1 DNase I Footprinting Keith R. Fox 1. Introduction Footprmtmg provides a simple, quick, and reasonably mexpensive meth...
72 downloads
1661 Views
18MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
1 DNase I Footprinting Keith R. Fox 1. Introduction Footprmtmg provides a simple, quick, and reasonably mexpensive method for assessingthe sequence specific mteraction of ligands with DNA. Although the techmque was developed in 1978 for studying the mteraction of DNAbinding proteins with then target sites (I), it has proved invaluable for determining the sequence specificity of many small hgands 1.1. Footprinting , Footprmting is essentially a protection assay, m which cleavage of DNA is inhibited at discrete locations by the sequence specific binding of a hgand or protein. In this technique, a DNA fragment of known sequence and length (typically a restriction fragment of 100-200 bp), which has been selectively radiolabeled at one end of one strand, IS lightly dtgested by a suitable endonucleolytic probe m the presence and absence of the drug under investigation The cleavage agent is prevented from cutting around the drug-binding sites so that, when the products of reaction are separated on a denaturing polyacrylamide gel and exposed to autoradiography, the position of the ligand can be seen as a gap m the otherwise continuous ladder of bands (see Fig. 1). In this figure, cleavage at position “a” will produce, after denaturing the DNA, one long fragment (9 bases) corresponding to the left hand strand, and two short fragments (7 bases and 2 bases) from cleavage of the right hand strand. Since the bands are located by autoradiography, only the shortest of these species bearing the radioactive label will be visualized. The condittons of the cleavage reaction are adjusted so that, on average, each DNA fragment is cut no more than once. As a result, each of the bands on the autoradiograph is produced by a single cleavage event, i.e., single-hit kmetics. If an excessive amount of cleavage agent is used, then From
Methods
m Molecular
Edited
by
Biology,
K R Fox
Vol 90 Drug-DNA
Humana
1
Press
Interactron
Inc , Totowa.
NJ
Protocols
Fox
gel eleotrophoresis
Fig 1 Schemattc representation of the footprtntmg experiment The DNA is labeled (*) at the 3’ end of the right-hand strand
labeled products can arose from more than one cleavage event, biasing the dlstribution
of fragments toward short products. In general, the extent of cleavage
1sadjusted so that between 60 and 90% of the radtolabeled DNA remains uncut, though longer fragments require greater amounts of digestion able band intensities.
to produce suit-
DNase I footprmtmg has been successfully employed for mdentrfymg or conlirmmg the preferred DNA binding sites for several hgands mcludmg actinomycm
(2-4), mtthramycin
(5), quinoxalme
antrbrotrcs (6,7), daunomycm
(8,9), nogalamycin (1/J), vartous minor groove binding agents (2,3,12), and triplex binding
ohgonucleottdes
(12,13). Various other cleavage agents, both
enzymrc and chemical, have also been used as footprinting probes for drugDNA interactions including micrococcal nuclease (24), DNase II (6,15), copper phenanthrolme (16,17), methtdiumpropyl-EDTA.Fe(II) (MPE) (18-21), uranyl photocleavage (22,23), and hydroxyl radicals (24-26). Each of these has a different cleavage mechanism,
revealmg
different aspects of drug-DNA
interactions. An ideal footprmtmg agent should be sequence neutral and generate an even ladder of DNA cleavage products in the absence of the hgand This property is
almost achieved by certain chemical probes, such as MPE and hydroxyl radicals. However,
the most commonly
used cleavage agent (because of its cost
and ease of use) 1sthe enzyme DNase I, which produces an uneven cleavage pattern that varies according DNA sequence and local structure (see Subheading 1.2.). Cleavage at mdrvtdual phosphodiester bonds can vary by over an order
DNase I Foo tprinting
3
of magnitude m a manner determined by both local and global DNA structure (27,28). In addltlon, drugs that modrfy DNA structure can induce enhanced DNase I activity m regions surroundmg their binding sites if they alter the DNA structure so as to render it more suscepttble to cleavage (3,6,15,29,30). This ISmost frequently seen m regions that are particularly refractory to cleavage m the drug-free controls. 1.2. DNase I DNase I 1sa monomeric glycoprotem of mol wt 30,400. It IS a double strandspecific endonuclease,which introduces single strand nicks m the phosphodiester backbone, cleaving the 03’-P bond. Single stranded DNA is degraded at least four orders of magmtude more slowly (32,32). The enzyme requires divalent cations and shows opttmal actlvlty m the presence of calcmm and magnesium (33). Although it cuts all phosphodiester bonds, and it does not possess any simple sequence dependency, its cleavage pattern 1svery uneven and 1sthought to reflect variations m DNA structure (27,34). In particular, A, * T, tracts and GC-rich regions are poor substrates for the enzyme. The most important factors affecting Its cleavage are thought to be mmor groove width (27,28) and DNA flexibility (35,36). Several crystal structures have been determined for both the enzyme and its complex with oligonucleotides (37-42). These show that DNase I bmds by inserting an exposed loop mto the DNA minor groove, Interacting with the phosphate backbone, as well as the walls of the groove. This explains why cleavage is poor in regions, such as A,, * T, tracts on account of their narrow minor groove, to which the enzyme cannot bind. An additional feature of these crystal structures 1sthat the DNA 1salways bent by about 2 lo toward the major groove, away from the enzyme. If this bendmg 1sa necessary feature of the catalytic reaction, then rigid regions, such as GC-rich sequences,may be refractory to cleavage. However, these factors do not explain the very different cutting rates that are often observed at adjacent dinucleotide steps.It 1spossible that this is determined by precise orientation of the sclssile phosphodlester bond, However, the crystal structures show that there may be other specific interactions between the exposed loop and DNA bases removed from the cutting site. In particular, tyrosme-76 mteracts with the base 2 posItIons to the 5’ side of the cutting site and arginme-4 1 binds to the base at position -3. This latter mteraction 1ssterically hindered by a GC base pair in thts position. By examining the characteristics of several good DNase I cleavage sites, Herrera and Chaires (43) suggested that the best cleavage site was WYWIWVN (where W = A or T, Y = C or T, and V = any base except T). The DNA-binding surface of DNase I covers about 10 bp, i.e., one complete turn the DNA helix. This has tmportant consequences for interpreting
4
Fox
A
B
Fig 2. Schemattc representatron of the 3’staggered cleavage produced by DNase I The DNA helix has been opened out and IS viewed along the minor groove The hatched box represents DNase I. the tilled box represents a DNA-binding ligand
footprmtmg results and explams the observatton that the enzyme overesttmates drug-binding site sizes Although DNA bases he perpendtcular to the hellcal axis, they are mclmed relative to the phosphodtester backbone. As a result, closest phosphates, postttoned across the minor groove, are not attached to a single base pan, but are staggered by about 2-3 bases m the 3’ direction. This is illustrated m Fig. 2A, m which the DNA has been drawn lookmg along the minor groove, showmg the inclmatton of the DNA base pans. Since DNase I (hatched box) binds across this groove, its bmdmg sate on the top strand 1s located 2 bases to the 3’ side of that on the lower strand. When a DNA-binding hgand is added (filled box in Fig. 2B), it can be seen that the closest approach of the enzyme is not the same on each strand. DNase I can approach closer to the enzyme on the lower strand; the region of the upper strand protected extends by about 2 bases beyond the actual ligand-bmdmg sate. As a result, DNase I footprmts are staggered by about 2-3 bases m the 3’ direction across the two strands
