel horizontally and allow to polymerize for at least 60–90 min at room temperature. 6. When the gel is polymerized, carefully remove the comb and remove any adherent polymerized gel. 7. Mount the gel into the sequencing apparatus. Fill the apparatus/buffer chambers with 0.6X TBE. Carefully flush out the wells. 8. Prerun the apparatus for 20–30 min at 6–8 W constant power at room temperature. A cooling fan may be directed at the gel to ensure that the gel does not overheat. 9. Add 1–2 µL of PCR product to 9 µL of stop solution and incubate at 94°C for 5 min, then place the denatured DNA samples onto ice for 2–3 min. 10. Rinse the wells and load 2–3 µL of each PCR product. A radiolabeled marker should be included in lane 1, which allows the orientation of the subsequent autoradiograph to be determined. A double-stranded DNA control sample should also be included. Do not heat-denature this and use a nondenaturing loading buffer. 11. Run at 6–8 W constant power for 12–14 h at room temperature. The precise electrophoresis times must be determined for each PCR product.

Screening for DNA Mutations by SSCP

109

12. When the electrophoresis is complete, remove the gel plates and separate. Transfer the gel to a sheet of Whatman 3 MM paper and cover with Saran Wrap. Dry the gel under vacuum at 80°C. Expose to X-ray film using standard techniques.

4. Notes 1. [32P]dCTP is strongly radioactive and must be handled with care. Workers using any radio-isotope must have training in their safe use and facilities must be available for the safe disposal not only of the isotope but also any contaminated solutions, pipet tips, Eppendorfs, etc. Obviously if silver staining is to be used, it is not necessary to radiolabel the PCR product! Because of our concerns over the radioactivity, silver staining is now our method of choice for detecting DNA fragments on SSCP gels. 2. Acrylamide and bisacrylamide are potent neurotoxins, mutagens, and teratogens and should, therefore, be handled with care. Always wear masks, gloves, and safety glasses during handling of these reagents especially when in the powder form and in a fume hood. 3. Allow the solution to warm to room temperate before use and any crystalline acrylamide/bisacrylamide will go back into solution. 4. Their are many variations of the SSCP technique. The original method used gels that contained glycerol, but we have found that this is not necessary. We do not routinely carry out the electrophoresis at 4°C, although in some cases a mutation may only be detected by electrophoresis at 4°C. The concentration of acrylamide and the ratio of acrylamide:bisacrylamide is important and this may be require optimization for a particular PCR fragment. The methods outlined is a good starting point to begin screening for mutations. 5. The precise voltage is dependent on many variables including the size of the PCR fragment. 500 V is suitable for an overnight run of fragment between 200 and 400 bp. We routinely use a fan aimed at the electrophoresis apparatus to cool the system. 6. Single-stranded DNA molecules may adopt more than one conformation and so gels may contain a number of bands. In addition, re-annealing of single-stranded fragment may occur giving rise to a double-stranded product. A nondenatured PCR product should be run on each gel to identify the position of this fragment. It is generally weaker than the single-stranded fragments. 7. 0.5X MDE is generally recommended as a starting point for MDE-SSCP gels, but it may be of value to use other concentrations of MDE between 0.4 and 0.7X.

References 1. Orita, M., Suzuki, Y., Sekiya,T., and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using polymerase chain reaction. Genomics 5, 874–879. 2. Michaelides, R., Schwaab, R., Lalloz, M. R. A., Schmidt, W., and Tuddenham, E. G. D. (1995) Mutational analysis: new mutations, in PCR 2: A Practical Approach. IRL, Oxford, UK.

110

Perry

Suggested Reading Hayashi, K. (1991) PCR-SSCP: A simple and sensitive method for detection of mutations in genomic DNA. PCR Methods Appl. 1, 34–38. Leren, T. P., Solberg, K., Rodningen, O. K., Ose, L., Tonstad, S., Berg, K. (1993) Evaluation of running condions for SSCP analysis: application of SSCP for detection of point mutations in the LDL receptor gene. Genomics 3, 159–162. Takahashi-Fujii, A., Ishino, Y., Shimada, A., and Kato, I. (1993) Practical application of fluorescence-based image analyszer for PCR single-stranded conformation polymorphism analysis used in detection of multiple point mutatiohns. PCR Methods Appl. 2, 323–327.

Factor VII Gene

111

11 Screening for DNA Heteroduplexes in the Factor VII Gene Using Ethylene Glycol Gel Electrophoresis of Solvent-Treated 32P-Labeled PCR Products Peter Baker 1. Introduction Sequencing exon by exon to identify mutations is both laborious and time consuming. Screening techniques have been sought to identify mutations without the need for this. Rapid detection of single base changes have focused on identification of the heteroduplex formed when wild-type and mutant come together (1–3). Enzymes have been employed to cleave the heteroduplex at the mismatch site, but this obviously needs the bases to be known prior to commencement (1). A second option is to detect the change by monitoring the affect on melting temperature of the double-stranded DNA and its subsequent migration during denaturing gel electrophoresis (2). Third, chemicals can be employed that bind to the mismatch site, allowing immunochemical labeling of the products for identification (3). All these techniques have their limitations and no one method will detect all mutations (4–6). The technique described here has been modified from an original report by Ganguly et al. (7) using [α-32P]dCTP incorporated into the PCR products and then run on a polyacrylamide gel containing ethylene glycol and formamide to induce bends in heteroduplexes and so alter electrophoretic mobility. This chapter describes its value in screening for mutation in the human factor VII gene. FVII acts as a key zymogen in the hemostatic pathway leading to clot formation and endothelial repair. Tissue factor (TF) exposed by vascular injury binds to the zymogen causing cleavage of the molecule into a two chain active form (FVIIa). It is the TF:FVIIa complex that in turn activates factors VII, IX, and X to initiate thrombin generation and clot formation. Cases of elevated From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

111

112

Baker

FVII leading to cardiovascular disease have been reported while deficiency has a variable bleeding outcome or paradoxically thrombotic manifestations (8,9). 2. Materials 2.1. PCR Materials All reagents supplied by Sigma (Poole, UK) or BDH Laboratory Supplies (Poole, UK) unless otherwise stated. 1. PCR primers. Synthesized oligonucleotides conforming to general production rules (see Note 1) reconstituted in UV treated H2O and stored at –20°C. 2. 10X PCR buffer: 500 mM KCl, 10 mM Tris-HCl, pH 8.3. Store at –20°C. 3. 25 mM MgCl2: Store at –20°C. 4. 20 mM dNTP’s: Dilute 100 mM stocks (available from many sources) 1+4 and store at –20°C. 5. Thermostable DNA polymerase, e.g., AmpliTaq (Perkin Elmer): 5 U/µL. Store at –20°C. 6. [α-32P]dCTP (Amersham, UK). Store at 4°C (see Note 2). 7. 10X TBE buffer: 121 g Tris 121, 61.8 g Boric acid, 7.4 g Na2EDTA. Distilled H2O to 1 L. Store at room temperature. 8. 10 mg/mL Ethidium bromide. 9. 1.5% Agarose gel in 1X TBE buffer (see Note 3). 10. PCR Loading buffer: 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol, 20% sucrose (w/v). 11. Molecular weight markers. ØX174-HaeIII Digest (New England Biolabs, Hitchin, UK). 12. Chromatography paper (Whatman International Ltd, Maidstone, Kent, UK). 13. Saran Wrap™. 14. TEMED. 15. 25% Ammonium persulfate, freshly prepared immediately before use. 16. 30% Acrylamide:bisacrylamide (19:1) (see Note 4). 17. Tris-Taurine-EDTA (TTE) buffer: 89 mM Tris, 15 mM Taurine, and 0.5 mM Di-sodium EDTA. Prepare by combining 21.4 g Tris base, 3.7 g Taurine, 0.372 g Na 2EDTA, and make up to 2 L with distilled H2O. Store at room temperature. 18. Gel loading buffer for acrylamide electrophoresis: 20% ethylene glycol (v/v), 30% formamide (v/v), 0.025% xylene cyanol (w/v), and 0.025 % bromophenol blue. Store at room temperature 19. Acrylamide gel mix is prepared by combing 20 mL of 30% acrylamide, 10 mL of ethylene glycol, 13.27 formamide, 50 mL TTE buffer and distilled water. Filter through a 0.45-mm syringe filter prior to use (see Note 4) 20. 100 mM EDTA. 21. Gel apparatus: Sequencing-type apparatus is used and available from many suppliers. Plates should measure 40–50 cm × 20 cm.

