ISBN: 0-8247-0317-0 This book is printed on acid-free paper. Headquarters Marcel Dekker, Inc. 270 Madison Avenue, New Y...
31 downloads
1423 Views
3MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ISBN: 0-8247-0317-0 This book is printed on acid-free paper. Headquarters Marcel Dekker, Inc. 270 Madison Avenue, New York, NY 10016 tel: 212-696-9000; fax: 212-685-4540 Eastern Hemisphere Distribution Marcel Dekker AG Hutgasse 4, Postfach 812, CH-4001 Basel, Switzerland tel: 41-61-261-8482; fax: 41-61-261-8896 World Wide Web http://www.dekker.com The publisher offers discounts on this book when ordered in bulk quantities. For more information, write to Special Sales/Professional Marketing at the headquarters address above. Copyright 2000 by Marcel Dekker, Inc. All Rights Reserved. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage and retrieval system, without permission in writing from the publisher. Current printing (last digit): 10 9 8 7 6 5 4 3 2 1 PRINTED IN THE UNITED STATES OF AMERICA
Series Introduction
Oxygen is a dangerous friend. Overwhelming evidence indicates that oxidative stress can lead to cell and tissue injury. However, the same free radicals that are generated during oxidative stress are produced during normal metabolism and thus are involved in both human health and disease. Free radicals are molecules with an odd number of electrons. The odd, or unpaired, electron is highly reactive as it seeks to pair with another free electron. Free radicals are generated during oxidative metabolism and energy production in the body. Free radicals are involved in: Enzyme-catalyzed reactions Electron transport in mitochondria Signal transduction and gene expression Activation of nuclear transcription factors Oxidative damage to molecules, cells, and tissues Antimicrobial action of neutrophils and macrophages Aging and disease Normal metabolism is dependent upon oxgyen, a free radical. Through evolution, oxygen was chosen as the terminal electron acceptor for respiration. The two unpaired electrons of oxygen spin in the same direction; thus, oxygen is a biradical, but is not a very dangerous free radical. Other oxygen-derived free radical species, such as superoxide or hydroxyl radicals, formed during metabolism or by ionizing radiation are stronger oxidants and are therefore more dangerous. In addition to research on the biological effects of these reactive oxygen species, research on reactive nitrogen species has been gathering momentum. NO, or nitrogen monoxide (nitric oxide), is a free radical generated by NO synthase (NOS). This enzyme modulates physiological responses such as vasodilaiii
iv
Series Introduction
tion or signaling in the brain. However, during inflammation, synthesis of NOS (iNOS) is induced. This iNOS can result in the overproduction of NO, causing damage. More worrisome, however, is the fact that excess NO can react with superoxide to produce the very toxic product peroxynitrite. Oxidation of lipids, proteins, and DNA can result, thereby increasing the likelihood of tissue injury. Both reactive oxygen and nitrogen species are involved in normal cell regulation in which oxidants and redox status are important in signal transduction. Oxidative stress is increasingly seen as a major upstream component in the signaling cascade involved in inflammatory responses, stimulating adhesion molecule and chemoattractant production. Hydrogen peroxide, which breaks down to produce hydroxyl radicals, can also activate NFκB, a transcription factor involved in stimulating inflammatory responses. Excess production of these reactive species is toxic, exerting cytostatic effects, causing membrane damage, and activating pathways of cell death (apoptosis and/or necrosis). Virtually all diseases thus far examined involve free radicals. In most cases, free radicals are secondary to the disease process, but in some instances free radicals are causal. Thus, there is a delicate balance between oxidants and antioxidants in health and disease. Their proper balance is essential for ensuring healthy aging. The term oxidative stress indicates that the antioxidant status of cells and tissues is altered by exposure to oxidants. The redox status is thus dependent upon the degree to which a cell’s components are in the oxidized state. In general, the reducing environment inside cells helps to prevent oxidative damage. In this reducing environment, disulfide bonds (S—S) do not spontaneously form because sulfhydryl groups kept in the reduced state (SH) prevent protein misfolding or aggregation. This reducing environment is maintained by oxidative metabolism and by the action of antioxidant enzymes and substances, such as glutathione, thioredoxin, vitamins E and C, and enzymes such as superoxide dismutase (SOD), catalase, and the selenium-dependent glutathione and thioredoxin hydroperoxidases, which serve to remove reactive oxygen species. Changes in the redox status and depletion of antioxidants occur during oxidative stress. The thiol redox status is a useful index of oxidative stress mainly because metabolism and NADPH-dependent enzymes maintain cell glutathione (GSH) almost completely in its reduced state. Oxidized glutathione (glutathione disulfide, GSSG) accumulates under conditions of oxidant exposure, and this changes the ratio of oxidized to reduced glutathione; an increased ratio indicates oxidative stress. Many tissues contain large amounts of glutathione, 2–4 mM in erythrocytes or neural tissues and up to 8 mM in hepatic tissues. Reactive oxygen and nitrogen species can directly react with glutathione to lower the levels of this substance, the cell’s primary preventative antioxidant. Current hypotheses favor the idea that lowering oxidative stress can have a clinical benefit. Free radicals can be overproduced or the natural antioxidant
Series Introduction
v
system defenses weakened, first resulting in oxidative stress, and then leading to oxidative injury and disease. Examples of this process include heart disease and cancer. Oxidation of human low-density lipoproteins is considered the first step in the progression and eventual development of atherosclerosis, leading to cardiovascular disease. Oxidative DNA damage initiates carcinogenesis. Compelling support for the involvement of free radicals in disease development comes from epidemiological studies showing that an enhanced antioxidant status is associated with reduced risk of several diseases. Vitamin E and prevention of cardiovascular disease is a notable example. Elevated antioxidant status is also associated with decreased incidence of cataracts and cancer, and some recent reports have suggested an inverse correlation between antioxidant status and occurrence of rheumatoid arthritis and diabetes mellitus. Indeed, the number of indications in which antioxidants may be useful in the prevention and/or the treatment of disease is increasing. Oxidative stress, rather than being the primary cause of disease, is more often a secondary complication in many disorders. Oxidative stress diseases include inflammatory bowel disease, retinal ischemia, cardiovascular disease and restenosis, AIDS, ARDS, and neurodegenerative diseases such as stroke, Parkinson’s disease, and Alzheimer’s disease. Such indications may prove amenable to antioxidant treatment because there is a clear involvement of oxidative injury in these disorders. In this new series of books, the importance of oxidative stress in diseases associated with organ systems of the body will be highlighted by exploring the scientific evidence and the medical applications of this knowledge. The series will also highlight the major natural antioxidant enzymes and antioxidant substances such as vitamins F, A, and C, flavonoids, polyphenols, carotenoids, lipoic acid, and other nutrients present in food and beverages. Oxidative stress is an underlying factor in health and disease. More and more evidence is accumulating that a proper balance between oxidants and antioxidants is involved in maintaining health and longevity and that altering this balance in favor of oxidants may result in pathological responses causing functional disorders and disease. This series is intended for researchers in the basic biomedical sciences and clinicians. The potential for healthy aging and disease prevention necessitates gaining further knowledge about how oxidants and antioxidants affect biological systems. This book in the Oxidative Stress and Disease series includes contributions by outstanding researchers and provides unprecedented insight into understanding the role of free radical mechanisms in brain pathophysiology. Chapters present the conceptual framework of processes such as signal transduction, apoptosis control, calcium homeostasis, and molecular genetics, and their implications for neurodegenerative disorders such as Parkinson’s, Alzheimer’s, and Alexander’s diseases, as well as amyotrophic lateral sclerosis. The contributions on the func-
vi
Series Introduction
tion of antioxidants and free radical scavengers in neuroprotection open new therapeutic strategies for the prevention as well as treatment of neurodegenerative diseases. Lester Packer Enrique Cadenas
Preface
Evidence is continually accumulating that strongly supports the contribution of free radicals to the expression of spinal cord damage, subarachnoid hemorrhage, and reperfusion damage, as well as various neurodegenerative diseases, including Parkinson’s disease and Alzheimer’s disease. Knowledge of the functions of free radicals in brain pathophysiology gains further significance when considering that it permits the development of new therapeutic strategies—largely of a preventive nature—and the recognition of compounds that can serve as efficient neuroprotectors. The role of free radicals in several pathophysiological situations is becoming increasingly clear, and these species have a prominent position in almost all neuropathological disorders. Oxygen- and nitrogen-centered radicals, such as superoxide anion and nitric oxide, respectively, are known to be important biological signaling molecules. On the one hand, when produced at low levels, these species act on membranes and receptors and modulate signal transduction pathways and gene expression. On the other hand, high steady-state levels of oxygenand nitrogen-centered radicals (e.g., as a consequence of activation of immune cells or drug biotransformation) are associated with cytotoxicity, which in brain leads to neurodegenerative disorders. Accordingly, several observations strengthen the notion that oxidative stress plays a pivotal role in brain pathophysiology. Examples include the high mitochondrial density in most neural tissues along with the fact that these organelles are the major cellular source of oxidants; the involvement of free radicals in the actions of some neurotransmitters as well as in the vasculature surrounding neural tissues; the contribution of prions and β-amyloid proteins to the intracellular level of free radicals; the reported abnormalities of superoxide dismutase in the familial form of amyotrophic lateral sclerosis; and the involvement of free radicals in mental disorders and in loss of cognitive functions. Conversely, improvement of neurological symptoms upon treatment with antioxidant molecules strongly suggests an oxidative stress component in these vii
viii
Preface
diseases; for example, Gingko biloba extract (EGb761) has been shown to reduce dementia in human subjects and vitamin E to promote the slowing of event-free survival in patients diagnosed with Alzheimer’s disease. Hence, it is logical to assume that if free radicals are important in the etiology and progression of neurological disorders, antioxidants may be beneficial not only in the possible prevention of the clinical symptoms of these disorders, but also in slowing their progress. Spectacular advances in this field have warranted inviting basic researchers, physiologists, and clinicians to describe their latest results and to provide new insights into the underlying factors that involve oxidative stress and neurological disorders. This is the foundation of this volume, which highlights new and important advances relating to the occurrence of oxidative stress and the impact of oxidative injury in brain physiology and neurodegeneration. The individual chapters—grouped in four main sections—provide an authoritative and comprehensive view of some of the most current issues in brain pathophysiology, such as the involvement of oxygen- and nitrogen-centered radicals and cell-specific antioxidant mechanisms in glutamate and catecholamine-mediated neurotoxicity as well as in neurological disorders such as Alzheimer’s disease, Parkinson’s disease, and amyotrophic lateral sclerosis. Further, a section of this book is devoted to the critical evaluation of antioxidant-based therapeutic approaches in neurodegeneration. Taken together, these chapters provide an up-to-date account of the significance of antioxidants underlying critical factors in neurological processes. Giuseppe Poli Enrique Cadenas Lester Packer
Contents
Series Introduction (Lester Packer and Enrique Cadenas) Preface Contributors
iii vii xiii
I. Free Radicals and Antioxidants in Brain Pathophysiology 1.
2.
Role of Free Radicals in the Brain in Health and Disease in Relation to Synaptic Plasticity John Smythies Neuromodulatory Effects of Nitric Oxide in Pain Perception Adalberto Merighi, Patrizia Aimar, Laura Lossi, Lucia Pasti, and Giorgio Carmignoto
1
17
3.
Ischemic and Metabolic Stress–Induced Apoptosis James David Adams, Jr., Lawrence R. Williams, Suman K. Mukherjee, Lori Klaidman, Glen Inouye, Vierka Cummins, and Maria Morales
55
4.
Nitrogen Radicals in Ischemic Damage of the Brain ¨ zben Tomris O
77
5.
Neuroinflammatory Events and Enhanced Signal Transduction Processes Involved in Neurodegeneration Robert A. Floyd, C. A. Stewart, K. A. Robinson, G. Bing, and K. Hensley
109
ix
x
Contents
II. Free Radicals in Glutamate and Catecholamine-Mediated Neurotoxicity 6. Oxidative Stress in Glutamate Neurotoxicity Derick S. Han, Enrique Cadenas, Michael S. Kobayashi, and Lester Packer 7. Modulation of Glutamate Release and Toxicity by Nitric Oxide C. M. Carvalho, S. M. Sequeira, C. B. Duarte, and Arse´lio P. Carvalho 8. Monoamines, Monoamine Oxidase Inhibitors, and the Maintenance of Mitochondrial Function During Oxidative Stress Pamela A. Maher and Shirlee Tan 9. Interplay Between Oxidative Stress and Calcium Homeostasis in Acute Neuronal Damage and Neurodegenerative Disease Julie K. Andersen and Veena Viswanath 10. MAO Knock-Out Mice and Behavior Jean Chen Shih, K. Chen, and M. J. Ridd 11. DNA Strand Breakage Induced by Nitric Oxide Together with Catecholamine: Implications for Neurodegenerative Disease Hiroshi Ohshima, Yumiko Yoshie, and Isabelle Gilibert 12. 6-Hydroxydopamine, Dopamine, and Ferritin: A Cycle of Reactions Sustaining Parkinson’s Disease? G. N. L. Jameson and Wolfgang Linert
127
157
177
197
217
229
247
III. Free Radicals and Antioxidants in Neurological Disorders 13. ROS and Parkinson’s Disease: A View to a Kill Serge Przedborski and Vernice R. Jackson-Lewis
273
Contents
14.
15.
16.
17.
18.
19.
xi
Nitric Oxide Overproduction and Oxidative Stress in Human Idiopathic Parkinson’s Disease Emilia Mabel Gatto, Natalia Andrea Riobo´, Maria Cecilia Carreras, and Juan Jose´ Poderoso Molecular and Cellular Aspects of Oxidative Damage in Alzheimer’s Disease Mark A. Smith and George Perry Free Radical–Mediated Disruption of Cellular Ion Homeostasis, Mitochondrial Dysfunction, and Neuronal Degeneration in Sporadic and Inherited Alzheimer’s Disease Mark P. Mattson Role of Transgenic Models for the Study of Oxidative Neurotoxicity in Alzheimer’s Disease Miguel A. Pappolla, Y.-J. Chyan, George Perry, Mark A. Smith, Melissa Sos, and Felix Cruz-Sanchez Oxidative Protein Modifications in Rosenthal Fibers: Implications for Alexander’s Disease Pathogenesis Rudolph J. Castellani, George Perry, and Mark A. Smith Superoxide Dismutase and Amyotrophic Lateral Sclerosis Giuseppe Rotilio, Alberto Ferri, Roberta Gabbianelli, and Maria Teresa Carrı`
291
313
323
359
383
393
IV. Neurodegeneration and Antioxidant-Based Therapeutic Approaches 20.
21.
Effects of Ginkgo biloba Extract (EGb 761) on Alzheimer’s Disease Yves Christen, Marie-The´re`se Droy-Lefaix, Catherine Pasquier, and Lester Packer Glutathione and Metallothionein in Oxidative Stress of Parkinson’s Disease Manuchair Ebadi and Midori Hiramatsu
411
427
xii
Contents
22. Estrogens and Other Antioxidants in Neuroprotection: Implications for Alzheimer’s Disease Christian Behl and Bernd Moosmann
467
23. Therapeutic Potential of Radical Scavengers in Parkinson’s Disease Silvia Mandel, Edna Gru¨nblatt, and Moussa B. H. Youdim
487
24. Vitamin E and Other Antioxidant Treatments for the Neurobehavioral Aspects of Alzheimer’s Disease and Other Neurodegenerative Disorders Fadi Massoud, Mario Schittini, and Mary Sano 25. Nitric Oxide and the NMDA Receptor in Ischemia and Reperfusion Injury: Is NO Protective or Injurious? Michael Graham Espey, Katrina M. Miranda, Carol A. Colton, Ryszard M. Pluta, Sandra J. Hewett, and David A. Wink 26. Endogenous Protection of Retinal Photoreceptors Against Light-Induced Oxidative Stress Pier Lorenzo Marchiafava and Biancamaria Longoni Index
501
523
541
553
Contributors
James David Adams, Jr., Ph.D. University of Southern California, Los Angeles, California Patrizia Aimar University of Torino, Torino, Italy Julie K. Andersen, Ph.D. University of Southern California, Los Angeles, California Christian Behl, Ph.D. Max Planck Institute of Psychiatry, Munich, Germany G. Bing Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma Enrique Cadenas, M.D. Institute for Toxicology, University of Southern California School of Pharmacy, Los Angeles, California Giorgio Carmignoto Universita` degli Studi di Padova e Centro per lo Studio delle Biomembrani del CNR, Padova, Italy Maria Cecilia Carreras, B.D. Laboratory of Oxygen Metabolism and Department of Clinical Biochemistry, University Hospital, University of Buenos Aires, Buenos Aires, Argentina Maria Teresa Carrı` Assistant Professor, Department of Biology, University of Rome ‘‘Tor Vergata,’’ Rome, Italy Arse´lio P. Carvalho, Ph.D. Center for Neuroscience, University of Coimbra, Coimbra, Portugal C. M. Carvalho University of Coimbra, Coimbra, Portugal xiii
xiv
Contributors
Rudolph J. Castellani, M.D. University of Maryland, Baltimore, Maryland K. Chen University of Southern California, Los Angeles, California Yves Christen Institut Ipsen, Paris, France Y.-J. Chyan University of South Alabama, Mobile, Alabama Carol A. Colton Georgetown University Medical School, Washington, D.C. Felix Cruz-Sanchez University of Catalonya, Barcelona, Spain Vierka Cummins Amgen, Inc., Thousand Oaks, California Marie-The´re`se Droy-Lefaix Institut Ipsen, Paris, France C. B. Duarte University of Coimbra, Coimbra, Portugal Manuchair Ebadi, Ph.D. University of North Dakota, School of Medicine and Health Sciences, Grand Forks, North Dakota Michael Graham Espey, Ph.D. National Cancer Institute, National Institutes of Health, Bethesda, Maryland Alberto Ferri Fondazione S. Lucia, Rome, Italy Robert A. Floyd, Ph.D. Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma Roberta Gabbianelli Fondazione S. Lucia, Rome, Italy Emilia Mabel Gatto, M.D. Assistant Professor, Department of Neurology and Laboratory of Oxygen Metabolism, University Hospital, University of Buenos Aires, Buenos Aires, Argentina Isabelle Gilibert Unit of Endogenous Cancer Risk Factors, International Agency for Research on Cancer, Lyon, France Edna Gru¨nblatt Technion Faculty of Medicine, Haifa, Israel Derick S. Han University of Southern California, Los Angeles, California
Contributors
xv
K. Hensley Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma Sandra J. Hewett University of Connecticut Health Center, Farmington, Connecticut Midori Hiramatsu, Ph.D. Institute for Life Support Technology, Yamagata Technopolis Foundation, Yamagata, Japan Glen Inouye Amgen, Inc., Thousand Oaks, California Vernice R. Jackson-Lewis, Ph.D. Columbia University School of Medicine, New York, New York G. N. L. Jameson Institute of Inorganic Chemistry, Technical University of Vienna, Vienna, Austria Lori Klaidman University of Southern California, Los Angeles, California Michael S. Kobayashi University of California, Berkeley, California Wolfgang Linert Institute of Inorganic Chemistry, Technical University of Vienna, Vienna, Austria Biancamaria Longoni University of Pisa, Pisa, Italy Laura Lossi University of Torino, Torino, Italy Pamela A. Maher, Ph.D. The Scripps Research Institute, La Jolla, California Silvia Mandel Technion Faculty of Medicine, Haifa, Israel Pier Lorenzo Marchiafava, M.D. University of Pisa, Pisa, Italy Fadi Massoud, M.D., F.R.C.P.(C) Gertrude H. Sergievsky Center, Columbia University, New York, New York Mark P. Mattson, Ph.D. National Institute on Aging, National Institutes of Health, Bethesda, Maryland Adalberto Merighi, D.V.M., Ph.D. University of Torino, Torino, Italy
xvi
Contributors
Katrina M. Miranda National Cancer Institute, National Institutes of Health, Bethesda, Maryland Bernd Moosmann Max Planck Institute of Psychiatry, Munich, Germany Maria Morales University of Southern California, Los Angeles, California Suman K. Mukherjee University of Southern California, Los Angeles, California Hiroshi Ohshima Unit of Endogenous Cancer Risk Factors, International Agency for Research on Cancer, Lyon, France ¨ zben, Ph.D. Akdeniz University, Antalya, Turkey Tomris O Lester Packer, Ph.D. Department of Molecular and Cell Biology, University of California, Berkeley, California Miguel A. Pappolla, M.D. University of South Alabama, Mobile, Alabama Catherine Pasquier INSERM U479, Paris, France Lucia Pasti Universita` degli Studi di Padova e Centro per lo Studio delle Biomembrani del CNR, Padova, Italy George Perry, Ph.D. Institute of Pathology, Case Western Reserve University, Cleveland, Ohio Ryszard M. Pluta National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland Juan Jose´ Poderoso, M.D. Professor, Department of Medicine; Director, Laboratory of Oxygen Metabolism, University Hospital, University of Buenos Aires, Buenos Aires, Argentina Serge Przedborski, M.D., Ph.D. Columbia University School of Medicine, New York, New York M. J. Ridd University of Southern California, Los Angeles, California Natalia Andrea Riobo´ Fellow, Laboratory of Oxygen Metabolism, University Hospital, University of Buenos Aires, Buenos Aires, Argentina
Contributors
xvii
K. A. Robinson Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma Giuseppe Rotilio, M.D., Ph.D. Professor, Department of Biology, University of Rome ‘‘Tor Vergata,’’ Rome, Italy Mary Sano, Ph.D. Gertrude H. Sergievsky Center, Columbia University, New York, New York Mario Schittini, M.D., M.P.H. Gertrude H. Sergievsky Center, Columbia University, New York, New York S. M. Sequeira University of Coimbra, Coimbra, Portugal Jean Chen Shih, Ph.D. University of Southern California, Los Angeles, California Mark A. Smith, Ph.D. Institute of Pathology, Case Western Reserve University, Cleveland, Ohio John Smythies, M.D., F.R.C.P. Center for Brain and Cognition, University of California–San Diego, La Jolla, California Melissa Sos University of South Alabama, Mobile, Alabama C. A. Stewart Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma Shirlee Tan The Salk Institute for Biological Studies, La Jolla, California Veena Viswanath
University of Southern California, Los Angeles, California
Lawrence R. Williams* Amgen, Inc., Thousand Oaks, California David A. Wink National Cancer Institute, National Institutes of Health, Bethesda, Maryland
*Present address: Guilford Pharmaceuticals, Baltimore, Maryland.
xviii
Contributors
Yumiko Yoshie* Unit of Endogenous Cancer Risk Factors, International Agency for Research on Cancer, Lyon, France Moussa B. H. Youdim, Ph.D. Technion Faculty of Medicine, Haifa, Israel
*Present address: Tokyo University of Fisheries, Tokyo, Japan.
1 Role of Free Radicals in the Brain in Health and Disease in Relation to Synaptic Plasticity John Smythies University of California–San Diego, La Jolla, California
I. INTRODUCTION There is considerable evidence that synapses in the adult as well as the developing brain are continually being formed and removed in a process called synaptic plasticity (21,65,80). The majority of excitatory synapses in the brain are glutamatergic and are formed mainly on dendritic spines. Spines are continually changing their shape and numbers. There must therefore be specific biochemical mechanisms mediating this activity. Some of these mechanisms involve various growth factors such as nerve growth factor (NGF). Others involve the interaction of neuromodulators such as the biogenic amines acting on their specific receptors. The receptors activate postsynaptic cascades that involve cyclic nucleotides and phosphorylation of cytoskeletal proteins leading to growth of synaptic elements. The purpose of this chapter is to review the evidence that free radicals derived from oxygen, nitrogen, and catecholamines might also play a role.
II. THE GLUTAMATE SYNAPSE Glutamate is a potent neurotoxin and there is evidence that its neurotoxicity is mediated by free oxygen radicals (20,22–24,45,61,71). The glutamate synapse (Fig. 1) possesses several features that indicate that oxidative stress mediated by free oxygen radicals, antioxidant defenses, and, in addition, nitric oxide, play a role in its function. 1
2
Smythies
Figure 1 Simplified diagram of the glutamate synapse. AA, arachidonic acid; C, ascorbate; DA, dopamine; DAQ, dopamine quinones; glu, glutamate; M glu, metabotropic glutamate receptors; NO, nitric oxide; NS, cytoskeleton; P.N., proteases and nucleases; PGH, prostaglandin H; PGH syn, prostaglandin H synthase (cyclooxygenase); ROS, reactive oxygen species. In loci that do not contain dopamine, the cofactor for PGH synthase will be some other molecule.
1. When glutamate is released into the synapse from the axon terminal its action is terminated by rapid reuptake by the glutamate transporter. The energy for this is provided by an Na⫹ /K⫹-dependent ATPase. Glutamate uptake is accompanied by simultaneous release by the glutamate transporter of ascorbate into the synaptic cleft (66,68). This ascorbate/glu hetero exchange is not tightly linked but rather is buffered by a further process such as competition for a common intracytoplasmic binding site (35). Ascorbate is the principal extracellular antioxidant in brain. 2. The antioxidant dipeptide carnosine is colocalized with glutamate in
Free Radicals and Synaptic Plasticity
3
the synaptic vesicle and is released with glutamate into the synaptic cleft (6,74). 3. The N-methyl-d-aspartate (NMDA) receptor for glutamate possesses a redox-sensitive site containing sulfydryl groups, oxidation of which downregulates the receptor. Since, as we will see, activation of the NMDA receptor leads to the release of neurotoxic free radicals, this provides a negative feedback mechanism to protect the receptor and synapse against glutamate neurotoxicity. The sources of free radicals at the glutamate synapse include the following: 1. Activation of the NMDA receptor opens a calcium channel. The entry of calcium into the dendritic spine activates phospholipase A2. This in turn acts on membrane phospholipids to release arachidonic acid, which leads to the activation of prostaglandin H synthase, the ratelimiting step in prostaglandin synthesis. This reaction leads to the release of large amounts of reactive oxygen species including hydrogen peroxide (H2O2), which is a freely diffusible molecule and so can enter the synaptic cleft. Here, in the presence of minute amounts of ‘‘free’’ iron, it could form the highly cytotoxic hydroxyl radical. The status of free iron in the brain is controversial. Recently, Mumby et al. (55) distinguished between free iron (iron free of high-affinity binding to transferrin), loosely bound iron (associated with proteins such as albumin), and labile iron (can be mobilized from biological ligands by oxidative stress). During periods of oxidative stress low molecular weight labile ferrous iron appears in the cerebrospinal fluid (CSF) (36) and so free iron could be present in the extracellular fluid of the synaptic space. 2. Entry of calcium into the postsynaptic region also activates nitric oxide synthase. This also leads to the release of reactive oxygen species. The predominant redox form of nitric oxide is the highly neurotoxic nitric oxide radical NO•. Nitric oxide is also a freely diffusible molecule and can diffuse back into the synaptic cleft. Moreover, nitric oxide and H2O2 can interact independently of free iron to produce hydroxyl radicals (57). It is therefore possible that one factor in synaptic plasticity may be the redox balance at the glutamate synapse between neurotoxic oxidants (such as H2O2 and NO•), on the one hand, and neuroprotective antioxidants (such as ascorbate, carnosine, and possibly glutathione) on the other (88). However, in at least some parts of the brain, synaptic plasticity is a function of learning and learning depends in part on positive reinforcement. One chemical signal of reinforcement received by the organism is the widespread release of dopamine throughout the
4
Smythies
higher cortex (77), especially the prefrontal cortex. Most dopamine terminals are nonsynaptic boutons-en-passage carried on widely diffuse networks. Many of these terminals are closely attached to glutamate synapses in the cortex and striatum (44). This would allow dopamine to diffuse into the glutamate synapse. The neurotoxic effects of dopamine are mediated by its oxidative quinone metabolites acting not on dopamine receptors but on NMDA receptors (3,9,47,53). This implies that dopamine or its metabolites can reach NMDA receptors. Pickel et al. (64) have presented evidence that dopamine can diffuse through extracellular space in this manner. Moreover, dopamine boutons-en-passage in the prefrontal cortex have low levels of the dopamine transporter (reuptake) molecule (86), which suggests that the dopamine released may be diffusing elsewhere. It may therefore be significant that dopamine is a potent antioxidant (48). The antioxidant effect of dopamine is mediated by redox cycling between dopamine and dopamine o-quinone. When dopamine reduces a reactive oxygen species (ROS) molecule it is converted to dopamine o-quinone. The latter is reconverted to dopamine by ambient antioxidants, in particular ascorbate and glutathione. Only when these are exhausted is the dopamine o-quinone further (irreversibly) oxidized to dopaminochrome (13,15,60). Thus, the release of dopamine into the glutamate synapse following reinforcement would tilt the redox balance toward neuroprotective reduction leading to the growth of that synapse. Lack of dopamine would tilt the redox balance in the other neurotoxic oxidant direction and so would promote deletion of that synapse. In this way glutamatergic synapses that were active during the period of dopamine release would be conserved and their growth (mediated by metabotropic glutamate receptors) would not be inhibited, whereas synapses that were active in the absence of dopamine release would tend to be pruned by unbuffered toxic free radicals. This suggested mechanism of the action of dopamine is meant to complement its other actions via its own receptors linked to postsynaptic cascades involving cyclic nucleotides that may also be involved in synaptic plasticity. Other factors in this reaction are the metabotropic glutamate receptors which are connected with a postsynaptic cascade in which phosphatases are activated. These act on the cytoskeletal proteins and result in growth of the spine (72). However, the action of ascorbate at synapses is more complex than simply that mediated by its antioxidant properties. It also exhibits the following properties: blockade of NMDA, adrenergic, 5-hydroxytryptamine (5-HT), and dopamine receptors (11); inhibition of glutamate binding to the NMDA receptor (35); inhibition of NMDA-evoked currents (32); inhibition of N⫹,K⫹-activated ATPase and of dopamine-sensitive adenylate cyclase; stimulation of release of acetylcholine and norepinephrine from synaptic vesicles; acting as a cofactor for dopamine β-hydroxylase (54); inhibition of dopamine uptake (4); promotion of synthesis of catecholamines by two mechanisms, i.e., reduction of pteridins (es-
Free Radicals and Synaptic Plasticity
5
sential cofactors for tyrosine hydroxylase) and induction of a threefold increase in mRNA production for enzymes involved in catecholamine synthesis (81). The bad news is that ascorbate interacts with the nitrosium ion to form the nitric acid radical (33) and also inhibits glutathione uptake (37). Clearly, the action of ascorbate at synapses is very complex.
III.
FREE RADICALS DERIVED FROM CATECHOLAMINES
Catecholamines are themselves potent antioxidants but they are easily oxidized to highly neurotoxic o-quinones (Fig. 2). Vulpian (95) noted in 1856 that adrenal gland tissue exposed to air turns red. This red pigment was later identified as adrenochrome, but it was thought for many years that this pathway of catecholamine metabolism never occurred in vivo. Recently, however, conclusive evidence has been obtained that this pathway does indeed occur in the body, particularly in the brain where it may be of great functional importance (91).
Figure 2 The pathway to neuromelanin. (a) Dopamine; (b) dopamine o-quinone; (c) dopaminochrome; (d) dopamine semiquinone free radical; (e) dopamine hydroquinone; (f) 5,6-dihydroxyindole, which polymerizes to form neuromelanin.
6
Smythies
This pathway runs as follows. If we take dopamine as the simplest example, dopamine is first oxidized to dopamine quinone. This step is reversible by some antioxidant such as ascorbate or glutathione. Dopamine quinone then cyclizes spontaneously and irreversibly to form dopaminochrome. This may then be converted by the enzyme DT-diaphorase to the relatively nontoxic o-hydroquinone. Or it may be converted by the enzyme NADPH cytochrome P450 reductase to the highly neurotoxic free radical o-semiquinone. The o-hydroquinone can autooxidize spontaneously to form the o-semiquinone, but this is normally inhibited by ambient antioxidant enzymes such as superoxide dismutase and catalase. The o-hydroquinone is metabolized to nontoxic products by catechol-O-methyltransferase (COMT) and sulfotransferase, and is thus neuroprotective as these reactions prevent the formation of the free radical o-semiquinone. These o-quinones then form 5,6-dihydroxyindole, which is the immediate precursor, by polymerization, of neuromelanin. 5,6-Dihydroxyindole is itself a substrate for O methylation, by COMT at the 6-position and by indoleamine-O-methyltransferase at the 5position. These methylated products are excreted in the urine. Dopamine quinone is also metabolized to 5-cysteinyl dopamine in neurons. The first evidence that dopamine quinones occur in the brain came when it was discovered that they form essential metabolic precursors of the neuromelanin located in the cell bodies of the dopaminergic neurons in the substantia nigra and of the noradrenergic neurons in the locus coeruleus. This was followed by their direct identification by definitive mass spectrometric methods by Costa et al. (19), and by the detection of 5-cysteinyl dopamine, a metabolite of dopamine quinone, in brain by Carlsson et al. (12). Segura-Aguilar (83) and Segura-Aguilar et al. (84,85) have worked out most of the enzymatic pathways in the brain dealing with these compounds as listed above. The presence of these enzymes in brain suggests that their substrates are present too. Last, dopamine toxicity has been shown to be mediated by these quinone metabolites as described above. The question then naturally arises, ‘‘Where in the brain are these catecholamine o-quinones formed?’’ The cell bodies containing dopamine are located in the substantia nigra and the ventral tegmentum. These neurons release dopamine from their dendrites as well as from their axon terminals (58). Dopamine is released diffusely from an extensive network of axons mainly in the prefrontal cortex, striatum, and nucleus accumbens. Norepinephrine is released from a similar axonal network widely in the cortex which arises from cell bodies in the locus coeruleus. Adrenaline-containing neurons are located in groups C1 –C3 in the medulla. These give rise to a dense innervation of medial thalamic nuclei and other limbic structures (63,69), where they are strategically placed powerfully to influence many limbic functions. The enzyme phenylethanolamine N-methyltransferase (PNMT), which synthesizes adrenaline from norepinephrine, is found in human brain (46) in high concentration in the reticular formation and hypothalamus,
Free Radicals and Synaptic Plasticity
7
and in intermediate amounts in the locus coeruleus, amygdala, and nucleus accumbens. In the cortex there is very little. These workers did not report on levels in the medial thalamus. Mefford et al. (51) measured levels of adrenaline in human postmortem brain and found high levels in the hypothalamus, medial thalamus, septum, and around the third ventricle. There were very low levels in the hippocampus, neocortex, and basal ganglia. So presumably there is an adrenergic innervation of these limbic structures (septum, amygdala, locus coeruleus, and nucleus accumbens) as well as the hypothalamus and midline thalamus. Thus catecholamines are widely distributed throughout the brain. The two more familiar metabolic pathways—COMT and monoamine oxidase (MAO)—are perisynaptic. The present question is, where does the oxidative metabolic pathway take place? Neuromelanin is found in the neuronal cell body, not in the axon or dendrites. It is not present at birth, but appears at around 6 months of age in humans, and gradually and steadily accumulates during life. It is not found in lower mammals such as rodents. This suggests that the oxidation of catecholamines, of which neuromelanin is one end-product, follows a similar course inside the cell body since there is no evidence of transport from the axon terminals. Presumably newly synthesized catecholamines are subject to oxidation in this location possibly by free radicals derived from the mitochondrial respiratory chain, which forms the most prominent source of free radicals in cells. However, it is possible that catecholamine oxidation can occur elsewhere in the brain but not progress as far as neuromelanin formation. It could stop at the stage of 5,6,-dihydroxyindole and its O-methylated metabolites that are found in normal urine. If dopamine enters the glutamate synaptic cleft, as I have suggested, it will be in an environment shared by oxidants such as H2O2 and nitric oxide. Normally dopamine is protected from oxidation by the antioxidant vitamin C in the synapse. Nitric oxide causes dopamine release and inhibits dopamine reuptake by a direct action on the dopamine storage system (18). In the presence of enough vitamin C this would tend to potentiate the antioxidant effect of dopamine. However, if vitamin C levels are low, nitric oxide can react with the superoxide ion to form the powerful oxidant peroxynitrite, which will rapidly convert dopamine to dopamine semiquinone (18). Thus catecholamine quinones could be produced in the glutamatergic synaptic cleft with the normal function of spine pruning. Their main metabolites could be O-methylated hydroquinones and O-methylated 5,6-dihydroxyindole, or possibly 5-cysteinyl dopamine, rather than neuromelanin. These would enter the extracellular space and eventually be excreted. In the nucleus accumbens glutamatergic terminals synapse onto dopamine nerve terminals (26). Thus the free radicals produced by the postsynaptic cascade would have direct access to dopamine at this site. Another possible site of production of catecholamine o-quinones is by the cyclooxygenase part of the enzyme prostaglandin H synthase II. Hastings (38)
8
Smythies
and Mattammal et al. (49) showed that this enzyme in vitro can use dopamine as a cofactor and, in doing so, the dopamine is converted to dopaminochrome. It has as yet to be shown that this reaction occurs in vivo.
IV. A.
ROLE OF FREE RADICALS IN BRAIN DISEASE Schizophrenia
There are several reports that spine numbers, and thus synapses, in the cortex and striatum in schizophrenic brain are reduced by 50% (28–30,70). There are also reports that certain brain areas have loss of neuropil (30,82,93). It is not clear, however, if this is because they were never formed properly or were pruned excessively. It is possible that this finding represents an imbalance in the dynamic process that controls the formation and deletion of synapses. I have put forward the hypothesis (88) that this dynamic process is disordered in schizophrenia because of an imbalance between excessive neurotoxic free radical production (including catecholamine o-semiquinones) and defective neuroprotective antioxidant mechanisms on the basis of the following evidence: 1. Antioxidant defenses have been reported to be weak in schizophrenia and oxidative stress to be present. Abdalla et al. (1) found an increase in superoxide dismutase and a decrease in glutathione peroxidase, which would result in an excess production of H2O2. Neutrophils from the blood of schizophrenics produce more superoxide anion than normal controls (52). Levels of measures of oxidative stress, such as malonyldialdehyde (MDA) and pentane production, are also raised (67). There is a highly significant negative correlation between glutathione peroxidase activity in blood cells and the degree of cortical atrophy in the disease (7,8). Hawkins and Pauling (39) and Kanofsky et al. (43) have reviewed the evidence of defective vitamin C function in schizophrenia. Cadet and Lohr (10) have suggested that the overactivity of dopaminergic neurons during the acute phase generates excess free radicals, which leads to neuronal damage and subsequent chronic disability. Antioxidant enzymes will inhibit the conversion of the o-hydroquinone to the o-semiquinone as we saw earlier. There is also evidence of increased activity of PLA2, which would lead to increased production of free radicals (41,96) and the abnormalities in membrane lipids found in the disease. 2. Formation of 5-cysteinyl derivatives prevents o-semiquinone formation. Levels of 5-cysteinyl dopamine in the striatum are raised in schizophrenia (12). 3. O-Methylation of the hydroquinone or dihydroxyindole prevents O-
Free Radicals and Synaptic Plasticity
9
semiquinone formation. O-Methylation systems are weak in schizophrenia (89a,89b,89c). 4. The last line of defense against o-semiquinone formation is the polymerization of 5,6-dihydroxyindole to form neuromelanin. There is some very preliminary evidence that neuromelanin is abnormal in schizophrenia (see Ref. 87 for details). Very little work has been done on the pharmacology of catecholamine oquinones. Adrenochrome has been reported to be a psychotomimetic agent (34,40,78,79,94) so the question arises as to whether it occurs in brain. The noradrenergic A1–A3 neurons in the medulla have been reported to contain neuromelanin (5), a certain marker for catecholamine o-quinone formation. In the adrenergic C1 –C3 group, Gai et al. (27) present evidence that some 30% adrenergic neurons are pigmented. Adrenochrome formation would be limited to the C1 –C3 neurons and their projections to the hypothalamus and medial thalamus and other limbic structures. In these key areas the production of a neurotoxic free radical form of adrenochrome (the o-semiquinone) might be expected to have far-reaching consequences. It is of course also possible that any adrenochrome produced at adrenergic terminals is metabolized as far as the 5,6-dihydroxyindole derivative and its O-methylated products, which are excreted, without going as far as neuromelanin. Furthermore, a major metabolite of adrenochrome is adrenolutin, which does not form neuromelanin readily (92). Adrenochrome is a much more stable compound than either dopaminochrome or noradrenochrome, and is thus easier to work with in pharmacological tests. No psychopharmacological research has been carried out as yet with dopaminochrome or noradrenochrome. In the periphery adrenochrome has been reported to be the major metabolite of adrenaline by polymorphonuclear leukocytes where it may form part of the cytotoxic armamentarium of the leukocyte (50). It might be relevant that the immediate c-fos response to haloperidol and clozepine is specifically localized to the medial thalamic nuclei and nucleus accumbens (to which the former project) (17). Antipsychotic drugs are also potent free radical scavengers. VanderWende and Johnson (89d) showed that serotonin and catecholamines form complexes which inhibit the autooxidation of the latter. They suggested that such direct chemical interactions between neurotransmitters might have some functional importance. Galzigna and Rizzoli (89c) have reported that acetylcholine also binds to catecholamine oxidation products such as adrenochrome, which led them to their ‘‘short circuit’’ theory of the biochemical basis of schizophrenia. B.
Parkinson’s Disease
Parkinson’s disease is due to the destruction of the neuromelanin-containing neurons in the substantia nigra, locus coeruleus, as well as the C1 and C3 medullary
10
Smythies
group (27). There is abundant evidence that free radical damage is involved. The normal substantia nigra has poor antioxidant defenses. The levels of vitamin E and glutathione are low (33,62,97) and levels of prooxidant free iron (2) and monoamine oxidase, a free radical generator (16), are high, as well as the neurotoxic prooxidant nitric acid radical (59). In Parkinson’s disease there are excess levels of glycolation (a sign of oxidative damage) in the substantia nigra and cortex (14). The intake of excessive levels of heavy metals including iron is a risk factor for Parkinson’s disease (31). In India the vegetarian Hindus have a much lower prevalence of Parkinson’s disease than the meat-eating Parsees (56). One source of iron in the diet is the heme from myoglobin. Iron adsorption is inhibited by the polyphenols present in spices of which the Hindus eat a large amount. In Parkinson’s disease the glia have raised levels of heme oxygenase–1. This enzyme catalyzes heme breakdown to biliverdin and produces CO and free iron as byproducts. Lewy bodies, which consist of cross-linked neurofilaments, also have greatly raised levels of this enzyme (76). There is also evidence of excess dopamine quinone formation (15,49), which correlates with the fact that the cells that are destroyed in the disease are those that contain neuromelanin, which is the end-product of dopamine quinone metabolism. Neuromelanin is normally neuroprotective as it chelates large amounts of toxic heavy metals. However, in excess it disrupts cellular function and leads to release of the iron contained in its neuromelanin and to death of the cell. Dihydroergocryptine may exert its therapeutic effect in Parkinson’s disease not by acting as a dopamine agonist but by scavenging free oxygen radicals (25) or nitrogen radicals (59). Moreover, the very low levels of glutathione (GSH) in the substantia nigra in the disease is not accompanied by any rise in oxidized glutathione (GSSH) levels, but with a rise in 5-cysteinyl dopamine levels instead. This suggests that the glutathione is being used up not as an antioxidant but to form complexes with neurotoxic dopamine quinones (33). Ben-Shachar et al. (3) have suggested that Parkinson’s disease is associated with damage to the mitochondrial electron chain brought about by free oxygen radicals and dopamine quinones. Itoh et al. (42) and Schapira et al. (75) report defective complex I function in this chain in the disease. As we have seen, nitric oxide is a powerful oxidant of dopamine. It may therefore be significant that astrocytes containing the isoform of nitric acid synthase are double the normal level in the substantia nigra in Parkinson’s disease (33). Thus, in summary, there is growing evidence that schizophrenia and Parkinson’s disease may be associated with increased oxidative stress, with decreased antioxidant defenses, and with abnormalities in the oxidative pathway of catecholamine metabolism.
Free Radicals and Synaptic Plasticity
11
REFERENCES 1.
2.
3. 4.
5. 6.
7.
8.
9. 10. 11.
12.
13.
14.
15.
Abdalla, D.S.P., Monterio, H.P., Oliveira, J.A.C., and Bechara, E.J.H. (1986) Activities of superoxide dismutase and glutathione peroxidase in schizophrenic and manic depressive patients. Clin. Chem. 32, 805–807. Ben-Shachar, D., Eshel, G., Riederer, P., and Youdim, M. (1992) Role of iron and iron chelation in dopaminergic-induced neurodegeneration: implications for Parkinson’s disease. Ann. Neurol. 32, S105–S110. Ben-Shachar, D., Zuk, R., and Glinka, Y. (1995) Dopamine neurotoxicity: inhibition of mitochondrial respiration. J. Neurochem. 64, 718–723. Berman, S.B., Zigmond, M.J., and Hastings, T.G. (1996) Modification of dopamine transporter function: effect of reactive oxygen species and dopamine. J. Neurochem. 67, 593–600. Bogerts, B. (1981) A brainstem atlas of catecholaminergic neurons in man, using melanin as a natural marker. J. Comp. Neurol. 197, 63–80. Boldyrev, A.A., Stvolinsky, S.L., Tyulina, O.V., Koshelev, V.B., Hori, N., and Carpenter, O. (1997) Biochemical and physiological evidence that carnosine is an endogenous neuroprotector against free radicals. Cell. Mol. Neurobiol. 17, 259– 271. Buckman, T.D., Kling, A.S., Eiduson, S., Sutphin, M.S., and Steinberg, A. (1987) Glutathione peroxidase and CT scan abnormalities in schizophrenia. Biol. Psychiatr. 22, 1349–1356. Buckman, T.D., Kling, A., Sutphin, M.S., Steinberg, A., and Eiduson, S. (1990) Platelet glutathione peroxidase and monoamine oxidase activity in schizophrenia with CT scan abnormalities: relation to psychosocial variables. Psychiatr. Res. 31, 1–14. Cadet, J.L., and Kahler, L.A. (1994) Free radical mechanisms in schizophrenia and tardive dyskinesia. Neurosci. Biobehav. Rev. 18, 457–467. Cadet, J.L., and Lohr, J.B. (1987) Free radicals and the developmental pathobiology of schizophrenic burnout. Integr. Psychiatry 51, 40–48. Cammack, J., Ghasemzadeh, B., and Adams, R.N. (1991) The pharmacological profile of glutamate-evoked ascorbic acid efflux measured by in vivo electrochemistry. Brain Res. 565, 17–21. Carlsson, A., Waters, N., and Hansson, L.O. (1994) Neurotransmitter aberrations in schizophrenia: new findings. In: R. Fog, J. Gerlach, R. Hemmingsen (eds.), Schizophrenia: An Integrated View. Copenhagen, Munksgard. Carstam, R., Brinck, C., Hindemith-Augustsson, A., Rorsman, H., and Rosengren, E. (1991) The neuromelanin of the human substantia nigra. Biochim. Biophys. Acta 1097, 152–160. Castellani, R., Smith, M.A., Richey, P.L., and Perry, G. (1996) Glycoxidation and oxidative stress in Parkinson’s disease and diffuse Lewy body disease. Brain Res. 737, 195–200. Cheng, F.-C., Ko, J.-S., Chia, L.-G., and Dryhurst, G. (1996) Elevated 5-Scysteinyldopamine/homovanillic acid ratio and reduced homovanillic acid in cerebrospinal fluid: possible markers for and potential insights into the pathobiology of Parkinson’s disease. J. Neur. Transm. 103, 433–446.
12
Smythies
16.
Cohen, G. (1986) Monoamine oxidase, hydrogen peroxide, and Parkinson’s disease. Adv. Neurol. 45, 119–125. Cohen, B.M., and Wan, W. (1995) The thalamus as a site of action of antipsychotic drugs. Am. J. Psychiatr. 153, 104–106. Cook, J.A., Wink, D.A., Blount, V., Krishna, M.C., and Hanbauer, I. (1996) Role of antioxidants in the nitric oxide-elicited inhibition of dopamine uptake in cultured mesencephalic neurons. Insights into potential mechanisms of nitric oxide-mediated neurotoxicity. Neurochem. Int. 28, 609–617. Costa, C., Bertazzo, A., Allegri, G., Toffano, G., Curcuruto, G., and Traldi, P. (1992) Melanin biosynthesis from dopamine: II. A mass spectrometric and collisional spectroscopic investigation. Pigment Cell Res. 5, 122–131. Coyle, J.T., and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disease. Science (Wash.) 262, 689–695. Cramer, K.S., and Sur, M. (1995) Activation-dependent remodeling of connections in the mammalian visual system. Curr. Opin. Neurobiol. 5, 106–111. Dubinsky, J.M., Kristal, B.S., and Elizondo-Furnier, M. (1995) An obligate role for oxygen in the early stages of glutamate-induced, delayed neuronal death. J. Neurosci. 15, 7071–7078. Dykens, J.A., Stern, A., and Trenker, E. (1987) Mechanism of kainate toxicity to cerebellar neurons in vitro is analogous to reperfusion tissue injury. J. Neurochem. 49, 1222–1228. Favit, A., Sortino, M.A., Aleppo, G., Scapagnini, U., and Canonico, P.L. (1993) Protection by dihydroergocryptine of glutamate-induced neurotoxicity. Pharmacol. Toxicol. 73, 224–228. Favit, A., Sortino, M.A., Aleppo, G., Scapagnini, U., and Canonico, P.L. (1995) The inhibition of peroxide formation as a possible substrate for the neuroprotective action of dihydroergocryptine. J. Neural Trans. Suppl. 45, 297–305. Floresco, S.B., Yang, C.R., Phillips, A.G., and Blaha, C.D. (1998) Basolateral amygdala stimulation evokes glutamate receptor–dependent dopamine efflux in the nucleus accumbens of the anesthetized rat. Eur. J. Neurosci. 10, 1241–1251. Gai, W-P., Geffen, L.B., and Denoroy, L. (1993) Loss of C1 and C3 epinephrinesynthesizing neurons in the medulla oblongata in Parkinson’s disease. Ann. Neurol. 33, 357–367. Garey, L.J., Ong, U.Y., Patel, T.S., Kanami, M., Davis, A., Hornstein, C., and Bauer, M. (1995) Reduction in dendritic spine number on cortical neurons in schizophrenia. Abst. Soc. Neurosci. 21, 236. Glanz, L.A., and Lewis, D.A. (1995) Assessment of spine density on layer III pyramidal cells in the prefrontal cortex of schizophrenic subjects. Abst. Soc. Neurosci. 21, 239. Goldman-Rakic, P.S., and Selemon, L.D. (1997) Functional and anatomical aspects of prefrontal pathology in schizophrenia. Schiz. Bull. 23, 437–458. Goldsmith, J.R., Herishanu, Y., Abarbanel, J.M., and Weinbaum, Z. (1990) Clustering of Parkinson’s disease points to environmental factors. Arch. Environ. Health 45, 88–94. Gozlan, H., and Ben-Ari, Y. (1995) NMDA receptor redox sites: are they targets for selective neuronal protection? Trends Pharm. Sci. 16, 368–374.
17. 18.
19.
20. 21. 22.
23.
24.
25.
26.
27.
28.
29.
30. 31.
32.
Free Radicals and Synaptic Plasticity 33.
34. 35. 36. 37.
38. 39. 40. 41. 42.
43. 44. 45. 46.
47.
48.
49.
50.
51.
13
Grasbon-Frodl, E.M., and Brundin, P. (1997) Mesencephalic neuron death induced by congenors of nitrogen monoxide is prevented by the lazaroid U 83836E. Exp. Brain Res. 113, 138–143. Grof, S. (1963) Clinical and experimental study of central effects of adrenochrome. J. Neuropsychiatr. 5, 33–50. Gru¨newald, R.A. (1993) Ascorbic acid in the brain. Brain Res. Rev. 18, 123– 133. Gutteridge, J.M.C. (1992) Ferrous iron detected in cerebrospinal fluid by using bleomycin and DNA damage. Clin. Sci. 82, 315–320. Han S.-K., Mytilineou, C., and Cohen, G. (1996) L-DOPA up-regulates glutathione and protects mesencephalic cultures against oxidative stress. J. Neurochem. 66, 501– 510. Hastings, T.G. (1995) Enzymatic oxidation of dopamine: the role of prostaglandin H synthase. J. Neurochem. 64, 919–924. Hawkins, D., and Pauling, L. Orthomolecular Psychiatry. Freeman, San Francisco, 1973. Hoffer, A., Osmond, H., and Smythies, J.R. (1953) Schizophrenia. A new approach. Part II. J. Ment. Sci. 100, 29–45. Horrobin, D.F. (1996) Schizophrenia as a membrane lipid disorder which is expressed throughout the body. Prostagland. Leukotr. Ess. Fatty Acids 55, 3–7. Itoh, K., Weis, S., Mehraein, P., and Mu¨ller-Ho¨cker, J. (1996) Cytochrome c oxidase deficits of the human substantia nigra in normal aging. Neurobiol. Aging 17, 843– 841. Kanofsky, J.D., Kay, S.R., Lindenmayer, J.P., and Seifter, E. (1989) Ascorbate: an adjunctive treatment for schizophrenia. J. Am. Coll. Nutr. 8, 425. Ko¨tter, R. (1994) Postsynaptic integration of glutamatergic and dopaminergic signals in the striatum. Prog. Neurobiol. 44, 163–196. Lafon-Cazal, M., Pietri, S., Culcasi, M., and Bockaert, J. (1993) NMDA-dependent superoxide production and neurotoxicity. Nature London 364, 535–537. Lew, J.Y., Matsumoto, Y., Pearson, J., Goldstein, M., Hokfelf, T., and Fuxe, K. (1997) Localization and characterization of phenolethanolamine N-methyl transferase in the brain in various mammalian species. Brain Res. 119, 199–210. Lieb, K., Andrae, J., Reisert, I., and Pilgrim, C. (1995) Neurotoxicity of dopamine and protective effects of the NMDA receptor antagonist AP-5 differ between male and female dopaminergic neurons. Exp. Neurol. 134, 222–229. Liu, J., and Mori, A. (1993) Monoamine metabolism provides an antioxidant defense in the brain against oxidant- and free radical–induced damage. Arch. Biochem. Biophys. 302, 118–127. Mattammal, M.B., Strong, R., Lakshmi, V.M., Chung H.D., and Stevenson, A.H. (1995) Prostaglandin H synthase-mediated metabolism of dopamine: implication for Parkinson’s disease. J. Neurochem. 64, 1645–1654. Matthews, S.B., Henderson, A.H., and Campbell, A.K. (1985) The adrenochrome pathway: the major route for adrenalin catabolism by polymorphonuclear leucocytes. J. Mol. Cell. Cardiol. 17, 339–348. Mefford, I., Oke, A., Keller, R., Adams, R.N., and Jonsson, G. (1978) Epinephrine distribution in human brain. Neurosci. Lett. 9, 227–231.
14
Smythies
52.
Melamed, Y., Sirota, P., Dicker, D.R., and Fishman, P. (1998) Superoxide anion production by neutrophils derived from peripheral blood of schizophrenic patients. Psychiatr. Res. 77, 29–34. Michel, P.P., and Hefti, F. (1990) Toxicity of 6-hydroxydopamine and dopamine for dopaminergic neurons in culture. J. Neurosci. Res. 26, 428–435. Milby, K.H., Mefford, I.N., Chey, W., and Adams, R.N. (1981) In vitro and in vivo depolarization coupled efflux of ascorbic acid in rat brain preparations. Br. Res. Bull. 7, 237–242. Mumby, S., Koizumi, M., Taniguchi, N., and Gutteridge, J.M.C. (1998) Reactive iron species in biological fluids activate the iron-sulphur cluster of aconitase. Biochim. Biophys. Acta 1380, 102–108. Muthane, U., Yasha, T.C., and Shankar, S.K. (1998) Low numbers and no loss of melanized nigral neurons with increasing age in normal human brains in India. Ann. Neurol. 43, 283–287. Nappi, A.J., and Vass, E. (1998) Hydroxyl radical formation resulting from the interaction of nitric oxide and hydrogen peroxide. Biochim. Biophys. Acta 1380, 55– 63. Nirenberg, M.J., Chan, J., Vaughan, R.A., Uhl, G.R., Kuhar, M.J., and Pickel, V.M. (1997) Immunogold localization of the dopamine transporter: an ultrastructural study of the rat ventral tegmental area. J. Neurosci. 17, 4037–4044. Nishibayshi, S., Asanuma, M., Kohno, M., Go´mez-Vargas, N., and Ogawa, N. (1996) Scavenging effects of dopamine agonists on nitric oxide radicals. J. Neurochem. 67, 2208–2211. Odh, G., Carstam, R., Paulson, J., Wittbjen, A., Rosengren, E., and Rorsman, H. (1994) J. Neurochem. 62, 2030–2036. Patel, M., Day, B.J., Crapo, J.D., Fridovich, I., and McNamara, J.O. (1996) Requirement for superoxide in excitotoxic cell death. Neuron 16, 345–355. Pearce, R.K.B., Owen, A., Daniel, S., Jenner, P., and Marsden, C.D. (1997) Alterations in the distribution of glutathione in the substantia nigra in Parkinson’s disease. J. Neural Trans. 104, 661–677. Phillipson, O.T., and Bohn, M.C. (1994) C1-C3 adrenergic medullary neurons project to the paraventicular thalamic nucleus in the rat. Neurosci. Lett. 176, 67–70. Pickel, V.M., Nirenberg, M.J., and Milner, T.A. (1997) Ultrastructural view of central catecholaminergic transmissions: immunochemical localization of synthesizing enzymes, transporters and receptors. J. Neurocytol. 25, 843–656. Quartz, S.R., and Sejnowski, T.J. (1997) The neural basis of cognitive development: a constructivist manifesto. Behav. Brain Sci. 20, 537–556. Rebec, G.V., and Pierce, R.C. (1994) A vitamin as neuromodulator: ascorbate release into the extracellular fluid of the brain regulates dopaminergic and glutamatergic transmission. Prog. Neurosci. 43, 537–565. Reddy, R.D., and Yao, J.K. (1996) Free radical pathology in schizophrenia: a review. Prost. Leuk. Ess. Fatty Acids 55, 33–43. Rice, M.E., and Russo-Menna, I. (1998) Differential compartmentalization of brain ascorbate and glutathione between neurons and glia. Neuroscience 82, 1213–1223. Rico, B., and Cavada, C. (1998) Adrenergic innervation of the monkey thalamus: an immunohistochemical study. Neuroscience 84, 839–847.
53. 54.
55.
56.
57.
58.
59.
60. 61. 62.
63. 64.
65. 66.
67. 68. 69.
Free Radicals and Synaptic Plasticity 70.
71. 72. 73. 74.
75.
76. 77. 78.
79.
80. 81.
82.
83.
84.
85.
86.
15
Roberts, R.C., Gauther, L.A., Peretti, F., Peretti, F.J., and Chute, D.J. (1995) Structural pathology in schizophrenia: a postmortem ultrastructural study. Abst. Soc. Neurosci. 21, 237. Rothman, S.M., and Olney, J.W. (1995) Excitotoxicity and the NMDA receptor— still lethal after eight years. TINS 18, 57–58. Sagara, Y., and Schubert, D. (1998) The activation of metabotropic receptors protects nerve cells from oxidative stress. J. Neurosci. 18, 6662–6671. Sampath, D., and Perez-Polo, R. (1997) Regulation of antioxidant enzyme expression by NGF. Neurochem. Res. 22, 351–362. Sassoe-Pognetto, M., Cantino, D., Panzanelli, P., di Cantogno, L.V., Giustetto, M., Margolis, F., de Biasi, L., and Fasolo, A. (1993) Presynaptic colocalization of carnosine and glutamate in olfactory neurons. Neuroreport 5, 7–10. Schapira, A.V.H., Mann, V.M., Cooper, J.M., Krige, D., Jenner, P.J., and Marsden, C.D. (1992) Mitochondrial function in Parkinson’s disease. Ann. Neurol. 32, S116– S124. Schipper, H.M., Liberman, A., and Stopa, E.G. (1996) Neural heme oxygenase-1 expression in idiopathic Parkinson’s disease. Exp. Neurol. 150, 60–68. Schultz, W. (1997) Dopamine neurons and their role in reward mechanisms. Curr. Op. Neurobiol. 7, 191–197. Schwartz, B.E., Sem-Jacobsen, C., and Petersen, M.C. (1956) Effects of mescaline, LSD-25 and adrenochrome on depths electrograms in man. Arch. Neurol. Psychiatr. 75, 579–587. Schwartz, B.E., Wakim, K.G., and Bickford, R. (1956) Behavioral and electroencephalographic effects of hallucinogenic drugs: changes in cats on intraventricular injection. Arch. Neurol. Psychiatr. 75, 83–90. Segal, M. (1995) Dendritic spines for neuroprotection: a hypothesis. TINS 18, 468– 471. Seitz, G., Gebhardt, S., Beck, J.F., Bo¨hm, W., Lode, H.N., Niethammer, D., and Bruchelt, G. (1998) Ascorbic acid stimulates DOPA synthesis and tyrosine hydroxylase gene expression in the human neuroblastoma cell line SK-N-SH. Neurosci. Lett. 244, 33–36. Selemon, L.D., Rajkowska, G., and Goldman-Rakic, P.S. (1998) Elevated neuronal density in prefrontal area 46 in brains from schizophrenic patients: application of a three-dimensional, stereological counting method. J. Comp. Neurol. 392, 402–412. Segura-Aguilar, J. (1996) Peroxidase activity of liver microsomal vitamin D 25hydrolase and cytochrome P450 1A2 catalyzes 25-hydroxylation of vitamin D3 and oxidation of dopamine to aminochrome. Biochem. Mol. Med. 58, 122–129. Segura-Aguilar, J., Metodiewa, D., and Welch, C. (1998) Metabolic activation of dopamine o-quinones to o-semiquinones by NADPH cytochrome P450 reductase may play an important role in oxidative stress and apoptotic effects. Biochim. Biophys. Acta 1381, 1–6. Segura-Aguilar, J., Baez, S., Widersten, M., Welch C.J., and Mannervik, B. (1997) Human class mu glutathione transferases, in particular isoenzymes M2-2, catalyze detoxification of the dopamine metabolite aminochrome. J. Biol. Chem. 272, 5727– 5731. Sesack, S.R., Hawrylak, V.A., Matus, C., Suido, M.A., and Levey, A.I. (1998) Dopa-
16
87. 88. 89a. 89b.
89c. 89d. 90. 91. 92. 93.
94. 95. 96.
97.
Smythies mine axon varicosities in the prelimbic division of the rat prefrontal cortex exhibit sparse immunoreactivity for the dopamine transporter. J. Neurosci. 18, 2697–2708. Smythies, J.R. (1996) On the function of neuromelanin. Proc. R. Soc. London B. 263, 487–489. Smythies, J.R. (1997) The biochemical basis of synaptic plasticity and neurocomputation: a new theory. Proc. R. Soc. Lond. B., 264, 575–579. Smythies, J.R. (1997) Oxidative reactions and schizophrenia: a review-discussion. Schiz. Res. 24, 357–364. Vanderwende, C., and Johnson, J. C. (1970). Interaction of serotonin with the catecholamines. I. Inhibition of dopamine and epinephrine oxidation. Biochem. Pharmacol. 19, 1991–2000. Galzigna, L., and Rizzoli, A. A. (1970). Short circuit theory on the onset of mental illness. Clin. Chim. Acta 30, 5–11. Smythies, J. R., Gottfries, C-G., and Regland, B. (1997). Disturbances of one-carbon metabolism in neuropsychiatric disorders: a review. Biol. Psychiat. 41, 230–233. Smythies, J.R. Every Person’s Guide to Antioxidants. New Brunswick, NJ, Rutgers University Press, 1999. Smythies, J.R., and Galzigna, L. (1998) The oxidative metabolism of catecholamines in the brain: a review. Biochim. Biophys. Acta 1380, 159–162. Solano, P. (1998) personal communication. Sullivan, E.V., Lim, K.O., Mathalon, D., Marsh, L., Beal, D.M., Harris, D., Hoff, A.L., Faustman, W.O., and Pfefferbaum, A. (1998) A profile of cortical grey matter volume deficits characteristic of schizophrenia. Cerebral Cortex 8, 117–124. Taubman, G., and Jantz, H. (1957) Untersuchung u¨ber die dem adrenochrom zugeschrieben psychotoxischen wirkungen. Nervenartz 28, 1957. Vulpian, M. (1856) C. R. Soc. Biol. 43, 223. Yao, J.K., and van Kammen, D.P. (1996) Incorporation of 3H-arachidonic acid into platelet phospholipids of patients with schizophrenia. Prostagland. Leuk. Essent. Fatty Acids, 55, 21–26. Zhang, F., and Dryhurst, G. (1994) Effects of l-cysteine on the oxidation chemistry of dopamine: new reaction pathways of potential relevance to idiopathic Parkinson’s disease. J. Med. Chem. 37, 1084–1098.
2 Neuromodulatory Effects of Nitric Oxide in Pain Perception Adalberto Merighi, Patrizia Aimar, and Laura Lossi University of Torino, Torino, Italy
Lucia Pasti and Giorgio Carmignoto Universita` degli Studi di Padova e Centro per lo Studio delle Biomembrani del CNR, Padova, Italy
I. NITRIC OXIDE IN THE CENTRAL NERVOUS SYSTEM The gas nitric oxide (NO) is a novel messenger in the nervous system that has revolutionized our way of thinking about neuronal transmission. According to our current view, two main types of signaling molecules are used by neurons to communicate with each other: these are the ‘‘classical’’ neurotransmitters, such as, for example, acetylcholine, glutamate, and γ-aminobutyric acid (GABA), and a number of biologically active small peptides. Both are packaged and released from synaptic vesicles, albeit of different types; their spatial signaling is, in general terms, restricted to synaptic sites* where they bind to transmembrane receptors. The action of neurotransmitters is usually concluded with the crucial contribution of uptake pumps or by inactivation carried out by specific enzymes. NO is an unconventional transmitter as it is not packaged in vesicles and it can cross cell membranes rapidly, diffusing from the site of production in the absence of any specialized release machinery (2). Therefore, NO signaling is not restricted to defined synapses; rather it diffuses through cell membranes, being able to bind and influence numerous protein targets. Since NO cannot be stored and released by the cell, it is generated when needed by a complex family of nitric oxide
* Neuroactive peptides can also be released at nonsynaptic sites by simple exocytosis (1).
17
18
Merighi et al.
synthase (NOS) enzymes. Moreover, it cannot be inactivated by conventional mechanisms and is therefore regulated at the level of biosynthesis. A thorough description of the NO biosynthetic pathway is beyond the purpose of this chapter. Nevertheless to put our work in perspective we will briefly summarize the state of the art on the biochemistry and pharmacology of NOS. Further details on this matter are easily found in a number of recent reviews (see, for example, Refs. 2–8). A.
Biochemistry Nitric Oxide Synthase
Since the first reports on mammalian NO synthesis (9,10) knowledge about NO biosynthesis has increased rapidly. In all tissue studied so far, NO is generated by nitric oxide synthase (NOS), together with l-citrulline, from one of the guanidino nitrogens of the amino acid l-arginine, in the presence of molecular oxygen (Fig. 1). There is actually a family of NO synthases that constitute a rather complex
Figure 1 Mechanism of production of NO at synapses. NO is generated from l-arginine by nNOS. NOS requires molecular oxygen and a number of cofactors including calmodulin (CaM), flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), heme and tetrahydrobiopteridin (H4B). The enzyme can be phosphorylated at different sites (P). nNOS is tethered to the postsynaptic density by a postsynaptic density protein (PSD-95). Activation of nNOS requires a rise in intracellular Ca2⫹ which is initially fluxed into the cell through the NMDA receptor channel. Increase in intracellular Ca2⫹ can also follow the opening of Ca2⫹ voltage-dependent channels or release from intracellular stores. Newly synthesized NO can then diffuse from the site of production and influence nearby synapses by crossing cell membranes.
Nitric Oxide and Pain Perception
19
enzymatic system. Their cofactors include flavins, NADPH, and tetrahydrobioptherin (4). So far, three distinct NOS isoforms have been purified, cloned, and biochemically characterized (see, for example, Refs. 2, 4–7). Two of them, the neuronal and endothelial NOS, are constitutively expressed and regulated by the intracellular concentration of free Ca2⫹; the third one is a Ca2⫹-independent enzyme that is cytokine-inducible in macrophages and many other cells. Neuronal NOS (nNOS)* is a Ca2⫹ /calmodulin-dependent enzyme first purified to homogeneity from rat cerebellum (11). The pure protein appeared as a single 150-kDa band on sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDSPAGE) gels, and the molecular mass of the native enzyme was estimated as 200 kDa in monomeric conformation. The results obtained so far suggest that nNOS is a soluble enzyme that converts l-arginine to l-citrulline and NO, and presumably represents a homodimer with subunit molecular mass of 150 kDa (7). A similar protein has been isolated from Triton X-100 solubilized particulate fractions of rat cerebellum, suggesting that the enzyme may be also associated with membranes (12). Therefore, nNOS may be loosely associated with membranes and likely becomes solubilized to variable degrees upon tissue homogenization. This is in keeping with a number of histochemical studies on the subcellular localization of NADPH diaphorase (NADPH-d) activity (see next section) (13). The amino terminus of nNOS encodes a postsynaptic density zone (PDZ) protein motif (14). PDZ domains are molecular protein motifs implicated in N-methyl-d-aspartate (NMDA) receptor–mediated signal transduction in neurons and other cell types (15,16). The PDZ domain of nNOS tethers the synthase to protein complex at postsynaptic densities (17). The endothelial NOS (eNOS) has been initially characterized from soluble fractions of endothelial cells (10,18). Later it became apparent that the enzyme is predominantly localized in KCI-insoluble membrane fractions (19). The enzyme has a molecular mass of 135 kDa on SDS-PAGE gels. It also requires Ca2⫹ / calmodulin for activity. eNOS is about 60% identical to the neuronal isoenzyme after molecular cloning (8). Inducible NOS (iNOS) has been widely characterized in activated macrophages, but expression of this NOS isoform is induced by cytokines in several mammalian cells, including brain microglia (see next section), thus suggesting an important role of iNOS in neurotoxicity (20). Once made, this inducible enzyme continues to form large amounts of NO for many hours. The native enzyme is a dimer of two subunits of 130–150 kDa. Enzyme activity is Ca2⫹-independent. * The constitutive NOS isoenzyme that is found in the nervous tissue is commonly referred to as either neuronal or brain NOS. Although the term neuronal NOS might not be fully appropriated, since the enzyme is likely to be present also in glial cells, we will use it throughout the text for the sake of simplicity.
20
Merighi et al.
Macrophage NOS contains a consensus site for calmodulin binding similar to the motif found in the neuronal enzyme sequence (21). iNOS tightly binds calmodulin as a subunit (22), indicating that all NOS isoforms require bound calmodulin for activity. Therefore, only the constitutive neuronal and endothelial isoforms require micromolar concentrations of free Ca2⫹ for calmodulin binding, while binding of calmodulin to iNOS is Ca2⫹ independent. NO formation in the nervous system is primarily regulated through intracellular Ca2⫹ concentration. Nevertheless several additional mechanisms may contribute to the modulation of NO-mediated cellular signaling. These include substrate (l-arginine) and cofactor (tetrahydrobiopteridin) availability, phosphorylation of NOS, feedback inhibition by NO, and de novo synthesis of the NOS protein (for review, see Ref. 8.) Although the content of free l-arginine in total brain extracts should be sufficient to saturate brain NOS, several experimental reports demonstrated a number of biological effects of exogenous l-arginine, among which are alteration of nociceptive processing (23), release of dopamine from rat striatal slices (24), inhibition of NMDA-mediated cGMP accumulation in the rat cerebellum (25). On the other hand, l-arginine deficiency decreases the rate of NO formation but also is responsible of the generation of superoxide anions and hydrogen peroxide. Superoxide rapidly combines with NO to form peroxynitrite, which is toxic to the cell (26). Studies on several different cell types, including fibroblasts, macrophages, smooth muscle cells, endothelial cells, and tumor cells, have clearly demonstrated that NO release from intact cells is dependent on the levels of tetrahydrobiopteridin. The existence of such a relationship in neuronal cells is at present unknown (8). The functional consequences of NOS phosphorylation on NO levels are still a matter of debate. Several investigators agree that the activity of purified NOS is not affected after cAMP- or cGMP-dependent protein kinase (PK) phosphorylation, but the effects of PKC are controversial. Nonetheless, studies on intact cells indicate an involvement of PKC in the regulation of NO synthesis (8). Such a relationship might be of interest in the view of the observed reduction of neuropathic pain in mice lacking PKC-γ (27). A number of reports suggest that NOS is inhibited by its reaction product NO (8). This is of clinical relevance considering the possible therapeutic potential of administration of different NO donors. However, it must be pointed out that the studies supporting feedback inhibition of NOS have been performed with very high concentrations of added NO donors, which may be responsible for noncharacterized unspecific effects. Finally, several reports indicate that the synthesis of constitutive NOSs is also under transcriptional control, particularly during development (28), and in
Nitric Oxide and Pain Perception
21
numerous pathophysiological conditions including nerve injury (29). The functional significance of these changes is still poorly understood. B.
Distribution and Cellular Localization of NOS in the Central Nervous System
Since NO is a highly reactive unstable species our knowledge on the distribution of the cells that use this signaling molecule throughout the nervous system relies on the possibility of localizing NOS, the key enzyme in NO synthesis, in tissue sections. The purification and cloning of the various NOSs allowed for the development of antibodies and nucleic acid probes that have, in turn, permitted the immunocytochemical mapping of NOS and the localization in situ of the NOS mRNA. Moreover, the redox activity of NOS accounted for the histochemical NADPH-d reaction in aldehyde-fixed tissues (30,31). Accordingly, in several areas of the brain a one-to-one correspondence between neurons expressing NOS mRNA or NOS immunoreactivity and those showing NADPH-d positivity was found (30,32). Moreover, the recent demonstration that after knocking out the NOS gene there is a complete loss of NADPH-d activity in the nervous system provided definitive evidence for the correspondence of NADPH-d and NOS activities (33). A comparative evaluation of the different methods so far employed for localizing NO-producing neurons is beyond the purpose of this work. The issue has recently been reviewed in details and readers are referred to the literature on this matter (34). In the nervous system NOS is mainly localized in neurons. NOS is present in several regions of the mammalian brain including the telencephalon, diencephalon, midbrain, pons, medulla, cerebellum, and spinal cord (for review, see Ref. 34). Different neuronal types were found to contain NOS, sometimes associated with other signaling molecules in these locations. Being relevant to our work, we will briefly review the data on spinal cord localization (Figs. 2 and 3). Several investigators have described the distribution of NOS-containing neurons in the rat, mouse, cat, and primate. Positive neurons are concentrated in the dorsal horn (laminae I–IV) and the central gray matter (lamina X) at all segmental levels (35,36). Moreover, in all species studied so far, the cholinergic preganglionic autonomic neurons in the intermediolateral cell columns of the thoracic spinal cord are highly positive after either NOS immunocytochemistry or NADPH-d staining, as well as most sacral parasympathetic preganglionic neurons (35). In the human spinal cord some ventral horn motor neurons are also NOS-immunoreactive (37). Many of the NADPH-d positive neurons in the dorsal horn are also GABA- and glycine-immunoreactive (38). The outer lamina II (lamina IIo) is particularly rich of NOS-containing neuronal processes. The major contribution to neuropil staining in lamina II of rats appears to be related to projection fibers
22
Merighi et al.
Figure 2 Distribution of NADPH-d-positive neurons in the spinal cord. Positive neurons and processes are evident in the superficial dorsal horn (A), the gray matter surrounding the central canal (B), and deep laminae of the dorsal horn (C). wm, white matter. Roman numerals indicate the laminae of the dorsal horn. Scale bars: A ⫽ 50 µm; B ⫽ 100 µm; C ⫽ 10 µm.
as well as processes from local circuit neurons (35). However, some staining may arise from primary afferents at least at the thoracic and lumbar levels (39). In other species, such as cats and humans, the contribution from primary afferents to neuropil staining in the dorsal horn might be more substantial (36,40). As mentioned in the previous section, after biochemical analysis both a soluble and a membrane-bound insoluble fraction of NOS were found in the brain. We have recently demonstrated that the use of different tetrazolium salts for the histochemical localization of NADPH-d yields different subcellular localization of positive reaction sites (41) (Fig. 4). When observed in the electron microscope, nitroblue tetrazolium (NBT) formazan deposits were scattered throughout the neuronal cell body and processes without any preferential association with cell organelles. In keeping, those who have used NOS immunocytochemistry have not been able to observe a specific association with any subcellular organelle or membrane
Nitric Oxide and Pain Perception
23
Figure 3 Distribution of nNOS-immunoreactive neurons and nNOS mRNA in the spinal cord. nNOS-immunoreactive neurons in lamina IV (A) and X (B) after immunolabeling with a specific monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Neurons expressing the nNOS mRNA in lamina II (C) and III (D). Arrows in C indicate the sites of mRNA accumulation. In situ hybridization of nNOS mRNA was performed using a pool of three 45-mer antisense oligonucleotides complementary to nucleotides 211– 266, 795–840, and 4712–4757 of the cloned cDNA, end-labeled with digoxigeninated11-dUTP. Scale bars: A, C, D ⫽ 25 µm; B ⫽ 50 µm.
(42). On the other hand, when we have used 2-(2′-benzothiazolyl)-5-styryl-3-(4′phthalhydrazidyl)tetrazolium chloride (BSPT) as a chromagen, enzyme activity appeared to be localized to the rough endoplasmic reticulum, mitochondria, and nuclear membranes, as previously observed in some other areas of the brain (43– 45). Therefore, it seems reasonable to assume that both a membrane-bound and a cytosolic fraction of the enzyme exist in neurons in keeping with the already discussed results obtained after biochemical characterization of tissue homogenates. Although nNOS was originally regarded as being constitutively expressed solely in neurons, there is increasing evidence that astrocytes also contain a con-
24
Merighi et al.
Figure 4 Ultrastructural visualization of NADPH-d-positive neurons. The diaphorase reaction can be revealed by using different chromagens such as NBT, which gives a floccular reaction product uniformly distributed with the cytoplasm of positive cells (A). When BSPT is used, the formazan deposits are clearly localized to the membrane of several cell organelles (B), including the endoplasmic reticulum (insert). Scale bars: A, B ⫽ 1 µm; insert ⫽ 0.5 µm.
stitutive, calcium-activated NOS (for review, see Ref. 46). Astrocytes are intimately associated with blood vessels and neurons, and it is now widely recognized that they have a role not only in development and response to injury, but also in normal cell-to-cell signaling (47). Although most of the studies on the localization of NOS in the central nervous system suggested that its distribution was entirely neuronal (see above), the immunocytochemical localization of larginine revealed a predominantly astrocytic distribution (48). Moreover, immunocytochemical labeling in the cerebellum besides the neurons revealed a positive reaction over several nonneuronal types including the Bergmann glia and astrocytes (49). Furthermore, NADPH-d was found to colocalize with NOS in both neuronal and glial cells, and a nonneuronal expression of NADPH-d was also reported in the perivascular glia (45). At the electronic level it appeared that NADPH-d activity is highly concentrated in neurons and endothelial cells (41,45). We have been unable to detect any glial staining after ultrastructural
Nitric Oxide and Pain Perception
25
NADPH-d staining (41), but it was previously claimed that enzyme activity was ubiquitously distributed in all cells of the central nervous system, albeit at lower concentration than in neurons and endothelial cells (45). As to the localization of iNOS, it was mainly described in microglial cells (for review, see Ref. 46). Once induced, this NOS isoform is continually active over a period of hours. Generally NO production by the microglia requires transcription and translation, and needs l-arginine and NADPH, but not Ca2⫹ and calmodulin. Evidence has also been provided for the existence of iNOS in astrocytes in vitro (20,50,51). The astrocyte iNOS cDNA has also been cloned and appeared to share 91% sequence homology with mouse macrophage enzyme (20). In vitro studies suggested that a single astrocyte is likely to produce less NO than a single microglial cell, but since astrocytes are by far more numerous than microglia, their contribution could be substantial (46). C.
Synaptic Signaling by NO
Although NO was first identified as the endothelium-derived relaxing factor, it is now clear that the brain is the primary source of NO in the body. Peripherally NO often acts like a classical neurotransmitter. In the intestine nNOS is concentrated in axon varicosities of certain mysenteric neurons (52). The enzyme is then activated by Ca2⫹ influx through N-type channels via calmodulin (53). Newly synthesized NO diffuses to adjacent smooth muscle where it causes relaxation. Mutant mice deficient in NOS display severe intestinal dysfunction and a hypertrophic stomach (33,53). The function of NO in the central nervous system is still not completely understood. Again several excellent reviews of the literature have recently been published on this issue (2,4,17,54,55) and we will briefly summarize here only the most relevant findings to our work. A fundamental event that is at the basis of NO actions in the brain is the functional connection of NOS with NMDA glutamate receptors. The NMDA receptor channels are a rather unique class of glutamate receptor channels that usually require depolarization to flux Ca2⫹ into the cell. As discussed previously, nNOS is a Ca2⫹ /calmodulin-dependent enzyme and is therefore regulated by the concentration of intracellular Ca2⫹. In the brain, NOS is functionally coupled to Ca2⫹ influx through NMDA glutamate receptors, being poorly linked to other Ca2⫹ pools (5). Thus, NO function in synaptic transmission is directly associated with the NMDA receptor channel. By modulating the current flow through this particular channel NO can influence a number of calcium-regulated processes, such as synaptic transmission, plasticity, neurotoxicity, and some developmental events. When the NMDA receptor channel is open, the resulting entry of Ca2⫹ into the cells activates the NOS leading to production of NO and subsequent reduction of NMDA currents (2). Reduction of NMDA currents by NO may be of significance for several processes involving the NMDA receptor. However, at
26
Merighi et al.
present, it appears to be essentially a feedback inhibition mechanism, since the NMDA receptor must first be activated, to flux Ca2⫹ into the cell and activating the NOS, before the currents are reduced (2). The mechanism for selective coupling of nNOS to Ca2⫹ influx through the NMDA receptors apparently involves the targeting of nNOS to the postsynaptic density (56). As previously mentioned, the amino terminal PDZ domain of nNOS specifically links the enzyme to synaptic membranes (14). Once activated, the synthase produces NO, whose major action is to stimulate soluble guanylate cyclase and thereby raise cGMP levels in target structures (2,4). Since endogenously generated NO is an unstable free radical species that readily crosses cell membranes, a very important question regarding its action in the brain regards the limits of its the sphere of influence. The inherent instability of NO, which has a half-life of about 3 s when perfused in oxygenated saline solution, is thought to reflect mainly its reactivity with oxygen and superoxide ions. An important feature of NO is its high rate of diffusion. In model systems, it has been estimated that the concentration of NO, even as far as 10 µm away from its site of generation, reach virtual steady state within a few hundred milliseconds (4). Therefore, the lability of NO does not appreciably influence its concentration within a relatively large three-dimensional space: a sphere of 10 µm radius. A variety of functions for this novel messenger in the central nervous system have emerged in the recent past, and ongoing research is still adding new information about the role of NO in brain function. NO has been implicated in several different processes including modulation of transmitter release, neurotoxicity, and neurodegeneration; long-term potentiation and depression; animal learning; regulation of cerebral circulation; and, most relevant to the present issue, pain perception and hyperalgesia (2,4).
II. NOCICEPTIVE PATHWAYS IN THE SPINAL DORSAL HORN The somatosensory system is concerned with general sensation throughout the body, as opposed to specific senses, such as vision, hearing, olfaction, and taste for which specific end-organs have developed. Nociceptive pathways are activated by a subset of sensory receptors (nociceptors) that provide information about tissue damage. Under different conditions, activation of nociceptive pathways leads to the perception of pain (see Sec. III.A). We will briefly discuss here the anatomical and neurochemical organization of nociceptive pathways in the spinal dorsal horn (further details can be found, for example, in Refs. 57–60).
Nitric Oxide and Pain Perception
A.
27
Distribution and Connectivity of Nociceptive Fibers in the Dorsal Horn
According to their morphology and physiology, primary afferent nociceptive fibers in the dorsal horn are of two categories: the Aδ and the C fibers. Both originate from small type B neurons in the dorsal root ganglia (DRG) (61). These cells give raise to centrally directed small sized unmyelinated (C) and/or scarcely myelinated (Aδ) processes that normally reach the cord via the dorsal roots, although unmyelinated fibers originating from the DRGs are present in the ventral roots as well (see Ref. 59). Aδ fibers, mediating input from high-threshold mechanoceptors, some thermal receptors and down hairs, and C fibers from cutaneous nociceptors enter ther cord via a lateral division (62). Unmyelinated primary afferent may also reach the spinal gray matter by crossing the Lissauer’s tract and the dorsal part of the lateral funiculus (63). The pattern of termination is mainly ipsilateral, although the presence of contralateral projections has been reported by several investigators. Aδ and C fibers have longitudinal projections extending along several consecutive segments of the cord (see Ref. 59). Tract tracing studies with appropriate tracers have demonstrated the existence of preferential laminar termination for different types of afferents. Aδ fibers innervating down hair terminate in lamina III and the inner portion of lamina II (lamina IIi ), whereas Aδ nociceptive fibers terminate in lamina I, the outer portion of lamina II (lamina II0), lamina V and the region around the central canal (lamina X) (see, for example, Refs. 64–67). Cutaneous C fibers terminate in laminae I and II0 (68,69). Three main types of primary afferent terminal configurations have been described in the superficial dorsal horn. These are the central terminals of type I and type II glomeruli, usually referred to as C1 and C2, respectively, which have different and peculiar ultrastructural and neurochemical features, and a third nonglomerular type particularly enriched of peptide-containing large dense-cored vesicles (LGVs). It is now clearly demonstrated that C1 and C2 terminals originate from C and Aδ fibers, respectively (191).
B.
The Substantia Gelatinosa
As evident from the previous section, the lamina II of the dorsal horn, which is commonly referred to as the substantia gelatinosa of Rolando, receives a major input from primary afferents of both the Aδ and C types. Indeed, the substantia gelatinosa is the principal site of integration of nociceptive primary afferent input to the dorsal horn (see, for example, Refs. 59,70,71). Cajal was the first to describe two main neuronal types in the gelatinosa that were originally referred to as central cells and limiting cells. Later work
28
Merighi et al.
confirmed the existence of two distinct cell populations in this area of the dorsal horn, and after ultrastructural analysis Gobel classified these two major cell types as stalked cells and islet cells, on the basis of the morphology of their dendritic trees and differences in their synaptology (72). Subsequent work has confirmed that additional subtypes can be found and several other classifications have been proposed, although Gobel’s subdivision of the gelatinosa cells still remains the most widely accepted (see Ref. 59 for review). Most of the cells in the gelatinosa are short-axoned Golgi type II neurons, their axons are unmyelinated, and the terminal arbors are confined to this same lamina (72,73). Nevertheless, the existence of some neurons sending their axons outside the gelatinosa has been reported by several authors (74–76).
C.
Neurotransmitters and Modulators of Nociceptive Pathways in the Dorsal Horn
1.
Amino Acids
Glutamate was one of the first neurotransmitters proposed for primary afferent fibers (77,78). Nowadays the role of this amino acid as a major excitatory neurotransmitter in the spinal cord and throughout the central nervous system is fully established. The evidence that primary afferent fibers use glutamate as a neurotransmitter was initially obtained after uptake studies following ligation or section of the dorsal roots (79,80). Further evidence came from physiological and pharmacological studies based on iontophoretic administration of the amino acid and/ or its antagonists (81–84). Later, the availability of antisera against amino acid fixed in tissue sections has made possible the visualization of glutamate and other amino acids in specific neurons and pathways that use them as neurotransmitters (85,86). Immunocytochemical studies at the light level revealed that glutamate is mainly detected in large type A neurons but also, to a lesser extent, in small type B cells within the DRGs, and in a rich plexus of fibers in the superficial laminae of the dorsal horn (58,87). At the ultrastructural level, glutamate immunostaining was localized in numerous neuronal profiles within the dorsal horn (88–90). Glutamate-positive C1 and C2 terminals often formed the core of type I and II glomeruli, but immunoreactive terminals were also detected in simple nonglomerular axodendritic configurations (91). At the subcellular level staining appeared to be selectively localized to small, clear, round, synaptic vesicles (90,91). More recently, after the dissection of the pharmacology and molecular biology of the glutamate receptor complex, the spinal cord distribution of the inotropic and metabotropic receptor subtypes has been thoroughly analyzed and resulted in being consistent with the postulated role of glutamate as the major transmitter of primary afferent fibers (92,93).
Nitric Oxide and Pain Perception
29
Aspartate has also been implicated as a putative neurotransmitter for primary afferent fibers after lesion and release studies (58). Moreover, biochemical studies indicated that aspartate may be released from dorsal root fibers, and this possibility is of significance, as aspartate is a selective agonist of the NMDA receptor (94,95). Ultrastructural studies revealed enrichment of aspartate, though to a lesser degree than glutamate, in central glomerular terminals (90,91). GABA and glycine are two major inhibitory transmitter amino acids that are found in the superficial dorsal horn (for review, see Ref. 96). The neuronal cells and processes containing GABA were first identified in the dorsal horn using antisera raised against glutamate decarboxylase (GAD), the key enzyme in the GABA biosynthetic pathway, and ended up being concentrated in terminals scattered within laminae I–III of the rat dorsal horn. Initially, GAD-immunoreactive neurons were reported to be among the largest cells of laminae I–III and were tentatively identified as stalked cells (97,98). More recently, the use of antisera directed against the conjugated amino acid allowed for a more precise dissection of the distribution of GABAergic neurons in the central nervous system. In keeping with findings after GAD immunostaining, GABA-immunopositive neuronal cell bodies were detected in laminae I–III. However, after combined Golgi and immunocytochemical labeling, most of the GABA-immunoreactive cells in lamina II were identified as islet cells (99). On the basis of these studies it was concluded that stalked cells are not GABAergic and that there were two neurochemically distinct populations of islet cells; large islet cells, which were consistently GABA-immunoreactive, and smaller unreactive cells (75,99). Subsequent work indicated that GABA can coexist with glycine in some islet cells (100). As already mentioned in a previous section, some of these cells might also contain NOS. At the ultrastructural level GABAergic axon terminals within laminae I– III were often seen at the periphery of synaptic glomeruli, mainly of the type I (101). Glycine is mainly concentrated in lamina III and deeper of the dorsal horn (101–103). 2. Peptides Biologically active peptides are highly concentrated in the superficial dorsal horn, their sources being neurons in the DRGs, intrinsic spinal neurons, or nerve cells in supraspinal centers. A massive number of immunocytochemical studies in the last decade provided a detailed mapping of the distribution of a number of peptides in the spinal cord (see, for example, Refs. 57, 58, 96, 104). We will restrict our discussion to the tachykinins and the calcitonin gene–related peptide (CGRP), which are directly implicated in nociceptive processing and most relevant to the present work (Figs. 5 and 6) The tachykinins are a family of structurally related peptides derived from
30
Merighi et al.
Figure 5 Immunocytochemical labeling of peptides in primary afferent fibers. Primary afferents in the dorsal horn have been traced using horseradish peroxidase (HRP) and subsequently labeled for substance P and CGRP (see Ref. 109). A. Fine-caliber C fiber with two varicosities (curved arrows) containing immunoreactive large, dense-cored vesicles (insert). B. primary afferent terminal filled with small clear synaptic vesicles (sv) and a number of immunoreactive large dense-cored vesicles (curved arrows). These latter are shown at higher magnification in the insert. d, dendrite; sv, synaptic vesicles. Substance P ⫽ 10-nm gold particles (arrows); CGRP ⫽ 20-nm gold particles (arrowheads). Scale bars: A, B ⫽ 0.5 µm. Inserts ⫽ 0.1 µm.
two precursor proteins, preprotachykinin I and II (105). The most widely known member of the family is substance P, an 11-amino-acid peptide, which as been implicated in pain neurotransmission since the early 1950s (106). Other members of the family include neurokinin A, neurokinin B, and neuropeptide K (105). Numerous substance P–immunoreactive* fibers and cell bodies are present within laminae I–III of the spinal cord in rat and several other mammals, including humans (see, for review, Refs. 58, 96, 104). Fibers are mainly concentrated in * In the spinal cord many histochemical studies have been carried out using antisera to substance P, although many of these antisera showed significant cross-reactivity with other tachykinins.
Nitric Oxide and Pain Perception
31
Figure 6 Interactions of peptides and glutamate at synapses between primary afferent endings and dorsal horn nociceptive neurons. Primary afferent nociceptive fibers release a number of peptides (CGRP, neurokinin A, and substance P) and excitatory amino acids (aspartate, glutamate). Peptides are costored in large dense-cored vesicles and are released together upon stimulation. Excitatory amino acids are stored in small agranular synaptic vesicles, and according to the pattern of stimulation may be released independently from peptides. All of these bioactive molecules act at specific receptors that are located at postsynaptic neurons. These include the NK1 tachykinin receptor and the NMDA and AMPA subtypes of glutamate receptors. Postsynaptic neurons also express the NK2 tachykinin receptor (not shown). The localization of the CGRP receptor is presumptive. There is evidence for a presynaptic localization of NK1 and CGRP receptors. Presynaptic CGRP receptors are likely involved in the potentiating effect of this peptide on the release of substance P. Alternatively, or in addition, CGRP potentiates the action of substance P by inactivating the substance P endopeptidase that is present at the synaptic cleft. For the sake of simplicity all receptors have been shown at a single postsynaptic element. However, it is possible that specific subsets of dorsal horn neurons selectively express the tachykinin or the glutamate receptor types.
lamina I and lamina IIo, while they are less abundant in lamina IIi and even fewer in lamina III. Most of the tachykinin-immunoreactive fibers in the dorsal horn are primary afferents (57), although the existence of immunoreactive cell bodies in laminae I–III is widely recognized (see, for example, Refs. 60, 97, 107, 108). The distribution of substance P (and CGRP; see below) immunoreactivity in the dorsal horn has been extensively studied at the ultrastructural level by several laboratories, including ours (88,90,109,110). Substance P immunostaining was
32
Merighi et al.
mainly detected in axonal varicosities of laminae I–IIo, which sometimes formed the central boutons (C1) of type I synaptic glomeruli. At the cellular level immunoreactivity was restricted to LGVs within positive terminals (Fig. 5). Three different G-protein–coupled receptors, named NK1 NK2, and NK3, have been so far described in mammals with maximal affinity for substance P, neurokinin A, and neurokinin B, respectively (for review, see Ref. 111). The cloning of the NK1 receptor (112) with subsequent production of specific antibodies (113), and the development of specific nonpeptide antagonists (114), added further information to our knowledge of the role of substance P in nociception. The NK1 substance P receptor and its mRNA are widely distributed throughout the central nervous system (113,115,116–119). In the spinal cord, the receptor is present in numerous neuronal processes in lamina I–IIo . Immunoreactive cell bodies are mainly localized in lamina I and III, with only a few being detected in the substantia gelatinosa. Double immunocytochemical labeling showed a lack of correlation in the distribution of the receptor and its ligand, particularly in lamina II (117,120–122). Indeed, although direct contacts between substance P–immunoreactive terminals and NK1-positive processes could be found in the gelatinosa (123), they were rare and, after quantitative examination, did not exceed 15% of the profiles analyzed (122). Over the past years, several lines of evidence have implicated substance P as a, if not the, neurotransmitter of pain. Besides to its distribution in primary afferents of the Aδ and C types, which, as previously discussed, are directly involved in the processing of nociceptive information (124–126), substance P is released at central endings in the spinal cord after activation of nociceptive primary afferents (127) and depolarizes spinal cord neurons which are excited by noxious stimuli (128,129). Moreover, in hyperalgesic conditions (see Sec. III.A) the spinal release of substance P is increased and NK1 receptors are activated (70,130,131). Finally, blocking of the NK1 receptors with specific antagonists greatly attenuates experimental hyperalgesia in rats (132,133). More recently, mice with targeted mutations deleting the preprotachykinin gene I, which is responsible for production, among others, of substance P and neurokinin A, and the NK1 receptor have been generated (134–136). Although still incomplete, the characterization of phenotypic and behavioral changes in these mice indicates that substance P has a major role in pain transmission but is not the sole pain neurotransmitter (for review, see Ref. 137). CGRP is a 37-amino-acid peptide produced by tissue-specific alternative processing of the primary transcript of the calcitonin gene (138,139). In rats and humans two main forms of CGRP have been identified, derived from related α and β genes (140–142). CGRP is widely distributed in the central and peripheral nervous system (29,143,144) and is particularly abundant in sensory pathways, where the predominant form is αCGRP (140). The distribution of CGRP in the somatosensory system shows remarkable similarities to that of substance P, and
Nitric Oxide and Pain Perception
33
indeed the two peptides are often colocalized in DRG neurons (145–147), peripheral sensory nerves supplying the blood vessels (148,149), and central projections to the spinal cord (90,150). It is noteworthy to remember here that the percentage of CGRP-immunoreactive neurons in the DRG (around 60%) greatly overcomes that of substance P–positive cells (151) and that in most mammals there are not immunopositive neurons in the dorsal horn (see Ref. 152), neither CGRPimmunoreactive descending fibers in the spinal cord (see, for example, Refs. 57 and 145). Therefore, CGRP is commonly regarded as a reliable marker of primary sensory afferents in the superficial laminae of the spinal cord. The ultrastructural distribution of CGRP-immunopositive nerve profiles in the dorsal horn has been extensively studied in our laboratory, with particular emphasis on the colocalization with substance P (90,109,150). The two neuropeptides are often costored within LGVs in immunopositive terminals (Figs. 5 and 6). Multiple labeling experiments demonstrated the coexistence of CGRP/substance P double-labeled LGVs and glutamate-immunoreactive synaptic vesicles in single axonal varicosities and terminals within the substantia gelatinosa (90). CGRP receptors have been studied in humans and rats, and are widely distributed in the nervous system, the cardiovascular system, and several other nonnervous tissues and organs (144). Two types of CGRP receptors have been described: the CGRP type 1 receptor is highly sensitive to the antagonistic properties of CGRP8–37, while the CGRP type 2 receptor is not (153). The intact CGRP receptor is a 66,000-kDa protein consisting of a solitary subunit. It appears to be a metabotropic receptor coupled to G proteins. The receptor has been tentatively cloned, but the results obtained so far are puzzling. Indeed, the distribution of the cloned receptors is not fully compatible with the demonstrated binding sites for CGRP and the known biological functions of the peptide (144). Binding studies with radioactive ligands have demonstrated that CGRP receptors in the central nervous system are mainly concentrated in the cerebellum, immediately followed by the substantia gelatinosa (153,154). The peripheral actions of CGRP are widely characterized and appear to be mainly linked to its synergistic role together with substance P in neurogenic inflammation (for review, see Ref. 144). On the other hand, the central effects of CGRP in the dorsal horn are not fully understood. It is generally agreed that the peptide has an excitatory action in the dorsal horn (see, for example, Ref. 155) or potentiating the effects of other transmitter candidates of primary afferent pathways such as substance P or the excitatory amino acids (Fig. 6). CGRP may indirectly act by inhibiting a substance P endopeptidase, which is involved in the inactivation of substance P in vivo (156), and thus prolonging the effects of substance P by preventing its breakdown (Fig. 6). Alternatively or in addition to such a possibility, CGRP directly potentiates the release in vitro of substance P (157), glutamate and aspartate (158), by increasing the Ca2⫹ levels in primary afferent endings (159). In keeping with the idea that CGRP mainly acts indirectly
34
Merighi et al.
on dorsal horn neurons, it was recently demonstrated that concentrations of the peptide that alone have little or no effect markedly potentiate the excitatory effect of either substance P or noxious stimuli on these neurons (160).
III. A.
NO AND THE CENTRAL MECHANISMS OF NOCICEPTION Pain, Sensitization, and Hyperalgesia
It is now well established that modifications in nociceptor function as well as altered processing of nociceptive information in the spinal cord contribute to long-term changes in nociception ultimately leading to hyperalgesia and allodynia (161). Pain is the perception of an aversive or unpleasant sensation originating from a given region of the body and thus involves integration and elaboration of the nociceptive input. Therefore, the nature of pain is highly subjective and this makes it difficult to clinically manage in a convenient way. Activation of nociceptors requires intense mechanical, thermal, or chemical stimuli. Also, nociceptors can be activated from endogenous molecules such as bradykinin (161). Unlike many sensory receptors in which a constant stimulus– response function is observed, nociceptors respond with increased excitability to repeated noxious stimulation or tissue damage. This phenomenon is commonly referred to as sensitization and is characterized by enhanced spontaneous activity, lowered activation threshold, and increased and prolonged firing to suprathreshold stimulation (162,163). From the beginning NO has always been an attractive candidate for a retrograde messenger in that it could mediate use-dependent changes in synaptic transmission by acting at presynaptic sites following its production in postsynaptic neurons (164,165). A role for NO in central mechanisms of nociception was first suggested on the basis of the l-arginine-sensitive antinociceptive effects of NOS inhibitors (166). Since then the results obtained after administration of inhibitors of the NO pathways have reinforced this idea (167–169). Hyperalgesia and hippocampal long-term potentiation share a number of features, such as endurance and dependence on afferent fiber activity and its blockade by NMDA antagonists. Indeed, intrathecal NMDA, but not other glutamate receptor agonists, induces hyperalgesia, which may be blocked by NOS inhibitors or hemoglobin (which inactivates NO), and NO synthesis linked to NMDA receptor activation has been implicated in the maintenance of hyperalgesia in several models of persistent pain (70,170). Moreover, the thermal hyperalgesia that develops in a model of neuropathic pain can be reversed after NOS inhibition, suggesting its dependence on endogenous NO production (171). It was also shown that NO contributes to persistent nociception and hyperalgesia induced by glutamate and substance P in the rat formalin pain model (167) and that the NO inhibitor Nω-nitro-l-arginine
Nitric Oxide and Pain Perception
35
methyl esther (l-NAME) blocks the thermal hyperalgesia induced by endogenous and exogenous substance P (172). In many of the experimental conditions that can increase nociceptive transmission, the spinal NMDA-NO cascade is initiated by prolonged release of substance P and glutamate from primary afferents (172,173). In addition, previous studies have repeatedly demonstrated that the release of immunoreactive CGRP and substance P is increased in the dorsal horn during hyperalgesia (70,130,157,174). More recently, evidence has been obtained that sodium nitroprusside, used as an NO donor, evokes the release of CGRP and substance P from capsaicin-sensitive primary afferents, via NO-dependent and independent mechanisms (175). B.
Synaptic Circuitry and Functional Properties of NO-Producing Neurons Involved in Pain Modulation
An understanding of the central mechanisms by which NO acts on nociception and the functional links between NO and peptidergic neurotransmission in the dorsal horn clearly requires a multidisciplinary approach in which the synaptic circuitry of relevant pathways in the substantia gelatinosa is dissected out at the electron microscope level in parallel with a thorough analysis of the functional properties of the gelatinosa neurons, which are activated by primary afferent input. To this end, we recently carried out a series of experiments based on correlative light and electron microscopic analysis of the gelatinosa neurons that produce NO and real-time confocal microscopy of intracellular Ca2⫹ changes in neurons from acute spinal cord slices after loading of cells with fluorescent calcium indicators (176). The great advantage of using such an approach is that it permits one to investigate the multiple aspects of the processing of nociceptive information in a quasi-physiological preparation that allows ready access for experimental manipulations and observations. In agreement with the observations carried out at the light microscopy level by several laboratories (35,36) we have confirmed that the majority of NO-producing neurons in lamina II correspond to islet cells. In addition, the use of an NADPH-d reaction modified for ultrastructural analysis (41) enabled us to observe that lamina II contains a number of small-caliber myelinated axons that are labeled by the histochemical stain, but only rare if not totally absent positive terminals. On this basis, we believe that at least part of the NO-producing islet cells in the gelatinosa, which are traditionally regarded as local circuit neurons, might instead send their axons outside the gelatinosa itself (see Sec. II.B). Interestingly, it was demonstrated that some islet cells have long axons that reach the thalamus via the spinothalamic tract (74). This latter represents one of the ascending pathways along which nociceptive information is conveyed to the brain, and is known to be composed of the axons of nociceptive-specific and widedynamic-range (WDR) neurons in the spinal cord (59).
36
Merighi et al.
As to the connectivity of these cells, we have demonstrated that NADPHd-positive dendrites are commonly seen close to immunoreactive primary afferent axonal varicosities and terminals of the nonglomerular type containing significant numbers of CGRP/substance P immunolabeled LGVs. However, synapses between the two types of profiles were exceptional. In addition, NADPH-d-positive dendrites were at times detected at the periphery of type II glomeruli with glutamate-immunoreactive central boutons (C2). By confocal experiments we provided evidence that neurons with functional NMDA receptors (1) are preferentially located in lamina IIi , as previously suggested by in situ hybridization studies on the distribution of spinal cord neurons expressing functional NMDAR1–NMDAR2D receptor complex (93,103); and (2) show a laminar distribution similar to that of islet cells, in keeping with the observation that NOS-containing neurons in the spinal trigeminal nucleus of the rat express NMDA receptor mRNA (177). The response of neurons to slice perfusion with NMDA (100–200 µM) was characterized by a relatively slow increase in the intracellular Ca2⫹ concentration ([Ca2⫹]i ) followed by an elevated plateau. Although loading of the Ca2⫹ indicator Indo-1 into dendrites was in general insufficient for a clear visualization of the dendritic arbor and thus it did not permit an unambiguous cell classification on the basis of pure morphological criteria, some, though not all, of these neurons displayed a bipolar-like shape similar to that of NADPH-d-positive neurons (see Ref. 176 for further discussion). Perhaps the most intriguing result of our study was that the great majority of neurons in laminae I–II responded exclusively to either substance P (69%) or NMDA (9%) (Fig. 7). Very few (approximately 4%) were responsive to both agents, while unresponsive neurons corresponded to less than 20% of the total number of neurons examined. As in the example reported in Fig. 7, neuron 1, which displayed the typical response to substance P, i.e., a transient, often repetitive [Ca2⫹]i rise, did not respond to stimulation with NMDA. In contrast, neuron 2, localized deeper with respect to neuron 1, displayed a significant [Ca2⫹]i increase after NMDA but not after substance P stimulation. This result may have a series of implications for understanding of the mechanism by which substance P contributes to the modulation of the synaptic information transfer in the dorsal horns. It is known that substance P can potentiate in a large number of dorsal horn neurons the action of glutamate on the NMDA receptor. In vivo, iontophoretically applied substance P potentiates NMDA-induced responses in identified spinothalamic tract neurons (178). In addition, substance P markedly potentiates an inward glutamate-gated current in whole cell voltage clamp experiments (179,180). Accordingly, it is generally proposed that substance P may directly modulate the NMDA receptor assuming that NK1 and NMDA receptors are expressed in the same neuronal population (137,161). In contrast, our results suggest that sub-
Nitric Oxide and Pain Perception
37
Figure 7 Responses of the substantia gelatinosa neurons to stimulation with substance P and NMDA. A. Confocal image of two Indo-1-loaded neurons (marked 1 and 2) in the dorsal horn. The dashed line corresponds to the dorsolateral border of the substantia gelatinosa. Scale bar ⫽ 20 µm. B. Kinetics of their response to NMDA and substance P. See text for further explanation.
stance P may modulate the NMDA receptor response indirectly, e.g., acting on neurons from deeper laminae whose dendrites are postsynaptic targets of C-fiber terminals in laminae I–II (such is the case of spinothalamic neurons). An alternative, plausible hypothesis is that the ability of substance P to induce repetitive intracellular Ca2⫹ transients is independent of its effects on the NMDA receptor. It is noteworthy that substance P is known to slowly depolarize dorsal horn neurons due to its blocking action on potassium channels (181). The increase in [Ca2⫹]i resulting from this action of substance P could be rather slow probably
38
Merighi et al.
occurring in several minutes and might not have been detected under our experimental conditions. This type of effect might be important for the modulatory action of substance P on the NMDA receptor. A relatively large population of neurons (77.1% of cells analyzed) in laminae I–IIo responded to substance P stimulation with a significant [Ca2⫹]i increase. As expected, this response was mediated by NK1 receptors, since the NK1 receptor antagonist sendide (182) blocked substance P–mediated [Ca2⫹]i increase. In addition, we observed that the neurons in the superficial dorsal horn which show [Ca2⫹]i increase following stimulation with substance P display [Ca2⫹]i increase also following slice perfusion with the NO donor SIN-1. The finding that the effect of SIN-1 was significantly inhibited by the NK1 antagonist sendide provided compelling evidence that NO is capable of evoking the release in vitro of substance P from endogenous spinal sources, as previously suggested by others after radioimmunoassay experiments on superfused spinal cord slices (175). The response to SIN-1 was inhibited completely by sendide in 5 of 28 neurons analyzed, whereas in the remaining 23 the amplitude of the [Ca2⫹]i increase induced by SIN-1 in the presence of sendide was reduced to less than 50%. These data suggest that other agents beside substance P, such as CGRP, are probably released on SIN-1 stimulation and can thus be involved in the intracellular Ca2⫹ change observed. C.
Retrograde Signaling by NO in Pain Perception
As discussed previously, NO, glutamate, substance P, and CGRP are all involved in nociceptive processing and hyperalgesia in the dorsal horn (70,170,173,183– 189). Our findings provided a series of new information on the interactions among NO-producing neurons and peptidergic and glutamatergic processes primary afferents (176). On the basis of our observations we advanced the following hypothesis on the possible role of NO as a retrograde signaling molecule in nociceptive pathways (Fig. 8). Glutamate released at C2 endings in type II glomeruli induces a intracellular Ca2⫹ increase in NADPH-d-positive islet cells following activation of the NMDA receptor (as discussed in a previous section, at least some of these cells might correspond to WDR neurons, which in certain hyperalgesic conditions exhibit enhanced spontaneous firing (190)). The NMDA-mediated intracellular Ca2⫹ rise results in the activation of NOS with production of NO. Newly generated NO could then evoke the release of substance P (and CGRP) from primary afferent endings. This is demonstrated by the substance P–mediated intracellular Ca2⫹ increase that is observed following SIN-1 stimulation. Interactions of NO-producing neurons and primary afferent fibers preferentially occur at the level of Aδ fibers which form the C2 central terminals of type II glomeruli (60,191). This is in agreement with the recent reported finding that C2 terminals,
Nitric Oxide and Pain Perception
39
Figure 8 Hypothetical mechanism of action of NO on peptide-containing primary afferent C fibers. Stimulation of Aδ afferents evokes a release of glutamate from C2 central endings in type II glomeruli within lamina IIi . In hyperalgesic conditions, such a stimulation would be effective in activating the NMDA-NO cascade in the peripheral dendrites of glomeruli, which originate from NADPH-d-positive islet cells. NO released from the dendritic tree of islet cells diffuses throughout lamina IIo and enhances the release of substance P (and CGRP) from C-fiber varicosities and terminals, which are enriched of peptide containing large dense-cored vesicles. The simultaneous and prolonged release of sensory neuropeptides throughout the substantia gelatinosa represents one of the mechanisms of central sensitization. (Redrawn from Ref. 176.)
but not the two other types of primary afferent terminals (C1 and nonglomerular endings) which can be detected in the substantia gelatinosa, are contacted by NOS-immunoreactive dendrites (192). From our experiments, interactions between primary afferent fibers and NO-producing neurons primarily occur in lamina IIi which is not the main site of noxious input to the gelatinosa (59,71). As a possible explanation, it was suggested that Aδ fibers could make axodendritic contacts in lamina IIo before contacting NO-producing neurons at type II glomeruli in lamina IIi (192). However, we were unable to observe any contact between peptide/glutamate-containing terminals of presumable primary afferent origin and NADPH-d positive dendrites in lamina IIo . Alternatively, NO could influence C fibers simply by diffusion (see Sec. I.C.). If NO indeed diffuses throughout the gelatinosa, how can signaling specificity be achieved? Two recent reports indicate that specificity of action can be
40
Merighi et al.
accomplished by requiring that messenger production coincide with synaptic activity (193,194). The high density of NADPH-d-positive dendrites in the gelatinosa, as demonstrated by our ultrastructural analysis, would allow for simultaneous release of NO and sensory neuropeptides throughout lamina IIo . In keeping, we observed rapid increase of intracellular Ca2⫹ in a subpopulation of neurons in lamina I-IIo after SIN-1 administration. Also in accord with our hypothesis it was previously suggested that during the course of hyperalgesia the entire dorsal horn might be flooded with substance P and nonsynaptic volume transmission occurs (195). IV.
CONCLUDING REMARKS AND FUTURE PERSPECTIVES
Ongoing research on NO has opened a series of new frontiers in neurobiology, particularly about our common thinking of neuron-to-neuron communication. Experimental evidence has also clearly indicated that the cross-talk between neurons and glial cells is of paramount importance for modulating the final response of nerve cells to stimulation. NO is an attractive candidate for a retrograde signaling molecule that could easily transfer information from neuron to neuron and from neuron to glia. Considering its unique nature, an in-depth characterization of its biological actions and signaling pathway could possibly help to explain some puzzling or even paradoxical results so far obtained while trying to dissect out nociceptive pathways in the spinal cord. Characterization of the connectivity, physiology, and pharmacology of these pathways is of paramount importance, also considering that management of chronic pain represents a major social and economical problem. At present, even the results obtained with the modern tools offered by genetic pharmacology have demonstrated the difficulty in identifying a unique transmitter of pain. Thus, we still need to research the interactions of different transmitter molecules that generate the final response to noxious stimulation and put together a detailed scheme of such interactions. The role of glial cells, in particular astrocytes, as possible partners of neurons in the processing of information has been underestimated in the past, and future studies will necessarily have to address this issue. Moreover, several as yet unexpected candidates have appeared on the scene, such as some members of the neurotrophin family. NO has somehow changed our way of thinking about synapses as the site of exchange of information in the brain, and we are entering the third millennium with a series of new and exciting challenges to play. ACKNOWLEDGMENTS This work was supported by grants from the Italian CNR and MURST (fondi ex40%) to AM and Telethon n. 1095 to GC and AM. P. Aimar was in receipt
Nitric Oxide and Pain Perception
41
of a postdoctoral fellowship from the Cavalieri Ottolenghi Foundation for the study of Molecular, Cellular and Biological Bases of Brain Functions and Disfunctions, Torino, Italy.
REFERENCES 1. Buma, P., Roubos, E.W., and Buijs, R.M. (1984) Ultrastructural demonstration of exocytosis of neural, neuroendocrine and endocrine secretions with an in vitro tannic acid (TARI-) method. Histochemistry 80, 247–256. 2. Schuman, E.M., and Madison, D.V. (1994) Nitric oxide and synaptic function. Annu. Rev. Neurosci. 17, 153–183. 3. Moncada, S., Palmer, M.R.J., and Higgs, E.A. (1991) Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 43, 109–142. 4. Garthwaite, J. (1993) Nitric oxide signalling in the nervous system. Semin. Neurosci. 5, 171–180. 5. Garthwaite, J., and Boulton, C.L. (1995) Nitric oxide signaling in the central nervous system. Annu. Rev. Physiol. 57, 683–706. 6. Mayer, B. (1993) Molecular characteristics and enzymology of nitric oxide synthase and soluble guanylyl cyclase in the CNS. Semin Neurosci. 5, 197–205. 7. Bredt, D.S. (1995) Molecular characterization of nitric oxide synthase. In: Nitric Oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, London, pp. 1–19. 8. Mayer, B. (1995) Biochemistry and molecular pharmacology of nitric oxide syntheses. In: Nitric Oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, London, pp. 21–42. 9. Ignarro, L.J., Buga, G.M., Wood, K.S., and Byrns, R.E.C.G. (1987) Endotheliumderived relaxing factor produced and released from artery and vein is nitric oxide. Proc. Natl. Acad. Sci. USA 84, 9265–9269. 10. Palmer, R.M.J., Ferrige, A.G., and Moncada, S. (1987) Nitric oxide accounts for the biological activity of endothelium-derived relaxing factor. Nature 327, 524– 526. 11. Bredt, D.S., and Snyder, S.H. (1990) Isolation of nitric oxide synthase, a calmodulin requiring enzyme. Proc. Natl. Acad. Sci. USA 87, 682–685. 12. Schimdt, H.H.W., Smith, R.M., Nakane, M., and Murad, F. (1991) Purification of a soluble isoform of guanylyl ciclase-activating-factor synthase. Proc. Natl. Acad. Sci. USA 88, 365–369. 13. Mayer, C., and Zieglga¨nsberger, W. (1991) Peptidergic neurotransmission in the dorsal horn of the rat spinal cord. In: Fine Afferent Nerve Fibers and Pain (R.F. Schmidt and H.-G. Schaible, eds.), VCH, Wienheim, pp. 249–262. 14. Brenman, J.E., Chao, D.S., Gee, S.H., McGee, A.W., Craven, S.E., Santillano, D.R., Huang, F., Xia, H., Peters, M.F., Froeher, S.C., and Bredt, D.S. (1996) Interaction of nitric oxide synthase with the synaptic density protein PSD-95 and α-1 syntrophin mediated PDZ motifs. Cell 84, 757–767. 15. Kornau, H.-C., Schenker, L.T., Kennedy, M.B., and Seeburg, P.H. (1995) Domain
42
16.
17. 18.
19.
20.
21.
22.
23.
24. 25.
26.
27.
28. 29.
30.
Merighi et al. interaction between the NMDA receptor subunits and the postsynaptic density protein PSD-95. Science 269, 1737–1740. Kim, E., Niethammer, M., Rotschild, A., Jan, Y.N., and Scheng, M. (1995) Clustering of the Shaker-type K⫹ channels by direct interaction with the PSD-95/SAP90 family of membrane-associated guanylate kinases. Nature 378, 85–88. Brenman, J.E., and Bredt, D.S. (1997) Synaptic signaling by nitric oxide. Curr. Opin. Neurobiol. 7, 374–378. Mayer, B., Schmidt, K., Humbert, P., and Bo¨hme, E. (1989) Biosynthesis of endothelium-derived relaxing factor: a cytosolic enzyme in porcine aortic endothelial cells Ca2⫹-dependently converts l-arginine into an activator of soluble guanylyl cyclase. Biochem. Biophys. Res. Commun. 164, 678–685. Pollock, J.S., Fo¨rstermann, U., Mitchell, J.A., Warner, T.D., Schmidt, H.H.H.W., Nakane, M., and Murad, F. (1991) Purification and characterization of particulate endothelium-derived relaxing factor synthase from cultured native bovine aortic endothelial cells. Proc. Natl. Acad. Sci. USA 88, 10480–10484. Murphy, S., Simmons, M.L., Agullo, L., Garcia Douglas, A., Feinstein, D.L., Galea, E., Reis, D.J., Minc-Golomb, D., and Schwartz, J.P. (1993) Synthesis of nitric oxide in CNS glial cells. Trends Neurosci. 16, 323–328. Bredt, D.S., Hwang, P.M., and Snyder, S.H. (1991) Cloned and expressed nitric oxide synthase structurally resembles cytochrome P-450 reductase. Nature 351, 714–718. Cho, H.J., Xie, Q.W., Calaycay, J., Mumford, R.A., Swiderek, K.M., Lee, T.D., and Nathan, C. (1992) Calmodulin is a subunit of nitric oxide synthase from macrophages. J. Exp. Med. 176, 599–604. Kawabata, A., Umeda, N., and Takagi, H. (1993) l-Arginine exerts a dual role in nociceptive processing in the brain: involvement of the kyotorphin-Met-enkephalin pathway and NO-cyclic GMP pathway. B. J. Pharmacol. 109, 73–79. Zhu, X.Z., and Luo, L.G. (1992) Effect of nitroprusside (nitric oxide) on endogenous dopamine release from rat striatal slices. J. Neurochem. 59, 932–935. East, S.J., Batchelor, A.M., and Garthwaite, J. (1991) Selective blockade of Nmethyl-d-aspartate receptor function by the nitric oxide donor, nitroprusside. Eur. J. Pharmacol. 209, 119–121. Estevez, A.G., Radi, R., Barbeito, L., Shin, J.T., Thompson, J.A., and Beckman, J.S. (1995) Peroxynitrite-induced cytotoxicity in PC12 cells: evidence for an apoptotic mechanism differentially modulated by neurotrophic factors. J. Neurochem. 65, 1543–1550. Malmberg, A.B., Chen, C., Tonegawa, S., and Basbaum, A.I. (1997) Preserved acute pain and reduced neuropathic pain in mice lacking PKCgamma. Science 278, 279–283. Bru¨ning, G., and Mayer, B. (1996) Prenatal development of nitric oxide synthase in the mouse spinal cord. Neurosci. Lett. 202, 189–192. Verge, V.M.K., Xu, Z., Xu, X.-J., Wiesenfeld-Hallin, Z., and Ho¨kfelt, T. (1992) Marked increase in nitric oxide synthase mRNA in rat dorsal root ganglia after peripheral axotomy: In situ hybridization and functional studies. Proc. Natl. Acad. Sci. USA 89, 11617–11621. Dawson, T.M., Bredt, D.S., Fotuhi, M., Hwang, P.M., and Snyder, S.H. (1991)
Nitric Oxide and Pain Perception
31.
32.
33. 34.
35. 36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
43
Nitric oxide synthase and neuronal NADPH diaphorase are identical in brain and peripheral tissues. Neurobiology 7797–7801. Tracey, W.R., Nakane, M., Pollock, J.S., and Forstermann, U. (1993) Nitric oxide synthases in neuronal cells, macrophages and endothelium are NADPH diaphorases, but represent only a fraction of total cellular NADPH diaphorase activity. Biochem. Biophys. Res. Commun. 195, 1035–1040. Bredt,. D.S., Glatt, C.E., Hwang, P.M., Fotuhi, M., Dawson, T.M., and Snyder, S.H. (1991) Nitric oxide synthase protein and mRNA are discretely localized in neuronal populations of the mammalian CNS together with NADPH diaphorase. Neuron 7, 615–624. Huang, P.L., Dawson, T.M., Bredt, D.S., Snyder, S.H., and Fishman, M.C. (1993) Targeted disruption of the neuronal nitric oxide synthase gene. Cell 75, 1273–1286. Vincent, S.R. (1995) Localization of nitric oxide neurons in the central nervous system. In: Nitric Oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, London, pp. 83–102. Valtschanoff, J.G., Weinberg, R.J., and Rustioni, A. (1992) NADPH diaphorase in the spinal cord of rats. J. Comp. Neurol. 321, 209–222. Vizzard, M.A., Erdman, S.L., Erickson, V.L., Stewart, R.J., Roppolo, J.R., and De Groat, W.C. (1994) Localization of NADPH diaphorase in the lumbosacral spinal cord and dorsal root ganglia of the cat. J. Comp. Neurol. 339, 62–75. Springall, D.R., Riveros-Moreno, V., Buttery, L., Suburo, A., Bishop, A.F., Merrett, M., Moncada, S., and Polak, J.M. (1992) Immunological detection of nitric oxide synthase(s) in human tissues using heterologous antibodies suggesting different isoforms. Histochemistry 98, 259–266. Spike, R.C., Todd, A.J., and Johnston, H.M. (1993) Coexistence of NADPH diaphorase with GABA, glycine, and acetylcholine in rat spinal cord. J. Comp. Neurol. 335, 320–333. Aimi, Y., Fujimura, M., Vincent, S.R., and Kimura, H. (1991) Localization of NADPH-diaphorase-containing neurons in sensory ganglia of the rat. J. Comp. Neurol. 306, 382–392. Vizzard, M.A., Erdman, S.L., and De Groat, W.C. (1993) The effect of rhizotomy on NADPH diaphorase staining in the lumbar spinal cord of the rat. Brain Res. 607, 349–353. Aimar, P., Barajon, I., and Merighi, A. (1998) Ultrastructural features and synaptic connections of NADPH-diaphorase positive neurones in the rat spinal cord. Eur. J. Anat. 2, 27–34. Llewellyn-Smith, I.J., Song, Z.-M., Costa, M., Bredt, D.S., and Snyder, S.H. (1992) Ultrastructural localization of nitric oxide synthase immunoreactivity in guinea-pig enteric neurons. Brain Res. 577, 337–342. Darius, S., Wolf, G., Huang, P.L., and Fishman, M.C. (1995) Localization of NADPH-diaphorase/nitric oxide synthase in the rat retina: an electron microscopic study. Brain Res. 690, 231–235. Tang, F.R., Tan, C.K., and Ling, E.A. (1995) The distribution of NADPH-d in the central grey region (lamina X) of rat upper thoracic spinal cord. J. Neurocytol. 24, 735–743. Wolf, G., Wu¨rdig, S., and Schu¨nzel, G. (1992) Nitric oxide synthase in rat brain is
44
46.
47.
48.
49.
50.
51.
52. 53.
54.
55.
56.
57. 58.
59. 60.
Merighi et al. predominantly located at neuronal endoplasmic reticulum: an electron microscopic demonstration of NADPH-diaphorase activity. Neurosci. Lett. 147, 63–66. Murphy, S., Grzybychi, D., and Simmons, M.L. (1995) Glial cells as nitric oxide sources and targets. In: Nitric Oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, London, pp. 163–190. Pasti, L., Volterra, A., Pozzan, T., and Carmignoto, G. (1997) Intracellular calcium oscillations in astrocytes: a highly plastic, bidirectional form of communication between neurons and astrocytes in situ. J. Neurosci. 17, 7817–7830. Aoki, E., Semba, R., Mikoshiba, K., and Kashiwamata, S. (1991) Predominant localization in glial cells of free l-arginine. Immunocytochemical evidence. Brain Res. 547, 190–192. Schmidt, H.H.H.W., Gagne, G.D., Nakane, M., Pollock, J.S., Miller, M.F., and Murad, F. (1992) Mapping of neural nitric oxide synthase in the rat suggests frequent co-localization with NADPH diaphorase but not with soluble guanylyl cyclase and novel paraneural functions for nitrinergic signal transduction. J. Histochem. Cytochem. 40, 1439–1456. Galea, E., Feinstein, D.L., and Reis, D.J. (1992) Induction of calcium-independent nitric oxide synthase in primary rat glial cultures. Proc. Natl. Acad. Sci. USA 89, 10945–10949. Murphy, T.H., Blatter, L.A., Wier, W.G., and Baraban, J.M. (1993) Rapid communication between neurons and astrocytes in primary cortical cultures. J. Neurosci. 13, 2672–2679. Bredt, D.S., Hwang, P.M., and Snyder, S.H. (1990) Localization of nitric oxide synthase indicating a neural role for nitric oxide. Nature 347, 768–770. Mashimo, H., He, X.D., Huang, P.L., Fishman, M.C., and Goyal, R.K. (1996) Neuronal constitutive nitric oxide synthase is involved in murine enteric inhibitory neurotransmission. J. Clin. Invest. 98, 8–13. Wood, P.L. (1995) Nitric oxide and excitatory amino acid-coupled signal transduction in the cerebellum and hippocampus. In: Nitric Oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, New York, pp. 103–124. Schuman, E.M. (1995) Nitric oxide signalling, long-term potentiation and longterm depression. In: Nitric oxide in the Nervous System (S.R. Vincent, ed.), Academic Press, London, pp. 125–150. Aoki, C., Fenstemaker, S., Lubin, M., and Go, C.G. (1993) Nitric oxide synthase in the visual cortex of monocular monkeys as revealed by light and electron microscopic immunocytochemistry. Brain Res. 620, 97–113. Ruda, M.A., Bennett, G.J., and Dubner, R. (1986) Neurochemistry and neural circuitry in the dorsal horn. Progr. Brain Res. 66, 219–268. Rustioni, A., and Weinberg, R.J. (1989) The somatosensory system. In: Handbook of Chemical Neuroanatomy, Vol. 7, Integrated Systems of the CNS, Part II (A. Bjo¨rklund, T. Ho¨kfelt, and L.W. Swanson, eds.), Elsevier, Amsterdam, pp. 219– 321. Willis, W.D., Jr. and Coggeshall, R.E. (1991) Sensory Mechanisms of the Spinal Cord. Plenum Press, New York. Ribeiro-Da-Silva, A. (1994) Substantia gelatinosa of spinal cord. In: The Rat Nervous System (G. Paxinos, ed.), Academic Press, New York.
Nitric Oxide and Pain Perception
45
61. Lieberman, A.R. (1976) Sensory ganglia. In: The Peripheral Nerve (D.M. Landon, ed.), Chapman and Hall, London, pp. 188–278. 62. Light, A.R., and Perl, E.R. (1979) Reexamination of the dorsal root projection to the spinal dorsal horn including observations on the differential termination of coarse and fine fibers. J. Comp. Neurol. 186, 117–132. 63. Chung, K., Langford, L., Applebaum, A.E., and Coggeshall, R.E. (1979) Primary afferent fibers in the tract of Lissauer in the rat. J. Comp. Neurol. 184, 587–598. 64. Light, A.R., and Perl, E.R. (1979) Spinal termination of functionally identified primary afferent neurons with slowly conducting myelinated fibers. J. Comp. Neurol. 186, 133–150. 65. Nahin, R.L., Madsen, A.M., and Giesler, G.J., Jr. (1983) Anatomical and physiological studies of the gray matter surrounding the spinal cord central canal. J. Comp. Neurol. 220, 321–335. 66. Honda, C.N., and Perl, E.R. (1985) Functional and morphological features of neurons in the midline region of the caudal spinal cord of the cat. Brain Res. 340, 285–295. 67. Willis, W.D. (1991) Sensory Mechanisms of the Spinal Cord. Oxford University Press, New York. 68. Sugiura, Y., Lee, C.L., and Perl, E.R. (1986) Central projections of identified, unmyelinated (C) fibers innervating the mammalian skin. Science 234, 358–361. 69. McMahon, S., and Wall, P.D. (1985) The distribution and central termination of single cutaneous and muscle unmyelinated fibers in the rat spinal cord. Brain Res. 359, 39–48. 70. Meller, S.T., and Gebhart, G.F. (1994) Spinal mediators of hyperalgesia. Drugs 47, 10–20. 71. Light, R. (1992) The Initial Processing of Pain and Its Descending Control: Spinal and Trigeminal Systems. Karger, New York. 72. Gobel, S., Falls, W.M., Bennett, G.J., Abdelmoumene, M., Hayashi, H., and Humprey, E. (1980) An EM analysis of the synaptic connections of horseradish peroxidase filled stalked cells and islet cells in the substantia gelatinosa of adult cat spinal cord. J. Comp. Neurol. 194, 781–807. 73. Bennett, G.J., Abdelmoumene, M., Hayashi, H., and Dubner, R. (1980) Physiology and morphology of substantia gelatinosa neurons intracellulary stained with horseradish peroxidase. J. Comp. Neurol. 194, 809–827. 74. Willis, W.D., Leonard, R.B., and Kenshalo, D.R., Jr. (1978) Spinothalamic tract neurons in the substantia gelatinosa. Science 202, 986–988. 75. Spike, R.C., and Todd, A.J. (1992) Ultrastructural and immunocytochemical study of lamina II islet cells in rat spinal dorsal horn. J. Comp. Neurol. 323, 359–369. 76. Giesler Jr., G.J., Cannon, J.T., Urca, G., and Liebeskind, J.C. (1978) Long ascending projections from substantia gelatinosa Rolandi and the subjacent dorsal horn in the rat. Science 202, 984–986. 77. Hutchinson, G.B., McLennan, H., and Wheal, H.V. (1978) The responses of Renshaw cells and spinal interneurons of the rat to l-glutamate and l-aspartate. Brain Res. 141, 129–136. 78. Johnson, J.L. (1972) Glutamic acid as a synaptic transmitter candidate in dorsal sensory neuron—reconsideration. Life Sci. 20, 1637–1644.
46
Merighi et al.
79. Roberts, P.J., and Keen, P. (1973) Uptake of [14C]glutamate into dorsal and ventral roots of spinal nerves of the rat. Brain Res. 57, 234–238. 80. Roberts, P.J. (1974) The release of amino acids with proposed neurotransmitter function from the cuneate and gracile nuclei of the rat in vivo. Brain Res. 67, 419– 428. 81. Jahr, C.E., and Jessel, T.M. (1985) Synaptic transmission between dorsal root ganglion and dorsal horn neurons in culture: antagonism of monosynaptic excitatory postsynaptic potentials and glutamate excitation by kynurenate. J. Neurosci. 5, 2281–2289. 82. Yoshimura, M., and Jessel, T.M. (1990) Amino acid–mediated EPSPs at primary afferent synapses with substantia gelatinosa neurones in the rat spinal cord. J. Physiol. 430, 315–335. 83. Yoshimura, M., and Jessell, T.M. (1989) Membrane properties of rat substantia gelatinosa neurons in vitro. J. Neurophysiol. 62, 109–118. 84. Yoshimura, M., and Jessell, T.M. (1989) Primary afferent-evoked synaptic responses and slow potential generation in rat substantia gelatinosa neurons in vitro. J. Neurophysiol. 62, 96–108. 85. Ottersen, O.P., and Sto¨rm-Mathisen, J. (1984) Glutamate- and GABA-containing neurons in the mouse and rat brain as demonstrated with a new immunocytochemical technique. J. Comp. Neurol. 229, 374–392. 86. Ottersen, O.P., and Sto¨rm-Mathisen, J. (1987) Localization of amino acid neurotransmitters by immunocytochemistry. Trends Neurosci. 10, 250–255. 87. Battaglia, G., and Rustioni, A. (1988) Coexistence of glutamate and substance P in dorsal root ganglion neurons of the rat and monkey. J. Comp. Neurol. 277, 302– 312. 88. De Biasi, S., and Rustioni, A. (1988) Glutamate and substance P coexist in primary afferent terminals in the superficial laminae of the spinal cord. Proc. Natl. Acad. Sci. USA 85, 7820–7824. 89. Maxwell, D.J., Christie, W.M., Ottersen, O.P., and Sto¨rm-Mathisen, J. (1990) Terminals of group la primary afferent fibers in Clarke’s column are enriched with lglutamate-like immunoreactivity. Brain Res. 510, 346–350. 90. Merighi, A., Polak, J.M., and Theodosis, D.T. (1991) Ultrastructural visualization of glutamate and aspartate immunoreactivities in the rat dorsal horn with special reference to the co-localization of glutamate, substance P and calcitonin gene-related peptide. Neuroscience 40, 67–80. 91. Valtschanoff, J.G., Phend, K.D., Bernardi, P.S., Weinberg, R.J., and Rustioni, A. (1994) Amino acid immunocytochemistry of primary afferent terminals in the rat dorsal horn. J. Comp. Neurol. 346, 237–252. 92. To¨lle, T.R., Berthele, A., Zieglga¨nsberger, W., Seeburg, P.H., and Wisden, W. (1993) The differential expression of 16 NMDA and non NMDA receptor subunits in the rat spinal cord and in periaqueductal gray. J. Neurosci. 13, 5009– 5028. 93. To¨lle, T.R., Berthele, A., Laurie, D.J., Seeburg, P.H., and Zieglga¨nsberger, W. (1995) Cellular and subcellular distribution of NMDAR1 splice variant mRNA in the rat lumbar spinal cord. Eur. J. Neurosci. 7, 1235–1244. 94. Partneau, D.K., and Mayer, M.L. (1990) Structure-activity relationships for amino
Nitric Oxide and Pain Perception
95.
96.
97.
98.
99. 100.
101. 102.
103.
104. 105.
106.
107.
108.
109.
47
acid transmitter candidates acting at N-methyl d-aspartate and quisqualate receptors. J. Neurosci. 10, 2385–2399. Curras, M.C., and Dingledine, R.J. (1992) Selectivity of amino acid transmitters acting at N-methyl d-aspartate and amino-3-hydroxy-5-methyl-4-isoxazolypropionate receptors. Mol. Pharmacol. 41, 520–526. Todd, A.J., and Spike, R.C. (1993) The localization of classical transmitters and neuropeptides within neurons in laminae I-III of the mammalian spinal dorsal horn. Prog. Neurobiol. 41, 609–638. Hunt, S.P., Kelly, J.S., Emson, P.C., Kimmel, J.R., Miller, R.J., and Wu, J.Y. (1981) An immunohistochemical study of neuronal populations containing neuropeptides or gamma-aminobutyrate within the superficial layers of the rat dorsal horn. Neuroscience 6, 1883–1981. McLaughlin, B.J., Barber, R., Saito, K., Roberts, E., and Wu, J.Y. (1975) Immunocytochemical localization of glutamate decarboxylase in rat spinal cord. J. Comp. Neurol. 164, 305–322. Todd, A.J., and McKenzie, J. (1989) GABA-immunoreactive neurons in the dorsal horn of the rat spinal cord. Neuroscience 31, 799–806. Laing, I., Todd, A.J., Heizmann, C.W., and Schmidt, H.H.H.W. (1994) Subpopulations of GABAergic neurons in laminae I–III of rat spinal dorsal horn defined by coexistence with classical transmitters, peptides, nitric oxide synthase or parvalbumin. Neuroscience 61; 123–132. Todd, A.J. (1996) GABA and glycine in synaptic glomeruli of the rat spinal dorsal horn. Eur. J. Neurosci. 8, 2492–2498. Todd, A.J., Spike, R.C., Chong, D., and Neilson, M. (1995) The relationship between glycine and gephyrin in synapses of the rat spinal cord. Eur. J. Neurosci. 7, 1–11. Todd, A.J., Watt, C., Spike, R.C., and Sieghart, W. (1996) Colocalization of GABA, glycine, and their receptors at synapses in the rat spinal cord. J. Neurosci. 16: 974– 982. Salt, T.E., and Hill, R.G. (1983) Neurotransmitter candidates of somatosensory primary afferent fibres. Neuroscience 10, 1083–1103. Helke, C.J., Krause, J.E., Mantyh, P.W., and Couture, R. (1990) Diversity of tachykinin peptidergic neurons: multiple peptides, receptors and regulatory mechanisms. FASEB J. 4, 1606–1615. Lembeck, F. (1953) Zur Frage den zentralen bertragung afferenter Impulse. Das Vorkommen und die Bedeutung der Substanz P in den dorsalen Wurzeln des Ru¨chkenmarks. Naunyn-Schmiedeberg’s. Arch. Exp. Pathol. Pharm. 219, 197–213. ˚ , Terenius, L., Elde, R.P., and Nilsson, G. (1977) ImmunoHo¨kfelt, T., Ljungdahl, A histochemical analysis of peptide pathways possibly related to pain and analgesia: enkephalin and substance P. Proc. Natl. Acad. Sci. USA 74, 3081–3085. Gibson, S.J., Polak, J.M., Bloom, S.R., and Wall, P.D. (1981) The distribution of nine peptides in rat spinal cord with special emphasis on the substantia gelatinosa and on the area around the central canal (lamina X). J. Comp. Neurol. 201, 65– 79. Merighi, A., Cruz, F., and Coimbra, A. (1992) Immunocytochemical staining of neuropeptides in terminal arborization of primary afferent fibers anterogradely la-
48
110.
111. 112. 113.
114.
115.
116.
117.
118.
119. 120.
121.
122.
123.
Merighi et al. beled and identified at light and electron microscopic levels. J. Neurosci. Meth. 42, 105–113. Pignatelli, D., Ribeiro-Da-Silva, A., and Coimbra, A. (1989) Postnatal maturation of primary afferent terminations in the substantia gelatinosa of the rat spinal cord. An electron microscopic study. Brain Res. 491, 33–44. Regoli, D., Boudon, A., and Fauche´re, J.-L. (1994) Receptors and antagonists for substance P and related peptides. Pharmacol. Rev. 46, 551–599. Hershey, A.D., and Krause, J.E. (1990) Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247, 958–962. Vigna, S.R., Bowden, J.J., McDonald, D.M., Fisher, J., Okamoto, A., McVey, D.C., Payan, D.G., and Bunnett, N.W. (1994) Characterization of antibodies to the rat substance P (NK-1) receptor and to a chimeric substance P receptor expressed in mammalian cells. J. Neurosci. 14, 834–845. Snider, R.M., Constantine, J.W., Lowe, J.A., III, Longo, K.P., Lebel, W.S., Woody, H.A., Dorzda, S.F., Desai, M.C., Vinik, F.J., Spencer, R.W., and Hess, H.J. (1991) A potent nonpeptide antagonist of the SP (NK-1) receptor. Science 251, 435–437. Kaneko, T., Shigemoto, R., Nakanishi, S., and Mizuno, N. (1994) Morphological and chemical characteristics of substance P receptor-immunoreactive neurons in the rat neocortex. Neuroscience 60, 199–211. Li, J.L., Kaneko, T., Shigemoto, R., and Mizuno, N. (1997) Distribution of trigeminohypothalamic and spinohypothalamic tract neurons displaying substance P receptor-like immunoreactivity in the rat. J. Comp. Neurol. 378, 508–521. Nakaya, Y., Kaneko, T., Shigemoto, R., Nakanishi, S., and Mizuno, N. (1994) Immunohistochemical localization of substance P receptor in the central nervous system of the adult rat. J. Comp. Neurol. 347, 249–274. Moussaoui, S., Carruette, A., and Garret, C. (1993) Further evidence that substance P is a mediator of both neurogenic inflammation and pain: two phenomena inhibited either by postsynaptic blockade of NK1 receptors or by presynaptic action of opioid receptor agonists. Regul. Pept. 46, 424–425. Hershey, A.D., and Krause, J.E. (1990) Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247, 958–962. Bleazard, L., Hill, R.G., and Morris, R. (1994) The correlation between the distribution of the NK1 receptor and the actions of tachykinin agonists in the dorsal horn of the rat indicates that substance P does not have a functional role on substantia gelatinosa (lamina II) neurons. J. Neurosci. 14, 7655–7664. Brown, J.L., Liu, H., Maggio, J.E., Vigna, S.R., Mantyh, P.W., and Basbaum, A.I. (1995) Morphological characterization of substance P receptor–immunoreactive neurons in the rat spinal cord and trigeminal nucleus caudalis. J. Comp. Neurol. 356, 327–344. Liu, H., Brown, J.L., Jasmin, L., Maggio, J.E., Vigna, S.R., Mantyh, P.W., and Basbaum, A.I. (1994) Synaptic relationship between substance P and the substance P receptor: Light and electron microscopic characterization of the mismatch between neuropeptides and their receptors. Proc. Natl. Acad. Sci. USA 91, 1009– 1013. Ma, W., Ribeiro-Da-Silva, A., De Koninck, Y., Radhakrishnan, V., Henry, J.L., and Cuello, A.C. (1996) Quantitative analysis of substance P–immunoreactive bou-
Nitric Oxide and Pain Perception
124.
125.
126. 127.
128. 129.
130.
131.
132.
133.
134.
135.
136.
137.
138.
49
tons on physiologically characterized dorsal horn neurons in the cat lumbar spinal cord. J. Comp. Neurol. 376, 45–64. Ho¨kfelt, T., Kellerth, J.O., Nilsson, G., and Pernow, B. (1975) Substance P: localization in the central nervous system and in some primary sensory neurons. Science 190, 889–890. Cuello, A.C., Ribeiro-Da-Silva, A., Ma, W., De Koninck, Y., and Henry, J.L. (1993) Organization of substance P primary sensory neurons: Ultrastructural and physiological correlates. Regul. Pept. 46, 155–164. Hunt, S.P. (1983) Cytochemistry of the spinal cord. In: Chemical Neuroanatomy (P.C. Emson, ed.), Raven Press, New York, pp. 53–84. Yaksh, T.L., Jessel, T.M., Gamse, R., Mudge, A.W., and Leeman, S.E. (1980) Intrathecal morphine inhibits substance P release from spinal cord in vivo. Nature 286, 155–157. Henry, J.L. (1976) Effects of substance P on functionally identified units in cat spinal cord. Brain Res. 114, 439–451. Piercey, M.F., Einsphar, F., Dobry, P.T.K., Schroeder, L.A., and Hollister, R.P. (1980) Morphine does not antagonize the substance P mediated excitation of dorsal horn neurons. Brain Res. 186, 421–434. Garry, M.G., and Hargreaves, K.M. (1992) Enhanced release of immunoreactive CGRP and substance P from spinal dorsal horn slices occurs during carrageenan inflammation. Brain Res. 582, 139–142. Thompson, S.W.N., Dray, A., and Urban, L. (1994) Injury-induced plasticity of spinal reflex activity: NK-1 neurokinin receptor activation and enhanced Aδ- and C-fiber mediated responses in the rat cord in vitro. Regul. Pept. 14, 3672–3687. Birch, P.J., Harrison, S.M., Hayes, A.G., Rogers, H., and Tyres, M.B. (1992) The non-peptide NK-1 receptor antagonist (⫹)-CP-96, 345 produces anti-nociceptive and anti-oedema effects in the rat. Br. J. Pharmacol. 105, 508–510. Yamamoto, T., Shimoyama, N., and Mizuguchi, T. (1993) Morphine, MK-801, an NMDA antagonist, and CP-96, 345, an NK1 antagonist, on the hyperesthesia evoked by carageenan injection in the rat paw. Anesthesiology 78, 124–133. Cao, Y.Q., Mantyh, P.W., Carlson, E.J., Gillespie, A.M., Epstein, C.J., and Basbaum, A.I. (1998) Primary afferent tachykinins are required to experience moderate to intense pain. Nature 392, 390–394. De Felipe, C., Herrero, J.F., O’Brien, J.A., Palmer, J.A., Doyle, C.A., Smith, A.J., Laird, J.M.A., Ben-Ari, Y., Cervero, F., and Hunt, S.P. (1998) Altered nociception, analgesia and aggression in mice lacking the receptor for substance P. Nature 392, 394–397. Zimmer, A., Zimmer, A.M., Baffi, J., Usdin, T., Reynolds, K., Konig, M., Palkovits, M., and Mezey, E. (1998) Hypoalgesia in mice with a targeted deletion of the tachykinin 1 gene. Proc. Natl. Acad. Sci. USA 95, 2630–2635. Woolf, C.J., Mannion, R.J., and Neuman, S. (1998) Null mutations lacking substance: elucidating pain mechanisms by genetic pharmacology. Neuron 20, 1063– 1066. Amara, S.G., Jonas, V., Rosenfeld, M.G., Ong, E.S., and Evans, R.M. (1982) Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products. Nature 298, 240–244.
50
Merighi et al.
139. Rosenfeld, M.G., Mermod, J.J., Amara, S.J., Swanson, L.W., Rivier, J., Vale, W.W., and Evans, R.M. (1983) Production of a novel neuropeptide encoded by the calcitonin gene via tissue-specific RNA processing. Nature 304, 129–135. 140. Amara, S.G., Arriza, J.L., Leff, S.E., Swanson, L.W., Evans, R.M., and Rosenfeld, M.G. (1985) Expression in brain of a messenger RNA encoding a novel neuropeptide homologous to calcitonin gene–related peptide. Science 229, 1094–1097. 141. Morris, H.R., Panico, M., Etienne, T., Tippins, J., Girgis, S.I., and Maclntyre, I. (1984) Isolation and characterisation of human calcitonin gene–related peptide. Nature 308, 746–748. 142. Gibson, S.J., Polak, J.M., Giaid, A., Hamid, Q.A., Kar, S., Jones, P.M., Denny, P., Legon, S., Amara, S.G., Craig, R.K., Bloom, S.R., Penketh, R.J.A., Rodek, C., Ibrahim, N.B.N., and Dawson, A. (1988) Calcitonin gene–related peptide messenger RNA is expressed in sensory neurones of the dorsal root ganglia and also in spinal motorneurones in man and rat. Neurosci. Lett. 91, 283–288. 143. Ho¨kfelt, T., Ardvisson, U., Ceccatelli, S., Cortes, R., Cullheim, S., Dagerlind, A., Johnson, H., Orazzo, C., Piehl, F., Pieribone, V., Schalling, M., Terenius, L., Ulfhake, B., Verge, V., Villar, M., Wiesenfeld-Hallin, Z., Xu, X.-J., and Xu, Z. (1992) Calcitonin gene–related peptide in the brain, spinal cord and some peripheral systems. In: Calcitonin Gene–related Peptide—The First Decade of a Novel Pleiotropic Neuropeptide (P. Holzer and M.G. Rosenfeld, eds.), New York Academy of Science, New York, pp. 119–134. 144. Wimalawansa, S.J. (1996) Calcitonin gene–related peptide and its receptors: molecular genetics, physiology, pathophysiology, and therapeutic potentials. Endoc. Rev. 17, 533–585. 145. Gibson, S.J., and Polak, J.M. (1986) Neurochemistry of the spinal cord. In: Immunocytochemistry: Modern Methods and Applications (J.M. Polak and S. Van Noorden, eds.), John Wright & Sons, Bristol, pp. 360–390. 146. Dalsgaard, C.J. (1988) The sensory system. In: Handbook of Chemical Neuroanatomy (A. Bjo¨rklund, T. Ho¨kfelt, and C. Owman, eds.), Elsevier, Amsterdam, pp. 599–636. 147. Hua, X.Y., Theodorsson-Norheim, E., Lundberg, J.M., Kinn, A.C., Ho¨kfelt, T., and Cuello, A.C. (1987) Co-localization of tachykinins and calcitonin gene-related peptide in capsaicin-sensitive afferents in relation to motility effects on the human ureter in vitro. Neuroscience 23, 693–703. 148. Su, H.C., Wharton, J., Polak, J.M., Mulderry, P.K., Ghatei, M.A., Gibson, S.J., Terenghi, G., Morrison, J.F.B., Ballesta, J., and Bloom, S.R. (1986) Calcitonin gene-related peptide-immunoreactivity in afferent neurones supplying the urinary tract: combined retrograde tracing and immunocytochemistry. Neuroscience 18, 727–747. 149. Gulbenkian, S., Merighi, A., Wharton, J., Varndell, I.M., and Polak, J.M. (1986) Ultrastructural evidence for the coexistence of calcitonin gene-related peptide and substance P in secretory vesicles of peripheral nerves in the guinea pig. J. Neurocytol. 15, 535–542. 150. Merighi, A., Polak, J.M., Fumagalli, G., and Theodosis, D.T. (1989) Ultrastructural localisation of neuropeptides and GABA in the rat dorsal horn: a comparison of different immunogold labelling techniques. J. Histochem. Cytochem. 37, 529–540.
Nitric Oxide and Pain Perception
51
151. Tuchscherer, M.M., and Seybold, V.S. (1989) A quantitative study of the coexistence of peptides in varicosities within the superficial laminae of the dorsal horn of the rat spinal cord. J. Neurosci. 9, 195–205. 152. Bonfanti, L., Bellardi, S., Ghidella, S., Gobetto, A., Polak, J.M., and Merighi, A. (1991) Distribution of five peptides, three general neuroendocrine markers and two synapticvesicle-associated proteins in the spinal cord and dorsal root ganglia of the adult and newborn dog: an immunocytochemical study. Am. J. Anat. 191, 154–166. 153. Quirion, R., Van Rossum, D., Dumont, Y., St-Pierre, S., and Fournier, A. (1992) Characterization of CGRP1 and CGRP2 receptor subtypes. In: Calcitonin Gene–Related Peptide—The First Decade of a Novel Pleiotropic Neuropeptide (P. Holzer and M.G. Rosenfeld, eds.), New York Academy of Science, New York, pp. 88–105. 154. Wimalawansa, S.J. (1992) Isolation, purification, and biochemical characterization of calcitonin gene-related peptide. In: Calcitonin Gene–Related Peptide—The First Decade of a Novel Pleiotropic Neuropeptide (P. Holzer and M.G. Rosenfeld, eds.), New York Academy of Science, New York, pp. 70–87. 155. Woolf, C.J., and Wiesenfeld-Hallin, Z. (1986) Substance P and calcitonin gene– related peptide synergistically modulate the gain of the nociceptive flexor withdrawal reflex in the rat. Neurosci. Lett. 66, 226–230. 156. Le Greves, P., Nyberg, F., Terenius, L., and Ho¨kfelt, T. (1985) Calcitonin gene– related peptide is a potent inhibitor of substance P degradation. Eur. J. Pharmacol. 155, 309–311. 157. Oku, R., Satoh, M., Fuji, N., Otaka, A., Yajima, H., and Takagi, H. (1987) Calcitonin gene–related peptide promotes mechanical nociception by potentiating release of substance P from spinal dorsal horn in rat. Brain Res. 403, 350–354. 158. Kangrga, I., and Randic, M. (1990) Tachykinins and calcitonin gene–related peptide enhance release of endogenous glutamate and aspartate from the rat spinal dorsal horn slice. J. Neurosci. 10, 2026–2026. 159. Ryu, P.D., Gerber, G., Murase, K., and Randic, M. (1988) Calcitonin gene–related peptide enhances calcium current of rat dorsal root ganglion neurons and spinal excitatory synaptic transmission. Neurosci. Lett. 89, 305–312. 160. Biella, G., Panara, C., Pecile, A., and Sotgui, M.L. (1991) Facilitatory role of calcitonin gene–related peptide (CGRP) on excitation induced by substance P (SP) and noxious stimuli in rat spinal dorsal horn neurons. An iontophoretic study in vivo. Brain Res. 559, 352–356. 161. Levine, J.D., Fields, H.L., and Basbaum, A.I. (1993) Peptides and the primary afferent nociceptor. J. Neurosci. 13, 2273–2286. 162. Meyer, R.A., and Campbell, J.N. (1981) Myelinated nociceptive afferents account for the hyperalgesia that follows a burn to the hand. Science 213, 1527–1529. 163. LaMotte, C.C., Thalhammer, J.G., Torebjork, H.E., and Robinson, C.J. (1982) Peripheral neural mechanisms of cutaneous hyperalgesia following mild injury to heat. J. Neurosci. 2, 765–781. 164. Garthwaite, J., Charles, S.L., and Chess-Williams, R. (1988) Endothelium-derived relaxing factor release on activation of NMDA receptors suggests role as intracellular messenger in the brain. Nature 336, 385–388. 165. Gally, J.A., Read, P., Montagu, P.R., Reeke, Jr. G.N., and Edelman, G.M. (1990) The NO hypothesis: possible effects of a short-lived, rapidly diffusible signal in
52
166.
167.
168.
169.
170. 171.
172.
173. 174. 175.
176.
177.
178.
179.
180.
Merighi et al. the development and function of the nervous system. Proc. Natl. Acad. Sci. USA 87, 3547–3551. Moore, P.K., Oluyomi, A.O., Babbedge, R.C., Wallace, P., and Hart, S.L. (1991) l-NG-nitro-arginine methyl ester exhibits antinociceptive activity in the mouse. Br. J. Pharmacol. 102, 198–202. Coderre, T.J., and Yashpal, K. (1994) Intracellular messengers contributing to persistent nociception and hyperalgesia induced by l-glutamate and substance P in the rat formalin pain model. Eur. J. Neurosci. 6, 1328–1334. Kurihara, T., and Yoshioka, K. (1996) The excitatory and inhibitory modulation of primary afferent fibre-evoked responses of ventral roots in the neonatal rat spinal cord exerted by nitric oxide. Br. J. Pharmacol. 118, 1743–1753. Sakurada, T., Sugiyama, A., Sakurada, C., Tan-No, K., Yonezawa, A., Sakurada, S., and Kisara, K. (1996) Effect of spinal nitric oxide inhibition on capsaicin-induced nociceptive response. Life Sci. 59, 921–930. Meller, S.T., and Gebhart, G.F. (1993) Nitric oxide (NO) and nociceptive processing in the spinal cord. Pain 52, 127–136. Meller, S.T., Pechman, P.S., Gebhart, G.F., and Maves, T.J. (1992) Nitric oxide mediates the thermal hyperalgesia produced in a model of neuropathic pain in the rat. Neuroscience 50, 7–10. Radhakrishnan, V., Yashpal, K., Hui-Chan, C.W.Y., and Henry, J.L. (1995) Implication of a nitric oxide synthase mechanism in the action of substance P: l-NAME blocks thermal hyperalgesia induced by endogenous and exogenous substance P in the rat. Eur. J. Neurosci. 7, 1920–1925. McMahon, S., Lewin, G.R., and Wall, P.D. (1993) Central hyperexitability triggered by noxious inputs. Curr. Opin. Neurobiol. 3, 602–610. Oku, R., Satoh, M., and Takagi, H. (1987) Release of substance P from the spinal dorsal horn is enhanced in poyarthritic rats. Neurosci. Lett. 74, 315–319. Garry, M.G., Richardson, J.D., and Hargreaves, K.M. (1994) Sodium nitroprusside evokes the release of immunoreactive calcitonin gene-related peptide and substance P from dorsal horn slices via nitric oxide-dependent and nitric oxide-independent mechanisms. J. Neurosci. 14, 4329–4337. Aimar, P., Pasti, L., Carmignoto, G., and Merighi, A. (1998) Nitric oxide-producing islet cells modulate the release of sensory neuropeptides in the rat substantia gelatinosa. J. Neurosci. 18, 10375–10388. Dohrn, C.S., and Beitz, A.J. (1994) NMDA receptor messenger-RNA expression in NOS-containing neurons in the spinal trigeminal nucleus of the rat. Neurosci. Lett. 175, 28–32. Dougherty, P.M., Palecek, J., Zorn, S., and Willis, W.D. (1993) Combined application of excitatory amino acids and substance P produces long-lasting changes in responses of primate spinothalamic tract neurons. Brain Res. Rev. 18, 227–246. Dougherty, P.M., and Willis, W.D. (1991) Enhancement of spinothalamic neuron responses to chemical and mechanical stimuli following combined micro-ionotophoretic application of N-methyl-d-aspartate and substance P. Pain 4, 85–93. Randic, M., Hecimovic, H., and Ryu, P.D. (1990) Substance P modulates glutamate-induced currents in acutely isolated rat spinal dorsal horn neurones. Neurosci. Lett. 117, 74–74.
Nitric Oxide and Pain Perception
53
181. Takano, K., Stanfield, P.R., Nakajima, S., and Nakajima, Y. (1995) Protein kinase C–mediated inhibition of an inward rectifier potassium channel by substance P in nucleus basalis neurons. Neuron 14, 999–1008. 182. Sakurada, T., Manome, Y., Tan-No, K., Sakurada, S., Onba, M., Kisara, K., and Terenius, L. (1993) A selective and extremely potent antagonist of the neurokinin1 receptor. Regul. Peptides 46, 326–328. 183. Honore´, P., Chapman, V., Buritova, J., and Besson, J.-M. (1995) Reduction of carrageenin oedema and the associated c-Fos expression in the rat lumbar spinal cord by nitric oxide synthase inhibitor. Br. J. Pharmacol. 114, 77–84. 184. Minami, T., Nishihara, I., Ito, S., Sakamoto, K., Hyodo, M., and Hayaishi, O. (1995) Nitric oxide mediates allodynia induced by intrathecal administration of prostaglandin E2 or prostaglandin F2α in conscious mice. Pain 61, 285–290. 185. Morris, R., Southam, E., Gittins, S.R., De Vente, J., and Garthwaite, J. (1994) The NO-cGMP pathway in neonatal rat dorsal horn. Eur. J. Neurosci. 6, 876–879. 186. Traub, R.J., Solodkin, A., and Gebhart, G.F. (1994) NADPH-diaphorase histochemistry provides evidence for a bilateral, somatotopically inappropriate response to unilateral hindpaw inflammation in the rat. Brain Res. 647, 113–123. 187. Traub, R.J., Solodkin, A., Meller, S.T., and Gebhart, G.F. (1994) Spinal cord NADPH-diaphorase histochemical staining but not nitric oxide synthase immunoreactivity increases following carrageenan-produced hindpaw inflammation in the rat. Brain Res. 668, 204–210. 188. Vizzard, M.A., Erdman, S.L., and De Groat, W.C. (1995) Increased expression of neuronal nitric oxide synthase (NOS) in visceral neurons after nerve injury. J. Neurosci. 15, 4033–4045. 189. Wiertelak, E.P., Furness, L.E., Watkins, L.R., and Maier, S.F. (1994) Illness-induced hyperalgesia is mediated by a spinal NMDA-nitric oxide cascade. Brain Res. 664, 9–16. 190. Mene´trey, D., and Besson, J.-M. (1988) Electrophysiological characteristics of dorsal horn cells in rats with cutaneous inflammation resulting from chronic arthritis. Pain 13, 343–364. 191. Ribeiro-Da-Silva, A., and Coimbra, A. (1982) Two types of synaptic glomeruli and their distribution in laminae I-III of the rat spinal cord. J. Comp. Neurol. 209, 176– 186. 192. Bernardi, P.S., Valtschanoff, J.G., Weinberg, R.J., Schmidt, H.H.H.W., and Rustioni, A. (1995) Synaptic interactions between primary afferent terminals and GABA and nitric oxide-synthesizing neurons in superficial laminae of the rat spinal cord. J. Neurosci. 15, 1363–1371. 193. Peunova, N., and Enikolopov, G. (1993) Amplification of calcium-induced gene transcription by nitric oxide in neuronal cells. Nature 364, 450–453. 194. Zhuo, M., Small, S.A., Kandell, E.R., and Hawkins, R.D. (1993) Nitric oxide and carbon monoxide produce long-term enhancement of synaptic transmission in the hippocampus by an activity-dependent mechanism. Science 260, 1946–1949. 195. Duggan, A.W., Hope, P.J., Jarrott, B., Schaible, H.G., and Fleetwood-Walker, S.M. (1990) Release, spread and persistence of immunoreactive neurokinin A in the dorsal horn of the cat following noxious cutaneous stimulation. Studies with antibody microprobes. Neuroscience 35, 195–195.
3 Ischemic and Metabolic Stress–Induced Apoptosis James David Adams, Jr., Suman K. Mukherjee, Lori Klaidman, and Maria Morales University of Southern California, Los Angeles, California
Lawrence R. Williams,* Glen Inouye, and Vierka Cummins Amgen, Inc., Thousand Oaks, California
I. INTRODUCTION Patients who suffer from strokes typically exhibit a progressive neurodegeneration after admission to the hospital. This may be due to a delayed increase of the lesion in their brains, which strongly suggests that apoptosis is involved in stroke, since apoptosis is a delayed process. This delayed neurodegenerative process can last for days or even weeks and provides a time window for the treatment of stroke. Stroke is caused by thrombosis or embolism in the brain vasculature. A drug, tissue plasminogen activator (tPA), that accelerates thrombolysis has become accepted therapy in stroke. Clearly blood flow must be reestablished as quickly as possible following a stroke. Neuroprotective agents should then be used to enhance survival of brain cells. It may be possible that combination therapy, with a thrombolytic agent, combined with a neuroprotective agent, will be of great utility in stroke. Cell death occurs in stroke by two mechanisms, necrotic and apoptotic, as discussed below. Neuroprotective agents that inhibit apoptotic mechanisms are of potential interest in the treatment of stroke. There has been considerable dis-
* Present address: Guilford Pharmaceuticals, Baltimore, Maryland.
55
56
Adams et al.
cussion in the literature about the characterization of apoptosis and necrosis, how these processes differ, and how to use pharmacological agents to stop these processes. II. APOPTOSIS CHARACTERIZATION Apoptosis in the brain has been well characterized over the last few years by both electron and light microscopy (1–4). Cells undergoing apoptosis condense and develop very dark cytoplasms, which also contain very large vacuoles and lipofuscin (Fig. 1). There is no obvious rupture of the cytoplasmic or other membranes, yet a large amount of the intracellular fluid is lost to the extracellular spaces and appears as an edematous area surrounding the cell. The mechanism involved in this loss of intracellular fluid has not been characterized. Endothelial cells may form blebs into the vascular spaces during apoptosis. Cytoplasmic and mitochondrial functions appear to remain in tact, such as the immunochemical staining of tyrosine hydroxylase in dopaminergic neurons (Fig. 1). A few mitochondria in an apoptotic cell may change shape or become very dark and condensed. The condensed mitochondrial remnants appear as clumps of very dark material in the cell. Nuclear material changes such that nucleoli disappear and chromatin disperses. Small vacuoles may form in the nucleus. Then clumps of nuclear material form along the edges of the nucleus. Soon, the nucleus becomes very dark and condensed, and can be called pyknotic. Next, the nucleus begins
Figure 1 The differences between apoptosis and necrosis are demonstrated in these electron microscopic images of mouse brain from control, tBuOOH- or MPTP-treated mice. (a) Control mouse neuron. (b) Necrotic neuron from a tBuOOH-treated mouse, showing swelling and rupture of the cytoplasmic membrane and nuclear membrane. The cytoplasm is swollen with fluid and contains material that has leaked out of the nucleus. The nucleus is swollen and contains diffuse nuclear material. (c) Apoptotic neuron from a tBuOOHtreated mouse, showing very large vacuoles, a condensed cytoplasm, and a condensed nucleus, which has changed shape. One of the mitochondria has changed shape and is no longer rod-shaped. Apoptotic bodies are present, which are very dense structures near the cell. (d) Control mouse dopaminergic neuron showing dense cytoplasmic immunocytochemical staining for tyrosine hydroxylase. (e) Necrotic dopaminergic neuron showing a swollen cytoplasm that still contains faintly staining tyrosine hydroxylase and a swollen nucleus. Further swelling and degeneration leads to the loss of tyrosine hydroxylase staining. Some of the mitochondria are somewhat swollen. (f) Apoptotic dopaminergic neuron showing tyrosine hydroxylase staining, a highly condensed cytoplasm and nucleus, and large vacuoles in the cytoplasm. Bar length in D is 1 µm and is representative of the magnification in all the photographs.
Ischemic and Metabolic Stress Induce Apoptosis
(a)
(b)
(c)
57
58
Adams et al.
(d)
(e) Figure 1
Continued
to change shape and becomes very contorted in comparison to the normal nucleus. The nucleus and the cell then begin to split up into many, small, membranebound structures, called apoptotic bodies. The apoptic bodies are phagocytized by neighboring cells or by macrophages, which occurs fairly rapidly over the next few hours. In general, cells that die by becoming shrunken and dark, such as red neurons in stroke models, neurofibrillary tangles in Alzheimer’s disease,
Ischemic and Metabolic Stress Induce Apoptosis
59
(f) Figure 1 Continued
and similar cells, die by apoptosis. Evidence is accumulating which suggests that apoptosis contributes to brain infarction in stroke.
III.
NECROSIS CHARACTERIZATION
The center of the lesion in stroke is undoubtedly formed mostly by necrotic cells. Necrosis is a rapid process that occurs within minutes of an insult (1–4). The cytoplasm becomes watery and swollen (Fig. 1). Vacuoles and lipofuscin may be seen in the cytoplasm. The vacuoles are smaller than the vacuoles seen in apoptosis. Cytoplasmic and mitochondrial functions may be lost, such as triphenyltetrazolium chloride (TTC) staining of mitochondria and tyrosine hydroxylase immunochemical staining of dopaminergic neurons (Fig. 1). A few mitochondria in a necrotic cell may swell. The nucleus also becomes swollen and much less electron-dense due to chromatin dispersal. Pores form in the nuclear membrane allowing the contents to leak into the cytoplasm. Pores can form in the plasma membrane allowing the contents of the cell to spill into the extracellular spaces. Eventually all that is left of the cell is debris from the organelles and nucleus. This debris is cleared over the next few days by macrophages and polymorphonuclear leukocytes. However, in areas where extensive death of cells
60
Adams et al.
through necrosis has occurred, the cellular debris is very slowly cleared over the next weeks or months with the formation of glial scars. Necrosis can continue to be seen in the brain even days after an insult and may be caused by secondary events, such as delayed reperfusion, loss of supporting astrocytes, breakdown of the blood–brain barrier, inflammation, and other factors. However, progression of the lesion probably involves apoptosis.
IV.
MECHANISMS OF INDUCTION OF APOPTOSIS
DNA fragmentation (Fig. 2) induces necrosis and apoptosis (1,5). DNA oxidation and fragmentation are very early effects of oxidative stress in the brain, with measurable changes in DNA occurring within a few minutes of an insult (1,5–7). A high dose of an oxidative stress–inducing agent such as t-butylhydroperoxide (tBuOOH) induces immediate, large-scale DNA fragmentation and predominantly necrosis (1,5). A small dose of tBuOOH induces a small amount of DNA
Figure 2
Scheme of mechanisms of apoptosis and necrosis.
Ischemic and Metabolic Stress Induce Apoptosis
61
fragmentation initially. However, apoptotic processes are triggered by this smallscale DNA fragmentation such that endonucleases are eventually activated, resulting in large amounts of DNA fragmentation and apoptosis that is maximal by 24 h or later (1,5). Necrosis is induced by massive insults that overcome the defense mechanisms of cells. Apoptosis is induced by moderate insults that activate apoptotic processes and cause a cell to kill itself. Examples of moderate insults include mild ischemia and reperfusion such as in the penumbra area (8,9), low doses of tBuOOH (1,5), and low doses of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) (4). As much as 20–30% or more of the lesion produced in ischemia and reperfusion is due to apoptotic cell death (8). DNA damage causes the activation of the nuclear enzyme poly(ADP-ribose) polymerase (PARP) (Fig. 2), which binds to DNA nicks and fragments and is activated by the binding process (10). PARP contains two zinc fingers in the N-terminal portion of the protein, which bind to and stabilize DNA nicks (11). This allows the DNA to eventually be repaired. The C-terminal portion of PARP then catalyzes the synthesis of poly(ADP-ribose) from NAD and the conjugation of poly(ADP-ribose) onto proteins, including the middle region of PARP (10,11). PARP is also involved in base excision repair processes (12) and stimulates DNA transcription (13). Excessive PARP activity can result in depletion of brain NAD and another adenine containing compound, ATP (1,14, manuscript in preparation). This may compromise cellular energetics. Mice that express an inactive form of PARP can be resistant to ischemia- and reperfusion-induced brain damage (14,15). Susceptibility to brain damage may depend on the form of PARP expressed by the mice (16). Mice that have a mutation of the C-terminal region of PARP and express an inactive form of PARP that is still capable of binding to and stabilizing DNA nicks may be resistant to ischemia and reperfusion. However, mice expressing a form of PARP with a mutation in the N-terminal area, which cannot bind to DNA nicks, may not be resistant to ischemia and reperfusion. A.
t-Butyl Hydroperoxide Model
We have used tBuOOH to induce oxidative stress and neurodegeneration in the brain. tBuOOH-treated mice are a model for the study of the effects of oxidative stress in the brain, such as the oxidative stress associated with stroke and other conditions. Administration of tBuOOH intracerebroventricularly allows the compound to rapidly penetrate into the brain and induce oxidative stress (17). When administered in high doses that result in 1 mM tBuOOH in the brain (18), tBuOOH causes DNA fragmentation, glutathione (GSH) oxidation, protein sulfhydryl oxidation, edema, and lipid peroxidation (15,17,19). The brain mounts various defense mechanisms against tBuOOH toxicity such as increased GSH turnover, increased cellular availability of GSH, and increased activity of gluta-
62
Adams et al.
thione disulfide (GSSG) reductase (20,21). tBuOOH affects a number of neurons in the brain including dopaminergic, serotonergic, GABAergic, cholinergic, and others (19). The compound also affects astrocytes, endothelial cells, and oligodendroctyes (19). Older and senescent mice are more susceptible to the toxic effects of tBuOOH than are younger mice (3,20,21). Perhaps the most age-sensitive effect of tBuOOH is the fragmentation of DNA, to which senescent mice are particularly susceptible (1,22). B.