2. Materials 2.1. DNase
I
For most footprintmg experiments the DNase I does not need to be especially pure. There 1s ltttle advantage m purchasmg HPLC-pure, RNase-free enzymes. Currently purchased 1s the type IV enzyme, from bovme pancreas, from Sigma (St. Louis, MO). This should be dtssolved m 0.15 MNaCl contaming 1 mMMgC1, at a concentratton of 7200 Kumtz U/mL. Thts can be stored at
-20°C, and is stable to frequent freezing and thawing. The enzyme 1sdiluted to workmg concentrattons immedtately enzyme should be discarded
before use; the remainder
of the diluted
5
DNase I Footprinting Table 1 Sequence
of the tyrT DNA Fragment
AATTCCGGTTACCTTTAATCCGTTACGGATGAAAATTACGC~CCAGTTCATTTTTCTC~CGT~CAC 0 10 20 30 40 3'-AAGGCCAATGGAAATTAGGCAATGCCTACTACTTTT~TGCGTTGGTC~GT~GAGTTGCATTGTG
50
60
TTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGAT~GGGAGCAGGCCAGT~GCATT 70 80 90 100 110 AAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAG
120
130
ACCCCGTGGTGGGGGTTCCC 140 150 TGGGGCACCACCCCCAAGGGCT-5'
The fragment ISobtainedby cutting with EcoRI andAvuI a-32P-dATP ISusedto labelthe3’endof the lower strand,whereasa-32P-dCTPISusedto labelthe upperstrand
2.2. Choice of DNA Fragment 2.2.1. Natural DNA Fragments For footprinting experiments, the length of fragment used depends on both convenience (how easily a specific fragment can be generated) and the resolution limit of the polyacrylamide gels. The chosen fragment length is typically between 50 and 200 bp. Although different laboratories have adopted different natural fragments as standard substratesfor footprmtmg experiments, a few have been used more widely Among these are the 160 bp tyrT fragment (sequence shown m Table 1) t&8)), the EcoRI-PvuII fragments from PBS (Stratagene) (4&M), and several fragments from pBR322 (HindIII-HueIII, HindIII-AM, or EcoRI-RsaI). The plasmids from which these can be prepared are available from commercial sources or from the author’s laboratory. In many ways it would be convenient if a few fragments did become recognized standards, since this would facilitate direct comparison of the relattve specrfictttes of hgands prepared in different laboratories. Since many sequence selective small molecules have recognition sites of between 2 and 4 bp, there is a reasonable probability that their preferred sites will be present in a lOO- to 200-bp restriction fragment. However, it should be noted that there are 2 different bp, 10 different dmucleotides, 32 trmucleotides, 136 tetranucleotides, 512 pentanucleotides, and 2080 hexanucleotides. It can therefore be seen that the chance of finding a particular binding site within a given DNA fragment becomes more remote the greater the selectivity of the ligand. A further complicatmg factor is that, although many ltgands spectfically recognize only a dmucleotlde step, their binding affinity is often influenced by the nature of the surrounding bases,
6
Fox
which alter the local DNA structure (47-49). It IS therefore possible that using a natural fragment may fail to detect the optimum bmdmg sites for the most selective hgands. This becomes especially relevant since many novel synthetic ligands possessenhanced sequence recogmtton properties, with binding sites of eight or more base pairs. 2.2.2. Synthetic Oligonucleotides As explamed, although footprmtmg experiments with natural DNA fragments provide a reasonable estimate of a ligand’s preferred bmdmg sites, these are complicated by the limited number of sequences studied, together with ambiguities over the exact bmdmg site within a larger footprmt. The next step m confirmmg the sequence preference may be to prepare a synthetic DNA fragment containing the putative binding site and to use this as a substrate for footprmting experiments (50,51). In addition, for compounds that have been produced as the result of rational design, one may be able to predict their preferred bmdmg site. Synthesis of suitable length ohgonucleotides (50 bases or longer) IS now routine. However, the results obtained with short oligonucleotides need to be interpreted with caution and rigorously controlled for several reasons. First, binding sites located close to the ends of short ohgonucleotides may not adopt the same configuration as when located within longer sequences because of “end effects.” Second, smce the synthetic fragments will contam only one or two binding sites, it is necessary to ensure that other sequences with equal or greater affinity have not been excluded. This can be investigated by comparing the mteraction with other closely related sequences, m which one or two bases m or around the cognate sequence are altered m turn. Analysis is simphfied further if the variant sites are contamed withm the same DNA fragment. 2.2.3. Synthetic Fragments A frequent variant on the above is to clone the synthetic oligonucleottdes mto longer DNA fragments. This removes the problems associated with end effects and provides other common flanking sequences to which ligand binding can be compared. An added advantage is that, once it has been cloned, the sequence can be readily isolated from bacteria. The authors usually clone synthetic ohgonucleotides mto the BamHI site of pUC plasmids. They have prepared a wide range of such cloned inserts, containing central GC, CG, or (A/T),, sites (11,15,29,30), which are available from the authors’ laboratory on request. DNA fragments contammg the synthetic inserts can be prepared and radiolabeled at either end (see Subheading 3.2.) by isolatmg the modified polylmker. Once again a proper analysis will requtre fragments contammg both cognate and closely related noncognate sequences.
DNase I Footprinting
7
2.3. Buffers 2.3.1. Solutrons for Plasmid Preparation 1 Resuspenston solution 50 mM Trts-HCl. pH 7 5, contammg 10 mM EDTA. 2. Lysis solution. 0.1% SDS, 0.1 MNaOH. 3 Neutralization solutton 3 M potassium acetate, 2 A4 acettc acid
2.3.2. Genera/ Buffers 1 10 mA4Tris-HCl, pH 7 5, contannng 0 1 mA4EDTA This is used for dtssolvmg DNA. 2. 10 mM Trts-HCl, pH 7.5, containing 10 mA4 NaCl. This is used for preparing drug solutions 3 DNase I buffer 20 mMNaC1,2 mM MgCl*, 2 mM MnC&
2.3.3. Reagents for Electrophoresis 1. TBE electrophorests buffer This should be made up as a 5X stock solutton containing 108 g Tns, 55 g Boric acid, and 9.4 g EDTA made up to 2 L with water 2 Acrylamide solutions Polyacrylamide sequencing gels are made from a mixture containing acrylamtde*btsacrylamtde in the ratio 19.1. Because of the toxic nature of these compounds. acrylamide solution are best purchased from a commerctal supplier (National Diagnostics [Atlanta, GA], Anachem [Luton, Beds, UK]) and should be used according to the manufacturers mstructions 3 DNase I stop solution. Formamide containing 10 mM EDTA and 0 1% (w/v) bromophenol blue 3. Methods
3.1. Plasmid Preparation Several methods are available for preparing plasmid DNA, which IS suitable for restriction digestion and radiolabeling, including several commerctal kits (including Qiagen or Wizard) and caesium chloride density gradient centrifugation. It 1sbeyond the scope of this article to review the relative merits of each procedure, except to note that in many instances it is not necessary to generate high purity plasmid preparations. Since the radtolabeled restrtction fragments are eventually isolated and purified by gel electrophoresis, prior purification of the plasmids may not be necessary, so long as the preparations do not contain nucleases or any agents that inhibit restriction enzymes or polymerases. As a result, plasmtds are usually prepared by standard alkaline lysts procedures, followed by extraction with phenol/chloroform. A very brief protocol for extractmg pUC plasmids 1sdescribed as follows: 1 Grow 50 mL bacteria overnight. 2 Spin culture at 3000g (I e., 5000 rpm m a Beckman JA20 rotor) for 5 mm m Oakridge tube.