Factor VII Gene

113

3. Methods 3.1. PCR Reactions Reaction conditions will vary according to the target DNA sequence being amplified, however standard PCR cycling times can be found in any text and provide a point from which to start (see Note 5). 1. Twenty microliter amplification reactions are performed and consist of: 16 µL of UV H2O, 2 µL of 10X PCR buffer, 1.2 µL of 25 mM MgCl2, 0.2 µL 20 mM dNTP’s, 0.2 µL of each amplification primer at 50 pmol/µL, 0.4 µL DNA (1 µg) (see Note 6), 0.2 µL [α-32P]dCTP, and 0.4 µL (2 U) of a thermostable DNA polymerase (see Note 7). Overlay with mineral oil. Appropriate negative and positive controls should be included in each batch of amplifications. In addition, include 1–2 samples that do not have the radiolabeled nucleotide present in the amplification mix. 2. Transfer to a thermal cycler and incubate at 95°C for 5 min to denature the doublestranded DNA and carry out 40 cycles of amplification comprising: 94°C for 10 seconds, 54–60°C for 10 s (depending upon the primers) and 74°C for 10 s. On the last cycle the extension time should be increased to 10 min. 3. Check the efficiency of the amplification reaction by mixing 5 µL of the unlabeled PCR products with 1 µL of loading buffer and running on a 1.5% agarose gel in 1X TBE. Run for 10–15 min at 90 V using molecular weight markers in Lane 1 to identify correct product size. 4. Visualize under UV light, photograph for permanent record.

3.2. Gel Preparation 1. Prepare the gel plates by washing thoroughly, first with a mild detergent, wiping dry with lint-free tissues, and then wiping over with 90% methanol. Coat one plate with dimethylchlorosilane and allow to dry. 2. Assemble the gel apparatus using 1-mm spacers. 3. Prepare the acrylamide/ethylene glycol/formamide gel mix and add 130 µL TEMED and 130 µL of 25 ammonium persulfate to initiate polymerization. Draw up the solution into a 50-mL syringe and inject into the space the two glass plates. Insert a 12-tooth comb (0.5-cm wide teeth). Clamp the top of the gel and allow to polymerize for at least 90 min. Assemble the apparatus, fill the upper buffer reservoir with 0.25X TTE and lower buffer reservoir with 1X TTE. Prerun the gel at 45 W (constant power) for 15 min. 4. Add 18 µL of each PCR product to 2 µL of 100 mM EDTA and incubate at 98°C for 5 min then 68°C for 60 min (see Note 8). 5. Add 4 µL of the PCR/EDTA mix to 4 µL of loading buffer. Load onto the pre-run gel and run for 2–4 h at room temperature depending on the size of the PCR product. 6. Separate the gel plates and transfer to chromatography paper (see Note 9). Place a layer of Saran Wrap over the gel and transfer to a gel dryer. Dry for 2 h at 80°C under vacuum. 7. Remove the Saran Wrap and expose to X-ray film (Fuji RX) in an intensifier cassette overnight at room temperature before being developed.

114

Baker

3.3. Interpretation of Results PCR products can be seen as distinct bands, heteroduplex formation leading to differential mobility of the mismatch pairing. The longer the products are run the greater the separation (see Fig. 1). Normal control DNA should be run at the same time for comparison. Limitations of the technique are its inability to differentiate heteroduplexes if the mutation occurs within 50 bp of the end of the amplified fragment. The benefits of these modifications from the original report are shorter running times and easier handling associated with a smaller gel, and greater visibility of the altered heteroduplex when 32P is incorporated. 4. Notes 1. Oligonucleotide synthesis should be performed according to the common guidelines available. Use of primer pairs already documented as producing the DNA fragment of interest will save time. Computer programs are now available commercially that will produce matching primer pairs most likely to succeed. These take into account factors such as oligonucleotide length, G/C content, and primer pair homology. All these factors will affect the oligonucleotides ability to anneal specifically to the target sequence. 2. 32P is one of the highest energy radio nucleotides encountered in the laboratory. Precautions should be taken to minimise exposure to it. All work should be performed in a dedicated radioactive area shielded by 1 cm perspex (Plexiglas). Clothing including overalls, glasses and gloves should be worn with appropriate dosimeters i.e. those for monitoring the body and finger tips. 3. 1.5 % agarose gel is sufficient to differentiate PCR products when used in conjunction with suitable molecular weight markers. HaeIII digested ØX174 DNA gives a range of fragments spanning 1353-72 bp 4. Acrylamide:bisacrylamide is toxic and potentially carcinogenic. It can be absorbed via the skin and through inhalation. It should be used in well ventilated areas with gloves and mask. 5. Cycling times and conditions, as with primer design, play a key role in the amplification of a single DNA fragment. Annealing temperatures can be calculated to obtain maximal specificity in the reactions with the primer pair being used. Also buffer concentrations, particularly Mg2+ concentration will affect yield. Normal DNA amplification is recommended before patient samples are investigated. 6. DNA quality and concentration will vary according to source. Phenol/Chloroform extracted peripheral blood leukocytes were used in this instance, exact amounts being calculated by measuring the DNA absorbance at 260nm. Too much template will inhibit amplification. 7. The volumes of the reagents for a single 20 µL PCR are small and it is considerably easier to prepare a master mix containing all reagents minus the DNA. This can then be aliquoted into individual amplification tubes and the DNA added. 8. Once the PCR products have been incubated at 68°C to induce maximal heteroduplex formation, a sample can be run on normal 1.5% agarose gel prior to loading to confirm they are still intact.

Factor VII Gene

115

Fig. 1. An acrylamide/ethylene glycol/formamide gel showing Exon 5 of the human factor VII gene: Lane 1 Normal, Lanes 2 and 3 show two patients with a single basepair substitution at codon 115 [115 CAC → CAT]. 9. Separation of the glass plates can be made easier by inserting a scalpel blade, or similar, between them and gently levering. If the plates are first allowed to cool then the gel will be easier to handle. The gel should stick to the plate not coated with dimethyldichlorosilane. If this doesn’t happen it can still be removed with care!

References 1. Shenk, T. E., Rhodes, C., Rigby, P. W. J., and Berg, P. (1975) Biochemical method for mapping mutational alterations in DNA with S1 nuclease: the location of deletions and temperature sensitive mutations in Simian virus 40. Proc. Natl. Acad. Sci. USA 72, 989–993. 2. Lerman, L. S. and Silverstein, V. (1987) Computational simulation of DNA melting and it’s application to denaturing gradient gel electrophoresis. Methods Enzymol. 155, 482–501. 3. Novack, D. F., Casna, N. J., Fischer, S. G., and Ford, J. P. (1986) Detection of single base-paired mismatches in DNA by chemical modification followed by electrophoresis in 15% polyacrylamide gels. Proc. Natl. Acad. Sci. USA, 83, 586–590.

116

Baker

4. Dodgson, J. B. and Wells, R. D. (1977) Action of single-stranded specific nucleases on model DNA heteroduplexes of defined size and sequence. Biochemistry 16, 2374–2379. 5. Myer, R. M., Maniatis, T., and Lerman, L. S. (1987) Detection and localisation of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol. 155, 501–527. 6. Ganguly, A., Rooney, J. E., Hosomi, S., Zeiger, A., Prockop, D. J. (1989) Detection and location of single-base mutations in large DNA fratgments by immunomicroscopy Genomics 4, 530–538. 7. Ganguly, A., Rock, M. J., and Prockop, D. J. (1993) Conformation-sensitive gel elctrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes. Proc. Natl. Acad. Sci. USA 90, 10,325–10,329. 8. Meade, T. W. (1983) Factor VII and ischaemic disease: epidemiological evidence. Haemostasis 13, 178-185. 9. Tuddenham, E. G. D, Pemberton, S., and Cooper, D. (1995) Inherited factor VII deficiency: genetics and molecular pathology. Thromb. Haemostasis 74(1), 313–321.