MPTP Model
We have also used MPTP, which is 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, to induce oxidative stress and neurodegeneration in the brain, which is partly due to its ability to interfere with mitochondrial function (23). MPTP has been used to model Parkinson’s disease in animals. MPTP is bioactivated by monoamine oxidase B to MPP ⫹, which is 1-methyl-4-phenylpyridine, such that monoamine oxidase B knock-out mice, which do not express the enzyme, are resistant to MPTP toxicity (24). MPP ⫹ is reduced by a number of different enzymes including tyrosine hydroxylase, monoamine oxidase, xanthine dehydrogenase, aldehyde dehydrogenase, lipoamide dehydrogenase, and NADH dehydrogenase (25–27). The result of the two-electron reduction is the induction of oxygen radical formation and redox cycling of MPP ⫹. MPTP administration causes brain levels of GSH to change, GSSG levels to increase, and protein sulfhydryl levels to decrease in some brain regions (26,27). GSSG reductase is involved in protection against MPTP toxicity (28,29), since it reduces the GSSG produced during MPTP-induced oxidative stress. Vitamin E–deficient mice are more susceptible to MPTP toxicity than are normal mice (30). These facts demonstrate the importance of oxidative stress in the neurotoxicity of MPTP. MPTP induces necrosis and apoptosis in the brain and causes DNA fragmentation (4). Dopaminergic neurons in the midbrain have been observed to undergo apoptosis following MPTP administration (Fig. 1). C.
Focal Ischemia and Reperfusion Model
Focal cerebral ischemic stroke results in the neurodegeneration of cortical and other brain tissue and loss of function (31,32). Cessation of blood flow to the brain, whether permanent or transient, results in pannecrosis (infarction) to those areas that are truly ischemic. The penumbral areas surrounding the anoxic and aglycemic core are susceptible to a variety of toxicities created by ischemia that include overexposure to glutamate, oxygen radicals, and cytokines. Recent evidence indicates that, especially in the penumbra, delayed cellular death (apoptosis) by caspase activation (see Sec. IX) and DNA fragmentation can be a major contributor to the total infarcted tissue (33–39). In an intraluminal thread
Ischemic and Metabolic Stress Induce Apoptosis
63
paradigm of transient focal cerebral ischemia, Li and Chopp and colleagues (8,33) studied in detail the involvement of apoptotic mechanisms in the progression of tissue infarction. They reported a temporal progression of cells including neurons that label histochemically with the TUNEL method for identifying doublestranded DNA breaks and, using northern analysis of DNA in ischemic tissue, found a characteristic laddering of fragments indicative of apoptotic processes. Similarly, Du et al., in a model of mild transient ischemia (9), found a substantial involvement of TUNEL-positive cells (with coincident DNA laddering) contributing to the progress of a reportedly delayed cortical infarction. Cortical infarction is significantly reduced when apoptosis is presumably inhibited in animals treated with caspase inhibitors (40–42). In the present work we report some of our findings from experiments with a model of focal ischemia and reperfusion. 1. Materials and Methods Model Long-Evans male rats (body weight 300–350 g, Harlan Sprague-Dawley, Indianapolis, IN) were used in this study. Housing and anesthesia concurred with guidelines established by the institutional Animal Studies Committee and were in accordance with the PHS Guide for the Care and Use of Laboratory Animals, USDA Regulations, and the AVMA Panel on Euthanasia guidelines. Rats were allowed free access to water and rat chow (Wayne, Chicago, IL) before and after surgery. Under isoflurane anesthesia in a mixture of 30% O 2 and 70% N 2, animals were first implanted with an intraventricular cannula connected to an Alzet miniosmotic pump (43,44), and pretreated with PBS vehicle or glial cell line–derived neurotrophic factor (GDNF, Amgen, Inc., Thousand Oaks, CA) infused at 10 µg/ day for 1 day prior to the middle cerebral artery (MCA) occlusion; other animals were left untreated without a cannula. Mild transient focal cerebral ischemia was accomplished by occlusion of the MCA in a modification of the procedure described by Du et al. (9), as modified by Buchan et al. (45). The core body temperature of anesthetized animals was maintained at 37 ⫾ 0.5°C throughout the surgical procedure using a homeothermic water blanket under the animal and a heating lamp linked to an electronic temperature controller (YSI Model 73A, Yellow Springs, OH) regulated by a rectal thermometer. The right MCA was occluded using a Sundt #1 microaneurysm clip within 1 mm distal to its crossing of the rhinal fissure and the inferior cerebral vein. Both common carotid arteries were then occluded using nontraumatic aneurysm clips. The MCA was occluded for 45 min. At the end of the ischemic period, the aneurysm microclip and the carotid arterial clips were removed. Reperfusion of the arteries was confirmed by visual observation. 2. Histochemistry At 1 and 3 days after reperfusion, the animals were reanesthetized and perfused intracardially with 4% buffered paraformaldehyde. The brains were removed and
64
Adams et al.
sectioned into seven 2-mm coronal blocks used traditionally for analysis of infarct volume using TTC histochemistry. The blocks were embedded in paraffin, which allowed 5-µm sections to be collected from those blocks representing regions 2, 4, and 6 of the traditional seven-block set. The sections were processed with TUNEL histochemistry (Apotag, Intergen, Purchase, NY) to label cells with double-stranded DNA breaks. The number of TUNEL-positive cells was counted throughout the affected cortex in each of three sections per brain from untreated, vehicle-treated, and GDNF-treated rats (n ⫽ 6 per group). In addition, tissue was collected from the ischemic cortex at 3 days after the mild transient ischemia and prepared for analysis of DNA fragmentation by northern blot. 3.
DNA Extraction Method, Gel Electrophoresis, and Autoradiography
Brain tissue (50–100 mg) was gently disrupted in a hand-operated glass/glass Dounce homogenizer in 500 µl of lysis buffer (5 mM Tris-HCl, pH 7.4, containing 0.5% Triton X-100) and incubated on ice for 20 min. Samples were then spun for 20 min at 800g to remove nuclei and cellular debris. The supernatant was extracted with an equal volume of phenol chloroform isoamyl alcohol mixture (25:24 :1). After centrifugation for 30 min at 2700g, DNA in the aqueous phase was precipitated twice with ethanol. The DNA pellet was resuspended in 20 µl of Tris-EDTA buffer (pH 8.0) and treated with 20 µg/ml RNase A for 45 min at 37°C to digest RNA. After quantitation, 2 µg of DNA was labeled with 32 P-deoxycytosine triphosphate (dCTP) by a standard protocol involving the Klenow fragment of DNA polymerase 1. DNA in the samples was then reextracted as above to get rid of unincorporated nucleotide, resuspended in DNA loading buffer, and applied onto a 2% agarose submerged gel. After electrophoresis, the gel was dried in a vacuum-driven gel drier and exposed for 4–24 h to autoradiographic film, which was then developed. 4.
Results and Discussion—Focal Ischemia and Reperfusion
Figure 3 illustrates the profusion of TUNEL-positive cells in the ischemic cortex 3 days following a mild 45-min transient focal ischemia, in agreement with Du et al. (9). Such profiles were not frequent at 1 day of reperfusion (data not shown). Double labeling with glial fibrillary acidic protein (GFAP) immunohistochemistry, a marker for reactive astrocytes, resulted in only 10% of the TUNEL-positive cells double labeling with GFAP, indicating that most of the TUNEL-positive cells are neurons. As seen in Fig. 3, most of the TUNEL-positive cells have neuronal morphology. In addition, the TUNEL-positive cells are all dark and shrunken with very dark or pyknotic nuclei, which is indicative of apoptosis. Figure 4 shows DNA laddering in the cerebral cortex that suffered ischemia and reperfusion. This is further evidence of apoptosis.
Ischemic and Metabolic Stress Induce Apoptosis
65
Figure 3 TUNEL-positive cells in the cerebral cortex after 45 min of focal ischemia and 3 days of reperfusion. A large number of TUNEL-positive cells are present. The morphology of these cells resembles that of neurons and are GFAP-negative.
Figure 4 Autoradiographic image of DNA laddering after 45 min of focal ischemia and 3 days of reperfusion. The DNA laddering pattern resolved by this method is indicative of DNA fragmentation associated with apoptosis. Details of the method are given in the text. One lane is 1 µg of DNA. The other lane is 2 µg of DNA. Control DNA samples showed no fragmentation.
66
Adams et al.
Figure 5 GDNF protection of the brain subjected to ischemia and reperfusion. Quantitative data were obtained from the analysis of three coronal sections representative of the rostral-caudal extent of the ischemic cortex after 3 days of reperfusion. The bars illustrate the total number of TUNEL-positive cells counted. GDNF treatment substantially decreased the incidence of TUNEL staining in the cortex.
Figure 5 illustrates the quantitative data for apoptotic cells from the experimental groups. In the untreated and vehicle-treated animals subjected to ischemia and reperfusion, around 2000 total TUNEL-positive cells were present in the three sections examined in each brain. In the GDNF-treated group subjected to ischemia and reperfusion, the number of TUNEL-positive cells was reduced by 60%.
V.
NEUROTROPHINS
In vitro, many types of neurons are dependent for their survival on the presence of identified neurotrophic factors (NTFs), such as nerve growth factor (NGF) and GDNF. GDNF is a recently discovered protein identified and purified using assays based on its very potent efficacy in promoting the survival and stimulating the transmitter phenotype of mesencephalic dopaminergic neurons in vitro (46). Subsequent experiments have found that GDNF has neurotrophic efficacy on brainstem, spinal cord, and basal forebrain cholinergic motor neurons, both in vivo and in vitro (47,48). Johnson and colleagues have elegantly shown that upon
Ischemic and Metabolic Stress Induce Apoptosis
67
trophic factor withdrawal, cultured neurons die via an apoptotic process involving caspase activation (49,50). The apoptotic process can be interrupted or blocked by readdition of NTFs. Apoptotic processes initiated by glutamate toxicity and oxidative stress can be prevented by the administration of NTFs (51). In vivo, exogenous administration of neurotrophic factors, such as NGF (52,53), brainderived neurotrophic factor (BDNF) (54–56), and fibroblast growth factor (FGF) (57,58), has been shown to be neuroprotective in models of both global and focal cerebral ischemia. In particular, we found that GDNF provided significant neuroprotection following severe, transient, focal ischemia (43,44,59). The mechanism(s) mediating such neuroprotection is not clear but certainly may include blocking apoptotic processes. In the present study, we demonstrate the ability of GDNF to affect the apparent apoptotic processes in a model of mild transient focal ischemia. Neurotrophins increase the survival of neurons in culture by preventing apoptosis. GDNF decreases the infarct lesion during focal ischemia and reperfusion, which demonstrates that GDNF, or a compound that stimulates GDNF production, may be useful in stroke patients. GDNF belongs to the family of transforming growth factor–β (TGF-β) NTFs. These factors are soluble proteins with a cystine knot structure and are structurally related to the neurotrophins (60). There are three distinct receptors for the TGF-β proteins. Binding of GDNF dimers to the receptors causes phosphorylation of the receptors and propagation of signal transduction mechanisms.
VI.
NEUROPROTECTIVE AGENTS
A number of potential neuroprotective agents have been designed, many of which are antioxidants, in an attempt to prevent the ravages of oxidative stress on brain lipids. Our experience with antioxidants and other compounds in tBuOOH-treated mice has been discouraging (Table 1). Most of the compounds show no ability to increase the survival of mice treated with tBuOOH. However, nicotinamide (vitamin B 3) is the exception. Nicotinamide greatly increases the survival of mice subjected to neurodegenerative insults. Large doses of tBuOOH (110 mg/kg, ICV) induce a largely necrotic lesion that results in 94% mortality within 24 h. Most mice die within 4 h. A number of compounds were tested and found to not increase survival following tBuOOHinduced necrosis. These agents include N-acetylcysteine used as an antioxidant (160 mg/kg, 15 min prior to tBuOOH), the calcium channel blocker nifedipine (0.4 mg/kg, 20 min prior to tBuOOH), the antioxidant vitamin C (100 mg/kg, 30 min prior to tBuOOH), the antioxidant GM1 ganglioside (30 mg/kg, 20 min prior to tBuOOH), and the anti-inflammatory steroid 6-α methylprednisolone (30 mg/kg, 20 min prior to tBuOOH).
68
Adams et al.
Table 1 Apoptosis and Neuroprotective Agents a Treatment TbuOOH TbuOOH TbuOOH TbuOOH TbuOOH TbuOOH TbuOOH TbuOOH TbuOOH
Survivors/total (22mg/kg, ICV) ⫹ nicotinamide (500 mg/kg) ⫹ flunarazine (1.5 mg/kg) ⫹ verapamil (0.2 mg/kg) ⫹ acetyl-l-carnitine (100 mg/kg) ⫹ desferal (170 mg/kg) ⫹ U-74500A (30 mg/kg) ⫹ U-83836E (30 mg/kg) ⫹ U-74389G (30 mg/kg)
13/26 13/16 b 4/7 2/6 4/7 4/6 7/13 0/6 8/13
a
Low-dose tBuOOH (22 mg/kg, ICV) was administered to induce apoptosis. Some mice were pretreated with nicotinamide (0–9 h), flunarizine (20 min), verapamil (10 min), acetyl-l-carnitine (2 h), desferal (30 min), or lazaroids (30 min) before tBuOOH administration. Lazaroids were U-74500A, a 21-aminosteroid, U-83836E, a purified enantiomer of a 2-methylchroman; and U-74389G, which is 16-desmethyltirilazad, the active metabolite of tirilazad. Survival was assessed at 24 h after tBuOOM. b Significantly different from tBuOOH alone by the Chi-square test (p⬍0.05).
Small doses of tBuOOH (22 mg/kg, ICV) induce a largely apoptotic lesion that results in about 50% mortality within 24 h. Most mice die after about 6 h. A number of agents have been tested and found to be ineffective at increasing survival due to tBuOOH-induced apoptosis. These agents include flunarizine and verapamil (calcium channel blockers), acetyl-l-carnitine (aids mitochondrial energetics), desferal (iron chelator), and various lazaroids (antioxidants). Only nicotinamide (500 mg/kg) significantly increases the survival of apoptosis induced by tBuOOH. The increase in survival was found after administering nicotinamide simultaneously with tBuOOH or 9 h before tBuOOH.
VII. PARP INHIBITION Inhibition of PARP by 3-aminobenzamide, nicotinamide, and other compounds is an obvious way to prevent the depletion of NAD and ATP that compromises cellular energetics (14,61,62). PARP is activated by binding to DNA nicks and fragments, which may lead to depletion of NAD. Inhibition of PARP may not result in increased DNA fragmentation (1,3). PARP inhibitors usually bind to the NAD binding site, which is in the C-terminal region. Therefore, these inhibi-
Ischemic and Metabolic Stress Induce Apoptosis
69
tors may not prevent the N-terminal portion of PARP from binding to and stabilizing DNA nicks. This stabilization may allow DNA repair to progress. In fact, PARP inhibitors, including nicotinamide, are known to diminish the lesion seen following ischemia and reperfusion (14,61,62). Neurotrophins may inhibit the synthesis of PARP and are known to enhance NAD levels during oxidative stress (63). So PARP could be an important factor in the mechanism of action of GDNF in rats subjected to focal ischemia and reperfusion.
VIII. NICOTINAMIDE One approach to aiding cellular energetics is to give nicotinamide, which is a precursor for NAD (1,3,4,22). Nicotinamide penetrates rapidly into the brain by a specific, active uptake mechanism (64). In the brain, it is converted to NAD such that within a few hours brain NAD levels can double (1,3,4,20). ATP levels also increase following nicotinamide administration (manuscript in preparation). NAD and ATP are both critical to mitochondrial function, whereby NAD is reduced to NADH and ATP provides energy. Both NAD and ATP are also critical to nuclear function since ATP is required for DNA synthesis and NAD is required for DNA repair. High brain NAD levels protect mice against ischemia and reperfusion, tBuOOH (1,3) and MPTP toxicity (4). High brain NAD levels prevent, or decrease, necrosis and apoptosis (1,3,4,20). Nicotinamide also has other neuroprotective effects such as lowering body temperature, a well-known neuroprotective effect, inhibition of the induction of NO synthase, and stimulation of the regrowth of endothelial cells following ischemia and reperfusion (60).
IX. NAD AND DNA REPAIR PARP is activated very early in the apoptotic program by DNA nicks (Fig. 6). When NAD levels are high, such as 9 h after nicotinamide administration, DNA repair proceeds very rapidly such that PARP activation is not seen 20 min after administration of tBuOOH. High NAD allows PARP to very rapidly poly(ADPribosylate) several enzymes critical to stopping the apoptotic program. For instance, PARP deactivates endonucleases (65), which may prevent endonucleasestimulated DNA fragmentation. PARP also activates DNA ligase, which stimulates DNA repair (65). Therefore, when NAD levels are high, the apoptotic program is stopped before potentially damaging events can occur, such as NAD or ATP depletion. When NAD levels are normal during the apoptotic program, histones are poly(ADP-ribosylated) by PARP which causes them to detach from DNA and form octamers (66). This detachment of histones makes DNA more susceptible
70
Adams et al.
Figure 6 PARP activity in brain regions from t-BuOOH-treated mice. Controls include untreated mice and mice treated with nicotinamide (500 mg/kg, IP, 13 h prior to brain removal). There was no difference between untreated and nicotinamide-treated mice, so the data were combined (n ⫽ 8). tBuOOH mice were treated with t-BuOOH (110 mg/kg, ICV, 20 min prior to brain removal, n ⫽ 4). t-BuOOH ⫹ nicotinamide mice were treated with nicotinamide (500 mg/kg, iP, 13 h) and t-BuOOH (110 mg/kg, ICV, 20 min, n ⫽ 4). Data are expressed as means ⫾ SD. *Significantly different from control values by ANOVA with Newman Keul’s test ( p ⬍ 0.05). PARP activity was measured by incubating brain homogenates with DNA and 14C-NAD, then precipitating proteins and measuring the amount of radioactive ADP-ribose bound to proteins. Control brain PARP activity was 1.5 ⫾ 0.2 pmol/min/mg protein.
Ischemic and Metabolic Stress Induce Apoptosis
71
to fragmentation. PARP-induced NAD and ATP depletion may result in calcium influx into the cell, since ATP is needed to keep calcium out of cells. NAD depletion occurs due to oxidative stress induction (1) and during reperfusion following focal ischemia in the brain (Fig. 7). Calcium influx activates endonucleases, which cleaves DNA into nucleosome-sized fragments. These fragments are responsible for the DNA laddering seen during apoptosis. PARP is cleaved by caspases (67), which are induced early in the apoptotic program (39,68). This should decrease PARP activity. Yet PARP is found in large excess in the nucleus, such that cleavage of some of the PARP enzymes may just allow the activation of other PARP enzymes. However, if PARP is not deactivated, it might not be possible for DNA fragmentation to occur, since PARP stabilizes and aids in the repair of DNA nicks and other DNA damage. Caspases, especially caspase-3 (CPP32/Yama/apopain), cleave PARP at the N-terminal and other regions such that stabilization of DNA nicks cannot occur. Caspase inhibitors decrease apoptosis and infarct volume in ischemia and reperfusion (69), presumably by decreasing the proteolysis of PARP. Mice expressing a mutant, inactive caspase are resistant to apoptosis caused by cerebral ischemia and reperfusion (70). Therefore, caspases and PARP are very important in apoptosis associated with ischemia and reperfusion. The prevention of lesion progression is a new approach to the treatment of stroke. Agents that prevent apoptosis continue to be tested in animal models
Figure 7 NAD levels in brain regions derived from rats subjected to 90 min of ischemia and 30 min of reperfusion in the middle cerebral artery occlusion model. NAD levels are expressed as means and SD (n ⫽ 3) in units of µmol/g tissue. Ischemia-reperfusion samples came from the right side of the brain, which would demonstrate an infarct after 24 h. Sham samples came from the left side of the brain. NADH levels increased significantly in the cerebral cortex subjected to ischemia and reperfusion (0.045 ⫾ 0.006) compared to sham levels (0.025 ⫾ 0.011). *Significantly different from control levels by Student’s paired t test.
72
Adams et al.
of stroke and neurodegeneration. This approach could lead to a new era in the treatment and management of stroke patients.
REFERENCES 1. Adams, J.D., Mukherjee, S.K., Klaidman, L.K., Chang, M.L., and Yasharel, R. (1996) Apoptosis and oxidative stress in the aging brain. Ann. N.Y. Acad Sci. 786, 135–151. 2. Nitatori, T., Sato, N., Waguri, S., Karasawa, Y., Araki, H., Shibanai, K., Kominami, E., and Uchiyama, Y. (1995) Delayed neuronal death in the CA1 pyramidal cell layer of the gerbil hippocampus following transient ischemia is apoptosis. J. Neurosci. 15, 1001–1011. 3. Klaidman, L.K., Mukherjee, S.K., Hutchin, T.P., and Adams, J.D. (1996) Nicotinamide as a precursor for NAD ⫹ prevents apoptosis in the mouse brain induced by tertiary-butylhydroperoxide. Neurosci. Lett. 206, 5–8. 4. Mukherjee, S.K., Klaidman, L.K., Yasharel, R., and Adams, J.D. (1997) Increased brain NAD prevents neuronal apoptosis in vivo. Eur. J. Pharmacol. 30, 27–34. 5. Mukherjee, S.K., Yasharel, R., Klaidman, L.K., Hutchin, T.P., and Adams, J.D. (1995) Apoptosis and DNA fragmentation as induced by tertiary butylhydroperoxide in the brain. Brain Res. Bull. 38, 595–604. 6. Liu, P.K., Hsu, C.Y., Dizdaroglu, M., Floyd, R.A., Kow, Y.W., Karakaya, A., Rabow, L.E., and Cui, J.K. (1996) Damage, repair, and mutagenesis in nuclear genes after mouse forebrain ischemia-reperfusion. J. Neurosci. 16, 6795–6806. 7. Chen, J., Jin, K., Chen, M., Pei, W., Kawaguchi, K., Greenberg, D.A., and Simon, R.P. (1997) Early detection of DNA strand breaks in the brain after transient focal ischemia: implications for the role of DNA damage in apoptosis and neuronal cell death. J. Neurochem. 69, 232–245. 8. Li, Y., Chopp, M., Jiang, N., Yao, F., and Zaloga, C. (1995) Temporal profile of in situ DNA fragmentation after transient middle cerebral artery occlusion in the rat. J. Cereb. Blood Flow Metab. 15, 389–397. 9. Du, C., Hu, R., Csernansky, C.A., Hsu, C.Y., and Choi, D.W. (1996) Very delayed infarction after mild focal cerebral ischemia: a role for apoptosis? J. Cereb. Blood Flow Metab. 16, 195–201. 10. Schreiber, V., Hunting, D., Trucco, C., Gowans, B., Grunwald, D., De Murcia, G., and De Murcia J.M. (1995) A dominant negative mutant of human poly(ADP-ribose) polymerase affects cell recovery, apoptosis, and sister chromatid exchange following DNA damage. Proc. Natl. Acad. Sci. USA 92, 4753–4757. 11. Dantzer, F., Nasheuer, H.P., Vonesch, J.L., de Murcia G., and de Murcia, J.M. (1998) Functional association of poly(ADP-ribose) polymerase with DNA polymerase alpha-primase complex: a link between DNA strand break detection and DNA replication. Nucleic Acids Res. 26, 1891–1898. 12. Wilson, D.M., and Thompson, L.H. (1997) Life without DNA repair. Proc. Natl. Acad. Sci. USA 94, 12754–12757. 13. Meisterernst, M., Stelzer, G., and Roeder, R.G. (1997) Poly(ADP-ribose) polymer-
Ischemic and Metabolic Stress Induce Apoptosis
14.
15.
16. 17.
18. 19.
20.
21.
22.
23.
24.
25.
26.
27. 28.
73
ase enhances activator dependent transcription in vitro. Proc. Natl. Acad. Sci. USA 94, 2261–2265. Endres, M., Wang, Z.Q., Namura, S., Waeber, C., and Moskowitz, M.A. (1997) Ischemic brain injury is mediated by the activation of poly(ADP-ribose) polymerase. J. Cereb. Blood Flow Metab. 17, 1143–1151. Eliasson, M.J.L, Sampei, K, Mandir, A.S., Hurn, P.D., Traystman, R.J., Bao, J., Pieper, A., Wang, Z.Q., Dawson, T.M., Snyder, S.H., and Dawson, V.L. (1997) Poly(ADP-ribose) polymerase gene disruption renders mice resistant to cerebral ischemia. Nature Med. 3, 1089–1095. Jeggo, P.A. (1998) DNA repair: PARP—another guardian angel? Curr. Biol. 8, R49–R51. Adams, J.D., Wang, B., Klaidman, L.K., LeBel, C.P., Odunze, I.N. and Shah, D. (1993) New aspects of brain oxidative stress induced by tert-butylhydroperoxide. Free Radic. Biol. Med. 15, 195–202. Chang, M.L., and Adams, J.D. (1997) Pharmacokinetics of intracerebroventricular tBuOOH in young adult and mature mice. Mol. Chem. Neuropathol. 31, 73–84. Adams, J.D., Klaidman, L.K., Huang, Y.M., Cheng, J.J., Wang, Z.J., Nguyen, M., Knusel, B., and Kuda, A. (1994) The neuropathology of intracerebroventricular tbutylhydroperoxide. Mol. Chem. Neuropathol. 22, 123–142. Chang, M.L., Klaidman, L., and Adams, J.D. (1995) Age dependent effects of tBuOOH on glutathione disulfide reductase, glutathione peroxidase and malondialdehyde in the brain. Mol. Chem. Neuropathol. 26, 95–106. Chang, M.L., Klaidman, L.K., and Adams, J.D. (1997) The effects of oxidative stress on in vivo brain GSH turnover in young and mature mice. Mol. Chem. Neuropathol. 30, 187–197. Mukherjee, S.K., and Adams, J.D. (1997) The effects of aging and neurodegeneration on apoptosis associated DNA fragmentation and the benefits of nicotinamide. Mol. Chem. Neuropathol. 32, 59–74. Singer, T.P., Castagnoli, N., Ramsay, R.R., and Trevor, A.J. (1987) Biochemical events in the development of parkinsonism induced by 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine. J. Neurochem. 49, 1–8. Grimsby, J., Toth, M., Chen, K., Kumazawa, T., Klaidman, L., Adams, J.D., Karoum, R., Gal, J., and Shih, J. (1997) Mice lacking MAO B show marked increases in beta-phenylethylamine, stress responsiveness, and resistance to MPTP toxicity. Nature Genet. 17, 206–210. Klaidman, L.K., Adams, J.D., Leung, A.C., Kim, S.S., and Cadenas, E. (1993) Redox cycling of MPP ⫹: evidence for a new mechanism involving hydride transfer with xanthine oxidase, aldehyde dehydrogenase and lipoamide dehydrogenase. Free Radic. Biol. Med. 15, 169–179. Adams, J.D., Klaidman, L.K., and Leung, A.C. (1993) MPP ⫹ and MPDP ⫹ induced oxygen radical formation with mitochondrial enzymes. Free Radic. Biol. Med. 15, 181–186. Adams, J.D., Klaidman, L.K., and Ribeiro, P. (1997) Tyrosine hydroxylase: mechanisms of oxygen radical formation. Redox Rep. 3, 273–279. Adams, J.D., Klaidman, L.K., and Odunze, I.N. (1989) Oxidative effects of MPTP in the midbrain. Res. Commun. Subst. Abuse 10, 169–180.
74
Adams et al.
29. Odunze, I.N., Klaidman, L.K., and Adams, J.D. (1990) MPTP toxicity: differential effects in the striatum, cerebral cortex and midbrain on glutathione, glutathione disulfide and protein sulfhydryl levels. Res. Commun. Subst. Abuse 11, 123–134. 30. Adams, J.D., Odunze, I.N., and Sevanian, A. (1989) Induction by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine of lipid peroxidation in vivo in vitamin E deficient mice. Biochem. Pharmacol. 39, R5–R8. 31. Braughler, J.M., and Hall, E.D. (1989) Central nervous system trauma and stroke. I. Biochemical considerations for oxy radical formation and lipid peroxidation. Free Radic. Biol. Med. 6, 289–301. 32. Siesjo¨, B.K. (1992) Pathophysiology and treatment of focal cerebral ischemia. Part I: Pathophysiology. J. Neurosurg. 77, 169–184. 33. Li, Y., Chopp, M., Powers, C., and Jiang, N. (1997) Apoptosis and protein expression after focal cerebral ischemia in rat. Brain Res. 765, 301–312. 34. Li, Y., Sharov, V.G., Jiang, N., Zaloga, C., Sabbah, H.N., and Chopp, M. (1995) Ultrastructural and light microscopic evidence of apoptosis after middle cerebral artery occlusion in the rat. Am. J. Pathol. 146, 1045–1051. 35. Linnik, M.D., Miller, J.A., Sprinkle-Cavallo, J., Mason, P.J., Thompson, F.Y., Montgomery, L.R., and Schroeder, K.K. (1995) Apoptotic DNA fragmentation in the rat cerebral cortex induced by permanent middle cerebral artery occlusion. Mol. Brain Res. 32, 116–124. 36. Linnik, M.D., Zobrist, R.H., and Hatfield, M.D. (1993) Evidence supporting a role for programmed cell death in focal cerebral ischemia in rats. Stroke 24, 2002– 2009. 37. MacManus, J.P., Hill, I.E., Preston, E., Rasquinha, I., Walker, T., and Buchan, A.M. (1995) Differences in DNA fragmentation following transient cerebral or decapitation ischemia in rats. J. Cereb. Blood Flow Metab. 15, 728–737. 38. MacManus, J.P., Hill, I.E., Huang, Z-G., Rasquinha, I., Xue, D., and Buchan, A.M. (1994) DNA damage consistent with apoptosis in transient focal ischaemic neocortex. Neuroreport 5, 493–496. 39. Namura, S., Zhu, J., Fink, K., Endres, M., Srinivasan, A., Tomaselli, K.J., Yuan, J., and Moskowitz, M.A. (1998) Activation and cleavage of caspase-3 in apoptosis induced by experimental cerebral ischemia. J. Neurosci. 18, 3659–3668. 40. Cheng, Y., Deshmukh, M., D’Costa, A., Demaro, J.A., Gidday, J.M., Shah, A., Sun, Y., Jacquin, M.F., Johnson, E.M., Jr., and Holtzman, D.M. (1998) Caspase inhibitor affords neuroprotection with delayed administration in a rat model of neonatal hypoxic-ischemic brain injury [see comments]. J. Clin. Invest. 101, 1992–1999. 41. Hara, H., Friedlander, R.M., Gagliardini, V., Ayata, C., Fink, K., Huang, Z., Shimizu-Sasamata, M., Yuan, J., and Moskowitz, M.A. (1997) Inhibition of interleukin 1 beta converting enzyme family proteases reduced ischemic and excitotoxic neuronal damage. Proc. Natl. Acad. Sci. USA 94, 2007–2012. 42. Loddick, S.A., MacKenzie, A., and Rothwell, N.J. (1996) An ICE inhibitor, z-VADDCB attenuates ischaemic brain damage in the rat. Neuroreport 7, 1465–1468. 43. Wang, Y., Lin, S.Z., Chiou, A.L., Williams, L.R., and Hoffer, B.J. (1997) Glial cell line–derived neurotrophic factor protects against ischemia-induced injury in the cerebral cortex. J. Neurosci. 17, 4341–4348. 44. Williams, L.R., Inouye, G., Cummins, V., and Du, C. (1996) ICV pretreatment with
Ischemic and Metabolic Stress Induce Apoptosis
45. 46.
47. 48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
75
GDNF reduces infarct volume in a rat model of transient middle cerebral artery occlusion. Soc. Neurosci. Abstr. 22, 1667. Buchan, A.M., Xue, D., and Slivka, A. (1992) A new model of temporary focal neocortical ischemia in the rat. Stroke 23, 273–279. Lin, L-F.H., Doherty, D.H., Lile, J.D., Bektesh, S., and Collins, F. (1993) GDNF: a glial cell line–derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 1130–1132. Yan, Q., Matheson, C., and Lopez, O.T. (1995) In vivo neurotrophic effects of GDNF on neonatal and adult facial motor neurons. Nature 373, 341–344. Zurn, A.D., Baetge, E.E., Hammang, J.P., Tan, S.A., and Aebischer, P. (1994) Glial cell line-derived neurotrophic factor (GDNF), a new neurotrophic factor for motoneurones. Neuroreport 6, 113–118. Deshmukh, M., and Johnson, E.M., Jr. (1997) Programmed cell death in neurons: focus on the pathway of nerve growth factor deprivation-induced death of sympathetic neurons. Mol. Pharmacol. 51, 897–906. Johnson, E.M., Jr., Greenlund, L.J.S., Akins, P.T., and Hsu, C.Y. (1995) Neuronal apoptosis: Current understanding of molecular mechanisms and potential role in ischemic brain injury. J. Neurotrauma 12, 843–852. Mattson, M.P., Lovell, M.A., Furukawa, K., and Markesbery, W.R. (1995) Neurotrophic factors attenuate glutamate-induced accumulation of peroxides, elevation of intracellular Ca 2⫹ concentration, and neurotoxicity and increase antioxidant enzyme activities in hippocampal neurons. J. Neurochem. 65, 1740–1751. Shigeno, T., Mima, T, Takakura, K., Graham, D.I., Kato, G., Hashimoto, Y., and Furukawa, S. (1991) Amelioration of delayed neuronal death in the hippocampus by nerve growth factor. J. Neurosci. 11, 2914–2919. Buchan, A.M., Williams, L.R., and Bruederlin, B. (1990) Nerve growth factor: pretreatment ameliorates ischemic hippocampal neuronal injury. Stroke 21, 177– 182. Beck, T., Lindholm, D., Castre´n, E., and Wree, A. (1994) Brain-derived neurotrophic factor protects against ischemic cell damage in rat hippocampus. J. Cereb. Blood Flow Metab. 14, 689–692. Scha¨bitz, W.R., Schwab, S., Spranger, M., and Hacke, W. (1997) Intraventricular brain-derived neurotrophic factor reduces infarct size after focal cerebral ischemia in rats. J. Cereb. Blood Flow Metab. 17, 500–506. Chan, K.M., Lam, D.T.N., Pong, K., Widmer, H.R., and Hefti, F. (1996) Neurotrophin-4/5 treatment reduces infarct size in rats with middle cerebral artery occlusion. Neurochem. Res. 21, 763–767. Bethel, A., Kirsch, J.R., Koehler, R.C., Finklestein, S.P., and Traystman, R.J. (1997) Intravenous basic fibroblast growth factor decreases brain injury resulting from focal ischemia in cats. Stroke 28, 609–615. Koketsu, N., Berlove, D.J., Moskowitz, M.A., Kowall, N.W., Caday, C.G., and Finklestein, S.P. (1994) Pretreatment with intraventricular basic fibroblast growth factor decreases infarct size following focal cerebral ischemia in rats. Ann. Neurol. Apr. 35, 451–457. Williams, L.R., Inouye, G., Cummins, V., and Pelleymounter, M.A. (1996) Glial cell line–derived neurotrophic factor sustains axotomized basal forebrain cholinergic
76
60.
61.
62.
63.
64. 65. 66. 67.
68.
69.
70.
Adams et al. neurons in vivo: dose–response comparison to nerve growth factor and brain-derived neurotrophic factor. J. Pharmacol. Exp. Ther. 277, 1140–1151. Adams, J.D. (1996) Agents used in neurodegenerative disorders. In: Burger’s Medicinal Chemistry and Drug Discovery (M.E. Wolff, ed.), John Wiley and Sons, New York, pp. 261–319. Takahashi, K., Greenberg, J.H., Jackson, P., Maclin, K., and Zhang, J. (1997) Neuroprotective effects of inhibiting poly(ADP-ribose) synthetase on focal cerebral ischemia in rats. J. Cereb. Blood Flow Metab. 17, 1137–1142. Lo, E.H., Bosque-Hamilton, P., and Meng, W. (1998) Inhibition of poly(ADPribose) polymerase reduction of ischemic injury and attenuation of N-methyl-daspartate induced neurotransmitter dysregulation. Stroke 29, 830–836. Jackson, G.R., Werrbach-Perez, K., Pan, Z., Sampath, C., and Perez-Polo, J.R. (1994) Neurotrophin regulation of energy homeostasis in the central nervous system. Dev. Neurosci. 16, 285–290. Spector, R. (1979) Niacin and nicotinamide transport in the central nervous system. In vivo studies. J. Neurochem. 33, 895–904. Berger, N.A. (1985) Poly(ADP-ribose) in the cellular response to DNA damage. Radic. Res. 101, 4–15. Boulikas, T. (1991) Relation between carcinogenesis, chromatin structure and poly (ADP-ribosylation). Anticancer Res. 11, 489–528. D’Amours, D., Germain, M., Orth, K., Dixit, V.M., and Poirier, G.G. (1998) Proteolysis of poly(ADP-ribose) polymerase by caspase 3: kinetics of cleavage of mono(ADP-ribosyl)ated and DNA bound substrates. Radic. Res. 150, 3–10. Hayashi, T., Sakurai, M., Abe, K., Sadahiro, M., Tabayashi, K., and Itoyama, Y. (1998) Apoptosis of motor neurons with induction of caspases in the spinal cord after ischemia. Stroke 29, 1007–1013. Endres, M., Namura, S., Shimizu-Sasamata, M., Waeber, C., Zhang, L., GomezIsla, T., Hyman, B.T., and Moskowitz, M.A. (1998) Attenuation of delayed neuronal death after mild focal ischemia in mice by inhibition of the caspase family. J. Cereb. Blood Flow Metab. 18, 238–247. Hara, H., Fink, K., Endres, M., Friedlander, R.M., Gagliardini, V., Yuan, J., and Moskowitz, M.A. (1997) Attenuation of transient focal ischemic injury in transgenic mice expressing a mutant ICE inhibitory protein. J. Cereb. Blood Flow Metab. 17, 370–375.
4 Nitrogen Radicals in Ischemic Damage of the Brain ¨ zben Tomris O Akdeniz University, Antalya, Turkey
I. INTRODUCTION The discovery that the free radical gas nitric oxide (NO•, commonly abbreviated to NO) has multiple biological roles—as a neurotransmitter, in the regulation of blood pressure, and in the host response to infection—has resulted in this molecule becoming the focus of intense research activity. These studies not only have increased our understanding of the biological function of NO but also suggest that there may be therapeutic benefit in inhibiting the production and/or function of NO in certain clinical indications (1). Nitric oxide, which was defined as the molecule of the year in 1992 in Science, has recently emerged as an important mediator of cellular and molecular events that impact the pathophysiology of cerebral ischemia (2–12). In the central nervous system (CNS), NO is a neuronal messenger and mediator having both neurotoxic and neuromodulator effects (11,13–15). It fulfills most of the criteria of a neurotransmitter (16). NO was first identified as endothelium-derived relaxing factor. It is also involved in N-methyld-aspartate (NMDA) glutamatergic neurotransmission (8). Since the mid-1970s, it has been known that synaptic excitation in the CNS is associated with elevations in the level of the second messenger, cyclic GMP (cGMP) (17,18). These responses are now known to be mediated through the release of the novel messenger molecule NO, which functions as a powerful activator of the cGMP-synthesizing enzyme, the soluble guanylate cyclase (18). A major primary trigger for NO formation is the increased cytosolic free Ca 2⫹ levels resulting from the activation of voltage-gated Ca 2⫹ channels or ligand-gated Ca 2⫹ channels or from the mobilization of intracellular Ca 2⫹ stores. NO has a number of properties that set 77
¨ zben O
78
it apart from conventional signaling molecules, not the least of which is its ability to diffuse readily across membranes and so act on cellular elements located some distance from its site of formation (18).
II. SYNTHESIS OF NITRIC OXIDE Nitric oxide is synthesized from the guanido nitrogen of l-arginine and molecular oxygen by nitric oxide synthase (NOS; EC 1.14.13.39) (19–21). The end-products are citrulline and NO. NOS is a protoporphyrin IX heme-containing enzyme of molecular mass 130–160 kDa, which is thought to exist as a homodimer, and which requires flavin adenine mono- and dinucleotide (FMN and FAD), tetrahydrobiopterin (BH4), NADPH, and calmodulin for activity (Fig. 1). Although the precise details of the reaction have not yet been elucidated, a two-step mechanism has been postulated. In the first step, l-arginine is converted to l-N G-hydroxy arginine (l-HOARG) by a reaction requiring one molecule of molecular oxygen and NADPH in the presence of BH4. The second step
Figure 1
Nitric oxide synthase and its cofactors exist as a homodimer.
Nitrogen Radicals in Ischemic Brain Damage
79
Figure 2 Conversion of l-arginine to L-citrulline and NO catalyzed by nitric oxide synthase (NOS).
is the oxidation of l-HOARG to yield NO and citrulline (Fig. 2). While NOS is capable of catalyzing both reactions in the sequence, it is of interest that cytochrome P450 reductase has also been shown to catalyze the second (but not the first) step. Indeed, cytochrome P450 reductase has structural similarity to NOS (Fig. 3).
III.
ISOFORMS OF NITRIC OXIDE SYNTHASE
Three isoforms of NOS have been defined and their cDNAs have been isolated in humans (8,19,22) (Table 1): 1. Isozyme I. Constitutive neuronal isoform (cNOS) that is present in neurons and epithelial cells and is Ca 2⫹-calmodulin-dependent 2. Isozyme II. Inducible isoform (iNOS) that is present in macrophages and glial cells 3. Isozyme III. Endothelial isoform (eNOS) that is present in endothelial cells They are coded by three distinct genes located on chromosomes 12, 17, and 7. Amino acid sequence of human isozymes show less than 59% identification. Be-
80
Figure 3
¨ zben O
Structure of NOS isoform cDNAs compared with cytochrome P450 reductase.
tween species, amino acid sequence of each isoform has been preserved better (more than 90% for isoform I and III and more than 80% for isoform II). All isoforms use l-arginine and molecular oxygen as substrates and NADPH, tetrahydrobiopterin, FAD, and FMN as cofactors. All of them bind calmodulin and contain heme (8,19,22). All three isoforms possess NADPH-diaphorase activity, the presence of which has been used to infer the localization of NOS (23). In the presence of NADPH, part of the enzyme is able to supply electrons to the dye, nitroblue tetrazolium, which then forms an insoluble formazan product. This explains the striking staining pattern observed with NADPH diaphorase histochemistry and that was found over 30 years ago to stain discrete populations of neurons in the brain. These neurons are now known to be those containing NO synthase (18,23,24). Under normal conditions, only constitutive NOS can be detected in brain using immunohistochemical methods. However, astrocytes, microglia, vascular smooth muscle, and endothelial cells express iNOS upon induction (25– 29). In general, the iNOS enzyme produces much greater amounts of NO (in the micromolar range) than either nNOS or eNOS (picomolar levels) (1). The constitutive isoform (cNOS) is a soluble 150-kDa protein and Ca 2⫹calmodulin-dependent. It binds calmodulin loosely. When cytosolic Ca 2⫹ is increased, it causes firm binding of calmodulin and NOS, thereby producing NO. An increase in intracellular calcium concentration from 100 nM to 500 nM changes the rate of NO synthesis from ⬍5% to ⬎95% of maximum (8). Besides synthesizing NO, purified nNOS (30) can produce superoxide at lower l-arginine
Isoforms of Nitric Oxide Synthase (NOS, EC 1.14.13.39)
Isoform Constitutive, neuronal cNOS Inducible iNOS Endothelial eNOS
Activator
Location
Gene location
Ca /Cam
Neurons, epithelial cells
Chromosome 12
Neurotoxic
Endotoxins, cytokines, lipopolysaccharides Ca 2⫹ /Cam
Macrophages, glial cells
Chromosome 17
Cytotoxic
Endothelial cells
Chromosome 7
Neuroprotective
2⫹
Effect
Nitrogen Radicals in Ischemic Brain Damage
Table 1
81
¨ zben O
82
concentrations. Regulating arginine levels may provide a therapeutic approach to disorders involving O 2⫺• /NO-mediated cellular injury. Inducible isoform (iNOS) is calcium-insensitive and is stimulated by endotoxins, cytokines, interferon-γ, and lipopolysaccharides. iNOS binds calmodulin tightly. For this reason, it does not require the presence of Ca 2⫹, making it insensitive to fluctuations in cytoplasmic calcium levels (31). iNOS is present in glial cells in the CNS (8,19). In glial cells, cytokines such as interleukin-1β (IL-1β) and tumor necrosis factor–α (TNF-α) are produced following acute ischemic stress. iNOS induction occurs in autoimmune diseases and septic shock. Once expressed, iNOS is continuously active and leads to a long-lasting (several hours to days) NO generation compared to calcium-dependent NO synthesis lasting a few minutes (31). By inhibiting iron-containing enzymes in parasitic target cells and causing DNA fragmentation, iNOS exerts its cytotoxic effects. On the other hand, it is suggested that NO/iNOS is involved in neuronal apoptosis. The iNOS induction was detected primarily in astrocytes after the transient forebrain ischemia when the neuronal apoptosis was observed (32). NO produced by iNOS exerts inhibitory and cytotoxic effects on various cells including neuronal cells. Interferon regulatory factor–1 (IRF-1) has been reported to be an essential transcription factor for iNOS mRNA induction in murine macrophages (33). Endothelial isoform is present in endothelial cells. It is expressed constitutively, but its expression can be enhanced. Its activity is regulated by Ca 2⫹-calmodulin. It is a 130-kDa protein and can be myristoylated at its N terminus, allowing attachment to membranes (18). NO originating from endothelium causes dilatation of blood vessels, inhibition of platelet and leukocyte adhesion, and proliferation of vascular smooth muscle. An electron microscopic immunocytochemical study was performed to clarify ultrastructural localization and the role of eNOS in the endothelial cells (ECs) of rat hippocampal vessels after transient cerebral ischemia. eNOS immunoreactivity was found in the endothelial cells in association with plasma membrane, subplasmalemmal vesicles, basal membrane, and in the cytosol. A sharp transient increase in immunoreactivity of NOS was observed at 10 min up to 1 h after ischemia. The results indicated that NO, as a potent vasodilator, may play a protective role in ischemic brain damage (34).
IV.
PROPERTIES AND FUNCTIONS OF NITRIC OXIDE
Nitric oxide is an unstable free radical species that readily crosses cell membranes and is lipid-soluble. Its half-life is very short (4 s) (35,36). It reacts rapidly with superoxide (37). Hemoglobin and other heme proteins inhibit NO by binding it tightly. Rapid metabolism of superoxide by superoxide dismutase (SOD) and removal of hemoglobin prolong its half-life. Formation of S-nitrosothiol adducts may stabilize the labile NO radical and prolong its biological half-life. Sulfhydryl
Nitrogen Radicals in Ischemic Brain Damage
83
groups in proteins (e.g., albumin) represent a rich source of reduced thiol and Snitroso proteins are formed readily under physiological conditions (8,38). NO binds to metals (Fe, Cu, Co, Mn, etc.) within cells. These metal ions are required for the activity of cytochrome oxidases (22). NO converts hemoglobin to methemoglobin in red cells. In vitro experiments imply that NO inhibits NOS activity by interacting with NOS or its cofactors (39). However, whether this inhibitory feedback mechanism occurs in vivo is not known. Nitric oxide is produced in neurons, glia cells, and vascular endothelium in the CNS. Depending on its origin, its effects are varied. Neuronal NO increases acute ischemic damage, while vascular NO diminishes ischemic injury by increasing cerebral blood flow (8). The effects of NO may vary with the tissue compartment (e.g., vascular vs. parenchymal) or with the time after the onset of ischemia (40,41). While endothelial and perivascular NO have neuroprotective roles, parenchymal NO exerts neurotoxic effects. Pharmacological and genetic approaches have significantly advanced our knowledge regarding the role of NO and the different NOS isoforms in focal cerebral ischemia (11). nNOS and iNOS play key roles in neurodegeneration, whereas eNOS plays a prominent role in maintaining cerebral blood flow, reducing infarct volume, and preventing neuronal injury (11). Excitotoxic or ischemic conditions excessively activate nNOS, resulting in concentrations of NO that are toxic to surrounding neurons (11). iNOS, which is not normally present in healthy tissue, is induced shortly after ischemia and contributes to secondary late phase damage (11). There are some reports in the literature suggesting that the vast majority of NOS-positive cells are iNOS-containing astrocytes 3 days after lesioning and astrocyte-derived NO plays a significant role in delayed neuronal death (42). Nitric oxide activates heme-containing guanylate cyclase by forming an NO–heme complex (8). Elevations in 3′,5′-cyclic guanosine monophosphate (cGMP) result in vascular smooth muscle and this increases cerebral blood flow (CBF) (43). However, cGMP-dependent mechanisms may only be operational in cells adjacent to those generating NO because intracellular calcium levels sufficient to activate NOS inhibit guanylate cyclase. Blood vessels may provide an example (8,44). Vasodilatory neuromediators like acetylcholine or bradykinin raise intracellular calcium and stimulate endothelial NOS activity to release NO from endothelial cells. NO, in turn, enhances cGMP synthesis in smooth muscle cells. Nitrovasodilators such as nitroglycerin, nitroprusside, or 3-morpholinosynonimine (SIN-1) raise cGMP in vascular smooth muscle by directly liberating or donating NO (8,45). Under physiological conditions guanylate cyclase is a key mediator of cerebral arterial relaxations to NO. Platelet inhibition, neurotransmission, and penile erection are also mediated by cGMP-dependent mechanisms (46,47). However, under pathological conditions associated with induction of NOS and increased biosynthesis of NO (e.g., cerebral ischemia, inflammation, sepsis), mechanisms other than the formation of cyclic GMP may be activated
84
¨ zben O
(48). Because cGMP-dependent protein kinase has a very restricted distribution (mainly in cerebellar Purkinje cells) with NOS and the soluble guanylate cyclase, cGMP probably acts mainly through activation or inhibition of phosphodiesterases or, perhaps, by direct interaction with ionic channels (18,49,50). The targets of NO within the CNS include presynaptic nerve terminals, postsynaptic neuronal elements, and glia. NO can diffuse into neighboring cells and increase cGMP in glia and/or presynaptic neurons, and thus behave as an intracellular messenger (Fig. 4). Presynaptically, NO might be expected to modify neurotransmitter release. In different areas of brain, NO can increase the release of a variety of neurotransmitters, including glutamate, GABA, acetylcholine, dopamine, and noradrenaline, Postsynaptically, one effect of NO could be to influence receptor function (18). Nitric oxide can exist in three redox forms (8,51): (1) nitrosonium (NO ⫹); (2) nitric oxide (NO •); (3) nitroxyl anion (NO ⫺). (NO •)was proposed as the neurotoxic agent mediating NMDA toxicity, whereas the nitrosonium (NO ⫹) form of NO reacts with the thiol group of NMDA receptor, downregulates NMDA recep-
Figure 4 The mechanisms leading to neuronal death after cerebral ischemia. NMDA receptor stimulation increases cyclic GMP levels in glia and/or presynaptic neurons via a mechanism that involves NO which is synthesized by Ca 2⫹ /calmodulin-induced activation of NOS.
Nitrogen Radicals in Ischemic Brain Damage
85
tor activity, and blocks its function. So it is neuroprotective (8,51). NO donors may exert different actions depending on the redox form of NO generated. Sodium nitroprusside protects neurons because it generates nitrosonium (NO ⫹), which can be converted to the toxic NO• after reduction with cysteine. Long halflife diazeniumdiolate-class NO donor was shown to be useful as an agent to restore circulation in patients suffering from cerebral vasospasm (52). Tissue redox state and pH favor different redox forms of NO and consequently different target molecules may be activated within cellular compartments under various pathological conditions. However, whether NO • or NO ⫹ predominates in tissue remains to be determined (8). The hypotheses remain uncertain at the present time because of difficulties in detection of NO and its redox forms in vivo currently. It also remains possible that some of these reactions may provide important signaling mechanisms essential for physiological cell regulation (8).
V.
NITRIC OXIDE–MEDIATED NEUROTOXICITY
Nitric oxide and its degradation products cause cytotoxicity through formation of iron–NO complexes with several enzymes including aconitase and complex I and II of mitochondrial electron transport chain, oxidation of protein sulfhydryls, and DNA nitration (8,51). The inhibition of glyceraldehyde-3-phosphate dehydrogenase depresses glycolysis. NO ⋅ contains an unpaired electron and is paramagnetic. It rapidly reacts with superoxide (O 2⫺•) to form peroxynitrite anion (ONOO ⫺) (53). Especially in a superoxide-rich environment, NO may release intracellular iron thereby triggering the Haber–Weiss reaction and formation of reactive oxygen species (54). Peroxynitrite can diffuse for several micrometers before decomposing to form the powerful and cytotoxic oxidants hydroxyl radical and nitrogen dioxide (55). It is stable in alkaline solutions, but decays rapidly once protonated. O 2⫺• ⫹ NO • → ONOO ⫺ ⫹ H ⫹ → ONOOH → OH • ⫹ NO 2• → NO 3• ⫹ H ⫹ The half-life of peroxynitrite at pH 7.4 is 1.9 s. SOD, preventing peroxynitrite formation protects tissues (8,35). The nitration of tyrosine residues to produce nitrotyrosine is a sensitive marker elicited by peroxynitrite. Nitrotyrosine was not detected in the ischemic brain, suggesting that nitration of tyrosine residues in various proteins may be closely associated with reperfusion injury of the brain (56). It was reported that NO inactivates protein kinase C (PKC) through the inhibition of phosphatidylinositol breakdown (57). In addition to disrupting cellular metabolism, NO inhibits DNA synthesis by depressing ribonucleotide reductase activity (58). NO also damages DNA structure in several possible ways including DNA nitration, deamination, and oxidation (59). Recently, it has been proposed that DNA damage plays a central role in NO toxicity. According to
¨ zben O
86
this hypothesis, DNA damage activates normal reparative mechanisms such as poly(ADP-ribose) synthetase (PARS), which can deplete ATP and nicotinamide dinucleotide (60). PARS activation, a downstream event of NO neurotoxicity, has been implicated in cerebral reperfusion injury. nNOS is responsible for PARS activation in stroke. PARS activation, however, is not a direct result of NO production, but it occurs via peroxynitrite formation (61). Poly(ADP-ribose) polymerase (PARP, EC 2.4.2.30), an abundant nuclear protein activated by DNA nicks, mediates cell death in vitro by NAD depletion and energy failure after exposure to NO (62). PARP catalyzes attachment of ADP ribose units from NAD to nuclear proteins following DNA damage. Excessive activation of PARP can deplete NAD and ATP, which is consumed in regeneration of NAD, leading to cell death by energy depletion (63). Other than promoting necrotic cell death, NO may be one of the mediators inducing programmed cell death (apoptosis). Apoptotic cell death was demonstrated in global and transient focal ischemia (64–66).
VI.
NITRIC OXIDE AND GLUTAMATE NEUROTOXICITY
Glutamate is a major excitatory neurotransmitter in the mammalian CNS (67). Extracellular concentrations of glutamate are markedly elevated in ischemic brain tissue as a consequence of both enhanced release of the amino acid from neurons and its impaired uptake into glia and neurons (68). Due to energy failure, presynaptic depolarization causes voltage-sensitive calcium channels (VSCCs) to open, allowing Ca 2⫹ to enter and triggers release of excitatory amino acids (EAAs) such as glutamate. Synaptic release of glutamate is also increased due to the elevated extracellular K ⫹ concentration. Due to energy failure, glial and neuronal uptake of glutamate are impaired. The increased glutamate in the extracellular space overactivates postsynaptic glutamate receptors, of which there are two broad classes (18,69,70). Those containing an integral ion channel (ionotrophic receptors) fall into three subgroups. These are named according to their preferred agonists: AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate), NMDA (N-methyl-d-aspartate), and kainate receptors; the others (metabotropic receptors), of which there are at least six types, are coupled through G proteins to alterations in the activity of intracellular enzyme systems (phospholipase C, adenylate cyclase, etc.). Glutamate acts on and activates both NMDA and non-NMDA receptor types. Non-NMDA receptors mediate acute neuronal swelling dependent on extracellular Na ⫹ and K ⫹. NMDA receptors are particularly important in mediating subsequent delayed neuronal disintegration dependent on Ca 2⫹. NonNMDA receptors play a more significant role in global ischemia and NMDA receptors in focal ischemia (67–69).
Nitrogen Radicals in Ischemic Brain Damage
87
Intracellular Ca 2⫹ overload activates NOS leading to the formation of NO from arginine. NO produces cGMP by activating guanylate cyclase (69). It has been suggested, therefore, that NO plays a modulatory role following excessive NMDA receptor stimulation leading to cell death (15,46,71). Neuronal degeneration can occur at several levels in the ischemic cascade. The free radical NO has been clearly linked to ischemic neurodegeneration in both animal models and cell culture systems, but the final cellular pathways that lead from the generation of NO to eventual neuronal death require further investigation.
VII.
L-ARGININE
ANALOGS AND NITRIC OXIDE SYNTHASE
INHIBITION Most researchers use NOS inhibitors to investigate the role of NO in various physiological and pathological conditions. The most widely studied inhibitors are the substrate analogs of l-arginine: 1. Nitro-l-arginine methyl ester (l-NAME) 2. Nitro-l-arginine (l-NA) 3. Monomethyl-l-arginine (l-NMMA) l-Arginine analogs (72–74) are competitive inhibitors of NOS, although noncompetitive inhibition may occur depending on dosage and duration of treatment (75–77). l-NAME, l-NA, and l-NMMA inhibit both the constitutively expressed and inducible enzymes and do not discriminate between the neuronal and endothelial isoforms (1). It is notable, however, that l-NA displays a marked preference for the constitutively expressed protein whereas l-NMMA is reportedly more potent and effective against the inducible protein (78). Recently, 7-nitroindazole was reported to inhibit neuronal NOS potently without increasing blood pressure (79) or blocking acetylcholine relaxation of pial vessels (80), suggesting that it may selectively inhibit the neuronal form in vivo; however, it has a similar IC 50 for nNOS and eNOS in vitro (81). Aminoguanidine has drawn particular attention as a selective iNOS inhibitor, considering the putative role of iNOS in many diseases (82). However, the molecular basis of its selectivity is not clear and it has actions on several other enzymes. Nitric oxide synthase inhibitors have been administered systemically (intraperitoneal, intravenous), directly into the brain (microdialysis), topically by superfusion (cranial window preparation) or into the CSF (intracerebroventricular). There are conflicting results in the literature reporting either increases or reductions in infarct volume after permanent or transient middle cerebral artery (MCA) occlusion and NOS inhibition (8,29,83,84). Reasons that may underlie some of the existing controversies are as follows:
88
¨ zben O
1. Use of nonselective NOS inhibitors 2. Choice of species, anesthetics, dose administered, or ischemic models Although each of them may contribute to these contradictory results, none is sufficient to explain the observed differences. For example, anesthetics like halothane and isoflurane are reported to increase pial arterial diameter with an NOmediated but unknown mechanism. The choice of model is also important. For example, injury in the hypoxia-ischemic neonatal rat may be more dependent on excitotoxic mechanisms and less on reductions in blood flow. As a general rule, in the various studies performed so far with NOS inhibitors, administration of low doses of NOS inhibitors was associated with neuroprotection whereas high doses were either ineffective or even deleterious (73). Various species and strains possess different susceptibilities to stroke (level of blood pressure, differences in endothelial NOS activity, extent of collateral blood flow). The effect of inhibition of NO synthesis on cerebral ischemic damage may vary depending on the timing of inhibition relative to the induction of ischemia (40). The protocol chosen for experiments may give rise to contradictory results. Some answers may be forthcoming with the development of selective inhibitors for the neuronal or vascular isoforms, or transgenic mice whose neuronal or endothelial NOS are selectively knocked out (8,85,86). A clearer appreciation of the potential therapeutic utility of NOS inhibitors will emerge only when the complexity of their effects on the extent of ischemic damage in vivo is more fully defined and understood. Severe hypertension caused by NOS inhibitors may also potentiate edema formation and cause bleeding into the core territory (8). l-NAME has been shown to prevent intracellular brain acidosis during focal cerebral ischemia independent of regional cortical blood flow changes (72,74). Nitric oxide synthase inhibitors were ineffective in various models of global cerebral ischemia (73,87,88). While most of these studies have been performed with high doses of NOS inhibitors that would not be expected to afford neuroprotection, administration of a low dose of l-NAME also failed to decrease neuronal death (73,87). Interestingly, in models of global cerebral ischemia, NMDA receptor antagonists are generally ineffective (73,89). Blockade of AMPA-kainate, but not NMDA receptors, decreases hippocampal damage after a global cerebral ischemia (73,90). Administration of inhibitors of neuronal NOS or deletion of the encoding gene in rodents provided evidence that neuronal NOS activity may contribute to neuronal cell death following global and focal cerebral ischemia. It was shown that cerebral ischemia leads to an increase in neuronal expression of protein inhibitor of neuronal NOS in brain regions like hippocampal CA3 region and granule cell of the dentate gyrus where sustained or ‘‘uncoupled’’ NOS activity may be detrimental to neurons. Lack of postischemic induction of protein inhibitor of neuronal NOS in CA1 pyramidal neurons may result in high
Nitrogen Radicals in Ischemic Brain Damage
89
NOS activity after global ischemia and could contribute to delayed neuronal cell death (91).
VIII. NITRIC OXIDE AND FOCAL ISCHEMIA Defining the role of NO in cerebral ischemia provides the rationale for new protective strategies based on modulation of NO production in the postischemic brain (92). At present, the only effective treatment of acute ischemic stroke is prevention of risk factors. There is currently no medical therapy that can be recommended for routine use in patients with acute ischemic stroke. Therefore, therapies to reduce mortality and to improve neurological outcome are needed. Heavy studies are performed to develop drugs that will prevent neurodegeneration following acute ischemic stroke. For this purpose, animal models have been produced that mimic the neuropathological consequences of stroke. These models have several advantages and disadvantages (93). Reversible or irreversible focal ischemia models like stroke in humans are useful for investigations of molecular mechanisms of stroke and also for the development of neuroprotective drugs. In our experiments, focal cerebral ischemia was produced by permanent occlusion of right MCA in urethane-anesthetized rats using a modification of techniques described by Chen et al. (94). We determined a number of indicators of brain NO nitrite, and cGMP production in ipsilateral and contralateral cerebral cortex and cerebellum after 0, 10, and 60 min of focal cerebral ischemia. We also investigated and compared the effects of MK-801 (0.5 mg/kg IP), a glutamate receptor antagonist; lamotrigine (20 mg/kg IP), a glutamate release inhibitor; and l-NAME (10 mg/kg IP), a potent inhibitor of NOS administered 30 min before or just after the onset of focal ischemia on nitrite and cGMP. Infarct volumes were measured in rat brain slices using triphenyltetrazolium chloride staining (TTC) 24 h after the induction of MCA occlusion with and without drug administration. Ipsilateral cerebral cortical nitrite levels were increased relative to contralateral cortex after MCA occlusion, peaking at 10 min and returning to baseline by 60 min. No significant right-to-left differences or differences from 0 min of ischemia were observed in the cerebellum. Nitrite levels of brain regions at different times of ischemia were higher than those in sham-treated animals (3,4,95) (Fig. 5). We found a striking activation followed by an equally striking inactivation of NOS after MCA occlusion (3,4,95). Different factors may be responsible for this observation. Previous studies showed that NOS activity in vivo is at least partly regulated by phosphorylation/dephosphorylation (8,9). If the rapid depletion of ATP is rapidly coupled to NOS dephosphorylation, it would lead to activation of the enzyme. The Ca 2⫹-calmodulin-regulated phosphatase, calcineurin, has
90
¨ zben O
Figure 5 Line graphs of nitrite and cyclic guanosine monophosphate (cGMP) levels in ipsilateral and contralateral cortex and cerebellum after 0, 10, or 60 minutes of right middle cerebral artery occlusion.
been demonstrated to dephosphorylate NOS, thereby activating it. The immunomodulatory drug FK-506 inhibits calcineurin and potently inhibits glutamate toxicity in cell culture. NOS produces highly oxidizing NO. NOS requires numerous highly reduced cofactors. Rapid NO production might inactivate NOS by diminishing these reduced cofactors required for its synthesis. NO could also nitrosylate sulfhydryl groups in NOS, thereby inactivating it. Another possible inactivation mechanism involves the NMDA receptor. It was demonstrated that NO oxidizes a critical sulfhydryl group in the NMDA receptor that might decrease calcium influx and thereby reduce NOS activity. Finally, activation of a peptidase in ischemic tissue causes NOS deactivation. Similar results were reported in NO levels following acute cerebral ischemia. Within 3 to 24 min after MCA occlusion, NO was reported to increase dramatically from 10 nM to 2.2 µM within cortex as detected by a porphyrinic microsensor (8,96–98). Brain NOS activity increased as well. Nitrite, NO, and NOS activity returned to baseline within 1 h. cNOS activity increased due to a rise in intracellular Ca 2⫹ –calmodulin complex (8,9,47,96). These increases were
Nitrogen Radicals in Ischemic Brain Damage
91
effectively blocked by prior l-NA administration, indicating an enhanced NOS activity (9). Electron paramagnetic studies coupled with administration of an in vivo spin trap also demonstrated an increased NO level during ischemia (99). A contribution of iNOS to the observed enhancement in NOS activity is unlikely since these effects were detected in the immediate period following MCA occlusion before induction of iNOS. NO concentration increased in the core and periphery of the MCA following occlusion of MCA in the cat. This increase was abolished by NG-nitro-l-arginine (l-NA) treatment (100). The stable end-products of NOS (NOx ⫽ nitrite ⫹ nitrate) were reported to increase immediately after head trauma or ischemia and gradually returned to control levels over 24 h of reperfusion (101). Higuchi et al. measured the changes in NO metabolites in the brains of neonatal rats with hypoxic-ischemic damage. There were two peaks of NO metabolites in the lesioned side of the cortex: one during hypoxia and the other during the reoxygenation period. Prehypoxic treatment with 7-nitroindazole, a selective nNOS inhibitor, suppressed both peaks of NO metabolites, whereas prehypoxic treatment with aminoguanidine, a selective iNOS inhibitor, partially suppressed only the peak in the reoxygenation period. These data suggest different roles of neuronal and inducible NOSs in the pathogenesis of hypoxicischemic encephalopathy (102). It was reported that after a 2-h transient focal cerebral ischemia and 6 h of reperfusion, constitutive NOS (cNOS) activity was significantly reduced in the infarcted cortical area and remained attenuated for up to 10 days after ischemia. A calcium-independent NOS activity began to increase 48 h after reperfusion, reached a maximum at 7 days, and returned to baseline at 10 days leading to a significant increase of brain NOx content beginning after 3 days of reperfusion. The concentration of NO was reported to increase during and after cerebral ischemia and a selective inhibitor of nNOS suppressed this increase. In contrast, iNOS induction during and after MCA occlusion may not be a critical event for the development of infarction caused by ischemia (103). In wild-type mice, iNOS mRNA expression in the postischemic brain began between 24 and 48 h peaked at 96 h and subsided 7 d after MCA occlusion. iNOS mRNA induction was associated with expression of iNOS protein and enzymatic activity. In contrast, mice lacking the iNOS gene did not express the iNOS message or protein after MCA occlusion. The infarct and the motor deficits produced by MCA occlusion were smaller in iNOS knockouts than in wild-type mice (104). Cerebral ischemia is followed by a local inflammatory response that is thought to participate in the extension of the tissue damage occurring in the postischemic period. Molecular and cellular events occurring in the late stages of cerebral ischaemia (⬎6 h) play an important role in the evaluation of ischemic brain damage. It was reported that expression of two inflammation-related genes—iNOS and cyclooxygenase-2 (COX-2)—contributes to the late stages of ischemic brain damage (105). iNOS is expressed in inflammatory and vascular cells in the postischemic brain. Pharmacological inhibition of iNOS activity ameliorates ischemic
92
¨ zben O
damage, whereas knockout mice lacking the iNOS gene are relatively protected from the consequences of cerebral ischemia. COX-2 is expressed in neurons at the infarct border and inhibition of COX-2 activity improves ischemic brain damage. Consequently, inhibition of iNOS and COX-2 could be a valuable addition to treatment strategies for ischemic stroke. Focal cerebral ischemia is associated with expression of both iNOS and COX-2 enzymes whose reaction products contribute to the evolution of ischemic brain injury. Twenty-four hours after MCA occlusion in rats, iNOS-immunoreactive neutrophils were observed in close proximity to COX-2-positive cells at the periphery of the infarct. Cerebral ischemia increased the concentration of the COX-2 reaction product prostaglandin E 2 (PGE 2) in the ischemic area and in the ipsilateral olfactory bulb. The iNOS inhibitor aminoguanidine reduced PGE 2 concentration in the infarct, where both iNOS and COX-2 were expressed. Postischemic PGE 2 accumulation was reduced significantly in iNOS null mice compared with wild-type controls. The data provide evidence that NO produced by iNOS influences COX-2 activity after focal cerebral ischemia (106). In our experiments, in both cortex and cerebellum, cGMP concentrations at 10 and 60 min were significantly increased when compared with 0-min values of ischemia. Unlike nitrite, which returned to baseline by 60 min, changes in cGMP were sustained. There was also a marked increase in the ipsilateral cortex at 10 and 60 min ( p ⬍ 0.001), but on the contralateral cerebellum at 10 and 60 min ( p ⬍ 0.001) when compared with opposite cortex and cerebellum. cGMP levels of brain regions at different times of ischemia were higher than those in sham-operated animals (3,4,95) (Fig. 5). The production of NO and cGMP are closely interrelated. NO activates heme-containing enzyme guanylate cyclase following formation of an NO–heme complex. Elevations in cGMP result. Glutamate (via NMDA receptors) has been shown to increase cGMP levels via NO in the cerebellum, hippocampal slices, and primary cortical cultures. NO-binding protein, guanylate cyclase, appears more robust and resistant to the effects of ischemia than NOS. In our experiments, ipsilateral cerebral cortical cGMP levels were increased (relative to contralateral cortex) after MCA occlusion as expected. But the unexpected increase in contralateral cerebellar cGMP production (relative to ipsilateral cerebellum) may be explained by several possible mechanisms. An increase in carbon monoxide may be responsible in contralateral cGMP production without a concomitant increase in nitrite. It has been shown that carbon monoxide, like NO, activates guanylate cyclase and is formed by the action of the enzyme heme oxygenase. The localization of this enzyme is essentially the same as that for guanylate cyclase. These findings, together with the neuronal localization of heme oxygenase, suggest that carbon monoxide may function as a neurotransmitter. Cerebellar hypoperfusion in the contralateral hemisphere after stroke, known as crossed cerebellar diaschisis, is due to interruption of afferent input from the corticopontocerebellar path-
Nitrogen Radicals in Ischemic Brain Damage
93
way. It is possible that a decrease in CBF may occur, which could account for the observed rise in cGMP in contralateral cerebellum (3,4,107). In our experiments, pharmacological inhibition of glutamate receptor by MK-801 (0.5 mg/kg IP), glutamate release by lamotrigine (20 mg/kg IP), and NOS inhibition by l-NAME) (10 mg/kg i.p.), 30 min before or just after MCA occlusion decreased significantly the nitrite (Fig. 6) and cGMP (Fig. 7) concentrations in ipsilateral and contralateral cortex and cerebellum. No significant difference was observed between the effects of MK-801, lamotrigine, and l-NAME on nitrite and cGMP levels before and after treatment (3,4,5,95,107). In our studies we also observed that lamotrigine and l-NAME treatment markedly reduced ipsilateral cortical infarct volumes 24 h following MCA occlusion. Inhibition of iNOS was reported to reduce infarct volume in focal cerebral ischemia, indicating that NO production may play an important pathogenic role in the progression of the tissue damage that follows cerebral ischemia (41,108). In mice and rats, lubeluzole reduced ischemic brain damage when administered immediately after MCA occlusion. The protective effect (reduction of the infarct
(A)
(C)
(B)
(D) Figure 6 Time course of the alterations in mean nitrite levels after MK-801 (0.5 mg/ kg i.p.), lamotrigine (20 mg/kg i.p.), or l-NAME (10 mg/kg i.p.) administered 30 minutes before right middle cerebral artery occlusion.
¨ zben O
94
(A)
(C)
(B)
(D) Figure 7 Time course of the alterations in mean cyclic guanosine monophosphate levels after MK-801 (0.5 mg/kg i.p.), lamotrigine (20 mg/kg i.p.), or l-NAME (10 mg/kg i.p.) administered 30 minutes before right middle cerebral artery occlusion.
volume in rats to 77% of control; P ⬍ 0.01) was also found when the lubeluzole treatment was started 3 h after ischemia (109). Immediate or delayed administration of the selective neuronal NOS inhibitor 1-(2-trifluoromethylphenyl)imidazole (TRIM) reduced the lesion volume after transient MCA occlusion. In contrast, only immediate administration of 7-nitroindazole (7-NI) reduced lesion volume (110). Transforming growth factor–β1 (TGF-β1) has been shown to rescue cultured neurons from excitotoxic and hypoxic cell death and to reduce infarct size after focal cerebral ischemia in mice and rabbits (111). Genetic disruption of PARP provided profound protection against glutamate-NO–mediated ischemic insults in vitro and major decreases in infarct volume after reversible MCA occlusion (63). Inhibitors of PARP activation like 3-aminobenzamide (3-AB) could provide a potential therapy in acute stroke (62). Dot-blot and immunohistochemistry studies were performed on the magnitude and time course of tyrosine nitration and iNOS in the postischemic rat pup brain induced by permanent left MCA occlusion in association with 1-h occlusion of the left common carotid artery. Nitrotyrosine (NT) immunoreactivity was evident in the blood vessels close to
Nitrogen Radicals in Ischemic Brain Damage
95
the cortical infarct at 48–72 h of recovery, and T lymphocytes were involved with this production. iNOS immunoreactivity was seen in neutrophils in the same vessels and in the parenchyma at 72 h of recirculation. Whereas NT staining decreased with time, iNOS-positive neutrophils could be still detected in arachnoid vessels at 14 days of recirculation. It is concluded that perivascular reactions mediated by peroxynitrite are important in the cascade of events that lead to brain oxidative stress in neonatal ischemia. Moreover, NO-related species may serve as a signaling function instead of directly mediating toxicity (112). It was reported that the release of NO induced by experimental ischemia resulted in the irreversible membrane dysfunction and that an NO scavenger, carboxy-2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (carboxyPTIO), prevented the ischemic changes in membrane potential (113). l-NAME, a nonspecific endothelial and neuronal NOS inhibitor, was reported to be neuroprotective in the hyperglycemic rat model of 2 h of transient MCA occlusion followed by 2 h of reperfusion (MCAO/R). The salicylate trapping method was used in conjunction with a microdialysis technique to continuously estimate hydroxyl radical (.OH) formation by measurement of the stable adducts 2,3- and 2,5-dihydroxybenzoic acid (DHBA). Extracellular excitatory amino acids (EAAs) were detected from the same microdialysis samples. Treatment with lNAME (3 mg/kg, IP) 1 min before MCA occlusion and again 1 min before reperfusion reduced the levels of DHBA by 46.4% and glutamate by 50.5% in hyperglycemic rats compared to untreated hyperglycemic controls (114). These data suggest that hyperglycemic MCAO/R results in excessive glutamate excitotoxicity, leading to enhanced generation of .OH via an NO-mediated mechanism, in turn resulting in severe ischemia/reperfusion brain injury. It was shown that membrane lipid peroxidation, protein nitration, and neuronal death after focal cerebral ischemia were significantly reduced in transgenic mice overexpressing human MnSOD (115). Acute ethanol (3 g/kg) was reported to protect against ischemia-induced CA1 hippocampal damage by lowering body temperature. On the other hand, chronic ethanol increased stroke-induced brain damage by increasing NMDA excitotoxicity (116). Sodium nitroprusside (SNP), a spontaneous NO donor, was shown to improve regional CBF and to reduce platelet aggregation in patients with acute ischemic stroke (117). It was reported that prophylactic treatment with 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase inhibitors protected against cerebral injury, augmented cerebral blood flow, reduced infarct size, and improved neurological function in normocholesterolemic mice. The blood flow and neuroprotective effects of HMG-CoA reductase inhibitors were completely absent in eNOS-deficient mice, indicating that enhanced eNOS activity by HMG-CoA reductase inhibitors is the predominant if not the only mechanism by which these agents protect against cerebral injury. Thus, it was suggested that HMG-CoA reductase inhibitors provide a prophylactic treatment strategy for increasing blood flow and reducing brain injury during cerebral ischemia (118).
96
¨ zben O
The barbiturate thiopentone sodium, which acts as a free radical scavenger, protected the CNS neurons against NO-mediated cytotoxicity in vitro and was suggested as one of the best currently available pharmacological agents for protection of neurons against cerebral ischemia (119). The role of NO in metabolic disturbances induced in brain tissue of fetal guinea pigs 10 min after oxygen-glucose deprivation (OGD) of 40 min duration was investigated and the concentration of cGMP in tissue slices rose significantly. This rise was almost completely inhibited by the addition of N-nitro-l-arginine (l-NA), indicating that NOS was strongly activated after OGD in fetal brain tissue. However, addition of l-NA improved neither protein synthesis nor energy metabolism measured 12 h after OGD. Thus, NO does not appear to contribute directly to processes leading to metabolic disturbances induced by transient ischemia in immature brain tissue (120). It has been reported that mild hypothermia (33°C) modulates the burst of NO synthesis during cerebral ischemia and may account, at least partially, for its cerebroprotective effects (9). Neurons, astrocytes, perivascular nerves, and cerebrovascular endothelium may form NO during cerebral ischemia (8). A late but sustained increase in NO levels may also occur due to expression of iNOS within microglia and invading inflammatory cells 24–72 h after the induction of ischemia (41,121). During the immediate period following ischemia, an increased NO production in vascular endothelium or perivascular nerves improves blood flow and is neuroprotective. Infusion of l-arginine, which dilates pial vessels, increases rCBF, reduces infarct size, and causes functional recovery (8,13). Hence, administering NO donors leads to blood flow increases within the ischemic tissue for at least 1 h after arterial occlusion and a decrease in infarct size in models of focal ischemia (8). One may speculate that NO production by perivascular nerves improves blood flow in a zone of hypoperfusion (8,13). Although the ameliorative effects of raising blood flow within ischemic tissues have been known for 10 years, a common treatment strategy has not yet been developed. There are several arguments against this. Increasing rCBF promotes edema formation and free radical generation during reperfusion and normal tissue may steal blood from the ischemic zone. Recent findings with NO donors and l-arginine and preliminary data following thrombolytic therapy in stroke patients strongly suggest that early restoration of rCBF can increase tissue survival and restore function. These events are more critical in ischemic penumbra (8).
IX. NITRIC OXIDE AND GLOBAL ISCHEMIA In rats, we established global ischemia for 30 min by ligating both common carotid arteries and by hypotension that was induced by drawing blood from tail vein. Reoxygenation has been provided for 1 h by deligating the common carotid
Nitrogen Radicals in Ischemic Brain Damage
97
arteries. In the treatment group, lamotrigine (20 mg/kg) has been applied intraperitoneally just after the ischemic insult; then ischemia and reperfusion periods were followed as in ischemia or reperfusion groups similarly. In sham-operated animals, common carotid arteries were exposed but not ligated. NO indicators nitrite and nitrate were found to be increased in cortical, subcortical, and cerebellar brain regions after ischemia. This increase persisted and continued during reperfusion. Although NO indicators were found to be decreased in the lamotrigine-treated group, they were still higher than levels in the ischemic group (122) (Fig. 8). Similar results have been reported by different groups. NOS activity is transiently activated during global cerebral ischemia produced by occlusion of both common carotid arteries together with induced hypotension in rats (123). In complete global ischemia, NO concentration was reported to increase transiently at 2.5 min and decreased thereafter. The NOS inhibitor NG-nitro-l-arginine abolished NO elevation during ischemia (124). During exposure to global ischemia for 7 min, the generation of NO increased in all parts of the brain. In the hippocampus the rate of NO formation during ischemia increased by sixfold from a control rate. This increase was attenuated 47% by treatment with the NOS antagonist 7-nitroindazole (7-NI) (125). Brain ischemia induced by ligation of both common carotid arteries in gerbils increased significantly NOS activities as well as the level of cGMP. The ischemia evoked changes of NOS/cGMP were eliminated by a specific inhibitor of the neuronal form of NOS, 7-NI. The inhibitor of guanylate cyclase, LY-83583, administered before ischemia diminished not only the enhanced level of cGMP but also NOS activity stimulated by ischemia (126). 7-NI was shown to be neuroprotective in 20-min global ischemia in rats, suggesting that NO released from neurons in ischemic conditions has a deleterious influence on hippocampal pyramidal neurons (127,128). Bilateral carotid artery occlusion and combined vertebral artery occlusion in rats produced a transient increase in hippocampal NO 2 and NO 3 levels, according to the duration and degree of ischemic insults which was abolished by an inducible NOS inhibitor aminoguanidine (129). Cerebral ischemia produced by bilateral occlusion of the common carotid arteries (30 min) followed by 4 h of reperfusion resulted in a significant increase in total and inducible NOS activity and a significant increase in the production of NO and superoxide in the cerebral hemispheres (130). TGFβ1 in a low dose range was shown to have the capacity to reduce injury to CA1 hippocampal neurons caused by transient global ischemia in rats (111). Cerebral global transient ischemia induced by bilateral clamping of the carotids for 30 min and reduction of arterial pressure to 50–60 mm Hg caused a rise in cNOS activity and cGMP levels. Pretreatment with desmethyltirilazad (21-aminosteroid) or dizocilpine maleate (NMDA receptor antagonist) or nimodipine (calcium channel antagonist) individually or in combination of three drugs significantly suppressed the increase in cNOS activity and cGMP levels (131–133). It was reported that pretreatment with Radix salviae miltiorrhizae (RSM) reduced the
98
¨ zben O
Figure 8 Nitrite and nitrate levels in different brain regions after global ischemia/reperfusion.
increased cerebral NO concentration on reperfusion in a four-vessel occlusion rat model after 30 min of global ischemia and 15 min of reperfusion (134). It was demonstrated that hypothermia suppresses the elevation in intrajugular NO after cerebral ischemia-reperfusion (135). Exogenous melatonin administration prevented the increases in cerebral cortical and cerebellar NO production (nitrite/ nitrate levels and cGMP) after transient bilateral carotid artery occlusion/reperfusion in adult Mongolian gerbils (136).
Nitrogen Radicals in Ischemic Brain Damage
X.
99
CONCLUSIONS
There have been considerable advances in understanding the functions of NO in the CNS. Recently, development of mutant mice with deletions of the gene encoding nNOS or eNOS provided an opportunity to elucidate the complex role of NO in cerebral ischemia. NO is produced in neurons, glia cells, and vascular endothelium in the CNS. Depending on its origin, its effects are varied. Neuronal NO was proposed as the neurotoxic agent mediating NMDA toxicity and increasing acute ischemic damage. On the other hand, vascular NO as a potent vasodilator and an inhibitor of platelet aggregation may be beneficial in the early stages of cerebral ischemia. It may faciliate collateral blood flow to the ischemic territory. The original observation that inhibitors of NO synthesis can antagonize glutamate toxicity in cell cultures has led to extensive investigation of the role of NO in the pathophysiology of cerebral ischemic injury in vivo. However, studies of the efficacy of NOS inhibitors in models of cerebral ischemia have generated widely disparate findings, ranging from dramatic neuroprotection to exacerbation of ischemic damage. The main reason that underlies some of the existing controversies is the use of nonselective NOS inhibitors. To diminish the ischemic injury, selective inhibitors for neuronal isoform should be developed. However, the potential therapeutic role of NOS inhibitors must be viewed realistically. The therapeutic potential of NOS inhibition is based solely on animal experiments without any clinical trials in humans yet. Although numerous NOS inhibitors have been identified, little is known of their pharmacokinetics, effective plasma concentration range, and long-term side effects. These findings emphasize the need to develop selective inhibitors of the neuronal isoform to protect the brain from injury.
REFERENCES 1. Ogden, J.E., and Moore, P.K. (1995) Inhibition of nitric oxide synthase-potential for a novel class of therapeutic agent? TibTech 131, 70–78. 2. Snyder, S.H. (1992) Nitric oxide: first in a new class of neurotransmitters. Science 257:494–498. ¨ zben, T., Serteser, M., Gu¨mu¨slu¨, S., and Oguz, N. (1997) 3. Balkan, E., Balkan, S., O The effects of nitric oxide synthase inhibitor, l-NAME on NO production during focal cerebral ischemia in rats: could l-NAME be the future treatment of sudden deafness? Int. J. Neurosci. 89:61–67. ¨ zben, T., Balkan, E., Oguz, N., Serteser, M., and Gu¨mu¨slu¨, S. (1997) 4. Balkan, S., O Effects of lamotrigine on brain nitrite and cGMP levels during focal cerebral ischemia in rats. Acta Neurol. Scand. 95:140–146. ¨ zben, T., Balkan, S., and Balkan, E. (1997) Inhibitory 5. Gu¨mu¨slu¨, S., Serteser, M., O role of N w-nitro-l-arginine methyl ester (l-NAME), a potent nitric oxide synthase
100
6.
7.
8. 9. 10. 11. 12.
13.
14.
15.
16.
17. 18.
19.
20.
21.
¨ zben O inhibitor on brain malondialdehyde and conjugated diene levels during focal cerebral ischemia in rats. Clin. Chim. Acta 267(2):213–223. ¨ zben, T. (1998) Pathophysiology of cerebral ischemia: mechanisms involved in O neuronal damage. In: Free Radicals, Oxidative Stress and Antioxidants. Pathologi¨ zben, ed.), Plenum Press, New York, cal and Physiological Significance (T. O pp. 163–189. Buisson, A., Margaill, I., Callebert, J., Plotkine, M., and Boulu, R.G. (1993) Mechanisms involved in the neuroprotective activity of a nitric oxide synthase inhibitor during focal cerebral ischemia, J. Neurochem. 61(2):690–696. Dalkara, T., and Moskowitz, M.A. (1994) The complex role of nitric oxide in the pathophysiology of focal cerebral ischemia. Brain Pathol. 4:49–57. Kader, A., Frazzini, V.I., Solomon, R.A., and Trifiletti, R.R. (1993) Nitric oxide production during focal cerebral ischemia in rats. Stroke 24:1709–1716. Moskowitz, M.A., and Dalkara, T. (1996) Nitric oxide and cerebral ischemia. Adv. Neurol. 71:365–367. Samdani, A.F., Dawson, T.M., and Dawson, V.L. (1997) Nitric oxide synthase in models of focal ischemia. Stroke 28(6):1283–1288. Stuhlmiller, D.F., and Boje, K.M. (1995) Characterization of l-arginine and aminoguanidine uptake into isolated rat choroid plexus: differences in uptake mechanisms and inhibition by nitric oxide synthase inhibitors. J. Neurochem. 65(1):68–74. Anile, C., Maira, G., Iannone, M., Corte, F.D., Mangiola, A., and Nistico, G. (1993) Role of nitric oxide in the regulation of cerebral blood flow under normal conditions and in brain ischaemia in pigs. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 143–149. Hanbauer, I. (1993) The role of nitric oxide in neurotransmitter release. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 135–143. Moncada, C., Lekieffre, D., Arvin, B., and Meldrum, B.S. (1993) The involvement of nitric oxide in neuronal damage in a focal model of excitotoxicity in vivo and a global model of ischemia. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 191–199. Bredt, D.S. (1993) Neurobiological roles of nitric oxide synthase. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 97–111. Drummond, G.I. (1983) Cyclic nucleotides in the nervous system. Adv. Cyclic Nucleotide Res. 15:373–394. Garthwaite, J. (1993) Nitric oxide signalling in the nervous system. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 85–97. Bories, P.N., and Bories, C. (1995) Nitrate determination in biological fluids by an enzymatic one-step assay with nitrate reductase. Clin. Chem. 41(6):904– 907. Dawson, V.L., Dawson, T.M., London, E.D., Bredt, D.S., and Snyder, S.H. (1991) Nitric oxide mediates glutamate neurotoxicity in primary cortical cultures. Proc. Natl. Acad. Sci. USA 88:6368–6371. Springall, D.R., Suburo, A., Bishop, A.E., Merrett, M., Moncada, S., and Polak,
Nitrogen Radicals in Ischemic Brain Damage
22. 23.
24.
25.
26.
27.
28.
29. 30.
31. 32.
33.
34.
35.
101
J.M. (1992) Nitric oxide synthase is present abundantly in human neurons and vascular endothelium. In: The Biology of Nitric Oxide: Enzymology, Biochemistry, and Immunology (S. Moncada, M.A. Marletta, J.B. Hibbs, and E.A. Higgs, eds.), Portland Press, London, pp. 117–119. Archer, S. (1993) Measurement of nitric oxide in biological models. FASEB J. 7: 349–360. Dawson, T.M., Bredt, D.S., Fotuhi, M., Hwang, P.M., and Snyder, S.H. (1991) Nitric oxide synthase and neuronal NADPH diaphorase are identical in brain and peripheral tissues. Proc. Natl. Acad. Sci. USA 88:7797–7801. Hope, B.T., Michael, G.J., Knigge, K.M., and Vincent, S.R. (1991) Neuronal NADPH diaphorase is a nitric oxide synthase. Proc. Natl. Acad. Sci. USA 88:2811– 2814. Knowles, R.G., Salter, M., Brooks, S.L., and Moncada, S. (1990) Anti-inflammatory glucocorticoids inhibit the induction by endotoxin of nitric oxide synthase in the lung, liver and aorta of the rat. Biochem. Biophys. Res. Commun. 172:1042– 1048. Gross, S.S., Jaffe, E.A., Levi, R., and Kilbourn, R.G. (1991) Cytokine-activated endothelial cells express an isotype of nitric oxide synthase which is tetrahydrobiopterin-dependent, calmodulin-independent and inhibited by arginine analogs with a rank-order potency characteristic of activated macrophages. Biochem. Biophys. Res. Commun. 178:823–829. Chao, C.C., Hu, S., Molitor, T.W., Shaskan, E.G., and Peterson, P.K. (1992) Activated microglia mediate neuronal cell injury via a nitric oxide mechanism. J. Immunol. 149:2736–2741. Murphy, S., Simmons, M.L., Agullo, L., Garcia, A., Feinstein, D.L., Galea, E., Reis, D.J., Minc-Golomb, D., and Schwartz, J.P. (1993) Synthesis of nitric oxide in CNS glial cells. Trends Neurosci. 16:323–328. Dalkara, T., Yoshida, T., Irikura, K., and Moskowitz, M.A. (1994) Dual role of nitric oxide in focal cerebral ischemia. Neuropharmacology 33(11):1447–1452. Xia, Y., Dawson, V.L., Dawson, T.M., Snyder, S.H., and Zweier, J.L. (1996) Nitric oxide synthase generates superoxide and nitric oxide in arginine-depleted cells leading to peroxynitrite-mediated cellular injury. Proc. Natl. Acad. Sci. USA 93(13): 6770–6774. Marletta, M.A. (1991) Nitric oxide biosynthesis and biological significance. Trends Biochem. Sci. 14:488–492. Okuma, Y., Uehara, T., Miyazaki, H., Miyasaka, T., and Nomura, Y. (1998) The involvement of cytokines, chemokines and inducible nitric oxide synthase (iNOS) induced by a transient ischemia in neuronal survival/death in rat brain. Nippon Yakurigaku Zasshi 111(1):37–44. Fujimura, M., Tominaga, T., Kato, I., Takasawa, S., Kawase, M., Taniguchi, T., Okamoto, H., and Yoshimoto, T. (1997) Attenuation of nitric oxide synthase induction in IRF-1-deficient glial cells. Brain Res. 759(2):247–250. Gajkowska, B., and Mossakowski, M.J. (1997) Endothelial nitric oxide synthase in vascular endothelium of rat hippocampus after ischemia: evidence and significance. Folia Neuropathol. 35(3):171–180. Beckman, J.S., and Koppenol, W. (1992) Why is the half-life of nitric oxide so
102
36.
37.
38.
39.
40.
41. 42.
43.
44.
45. 46. 47. 48.
49.
50.
¨ zben O short? In: The Biology of Nitric Oxide: Enzymology, Biochemistry, and Immunology (S. Moncada, M. A. Marletta, J.B. Hibbs, and E.A. Higgs, eds.), Portland Press, London, p. 131. Habu, H., Yokoi, I., Kabuto, H., and Mori, A. (1994) Application of automated flow injection analysis to determine nitrite and nitrate in mouse brain. Neuroreport 5(13):1571–1573. Beckman, J.S., Beckman, T.W., Chen, J., Marshall, P.A., and Freeman, B.A. (1990) Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. USA 87:1620–1624. Stamler, J.S., Simon, D.I., Osborne, J.A., Mullins, M.E., Jaraki, O., Michel, T., Singel, D.J., and Loscalzo, J. (1992) S-Nitrosylation of proteins by nitric oxide: synthesis and characterization of novel biologically active compounds. Proc. Natl. Acad. Sci. USA 89:444–448. Griscavage, J.M., Rogers, N.E., Sherman, M.P., and Ignarro, L.J. (1993) Inducible nitric oxide synthase from rat alveolar macrophage cell line is inhibited by nitric oxide. J. Immunol. 151:6329–6337. Zhang, F., Xu, S., and Iadecola, C. (1995) Time dependence of effect of nitric oxide synthase inhibition on cerebral ischemic damage. J. Cereb. Blood Flow Metab. 15(4):595–601. Iadecola, C., Zhang, F., and Xu, S. (1995) Inhibition of inducible nitric oxide synthase ameliorates cerebral ischemic damage. Am. J. Physiol. 268(1 Pt2):R286–292. Bidmon, H.J., Wu, J., Buchkremer-Ratzmann, I., Mayer, B., Witte, O.W., and Zilles, K. (1998) Transient changes in the presence of nitric oxide synthases and nitrotyrosine immunoreactivity after focal cortical lesions. Neurosciences 82(2):377– 395. Yamamoto, S., Nishizawa, S., Yokoyama, T., Ryu, H., and Uemura, K. (1997) Subarachnoid hemorrhage impairs cerebral blood flow response to nitric oxide but not to cyclic GMP in large cerebral arteries. Brain Res. 757(1):1–9. Knowles, R.G., Palacios, M., Palmer, R.M.J., and Moncada, S. (1989) Formation of nitric oxide from l-arginine in the central nervous system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc. Natl. Acad. Sci. USA 86:5159–5162. Knowles, R.G., and Moncada, S. (1992) Nitric oxide as a signal in blood vessels. Trends Biochem. Sci. 17:399–402. Moncada, S., Palmer, R.M.J., and Higgs, E.A. (1991) Nitric oxide:physiology, pathophysiology and pharmacology. Pharmacol. Rev. 43:109–142. Dawson, T.M., Dawson, V.L., and Snyder, S.H. (1992) A novel neuronal messenger in brain: the free radical, nitric oxide. Ann. Neurol. 32:297–311. Onoue, H., and Katusic, Z.S. (1998) The effect of 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ) and charybdotoxin (CTX) on relaxations of isolated cerebral arteries to nitric oxide. Brain Res. 785(1):107–113. Lohmann, S.M., Walter, U., Miller, P.E., Greengard, P., and De Camilli, P. (1981) Immunohistochemical localisation of cyclic GMP-dependent protein kinase in mammalian brain. Proc. Natl. Acad. Sci. USA 78:653–657. Garthwaite, J. (1991) Glutamate, nitric oxide and cell-cell signalling in the nervous system. Trends Neurosci. 14:60–67.
Nitrogen Radicals in Ischemic Brain Damage
103
51. Stamler, S.S., Singel, D.J., and Loscalzo, J. (1992) Biochemistry of nitric oxide and its redox-activated forms. Science 258:1898–1902. 52. Wolf, E.W., Banerjee, A., Soble-Smith, J., Dohan, F.C. Jr, White, R.P., and Robertson, J.T. (1998) Reversal of cerebral vasospasm using an intrathecally administered nitric oxide donor. J. Neurosurg. 89:279–288. 53. Kumura, E., Yoshimine, T., Iwatsuki, K.I., Yamanaka, K., Tanaka, S., Hayakawa, T., Shiga, T., and Kosaka, H. (1996) Generation of nitric oxide and superoxide during reperfusion after focal cerebral ischemia in rats. Am. J. Physiol. 270(3 Pt. 1):C748–C752. 54. Gross, S.S., and Wolin, M.S. (1995) Nitric oxide: pathophysiological mechanisms. Annu. Rev. Physiol. 57:737–769. 55. Beckman, J.S. (1991) The double-edged role of nitric oxide in brain function and superoxide-mediated injury. J. Dev. Physiol. 15(1):53–59. 56. Tanaka, K., Shirai, T., Nagata, E., Dembo, T., and Fukuuchi, Y. (1995). Immunohistochemical detection of nitrotyrosine in postischemic cerebral cortex in gerbil. Neurosci. Lett. 235:85–88. 57. Nishizawa, S., Yamamoto, S., Yokoyama, T., and Uemura, K. (1997) Dysfunction of nitric oxide induces protein kinase C activation resulting in vasospasm after subarachnoid hemorrhage. Neurol Res. 19(5):558–562. 58. Kwon, N.S., Stuehr, D.J., and Nathan, C.F. (1991) Inhibition of tumor cell ribonucleotide reductase by macrophage-derived nitric oxide. J. Exp. Med. 174:761– 767. 59. Liu, R.H., and Hotchkiss, J.H. (1995) Potential genotoxicity of chronically elevated nitric oxide: a review. Mutat. Res. 339:73–89. 60. Zhang, J., Dawson, V.L., Dawson, T.M., and Snyder, S.H. (1994) Nitric oxide activation of poly(ADP-ribose) synthase in neurotoxicity. Science 263:686–689. 61. Endres, M., Scott, G., Namura, S., Salzman, A.L., Huang, P.L., Moskowitz, M.A., and Szabo, C. (1998) Role of peroxynitrite and neuronal nitric oxide synthase in the activation of poly(ADP-ribose) synthetase in a murine model of cerebral ischemiareperfusion. Neurosci. Lett. 248(1):41–44. 62. Endres, M., Wang, Z.Q., Namura, S., Waeber, C., and Moskowitz, M.A. (1997) Ischemic brain injury is mediated by the activation of poly(ADP-ribose)polymerase. J. Cereb. Blood Flow Metab. 17(11):1143–1151. 63. Eliasson, M.J., Sampei, K., Mandir, A.S., Hurn, P.D., Traystman, R.J., Bao, J., Pieper, A., Wang, Z.Q., Dawson, T.M., Snyder, S.H., and Dawson, V.L. (1997) Poly (ADP-ribose) polymerase gene disruption renders mice resistant to cerebral ischemia. Natl. Med. 3(10):1089–1095. 64. Tominiga, T., Kure, S., Narisawa, K., and Yoshimoto, T. (1993) Endonuclease activation following focal ischemic injury in the brain. Brain Res. 608:21–26. 65. Charriaut-Marlangue, C., Margaill, I., Plotkine, M., and Ben-Ari, Y. (1995) Early endonuclease activation following reversible focal ischemia in the rat brain. J. Cereb. Blood Flow Metab. 15:385–388. 66. Li, Y., Chopp, M., Jiang, N., Yao, F., and Zaloga, C. (1995) Temporal profile of in situ DNA fragmentation after middle cerebral artery occlusion in the rat. J. Cereb. Blood Flow Metab. 15:389–397. 67. Ozyurt, E., Graham, D.I., Woodruff, G.N., and McCulloch, J. (1988) Protective
104
68.
69. 70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
¨ zben O effect of the glutamate antagonist, MK-801 in focal cerebral ischemia in the cat. J. Cereb. Blood Flow Metab. 8(1):138–143. Park, C.K., Nehls, D.G., Graham, D.I., Teasdale, G.M., and McCulloch, J. (1988) The glutamate antagonist MK-801 reduces focal ischemic brain damage in the rat. Ann. Neurol. 24:543–551. Scatton, B. (1994) Excitatory amino acid receptor antagonists: a novel treatment for ischemic cerebrovascular diseases. Life Sci. 55(25/26):2115–2124. Hansen, A.J. (1995) The importance of glutamate receptors in brain ischemia. In: Neurochemistry in Clinical Applications, Vol. 363 (L.C. Tang and S.J. Tang, eds.), Plenum Press, New York, pp. 123–131. Garthwaite, J., Charles, S.L., and Chess-Williams, R. (1988) Endothelium-derived relaxing factor release on activation of NMDA receptors suggests role as intercellular messenger in the brain. Nature 336:385–388. Anderson, R.E., and Meyer, F.B. (1996) Nitric oxide synthase inhibition by lNAME during repetitive focal cerebral ischemia in rabbits. Am. J. Physiol. 271(2 Pt 2):H588–H594. Nowicki, J.P., Carreau, A., Duval, D., Vige, X., and Scatton, B. (1993) Neuroprotective potential of nitric oxide synthase inhibitors. In: Nitric Oxide: Brain and Immune System (S. Moncada, G. Nistico, and E.A. Higgs, eds.), Portland Press, London, pp. 121–135. Regli, L., Held, M.C., Anderson, R.E., Meyer, F.B., Thoralf, M., and Sundt, M.D., Jr. (1996) Nitric oxide synthase inhibition by l-NAME prevents brain acidosis during focal cerebral ischemia in rabbits, J. Cereb. Blood Flow Metab. 16(5):988– 995. Moore, P.K., al-Swayeh, O.A., Chong, N.W.S., Evans, R., Mirzazadeh, S., and Gibson, A. (1990) L-N G-nitroarginine, a novel, l-arginine-reversible inhibitor of endothelium-dependent vasodilatation in vivo. Br. J. Pharmacol. 99:408–412. Rees, D.D., Palmer, R.M.J., Schulz, R., Hodson, F., and Moncada, S. (1990) Characterization of three inhibitors of endothelial nitric oxide synthase in vitro and in vivo. Br. J. Pharmacol. 101:746–752. Dwyer, M.A., Bredt, D.S., and Snyder, S.H. (1991) Nitric oxide synthase: irreversible inhibition by L-N G-nitroarginine in brain in vitro and in vivo. Biochem. Biophys. Res. Commun. 176:1136–1141. Lambert, L.E., Whitten, J.P., Baron, B.M., Chang, H.C., Doherty, N.S., and McDonald, J.H. (1991) Nitric oxide in the CNS, endothelium, and macrophages differ in its sensitivity to inhibition by arginine analogs. Life Sci. 48:69–75. Moore, P.K., Wallace, P., Gaffen, Z., Hart, S.L., and Babbedge, R.C. (1993) Characterization of a novel nitric oxide synthase inhibitor 7-nitroindazole and related indazoles: antinociceptive and cardiovascular effects. Br. J. Pharmacol. 110:219– 224. Yoshida, T., Limmroth, V., Irikura, K., and Moskowitz, M. (1994) The NOS inhibitor 7-nitroindazole decreases focal infarct volume but not the response to topical acethylcholine in pial vessels. J. Cereb. Blood Flow Metab. 14:924–929. Babbedge, R.C., Bland-Ward, S.L., Hart, S.L., and Moore, P.K. (1993) Inhibition of rat cerebellar nitric oxide synthase by 7-nitroindazole and related substituted indazoles. Br. J. Pharmacol. 110:225–228.
Nitrogen Radicals in Ischemic Brain Damage
105
82. Misko, T.P., Moore, W.M., Kasten, T.P., Nickols, G.A., and Corbet, J.A. (1993) Selective inhibition of inducible nitric oxide synthase by aminoguanidine. Eur. J. Pharmacol. 233:119–125. 83. Dawson, D.A. (1994) Nitric oxide and focal cerebral ischemia: multiplicity of actions and diverse outcome. Cerebrovasc. Brain Metab. Rev. 6(4):299–324. 84. Yamamoto, S., Golanov, E.V., Berger, S.B., and Reis, D.J. (1992) Inhibition of nitric oxide synthesis increases focal ischemic infarction in rat. J. Cereb. Blood Flow Metab. 12(5):717–726. 85. Hamada, J., Greenberg, J.H., Croul, S., Dawson, T.M., and Reivich, M. (1995) Effects of central inhibition of nitric oxide synthase on focal cerebral ischemia in rats. J. Cereb. Blood Flow Metab. 15(5):779–786. 86. Huang, Z., Huang, P.L., Panahian, N., Dalkara, T., Fishman, M.C., and Moskowitz, M.A. (1994) Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science 265(5180):1883–1885. 87. Moncada, C., Lekieffre, D., Arvin, B., and Meldrum, B. (1992) Effect of NO synthase inhibition on NMDA- and ischaemia-induced hippocampal lesions. Neuroreport 3:530–532. 88. Weissman, B.A., Kadar, T., Brandeis, R., and Shapira, S. (1992) NG-nitro-l-arginine enhances neuronal death following transient forebrain ischemia in gerbils. Neurosci. Lett. 146:139–142. 89. Meldrum, B. (1990) Protection against ischemic neuronal damage by drugs acting on excitatory neurotransmission. Cerebrovasc. Brain Metab. Rev. 2:27–57. 90. Nellgard, B., and Wieloch, T. (1992) Postischemic blockade of AMPA but not NMDA receptors mitigates neuronal damage in the rat brain following transient severe cerebral ischemia. J. Cereb. Blood Flow Metab. 12:2–11. 91. Gillardon, F., Krep, H., Brinker, G., Lenz, C., Bottiger, B., and Hossman, K.A. (1998) Induction of protein inhibitor of neuronal nitric oxide synthase/cytoplasmic dynein light chain following cerebral ischemia. Neuroscience 84(1):81–88. 92. Iadecola, C. (1997) Bright and dark sides of nitric oxide in ischemic brain injury. Trends Neurosci. 20(3):132–139. 93. Hunter, A.J., Green, A.R., and Cross, A.J. (1995) Animal models of acute ischaemic stroke: can they predict clinically successful neuroprotective drugs. TIPS 16:123– 128. 94. Chen, S.T., Hsu, C.Y., Hogan, E.L., Maricq, H., and Balentine, J.D. (1986) A model of focal ischemic stroke in the rat: reproducible extensive cortical infarct. Stroke 17:738–743. ¨ zben, T., Balkan, E., Balkan, S., Oguz, N., Gu¨mu¨slu¨, S., and Serteser, M. (1999) 95. O The effects of the glutamate antagonist, MK-801 in focal cerebral ischemia in the rat (in press). 96. Kumura, E., Kosaka, H., Shiga, T., Yoshimine, T., and Hayakawa, T. (1994) Elevation of plasma nitric oxide end products during focal cerebral ischemia and reperfusion in the rat. J. Cereb. Blood Flow Metab. 14(3):487–491. 97. Rice-Evans, C.A., Diplock, A.T., and Symons, M.C.R. (1991) The detection and characterization of free radical species. in: Techniques in Free Radical Research, Vol. 22 (R.H. Burdon and P.H. van Knippenberg, eds.), Elsevier, Amsterdam, pp. 51–99.
106
¨ zben O
98. Malinski, T., Patton, S., Grunfeld, S., Kubaszewski, E., Pierchala, B., Kiechle, F., and Radomski, M.W. (1994) Determination of nitric oxide in vivo by a porphyrinic microsensor. In: The Biology of Nitric Oxide: Physiological and Clinical Aspects (S. Moncada, M. Feelisch, R. Busse, and E.A. Higgs, eds.), Portland Press, London, pp. 48–53. 99. Sato, S., Tominaga, T., Ohnishi, T., and Ohnishi, S.T. (1993) EPR spin trapping study of nitric oxide formation during bilateral carotid occlusion in the rat. Biochim. Biophys. Acta 1181:195–197. 100. Ohta, K., Graf, R., Rosner, G., Kumura, E., and Heiss, W.D. (1996) Early nitric oxide increases in depolarised tissue of cat focal cerebral ischaemia. Neuroreport 8(1):143–148. 101. Rao, A.M., Dogan, A., Hatcher, J.F., and Dempsey, R.J. (1998) Fluorometric assay of nitrite and nitrate in brain tissue after traumatic brain injury and cerebral ischemia. Brain Res. 793:265–270. 102. Higuchi, Y., Hattori, H., Kume, T., Tsuji, M., Akaike, A., and Furusho, K. (1998) Increase in nitric oxide in the hypoxic-ischemic neonatal rat brain and suppression by 7-nitroindazole and aminoguanidine. Eur. J. Pharmacol. 342(1):47–49. 103. Nagafuji, T., Suzuki, M., and Hosoi, Y. (1998) Lack of evidence that inducible nitric oxide synthase participates in the development of ischemic brain damage. Nippon Yakurigaku Zasshi 111(1):45–53. 104. Iadecola, C., Zhang, F., Casey, R., Nagayama, M., and Ross, M.E. (1997) Delayed reduction of ischemic brain injury and neurological deficits in mice lacking the inducible nitric oxide synthase gene. J. Neurosci. 17(23):9157–9164. 105. Iadecola, C., and Ross, M.E. (1997) Molecular pathology of cerebral ischemia: delayed gene expression and strategies for neuroprotection. Ann. NY Acad. Sci. 835:203–217. 106. Nogawa, S., Forster, C., Zhang, F., Nagayama, M., Ross, M.E., and Iadecola, C. (1998) Interaction between inducible nitric oxide synthase and cyclooxygenase-2 after cerebral ischemia. Proc. Natl. Acad. Sci. USA 95(18):10966–10971. ¨ zben T., Balkan S., and Balkan E. (1998) Biochemical 107. Serteser M., Gu¨mu¨slu¨ S., O evidence of crossed cerebellar diaschisis in terms of nitric oxide indicators and lipid peroxidation products in rats during focal cerebral ischemia (in press). 108. Iadecola, C., Zhang, F., Xu, S., Casey, R., and Ross, M.E. (1995) Inducible nitric oxide synthase gene expression in brain following cerebral ischemia. J. Cereb. Blood Flow Metab. 15(3):378–384. 109. Culmsee, C., Junker, V., Wolz, P., Semkova, I., and Krieglstein, J. (1998) Lubeluzole protects hippocampal neurons from excitotoxicity in vitro and reduces brain damage caused by ischemia. Eur. J. Pharmacol. 342(2–3):193–201. 110. Escott, K.J., Beech, J.S., Haga, K.K., Williams, S.C., Meldrum, B.S., and Bath, P.M. (1998) Cerebroprotective effect of the nitric oxide synthase inhibitors, 1-(2trifluoromethylphenyl)imidazole and 7-nitro indazole, after transient focal cerebral ischemia in the rat. J. Cereb. Blood Flow Metab. 18(3):281–287. 111. Henrich-Noack, P., Prehn, J.H., and Krieglstein, J. (1996) TGF-beta 1 protects hippocampal neurons against degeneration caused by transient global ischemia. Dose– response relationship and potential neuroprotective mechanisms. Stroke 27(9): 1609–1614.
Nitrogen Radicals in Ischemic Brain Damage
107
112. Coeroli, L., Renolleau, S., Arnaud, S., Plotkine, D., Cachin, N., Plotkine, M., BenAri, Y., and Charriaut-Marlangue, C. (1998). Nitric oxide production and perivascular tyrosine nitration following focal ischemia in neonatal rat. J. Neurochem. 70(6):2516–2525. 113. Onitsuka, M., Mihara, S., Yamamoto, S., Shigemori, M., and Higashi, H. (1998) Nitric oxide contributes to irreversible membrane dysfunction caused by experimental ischemia in rat hippocampal CA1 neurons. Neurosci. Res. 30(1):7–12. 114. Wei, J., and Quast, M.J. (1998) Effect of nitric oxide synthase inhibitor on a hyperglycemic rat model of reversible focal ischemia: detection of a excitatory amino acids release and hydroxyl radical formation. Brain Res. 791(1–2):146–156. 115. Keller, J.N., Kindy, M.S., Holtsberg, F.W., St Clair, D.K., Yen, H.C., Germeyer, A., Steiner, S.M., Bruce-Keller, A.J., Hutchins, J.B., and Mattson, M.P. (1998) Mitochondrial manganese superoxide dismutase prevents neural apoptosis and reduces ischemic brain injury: suppression of peroxynitrite production, lipid peroxidation and mitochondrial dysfunction. J. Neurosci. 18(2):687–697. 116. Crews, F.T., Steck, J.C., Chandler, L.J., Yu, C.J., and Day, A. (1998) Ethanol, stroke, brain damage, and excitotoxicity. Pharmacol. Biochem. Behav. 59(4):981– 991. 117. Butterworth, R.J., Cluckie, A., Jackson, S.H., Buxton-Thomas, M., and Bath, P.M. (1998) Pathophysiological assessment of nitric oxide (given as sodium nitroprusside) in acute ischaemic stroke. Cerebrovasc. Dis. 8(3):158–165. 118. Endres, M., Laufs, U., Huang, Z., Nakamura, T., Huang, P., Moskowitz, M.A., and Liao, J.K. (1998) Stroke protection by 3-hydroxy-3-methylglutaryl (HMG)–CoA reductase inhibitors mediated by endothelial nitric oxide synthase. Proc. Natl. Acad. Sci. USA 95(15):8880–8885. 119. Shibuta, S., Kosaka, J., Mashimo, T., Fukuda, Y., and Yoshiya, I. (1998) Nitric oxide-induced cytotoxicity attenuation by thiopentone sodium but not pentobarbitone sodium in primary brain cultures. Br. J. Pharmacol. 124(4):804–810. 120. Berger, R., Jensen, A., and Paschen, W. (1998) Metabolic disturbances in hippocampal slices of fetal guinea pigs during and after oxygen-glucose deprivation: is nitric oxide involved? Neurosci. Lett. 245(3):163–166. 121. Iadecola, C., Xu, S., Zhang, F., el-Fakahany, E.E., and Ross, M.E. (1995) Marked induction of calcium-independent nitric oxide synthase activity after focal cerebral ischemia J. Cereb. Blood Flow Metab. 15(1):52–59. ¨ zben, T. (1998) Nitric oxide, lipid peroxidation and protein 122. Serteser, M., and O oxidation in experimental global cerebral ischemia-reperfusion damage. Neuroprotective effect of glutamate release inhibition. Unpublished results. 123. Shibata, M., Araki, N., Hamada, J., Sasaki, T., Shimazu, K., and Fukuuchi, Y. (1996) Brain nitrite production during global ischemia and reperfusion: an in vivo microdialysis study. Brain Res. 734(1–2):86–90. 124. Ohta, K., Graf, R., Rosner, G., and Heiss, W.D. (1997) Profiles of cortical tissue depolarization in cat focal cerebral ischemia in relation to calcium ion homeostasis and nitric oxide production. J. Cereb. Blood Flow Metab. 17(11):1170–1181. 125. Olesen, S.P., Moller, A., Mordvintcev, P.I., Busse, R., and Mulsch, A. Regional measurement of NO formed in vivo during brain ischemia. Acta Neurol. Scand. 95(4):219–224.
108
¨ zben O
126. Chalimoniuk, M., Glod, B., and Strosznajder, J. NMDA receptor mediated nitric oxide dependent cGMP synthesis in brain cortex and hippocampus. Effect of ischemia on NO related biochemical processes during reperfusion. Neurol. Neurochir. Pol. 30(2):65–84. 127. Nanri, K., Montecot, C., Springhetti, V., Seylaz, J., and Pinard, E. (1998) The selective inhibitor of neuronal nitric oxide synthase, 7-nitroindazole, reduces the delayed neuronal damage due to forebrain ischemia in rats. Stroke 29(6):1248–1253. 128. O’Neill, M.J., Hicks, C., and Ward, M. (1996) Neuroprotective effects of 7-nitroindazole in the gerbil model of global cerebral ischaemia. Eur. J. Pharmacol. 310(2– 3):115–122. 129. Togashi, H., Mori, K., Ueno, K., Matsumoto, M., Suda, N., Saito, H., and Yoshioka, M. (1998) Consecutive evaluation of nitric oxide production after transient cerebral ischemia in the rat hippocampus using in vivo brain microdialysis. Neurosci. Lett. 240(1):53–57. 130. Forman, L.J., Liu, P., Nagele, R.G., Yin, K., and Wong, P.Y. (1998) Augmentation of nitric oxide, superoxide, and peroxynitrite production during cerebral ischemia and reperfusion in the rat. Neurochem. Res. 23(2):141–148. 131. Fernandez, M.P., Belmonte, A., Meizoso, M.J., Garcia-Novio, M., and Garcia-Iglesias, E. (1997) Desmethyl tirilazad reduces brain nitric oxide synthase activity and cyclic guanosine monophosphate during cerebral global transient ischemia in rats. Res. Commun. Mol. Pathol. Pharmacol. 95(1):33–42. 132. del Pilar Fernandez, R.M., Belmonte, A., Meizoso, M.J., Garcia-Novio, M., and Garcia-Iglesias, E. (1997) Effect of tirilazad on brain nitric oxide synthase activity during cerebral ischemia in rats. Pharmacology 54(2):108–112. 133. del Pilar Fernandez, M., Meizoso, M.J., Lodeiro, M.J., and Belmonte, A. (1998) Effect of desmethyl tirilazad, dizocilpine maleate and nimodipine on brain nitric oxide synthase activity and cyclic guanosine monophosphate during cerebral ischemia in rats. Pharmacology 57(4):174–179. 134. Kuang, P., Tao, Y., and Tian, Y. (1996) Effect of radix salviae miltiorrhizae on nitric oxide in cerebral ischemic-reperfusion injury. J. Trad. Chin. Med. 16(3):224– 227. 135. Kumura, E., Yoshimine, T., Takaoka, M., Hayakawa, T., Shiga, T., and Kosaka, H. (1996) Hypothermia suppresses nitric oxide elevation during reperfusion after focal cerebral ischemia in rats. Neurosci. Lett. 220(1):45–48. 136. Guerrero, J.M., Reiter, R.J., Ortiz, G.G., Pablos, M.I., Sewerynek, E., and Chuang, J.I. (1997) Melatonin prevents increases in neuronal nitric oxide and cyclic GMP production after transient brain ischemia and reperfusion in the Mongolian gerbil (Meriones unguiculatus). J. Pinael Res. 23(1):24–31.
5 Neuroinflammatory Events and Enhanced Signal Transduction Processes Involved in Neurodegeneration Robert A. Floyd, C. A. Stewart, K. A. Robinson, G. Bing, and K. Hensley Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma
I. INTRODUCTION Increased oxidative damage in the central nervous system has become closely associated with several age-related neurodegenerative diseases. Results from our research effort in this area have lead to demonstrations that enhanced neuroinflammatory events and elevated signal transduction processes are closely tied to age-associated neurodegenerative etiology. Enhanced production of reactive oxygen species (ROS) leading to elevated oxidative damage is mostly understood as a result of enhanced activation of glial cells, which then lead to enhanced production of reactive nitrogen species (RNS). Increased amounts of RNS are due to enhanced signal transduction–mediated elevation of inducible nitric oxide synthase (iNOS) gene expression. Although this broad overview purposely oversimplifies the many different dynamic control processes involved, on the whole the experimental data emerging do underscore its validity. We present a brief historical view of how our experimental data forced us to reach the conclusions drawn. Attempts to understand the mechanism of the neuroprotective action of α-phenyl-tert-butylnitrone (PBN), a nitrone-based free radical trap, provided an initial thrust. A summary of recently obtained data from brains of Alzheimer subjects, in comparison to age-matched controls, will be presented. These results
109
110
Floyd et al.
can be understood in the context of basic studies on cultured astrocytes demonstrating cytokine-mediated upregulation of signal transduction processes, particularly those involving the activation of the p38 protein kinase signal transduction pathway.
II. BACKGROUND The approach that led to our current understanding began with the inability to explain the neuroprotective activity of PBN as being simply due to its ability to trap free radicals. A critical evaluation of the role of ROS in brain aging and in neurodegenerative processes required the development and use of rigorous methods. Use of salicylate hydroxylation methodology to assess hydroxyl free radical flux in vivo demonstrated that enhanced flux of ROS is produced when brain is subjected to experimental stroke (1). In addition, it was shown that old brain is much more susceptible to an experimental stroke than young brain (2) and that tissue injury from experimental brain stroke is largely prevented by an after-theevent administration of PBN. Subsequently, it was shown that chronic low-level administration of PBN to older animals decreased the elevated oxidized protein content of their brains (3–5) and caused a lingering reversal of the age-enhanced susceptibility of old brain to stroke, even 5 days after cessation of PBN administration (5). It was also demonstrated that there was a return to young status of some age-modified decrement of memory functions as a result of chronic lowlevel PBN treatment (4). Since PBN was effective even when delivered after the massive increase in ROS production, which occurs immediately after a stroke, it was clear that direct trapping of free radicals is unlikely to be the primary mechanism of its neuroprotective action. Additionally, the fact that its chronic low-level administration reversed age-related susceptibility to a stroke even several days after cessation of its administration also provided ample evidence that stoichiometric mass action trapping could not explain its action since its biological half-life is relatively short, i.e., about 2 h (6). It was shown that PBN prevents an oxidative insult–mediated upregulation of iNOS and c-fos genes in the liver of a septic shock model (7) and in the brain of an experimental stroke model (8), respectively. Therefore, we postulated that the neuroprotective action of PBN was in large part due to its ability to prevent an oxidative insult–mediated upregulation of genes that produce neurotoxic products (9,10). Candidate neurotoxic products include nitric oxide (NO), produced by iNOS, and lipid oxidation products produced by inducible cyclooxygenase (COX-II) gene. This hypothesis has largely held up and become stronger over the course of its experimental testing throughout the last 4 years. Summarizing more recent results, we have shown (1) that certain oxidative insults to the brain cause the induction of iNOS, which results
Neuroinflammatory Events and Neurodegeneration
111
in the direct unequivocal trapping of NO in brain and that PBN suppresses iNOS induction and NO formation (11); (2) that cultured brain glia cells are activated by proinflammatory cytokines to mediate large increases in ROS as well as iNOS induction resulting in peroxynitrite formation leading to protein nitration products (12); (3) that interleukin-1β (IL-1β) as well as H2O2 activate p38 signal transduction–mediated p38 phosphorylation in glia and that redox-active agents (PBN and N-acetylcysteine) significantly inhibit the process (13); (4) that respiring brain mitochondria produce H2O2 equivalent to about 2% of the total oxygen flux in the complex I region and this is suppressed by PBN without significantly altering normal mitochondrial functions (14); and (5) that the protein from the brain of Alzheimer’s subjects has significantly elevated nitrotyrosine and dityrosine content (15), products expected to be increased if enhanced neuroinflammatory processes occur.
III.
EARLY EXPERIMENTAL DATA IMPLICATING NEUROINFLAMMATORY PROCESSES
The classical view of the brain as an immunologically privileged site primarily due to its effective selectivity and the relative impermeability of the blood–brain barrier has made it difficult to consider the notion that inflammatory processes, also classically considered to be a domain of the circulatory system, occur in the brain. But the early findings by the McGeer and Rogers groups, starting as early as 1987, on the expression of immune system antigens (16), the presence of reactive microglia (17), and the activation of the classical compliment pathway in Alzheimer’s disease (AD) brain (18) strongly implicated neuroinflammatory processes. In addition, their early demonstrations that rheumatoid patients taking antiinflammatory drugs had delayed appearance of AD symptoms (19) also strongly suggested the importance of neuroinflammatory events in the dementia associated with the disease. The early demonstrations that proinflammatory cytokines were shown to be elevated in neurodegenerative conditions (20–23) and that activated microglia cells produce superoxide (23,24) thus also provided a solid foundation for the rationale. Rogers and O’Barr (25) and Floyd (26) recently reviewed the data and ideas of neuroinflammation.
IV.
EXPERIMENTAL DATA SUPPORTING NEUROINFLAMMATORY PROCESSES
Data presented in this section represent some of the results we have collected over the last 2 years that strongly support the idea that neuroinflammatory processes are important in neurodegenerative conditions.
112
A.
Floyd et al.
HPLC Methods to Quantitate Protein Nitration Products
In order to rigorously evaluate our ideas, it was considered necessary to develop a method to quantitatively determine the amount of protein nitration adducts present in brain tissue. Peroxynitrite reacts with the tyrosine residues of proteins to form 3-nitrotyrosine adducts. Peroxynitrite is formed by the reaction of NO with superoxide. NO reacts rapidly with superoxide. In fact, NO reacts more rapidly with superoxide than superoxide reacts with superoxide dismutase (SOD). In addition to 3-nitrotyrosine, several other tyrosine reaction products are formed by free radical reactions and by the action of inflammatory processes. For instance, hydroxyl free radicals react with phenylalanine to form ortho-tyrosine as well as meta-tyrosine, which can be distinguished from natural tyrosine (i.e., para-tyrosine or p-hydroxyphenylalanine). The action of myeloperoxidase on tyrosine in the presence of H2O2 and Cl⫺ yields 3-chlorotyrosine. Additionally, Fenton free radical reactions acting on tyrosine yield dityrosine. The possible reaction products of tyrosine and phenylalanine to yield tyrosine products are presented in Figure 1. We focused on tyrosine because it is possible to detect and sensitively quantitate not only tyrosine but also the many reaction products noted in Figure 1 using high-performance liquid chromatography–electrochemical detection (HPLC-EC) methodology. The methodology was chosen because of our success using it in pioneering the sensitive detection of 8-hydroxy-2′-deoxyguanosine (27–29) and salicylate hydroxylation to assess hydroxyl free radical flux in vivo
Figure 1 Various reaction products of tyrosine and hydroxyl free radical reaction products of phenylalanine that can be quantitated by the use of HPLC-electrochemical array (HPLC-EC) detection methodology.
Neuroinflammatory Events and Neurodegeneration
113
(1,30,31). Therefore, in principle, it was possible to quantitate the various tyrosine reaction products formed and normalize them to the total tyrosine content in the protein per se. Figure 2 shows the electrochemical traces of an eight-channel EC detection array arranged in series where each detector is running at a different but increasing oxidation potential from electrode 1 to electrode 8. Note that the various reaction products of tyrosine not only register maximally at a specific EC potential but appear on the chromatogram at a specific elution time. Each tyrosine adduct has a specific midpoint oxidation potential and hence the settings of the various electrodes can be chosen to maximize the detector response. In addition, a ‘‘ratio accuracy’’ parameter of the response of the electrode nearest the midpoint oxidation potential for each analyte can be compared to the leading channel, as well as to the following channel. The goodness of fit of an unknown then can be compared to a standard analyte for confidence assessment when assigning the peak (12). The separation and quantitation of a mixture of various tyrosine analogs were possible as shown in Figure 2, but digestion of tissue proteins in order to recover not only the total tyrosine of the proteins but the tyrosine analogs as well required considerable methods development. We utilized protease digestion
Figure 2 Chromatographic traces of the eight electrochemical detectors of the HPLCEC elution system. Each of the electrodes is set at the noted oxidation potential. Traces show the detection of the various tyrosine adducts and phenylalanine oxidation products from a standard mixture of these chemicals. The exact methods used are defined in Refs. 12 and 14.
114
Floyd et al.
to liberate the tyrosine adducts (12). Experiments conducted on nitrated serum albumin demonstrated that the digestion method as well as the HPLC-EC method allowed complete recovery of the total tyrosine residues in the protein as well as their nitration products (12).
B.
Protein Nitration in IL-1-Stimulated Glia Cells
The basic ideas underpinning the neuroinflammatory concept involves increased proinflammatory cytokines activating brain glia cells to produce not only ROS but RNS as well. RNS is formed due to the upregulation of iNOS activity within these cells. If iNOS is induced then not only should one see increased NO oxidation products (nitrite, nitrate) in the media, but also increased nitration of proteins in the cells. The ability to quantitate 3-nitrotyrosine in proteins using HPLC-EC allowed us to test this idea. Glia cells were isolated from neonatal rats and cultured for 48 h (12). These cells are about 95% astrocytes. The cytokine IL-1β was used to stimulate the cells and nitrite in the media was measured by the Griess diazotization assay and 3-nitrotyrosine in cellular protein was quantitated using the HPLC-EC method (12). We also tested the effect of PBN addition. The results demonstrated that IL-1β caused not only an increased amount of nitrite in the media but also an increase in 3-nitrotyrosine in the cellular protein (12). A brief summary of the results obtained are shown in Table 1. The data clearly show that IL-1β not only stimulated nitrite formation in the media but increased the amounts of 3-nitrotyrosine formed in cellular proteins. Incremental protein nitration increased more with the higher dose of IL-1β, when compared to the
Table 1 Effect of IL-1β Addition on Protein Nitration and Nitrite Formation in Cultured Rat Glia Cells Protein nitration Nitrite in media IL-1β additions None 10 ng/ml 20 ng/ml 10 ng/ml ⫹ PBN a
(nmol/mg protein)
3-Nitrotyrosine per 1000 tyrosine
⫾ ⫾ ⫾ ⫾
0.5 ⫾ 0.1 1.5 ⫾ 0.2 8.5 ⫾ 2.0 Non-detectable
15 51 62 67
3 25 12 48
PBN was added at 100 µM immediately before IL-1β and the cells were then incubated for 48 h before analysis of nitrite in the media and quantification of 3-nitrotyrosine in the cellular protein fraction. Data from Ref. 12.
a
Neuroinflammatory Events and Neurodegeneration
115
lower dose, vs. control. Only a small amount of increased nitrite formation appeared to occur due to the extra added amount of IL-1β. The results obtained with PBN showed that it had no inhibiting effect, in fact possibly increased, nitrite formation in the media. In contrast, PBN drastically suppressed protein nitration. The mechanistic basis of why this diverse action of PBN occurs with respect to nitrite formation vs. protein nitration is not known.
C.
Protein Nitration Products Significantly Increased in the Brains of Alzheimer Subjects
If neuroinflammatory processes are enhanced in the AD brain, it is expected that the iNOS gene is expressed at much higher levels and that this would bring about increased protein nitration. The new methods available to quantitate tyrosine nitration and oxidation products in tissue proteins made it possible to test this idea in AD brain. Collaborating with Dr. William Markesbery (University of Kentucky), who made available brain regions from 11 AD brains and from 7 agematched control brains, we quantitated the protein tyrosine products (15). The results clearly demonstrated that, compared with brain regions of age-matched controls known to be extensively involved in the disease, there was a five- to eightfold enhanced level of 3-nitrotyrosine and dityrosine present in the AD brain tissue. A very condensed summary of the data is presented in Table 2. The data clearly demonstrate that regions having the highest plaque and tangles (hippocampus ⬎ inferior parietal lobule ⬎ superior and middle temporal gyri) have much more dityrosine and 3-nitrotyrosine than the cerebellum, which is not usually considered to be involved in AD. Cerebellum showed no enhancement of nitrotyrosine when compared to controls; in fact, there were even lower amounts in AD than in the control tissue (Table 2). We consider the enhanced nitrotyrosine
Table 2 Region-Specific Patterns of Protein Tyrosine Products in Alzheimer’s Brain vs. Age-Matched Control Brain AD/control Brain region Hippocampus Inferior parietal lobule Superior and middle temporal gyri Cerebellum Data from Ref. 15.
Dityrosine
3-Nitro-tyrosine
4.6 4.5 2.7 1.3
7.8 6.5 5.2 0.17
116
Floyd et al.
and dityrosine levels to be a very strong demonstration that neuroinflammatory processes are significantly elevated in the AD brain.
D.
p38 Phosphorylation and Signal Transduction Processes in Cultured Glia Cells
Increased activity of neuroinflammatory processes necessitates enhanced signal transduction processes certainly in glia and most likely in neurons. Over the last several years, initiated by the observations of Baeuerle and colleagues (32,33), who showed that activation of the transcription factors NF-kB and AP-1 were sensitive to antioxidants and were activated by H2O2, much evidence has accumulated supporting the role of ROS in signal transduction processes. Much research has also shown that signal transduction processes involve protein phosphorylation cascades whereby proinflammatory cytokines or other stimuli trigger the activation of protein kinases to mediate phosphorylation of specific proteins, which in turn act as kinases to phosphorylate other proteins, and so forth. The protein kinase cascades have been termed mitogen-activated protein kinase (MAPK) pathways. At least four separate but cross-reacting protein kinase modules have been elucidated in recent years. Protein kinases mediate the transduction of cell membrane stimuli (growth factors, cytokines, environmental stress) to the nucleus. Figure 3 presents a diagram illustrating signal transduction processes involving the three most widely studied protein kinase cascades. ROS has been implicated as important agents and/or modulators of the protein kinase cascades, but a clear definition of how they act has not been worked out. Most studies implicating ROS involve the use of H2O2 as an activator and/or the use of the antioxidant N-acetylcysteine (NAC) to suppress protein phosphorylation. We have focused on the role of ROS in the activation of p38 pathway and the action of antioxidants in this pathway. p38 is activated by the dual phosphorylation of the residues Thr 180 and Tyr 182. Once activated, this protein mediates the phosphorylation of the transcription factors CREB, ATF-1 (34), ATF-2 (35), and the phosphorylation of hsp 27 (36). Studies involving activation with H2O2 or inhibition by NAC implicate the involvement of ROS in the p38 signal transduction pathway (37–39). Of particular pertinence to neurodegenerative conditions, p38 has been shown to be involved in the activation of iNOS in astrocytes (40), to be activated by ischemia in brain (41), ischemia in heart and kidney (42), nerve growth factor–mediated signal transduction processes (43), oxidative stress–induced events in vascular endothelial cells (44), as well as apoptosis mediated by trophic factor withdrawal (45) and in neutrophil stimulation (46). The results obtained in cultured glia cells clearly show that IL-1β and H2O2 stimulate p38 phosphorylation and that PBN as well as NAC act to inhibit the processes involved (13). Activation of p38 involves only about 2% of the total
Neuroinflammatory Events and Neurodegeneration
117
Figure 3 Illustration demonstrating proinflammatory cytokine-mediated signal transduction pathways involving mitogen-activated protein kinase cascades.
amount of p38 protein within the astrocyte (13). A brief summary of the results are presented in Figures 4 and 5 and Table 3. IL-1β stimulated p38 phosphorylation within 5 min; and it then decreased back down to nearly half of what it was at 5 min. PBN and NAC at 1 mM largely prevented IL-1β-induced p38 activation. H2O2 at 100 µM mediated a larger amount of p38 activation than did IL-1β. Even though PBN and NAC significantly suppressed p38 activation there still was an elevated level of activity. Table 3 shows that hyperosmotic amounts of sorbitol induced p38 activation. Even though 1 mM NAC was quite effective in suppressing this activation, in contrast 1 mM PBN was not very effective. It is not known why the effectiveness of NAC and PBN, which were almost equally effec-
118
Floyd et al.
Figure 4 Data showing time–course of p38 phosphorylation induced by IL-1β (A) or H2O2 (B) in cultured rat glia cells. The effects of NAC (N-acetylcysteine) or PBN (αphenyl-tert-butylnitrone) added 2 h prior to cytokine stimulation are shown. (Redrawn from Ref. 13.)
tive in suppressing IL-1β- and H2O2-mediated p38 activation, were not similar in the case of sorbitol-induced hyperactivity. Concomitant with the increase in p38 phosphorylation, there was a decrease in the activity of phosphatase(s) as the data in Figure 5 and Table 3 demonstrate. PBN and NAC were effective in helping to prevent loss of phosphatase activity. There appeared to be some divergence of the effectiveness in PBN vs. NAC when results between H2O2 and IL-1β are compared. Since phosphatase(s) act to dephosphorylate specific proteins whereas specific kinases act to phosphorylate specific proteins, the data provide support for the notion that phosphatase activity may be redox-sensitive and that the action of ROS in signal transduction processes may be partly due to their inactivation of phosphatase(s).
Figure 5 Data showing that the activity of phosphatase(s) in cultured glia is decreased by treatment with IL-1β or H2O2. Addition of either 1 mM NAC or 1 mM PBN 2 h prior to stimulation with IL-1β or H2O2 maintains or even increases the enzymatic activity. (Redrawn from Ref. 13.)
Table 3 Sorbitol-Mediated Osmotic Stress–Induced p38 Phosphorylation and Inhibition by PBN and NAC and the Corresponding Changes in Phosphatase Activity and Cultured Glia Cells Treatment Control (No Additives) 0.3 M Sorbitol 0.3 Sorbitol ⫹1 mM PBN 0.3 Sorbitol ⫹1mM NAC a
∆p38 phosphorylation a 0 411 ⫾ 69 330 ⫾ 29 65 ⫾ 47
Phosphatase activity b 10.1 7.2 11.7 10.8
⫾ ⫾ ⫾ ⫾
1.1 0.6 0.6 1.5
Activation of p38 expressed as a percentage of control, measured 15 min after sorbitol addition. b Activity of phosphatase(s) measured 5 min after sorbitol addition. Net ∆ ⫾ SEM. Data from Ref. 13.
120
V.
Floyd et al.
IMPLICATIONS FOR NEW THERAPEUTIC TREATMENTS FOR NEURODEGENERATIVE DISEASES
Our data demonstrating enhanced protein oxidation in AD brain (47) combined with our recent observations demonstrating the presence of increased protein nitration products (15) strongly indicate that neuroinflammatory processes may be important factors in the progression of the neuropathology and the dementia of the disease. Thus we conclude that enhanced signal transduction processes are interrelated with the transition from the normal brain to one that is suffering from a neurodegenerative condition. Figure 6 presents this concept. In the broadest terms, then, compounds that suppress pathological signal transduction processes in brain may be an effective therapeutic. In this context, PBN derivatives could be useful. It is an obvious oversimplification to blame the etiology of neurodegenerative conditions on ROS or enhanced signal transduction processes. In fact, we have hypothesized that many risk factors, one of the greatest of which is age, are all additive and contribute to the particular neurodegenerative condition (26). Therapeutics based on suppressing pathological signal transduction processes would certainly not be expected to alleviate a major triggering risk factor, such as a genetic alteration for instance; but they may be expected to help reverse some of the age effect, if, as we have postulated (10), this is attended by enhanced
Figure 6 Illustration of the concept that brain neuroinflammation processes are associated with increased oxidative stress levels and enhanced signal transduction processes as compared to the normal (unperturbed) state.
Neuroinflammatory Events and Neurodegeneration
121
proinflammatory cytokine increases. Figure 7 presents a perspective of how risk factors, as well as age, contribute to enhanced oxidative stress. Various risk factors and age are additive. The combined actions are expected to put the system more out of balance, which then contributes to pathological upregulation of signal transduction processes and increased levels of oxidative stress. The exact mechanistic basis of how PBN and NAC suppress enhanced signal transduction processes is not known. However, it seems clear that they may interfere either with ROS production or possibly with the biochemical events, such as redox states of regulatory enzymes, especially protein phosphatases, that contribute to enhanced signal transduction processes. In the first of the two possibilities, PBN has been shown to interfere with mitochondria-mediated ROS production (14). Mitochondria ROS production most likely contributes to signal transduction processes. With reference to the second possibility, the action of antioxidants on regulatory enzymes (phosphatase(s) activity, for instance) remains to be ascertained. These areas are very fertile ground for further studies.
Figure 7 The many risk factors influencing oxidative stress levels in age-associated neurodegeneration. As age increases it plays an even greater role in an additive fashion with the other risk factors, thus enhancing the process and contributing to the oxidative stress involved.
122
Floyd et al.
ACKNOWLEDGMENTS Research reported here was supported in part by NIH grant NS35747 and Oklahoma Center for Advancement of Science Technology (OCAST) grants H97-067 and HR98-004. K. A. Robinson was supported by a predoctoral fellowship from NIH (NS35747). REFERENCES 1. Cao, W., Carney, J.M., Duchon, A., Floyd, R.A., and Chevion, M. (1988) Oxygen free radical involvement in ischemia and reperfusion injury to brain. Neurosci. Lett. 88, 233–238. 2. Floyd, R.A. (1990) Role of oxygen free radicals in carcinogenesis and brain ischemia. FASEB J. 4, 2587–2597. 3. Oliver, C.N., Starke-Reed, P.E., Stadtman, E.R., Liu, G.J., Carney, J.M., and Floyd, R.A. (1990) Oxidative damage to brain proteins, loss of glutamine synthetase activity, and production of free radicals during ischemia/reperfusion-induced injury to gerbil brain. Proc. Natl. Acad. Sci. USA 87, 5144–5147. 4. Carney, J.M., Starke-Reed, P.E., Oliver, C.N., Landrum, R.W., Chen, M.S., Wu, J.F., and Floyd, R.A. (1991) Reversal of age-related increase in brain protein oxidation, decrease in enzyme activity, and loss in temporal and spacial memory by chronic administration of the spin-trapping compound N-tert-butyl-α-phenylnitrone. Proc. Natl. Acad. Sci. USA 88, 3633–3636. 5. Floyd, R.A., and Carney, J.M. (1996) Nitrone radical traps protect in experimental neurodegenerative diseases. In: Neuroprotective Approaches to the Treatment of Parkinson’s Disease and Other Neurodegenerative Disorders (C.A. Chapman, C.W. Olanow, P. Jenner, and M. Youssim, eds.), Academic Press, London, pp. 69–90. 6. Chen, G., Bray, T.M., Janzen, E.G., and McCay, P.B. (1990) Excretion, metabolism and tissue distribution of a spin trapping agent, α-phenyl-N-tert-butyl-nitrone (PBN) in rats. Free Rad. Res. Commun. 9, 317–323. 7. Miyajima, T., and Kotake, Y. (1995) Spin trapping agent, phenyl-N-tert-butyl nitrone, inhibits induction of nitric oxide synthase in endotoxin-induced shock in mice. Biochem. Biophys. Res. Commun. 215, 114–121. 8. Carney, J.M., Kindy, M.S., Smith, C.D., Wood, K., Tatsuno, T., Wu, J.F., Landrum, W.R., and Floyd, R.A. (1994) Gene expression and functional changes after acute ischemia: age-related differences in outcome and mechanisms. In: Cerebral Ischemia and Basic Mechanisms (A. Hartmann, F. Yatsu, and W. Kuschinsky, eds.), SpringerVerlag, Berlin, pp. 301–311. 9. Floyd, R.A. (1996) The protective action of nitrone-based free radical traps in neurodegenerative diseases. In: Neurodegenerative Diseases ’95: Cellular and Molecular and Mechanisms and Therapeutic Advances (G. Fiskum, ed.), Plenum Press, New York. 10. Floyd, R.A. (1997) Protective action of nitrone-based free radical traps against oxidative damage to the central nervous system. Adv. Pharmacol. 38, 361–378.
Neuroinflammatory Events and Neurodegeneration
123
11. Tabatabaie, T., Stewart, C., Pye, Q., Kotake, Y., and Floyd, R.A. (1996) In vivo trapping of nitric oxide in the brain of neonatal rats treated with the HIV-1 envelope protein gp 120: protective effects of α-phenyl-tert-butylnitrone. Biochem. Biophys. Res. Commun. 221, 386–390. 12. Hensley, K., Maidt, M.L., Pye, Q.N., Stewart, C.A., Wack, M., Tabatabaie, T., and Floyd, R.A. (1997) Quantitation of protein-bound 3-nitrotyrosine and 3,4-dihydroxyphenylalanine by high performance liquid chromatography with electrochemical array detection. Anal. Biochem. 251, 187–195. 13. Robinson, K.A., Hensley, K., Stewart, C.A., Pye, Q., and Floyd, R.A. (1998) Modulation of IL 1β, H2O2, and osmotic activation of p38MAPK by antioxidant compounds in primary rat glial cell culture. FEBS Lett. (submitted). 14. Hensley, K., Pye, Q.N., Maidt, M.L., Stewart, C.A., Robinson, K.A., Jaffrey, F., and Floyd, R.A. (1998) Interaction of α-phenyl-N-tert-butyl nitrone and alternative electron acceptors with complex I indicates a substrate reduction site upstream from the rotenone binding site. J. Neurochem. (in press). 15. Hensley, K., Maidt, M.L., Yu, Z., Sang, H., Markesbery, W.R., and Floyd, R.A. (1998) Electrochemical analysis of protein nitrotyrosine and dityrosine in the Alzheimer brain indicates region-specific accumulation. J. Neurosci. (in press). 16. Rogers, J., Luber-Narod, J., Styren, S.D., and Civin, W.H. (1988) Expression of immune system–associated antigen by cells of the human central nervous system: relationship of the pathology of Alzheimer’s disease. Neurobiol. Aging 9, 330–349. 17. McGeer, P.L., Itagaki, S., Tago, H., and McGeer, E.G. (1987) Reactive microglia in patients with senile dementia of the Alzheimer’s type are positive for the histocompatability of glycoprotein HLA-DR. Neurosci. Lett. 79, 195–200. 18. McGeer, P.L., Akiyama, H., Itagaki, S., and McGeer, E.G. (1989) Activation of the classical complement pathway in brain tissue of Alzheimer patients. Neurosci. Lett. 107, 341–346. 19. McGeer, P.L., McGeer, E., Rogers, J., and Sibley, J. (1990) Anti-inflammatory drugs and Alzheimer disease. Lancet 335, 1037. 20. Vandenabeele, P., and Fiers, W. (1991) Is amyloidogenesis during Alzheimer’s disease due to an IL-1-/IL-6-mediated ‘‘acute phase response’’ in the brain? Immunol. Today 12, 217–219. 21. Strauss, S., Bauer, J., Ganter, U., Jonas, U., Berger, M., and Volk, B. (1992) Detection of interleukin-6 and α2-macroglobulin immunoreactivity in cortex and hippocampus of Alzheimer’s disease patients. Lab. Invest. 66, 223–230. 22. Rothwell, N.J., and Relton, J.K. (1993) Involvement of cytokines in acute neurodegeneration in the CNS. Neurosci. Biobehav. Rev. 17, 217–227. 23. Colton, C.A., and Gilbert, D.L. (1987) Production of superoxide anions by a CNS macrophage, the microglia. Fed. Eur. Biochem. Soc. 223, 284–288. 24. Colton, C.A., Yao, J., Gilbert, D., and Oster-Granite, M.L. (1990) Enhanced production of superoxide anion by microglia from trisomy 16 mice. Brain Res. 519, 236– 242. 25. Rogers, J., and O’Barr, S. (1997) Inflammatory mediators in Alzheimer’s disease. In: Molecular Mechanisms of Dementia (W. Wasco, and R.E. Tanzi, eds.). Humana Press, Totowa, NJ, pp. 177–198. 26. Floyd, R.A. (1998) Neuroinflammatory processes are important in neurodegenera-
124
27.
28.
29. 30.
31.
32.
33.
34.
35. 36.
37.
38.
39. 40.
41.
Floyd et al. tive diseases: an hypothesis to explain the increased formation of reactive oxygen and nitrogen species as major factors involved in neurodegenerative disease development. Free Radic. Biol. Med. (in press). Floyd, R.A., Watson, J.J., Wong, P.K., Altmiller, D.H., and Rickard, R.C. (1986) Hydroxyl free radical adduct of deoxyguanosine: sensitive detection and mechanisms of formation. Free Radic. Res. Commun. 1, 163–172. Floyd, R.A. (1990) The development of a sensitive analysis for 8-hydroxy-2′-deoxyguanosine. FRRC Highlight: This note highlights a seminal paper published in Free Rad. Res. Commun. 1, 163–172 (1986). Free Rad. Res. Commun. 8, 139–141. Floyd, R.A. (1990) The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis 11, 1447–1450. Floyd, R.A., Watson, J.J., and Wong, P.K. (1984) Sensitive assay of hydroxyl free radical formation utilizing high pressure liquid chromatography with electrochemical detection of phenol and salicylate hydroxylation products. J. Biochem. Biophys. Meth. 10, 221–235. Floyd, R.A., Henderson, R., Watson, J.J., and Wong, P.K. (1986) Use of salicylate with high pressure liquid chromatography and electrochemical detection (LCED) as a sensitive measure of hydroyxl free radicals in adriamycin treated rats. J. Free Radic. Biol. Med. 2, 13–18. Schreck, R., Rieber, P., and Baeuerle, P.A. (1991) Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kB transcription factor and HIV-1. EMBO J. 10, 2247–2258. Meyer, M., Schreck, R., and Baeuerle, P.A. (1993) H2O2 and antioxidants have opposite effects on activation of NF-kB and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 12, 2005–2015. Yi, T., Rouse, J., Zhang, A., Cariati, S., Cohen, P., and Comb, M.J. (1996) FGF and stress regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP kinase-2. EMBO J. 15, 4629–4642. Gupta, S., Campbell, D., Derijard, B., and Davis, R.J. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267, 389–393. Wang, X.Z., and Ron, D. (1996) Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP kinase. Science 272, 1347– 1349. Abe, J-I., Kusuhara, M., Ulevitch, R.J., Berk, B.C., and Lee, J-D. (1996) Big mitogen-activated protein kinase 1 (BMK1) is a redox-sensitive kinase. J. Biol. Chem. 271, 16586–16590. Lo, Y.Y.C., and Cruz, T.F. (1995) Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes. J. Biol. Chem. 270, 11727–11730. Guyton, K.Z., Liu, Y., Gorospe, M., Xu, Q., and Holbrook, N.J. (1996) Activation of mitogen-activated protein kinase by H2O2. J. Biol. Chem. 271, 4138–4142. Da Silva, J., Pierrat, B., Mary, J.-L., and Lesslauer, W. (1997) Blockade of p38 mitogen-activated protein kinase pathway inhibits inducible nitric-oxide synthase expression in mouse astrocytes. J. Biol. Chem. 272, 28373–28380. Walton, K.M., DiRocco, R., Bartlett, B.A., Koury, E., Marcy, V.R., Jarvis, B.,
Neuroinflammatory Events and Neurodegeneration
42.
43.
44.
45.
46.
47.
125
Schaefer, E.M., and Bhat, R.V. (1998) Activation of p38MAPK in microglia after ischemia. J. Neurochem. 70, 1764–1767. Yin, Y., Sandhu, G., Wolfgang, C.D., Burrier, A., Webb, R.L., Rigel, D.F., Hai, T., and Whelan, J. (1997) Tissue-specific pattern of stress kinase activation in ischemic/ reperfused heart and kidney. J. Biol. Chem. 272, 19943–19950. Xing, J., Kornhauser, J.M., Xia, Z., Thiele, E.A., and Greenberg, M.E. (1998) Nerve growth factor activates extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways to stimulate CREB serine 133 phosphorylation. Mol. Cell. Biol. 18, 1946–1955. Huot, J., Houle, F., Marceau, F., and Landry, J. (1997) Oxidative stress-induced actin reorganization mediated by the p38 mitogen-activated protein kinase/heat shock protein 27 pathyway in vascular edothelial cells. Cir. Res. 80, 383–392. Kummer, J.L., Rao, P.K., and Heidenreich, K.A. (1997) Apoptosis induced by withdrawal of trophic factors is mediated by p38 mitogen-activated protein kinase. J. Biol. Chem. 272, 20490–20494. El Benna, J., Han, J., Park, W.D., Schmid, E., Ulevitch, R.J., and Babior, B.M. (1996) Activation of p38 in stimulated human neutrophils: phosphorylation of the oxidase component p47phox by p38 and ERK but not by JNK. Arch. Biochem. Biophys. 334, 395–400. Smith, C.D., Carney, J.M., Starke-Reed, P.E., Oliver, C.N., Stadtman, E.R., Floyd, R.A., and Markesbery, W.R. (1991) Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 88, 10540–10543.
6 Oxidative Stress in Glutamate Neurotoxicity Derick S. Han University of Southern California, Los Angeles, California
Enrique Cadenas University of Southern California School of Pharmacy, Los Angeles, California
Michael S. Kobayashi and Lester Packer University of California, Berkeley, California
I. INTRODUCTION Oxidative stress is defined as a shift in the normal prooxidant/antioxidant balance in favor of prooxidants (1). Physiological processes such as signal transduction (2) and pathophysiological conditions such as neurodegeneration (3) have been suggested to be mediated by oxidative stress, although in most cases the mechanisms remain poorly understood. In recent years, there has been growing evidence suggesting that glutamate neurotoxicity is mediated by oxidative stress (3–6). Glutamate is the major excitatory neurotransmitter in the central nervous system (CNS) (7), but under certain conditions it can be toxic to neural cells. Exposure of cultured neurons to elevated glutamate levels results in both apoptotic and necrotic cell death (8,9). Glutamate is believed to play an important role in neurodegeneration associated with Alzheimer’s disease (10,11), Parkinson’s disease (12,13), and cerebral ischemia (14). Understanding the mechanisms of glutamate neurotoxicity may, therefore, have important clinical ramifications for many neurodegenerative disorders. In this chapter, we will review the evidence connecting oxidative stress with glutamate neurotoxicity. The possible mechanisms by which the treatment of neurons with glutamate can lead to reactive oxygen species generation and the free radical reactions important in mediating cell death will be discussed. 127
128
Han et al.
II. GLUTAMATE AS A NEUROTRANSMITTER Glutamate serves as a neurotransmitter for both fast excitatory synaptic transmissions and slow long-term excitatory changes such as long-term potentiation and long-term depression (4). The physiological action of glutamate is mediated through the activation of glutamate receptors, found throughout the CNS. Glutamate receptors can be broadly divided into two classes: ionotropic and metabotropic (4,7,15). Glutamate ionotropic receptors are ligand-gated ion channels that are important in regulating ion influx and membrane depolarization. Ionotropic glutamate receptors can be further subdivided into three categories (named after the agonist found to selectively activate that particular receptor): NMDA (Nmethyl-d-aspartate), kainate, and AMPA (d,l-α-amino-3-hydroxy-5-methyl-4isoxazolepropionate) receptors (Table 1). Ionotropic glutamate receptors directly mediate glutamate neurotoxicity (16). Metabotropic glutamate receptors are Gprotein-linked receptors that are important in activating various second messengers (15,17–19). There is some evidence indicating that the activation of metabotropic receptors can either potentiate or inhibit glutamate neurotoxicity (20–23). However, because metabotropic receptors are not directly involved in glutamate neurotoxicity, they will not be discussed further. Because glutamate can activate such a wide range of receptors it is often considered to be a ‘‘nonselective agonist’’ (11).
III.
GLUTAMATE NEUROTOXICITY: RECEPTOR-MEDIATED AND NONRECEPTOR-MEDIATED
The neurotoxic effects of glutamate are directly related to its ability to cause excitatory responses in neurons (7,15). In synaptic transmission, the binding of glutamate to ionotropic receptors in postsynaptic neurons leads to an opening of ion channels and membrane depolarization. The excitatory response is turned off by removal of glutamate by Na ⫹-dependent transport systems in the neuron and surrounding glial cells (4). If there is an excess of glutamate and/or if the mechanisms for glutamate uptake are inadequate, glutamate remains continuously bound to the ionotropic receptors causing continual ion influx and membrane depolarization. In a sense there is an ‘‘overexcitation’’ of the neuron, which if strong enough will result in cell death. This type of receptor-dependent glutamate neurotoxicity is frequently referred to as ‘‘excitotoxicity’’ (24,25). Neuronal death via excitotoxicity is believed to play an important role in many neurodegenerative diseases (4,16) and constitutes the focus of this chapter. A second type of glutamate neurotoxicity was characterized in neural cells that lacked ionotropic glutamate receptors (26). The main features of the two forms of glutamate neurotoxicity are summarized in Table 2. This second type of
Glutamate Receptors
Receptor Ionotropic receptors NMDA
Kainate AMPA Metabotrophic receptors
Agonist Glutamate, NMDA, ibotenic acid, quinolinic acid, l-homocysteic acid
Glutamate, kainate, domoate, AMPA (weak agonist) Glutamate, AMPA, quisqualic acid, ibotenic acid, kainate (weak agonist) Glutamate, ibotenic acid, quisqualic acid, aminocyclopentanedicarboxylic acid
Receptor properties Ligand-gated ion channels Contains an intrinsic cation channel with a high conductance for Ca 2⫹, Na ⫹, and K ⫹. Glycine acts as a coagonist and Mg 2⫹ blocks channel function. Contains an intrinsic cation channel with a high conductance for Na ⫹ and K ⫹. Contains an intrinsic cation channel with a high conductance for Na ⫹ and K ⫹. G-protein-linked receptor that activates various second-messenger systems (cAMP, Ca 2⫹, DAG, etc.)
Ref. 4, 15
4, 108, 109
Oxidative Stress in Glutamate Neurotoxicity
Table 1
4, 108 15, 17, 19
129
130
Han et al.
Table 2 Two Types of Glutamate Neurotoxicity Factor
Excitotoxicity
Nonreceptor-mediated glutamate neurotoxicity
Concentration of glutamate used to induce toxicity Usual glutamate incubation time Key molecule involved in toxicity Cell types in which process occurs
100 µM–1 mM
5 mM–10 mM
5 min
at least 6 h
Ca 2⫹
GSH
Primary cultured neurons
Immature cortical neurons, oligodendroglia, and various neural cell lines
glutamate neurotoxicity is a transport-mediated phenomenon. Excess glutamate inhibits transport of cystine into cells that is needed for glutathione (GSH) synthesis (27). The depletion of GSH, a critical player in the thiol/disulfide status of the cell, renders cells vulnerable to oxidative stress and, accordingly, cell death ensues. This type of glutamate neurotoxicity, often referred to as oxidative glutamate toxicity (28,29), has been shown to occur in neural cell lines (26,30,31), oligodendroglia cells (32), and immature cortical neurons (33). Because both forms of glutamate neurotoxicity involve oxidative stress, this type of glutamate neurotoxicity will be referred to as nonreceptor-mediated glutamate neurotoxicity (NRGN). One striking difference between the two types of glutamate neurotoxicity is the dose of glutamate required to induce cell death (Table 2). In excitotoxicity, a 5-min exposure of cortical neurons to glutamate (100 µM) can lead to cell death within 24 h (16). In NRGN, neural cells need to be exposed to higher levels of glutamate (5–10 mM) for a period greater than 6 h (26). The high levels of glutamate needed to induce NRGN brings into question its physiological relevance in vivo. It is unlikely that local concentrations of glutamate may reach high levels for the extended period needed to inhibit GSH synthesis in vivo. Yet NRGN is an interesting model to study toxicity caused by oxidants and may be a model of the neural death associated with GSH depletion that occurs in conditions such as Parkinson’s disease (34).
IV.
EXCITOTOXICITY
Excitotoxicity can be mediated by the hyperactivation of any of the three ionotropic glutamate receptors (NMDA, kainate, AMPA) (3,16). The prolonged treat-
Oxidative Stress in Glutamate Neurotoxicity
131
ment of cultured neurons with either NMDA, kainate, or AMPA results in overstimulation of their receptors and causes excitotoxic cell death. NMDA has a strong excitotoxic potency (similar to glutamate), whereas AMPA and kainate are weaker neurotoxins that require higher doses or incubation times for toxicity to occur in vitro (16). It is believed that overstimulation of the NMDA receptor mediates the toxic effect of glutamate in vitro and is considered to be a major mechanism accounting for neurodegeneration in vivo (16,35). NMDA receptor antagonists can inhibit excitotoxicity caused by NMDA and glutamate, and they are being explored as a therapeutic agent for various neurodegenerative disorders (16,36). Kainate and AMPA receptor antagonists cannot protect neurons from the toxic effects of glutamate. However, kainate/AMPA receptors may play a role in some neurodegenerative diseases (16). A.
NMDA Receptor-Mediated Excitotoxicity
NMDA receptors have a high conductance for Ca2⫹ (37) and mediate the slow components of excitatory postsynaptic currents (4). The agonist activation of the NMDA receptor is regulated by Mg 2⫹ and glycine levels; the former acts as an inhibitor of the NMDA receptor by blocking the ion channel (37), whereas the latter binds to the NMDA receptor and potentiates its action (38). Consequently, Mg 2⫹ and glycine levels, by modulating NMDA receptor activity, alter the neurotoxicity of glutamate. Other agents shown to modulate NMDA receptor activity include polyamines, phencyclidine (PCP), and ketamine (4). The hyperstimulation of the NMDA receptor will cause an excess Ca 2⫹ influx into cells and trigger a cascade of events that lead to cell injury (Fig. 1). Among the important events that characterize excitotoxicity are influx of ions (e.g., Ca 2⫹, Na ⫹) that lead to cell swelling during the early stages of excitotoxicity, mitochondrial impairment leading to a decrease in ATP synthesis, Ca 2⫹ activation of proteases and endonucleases that are important in mediating apoptosis, and generation of reactive oxygen species (4,6,12,16). While all these factors contribute to the excitotoxic process, free radical reactions may be important in executing the process of cell death. The evidence that NMDA receptor–mediated excitotoxicity involves oxidative stress stems from the following facts: (1) the levels of reactive oxygen species are enhanced following NMDA or glutamate treatment of neurons and (2) antioxidants can partially inhibit the excitotoxic effects of NMDA or glutamate. 1. Generation of Reactive Oxygen Species The appendix provides a brief summary of methods used to measure reactive oxygen species generated during NMDA receptor–mediated excitotoxicity. Several probes used to assess reactive oxygen species production are subject to non-
132
Han et al.
Figure 1 Schematic representation of glutamate neurotoxicity. The binding of glutamate to the NMDA receptor triggers calcium influx into cells, which initiates a cascade of events leading to cell injury.
specific reactions and can provide misleading results (39). Commonly used fluorescent probes, such as 2′,7′-dichlorofluorescin (DCFH), dihydrorhodamine 123 (DHR), and hydroethidine (HEt), are affected by cellular processes (e.g., peroxidase levels, mitochondrial membrane potential, and intracellular pH) (see Appendix). Consequently, the use of these nonspecific probes has rendered questionable some data obtained about reactive oxygen species generation during excitotoxicity. However, since more specific methods, e.g., electron spin resonance (ESR), aconitase assay have also detected an increased reactive oxygen species during excitotoxicity, the body of evidence taken as a whole strongly supports the notion that reactive oxygen species production occurs following glutamate treatment. Superoxide. O 2⫺• production using spin traps and ESR was first demonstrated in cultured cerebellar neurons 15 min after glutamate or NMDA treatment (40). This generation of O 2⫺• by neurons could be blocked by antagonists to NMDA receptors (e.g., MK-801, 2-amino-5-phosphonopentanoic acid), but not by antagonists to non–NMDA glutamate receptors, such as 6-cyano-7-nitro-quin-
Oxidative Stress in Glutamate Neurotoxicity
133
oxaline-2,3-dione. The addition of superoxide dismutase (SOD) to the extracellular medium was able to quench the ESR signal, demonstrating that the signal was specific for O 2⫺• (40). However, neither O 2⫺• nor SOD can cross the cell membrane, suggesting that O 2⫺• was either being generated at the outer surface of the cells or that cell membrane intregrity had been compromised. The localization of the spin adduct of O 2⫺• following NMDA treatment has not yet been completely clarified. Using different analytical approaches, other researchers have observed an intracellular generation of O 2⫺• following NMDA or glutamate treatment. Using an aconitase-based method, a dose-dependent relationship was found between the concentration of NMDA added to neurons and the level of O 2⫺• production (41). The aconitase assay confirms that O 2⫺• is formed internally, since it cannot detect O 2⫺• produced extracellularly. Likewise, measurement of O 2⫺• with the fluorescent dye HEt also confirmed intracellular generation of O 2⫺• following NMDA receptor activation in cultured neurons (42,43), although there may be some inherent problems with this method (see Appendix). The generation of O 2⫺• following NMDA receptor activation is further supported by the observation that increasing SOD activity leads to inhibition of glutamate neurotoxicity. Cortical neurons from transgenic mice overexpressing the CuZn-SOD gene were more resistant to glutamate treatment (44), as were neurons transfected with the Mn-SOD gene (45). The treatment of neurons with a chemical SOD mimic, MnTBAP [Mn(III) porphyrin 5,10,15,20-tetrakis(benzoic acid)porphyrin manganese(III)], substantially inhibited NMDA-induced neurotoxicity (41). In excitotoxicity, the protective action of enhancing SOD suggests that O 2⫺•, not H 2 O 2 or HO •, is the most important radical in mediating excitotoxic cell death. O 2⫺• generated either outside the cells by xanthine oxidase (O 2⫺• cannot cross membranes, suggesting that a reaction at the membrane surface may be important) (46) or intracellularly by paraquat (41) will result in neuronal death. This poses an intriguing question of how O 2⫺• mediates cell death. O 2⫺• itself is not an extremely reactive radical and its direct role in mediating oxidative damage remains uncertain. In fact, many researchers consider HO •, generated from H 2 O 2 and Fe 2⫹ via the Fenton reaction, to be the most likely candidate for oxidative damage. There are three decay pathways for O 2⫺• that may be important in excitotoxicity: (1) its dismutation catalyzed by SOD [reaction (1)], (2) its protonation to perhydroxyl radical [reaction (2)], which is likely to occur in the vicinity of membranes, and (3) its reaction with nitric oxide [reaction (3)] at diffusion-controlled rates yielding the potent oxidant peroxynitrite. SOD
O 2⫺• ⫹ O 2⫺• ⫹ 2H ⫹ I H 2 O 2 O 2⫺• ⫹ H ⫹ I HO 2• O 2⫺• ⫹ NO • I ONOO⫺
(1) (2) (3)
134
Han et al.
The SOD-catalyzed disproportionation reaction represents a protective pathway against excitotoxicity: increasing the rate of O 2⫺• dismutation by increasing SOD activity affords cellular protection against glutamate or NMDA. The O 2⫺• radical is much more reactive in its protonated form [reaction (2)]. Perhydroxyl radicals constitute a small fraction of O 2⫺•, but its formation increases near membranes where pH levels are lower due to anionic phospholipids and proteins (47). Mathematical models have suggested that perhydroxyl radicals are the main initiators of lipid peroxidation (47). Because lipid peroxidation appears to occur in excitotoxicity (48), the possible role of perhydroxyl radicals in the initiation of lipid peroxidation should be considered a viable mechanism in mediating damage in excitotoxicity. An alternative mechanism for O 2⫺•-mediated toxicity is its combination with nitric oxide forming peroxynitrite [reaction (3)], a strong oxidant (49,50). In certain cases where nitric oxide formation appears to be important in excitotoxicity (to be discussed later), peroxynitrite formation may occur and mediate excitotoxicity. Hydrogen peroxide. Due to SOD catalysis, the increase in O 2⫺• production following NMDA receptor activation should be accompanied by an increase in H 2 O 2 production [Eq. (1)]. Unfortunately, there are some methodological drawbacks inherent in H 2 O 2 measurement, and its direct determination in excitotoxicity has not been achieved successfully. Fluorescent dyes such as DHR and DCFH, although nonspecific (see Appendix), are the best indicators of H 2 O2 that have been used in excitotoxicity. The treatment of neurons with glutamate or NMDA has been shown to increase DCFH and DHR fluorescence, possibly indicating that H 2 O 2 levels are increased following NMDA overstimulation (51–54). Hydroxyl radical. HO • molecules are generated in biological systems by an O 2 -driven Fenton reaction encompassing reduction of transition metals (e.g., iron, copper) by O 2⫺• [reaction (4)], followed by homolytic cleavage of H 2 O 2 to HO • by the reduced transition metal [reaction (5)] (55). ⫺•
Fe 3⫹ ⫹ O 2⫺• I Fe 2⫹ ⫹ O 2
(4)
Fe 2⫹ ⫹ H 2 O 2 → HO • ⫹ HO ⫺ ⫹ Fe 3⫹
(5)
In isolated brain mitochondria, the addition of Ca 2⫹ and Na ⫹ (in concentrations that occur in the cytoplasm following NMDA receptor activation) lead to the generation of HO • detected by spin trapping ESR (56). HO • generation was later measured in intact neurons following NMDA treatment (51). The addition of an NMDA receptor antagonist was found to inhibit this process, suggesting that stimulation of the NMDA receptor was directly responsible for HO • generation. The most reasonable pathway for HO • formation following NMDA or gluta-
Oxidative Stress in Glutamate Neurotoxicity
135
mate stimulation is from the dismutation of O 2⫺• to H 2 O 2 [reaction (1)] and Fenton reaction [reactions (4) to (5)]. HO • molecules are the most reactive radicals and can damage lipids, proteins, and DNA. Nitric Oxide. Nitric oxide levels have been shown to increase following NMDA receptor stimulation (57,58). The production of nitric oxide was suggested to mediate excitotoxicity based on the observations that inhibitors to nitric oxide synthase or the removal of arginine, a substrate for nitric oxide synthase, from culture media could protect cortical neurons from NMDA-induced neurotoxicity (59). The addition of nitric oxide generators, e.g., nitroprusside, SIN-1 (3-morpholinosydnonimine, S-nitrosocysteine) was found to be neurotoxic, while the addition of hemoglobin, which forms complexes with nitric oxide [reactions (6) to (7)] (60), was found to inhibit excitotoxicity (9,59,61). Because hemoglobin cannot cross the cell membrane, the protective effects of this hemoprotein suggest that nitric oxide diffusing between cells is responsible for excitotoxic cell death. Peroxynitrite formation [reaction (3)] has been suggested to mediate excitotoxicity—a view based on the modest chemical reactivity of nitric oxide and the assumption that O 2⫺• generation is an inherent feature in excitotoxicity (9,61). NO ⫹ Hem III I (NO)Hem III
(6)
(NO) Hem → (NO)Hem
(7)
III
II
The importance of nitric oxide in excitotoxicity has been disputed: nitric oxide inhibitors have been reported to elicit minor or no protective effects against glutamate or NMDA neurotoxicity (41,46,62–64). In addition, treatment of neurons with nitric oxide donors (i.e., SIN-1) does not always lead to neuronal death (46) and hemoglobin is not always protective against NMDA in cortical neurons (64). Why these discrepancies exist is not known. It may be plausible that nitric oxide is involved in excitotoxicity in special situations but it is probably not a universal mediator of excitotoxicity. Figure 2 summarizes the free radical reactions that may be important in excitotoxicity. Glutamate or NMDA treatment triggers enhanced production of O 2⫺•, which undergoes a series of reactions leading to cell damage and death. While the evidence of reactive oxygen species generation during excitotoxicity is compelling, more detailed analysis must be performed. Imlay and Fridovich have advanced the concept that pathophysiological states linked to oxidative stress should be confirmed quantitatively by changes in the concentration of oxidative species (65). Calculations of steady-state levels of oxidants is requisite to establish a role for oxidative stress in the mediation of glutamate neurotoxicity. In addition, there are few data available, aside from the measurement of malondialdehyde (MDA) (48), about the type and extent of oxidative damage that occurs during glutamate neurotoxicity.