Fox
8
3 Resuspend the bacterial pellet m 5 mL cell resuspension solution (50 mM Tns-HCl, pH 7.5, containing 10 mM EDTA) 4. Add 5 mL cell lysis solution (0 1% SDS, 0 1 MNaOH) and mix gently until the solution becomes clear Add 5 mL neutralization solution (3 M potassium acetate, 2 M acetic acid) Spin at 17,000g (12,000 rpm) for 15 mm Remove the supernatant and add 0 6 vol of lsopropanol. Spin at 17,OOOg(12,000 rpm) for 15 mm Remove the supernatant and wash the crude DNA pellet with 5-10 mL 70% ethanol Transfer the pellet to an Eppendorf tube and dry 10 Redissolve pellet m 0 5 mL 10 mA4 Tns-HCl, pH 7 5, containing 0.1 mM EDTA and 100 pg/mL RNase Leave at 37°C to dissolve for at least 30 mm 11 Extract twice with 0 5 mL phenol/chloroform (phenol forms the bottom layer and should be discarded) The interface will probably be very messy, leave the Junk behind 12. Remove any dissolved phenol by extracting twice with 0 5 mL ether (which forms the top layer and should be discarded) Allow excess ether to evaporate by standing at 37°C for a few minutes 13 Precipitate with ethanol, dry and dissolve m 100-l 50 JJL Tns-HCI, pH 7 5, containing 0.1 mM EDTA
3.2. Radiolabeling
the DNA
DNA fragments can be efficiently labeled at either the 5’ end (using polynucleotlde kmase) or 3’ end using a DNA polymerase. However, the results of DNase I digestion are easiest to interpret for 3’-end-labeled fragments. Smce DNase I cuts the 03’-P bond, the products of dlgestlon possess a 3’-hydroxyl and 5’-phosphate group. In contrast, Maxam-Gilbert sequencing reactions, which are used as markers in footprmtmg gels (see Subheading 3.3.), leave phosphate groups on both sides of the cleavage pomt (52). As a result, the radlolabeled products of DNase I cleavage and Maxam-Gilbert sequencmg reactions will be identical if the DNA 1s labeled at the 3’ end (i.e., both possess a phosphate at the 5’ end). However, if the DNA 1s labeled at the 5’ end then the labeled DNase I products will possess an extra phosphate group and so run slightly faster than the correspondmg Maxam-Gllbert products. Although this difference 1s often overlooked in footprmtmg gels, it becomes significant for short fragments for which the difference m mobility may be as great as 2-3 bands. For enzymes that cut the O-5’ bond, such as DNase II and mtcrococcal nuclease, 5’-end-labeled fragments comlgrate with the Maxam-Gilbert marker lanes.
3.2.1. 3’-End Labeling with Reverse Transcriptase The production of 3’-end-labeled DNA fragments can be achieved by cutting with a restrlction enzyme that generates sticky ends with 3’-overhanging
9
DNase I Footprmting
ends, followed by filling m with a polymerase using a suitable [a-32P]-dNTP. The fragment of interest IS then released from the remamder of the plasmid by cleaving with a second enzyme that cuts the other side of the region of interest. The two restriction enzymes usually cut at single locatlons in the plasmid, though this 1snot necessary so long as the various radiolabeled fragments can be separated from each other. The most commonly used polymerase is the Klenow fragment. However, it is found that the most efficient labeling is achieved using AMV reverse transcriptase, even though this 1s actually an RNA-dependent DNA polymerase. However, not all commercially sources of this enzyme are equally reltable; consistent results are obtained with reverse transcrlptase from Promega or Pharmacia 3 2 1 .l
RESTRICTION DIGESTION AND a’-END
LABELING
Using the aforementioned procedure for DNA isolation, the followmg 1s used for generating radlolabeled Hindlll-EcoRl polylmker fragments from pUC plasmids. 1. Mix 30 pL plasmld (about 50 pg DNA) with 10 pL of 10X restrlctlon enzyme
buffer (as supplied by the manufacturer), 45 PL water. 2 Add 3 pL HzndIII (A/AGCTT) and incubate at 37°C for 2 h 3. Add 1 PL [a-32P]-dATP (3000 Wmmol, Amersham)together with 1 PL reverse transcriptase and Incubate for a further 1 h 4 The reverse transcriptase IS then Inactivated (to prevent further mcorporatlon of radiolabel at the 3’ end of the second restrlctlon site) by heatmg at 65°C for 5 mm 5 After cooling to 37”C, 3 pL EcoRI (G/AATTC) is added and the mixture mcubated for a further 1-2 h In this case, the DNA can be labeled on the opposite strand by reversing the order of addition of EcoRI and HzndIII
If the second enzyme produces blunt ends or sticky ends with 5’ overhangs, or if the 3’ overhangs sites can not be filled m with dATP, then all the enzymes can be added simultaneously. Examples of such combinations for pUC polylinker fragments are HzndlII-SacI, and EcoRI-&I. The @rT fragment can be prepared by simultaneous digestion with EcoRl and Aval. In this instance the EcoRl end is labeled with [a-32P]-dATP, whereas the Aval end can be labeled with [a-32P]dCTP. Although various enzymes are supplied with dlfferent reaction buffers, it 1sfound that there IS usually no need to change buffers between the first and second enzymes. 6 The mixture of radlolabeled fragments is preclpltated by addmg 10 PL of 3 M sodium acetate and 300 pL ethanol, followed by centrlfugatlon m a suitable microfuge, at top speed The pellet 1swashed with 70% ethanol, dried and dlssolved m 15-20 FL Tris-HCl containing 0 1 mA4 EDTA. Then 4 PL of loading dye (20% F~oll, 10 mA4EDTA, 4 1% [w/v] bromophenol blue) is added before
10
Fox loading onto a polyacrylamide gel (typically 6-8%). The gel should be run cold, so as not to denature the DNA, it is usually run 0 3-mm-thick, 40-cm-long gels in 1X TBE at 800 V Samples are loaded into slots 10 mm wide by 15 mm deep After the bromophenol blue has reached the bottom of the gel (about 2 h), the plates are separated and the gel covered with Saran wrap Scanning the gel with a hand-held Geiger counter should give a reading off scale (1 e , at least 3000 cps) over the radiolabeled bands The precise location of the radiolabeled bands is determined by short (2-10 min) autoradiography This autoradlograph IS placed under the glass plates and used to locate the band of Interest, which IS cut out using a sharp razor blade
3.2.1.2
EXTRACTION OF RADIOLABELED DNA FRAGMENTS
The simplest, labeled DNA
cheapest, and most efficient
fragments
from polyacrylamlde
method
for extracting
gel slices IS by diffusion
radioPlace a
small glass wool plug m the bottom of a 1 mL (PlOOO) pipet tip and seal the bottom end with parafilm. Add the gel slice containing the radiolabeled DNA and cover this with 10 mA4 Tris-HCl, pH 7 5, containing 10 mM EDTA (about 300 pL is sufficient). Cover the top of the pipet tip with parafilm and incubate at 37°C with gentle agitation. This is usually incubated overmght, though most of the DNA elutes after 2 h. Remove the parafilm from the top and bottom of the tip and expel the buffer mto an Eppendorf tube using a pipet and/or lowspeed centrifugation (15OOg m an Eppendorf centrifuge). The gel slice should be retamed in the pipet tip by the plug of glass wool, though a small amount of polyacrylamide does occasionally come through This can be removed by centrifugation. For fragments shorter than 200 bp, this procedure recovers about 95% of the radiolabel m the gel slice, though the efficiency decreases for longer fragments. The DNA should then be precipitated with ethanol and redissolved m Tris-HCI containing 0.1 mA4 EDTA so as to generate at least 10 cps per pL on a hand-held counter. For most footprintmg experiments it is not necessary to know the absolute DNA concentration, since this is vamshmgly small. The important factor is concentration of the radiolabel, which should be sufficient to produce an autoradiograph within l-2 d exposure.
3.3. Maxam-Gilbert
Marker Lanes
Bands in the DNase I digestion patterns are identified by comparison with suitable marker lanes. Since each DNA fragment produces a characteristic sequence dependent digestion pattern, it is sometimes possible to identify the bonds by comparison with a previous (published) pattern.