Hemophilia A

117

12 Detection of Mutations Causing Hemophilia A Using an In Vitro Coupled Transcription and Translation System Chike Ononye and P. Vincent Jenkins 1. Introduction Mutation detection in the factor VIII gene is complicated by the size and complexity of the gene—186 kb spanning 26 exons. The exons vary in size from 69 bp to 3106 bp and the introns from 207 bp to 32.4 kb (1). The first mutations to be identified in the factor VIII gene involved mutations at Taq I restriction sites (an enzyme that contains the mutational CpG dinucleotide within its recognition sequence) or were large deletions detected by Southern blotting (2). Small deletions, substitution, and missense mutations proved more difficult to detect as these appear to be randomly distributed throughout the factor VIII gene. For these reasons, therefore, many laboratories involved in carrier detection in Hemophilia A have used an indirect procedure known as gene tracking or linkage analysis. This involves the use of various polymorphic markers (RFLPs and VNTRs) to follow the segregation of the defective factor VIII gene through individuals in a family (This is not covered in this chapter, but an excellent review on the subject is available [3]). Several factors limit this technique, primarily the need for intervening family members, the need for a proband to be present, the occasional need for paternity testing, and the frequent occasions where all polymorphic markers prove to be uninformative. Furthermore, it adds little to our understanding of the mutations that underlie Hemophilia A. To simplify the detection of mutations in the factor VIII gene, we have employed a technique known as coupled transcription and translation (TNT) to From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

117

118

Ononye

screen the FVIII cDNA, isolated from peripheral blood lymphocytes, for mutations. The TNT system offers an alternative for other eukaryotic in vitro translations. As a one-tube technique, it by-passes many of the steps required by other systems by incorporating RNA synthesis into the translation mix. The value of this approach is illustrated by its use in the detection of mutations in other disorders, e.g., Duchenne’s and Becker muscular dystrophy (4–6), cystic fibrosis (7), polycystic kidney disease (8), breast cancer (9), and neurofibromatosis (10). The approach detailed in this chapter involves isolating the 9 kb factor VIII mRNA from peripheral lymphocytes, reverse transcribing this, and then amplifying the cDNA by nested PCR in a series of overlapping segments. A T7 promoter is attached to the 5' amplification primer that is in-frame with the cDNA and will, under the appropriate conditions allow in vitro translation. The protein expression products are labeled with 35S-methionine, separated on a gel, and visualized by autoradiography. Any aberrant protein product indicates a possible mutation in the segment of mRNA from which it is derived. This aberrant product may even be mapped to an area of a segment. Once a candidate segment (or segment area) is identified in a family or patient, the DNA can be sequenced for definitive proof of mutation. 2. Materials 2.1. Lymphocyte Separation 1. Histopaque 1077: Density 1.077 g/L: (Sigma, Poole Dorset, UK). 2. Phosphate-buffered saline (PBS): 10 mM potassium phosphate buffer, 138 mM NaCl, 2.7 mM KCl, pH 7.4. (Sigma). 3. 50-mL conical tubes, e.g., Falcon tubes. 4. Sterile plastic pipets.

2.2. RNA Extraction 1. RNA Easy kit (Qiagen) (see Note 1).

2.3. Reverse Transcription 1. 5X RT Buffer: 250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2. (Gibco, Gibco-BRL, Life Technologies Ltd., Paisley). 2. 100 mM DTT (Gibco BRL, Life Technologies Ltd., Paisley). 3. 5 mM dNTPs. 4. 200 U/mL M-MLV reverse transcriptase (Gibco-BRL, Life Technologies Ltd., Paisley). 5. 50 U/mL RNAse inhibitor (Boehringer Mannheim). 6. DEPC-treated water. 7. Sterile, RNAse-free Eppendorfs.

Hemophilia A 8. 9. 10. 11.

119

Total cellular target RNA: 1 µg 50 µL in DEPC H2O. TE buffer, pH 8.0: 10 mM Tris HCl, pH 8.0, 0.1 mM EDTA. Oligonucleotide primers at 50 pmol/µL (see Note 2). Heating block.

2.4. Polymerase Chain Reaction 1. 5 U/µL Taq DNA polymerase (Bioline). 2. PCR buffer: 0.8 g Trizma base, 0.22 g NH4SO4, and 0.67 mL 1 M MgCl2. Dissolve in 8 mL TE buffer, pH 8.0. Adjust pH to 8.8 with concentrated HCl. Make up to 10 mL with TE. Autoclave and dispense into 0.5-mL aliquots. Store at –20°C. Immediately before use, thaw an aliquot and add 3.5 µL of β-mercaptoethanol and 17 µL of 5% BSA (w/v). 3. BSA solution (Sigma). 4. Oligonucleotide primers at 50 pmol/µL (see Tables 1 and 2). 5. 0.5-mL sterile Eppendorfs. 6. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA. 7. Light mineral oil (Sigma). 8. 1.5% Agarose gel in 1X TBE containing ethidium bromide 0.5 µg/mL.

2.5. Translation and Termination 1. A commercially available kit is used for the translation and termination reaction: Coupled Reticulolysate Systems (Promega). The kit includes T N T rabbit reticulolysate, TNT reaction buffer, TNT T7 polymerase, control DNA, and amino acid mixtures (minus methionine). 2. Nuclease-free water. 3. RNAsin ribonuclease inhibitor 40 U/µL (Promega). 4. 35S methionine (1,000 Ci/mmol) at 10 mCi/mL (Amersham). 5. Protein loading buffer: 2 mL glycerol (v/v), 2 mL 10% SDS, 0.25% bromophenol blue, 2.5 mL 4X stacking gel buffer and 0.5 mL β-mercaptoethanol. Store at room temperature. Add the β-mercaptoethanol immediately before use. 6. 4X Stacking gel buffer: 6.06 g Tris base and 4 mL 10% SDS. Bring the volume to approx 100 mL with water. Adjust pH to 6.8 with 12 N HCl and adjust volume to 100 mL. Store at room temperature. 7. 5% Stacking gel: 225 mL 40% acrylamide:bisacrylamide (19:1) (see Note 3), 1.75 mL water, 444 µL 4X stacking gel buffer, 28 µL 10% ammonium persulphate (prepared immediately before use), and 5 µL TEMED. The volumes of reagents are sufficient for a 0.75-mm thick gel measuring 100 mm × 70 mm. 8. 15% SDS polyacrylamide separating gel: 2.68 mL water, 2.82 mL 40% acrylamide:bisacrylamide solution (see Note 3), 1.9 mL separating gel buffer, 112 µL 10% ammonium persulphate (prepared immediately before use). 9. Separating gel buffer (see Note 4): 18.17 g Tris base and 4 mL 10% SDS. Bring the volume to approx 100 mL with water. Adjust pH to 8.8 with 12 N HCl and add water to a final volume of 100 mL. Store at room temperature.

120

Ononye

Table 1 First Round PCR Primersa Primer name

mRNA segment

Primer sequence

1W 1X 2W 2X 5W 5X 6W 6X

1 1 2 2 5 5 6 6

5'-GGG AGC TAA AGA TAT TTT AGA GAA G 5'-TTC CTA CCA ATC CGC TGA GG 5'-AGA AGC GGA AGA CTA TGA TG 5'-TTG CCT AGT GCT AGG GTG TC 5'-ACC CAC CAG TCT TGA AAC GC 5'-TCC ATA TTG TCC TGA AGC TG 5'-TTC ATT TCA GTG GAC ATG TG 5'- GGC TTC AAG GCA GTG TCT GC

aSegments 3 and 4 span exon 14 and encode the B domain of factor VIII. This region is amplified directly from genomic DNA. bAdapted from Naylor et al. (11).