136
Han et al.
Figure 2
2.
Free radical reactions involved in NMDA receptor–mediated excitotoxicity.
Protective Effects of Antioxidants
A wide range of antioxidant treatments can protect neurons from the toxic effects of glutamate or NMDA. As previously mentioned, increasing O 2⫺• dismutase activity either by addition of SOD mimics or overexpressing SOD could protect neurons from glutamate. Treatment of neurons with small molecular weight antioxidants such as Trolox, vitamin E (52,66,67), ascorbic acid (67), and spin traps, e.g., 5,5-dimethylpyrroline-1-oxide (DMPO) or α-phenyl-N-tert-butylnitrone (PBN) (68), can decrease glutamate neurotoxicity. Some of these compounds are
Oxidative Stress in Glutamate Neurotoxicity
137
chain-breaking antioxidants that inhibit free radical reactions that occur in lipid membranes. Thiols such as lipoic acid (69), GSH (66), and dithiothreitol (DTT) (66), which can act as antioxidants or act by increasing cellular GSH, were found to protect neurons from glutamate neurotoxicity. No individual antioxidant can completely prevent excitotoxicity, with the most effective antioxidants (e.g., DTT, SOD mimic, vitamin E) being 50–70% effective. It has yet to be determined if treatment with a combination of antioxidants (i.e., SOD mimics plus vitamin E) could completely inhibit NMDA receptor–mediated excitoxicity. The failure of antioxidants to completely protect neurons from glutamate also suggests the possibility that factors other than reactive oxygen species may be involved in excitotoxicity. 3. Sources of Reactive Oxygen Species The influx of Ca 2⫹ arising from overstimulation of the NMDA receptor is believed to be the critical step in causing reactive oxygen species generation and excitotoxic cell death (3,16,70). The importance of Ca 2⫹ in excitotoxicity is demonstrated by the following: (1) the extent of acute cell death strongly correlates with the quantity of Ca 2⫹ entering cells following NMDA receptor activation (71,72), and (2) removal of Ca 2⫹ from the extracellular environment or addition of Ca 2⫹ chelators can inhibit NMDA- or glutamate-induced cell death. Similarly, when Ca 2⫹ chelators are added to culture medium, reactive oxygen species generation does not occur following NMDA treatment (40,42). In fact, Ca 2⫹ influx into neurons is not cytotoxic per se. Ca 2⫹ influx following NMDA stimulation was found to be nontoxic to neurons without oxygen present (73). Although it is not completely clear which oxygen-dependent events are needed for Ca 2⫹mediated toxicity to occur, the generation of reactive oxygen species is a strong candidate. It is believed that Ca 2⫹ influx causes cellular alterations that lead to reactive oxygen species production (Fig. 2). Xanthine oxidase, nitric oxide synthase, phospholipase A 2 and certain mitochondrial activities have been suggested to be activated by Ca 2⫹ and generate reactive oxygen species during excitotoxicity. Xanthine Oxidase. The activation of xanthine oxidase by Ca 2⫹ has been proposed to be responsible for excitotoxicity, based on a myocardial ischemiareperfusion injury model (74). During myocardial ischemia-reperfusion injury, it is believed that Ca 2⫹ enters cells and activates serine proteases that convert xanthine dehydrogenase to the oxidase (75). O 2⫺• generated by xanthine oxidase is believed to cause oxidative damage leading to cell damage (76). Allopurinol, an inhibitor of xanthine oxidase, or antioxidant treatment has been shown to decrease myocardial ischemia-reperfusion injury. Because allopurinol was protective against kainate receptor–induced neurotoxicity, the mediation of excitotoxicity by xanthine oxidase was suggested (74). The protective effects of allopurinol were later shown against glutamate toxicity in vitro (66,74) and kainate
138
Han et al.
toxicity in vivo (77). In addition, xanthine oxidase activity, which is not normally present in neurons, was measurable 5 min following the addition of glutamate to cells (66). The glutamate-induced xanthine oxidase activity could be blocked by the NMDA receptor antagonist MK-801 and by leupeptin, a protease inhibitor. Evidence supporting a role for xanthine oxidase in oxidant generation during glutamate neurotoxicity has been limited. The protective effects of allopurinol do not seem to be universal, with some researchers reporting allopurinol to have no protective effects in glutamate neurotoxicity (67). Several groups have reported low xanthine dehydrogenase/oxidase levels in neurons (78,79), which may suggest that xanthine oxidase activity is an unlikely source of O 2⫺• during excitotoxicity. It may be surmised that there is not enough evidence to warrant a major involvement of xanthine oxidase in excitotoxicity (78). Nitric Oxide Synthase. Brain nitric oxide synthase is regulated by intracellular Ca 2⫹ and has been shown to be activated following NMDA receptor stimulation (57,58). As previously mentioned, although nitric oxide generation may occur following NMDA receptor stimulation, its role in excitotoxicity is probably limited. Phospholipase A 2. Activation of Ca 2⫹-dependent phospholipase A 2 and consequent release of arachidonic acid has been suggested to be a source of reactive oxygen species during excitotoxicity. The involvement of phospholipase in excitotoxicity is based on the following: (1) glutamate treatment of neurons results in the release of arachidonic acid (80); (2) treatment of neurons with arachidonic acid leads to O 2⫺• production detected by spin-trapping ESR in cerebrellar neurons (40); and (3) treatment of neurons with nordihydroguaiaretic acid (NDGA), a phospholipase and lipoxygenase inhibitor, protected neurons from glutamate neurotoxicity (81). Although phospholipase A2 activation and arachidonic acid cascades may play a role in reactive oxygen species generation during excitotoxicity, the role is probably a minor one. Arachidonic acid metabolism by cyclooxygenase and lipoxygenase are known to generate peroxide intermediates, which may potentially initiate lipid peroxidation (82). However, the cellular pathways for O 2⫺• generation through arachidonic acid–dependent pathways other than within macrophages (where an arachidonic acid cascade activates respiratory burst), are not well defined (83). In addition, NDGA is a chain-breaking antioxidant, and its protective abilities against excitotoxicity may be mediated by its antioxidant activity (84). Mitochondria. Mitochondria generate a steady flow of reactive oxygen species during aerobic respiration that contributes substantially to the cellular steady-state generation of these species (85,86). Along specific sites of the electron transport chain, O 2⫺• has been shown to be generated by a univalent transfer of electrons to oxygen (87,88). Mitochondria are also a major regulator of cyto-
Oxidative Stress in Glutamate Neurotoxicity
139
plasmic Ca 2⫹ levels (89,90). When cytoplasmic Ca 2⫹ levels increase, as seen following NMDA receptor overstimulation, mitochondria accumulate Ca 2⫹ in an effort to reduce the cytoplasmic levels (91). This Ca 2⫹ sequestering activity in brain mitochondria has a price: heavy loading of mitochondria with Ca 2⫹ leads to a collapse of the mitochondrial membrane potential and to an increased generation of reactive oxygen species. The ‘‘Ca 2⫹ overload’’ hypothesis of mitochondria has gained popularity as a major mechanism that leads to reactive oxygen species generation and excitotoxic cell death. Mitochondria, Reactive Oxygen Species, and Ca 2ⴙ. It has been estimated that during aerobic respiration 1–2% of oxygen consumed becomes univalently reduced to O 2⫺• by the electron transport chain instead of being tetravalently reduced to water by cytochrome oxidase at the end of the chain (88,92). Through the catalytic action of MnSOD, O 2⫺• is converted to H 2O2, which readily diffuses out of mitochondria. Autoxidation of ubisemiquinone and NADH-dehydrogenase activity, in particular, are important mechanisms in generating O 2⫺• in the electron transport chain (88,93). Chemicals that affect mitochondrial respiration have been shown to modulate H 2 O 2 production. Addition of complex III inhibitors (i.e., antimycin A) or complex IV inhibitors (i.e., cyanide) to isolated mitochondria increases the ubisemiquinone pool leading to increased H2O2 production (86,87). Inhibitors of complex I (i.e., rotenone) inhibit ubisemiquinone formation and consequently O 2⫺• formation (93). Mitochondria uncouplers [e.g., carbonyl cyanide p-(trifluoromethoxy)phenylhydrazone (FCCP), carbonyl cyanide m-chlorophenylhydrazone (CCCP)] alone do not affect H 2 O 2 production by isolated mitochondria (86), but in the presence of mitochondrial electron transport inhibitors (e.g., antimycin A, cyanide) H 2 O 2 production is greatly enhanced (94). Ca 2⫹ treatment of isolated mitochondria also potentiates mitochondrial reactive H 2 O 2 production. Using isolated heart mitochondria treated with antimycin A, an increase in mitochondrial H 2 O 2 generation was observed with Ca 2⫹ treatment (94). A linear relationship between H 2 O 2 production and Ca 2⫹ concentration (range: 0–0.45 µM) was found to occur. Ca 2⫹ was later shown to potentiate t-butyl hydroperoxide–mediated free radical production by mitochondria (95). As previously discussed, a steady-state production of HO • (by spin-trapping ESR) occured in isolated brain mitochondria treated with Ca 2⫹ (2.5 µM), Na ⫹ (14 mM), and elevated ADP (cytoplasmic conditions associated with excitotoxicity) (56). When Ca 2⫹ or Na ⫹ were not present, HO • were not produced in isolated brain mitochondria. Taken together, the data suggest that Ca 2⫹ treatment of mitochondria, under certain conditions, can enhance O 2⫺• /H2O2 generation. The mitochondrial changes underlying an enhanced production of O 2⫺• / H 2 O 2 following Ca 2⫹ treatment remain unknown. The sequestering of Ca 2⫹ by mitochondria is likely to play a role in this process, since mitochondria uptake of Ca 2⫹ can cause functional alterations. Ca 2⫹ is transported into the mitochondria by a uniport transport system that is dependent on the mitochondrial membrane potential (90). Ruthenium red has been found to be an inhibitor of the uniport
140
Han et al.
mitochondrial Ca 2⫹ transport system (90). Mitochondria uncouplers and inhibitors, which dissipate the mitochondrial membrane potential, have also been shown to inhibit Ca 2⫹ transport into the mitochondria (96). Uptake of small amounts of Ca 2⫹ by mitochondria appears to have few functional consequences, whereas the accumulation of large amounts of Ca 2⫹ appears to dramatically alter mitochondrial functions. Mitochondrial Ca 2⫹ overload causes a dissipation of the mitochondrial membrane potential and/or activation of the mitochondrial permeability transition resulting in an inability of mitochondria to perform oxidative phosphorylation (97–99). Excitotoxicity: Ca 2ⴙ Overload and Reactive Oxygen Species Generation. In excitotoxicity, NMDA receptor overstimulation results in a large influx of Ca 2⫹, which is then sequestered by the mitochondria (91,96,100–102). The uptake of Ca 2⫹ by mitochondria causes functional alterations including acidosis (99,103) and a collapse of the mitochondrial membrane potential (101,104). The accumulation of Ca 2⫹ by mitochondria appears to be the key step in mediating excitotoxic cell death. Neurons treated with ruthenium red, an inhibitor of Ca 2⫹ uptake in mitochondria, are protected against glutamate neurotoxicity (105). Reactive oxygen species generation, measured by HEt, DCFH, and DHR, increases as soon as Ca 2⫹ is sequestered by mitochondria (42,51,52,70). Confocal measurements show that DCF fluorescence occurs in the same proximity as mitochondria, suggesting that mitochondria are the source of reactive oxygen species (54). The argument that mitochondria are directly responsible for O 2⫺• /H 2 O 2 generation following Ca 2⫹ accumulation is based on the fact that (1) electron transfer inhibitors decrease reactive oxygen species generation during excitotoxicity and (2) mitochondria uncouplers can mimic excitotoxicity and can cause reactive oxygen species generation in neurons. Treatment of neurons with rotenone and cyanide results in inhibition of O 2⫺• production (measured by HEt) induced by NMDA treatment (42,43). A similar decrease in NMDA-induced reactive oxygen species production, using DHR, was observed after treatment of neurons with rotenone or antimycin A (51). On the other hand, the treatment of neurons with mitochondria uncouplers CCCP (51) and FCCP (42,43) have been shown to mimic NMDA and cause an increase in reactive oxygen species production. The simultaneous treatment of neurons with NMDA and FCCP causes no additive effect on reactive oxygen species generation, suggesting that the reactive oxygen species were orginating from mitochondria (42). Since both glutamate and mitochondria uncoupler treatment to neurons causes a dissipation of the mitochondrial membrane potential and increase reactive oxygen species generation, it has been suggested that loss of mitochondrial membrane potential is a key step in mitochondrial generation of reactive oxygen species (51). Unfortunately, such data are contrary to what has been established in O 2⫺• / H 2 O 2 production in isolated mitochondria. As mentioned above, supplementation of isolated mitochondria with inhibitors antimycin A and cyanide increases H 2 O 2 production as a consequence to an increase of the ubisemiquinone pool (86). The
Oxidative Stress in Glutamate Neurotoxicity
141
opposite is seen in excitotoxicity experiments, i.e., the addition of mitochondrial electron transport inhibitors was shown to decrease reactive oxygen species production by mitochondria. Mitochondria uncouplers will decrease H 2 O 2 production in isolated mitochondria (86) unless there is a block in the electron transport chain, in which case there would be a dramatic increase in H 2 O 2 production (94). Yet in neurons the treatment of uncouplers causes an increase in reactive oxygen species production by mitochondria. Why are there such conflicting results between isolated mitochondria and neurons? The discrepancies may be bridged by considering differences in experimental designs. For example, most studies with mitochondria and O 2⫺• /H 2 O 2 production were carried out with isolated liver mitochondria, and perhaps there is some difference in functionality between liver and brain mitochondria. The discrepancy may also be due to technical difficulties in measuring reactive oxygen species in intact cells. The fluorescent dyes used to measure reactive oxygen species in neurons are not necessarily specific for reactive oxygen species and can be influenced by cellular changes. Et fluorescence and rhodamine 123 fluorescence are highly dependent on the mitochondrial membrane potential (106), and it is likely that their increase in fluorescence during excitotoxicity is due to mitochondrial changes rather than reactive oxygen species production (see Appendix). Clearly, experiments using specific detection methods (e.g., aconitase, ESR) are necessary to determine conclusively if treatment of electron transport chain inhibitors can halt reactive oxygen species production during excitotoxicity. At present, it may be concluded that Ca2⫹ overloading of mitochondria is a key step in excitotoxicity (107). Increased reactive oxygen species generation may result from Ca2⫹ overloading of mitochondria, but methodological problems hinder the gathering of conclusive evidence. B.
Kainate/AMPA Receptor-Mediated Excitotoxicity
Kainate and AMPA receptors are ligand-gated ions channels with high conductance for K ⫹ and Na ⫹ and are considered mediators of the fast components of excitatory postsynaptic currents (37,108,109). The overstimulation of the kainate/ AMPA receptors will also result in excitotoxic cell death, but only at higher doses of agonist (i.e., kainate 15 min at 1 mM) or longer incubation times (e.g., 10 µM AMPA for 24 h) than those needed for NMDA or glutamate (16). Kainate and AMPA receptor–mediated excitotoxicity share many similar characteristics and therefore will be discussed as one process. Although kainate and AMPA receptors both have a poor conductance for Ca 2⫹, their prolonged activation is believed to cause the opening of voltage-sensitive Ca 2⫹ channels. Hyperstimulation of kainate/AMPA receptors results in Ca2⫹ influx into cells but at lower quantities than observed following NMDA receptor overstimulation (72). Mitochondria have been shown to sequester elevated levels
142
Han et al.
of intracellular Ca 2⫹ caused by kainate receptor stimulation, but were able to retain their membrane potential and experienced no significant changes (110). Controversy has arisen on whether or not Ca 2⫹ influx plays an important role in kainate/AMPA receptor–mediated excitotoxicity. Several reports have suggested that addition of Ca 2⫹ chelators or the removal of Ca 2⫹ from culture medium cannot protect neurons from kainate-induced cytotoxicity (3,111), while several reports suggest the contrary (112,113). 1.
Generation of Reactive Oxygen Species
There are a large number of reports suggesting that kainate/AMPA receptor– mediated excitotoxicity involves the generation of reactive oxygen species, whereas many others claim there is no evidence of reactive oxygen species involvement. Using the fluorescent dye HEt, O 2⫺• levels were found to be increased following treatment with both kainic acid and AMPA (42). An increased O 2⫺• production was observed with kainate treatment after 6 h using the aconitase assay for O 2⫺• (41). Both AMPA and kainate treatment have been shown to cause increased DCF fluorescence, indicating increased reactive oxygen species production (114). In addition, like NMDA receptor–mediated excitotoxicity, it has been found that kainate and AMPA receptor–mediated excitotoxicity requires oxygen to occur. However, several studies failed to detect reactive oxygen species after kainate treatment: neither O 2⫺• (40) nor HO • (51) was seen 15 min following kainate treatment, as monitored by spin-trapping ESR. Similarly, an increased rhodamine 123 fluorescence occurred following NMDA but not kainate treatment (51). Part of the discrepancy about the involvement of reactive oxygen species in kainate/AMPA-mediated cell death may be due to the time after kainate/AMPA treatment that reactive oxygen species are measured (41). In most studies that failed to observe reactive oxygen species generation, measurements occurred within 15 min of kainate treatment, whereas studies that observed reactive oxygen species generation after kainate treatment were performed at time points greater than 30 min. For example, minimal O 2⫺• generation occurred at 15 min but increased substantially with time (41). Kainate- and AMPA-induced generation of reactive oxygen species appears to be slower than that induced by NMDA. The possible sources of reactive oxygen species following kainate/AMPA treatment remain unknown. Mitochondria (42) and xanthine oxidase (74) have been suggested as possible sources. However, because Ca 2⫹ may not be essential for kainate/AMPA receptor–mediated excitotoxicity, the mechanism encompassing reactive oxygen species generation has not been elucidated. 2.
Protective Effects of Antioxidants
Antioxidant treatment for the most part protects neurons from the toxic effects of kainate and AMPA. Treatment of neurons with SOD (74) or the SOD mimic
Oxidative Stress in Glutamate Neurotoxicity
143
MnTrap was found to dramatically reduce kainate toxicity. However, the overexpression of MnSOD (45), which was shown to protect cells from NMDA-induced excitotoxicity, did not protect cells against AMPA- or kainate-induced toxicity. The spin trap N-tert-butyl-α-(2-sulfophenyl)nitrone (S-PBN) was shown to protect neurons against lesions caused by kainate and AMPA (68). Both vitamin E and Trolox treatment can moderately protect cells against AMPA and kainate toxicity (74,115,116). V.
NONRECEPTOR-MEDIATED GLUTAMATE NEUROTOXICITY
Nonreceptor-mediated glutamate neurotoxicity (NRGN) occurs in a large variety of neural cells that lack ionotropic glutamate receptors (Table 2). The central feature that characterizes NRGN is a depletion of cellular GSH caused by a glutamate inhibition of cystine transport (26). Cysteine is the rate-limiting amino acid substrate for intracellular GSH synthesis (27). Because of its redox instability, almost all of the extracellular cysteine is present in the oxidized cystine state (in cell culture medium). Cystine is transported into cells, reduced to cysteine, and utilized for protein and GSH synthesis. Glutamate and cystine share the same amino acid transporter, the xc antiport system, and therefore compete for transport into cells (117). Under conditions of elevated extracellular glutamate levels, cystine transport is inhibited. Because GSH has a high turnover in cells, the inhibition of cystine transport leads to rapid GSH depletion (27). Depletion of GSH, the major cellular antioxidant, results in increased vulnerability of cells to oxidative stress and ultimately cell death (26). Cytotoxicity due to GSH depletion is not unique to glutamate. Other agents that deplete cells of GSH have also been shown to cause cell death. Agents that target γ-glutamylcysteine synthetase (GCS), the rate-limiting enzyme in GSH synthesis, are particularly cytotoxic. Treatment of cells with l-buthionine-(s,R)sulfoximine (BSO), an inhibitor of GCS, and transfection of cells with GCS antisense DNA leads to GSH depletion and cell death (30,118,119). GSH-depleting agents do not, however, always completely mimic the effects of glutamate. For example, glutamate treatment of C6 glial cells resulted in GSH depletion and cell death within 24 h (120). BSO treatment of C6 cells, although causing GSH depletion, has no effect on cell viability within 24 h. Only after longer periods was BSO cytotoxic to C6 cells (121). Overall, the study of GSH depletion in neurons may provide valuable insight in conditions such as Parkinson’s disease, which is associated with decreased GSH in patients’ brains (34). A.
Protective Effects of Antioxidants
A wide range of antioxidants can compensate for the GSH loss and protect neural cells from NRGN. In contrast to excitotoxicity, antioxidant treatment can com-
144
Han et al.
pletely prevent NRGN, thus suggesting that NRGN is a process solely mediated by oxidative stress. Thiol-based antioxidants, such lipoic acid and N-acetylcysteine (NAC), prevent NRGN in several neural cell lines either by modulating GSH levels (122) or through their antioxidant properties (120). Members of the vitamin E family, including Trolox (123), α-, β-, γ-tocopherol (26,31,122), and 2,2,5,7,8-pentamethyl-6-hydroxychroman (PMHC) (123), are effective in inhibiting NRGN. The iron chelator desferrioxamine mesylate (121) and various flavonoids also prevent NRGN (123). Using a hippocampal HT-4 cell line, most conventional antioxidants were found to be effective in protecting cells against NRGN (123).
B.
Reactive Oxygen Species Generation and Lipid Peroxidation
A fall in cellular GSH levels is associated with a rise in reactive oxygen species formation in cells. Using the fluorescent probe DCFH, many groups have observed increased reactive oxygen species generation in NRGN (26,28,120). In C6 cells treated with 10 mM glutamate a fivefold increase in DCF fluorescence was observed 8 h after glutamate treatment (120). Since DCFH is not a very specific probe and reacts with many reactive oxygen species including H 2 O 2, lipid peroxides, peroxynitrite, and HO •, the nature of the reactive oxygen species remains in question. Oxidants measured by DCFH may, at least in part, be lipid peroxides. This is based on two observations. On the one hand, glutamate-induced DCF fluorescence was alleviated by low concentrations of vitamin E, whose major feature is that of being a chain-breaking antioxidant in membranes. On the other hand, MDA, a marker of lipid peroxidation, increased following glutamate treatment (121). We suggest that the main consequence of GSH depletion by glutamate is that it renders cells vulnerable to lipid peroxidation (Fig. 3) (120). GSH peroxidase and GSH transferase are important enzymes that utilize GSH to detoxify lipid peroxides (124–126). The decrease in GSH caused by glutamate treatment may leave GSH peroxidase or transferase operating at lower efficiencies, resulting in a buildup of lipid peroxides in the cell membrane. Lipid peroxides can initiate further lipid peroxidation reactions leading to the generation of more lipid peroxides [reactions (8) to (11)] (55). LOOH ⫹ Fe 2⫹ I LO • ⫹ HO • Fe 3⫹
(8)
LO ⫹ LH I LOH ⫹ L
(9)
•
L ⫹ O 2 I LOO •
•
•
LOO • ⫹ LH I LOOH ⫹ L •
(10) (11)
Oxidative Stress in Glutamate Neurotoxicity
145
Figure 3 Proposed mechanism of nonreceptor-mediated glutamate neurotoxicity.
The failure of cells to clear lipid peroxides due to a lack of GSH will probably set up a situation where lipid peroxidation goes unchecked—a situation that is remedied by treatment of cells with vitamin E or desferrioxamine mesylate. C.
Sources of Reactive Oxygen Species
As with excitotoxicity, the influx of Ca 2⫹ into cells appears to be important in mediating cell death. The addition of Ca 2⫹ chelators or Ca 2⫹ channel blockers were found to prevent NRGN in N18-RE-105 cells (127). NRGN has been shown to be associated with rises in intracellular Ca 2⫹ levels (119) through Ca 2⫹ channels that are inhibitable by CoCl 2 (127). A feed-forward relationship between Ca 2⫹ and reactive oxygen species (i.e., reactive oxygen species trigger Ca 2⫹ influx, which can further potentiate reactive oxygen species generation, which further opens Ca 2⫹ channels) has been shown to occur (29). Mitochondria and a monoamine oxidase–like protein remain attractive candidates for reactive oxygen species generation in NRGN. There is little evidence that xanthine oxidase or nitric oxide plays a role in NRGN (121). In HT-22 cells, reactive oxygen species generated during NRGN were found to be inhibited by treatment of cells with FCCP or antimycin A (29). In addition, both FCCP and antimycin A were found to lower H 2 O 2 production during succinate utilization
146
Han et al.
in isolated mitochondria from HT-22 cells. These results conflict with previous work on isolated mitochondria and H 2 O 2 generation. Work done in the 1970s clearly shows that in isolated liver mitochondria, antimycin A treatment increases H 2 O 2 generation (87). The discrepancies between classic experiments with isolated mitochondria and recent studies with isolated mitochondria from neural cells need to be addressed. A monoamine oxidase–like protein has been suggested to be responsible for NRGN, based on the observation that monoamine oxidase inhibitors could protect cells from glutamate (28). The doses of monoamine oxidase inhibitor needed to protect cells from NRGN were substantially higher than those needed to inhibit monoamine oxidase activity, suggesting that the inhibitors were affecting a different protein (28).
VI.
CONCLUDING REMARKS
Current evidence suggests that oxidative stress is a key component in all forms of glutamate neurotoxicity. In particular, the formation of O 2⫺• and its decay pathways in a cellular setting seem to be critical determinants of glutamate neurotoxicity. Mitochondria appear to be the primary source of reactive oxygen species during excitotoxicity although methodological difficulties make it difficult to make any sound conclusions. More quantitative analysis of oxidant generation following glutamate treatment and analysis of oxidative damage needs to be performed to better assess the involvement of reactive oxygen species in glutamate neurotoxicity. Because glutamate is believed to play an important role in the neurodegeneration associated with Alzheimer’s disease, Huntington’s disease, epilepsy, and cerebral ischemia, understanding the complex free radical chemistry involved in glutamate neurotoxicity will hopefully advance therapeutic strategies for many neurodegenerative disorders.
APPENDIX A.
Electron Spin Resonance
ESR is the only method that can directly detect free radicals. Since most free radicals are short lived, spin traps, which react with radicals to form stable radicals, are often used for ESR determination. Hyperfine splitting patterns on an ESR spectrum can be used to identify the type of radicals being generated. O 2⫺• and HO • have been observed by ESR in neurons following glutamate treatment (40,51).
Oxidative Stress in Glutamate Neurotoxicity
B.
147
Aconitase Assay
Aconitase is a TCA cycle enzyme that contains an iron-sulfur prosthetic group ([4Fe-4S] 2⫺). O 2⫺• has been shown to inactivate aconitase by attacking the ironsulfur cluster assembly (128). This O 2⫺•-induced inactivation of aconitase can be reversed by the addition of strong reducing agents. Measurement of aconitase activity can be used to assess the steady-state level of O 2⫺• production inside cells (129,130). This method is fairly specific for detecting O 2⫺• with peroxynitrite being the only other reactive oxygen species that can reversibly inactivate aconitase (131). The treatment of neurons with either NMDA or kainate has been shown to inactivate aconitase, indicating O 2⫺• production (41). C.
Hydroethidine
O 2⫺• has been shown to oxidize hydroethidine (HEt) to ethidium (Et) (42). The treatment of cells with HEt and the monitoring of Et fluorescence is frequently used to assess O 2⫺• generation in biological systems. Et fluorescence has been shown to increase in neurons following NMDA treatment, suggesting O 2⫺• production (42). Unlike most probes, HEt oxidation is very specific for O 2⫺• and does not react with H 2 O 2, HO •, singlet oxygen, or nitrogen radicals (42,132). However, it has been recently shown that Et localization is affected by the mitochondrial membrane potential. A loss of the mitochondrial membrane potential can cause a redistribution of Et that leads to an increase in fluorescence (106). Since glutamate neurotoxicity is associated with a dissipation of the mitochondrial membrane potential, it has been argued that the observed increase in Et fluorescence may reflect mitochondrial membrane potential changes and not O 2⫺• production (106). D.
Dihydrorhodamine 123
Dihydrorhodamine 123 (DHR) is a nonfluorescent probe that upon oxidation by various reactive oxygen species is converted to rhodamine 123, a fluorescent molecule. DHR is probably oxidized H 2 O 2 indirectly, either through Fenton chemistry and/or peroxidase activity (133,134). Neurons treated with NMDA were shown to have increased rhodamine 123 fluorescence (51,53). However, as with HEt, rhodamine 123 localization is influenced heavily by the mitochondrial membrane potential (135,136). Changes in fluorescence seen with DHR in glutamate neurotoxicity may therefore reflect mitochondrial membrane changes rather than reactive oxygen species generation. E. Dichlorofluorescin Dichlorofluorescin (DCFH) is a nonfluorescent probe that is converted to the fluorescent molecule dichlorofluorescein (DCF) upon oxidation. Like DHR,
148
Han et al.
DCFH is believed to be oxidized by H 2 O 2 indirectly, either through Fenton chemistry and/or peroxidase activity (133,137). In addition, DCF oxidation can occur through reactions with lipid peroxides, peroxynitrite, and DCF may also be a substrate for certain oxidases such as xanthine oxidase (133,137–139). DCFH is, therefore, nonspecific, and should not be mistakenly considered a probe that monitors H 2 O 2 levels. DCF fluorescence is also strongly influenced by intracellular pH (54). An average increase in DCF fluorescence has been shown to occur in synaptoneurosomal fractions treated with various glutamate receptor agonists (114) and localized increases in DCF fluorescence have been observed in forebrain neurons treated with glutamate (54). However, acidosis associated with glutamate neurotoxicity (103) quenches DCF fluorescence, making the use of this probe in excitotoxicity fairly difficult (54).
ACKNOWLEDGMENT The authors thank Pamela Hong for her technical assistance.
REFERENCES 1. Sies, H. (1985) Oxidative Stress. Academic Press, New York. 2. Suzuki, Y.J., Forman, H.J., and Sevanian, A. (1997) Oxidants as stimulators of signal transduction. Free Radic. Biol. Med. 22, 269–85. 3. Coyle, J.T., and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262, 689–95. 4. Michaelis, E.K. (1998) Molecular biology of glutamate receptors in the central nervous system and their role in excitotoxicity, oxidative stress and aging. Prog. Neurobiol. 54, 369–415. 5. Bondy, S.C., and LeBel, C.P. (1993) The relationship between excitotoxicity and oxidative stress in the central nervous system. Free Radic. Biol. Med. 14, 633–42. 6. Dugan, L.L., and Choi, D.W. (1994) Excitotoxicity, free radicals, and cell membrane changes. Ann. Neurol. 35, S17–21. 7. Greenamyre, J.T., and Porter, R.H. (1994) Anatomy and physiology of glutamate in the CNS. Neurology 44, S7–13. 8. Ankarcrona, M., Dypbukt, J.M., Bonfoco, E., Zhivotovsky, B., Orrenius, S., Lipton, S.A., and Nicotera, P. (1995) Glutamate-induced neuronal death: a succession of necrosis or apoptosis depending on mitochondrial function. Neuron 15, 961–73. 9. Bonfoco, E., Krainc, D., Ankarcrona, M., Nicotera, P., and Lipton, S.A. (1995) Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with N-methyl-d-aspartate or nitric oxide/superoxide in cortical cell cultures. Proc. Natl. Acad. Sci. USA 92, 7162–6. 10. Olney, J.W., Wozniak, D.F., and Farber, N.B. (1997) Excitotoxic neurodegenera-
Oxidative Stress in Glutamate Neurotoxicity
11. 12. 13. 14.
15. 16. 17.
18. 19. 20.
21.
22.
23.
24.
25. 26.
27.
149
tion in Alzheimer disease. New hypothesis and new therapeutic strategies. Arch. Neurol. 54, 1234–40. Greenamyre, J.T., and Young, A.B. (1989) Excitatory amino acids and Alzheimer’s disease. Neurobiol. Aging 10, 593–602. Beal, M.F. (1992) Mechanisms of excitotoxicity in neurologic diseases. FASEB J. 6, 3338–44. Loopuijt, L.D., and Schmidt, W.J. (1998) The role of NMDA receptors in the slow neuronal degeneration of Parkinson’s disease. Amino Acids 14, 17–23. Myseros, J.S., and Bullock, R. (1995) The rationale for glutamate antagonists in the treatment of traumatic brain injury. Ann. N.Y. Acad. Sci. 765, 262–71; discussion 298. Ozawa, S., Kamiya, H., and Tsuzuki, K. (1998) Glutamate receptors in the mammalian central nervous system. Prog. Neurobiol. 54, 581–618. Choi, D.W. (1988) Glutamate neurotoxicity and diseases of the nervous system. Neuron 1, 623–34. Sladeczek, F., Manzoni, O., Fagni, L., Dumuis, A., Pin, J.P., Sebben, M., and Bockaert, J. (1992) The metabotropic glutamate receptor (MGR): pharmacology and subcellular location. J. Physiol. (Paris) 86, 47–55. Sladeczek, F., Pin, J.P., Recasens, M., Bockaert, J., and Weiss, S. (1985) Glutamate stimulates inositol phosphate formation in striatal neurones. Nature 317, 717–9. Pin, J.P., and Duvoisin, R. (1995) The metabotropic glutamate receptors: structure and functions. Neuropharmacology 34, 1–26. Koh, J.Y., Palmer, E., and Cotman, C.W. (1991) Activation of the metabotropic glutamate receptor attenuates N-methyl-d-aspartate neurotoxicity in cortical cultures. Proc. Natl. Acad. Sci. USA 88, 9431–5. Bruno, V., Copani, A., Knopfel, T., Kuhn, R., Casabona, G., Dell’Albani, P., Condorelli, D.F., and Nicoletti, F. (1995) Activation of metabotropic glutamate receptors coupled to inositol phospholipid hydrolysis amplifies NMDA-induced neuronal degeneration in cultured cortical cells. Neuropharmacology 34, 1089–98. Bruno, V., Battaglia, G., Copani, A., Giffard, R.G., Raciti, G., Raffaele, R., Shinozaki, H., and Nicoletti, F. (1995) Activation of class II or III metabotropic glutamate receptors protects cultured cortical neurons against excitotoxic degeneration. Eur. J. Neurosci. 7, 1906–13. Montoliu, C., Llansola, M., Cucarella, C., Grisolia, S., and Felipo, V. (1997) Activation of the metabotropic glutamate receptor mGluR5 prevents glutamate toxicity in primary cultures of cerebellar neurons. J. Pharmacol. Exp. Ther. 281, 643–7. Olney, J.W., Ho, O.L., and Rhee, V. (1971) Cytotoxic effects of acidic and sulfur containing amino acids on the infant mouse central nervous system. Exp. Brain Res. 14, 61–70. Olney, J.W. (1969) Brain lesions, obesity, and other disturbances in mice treated with monosodium glutamate. Science 164, 719–21. Murphy, T.H., Miyamoto, M., Sastre, A., Schnaar, R.L., and Coyle, J.T. (1989) Glutamate toxicity in a neuronal cell line involves inhibition of cystine transport leading to oxidative stress. Neuron 2, 1547–58. Bannai, S., and Tateishi, N. (1986) Role of membrane transport in metabolism and function of glutathione in mammals. J. Membr. Biol. 89, 1–8.
150
Han et al.
28. Maher, P., and Davis, J.B. (1996) The role of monoamine metabolism in oxidative glutamate toxicity. J. Neurosci. 16, 6394–401. 29. Tan, S., Sagara, Y., Liu, Y., Maher, P., and Schubert, D. (1998) The regulation of reactive oxygen species production during programmed cell death. J. Cell Biol. 141, 1423–32. 30. Kato, S., Negishi, K., Mawatari, K., and Kuo, C.H. (1992) A mechanism for glutamate toxicity in the C6 glioma cells involving inhibition of cystine uptake leading to glutathione depletion. Neuroscience 48, 903–14. 31. Pereira, C.M., and Oliveira, C.R. (1997) Glutamate toxicity on a PC12 cell line involves glutathione (GSH) depletion and oxidative stress. Free Radic. Biol. Med. 23, 637–47. 32. Oka, A., Belliveau, M.J., Rosenberg, P.A., and Volpe, J.J. (1993) Vulnerability of oligodendroglia to glutamate: pharmacology, mechanisms, and prevention. J. Neurosci. 13, 1441–53. 33. Murphy, T.H., Schnaar, R.L., and Coyle, J.T. (1990) Immature cortical neurons are uniquely sensitive to glutamate toxicity by inhibition of cystine uptake. FASEB J. 4, 1624–33. 34. Adams, J.D., Jr., and Odunze, I.N. (1991) Oxygen free radicals and Parkinson’s disease. Free Radic. Biol. Med. 10, 161–9. 35. Choi, D.W. (1992) Excitotoxic cell death. J. Neurobiol. 23, 1261–76. 36. Olney, J.W., and Farber, N.B. (1995) NMDA antagonists as neurotherapeutic drugs, psychotogens, neurotoxins, and research tools for studying schizophrenia. Neuropsychopharmacology 13, 335–45. 37. Jahr, C.E., and Stevens, C.F. (1987) Glutamate activates multiple single channel conductances in hippocampal neurons. Nature 325, 522–5. 38. Parsons, C.G., Danysz, W., Hesselink, M., Hartmann, S., Lorenz, B., Wollenburg, C., and Quack, G. (1998) Modulation of NMDA receptors by glycine—introduction to some basic aspects and recent developments. Amino Acids 14, 207–16. 39. Han, D., Loukianoff, S., and McLaughlin, L. (1999) Oxidative stress indices: analytical aspects and significance. In: Exercise and Oxygen Toxicity, 2nd ed. (C.K. Sen, L. Packer, and O. Hanninen, eds.), Elsevier, Amsterdam (in press). 40. Lafon-Cazal, M., Pietri, S., Culcasi, M., and Bockaert, J. (1993) NMDA-dependent superoxide production and neurotoxicity. Nature 364, 535–7. 41. Patel, M., Day, B.J., Crapo, J.D., Fridovich, I., and McNamara, J.O. (1996) Requirement for superoxide in excitotoxic cell death. Neuron 16, 345–55. 42. Bindokas, V.P., Jordan, J., Lee, C.C., and Miller, R.J. (1996) Superoxide production in rat hippocampal neurons: selective imaging with hydroethidine. J. Neurosci. 16, 1324–36. 43. Sengpiel, B., Preis, E., Krieglstein, J., and Prehn, J.H. (1998) NMDA-induced superoxide production and neurotoxicity in cultured rat hippocampal neurons: role of mitochondria. Eur. J. Neurosci. 10, 1903–10. 44. Chan, P.H., Chu, L., Chen, S.F., Carlson, E.J., and Epstein, C.J. (1990) Reduced neurotoxicity in transgenic mice overexpressing human copper-zinc-superoxide dismutase. Stroke 21, III80–2. 45. Gonzalez-Zulueta, M., Ensz, L.M., Mukhina, G., Lebovitz, R.M., Zwacka, R.M., Engelhardt, J.F., Oberley, L.W., Dawson, V.L., and Dawson, T.M. (1998) Manga-
Oxidative Stress in Glutamate Neurotoxicity
46.
47.
48.
49.
50.
51.
52.
53.
54.
55. 56.
57.
58.
59.
60.
151
nese superoxide dismutase protects nNOS neurons from NMDA and nitric oxidemediated neurotoxicity. J. Neurosci. 18, 2040–55. Lafon-Cazal, M., Culcasi, M., Gaven, F., Pietri, S., and Bockaert, J. (1993) Nitric oxide, superoxide and peroxynitrite: putative mediators of NMDA-induced cell death in cerebellar granule cells. Neuropharmacology 32, 1259–66. Antunes, F., Salvador, A., Marinho, H.S., Alves, R., and Pinto, R.E. (1996) Lipid peroxidation in mitochondrial inner membranes. I. An integrative kinetic model. Free Radic. Biol. Med. 21, 917–43. Yang, C.S., Tsai, P.J., Lin, N.N., and Kuo, J.S. (1998) Elevated extracellular glutamate concentrations increased malondialdehyde production in anesthetized rat brain cortex. Neurosci. Lett. 243, 33–6. Radi, R., Beckman, J.S., Bush, K.M., and Freeman, B.A. (1991) Peroxynitriteinduced membrane lipid peroxidation: the cytotoxic potential of superoxide and nitric oxide. Arch. Biochem. Biophys. 288, 481–7. Beckman, J.S., Beckman, T.W., Chen, J., Marshall, P.A., and Freeman, B.A. (1990) Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. USA 87, 1620–4. Dugan, L.L., Sensi, S.L., Canzoniero, L.M., Handran, S.D., Rothman, S.M., Lin, T.S., Goldberg, M.P., and Choi, D.W. (1995) Mitochondrial production of reactive oxygen species in cortical neurons following exposure to N-methyl-d-aspartate. J. Neurosci. 15, 6377–88. Mattson, M.P., Lovell, M.A., Furukawa, K., and Markesbery, W.R. (1995) Neurotrophic factors attenuate glutamate-induced accumulation of peroxides, elevation of intracellular Ca 2⫹ concentration, and neurotoxicity and increase antioxidant enzyme activities in hippocampal neurons. J. Neurochem. 65, 1740–51. Perez Velazquez, J.L., Frantseva, M.V., and Carlen, P.L. (1997) In vitro ischemia promotes glutamate-mediated free radical generation and intracellular calcium accumulation in hippocampal pyramidal neurons. J. Neurosci. 17, 9085–94. Reynolds, I.J., and Hastings, T.G. (1995) Glutamate induces the production of reactive oxygen species in cultured forebrain neurons following NMDA receptor activation. J. Neurosci. 15, 3318–27. Cadenas, E. (1989) Biochemistry of oxygen toxicity. Annu. Rev. Biochem. 58, 79– 110. Dykens, J.A. (1994) Isolated cerebral and cerebellar mitochondria produce free radicals when exposed to elevated Ca 2⫹ and Na ⫹: implications for neurodegeneration. J. Neurochem. 63, 584–91. Garthwaite, J., Garthwaite, G., Palmer, R.M., and Moncada, S. (1989) NMDA receptor activation induces nitric oxide synthesis from arginine in rat brain slices. Eur. J. Pharmacol. 172, 413–6. Kiedrowski, L., Costa, E., and Wroblewski, J.T. (1992) Glutamate receptor agonists stimulate nitric oxide synthase in primary cultures of cerebellar granule cells. J. Neurochem. 58, 335–41. Dawson, V.L., Dawson, T.M., London, E.D., Bredt, D.S., and Snyder, S.H. (1991) Nitric oxide mediates glutamate neurotoxicity in primary cortical cultures. Proc. Natl. Acad. Sci. USA 88, 6368–71. Hoshino, M., Ozawa, K., Seki, H., and Ford, P.C. (1993) Photochemistry of nitric
152
61.
62.
63.
64.
65. 66.
67.
68.
69.
70.
71. 72.
73.
74.
75.
Han et al. oxide adducts of water-soluble iron(III) porphyrin and ferrihemoproteins studied by nanosecond laser photolysis. J. Am. Chem. Soc. 115, 9568–75. Lipton, S.A., Choi, Y.B., Pan, Z.H., Lei, S.Z., Chen, H.S., Sucher, N.J., Loscalzo, J., Singel, D.J., and Stamler, J.S. (1993) A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds [see comments]. Nature 364, 626–32. Hewett, S.J., Corbett, J.A., McDaniel, M.L., and Choi, D.W. (1993) Inhibition of nitric oxide formation does not protect murine cortical cell cultures from N-methyld-aspartate neurotoxicity. Brain Res. 625, 337–41. Pauwels, P.J., and Leysen, J.E. (1992) Blockade of nitric oxide formation does not prevent glutamate-induced neurotoxicity in neuronal cultures from rat hippocampus. Neurosci. Lett. 143, 27–30. Regan, R.F., Renn, K.E., and Panter, S.S. (1993) NMDA neurotoxicity in murine cortical cell cultures is not attenuated by hemoglobin or inhibition of nitric oxide synthesis. Neurosci. Lett. 153, 53–6. Imlay, J.A., and Fridovich, I. (1991) Assay of metabolic superoxide production in Escherichia coli. J. Biol. Chem. 266, 6957–65. Atlante, A., Gagliardi, S., Minervini, G.M., Ciotti, M.T., Marra, E., and Calissano, P. (1997) Glutamate neurotoxicity in rat cerebellar granule cells: a major role for xanthine oxidase in oxygen radical formation. J. Neurochem. 68, 2038–45. Ciani, E., Groneng, L., Voltattorni, M., Rolseth, V., Contestabile, A., and Paulsen, R.E. (1996) Inhibition of free radical production or free radical scavenging protects from the excitotoxic cell death mediated by glutamate in cultures of cerebellar granule neurons. Brain Res. 728, 1–6. Schulz, J.B., Henshaw, D.R., Siwek, D., Jenkins, B.G., Ferrante, R.J., Cipolloni, P.B., Kowall, N.W., Rosen, B.R., and Beal, M.F. (1995) Involvement of free radicals in excitotoxicity in vivo. J. Neurochem. 64, 2239–47. Muller, U., and Krieglstein, J. (1995) Prolonged pretreatment with alpha-lipoic acid protects cultured neurons against hypoxic, glutamate-, or iron-induced injury. J. Cereb. Blood Flow Metab. 15, 624–630. Carriedo, S.G., Yin, H.Z., Sensi, S.L., and Weiss, J.H. (1998) Rapid Ca 2⫹ entry through Ca 2⫹-permeable AMPA/Kainate channels triggers marked intracellular Ca 2⫹ rises and consequent oxygen radical production. J. Neurosci. 18, 7727–38. Eimerl, S., and Schramm, M. (1994) The quantity of calcium that appears to induce neuronal death. J. Neurochem. 62, 1223–6. Hartley, D.M., Kurth, M.C., Bjerkness, L., Weiss, J.H., and Choi, D.W. (1993) Glutamate receptor-induced 45 Ca 2⫹ accumulation in cortical cell culture correlates with subsequent neuronal degeneration. J. Neurosci. 13, 1993–2000. Dubinsky, J.M., Kristal, B.S., and Elizondo-Fournier, M. (1995) An obligate role for oxygen in the early stages of glutamate-induced, delayed neuronal death. J. Neurosci. 15, 7071–8. Dykens, J.A., Stern, A., and Trenkner, E. (1987) Mechanism of kainate toxicity to cerebellar neurons in vitro is analogous to reperfusion tissue injury. J. Neurochem. 49, 1222–8. McCord, J.M. (1985) Oxygen-derived free radicals in postischemic tissue injury. N. Engl. J. Med. 312, 159–63.
Oxidative Stress in Glutamate Neurotoxicity
153
76. McCord, J.M. (1983) The superoxide free radical: its biochemistry and pathophysiology. Surgery 94, 412–4. 77. Facchinetti, F., Virgili, M., Contestabile, A., and Barnabei, O. (1992) Antagonists of the NMDA receptor and allopurinol protect the olfactory cortex but not the striatum after intracerebral injection of kainic acid. Brain Res. 585, 330–4. 78. Dykens, J.A. (1995) Mitochondrial radical production and mechanisms of oxidative excitotoxicity: implications for neurodegeneration. In: The Oxygen Paradox (K.J.A. Davies, and F. Ursini, ed.), Cleup University Press, Padova, pp. 453–468. 79. Markley, H.G., Faillace, L.A., and Mezey, E. (1973) Xanthine oxidase activity in rat brain. Biochim. Biophys. Acta 309, 23–31. 80. Dumuis, A., Sebben, M., Haynes, L., Pin, J.P., and Bockaert, J. (1988) NMDA receptors activate the arachidonic acid cascade system in striatal neurons. Nature 336, 68–70. 81. Rothman, S.M., Yamada, K.A., and Lancaster, N. (1993) Nordihydroguaiaretic acid attenuates NMDA neurotoxicity—action beyond the receptor. Neuropharmacology 32, 1279–88. 82. Yamamoto, S. (1991) ‘‘Enzymatic’’ lipid peroxidation: reactions of mammalian lipoxygenases. Free Radic. Biol. Med. 10, 149–59. 83. Needleman, P., Turk, J., Jakschik, B.A., Morrison, A.R., and Lefkowith, J.B. (1986) Arachidonic acid metabolism. Annu. Rev. Biochem. 55, 69–102. 84. Robison, T.W., Sevanian, A., and Forman, H.J. (1990) Inhibition of arachidonic acid release by nordihydroguaiaretic acid and its antioxidant action in rat alveolar macrophages and Chinese hamster lung fibroblasts. Toxicol. Appl. Pharmacol. 105, 113–22. 85. Boveris, A., Oshino, N., and Chance, B. (1972) The cellular production of hydrogen peroxide. Biochem J. 128, 617–30. 86. Forman, H.J., and Boveris, A. (1982) Superoxide radical and hydrogen peroxide in mitochondria. In: Free Radicals in Biology, Vol. 5 (W.A. Pryor, ed.), Academic Press, New York, pp. 65–89. 87. Boveris, A., and Cadenas, E. (1975) Mitochondrial production of superoxide anions and its relationship to the antimycin insensitive respiration. FEBS Lett. 54, 311– 4. 88. Boveris, A., Cadenas, E., and Stoppani, A.O. (1976) Role of ubiquinone in the mitochondrial generation of hydrogen peroxide. Biochem. J. 156, 435–44. 89. Nicholls, D.G. (1985) A role for the mitochondrion in the protection of cells against calcium overload? Progr. Brain Res. 63, 97–106. 90. Gunter, T.E., Gunter, K.K., Sheu, S.S., and Gavin, C.E. (1994) Mitochondrial calcium transport: physiological and pathological relevance. Am. J. Physiol. 267, C313–39. 91. Werth, J.L., and Thayer, S.A. (1994) Mitochondria buffer physiological calcium loads in cultured rat dorsal root ganglion neurons. J. Neurosci. 14, 348–56. 92. Boveris, A., and Chance, B. (1973) The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem. J. 134, 707– 16. 93. Cadenas, E., Boveris, A., Ragan, C.I., and Stoppani, A.O. (1977) Production of superoxide radicals and hydrogen peroxide by NADH-ubiquinone reductase and
154
94.
95.
96.
97. 98.
99.
100.
101.
102.
103. 104.
105.
106.
107. 108. 109.
Han et al. ubiquinol-cytochrome c reductase from beef-heart mitochondria. Arch. Biochem. Biophys. 180, 248–57. Cadenas, E., and Boveris, A. (1980) Enhancement of hydrogen peroxide formation by protophores and ionophores in antimycin-supplemented mitochondria. Biochem. J. 188, 31–7. Castilho, R.F., Kowaltowski, A.J., Meinicke, A.R., Bechara, E.J., and Vercesi, A.E. (1995) Permeabilization of the inner mitochondrial membrane by Ca 2⫹ ions is stimulated by t-butyl hydroperoxide and mediated by reactive oxygen species generated by mitochondria. Free Radic. Biol. Med. 18, 479–86. Wang, G.J., and Thayer, S.A. (1996) Sequestration of glutamate-induced Ca 2⫹ loads by mitochondria in cultured rat hippocampal neurons. J. Neurophysiol. 76, 1611– 21. Gunter, K.K., and Gunter, T.E. (1994) Transport of calcium by mitochondria. J. Bioenerg. Biomembr. 26, 471–85. Bernardi, P., Broekemeier, K.M., and Pfeiffer, D.R. (1994) Recent progress on regulation of the mitochondrial permeability transition pore; a cyclosporin-sensitive pore in the inner mitochondrial membrane. J. Bioenerg. Biomembr. 26, 509–17. Wang, G.J., Randall, R.D., and Thayer, S.A. (1994) Glutamate-induced intracellular acidification of cultured hippocampal neurons demonstrates altered energy metabolism resulting from Ca 2⫹ loads. J. Neurophysiol. 72, 2563–9. White, R.J., and Reynolds, I.J. (1997) Mitochondria accumulate Ca 2⫹ following intense glutamate stimulation of cultured rat forebrain neurons. J. Physiol. (Lond) 498, 31–47. Schinder, A.F., Olson, E.C., Spitzer, N.C., and Montal, M. (1996) Mitochondrial dysfunction is a primary event in glutamate neurotoxicity. J. Neurosci. 16, 6125– 33. Kiedrowski, L., and Costa, E. (1995) Glutamate-induced destabilization of intracellular calcium concentration homeostasis in cultured cerebellar granule cells: role of mitochondria in calcium buffering. Mol. Pharmacol. 47, 140–7. Hartley, Z., and Dubinsky, J.M. (1993) Changes in intracellular pH associated with glutamate excitotoxicity. J. Neurosci. 13, 4690–9. White, R.J., and Reynolds, I.J. (1996) Mitochondrial depolarization in glutamatestimulated neurons: an early signal specific to excitotoxin exposure. J. Neurosci. 16, 5688–97. Dessi, F., Ben-Ari, Y., and Charriaut-Marlangue, C. (1995) Ruthenium red protects against glutamate-induced neuronal death in cerebellar culture. Neurosci. Lett. 201, 53–6. Budd, S.L., Castilho, R.F., and Nicholls, D.G. (1997) Mitochondrial membrane potential and hydroethidine-monitored superoxide generation in cultured cerebellar granule cells. FEBS Lett. 415, 21–4. Nicholls, D.G., and Budd, S.L. (1998) Mitochondria and neuronal glutamate excitotoxicity. Biochim. Biophys. Acta 1366, 97–112. Bettler, B., and Mulle, C. (1995) Review: neurotransmitter receptors. II. AMPA and kainate receptors. Neuropharmacology 34, 123–39. Lerma, J., Morales, M., Vicente, M.A., and Herreras, O. (1997) Glutamate receptors of the kainate type and synaptic transmission. Trends Neurosci. 20, 9–12.
Oxidative Stress in Glutamate Neurotoxicity
155
110. Hoyt, K.R., Stout, A.K., Cardman, J.M., and Reynolds, I.J. (1998) The role of intracellular Na⫹ and mitochondria in buffering of kainate-induced intracellular free Ca 2⫹ changes in rat forebrain neurones. J. Physiol. (Lond) 509, 103–16. 111. Kato, K., Puttfarcken, P.S., Lyons, W.E., and Coyle, J.T. (1991) Developmental time course and ionic dependence of kainate-mediated toxicity in rat cerebellar granule cell cultures. J. Pharmacol. Exp. Ther. 256, 402–11. 112. Rothman, S.M., Thurston, J.H., and Hauhart, R.E. (1987) Delayed neurotoxicity of excitatory amino acids in vitro. Neuroscience 22, 471–80. 113. Garthwaite, G., and Garthwaite, J. (1986) Amino acid neurotoxicity: intracellular sites of calcium accumulation associated with the onset of irreversible damage to rat cerebellar neurones in vitro. Neurosci. Lett. 71, 53–8. 114. Bondy, S.C., and Lee, D.K. (1993) Oxidative stress induced by glutamate receptor agonists. Brain Res. 610, 229–33. 115. Chow, H.S., Lynch, J.J. III, Rose, K., and Choi, D.W. (1994) Trolox attenuates cortical neuronal injury induced by iron, ultraviolet light, glucose deprivation, or AMPA. Brain Res. 639, 102–8. 116. Puttfarcken, P.S., Lyons, W.E., and Coyle, J.T. (1992) Dissociation of nitric oxide generation and kainate-mediated neuronal degeneration in primary cultures of rat cerebellar granule cells. Neuropharmacology 31, 565–75. 117. Bannai, S. (1986) Exchange of cystine and glutamate across plasma membrane of human fibroblasts. J. Biol. Chem. 261, 2256–63. 118. Jurma, O.P., Hom, D.G., and Andersen, J.K. (1997) Decreased glutathione results in calcium-mediated cell death in PC12. Free Radic. Biol. Med. 23, 1055–66. 119. Li, Y., Maher, P., and Schubert, D. (1997) A role for 12-lipoxygenase in nerve cell death caused by glutathione depletion. Neuron 19, 453–63. 120. Han, D., Sen, C.K., Roy, S., Kobayashi, M.S., Tritschler, H.J., and Packer, L. (1997) Protection against glutamate-induced cytotoxicity in C6 glial cells by thiol antioxidants. Am. J. Physiol. 273, R1771–8. 121. Han, D. (1998) Unpublished results. 122. Han, D., Handelman, G., Marcocci, L., Sen, C.K., Roy, S., Kobuchi, H., Tritschler, H.J., Flohe, L., and Packer, L. (1997) Lipoic acid increases de novo synthesis of cellular glutathione by improving cystine utilization. Biofactors 6, 321–38. 123. Kobayashi, M.S., Han, D., and Packer, L. (1999) Antioxidants and herbal extracts protect HT-4 neuronal cells against glutamate-induced cytotoxicity. Free Rad. Res. (in press). 124. Flohe, L., Gunzler, W.A., and Ladenstein, R. (1976) Glutathione peroxidase. In: Glutathione: Metabolism and Function (I.M. Arias and W.B. Jakoby, eds.), Raven Press, New York. 125. Ketterer, B., Meyer, D.J., Coles, B., Taylor, J.B., and Pemble, S. (1986) Glutathione transferases and carcinogenesis. Basic Life Sci. 39, 103–26. 126. Ursini, F., Maiorino, M., Brigelius-Flohe, R., Aumann, K.D., Roveri, A., Schomburg, D., and Flohe, L. (1995) Diversity of glutathione peroxidases. Meth. Enzymol 252, 38–53. 127. Murphy, T.H., Malouf, A.T., Sastre, A., Schnaar, R.L., and Coyle, J.T. (1988) Calcium-dependent glutamate cytotoxicity in a neuronal cell line. Brain Res. 444, 325– 32.
156
Han et al.
128. Gardner, P.R., and Fridovich, I. (1992) Inactivation-reactivation of aconitase in Escherichia coli. A sensitive measure of superoxide radical. J. Biol. Chem. 267, 8757–63. 129. Gardner, P.R., and White, C.W. (1995) Application of the aconitase method to the assay of superoxide in the mitochondria matrices of cultured cells: effects of oxygen, redox-cycling agents, TNF-α. IL-1, LPS and inhibitors of respiration. In: The Oxygen Paradox (K.J.A. Davies and F. Ursini, ed.), Cleup University Press, Padova. 130. Fridovich, I. (1997) Superoxide anion radical (O2⫺⋅), superoxide dismutases, and related matters. J. Biol. Chem. 272, 18515–7. 131. Castro, L., Rodriguez, M., and Radi, R. (1994) Aconitase is readily inactivated by peroxynitrite, but not by its precursor, nitric oxide. J. Biol. Chem. 269, 29409–15. 132. Benov, L., Sztejnberg, L., and Fridovich, I. (1998) Critical evaluation of the use of hydroethidine as a measure of superoxide anion radical. Free Radic. Biol. Med. 25, 826–31. 133. Royall, J.A., and Ischiropoulos, H. (1993) Evaluation of 2′,7′-dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H 2 O 2 in cultured endothelial cells. Arch. Biochem. Biophys. 302, 348–55. 134. Henderson, L.M., and Chappell, J.B. (1993) Dihydrorhodamine 123: a fluorescent probe for superoxide generation? Eur. J. Biochem. 217, 973–80. 135. O’Connor, J.E., Vargas, J.L., Kimler, B.F., Hernandez-Yago, J., and Grisolia, S. (1988) Use of rhodamine 123 to investigate alterations in mitochondrial activity in isolated mouse liver mitochondria. Biochem. Biophys. Res. Commun. 151, 568– 73. 136. Emaus, R.K., Grunwald, R., and Lemasters, J.J. (1986) Rhodamine 123 as a probe of transmembrane potential in isolated rat-liver mitochondria: spectral and metabolic properties. Biochim. Biophys. Acta 850, 436–48. 137. Zhu, H., Bannenberg, G.L., Moldeus, P., and Shertzer, H.G. (1994) Oxidation pathways for the intracellular probe 2′,7′-dichlorofluorescein. Arch. Toxicol. 68, 582– 7. 138. Cathcart, R., Schwiers, E., and Ames, B.N. (1983) Detection of picomole levels of hydroperoxides using a fluorescent dichlorofluorescein assay. Anal. Biochem. 134, 111–6. 139. Kooy, N.W., Royall, J.A., and Ischiropoulos, H. (1997) Oxidation of 2′,7′-dichlorofluorescein by peroxynitrite. Free Radic. Res. 27, 245–54.
7 Modulation of Glutamate Release and Toxicity by Nitric Oxide C. M. Carvalho, S. M. Sequeira, C. B. Duarte, and Arse´lio P. Carvalho University of Coimbra, Coimbra, Portugal
I. INTRODUCTION Glutamate is the major excitatory neurotransmitter in the central nervous system and, like other neurotransmitters, interacts with specific receptors that are of two major types: ionotropic receptors and metabotropic receptors (1,2). The ionotropic receptors have been classified based on their pharmacological and physiological properties as N-methyl-d-aspartate (NMDA), kainate, and α-amino-3hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptors. Activation of the NMDA receptors leads to influx of large quantities of Ca2⫹ and Na⫹, which normally serve as the physiological trigger signal leading to cell depolarization, but under overstimulation of the NMDA receptor inappropriately high concentrations of Ca2⫹ are reached intracellularly leading to interference with mitochondrial function and overactivation of Ca2⫹-dependent cellular enzymes [reviewed in Refs. 2 and 3], including nitric oxide synthase (NOS) in nerve cells containing this enzyme, which causes increased production of NO (4,5). Thus, the toxicity of glutamate is explained to a great extent in terms of the overload of Ca2⫹ it produces in the cell and the consequences of that overload (6). The targets and mechanisms of the toxic effects of NO may include DNA damage and irreversible protein modifications. Thus, NO reacts with cellular thiols, metals, or with superoxide (O2⫺•), and the products of these reactions may alter various biological functions (5,7–9). In particular, peroxynitrite (ONOO⫺), formed in the reaction of NO with O2⫺•, has been implicated in neuronal cell apoptosis (10–13).
157
158
Carvalho et al.
More recently, it turned out that increases in NO, which account for some of the toxicity of glutamate, may also protect the cells against NMDA-mediated toxicity (7,14,15) and may modulate the release of glutamate by the presynaptic cells (16,17). Thus, a new notion for the actions of NO in nerve cells has emerged that involves presynaptic actions of NO on the neurotransmitter release mechanisms. Thus, NO is known to stimulate the release of glutamate either by exocytosis from synaptic vesicles, probably by S-nitrosylation of proteins responsible for the fusion of the neurosecretory vesicle membrane with the plasma membrane (18), or by Ca2⫹-independent mechanisms, which probably involve reversal of the glutamate carrier (17,19). In this chapter, we will bring together the evidence that NO may either inhibit or enhance the presynaptic release of glutamate, thereby modulating synaptic activity, such as long-term potentiation (20,21) and also the toxic effect of glutamate (3,16).
II. NITRIC OXIDE, GLUTAMATE RELEASE, AND SYNAPTIC PLASTICITY Nitric oxide has been implicated in regulating the release of glutamate during long-term potentiation (LTP) in the hippocampus, and long-term depression (LTD) in the cerebellum, which are forms of synaptic plasticity (for a review, see Ref. 9). LTP occurs at synapses that use glutamate as a neurotransmitter, which increases the influx of Ca2⫹ through the postsynaptic NMDA receptor channels, as shown, for instance, in the CA1 region of the hippocampus (22). There is compelling evidence that both the glutamate NMDA receptors and Ca2⫹ are involved in LTP, since NMDA receptor antagonists block LTP with minimal effect on basal synaptic transmission (23), and synaptic activation of NMDA receptors causes accumulation of Ca2⫹ within dendritic spines (24). Nitric oxide increases the frequency of spontaneous excitatory postsynaptic potentials (25,26). Furthermore, exposure of hippocampal slices to NMDA, or tetanic stimulation of the Schaffer collateral fibers, leads to NO formation (27). Thus, NO, a freely diffusible gas generated as a result of Ca2⫹ influx associated with the postsynaptic NMDA receptor activation, is a good candidate for a retrograde messenger that would modulate LTP by controlling the presynaptic release of glutamate (28,29). The notion is that in this particular system NO is produced in the pyramidal cells and migrates to the presynaptic cell to stimulate the release of glutamate from the Schaffer collaterals. This role of NO is supported by the observation that inhibitors of NOS directly injected into the CA1 pyramidal cells, or hemoglobin, which binds extracellular NO, block LTP (9,30). Furthermore, hippocampal LTP in the CA1 region is markedly reduced in a knockout mouse strain that lacks both neuronal and endothelial NO synthase (nNOS/eNOS-null mice) (31).
Glutamate Release and Nitric Oxide
159
Thus, in LTP, glutamate activation of the NMDA receptor, and the subsequent influx of Ca2⫹, leads to activation of NOS and NO production in the postsynaptic cell. NO then diffuses to the presynaptic terminal where it enhances glutamate release thereby potentiating neurotransmission. In isolated nerve terminals, i.e., synaptosomes, it has been shown by various laboratories that NO donors either decrease (17,32,33) or increase (17–19,34) the release of glutamate, depending on the concentration of NO attained (17,35). Nitric oxide has also been proposed to participate in cerebellar long-term depression, which is a sustained attenuation of the parallel fiber–Purkinje neuron synapse, evoked by coactivation of parallel fibers and climbing fibers (36). These synapses are enriched in AMPA receptors, and their desensitization by phosphorylation is likely to cause LTD (37). In this model of synaptic plasticity, NO produced by neighboring cells (38) is thought to activate the soluble guanylate cyclase of Purkinje neurons (39,40), generating cGMP which is known to activate a cGMP-dependent protein kinase (PKG). One of the PKG substrates is the G substrate, a potent inhibitor of phosphatases, which may therefore prevent the dephosphorylation of AMPA receptors of Purkinje neurons, phosphorylated by protein kinase C (39).
III.
MODULATION OF NEURONAL GLUTAMATE TOXICITY BY NITRIC OXIDE
There is substantial evidence that ischemia in the brain causes excess release of glutamate, which then overstimulates the glutamate receptors, and it appears that it is the excess of glutamate, acting via NMDA receptors, that kills the cells (41,42), although in cultured retinal cells and in cultured neocortical neurons overactivation of the AMPA receptors is also associated with cell death (43–46). The activation of the glutamate receptors by excess glutamate causes excess entry of Ca2⫹, which is necessary for glutamate toxicity (43–45,47). The increased intracellular Ca2⫹ may induce neurotoxicity by activating several pathways leading to oxidative stress. Thus, glutamate increases the formation of reactive oxygen species (ROS) (48), including NO (49), as a consequence of activating the Ca2⫹-dependent neuronal nitric oxide synthase (nNOS) (13,50), which plays an important role in developing NMDA-mediated neurotoxicity, since treatment of cortical cultures with NOS inhibitors, or removal of the NOS substrate l-arginine, protects the cells against NMDA neurotoxicity (13). Other evidence that NO mediates glutamate toxicity comes from observations that reduced hemoglobin, or NO scavengers, reduce glutamate toxicity (15), and that in nNOS-null mice neuronal cells are also relatively resistant to toxicity produced either by glutamate or by oxygen-glucose deprivation (5). It is interesting that recently it was shown that the expression of nNOS is increased by neurotrophins
160
Carvalho et al.
in cortical neuronal cultures and that this renders neurons more sensitive to NMDA neurotoxicity (15). It should be noted that only 1–2% of the total neuronal population in the cortex and striatum contain the enzyme nNOS (4). However, NO produced in the nNOS neurons diffuses to adjacent neurons and may affect their survival (13). It has been calculated that NO can diffuse as far as 300 µm from where it is produced, which would encompass about 2 million synapses (52). Although NO by itself is relatively untoxic, it reacts with O2⫺• to generate ONOO⫺, which is very toxic (53), and in vitro the rate of this reaction is three times faster than the rate of the reaction catalyzed by superoxide dismutase (SOD), which dismutates O2⫺• to H2O2. The anion ONOO⫺, which is highly reactive, nitrates and hydroxylates aromatic rings on amino acid residues, and is a strong oxidant that reacts with sulfhydryls, zinc-thioate moities, lipids, proteins, and DNA (53). It has been shown that certain neurons expressing the nNOS are resistant to NMDA neurotoxicity, and this is also observed in neuronal diseases, such as Alzheimer’s, or in situations of ischemia (54), in spite of the fact that these neurons have glutamate receptors (55,56). The explanation for this resistance to neurotoxicity of the very neurons that produce NO came about recently, using an NO-resistant PC12 cell line, which permitted determining that the presence of high levels of manganese-SOD (MnSOD) in these cells accounts for the resistance of the nNOS-containing cells to NMDA- and NO-induced toxicity (57). In primary cortical cultures, the MnSOD is colocalized with nNOS in the neurons and, thus, the MnSOD is strategically localized to protect the NO-producing cells against the toxic effect of NO. Furthermore, nNOS-containing neurons from mice lacking the gene for MnSOD are very sensitive to the toxic effects of NMDA and NO (29,57). The protection offered by MnSOD is highly selective against NMDA and NO toxicity, and offers no protection against the toxic effects of kainate or quisqualate, and overexpression of MnSOD renders PC12 cells three times more resistant to NO-induced toxicity vs. O2⫺•-mediated toxicity. Apparently, NO-producing nerve cells (nNOS neurons) with high MnSOD are able to scavenge the excess O2⫺• produced by their mitochondria under excessive stimulation of the glutamate NMDA receptors, and this prevents the formation of ONOO⫺ (O2⫺• ⫹ NO → ONOO⫺) in these cells. However, excess NO will diffuse into the neighboring cells lacking the nNOS, where ONOO⫺ will be preferentially formed and cause damage. Several possible molecular mechanisms of NO toxicity have been advanced. First, NO is an activator of guanylate cyclase (GC), and the increase in cGMP mediates several physiological effects of NO, including the effect of NO on the exocytosis of glutamate (17,18,33); however, cGMP is not involved in NO-induced neurotoxicity (15,58), and it may actually be neuroprotective (59). The NO/ONOO⫺ causes damage in DNA followed by activation of poly(ADPribose) polymerase (PARP) involved in DNA repair (60). The addition of ADP-
Glutamate Release and Nitric Oxide
161
ribose to nuclear proteins by PARP, however, consumes NAD and, consequently, ATP is utilized to regenerate NAD. Four ATP energy equivalents are necessary to regenerate each mole of NAD, which causes rapid depletion of the cellular energy stores (60,61). The involvement of PARP in NO-mediated neurotoxicity has been confirmed by studies in cortical cultures of PARP-null mice, which are resistant to NMDA and oxygen/glucose deprivation–induced neurotoxicity (62). On the other hand, NO may also regulate the activity of the NMDA receptor, which would explain the neuroprotective action reported by several authors (7,14,50,58,63–65). It has been shown that NO donors reversibly block wholecell NMDA currents due to both a decrease in the opening probability of single channels and a decrease in their unitary conductance, without the participation of cGMP (14). Interestingly, NO does not modify the activity of AMPA or kainate receptors, the other ionotropic glutamate receptors of cortical neurons (63). The inhibitory effect of NO on the whole-cell NMDA currents is not additive with the inhibitory effects of Mg2⫹ or Zn2⫹, suggesting that both divalent cations and NO act on common sites on the receptor–channel complex (14). Contradictory results have been reported for a direct effect of NO on the NMDA receptor, which would be exerted through chemical oxidation of thiol residues in the NMDA receptor (7). Downregulation of the NMDA receptor activity by NO would be neuroprotective by reducing the effect of glutamate on the Ca2⫹ influx. Thus, it appears that NO may be both neurotoxic and neuroprotective. These contradictory roles of NO may be due to different oxidized states of NO, which may exist as NO•, NO⫹, and NO⫺, depending on the redox state of the media. Lipton et al. (7) have suggested that NO• is neurotoxic, at least in part, by reacting with superoxide anion (O2⫺•), leading to the formation of peroxynitrite (ONOO⫺). In contrast, NO⫹ would be neuroprotective by downregulation of the NMDA receptor activity by reaction with thiol groups of the receptor’s redox modulatory site. However, Fagni and Bockaert (64) proposed that NO•, but not NO⫹, can form metal–nitrosyl complexes that may block the NMDA channels. Furthermore, the reaction of NO with critical cysteine sulfydryl groups (Snitrosylation) of the caspase-3-like proteases has been shown to suppress their activity in a number of cell types, including cerebrocortical neurons (66). Caspases play an important role in the apoptosis signaling cascade and, therefore, inhibition of caspase-3-like activity is likely to rescue the cells from a suicidal cell death upon overstimulation of glutamate receptors (66). Similar results were recently reported in hepatocytes where the protective effect of NO against apoptotic cell death, induced by removal of growth factors or exposure to tumor necrosis factor–α(TNF-α) or Anti-Fas antibody, were also partly attributed to a cGMPdependent mechanism, acting at the level of caspase-3-like protease activation or upstream of this event to prevent the activation of the protease (67). The NO donor, S-nitroso-N-acetylpenicillamine (SNAP), also inhibits TNF-α-induced en-
162
Carvalho et al.
dothelial cell apoptosis, in part through the cGMP pathway (68). It remains to be determined as to whether the latter pathway plays any role in protecting neurons against apoptosis. The neurotoxic vs. neuroprotective effects of NO in neurons may also depend on the local concentration of NO achieved. For example, in a model of NO-stimulated autocrine excitotoxicity, the cerebellar granule cell cultures, the morphological and biochemical features of neuronal cell death were found to be affected by the concentration of NO donors or ONOO⫺ used (10,16,69). In this model, low concentrations of NO donors cause cell death by apoptosis, which could be inhibited by NMDA receptor antagonists and by caspase inhibitors. The NMDA receptors are also involved in neuronal cell death caused by higher concentrations of NO donors, but in this case caspase inhibitors were without effect on cell death. Strong insults, caused by high ONOO⫺ concentrations, induce a rapid granule cell death by necrosis, contrasting with the effect of low levels of peroxynitrite, characterized by apoptotic features (10).
IV.
ROLE OF GLIA IN NITRIC OXIDE–INDUCED NEUROTOXICITY
Until very recently, glial cells and their function at the active synapse have been underestimated as having a passive supporting role for neurons. However, it is now becoming clear that glial cells establish an active signaling and metabolic system with neuronal cells, in which they play an important regulatory role. Glial cells not only physically support neurons (70) but release neurotrophic factors that promote neuronal growth and differentiation, and scavenge several agents from the synaptic cleft, otherwise toxic to neurons, such as glutamate and calcium (70). Along with their neuroprotective role in the brain, inflammatory responses of glial cells occur under conditions of disease, infection, and ischemia, which cause severe damage to neurons (71) due to the release of proinflammatory cytokines and to the synthesis and massive release of NO. Glial cells contain large amounts of l-arginine, the substrate for NOS (72), and although the constitutive isoform eNOS has been identified in astroglial cells (73), it appears that the primary source of NO is the Ca2⫹-independent, inducible NOS (74–77) whose expression is activated by a variety of stimuli (76,78–82). Other studies have suggested that ATP and glutamate may have an important role in the interaction between neurons and glia, and both neurotransmitters are potential iNOS regulators at the transcriptional level in astrocytes (81). Accordingly, when extracellular ATP and glutamate levels rise dramatically upon acute neuronal injury, astrocytes would respond to the injury by suppressing iNOS synthesis and the release of neurotoxic NO. Calcium has been suggested to have a similar role (83), and other neurotransmitters, such as NE, can act as
Glutamate Release and Nitric Oxide
163
endogenous suppressors of brain inflammation (82). It has been shown that NO produced by astrocytes inhibits cellular respiration (84) and therefore ATP-dependent cell functions in the astrocytes and surrounding cells. It is interesting that glial cells appear to be resistant to the potentially neurotoxic effects of the NO they synthesize, in comparison to the more vulnerable neurons (84). A possible explanation is that glial cells can rely on efficient glycolysis to maintain ATP levels in conditions of suppressed mitochondrial respiration (77). The data therefore suggest that the inducible NO production in glia in response to certain stimuli functions as a specific toxin toward neurons. Induction of iNOS did not cause neuronal death in mixed astrocytic-neuronal cocultures but displayed increased sensitivity to glutamate receptor activation (85,86). However, Dawson et al. (54) and Chao et al. (87) found that iNOS expression can cause neuronal cell death 24–36 h after exposure in astrocytic-neuronal cocultures, following neuronal loss of ATP. It has recently been reported that AMPA receptors in cerebellar astroglial cells stimulate NO formation and increase cGMP levels (88), although the functional role of this pathway remains to be clarified.
V.
MODULATION OF PRESYNAPTIC GLUTAMATE RELEASE BY NITRIC OXIDE
In Sec. III we reviewed the evidence showing that glutamate toxicity is mediated by NMDA glutamate receptors which, when activated, lead to Ca2⫹ entry which, in turn, activates the production of NO by NOS. Thus, it is the increase in NO concentration in the cell that would be responsible for many of the toxic effects of glutamate (6). On the other hand, recent observations also show that NO donors and peroxynitrite (ONOO⫺) stimulate a sustained increase of [Ca2⫹]i in cerebellar granule cells, which can be prevented by inhibitors of NMDA receptors, such as MK-801, suggesting that NO and ONOO⫺ causes the release of glutamate (16), which then activates its receptors postsynaptically. In these studies, Leist et al. (16) showed that both the intracellular Ca2⫹ increase and apoptosis elicited by ONOO⫺ or the NO donors were prevented by blocking exocytosis with tetanus toxin or botulinum neurotoxin C. These studies suggest that NO toxicity may also be based on its presynaptic actions. In fact, it is known that NO stimulates neurotransmitter release (17,34,35,89–91). Furthermore, Meffert et al. (18) produced evidence showing an increase in docking/fusion of synaptic vesicles in synaptosomes by NO donors, which was abolished by the Clostridium neurotoxins. This would imply that, to some extent, similar mechanisms underly the physiological and the toxic action of NO in neurons in that NO would affect neurotransmitter release by controlling S-nitrosylation of fusion proteins, and whether normal cell communi-
164
Carvalho et al.
cation or toxicity occurs would depend on the intensity of the insult (16). Actually, this is similar to what occurs in ischemia and other pathological conditions in which unbalanced release of glutamate contributes significantly to toxicity, since antagonists of the NMDA receptors are neuroprotective (43,45,92,93). Although ONOO⫺ has been considered a terminal mediator of toxicity, compared to the less reactive NO, these studies indicate that direct exposure of neurons to ONOO⫺ does not result in immediate lethal events and that ONOO⫺, under some conditions, may act by an indirect but specific mechanism in which it stimulates the exocytotic release of glutamate. Thus, ONOO⫺ is capable of recruiting a physiological pathway to initiate damage of neurons exposed to increasing concentrations of NO, and the threshold between fine modulation of neuronal responses in which NO would have a physiological function in stimulating neurosecretion (18) and that for neuronal injury may be decided by the relative concentrations of NO and ONOO⫺. Pathological situations may bring about inbalances in NO production and in the release and uptake of glutamate, which would cause neurodegeneration. In this respect, NO has been shown to inhibit [3H]glutamate transport in striatal synaptosomes (94), and other studies showed that NO donors (nitroprusside, SNP; S-nitrosoacetylpenicillamine, SNAP) inhibit [3H]glutamate uptake by hippocampal synaptosomes from rat brain due to changes in both Km and Vmax of the uptake. The effect of NO donors on glutamate uptake could be reduced by hemoglobin, which binds NO, suggesting that the effects are due to NO (95) or to products of NO metabolism. In fact, studies carried out using reconstituted glutamate transporters revealed that ONOO⫺ inhibits the Vmax of the transport, whereas NO donors failed to significantly modify reconstituted glutamate uptake (96). Therefore, the effects of NO and of NO donors on glutamate uptake in synaptosomes (94,95) are likely to be due to ONOO⫺ formed in the reaction of NO with superoxide. The recombinant rat brain glutamate transporters GLT1, GLAST, and EAAC1 are equally sensitive to ONOO⫺ (96). The observed inhibition by NO/ONOO⫺ of glutamate reuptake may represent a novel type of transsynaptic retrograde regulation of glutamate transport, involved in the toxic effects of NO and of glutamate, and in more physiological functions, such as long-term potentiation.
VI.
MECHANISMS UNDERLYING THE EFFECTS OF NITRIC OXIDE ON PRESYNAPTIC GLUTAMATE RELEASE
Although there is clear evidence that NO interferes with the process of glutamate release, it is difficult to compare the results from various laboratories which report that NO can either enhance (17,19,34) or inhibit glutamate release (17,32,33), and consensus is still lacking as to whether NO-stimulated glutamate release is
Glutamate Release and Nitric Oxide
165
strictly Ca2⫹-dependent, or whether NO also affects the Ca2⫹-independent release mediated by the glutamate carrier. In fact, glutamate can be released from isolated presynaptic nerve terminals by two distinct mechanisms (97,98): by the Ca2⫹-dependent vesicular release (exocytotic) that occurs in normal physiological conditions subsequent to a rise in [Ca2⫹]i, and by the Ca2⫹-independent release from the cytoplasm that occurs by reversal of Na⫹-glutamate cotransport pathway of the plasma membrane. This latter component may be predominant in pathological conditions, such as due to inhibition of mitochondrial respiration during hypoxia/anoxia, or due to direct inhibition of the respiratory chain, leading to ATP depletion (17,34,99). Thus, it is of great importance to clearly show the differences between the effects of NO on either Ca2⫹-dependent and/or Ca2⫹-independent glutamate release mechanisms. Another important aspect to take into consideration is that there are fast and slow components of Ca2⫹-dependent release of glutamate in nerve terminals (100) that may be differentially affected by presynaptic modulation by NO. These components of release apparently correspond to two different populations of synaptic vesicles: a ready fusion pool of vesicles docked to the plasma membrane, and a reserve pool of vesicles attached to cytoskeleton elements but distal to the plasma membrane (101). Consequently, the type of techniques used to follow glutamate release are determinant in accessing different phases of glutamate release and in determining the effect of NO on this release. There are essentially three methodologies that have been utilized: (1) the direct measurement of endogenous glutamate release, using a continuous fluorimetric detection assay (97); (2) superfusion of synaptosomes, followed by determination of glutamate in the superfusate (34); and (3) a fluorescence method, using the dye FM1-43 to label a recycling heterogeneous population of synaptic vesicles (102). It turns out that different results of the effect of NO on glutamate release have been obtained with the different techniques, and we will now review the data obtained in our and other laboratories, especially referring to the cellular mechanisms that have been recognized to be involved on the effects of NO in the presynaptic glutamate release. The results obtained with hippocampal synaptosomes to determine the effects of increasing concentrations of NO, originating either from NO donors or from activation of the endogenous NO synthase, on the Ca2⫹-dependent release of glutamate due to 4-aminopyridine (4-AP) depolarization showed that low concentrations of NO inhibit the Ca2⫹-dependent release of glutamate, whereas higher concentrations of NO promote Ca2⫹-independent glutamate release, via the reversal of the glutamate carrier (17,103). These differential effects of NO, at low or high concentrations, were found to be related to an increase in cGMP content and to a decrease in the ATP/ADP levels of the preparation, respectively (17). These results are in agreement with the results of Sistiaga et al. (33), who
166
Carvalho et al.
also show an inhibition of exocytosis of glutamate in cerebrocortical synaptosomes, which is correlated with elevation of cGMP levels and is not related to inhibition of Ca2⫹ entry through Ca2⫹ channels. In this study (33) it is also shown that the slow phase component of the exocytotic glutamate release, occurring within 5 min after depolarization, is the most affected by cGMP or NO donors, thus indicating that NO is affecting the mobilization of synaptic vesicles from a reserve pool to the release site (33,100). On the other hand, an increase in the Ca2⫹-independent vesicular release of neurotransmitter caused by NO donors has been reported in hippocampal synaptosomes (18,34), in studies using the FM1-43 dye to follow the release of neurotransmitters with high time resolution (102). However, using the same NO donors, SNP or SNAP, or hydroxylamine up to 300 µM, which are conditions known to increase the cGMP levels, we and others (17,33) have reported an inhibition of the depolarization-evoked Ca2⫹-dependent release of endogenous glutamate; only at higher concentrations of the NO donors do we obtain a massive Ca2⫹-independent release of glutamate (17) or GABA (104) in hippocampal synaptosomes. For these high NO concentrations, there is an extensive energy depletion, as measured by the ATP/ADP ratio in the synaptosomal preparation. Similar results were reported more recently by McNaught and Brown (19). These effects obtained at the higher [NO] are compatible with a direct inhibition by NO of mitochondrial function, as shown by various groups (17,19,99,105), which would subsequently cause unloading of the neurotransmitters by the synaptic vesicles into the cytoplasm. Also, a recent study shows that NO causes vesicular release of glutamate into the cytoplasm by directly inhibiting the vesicular transport system (106). As for the origin of the increased release of endogenous glutamate from synaptosomes in a Ca2⫹-independent manner, obtained at the high [NO], it was observed that glutamate release was blocked by l-trans-PDC (l-trans-2,4-pyrrolidine dicarboxylate), a glutamate carrier blocker, when it was preloaded into the synaptosomes (17). Thus, the Ca2⫹-independent release reported in this work represents mostly glutamate release by reversal of the glutamate carrier. This mechanism is favored in conditions that produce increased glutamate in the cytosol, such as energy depletion of the cell which favors vesicular unloading, or direct inhibition by NO of the vesicle glutamate transport, which has also been reported (106). The energy depletion also favors membrane depolarization and reversal of the glutamate transporter at the synapse. An important issue is whether the data obtained from the synaptosomal preparation using the NO donors apply to situations in which endogenous production of NO is obtained by activation of the endogenous NOS. When the synaptosomal NOS was stimulated by increasing the concentration of the substrate, l-arginine, and by adding cofactors for the enzyme, there was a significant inhibition of the Ca2⫹-dependent release of glutamate evoked by 4-aminopyridine and
Glutamate Release and Nitric Oxide
167
a small increase in the basal release, and both effects were reversed by l-NOArg (17), an inhibitor of NOS that does not inhibit l-arginine transport (107). Furthermore, it was shown that stimulation of NOS activity in isolated nerve terminals increases the levels of cGMP by activating soluble guanylate cyclase, and that this increase in cGMP is related to the observed decrease in the glutamate release evoked by 4-aminopyridine (17). The subcellular localization of the NOS activity in synaptosomal preparations is not clearly established, but it has been accepted that the nNOS is essentially localized in the soluble fraction (28,107). However, a recent study shows that rat liver submitochondrial particles are also a source of NO (108). Mitochondrial immunoreactivity with antibodies raised against eNOS has been detected in different preparations (109,110) and cross-reaction of mitochondria with nNOS antibodies has also been reported (111). This is in agreement with the observation that NOS activity in mitochondria is strictly Ca2⫹-dependent and the presence of NOS within the mitochondria may be important for its function (108,112). Based on the data available, we summarize in Figure 1 the possible neurotoxic and neuroprotective pathways of NO, and how NO modulates the release of glutamate in the nerve terminal. The effect on the exocytotic glutamate release at low NO levels is induced via the NO/cGMP pathway, and the increase in the carrier-mediated release, obtained in conditions of energy depletion, is primarily due to inhibition of the mitochondrial function. It is not yet clear as to how cGMP inhibits the exocytosis of glutamate, but at least part of the effect is exerted through protein phosphorylation since a partial reversal of the inhibitory effect of cGMP is obtained in the presence of the inhibitors of cGMP protein kinase G, H-8, or Rp-8-pCPT-cGMP (33,113). It should be stated that although the mechanism of mobilization of the reserve vesicles prior to exocytosis is not well clarified, it may involve phosphorylation of synapsin I catalyzed by the Ca2⫹ / calmodulin-dependent kinase II (114). However, the brain also contains protein kinase G substrates whose identities are not yet known (reviewed in Ref. 115). Very recently, evidence has been reported that in a particular brain region, the thalamus, there is NO/cGMP-dependent phosphorylation of proteins, particularly of the type II cGMP-dependent protein kinase itself, possibly as an initial step in regulating the activity of this kinase, which may be required for the phosphorylation of other target proteins (116).
VII. CONCLUSIONS In conclusion, NO originating from neurons or glial cells acts both presynaptically and postsynaptically in modulating the toxicity of glutamate. Presynaptically, NO either inhibits or stimulates the release of glutamate, and these effects are exerted through the exocytotic or the glutamate carrier mechanisms, respec-
168
Carvalho et al.
Figure 1 Possible presynaptic and postsynaptic mechanisms of action of NO to regulate glutamate release and toxicity. At the presynaptic level, low concentrations of NO (low [NO]) activate guanylate cyclase (GC) and a cGMP-dependent pathway, which may involve protein kinase G–dependent and independent effects on the exocytotic machinery, leading to the inhibition of the evoked glutamate release. This pathway of NO action confers neuroprotection to postsynaptic and surrounding neurons. High concentrations of NO (high [NO]) deplete the intrasynaptosomal ATP/ADP levels, due to inhibition of mitochondrial function, leading to unloading of glutamate from the vesicles into the cytosol and to an increase in the carrier-mediated release of glutamate. NO/ONOO⫺ may also inhibit the glutamate carrier leading also to extracellular accumulation of glutamate and to neurotoxicity. At the postsynaptic level, the released glutamate may interact with its postsynaptic receptors, namely, the NMDA receptor, which is responsible for Ca2⫹ entry and activation of the NOS, leading to NO production. In turn, NO can downregulate the NMDA receptor, and may also interfere with the caspase activity involved in the apoptosis signaling cascade, and all of these pathways can lead to neuroprotection. In appropriate conditions, NO can also react with superoxide radical to form peroxynitrite (ONOO⫺), which causes damage to neurons by acting on lipids, proteins, and DNA (through PARP). The effects of NO at the presynaptic level may be produced by locally generated NO, or may be due to NO that diffuses from the postsynaptic cell, as a retrograde messenger. Glial cells may also contribute to accentuate neurotoxicity in conditions that favor glial production of NO by iNOS in response to certain stimuli.
Glutamate Release and Nitric Oxide
169
tively. The selective effect of NO in inhibiting the exocytotic mechanism is observed at low NO concentrations and is mediated by cGMP. This pathway involves protein kinase G and the phosphorylation of unspecified proteins in the nerve terminals that may control exocytosis. At high NO concentrations, mitochondrial functions in the presynaptic terminal are affected and the ATP/ADP ratio is decreased. This causes the transfer of glutamate from the vesicles to the cytoplasm, with a consequent increase of glutamate in the cytoplasm. In parallel, the Na⫹ electrochemical gradient decreases and there is an increase in glutamate release through reversal of the glutamate carrier. It seems that NO may also inhibit the glutamate carrier, so that the overall effect is a balance between the various effects of NO. Postsynaptically, the glutamate released activates the NMDA receptor, increasing the intracellular Ca2⫹ concentration, which activates the NOS. Consequently, the increased NO production in the postsynaptic cell may become toxic by reacting with superoxide radical to produce peroxynitrite, which may cause damage to proteins and DNA. However, NO may be neuroprotective by downregulating the NMDA receptor and by inhibiting the caspases. NO produced postsynaptically also diffuses into other cells, including the presynaptic cell, thus acting as a retrograde messenger.
REFERENCES 1. Hollmann, M., and Heinmann, S. (1994). Cloned glutamate receptors. Annu. Rev. Neurosci. 17, 31–108. 2. Michaelis, E.K. (1998). Molecular biology of glutamate receptors in the central nervous system and their role in excitotoxicity, oxidative stress and aging. Progr. Neurobiol. 54, 369–415. 3. Dawson, V.L., and Dawson, T.M. (1996). Free radicals and neuronal cell death. Cell Death Differ. 3, 71–78. 4. Dawson, T.M., Bredt, D.S., Fotuhi, M., Hwang, P.M., and Snyder, S.H. (1991). Nitric oxide synthase and neuronal NADPH diaphorase are identical in brain and peripheral tissues. Proc. Natl. Acad. Sci. USA 88, 7797–7801. 5. Zhang, J., and Snyder, S.H. (1995). Nitric oxide in the nervous system. Annu. Rev. Pharmacol. Toxicol. 35, 213–233. 6. Choi, D.W. (1995). Calcium: still centre-stage in hypoxic-ischemic neuronal death. Trends Neurosci. 18, 1558–1566. 7. Lipton, S.A., Choi, Y.-B, Pan, Z.H., Lei, S.Z., Chen, H.S.V., Sucher, N.J., Loscalzo, J., Singel, D.J., and Stamler, S.J. (1993). A redox-based mechanism for the neuroprotective and neurodegenerative effects of nitric oxide and related nitrosocompounds. Nature 364, 626–632. 8. Stamler, J.S. (1994). Redox signalling: nitrosylation and related target interactions of nitric oxide. Cell 78, 931–936.
170
Carvalho et al.
9. Garthwaite, J., and Boulton, C.L. (1995). Nitric oxide signalling in the central nervous system. Annu. Rev. Physiol. 57, 683–706. 10. Bonfoco, E., Krainc, D., Ankarcrona, M., Nicotera, P., and Lipton, S.A. (1995). Apoptosis and necrosis: two different events induced respectively by mild and intense insults with NMDA or nitric oxide/superoxide in cortical cell cultures. Proc. Natl. Acad. Sci, USA 92, 7162–7166. 11. Bonfoco, E., Leist, M., Zhivotovsky B., Orrenius, S., Lipton, S.A., and Nicotera, P. (1996). Cytoskeletal breakdown and apoptosis elicited by nitric oxide donors in cerebellar granule cells require NMDA receptor activation. J. Neurochem. 67, 2484–2493. 12. Este´vez, A.G., Radi, R., Barbeito, L., Shin, J.T., Thompson, J.A., and Beckman, J.S. (1995). Peroxynitrite-induced cytotoxicity in PC12 cells: evidence for an apoptotic mechanism differentially modulated by neurotrophic factors. J. Neurochem. 65, 1543–1550. 13. Dawson, V.L., Dawson, T.M., Bartley, D.A., Uhl, G.R., and Snyder, S.H. (1993). Mechanisms of nitric oxide mediated neurotoxicity in primary brain cultures. J. Neurosci. 13, 2651–2661. 14. Fagni, L., Olivier, M., Lafon-Cazal, M., and Bockaert, J. (1995). Involvement of divalent ions in the nitric oxide-induced blockade of N-methyl-d-aspartate receptors in cerebellar granule cells. Mol. Pharmacol. 47, 1239–1247. 15. Samdani, A., Newcamp, C., Resink, A., Facchinetti, F., Hoffman, B.E., Dawson, V.L., and Dawson, T.M. (1997). Differential susceptibility to neurotoxicity mediated by neurotrophins and neuronal nitric oxide synthase. J. Neurosci. 17, 4633– 4646. 16. Leist, M., Fava, E., Montecucco, C., and Nicotera, P. (1997). Peroxynitrite and nitric oxide donors induce neuronal apoptosis by eliciting autocrine excitotoxicity. Eur. J. Neurosci. 9, 1488–1498. 17. Sequeira, S.M., Ambro´sio, A.F., Malva, J.O., Carvalho, A.L., and Carvalho, A.P. (1997). Modulation of glutamate release from rat hippocampal synaptosomes by nitric oxide. Nitric Oxide Biol. Chem. 1, 315–329. 18. Meffert, M.K., Calakos, N.C., Scheller, R.H., and Schulman, H. (1996). Nitric oxide modulates synaptic vesicle docking/fusion reactions. Neuron 16, 1229–1236. 19. McNaught, K.St.P. and Brown, G.C. (1998). Nitric oxide causes glutamate release from brain synaptosomes. J. Neurochem. 70, 1541–1546. 20. Arancio, O., Kiebler, M., Lee, C.J., Lev-Ram, V., Tsien, R.Y., Kandel, E.R., and Hawkins, R.D. (1996). Nitric oxide acts directly in the presynaptic neuron to produce long-term potentiation in cultured hippocampal neurons. Cell 87, 1025– 1035. 21. Holscher, C. (1997). Nitric oxide, the enigmatic neuronal messenger: its role in synaptic plasticity. Trends Neurosci. 20, 298–303. 22. Bliss, T.V.P., and Collingridge, G.L. (1993). A synaptic model of memory: longterm potentiation in the hippocampus. Nature 361, 31–39. 23. Collingridge, G.L., Kehl, S.J., and McLennan, H. (1983). Excitatory amino acids in synaptic transmission in the Schaffer collateral-commissural pathway of the rat hippocampus. J. Physiol. (Lond) 334, 33–46. 24. Perkel, D.J., Petrozzino, J.J., Nicoll, R.A., and Connor, J.A. (1993). The role of
Glutamate Release and Nitric Oxide
25.
26.
27.
28.
29.
30. 31.
32.
33.
34. 35.
36.
37.
38.
39.
171
Ca2⫹ entry via synaptically activated NMDA receptors in the induction of longterm potentiation. Neuron 11, 817–823. O’Dell, T.J., Hawkins, R.D., Kandel, E., and Arancio, O. (1991). Tests of the roles of two diffusible substances in long-term potentiation: evidence for nitric oxide as a possible early retrograde messenger. Proc. Natl. Acad. Sci. USA 88, 11285– 11289. Zhuo, M., Small, S.A., Kandel, E.R., and Hawkins, R.D. (1993). Nitric oxide and carbon monoxide produce activity-dependent long-term synaptic enhancement in hippocampus. Science 260, 1946–1950. Chetkovich, D.M., Klan, E., and Sweatt, J.D. (1993). Nitric oxide synthase–independent long-term potentiation in area CA1 of hippocampus. Neuro Report 4, 919– 922. Gally, J.A., Montague, P.R., Reeke, G.N. Jr., and Edelman, G.M. (1990). The NO hypothesis: possible effects of a short-lived rapidly diffusible signal in the development and function of the nervous system. Proc. Natl. Acad. Sci. USA 87, 3547– 3551. Dawson, T.M., Gonzalez-Zulneta, M., Kusel, J., and Dawson, V.L. (1998). Nitric oxide: diverse actions in the central and peripheral nervous systems. Neuroscientist 4, 96–112. Schuman, E.M., and Madison, D.V. (1991). A requirement for the intracellular messenger nitric oxide in long-term potentiation. Science 254, 1503–1506. Son, H., Hawkins, R.D., Martin, K., Kiebler, M., Huang, P.L., Fishman, M.C., and Kandel, E.R. (1996). Long-term potentiation is reduced in mice that are double mutant in endothelial and neuronal nitric oxide synthase. Cell 87, 1015–1023. Kamisaki, Y., Wada, K., Nakamoto, K., and Itho, T. (1995). Nitric oxide inhibition of the depolarization-evoked glutamate release from synaptosomes of rat cerebellum. Neurosci. Lett. 194, 5–8. Sistiaga, A., Miras-Portugal, M.T., and Sa´nchez-Prieto, J. (1997). Modulation of glutamate release by a nitric oxide/cGMP-dependent pathway. Eur. J. Pharmacol. 321, 247–257. Meffert, M.K., Premack, B.A., and Shulman, H. (1994). Nitric oxide stimulates calcium-independent synaptic vesicle release. Neuron 12, 1235–1244. Segieth, J., Getting, S.J., Biggs, C.S., and Whitton, P.S. (1995). Nitric oxide regulates excitatory mono acid release in a biphasic manner in freely moving rats. Neurosci. Lett. 200, 101–104. Levenes, C., Daniel, H., and Cre´pel, F. (1998). Long-term depression of synaptic transmission in the cerebellum: cellular and molecular mechanisms revisited. Prog. Neurobiol. 55, 79–91. Duarte, C.B., Carvalho, A.L., and Carvalho, A.P. (1995). Modulation of AMPA/ kainate receptors by protein kinase C. In: Signalling Mechanisms—From Transcription Factors to Oxidative Stress (L. Packer, and K. Wirtz, eds.). NATO ASI Series, Vol. H 92, Springer-Verlag, Berlin, pp. 115–124. Daniel, H., Hemart, N., Jaillard, D., and Cre´pel, F. (1993). Long-term depression requires nitric oxide and guanosine 3′:5′ cyclic monophosphate production in rat cerebellar Purkinje cells. Eur. J. Neurosci. 5, 1079–1082. Ito, M., and Karachot, L. (1992). Protein kinase and phosphatase inhibitors mediat-
172
40.
41. 42. 43.
44.
45.
46.
47. 48. 49.
50.
51.
52. 53. 54.
55.
56.
Carvalho et al. ing long-term desensitization of glutamate receptors in cerebellar Purkinje cells. Neurosci. Res. 14, 27–38. Boxall, A.R., and Garthwaite, J. (1996). Long-term depression in rat cerebellum requires NO synthase and NO-sensitive guanylyl cyclase. Eur. J. Neurosci. 8, 2209–2212. Choi, D.W. (1988). Glutamate neurotoxicity and diseases of the nervous system. Neuron 1, 623–634. Choi, D.W., and Rothman, S.M. (1990). The role of glutamate neurotoxicity in hypoxic-ischemic neuronal death. Annu. Rev. Neurosci. 13, 177–182. Ferreira, I.L., Duarte, C.B., and Carvalho, A.P. (1996). Ca2⫹ influx through glutamate receptor–associated channels in retina correlates with neuronal cell death. Eur. J. Pharmacol. 302, 153–162. Ferreira, I.L., Duarte, C.B., and Carvalho, A.P. (1998). Kainate-induced retina amacrina–like cell damage is mediated by AMPA receptors. Neuroreport 9, 3471– 3475. Duarte, C.B., Ferreira, I.L., Santos, P.F., Carvalho, A.L., Agostinho, P.M., and Carvalho, A.P. (1998). Glutamate in life and death of retinal amacrine cells. Gen. Pharmacol. 30, 289–295. Jensen, J.B., Schousboe, A., and Pickering, D.S. (1998). AMPA receptor mediated excytoxicity in neocortical neurons is developmentally regulated and dependent upon receptor desensitization. Neurochem. Int. 32, 505–513. Duggan, L.L., and Choi, D.W. (1994). Excitotoxicity, free radicals, and cell membrane changes. Ann. Neurol. 35, S17–21. Lafon-Cazal, M., Pietri, S., Culcasi, M., and Bockaert, J. (1993). NMDA-dependent superoxide production and neurotoxicity. Nature 364, 535–537. Dawson, T.M., Dawson, V.L., and Snyder, S.H. (1992). A novel neuronal messenger molecule in the brain: the free radical, nitric oxide. Ann. Neurol. 32, 297– 311. Dawson, V.L., Dawson, T.M., London, E.D., Bredt, D.S., and Snyder, S.H. (1991). Nitric oxide mediates glutamate toxicity in primary cortical cultures. Proc. Natl. Acad. Sci. USA 88, 6368–6371. Dawson, V.L., Kizushi, V.M., Huang, P.L., Snyder, S.H., and Dawson, T.M. (1996). Resistance to neurotoxicity in cortical neuronal cultures from neuronal nitric oxide synthase deficient mice. J. Neurosci. 16, 2479–2487. Lancaster, J.R. Jr. (1994). Stimulation of the diffusion and reaction of endogenously produced nitric oxide. Proc. Natl. Acad. Sci. USA 91, 8137–8141. Beckman, J.S., and Koppenol, W.H. (1996). Nitric oxide, superoxide, and peroxynitrite: the good, the bad and the ugly. Am. J. Physiol. 271, C1424–C1437. Dawson, V.L., Brahmbhatt, H.P., Mong, J.A., and Dawson, T.M. (1994) Expression of inducible nitric oxide synthase causes delayed neurotoxicity in primary mixed neuronal-glial cortical cultures. Neuropharmacology 33, 1425–1430. Catania, M.V., Tolle, T.R., and Monyer, H. (1995). Differential expression of AMPA receptor subunits in NOS-sensitive neurons of cortex, striatum, and hippocampus. J. Neurosci. 15, 7046–7061. Standaert, D.G., Landwehrmeyer, G.B., Kerner, J.A., Penny, J.B., and Young, A.B. (1996). Expression of NMDAR2D glutamate receptor subunit mRNA in neuro-
Glutamate Release and Nitric Oxide
57.
58. 59.
60. 61.
62.
63.
64. 65.
66. 67.
68. 69.
70. 71. 72.
73.
173
chemically identified interneurons in the rat striatum, neocortex, and hippocampus. Mol. Brain Res. 42, 89–102. Gonzalez-Zulueta, M., Enz, L.M., Mukhina, G., Lebovitz, R.M., Zwacka, R.M., Engelhardt, J.F., Oberley, L.M., Dawson, V.L., and Dawson, T.M. (1998). Manganese superoxide dismutase protects nNOS neurons from NMDA and nitric oxide– mediated neurotoxicity. J. Neurosci. 18, 2040–2055. Iadecola, C. (1997). Bright and dark sides of nitric oxide in ischemic brain injury. Trends Neurosci. 20, 132–139. Farinelli, S.E., Park, D.S., and Greene, L.A. (1996). Nitric oxide delays the death of trophic factor–deprived PC12 cells and sympathetic neurons by a cGMP-mediated mechanism. J. Neurosci. 16, 2325–2334. Zhang, J., Dawson, V.L., Dawson, T.M., and Snyder, S.H. (1994). Nitric oxide activation of poly(ADP-ribose) synthase in neurotoxicity. Science 263, 687–689. Gaal, J.C., Smith, K.R., and Pearson, C.K. (1987). Cellular euthanasia mediated by a nuclear enzyme: a central role for nuclear ADP-ribosylation in cellular metabolism. Trends Biochem. Sci. 12, 129–130. Wang, Z.Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Shweiger, M., and Wagner, E.F. (1995). Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev. 9, 509–520. Lei, S.Z., Pan, Z.H., Aggarwal, S.K., Chen, H.S.V., Hartman, J., and Lipton, S.A. (1992). Effect of nitric oxide production on the redox modulatory site of the NMDA receptor–channel complex. Neuron 8, 1087–1099. Fagni, L., and Bockaert, J. (1996). Effects of nitric oxide on glutamate-gated channels and other ionic channels. J. Chem. Neuroanat. 10, 231–240. Kro¨ncke, K-D., Fehsel, K., and Kolb-Bachofen, V. (1997). Nitric oxide: cytotoxicity versus cytoprotection. How, why, when and where? Nitric Oxide Biol. Chem. 1, 107–120. Tenneti, L., D’Emilia, D.M., and Lipton, S. (1997). Suppression of neuronal cell apoptosis by S-nitrosylation of caspases. Neurosci. Lett. 236, 139–142. Kim, Y.-M., Talanian, R.V., and Billiar, T.R. (1997). Nitric oxide inhibits apoptosis by preventing increases in caspase-3-like activity via two distinct mechanisms. J. Biol. Chem. 272, 31138–31148. Shen, Y.H., Wang, X.L., and Wilcken, D.E.L. (1998). Nitric oxide induces and inhibits apoptosis through different pathways. FEBS Lett. 433, 125–131. Leist, M., Volbracht, C., Ku¨hnle, S., Fava, E., Ferrando-May, E., and Nicotera, P. (1997). Caspase mediated apoptosis in neuronal excitotoxicity triggered by nitric oxide. Mol. Med. 3, 750–764. Barres, B.A. (1991). New roles for glia. J. Neurosci. 11(12), 3685–3694. Viviani, B., and Marinovich, M. (1998). Neurotoxicity: an active role for glia? Neurosci. Res. Commun. 23, 1–12. Aoki, E., Semba, R., and Kashiwamata, S. (1991). Evidence for the presence of l-arginine in the glial components of the peripherical nervous system. Brain Res. 559, 159–162. Arbone´s, M.L., Ribera, J., Agullu, L., Baltrons, M.A., Casanovas, A., RiverosMoreno, V., and Garcı´a, A. (1996). Characteristics of nitric oxide synthase type I of rat cerebellar astrocytes. Glia 18, 224–232.
174
Carvalho et al.
74. Galea, E., Feinstein, D.L., and Reis, D.J. (1992). Induction of calcium-independent nitric oxide synthase activity in primary rat glial cultures. Proc. Natl. Acad. Sci. USA 89, 10945–10949. 75. Simmons, M.L., and Murphy, S. (1992). Induction of nitric oxide synthase in glial cells. J. Neurochem. 59, 897–905. 76. Murphy, S., Simmons, M.L., Agullo, L., Garcia, A., Feinstein, D., Galea, E., Reis, D.J., Minc-Golomb, D., and Schwartz, J.P. (1993). Synthesis of nitric oxide in CNS glial cells. TINS 16(8), 323–328. 77. Bolan˜os, J.P., Peuchen, S., Land, J.M., Heales, S.J.R., and Clark, J.B. (1994). Nitric oxide–mediated inhibition of the mitochondrial respiratory chain in cultured astrocytes. J. Neurochem. 63, 910–916. 78. Endoh, M., Maiese, K., and Wagner, J.A. (1994). Expression of the inducible nitric oxide synthase activity by reactive astrocytes after transient global ischemia. Brain Res. 651, 92–100. 79. Feinstein, D.L., Galea, E., Cermack, J., Chugh, P., Lyandvert, L., and Reis, D.J. (1994). Nitric oxide expression in glial cells: suppression by tyrosine kinase inhibitors. J. Neurochem. 62, 811–814. 80. Koka, P., He, K., Zack, J.A., Kitchen, S., Peacock, W., Fried, I., Tran, T., Yashar, S., and Merrill, J.E. (1995). HIV-1 envelope proteins induce IL1, TNFα and nitric oxide in glial cultures derived from fetal, neonatal and adult human brain. J. Exp. Med. 182, 941–952. 81. Lin, H.L., and Murphy, S. (1997). Regulation of astrocyte nitric oxide synthase type II expression by ATP and glutamate involves loss of transcription factor binding to DNA. J. Neurochem. 69, 612–616. 82. Feinstein, D.L. (1998). Suppression of astroglial nitric oxide synthase expression by norepinephrine results from decreased NOS-2 promoter activity. J. Neurochem. 62, 811–814. 83. Jordan, M.L., Rominski, B., Jaquins-Gerstl, A., Geller, D., and Hoffman, R.A. (1995). Regulation of inducible nitric oxide production by intracellular calcium. Surgery 118, 138–146. 84. Brown, G.C., Bolan˜os, J.P., Heales, S.J.R., and Clark, J.B. (1995). Nitric oxide produced by activated astrocytes rapidly and reversibly inhibits cellular respiration. Neurosci. Lett. 193, 201–204. 85. Demerle´-Pallardy, C., Lonchampt, M.O., Chabrier, P.E., and Braquet, P. (1993). Nitric oxide synthase induction in glial cells: effect on neuronal survival. Life Sci. 52, 1883–1890. 86. Hewett, S.J., Csernansky, C.A., and Choi, D.W. (1994). Selective potentiation of NMDA-induced neuronal injury following induction of astrocytic iNOS. Neuron 13, 487–494. 87. Chao, C.C., Hu, S., Sheng, W.S., Bu, D., Bukrinsky, M.I., and Peterson, P. (1996). Cytokine-stimulated astrocytes damage human neurons via a nitric oxide mechanism. Glia 16, 276–284. 88. Baltrons, M.A., and Garcı´a, A. (1997). AMPA receptors are coupled to the nitric oxide/cyclic GMP pathway in cerebellar astroglial cells. Eur. J. Neurosci. 9(11), 2497–2501. 89. Lonart, G., and Johnson, K.M. (1995). Characterization of nitric oxide generator–
Glutamate Release and Nitric Oxide
90.
91.
92. 93.
94.
95. 96.
97.
98.
99.
100.
101. 102. 103.
104.
175
induced hippocampal [3H]norepinephrine release I. The role of glutamate. J. Pharmacol. Exp. Ther. 275, 7–13. Lonart, G., and Johnson, K.M. (1995). Characterization of nitric oxide generator– induced hippocampal [3H]norepinephrine release II. The role of calcium, reverse norepinephrine transport and cyclic-3,5-guanosine monophosphate. J. Pharmacol. Exp. Ther. 275, 14–22. Stewart, T.L., Michel, A.D., Black, M.D., and Humphrey, P.P.A. (1996). Evidence that nitric oxide causes calcium-independent release of [3H]-dopamine from rat striatum in vitro. J. Neurochem. 66, 131–137. Rothman, S.M. (1984). Synaptic release of excitatory amino acid neurotransmitter mediates anoxic neuronal death. J. Neurosci. 4, 1884–1891. Drejer, J., Benevist, H., Diemer, N.H., and Schousboe, A. (1985). Cellular origin of ischemia-induced glutamate release from brain tissue in vivo and in vitro. J. Neurochem. 45, 145–151. Lonart, G., and Johnson, K.M. (1994). Inhibitory effects of nitric oxide on the uptake of [3H]dopamine and [3H]glutamate by striatal synaptosomes. J. Neurochem. 63, 2108–2117. Pogu¨n, S., Dawson, V., and Khuar, M. (1994). Nitric oxide inhibits 3H-glutamate transport in synaptosomes. Synapse 18, 21–26. Trotti, D., Rossi, D. Gyesdal, O., Levy, L.M., Racagni, G., Danbolt, N.C., and Volterra, A. (1996). Peroxynitrite inhibits glutamate transporter subtypes. J. Biol. Chem. 271, 5976–5979. Nicholls, D.G., Sihra, T.S., and Sa´nchez-Prieto, J. (1987). Calcium-dependent and independent release of glutamate from synaptosomes monitored by continuous fluorimetry. J. Neurochem. 49, 50–57. Kauppinen, R.A., McMahon, H.T., and Nicholls, D.G. (1988). Ca2⫹-dependent and Ca2⫹-independent glutamate release, energy status and cytosolic free Ca2⫹ concentration in isolated nerve terminals following metabolic inhibition: possible relevance to hypoglycemia and anoxia. Neuroscience 27, 175–182. Erecinska, M., Nelson, D., and Vanderkooi, J.M. (1995). Effects of NO-generating compounds on synaptosomal energy metabolism. J. Neurochem. 65, 2699– 2705. Herrero, I., Castro, E., Miras-Portugal, M.T., and Sa´nchez-Prieto, J. (1996). Two components of glutamate exocytosis differentially affected by presynaptic modulation. J. Neurochem. 67, 2348–2354. Walch-Silomena, C., Jhan, R., and Sudhof, T.C. (1993). Synaptic vesicle proteins in exocytosis: what do we know? Curr. Opin. Neurobiol. 3, 329–336. Betz, W.J., and Bewick, C.S. (1996). Optical analysis of synaptic vesicle recycling at the frog neuromuscular junction. Science 255, 200–203. Sequeria, S.M., Ambro´sio, A.F., Malva, J.O., Carvalho, A.P., and Carvalho, C.M. (1996). Nitric oxide donors differentially affect the Ca2⫹-dependent and the Ca2⫹independent release of glutamate in hippocampal synaptosomes. Eur. J. Neurosci. Suppl. 9, 46.16. Sequeira, S.M., Duarte, C.B., Carvalho, A.P., and Carvalho, C.M. (1998). Nitric oxide differentially affects the exocytotic and the carrier-mediated release of [3H]γaminobutyric acid in rat hippocampal synaptosomes. Mol. Brain Res. 55, 337–340.
176
Carvalho et al.
105. Bolan˜os, J.P., Almeida, A., Stewart, V., Peuchen, S., Land, J.M., Clarck, J.B., and Heales, S.J.R. (1997). Nitric oxide–mediated mitochondrial damage in the brain: mechanisms and implications for neurodegenerative diseases. J. Neurochem. 68, 2227–2240. 106. Wolosker, H., Reis, M., Assreuy, J., and de Meis, L. (1996). Inhibition of glutamate uptake and proton pumping in synaptic vesicles by S-nitrosylation. J. Neurochem. 66, 1943–1948. 107. Lopes, M.C., Cardoso, S.A., Schousboe, A., and Carvalho, A.P. (1995). Amino acids differentially inhibit the l-[3H]arginine transport and nitric oxide synthase in rat brain synaptosomes. Neurosci. Lett. 181, 1–4. 108. Giulivi, C., Poderoso, J.J., and Boveris, A. (1998). Production of nitric oxide by mitochondria. J. Biol. Chem. 273, 11038–11043. 109. Bates, T.E., Loesch, A., Burnstock, G., and Clarck, J.B. (1995). Immunocytochemical evidence for a mitochondrially located nitric oxide synthase in brain and liver. Biochem. Biophys. Res. Commun. 213, 896–900. 110. Kobzik, L., Stringer, B., Balligand, J.L., Reid, M.B., and Stamler, J.S. (1995). Endothelial type nitric oxide synthase in skeletal muscle fibers: mitochondrial relationships. Biochem. Biophys. Res. Commun. 211, 375–381. 111. Frandsen, U., Lopez Figueroa, M., and Hellsten, Y. (1996). Localization of nitric oxide synthase in human skeletal muscle. Biochem. Biophys. Res. Commun. 227, 88–93. 112. Ghafourifar, P., and Richter, C. (1997). Nitric oxide synthase activity in mitochondria. FEBS Lett. 418, 291–296. 113. Carvalho, C.M., Sequeira, S.M., Malva, J.O., and Carvalho, A.P. (1998). Involvement of the NO/cGMP signalling on the modulation by nitric oxide of glutamate release in hippocampal nerve terminals. FASEB J. 12, A460. 114. Valtorta, F., Benfenati, F., and Greengard, P. (1992). Structure and function of the synapsins. J. Biol. Chem. 267, 7195–7198. 115. Wang, X., and Robinson, P.J. (1997). Cyclic GMP–dependent protein kinase and cellular signalling in the nervous system. J. Neurochem. 68, 443–456. 116. El-Hussein, A.E-D., Bladen, C., Williams, J.A., Reiner, P.B., and Vincent, S.R. (1998). Nitric oxide regulates cyclic GMP-dependent protein kinase phosphorylation in rat brain. J. Neurochem. 71, 676–683.
8 Monoamines, Monoamine Oxidase Inhibitors, and the Maintenance of Mitochondrial Function During Oxidative Stress Pamela A. Maher The Scripps Research Institute, La Jolla, California
Shirlee Tan The Salk Institute for Biological Studies, La Jolla, California
I. INTRODUCTION Although programmed cell death (PCD) plays an important role in the normal development of the nervous system, in adults PCD leads to the neuronal cell loss associated with various neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, as well as that associated with acute central nervous system (CNS) trauma, including stroke (for review, see Ref. 1). In all of these cases PCD has been linked to oxidative stress and the production of reactive oxygen species (ROS) (for reviews, see Refs. 1–4). One potential mechanism for the generation of ROS in the CNS is via the excitatory amino acid glutamate. Excess glutamate has been linked to the neuronal cell death seen in Alzheimer’s disease and Parkinson’s disease, as well as that seen following acute insults to the CNS (5). Two pathways for glutamate toxicity have been described: excitotoxicity (6), which occurs through activation of ionotropic glutamate receptors, and oxidative glutamate toxicity (7), which is mediated via a series of disturbances to the redox homeostasis of the cell. Evidence for the involvement of the oxidative pathway in glutamate toxicity arose from several discrepancies in studies involving ionotropic glutamate receptors, antagonists, and cell death (8–12). This pathway does not involve ionotropic glutamate receptors but rather a 177
178
Maher and Tan
glutamate/cystine antiporter that is required for the delivery of cystine into neuronal cells (7). Inhibition of cystine uptake by high concentrations of extracellular glutamate leads to an imbalance in cellular cysteine homeostasis and a reduction in cellular glutathione (GSH) levels, which can eventually lead to cell death. A critical role for GSH in protecting neuronal cells from PCD has been suggested by a number of in vitro and in vivo studies. For instance, in Parkinson’s disease patients there is an early and specific decrease in GSH levels that may precede cell death (for review, see Ref. 13). Similarly, the levels of GSH were shown to fall during ischemia (14). In vitro, the inhibition of GSH biosynthesis leads to the degeneration of cultured dopaminergic neurons and increases in their sensitivity to various neurotoxic agents (15,16). Thus, the early drop in cellular GSH levels seen in oxidative glutamate toxicity is very similar to changes seen in vivo in neuronal cells responding to both acute and chronic injury.
II. OXIDATIVE GLUTAMATE TOXICITY: A MODEL FOR STUDYING THE RESPONSE OF NEURONAL CELLS TO OXIDATIVE STRESS A.
Background
Neuronal cell death via the oxidative pathway is inhibited by antioxidants (7,17) or high concentrations of extracellular cystine (7), and has been described in neuronal cell lines (7,17–20), primary neuronal cultures (17,18,21,22), oligodendrocytes (23), and tissue slices (9). This pathway is likely to be a major source of glutamate-induced cell death in vivo (10–12). Thus, oxidative glutamate toxicity can serve as a useful model for studying the response of neuronal cells to oxidative stress. For many of our studies, we have used HT22 cells, a mouse hippocampal cell line that lacks ionotropic glutamate receptors but is particularly sensitive to glutamate via the oxidative pathway (17,18,24). However, in all cases we have confirmed our results using primary cultures of cortical neurons from rat or chick embryos. We have determined the time course of the major events in oxidative glutamate toxicity as well as the form of PCD involved. In addition, we have identified several enzymes that appear to be critically involved in cell death via the oxidative pathway. B.
Outline of Cell Death Pathway
The exposure of HT22 cells to glutamate leads to depletion of GSH over 6 hr which is paralleled by a slow increase in ROS levels. However, once GSH levels fall below 20% of control values, ROS levels increase sharply, reaching levels over 200 times greater than control values by 10 h after the addition of glutamate (25). This late rise in ROS levels is not simply a consequence of GSH depletion
MOAs, MAOIs, and Mitochondrial Function
179
since depletion of GSH with buthionine sulfoximine (BSO), an irreversible inhibitor of γ-glutamyl cysteine synthetase, the rate-limiting enzyme in GSH biosynthesis, only results in the initial slow increase in ROS levels (25). Instead, the late rise in ROS levels comes from mitochondria and can be blocked by RNA and protein synthesis inhibitors as well as by caspase inhibitors, but only when these agents are added within 2–4 h after the initiation of glutamate treatment (25,26). These results indicate that the form of PCD associated with oxidative glutamate toxicity has many of the characteristics of PCD seen in a variety of other systems. However, morphologically the cell death is more reminiscent of that seen in early neuronal development rather than the classical form seen in lymphoid cells and no DNA fragmentation into defined fragments is observed (26). In addition to the requirements for macromolecular synthesis and protease activation, activation of 12-lipoxygenase (12-LOX) is required for maximal late phase ROS production and cell death (24). The arachidonic acid that is used as a substrate by 12-LOX is generated at least in part by the action of phospholipase A2 and not by either phosphatidylinositol-specific phospholipase C or phosphatidylcholine-specific phospholipase D (27). In the presence of glutamate, low intracellular GSH levels cause 12-LOX activation, leading to the production of one or more unidentified products required for the generation of maximal levels of ROS (24). In addition, a product of 12-LOX activity also activates guanylate cyclase, resulting in the production of cGMP which activates a cobalt-sensitive Ca2⫹ channel which mediates the large increase in intracellular Ca2⫹ (28). The relationship between ROS production and intracellular Ca2⫹ elevation is complex. Although the increase in cytosolic Ca2⫹ follows the late rise in ROS production and can be blocked by agents that prevent late phase ROS generation, inhibition of Ca2⫹ influx significantly reduces the late increase in ROS levels (25). Thus, the influx of Ca2⫹ and mitochondrial ROS production appear to be tightly coupled. These late stages of oxidative glutamate toxicity share many characteristics with receptor-mediated glutamate toxicity, including inhibition by CoCl2 and ruthenium red, suggesting that different initial insults can eventually lead to activation of a common pathway of PCD in neuronal cells. C.
Protection by Monoamine Oxidase A Inhibitors
In addition to the agents that inhibit the various biochemical pathways described above, several years ago we found that oxidative glutamate toxicity could be blocked by monoamine oxidase (MAO) A inhibitors (18). MAO-A is one of the two forms of MAO present in mammalian cells. The MAOs are the major enzymes in the CNS and peripheral tissues that catalyze the oxidative deamination of neuroactive and vasoactive amines generating, among other products, hydrogen peroxide (for reviews, see Refs. 29–31). These enzymes are integral proteins of the outer mitochondrial membrane and can be distinguished from each other
180
Maher and Tan
by differences in substrate and inhibitor specificity and in their cell and tissue distributions. We tested a range of different MAO inhibitors (Fig. 1) with a variety of distinct chemical structures and found that MAO-A inhibitors (clorgyline, harmine, RO41-1049, TC724) or nonsubtype-specific MAO inhibitors (hydralazine) provided good protection from glutamate toxicity, whereas MAO-B inhibitors (deprenyl, pargyline, RO16-6491, TC715) consistently had little or no effect. Both irreversible (e.g., clorgyline) and reversible (e.g., RO41-1049, TC724) MAO-A inhibitors were effective at blocking glutamate toxicity. All of these results were confirmed in primary cultures of cortical neurons (18). However, one of the curious characteristics of this protection was that it required high doses
Figure 1 The rescue of neuronal cells from glutamate toxicity by MAO inhibitors. HT22 cells were incubated with 100 µM deprenyl, 100 µM pargyline, 100 µM RO16-6491, 100 µM TC715, 100 µM hydralazine, 100 µM clorgyline, 50 µM harmine, 100 µM RO411049, or 100 µM TC724 in the presence of 5 mM glutamate. After 24 h, cell viability was assessed using the MTT assay. Data are expressed as % survival relative to controls treated with inhibitor alone and are the mean of quadruplicate determinations ⫾ SD. Similar results were obtained in five separate experiments. (From Ref. 18.)
MOAs, MAOIs, and Mitochondrial Function
181
of MAO-A inhibitors that were well above the concentrations required to inhibit MAO activity in the HT22 cells (18). Taken together these results suggested that the MAO-A inhibitors might be acting on some structurally related enzyme distinct from MAO-A to block oxidative glutamate toxicity. To determine if protection by MAO-A inhibitors was limited to oxidative glutamate toxicity or could also be seen with other forms of oxidative stress, we exposed the HT22 cells to a variety of other conditions in the absence or presence of MAO inhibitors. As shown in Figure 2, MAO-A inhibitors protect cells from cystine deprivation and quisqualate at the same concentrations that also protect the HT22 cells from glutamate toxicity. Again, no protection is seen with the MAO-B inhibitors (not shown). In contrast, the MAO-A inhibitors fail to protect the cells from cell death induced by either the GSH synthesis inhibitor, BSO, or
Figure 2 The effect of the MAO-A inhibitor clorgyline on cell death induced by a variety of different agents. HT22 cells were incubated with 5 mM glutamate (glu), 1 mM BSO (BSO), 0.5 mM quisqualate (quis), 2.5 mM HCA (HCA), or cystine-free DME (0 cys) in the absence or presence of 100 µM clorgyline. After 24 h, cell viability was assessed using the MTT assay. Data are expressed as % survival relative to controls treated with inhibitor alone and are the mean of quadruplicate determinations ⫾ SD. Similar results were obtained in three separate experiments.
182
Maher and Tan
the cystine uptake inhibitor, homocysteic acid (HCA). While the results with HCA are surprising since this compound blocks cystine uptake and therefore was expected to act similar to glutamate and quisqualate, the results with BSO may be related to the apparent lack of mitochondrial involvement in BSO toxicity (see Sec. II.B). Thus, these results indicate that different forms of oxidative stress act through distinct pathways to induce cell death and suggest that further examination of the role of mitochondria in oxidative glutamate toxicity might provide additional information on the mechanism of protection by MAO-A inhibitors.
III.
ROLE OF MITOCHONDRIA IN OXIDATIVE GLUTAMATE TOXICITY
One of the reasons we initially examined the possible involvement of MAO activity in oxidative glutamate toxicity was the requirement for ROS production in this form of cell death (7,18,25). MAOs are one of the possible sources of ROS in cells (4). Other sources include the mitochondrial electron transport chain and a variety of enzymes such as tyrosine hydroxylase, amino acid oxidases, lipoxygenases, cyclooxygenase, and xanthine oxidase (4). While our results suggested that MAO-A inhibitors were not protecting cells by blocking MAO activity, it was still possible that they were effective at blocking cell death because they inhibited a related enzyme whose activity also resulted in the generation of ROS. As mentioned in Sec. II.B, two phases of ROS production can be detected in glutamate-treated cells: an early phase that is related to the drop in GSH levels and a late phase that involves mitochondria. To test whether MAO inhibitors blocked one or both phases of ROS production in glutamate-treated cells, we used flow cytometry in conjunction with the dye dichlorofluoroscein diacetate (18,25). Dichlorofluoroscein diacetate is a nonfluorescent, cell-permeable molecule. However, once inside the cell it is cleaved by endogenous esterases, which results in its being trapped in the cell where it becomes the fluorescent compound 2′,7′-dichlorofluorescein (DCF) upon oxidation by ROS. The MAO-A inhibitor clorgyline completely inhibited the late phase of ROS production by the cells exposed to glutamate (Fig. 3), whereas MAO-B inhibitors had little or no effect at any of the concentrations tested (not shown and Ref. 18). These results indicated that MAO-A inhibitors block the production of ROS induced by glutamate treatment and, in doing so, inhibit oxidative glutamate toxicity. As mentioned above, one source of ROS in cells is the mitochondrial electron transport chain. Mitochondria use about 90% of the inhaled oxygen and, since 1–2% of the oxygen reduced in mitochondria is constitutively converted to superoxide, they are a very good source of ROS (32). Furthermore, trauma (33,34), as well as a variety of toxic agents (35), can dramatically enhance the generation of superoxide by mitochondria. Superoxide can be produced by the
MOAs, MAOIs, and Mitochondrial Function
183
Figure 3 The effect of clorgyline on ROS production. Clorgyline was added to the HT22 cells at 2 h intervals during a 10 h exposure to 10 mM glutamate, and then DCF fluorescence and cell survival were measured. ROS production is presented as the ratiometric increase in median DCF fluorescence vs. the control value (black circles). Cell survival was measured at 10 h by trypan blue exclusion and is presented as the percentage of the control value (bars).
reaction of oxygen with several components of the electron transport chain including NADH dehydrogenase (complex I) and ubiquinone and the b cytochromes in complex III (32). The NADH dehydrogenase–dependent generation of ROS is specifically stimulated upon the depletion of mitochondrial glutathione (36). Dismutation of superoxide by the Mn2⫹-containing superoxide dismutase provides the major source of mitochondrial hydrogen peroxide. Reduction of hydrogen peroxide can generate the highly reactive hydroxyl radical. To determine if the mitochondrial electron transport chain could be the source of the late rise in ROS in cells treated with glutamate and therefore the site of action of the MAO-A inhibitors, studies were carried out both in whole cells and on isolated mitochondria (25). Inhibitors and uncouplers of the mitochondrial electron transport chain were tested for their effects on ROS production and cell survival. The mitochondrial uncoupler carbonyl cyanide p-trifluoro-methoxyphenyl-hydrazone (FCCP) eliminates the mitochondrial membrane potential by allowing protons to leak across mitochondrial membranes and thereby prevents the transfer of energy
184
Maher and Tan
from electron flow to ATP synthesis (37). Uncoupling results in an electron transport chain which works more efficiently to reestablish the proton gradient, while ATP synthesis becomes dependent on glycolysis. This increase in efficiency leads to a decreased leakage of electrons from the electron transport chain and thus a much lower level of ROS generation. Mild uncoupling by means of proton leakage through the inner mitochondrial membrane has even been proposed as a mechanism that cells may use as a first line of defense to inhibit ROS production (38). Thus, if the mitochondrial electron transport chain is a major source of ROS in oxidative glutamate toxicity, then the addition of uncouplers such as FCCP should block ROS production. Not only did FCCP prevent the late rise in ROS production following the treatment of cells with glutamate but it also blocked the ensuing cell death (25). The effect of FCCP on ROS production by mitochondria was confirmed in studies using isolated mitochondria (25). In these experiments, the production of hydrogen peroxide by isolated mitochondria was monitored by fluorescence spectroscopy using the fluorescent substrate p-hydroxyphenylacetic acid. The addition of succinate to the mitochondria resulted in the production of substantial quantities of hydrogen peroxide, which was completely blocked by the addition of FCCP. The isolated HT22 mitochondria did not produce detectable levels of hydrogen peroxide in the presence of the complex I substrates glutamate or malate. Several mitochondrial electron transport chain inhibitors were also tested on both whole cells and isolated mitochondria to determine if they too could block the late phase of ROS production and cell death following the addition of glutamate to cells (25). The complex III inhibitor, antimycin A, inhibited the massive increase in ROS production and also blocked glutamate-induced cell death. Antimycin A also decreased the rate of hydrogen peroxide production in isolated mitochondria. Although antimycin A itself causes some ROS production in cells, it is at a lower rate than that seen with glutamate so that overall it causes a significant decrease in ROS production relative to glutamate alone. In contrast, both rotenone, an inhibitor of complex I, and oligomycin, an inhibitor of the ATP synthase, cause massive increases in ROS production on their own and therefore are unable to block the glutamate-induced increase in ROS production or cell death. Nevertheless, these data indicate that much of the late rise in ROS production is generated by the mitochondrial electron transport chain and suggest that MAO-A inhibitors could be acting on one or more elements of this respiratory chain to inhibit ROS production and block oxidative glutamate toxicity. To examine the possibility that MAO-A inhibitors act on the electron transport chain to block ROS production, the effect of these inhibitors on the generation of hydrogen peroxide by isolated mitochondria was tested (25). When the mitochondrial electron transport chain substrate succinate was used to initiate hydrogen peroxide production by the mitochondria, high concentrations (100 µM) of the MAO-A inhibitor clorgyline blocked hydrogen peroxide production
MOAs, MAOIs, and Mitochondrial Function
185
by 90%, whereas similar concentrations of the MAO-B inhibitor pargyline had no effect. Since these concentrations of pargyline can inhibit MAO activity in intact HT22 cells (18) and in isolated mitochondria in the presence of the MAO substrates tryptamine or tyramine (25), it is highly unlikely that the effect of clorgyline on the generation of hydrogen peroxide by isolated mitochondria is due to the inhibition of MAO activity. Instead, these data suggest that the MAO-A inhibitors interact with one or more components of the electron transport chain to block ROS production in mitochondria. Exactly which components remain to be determined although several possibilities are discussed below in Sec. VII.
IV.
MONOAMINE UPTAKE INHIBITORS AND OXIDATIVE GLUTAMATE TOXICITY
Not only did we find that MAO-A inhibitors blocked oxidative glutamate toxicity but we also observed that monoamine uptake inhibitors could significantly reduce glutamate-induced cell death (18). We initially tested monoamine uptake inhibitors because we reasoned that if monoamine metabolism was involved in oxidative glutamate toxicity, then agents which reduce the intracellular levels of monoamines should protect cells from glutamate treatment. However, since we could not detect monoamine synthesis in the HT22 cells, the medium in which the cells were grown could be the only potential source of monoamines. Thus, agents which block monoamine uptake were assayed to determine whether they could decrease glutamate-induced cell death. We tested a group of different monoamine uptake inhibitors which included a range of chemical structures. All of the uptake inhibitors we tested blocked glutamate toxicity, indicating that protection was not limited to one type of molecule (18). For some of the inhibitors, the protection fell within a very narrow concentration range; lower concentrations were ineffective and slightly higher concentrations were extremely toxic to the cells. A comparison of the effective concentration ranges of the monoamine uptake inhibitors imipramine and fluoxetine is shown in Fig. 4. All of the uptake inhibitors that block glutamate toxicity are capable of inhibiting the uptake of several different monoamines, albeit with varying potencies (39), so that we could draw no clearcut conclusions with regard to which monoamines were the most effective at promoting glutamate-induced cell death. Similar results were obtained with primary cultures of rat cortical neurons (18). We also determined the latest time after glutamate addition at which monoamine uptake inhibitors could be added to the HT22 cells and still protect the cells from death (Fig. 5). Protection by imipramine dropped off sharply between 4 and 6 h after the addition of glutamate so that little or no protection was seen if imipramine was added after 6 h of glutamate treatment. This time course for protection is similar to that seen with both clorgyline (Fig. 3) and vitamin E (17),
186
Maher and Tan
Figure 4 The effect of monoamine uptake inhibitors on cell survival. HT22 cells were treated with varying doses of imipramine (A) or fluoxetine (B) in the absence or presence of 5 mM glutamate. After 24 h, cell viability was assessed using the MTT assay. Data are expressed as % survival relative to untreated controls and are the mean of quadruplicate determinations ⫾ SD. Similar results were obtained in two separate experiments.
MOAs, MAOIs, and Mitochondrial Function
187
Figure 5 Time dependence of protection from glutamate toxicity by the monoamine uptake inhibitor imipramine. HT22 cells were treated with 5 mM glutamate and imipramine (75 µM) added at the same time (0) or up to 7 h after the addition of glutamate. After 24 h, cell viability was assessed using the MTT assay. Data are expressed as % survival relative to controls treated with inhibitor alone and are the mean of quadruplicate determinations ⫾ SD. Similar results were obtained in two separate experiments.
suggesting that monoamine uptake inhibitors also play a role in blocking the late rise in ROS production. Since the data with the monoamine uptake inhibitors indicated that the culture medium provided the monoamines which could promote glutamate toxicity, we tested whether the serum in which the cells are grown was the source of those monoamines. Several earlier studies had demonstrated a requirement for serum in glutamate toxicity in both primary neuronal cell cultures (22) and neuronal cell lines (40), but no clear explanation for this requirement had been provided. We obtained a similar result when we treated HT22 cells with glutamate in either a defined medium without serum (N2 medium) (41) or a medium with serum that was pretreated with charcoal to remove monoamines and other small molecules (18). Under these conditions, glutamate was completely ineffective at killing the cells. However, when we added 100 µM dopamine to the N2 medium we restored the ability of glutamate to kill the cells. This concentration of dopamine alone was only slightly toxic to the cells. Furthermore, the monoamine uptake inhibitors blocked the toxicity seen in the presence of dopamine, providing
188
Maher and Tan
further evidence that their protective effect is due to their ability to block the uptake of monoamines into cells. We also tested the uptake inhibitors with several of the other agents that induce oxidative stress in neuronal cells as described in Sec. II.C. Similar to the results with the MAO inhibitors, the monoamine uptake inhibitors also blocked cell death induced by cystine deprivation and quisqualate treatment but had no effect on BSO toxicity (Fig. 6). However, surprisingly, in contrast to the results with the MAO inhibitors, the uptake inhibitors did inhibit the toxicity of HCA. Together, all of these data suggest that monoamine uptake inhibitors prevent cell death via a pathway distinct from the one involving inhibition by MAO-A inhibitors. One obvious possibility is that monoamines contribute to oxidative glutamate toxicity because they are metabolized by MAO, which results in the generation of hydrogen peroxide. This hydrogen peroxide, together with the hydrogen peroxide generated via the electron transport chain, could combine
Figure 6 The effect of the monoamine uptake inhibitor imipramine on cell death induced by a variety of different agents. HT22 cells were incubated with 5 mM glutamate (glu), 1 mM BSO (BSO), 0.5 mM quisqualate (quis), 2.5 mM HCA (HCA), or cystine-free DME (0 cys) in the absence or presence of 75 µM imipramine. After 24 h, cell viability was assessed using the MTT assay. Data are expressed as % survival relative to controls treated with inhibitor alone and are the mean of quadruplicate determinations ⫾ SD. Similar results were obtained in three separate experiments.
MOAs, MAOIs, and Mitochondrial Function
189
to cause the large increase in ROS and the activation of a cell death pathway. A second possibility is that dopamine promotes cell death by a direct interaction with the electron transport chain, which results in the inhibition of NADH dehydrogenase (42) in complex I of the electron transport chain. The degree of this inhibition is highly dependent on the concentration of dopamine, so that low concentrations of this monoamine only cause partial inhibition in isolated mitochondria. As discussed in Sec. III, treatment of cells with rotenone, an inhibitor of complex I, results in a massive increase in ROS. Thus, it is possible that the combined effects of glutamate and low concentrations of dopamine on mitochondria give rise to the late phase increase in ROS production. Consistent with either possibility is the observation that monoamine uptake inhibitors block the large, delayed increase in ROS seen following treatment of cells with glutamate (18).
V.
MAO INHIBITORS
If the MAO-A inhibitors are acting on some mitochondrial enzyme distinct from MAO to protect cells from oxidative glutamate toxicity, then in order to speculate as to what this enzyme might be it is necessary to understand what is known about MAOs and how they interact with their inhibitors (for reviews, see Refs. 31, 43, and 44). The MAOs are flavoproteins. As such they contain a covalently bound flavin adenine dinucleotide (FAD) cofactor in the active site. Oxidation of a monoamine substrate is coupled to the reduction of the FAD cofactor. The product of this reaction is the imine of the substrate, which hydrolyzes spontaneously to give the corresponding aldehyde and ammonia. Reoxidation of the cofactor by molecular oxygen produces hydrogen peroxide. As mentioned briefly in Sec. II.C, MAO inhibitors can be divided into two general classes: reversible and irreversible. The MAO-A inhibitors that were effective at blocking oxidative glutamate toxicity fall into both classes. Reversible inhibitors bind at the substrate binding site, thereby blocking substrate access. The irreversible MAO inhibitors are mechanism-based inactivators, which means that they are converted by the enzyme to a reactive species that can form a covalent adduct with the enzyme, bringing about its irreversible inactivation. For instance, clorgyline and deprenyl first form noncovalent complexes with the active site of MAO and a subsequent reaction within that complex leads to the generation of a reactive species that couples irreversibly to the nitrogen atom of the reduced FAD cofactor. Since the site of covalent attachment of FAD, as well as other sites involved in the interaction of this cofactor with MAO, are identical between the two MAO isozymes (45), it is likely that the inhibitor, as well as the substrate, specificity of the two forms of MAO derives from the regions in the catalytic site that mediate the interaction with substrate. MAO substrates are thought to interact at two sites within the active site of the enzyme; one site interacts with the amine group of
190
Maher and Tan
the substrate and a second site provides a hydrophobic binding region for the substrate (44). Studies using site-directed mutagenesis and the generation of chimeras between MAO-A and MAO-B have provided further evidence for significant differences in the substrate binding sites of the two isozymes (46,47). In order to begin to address the possibility of a mitochondrial enzyme distinct from MAO-A which interacts with MAO-A inhibitors, we decided to determine if the ability of clorgyline to complex irreversibly with MAO-A would extend to other enzymes with which it might interact (18). Thus, 3H-clorgyline was synthesized and added to purified mitochondria. The resulting products were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and fluorography (Fig. 7). At low concentrations (5 µM), 3H-clorgyline labeled a single band corresponding to the known size of MAO-A (63 kDa). However, at high concentrations (100 µM), an additional labeled protein band with an apparent molecular weight of ⬃40 kDa was observed. Deprenyl, which is a specific inhibitor of MAO-B at 1 µM but inhibits both MAO-A and MAO-B at 100 µM, completely blocked the labeling of the 63-kDa band with the 3H-clorgyline but had little effect on the labeling of the ⬃40-kDa band. This result was in exact agreement with the observation that glutamate toxicity is inhibited by clorgyline
Figure 7 3H-Clorgyline binding to HT22 mitochondria. Mitochondria were prepared from low-density cultures of HT22 cells and labeled with different concentrations of 3Hclorgyline in the absence or presence of the indicated MAO inhibitors. Lane 1, 100 µM 3 H-clorgyline; lane 2, 5 µM 3H-clorgyline; lane 3, 100 µM 3H-clorgyline plus 100 µM deprenyl; and lane 4, 100 µM 3H-clorgyline plus 10 mM unlabeled clorgyline. Molecular weights (in kDa) are indicated at left. Similar results were obtained in two separate experiments. (From Ref. 18.)
MOAs, MAOIs, and Mitochondrial Function
191
but not by deprenyl, even at high concentrations. In contrast, excess cold clorgyline completely blocked the labeling of both bands with 3H-clorgyline. Thus, mitochondria contain a protein that can specifically interact with clorgyline but is distinct from MAO-A.
VI. A.
OTHER EVIDENCE FOR THE NEUROPROTECTIVE EFFECTS OF MAO INHIBITORS MAO-A Inhibitors
Serum, and thereby growth factor, deprivation can induce PCD in a variety of different types of cells and is often considered a model for the death of vertebrate neurons during embryonic development. Serum deprivation of cultured melanoma cells leads to a high level of cell death within 24–48 h (48). Death can be blocked by both high doses of pargyline (1 mM) and lower doses of clorgyline, whereas deprenyl is completely ineffective at any concentration. Both high doses of pargyline and clorgyline also significantly reduced mitochondrial damage brought about by serum deprivation whereas deprenyl did not. Thus, these data provide another demonstration of protection from PCD by MAO-A inhibition that correlates with the maintenance of mitochondrial function. B.
Deprenyl and Related Compounds
A good deal of evidence has also accumulated in recent years indicating that the MAO-B inhibitor deprenyl can protect neuronal cells from a variety of insults by a mechanism that does not appear to involve inhibition of MAO-B (for review, see Ref. 49). Other MAO-B inhibitors are ineffective in the same models and the S isomer of deprenyl is completely ineffective, although it does inhibit MAO-B activity (44). Furthermore, a metabolite of deprenyl, desmethylselegiline, is a significantly more potent inhibitor of neuronal cell death than deprenyl but a much less potent MAO-B inhibitor (50). Deprenyl was found to protect neuronal cells in an MAO-B-independent manner in a variety of in vivo and in vitro models of cell death. These include preventing DSP-4-induced neuronal cell death in the hippocampus (51), reducing the death of motor neurons caused by axotomy (52), protecting cultured dopaminergic neurons from excitotoxic damage associated with the activation of NMDA receptors (53) or exposure to nitric oxide (54) and inhibiting the cell death associated with trophic factor withdrawal in PC12 cells (55). However, there are some other models of neuronal cell death where deprenyl is ineffective, including PCD induced by low extracellular potassium in cerebellar granule cells (56). The mechanism for protection by deprenyl is not clear. There is some evidence that deprenyl induces the synthesis of several different classes of proteins that mediate cell survival (49,55). However,
192
Maher and Tan
deprenyl was also reported to protect cells in a model where protein synthesis inhibitors can block cell death (54). Deprenyl has also been shown to prevent the loss of mitochondrial function (44) but whether this is related to its ability to induce new protein synthesis is not clear. However, what is clear is that MAO inhibitors have the ability to protect cells from various types of insults that can induce PCD in a manner independent of their ability to block the biodegradation of aromatic monoamines. Different forms of PCD induced by distinct insults may be blocked by different classes of MAO inhibitors because these inhibitors block distinct steps in the pathways leading to cell death. Further studies will be needed to clarify this issue. VII. SUMMARY Our results, as well as those from other laboratories, clearly indicate that MAO inhibitors can act within the cell at sites distinct from MAO and, in doing so, can protect cells from various insults which induce PCD. The nature of these sites is still not clear but our data indicate that, at least in the case of the protection provided by MAO-A inhibitors, these sites are within the mitochondria and are probably part of the electron transport chain. As mentioned above, hydrogen peroxide production by the electron transport chain is thought to come primarily from two sites: complex I and complex III. Although the production of hydrogen peroxide by mitochondria isolated from the HT22 cells is only observed when succinate is used as a substrate and this production is blocked by the MAO-A inhibitor clorgyline, it is still possible that complex I is the site of action of clorgyline since there is evidence that succinate-supported mitochondrial hydrogen peroxide generation occurs at both complex III and complex I (57). Both complex III and complex I contain large numbers of proteins, many of which do not play a direct role in electron transfer or proton translocation. Nevertheless, it is possible that the modification of one or more of these proteins by clorgyline could inhibit the production of hydrogen peroxide by the electron transport chain. Further studies are required to resolve this issue. While the action of the MAO-A inhibitors on the electron transport chain is apparently independent of monoamines, the studies with the monoamine uptake inhibitors suggest that monoamine metabolism by MAO could contribute to oxidative glutamate toxicity and other forms of oxidative stress. ACKNOWLEDGMENTS The authors thank Drs. John Davis, Yutaka Sagara, Yuanbin Liu, and, especially, David Schubert for technical advice and helpful discussions. This work was supported by Grant 5PO1NS28121 from the National Institutes of Health.
MOAs, MAOIs, and Mitochondrial Function
193
REFERENCES 1. Rubin, L.L. (1997) Neuronal cell death: when, why and how. Br. Med. Bull. 53, 617–631. 2. Ames, B.N., Shigenaga, M.K., and Hagen, T.M. (1993) Oxidants, antioxidants, and the degenerative diseases of aging. Proc. Natl. Acad. Sci. USA S.A. 90, 7915–7922. 3. Beal, M.F. (1995) Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 38, 357–366. 4. Coyle, J.T. and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262, 689–695. 5. Choi, D.W. (1988) Glutamate neurotoxicity and diseases of the nervous system. Neuron 1, 623–634. 6. Olney, J.W. (1969) Brain lesions, obesity and other disturbances in mice treated with monosodium glutamate. Science 164, 719–721. 7. Murphy, T.H., Miyamoto, M., Sastre, A., Schnaar, R.L., and Coyle, J.T. (1989) Glutamate toxicity in a neuronal cell line involves inhibition of cystine transport leading to oxidative stress. Neuron 2, 1547–1558. 8. Garthwaite, J., Garthwaite, G., and Hajos, F. (1986) Amino acid neurotoxicity: relationship to neuronal depolarisation in rat cerebellar slices. Neuroscience 18, 449– 460. 9. Vornov, J.J. and Coyle, J.T. (1991) Glutamate neurotoxicity and the inhibition of protein synthesis in the hippocampal slice. J. Neurochem. 56, 996–1006. 10. Greene, J.G. and Greenamyre, J.T. (1995) Exacerbation of NMDA, AMPA and I-glutamate excitotoxicity by the succinate dehydrogenase inhibitor malonate. J. Neurochem. 64, 2332–2338. 11. Gwag, B.J., Lobner, D., Koh, J.Y., Wie, M.B., and Choi, D.W. (1995) Blockade of glutamate receptors unmasks neuronal apoptosis after oxygen-glucose deprivation in vitro. Neurosci. 68, 615–619. 12. Newell, D.W, Barth, A., Papermaster, V., and Malouf, A.T. (1995) Glutamate and non-glutamate receptor mediated toxicity caused by oxygen and glucose deprivation in organotypic hippocampal cultures. J Neurosci. 15, 7702–7711. 13. Owen, A.D., Schapira, H.V., Jenner, P., and Marsden, C.D. (1996) Oxidative stress and Parkinson’s disease. Ann. N. Y. Acad. Sci. 786, 217–223. 14. Koroshetz, W.J. and Moskowitz, M.A. (1996) Emerging treatments for stroke in humans. TiPS 17, 227–233. 15. Pilebad, E., Magnusson, T., and Fornstedt, B. (1989) Reduction of brain glutathione by L-buthionine sulfoximine potentiates the dopamine-depleting action of 6-hydroxydopamine in rat striatum. J. Neurochem. 52, 978–980. 16. Wullner, U., Loschmann, P.A., Schulz, J.B., Schmid, A., Dringen, R., Eblen, F., Turski, L., and Klockgether, T. (1996) Glutathione depletion potentiates MPTP and MPP⫹ toxicity in nigral dopaminergic neurons. NeuroRep. 7, 921–923. 17. Davis, J.B. and Maher, P. (1994) Protein kinase C activation inhibits glutamateinduced cytotoxicity in a neuronal cell line. Brain Res. 652, 169–173. 18. Maher, P. and Davis, J.B. (1996) The role of monoamine metabolism in oxidative glutamate toxicity. Neuroscience 16, 6394–6401.
194
Maher and Tan
19. Miyamoto, M., Murphy, T.H., Schnaar, R.L., and Coyle, J.T. (1989) Antioxidants protect against glutamate-induced cytotoxicity in a neuronal cell line. J Pharmacol Exp. Ther. 250, 1132–1140. 20. Froissard, P. and Duval, D. (1994) Cytotoxic effects of glutamic acid on PC12 cells. Neurochem. Int. 24, 485–493. 21. Murphy, T.H., Schnaar, R.L., and Coyle, J.T. (1990) Immature cortical neurons are uniquely sensitive to glutamate toxicity by inhibition of cystine uptake. FASEB J. 4, 1624–1633. 22. Erdo, S.L., Michler, A., Wolff, J.R., and Tytko, H. (1990) Lack of excitotoxic cell death in serum-free cultures of rat cerebral cortex. Brain Res. 526, 328–332. 23. Oka, A., Belliveau, M.J., Rosenberg, P.A., and Volpe, J.J. (1993) Vulnerability of oligodendroglia to glutamate: pharmacology, mechanisms and prevention. J. Neurosci. 13, 1441–1453. 24. Li, Y., Maher, P., and Schubert, D. (1997) A role of 12-lipoxygenase in nerve cell death caused by glutathione depletion. Neuron 19, 453–463. 25. Tan, S., Sagara, Y., Liu, Y., Maher, P., and Schubert, D. (1998) The regulation of reactive oxygen species production during programmed cell death. J. Cell Biol. 141, 1423–1432. 26. Tan, S., Wood, M., and Maher, P. (1998) Oxidative stress induces a form of programmed cell death with characteristics of both apoptosis and necrosis in neuronal cells. J. Neurochem. 71, 95–105. 27. Li, Y., Maher, P., and Schubert, D. (1998) Phosphatidylcholine-specific phospholipase C regulates glutamate-induced nerve cell death. Proc. Natl. Acad. Sci. USA 95, 7748–7753. 28. Li, Y., Maher, P., and Schubert, D. (1997) Requirement for cGMP in nerve cell death caused by glutathione depletion. J. Cell Biol. 139, 1317–1324. 29. Weyler, W., Hsu, Y.-P. P., and Breakefield, X.O. (1990) Biochemistry and genetics of monoamine oxidase. Pharmacol. Ther. 47, 391–417. 30. Singer, T.P. and Ramsay, R.R. (1995) Monoamine oxidases: old friends hold many suprises. FASEB J. 9, 605–610. 31. Kalgutkar, A.S. and Castagnoli, N. (1995) Selective inhibitors of monoamine oxidase (MAO-A and MAO-B) as probes of its catalytic site and mechanism. Med. Res. Rev. 15, 325–388. 32. Richter, C., Gogvadze, V., Laffranchi, R., Schlapbach, R., Schweizer, M., Suter, M., Walter, P., and Yaffee, M. (1995) Oxidants in mitochondria: from physiology to diseases. Biochim Biophys Acta 1271, 67–74. 33. Gonzalez-Flecha, B. and Boveris, A. (1995) Mitochondrial sites of hydrogen peroxide production in reperfused rat kidney cortex. Biochim Biophys Acta 361– 366. 34. Nohl, H. (1994) Generation of superoxide radicals as byproduct of cellular respiration. Ann. Biol. Clin. 52, 199–204. 35. Cai, J. and Jones, D.P. (1998) Superoxide in apoptosis. J. Biol. Chem. 273, 11401– 11404. 36. Zoccarato, F., Cavallini, L., Deana, R., and Alexandre, A. (1988) Pathways of hydrogen peroxide generation in guinea pig cerebral cortex mitochondria. Biochem. Biophys. Res. Commun. 154, 727–734.
MOAs, MAOIs, and Mitochondrial Function
195
37. Harris, D.A. (1995) Bioenergetics at a Glance. Blackwell Scientific, Oxford. 38. Skulachev, V.P. (1996) Why are mitochondria involved in apoptosis? FEBS Lett. 397, 7–10. 39. Richelson, E. (1994) Pharmacology of anti-depressants-characteristics of the ideal drug. Mayo Clin. Proc. 69, 1069–1081. 40. Froissard, P., Monrocq, H., and Duval, D. (1997) Role of glutathione metabolism in the glutamate-induced programmed cell death of neuronal-like PC12 cells. Eur. J. Pharmacol. 326, 93–99. 41. Bottenstein, J. and Sato, G. (1979) Growth of a rat neuroblastoma cell lines in serumfree supplemented medium. Proc. Natl. Acad. Sci. USA 76, 514–517. 42. Ben-Shachar, D., Zuk, R., and Glinka, Y. (1995) Dopamine neurotoxicity: inhibition of mitochondrial respiration. J. Neurochem. 64, 718–723. 43. Wouters, J. and Baudoux, G. (1998) First partial three-dimensional model of human monoamine oxidase A. Proteins: Struct. Func. Genet. 32, 97–110. 44. Dostert, P. (1994) Can our knowledge of monoamine oxidase (MAO) help in the design of better MAO inhibitors? J. Neural Transm. 41, 269–279. 45. Zhou, B.P., Wu, B., Kwan, S.W., and Abell, C.W. (1998) Characterization of a highly conserved FAD-binding site in human monoamine oxidase B. J. Biol. Chem. 273, 14862–14868. 46. Chen, K. and Shih, J.C. (1998) Monoamine oxidase A and B: structure, function, and behavior. Adv. Pharmacol. 42, 292–296. 47. Cesura, A.M., Gottowik, J., Lang, G., Malherbe, P., and DaPrada, M. (1998) Structure–function relationships of mitochondrial monoamine oxidase A and B: chimaeric enzymes and site-directed mutagenesis studies. J. Neural Transm. Suppl. 52, 189–200. 48. Malorni, W., Giammarioli, A.M., Matarrese, P., Pietrangeli, P., Agostinelli, E., Ciaccio, A., Grassili, E., and Mondovi, B. (1998) Protection against apoptosis by monoamine oxidase A inhibitors. FEBS Lett. 426, 155–159. 49. Tatton, W.G. and Chalmers-Redman, R.M.E. (1996) (⫺)-Deprenyl-related compounds in controlling neurodegeneration. Neurology 47, S171–S183. 50. Mytilineou, C., Radcliffe, P.M., and Olanow, C.W. (1997) l-(⫺)-desmethylselegiline, a metabolite of selegilin (l-(⫺)-deprenyl1), protects mesencephalic dopamin neurons from excitotoxicity in vitro. J. Neurochem. 68, 434–436. 51. Finnegan, K.T., Skratt, J.J., Irwin, I., DeLanney, L.E., and Langston, J.W. (1990) Protection against DSP-4-induced neurotoxicity by deprenyl is not related to its inhibition of MAO B. Eur. J. Pharmacol. 184, 119–126. 52. Ansari, K.S., Yu, P.H., Kruck, T.P.A., and Tatton, W.G. (1993) Rescue of axotomized immature rat facial motoneurons by R(⫺)-deprenyl: stereospecificity and independence from monoamine oxidase inhibition. J. Neurosci. 13, 4042–4053. 53. Mytilineou, C., Radcliffe, P., Leonardi, E.K., Werner, P., and Olanow, C.W. (1997) l-Deprenyl protects mesencephalic dopamine neurons from glutamate receptormedicated toxicity in vitro. J. Neurochem. 68, 33–39. 54. Maruyama, W., Takahashi, T., and Naoi, M. (1998) (⫺)-Deprenyl protects human dopaminergic neuroblastoma SH-SY5Y cells from apoptosis induced by peroxynitrite and nitric oxide. J. Neurochem. 70, 2510–2515. 55. Tatton, W.G., Ju, W.Y.L., Holland, D.P., Tai, C., and Kwan, M. (1994) (⫺)-De-
196
Maher and Tan
prenyl reduces PC12 cell apoptosis by inducing new protein synthesis. J. Neurochem. 63, 1572–1575. 56. Paterson, I.A., Zhang, D., Warrington, R.C., and Boulton, A.A. (1998) R-Deprenyl and R-2-heptyl-N-methylpropargylamine prevent apoptosis in cerebellar granule neurons induced by cytosine arabinoside but not low extracellular potassium. J. Neurochem. 70, 515–523. 57. Kwong, L.K. and Sohal, R.S. (1998) Substrate and site specificity of hydrogen peroxide generation in mouse mitochondria. Arch. Biochem. Biophys. 350, 118–126.
9 Interplay Between Oxidative Stress and Calcium Homeostasis in Acute Neuronal Damage and Neurodegenerative Disease Julie K. Andersen and Veena Viswanath University of Southern California, Los Angeles, California
I. INTRODUCTION Due to a rapidly growing body of scientific evidence, the concept that production of reactive oxygen species (ROS) and sustained elevation in levels of intracellular calcium are major components in various types of neuropathological events has gained wide acceptance in the past several years. Not only do aberrant increases in levels of these compounds appear to damage neurons but they also appear to interact with one another to bring about and accentuate their respective harmful effects. In this chapter we give a brief review of data suggesting a correlation between these two phenomena both in a well-characterized example of acute neuronal damage, i.e., ischemia/stroke, and in slow neuronal cell death associated with various neurodegenerative diseases.
II. HOW CALCIUM AND ROS CAN INTERACT WITH ONE ANOTHER TO ELICIT NEUROPATHOLOGY: AN OVERVIEW Calcium concentrations in the brain’s extracellular fluids are in the range of 1– 2 mM. Intracellular calcium concentrations within the neurons themselves are normally maintained at around 100 nM due to a balance between calcium influx 197
198
Andersen and Viswanath
through voltage or ligand-gated calcium ion channels and calcium efflux by active transport and through Ca2⫹ /Na⫹ exchange, through sequestration of calcium in the endoplasmic reticulum (ER), mitochondria, and nucleus, and its chelation by cytoplasmic calcium-binding proteins (Fig. 1) (1,2). In addition to influx through receptor-linked calcium ion channels, stimulation of receptors not directly linked to such channels (e.g., G protein–linked metabotropic glutamate receptors) may also act to raise intracellular calcium levels via activation of IP3 or ryanodine receptors on the ER via second messengers that elicit release of calcium from this intracellular store. Maintenance of intracellular calcium at low nanomolar concentrations through the interplay of these various processes results in a concentration gradient across the membrane which, when disturbed, can signal both physiological events such as neurotransmitter release and, if sustained, pathological events including activation of calcium-dependent proteases that can damage cytoskeletal and membrane proteins, lipases that can catalyze hydrolysis of membrane phospholipids, and endonucleases that can cleave DNA. Increased calcium can also stimulate other calcium-dependent processes such as conversion of xanthine dehydrogenase to xanthine oxidase (XO) and activation of calmodulin-dependent nitric oxide synthase (NOS). Activation of both XO and NOS results in the production of ROS, specifically superoxide (O2•) and hydrogen peroxide (H2O2) or nitric oxide (NO•), respectively, which can either themselves be toxic to neurons or can undergo further reactions that can produce neurotoxic products. These include peroxynitrite (ONOO⫺) formed as a byproduct of the rapid reaction of superoxide with nitric oxide and hydroxyl radical (OH•) formed either as a consequence of hydrogen peroxide conversion by transition metals such as Fe2⫹ via the Fenton reaction or by decomposition of ONOO⫺. In addition to XO and NOS, increased calcium can activate phospholipase A2 (PLA2), which elicits the release of arachidonic acid which, when further metabolized by lipoxygenases or cyclooxygenases, liberates free fatty acids from the plasma membrane. Free fatty acids can increase mitochondrial membrane damage and cause subsequent mitochondrial uncoupling and ROS generation (3–5).
Figure 1 Control of intracellular Ca2⫹ levels. Intracellular Ca2⫹ levels are maintained due to a balance between calcium influx through agonist and voltage-gated channels or metabotropic receptors via activation of ionositol triphosphate (IP3) and calcium efflux by active transport or ion exchange, through sequestration of calcium in the endoplasmic reticulum, nucleus, and mitochondria, and chelation by cytoplasmic calcium-binding proteins like calmodulin.
Oxidative Stress and Calcium Homeostasis
199
200
Andersen and Viswanath
Of all of the oxidant species produced by these various reactions, hydroxyl radical is the most volatile, its reactivity being limited only by its rate of diffusion. O•2 and ONOO⫺ are less reactive and therefore capable of acting at a distance from their sites of production. ROS produced by all of these reactions are believed to damage neurons by rapidly reacting with various organic molecules within the cell such as DNA, proteins, and membrane lipids and thereby affecting the function of these cellular components. Besides being capable of activating various enzymes, a large, sustained increase in intracellular calcium can also result in increased transport and sequestration of calcium within the mitochondria by a high-capacity, low-affinity calcium uniporter (6). This can eventually trigger the assembly and transient opening of the mitochondria permeability transition (MPT) pore in the inner mitochondrial membrane, leading to the collapse of the electrochemical proton potential (7). This results in decreased ATP production and increased production of incompletely reduced oxygen species which, as mentioned above, are highly reactive and detrimental to the cell. For example, O2• produced in this process is capable of further affecting mitochondrial function by inactivating mitochondrial enzymes such as those making up complex I perhaps via oxidation of the complex’s iron-sulfur clusters (8). Opening of the MPT pore appears to be triggered by the presence of ONOO⫺ and OH•, suggesting that free radicals are not only formed by this process but may contribute to it as well (9,10). In neuronal cells, a decrease in energy metabolism and inability to maintain cellular ATP levels can result in membrane depolarization and influx of calcium via various calcium ion channels creating a vicious cycle of increased calcium and subsequent oxidative stress that can eventually lead to loss of neuronal function (Fig. 2). Sustained intracellular calcium levels may also result in depletion of available ATP via increased consumption as activation of many of the uptake systems required for its sequestration into organelles as well as its extrusion are energy-requiring processes. In addition, some components such as the ER calcium importer appear to be themselves very susceptible to oxidative damage, suggesting that not only do sustained increases in intracellular calcium levels appear to result in increased oxidative stress, but generation of ROS itself may result in increased calcium levels within the cytoplasm (2). In fact, disruption of calcium homeostasis via free radical–mediated inhibition of one or more of the membrane ATPases has been proposed to be a major player in cellular impairment associated with both cerebral and cardiac ischemia (see below) (11–15). In the heart, ischemic damage can be produced by exposure of cells to oxygen radicals resulting in an intracellular calcium overload, possibly through inhibition of both the Na⫹ /K⫹ ATPase and the Ca2⫹ ATPase (16–18).
Oxidative Stress and Calcium Homeostasis
201
Figure 2 Destructive calcium–ROS cycle. Disturbance of intracellular calcium levels leads to activation of calcium-dependent proteases, nucleases, and lipases, e.g., phospholipase A2 (PLA2). This catalyzes the hydrolysis of membrane lipids, freeing fatty acids (FAs) which can cause mitochondrial uncoupling and generation of ROS. Increased Ca2⫹ levels also lead to conversion of xanthine dehydrogenase (XD) to xanthine oxidase (XO) and activation of nitric oxide synthetase (NOS) producing hydrogen peroxide (H2O2), superoxide (O2•), and nitric oxide; O2• can combine with NO• to create peroxynitrite (ONOO⫺). ONOO⫺ can decompose to form hydroxyl radical (OH•) and nitrous oxide (NO 2⫺) and H2O2 can react with ferrous iron (Fe2⫹) to form OH•. Increased intracellular calcium also results in increased sequestration of Ca2⫹ in the mitochondria, causing the opening of the mitochondrial permeability transition (MPT) pore which results in collapse of mitochondrial membrane potential and production of ROS and decreased ATP production. The combined effects of increased ROS and decreased ATP can affect the ATP-requiring Ca2⫹ mobilization systems resulting in further increases in intracellular Ca2⫹ levels, thus resulting in a cycle of increased calcium and ROS.
202
III.