3.3.1. G-Tracks The simplest and most commonly used marker lane is the dimethylsulfatepiperidme marker specific for guanine (52). Since the procedure is more time-
11
DNase I Footprintmg
consuming than DNase I digestion itself, it is usual to prepare sufficient quantity of “G-track” for several footprmting experimentswith the batch of radiolabeled DNA. Add 10 uL radiolabeled DNA to 200 pL of 10 mA4 Tris-HCl, pH 7.5, contammg 10 mM NaCl. To this add 1 pL dtmethylsulfate and mcubate at room temperature
for 1 mm before stopping the reaction by addmg 50 uL of a solution
containing 1.5 Msodmm acetate and 1Mmercaptoethanol followed by 750 pL ethanol. Some laboratortes include tRNA in this G-stop, as a coprectpttant, but it is found that this is not generally necessary. Leave the mixture on dry ice for 10 min, then spin at full speed in an Eppendorf centrifuge (12,000g) for 10 min. Remove the supernatant and wash the pellet twice with 70% ethanol. After drying the pellet, add 50-l 00 yL of 10% (v/v) plperidme
and heat at 100°C for
between 20 and 30 min. Remove the ptpertdme by either lyophilizatton or m a speed-vat. Redissolve the sample m loading dye (formamlde
containing
10 mJ4
EDTA and 0.1% [w/v] bromophenol blue) so that each electrophorests sample contains about 10 cps. 3.3.2. G+A Tracks Although the preparation of a G-track is reliable, it is time-consummg and mvolves some highly toxic compounds (dimethylsulfate). G+A marker lanes are also widely used and are usually prepared by limited acid depurmation using formtc acid-ptperidme
reactions. During the DNase I footprintmg
work
it was noted that occastonal careless handling of the samples resulted m put-me tracks appearing m the DNase I cleavage lanes. This observatton has been used to establish an empirical method for rapidly preparing G+A marker lanes To 2 pL of radiolabeled DNA, add 15-20 pL of Trts-HCl, pH 7.5, contaming 10 MNaCl and 5 pL of loading dye (formamide containing 10 mM EDTA
and 0.1% [w/v] bromophenol blue). Heat at 100°C for about 20 mm in an Eppendorf tube, with the cap open This reduces the volume to about 5-6 pL, sufficient for loading onto the gel and generates a clean G+A track. Since this method 1s rapid, each marker lane can be freshly prepared while performing the DNase I digestions. 3.4. DNase I Footprinting
3.4. I. Basic Footprinting Protocol The basicprocedure for DNase I footprinting is quick and snnple (hence its popularity as a footpnnting agent) and can readily be adaptedto suit a rangeof conditions. 1. Mix 2 uL radiolabeled DNA (dissolved m 10 mMTrrs-HCl, pH 8.0, contannng 0.1 rniI4 EDTA) with 2 uL ligand (dissolved in a surtable buffer, such as 10 n&I Trrs-HCl, pH 7.5, containing 10 m&I NaCl). See Note 5 for suitable hgand concentrations.
12
Fox
2 Leave this to equihbrate for an approprtate length of time. For most small hgands, such as minor groove binding ligands or simple intercalators, the interaction with DNA is very fast, though some hgands require in excess of 30 mm for equiltbrium distribution. 3. Start the digestion by adding 2 PL DNase I (dissolved in 2 mM MgCI,, 2 mM MnCl,, 20 mM NaCi) 4 After 1 minute stop the reaction by adding 3 pL of formamide containing 10 mh4 EDTA and 0 1% (w/v) bromophenol blue The concentratton of DNase I requtred will depend on the reaction condrttons, 1-e , temperature, pH, DNA concentration, tonic strength This should be adjusted emptrtcally so as to give suitable extent of dtgestton (see Notes l-4). It 1s typically found that, at 20°C with 10 mM NaCl, a suitable enzyme concentration is about 0.03 Kunitz U/rnL (i.e., dilute 2 PL of stock DNase I [7200 U/mL] m 1 mL DNase I buffer, followed by adding 2 l.rL of this dtlutton to a further 1 mL buffer Each of these dilutions should be mixed gently, avotdmg vtgorous agitation) The enzyme should be freshly diluted immediately before use.
3.5. Electrophoresis
and Autoradiography
1 After DNase I digestion the samples should be denatured by boiling for about 3 mm, before loading onto a denaturing polyacrylamide gel Samples can be loaded directly from the boiling conditions, though excessive heating can produce some depurmation. However, it is probably best rapidly to cool the samples on ice before loading For most footprmtmg reactions there ts no need to use sharks teeth combs, and simple slots are sufficient Denaturing polyacrylamide gels (6-l 2% depending on fragment length) should contam 8 M urea and are run m 1X TBE buffer, For some CC-rich DNAs these denaturing conditions are not harsh enough and some bands are compressed. Thts can be alleviated by including formamtde (up to 30%) m the gel mixture and can be further improved by prerunning the gel for 30 mm before use. Formamtde contammg gels run slightly slower than conventtonal gels and should be of a slightly higher percentage. For footprmtmg expertments 0.3-mm-thick gels are normally used that are 40 cm long; these are run at 1500 V until the bromophenol blue reaches the bottom (about 2 h). The gels should be run hot, maintaining the DNA m a denatured form. Although many modern electrophoresls tanks are thermostatically controlled, “smtling” of the lanes can also be avoided by clamping a metal plate over the glass surface, ensuring an even dtstributton of heat. 2. After electrophoresis the plates are separated and the gel is soaked in 10% (v/v) acetic acid. This serves to fix the DNA and remove much of the urea, prior to drying Each 2 L of 10% acetic acid can be used to fix up to three gels.
DNase I Foo tpnn trng
13
3 After fixing, the gels are transferred to Whatman 3MM paper, covered with Saran wrap and dried at 80°C m a commercial gel drier 4. The dried gels are exposed to autoradiography If the DNA IS suitably “hot,” then 1-2 d exposure at -70°C with an Intensifying screen should be sufficient.
3.6. Analysis Although rigorous quantitative analysis is required for assessingthe relative binding affinity at different sites, and for measuring bmdmg constants, the locatton of drug-induced footprmts can usually be directly assessedby visual mspectlon. Quantitative analysis requires additional equipment (densitometer or phosphorimager) and 1sbeyond the scope of this chapter (see Chapter 2). However, since DNase I footprmts are necessarily larger than the actual hgand binding site, on account of the size of the enzyme, both visual and quantitative analyses leave some uncertainties. The footprint will be larger than the binding site, and this too may be larger than the recognition site. For example, although actinomycm D specttically recognizesthe dmucleotide GpC, tt covers about 4 bp and protects about 6 bases from DNase I cleavage. For small hgands that recognize only 2 or 3 bp, and which may generate several discrete footprmts on any given DNA fragment, the ambiguity concermng the exact bindmg can often be resolved by determmmg the sequencesthat are common to each of the footprints. Additional mformatton is gleaned by comparmg the location of the footprints on each of the DNA strands, visualized by performing separate experiments with DNA labeled on each strand. Since DNase I footprmts are staggered in the 3’ direction by 2-3 bases,the exact binding site will be located toward the 5’ end of each footprint and will be contained m the region of overlap protected on both strands. If there are still uncertamtres about the sequence recognitton properties, then it may be necessary to synthesize (a series of) synthetic fragments that contam putative binding sites based on the preliminary footprinting data. An example of this is the AT-selective bifuncttonal intercalator TANDEM Footprmting experiments with natural DNA fragments confirmed the AT-selectivity, but could not determine whether the recognition site was ApT or TpA (7). This was resolved by producmg fragments containing a series of different AT-rich binding sites, i.e., ATAT, TATA, TTAA, and AATT (53). These demonstrated that the recognition sateis TpA not ApT. An alternative strategy is to use another footprmting agent such as MPE, hydroxyl radicals, mrcrococcal nuclease, DNase II, or uranyl radicals, though these suffer to different degrees from the same problems of locating the exact ligand binding site. 3.7. A Worked Example Figure 3 shows DNase I digestion of the tyr?” DNA fragment m the presence of varying concentratrons of the AT-selective anttbiotrc distamycm. The
Fox
14
20-
Fig. 3. DNaseI footprinting of distamycin on the 160bp Qv-TDNA fragment,whose sequenceis presentedin Table 2. The EcoRI-AvaI fragment is labeled at the 3’ end of the EcoRI site. The distamycin concentration(pA4) is shown at the top of the lanes. Each pair of lanescorrespondsto cleavageby the enzyme for 1 and 5 min.
sequenceof this DNA fragment is presentedin Table 1. The DNA fragment in Fig. 3 hasbeen obtainedby digesting with EcoRI andAvaI and hasbeen labeled at the 3’ end of the EcoRI site with a-32PdATP, using reverse transcriptase, revealing the bottom strand in Table 1. Since this fragment has been widely used as a footprinting substrate,the bands have been assignedby comparison with other published data. Sampleshavebeenremoved from the digestion mixture at times of 1 and 5 min. This figure will be usedto illustrate severalaspects of DNase I footprinting. It can be seenthat DNase I cleavagein the drug-free control is not even (see Note 6). Some regions are cut poorly, particularly between 26-32 and 42-50. These are staggeredto the 3’ side of the A, 1T, blocks at 27-33 and 46-52.