Table 2 Second Round PCR Primersa Primer name

mRNA segment

Primer sequence

1Y

1

1Z 2Y

1 2

2Z 5Y

2 5

5Z 6Y

5 6

6Z

6

5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG GAG AAG AAT TAA CCT TTT GCT TCT C 5'-CAG CAG CAA TGT AAT GTA CC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG TCT GAA ATG GAT GTG GTC AGG 5'-AAG CTT CTT GGT TCA ATG GC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG ACT CTT CAG TCA GAT CAA GAG 5'-CTC TAA TGT GTC CAG AAG CC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG CAT CTA CAT GCT GGG ATG AGC 5'-AAG GTA GAA GGC AAG CCA GG

aA

T7 promoter is incorporated in the upstream primer (underlined).

10. SDS-polyacrylamide 10X running buffer: 30 g Tris base, 144 g glycine, and 100 mL 10% SDS. Adjust the volume to 1 L with distilled water. 11. Protein markers, e.g., Rainbow markers (Amersham). 12. Organic scintillant, e.g., Amplify™ (Amersham). 13. Fixing solution: 5% acetic acid (v/v), 15% methanol. 14. X-ray film.

Hemophilia A

121

3. Methods 3.1. Lymphocyte Isolation 1. Collect 10 mL of whole blood using EDTA as an anticoagulant (see Note 5). 2. Dilute with an equal volume of PBS and carefully layer onto 10 mL Histopaque 1077 in a 50-mL conical tube. 3. Carefully transfer to a centrifuge without disturbing the layers and spin at 2000 rpm for 20 min at room temperature. 4. After centrifugation, remove from the centrifuge without disturbing the layers and aspirate the cellular interface with a sterile plastic pipet and transfer to a fresh 50-mL Falcon. 5. Make up to 30 mL with cold PBS and invert several times to mix. 6. Spin at 2000 rpm for 10 min, carefully decant the supernatant and freeze the cellular pellet at –70/80°C. The RNA is not to be isolated immediately.

3.2. RNA Extraction Total RNA is prepared using the Qiagen RNAEasy kit. Extraction procedure is carried out as per manufacturers instructions.

3.3. Reverse Transcription The following protocol outlines the procedure to screen the factor VIII coding sequences from mRNA by protein translation and termination (TNT) (see Note 6). 1. Perform all reactions in duplicate including duplicate negative controls in which TE buffer is used to replace the total cellular RNA. 2. Thaw RNA samples on ice. RNA samples are generally eluted/re-suspended in 50 µL DEPC-treated water. 3. To 5 µL of each RNA sample, add 1.5 µL of TE buffer and 1 µL of the inner, downstream amplification primer. 4. Heat the RNA/primer mixture to 65°C and snap-cool on ice. 5. Prepare an RT-mix on ice by adding the following to a 1.5-mL Eppendorf (given volumes are per sample or reaction: 4 µL 5X RT buffer, 5 µL dNTPs, 2 µL 100 mM DTT, 0.5 µL RNAse inhibitor, and 1 µL of M-MMLV reverse transcriptase. 6. Add 12.5 µL of the RT-Mix to the snap-cooled reaction mixture, mix, and incubate at 42°C for 60 min.

3.4. Amplification of the FVIII cDNA 3.4.1. First Round PCR 1. Prepare a PCR mix on ice consisting of: 5 µL 10X PCR buffer, 5 µL of the upstream amplification primer (Primer W, see Table 1), 4 µL of the downstream amplification primer (Primer X, see Table 1), 0.5 µL (2.5 U) Taq DNA polymerase, and 16 µL of TE, pH 8.0. 2. Add the 30 µL of the primary PCR mix to the RT product on ice. 3. Mix well and overlay with oil.

122

Ononye

4. Place in a PCR block and denature the samples by incubating at 93°C for 3 min and then carry out 30 cycles of PCR consisting of: 93°C for 60 s (denaturation), 55°C for 30 s (annealing) and 72°C for 60 s (extension). On the final step the extension time should be increased to 5 min (at 72°C).

3.4.2. Second Round PCR 1. Prepare a second round PCR mix on ice consisting of: 27.5 µL of TE, pH 8.0 buffer, 5 µL 10X PCR buffer, 5 µL dNTPs, 5 µL (50 pmol/µL) upstream amplification primer (Primer Y; see Table 2), 5 µL (50 pmol/µL) downstream amplification primer (Primer Z; see Table 2), and 0.5 µL (2.5 U) Taq DNA polymerase. 2. Add 2 µL of the first round PCR product to the second round PCR mix. Mix well and overlay with oil. 3. Place in a PCR block and denature the samples by incubating at 93°C for 3 min and then carry out 30 cycles of PCR consisting of: 93°C for 60 s (denaturation), 55°C for 30 s (annealing) and 72°C for 60 s (extension). On the final step the extension time should be increased to 5 min (at 72°C). 4. Following amplification run a 5-µL aliquot on a 1.5% agarose gel in 1X TBE to check the specificity and efficiency of the amplification.

3.5. Translation and Termination 1. Prepare a TNT mix consisting of: 12.5 µL TNT rabbit reticulolysate, 1 µL TNT buffer, 0.5 µL T7 TNT polymerase, 0.5 µL amino acid mix (minus methionine), 0.5 µL RNAsin, 7 µL nuclease-free water, and 2 µL 35S methionine. 2. Add 1 µL of the second-round PCR product to 24 µL of the TNT mix and Incubate at 30°C for 60 min. 3. After incubation, remove 5 µL of the product and add to 20 µL of protein loading buffer. 4. Denature at 100°C for 2 min. 5. Load and run 5 µL of the denatured product on a 15% SDS-polyacrylamide gel. The remainder of the translation reaction may be stored at –20°C. 6. To prepare the SDS-polyacrylamide gel, pour the separating gel mix into the assembled gel plates, leaving sufficient space above the gel for the stacking gel to be added later. 7. Gently overlay the gel mix with 0.1% SDS. 8. After polymerization is complete (15–20 min), remove the overlay and rinse the surface of the separating gel initially with water to remove any unpolymerized acrylamide and then with a small volume of 4X stacking gel bufffer. 9. Fill the remaining space with stacking gel mix and insert the comb immediately. 10. After the stacking gel has polymerized (30 min), remove the comb and rinse the wells with 10X SDS-polyacrylamide running buffer to remove unpolymerized acrylamide. Run the gel in 1X SDS-polyacrylamide running buffer. 11. Typically, electrophoresis is carried out at a constant current of 15mA in the stacking gel and 30mA in the separating gel until the bromophenol blue begins to run off the gel.

Hemophilia A

123

Fig. 1. Autoradiograph showing the results of a TNT analysis. M, size marker. Lanes 1, 3, and 5, controls. Lanes 2, 4, and 6, patient samples. Lanes 1 and 2 correspond to segment 3, lanes 3 and 4 correspond to segment 5; and lanes 6 and 7 correspond to segment 7 of the FVIIIc DNA (see text). In lane 7, a faster moving band is clearly seen compared to the major band seen in lane 6. The mutation in this patient arises from a 2bp deletion at position 6875 within the FVIII cDNA (exon 25), resulting in the creation of a premature stop codon. A minor band sometimes seen with segment 6 is also visible in lane 6. 12. Following electrophoresis, separate the gel plates and immerse the gel in fixing solution for 30 min and then in Amplify™ for 30 min. 13. Dry the gel under vacuum at 60°C for 30 min. Expose the gel to X-ray film for 1–7 h at –70°C or 6–12 h at room temperature. 14. The results of a screen of the factor VII cDNA for mutations, in the presence of a mutation that leads to the formation of a truncated protein, should be clearly visible on the autoradiograph (see Fig. 1).

4. Notes 1. Numerous methods are available for isolating total cellular RNA, but the RNAeasy kit is convenient and provides high-quality RNA. 2. The outer downstream amplification primer is used as a primer for the reverse transcription reaction. 3. Acrylamide is a potent neurotoxin and must be handled with care. 4. The gel buffer is radioactive and must be disposed of accordingly. 5. Do not use blood samples for RNA isolation that are more than 2–3 d old. 6. Exon 14 and the 5' and 3' untranslated regions of the FVIII are amplified directly from genomic DNA.