Andersen and Viswanath
ROLE OF OXIDATIVE STRESS AND DISRUPTION OF CALCIUM HOMEOSTASIS IN ACUTE NEURONAL DAMAGE: STROKE
Cerebral ischemia involves damage to brain tissue as a result of depletion of the available oxygen and/or nutrient supply, often due to the formation of a blood clot in cerebral vessels which inhibits the flow of blood into the area. Recovery of blood flow into the region by removal of the clot has also been reported to result in tissue injury. Acute increases in both intracellular calcium levels and ROS have been suggested by several lines of evidence to be associated with neuronal damage accompanying transient cerebral ischemia (e.g., Refs. 12, 15, 19–25). It is in fact not difficult to conceive that even a temporary decrease in blood supply levels to various brain regions could have a profound effect on mitochondrial function in high-energy-requiring cells like neurons, which in turn could result in cellular injury as a consequence of increased production of ROS and disruption of calcium homeostasis. Because of the high concentration of calcium channels in their plasma membranes, certain neurons in the brain may be particularly prone to disruption in calcium homeostasis (12). Opening of these calcium ion channels is in general dependent on either binding of the excitatory amino acid neurotransmitter glutamate or glutamate-like compounds such as N-methyl-d-aspartate (NMDA), kainate, or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) to receptors linked to these channels (ligand-dependent) or on the polarization state of the plasma membrane (voltage-dependent). The ability of NMDA to open calcium channels is dependent on both as it requires not only binding of ligand to receptor but also membrane depolarization, which allows release of a voltagedependent Mg2⫹ block on the NMDA receptor–coupled calcium ion channel. Neuronal injury elicited as a consequence of the actions of excitatory amino acids has been termed the excitatory theory of neurotoxicity (26). Vulnerability of neurons to this type of toxicity may be dependent on their concentration of ionotrophic glutamate receptors; these are high, for example, in the CA1 region of the hippocampus that is found to be particularly affected in forebrain ischemia, suggesting that excitotoxicity plays a role in neuronal cell death associated with this process (23). In various models of ischemia, a rise in intracellular calcium appears to occur via increased influx due to activation of ionotrophic glutamate receptors (19,27–29). The NMDA receptor appears to be the most important in mediating cell death via increases in calcium levels perhaps due to compartmentalization of calcium-mediated processes near it in the plasma membrane (30,31). Binding of agonist to non-NMDA receptors (e.g., AMPA) that are primarily permeable to Na⫹ ion may initiate action by sensitizing the NMDA receptor to glutamate
Oxidative Stress and Calcium Homeostasis
203
by allowing partial membrane depolarization to occur resulting in a release of the voltage-dependent Mg2⫹ block. In fact, the AMPA receptor appears to be responsible for most fast glutamate-stimulated transmission (32). Release of calcium from intracellular stores may also contribute to the rise in cytoplasmic calcium (33–35). Release of calcium from the ER, for example, has been implicated in ischemic injury to neurons (36). Part of the in vivo toxicity elicited by increased calcium levels may be accounted for due to calciummediated increases in NO• and O2• via stimulation of NOS and XO activities, respectively (37–40). Increased sequestration of calcium in the mitochondria and its subsequent detrimental effects may also play a role; mitochondrial calcium levels were found to increase following transient ischemia and this increase was found to occur prior to cell death (41,42). In fact, physical swelling of the mitochondria is one of the first signs of excitotoxic neuronal injury (26). A loss in mitochondrial function as a result of mitochondrial calcium uptake could result in membrane depolarization and further calcium influx through voltage-dependent channels. Increased sequestration of calcium could also activate the MPT pore leading to loss of mitochondrial function; excitotoxic cell death in vitro is preceded by depolarization of the mitochondrial inner membrane and can be blocked by cyclosporin A, which inhibits opening of the pore (23,43–45). Increased calcium levels during and following ischemia may also affect the activation of protein kinases and phosphatases such as calmodulin-dependent protein kinase II and protein kinase C whose activities control aspects of gene expression/protein synthesis and membrane function/ion conductances, as well as having regulatory effects on NMDA receptors themselves (2,14,23,46). This may, among other things, act to disturb signal transduction events that alter the way calcium is handled by the cell membrane, which could result in various effects on the cell (47). It has also been suggested that mitochondrial failure could be enhanced by the breaking down of cytoskeletal components via calcium-mediated processes needed to propel the mitochondria into proximity of the nucleus in order to receive nuclearly encoded materials needed for construction of mitochondrial enzyme complexes (48). This would result in reduced activities of these enzyme complexes and decreased ATP production. This hypothesis, however, awaits further verification. Direct evidence exists for the role that the generation of ROS plays in the neuropathology associated with cerebral ischemia; free radical scavengers have been demonstrated to ameliorate ischemic cell death (e.g., 49–53). ROS may be produced as a consequence of calcium-activated enzymes or decreased mitochondrial function as a consequence of mitochondrial calcium overload and stimulation of the MPT. Resulting ROS creation could in turn result in oxidation of proteins and/or lipids involved in regulating calcium levels within the cell, thus perpetuating the disruption of calcium homeostasis and all of
204
Andersen and Viswanath
its effects. Oxidative stress may also induce release of glutamate and increase levels extracellularly, which can in turn increase intracellular calcium concentrations (54).
IV.
A.
OXIDATIVE STRESS AND DISRUPTION OF CALCIUM HOMEOSTASIS AS THEY RELATE TO SLOW NEURONAL CELL LOSS: NEURODEGENERATIVE DISEASES Huntington’s Disease
Huntington’s disease (HD) is an age-related disorder characterized by choreic movements and progressive dementia. This disease is hereditary, resulting from expansion in a CAG trinucleotide repeat in the coding region of the huntington gene on chromosome 4. This mutation results in degeneration of a subset of GABAergic neurons in the basal ganglia. Production of genetically engineered mice in which the gene has been ‘‘knocked out’’ results in embryonic lethals, indicating that HD is not the result of a loss of function mutation but rather is due to the gain of function by the protein (55,56). Several of the pathological hallmarks of HD can be mimicked via intrastriatal injection of glutamate agonists including selective loss of spiny neurons of the striatum. Based on these findings it has been proposed that the disease may be due to a preexisting metabolic defect resulting in impaired mitochondrial energy metabolism perhaps exacerbated by age-related declines rendering striatum neurons more vulnerable to normal physiological levels of glutamate or related endogenous compounds. This has been termed ‘‘slow excitotoxicity’’ as opposed to what is believed to occur in the acute chronic sort of excitotoxicity associated with stroke, which is believed to involve excess extracellular levels of the excitatory amino acid as a result of increased release and decreased presynaptic uptake, e.g., 57–60. Administration of chronic low dosages of 3-nitroproprionic acid (3-NP), an inhibitor of succinate dehydrogenase and therefore of mitochondrial respiration at complex II of the electron transport chain, resulted in selective striatal lesions which are age-dependent and in motor movement impairment in primates closely resembling that seen in the disease (31). In addition, the pathological effects of 3-NP administration could be attenuated by pretreatment with either inhibitors of glutamate release or excitatory amino acid receptor antagonists, suggesting the involvement of a secondary excitotoxicity in the neurotoxicity associated with this process. This is most likely due to a decrease in ATP production resulting in partial loss of polarization of neuronal cell membranes, the release of the Mg2⫹ block on NMDA receptors which allows normal extracellular levels of glutamate to induce NMDA receptor activation, and influx of cal-
Oxidative Stress and Calcium Homeostasis
205
cium which could result in a sustained disruption of calcium homeostasis with all of its subsequent degenerative effects. B.
Alzheimer’s Disease
Alzheimer’s disease (AD) is currently the most prevalent cause of progressive intellectual failure in older individuals. A primary pathological feature of Alzheimer’s disease is the increased age-related formation of extracellular deposits in the cerebral cortex and hippocampus of affected individuals known as amyloid plaques, named for the presence of aggregates of a 40- to 42-amino-acid species called β-amyloid (Aβ); Aβ is itself an aberrantly cleaved fragment of the larger membrane-associated amyloid precursor protein (APP). Some cases of familial AD have been demonstrated to be due to mutations in the APP gene and these mutations appear to promote increased production of Aβ (61–63). In addition, transgenic mice expressing mutant forms of APP show a regionally specific increase in Aβ deposition that increases with age and results in AD-like neurodegeneration in those brain areas containing Aβ (64,65). Several lines of evidence suggest that the ability of Aβ aggregates to cause neuronal injury to hippocampal neurons in AD results from accumulation of ROS (66,67). For example, exposure of cultured hippocampal neurons to Aβ results in increased ROS production along with increases in both protein oxidation and lipid peroxidation. This results in decreased cellular viability, and neurodegeneration of these cells can be prevented by treatment with antioxidants (65,68). In organotypic hippocampal cultures, which, unlike dissociated hippocampal neurons, maintain the synaptic circuitry of the hippocampus and may more closely model the hippocampus in vivo, Aβ toxicity is also preventable using a general synthetic scavenger of superoxide/hydrogen peroxide (69). It has been suggested that Aβ-catalyzed increases in ROS production result in inhibition of ion-motive ATPases yielding a subsequent loss in intracellular calcium homeostasis which may contribute to the toxic effects of the compound (70,71). Injection of the Na⫹K⫹ ATPase inhibitor ouabain into the hippocampus results in calcium-mediated necrosis of cells in the region, and Na⫹ /K⫹ ATPase activity has in fact been found to be markedly reduced in the brains of AD patients vs. age-matched controls (72–74). Plasma membrane ATPases are very sensitive to perturbation of surrounding membrane lipids; lipid peroxidation results in a decrease in their activities, and structural alterations in membranes have been reported in the brains of AD patients vs. age-matched controls (75). Oxidative damage, therefore, to either the plasma membrane ion ATPases themselves or their lipid environment would likely lead to events that could contribute to a decrease in activity of these molecules and a resultant increase in intracellular calcium levels. In addition, resting calcium concentration levels have been re-
206
Andersen and Viswanath
ported to increase in hippocampal and cortical neurons with age, which could also contribute to this effect (76). Aβ has been reported to render hippocampal neurons more susceptible to glutamate toxicity (77,78). This has been suggested to be due to the ability of ROS production to decrease activity of the Na⫹ /K⫹ ATPase resulting in depolarization and removal of the Mg2⫹ blockade on the NMDA receptor-linked calcium channel and possibly to oxidation of surrounding plasma membrane lipids, making it more probable that the NMDA-linked calcium channel will be in an open state (79). Increases in cellular calcium can consequentially activate PLA2 and/ or calcium uptake by the mitochondria resulting in increased ROS production due to decreased mitochondrial function. Exposure of cultured neurons to Aβ has also been demonstrated to impair mitochondrial function and cause damage to high-affinity glial glutamate transporters which would have the effect of increasing the level of extracellular glutamate at the synapse apparently via production of 4-hydroxynonenal (4-HNE), an aldehyde byproduct of lipid peroxidation (80,81). C.
Parkinson’s Disease
Parkinson’s disease (PD) is an age-related neurodegenerative condition that occurs in 1% of the population over 65 and is characterized by a progressive loss in the ability to initiate voluntary motor movement. PD involves a selective loss of dopaminergic neurons in an area of the midbrain called the substantia nigra (SN). This brain region makes connections with other brain areas such as the striatum, cortex, and thalamus and via this circuitry aids in the coordination of voluntary motor control. Dopaminergic neurons are believed to be particularly prone to oxidative stress due to their high rate of oxygen metabolism and the potential for dopamine oxidation to occur either through autooxidation or via metabolism by the enzyme monoamine oxidase (MAO) (82). Oxidative deamination of dopamine produces H2O2 which, as mentioned previously, can react with free Fe2⫹ to produce OH• which in turn can cause damage to proteins, nucleic acids, and membrane phospholipids (30,31). Levels of both lipid peroxidation and 8-hydroxydeoxyguanosine (8-OHdG), indicators of oxidative membrane and DNA damage, respectively, have been demonstrated to be elevated in the SN of PD patients compared with age-matched controls (83–85). PD is also characterized by decreases in SN levels of the thiol tripeptide antioxidant compound glutathione (GSH) (86–89). GSH is believed to be the predominant intracellular molecule involved in the removal of hydroperoxides from the brain as well as for the removal via conjugation of various toxic byproducts of oxidative stress such as 4-HNE produced during oxidation of membrane
Oxidative Stress and Calcium Homeostasis
207
lipids. It can also eliminate both O2• and OH• via nonenzymatic reactions. Although GSH is not the only antioxidant molecule reported to be altered in PD, it is the only one that shows a significant depletion in incidental Lewy body disorder of the basal ganglia, a closely related disease and arguably a precursor of PD (90,91). Decreases in GSH availability in the brain are believed to promote mitochondrial damage perhaps via increased levels of ROS (92–94). Reductions in the activities of mitochondrial complex I as well as II/III have been reported in PD (30,31,95,96). Depletion of brain GSH has been shown to result in decreases in mitochondrial enzyme activities in preweaning rats as well as losses in ATP production in the aging murine brain (97,98). Studies from our laboratory indicate that depletion of GSH and resulting oxidative stress also results in perturbation of calcium homeostasis within dopaminergic cells via decreased activity of the Na⫹ /K⫹ ATPase possibly as a result of decreased mitochondrial function and ATP synthesis (94, unpublished results). It is interesting to note in this light that levels of the calcium-binding protein calbindin have been found to be decreased in the autopsied brains of PD patients and those neurons that are spared in the disease appear to express elevated levels of the protein (99–101). 1-Methyl-4-phenyl-1,2,6-tetrahydropyridine (MPTP) is a protoxin that causes selective destruction of the pars compacta of the SN in humans and other primates resulting in an acute parkinsonism. Following injection, it crosses the blood–brain barrier and is converted by the B isoform of MAO within glia to its active form, 1-methyl-4-phenylpyridinium (MPP⫹). MPP⫹ is taken up by a receptor-mediated mechanism into dopaminergic neurons and then into the mitochondria where it is postulated to evoke its toxic effects through inhibition of complex I resulting in a reduction in ATP synthesis. While MPTP administration does not perfectly mimic the full range of pathological changes that occur in PD, MPTP-treated primates do exhibit the major hallmarks of the disease including substantial loss of dopaminergic SN neurons. In experimental studies in mice, MPTP administration results in damage to neurons in the SN that can be prevented by treatment with antioxidants (e.g., 102). Evidence from both superoxide dismutase (SOD) transgenic and glutathione peroxidase (GSHPx) knockout mouse lines indicates that this agent mediates its deleterious effects at least in part through induction of oxidative damage since increased expression of either of these enzymes is protective against its toxicity (103,104). In addition, the free radical spin-trap compound N-tert-butyl-α-(2sulfophenyl)nitrone (S-PBN) significantly attenuates degeneration of SN neurons in rats resulting from intrastriatal injection of MPP⫹ (105). MPP⫹ has been shown to produce O2, H2O2, and •OH possibly through interaction with the MPTP reaction intermediate 1-methyl-4-phenyl-2,3-dihydropyridinium (MPDP⫹) (106– 108). MPTP not only causes an increase in ROS production and degeneration of
208
Andersen and Viswanath
dopaminergic neurons, but it also results in a decrease in GSH levels in the SN (109,110). The decrease in GSH is specific to the SN and does not occur in the neighboring dopaminergic cell populations in the basal ganglia (111). An increase in ROS could result in damage to the mitochondria resulting in a decrease in energy production. A release of the magnesium block on NMDA channels due to subsequent partial loss of membrane depolarization as a result of mitochondrial dysfunction may explain why NMDA blockers act to prevent MPTP toxicity (112). This secondary excitotoxicity may lead to further mitochondrial dysfunction, feeding into an ongoing cycle of mitochondrial deficit, ROS production and GSH depletion, and NMDA receptor activation.
V.
CONCLUSIONS
Oxidative stress and disruption of calcium homeostasis linked by defects in mitochondrial energy metabolism appear to be a common feature leading to neuronal cell death in several different conditions. The ability of a combined increase in ROS and intracellular calcium to damage neurons may be dependent on both the severity of the elevation and the time over which it occurs; in the case of acute conditions like stroke, changes in these two parameters may be acute and rapid, whereas in the case of chronic neurodegenerative diseases changes may be smaller but sustained over a longer period of time. However, the interplay between these phenomena still appears to represent the final common pathway for neuropathological events accompanying either type of condition and suggests that coupled use of both antioxidants and calcium-blocking drugs may be beneficial treatment for both.
REFERENCES 1. Orrenius, S., Burkitt, M.J., Kass, G.E.N., Dypbukt, J.M., and Nicotera, P. (1992) Calcium ions and oxidative injury. Ann. Neurol. 32, S33–S42. 2. Leist, M., and Nicotera, P. (1998) Calcium and neuronal death. Rev. Physiol. Biochem. Pharmacol. 132, 79–125. 3. Bazan, N. (1970) Effects of ischemia and electroconvulsive shock on free fatty acid pool in the brain. Biochim. Biophys. Acta 218, 1–10. 4. Bazan, N. (1976) Free arachadonic acid and other lipids in the nervous system during early ischemia and after electroshock. Adv. Exp. Med. Biol. 72, 317– 335. 5. Kukreja, R.C., Kontos, H.A., Hess, M.L., and Ellis, E.F. (1986) PGH synthase and lipoxygenase generate superoxide in the presence of NADH or NADPH. Circ. Res. 59, 612–619.
Oxidative Stress and Calcium Homeostasis
209
6. White, R.J., and Reynolds, I.J. (1995) Mitochondria and Na⫹ /Ca2⫹ exchange buffer glutamate-induced calcium loads in cultured cortical neurons. J. Neurosci. 15, 1318–1328. 7. Zoratti, M., and Szabo, I. (1995) The mitochondrial permeability transition. Biochim. Biophys. Acta 1241, 139–176. 8. Boitier, E., Merad-Boudia, M., Guguen-Guillouzo, C., Defer, N., Ceballos-Picot, I., Leroux, J.P., and Marsac, C. (1995) Impairment of the mitochondrial respiratory chain activity in diethylnitrosamine-induced rat hepatomas: possible involvement of oxygen free radicals. Cancer Res. 55, 3028–3035. 9. Crompton, M., Ellinger, H., and Costi, A. (1988) Inhibition by cyclosporin A of a CsA dependent pore in heart mitochondria activated by inorganic phosphate and oxidative stress. Biochem. J. 255, 357–360. 10. Packer, M.A., and Murphy, M.P. (1995) Peroxynitrite formed by simultaneous nitric oxide and superoxide generation causes cyclosporin-A-sensitive mitochondrial calcium efflux and depolarisation. Eur. J. Biochem. 234, 231–239. 11. Fleckenstein, A., Janke, J., Doring, H.J., and Leder, O. (1974) Myocardial fiber necrosis due to intracellular calcium overload: a new principle in cardiac hypertrophy. Rec. Adv. Stud. Card. Struct. Metab. 4, 563–568. 12. Siesjo, B.K. (1981) Cell damage in the brain: a speculative synthesis. J. Cereb. Blood Flow Metab. 1, 155–185. 13. Siesjo, B.K., and Bengtsson, F. (1989) Calcium fluxes, calcium antogonists, and calcium-related pathology in brain ischemia, hypoglycemia, and spreading depression: a unifying hypothesis. J. Cereb. Blood Flow Metab. 9, 127–140. 14. Choi, D.W. (1988) Calcium-mediated neurotoxicity: relationship to specific channel types and role in ischemic damage. Trends Neurosci. 11, 465–469. 15. Choi, D.W. (1995) Calcium: still center stage in hypoxia-ischemic neuronal damage. Trends Neurosci. 18, 58–60. 16. Kaneko, M., Matsumoto, Y., Hayashi, H., Kobayashi, A., and Yamazaki, N. (1994) Oxygen free radicals and calcium homeostasis in the heart. Mol. Cell. Biochem. 139, 91–100. 17. Clague, J.R., and Langer, G.A. (1994) The pathogenesis of free-radical induced calcium leak in cultured rat cardiomyocytes. J. Mol. Cell. Cardiol. 26, 11– 21. 18. Shattock, M.J., and Matsuura, H. (1993) Measurement of Na⫹, K⫹ pump current in isolated rabbit ventricular myocytes using the whole cell voltage clamp technique. Circul. Res. 72, 91–101. 19. Simon, R.P., Griffiths, T., Evan, M.C., Swan, J.H., and Meldrum, B.S. (1984) Calcium overload in selectively vulnerable neurons of the hippocampus during and after ischemia: an electron microscopy study in rats. J. Cereb. Blood Flow Metab. 4, 350–361. 20. Dienel, G.A. (1984) Regional accumulation of calcium in postischemic rat brain. J. Neurochem. 43, 913–925. 21. Choi, D.W., and Rothman, S.M. (1990) The role of glutamate neurotoxicity in hypoxic-ischemic neuronal death. Annu. Rev. Neurosci. 13, 171–182. 22. Kristian, T., and Siesjo, B.K. (1996) Calcium-mediated damage in ischemia. Life Sci. 59: 357–367.
210
Andersen and Viswanath
23. Kristian, T., and Siesjo, B.K. (1998) Calcium-related damage in ischemia. Stroke 29, 705–718. 24. Zini, I., Tomasi, A., Grimaldi, R., Vannini, V., and Agnati, L.F. (1992) Detection of free radicals during brain ischemia and reperfusion by spin trapping and microdialysis. Neurosci. Lett. 138, 279–282. 25. Christensen, T., Bruhn, T., Balchen, T., and Diemer, N.H. (1994) Evidence for formation of hydroxyl radicals during reperfusion after global ischemia in rats using salicylate trapping and microdialysis. Neurobiol. Dis. 1, 131–138. 26. Olney, J.W., Ho, O.L., and Rhee, V. (1971) Cytotoxic effects of acidic and sulphur containing amino acids on the infant mouse central nervous system. Exp. Brain Res. 14, 61–76. 27. Gill, R., Andine, P., Hillered, L., Persson, L., and Hagberg, H. (1992) The effect of MK801 on cortical spreading depression in the penumbrum zone following focal ischemia in the rat. J. Cereb. Blood Flow Metab. 12, 371–379. 28. Tymianski, M., Wallace, M.C., Spigelman, I., Uno, M., Carlen, P.L., Tator, C.H., and Charlton, M.P. (1993) Cell-permeant Ca2⫹ chelators reduce early excitotoxic and ischemic neuronal injury in vitro and in vivo. Neuron 11, 221–235. 29. Lipton, S.A., and Rosenberg, P.A. (1994) Excitatory amino acids as a final common pathway for neurological disorders. N. Engl. J. Med. 330, 613–622. 30. Beal, M.F. (1992) Does impairment of energy metabolism result in excitotoxic neuronal death in neurodegenerative disease? Ann. Neurol. 31, 119–130. 31. Beal, M.F. (1995) Aging, energy, and oxidative stress in neurodegenerative disease. Ann. Neurol. 38, 357–366. 32. Blandini, F., Porter, R.H.P., and Greenamyre, J.T. (1996) Glutamate and Parkinson’s disease. Mol. Neurobiol. 12, 73–94. 33. Frandsen, A., Dreker, J., and Schousboe, A. (1989) Direct evidence that excitotoxicity in cultured neurons is mediated via N-methyl-D-aspartate (NMDA) as well as non-NMDA receptors. J. Neurochem. 53, 297–299. 34. Bouchelouche, P., Belhage, B., Frandsen, A., Drejer, J., and Schousboe, S. (1989) Glutamate receptor activation in cultured cerebellar granule cells increases cytosolic free Ca2⫹ by mobilization of cellular Ca2⫹ and activation of Ca2⫹ influx. Exp. Brain Res. 76, 281–291. 35. Paschen, W. (1996) Disturbances of calcium homeostasis within the endoplasmic reticulum may contribute to the development of ischemic-cell damage. Med. Hypoth. 47, 283–288. 36. Tsubokawa, H., Oguro, K., Robinson, H.P.C., Masuzawa, T., and Kawai, N. (1996) Intracellular 1,3,4,5-tetrakisphosphate enhances the calcium current in hippocampal CA1 neurones of the gerbil after ischemia. J. Physiol. 497, 67–78. 37. Chan, P.H., Chu, L., Chen, S., Carlson, E.J., and Epstein, C.J. (1990) Reduced neurotoxicity in transgenic mice overexpressing human copper-zinc-superoxide dismutase. Stroke 21, 11180–11182. 38. Huang, Z., Huang, P.L., Panahian, N., Dalkara, T., Fishman, M.C., and Moskowitz, M.A. (1994) Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science 265, 1883–1885. 39. Coyle, J.T., and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262, 689–695.
Oxidative Stress and Calcium Homeostasis
211
40. Dawson, V.L., Dawson, T.M., Bartley, D.A., Uhl, G.R., and Snyder, S.H. (1993) Mechanisms of nitric oxide-mediated neurotoxicity in primary brain cultures. J. Neurosci. 13, 2651–2661. 41. Budd, S.L., and Nicholls, D.G. (1996a) A reevaluation of the role of the mitochondria in neuronal Ca2⫹ homeostasis. J. Neurochem. 66, 403–411. 42. Budd, S.L., and Nicholls, D.G. (1996b) Mitochondria, calcium regulation, and acute glutamate excitotoxicity in cultured cerebellar granule cells. J. Neurochem. 67, 2282–2291. 43. Ankarcrona, M., Dypbukt, J.M., Bonfoco, E., Zhivotosky, B., Orrenius, S., Lipton, S.A., and Nicotera, P. (1995) Glutamate-induced neuronal death: a succession of necrosis or apoptosis depending on mitochondrial function. Neuron 15, 961–973. 44. Ankarcrona, M., Dypbukt, J.M., Orrenius, S., and Nicotera, P. (1996) Calcineurin and mitochondrial function in glutamate-induced neuronal cell death. FEBS Lett. 394, 321–324. 45. White, R.J., and Reynolds, I.J. (1996) Mitochondrial depolarization in glutamate stimulated neurons: an early signal specific to excitotoxic exposure. J. Neurosci. 16, 5688–5697. 46. Tymianski, M., and Tator, C.H. (1996) Normal and abnormal calcium homeostasis in neurons: a basic for the pathophysiology of traumatic and ischemic central nervous system injury. Neurosurgery 38, 1176–1195. 47. Wieloch, T., Hu, B.-R., Kamme, F., Kurihara, J., and Sakata, J. (1996) Intracellular signal transduction in the postischemic brain. Adv. Neurol. 71, 371–387. 48. Abe, A., Aoki, M., Kawagoe, J., Yoshida, T., Hattori, A., Kogure, K., and Itoyama, Y. (1995) Ischemic delayed neuronal cell death: a mitochondrial hypothesis. Stroke 26, 1478–1489. 49. Phillis, J., and Cough-Helfman, C. (1990) Protection from cerebral ischemic injury in gerbils with the spin trap agent N-tert-butyl-alpha-phenylnitrone (PBN). Neurosci. Lett. 116, 315–319. 50. Carney, J.M., and Floyd, R.A. (1991) Protection against oxidative damage to CNS by alpha-phenyl-butyl nitrone (PBN) and other spin-trapping agents: a novel series of nonlipid free radical scavengers. J. Mol. Neurosci. 3, 47–57. 51. Zhao, Q., Pahlmark, K., Smitm, M.-L., and Siesjo, B. (1994) Delayed treatment with the spin trap alpha-phenyl-N-tert-butyl nitrone (PBN) reduced infarct size following transient middle cerebral artery occlusion in rats. Acta Physiol. Scand. 152, 349–350. 52. Chan, P.H., Epstein, C.J., Li, Y., Huang, T.T., Carlson, E., Kinouchi, H., Yang, G., Kamii, H., Mikawa, S., and Kondo, T. (1995) Transgenic mice and knockout mutants in the study of oxidative stress in brain injury. J. Neurotrauma 12, 815– 824. 53. Pahlmark, K., and Siesjo, B.K. (1996) Effects of the spin trap alpha-phenyl-N-tertbutyl nitrone (PBN) in transient focal ischemia in the rat. Acta Physiol. Scand. 157, 41–51. 54. Pellegrino-Giampeitro, D.E., Cherici, G., Alestani, M., Caria, M., and Morini, F. (1990) Excitatory amino acid release and free radical formation may cooperate in the genesis of ischemia-induced neuronal damage. J. Neurosci. 10, 1035–1041. 55. Duyao, M.P., Auerbach, A.B., Ryan, A., Persichetti, F., Barnes, G.T., McNeil,
212
56.
57.
58.
59. 60.
61. 62.
63.
64. 65.
66.
67.
68.
Andersen and Viswanath S.M., Ge, P., Vonsattel, J.P., Gusella, J.F., Joyner, A.L., and MacDonald, M.E. (1995) Inactivation of the mouse Huntington’s disease gene homologue Hdh. Science 269, 407–410. Nasir, J., Floresco, S.B., O’Kusky, J.R., Diewert, V.M., Richman, J.M., Zeisler, J., Borowski, A., Marth, J.D., Phillips, A.G., and Hayden, M.R. (1995) Targeted disruption of the Huntington’s disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell 2, 811–823. Hanson, A., and Zeuthen, T. (1981) Extracellular ion concentration during spreading depression and ischemia in the rat brain cortex. Acta Physiol. Scand. 113, 437– 445. Harris, R.J., Symon, L., Branston, N.M., and Bayhan, M. (1981) Changes in extracellular calcium activity in cerebral ischaemia. J. Cereb. Blood Flow Metab. 1, 203–209. Rothman, S.M., and Olney, J.W. (1986) Glutamate and the pathophysiology of hypoxia-ischemic brain damage. Ann. Neurol. 19, 105–111. Siesjo, B.K., Zhao, Q., Pahlmark, K., Siesjo, P., Katsura, K., and Folbergrova, J. (1995) Glutamate, calcium, and free radicals as mediators of ischemic brain damage. Ann. Thoracic Surg. 59, 1316–1320. Mullan, M., and Crawford, F. (1993) Genetic and molecular advances in Alzheimer’s disease. Trends Neurosci. 16, 398–403. Games, D.A., Adams, R., Alessandrini, R., Barbour, P., Berthelette, C., Blackwell, T., Carr, J., Clemens, T., Donaldson, F., Gillespie, T., Guido, S., Hagopian, K., Wood-Johnson, K., Khan, M., Lee, P., Liebowitz, I., Leiberburg, S., Little, E., Masliah, L., McConlogue, M., Montoya-Zavala, L., Mucke, L., Paganini, E., Penniman, M., Power, D., Schenk, P., Seubert, B., Snyder, F., Soriano, H., Tan, J., Vitale, S., Wadsworth, B., Wolozin, B., and Zhao, J. (1995) Alzheimer-type neuropathology in transgenic mice overexpressing V717F beta-amyloid precursor protein. Nature 373, 523–527. Hsaio, K., Chapman, P., Nilsen, S., Eckman, C., Harigaya, Y., Younkin, S., Yang, F., and Cole, G. (1996) Correlative memory deficits, beta-amyloid elevation, and amyloid plaques in transgenic mice. Science 274, 99–103. Behl, C., Davis, J.B., Lesley, R., and Schubert, D. (1994) Hydrogen peroxide mediates beta amyloid protein toxicity. Cell 77, 817–827. Butterfield, D.A., Hensley, K., Harris, M., Mattson, M.P., and Carney, J. (1994) Beta-amyloid peptide free radical fragments initiate synaptosomal lipoperoxidation in a sequence-specific fashion: implication to Alzheimer’s disease. Biochem. Biophys. Res. Commun. 200, 710–715. Hensley, K., Carney, J.M., Mattson, M.P., Aksenova, M., Harris, M., Wu, J.F., Floyd, R.A., and Butterfield, D.A. (1994) A model for beta-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease. Proc. Natl. Acad. Sci. USA 91, 3270–3274. Harris, M.E., Hensley, K., Butterfield, D.A., Leedle, R.A., and Carney, J.M. (1995) Direct evidence of oxidative injury produced by the Alzheimer’s beta-amyloid protein (1–40) in cultured hippocampal neurons. Exp. Neurol. 131, 193–202. Carney, J.M., and Carney, A.M. (1994) Role of protein oxidation in aging and ageassociated neurodegenerative diseases. Life Sci. 55, 2097–2103.
Oxidative Stress and Calcium Homeostasis
213
69. Bruce, A.J, Malfroy, B., and Baudry, M. (1996) Beta-amyloid toxicity in organotypic hippocampal cultures: protection by EUK-8, a synthetic catalytic free radical scavenger. Proc. Natl. Acad. Sci. USA 93, 2312–2316. 70. Mattson, M.P., Barger, S.W., Cheng, B., Lieberburg, I., Smith-Swintosky, V.L., and Rydel, R.E. (1993) Beta-amyloid protein metabolites and loss of neuronal Ca2⫹ homeostasis in Alzheimer’s disease. Trends Neurosci. 16, 409–411. 71. Mark, R.J., Hensley, K., Butterfield, D.A., and Mattson, M.P. (1995) Amyloid betapeptide impairs ion-motive ATPase activities: evidence for a role in the loss of neuronal Ca2⫹ homeostasis and cell death. J. Neurosci. 15, 6239–6249. 72. Lees, G.J., Lehmann, A., Sandberg, M., and Hamberger, A. (1990) The neurotoxicity of ouabain, a sodium-potassium ATPase inhibitor, in the rat hippocampus. Neurosci. Lett. 120, 159–162. 73. Liguri, G., Taddei, N., Nassi, P., Latorraca, S., Nediani, C., and Sorbi, S. (1990) Changes in Na⫹, K⫹ ATPase, Ca2⫹ ATPase and some soluble enzymes related to energy metabolism in brains of patients with Alzheimer’s disease. Neurosci. Lett. 112, 338–342. 74. Rohn, T.T., Hinds, T.R., and Vincenzi, F.F. (1993) Ion transport ATPases as targets for free radical damage. Biochem. Pharmacol. 46, 525–534. 75. McClure, R.J., Kanfer, J.N., Panchalingam, K., Klunk, W.E., and Pettegrew, J.W. (1994) Alzheimer’s disease: membrane-associated metabolic changes. Ann. N.Y. Acad. Sci. 747, 110–124. 76. Verkhratsky, A., Shmigol, A., Kirischuk, S., Pronchuk, N., and Kostyuk, P. (1994) Age-dependent changes in calcium currents and calcium homeostasis in mammalian neurons. Ann. N.Y. Acad. Sci. 747, 365–381. 77. Koh, J., Yang, L.L., and Cotman, C.W. (1990) Beta-amyloid protein increases the vulnerability of cultured cortical neurons to excitotoxic damage. Brain Res. 533, 315–320. 78. Mattson, M.P., Cheng, B., Davis, D., Bryant, K., Lieberburg, I., and Rydel, R.E. (1992) Beta-amyloid peptides destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J. Neurosci. 12, 376–389. 79. Miller, B., Sarantis, M., Traynelis, F.S., and Attwell, D. (1992) Potentiation of NMDA receptor currents by arachidonic acid. Nature 355, 722–725. 80. Mark, R.J., Lovell, M.A., Markesbery, W.R., Uchida, K., and Mattson, M.P. (1997) A role for 4-hydroxynonenal, and aldehyde product of lipid peroxidation, in disruption of ion homeostasis and neuronal death induced by amyloid beta-peptide. J. Neurochem. 68, 255–264. 81. Keller, J.N., Mark, R.J., Bruce, A.J., Blanc, E., Rothstein, J.D., Uchida, K., Waeg, G., and Mattson, M.P. (1997) 4-Hydroxynonenal, an aldehydic product of membrane lipid peroxidation, impairs glutamate transport and mitochondrial function in synaptosomes. Neuroscience 80, 685–696. 82. Hirsch, E.C. (1992) Why are catecholaminergic neurons more vulnerable than other cells in Parkinson’s disease. Ann. Neurol. 32, S88–S93. 83. Dexter, D.T., Carter, C.J., Wells, F.R., Javoy-Agid, F., Agid, Y., Lees, A., Jenner, P., and Marsden, C.D. (1989) Basal lipid peroxidation in substantia nigra is increased in Parkinson’s disease. J. Neurochem. 52, 381–389. 84. Dexter, D.T., Holley, A.E., and Flitter, W.D. (1994) Increased levels of hydroperox-
214
85.
86. 87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
Andersen and Viswanath ides in the Parkinsonian substantia nigra: an HPLC and ESR study. Movement Dis. 9, 92–97. Sanchez-Ramos, J.R., Overvik, E., and Ames, B.N. (1994) A marker of oxyradicalmediated DNA damage (8-hydroxy-2′deoxyguanosine) is increased in nigrostriatum of Parkinson’s disease brain. Neurodegeneration 3, 197–204. Perry, T.L., Godin, D.V., and Hansen, S. (1982) Parkinson’s disease: a disorder due to nigral glutathione deficiency? Neurosci. Lett. 33, 305–310. Andersen, J.K., Mo, J.-Q., Koek, L.L., Hom, D.G., and McNeill, T.H. (1996) Effects of buthionine sulfoximide, a synthesis inhibitor of the antioxidant glutathione, on murine nigrostriatal neurons. J. Neurochem. 67, 2164–2171. DiMonte, D.A., Chan, P.A., and Sandy, M.S. (1992) Glutathione in Parkinson’s disease: a link between oxidative stress and mitochondrial damage? Ann. Neurol. 32, S111–115. Sian, J., Dexter, D.T., Lees, A.J., Daniel, S., Agid, Y., Javoy-Agid, F., Jenner, P., and Marsden, C.D. (1994) Alterations in glutathione levels in Parkinson’s disease and other neurodegenerative disorders. Ann. Neurol. 36, 348–355. Jenner, P.D., Schapira, A.H.V., and Marsden, C.D. (1992) Oxidative stress as a cause of nigral cell death in Parkinson’s disease and incidental Lewy body disorder. Neurology 42, 2241–2250. Dexter, D.T., Sian, J.T., Rose, S., Hindmarsh, J.G., Mann, V.M., Cooper, J.M., Wells, F.R., Daniel, S.E., Lees, A.J., Schapira, A.H.V., Jenner, P., and Marsden, C.D. (1994). Indices of oxidative stress and mitochondrial function in individuals with incidental Lewy body disease. Ann. Neurol. 35, 38–44. Jain, A., Martensson, J., Stole, E., Auld, P.A., and Meister, A. (1991) Glutathione deficiency leads to mitochondrial damage in brain. Proc. Natl. Acad. Sci. USA 88, 1913–1917. Jurma, O.P., Hom, D.G., and Andersen, J.K. (1997) Decreased glutathione results in calcium-mediated cell death in PC12. Free Rad. Biol. Med. 23, 1055– 1066. Kang, Y., Qiao, X., Jurma, O.P., Knusel, B., and Andersen, J.K. (1997) Cloning of cDNA encoding the mouse glutamyl cysteine synthetase heavy chain subunit and localization of expression in the brain. Neuroreport 8, 2053–2060. Haas, R.H., Nasirian, F., Nakano, K., Ward, D., Pay, M., Hill, R., and Shults, C.W. (1995) Low platelet mitochondrial complex I and complex II/III activity in early untreated Parkinson’s disease. Ann. Neurol. 37, 714–722. Schapira, A.H.V., Mann, V.M., Cooper, J.M., Dexter, D., Daniel, S.E., Jenner, P., Clark, J.B., and Marsden, C.D. (1990) Anatomical and disease specificity of NADH-CoQ1 reductase (complex I) deficiency in Parkinson’s disease. J. Neurochem. 55, 2142–2145. Heales, S.J., Davies, S.E., Bates, T.E., and Clark, J.B. (1995) Depletion of brain glutathione is accompanied by impaired mitochondrial function and decreased Nacetyl aspartate concentration. Neurochem. Res. 20, 31–38. Martinez, M., Ferrandiz, M.L., Diez, A., and Miquel, J. (1995) Depletion of cytosolic GSH decreases the ATP levels and viability of synaptosomes from aged mice but not from young mice. Mech. Ageing Dev. 84, 77–81. Luiten, P.G.M., DeJong, G.I., and Schuurman, T. (1994) Cerebrovascular, neu-
Oxidative Stress and Calcium Homeostasis
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
215
ronal, and behavioral effects of long-term Ca2⫹ channel blockade in aging normotensive and hypertensive rat strains. Ann. N.Y. Acad. Sci. 747: 431–451. Iacopino, A.M., and Christakoss, S. (1990) Specific reduction of calcium-binding protein (28-kilodalton calbindin-D) protein gene expression in aging and neurodegenerative diseases. Proc. Nat. Acad. Sci. USA 87, 4078–4092. Yamada, T., McGeer, P.L., Baimbridge, K.G., and McGeer, E. (1990) Relative sparing in Parkinson’s disease of substantia nigra dopamine neurons containing calbindin-D28K. Brain Res. 526, 303–307. Yong, V.W., Perry, T.L., and Krisman, A.A. (1986) Depletion of glutathione in brainstems of mice by N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine is prevented by antioxidant pretreatment. Neurosci. Lett. 63, 56–60. Przedborski, S., Kostic, V., Jackson-Lewis, V., Naini, A.B., Simonetti, S., Fahn, S., Carlson, E., Epstein, C.J., and Cadet, J.L. (1992) Transgenic mice with increased Cu/Zn-superoxide dismutase activity are resistant to N-methyl-4-phenyl-1,2,3,6tetrahydropyridine-induced neurotoxicity. J. Neurosci. 12, 1658–1667. Klivenyi, P., Ferrante, R.J., Mueller, G., Lancelot, E., Andersen, J.K., Jiang, D., and Beal, M.F. (1998) Mice deficient in cellular glutathione peroxidase show increased vulnerability to malonate, 3-nitropropionic acid, and MPTP (submitted). Fallon, J., Matthews, R.T., Hyman, B.T., and Beal, M.F. (1997) MPP⫹ produces progressive neuronal degeneration which is mediated by oxidative stress. Exp. Neurol. 144, 193–198. Sinha, B.K., Singh, Y., and Krishna, G. (1986) Formation of superoxide and hydroxyl radicals from 1-methyl-4-phenylpyridinium ion (MPP⫹): reductive activation by NADPH cytochrome P-450 reductase. Biochem. Biophys. Res. Commun. 135, 583–588. Chacon, J.N., Chedekel, M.R., Land, E.J., and Truscott, T.G. (1987) Chemically induced Parkinson’s disease: intermediates in the oxidation of 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine to the 1-methyl-4-phenyl-pyridinium ion. Biochem. Biophys. Res. Comm. 144, 957–964. Adams, J.D., Klaidman, L.K., and Leung, A.C. (1993) MPP⫹ and MPDP⫹ induced oxygen radical formation with mitochondrial enzymes. Free Rad. Biol. Med. 15, 181–186. Bannon, M.J., Goedert, M., and Wolff, O.H. (1984) The possible relationship of glutathione, melanin, and 1-methyl-4-phenyl-1,2,5,6-tetrahydropyridine (MPTP) to Parkinson’s disease. Biochem. Pharmacol. 33, 2697–2698. Hallman, H., Lange, J., Olson, L., Stro¨mberg, I., and Jonsson, G. (1985) Neurochemical and histochemical characterization of neurotoxic effects of 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine on brain catecholamine neurons in the mouse. J. Neurochem. 44, 117–127. Hung, H.-C., and Lee, E.H.Y. (1997) MPTP produced differential oxidative stress and antioxidant responses in the nigrostriatal and mesolimbic dopaminergic pathways. Free Rad. Biol. Med. 24, 76–84. Turski, L., Bressler, K., Rettig, K.J., Loschmann, P.A., and Wachtel, H. (1991) Protection of substantia nigra from MPP⫹ toxicity by NMDA antagonists. Nature 349, 414–418.
10 MAO Knock-Out Mice and Behavior Jean Chen Shih, K. Chen, and M. J. Ridd University of Southern California, Los Angeles, California
I. INTRODUCTION Monoamine oxidase A and B (MAO-A and MAO-B) are important isoenzymes which catalyze the oxidation deamination of biogenic and dietary amines in the brain and in the periphery with the production of hydrogen peroxide (H 2 O 2 ) (1,2). MAO-A has higher affinity for the substrates serotonin (5-HT), norepinephrine (NE), dopamine (DA), and the inhibitor clorgyline whereas MAO-B has higher affinity for phenylethylamine (PEA), benzylamine, and the inhibitor deprenyl (3). These isoenzymes are made of different polypeptides (4,5) located on the X chromosome (6,7) and have identical intron and exon organization (8). Different cysteines are important for the catalytic activity of MAO-A and B (9), and distinct domains confer their substrate specificity (10). The different cis and trans elements in the promotor suggest that the regulation of these two genes is different (11,12). A line of transgenic mice has been generated in which the gene that encodes MAO-A is disrupted. MAO-A knock-out (KO) mice have elevated brain levels of 5-HT, NE, and DA and manifest aggressive behavior similar to men with a deletion of MAO-A (4,13,14). Emotional learning and memory are also increased in MAO-A KO mice (15). We have also generated mice deficient in MAO-B by homologous recombination. MAO-B KO mice do not exhibit aggression and only levels of PEA are increased. Mice lacking MAO-B are also resistant to the Parkinsongenic neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) (16). Both MAO-A (17) and MAO-B KO (16) mice show increased reactivity to stress. Thus, studies of MAO-A and MAO-B KO mice have clearly shown that MAO-A and B have distinct functions in neurotransmitter metabolism and behavior. These KO mice are valuable models for investigating the role of monoamines in psychoses, neurodegenerative, and stress-related disorders. In this 217
218
Shih et al.
chapter we will discuss the behavior and monoamine metabolism of mice deficient in MAO-A and B and future research directions using KO mice.
II. DIFFERENT MONOAMINE METABOLISM IN MAO-A AND B KO MICE In collaboration with Isabelle Seif and Edward De Maeyer at the Centre National de la Recherche Scientifique in France, a line of transgenic mice has been gener-
Figure 1 Concentrations of 5-HT, 5-HIAA, DA, and NE in whole brains from MAOA wild-type and MAO-A-deficient mice. Values represent the mean ⫾ SEM. For 5-HT, n ⫽ 4 in MAO-A wild-type and n ⫽ 5 in MAO-A KO mice; 5-HIAA, n ⫽ 7 in MAOA wild-type and n ⫽ 8 in MAO-A KO mice; NE, n ⫽ 2 in MAO-A wild-type and MAOA KO mice; DA, n ⫽ 4 in MAO-A wild-type and MAO-A KO mice. (Data are from Ref. 17.)
MAO Knock-Out Mice and Behavior
219
Table 1 Concentrations of PEA in Whole Brains from MAO-B Wild-Type and MAO-B-Deficient Mice
PEA
MAO-B wild-type mice
MAO-B KO mice
1.70 ⫾ 0.17
14.1 ⫾ 2.81*
Values are in n/s net weight and represent the mean ⫾ SD. n ⫽ 4 in MAOB wild type; n ⫽ 3 in MAO-B KO mice. * P ⬍ 0.05 (t test). Data are from Ref. 16.
ated in which the gene that encodes MAO-A (17) is disrupted. The levels of 5HT in MAO-A KO mice were ninefold higher at day 1 and sixfold higher at day 12 (Fig. 1). In adult brains, the 5-HT level was only increased twofold, which may reflect the development of MAO-B (18). In contrast, the amount of the 5HT metabolite 5-hydroxyindoleacetic acid was considerably lower in mutant pups and returned to normal in older mice. The elevation in DA was slight, although the DA metabolite dihydroxyphenylacetic acid was markedly decreased (3.5 times less at 3 months). Compared to wild-type mice, the level of NE in mutant pups was twofold higher between days 12 and 90. In older mutant mice the amount of NE had returned to normal. We have also generated mice deficient in MAO-B by homologous recombination (16). Targeted inactivation of MAO-B in mice increases levels of PEA eightfold (16) (Table 1). However, no difference in the concentration of 5-HT, DA, and NE was found between mutant and wildtype mice.
III.
MAO CAUSES OXIDATIVE DAMAGE OF MITOCHONDRIAL DNA
Supplementation of intact rat brain mitochondria with tyramine (a substrate for MAO-A and B) produced a 50-fold increase in the steady-state concentration of H 2 O 2 (19) (Table 2). Oxidative damage to the brain mitochondria was assessed by single-strand DNA breakage. The ratio of nicked DNA for the preparations treated with tyramine and those without the amine increased from 0.75/10 4 base pairs to 3.12/10 4 base pairs. Catalase, which catalyzes the removal of H 2 O 2 , inhibited mitochondria DNA strand breakage by approximately 60%. Preincubation of mitochondria with tranylcypromine, an inhibitor of MAO-A and B, abolished mitochondria DNA damage. These data have demonstrated that H 2 O 2 generated during MAO-catalyzed oxidation of tyramine contributes to the steady-
220
Shih et al.
Table 2 Metabolism of Tyramine by MAO-A and B Causes Oxidative Damage to Mitochondrial DNA
Rat brain mitochondria ⫹ tyramine ⫹ catalase ⫹ tranylcypromine
Steady-state H 2O 2 concentration/10⫺7 (M)
Single-strand breaks/104 (bp)
0.16 7.71 — —
0.75 3.12 1.27 0.75
Values are shown as mean. Data are from Ref. 19.
state concentration of intramitochondrial H 2 O 2 and may cause oxidative damage to mitochondrial DNA.
IV.
BOTH MAO-A AND MAO-B SHOW INCREASED MOBILITY IN THE FORCED SWIM TEST
Both MAO-A (17) (Table 3) and MAO-B (16)–deficient (Fig. 2) mice show an increased reactivity to stress in the forced swim test reflected as increased mobility. Since NE and DA mediate the stress response and their action is potentiated by PEA (20–25), these findings are consistent with elevated brain levels of NE and DA in MAO-A KO mice (17) and PEA in MAO-B KO mice (16).
Table 3 Mobility of MAO-A Wild-Type and MAO-A KO Mice in a 4-Min Forced Swim Test Genotype MAO-A wild-type MAO-A KO
Time spent immobile in water (s) 156 ⫾ 12 37 ⫾ 8*
Note: For 9-week-old mice, the time spent immobile in water, in a test of 4 min (after 2 min for habituation) is shown. * P ⱕ 0.01 (t test). (Data are from Ref. 17.)
MAO Knock-Out Mice and Behavior
221
Figure 2 Mobility of MAO-B wild-type and mutant mice in a 6-min forced swim test. Values represent the mean ⫾ SD. Mutant mice were derived from CCE and J1 ES clones. For MAO-B KO CCE, n ⫽ 8; MAO-B KO J1, n ⫽ 19; MAO-B wild-type mice, n ⫽ 17. *, P ⬍ 0.05; **, P ⬍ 0.01; and ***, P ⬍ 0.005 (t test). (Data are from Ref. 16.)
V.
LACK OF MPTP TOXICITY IN MAO-B KO MICE
Several lines of evidence have shown that MPTP is converted to 1-methyl-4phenylpyridine (MPP ⫹ ) by MAO-B, which selectively induces degeneration of dopaminergic neurons of the midbrain (26). MPTP is commonly used to induce a condition in animals that is reminiscent of Parkinson’s disease (26). Indeed, we have shown that MPTP toxicity results in the depletion of DA and its metabolites in wild-type mice (16) (Fig. 3). Mice deficient in MAO-B did not, however, sustain damage to the dopaminergic terminals of the striatum after MPTP injection. These data demonstrate unequivocally that MAO-B is required for MPTP toxicity. MAO-B may promote the aging process in the brain by either bioactivating exogenous/endogenous neurotoxins or by increasing the levels of toxic H 2 O 2 .
222
Shih et al.
Figure 3 The level of DA in the striatum of MAO-B wild-type and MAO-B KO pups after subcutaneous administration of 60 mg/kg MPTP. Values represent the mean ⫾ SD. n ⫽ 10 in saline-treated mice; n ⫽ 4 in MPTP-treated mice. **P ⬍ 0.01 level (t test). (Data are from Ref. 16.)
VI.
ENHANCED AGGRESSIVE BEHAVIOR IN MAO-A-DEFICIENT MICE
Mice lacking 5-HT 1B receptors show enhanced aggression (27) and changes in 5-HT 1A and 5-HT 2A receptor expression have been reported in aggressive mice (28,29). Furthermore, 5-HT 1A (30–32), 5-HT 1B/C (31), and 5-HT 2 (31) receptor agonists and antagonists (30,33) reduce many forms of aggression. Pups lacking MAO-A have elevated brain levels of 5-HT (17) and a distinct behavioral syndrome, including enhanced aggression, is manifested by adult males (17) consistent with the impulsive aggression reported in men from a Dutch family with an MAO-A deficiency (14). When adult mice of the same strain were paired together in a neutral cage, mutant mice spent more time displaying aggressive (65.6 ⫾
MAO Knock-Out Mice and Behavior
223
21.4 s/10 min vs. 1.3 ⫾ 1.3 s/10 min) and defensive behaviors (43.4 ⫾ 13.3 s/ 10 min vs. 24.2 ⫾ 0.9 s/10 min) than the wild-type mice (34) (Fig. 4). It is possible that the elevated levels of 5-HT in MAO-A KO pups underlies the enhanced aggressive behavior of adult mice. Similarly, elevated levels of 5-HT may be important in the enhanced emotional but not motor learning that adult mutant mice exhibit (15). It has been suggested that altered 5-HT levels may affect brain development in utero (35). Indeed, there is evidence that increased 5-HT levels in MAO-A KO pup brains causes cytoarchitectural alterations in the somatosensory cortex, since administration of parachlorophenylalanine, an inhibitor of 5-HT synthesis, reverses the changes (36). Thus, the molecular basis of aggressive be-
Figure 4 Aggressive and defensive behavior of wild-type and MAO-A KO mice. Pairs of MAO-A wild-type and MAO-A KO mice were placed in a neutral cage for 10 min. The duration of time spent displaying aggressive and defensive behaviors is shown. *, P ⬍ 0.05 (one-way ANOVA followed by post hoc analysis with Tukey’s HSD test). Data from unpublished work by Shih (1998).
224
Shih et al.
havior of mutant mice is complicated and may in part be related to structural changes to the somatosensory cortex (36) in response to elevated cortical levels of 5-HT in pups.
VII. FUTURE DIRECTIONS This is an exciting period for MAO research and its effects on behavior. Since MAO-A KO mice display elevated levels of aggressive behavior (17), these mice provide an excellent model to study the mechanism of aggression. Recently, Cases et al. (37) showed atypical localization of 5-HT immunolabeling in the developing brain of MAO-A KO mice. The molecular role of 5-HT during development can be further studied in these mice. MAO-B can metabolize the main metabolite of histamine, telehistamine (38). Studies with MAO-A and MAO-B KO mice will clarify the physiological role of MAO-B in histamine catabolism. PEA can significantly alter behavior and may be important in disease. Several lines of evidence suggest that increased levels of PEA are associated with the manic phase of bipolar disease (39) and with schizoaffective disorders (40). We have demonstrated that H 2 O 2 generated during MAO-catalyzed oxidation of neurotransmitters may cause oxidative damage to mitochondrial DNA (19). Thus, increased PEA and reduced H 2O 2 resulting from MAO-B inhibition may account for the slowing of Alzheimer’s disease by deprenyl (41). Therefore, MAO-B KO mice may be a good animal model for studying the molecular basis of oxidative stress in aging, neurodegeneration, and disorders such as bipolar disease.
ACKNOWLEDGMENTS This study has been supported by grants from the National Institute for Mental Health (R37 MH39085, MERIT Award; K05 MH00795, Research Scientist Award; and RO1MH37020, the Boyd and Elsie Welin Professorship Award).
REFERENCES 1. Thorpe, L.W., Westlund, K.N., Kochersperger, L.M., Abell, C.W., and Denney, R.M. (1987) Immunocytochemical localization of monoamine oxidases A and B in human peripheral tissues and brain. J. Histochem. Cytochem. 35, 23–32. 2. Shih, J.C. (1991) Molecular basis of human MAO A and B. Neuropsychopharmacology 4, 1–7. 3. Fowler, C.J., Mantle, T.J., and Tipton, K.F. (1982) The nature of the inhibition of
MAO Knock-Out Mice and Behavior
4.
5. 6. 7. 8.
9. 10. 11.
12.
13.
14.
15. 16.
17. 18.
19.
225
rat liver monoamine oxidase types A and B by the acetylenic inhibitors clorgyline, 1-deprenyl and pargyline. Biochem. Pharmacol. 31, 3555–3561. Bach, A.W., Lan, N.C., Johnson, D.L., Abell, C.W., Bembenek, M.E., Kwan, S.W., Seeburg, P.H., and Shih, J.C. (1988) cDNA cloning of human liver monoamine oxidase A and B: molecular basis of differences in enzymatic properties. Proc. Natl. Acad. Sci. USA 85, 4934–4938. Lan, N.C., Chen, C.H., and Shih, J.C. (1989) Expression of functional human monoamine oxidase A and B cDNAs in mammalian cells. J. Neurochem. 52, 1652–1654. Lan, N.C., et al. (1989) Human monoamine oxidase A and B genes map to Xp 11.23 and are deleted in a patient with Norrie disease. Genomics 4, 552–559. Sims, K.B., et al. (1989) Monoamine oxidase deficiency in males with an X chromosome deletion. Neuron 2, 1069–1076. Grimsby, J., Chen, K., Wang, L.J., Lan, N.C., and Shih, J.C. (1991) Human monoamine oxidase A and B genes exhibit identical exon-intron organization. Proc. Natl. Acad. Sci. USA 88, 3637–3641. Wu, H.F., Chen, K., and Shih, J.C. (1993) Site-directed mutagenesis of monoamine oxidase A and B: role of cysteines. Mol. Pharmacol. 43, 888–893. Chen, K., Wu, H.F., and Shih, J.C. (1996) Influence of C terminus on monoamine oxidase A and B catalytic activity. J. Neurochem. 66, 797–803. Zhu, Q.S., Grimsby, J., Chen, K., and Shih, J.C. (1992) Promoter organization and activity of human monoamine oxidase (MAO) A and B genes. J. Neurosci. 12, 4437– 4446. Zhu, Q.S., Chen, K., and Shih, J.C. (1994) Bidirectional promoter of human monoamine oxidase A (MAO A) controlled by transcription factor Spl. J. Neurosci. 14, 7393–7403. Brunner, H.G., Nelen, M.R., Van Zandvoort, P., Abeling, N.G.G.M., Van Gennip, A.H., Wolters, E.C., Kuiper, M.A., Ropers, H.H., and Van Oost, B.A. (1993) Xlinked borderline mental retardation with prominent behavioral disturbance: phenotype, genetic localization, and evidence for disturbed monoamine metabolism. Am. J. Hum. Genet. 52, 1032–1039. Brunner, H.G., Nelen, M., Breakefield, X.O., Ropers, H.H., and Van Oost, B.A. (1993) Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A. Science 262, 578–580. Kim, J.J., et al. (1997) Selective enhancement of emotional, but not motor, learning in monoamine oxidase A-deficient mice. Proc. Natl. Acad. Sci. USA 94, 5929–5933. Grimsby, J., Toth, M., Chen, K., Kumazawa, T., Klaidman, L., Adams, J.D., Karoum, F., Gal, J., and Shih, J.C. (1997) Increased stress response and β-phenylethylamine in MAOB-deficient mice. Nature Genetics 17, 1–5. Cases, O., et al. (1995) Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAO A. Science 268, 1763–1766. Fowler, C.J., Wiberg, A., Oreland, L., Marcusson, J., and Winblad, B. (1980) The effect of age on the activity and molecular properties of human brain monoamine oxidase. J. Neural Transm. 49, 1–20. Hauptmann, N., Grimsby, J., Shih, J.C., and Cadenas, E. (1996) The metabolism of tyramine by monoamine oxidase A/B causes oxidative damage to mitochondrial DNA. Arch. Biochem. Biophys. 335, 295–304.
226
Shih et al.
20. Scarr, E., Wingerchuk, D.M., Juorio, A.V., and Paterson, I.A. (1994) The effects of monoamine oxidase B inhibition on dopamine metabolism in rats with nigro-striatal lesions. Neurol. Res. 19, 153–159. 21. Paterson, I.A., Juorio, A.V., and Boulton, A.A. (1990) Possible mechanism of action of deprenyl in parkinsonism [letter]. Lancet 336, 183. 22. Juorio, A.V., Greenshaw, A.J., and Wishart, T.B. (1988) Reciprocal changes in striatal dopamine and β-phenylethylamine induced by reserpine in the presence of monoamine oxidase inhibitors. Naunyn-Schmiedeberg’s Arch. Pharmacol. 338, 644–648. 23. Yu, P.H., Davis, B.A., Durden, D.A., Barber, A., Terleckyj, I., Nicklas, W.G., and Boulton, A.A. (1994) Neurochemical and neuroprotective effects of some aliphatic propargylamines: new selective nonamphetamine-like monoamine oxidase B inhibitors. J. Neurochem. 62, 697–704. 24. Dyck, L.E., Durden, D.A., and Boulton, A.A. (1993) Effects of monoamine oxidase inhibitors on the acid metabolites of some trace amines and of dopamine in the rat striatum. Biochem. Pharmacol. 45, 1317–1322. 25. Berry, M.D., Scarr, E., Zhu, M.Y., Paterson, I.A., and Juorio, A.V. (1994) The effects of administration of monoamine oxidase-B inhibitors on rat striatal neurone responses to dopamine. Br. J. Pharmacol. 113, 1159–1166. 26. Gerlach, M., Youdim, M.B.H., and Riederer, P. (1996) Pharmacology of selegiline. Neurology 47, S137–S145. 27. Saudou, F., Amara, D.A., Dierich, A., LeMeur, M., Rarnboz, S., Segu, L., Buhof, M.-C., and Hen, R. (1994) Enhanced aggressive behavior in mice lacking 5-HT1B receptor. Science 265, 1875–1878. 28. Korte, S.M., Meijer, O.C., De Kloet, R.E., Buwalda, B., Keijser, J., Sluyter, E., Van Ootmerssen, G., and Bohus, B. (1996) Enhanced 5-HT 1A receptor expression in forebrain regions of aggressive house mice. Brain Res. 736, 338–343. 29. Popova, N.K., Kulikov, A.V., Avgustinovich, D.E., and Shigantsov, S.N. (1996) The characteristics of the brain serotonin system and anxiety in the C57BL and CBA mouse strains. Zh. Vyssh. Nerv. Deiat. Im. I. P. Pavlova. 46, 348–354. 30. Sanchez, C., Arnt, J., Hyttel, J., and Moltzen, E.K. (1993) The role of serotonergic mechanisms in inhibition of isolation-induced aggression in male mice. Psychopharmacology 110, 53–59. 31. Olivier, B., and Mos, J. (1992) Rodent models of aggressive behavior and serotonergic drugs. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 16, 847–870. 32. Molina, V., Ciesielski, L., Gobaille, S., Isel, F., and Mandel, P. (1987) Inhibition of mouse-killing behavior by serotoninmimetic drugs: effects of partial alterations of serotonin neurotransmission. Pharmacol. Biochem. Behav. 27, 123–131. 33. Sorensen, S.M., Kehne, J.H., Fadayel, G.M., Humphreys, T.M., Ketteler, H.J., Sullivan, C.K., Taylor, V.L., and Schmidt, C.J. (1993) Characterization of the 5-HT 2 receptor antagonist MDL 100907 as a putative atypical antipsychotic: behavioral, electrophysiological and neurochemical studies. J. Pharmacol. Exp. Ther. 266, 684– 691. 34. Shih, J.C. (1998) Unpublished work. 35. Brunner, H.G. (1995) Monoamine oxidase and behavior [editorial]. Ann. Med. 27, 431–432. 36. Cases, O., Vitalis, T., Seif, I., De Maeyer, E., Sotelo, C., and Gaspar, P. (1996) Lack
MAO Knock-Out Mice and Behavior
37.
38. 39.
40.
41.
227
of barrels in the somatosensory cortex of monoamine oxidase A-deficient mice: role of a serotonin excess during the critical period. Neuron 16, 297–307. Cases, O., Lebrand, C., Giros, B., Vitalis, T., De Maeyer, E., Caron, M.G., Price, D.J., Gaspar, P., and Seif, I. (1998) Plasma membrane transporters of serotonin, dopamine, and norepinephrine mediate serotonin accumulation in atypical locations in the developing brain of monoamine oxidase A knock-outs. J. Neurosci. 18, 6914– 6927. Hough, L.B., and Domino, E.F. (1979) Tele-methylhistamine oxidation by type B monoamine oxidase. J. Pharmacol. Exp. Ther. 208, 422–428. Linnoila, M., Karoum, F., Cutler, N.R., and Potter, W.Z. (1983) Temporal association between depression dependent dyskinesias and high urinary phenylethylamine output. Biol. Psychiatry 18, 513–518. Potkin, S.G., Wyatt, R.J., and Karoum, F. (1980) Psychostimulants and dopaminergic agonists in the study of adult hyperkinesis, schizophrenia and affective disorders. Psychopharmacol. Bull. 16, 52–59. Sano, M., et al. (1997) A controlled trial of selegiline or α-tocopherol, or both as treatment for Alzheimer’s disease. N. Engl. J. Med. 336, 1216–1222.
11 DNA Strand Breakage Induced by Nitric Oxide Together with Catecholamine: Implications for Neurodegenerative Disease Hiroshi Ohshima, Yumiko Yoshie,* and Isabelle Gilibert International Agency for Research on Cancer, Lyon, France
I. INTRODUCTION Oxidative damage in neuronal cells and DNA has been implicated in the pathogenesis of neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, amyotrophic lateral sclerosis, and prion diseases (bovine spongiform encephalopathy, scrapie, and Creutzfeldt-Jakob disease), as well as in the etiology of brain cancer. There are several indications for this increased oxidative stress in neurodegenerative diseases, including increased iron levels, lipid peroxidation, nitrite [a marker for nitric oxide (NO) production] concentrations and levels of nitrotyrosine-containing proteins, decreased peroxidase and catalase levels, increased superoxide dismutase (SOD) levels, and decreased glutathione levels (1– 6). Oxidative damage/stress may induce apoptosis and/or necrosis in neuronal cells, which have been proposed to play a crucial role in neurodegenerative disease (7–9). Nitric oxide, produced from l-arginine by three distinct isoforms of NO synthase, plays various important roles in the central nervous system (10,11). NO, a freely diffusible gas with free radical properties, functions as a neurotransmitter and participates in synaptic plasticity such as long-term potentia* Present address: Tokyo University of Fisheries, Tokyo, Japan.
229
230
Ohshima et al.
tion in the hippocampus and long-term depression in the cerebellum (10,11). Excess NO, however, could also be responsible for neurotoxicity associated with NMDA receptor activation (12), ischemia-reperfusion (13,14), and coldinduced brain edema (15), although the involvement of NO in neuronal injury and death remains controversial. 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) causes nigrostriatal dopaminergic pathway damage similar to that observed in Parkinson’s disease. Recent studies have shown that inhibition of neuronal NO synthase (nNOS) by a specific inhibitor (7-nitroindazole) significantly inhibited MPTP-induced neurotoxicity in mice (16,17) and in baboons (18). Mice lacking nNOS have also been shown to be significantly more resistant to MPTP-induced neurotoxicity than wild-type mice (17). The NO-mediated tissue injury may be caused mainly by reactive nitrogen species such as NOx and peroxynitrite (ONOO ⫺ ), which are formed by the reaction of NO with oxygen and superoxide (O •⫺ 2 ), respectively (19–21). Reactive nitrogen species can oxidize, nitrate and nitrosate biomolecules such as proteins, lipids, and DNA, thus altering their functions (19–21). NOx deaminates DNA bases to induce various types of mutations (22,23). Peroxynitrite induces DNA strand breaks (24–28) and base modifications in isolated DNA in vitro (29). Peroxynitrite reacts rapidly with guanine and 2′-deoxyguanosine to form the adducts 8nitroguanine (30,31) and 4,5-dihydro-5-hydroxy-4-(nitrosooxy)-2′-deoxyguanosine (32), respectively. Cells treated with NO (33,34) or peroxynitrite (35,36) undergo apoptosis. Catecholamines, including the neurotransmitter dopamine and its precursor l-dopa, have been implicated as sources of reactive oxygen species (37–39). Dopamine and l-dopa can easily autooxidize, especially in the presence of transition metals such as iron and copper, to generate reactive oxygen species, including O •⫺ 2 , hydrogen peroxide (H 2 O2 ), and hydroxyl radical (HO • ) (40). Furthermore, quinone derivatives formed by oxidation of catecholamines are also considered to mediate toxicity by binding covalently to sulfhydryl or other nucleophilic groups of biological macromolecules in the cell (37–39). We recently reported that concurrent incubation of plasmid DNA with an NO-releasing compound and a polyhydroxyaromatic compound, such as catechol or 1,4-hydroquinone, leads to a synergistic induction of DNA strand breaks (27). As catechol is structurally similar to biologically important catecholamines such as l-dopa, dopamine, and epinephrine, we have examined the effects of combinations of catecholamines and NO, both formed in the central nervous system, on the induction of DNA strand breakage. We have found that DNA strand breakage is induced synergistically by NO and catecholamines (41). In the following, we have summarized these findings and discussed their possible role in various neurodegenerative diseases.
DNA Strand Breakage
231
II. INDUCTION OF DNA STRAND BREAKAGE BY NO AND CATECHOLAMINES DNA strand breakage is induced synergistically when plasmid DNA is incubated in the presence of both an NO-releasing compound and catecholamine (Fig. 1) (41). A typical agarose gel electrophoresis of pBR322 plasmid DNA which was incubated with either a catecholamine (l-dopa, dopamine, 6-hydroxydopamine, or 3-O-methyl-dopa) alone, an NO-releasing compound [diethylamine-NONOate (DEA-NO)] alone, or the NO-releasing compound and catecholamine in combination is shown in Fig. 1. Incubation of the plasmid DNA with l-dopa and dopamine resulted in a small increase in conversion of the covalently closed circular double-stranded supercoiled DNA (form I) to a relaxed open circle (form II) (lanes 3 and 4), compared to that of the nontreated plasmid (lane 1). 6-Hydroxydopamine alone induced about 37% of form II, corresponding to ⬃0.63 singlestrand breakage (SSB)/10 4 bp (lane 5). DEA-NO at 0.1 mM did not increase the formation of form II significantly (lane 2). However, when the plasmid was incubated in the presence of both DEA-NO and a catecholamine (l-dopa, dopamine, or 6-hydroxydopamine), significant conversion of form I to form II was observed (lanes 7–9). In contrast, 3-O-methyl-dopa did not induce strand breakage in either the absence or presence of NO (lane 6 and 10).
Figure 1 A typical agarose gel electrophoresis of pBR322 plasmid DNA incubated with either an NO-releasing compound (DEA-NO) alone, catecholamine (l-dopa, dopamine, 6-hydroxydopamine, or 3-O-methyldopa) alone, or the two compounds in combination. The experiments were carried out by incubating pBR322 plasmid DNA (100 ng) in 100 mM sodium phosphate buffer (pH 7.4) containing 0.1 mM DTPA and either 0.1 mM DEA-NO alone (lane 2), 0.1 mM catecholamine (lane 3–6) alone, or the two compounds in combination (lanes 7–10) at 37°C for 1 h (final volume, 10 µL). (Reprinted from Ref. 41. Copyright 1997, American Chemical Society.)
232
Ohshima et al.
Table 1 DNA Strand Breaks Induced by Catecholamines and Related Compounds in Combination with NO-Releasing Compoundsa Catecholamine or related compounds None Dopa Dopamine Epinephrine Norepinephrine 6-Hydroxydopa 6-Hydroxydopamine Adrenochrome 3-O-Methyl-dopa 3-O-Methyldopamine 4-O-Methyldopamine Tyrosine Tyramine Xanthine oxidaseb a
SSB/10 4bp None 0 ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ 0 0 0 0 0.39 ⫾
0.12 0.06 0.06 0.04 0.85 0.52 0.52 0.10
0.02 0.01 0.02 0.02 0.04 0.04 0.04 0.02
0.02
DEA-NO 0.46 0.75 0.29 0.36 2.54 2.01 9.80 0.08 0.04 0.04 0.04 0.04 0.72
0 ⫾ 0.06 ⫾ 0.06 ⫾ 0.08 ⫾ 0.04 ⫾ 0.04* ⫾ 0.10 ⫾ 0.04 ⫾ 0.08 ⫾ 0.04 ⫾ 0.04 ⫾ 0.04 ⫾ 0.04 ⫾ 0.12
SPER-NO 0.06 1.31 1.35 0.75 0.49 2.32 2.45 2.14 0.14 0.08 0.02 0.04 0.02 1.22
⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾
0.04 0.10 0.06 0.10 0.06 0.02** 0.20 0.12 0.02 0.08 0.02 0.02 0.02 0.12
SNP 0 0.02 0.04 0.06 0.06 0.06*** 0.10 0.04 0.02 0.02 0.02 0 0.02 ⫾ 0.02 2.72 ⫾ 0.06
0.41 0.16 0.14 0.06 3.09 4.42 2.72 0.03 0.02 0.02
⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾
The experiments were carried out by incubating plasmid pBR322 DNA (100 ng) in 100 mM sodium phosphate buffer (pH 7.4) containing 0.1 mM DTPA and either 0.1 mM NO-releasing compound alone, 0.1 mM catecholamine or related compound alone, or these two compounds in combination at 37°C for 1 h (final volume, 10 µL). The conversion of the covalently closed circular doublestranded supercoiled DNA (form I) to a relaxed open circle (form II) and a linear form (form III) was used to investigate DNA strand breakage induced by NO plus catecholamine, according to the method of Yermilov et al. (28). Results (mean ⫾ SD) are expressed as numbers of SSB/10 4 bp (pBR322 consists of 4363 bp) after correcting for the numbers of SSB in untreated pBR322 plasmid, which contained 5–15% form II (corresponding to 0.08–0.27 site/10 4). All experiments were carried out in triplicate and statistical significance was calculated using Student’s t test. In the case of 6hydroxydopa, linear form DNA (form III) was observed in addition to supercoiled (form I) and relaxed ring-open (form II) DNA. In these cases, the following equations were used to calculate SSB and double-strand breakage, respectively. SSB ⫽ ⫺ln [1.4 ⫻ form I/(1.4 ⫻ form I ⫹ form II ⫹ form III)], double-strand breaks ⫽ form III/(1.4 ⫻ form I ⫹ form II ⫹ form III). Doublestrand breaks formed/10 4 bp were: *0.11, **0.06, ***0.46. b The experiments were carried out by incubating plasmid pBR322 DNA (100 ng) in 100 mM sodium phosphate buffer (pH 7.4) containing 0.1 mM DTPA in the presence of 5 mU/mL xanthine oxidase plus 0.5 mM hypoxanthine (which catalyzed the formation of approximately 1.5 nmol/min O•⫺ 2 under these conditions) with or without 0.1 mM NO-releasing compound at 37°C for 1 h (final volume, 10 µL). (Reprinted with permission from Ref. 41. Copyright 1997, American Chemical Society.)
DNA Strand Breakage
233
As shown in Table 1, similar synergistic effects on the induction of singlestrand breakage were observed with various catecholamines including l-dopa, dopamine, epinephrine, and norepinephrine (structures are shown in Fig. 2) in combination with NO-releasing compounds such as DEA-NO, spermine NONOate (SPER-NO), and sodium nitroprusside (SNP). Conversely, no obvious DNA damage was induced by 3-O-methyl-dopa, 3-O-methyldopamine, tyrosine, or tyramine in the presence of NO-releasing compounds, in contrast to the above catecholamines. Among the various catecholamines tested, 6-hydroxydopa and 6-hydroxydopamine in the presence of NO-releasing compounds induced SSB most strongly (2.0–4.4 SSB/10 4 bp). A combination of 6-hydroxydopa and NO also induced formation of a linear form (form III) in addition to relaxed open circular (form II) DNA, indicating that these compounds caused double-strand breaks in DNA. For comparison, we examined DNA strand breakage induced by O •⫺ 2 generated by xanthine oxidase and hypoxanthine in the absence or presence of NO-releasing compounds. Under the present conditions, it was found that about 1.5 nmol/min O •⫺ 2 were generated by 5 mU/mL xanthine oxidase and 0.5 mM hypoxanthine. A significant induction of SSB (0.72–2.72 SSB/10 4 bp) was observed only in the presence of NO-releasing compounds (Table 1) (41). Dopamine and DEA-NO induced SSB very rapidly (⬍15 min) and no further increase in SSB was apparent during incubation for up to 120 min. In con-
Figure 2 Structures of catecholamines that induce DNA strand breakage synergistically with nitric oxide (A) and of the related compounds which do not induce the damage (B).
234
Ohshima et al.
trast, SSB induced by dopamine together with SPER-NO increased gradually over 120 min. These results reflect well the half-lives of DEA-NO and SPERNO, which were estimated to be about 2 and 40 min at 37°C, respectively (42). It was also found that dopamine decreased rapidly during incubation with DEA-NO or SPER-NO for 120 min, its disappearance also correlating well with the half-lives of the NO-releasing compounds. When the concentration of an NO-releasing compound (DEA-NO or SPER-NO) was constant at 0.1 mM, strand breakage was maximal with 0.3–1 mM dopamine, whereas dopamine alone did not induce significantly strand breakage under these conditions. When the concentration of dopamine in the reaction mixture was constant at 0.1 mM, strand breakage was maximal with 0.1–0.3 mM DEA-NO or SPERNO, whereas DEA-NO or SPER-NO alone did not induce significantly strand breakage (41). The effect of pH on DNA damage induced by dopamine or DEA-NO alone and the two compounds in combination was also studied. Under acidic and neutral conditions (pH 4.5–7.4) dopamine alone did not induce SSB, whereas it caused ⬃0.5 SSB/10 4 bp under alkaline conditions (pH 9.0 and 10.5). Addition of DEANO into reaction mixtures containing dopamine markedly increased SSB only at neutral (pH 7.4) conditions when compared to those induced by dopamine alone. DEA-NO alone did not induce SSB over a range of pH levels. As shown in Fig. 3A (41), SSB induced by dopamine and DEA-NO were significantly inhibited by higher concentrations (10 mM) of ascorbate, N-acetylcysteine, 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3oxide, potassium salt (carboxy-PTIO) and sodium azide, as well as superoxide dismutase (SOD, 5000 U/mL) ( p ⬍ 0.05), whereas HO• scavengers (DMSO, ethanol, and d-mannitol) and catalase showed no inhibitory effects. Conversely, the strand breakage induced by 6-hydroxydopamine alone was significantly ( p ⬍ 0.05) inhibited by higher concentrations (10 mM) of DMSO, d-mannitol, ascorbate, carboxy-PTIO, and sodium azide, as well as SOD and/or catalase (500 or 5000 U/mL) (Fig. 3B). Ultraviolet (UV)–visible spectrophotometry analyses demonstrated a timedependent increase in absorption at 300–400 nm during incubation of 0.1 mM dopamine and 0.1 mM DEA-NO. Incubation of dopamine under alkaline conditions (pH 10.6) or in the presence of Cu 2⫹ ion resulted in a similar increase in absorbance at 300–400 nm, which has been attributed to the dopamine quinone (43,44). High-performance liquid chromatography (HPLC) analyses of the reaction products after incubation of dopamine and DEA-NO for 5–120 min showed a rapid decrease of the dopamine peak and the appearance of a new peak. The same new peak was also observed with the reaction products obtained by autooxidation of dopamine under alkaline conditions or in the presence of Cu 2⫹ ion, indicating that the newly formed compound is the dopamine quinone. The reten-
DNA Strand Breakage
235
Figure 3 Effects of hydroxyl radical scavengers, antioxidants, and an NO-trapping agent on the strand breakage induced by DEA-NO plus dopamine (A) or 6-hydroxydopamine alone (B). Plasmid pBR322 DNA (100 ng) was incubated at 37°C for 1 h in 100 mM sodium phosphate buffer (pH 7.4) containing 0.1 mM DTPA and either 0.1 mM DEANO plus 1 mM dopamine (A) or 0.1 mM 6-hydroxydopamine alone (B) in the presence or absence (control) of test compounds. The NO-trapping agent (carboxy-PTIO), HO• scavengers (DMSO, ethanol, and d-mannito), antioxidants (ascorbic acid and N-acetylcysteine), and other compounds (sodium azide, desferrioxamine) were examined at 1 (filled bar) and 10 mM (dark hatched bar), except for uric acid (0.2 mM) (light hatched bar). SOD and catalase were tested at 500 (filled bar) and 5000 (dark hatched bar) units/mL. Results are presented as % of control (means ⫾ SD, n ⫽ 3). *Significantly different from the control (Student’s t test, p ⬍ 0.05). (Reprinted from Ref. 41. Copyright 1997, American Chemical Society.)
236
Ohshima et al.
tion time and UV spectrum of this new compound differed from those of 6nitrodopamine, which was formed by the reaction of dopamine with NO gas (equivalent to ⬃5 mM nitrite) for 5 min (45,46). However, 6-nitrodopamine was not observed after the reaction of dopamine with 5mM DEA-NO for 60 min. In addition to dopamine, we carried out similar experiments with epinephrine. The quinone derivatives of epinephrine and/or adrenochrome, but not the 6-nitro derivative, were formed by incubation of 0.1 mM epinephrine in the presence of 0.1–5 mM DEA-NO (41).
III.
PEROXYNITRITE AS A POSSIBLE COMPOUND RESPONSIBLE FOR DNA STRAND BREAKAGE INDUCED BY NO AND CATECHOLAMINES
Studies on a structure–activity relationship (Table 1, Fig. 2) (41) demonstrate that catechol-type compounds as well as 6-hydroxy derivatives of dopa and dopamine exhibit strong activities, whereas tyrosine, tyramine, and O-methyl derivatives of dopa and dopamines did not exert this synergistic effect even in the presence of NO. Catecholamines and the 6-hydroxy derivatives, but not tyrosine, tyramine, or O-methyl derivatives of catecholamines, have been reported to autooxidize easily to their semiquinone derivatives, which can reduce dioxygen to generate •⫺ O •⫺ 2 (37,40,47). O 2 generated by xanthine oxidase and hypoxanthine also induced strand breakage in the presence of NO-releasing compounds. Thus, O •⫺ 2 and reactive oxygen species formed from O •⫺ 2 could be involved in DNA damage induced by catecholamines and NO. However, as shown in Fig. 3A, catalase as well as HO • scavengers such as DMSO, ethanol, and d-mannitol did not inhibit strand breakage induced by dopamine and NO. This contrasts considerably with the fact that the SSB induced by 6-hydroxydopamine alone can be inhibited by compounds such as DMSO, d-mannitol, and catalase (Fig. 3B). These findings indicate that SSB induced by 6-hydroxydopamine are most likely caused by free hydrogen peroxide and HO • , which may be formed in the presence of metallic ions. These reactive oxygen species may not be involved in the breakage induced by dopamine and NO; rather a new oxidant(s) formed by the reaction of NO with either dopamine or O •⫺ 2 could be responsible for causing DNA strand breakage. As shown in Fig. 3A, DNA damage induced by a catecholamine and NOreleasing compounds can be inhibited by carboxy-PTIO [an NO-trapping agent (48)] and SOD, suggesting that both NO and O •⫺ 2 are needed to exert this synergistic effect on the DNA breakage. It has recently been reported that these two radicals react very rapidly to form a strong oxidant and nitrating agent, peroxynitrite, which can initiate reactions characteristic of HO • , nitronium ion (NO 2⫹), and
DNA Strand Breakage
237
nitrogen dioxide radical (•NO 2 ) (19,20). Peroxynitrite can induce DNA strand breaks in plasmid DNA in vitro (24–26), which, however, cannot be inhibited by HO• scavengers such as d-mannitol and DMSO (24,27). Similarly, the strand breakage induced by dopamine plus NO was not inhibited by HO • scavengers (DMSO, ethanol, and d-mannitol) (Fig. 3A). Taken together, our data support a mechanism by which the peroxynitrite formed by interaction between NO and •⫺ O •⫺ 2 is responsible for DNA strand breakage. The latter compound (O 2 ) can be generated by the quinone/hydroquinone redox system with NO-mediated autooxidation of catecholamines (Fig. 4) (37,40,47). Among the various catecholamines tested, 6-hydroxydopa and 6-hydroxydopamine in the presence of NO-releasing compounds induced SSB most strongly (2.0–4.4 SSB/10 4 bp). A combination of 6-hydroxydopa and NO also induced formation of the linear form III in addition to the open circular form II, indicating that these compounds caused double-strand breaks in DNA. It has been reported that the rates of autooxidation of 6-hydroxydopa and 6-hydroxydopamine at pH 7.2 are much greater (⬎150 times) than those of other catecholamines such as dopamine (37). It is therefore possible that 6-hydroxydopa and 6hydroxydopamine generate greater amounts of O •⫺ 2 , which reacts with NO to generate increased levels of peroxynitrite, resulting in stronger induction of SSB than that produced by other catecholamines (41).
Figure 4 Proposed mechanisms for production of reactive species (peroxynitrite and nitroxyl anion) responsible for DNA strand breakage induced by catecholamines and nitric oxide.
238
IV.
Ohshima et al.
NITROXYL ANION (NO ⴚ) AS A POSSIBLE COMPOUND RESPONSIBLE FOR DNA STRAND BREAKAGE INDUCED BY NO AND CATECHOLAMINES
Although the DNA strand breakage caused by peroxynitrite is markedly inhibited by desferrioxamine and uric acid (27), these compounds were less effective against the strand breakage induced by NO and dopamine (Fig. 3A). These results suggest that, in addition to peroxynitrite, the reaction between catecholamines and NO may also yield other types of compound, which could cause DNA damage directly. We have recently studied the effects of 18 flavonoids and related phenolic compounds on DNA damage induced by nitric oxide (NO), peroxynitrite, and nitroxyl anion (NO ⫺ ) (49). Similarly to the findings with catecholamines as described above, DNA single-strand breakage was induced synergistically when pBR322 plasmid was incubated in the presence of an NO-releasing compound (DEA-NO) and a flavonoid having an ortho-trihydroxyl group in either the B ring (e.g., epigallocatechin gallate) or the A ring (e.g., quercetagetin). Neither NO or any of the above flavonoids alone induced significant strand breakage. On the other hand, most of the flavonoids tested inhibited peroxynitritemediated DNA strand breakage. Similarly, most of the catecholamines tested were also found to inhibit peroxynitrite-mediated DNA strand breakage dosedependently. The question arises as to why catecholamines do not inhibit the strand breakage induced by NO. A possible explanation is that NO rapidly oxidizes catechol-type compounds to their semiquinone/quinone derivatives, which have only a weak ability to scavenge peroxynitrite and other reactive species (49). Another possible explanation could be that reactive species other than peroxynitrite might be formed by the reaction between catecholamines and NO. Such compounds include NO x and NO ⫺. NO may react with a semiquinone radical to form a semiquinone-NO adduct(s), which may cause SSB by a direct reaction with DNA or by NO x generated from it (41,50). NO ⫺ could also be formed by one-electron reduction of NO by the quinone/hydroquinone redox system in a manner similar to that of the formation of O •⫺ 2 from oxygen (Fig. 4). We have recently demonstrated that NO ⫺ generated from Angeli’s salt is a strong oxidant, which can cause DNA strand breakage and induce oxidative damage (49,51). At physiological pH, Angeli’s salt exists predominantly in the form of the monoanion HN 2 O 3⫺ , which decomposes to NO ⫺ and nitrite (NO 2⫺) [Eq. (1)] (52). As HNO is a weak acid (pK a ⫽ 4.7), NO ⫺ is the predominant form in aqueous solution at neutral pH [Eq. (2)] (52). HN 2 O 3⫺ → HNO ⫹ NO 2⫺
(1)
HNO ↔ NO ⫺ ⫹ H ⫹
(2)
DNA Strand Breakage
239
SSB induced by Angeli’s salt are time- and dose-dependent and are inhibited not only by various antioxidants but also by SOD, which converts NO ⫺ to NO (53). Interestingly, various flavonoids and phenolic compounds tested showed only weak inhibitory effects against NO ⫺-mediated SSB, compared to the damage induced by peroxynitrite (49). Taken together, it is possible that NO ⫺ generated from NO by the quinone/hydroquinone redox system may also be responsible, at least in part, for SSB induced by NO and catecholamine. NO ⫺ generated from Angeli’s salt has recently been reported to be cytotoxic and to cause DNA damage in cultured cells (54). However, as NO ⫺ can be converted to NO under physiological conditions (55) and in cells (56), it is currently unknown as to what species derived from NO ⫺ are responsible for such toxicity. Our recent findings indicate that NO ⫺ itself or an immediate reaction product(s) may cause SSB directly (49,51). It has been reported that NO ⫺ can be converted to NO by reaction with oxygen, which is accompanied with the formation of hydrogen peroxide [Eqs. (3) and (4)] (55). It is therefore possible that reactive oxygen species such as hydrogen peroxide and hydroxyl radical (HO • ) are involved in the toxicity mediated by Angeli’s salt. NO ⫺ ⫹ O 2 → NO ⫹ O •⫺ 2 2O
•⫺ 2
(3)
⫹ 2H → H 2 O 2 ⫹ O 2 ⫹
(4)
It has also been suggested that NO ⫺ reacts rapidly with NO to form (NO) •⫺ 2 and (NO) •⫺ 3 [Eqs. (5) and (6)] (57,58). In vivo, the concentration of NO is not high enough to form (NO) 3⫺ , but (NO) •⫺ 2 may be formed, which could then decay to N 2O and the highly reactive hydroxyl radical (HO • ) [Eq. (7)] (57,58). In addition, triplet state NO ⫺ could react with molecular oxygen to form peroxynitrite, although this reaction occurs only slowly [Eq. (8)] (59). NO ⫺ ⫹ NO → N2O •⫺ 2 N2O
⫹ NO → N 3 O
•⫺ 2
⫹ H → N 2O ⫹ HO
N2O
⫺ 3
⫹
NO ⫹ O2 → ONOO ⫺
V.
(5)
•⫺ 2
(6) •
⫺
(7) (8)
PATHOPHYSIOLOGICAL IMPLICATIONS
The reaction of catecholamines with NO yields a strong oxidant(s) and elicits DNA strand breakage synergistically. In a variety of cells, DNA single-strand breakage activates the nuclear enzyme poly(ADP-ribose) polymerase (PARP) (60,61). This enzyme transfers multiple poly(ADP-ribose) groups to nuclear proteins such as histones and PARP itself, using NAD ⫹ as a substrate. Massive
240
Ohshima et al.
activation of PARP results in rapid depletion of intracellular NAD ⫹, slowing the rate of glycolysis, electron transport, and subsequently ATP formation, and leading to cell death from energy deficiency (60,61). Recent in vitro and in vivo studies have shown that NO and peroxynitrite can trigger DNA single-strand breakage and PARP activation in various cell types (60,61). Brain injury caused by ischemia-reperfusion or MPTP can be diminished in animals treated with pharmacological inhibitors of NO synthase (16–18) or PARP (62,63), or in mice with disruption of the gene which encodes either nNOS (14,17,63) or PARP (64). Catecholamines and NO have been postulated separately as playing a role in the pathogenesis of various neurodegenerative diseases (see Sec. I). However, it has never been considered that these two compounds act synergistically to cause cellular and/or DNA damage. Many recent studies have demonstrated that interaction between NO and catecholamines may occur in vivo. For example, NO has been implicated in the regulation of the release of neurotransmitters such as norepinephrine (65,66) and dopamine (67,68) in vivo. More direct evidence is also accumulating, including the identification in the mammalian brain (69) of 6-nitroepinephrine, the reaction product between NO and epinephrine (45,46). Increased release of both dopamine and NO has also been shown to occur during neuronal damage caused by cerebral ischemia-reperfusion (13,70,71). Under physiological and pathological conditions, NO is synthesized by three distinct isoforms of NO synthase, i.e., constitutive neuronal, constitutive endothelial, and inducible types of NO synthase. All of these isoforms play important roles in the central nervous system (10,11). Heme–NO complex in human substantia nigra (72) as well as increased concentrations of nitrite, an in vivo–oxidized product of NO, in cerebrospinal fluids (4), have been reported in patients with Parkinson’s disease. Increased levels of nitrotyrosine-containing proteins, which have been measured as a marker for in vivo formation of peroxynitrite and other reactive nitrogen species (73,74), have been detected in human subjects with neurodegenerative diseases (5,6). Excess NO could also be responsible for neurotoxicity associated with NMDA receptor activation (12) and cold-induced brain edema (15). Thus, the interaction between catecholamines and NO may occur under a variety of pathophysiological conditions and may result in the production of a new oxidant(s), including peroxynitrite and NO ⫺ , which may induce cellular and/ or DNA damage. In conclusion, catecholamines formed in dopaminergic neurons and NO formed by microglia or astrocytes or the two compounds produced within the same neuronal cells may interact synergistically to produce a potent oxidant(s), peroxynitrite, and/or nitroxyl anion. These oxidants can elicit DNA strand breakage, which may cause PARP activation and subsequent cell death due to depletion of NAD ⫹ and ATP, thus playing an important role in the pathogenesis of various neurodegenerative diseases.
DNA Strand Breakage
VI.
241
SUMMARY
Oxidative damage in neuronal cells and DNA has been implicated in the pathogenesis of various neurodegenerative diseases. DNA strand breakage is induced synergistically when plasmid DNA is incubated in the presence of both a nitric oxide–releasing compound and a catecholamine (e.g., l-dopa, dopamine, etc.). We propose that peroxynitrite and/or nitroxyl anion (NO ⫺) could be responsible for DNA strand breakage induced by NO and catecholamines. NO in the presence of oxygen can oxidize catecholamines to form quinone derivatives, which lead •⫺ to the generation of O •⫺ 2 by the quinone/hydroquinone redox system. O 2 then reacts rapidly with NO to form peroxynitrite, a strong oxidant and nitrating agent. It is also possible that NO ⫺ , which is generated by one-electron reduction of NO by the quinone/hydroquinone redox system in a manner similar to that of the ⫺ formation of O •⫺ 2 , may cause DNA damage. The NO -releasing compound Angeli’s salt can cause DNA strand breakage. Thus a synergistic interaction between catecholamines formed in dopaminergic neurons and NO formed by microglia or astrocytes or the two componds produced within the same neuronal cells may lead to the production of a potent oxidant(s), which could cause damage in cells and DNA. This process could play an important role in the pathogenesis of various neurodegenerative diseases.
NOTE ADDED TO PROOFS Nitroxy anion (NO⫺ ) was found to act as a reductant to catalyze the formation of HO• from H 2 O 2 plus Fe (III) and formation of Cu (I)-peroxide complexes with a reactivity similar to HO• form H 2 O 2 and Cu (II) (75).
ACKNOWLEDGMENTS The authors thank Ms. J. Mitchell for editorial assistance, Mr. S. Auriol for technical assistance, and Mrs. P. Collard for secretarial work. Y.Y. was the recipient of a fellowship from the Japan Society for the Promotion of Science.
REFERENCES 1. Coyle, J.T. and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262, 689–695.
242
Ohshima et al.
2. Adams, J.D., Jr. and Odunze, I.N. (1991) Oxygen free radicals and Parkinson’s disease. Free Radic. Biol. Med. 10, 161–169. 3. Gerlach, M., Ben Shachar, D., Riederer, P., and Youdim, M.B. (1994) Altered brain metabolism of iron as a cause of neurodegenerative diseases? J. Neurochem. 63, 793–807. 4. Qureshi, G.A., Baig, S., Bednar, I., Sodersten, P., Forsberg, G., and Siden, A. (1995) Increased cerebrospinal fluid concentration of nitrite in Parkinson’s disease. Neuroreport 6, 1642–1644. 5. Smith, M.A., Richey, H.P., Sayre, L.M., Beckman, J.S., and Perry, G. (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J. Neurosci. 17, 2653–2657. 6. Good, P.F., Werner, P., Hsu, A., Olanow, C.W., and Perl, D.P. (1996) Evidence of neuronal oxidative damage in Alzheimer’s disease. Am. J. Pathol. 149, 21–28. 7. Thompson, C.B. (1995) Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456–1462. 8. Dragunow, M., MacGibbon, G.A., Lawlor, P., Butterworth, N., Connor, B., Henderson, C., Walton, M., Woodgate, A., Hughes, P., and Faull, R.L. (1997) Apoptosis, neurotrophic factors and neurodegeneration. Rev. Neurosci. 8, 223–265. 9. Savitz, S.I. and Rosenbaum, D.M. (1998) Apoptosis in neurological disease. Neurosurgery 42, 555–572. 10. Moncada, S. and Higgs, A. (1993) The l-arginine-nitric oxide pathway. N. Engl. J. Med. 329, 2002–2012. 11. Schmidt, H.H. and Walter, U. (1994) NO at work. Cell 78, 919–925. 12. Dawson, V.L., Dawson, T.M., London, E.D., Bredt, D.S., and Snyder, S.H. (1991) Nitric oxide mediates glutamate neurotoxicity in primary cortical cultures. Proc. Natl. Acad. Sci. USA 88, 6368–6371. 13. Huang, Z., Huang, P.L., Panahian, N., Dalkara, T., Fishman, M.C., and Moskowitz, M.A. (1994) Effects of cerebral ischemia in mice deficient in neuronal nitric oxide synthase. Science 265, 1883–1885. 14. Dawson, V.L., Kizushi, V.M., Huang, P.L., Snyder, S.H., and Dawson, T.M. (1996) Resistance to neurotoxicity in cortical cultures from neuronal nitric oxide synthase– deficient mice. J. Neurosci. 16, 2479–2487. 15. Oury, T.D., Piantadosi, C.A., and Crapo, J.D. (1993) Cold-induced brain edema in mice. Involvement of extracellular superoxide dismutase and nitric oxide. J. Biol. Chem. 268, 15394–15398. 16. Schulz, J.B., Matthews, R.T., Muqit, M.M., Browne, S.E., and Beal, M.F. (1995) Inhibition of neuronal nitric oxide synthase by 7-nitroindazole protects against MPTP-induced neurotoxicity in mice. J. Neurochem. 64, 936–939. 17. Przedborski, S., Jackson Lewis, V., Yokoyama, R., Shibata, T., Dawson, V.L., and Dawson, T.M. (1996) Role of neuronal nitric oxide in 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine (MPTP)–induced dopaminergic neurotoxicity. Proc. Natl. Acad. Sci. USA 93, 4565–4571. 18. Hantraye, P., Brouillet, E., Ferrante, R., Palfi, S., Dolan, R., Matthews, R.T., and Beal, M.F. (1996) Inhibition of neuronal nitric oxide synthase prevents MPTPinduced parkinsonism in baboons. Nature Med. 2, 1017–1021.
DNA Strand Breakage
243
19. Beckman, J.S., Chen, J., Ischiropoulos, H., and Crow, J.P. (1994) Oxidative chemistry of peroxynitrite. Meth. Enzymol. 233, 229–240. 20. Pryor, W.A. and Squadrito, G.L. (1995) The chemistry of peroxynitrite: a product from the reaction of nitric oxide with superoxide. Am. J. Physiol. 268, L699– L722. 21. Wink, D.A. and Mitchell, J.B. (1998) Chemical biology of nitric oxide: insights into regulatory, cytotoxic, and cytoprotective mechanisms of nitric oxide. Free Rad. Biol. Med. 25, 434–456. 22. Nguyen, T., Brunson, D., Crespi, C.L., Penman, B.W., Wishnok, J.S., and Tannenbaum, S.R. (1992) DNA damage and mutation in human cells exposed to nitric oxide in vitro. Proc. Natl. Acad. Sci. USA 89, 3030–3034. 23. Wink, D.A., Kasprzak, K.S., Maragos, C.M., Elespuru, R.K., Misra, M., Dunams, T.M., Cebula, T.A., Koch, W.H., Andrews, A.W., Allen, J.S., and Keefer, L.K. (1991) DNA deaminating ability and genotoxicity of nitric oxide and its progenitors. Science 254, 1001–1003. 24. Salgo, M.G., Stone, K., Squadrito, G.L., Battista, J.R., and Pryor, W.A. (1995) Peroxynitrite causes DNA nicks in plasmid pBR322. Biochem. Biophys. Res. Commun. 210, 1025–1030. 25. King, P.A., Anderson, V.E., Edwards, J.O., Gustafson, G., Plumb, R.C., and Suggs, J.W. (1992) A stable solid that generates hydroxyl radical upon dissolution in aqueous solutions: reactions with proteins and nucleic acid. J. Am. Chem. Soc. 114, 5430–5432. 26. Rubio, J., Yermilov, V., and Ohshima, H. (1996) DNA damage induced by peroxynitrite: formation of 8-nitroguanine and base propenals. In: The Biology of Nitric Oxide (Moncada, S., Stamler, J., Gross, S., and Higgs, E.A., eds.), Portland Press Proceedings, London, p. 34. 27. Yoshie, Y. and Ohshima, H. (1997) Nitric oxide synergistically enhances DNA strand breakage induced by polyhydroxyaromatic compounds, but inhibits that induced by the Fenton-reaction. Arch. Biochem. Biophys. 342, 13–21. 28. Yermilov, V., Yoshie, Y., Rubio, J., and Ohshima, H. (1996) Effects of carbon dioxide/bicarbonate on induction of DNA single-strand breaks and formation of 8nitroguanine, 8-oxoguanine and base-propenal mediated by peroxynitrite. FEBS Lett. 399, 67–70. 29. Szabo, C. and Ohshima, H. (1997) DNA damage induced by peroxynitrite: subsequent biological effects. Nitric Oxide Biol. Chem. 1, 373–385. 30. Yermilov, V., Rubio, J., Becchi, M., Friesen, M.D., Pignatelli, B., and Ohshima, H. (1995) Formation of 8-nitroguanine by the reaction of guanine with peroxynitrite in vitro. Carcinogenesis 16, 2045–2050. 31. Yermilov, V., Rubio, J., and Ohshima, H. (1995) Formation of 8-nitroguanine in DNA treated with peroxynitrite in vitro and its rapid removal from DNA by depurination. FEBS Lett. 376, 207–210. 32. Douki, T., Cadet, J., and Ames, B.N. (1996) An adduct between peroxynitrite and 2′deoxyguanosine: 4,5-dihydro-5-hydroxy-4-(nitrosooxy)-2′-deoxyguanosine. Chem. Res. Toxicol. 9, 3–7. 33. Blanco, F.J., Ochs, R.L., Schwarz, H., and Lotz, M. (1995) Chondrocyte apoptosis induced by nitric oxide. Am. J. Pathol. 146, 75–85.
244
Ohshima et al.
34. Ankarcrona, M., Dypbukt, J.M., Brune, B., and Nicotera, P. (1994) Interleukin-1 beta-induced nitric oxide production activates apoptosis in pancreatic RINm5F cells. Exp. Cell Res. 213, 172–177. 35. Salgo, M.G., Squadrito, G.L., and Pryor, W.A. (1995) Peroxynitrite causes apoptosis in rat thymocytes. Biochem. Biophys. Res. Commun. 215, 1111–1118. 36. Estevez, A.G., Radi, R., Barbeito, L., Shin, J.T., Thompson, J.A., and Beckman, J.S. (1995) Peroxynitrite-induced cytotoxicity in PC12 cells: evidence for an apoptotic mechanism differentially modulated by neurotrophic factors. J. Neurochem. 65, 1543–1550. 37. Graham, D.G., Tiffany, S.M., Bell, W.R., Jr., and Gutknecht, W.F. (1978) Autoxidation versus covalent binding of quinones as the mechanism of toxicity of dopamine, 6-hydroxydopamine, and related compounds toward C1300 neuroblastoma cells in vitro. Mol. Pharmacol. 14, 644–653. 38. Kalyanaraman, B., Felix, C.C., and Sealy, R.C. (1985) Semiquinone anion radicals of catechol(amine)s, catechol estrogens, and their metal ion complexes. Environ. Health Persp. 64, 185–198. 39. O’Brien, P.J. (1991) Molecular mechanisms of quinone cytotoxicity. Chem. Biol. Interact. 80, 1–41. 40. Spencer, J.P., Jenner, A., Aruoma, O.I., Evans, P.J., Kaur, H., Dexter, D.T., Jenner, P., Lees, A.J., Marsden, D.C., and Halliwell, B. (1994) Intense oxidative DNA damage promoted by l-dopa and its metabolites. Implications for neurodegenerative disease. FEBS Lett. 353, 246–250. 41. Yoshie, Y. and Ohshima, H. (1997) Synergistic induction of DNA strand breakage caused by nitric oxide together with catecholamine: implications for neurodegenerative disease. Chem. Res. Toxicol. 10, 1015–1022. 42. Keefer, L.K., Nims, R.W., Davies, K.M., and Wink, D.A. (1996) ‘‘NONOates’’ (1substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: convenient nitric oxide dosage forms. Meth. Enzymol. 268, 281–293. 43. Mattammal, M.B., Strong, R., White, E.5., and Hsu, F.F. (1994) Characterization of peroxidative oxidation products of dopamine by mass spectrometry. J. Chromatogr. B. Biomed. Appl. 658, 21–30. 44. Macarthur, H., Mattammal, M.B., and Westfall, T.C. (1995) A new perspective on the inhibitory role of nitric oxide in sympathetic neurotransmission. Biochem. Biophys. Res. Commun. 216, 686–692. 45. de la Breteche, M.-L., Servy, C., Lenfant, M., and Ducrocq, C. (1994) Nitration of catecholamines with nitrogen oxides in mild conditions: a hypothesis for the reactivity of NO in physiological systems. Tetrahedron Lett. 39, 7231–7232. 46. d’Ischia, M. and Costantini, C. (1995) Nitric oxide-induced nitration of catecholamine neurotransmitters: a key to neuronal degeneration? Bioorg. Med. Chem. 3, 923–927. 47. Basma, A.N., Morris, E.J., Nicklas, W.J., and Geller, H.M. (1995) l-Dopa cytotoxicity to PC12 cells in culture is via its autoxidation. J. Neurochem. 64, 825–832. 48. Akaike, T., Yoshida, M., Miyamoto, Y., Sato, K., Kohno, M., Sasamoto, K., Miyazaki, K., Ueda, S., and Maeda, H. (1993) Antagonistic action of imidazolineoxyl Noxides against endothelium-derived relaxing factor/•NO through a radical reaction. Biochemistry 32, 827–832.
DNA Strand Breakage
245
49. Ohshima, H., Yoshie, Y., Auriol, S., and Gilibert, I. (1998) Anti-oxidant and prooxidant actions of flavonoids: effects on DNA damage induced by nitric oxide, peroxynitrite and nitroxyl anion. Free Radic. Biol. Med. 25, 1057–1065. 50. Yoshie, Y. and Ohshima, H. (1998) Synergistic induction of DNA strand breakage by catechol-estrogen and nitric oxide: implications for hormonal carcinogenesis. Free Rad. Biol. Med. 24, 341–348. 51. Ohshima, H., Gilibert, I., and Bianchini, F. (1999) Induction of DNA strand breakage and base oxidation of nitroxyl anion through hydroxyl radical production. Free Radic. Biol. Med. 26, 1305–1313. 52. Wink, D.A. and Feelisch, M. (1996) Formation and detection of nitroxyl and nitrous oxide. In: Methods in Nitric Oxide Research (Feelisch, M. and Stamler, J. eds.), Wiley, New York, pp. 403–412. 53. Murphy, M.E. and Sies, H. (1991) Reversible conversion of nitroxyl anion to nitric oxide by superoxide dismutase. Proc. Natl. Acad. Sci. USA 88, 10860–10864. 54. Wink, D.A., Feelisch, M., Fukuto, J., Chistodoulou, D., Jourd’heuil, D., Grisham, M.B., Vodovotz, Y., Cook, J.A. Krishna, M., DeGraff, W.G., Kim, S., Gamson, J., and Mitchell, J.B. (1998) The cytotoxicity of nitroxyl: possible implications for the pathophysiological role of NO. Arch. Biochem. Biophys. 351, 66–74. 55. Fukuto, J.M., Hobbs, A.J., and Ignarro, L.J. (1993) Conversion of nitroxyl (HNO) to nitric oxide (NO) in biological systems: the role of physiological oxidants and relevance to the biological activity of HNO. Biochem. Biophys. Res. Commun. 196, 707–713. 56. VanUffelen, B.E., Van der Zee, J., de Koster, B.M., VanSteveninck, J., and Elferink, J.G.R. (1998). Intracellular but not extracellular conversion of nitroxyl anion into nitric oxide leads to stimulation of human neutrophil migration. Biochem. J. 330, 719–722. 57. Seddon, W.A., Fletcher, J.W., and Sopchyshyn, F.C. (1998). Pulse radiolysis of nitric oxide in aqueous solution. Can. J. Chem. 51, 1123–1130. 58. Koppenol, W.H. (1996) Thermodynamics of reactions involving nitrogen-oxygen compounds. Meth. Enzymol. 268, 7–12. 59. Donald, C.E., Hughes, M.N., Thompson, J.M., and Bonner, F.T. (1986). Photolysis of the N ⫽ N bond in trioxodinitrate: reaction between triplet NO⫺ and O2 to form peroxynitrite. Inorg. Chem. 25, 2676–2677. 60. Szabo, C. (1996) DNA strand breakage and activation of poly-ADP ribosyltransferase: a cytotoxic pathway triggered by peroxynitrite. Free Rad. Biol. Med. 21, 855– 869. 61. Szabo, C. and Dawson, V.L. (1998). Role of poly(ADO-ribose)synthetase in inflammation and ischemia-reperfusion. Trends Pharmacol. Sci. 19, 287–298. 62. Cosi, C., Chopin, P., and Marien, M. (1996) Benzamide, an inhibitor of poly(ADPribose) polymerase, attenuates methamphetamine-induced dopamine neurotoxicity in the C57B1/6N mouse. Brain Res. 735, 343–348. 63. Cosi, C., Colpaert, F., Koek, W., Degryse, A., and Marien, M. (1996) Poly(ADPribose) polymerase inhibitors protect against MPTP-induced depletions of striatal dopamine and cortical noradrenaline in C57B1/6 mice. Brain Res. 729, 264–269. 64. Eliasson, M.J., Sampei, K., Mandir, A.S., Hurn, P.D., Traystman, R.J., Bao, J., Pieper, A., Wang, Z.Q., Dawson, T.M., Snyder, S.H., and Dawson, V.L. (1997)
246
65.
66.
67.
68.
69.
70.
71.
72.
73. 74.
75.
Ohshima et al. Poly(ADP-ribose) polymerase gene disruption renders mice resistant to cerebral ischemia. Nature Med. 3, 1089–1095. Montague, P.R., Gancayco, C.D., Winn, M.J., Marchase, R.B., and Friedlander, M.J. (1994). Role of NO production in NMDA receptor–mediated neurotransmitter release in cerebral cortex. Science 263, 973–977. Canteros, G., Rettori, V., Franchi, A., Genaro, A., Cebral, E., Faletti, A., Gimeno, M., and McCann, S.M. (1995) Ethanol inhibits luteinizing hormone–releasing hormone (LHRH) secretion by blocking the response of LHRH neuronal terminals to nitric oxide. Proc. Natl. Acad. Sci. USA 92, 3416–3420. Liu, L., Liu, G.L., and Barajas, L. (1995) Colocalization of NADPH-diaphorase and dopamine beta-hydroxylase in the neuronal somata of the rat kidney. Neurosci. Lett. 202, 69–72. Fujiyama, F. and Masuko, S. (1996) Association of dopaminergic terminals and neurons releasing nitric oxide in the rat striatum: an electron microscopic study using NADPH-diaphorase histochemistry and tyrosine hydroxylase immunohistochemistry. Brain Res. Bull. 40, 121–127. Shintani, F., Kinoshita, T., Kanba, S., Ishikawa, T., Suzuki, E., Sasakawa, N., Kato, R., Asai, M., and Nakaki, T. (1996) Bioactive 6-nitronorepinephrine identified in mammalian brain. J. Biol. Chem. 271, 13561–13565. Kahn, R.A., Weinberger, J., Brannan, T., Prikhojan, A., and Reich, D.L. (1995) Nitric oxide modulates dopamine release during global temporary cerebral ischemia. Anesth. Analg. 80, 1116–1121. Zhang, Z.G., Chopp, M., Gautam, S., Zaloga, C., Zhang, R.L., Schmidt, H.H., Pollock, J.S., and Forstermann, U. (1994) Upregulation of neuronal nitric oxide synthase and mRNA, and selective sparing of nitric oxide synthase–containing neurons after focal cerebral ischemia in rat. Brain Res. 654, 85–95. Shergill, J.K., Cammack, R., Cooper, C.E., Cooper, J.M., Mann, V.M., and Schpira, A.H.V. (1996) Detection of nitrosyl complexes in human substantia nigra, in relation to Parkinson’s disease. Biochem. Biophys. Res. Commun. 228, 298–305. Crow, J.P. and Ischiropoulos, H. (1996) Detection and quantification of nitrotyrosine residues in proteins: in vivo marker of peroxynitrite. Meth. Enzymol. 269, 185–194. van der Vliet, A., Eiserich, J.P., Kaur, H., Cross, C.E., and Halliwell, B. (1997) Nitrotyrosine as biomarker for reactive nitrogen species. Meth. Enzymol. 269, 175– 194. Chazotte-Aubert, L., Oikawa, S., Gilibert, I., Bianchini, F., Kawanishi, S., and Ohshima, H. (1999) Cytotoxicity and site-specific DNA damage induced by nitroxyl anion (NO⫺ ) in the presence of hydrogen peroxide: implications for various pathophysiological conditions. J. Biol. Chem. 274, 20909–20915.
12 6-Hydroxydopamine, Dopamine, and Ferritin: A Cycle of Reactions Sustaining Parkinson’s Disease? G. N. L. Jameson and Wolfgang Linert Institute of Inorganic Chemistry, Technical University of Vienna, Vienna, Austria
I. INTRODUCTION A.
General
Parkinson’s disease is a neurologically based disorder first described by Parkinson in 1817 which affects approximately 1% of the population over 55 years in age. It is characterized by hypokinesia, rigidity, and tremor, and can be related to an extreme deficiency of the neurotransmitter dopamine in the striatum. When studying the biochemistry of such a complex system as the human body and what can go wrong with it, it is essential to understand the underlying chemistry involved. In this chapter we hope to describe some chemical interactions that might be important and might stimulate and guide further medical and biochemical research in this field. B.
Medical Aspects
Some populations of melanized neurons of the brain have been shown to be selectively vulnerable in that, in contrast to most other neurons of the lower brainstem, they show an increased rate of degeneration in both normal aging and in the development of Parkinson’s disease (1–3). This is directly related to more rapidly decreasing dopamine concentrations in the brain, as is shown schematically in Figure 1. These dopaminergic neurons are also specifically sensitive to manganese, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), 6-hydroxy247
248
Jameson and Linert
Figure 1 Destruction of neurons during normal aging, Parkinson’s disease, and induced by neurotoxins.
dopamine, and other, as yet unidentified, factors such as specific proteins that are presumed to give rise to Parkinson’s disease. It is significant in this respect that both MPTP and 6-hydroxydopamine are used in animal models to induce and thus study Parkinson’s disease. In neither case is the mechanism of their toxicity understood with certainty. It is known that MPTP is converted by (and competitively inhibits) monoamine oxidases into MPP⫹ which has an extended π system stabilizing the radical and allowing redox cycling. Consequently, interference with the mitochondrial electron transport system seems a likely candidate (4,5) (see Fig. 2). A plausible
Figure 2
Metabolism of MPTP by MAO-B and subsequent redox cycling.
6-Hydroxydopamine, Dopamine, and Ferritin
249
mechanism for 6-hydroxydopamine will be presented here, although the issue has been confused because many animal experiments with 6-hydroxydopamine are carried out in the presence of antioxidants such as ascorbic acid or glutathione. These molecules have been shown unable to stop oxidation of 6-hydroxydopamine which occurs extremely rapidly at physiological pH (6). Further, as we shall see later, thiol-containing compounds such as glutathione react rapidly with the first stable oxidation product, i.e., the quinone, to give toxic dihydrobenzothiazines. The decompartmentation of iron (or ‘‘tissue iron overload’’) is known (7) to lead to a state of oxidative stress, and it is highly relevant that many cytotoxic compounds that readily promote redox reactions can release iron from storage. A well-documented example is that of paraquat toxicity of the lung, which has been linked (8) to the ability of paraquat to completely release the iron from ferritin. Very importantly, studies have demonstrated that in rats intraventricular preinjection of desferrioxamine (Desferral, a selective iron chelator) attenuates 6-hydroxydopamine-induced lesions of nigrostriatal dopamine neurons (9). This was made evident by the prevention of loss of striatal dopamine and the reduction of homovanillic acid (HVA) and 3,4-dihydroxyphenylacetic acid (DOPAC) (usually observed after injection with 6-hydroxydopamine). In the central nervous system (CNS), bound iron [Fe(III)] is usually concentrated in specialized membranes, such as mitochondria, or the cellular cytoplasm. Most brain iron is stored in an inactive form bound to intracellular ferritin that can be considered a special compartment of its own and will be discussed in more detail later. The human brain iron content is highest in the substantia nigra, globus pallidus, red nucleus, caudate nucleus, and putamen. Increased iron levels have been observed in several neurological disorders, e.g., Parkinson’s disease, Huntington’s disease, striatonigral degeneration, and Hallervorden-Spatz disease (10–13). However, these data and the demonstration of increased iron content in the SN in experimentally induced lesions of the nigrostriatal dopaminergic system by 6-hydroxydopamine (14) suggest that iron accumulation is not the primary cause of selective degeneration of dopaminergic neurons in Parkinson’s disease. The degeneration is in fact more likely due to a secondary process related to some initial toxic insult involving heterogeneous catecholaminergic cell groups in the brain (15,16). In fact, an excess of iron within the substantia nigra has been implicated in the progression of the disease through its participation in the continuous formation of cytotoxic free radicals (17). Based on the demonstration of this increase in ‘‘free’’ iron in the substantia nigra of the brains of patients who had died from Parkinson’s disease, together with its accumulation in melanin particles in the remaining cells (18), it has been proposed (19) that iron–melanin interactions may be involved in the degeneration of dopaminergic neurons. A possible mechanism that leads to an increase in the level of iron not protected by being bound to ferritin is thus required.
250
Jameson and Linert
C.
Chemical Aspects
1.
Oxygen
One of the most important yet dangerous reactions occurring in biological systems is that of oxidation. One form of oxidant employed (and historically the origin of the word) is dioxygen. Let us first consider the redox potentials given in Table 1. However, on the basis of this purely thermodynamic approach most organic substances should be oxidized under normal conditions which would, of course, be a disaster for life. Practical experience shows us that this is not the case and the reason behind this is readily explained on the basis of the molecular structure of dioxygen itself (Fig. 3). Dioxygen has a Π ground state with two unpaired electrons in the antibonding π* orbitals (see the left-hand side of Fig. 3) and as a result is paramagnetic. It is this fact that kinetically hinders its reaction with organic substrates. This is because most organic substances have a ⌺ ground state (i.e., all electrons are paired) in both the oxidized and reduced forms. The other products (hydrogen peroxide and water) are also singlets and spin conservation rules (20) forbid such reactions as: Triplet ⫹ Singlet → Singlet ⫹ Singlet [It is interesting to note at this point that in the presence of suitable UV light dioxygen is excited from the triplet ground state to a higher (excited) singlet state where all electrons are paired. As a result a very different chemistry of oxygen is observed in the upper atmosphere.] However, oxygen can be activated by using a transition metal ion catalyst. The bound dioxygen can adopt a variety of geometries with respect to the transi-
Table 1 Pertinent Redox Potentials for Oxygen Redox potential
Reaction H⫹ H⫹ H 2O 2 H⫹
⫹ ⫹ ⫹ ⫹
O2 HO2• e⫺ OH •
⫹ ⫹ → ⫹
e⫺ e⫺ OH• e⫺
→ → ⫹ →
HO2• H 2O2 OH • (bond breakage) H 2O
2H ⫹ H2O2
⫹ ⫹
O2 2H •
⫹ ⫹
2e⫺ 2e⫺
→ →
H2O2 2H 2O
4H ⫹
⫹
O2
⫹
4e⫺
→
2H 2O (simultaneous bond breakage)
⫺0.32V ⫹1.68V ⫹0.80V ⫹2.74V
⫹1.23V
6-Hydroxydopamine, Dopamine, and Ferritin
251
Figure 3 Simplified MO diagram showing how a transition metal complex activates dioxygen by inducing spin pairing.
tion metal ion, namely, parallel to or at right angles to the line linking the two species or ‘‘bent.’’ In all cases the d orbitals on the metal ion have the correct symmetry to interact with the π* orbitals of the O2 molecule (Fig. 4). This removes the degeneracy of these orbitals (see MO scheme depicted in Fig. 3), thus removing the spin restriction. Furthermore, if the substrate has orbitals of the correct symmetry to interact with the metal ion dzx orbitals, an extended molecular orbital system is produced allowing easy electron transfer from a ligand, ‘‘over’’ the metal ion, to the dioxygen—and this is the basis of metal ion catalyses involving dioxygen. Obviously, the extent and type of interaction depends on, inter alia, the metal ion, its valency state, and its environment. To take iron(II) as an example: it was shown many years ago by George (21) that the reaction of aqueous ferrous iron with dioxygen, to yield iron(III) and peroxide, proceeds via the formation of FeO 22⫹ which then binds to another, free, Fe2⫹ ion at which point two electrons are simultaneously transferred to the sandwiched O2. The binding of dioxygen to hemoglobin also involves this Fe(II)–
252
Jameson and Linert
Figure 4 The two extreme modes of bonding the dioxygen molecule to a transition metal ion. In many cases (e.g., hemoglobin) the bonding is intermediate in type, i.e., angular.
O2 bond, but electron transfer is prevented by the isolation of the heme ring system. We can now ask, what is the role of the distal nitrogen ligand in this binding? At this point we digress to discuss the Schiff base complexes of Co(II): If these complexes are dissolved in DMSO, then they rapidly take up O2 to form µ-peroxo-complexes (see Fig. 5). If a large excess of either chloroform (a poor donor to Co) OR pyridine (a very strong donor) is added, then the dioxygen is quantitatively released. In other words, the donor properties of the axial ligand have a profound effect on the donor properties of the cobalt vis-a`-vis the O2 molecule. Returning to the hemoglobin problem, we now see that the position (and hence donor properties) of the distal N atom are crucial—only when it is close to the Fe(II) atom is the dioxygen bound.
Figure 5 A µ-peroxo cobalt complex with a Schiff base where Solv. ⫽ DMSO and is the axial ligand with respect to the square-planar complex.
6-Hydroxydopamine, Dopamine, and Ferritin
253
Interaction with the O2 molecule is usually confined to the lower oxidation state, e.g., Cu(I), Fe(II), Co(II), V(II), etc., and so these are in general the active catalysts or reagents for the oxidation of organic species. The electron is thus transferred from the bound ligand via the metal ion to the O2. (This can, in many instances, mean that more than one complex is involved and hence a rapid or synchronous two-electron transfer to the dioxygen, i.e., no peroxy radical is detectable.) However, in the case of highly noninnocent ligands (i.e., those whose degree of delocalization prevents the assignment of meaningful oxidation states to the bound metal ion), this rule if often broken. For example, the oxidation of cysteine to cystine is catalyzed by both iron(II) and iron(III). It is noteworthy, therefore, that unlike the former, the iron(III) operates via the bis complex in which, because of very strong ligand-to-metal charge transfer, the iron acts essentially as iron(II) toward dioxygen. 2. Iron The aqueous solution chemistry of iron is governed by iron(II) and iron(III). At higher pH values and in the absence of ligands, the aqua ions of iron(II) are more stable with respect to hydrolysis than those of iron(III). In strongly acid solution the [Fe(H2O)6]3⫹ is stable but as the pH is increased the hexa-aqua ion is deprotonated to give the hydroxide, which further condenses and then precipitates out of solution. This propensity to flocculate and thus be removed from solution is due to the extremely low solubility product of Fe(OH)3 (see Table 2). An excellent review of this extremely complicated system is given by Flynn (22). Many complexes of iron are octahedral and then the ligand field can change the reactivity considerably. In a weak ligand field the complexes are high-spin and labile, while in a strong ligand field they are low-spin and inert. This is of importance and nature took account of this when she designed transport proteins.
Table 2 Pertinent Information About the Solution Chemistry of Iron Solubility product
K SP
Fe(II) as Fe(OH) 2 Fe(III) as Fe(OH) 3
4.9 ⫻ 10⫺17 2.6 ⫻ 10⫺39
Reaction (25°C, ionic strength ⫽ 1 M) Fe 3⫹ ⫹ H2O → FeOH 2⫹ ⫹ H⫹ FeOH 2⫹ ⫹ H2O → Fe(OH)2⫹ ⫹ H ⫹ 2Fe 3⫹ ⫹ 2H 2O → Fe 2(OH) 24⫹ ⫹ 2H ⫹
⫺log K 2.82 3.2 2.7
254
Jameson and Linert
Iron is well known to undergo a series of redox reactions with oxygen, superoxide, and peroxide which appear in the reaction pathway of oxidation due to dioxygen (see above). The reactivity of mixtures of iron(II) with hydrogen peroxide [known as Fenton’s reagent after H.J.H. Fenton (23)] is of particular importance. It gains its reactivity from the formation of hydroxyl radicals. Haber and Weiss in the early 1930s (24) proposed the following mechanism whereby iron acts as a catalyst in the decomposition of hydrogen peroxide. Fe2⫹ ⫹ H2O2 → Fe3⫹ ⫹ OH• ⫹ OH⫺ Fe3⫹ ⫹ H2O2 → Fe2⫹ ⫹ O2⫺ ⫹ H⫹ OH • ⫹ H2O2 → H2O ⫹ H⫹ ⫹ O 2⫺ Fe3⫹ ⫹ O2⫺ → Fe2⫹ ⫹ O2 Fe2⫹ ⫹ OH• → Fe3⫹ ⫹ OH⫺ Obviously, the resulting OH• radicals are extremely oxidizing (see Table 1) and capable of extensive damage to cell organelles. It might be argued, however, that in aqueous solutions it is not OH• radicals themselves that are of importance but rather ferryl species containing Fe(IV). These might be expected to be more selective in oxidation and this has been extensively discussed in the literature (25,26). Either way, both species are dangerous and are able to introduce hydroxyl substituents into organic substrates (see below where the formation of 6hydroxydopamine from dopamine is discussed). 3.
Ferritin
To avoid reactions such as the Fenton reaction described above (which would immediately lead to serious damage of any cell organelles, e.g., cell membranes, mitochondria, etc.), iron and other redox-active transition metal ions do not occur free in solution. They are either trapped in transport or in storage proteins, where they can be used as and when or where they are needed. One of the most important storage proteins for iron is ferritin (see Fig. 6). Ferritin is a spherical protein found in almost every form of life from bacteria to humans. It contains 24 equal subunits (or almost equal depending on the type of ferritin) (27). In the ‘‘empty’’ space inside up to 4500 Fe(III) ions can be stored in the form of a microcrystalline structure mainly built from FeO(OH) units. Iron is added and released as Fe(II), implying that both processes contain a redox step. In fact, work by Jones et al. (28) has shown a relation between the rate of iron release and redox potential. It has been found that 6-hydroxydopamine (29–31) releases iron from ferritin, and we believe that this ability is related to its action as a neurotoxin (see below). Note that its reactivity depends on its ability to reduce iron(III) to iron(II) and the ability of its oxidation product to complex iron(II).
6-Hydroxydopamine, Dopamine, and Ferritin
255
Figure 6 Cartoon of ferritin giving an idea of size and types of access to the iron(III) oxyhydroxide core.
4. The Catecholamines The catecholamines are a class of compounds of great biochemical importance (Fig. 7). They comprise a series of substituted catechols in which the substituent is ethylamine with various other substituents R1, R2, and R3. The most important are as follows: (i) Dopa [l-3-(3,4-dihydroxyphenyl)alanine] R1 ⫽ H, R2 ⫽ CO2H, R3 ⫽ H
Figure 7 General molecular structure of the catecholamines.
256
Jameson and Linert
Biochemical roles: A precursor of dopamine and formed by hydroxylation of tyrosine. (ii) Dopamine [2-(3,4-dihydroxyphenyl)ethylamine] R1 ⫽ R2 ⫽ R3 ⫽ H Biochemical roles: An important neurotransmitter in the central nervous system, and a precursor of noradrenaline and adrenaline. (iii) Adrenaline [epinephrine, l-1-(3,4-dihydroxyphenyl)-2-(methylamino)ethanol] R1 ⫽ OH, R2 ⫽ H, R3 ⫽ CH3 Biochemical roles: A hormone and a neurotransmitter. (iv) Noradrenaline [norepinephrine, 1-(3,4-dihydroxyphenyl)-2-aminoethanol] R1 ⫽ OH, R2 ⫽ R3 ⫽ H Biochemical roles: A hormone and a neurotransmitter. The nomenclature is retained when it is necessary to accommodate further substitution in the ring, e.g.: (v) 6-Hydroxydopamine (2,4,5-trihydroxyphenethylamine) R1 ⫽ R2 ⫽ R3 ⫽ H This is, as stated above, a potent neurotoxin and something we will talk a lot more about later in this chapter. II. THE INTERACTIONS OF CATECHOLAMINES WITH IRON(III): THE EXCEPTIONAL BEHAVIOR OF 6-HYDROXYDOPAMINE A.
Catecholamines
Catechols have been known for nearly 150 years to produce strongly colored complexes with transition metal ions (32). This color arises from a strong ligandto-metal charge transfer band. (For more information, see Ref. 33.) With time, however, this color disappears because of internal electron transfer. The stability of the complex depends on the coordination. For example, the bis complexes of iron(III) absorb at around 500 nm and are relatively stable. This is because in this case the ligands are non-innocent and so the iron is essentially iron(II) because of the large extent of charge transfer. The mono complex, on the other hand, which absorbs at 700 nm and is present mainly at lower pH reacts rapidly via internal electron transfer to produce the semiquinone and iron(II). Because of this variation in reactivity, investigations into the speciation are difficult, but, based on published data, it is possible to draw up a schematic speciation diagram
6-Hydroxydopamine, Dopamine, and Ferritin
257
Figure 8 An approximate speciation diagram using the following values: [Fe(III)]T ⫽ 1 ⫻ 10⫺4 M, [catecholamine (L)]T ⫽ 1 ⫻ 10⫺3 M, log KFeOH ⫽ 3, log K1 ⫽ 20, log K2 ⫽ 15, log K3 ⫽ 10, log β2H ⫽ 22.
(Fig. 8). After initial electron transfer further reactions occur, and these are summarized in Figure 9. It has been established that only FeOH2⫹ reacts. This may well be because the rearrangement of orbitals and protons required is thus minimized (34–37). In acid solution the product is the mono complex with a strong metal-to-ligand charge transfer band at about 700 nm. Protonation of this may lead to the monodentate complex in which an electron is transferred. [It is worth noting at this point that there is x-ray (38) and NMR spectroscopic evidence in solution (39) that protonated catechols act as monodentate ligands towards iron(III).] The semiquinone produced reacts rapidly to give the quinone and this undergoes an internal Michael addition to form the colorless leucodopaminochrome. Only in the presence of more oxidant [iron(III) or oxygen] does the reaction go further to the dopaminochrome and, finally, melanin. It may also be of interest that (excluding the formation of melanin) all of these reactions in the absence of oxygen are reversible, i.e., addition of excess iron(II) will reverse the reaction. This is really quite a general picture and in fact many of the catecholamines have similar rates of reaction and stability constants for the mono complex. Some values are listed in Table 3. Nevertheless there are some important exceptions (namely, noradrenaline and 6-hydroxydopamine) and these will be dealt with now. B.
Noradrenaline
It has been shown in our laboratory that noradrenaline reacts by parallel pathways (37); one ‘‘inner sphere’’ involving complex formation as described above and
258
Jameson and Linert
Figure 9 General reaction scheme for the catecholamines with iron(III). Dashed line shows the route of direct electron transfer observable with noradrenaline and 6-hydroxydopamine.
one involving ‘‘direct electron transfer’’ (this latter route is indicated by the dashed arrow in Fig. 9). In other words, this pathway involves FeOH2⫹ and noradrenaline interacting to give iron(II) and the semiquinone directly. C.
6-Hydroxydopamine
No complex is observable during the reaction of 6-hydroxydopamine with iron(III). More recent kinetic studies suggest very strongly that almost no complex is in fact formed (43). A rate equation has been deduced based on the fully protonated ligand to interact directly with the FeOH2⫹ at a rate significantly lower than that expected for complex formation, thus ruling this out. (Note that the rate of the reaction leading to direct electron exchange is also slower than that leading to complex formation in the case of noradrenaline, above.) We therefore have a series of chemicals with progressively different reactivity. On the one hand, we have dopa, dopamine, and adrenaline, which react
Stabilities and Rates of Reactions of Some Catecholamines k electron transfer
Catecholamine Dopamine Dopa Adrenaline Noradrenaline 6-Hydroxydopamine
Forms a complex?
E1 (V)
E2 (V)
K 1M
Yes Yes Yes Yes Noe
⫺0.223 a ⫺0.223 a ? ⫺0.197 a ?
0.250 b 0.798 c 0.812 c ? ⫺0.022b ⫺0.210 d
21.14 21.43 21.38 21.20 NA
k1 (dm3 mol⫺1 s⫺1) 2090 2100 3130 2170
⫾ 50 ⫾ 30 ⫾ 95 ⫾ 20 NA
k ⫺1 (dm3 mol⫺1 s⫺1) 23 22 17.3 21
⫾2 ⫾2 ⫾ 1.5 ⫾2 NA
Internal (s⫺1) 0.23 0.30 0.0511 2.6
⫾ 0.02 ⫾ 0.05 ⫾ 0.2 ⫾ 0.1 NA
‘‘Outer sphere’’ (dm 3 mol⫺1 s⫺1) NA NA NA 100 ⫾ 2 470 ⫾ 10
6-Hydroxydopamine, Dopamine, and Ferritin
Table 3
E1 ⫽ one-electron redox potential, E2 ⫽ two-electron redox potential (all measured vs. the standard calomel electrode); NA ⫽ not applicable; a ⫽ (40): one-electron redox potentials, derived from thermodynamic information obtained by following the formation or depletion of radicals produced by the pulse radiolysis technique, pH ⫽ 13.5, water containing 0.9 M ethylene glycol; b ⫽ (31): anodic peak potentials (measured under quasireversible conditions?), cyclic voltammetry (100 mV s⫺1), pH ⫽ 7.2; c ⫽ (41): formal redox potential calculated by partial oxidation with Tl(III) using catechol as a standard, pH ⫽ 0; d ⫽ (42): formal redox potential?, cyclic voltammetry (2 V min⫺1 ⫺ 1000 V min⫺1), pH ⫽ 7.4; all other values (34–37); e ⫽ at high pH less than 5% reacts via a complex.
259
260
Jameson and Linert
purely via complex formation through noradrenaline to 6-hydroxydopamine which, on the other hand, reacts almost entirely by direct electron transfer. We can maybe relate this variation to redox potential, and some representative values are given in Table 3. The problem is that most of the redox potentials are measured under different conditions and refer to different potentials. Therefore, a direct comparison of published data could be suspect. Furthermore, it is almost certain that the one-electron redox potentials are the most important since in most cases it is the formation of the semiquinone that is rate limiting. One thing is certain, however: 6-hydroxydopamine is different and this difference in reaction mechanism may mean that 6-hydroxydopamine holds the key to explaining its biologically dangerous properties! D.
Reactions Under Oxygen
Reactions in the presence of O2 are a lot more complicated to understand, especially at higher pH when the bis complex is formed. Nevertheless, some important observations can be summarized as follows: The reaction of dopa with dioxygen in the presence of metal ions is particularly revealing: when vanadyl(IV), VO2⫹, is employed in acid solution (pH ⬍4.5) the metal ion–catalyzed oxidation of dopa proceeds smoothly to completion (44), i.e., the reaction is catalytic. At higher pH values, however, the uptake of oxygen ceases before all of the oxygen is consumed and the melanin that precipitates is colored dark blue; the reaction continues, but again not to completion, on the addition of more vanadyl. What is even more significant is the observation that resaturation with dioxygen leads to a stable solution. This can be explained by postulating that all of the active metal ions are removed completely by encapsulation in the precipitated melanin. This adds considerable weight to the often held belief that in the strict absence of transition metal ions the catecholamines are stable in the presence of dioxygen. When iron(III) is added, the reaction does not go to completion even at low pH. Furthermore, if equimolar amounts of O2 and iron(III) are used, then all of the oxygen is removed by a second-order reaction (45). This shows clearly that the iron(III) is a reagent in this reaction and not a catalyst. It also throws a new light on the presence of iron-containing melanin in neural cells—it probably serves the very important role of removing free iron from the system. In the case of dopamine, added iron(III) initially starts an oxidation process which again soon comes to an end because the metal ions are efficiently removed from the solution by the final product, melanin, or by a soluble precursor of it. The involvement of metal ions in this reaction is now being studied in greater detail because, contrary to what is stated above, the oxidation of dopamine appears to proceed in the absence of transition metal ions (46). But is it possible to remove all potentially active metal ions from the system?
6-Hydroxydopamine, Dopamine, and Ferritin
261
What must be stressed, however, is that for all of these reactions taking place in the presence of dioxygen stoichiometric amounts of hydrogen peroxide are produced. E. Oxidation Involving Other Transition Metal Ions Some other work using other transition metal ions has been published and some important results for vanadyl have been summarized above. This reaction with vanadyl is noteworthy because of work carried out by Naylor (47–50) some years ago. He showed that there is a very good correlation between the levels of vanadium in the blood and the manic depressant cycle. In such cases knowledge of the chemistry between vanadium and dopamine is of importance, since some involvement of vanadium in the dopamine cycle in the brain would seem to be the obvious conclusion. Another significant example is that of manganese. It is found that it alone acts as a true catalyst in the oxidation of dopamine with the active species containing Mn(III) (51). Thus it appears that manganese is not removed from solution by incorporation into melanin. This result has important consequences for the research into manganosis, which is a disorder similar to Parkinson’s disease and found to occur near manganese mines in Chile, Cuba, and the United States (52,53). There are many other transition metal ions that have not been investigated with regard to their anaerobic interaction with the catecholamines and their influence on the oxidation of the catecholamines by dioxygen, leaving a lot more work to be done. F. Formation of 6-Hydroxydopamine Experiments with high-performance liquid chromatography (HPLC) completed in our laboratory have shown that the major product when dopamine interacts with Fenton’s reagent is 6-hydroxydopamine (54). This is remarkably selective oxidation and provides an interesting pathway by which 6-hydroxydopamine could be produced in vivo. G.
Implications of ‘‘Direct Electron Transfer’’: Removal of Iron from Ferritin
There has been much research into which molecules are capable of removing iron from ferritin (see Table 4). It is found that reducing agents such as ascorbic acid remove iron slowly, and there is some relationship between speed of release and redox potential, although this rate is increased in the presence of chelators. Strong chelators can also remove iron from ferritin though extremely slowly. As a result, one would expect that the most efficient reagents would be those that can (1) reduce the bound iron and (2) complex the iron with the oxidized product.
262
Jameson and Linert
Table 4 Relative Rates of Iron Mobilization from Ferritin Mobilizers of iron from ferritin Chelators EDTA (55), 1,10-phenanthroline (56), desferrioxamine (57) Ferrozene (58) Reducing agents Ascorbic acid (59), cysteine (59), glutathione (59), dopamine (58) Paraquat (8), dihydroflavins (28,60), 6-hydroxydopamine (29–31)
Time scale Slow (days) Slow (hours) Slow (hours; need high concentrations to get reasonable mobilization) Fast (min)
From the work described above we would therefore believe that dopamine is not able to remove iron efficiently from ferritin although this has been claimed by Gerlach and co-workers (31). Because of its low redox potential and the fact that the para-semiquinone retains its ortho-chelating function we would expect 6hydroxydopamine to be able to mobilize iron very efficiently and this has, in fact, been reported widely (29–31). As we showed above, the reaction of 6-hydroxydopamine with iron(III) occurs via direct electron transfer (maybe via the 6-hydroxyl group). This seems a very plausible reason why it alone can react successfully with iron(III) encapsulated within ferritin, which is, of course, of great biological importance. This is shown schematically in Figure 10.
Figure 10 Schematic diagram showing how 6-hydroxydopamine can remove iron from ferritin.
6-Hydroxydopamine, Dopamine, and Ferritin
III. A.
263
POSSIBLE PATHOGENIC FACTORS LEADING TO PARKINSON’S DISEASE Propagation of Cytotoxins
Based on the reactions discussed above, it seems to be possible to produce a diagram that describes the reactions that can induce Parkinson’s disease. This is depicted in Figure 11. Starting from the oxidation of dopamine by oxygen via dopaminoquinone to dopaminochrome and finally to melanin we know that peroxide is produced. Fluorescence spectroscopic investigations into unfixed postmortem brain material show that peroxides are present in the brain (61). Usually, this should be no problem to living systems because there are enough enzymes, e.g., catalases and peroxidases, that get rid of this dangerous substance. [It should be mentioned at this point that during aging these enzymes are present in lower concentrations in the brain (62).] If any free iron(II) ions are present (originating from some source described below in initialization) the peroxide will react via Fenton reactions forming extremely toxic hydroxy radicals or ferryl species [Fe(IV)]. (It is very difficult to decide by experiment which species are present but our experiments suggest that ferryl species occur because they would be more selective in oxidation yielding 6-hydroxydopamine rather than 5-hydroxydopamine, in agreement with our find-
Figure 11 Propagation of cytotoxins.
264
Jameson and Linert
ings.) These oxidative species are able (see above) to produce 6-hydroxydopamine (known to induce Parkinson’s disease) which in turn is able to free iron from ferritin. Iron(III) as well as the oxidation products of 6-hydroxydopamine will be built into insoluble melanin where the iron becomes visible in increased concentrations (10,13). The iron(II) set free during this reaction will react with further peroxide starting to describe the cycle from the beginning, so that the disease continues even when products of the reaction are built into neuromelanin. Once this cycle has started it might continue, leading to the destruction of the substantia nigra. B.
Initialization Processes
Having described this cycle of chemical reactions it would seem pertinent to now consider how this process could be initiated. There are several possibilities. It might be that iron is released into the system by some other method prior to these reactions. This line of thought could be supported by the observation that men have a higher risk of getting Parkinson’s disease than women (63). It should also be noted at this point that women commonly have a lower iron concentration in their body. These two facts taken together may support an iron overload hypothesis. A second possibility is that there is an increase in peroxide in the body thus stimulating 6-hydroxydopamine production via Fenton’s reaction. Such conditions are observed after periods of oxygen deficiency when lower levels of catalase and peroxidase occur. It has been reported that Parkinson’s disease might occur as a result of long periods of high temperature (fever) and this has been associated with acidosis occurring. In this respect there is an interesting paper by F. Garcı´a-Ca´novas and co-workers (64). The authors claim that oxidation of dopamine by oxygen catalyzed by tyrosinase at pH values below 6 results in a significant amount of 6hydroxydopamine formation. Inflammation may lead to a pH of 5.5 but the problem is that tyrosinase is not present in the brain. However, an enzyme-mediated production of 6-hydroxydopamine cannot be ruled out. Alternatively, as has been mentioned above, overexposure to manganese can lead to similar symptoms. Manganese is dangerous because it is multifaceted and could take part in a Fenton-type reaction or oxidize dopamine with concomitant production of peroxide. Again it should be noted that manganese alone seems to act as a true catalyst in the oxidation of catecholamines at physiological pH. It should also be remembered that we are not dealing with (relatively) straightforward solution chemistry and therefore certain proteins may also play an important role in any initialization process.
6-Hydroxydopamine, Dopamine, and Ferritin
C.
265
Treatment with Dopa
Treatment with dopa remains to this day the single most successful drug for the pacification of the symptoms of Parkinson’s disease. There is wide discussion among physicians, however, that although a large improvement in the quality of life is observed, later there is a sudden turn for the worse and quick death. This could be explained as follows. The dopa is converted to dopamine by the monoamineoxidases as required, but then some of this dopamine oxidizes to give peroxide, which helps form 6-hydroxydopamine. In other words, with more dopa/dopamine in the system there is more chance of our postulated cycle of events occurring. It is interesting, therefore, that work by R. Andrew et al. has shown that there are increased concentrations of 6-hydroxydopamine in the urine of patients suffering from Parkinson’s disease who are being treated by l-dopa (65).
D.
Involvement of Thiols in the Biochemistry of Catecholamines
The first observable intermediate of catecholamine oxidation is normally the quinone (see general reaction scheme Fig. 9). The quinone is highly reactive and readily undergoes nucleophilic attack. This can be internal in the case of ring cyclization or external if an appropriate nucleophile exists. In this respect the thiol group is a good nucleophile, and indeed many biological molecules contain this functional group. The most obvious examples are cysteine and glutathione. Experiments show (66) that these molecules react rapidly with the quinone to form sulfur-containing compounds that are readily oxidized and react further. In the case of cysteine the first product formed with dopaminoquinone is 5-Scysteinyldopamine (see Fig. 12). This chemistry is found to exist in the body and can be related to the onset of Parkinson’s disease. 5-S-Cysteinyldopamine has been found in various dopaminergic regions of the brain including the substantia nigra (67). It has also been reported to increase in concentration in the brains of patients suffering from Parkinson’s disease (68). It is possible, though, that 5-S-cysteinyldopamine is produced by reaction of reduced glutathione with dopaminoquinone followed by enzymatic hydrolysis by γ-glutamyl transpeptidase and peptidase (69). This would make sense since glutathione is present in much higher concentrations in the brain (mM) than cysteine, and γ-glutamyl transpeptidase activity has been found to be increased in the substantia nigra of those suffering from Parkinson’s disease (70). Various arguments have been put forward as to the importance of this reaction. One hypothesis is that this reaction serves as a defense mechanism whereby the very reactive quinone is removed safely from involvement in dangerous side
266
Jameson and Linert
Figure 12 A suggested reaction pathway of cysteine and reduced glutathione with dopaminoquinone.
reactions. In this respect it is interesting that 5-S-cysteinyldopa is an efficient inhibitor of the Fenton reaction (71). An alternative hypothesis is, unfortunately, almost the exact opposite! The formation of 5-S-cysteinyldopamine diverts dopamine from melanin formation resulting in depigmentation of the substantia nigra. The 5-S-cysteinyldopamine then reacts further to form highly toxic dihydrobenzothiazines which can induce hyperactivity and tremor in laboratory mice (72). Whatever the case a knowledge of the chemistry is vital, especially since in the brain there are no enzymes capable of forming the dopaminoquinone (69). E. Inhibition If we look at the chemical reactions described in Figure 10 it should be possible to use chemical knowledge to understand why and how these processes could be inhibited. For example, there have been some reports that smoking could actu-
6-Hydroxydopamine, Dopamine, and Ferritin
267
ally lead to a decreased risk in getting Parkinson’s disease (73–75). There are of course inherent difficulties in such statistical investigations, especially when you consider that smoking itself reduces the human life span. Still, there have even been reports that nicotine gum and nicotine patches can help reduce the symptoms of Parkinson’s disease (76). It was proposed that nicotine-iron complexes could be Fenton-inactive and stop the production of 6-hydroxydopamine, in keeping with Fig. 10. Unfortunately, in vitro and in vivo investigations have shown that these complexes are highly Fenton-active (77) leading to destruction of nicotine itself. It has been found (78), however, that nicotine is able to increase dopamine production and this may explain its capability to reduce certain symptoms. The idea of producing complexes that can reduce Fenton activity should not be overlooked and is indeed an active subject of research. Maybe in this way the production of harmful oxy and hydroxy radicals (if not 6-hydroxydopamine itself) can be stopped.
IV.
CONCLUSION
We have shown that a study of the chemistry of biological compounds important in the progression of Parkinson’s disease can throw valuable light on the problem and even enables us to suggest a plausible reaction pathway by which this disease progresses. Of course, most of the work presented here is carried out in vitro and thus cannot provide a completely true picture of what can happen in a biological system. Nevertheless, not understanding the underlying chemistry has in the past led to some bizarre suggestions as to possible mechanisms being put forward, whereas a knowledge of what takes place in vitro can only lead to better experiments being carried out and the answers being better understood.
ACKNOWLEDGMENTS Thanks to the Fonds zur Fo¨rderung der wissenschaftlichen Forschung (FWF), ¨ sterreichische Nationalbank, Project 5556, for Project 11218-CHE, and to the O financial support. This project was also supported by the Austrian Federal Ministry of Science and Transport (GZ 70.023/2-Pr/4/97).
REFERENCES 1. Hirsch, E.C. (1992) Why are catecholaminergic neurons more vulnerable than other cells in Parkinson’s disease? Ann. Neurol. 32, 88–93.
268
Jameson and Linert
2. Kastner, A., Hirsch, E.C., Lejeune, O., Javoy-Agid, F., Rascol, O., and Agid, Y. (1992) Is the vulnerability of neurons in the substantia nigra of patients with Parkinson’s Disease related to their neuromelanin content? J. Neurochem. 59, 1080– 1089. 3. Fearnley, J.M., and Lees, A.J. (1991) Aging and Parkinson’s Disease: substantia nigra regional selectivity. Brain 114, 2289–2301. 4. Halliwell, B. (1992) Reactive oxygen species and the central nervous system. In: Free Radicals in the Brain: Aging, Neurological and Mental Disorders (Packer, L., Prilipko, L., and Christen, Y., eds.), Springer-Verlag, Berlin, pp. 21–40. 5. Turski, L., Bressler, K., Rettig, K.J., Loschman, P.A., and Wachtel, H. (1991) Protection of substantia nigra from MPP⫹ neurotoxicity by N-methyl-d-aspartate antagonists. Nature 349, 414–418. 6. Nappi, A.J., and Vass E. (1994) The effects of glutathione and ascorbic acid on the oxidations of 6-hydroxydopa and 6-hydroxydopamine. BBA 1201, 498–504. 7. Ben-Schachar, D., Riederer, P., and Youdim, M.B.H. (1991) Iron–melanin interaction and lipid peroxidation: implications for Parkinson’s disease. J. Neurochem. 57, 1609–1614. 8. Thomas, C.E., and Aust, S.D. (1986) Reductive release of iron from ferritin by cation and free radicals of paraquat and other bipyridals. J. Biol. Chem. 261, 13064–13070. 9. Ben-Shachar, D., Eshel, G., Finberg, J.P.M., and Youdim, M.B.H. (1991) The iron chelator desferrioxamine (desferal) retards 6-hydroxydopamine induced degeneration of nigrostriatal dopamine neurons. J. Neurochem. 56, 1441–1444. 10. Dexter, D.T., Jenner, P., Schapira, A.H.V., and Marsden, C.D. (1992). Alterations in levels of iron, ferritin, and other trace metals in neurodegenerative disease affecting the basel ganglia. Ann. Neurol. 32, 94–100. 11. Good, P.F., Pel, D.P., Bierer, L.M., and Schmeidler, J. (1992) Selective accumulation of aluminium and iron in the neurofibrillary tangles of Alzheimer’s disease: a laser microprobe (LAMMA) study. Ann. Neurol. 31, 286–292. 12. Good, P.F., Olanov, C., and Perl, D. (1992) Neuromelanin containing neurons of the substantia nigra accumulate iron and aluminum in Parkinson’s disease: a LAMMA study. Brain Res. 593, 343–346. 13. Jellinger, K. and Kienzl, E. (1993) Iron deposits in brain disorders. In: Iron in Central Nervous System Disorders (P. Riederer and M.B.H. Youdim, eds.), Springer-Verlag, New York, pp. 19–36. 14. Oestreicher, E., Sengstock, G.J., Riederer, P., Olanow, C.W., Dunn, A.J., and Arendash, G.W., (1994) Degeneration of nigrostriatal dopaminergic neurons increases iron within the substantia nigra: a histochemical and neurochemical study. Brain Res. 600, 8–18. 15. Hirsch, E.C., Graybiel, A.M., and Agid, Y. (1988) Melanised dopaminergic neurons are differently susceptible to degeneration in Parkinson’s disease. Nature 334, 345– 348. 16. Jellinger, K., (1991) Pathology of Parkinson’s disease, changes other than the nigrostriatal pathway. Mol. Chem. Neuropathol. 14, 153–197. 17. Sengstock, G.J., Olanow, C.W., Dunn, A.J., and Arendash, G.W (1992) Iron induces degeneration of nigrostriatal neurons. Brain Res. Bull. 645–649. 18. Riederer, P., Dirr, A., Goetz, M., Sofic, E., Jellinger, K., and Youdim, M.B.H. (1992)
6-Hydroxydopamine, Dopamine, and Ferritin
19. 20. 21. 22. 23. 24. 25. 26. 27. 28.
29.
30.
31.
32. 33. 34.
35. 36. 37.
269
Distribution of iron in different brain regions and subcellular compartments in Parkinson’s Disease. Ann. Neurol. 32, 101–104. Youdim, M.B.H., Ben-Schachar, D., and Riederer, P. (1993) The possible role of iron in the etiopathology of Parkinson’s disease. Mov. Disord. 8, 1–12. Wilkinson, F., (1980) Chemical Kinetics and Reaction Mechanisms. Van Nostrand Reinhold, New York, p. 278. George, P. (1954) The oxidation of ferrous perchlorate by molecular oxygen. J. Chem. Soc. 4349–4359. Flynn, C.M., Jr. (1984) Hydrolysis of inorganic iron(III) salts. Chem. Rev. 84, 31– 41. Fenton, H.J.H. (1894) Oxidation of tartaric acid in the presence of iron. J. Chem. Soc. 65, 899–910. Haber, F., and Weiss, J. (1934) The catalytic decomposition of H2O2 by iron salts. Proc. R. Soc. London (Biol.) 147, 332–351. Uri, N. (1952) Inorganic free radicals in solution, Chem. Rev. 50, 375–454. Goldstein, S., Meyerstein, D., and Czapski, G. (1993) The Fenton reagents. Free Rad. Biol. Med. 15, 435–445. Crichton, R.R. (1991) Inorganic Biochemistry of Iron Metabolism. Ellis Horwood, Chichester. Jones, T., Spencer, R., and Walsh, C. (1978) Mechanism and kinetics of iron release from ferritin by dihydroflavins and dihydroflavin analogues. Biochemistry 17(19), 4011–4017. Monteiro, H.P., and Winterbourn, C.C. (1989) 6-Hydroxydopamine releases iron from ferritin and promotes ferritin dependent lipid peroxidation. Biochem. Pharmacol. 38(23), 4177–4182. Linert, W., Herlinger, E., Jameson, R.F., Kienzl, E., Jellinger, K., and Youdim, M.B.H. (1996) Dopamine, 6-hydroxydopamine, iron, and dioxygen: their mutual interactions and possible implication in the development of Parkinson’s disease. BBA 1316, 160–169. Double, K.L., Maywald, M., Schmittel, M., Riederer, P., and Gerlach, M. (1998) In Vitro Studies of Ferritin Iron Release and Neurotoxicity. J. Neurochem. 70(6), 2492–2499. Heacock, R.A. (1959) The chemistry of adrenachrome and related compounds. Chem. Rev. 59, 181–237. Lever, A.B.P. (1984) Inorganic Electronic Spectroscopy, 2nd ed. Elsevier, Amsterdam. Linert, W., Jameson, R.F., and Herlinger, E. (1991) Complex formation followed by internal electron transfer: the reaction between l-dopa and iron(III). Inorg. Chim. Acta 187, 239–247. Linert, W., Herlinger, E., and Jameson, R.F. (1993) A kinetic study of the anaerobic reactions between adrenaline and iron(III). J. Chem. Soc. Perkin Trans. 2, 2435–2439. El-Ayaan, U., Herlinger, E., Jameson, R.F., and Linert, W. (1997) Anaerobic oxidation of dopamine by iron(III). J. Chem. Soc. Dalton Trans. 2813–2818. El-Ayaan, U., Jameson, R.F., and Linert, W. (1998) A kinetic study of the reaction between noradrenaline and iron(III): an example of parallel inner- and outer-sphere electron transfer. J. Chem. Soc. Dalton Trans. 1315–1319.
270
Jameson and Linert
38. Heistand, R.H., Roe, A.L., and Que Jr., L. (1982) Dioxygenase models. Crystal structures of [N,N′-(1,2-phenylene)bis(salicylideniminato)](catecholato-O)iron(III) and µ-(1,4-Benzenediolato-O,O′)-bis[N,N′-ethylenebis(salicylideiminato)iron(III)]. Inorg. Chem. 21, 676–681. 39. Que Jr., L. (1983) Metalloproteins with phenolate coordination. Coord. Chem. Rev. 50, 73–108. 40. Steenken, S., and Neta, P. (1982) One-electron redox potentials of phenols. Hydroxy- and aminophenols and related compounds of biological interest. J. Phys. Chem. 86, 3661–3667. 41. Mentasti, E., Pelizzetti, E., and Giraudi, G. (1976) The oxidation of aromatic orthodiols by periodic acid: kinetics and mechanism. Zeit. Phys. Chem. 100, 17–23. 42. Blank, C.L., McCreery, R.L., Wightman, R.M., Chey, W., Adams, R.N., Reid, J.R., and Smissman, E.E. (1976) Intracyclization rates of 6-hydroxydopamine and 6aminodopamine analogs under physiological conditions. J. Med. Chem. 19,1, 178– 180. 43. Jameson, G.N.L. (2000) In press. 44. Thompson, S.W. (1976) PhD thesis, University of Dundee, Scotland. 45. Herlinger, E. (1994) Unpublished work. 46. Herlinger, E., Jameson, R.F., and Linert, W. (1995) Spontaneous autoxidation of dopamine. J. Chem. Soc. Perkin Trans. 259–263. 47. Naylor, G.J. (1985) Vanadium and affective disorders. Neural Neurobiol. 15, 91– 105. 48. Naylor, G.J. (1984) Vanadium and Manic depressive psychosis. Nutr. Health 3, 78– 85. 49. Naylor, G.J., Smith, A.H.W., Bryce-Smith, D., and Wood, N.I. (1984) Elevated vanadium content of hair and mania. Biol. Psychiatry 19, 759–761. 50. Naylor, G.J., Corrigan, F.M., Smith, A.H.W., Connelly, P., and Ward, N.I. (1987) Further studies of vanadium in depressive psychosis. Br. J. Psychiatry 150, 656–661. 51. Herlinger, E., Jameson, R.F. (1995) Manganese(II) catalysis of the autoxidation of dopamine resulting from dioxygen adduct formation. J. Inorg. Biochem. 59, 622. 52. Barbeau, A. (1984) Manganese and extrapyramidal disorders. Neurotoxicology 5, 13–36. 53. Cotzias, G.C. (1958) Manganese in health and disease. Physiol. Rev. 38, 503–532. 54. Huber, M. (1997) Diplomarbeit, Technical University of Vienna. 55. Pape, L., Multani, J.S., Stitt, C., and Saltman, P. (1968) The mobilization of iron from ferritin by chelating agents. Biochemistry 7, 613–616. 56. Jones, M., and Johnstone, D.O. (1967) Rate of release of iron from ferritin to 1,10phenanthroline. Nature 216, 509–510. 57. Kontoghiorghes, G.J., Chambers, S., and Hoffbrand, A.V. (1987) Comparative study of iron mobilization from hemosiderin, ferritin and iron(III) precipitates by chelators. Biochem. J. 241, 87–92. 58. Jameson, G.N.L. (1997) Unpublished work. 59. Dognin, J., and Crichton, R.R. (1975) Mobilization of iron from ferritin fractions of defined iron content by biological reductants. FEBS Lett. 54, 2, 234–236. 60. Sirivech, S., Frieden, E., and Osaki, S. (1974) The release of iron from horse spleen ferritin by reduced flavins. Biochem. J. 143, 311–315.
6-Hydroxydopamine, Dopamine, and Ferritin
271
61. Kienzl, E., Puchinger, L., Jellinger, K., Linert, W., Stachelberger, H., and Jameson, R.F. (1995) The role of transition metals in the pathogenesis of Parkinson’s Disease. J. Neurol. Sci. 134 (Suppl), 69–78. 62. Bjerrum, M.J., Private communications. 63. McGeer, E.G. (1991) Parkinson’s disease. In: Encyclopedia of Human Biology, Vol. 5. Academic Press, San Diego, pp. 667–673. 64. Garcı´a-Moreno, M., Rodrı´guez-Lo´pez, J.N., Martı´nez-Ortiz, F., Tudela, J., Varo´n, R., and Garcı´a-Ca´novas, F. (1991) Effect of pH on the oxidation pathway of dopamine catalysed by tyrosinase. Arch. Biochem. Biophys. 288(2), 427–434. 65. Andrew, R., Watson, D.G., Best, S.A., Midgley, J.M., Wenlong, H., and Petty, R.K.H. (1993) The determination of hydroxydopamines and other trace amines in the urine of Parkinsonian patients and normal controls. Neurochem. Res., 18, 1175– 1177. 66. Jameson, G.N.L. (2000) In press. 67. Fornstedt, B., Bergh, I., Rosengren, E., and Carlsson, A. (1990) An improved HPLCelectrochemical method for measuring brain levels of 5-S-cysteinyldopamine, 5-Scysteinyl-3,4-dihydroxyphenylalanine, and 5-S-cysteinyl-3,4-dihydroxyphenylacetic acid. J. Neurochem. 54, 578–586. 68. Fornstedt, B., Brun, A., Rosengren, E., and Carlsson, A. (1989) The apparent autoxidation rate of catechols in dopamine-rich regions of human brains increases with the degree of depigmentation of the substantia nigra. J. Neural Transm. 1(P-D section), 279–295. 69. Palumbo, A., d’Ischia, M., Misuraca, G., De Martino, L., and Prota, G. (1995) Iron and peroxide dependent conjugation of dopamine with cysteine: oxidative routes to the novel brain metabolite 5-S-cysteinyldopamine. BBA 1245, 255–261. 70. Jenner, P., Dexter, D.T., Sian, J., Schapira, A.H.V., and Marsden, C.D. (1992) Oxidative stress as a cause of nigral cell death in Parkinson’s disease and incidental Lewy body disease. Ann. Neurol., 32(Suppl.), S82–S87. 71. Napolitano, A., Memoli, S., Nappi, A.J., d’Ischia, M., and Prota, G. (1996) 5-SCysteinyldopa, a diffusible product of melanocyte activity, is an efficient inhibitor of hydroxylation/oxidation reactions induced by the Fenton system. BBA 1291, 75– 82. 72. Zhang, F. and Dryhurst G. (1994) Effects of l-cysteine on the oxidation chemistry of dopamine: new reaction pathways of potential relevance to idiopathic Parkinson’s diseases. J. Med. Chem. 37, 1084–1098. 73. Morens, D.M., Grandinetti, A., Reed, D., and White, L.R. (1994) Smoking-associated protection from Alzheimer’s disease and Parkinson’s disease. Lancet 343, 356– 357. 74. Morens, D.M., Grandinetti, A., Reed, D., White, L.R., and Ross, G.W. (1995) Cigarette smoking and protection from Parkinson’s disease. Neurology 45, 1041–1051. 75. Grandinetti, A., Morens, D.M., Reed, D., and MacEachern, D. (1994) Prospective study of cigarette smoking and the risk of developing idiopathic Parkinson’s disease. Am. J. Epidemiol. 139, 1129–1138. 76. Ishikawa, A. and Miyatke, T. (1993) Effects of smoking in patients with early-onset Parkinson’s disease. J. Neurol. Sci. 117, 28. 77. Linert, W., Bridge, M.H., Huber, M., Bjugstad, K.B., Grossman, S., and Arendash,
272
Jameson and Linert
G.W. (1999) In vitro and in vivo studies investigating possible antioxidant actions of nicotine: relevance to Parkinson’s and Alzheimer’s diseases. BBA 1454, 143– 152. 78. Fowler, J.S., Volkow, N.D., Wang, G.J., Pappas, N., Logan, J., MacGregor, R., Alexoff, D., Shea, C., Schleyer, D., Wolf, A.P., Warner, D., Zezulkova, I., and Cilento, R. (1996) Inhibition of monoamine oxidase B in the brain of smokers. Nature 379, 733–736.
13 ROS and Parkinson’s Disease: A View to a Kill Serge Przedborski and Vernice R. Jackson-Lewis Columbia University School of Medicine, New York, New York
I. INTRODUCTION Under normal and pathological conditions, cellular metabolism generates substantial amounts of free radicals, i.e., atoms and molecules with one or more unpaired electrons (1). By virtue of this electron imbalance, free radicals are unstable and prone to snatch electrons from neighboring atoms and molecules, whereby they inflict oxidative damage. The classical view is that free radical– induced oxidative damage of biological compounds such as DNA, proteins, and lipids may cause serious cellular derangement and ultimately even cell death. Of note, not all atoms or molecules that can cause oxidative damage are free radicals because they do not have unpaired electrons (e.g., singlet oxygen, hydrogen peroxide). Therefore, those species that either have or do not have unpaired electrons and are all mainly oxygen-centered we refer to as reactive oxygen species (ROS). For the past decade, the oxidative stress hypothesis has gained in popularity to explain cell death in neurological diseases as diverse as stroke, dementia, amyotrophic lateral sclerosis, and Parkinson’s disease (PD). The latter disorder is viewed by some as the model ‘‘par excellence’’ of oxidative stress in chronic neurological conditions for several reasons that will be reviewed and discussed below. However, while compelling evidence exists to implicate ROS in the pathogenesis of acute neurological conditions, such as strokes, the jury is still out as to whether the role of ROS in chronic neurodegenerative disorders such as PD is myth or reality. In addition, even if one believes the latter, one is left with the dilemma as to whether the oxidative damage observed in PD brains (detailed 273
274
Przedborski and Jackson-Lewis
below) is the cause or the consequence of the neurodegenerative process, or is the result of the chronic use of anti-PD treatments such as levodopa. These various issues will be discussed in light of earlier landmark studies, as well as of more recent findings obtained in humans, in animals, and in cell culture.
II. PARKINSON’S DISEASE Parkinson’s disease affects about 1% of the population over 50 years of age in the United States alone; about 50,000 new cases are diagnosed each year (2). This common neurodegenerative disorder, which is mainly sporadic, is a slow, progressive disease characterized mainly by resting tremor, slowness of movement (bradykinesia), stiffness (rigidity), and poor balance (postural instability) (2). Most if not all of these symptoms are attributed to the severe loss of dopamine (DA)–containing neurons in the substantia nigra pars compacta (SNpc) and the concomitant loss of DA nerve terminals in the caudate putamen, which is the main projection area for the SNpc neurons (3). To a lesser extent, neuronal loss is found in the locus coeruleus and in the dorsal motor nucleus of vagus (3). Another morphological hallmark of PD is the eosinophilic intraneuronal inclusion called the Lewy body (4), which is regarded as either a tombstone for the cell or a key player in the neurodegenerative process. PD patients can avoid medication for a while, but at some point the motor disability becomes so severe that treatment aimed at either replenishing DA stores in the brain (e.g., levodopa) or stimulating DA receptors (e.g., DA agonists), or both, is required to alleviate symptoms. Unfortunately, the chronic administration of levodopa often causes motor and psychiatric side effects that may be as debilitating as the disease itself (5). Furthermore, there is no supportive evidence that levodopa therapy impedes the progressive death of SNpc DA neurons; on the contrary, there are speculations that levodopa may contribute to the progressive nature of the disease. Although the actual cause and mechanism of neurodegeneration in PD remains uncertain, it has been hypothesized that the finely tuned balance between the production and the destruction of ROS is upset by either increased ROS formation, decreased ROS detoxification, or both, leading to SNpc DA neuronal death. Over the years, a huge number of factors have been proposed for mediating the speculated ROS attack on SNpc DA neurons. It is our opinion, however, that only a handful of these are credible and warrant in-depth discussion (Table 1).
III.
IS DOPAMINE THE CULPRIT?
For a long time, DA was thought of as a ‘‘Jekyll and Hyde’’ agent. On the one hand, DA is the necessary chemical of catecholamine neurotransmission; hence
ROS and Parkinson’s Disease
275
Table 1 Presumed Contributing Factors in Oxidative Stress in PD Factors that can stimulate ROS formation Dopamine metabolism Autooxidation (nonenzymatic) Oxidative deamination (enzymatic; MAO) Neuromelanin Increased iron content Impaired mitochondrial electron transport chain activity Factors that can reduce ROS detoxification Decrease in activity of ROS scavenging enzymes Low glutathione peroxidase Low catalase Decrease in ROS-scavenging small molecules Low reduced glutathione Low ubiquinone
it plays a critical role in proper motor control and other essential neurological functions. On the other hand, as it can engage in ROS-producing biological reactions, DA can be cytotoxic (6). Thus, it may well be that DA neurons are the initiators of their own demise.
A.
How Does Dopamine Stimulate ROS Formation?
To date, two mechanisms have been postulated to underlie DA stimulation of ROS (Fig. 1). First of all, because of its catechol moiety, DA is prone to autooxidation in aqueous medium and at physiological pH. DA and other catecholamines undergo a nonenzymatic degradation to ROS as well as to semiquinone and quinone intermediates (Fig. 2) (7). Although the autooxidation of DA occurs readily in vitro (and likely in vivo), its actual cytotoxic role in PD remains unclear. Most arguments supporting the deleterious effects of DA autooxidation derive not from experiments using DA itself but from experiments using its precursor levodopa and the neurotoxin 6-hydroxydopamine—a compound suggested as an endogenous toxin although to date it has never been recovered from PD brains. Second, DA is oxidatively deaminated in the SNpc and in the striatum by the enzyme monoamine oxidase (MAO) which is located in the outer mitochondrial membrane (Fig. 2) (8). This reaction results in a two-electron reduction of oxygen and the production not only of hydrogen peroxide but of superoxide and hydroxyl radicals (7). Of note, while there is some controversy as to whether hydrogen
276
Przedborski and Jackson-Lewis
Figure 1 Dopamine metabolism and ROS production. (A) The nonenzymatic and the enzymatic metabolic routes by which dopamine produces ROS. (B) ROS formation is increased in PD due to the augmented dopamine turnover in spared dopamine neurons in the absence or presence of levodopa.
Figure 2 Ferrous ion (Fe2⫹) can combine with oxygen to produce superoxide radical ⫹ (O •⫺ 2 ) which, in the presence of hydrogen (H ), can produce hydrogen peroxide (H 2 O 2 ). Both can react in the presence of Fe 2⫹ /ferric (Fe3⫹) redox couple to produce the hydroxyl radical (•OH); this reaction is called the iron-catalyzed Haber-Weiss reaction. Hydroxyl radical can also be produced by the reaction of H 2 O 2 with Fe 2⫹; this reaction is called the Fenton reaction. Note the cyclic nature of the iron involvement in ROS production.
ROS and Parkinson’s Disease
277
peroxide and superoxide radicals can exert direct cytotoxic effects, there is no doubt that the hydroxyl radical is a tissue-damaging reactive species (1).
B.
Dopamine and Neurodegeneration
In light of the above, it has been proposed that both the nonenzymatic and enzymatic metabolism of DA produce an ROS burden on the cell which, if not properly detoxified, may become a key factor in the degeneration of DA neurons in PD (6). Relevant to this view is the demonstration that the remaining DA neurons in PD brains are hyperactive and exhibit increased DA turnover (3,9), which presumably increases ROS formation (Fig. 1B). When levodopa is given, these remaining DA neurons are flooded with DA, which increases ROS formation even further (Fig. 1B). This has led to the contention that levodopa therapy and the consequent formation of ‘‘excess’’ DA may promote the progression of PD by increasing the cellular load of ROS. In cell culture, it has been clearly demonstrated that levodopa produces a ROS-related, dose-dependent cytotoxicity (10– 12). Also, chronic administration of levodopa enhances DA neuron degeneration in animals with partial lesions of the nigrostriatal DA system (13), but not in animals with intact brain DA systems (14). This observation suggests that levodopa contributes to the further degeneration of an already damaged DA pathway, likely via a ROS-related mechanism. Furthermore, exposure of brain mitochondria to DA causes a significant ROS-mediated inhibition of complex I activity of the electron transport chain (15) associated with a sharp increase in the mitochondrial consumption of the antioxidant glutathione (16,17). These findings are consistent with the view that the metabolism of DA by MAO, a mitochondrial enzyme, can alter mitochondrial function, which in turn may enhance ROSmediated injury to the cell.