D Nase I Foo tpnn tmg
75
Cleavage is also poor around position 100, m a GC-rich block. In addition some positions are cut much better than the surroundmg bonds (e.g., 41, 69, and 81), whereas others are cut less well (e.g., 39,58, 83). The poor cutting m the AT-rich regions of the control presents an obvious problem for this hgand that 1sAT-selective since the binding sites correspond to regions where there is little or no cleavage m the control. Visual inspection reveals that distamycm has altered the DNase I cleavage pattern. Clear protections from DNase I cleavage are evident at the lowest hgand concentration (0.2 PM) at positions 26-32 and 43-50. These sites correspond to regtons that are poor sites of DNase I cleavage in the control. Other regions of protection can be seen at 1 and 5 )L&!at 56-68, 78-89, and around 110. Each of these positions corresponds to an AT-rich sequence. The first contains two distamycin bmdmg sites (TTA and TAAA) that produce a single overlappmg footprint, as does the second (AAT and ATAT), whereas the third contams a single site TTAT. At concentrations of 25 and 100 uM most of the cleavage in the lower portion of the fragment is protected. It can be seen that each of these protections is staggered by 2-3 bases in the 3’ (lower) direction relative to the actual binding site For example, the protection around posinon 60 extends down at least as far as posttion 56, whereas the AT-bindmg site ends at position 59 In contrast, the 5’ (upper) end of the footprmt is coincident with the edge of the binding sites (position 69) As a result of the overlapping footprints, and the poor cleavage of the enzyme around some bmdmg sites, it is not possible to determine the ligand bmdmg site size from these footprmts. The intensity of certain bands is increased at distamycm concentrations of 5 wand above, especrally at positions 72/73,94/95, and 99/l 00, each of which is located m a GC-rich region. Indeed at the highest lrgand concentration the bands at 72/73 and 94/95 are the only cleavage products remainmg. These regions of enhanced cleavage have previously been interpreted as arising from ligand induced changes in DNA structure (4). However, in view of small amount of free DNA available for enzyme cleavage these enhancements could simply reflect changes in the ratio of free DNA to enzyme (54,55). Since most of the enzyme binding sites are occupied by the ligand, the relative concentration of enzyme at these sites will be much greater, hence the greater cleavage efficiency (see Note 8). It should be noted that, in this example, the 5-min lanes are overdigested; only a small proportion of the DNA is uncut. As a result, bands toward the top of the gel are much lighter, whereas those toward the bottom are overrepresented, since they arise from multrple cleavage events. Although it is still possible to discern the footprmting sites m the lower portion, this is less clear m the upper part, and could certamly not be used in any quantitative analysis.
16
Fox
Table 2 The Effect of Various Conditions on the Relative of DNase I Required in Footprinting Experiments Relative enzyme concentration
Ionic strength
4°C 20°C 37OC
6 1 05
001 0.1 10
5OT
1
65°C
2
Temperature
Concentration
Relative enzyme concentration 1 5 10
pH 50 6.0 70 80
Relative enzyme concentration 5 3
1 1
4. Notes 1 The activity of DNase I will. of course, vary according to the different reactlon condltlons, affecting the extent of digestion, and suitable adjustments should be made to ensure sufficient cleavage, yet maintaining “single-hit” kinetics This can be achieved either by altermg the digestion time or varying the concentration of the enzyme The latter 1s generally varied A rough guide for the effect of various condltlons on the relative concentration of DNase I required IS presented m Table 2 For mitral experiments it 1soften worth performing a time course for the enzyme digestion, increasing the volume of the reactants and removing allquots e g., say, 1, 5, and 30 mm 2. DNase I requires the presence of dlvalent metal ions, particularly magnesium, and so Its action can be stopped by adding EDTA The enzyme has more than one bmdmg site for dlvalent catlons, though only one of these 1sat the catalytic site The literature on the preferred metal ions IS confusing with various claims for different sites for calcium and/or magnesium suggestmg that both ions are required However, good cleavage is observed with either calcium or magnesium, although slrghtly higher enzyme concentrations are reqmred when using calcmm alone Since manganese has been shown to increase the rate of digestton, equlmolar concentrations of manganese and magnesium are generally used It IS found that the cleavage pattern 1s largely unaffected by the nature of the divalent metal Ion, even though crystallographic data has suggested an alternative bmdmg site for manganese that might produce a different cleavage pattern In contrast, mllllmolar concentrations of ions such as Co*+ and Zn*+ inhlblt the activity of DNase I 3 DNase I 1sreasonably tolerant to a variety of organic solvents mcludmg methanol, ethanol, and dlmethylsulfoxlde (DMSO) This 1s useful since many DNAbindmg ligands are only sparmgly soluble m water and must be prepared as stock solutions in various other solvents. DMSO concentrations as high as 40% require a threefold higher enzyme concentration, though this does modify the cleavage pattern, increasing the cuttmg m regions that are poor substrates for DNase I, such as polydA tracts
DNase I Footprinting 4. A glance at the literature reveals that many laboratories include known concentration of unlabeled carrier DNA m the footprmtmg reaction. This is only necessary for experiments m which the absolute DNA concentration 1s needed (I e , some forms of quantitative footprmtmg analysis) and can be omitted for most experiments However, one advantage of mcludmg a fixed concentration of carrler DNA IS that the concentration of DNase I required to produce a given level of cleavage does not vary between experiments m which the absolute amount of radlolabeled DNA may not be constant 5 In most footprintmg reactions the concentration of the target DNA IS vamshmgly small (nanomolar) whereas the DNA bmdmg ligand IS present m mlcromolar amounts The extent of bmdmg is, therefore, not determined by the stolchlometric ratio of drug to DNA, but by the equlhbrmm bmdmg constant In this regard footprinting reactions resemble typlcal pharmacological experiments, m which the concentration of the target site IS small and unknown and m which the probability of each site being occupied is 50% at a ligand concentration equivalent to the equlhbrium dlssoclatlon constant Since many hgands bmd to DNA with affmties of between 1 and 100 PM’, drug concentrations between 1 and 100 @4 are usually examined. For drugs that bmd more tightly, lower ligand Concentrations should be explored. It IS generally best to test a range of hgand concentrations, extending down to a concentration at which the digestion IS not noticeably affected High hgand concentrations (100 CLM)often mhlblt DNase I digestion throughout the DNA fragment, this could be the result of nonspecific interaction with DNA or direct inhibition of the enzyme itself 6 A major problem with using DNase I as a footprmtmg tool IS that the enzyme cuts different sequences with efficiencies that can vary over two orders of magmtude. These variations can be both local, m which isolated bonds are cut better or worse than average, or global, where long DNA regions are cut poorly In general, polydA polydT tracts are poor substrates for DNase I, on account of their narrow minor grooves GC-rich regions are also cut poorly, probably because they are more rigid and resist the bending that may be an important part of the DNase I catalytic reaction. In addition, RpY steps are generally cut better than YpR. Llgands that bind to those regions that are cut poorly by DNase I, produce footprmts that are difficult to detect. The only way round this problem 1sto use a different footprmting probe 7 A similar problem 1sencountered when assessing the exact size of a footprint if bands at the edges of the footprint are cut poorly m the control Although this may be clarified by examining the cleavage of the other strand, the ambiguity often remains so that the footprmting site size can usually only be quoted to within an accuracy of +l base. 8 As well as producing footprmts, many hgands also generate enhanced DNase I cleavage m regions surrounding their binding sites. These have been explained m two different ways, each of which is correct in different circumstances First, these may arise from drug-induced changes m DNA structure, which are propagated mto neighboring regions, and which render the DNA more susceptible to
18
9
10
11.