124

Ononye

References 1. Green, P. M, et al. (1991) Genetics and molecular biology of haemophilia A & B. Blood Coag. Fibrinol. 2, 539–565. 2. Tuddenham, E. G. D. (1993) Flipping the tip of the X. Nat. Genetics 5, 209. 3. Peake, I. R., et al. (1993) Report of a joint WHO/WFH meeting on the control of haemophilia: carrier detection and prenatal diagnosis. Blood Coag. Fibrinol. 4, 313–344. 4. Gardner, R. J., et al. (1995) The identification of point mutation in Duchenne muscular dystrophy patients by using reverse transcription PCR and the protein truncation test. Am. J. Human Genetics 57, 311–320. 5. Tuffery, S., et al. (1996) Four novel dystrophin point mutations: detection by protein truncation test and transcript analysis in lymphocytes from Duchenne muscular dystrophy patients. Eur. J. Human Genetics 4, 143–152. 6. van Essen, A. J., et al. (1997) The clinical and molecular genetic approach to Duchenne and Becker muscular dystrophy: an updated protocol. J. Med. Genetics 34, 805–812. 7. Romey, M. C. (1996) Transcript analysis of CFTR frameshift mutations in lymphocytes using the reverse transcription-polymerase chain reaction technique and the protein truncation test. Human Genetics 98, 328–332. 8. Peral, B., et al. (1997) Identification of mutations in the duplicated region of the polycystic kidney disease 1 gene (PKD1) by a novel approach. Am. J. Human Genetics 60, 1399–1410. 9. De Benedetti, V. M., et al. (1996) Screening for mutations in exon 11 of the BRCA1 gene in 70 Italian breast and ovarian cancer patients by protein truncation test. Oncogene 13, 1353–1357. 10. Heim, R. A., et al. (1995) Distribution of 13 truncating mutations in the neurofibromatosis 1 gene. Human Mol. Genetics 4, 975–981. 11. Naylor, J. A., Green, P. M., Montandon, A. J., Rizza, C. R., Giannelli, F. (1991) Detection of three novel mutations in two haemophilia A patients by rapid screening of whole essential region of factor VIII gene. Lancet 337, 635–639.

The Human Antithrombin Gene

125

13 Screening for Mutations in the Human Antithrombin Gene by Hydrolink D-5000™ and MDE™ Gel Electrophoresis David J. Perry 1. Introduction The polymerase chain reaction (PCR) provides a rapid method for generating a large amount of a defined region of DNA without recourse to cloning. However, direct sequencing of this amplified material is tedious, time-consuming, and frequently generates large amounts of normal sequence data. Based on the PCR technique, a number of screening methods for detecting DNA mutations have been developed and a number of these are described in this volume. Many of these techniques are dependent on the formation of heteroduplexes during the amplification reaction, i.e., mixed double-stranded DNA molecules in which one strand is derived from the normal allele and the other from the mutant or altered allele. The heteroduplexes can exhibit a variety of changes in their physical properties and can be readily detected by a variety of techniques. In the many cases, such heteroduplexes can be detected without the use of radiolabeling. A novel polymer–Hydrolink D5000–specifically designed for the electrophoretic separation of double-stranded DNA fragments, has been shown to be capable of readily detecting heteroduplex formation following PCR (1,2). More recently, the introduction of a unique polymer termed mutation detection enhancement (MDE) has been shown to be superior to Hydrolink D5000 in the detection of DNA mutations (3).

From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

125

126

Perry

2. Materials 2.1. Mutation Detection Using Hydrolink D-5000 Gels 1. Hydrolink D-5000 gel solution (AT Biochem). Comes as an 1X solution (see Note 1). 2. 10X Tris-Borate-EDTA (TBE): 108 g Tris base, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Ethidium bromide: Stock solution at 10 mg/mL in distilled water. 4. 10% Ammonium persulfate solution–freshly prepared. 5. TEMED. 6. Dimethylchlorosilane, e.g., Sigma. 7. 10X sample loading buffer: 50% sucrose, 0.6% Orange G (see Note 2). 8. Gel apparatus, e.g., Bio-Rad.

2.2. Mutation Detection Using MDE Gels 1. MDE gel solution (AT Biochem). Comes as an 2X solution. 2. 10X Tris-Borate-EDTA (TBE): 121 g Tris, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Urea (optional). 4. Ethidium bromide: Stock solution at 10 mg/mL in distilled water. 5. 10% Ammonium persulfate solution–freshly prepared. 6. TEMED. 7. Dimethylchlorosilane. 8. 10X sample loading buffer: 50% sucrose, 0.6% Orange G. 9. Gel apparatus, e.g., Bio-Rad.

3. Method 3.1. Hydrolink-D-5000 Gel Electrophoresis 1. Wash 20 cm × 20 cm glass gel plates with detergent, rinse in deionized water and wipe dry with lint-free tissues. Remove any grease by wiping each plate with an ethanol-soaked tissue and allow to dry. Siliconize one of the two plates (the “eared” plate) by applying 1–2 mL of dimethylchlorosilane and allowing to dry at room temperature in a fume hood. 2. Electrophoresis is carried out in a vertical fashion. Assemble the gel plates using 1-mm spacers with all but the top edge sealed with waterproof tape. With a commercial vertical electrophoresis system, sealing of the gel edges with tape may not be required and the manufacturer’s recommendations should be followed. 3. Prepare the gel by mixing 5 mL of 10X TBE with 44.4 mL of the Hydrolink D5000 gel solution. Add 50 µL of TEMED and 750 µL 10% ammonium persulphate and pout the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.4-µm filter. Insert a 20-well comb (1-mm thickness) with 0.5-cm teeth and clamp the top of the gel with bulldog clips. Place the gel horizontally and allow to polymerize for at least 60–90 min.

The Human Antithrombin Gene

127

4. Assemble the gel apparatus, fill the buffer reservoirs with 1X TBE and pre-run the gel for 30 min at 200 V. 5. Denature the PCR products prior to loading by heating to 95°C for 3 min and then slowing cooling to 37°C over 20–30 min (see Note 3). This is most conveniently carried out using a programable heating block with an adjustable ramp time. 6. Mix 12–16 µL of each PCR reaction with 2–3 µL of loading buffer and load using a micropipet and disposable tips (see Notes 2, 4, and 5). Electrophoresis is performed at 200 V at room temperature until the Orange-G dye front has reached the end of the gel (see Notes 6 and 7). 7. Separate the gel plates and soak the gel in 1X TBE containing ethidium bromide 0.5 µg/mL for 20–30 min (see Notes 8–10). Place the gel onto the surface of a transilluminator covered with Saran Wrap™ and visualize the DNA bands under UV light.

3.2. MDE Gel Electrophoresis 1. 20 cm × 20 cm glass gel plates are prepared and assembled as detailed in Subheading 3.1. 2. Prepare a 1X gel mix by combining 25 mL of 2X MDE gel solution, 3 mL 10X TBE (final concentration 0.6X TBE), 3.75 g urea (optional) and deionized water to 50 mL. The reagents should be gently mixed until the urea, if included, has gone into solution. 3. Add 50 µL of TEMED and 750 µL of 10% ammonium persulphate to initiate polymerization and pour the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.4-µm filter. Insert a 20-well comb (1-mm thickness) with 0.5-cm teeth and clamp the top of the gel apparatus with bulldog clips. The gel is placed horizontally and allowed to polymerise for at least 60–90 min. 4. Assemble the apparatus, fill the buffer reservoirs with 0.6X TBE and pre-run the gel for 30 min at 20 V/cm. 5. Denature the PCR products prior to electrophoresis by heating to 95°C for 3 min and then slowing cooling to 37°C over 20–30 min. This is most conveniently carried out using a programmable heating block with an adjustable ramp time. 6. Mix 12–16 µL of each PCR reaction with 2–3 µL of loading buffer and load into the wells of the gel using a micropipet and disposable tips. Electrophorese at room temperature at 200 V until the Orange-G dye front has reached the end of the gel. 7. Separate the gel plates and soak the gel in 0.6X TBE containing ethidium bromide 0.5 µg/mL for 20–30 min. Place the gel onto the surface of a transilluminator covered with Saran Wrap™ and visualize the DNA bands under UV light.