IV.
NEUROMELANIN
Neuromelanin is a black pigment found in certain monoaminergic neuron subpopulations of some animal species, including primates (18). This insoluble pigment results from the autooxidation, condensation, and polymerization of DA and its oxidation products (8). Although some neuromelanin accumulates in DA cell bodies during the normal aging process, those SNpc DA neurons that contain the greatest amounts of neuromelanin die preferentially in PD compared to those with less neuromelanin (19). Further, mammalian species that have neuromelanin, such as monkeys, are more sensitive to the deleterious effects of the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) than those who do not have neuromelanin, such as mice. All together, these observations suggest
278
Przedborski and Jackson-Lewis
that neuromelanin may not be just a benign pigment but rather another component of the SNpc neuron which, like DA, can turn against its own cell. How is it that neuromelanin can contribute to the death of SNpc neurons? There are at least three possible mechanisms. First, neuromelanin exhibits an impressive capacity to bind anything that is not standing still, including the active metabolite of MPTP, 4-phenylpyridinium ion (MPP ⫹ ) (20), and iron (21), making neuromelanin a potential toxic reservoir within the neuron. For instance, by binding iron, neuromelanin ‘‘neutralizes’’ iron, preventing its participation in ROS production. However, if neuromelanin releases iron in response to cellular events (e.g., oxidative attack on neuromelanin or increased reduced glutathione levels; L. Zecca, personal communication), neuromelanin can become an accomplice in iron-catalyzed ROS production (Fig. 2) (22). Second, neuromelanin also contains redox partners involving quinone, hydroquinone, and semiquinone intermediates (22). These redox partners, under biological conditions, can be responsible for catalyzing the formation of ROS such as superoxide radicals and hydrogen peroxide (22). Third, several breakdown products of neuromelanin are easily oxidized and can exert cytotoxic effects (23). In light of these facts, it is highly plausible that neuromelanin may indeed behave as a ferocious prooxidant in pathological situations such as in PD.
V.
METALS AND OXIDATIVE STRESS
Formation of highly reactive tissue-damaging ROS is catalyzed by transition metals such as iron (Fig. 2). In the absence of these metals, it is likely that cells will produce only poorly reactive oxygen species with little potential to cause oxidative damage. Because distribution of transition metals in organs like the brain exhibit striking regional differences, it follows that those brain regions with the highest iron content ought to be at the greatest risk for aggressive oxidative attack. It is thus tempting to implicate iron in SNpc DA neuron degeneration not only because this region of the brain contains a high amount of iron in the normal situation but also because iron content is even higher in PD brains (24–27). In support of this supposition is a recent study showing that increased iron in PD occurs solely in the melanized neurons of the SNpc (28). This result suggests that iron metabolism is specifically altered in SNpc DA neurons in PD, leading to an abnormal accumulation of iron in these neurons. This is plausible because lactoferrin receptors, which facilitate iron entry into cells, are increased most significantly in the remaining melanized neurons in the most damaged area of the SNpc in PD brains (29). However, despite the fact that intracellular iron content is increased in PD brains, one should remember that iron is bound to ferritin as well as to neuromelanin, thus forming a nonreactive complex. The status of ferritin in PD is controversial in that ferritin levels have been reported to
ROS and Parkinson’s Disease
279
be increased (30) and decreased (27) in PD brains. Therefore, whether increased intracellular iron corresponds, at least in part, to an increase in free iron, which in turn can catalyze oxidative reactions, remains uncertain.
VI.
ALTERATIONS IN THE MITOCHONDRIAL ELECTRON TRANSPORT CHAIN
Mitochondria control oxidation–reduction reactions in the cell, generate energy in the form of ATP, and are the main cellular source of ROS through the respiratory chain/oxidative phosphorylation system (1,31). It is believed that mitochondrial function is impaired in postmortem PD midbrains due to a deficit in complex I activity (32,33). Consequently, neurons with lower mitochondrial electron transport chain activity may be subjected to both oxidative stress and energy failure (31). Because this deficit occurs in end-stage PD, a legitimate question is whether the decrease in complex I activity is the cause or the consequence of the neurodegenerative process. To date, there is no definite answer to this important issue. However, studies in animals treated with MPTP suggest that decreases in complex I activity belong on the list of causes rather than consequences, as inhibition of complex I by MPP ⫹ (which increases ROS formation and decreases ATP production) precedes cell death (34). Since most PD patients receive some chronic anti-PD treatment, it is worth mentioning that high amounts of levodopa and DA can affect brain mitochondrial complex I activity by a ROS-mediated mechanism (15,17,35). These observations suggest that SNpc DA neurons may be subjected to a higher magnitude of chronic oxidative stress originating from the defective mitochondria and, again, could be exacerbated by chronic levodopa therapy (Fig. 1).
VII. ANTIOXIDANT DEFENSE SYSTEMS IN THE BRAIN In the above sections, we have reviewed several cellular factors about SNpc DA neurons that can underlie the production of ROS and which, by virtue of pathological changes, can participate directly or indirectly in subjecting SNpc DA neurons to oxidative stress. Defense mechanisms exist that limit the levels and the role of ROS in inflicting damage on cellular components (1), as illustrated in Fig. 3. Therefore, while it is unquestionable that a number of factors may contribute to increasing ROS production in SNpc DA neurons, their role must be placed in the context of the natural antioxidant protective arsenal. This suggests that oxidative damage can only be incriminated in PD pathogenesis if the rate of ROS production exceeds that of ROS scavenging. Thus, regardless of the magnitude of ROS production in PD, one may wonder whether there is any evidence supporting the
280
Przedborski and Jackson-Lewis
Figure 3
Illustration of ROS-scavenging enzymes.
concomitant weakening of ROS protective mechanisms. The main ROS scavengers are superoxide dismutase (SOD), catalase, and glutathione peroxidase (Fig. 3), as well as several small molecules with strong antioxidant properties, such as glutathione, vitamin C, vitamin E, and ubiquinone.
A.
ROS-Scavenging Enzymes
Among the ROS-scavenging enzymes in PD, SOD has received the lion’s share of investigation. One finding that makes SOD, and more particularly the cytosolic form of this enzyme, i.e., copper/zinc-SOD (SOD1), appealing in relation to PD is the fact that extremely high amounts of SOD1 are present in SNpc DA neurons (36,37). However, analyses of SOD levels in PD brains show no changes in SOD1 activity in either striatum or SNpc, whereas that of mitochondrial manganeseSOD (SOD2) is significantly increased in both regions (38,39). As opposed to SOD1, which is expressed constitutively, SOD2 is highly inducible in response to an excess of ROS (1). Thus, because it is likely that increased SOD2 activity is protective rather than deleterious, the observed increases in SOD2 in PD strongly suggest that the mitochondrial compartment in PD is subjected to an oxidative stress which, in turn, stimulates the expression of SOD2. Consistent with the neuroprotective effects of increased SOD activity are the observations that a three- to fourfold increase in SOD1 activity promotes DA neuronal survival and nerve fiber sprouting in vitro (37) and stimulates embryonic midbrain graft development in transplanted PD rat models (40). In addition, transgenic mice that overexpress SOD1 are more resistant to MPTP, which stimulates the production of ROS (41). Collectively, these findings support the idea that increased SOD
ROS and Parkinson’s Disease
281
activity in PD is more likely to be the reflection of a neuroprotective response than part of a destructive phenomenon. In contrast to SOD, both catalase and glutathione peroxidase activities are reduced in PD brains (42,43). It is surprising, however, that glutathione peroxidase in PD brains is found essentially in SNpc glial cells and not in SNpc neurons (44). This suggests that a deficit in the ROS scavenging system in glial cells, by impairing glial/neuronal cooperation, may trigger neuronal injury, a possibility that would challenge our common ‘‘neuronal centrist’’ view of neurodegeneration. It is also important to note that the reported changes in catalase and glutathione peroxidase activities in PD brains are of small magnitude, implying that they would be insufficient in causing damage in the absence of a concomitant overproduction of ROS. B.
ROS-Scavenging Small Molecules
It is commonly recommended that PD patients take dietary supplements such as vitamins E and C for neuroprotective purposes. Although this recommendation is harmless, its usefulness in PD is quite equivocal, as high intakes of both vitamins do not appear either to lower the risk of developing PD or to slow down its progression (45–48). Furthermore, there is also no indication that levels of vitamin E are abnormal in PD brains (49). In contrast, both ubiquinone (50) and glutathione (51) levels appear abnormally low in PD, which may be of pathological significance, since both compounds play an important antioxidant role in the brain and are present in high amounts within mitochondria. Of interest are the observations that ubiquinone supplements are well tolerated and seem to increase complex I activity in PD patients (52), as well as to attenuate MPTP toxicity in mice (53). No information seems to be available regarding the use and potential benefit of glutathione or its precursor, N-acetylcysteine, in PD.
VIII. ROS-INDUCED NEURONAL DAMAGE IN THE SUBSTANTIA NIGRA PARS COMPACTA There is little doubt that neurons (or any other cell types for that matter) would die if subjected to the postulated harsh oxidative insults likely to be encountered in certain acute neurological disorders such as ischemia and stroke. In PD, however, there is no evidence that SNpc DA neurons face such a severe insult. On the other hand, because PD is a chronic disorder, a much milder oxidative stress may cause a buildup of ROS-mediated damage over several years, leading to progressive cellular dysfunction which ultimately commits the neuron to die. Furthermore, it is not even clear if SNpc DA neurons can actually die following oxidative stress. This problem can be addressed in experimental models
282
Przedborski and Jackson-Lewis
of PD, in which the moment of the injury is known and the neurodegenerative process can be followed from beginning to end (54,55). The two most popular and extensively validated models of PD are those produced by the neurotoxins 6-hydroxydopamine and MPTP. Both compounds stimulate ROS production, albeit by quite different and distinct mechanisms. 6-Hydroxydopamine is believed to kill cells (more specifically, catecholaminergic neurons) by the production of hydrogen peroxide, superoxide, and hydroxyl radicals following its autooxidation (56,57). The specificity of action depends on its uptake and accumulation into catecholaminergic neurons and terminals (58–60). Since 6-hydroxydopamine does not cross the blood–brain barrier, its systemic administration only affects the catecholaminergic structures of the peripheral nervous system. On the other hand, when 6-hydroxydopamine is injected locally into the striatum, the median forebrain bundle, or the SNpc, it selectively destroys the nigrostriatal DA pathway (58–60). Because of this, 6hydroxydopamine is often used to produce a rat model of PD. Strengthening the role of ROS in the 6-hydroxydopamine-induced neurotoxicity is the fact that various antioxidants attenuate its deleterious effects (61,62). As opposed to 6-hydroxydopamine, MPTP does cross the blood–brain barrier, and systemic administration damages DA neurons and reproduces most of the clinical and pathological hallmarks of PD (63). Its metabolism is a complex multistep process that can stimulate ROS production by both mitochondrial (64– 66) and cytosolic (67,68) mechanisms. In addition, MPTP’s mode of action involves not only ROS such as superoxide anion and hydroxyl radicals (64,69,70), but also nitric oxide (71). Here again, strategies that either increase the protection against ROS or hamper the production of ROS attenuate MPTP-induced toxicity (41,70,71). Thus, both models provide compelling evidence that oxidative stress unequivocally kills SNpc DA neurons. The specificity of the lesions caused by both 6-hydroxydopamine and MPTP, however, result from the specific uptake of these neurotoxins into the DA neurons and do not speak to the specific susceptibility of DA neurons to oxidative stress over any other subpopulation of neurons. Other informative models have been used over the years to test whether the different factors presented in Table 1 can actually ignite ROS attack on SNpc DA neurons. For instance, it was shown that stereotaxic injection of synthetic neuromelanin into rodent brains did not cause cell death by itself but potentiated MPTP-induced neurotoxicity (72). One caveat with this study is that the injected synthetic neuromelanin most likely remained in the extracellular space and did not enter the neurons. Thus, based on this work, we cannot exclude neuromelanin as a neurotoxic compound. More importantly, the stereotaxic injection of MPP ⫹ and rotenone, two mitochondrial poisons, produced severe nigrostriatal damage (73), illustrating the importance of mitochondrial impairment in the death of SNpc DA neurons. As critical as ROS-scavenging enzymes appear to be in the detoxification of ROS, it appears that ablation of extracellular and cytosolic SOD or glutathione peroxidase in knockout mice had negligible effects on the develop-
ROS and Parkinson’s Disease
283
ment and survival of SNpc DA neurons (74–76). On the other hand, increased activity of ROS scavenging enzymes, and particularly of cytosolic SOD, promoted the development and survival of SNpc DA neurons and rendered SNpc DA neurons more resistant to oxidative stress (37,41).
IX. TARGETS OF ROS There is no doubt that by combining the various potentially deleterious factors described above one can produce an explosive scenario that could convince even the most die-hard skeptics that SNpc DA neurons are, or can be, the sites of oxidative attack. However, one has to keep in mind that all of these findings, appealing as they may be, are strictly circumstantial. Indeed, SNpc DA neurons do die, and clear abnormalities in both the production of ROS and in the detoxification of ROS are observed in SNpc, but whether the former is due to the latter has yet to be unequivocally demonstrated. While the experimental models strongly support this contention, none of the postmortem studies have been able to settle the issue. ROS can attack virtually all cellular components, including nucleic acids, proteins, and lipids (1). Some of the ROS-mediated alterations in cellular components are stable modifications and can readily be quantified. Therefore, the demonstration that cellular elements critical to cellular function, survival, or both are damaged by ROS may provide invaluable support for the role of oxidative stress in the pathogenesis of PD. It should also be pointed out that while ROS can theoretically affect all cellular elements, in reality, it is frequently specific elements that are preferentially damaged. Consequently, it is the general consensus that an accurate demonstration of the existence and the severity of ROS-mediated damage can only be achieved by examining more than a single marker of ROSmediated damage, and probably by using more than one technique. The brain is extremely rich in phospholipids and polyunsaturated free fatty acids (PUFAs), both of which are highly susceptible to ROS attack. Following ROSmediated damage of phospholipids and PUFAs, plasma membrane and intracellular organelles, whose structure and function rely on a normal protein/lipid bilayer organization, can be dangerously jeopardized. In PD, the concentration of PUFAs in the nigra is decreased, while that of malondialdehyde, a marker of lipid oxidation, is increased (77). Additional evidence of lipid oxidation in PD is provided by the demonstration that 4-hydroxy-2-nonenal, a lipophilic product of the peroxidation of membrane-bound arachidonic acid that accumulates in membranes, is increased about fourfold in the spinal fluid of PD patients (78). Levels of markers of oxidative damage to proteins, such as carbonyl modifications of soluble proteins, are also significantly increased in postmortem samples of substantia nigra in PD brains as compared to controls (79). DNA also does not escape ROS attack; for example, deoxyguanosine is converted to 8-hydroxydeoxyguanosine (8-OHdG) (80). Like
284
Przedborski and Jackson-Lewis
the other markers of oxidative damage, 8-OHdG is also markedly increased in postmortem samples of substantia nigra in PD brains (81). X.
CONCLUSION
PD is a slow, progressive neurodegenerative disorder. The evidence presented here views ROS as instrumental in fostering oxidative stress, leading to the eventual destruction of SNpc DA neurons, which are the primary targets in PD. The slow, progressive nature of PD suggests that ongoing mild increases in oxidative stress, rather than a one-time dramatic insult, has the potential to be pathogenic. We remain unable, however, to point to a single abnormality in ROS metabolism that we can confidently convict as the executioner of SNpc DA neurons. On the other hand, if we try to reconcile all of the different experimental evidence presented above, we could raise the possibility of a conspiracy theory in which SNpc DA neuronal death is mediated by a group of otherwise unimpressive attackers that combine their forces to produce SNpc DA neurodegeneration. In most instances, we are used to thinking in terms of ‘‘one disease–one mechanism,’’ making the idea of a conspiracy theory difficult to envision in the case of PD. But if one looks at PD as the outcome of a cascade of deleterious events, even if some of the observed abnormalities are secondary, albeit meaningful, the conspiracy theory becomes much more plausible. In conclusion, we believe that compelling evidence now exists to support the role of ROS in the pathogenesis of PD. We also believe that more mechanistic studies are still needed to clarify the actual importance of certain alterations reported in the literature, and to distinguish those agents that cause real deleterious effects from those that are unlikely to have any real pathological role in the development and progression of PD. ABBREVIATIONS DA MAO MPP⫹ MPTP PD PUFA ROS SNpc SOD SOD1 SOD2 8-OHdG
dopamine monoamine oxidase 1-methyl-4-phenylpyridinium ion 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Parkinson’s disease polyunsaturated free fatty acid reactive oxygen species substantia nigra pars compacta superoxide dismutase copper/zinc-SOD manganese-SOD 8-hydroxydeoxyguanosine
ROS and Parkinson’s Disease
285
REFERENCES 1. Halliwell, B. and Gutteridge, J.M. (1991) Free Radicals in Biology and Medicine, Clarendon Press, Oxford. 2. Fahn, S. (1988) Parkinsonism. In: Cecil’s Textbook of Medicine (Wyngaarden, J.B. and Smith, L.H., Jr., eds.), W.B. Saunders, Philadelphia, pp. 2143–2147. 3. Agid, Y., Javoy-Agid, F., and Ruberg, M. (1987) Biochemistry of neurotransmitters in Parkinson’s disease. In: Movement Disorders, Vol. 2 (Marsden, C.D. and Fahn, S., eds.), Butterworths, London, pp. 166–230. 4. Forno, L.S. (1990) Pathology of Parkinson’s disease: the importance of the substantia nigra and Lewy bodies. In: Parkinson’s Disease (Stern, G.M., ed.), The Johns Hopkins University Press, Baltimore, pp. 185–238. 5. Kostic, V., Przedborski, S., Flaster, E., and Sternic, N. (1991) Early development of levodopa-induced dyskinesias and response fluctuations in young-onset Parkinson’s disease. Neurology 41, 202–205. 6. Cohen, G. (1984) Oxy-radical toxicity in catecholamine neurons. Neurotoxicology 5, 77–82. 7. Graham, D.G. (1978) Oxidative pathways for catecholamines in the genesis of neuromelanin and cytotoxic quinones. Mol. Pharmacol. 14, 633–643. 8. Cohen, G. and Werner, P. (1994) Free radicals, oxidative stress, and neurodegeneration. In: Neurodegenerative Diseases (Calne, D.B., ed.), W.B. Saunders, Philadelphia, pp. 139–161. 9. Zigmond, M.J., Abercrombie, E.D., Berger, T.W., Grace, A.A., and Stricker, E.M. (1990) Compensations after lesions of the central dopaminergic neurons: some clinical and basic implications. Trends Neurosci. 13, 290–296. 10. Mena, M.A., Pardo, B., Paino, C.L., and Garcia de Yebenes, J. (1993) Levodopa toxicity in foetal rat midbrain neurones in culture: modulation by ascorbic acid. Neuroreport 4, 438–440. 11. Mytilineou, C., Han, S.-K., and Cohen, G. (1993) Toxic and protective effects of l-DOPA on mesencephalic cell cultures. J. Neurochem. 61, 1470–1478. 12. Mena, M.A., Khan, U., Togasaki, D.M., Sulzer, D., Epstein, C.J., and Przedborski, S. (1997) Effects of wild-type and mutated copper/zinc superoxide dismutase on neuronal survival and l-DOPA-induced toxicity in postnatal midbrain culture. J. Neurochem. 69, 21–33. 13. Blunt, S.B., Jenner, P., and Marsden, C.D. (1993) Suppressive effect of L-DOPA on dopamine cells remaining in the ventral tegmental area of rats previously exposed to the neurotoxin 6-hydroxydopamine. Mov. Disord. 8, 129–133. 14. Hefti, F., Melamed, E., Bhawan, J., and Wurtman, R.J. (1981) Long-term administration of levodopa does not damage dopaminergic neurons in the mouse. Neurology 31, 1194–1195. 15. Przedborski, S., Jackson Lewis, V., Muthane, U., Jiang, H., Ferreira, M., Naini, A.B., and Fahn, S. (1993) Chronic levodopa administration alters cerebral mitochondrial respiratory chain activity. Ann. Neurol. 34, 715–723. 16. Spina, M.B. and Cohen, G. (1988) Dopamine turnover and glutathione oxidation: implications for Parkinson’s disease. Proc. Natl. Acad. Sci. USA 86, 1398– 1400. 17. Cohen, G., Farooqui, R., and Kesler, N. (1997) Parkinson disease: a new link be-
286
18. 19.
20.
21.
22. 23.
24.
25.
26.
27.
28.
29.
30.
31. 32.
Przedborski and Jackson-Lewis tween monoamine oxidase and mitochondrial electron flow. Proc. Natl. Acad. Sci. USA 94, 4890–4894. Marsden, C.D. (1983) Neuromelanin and Parkinson’s disease. J. Neural Transm. Suppl. 19, 121–141. Hirsch, E., Graybiel, A.M., and Agid, Y.A. (1988) Melanized dopaminergic neurons are differentially susceptible to degeneration in Parkinson’s disease. Nature 334, 345–348. D’Amato, R.J., Lipman, Z.P., and Snyder, S.H. (1986) Selectivity of the parkinsonian neurotoxin MPTP: toxic metabolite MPP⫹ binds to neuromelanin. Science 231, 987–989. Zecca, L., Pietra, R., Goj, C., Mecacci, C., Radice, D., and Sabbioni, E. (1994) Iron and other metals in neuromelanin, substantia nigra, and putamen of human brain. J. Neurochem. 62, 1097–1101. Swartz, H.M., Sarna, T., and Zecca, L. (1992) Modulation by neuromelanin of the availability and reactivity of metal ions. Ann. Neurol. 32 (Suppl.), S69–S75. Zhang, F. and Dryhurst, G. (1994) Effects of l-cysteine on the oxidation chemistry of dopamine: new reaction pathways of potential relevance to idiopathic Parkinson’s disease. J. Med. Chem. 37, 1084–1098. Dexter, D.T., Wells, F.R., Agid, F., Agid, Y., Lees, A., Jenner, P., and Marsden, C.D. (1987) Increased nigral iron content in post-mortem parkinsonian brain. Lancet 2, 219–220. Youdim, M.B.H., Ben-Shachar, D., Eshel, G., Finberg, J.P.M., and Riederer, P. (1993) The neurotoxicity of iron and nitric oxide. Relevance to the etiology of Parkinson’s disease. Adv. Neurol. 60, 259–266. Sofic, E., Paulus, W., Jellinger, K., Riederer, P., and Youdim, M.B. (1991) Selective increase of iron in substantia nigra zona compacta of parkinsonian brains. J. Neurochem. 56, 978–982. Riederer, P., Sofic, E., Rausch, W.D., Schmidt, B., Reynolds, G.P., Jellinger, K., and Youdim, M.B. (1989) Transition metals, ferritin, glutathione, and ascorbic acid in parkinsonian brains. J. Neurochem. 52, 515–520. Hirsch, E.C., Brandel, J.-P., Galle, P., Javoy-Agid, F., and Agid, Y. (1991) Iron and aluminum increase in the substantia nigra of patients with Parkinson’s disease: an x-ray microanalysis. J. Neurochem. 56, 446–451. Faucheux, B.A., Nillesse, N., Damier, P., Spik, G., Mouatt-Prigent, A., Pierce, A., Leveugle, B., Kubis, N., Hauw, J.J., Agid, Y., and Hirsch, E.C. (1995) Expression of lactoferrin receptors is increased in the mesencephalon of patients with Parkinson disease. Proc. Natl. Acad. Sci. USA 92, 9603–9607. Dexter, D.T., Carayon, M., Vidailhet, M., Ruberg, M., Agid, F., Agid, Y., Lees, A., Wells, F.R., Jenner, P., and Marsden, C.D. (1990) Decreased ferritin levels in brain in Parkinson’s disease. J. Neurochem. 55, 16–20. Beal, M.F. (1995) Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 38, 357–366. Mizuno, Y., Ohta, S., Tanaka, M., Takamiya, S., Suzuki, K., Sato, T., Oya, H., Ozana, T., and Kagawa, Y. (1989) Deficiencies in complex I subunits of the respiratory chain in Parkinson’s disease. Biochem. Biophys. Res. Commun. 163, 1450– 1455.
ROS and Parkinson’s Disease
287
33. Schapira, A.H., Cooper, J.M., Dexter, D., Clark, J.B., Jenner, P. and Marsden, C.D. (1990) Mitochondrial complex I deficiency in Parkinson’s disease. J. Neurochem. 54, 823–827. 34. Przedborski, S. and Jackson-Lewis, V. (1998) Mechanisms of MPTP toxicity. Mov. Disord. 13 (Suppl 1), 35–38. 35. Przedborski, S., Jackson-Lewis, V., and Fahn, S. (1995) Antiparkinsonian therapies and brain mitochondrial complex I activity. Mov. Disord. 10, 312–317. 36. Zhang, P., Damier, P., Hirsch, E.C., Agid, Y., Ceballos-Picot, I., Sinet, P.M., Nicole, A., Laurent, M., and Javoy-Agid, F. (1993) Preferential expression of superoxide dismutase messenger RNA in melanized neurons in human mesencephalon. Neuroscience 55, 167–175. 37. Przedborski, S., Khan, U., Kostic, V., Carlson, E., Epstein, C.J., and Sulzer, D. (1996) Increased superoxide dismutase activity improves survival of cultured postnatal midbrain neurons. J. Neurochem. 67, 1383–1392. 38. Poirier, J., Dea, D., Baccichet, A., and Thiffault, C. (1994) Superoxide dismutase expression in Parkinson’s disease. Ann. N. Y. Acad. Sci. 738, 116–120. 39. Saggu, H., Cooksey, J., Dexter, D., Wells, F.R., Lees, A., Jenner, P., and Marsden, C.D. (1989) A selective increase in particulate superoxide dismutase activity in parkinsonian substantia nigra. J. Neurochem. 53, 692–697. 40. Nakao, N., Frodl, E.M., Widner, H., Carlson, E., Eggerding, F.A., Epstein, C.J. and Brundin, P. (1995) Overexpressing Cu/Zn superoxide dismutase enhances survival of transplanted neurons in a rat model of Parkinson’s disease. Nature Med. 1, 226– 231. 41. Przedborski, S., Kostic, V., Jackson-Lewis, V., Naini, A.B., Simonetti, S., Fahn, S., Carlson, E., Epstein, C.J., and Cadet, J.L. (1992) Transgenic mice with increased Cu/Zn-superoxide dismutase activity are resistant to N-methyl-4-phenyl-1,2,3,6tetrahydropyridine-induced neurotoxicity. J. Neurosci. 12, 1658–1667. 42. Ambani, L.M., Van Woert, M.H., and Murphy, S. (1975) Brain peroxidase and catalase in Parkinson’s disease. Arch. Neurol. 32, 114–118. 43. Kish, S.J., Morito, C.L., and Hornykiewicz, O. (1985) Glutathione peroxidase activity in Parkinson’s disease. Neurosci. Lett. 58, 343–346. 44. Damier, P., Hirsch, E.C., Zhang, P., Agid, Y., and Javoy-Agid, F. (1993) Glutathione peroxidase, glial cells and Parkinson’s disease. Neuroscience 52, 1–6. 45. de Rijk, M.C., Breteler, M.M., den Breeijen, J.H., Launer, L.J., Grobbee, D.E., van der Meche, F.G., and Hofman, A. (1997) Dietary antioxidants and Parkinson disease. The Rotterdam Study. Arch. Neurol. 54, 762–765. 46. Scheider, W.L., Hershey, L.A., Vena, J.E., Holmlund, T., Marshall, J.R., and Freudenheim (1997) Dietary antioxidants and other dietary factors in the etiology of Parkinson’s disease. Mov. Disord. 12, 190–196. 47. Logroscino, G., Marder, K., Cote, L., Tang, M.X., Shea, S., and Mayeux, R. (1996) Dietary lipids and antioxidants in Parkinson’s disease: a population-based, casecontrol study. Ann. Neurol. 39, 89–94. 48. The Parkinson Study Group (1993) Effects of tocopherol and deprenyl on the progression of disability in early Parkinson’s disease. The Parkinson Study Group (see comments). N. Engl. J. Med. 328, 176–183. 49. Dexter, D.T., Ward, R.J., Wells, F.R., Daniel, S.E., Lees, A.J., Peters, T.J., Jenner,
288
50.
51.
52.
53.
54.
55.
56.
57. 58. 59.
60.
61.
62.
63.
Przedborski and Jackson-Lewis P. and Marsden, C.D. (1992) Alpha-tocopherol levels in brain are not altered in Parkinson’s disease [see comments]. Ann. Neurol. 32, 591–593. Shults, C.W., Haas, R.H., Passov, D. and Beal, M.F. (1997) Coenzyme Q10 levels correlate with the activities of complexes I and II/III in mitochondria from parkinsonian and nonparkinsonian subjects. Ann. Neurol. 42, 261–264. Sian, J., Dexter, D.T., Lees, A.J., Daniel, S., Agid, Y., Javoy-Agid, F., Jenner, P., and Marsden, C.D. (1994) Alterations in glutathione levels in Parkinson’s disease and other neurodegenerative disorders affecting basal ganglia. Ann. Neurol. 36, 348–355. Shults, C.W., Beal, M.F., Fontaine, D., Nakano, K., and Haas, R.H. (1998) Absorption, tolerability, and effects on mitochondrial activity of oral coenzyme Q10 in parkinsonian patients. Neurology 50, 793–795. Beal, M.F., Matthews, R.T., Tieleman, A., and Shults, C.W. (1998) Coenzyme Q10 attenuates the 1-methyl-4-phenyl-1,2,3,tetrahydropyridine (MPTP) induced loss of striatal dopamine and dopaminergic axons in aged mice. Brain Res. 783, 109– 114. Przedborski, S., Levivier, M., Jiang, H., Ferreira, M., Jackson-Lewis, V., Donaldson, D., and Togasaki, D.M. (1995) Dose-dependent lesions of the dopaminergic nigrostriatal pathway induced by intrastriatal injection of 6-hydroxydopamine. Neuroscience 67, 631–647. Jackson-Lewis, V., Jakowec, M., Burke, R.E., and Przedborski, S. (1995) Time course and morphology of dopaminergic neuronal death caused by the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Neurodegeneration 4, 257–269. Cohen, G. and Heikkila, R.E. (1974) The generation of hydrogen peroxide, superoxide radical, and hydroxyl radical by 6-hydroxydopamine, dialuric acid, and related cytotoxic agents. J. Biol. Chem. 249, 2447–2452. Heikkila, R.E. and Cohen, G. (1973) 6-Hydroxydopamine: evidence for superoxide radical as an oxidative intermediate. Science 181, 456–457. Ungerstedt, U. (1968) 6-Hydroxydopamine induced degeneration of central monoamine neurons. Eur. J. Pharmacol. 5, 107–110. Javoy, F., Sotelo, C., Herbert, A. and Agid, Y. (1976) Specificity of dopaminergic neuronal degeneration induced by intracerebral injection of 6-hydroxydopamine in the nigrostriatal dopamine system. Brain Res. 102, 210–215. Javoy, F., Agid, Y. and Sotelo, C. (1975) Specific and non-specific catecholaminergic neuronal destruction by intracerebral injection of 6-OH-DA in the rat. In: 6Hydroxydopamine as a Denervation Tool in Catecholamine Research (Jonsson, G., Malmfors, T., and Sachs, C., eds.), Elsevier, New York, pp. 75–82. Cohen, G., Heikkila, R.E., Allis, B., Cabbat, F., Demblec, D., MacNamee, D., Mytilineou, C., and Winston, B. (1976) Destruction of sympathetic nerve terminals by 6-hydroxydopamine: protection by 1-phenyl-3-(2-thiaxolyl)-2-thiourea, diethyldithiocarbamate, methimazol, cysteamine, ethanol, and N-butanol. J. Pharmacol. Exp. Ther. 199, 336–352. Cadet, J.L., Katz, M., Jackson-Lewis, V., and Fahn, S. (1989) Vitamin E attenuates the toxic effects of intrastriatal injection of 6-hydroxydopamine (6-OHDA) in rats: Behavioral and biochemical evidence. Brain Res. 476, 10–15. Langston, J.W. (1987) MPTP: the promise of a new neurotoxin. In: Movement Dis-
ROS and Parkinson’s Disease
64.
65.
66.
67. 68.
69.
70.
71.
72.
73.
74.
75.
76.
289
orders, Vol. 2 (Marsden, C.D. and Fahn, S., eds.), Butterworths, London, pp. 73– 90. Hasegawa, E., Takeshige, K., Oishi, T., Murai, Y., and Minakami, S. (1990) 1Methyl-4-phenylpyridinium (MPP⫹) induces NADH-dependent superoxide formation and enhances NADH-dependent lipid peroxidation in bovine heart submitochondrial particles. Biochem. Biophys. Res. Commun. 170, 1049–1055. Cleeter, M.W., Cooper, J.M., and Schapira, A.H. (1992) Irreversible inhibition of mitochondrial complex l by 1-methyl-4-phenylpyridinium: evidence for free radical involvement. J. Neurochem. 58, 786–789. Adams, J.D., Jr., Klaidman, L.K., and Leung, A.C. (1993) MPP ⫹ and MPDP ⫹ induced oxygen radical formation with mitochondrial enzymes. Free Rad. Biol. Med. 15, 181–186. Poirier, J. and Barbeau, A. (1985) A catalyst function for MPTP in superoxide formation. Biochem. Biophys. Res. Commun. 131, 4573–4574. Klaidman, L.K., Adams, J.D., Jr., Leung, A.C., Kim, S.S., and Cadenas, E. (1993) Redox cycling of MPP⫹: evidence for a new mechanism involving hydride transfer with xanthine oxidase, aldehyde dehydrogenase, and lipoamide dehydrogenase. Free Radic. Biol. Med. 15, 169–179. Wu, R.-M., Chiueh, C.C., Pert, A., and Murphy, D.L. (1993) Apparent antioxidant effect of 1-deprenyl on hydroxyl radical formation and nigral injury elicited by MPP ⫹ in vivo. Eur. J. Pharmacol. 243, 241–247. Schulz, J.B. and Beal, M.F. (1995) Neuroprotective effects of free radical scavengers and energy repletion in animal models of neurodegenerative disease. Ann. N.Y. Acad. Sci. 765, 100–110. Przedborski, S., Jackson-Lewis, V., Yokoyama, R., Shibata, T., Dawson, V.L., and Dawson, T.M. (1996) Role of neuronal nitric oxide in MPTP (1-methyl-4-phenyl1,2,3,6-tetrahydropyridine)-induced dopaminergic neurotoxicity. Proc. Natl. Acad. Sci. USA 93, 4565–4571. Melamed, E., Soffer, D., Rosenthal, J., Pikarsky, E., and Reches, A. (1987) Effect of intrastriatal and intranigral administration of synthetic neuromelanin on the dopaminergic neurotoxicity of MPTP in rodents. Neurosci. Lett. 83, 41–46. Heikkila, R.E., Nicklas, W.J., Vays, I., and Duvoisin, R.C. (1985) Dopaminergic toxicity of rotenone and the MPTP ion after their stereotaxic administration to rats: implication for the mechanism of MPTP toxicity. Neurosci. Lett. 62, 389–394. Reaume, A.G., Elliott, J.L., Hoffman, E.K., Kowall, N.W., Ferrante, R.J., Siwek, D.F., Wilcox, H.M., Flood, D.G., Beal, M.F., Brown, R.H., Jr., Scott, R.W., and Snider, W.D. (1996) Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nature Genet. 13, 43–47. Carlsson, L.M., Jonsson, J., Edlund, T., and Marklund, S.L. (1995) Mice lacking extracellular superoxide dismutase are more sensitive to hyperoxia. Proc. Natl. Acad. Sci. USA 92, 6264–6268. Ho, Y.S., Magnenat, J.L., Bronson, R.T., Cao, J., Gargano, M., Sugawara, M., and Funk, C.D. (1997) Mice deficient in cellular glutathione peroxidase develop normally and show no increased sensitivity to hyperoxia. J. Biol. Chem. 272, 16644– 16651.
290
Przedborski and Jackson-Lewis
77. Dexter, D.T., Carter, C.J., Wells, F.R., Javoy-Agid, F., Agid, Y., Lees, A., Jenner, P., and Marsden, C.D. (1989) Basal lipid peroxidation in substantia nigra is increased in Parkinson’s disease. J. Neurochem. 52, 381–389. 78. Selley, M.L. (1998) (E)-4-hydroxy-2-nonenal may be involved in the pathogenesis of Parkinson’s disease. Free Rad. Biol. Med. 25, 169–174. 79. Floor, E. and Wetzel, M.G. (1998) Increased protein oxidation in human substantia nigra pars compacta in comparison with basal ganglia and prefrontal cortex measured with an improved dinitrophenylhydrazine assay. J. Neurochem. 70, 268–275. 80. Shigenaga, M.K., Hagen, T.M., and Ames, B.N. (1994) Oxidative damage and mitochondrial decay in aging. Proc. Natl. Acad. Sci. USA 91, 10771–10778. ¨ vervik, E., and Ames, B.N. (1994) A marker of oxyradical81. Sanchez-Ramos, J.R., O mediated DNA damage (8-hydroxy-2′deoxyguanosine) is increased in nigrostriatum of Parkinson’s disease brain. Neurodegeneration 3, 197–204.
14 Nitric Oxide Overproduction and Oxidative Stress in Human Idiopathic Parkinson’s Disease Emilia Mabel Gatto, Natalia Andrea Riobo´, Maria Cecilia Carreras, and Juan Jose´ Poderoso University Hospital, University of Buenos Aires, Buenos Aires, Argentina
Neurodegenerative diseases are a complex group of neurological disorders that present a common hallmark: the selective death of circumscribed groups of neurons. In accord, Parkinson’s disease (PD) is characterized by a massive loss of melanized dopaminergic neurons in the pars compacta of the substantia nigra with a significant reduction of the striatal dopamine (DA) content (1) (Fig. 1). Cell death should be related to the activation of proapoptotic pathways. In the last years, many efforts were conducted to determine the etiology and pathophysiology of PD, although the mechanism underlying the selective neuron death remains unknown. Both genetic predisposition and environmental factors have been implicated in the etiology of PD (2). The presence of a familiar trait could account for the development of the illness in some populations. In this regard, a single base substitution in the α-synuclein gene in the 4q21-23 chromosome has been reported; however, DNA mutations should be present only in a minority of families with PD (3,4). On the other hand, toxic mechanisms related to endogenous or exogenous toxins have been proposed (5). At present, there is increasing evidence that either genetic or acquired factors could lead to oxidative stress, excitotoxicity, and mitochondrial impairment, as the confluent mechanisms which ultimately increase cell apoptosis in the substantia nigra (2,5,6).
291
292
(a)
(b)
(c)
Gatto et al.
NO Overproduction in Parkinson’s Disease
293
I. OXIDATIVE STRESS IN PD The substantia nigra neurons seem to be exquisitely sensitive to those stimuli which promote oxidative stress. In accord, under physiological conditions, protein oxidation in the substantia nigra is approximately twice that of any other brain area (2,7). In the last years, increased malondialdehyde levels, a metabolite of lipid peroxides, were detected in the substantia nigra of PD patients; more recently, increased lipid peroxidation was proposed as a marker of oxidative stress in PD (8). In addition, increased iron concentration in substantia nigra of PD patients has been implicated in the progressive dopaminergic neuronal degeneration (9–11). In accord, experimental models confirmed that iron overload induces nigral degeneration, possibly through the production of hydroxyl radicals by the Fenton reaction: H 2O 2 ⫹ Fe2⫹ → OH• ⫹ OH⫺ ⫹ Fe3⫹
[1]
However, these findings are common to other neurodegenerative diseases and they become evident only at late stages of PD (2). In addition, oxidative stress depends not only on an increased oxygen free radical production but on the activities of antioxidant enzymes. Nigral neuron death was previously related to a reduction in glutathione peroxidase and catalase activities (12,13). In contrast, both superoxide dismutase (SOD) isoforms I and II were found to be overexpressed, probably as an adaptative response to the increased superoxide (O •⫺ 2 ) formation (14,15). The increased SOD activity/glutathione peroxidase ratio could in turn mediate the accumulation of hydrogen peroxide (H 2O 2 ), which then gives rise to hydroxyl radicals by the Fenton reaction, promoted by the iron overload in the substantia nigra. It is relevant to define the source of oxygen free radicals in PD. The damage of dopaminergic cells in the substantia nigra specifically occurs in pigmented neurons which contain high amounts of neuromelanin. The role of neuromelanin in neuron degeneration is emphasized by the fact that other affected brain areas in PD are pigmented as well like locus coeruleus and the ventral tegmental area (1). The presence of neuromelanin, a brown pigment synthesized by polymerization of oxidized dopamine, correlates with areas of high oxygen free radicals production (16). In addition, the reaction of autooxidation of DA, the precursor of neuromelanin, generates intermediary semiquinone radicals that became further
Figure 1 1.5-T MRI, T2-weighted images. (a) Midbrain section of a 25-year-old healthy man showing the normal distribution of hypointensity in the substantia nigra and red nuclei with a normal high-intensity signal between these structures. (b) Normal midbrain section of a 79-year-old man. (c) A 53-year-old Parkinson’s disease patient midbrain section that shows the smudging of the hypointensity in the substantia nigra toward the red nucleus.
294
Gatto et al.
oxidized yielding superoxide anion and quinones (17). Additional sources of oxygen radicals are related to microglia proliferation within the substantia nigra (18).
II. MITOCHONDRIAL DYSFUNCTION Several studies have previously demonstrated a partial inhibition of mitochondrial complex I activity in the substantia nigra, skeletal muscle, and platelets of PD patients (19,20). Moreover, parkinsonism secondary to MPTP (1-methyl-4phenyl-1,2,3,6-tetrahydropyridine) administration was considered to be mediated by a mitochondrial complex I blockage by the active metabolite MPP ⫹ with O •⫺ 2 production at the same site of the electron transfer chain (21). The cause of mitochondrial complex I inhibition in PD remains to be elucidated. Some evidences propose a role for reduced glutathione (GSH) which is normally present at millimolar concentrations in mitochondria. A decrease in GSH in incidental Lewy body disease had been suggested as an evidence of early neural tissue impairment in PD. In addition, GSH is able to form adducts with oxidized forms of DA which act as complex I inhibitors (22). Moreover, a decrease in mitochondrial GSH could favor the inhibitory effects of other oxidants and nitrosating agents like nitric oxide (•NO). In this way, Clementi et al. recently demonstrated in a human macrophage cell line that mitochondrial complex I inhibition mediated by •NO is inversely related to GSH concentrations (23). Oxidative damage to mitochondrial DNA could impair mitochondrial function. The concentration of 8-hydroxyguanine, an index of oxidative DNA damage, was found increased by three- to fourfold in the caudate nucleus and the substantia nigra of PD patients (24). However, specific damage to any of the mitochondrial genes encoding for complex I subunits remains to be evaluated. Increasing evidence suggests that impaired proton pumping with a reduction in the mitochondrial membrane potential leads to the opening of a permeability transition pore with the release of mitochondrial sequestered proapoptotic factors (like cytochrome c, apoptosis-inducing factor, and apoptosis protease– activating factor 1) (25). This energetic defect also produces partial neuron depolarization, relief of the voltage-dependent Mg 2⫹ block of N-methyl-d-aspartate (NMDA) receptors with persistent receptor activation by glutamate, and massive calcium entrance (26). The rise in cytoplasmic calcium promotes the activation of several enzymes such as constitutive NO synthases (NOS) (Fig. 2). Recently, a new isoform of NOS was isolated from liver mitochondria (27); this mtNOS has structural similarity to the inducible isoform but its activity depends on calcium availability. Its presence in neuronal mitochondria is not established but it is noteworthy that it could contribute to calcium-mediated neuronal impairment.
NO Overproduction in Parkinson’s Disease
295
Figure 2 Hypothetical sources of •NO in the vicinity of SNpc dopaminergic neurons in Parkinson’s disease. Inside the affected neuron •NO inhibits mitochondrial respiration and promotes superoxide anion production at complex III. The formation of peroxynitrite leads to oxidative damage of proteins, lipids, and DNA molecules. Both mitochondrial membrane potential impairment and nonspecific biomolecule damage activate the apoptotic process, possibly through proteolytic activation of caspases.
III.
NITRIC OXIDE EFFECTS ON OXYGEN FREE RADICAL GENERATION BY MITOCHONDRIA
Nitric oxide exerts different actions on mitochondria. First, •NO reversibly inhibits cytochrome oxidase (complex IV) and modulates mitochondrial oxygen uptake at a low nanomolar concentration (28). Although mitochondrial complex I is currently affected in PD, the inhibition of complex IV has been reported as well (29). Inhibitory effects of •NO on oxygen uptake has been also reported in synaptosomal preparations from neural tissue (30). On the other hand, •NO has an additional inhibitory effect on complex II–III of the electron transfer chain but at higher concentrations. About 2% of the oxygen consumed during mitochondrial respiration is reduced to superoxide radicals mainly at the UQ cycle site. Previously, we reported that •NO markedly increases the production rates of O •⫺ 2 and H 2 O 2 in mitochondria and submitochondrial particles (31). This effect
296
Gatto et al.
depends on a direct reaction of •NO with ubiquinol to form semiquinone radical that in the presence of oxygen decays to O •⫺ 2 and oxidized ubiquinone (58). Thus, under conditions of •NO overproduction, the mitochondrial steady-state concentration of superoxide anion may be increased by severalfold, promoting the formation of the highly reactive peroxynitrite anion (ONOO ⫺ ) within mitochondria (31) by Reactions [2] to [4]. UQH 2 ⫹ •NO → UQ •⫺ ⫹ NO ⫺
[2]
⫹ O 2 → UQ ⫹ O
[3]
UQ O
•⫺ 2
•⫺
⫹ •NO → ONOO
•⫺ 2
⫺
[4]
The reaction of •NO with O •⫺ 2 is diffusion-limited with a reaction rate constant of 6.9 ⫻ 10 9 M ⫺1 s ⫺1 . The above-presented reaction introduces a new insight into the cell production of oxygen active species: a significant part of them should come from the oxidative catabolism of •NO and, thus, •NO overproduction should be always accompanied to some extent by oxidative stress.
IV.
ROLE OF NITRIC OXIDE IN NIGRAL CELL DEATH IN PARKINSON’S DISEASE
In the last years, nitric oxide has been implicated by several evidences in the pathophysiology of nigral degeneration. In the CNS, •NO acts as the second messenger of NMDA-glutamate receptors and also as a retrograde signaling molecule, as in long-term potentiation. On the other hand, •NO may be toxic; at micromolar concentrations of •NO (usually after iNOS induction) the formation of peroxynitrite anion irreversibly inhibits glutathione peroxidase, Mn-SOD, and mitochondrial complex I, and leads to the oxidation and nitration of proteins, lipids, and DNA (32). The role of •NO in human idiopathic PD is highlighted by the presence of 3-nitrotyrosine (3-NT), a product of peroxynitrite reaction with tyrosyl residues of proteins, in the core of Lewy bodies (the histological hallmark of PD), striatum, and substantia nigra (33) and the finding of iron-nitrosyl complexes by EPR in postmortem studies of substantia nigra from PD patients (34). In accord, nigral melanized neurons in PD expressing nNOS are relatively more spared than nNOS ⫺ neurons, a feature characteristic of •NO-dependent excitotoxicity (35). Moreover, lesions induced by MPTP administration are mediated to a great extent by peroxynitrite. In this way, transgenic nNOS ⫺/⫺ mice (36,37), as well as those overexpressing SOD1 (38) were significantly protected against MPTP. Also, the treatment with the nNOS inhibitor 7-nitroindazole protected in vivo against MPTP-induced dopamine depletion in mice and baboons (39,40). In the same way, it was demonstrated that nitration of a single residue inactivates tyrosine hydroxy-
NO Overproduction in Parkinson’s Disease
297
lase, the rate-limiting enzyme in the synthesis of dopamine, in MPTP-treated mice (41). Altogether, this evidence suggests that peroxynitrite formation within pigmented neurons contributes to the degenerative process in PD.
V.
THE SOURCE OF NEUROTOXIC •NO
For many years a central role of •NO in PD was questioned because NOS ⫹ neurons could not be detected in the vicinity of nigral neurons. Later studies proved that the striatum, the major projection of the pars compacta nigral neurons, contains a rich density of nNOS ⫹ neurons, as well as other related structures like subthalamic nucleus (95%), globus pallidus, and claustrum (42). Recently, a small number of nNOS ⫹ interneurons were detected by immunohistochemistry in the substantia nigra pars compacta (43). Staining intensity was only slightly lower in PD than controls. Therefore, nNOS ⫹ neurons appeared twofold preserved in idiopathic PD than nNOS ⫺ cells (35). On the other hand, several authors found a clear increase in the number of glial cells expressing iNOS in PD substantia nigra (18,44,45). Indeed, not only iNOS but nNOS were found in astrocytes, allowing them to be an alternative source of neurotoxic •NO (46).
VI.
PERIPHERAL ABNORMALITIES IN CELLS AND TISSUES OTHER THAN CNS
Although substantia nigra is particularly vulnerable in PD, several studies suggest that the pathogenic process is more diffuse than previously thought and that it should not be exclusively restricted to the CNS. Blood platelets are frequently utilized to detect peripheral defects in neurodegenerative disorders. In fact, some authors suggest that platelets reflect some biochemical processes in the CNS, like their capacity to uptake dopamine and the expression of brain MAO-B enzyme. In this way, the most consistent finding is still the partial complex I inhibition in platelet mitochondria from PD patients (19). On the other hand, an increased production of oxygen free radicals was reported by Kalra et al. in polymorphonuclear leukocytes (PMNs) from PD patients (47). In the last years our laboratory reported the simultaneous production of nitric oxide and superoxide anion during the respiratory burst of human PMNs by simultaneous activation of a constitutive NOS (further identified as nNOS) and NADPH oxidase (Fig. 3) (48). On the basis of these results, our group performed several studies with human PMNs as a suitable model to analyze outside the CNS the production of •NO and peroxynitrite anion in PD.
298
Gatto et al.
Figure 3 Formation of peroxynitrite anion during the respiratory burst of purified PMN cells exposed to 0.1 µg/mL PMA. (A) Effect of 500 U/mL SOD on •NO, H 2O 2, and superoxide anion initial production rate with respect to the control value. Nitric oxide detection was performed by conversion of 20 µM oxymyoglobin to metmyoglobin in a double-beam–double-wavelength 356 Perkin-Elmer spectrophotometer at 581–593 nm. The absorption difference was continuously monitored at 37°C and •NO was calculated with the extinction coefficient 11.6 mM ⫺1 cm ⫺1. Superoxide anion was measured by monitoring cytochrome c reduction at 550 nm and 37°C and calculated using ⑀ ⫽ 21.1 mM ⫺1 cm ⫺1. Hydrogen peroxide was assessed by the horseradish peroxidase–p-hydroxyphenylacetic acid assay in a Hitachi F2000 fluorimeter at 37°C with λ ex ⫽ 315 nm and λ em ⫽ 425 nm. Values were calculated using ⑀ ⫽ 0.5 mM ⫺1 cm ⫺1. (B) Western blot detection of 3-nitrotyrosine formation of BSA. 10 µg BSA was loaded on a 12% SDS polyacrylamide gel, electrophoresed, transferred to a nitrocellulose membrane, and confronted 1 h at room temperature with polyclonal antinitrotyrosine antibody (Upstate Biothec., Inc) at 1: 1000 dilution followed by incubation with a 1: 3000 dilution of a second antibody conjugated to alkaline phosphatase (BioRad) and developed with the Immune-Star chemiluminescent method (BioRad). Lane 1: positive control of BSA nitrated by addition of 0.3 mM ONOO ⫺; lane 2: BSA incubated with unstimulated neutrophils; lane 3: nitration of BSA by ONOO⫺ generated by PMA-stimulated neutrophils.
NO Overproduction in Parkinson’s Disease
299
VII. INCREASED NITRIC OXIDE PRODUCTION BY PMN FROM PD PATIENTS To that purpose, patients who fulfilled the United Kingdom Brain Bank Criteria for idiopathic PD were divided after careful clinical evaluation in two groups: a newly diagnosed, still untreated group (de novo) and a group composed of ldopa-administered subjects (L-dopa-treated ). Control samples were obtained from healthy volunteer blood donors of similar ages. Neutrophils isolated from both groups of patients showed an increased •NO production rate during the respiratory burst stimulated by phorbol-12-myristate13-acetate (PMA) (Table 1). In the l-dopa-treated group, both •NO and H 2 O 2 production rates were increased by 57% and 56%, respectively, with respect to the control values. By contrast, only •NO release was increased (61%) in the de novo group, without changes in H 2 O 2 production rates (49). ⫺ The simultaneous generation of •NO and O •⫺ 2 leads to ONOO formation by reaction [4]. Luminol-dependent chemiluminescence is enhanced when •NO and/or O •⫺ 2 is increased, with concomitant higher peroxynitrite formation rate. In accord, both groups showed an increase in light emission (157% in the treated vs. 65% in the de novo group) (Table 1). We also performed the detection of tyrosine nitration, as a stable product of peroxinitrite, by western blot of proteins extracted from resting PMN cells. Tyrosine nitration of samples derived from PD subjects was more intense than in controls (Fig. 4), suggesting that even in the absence of stimulus the basal •NO production becomes increased and leads to the formation of ONOO ⫺ (50).
Table 1 Production of Reactive Oxygen Species, •NO, and H 2O 2 by PMA-Activated Neutrophils
Controls PD de novo l-Dopa treated PD
•NO (nmol/min 10 6 cells)
H 2O 2 (nmol/min 10 6 cells)
CL (cps/5.10 5 cells)
0.46 ⫾ 0.04 0.74 ⫾ 0.08* 0.72 ⫾ 0.05*
0.77 ⫾ 0.05 0.99 ⫾ 0.09 1.20 ⫾ 0.10*
95 ⫾ 12 157 ⫾ 20 244 ⫾ 40*
Nitric oxide and H 2O 2 production were measured as in Fig. 3A. Luminol-dependent chemiluminescence (CL) was measured with a C-660 computerized Thorn EMI (UK) photon counter at 30°C. The reaction medium contained HBSS, 5 µM luminol, and 5 ⫻ 10 5 cells/mL. Results are expressed as the mean ⫾ SEM. *p ⬍ 0.05.
300
Gatto et al.
Figure 4 Tyrosine nitration of proteins from resting PMN of controls vs. PD patients. Total soluble and weak membrane–associated proteins were extracted, electrophoretically separated on a 12% SDS-polyacrylamide gel, and transferred to a nitrocellulose membrane. Western blot was performed as in Fig. 3.
VIII. NEURONAL NOS OVEREXPRESSION The above results provided two independent observations of enhanced neutrophil constitutive NOS activity in Parkinson’s disease. To investigate the origin of the higher activity, we performed reverse transcription polymerase chain reaction studies (RT-PCR) to compare the nNOS messenger expression levels in all groups. Complementary DNA was synthesized from total mRNA of each individual, followed by amplification of a nNOS-specific fragment and hybridization with an internal probe. We detected nNOS mRNA in all evaluated samples from PD patients and in most of controls. The expression level of nNOS was significantly increased in the patients (Fig. 5), densitometric data normalized to β-actin content revealed a 10-fold overexpression with respect to the controls. In accord, immunodetection of the nNOS protein by western blot revealed the presence of a single band of 160 kDa in some PD samples, identical to the band of nNOS in rat cerebellum homogenate; as previously referred in the literature (51), the protein was below the detection level in control PMNs (Fig. 6). By contrast, iNOS protein was not detected by western blot either in controls or in PD samples, indicating that changes in •NO production are primarily due to nNOS overexpression. IX. A POSSIBLE MECHANISM FOR •NO DOPAMINERGIC TOXICITY Increased hydrogen peroxide production by neutrophils from l-dopa-treated patients (49) but not from de novo parkinsonians arises a crucial question: is oxygen
NO Overproduction in Parkinson’s Disease
301
Figure 5 Neuronal NOS expression in PMN cells from control and PD subjects. The upper panel shows the autoradiography of hybridization with the nNOS probe (CTGA GACCACGTGGTCCTCATTCTG). The lower panel corresponds to the β-actin control. Densitometric data normalized to β-actin content revealed an increase in nNOS mRNA of about 10-fold in the parkinsonian subjects. Total RNA was extracted from 40,000 to 100,000 cells, then cDNA was constructed with reverse transcriptase and poly(T) as primer. Subsequently, cDNA was purified and 30 cycles of PCR were performed at 64°C annealing temperature with the set of primers for nNOS amplification (5′ primer: AGGCCGGAGATCATTCTT GCGGT; 3′ primer: CTCCTGCCCATCATCGTAGGC). As a control for cDNA mass, a fragment of β-actin was also amplified for 15 cycles. PCR products were subjected to agarose gel electrophoresis, blotted on a membrane, and hybridized with the corresponding P 32-radiolabeled probe.
free radicals production related to the progression of the disease or to the oxidation of administered l-dopa? In the literature, a possible contribution to the oxidative stress state by l-dopa and dopamine metabolism in the progression of PD supports a controversy about whether l-dopa has to be administered early in the treatment of PD or should be delayed up to the latter stages (52,53). In vitro, l-dopa is a very potent toxin and is lethal to many types of neuronal and nonneuronal cells (54–57). In this condition, most of l-dopa effects are mediated by its autooxidation. In this process, catecholamines’ nonenzymatic reactions lead to the formation of highly reactive radical species as intermediary products. The common catechol nucleus (QH 2 ) of all catecholamines could be partially oxidized to a semiquinone radical, which in turn decays to superoxide anion and to oxidized quinone which undergoes cyclization in reactions [5] and [6] (Fig. 7) (17). This oxidative metabolism is particularly high in pigmented neurons because it is the pathway for neuromelanin formation. QH 2 ⫹ O 2 → Q •⫺ ⫹ O •⫺ 2 Q •⫺ ⫹ O 2 → Q ⫹ O •⫺ 2
[5] [6]
302
Gatto et al.
Figure 6 Immunodetection of the nNOS protein by western blot in neutrophil samples from control and PD patients. Briefly, total soluble and weak membrane–associated proteins were extracted, electrophoretically separated on a 12% SDS-polyacrylamide gel, transferred to a nitrocellulose membrane, and confronted 1 h at room temperature with polyclonal mouse anti-human neuronal NOS antibody (Upstate Biothec) at 1:1000 dilution followed by incubation with a 1:3000 dilution of a second goat anti-mouse IgG antibody conjugated to alkaline phosphatase (BioRad) and developed with the Immune-Star chemiluminescent method (BioRad). Lane a: rat cerebellum lysate; lane b: control PMN; lane c: PD patient’s PMN.
Similarly to the •NO-dependent oxidation of ubiquinol shown in reaction [2] (58), •NO is able to react with the quinoid nucleus of catecholamines. In this way, we studied the reaction of •NO with different catecholamines and particularly with 6-hydroxydopamine (6-OHDA), a neurotoxin utilized to develop experimental models of PD, because of its high autooxidation rate (59). The nitric oxide decay rate was increased in the presence of 6-OHDA in aerobiosis and pH 7; the kinetic data fitted to a second-order reaction with a rate constant k a ≅ 10 4 M ⫺1 s ⫺1 . In contrast, at lower pH, the reaction was much slower, being k b ≅ 10 2 M ⫺1 s ⫺1 (Fig. 8). To avoid spontaneous oxidation, spectral changes of 6-OHDA oxidation were followed at low pH. In these conditions, reduced 6-OHDA remained stable and the subsequent addition of •NO started 6-OHDA oxidation
Figure 7
Autooxidation reactions of the catechol nucleus of 6-hydroxydopamine.
NO Overproduction in Parkinson’s Disease
303
Figure 8 Dependence of •NO consumption on 6-OHDA concentration at different pH values. The initial decay rate of 1 µM •NO supplemented with increasing concentrations of reduced 6-OHDA was measured electrochemically at 30°C. Experiments were performed either in 50 mM potassium phosphate buffer, pH 7.0 (A) or in 50 mM acetate buffer, pH 4.0 (B).
until completion (Fig. 9), according to reactions [7] and [8]. Differences in reaction rates between aerobic and anaerobic conditions suggest that both reactions [4] and [7] are competing for •NO consumption. QH 2 ⫹ NO → NO ⫺ ⫹ Q • Q • ⫹ O 2 → O •⫺ 2 ⫹ Q
[7] [8]
Independently of the predominant pathway for •NO reaction with 6-OHDA that could take place in vivo, peroxynitrite will be a final product (reaction [4]). In accord, in Fig. 10 it is shown the tyrosine nitration of bovine serum albumin (BSA) exposed aerobically to •NO and 6-OHDA and assessed by western blot. These findings suggest that ONOO ⫺ could be formed within SNpc in PD by reaction of increased •NO concentration with ubiquinol (mitochondrial and cytosolic) and with the particularly high catecholamine content of the cytosol of pigmented neurons. X.
NEUROPROTECTION IN PARKINSON’S DISEASE
Neuroprotective strategies appear as an attractive instance for Parkinson’s disease treatment. In this way, dopamine D 3- and D 2-type agonists have provided neuro-
304
Gatto et al.
Figure 9 Oxidation of 6-OHDA by •NO. UV absorption spectral changes of 6-OHDA elicited by •NO addition. After 10 min of stable recordings, 50 µM •NO was added to the cuvette containing 100 µM 6-OHDA in 50 mM acetoacetic buffer, pH 4.0, at 30°C and spectra were recorded with scan intervals of 1 min over a 15-min period until complete formation of the quinone was observed.
Figure 10 Peroxynitrite formation during the reaction of •NO with 6-OHDA. 200 µM 6-OHDA was incubated with 4 mg/mL BSA in 50 mM potassium phosphate, pH 7.0 in the presence or absence of 200 µM •NO. A positive control of tyrosine nitration was generated by ONOO ⫺ addition to 4 mg/mL BSA. 10 µg BSA were loaded on a 12% SDS-polyacrylamide gel, electrophoresed, and transferred to a nitrocellulose membrane. Western blot was then performed as described in Fig. 3.
NO Overproduction in Parkinson’s Disease
305
Table 2 Effect of Selegiline on NO and H 2O 2 Production by PMA-Activated PMN Cells
PD PD with selegiline Control
•NO (nmol/min 10 6 cells)
H 2O 2 (nmol/min 10 6 cells)
0.89 ⫾ 0.09 a 0.63 ⫾ 0.09 0.56 ⫾ 0.05
4.10 ⫾ 0.34 b 2.5 ⫾ 0.58 3.1 ⫾ 0.28
Nitric oxide and H 2O 2 production were measured as in Fig. 3A. Results are expressed as the mean ⫾ SEM. Significantly different vs. control value, ap ⫽ 0.013; vs. PD ⫹ selegilineb, p ⬍ 0.05.
protection against toxicity induced by calcium overload and oxygen free radicals (60). The most extensive evidence in neuroprotective therapies has been provided by selegiline, a selective inhibitor of monoamine oxidase type B (MAO-B) that slows the progression of PD (61,62). Although its mechanism of action remains poorly understood, the protective effect of selegiline appeared to be independent of MAO-B inhibition and more probably related to neurotrophic (63) and antioxidant properties, like increasing reduced ubiquinol concentration in the striatum (64). Indeed, selegiline neuroprotection in cell cultures is associated with changes in the expression of about 50 genes and, among them, with upregulation of antioxidant and antiapoptotic enzymes (63). To further assess the putative neuroprotective capacity in human subjects, we have recently evaluated the effect of chronic treatment with selegiline on •NO and H 2 O 2 production during the respiratory burst of activated PMN from PD patients, as well as the extent of protein tyrosine nitration before and after selegiline treatment. Selegiline treatment at 10 mg/day during 1 month decreased the PMA-enhanced •NO and H 2 O 2 production of PMN from PD patients (Table 2). The treatment with selegiline also inhibited protein tyrosine nitration, as a reflection of lower ONOO ⫺ production (Fig. 11). The present findings suggest that the effect of selegiline could be mediated by lowering •NO and ONOO ⫺ levels probably by modifying NOS expression and/or activity.
XI. IS •NO INVOLVED IN THE PATHOPHYSIOLOGY OF PD? Accordingly with previous studies that proposed that nNOS activity should contribute to MPTP toxicity in experimental models (37,39), it is believed that the increased NOS activity of PMN isolated from PD patients is probably a reflection
306
Gatto et al.
Figure 11 Effect of selegiline treatment on protein tyrosine nitration of neutrophils isolated from PD patients. Resting cells isolated before and after 1 month of treatment with 10 mg/day selegiline were processed and subjected to immunoblotting with an antinitrotyrosine antibody as described in Fig. 3.
of a widespread disorder, especially considering that it is related to the overexpression of nNOS. To our knowledge, this is the first evidence that constitutive •NO production is increased in other cells besides neurons in PD. Previous studies supported the hypothesis that •NO toxicity is mediated through iNOS of activated glial cells (18). At present, it cannot be excluded that iNOS expression in the substantia nigra could be involved in the propagation of neurodegeneration initiated by nNOS overexpression. As mentioned above, the presence of nitrotyrosine in SN of PD as well as in circulating cells like neutrophils is likely to be relevant evidence to assign a central role to •NO in the pathophysiology of PD. Increased tyrosine nitration of neutrophil proteins from PD patients suggests a higher ONOO ⫺ formation by enhanced NOS activity. Accordingly, increased reactive carbonyl levels that reflect nonspecific oxidation of protein has been found not restricted to the substantia nigra in PD (65). Although these peripheral findings do not allow them to be extrapolated to the CNS, the data contribute to our suspecting PD to be a systemic or more widespread disorder in which the specific increase of •NO seems to play a key role. In spite of a higher nNOS protein expression in PD, •NO production seems to be tightly regulated, since about 10-fold nNOS overexpression was followed by only about a 50% increase in enzyme activity. In this sense, •NO itself decreases NOS activity by binding to the heme prosthetic group of the enzyme (66). In addition, the signal transduction pathway for NOS activation and •NO release in neutrophils is finely regulated (67).
NO Overproduction in Parkinson’s Disease
307
A number of factors stimulate nNOS expression. For instance, one possible mechanism could be related to the Oct-2 transcription factor that has been shown to repress cellular tyrosine hydroxylase gene and to activate the nNOS gene in neuronal cells (68). It cannot be excluded that changes in gene regulation should be secondary to some metabolite imbalance. In this way, we recently found that after incubation with plasma from PD patients control neutrophils showed an enhanced •NO production (69). Thus, circulating plasmatic factors in PD could contribute to regulate nNOS expression and/or activity. The increase in nNOS activity and the formation of peroxynitrite could explain most of the reported features of idiopathic Parkinson’s disease including complex I deficiency, the loss of reduced glutathione, and oxidative stress. It is believed that elucidation of the origin of the nNOS gene disregulation will provide a clue onto the mechanisms underlying PD development and progression; in this way, familiar linkage studies are required to assess whether or not overexpression of nNOS represents only a cell marker of disease or a true susceptibility factor for ulterior development of the illness.
REFERENCES 1. Lang, A.E. and Lozano, A.M. (1998) Parkinson’s disease. N. Engl. J. Med. 339, 1044–1053. 2. Jenner, P. (1998) Oxidative mechanisms in nigral cell death in Parkinson’s disease. Mov. Disord. 13(suppl 1), 24–34. 3. Polymeropoulos, M.H., Higgings, J.H., Golbe, L.I., et al. (1996) Mapping of a gene for Parkinson’s disease to chromosome 4q21-q23. Science 274, 1197–1199. 4. Polymeropoulos, M.H., Lavedan, C., Leroy, E., et al. (1997) Mutation in the αsynuclein gene identified in families with Parkinson’s disease. Science, 276, 2045– 2047. 5. Fahn, S. and Cohen, G. (1992) The oxidative stress hypothesis in Parkinson’s disease. Evidence supporting it. Ann. Neurol. 32, 804–812. 6. Beal, M.F. (1997) Oxidative damage in neurodegenerative diseases. Neuroscientist 3, 21–27. 7. Jenner, P. and Olanow, C.W. (1996) Oxidative stress and the pathogenesis of Parkinson’s disease. Neurology 47(6 suppl 3), S161–S170. 8. Dexter, D.T., Holley, A.E., Flitter, W.D., et al. (1994) Increased levels of lipid hydroperoxides in the parkinsonian substantia nigra: an HPLC and ESR study. Mov. Disord. 9, 92–97. 9. Hirsch, S. and Faucheux, B.A. (1998) Iron metabolism and Parkinson’s disease. Mov. Disord. 13 (suppl), 39–45. 10. Dexter, D.T., Carayon, A., Vidaihet, M., et al. (1990) Decreased ferritin levels in brain in Parkinson’s disease. J. Neurochem. 55, 16–20. 11. Sofic, E., Paulus, W., Jellinger, K., Riederer, P., and Youdim, M.B.H. (1991) Selec-
308
12.
13.
14.
15.
16. 17. 18.
19. 20. 21. 22.
23.
24.
25. 26.
27. 28.
Gatto et al. tive increase of iron in substantia nigra zona compacta of parkinsonian brains. J. Neurochem 56, 978–982. Sian, J., Dexter, D.T., Lees, A.J., et al. (1994) Alterations in glutathione levels in Parkinson’s disease and other neurodegenerative disorders affecting basal ganglia. Ann. Neurol. 36, 348–355. Sofic, E., Lange, K.W., Jellinger, K., and Riederer, P. (1992) Reduced oxidized glutathione in the substantia nigra of patients with Parkinson’s disease. Neurosci. Lett. 142, 128–130. Saggu, H., Cooksey, J., Dexter, D., et al. (1989) A selective increase in particulate superoxide dismutase activity in parkinsonian substantia nigra. J. Neurochem. 53, 692–697. Yoritaka, A., Hattori, N., Mori, H., Kato, K., and Mizono, Y. (1997) An immunohistochemical study on manganese superoxide dismutase in Parkinson’s disease. J. Neurol. Sci. 148, 181–186. Smythies, J. and Galzigna, L. (1998) The oxidative metabolism of catecholamines in the brain: a review. Biochim. Biophys. Acta 1380, 159–162. Graham, D.G. (1978) Oxidative pathways for catecholamines in the genesis of neuromelanin and cytotoxic quinones. Mol. Pharmacol. 14, 633–643. Hirsch, E.C., Hunot, S., Damier, P., and Faucheux, B. (1998) Glial cells and inflammation in Parkinson’s disease: a role in neurodegeneration? Ann. Neurol. 44(suppl 1), S115–S120. Schapira, A.H.V. (1994) Evidence for mitochondrial dysfunction in Parkinson’s disease. A critical appraisal. Mov. Disord. 9, 125–138. Miller, R.J. (1998) Mitochondria—the Kraken wakes. TINS 21, 95–97. Przedborski, S. and Jackson-Lewis, V. (1998) Mechanisms of MPTP toxicity. Mov. Disord. 13 (suppl 1), 35–38. Shen, X.M. and Dryhurst, G. (1996) Further insights into the influence of l-cysteine on the oxidation chemistry of dopamine: reaction pathways of potential relevance to Parkinson’s disease. Chem. Res. Toxicol. 9, 751–763. Clementi, C., Brown, G.C., Feelish, M., and Moncada, S. (1998) Persistent inhibition of cell respiration by nitric oxide: crucial role of S-nitrosylation of mitochondrial complex I and protective action of glutathione. Proc. Natl. Acad. Sci. USA 95(13), 7631–7636. Alam, Z.I., Jenner, A., Daniel, S.E., et al. (1997) Oxidative DNA damage in parkinsonian brain. A selective increase in 8-hydroxyguanine in substantia nigra? J. Neurochem. 69, 1196–1203. Mignotte, B. and Vayssiere, J.L. (1998) Mitochondria and apoptosis. Eur. J. Biochem. 252, 1–15. Samdani, A.F., Newcamp, C., Resnik, A., Facchinetti, F., Hoffman, B.E., Dawson, V.L., and Dawson, T.M. (1997) Differential susceptibility to neurotoxicity mediated by neurotrophins and neuronal nitric oxide synthase. J. Neurosci. 17, 4633– 4641. Tatoyan, A. and Giulivi, C. (1998) Purification and characterization of a nitric oxide synthase from rat liver mitochondria. J. Biol. Chem. 273(18), 11044–11048. Cleeter, M.W.J., Cooper, J.M., Darley-Usmar, V.M., Moncada, S., and Schapira, A.H.V. (1994) Reversible inhibition of cytochrome c oxidase, the terminal enzyme
NO Overproduction in Parkinson’s Disease
29.
30.
31.
32. 33. 34.
35.
36.
37. 38.
39.
40.
41. 42.
43. 44.
309
of the mitochondrial respiratory chain, by nitric oxide. Implications for neurodegenerative diseases. FEBS Lett. 345, 50–55. Benecke, R., Strumper, P., and Weiss, H. (1993) Electron transfer complexes I and IV of platelets are abnormal in Parkinson’s disease but normal in Parkinson’s plus syndromes. Brain 116, 1451–1463. Brown, G.C. and Cooper, C.E. (1994) Nanomolar concentrations of nitric oxide reversibly inhibits synaptosomal respiration by competing with oxygen at cytochrome oxidase. FEBS Lett. 356, 295–298. Poderoso, J.J., Carreras, M.C., Lisdero, C., Riobo´, N., Scho¨pfer, F., and Boveris, A. (1996) Nitric oxide inhibits electron transfer and increases superoxide radical production in rat heart mitochondria and submitochondrial particles. Arch. Biochem. Biophys. 328, 85–92. Dawson, V.L., Dawson, T.M. (1996) Nitric oxide actions in neurochemistry. Neurochem. Int. 29, 97–110. Good, P.F., Hsu, A., Werner, P., Perl, D.P., Olanow, C.W. (1998) Protein nitration in Parkinson’s disease. J. Neuropathol. Exp. Neurol. 57, 338–342. Shergill, J.K., Commark, R., Cooper, C.E., Cooper, J.M., Mann, V.M., and Shapira, A.H. (1996) Detection of nitrosyl complexes in human substantia nigra in relation to Parkinson’s disease. Biochem. Biophys. Res. Commun. 228, 298–305. Hunot, S., Boissiere, F., Facheux, B., Brugg, B., Movatt-Prigent, A., Agid, Y., and Hirsch, E.C. (1996) Nitric oxide synthase and neuronal vulnerability in PD. Neuroscience 72, 355–363. Przedborski, S., Jackson-Lewis, V., Yokoyama, R., Shibata, T., Dawson, V.L., and Dawson, T. (1996) Role of neuronal nitric oxide in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced dopaminergic neurotoxicity. Proc. Natl. Acad. Sci. USA 93, 4565–4571. Matthews, R.T., Beal, M.F., Fallon, J., et al. MPP ⫹ induced substantia nigra degeneration is attenuated in nNOS knockout mice. Neurobiol. Dis. 4, 114–121. Przedborski, S., Kostic, V., Jackson-Lewis, V., Naini, A.B., and Simonetti, S. (1992) Transgenic mice with increased Cu/Zn superoxide dismutase activity are resistant to N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurotoxicity. J. Neurosci. 12, 1658–1667. Schulz, J.B., Matthews, R.T., Muqit, M.M.K., Browne, S.E., and Beal, M.F. (1995) Inhibition of neuronal nitric oxide synthase by 7-nitroindazole protects against MPTP-induced neurotoxicity in mice. J. Neurochem. 64, 936–939. Hantraye, P., Brouillet, P., Ferrante, R., et al. (1996) Inhibition of neuronal nitric oxide synthase prevents MPTP induced parkinsonism in baboons. Nature Med. 2, 1017–1021. Przedborski, S. (1998) What can we learn from nitric oxide and MPTP? Mov. Disord. 13 (suppl 2), 4. Nisbet, A.P., Foster, O.J.F., Kingsbury, A., Lees, A.J., and Marsden, C.D. (1994) Nitric oxide synthase mRNA expression in subthalamic nucleus, striatum and globus pallidus: implications for basal ganglia function. Mol. Brain Res. 22, 329–332. Flint Beal, M. (1998) Excitotoxicity and nitric oxide in parkinson’s disease pathogenesis. Ann. Neurol. 44 (suppl 1), S110–S114. Skaper, S.T., Facci, L., and Leon, A. (1995) Inflammatory mediator stimulation of
310
45. 46.
47.
48.
49.
50. 51.
52.
53. 54. 55. 56.
57.
58.
59. 60. 61.
Gatto et al. astrocytes and meningeal fibroblasts induces neuronal degeneration via the nitridergic pathway. J. Neurochem. 64, 266–276. Boje, K.M., Arora, P.K. (1992) Microglial-produced nitric oxide and reactive nitrogen oxides mediate neuronal cell death. Brain Res. 587, 250–256. Togashi, H., Sasaki, M., Frohman, E., Taira, E., Ratan, R.R., Dawson, T.M., and Dawson, V.L. (1997) Neuronal (type I) nitric oxide synthase regulates nuclear factor kappa B activity and immunologic (type II) nitric oxide synthase expression. Proc. Natl. Acad. Sci. USA 94, 2676–2680. Kalra, J., Rajput, A.H., Mantha, S.V., Chaudhanry, A.K., and Prasad, K. (1992) Oxygen free radicals producing activity of polymorphonuclear leukocytes in patients with Parkinson’s disease. Mol. Cell. Biochem. 112, 181–186. Carreras, M.C., Pargament, G., Catz, S.D., Poderoso, J.J., and Boveris, A. (1994) Kinetics of nitric oxide and hydrogen peroxide production and formation of peroxynitrite during the respiratory burst of human neutrophils. FEBS Lett. 341, 65–68. Gatto, E.M., Carreras, M.C., Pargament, G., Riobo´, N.A., Reides, C., Repetto, M., et al. (1996) Neutrophil function, nitric oxide, and blood oxidative stress in Parkinson’s disease. Mov. Disord. 11, 261–267. Gatto, E.M., Riobo´, N.A., Carreras, M.C., Chern˜avsky, A., Rubio, A., and Poderoso, J.J. (1998) Unpublished results. Hall, A.V., Antoniou, H., Wang, Y., Cheung, A.H., Arbus, A.M., Olson, S.L., Luwc Kou, C.L., Marsden, P.A. (1994) Structural organization of human neuronal nitric oxide synthase gene (NOS I). J. Biol. Chem. 269, 33082–33090. Fahn, S., Bressman, S.B. (1984) Should levodopa therapy for parkinsonism be started early or late? Evidence against early treatment. Can. J. Neurol. Sci. 11, 200– 206. Fahn, S. (1996) Is levodopa toxic? Neurology 47 (suppl), S184–S195. Mena, M.A., Pardo, B., Casarejos, M.J., Fahn, S., and de Yebenes, J.G. (1992) Neurotoxicity of levodopa on catecholamine rich neurons. Mov. Disord. 7, 23–31. Basma, A.N., Morris, E.J., Nicklas, W.J., and Geller, H.M. (1995) l-Dopa cytotoxicity to PC-12 cells in culture is via its autooxidation. J. Neurochem. 64, 825–832. Pardo, B., Mena, M.A., Casarejos, M.J., Paino, C.R., and de Yebenes, J.G. (1995) Toxic effects of l-dopa in mesencephalic cell cultures: protection with antioxidants. Brain Res. 682, 133–143. Urabe, K., Aroca, P., Tsukamoto, K., Mascagna, D., Palumbo, A., Prota, G., and Hearing, V.J. (1994) The inherent cytotoxicity of melanin precursors: a revision. Biochim. Biophys. Acta 1221, 271–278. Poderoso, J.J., Carreras, M.C., Scho¨pfer, F., Lisdero, C., Riobo´, N., Giulivi, C., Boveris, A.D., et al. (1999) The reaction of nitric oxide with ubiquinol; kinetics properties and biological significance. Free Rad. Biol. Med. 26(7/8), 925–935. Floyd, R.A., and Wiseman, B.B. (1979) Spin trapping free radicals in the autooxidation of 6-hydroxydopamine. Biochim. Biophys. Acta 586, 196–207. Olanow, C.W., Jenner, P., and Brooks, D. (1998) Dopamine agonists and neuroprotection in Parkinson’s disease. Ann. Neurol. 44 (suppl 1), S167–S174. Olanow, C.W., Mytilineou, C., and Tatton, W. (1998) Current status of selegiline as a neuroprotective agent in Parkinson’s disease. Mov. Disord. 13 (suppl 1), 55– 58.
NO Overproduction in Parkinson’s Disease
311
62. Palhagen, S., Heinonen, E.H., Hagglund, J., et al. (1998) Selegiline delay the onset of disability in de novo parkinsonian patients. Neurology 51, 520–525. 63. Tatton, W.G. and Chalmers-Redman, R.M.E. (1996) Modulation of gene expression rather than monoamine oxidase inhibition: (1)-deprenyl-related compounds in controlling neurodegeneration. Neurology 47(suppl 3), S171–S183. 64. Gotz, M.E., Dirr, A., Burger, R., Rausch, W.D., and Riederer, P. (1995) High dose selegiline augments striatal ubiquinol in mouse: an indication of decreased oxidative stress or of interference with mitochondrial respiration? A pilot study. J. Neural Transm. (suppl) 46, 149–156. 65. Alam, Z.I., Daniel, S.E., Lees, A.J., Marsden, D.C., Jenner, P., and Halliwell, B. (1997) A generalized increase in protein carbonyls in the brain in Parkinson’s but not incidental Lewy body disease. J. Neurochem. 69(3), 1326–1329. 66. Assreuy, J., Cunha, F.Q., and Liew, F.Y. (1993) Feedback inhibition of nitric oxide synthase activity by nitric oxide. Br. J. Pharmacol. 108, 833. 67. Carreras, M.C., Riobo´, N.A., Pargament, G.A., Boveris, A., and Poderoso, J.J. (1997) Effects of respiratory burst inhibitors on nitric oxide production by human neutrophils. Free Rad. Res. 26, 325–334. 68. Deans, Z., Dawson, S.J., Xie, J., Young, A.P., Wallace, D., and Latchman, D.S. (1996) Differential regulation of the two neuronal nitric oxide synthase gene promoters by the Oct-2 transcription factor. J. Biol. Chem. 271(50), 32153–32158. 69. Gatto, E.M., Riobo´, N.A., Carreras, M.C., and Poderoso, J.J. (1999) J. Neurol. Sci. 165, 66–70.
15 Molecular and Cellular Aspects of Oxidative Damage in Alzheimer’s Disease Mark A. Smith and George Perry Case Western Reserve University, Cleveland, Ohio
I. OVERVIEW Evidence for free radical damage in Alzheimer’s disease includes damage to lipids, proteins, and nucleic acids and is likely a consequence of redox-active metal accumulations, mitochondrial damage, and the formation of advanced glycation end-products. Furthermore, free radical–mediated events are linked to all of the genetic modulators of the disease since β-protein precursor, amyloid-β, presenilins, and apolipoprotein E are associated with reactive oxygen species production or processes intimately associated with oxidative stress such as apoptosis. An involvement of free radicals accounts for the two most striking features of Alzheimer’s disease, namely, the multitude of abnormalities affecting essentially every system and the strict age dependence. Furthermore, in therapeutics, the commonality between a number of efficacious agents appears to be oxidative stress reduction. In this chapter, we present evidence that oxidative stress is the element that links the multitude of changes in Alzheimer’s disease and that a reduction of oxidative stress will have a dramatic effect on reducing the incidence or progression of Alzheimer’s disease. II. INTRODUCTION A number of reports have established damage from reactive oxygen species (ROS) in Alzheimer’s disease (1–10). Now studies are focused on determining 313
314
Smith and Perry
whether oxidative stress is a central process in neurodegeneration or instead a result of the disease process. This distinction is essential to whether therapeutic reduction of oxidative stress will be efficacious. This chapter presents evidence that oxidative damage is among the earliest cytopathological markers of neuronal dysfunction in Alzheimer’s disease and impinges on all of the known pathogenic risk factors for the disease. A.
Alzheimer’s Disease: General Aspects
Alzheimer’s disease, the leading cause of senile dementia, is characterized pathologically by regionalized neuronal death and an accumulation of intraneuronal and extracellular lesions termed neurofibrillary tangles and senile plaques, respectively (11). A number of hypotheses link the pathological changes with, among others, apolipoprotein E genotype (12,13), phosphorylation of cytoskeletal proteins (14), and amyloid-β metabolism (15). However, alone not one of these theories is sufficient to explain the spectrum of abnormalities found in the disease. Additionally, perturbation of these elements in cell or animal models does not result in the same multitude of biochemical and cellular changes. For example, in transgenic rodent models overexpressing β-protein precursor, where amyloidβ plaques are deposited, there is no neuronal loss (16,17). B.
Aging and Oxidative Stress
With regard to Alzheimer’s disease, many theories have failed to recognize that age is a clear contributor in 100% of Alzheimer’s disease cases, whatever the genetic background (18). That the aging process is associated with an increase in the adventitious production of ROS together with a concurrent decrease in the ability to defend against such ROS (19) suggests that oxidative stress may be important in the pathogenesis of Alzheimer’s disease. C.
Oxidative Stress and Alzheimer’s Disease
Oxidative damage in Alzheimer’s disease includes advanced glycation end-products (1,20–22), nitration (8,23), lipid peroxidation adduction products (10,24), and carbonyl-modified protein (4,6,25). Importantly, the oxidative damage extends beyond the lesions to neurons not displaying obvious degenerative change, indicating that this type of damage is an extremely early pathogenic event. Furthermore, the significance of oxidative damage is seen by the upregulation of the antioxidant enzyme heme oxygenase-1 in neurons with neurofibrillary tangles (NFTs) (2,26,27). The production of ROS occurs as a ubiquitous byproduct of both oxidative phosphorylation and the myriad of oxidases necessary to support aerobic metabo-
Oxidative Damage in Alzheimer’s Disease
315
lism. In Alzheimer’s disease, in addition to this background level, there are a number of additional contributory sources that are thought to play an important role in the disease process, including the following: (1) Iron, in a redox-active state, is increased in neurofibrillary tangles as well as in amyloid-β deposits (9,28). (2) Activated microglia, such as those that surround most senile plaques (29), are a source of NO and O 2⫺• (30) which can react to form peroxynitrite, leaving nitrotyrosine as an identifiable marker (8,23). (3) Amyloid-β itself has been directly implicated in the formation of free radicals through peptidyl radicals (31–33). (4) Advanced glycation end-products in the presence of transition metals (see above) can undergo redox cycling with consequent production of free radicals (22,34,35). Furthermore, advanced glycation end-products and amyloid-β activate the receptor for advanced glycation end-products (RAGEs) with consequent production of oxidizing species (36,37). (5) Abnormalities in the mitochondrial genome (38,39) or deficiencies in key metabolic enzymes (40–44) suggest that metabolic abnormalities affecting mitochondria may be the major and possible initiating source of free radicals. D.
Genetic Factors and Oxidative Stress
The influences of amyloid-β and other genetic factors on Alzheimer’s disease may be through their effect on oxidative stress. A number of mechanisms have been invoked for the neurotoxicity of amyloid-β (33); however, the leading hypothesis is that neuronal damage by amyloid-β is mediated by free radicals and, as such, can be attenuated using antioxidants such as vitamin E (45,46) or catalase (47,48). Presenilins 1 and 2 (15,49) are genetic factors where the biological mechanism, although not established, may also involve oxidative damage. Increased presenilin 2 expression increases DNA fragmentation and apoptotic changes (50), both important consequences of oxidative damage. Apolipoprotein E, in brains and cerebrospinal fluid, is found adducted with the highly reactive lipid peroxidation product, hydroxynonenal (51). Furthermore, apolipoprotein E is a strong chelator of copper and iron, important redox-active transition metals (52). Finally, interaction of apolipoprotein E with amyloid-β only occurs in the presence of oxygen (53). E. Therapeutics An important question in discerning whether reducing oxidative stress may have therapeutic value is whether it is a primary or secondary event in disease pathogenesis (5,54). Recent evidence, reviewed above, supports oxidative damage as the earliest cytopathological and biochemical change of Alzheimer’s disease (1,3,6,8,10,20–22). Additionally, agents that inhibit free radical formation reduce both the incidence and the progression of Alzheimer’s disease (55–72). This
316
Smith and Perry
relationship, together with the efficacy of metal chelation treatment (73), strongly suggests that oxidative stress precedes cell and tissue damage and therefore agents that prevent oxidative damage show promise in the treatment of Alzheimer’s disease.
III.
CONCLUSION
In summary, oxidative stress is intimately associated with the pathogenesis of Alzheimer’s disease. Further studies, to examine the types and extent of oxidative damage as well as their source will undoubtedly identify which antioxidant agents will prove most efficacious in future treatment strategies.
ACKNOWLEDGMENTS This work was supported through grants from the National Institutes of Health (AG09287), the American Health Assistance Foundation (AHAF), and the Alzheimer’s Association.
REFERENCES 1. Smith, M.A., Taneda, S., Richey, P.L., Miyata, S., Yan, S.-D., Stern, D., Sayre, L.M., Monnier, V.M. and Perry, G. (1994) Advanced Maillard reaction products are associated with Alzheimer disease pathology. Proc. Natl. Acad. Sci. USA 91, 5710– 5714. 2. Smith, M.A., Kutty, R.K., Richey, P.L., Yan, S.-D., Stern, D., Chader, G.J., Wiggert, B., Petersen, R.B. and Perry, G. (1994) Heme oxygenase-1 is associated with the neurofibrillary pathology of Alzheimer’s disease. Am. J. Pathol. 145, 42–47. 3. Smith, M.A., Sayre, L.M., Monnier, V.M. and Perry, G. (1995) Radical AGEing in Alzheimer’s disease. Trends Neurosci. 18, 172–176. 4. Smith, M.A., Rudnicka-Nawrot, M., Richey, P.L., Praprotnik, D., Mulvihill, P., Miller, C.A., Sayre, L.M. and Perry, G. (1995) Carbonyl-related posttranslational modification of neurofilament protein in the neurofibrillary pathology of Alzheimer’s disease. J. Neurochem. 64, 2660–2666. 5. Smith, M.A., Sayre, L.M., Vitek, M.P., Monnier, V.M. and Perry, G. (1995) Early AGEing and Alzheimer’s. Nature 374, 316. 6. Smith, M.A., Perry, G., Richey, P.L., Sayre, L.M., Anderson, V.E., Beal, M.F. and Kowall, N. (1996) Oxidative damage in Alzheimer’s. Nature 382, 120–121. 7. Smith, M.A., Siedlak, S.L., Richey, P.L., Nagaraj, R.H., Elhammer, A. and Perry, G. (1996) Quantitative solubilization and analysis of insoluble paired helical filaments from Alzheimer disease. Brain Res. 717, 99–108.
Oxidative Damage in Alzheimer’s Disease
317
8. Smith, M.A., Harris, P.L.R., Sayre, L.M., Beckman, J.S. and Perry, G. (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J. Neurosci. 17, 2653–2657. 9. Smith, M.A., Harris, P.L.R., Sayre, L.M. and Perry, G. (1997) Iron accumulation in Alzheimer disease is a source of redox-generated free radicals. Proc. Natl. Acad. Sci. USA 94, 9866–9868. 10. Sayre, L.M., Zelasko, D.A., Harris, P.L.R., Perry, G., Salomon, R.G. and Smith, M.A. (1997) 4-Hydroxynonenal-derived advanced lipid peroxidation end products are increased in Alzheimer’s disease. J. Neurochem. 68, 2092–2097. 11. Smith, M.A. (1998) Alzheimer disease. In: International Review of Neurobiology, Vol. 42 (Bradley, R.J. and Harris, R.A., eds.), Academic Press, San Diego, pp. 1– 54. 12. Corder, E.H., Saunders, A.M., Strittmatter, W.J., Schmechel, D.E., Gaskell, P.C., Small, G.W., Roses, A.D., Haines, J.L. and Pericak-Vance, M.A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261, 921–923. 13. Roses, A.D. (1995) On the metabolism of apolipoprotein E and the Alzheimer diseases. Exp. Neurol. 132, 149–156. 14. Trojanowski, J.Q., Schmidt, M.L., Shin, R.-W., Bramblett, G.T., Goedert, M. and Lee, V.M.-Y. (1993) PHF-τ (A68): From pathological marker to potential mediator of neuronal dysfunction and degeneration in Alzheimer’s disease. Clin. Neurosci. 1, 184–191. 15. Selkoe, D.J. (1997) Alzheimer’s disease: genotypes, phenotypes, and treatments. Science 275, 630–631. 16. Irizarry, M.C., McNamara, M., Fedorchak, K., Hsiao, K. and Hyman, B.T. (1997) APPSw transgenic mice develop age-related A beta deposits and neuropil abnormalities, but no neuronal loss in CA1. J. Neuropathol. Exp. Neurol. 56, 965–973. 17. Irizarry, M.C., Soriano, F., McNamara, M., Page, K.J., Schenk, D., Games, D. and Hyman, B.T. (1997) Aβ deposition is associated with neuropil changes, but not with overt neuronal loss in the human amyloid precursor protein V717F (PDAPP) transgenic mouse. J. Neurosci. 17, 7053–7059. 18. Katzman, R. (1986) Alzheimer’s disease. N. Engl. J. Med. 314, 964–973. 19. Harman, D. (1956) Ageing: a theory based on free radical and radiation chemistry. J. Gerontol. 11, 298–300. 20. Ledesma, M.D., Bonay, P., Colaco, C. and Avila, J. (1994) Analysis of microtubuleassociated protein tau glycation in paired helical filaments. J. Biol. Chem. 269, 21614–21619. 21. Vitek, M.P., Bhattacharya, K., Glendening, J.M., Stopa, E., Vlassara, H., Bucala, R., Manogue, K. and Cerami, A. (1994) Advanced glycation end products contribute to amyloidosis in Alzheimer disease. Proc. Natl. Acad. Sci. USA 91, 4766–4770. 22. Yan, S.-D., Chen, X., Schmidt, A.-M., Brett, J., Godman, G., Zou, Y.-S., Scott, C.W., Caputo, C., Frappier, T., Smith, M.A., Perry, G., Yen, S.-H. and Stern, D. (1994) Glycated tau protein in Alzheimer disease: a mechanism for induction of oxidant stress. Proc. Natl. Acad. Sci. USA 91, 7787–7791. 23. Good, P.F., Werner, P., Hsu, A., Olanow, C.W. and Perl, D.P. (1996) Evidence of neuronal oxidative damage in Alzheimer’s disease. Am. J. Pathol. 149, 21–28.
318
Smith and Perry
24. Montine, T.J., Amarnath, V., Martin, M.E., Strittmatter, W.J. and Graham, D.G. (1996) E-4-Hydroxy-2-nonenal is cytotoxic and cross-links cytoskeletal proteins in P19 neuroglial cultures. Am. J. Pathol. 148, 89–93. 25. Smith, C.D., Carney, J.M., Starke-Reed, P.E., Oliver, C.N., Stadtman, E.R., Floyd, R.A., and Marksberry, W.R. (1991) Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer disease. Proc. Natl. Acad. Sci. USA 88, 10540–10543. 26. Schipper, H.M., Cisse, S. and Stopa, E.G. (1995) Expression of heme oxygenase1 in the senescent and Alzheimer-diseased brain. Ann. Neurol. 37, 758–768. 27. Premkumar, D.R.D., Smith, M.A., Richey, P.L., Petersen, R.B., Castellani, R., Kutty, R.K., Wiggert, B., Perry, G. and Kalaria, R.N. (1995) Induction of heme oxygenase-1 mRNA and protein in neocortex and cerebral vessels in Alzheimer’s disease. J. Neurochem. 65, 1399–1402. 28. Good, P.F., Perl, D.P., Bierer, L.M. and Schmeidler, J. (1992) Selective accumulation of aluminum and iron in the neurofibrillary tangles of Alzheimer’s disease: a laser microprobe (LAMMA) study. Ann. Neurol. 31, 286–292. 29. Cras, P., Kawai, M., Siedlak, S., Mulvihill, P., Gambetti, P., Lowery, D., GonzalezDeWhitt, P., Greenberg, B. and Perry, G. (1990) Neuronal and microglial involvement in β-amyloid protein deposition in Alzheimer’s disease. Am. J. Pathol. 137, 241–246. 30. Colton, C.A. and Gilbert, D.L. (1987) Production of superoxide anions by a CNS macrophage, the microglia. FEBS Lett. 223, 284–288. 31. Butterfield, D.A., Hensley, K., Harris, M., Mattson, M. and Carney, J. (1994) βAmyloid peptide free radical fragments initiate synaptosomal lipoperoxidation in a sequence-specific fashion: implications to Alzheimer’s disease. Biochem. Biophys. Res. Commun. 200, 710–715. 32. Hensley, K., Carney, J.M., Mattson, M.P., Aksenova, M., Harris, M., Wu, J.F., Floyd, R.A. and Butterfield, D.A. (1994) A model for β-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease. Proc. Natl. Acad. Sci. USA 91, 3270–3274. 33. Sayre, L.M., Zagorski, M.G., Surewicz, W.K., Krafft, G.A. and Perry, G. (1997) Mechanisms of neurotoxicity associated with amyloid β deposition and the role of free radicals in the pathogenesis of Alzheimer’s disease. A critical appraisal. Chem. Res. Toxicol. 10, 518–526. 34. Baynes, J.W. (1991) Role of oxidative stress in development of complications in diabetes. Diabetes 40, 405–412. 35. Yan, S.D., Yan, S.F., Chen, X., Fu, J., Chen, M., Kuppusamy, P., Smith, M.A., Perry, G., Godman, G.C., Nawroth, P., Zweier, J.L. and Stern, D. (1995) Nonenzymatically glycated tau in Alzheimer’s disease induces neuronal oxidant stress resulting in cytokine gene expression and release of amyloid β-peptide. Nature Med. 1, 693–699. 36. Yan, S.D., Chen, X., Fu, J., Chen, M., Zhu, H., Roher, A., Slattery, T., Zhao, L., Nagashima, M., Morser, J., Migheli, A., Nawroth, P., Stern, D. and Schmidt, A.M. (1996) RAGE and amyloid-β peptide neurotoxicity in Alzheimer’s disease. Nature 382, 685–691. 37. El Khoury, J., Hickman, S.E., Thomas, C.A., Cao, L., Silverstein, S.C. and Loike,
Oxidative Damage in Alzheimer’s Disease
38.
39.
40. 41.
42.
43. 44. 45.
46. 47.
48.
49.
50.
51.
319
J.D. (1996) Scavenger receptor–mediated adhesion of microglia to β-amyloid fibrils. Nature 382, 716–719. Corral-Debrinski, M., Horton, T., Lott, M.T., Shoffner, J.M., McKee, A.C., Beal, M.F., Graham, B.H. and Wallace, D.C. (1994) Marked changes in mitochondrial DNA deletion levels in Alzheimer brains. Genomics 23, 471–476. Davis, R.E., Miller, S., Herrnstadt, C., Ghosh, S.S., Fahy, E., Shinobu, L.A., Galasko, D., Thal, L.J., Beal, M.F., Howell, N. and Parker, W.D. Jr. (1997) Mutations in mitochondrial cytochrome c oxidase genes segregate with late-onset Alzheimer disease. Proc. Natl. Acad. Sci. USA 94, 4526–4531. Sorbi, S., Bird, E.D. and Blass, J.P. (1983) Decreased pyruvate dehydrogenase complex activity in Huntington and Alzheimer brain. Ann. Neurol. 13, 72–78. Sheu, K.F., Kim, Y.T., Blass, J.P. and Weksler, M.E. (1985) An immunochemical study of the pyruvate dehydrogenase deficit in Alzheimer’s disease brain. Ann. Neurol. 17, 444–449. Sims, N.R., Finegan, J.M., Blass, J.P., Bowen, D.M. and Neary, D. (1987) Mitochondrial function in brain tissue in primary degenerative dementia. Brain Res. 436, 30– 38. Blass, J.P., Baker, A.C., Ko, L. and Black, R.S. (1990) Induction of Alzheimer antigens by an uncoupler of oxidative phosphorylation. Arch. Neurol. 47, 864–869. Parker, W.D. Jr., Filley, C.M. and Parks, J.K. (1990) Cytochrome oxidase deficiency in Alzheimer’s disease. Neurology 40, 1302–1303. Behl, C., Davis, J., Cole, G.M. and Schubert, D. (1992) Vitamin E protects nerve cells from amyloid-β protein toxicity. Biochem. Biophys. Res. Commun. 186, 944– 950. Behl, C., Davis, J.B., Lesley, R. and Schubert, D. (1994) Hydrogen peroxide mediates amyloid β protein toxicity. Cell 77, 817–827. Lockhart, B.P., Benicourt, C., Junien, J.L. and Privat, A. (1994) Inhibitors of free radical formation fail to attenuate direct β-amyloid 25–35 peptide-mediated neurotoxicity in rat hippocampal cultures. J. Neurosci. Res. 39, 494–505. Zhang, Z., Rydel, R.E., Drzewiecki, G.J., Fuson, K., Wright, S., Wogulis, M., Audia, J.E., May, P.C. and Hyslop, P.A. (1996) Amyloid beta-mediated oxidative and metabolic stress in rat cortical neurons: no direct evidence for a role for H 2O2 generation. J. Neurochem. 67, 1595–1606. Sherrington, R., Rogaev, E.I., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Foncin, J.-F., Bruni, A.C., Montesi, M.P., Sorbi, S., Rainero, I., Pinessi, L., Polinsky, R.J., Wasco, W., Da Silva, H.A.R., Haines, J.L., Pericak-Vance, M.A., Tanzi, R.E., Roses, A.D., Fraser, P.E., Rommens, J.M. and St. George-Hyslop, P.H. (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease. Nature 375, 754– 760. Wolozin, B., Iwasaki, K., Vito, P., Ganjei, J.K., Lacana, E., Sunderland, T., Zhao, B., Kusiak, J.W., Wasco, W. and D’Adamio, L. (1996) Participation of presenilin 2 in apoptosis: enhanced basal activity conferred by an Alzheimer mutation. Science 274, 1710–1713. Montine, T.J., Huang, D.Y., Valentine, W.M., Amarnath, V., Saunders, A., Weisgraber, K.H., Graham, D.G. and Strittmatter, W.J. (1996) Crosslinking of apolipo-
320
52.
53.
54. 55. 56.
57.
58.
59.
60.
61.
62.
63. 64.
65.
Smith and Perry protein E by products of lipid peroxidation. J. Neuropathol. Exp. Neurol. 55, 202– 210. Miyata, M. and Smith, J.D. (1996) Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and β-amyloid peptides. Nature Genetics 14, 55–61. Strittmatter, W.J., Weisgraber, K.H., Huang, D.Y., Dong, L.M., Salvesen, G.S., Pericak-Vance, M., Schmechel, D., Saunders, A.M., Goldgaber, D. and Roses, A.D. (1993) Binding of human apolipoprotein E to synthetic amyloid β peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc. Natl. Acad. Sci. USA 90, 8098–8102. Mattson, M.P., Carney, J.W. and Butterfield, D.A. (1995) A tombstone in Alzheimer’s? Nature 373, 481. McGeer, P.L. and Rogers, J. (1992) Anti-inflammatory agents as a therapeutic approach to Alzheimer’s disease. Neurology 42, 447–449. Rogers, J., Kirby, L.C., Hempelman, S.R., Berry, D.L., McGeer, P.L., Kaszniak, A.W., Zalinski, J., Cofield, M., Mansukhani, L., Willson, P. and Kogan, F. (1993) Clinical trial of indomethacin in Alzheimer’s disease. Neurology 43, 1609–1611. Breitner, J.C.S., Gau, B.A., Welsh, K.A., Plassman, B.L., McDonald, W.M., Helms, M.J. and Anthony, J. (1994) Inverse association of anti-inflammatory treatments and Alzheimer’s disease: initial results of a co-twin control study. Neurology 44, 227– 232. Mu¨nch, G., Taneli, Y., Schraven, E., Schindler, U., Schinzel, R., Palm, D. and Riederer, P. (1994) The cognition-enhancing drug tenilsetam is an inhibitor of protein crosslinking by advanced glycosylation. J. Neural Trans-Parkinsons Dis. Dem. Sect. 8, 193–208. Mu¨nch, G., Mayer, S., Michaelis, J., Hipkiss, A.R., Riederer, P., Muller, R., Neumann, A., Schinzel, R. and Cunningham, A.M. (1997) Influence of advanced glycation end-products and AGE-inhibitors on nucleation-dependent polymerization of beta-amyloid peptide. Biochem. Biophys. Acta 1360, 17–29. Rich, J.B., Rasmusson, D.X., Folstein, M.F., Carson, K.A., Kawas, C. and Brandt, J. (1995) Nonsteroidal anti-inflammatory drugs in Alzheimer’s disease. Neurology 45, 51–55. Colaco, C.A., Ledesma, M.D., Harrington, C.R. and Avila, J. (1996) The role of the Maillard reaction in other pathologies: Alzheimer’s disease. Nephrol. Dialysis Transplant. 11 (Suppl 5), 7–12. Kanowski, S., Herrmann, W.M., Stephan, K., Wierich, W. and Horr, R. (1996) Proof of efficacy of the ginkgo biloba special extract EGb 761 in outpatients suffering from mild to moderate primary degenerative dementia of the Alzheimer type or multi-infarct dementia. Pharmacopsychiatry 29, 47–56. Smalheiser, N.R. and Swanson, D.R. (1996) Indomethacin and Alzheimer’s disease. Neurology 46, 583. Stoll, S., Scheuer, K., Pohl, O. and Muller, W.E. (1996) Ginkgo biloba extract (EGb 761) independently improves changes in passive avoidance learning and brain membrane fluidity in the aging mouse. Pharmacopsychiatry 29, 144–149. Thal, L.J., Carta, A., Clarke, W.R., Ferris, S.H., Friedland, R.P., Petersen, R.C., Pettegrew, J.W., Pfeiffer, E., Raskind, M.A., Sano, M., Tuszynski, M.H. and Wool-
Oxidative Damage in Alzheimer’s Disease
66. 67.
68.
69.
70.
71. 72. 73.
321
son, R.F. (1996) A 1-year multicenter placebo-controlled study of acetyl-l-carnitine in patients with Alzheimer’s disease. Neurology 47, 705–711. Henderson, V.W. (1997) The epidemiology of estrogen replacement therapy and Alzheimer’s disease. Neurology 48 (Suppl 7), S27–S35. Kawas, C., Resnick, S., Morrison, A., Brookmeyer, R., Corrada, M., Zonderman, A., Bacal, C., Lingle, D.D. and Metter, E. (1997) A prospective study of estrogen replacement therapy and the risk of developing Alzheimer’s disease: the Baltimore Longitudinal Study of Aging. Neurology 48, 1517–1521. Papasozomenos, S.C. (1997) The heat shock-induced hyperphosphorylation of tau is estrogen-independent and prevented by androgens: implications for Alzheimer disease. Proc. Natl. Acad. Sci. USA 94, 6612–6617. Sano, M., Ernesto, C., Thomas, R.G., Klauber, M.R., Schafer, K., Grundman, M., Woodbury, P., Growdon, J., Cotman, C.W., Pfeiffer, E., Schneider, L.S. and Thal, L.J. (1997) A controlled trial of selegiline, alpha-tocopherol, or both as treatment for Alzheimer’s disease. The Alzheimer’s Disease Cooperative Study. N. Engl. J. Med. 336, 1216–1222. Shoda, H., Miyata, S., Liu, B.F., Yamada, H., Ohara, T., Suzuki, K., Oimomi, M. and Kasuga, M. (1997) Inhibitory effects of tenilsetam on the Maillard reaction. Endocrinology 138, 1886–1892. Skolnick, A.A. (1997) Old Chinese herbal medicine used for fever yields possible new Alzheimer disease therapy. JAMA 277, 776. Stewart, W.F., Kawas, C., Corrada, M. and Metter, E.J. (1997) Risk of Alzheimer’s disease and duration of NSAID use. Neurology 48, 626–631. McLachlan, D.R., Kruck, T.P., Lukiw, W.J. and Krishnan, S.S. (1991) Would decreased aluminum ingestion reduce the incidence of Alzheimer’s disease? Can. Med. Assoc. 145, 793–804.
16 Free Radical–Mediated Disruption of Cellular Ion Homeostasis, Mitochondrial Dysfunction, and Neuronal Degeneration in Sporadic and Inherited Alzheimer’s Disease Mark P. Mattson National Institute on Aging, National Institutes of Health, Bethesda, Maryland
I. MECHANISMS OF GENERATION AND REMOVAL OF REACTIVE OXYGEN SPECIES IN NEURONS As in other cell types, the principal reactive oxygen species (ROS) generated in neurons is superoxide anion radical (O ⫺• 2 ) which arises from the electron transport process in mitochondria (Fig. 1). Neurons express two different superoxide dismutases (Mn-SOD, which is localized in mitochondria, and Cu/Zn-SOD, which is located primarily in the cytoplasm) which convert O ⫺• 2 to hydrogen peroxide (H 2O 2 ). The brain contains high levels of iron which, when in the Fe 2⫹ form, catalyzes the conversion of H 2 O 2 to the highly destructive hydroxyl radical (OH•). Hydroxyl radical is a potent inducer of membrane lipid peroxidation, an autocatalytic process involving propagation of an initial free radical attack on double bonds of polyunsaturated membrane fatty acids. When membrane lipids are peroxidized a toxic aldehyde called 4-hydroxynonenal is liberated which can covalently modify proteins (on cysteine, lysine, and histidine residues) and thereby impair their function (1,2). Protein targets of 4-hydroxynonenal that appear to play a role in its neurotoxic actions are membrane ion-motive ATPases (3,4), glucose transporters (5,6), and glutamate transporters (6,7). Another oxy radical pathway that appears to be a major contributor to neurodegenerative processes involves the interaction of O ⫺• 2 with nitric oxide (NO) resulting in the formation 323
324
Mattson
Figure 1 Mechanisms for production and removal of reactive oxygen species in neurons, and mechanisms responsible for oxidative stress–induced disruption of neuronal ion homeostasis. See text for discussion.
of peroxynitrite, which may damage cells by promoting membrane lipid peroxidation and nitration of proteins on tyrosine residues (8–10). A trigger for O ⫺• 2 and NO production that is particularly important in neurons is calcium influx, such as that induced by glutamate, the major excitatory neurotransmitter in the central nervous system (11,12). Calcium also stimulates phospholipases which liberate arachidonic acid, a target for oxygenases. In addition to production of the various oxy radicals within neurons, ROS arising from other cells and from the environment may be important contributors to oxidative stress in neurons. For example, microglia produce large amounts of NO, O ⫺• 2 , and peroxynitrite when activated (as in response to the presence of amyloid aggregates or neuronal injury), which can be released and adversely affect adjacent cells (13). Microglia may also produce excitotoxins that induce calcium influx and ROS production in neurons.
II. EVIDENCE FOR INCREASED OXIDATIVE STRESS IN THE BRAINS OF AD PATIENTS The regional pattern of neuronal degeneration in the Alzheimer’s disease (AD) brain is such that temporal lobe structures including the entorhinal cortex and
Genetics, Oxy Radicals, and AD
325
hippocampus are affected first, followed by basal forebrain, amygdala, and association cortices (e.g., inferior parietal cortex). Primary motor and sensory cortices, and cerebellum, exhibit little or no neuronal loss, but may contain diffuse amyloid deposits. Levels of protein and DNA oxidation, and membrane lipid peroxidation, are increased in vulnerable regions of AD brain compared to the same brain regions from age-matched controls and to less vulnerable brain regions from the same AD patients (14–16). Immunohistochemical analyses of brain sections from AD patients reveal increased protein oxidation, protein nitration, and lipid peroxidation in neurofibrillary tangles (NFTs) and neuritic plaques (17–19). Moreover, levels of the lipid peroxidation product 4-hydroxynonenal in the ventricular cerebrospinal fluid (CSF) of AD patients were increased approximately threefold compared to age-matched controls (20). Alterations of antioxidant enzymes in vulnerable regions of AD brain have been documented and provide evidence for increased oxidative stress in association with degenerating neurons. For example, catalase protein and activity levels are decreased relative to control brain, while levels of Cu/Zn-SOD and Mn-SOD are increased, in vulnerable (and to a lesser extent in nonvulnerable) regions of AD brain (21). Interestingly, exposure of cultured rat hippocampal neurons to amyloid-β peptide (Aβ) induces time- and dose-dependent decreases in catalase activity and increases in Cu/Zn-SOD and Mn-SOD activities, suggesting a role for Aβ in the altered antioxidant enzyme profile in AD brain (21). Iron levels are increased in degenerating neurons in AD brain (22,23), and there is also evidence for alterations in the iron-binding proteins that normally keep levels of free iron low (24).
III.
CONTRIBUTION OF AMYLOID- PEPTIDE TO OXIDATIVE STRESS AND NEURONAL DEGENERATION IN AD
Amyloid-β peptide (Aβ) is a 40- to 42-amino-acid peptide that is liberated from the β-amyloid precursor protein (APP) via proteolysis by β- and γ-secretases that cleave APP at the N and C termini of Aβ, respectively (Fig. 2). We discovered that Aβ can induce membrane lipid peroxidation and accumulation of hydrogen peroxide in cultured neurons and synaptosomes and that antioxidants (e.g., vitamin E and nordihydroguaiaretic acid) can protect neurons against Aβ toxicity (25–28). The mechanism whereby Aβ induces membrane lipid peroxidation is associated with the propensity of the peptide to form fibrils and likely involves an Fe 2⫹-dependent formation of peptide radicals associated with methionine residue 35 of the peptide. Nonamyloidogenic peptides including Aβ-related peptides with reversed or scrambled sequences and rat amylin do not induce oxidative stress in cultured cells and are not cytotoxic (29).
326
Mattson
Figure 2 Proteolytic processing and biological activities of the amyloid precursor protein. See text for discussion.
Following exposure of cultured hippocampal neurons (3) and cortical synaptosomes (6) to Aβ, the toxic aldehyde 4-hydroxynonenal is produced and can be shown to covalently modify a variety of cellular proteins as detected by western blot and immunocytochemical analyses using antibodies against 4-hydroxynonenal-protein adducts (Fig. 3). Covalent modification of proteins by 4-hydroxynonenal occurs on cysteine, lysine, and histidine residues via a process called Michael addition; 4-hydroxynonenal also undergoes Schiff base chemistry with proteins. 4-Hydroxynonenal appears to be a key mediator of neuronal injury and death induced by Fe 2⫹ , amyloidogenic peptides, and other conditions that induce lipid peroxidation. Thus, exposure of cultured hippocampal neurons to Aβ or Fe 2⫹ results in production of 4-hydroxynonenal at levels of 1–10 µM, and such concentrations of pure 4-hydroxynonenal can cause synaptic degeneration and neuronal death (3,6). Glutathione, a tripeptide with a cysteine residue, is a very
Genetics, Oxy Radicals, and AD
327
Figure 3 Generation of, and protein modification by, 4-hydroxynonenal (HNE) in neurons exposed to Aβ and oxidative insults. The western blot at the left shows immunoreactivity of proteins in synaptosomes with an antibody against HNE-modified proteins. Synaptosomes had been left untreated (con) or had been exposed to FeSO 4 or HNE. Note that endogenous and exogenous HNE covalently modifies many different proteins. The blots at the right are from experiments in which either the Na ⫹ /K ⫹-ATPase protein or the GTP-binding protein Gq11 were immunoprecipitated and reacted with an antibody against HNE.
important antioxidant that can bind and detoxify 4-hydroxynonenal, and thereby protects neurons against the toxicities of Aβ, Fe 2⫹ , and hydroxynonenal (3,30). 4-Hydroxynonenal may play a particularly prominent role in a form of cell death called apoptosis in which a cell shrinks, and nuclear chromatin condensation and DNA fragmentation occurs (30). Accordingly, antioxidants that suppress membrane lipid peroxidation, including vitamin E, propyl gallate, 17β-estradiol, and uric acid, prevent Aβ-induced apoptosis (3–7,10,25–31).
IV.
OXIDATIVE IMPAIRMENT OF MEMBRANE ION-MOTIVE ATPases, GLUCOSE AND GLUTAMATE TRANSPORTERS: A FUNDAMENTAL STEP IN THE NEURODEGENERATIVE PROCESS IN AD
In a series of studies performed during the past 8 years we found that amyloidogenic peptides, including Aβ, human amylin, and β 2-microglobulin, can disrupt cellular calcium homeostasis resulting in progressive increases in cytoplasmic free calcium levels (3,27,29,32–35). We found that a particularly striking consequence of Aβ’s adverse effects on cellular calcium homeostasis was its ability to render neurons vulnerable to excitotoxicity, a cell death process that involves
328
Mattson
massive calcium influx through glutamate receptors, the most prominent excitatory neurotransmitter receptors in the central nervous system (3,32,33). Treatment of cultured neurons, as well as other cell types vulnerable to Aβ toxicity (e.g., vascular endothelial cells), with intracellular calcium chelators (e.g., BAPTA-AM) or agents that block voltage-dependent calcium channels (e.g., nifedipine), can protect the cells from being killed by Aβ and other amyloidogenic peptides, demonstrating a central role for calcium overload in the cell death process (29,33,35–37). How does oxidative stress, such as that induced by Aβ and Fe 2⫹ , disrupt neuronal ion homeostasis? We found that Aβ impairs the function of Na ⫹ /K ⫹ATPase and Ca 2⫹-ATPase in cultured rat hippocampal neurons, and in rat cortical and human hippocampal synaptosomes (4,27,38). Antioxidants that suppress lipid peroxidation (vitamin E, propyl gallate, and 17β-estradiol) prevented impairment of ion-motive ATPases by Aβ, indicating an important role for lipid peroxidation in the mechanism of action of Aβ. Lipid peroxidation was sufficient to account for impairment of the function of these ion-motive ATPases because exposure of cultured neurons and synaptosomes to Fe 2⫹ mimicked the effects of Aβ on the ATPase activities (4,27). Additional findings suggest a key role for 4hydroxynonenal in impairment of ion-motive ATPases by Aβ and Fe 2⫹ . Exposure of synaptosomes and cultured rat hippocampal neurons to 4-hydroxynonenal impaired Na ⫹ /K ⫹-ATPase activity and increased neuronal vulnerability to excitotoxicity (3,6). The Na ⫹ /K ⫹-ATPase and the Ca 2⫹-ATPase appear to be particularly sensitive to impairment by lipid peroxidation because other membraneassociated Mg 2⫹-ATPases were not adversely affected by Fe 2⫹ or Aβ. Our findings suggest a scenario in which amyloidogenic peptides induce membrane lipid peroxidation and 4-hydroxynonenal production, resulting in impairment of the Na ⫹ /K ⫹-ATPase which in turn promotes membrane depolarization and thereby sensitizes neurons to excitotoxicity (Fig. 1). Impairment of the plasma membrane Ca 2⫹-ATPase compromises the ability of the cells to restore intracellular calcium levels to basal levels and thereby contributes to calcium overload and cell death. Neurons rely on a constant supply of glucose, which is the substrate critical for production of the ATP required for maintenance of ion homeostasis in such highly excitable cells. Glucose uptake in the brain is mediated by the specific membrane transport proteins GLUT-1 (located mainly in endothelial cells) and GLUT-3 (located in neurons) (39). A striking finding in clinical studies of AD patients is that glucose uptake into brain cells is greatly reduced (40), which appears to be associated with decreased levels and/or activities of glucose transporters in vascular endothelial cells and neurons (41). We have provided evidence that Aβ and membrane lipid peroxidation play roles in impairing glucose transport in AD brain cells. Thus, exposure of cultured hippocampal neurons and cortical synaptosomes to Aβ results in time- and dose-dependent decreases in
Genetics, Oxy Radicals, and AD
329
glucose transport (4–6). Vitamin E, 17β-estradiol, and glutathione prevented impairment of glucose transport by Aβ, indicating an important role for membrane lipid peroxidation and 4-hydroxynonenal in the action of Aβ. Increased lipid peroxidation is sufficient to impair glucose transport as demonstrated in experiments in which cultured neurons and synaptosomes were exposed to Fe 2⫹ (4– 6). Exposure of cultured hippocampal neurons to 4-hydroxynonenal also impaired glucose transport (5). It is likely that 4-hydroxynonenal impairs glucose transport by directly modifying the glucose transport protein because immunoprecipitation–western blot analysis showed that 4-hydroxynonenal covalently binds to GLUT-3 following exposure of cultured neurons to Aβ or Fe 2⫹ (5). Interestingly, in addition to impairing glucose transport in neurons, Aβ can impair glucose transport in vascular endothelial cells (37), suggesting that any circulating amyloidogenic peptide (or aggregated peptide that accumulates in the cerebral vessels) has the potential to impair endothelial cell membrane transporters. The major mechanism for removal of potentially toxic glutamate from the extracellular fluid is via uptake into astrocytes (42). Exposure of synaptosomes to Aβ results in concentration- and time-dependent decreases in radiolabeled glutamate uptake into the nerve endings (6). Glutamate transport is also sensitive to impairment by Fe 2⫹ , and vitamin E and 17β-estradiol prevent impairment of glutamate transport by Aβ and Fe 2⫹ indicating a central role for lipid peroxidation. 4-Hydroxynonenal covalently modifies the astrocyte glutamate transporter GLT-1 suggesting a key role for this aldehyde in the adverse effect of lipid peroxidation on glutamate transport (7). These findings suggest that in AD impairment of astrocyte glutamate transport by oxidative stress, in combination with impaired ion-motive ATPase and glucose transport in neurons, may render neurons extraordinarily vulnerable to excitotoxicity.
V.
IMPACT OF OXIDATIVE STRESS ON MITOCHONDRIA AND THE ENDOPLASMIC RETICULUM IN AD
Mitochondrial dysfunction has been proposed to play a role in the pathogenesis of AD (43). Levels of cytochrome c oxidase activity and α-ketoglutarate dehydrogenase complex activity are decreased in brain tissue from AD patients (44,45). These mitochondrial alterations may precede the neurodegenerative process because similar mitochondrial metabolic deficits in fibroblasts and blood cells from AD patients (46,47). Exposure of cultured neurons or cortical synaptosomes to Aβ causes mitochondrial dysfunction as indicated by a decreased level of 3(4,5dimethylthiazal-2-yl)2,5-diphenyltetrazolium bromide (MTT) reduction and mitochondrial membrane depolarization (6,10,30,38). Mitochondrial membrane potential is maintained following exposure to Aβ in neurons pretreated with antioxidants including glutathione ethyl ester, vitamin E, and 17β-estradiol. The ac-
330
Mattson
tivity of mitochondrial membrane–associated enzymes such as succinate dehydrogenase is also decreased following exposure of cells to Aβ (48), which may be caused by oxidative stress and thereby play a role in the decreased ATP production that occurs in neurons exposed to Aβ (5). Superoxide production in mitochondria appears to play a particularly important role in neuronal damage and death in AD. In addition to superoxide being critical for the increased levels of peroxynitrite and membrane lipid peroxidation, repeatedly demonstrated in AD brain tissue, experimental studies have shown the necessity of superoxide production and peroxynitrite formation for the neurotoxicity of Aβ. Thus, overexpression of Mn-SOD in cultured neural cells results in resistance of these cells to death induced by Aβ and nitric oxide donors (10), and induction of Mn-SOD expression in primary hippocampal neurons appears to be central to the neuroprotective effect of tumor necrosis factor (9). Moreover, the peroxynitrite scavenger uric acid is very effective in protecting neurons against Aβ toxicity, and excitotoxic and metabolic insults (10,31). Mitochondria play important roles in neuronal calcium homeostasis (49), and this important function of mitochondria is likely to be disrupted as the result of oxidative stress in AD. The endoplasmic reticulum plays important roles in protein synthesis and export, and in regulation of cellular calcium homeostasis. We have found that agents that block calcium release from the endoplasmic reticulum (e.g., dantrolene) can protect cultured neural cells against apoptosis induced by Aβ (50,51), suggesting a role for impaired calcium regulation in this organelle in the pathogenesis of neuronal degeneration in AD (Fig. 4). As will be described in detail below, recent findings suggest that presenilin proteins (mutations in presenilins are causally linked to early-onset inherited AD) are localized in the endoplasmic reticulum wherein they may modulate calcium regulation (52). The endoplasmic reticulum is also a likely site for perturbed APP metabolism, which may result in increased production of neurotoxic forms of Aβ (53). It will therefore be of considerable interest to examine the impact of oxidative stress on the various functions of the endoplasmic reticulum that are relevant to the pathogenesis of AD.
VI.
OXIDATIVE STRESS AND NEURONAL DYSFUNCTION: CHOLINERGIC SYSTEMS AS AN EXAMPLE
An early and prominent neurochemical deficit in AD is impaired muscarinic cholinergic signaling, which is associated with reduced acetylcholine production and impaired coupling of muscarinic receptors to the GTP-binding protein G q11 (54). Roles for oxidative stress in these cholinergic alterations are suggested by several recent findings. Aβ can impair acetylcholine synthesis and/or release from cholinergic neurons in vivo. Abe et al. (55) reported that intraparenchymal administration of Aβ into the basal forebrain of adult rats decreases release of acetylcholine
Genetics, Oxy Radicals, and AD
331
Figure 4 Evidence that perturbed calcium homeostasis in the endoplasmic reticulum enhances oxidative stress and increases vulnerability of neurons to Aβ and excitotoxicity. (A) Intracellular free calcium levels were measured in the indicated cell lines prior to (Basal) and following exposure to the muscarinic agonist carbachol or thapsigargin, an inhibitor of the endoplasmic reticulum ATPase. Parent, untransfected; Vector, transfected with empty vector; WTPS1, cells overexpressing wild-type human presenilin-1; mutant PS-1, cells overexpressing the L286V presenilin-1 mutation. (Modified from Ref. 50.) (B) PC6 cells overexpressing wild-type (WT) or mutant (M146V) PS-1 alone, or in combination with Mn-SOD, were exposed to 50 µM Aβ1-42. The percentage of cells with apoptotic nuclei was quantified 48 h following exposure to Aβ1-42, and relative levels of hydroethidine fluorescence (a measure of superoxide levels) were quantified 12 h later. Values are the mean of determinations made in four separate cultures. (Modified from Ref. 166.)
332
Mattson
from the hippocampus. Harkany et al. (56) found that Aβ1-42 causes a decrease in choline acetyltransferase (ChAT) immunoreactive neurons within the basal forebrain and a reduction in ChAT immunoreactive axons in cerebral cortex. Aβ can also impair both acetylcholine production and release in cultured cells and brain tissue preparations (57,58). Muscarinic cholinergic receptors are linked to activation of GTP-binding proteins of the G q/11 family which, when activated, stimulate the membraneassociated enzyme phospholipase C. Phospholipase C catalyzes the hydrolysis of phosphatidylinositol bisphosphate, resulting in liberation of inositol triphosphate (IP 3 ) and diacylglycerol (Fig. 5). IP 3 binds to receptors in the endoplasmic reticulum resulting in calcium release, while diacylglycerol activates protein kinase C. Several different laboratories have shown that responses to muscarinic agonists
Figure 5 Mechanisms involved in oxidative disruption of cholinergic signaling. See text for discussion.
Genetics, Oxy Radicals, and AD
333
are diminished in brain cell membranes from AD patients (59–62). We found that exposure of cultured cortical neurons to Fe 2⫹ or Aβ results in impairment of carbachol (muscarinic agonist)–induced GTPase activity, without affecting agonist binding to the receptors (63). The ability of carbachol to induce inositol phosphate production and calcium release from the endoplasmic reticulum was also impaired in cortical neurons exposed to oxidative insults. Impairment of receptor–G protein coupling following exposure of neurons to Fe 2⫹ and Aβ was prevented by vitamin E, indicating a necessary role for membrane lipid peroxidation (63). Blanc et al. (64) further showed that 4-hydroxynonenal can covalently modify G q11 and prevent its coupling to muscarinic cholinergic and metabotropic glutamate receptors. Li et al. (65) reported that exposure of a cultured human neuroblastoma cell line to H 2 O 2 results in an inhibition of carbachol-induced inositol phospholipid hydrolysis and activation of the transcription factor AP-1. Additional data in the latter study indicated that H 2 O 2 exposure impairs G-protein function. Glutathione depletion greatly exacerbated the impairment of cholinergic signaling in neuroblastoma cells (66), consistent with a role for 4-hydroxynonenal in impairment of G-protein function (64). Additional findings from in vivo studies suggest that lipid peroxidation and 4-hydroxynonenal production play important roles in age- and AD-related deficits in muscarinic cholinergic signaling. Maintenance of rats on a reduced calorie diet (a well-established method for for increasing lifespan in rodents) suppresses age-related deficits in muscarinic signaling (67) by a mechanism likely involving reduced oxidative stress (68). We have found that rats maintained on a foodrestricted diet exhibit increased resistance of hippocampal and striatal neurons to excitotoxic and metabolic insults, and improved behavioral outcome, suggesting a protective effect of food restriction against age-related neurodegenerative processes (69). Antioxidant supplementation in aged rats may improve performance in learning and memory tasks dependent cholinergic signaling (70). On the other hand, increased levels of membrane lipid peroxidation and 4hydroxynonenal decrease ChAT levels, damage basal forebrain cholinergic neurons, and impair visuospatial memory in adult rats (71). Various oxidative insults in vivo have also been shown to impair muscarinic receptor–G protein coupling (62,72). Behavioral correlates of oxidative stress–induced deficits in acetylcholine production and muscarinic signal transduction are further suggested by studies showing that infusion of Aβ into the lateral ventricles of adult rats results in impaired performance on learning and memory tasks which are correlated with deficits in cholinergic transmission (73,74). Neurotransmitters may themselves be a source of oxidative stress in several different neurodegenerative disorders including AD. We have found that norepinephrine and dopamine can induce oxidative stress in cultured hippocampal neurons and can greatly increase their vulnerability to Aβ toxicity (75). Subtoxic levels of catecholamines exacerbated Aβ-induced mitochondrial dysfunction and
334
Mattson
membrane depolarization. Vitamin E, glutathione ethyl ester, and propyl gallate protected neurons against the damaging effects of Aβ and catecholamines, whereas the β-adrenergic receptor antagonists and dopamine (D1) receptor antagonists were ineffective. The catecholamines also exacerbated the disruption of neuronal calcium homeostasis caused by Aβ. Immunohistochemical analyses of brain tissue from AD patients revealed the presence of dopamine β-hydroxylasepositive neurites in senile plaques. The collective data therefore suggest a role for catecholamine-related oxidative stress in the pathogenesis of AD.
VII. GENETIC ABBERRANCIES AND OXIDATIVE STRESS IN AD The majority of cases of AD are not caused by a specific genetic defect and are characterized by a relatively late age of onset, typically in the range of 65–85 years. However, in some families individuals develop AD symptoms at an early age, usually when they are in their 30s, 40s, and 50s. Such inherited familial AD (FAD) cases account for approximately 15% of all AD cases (76). Recent studies have identified the genetic defects responsible for some cases of FAD (Table 1). At least five different chromosomes (chromosomes 1, 12, 14, 17, and 21) harbor defective genes that cause AD. The APP gene located on chromosome 21 is mutated at amino acids within and adjacent to the Aβ sequence, and such mutations appear to alter proteolytic processing of APP such that levels of Aβ are increased and levels of soluble sAPP are decreased (53). An important advance in the AD field was the identification of two homologous genes, presenilin-1 (chromosome 14) and presenilin-2 (chromosome 1), that harbor mutations responsible for the most vigorous (earliest age of onset) forms of AD (77). The AD-linked genes on chromosomes 12 and 17 have yet to be identified, although recent findings suggest that α 2-macroglobulin is the culprit on chromosome 12 (78) and that tau is the affected gene on chromosome 17 (79).
Table 1 Genetic Factors That Cause or Increase the Risk for Alzheimer’s Disease Factor
Gene
Chromosome
Age of onset
Causal
Amyloid precursor protein Presenilin-1 Presenilin-2 Apolipoprotein E4 α 2-Macroglobulin Bleomycin hydrolase
21 14 1 19 12 17
45–65 28–50 40–55 65–85 65–85 65–85
Risk
Genetics, Oxy Radicals, and AD
335
Missense mutations in APP, resulting in either a single-amino-acid change at codon 717 (‘‘London’’ mutation) or a two-amino-acid substitution at codons 670 and 671 (‘‘Swedish’’ mutation), cause AD. The mutations are located immediately N-(Swedish mutation) or C-terminal (V717F) to the Aβ sequence. Additional APP mutations are at codons 692 (‘‘Flemish’’ mutation) or 693 (‘‘Dutch’’ mutation), which lie within the Aβ sequence. Cleavage of APP in the middle of the Aβ sequence, effected by an enzyme called α-secretase, results in release of a secreted form of APP called sAPPα from cells. In neurons APP is axonally transported and data suggest that high levels of sAPPα are released from axon terminals. The α-secretase cleavage prevents production of intact and therefore potentially amyloidogenic Aβ. The α-secretase cleavage is induced when neurons are electrically active, and our studies have shown that sAPPα plays important roles in modulating neuronal excitability and synaptic plasticity (80–83). A role for sAPPα in reducing oxidative stress in neurons is suggested by data showing that sAPPα can protect cultured neurons against oxidative, excitotoxic, and metabolic insults (25,81,84). An alternative cleavage of APP at the N terminus of the Aβ sequence (by β-secretase) leaves a membrane-associated fragment that contains intact Aβ that can be further cleaved at the C terminus (by γ-secretase), resulting in the release of Aβ. As described above, Aβ induces membrane lipid peroxidation, disruption of membrane transporters, and increases intracellular calcium levels in neurons. To date, 45 mutations in presenilin-1 and two mutations in presenilin-2 have been reported in familial AD kindreds. With few exceptions, all of the presenilin mutations are missense in nature, resulting in a single-amino-acid substitution. Presenilins are integral membrane proteins with 8 transmembrane domains and a hydrophilic loop located on the same side of the membrane as the N and C termini (52,77). The mutations tend to cluster in two regions of the presenilin protein, one in and adjacent to putative transmembrane domain 2, and the other adjacent to the hydrophilic loop domain (Fig. 6). Presenilins are widely expressed in the nervous system where they are at particularly high levels in neurons (85,86). Analyses of the subcellular localization of presenilins suggest that they are present primarily in the endoplasmic reticulum (50,87). The normal function(s) of presenilins are unclear, but they do appear to play important roles in regulation of body segmentation during development (88,89). Presenilin mutations may promote increased oxidative stress in neurons by several interrelated mechanisms. One mechanism involves aberrant processing of APP resulting in increased levels of neurotoxic Aβ1-42 (90–92) and decreased levels of neuroprotective sAPPα (93,94). Aβ1-42 forms fibrils more readily than does Aβ1-40, and also exhibits increased neurotoxicity. Data suggest that Aβ itself (particularly Aβ1-42) may be a source of oxy radicals upon interaction with pathophysiologically relevant concentrations of oxygen and iron (25,53,95). It is
336
Mattson
Figure 6 Presenilin structure and possible pathogenic actions of presenilin mutations. (A) Presenilins are integral membrane proteins believed to have eight transmembrane domains. They are localized mainly in the endoplasmic reticulum (ER), with their N and C termini and a loop region residing on the cytoplasmic side of the membrane. Two different enzymatic cleavage sites have been identified in the cytoplasmic loop region of presenilins: an endoproteolytic (constitutive cleavage) site and a caspase cleavage site. Missense mutations are located in several different regions of presenilins, with clusters of mutations (mut) occurring in the region of transmembrane 2 and in the cytoplasmic loop region. Phosphorylation sites are present in the C-terminal region of presenilins (*). (B) Primary actions of presenilin mutations may include perturbed calcium regulation in the endoplasmic reticulum and altered APP processing. These alterations lead to increased reactive oxygen species (ROS) production, impairment of membrane transporters, and increased activation of glutamate receptors resulting in further increases of intracellular calcium levels and ROS. ROS and calcium lead to impaired mitochondrial function, activation of caspases, and apoptosis.
Genetics, Oxy Radicals, and AD
337
unclear as to how presenilin mutations increase Aβ1-42 production. Presenilins might directly interact with APP (96,97) or might indirectly affect APP processing by increasing levels of endoplasmic reticulum ‘‘stress’’ (51). We have found that a prominent adverse effect of presenilin mutations in neurons is to perturb calcium regulation in the endoplasmic reticulum in a manner that increases neuronal vulnerability to cell death induced by trophic factor withdrawal and various metabolic and oxidative insults (50,51,98). Calcium imaging studies showed that agonist-induced calcium release from endoplasmic reticulum is enhanced in neural cells expressing mutant presenilin-1 (50). Calcium release in response to thapsigargin, an inhibitor of the ER Ca 2⫹-ATPase, was also enhanced in cells expressing presenilin-1 mutations, suggesting an increased endoplasmic reticulum calcium pool in those cells. Presenilin-1 mutations alter nerve growth factor (NGF)–induced differentiation of PC12 cells, and this alteration is associated with abnormalities in cellular calcium homeostasis and transcription factor AP-1 activation (99). It is not known whether presenilins normally play a role in regulating neuronal calcium homeostasis. However, the important roles of calcium in the regulation of neuronal development and synaptic plasticity suggest that perturbations of calcium homeostasis may be an important consequence of presenilin mutations that results in premature age-related synaptic dysfunction and neuronal degeneration. Apoptosis is an active form of cell death in which cells shrink and exhibit nuclear chromatin condensation and DNA fragmentation, but maintain membrane integrity. Two general mechanisms responsible for apoptosis are induction of the expression of ‘‘death genes’’ and reduced activation of antiapoptotic signaling pathways (100). Studies of postmortem brain tissue from AD patients (101,102) and of the neurotoxic actions of Aβ in cultured neurons (27,30,103) suggest a role for apoptosis in AD. Overexpression of presenilin-1 mutations in cultured PC12 cells increases their vulnerability to apoptosis induced by exposure to Aβ, trophic factor withdrawal, and mitochondrial toxins (50,51,98,104). Presenilin2 mutations may also result in increased vulnerability to cells to apoptosis (105). The apoptosis-enhancing action of presenilin mutations appears to involve perturbation of calcium signaling and calcium overload because drugs that block calcium influx or release, or buffer cytoplasmic calcium protect cells expressing presenilin mutations against apoptosis (50,51). Moreover, overexpression of the calcium-binding protein calbindin D28k counteracts the apoptosis-enhancing action of presenilin-1 mutations in PC12 cells (98). Markers of oxidative stress including accumulation of superoxide anion radical, hydrogen peroxide, and peroxynitrite are increased in PC12 cells expressing presenilin-1 mutations following exposure to Aβ, trophic factor withdrawal, or mitochondrial toxins (51,98,104). PC12 cells expressing mutant presenilin-1 are very sensitive to mitochondrial membrane depolarization and metabolic failure following exposure to Aβ or the mitochondrial toxin 3-nitropropionic acid, suggesting a widespread defect in cal-
338
Mattson
cium handling and oxy radical metabolism (98,104). Thus, increased levels of oxidative stress and impaired mitochondrial function may represent pivotal events in the pathogenic action of presenilin mutations. A novel gene product called Par-4, which may participate in neuronal apoptosis in AD, was recently identified (106). Par-4 (prostate apoptosis response 4) was identified by differential screening of genes induced in prostate tumor cells undergoing apoptosis and was shown to function as a death-promoting signal in those cells (107). Par-4 mRNA and protein levels are greatly increased in AD brain tissue, and immunohistochemical analyses indicate that Par-4 is localized in many neurofibrillary tangle-bearing neurons but not in neurons in the brains of neurologically normal patients (106). Par-4 protein levels rapidly increase in cultured rat hippocampal neurons following exposure to Aβ1-42, and Par-4 antisense treatment protects the hippocampal neurons against apoptosis (106). In PC12 cells the apoptosis-enhancing action of presenilin-1 mutations can be blocked by overexpression of a dominant-negative Par-4 leucine zipper domain, indicating that Par-4 participates in the pathogenic mechanism of the presenilin mutations (106). Interestingly, sAPP can protect cultured neural cells against the proapoptotic action of presenilin-1 mutations (94). PC12 cells expressing mutant presenilin-1 are relatively resistant to Aβ-induced apoptosis when pretreated with sAPPα. sAPPα stabilized intracellular calcium levels, suppressed oxidative stress, and prevented mitochondrial dysfunction normally observed in cells expressing mutant presenilin-1 following exposure of cells to Aβ (94). Additional analyses indicate that the mechanism whereby sAPPα protects PC12 cells against the adverse effects of presenilin-1 mutations appears to involves activation of NF-κB (94), a transcription factor previously shown to prevent neuronal apoptosis (9,108,109). We recently employed an exon exchange approach to generate presenilin1 mutant knock-in mice (110). Exons 4 and 5 of the human presenilin-1 gene harboring the AD-linked M146V mutation were introduced into the mouse presenilin-1 gene resulting in mice expressing no wild-type mouse presenilin-1, and expressing the mutant presenilin-1 gene at normal levels. Primary hippocampal neurons from presenilin-1 mutant knock-in mice exhibit increased vulnerability to excitotoxicity, which is correlated with perturbed increased oxy radical production and mitochondrial dysfunction (110). Pretreatment with either basic fibroblast growth factor (bFGF) or activity-dependent neurotrophic factor (ADNF) protected neurons expressing mutant presenilin-1 against excitotoxicity (Fig. 7). Both bFGF and ADNF abrogated the increased oxy radical production and mitochondrial dysfunction otherwise caused by the presenilin-1 mutation. These findings suggest that increased neuronal vulnerability to excitotoxicity may contribute to the pathogenic action of presenilin-1 mutations, and neurotrophic factors may counteract the adverse property of such AD-linked mutations. Taken to-
Genetics, Oxy Radicals, and AD
339
Figure 7 Neurotrophic factors protect neurons from presenilin-1 mutant knock-in mice against oxidative stress induced by an excitotoxic insult. Hippocampal cultures from wildtype mice and presenilin-1 mutant knock-in mice were left untreated, or were pretreated for 24 h with vehicle, 100 ng mL bFGF or 0.1 pM ADNF9. Cultures were then exposed for 4 h to 100 µM glutamate and levels of dihydrorhodamine 123 fluorescence (A; a measure of peroxynitrite levels) and TBARS fluorescence (B; a measure of membrane lipid peroxidation) were quantified. Values are the mean of determinations made in four to six cultures. (Modified from Ref. 110.)
340
Mattson
gether with the abundant literature on neuroprotective actions of trophic factors (100) and the finding that some trophic factors can protect hippocampal neurons against Aβ toxicity (33), the data suggest that stimulating neurotrophic signaling pathways may prove beneficial in suppressing the neurodegenerative process in AD. Beyond their ability to increase neuronal vulnerability to apoptosis and excitotoxicity, presenilin mutations may perturb physiological signaling pathways in neurons. ChAT levels were greatly decreased in PC12 cells expressing mutant presenilin-1 compared to control PC12 cell lines and to lines overexpressing wild-type presenilin-1 (111). The adverse effect of mutant presenilin-1 on ChAT levels may be relevant to the well-documented deficits in ChAT and acetylcholine in basal forebrain cholinergic neurons and their cortical and hippocampal targets in AD. Another signaling pathway altered in cells expressing mutant presenilin-1 involves NF-κB (94). PC12 cells expressing mutant presenilin-1 exhibit altered kinetics of NF-κB activation following exposure to either ligands that activate NF-κB or following exposure to oxidative insults. The initial peak of NF-κB activation is greater in cells expressing mutant presenilin-1, and this is followed by a sustained suppression of NF-κB activity which correlates with increased vulnerability to apoptosis (94). Presenilins have also been suggested to function in the Notch signaling pathway (88,89) and in the Wg/Wnt signaling pathway (112).
VIII. GENETIC RISK FACTORS AND OXIDATIVE STRESS IN AD AD is an invariant component of the Down syndrome complex, as these individuals develop classic AD pathology including Aβ deposition, neurofibrillary tangles, and synapse loss (113). Because Down syndrome is caused by trisomy 21, efforts have focused on determining which gene(s) on that chromosome is responsible for the abnormal phenotype (114). In addition to the APP gene, the gene encoding Cu/Zn-SOD is on chromosome 21. Overexpression of human Cu/ZnSOD in mice results in a phenotype that includes some features of Down syndrome, although the mice do not exhibit amyloid deposition or neurofibrillary degeneration (115). A fundamental defect in oxy radical metabolism is suggested by the finding that embryonic cortical neurons from Down syndrome fetuses exhibit spontaneous apoptosis associated with increased levels of oxidative stress (116). Glial cells from trisomy 16 mice (mice with phenotypic similarities to Down patients) exhibit increased rest levels of cytoplasmic calcium, and markedly increased calcium release from endoplasmic reticulum in response to agonists that activate the IP 3 pathway (117). These findings are of considerable inter-
Genetics, Oxy Radicals, and AD
341
est in light of the evidence that mutations in APP and presenilins also perturb cellular calcium homeostasis and enhance oxidative stress (see above). The data suggest that similar cascades of events, involving increased oxidative stress and dysregulation of calcium homeostasis, occur in both Down syndrome and AD. Polymorphisms in the genes encoding apolipoprotein E can influence the age of onset of sporadic AD (118). Individuals with the E4 isoform of apolipoprotein E (there are three: E2, E3, and E4) have an increased risk of developing AD at an early age. The E4 allele also increases the risk for atherosclerosis (119), and a vascular mechanism for increased risk of AD in persons with the E4 allele is possible (120). Apolipoproteins may also have direct effects on brain cells. Apolipoprotein E affects neurite outgrowth and cell survival in cultured neurons (121). In addition, astrocytes produce apolipoprotein E and its expression is increased during nerve cell degeneration and regeneration (122), suggesting a role for apolipoprotein E in the brain’s response to injury. Apolipoprotein E is present in amyloid plaques in AD, and interactions of apolipoprotein E isoforms with Aβ have been documented (123,124) suggesting that apolipoprotein E plays a role in Aβ deposition and/or clearance from the brain. Interestingly, it was reported that apolipoprotein E has antioxidant actions (125), which might explain data showing that apolipoproteins can protect neurons against Aβ toxicity and other insults in an isoform-dependent manner (126,127). We and others have found that oxidized low-density lipoprotein can damage and kill cultured neurons (128,129), although it remains to be determined whether oxidized low-density lipoprotein contributes the neurodegenerative process in AD. Increased risk for AD has also been linked to the genes encoding bleomycin hydrolase on chromosome 17 (130) and α 2-macroglobulin on chromosome 12 (78). Analyses of frequencies of a polymorphism at codon 1450 (A to G substitution) of bleomycin hydrolase revealed a strong correlation with incidence of lateonset AD. Bleomycin hydrolase is a cysteine protease in the papain superfamily that exhibits aminopeptidase and endopeptidase activities. In theory, alterations in bleomycin hydrolase activity might impact on the various alterations of proteolytic mechanisms documented in AD, including altered APP processing. A fivebase deletion in exon 2 of α 2-macroglobulin confers increased risk for AD (78). α 2-Macroglobulin is a protease inhibitor, is a major ligand for the lipoprotein receptor-related protein, and may play roles in modulating Aβ aggregation and clearance (131,132), thereby indirectly promoting oxidative stress. It is also conceivable that AD-linked polymorphisms in apolipoprotein E and α 2-macroglobulin may enhance oxidative stress and dysfunction of the vascular endothelium, thereby reducing energy availability to neurons (37). Alterations in mitocondrial DNA may also influence the risk for AD. Some mitochondrial proteins are encoded by genes in the cell nucleus, whereas others are encoded by DNA located within the mitochondria. Mitochondrial DNA is
342
Mattson
constantly bombarded with oxy radicals, yet mitochondria have relatively inefficient DNA repair mechanisms—which means that mitochondrial DNA accumulate progressively during a lifetime. Although it was initially reported that AD patients have an increased frequency of specific missense mutations in mitochondrial DNA (133), subsequent studies have not confirmed this association (134,135). Nevertheless, an impact of ‘‘acquired’’ mitochondrial DNA mutations on mitochondrial dysfunction and oxy radical production on the risk for AD seems likely.
IX. HORMONAL AND ENVIRONMENTAL FACTORS CONTRIBUTING TO OXIDATIVE STRESS IN AD A very clear relationship between estrogens and AD has been established in epidemiological studies showing that postmenopausal women who receive estrogen replacement therapy have a greatly reduced risk for developing AD (136,137), and by experimental studies showing that estrogen is neuroprotective (138). It has been known for many years that estrogen has beneficial effects in many organ systems susceptible to age-related oxidative damage including the cardiovascular system and nervous system. We (28) and others (139,140) have found that estrogens can protect neurons against various oxidative, metabolic, and excitotoxic insults. The data suggest that the neuroprotective action of estrogen is the direct result of its ability to suppress membrane lipid peroxidation (28). Estrogen can protect PC12 cells expressing mutant presenilin-1 against apoptosis induced by Aβ and trophic factor withdrawal by a mechanism involving suppression of oxidative stress and preserved mitochondrial function (141). In response to physical and psychological stressors, glucocorticoids (cortisol in humans and corticosterone in rodents) are released from the adrenal gland. Based on extensive experimental data, it has been proposed that glucocorticoids promote neuronal degeneration in some brain regions in aging and AD (142). Glucocorticoids may endanger neurons by inhibiting glucose transport, thereby promoting metabolic compromise and excitotoxic injury (143). We have found that exposure of cultured hippocampal neurons to glucocorticoids increases their vulnerability to oxidative and excitotoxic insults, and to death induced by Aβ (28). Our data suggest that glucocorticoids enhance disruption of calcium homeostasis and oxy radical production in neurons. Interestingly, there is evidence that AD patients have perturbed regulation of glucocorticoid production resulting in increased levels of circulating glucocorticoids, which could contribute to the neurodegenerative process. Several environmental risk factors for AD have been identified including history of traumatic head injury (144), small strokes (145), and low level of education (146). Head trauma itself induces considerable oxidative stress in neurons,
Genetics, Oxy Radicals, and AD
343
not only at the site of trauma but in distant brain structures including the hippocampus (147). Similarly, cerebral ischemia is known to induce oxidative stress in neurons in and surrounding the ischemic focus (148). It is therefore not too surprising that head trauma and ischemia can combine with age-related increases in oxidative stress and impaired energy metabolism to accelerate the processes of amyloid deposition and neuronal degeneration that underlie AD. The beneficial effect of education is likely the result of the following mechanism. Increased brain use (i.e., activity in neuronal circuits involved in learning and memory) results in increased neurotrophic factor production. Increased levels of neurotrophic factors promote neuronal growth and plasticity, and suppress age-related increases in levels of oxidative stress (149). This ‘‘use-it-or-lose-it’’ phenomenon is consistent with many different observations in both the human population and experimental animals.
X.
OXIDATIVE STRESS AND THE FORMATION OF NEUROFIBRILLARY TANGLES IN AD
Using antibodies that recognize advanced glycation end-product-modified proteins, it was shown that amyloid plaques and neurofibrillary tangles contain high levels of glycated proteins (150–152). Glycation involves crosslinking of sugars to proteins and is a well-known indicator of oxidative stress. Both Aβ and the microtubule-associated protein tau (the major component of straight and pairedhelical filaments in neurofibrillary tangles) are glycated in brain tissue from AD patients. That oxidative stress is involved in the formation of tau filaments in neurofibrillary tangles is suggested by the results of several different experiments. Incubation of tau (153) and Aβ (154) in an oxidizing environment can result in formation of filaments that appear indistinguishable from the protein fibrils present in neurofibrillary tangles and senile plaques, respectively. As oxidative stress increases with normal aging, it is reasonable to consider that such an oxidizing environment could promote a cascade of events in which oxidation promotes Aβ and tau fibril formation, which then induces further oxidative stress in brain cells (see above). Indeed, our previous cell culture and in vivo studies showed that insults that induce oxidative stress (e.g., glutamate, glucose deprivation, and Aβ) induce antigenic changes in tau similar to those seen in the neurofibrillary tangles of AD (32,155–159). The lipid peroxidation product 4-hydroxynonenal may play a central role in the genesis of neurofibrillary tangles. We have found that when cultured hippocampal neurons are exposed to 4-hydroxynonenal or agents that induce membrane lipid peroxidation, tau forms filaments that are hyperphosphorylated (160). In the latter study we found that covalent modification of tau by 4-hydroxynonenal results in a form of tau that is not readily dephosphorylated by phosphatases. Recent studies have shown that, indeed, neurofibrillary tangle–
344
Mattson
bearing neurons are highly immunoreactive with antibodies that recognize 4hydroxynonenal-modified proteins (161,162).
XI. DIETARY MODIFIERS OF AD RISK Can AD be forestalled by dietary manipulations. Dietary risk factors for AD may be similar to those that increase risk of other prominent age-related degenerative conditions including cardiovascular disease and diabetes. Such risk factors include high calorie intake (combined with low level of exercise) and low antioxidant intake. The ability of food restriction to extend lifespan and forestall the development of age-related diseases is well known (68), and appears to apply also to brain aging (163). Interestingly, some epidemiological data are consistent with the possibility that food restriction reduces the risk for AD. For example, there is a strong correlation between per capita food consumption and incidence of AD among populations in different countries (Fig. 8). The ability of antioxidant supplementation to prevent AD is not yet established but, based on the data described above (and many more data not covered herein), the prediction is that this will prove to be the case. Indeed, data are emerging to support a recommendation of antioxidant therapy for AD patients. For example, a beneficial effect of
Figure 8 Relationship between food consumption and incidence of AD. (Modified from Ref. 167.)
Genetics, Oxy Radicals, and AD
345
vitamin E supplementation in slowing the progression of AD was documented in a recent clinical trial (164). In addition, a recent epidemiological study showed that ethnic groups known to have diets high in calories and low in antioxidants have an increased incidence of AD (165).
XII.
SUMMARY
Biochemical and immunohistochemical analyses of postmortem brain tissue from AD patients have provided compelling evidence for increased oxidative stress in vulnerable neuronal populations. Increased membrane lipid peroxidation, protein oxidation, and DNA damage have been described. Experimental studies in cell culture and animal models of AD have shown that Aβ, a protein strongly linked to the neurodegenerative process, damages and kills neurons by a mechanism involving membrane lipid peroxidation and disruption of cellular ion homeostasis and mitochondrial function. Lipid peroxidation results in generation of the toxic aldehyde 4-hydroxynonenal which covalently modifies, and thereby impairs the function of, membrane ion-motive ATPases, and glucose and glutamate transporters. The latter process increases neuronal vulnerability to excitotoxicity and apoptosis. Studies of the pathogenic mechanism of genetic mutations linked to early-onset inherited forms of AD are revealing novel mechanisms for enhancement of oxidative stress in the brain. Mutations in the β-APP lead to altered proteolytic processing of APP in a manner that increases levels of neurotoxic Aβ, while decreasing levels of a secreted form of APP that activates a signaling pathway (involving the transcription factor NF-κB) that protects neurons against oxidative and excitotoxic injury. Mutations in the presenilin genes may promote oxidative stress by perturbing neuronal calcium homeostasis, which leads to impaired mitochondrial function and increased superoxide and peroxynitrite production. Additional genetic risk factors, as well as environmental factors, have also been linked to a final common pathway of neuronal injury involving increased oxidative stress and mitochondrial dysfunction. Dietary and pharmacological approaches aimed at reducing levels of oxidative stress in neurons are likely to prove beneficial in reducing the risk for AD in the general population.
ACKNOWLEDGMENTS I am very grateful to the many outstanding young scientists who have worked in my laboratory, and to colleagues who have collaborated on studies described in this chapter. Because of space and time limitations, I did not attempt a comprehensive review of the subject matter of this chapter. There are therefore many relevant published articles that were not cited here, and many such references
346
Mattson
can be found in the review articles I have cited in the present manuscript (2,13,40,43,44,52,54,61,68,76,77,100,120,122,138,142,149,163).
REFERENCES 1. Esterbauer, H., Schaur, R.J. and Zollner, H. (1991) Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Rad. Biol. Med. 11, 81–128. 2. Mattson, M.P. (1998) Modification of ion homeostasis by lipid peroxidation: roles in neuronal degeneration and adaptive plasticity. Trends Neurosci. 21, 53–57. 3. Mark, R.J., Lovell, M.A., Markesbery, W.R., Uchida, K. and Mattson, M.P. (1997) A role for 4-hydroxynonenal in disruption of ion homeostasis and neuronal death induced by amyloid β-peptide. J. Neurochem. 68, 255–264. 4. Keller, J.N. and Mattson, M.P. (1997) 17β-estradiol attenuates oxidative impairment of synaptic Na ⫹ /K ⫹-ATPase activity, glucose transport and glutamate transport induced by amyloid β-peptide and iron. J. Neurosci. Res. 50, 522–530. 5. Mark, R.J., Pang, Z., Geddes, J.W., Uchida, K. and Mattson, M.P. (1997) Amyloid β-peptide impairs glucose uptake in hippocampal and cortical neurons: involvement of membrane lipid peroxidation. J. Neurosci. 17, 1046–1054. 6. Keller, J.N., Pang, Z., Geddes, J.W., Begley, J.G., Germeyer, A., Waeg, G. and Mattson, M.P. (1997) Impairment of glucose and glutamate transport and induction of mitochondrial oxidative stress and dysfunction in synaptosomes by amyloid βpeptide: role of the lipid peroxidation product 4-hydroxynonenal. J. Neurochem. 69, 273–284. 7. Blanc, E.M., Keller, J.N., Fernandez, S. and Mattson, M.P. (1998) 4-Hydroxynonenal, a lipid peroxidation product, inhibits glutamate transport in astrocytes. Glia 22, 149–160. 8. Beckman, J.S. and Crow, J.P. (1993) Pathological implications of nitric oxide, superoxide and peroxynitrite formation. Biochem. Soc. Trans. 21, 330–334. 9. Mattson, M.P., Goodman, Y., Luo, H., Fu, W., Furukawa, K. (1997) Activation of NF-κB protects hippocampal neurons against oxidative stress-induced apoptosis: evidence for induction of Mn-SOD and suppression of peroxynitrite production and protein tyrosine nitration. J. Neurosci. Res. 49, 681–697. 10. Keller, J.N., Kindy, M.S., Holtsberg, F.W., St Clair, D.K., Yen, H.-C., Germeyer, A., Steiner, S.M., Bruce-Keller, A.J., Hutchins, J.B. and Mattson, M.P. (1998) Mitochondrial MnSOD prevents neural apoptosis and reduces ischemic brain injury: suppression of peroxynitrite production, lipid peroxidation and mitochondrial dysfunction. J. Neurosci. 18, 687–697. 11. Lafon-Cazal, M., Pietri, S., Cuicasi, M. and Bockaert, J. (1993) NMDA-dependent superoxide production and neurotoxicity. Nature 364, 535–537. 12. Mattson, M.P., Lovell, M.A., Furukawa, K. and Markesbery, W.R. (1995) Neurotrophic factors attenuate glutamate-induced accumulation of peroxides, elevation of [Ca 2⫹ ] i and neurotoxicity, and increase antioxidant enzyme activities in hippocampal neurons. J. Neurochem. 65, 1740–1751.
Genetics, Oxy Radicals, and AD
347
13. McGeer, P.L. and McGeer, E.G. (1995) The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases. Brain Res. Rev. 21, 195–218. 14. Lovell, M.A., Ehmann, W.D., Butler, S.M. and Markesbery, W.R. (1995) Elevated thiobarbituric acid-reactive substances and antioxidant enzyme activity in the brain in Alzheimer’s disease. Neurology 45, 1594–1601. 15. Moccoci, P., MacGarvey, M.S. and Beal, M.F. (1994) Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease. Ann. Neurol. 36, 747–751. 16. Smith, C.D., Carney, J.M., Starke-Reed, P.E., Oliver, C.N., Stadtman, E.R., Floyd, R.A. and Markesbery, W.R. (1991) Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 88, 10540–10543. 17. Good, P.F., Werner, P., Hsu, A., Olanow, C.W. and Perl, D.P. (1996) Evidence of neuronal oxidative damage in Alzheimer’s disease. Am. J. Pathol. 149, 21–28. 18. Lyras, L., Perry, R.H., Perry, E.K., Ince, P.G., Jenner, A., Jenner, P. and Halliwell, B. (1998) Oxidative damage to proteins, lipids, and DNA in cortical brain regions from patients with dementia with Lewy bodies. J. Neurochem. 71, 302–312. 19. Smith, M.A., Harris, P.L.R., Sayre, L.M., Beckman, J.S. and Perry, G. (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J. Neurosci. 17, 2653–2657. 20. Lovell, M.A., Ehmann, W.D., Mattson, M.P. and Markesbery, W.R. (1997) Elevated 4-hydroxynonenal levels in ventricular fluid in Alzheimer’s disease. Neurobiol. Aging 18, 457–461. 21. Bruce, A.J., Bose, S., Fu, W., Butt, C.M., Mirault, M.-E., Taniguchi, N. and Mattson, M.P. (1997) Amyloid β-peptide alters the profile of antioxidant enzymes in hippocampal cultures in a manner similar to that observed in Alzheimer’s disease. Pathogenesis 1, 15–30. 22. Gerlach, M., Ben-Shachar, D., Riederer, P. and Youdim, M.B. (1994) Altered brain metabolism of iron as a cause of neurodegenerative diseases? J. Neurochem. 63, 793–807. 23. Morris, C.M., Kerwin, J.M. and Edwardson, J.A. (1994) Non-heme iron histochemistry of the normal and Alzheimer’s disease hippocampus. Neurodegeneration 3, 267–275. 24. Namekata, K., Imagawa, M., Terashi, A., Ohta, S., Oyama, F. and Ihara, Y. (1997) Association of transferrin C2 allele with late-onset Alzheimer’s disease. Hum. Genet. 101, 126–129. 25. Goodman, Y., and Mattson, M.P. (1994) Secreted forms of β-amyloid precursor protein protect hippocampal neurons against amyloid β-peptide-induced oxidative injury. Exp. Neurol. 128, 1–12. 26. Butterfield, D.A., Hensley, K., Harris, M., Mattson, M.P. and Carney, J. (1994) βamyloid peptide free radical fragments initiate synaptosomal lipoperoxidation in a sequence-specific fashion: implications to Alzheimer’s disease. Biochem. Biophys. Res. Commun. 200, 710–715. 27. Mark, R.J., Hensley, K., Butterfield, D.A. and Mattson, M.P. (1995) Amyloid βpeptide impairs ion-motive ATPase activities: evidence for a role in loss of neuronal Ca 2⫹ homeostasis and cell death. J. Neurosci. 15, 6239–6249.
348
Mattson
28. Goodman, Y., Bruce, A.J., Cheng, B. and Mattson, M.P. (1996) Estrogens attenuate and corticosterone exacerbates excitotoxicity, oxidative injury and amyloid βpeptide toxicity in hippocampal neurons. J. Neurochem. 66, 1836–1844. 29. Mattson, M.P. and Goodman, Y. (1995) Different amyloidogenic peptides share a similar mechanism of neurotoxicity involving reactive oxygen species and calcium. Brain Res. 676, 219–224. 30. Kruman, I., Bruce, A.J., Bredesen, D.E., Waeg, G. and Mattson, M.P. (1997) Evidence that 4-hydroxynonenal mediates oxidative stress-induced neuronal apoptosis. J. Neurosci. 17, 5089–5100. 31. Yu, Z.F., Bruce-Keller, A.J., Goodman, Y. and Mattson, M.P. (1998) Uric acid protects neurons against excitotoxic and metabolic insults in cell culture, and against focal ischemic brain injury in vivo. J. Neurosci. Res. 53, 613–625. 32. Mattson, M.P., Cheng, B., Davis, D., Bryant, K., Lieberburg, I. and Rydel, R.E. (1992). β-Amyloid peptides destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J. Neurosci. 12, 376–389. 33. Mattson, M.P., Tomaselli, K. and Rydel, R.E. (1993) Calcium-destabilizing and neurodegenerative effects of aggregated β-amyloid peptide are attenuated by basic FGF. Brain Res. 621, 35–49. 34. Goodman, Y., Steiner, M.R., Steiner, S.M. and Mattson, M.P. (1994) Nordihydroguaiaretic acid protects hippocampal neurons against amyloid β-peptide toxicity, and attenuates free radical and calcium accumulation. Brain Res. 654, 171– 176. 35. Mark, R.J., Ashford, J.W. and Mattson, M.P. (1995) Anticonvulsants attenuate amyloid β-peptide neurotoxicity and promote maintenance of calcium homeostasis. Neurobiol. Aging 16, 187–198. 36. Weiss, J.H., Pike, C.J. and Cotman, C.W. (1994) Ca 2⫹ channel blockers attenuate β-amyloid peptide toxicity to cortical neurons in culture. J. Neurochem. 62, 372– 375. 37. Blanc, E.M., Toborek, M., Mark, R.J., Hennig, B. and Mattson, M.P. (1997) Amyloid β-peptide disrupts barrier and transport functions and induces apoptosis in vascular endothelial cells. J. Neurochem. 68, 1870–1881. 38. Mark, R.J., Keller, J.N., Kruman, I. and Mattson, M.P. (1997) Basic FGF attenuates amyloid β-peptide-induced oxidative stress, mitochondrial dysfunction, and impairment of Na ⫹ /K ⫹-ATPase activity in hippocampal neurons. Brain Res. 756, 205– 214. 39. Simpson, I.A., Vannucci, S.J. and Maher, F. (1994) Glucose transporters in mammalian brain. Biochem. Soc. Trans. 22, 671–675. 40. Hoyer, S., Oesterreich, K. and Wagner, O. (1988) Glucose metabolism as the site of the primary abnormality in early-onset dementia of Alzheimer type? J. Neurol. 235, 143–148. 41. Simpson, I.A., Chundu, K.R., Davies-Hill, T., Honer, W.G. and Davies, P. (1994) Decreased concentrations of GLUT1 and GLUT3 glucose transporters in the brains of patients with Alzheimer’s disease Ann. Neurol. 35, 546–551. 42. Rothstein, J.D., Martin, L., Levey, A.I., Dykes-Hoberg, M., Jin, L., Wu, D., Nash, N. and Kuncl, R.W. (1994) Localization of neuronal and glial glutamate transporters. Neuron 13, 713–725.
Genetics, Oxy Radicals, and AD
349
43. Mattson, M.P. (1997) Mother’s legacy: mitochondrial DNA mutations and Alzheimer’s disease. Trends Neurosci. 20, 373–375. 44. Blass, J.P. (1993) Metabolic alterations common to neural and non-neural cells in Alzheimer’s disease. Hippocampus 3, 45–54. 45. Kish, S.J., Bergeron, C., Rajput, A., Dozic, S., Mastrogiacomo, F., Chang, L.J., Wilson, J.M., DiStefano, L.M. and Nobrega, J.N. (1992) Brain cytochrome oxidase in Alzheimer’s disease. J. Neurochem. 59, 776–779. 46. Sims, N.R., Finegan, J.M. and Blass, J.P. (1987) Altered metabolic properties of cultured skin fibroblasts in Alzheimer’s disease. Ann. Neurol. 21, 451–457. 47. Sheu, K.F., Cooper, A.J., Koike, K., Koike, M., Lindsay, J.G. and Blass, J.P. (1994) Abnormality of the α-ketoglutarate dehydrogenase complex in fibroblasts from familial Alzheimer’s disease. Ann. Neurol. 35, 312–318. 48. Kaneko, I., Yamada, N., Sakuraba, Y., Kamenosono, M. and Tutumi, S. (1995) Suppression of mitochondrial succinate dehydrogenase, a primary target of βamyloid, and its derivative racemized at Ser residue. J. Neurochem. 65, 2585– 2593. 49. Kruman, I., Pang, Z., Geddes, J.W. and Mattson, M.P. (1999) Pivotal role of mitochondrial calcium uptake in neural cell apoptosis and necrosis. J. Neurochem. 72, 529–540. 50. Guo, Q., Furukawa, K., Sopher, B.L., Pham, D.G., Xie, J., Robinson, N., Martin, G.M. and Mattson, M.P. (1996) Alzheimer’s PS-1 mutation perturbs calcium homeostasis and sensitizes PC12 cells to death induced by amyloid β-peptide. NeuroReport 8, 379–383. 51. Guo, G., Sopher, B.L., Pham, D.G., Furukawa, K., Robinson, N., Martin, G.M. and Mattson, M.P. (1997) Alzheimer’s presenilin mutation sensitizes neural cells to apoptosis induced by trophic factor withdrawal and amyloid β-peptide: involvement of calcium and oxyradicals. J. Neurosci. 17, 4212–4222. 52. Mattson, M.P., Guo, Q., Furukawa, K. and Pedersen, W.A. (1998). Presenilins, the endoplasmic reticulum, and neuronal apoptosis in Alzheimer’s disease. J. Neurochem. 70, 1–14. 53. Mattson, M.P. (1997) Cellular actions of β-amyloid precursor protein, and its soluble and fibrillogenic peptide derivatives. Physiol. Rev. 77, 1081–1132. 54. Kelly, J.F. and Roth, G.S. (1997) Changes in neurotransmitter signal transduction pathways in the aging brain. Adv. Cell Aging Gerontol. 2, 243–278. 55. Abe, E., Casamenti, F., Giovannelli, L., Scali, C. and Pepeu, G. (1994) Administration of amyloid β-peptides into the medial septum of rats decreases acetylcholine release from hippocampus in vivo. Brain Res. 636, 162–164. 56. Harkany, T., De Jong, G.I., Soos, K., Penke, B., Luiten, P.G.M. and Gulya, K. (1995) β-Amyloid 1–42 affects cholinergic but not parvalbumin-containing neurones in the septal complex of the rat. Brain Res. 698, 270–274. 57. Kar, S. Seto, D., Gaudreau, P. and Quirion, R. (1996) β-Amyloid-related peptides inhibit potassium-evoked acetylcholine release from rat hippocampal formation. J. Neurosci. 16, 1034–1040. 58. Pedersen, W.A., Kloczewiak, M.A. and Blusztajn, J.K. (1996) Amyloid β-protein reduces acetylcholine synthesis in a cell line derived from cholinergic neurons of the basal forebrain. Proc. Natl. Acad. Sci. USA 93, 8068–8071.