12
Fox DNase I cleavage. Second, they may simply reflect a change in the ratio of free DNA to enzyme m the presence of the ligand (5455) These two posslblhtles can only be properly dlstingulshed by quantitative footprmtmg experiments However, a few other factors may indicate which is occurrmg. Enhancements artsmg from changes m the ratio of free DNA to enzyme should be constant at all points to which the hgand 1snot bound, whereas those that are directly attributable to hgand bmdmg will be located closest to the hgand bmdmg sites A further posseblhty, which 1s rarely considered, 1s that of llgand-induced protections from enzyme cleavage, m surrounding regions An apparently mmor detail, which 1srarely addressed, concerns the hgand concentration Does this refer to the actual concentration before or after adding the DNase 17 For a hgand m fast exchange with the DNA, a new equlhbrmm will rapidly be established after the small dilution because of the addltlon of the enzyme In contrast, if the dlssoclatlon IS slow compared with the time course of the dlgestion, then the dlstrlbutlon of the hgand will resemble the startmg condltlons throughout the reaction In the former case the hgand concentration should be that after adding the DNase I, whereas m the latter case this should refer to the concentration before In theory, the answer to the question requires some prior knowledge of the kinetics of hgand bmdmg, though m practice one or other 1s consistently adopted Unwanted bands sometimes appear m the lanes, which clearly do not arlse from enzyme digestion These may be contaminants m the DNA preparation and can be checked by running a sample of DNA that has not been digested with the enzyme Artlfactual bands, particularly depurmatlon products, can be produced by the bollmg procedure. These can be obviated by mcludmg a small amount of sodium hydroxide (l-2 m44) in the stop solution Since DNase I cuts from the minor groove, protections are easiest to Interpret for llgands that also bind m this groove, sterlcally inhibiting enzyme activity However, major groove bmdmg agents, such as triplex-formmg ohgonucleotldes, also generate clear DNase I footprints (12,13) In this case cleavage mhlbltlon cannot result from sterlc hmderance, but must arise from changes in the DNA structure and/or rigidity and are, therefore, less easily interpreted It should be noted that the footprmtmg pattern should still be staggered across the two strands by about 2-3 bases m the 3’ direction since this is a function of the cleavage agent, rather than the ligand under mvestlgatlon Agents that cut from the major groove would be expected to generate a 5’ stagger Another ambiguity m DNase I footprinting gels, which 1srarely addressed, concerns the numbering/assignment of the cleavage products. Although this would seem to be a trivial problem the uncertainty arises because, whereas most DNA sequences number the bases, DNase I cleavage products correspond to the phosphodlester bonds When Maxam-Gilbert markers are used alongslde DNase I cleavage of 3’-end-labeled fragments, each band m the marker lane (X) comlgrates with the band corresponding to cleavage of the phosphodlester bond on the 3’ side, 1 e , the XpY step
DNase I Foo tprin tmg
79
13 By adapting the simple footprmtmg protocol it can also be used for measurmg slow kinetic parameters, by removing samples from a reaction mixture and subjecting to short DNase I footprintmg (48,49). 14. It IS possible that some sequence selective compounds will not produce DNase I footprints if they are in rapid exchange with the DNA. In such cases footprints can be induced by lowermg the temperature, thereby increasing then persistence time on the preferred binding sites (56).
Acknowledgments Work in the author’s laboratory ts supported by grants from the Medical Research Council and the Cancer Research Campaign.
References 1 Galas, D J. and Schmitz, A (1978) DNAase footprmtmg-simple method for detection of protein-DNA binding specificity Nucleic Acids Res 5, 3 157-3 170 2 Lane, M. J , Dabrowrak, J C , and Vournakis, J N. (1983) Sequence specificity of actinomycm D and netropsm binding to pBR322 analysed by protection from DNAase I. Proc Nat1 Acad Sci USA 80,326&3264 3 Scamrov, A V. and Beabealashvilh, R Sh. (1983) Bmdmg of actmomycm D to DNA revealed by DNAase I footprintmg. FEBS Lett 164, 97-101. 4 Fox, K R and Warmg, M J (1984) DNA structural variatrons produced by actrnomycm and distamycm as revealed by DNAase I footprmtmg Nuclezc Aczds Res 12,9271-9285 5 Fox, K R. and Howarth, N R (1985) Investigations into the sequence-selective bmding of muhramycm and related ligands to DNA Nuclezc AczdsRes 13,8695-87 14 6. Low, C M L , Drew, H R , and Waring, M J (1984) Sequence-specific binding of echmomycm to DNA. evidence for conformational changes affecting flanking sequences. Nucleic Acids Res 12, 48654879 7. Low, C. M L , Olsen, R K., and Warmg, M. J. (1984) Sequence preferences m the binding to DNA of triostm A and TANDEM as reported by DNase I footprmtmg. FEBS Lett 176,4 14-4 19. 8 Chaires, J. B., Fox, K. R , Herrera, J E., Britt, M , and Warmg, M J (1987) Site and sequence specificity of the daunomycin-DNA interaction Blochemzstry 26,8227-8236 9 Chanes, J B , Herrera, J E , and Waring, M J (1990) Preferential bindmg of daunomycm to S’(A/T)CG and S’(A/T)GC sequences revealed by footprmtmg titration experiments Brochemzstry 29, 614556153 10 Fox, K. R. and Warmg, M J. (1986) Nucleotide sequence bmdmg preferences of nogalamycin investigated by DNase I footprintmg. Bzochemzstry 25,4349-4356 11 Abu-Daya, A , Brown, P M., and Fox, K. R. (1995) DNA sequence preferences of several AT-selecttve minor groove binding hgands Nucleic Acids Res 23, 3385-3392 12 Cooney, M., Czernuszewicz, G., Pastel, E. H , Flmt, S. J., and Hogan, M E (1988) Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro Science 241,456459
20
Fox
13 Cheng, A -J and van Dyke, M W (1994) Oltgodeoxyribonucleotide length and sequence effects on mtermolecular purine-purme-pyrimidme triple-helix formatlon Nucleic Acids Res 22,4742-4747 14 Fox, K. R and Waring, M. J (1987) The use of micrococcal nuclease as a probe for drug-binding sites on DNA Blochrm Bzophys Acta 909, 145-l 55 15 Cons, B M G and Fox, K R (1990) The GC-selective hgand mtthramycm alters the structure of (AT), sequences flankmg its bmding sites FEBS Lett 264, lo&104 16. Stgman, D. S. (1990) Chemical nucleases. Brochemlstry 29,9097-9105 17 Spassky, A and Slgamn, D S (1985) Nuclease acttvny of 1,lO phenanthrolmecopper ion. conformational analysis and footprmting of the lac operon Blochemwtry 24,8050-8056. 18 Van Dyke, M W , Hertzberg, R P , and Dervan, P B (1982) Map of distamycin, netropsm and actmomycm binding sites on heterogeneous DNA DNA cleavage inhibition patterns with methidmmpropyl-EDTA-Fe(I1). Proc Nat1 Acad Scz USA 79,5470-5474 19. Van Dyke, M W and Dervan, P. B (1983) Chromomycin, mithramycm and ohvomycin binding sites on heterogeneous deoxyribonucleic acid Footprintmg with (methidmmpropyl-EDTA)Iron(II) Biochemutry 22,2373-2377 20 Hertzberg, J P and Dervan, P B. (1984) Cleavage of DNA with methidmmpropylEDTA-Iron(I1) reaction conditions and product analyses Blochemlstry 23, 3934-3945 2 1. Van Dyke, M. W. and Dervan, P B. (1983) Methidmmpropyl-EDTA.Fe(II) and DNase I footprmtmg report different small molecule bmdmg site sizes on DNA Nuclerc Acids Res 10,5555-5567 22. Nielsen, P E., Jeppesen, C., and Buchardt, 0. (1988) Uranyl salts as photochemical agents for cleavage of DNA and probing of protein DNA contacts FEBS Lett 235, 122-124. 23. Nielsen, P E., Hiort, C , Sonmchsen, S H., Buchardt, O., Dahl, O., and Norden, B. (1993) DNA bmdmg and photocleavage by uranyl(VI)(UOZ2’) salts J Am Chem Sot 114,4967-4975 24. Cons, B. M. G. and Fox, K R. (1989) High Resolution hydroxyl radtcal footprmting of the bmdmg of mtthramycin and related antibiotics to DNA Nucleic Acids Res 17,5447-5459 25. Churchill, M. E. A , Hayes, J J , and Tullms, T D. (1990) Detection of drug binding to DNA by hydroxyl radical footprintmg Relationship of distamycm binding sites to DNA structure and positioned nucleosomes on 5s RNA genes of Xenopus Biochemistry 29,6043-6050. 26 Portugal, J and Warmg, M J. (1987) Hydroxyl radical footprmtmg of the sequenceselective bmdmg of netropsm and distamycin to DNA. FEBS Lett 225, 195-200 27 Drew, H. R and Travers, A A. (1984) DNA structural variations m the E colz tyrT promoter. Cell 37,491-502 28. Drew, H. R. (1984) Structural specificrues of five commonly used DNA nucleases J Mel Bzol 176,535-557