3.3. Interpretation of Results (see Fig. 1) 1. Both Hydrolink D-5000 and MDE gels appear to detect most if not all insertion/deletion type mutations but vary in their ability to detect single base pair substitutions. 2. Heteroduplex fragments generally migrate slower than the homoduplex fragments and usually stain at 25–30% of the intensity of the homoduplex bands. The two

128

Perry

Fig. 1. Hydrolink D5000 gel showing the results of screening for mutations in exons 3 (3a + 3b), 3b, 4, and 5 of the antithrombin gene. PCR amplified fragments were electrophoresed at 200 V for 3 h in a 100% (1X) Hydrolink D5000 gel and then stained with ethidium bromide. Lanes 1, 5, 9, and 11 contain controls whilst lanes 6, 7, 8, and 12 contain amplified DNA from patients with antithrombin deficiency. By extending the electrophoresis times for the exon 3 fragments (lanes 2–4) to 6 h, the mutations in these fragments were clearly visible. In contrast to the results shown on this gel, agarose-gel electrophoresis showed only a single fragment in all cases.

heteroduplex bands may migrate as a single band. Depending upon the mutation up two four-bands may be seen: mutant/mutant homoduplex, normal/normal homoduplex, mutant/normal heteroduplex, and normal/mutant heteroduplex. 3. The pattern of bands obtained may provide some indication of the underlying mutation. Analysis of a series of mutations in the human antithrombin gene showed that single base-pair substitutions were associated with the presence of only one additional DNA band whereas small insertions/deletions were associated with presence of two additional bands. 4. MDE gels may be used in single-stranded conformation polymorphism (SSCP) analysis. 5. The method as described can detect mutations and polymorphisms in heterozygous individuals. If however, an individual is homozygous for a mutation or polymorphism then heteroduplexes will not be generated. The technique can, therefore, be modified by including an additional step prior to the denaturation/ renaturation step. Ten microliters of the test PCR product is mixed with 5 µL of a wild-type control and denaturation/renaturation then performed .

The Human Antithrombin Gene

129

4. Notes 1. The gel mix as shown results in a “1X” final concentration of Hydrolink D-5000 or MDE and is suitable for the majority of applications. In some cases reducing this to 0.5X may be useful. 2. Only sucrose-containing loading buffers should be used. 3. The most important aspect of this method is the quality of the PCR product. If additional bands are present when the PCR product is run on an agarose gel, or the amplification is weak or the bands are not sharp then the results obtained from the Hydrolink D-5000 or MDE gels will be disappointing. The inclusion of urea at a nondenaturing concentration (7.5%) often sharpens the bands. 4. Lane 1 should always contain a molecular weight marker. 5. Suitable positive controls should always be included. 6. Electrophoresis times are very much dependent upon fragment size. However, 3 h at 200 V for a 1X gel is a suitable starting point. 7. For fragments between 1–1.5 kb in length, electrophoresis times of 6–8 h may be necessary. Long gels, e.g., 40 cm × 20 cm allow longer electrophoresis times and may facilitate the detection of mutations. In such cases, additional gel mix will be required. However, the optimum PCR fragment seize for resolving mutations appears to be between 200 to. For larger fragments digestion with various restriction enzymes to produce smaller fragments may be necessary or alternatively the use of additional primers to amplify smaller fragments may be required. 8. Do not allow gels to soak for long periods of time in ethidium bromide/TBE–it soaks up the buffer and increases in size quite dramatically! If excessive background staining of gels is noted, the gels may be destained by soaking in deionized water for 30–60 min 9. The reagents are potentially toxic and should be treated in the same way as acrylamide-based gel solutions. 10. Ethidium bromide is a potential mutagen and should be handled with care. Solutions containing ethidium bromide must be disposed of appropriately. 11. Ethidium bromide detects bands that contain 150–250 ng DNA. Silver staining increases the sensitivity approx fivefold allowing the use of thinner gels and less sample loading. If silver staining of gels is planned then it is important that the gel should be “bound” to one of the glass plates, for example using “Bind Silane” to facilitate subsequent handling of the gel.

References 1. Keen, J., Lester, D., Inglehearn, C., Curtis, A., and Bhattacharya, S. (1991) Rapid detection of single base mismatches as heteroduplexes on Hydrolink gels. Trends Genetics 7, 5. 2. Perry, D. J. and Carrell, R. W. (1992) Hydrolink gels: a rapid and simple approach to the detection of DNA mutations in thromboembolic disease. J. Clin. Pathol. 45, 158–160. 3. Soto, D. and Saraswati, S. (1992) Improved detection of mutation in the p53 gene in human tumors as single-stranded conformation polymorphs and doublestranded heteroduplex DNA. PCR Methods Appl. 2, 96–98.

Chemical Cleavage of Mismatch Method

133

14 Detection of Mutations in Hemophilia A Patients by Chemical Cleavage of Mismatch Method Naushin H. Waseem, Richard Bagnall, Peter M. Green, and Francesco Giannelli 1. Introduction Hemophilia A is an X-linked disorder that leads to a defect in blood coagulation. This is caused by mutations in the factor VIII gene, which results in its activity being reduced or abolished in the blood-clotting cascade. The factor VIII gene is 186 kb long with 26 exons, varying from 69 bp (exon 5) to 3106 bp (exon 14) (1). The factor VIII mRNA is 9028 bases in length with a 7053 nucleotides long coding region (2). Various methods have been used for the detection of hemophilia A mutations. The more widely used are as follows: 1. Denaturing gradient gel electrophoresis (DGGE): This is based on the ability of mutations to reduce the melting temperature of DNA domains resulting in altered mobility on a formamide and urea gradient polyacrylamide gel. This method can detect any sequence change but for detecting factor VIII mutations it requires 41 PCR to amplify 26 exons of factor VIII gene and the putative promoter region. The maximum length of the PCR product is 600–700 bp and must have appropriate melting domain structure. Some splicing signal regions were not screened by this procedure (3). 2. Single-strand conformation polymorphism (SSCP): This method is based on the fact that single-stranded DNAs differing in a single nucleotide will acquire different conformations and so have different mobilities on a polyacrylamide gel. Various exons of factor VIII are amplified using polymerase chain reaction (PCR) and subjected to electrophoresis. The exon showing an altered electrophoretic mobility is then sequenced (4). This method requires at least 41 amplifications to scan the entire factor VIII coding region as PCR products must be between 100300 bp for efficient screening. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ

133

134

Waseem et al.

In both of the aforementioned procedures the PCR products containing the mutation are identified but the position of the mutation is not determined. 3. Chemical cleavage of mismatch: In order to develop a rapid and fully effective procedure for the detection of hemophilia A mutations, the method of chemical cleavage of mismatch (CCM) was combined with analysis of the traces of factor VIII mRNA present in the peripheral blood lymphocytes. The method of CCM has the advantage that it detects any sequence change even in long DNA segments (1.5–1.8 kb) and indicates the position of mismatch within the segment. The entire mRNA can be screened in few overlapping segments and offers a chance of detecting mutations occurring in any region of the gene, including internal region of the long introns by virtue of their effect on the structure of the mRNA, thus allowing a gain not only in the speed, but also in the completeness of mutation detection. A further advantage of mRNA analysis is that it provides direct evidence of the effect gene mutation may have on the structure of the gene transcript. In the basic procedure the factor VIII message and appropriate segments of a patient gene are specifically amplified and compared with similar products amplified from control RNA. The patient and control PCR products are then hybridized to form a heteroduplex and treated with hydroxylamine and/or osmium, which modify C or T residues, respectively. The DNA is then cleaved with piperidine at the modified base and analyzed on a denaturing polyacrylamide gel. From the size of the cleavage fragments, the position of the mutation is estimated and the relevant exons sequenced (5). To aid the visualization of DNA on the acrylamide gel the DNA is either radioactively or fluorescently labeled. This chapter describes the methods used in the detection of mutations by fluorescent chemical cleavage of mismatch method (FCCM).