350
Mattson
59. Cutler, R., Joseph, J.A., Yamagami, K., Villalobos-Molina, R. and Roth, G.S. (1994) Area specific alterations in muscarinic stimulated low K m GTPase activity in aging and Alzheimer’s disease: implications for altered signal transduction. Brain Res. 664, 54–60. 60. Ferrari-DiLeo, G. and Flynn, D.D. (1993) Diminished muscarinic receptorstimulated 3H-PIP 2 hydrolysis in Alzheimer’s disease. Life Sci. 53, PL439–444. 61. Jope, R.S. (1996) Cholinergic muscarinic receptor signaling by the phosphoinositide signal transduction system in Alzheimer’s disease. Alzheimer’s Dis. Rev. 1, 2–14. 62. Roth, G.S., Joseph, J.A. and Mason R.P. (1995) Membrane alterations as causes of impaired signal transduction in Alzheimer’s disease and aging. Trends Neurosci. 18, 203–206. 63. Kelly, J., Furukawa, K., Barger, S.W., Mark, R.J., Rengen, M.R., Blanc, E.M., Roth, G.S. and Mattson, M.P. (1996) Amyloid β-peptide disrupts carbacholinduced muscarinic cholinergic signal transduction in cortical neurons. Proc. Natl. Acad. Sci. USA. 93, 6753–6758. 64. Blanc, E.M., Kelly, J.F., Mark, R.J. and Mattson, M.P. (1997) 4-Hydroxynonenal, an aldehydic product of lipid peroxidation, impairs signal transduction associated with muscarinic acetylcholine and metabotropic glutamate receptors: possible action on Gα q /11. J. Neurochem. 69, 570–580. 65. Li, X., Song, L. and Jope, R.S. (1996) Cholinergic stimulation of AP-1 and NFκB transcription factors is differentially sensitive to oxidative stress in SH-SY5Y neuroblastoma: relationship to phosphoinositide hydrolysis. J. Neurosci. 16, 5914– 5922. 66. Li, X., Song, L. and Jope, R.S. (1998) Glutathione depletion exacerbates impairment by oxidative stress of phosphoinositide hydrolysis, AP-1, and NF-κB activation by cholinergic stimulation. Mol. Brain Res. 53, 196–205. 67. Joseph, J.A., Algeri, S., De-Cesare, A., Comuzio, M., Erat, S., Kelly, J., Cagnotto, A., Mennini, T. (1995) A reduced calorie-high fiber diet retards age-associated decreases in muscarinic receptor sensitivity. Neurobiol. Aging 16, 607–612. 68. Sohal, R.S. and Weindruch, R. (1996) Oxidative stress, caloric restriction, and aging. Science 273, 59–63. 69. Bruce-Keller, A.J., Umberger, G., McFall, R. and Mattson, M.P. (1999) Food restriction reduces brain damage and improves behavioral outcome following excitotoxic and metabolic insults. Ann. Neurol. 45, 8–15. 70. Collerton, D. (1986) Cholinergic function and intellectual decline in Alzheimer’s disease. Neuroscience 19, 1–28. 71. Bruce-Keller, A.J., Li, Y.-J., Lovell, M.A., Kraemer, P.J., Gary, D.S., Brown, R.R., Markesbery, W.R. and Mattson, M.P. (1998) 4-Hydroxynonenal, a product of lipid peroxidation, damages cholinergic neurons and impairs visuospatial memory in rats. J. Neuropathol. Exp. Neurol. 57, 257–267. 72. Villalobos-Molina, R., Joseph, J.A., Rabin, B., Kandasamy, S., Dalton, T. and Roth, G.S. (1994) 56Fe irradiation diminishes muscarinic, but not α1-adrenergic stimulated low-Km GTPase in rat brain. Radiat. Res. 140, 382–386. 73. Itoh, A., Nitta, A., Nadai, M., Nishimura, K., Hirose, M., Hasegawa, T. and Nabeshima, T. (1996) Dysfunction of cholinergic and dopaminergic neuronal systems in β-amyloid protein-infused rats. J. Neurochem. 66, 1113–1117.
Genetics, Oxy Radicals, and AD
351
74. Maurice, T., Lockhart, B.P. and Privat, A. (1996) Amnesia induced in mice by centrally administered β-amyloid peptides involves cholinergic dysfunction. Brain Res. 706, 181–193. 75. Fu, W., Luo, H., Parthasarathy, S. and Mattson, M.P. (1998) Catecholamines potentiate amyloid β-peptide neurotoxicity: involvement of oxidative stress, mitochondrial dysfunction, and perturbed calcium homeostasis. Neurobiol. Dis. 5, 229– 243. 76. Finch, C.E. and Tanzi, R.E. (1997). Genetics of aging. Science 278, 407–411. 77. Hardy, J. (1997) Amyloid, the presenilins and Alzheimer’s disease. Trends Neurosci 20, 154–159. 78. Blacker, D., Wilcox, M.A., Laird, N.M., Rodes, L., Horvath, S.M., Go, R.C.P., Perry, R., Watson, B., Bassett, S.S., McInnis, M.G., Albert, M.S., Hyman, B.T. and Tanzi, R.E. (1998) Alpha-2 macroglobulin is a novel Alzheimer’s disease gene on chromosome 12. Nature Gen. 19, 357–360. 79. Poorkaj, P., Bird, T.D., Wijsman, E., Nemens, E., Garruto, R.M., Anderson, L., Andreadis A., Wiederholt, W.C., Raskind, M. and Schellenberg, G.D. (1998) Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann. Neurol. 43, 815–825. 80. Furukawa, K., Barger, S.W., Blalock, E. and Mattson, M.P. (1996a). Activation of K ⫹ channels and suppression of neuronal activity by secreted β-amyloid precursor protein. Nature 379, 74–78. 81. Furukawa, K., Sopher, B., Rydel, R.E., Begley, J.G., Martin, G.M. and Mattson, M.P. (1996b). Increased activity-regulating and neuroprotective efficacy of αsecretase-derived secreted APP is conferred by a C-terminal heparin-binding domain. J. Neurochem. 67, 1882–1896. 82. Ishida, A., Furukawa, K., Keller, J.N. and Mattson, M.P. (1997). Secreted form of β-amyloid precursor protein shifts the frequency dependence for induction of LTD, and enhances LTP in hippocampal slices. NeuroReport 8, 2133–2137. 83. Furukawa, K. and Mattson, M.P. (1998). Secreted amyloid precursor protein a selectively suppresses NMDA receptor currents in hippocampal neurons: involvement of cyclic GMP. Neuroscience 83, 429–438. 84. Mattson, M.P., Cheng, B., Culwell, A., Esch, F., Lieberburg, I. and Rydel, R.E. (1993). Evidence for excitoprotective and intraneuronal calcium-regulating roles for secreted forms of β-amyloid precursor protein. Neuron 10, 243–254. 85. Cook, D.B., Sung, J.C., Golde, T.E., Felsenstein, K.M., Wojczyk, B.S., Tanzi, R.E., Trojanowski, J.Q., Lee, V.M.Y. and Doms, R.W. (1996). Expression and analysis of presenilin 1 in a human neuronal system: localization in cell bodies and dendrites. Proc. Natl. Acad. Sci. USA 93, 9223–9228. 86. Elder, G.A., Tezapsidis, N., Carter, J., Shioi, J., Bouras, C., Li, D., Johnston, J.M., Efthimiopoulos, S., Friedrich, V.L. and Robakis, N.K. (1996) Identification and neuron specific expression of the S182/presenilin 1 protein in human and rodent brains. J. Neurosci. Res. 45, 308–320. 87. Kovacs, D.M., Fausett, H.J., Page, K.J., Kim, T-W., Moir, R.D., Merriam, D.E., Hollister, R.D., Hallmark, O.G., Mancini, R., Felsenstein, K.M., Hyman, B.T., Tanzi, R.E. and Wasco, W. (1996). Alzheimer-associated presenilins 1 and 2: neuronal expression in brain and localization to intracellular membranes in mammalian cells. Nature Med. 2, 224–229.
352
Mattson
88. Shen, J., Bronson, R.T., Chen, D.F., Xia, W., Selkoe, D.J. and Tonegawa, S. (1997). Skeletal and CNS defects in presenilin-1-deficient mice. Cell 89, 629–639. 89. Wong, P.C., Zheng, H., Chen, H., Becher, M.W., Sirinathsinghji, D.J.S., Trumbauer, M.E., Chen, H.Y., Price, D.L., Van der Ploeg, L.H.T. and Sisodia, S.S. (1997). Presenilin 1 is required for Notch1 and Dll1 expression in the paraxial mesoderm. Nature 387, 288–292. 90. Scheuner, D., Eckman, C., Jensen, M., Song, X., Citron, M., Suzuki, N., Bird, T.D., Hardy, J., Hutton, M., Kukull, W., Larson, E., Levy-Lahad, E., Viitanen, M., Peskind, E., Poorkaj, P., Schellenberg, G., Tanzi, R., Wasco, W., Lannfelt, L., Selkoe, D. and Younkin, S. (1996) The amyloid β protein deposited in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nature Med. 2, 864– 870. 91. Duff, K., Eckman, C., Zehr, C., Yu, X., Prada, C.-M., Perez-tur, J., Hutton, M., Buee, L., Harigaya, Y., Yager, D., Morgan, D., Gordon, M.N., Holcomb, L., Refolo, L., Zenk, B., Hardy, J. and Younkin, S. (1996). Increased amyloid-β42(43) in brains of mice expressing mutant presenilin 1. Nature 383, 710–713. 92. Borchelt, D.R., Thinakaran, G., Eckman, C.B., Lee, M.K., Davenport, F., Ratovitsky, T., Prada, C-M., Kim, G., Seekins, S., Yager, D., Slunt, H.H., Wang, R., Seeger, M., Levey, A.I., Gandy, S.E., Copeland, N.G., Jenkins, N.A., Price, D.L., Younkin, S.G. and Sisodia, S.S. (1996). Familial Alzheimer’s disease-linked presenilin 1 variants elevate Aβ1-42/1-40 ratio in vitro and in vivo. Neuron 17, 1005– 1013. 93. Ancolio, K., Marambaud, P., Dauch, P. and Checler, F. (1997). α-secretase-derived product of β-amyloid precursor protein is decreased by presenilin-1 mutations linked to familial Alzheimer’s disease. J. Neurochem. 69, 2494–2499. 94. Guo, Q., Robinson, N. and Mattson, M.P. (1998) Secreted APPα counteracts the pro-apoptotic action of mutant presenilin-1 by activation of NF-κB and stabilization of calcium homeostasis J. Biol. Chem. 273, 12341–12351. 95. Hensley, K., Carney, J.M., Mattson, M.P., Aksenova, M., Harris, M., Wu, J.F., Floyd, R. and Butterfield, D.A. (1994) A model for β-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 91, 3270–3274. 96. Weidemann, A., Paliga, K., Durrwang, U., Czech, C., Evin, G., Masters, C.L. and Beyreuther, K. (1997) Formation of stable complexes between two Alzheimer’s disease gene products, presenilin-2 and β-amyloid precursor protein. Nature Med. 3, 328–332. 97. Xie, W., Zhang, J., Perez, R., Koo, E.H. and Selkoe, D.J. (1997). Interaction between amyloid precursor protein and presenilins in mammalian cells: implications for the pathogenesis of Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 94, 8208– 8213. 98. Guo, Q., Christakos, S., Robinson, N. and Mattson, M.P. (1998). Calbindin blocks the pro-apoptotic actions of mutant presenilin-1: reduced oxidative stress and preserved mitochondrial function. Proc. Natl. Acad. Sci. USA 95, 3227– 3232. 99. Furukawa, K., Guo, Q., Schellenberg, G.D. and Mattson, M.P. (1998) Presenilin-
Genetics, Oxy Radicals, and AD
100.
101.
102. 103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
353
1 mutation alters NGF-induced neurite outgrowth, calcium homeostasis, and transcription factor (AP-1) activation in PC12 cells. J. Neurosci. Res. 52, 618–624. Mattson, M.P. and Furukawa, K. (1996) Programmed cell life: anti-apoptotic signaling and therapeutic strategies for neurodegenerative disorders. Restor. Neurol. Neurosci. 9, 191–205. Su, J.H., Anderson, A.J., Cummings, B. and Cotman, C.W. (1994) Immunocytochemical evidence for apoptosis in Alzheimer’s disease. NeuroReport 5, 2529– 2533. Smale, G., Nichols, N.R. and Brady, D.R. (1995) Evidence for apoptotic cell death in Alzheimer’s disease. Exp. Neurol. 133, 225–230. Loo, D., Copani, A., Pike, C., Whittemore, E., Walencewicz, A. and Cotman, C.W. (1993) Apoptosis is induced by β-amyloid in cultured central nervous system neurons. Proc. Natl. Acad. Sci. USA 90, 7951–7955. Keller, J.N., Guo, Q., Holtsberg, F.W., Bruce-Keller, A.J. and Mattson, M.P. (1998) Increased sensitivity to mitochondrial toxin–induced apoptosis in neural cells expressing mutant presenilin-1 is linked to perturbed calcium homeostasis and enhanced oxyradical production. J. Neurosci. 18, 4439–4450. Wolozin, B., Iwasaki, K., Vito, P., Ganjei, J.K., Lacana, E., Sunderland, T., Zhao, B., Kusiak, J.W., Wasco, W. and D’Adamio, L. (1996) Participation of presenilin 2 in apoptosis: enhanced basal activity conferred by an Alzheimer mutation. Science 274, 1710–1713. Guo, Q., Fu, W., Xie, J., Luo, H., Sells, S.F., Geddes, J.W., Bondada, V., Rangnekar, V.M. and Mattson, M.P. (1998) Par-4 is a mediator of neuronal degeneration associated with the pathogenesis of Alzheimer’s disease. Nature Med. 4, 957–962. Sells, S.F., Han, S.-S., Muthukkumar, S., Maddiwar, N., Johnstone, R., Boghaert, E., Gillis, D., Liu, G., Nair, P., Monnig, S., Collini, P., Mattson, M.P., Sukhatme, V.P., Zimmer, S.G., Wood, D.P., McRoberts, J.W., Shi, Y. and Rangnekar, V.M. (1997) Expression and function of the leucine zipper protein PAR-4 in apoptosis. Mol. Cell. Biol. 17, 3823–3832. Barger, S.W., Horster, D., Furukawa, K., Goodman, Y., Krieglstein, J. and Mattson, M.P. (1995). Tumor necrosis factors a and b protect neurons against amyloid bpeptide toxicity: evidence for involvement of a κB-binding factor and attenuation of peroxide and Ca 2⫹ accumulation. Proc. Natl. Acad. Sci. USA 92, 9328–9332. Barger, S.W. and Mattson, M.P. (1996). Induction of neuroprotective κB-dependent transcription by secreted forms of the Alzheimer’s β-amyloid precursor. Mol. Brain Res. 40, 116–126. Guo, Q., Sebastian, L., Sopher, B.L., Miller, M.W., Glazner, G.W., Ware, C.B., Martin, G.M. and Mattson, M.P. (1999) Neurotrophic factors (ADNF and GFGF) interrupt excitotoxic neurodegenerative cascades promoted by a presenilin-1 mutation. Proc. Natl. Acad. Sci. U.S.A. 96, 4125–4130. Pedersen, W., Guo, Q., Hartman, B.K. and Mattson, M.P. (1997). NGF-independent reduction in choline acetyltransferase activity in PC12 cells expressing mutant presenilin-1. J. Biol. Chem. 272, 22397–22400. Zhou, J., Liyangage, U., Medina, M., Ho, C., Simmons, A.D., Lovett, M. and Kosik, K.S. (1997) Presenilin 1 interaction in the brain with a novel member of the Armadillo family. NeuroReport 8, 1489–1494.
354
Mattson
113. Cutler, N.R., Heston, L.L., Davies, P., Haxby, J.V. and Schapiro, M.B. (1985) NIH Conference. Alzheimer’s disease and Down’s syndrome: new insights. Ann. Intern. Med. 103, 566–578. 114. Schellenberg, G.D., Kamino, K., Bryant, E.M., Moore, D. and Bird, T.D. (1992) Genetic heterogeneity, Down syndrome, and Alzheimer’s disease. Prog. Clin. Biol. Res. 379, 215–226. 115. Ceballos, I., Nicole, A., Briand, P., Grimber, G., Delacourte, A., Flament, S., Blouin, J.L., Thevenin, M., Kamoun, P. and Sinet, P.M. (1991) Expression of human Cu-Zn superoxide dismutase gene in transgenic mice: model for gene dosage effect in Down syndrome. Free Rad. Res. Commun. 12-13, 581–589. 116. Busciglio, J. and Yankner, B.A. (1995) Apoptosis and increased generation of reactive oxygen species in Down’s syndrome neurons in vitro. Nature 378, 776–779. 117. Bambrick, L.L., Golovina, V.A., Blaustein, M.P., Yarowsky, P.J. and Krueger, B.K. (1997) Abnormal calcium homeostasis in astrocytes from the trisomy 16 mouse. Glia 19, 352–358. 118. Saunders, A.M., Strittmatter, W.J., Schmechel, D., St. George-Hyslop, P.H., Pericak, V.M.A., Joo, S.H., Rosi, B.L., Gusella, J.F., Crapper-MacLachlan, D.R., Alberts, M.J., Hulette, C., Crain, B., Goldgaber, D. and Roses, A.D. (1993) Association of apolipoprotein E allele e4 with late-onset familial and sporadic Alzheimer’s disease. Neurology 43, 1467–1472. 119. Hixon, J.E. (1991) Apolipoprotein E polymorphisms affect atherosclerosis in young males. Arterioscler. Thromb. 11, 1237–1244. 120. de la Torre, J.C. (1997) Cerebrovascular changes in the aging brain. In: The Aging Brain (Mattson, M.P. and Geddes, J.W., eds.). JAI Press, Adv. Cell Aging Gerontol. 2, 77–107. 121. Nathan, B.P., Bellosta, S., Sanan, D.A., Weisgraber, K.H., Mahle, R.W. and Pitas, R.E. (1994) Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro. Science 264, 850–852. 122. Poirier, J. (1994) Apolipoprotein E in animal models of CNS injury and in Alzheimer’s disease. Trends Neurosci. 17, 525–530. 123. Castano, E., Prelli, F., Wisniewski, T., Golabek, A., Kumar, R., Soto, C. and Frangione, B. (1995) Fibrillogenesis in Alzheimer’s disease of amyloid β peptides and apolipoprotein E. Biochem. J. 306, 599–604. 124. Evans, K.C., Berger, E.P., Cho, C.G., Wiesbraber, K.H. and Lansbury, P.T. (1995) Apolipoprotein E is a kinetic but not a thermodynamic inhibitor of amyloid formation: implications for the pathogenesis and treatment of Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 92, 763–767. 125. Miyata, M. and Smith, J.D. (1996) Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and beta-amyloid peptides. Nature Genet. 14, 55–61. 126. Whitson, J., Mims, M., Strittmatter, W., Yamaki, T., Morrisett, J. and Appel, S. (1994) Attenuation of the neurotoxic effect of Ab amyloid peptide by apolipoprotein. Biochem. Biophys. Res. Commun. 199, 163–170. 127. Barger, S.W. and Mattson, M.P. (1997) Isoform-specific modulation by apolipoprotein E of the activities of secreted β-amyloid precursor protein. J. Neurochem. 69, 60–67.
Genetics, Oxy Radicals, and AD
355
128. Sugawa, M., Ikeda, S., Kushima, Y., Takashima, Y. and Cynshi, O. (1997) Oxidized low density lipoprotein caused CNS neuron cell death. Brain Res. 761, 165– 172. 129. Keller, J.N., Hanni, K.B., Pedersen, W.A., Cashman, N.R., Gabbita, S.P., Mattson, M.P., Froebe, V. and Markesbery, W. R. (1999) Opposing actions of native and oxidized lipoprotein on motor neuron-like cells. J. Neurochem. Exp. Neurol. 157, 202–210. 130. Montoya, S.E., Aston, C.E., DeKosky, S.T., Kamboh, M.I., Lazo, J.S. and Ferrell, R.E. (1998) Bleomycin hydrolase is associated with risk of sporadic Alzheimer’s disease. Nature Genet. 18, 211–212. 131. Narita, M., Holtzman, D.M., Schwartz, A.L. and Bu, G. (1997) α2-Macroglobulin complexes with and mediates the endocytosis of b-amyloid peptide via cell surface low-density lipoprotein receptor–related protein. J. Neurochem. 69, 1904–1911. 132. Du, Y., Bales, K.R., Dodel, R.C., Liu, X., Glinn, M.A., Horn, J.W., Little, S.P. and Paul, S.M. (1998) α2-macroglobulin attenuates β-amyloid peptide 1-40 fibril formation and associated neurotoxicity of cultured fetal rat cortical neurons. J. Neurochem. 70, 1182–1188. 133. Davis, R.E., Miller, S., Herrnstadt, C., Ghosh, S.S., Fahy, E., Shinobu, L.A., Galasko, D., Thal, L.J., Beal, M.F., Howell, N. and Parker, W.D. Jr. (1997) Mutations in mitochondrial cytochrome c oxidase genes segregate with late-onset Alzheimer disease. Proc. Natl. Acad. Sci. USA 94, 4526–4531. 134. Hutchin, T.P., Heath, P.R., Pearson, R.C. and Sinclair, A.J. (1997) Mitochondrial DNA mutations in Alzheimer’s disease. Biochem. Biophys. Res. Commun. 241, 221–225. 135. Wallace, D.C., Stugard, C., Murdock, D., Schurr, T. and Brown, M.D. (1997) Ancient mtDNA sequences in the human nuclear genome: a potential source of errors in identifying pathogenic mutations. Proc. Natl. Acad. Sci. USA 94, 14900–14905. 136. Henderson, V.W., Paganini-Hill, A., Emanuel, C.K., Dunn, M.E., and Buckwalter, J.G. (1994) Estrogen replacement therapy in older women. Comparisons between Alzheimer’s disease cases and nondemented control subjects. Arch. Neurol. 51, 896–900. 137. Tang, M.X., Jacobs, D., Stern, Y., Marder, K., Schofield, P., Gurland, B., Andrews, H. and Mayeux, R. (1996) Effect of oestrogen during menopause on risk and age at onset of Alzheimer’s disease. Lancet 348, 429–432. 138. Mattson, M.P. and Keller, J.N. (1998) Neuroprotective actions of estrogen: a preventative and therapeutic approach for Alzheimer’s disease and stroke. Current Drugs (in press). 139. Behl, C., Skutella, T., Lezoualc’h, F., Post, A., Widmann, M., Newton, C.J. and Holsboer, F. (1997) Neuroprotection against oxidative stress by estrogens: structure-activity relationship. Mol. Pharmacol. 51, 535–541. 140. Green, P.S., Gordon, K. and Simpkins, J.W. (1997) Phenolic A ring requirement for the neuroprotective effects of steroids. J. Steroid Biochem. Mol. Biol. 6, 229– 235. 141. Mattson, M.P., Robinson, N. and Guo, Q. (1997) Estrogens stabilize mitochondrial function and protect neural cells against the pro-apoptotic action of mutant presenilin-1. NeuroReport 8, 3817–3821.
356
Mattson
142. Wise, P.M., Herman, J.P. and Landfield, P. (1997) Neuroendocrine aspects of the aging brain. In: The Aging Brain (Mattson, M.P. and Geddes, J.W., eds.), JAI Press, Adv. Cell Aging Gerontol. 2, 193–241. 143. Sapolsky, R.M. (1994) The physiological relevance of glucocorticoid endangerment of the hippocampus. Ann. N. Y. Acad. Sci. 746, 294–304. 144. Tang, M.X., Maestre, G., Tsai, W.Y., Liu, X.H., Feng, L., Chung, W.Y., Chun, M., Schofield, P., Stern, Y., Tycko, B. and Mayeux, R. (1996) Effect of age, ethnicity, and head injury on the association between APOE genotypes and Alzheimer’s disease. Ann. N.Y. Acad. Sci. 802, 6–15. 145. Pasquier, F. and Leys, D. (1997) Why are stroke patients prone to develop dementia? J. Neurol. 244, 135–142. 146. Evans, D.A., Hebert, L.E., Beckett, L.A., Scherr, P.A., Albert, M.S., Chown, M.J., Pilgrim, D.M. and Taylor, J.O. (1997) Education and other measures of socioeconomic status and risk of incident Alzheimer disease in a defined population of older persons. Arch. Neurol. 54, 1399–1405. 147. Inci, S., Ozcan, O.E. and Kilinc, K. (1998) Time-level relationship for lipid peroxidation and the protective effect of alpha-tocopherol in experimental mild and severe brain injury. Neurosurgery 43, 330–335. 148. Chan, P.H. (1994) Oxygen radicals in focal cerebral ischemia. Brain Pathol. 4, 59– 65. 149. Mattson, M.P. (1998) Experimental models of Alzheimer’s disease. Sci. Med. March/April 16–25. 150. Vitek, M.P., Bhattacharya, K., Glendening, J.M., Stopa, E., Vlassara, H., Bucala, R., Manogue, K. and Cerami, A. (1994) Advanced glycation end products contribute to amyloidosis in Alzheimer disease. Proc. Natl. Acad. Sci. USA 91, 4766– 4770. 151. Smith, M.A., Taneda, S., Richey, P.L., Miyata, S., Yan, S.D., Stern, D., Sayre, L.M., Monnier, V.M. and Perry, G. (1994) Advanced maillard reaction end products are associated with Alzheimer disease pathology. Proc. Natl. Acad. Sci. USA 91, 5710–5714. 152. Yan, S.-D., Chen, X., Schmidt, A.-M., Brett, J., Goodman, G., Zou, Y.-S., Scott, C.W., Caputo, C., Frappier, T., Smith, M.A., Perry, G., Yen, S.-H. and Stern, D. (1994) Glycated tau protein in Alzheimer disease: A mechanism for induction of oxidant stress. Proc. Natl. Acad. Sci. USA 91, 7787–7791. 153. Troncoso, J.C., Costello, A., Watson, A.L. and Johnson, G.V.W. (1993) In vitro polymerization of oxidized tau into filaments. Brain Res. 613, 313–316. 154. Dyrks, T., Dyrks, E., Hartmann, T., Masters, C. and Beyreuther, K.E. (1992) Amyloidogenicity of beta A4 and beta A4-bearing amyloid protein precursor fragments by metal-catalyzed oxidation. J. Biol. Chem. 267, 18210–18217. 155. Mattson, M.P. (1990) Antigenic changes similar to those seen in neurofibrillary tangles are elicited by glutamate and calcium influx in cultured hippocampal neurons. Neuron 4, 105–117. 156. Cheng, B. and Mattson, M.P. (1992) Glucose deprivation elicits neurofibrillary tangle-like antigenic changes in hippocampal neurons: prevention by NGF and bFGF. Exp. Neurol. 117, 114–123.
Genetics, Oxy Radicals, and AD
357
157. Elliott, E., Mattson, M.P., Vanderklish, P., Lynch, G., Chang, I. and Sapolsky, R.M. (1993) Corticosterone exacerbates kainate-induced alterations in hippocampal tau immunoreactivity and spectrin proteolysis in vivo. J. Neurochem. 61, 57–67. 158. Stein-Behrens, B., Mattson, M.P., Chang, I., Yeh, M. and Sapolsky, R.M. (1994) Stress excacerbates neuron loss and cytoskeletal pathology in the hippocampus. J. Neurosci. 14, 5373–5380. 159. Mattson, M.P., Engle, M.G. and Rychlik, B. (1991) Effects of elevated intracellular calcium levels on the cytoskeleton and tau in cultured human cerebral cortical neurons. Mol. Chem. Neuropathol. 15, 117–142. 160. Mattson, M.P., Fu, W., Waeg, G. and Uchida, K. (1997) 4-Hydroxynonenal, a product of lipid peroxidation, inhibits dephosphorylation of the microtubule-associated protein tau. NeuroReport 8, 2275–2281. 161. Sayre, L.M., Zelasko, D.A., Harris, P.L., Perry, G., Salomon, R.G. and Smith, M.A. (1997) 4-Hydroxynonenal-derived advanced lipid peroxidation end products are increased in Alzheimer’s disease. J. Neurochem. 68, 2092–2097. 162. Montine, K.S., Reich, E., Neely, M.D., Sidell, K.R., Olson, S.J., Markesbery, W.R. and Montine, T.J. (1998) Distribution of reducible 4-hydroxynonenal adduct immunoreactivity in Alzheimer disease is associated with APOE genotype. J. Neuropathol. Exp. Neurol. 57, 415–425. 163. Finch, C.E. and Morgan, T.E. (1997) Food restriction and brain aging. In: The Aging Brain (Mattson, M. and Geddes, J.W., eds.), JAI Press, Adv. Cell Aging Gerontol. 2, 279–297. 164. Sano, M., Ernesto, C., Thomas, R.G., Klauber, M.R., Schafer, K., Grundman, M., Woodbury, P., Growdon, J., Cotman, C.W., Pfeiffer, E., Schneider, L.S. and Thal, L.J. (1997) A controlled trial of selegiline, alpha-tocopherol, or both as treatment for Alzheimer’s disease. The Alzheimer’s Disease Cooperative Study. N. Engl. J. Med. 336, 1216–1222. 165. Tang, M.X., Stern, Y., Marder, K., Bell, K., Gurland, B., Lantigua, R., Andrews, H., Feng, L., Tycko, B. and Mayeux, R. (1998) The Apo-E4 allele and risk of Alzheimer’s disease among African Americans, whites and hispanics. JAMA 279, 751–755. 166. Guo, Q., Fu, W., Sopher, B.L., Holtsberg, F.W., Steiner, S.M. and Mattson, M.P. (1999) Superoxide mediates the apoptosis-enhancing action of presenilin-1 mutations. J. Neurosci. Res. 56, 457–470. 167. Grant, W. (1997) Dietary links to Alzheimer’s disease. Alzheimer’s Rev. 2, 42– 55.
17 Role of Transgenic Models for the Study of Oxidative Neurotoxicity in Alzheimer’s Disease Miguel A. Pappolla, Y.-J. Chyan, and Melissa Sos University of South Alabama, Mobile, Alabama
George Perry and Mark A. Smith Case Western Reserve University, Cleveland, Ohio
Felix Cruz-Sanchez University of Catalonya, Barcelona, Spain
I. INTRODUCTION A growing body of data suggest that free radicals are involved at some point in the pathogenesis of Alzheimer’s disease (AD). However, most studies regarding the role of oxidation in AD are being conducted in vitro. Although such approaches are expedient, the results are often difficult to correlate with the sequence of events that characterize the course of the human disease. One of the main reasons for this problem is that in vitro models do not reflect well the complexity of the stress response in nervous tissue. Induction of heat-shock proteins in tissue glia, for example, is followed by export of the proteins into adjacent axons so that compartments that are distant from the neuronal soma can be effectively protected (1). Such intricate interactions are ideally studied only in in vivo paradigms. Recent advances in transgenic models have provided unique avenues to explore various hypotheses about the pathogenesis of AD. This chapter discusses the potential use of transgenic models of AD for the analysis of phenomena involving oxidative stress. In the initial paragraphs, we will briefly review some of the exciting find359
360
Pappolla et al.
ings generated during the last few years on the molecular biology of AD and the role of oxygen free radicals in the pathogenesis of this disorder. Thereafter, we will address pertinent biological and pathological features of transgenic models of AD as well as their potential use for the study of oxidative neurotoxicity.
II. MOLECULAR BIOLOGY OF ALZHEIMER’S DISEASE A.
The Amyloid Peptide, Biogenesis, and Neuropathology
Most of the recent advances in AD stem from the study of a 40- to 43-aminoacid peptide called the amyloid beta protein (Aβ), as the essential pathological marker of the disorder (2,3). Deposits of Aβ in the form amyloid fibrils are widespread in AD, mostly within senile plaques (Fig. 1) and in cerebral and meningeal
Figure 1 Senile plaque and neurofibrillary tangle. Section from the hippocampus of a patient afflicted by Alzheimer’s disease stained with a silver impregnation method. A neuritic plaque is shown in the center of the photograph. This is a complex lesion containing amyloid, dystrophic neuritic processes (arrow heads) and reactive glial cells among numerous other substances. Note black staining processes inside the plaque. These are dystrophic cell processes; their identification is required for the classification of this plaque as neuritic. Neuritic plaques are the type of pathology quantitated in some of the schemes available for neuropathological diagnosis of AD. This particular plague exhibits a prominent core of amyloid; however, this feature is not required for the classification of this plaque as a neuritic plaque. Note a neurofibrillary tangle (see also Fig. 2) immediately below the senile plaque (arrow). (Magnification ⫻ 400.)
Transgenic Models in Alzheimer’s Disease
361
Figure 2 Neurofibrillary tangles. The other conspicuous abnormality found in AD brains is the NFT. The NFT is an intracytoplasmic neuronal inclusion containing altered cytoskeletal components, mainly abnormally phosphorylated tau. This picture shows three NFT as visualized by anti-ubiquitin immunohistochemistry. (Magnification ⫻ 400.)
blood vessels (4,5). The other conspicuous features of AD are intracytoplasmic neuronal inclusions called neurofibrillary tangles (NFTs) (4,5) (Fig. 2). Filamentous bundles of hyperphosphorylated tau (τ) proteins are, among other cytoskeletal proteins, the principal components of these lesions (6,7). Sequencing studies of senile plaque amyloid showed that the longest Aβ peptides contain 42–43 amino acids and begin at Asp 1 (8). Marked heterogeneity of plaque amyloid was subsequently found with smaller amounts of peptides starting at virtually any of the first 11 amino acids of the originally reported sequence (often Glu 4) and ending at Val 40, Ala 42, or Thr 43 (9,10). Recently, a peptide starting at amino acid 17 (P3 peptide) was found significantly represented in plaques (11). In contrast, vascular amyloid, was found to be more homogeneous. Molecular cloning showed that Aβ comprises only a small portion of a larger amyloid precursor protein (APP) (8,12–16) (Fig. 3). Several isoforms of APP were identified (12–18) that were derived from alternative splicing of a single gene in chromosome 21 (12). APP is a type I integral membrane glycoprotein having a large extracytoplasmic portion, a smaller intracytoplasmic region, and a single transmembrane domain. APP is highly conserved in evolution and
362
Pappolla et al.
Figure 3 Schematic representation of the main domains of the amyloid precursor protein.
has several postulated functions, including growth-promoting properties (15), receptor function (10), and cell adhesion (19,20). It is widely expressed in tissues (18) and is a part-time chondroitin sulfate proteoglycan in glial cells (21). The origin of amyloid deposits remains one of the major unanswered issues in AD. It has been postulated that amyloid accumulation may be either the result of abnormal processing of APP (22) or the product of pathological interactions between Aβ and a number of possible chaperone proteins (23). Because most patients with Down syndrome develop neuropathological changes of AD and carry an extra chromosome 21, it was initially postulated that increased expression of APP was the crucial biochemical abnormality in AD (24). However, such a mechanism could not be definitely substantiated in subsequent studies (25). The processing of APP is the subject of a large and continuously growing body of literature and its detailed discussion is outside the scope of this chapter. Briefly, APP undergoes glycosylation (22,26), sulfation (19), and cleavage in the trans-Golgi and/or post-Golgi compartment (27,28), prior to the secretion of its N-terminus portion (26). Physiological processing of APP involves (mainly) cleavage between Lys 16 and Leu 17 of the Aβ sequence by a still unidentified enzyme called α-secretase (29). The activity of the cleaving enzyme is regulated by many substances including phorbol esters (30,31), cholinergic drugs (32), and growth factors (33). Smaller quantities of APP molecules are also cleaved at two sites that produce potentially amyloidogenic membrane-bound or secreted APP
Transgenic Models in Alzheimer’s Disease
363
fragments (34). The enzymes involved at these sites have been termed β- and γsecretases, respectively. Small quantities of Aβ 1–40 and Aβ 1–42 are produced during normal cellular metabolism (35–37), and the identification of such fractions has raised alternative possibilities to explain amyloid accumulation. B.
Does Amyloid Cause Neurodegeneration?
This has been one of the most vexing questions in the Alzheimer’s field. The relatively poor correlation between amyloid load, on the one hand, and cell loss, NFTs, or degree of dementia, on the other, has been the source of controversy regarding the role of amyloid in AD (25). Over the last few years, however, several lines of evidence have significantly strengthened the amyloid hypothesis. The first piece of evidence comes from the identification of several point mutations within the APP gene. These mutations segregate with a subgroup of patients afflicted with a familial form of AD (FAD), strongly suggesting a relationship between the APP gene and AD (38–43). Second, it has been shown that Aβ is toxic to neurons in in vitro studies (44–55), a finding that further associates Aβ with neuronal degeneration. Third, it has been observed that amyloid deposition (generally) precedes the development of neurofibrillary changes (57,58), which is also consistent with a link between amyloid and neuronal pathology. Finally, recent evidence from transgenic animals (discussed below) shows that overexpression of a mutant human APP gene causes senile plaque–like changes followed by neuritic degeneration (59–62). After some initial controversy regarding Aβ toxicity in vitro, a number of laboratories reported that the ability of the peptide to induce neurodegeneration is modulated by several factors including its β-sheet secondary structure (64,65), the state of aggregation, time of exposure, osmolarity, pH, and concentration (64–69). While the molecular bases of Aβ toxicity are not totally understood, it appears that oxygen free radicals (OFRs) play a major role in this process (discussed in the next paragraph.) C.
Is Oxidative Stress Involved in AD?
Involvement of free radical oxidation in aging has been a topic of interest since Harman’s seminal paper (70). Because of the close association between aging and AD and the qualitative similarities in the neuropathology of both conditions, it has been proposed by several investigators that oxidative stress may play a role in the pathogenesis of AD (71–73). Several lines of investigation have now converged to support this possibility. One line of evidence is the presence of oxidative markers that colocalize within the neuropathological lesions of AD, including senile plaques and NFTs. The identification of antioxidant enzymes, key indicators of oxidative stress, was
364
Pappolla et al.
the first documented evidence of oxidative neurotoxicity in the AD lesions (73, 74). Abnormal expression of these markers of oxidation was distinctly accentuated around amyloid deposits. Subsequently, other markers of oxidative stress were also colocalized to senile plaques, to NFTs, or to vulnerable neurons in AD brain. These included heat-shock proteins (75–80), miscompartmentalized lysosomal enzymes (81–82), increased protein carbonyls (83), and lipid peroxides (84). Involvement of OFRs in AD is also supported by the identification in tissue homogenates of AD brains of increased products of lipid peroxidation (85), mitochondrial (86) and nuclear DNA lesions (87), and neuronal membrane damage (88). The degree of oxidative damage measured in tissue homogenates, however, cannot be directly correlated with the neuropathology (i.e., NFTs and senile plaques) since AD brains also exhibit evidence of vascular pathology and hypoperfusion that may secondarily cause oxidative injury. A second, but equally important, body of data suggests that the neurotoxic properties of Aβ are mediated by oxygen free radicals. In in vitro systems, cells exposed to Aβ generate increased levels of H 2 O 2 (50) that in the presence of transition metals gives rise to destructive hydroxyl radicals (51,89). Induction of OFRs may be initiated by binding of Aβ to cell surface receptors such as that for advanced glycated end-products (90), although involvement of other receptors or receptor-independent mechanisms may also be implicated (91). In addition, impaired Ca 2⫹ homeostasis that appears to follow oxidation of Ca 2⫹ membrane pumps (92) has been demonstrated after exposure of cells to Aβ (93). Among various adverse effects on neurons (94), increased intracellular Ca 2⫹ leads to activation of calmodulin-dependent nitric oxide synthase and increased intracellular nitrous oxide (NO) (95), which in turn reacts with superoxide anions forming peroxynitrates. These can exist in activated transitional forms (ONOO ⫺) with reactive potentials comparable to hydroxyl radicals. The recent demonstration of widespread nitration of proteins in brains affected with AD (96,97) suggests involvement of ONOO ⫺ radicals. Although the contribution from each of the potential mentioned sources of OFRs to the overall degree of oxidative damage is not certain, exposure of cells to Aβ causes oxidation of key cellular components that culminate in profoundmetabolic changes and death of neurons. Finally, abnormally phosphorylated τ, one main component of NFTs (6,7,98,99), has been induced in vivo by heat shock (99). This is important since oxygen free radicals are potent inducers of heat-shock proteins (100). In addition, polymerization of τ is induced by oxidative stress (101) and oxidation of cysteine 322 in the repeat domain of τ appears to control its aggregation into paired helical filaments (102). It is noteworthy that fibrillar Aβ also causes hyperphosphorylation of τ at serine 202, serine 396, and serine 404 (103). Despite all of the cited evidence, it is appropriate to mention at this point that a number of negative reports regarding Aβ toxicity (104–106) have fueled
Transgenic Models in Alzheimer’s Disease
365
some controversy regarding the role of this peptide in AD (reviewed in Ref. 25). More recent investigations, however, stressed the observations that animal age (107) and state of aggregation of Aβ (108) are crucial determinants for toxicity to occur. The identification of markers of oxidative stress in transgenic mice (described in subsequent paragraphs) may also contribute to resolve some of these controversies (62,63) because oxidative stress is considered to be the principal modality of damage involved in Aβ-induced neurotoxicity. Although the previous discussion favors the argument that APP and Aβ are central to the pathogenesis of AD, the disease is far more complex in that other genes and loci have been linked to the disorder (109–111). Whereas APP mutations account for only a small fraction of familial AD, the roles of these other genes in AD have not yet been determined. Late-onset familial AD and sporadic AD have been associated with the presence of the ε-4 allele of the ApoE gene (112,113). The mechanisms leading to increased risk for developing AD are uncertain and were recently investigated by several laboratories. Binding of apoE4 to Aβ appears to modulate amyloid fibril formation, although the nature of these biochemical interactions is controversial (114,116). In 1995, two partly homologous genes have been identified and termed presenilin-1 and 2 (109,117,118). Missense mutations in these genes account for almost two-thirds of early-onset forms of familial AD. The functions of these widely expressed proteins are not yet known and may include regulation of apoptosis (119), injury (120), cell fate (121), and/or cytoplasmic transport (122). Some mutations appear to affect APP processing and enhance the rate of aggregation of Aβ by increasing the fraction of the more amyloidogenic peptide A 1-42 (123–125). Recently, several laboratories have reported a possible increased susceptibility to oxidative damage or to apoptosis in cells transfected with mutated forms of presenilins (119). Other proteinaceous components of senile plaques have been described including antichymotrypsin (126) and an α-synuclein-derived fragment named NAC (127). The pathogenic significance of these proteins also is uncertain.
III.
TRANSGENIC MODELS OF ALZHEIMER’S DISEASE
The lack of an animal model of AD has hindered the study of the disease pathogenesis for many years. However, strides toward model development have recently been made with the generation of transgenic mouse models of AD. Some of these animals recapitulate salient neuropathological and behavioral features of the disease including senile plaque–like amyloid deposits and behavioral impairments. Admittedly, these are not perfect paradigms but nonetheless are beginning to have a sizable impact on our understanding of the disease mechanisms.
366
Pappolla et al.
Most of the mice created show no NFTs or cell loss although some of them develop conspicuous features of neurodegeneration such as dystrophic neuritic elements surrounding the plaque amyloid deposits. It should be remembered that many of the biochemical features of neuronal dystrophy, including immunoreactivity with antibodies against phosphorylated tau and ubiquitinilated proteins, are virtually identical to those found in NFTs. The characteristics of some recently created AD mice are summarized in Table 1. The extent of induction of the pathological phenotype varies in different lines of mice and appears to hinge on several distinct parameters. Some of these are (1) levels of APP expression, (2) type of APP transgene isoform, (3) strain genetic background, and (4) APP mutations. The individual contribution from each of the above-mentioned features (as well as the extent of their interaction) to the overall degree of abnormal phenotypic expression in the mice is currently unknown. Plaque-bearing mice generally express higher than normal levels of transgenic APP (128–130); however, the timing and extent of the amyloid deposits is modulated by a spectrum of interactions with the other mentioned factors. For example, mice expressing mutant APP bearing the KPI domain (APP751 and APP770) (130) develop amyloid deposits earlier than those expressing APP695 (60). Likewise, transgenic mice expressing a relative increase in the ratio of wild-type APP751/APP695 were found to develop diffuse amyloid deposits (131). Several recent studies suggest that the genetic background of the strain carrying the transgene and the expression of a number of ‘‘extraamyloid’’ genes exerts powerful influences in the expression of the pathological phenotypes. While some coexpressed proteins determine the extent and severity of amyloid deposition, others appear to modulate the degree of neurodegeneration. Because in sporadic AD neither APP mutations nor increased production of Aβ peptides causes amyloid deposition, the analysis of such cofactors may be critical to understanding the pathogenesis of the disorder. Several potentially relevant examples are as follows. Progeny resulting from a cross between an apolipoprotein E gene knockout line and mice bearing a mutant APP transgene, for example, showed a dramatic arrest in lesion development that apparently resulted from decreased or absent apolipoprotein E expression (132). In this study, the degree of Aβ deposition was inversely correlated with the number of ApoE genes. While knockout homozygous mice showed almost absent senile plaque–like deposits, heterozygous animals displayed intermediate levels of amyloid deposition (132). Another interesting lesion was observed in mice created by overexpressing transforming growth factor–β1 (TGF-β1), a protein with important roles in the response of the nervous tissue to injury (133,134). These mice developed perivascular deposits of Aβ in the absence of changes in the APP gene. When these mice were crossed with mice overexpressing mutant APP, which are known to develop AD-like neuropathology, development of the abnormal phenotype was
Main Characteristics of Some of the Mice Showing Aβ Deposits
Strains C3H/HeJx C57BL/6 C57BL/6xSJL C57BL/6, DBA-2, and Swiss-Webster C57BL/6 JU Balb/c x SJL
cDNA Mice APP695 with human Aβsw Human APP695 SW Human APP751 ‘‘minigene’’ Human APP751 SW SW ⫹ V7171 Human APP751 Human APPV717F with TGF-β1
Promoter
Level of APP expression
Abnormal τ phosphorylation
Ref.
Murine PrP
2-fold increase
Absent
128
Hamster PrP Human PDGF
5-fold increase 4-fold increase
Present Present
60 59
7-fold increase 2-fold increase Increased (level not determined) Increased
Present
129
Present
131
Not determined
135
Mouse Thy1/human Thy1 Human NSE Human PDGF
Transgenic Models in Alzheimer’s Disease
Table 1
367
368
Pappolla et al.
distinctly accelerated (135). Of obvious interest to our topic is the fact that TGFβ1 causes upregulation of several proteoglycan matrix proteins and that similar increases are also known to occur following oxidative injury (136). In this connection, proteoglycan matrix proteins have been proposed to function as abnormal chaperones leading to Aβ deposition (137,138). Similar coexpression experiments have also uncovered the influence of additional proteins in neurodegeneration. Co-overexpression of wild-type SOD1, for example, was found to be protective in a mouse strain in which expression of an APP transgene was associated with premature death (139). This finding supports the postulated role of oxidative stress in neurodegeneration. Several other background genes appear to modify the degree of neurodegeneration induced by mutant APP transgenes (140). Many of these genes remain to be discovered. Creation of bigenic lines is another ingenious approach that is also contributing to unravel the roles of the various genes involved in familial AD. Recent reports have shown that a doubly transgenic progeny coexpressing mutant presenilin-1, a gene responsible for a subgroup of early-onset familial AD, and mutant APP transgenes develop an accelerated AD phenotype earlier than that seen in littermates expressing singly mutated APP (128,141). Interestingly, mutant presenilin-1 transgenics exhibit subtle elevation of Aβ1-42 levels but no Aβ deposition (142). A.
Transgenic Alzheimer Mice as Models of Chronic Oxidative Stress
As discussed previously, several independent lines of investigation have now converged to suggest that oxidative stress may be important in the pathogenesis of AD. This information, however, does not resolve the issue of whether oxidative stress is a cause or a consequence of the disorder. Most importantly, the bulk of the evidence for a neurotoxic role of Aβ comes from in vitro data, and whether such toxicity exists in vivo has been questioned in several reports (143–147). The recent development of transgenic models of AD gives us an opportunity to find the answers for the stated questions and to gain insight into Aβinduced oxidative neurotoxicity in vivo. As a first step to validate such approaches for the study of free radical oxidation, it has recently been reported that the expression of copper/zinc superoxide dismutase (Cu/Zn-SOD) and hemeoxygenase-1 (HO-1), two key markers of oxidative stress, is abnormal in brain sections from a transgenic model of AD (62,63). As revealed by standard immunohistochemistry, the expression of the indicated oxidation markers provided a striking contrast between older transgene positive (Tg⫹) and transgene negative (Tg⫺) mice. The results offered remarkable parallels with earlier observations
Transgenic Models in Alzheimer’s Disease
369
in AD brains and previous in vitro studies that implicate Aβ in oxidative neurotoxicity (Fig. 4). The markers of oxidation were mainly colocalized with the amyloid deposits and overlapped topographically with areas showing increased products of lipid peroxidation and neuronal dystrophy as demonstrated by antibodies to adducts of the lipid peroxidation products, hydroxynonenal (HNE) as well as ubiquitin and tau antibodies, respectively (62,63). The results confirmed a relationship between oxidative stress and Aβ-mediated neurotoxicity in vivo. Such a connection is supported by the following findings: (1) marked accentuation of immunoreactivity for SOD, HO-1, and HNE around amyloid deposits; (2) presence of ubiquitin and tau reactive structures at the sites where oxidative
Figure 4 Representative comparative images from human and murine senile plaque pathology as visualized by immunohistochemistry with some of the markers discussed. The illustrated sections are immunostained with anti-Aβ (4G8), anti-SOD CuZn, and antiubiquitin antibodies and highlight senile plaques in AD brain and Tg⫹ mouse brain. Note highly abnormal immunoreactive deposits of these proteins. Anti-ubiquitin immunoreactivity colocalizes mostly with dystrophic processes. Increased expression of anti-oxidant enzymes (such as SOD) are one of the most typical responses to oxidative injury. (Magnification ⫻ 400.)
370
Pappolla et al.
stress is detected; (3) lack of immunoreactivity in Tg⫹ younger mice (which are devoid of amyloid deposits). Evidence of oxidative stress in aged mice could also be detected (to a much lesser degree), in areas topographically unrelated to senile plaque–like deposits. This was characterized by a fine granular pattern of reactivity with anti-HO-1 antibodies in two of three Tg⫹ mice, which suggests that the development of senile plaque pathology may not be necessary for oxidative injury to occur (62). We think that oligomeric and polymeric microaggregates of Aβ, not yet recognizable as fully developed plaques, are sufficient to produce a small but yet detectable induction of the stress response. Another possibility may involve APP overexpression that by itself may be a potential source of neuronal injury (148). Such a possibility, however, is highly unlikely since every injury indicator identified in the mice became apparent only after amyloid deposits begin to develop (no markers of oxidative stress or neuronal dystrophy can be detected in young Tg⫹ amyloid-free mice despite APP overexpression). Taken together, the results are in agreement with previous in vitro studies linking oxidative stress to Aβ toxicity. Confirmation of these interpretations in subsequent studies may help explain the apparent lack of correlation between cell loss and senile plaques in human brain (149,150). Although the findings previously discussed have been obtained in only one of several available AD mice, they validate the use of this paradigm as an in vivo system for the study of chronic oxidative neurotoxicity.
IV.
CONCLUDING REMARKS
The study of oxidative stress in AD as well as the evaluation of experimental antioxidant therapies has been hampered by the vexing level of complexity of the stress response in tissues. The use of transgenic AD animals as models of chronic oxidative stress will allow us to reexamine previous studies in vitro (regarding Aβ-induced oxidative neurotoxicity) and determine whether certain proposed mechanisms are germane to in vivo systems. Important questions regarding the integrity of the heat-shock response and antioxidant defenses in the aging process can now be investigated in this innovative paradigm. Likewise, limited information is currently available about the proposed neuroprotective roles of various cell interactions (i.e., glia–endothelium, neuron–glia) and other cytoprotective proteins (i.e., bcl-2 family, BAX, p53) during chronic oxidative stress. It will also be important to determine the overall contribution of cytokines, other inflammatory factors (151), and activated microglia (152) to oxidative stress. Finally, the transgenic approach will be invaluable in testing therapies aimed at reducing the overall oxidative burden associated with the disease.
Transgenic Models in Alzheimer’s Disease
371
ACKNOWLEDGMENTS Supported by grant numbers AG11130-03 and R55AG14381 to MAP and by a grant from LaMarato to FC-S.
REFERENCES 1. Tytell, M., Greenberg, S.G., Lasek, R.J. (1986) Heat shock-like protein is transferred from glia to axon. Brain. Res. 363:161–164. 2. Glenner, G.G., Wong, C.W. (1984) Alzheimer’s disease: Initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem. Biophys. Res. Commun., 120:885–890. 3. Masters, C.L., Simms, G., Weinman, N.A., Multhaup, G., McDonald, B.L., Beyreuther, K. (1985) Amyloid plaque core protein in Alzheimer’s disease and Down syndrome. Proc. Natl. Acad. Sci. USA 82:4245–4249. 4. Sisodia, S.S., Price, D.L. (1995) Role of the beta-amyloid protein in Alzheimer’s disease. FASEB J 9:366–370. 5. Esiri, M.M., Hyman, B., Beyreuther, K., Masters, C.L. (1997) Aging and dementia. In: Greenfield’s Neuropathology, 6th ed. (Graham, D.I., Lantio, P.L., eds.), Arnold, London, pp. 151–233. 6. Grundke-Iqbal, I., Iqbal, K., Tung, Y.C., Quinlan, M., Wiesniewski, H.M., Binder, L.I. (1986) Abnormal phosphorylation of the microtubule protein tau in Alzheimer’s cytoskeletal pathology. Proc. Natl. Acad. Sci. USA 83:4913–4917. 7. Kosik, K.S. (1993) The molecular and cellular biology of tau. Brain. Pathol. 3:39– 43. 8. Miller, D.L., Papayannopoulos, I.A., Styles, J., Bobin, S.A., Lin, Y.Y., Biemann, K., Iqbal, K. (1993) Peptide compositions of the cerebrovascular and senile plaque core amyloid deposits of Alzheimer’s disease. Arch. Biochem. Biophys. 301:41– 52. 9. Mori, H., Takio, K., Ogawara, M., Selkoe, D.J. (1992) Mass spectrometry of purified amyloid protein in Alzheimer’s disease. J. Biol. Chem. 267:17082–17086. 10. Kang, J., Lemaire, H-G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschik, K-H., Multhaup, G., Beyreuther, K., Muller-Hill, B. (1987) The precursor of Alzheimer’s disease amyloid A4 protein resembles a cell-surface receptor. Nature 324: 733–736. 11. Higgins, L.S., Murphy Jr., G.M., Forno, L.S., Catalano, R., Cordell, B. (1996). P3 β-amyloid peptide has a unique and potentially pathogenic immunohistochemical profile in Alzheimer’s disease brain. Am. J. Pathol. 149:585–596. 12. Goldgaber, D., Lerman, M.I., McBride, O.W., Saffiotti, U., Gadjusek, D.C. (1987) Characterization and chromosomal localization of a cDNA encoding brain amyloid of Alzheimer’s disease. Science 235:877–880. 13. Robakis, N.K., Ramakrishna, N., Wolfe, G., Wisniewski, H.M. (1987) Molecular cloning and characterization of a cDNA encoding the cerebrovascular and the neuritic plaque amyloid peptides. Proc. Natl. Acad. Sci. USA 84:4190–4194.
372
Pappolla et al.
14. Kitaguchi, N., Takahashi, Y., Tokushima, Y., Shiojiri, S., Ito, H. (1988) Novel precursor of Alzheimer’s disease amyloid protein shows protease inhibitory activity. Nature 331:530–532. 15. Ponte, P., Gonzales-Dewhitt, P., Schilling, J.P., Miller, J., Hsu, D., Greenberg, B., Davis, K., Wallace, W., Lieberburg, I., Fuller, F., Cordell, B. (1988) A new A4 amyloid mRNA contains a domain homologous to serine protease inhibitors. Nature 331:525–527. 16. Tanzi, R.E., McClatchey, A.I., Lamperti, E.D., Villa-Komaroff, L., Gusella, J.F., Neve, R.L. (1988) Protease inhibitor domain encoded by an amyloid precursor mRNA associated with Alzheimer’s disease. Nature 331:528–530. 17. Golde, T.E., Estus, S., Usiak, M., Younkin, L.H., Younkin, S.G. (1990) Expression of beta amyloid protein precursor mRNAs: recognition of a novel alternatively spliced form and quantitation in Alzheimer’s disease using PCR. Neuron 4:253– 267. 18. Weidemann, A., Konig, G., Bunke, D., Fisher, P., Salbaum, J.M., Masters, C.L., Beyreuther, K. (1989) Identification, biogenesis, and localization of precursors of Alzheimer’s disease A4 amyloid protein. Cell 57:115–126. 19. Schubert, D., Lin, L-W., Saitoh, T., Cole, G. (1989) The regulation of the amyloid beta protein and its modulatory role in cell adhesion. Neuron 3:689–694. 20. Breen, K.C., Bruce, M., Anderton, B.H (1991) Beta amyloid precursor protein mediates neuronal cell-cell and cell-surface adhesion. J. Neurosci. Res. 28:90–100. 21. Shioi, J.S., Anderson, J.P., Ripellino, J.P., Robakis, N.K. (1990) Chondroitin sulfate proteoglycan form of the Alzheimer beta amyloid precursor. J. Biol. Chem. 265: 4492–4497. 22. Haas, C., Selkoe, D.J. (1993) Cellular processing of beta-amyloid precursor protein and the genesis of amyloid beta-peptide. Cell. 75:1039–1042. 23. Frangione, B., Castano, E.M., Wisniewski, T., Ghiso, J., Prelli, F., Vidan, R. (1996) Apolipoprotein E and amyloidogenesis. Ciba Found. Symp. 199:132–141. 24. Palmert, M.R., Golde, T.E., Cohen, M.L., Kovacs, D.M., Tanzi, R.E., Gusella, J.F., Usiak, M.F., Younkin, L.H., Younkin, S.G. (1988) Amyloid protein precursor messenger RNAs: differential expression in Alzheimer’s disease. Science 241:1080– 1084. 25. Neve, R.L., Robakis, N.K. (1998) Alzheimer’s disease: a re-examination of the amyloid hypothesis. Trends Neurosci. 21:15–19. 26. Gandy, S., Greengard, P. (1994) Processing of Alzheimer A beta-amyloid precursor protein: cell biology, regulation, and role in Alzheimer disease. Int. Rev. Neurobiol. 36:29–50. 27. Sambamurti, K., Shioi, J., Anderson, J.P., Pappolla, M.A., Robakis, N.K. (1992) Evidence for intracellular cleavage of the Alzheimer’s amyloid precursor in PC12 cells. J. Neurosci. Res. 33:319–329. 28. DeStrooper, B., Umans, L., VanLeuven, F., VanDen Berghe, H. (1993) Study of the synthesis and secretion of normal and artificial mutants of murine amyloid precursor protein (APP):Cleavage occurs in a compartment of the default secretory pathway. J. Cell Biol. 121:295–304. 29. Anderson, J.P., Esch, F.S., Keim, P.S., Robakis, N.K. (1991) Exact cleavage site of Alzheimer s amyloid precursor in neuronal PC-12 cels. Neurosci. Lett. 128:126–129.
Transgenic Models in Alzheimer’s Disease
373
30. Caporaso, G.L., Gandy, S.E., Buxbaum, J.D., Ramabhadran, T.V., Greengard, P. (1992) Protein phosphorylation regulates secretion of Alzheimer β/A4 amyloid precursor protein. Proc. Natl. Acad. Sci. USA 89:3055–3059. 31. Koo, E.H. (1997) Phorbol esters affect multiple steps in beta-amyloid precursor protein trafficking and amyloid beta-protein production. Mol. Med. 3:204– 211. 32. Buxbaum, J.D., Oishi, M., Chen, H.I., Pinkas-Kramarski, R., Jaffe, E.A., Gandy, S.E., Greengard, P. (1992) Cholinergic agonists and interleukin 1 regulate processing and secretion of the Alzheimer β/A4 amyloid protein precursor. Proc. Natl. Acad. Sci. USA 89:10075–10078. 33. Refolo, L.M., Salton, S.R.J., Anderson, J.P., Mehta, P., Robakis, N.K. (1989) Nerve and epidermal growth factors induce the release of the Alzheimer amyloid precursor from PC-12 cell cultures. Biochem. Biophys. Res. Commun. 164:664–670. 34. Maruyama, K., Usami, M., Yamao-Harigaya, W., Tagawa, K., Ishiura, S. (1991) Mutation of Glu693 or Val717 to Ile has no effect on the processing of Alzheimer amyloid precursor protein expressed in COS-1 cells by cDNA transfection. Neurosci. Lett. 132:97–100. 35. Haas, C., Schlossmacher, M.G., Hung, A.Y., Vigo-Pelfrey, C., Mellon, A., Ostaszewski, B.L., Lieberburg, I., Koo, E.H., Schenk, D., Teplow, D.B., Selkoe, D.J. (1992) Amyloid β-peptide is produced by cultured cells during normal metabolism. Nature 359:322–324. 36. Seubert, P., Vigo-Pelfrey, C., Esch, F., Lee, M., Dovey, H., Davis, D., Sinha, S., Schlossmacher, M., Whaley, J., Swindlehurst, C., McCormack, R., Wolfert, R., Selkoe, D.J., Lieberburg, I., Schenk, D. (1992) Isolation and quantification of soluble Alzheimer’s β-peptide from biological fluids. Nature 359:325–327. 37. LeBlanc, A.C., Papadopoulos, M., Belair, C., Chu, W., Crosato, M., Powell, J., Goodyear, C.G. (1997) Processing of amyloid precursor protein in human primary neuron and astrocyte cultures. J. Neurochem. 68:1183–1190. 38. Chartier-Harlin, M.C., Crawford, F., Houlden, H., Warren, A., Hughes, D., Fidani, L., Goate, A., Rossor, M., Roques, P., Hardy, J., Mullan, M. (1991) Early-onset Alzheimer’s disease caused by mutations at codon 717 of the beta-amyloid precursor protein gene. Nature 353:844–846. 39. Goate, A., Chartier-Harlin, M.C., Mullan, M., Brown, J., Crawford, F., Fidani, L., Giuffra, L., Haynes, A., Irving, N., James, L., Mant, R, Newton, P., Rooke, K., Roques, P., Talbot, C., Pericak-Vance, M., Roses, A., Williamson, R., Rossor, M., Owen, M., Hardy, J. (1991) Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease. Nature 349:704– 706. 40. Murrell, J., Farlow, M., Ghetti, B., Benson, M.D. (1991) A mutation in the amyloid precursor protein associated with hereditary Alzheimer’s disease. Science 254:97– 99. 41. Naruse, S., Igarashi, S., Kobayashi, H., Aoki, K., Inuzuka, T., Kaneko, K., Shimizu, T., Iihara, K., Kojima, T., Miyatake, T. and Tsuji, S. (1991) Missense mutation Val → Ile in exon 17 of amyloid precursor protein gene in Japanese familial Alzheimer’s disease. Lancet. 337:978–979. 42. Mullan, M., Crawford, F., Axelman, K., Houlden, H., Lilius, L., Winblad, B., Lann-
374
43.
44.
45.
46. 47.
48.
49.
50. 51. 52.
53.
54.
55.
56.
57.
Pappolla et al. felt, L. (1992) A pathogenic mutation for probable Alzheimer’s disease in the APP gene at the N terminus of beta-amyloid. Nature Genet. 1:345–347. Kennedy, A.M., Newman, S., McCaddon, A., Ball, J., Roques, P., Mullan, M., Hardy, J., Chartier-Harlin, M.C., Frackowiak, R.S., Warrington, E.K. (1993) Familial Alzheimer’s disease. A pedigree with a mis-sense mutation in the amyloid precursor protein gene (amyloid precursor protein 717 valine → glycine). Brain 116: 309–324. Yankner, B.A., Duffy, L.K., Kirschner, D.A. (1990) Neurotrophic and neurotoxic effects of amyloid protein: reversal by tachykinin neuropeptides. Science 250:279– 282. Pappolla, M.A., Sos, M., Omar, R.A., Bick, R.J., Hickson-Bick, D.L., Reiter, R.J., Efthimiopoulos, S., Robakis, N.K. (1997) Melatonin prevents death of neuroblastoma cells exposed to the Alzheimer amyloid peptide. J. Neurosci. 17:1683– 1690. Pike, C.J., Cotman, C.W. (1993) Cultured GABA-immunoreactive neurons are resistant to toxicity induced by amyloid. Neuroscience 56:269–274. Bozner, P., Grishko, V., LeDoux, S.P., Wilson, G.L., Chyan, Y-J., Pappolla, M.A. (1997) The amyloid protein induces oxidative damage of mitochondrial DNA. J. Neuropathol. Exp. Neurol. 56:1356–1362. Zhao, X., Valantas, J.A., Vyas, S., Duffy L.K. (1993) Comparative toxicity of amyloid beta peptide in neuroblastoma cell lines; effects of albumin and physalaemin. Comp. Biochem. Physiol. 106:165–170. Behl, C., Davis, J.B., Cole, G.M., Schubert, D. (1992) Vitamin E protects nerve cells from amyloid protein toxicity. Biochem. Biophys. Res. Commun. 186:944– 950. Behl, C., Davis, J.B., Klier, F.G., Schubert, D. (1994) Amyloid beta peptide induces necrosis rather than apoptosis. Brain. Res. 645:253–264. Behl, C., Davis, J.B., Lesley, R., Schubert, D. (1994). Hydrogen peroxide mediates amyloid protein toxicity. Cell 77:817–827. Shearman, M.S., Ragan, C.I., Iversen, L.L. (1994) Inhibition of PC12 cell redox activity is a specific, early indicator of the mechanism of beta-amyloid mediated cell death. Proc. Natl. Acad. Sci. USA 91:1470–1474. Zhang, Z., Drzewiecki, G.H., Hom, J.P., May, P.C., Hyslop, P.A. (1994) Human cortical neuronal (HCN) cell lines: a model for amyloid beta neurotoxicity. Neurosci. Lett. 177:162–164. Schubert, D., Behl, C., Lesley, R., Brack, A., Dargusch, R., Sagara, Y., Kimura, H. (1995) Amyloid peptides are toxic via a common oxidative mechanism. Proc. Natl. Acad. Sci. USA 92:1989–1993. Harris, M.E., Hensley, K., Butterfield, D.A., Leedle, R.A., Carney, J.M. (1995). Direct evidence of oxidative injury produced by the Alzheimer’s beta-amyloid peptide (1–40) in cultured hippocampal neurons. Exp. Neurol. 131:193–202. Hensley, K., Carney, J.M., Mattson, M.P., Aksenova, M., Harris, M., Wu, J.F., Floyd, R.A., Butterfield, D.A. (1994) A model for beta-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: Relevance to Alzheimer disease. Proc. Natl. Acad. Sci. USA 91:3270–3274. Tagliavini, F., Giaccone, G., Frangione, B., Bugiani, O. (1988) Preamyloid deposits
Transgenic Models in Alzheimer’s Disease
58.
59.
60.
61.
62.
63.
64. 65.
66. 67. 68.
69.
70. 71. 72.
375
in the cerebral cortex of patients with Alzheimer’s disease and nondemented individuals. Neurosci. Lett. 93:191–195. Pappolla, M.A., Robakis, N.K. (1995) Neuropathology and molecular biology of Alzheimer’s disease. In: Perspectives in Behavioral Medicine: Alzheimer’s Disease (Stein, M. and Baum, M., eds.), Academic Press, San Diego. Games, D., Adams, D., Allesandrini, R., Barbour, R., Berthelette, P., Blackwell, C., Carr, T., Clemens, J., Donaldson, T., Gillespie, F. (1995) Alzheimer-type neuropathology in transgenic mice overexpressing V717F β-amyloid precursor protein. Nature 373:523–527. Hsiao, K., Chapman, P., Nilsen, S., Eckman, C., Harigaya, Y., Younkin, S., Yang, F., Cole, G. (1996). Correlative memory deficits, Aβ elevation, and amyloid plaques in transgenic mice. Science 274:99–102. Masliah, E., Sisk, A., Mallory, M., Mucke, L., Schenk, D., Games, D. (1996) Comparison of neurodegenerative pathology in transgenic mice overexpressing V717Famyloid precursor protein and Alzheimer’s disease. J. Neurosci. 16:5795–5811. Pappolla, M.A., Chyan, Y-J., Omar, R.A., Hsiao, K., Perry, G., Smith, M.A., Bozner, P. (1998). Evidence of oxidative stress and in vivo neurotoxicity of beta amyloid in a transgenic mouse model of Alzheimer’s disease: a chronic oxidative paradigm for testing antioxidant therapies in vivo. Am. J. Pathol. 152:871–877. Smith, M.A., Hirai, K., Hsiao, K., Pappolla, M.A., Harris, P.L.R., Siedlak, S.L., Tabaton, M., Perry, G. (1998) Amyloid-beta deposition in Alzheimer transgenic mice is associated with oxidative stress. J. Neurochem. 70:2212–2215. Busciglio, J., Lorenzo, A., Yankner, B.A. (1992) Methodological variables in the assessment of beta amyloid neurotoxicity. Neurobiol. Aging 13:609–612. Pike, C.J., Burdick, D., Walencewicz, A.J., Glabe, C.G., Cotman, C.W. (1993) Neurodegeneration induced by β-amyloid peptide in vitro: The role of peptide assembly state. J. Neurosci. 13:1676–1687. Lorenzo, A., Yankner, B.A. (1994) Beta-amyloid neurotoxicity requires fibril formation and is inhibited by Congo red. Proc. Natl. Acad. Sci. USA 91:12243–12247. Barrow, C.J., Zagorski, M.G. (1991) Solution structures of peptide and its constituent fragments: relation to amyloid deposition. Science 253:179–182. Hilbich, C., Kisters-Woike, B., Reed, J., Masters, C.L., Beyreuther, K. (1991) Aggregation and secondary structure of synthetic amyloid A4 peptides in Alzheimer’s disease. J. Mol. Biol. 218:149–163. Burdick, D., Soregan, B., Kwon, M., Kosmoski, J., Knauer, M., Henschen, A., Yates, J., Cotman, C.W., Glabe, C. (1992) Assembly and aggregation properties of synthetic Alzheimer’s A4/amyloid peptide analogs. J. Biol. Chem. 267:546– 554. Harman, D. (1956) Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 11:298–300. Volicer, L., Crino, B. (1990) Involvement of free radicals in dementia of the Alzheimer’s type: a hypothesis. Neurobiol. Aging 11:567–571. Smith, C.D., Carney J.M., Starke-Reed, P.E., Oliver, C.N., Stadtman, E.R., Floyd, R.A., Markesbery, W.R. (1991) Excess brain protein oxidation and enzyme dysfunction in normal aging and in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 88:10540–10543.
376
Pappolla et al.
73. Pappolla, M.A., Omar, R.A., Kim, K.S., Robakis, N.K. (1992) Immunohistochemical evidence of oxidative stress in Alzheimer’s disease. Am. J. Pathol. 140:621– 628. 74. Furuta, A. Price, D.L., Pardo, C., Troncoso, J.C., Xu, Z-S., Taniguchi N., Martin, L.J. (1995) Localization of superoxide dismutases in Alzheimer’s disease and Down syndrome neocortex and hippocampus. Am. J. Pathol. 146:357–367. 75. Smith, M.A., Kutty, R.K., Richey, P.L., Yan, S.D., Stern, D., Chader, G.J., Wiggert, B., Petersen, R.B., Perry, G. (1994) Heme oxygenase-1 is associated with the neurofibrillary pathology of Alzheimer’s disease. Am. J. Pathol. 145:42–47. 76. Hamos, J.E., Oblas, B., Pulaski-Salo, B.S., Welch, W.J., Bole, D.G., Drachman, D.A. (1991) Expression of heat-shock proteins in Alzheimer’s disease. Neurology 41:345–350. 77. Cole, G.M., Timiras, P.S. (1987) Ubiquitin-protein conjugates in Alzheimer’s lesions. Neurosci. Lett. 79:207–212. 78. Mori, H., Kondo, J., Ihara, Y. (1987) Ubiquitin is a component of paired helical filaments in Alzheimer’s disease. Science 235:1641–1644. 79. Perry, G., Friedman, R., Shaw, G., Chau, V. (1987) Ubiquitin is detected in neurofibrillary tangles and senile plaque neurites of Alzheimer disease brains. Proc. Natl. Acad. Sci. USA 84:3033–3036. 80. Pappolla, M.A., Omar, R.A., Saran, B. (1989) The ‘‘normal’’ brain. ‘‘Abnormal’’ ubiquitinilated deposits highlight an age-related protein change. Am. J. Pathol. 135: 585–591. 81. Cataldo, A.M., Nixon, R.A. (1990) Enzymatically active lysosomal proteases are associated with amyloid deposits in Alzheimer brain. Proc. Natl. Acad. Sci. USA 87:3861–3865. 82. Omar, R.A., Pappolla, M.A., Argani, I., Davis, K. (1993) Acid phosphatase in senile plaque and CSF of Alzheimer’s disease patients. Arch. Pathol. Lab. Med. 117:166– 169. 83. Smith, M.A., Rudnicka-Nawrot, M., Richey P.L., Praprotnik, D., Mulvihill, P., Miller, C.A. Sayre, L.M., Perry, G. (1995) Carbonyl-related posttranslational modification of neurofilament protein in the neurofibrillary pathology of Alzheimer’s disease. J. Neurochem. 64:2660–2666. 84. Montine, K.S., Kim, P.J., Olson, S.J., Markersbery, W.R., Montine, T.J. (1997) 4Hyroxy-2-nonenal pyrrole adducts in human neurodegenerative disease. J. Neuropathol. Exp. Neurol. 56:866–871. 85. Subbarao, K.V., Richardson, J.S., Ang, L.C. (1990) Autopsy samples of Alzheimer’s cortex show increased lipid peroxidation in vitro. J. Neurochem. 55:342–345. 86. Mecocci, P., MacGarvey, U., Beal, M.F. (1994) Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease. Ann. Neurol. 36:747–751. 87. Cotman, C.W. (1998) Apoptosis decision cascades and neuronal degeneration in Alzheimer’s disease. Neurobiol. Aging 19 (1 suppl):S29–S32. 88. De Keyser, J., Ebinger, G., Vanguelin, G. (1990) D1-receptor abnormality in frontal cortex points to a functional alteration of cortical cell membranes in Alzheimer’s disease. Arch. Neurol. 47:761–763. 89. Imlay, J.A., Chin, S.M., Linn, S. (1988) Toxic DNA damage by hydrogen peroxide through the Fenton reaction in vivo and in vitro. Science 240:1302–1309.
Transgenic Models in Alzheimer’s Disease
377
90. Yan, S.D., Chen, X., Fu, J., Chen, M., Zhu, H., Roher, A., Slattery, T., Zhao, L., Nagashima, M., Morser, J., Migheli, A., Nawroth, P., Stern, D., Schmidt, A.M. (1996) RAGE and amyloid-peptide neurotoxicity in Alzheimer’s disease. Nature 382:685–691. 91. Pappolla, M.A., Chyan, Y.-J., Bozner, P., Martin, B., Frangione, B., Hsiao, K., Omar, R.A., Perry, G., Smith, M.A., Ghiso, J. NADPH-cytochrome P450 reductase mediates oxidative stress induced by the amyloid b protein. Soc. Neurosci. (L.A.) 1998 abstract. 92. Mark, R.J., Hensley, K., Butterfield, D.A., Mattson, M.P. (1995) Amyloid-peptide impairs ion-motive ATPase activities: evidence for a role in the loss of neuronal Ca 2⫹ homeostasis and cell death. J. Neurosci. 15:6239–6249. 93. Mattson, M.P., Cheng, B., Davis, D., Bryant, K., Lieberburg, I., Rydel, R.E. (1992) Amyloid peptides destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J. Neurosci. 12:376–389. 94. Mattson, M.P. (1990) Excitatory amino acids, growth factors and calcium: a teetertotter model for neural plasticity and degeneration. In: Excitatory Amino Acids and Neuronal Plasticity (Ben-Ari, Y., ed.), Plenum Press, New York. 95. Morel, F., Doussiere, J., Vignais, P.V. (1991) The superoxide-generating oxidase of phagocytic cells. Eur. J. Biochem. 201:523–546. 96. Smith, M.A., Harris, P.L.R., Sayre, L.M., Beckman, J.S., Perry G. (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J. Neurosci. 17: 2653–2657. 97. Good, P.F., Werner, P., Hsu, A., Olanow, C.W., Perl, D.P. (1996) Evidence for neuronal oxidative damage in Alzheimer’s disease. Am. J. Pathol. 149:21– 28. 98. Wood, J.G., Mirra, S.S., Pollock, N.J., Binder, L.I. (1986) Neurofibrillary tangles of Alzheimer’s disease share antigenic determinants with the axonal microtubuleassociated protein tau. Proc. Natl. Acad. Sci. USA 83:4040–4043. 99. Papasozomenos, S.C., Su, Y. (1991) Altered phosphorylation of tau protein in heatshock rats and patients with Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 88: 4543–4547. 100. Omar, R.A., Pappolla, M.A. (1993) Oxygen free radicals as inducers of heat shock protein synthesis in cultured human neuroblastoma cells: Relevance to neurodegenerative disease. Eur. Arch. Psychiatr. Clin. Neurosci. 651:1–6. 101. Troncoso, J.C., Costello, A., Watson, A.L., Jr., Johnson, G.V.W. (1993) In vitro polymerization of oxidated tau into filaments. Brain. Res. 613:313–316. 102. Schweers, O., Mandelkow, E.M., Biernat, J., Mandelkow, E. (1995) Oxidation of cysteine-322 in the repeat domain of microtubule-associated protein tau controls the in vitro assembly of paired helical filaments. Proc. Natl. Acad. Sci. USA 92: 8463–8467. 103. Busciglio, J., Lorenzo, A., Yeh, J., Yankner, B.A. (1995) β-amyloid fibrils induce tau phosphorylation and loss of microtubule binding. Neuron 14:879–888. 104. Games, D., Khan, K.M., Soriano, F.G., Davis, D.L., Bryant, K., Lieberburg, I. (1992) Lack of Alzheimer’s pathology after β-amyloid protein injections in the brain. Neurobiol. Aging 13:569–576. 105. Podlisny, MB., Sephenson, DT., Frosch, MP., Leiberburg, I., Clemens, JA., Selkoe,
378
106.
107.
108.
109.
110. 111.
112.
113.
114.
115. 116.
117.
118.
Pappolla et al. D.J. (1992) Synthetic β-amyloid protein fails to produce specific neurotoxicity in monkey cerebral cortex. Neurobiol. Aging 13:561–568. Stein-Beherns, B., Adams, K., Yeh, M., Sapolsky, R. (1992) Failure of beta-amyloid protein fragment 25–35 to cause hippocampal damage in the rat. Neurobiol. Aging 13:577–579. Geula, C., Wu, C-K., Saroff, D., Lorenzo, A., Yuan, M., Yankner, BA. (1998) Aging render the brain vulnerable to amyloid β-protein neurotoxicity. Nature Med. 4:827–831. Weldon, D.T., Maggio, J.E., Mantyh, P.W. (1997) New insights into the neuropathology and cell biology of Alzheimer’s disease. Geriatrics 52 (suppl) 2:13– 16. Sherrington, R., Rogaev, E.I., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Fonci, J.-F., Bruni, A.C., Montesi, M.P., Sorbi, S., Rainero, I., Pinessi, L., Nee, L., Chumakov, I., Pollen, D., Brookes, A., Sanseau, P., Polinsky, R.J., Wasco, W., Da Silva, H.A.R., Haines, J.L., Pericak-Vance, M.A., Tanzi, R.E., Roses, A.D., Fraser, P.E., Rommens, J.M., St George-Hyslop, P.H. (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease. Nature 375:734. Hardy, J., Hutton, M. (1995) Two new genes for Alzheimer’s disease. Trends Neurosci. 18:436. Tanzi, R.E., Kovacs, D.M., Kim, T.W., Moir, R.D., Guenette, S.Y., Wasco, W. (1996) The gene defects responsible for familial Alzheimer’s disease. Neurobiol. Dis. 3:159–168. Strittmatter, W.J., Weisgraber, K.H., Huang, D.Y., Dong, L.M., Salvesen, G.S., Pericak-Vance, M., Schmechel, D., Saunders, A.M. Goldgaber, D., Roses, A.D. (1993) Binding of human apolipoprotein E to synthetic amyloid beta peptide: Isoform-specific effects and implications for late-onset Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 90:8098–8102. Rebeck, G.W., Reiter, J.S., Strickland, D.K., Hyman, B.T. (1993) Apolipoprotein E in sporadic Alzheimer’s disease: allelic variation and receptor interactions. Neuron 11:575–580. Wisniewski, T., Casta˜o, E.M., Golabek, A., Vogel, T., Frangione, B. (1994) Acceleration of Alzheimer’s fibril formation by apolipoprotein E in vitro. Am. J. Pathol. 145:1030–1035. Naiki, H., Nakakuki, K. (1996) First-order kinetic model of Alzheimer’s β-amyloid fibril extinction in vitro. Lab. Invest. 74:374. Naiki, H., Gejyo, F., Nakakuki, K. (1997) Concentration-dependent inhibitory effects of apolipoprotein E on Alzheimer’s beta-amyloid fibril formation in vitro. Biochemistry 36(20):6243–6250. Levy-Lahad, E., Wasco, W., Poorkaj, P., Romano, D.M., Oshima, J., Pettingell, W.H., Yu, C.E., Jondro, P.D., Schmidt, S.D., Wang, K. (1995) Candidate gene for the chromosome 1 familial Alzheimer’s disease locus. Science 269:973–977. Rogaev, E.I., Sherrington, R., Rogaeva, E.A., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K., Tsuda, T. (1995). Familial Alzheimer’s disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer’s disease type 3 gene. Nature 376:775–778.
Transgenic Models in Alzheimer’s Disease
379
119. Guo, Q., Soper, B.L., Furukawa, K., Robinson, N., Martin, G.M., Mattson, M.P. (1997). Alzheimer’s presenilin mutation sensitizes neural cells to apoptosis induced by trophic factor withdrawal and amyloid beta-peptide: involvement of calcium and oxyradicals. J. Neurosci. 17:4212–4222. 120. Cribbs, D.H., Chen, L.S., Cotman, C.W., LaFerla, F.M. (1996) Injury induces presenilin-1 gene expression in mouse brain. NeuroReport 7:1773–1776. 121. De Stooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J.S., Schroeter, E.H., Schrijvers, V., Wolfe, M.S., Ray, W.J., Goate, A., Kopan, R. (1999) A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398:518–522. 122. Dewji, N.N., Singer, S.J. (1996). Specific transcellular binding between membrane proteins crucial to Alzheimer disease. Proc. Natl. Acad. Sci. USA 93:12575–12580. 123. Scheuner, D., Song, X., Suzuki, N., Bird, T., Citron, M., Suzuki, N., Bird, T.D., Hardy, J., Hutton, M., Kukull, W., Larson, E., Levy-Lahad, E., Viitanen, M., Peskind, E., Poorkaj, P., Schellenberg, G., Tanzi, R., Wasco, W., Lannfelt, L., Selkoe, D., Younkin, S. (1996). Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nature Med. 2: 864–870. 124. Lemere, C.A., Lopera, F., Kosik, K.S., Lendon, C.L., Ossa, J., Saido, T.C., Yamaguchi, H. Ruiz, A., Martinez, A., Madrigal, L., Hincapie, L., Arango, J.C.L., Anthony, D.C., Koo, E.H., Goate, A.M., Selkoe, D.J., Arango, J.C.V. (1996). The E280A presenilin 1 Alzheimer mutation produces increased Aβ42 deposition and severe cerebellar pathology. Nature Med. 2:1146–1150. 125. Duff, K., Eckman, C., Zehr, C., Yu, X., Prada, C.-M., Perez-tur, J., Hutton, M., Buee, L., Harigaya, Y., Yager, D., Morgan, D., Gordon, M.N., Holcomb, L., Refolo, L., Zenk, B., Hardy, J., Younkin, S. (1996). Increased amyloid-β42(43) in brains of mice expressing mutant presenilin 1. Nature 383:710–713. 126. Abraham, C.R., Selkoe, D.J., Potter, H. (1988) Immunochemical identification of the serine protease inhibitor α1-antichymotrypsin in the brain amyloid deposits of Alzheimer’s disease. Cell 52:487–501. 127. Ueda, K., Fukushima, H., Maslian, E., Xia, Y., Iwai, A., Yoshimoto, M., Otero, D.A.C., Kondo, J., Ihara, Y., Saitoh, T. (1993) Molecular cloning of a novel component of amyloid in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 90:11282– 11286. 128. Borchelt, D.R., Ratovitski, T., Lare, J.V., Lee, K.M., Gonzales, V., Jenkins, N.A., Copeland, N.G., Price, D.L., Sisodia, S. (1997) Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19:939–945. 129. Sturchler-Pierrat, C., Abramowski, D., Duke, M., Wiederold, K.H., Mistl, C., Rothacher, S., Ledermann, B., Burki, K., Frey, P., Paganetti, A., Waridel, C., Calhoun, M.E., Jucker, M., Probst, A., Staufenbiel, M., Sommer, B. (1997) Two amyloid precursor protein transgenic mouse models with Alzheimer disease-like pathology. Proc. Natl. Acad. Sci. USA 94:13287–13292. 130. Games, D., Adams, D., Alessandrini, R., Barbour, R., Berthelette, P., Blackwell, C., Carr, T., Clemens, J., Donaldson, T., Gillespie, F., Guido, T., Hagoplan, S.,
380
131.
132.
133. 134. 135.
136.
137. 138.
139.
140.
141.
142.
Pappolla et al. Johnson-Wood, K., Khan, K., Lee, M., Lelbowitz, P., Lieberburg, I., Little, S., Masllah, E., McConlogue, L., Montoya-Zavala, M., Mucke, L., Paganini, L., Pennlman, E., Power, M., Schenk, D., Seubert, P., Snyder, B., Soriano, F., Tan, H., Vitale, J., Wadsworth, S., Wolozin, B., Zhao, J. (1995) Alzheimer-type neuropathology in transgenic mice overexpressing V717F β-amyloid precursor protein. Nature 373:523–527. Quon, D., Wang, Y., Catalano, R., Scardina, J.M., Murakami, K., Cordell, B. (1991) Formation of β-amyloid protein deposits in brains of transgenic mice. Nature 352: 239–241. Bales, K.R., Verina, T., Dodel, R.C., Du, Y., Altstiel, L., Bender, M., Hyslop, P., Johnstone, E.M., Little, S.P., Cummins, D., Piccardo, P., Ghetti, B., Paul, S.M. (1997) Lack of apolipoprotein E dramatically reduces amyloid β-peptide deposition. Nature Genet. 17:263–264. Finch, C.E., Laping, N., Morgan, T.E., Nichols, N.R., Pasinetti, G.M. (1993) TGFβ1 is an organizer of responses to neurodegeneration. J. Cell Biochem. 53:314–322. McCartney-Francis, N.L., Wahl, S.M. (1994) Transforming growth factor β: a matter of life and death. J. Leuk. Biol. 55:401–409. Wyss-Coray, T., Masliah, E., Mallory, M., McConlogues, L., Johnson-Wood, K., Lin, C., Mucke, L. (1997) Amyloidogenic role of cytokine TGF-β1 in transgenic mice and in Alzheimer’s disease. Nature 389:603–606. Gasic, A.C., McGuire, G., Krater, S., Farhood, A.I., Goldstein, M.A., Smith, C.W., Entman, M.L., Taylor, A.A. (1991) Hydrogen peroxide pretreatment of perfused canine vessels induces ICAM-1 and CD18-dependent neutrophil adherence. Circulation 84(5):2154–2166. Fillit, H., Leveugle, B. (1995) Disorders of the extracellular matrix and the pathogenesis of senile dementia of the Alzheimer’s type. Lab. Invest. 72:249–253. Wisniewski, T., Frangione, B. (1992) Apolipoprotein E: a pathological chaperone protein in patient with cerebral and systemic amyloid angiopathy in Alzheimer’s disease and Lewy body variant. Neurosci. Lett. 135:235–238. Carlson, G.A., Borchelt, D.R., Dake, A., Turner, S., Danielson, V., Coffin, J.D., Eckman C. Meiners, J., Nilsen, S.P., Younkin, S.G., Hsiao, K.K. (1997) Genetic modification of the phenotypes produced by amyloid precursor protein overexpression in transgenic mice. Hum. Mol. Gen. 6:1951–1959. Hsiao, K., Brochelt, D., Olson, K., Johannsdottir, R., Kitt, C., Yunis, W., Xu, S., Eckman, C., Younkin, S., Price, D., Iadecola, C., Clark, H.B., Carlson, G. (1995) Age-related CNS disorder and early death in transgenic FVB/N mice overexpressing Alzheimer amyloid precursor proteins. Neuron 15:1203–1218. Holcomb, L., Gordon, M.N., McGowan, E., Yu, X., Benkovic, S., Jantzen, P., Wright, K., Saad, I., Mueller, R., Morgan, D., Sanders, S., Zehr, C., O Campo, K., Hardy, J., Prada, C.M., Eckman, C., Younkin, S., Hsiao, K., Duff, K. (1998) Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat. Med. 4(1):97–100. Duff, K., Eckman, K., Zehr, C., Yu, X., Prada, C-M., Perez-tur, J., Hutton, M., Buee, L., Harigaya, Y., Yager, D., Morgan, D., Gordon, M.N., Holcomb, L., Refolo, L., Zenk, B., Hardy, J., Younkin, S. Increased amyloid-β42(43) in brain of mice expressing mutant presenilin 1. Nature. 383:710–713.
Transgenic Models in Alzheimer’s Disease
381
143. Games, D., Khan, K.M., Soriano, F.G., Davis, D.L., Bryant, K., Leiberburg, I. (1992) Lack of Alzheimer pathology after β-amyloid protein injection in the brain. Neurobiol. Aging 13:569–576. 144. Podlisny, M.B., Sephenson, D.T., Frosch, M.P., Leiberburg, I., Clemens, J.A., Selkoe, D.J. (1992) Synthetic β-amyloid protein fails to produce specific neurotoxicity in monkey cerebral cortex. Neurobiol. Aging 13:561–568. 145. Irizarry, M.C., Soriano, F., McNamara, M., Page, K.J., Schenk, D., Games, D., Hyman, B.T. (1997) A beta deposition is associated with neuropil changes, but not with overt neuronal loss in the human amyloid precusor protein V717F (PDAPP) transgenic mouse. J. Neurosci. 17:7053–7059. 146. Irizarry, M.C., McNamara, M., Fedorchak, K., Hsiao, K., Hyman, B.T. (1997) APPsw transgenic mice develop age-related Ab deposits and neuropil abnormalities, but not neuronal loss in CA1. J. Neuropathol. Exp. Neurol. 56:965–973. 147. Allen, Y.S., Devanathan, P.H., Owen, G.P. (1995) Neurotoxicity of beta-amyloid protein: cytochemical changes and apoptotic cell death investigated in organotypic culture. Clin. Exp. Pharmacol. Physiol. 22:370–371. 148. Nishimura, I., Uetsuki, T., Dani, S.U., Ohsawa, Y., Saito, I., Okamura, H., Uchiyama, Y., Yoshikawa, K. (1998) Degeneration in vivo of rat hippocampal neurons by wild-type Alzheimer amyloid precursor protein overexpressed by adenovirusmediated gene transfer. J. Neurosci. 18:2387–2398. 149. Hyman, B.T., Narzloff, K., Arriagada, P.V. (1993) The lack of accumulation of senile plaques or amyloid burden in Alzheimer’s disease suggests a dynamic balance between amyloid deposition and resolution. J. Neuropathol. Exp. Neurol. 52: 594–600. 150. Nagy, Z., Esiri, M.M., Jobst, K.A. (1995) Relative roles of plaques and tangles in the dementia of Alzheimer’s disease: Correlations using three sets of neuropathological criteria. Dementia 6:21–31. 151. Meda, L., Cassatella, M.A., Szendrel, G.I., Otvos, L.Jr., Baron, P., Villalba, M., Ferrai, D., Rossi, F. (1995) Activation of microglial cells by β-amyloid protein and interferon-γ. Nature 374:647–650. 152. Frautschy, S.A., Fusheng, Y., Irrizarry, M., Hyman, B., Saido, T.C., Hsiao, K., Cole, G.M. Microglial response to amyloid plaques in APPsw transgenic mice. Am. J. Pathol. 152:307–317.
18 Oxidative Protein Modifications in Rosenthal Fibers: Implications for Alexander’s Disease Pathogenesis Rudolph J. Castellani University of Maryland, Baltimore, Maryland
George Perry and Mark A. Smith Case Western Reserve University, Cleveland, Ohio
I. INTRODUCTION Rosenthal fibers (RFs) are intraastrocytic hyaline inclusions that accumulate in a variety of pathological conditions. Initially described in the wall of a syringomyelic cavity over 100 years ago (1), RFs are now known to occur, most commonly, as a reaction to slowly expanding, often cystic lesions of the central nervous system (CNS) (2). They typically occur, for example, in reactive astrocytes adjacent to craniopharyngiomas, pineal cysts, and syrinxes, and in neoplastic astrocytes of pilocytic astrocytoma. RFs may also occur in the gliotic reaction in and around vascular malformations, while uncommonly they may be encountered in chronic multiple sclerosis plaques and in reactive glial tissue in brains affected by fucosidosis (3,4). Arguably, the most important condition in which RFs accumulate, in terms offering insight into the pathogenesis of RF formation, is Alexander’s disease. Described by Alexander in 1949 (5), Alexander’s disease is a leukodystrophylike neurodegenerative disease that typically presents in infancy or childhood. The disease is essentially a sporadic condition, isolated reports of familial disease notwithstanding (6), and so far there is no known genetic predisposition or metabolic abnormality. The common denominator and, indeed, the only hallmark of the disease is the diffuse accumulation of RFs throughout the central nervous 383
384
Castellani et al.
system, making it an ideal condition for the study of RF pathogenesis. Recently, we have identified a number of oxidative posttranslational modifications, including advanced glycation end-products as well as adducts of lipid peroxidation, in intimate association with the RFs of Alexander’s disease (7,8). These posttranslational protein modifications provide a mechanism for RF insolubility and accumulation, and implicate oxidative injury as a potential primary process in the etiology and pathogenesis of Alexander’s disease. Moreover, our findings further the evidence that oxidative injury and its sequelae are an integral component of the insoluble inclusions that characterize a variety of neurodegenerative diseases.
II. MORPHOLOGICAL ASPECTS AND PROTEIN COMPONENTS OF ROSENTHAL FIBERS By light microscopy, RFs are often described as rod- or carrot-shaped, and beaded. RFs are eosinophilic with hematoxylin and eosin, blue with luxol-fast blue, and negative with PAS, Oil Red O, and Congo red. Their diameter ranges from 1 to 25 µm while their lenght may measure up to 50 µm (9). On ultrastructural examination, RFs are seen within astrocytic processes and consist of nonmembrane-bound granular deposits in intimate association with intermediate filaments showing immunoreactivity for glial fibrillary acidic protein (GFAP) (9). The intimate association of RFs with intermediate filaments noted ultrastructurally, and the immunolocalization of GFAP in or near RFs, has lead to the suggestion that the RFs represent a collection of degraded glial filaments (2,3,10). However, in 1988, Goldman and Corbin identified a major 19-kDa protein band in RFs purified from the brain of a patient with Alexander’s disease (11). Antisera to this protein product were raised and found to react with RFs. Subsequently, the cDNA encoding the 19-kDa molecular weight RF protein was cloned and found to correspond to the amino acid sequence of human αBcrystallin (12), previously known as a component of the human lens. Interestingly, expression of αB-crystallin was also detected by northern analysis in several nonlenticular tissues including brain, heart, skeletal muscle, and kidney. αB-Crystallin is a member of the small heat-shock protein family and accumulates in a variety of intracellular inclusions (13–19). That the expression of αB-crystallin in Alexander’s disease occurs as a reaction to cellular stress is compatible with the proposed role of αB-crystallin as a molecular chaperone and stabilizer of the cytoskeleton. Such a notion is further supported by the colocalization of other heat-shock proteins such as ubiquitin and HSP-27 to RFs (20). Still, the mechanisms for extreme insolubility of αB-crystallin in RFs, in contrast to lenticular αB-crystallin, and therefore an explanation for the marked RF accumulation in Alexander’s disease are only now beginning to unravel.
Oxidative Protein Modifications in Rosenthal Fibers
III.
A.
385
OXIDATIVE MODIFICATIONS: IMPLICATIONS FOR ROSENTHAL FIBER FORMATION AND ALEXANDER’S DISEASE PATHOGENESIS Advanced Glycation End-Products
The parallels between RFs of Alexander’s disease and the intracellular inclusions of common neurodegenerative diseases (e.g., neurofibrillary tangles, Lewy bodies) are striking. Common to these inclusions are extreme insolubility of accumulating protein, resistance to detergents and proteases, ubiquitination, high lysine content, absence of mutation, and accumulation with disease in a region-specific manner that correlates with clinical deficits (7,11,12,21). In neurodegenerative diseases such as Alzheimer’s disease, increasing data indicate that oxidative posttranslational modifications confer these characteristics (22–24). Thus, it may also be that similar posttranslational protein modifications in RFs confer the biochemical properties necessary for their insolubility and, therefore, accumulation, and that such accumulation is intimately related to disease expression and pathogenesis. Particularly relevant to the RF are the formation of advanced glycation endproducts (AGEs). Given that the major protein component of RFs is αB-crystallin and that significant increases in AGE modifications of lens crystallins in diabetes mellitus and in aging have been demonstrated, similar modifications may alter αB-crystallin in RFs (7). AGE modifications are the stable adducts of the Maillard reaction, a series of interrelated chemical processes capable of altering the structural and functional characteristics of proteins. The initial step consists of nonenzymatic condensation between glucose and several different protein side chains, particularly ε-lysine, and is potentiated by the presence of oxygen in a process termed glycoxidation (25). It is noteworthy that αB-crystallin is relatively lysine-rich and is susceptible to AGE modifications (26). This parallels neurofilament protein of Lewy bodies and tau protein of neurofibrillary tangles, both of which are lysine-rich and accumulate in inclusions that also contain AGE modifications (22). In a recent study, we immunocytochemically examined RFs in three cases of Alexander’s disease using antibodies that recognize two specific AGE modification—pentosidine and pyrraline (7). Both antibodies showed specific immunolabeling of RFs in each case regardless of the disease duration, indicating that AGE modifications are intimately associated with RF accumulation (Fig. 1). It is also noteworthy that pentosidine and pyrraline, while comprising two of the few modifications that define AGE immunocytochemically, constitute but a small percentage of the total AGEs (27). The finding of both modifications in RFs of Alexander’s disease suggest that AGE modification is a dominant feature of RF pathogenesis. That AGE modifications have been shown to inhibit ubiquitin-mediated proteolysis (28) further supports a role of such modifications in RF accumulation, as RFs are persistent structures in the face of extensive ubiquitination.
386
Castellani et al.
Figure 1 Immunohistochemical stain of a case of Alexander’s disease using antipyrraline antibodies shows strong immunolabeling of Rosenthal fibers. Final enlargement, 400⫻.
It should be pointed out, however, that advanced age is not a prerequisite for Alexander’s disease. Indeed, most cases present early in life. This is not a trivial issue since AGE modification is often thought of as a process that would only be important in diseases of advanced age (29). and its involvement in childhood disease suggests more than an end-stage aging phenomenon. Nevertheless, the findings of AGE modifications in RF is evidence in support of our previous assertions that AGE modification de facto might precipitate or accelerate disease pathogenesis (22). B.
Lipid Peroxidation Adducts
The Maillard reaction resulting in AGEs is potentiated by reactive oxygen species and does not occur in their absence. Therefore, the role of oxidative stress independent of the formation of AGEs should be considered. Evidence for oxidative damage and free radical injury is well documented in common age-related neurodegenerative diseases, including Alzheimer’s disease and Parkinson’s disease (22–24,30,31). As these diseases are defined by the presence of insoluble inclusions that show a number of similarities to RFs, we hypothesized that oxidative stress as a generalized pathological process may be occurring in patients with Alexander’s disease or have occurred as an initiating event in the disease pathogenesis. Molecular changes induced by oxidative stress occur at multiple cellular levels, including DNA (8-hydroxy, 2-deoxyguanosine modification), protein
Oxidative Protein Modifications in Rosenthal Fibers
387
(e.g., AGE, reactive carbonyl adducts, and protein crosslinks), and cell membranes (lipid peroxidation). Lipid peroxidation is an autocatalytic process initiated by oxidant stress that damages lipid and leads, among other things, to the formation of several highly reactive carbonyls, including 4-hydroxy-2-nonenal (HNE) and malondialdehyde (32). HNE modifies proteins through formation of Michael adducts on histidine and cysteine side chains and through more complex reactions with lysine (33–35), and it is through these that lipid peroxidation can be specifically detected. Under physiological conditions, HNE appears to be efficient at adduct formation and it is believed that HNE is largely responsible for cytopathic effects mediated by lipid peroxidation. Moreover, HNE forms a stable adduct (advanced lipid peroxidation end-products) that can be detected in human tissues in vivo with specific antisera. Immunolabeling of neurofibrillary pathology of Alzheimer’s disease has been documented with these antisera (36). When antisera to HNE were applied to cases of Alexander’s disease, specific immunolabeling of RFs was noted (8) (Fig. 2). This is further evidence that oxidative stress is intimately involved in RF formation and therefore may be critical to Alexander’s disease pathogenesis. C.
Insolubility: A Consequence of Oxidative Cross-Linking
One consequence common to both AGEs and lipid peroxidation is the formation of intra- and intermolecular cross-links. Such cross-links result in protease resistance and extreme insolubility (22,31,37). This is compatible with the biochemical characteristics of RFs and may account for their massive accumulation in Alexander’s disease. It is interesting in this regard that patients with Alexander’s disease often have megalencephaly at some point during the course of the disease; while the specific brain substances responsible for the increased brain size have not been determined, it seems reasonable to speculate that insoluble protein accumulation and impaired proteolytic degradation, mediated by AGEs and lipid peroxidation through inter- and intramolecular cross-links and inhibition of ubiquitin-mediated proteolysis, might contribute to the macroscopic increase in brain size. It is should also be pointed out that Rosenthal fibers are acquired lesions in the vast majority of pathological conditions in which they occur; this is also consistent with our assertion that posttranslational processes such as adduct formation may be critical to RF formation. Finally, while the many parallels between intracellular inclusions of classical neurodegenerative diseases and RFs of Alexander’s disease have been noted, the predominant involvement of astrocytes by the disease process is generally not found in other neurodegenerative diseases. This may argue against pathogenic similarities between classical neurodegenerative diseases and Alexander’s disease. On the other hand, the presentation of Alexander’s disease often in early childhood may be significant in that the metabolic activity of glial cells is rela-
388
Castellani et al.
A
B Figure 2 Low-magnification photomicrograph (Fig. 2A, final enlargement, 25⫻) of Alexander’s disease brain immunostained with anti-HNE antibodies demonstrates immunoreactivity in subpial and perivascular regions of the frontal cerebral neocortex, areas of predilection for Rosenthal fiber formation in Alexander’s disease. At higher magnification (Fig. 2B, final enlargement, 275⫻), RFs showing immunoreactivity with anti-HNE antibodies are apparent.
Oxidative Protein Modifications in Rosenthal Fibers
389
Figure 3 Proposed mechanism for RF formation mediated by oxidative injury. While the precise etiology of RF formation is unknown, their occurrence with slowly expanding cystic lesions and in a sporadic neurodegenerative disease (Alexander’s disease) strongly implicates an acquired process. One hypothesis would therefore suggest that RF formation is due to an acquired CNS stressor, focal in the case of cystic lesions and global in the setting of Alexander’s disease, precipitated or accompanied by oxidative injury. This would set up a series of molecular events as outlined by our studies with adduct formation (advanced glycation and lipid peroxidation end-products), intra- and intermolecular protein cross-links, and, ultimately, extreme protein insolubility and inclusion (RF) formation.
tively high in the developing brain, whereas that of most neuronal populations is relatively low.
IV.
SUMMARY AND CONCLUSIONS
After a century since the original description of the Rosenthal fibers and nearly 50 years since the description of Alexander’s disease, evidence is pointing away from an isolated genetic or metabolic basis for RF formation and Alexander’s disease pathogenesis, and toward posttranslational processes that alter biochemi-
390
Castellani et al.
cal characteristics of stress-related proteins. Taken together, the evidence from our studies suggests an acquired central nervous system stressor in the etiology of Alexander’s disease that encompasses oxidative injury and initiates modifications of stress-related proteins (AGE and lipid modifications), resulting in RF formation and accumulation. The heavy ubiquitination and increased HSP-27 in Rosenthal fibers seen in other studies are further evidence in this regard (20,38). While we would note the many properties that are shared between intracellular inclusions of classical neurodegenerative diseases and RFs, such similarities do not necessarily explain the relative susceptibility of the astrocyte to pathology and the early age at presentation. Moreover, the basic issue of individual susceptibility to Alexander’s disease and factors responsible for disease susceptibility in this interesting but rare affliction remains entirely unexplored.
ACKNOWLEDGMENTS This work was supported in part by the National Institutes of Health, the American Health Assistance Foundation, and the Alzheimer’s Association. Alexander’s disease cases depicted in the figures were obtained from the University of Maryland Brain and Tissue Bank.
REFERENCES 1. Rosenthal, W. (1898) Ueber eine eigenthmliche, mit Syringomyelie complicirte Geschwulst des Rckenmarks. Beitr. Path. Anat. 23:111–143. 2. Borrett, D., Becker, L.E. (1985) Alexander’s disease: a disease of astrocytes. Brain 108:367–385. 3. Herndon, R.M., Rubinstein, L.J., Freeman, J.M., Mathieson, G. (1970) Light and electron microscopic observations on Rosenthal fibers in Alexander’s disease and multiple sclerosis. J. Neuropathol. Exp. Neurol. 29:524–551. 4. Garcia, C.P., McGarry, P.A., Duncan, C.M. (1980) Fucosidosis and Alexander’s leukodystrophy. J. Neuropathol. Exp. Neurol. 39:353. 5. Alexander, W.S. (1949) Progressive fibrinoid degeneration of fibrillary astrocytes associated with mental retardation in a hydrocephalic infant. Brain 72:373–381. 6. Schwankhaus, J.D., Parisi, J.E., Gulledge, W.R., Chin, L., Currier, R.D. (1995) Hereditary adult-onset Alexander’s disease with palatal myoclonus, spastic paraparesis, and cerebellar ataxia. Neurology 45:2266–2271. 7. Castellani, R.J., Perry, G., Harris, P.L.R., Monnier, V.M., Cohen, M.L., Smith, M.A. (1997) Advanced glycation modification of Rosenthal fibers in patients with Alexander disease. Neurosci. Lett. 231:79–82. 8. Castellani, R.J., Perry, G., Harris, P.L.R., Cohen, M.L., Sayre, L.M., Salomon, R.G., Smith, M.A. (1998) Advanced lipid peroxidation end products in Alexander’s disease. Brain Res. 787:15–18.
Oxidative Protein Modifications in Rosenthal Fibers
391
9. Towfighi, J., Young, R., Sassani, J., Ramer, J., Horoupian, D.S. (1983) Alexander’s disease: further light and electron microscopic observations. Acta Neuropathol. 61: 36–42. 10. Johnson, A.B., Bettica, A. (1989) On-grid immunogold labeling of glial intermediate filaments in epoxy-embedded tissue. Am. J. Anat. 185:335–341. 11. Goldman, J.E., Corbin, E. (1988) Isolation of a major protein component of Rosenthal fibers. Am. J. Pathol. 130:569–578. 12. Iwaki, T., Kume-Iwaki, A., Liem, R.K., Goldman, J.E. (1989) Alpha B crystallin is expressed in non-lenticular tissues and accumulates in Alexander’s disease brain. Cell 57:71–78. 13. Cooper, P.N., Jackson, M., Lennox, G., Lowe, J., Mann, D.M. (1995) Tau, ubiquitin, and alpha B-crystallin immunohistochemistry define the principal causes of degenerative frontotemporal dementia. Arch. Neurol. 52:1011–1015. 14. Higuchi, Y., Iwaki, T., Tateishi, J. (1995) Neurodegeneration in the limbic and paralimbic system in progressive supranuclear palsy. Neuropathol. Appl. Neurobiol. 21: 246–254. 15. Iwaki, T., Wisniewski, T., Iwaki, A., Corbin, E., Tomokane, N., Tateishi, J., Goldman, J.E. (1992) Accumulation of alpha B-crystallin in central nervous system glia and neurons in pathologic conditions. Am. J. Pathol. 140:345–356. 16. Jackson, M., Gentleman, S., Lennox, G., Ward, L., Gray, T., Randall, K., Morrell, K., Lowe, J. (1995) The cortical neuritic pathology of Huntington’s disease. Neuropathol. Appl. Neurobiol. 21:18–26. 17. Matsumoto, S., Udaka, F., Kameyama, F., Kusaka, H., Ito, H., Imai, T. (1996) Subcortical neurofibrillary tangles, neuropil threads, and argentophilic glial inclusions in corticobasal degeneration. Clin. Neuropathol. 15:209–214. 18. Renkawek, K., Voorter, C.E., Bosman, G.J., van workum, F.P., de Jong, W.W. (1994) Expression of alpha B-crystallin in Alzheimer’s disease. Acta. Neuropathol. (Berl) 87:155–160. 19. Tamaoka, A., Mizusawa, H., Mori, H., Shoji, S. (1995) Ubiquitinated alpha Bcrystallin in glial and cytoplasmic inclusions from the brain of a patient with multiple system atrophy. J. Neurol. Sci. 129:192–198. 20. Iwaki, T., Iwaki, A., Tateishi, J., Yoshiyuki, S., Goldman, J.E. (1993) Alpha B crystallin and 27kd heat shock protein are regulated by stress conditions in the central nervous system and accumulate in Rosenthal fibers. Am. J. Pathol. 143:487–495. 21. Mann, E., McDermott, M.J., Goldman, J., Chiesa, R., Spector, A. (1991) Phosphorylation of alpha-crystallin B in Alexander’s disease brain. FEBS Lett. 294:133–136. 22. Smith, M.A., Taneda, S., Richey, P.L., Miyata, S., Yan, S.-D., Stern, D., Sayre, L.M., Monnier, V.M., Perry, G. (1994) Advanced Maillard reaction end products are associated with Alzheimer disease pathology. Proc. Natl. Acad. Sci. USA 91: 5710–5714. 23. Smith, M.A., Sayre, L.M., Monnier, V.M., Perry, G. (1995) Radical AGEing in Alzheimer’s disease. Trends Neurosci. 18:172–176. 24. Smith, M.A., Siedlak, S.L., Richey, P.L., Nagaraj, R.H., Elhammer, A., Perry, G. (1996) Quantitative solubilization and analysis of insoluble paired helical filaments from Alzheimer disease. Brain Res. 717:99–108. 25. Baynes, J.W. (1991) Role of oxidative stress in development of complications of diabetes. Diabetes 40:405–412.
392
Castellani et al.
26. Liang, J.N., Hershorin, L.L., Chylack, L.T. Jr. (1986) Non-enzymatic glycosylation in human lens crystallins. Diabetologia 29:25–228. 27. Miyata, S., Monnier, V. (1992) Immunohistochemical detection of advanced glycosylation end products in diabetic tissues using monoclonal antibody to pyrraline. J. Clin. Invest. 85:380–384. 28. Takizawa, N., Tadaka, K., Ohkawa, K. (1993) Inhibitory effects of nonenzymatic glycation on ubiquitination and ubiquitin-mediated degradation of lysozyme. Biochem. Biophys. Res. Commun. 192:700–706. 29. Mattson, M.P., Carney, J.W., Butterfield, D.A. (1995) A tombstone in Alzheimer’s? Nature 373:481. 30. Markesbery, W.R. (1997) Oxidative stress hypothesis in Alzheimer’s disease. Free Rad. Biol. Med. 23:134–147. 31. Smith, M.A., Harris, P.L.R., Sayre, L.M., Beckman, J.S., Perry, G. (1997) Widespread peroxynitrite-mediated damage in Alzheimer’s disease. J. Neurosci. 17: 2653–2657. 32. Esterbauer, H., Schaur, R.J., Zollner, H. (1991) Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde, and related aldehydes. Free. Rad. Biol. Med. 11:81–128. 33. Nadkarni, D.V., Sayre, L.M. (1995) Structural definition of early lysine and histidine adduction chemistry of 4-hydroxynonenal. Chem. Res. Toxicol. 8:284–291. 34. Sayre, L.M., Arora, P.K., Iyer, R.S., Salomon, R.G. (1993) Pyrrole formation from 4-hydroxynonenal and primary amines. Chem. Res. Toxicol. 6:19–22. 35. Sayre, L.M., Sha, W., Xu, G., Kaur, K., Nadkarni, D., Subbanagounder, G., Salomon, R.G. (1996) Immunochemical evidence supporting 2-pentylpyrrole formation on proteins exposed to 4-hydroxy-2-nonenal. Chem. Res. Toxicol. 9:1194–1201. 36. Sayre, L.M., Zelasko, D.A., Harris, P.L.R., Perry, G., Salomon, R.G., Smith, M.A. (1997) 4-Hydroxynonenal-derived advanced lipid peroxidation end products are increased in Alzheimer’s disease. J. Neurochem. 68:2092–2097. 37. Friguet, B., Stadtman, E.R., Szweda, L.I. (1994) Modification of glucose 6-phosphate dehydrogenase by 4-hydroxy-2-nonenal. Formation of cross-linked proteins that inhibits the multicatalytic protease. J. Biol. Chem. 269:21639–21643. 38. Tomokane, N., Iwaki, T., Tateishi, J., Iwaki, A., Goldman, J.E. (1991) Rosenthal fibers share epitopes with alpha B-crystallin, glial fibrillary acidic protein, and ubiquitin, but not with vimentin: immunoelectron microscopy study with colloidal gold. Am. J. Pathol. 138:875–885.
19 Superoxide Dismutase and Amyotrophic Lateral Sclerosis Giuseppe Rotilio and Maria Teresa Carrı` University of Rome ‘‘Tor Vergata,’’ Rome, Italy
Alberto Ferri and Roberta Gabbianelli Fondazione S. Lucia, Rome, Italy
I. AMYOTROPHIC LATERAL SCLEROSIS Amyotrophic lateral sclerosis (ALS) is a progressive devastating neurological syndrome that produces upper and lower motoneuron loss, manifested as progressive limb and facial motor weakness, atrophy, spasticity and hyperactive reflexes, and eventually respiratory compromise and death. The disorder has currently an incidence of 1–2 per 10,000, which is comparable to that of multiple sclerosis. However, recent epidemiological evidence indicates that the incidence of ALS is increasing in many countries, suggesting a role for environmental factors in the cause of the disease. The disease is present worldwide, but with an increased incidence in regions of the western Pacific, among the Chamorros of Guam, the Auyu and Jakei of West New Guinea, and the Japanese in the Kii peninsula (1). The time of onset averages around 50 years but much younger patients are not rare; death occurs typically 3 years after the diagnosis. ALS occurs both as sporadic (SALS) and familial (FALS), with inherited cases accounting for about 10% of patients. SALS and FALS patients are clinically indistinguishable; therefore, studies on the less frequent, genetically inherited form of the disease are thought to be potentially useful for a general understanding of ALS. FALS is expressed as an age-dependent autosomal dominant trait. There is incomplete penetrance (0.8 at the age of 85 years), with phenotypic heterogeneity similar to that of SALS: age of onset, duration of illness, and sign at onset may vary widely even in the same family (2). 393
394
Rotilio et al.
Only support and symptomatic treatment are available for patients; in fact, despite numerous preclinical and clinical trials, at present no effective therapy exists for ALS patients (3).
II. SUPEROXIDE DISMUTASE AND FAMILIAL AMYOTROPHIC LATERAL SCLEROSIS: CLINICAL EVIDENCE Copper/zinc-superoxide dismutase (SOD1) is a homodimeric enzyme that catalyzes the disproportionation of superoxide anions via the cyclic oxidation and reduction of a single bound copper ion per subunit (4,5). Its sequence consists of 153 amino acids and its structure, built with tightly packed β strands connected by loops in a typical β-barrel, is remarkably well conserved throughout evolution (6). The bound metal ions differ in that copper constitutes the actual active site of the enzyme, while zinc has a function in the correct folding. The enzyme is present in virtually all animal cells; in humans SOD1 is especially highly concentrated in liver, erythrocytes, and brain. The earliest evidence of involvement of SOD1 with FALS came from studies using restriction fragment length polymorphism (RFLPs) when Siddique et al. mapped a FALS locus to chromosome 21q22.1 (7). Subsequent linkage studies have revealed that mutations in SOD1 are responsible for 10–15% of FALS. This finding has opened the way to investigating potential pathogenic mechanisms and developing treatment rationales. To date there are more than 60 SOD1 point mutations reported in FALS families, distributed in all five exons of the gene and affecting 43 positions (8). All of them are missense except two: one is a two-nucleotide deletion causing premature termination in position 126 of the amino acid sequence (9) and one is a stop codon (10). All of them occur in heterozygosity except mutation Asp90Ala which was reported in homozygote families from northern Europe (11). The most common mutation is Ala4Val (12), which is found in almost 50% of patients in North America and is associated with a severe form of FALS, although SOD1 activity is only slightly reduced (13). This mutation maps in exon 1 and is involved in β-barrel and dimer packing. Many other mutations are localized at or close to SOD1 dimer interface (e.g., Ile113Thr and Val148Gly, which pack self-symmetrically at the interface). However, this is not the general rule. A large subset of FALS mutations are localized in regions involved in packing of the Greek key structure, either in β strands or in connecting loops (e.g., the series of conserved left-handed Gly residues in positions 37, 41, 85, 93, or the two Leu residues in the β-barrel plug, in positions 38 and 106) and therefore could severely affect folding and stability of the enzyme (14). Finally, a minority of mutations, such as those in positions 46 and 48, are involved in metal binding at the active site.
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
395
It is intriguing that substitution of two different residues essential for copper binding at the active site produce completely different effects in terms of severity of the disease: mutation His46Arg, which has been reported in two Japanese families (15,16), is associated with a mild form of the disease, with relatively late onset and slow progression (average duration 17 years). Conversely, mutation His48Gln was described for patients severely affected, with a rapid course of 8 months duration (2). Although wide variations of effects are observed within individuals carrying the same mutation and even within the same family, it is apparent that no clear relation exists between loss of SOD activity and severity of the disease. Therefore, it is not possible to offer prognosis for a given mutation and understanding of the pathogenetic mechanisms must take into account the fact that there is little regional clustering of mutation in a computer-generated reconstruction of the protein. It is notable that linkage analysis provided evidence for the exclusion of the genes coding for two other SOD isoenzymes, which are localized in other compartments (SOD2, mitochondrial MnSOD and SOD3, extracellular EC-SOD), in the pathogenesis of FALS (2). Other candidate loci involved in free radical handling need further investigation (see below).
III.
SOD AND FALS: EXPERIMENTAL MODELS
ALS is a distinctly human disease and there are no natural animal models that faithfully mimic the human disease. This might be explained by the selective, although not exclusive, vulnerability of the corticomotoneuronal system that has enlarged greatly in humans, at the expense of other descending systems (17). Today availability of various model systems offers the opportunity to test hypotheses on the pathogenic processes involved in ALS and devise treatment strategies.
A.
Animal Models
Gurney et al. (18) have been able to establish transgenic mice strains introducing either of two human mutant SOD1 enzymes (Ala4Val or Gly93Ala). In the presence of both endogenous mouse genes and exogenous human gene copies expressed at high levels, a phenotype closely resembling motor neuron disease was observed. Since the disease was expressed in only one line of mice, those authors could not exclude the possibility that the event of transgene integration itself had caused the disruption of some other critical gene, thereby producing the disease. The possibility was ruled out when other FALS-SOD genes were introduced into
396
Rotilio et al.
other strains of mice, still reproducing the motor neuron disease (19). Ripps et al. (20) have also produced transgenic mice expressing the mutant mouse SOD Gly86Arg, homologous to Gly85Arg human FALS mutation, and obtained the same phenotype. FALS mice develop a progressive paralytic illness with general features resembling human ALS. Initial clinical findings are suggestive of disinhibition of spinal reflexes; as disease progresses, mice show increasing paralysis and finally become incapacitated. The mutant protein is expressed in all tissues, but disease is restricted primarily to motor neurons in spinal cord and brainstem. Death occurs after about a month in all the different transgenic lines, while the time of onset of clinically discernible symptoms varies with transgene copy number (21) and the severity of disease is proportional to the amount of mutant protein expressed. A few criticisms have been addressed to the use of such a model for a typically human disease, i.e., a high-level expression of the transgene is needed to induce the FALS phenotype in mice and anatomic differences in the nervous system might cause variations in symptoms between mice and humans (22). However, the transgenic mouse model has proven an invaluable tool for the study of the specific mechanism of neuronal death in ALS and for testing therapeutic strategies. A different approach allowed the evaluation of the effects of either increasing or decreasing SOD1 activity by genetic manipulation. Phillips et al. (23) showed that Drosophila fruit flies mutated in the SOD1 gene in positions homologous to human FALS-SOD exhibit striking neuropathological alterations, such as lesions of ommatidia, related to variations in SOD activity. However, expression in a specific cell type is probably crucial for the study of pathogenesis of FALS in humans and the significance of systemic expression of SOD1 mutants in these flies remains to be determined. Indeed, in a recent work, Parkes et al. (24) showed that at variance with previous experiments involving systemic SOD1 expression (25,26), Drosophila expressing wild-type human SOD1 selectively in motor neurons have a lifespan that is 40% longer than that of the normal counterparts. B.
Yeast and Cellular Models
Saccharomyces cerevisiae represents a unicellular system used to examine the behavior of a broad range of human FALS-linked SOD1 mutants. In spite of the conspicuous distance with the human cell, yeast represents a useful model since it is a simple organism, easily engineered and with known metabolic pathways. The difficulty of assaying FALS-SOD1 metalloproteins in mammals already containing endogenous cytosolic SOD1, mitochondrial SOD2, and extracellular SOD3 was overcome by the construction of yeast strains lacking SOD1 or other proteins involved in the copper metabolism (27–30).
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
397
Several in vitro model cell systems have been devised to examine the mechanisms of disease underlying ALS. Borchelt et al. (31) assayed the enzymatic activity and polypeptide stability of six different FALS missense SOD1 mutants by transfecting transiently a primate nonneural cell line (COS-1). Rabizadeh et al. (27) investigated on the stable expression of wild-type and FALS-associated mutant human SOD1 proteins in a conditionally immortalized rat nigral neural cell line to test the hypothesis that SOD1 mutations might influence neural cell survival by mechanisms independent of superoxide metabolism. A similar study was performed by Ghadge et al. (32) on rat neuronal cell lines (PC12, superior cervical ganglion neurons and hippocampus pyramidal neurons) expressing two FALS-related mutant SODs, by means of infection with replication-deficient recombinant adenovirus. This strategy had the advantage to involve expression in primary cultured neurons and a differentiated neural cell line, thus approximating the natural system of motor neurons affected in ALS. Even though no in vitro model of ALS is completely equivalent to the human disease, human neuronal cell lines might represent a closer mimic of the syndrome than rat analogs. Recently, we (33) permanently transfected human neuroblastoma cell line SH-SY5Y with plasmids directing constitutive expression of either wild-type human SOD1 or mutant SODs associated with FALS. In this system, we have selected monoclonal cell lines where the wild-type or mutant enzymes are expressed in a ratio close to 1:1 with the endogenous wild-type protein, a situation similar to that observed in heterozygous FALS patients. C.
Studies on Isolated FALS Superoxide Dismutase
Recombinant FALS mutant proteins purified from Escherichia coli (34–38), from Saccharomyces cerevisiae (35), and from Baculovirus-infected insect cells (39) have given the opportunity for biochemical studies on the relationship between structure and function of the ALS-linked enzymes.
IV. A.
SOD AND FALS: POSSIBLE MECHANISMS FALS and Loss of Superoxide Dismutase Function
The association of FALS with mutations in SOD1 made it possible for the first time to generate plausible theories for the pathogenesis of this disease. If destabilizing mutations affecting either their half-lives or their enzyme activity inactivated FALS-SODs, the superoxide radical would accumulate and might itself be cytotoxic because it can act as either an oxidant or a reductant. While investigating on functionality of mutant enzymes, several authors have observed that impairment of dismutase activity could arise by decreased stability and/or formation of incorrect heterodimers with the wild-type enzyme. Indeed, formation of hetero-
398
Rotilio et al.
dimers was suggested by Phillips et al. (23), in transgenic Drosophila melanogaster. Flies that were made heterozygous for SOD deletion alleles displayed enzyme activity that averaged 50% of the activity for homozygous wild-type controls. Conversely, flies that were heterozygous for five different missense alleles exhibited SOD activities ranging from 10% to 37% of the homozygous normal flies. This former possibility, based on the loss of SOD activity as the mechanism generating FALS, was questioned shortly after (1): even less than half normal activity, resulting from complete inactivation of mutant SODs in heterozygous patients, should not result in a dominant disease and most probably is compatible with normal life. In fact, transgenic mice completely lacking SOD1 activity, although less resistant to injury following axotomy, develop normally and show no motor deficit by 6 months of age, demonstrating that SOD1 loss is not by itself sufficient to kill motor neurons in vivo (40). SOD1 activity is not significantly reduced in many FALS families, as expected on the basis of the known crystallographic structure of the human enzyme (6) that allows detailed mapping of mutations and accurate prediction of their impact on dismutase activity. Furthermore, several studies on residual activity of mutant SOD1 both in vivo (11,14,30,31,41–44) and in vitro (28,31,39,45) have conclusively demonstrated that the decrease is variable from none to almost 100% and is not directly related to the severity of the disease, a fact that speaks against a loss of function as the mechanism underlying FALS. Finally, mutations associated with FALS convert SOD1 from an antiapoptotic gene (46) to a proapoptotic gene in yeast and in conditionally immortalized mammalian neural cells in a dominant fashion (27), thus indicating the existence of FALS-SOD activity distinct from dismutation of superoxide. A second alternative in this context involves the formation of nitrotyrosines. Superoxide and nitric oxide (NO • ) are known to rapidly react to form the stable peroxynitrite anion (ONOO ⫺ ); peroxynitrite decomposes to generate peroxynitrous acid which, in turn, generates a strong oxidant with reactivity similar to hydroxyl radical (47). By scavenging superoxide, SOD1 protects the cell from the deleterious effects of peroxynitrite. While investigating on the hypothesis that FALS-SOD could have lost the ability to incercept peroxynitrite formation (48), the group of Beckman has found that, in agreement with a previous report in vitro (35), mutant FALS-SOD have decreased affinity for zinc in vivo (37). In the same work the same authors demonstrated that Zn-deprived wild-type SOD shows enhanced catalysis of tyrosine nitration by peroxynitrite (37); therefore, they infer that ALS pathogenesis might be mediated by FALS-SOD increased catalysis of nitrotyrosine. This might be particularly relevant in the CNS, since wild-type SOD1 catalyzes nitration of tyrosines in specific proteins in brain, such as neurofilament light subunit (38). Neurofilaments are strongly implicated in the pathogenesis of ALS. Axonal swelling and accumulation of neurofilaments are commonly observed in motor neuron of ALS patients (49). Abnormal aggregates of neurofilaments are also observed in some strains of FALS transgenic mice
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
399
(50); nitrotyrosine, SOD1, and neuronal nitric oxide synthase colocalize in conglomerates of neurofilaments in sporadic ALS patients (51,52). Although increased free nitrotyrosine have been detected in the transgenic mice model, protein-bound nitrotyrosine was not increased and therefore bulk nitration of proteins is probably not the main mechanism involved in human disease. Nitration of specific, critical targets cannot be ruled out on the basis of that work (53).
B.
FALS and Gain of Novel Function by SOD
Other lines of evidence have pointed to the gain of a novel, adverse property of mutant SODs as responsible for the phenotype. Mutant enzymes might have an altered substrate affinity and acquire the ability to catalyze a different reaction than dismutation of superoxide, leading to the generation of toxic product(s). Poorly folded SOD1 mutants might also produce aggregates that are toxic to motor neurons. Much effort has been spent in the last 4 years to identify FALSSOD toxic properties and several hypotheses have been proposed. Evidence for increased peroxidase activity or •OH formation from FALSassociated SOD mutants (Ala4Val and Gly93Ala) was first obtained through the electron spin resonance (ESR) spin-trapping technique with 5,5′-dimethyl-1-pyrroline N-oxide (DMPO). By using this technique, which involves trapping of a reactive radical and the formation of a more stable, ESR-detectable adduct, Valentine and coinvestigators suggested that FALS-SODs catalyze oxidation of model substrate DMPO by hydrogen peroxide at a higher rate than that seen with the wild-type enzyme (54,55). Stadtman, Yim, and co-workers (13,56) also found that FALS mutants generated increased formation of •OH upon reaction with H 2 O 2 , with a K m value for this substrate lower for mutants Gly93Ala and Ala4Val (25 and 13 mM, respectively) than for the wild-type enzyme (44 mM), while the K cat resulted identical for all three enzymes. Those spin-trapping experiments were criticized by Fridovich (5) who suggested that the DMPO/ •OH adduct was formed from the peroxidase activity of SOD and not from trapping the hydroxyl radical. The relevance of such reactions in vivo has also been questioned. No evidence for increased hydroxyl radical formation was obtained in transgenic FALS mice, either using salicylate hydroxylation or lipid peroxidation assays (53). Furthermore, Marklund et al. (41) did not find increased peroxidase activity with mutant Asp90Ala. The mechanism of hydroxyl radical adducts formation by FALS-SOD1 and hydrogen peroxide has recently been reexamined by Singh et al. (57) using both spintraps DMPO and 5-diethoxyphosphoryl-5-methyl-1pyrroline N-oxide (DEPMPO) and studying the incorporation of 17O. Those authors found no significant difference in formation of DMPO/ •OH or DEPMPO/ • OH radicals between human wild-type and several mutant enzymes and interpreted their data as ruling out the formation of free hydroxyl radical from loosely bound copper and increased peroxidase activity as well.
400
C.
Rotilio et al.
FALS and Aberrant Copper Chemistry in SOD
Another possible mechanism (set of mechanisms) by which mutant SOD1 might lead to motor neuron degeneration is via abnormal metal binding. Direct measurements of purified recombinant FALS-SOD1 have demonstrated a decrease in metal binding for yeast Gly85Arg (28) and human His46Arg (34) but not for other mutants, such as yeast Gly93Ala (28). In a recent study, Corson et al. (30) have analyzed several FALS-SOD mutants overexpressed in Saccharomyces cerevisiae and found that they shared similar properties such as copper binding and dismutase activity (although to different levels) and that they all acquired copper in vivo by interaction with copper chaperone for SOD (CCS), the copper chaperone for SOD. Based on evidence obtained in their yeast model system, the authors have suggested that aberrant copper-mediated chemistry catalyzed by a less tightly folded mutant enzymes might be responsible for SOD-linked FALS phenotype. In our human model system, where mutant FALS-SOD1 are expressed in the correct genetic background and in a 1: 1 ratio with the wild-type enzyme, we have observed that expression of mutant His46Arg induces a selective increase in paraquat sensitivity. This susceptibility is mediated by copper and may be ascribed to aberrant metal chemistry of this mutant enzyme (34) and impairment of the activity of wild-type endogenous enzyme (see above). Both effects compromise the cell’s ability to respond to oxidative stress (82). That copper chemistry could be involved in FALS mechanisms had indeed already been suggested by the observation that the copper chelator dpenicillamine delays onset of disease and extends survival in FALS transgenic mice (58). Furthermore, Valentine and co-workers (54) observed that penicillamine inhibited the peroxidase activity of mutants Ala4Val and Gly93Ala in vitro. By the same group came also the observation that some FALS mutations in yeast and human SOD1 alter the zinc binding site and the redox behavior of the enzyme as judged by their spectroscopic properties and by increased rate of reduction by ascorbate (35).
D.
FALS and Stability of the SOD Protein
A possible mechanism for SOD1-linked FALS is unrelated to enzymatic activity or metal-binding functionality but related instead to the fact that SOD1 is an abundant protein in the cytosol of many cell types and is particularly expressed in motoneurons (59). Thus, specific mechanisms could be envisaged in which the central abnormality is related to protein folding, solubility, denaturation, or degradation. The presence of aggregates containing misfolded SOD1 had already been reported by Chou et al. (51). More recently, Brujin et al. (60) reported the pres-
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
401
ence of aggregates containing SOD1 in spinal cords from transgenic mice expressing several FALS mutants in the presence or in the absence of overexpression of wild-type human SOD1. Their data indicate that FALS-SOD1 are unstabilized by mutations and capable to form precipitates independently from the coexpression of wild-type protein. Recently, we also obtained data indicating the formation of unstable or partially inactive heterodimers between mutant His46Arg and wild-type SOD1 in our neuroblastoma cell model (82). Relatively close to this hypothesis is the theory of incorrect interaction of SOD with other proteins, as suggested by the work of Kunst et al. (61) who reported coimmunoprecipitation of Gly93Ala or Gly85Arg, but not wild-type SOD1, together with either TRAP-δ and KARS.
V.
OTHER SUGGESTED MECHANISMS FOR ALS
To date we do not know when the disease process begins in ALS patients. Since early detection of symptoms would help efficacious therapy, much effort has been spent in research of the initial trigger, covering a broad reach of a modern neuroscience drawing from free radical neurotoxicology, excitotoxicity, and autoimmunity. Several observations suggest that the disease may have its initial onset years before the obvious muscle weakness and fasciculation that are hallmarks of ALS. Several hypotheses have been advanced along the years to explain the many facets of both the sporadic and familial form, including the variability of the course. Epidemiological studies indicate that there is an increasing incidence of ALS, which would imply that environmental agents are important. However, ALS triggering by specific toxic agents such as contamination of drinking water and poisoning by heavy metals has never been satisfactorily proven. Once ALS has been initiated, a final cascade of events follow that primarily involve the corticomotoneurons, the spinal motoneurons, and glial cells, including astrocytes. One popular hypothesis on ALS involves glutamate excitotoxicity as the major mediator of pathogenesis (62). Glutamate is the principal excitatory neurotransmitter in mammalian central nervous system. Its intra- and extracellular concentrations are tightly controlled and can become defective for several reasons (failure of transporters, diseased astrocytes, abnormal release from vescicular stores). In SALS patients glutamate transporter sites are reduced (particularly GLT1 and EAAC1) (63) and this could lead to accumulation resulting in cellular death. A number of studies have been addressed to glutamate-induced excitotoxicity in ALS and to its treatment by glutamate inhibitors as lamotrigine and other N-methyl-d-aspartate (NMDA) and non-NMDA (3,64) receptor antagonists, with very limited success thus far.
402
Rotilio et al.
Although sporadic ALS is believed not to be a primary genetic disease, genetic susceptibility might be relevant; furthermore, it is not excluded that the number of ALS patients turning out to be part of FALS families will increase as epidemiological studies advance. As mentioned above, mutations in the SOD1 gene account only for about 20% of familial ALS, indicating that genes other than SOD1 must be involved in FALS. The genes coding for five glutamate receptor subunits designated GluR1-GluR5 have been localized in the human genome and GluR5 maps between the loci for Alzheimer APP and SOD1 genes on chromosome 21. However, linkage between GluR5 and FALS has been conclusively excluded; other members of the family are still good candidates (17). Also good candidates are the genes encoding for neurofilament proteins, since a typical feature of ALS motoneurons is represented by the accumulation of neurofilaments leading to axon swelling (49). In this respect, it must be mentioned that mice transgenic for heavy neurofilament gene NF-H develop some of, but not all of, the symptoms of ALS (65). Several neurotrophins, such as NGF, BDNF, CNTF, and IGF-I and II, have been tested in ALS therapy on the rationale that they could slow the process by stimulating and supporting several neuronal populations. However, there is no convincing evidence that neurotrophic factors are actually involved in this pathology and the only (limited) success has been demonstrated in wobbler mouse motor neuron disease by a combined treatment with CNTF and BDNF (17). Numerous studies of ALS have suggested that increased intracellular calcium concentration is a common denominator in motoneuron injury. Immunoglobulins from patients with sporadic ALS can bind and alter the function of L-type and P-type calcium channels (66) and can induce apoptotic death in a motoneuron cell line (67). Intracellular calcium is also increased in lymphoblasts (68) and motor nerve terminals (69) from ALS patients. In experimental models of SOD1-linked FALS, alteration of calcium homeostasis has also been observed. In transgenic mice expressing FALS-SOD1 Gly93Ala calcium was found sequestered in vacuoles selectively in motoneurons and intracellular calcium paralleled motoneuron degeneration (70). In our neuroblastoma cell lines for the expression of FALS-SODs we have also observed an increase of intracellular calcium concentration, accompanied with mitochondrial alterations (33). The abovementioned hypothesis of calcium-mediated pathogenesis of ALS would also explain selective vulnerability of motoneurons, since this cell type is particularly poor in calcium-binding proteins involved in intracellular homeostasis of this critical ion (as calbindin-D28K). Indeed, it has been demonstrated that expression of calbindin cDNA by retroviral infection prevents ALS-IgG-mediated cytotoxicity in motoneuron hybrid cells (71). Finally, a longstanding hypothesis proposes that ALS is the late consequence of subclinical poliovirus infection because polio and ALS are both manifestations of anterior horn disease. However, studies that show an association are greatly outnumbered by negative reports (72,73). SALS has also been associated
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
403
with elevated circulating IgG immune complexes and seroreactivity against human retroviral agents (HIV-2 and HTLV) (74), but whether this association is actually relevant to the pathogenesis of ALS is still to be ascertained (75).
VI.
CONCLUSIONS
To date, no study has definitely identified an individual cause for ALS, leading to the common view that ALS is a multifactorial disease, where several pathways concur to the final event of pathogenesis. This might also be the case for familial ALS, which accounts only for 10% of clinical cases but is indistinguishable from the sporadic form. Studies on FALS-SOD1 have proven invaluable in that they have provided new models and new approaches to the understanding of mechanisms; however, still a lot of work is needed before a satisfying answer can be found and novel therapeutic approaches can be envisaged. In fact, even in the subset of SOD-mutant patients, the general picture might be much more complex than that initially suggested (14,48,76). For instance, the observation that motoneurons are deficient in Ca 2⫹-binding proteins might be relevant also for coppermediated mechanisms of pathogenesis. It has been reported that calcium-binding protein S100b from bovine brain is able to sequester copper ions in vitro and reduce oxidative cell damage induced by CuCl2 plus H 2 O 2 in E. coli (77). It must also be kept in mind that SOD1 is present in eukaryotic cells both in the holo-, Cu,Zn form and as apo-, copper-free enzyme and a role in the cell copper-buffering system has been proposed (78–81). Alteration of Cu binding site in ALStype SODs might (1) cause the release of the metal ion increasing both cellular copper availability and the ratio of apo- to holo-SOD; (2) impair copper buffering by SOD, therefore causing metal-mediated oxidative stress; (3) lead to a novel function of the enzyme. These effects might not be adequately counterbalanced by the relatively ineffective Cu/Ca-binding system in motoneurons.
ACKNOWLEDGMENT The financial support of Prog. Finalizzato Min. Sanita 1998–2000 is gratefully acknowledged.
REFERENCES 1. Rowland, L.P. (1995) Amyotrophic lateral sclerosis: human challenge for neuroscience. Proc. Natl. Acad. Sci. USA 92:1251–1253. 2. De Belleroche, J., Orrell, R., and King A. (1995) Familial amyotrophic lateral
404
3. 4.
5. 6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Rotilio et al. sclerosis/motor neurone disease (FALS): a review of current developments. J. Med. Genet. 32:841–847. Louvel, E., Hurgon, J., and Doble, A. (1997) Therapeutic advances in amyotrophic lateral sclerosis. TiPS 18:196–203. Bannister, J.V., Bannister, W.H., and Rotilio, G. (1987) Aspects of the structure, function and applications of superoxide dismutase. CRC Crit. Rev. Biochem. 22: 111–180. Fridovich, I. (1995) Superoxide radical and superoxide dismutases. Annu. Rev. Biochem. 64:97–112. Getzoff, E.D., Tainer, J.A., Stempien, M.M., Bell., G.I., and Hallewell, R.A. (1989) Evolution of Cu,Zn superoxide dismutase and the greek key β-barrel structural motif. Proteins 5:322–336. Siddique, T., Figlewicz, D.A., Pericak-Vance, M.A., Haines, J.L., Rouleau, G., Jeffers, A.J., Sapp, P., Hung, W.Y., Bebout, J., McKenna-Yasek, D., Deng, G., Horvitz, H.R., Gusella, J.F., Brown, R.H., Jr., Roses, A.D., and Collaborators (1991) Linkage of a gene causing familial amyotrophic lateral sclerosis to chromosome 21 and evidence of genetic-locus heterogeneity. N. Engl. J. Med. 20:1381–1384. Shaw, P.J., Tomkins, J., Slade, J.Y., Usher, P., Curtis, A., Bushby, K., and Ince, P.G. (1997) CNS tissue Cu/Zn superoxide dismutase (SOD 1) mutations in motor neurone disease (MND). NeuroReport 8:3923–3927. Pramatarova, A., Goto, J., Nanba, E., Nakashima, K., Takahashi, K., Takagi, A., Kanazawa I., Figlewicz, D., and Rouleau, G.A. (1994) A two basepair deletion in the SOD 1 gene causes familial amyotrophic lateral sclerosis. Hum. Mol. Gen. 3: 2061–2062. Zu, J.S., Deng, H.X., Lo, T.P., Mitsumoto, H., Ahmed, M.S., Hung, W, Y., Cai, Z.J., Tainer, J.A., and Siddique, T. (1997) Exon 5 encoded domain is not required for the toxic function of mutant SOD1 but essential for the characterization of two new SOD1 mutations associated with familial amyotrophic lateral sclerosis. Neurogen. 1:65–71. Andersen, P.M., Nilsson, P., Ala-Hurula, V., Keranen, M.-L., Tarvainen, I., Haltia, T., Nilsson, L., Binzer, M., Forsgren, L., and Marklund, S.L. (1995) Amyotrophic lateral sclerosis associated with homozygosity for an Asp90Ala mutation in Cu,Znsuperoxide dismutase. Nature Genet. 10:61–66. Deng, H.X., Tainer, J.A., Mitsumoto, H., Ohnishi, A., He, X., Hung, W.Y., Zhao, Y., Juneja, T., Hentati, A., and Siddique, T. (1995) Two novel SOD1 mutations in patients with familial amyotrophic lateral sclerosis. Hum. Mol. Genet. 4:1113– 1116. Yim, H.-S., Kang, J.-H., Chock, P.B., Stadtman, E.R., and Yim, M.B. (1997) A familial amyotrophic lateral sclerosis–associated A4V Cu,Zn-superoxide dismutase mutant has a lower Km for hydrogen peroxide. J. Biol. Chem. 272:8861–8863. Deng, H.X., Hentati, A., Tainer, J.A., Iqbal, Z., Cayabyab, A., Hung, W.Y., Getzoff, E.D., Hu, P., Herzfeldt, B., Roos, R.P., Warner, C., Deng, G., Soriano, E., Smyth, C., Parge, H.E., Ahmed, A., Roses, A.D., Hallewell, R.A., Pericak-Vance, M.A., and Siddique, T. (1993) Amyotrophic lateral sclerosis and structural defects in Cu/ Zn superoxide dismutase. Science 261:1047–1051. Ogasawara, M., Matsubara, Y., Narisawa, K., Aoki, M., Nakamura, S., Itoyama, Y.,
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
16.
17. 18.
19. 20.
21. 22.
23.
24.
25.
26.
27.
28.
29.
405
and Abe, K. (1993) Mild ALS in Japan associated with novel SOD mutation. Nature Genet. 5:323–324. Aoki, M., Abe, K., Houi, K., Ogasawara, M., Matsubara, Y., Kobayashi, T., Mochio, S., Narisawa, K., and Itoyama, Y. (1995) Variance of age at oneset in a Japanese family with amyotrophic lateral sclerosis associated with a novel Cu/Zn superoxide dismutase mutation. Ann. Neurol. 37:676–679. Eisen, A. (1995) Amyotrophic lateral sclerosis is a multifactorial disease. Muscle Nerve 18:741–752. Gurney, M.E., Pu, H., Chiu, A.Y., Dal Canto, M.C., Polchow, C.Y., Alexander, D.D., Caliendo, J., Hentati, A., Kwon, Y.W., Deng, H.X., Chen, W., Zhai, P., Safit, R.L., and Siddique, T. (1994) Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 264:1772–1775. Price, D.L., Cleveland, D.W., and Koliatsos, V. (1994) Motor neuron disease and animal models. Neurobiol. Dis. 1:3–11. Ripps, M.E., Huntley, G.W., Hof, P.R., Morrison, J.H., and Gordon, J.W. (1995) Transgenic mice expressing an altered murine superoxide dismutase gene provide an animal model of amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. USA 92: 689–693. Gurney, M.E. (1997) Transgenic animal models of familial amyotrophic lateral sclerosis. J. Neurol 244:S15–S20. Cleveland, D.W., Bruijn, L.I., Wong, P.C., Marszalek, J.R., Vechio, J.D., Lee, M.K., Xu, X.S., Borchelt, D.R., Sisodia, S.S., and Price, D.L. (1996) Mechanisms of selective motor neuron death in transgenic mouse models of motor neuron disease. Neurology 47 (suppl 2), 54–62. Phillips, J.P., Tainer, J.A., Getzoff, E.D., Boulianne, G.L., Kirby, K., and Hilliker, A.J. (1995) Subunit-destabilizing mutations in drosophila copper/zinc superoxide dismutase: neuropathology and a model of dimer dysequilibrium. Proc. Natl. Acad. Sci. USA 92:8574–8578. Parkes, T.L., Elia, A.J., Dickinson, D., Hilliker, A.J., Phillips, J.J., and Boulianne, G.L. (1998) Extension of Drosophila lifespan by overexpression of human SOD1 in motoneurons. Nature Genet. 19:171–174. Seto, N.O., Hayashi, S., and Tener, G.M. (1990) Overexpression of Cu,Zn superoxide dismutase in Drosophila does not affect life-span. Proc. Natl. Acad. Sci. USA 87:4270–4274. Orr, W.C. and Sohal, R.S. (1993) Effects of Cu,Zn superoxide dismutase overexpression on life-span and resistance to oxidative stress in transgenic Drosophila melanogaster. Arch. Biochem. Biophys. 301:34–40. Rabizadeh, S., Gralla, E.B., Borchelt, D.R., Gwinn, R., Valentine, J.S., Sisodia, S., Wong, P., Lee, M., Hahn, H., and Bredesen, D.E. (1994) Mutations associated with amyotrophic lateral sclerosis convert superoxide dismutase from an antiapoptotic gene to a proapoptotic gene: studies in yeast and neural cells. Proc. Natl. Acad. Sci. USA 92:3024–3028. Nishida, C.R., Gralla, E.B., and Valentine, J.S. (1994) Characterization of three yeast copper-zinc superoxide dismutase mutants analogous to those coded for in familial amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. USA 91:9906–9910. Culotta, V.C., Joh, H.D., Lin, S.J., Slekar, K.H., and Strain, J. (1995) A physiological
406
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
Rotilio et al. role for S. cerevisiae copper/zinc superoxide dismutase in copper buffering. J. Biol. Chem. 270:29991–29997. Corson, L.B., Strain, J.J., Culotta, V.C., and Cleveland, D.W. (1998) Chaperonefacilitated copper binding is a property common to several classes of familial amyotrophic lateral sclerosis–linked superoxide dismutase mutants. Proc. Natl. Acad. Sci. USA 95:6361–6366. Borchelt, D.R., Lee, M.K., Slunt, H.S., Guarnieri, M., Xu, Z.S., Wong, P.C., Brown, R.H., Price, D.L., Sisodia, S.S., and Cleveland, D.W. (1994) Superoxide dismutase 1 with mutations linked to familial amyotrophic lateral sclerosis possesses significant activity. Proc. Natl. Acad. Sci. USA 91:8292–8296. Ghadge, G.D., Lee, J.P., Bindokas, V.P., Jordan, J., Ma, L., Miller, R.J., and Roos, R.P. (1997) Mutant superoxide dismutase-1-linked familial amyotrophic lateral sclerosis: molecular mechanisms of neuronal death and protection. J. Neurosci. 17: 8756–8766. Carrı`, M.T., Ferri, A., Battistoni, A., Famhy, L., Gabbianelli, R., Poccia, F., and Rotilio, G. (1997) Expression of a Cu,Zn superoxide dismutase typical of familial amyotrophic lateral sclerosis induces mitochondrial alteration and increase of cytosolic Ca 2⫹ concentration in transfected neuroblastoma SH-SY5Y cells. FEBS Lett. 414:365–368. Carrı`, M.T., Battistoni, A., Polizio, F., Desideri, A., and Rotilio, G. (1994) Impaired copper binding by the H46R mutant of human Cu,Zn superoxide dismutase, involved in amyotrophic lateral sclerosis. FEBS Lett. 356:314–316. Lyons, T.J., Liu, H., Goto, J.J., Nersissian, A., Roe, J.A., Graden, J.A., Cafe´, C., Ellerby, L.M., Bredesen, D.E., Gralla, E.B., and Valentine, J.S.(1996) Mutations in copper -zinc superoxide dismutase that cause amyotrophic lateral sclerosis alter the zinc binding site and the redox behavior of the protein. Proc. Natl. Acad. Sci. USA 93:12240–12244. Liochev, S.I., Chen, L.L., Hallewell, R.A., and Fridovich, I. (1997) Superoxidedependent peroxidase activity of H48Q: a superoxide dismutase variant associated with familial amyotrophic lateral sclerosis. Arch Biochem. Biophys. 346(2):263–268. Crow, J.P., Sampson, J.B., Zhuang, Y., Thompson, J.A., and Beckman, J.S. (1997) Decreased zinc affinity of amyotrophic lateral sclerosis-associated superoxide dismutase mutants leads to enhanced catalysis of tyrosine nitration by peroxynitrite. J. Neurochem. 69:1936–1944. Crow, J.P., Ye, Y.Z., Strong, M., Kirk, M., Barnes S., and Beckman, J.S. (1997) Superoxide dismutase catalyzes nitration of tyrosines by peroxynitrite in the rod and head domains of neurofilament-L. J. Neurochem. 69:1945–1953. Fujii, J., Myint, T., Seo, H.G., Kayanoki, Y., Ikeda, Y., Taniguchi, N. (1995) Characterization of wild type and amyotrophic lateral sclerosis–related mutant Cu/Znsuperoxide dismutases overproduced in baculovirus-infected insect cells. J. Neurochem. 64:1456–1461. Reaume, A.G., Elliott, J.L., Hoffman, E.K., Kowall, N.W., Ferrante, R.J., Siwek, D.E., Wilcox, H.M., Flood, D.G., Beal, M.F., Brown, R.H. Jr., Scott, R.W., and Snider, W.D. (1996) Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nature Genet. 13:43–47.
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
407
41. Marklund, S.L., Andersen, P.M., Forsgren, L., Nilsson, P., Ohlsson, P.I., Wikander, G., and Oberg, A. (1997) Normal binding and reactivity of copper in mutant superoxide dismutase isolated from amyotrophic lateral sclerosis patients. J. Neurochem. 69:675–681. 42. Bowling, A.C., Barkowski, E.E., McKenna-Yasek, D., Sapp, P., Horvitz, H.R., Beal, M.F., and Brown, R.H. (1995) Superoxide dismutase concentration and activity in familial amyotrophic lateral sclerosis. J. Neurochem. 64:2366–2369. 43. Radunovic, A., Delves, H.T., Robberecht, W., Tilkin, P., Enayat, Z.E., Shaw, C.E., Stevic, Z., Apostoloski, S., Powell, J.F., and Leigh, P.N. (1997) Copper and zinc levels in familial amyotrophic lateral sclerosis patients with CuZnSOD gene mutations. Ann. Neurol. 42:130–131. 44. Kostic, V., Gurney, M.E., Deng, H.X., Siddique, T., Epstein, C.J., and Przedborski, S. (1997) Midbrain dopaminergic neuronal degeneration in a transgenic mouse model of familial amyotrophic lateral sclerosis. Ann. Neurol. 41:497–504. 45. Winterbourn, C.C., Domigan, N.M., and Broom, J.K. (1995) Decreased thermal stability of red blood cell glu 100 → gly superoxide dismutase from a family with amyotrophic lateral sclerosis. FEBS Lett. 368:449–451. 46. Kane, D.J. Sarafian, T.A., Anton, R., Hahn, H., Gralla, E.B., Valentine, J.S., Ord, T., and Bredesen, D.E. (1993). Bcl-2 inhibition of neural death: decreased generation of reactive oxygen species. Science 262:1274–1277. 47. Beckman, B.J., Beckman, T.W., Chen, J., Marshall, P.A., and Freeman, B.A. (1990) Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. USA 87:1620–1624. 48. Beckman, J.S., Carson, M., Smith, C.D., and Koppenol, W.H. (1993) ALS, SOD and peroxynitrite. Nature 364:584. 49. Cleveland, D.W. (1996) Neuronal growth and death: order and disorder in the axoplasm. Cell 84:663–666. 50. Dal Canto, M.C. and Gurney, M.E. (1995) Neuropathological changes in two lines of mice carrying genes for mutant Cu,ZnSOD, and in mice overexpressing wildtype human SOD: a model of familial lateral sclerosis (FALS). Brain Res. 676:25– 40. 51. Chou, S.M., Wang, H.S., and Komai, K. (1996) Colocalization of Nos and SOD1 in neurofilament accumulation within motor neurons of amyotrophic lateral sclerosis: an immunohistochemical study. J. Chem. Neuroanat. 10:249–258. 52. Chou, S.M., Wang, H.S., and Tanuguchi, A. (1996) Role of SOD1 and nitric oxide/ cyclic GMP cascade on neurofilament aggregation in ALS/MND. J. Neurol. Sci. 139 (Suppl) 16:26. 53. Bruijn, L.I., Beal, M.F., Becher, M.W., Schulz, J.B., Wong, P.C., Price, D.L., and Cleveland, D.W. (1997) Elevated free nitrotyrosine levels, but no protein-bound nitrotyrosine or hydrosyl radicals, throughout amyotrophic lateral sclerosis like disease implicate tyrosine nitration as an aberrant in vivo property of one familial AlS-linked superoxide dismutase 1 mutant. Proc. Natl. Acad. Sci. USA 94:7606–7611. 54. Wiedau-Pazos, M., Goto, J.J., Rabizadeh, S., Gralla, E.B., Roe, J.A., Lee, M.K., Valentine, J.S., and Bredesen, D.E. (1996) Altered reactivity of superoxide dismutase in familial amyotrophic lateral sclerosis. Science 271:515–518. 55. Bredesen, D.E., Wiedau-Pazos, M., Goto, J.J., Rabizadeh, S., Roe, J.A., Gralla,
408
56.
57.
58.
59.
60.
61.
62. 63.
64.
65.
66.
67.
68.
Rotilio et al. E.B., Ellerby, L.M., and Valentine, J.S. (1996). Cell death mechanisms in ALS. Neurology 47 (suppl 2):S36–S39. Yim, M.B., Kang, J.H., Yim, H.S., Kwak, H.S., Chock, P.B., and Stadtman, E.R. (1996) A gain of function of an amyotrophic lateral sclerosis associated Cu,Zn superoxide dismutase mutant: and enhancement of free radical formation due to a decrease in Km for hydrogen peroxide. Proc. Natl. Acad. Sci. USA 93:5709–5714. Singh, R.J., Karoui, H., Gunther, M.R., Beckman, J.S., Mason, R.P., and Kalyanaraman, B. (1998) Reexamination of the mechanism of hydroxyl radical adducts formed from the reaction between familial amyotrophic lateral sclerosis associated Cu,Zn superoxide dismutase mutants and H 2 O2 . Proc. Natl. Acad. Sci. USA 95:6675–6680. Hottinger, A.F., Fine, E.G., Gurney, M.E., Zurn, A.D., and Aebscher, P. (1997) The copper chelator d-penicillamine delays onset of disease and extends survival in a transgenic mouse model of familial amyotrophic lateral sclerosis. Eur. J. Neurosci. 9:1548–1551. Pardo, C.A., Xu, Z., Borchelt, D.R., Price, D.L., Sisodia, S.S., and Cleveland, D.W. (1995) Superoxide dismutase is an abundant component in cell bodies, dendrites, and axons of motor neurons and in a subset of neurons. Proc. Natl. Acad. Sci. USA 92:954–958. Bruijn, L.L., Houseweart, M.K., Kato, S., Anderson, K.L., Anderson, S.D., Ohama, E., Reaume, A.G., Scott, R.W., and Cleveland, D.W. (1998) Aggregation and motor neuron toxicity of an ALS-linked SOD1 mutant independent from wild type SOD1. Science 281:1851–1854. Kunst, C.B., Mezey, E., Brownstein, M.J., and Patterson, D. (1997) Mutations in SOD associated with amyotrophic lateral sclerosis cause novel protein interactions. Nature Genet. 15, 91–94. Shaw, P.J. and Ince, P.G. (1997) Glutamate excitotoxicity and amyotrophic lateral sclerosis. J. Neurol. 244 (suppl 1):S3–S14. Rothstein, J.D., Martin, L., and Dykes-Hoberg, M. (1994) Glutamate transporter subtypes: role in excitotoxicity and amyotrophic lateral sclerosis. Ann. Neurol. 36: 282. Eisen, A., Stewart, H., Schulzer, M., and Cameron, D. (1993) Anti-glutamate therapy in amyotrophic lateral sclerosis: a trial using lamotrigine. Can. J. Neurol. Sci. 20: 297–301. Xu, Z., Cork, L.C., Griffin, J.W., and Cleveland, D.W. (1993) Increased expression of neurofilament subunit NF-L produces morphological alterations that resemble the pathology of human motor neuron disease. Cell 73:23–33. Kimura, F., Glenn Smith, R., Del Bono, O., Nyormoi, O., Schneider, T., Nastainczyk, W., Hofman, F., Stefani, E., and Appel, S.H. (1994) Amyotrophic lateral sclerosis patient antibodies label Ca 2⫹ channel α 1 subunit. Ann. Neurol. 35:164–171. Mosier, D.R., Bandelli, P., Delbono, O., Smith, R.G., Alexianu, M.E., Appel, S.H., and Stefani, E. (1995) Amyotrophic lateral sclerosis immnunoglobulins increase Ca 2⫹ currents in a motoneuron cell line. Ann. Neurol. 37:102–109. Curti, D., Malaspina, A., Facchetti, G., Camana, C., Mazzini, L., Tosca, P., Zerbi, F., and Ceroni, M. (1996) Amyotrophic lateral sclerosis: oxidative energy metabolism and calcium homeostasis in peripheral blood lymphocytes. Neurology 47:1060– 1064.
Superoxide Dismutase and Amyotrophic Lateral Sclerosis
409
69. Siklos, L., Engelhardt, J., Harati, Y., Smith, R.G., and Appel, S.H. (1996) Ultrastructural evidence for altered calcium in motor nerve terminals in amyotrophic lateral sclerosis. Ann. Neurol. 39:203–216. 70. Siklos, L., Engelhardt, J.I., Alexianu, M.E., Gurney, M.E., Siddique, T., and Appel, S.H. (1998) Intracellular calcium parallels motoneuron degeneration in SOD-1 mutant mice. J. Neuropathol. Exp. Neurol. 57:571–587. 71. Ho, B.K., Alexianu, M.E., Colom, L.V., Serrano, F., and Appel, S.H. (1996) Expression of calbindin-D28K in motoneuron hybrid cells after retroviral infection with calbindin-D28k cDNA prevents amyotrophic lateral sclerosis IgG-mediated cytotoxicity. Proc. Natl. Acad. Sci. USA 93:6796–6801. 72. Swanson, N.R., Fox, S.A., and Mastaglia, F.L. (1995) Search for persistent infection with poliovirus or other enteroviruses in amyotrophic lateral sclerosis–motor neuron disease. Neuromusc. Disord. 5:457–465. 73. Okumura, H., Kurland, L.T., and Waring, S.C. (1995) Amyotrophic lateral sclerosis and polio: is there an association? Ann. N.Y. Acad. Sci. 753:245–256. 74. Westarp, M.E., Ferrante, P., Perron, H., Batmann, P., and Kornhuber, H.H. (1995) Sporadic ALS/MND: a global neurodegeneration with retroviral involvement? J. Neurol. Sci. 129 (suppl):145–147. 75. Salazar-Grueso, E.F. and Roos, R.P. (1995) Amyotrophic lateral sclerosis and viruses. Clin. Neurosci. 3:360–367. 76. Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp., P., Hentati, A., Donaldson, D., Goto, J., O’regan, J.P., Deng, H.X., Rahmani, Z., Krizus, A., Mc Kenna-Yasek, D., Cayabyab, A., Gaston, S.M., Berger, R., Tanzi, R.E., Halperin, J.J., Herzfeldt, B., V.D. Bergh, R., Hung, W.Y., Bird, T., Deng, G., Mulder, D.W., Smyth, C., Laing, N.G., Soriano, E., Pericak-Vance, M.A., Haines, J., Rouleau, G.A., Gusella, J.S., Horvitz, H.R., and Brown, R.H. (1993) Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362:59–61. 77. Nishikawa, T., Lee, S.M., Shiraishi, N., Ishikawa, T., Ohta, Y., and Nishikimi, M. (1997). Identification of S100b protein as copper-binding protein and its suppression of copper-induced cell damage. J. Biol. Chem. 272:23037–23041. 78. Galiazzo, F., Ciriolo, M.R., Carrı`, M.T., Civitareale, P., Marcocci, L., Marmocchi, F., and Rotilio, G. (1991) Activation and induction by copper of CuZn superoxide dismutase in Saccharomyces cerevisiae. Eur. J. Biochem. 196:545–549. 79. Steinkuhler, C., Sapora, O., Carrı`, M.T., Nagel, W., Marcocci, L., Ciriolo, M.R., and Weser, U., Rotilio, G. (1991) Increase of Cu,Zn-superoxide dismutase activity during differentiation of human K562 cells involves activation by copper of a constantly expressed copper-deficient protein. J. Biol. Chem. 266:24580–24587. 80. Steinkuhler, C., Carrı`, M.T., Micheli, G., Knoepfel, L., Weser, U., and Rotilio, G. (1994) Copper-dependent metabolism of Cu,Zn-superoxide dismutase in human K562 cells. Biochem. J. 302:687–694. 81. Petrovic, N., Comi, A., and Ettinger, M.J. (1996) Identification of an Apo-superoxide dismutase pool in human lymphoblasts. J. Biol. Chem. 271:28331–28334. 82. Gabbianelli, R., Ferri, A., Rotilio, G., and Carri, M.T. (1999) Aberrant copper chemistry as a major mediator of oxidative stress in a human cellular model of amyotrophic lateral sclerosis. J. Neurochem. 73:1175, 1180.
20 Effects of Ginkgo biloba Extract (EGb 761) on Alzheimer’s Disease Yves Christen and Marie-The´re`se Droy-Lefaix Institut Ipsen, Paris, France
Catherine Pasquier INSERM U479, Paris, France
Lester Packer University of California, Berkeley, California
I. INTRODUCTION Over the past decade the study of Alzheimer’s disease has seen some of the most spectacular research in the field of neurology. Quite a clear, coherent explanation of the pathogenesis of the disease has emerged, although there is no explanation of the causes and mechanisms involved in the dementia that has met with unanimous acceptance. Clinical research has had to contend with major obstacles as, for example, the need for proper scales to assess the development of states of dementia for the purposes of accurate analysis, and the time lag, as diagnosis is only confirmed decades after pathogenesis has already started. However, recent progress has made it possible to conduct a number of clinical and epidemiological studies producing positive findings, proving that it is not totally unrealistic to consider ways of counteracting a neurodegenerative process, and to observe a coherent pattern in the pathogenesis of Alzheimer’s disease. While specialists may have differing opinions on the causal relationship of particular cellular events, a consensus on the usefulness of taking action on certain physiological processes is currently emerging (1–3). It is generally agreed, for example, that a substance that counteracts the effects of β-amyloid peptide on the neurons (βamyloid peptide being the principal component of senile plaques, which are one of the hallmarks of Alzheimer’s disease) will be beneficial in treating the disease, 411
412
Christen et al.
even if it could be proved at a later date that the actual deposit of the substance is not the primary causal event (4). For this reason, the coexistence of different etiopathogenic hypotheses does not invalidate the findings of pharmacological research. It is quite clear, however, that research should not stop once the mechanisms of action have been identified on a solely molecular level. The pharmacological approach must include verifications covering the different levels of organization of living organisms. In the case of Ginkgo biloba extract EGb 761, a standardized extract of the ginkgo tree leaves, containing 24% flavonoids and 6% terpene lactones (ginkgolides and bilobalide), studies carried out are relevant as they cover all levels of analysis in the pathological process, i.e., molecules, cells, and tissues; whole body (normal, old as well as pathological); behavior; and human cases.
II. MOLECULAR AND CELLULAR EFFECTS OF EGb 761 A.
Antioxidant Effect
No matter which explanation of the pathogenesis of Alzheimer’s disease is adopted, it is important to bear in mind that at one point or another in the pathological process neurons are damaged and die. The most likely explanation is based on the involvement of oxidative processes, caused by the action of β-amyloid (which produces free radicals), the penetration of calcium (which encourages the formation of the peroxynitrite radical), membrane peroxidation and the consequent release of 4-hydroxynonenal, or the action of iron or other metals or even of a mechanism of apoptosis (1,5–7). It has been shown under experimental conditions that neuronal death induced by β-amyloid is the result of an attack by free radicals (8). For this reason, substances capable of scavenging free radicals and/or antioxidants are prime candidates as therapy for Alzheimer’s disease. It is quite remarkable at present to see antioxidant effects being used to explain the apparently beneficial action of drugs which, a priori, belong to different therapeutic classes (this is particularly the case of estrogen). Dozens of publications have presented findings confirming the effect of EGb 761 as a scavenger of free radicals and an antioxidant (9–12) and the effect has been largely recognized in recent international publications on the subject (13,14). EGb 761 scavenges many free radicals which may be involved in neurodegenerative processes: hydroxyl, superoxide, nitric oxide (an extremely important element as nitric oxide is a component in the formation of the neurotoxic peroxynitrite), oxoferryl radicals, lipid peroxide, etc. EGb 761 also helps prevent the loss of vitamin E and β-carotene in human LDL (low-density lipoprotein) subjected to oxidative stress and this has been shown to be dose-dependent (15).
Ginkgo biloba and Alzheimer’s Disease
413
The antioxidant effect has even been demonstrated by in vivo studies on human subjects orally treated with EGb 761 (16). In the case of Alzheimer’s disease, EGb 761 stands to be a very valuable candidate because: 1. It has a dual action. First, through its flavonoid component, scavenging free radicals which have been formed and thus countering membrane peroxidation; it is possible to avoid membrane damage and the consequent formation of extremely toxic compounds such as 4-hydroxynonenal. Second, the ginkgolides help counteract the formation of free radical–type species, particularly in the mitochondria, thus helping counteract intracellular damage. 2. It acts directly on the neurons affected by oxidative stress, specifically the hippocampal neurons which suffer the most damage in Alzheimer’s disease (17). This action on the cells correlates with the protective effect on the hippocampus in living animals treated orally with EGb 761 (18) as will be shown below. B.
Effects on -Amyloid
The main etiopathogenic hypotheses currently held focus on amyloidogenesis, i.e., the formation and deposit of β-amyloid in senile plaques (the main histological phenomenon of Alzheimer’s disease with neurofibrillary tangles). Whether or not this particular peptide plays the initial causal role, there is no longer any doubt cast on its involvement in the pathogenesis at one stage or another (2,3). The main aspects of its pathological effects include aggregation (nonaggregated peptide does not appear to be neurotoxic) and the production of free radicals, as well as its neuronal toxicity resulting from an attack by free radicals (8). EGb 761 inhibits not only the aggregation of β-amyloid (K. Beyreuther, personal communication), but also β-amyloid toxicity (19). This protective effect has been verified on hippocampal cells in primary culture with a very distinct dose–effect correlation. C.