DNase I Footprintmg
21
29. Waterloh, K. and Fox, K R. (199 I) The effects of actmomycm on the structure of dA, * dT, and (dA-dT), regions surroundmg its GC bmding site: a footprintmg study J Biol Chem. 266,6381-6388. 30. Waterloh, K. and Fox, K R. (1991) Interaction of echmomycm with A,, T, and (AT), regions flanking its CG bmding site Nucleic Acids Res 19,67 19-6724 3 1. Laskowskr, M (197 1) Deoxyrlbonuclease I, in The Enzymes, vol. 4 (Boyer, P D , ed ), Academtce, London, pp 289-3 11, 32. Kumtz, M. (1950) Crystallme deoxyribonuclease I isolation and general properties spectrophotometric method for the measurement of deoxyribonuclease activity. J Gen Physzol 33, 349-369 33. Price, P. A (1975) The essential role of Cazf m the activity of bovine pancreatic deoxyribonuclease J Blol Chem 250, 1981-1986 34 Lomonossoff, G. P , Butler, P. J. G , and Klug, A. (198 1) Sequence-dependent variation m the conformation of DNA. J Mol BIO~ 149,745-760. 35 Hogan, M. E., Roberson, M W., and Austin, R. H. (1989) DNA flexibility variation may dominate DNase I cleavage Proc Nat1 Acad Scz USA 86,9273-9277 36 Brukner, I., Jurukovski, V , and Savic, A. (1990) Sequence-dependent structural variations of DNA revealed by DNase I. Nuclezc Aczds Res 18, 89 l-894 37. Suck, D., Oefner, C , and Kabasch, W. (1984) Three-dimensional structure of bovine pancreatic DNAase I at 2.5A resolution. EMBO J 3, 2423-2430. 38 Suck, D. and Oefner, C (1986) Structure of DNaseI at 2A resolution suggests a mechanism for bmdmg to and cuttmg DNA Nature 321,62(X-625. 39 Oefner, C and Suck, D (1986) Crystallographic refinement and structure of DNAase I at 2A resolution. J Mol Blol. 192, 605432. 40 Suck, D , Lahm, A, and Oefner, C (1988) Structure refined to 2A of anicked octanulceotide complex with DNAase I Nature 332,464-468 4 1 Weston, S A , Lahm, A , and Suck, D. (1992) X-ray structure of the DNase Id(GGTATACC)2 complex at 2 3k resolution. J Mol Bzol 226, 1237-1256 42 Lahm, A. and Suck, D (1991) DNase I-induced DNA conformation. 2A structure of a DNase I-octamer complex J Mel Bzol 221, 645-667 43. Herrera, J. E. and Chaires, J B (1994) Characterization of preferred Deoxyribonuclease I cleavage sites J Mol Bzol 236,405-411 44. Bailly, C., Donker, I. O., Gentle, D., Thornalley, M., and Warmg, M. J (1994) Sequence selective binding to DNA of cis- and trans- butamidme analogues of the anti-Pneumocystis carmn pneumonia drug pentamidme. MoZ Pharm 46, 3 13-322 45 Bailly, C , Gentle, D , Hamy, F , Purcell, M., and Waring, M J. (1994) Localized chemical reactivity in DNA associated with the sequence specific bismtercalatlon of echmomycm Blochem J 300, 165-173 46 Ridge, G. S , Bailly, C , Graves, D. E., and Warmg, M J (1994) Daunomycm modifies the sequence-selective recognition of DNA by actinomycm. Nuclezc Acids Res. 22,5241-5246.
47. Waterloh, K. and Fox, K. R. (1992) Secondary (non-GpC) bmdmg sites for actinomycin on DNA. Blochzm Biophys Acta 1131,300-306
22
Fox
48 Fletcher, M C and Fox, K R. (1993) Vtsuahsmg the kmettcs of dtssoctatron ofactinomycin from mdtvrdual bmdmg sites m mixed sequence DNA by DNase I footprmting Nucleic Acids Res 21, 1339-l 344 49 Fletcher, M C and Fox, K R (1996) Dtssoctatton kmettcs of echmomycm from CpG sites m different sequence envtronment Bzochemzstry 35, 1064-l 075 50 Huang, Y -Q , Rehfuss, R. P , LaPlante, S. R., Boudreau, E Borer, P N , and Lane, M J (1988) Actmomycm D Induced DNAase I cleavage enhancement caused by sequence specttic propagation of an altered DNA structure Nuclezc Aczds Res 16, 11,125-l 1,139 5 1 Bishop, K D , Borer, P N , Huang, Y -Q., and Lane, M J (1991) Actmomycm D induced DNase I hypersensitivtty and asymmetrtc structure transmission m a DNA hexadecamer Nucleic Aclds Res 19, 87 l-875 52 Maxam, A M and Gilbert, W (1980) Sequencmg end labelled DNA wtth basespecific chemical cleavages Methods Enzymol 65,499-560 53 Lavesa, M., Olsen, R K , and Fox, K. R (1993) Sequence spectfic bmdmg of [NMeCys3,N-MeCys’] TANDEM to TpA. Blochem .I 289,605-607. 54 Ward, B. Rehfuss, R , Goodisman, J , and Dabrowtak, J C (1988) Rate enhancements m the DNase I footprmting experiment Nucfezc Aczds Res 16, 1359-l 369 55 Ward, B. Rehfuss, R Goodisman, J., and Dabrowtak, J D. (1988) Determination of netropsm-DNA bmdmg constants from footprmtmg data Bzochemzstry 27, 1198-1205 56 Fox, K R and Warmg, M J (1987) Footprmtmg at low temperatures* evidence that ethidmm and other sample mtercalators can drscrimmate between different nucleottde sequences Nucleic Aczds Res 15,49 l-507
2 Quantitative
DNA Footprinting
James C. Dabrowiak,
Jerry Goodisman,
and Brian Ward
1. Introduction Footprmting analysis has been used to identify the bmdmg sites of drugs and other hgands bound to DNA molecules (see Chapter 1) (1-3). It is particularly useful for equilibrium bmdmg drugs or hgands that leave no record of their residence position on DNA In the footprmtmg procedure, the hgandDNA complex is exposed to an agent or probe that can cleave DNA, and the ohgonucleotide products from the cleavage reaction are separated using, for example, electrophoresis m a polyacrylamide gel. If the hgand, when bound, inhibits cleavage by the probe, the ohgonucleotides that terminate at the hgand binding site will be underrepresented among the products analyzed using the sequencing gel. This appears as omissions or “footprmts” m the spots on the sequencing autoradiogram In quantitative footprmtmg, digests are carried out using different concentrations of drug. Then the drug binding can be seen as a decreasein the intensity of a spot (corresponding to a particular cleavage site) with drug concentration. Since the autoradiographic spot mtensities are directly proportional to oligonucleotide concentrations, they give the proportion of sites occupied by drug so that from the dependence of spot mtenstty on drug concentration one may obtain the drug (or protein) bmdmg constant for a particular site, i.e., as a function of sequence. In this chapter, we outline the approach used to obtain binding constants for drugs bound to DNA. In Subheading 3.1., the experiment is reviewed and, m Subheadings 3.2.-3.3., the theory behind quantitative footprmtmg analysis is outlined. The method is illustrated with published results (46) for the DNA sequence shown m Fig, 1 (Subheading 3.4.), with new results for ohgonucleotide duplexes having only a single site (Subheading 3.5.). The drug used m From
Methods
m Molecular
Edlted
by
Bology,
K R Fox
Vol 90 Drug-DNA
Humana
23
Press
Interact/on
Inc , Totowa,
NJ
Protocols
Dabrowiak et al.