The factor VIII message, except the large exon 14, is reverse transcribed with AMV reverse transcriptase and amplified with Tfl DNA polymerase into four overlapping segments (Fig. 1). Exon 14 is amplified from genomic DNA as two additional segments so that the entire coding region is represented in six overlapping segments. The promoter region (segment 7) and the polyadenylation signal region (segment 8) are also amplified from the genomic DNA. The promoter region overlaps with segment 1 (Fig. 1). The promoter region and polyadenylation signal region are sequenced directly whereas the rest of the segment are processed through FCCM. Three different fluorescent labeled dUTPs are used to label the segments: segment 1 and 2 with green, segment 3 and 4 with blue, and segment 5 and 6 with yellow. Similar segments are amplified from either control RNA or cloned factor VIII cDNA using biotinylated primers and fluorescent dUTPs. The patient and the control products are then hybridised to form heteroduplexes in two multiplex reactions. The heteroduplexes are then captured on streptavidin coated magnetic beads and treated with hydroxylamine and osmium followed

Chemical Cleavage of Mismatch Method

135 Fig. 1. Schematic diagram of factor VIII cDNA showing segments 1–8. Open bars represent primary PCR whereas filled bars are nested PCR. Segments 3 and 4, promoter region (segment 7) and polyadenylation signal region (segment 8) are amplified from DNA.

135

136

Waseem et al.

Fig. 2. Diagrammatic representation of steps involved in the fluorescent chemical cleavage of mismatch method.

136

Chemical Cleavage of Mismatch Method

137

by treatment with piperidine (Fig. 2). The products are analyzed on an ABI PRISM 377 DNA sequencer. 2. Materials

2.1. Lymphocyte Isolation 1. Histopaque-1077 is supplied by Sigma (cat. no. 1077-1). 2. Phosphate-buffered saline (PBS): 10 mM potassium phosphate buffer, 138 mM NaCl, 2.7 mM KCl, pH 7.4.

2.2. RNA Isolation 1. Various RNA isolation kits are available commercially. We have used two RNA isolation kits; (a) Purescript RNA isolation kit from Gentra (cat. no. R-5500A) and (b) RNA isolator from Genosys (cat. no. RNA-ISO-050). 2. Isopropanol. 3. Chloroform.

2.3. RT-PCR and PCR 1. Primers: The primers used for amplification are listed in Table 1. The four RTPCR fragments are labeled 1, 2, 5, and 6. The outer primers are called A and B whereas the nested ones are given C and D as suffix. Segments 3, 4, 7, and 8 are amplified from DNA and therefore, require only one pair of primers each. The nested and the segment 3 and 4 primers are also synthesized with biotin at their 5'-end and are marked with an asterisk in the table. A working solution of primers at 100 ng/mL is kept at 4°C and primer stocks are kept at –20°C. 2. Access RT-PCR System is supplied by Promega (cat. no. A1250). The kit is stored at –20°C. 3. Fluorescent deoxynucleotides : Fluorescent deoxynucleotides for labelling PCR products can be obtained from Perkin Elmer Applied Biosystems. [F]dUTP set (cat. no. P/N 401894) contains 12 nmol of [TAMRA]dUTP, 3 nmol of [R110]dUTP, and 3 nmol of [R6G]dUTP. These are stored as 2-ÂL aliquots at –20°C in the dark to avoid repeated freezing and thawing.

2.4. Chemical Cleavage of Mismatch 1. Hydroxylamine hydrochloride (Sigma, cat. no. H 2391): A 4 M solution is prepared and titrated to pH 6.0 with diethylamine (Sigma, cat. no. D 3131). Because very little hydroxylamine (20 µL/reaction) is required for the reaction a rough guide to prepare a 4 M solution, pH 6.0, is: weight (in mg) of hydroxylamine divided by 0.28 gives the volume of water to be added. This value times 0.2 to 0.3 gives the volume of diethylamine to be added to the solution to reach pH 6.0. The volume of diethylamine to be added varies from batch to batch and should be titrated for every batch. Hydroxylamine is highly

138

Waseem et al. Table 1 Sequence of the Primers Used in the Amplification of the Eight Segments from the Factor VIII cDNA 1A 1B 1C* 1D* 2A 2B 2C* 2D* 3A* 3B* 4A* 4B* 5A 5B 5C* 5D* 6A 6B 6D* 7A 7B 8A 8B

2.

3.

4. 5.

GGGAGCTAAAGCTATTTTAGAGAAG CAACAGTGTGTCTCCAACTTCCCCAT GAGAAGATTAACCTTTTGCTTCTC CCTACCAATCCGCTGAGGGCCATTG GAAGAAGCGGAAGACTATGATGATG GCCTAGTGCTACGGTGTCTTGAATTC CTGATTCTGAAATGGATGTGGTCAGG GGGAGAAGCTTCTTGGTTCAATGGC AGAGTTCTGTGTCACTATTAAGACCC TCTGAGGCAAAACTACATTCTCTTGG CAAGGACGTAGGACTCAAAGAGATGG CACCAGAGTAAGAGTTTCAAGACAC CTTCAGTCAGATCAAGAGGAAATTGAC GAAGTCTGGCCAGCTTTGGGGCCCAC TATGATGATACCATATCAGTTGAAATG CTCTAATGTGTCCAGAAGCCATTCCC TTCATTTCAGTGGACATGTG CAGGAGGCTTCAAGGCAGTGTCTG TAGCACAAAGGTAGAAGGCAAGC GGATGCTCTAGGACCTAGGC AAGAAGCAGGTGGAGAGCTC GCAGTGACCATTGTCCTGTCAGAC GAGTGTCCATCTTGCTATTCAGTGCC

toxic and should be handled in a fumehood and protective laboratory clothing should be worn. Osmium tetroxide: A 4% solution can be obtained from Sigma (cat. no. O 0631). A working solution of osmium tetroxide is 0.4% osmium in 2% pyridine (Sigma, P 3776). A fresh solution of osmium should be made each time it is required as it has a short half-life. Fresh stock solution should be purchased every 2–3 mo. Osmium is very toxic and should be handled in a fumehood. Protective laboratory clothing should be worn at all times during handling. Formamide loading dye: Deionized formamide containing 10 mg/mL dextran blue. Formamide from Amresco and Sigma give no background fluorescence when used as loading dye on ABI PRISM 377 DNA Sequencer. Piperidine: A 1 M solution of piperidine (Aldrich, cat. no. 10409-4) is prepared in formamide loading dye. 10X Hybridization buffer: 3 M NaCl in 1 M Tris-HCl, pH 8.0. This is stored at room temperature.

Chemical Cleavage of Mismatch Method

139

Table 2 Sequence of the Primers Used for the Detection of Intron 22 Iversion in Factor VIII Gene 22A 22C 23A 23C

TGGATCTGTTGGCACCAATG CGAGGAAATTCCACTGGAAC GGCAATGTGGATTCATCTGG CATGGAGTTGATGGGCTGTG

6. 2X Binding buffer: 2 M NaCl, 0.4% Tween 20, 0.1 mM EDTA , 10 mM Tris-HCl, pH 8.0, stored at room temperature. 7. TE 8.0: 10 mM Tris-HCl, pH 8.0, containing 0.1 mM EDTA, autoclaved, and stored at room temperature.

2.5. Fluorescent Dye Terminator DNA Sequencing 1. ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction Kit (cat. no. P/N 4022078) is supplied by Perkin Elmer Applied Biosystems and is stored as 4-µL aliquots at –20°C. 2. Absolute and 70% ethanol. 3. 3 M sodium acetate, pH 4.6. 4. 40% Acrylamide:bisacrylamide stock solution. 5. Sequence Navigator software from ABI.