Apolipoprotein E
The involvement of apolipoprotein E (apo E) in Alzheimer’s disease was observed with the discovery of the frequent occurrence of the ε4 allele in the gene coding for this protein in Alzheimer patients. (The other two alleles, ε2 and ε3, appear to play a protective role.) The discovery is of special interest as apo E is the sole transporter of cholesterol in the brain and because synaptic activity and neurodegenerative processes involve membrane remodeling and therefore transportation of lipids to the membranes of the neurons (20). But apo E is prone to
414
Christen et al.
attacks by free radicals and in fact in an allele-dependent way, apo E4 being more sensitive than apo E3 which in turn is more sensitive than apo E2. EGb 761 protects apo E (specifically the E4 isotope) from attacks by free radicals (21,22). Ramassamy et al. (23,24) showed an increase in the lipoperoxidation of proteins in the cerebrospinal fluid of patients with an ε4 allele, which offers an argument in the explanation of the role of apo E in Alzheimer’s disease. Apo E has an antioxidant effect (25) which the E4 form, could not produce. Ramassamy et al. (24) also showed that EGb 761 inhibited the peroxidation of proteins in the cerebrospinal fluid of Alzheimer’s patients. Another factor explaining the involvement of apo E in Alzheimer’s disease is the apparently beneficial effect of the substance on processes involving neuronal plasticity and recovery after damage; this has been shown in experiments on apo E knockout animals with low synaptic density. The hypothesis is that apo E4 is not toxic, but simply less efficient in carrying out neuronal repairs; this has been proven with transgenic mice expressing each of the apo E isoforms (after a stroke, ε4 animals do not recover as well as ε2 or ε3 animals). A number of studies have confirmed that the E3 isoform has a trophic effect on neurite outgrowth; this is not found with the E4 isoform (27–29). One possible therapeutic approach to Alzheimer’s disease would therefore be to encourage the production of apo E. Ramassamy et al. (24) showed EGb 761 (20 µg/mL) to be an effective means of increasing the production of apo E in cells subjected to oxidative stress in hippocampus and entorhinal cortex. D.
Inhibition of Monoamine Oxidase
The inhibition of monoamine oxidases, the mitochondrial enzymes found in two forms, MAO-A and MAO-B, has a neuroprotective action that has been shown in a number of experimental models; this may be explained by the scavenging of free radicals or by other mechanisms. Increased MAO-B activity has been observed in the brains of Alzheimer’s patients (30,31) as well as in patients suffering from amyotrophic lateral sclerosis (32). The potential of inhibiting monoamine oxidases as a means of reducing neurodegenerative processes has been confirmed in spectacular fashion by using monoamine oxidase gene B knockout mice, which not only show a better reaction to stress but also display resistance to the neurodegenerative effect of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) (33). Pardon et al. (34) observed a substantial increase in monoamine oxidase activity in aging mice subjected to mild stress (using a model for stress as encountered in everyday life). The effect is totally reversed in mice treated with EGb 761. It is not clear, however, whether the inhibitory action of monoamine oxidase (both A and B), observed in vivo and seen to offset the increase caused by aging and/or stress, does in fact reveal a direct effect of EGb 761 on the enzyme. A more probable explanation would be downregulation.
Ginkgo biloba and Alzheimer’s Disease
415
E. Cytochrome c Oxidase Upregulation and Mitochondrial Protection Many studies have identified mitochondrial anomalies in Alzheimer’s disease. Such anomalies offer an explanation for both the hypometabolism observed, for example, on PET scan, and the maternal link sometimes found in Alzheimer’s disease which often appears to be passed on from mother to child (the mitochondria, of course, coming only from the mother). Recent genetic discoveries have shown the mitochondrial genome to be affected in Alzheimer’s disease, although other studies have proved this link to be invalid. No matter what the explanation may be for the anomalies in the mitochondrial genome, poor operational status of the mitochondria has been clearly observed (see, in particular, Ref. 5), and specifically so in relation to complex IV in the electron transport chain (related to cytochrome c oxidase activity). EGb 761 prevents age-related changes to the size of the mitochondria (35) and protects the mitochondrial genome (36). For this general reason, therefore, it is a beneficial factor helping to maintain metabolic function and specifically the metabolism of the brain, as has also been shown by in vivo studies (37; see also Ref. 38). Regardless of any general considerations relating to this, cytochrome c oxidase deficit has been extensively reported. Rapoport et al. (39) maintain that it is caused by downregulation related to synaptic loss: as the neurons are exercised to a lesser degree, their energy is reduced at the very time there should be greater activity. The theory implies a degree of reversibility in the metabolic deficit at the onset of Alzheimer’s disease, provided that drugs capable of upregulating cytochrome c oxidase can be found. The latest studies by Chandrasekaran et al. (40) have shown that EGb 761 can in fact upregulate and is therefore able to correct this key factor of hypometabolism found in Alzheimer’s disease. F. Antiapoptosis Effect Apoptosis seems to be involved in the process of neuronal death found in Alzheimer’s disease. EGb 761 has been shown to inhibit this process of apoptosis in a number of experimental situations and particularly (when administered at doses of 50 mg/day per os) for the neurons in the olfactory epithelium (41). G.
Inhibition of Protein Kinase C
Alzheimer’s disease, like other neurodegenerative processes, involves the action of kinases (and also phosphatases) for the phosphorylation of tau protein, the main component of neurofibrillary tangles, and other processes. A number of studies (42) have suggested that overactivation of protein kinase C (PKC) causes neural cell death and that PKC inhibitors can decrease this phenomenon. It there-
416
Christen et al.
fore follows that PKC inhibitors should have a beneficial effect on neurodegenerative processes (and in ischemia). Rogue and Malviya (43) demonstrated this inhibiting effect in EGb 761 using a model of bilateral ischemia. It is interesting to note that the same authors showed that EGb 761 also increased the activity of protein kinase A, which could prove to be beneficial in improving mnesic processes.
H.
Effects on Neurotransmitter Receptors in Aged Subjects
Neurotransmitter systems are disturbed in both aged subjects and Alzheimer’s patients. Kristofikova et al. (44) found that EGb 761 could, both in vitro and in vivo (50 mg/kg), produce a significant increase in the choline captured in the synaptosomes of the hippocampal neurons in aged rats (24 months), resulting in a functional improvement in cholinergic endings (which are severely affected in Alzheimer’s disease). Huguet and Tarrade (45) showed that subchronic treatment with EGb 761 (5 mg/kg/day IP) significantly reversed the loss of noradrenergic receptors in the cell membranes in the cortex and hippocampus of aged rats (24 months).
III. A.
EFFECTS ON THE LIVING ORGANISMS Protection of the Brain in Aged Animals
A number of investigators observed a protective effect on the hippocampus of ischemic animals treated with EGb 761. Research by Barkats et al. (18) studying the reduction of the area of mossy fibers in the hippocampus of aged mice both treated and not treated with EGb 761, was even more convincing. It should be noted that this is an area of synapses that is highly subject to the effects of aging, that the role of the hippocampus in memory has been well established, and that the hippocampal region is one of the first regions affected in Alzheimer’s disease. In a comprehensive study, Barkats (46) showed that the reduction of the surface area of mossy fibers was directly related to the attack by free radicals, as observed by studying a transgenic strain of mice overexpressing copper/zinc superoxide dismutase (Cu/Zn-SOD) (the animal model for trisomy 21 syndrome). Not only do mice given chronic EGb 761 treatment (50 mg/kg/day PO.) appear to be protected, but the protection itself correlates with improved mnesic performances by the animals as assessed in the Morris water maze (47). Taken together, these experimental data can provide confirmation of the impact of free radicals on cerebral aging and atrophy of the hippocampus, their adverse effect on mnesic performance, and the possibility of using a free radical scavenger to correct the deficit, in the present case EGb 761 orally administered.
Ginkgo biloba and Alzheimer’s Disease
B.
417
Repairing Brain Damage
Many studies have shown EGb 761 to have an effect in repairing brain damage (48). Brailowski and Montiel (49) observed an effect with chronic treatment (100 and 50 mg/kg/day PO and even 10 mg/kg/day IP) using a model of hemiplegia induced by aspirating the motor cortex in the rat; Kelche et al. (50) showed behavioral recovery after septohippocampal damage in the rat (with a treatment of 60 mg/kg/day IP); Shifman et al. (51) observed operational and anatomic recovery after damage to the entorhinal cortex in the rat (EGb 761, 100 mg/kg/day IP.) and Attella et al. (52) showed recovery after damage to the frontal cortex (EGb 761, 100 mg/kg/day IP). All of these studies confirm the possibility of improved brain recovery when treated with EGb 761, particularly in areas most affected at the beginning of Alzheimer’s disease (entorhinal cortex and hippocampus) and where brain plasticity remains at a high level until an advanced age. C.
Behavioral Effects
Many studies using rodents as various learning and memory models have confirmed the beneficial effect of EGb 761 via different administration routes, including per os (47,53–59). It is quite clear that the drug has a beneficial action, counteracting one of the main symptoms of Alzheimer’s disease, which is memory loss. D.
Antistress Effects
Alzheimer’s disease involves a number of disturbances to the neuroendocrine system and an increase in the level of circulating cortisol. Glucocorticoids (and cortisol in humans) are produced by the adrenal cortex in reaction to stress and have an adverse effect on hippocampal neurons, making them more prone to attacks by oxygen-containing free radicals (1). Recent observations of human subjects have confirmed the relationship between aging and plasma cortisol levels, memory deficits, and hippocampal atrophy (60). These discoveries justify the studies of the protective role of EGb 761 in counteracting different types of stress. These effects, as shown with different doses of EGb 761 per os, ranging from 50 to 100 mg/kg, have been confirmed by a number of research teams working with different models (61–63). This protective effect is accompanied by a lowering of circulating corticosterone and ACTH levels (63,64), a restoration of the number of operational type II glucocorticoid receptors in the hippocampus (65), and restored cognitive performance in stressed animals (63). The drop in circulating glucocorticoids caused by EGb 761 treatment could be explained by reduced expression of the peripheral-type benzodiazepine receptor (66). It should also be noted that free radicals and glucocorticoids may have a concerted action
418
Christen et al.
causing neuronal death; Behl et al. (67) showed that glucocorticoids increased death of hippocampal neurons due to oxidative stress. IV. A.
EFFECTS IN HUMANS Human Pharmacology
A number of clinical studies have shown EGb 761 to have a beneficial effect on memory performance and/or vigilance as assessed by a quantitative electroencephalogram (see Ref. 38); the drug has a facilitating effect on the information acquisition process as seen, for example, using the dual coding test (68). This suggests that EGb 761 improves the rate of information processing (learning and storage), including cases of acute treatment at high doses (320 and 600 mg). Israel et al. (69) showed that aged subjects (average age 68.4) after 8 months of EGb 761 treatment (160 mg/day) displayed improved mnesic capacity, which could be used to complement methods for memory training and improvement. This observation is of great therapeutic value and is also an interesting contribution to the concept of neuronal plasticity. It could then be deduced that EGb 761 may help enhance plasticity processes requiring stimulation methods. B.
Clinical Observations
Biological and pharmacological research suggests that EGb 761 could have an effect on Alzheimer’s disease. Such an effect has been observed in a number of studies in Germany (70–72) and the United States (73). The study by Le Bars et al. (73) observed 202 patients over a period of 52 weeks. The treated group was given a daily dose of 120 mg/kg of EGb 761. All subjects were assessed using standard Alzheimer scales: Alzheimer’s Disease Assessment Scale–Cognitive Subscale (ADAS-Cog), Geriatric Evaluation by Relative Rating Instrument (GERRI), and Clinical Global Impression of Change (CGIC). EGb 761–treated subjects recorded a significant lead of 1.4 points on the ADAS-Cog and 0.14 on the GERRI scales. As free radical scavenging effect appears to be an important feature in the action of EGb 761, it is interesting to note that the other two free radical scavengers, vitamin E and selegiline, have also produced positive clinical results (74). These two substances, however, did not have any effect on the cognitive parameters, while EGb 761 produced a significant improvement in these parameters as assessed on the ADAS-Cog scale. V.
CONCLUSIONS
The review of the effects of EGb 761 has presented the mechanisms of action offering potential benefit, a protective effect observed in vivo in animals and in particular in aged animals, and a behavioral and cognitive effect seen in both
Ginkgo biloba and Alzheimer’s Disease
419
animals and humans. These effects may be interpreted in the light of current theories on Alzheimer’s disease or, quite independently of such hypotheses, in terms of their own protective features. Most importantly, they are remarkable in their demonstration of action observed at every level of living organisms. Of the different mechanisms of action, the most likely appears to be based on protection from free radicals. This infers a neuroprotective effect offering a tantalizing interpretation of a fundamentally preventive and therefore long-term effect. It should be noted, however, that many of the beneficial effects of EGb 761 mentioned are almost immediate. These can also be interpreted in the context of antioxidant action. Free radicals clearly play a role causing damage but also activating genes. This second effect can be very rapid in action. It appears to occur in the context of cell protection from Alzheimer’s disease and in the absence of medication. The NF-κB transcription factor is particularly sensitive to the presence of a large pool of free radical species in the cell, activating it and triggering the action of genes having a protective effect (75–77). While free radicals are known to be a direct cause of damaging effects, their influence (and hence the systems of scavenging free radicals) on gene expression is no doubt crucial. Relevant to this point are recent studies aimed at showing the effect of EGb 761 on the expression of a number of genes. At least three have been identified to date: the AP-1 transcription factor (78), the cytochrome c oxidase gene (40), and the gene for the peripheral-type benzodiazepine receptor (66). An action on the regulation of gene expression offers a tempting explanation for some of the rapid effects of EGb 761 (79). The studies mentioned in this chapter have made it possible to consider other mechanisms of action (such as the inhibition of PKC or of monoamine oxidase). These different mechanisms of action do not necessarily cancel one another out but reflect the effects of processes of biological inhibition or activation at different levels. It is, however, quite clear that attention must focus on a number of mechanisms of action as it has been shown that some of the findings quoted here can be ascribed to the flavonoid component of EGb 761 (e.g., scavenging free radicals, inhibition of β-amyloid toxicity, protecting against brain damage, and inhibiting PKC), while others can be ascribed to the ginkgolides (inhibiting the production of oxygen-containing free radicals or the expression of the peripheral-type benzodiazepine receptor), and others again can be attributed to bilobalide (the effect on the regulation of cytochrome c oxidase). Seen from this point of view, EGb 761 is unique as it contains a number of active ingredients affecting processes believed to be involved in Alzheimer’s disease.
REFERENCES 1. Mattson, M.P. (1998) Experimental models of Alzheimer’s disease. Sci. Med. 5(2): 16–25.
420
Christen et al.
2. Selkoe, D.J. (1997) Alzheimer’s disease: genotype, phenotype, and treatments. Science 275:630–631. 3. Younkin, S., Tanzi, R. and Christen, Y., eds. (1998) Presenilins and Alzheimer’s Disease. Springer-Verlag, Heidelberg. 4. Wisniewski, T., Ghiso, J. and Frangione, B. (1997) Biology of Aβ amyloid in Alzheimer’s disease. Neurobiol. Dis. 4:313–328. 5. Beal, M.F., Howell, N. and Bodis-Wollner, I.B., eds. (1997) Mitochondria and Free Radicals in Neurodegenerative Disease. Wiley-Liss, New York. 6. Ceballos-Picot, I. (1997) The Role of Oxidative Stress in Neuronal Death. SpringerLandes, Austin. 7. Christen, Y. (2000) Oxidative stress and Alzheimer’s disease. J. Nutr. Health Aging (in press). 8. Behl, C., Davis, J.B., Lesley, R. and Schubert, D. (1994) Hydrogen peroxide mediates amyloid β protein toxicity. Cell 77:817–827. 9. Ferradini, C., Droy-Lefaix, M.-T. and Christen, Y., eds. (1993) Ginkgo biloba Extract (EGb 761) as a Free-Radical Scavenger. Elsevier, Paris. 10. Haramaki, N., Packer, L., Droy-Lefaix, M.-T. and Christen, Y. (1996) Antioxidant actions and health implications of Ginkgo biloba extract. In: Handbook of Antioxidants (Cadenas, E. and Packer L., eds.), Marcel Dekker, New York, pp. 487–510. 11. Packer, L, Saliou, C, Droy-Lefaix, M.-T. and Christen, Y. (1998) Ginkgo biloba extract EGb 761: antioxidant activity, and regulation of nitric oxide synthase. In: Flavonoids in Health and Disease (Rice-Evans, C.A. and Packer, L., eds.), Marcel Dekker, New York, pp. 303–341. 12. Droy, M.-T. (1997) Effect of the antioxidant action of Ginkgo biloba extract (EGb 761) on aging and oxidative stress. Age 20:141–149. 13. Rice-Evans, C.A. and Packer, L., eds. (1998) Flavonoids in Health and Disease. Marcel Dekker, New York. 14. Cadenas, E. and Packer, L., eds. (1996) Handbook of Antioxidants. Marcel Dekker, New York. 15. Maitra, I., Marcocci, L., Droy-Lefaix, M.-T. and Packer L. (1995) Peroxyl radical scavenging activity of Ginkgo biloba extract EGb 761. Biochem. Pharmacol. 49: 1443–1446. 16. Pietri, S., Maurelli, E., Drieu, K. and Culcasi, M. (1997) Cardioprotective antioxidant effects of the terpenoid constituents of Ginkgo biloba extract (EGb 761). J. Mol. Cell. Cardiol. 29:733–742. 17. Bastianetto, S., Ramassamy, C., Christen, Y., Poirier, J. and Quirion, R. (1998a) Ginkgo biloba extract (EGb 761) prevents cell death induced by oxidative stress in hippocampal neuronal cell cultures. In: Ginkgo biloba Extract (EGb 761) Study: Lessons from Cell Biology (Packer, L. and Christen, Y, eds.), Elsevier, Paris, pp. 85–99. 18. Barkats, M., Venault, P., Christen, Y. and Cohen-Salmon, C. (1995) Effect of longterm treatment with EGb 761 on age-dependent structural changes in the hippocampi of three inbred mouse strains. Life Sci. 56:213–222. 19. Bastianetto, S., Ramassamy, C., Christen, Y., Poirier, J. and Quirion, R. (1998b) Ginkgo biloba extract (EGb 761) protects in vitro rat hippocampal cells against toxicity induced by β-amyloid. Soc. Neurosci. 24:1456.
Ginkgo biloba and Alzheimer’s Disease
421
20. Poirier, J. (1994) Apolipoprotein E in animal models of CNS injury and in Alzheimer’s disease. Trends Neurosci., 12, 525–530. 21. Jolivalt, C. (1998) Oxydation des 3 isoformes d’apolipoprote´ine E humaine. The`se de l’Universite´ Henri Poincare´-Nancy I. 9 Juin 1998. 22. Leininger-Muller, B., Jolivalt, C., Bertrand, P. and Siest, G. (1998) Oxidation of human apolipoprotein E: isoforms susceptibility and protection with Ginkgo biloba EGb 761 extract. In: Ginkgo biloba Extract (EGb 761) Study: Lessons from Cell Biology (Packer, L. and Christen, Y., eds.), Elsevier, Paris, pp. 57–68. 23. Ramassamy, C., Beffert, U., Averill, D., Christen, Y., Schoofs, A., and Poirier, J. (1997) Influence of apolipoprotein E genotype on lipoperoxidation in Alzheimer’s disease brain. Soc. Neurosci., 23, 1369. 24. Ramassamy, C., Bastianetto, S., Krzywkowski, P., Averill, D., Christen, Y., Quirion, R. and Poirier J. (1998) Apolipoprotein E and EGb 761 in Alzheimer’s disease. In: Ginkgo biloba Extract (EGb 761) Study: Lessons from Cell Biology (Packer, L. and Christen, Y., eds.), Elsevier, Paris, pp. 69–83. 25. Miyata, M., Smith, J.D. (1996) Apolipoprotein E allele-specific antioxidant activity and effects on cytotoxicity by oxidative insults and β-amyloid peptides. Nature Genet. 14:55–61. 26. Laskowitz, D.T. and Roses, A.D. (1998) Apolipoprotein E: an expanding role in the neurobiology of disease. Alzheimer’s Rep. 1:5–12. 27. Nathan, B.P., Bellosta, S., Sanan, D.A., Weisgraber, K.H., Mahley, R.W. and Pitas, R.E. (1994) Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro. Science 264:850–852. 28. Masliah, E., Mallory, M., Ge, N., Aford, M., Veinbergs, I. and Roses, A.D. (1995) Neurodegeneration in the CNS of apoE-deficient mice. Exp. Neurol. 136:107–122. 29. Sun, Y., Wu, S., Bu, G., Onifade, M.K., Patel, S.N., LaDu, M.J. Fagan, A.M. and Holtzman, D. (1998) Glial fibrillary acidic protein–apolipoprotein E (apoE) transgenic mice: astrocyte-specific expression and differing biological effects of astrocyte-secreted apoE3 and apoE4 lipoproteins. J. Neurosci. 18:3261–3272. 30. Adolfsson R., Gottfries C.G., Oreland L., Wiberg A. and Winblad, B. (1980) Increased activity of brain and platelet monoamine oxidase activity in dementia of Alzheimer type. Life Sci. 27:1029–1034. 31. Jossan, S.S., Gilberg, P.G., Gotteries, C.G., Karlsson, I. and Oreland L. (1991) Monoamine oxidase B in brains from patients with Alzheimer’s disease: a biochemical and autoradiographical study. Neuroscience 45:1–12. 32. Ekblom, J., Jossan, S.S., Gilberg, P.G., Oreland, L. and Aquilonius, S.M. (1992) Monoamine oxidase-B in motor cortex: changes in amyotrophic lateral sclerosis. Neuroscience 49:763–769. 33. Grimsby, J., Toth, M., Chen, K., Kumazawa, T., Klaidman, L., Adams, J.D., Karoum, F., Gal, J. and Shih, J.C. (1997) Increased stress response and β-phenylethylamine in MAOB-deficient mice. Nature Genet. 17:206–210. 34. Pardon, M.-C., Launay, J.-M., Christen, Y. and Cohen-Salmon, C. (2000) In vivo regulation of cerebral monoamine oxidase activities of senescent mice by a longterm treatment with EGb 761, the standardized Ginkgo biloba extract. Mechan. Aging Dev. (in press). 35. Sastre, J., Pla, R., Juan, G., Millan, A., Pallardo, F.V., Garcia de la Asuncion, J.,
422
36.
37.
38. 39.
40.
41.
42.
43.
44.
45. 46. 47.
48.
Christen et al. Martin, J.A., O’Connor, E., Droy-Lefaix, M.-T. and Vina, J. (1996) Prevention by Ginkgo biloba extract (EGb 761) of age-associated impairment of brain mitochondria. In: Proceedings of the International Symposium on Natural Antioxidants: Molecular Mechanisms and Health Effect (Packer, L., Traber, M.G. and Xin, W. eds.), AOCS Press, Champaign, IL, pp. 434–443. Sastre, J., Millan, A., Garcia de la Asuncion, J., Pla, R., Juan, G., Pallardo, F.V., O’Connor, E., Martin, J.A, Droy-Lefaix, M.T. and Vina, J. (1998) A Ginkgo biloba extract (EGb 761) prevents mitochondrial aging by protecting against oxidative stress. Free Rad. Biol. Med. 24:298–304. Lamour, Y., Holloway, H.W., Rapoport, S.I. and Soncrant, T.T. (1991) Effects of ginkgolide-B and Ginkgo biloba extract on local cerebral glucose utilization in the awake adult rat. Drug Dev. Res. 23:219–225. De Feudis, F.V. (1998) Ginkgo biloba Extract (EGb 761): From Chemistry to the Clinic. Ullstein Medical, Wiesbaden. Rapoport, S.I., Haˆtanpa¨a¨, K., Brady, D.R., and Chandrasekaran, K. (1996) Brain energy metabolism, cognitive function and down-regulated oxidative phosphorylation in Alzheimer’s disease. Neurodegeneration 5:473–476. Chandrasekaran, K., Liu, I.L., Haˆtanpa¨a¨, K., Drieu, K. and Rapoport, S.I. (1998) Stimulation of mitochondrial gene expression by bilobalide, a component of Ginkgo biloba extract, EGb 761. In: Ginkgo biloba Extract (EGb 761) Study: Lessons from Cell Biology (Packer, L. and Christen, Y. eds.), Elsevier, Paris, pp. 121–128. Didier, A., Rouiller, D., Coronas, V., Jourdan, F. and Droy-Lefaix, M.-T. (1996) Effects of Ginkgo biloba Extract (EGb 761) on apoptosis and regeneration of primary olfactory neurons following target ‘‘lesioning’’ in rats. In: Effects of Ginkgo biloba Extract (EGb 761) on Neuronal Plasticity (Christen, Y., Droy-Lefaix, M.-T. and Macias-Nunez, J.F., eds.), Elsevier, Paris, pp. 45–52. Mattson, M.P. (1991) Evidence for the involvement of protein kinase C in neurodegenerative changes in cultured human cortical neurons. Exp. Neurol. 112:95– 103. Rogue, P. and Malviya, A.N. (1996) Inhibition of protein kinase C by Ginkgo biloba extract (EGb 761). In: Effect of Ginkgo biloba Extract (EGb 761) on Neuronal Plasticity (Christen, Y., Droy-Lefaix, M.-T. and Macias-Nunez, J.F. eds.), Elsevier, Paris, pp. 1–6. Kristofikova, Z, Benesova, O and Tejkalova, H. (1992) Changes of high-affinity choline uptake in the hippocampus of old rats after long-term administration of two nootropic drugs (tacrine and Ginkgo biloba extract). Dementia 3:304–307. Huguet, F. and Tarrade, T. (1992) α2-Adrenoreceptor changes during cerebral ageing; the effect of Ginkgo biloba extract. J. Pharm. Pharmacol. 44:24–27. Barkats, M. (1994) Approche ge´ne´tique du vieillissement hippocampique chez la souris. The`se de l’Universite´ de Paris 6. Cohen-Salmon, C., Pardon, M.C., Venault, P and Christen, Y. (1995) Long-term EGb 761 treatment improving spatial mnesic performance in a Morris water maze and preventing ‘‘behavioral despair’’ reactions in senescent inbred mice. Soc. Neurosci. Abstr. 21 (part 1):165. Christen, Y., Droy-Lefaix, M.-T. and Macias-Nunez, J.F., eds. (1996) Effects of Ginkgo biloba Extract (EGb 761) on Neuronal Plasticity. Elsevier, Paris.
Ginkgo biloba and Alzheimer’s Disease
423
49. Brailowski, S., Montiel, T. (1997) Motor function in young and aged hemiplegic rats: effects of a Ginkgo biloba extract. Neurobiol. Aging 18:219–227. 50. Kelche, C., Roeser, C., Schumm, S. and Will, B. (1996) Ginkgo biloba extract (EGb 761) can promote some behavioral recovery after septohippocampal damage in the rat, but its effects depend upon the degree of hippocampal deafferentation. In: Effects of Ginkgo biloba (EGb 761) on Neuronal Plasticity (Christen, Y., Droy-Lefaix, M.-T. and Macias-Nunez, J.F., eds.), Elsevier, Paris, pp. 85–100. 51. Shifman, M.I., Fulop, Z.L., Hashemzadeh-Gargari, H. and Stein, D.G. (1996) Effects of Ginkgo biloba extract (EGb 761) on behavioral recovery and expression of NGF, GAP-43 and β-actin mRNA after inducing unilateral entorhinal cortex lesions. In: Effects of Ginkgo biloba Extract (EGb 761) on Neuronal Plasticity (Christen, Y., Droy-Lefaix, M.-T. and Macias-Nunez, J.F., eds.), Elsevier, Paris, pp. 61–74. 52. Attella, M.J., Hoffman, S.W., Stasio, M.J. and Stein, D.J. (1989) Ginkgo biloba extract facilitates recovery from penetrating brain injury in adult male rats. Exp. Neurol. 105:62–71. 53. Cohen Salmon, C., Venault, P., Martin, B., Raffalli-Se´bille, M.J., Barkats, M., Clostre, F., Pardon, M.C., Christen, Y. and Chapouthier, G. (1997) Effects of Ginkgo biloba extract EGb 761 on learning and memory. J. Physiol. (Paris) 91:291– 300. 54. Winter, E. (1991) Effects of an extract of Ginkgo biloba on learning and memory in mice. Pharmacol. Biochem. Behav. 38:109–114. 55. Winter, J.C. (1998) The effects of an extract of ginkgo biloba EGb 761, on cognitive behavior and longevity in the rat. Physiol. Behav. 63:425–433. 56. Continella, G., Drago, F. (1985) Behavioral effects of ginkgo-biloba extract. In: Effects of Ginkgo biloba Extract on Organic Cerebral Improvement (Agnoli, A., Rapin, J.R., Scapagnini, V. and Weitbrecht, W.V., eds.), John Libbey, Paris, pp. 35– 42. 57. Ravel, N., Chabaud, P. Mannino, S., Vigouroux, M., Gervais, R. and Droy-Lefaix, M.-T. (1996) Ginkgo biloba extract and short-term olfactory memory. In: Effects of Ginkgo biloba Extract (EGb 761) on Neuronal Plasticity (Christen, Y., DroyLefaix, M.-T. and Macias-Nunez, J.F., eds.), Elsevier, Paris, pp. 35–44. 58. Raffali-Se´bille, M.J., Chapouthier, G., Clostre, F. and Christen, Y. (1992) Learning improvment in adult and aged mice induced by a ginkgo biloba extract. In: Effects of Ginkgo biloba Extract EGb 761 on the Central Nervous System (Christen, Y., Costentin, J. and Lacour, M., eds.), Elsevier, Paris, pp. 129–134. 59. Stoll, S., Scheuer, K., Pohl, O. and Muller, W.E. (1996) Ginkgo biloba extract (EGb 761) attenuates age-related memory deficits in female NMRI mice. Pharmacopsychiatry 29:144–149. 60. Lupien, S.J., de Leon, M., de Santi, S., Convit, A., Tarshish, C., Nair, N.P.V., Thakur, M., McEwen, B.S., Hauger, R.L. and Meaney, M.J. (1998) Cortisol levels during human aging predict hippocampal atrophy and memory deficits. Nature Neurosci. 1:69–73. 61. Cohen-Salmon, C.A., Hamon, M., Pardon, M.C. and Christen, Y. (1997) Chronic mild unpredictable stress and ‘‘decision-making’’ in B6D2F1 mice: the regulating effect of Ginkgo biloba extract EGb 761. Soc. Neurosci. 23:1841. 62. Porsolt, R.D., Martin, P., Lene`gre, A., Fromage, S. and Drieu, K. (1990) Effects of
424
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
Christen et al. an extract of Ginkgo biloba (EGb 761) on ‘‘learned helplessness’’ and other models of stress in rodents. Pharmacol. Biochem. Behav. 36:963–971. Rapin, J.R., Lamproglou, I., Drieu, K., and DeFeudis, F.V. (1994) Demonstration of the ‘‘anti-stress’’ activity of an extract of Ginkgo biloba (EGb 761) using a discrimination learning task. Gen. Pharmacol. 25:1009–1016. Oliver, C., Guillaume, V., He´ry, F., Bourhim, N., Boiteau, K. and Drieu, K. (1994) Effect of ginkgo biloba extract on the hypothalamo-pituitary-adrenal axis and plasma catecholamine levels in stress. Eur. J. Endocrinol. 130 (Suppl. 2):207. Rapin, J.R., Provost, P., and Drieu, K. (1997) Ginkgo biloba extract (EGb 761) antistress effects on hippocampal glucocorticoid receptors: comparison with diazepam. In: Adaptative Effects of Ginkgo biloba Extract (EGb 761) (Papadopoulos, V., Drieu, K. and Christen, Y., eds.), Elsevier, Paris, pp. 129–138. Amri, H.S.O., Gwuegbu, O., Boujrad, N., Drieu, K. and Papadopoulos, V. (1996) In vivo regulation of peripheral-type benzodiazepine receptor and glucocorticoid synthesis by Ginkgo biloba extract EGb 761 and isolated ginkgolides. Endocrinology 137:5707–5718. Behl, C., Lezoualc’h, F., Trapp, T., Widmann, M., Skutella, T. and Holsboer, F. (1997) Glucocorticoids enhance oxidative stress–induced cell death in hippocampal neurons in vitro. Endocrinology 136:101–106. Allain, H., Raoul, P., Lieury, A., LeCoz, F., Gandon, J.M. and d’Arbigny, P. (1993) Effect of two doses of Ginkgo biloba extract (EGb 761) on the dual-coding test in elderly subjects. Clin. Ther. 15:549–558. Israel, L., Dell’Accio, E., Martin, G. and Hugonot, R. (1987) Extrait de Ginkgo biloba et exercices d’entraıˆnement de la me´moire. Evaluation comparative chez des personnes aˆge´es ambulatoires. Psychol. Me´d. 19:1431–1439. Hofferberth, B. (1994) The efficacy of EGb 761 in patients with senile dementia of the Alzheimer type, a double-blind, placebo-controlled study on different levels of investigation. Hum. Psychopharmacol. 9:215–222. Kanowski, S., Herrmann, W.M., Stephan, K., Wierich, W. and Ho¨rr, R. (1996) Proof of efficacy of the Ginkgo biloba special extract EGb 761 in outpatients suffering from mild to moderate primary degenerative dementia of the Alzheimer type or multi-infarct dementia. Pharmacopsychiatry 29:47–56. Maurer, K., Ihl, R., Dierks, T. and Frolich, L. (1997) Clinical efficacy of Ginkgo biloba special extract EGb 761 in dementia of the Alzheimer type. J. Psychiat. Res. 31:645–655. Le Bars, P.L., Katz, M.M., Berman, N, Itil, T, Freeman, A.M. and Schalzberg, A.F. (1997) A placebo-controlled, double-blind, randomized trial of a extract of Ginkgo biloba for dementia. JAMA 278:1327–1332. Sano, M., Ernesto, C., Thomas, R.G., Klauser, M.R., Schaffer, K., Grundman, M., Woodbury, P., Growdon, J., Cotman, C.W., Pfeiffer, E., Schneider, L.S. and Thal, L.J. (1997) A controlled trial of selegiline, α-tocopherol, or both as treatment for Alzheimer’s disease. N. Engl. J. Med. 336:1216–1222. Mattson, M.P., Furukawa, K., Bruce, A.J., Mark, R.J. and Blanc, E.M. (1997) Amyloid cytotoxicity and Alzheimer’s disease: roles of membrane oxidation and perturbed ion homeostasis. In: Pharmacological Treatment of Alzheimer’s Disease: Mo-
Ginkgo biloba and Alzheimer’s Disease
76. 77.
78.
79.
425
lecular and Neurobiological Foundations (Brioni, J.D. and Decker, M.W., eds.), Wiley, New York, pp. 239–285. Lezoualc’h, F. and Behl, C. (1998) Transcription factor NF-κB: friend or foe of neurons? Mol. Psychiatry 3:15–20. Lezoualc’h, F., Sagara, Y., Holsboer, F. and Behl, C. (1998) High constitutive NFκB activity mediates resistance to oxidative stress in neuronal cells. J. Neurosci. 18: 3224–3232. Mizuno, M., Droy-Lefaix, M.-T., and Packer, L. (1996) Ginkgo biloba Extract EGb 761 is a suppressor of AP-1 transcription factor stimulated by phorbol 12-myristate 13-acetate. Biochem. Mol. Biol. Int. 39: 395–401. Roy, S., Kobuchi, H., Sen, S.H., Gohil, K., Droy-Lefaix, M.-T. and Packer, L. (1998) Ginkgo biloba extract (EGb 761): antioxidant properties and regulation of gene expression. In: Ginkgo biloba Extract (EGb 761): Lessons from Cell Biology (Packer, L. and Christen, Y., eds.), Elsevier, Paris.
21 Glutathione and Metallothionein in Oxidative Stress of Parkinson’s Disease Manuchair Ebadi University of North Dakota, School of Medicine and Health Sciences, Grand Forks, North Dakota
Midori Hiramatsu Institute for Life Support Technology, Yamagata Technopolis Foundation, Yamagata, Japan
I. INTRODUCTION Parkinson’s disease is the second most common neurodegenerative disorder after Alzheimer’s disease, affecting approximately 1% of the population older than 50 years. There is a worldwide increase in disease prevalence due to the increasing age of human populations. A definitive neuropathological diagnosis of Parkinson’s disease requires loss of dopaminergic neurons in the substantia nigra and related brainstem nuclei, and the presence of Lewy bodies in remaining nerve cells. The contribution of genetic factors to the pathogenesis of Parkinson’s disease is being increasingly recognized. A point mutation that is sufficient to cause a rare autosomal dominant form of the disorder has recently been identified in the α-synuclein gene on chromosome 4 in the much more common sporadic, or ‘‘idiopathic,’’ form of Parkinson’s disease, and a defect of complex I of the mitochondrial respiratory chain was confirmed at the biochemical level. Disease specificity of this defect has been demonstrated for the parkinsonian substantia
427
428
Ebadi and Hiramatsu
nigra. These findings and the observation that the neurotoxin MPTP (1-methyl4-phenyl-1,2,3,6-tetrahydropyridine), which causes a Parkinson-like syndrome in humans, acts via inhibition of complex I have triggered research interest in the mitochondrial genetics of Parkinson’s disease. Reactive oxygen species (ROS) denote superoxide, hydrogen peroxide, hydroxyl radical, and singlet oxygen, which are able to trigger both necrotic and apoptotic cell death. ROS are able to activate signaling pathways and transcription factors such as AP-1 and NF-κB. Antioxidants may modify gene expression in several ways. One possible mechanism for these observations is that antioxidants regulate the activation and/or binding of specific transcription factors to their cognate sites on DNA. Depletion of glutathione coupled with hydrogen peroxide treatment of cells increases the expression of metallothionein as well as metallothionein promotor expression vector–containing Sp1 sites. Nitric oxide is synthesized by the conversion of l-arginine to l-citrulline by nitric oxide synthase (NOS). The neuronal NOS (nNOS) is localized in many regions of the brain including striatum. In primary cerebral cortical cultures, the toxicity of excess glutamate is prevented by various NOS inhibitors. In addition, selective nNOS inhibitors protect dopaminergic neurons against MPTP in an animal model of Parkinson’s disease and also provide protection against various mitochondrial neurotoxins. The superoxide anion rapidly reacts with NO yielding peroxynitrite. Downregulation of superoxide dismutase causes apoptotic death of neurons. Metallothionein scavenges superoxide anions and helps prevent the formation and hence the neurotoxicity of peroxynitrite. Oxidative phosphorylation consists of five protein–lipid enzyme complexes located in the mitochondrial inner membrane that contain flavins (FMN, FAD), quinoid compounds (coenzyme Q 10), and transition metal compounds (ironsulfur clusters, hemes, protein-bound copper). These enzymes are designated complex I (NADH: ubiquinone oxidoreductase, EC 1.6.5.3), complex II (succinate: ubiquinone oxidoreductase, EC 1.3.5.1), complex III (ubiquinol: ferrocytochrome c oxidoreductase, EC 1.10.2.2), complex IV (ferrocytochrome c: oxygen oxidoreductase or cytochrome c oxidase, EC 1.9.3.1), and complex V (ATP synthase, EC 3.6.1.34). A defect in mitochondrial oxidative phosphorylation, in terms of a reduction in the activity of NADH CoQ reductase (complex I), has been reported in the striatum of patients with Parkinson’s disease. The reduction in the activity of complex I is found in the substantia nigra, but not in other areas of the brain, such as globus pallidus or cerebral cortex. Therefore, the specificity of mitochondrial impairment may play a role in the degeneration of nigrostriatal dopaminergic neurons. This view is supported by the fact that MPTP generating 1-methyl-4-phenylpyridine (MPP⫹) destroys dopaminergic neurons in the substantia nigra. Glutathione deficiency, which causes the accumulation of H2O2, leads to
Oxidative Stress in Parkinson’s Disease
429
mitochondrial damage in the brain. Moreover, coenzyme Q 10 attenuates the MPTP-induced loss of atriatal dopaminergic neurons. The selective vulnerability and loss of certain neurons is a remarkable characteristic of age-related degenerative disorders of the brain as seen in Parkinson’s disease. Glutamate is the major excitatory neurotransmitter in the brain and excitotoxicity plays a role in Parkinson’s disease. Furthermore, growing evidence implicates oxidative stress as a mediator of excitotoxic cell death. Following activation of N-methyl-d-aspartate (NMDA) receptors, the generation of free radicals increases, oxidation damage to lipids occurs, and antioxidants protect cell death. Dizocilpine blocking NMDA receptor may provide neuroprotection in Parkinson’s disease. Deficiency of striatal glutathione (GSH) in Parkinson’s disease fosters oxidative stress and causes apoptosis. This is prevented by paracrine surviving factors. γ-Glutamylcysteinylglycine assists in maintaining the intracellular reducing environment, protects protein thiol groups from oxidation, and participates as a coenzyme or cofactor in a wide variety of chemical reactions. Glutathione exerts its antioxidant activity synergistically with both vitamin C and vitamin E. Striatal glutathione deficiency in Parkinson’s disease enhances the susceptibility of substantia nigra to destruction by endogenous or exogenous neurotoxins. Moreover, treatment with lazaroid, which inhibits lipid peroxidation, prevents death of mesencephalic dopaminergic neurons following glutathione depletion. Metallothioneins, consisting of four isoforms, are low molecular weight proteins that contain 25–30% cysteine. Metallothionein isoforms have been proposed to participate in the transport, accumulation, and compartmentation of zinc in various brain regions. Metallothionein keeps the cellular concentration of free zinc very low, acting as a reservoir, releasing zinc in a process that is dynamically controlled by its interaction with both reduced (GSH) and oxidized (GSSG) glutathione. 6-Hydroxydopamine (6-OH), which generates free radicals and causes parkinsonism in experimental animals, enhances the level of metallothionein I mRNA in some brain areas such as hippocampus, arcuate nucleus, choroid plexus, and granular layer of cerebellum, but not in the caudate putamen. The results of these studies are interpreted to suggest that zinc or metallothionein are altered in conditions where oxidative stress has taken place. Moreover, it is proposed that areas of the brain, such as striatum containing high concentrations of iron but low levels of inducible metallothionein, are particularly vulnerable to oxidative stress. Since both superoxide and hydroxyl radicals are generated in excess in the substantia nigra of patients with Parkinson’s disease and since metallothionein isoforms I and II are able to scavenge superoxide anions and hydroxyl radicals, an augmentation of the levels of glutathione and metallothioneins may have potentially therapeutic benefits in attenuating oxidative stress in this and other neurodegenerative disorders.
430
Ebadi and Hiramatsu
II. ANTIOXIDANTS AND REACTIVE OXYGEN SPECIES IN GENE EXPRESSION AND SIGNAL TRANSDUCTION Oxygen not only burns quickly (‘‘explode’’) radiating light and heat, but also oxidizes slowly in the living organisms. The high oxidizing potential of oxygen is a valuable source of energy for the organism. Oxygen is reduced to water and the redox potential of O2 /H2O is ⫹0.81 V, which means the reduction of oxygen to water is an exergonic process, producing 113.5 kcal per mole of oxygen. Life is sustained by capturing this energy as adenosine triphosphate (ATP). Other merits that make oxygen ideal for a terminal oxidant include the kinetic barrier to reaction by oxygen and the innocuous nature of the oxidized products, i.e., water and carbon dioxide. To use dioxygen to produce energy is not without problems. The kinetic barrier poses a problem when the organism uses oxygen to get energy, and various forms of catalysis that reduce this barrier have evolved to get energy in living systems. Transition metals, such as iron, copper, or manganese, are found at the active sites of most oxidases and oxygenases because their ability to accept and donate a single electron can overcome the spin restriction of dioxygen. Another problem with oxygen is that it has a low solubility in water, only 3.1% (v/v) at 20°C. The last but not the least problem is that oxygen, in one form or another, is toxic. Organisms that utilize oxygen must have mechanisms to minimize the production of toxic intermediates in the first place, to efficiently scavenge those toxic substances once they are formed, and to repair any damage that is caused. Related terms such as oxy radicals, oxygen free radicals, and (re)active oxygen species are often used in biological publications and their definitions vary among authors. Moreover, those terms, and that of free radicals, a closely associated but not identical term, are often used synonymously or interchangeably (1). A.
Nature of Reactive Oxygen Species and Free Radicals
Reactive oxygen species include superoxide, hydrogen peroxide, hydroxyl radicals, and singlet oxygen. In a broader sense, peroxides, hydroperoxide, epoxide metabolites of endogenous lipids, and xenobiotics, which have chemically reactive oxygen-containing functional groups, can be included among ROS. Free radicals (FRs) are defined as any atom or molecule that has one or more unpaired electrons. The oxygen molecule is itself a radical, two of the unpaired electrons located separately in a π antibonding orbital. Among ROS, superoxide and hydroxyl radicals are FRs, but singlet oxygen and hydrogen peroxide are not. Therefore, ROS and FRs are not identical. Reactive oxygen species accumulate in brain and brain cell cultures under many pathological conditions (Fig. 1). This general finding suggests that pathological consequences result from a disparity between the production of free radicals and the sustainable rate at which cells can eliminate
Oxidative Stress in Parkinson’s Disease
431
Figure 1 The high oxidizing potential of dioxygen is a valuable source of energy. The reactivity of an oxygen molecule is low and hence is spin-forbidden. Triplet oxygen has 16 electrons in a molecular orbital and two of them are located in different π antibonding orbitals as unpaired electrons (↑). Therefore, dioxygen is a radical (a biradical entity because it has two unpaired electrons). Reactive oxygen species (ROS) denote superoxide, hydrogen peroxide, hydroxyl radicals, and singlet oxygen. In a broader sense, peroxides, hydroperoxide, epoxide metabolites of endogenous lipids, and xenobiotics, which have chemically reactive oxygen-containing functional groups, can be included among ROS. Free radicals (FRs) are defined as any atom or molecule that has one or more unpaired electron. Among ROS, superoxide and hydroxyl radicals are FR, but singlet oxygen and hydrogen peroxide are not. (Concepts from Ref. 1.)
432
Ebadi and Hiramatsu
them, i.e., from oxidative stress. Both necrotic and apoptotic cell death can be triggered by oxidative stress (2). B.
Oxidative Stress Can Cause Cell Death by Necrosis or Apoptosis
Some of the acute effects of oxidative stress on brain cells are as follows: • Facilitated uptake of dihydroascorbic acid (DHAA) and intracellular reduction to ascorbate in astrocytes • Inhibition of active transport of ions and reuptake of neurotransmitters • Cell swelling • Release of ascorbate by facilitated diffusion from swollen astrocytes • Depletion of intracellular antioxidants • Increased glucose utilization in astrocytes • Oxidation and sulfoconjugation of proteins • Elevation of free calcium concentration in cytosol • Sensitization of mitochondria to calcium-induced uncoupling • Decreased mitochondrial membrane potential • Decreased ATP concentration • Lipid oxidation and degradation • DNA fragmentation Some of the initiators of oxidative stress in brain cells are as follows: • • • • • • • • • • •
C.
Acidosis Transition metals β-Amyloid Catecholamine oxidation products Kainic acid–induced seizures Activation of NMDA-type glutamate receptors Nitric oxide Activated neutrophils Hypoglycemia Prolonged hypoxia Uncoupled mitochondrial electron transport in resident brain cells (see Ref. 2)
Reactive Oxygen Species and Antioxidants in Signal Transduction and Gene Expression
Reactive oxygen species such as superoxide O2•⫺, hydroxyl radical (OH⋅), and hydrogen peroxide (H2O2) are constantly produced by metabolic reactions in the
Oxidative Stress in Parkinson’s Disease
433
human body. What remains unclear, despite epidemiological and intervention studies, is the molecular mechanisms by which ROS are directly involved in disease processes. Similarly, how antioxidants might function in the prevention of disease is also unclear. Signal transduction may be generally described as the process through which cellular components (i.e., contractile elements or the transcriptional machinery) receive information from outside the cell and transmit that information intracellularly to elicit a response. Typical carriers of information include hormones, cytokines, neurotransmitters, and other molecules that interact with receptor molecules on or within the cell. Intracellular transmission of that information can use very simple relays or highly complex processes. In the most simple signaling pathways, such as that used by corticosteroids, a hormone binding to its specific intracellular receptor results in translocation of the hormone–receptor complex into the nucleus. Following nuclear translocation, the hormone–receptor complex affects target gene expression by directly binding to specific DNA sequences within regulatory regions of the target gene. Numerous other signaling systems are present in cells and rely on complex kinase cascades, protease cascades, and/or second messengers such as cAMP and Ca2⫹. These signaling pathways regulate cytoplasmic and nuclear proteins, which activate transcription factors such as AP-1 and NF-κB, and the endpoints of activated gene transcription, including cell growth and apoptosis (see Ref. 3 and Fig. 2). D.
Intracellular Reactive Oxygen Species Are Generated as Second Messengers
Reactive oxygen species are able to activate signaling pathways and transcription factors. Environmental exposure to radiation initiates cellular signaling by activating growth factor such as epidermal growth factor (EGF) and tumor necrosis factor–α (TNF-α), which are required for receptor kinase activation. In fact, hydrogen peroxide (H2O2 ), which is increased in the striatum of patients with Parkinson’s disease, activates EGF receptors. Furthermore, TNF-α has been shown to increase intracellular H2O2 by mitochondria. TNF-α induces ROS production through the activation of flavonoid-containing enzymes such as NADPH oxidase. Membrane receptor–generated signaling is often coupled to cytosolic signal transduction via the small protein ras, and activated ras can stimulate directly the small G protein rac, which binds and activates the membrane-bound NADPH oxidase complex to produce ROS. ROS influences mitogenic-activated protein kinase (MAP kinase) cascades and the transcription factors that are controlled by these kinase cascades, such as AP-1 and NF-κB (see Fig. 2). Antioxidants may modify gene expression in several ways. One possible mechanism for these observations is that antioxidants directly regulate the activation and/or binding of specific transcription factors to their cognate sites of DNA.
434
Ebadi and Hiramatsu
Figure 2 Reactive oxygen species (ROS) in cellular signaling and gene expression. Cytokines (i.e., TNF-α) and growth factors (i.e., EGF) bind to and activate membrane receptors. Activation of these receptors causes an increase in intracellular ROS through mitochondrial and/or nonmitochondrial mechanisms. The ROS signal is then propagated through several signaling pathways, such as the MAP kinase pathways, resulting in phosphorylation of transcription factors, such as AP-1 and NF-κB. Activated transcription factors alter gene expression, resulting in apoptosis. (Concepts from Ref. 3.)
Oxidative Stress in Parkinson’s Disease
435
Antioxidants have potent effects on the ability of several transcription factors to bind to DNA (4–6). Examples of these factors include AP-1, NF-κB, Sp1, and elk-1 of the ternary complex factor and the glucocorticoid receptor. In vitro, redox can regulate critical cysteines in AP-1 components, which can activate or inhibit transcription of genes regulated by AP-1. Also of potential importance are critical cysteines in both AP-1 and NFκB, which are reduced by thioredoxin and ref-1 for DNA binding to occur (7– 9). The binding of Spl, a zinc finger transcription factor, is also sensitive to redox regulation as its binding is decreased by oxidized glutathione (10). Depletion of glutathione, coupled with hydrogen peroxide treatment of cells, increases the expression of metallothionein as well as metallothionein promotor expression vector containing SP1 sites (11). Glutathione is reduced in the striatum of patients with Parkinson’s disease leading to augmented generation of hydroxyl radicals (•OH) and metallothionein isoforms are able to scavenge hydroxy radicals (see Fig. 6 and Ref. 114).
III.
DOWNREGULATION OF Cu/Zn SUPEROXIDE DISMUTASE LEADS TO CELL DEATH VIA THE NITRIC OXIDE–PEROXYNITRITE PATHWAY
Free radicals represent a class of biologically generated species that pose a potential threat to neuronal survival. NO is a unique messenger molecule that serves diverse physiological functions throughout the body. It can be formed in a wide range of cells by the conversion of l-arginine to l-citrulline by NOS. Three isoforms of NOS have been identified and are the products of three distinct genes: neuronal NOS (nNOS, type I), immunological NOS (iNOS, type II), and endothelial NOS (eNOS, type III). In the nervous system, nNOS is localized in discrete populations of neurons in the cerebellum, cortex, striatum, olfactory bulb, hippocampus, basal forebrain, and brainstem. Excess production of NO via nNOS has been implicated in various neurotoxic paradigms. Excess glutamate acting via NMDA receptors may mediate cell death in focal cerebral ischemia, trauma, and epilepsy, and in neurodegenerative diseases such as Huntington’s disease, Alzheimer’s disease, and Parkinson’s disease. In primary cerebral cortical cultures, NMDA neurotoxicity is prevented by various NOS inhibitors. Evaluation of nNOS inhibitors in various stroke models has shown that selective inhibitors provide dramatic reductions in infarct volume in focal cerebral ischemia (see Fig. 3). In addition, selective nNOS inhibitors provide protection against the dopaminergic neurotoxin 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine (MPTP) in an animal model of Parkinson’s disease and also provide protection against various mitochondrial neurotoxins.
436
Ebadi and Hiramatsu
Figure 3 Growing evidence points to the involvement of free radicals in mediating nigral death in Parkinson’s disease. Circumstantial evidence suggests that activation of glutamate receptors and excitotoxicity play a role in Parkinson’s disease and other neurodegenerative disorders. Calcium-activated protease and phospholipase A2 generate superoxide anions (O2•⫺ ) and peroxynitrite (OONO⫺) capable of damaging proteins, lipids, and DNA and producing either necrosis or apoptosis. Glutathione deficiency, as seen in the substantia nigra of Parkinson’s patients, causes conversion of H2O2 to excess hydroxyl radicals (⋅OH). Selegeline (which enhances the level of superoxide dismutase), metallothionein isoforms (which scavenge ⋅OH radicals and O2•⫺ anions), or dizocilpine (an NMDA receptor channel blocker) are postulated to avert oxidative stress in Parkinson’s disease.
Oxidative Stress in Parkinson’s Disease
A.
437
Peroxynitrite: A Putative Cytotoxin
The superoxide anion rapidly reacts with NO, yielding peroxynitrite, and this reaction occurs in vivo according to the following reaction: NO• ⫹ O2•⫺ → ONOO⫺ The rate constant of this reaction is near the diffusion-controlled limit (4–7 ⫻ 109 M⫺1 s⫺1). The half-life of peroxynitrite at 37°C and pH 7.4 is approximately 1 s. Peroxynitrite is in equilibrium with peroxynitrous acid. ONOO⫺ ⫹ H⫹ i ONOOH The peroxynitrite anion itself is relatively stable, but peroxynitrous acid rapidly rearranges to form nitrate. Therefore, peroxynitrite is practically stable in alkaline solutions. Although it has long been thought that peroxynitrous acid decomposes to form nitrate and hydroxy radicals, it is now believed that peroxynitrous acid (via an activated state: HOONO•) reacts with biological substrates in a hydroxyl radical–like way. Consequently, free radicals are probably not formed during the self-decomposition of peroxynitrous acid. Nonetheless, recent evidence suggests that the reaction of peroxynitrite with carbon dioxide is the most important route for peroxynitrite in biological environments, where carbon dioxide is relatively abundant. In short, peroxynitrite reacts with carbon dioxide to form the nitrosoperoxycarbonate anion, which subsequently rearranges to form the nitrocarbonate anion. ONOO⫺ ⫹ CO2 → ONOOCO2⫺ → O2NOCO2⫺ The nitrocarbonate anion is postulated to be the proximal oxidant of peroxynitrite-mediated reactions in biological environments. Nitrocarbonate can undergo hydrolysis, can oxidize substrates via one- and two-electron transfers, and can nitrosylate substrates. Carbon dioxide concentration is therefore of crucial importance for peroxynitrite-mediated oxidations and nitrosylations. The exact biochemical fate of peroxynitrite in biological systems, however, is very complex and is as yet not completely clear. (See Ref. 12 for a review and additional references.) B.
Superoxide Dismutase Protects nNOS Neurons from Nitric Oxide–Mediated Neurotoxicity
Cu/Zn superoxide dismutase (SOD) is among the key cellular enzymes by which neurons and other cells detoxify free radicals and protect themselves from damage (13,14). Downregulation of SOD causes apoptotic death of neurons (15,16). The postulated molecular mechanisms by which superoxide anions produce its toxicity are according to the following scheme:
438
Ebadi and Hiramatsu
Fe 3⫹
H 2 O2 → Fe 2⫹ → OH• Pathway 1
↓ SOD → ↑ O2⫺
Apoptic cell death No• → ONOO⫺ Pathway 2
One involves superoxide purely as a reducing agent for transition metal ions such as Fe3⫹. In this scheme, the reduced metal ion catalyzes the conversion of hydrogen peroxide to the highly reactive and destructive hydroxyl radical (17). The other pathway invokes the interaction of superoxide with NO, leading to formation of peroxynitrite. Peroxynitrite then can be protonated and rapidly decomposed to a strong oxidant (18). Troy et al. (19) by using PC12 cells and antisense oligonucleotide reported that death induced by SOD downregulation appears to require the reaction of superoxide with NO to form peroxynitrite. In support of this observation, the authors have shown that inhibitors of NO synthase, the enzyme responsible for NO synthase, blocked death in their experiments, whereas NO generators and donors accelerated cell death. N-Acetylcysteine and chlorophenylthiol cAMP, which rescue PC12 cells and neurons from the withdrawal of nerve growth factor and other forms of trophic support, did not protect PC12 cells from SOD downregulation. In contrast, overexpression of bcl-2, which also rescues these cells from loss of trophic support, was equally effective in saving the cells in the SOD downregulation paradigm. Schwartz et al. (20) examined neuronal degeneration resulting from intrastriatal injection of quinolinic acid, an NMDA receptor agonist, and kainic acid in gene-targeted and transgenic mice that under- or overexpress SOD. Elevated SOD activity significantly protected against quinolinic acid and kainic acid neurotoxicity in the mouse striatum, whereas reduced activity appears to potentiate neurotoxicity (see also Fig. 3). Moreover, Gonzalez-Zulueta et al. (21) have shown that manganese superoxide dismutase protected nNOS neurons from NMDA and NO-mediated neurotoxicity. In addition, Sanchez-Ramos et al. (22) have shown that transgenic murine dopaminergic neurons expressing human SOD exhibited increased density in culture, but not enhanced resistance to neurotoxic substances. In conclusion, ONOO⫺ contributes significantly to mitochondrial oxidative stress in vivo, both from fluxes of damaging ONOO⫺ formed outside the mitochondria and from ONOO⫺ produced from the reaction of mitochondrial O2•⫺ with NO•. This ONOO⫺ damages mitochondria by a range of mechanisms and may be a significant contributor to the high levels of mitochondrial oxidative stress seen in vivo. In addition to these relatively nonspecific processes, ONOO⫺
Oxidative Stress in Parkinson’s Disease
439
induces the mitochondrial permeability transition, and this may contribute to both necrotic and apoptotic cell death in human pathologies (23). Therefore, development of specific peroxynitrite scavengers may provide a tool for the effective treatment of disease states in which peroxynitrite formation is thought to play an important role (24).
V.
DEFECT IN MITOCHONDRIAL OXIDATIVE PHOSPHORYLATION IN PARKINSON’S DISEASE
Oxidative phosphorylation consists of five protein–lipid enzyme complexes, located in the mitochondrial inner membrane that contain flavins (FMN, FAD), quinoid compounds (coenzyme Q 10), and transition metal compounds (ironsulfur clusters, hemes, protein-bound copper) and are designated as complex I (NADH: ubiquinone oxidoreductase, EC 1.6.5.3), complex II (succinate: ubiquinone oxidoreductase, EC 1.3.5.1), complex III (ubiquinol: ferrocytochrome c oxidoreductase, EC 1.10.2.2), complex IV (ferrocytochrome c: oxygen oxidoreductase or cytochrome C oxidase, EC 1.9.3.1), and complex V (ATP synthase, EC 3.6.1.34). Complexes I and II collect electrons from the catabolism of fats, proteins, and carbohydrates and transfer them to ubiquinone (coenzyme Q 10). The electrons then move sequentially through complex III, cytochrome c, and complex IV and finally react with oxygen, the terminal electron acceptor (see Fig. 4). Complexes I, III, and IV use the energy in electron transfer to pump protons across the inner mitochondrial membrane, thereby producing a proton gradient. Complex V uses the potential energy stored in the proton gradient to condense ADP and inorganic phosphate (Pi) into ATP. The resulting ATP is exchanged across the inner membrane with ADP by the adenine nucleotide translocase (ANT) (25–28). A.
Inhibitors of Complex I
There are a wide variety of complex I inhibitors acting at or close to the ubiquinone reduction site. These include MPP⫹, rotenoids, capsaicin, and pesticides such as fenpyroximate, pyridaben, tebufenpyrad, and fenazaquin (29,30). B.
Complex I in Parkinson’s Disease
A defect in mitochondrial oxidative phosphorylation in terms of a reduction in the activity of NADH CoQ reductase (complex I) has been reported in the striatum of patients with Parkinson’s disease (31–34). Similar defects have been found in the platelets (35) but not muscles (36) of patients with Parkinson’s disease. The reduction in the activity of complex I is found in the substantia nigra but not in
440
Ebadi and Hiramatsu
Figure 4 Mitochondria produce energy by recycling electrons from food down the respiratory chain through a series of protein complexes (I–V) in the mitochondrial inner membrane. Complexes I and II collect electrons from catabolism of fats, proteins, and carbohydrates and transfer them to ubiquinone (coenzyme Q 10). The electrons then move sequentially through cytochrome c, complex V and finally react with oxygen generating protons, which are pumped across the inner mitochondrial membrane producing a proton gradient. Complex V (ATP synthase) uses the potential energy stored in the proton gradients to condense ADP and inorganic phosphate into ATP. (Concepts from Refs. 27 and 28.)
other areas of the brain such as globus pallidus or cerebral cortex. Therefore, the specificity of mitochondrial impairment may play a role in the degeneration of nigrostriatal dopaminergic neurons. This view is supported by the fact that MPTP generating MPP⫹ destroys dopaminergic neurons in the substantia nigra (37). Mitochondrial respiratory complex I is also inhibited by 6-hydroxydopamine and the said effect is inhibited by desferrioxamine (38). Moreover, 6-hydroxydopamine causes apoptosis and the said effect is prevented by melatonin (39). C.
Sequence Analysis of Mitochondrial Complex I Genes
Ko¨sel et al. (40) performed complete sequence analysis of all mitochondrial complex I genes in 22 cases of neuropathologically confirmed idiopathic Parkinson’s
Oxidative Stress in Parkinson’s Disease
441
disease (PD). DNA from the substantia nigra was used as a template for polymerase chain reaction–based genomic sequencing. Seven novel mutations causing the exchange of amino acids were detected in subunit genes ND1 (3992 C/T, 4024 A/G), ND4 (11253 T/C, 12084 C/T), ND5 (13711 G/A, 13768 T/C), and ND6 (14582 T/C). In addition, five known missense mutations affecting the ND1 (3335 T/C, 3338 T/C), ND2 (5460 G/A), ND3 (10398 A/G), and ND5 (13966 A/G) genes as well as three secondary LHON mutations (4216 T/C, 4917 A/G, 13708 G/A) were found in the PD group. Among the novel mutations, the 11253 T/C transition, which changes a conserved isoleucine residue into threonine, is most likely to be of functional relevance. Furthermore, 43 synonymous polymorphisms were detected in PD brains, including 20 novel sequence variants. Haplogroup analysis revealed that most unique missense mutations were found in PD cases belonging to the Dc haplogroup. These data are in line with the view that PD is not a single disease entity but comprises a genetically heterogeneous group of disorders. The results of this study further suggest that 90% or more of all idiopathic PD cases are not due to sequence variation of mitochondrial complex I, but that mitochondrial mutations may play a pathogenic role in a subset of PD patients (40). The fact that production of ATP and striatal functions decline with age supports the contention that striatum is particularly vulnerable to oxidative stress (Fig. 4) (41,42). Indeed, apoptosis and necrosis are two distinct modes of cell death with respective morphological characteristics. However, apoptosis and some forms of necrosis must share common steps since both modes of cell death can be suppressed by the antiapoptotic Bcl-2 protein (see Fig. 3). Intracellular ATP levels have been implicated both in vitro and in vivo as a determinant of the cell’s decision to die by apoptosis or necrosis (43). D.
Glutathione Deficiency Leads to Mitochondrial Damage
Jain et al. (44) have shown that glutathione deficiency leads to mitochondrial damage in the brain. In this study, glutathione deficiency induced in newborn rats by giving buthionine sulfoximine, a selective inhibitor of γ-glutamylcysteine synthetase, led to markedly decreased cerebral cortex glutathione levels and striking enlargement and degeneration of the mitochondria. These effects were prevented by giving glutathione monoethyl ester, which relieved the glutathione deficiency, but such effects were not prevented by giving glutathione, indicating that glutathione is not appreciably taken up by the cerebral cortex. Some of the oxygen used by mitochondria is known to be converted to hydrogen peroxide. Jain et al. (44) suggested that in glutathione deficiency hydrogen peroxide accumulates and damages mitochondria. Glutathione, thus, has an essential function in mitochondria under normal physiological conditions. Observations on turnover and utilization of brain glutathione in newborn, preweaning, and adult rats have
442
Ebadi and Hiramatsu
shown that (1) some glutathione turns over rapidly (t1/2 ⬇ 30 min in adults, ⬇8 min in newborns), (2) several pools of glutathione probably exist, and (3) brain utilizes plasma glutathione, probably by γ-glutamyltranspeptidase-initiated pathways that account for some, but not all, of the turnover (see also Fig. 5). Decreases in mitochondrial respiratory chain complex activities have been implicated in neurodegenerative disorders such as Parkinson’s disease, Hunting-
Figure 5 Glutathione (GSH), through γ-glutamyl pathway, recycles glutamate, cysteine, and glycine. Glutathione is synthesized by the consecutive actions of the ATP-dependent enzymes γ-glutamylcysteine synthetase and glutathione synthetase. Levels of GSH are regulated in part by feedback inhibition of γ-glutamylcysteine synthetase by GSH. In the presence of a suitable amino acid [AA] acceptor, GSH is catabolized by the action of γglutamyltranspeptidase to yield a γ-glutamyl amino acid (γ-GLU-AA) and cysteinylglycine (CYSH-GLY). The γ-GLU-AA is converted to free amino acid and 5-oxoproline by the action of γ-glutamylcyclotransferase. 5-Oxoproline is converted back to glutamate by the ATP-dependent 5-oxoprolinase reaction. The glutamate released in this process can then be reused in the synthesis of GSH, thus completing the cycle with the glutamate component of GSH. The cysteinylglycine released in the γ-glutamyltranspeptidase reaction is hydrolyzed by the action of a dipeptidase to glycine and cysteine, completing the cycle with the glycine and cysteine components of GSH. (Concepts from Ref. 70.)
Oxidative Stress in Parkinson’s Disease
443
ton’s disease, and Alzheimer’s disease. However, the extent to which these decreases cause a disturbance in oxidative phosphorylation and energy homeostasis in the brain is not known. Davey et al. (45) examined the relative contribution of individual mitochondrial respiratory chain complexes to the control of NAD-linked substrate oxidative phosphorylation in synaptic mitochondria. Titration of complex I, III, and IV activities with specific inhibitors generated threshold curves that showed the extent to which a complex activity could be inhibited before causing impairment of mitochondrial energy metabolism. Complex I, III, and IV activities were de creased by approximately 25%, 80%, and 70%, respectively, before major changes in rates of oxygen consumption and ATP synthesis were observed. These results suggest that, in mitochondria of synaptic origin, complex I activity has a major control of oxidative phosphorylation, such that when a threshold of 25% inhibition is exceeded, energy metabolism is severely impaired, resulting in a reduced synthesis of ATP. In addition, depletion of glutathione, which has been reported to be a primary event in idiopathic Parkinson’s disease, eliminated the complex I threshold in PC12 cells, suggesting that antioxidant status is important in maintaining energy thresholds in mitochondria. Coenzyme Q10 attenuates the MPTPinduced loss of striatal dopamine and dopaminergic axons in aged mice (46).
V.
OXIDATIVE STRESS, GLUTAMATE TOXICITY, AND PARKINSON’S DISEASE
The selective vulnerability and loss of certain neurons is a remarkable characteristic of age-related degenerative disorders of the brain as seen in Parkinson’s disease, Huntington’s disease, and amyotrophic lateral sclerosis (see Refs. 47 and 48 for excellent reviews and references). Growing evidence points to the involvement of free radicals in mediating neuronal death in these diseases. A.
Excitotoxicity in Neurodegenerative Disorders
Glutamate is the major excitatory neurotransmitter in the brain. Three subtypes of glutamatergic ionotropic receptors exist that are named for their pharmacological agonists: N-methyl-d-aspartate (NMDA), and the non-NMDA agonists quisqualate/α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainic acid (KA). The recent cloning of the genes encoding the polypeptides that form the various glutamate receptors revealed a high level of molecular heterogeneity, pharmacological diversity, and biophysical variation. Notably, it is now known that posttranscriptional mRNA editing transforms non-NMDA receptors from permitting the passage of Ca2⫹ to sustaining only Na⫹ currents. Excitotoxi-
444
Ebadi and Hiramatsu
city refers to the excessive activation of glutamate receptors that results in neuronal death. Excitotoxicity is important in neuronal degeneration following acute insults such as hypoxia, ischemia, and trauma (49). Circumstantial evidence exists that excitotoxicity may play a role in neurodegenerative diseases such as Alzheimer’s disease, amyotrophic lateral sclerosis, and Parkinson’s disease (see Fig. 4). Although sodium influx through glutamate-gated ion channels may mediate acute forms of neuronal degeneration, calcium appears to be critical for delayed cell death induced by activation of NMDA and non-NMDA receptors (50). Growing evidence implicates oxidative stress as a mediator of excitotoxic cell death (49,51,52). Following activation of NMDA and KA receptors, the generation of free radicals increases (53,54), oxidative damage to lipids occurs, and antioxidants protect cell death (51,55–58). These findings suggest that glutamate receptor–linked processes may activate intracellular pathways that produce free radicals, uncouple mitochondrial electron transport, depress cellular defense systems, or a combination of these. In addition, free radicals themselves can increase the release and decrease the reuptake of glutamate, thus leading to increased glutamate in the synaptic cleft (59). This may lead to a self-perpetuating cycle in which the activation of glutamate receptors increases free radicals, which may lead to further receptor activation (47). B.
Sources of Free Radicals in Parkinson’s Disease
Current concepts as to the cause of Parkinson’s disease suggest an inherited predisposition to environmental or endogenously produced toxic agents causing oxidative damage to nigral cells for the following reasons: The level of reduced glutathione in substantia nigra is decreased. The depletion of reduced glutathione in the substantia nigra in Parkinson’s disease could be the result of neuronal loss. As a matter of fact, a positive correlation has been found to exist between the extent of neuronal loss and depletion of glutathione. A decrease in the availability of reduced glutathione would impair the capacity of neurons to detoxify hydrogen peroxide and increase the risk of free radical formation and lipid peroxidation. Indeed, the nigra contains increased levels of malondialdehyde and hydroperoxides. An increase in the activity of mitochondrial superoxide dismutase in the substantia nigra in Parkinson’s disease may indicate a compensatory mechanism to nullify the augmented oxidative stress. Another factor imposing increased oxidative stress is the accumulation of iron and progressive siderosis of substantia nigra. In addition, the level of ferritin, an iron-binding protein, is reduced in the substantia nigra and hence aggravating the iron-induced hydroxyl radical–mediated lipid peroxidation (see Ref. 60 for a review and additional references). Endogenously produced neurotoxins have long been suspected of being involved in the pathogenesis of Parkinson’s disease; however, little mechanistic
Oxidative Stress in Parkinson’s Disease
445
evidence existed to support this concept until the neurotoxic effects of MPTP were found to induce a Parkinson-like syndrome. The discovery that MPTP produces a CNS pathology very similar to that observed with Parkinson’s disease has strengthened the endogenous neurotoxin hypothesis and provided a heuristic model for investigating the pathological process of Parkinson’s disease in animals. The first stage in the mechanism of action of MPTP appears to be its deamination by MAO-B, possibly in glial cells which results in the formation of MPP⫹. The MPP⫹ is then selectively accumulated in dopamine nerve terminals by way of the high-affinity dopamine reuptake system. Neurons lacking dopamine transporter remain unaffected. Once inside the nerve terminals, MPP⫹ seems to act in a manner similar to that of 6-hydroxydopamine by generating hydrogen peroxide and free radicals that interfere with mitochondrial respiration. MPP⫹ is concentrated in mitochondria, where it impairs mitochondrial respiration by inhibiting complex I of the electron transfer complex and consequently causing death of neurons (see Fig. 4). The activity of complex I is reduced in the brains of Parkinson’s patients. It has been suggested that the neuromelanin present in dopaminergic neurons (by binding and storing the MPP⫹) acts as a storage site for MPP⫹ or other neurotoxins. Dopaminergic cell death by MPTP is caused by oxidative stress followed by lipid peroxidation caused by inhibition of mitochondrial enzymes participating in ATP synthesis. The production and accumulation of neurotoxin can be blocked by drugs such as selegiline that inhibit the activity of MAO-B (see Fig. 3). Moreover, monkeys treated with MPTP and at the same time selegiline do not develop Parkinson’s syndrome (see Ref. 60 for a review and additional references). Free radicals, namely superoxide, peroxide, and hydroxyl radicals, are produced within the midbrain dopaminergic neurons. Free radicals and quinones are produced in substantia nigra during catabolism of dopamine by MAO-B. Free radicals are produced during the synthesis of neuromelanin, which is found in most, but not all, dopaminergic neurons of the mesencephalon. The third source of free radicals in the substantia nigra is iron, which catalyzes the formation of hydroxyl radicals from H2O2, the breakdown of lipid peroxides, and accelerates the nonenzymatic oxidation of a variety of molecules. C.
Oxidative Stress–Induced Alteration in Transferrin Receptors
Malorni et al. (61) have shown that the free radical inducer menadione or hydrogen peroxide rapidly and specifically downmodulated the membrane transferrin receptors by blocking receptor recycling. This modulation is due to receptor redistribution and not to receptor loss. These results suggest the existence of a potentially important protective mechanism through which iron uptake is prevented in oxidatively imbalanced cells. Iron uptake can in fact give rise to the formation of highly toxic hydroxyl radicals reacting with hydrogen peroxide and
446
Ebadi and Hiramatsu
leading to cytotoxicity. Downmodulation of surface transferrin receptors may thus represent the physiological control mechanism for reducing iron uptake in diverse pathological conditions including hypoxia-reperfusion injury, acquired immunodeficiency syndrome, and aging. D.
Cellular Defense Mechanisms in Oxidative Stress of Parkinson’s Disease
Under normal conditions, the continuous production of free radicals is compensated for by powerful protective enzymes. Among these are cytosolic Zn2⫹ /Cu2⫺superoxide dismutase and mitochondrial Cu2⫹ /Mn2⫺-superoxide dismutase, which protect against oxygen toxicity by catalyzing the dismutation of superoxide anions to oxygen and hydrogen peroxide. The fact that the Cu2⫹ /Zn2⫹-superoxide dismutase gene is highly expressed in neuromelanin-pigmented neurons, the subset of cells vulnerable to the degenerative process within the substantia nigra in Parkinson’s disease, may be indicative that these highly reactive oxidative species are produced in significant concentrations in these cells. Glutathione peroxidase, one of the most potent enzymes that protects against oxygen toxicity by scavenging H2O2 generated by cellular metabolism, is detected exclusively in glial cells of the midbrain. The density of glutathione peroxidase containing glial cells identified by immunohistochemistry differs among the various dopaminergic cell groups of the normal mesencephalon: it is high in the central gray substance (preserved in Parkinson’s disease), low in substantia nigra pars compacta (the most affected in Parkinson’s disease), and intermediate in the ventral tegmental area. The strong relationship between the density of glutathione peroxidase– positive cells in control brains and the severity of the loss in dopaminergic neurons in Parkinson’s disease suggests that the neurons most vulnerable to Parkinson’s disease are surrounded by a low density of glutathione-positive cells and are therefore less protected against oxidative stress (see Ref. 60 for a review and additional references). Neuromelanin is the pigment contained in the cell bodies of substantia nigra and locus coeruleus. The concentration of this insoluble compound, which is derived from the nonenzymatic oxidation of catechols conjugated with a sulfated amino acid, increases with age. It has been recognized that dopaminergic neurons containing neuromelanin are more vulnerable to oxidative damage than nonmelanized dopaminergic neurons. A specific loss of melanized dopaminergic neurons, with an increased concentration of iron and copper, is noted in substantia nigra of Parkinson’s disease. The observation that lipid peroxidation is selectively increased in the substantia nigra of patients with Parkinson’s disease suggests an increased production of free radicals, resulting in chronic local oxidative stress which may cause
Oxidative Stress in Parkinson’s Disease
447
progressive degeneration of nigral dopaminergic neurons. The origin of this putative overproduction of free radicals is not known, but three potential candidates exist: neuromelanin, iron, and dopamine itself. There are two reasons for believing that neuromelanin contributes to dopaminergic nerve cell death in Parkinson’s disease. The percentage of neuromelanin-pigmented neurons normally present among dopaminergic cells correlates with the estimated degree of cell loss in the various cell subgroups in Parkinson’s disease, suggesting that melanized dopaminergic neurons are most susceptible to degeneration than those that do not contain the pigment. The vulnerability of these neurons depends not only on their location within the nigral complex but on their neuromelanin content as well. As a matter of fact, an inverse relationship has been observed between the percentage of melanized neurons that survive and the amount of neuromelanin per neuron quantified by densitometry. The gradual accumulation of neuromelanin over several decades may contribute in more than one way to the pathological process underlying cell death: either directly through the production of free radicals or indirectly by the binding and release of toxins as suggested by its ability to bind neurotoxin MPP⫹, the toxic metabolite of MPTP. Neuromelanin-induced toxicity cannot be the only cause of cell death; however, (1) the poorly melanized neurons in the ventrolateral part of the substantia nigra seem to be the most susceptible to degeneration, (2) neuromelanin-containing neurons of the medulla oblongata do not degenerate in the disease, unlike what is observed in multiple system atrophy. Unpigmented catecholaminergic and noncatecholaminergic neurons are lost as well. Therefore the pigment alone may be a contributing factor but is not sufficient to account for the death of the subpopulation of dopaminergic neurons affected by Parkinson’s disease (see Ref. 60 for a review and additional references). Numerous studies suggest that the activation of corticostriatal glutamatergic input can influence the functions of nigrostriatal dopamine terminals (62). Stimulation of excitatory amino acid receptors of the NMDA subtype has been shown to enhance dopamine release and synthesis within the striatum, suggesting that dopamine excitatory amino acid interactions are important for normal striatal function. Excitatory amino acid activity has also been suggested to contribute to nigrostriatal terminal injury, since NMDA receptor activity modulates methamphetamine-induced injury to striatal dopamine terminals. These studies highlight the importance of understanding further the relationship between striatal dopaminergic and excitatory amino acid–containing synapses. Weihmuller et al. (63) reported that l-[3H]glutamate binding to NMDA-sensitive receptors was 20– 40% higher in patients with Parkinson’s disease than in control subjects. Amantadine (64) and ethopropazine (65) are weak antagonists of NMDA receptors. It remains to be seen whether or not dizocilpine, a potent blocker of NMDA receptor, could benefit parkinsonian patients (see Fig. 3).
448
VI.
Ebadi and Hiramatsu
DEFICIENCY OF STRIATAL GLUTATHIONE IN PARKINSON’S DISEASE FOSTERS OXIDATIVE STRESS
Since the discovery of the cofactor γ-glutamylcysteineglycine by Hopkins (66), glutathione (GSH, reduced form) has been implicated in a number of diverse metabolic functions. In cells, GSH assists in maintaining the intracellular reducing environment, so protecting protein thiol groups from oxidation, and participates as a coenzyme or cofactor in a wide variety of chemical reactions. Recent complementary structural and biochemical studies of a number of proteins that use glutathione for a variety of purposes have provided new insight into details of glutathione’s biological roles. The early high-resolution structures of glutathione peroxidase and glutathione reductase have now been augmented by those of glutathione S-transferase, glutaredoxin, and glutathione synthetase. The structures reveal common features of binding and a diversity of mechanisms by which protein residues can influence glutathione chemistry (67). The discovery and the delineation of the structure of glutathione as l-γ-glutamyl-l-cysteineglycine have been described by Meister (68). Glutathione, whose concentration in the brain approaches 2–3 mM (69), has multiple functions in the CNS which include the following items (70), described in Secs. A–D. A.
Glutathione Is a Nontoxic Storage Form of Cysteine
Elevated cysteine/cystine is excitotic by interfering with NMDA receptors. Cysteine forming hemithioketals and hemithioacetals generates substances such as thiazolidinone which tend to inhibit glutamate decarboxylase. Furthermore, PukaSundvall et al. (71) have shown that a subtoxic dosage of cysteine administered before or after hypoxia-ischemia enhances brain injury. Furthermore, oxidation of dopamine in the presence of cysteine generates neurotoxic products such as dihydrobenzothiazines (72). B.
Glutathione Possesses Cofactor Functions
Glutathione serves as an essential cofactor for a number of enzymes including formaldehyde dehydrogenase, glyoxylase, maleylacetoacetate isomerase, dehydrochlorinase, and prostaglandin endoperoxidase isomerase. C.
Glutathione Recycles Glutamate, Cysteine, and Glycine Through ␥-Glutamyl Pathway
Glutathione (GSH) is synthesized by the consecutive actions of the ATP-dependent enzymes γ-glutamylcysteine synthetase and glutathione synthetase. Levels of GSH are regulated in part by feedback inhibition of γ-glutamylcysteine synthe-
Oxidative Stress in Parkinson’s Disease
449
tase by GSH. In the presence of a suitable amino acid [AA] acceptor, GSH is catabolized by the action of γ-glutamyltranspeptidase to yield a γ-glutamyl amino acid [γ-GLU-AA] and cysteinylglycine [CYSH-GLY]. The γ-GLU-AA is converted to free amino acid and 5-oxoproline by the action of γ-glutamylcyclotransferase. 5-Oxoproline is converted back to glutamate by the ATP-dependent 5oxoprolinase reaction. The glutamate released in this process can then be reused in the synthesis of GSH, thus completing the cycle with the glutamate component of GSH. The cysteinylglycine released in the γ-glutamyltranspeptidase reaction is hydrolyzed by the action of a dipeptidase to glycine and cysteine, completing the cycle with the glycine and cysteine components of GSH (see Fig. 5). γ-Glutamyl has a major role in metabolism of leukotrienes, estrogens, and prostaglandins, and detoxification of xenobiotics in the brain. The enzymes of the γ-glutamyl cycle are abundant in the choroid plexus (73), suggesting that the cycle plays a role in transporting essential substances into the brain, and recycling of glutathione in cerebrospinal fluid (74). γ-Glutamyltranspeptidase is present in capillaries, astrocytes, and neurons (75). In addition, glutathione transporters do exist, which plays a role in its homeostasis (76). D.
Glutathione Possesses a Neuroprotective Action
Glutathione exerts its antioxidant activity synergistically with both vitamin C and vitamin E (77,78). Vitamin E is essential for normal neurological function and is both a free radical scavenger and structural stabilizer (79). Dietary selenium, an essential component of glutathione peroxidase, prevents many symptoms of vitamin E deficiency. Patients with disorders of glutathione metabolism who display progressive neurological disease exhibit an increased reliance on ascorbate. An increased production of reactive oxygen species is thought to be critical to the pathogenesis of Parkinson’s disease. At autopsy, patients with either presymptomatic or symptomatic Parkinson’s disease have a decreased level of glutathione in the substantia nigra pars compacta. This change represents the earliest index of oxidative stress in Parkinson’s disease discovered to this point (see Ref. 60 for a review and additional references). Sian et al. (80) measured GSH and GSSG levels in various brain areas (substantia nigra, putamen, caudate nucleus, globus pallidus, and cerebral cortex) from patients dying with Parkinson’s disease, progressive supranuclear palsy, multiple system atrophy, and Huntington’s disease, and from control subjects with no neuropathological changes in substantia nigra. GSH levels were reduced in substantia nigra in Parkinson’s disease patients (40% compared to control subjects) and GSSG levels were marginally (29%) but insignificantly elevated; there were no changes in other brain areas. The only significant change in multiple system atrophy was an increase of GSH (196%) coupled with a reduction of
450
Ebadi and Hiramatsu
GSSG (60%) in the globus pallidus. The only change in progressive supranuclear palsy was a reduced level of GSH in the caudate nucleus (51%). The only change in Huntington’s disease was a reduction of GSSG in the caudate nucleus (50%). Despite profound nigral cell loss in the substantia nigra in Parkinson’s disease, multiple system atrophy, and progressive supranuclear palsy, the level of GSH in the substantia nigra was significantly reduced only in Parkinson’s disease. This suggests that the change in GSH in Parkinson’s disease is not solely due to nigral cell death or entirely explained by drug therapy, for multiple system atrophy patients were also treated with levodopa. The altered GSH/GSSG ratio in the substantia nigra in Parkinson’s disease in consistent with the concept of oxidative stress as a major component in the pathogenesis of nigral cell death in Parkinson’s disease. Pearce et al. (81) showed a significant loss of neuronal reduced glutathione in surviving nigral neurons in Parkinson’s disease. Han et al. (82) have shown that l-dopa upregulates glutathione and protects mesencephalic dopaminergie culture against oxidative stress in vitro. Furthermore, an ability to up regulate glutathione may serve as a protective role for dopaminergic neurons in vivo. Nakamura et al. (83) compared the sensitivity of dopaminergic and nondopaminergic neurons in dissociated mesencephalic cultures to the depletion of glutathione. They found that dopaminergic neurons were more resistant to the toxicity of glutathione depletion than nondopaminergic neurons. The possibility that dopaminergic neurons have a higher baseline glutathione level than nondopaminergic neurons is suggested by measurements of levels of cellular glutathione in a parallel system of immortalized embryonic dopaminergic and nondopaminergic cell lines. They also examined the role of glutathione in 1-methyl-4-phenylpyridinium toxicity. Decreasing the glutathione level of dopaminergic neurons potentiated their susceptibility to 1-methyl-4-phenylpyridinium toxicity, although 1-methyl-4-phenylpyridinium did not deplete glutathione from primary mesencephalic cultures. These data suggest that although a decreased glutathione content is not likely to be the sole cause of dopaminergic neuronal loss in Parkinson’s disease, decreased glutathione content may act in conjunction with other factors such as 1-methyl-4-phenylpyridinium to cause the selective death of dopaminergic neurons. Toffa et al. (84) infused L-buthionine-(S,R)-sulfoximine (BSO; 4.8 and 9.6 mg/kg/day), an irreversible inhibitor of γ-glutamylcysteine synthetase, chronically into the left lateral ventricle of rats over 28 days and markedly reduced GSH concentrations in substantia nigra (approximately 59% and 65% in 4.8 and 9.6 mg/kg/day BSO, respectively) and the striatum (approximately 63% and 80% in 4.8 and 9.6 mg/kg/day BSO, respectively). However, the number of tyrosine hydroxylase (TH)–positive cells in substantia nigra was not altered by BSO treatment compared to control animals. Similarly, there was no difference in specific 3 H-mazindol binding in the striatum and nucleus accumbens of BSO-treated rats compared to control rats. In conclusion, depletion of GSH following chronic administration of BSO in the rat brain does not cause damage to the nigrostriatal
Oxidative Stress in Parkinson’s Disease
451
pathway and suggests that loss of GSH alone is not responsible for nigrostriatal damage in PD. Rather, GSH depletion may enhance the susceptibility of substantia nigra to destruction by endogenous and exogenous toxins. Zeevalk et al. (85) have shown that glutathione is an important neuroprotectant for midbrain neurons during situations when energy metabolism is impaired. Andersen et al. (86) have shown that a reduction in glutathione level by buthionine sulfoximine resulted in the same type of nigrostriatal degeneration that occurs during the aging process. Grasbon-Frodl et al. (87) have shown that treatment with lazaroid, which inhibits lipid peroxidation, prevents death of cultured rat embryonic mesencephalic neurons following glutathione depletion. Zucker et al. (88) showed that the treatment of fibroblasts with BSO caused efficient depletion of intracellular reduced glutathione that was followed by substantial cell death. Based on the induction of membrane blobbing, chromatin condensation, and DNA strand breaks, cell death was characterized as apoptosis. Apoptosis after glutathione depletion seemed to be induced by endogenous reactive oxygen species (ROS), as it was antagonized by the antioxidant catechol and the hydroxyl radical scavenger dimethylsulfoxide (DMSO). Paracrine interaction between cells prevented ROS-induced apoptosis and therefore points to the existence of extracellular survival factors. These data show that the apoptosis-inducing potential of endogenous ROS is controlled by the intracellular glutathione concentration and by paracrine survival factors.
VII. METALLOTHIONEIN AND EXPERIMENTAL MODEL OF PARKINSONISM Metallothionein (MT) isoforms are low molecular weight (6000–7000) zincbinding proteins containing 60–61 amino acid residues, 25–30% cysteine, no aromatic amino acids or disulfide bonds, and binding 5–7 g zinc/mole of protein (89,90). The mammalian MT family consists of four similar but distinct isoforms, designated as MT I–IV. MT I and MT II isoforms were first identified in the rat brain in our laboratory by Itoh et al. (91). MT III containing 68 amino acids, also known as a growth inhibitory factor, was first identified by Uchida et al. (92) and MT IV is expressed in stratified squamous epithelia (93–95). MT isoforms are found in glial cells (96) as well as in neurons (97). By using fluoresceinated MT I isoform probe, and by employing cysteine, glutathione, and four MT isoforms to determine high-affinity and specific binding, El Refaey et al. (98) identified metallothionein receptors on human astrocytes (U373MG cell) membrane preparations. MT receptors revealed a Kd value of 0.84 nM and a Bmax of 99.82 fmol/mg protein. Moreover, MT receptors were found in greater density on the surface of aggregated astrocytes. It is postulated that conditions or agents generating ROS may influence the expression of MT receptors.
452
Ebadi and Hiramatsu
MT isoforms have been proposed to participate in the transport, accumulation, and compartmentation of zinc in various brain regions, including the areas that have extremely high concentration of zinc such as hippocampus (for reviews, see Refs. 99–102). Because among its 61 amino acids, MT possesses 18–20 cysteine residues, it is the most abundant and important thiol source in the brain. In those cells that can express MT genes, they are transcriptionally regulated by metals, glucocorticoid hormones, and cytokines (93–95,103). A.
Glutathione-Modulated Zinc Transfer from Metallothionein
Metallothionein, despite its high metal binding constant (Kzn ⫽ 3.2 ⫻ 1013 M⫺1 at pH 7.4), can transfer zinc to the apoforms of zinc enzymes that have inherently lower stability constants. In order to further clarify this paradox, Jacob et al. (104) studied zinc transfer between zinc enzymes and MT. Zinc can be transferred in both directions, i.e., from the enzymes to thioneine (the apo form of MT) and from MT to the apoenzymes. Agents that mediate or enhance zinc transfer have been identified that provide kinetic pathways in either direction. MT does not transfer all of its seven zinc atoms to an apoenzyme, but apparently contains at least one that is more prone to transfer than the others. Modification of thiol ligands in MT zinc clusters increases the total number of zinc ions released and, hence, the extent of transfer. Aside from disulfide reagents, the authors showed that selenium compounds are potential cellular enhancers of zinc transfer from MT to apoenzymes. Zinc transfer from zinc enzymes to thioneine, on the other hand, is mediated by zinc-chelating agents such as Tris buffer, citrate, or glutathione. Redox agents are asymmetrically involved in both directions of zinc transfer. For example, reduced glutathione mediates zinc transfer from enzymes to thioneine, whereas glutathione disulfide oxidizes MT with enhanced release of zinc and transfer of zinc to apoenzymes. Therefore, the cellular redox state as well as the concentration of other biological chelating agents might well determine the direction of zinc transfer and ultimately affect zinc distribution. Jiang et al. (105) have studied the release and transfer of zinc from MT to zinc-depleted sorbitol dehydrogenase (EC 1.1.1.14) in vitro. A 1:1 molar ratio of MT to sorbitol dehydrogenase is required for full reactivation, indicating that only one of the seven zinc atoms of MT is transferred in this process. Reduced glutathione (GSH) and glutathione disulfide (GSSG) are critical modulators of both the rate of zinc transfer and the ultimate number of zinc atoms transferred. GSSG increases the rate of zinc transfer threefold, and its concentration is the major determinant for efficient zinc transfer. GSH has a dual function. In the absence of GSSG, it inhibits zinc transfer from MT, indicating that MT is in a latent state under the relatively high cellular concentrations of GSH. In addition, it primes MT for the reaction with GSSG by enhancing the rate of zinc transfer 10-fold and by increasing the number of zinc atoms transferred to four. 65Zn labeling experiments confirm the release of one zinc from MT in the absence of
Oxidative Stress in Parkinson’s Disease
453
glutathione and the more effective release of zinc in the presence of GSH and GSSG. In vivo, MT may keep the cellular concentrations of free zinc very low and, acting as a temporary cellular reservoir, release zinc in a process that is dynamically controlled by its interactions with both GSH and GSSG. These results suggest that a change of the redox state of the cell could serve as a driving force and signal for zinc distribution from MT. Maret and Vallee (106) have shown that thiolate ligands in MT confer redox activity of zinc clusters. The interactive network featuring multiple zinc/sulfur bonds as found in the clusters of MT constitutes a coordination unit critical for the concurrent oxidation of cysteine ligands and the ensuing release of zinc. The low position of MT (less than ⫺366 mV) on a scale of redox reagents allows its effective oxidation by relatively mild cellular oxidants, in particular disulfides. When MT is exposed to an excess of dithiodipyridine, all of its 20 cysteines are oxidized within 1 h with the concomitant release of all seven zinc atoms; similarly, the thiol/disulfide oxidoreductase DsbA reacts stoichiometrically with MT to release zinc. Zinc and sulfur ligands in the clusters are in a spatial arrangement that seemingly favors disulfide bond formation. B.
Induction of Metallothionein by 6-Hydroxydopamine
Support for the hypothesis that metallothionein isoforms participate in intracellular defense against reactive oxygen and nitrogen species is derived from observations that substances causing oxidative stress, such as ethanol and iron, and agents involved in inflammatory processes, such as interleukin-1 and TNF-α, induce the synthesis of metallothionein. Moreover, animals deficient in metallothionein isoforms exhibit greater susceptibility to oxidative stress; metallothionein genes are transcriptionally activated in cells and tissues during oxidative stress; and overexpression of metallothionein reduces the sensitivity of cells and tissues to free radical–induced injury. Ebadi et al. (107) have shown that the ICV administration of ZnSO4 increases the synthesis of metallothionein I mRNA and metallothionein II mRNA. In addition, the ICV administration of ZnSO4 enhances the concentration of zinc and in direct proportion, the synthesis of metallothionein mRNA. Agents known to generate free radicals and to cause oxidative stress such a 6-hydroxydopamine, iron, hydrogen peroxide, and various alcohols lead to induction of metallothionein in the hippocampal neurons in primary culture and in Chang liver cells in culture. In view of the fact that the zinc and 6-hydroxydopamine induced the level of brain metallothionein and its mRNA, and that zinc and metallothionein concentrations vary in different regions of the brain, it is postulated that metallothionein may play a major role in nullifying the iron-mediated generation of free radicals and in protecting against oxidative stress in the brain. In patients with Parkinson’s disease, the ensuing dopamine deficiency state
454
Ebadi and Hiramatsu
is thought to accelerate the rate of synthesis of dopamine in remaining neurons, producing excess H2O2 , which becomes converted to hydroxyl radical (OH•), which may then act as a neurotoxin causing oxidative stress in the remaining striatal neurons (108). Several antioxidant defense systems prevent damage to the tissues by oxygen radicals. These systems include a range of specific antioxidants such as catalase for hydrogen peroxide, superoxide dismutase for superoxide, glutathione peroxidase for hydrogen peroxide, and MT for hydroxyl radicals (109). Indeed, transgenic mice deficient in MT genes exhibit enhanced sensitivity to oxidative stress, suggesting that basal MT levels can regulate intracellular redox status in mammalian systems (110). By using electron spin resonance (ESR) spectrometry and brain mitochondria, we (111) have shown previously that the neurotoxic substance 6-hydroxydopamine (6-OHDA) produces hydroxyl radicals and superoxide anions, which are prevented from being formed by a combination of superoxide dismutase, seligiline, and α-tocopherol. Similarly, Kumar et al. (112) showed that the administration of 6-OHDA decreased the levels of glutathione peroxidase and superoxide dismutase and increased the level of malondialdehyde. These results are interpreted to suggest that the generation of free radicals by 6-OHDA causes its neurotoxic effects. Since metallothionein is able to regulate the intracellular redox potential, we (113) have undertaken a group of experiments to learn whether or not 6hydroxydopamine, which generates free radicals and is toxic to dopaminergic neurons, could alter the levels of zinc and metallothionein in the brain. The lesioning of rat striatum with 6-hydroxydopamine (8.0 µg in 4 µL 0.02% ascorbic acid) resulted in a reduction in the levels of zinc and metallothionein in the striatum but not other brain regions tested. However, the intracerebroventricular administration of 6-hydroxydopamine, in a dosage regimen that does not lesion catecholaminergic pathways but causes oxidative stress, enhanced dramatically the level of metallothionein I mRNA in some brain areas such as hippocampus, arcuate nucleus, choroid plexus, and granular layer of cerebellum, but not in the caudate putamen. The results of these studies are interpreted to suggest that zinc or metallothionein are altered in conditions where oxidative stress has taken place. Moreover, it is proposed that areas of the brain, such as striatum containing high concentrations of iron but low levels of inducible metallothionein, are particularly vulnerable to oxidative stress. C.
Metallothionein Isoforms Scavenge Superoxide Anions and Hydroxyl Radicals
Ramana Kumari et al. (114) by ESR spectroscopy examined the free radicals scavenging effects of metallothionein isoforms I and II (MT I and II) on four types of free radicals. Solutions of 0.15 mM of MT I and 0.3 mM of MT II were
Oxidative Stress in Parkinson’s Disease
455
found to scavenge the 1,1-diphenyl-2-picrylhydrazyl radicals (1.30 ⫻ 1015 spins/ mL) completely. In addition, both isoforms exhibited total scavenging action against the hydroxyl radicals (1.75 ⫻ 1015 spins/mL) generated in a Fenton reaction (Fig. 6). Similarly, 0.3 mM of MT I scavenged almost 90% of the superoxide (2.22 ⫻ 1015 spins/mL) generated by the hypoxanthine and xanthine oxidase system, while a 0.3 mM MT II solution could only scavenge 40% of it. By using 2,2,6,6-tetramethyl-4-piperidone as a ‘‘spin trap’’ for the reactive oxygen species (containing singlet oxygen, superoxide, and hydroxyl radicals) generated by photosensitized oxidation of riboflavin and measuring the relative signal intensities of the resulting stable nitroxide adduct, 2,2,6,6-tetramethyl-4-piperidine-1-oxyl,
Figure 6 Metallothioneins are low-molecular-weight zinc-binding proteins consisting of 25-30% cysteine, with no aromatic amino acids or disulfide bonds (top panel). The areas of the brain containing high contents of zinc such as the retina, the pineal gland, and the hippocampus synthesize unique isoforms of MT on a continuous basis. The four MT isoforms are thought to provide the neurons and glial elements with mechanisms to distribute, donate, and sequester zinc at presynaptic terminals; or buffer the excess zinc at synaptic junctions. In this cause, glutathione disulfide may participate in releasing zinc from MT (top panel). Electron spin resonance (ESR) spectra showing that the metallothionein isoforms I and II (0.3 mM) are able to scavenge hydroxyl radicals (1.75 ⫻ 1015 spins/ml) generated in a Fenton reaction, as seen in the striatum of patients with Parkinson’s disease (bottom panel). (Concepts from Ref. 114.)
456
Ebadi and Hiramatsu
we observed that MT II (0.3 mM) could scavenge 92%, while MT I at 0.15 mM concentrations could completely scavenge all of the reactive species (2.15 ⫻ 1015 spins/mL) generated (114). The results of these studies suggest that although both isoforms of MT are able to scavenge free radicals, the MT I appears to be a superior scavenger of superoxide and 1,1-diphenyl-2-picrylhydrazyl radicals. Since both superoxide and hydroxyl radicals are generated in excess in the substantia nigra of patients with Parkinson’s disease, an augmentation of the levels of glutathione and metallothionein may have therapeutic benefits in attenuating oxidative state in this and other neurodegenerative disorders.
VIII. CONCLUSIONS The contribution of genetic factors to the pathogenesis of Parkinson’s disease (PD) is increasingly being recognized. A point mutation which is sufficient to cause a rare autosomal dominant form of the disorder has been recently identified in the α-synuclein gene on chromosome 4. In the much more common sporadic or ‘‘idiopathic’’ form of PD, a defect of complex I of the mitochondrial respiratory chain was confirmed at the biochemical level. Disease specificity of this defect has been demonstrated for the parkinsonian substantia nigra. These findings and the observation that the neurotoxic MPTP (1-methyl-4-phenyl-1,2,3,6tetrahydropyridine), which causes a PD-like syndrome in humans acts via inhibition of complex I, have triggered research interest in the mitochondrial genetics of PD. Complex I of the mitochondrial respiratory chain consists of more than 40 subunits which are encoded by both the nuclear and mitochondrial genome, with the latter providing seven genes. Whereas the nuclear subunits of complex I are as yet poorly characterized in humans, the genomic sequences of all mitochondrial subunit genes have been known for many years. Several lines of evidence indicate that the complex I defect observed in PD is genetic and may arise from mitochondrial DNA (mtDNA). Furthermore, there is a rapidly growing body of literature suggesting important roles of mitochondrial genetic defects in neurodegeneration. Mitochondrial functions are central to the control of some forms of cell death, as these organelles are involved in the regulation of essential steps of the apoptotic effector phase (see Fig. 2). In addition, mitochondria can serve both as a target and as a source of an increased production of oxygen radicals, which may directly and indirectly damage cells. Disturbances of oxidative metabolism are widely assumed to play a key role in the dopaminergic nerve cell death of the substantia nigra underlying PD.
Oxidative Stress in Parkinson’s Disease
457
Striatal dopamine neurons may be particularly vulnerable to oxidative stress because of an intrinsic stress already placed on them associated with dopamine metabolism via monoamine oxidase, which produces H2O2 and oxidation of dopamine by other enzymatic or nonenzymatic mechanisms. The glutathione system, which is responsible for removing H2O2 and maintaining protein thiols in their appropriate redox state in the cytosol and mitochondrion, is an important protective mechanism for minimizing oxidative damage. Both alterations in the glutathione system and deficits in mitochondrial metabolism have been observed in patients with PD. The cause/effect relationship among energy impairment, glutathione reduction, and loss of dopamine neurons in PD is not clear. Regardless of whether these events are initiating factors in the disease, there is ample evidence to show that derangements in oxidative phosphorylation and glutathione are present during the progression of the disease and may have an impact on the dopamine neurons at a time when they are declining in number. It is therefore of interest to investigate the interactions between deficits in energy metabolism and the glutathione system in the major neurotransmitter population lost in the disease, i.e., the dopamine neurons in the substantia nigra. The cause of the progressive nigral cell degeneration in PD remains unknown. However, postmortem studies of the substantia nigra strongly suggest the involvement of oxidative stress. Oxidative stress may arise from the metabolism of dopamine with the production of potentially harmful free radical species such as superoxide anions and hydroxyl radicals (see Figs. 1 and 3). This may be important as surviving neurons increase dopamine turnover to compensate for diminishing synaptic transmission. Endogenous or environment toxins such as MPTP induce oxidative stress through impairment of mitochondrial function and/or free radical formation. Neuronal degeneration in PD may result from an increased exposure to free radicals coupled with a deficit of antioxidant mechanisms. Most antioxidant systems in the substantia nigra in PD are either unchanged (glutathione peroxidase, catalase, ascorbic acid, α-tocopherol) or increased (superoxide dismutase) in activity. However, there is marked depletion of reduced glutathione (GSH) and total glutathione in the substantia nigra without any corresponding increase in the oxidant (GSSG) form (see also Fig. 5). The reduction of GSH is selective for the nigra in PD and does not occur in other neurodegenerative disorders exhibiting similar degrees of nigral cell loss, such as multiple system atrophy and progressive supranuclear palsy. The nigral GSH deficit in PD points to oxidative stress as being particularly relevant to neuronal death. GSH loss in PD is also accompanied by a reduction in mitochondrial complex I (NADH CoQ reductase) activity, which is similarly regionally selective for the nigra in PD and does not occur in related basal ganglia degenerative disorders (see also Fig. 4). Metallothionein (MT) is a zinc-binding protein of low molecular weight, containing cysteine as one-third of its total amino acids. This protein has been
458
Ebadi and Hiramatsu
shown to be an efficient scavenger of oxygen radicals, such as superoxide and hydroxyl radicals (see also Ref. 114, and Figs. 3 and 6). The synthesis of MT can be induced by some oxidative stress–inducing agents such as 6-hydroxydopamine or MPTP known to destroy nigral dopaminergic neurons and to cause PD experimental animals and human beings. The glutathione redox couple modulates zinc transfer from metallothionein to zinc-depleted enzymes. Therefore, zinc distributions is dependent not on MT alone but on a biochemical system in which MT and glutathione interact. Such a glutathione/MT system allows MT to serve as both a cellular reservoir for zinc and a controlled release system that can supply different amounts of zinc according to demand. Biological specificity of this system seems to be embedded not in the recognition between MT and apoproteins but in signals effecting a change of the cellular redox state and in signals that control the availability of apoproteins.
ACKNOWLEDGMENTS The authors gratefully acknowledge the excellent secretarial assistance of Margaret Mainelli. The studies cited in this paper have been funded by a grant from the U.S. Public Health Service (National Institutes of Health) No. 34566-04.
REFERENCES 1. Okada, S. (1996) Iron-induced tissue damage and cancer: the role of reactive oxygen species—free radicals. Pathol. Int. 46:311–332. 2. Wilson, J.X. (1997) Antioxidant defense of the brain: a role for astrocytes. Can. J. Physiol. Pharmacol. 75:1149–1163. 3. Palmer, H.J. and Paulson, K.E. (1997) Reactive oxygen species and antioxidants in signal transduction and gene expression. Nutr. Rev. 55:353–361. 4. Sun, Y. and Oberly, L.W. (1996) Redox regulation of transcriptional activators. Free Rad. Biol. Med. 21:335–348. 5. Winyard, P.G. and Blake, D.R. (1997) Antioxidants, redox-regulated transcription factors, and inflammation. Adv. Pharmacol. 38:403–421. 6. Powis, G., Gasdaska, J.R. and Baker, A. (1997) Redox signaling and the control of cell growth and death. Adv. Pharmacol. 38:329–359. 7. Walker, L.J., Robson, C.N. and Black, E. (1993) Identification of residues in the human DNA repair enzyme HAP1 (ref-1) that are essential for redox regulation of jun DNA binding. Mol. Cell Biol. 13:5370–5376. 8. Hayashi, T., Ueno, Y. and Okamoto, T. (1993) Oxidoreductive regulation of nuclear factor κB: involvement of a cellular reducing catalyst thioredoxin. J. Biol. Chem. 268:11380–11388.
Oxidative Stress in Parkinson’s Disease
459
9. Xanthoudakis, S. and Curran, T. (1996) Redox regulation of AP-1: a link between transcription factor signaling and DNA repair. Adv. Exp. Biol. Med. 387:69–75. 10. Knoepfel, L., Steinkuhler, C., Carri, M-T. and Rotilio, G. (1994) Role of zinccoordination and of the glutathione redox couple in the redox susceptibility of human transcription factor Spl. Biochem. Biophys. Res. Commun. 201:871–877. 11. Wu, X., Bishopric, N.H. and Discher, D.J. (1996) Physical and functional sensitivity of zinc finger transcription factors to redox change. Mol. Cell Biol. 16:1035–1046. 12. Muijsers, R.B.R., Folkerts, G., Henricks, P.A.J., Sadeghi-Hashjin, G., and Nijkamp, F.P. (1997) Peroxynitrite: a two-faced metabolite of nitric oxide. Life Sci. 60:1833– 1845. 13. McCord, J.M. and Fridovich, I. (1969) Superoxide dismutase: an enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244:6049–6055. 14. Fridovich, I. (1986) Superoxide dismutases. Adv. Enzymol. 58:61–97. 15. Rothstein, J.D., Bristol, L.A., Hosler, B., Brown Jr., R.H. and Kuncl, R.W. (1994) Chronic inhibition of superoxide dismutase produces apoptotic death of spinal neurons. Proc. Natl. Acad. Sci. USA 91:4155–4159. 16. Troy, C.M. and Shelanski, M.L. (1994) Downregulation of copper/zinc superoxide dismutase (SOD1) causes neuronal cell death. Proc. Natl. Acad. Sci. USA 91:6384– 6387. 17. Halliwell, B. and Gutteridge, J.C.M. (1990) Role of free radicals and catalytic metal ions in human disease: An overview. Meth. Enzymol. 186:1–88. 18. Beckman, J.S., Beckman, T.W., Chen, J., Marshall, P.A. and Freeman, B.A. (1990) Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. USA. 87:1620– 1624. 19. Troy, C.M., Derossi, D., Prochiantz, A., Greene, L.A. and Shelanski, M.L. (1996) Downregulation of Cu/Zn superoxide dismutase leads to cell death via the nitric oxide–peroxynitrite pathway. J. Neurosci. 16:253–261. 20. Schwartz, P.J., Reaume, A., Scott, R. and Coyle, J.T. (1998) Effects of over- and underexpression of Cu/Zn-superoxide dismutase on the toxicity of glutamate analogs in transgenic mouse striatum. Brain Res. 789:32–39. 21. Gonzalez-Zulueta, M., Ensz, L.M., Mukhina, G., Lebovitz, R.M., Zwacka, R.M., Engelhardt, J.F., Oberley, L.W., Dawson, V.L. and Dawson, T.M. (1998) Manganese superoxide dismutase protects nNOS neurons from NMDA and nitric oxide– mediated neurotoxicity. J Neurosci. 18:2040–2055. 22. Sanchez-Ramos, J.R., Song, S., Facca, A., Basit, A. and Epstein, C.J. (1997) Transgenic murine dopaminergic neurons expressing human Cu/Zn superoxide dismutase exhibit increased density in culture, but no resistance to methylphenylpyridinium-induced degeneration. J. Neurochem. 68:58–67. 23. Packer, M.A., Scarlett, J.L., Martin, S.W. and Murphy, M.P. (1997) Induction of the mitochondrial permeability transition by peroxynitrite. Biochem. Soc. Trans. 25:909–914. 24. Demiryu¨rek, A.T., Cakici, I˙. and Kanzik, I˙. (1998) Peroxynitrite: a putative cytotoxin. Pharmacol. Toxicol. 82:113–117. 25. Shoffner, J.M. and Wallace, D.C. (1990) Oxidative phosphorylation diseases. Disorder of two genomes. Adv. Hum. Genet. 19:267–330.
460
Ebadi and Hiramatsu
26. Babior, B.M. and Crowley, C.A. (1983) Chronic granulomatous disease and other disorders of oxidative killing by phagocytes. In: The Metabolic Basis of Inherited Disease, 5th ed. (Stanbury, J.B., Wyngaarden, J.B., Fredrickson, D.S., Goldstein, J.L. and Brown, M.S., eds.) McGraw-Hill, New York, pp. 1986–1994. 27. Shoffner, J.M. and Wallace, D.C. (1994) Oxidative phosphorylation diseases and mitochondrial DNA mutations: diagnosis and treatment. Annu. Rev. Nutr. 14:535– 568. 28. Wallace, D.C. (1997) Mitochondrial DNA in aging and disease. Sci. Am. 277:40– 47. 29. Klingenberg, M. (1980) The ADP-ATP translocation in mitochondria, a membrane potential controlled transport. J. Membr. Biol. 56:97–105. 30. Miyoshi, H. (1998) Structure–activity relationships of some complex I inhibitors. Biochem. Biophys. Acta 1364:236–244. 31. Schapira, A.H.V., Cooper, J.M. and Dexter, D. (1989) Mitochondrial complex I deficiency in Parkinson’s disease. Lancet 1:1269. 32. Schapira, A.H.V., Mann, V.M., Hartley, A., Cooper, J.M., Daniel, S.E. and Marsden, C.D. (1993) Complex I deficiency in Parkinson’s disease. Mov. Disord. 8: 403–404. 33. Parker Jr., W.D., Boyson, S.J. and Park, J.K. (1989) Abnormalities of the electron transport chain in idiopathic Parkinson’s disease. Ann. Neurol. 26:719–723. 34. Bindoff, L.A., Birch-Machin, M., Cartlidge, N.E.F., Parker Jr., W.D. and Turnbull, D.M. (1989) Mitochondrial function in Parkinson’s disease. Lancet 2:49. 35. Krige, D., Carroll, M.T., Cooper, J.M., Marsden, C.D. and Schapira, A.H.V. (1992) Platelet mitochondrial function in Parkinson’s disease. Ann. Neurol. 32:782– 788. 36. DiMonte, D.A., Sandy, M.S., Jewell, S.A., Adornato, B., Tanner, C.M. and Langston, J.W. (1993) Oxidative phosphorylation by intact muscle mitochondria in Parkinson’s disease. Neurodegeneration 2:275–281. 37. Burns, R.S., Chiueh, C.C., Markey, S.P., Ebert, M.H., Jacobowitz, D.M. and Kopin, I.J. (1983) A primate model of parkinsonism; selective destruction of dopaminergic neurons in the pars compacta of the substantia nigra by N-methyl-4-phenyl-1,2,3,6tetrahydropyridine. Proc. Natl. Acad. Sci. USA 80:4546–4550. 38. Glinka, Y., Tipton, K.F. and Youdim, M.B.H. (1998) Mechanism of inhibition of mitochondrial respiratory complex I by 6-hydroxydopamine and its prevention by desferrioxamine. Eur. J. Pharmacol. 351:121–129. 39. Mayo, J.C., Sainz, R.M., Uria, H., Antolin, I., Esteban, M.M. and Rodriquez, C. (1998) Melatonin prevents apoptosis induced by 6-hydroxydopamine in neuronal cells: implications for Parkinson’s disease. J. Pineal Res. 24:179–192. 40. Ko¨sel, S., Grasbon-Frodl, E.M., Mautsch, U., Egensperger, R., von Eitzen, U., Frishman, D., Hofmann, S., Klaus-Dieter, G., Mehraein, P. and Graeber, M.B. (1998) Novel mutations of mitochondrial complex I in pathologically proven Parkinson disease. Neurodegeneration 1:197–204. 41. Bowling, A.C., Mutisya, E.M., Walker, L.C., Price, D.L., Cork, L.C. and Beal, M.F. (1993) Age-dependent impairment of mitochondrial function in primate brain. J. Neurochem. 60:1964–1967. 42. DiMonte, DA, Sandy, M.S., DeLanney, L.E., Jewell, S.A., Chan, P., Irwin, I. and
Oxidative Stress in Parkinson’s Disease
43. 44.
45.
46.
47. 48. 49. 50. 51.
52. 53. 54. 55.
56. 57. 58.
59.
60.
461
Langston, J.W. (1993) Age-dependent changes in mitochondrial energy production in striatum and cerebellum of the monkey brain. Neurodegeneration 2:93–99. Tsujimoto, Y. (1997) Apoptosis and necrosis: Intracellular ATP level as a determinant for cell death modes. Cell Death Diff. 4:429–434. Jain, A., Ma˚rtensson, J., Stole E., Auld, P.A.M. and Meister, A. (1991) Glutathione deficiency leads to mitochondrial damage in the brain. Proc. Natl. Acad. Sci. USA 88:1913–1917. Davey, G.P., Peuchen, S. and Clark, J.B. (1998) Energy thresholds in brain mitochondria potential involvement in neurodegeneration. J. Biol. Chem. 273:12753– 12757. Beal, M.F., Matthews, R.T., Tieleman, A. and Shults, C.W. (1998) Coenzyme Q10 attentuates the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) induced loss of striatal dopamine and dopaminergic axons in aged mice. Brain Res. 783:109– 114. Simonian, N.A. and Coyle, J.T. (1996) Oxidative stress in neurodegenerative diseases. Annu. Rev. Pharmacol. Toxicol. 36:83–106. Coyle, J.T. and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262:689–694. Choi, D.W. (1988) Glutamate neurotoxicity and disease of the nervous system. Neuron 1:623–634. Choi, D.W. (1995) Calcium: still center-stage in hypoxic-ischemic neuronal death. Trends Neurosci. 18:58–60. Dykens, J.A., Stern, A. and Trenkner, E. (1987) Mechanisms of kainate toxicity to cerebellar neurons in vitro is analogous to reperfusion tissue injury. J. Neurochem. 49:1222–1228. Beal, M.F. (1992) Mechanisms of excitotoxicity in neurologic diseases. FASEB J. 6:3338–3344. Sun, A.Y., Chen, Y., Bu, Q. and Oldfield, F. (1992) The biochemical mechanisms of the excitotoxicity of kainic acid. Mol. Chem. Neuropathol. 17:51–63. Lafon-Cazal, M., Pletri, S., Culcasi, M. and Bockaert, J. (1993) NMDA-dependent superoxide production and neurotoxicity. Nature 364:535–537. Miyamoto, M., Murphy, T.H., Schnaar, R.L. and Coyle, J.T. (1989) Antioxidants protect against glutamate-induced cytotoxicity in a neuronal cell line. J. Pharmacol. Exp. Ther. 250:1132–1140. Monyer, H., Hartley, D.M. and Choi, D.W. (1990) 21-Aminosteroids attenuate excitotoxic neuronal injury in cortical cell cultures. Neuron 5:121–126. Miyamoto, M. and Coyle, J. (1990) Idebenone attenuates neuronal degeneration induced by intrastriatal injection of excitotoxins. Exp. Neurol. 108:38–45. Puttfarcken, P.S., Getz, R.L. and Coyle, J.T. (1993) Kainic acid–induced lipid peroxidation: protection with butylated hydroxytoluene and U78517F in primary cultures of cerebellar granule cells. Brain Res. 624:223–232. Volterra, A., Trotti, C., Tromba, C., Floridi, S. and Racagni, G. (1994) Glutamate uptake inhibition by oxygen free radicals in rat brain cortical astrocytes. J. Neurochem. 14:2924–2932. Ebadi, M., Srinivasan, S.K. and Baxi, M.D. (1996) Oxidative stress and antioxidant therapy in Parkinson’s disease. Progr. Neurobiol. 48:1–19.
462
Ebadi and Hiramatsu
61. Malorni, W., Testa, U., Rainaldi, G., Tritarelli, E. and Peschle, C. (1998) Oxidative stress leads to a rapid alteration of transferrin receptor intravesicular trafficking. Exp. Cell Res. 241:102–116. 62. Lange, K.W. and Riederer, P. (1994) Glutamatergic drugs in Parkinson’s disease. Life Sci. 55:2067–2075. 63. Weihmuller, F.B., Ulas, J., Nguen, L., Cotman, C.W. and Marshall J.F. (1992) Elevated NMDA receptors in parkinsonian striatum. NeuroReport 3:977–980. 64. Bormann, J. (1989) Memantine is a potent blocker of N-methyl-D-aspartate (NMDA) receptor channels. Eur. J. Pharmacol. 166:591–592. 65. Olney, J.W., Price, M.T. and Labruyere, J. (1987) Anti-Parkinsonian agents are phencyclidine agonists and N-methyl-aspartate antagonists. Eur. J. Pharmacol. 142: 319–320. 66. Hopkins, F.G. (1921) An autoxidizable constituent of the cell. Biochem. J. 15:286– 305. 67. Gilliland, G.L. (1993) Glutathione proteins. Curr. Opin. Struct. Biol. 3:875– 884. 68. Meister, A. (1989) On the biochemistry of glutathione. In: Glutathione Centennial: Molecular Perspectives and Clinical Implications (Taniguchi, N., Higashi, T., Sakamoto, Y. and Meister, A., eds.), Academic Press, San Diego, pp. 3–21. 69. Cooper, A.J.L. (1997) Glutathione in the brain: disorders of glutathione metabolism. In: The Molecular and Genetic Basis of Neurological Disease, 2nd ed. (Rosenberg,R.N., Prusiner, S.B., DiMauro, S. and Barchi, R.L., eds.), ButterworthHeinemann, Boston, pp. 1195–1230. 70. Cooper A.J.L. and Kristal, B.S. (1997) Multiple roles of glutathione in the central nervous system. Biol. Chem. 378:793–802. 71. Puka-Sundvall, M., Sandberg, M. and Hagberg, H. (1998) Brain injury after neonatal hypoxia-ischemia in rats: a role of cysteine? Brain Res. 797:328–332. 72. Shen, X-M., Zhang, F. and Dryhurst, G. (1997) Oxidation of dopamine in the presence of cysteine: characterization of new toxic products. Chem. Res. Toxicol. 10: 147–155. 73. Tate, S.S., Ross, L.L. and Meister, A. (1973) The γ-glutamyl cycle in the choroid plexus. Its possible function in amino acid transport. Proc. Natl. Acad. Sci. USA 70:1447–1449. 74. Anderson, M.E., Underwood, M., Bridges, R.J. and Meister, A. (1989) Glutathione metabolism at the blood–cerebrospinal fluid barrier. FASEB J. 3:2527–2531. 75. Makar, T.K., Nedergaard, M., Preuss, A., Gelbard, A.S., Perumal, A.S. and Cooper, A.J.L. (1994) Vitamin-E, ascorbate, glutathione, glutathione disulfide, and enzymes of glutathione metabolism in astrocytes and neurons: evidence that astrocytes play an important role in antioxidative processes in the brain. J. Neurochem. 62:45–53. 76. Kaplowitz, N., Ferna´ndez-Checa, J.C., Kannan, R., Garcia-Rui´z, C., Ookhtens, M. and Yu, J.R. (1996) GSH transporters: molecular characterization and role in GSH homeostasis. Biol. Chem. 377:267–273. 77. Jain, A., Buist, N.R.M., Kennaway, N.G., Powel, B.R., Auld, P.A.M. and Martensson, J. (1994) Effect of ascorbate and N-acetylcysteine treatment in a patient with hereditary glutathione synthetase deficiency. J. Pediatr. 124:229–233.
Oxidative Stress in Parkinson’s Disease
463
78. Meister, A. (1995) Mitochondrial changes associated with glutathione deficiency. Biochem. Biophys. Acta 1271:35–42. 79. Heslop, K.E., Goss-Sampson, M.A., Muller, D.P.R. and Curzon, G. (1996) Serotonin metabolism and release in frontal cortex of rats on a vitamin-E deficient diet. J. Neurochem. 66:860–864. 80. Sian, J., Dexter, D.T., Lees, A.J., Daniel, S., Agid, Y., Javoy-Agid F., Jenner, P. and Marsden, C.D. (1994) Alterations in glutathione levels in Parkinson’s disease and other neurodegenerative disorders affecting basal ganglia. Ann. Neurol. 36: 348–355. 81. Pearce, R.K.B, Owen, A., Daniel, S., Jenner, P. and Marsden, C.D. (1997) Alterations in the distribution of glutathione in the substantia nigra in Parkinson’s disease. J. Neural Transm. 104:661–677. 82. Han, S-K., Mytilineou, C. and Cohen G. (1996) L-DOPA up-regulates glutathione and protects mesencephalic cultures against oxidative stress. J. Neurochem. 66: 501–510. 83. Nakamura, K., Wang, W. and Kang, U.J. (1997) The role of glutathione in dopaminergic neuronal survival. J. Neurochem. 69:1850–1858. 84. Toffa, S., Kunikowska, G.M., Zeng, B.-Y., Jennder, P. and Marsden, C.D. (1997) Glutathione depletion in rat brain does not cause nigrostriatal pathway degeneration. J. Neural Transm. 104:67–75. 85. Zeevalk, G.D., Bernard, L.P. and Nicklas, W.J. (1998) Role of oxidative stress and glutathione system in loss of dopamine neurons due to impairment of energy metabolism. J. Neurochem. 70:1421–1430. 86. Andersen, J.K., Mo, J.Q., Hom, D.G., Lee, F.Y., Harnish, P., Hamill, R.W. and McNeill, T.H. (1996) Effect of buthionine sulfoximine, a synthesis inhibitor of the antioxidant glutathione, on the murine nigrostriatal neurons. J. Neurochem. 67: 2164–2171. 87. Grasbon-Frodl, E.M., Andersson, A. and Brundin, P. (1996) Lazaroid treatment prevents death of cultured rat embryonic mesencephalic neurons following glutathione depletion. J. Neurochem. 67:1653–1660. 88. Zucker, B., Hanusch, J. and Bauer, G. (1997) Glutathione depletion in fibroblasts is the basis for apoptosis-induction by endogenous reactive oxygen species. Cell Death Diff. 4:388–395. 89. Ka¨gi, J.H.R. and Kojima, Y. (1987) Chemistry and biochemistry of metallothionein. Experientia 52:25–61. 90. Ka¨gi, J.H.R. and Scha¨ffer, A. (1988) Biochemistry of metallothionein. Biochemistry 7:8509–8515. 91. Itoh, M., Ebadi, M. and Swanson, S. (1983) The presence of zinc binding proteins in the brain. J. Neurochem. 41:823–829. 92. Uchida, Y., Takio, K., Titani, K., Ihara, Y. and Tomonaga, M. (1991) The growth inhibitory factor that is deficient in the Alzheimer’s disease brain is a 68 amino acid metallothionein-like protein. Neuron 7:337–347. 93. Palmiter, R.D., Findley, S.D., Whitmore, T.E. and Durnam, D.M. (1992) MT-III, a brain-specific member of the metallothionein gene family. Proc. Natl. Acad. Sci. USA 89:6333–6337. 94. Kobayashi, H, Uchida, Y., Ihara, Y., Nakajima, K., Kohsaka, S., Miyatake, T., and
464
95.
96. 97. 98.
99.
100. 101.
102. 103.
104.
105.
106. 107. 108.
109. 110.
111.
Ebadi and Hiramatsu Tsuji, S. (1993) Molecular cloning of rat growth inhibitory factor cDNA and the expression in the central nervous system. Mol. Brain Res. 19:188–194. Quaife, C.J., Findley, S.D., Erickson, J.C., Forelick, G.J., Kelly, E.J., Zambrowicz, B.P. and Palmiter, R.D. (1994) Induction of a new metallothionein isoform (MTIV) occurs during differentiation of stratified squamous epithelia. Biochemistry 33: 7250–7259. Young, J.K., Garvey, J.S. and Huang, P.C. Glial immunoreactivity for metallothionein in the rat brain. Glia 4:602–610. Kasarskis, E.J., Ehmann, W.D. and Markesbery, W.R. (1993) Trace metals in human neurodegenerative diseases. Progr. Clin. Biol. Res. 380:299–310. El Rafaey, H., Ebadi, M., Kuszynski, C.A., Sweeney, J., Hamada, F.M., and Hamed, A. (1997) Identification of metallothionein receptors in human astrocytes. Neurosci. Lett. 231:131–134. Ebadi, M., Iversen, P.L., Hao, R., Cerutis, D.R., Rojas, P., Happe, H.K., Murrin L.C. and Pfeiffer, R.F. (1995) Expression and regulation of brain metallothionein. Neurochem. Int. 26:1–22. Ebadi, M. (1991) Metallothionein and other zinc binding proteins in the brain. Meth. Enzymol. 205:363–387. Ebadi, M., Perini, F., Mountjoy, K. and Garvey, J.S. (1996) Amino acid composition, immunoreactivity, sequence analysis, and function of bovine hippocampal metallothionein isoforms. J. Neurochem. 66:2121–2127. Palmiter, R.D. (1998) The elusive function of metallothioneins. Proc. Natl. Acad. Sci. USA 95:8428–8430. Yang, Y-Y., Woo, E.S., Reese, C.E., Bahnson, R.R., Saijo, N. and Lazo, J.S. (1994) Human metallothionein isoform gene expression in cisplatin-sensitive and resistant cells. Mol. Pharmacol. 45:453–460. Jacob, C., Maret, W. and Vallee, B.L. (1998) Control of zinc transfer between thionein, metallothionein, and zinc proteins. Proc. Natl. Acad. Sci. USA 95:3489– 3494. Jiang, L-J., Maret, W. and Vallee, B.L. (1998) The glutathione redox couple modulates zinc transfer from metallothionein to zinc-depleted sorbitol dehydrogenase. Proc. Natl. Acad. Sci. USA 95:3483–3488. Maret, W. and Vallee, B.L. (1998) Thiolate ligands in metallothionein confer redox activity on zinc clusters. Proc. Natl. Acad. Sci. USA 95:3478–3482. Ebadi, M., Leuschen, M.P., El Refaey, H., Hamada, F.M. and Rojas, P. (1996) The antioxidant properties of zinc and metallothionein. Neurochem. Int. 66:2121–2127. Dexter, D.T., Carter, C.J., Wells, F.R., Javay-Agid, F., Agid, Y., Lees, A., Jenner, P. and Marsden, C.D. (1989) Basal lipid peroxidation in substantia nigra is increased in Parkinson’s disease. J. Neurochem. 52:381–389. Sato, S.M., Frazier, J.M. and Goldberg, A.M. A kinetic study of the in vivo incorporation of 65Zn into the rat hippocampus. J. Neurosci. 4:1671–1675. Lazo, J.S., Kondo, Y., Dellapiazza, D., Michalska A.E., Choo, K.H.A. and Pitt, B.R. (1995) Enhanced sensitivity to oxidative stress in cultured embryonic cells from transgenic mice deficient in metallothionein I and II genes. J. Biol. Chem. 270:5506–5510. Hiramatsu, M., Kohno M., Mori, A., Shiraga, H., Pfeiffer, R.F. and Ebadi, M.
Oxidative Stress in Parkinson’s Disease
465
(1994) An ESR study of 6-hydroxydopamine: generated hydroxy radicals and superoxide anions in the brain. Neuroscience 20:129–138. 112. Kumari, R., Agarwal, A.K. and Seth, P.K. (1995) Free-radical generated neurotoxicity of 6-hydroxydopamine. J. Neurochem. 64:1703–1707. 113. Rojas, P., Cerutis, D.R., Happe, H.K., Murrin, L.C., Hao, R., Pfeiffer, R.F. and Ebadi, M. (1996) 6-Hydroxydopamine-mediated induction of rat brain metallothionein I mRNA. Neurotoxicology 17:323–334. 114. Ramana Kumari, M.V., Hiramatsu, M. and Ebadi, M. (1998) Free radical scavenging actions of metallothionein isoforms I and II. Free Rad. Res. 29:93–101.
22 Estrogens and Other Antioxidants in Neuroprotection: Implications for Alzheimer’s Disease Christian Behl and Bernd Moosmann Max Planck Institute of Psychiatry, Munich, Germany
I. INTRODUCTION Reactive oxygen species (ROS) are a natural byproduct of aerobic living conditions. Although the organism and the cells have developed powerful strategies to defend themselves against the high reactivity of ROS, under certain conditions ROS can lead to massive alterations in cell functions and ultimately to cell death. ROS have been suggested to be implicated in the pathogenesis of a variety of nonneuronal and neuronal disorders including artherosclerosis, stroke, cerebral ischemia, amyotrophic lateral sclerosis, and Parkinson’s disease (1–4). Compared to other tissues that can be damaged by ROS, the brain is particularly vulnerable to oxidation. Most importantly, neuronal membranes of the brain consist of high concentrations of polyunsaturated fatty acids which are potential substrates for peroxidation reactions. Moreover, the brain has only low levels of antioxidant defense enzymes compared to other tissues (1). The exact pathogenic events that lead to the development of Alzheimer’s disease (AD) are not fully understood, but it is accepted that oxidative changes can be found in postmortem material of AD patients and that therefore oxidations may play a role during the course of nerve cell degeneration. Consequently, oxidative stress has also been implicated in the pathogenesis of AD (5). Various hypotheses for the pathogenesis of AD are discussed such as the acetylcholine hypothesis (6), the amyloid cascade hypothesis (7,8), the arthritis of the brain hypothesis (9), or the energy metabolism hypothesis (10). Many parallels can be drawn between the pathophysiology of AD and pathophysiologi467
468
Behl and Moosmann
cal changes occurring during aging. Since over 85% of AD cases are age-related and obviously age is a reliable risk factor for the nongenetic sporadic forms of this disease, age-associated physiological and pathophysiological alterations have to be taken into account [aging has been explained by the free radical hypothesis (11,12)]. The current treatment strategies for AD are derived from the various hypotheses of AD pathogenesis. Those include the treatment with acetylcholinesterase inhibitors to increase levels of the neurotransmitter acetylcholine in the synaptic cleft or the treatment with antiinflammatory drugs in order to prevent inflammation-related damaging events. In consequence to the oxidative stress hypothesis of AD, antioxidant strategies have to be considered as well. Besides the well-known antioxidant compounds such as the lipophilic free radical scavenger vitamin E, novel and more effective antioxidant drugs have to be developed in order to prevent the massive oxidation reactions occurring during AD. In order to find such novel antioxidants, approaches using cultured nerve cells challenged by different AD-related oxidative stressors are highly feasible. Using such in vitro screening procedures in recent years, compounds such as the glucocorticoid receptor and progesterone receptor antagonist RU 486 (mifepreston), the pineal hormone melatonin, or the female sex hormone estrogen could be identified as powerful antioxidant structures (5).
II. OXIDATIVE STRESS IN ALZHEIMER’S DISEASE The histopathology of AD shows many signs of oxidative stress and an overall increased oxidative environment for the neurons. Various products of oxidation reactions and mediators of oxidative stress can be found in association with the histopathological AD hallmarks, mainly the senile plaques. Such oxidation endproducts include malondialdehyde, advanced glycation end-products (AGEs), carbonyls, nitrotyrosine, and various other oxidized molecules (4,13,14). In general, nearly all types of cellular macromolecules could be found in an oxidized form in AD tissue. The oxidation of proteins and lipids may lead to immediate alterations in enzyme activities and membrane integrity and the oxidation of DNA may have long-term mutagenic effects (15). There are also various studies showing that the peroxidation of lipids has increased in AD brain when compared to normal controls (16). Other oxidative players that are found in AD tissue belong to inflammation reactions and to the immune defense system. Many features of a massive immune reaction in AD tissues have been described (17). The activation of the immune defense system may cause tissue damage also via oxidation reactions either directly through their inflammatory mediators or via secondary events (18). Frequently, activated microglia is found in AD tissue and this activation can lead
Estrogens and Other Antioxidants
469
to the secretion of interleukin-1, tumor necrosis factor–α, and nitric oxide radicals (19–21). Nitric oxide radicals can react with superoxide radicals to peroxynitrite, which is known to be highly reactive and highly damaging to macromolecules (22). Microglial cells can be attracted and activated by amyloid β protein that is found as deposit in the senile plaques (18). The amyloid β protein is a 39- to 43-amino-acid-long peptide that is derived from a larger precursor and is found as a cross-β-sheet aggregate in senile plaques. Besides various genetic and biochemical lines of evidence showing that the metabolism of Aβ is a central event in AD pathogenesis, the direct neurotoxicity of this peptide is further supporting a pivotal role of Aβ in AD (for review see Refs. 23 and 24). The mechanism of Aβ’s neurotoxicity in vitro has been identified to be mediated by oxidative stress. Aβ aggregates activate oxidases in neurons that leads to the accumulation of hydrogen peroxide in the cells. Ultimately, membrane lipids are peroxidized leading to cell lysis and, therefore, to nerve cell death (5,26–31). Consequently, Aβ itself is an oxidative stress–inducing agent and can attract other oxidative stress mediators such as cells of the immune system. Overall, the deposition of Aβ may lead to a slowly increasing oxidative challenge to the neurons. One of the first hints that the toxicity of Aβ can be mediated by oxidative stress was the observation that the lipophilic free radical scavenger vitamin E (α-tocopherol) can protect nerve cells against Aβ-induced oxidative cell death (30). Moreover, other antioxidant systems can also protect against Aβ toxicity including antioxidants such as N-acetylcysteine, propyl gallate, or enzymes that degrade peroxides such as catalase (31). Vitamin E indeed blocks Aβ toxicity by the prevention of lipid peroxidation induced by Aβ. For this reason, antioxidants may be valuable drugs for the prevention of Aβ toxicity and of oxidative stress–induced cell death in general. In addition to Aβ, also other amyloidogenic peptides can induce oxidative stress by the activation of flavin-containing oxidases (31,32). Moreover, the excitatory amino acid glutamate can induce oxidations either via glutamate receptor–dependent or glutamate receptor–independent mechanisms (2,33,34). Interestingly, Aβ can also render neurons more vulnerable to oxidative stress as induced by glutamate indicating that various oxidative challenges can synergistically damage nerve cells (35,36). Apart from glutamate receptor antagonists, the toxicity of glutamate can be blocked by various antioxidants (2,5).
III.
ANTIOXIDANTS IN NEUROPROTECTION IN VITRO
Antioxidant therapies are discussed for a variety of neurodegenerative disorders such as Parkinson’s disease, ischemia, and other age-related disorders in general (3,37,38). Numerous free radical scavengers have been tested for their neuropro-
470
Behl and Moosmann
tective potential in vitro and in vivo. The most prominent lipophilic antioxidant is vitamin E which has not only a protective activity against Aβ toxicity, but also against other oxidative challenges such as glutamate (33). On the other hand, it is known that vitamin E does not easily pass the blood–brain barrier, which makes it hard to enrich a powerful antioxidant in brain tissue in general (39). Therefore, the search for antioxidants with an increased permeability for endothelial tissues is very important and may lead to more effective antioxidant neuroprotection. Among the various other compounds that have been tested for an antioxidant activity against Aβ toxicity or glutamate toxicity in vitro is also the pineal hormone melatonin, the 21-aminosteroids (lazaroids), and the prominent glucocorticoid and progesterone receptor antagonist RU 486 (mifepristone) (25,40,41). A.
Estrogen as Free Radical Scavenger
There are numerous links between the female sex hormone estrogen and neurodegenerative diseases in general and AD in particular. It is well known that women are twice as likely to develop AD than men (42,43) and that the loss of estrogens during menopause may play a role in an age-associated cognitive decline (44). Increasing the level of estrogens by estrogen replacement therapy may lower the risk of getting AD for postmenopausal women (45,46). Estrogen is a steroidal compound that binds to cognate receptors upon penetration of the cellular membrane, and these activated estrogen receptors comprise transcription factors that translocate into the nucleus. There estrogen receptors bind to estrogen-responsive elements in the promoter regions of certain target genes activating the transcription of these genes. It is known that estrogen affects neurons through this estrogen receptor–dependent hormonal effect by activating the transcription of certain receptors of neurotrophins such as nerve growth factor (NGF) (47). Therefore, estrogens may have a neuroprotective effect due to the increase of intrinsic neurotrophic activities. Furthermore, it has been shown that estrogens can modulate neurotransmitter receptors and may also regulate synapse formation during nerve system development and regeneration. Recently, it has been shown that estrogens also have a modulatory effect on the metabolism of the AD-associated amyloid β-protein precursor. Estrogens increase the so-called nonamyloidogenic pathway of APP processing and therefore decrease the secretion of potential neurotoxic Aβ fragments as they are found in an aggregated form in senile plaque deposit (48,49). In addition to these estrogen effects that are depending on estrogen receptor activation, estrogens may also have nonreceptor-mediated modulatory effects on neurons. Recently, it has been demonstrated that estrogens can modulate the activity of the 5HT3 receptors independently from estrogen receptor activation (50). Another recently discovered receptor-independent activity of estrogen is its role as antioxidant. The steroidal compound estrogen has been shown to prevent
Estrogens and Other Antioxidants
471
oxidative nerve cell death as caused by amyloid β protein, hydrogen peroxide, or glutamate (51). This antioxidant activity of estrogen is due to its chemical structure and is independent of estrogen receptor activation. Several estrogen derivatives have been tested for their protective activity in paradigms of oxidative nerve cell death and it has been found that other estrogens, such as estriol, estrone, ethinylestradiol, 2-hydroxyestradiol, and 4-hydroxyestradiol, also have powerful antioxidant effects. Oxidative cell death could be prevented in primary neurons as well as in clonal hippocampal cells and in differentiated tissue using organotypical slices. In summary, the basic prerequisites for estrogenic molecules to act as antioxidants and neuroprotectants against oxidations is the presence of the intact hydroxyl group on ring A of the steroidal compound (Fig. 1). Whenever this hydroxyl group is modified such as through an ether modification as in mestranol (methyl ether), the protective activity and the lipid peroxidation inhibiting activity of the compound is lost (52). The same is true for the molecule α-tocopherol (vitamin E) since in tocopherol acetate and other derivatives the antioxidant activity is almost completely lost. A comparison of the basic structure of estrogen and vitamin E clearly shows that there are common features. Both molecules consist of a large lipophilic structure conferring the ability to penetrate and accumulate in the neuronal cell membrane. Moreover, both molecules carry an intact hydroxyl group linked to an aromatic system comprising a phenolic structure. With respect to the structure of these molecules, vitamin E and estrogens are therefore quite similar, although the potency of the antioxidant activity is different. The major disadvantage of using estrogen as antioxidant with respect to a potential clinical use obviously is its hormonal effects that are mediated through estrogen receptors. Although for women, the application of estrogens may be envisaged specifically in conditions when estrogen levels drop. Of course, in men such a hormone cannot be used. More recent data show that estrogen can be degraded structurally into compounds that carry only selected structural characteristics of estrogen or vitamin E. Such compounds comprise the group of aromatic alcohols (53).
B.
Aromatic Alcohols and the Basic Structure of a Phenolic Antioxidant
Using liver microsomes, it was previously shown that naturally occurring phenolic compounds may potentially prevent peroxidative damage (54–56). When using aromatic alcohols with a phenolic group linked to a lipophilic side chain, the antioxidant activity of estrogen can be mimicked. A compound such as 4dodecylphenol has a similar antioxidant and neuroprotective activity as 17β-estradiol.
472
Figure 1 ties.
Behl and Moosmann
Structures of various phenolic structures tested for potential antioxidant activi-
Estrogens and Other Antioxidants
473
A second row of examples with neuroprotective activity consists of the group of indole derivatives such as 5-hydroxytryptamine (serotonin) and N-acetyl-5-hydroxytryptamine (normelatonin). Whenever the phenolic group is altered and the hydroxyl group modified such as in N-acetyl-5-methoxytryptamine (melatonin), the antioxidant capacity is decreased or lost. This might explain the fact that melatonin when used as an antioxidant in vitro has to be used in rather high concentrations (up to 1 mM) in order to get a significant protection, whereas its precursor molecule, N-acetyl-5-hydroxytryptamine (normelatonin), has much higher antioxidant and neuroprotective capacity (Table 1). Another example further confirming the concept of aromatic alcohols as potential basic structure for antioxidants is 2-naphthol. 2-Naphthol protects clonal mouse hippocampal HT22 cells against glutamate or H2O2, but its derivative methoxynaphthalene does not prevent oxidative cell death (53). Therefore, in general, it can be summarized that a phenolic structure and a lipophilic side chain are the minimal requirements for one class of potential antioxidant drugs that
Table 1 Protection of Clonal Hippocampal HT22 Cells from Mouse Against Oxidative Glutamate Toxicitya Control 5 mM glutamate alone 5 mM glutamate/pretreatment with
1 µM
17β-Estradiol 9⫾3 17α-Estradiol 6⫾4 Mestranol n.e. 2,4,6-Trimethylphenol n.e. α-Tocopherol (vitamin E) 81 ⫾ 6 4-Dodecylphenol 32 ⫾ 7 5-Hydroxytryptamine (serotonin) n.e. N-Acetyl-5-hydroxytryptamine (normelatonin) n.e. N-Acetyl-5-methoxytryptamine (melatonin) n.e. 2-Naphthol n.e. 2-Methoxynaphthalene n.e. 5-Hydroxyindole n.e. 6-Hydroxyquinoline n.e. Quercetin 6⫾4 Resveratrol 12 ⫾ 4 a
100% Viability 5⫾3 5 µM 20 µM 11 21 2 11 82 92 8 9 5 3 4 14 4 69 51
⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾
6 5 3 6 9 9 6 3 3 3 4 7 3 11 7
67 65 4 69 88 89 28 18 9 42 4 80 22 80 81
⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾ ⫾
5 7 3 8 8 7 4 6 5 10 5 5 7 7 6
200 µM n.d. n.d. n.d. 64 ⫾ 4 n.d. n.d. 72 ⫾ 6 89 ⫾ 5 25 ⫾ 7 88 ⫾ 10 5⫾3 95 ⫾ 4 90 ⫾ 5 n.d. 89 ⫾ 5
HT22 cells were preincubated with the indicated phenolic compounds and then challenged with 5 mM glutamate. Cell survival was determined by MTT assays (Ref. 26); n.e. is the abbreviation for no effect and means that no cell survival could be detected at this concentration; n.d. means that the compound was either toxic to the cells or interfered with the colorimetric MTT assay.
474
Behl and Moosmann
can also be used in neurotoxicity paradigms for neuroprotection (see Fig. 1). Of course, some of the phenolic compounds may have estrogen receptor activating effects, but there is no direct association between receptor activation and neuroprotective activity (54). This further confirms that for the neuroprotective activity of phenolic compounds, no receptor mediation is necessary. This basic neuroprotective structure outlined here might serve as the basis of a novel drug design toward more effective antioxidants that may ultimately as well be used in vivo. C.
Design of a Candidate Neuroprotective Phenolic Antioxidant: A Stepwise Chemical Approach
With respect to what we have learned from those diverse but (with respect to some basic structural features) nevertheless very similar antioxidants discussed above, we can try to outline a possibly optimized neuroprotective chemical antioxidant on the drawing board. We have seen in Table 1 that the neuroprotective properties of 5-hydroxyindole, 2-naphthol, and 6-hydroxyquinoline decrease (at a concentration of 20 µM) in this order in spite of 2-naphthol being the most lipophilic structure, which generally favors protective effects in experimental cell culture systems (53). Therefore, it may be concluded that aromatic compounds with high electron density bearing a phenolic group (5-hydroxyindole) are better antioxidants than electron density–lacking aromatic cores (6-hydroxyquinoline). This idea is consistent with the generally accepted prerequisite for chemical chain–breaking antioxidants to exhibit an electronically stabilized radical state (1). Since simple phenoxyl radicals are electrophilic structures, indoloxyl radicals should be more stable. This may explain why 5-hydroxyindole is a better antioxidant than 2naphthol and why even among the hydroxyl group modified phenolic compounds with their drastically decreased antioxidant potential, melatonin is a better antioxidant than 2-methoxynaphthalene (Table 1). If we employ this principle to the first antioxidant structure 17β-estradiol (1), and aromatize the B ring of the steroid core, structure (2) in Fig. 2 will result. Alkyl heteroatomic groups with oxygen, nitrogen, or sulfur as heteroatoms on a phenolic core like our indolic one in structure (2) are quite common in effective antioxidants and stabilize their radical states; vitamin E is a good example, as are designer drugs mimicking vitamin E (57) as well as probucol (9). But structure (2) may have an advantage: the opening of the five-membered ring B and, therefore, the degradation of our structure in the radical state is impossible since the hetero nitrogen is part of the aromatic core. In contrast to that, for vitamin E the opening of the second ring of the chromane core is a well-known side reaction (1,58) for which even a biological recycling pathway may exist, the re-reduction being fueled by vitamin C (59). Apart from reducing the effective concentration of our primary antioxidant structure, such a metabolic degradation to a para-
Estrogens and Other Antioxidants
475
Figure 2 Design of a candidate neuroprotective phenolic antioxidant: a stepwise chemical approach.
476
Behl and Moosmann
hydroquinone should be avoided for a second and even more important reason: para-hydroquinones and also catechins (ortho-hydroquinones) are capable of the prooxidant process of redox cycling since they exhibit different stable oxidation states (60). Prooxidant activities originating from redox cycling have been correlated with processes such as carcinogenesis (15), and neurodegenerative conditions such as occurring in Parkinson’s disease (38). It appears consequently to further increase the size of the aromatic system of our model antioxidant so that we get compound (3). Theoretically, this should further stabilize its radical intermediate state. Next we add two tert-butyl groups to both of the free ortho positions of our molecule leading to structure (4) since most chemicals with aromatic, especially phenolic moieties, are readily metabolized by a widespread class of detoxifying enzymes, cytochromes P450 (61). This is also true for 17β-estradiol, which is mainly hydroxylated in its C2 and C4 positions (62) to reach an estrocatechin structure. Most likely the hydroxylation reaction performed by cytochrome P450 isozymes can be perspiciously decelerated by any substitution of both ortho positions in structure (3) in general, and by bulky tert-butyl groups in particular. Nevertheless, the application of our nonsubstituted antioxidant (3) parenterally would not fully solve the problem of metabolization since the brain itself also expresses several xenobiotic-transforming enzymes (63). Furthermore, hydroxylation is not the only metabolic reaction that has to be avoided: As we have seen in Sec. III.B, it is important to keep the central phenolic group, and transformations like O-acetylations or O-glucuronylations, which destroy the molecule’s antioxidant effect, have to be prevented. Simple phenolic compounds are intracerebrally glucuronylated, e.g., in rat brain (64), and we may assume that reactions like these are also slowed down by two bulky tert-butyl groups. The latter chemical design concept described so far, intended to achieve increased concentrations of the model antioxidant compound in the brain and the cerebrospinal fluid, of course must not inhibit the molecule’s very prime feature, the possible formation of a stabilized phenoxyl radical. Potentially, two large tert-butyl groups could also prevent this antioxidative action, but different examples like probucol (9) as well as a very recently published new vitamin E analog (10) (65) prove instead the expectation that phenoxyl radical formation, which probably is a reaction with an organic peroxyl radical, is sterically not very pretentious. Both examples show that the antioxidant activity of phenolic compounds is not diminished by two ortho-tert-butyl groups. But there are still other advantageous side effects of the two tert-butyl groups: (1) their impact on the estrogen receptor–activating properties of the molecule, (2) their effect on the molecule’s physical properties as a surfactant, and (3) their effect on the molecules all over planarity and therefore DNA-intercalating potency.
Estrogens and Other Antioxidants
477
Diverse simple alkylphenolic compounds in low micromolar concentrations can competitively displace 17β-estradiol from estrogen receptors (66), but estrogenic activity is prevented when the ortho positions of the phenolic core are substituted (67). For example, while 4-dodecylphenol shows significant estrogen receptor activation at 100 nM, 2,4,6-trimethylphenol is nonactivating even at 20 µM (54). But both compounds are identically neuroprotective. It can be assumed that the molecular plank-like structure (3) would also act as an estrogen in low micromolar concentrations for it is known that molecular planks (annealed polycyclic aromatic compounds with three to five rings) exhibit this property (68,69) and that dihydroxylated molecular planks are especially estrogenic (70). Structure (4) instead can be expected to behave completely inert in this respect. Despite of the beneficial hormonal effects of estrogens as mentioned in Sec. III.A, estrogenicity is a property to avoid since the these hormonal effects are beneficial for women only. Moreover, our goal is to design a generally applicable bare antioxidant in which hormonal side effects should not limit the realizable effector concentrations. In addition, estrogenic molecules are well-characterized tumor promotors (71,72). A similar argument applies to the aryl hydrocarbon (Ah) receptor, another member of the nuclear receptor family sharing with the estrogen receptor the property of a strikingly wide range of activating ligands most prominently TCDD (2,3,7,8-tetrachlorodibenzo-p-dioxin) and other diverse polycyclic aromatic compounds (73). Since these compounds as well as hypothesized endogeneous ligands, annealed tryptophan metabolites (74), share planarity and aromaticity over several rings as a structural motif, the addition of the two tert-butyl groups to our structure (3) may be of value in this respect, too. Lipophilic phenolic compounds such as 4-dodecylphenol and 17β-estradiol exhibit detergent-like activites that may lead to the detachment of cultured cells in vitro in concentrations between 50 and 100 µM (unpublished observations). These concentrations are rather low since the compounds’ half-effective antioxidant concentrations are in the concentration range 5–10 µM in vitro. Furthermore, it can be expected that these molecules influence membrane fluidities and possibly membrane protein activities at much lower concentrations, which should be avoided. The alkyl substitution of the free positions of the phenolic ring drastically decreases the surfactant activity of the compounds which can be readily illustrated by means of the tocopherols: δ-tocopherol with its single nonsubstitued position is a detergent at 200–500 µM, and α-tocopherol (completely substituted) shows no detaching effect at even 2 mM. So structure (4) can also be expected not to exhibit detergent-like properties in comparable concentrations. A last feature to discuss concerning plane polycyclic aromatic molecules is their possible intercalation into DNA. Very often, DNA intercalating agents have been found to be carcinogenic (75), but there are also some intercalators
478
Behl and Moosmann
that show antitumor activity instead (76). Our molecule (4) can be expected not to intercalate into DNA for the following reasons: It does not contain any ionic, especially cationic, groups that confer a high activity of intercalation (e.g., ethidium bromide). It is only weakly polarizable since its only nitrogen heteroatom is located nearly in the middle of the structure and its only oxygen heteroatom is sterically shielded from inducing dipoles by the two bulky tert-butyl groups. Polarizability is thought to be a key criterion for fused-ring intercalators (77). Most importantly, it bears two tert-butyl groups that prevent intercalation because of their three-dimensional structure. Admittedly, structure (4) is no typical steroid anymore, but in a hopeful effort to increase its oral resorption and efficacy, an ethynyl group in that position that corresponds to the former position 17 of the steroid core may be added to obtain structure (5). Regarding steroids, this is a well-proven means of rendering oral administration possible, realized for example in mifepristone (RU 486) and ethynylestradiol, a component of oral contraceptives. The straightforward removal of structural elements not explicitly needed then leads to structure (6), which makes the synthesis much easier. Finally, a third tert-butyl group to the bay region of the aromatic core is added since polycyclic aromatic compounds, having such a bay region, sometimes undergo metabolic activation, a so-called epoxidation, by cytochrome P450 enzymes to reach structures that tend to form covalent bonds with DNA and therefore show some mutagenicity (78). But our addition has to be considered as a virtually unnecessary second line of defense since the structurally closely related aromatic compound phenanthrene is not mutagenic at all (79). We may add the third tert-butyl group for reasons similar to those for which we added the first two groups. Structure (7) now constitutes the proposed idea of a deliberately tailored phenolic antioxidant with a presumably better efficacy and fewer side effects than many other tested or proposed compounds. Structure (8) embodies nearly all of the same characteristics as structure (7) but is much easier to synthesize. Interestingly, independent of the considerations outlined, recently a similar compound (10) to structure (8) has been published and proposed as an antioxidant for pharmacological use (65). But with respect to this structure (10), one has to raise the objection that this compound will probably also be converted to an unfavorable para-hydroquinone (see above). Perhaps structure (7) will have to be slightly hydrophilized in order to better cross the blood–brain barrier. But there are enough sites at the molecule to do so, e.g., the tert-butyl group. In conclusion to this discussion, it has to be mentioned that we have considered the prevention of numerous unfavorable potential side effects of our artificial designer compound that may lead to the suggestion to use instead natural phenolic compounds, e.g., of plant origin. Let us consider this for just two candidates of common interest: the flavonoid quercetin and the grape stilbenol resveratrol. Quercetin (Fig. 1), a main flavonoid of Gingko biloba extracts (80), has been
Estrogens and Other Antioxidants
479
shown to be carcinogenic in several experimental systems (81). Moreover, besides its antioxidant effects [e.g., (82)], it can also act as a pro-oxidant (83,84), is an inhibitor of cAMP phosphodiesterase (85) and can activate estrogen receptor-driven transcription in human breast cancer MCF-7 cells at low micromolar concentrations (unpublished observations). Our rather critical discussion would therefore exclude quercetin a priori as a candidate for a pharmacologically used antioxidant, at least for long-term treatment. Resveratrol (Fig. 1), which is found in grapes and wine in high concentrations, is known for its in vitro antioxidant (86,87) and some anticarcinogenic effects (88), but it is also reported to be an effective agonist at the estrogen receptor (89). Furthermore, resveratrol may be metabolized to a redox-cycling catechin by phase I enzymes. These two examples of relatively well-characterized antioxidant compounds from natural origin may illustrate that the above principles for an optimized antioxidant are not at all automatically met by natural candidate compounds and, consequently, a rational design of synthetic antioxidants with deliberately improved properties is urgently needed. In the future this may ultimately lead to the development of antioxidant compounds for prevention and therapy of oxidative stress–related disorders.
IV.
ANTIOXIDANTS IN CLINICAL USE
Although most of the previously mentioned compounds that have neuroprotective capacities with respect to oxidative cell death are still being studied at the level of preclinical research, employing cultured nerve cells or brain slice preparations and, therefore, in vitro, a validation of these very promising data is necessary. Future clinical trials will show whether the concept of antioxidants as preventive drugs or as therapy for neurodegenerative disorders, or AD in particular, will hold this promise. A first clinical trial employing vitamin E was recently successfully completed. There, in a multicenter clinical trial on AD patients suffering from a moderately severe impairment, vitamin E effectively slowed down the progression of the disease (90). Of course, it is still open as to whether the vitamin E effect is due to its antioxidant and neuroprotective capacity or due to other modulatory functions of this compound. Nevertheless, this first success raises high hopes with respect to the concept of an antioxidant therapy and is currently fueling further intensive research and additional clinical trials on this particular topic. With respect to estrogen, it has to be mentioned that presently several sets of data are available showing that the use of estrogen replacement therapy in postmenopausal women may delay the onset of AD (46). Here, the question is still open regarding what particular function mediates this beneficial effect of estrogens. But as discussed before, estrogen in general has neuroprotective activities
480
Behl and Moosmann
at various levels; therefore, there might be a synergistic and overlapping effect of several protective activities of estrogen. Furthermore, with respect to estrogen, the results of detailed clinical studies will prove whether estrogen, at least for women, is a possible means of prevention and treatment of AD. In summary, it is clear that the neuroprotection mediated by antioxidants is a general concept of cell protection and is not specific for one particular type of oxidative cell death as induced by glutamate, amyloid β protein, or other oxidative stressors. But this general effect is also its conceptual advantage. As long as the specific pathological mechanisms are not clarified for neurodegenerative events such as in AD and, therefore, clear pharmaceutical targets are missing, a general neuroprotective concept is more than feasible. And even in the case that specific targets are identified, an overall neuroprotective frame provided by antioxidants is also beneficial for neurons. On the basis of the data so far available on antioxidants as neuroprotectants, it can be expected that newly designed antioxidants can serve even better conferring neuroprotection in certain neurodegenerative conditions.
ACKNOWLEDGMENT The authors thank Ms. Sandra Rengsberger for the editing of this manuscript.
REFERENCES 1. Halliwell, B. and Gutteridge, J.M.C. (1989) Free Radicals in Biology and Medicine. 2nd ed. Oxford University Press: Oxford. 2. Coyle, J.T. and Puttfarcken, P. (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262:689–695. 3. Ames, B.N., Shigenaga, M.K. and Hagen, T.M. (1993) Oxidants, antioxidants, and the degenerative diseases of aging. Proc. Natl. Acad. Sci. USA 90:7915– 7922. 4. Beal, M.F. (1995) Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 38:357–366. 5. Behl, C. (1998) Alzheimer’s disease and oxidative stress: implications for novel therapeutic approaches. Prog. Neurobiol. 56:1–23. 6. Whitehouse, P.J., Price, D.L., Struble, R.G., Clark, A.W., Coyle, A.W. and Delon, M.R. (1982) Alzheimer’s disease and senile dementia: loss of neurons in the basal forebrain. Science 215:1237–1239. 7. Hardy, J. and Allsop, D. (1991) Amyloid deposition as the central event in the etiology of Alzheimer’s disease. Trends Pharmacol. Sci. 12:383–388. 8. Selkoe, D.J. (1993) Physiological production of the β-amyloid protein and the mechanism of Alzheimer’s disease. Trends Neurosci. 16:403–409.
Estrogens and Other Antioxidants
481
9. Rogers, J., Cooper, N.R., Webster, S., Schultz, J., McGeer, P.L., Styren, S.D., Civin, W.H., Brachova, L., Bradt, B., Ward, P. and Lieberburg, I. (1992) Complement activation by β-amyloid in Alzheimer disease. Proc. Natl. Acad. Sci. USA 89: 10016–10020. 10. Hoyer, S. (1994) Age as a risk factor for sporadic dementia of the Alzheimer type? Ann. NY. Acad. Sci. 719:248–256. 11. Harman, D., Eddy, D.E. and Noffsinger, J. (1976) Free radical theory of aging: inhibition of amyloidosis in mice by antioxidants; possible mechanism. J. Am. Geriatr. Soc. 24:203–210. 12. Beckman, K.B. and Ames, B.N. (1998) The free radical theory of aging matures. Physiol. Rev. 78:547–581. 13. Pappolla, M.A., Omar, R.A., Kim, K.S. and Robakis, N.K. (1992) Immunhistochemical evidence of oxidative stress in Alzheimer’s disease. Am. J. Pathol. 140:621– 628. 14. Smith, M.A., Perry, G., Richey, P.L., Sayre, L.M., Anderson, V.E., Beal, M.F. and Kowall, N. (1996) Oxidative damage in Alzheimer’s. Nature 382:120–121. 15. Ames, B.N. (1983) Dietary carcinogens and anticarcinogens. Science 221:1256– 1263. 16. Hajimohammadreza, I. and Brammer, M. (1990) Brain membrane fluidity and lipid peroxidation in Alzheimer’s disease. Neurosci. Lett. 112:333–337. 17. McGeer, P.L. and McGeer, E.G. (1995) The inflammatory response system of brain; implications for therapy of Alzheimer and other neurodegenerative diseases. Brain Res. Brain Res. Rev. 21:195–218. 18. McGeer, P.L., Schulzer, M. and McGeer, E.G. (1996) Arthritis and antiinflammatory agents as possible protective factors for Alzheimer’s disease—a review of 17 epidemiologic studies. Neurology 47:425–432. 19. Griffin, W.S.T., Stanley, L.C., Ling, C., White, L., MacLeod, V., Perror, L.J., White III, C.L. and Araoz, C. (1989) Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proc. Natl. Acad. Sci. USA 86: 7611–7615. 20. Meda, L., Cassatella, M.A., Szendrei, G.I., Otvos, L., Baron, P., Villalba, M., Ferrari, D. and Rossi, F. (1995) Activation of microglial cells by β-amyloid protein and interferon-γ. Nature 347:647–650. 21. Yan, S.D., Chen, X., Fu, J., Chen, M., Zhu, H., Roher, A., Slattery, T., Zhao, L., Nagashima, M., Morser, J., Migheli, A., Nawroth, P., Stern, D., and Schmidt, A. (1996) RAGE and amyloid-β peptide neurotoxicity in Alzheimer’s disease. Nature 382:685–691. 22. Beckmann, J.S. and Koppenol, W.H. (1996) Nitric oxide, superoxide, and peroxynitrite–the good, the bad, and the ugly. Am. J. Physiol. 40:C1424–C1437. 23. Sandbrink, R., Hartmann, T., Masters, C.L. and Beyreuther, K. (1996) Genes contributing to Alzheimer’s disease. Mol. Psychiatry 1:27–40. 24. Yankner, B.A. (1996) Mechanism of neuronal degeneration in Alzheimer’s disease. Neuron 16:921–932. 25. Behl, C., Trapp, T., Skutella, T. and Holsboer, F. (1997) Protection against oxidative stress–induced neuronal cell death—a novel role for RU486. Eur. J. Neurosci. 9: 912–920.
482
Behl and Moosmann
26. Behl, C., Davis, J.B., Klier, F.G. and Schubert, D. (1994) Amyloid β peptide induces necrosis rather than apoptosis. Brain Res. 645:253–264. 27. Hensley, K., Carney, J.M., Mattson, M.P., Aksenova, M., Harris, M., Wu, J.F., Floyd, R.A. and Butterfield, D.A. (1994) A model for β-amyloid aggregation and neurotoxicity based on free radical generation by the peptide: relevance to Alzheimer disease. Proc. Natl. Acad. Sci. USA 91:3270–3274. 28. Butterfield, D., Hensley, K., Harris, M., Mattson, M., and Carney, J. (1994) β-Amyloid peptide free radical fragments initiate synaptosomal lipoperoxidation in a sequence-specific fashion: implications to Alzheimer’s disease. Biochem. Biophys. Res. Commun. 200:710–715. 29. Harris, M.E., Hensley, K., Butterfield, A., Leedle, R.A. and Carney, J.M. (1995) Direct evidence of oxidative injury produced by the Alzheimer’s β-amyloid peptide (1–40) in cultured hippocampal neurons. Exp. Neurol. 131:193–202. 30. Behl, C., Davis, J., Cole, G.M. and Schubert, D. (1992) Vitamin E protects nerve cells from amyloid β protein toxicity. Biochem. Biophys. Res. Commun. 186:944– 952. 31. Behl, C., Davis, J.B., Lesley, R. and Schubert, D. (1994) Hydrogen peroxide mediates amyloid β protein toxicity. Cell 77:817–822. 32. Schubert, D., Behl, C., Lesley, R., Brack, A., Dargusch, R., Sagara, Y. and Kimura, (1995) Amyloid peptides are toxic via a common oxidative mechanism. Proc. Natl. Acad. Sci. USA 92:1989–1993. 33. Schubert, D., Kimura, H. and Maher, P. (1992) Growth factors and vitamin E modify glutamate toxicity. Proc. Natl. Acad. Sci. USA 89:8264–8267. 34. Davis, J.B. and Maher, P. (1994) Protein kinase C activation inhibits glutamate cytotoxicity in a neuronal cell line. Brain Res. 652:169–173. 35. Koh, J., Yang, L.L. and Cotman, C.W. (1990) β Amyloid protein increases the vulnerability of cultured cortical neurons to excitotoxic damage. Brain Res. 553:315– 320. 36. Mattson, M.P., Cheng, B., Davis, D., Bryant, K., Lieberburg, I. and Rydel, R. (1992) β-Amyloid peptides destabilize calcium homeostasis and render human cortical neurons vulnerable to excitotoxicity. J. Neurosci. 12:376–389. 37. Hall, E.D. and Braughler, J. M. (1989) Central nervous system trauma and stroke. II. Physiological and pharmacological evidence for involvement of oxygen radicals and lipid peroxidation. Free Radic. Biol. Med. 6:303–313. 38. Ebadi, M., Srinivasan, S.K. and Baxi, M.D. (1996) Oxidative stress and antioxidant therapy in Parkinson’s disease. Prog. Neurobiol. 48:1–19. 39. Aigner, A., Wolf, S. and Gassen, H.G. (1997) Transport und Entgiftung: Ansa¨tze und Perspektiven fu¨r die Erforschung der Blut-Hirn-Schranke. Angew. Chem. 109: 25–42. 40. Lezoualc’h, F., Skutella, T., Widmann, M. and Behl, C. (1996) Melatonin prevents oxidative stress–induced cell death in hippocampal cells. Neuroreport 7:2071–2077. 41. Reiter, R. J. (1995) Functional pleiotropy of the neurohormone melatonin: antioxidant protection and neuroendocrine regulation. Front. Neuroendocrinol. 16:383–415. 42. Aronson, M.K., Ooi, W.L., Morgenstern, H., Hafner, A., Masur, D., Crystal, H., Frishman, W.H., Fisher, D. and Katzman, R. (1990) Women, myocardial infarction, and dementia in the very old. Behav. Neural Biol. 40:1102–1106.
Estrogens and Other Antioxidants
483
43. Rocca, W., Hofman, A., Brayne, C. et al., (1991) Frequency and distribution of Alzheimer’s disease in Europe: a collaborative study of 1980–1990 prevalence findings. Ann. Neurol. 30:381–390. 44. Simpkins, J.W., Singh, M. and Bishop, J. (1994) The potential role for estrogen replacement therapy in the treatment of the cognitive decline and neurodegeneration associated with Alzheimer’s disease. Neurobiol. Aging 15:195–197(S). 45. Paganini-Hill, A. and Henderson, V.W. (1994) Estrogen deficiency and risk of Alzheimer’s disease in women. Am. J. Epidemiol. 140:256–261. 46. Tang, M.X., Jacobs, D., Stern, Y., Marder, K., Schofield, P., Gurland, B., Andrews, H. and Mayeux, R. (1996) Effect of oestrogen during menopause on risk and age of onset of Alzheimer’s disease. Lancet 348:429–432. 47. Toran-Allerand, C.D., Miranda, R.C., Bentham, W.D., Sohrabji, F., Brown, T.J., Hochberg, R.B. and MacLusky, N.J. (1992) Estrogen receptors colocalize with lowaffinity nerve growth factor receptors in cholinergic neurons of the basal forebrain. Proc. Natl. Acad. Sci. USA 89:4668–4672. 48. Jaffe, A.B., Toran-Allerand, C.D., Greengard, P. and Gandy, S.E. (1994) Estrogen metablism of Alzheimer amyloid beta precursor protein. J. Biol. Chem. 269:13065– 13068. 49. Xu, H., Gouras, G.K., Greenfield, J.P., Vincent, B., Naslund, J., Mazzarelli, L., Fried, G., Jovanovic, J.N., Seeger, M., Relkin, N.R., Liao, F., Checler, F., Buxbaum, J.D., Chait, B.T, Thinakaran, G., Sisodia, S.S., Wang, R., Greengard, P. and Gandy, S. Estrogen reduces neuronal generation of Alzheimer β-amyloid peptides. Nature Med. 4:447–451. 50. Wetzel, C.H., Hermann, B., Behl, C., Pestel, E., Rammes, G., Zieglga¨nsberger, W., Holsboer, F. and Rupprecht, R. (1998) Functional antagonism of gonadal steroids at the 5-HT3 receptor. Mol. Endocrinol. 12:1441–1451. 51. Behl, C., Widmann, M., Trapp, T. and Holsboer F. (1995) 17-β estradiol protects from oxidative stress-induced cell death in vitro. Biochem. Biophys. Res. Commun. 216:473–482. 52. Behl, C., Skutella, T., Lezoualc’h, F., Post, A., Widmann, M., Newton, C. and Holsboer, F. (1997b) Neuroprotection against oxidative stress by estrogens: structure– activity relationship. Mol. Pharm. 51:535–541. 53. Moosmann, B., Uhr, M. and Behl, C. (1997) Neuroprotective potential of aromatic alcohols against oxidative cell death. FEBS Lett. 413:467–472. 54. Sugioka, K., Shimosegawa, Y. and Nakano, M. (1987) Estrogens as natural antioxidants of membrane phospholipid peroxidation. FEBS Lett. 210:37–39. 55. Nakano, M., Sugioka, K., Naito, I., Takehoshi, S. and Niki, E. (1987) Novel and potent antioxidants on membrane phospholipid peroxidation: 2-hydroxy estrone and 2-hydroxy estradiol. Biochem. Biophys. Res. Commun. 142:919–924. 56. Liu, G.T., Zhang, T.M., Wang, B.E., Wang, Y.W. (1992) Protective action of seven natural phenolic compounds against peroxidative damage to biomembranes. Biochem. Pharmacol. 43:147–152. 57. Burton, G.W., Hughes, L. and Ingold, K.U. (1983) Antioxidant activity of phenols related to vitamin E—are three chain-breaking antioxidants better than α-tocopherol? J. Am. Chem. Soc. 105:5950–5951. 58. Christen, S., Woodall, A.A., Shigenaga, M.K., Southwell-Keely, P.T., Duncan,
484
59. 60. 61.
62. 63.
64.
65.
66. 67. 68. 69. 70.
71. 72. 73. 74.
75.
Behl and Moosmann M.W. and Ames, B.N. (1997) γ-Tocopherol traps mutagenic electrophiles such as Nox and complements α-tocopherol: Physiological implications. Proc. Natl. Acad. Sci. USA 94:3217–3222. Sies, H. and Murphy, M.E. (1991) Role of tocophenols in the protection of biological systems against oxidative damage. J. Photochem. Photobiol. B. 8, 211–218. Kappus, H. and Sies, H. (1981) Toxid drug effects associated with oxygen metabolism—xxxx cycling and lipid peroxidation. Experientia 37:1233–1241. Rendic, S. and Di Carlo, F.J. (1997) Human cytochrome P450 enzymes: a status report summarizing their reactions, substrates, inducers, and inhibitors. Drug Metab. Rev. 29:413–580. Martucci, C.P. and Fishman, J. (1993) P450 enzymes of estrogen metabolism. Pharmacol. Ther. 57:237–257. Minn, A., Ghersi-Egea, J.F., Perrin, R., Leininger, B. and Siest, G. (1991) Drug metabolizing enzymes in the brain and cerebral microvessels. Brain Res. Brain Res. Rev. 16:65–82. Leininger, B., Ghersi-Egea, J.F., Siest, G. and Minn, A. (1991) In vivo study of the elimination from rat brain of an intracerebrally formed xenobiotic metabolite, 1naphthyl-beta-d-glucuronide. J. Neurochem. 56:1163–1168. Cynshi, O., Kawabe, Y., Suzuki, T., Takashima, Y., Kaise, H., Nakamura, M., Ohba, Y., Kato, Y., Tamura, K., Hayasaka, A., Higashida, A., Sakaguchi, H., Takeya, M., Takahashi, K., Inoue, K., Noguchi, N., Niki, E. and Kodama, T. (1998) Antiatherogenic effects of the antioxidant BO-653 in three different animal models. Proc. Natl. Acad. Sci. USA 95:10123–10128. Mueller, G.C. and Kim, U.H. (1978) Displacement of estradiol from estrogen receptors by simple alkyl phenols. Endocrinology 102:1429–1435. Routledge, E.J. and Sumpter, J.P. (1997) Structural features of alkylphenolic chemicals associated with estrogenic activity. J. Biol. Chem. 272:3280–3288. Cook, J.W., Dodds, E.C. and Hewett, C.L. (1933) A synthetic oestrus-exciting compound. Nature 131:56–57. Cook, J.W. and Dodds, E.C. (1933) Sex hormones and cancer-producing compounds. Nature 131:205–206. Schneider, S.L., Alks, V., Morreal, C.E., Sinha, D.K. and Dao, T.L. (1976) Estrogenic properties of 3,9-dihydroxybenz[a)anthracene, a potential metabolite of benz[a]anthracene. J. Natl. Cancer Inst. 57:1351–1354. Yager, J.D. and Liehr, J.G. (1996) Molecular mechanisms of estrogen carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 36:203–232. Colditz, G.A. (1998) Relationship between estrogen levels, use of hormone replacement therapy, and breast cancer. J. Natl. Cancer Inst. 90:814–823. Hankinson, O. (1995) The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol. 35:397–340. Rannug, U., Rannug, A., Sjoberg, U., Li, H., Westerholm, R. and Bergman, J. (1995) Structure elucidation of two tryptophan-derived, high affinity Ah receptor ligands. Chem. Biol. 2:841–845. Harvey, R.G., Osborne, M.R., Connell, J.R., Venitt, S., Crofton-Sleigh, C., Brookes, P., Pataki, J. and DiGiovanni, J. (1985) Role of intercalation in polycyclic aromatic hydrocarbon carcinogenesis. Carcinog. Compr. Surv. 10:449–464.
Estrogens and Other Antioxidants
485
76. Baguley, B.C. (1991) DNA intercalating anti-tumour agents. Anticancer Drug Des. 6:1–35. 77. Strekowski, L., Mokrosz, J.L., Wilson, W.D., Mokrosz, M.J. and Strekowski, A. (1992) Stereoelectronic factors in the interaction with DNA of small aromatic molecules substituted with a short cationic chain: importance of the polarity of the aromatic system of the molecule. Biochemistry 31:10802–10808. 78. Cavalieri, E.L. and Rogan, E.G. (1990) Radical cations in aromatic hydrocarbon carcinogenesis. Free Radic. Res. Commun. 11:77–87. 79. Pahlman, R. and Pelkonen, O. (1987) Mutagenicity studies of different polycyclic aromatic hydrocarbons: the significance of enzymatic factors and molecular structure. Carcinogenesis 8:773–778. 80. DeFeudis, F.D. (1991) Chemical composition of Gingko biloba extract (EGb 761). In: Gingko Biloba Extract (EGb 761): Pharmacological Activities and Clinical Applications, Elsevier, Paris, pp. 9–24. 81. Dunnick, J.K. and Hailey, J.R. (1992) Toxicity and carcinogenicity studies of quercetin, a natural component of foods. Fundam. Appl. Toxicol. 19:423–431. 82. Terao, J., Piskula, M. and Yao, Q. (1994) Protective effect of epicatechin, epicatechin gallate, and quercetin on lipid peroxidation in phospholipid bilayers. Arch. Biochem. Biophys. 308:278–284. 83. Canada, A.T., Giannella, E., Nguyen, T.D. and Mason, R.P. (1990) The production of reactive oxygen species by dietary flavonols. Free Radic. Biol. Med. 9:441–449. 84. Dickancaite, E., Nemeikaite, A., Kalvelyte, A. and Cenas, N. (1998) Prooxidant character of flavonoid cytotoxicity: structure–activity relationships. Biochem. Mol. Biol. Int. 45:923–930. 85. Beretz, A., Anton, R. and Stoclet, J.C. (1978) Flavonoid compounds are potent inhibitors of cyclic AMP phosphodiesterase. Experientia 34:1054–1055. 86. Fauconneau, B., Waffo-Teguo, P., Huguet, F., Barrier, L., Decendit, A. and Merillon, J.-M. (1997) Comparative study of radical scavenger and antioxidant properties of phenolic compounds from vitis vinifera cell cultures using in vitro tests. Life Sci. 61:2103–2110. 87. Soleas, G.J., Diamandis, E.P. and Goldberg, D.M. (1997) Resveratrol: a molecule whose time has come? And gone? Clin. Biochem. 30:91–113. 88. Jang, M., Cai, L., Udeani, G.O., Slowing, K.V., Thomas, C.F., Beecher, C.W.W., Fong, H.H.S., Farnsworth, N.R., Kinghorn, A.D., Mehta, R.G., Moon, R.C. and Pezzuto, J.M. (1997) Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275:218–220. 89. Gehm, B.D., McAndrews, J.M., Chien, P.-Y. and Jameson, J.L. (1997) Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor. Proc. Natl. Acad. Sci. USA 94:14138–14143. 90. Sano, M., Ernesto, C., Thomas, R.G. et al. (1997) A controlled trial of selegiline, alpha-tocopherol, or both as treatment for Alzheimer’s disease. N. Engl. J. Med. 336:1216–1222.
23 Therapeutic Potential of Radical Scavengers in Parkinson’s Disease Silvia Mandel, Edna Gru¨nblatt, and Moussa B. H. Youdim Technion Faculty of Medicine, Haifa, Israel
I. PARKINSON’S DISEASE AND REACTIVE OXYGEN SPECIES Free radicals and other reactive oxygen species (ROS) are formed as side products of oxygen metabolism in every aerobic organism. Acceptance of a single electron by an oxygen molecule forms the superoxide radical, O2⫺, which has an unpaired electron. Superoxide is formed in vivo in a variety of ways. A major source is the mitochondrial electron transport chain. The electrons passing through this chain are captured by O2 leading to water as the end-product. Because O2 accepts one electron at a time, O2⫺ is formed. Efficient antioxidant systems have been developed to prevent uncontrolled free radical formation before they can cause damage to cellular structures (Fig. 1). Superoxide dismutase is involved in detoxification by dismutation of O2⫺ to hydrogen peroxide (H2O2), which is rapidly converted to water by the reducing enzymes catalase or glutathione peroxidase (1–3). When the balance between the production of oxygen-derived species, such as O2⫺ and H2O2, and antioxidant defenses against them is disturbed, competing mechanisms can lead to abnormal levels of these molecules. H2O2 can react with ferrous ion (Fe2⫹) to undergo Fenton-type activation, giving rise to the highly cytotoxic hydroxyl radical (OH•), as schematized in Figure 1. Dopamine (DA) neurons within the substantial nigra may be particularly vulnerable to oxidant stress. Autooxidation or monoamine oxidase (MAO)–catalyzed DA oxidation could increase the likelihood of H2O2 formation with consequent OH• production, by means of iron-catalyzed Fenton reaction. Indeed, postmortem studies conducted in brain from parkinsonian patients indicate that a state of oxidant stress exists in the substantial nigra pars compacta, as manifested by 487
488
Figure 1 neurons.
Mandel et al.
Biochemical reactions hypothesized to cause oxidative stress in dopaminergic
increased levels of brain lipid hydroperoxides, accumulation of iron, and decreased levels of glutathione, the primary mechanism for clearing peroxides in the brain. Catecholamines may also interfere with the cellular oxygen metabolism in several ways including their MAO metabolic transformation which leads to formation of H2O2. In addition, they also may undergo autooxidation in the presence of iron to generate H2O2, O2⫺, and reactive quinones and semiquinones. Furthermore, catecholamines and their metabolites, as well as neuromelanin, are excellent iron chelators and are capable of maintaining the low molecular weight iron (Fe3⫹) pool. On the other hand, neuromelanin reduces Fe3⫹ to Fe2⫹ thus releasing Fe2⫹ back into the cytosol (4). The reaction between H2O2, iron, and DA may be a source of endogenous 6-hydroxydopamine (6-OHDA) formation. This risk is increased in Parkinson’s disease (PD) where the concentrations of iron in the striatum are relatively high. 6-OHDA by itself liberates iron from ferritin (5). In addition, 6-OHDA, as well as DA, have been shown to inhibit complex I and IV of the mitochondrial respiratory chain (6,7).
II. POTENTIAL STRATEGIES FOR RADICAL SCAVENGING Several evidences in the literature support the notion of oxidative stress as a critical factor contributing to the destruction of DA-producing neurons in PD.
Radical Scavengers in Parkinson’s Disease
489
Based on this assumption, neuroprotective strategies have been designed to interfere with this mechanism and retard the progression of the disease. Some of them include iron chelators, MAO-B inhibitors, radical scavengers, dopamine agonists, and normal endogenous antioxidants. They are considered below. A.
Iron Chelators
One of the main pathological features of PD is the appearance of abundant deposition of iron at the site of neurodegeneration, but the basis of the increased iron levels remains unclear (8). Iron has the capacity to promote oxidation reactions and the formation of cytotoxic free radicals (9). A marked increase in the concentration of iron in affected brain areas has been confirmed for PD, Huntington’s disease, supra nuclear palsy, multiple system atrophy, as well as Alzheimer’s disease (10). The late state of PD is characterized by an accumulation of iron in substantia nigra pars compacta (11). This raises the possibility that therapies designed to chelate iron and prevent it from participating in oxidation reactions may protect vulnerable neurons and slow the rate of disease progression in patients suffering from neurodegenerative disorders. Iron chelators have been demonstrated to effectively prevent iron-catalyzed reactions from taking place and to correspondingly limit free radical formation and tissue injury (6,12). An iron chelator with therapeutic potential must be able not only to bind iron but to lower its redox reactivity (12). In that respect, desferrioxamine mesylate (Desferal) appears to fulfill this requisite: it combines iron chelation with antioxidant properties. Furthermore it protects complex I of the mitochondrial respiratory chain against inhibition by 6-OHDA (13), an effect being completely unrelated to its iron chelation properties or antioxidant activity. In vivo and in vitro studies with Desferal revealed a possible clinical application in the therapy of ischemia/reperfusion (14). Given the high potential of Desferal, other iron chelators have been developed and tested, though only for non-CNS indications, such as the hydroxypyridone-type-iron chelators deferiprone (CP20) and CP22 (for review, see Ref. 12). There has been considerable interest in the 21 aminosteroids, or lazaroid group of drugs, which show both iron chelating and radical scavenging properties (15). Clinical trials of lazaroids have been initiated for cerebral hemorrhage and spinal cord injury, but whether iron chelation really makes a significant contribution to their pharmacological profile has not yet been documented. d-Penicillamine is an effective therapy for Wilson’s disease. While its effect has been related mainly to chelation of copper, it also is capable of binding iron (16,17). Thus, it is possible that some of the benefits observed are related to this latter property. Although these data suggest a therapeutic potential of ironchelating substances, no clear-cut clinical evidence for a beneficial effect on neurodegenerative diseases has been provided. In considering the initiation of clinical trials of iron chelators in humans, a note of caution is warranted. Patients that have received desferrioxamine given in combination with neuroleptics, in order
490
Mandel et al.
to facilitate access into the blood–brain barrier, exhibited cerebral and ocular toxicity (18). Thus, the emphasis should be directed to development of novel, centrally acting, nontoxic iron chelators. B.
Dopamine Agonists
There are several possible mechanisms by which DA agonists might provide neuroprotection: (1) an l-dopa sparing effect; (2) stimulation of DA autoreceptors; (3) direct antioxidant effect; and (4) inhibition of subthalamic nucleus–induced neurotoxicity (for review, see Ref. 19). During the past decade there has been increasing interest in the use of DA agonists in the early stages of PD because of reduced levodopa (l-dopa)–related motor disabilities when given alone or in combination with l-dopa (20–22). Monotherapy with two new DA agonists, pramipexole and ropinirole, was shown to be efficient in early Parkinson’s disease (23,24). In addition, patients receiving lisuride alone showed a significant lengthening of the period before initiation of l-dopa therapy (25), to a similar extent as has been reported for the MAO-B inhibitor l-Deprenyl in the DATATOP study (26). The relatively new concept of looking at DA agonists as neuroprotectants derives from previous observations that l-dopa can potentially increase H2O2 levels and the risk for OH• formation, through its enzymatic decarboxylation or autooxidation to DA, that might accelerate neuronal degeneration in PD (1,27). In addition, DA itself can induce oxidative stress both in vivo and in vitro (28,29) and initiate apoptosis in cultured dopaminergic neurons (30). The neuroprotective effect of DA agonists is manifested by their ability to protect dopaminergic cell loss in a number of model systems. In vivo treatment of mice with pramipexole, a new DA agonist, protected against methamphetamine-induced loss of nigral dopaminergic neurons (31). Similarly, pretreatment of mice with bromocriptine blocked 6-OHDA and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)–induced DA loss (32,33), and glutathione depletion in substantia nigra (33), and protected against ischemia-induced hippocampal neuronal damage in the mongolian gerbil—this last effect presumably via a preservation of the superoxide radical scavenger enzyme superoxide dismutase (34). We have recently found that pretreatment of mice with apomorphine (APO), a DA agonist sharing potent radical scavenger and iron chelator properties, almost completely prevented MPTP-induced striatal DA loss (35) (Fig. 2) and glutathione depletion (Fig. 3). Previous in vitro studies conducted by us have shown that APO is a highly potent radical scavenger, inhibiting rat mitochondrial lipid peroxidation at submicromolar concentrations (36). In addition, it protected rat pheochromocytoma (PC12) cells from the toxic effects of H2O2 and 6-OHDA (37). Given together, these findings raise the hypothetical possibility that dopaminergic agonists might exert antioxidant and radical scavenger properties in addition to their known dopamine receptor activation, which
Radical Scavengers in Parkinson’s Disease
491
Figure 2 Effect of APO on striatal DA and 3,4-dihydroxyphenylacetic acid (DOPAC) content. Mice were injected with APO (5 and 10 mg/kg) followed by a dose of MPTP (24 mg/kg) once daily for 5 days. Controls received saline or APO only. Striatal DA and DOPAC were measured by HPLC. MPTP-treated animal differed significantly (a/c) from the control group (ANOVA; p ⬍ 0.001/p ⬍ 0.05). APO-treated and APO ⫹ MPTP-treated groups differed significantly (b/d) from the MPTP-treated group (ANOVA; p ⬍ 0.001/ p ⬍ 0.05). The results represent the mean ⫾ SEM of a representative experiment that was repeated twice, each group consisting of 8–10 mice (35).
may account for their protective effect. Indeed, an increasing body of evidence has accumulated during recent years suggesting that dopamine agonists possess antioxidant and radical scavenger attributes. Recently, bromocriptine, a D2 receptor agonist and an antiparkinsonian agent, was shown to scavenge superoxide and hydroxyl radicals both in vitro (32,33,38) and in vivo (33), and to inhibit autooxidation of rat brain homogenates in vitro (38). In addition, pergolide (an-
492
Mandel et al.
Figure 3 Effect of R-APO on striatal GSH and oxidized glutathione (GSSG) content and the ratio of GSSG over total glutathione. C57-BL mice were injected with R-APO (10 mg/kg/day for 5 days) followed by a dose of MPTP (24 mg/kg/day for 5 days). Controls received saline or R-APO only. Striatal GSH and GSSG were measured by HPLC. The results represent the mean ⫾ SEM (n ⫽ 8–10 mice). The absolute concentrations of GSH and GSSG in control groups are 1.33 and 0.13 nmol/mg tissue, respectively. ANOVA; *p ⬍ 0.05 vs. control, **p ⬍ 0.001 vs. MPTP.
other ergot-derived DA agonist) and, to a lesser extent, bromocriptine were shown to scavenge nitric oxide radicals in vitro (39), though in our hands pergolide was practically ineffective in protecting ferrum-induced lipid peroxidation of brain mitochondrial membranes (36). In addition to their direct antioxidant effects, stimulation of presynaptic D2 autoreceptors by DA agonists has the potential to decrease DA synthesis, thereby contributing also to reduced generation of radical oxidative species (ROS). 1.
Apomorphine: Pro and Antioxidant Properties
During recent years the mixed-type dopamine D1 /D2 receptor agonist APO has been used as a replacement for l-dopa in the therapy of PD in the late stage of
Radical Scavengers in Parkinson’s Disease
493
the disease (40). However, its rapid metabolism and pharmacokinetics constitutes a limiting factor in therapy. This disadvantage has been overcome by the use of a continuous self-injector system (40). Recent clinical studies have indicated that long-term treatment with APO can wean the patient from l-dopa (41,42). These results have been interpreted as indicating either the necessity of continuous D1 /D2 dopamine receptor stimulation or possible neuroprotection in order to achieve a better therapeutic response (36,37). APO is a catechol-derived compound; thus it is easily oxidizable and can therefore react with ROS (for review, see Ref. 43). Indeed, our previous studies have shown that R-APO and its S enantiomer are highly potent radical scavengers (as shown by their inhibition of Fe/ascorbate-induced peroxidation of mitochondrial lipids) and iron chelators, displaying submicromolar IC50 values of 0.2 – 0.5 µM. APO also reduced formation of protein carbonyls (36). Since APO is readily autooxidized, this oxidation reflects the protection of mitochondrial lipids. Thus, there is an inverse correlation between APO autooxidation and thiobarbituric acid reactive substance formation. APO was found to be more potent than DA by a factor of 20 in inhibition of lipid peroxidation in this system, while pergolide, a non-catechol-related compound, showed no significant effect (36). The antioxidant properties of APO were further assessed on H2O2 and 6-OHDA-treated PC12 culture. APO conferred a concentration-dependent protection, with a maximal cell survival being achieved with 5 µM APO after H2O2 insult and with 1µM APO after 6-OHDA. APO was also cytotoxic by itself with LD50 ⫽ 50 µM (37). This leaves a narrow window for the cytoprotective effect. We have recently conducted an in vivo study with APO given at various concentrations to MPTP-treated mice. Pretreatment of R-APO protected against MPTP-induced loss of nigrostriatal DA neurons, as indicated by striatal dopamine content (Fig. 2), tyrosine hydroxylase content (Fig. 4), and activity (Fig. 5). Also, in vitro, APO inhibited mice striatal MAO-A and MAOB activities (35). The mechanism of action of APO is best explained by its antioxidant, radical scavenging, and iron chelating properties, since both S enantiomer (which is not a DA agonist) and R-APO share the same properties. However, additional in vivo studies with S-APO are required to separate between the radical scavenging activity and dopaminergic effects of R-APO. C.
Vitamin E
Classical free radical scavengers like vitamin E (α-tocopherol) and ascorbic acid react easily with ROS, thus protecting biological structures from oxidation. Vitamin E (an endogeneous phenol derivative) was the first antioxidant to be studied as a neuroprotective agent. The rationale for its use has been that a sustained use of α-tocopherol might scavenge oxygen radicals and thus interrupt the progression of the disease. In 1987 a clinical trial named DATATOP (Deprenyl and Tocopherol Antioxidative Therapy of Parkinsonism) was initiated for the evalua-
494
Mandel et al.
Figure 4 Western blot analysis of striatal TH from APO-treated mice. Striatal halves from Figure 2 mouse brains were homogenized and 25 µg protein was electrophoresed on 10% SDS-polyacrylamide gel. Each lane represents a pool of two animals. (A) TH bands were detected with mouse anti-TH monoclonal antibody followed by exposure to horseradish peroxidase–conjugated antibodies directed against mouse IgG. Immunoreactive bands were visualized by chemiluminescence. (B) Densitometric analysis: the values are the mean ⫾ SEM of four or five bands per group. Optical density in arbitrary units. ANOVA; a p ⬍ 0.001, b p ⬍ 0.01 vs. control; c p ⬍ 0.001, d p ⬍ 0.05 vs. MPTP. (From Ref. 35.)
tion of disabilities and signs of idiopathic parkinsonian patients receiving placebo, α-tocopherol, l-Deprenyl, or a combination of the two drugs (26). Unfortunately, despite its potent antioxidant effect in vitro, there are no clinical data supporting a promising use in the treatment of PD (44). D.
MAO-B Inhibitors
Selective MAO-B inhibitors such as selegiline are used in PD in conjuction with l-dopa to block metabolism of DA, thereby enhancing the levodopa effect. The
Radical Scavengers in Parkinson’s Disease
495
Figure 5 TH activity in R-APO (10 mg/kg)–treated mice. Mice striatal homogenates from Fig. 4 were analyzed for TH activity. The results represent the mean ⫾ SEM (n ⫽ 8–10 mice). ANOVA; a p ⬍ 0.001, b p ⬍ 0.01 vs. MPTP; c p ⬍ 0.01 vs. control.
rationale for MAO inhibition in PD as a neuroprotective strategy is based first on an indirect antioxidant effect of MAO-B inhibitors that might come from limitation of formation of H2O2 , derived from the oxidative metabolism of DA, thereby minimizing the risk of OH⋅ and cell degeneration. In addition to this MAO inhibition–mediated effect, experimental studies conferred some neuroprotective properties to these compounds that are unrelated to their ability to block MAO. These effects might possibly implicate antioxidant as well as antiapoptotic actions (45). Selegiline has been shown to increase levels of a variety of antioxidant molecules including SOD, catalase, reduced glutathione (GSH), and glutathione peroxidase (46–48). In vitro, selegiline was shown to protect DA neurons from toxicity induced by 1-methyl-4-phenylpyridine (49) and by glutathione deficiency (50). However, whether these neuroprotective actions are relevant in PD remains to be elucidated and might require additional clinical trials.
496
III.
Mandel et al.
CONCLUSIONS
During the past years, an increasing body of information has been accumulated that points to a state of ongoing oxidative stress in the brain of parkinsonian patients. Antioxidant strategies directed to inactivate or inhibit free radical formation are the focus of attention. Possible neuroprotective strategies include free radical scavengers, MAO-B inhibitors, nitric oxide scavengers, iron chelators, and physiological antioxidants. Restorative therapies using DA or neurotrophic factors producing cells grafted into the host brain are under intense investigation. Also, novel strategies might include interference with oxidative stress–related signal transduction processes, such as altering the activation pathway of nuclear factor κB (51). We have recently shown that the dopamine receptor agonist apomorphine, is a very potent antioxidant and iron chelator in vitro and exerts neuroprotective properties both in vivo and in vitro. Whether the neuroprotective effects of dopamine agonists and MAO-B inhibitors are a result of a direct antioxidant effect in PD remains to be demonstrated and requires development of biological markers and more sophisticated techniques directed to follow brain degeneration and neuroprotection of parkinsonian patients.
REFERENCES 1. Halliwell, B. and Gutteridge, J. (1985). Oxygen radicals and the nervous system. Trends Neurol. Sci. 8:22–29. 2. Gotz, M.E., Kunig, G., Riederer, P. and Youdim, M. B. H. (1994). Oxidative stress: free radical production in neural degeneration. Pharmacol. Ther. 63:37–122. 3. Gerlach, M., Riederer, P. and Youdim, M.B.H. (1996). Molecular mechanisms for neurodegeneration. Synergism between reactive oxygen species, calcium and excitotoxic amino acids. Adv. Neurol. 69:177–194. 4. Riederer, P., Dirr, A., Goetz, M., Sofic, E., Jellinger, K. and Youdim, M.B. (1992). Distribution of iron in different brain tissues and subcellular compartments in Parkinson’s disease. Ann. Neurol. 32 (suppl):S101–S104. 5. Dexter, D.T., Jenner, P., Schapira, A.H.V. and Marsden, C.D. (1992). Alterations in levels of iron, ferritin and other trace metals in neurodegenerative diseases affecting the basal ganglia. The Royal Kings and Queens Parkinson’s Disease Research Group. Ann. Neurol. 32 (suppl):S94–S100. 6. Ben Shachar, D., Eshel, G., Finberg, J.P. and Youdim, M.B. (1991). The iron chelator desferrioxamine (Desferal) retards 6-hydroxydopamine-induced neurodegeneration of nigrostriatal DA neurons. J. Neurochem. 56:1441–1444. 7. Ben Shachar, D., Zuk, R. and Glinka, Y. (1995). Dopamine neurotoxicity: inhibition of mitochondrial respiration. J. Neurochem. 64:718–723. 8. Riederer, P., Sofic, E., Rausch, W.D., Jellinger, K., and Youdim, M.B. (1989). Transition metals, ferritin, glutathione and ascorbic acid in parkinsonian brains. J. Neurochem. 52:515–520.
Radical Scavengers in Parkinson’s Disease
497
9. Youdim, M.B., Ben Shachar, D., and Riederer, P. (1993). The possible role of iron in the etiopathology of Parkinson’s disease. Mov. Disord. 8:1–12. 10. Gerlach, M., Ben Schachar, D., Riederer, P., Youdim, M.B. (1994). Altered brain metabolism of iron as a cause of neurodegeneration diseases? J. Neurochem. 63: 793–807. 11. Sofic, E., Paulus, W., Jellinger, K., Riederer, P. and Youdim, M.B. (1991). Selective increase of iron in substantia nigra zona compacta of parkinsonian brains. J. Neurochem. 56:978–982. 12. Gassen, M. and Youdim, M.B. (1997). The potential role of iron chelators in the treatment of Parkinson’s disease and related neurological disorders. Pharmacol. Toxicol. 80:159–166. 13. Glinka, Y., Tipton, K.F. and Youdim, M.B. (1996). Nature of inhibition of mitochondrial respiratory complex I by 6-hydroxydopamine. J. Neurochem. 66:2004–2010. 14. Marx, J.J. and van Asbeck B.S. (1996). Use of iron chelators in preventing hydroxyl radical damage: adult respiratory distress syndrome as an experimental model for the pathophysiology and treatment of oxygen-radical-mediated tissue damage. Acta Haematol. 95:49–62. 15. Hall, E.D. and McCall, J.M. (1993). Lazaroids: Potent inhibitors of iron-dependent lipid peroxidation for neurodegenerative disorders. In: Iron in Central Nervous System Disorders (Riederer P. and Youdim, M.B.H., eds.) Springer-Verlag, Wien, pp. 173–188. 16. Muller, A., Straube, M., Krickemeyer, E. and Bogge, H. (1992). Isolation of the first crystalline D-Penicillamine complex of iron and some remarks on relevant aspects of metal-chelating drugs as well as metabolism disorders. Naturwissenschaften 79: 323–325. 17. Kostiuk, V.A., Potapovich, A.I. and Soroka, N.F. (1990). Antioxidative activity of antiarthritic preparations. Vopr. Med. Khim. 36:37–39. 18. Blake, D.R., Winyard, P., Lunec, J., Williams, A., Good, P.A., Crewes, S.J., Gutteridge, J.M., Rowley, D., Halliwell, B. and Cornish, A. (1985). Cerebral and ocular toxicity induced by desferrioxamine. Q. J. Med. 56:345–355. 19. Olanow, C.W., Jenner, P. and Brooks, D. (1998). Dopamine agonists and neuroprotection in Parkinson’s disease. Ann. Neurol. 44(suppl.):S167–174. 20. Olanow, C.W. (1992). A rationale for dopamine agonists as primary therapy for Parkinson’s disease. Can. J. Neurol. Sci. 19:108–112. 21. Montastruc, J.L., Rascol, O., Serard, J.M. and Rascol, A.A. (1994). A randomised controlled study comparing bromocriptine to which levodopa was later added, with levodopa alone in previously untreated patients with Parkinson’s disease: a five year follow up. J. Neurol. Neurosurg. Psychiatry 57:1034–1038. 22. Zimmerman, T. and Sage, J.I. (1991). Comparison of combination pergolide and levodopa to levodopa alone after 63 months of treatment. Clin. Neuropharmacol. 14:165–169. 23. Adler, C.H., Sethi, K.D., Hauser, R.A., Davis, T.L., Hammerstad, J.P., Bertoni, J., Taylor, R.L., Sanchez-Ramos, J. and O’Brien, C.F. (1997). Ropinirole for the treatment of early Parkinson’s disease. The Ropinirole Study Group. Neurology 49:393– 399. 24. Parkinson Study Group. (1997). Safety and efficacy of pramipexole in early Parkinson’s disease. JAMA 278:125–130.
498
Mandel et al.
25. Runge, I. and Horowski R. (1991). Can we differentiate symptomatic and neuroprotective effects in Parkinsonism? The dopamine agonist lisuride delays the need for levodopa to a similar extent as reported for deprenyl. J. Neural Transm. Park. Dis. Dement. Sect. 3:273–283. 26. Parkinson Study group. (1989). DATATOP: a multicenter controlled clinical trial in early Parkinson’s disease. Arch. Neurol. 46:1052–1060. 27. Olanow, C.W. (1990). Oxidation reactions in Parkinson’s disease. Neurology 40: 32–37. 28. Chieuh, C.C., Krishna, G., Tulsi, P., Obata, T., Lang, K., Huang, S.J. and Murphy, D.L. (1992). Intracranial microdialysis of salicylic acid to detect hydroxyl radical generation through dopamine autooxidation in the caudate nucleus: effects of MPP⫹. Free Rad. Biol. Med. 13(5):581–583. 29. Spencer, J.P., Jenner, A., Butler, J., Aruoma, O.I., Dexter, D.T., Jenner, P. and Halliwell, B. (1996). Evaluation of the pro-oxidant and antioxidant actions of L-DOPA and dopamine in vitro: implications for Parkinson’s disease. Free Rad. Res. 24(2): 95–105. 30. Ziv, I., Melamed, E., Nardi, N., Luria, D., Achiron, A., Offen D. and Barzilai, A. (1994). Dopamine induces apoptosis-like cell death in cultured chick sympathetic neurons-a possible novel pathogenetic mechanism in Parkinson’s disease. Neurosci. Lett. 170(1):136–40. 31. Hall, E.D., Andrus, P.K., Oostveen, J.A., Althaus, J.S. and Voigtlander, P.F. (1996). Neuroprotective effect of the D2 /D3 agonist pramipexole against postischemic and methamphetamine-induced degeneration of nigrostriatal neurons. Brain Res. 742: 80–88. 32. Ogawa, N., Tanaka, K., Asanuma, M., Kawai, M., Mazumiso, T., Kohno, M. and Mori, A. (1994). Bromocriptine protects mice against 6-hydroxydopamine and scavenges hydroxyl free radicals in vitro. Brain Res. 657 (1–2):207–213. 33. Muralikrishnan, D. and Mohanakunar, K.P. (1998). Neuroprotection by bromocriptine against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurotoxicity in mice. FASEB J. 12:905–912. 34. Liu, X.H., Kato, H., Chen, T., Kato, K. and Itoyama, Y. (1995) Bromocriptine protects against delayed neuronal death of hippocampal neurons following cerebral ischemia in the gerbil. J. Neurol. Sci. 129:9–14. 35. Grunblatt, E., Mandel, S., Berkuzki, T. and Youdim, M.B.H. (1999). Apomorphine protects against MPTP-induced neurotoxicity in mice. Mov. Disord. 14:612–618. 36. Gassen, M., Glinka, Y., Pinchasi, B. and Youdim, M.B.H. (1996). Apomorphine is a highly potent free radical scavenger in rat brain mitochondrial fraction. Eur. J. Pharmacol. 308:219–225. 37. Gassen, M., Gross, A. and Youdim, M.B.H. (1998). Apomorphine enantiomers protect cultured pheocromocytoma (PC 12) cells from oxidative stress induced by H2O2 and 6-hydroxydopamine. Mov. Disord. 13:242–248. 38. Yoshikawa, T., Minamiyama, Y., Naito, Y. and Kondo, M. (1994). Antioxidant properties of bromocriptine, a dopamine agonist. J. Neurochem. 62(3):1034–1038. 39. Nishibayashi, S., Asanuma, M., Kohno, M., Gomez-Vargas, M. and Ogawa, N. (1996). Scavenging effects of dopamine agonists on nitric oxide radicals. J. Neurochem. 67:2208–2211.
Radical Scavengers in Parkinson’s Disease
499
40. Gancher, S.T., Nutt, J.G. and Woodward, W.R. (1995). Apomorphine infusional therapy in Parkinson’s disease: clinical utility and lack of tolerance. Mov. Disord. 10:37–43. 41. Lees, A.J. (1993). Dopamine agonists in Parkinson’s disease: a look at apomorphine. Fun. Clin. Pharmacol. 7:121–128. 42. Colzi, A., Turner, K. and Lees, A.J. (1998). Continuous subcutaneous waking day apomorphine in the long term treatment of levodopa induced interdose dyskinesias in Parkinson’s disease. J. Neurol. Neurosurg. Psychiatry 64(5):573–576. 43. Gassen, M. and Youdim, M.B.H. (1999). Free radical scavengers: chemical concepts and clinical relevance. J. Neural Transm. 56:193–210. 44. LeWitt, P.A. (1994). Clinical trials of neuroprotection in Parkinson’s disease: longterm selegiline and alpha-tocopherol treatment. J. Neural Transm. (suppl.) 43:171– 181. 45. Tatton, W.G. and Chalmers-Redman, R.M. (1996). Modulation of gene expression rather than monoamine oxidase inhibition: (⫺)-deprenyl-related compounds in controlling neurodegeneration. Neurology 47(suppl.): S171–183. 46. Clow, A,. Hussain, T., Glover, V., Sandler, M., Dexter, DT. and Walker. M. (1991). (⫺)Deprenyl can induce soluble superoxide dismutase in rat striata. J. Neural Transm. Gen. Sect. 86(1):77–80. 47. Carrillo, M.C., Ivy, G.O., Milgram, N.W., Head, E., Wu, P. and Kitani, K. (1994). (⫺). Deprenyl increases activities of superoxide dismutase (SOD) in striatum of dog brain. Life Sci. 54(20):1483–1489. 48. Kushleika, J., Checkoway, H., Woods, J.S., Moon, J.D., Smith-Weller, T., Franklin, G.M. and Swanson, P.D. (1996). Selegiline and lymphocyte superoxidase dismutase activities in Parkinson’s disease. Ann Neurol. 39(3):378–381. 49. Mytilineou, C. and Cohen, G. (1985). Deprenyl protects dopamine neurons from the neurotoxic effect of 1-methyl-4-phenylpyridinium ion. J. Neurochem. 45(6):1951– 1953. 50. Mytilineou, C., Leonardi, E.K., Radcliffe, P., Heinonen, E.H., Han, S.K., Werner, P., Cohen, G. and Olanow, C.W. (1998). Deprenyl and desmethylselegiline protect mesencephalic neurons from toxicity induced by glutathione depletion. J. Pharmacol. Exp. Ther. 284(2):700–706. 51. Tong, L., Toliver-Kinsky, T., Taglialatela, G., Werrbach-Perez, K., Wood, T. and Perez-Polo, J.R. (1998). Signal transduction in neuronal death. J. Neurochem. 71(2): 447–459.
24 Vitamin E and Other Antioxidant Treatments for the Neurobehavioral Aspects of Alzheimer’s Disease and Other Neurodegenerative Diseases Fadi Massoud, Mario Schittini, and Mary Sano Columbia University, New York, New York
I. INTRODUCTION There is a growing body of evidence suggesting that oxidative stress plays a key role in the pathophysiology of neurodegenerative disease (1–6). Reactive oxygen species (ROS), including free radicals, are produced as a result of normal and aberrant cellular reactions (7–10). ROS are known to cause neuronal cell damage by way of three main mechanisms: protein oxidation, DNA oxidation, and lipid peroxidation. The major ROS are superoxide anions, hydroxyl radical, and hydrogen peroxide (10). Antioxidative defense mechanisms exist to protect against the effects of ROS. These include enzyme systems (catalase, glutathione peroxidase, superoxide dismutase, and quinone reductase) and antioxidant vitamins (vitamins A, C, and E). Evidence suggests that these free radical scavenger systems lose efficiency with aging and that this age-associated increase in oxidative stress plays a major role in neurodegenerative processes (11). In addition, these mechanisms may play a role in neurodegenerative diseases not associated with aging. In Alzheimer’s disease (AD), the primary cause of dementia in the elderly, several lines of evidence seem to support the roles of oxidative stress in the pathophysiology of the disease (12,13). Elevation of iron, aluminum, and mercury in the brains of AD patients stimulate the production of hydroxyl radicals and lipid peroxidation (14–17). Markers of oxidative stress are increased in brains of AD patients as shown by increased protein oxidation (18,19), alterations in 501
502
Massoud et al.
brain phospholipids (20–23), and varied patterns of free radical scavenger enzymes (23–27). These markers are also associated with neurofibrillary tangles and senile amyloid plaques, the histopathological markers of AD (28–31). Several oxidative hypotheses have been proposed in the pathophysiology of Parkinson’s disease, a movement disorder that results from the degeneration of dopaminergic neurons in the substantia nigra (SN) (10,32–34). Monoamine oxidase (MAO), an enzyme whose activity increases with aging, catabolizes dopamine producing hydrogen peroxide, an ROS (35,36). A decrease in polyunsaturated fatty acids, which are very vulnerable to free radicals, and an increase in lipid hydroperoxides (37) have been interpreted as the result of oxidative damage. Catecholamines in the SN react with oxygen to form hydrogen peroxide and oxy radicals (38), and dopamine itself seems to induce cell death by an oxidative pathway in rat models (39). The SN is also very rich in iron, enhancing hydroxyl radical formation (1). Finally, the activity of glutathione peroxidase and concentrations of glutathione, both involved in antioxidative protective processes, were reduced in a neuropathological study of Parkinson’s disease (40). Huntington’s disease is a dominantly inherited movement disorder characterized by chorea, psychiatric manifestations, and cognitive deficits late in the disease resulting from a mutation in a gene on the short arm of chromosome 4. Neuronal loss is restricted to the spiny striatal neurons, which depend on the γ-aminobutyric acid (GABA) neurotransmitter (41). Pathophysiology involves dysfunction of glutamate neurotransmission mediated by the the N-methyl-dasparate (NMDA) receptor (excitotoxicity) (42–46) and mitochondrial energy defects (47–50), both of which lead to increased production of free radicals. Finally, one of the mechanisms of neurotoxicity associated with cerebrovascular diseases (including stroke and vascular dementia) is also thought to be mediated via the excitotoxic pathway of glutamate (1,49,51,52). Activation of this pathway results in the generation of ROS and may be amenable to antioxidant treatment (53,54). The role of ROS in the pathophysiology of these neurological diseases suggests that the reduction of oxidative stress by pharmacological interventions may slow or halt the rate of neurodegenaration. The late onset of some of these diseases further implies that the cumulative damage occurs over a prolonged period of time, and that the best results would be achieved with early and prolonged interventions. In this chapter, we discuss the results of observational studies and clinical trials with antioxidant agents in relation to the neurobehavioral manifestations of Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, and vascular dementia. Typically, clinical trials with other classes of agents have focused on improvement of these aspects of disease (symptomatic treatment). However, given their hypothesized mechanisms of action, it is more likely that antioxidants will show stabilization in the process of disease rather than improvement in symptoms, and clinical trial designs will be evaluated for their
Vitamin E and Alzheimer’s Disease
503
ability to assess clinical course rather than symptomatic benefit. A major emphasis will be placed on randomized, double-blind, placebo-controlled trials of 6 months or longer.
II. ANTIOXIDANT VITAMINS Vitamins A, C, and E represent the main exogenous sources of antioxidant protection. They are efficient free radical scavengers that act by converting free radicals into less damaging compounds, hence avoiding their deleterious effects (55,56). Studies based on dietary histories have shown that people with diets high in antioxidant vitamins tend to be protected against certain neurodegenerative diseases. Other studies have also shown that patients who have decreased blood levels of these vitamins are more prone to some of these diseases than healthy controls. This, however, does not imply automatically that vitamins taken as dietary supplements will provide equivalent protection. Diets rich in fruits and vegetables contain myriads naturally occurring antioxidants, which may be more efficient and possibly essential coadjuvants to these vitamins (57,58). Furthermore, diets rich in antioxidant vitamins may be a marker for other potentially unknown protective lifestyle practices, which can systematically bias the results of such studies (59). A.
Alzheimer’s Disease
Studies on dietary intake of antioxidant vitamins, vitamin levels in the plasma, cerebrospinal fluid, and brain of patients with AD have provided conflicting results. The Rotterdam Study, a cross-sectional analysis, examined the relationship between the intake of the dietary antioxidants beta-carotene and vitamins C and E, and cognitive function in a community-based sample (60). After adjustment for potential confounders, a statistically significant association was found between a lower intake of beta-carotene (but not vitamins C and E) and impaired cognitive function. Three traditional cross-sectional studies found no association between vitamin E intake (60) or vitamin E plasma and serum levels (61,62) and cognitive function in elderly people, although plasma levels of vitamins A and C were found to predict superior memory in one of the studies (62). Several design issues need to be considered when interpreting the results of such cross-sectional approaches: the difficulty in establishing a temporal relationship between exposure and outcome, the potential unreliability of dietary data among cognitively impaired subjects, and the possible intervention of unmeasured confounders (60). In a case-control study, Zaman et al. (63) have shown that serum levels of vitamins A and E were significantly lower in patients with AD than in controls. Another case-control study (64) evaluated lipid peroxidation products and de-
504
Massoud et al.
fenses against free radical damage in 55 patients with AD and 24 age-matched controls. There was a statistically significant decrease in the serum levels of vitamins A, C, and E among other things in the AD group. However, most of the deficiencies were found in the malnourished subgroup of the AD patients. Furthermore, one study suggests that among patients with AD serum vitamin E levels are associated with better results on cognitive measures, especially among female patients who had overall higher levels (65). In contrast, Ahlskog et al. (66) found no significant differences in serum levels of vitamin E between AD patients and controls. Cerebrospinal fluid (CSF) levels of vitamin E were found to be decreased in two studies comparing AD patients and controls (67,68). Again, weight and body mass index were found to be significantly lower in AD patients in one of these studies (67), suggesting that CSF and serum vitamin E concentrations in these patients may be due to a deficiency in dietary intake. A similar study evaluating vitamin C concentration in CSF and plasma showed no statistically significant difference between AD patients and controls (69). Finally, brain levels of vitamin E in AD patients have been shown to be either unchanged (60,70) or increased (70) when compared with controls. Only one interventional randomized clinical trial has examined the effects of an antioxidant vitamin in AD patients (71). In this double-blind, placebo-controlled, randomized multicenter trial of patients with AD of moderate severity, Sano et al. found that treatment with vitamin E (α-tocopherol) 2000 UI daily, selegiline (10 mg daily), or both showed the progression of disease as assessed by the primary outcomes of time to reach death, institutionalization, loss of activities of daily living, or severe dementia. Despite random allocation, baseline Mini-Mental State Examination (MMSE) score, which was highly predictive of the primary outcomes, was higher in the placebo group than in the other treatment groups, explaining why unadjusted analyses failed to show any statistically significant differences in the outcomes among the four groups. Only after adjustment for baseline MMSE was there a significant delay in the primary outcomes with vitamin E, selegiline, and combination therapy when compared to the placebo group. Furthermore, the group treated with vitamin E specifically showed a slowed deterioration in activities of daily living in comparison to the group receiving placebo. However, none of the groups showed improved cognitive function with treatment. B.
Parkinson’s Disease
One case-control (72) and one cross-sectional study (73) have shown lower dietary intakes of vitamins A, C, and E in patients suffering from PD. In the Rotterdam Study, the association with vitamin E intake was dose-dependent, suggesting that it may protect against the occurrence of PD (73). In contrast, two case-control studies (74,75) failed to confirm these findings. In fact, Scheider et al. (75) found trends toward greater PD risk with higher intakes of vitamins A and C. All
Vitamin E and Alzheimer’s Disease
505
(66,76–80), but two (81,82) case-control studies examining the association between PD and serum levels of vitamins A, C, and E have shown no statistically significant correlations. Yapa et al. (82) found that out of seven patients with vitamin C deficiency, four had PD, indicating a significantly higher prevalence of the disease in patients with subclinical ascorbate deficiency. Abbot et al. (81) assessed the nutritional status of a group of PD patients and found decreased plasma levels of vitamins A and E, zinc, and albumin in comparison with healthy controls. Fifty-two percent of the patients had lost weight since the onset of their disease, and 67% experienced eating difficulties associated with their disease, but dietary intakes of protein and energy were not lower than recommended daily allowances. Two intervention trials have examined the role of antioxidant vitamins on the progression of the motor deficits associated with Parkinson’s disease. Fahn (83,84) showed in an open pilot trial of 18 patients that increasing doses of vitamins C (up to 3000 U/day) and E (up to 3200 U/day) delayed the time to starting levodopa therapy by 2.5 years (mean duration of treatment was 49.8 months) when compared to a historical group of controls. Time to reach the endpoint was considered from the onset of PD symptoms and not from time of starting the supplements, which may overestimate the benefit. In the DATATOP study (Deprenyl and Tocopherol Antioxidant Therapy of Parkinsonism), a multicenter controlled clinical trial (85,86), 800 patients were randomly assigned to one of four treatments: double placebo, tocopherol (2000 UI daily) and placebo, Deprenyl (10 mg daily) and placebo, or both drugs. Mean duration of follow-up was 14 months. The primary endpoint was the onset of disability, justifying the decision to start levodopa. There was no beneficial effect of tocopherol nor any interaction between tocopherol and Deprenyl. To date, no study has specifically evaluated the effects of antioxidant vitamins on the neurobehavioral manifestations of the disease.
C.
Huntington’s Disease
Only one study has examined the role of antioxidant vitamins on the progression of Huntington’s disease (HD) (87). In this double-blind, placebo-controlled clinical trial, 73 patients with HD were randomly assigned to 12 months of either αtocopherol 3000 IU daily or placebo. Because high doses of α-tocopherol affect the metabolism of vitamin A, and vitamin C increases the bioavailability of αtocopherol, all patients were given 50,000 IU of vitamin A and 1000 mg of vitamin C daily. Treatment with α-tocopherol did not affect neurological or neuropsychiatric symptoms overall. However, a significant therapeutic effect on neurological symptoms (excluding neurobehavioral manifestations) was found in the subgroup of patients in the early stages of their disease in a post hoc analysis.
506
D.
Massoud et al.
Vascular Dementia
Several studies have examined the association between antioxidant vitamins and cerebrovascular diseases. Kritchevsky et al. (88) studied the relationship between dietary intake of vitamins A, C, and E and carotid artery wall thickness by ultrasonography in 6318 women and 4989 men. There was an inverse relationship between vitamin C intake and average artery wall thickness in both men and women over the age of 55. A similar relationship was also seen with α-tocopherol in women and with carotene in older men. Most but not all studies (89,90) seem to agree that high intake (91,92) and increased plasma levels of vitamins A, C, and E (93–96) are associated with decreased risk of stroke. Furthermore, in a prospective cohort study of 80 patients with stroke, De Keyser et al. (97) found that serum concentrations of vitamin A but not vitamin E were associated with a higher frequency of complete recovery within the first 24 h, and improvement in neurological deficits, functional outcome, and mortality. In a more recent prospective cohort study, Ross et al. (98) found no association between the serum levels of vitamins A, C, and E and mortality after a major cerebrovascular accident. These rather conflicting results have prompted some intervention trials to further clarify the issue. The Chinese Cancer Prevention Study (99,100) was conducted in Linxian, an area reputed for its high incidence of upper gastrointestinal tract cancers. Several antioxidant vitamin combinations were assessed for their effects on occurrence of cancer and cerebrovascular disease. The subgroup taking vitamin E (30 mg/day), beta-carotene, and selenium had a mild and nonsignificant decrease in the incidence of strokes. Tomeo et al. (101) investigated the potential effect of Palm Vitee, a γ-tocotrienol, and α-tocopherol-enriched fraction of palm oil (given over a period of 18 months) on carotid atherosclerosis in 25 patients with cerebrovascular disease. Follow-up duplex ultrasonography showed carotid artery regression in 7 and progression in 2 of the 25 patients in the treatment group, while 10 of the 25 control patients showed progression and none exhibited regression. Serum studies showed a decrease in indicators of platelet peroxidation and in collagen-induced platelet aggregation responses in the treatment group. The usefulness of vitamin E on recurrence and progression of neurological symptoms after a transient ischemic attack was assessed in a double-blind, randomized study comparing the effects of aspirin (325 mg) (48 patients) with aspirin plus vitamin E (400 IU) (52 patients) over a period of 2 years. Results showed a decrease in the incidence of ischemic events in patients taking vitamin E plus aspirin compared to those taking aspirin alone, with no significant effect on the incidence of hemorrhagic stroke. This benefit was associated with a significant reduction in platelet adhesiveness in patients who took vitamin E plus aspirin. However, there were no measures of the effect on oxidative stress in patients treated with vitamin E. These studies were hampered by the highly publicized α-Tocopherol, Beta-Carotene Cancer Prevention Study (102), which examined
Vitamin E and Alzheimer’s Disease
507
the effects of beta-carotene (20 mg/day) and vitamin E (50 mg/day) in 29,000 male Finnish smokers. Surprisingly, beta-carotene produced a significant increase in coronary heart disease mortality and vitamine E a 50% increase in stroke death. The dosage of vitamin E was lower than the range previously found to be effective in coronary heart disease prevention studies. The results of these studies suggest that antioxidant vitamins may potentially have a beneficial effect on the cognitive manifestations of cerebrovascular diseases. Unfortunately, very few observational studies and no intervention trials have specifically examined the role of antioxidant vitamins in vascular dementia. In a case-control study of patients with AD, vascular dementia, and healthy controls (63), serum concentrations of vitamin E and beta-carotene were found to be lower in the two groups of patients. However, vitamin A was only significantly reduced in the AD patients. Tohgi et al. (68) determined the concentrations of α-tocopherol and its oxidized derivative α-tocopherol quinone in patients with AD and vascular dementia of the Binswanger type. The latter group had a significant increase of α-tocopherol quinone which was correlated with the decrease in the Mini-Mental State Examination scores. These studies seem to support the oxidative stress hypothesis and the potential role of antioxidant vitamins in vascular dementia, but further clinical trials are warranted. In summary, antioxidant vitamins seem to be of some benefit in slowing the deterioration associated with neurodegenerative diseases. However, the conflicting results of different studies and the relatively marginal efficiency reported warrant more intervention studies. Furthermore, the long-term safety of these compounds has not been assessed thoroughly, and caution should be exerted in their usage. Nevertheless, and based on the results of the study previously discussed (71), the American Psychiatric Association has made vitamin E treatment of moderate AD a grade I recommendation (‘‘recommended with substantial clinical confidence’’) (103).
III.
L-DEPRENYL
AND OTHER MONOAMINE OXIDASE INHIBITORS (MAOIs)
Monoamine oxidase B (MAO-B) is an enzyme that induces monoamine oxidation in the human brain. MAO-B activity is increased in Alzheimer’s disease, which is thought to contribute to the neurotransmission defects associated with the disease (104–109). l-Deprenyl (selegiline) is a selective irreversible inhibitor of MAOB (at low doses of up to 10 mg daily) (110), which has been reported to have some beneficial effects in AD. Whether selegiline is efficient in the management of cognitive and behavioral symptoms of AD is still a question of controversy. Several studies have provided conflicting results as to the effects on improvement in symptomatology. A detailed discussion of selegiline in AD is beyond the scope
508
Massoud et al.
of this chapter and the reader is referred to a review on antioxidants in AD (111). Lazabemide is a new (112), highly selective, short-acting, and reversible inhibitor of MAO-B which, unlike selegiline, is not metabolized to active compounds. Trials are presently under way with this compound in Alzheimer’s disease. Several studies have investigated the role of selegiline in Parkinson’s disease. The reader is referred to the chapter in this book exclusively devoted to that subject. Finally, the use of selegiline concurrently with fluoxetine in a 19-year-old female with Huntington’s disease was reported recently (113). She showed significant improvement in affective, behavioral, and motor manifestations of the disease. More studies with MAO inhibitors in HD are needed before any conclusions can be drawn. IV.
IDEBENONE
Idebenone is a benzoquinone synthetic compound with several mechanisms of action including antioxidant effects. It has been shown to improve metabolic abnormalities caused by ischemia and acidosis in brain tissue, to accelerate net ATP formation by activating electron transfer systems in the mitochondria, to increase the efficiency of oxygen utilization by saving nonrespiratory consumption, to inhibit lipid peroxidation, and to scavenge free radicals (54,114–120). Idebenone has been utilized in several therapeutic trials of neurodegenerative diseases. A.
Alzheimer’s Disease
Behavioral studies with animal models indicate that idebenone reverses deficits in learning and memory associated with cholinergic and serotoninergic dysfunction (121). Early Italian and Japanese studies with idebenone involved relatively few mildly to moderately demented patients (122–127); most of these patients had vascular dementias, although one study described both AD and vascular dementia subjects (126). Even though no systematic or standardized outcomes were reported, a variety of benefits were described. An inverse relationship between the severity of cognitive impairment and response of idebenone has been suggested by some authors (128). It was also thought that subjects with vascular dementia might benefit more than patients with AD. Randomized clinical trials comparing idebenone with placebo or other agents are summarized in the table. Four of these trials were conducted in patients with Alzheimer’s disease (129–131). In a multicenter study, Senin et al. (129) evaluated the effects of a 4-month-long therapeutic trial of idebenone (45 mg daily) in AD patients. Treated patients had a significant improvement in memory and attention compared to the placebo group. The idebenone group also improved on a global test of intellectual and emotional impairment after the first month of
Vitamin E and Alzheimer’s Disease
509
treatment. In addition, behavior, as rated by informants and clinicians, significantly improved. In the multicenter, randomized, double-blind, placebo-controlled study conducted by Bergamasco et al. (131), 92 patients received idebenone or placebo for 90 days followed by a 30-day, single-blind placebo administration, and by an optional long-term period of treatment up to a year in an open fashion. Idebenone was found to be effective on measures of memory, attention, and orientation. It also slowed down the natural progression of the disease. The same group of investigators (132) randomized 79 AD patients to idebenone (90 mg daily) or oxiracetam (1600 mg daily) for 3 months. Idebenone proved to be more effective on measures of memory and in global ratings by the investigators. More recently, Weyer et al. (130) randomized 300 mildly to moderately demented patients to two doses of idebenone (90 and 270 mg daily) and placebo for 6 months. At the end of the trial, patients receiving 270 mg showed significant improvement on the total score of the Alzheimer’s Disease Assessment Scale (ADAS–Total), the cognitive subscale of the ADAS (ADAS– Cog), and on the rating of the clinical global impression scale (CGI). Patients with more severe cognitive impairment at baseline (ADAS–Tot ⬎20) responded better than patients with milder impairments. Idebenone was usually well tolerated in long-term trials. Patients most frequently complained of gastrointestinal symptoms (gastralgia, abdominal pain, vomiting, and diarrhea). Other adverse effects included insomnia, anxiety, headache, polyuria, drowsiness, dizziness, confusion, and tachycardia. These manifestations were usually mild in nature and were equally associated with placebo. B.
Huntington’s Disease
In a placebo-controlled, double-blind trial, Ranen et al. (133) randomized 100 patients with Huntington’s disease to either idebenone (270 mg/day) or placebo for 1 year. The outcome measure was the slowing of the rate of progression of the disease as measured by functional status and neurological examination. There were no significant differences between the two groups on the Huntington’s Disease Activities of Daily Living Scale, a measure of functional activity, or on neurological examination (Quantified Neurologic Examination). Further analysis showed that a larger sample would be necessary to detect significant changes in neurological and functional deterioration, which may justify a multicenter therapeutic trial in the future. C.
Vascular Dementia
Because of its specific beneficial effects on the metabolic abnormalities caused by ischemia (54), idebenone has been evaluated in several studies of vascular dementias (Table 1). Two studies compared idebenone 90 mg daily to placebo
510
Table 1
Randomized Clinical Trials with Idebenone
Patient population
Sample size (n)
Treatment duration (weeks)
Dosage (mg/day)
Senin et al., 1992 (129)
Alzheimer’s disease
102
16
45
Bergamasco et al., 1994 (131)
Alzheimer’s disease
92
12
90
Bergamasco et al., 1992 (132)
Alzheimer’s disease
79
12
90a
Weyer et al., 1997 (130)
Alzheimer’s disease
300
24
90, 270
Ranen et al., 1996 (133)
Huntington’s disease
100
52
270
Bergamasco et al., 1992 (134)
Vascular dementia
104
12
90
Marigliano et al., 1992 (135) Otomo et al., 1991 [136] Otomo et al., 1992 (137)
Vascular dementia Vascular dementia Vascular dementia
108 231 534
16 8 8
90 90a 90e
Source
Results/comments Improvement in memory, attention, emotional impairment, and behavior Improvement in memory, attention, and orientation Improvement in memory and global ratings Improvement on the ADAS-Cog,b ADASTot,c and CGId No improvement in functional status or neurological symptomatology Improvement in memory, attention, orientation, and comprehension Improvement in memory and attention No difference between groups No difference between groups
a
Massoud et al.
This study compared idebenone to oxiracetam. Alzheimer’s Disease Assessment Scale, cognitive portion. c Alzheimer’s Disease Assessment Scale, total score. d Clinical Global Impression Scale. e This study compared idebenone to nebracetam. b
Vitamin E and Alzheimer’s Disease
511
and found improvement in memory, attention (134,135), orientation, and comprehension (134) in the treatment group. Two studies compared idebenone to another agent in patients with dementia thought to be vascular in origin (136,137). Both of these studies, comparing idebenone 90 mg/day with oxiracetam 800 mg/day (136) and with nebracetam 400 mg/day (137), found no differences between the two groups. Most of these trials were carried out for relatively short periods of time (less than 6 months) suggesting that the benefit may be associated primarily with the ‘‘antiischemic’’ effect of idebenone rather than its antioxidant effects. These studies relied on different sets of criteria for their definitions of cerebrovascular disease or vascular dementia thus making generalization of the results less feasible.
V.
OTHER ANTIOXIDANTS
A.
Coenzyme Q
Coenzyme Q, or ubiquinone, enhances oxidative phosphorylation by shuttling electrons in the mitochondrial electron transport chain (138), scavenges free radicals, and may have membrane-stabilizing properties (139). The activity of the mitochondrial electron transport chain (especially the activities of complex I and complex II/III) has been shown to be reduced in patients with early, untreated, Parkinson’s disease (140). This was significantly correlated with the decrease in levels of coenzyme Q in these patients. Two openlabel clinical trials were prompted by these findings. Strijks et al. (141) performed a 3-month trial of 200 mg of coenzyme Q daily in 10 patients with PD and found no effect on motor performance as measured by the UPDRS at the end of the study. In a pilot study of three oral doses of coenzyme Q (400, 600, or 800 mg daily for 1 month) in 15 subjects with PD, Shultz et al. (142) also found no change in the mean score on the motor portion of the UPDRS. However, there was an increase in the plasma coenzyme Q levels and a trend toward an increase in complex I activity. Coenzyme Q has been shown to attenuate the striatal lesions in an experimental model of Huntington’s disease developed by the Huntington Study Group (143). Lactate levels, which are known to be elevated in the striatum of HD patients (144), decreased in 17 HD patients who were treated with coenzyme Q 360 mg daily for 3 months (145,146). Systematic clinical evaluations were not carried out in this study, and no striking changes in patients’ symptomatology were observed. In 6-month open-label trial of coenzyme Q in 10 HD patients, Feigin et al. (147,148) found a trend toward a reduction in the rate of decline on a functional scale (total functional capacity, or TFC), with no significant effects on neuropsychological measures. This trial, which was designed primarily to assess the tolerability of oral coenzyme Q, showed that 600 mg daily is the maxi-
512
Massoud et al.
mally tolerated dosage. The most common adverse experiences were mild and included heartburn, headache, fatigue, and increased involuntary movements. No patients required a reduction in CoQ dosage. These encouraging results led the Huntington Study Group to presently conduct a randomized, double-blind, placebo-controlled investigation of coenzyme Q, ramacemide hydrochloride, aNMDA receptor antagonist, and a combination of coenzyme Q and ramacemide hydrochloride in 340 ambulatory patients with Huntington’s disease. B.
New Lipid Peroxidation Inhibitors
Lazaroids represent a newly developed class of agents that act as potent lipid peroxidation inhibitors. One of these compounds, tirilazad mesylate (U-74006F), has shown efficacy in experimental models of brain injury, focal cerebral ischemia, and subarachnoid hemorrhage (149). U-74500A, a compound of the same family, has also been shown to decrease lipid peroxidation in brain tissue from patients with Alzheimer’s disease (150). U-78517F is a compound belonging to another series of lipid peroxidation inhibitors, the 2-methylaminochromans. In vitro, U-78517F protects hippocampal neurons from β-amyloid toxicity (151). These agents are limited by their ability to penetrate the blood–brain barrier. The pyrrolopyrimidines, a group of antioxidants with enhanced blood–brain barrier penetrance, have recently been developed (152,153). U-101033E, a compound belonging to this group, was shown to limit ischemic damage to the CA1 region of the hippocampus in an experimental model (152). In vitro and in vivo research on these compounds are needed before the development of human clinical trials. Finally, OPC-14117, a synthetic free radical scavenger with structural homology to vitamin E, blocks iron-induced lipid peroxidation. The Huntington Study Group conducted a randomized, double-blind, placebo-controlled, multicenter trial with OPC-14117 at three doses (60, 120, 240 mg daily) in 64 patients with Huntington’s disease for 4 months (154). The compound was well tolerated, and clinical adverse events were similar in frequency and quality in treatment and placebo groups. However, no significant differences in clinical and functional features of the disease (assessed by the Unified Huntington’s Disease Rating Scale, or UHDRS) were noted between the treatment and the placebo groups. Asymptomatic elevation in liver transaminases in four patients treated with OPC14117 suggests that surveillance monitoring will be necessary in future studies. VI.
CONCLUSIONS
The data concerning oxidative stress in the pathophysiology of neurodegenerative diseases seem very compelling. Nevertheless, trials evaluating the effects of antioxidant treatments on the progression of these diseases have failed to yield consistent and convincing results. This could be explained by the fact that interventions
Vitamin E and Alzheimer’s Disease
513
are introduced relatively late in the pathophysiological progression albeit early symptomatic stages of the disease. Considering the hypothesized gradual rate of oxidative damage, we believe that early and long-term treatment is a prerequisite in trials of antioxidants. A model for the treatment of neurodegenerative diseases based on primary, secondary, and tertiary prevention seems to fit quite nicely with their proposed pathophysiology. So far, studies have mainly involved the effects of treatment on morbidity in symptomatic patients (‘‘tertiary prevention’’). Interventions aimed at the presymptomatic stage in a population at risk (‘‘primary prevention’’) and at the very early symptomatic stages of disease (‘‘secondary prevention’’) are desperately needed and underscore the necessity to elaborate sensitive markers of preclinical disease. Furthermore, antioxidants have had dissimilar effects in different diseases, suggesting that oxidative damage may be triggered by diverse mechanisms and should be approached differently in each neurodegenerative disease. The need for prolonged treatment in a vulnerable, often aging population emphasizes the necessity to develop effective, safe, and well-tolerated agents. Presently, antioxidant vitamins seem to hold the most promise, given their relative efficacy in a host of degenerative diseases (neurological and nonneurological), and their favorable pharmacological profile as well as relative low cost. However, early, long-term intervention trials with these agents are needed before recommending their generalized use to slow the course of neurodegenerative diseases.
ACKNOWLEDGMENTS Dr. Massoud is supported by a grant from the McLaughlin Foundation, Ontario, Canada. This work of the authors is funded by National Institutes of Health Grants U01-AG 10483.
REFERENCES 1. Halliwell B. Oxidants and the central nervous system: some fundamental questions. Is oxidant damage relevant to Parkinson’s disease, Alzheimer’s disease, traumatic injury or stroke? Acta Neurol. Scand. Suppl. 1989;126:23–33. 2. Jenner P. Oxidative damage in neurodegenerative disease. Lancet 1994;344:796–8. 3. Halliwell B, Gutteridge J. Oxygen radicals and the nervous system. Trends Neurosci. 1985;8:22–26. 4. Knight JA. Reactive oxygen species and the neurodegenerative disorders. Ann. Clin. Lab. Sci. 1997;27:11–25. 5. Evans PH. Free radicals in brain metabolism and pathology. Br. Med. Bull. 1993; 49:577–587.
514
Massoud et al.
6. Gotz ME, Kunig G, Riederer P, Youdim MB. Oxidative stress: free radical production in neural degeneration. Pharmacol. Ther. 1994;63:37. 7. Halliwell B. Oxygen radicals as key mediators in neurological disease: fact or fiction? Ann. Neurol. 1992;32:S10–S15. 8. Friedlich AL, Butcher LL. Involvement of free oxygen radicals in beta-amyloidosis: an hypothesis. Neurobiol. Aging 1994;15:443–455. 9. Benzi G, Moretti A. Are reactive oxygen species involved in Alzheimer’s disease? Neurobiol. Aging 1995;16:661–674. 10. Coyle JT, Puttfarcken P. Oxidative stress, glutamate, and neurodegenerative disorders. Science 1993;262:689–695. 11. Joseph JA. The putative role of free radicals in the loss of neuronal functioning in senescence. Integr. Physiol. Behav. Sci. 1992;27:216–217. 12. Behl C. Amyloid beta-protein toxicity and oxidative stress in Alzheimer’s disease. Cell Tissue Res. 1997;290:471–480. 13. Markesbery WR. Oxidative stress hypothesis in Alzheimer’s disease. Free Rad. Biol. Med. 1997;23:134–147. 14. Marksberry W, Ehmann W. Brain Trace Elements in Alzheimer’s Disease. New York: Raven Press, 1993:353–367. 15. Thompson CM, Markesbery WR, Ehmann WD, Mao YX, Vance DE. Regional brain trace-element studies in Alzheimer’s disease. Neurotoxicology 1988;9:1–7. 16. Ehmann WD, Markesbery WR, Alauddin M, Hossain TI, Brubaker EH. Brain trace elements in Alzheimer’s disease. Neurotoxicology 1986;7:195–206. 17. Evans PH, Klinowski J, Yano E. Cephaloconiosis: a free radical perspective on the proposed particulate-induced etiopathogenesis of Alzheimer’s dementia and related disorders. Med. Hypoth. 1991;34:209–219. 18. Hensley K, Hall N, Subramaniam R, et al. Brain regional correspondence between Alzheimer’s disease histopathology and biomarkers of protein oxidation. J Neurochem. 1995;65:2146–2156. 19. Mecocci P, MacGarvey U, Beal MF. Oxidative damage to mitochondrial DNA is increased in Alzheimer’s disease. Ann Neurol. 1994;36:747–751. 20. Pettegrew JW, Moossy J, Withers G, McKeag D, Panchalingam K. 31P nuclear magnetic resonance study of the brain in Alzheimer’s disease. J. Neuropathol. Exp. Neurol. 1988;47:235–248. 21. Miatto O, Gonzalez RG, Buonanno F, Growdon JH. In vitro 31P NMR spectroscopy detects altered phospholipid metabolism in Alzheimer’s disease. Can. J. Neurol. Sci. 1986;13:535–539. 22. Nitsch RM, Blusztajn JK, Pittas AG, Slack BE, Growdon JH, Wurtman RJ. Evidence for a membrane defect in Alzheimer disease brain. Proc. Natl. Acad. Sci. USA 1992;89:1671–1675. 23. Marcus DL, Thomas C, Rodriguez C, et al. Increased peroxidation and reduced antioxidant enzyme activity in Alzheimer’s disease. Exp. Neurol. 1998;150:40–44. 24. Lovell MA, Ehmann WD, Butler SM, Markesbery WR. Elevated thiobarbituric acid–reactive substances and antioxidant enzyme activity in the brain in Alzheimer’s disease. Neurology 1995;45:1594–1601. 25. Kish SJ, Morito CL, Hornykiewicz O. Brain glutathione peroxidase in neurodegenerative disorders. Neurochem. Pathol. 1986;4:23–28.
Vitamin E and Alzheimer’s Disease
515
26. Balazs L, Leon M. Evidence of an oxidative challenge in the Alzheimer’s brain. Neurochem. Res. 1994;19:1131–1137. 27. Gsell W, Conrad R, Hickethier M, et al. Decreased catalase activity but unchanged superoxide dismutase activity in brains of patients with dementia of Alzheimer type. J. Neurochem. 1995;64:1216–1223. 28. Good PF, Werner P, Hsu A, Olanow CW, Perl DP. Evidence of neuronal oxidative damage in Alzheimer’s disease. Am. J. Pathol. 1996;149:21–28. 29. Smith MA, Perry G, Richey PL, et al. Oxidative damage in Alzheimer’s. Nature 1996;382:120–121. 30. Pappolla MA, Omar RA, Kim KS, Robakis NK. Immunohistochemical evidence of oxidative stress in Alzheimer’s disease. Am. J. Pathol. 1992;140:621–628. 31. Behl C, Sagara Y. Mechanism of amyloid beta protein induced neuronal cell death: current concepts and future perspectives. J. Neural Transm. Suppl. 1997;49:125– 134. 32. Ebadi M, Srinivasan SK, Baxi MD. Oxidative stress and antioxidant therapy in Parkinson’s disease. Prog. Neurobiol. 1996;48:1–19. 33. Burkhardt CR, Weber HK. Parkinson’s disease: a chronic, low-grade antioxidant deficiency? Med. Hypoth. 1994;43:111–114. 34. Yoshikawa T. Free radicals and their scavengers in Parkinson’s disease. Eur. Neurol. 1993;33 Suppl 1:60–8. 35. Fahn S, Cohen G. The oxidant stress hypothesis in Parkinson’s disease: evidence supporting it. Ann. Neurol. 1992;32:804–812. 36. Cohen G, Spina MB. Deprenyl suppresses the oxidant stress associated with increased dopamine turnover. Ann. Neurol. 1989;26:689–690. 37. Jenner P. Oxidative stress as a cause of Parkinson’s disease. Acta Neurol. Scand. Suppl. 1991;136:6–15. 38. Graham DG. Oxidative pathways for catecholamines in the genesis of neuromelanin and cytotoxic quinones. Mol. Pharmacol. 1978;14:633–643. 39. Tariot PN, Sunderland T, Weingartner H, et al. Cognitive effects of l-Deprenyl in Alzheimer’s disease. Psychopharmacology (Berl.) 1987;91:489–495. 40. Riederer P, Sofic E, Rausch WD, et al. Transition metals, ferritin, glutathione, and ascorbic acid in parkinsonian brains. J. Neurochem. 1989;52:515–520. 41. Albin RL, Young AB, Penney JB. The functional anatomy of basal ganglia disorders. Trends Neurosci. 1989;12:366–375. 42. Choi DW. Glutamate neurotoxicity and diseases of the nervous system. Neuron 1988;1:623–634. 43. Wang G, Thayer S. Mitochondria sequester NMDA receptor-mediated Ca2⫹ loads. Soc. Neurosci. 1994;20:1530. 44. Dugan L, Sensi S, Canzoniero L, et al. Imaging of mitochondrial oxygen radical production in cortical neurons exposed to NMDA. Soc. Neurosci. 1994;20: 1352. 45. Coyle JT, Schwarcz R. Lesion of striatal neurones with kainic acid provides a model for Huntington’s chorea. Nature 1976;263:244–246. 46. Perry TL, Hansen S. What excitotoxin kills striatal neurons in Huntington’s disease? Clues from neurochemical studies. Neurology 1990;40:20–24. 47. Tellez-Nagel I, Johnson A, Terry R. Ultrastructural and histochemical study of
516
48.
49.
50.
51.
52.
53. 54. 55. 56. 57. 58. 59. 60.
61. 62. 63.
64. 65.
Massoud et al. cerebral biopsies in Huntington’s chorea. In: Barbeau A, Chase T, Paulsen G, eds. Advances in Neurology, Vol. 1. New York: Raven Press; 1973:387–398. Bazzett TJ, Becker JB, Kaatz KW, Albin RL. Chronic intrastriatal dialytic administration of quinolinic acid produces selective neural degeneration. Exp. Neurol. 1993;120:177–185. Novelli A, Reilly JA, Lysko PG, Henneberry RC. Glutamate becomes neurotoxic via the N-methyl-d-aspartate receptor when intracellular energy levels are reduced. Brain Res. 1988;451:205–212. Borlongan CV, Kanning K, Poulos SG, Freeman TB, Cahill DW, Sanberg PR. Free radical damage and oxidative stress in Huntington’s disease. J. Fla. Med. Assoc. 1996;83:335–341. Benveniste H, Drejer J, Schousboe A, Diemer NH. Elevation of the extracellular concentrations of glutamate and aspartate in rat hippocampus during transient cerebral ischemia monitored by intracerebral microdialysis. J. Neurochem. 1984;43: 1369–1374. Katchman AN, Hershkowitz N. Early anoxia-induced vesicular glutamate release results from mobilization of calcium from intracellular stores. J. Neurophysiol. 1993;70:1–7. Miyamoto M, Coyle JT. Idebenone attenuates neuronal degeneration induced by intrastriatal injection of excitotoxins. Exp. Neurol. 1990;108:38–45. Nagaoka A. Idebenone. In: Scriabine A, ed. New Cardiovascular Drugs 1987. New York: Raven Press, 1987:217–235. Diplock AT. Antioxidant nutrients and disease prevention: an overview. Am. J. Clin. Nutr. 1991;53:189S–193S. Halliwell B, Gutteridge JM, Cross CE. Free radicals, antioxidants, and human disease: where are we now? J Lab. Clin. Med. 1992;119:598–620. Stanton R. Dispelling myths of nutrition: antioxidant theories create confusion. Aust Doctor 1997;Jul 11:45–46. Harman D. Aging and disease: extending functional life span. Ann. N.Y. Acad. Sci. 1996;786:321–336. Ward JA. Should antioxidant vitamins be routinely recommended for older people? Drugs Aging 1998;12:169–175. Jama JW, Launer LJ, Witteman JC, et al. Dietary antioxidants and cognitive function in a population-based sample of older persons. The Rotterdam Study. Am. J. Epidemiol. 1996;144:275–280. Kilander L, Ohrvall M. Alpha-tocopherol and Alzheimer’s disease [letter; comment]. N. Engl. J. Med. 1997;337:572–573. Perrig WJ, Perrig P, Stahelin HB. The relation between antioxidants and memory performance in the old and very old. J. Am. Geriat. Soc. 1997;45:718–724. Zaman Z, Roche S, Fielden P, Frost PG, Niriella DC, Cayley AC. Plasma concentrations of vitamins A and E and carotenoids in Alzheimer’s disease. Age Ageing 1992;21:91–94. Adelman A. Selegiline and vitamin E in Alzheimer’s disease. J. Fam. Pract. 1997; 45:98–100. Grundman M, Sano M, Thomas RG, Ernesto C, Galasko D, Thal LJ. Correlation of cognitive status with alpha-tocopherol levels in patients with Alzheimer’s disease. Soc. Neurosci. 1996;22:83–93.
Vitamin E and Alzheimer’s Disease
517
66. Ahlskog JE, Uitti RJ, Low PA, et al. No evidence for systemic oxidant stress in Parkinson’s or Alzheimer’s disease. Mov. Disord. 1995;10:566–573. 67. Jimenez-Jimenez FJ, de Bustos F, Molina JA, et al. Cerebrospinal fluid levels of alpha-tocopherol (vitamin E) in Alzheimer’s disease. J Neural Transm. 1997;104: 703–710. 68. Tohgi H, Abe T, Nakanishi M, Hamato F, Sasaki K, Takahashi S. Concentrations of alpha-tocopherol and its quinone derivative in cerebrospinal fluid from patients with vascular dementia of the Binswanger type and Alzheimer type dementia. Neurosci. Lett. 1994;174:73–76. 69. Paraskevas GP, Kapaki E, Libitaki G, Zournas C, Segditsa I, Papageorgiou C. Ascorbate in healthy subjects, amyotrophic lateral sclerosis and Alzheimer’s disease. Acta. Neurol. Scand. 1997;96:88–90. 70. Adams JDJ, Klaidman LK, Odunze IN, Shen HC, Miller CA. Alzheimer’s and Parkinson’s disease. Brain levels of glutathione, glutathione disulfide, and vitamin E. Mol. Chem. Neuropathol. 1991;14:213–226. 71. Sano M, Ernesto C, Thomas RG, et al. A controlled trial of selegiline, alpha-tocopherol, or both as treatment for Alzheimer’s disease. The Alzheimer’s Disease Cooperative Study. N. Engl. J. Med. 1997;336:1216–1222. 72. Morens DM, Grandinetti A, Waslien CI, Park CB, Ross GW, White LR. Casecontrol study of idiopathic Parkinson’s disease and dietary vitamin E intake. Neurology 1996;46:1270–1274. 73. de Rijk MC, Breteler MM, den Breeijen JH, et al. Dietary antioxidants and Parkinson disease. The Rotterdam Study. Arch. Neurol. 1997;54:762–765. 74. Logroscino G, Marder K, Cote L, Tang MX, Shea S, Mayeux R. Dietary lipids and antioxidants in Parkinson’s disease: a population-based, case-control study. Ann. Neurol. 1996;39:89–94. 75. Scheider WL, Hershey LA, Vena JE, Holmlund T, Marshall JR, Freudenheim. Dietary antioxidants and other dietary factors in the etiology of Parkinson’s disease. Mov. Disord. 1997;12:190–196. 76. Jimenez-Jimenez FJ, Molina JA, Fernandez-Calle P, et al. Serum levels of betacarotene and other carotenoids in Parkinson’s disease. Neurosci. Lett. 1993;157: 103–106. 77. Jimenez-Jimenez FJ, Molina JA, Fernandez-Calle P, et al. Serum levels of vitamin A in Parkinson’s disease. J. Neurol. Sci. 1992;111:73–76. 78. King D, Playfer JR, Roberts NB. Concentrations of vitamins A, C and E in elderly patients with Parkinson’s disease. Postgrad. Med. J. 1992;68:634–637. 79. Federico A, Battisti C, Formichi P, Dotti MT. Plasma levels of vitamin E in Parkinson’s disease. J. Neural. Transm. Suppl. 1995;45:267–270. 80. Dexter DT, Ward RJ, Wells FR, et al. Alpha-tocopherol levels in brain are not altered in Parkinson’s disease. Ann. Neurol. 1992;32:591–593. 81. Abbott RA, Cox M, Markus H, Tomkins A. Diet, body size and micronutrient status in Parkinson’s disease. Eur. J. Clin. Nutr. 1992;46:879–884. 82. Yapa SC. Detection of subclinical ascorbate deficiency in early Parkinson’s disease. Public Health 1992;106:393–395. 83. Fahn S. A pilot trial of high-dose alpha-tocopherol and ascorbate in early Parkinson’s disease. Ann. Neurol. 1992;32 Suppl:S128–132. 84. Fahn S. The endogenous toxin hypothesis of the etiology of Parkinson’s disease
518
85. 86. 87. 88.
89.
90.
91.
92. 93.
94.
95.
96.
97.
98.
99.
100.
Massoud et al. and a pilot trial of high-dosage antioxidants in an attempt to slow the progression of the illness. Ann. N. Y. Acad. Sci. 1989;570:186–196. The Parkinson Study Group. Effects of tocopherol and deprenyl on the progression of disability in early Parkinson’s disease. N. Eng. J. Med. 1993;328:176–183. Parkinson Study Group. DATATOP: a multicenter controlled clinical trial in early Parkinson’s disease. Arch. Neurol. 1989;46:1052–1060. Peyser CE, Folstein M, Chase GA, et al. Trial of d-alpha-tocopherol in Huntington’s disease. Am. J. Psychiatry 1995;152:1771–1775. Kritchevsky SB, Shimakawa T, Tell GS, et al. Dietary antioxidants and carotid artery wall thickness. The ARIC Study. Atherosclerosis Risk in Communities Study. Circulation 1995;92:2142–2150. Keli SO, Hertog MG, Feskens EJ, Kromhout D. Dietary flavonoids, antioxidant vitamins, and incidence of stroke: the Zutphen study. Arch. Intern. Med. 1996;156: 637–642. Barer D, Leibowitz R, Ebrahim S, Pengally D, Neale R. Vitamin C status and other nutritional indices in patients with stroke and other acute illnesses: a case-control study. J. Clin. Epidemiol. 1989;42:625–631. Daviglus ML, Orencia AJ, Dyer AR, et al. Dietary vitamin C, beta-carotene and 30-year risk of stroke: results from the Western Electric Study. Neuroepidemiology 1997;16:69–77. Klag MJ, Whelton PK. The decline in stroke mortality. An epidemiologic perspective. Ann. Epidemiol. 1993;3:571–575. Gey KF, Moser UK, Jordan P, Stahelin HB, Eichholzer M, Ludin E. Increased risk of cardiovascular disease at suboptimal plasma concentrations of essential antioxidants: an epidemiological update with special attention to carotene and vitamin C. Am. J. Clin. Nutr. 1993;57:787S–797S. Gey KF, Stahelin HB, Eichholzer M. Poor plasma status of carotene and vitamin C is associated with higher mortality from ischemic heart disease and stroke: Basel Prospective Study. Clin. Invest. 1993;71:3–6. Eichholzer M, Stahelin HB, Gey KF. Inverse correlation between essential antioxidants in plasma and subsequent risk to develop cancer, ischemic heart disease and stroke respectively: 12-year follow-up of the Prospective Basel Study. EXS 1992; 62:398–410. Chang CY, Lai YC, Cheng TJ, Lau MT, Hu ML. Plasma levels of antioxidant vitamins, selenium, total sulfhydryl groups and oxidative products in ischemicstroke patients as compared to matched controls in Taiwan. Free Rad. Res. 1998; 28:15–24. De Keyser J, De Klippel N, Merkx H, Vervaeck M, Herroelen L. Serum concentrations of vitamins A and E and early outcome after ischaemic stroke. Lancet 1992; 339:1562–1565. Ross RK, Yuan JM, Henderson BE, Park J, Gao YT, Yu MC. Prospective evaluation of dietary and other predictors of fatal stroke in Shanghai, China. Circulation 1997;96:50–55. Li JY, Li B, Blot WJ, Taylor PR. Preliminary report on the results of nutrition prevention trials of cancer and other common diseases among residents in Linxian, China. Chung. Hua. Chung. Liu. Tsa. Chih. 1993;15:165–181. Blot WJ, Li JY, Taylor PR, Guo W, Dawsey SM, Li B. The Linxian trials: mortality
Vitamin E and Alzheimer’s Disease
101.
102.
103.
104.
105.
106. 107.
108. 109. 110.
111. 112. 113. 114.
115. 116. 117.
118.
519
rates by vitamin-mineral intervention group. Am. J. Clin. Nutr. 1995;62:1424S– 1426S. Tomeo AC, Geller M, Watkins TR, Gapor A, Bierenbaum ML. Antioxidant effects of tocotrienols in patients with hyperlipidemia and carotid stenosis. Lipids 1995; 30:1179–1183. The Alpha-Tocopherol BCCPSG. The effect of vitamin E and beta carotene on the incidence of lung cancer and other cancers in male smokers. N. Engl. J. Med. 1994; 330:1029–1035. American Psychiatric Association. Practice guideline for the treatment of patients with Alzheimer’s disease and other dementias of late life. Am. J. Psychiatry 1997; 154:1–39. Jossan SS, Gillberg PG, Gottfries CG, Karlsson I, Oreland L. Monoamine oxidase B in brains from patients with Alzheimer’s disease: a biochemical and autoradiographical study. Neuroscience 1991;45:1–12. Adolfsson R, Gottfries CG, Oreland L, Wiberg A, Winblad B. Increased activity of brain and platelet monoamine oxidase in dementia of Alzheimer type. Life Sci. 1980;27:1029–1034. Alexopoulos GS, Lieberman KW, Young RC. Platelet MAO activity in primary degenerative dementia. Am. J. Psychiatry 1984;141:97–99. Robinson DS, Davis JM, Nies A, Ravaris CL, Sylwester D. Relation of sex and aging to monoamine oxidase activity of human brain, plasma, and platelets. Arch. Gen. Psychiatry. 1971;24:536–539. Smith RC, Ho BT, Kralik P, Vroulis G, Gordon J, Wolff J. Platelet monamine oxidase in Alzheimer’s disease. J. Gerontol. 1982;37:572–574. Reinikainen KJ, Paljarvi L, Halonen T, et al. Dopaminergic system and monoamine oxidase-B activity in Alzheimer’s disease. Neurobiol. Aging 1988;9:245–252. Elsworth JD, Glover V, Reynolds GP, et al. Deprenyl administration in man: a selective monoamine oxidase B inhibitor without the ‘‘cheese effect.’’ Psychopharmacology 1978;57:33–38. Schittini M, Sano M. Antioxidants in Alzheimer’s disease: role in therapy. ADIS Int. (in press). Da Prada M, Kettler R, Keller H. RO-196327, a novel highly selective and reversible MAO-B inhibitor. Pharmacol Toxicol. 1987;60 (Suppl I) [Abstract]. Patel SV, Tariot PN, Asnis J. L-Deprenyl augmentation of fluoxetine in a patient with Huntington’s disease. Ann. Clin. Psychiatry 1996;8:23–26. Mukarami M, Zs-Nagy I. Superoxide radical scavenging activity of idebenone in vitro studied by ESR spin trapping method and direct ESR measurement at liquid nitrogen. Arch. Gerontol. Geriatr. 1990;11:199–214. Zs-Nagy I, Floyd R. ESR spin traping studies on the OH free radical reactions of idebenone. Arch. Gerontol. Geriatr. 1990;11:215–231. Myamoto M, Coyle J. Idebenone attenuates neuronal degeneration induced by intrastriatal injection of excitotoxins. Exp. Neurol. 1990;108:38–45. Semsei I, Nagy K, Zs-Nagy I. In vitro studies on the OH and O2⫺ free radical scavenger properties of idebenone in chemical systems. Arch. Gerontol. Geriatr. 1990;11:187–197. Sugiyama Y, Fujita T, Matsumoto M, Okamoto K, Imada I. Effects of idebenone (CV-2619) and its metabolites on respiratory activity and lipid peroxidation in
520
119.
120. 121.
122.
123.
124. 125. 126.
127. 128.
129. 130.
131.
132.
133. 134.
135.
Massoud et al. brain mitochondria from rats and dogs. J. Pharmacobiol. Dynam. 1985;8:1006– 1017. Suno M, Nagaoka A. Inhibition of lipid peroxidation by a novel compound (CV2619) in brain mitochondria and mode of action of the inhibition. Biochem. Biophys. Res. Commun. 1984;125:1046–1052. Zs-Nagy I. Chemistry, toxicology, pharmacology, and pharmacokinetics of idebenone: a review. Arch. Gerontol. Geriatr. 1990;11:177–186. Yamazaki K, Nomura M, Nagaoka A, Nagawa Y. Idebenone improves learning and memory impairment induced by cholinergic or serotonergic dysfunction in rats. Arch. Gerontol. Geriatr. 1989;8:225–239. Linggetti M, Porfido FA, Ciarimboli M, et al. Evaluation of the clinical efficacy of idebenone in patients affected by chronic cerebrovascular disorders. Arch. Gerontol. Geriatr. 1992;15:225–237. Kadota I, Matsuoka M, Shirakawa S. Utility of long-term administration of cv2619 (idebenone) in patients with cerebrovascular disorders. Acta. Gerontol. 1986; 36:42–57. Takauchi S, Miyoshi K. A long-term trial of idebenone in cerebrovascular diseases. Acta. Gerontol. 1986;36:58–68. Ichimaru S. Efficacy and safety of cv-2619 tablets in long-term clinical treatment of elderly cerebral arteriosclerotic patients. J. Clin. Ther. Med. 1985;1:361–364. Nappi G, Bono G, Merlo P, et al. Long-term idebenone treatment of vascular and degenerative brain disorders of the elderly. Arch. Gerontol. Geriatr. 1992;15:261– 269. Nogaki H, Matsumoto M, Sasabe F. Effects of idebenone on quality of life of patients with cerebrovascular disease. Ther. Res. 1992;13:221–226. Gillis JC, Benefield P, McTavish D. Idebenone. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic use in age-related cognitive disorders. Drugs Aging 1994;5:133–152. Senin U, Parnetti L, Barbagallo-Sangiorgi G, et al. Idebenone in senile dementia of Alzheimer type: a multicentre study. Arch. Gerontol. Geriatr. 1992;15:249–260. Weyer G, Babej-Dolle RM, Hadler D, Hofmann S, Herrmann WM. A controlled study of two doses of idebenone in the treatment of Alzheimer’s disease. Neuropsychobiology 1997;36:73–82. Bergamasco B, Scarzella L, La Commare P. Idebenone, a new drug in the treatment of cognitive impairment in patients with dementia of the Alzheimer type. Funct. Neurol. 1994;9:161–168. Bergamasco B, Villardita C, Coppi R. Effects of idebenone in elderly subjects with cognitive decline. Results of a multicentre clinical trial. Arch. Gerontol. Geriatr. 1992;15:279–286. Ranen NG, Peyser CE, Coyle JT, et al. A controlled trial of idebenone in Huntington’s disease. Mov. Disord. 1996;11:549–554. Bergamasco B, Villardita C, Coppi R. Idebenone in the treatment of multi-infarct dementia: a randomised, double-blind, placebo controlled multicentre trial. Arch Gerontol. Geriatr. 1992;15:271–278. Marigliano V, Abate G, Barbagallo-Sangiorgi G, et al. Randomized, double-blind, placebo controlled, multicentre study of idebenone in patients suffering from multiinfarct dementia. Arch. Gerontol. Geriatr. 1992;15:239–248.
Vitamin E and Alzheimer’s Disease
521
136. Otomo E, Tohgi H, Hirai S. Clinical utility of ct-848 (oxiracetam) in the treatment of cerebral infarction—a multi-center, double-blind study in comparison with idebenone. Rinsho Hyoka 1991;19:315–353. 137. Otomo E, Kutsuzawa T, Hasegawa K. Clinical evaluation of web 1881 (nebracetam fumarate) in patients with cerebro-vascular disorders—a double-blind study in comparison with idebenone. Rinsho Hyoka 1992;8:1063(79)–1106(122). 138. Lenaz G, DeSantis A. A survey of the function and specificity of ubiquinone in the mitochondrial respiratory chain. In: Lenaz G, ed. Coenzyme Q. New York: Wiley-Interscience; 1985:165–199. 139. Frei B, Kim MC, Ames BN. Ubiquinol-10 is an effective lipid-soluble antioxidant at physiological concentrations. Proc. Natl. Acad. Sci. USA 1990;87:4879–4883. 140. Shults CW, Haas RH, Passov D, Beal MF. Coenzyme Q 10 levels correlate with the activities of complexes I and II/III in mitochondria from parkinsonian and nonparkinsonian subjects. Ann. Neurol. 1997;42:261–264. 141. Strijks E, Kremer HP, Horstink MW. Q 10 therapy in patients with idiopathic Parkinson’s disease. Mol. Aspects. Med. 1997;18 suppl:S237–240. 142. Shults CW, Beal MF, Fontaine D, Nakano K, Haas RH. Absorption, tolerability, and effects on mitochondrial activity of oral coenzyme Q 10 in parkinsonian patients. Neurology 1998;50:793–795. 143. Beal MF, Henshaw DR, Jenkins BG, Rosen BR, Schulz JB. Coenzyme Q 10 and nicotinamide block striatal lesions produced by the mitochondrial toxin malonate. Ann. Neurol. 1994;36:882–888. 144. Jenkins BG, Koroshetz WJ, Beal MF, Rosen BR. Evidence for impairment of energy metabolism in vivo in Huntington’s disease using localized 1H NMR spectroscopy. Neurology 1993;43:2689–2695. 145. Koroshetz WJ, Jenkins BG, Rosen BR, Beal MF. Energy metabolism defects in Huntington’s disease and effects of coenzyme Q 10. Ann. Neurol. 1997;41:160–165. 146. Koroshetz WJ, Jenkins BG, Beal MF. Evidence for a metabolic disorder in Huntington’s disease. Neurology 1994;44 (suppl 2):A338. 147. Feigin A, Kieburtz K, Como P, et al. Assessment of coenzyme Q 10 tolerability in Huntington’s disease. Mov. Disord. 1996;11:321–323. 148. Feigin A, Kieburtz K, Como P, et al. An open-label trial of coenzyme Q 10 (CoQ) in Huntington’s disease (HD). Neurology 1994;44 (suppl 2):A397–A398. 149. Hall ED. Novel inhibitors of iron-dependent lipid peroxidation for neurodegenerative disorders. Ann. Neurol. 1992;32 suppl:S137–S142. 150. Subbarao KV, Richardson JS, Ang LC. Autopsy samples of Alzheimer’s cortex show increased peroxidation in vitro. J. Neurochem. 1990;55:342–345. 151. Richardson JS, Kumar P, Kala S, et al. In vitro evidence for the use of antioxidants in Alzheimer’s disease. In: Giacobini E, Becker R, eds. Alzheimer Disease: Therapeutic Strategies. Boston: Birkhauser; 1994:334–339. 152. Hall ED. Lipid peroxidation. Adv. Neurol. 1996;71:247–257. 153. Sethy VH, Wu H, Oostveen JA, Hall ED. Neuroprotective effects of the pyrrolopyrimidine U-104067F in 3-acetylpyridine-treated rats. Exp. Neurol. 1996; 140:79–83. 154. The Huntington Study Group. Safety and tolerability of the free-radical scavenger OPC-14117 in Huntington’s disease. Neurology 1998;50:1366–1373.
25 Nitric Oxide and the NMDA Receptor in Ischemia and Reperfusion Injury: Is NO Protective or Injurious? Michael Graham Espey, Katrina M. Miranda, and David A. Wink National Cancer Institute, National Institutes of Health, Bethesda, Maryland
Carol A. Colton Georgetown University Medical School, Washington, D.C.
Ryszard M. Pluta National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland
Sandra J. Hewett University of Connecticut Health Center, Farmington, Connecticut
I. INTRODUCTION The close interrelationship between the diatomic radical nitric oxide (NO) and the N-methyl-d-aspartate (NMDA) subtype of glutamate receptors in the central nervous system (CNS) has been an area of intensive research over the last decade. In 1988, Garthwaite, Bredt, and co-workers demonstrated that NMDA receptor stimulation was coupled with NO-mediated activation of soluble guanylate cyclase (GC) (6,19,20). NADPH-diaphorase reactivity, used for decades to visualize subpopulations of neurons histologically, was found to be associated with the isozyme of nitric oxide synthase (NOS) [termed neuronal nitric oxide synthase (nNOS)] that catalyzes the formation of NO from arginine (7,30). Subsequently, two other isozymes of NOS were described, i.e., endothelial (ecNOS) and inducible (iNOS), which also utilize NADPH as a cofactor (25,46,50). The activity of both ecNOS and nNOS are closely regulated by the concentration of cytosolic 523
524
Espey et al.
calcium, acting through a binding site for calmodulin. In some neurons, nNOS can associate with the R1 subunit of membrane-bound NMDA receptors via an interaction of their respective PDZ motifs with the docking protein PSD-95 (8,60). In this manner, the influx of calcium ions gated through an NMDA receptor–nNOS complex can result in the formation of NO, temporally and spatially linking NO with glutamate release. In addition to effects mediated through GC, NO can modulate neurotransmitter release, neuronal development, synaptic plasticity, and gene expression. In contrast to these regulatory functions, it has been suggested that production of NO may be neurotoxic and this diatomic radical has been implicated in a variety of neurological disorders involving excitotoxicity including ischemia and reperfusion injury. Although NO is generally considered to be deleterious during ischemia-reperfusion, there are conflicting data that suggest that it could be protective. This paradox is confounded by both the complexity of determining the contribution of each NOS isoform (either pharmacologically or genetically) in vivo and the differences in cell culture models of excitotoxicity. For the purpose of this chapter, we will evaluate how NO chemistry is releated to potential neurotoxic mechanisms associated with ischemia and reperfusion injury. More specifically, we will examine the relationship between NO chemistry and the NMDA receptor. The influence of NO sources, concentration, time, and the cellular milieu will be emphasized and the potential clinical role of NO donors and inhibitors will be discussed.
II. DIRECT AND INDIRECT CHEMICAL BIOLOGY OF NO In order to understand the complex molecular mechanisms of NO that can be found under different pathophysiological conditions in the CNS, a general discussion of the chemistry as it is associated with different toxicological mechanisms is useful. The primary determinant of NO effect in vivo is its chemistry. NO itself is a relatively unreactive molecule in vivo (72). When NO reacts with either oxygen or the oxy radical superoxide (O2⫺), the resultant products are termed reactive nitrogen oxide species (RNOS), which in turn interact with a wide range of key biological complexes (72). To decipher which NO species are involved in a biological system, the effect of NO can be separated into two basic categories, direct and indirect (Fig. 1) (70,72). Direct effects are mediated by NO when it binds directly to a site on the target molecule. The most common reactions of this type are those between NO and heme-containing proteins. These reactions are generally rapid and require low concentrations of NO (submicromolar). The direct reaction between NO and the heme moiety of soluble GC results in a rapid allosteric change to facilitate the conversion of GTP to cyclic GMP and may account for the majority of effects of NO in vivo (9,16).
NO and the NMDA Receptor in Ischemia
525
Figure 1 Scheme for direct and indirect effects of NO.
Conversely, indirect effects are mediated by NO when it forms RNOS prior to interacting with the biological targets. Indirect effects can be subdivided into either nitrosative or oxidative stress (72). Under biological conditions, NO reacts with oxygen to form NO2, which reacts with a second NO to generate N2O3 (NO ⫹ NO2). As the primary intermediate, N2O3 mediates nitrosative stress and donates the equivalent of nitrosonium ion (NO⫹). N2O3 can readily nitrosate thiol groups via S-nitrosation reaction to form RS-NO moieties. Indirect effects mediated by N2O3 are implicated in either the inhibition or degradation of a number of critical proteins such as caspase-3 (17,40), protein kinase C (22), DNA repair proteins (24,38,67), zinc finger proteins (37,67), metallothionein (37,48), and glyceraldehyde-3-phosphate dehydrogenase (10,49). The reaction between NO and the oxy radical superoxide results in the formation of another RNOS, peroxynitrite (ONOO⫺). Peroxynitrite can oxidize a wide range of biomolecules including proteins (56), lipids (29,58), and nucleic acids (35,59). Peroxynitrite has been proposed to be the primary cytotoxic species responsible for neuronal damage in numerous models of brain injury (4). Support for this
526
Espey et al.
view has stemmed from the use of tyrosine nitration as a marker for peroxynitrite formation (5,14). However, several reports have demonstrated that nitrotyrosine residues are not generated exclusively by peroxynitrite. Nitrotyrosine can be formed via the myeloperoxidase-catalyzed oxidation of nitrite (64), acidic nitrite (54), and RNOS generated from the NO/O2 reaction (possibly through NO2, N2O3) in hydrophobic media (68). Recent studies have shown that NO donors can nitrate tyrosine, and the level of modified residues was reduced by peroxynitrite (53). These reports suggest that the formation of nitrotyrosine may represent the presence of RNOS produced as a result of NO indirect effects in general. Both N2O3 and peroxynitrite can mediate cytotoxicity by altering protein structure and generating mutations in DNA (reviewed in Ref. 72). In contrast to direct effects, a much higher concentration of NO (greater than 1 µM) is required to achieve indirect effects (70). This suggests that both the concentration and duration of NO production are determinants in the advent of either direct or indirect effects. NO production catalyzed by either ecNOS or nNOS is conducive to direct effects, while the flux of NO catalyzed from the iNOS isozyme may potentially generate indirect effects. The reactive intermediates responsible for the indirect effects of NO have a chemistry that shows they can induce either nitrosative or oxidative stress depending on the reactive species involved (72). The chemistry of nitrosation in vivo may be mediated primarily by N2O3, while oxidative chemistry is mediated by peroxynitrite (71). This implies that a balance between nitrosative and oxidative stress exists. Each is produced by a different chemical mechanism and may determine differential biological outcomes.
III.
CHEMISTRY OF NO AND CYTOTOXICITY
In order to place the role of NO in the context of different cytotoxic mechanisms, an understanding of when NO chemistry can be either protective or toxic is important. Clonogenic assays have provided some insights into general cytotoxic properties of NO. NO is not a potent toxic agent, even when indirect effects are involved, for cultured cells such as fibroblast, tumor cells, or endothelial cells (74). However, NO can modify the toxicity of other species and modulate apoptotic mechanisms (72). The toxicological mechanisms of NO can be based on both direct and indirect effects. NO exposure from NO donors (e.g., NONOates, S-nitrosothiols) can result in the activation of various cellular responses such as GC (34,44). Direct effects may have profound effects on functions such as blood flow and leukocyte adhesion. This can make deciphering definitive molecular mechanisms in vivo difficult. At the cellular level, low amounts of NO have been shown to have a protective effect against oxidative stress mediated by reactive oxygen species
NO and the NMDA Receptor in Ischemia
527
(ROS) such as H2O2 and superoxide. Several studies have shown that NO donor compounds abate the cytotoxicity elicited by of millimolar levels of ROS (27,66,69). Despite the formation of peroxynitrite, NO is protective in mammalian cells against ROS (66). Additional experiments have shown that NO protects against agents that mediate lipid peroxidation (e.g., alkylhydroperoxides) (69). In general, NO protects against chemical agents that mediate their toxicity through ROS in a wide variety of mammalian cells. The formation of nitrosative and oxidative stress mediated by intermediates derived from NO can render the cell susceptible to different toxins. Oxidative stress mediated by peroxynitrite or nitroxyl (NO⫺) can result in DNA damage and cell death. However, high concentrations of extracellular peroxynitrite or NO⋅ are required to mediate these events. Nitrosation of thiols can inhibit specific DNA repair proteins resulting in potentiation of the toxicity of some cytotoxic agents (13,38,48,73). Moreover, nitrosative stress can also induce the release of toxic metals or result in the formation of carcinogenic nitrosamines (42,45,48). Nitrosative stress can result in modification of caspases and mitochondrial proteins ultimately effecting apoptosis (11). In general, low amounts of NO will protect cells against the cytotoxic action of ROS and other forms of oxidative stress. Higher concentrations of NO that may be generated following expression of iNOS can modify some key biomolecules, weakening cellular defenses against different cytotoxic agents. In mechanisms involving apoptotic processes, the overall action of either oxidative or nitrosative stress will strongly depend on the target protein, time of exposure, and molecular pathways (discussed in Ref. 72). Ion channels are also modified by oxidative and nitrosative stress. The most extensively studied is the NMDA receptor, one of three classes of ionotropic glutamate receptors in the CNS. Although conflicting data exist, the NMDA receptor is directly implicated in the excitotoxicity that accompanies ischemia-reperfusion injury in the brain.
IV.
REDOX REGULATION OF THE NMDA RECEPTOR
The amplitude of NMDA-evoked responses can be modified by the redox status of the receptor complex (Fig. 2). Thiol reductants potentiate [e.g., 4 mM dithiothreitol increases the amplitude of NMDA-evoked currents twofold (3)], while thiol oxidants decrease (but do not completely inhibit) NMDA-evoked currents (12,23,75). Mutation analysis of recombinant subunits expressed in oocytes suggests that multiple redox modulatory interactions may exist dependent on the configuration of the NMDA receptor complex (63). The sensitivity of cortical neurons to dithiothreitol-induced potentiation decreases with time in culture (62). These data suggest that the redox equilibrium of NMDA receptors in mature neurons may limit Ca2⫹ conductance during periods of oxidative stress and render these cells less vulnerable to reductive stress.
528
Espey et al.
Figure 2
V.
NITROSATIVE STRESS AND S-NITROSATION
A neuroprotective role for NO has been proposed to occur through the S-nitrosylation and/or S-nitrosation of redox modulatory sites on the NMDA receptor complex. In early studies, Lipton and co-workers used the NO donor compounds (NO⫹ equivalents) sodium nitroprusside (SNP), nitroglycerine (NTG), and S-nitrosocysteine (SNOC, plus superoxide dismutase) to support this hypothesis (39,41). However, the precise mechanism of action with these compounds has not been rigorously tested and the formation of other intermediates (e.g., SNP, cyanide; lipid radical NTG mimetics; see below) cannot be ruled out. Factors that influence the decomposition SNOC in solution, e.g., pH, transition metal ions (notably Cu⫹), and endogenous reductants (glutathione and ascorbate), play a strong role in its ultimate reactive intermediate chemistry (36,47,61). Therefore,
NO and the NMDA Receptor in Ischemia
529
the buffer system and the influence of glial in these coculture experiments can be pivotal. In our direct/indirect scheme of NO reactions (Fig. 1), the generation of Snitrosation via N2O3 in vivo would require both high levels of NO and an aerobic environment. The production of l-arginine-derived NO catalyzed by nNOS decreases with increasing concentrations of NO (1) and also decreases as oxygen tension falls (2). The feedback inhibition of nNOS by NO combined with the lowered oxygen tension inherent to ischemia suggests that neurons cannot generate sufficient NO to elicit S-nitrosation reactions on the NMDA receptor complex during the initial phase of ischemic injury. When can an S-nitrosation mechanism for closure of the NMDA receptor occur? The expression of iNOS in rats was detected only after 24 h and peaked at 48 h, following occlusion of the middle cerebral artery (33). However, expression of iNOS is not synonymous with the generation of copious amounts of NO. While cytokines may induce iNOS expression in leukocytes and glia (e.g., interferon-γ and tumor necrosis factor-α), additional signals may be required to elicit S-nitrosation capacity (17b). The production of NO catalyzed by iNOS in the later stages following ischemia may be insufficient to S-nitrosate the NMDA receptor. Rather, a low NO flux from cells expressing iNOS may potentiate NMDA-evoked Ca2⫹ conductance (e.g., Ref. 28; also see below) consistent with the protective effect of aminoguanidine administered in this latter stage (78). These data suggest that S-nitrosation may not be a mechanism governing the conductance status of the NMDA receptor either in the initial ischemic or later postischemic periods. Inhibition of NMDA receptor activity by S-nitrosation may be a more relevant during infectious diseases with excitotoxic components (e.g., sepsis, meningitis; authors’ observations). Recent data suggest that high levels of NO (equivalent to 1 mM NO donors with a half-life of less than 15 min) may mediate protection against NMDAinduced neuronal death independent of S-nitrosation and cGMP-coupled mechanisms (78a). In this study, a broad range of NO donor compounds decreased NMDA-evoked Ca2⫹ conductance and neuronal death in an NO concentration– dependent manner. No correlation was found between protection and the ability of donor compounds to produce N2O3 (NO⫹ equivalent species). Ascorbate, which homolytically cleaves NO from S-nitrosothiols, did not alter blockade of Ca2⫹ conductance or attenuate protection. These data suggest that NO may interact directly with the NMDA receptor to limit Ca2⫹ entry at sites other than thiols such as the amino groups of lysyl residues. The target site(s), whether modified by direct effect or indirect nitrosative stress in a region inaccessible to ascorbate, would require high concentrations of NO for sustained periods to inactivate the NMDA receptor. This mechanism would be consistent with NO generation catalyzed by iNOS during infectious disease rather than in the primary events of ischemic injury of the brain.
530
VI.
Espey et al.
OXIDATIVE STRESS AND PEROXYNITRITE CHEMISTRY
The formation of peroxynitrite has been proposed to be a major mechanism involved in NO-mediated neurotoxicity. Exposure of both bacterial and mammalian cells to synthetically produced peroxynitrite can result in cell death (81; see review in Ref. 55). However, treatment of neurons with a combination of NO donors and the superoxide generator system of xanthine oxidase/hypoxanthine (XO) was not cytotoxic (66). Moreover, NO donors under these conditions ameliorate superoxide-mediated toxicity (69). Other studies have shown that ovarian carcinoma cells exposed to SIN-1 (5 mM), which releases superoxide and NO simultaneously, resulted in no appreciable toxicity (18). These results suggest that differences exist between using synthetically generated peroxynitrite and a combined NO/O2⫺ generating system. Part of the discrepancies in these data may be explained by the concentration of reactants. Beckman and co-workers reported that a bolus delivery of synthetically generated peroxynitrite (1 mM) was required to sufficiently penetrate into bacteria (81). Consistent with this, doses of peroxynitrite less than 100 µM (applied for 18 h) do not elicit neuronal death (41). Simultaneous NO and superoxide generation in vitro results the formation of peroxynitrite stoichiometrically over a specific period of time. However, this ephemeral chemical species (half-life ⬃2 s; Ref. 55) does not accumulate to the level required to exert the cytotoxic activity observed with a bolus application. The in vivo conditions that would recapitulate a bolus application of peroxynitrite exogenously may be rare. The impediment that the plasma membrane imposes on peroxynitrite availability to target molecules would be obviated in the case of intracellular formation. While NADPH oxidase, the major generator of superoxide, releases this oxy radical into the extracelluar space, intracellular superoxide sources also exist including the mitochondrial respiratory chain. The intracellular availability of superoxide for NO would be in competition with superoxide dismutase isozymes and other antioxidant systems reducing the probability of superoxide–NO interaction and peroxynitrite formation. For levels of peroxynitrite to accumulate, the ratio of NO to superoxide must be equal; the concentration of NO must be low to maintain a 1:1 balance when superoxide concentration is low. Furthermore, additional NO can react with peroxynitrite to form NO2 /N2O3. In this manner, the formation of peroxynitrite is severely limited by both the proximity of NO and superoxide sources to each other and the redox capacity of the intermediate milieu. Following ischemia, the return of oxygen tension during reperfusion greatly increases ROS levels in brain (17a). For peroxynitrite to be a predominant species under these conditions, NO levels would have to initially increase in parallel with the superoxide and then fall when superoxide levels subside. Analysis of NOS
NO and the NMDA Receptor in Ischemia
531
isozymes suggests that iNOS is best suited for high-level NO production that could match the initial burst of superoxide; however, its induction of iNOS is delayed until 24 to 48 h after the onset of ischemia (33). Regardless of when peroxynitrite is putatively formed, its oxidant properties should act on the redox modulatory sites of the NMDA receptor to close the channel. Therefore, the neurotoxic site of peroxynitrite action is likely to be independent of NMDA receptor activity. Since NO can act as an antioxidant to terminate chain propagation reactions during lipid peroxidation, a shift in the 1:1 balance of NO and superoxide toward NO at the site of peroxynitrite formation could ameliorate lipid peroxidation damage by this species. While specific biomolecules may be affected by peroxynitrite toxicity, the temporal incongruity of superoxide and NO production during ischemia-reperfusion suggests a limited role for this RNOS in neuronal damage and death.
VII. SCHEME OF NO PRODUCTION DURING ISCHEMIA AND REPERFUSION Using an NO-sensitive electrode, it has been shown in a rat carotid occlusion model that a small burst (⬃50 nM) of NO production occurs coincident with the onset of ischemia, and a secondary increase (⬃200 nM) peaks 25 min after reperfusion (personal communication, Pluta). NMDA receptor–mediated Ca2⫹ influx and activation of nNOS-catalyzed degradation of arginine would temporally couple NO synthesis with ischemia-induced glutamatergic hyperactivation. In our scheme of NO reactions, this low-flux pulse is insufficient to generate indirect effects that lead to the closing of the NMDA receptor pore. Patch clamp analysis of recombinant NMDA receptor expressed in HEK cells indicates that brief applications of NO donors (equivalent to approximately a 4 µM flux) coincident with glutamate results in an increase in the channel open probability and a decrease in desensitization (Colton, personal communication). These results are consistent with the potentiating effect of arginine on NMDA-evoked currents in cultured cortical neurons (43) and the reduction in NMDA receptor mediated Ca2⫹ flux and neuronal death following nNOS inhibition or genomic disruption (15). It is noteworthy that the potentiating effects of low NO fluxes on the NMDA receptor is enhanced as oxygen tension falls (Colton, personal communication). The oxygen requirement for nNOS activity may be aided by an ischemic acidosis–induced Bohr shift in erythrocytes leading to a brief surge in oxygen tension. These data suggest that NO generated in this manner may play a role in potentiating entry of Ca2⫹ through the NMDA receptor during the initial events of isch-
532
Espey et al.
emia. These observations are in agreement with studies indicating that inhibition of nNOS activity reduces infarct volume after middle cerebral artery occlusion (31,80). The apparent deleterious direct reaction of NO with the NMDA receptor must be contrasted with concurrent beneficial effects of NO on capillary blood flow. Inhibition of all NOS isoforms with nitroarginine methyl ester during this initial period of ischemia increases infarct size (77). NMDA receptor–evoked increase in nNOS activity plays a selective role in regulating cerebral blood flow and may constitute a mechanism for controlling capillary erythrocyte flow during hypoxia (32,51). In cases of focal ischemia (as opposed to global, e.g., heart failure), the beneficial effects of NO production catalyzed by nNOS in the penumbra region may outweigh the loss of select NMDA receptor–bearing neurons. Confounding variables from animal studies are the effects of anesthesia (76), selectivity of NOS inhibitors (57), and the emergence of compensatory systems in response to chronic NOS inhibition generated either pharmacologically or genetically (e.g., 52). In the period following the initial burst of NO during the onset of ischemia, the nNOS enzyme is still fully activated by the NMDA receptor–evoked increase in cytosolic Ca2⫹ and subsequent binding of calmodulin. However, as the concentration of arginine becomes limited, the oxidation of NADPH is uncoupled from NO production and the enzyme becomes a superoxide generator (25,26). Under these conditions, NMDA receptor complexes physically linked to nNOS (via PSD-95 motifs) should shut due to the oxidation of the redox site(s). As oxygen levels continue to fall after the onset of ischemia, a reductive environment may predominate over oxidation. Therefore, reductive stress may continue to modulate the redox sites on the NMDA receptor to an open state, exacerbating dysregulation of cytosolic Ca2⫹ homeostasis. With the increase in oxygen tension following reperfusion, increased superoxide levels can lead to the formation of a variety of ROS including H2O2, which may be a more relevant neurotoxic effector molecule than peroxynitrite under these conditions. During this oxidative period, the NMDA receptor complex would be in a closed state, as predicted by oxidation of redox modulatory sites. It is of interest that nNOS neurons are initially spared in vivo during ischemia and reperfusion (79). Only specific combinations of NMDA receptor subunit complexes may be associated with nNOS in vivo (65) suggesting that the nNOS-NMDA receptor scenarios depicted above may be significant for only select neuronal subpopulations. Recently, it has been shown that MnSOD expression in nNOS neurons may confer resistance to excitoxicity (21). A role for NO in the induction of MnSOD expression illustrates how NO may serve as a neuroprotectant in some neurons while potentiating toxicity in others. Given the complexity of these diverse roles for NO, a mixture of results in the various experimental paradigms is understandable.
NO and the NMDA Receptor in Ischemia
533
VIII. CLINICAL INSIGHTS AND THE POTENTIAL USE OF NOS INHIBITORS A model of NO in cerebral ischemia-reperfusion injury is depicted in Fig. 3. With the onset of ischemia (stage 1), a small burst of NO enhances the opening of the NMDA receptors, elevating intracellular Ca2⫹ in neurons bearing these channels. The use of NOS inhibitors at this point would aid in reducing the toxicity of Ca2⫹ overload in these neurons; however, this benefit must be weighed against the potentially deleterious effect of further constricting cerebral blood flow. As oxygen and arginine availability subside in the latent period of ischemia (stage 2), nNOS becomes uncoupled and briefly generates superoxide. However, this production may be insufficient to impact the dominant reductive environment of stage 2. Major ROS production occurs in stage 3 concomitant with increasing oxygen tension as the tissue is reperfused with blood. The redox model of the
Figure 3 Scheme for NO and ROS generation during ischemia/reperfusion injury of the brain (see text).
534
Espey et al.
NMDA receptor predicts closure of the channel in stage 3. Therefore, ROS mediate neurotoxicity independent of NMDA receptor status via oxidation of key biomolecular targets. NO levels rise in stage 3 slightly preceding the increase in ROS. At this point, NO may serve to reduce the degree of oxidative stress elicited by ROS such as the termination of lipid peroxidation reactions. This is consistent with the results of a recent study demonstrating that the application of NO donor compounds (e.g., DEA/NO, 1 µM i.v.) upon reperfusion lowers ROS levels and infarct volume (Pluta, personal communication). In summary, pharmacological intervention of NO action at the level of the NMDA receptor in the initial moments of stroke, heart failure, etc., may not be feasible. However, augmentation of NO levels via delivery of NO donor compounds at later time points following reperfusion (stage 3) might aid in ameliorating the impact of ROS-mediated oxidative neurotoxocity.
REFERENCES 1.
2.
3.
4. 5.
6. 7.
8.
9.
Abu-Soud, H.M., J. Wang, D.L. Rousseau, J.M. Fukuto, L.J. Ignarro, and D.J. Stuehr (1995). Neuronal nitric oxide synthase self-inactivates by forming a ferrous-nitrosyl complex during aerobic catalysis. J. Biol. Chem. 270:22997–23006. Abu-Soud, H.M., D.L. Rousseau, and D.J. Stuehr (1996). Nitric oxide binding to the heme of neuronal nitric-oxide synthase links its activity to changes in oxygen tension. J. Biol. Chem. 271:32515–32518. Aizenman, E., F.E. Jensen, P.M. Gallop, P.A. Rosenberg, and L.H. Tang (1994). Further evidence that pyrroloquinoline quinone interacts with the N-methyl-d-aspartate receptor redox site in rat cortical neurons in vitro. Neurosci. Lett. 168:189– 192. Beckman, J.S. (1991). The double-edged role of nitric oxide in brain function and superoxide-mediated injury. J. Dev. Physiol. 15:53–59. Beckman, J.S., Y.Z. Ye, J. Anderson, M.A. Chen, M.A. Accavitti, M.M. Tarpey, and C.R. White (1994). Extensive nitration of protein tyrosines in human atherosclerosis detected by immunohistochemistry. Biol. Chem. Hoppe-Seyler 375:81–88. Bredt, D.S., P.M. Hwang, and S.H. Snyder (1990). Localization of nitric oxide synthase indicating a neural role for nitric oxide. Nature 347:768–770. Bredt, D.S., C.E. Glatt, P.M. Hwang, M. Fotuhi, T.M. Dawson, and S.H. Snyder (1991). Nitric oxide synthase protein and mRNA are discretely localized in neuronal populations of the mammalian CNS together with NADPH diaphorase. Neuron 7: 615–624. Brenman, J.E., D.S. Chao, S.H. Gee, A.W. McGee, S.E. Craven, D.R. Santillano, Wu Z, F. Huang, H. Xia, M.F. Peters, S.C. Froehner, and D.S. Bredt (1996). Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and alphalsyntrophin mediated by PDZ domains. Cell 84:757–767. Burstyn, J.N., A.E. Yu, E.A. Dierks, B.K. Hawkins, and J.H. Dawson (1995). Studies of the heme coordination and ligand binding properties of soluble guanylyl cyclase
NO and the NMDA Receptor in Ischemia
535
(sGC): characterization of Fe(II)sGC and Fe(II)sGC(CO) by electronic absorption and magnetic circular dichroism spectroscopies and failure of CO to activate the enzyme. Biochemistry 34:5896–5903. 10. Clancy, R.M., D. Levartovsky, J. Leszczynska-Piziak, J. Yegudin, and S.B. Abramson (1994). Nitric oxide reacts with intracellular glutathione and activates the hexose monophosphate shunt in human neutrophils: evidence for S-nitrosoglutathione as a bioactive intermediary. Proc. Natl. Acad. Sci. USA 91:3680–3684. 11. Clementi, E., G.C. Brown, M. Feelisch, and S. Moncada (1998). Persistent inhibition of cell respiration by nitric oxide: crucial role of S-nitrosylation of mitochondrial complex I and protective action of glutathione. Proc. Natl. Acad. Sci. USA 95:7631– 7636. 12. Colton, C.A.,. J.S. Colton, and D.L. Gilbert (1986). Changes in synaptic transmission produced by hydrogen peroxide. Free Rad. Biol. Med. 2:141–148. 13. Cook, J.A., M.C. Krishna, R. Pacelli, W. DeGraff, J. Liebmann, A. Russo, J.B. Mitchell, and D.A. Wink (1997). Nitric oxide enhancement of melphalan-induced cytotoxicity. Br. J. Cancer 76:325–334. 14. Crow, J.P., and H. Ischiropoulos (1996). Detection and quantitation of nitrotyrosine residues in proteins: in vivo marker of peroxynitrite. Meth. Enzymol. 269:185–94. 15. Dawson, V.L., T.M. Dawson, E.D. London, D.S. Bredt, and S.H. Snyder (1991). Nitric oxide mediates glutamate neurotoxicity in primary cortical cultures. Proc. Natl. Acad. Sci. USA 88:6368–6371. 16. Deinum, G., J.R. Stone, G.T. Babcock, and M.A. Marletta (1996). Binding of nitric oxide and carbon monoxide to soluble guanylate cyclase as observed with resonance Raman spectroscopy. Biochemistry 35:1540–1547. 17. Dimmeler, S., and A.M. Zeiher (1997). Nitric oxide and apoptosis: another paradigm for the double-edged role of nitric oxide. Nitric Oxide 1:275–281. 17a. Dugan, L.L., T.S. Lin, Y.Y. He, C.Y. Hsu, and D.W. Choi (1995). Detection of free radicals by microdialysis/spin trapping EPR following focal cerebral ischemiareperfusion and a cautionary note on the stability of 5,5-dimethyl-1-pyrroline Noxide (DMPO). Free Radic. Res. 23:27–32. 17b. Espey, M.G., K.M. Miranda, R.M. Pluta, and D.A. Wink (1999). Nitrosative capacity of macrophages is dependent on nitric oxide synthase induction signals. Biol. Chem. (submitted). 18. Farias-Eisner, R., G. Chaudhuri, E. Aeberhard, and J.M. Fukuto (1996). The chemistry and tumoricidal activity of nitric-oxide hydrogen-peroxide and the implications to cell resistance susceptibility. J. Biol. Chem. 271:6144–6151. 19. Garthwaite, J., S.L. Charles, and R. Chess-Williams (1988). Endothelium-derived relaxing factor release on activation of NMDA receptors suggests a role as intercellular messenger in the brain. Nature 336:385–388. 20. Garthwaite, J., and C.L. Boulton (1995). Nitric oxide signaling in the central nervous system. Annu. Rev. Physiol. 57:683–706. 21. Gonzalez-Zulueta, M., L.M. Ensz, G. Mukhina, R.M. Lebovitz, R.M. Zwacka, J.F. Engelhardt, L.W. Oberley, V.L. Dawson, and T.M. Dawson (1998). Manganese superoxide dismutase protects nNOS neurons from NMDA and nitric oxide–mediated neurotoxicity. J. Neurosci. 18:2040–255. 22. Gopalakrishna, R., Z.H. Chen, and U. Gundimeda (1993). Nitric oxide and nitric
536
23. 24.
25. 26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
Espey et al. oxide generating agents induce a reversible inactivation of protein kinase c activity and phorbol ester binding. J. Biol. Chem. 268:27180–27185. Gozlan, H., and Y. Ben-Ari (1995). NMDA receptor redox sites: are they targets for selective neuronal protection? Trends Pharmacol. Sci. 16:368–374. Graziewicz, M., D.A. Wink, and F. Laval (1996). Nitric oxide inhibits DNA ligase activity. Potential mechanisms for NO mediated DNA damage. Carcinogenesis 17: 2501–2505. Griffith, O.W., and D.J. Stuehr (1995). Nitric oxide synthases: properties and catalytic mechanism. Annu. Rev. Physiol. 57:707–736. Grima, G., M. Cuenod, S. Pfeiffer, B. Mayer, and K.Q. Do (1998). Arginine availability controls the N-methyl-d-aspartate-induced nitric oxide synthesis: involvement of a glial-neuronal arginine transfer. J. Neurochem. 71:2139–2144. Gupta, M.P., V. Evanoff, and C.M. Hart (1997). Nitric oxide attenuates hydrogen peroxide-mediated injury to porcine pulmonary artery endothelial cells. Am. J. Physiol. 272:L1133–1141. Hewett, S.J., C.A. Csernansky, and D.W. Choi (1994). Selective potentiation of NMDA-induced neuronal injury following induction of astrocytic iNOS. Neuron 13: 487–494. Hogg, N., V.M. Darley-Usmar, M.T. Wilson, and S. Moncada (1993). The oxidation of a in human low-density lipoprotein by the simultaneous generation of superoxide and nitric oxide. FEBS Lett. 326:199–203. Hope, B.T., G.J. Michael, K.M. Knigge, and S.R. Vincent (1991). Neuronal NADPH diaphorase is a nitric oxide synthase. Proc. Natl. Acad. Sci. USA 88:2811–284. Huang, Z., P.L. Huang, N. Panahian, T. Dalkara, M.C. Fishman, and M.A. Moskowitz (1994). Effects of cerebral ischemia in mice deficient in neuronalnitric oxide synthase. Science 265:1883–1885. Hudetz, A.G., H. Shen, and J.P. Kampine (1998). Nitric oxide from neuronal NOS plays critical role in cerebral capillary flow response to hypoxia. Am. J. Physiol. 274:H982–989. Iadecola, C., F. Zhang, S. Xu, R. Casey, and M.E. Ross (1995). Inducible nitric oxide synthase gene expression in brain following cerebral ischemia. J. Cereb. Blood. Flow Metab. 15:378–384. Ignarro, L.J., J.C. Edwards, D.Y. Gruetter, B.K. Barry, and C.A. Gruetter (1980). Possible involvement of S-nitrosothiols activation of guanylate cyclase nitroso compounds, FEBS Lett. 110:275–278. Kennedy, L.J., K.J. Moore, J.L. Caulfield, S.R. Tannenbaum, and P.C. Dedon (1997). Quantitation of 8-oxoguanine and strand breaks produced by four oxidizing agents. Chem. Res. Toxicol. 10:386–392. Kowaluk, E.A., and H.L. Fung (1990). Spontaneous liberation of nitric oxide cannot account for in vitro vascular relaxation by S-nitrosothiols. J. Pharmacol. Exp. Ther. 255:1256–1264. Kroncke, K.-D., K. Fechsel, T. Schmidt, F.T. Zenke, I. Dasting, J.R. Wesener, H. Bettermann, K.D. Breunig, and V. Kolb-Bachofen (1994). Nitric oxide destoys zincfinger clusters inducing zinc release from metallothionein and inhibition of the zinc finger-type yeast transcription activator LAC9. Biochem. Biophys. Res. Commun. 200:1105–1110.
NO and the NMDA Receptor in Ischemia 38. 39.
40.
41.
42.
43. 44.
45. 46. 47. 48.
49.
50. 51.
52.
53. 54.
537
Laval, F., and D.A. Wink (1994). Inhibition by nitric oxide of the repair protein O6methylguanin-DNA-methyltransferase. Carcinogenesis 15:443–447. Lei, S.Z., Z.H. Pan, S.K. Aggarwal, H.S. Chen, J. Hartman, N.J. Sucher, and S.A. Lipton (1992). Effect of nitric oxide production on the redox modulatory site of the NMDA receptor-channel complex. Neuron 8:1087–1099. Li, J., T.R. Billiar, R.V. Talanian, and Y.M. Kim (1997). Nitric oxide reversibly inhibits seven members of the caspase family via S-nitrosylation. Biochem. Biophys. Res. Commun. 240:419–424. Lipton, S.A., Y.B. Choi, Z.H. Pan, S.Z. Lei, H.S. Chen, N.J. Sucher, J. Loscalzo, D.J. Singel, and J.S. Stamler (1993). A redox-based mechanism for the neuroprotective and neurodestructive effects of nitric oxide and related nitroso-compounds. Nature 364:626–632. Liu, R.H., B. Baldwin, B.C. Tennant, and J.H. Hotchkiss (1991). Elevated formation of nitrate and N-nitrosodimethylamine in woodchucks (Marmota monax) associated with chronic woodchuck hepatitis virus infection. Cancer Res 51:3925–3929. Manzoni, O., and J. Bockaert (1993). J. Neurochem. 61:368–370. Maragos, C.M., D. Morley, D.A. Wink, T.M. Dunams, J.E. Saavedra, A. Hoffman, A.A. Bove, L. Isaac, J.A. Hrabie, and L.K. Keefer (1991). Complexes of NO with nucleophiles as agents for the controlled biological release of nitric oxide. Vasorelaxant effects. J. Med. Chem. 34:3242–3247. Marletta, M.A. (1988). Mammalian synthesis of nitrite, nitrate, nitric oxide and Nnitrosating agents. Chem. Res. Toxicol. 1:249–257. Marletta, M.A. (1993). Nitric oxide synthase structure and mechanism. J. Biol. Chem. 268:12231–12234. Mathews, W.R., and S.W. Kerr (1993). Biological activity of S-nitrosothiols: the role of nitric oxide. J. Pharmacol. Exp. Ther. 267:1529–1537. Misra, R.R., J.F. Hochadel, G.T. Smith, M.P. Waalkes, and D.A. Wink (1996). Evidence that nitric oxide enhances cadmium toxicity by displacing the metals from metallothionein. Chem. Res. Toxicol. 10:326–332. Molina y Vedia, L., B. McDonald, B. Reep, B. Brune, M. DiSilvio, T.R. Billiar, and E.G. Lapetina (1992). Nitric oxide-induced S-nitrosylation of glyceraldehyde3-phosphate dehydrogenase inhibits enzymatic activity and increases endogenous ADP-ribosylation. J. Biol. Chem. 267:24929–24932. Nathan, C., and Q. Xie (1994). Regulation of biosynthesis of nitric oxide. J. Biol. Chem. 269:13725–13728. Pelligrino, D.A., Q. Wang, H.M. Koenig, and R. Albrecht (1995). Role of nitric oxide, adenosine, N-methyl-d-aspartate receptors, and neuronal activation in hypoxia-induced pial arteriolar dilation in rats. Brain Res. 704:61–70. Pelligrino, D.A., R.L.r. Gay, V.L. Baughman, and Q. Wang (1996). NO synthase inhibition modulates NMDA-induced changes in cerebral blood flow and EEG activity. Am. J. Physiol. 271:H990–995. Pfeiffer, S., and B. Mayer (1998). Lack of tyrosine nitration by peroxynitrite generated at physiological pH., J. Biol. Chem. 273:27280–27285. Prutz, W.A., H. Monig, J.L. Butler, and E. Land (1985). Reactions of nitrogen dioxide in aqueous model systems: oxidation of tyrosine units in peptides and proteins. Arch. Biochem. Biophys. 243:125–134.
538 55.
56.
57. 58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
Espey et al. Pryor, W.A., and G.L. Squadrito (1996). The chemistry of peroxtynitrite and peroxynitrous acid: Products from the reaction of nitric oxide with superoxide. Am. J. Phys. 268:L699–721. Radi, R., J.S. Beckman, K.M. Bush, and B.A. Freeman (1991). Peoxynitrite oxidation of sulfhydryls: the cytotoxic potential of superoxide and nitric oxide. J. Biol. Chem. 266:4244–4250. Reiner, A., and Y. Zagvazdin (1998). On the selectivity of 7-nitroindazole as an inhibitor of neuronal nitric oxide synthase. Trends Pharmacol. Sci. 19:348–350. Rubbo, H., R. Radi, M. Trujillo, R. Telleri, B. Kalyanaraman, S. Barnes, M. Kirk, and B.A. Freeman (1994). Nitric oxide regulation of superoxide and peroxynitrite dependent lipid peroxidation: formation of novel nitrogen containing oxidized lipid derivatives. J. Biol. Chem. 269:26066–26075. Salgo, M.G., E. Bermudez, G.L. Squadrito, and W.A. Pryor (1995). Peroxynitrite causes DNA damage and oxidation of thiols in rat thymocytes. Arch. Biochem. Biophys. 322:500–505. Schepens, J., E. Cuppen, B. Wieringa, and W. Hendriks (1997). The neuronal nitric oxide synthase PDZ motif binds to-G(D,E)XV* carboxyterminal sequences. FEBS Lett. 409:53–56. Singh, S.P., J.S. Wishnok, M. Keshive, W.M. Deen, and S.R. Tannenbaum (1996). The chemistry of the S-nitrosoglutathione/glutathione system. Proc. Natl. Acad. Sci. USA 93:14428–14433. Sinor, J.D., F.A. Boeckman, and E. Aizenman (1997). Intrinsic redox properties of N-methyl-d-aspartate receptor can determine the developmental expression of excitotoxicity in rat cortical neurons in vitro. Brain Res. 747:297–303. Sullivan, J.M., S.F. Traynelis, H.S. Chen, W. Escobar, S.F. Heinemann, and S.A. Lipton (1994). Identification of two cysteine residues that are required for redox modulation of the NMDA subtype of glutamate receptor. Neuron 13:929–936. van der Vliet, A., J.P. Eiserich, C.A. O’Neill, B. Halliwell, and C.E. Cross (1995). Tyrosine modification by reactive nitrogen species: a closer look., Arch. Biochem. Biophys. 319:341–349. Weiss, S.W., D.S. Albers, M.J. Iadarola, T.M. Dawson, V.L. Dawson, and D.G. Standaert (1998). NMDAR1 glutamate receptor subunit isoforms in neostriatal, neocortical, and hippocampal nitric oxide synthase neurons. J. Neurosci. 18:1725–1734. Wink, D.A., I. Hanbauer, M.C. Krishna, W. DeGraff, J. Gamson, and J.B. Mitchell (1993). Nitric oxide protects against cellular damage and cytotoxicity from reactive oxygen species. Proc. Natl. Acad. Sci. USA 90:9813–9817. Wink, D.A., and J. Laval (1994). The Fpg protein, a DNA repair enzyme, is inhibited by the biomediator nitric oxide in vitro and in vivo. Carcinogenesis 15:2125– 2129. Wink, D.A., R.W. Nims, J.F. Darbyshire, D. Christodoulou, I. Hanbauer, G.W. Cox, F. Laval, J. Laval, J.A. Cook, M.C. Krishna, W. DeGraff, and J.B. Mitchell (1994). Reaction kinetics for nitrosation of cysteine and glutathione in aerobic nitric oxide solutions at neutral pH. Insights into the fate and physiological effects of intermediates generated in the NO/O2 reaction. Chem. Res. Toxicol. 7:519–525. Wink, D.A., J. Cook, R. Pacelli, W. DeGraff, J. Gamson, J. Liebmann, M. Krishna, and J.B. Mitchell (1996a). Effect of various nitric oxide-donor agents on peroxide
NO and the NMDA Receptor in Ischemia
539
mediated toxicity. A direct correlation between nitric oxide formation and protection. Arch. Biochem. Biophys. 331:241–248. 70. Wink, D.A., M. Grisham, J.B. Mitchell, and P.C. Ford (1996). Direct and indirect effects of nitric oxide. Biologically relevant chemical reactions in biology of NO. Meth. Enzymol. 268:12–31. 71. Wink, D.A., J.A. Cook, S. Kim, Y. Vodovotz, R. Pacelli, M.C. Kirshna, A. Russo, J.B. Mitchell, D. Jourd’heuil, A.M. Miles, and M.B. Grisham (1997). Superoxide modulates the oxidation and nitrosation of thiols by nitric oxide derived reactive intermediates. J. Biol. Chem. 272:11147–11151. 72. Wink, D.A., and J.B. Mitchell (1998). The chemical biology of nitric oxide: insights into regulatory, cytotoxic and cytoprotective mechanisms of nitric oxide. Free Rad. Biol. Med. 25:434–456. 73. Wink, D.A., J.A. Cook, D. Christodoulou, M.C. Krishna, P. Pacelli, S. Kim, W. DeGraff, J. Gamson, Y. Vodovotz, A. Russo, and J.B. Mitchell (1997b). Nitric oxide (NO) and some NO donor compounds enhance the cytotoxicity of cisplatin. Nitric Oxide 1:88–94. 74. Wink, D.A., I. Hanbauer, M.B. Grisham, F. Laval, R.W. Nims, J. Laval, J.C. Cook, R. Pacelli, J. Liebmann, M.C. Krishna, M.C. Ford, and M. JB (1996). The chemical biology of NO. Insights into regulation, protective and toxic mechanisms of nitric oxide. Curr. Top. Cell. Regul. 34:159–187. 75. Woodward, J.J., and R. Blair (1991). Redox modulation of N-methyl-d-aspartate– stimulated neurotransmitter release from rat brain slices. J. Neurochem. 57:2059– 2064. 76. Zagvazdin, Y., G. Sancesario, M.E.C. Fitzgerald, and A. Reiner (1998). Effects of halothane and urethane-chloralose anaesthesia on the pressor and cerebrovascular responses to 7-Nitroindazole, an inhibitor of nitric oxide synthase. Pharmacol. Res. 38:339–346. 77. Zhang, F., S. Xu, and C. Iadecola (1995). Time dependence of effect of nitric oxide synthase inhibition on cerebral ischemic damage. J. Cereb. Blood Flow Metab. 15: 595–601. 78. Zhang, F., R.M. Casey, M.E. Ross, and C. Iadecola (1996). Aminoguanidine ameliorates and l-arginine worsens brain damage from intraluminal middle cerebral artery occlusion. Stroke 27:317–323. 78a. Gbadegesin, M., S. Vicini, S. Hewett, D.A. Wink, M.G. Espey, R.M. Pluta, and C.A. Colton (1999). Nitric oxide induces potentiation of NMDA receptor whole cell currents and single channel properties. Am. J. Physiol. 277: in press. 79. Zhang, Z.G., M. Chopp, S. Gautam, C. Zaloga, R.L. Zhang, H.H. Schmidt, J.S. Pollock, and U. Forstermann (1994). Upregulation of neuronal nitric oxide synthase and mRNA, and selective sparing of nitric oxide synthase-containing neurons after focal cerebral ischemia in rat. Brain Res. 654:85–95. 80. Zhang, Z.G., D. Reif, J. Macdonald, W.X. Tang, D.K. Kamp, R.J. Gentile, W.C. Shakespeare, R.J. Murray, and M. Chopp (1996). ARL 17477, a potent and selective neuronal NOS inhibitor decreases infarct volume after transient middle cerebral artery occlusion in rats. J. Cereb. Blood Flow Metab. 16:599–604. 81. Zhu, L., C. Gunn, and J.S. Beckman (1992). Bactericidal activity of peroxynitrite. Arch. Biochem. Biophys. 298:452–457.
26 Endogenous Protection of Retinal Photoreceptors Against Light-Induced Oxidative Stress Pier Lorenzo Marchiafava and Biancamaria Longoni University of Pisa, Pisa, Italy
I. INTRODUCTION The nature of the phototransductive mechanism operating in vertebrate retinal photoreceptors favors a conspicuous production of reactive oxygen species (ROS) in these cells, both in darkness and during illumination. In the dark, a high ROS production should be related to the steady influx of cations (Na⫹ and Ca2⫹) (1,2) which is balanced, at the level of the inner cell segment, by activating metabolic pumps. These utilize energy derived from ATP hydrolytic dephosphorylation (3), and consequently a sustained oxidative phosphorylation is required to satisfy such a high energy demand, about 2 mM ATP s⫺1 (4), in mammals. Thus, the high rate of mitochondrial ATP synthesis should be associated to a high production rate of ROS, which comprises about 5% of the total oxygen consumed. During illumination, the cessation of the dark current is replaced, as an indirect source of ROS, by a different mechanism originating from light absorption by the photoreceptor outer segment, i.e., at the initial step of phototransduction. The initiator of this oxidative process may be a byproduct of a light-induced enzymatic reaction leading to lipid peroxidation (5–7). This self-generating intermediate diffuse throughout the outer segment where the disk membranes offer suitable substrates for lipid peroxidation. In particular, they contain high concentrations of docosahexaenoic acid, a 22-carbon (ω⫺3) fatty acid with six double bonds, which is particularly susceptible to oxidation. 541
542
Marchiafava and Longoni
The above-mentioned ROS production related to the specific photoreceptor properties obviously adds to the ordinary cellular metabolic byproducts, thus building up an unusual level of oxidant species, which may constitute a potential threat to photoreceptor homeostasis. In front of these mechanisms of oxidants production, retinal photoreceptors oppose a relatively low content of both catalase and glutathione peroxidase, as reported in other nerve cells (8). These considerations suggest that photoreceptors might possess special, yet still unknown, protective compounds to arrest the intracellular buildup of ROS and their derivatives. Our attention was directed to indolaminergic products, synthesized within retinal photoreceptors (9), where their functional role has not yet been studied. In particular, melatonin (MLT), an intermediate indolaminergic metabolite, has been found to possess antioxidant properties (10–12) even though the absolute as well as the relative efficacy of indolaminergic protection with respect to other antioxidants is still an uncertain matter, both in vitro (13) and in live cells (14,15). Thus, before testing the effects of MLT in cells, we thought it convenient to reassess its antioxidant properties in vitro, by specifically acting against similar oxidative products encountered in nature. The significant results obtained in the first part of this work (16) made it interesting to test whether antioxidant actions could also be exerted in photoreceptors to provide the necessary protection from an oxidative stress generated by their internal ROS production.
II. METHODS A.
Experiments on Linoleic Acid Peroxidation
Linoleic acid was used as a substrate for lipid peroxidation either in dispersed micellar form or as multilamellar vesicles. Lipid peroxidation was induced either by the water-soluble initiator 2.2′-azobis(2-amidinopropane (ABAP)) or by Fe2⫹EDTA (17,18). Lipid peroxidation was detected either by the formation of conjugated dienes, monitored spectrophotometrically at 236 nm, or by the production of malonaldehyde (MDA) plus 4-hydroxyalkenals (4-HDA) (19). The antioxidant activity was measured in accordance with the method of Pryor et al. (17). In a typical run, 2.4 mL of linoleic acid micelles suspension was added to the sample cuvette and thermostated at 36°C in a Perkin-Elmer (Lambda 6) double-beam spectrophotometer. The formation of conjugated dienes was monitored continuously at 236 nm. The blank contained the same solution as the sample, but without linoleic acid. After a stable baseline was attained, 5 mL of 0.5 mM ABAP was added to both the sample and the blank, and incubated for 20 min to allow the rate of autoxidation to become constant. Antioxidants were then added to both the sample and the blank. Liposomes were obtained from l-α-dilinoleoylphosphatidylcholine dissolved in chloroform (20 mg/mL) and dried under a stream of N2. After the
Oxidative Stress in Photoreceptors
543
addition of 4 mL of 20 mM Tris-HCl buffer, pH 7.4, the suspension was vortexed for 30 min at 60°C, then sonicated for 10 min in the presence of different melatonin concentrations. Lipid peroxidation products in liposomes were measured after 90 min incubation with 0.15 mM Fe2⫹-3 mM EDTA, followed by extraction in CHCl3 /MetOH (2:1). A lipid peroxidation assay kit purchased from Calbiochem (Milano, Italy) was used to measure MDA and 4-HDA, the end-products of lipid peroxidation. This kit makes use of the chromogenic reagent N-methyl-2-phenylindole, which reacts with MDA and 4-HDA, yielding a stable chromophore that absorbs light at 586 nm. B.
Experiments on Isolated Photoreceptor Segments
The experimental preparation used consisted of rod cell single outer segment, isolated by finely triturating dark adapted frog retinas by means of a razor blade. The isolation procedure was conducted in darkness, with the aid of an infrared lamp and a converter (Find-R-Scope, FJW Industries) attached to the dissecting microscope. Rod outer segments were finally isolated by further shaking the retinal fragments bathed in a saline solution containing (in mM): NaCl, 120; KCl, 2.6; CaCl2, 3; MgCl2, 1.5; Hepes, 10; Glucose, 12, at pH 7.6. Dihydrorhodamine 123 (DHR; Molecular Probes Inc., Eugene, OR) was then added to the solution up to a final concentration of 10 µM and allowed to diffuse for 20 min at 8°C prior to observation. This time interval was found to be optimal to reach the final intracellular concentration of DHR, as shown by the fact that the peak, lightinduced fluorescence intensity did not increase but rather remained constant in segments illuminated after longer periods of incubation, at 8°C, up to 2 h. This result offered the possibility to test the effects of various compounds, at different concentrations, on a sequence of cellular aliquots and to compare the results obtained with control aliquots taken at regular intervals from the same cell suspension. While the absolute peak fluorescence intensity, as well as the other response parameters, was constant among cells taken from a given cell suspension obtained from a single retina, some variations were still observed among different retinas, perhaps as a result of uncontrollable differences among DHR effective concentrations. Thus, comparative measurements, as in Figures 5 and 6, were made among cells all taken from the same cell suspension. In the presence of ROS, DHR oxidizes to fluorescent rhodamine 123 (RHO), the intensity of which thus reflects the level of ROS inside the cell. Stock solutions (10⫺3 M) of vitamin E and melatonin (Sigma, St. Louis, MO) were prepared in ethanol and diluted with saline to final concentrations, where cells bathed for about 5 min prior to observation, i.e., 15 min after the addition of DHR. Parachlorophenylalanine (PCPA) 5 µM, a tryptophan competitor for tryptophan hydroxylase, was added to the saline solution where the isolated retina rested for
544
Marchiafava and Longoni
45 min before it was triturated and subsequently illuminated. One drop of the cell-containing solution was deposited on a microscope slide and observed, at 21°C, through a 100/1.32 Leitz Fluotar objective mounted on a Leitz Orthoplan light microscope, equipped with a 35-mm photographic camera. Photoreceptors were never kept under the microscope for more than 15 min, during which time the cells, under continuous observation by the experimenter, maintained normal morphological characteristics. The light source was a standard OSRAM HBO 100-W mercury lamp housed in the microscope stand. The light beam was filtered at 450–490 nm (blue) and used both for exciting RHO and for photoreceptor epiillumination with a 50-µm circle of light obtained by the field diaphragm and focused on the isolated cell. RHO emission was filtered at 529 nm. The intensity of the light spot, measured at the level of the preparation, was 0.32 mW/µm2. An 818 ST silicon detector (400–1100 nm) feeding to a Newport power meter model 1815-C was fixed at a point along the optic path to follow the variations in cell fluorescence. Fluorescence intensity was recorded by feeding the power meter output into a Labmaster A/D converter, driven by the computer software Axotape (Axon Instruments, CA). Data analysis was performed with MicroCal Origin software.
III.
RESULTS
A simple and direct test to verify the antioxidant potentialities of MLT consisted of measuring its antioxidant efficacy in vitro against artificially induced ROS of the same species as those presumably generated within photoreceptors, both in the dark and during illumination. MLT antioxidant activity was then compared with those of other classic antioxidants, such as vitamin E and its water-soluble analog Trolox. When MLT was tested against ABAP-induced lipid peroxidation, consistent inhibitory effects were obtained, albeit less evident than those obtained with vitamin E or Trolox. When lipid peroxidation was induced by the Fenton reaction, MLT 0.2 µM and 0.5 µM produced clear antioxidant effects shown by a 26.6% and 30% decrease in conjugated diene concentration, respectively (Fig. 1). More marked inhibition was obtained with Trolox and vitamin E (65% or 50%, and 85% or 59% at the concentration of 0.5 µM or 0.2 µM, respectively). This result indicated that under these conditions the average inhibition exerted by MLT is respectively 39.6% and 51% as effective as vitamin E (Fig. 1). A considerably more marked inhibitory effect of MLT on lipid peroxidation was obtained when a multilamellar vesicle system was used as a substrate instead of the dispersed micellae. Figure 2 shows that using the 0.5 µM MLT the products of lipid peroxidation (MLD and 4HDA) decreased by 69.5% in the multilamellar
Oxidative Stress in Photoreceptors
545
Figure 1 MLT, trolox, and vitamin E inhibition of Fe2⫹-EDTA-induced linoleic acid peroxidation. Each column represents the percentage inhibition, with respect to the two concentrations used (0.2 and 0.5 µM), according to the following equation: % inhibition ⫽ 100 ⫺ AE100, where AE100 is equal to (rate2 /rate1) ⫻ 100. Rate1 and Rate2 are the rates of conjugated diene formation in the absence and in the presence of the inhibitor, respectively. Antioxidant efficiency (AE) was calculated in accordance with the method of Pryor et al. (18).
preparation, with respect to the 30% decrease in diene concentration obtained with the dispersed micellar substrate (Fig. 1). The inhibitory range of MLT shown in Figure 2 slightly exceeds two logarithmic units, while the inhibitory threshold is close to 10⫺9 M, a value approximating the plasmatic level in vivo (20). The results obtained by the in vitro experiments prompted us to verify possible MLT antioxidant effects during illumination of isolated photoreceptor outer segments since in the rat they have been described to undergo lipid peroxidation after prolonged periods of intense illumination (5,21). Therefore, isolated outer segments were bathed in saline and preloaded with DHR, which is converted to RHO by the presence of ROS. The intensity of RHO fluorescence inside the outer segments would then reflect the level of ROS produced. The micrographs in the upper portion of Figure 3 represent the fluorescence intensity developed by an isolated rod outer segment during illumination, at the times indicated by the numbers at the bottom of each image. It can be seen that the fluorescence of the photoreceptor outer segments increased during illumination in a time-dependent fashion. After 5 s of light (Fig. 3A), the cell segment is characterized by a low, diffuse, spontaneous fluorescence. At 2 min (B), the fluorescence intensity has slowly but constantly increased, mostly localized at some portion of the outer segment, from where it rapidly diffuses to the whole cell segment
546
Marchiafava and Longoni
Figure 2 Inhibitory effects of different concentrations of melatonin on Fe2⫹-EDTA-induced peroxidation of multilamellar vesicles. Lipid peroxidation is expressed as the content of MDA and 4-HDA normalized to the average amplitude (n ⫽ 3) of controls (20 nmol/mg liposomes). Values are the mean ⫾ SEM.
(Fig. 3C). The kinetics of both the slow and the rapid fluorescence increases during illumination is well illustrated in the graph of Figure 3, where a fluorescence decay is also shown to occur at later times. Light apparently did not have a significant, direct oxidizing effect on DHR since the fluorescence measured extracellularly never exceeded 1% of the maximal intensity of the outer segment. However, to rule out the possibility that a potential intracellular accumulation of DHR could at least partially contribute to the increase in fluorescence observed, tests were held by illuminating acellular solutions of DHR at concentrations up to 100 µM. Figure 4 shows that the direct oxidation of DHR, at concentrations up to 10 times the level used to load photoreceptors, gives rise to a low amplitude and roughly linear increase in fluorescence that may easily be discriminated from the rapid, exponential rise recorded from cells. Since the different kinetics of DHR oxidation in the acellular system and in the outer segment suggests that illumination of the latters promotes the formation of oxidant species, tests were held to measure the antioxidant effects of MLT during photoreceptor illumination, with the expectation that they would modulate light-induced fluorescence intensity.
Oxidative Stress in Photoreceptors
(A)
5s
(B)
120 s
547
(C)
150 s
Figure 3 Microphotographs of an isolated rod receptor cell (exposure 1 s, Kodak Tmax 3200 ASA) preincubated with dihydrorhodamine 123 (10 µM), at the illumination intervals indicated below each picture. Below, the graph represents a typical photometric recording, from a different cell, of light-induced rhodamine 123 fluorescence. Ordinates represent the output of the recording phototube applied to the microscope camera attachment. In this, and in Figures 4 and 5, abscissae indicate time of illumination.
The addition of MLT delayed the fluorescence increase, slowed its rate of rise, and induced a smaller peak intensity (Fig. 5, 3). It is interesting to note that MLT never decreased fluorescence intensity by more than 60%. The relationship between fluorescence inhibition and MLT concentration is shown in the graph of Figure 6 (continuous line). These results were then compared with those ob-
548
Marchiafava and Longoni
Figure 4 Effect of illuminating an acellular saline solution of DHR, at the concentrations indicated to the right of each trace, also expressed as the number of times the DHR concentration (10 µM) was used to study cellular fluorescence.
Figure 5 Photometric recording of the light-induced increase in fluorescence in four different outer segments bathed in control saline solution (2), or in a solution containing either PCPA 5 µM (1), or MLT 1 nM (3), or vitamin E 10 nM (4), respectively. All cells represented in this figure belong to the same retina, subdivided into four portions, to which DHR was added before trituration. One portion was incubated with PCPA for 45 min before trituration, while the other portions were treated as described in the Methods section.
Oxidative Stress in Photoreceptors
549
Figure 6 Effects of increasing concentrations of MLT, or vitamin E, upon light-induced fluorescence of isolated rod outer segments. Each point represents the average steepest slope of the fluorescence rising phase, recorded from three different outer segments, and normalized to the control slope (slopemax ⫽ 1), obtained with no added compounds.
tained in the presence of vitamin E. In Figure 5 it is evident that vitamin E (4) produced inhibitory effects similar to MLT (3), but with a concentration one order of magnitude higher. A different antioxidant efficacy is indicated also by a narrower dynamic range of vitamin E with respect to MLT (Fig. 6, dotted line). In addition, it is interesting to note, in Figure 6, that the antioxidant actions of both MLT and vitamin E rapidly decrease at concentrations ⱖ1 µM. Before concluding that MLT plays an effective antioxidant role in nature, one should ascertain that protective actions similar to those obtained by the exogenous applications are also exerted by the analogous compound synthesized endogenously. For this reason, we blocked photoreceptor indolaminergic synthesis by adding PCPA to the saline bathing the isolated retina, about 45 min before the experimental session. This procedure should deplete photoreceptors of endogenous indolamines, thus making them more liable to light-induced oxidation. Retinal rods, treated with PCPA 5 µM before the outer segment isolation, produced a stronger oxidative reaction under illumination (Fig. 5, 1), characterized by a reduced delay of the increase in fluorescence, a faster rate of rise, and a greater peak intensity, denoting a higher level of ROS production with respect to the control response.
550
IV.
Marchiafava and Longoni
DISCUSSION
The present results originate from our observation that a brief illumination (1– 3 min) of isolated retinal rod outer segments is accompanied by a production of oxidants. These, in turn, are responsible for the oxidation of preloaded DHR to fluorescent RHO, the intensity of which could be taken as an index of ROS level. A light-induced oxidation of rod outer segments has already been shown to occur in rats (5), where the initiation time of the oxidative process, however, was considerably delayed. The quicker oxidative reactions observed here may be connected with a possible loss of intracellular protective constituents, occurring during the outer segment isolation procedure. Bathing the outer segments in a solution containing MLT, an indolaminergic compound synthesized by intact photoreceptors (9), reestablishes the cellular protective system by inhibiting lightinduced oxidation, thus causing the isolated outer segments to approach their normal condition. The physiological significance of these results is based on the antioxidant concentration used which, in the case of MLT, is of the same order of magnitude as that measured in human plasma (20). The narrow range of MLT concentrations inducing inhibitory effects in photoreceptors, as shown in Figure 6, offers a likely explanation of the large discrepancies among previous experiments on MLT as an antioxidant in different tissues (11,12,14,15,22). Indeed, a prooxidant effect may be predicted to originate from the use of MLT concentrations above those required for antioxidant actions. The present results show that the concentration of MLT adequate to produce a powerful antioxidant action in vivo may be one order of magnitude lower than vitamin E (Fig. 6). This is a surprising result, considering that vitamin E is known to be the major lipid-soluble chain-breaking antioxidant in vivo (23) and that its deficiency is associated with severe photoreceptor functional impairment (24). The difference between the inhibitory action of MLT in the micellar substrate (30% fluorescence inhibition) (Fig. 1) with respect to that observed when using a lamellar lipid substrate (Fig. 2) indicates that the efficacy of this compound may depend on the structure of the lipophilic substrate. It has been suggested that a precise positioning and orientation of the phospholipids in the membrane may contribute to the effectiveness of a radical scavenger (25). Accordingly, in the case of a lamellar lipid assemblage, structurally close to the biological membrane, the peak MLT-induced decrease in MDA content (69%, with MLT 0.5 µM) is close to the percentage inhibition of ROS production (i.e., about 60%) observed in the live cell (Fig. 6). However, the range of MLT concentrations inducing inhibition both of the outer segment fluorescence (Fig. 6) and of lipid peroxidation in vitro (Fig. 2) are not identical. MLT reactivity in the multilamellar lipid substrate is observed at higher concentrations than in the iso-
Oxidative Stress in Photoreceptors
551
lated cell, where MLT inhibitory threshold (10⫺10 M) (Fig. 6) approaches the plasmatic values measured in vivo (20). In conclusion, a model of oxidative stress induced by natural stimulation, consisting of a retinal photoreceptor outer segment under constant illumination for a few minutes, has been reproduced. The addition of MLT protects the cell segments from oxidative damage, indicating that endogenously synthesized analogs may have similar effects in intact, normal cell condition. Their protective action in nature is confirmed by the greater production of ROS after blocking indolaminergic synthesis by using PCPA. As the indolaminergic metabolism resides at the photoreceptor inner segment, the prooxidant effect of PCPA shows that MLT diffuses from there to the outer segment, where it acts against lightinduced peroxyl radicals. Thus, in natural conditions, one may envisage a ubiquitous distribution of indolamines characterized by a high nocturnal level at the site of synthesis, i.e., the inner segment, to protect against the ROS produced by oxidative phosphorylation (26). At the same time, MLT tends to diffuse from here toward the outer segment, where, at the end of the night, it might have reached its peak levels, i.e., those needed to scavenge light-induced peroxyl radicals. We suggest that the introduction of melatonin in vivo may be helpful in those retinal disorders where oxidative stress originates in photoreceptors from an insufficient supply of endogenous antioxidants.
REFERENCES 1. McNaughton, P.A. (1990) Light response of vertebrate photoreceptors. Physiol. Rev. 70:847–883. 2. Rispoli, G., Navangione, A., Vellani, V. (1997) cGMP gated channel, exchanger and phototransduction in isolated rod outer segments. In: Biophysics of Phototransduction (C. Taddei-Ferretti, ed.), World Scientific, Singapore, pp. 322–334. 3. Robinson, D.W., Ratto, G.M., Lagnado, L., McNaughton, P.A. (1993) Temperature dependence of the light response in rat rods. J. Physiol. (Lond.), 462:465–481. 4. Demontis, G.C., Longoni, B., Gargini, C., Cervetto L. (1997) The energetic cost of photoreception in retinal rods of mammals. Arch. Ital. Biol. 135:95–109. 5. Wiegand, R.D., Giusto, N.M., Rapp, L.M., Anderson, R.E. (1983) Evidence for rod outer segment lipid peroxidation following constant illumination of the rat retina. Invest. Ophthalmol. Vis. Sci. 24:1433–1435. 6. Jelsema, C.L., Axelrod, J. (1987) Stimulation of phospholipase A2 activity in bovine rod outer segments by the βγ subunits of transduction and its inhibition by the α subunit. J. Biol. Chem. 262:1163–1168. 7. Ghalayini, A.J., Anderson, R.E. (1992) Activation of bovine rod outer segment phospholipase C by arrestin. J. Biol. Chem. 267:17977–17982.
552
Marchiafava and Longoni
8. Halliwell, B. (1992) Reactive oxygen species and the central nervous system. J. Neurochem. 59:1609–1623. 9. Cahill, G.M., Besharse, J.C. (1989) Retinal melatonin is metabolized within the eye of Xenopus laevis. Proc. Natl. Acad. Sci. USA 86:1098–1102. 10. Tan, D-X., Chen, L-D., Poeggeler, B., Manchester, L.C., Reiter, R.J. (1993) Melatonin: a potent, hydroxyl radical scavenger. Endocr. J. 1:57–60. 11. Carneiro, R.C.G., Reiter, R.J. (1998) Melatonin protects against lipid peroxidation induced by δ-aminolevulinic acid in rat cerebellum, cortex and hippocampus. Neuroscience 82:293–299. 12. Siu, A.W., Reiter, R.J., To, C.H. (1998) The efficacy of vitamin E and melatonin as antioxidants against lipid peroxidation in rat retinal homogenates. J. Pineal Res. 24:239–244. 13. Marshall, K.A., Reiter, R.J., Poeggeler, B., Aruoma, O.I.;, Halliwell, B. (1996) Evaluation of the antioxidant activity of melatonin in vitro. Free Rad. Biol. Med. 21: 307–315. 14. Pieri, C., Marra, M., Moroni, F., Recchioni, R., Marcheselli, F. (1994) Melatonin: a peroxyl radical scavenger more effective than vitamin E. Life Sci. 55:271–276. 15. Barsacchi, R., Kusmic, C., Damiani, E., Carloni, P., Greci, L., Donato, L. (1998) Vitamin E consumption induced by oxidative stress in red blood cells is enhanced by melatonin and reduced by N-acetylserotonin. Free Rad. Biol. Med. 24:1187– 1192. 16. Longoni, B., Pryor W.P., Marchiafava P.L. (1997) Inhibition of lipid peroxidation by N-acetylserotonin and its role in retinal physiology. Biochem. Biophys. Res. Commun. 233:778–780. 17. Pryor, W.A., Cornicelli, J.A., Devall, L.J., Tait, D., Trivedi, B.K., Witiak, D.T., Wu, M. (1993) A rapid screening test to determine the antioxidant potencies of natural and synthetic antioxidants. J. Org. Chem. 58:3521–3532. 18. Longoni, B., Salgo, M.G., Pryor, W.P., Marchiafava, P.L. (1998) Effects of melatonin on lipid peroxidation induced by oxygen radicals. Life Sci. 62:853–859. 19. Esterbauer, H., Cheeseman, K.H. (1990) Determination of aldehydic lipid peroxidation products: malonaldehyde and 4-hydroxynonenal. Meth. Enzymol. 186:407–421. 20. Brzezinsky, A. (1997) Melatonin in humans. N. Engl. J. Med. 336:186–195. 21. Organisciak, D.T., Winkler, B.S. (1994) Retinal light damage: practical and theoretical considerations. In: Progress in Retinal and Eye Research (Osborne, N.N., Chader, G.J. eds.), Pergamon Press, Oxford, pp. 1–29. 22. Wiechmann, A.F., O’Steen, W.K. (1992) Melatonin increases photoreceptor susceptibility to light-induced damage. Invest. Ophthalmol. Vis. Sci. 33:1894–1902. 23. Burton, G.W., Joyce, A., Ingold, K.U. (1983) Is vitamin E the only lipid-soluble, chain-breaking antioxidant in human blood plasma and erythrocyte membranes? Arch. Biochem. Biophys. 221:281–290. 24. Goss-Sampson, M.A., Kriss, T., Muller, D.P.R. (1998) Retinal abnormalities in experimental vitamin E deficiency. Free Rad. Biol. Med. 25:457–462. 25. van Ginkel, D., Sevanian, A. (1994) Lipid peroxidation-induced membrane structural alterations. Meth. Enzymol. 233:273–288. 26. Hsu, S-C., Molday, R.S. (1994) Glucose metabolism in photoreceptors outer segments. J. Biol. Chem. 269:17954–17959.
Index Aconitase, assay, 147 Alexander’s disease, 383 Alzheimer, calcium homeostasis, 205 dietary modifiers, 344 effect of Ginkgo biloba, 411 estrogens, 467 genetic aberrancies, 334, 340 hormonal factors, 342 impairment of membrane ATPases, 327 mitochondrial dysfunction, 329 nitration products, 115 transgenic models, 359 vitamin E, 501 Amino acids, 28 AMPA (D,L-amino-3-hydroxy-5methyl-4-isoxazolepropionate) receptors, 141 toxicity, 128 Amyloid-β peptide and oxidative stress, 325 effect of Ginkgo biloba, 413 transgenic models, 360 Amyotrophic lateral sclerosis, 393 Antioxidants, gene expression, 430 general aspects, 280, 324, 487 neuroprotection, 460 protection against AMPA effect, 142 Apolipoprotein E, 413
Apoptosis, and ischemia, 56 and oxidative stress, 432 etiology in the brain, 60 Calcitonin gene-related peptides, 29 Catecholamines, classification, 255 DNA strand breakage, 231 production of free radicals, 5 release of ferritin, 255 Cholinergic systems, 330 Coenzyme Q, 511 Complex I, 439 Cysteine, 448 Cytochrome oxidase, 415 Deprenyl, 191, 507 Dichlorofluorescin, 147 Dihydrorhodamine, 123, 147 DNA repair, 69 Dopamine, agonists, 490 formation of reactive oxygen species, 275 Electron spin resonance, 146 Endoplasmic reticulum, 329 Environmental factors, 342 Excitotoxicity, 130 Ginkgo biloba extract (EGb761), 411 553
554 Glia cells, protein nitration, 114 role in NO toxicity, 162 Glucose, 327 Glutamate, neurotoxicity nonreceptor-mediated, 143 neurotoxicity receptor-mediated, 128 role of mitochondria, 182 synapse, 1 synaptic plasticity, 158 transporters, 327 Glutathione, deficiency, 441, 448 Huntington’s disease, 505 Hydroethidine, 147 Hydrogen peroxide, 134 4-Hydroxynonenal, 326 Hydroxyl radical, 134 Hyperalgesia, 34 Idebenone, 508 Interleukin-1, 114 Iron, chelators, 489 redox reactions, 253 transferrin receptors, 445 Ischemia, focal, 62, 89 global, 96 Kainate receptor, 128 L-Arginine, 87 Linoleic acid, 542 Lipid peroxidation, 144, 386 Mitochondria, glutamate toxicity, 182 source of reactive oxygen, 138 Monoamine oxidase A (MAO A), inhibitors, 179 knock-out mice, 217 Monoamine oxidase B (MAO B), inhibitors, 494 knock-out mice, 217
Index 1-Methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP), model disease, 62 calcium homeostasis, 207 MAO-B knock-out mice, 221 Necrosis, characterization, 59 etiology in the brain, 432 Neurofibrillary tangles, 343 Neuroinflammation, 109 Neuromelanin, 277 Neurotrophins, 66 Nicotinamide (NAD), 69 Nitric oxide, DNA strand breakage, 231 glutamate neurotoxicity, 135, 157 ischemic damage of the brain, 77 nigral cell death, 296 nitroxyl anion, 238 Nitric oxide synthase (NOS), biochemistry, 18 inhibitors, 533 isoforms, 79 L-arginine analogs, 87 neuronal NOS overexpression, 300 NMDA receptor, 523 pain perception, 17 peroxynitrite pathway, 435, 530 NMDA ( N-methyl-D-aspartate) receptor, 131 Nociceptive pathways, 26 Noradrenaline, 257 Oxidative stress, in Alzheimer’s disease, 313, 329, 363 in Parkinson’s disease, 427 Parkinson’s disease, antioxidant vitamins, 503 general features, 10, 206 metallothionein, 451 mitochondrial dysfunction, 294, 439 nitric oxide overproduction, 291 pathogenetic factors, 263 radical scavengers, 487
Index
555
Phenolic antioxidants, 471 Phospholipase A 2, 138 Poly(ADP-ribose) polymerase (PARP), 68 Polymorphonuclear cells, 299 Protein kinase C, 415
Schizophrenia, 8 Spinal dorsal horn, 26 Substantia gelatinosa, 27 Substantia nigra, 281 Superoxide dismutase, 393, 435 Swim test, 220
Reactive oxygen species (ROS), gene expression, 430 glutamate toxicity, 130, 144 intracellular calcium, 197, 207 scavenging enzymes, 280, 324, 487 scavenging molecules, 281, 324, 487 Reperfusion, 62 Rosenthal fibers, 383
Tachykinins, 29 t-Butyl hydroperoxide, 61 Thiols, 265 Vascular dementia, 507 Vitamin E, 281, 493 Xanthine oxidase, 137