2.6. Detection of Intron 22 Inversions Primers used for the amplification of exon 22–26 or 23–26 are listed in Table 2. 3. Methods

3.1. Isolation of Lymphocytes Histopaque 1077 is a mixture of polysucrose and sodium diatrizoate at a density of 1.077 g/mL. When anticoagulated blood is layered on Histopaque 1077, polysucrose aggregates the erythrocytes and granulocytes and they rapidly sediment. At low speed centrifugation, erythrocytes, and granulocytes form a pellet, the mononuclear cells remain at the interface of plasma–Histopaque 1077 and the platelets are removed at the washing step. 1. In a 50-mL polypropylene conical tube add 10 mL of Histopaque 1077. Gradually overlay an equal volume of anticoagulated blood. This can be facilitated by tilting the centrifuge tube containing Histopaque so that the blood trickles down

140

2. 3.

4. 5.

Waseem et al. the side of the tube. It is essential that Histopaque and the blood are at room temperature. Centrifuge at 400g at room temperature for 20 min. Transfer the opaque layer of lymphocytes at the interface with a disposable plastic Pasteur pipet into a fresh 50-mL centrifuge tube and add 35 mL of phosphate buffered saline. Centrifuge at 400g for 10 min at room temperature. Resuspended the lymphocyte pellet in either 600 µL of Cell Lysis Solution (Gentra) for the isolation of RNA/DNA or 1 mL of RNA Isolator (Genosys, UK) for the isolation of RNA. This can either be used immediately for the isolation of RNA and DNA or stored at –70°C until later use.

3.2. Isolation of DNA and RNA There are a number of kits available commercially for the isolation of DNA and RNA from a clinical sample, however, we have found that in our hands a combination of two RNA isolation kits actually works much better. Although this modification, sometimes, compromises the quality or the yield of DNA, it is enough for few PCRs. The blood is processed according to the protocol described in Purescript kit, which gives us a mixture of DNA and RNA. The DNA from this solution can be spooled out. The solution containing mostly RNA is then processed with RNA isolator.

3.2.1. Isolation of DNA 1. Thaw out lymphocyte in cell lysis solution at room temperature (if frozen) and add 200 µL of protein-DNA precipitation solution (Gentra). Invert gently about 10-15 times and place the tube on ice for 5 min. 2. Centrifuge at 16,000g for 3 min and transfer the supernatant to a fresh 1.5-mL microfuge tube. 3. Add 600 µL isopropanol and mix the sample 10–15 times. At this step, DNA should form a clump. Remove the DNA with a yellow tip and transfer it into a 1.5-mL microfuge tube containing 100 µL 70% ethanol (Save the rest of the solution for the isolation of RNA). 4. Centrifuge the DNA at 16,000g for 3 min. 5. Decant the ethanol and air dry the DNA pellet for 5–10 min at room temperature. 6. Resuspend the DNA in 50 µL of TE 8.0 and store at 4°C.

3.2.2. Isolation of RNA 1. Centrifuge the solution from step 3 above at 16,000g for 5 min at room temperature. 2. Decant the supernatant and wash the pellet with 100 µL 70% ethanol and repeat step 1. 3. Decant ethanol, flick spin again and aspirate traces of ethanol with a yellow tip. Allow it to airdry for 10–15 min and resuspend it in 50 µL RNA hydration solu-

Chemical Cleavage of Mismatch Method

4. 5. 6. 7. 8. 9.

141

tion (Gentra). If DNA could not be spooled out above, save 10 µL of this solution as a source of DNA for PCR amplification. Add 500 µL of RNA isolator (Genosys) to the rest of the solution. Add 100 µL chloroform and mix gently 15 times and incubate for 15 min at room temperature. Centrifuge at 16,000g for 15 min at room temperature. Transfer the upper aqueous phase to a fresh 1.5 microfuge tube and add 250 µL isopropanol. Mix and incubate for 10 min at room temperature. Centrifuge at 16,000g for 10 min at room temperature. At this stage RNA should be visible as translucent pellet. Wash pellet with 70% ethanol. Repeat step 6, airdry the RNA pellet and dissolve it in 50 µL RNA hydration solution (see Note 2).

3.3. RT-PCR For reverse transcription and amplification of four out of the eight segments from factor VIII mRNA we use Access RT-PCR System. In this kit the reverse transcription by AMV reverse transcriptase and initial 10 cycles of amplification by Tfl DNA polymerase is performed in a single tube (primary PCR) (see Note 3). An aliquot is then amplified for another 30 cycles with nested primers (secondary PCR). Two of the four segments (segments 1 and 5 and 2 and 6) are multiplexed in the primary PCR so in total we have two primary and four secondary PCRs. 1. Add 5 µL 5X reaction buffer, 0.5 µL 10 mM dNTPs, 3.0 µL 25 mM MgSO 4, 2.5 µL of 100 ng/mL primer 1A, 1B, 5A, 5B, 0.5 µL AMV reverse transcriptase, 0.5 µL Tfl DNA polymerase, 100–200 ng RNA. Make up the volume with RNase-free water to 25 µL. Set up a second RT-PCR substituting primer 1A, 1B, 5A, 5B for 2A, 2B, 6A, and 6B. 2. Overlay with mineral oil and place the tubes in controlled temperature block equilibrated at 48°C and incubate for 1 h and proceed immediately to thermal cycling reactions: 93°C for 30 s, 65°C for 30 s, 68°C for 5 min for 10 cycles. 3. To set up the secondary PCR, add 2.5 µL of 10X Tfl buffer, 0.5 µL of 10 mM dNTPs, 1.5 µL of 25 mM MgSO4, 2.5 µL of 100 ng/mL primer XC & XD (x is the segment number), 0.5 µL Tfl I , 0.4 µL [F]dUTP, 14.5 µL water, 2.5 µL of primary PCR. This reaction mix is also used for the amplification of segment 3 and 4 from DNA (see Note 4). 4. Set up the cycling conditions as follows: 94°C for 5 min and 30 cycles of 93°C for 30 s, 65°C for 30 s, 72°C for 3 min. 5. For amplification from control RNA or cloned factor VIII cDNA (referred to as probe from now on) use the same recipe except use biotinylated primers. The products should be gel purified before using in the fluorescent chemical cleavage of mismatch method (see Note 6).

142

Waseem et al.

3.4. Fluorescent Chemical Cleavage of Mismatch Method 3.4.1. Preparation of Hybrids 1. Set up the hybridization as follows: 3 µL 10X hybridization buffer, 30 ng each of the probe 1, 3, and 6 (the other multiplex will be 2, 4, and 5), 100–300 ng of target 1, 3, and 6. Make up the volume to 30 µL with TE 8.0. 2. Incubate at 95°C for 5 min and 65°C for 1 h (see Note 7). 3. Ten microliters of streptavidin coated magnetic beads (a 50% suspension is supplied) are required to bind the biotin tagged products per reaction. Take out the required volume and wash twice with 2X binding buffer. Resuspend in three times the original volume of the beads with 2X binding buffer. 4. Add 30 µL of the washed streptavidin beads to each reaction. Incubate 15 min at room temperature. 5. Place the tube on a magnetic stand to pellet the beads and aspirate the supernatant.

3.4.2. Hybrid Modification and Cleavage 3.4.2.1. HYDROXYLAMINE 1. Resuspend in the beads in 20 µL of 4 M hydroxylamine, pH 6.0 (see Subheading 3.). 2. Incubate 2 h at 37°C. 3. Pellet the streptavidin beads on a magnetic stand and wash the beads with TE 8.0 and proceed to Subheading 3.4.2.3. (see Note 9).

3.4.2.2. OSMIUM 1. Resuspend the beads from step 5 above in 20 µL 0.4 % osmium, 2% pyridine, and incubate for 15 min at 37°C. 2. Pellet the streptavidin beads on a magnetic stand and wash with TE 8.0.

3.4.2.3. CLEAVAGE OF DNA

Add 5 µL of piperidine/formamide loading dye to the reaction and incubate at 90°C for 30 min (see Note 10).

3.5. Analysis of the Products from FCCM on ABI PRISM 377 DNA Sequencer 3.5.1. Preparation and Loading of Polyacrylamide Gel 1. C