24
5’-AGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACcGTGTATGAAATcTAACAA . 30% 40 50 60 70 00
90
TGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCG~3’ 100 110 120 130 140 150 160 ACGCGAGTAGCAGTAGGAG~CGTFGCqGTGGGACCTACGACAT~ATC~ACCAAT~CCATGACGGC-5’ -
-
Strong Site
u
170
Weak Site
Fig 1, The sequence of a 139-bp fragment from pBR 322 DNA Strong and weak binding sites for ActD are indicated by filled and hatched rectangles, respectively (6).
both casesIS actinomycin D (ActD). Quantitative footprinting analysis is also apphed to determination of the dissociation constantof a triple helix formed from an ohgonucleotlde and a lineanzed double-stranded plasmld (Subheading 3.6.) 2. Materials The materials and equipment necessary for quantitative footprinting analySISare readily avallable m most biochemical laboratories. The DNA substrate can be obtained from restriction cleavage of natural DNA& synthesized or generated using PCR. It 1sadvisable to purify the end-labeled DNA, using a gel to remove labeling reagents that may interfere with the equilibria being measured (7). If calf thymus DNA 1sto be added to the mixture, it should be deproteinized and sonicated prior to use. No special treatment of the enzyme DNase I 1snecessary.However, all commercial preparations of the enzyme slowly degrade m solution with time. For this reason, calibrated stocks of DNase I should be stored at -20°C until needed(8). The sequencing gel, after electrophoreSIS,can be analyzed with a phosphorlmagmg device or by autoradlography/ mlcrodensitometry to obtain quantities proportional to DNA concentrations. The concentrations can be used to measure ligand binding constants according to the method outlined in Subheaading 3.2. 3. Methods 3.7. The Footprinting Experiment: General Considerations The interpretation of the quantitative footprmtmg experiment 1sslmphfied when one terminates the cleavage reaction with -80% of the full-length DNA uncleaved. This ensures that the products are the result of a single cleavage m the full-length fragment of DNA. In this “single-hit” regime, the amount of each ohgomer 1sproportional to the probability of cleavage at the correspondmg
Quantitative DNA Footprintmg -
300
27Ol'
340:
74 %210E
25
. A
AA 1, AA A -p-‘---.._‘-a ---_ --__ -5 AA ---_ f
*
--__ --a_ A --. A .
Fig 2 Sum of the band mtenslties m a lane as a function of Actmomycm D concentration (6)
site on the original DNA. To choose the concentration of cleavage agent, the amount of DNA, and the reaction time so as to be m the single-htt regime, one carries out a series of calibration experiments in the absence of drug. One also carries out a series of reactions with vartous concentrations of the DNA-binding drug to be studied to establish the general range of drug concentration over which drug loading takes place on the polymer Since one 1strying to measure a titration curve, one wants more points for drug concentrations for which the occupation probabthty of a site varies, and fewer for drug concentrations corresponding to zero occupation or complete occupation. Afterward, experiments are performed using drug concentrattons in the range identified. From quantitation of the resulting gel, one obtains spot intenstties as a function of sequence and drug concentration. In principle, one has carried out a series of digests of identical DNA fragments in the presence of varying amounts of drug, but otherwise under identical conditions. The “total cut” plot, the sum of the spot intensities as a function of drug concentration, is shown for actmomycin D interacting with a 139-bp fragment from pBR 322 DNA m Fig. 2 (4). To account for lane-to-lane differences, a “total cut” plot, the sum of all cleavage products vs the drug concentration, 1sconstructed. Since this plot is a smooth function of drug concentration, deviattons from the curve are due to experimental error. A least-square-fit stratght line is shown m Fig. 2; in many
cases,a horizontal line, i.e., total cut = constant,fits the dataas well as a function contammg more parameters. To correct for experimental error, all spot
26
Dabrowiak et al.
mtenstties m a lane are multiplied by a common factor, the ratlo of the value of the smooth curve to the actual spot intensity sum. After making this correction, one constructs a plot of spot intensity vs drug concentration for each ohgomer. These plots are referred to as “footprinting plots.” Some footprmting plots for ActD bmding to a 139-mer are shown in Fig. 3 Their shapes can be explamed by noting that the spot Intensity is proportional to the rate of cleavage at a nucleotide position because the digest time IS constant. The rate of cleavage at site 1, m turn, may be written as: (rate), = k, [probe], where k, is the rate constant for cleavage at site i, and [probe],, the effective concentration of cleavage agent at that site, may depend on drug concentration. For a nucleotide position within a drug-bmdmg site, [probe], decreases as drug IS added to the systembecause this increases the probability that drug ~111 be bound at that site and cleavage agent cannot bmd where drug is already present. This is the classic footprmtmg phenomenon; it predicts a monotomc decrease of spot mtensity with drug concentration. If the drug-bmding constant is much larger than that for probe, so that a drug molecule always displaces a probe, [probe], will be proportional to I-vk, where vk IS the fraction of sites 1 having drug bound. For a nucleotide site not within a drug bmdmg site, the spot mtensity should not depend on drug concentration. For relatively long DNA molecules, spot mtensities correspondmg to sites between drug-bmdmg sites are observed to mcrease as drug is added to the system. If DNA is not saturated with probe, increased cleavage with added drug may occur because bound drug decreasesthe amount of cleavage agent at drug binding sites and, hence, must increase tt elsewhere, i.e., m bulk solution and at sites not blocked by drug. The increase m [probe], is important when the ratio of probe concentration to DNA concentration 1ssmall. It ~111not occur when the DNA is saturated wtth probe. It is also possible that drug binding induces a structural change in the DNA, changing the cleavage rate constant k,. This could lead to either an increase or a decrease in (rate),, superposed on the mass-action effect just mentioned. Intercalating drugs like ActD are more likely to cause a distortion m DNA upon bmdmg than are groove-bmdmg drugs like netropsin (9). Alterations in cleavage rate constantsk, may explain apparent osclllations seenin some footprintmg plots for low drug concentrations,O-2 l.tA4,Fig. 3. Some of the footprinting plots shown seem to be composites: cleavage is first enhanced and then mhlbtted by increased drug concentration. Nonmonotomc footprmting plots arise for cleavage sites within secondary drug-binding sites, with lower bmdmg constants than primary drug-binding sites. The explanation is that, for lower drug concentrations, drugs bind at the primary sites, displacmg probe and leading to enhanced cleavage at other sites. At higher drug concen-
Quantitative DNA Foo tprin tmg
0.0
.
..
. . . ..‘.‘..““.‘~,‘,“.‘,.,,.,..,.)
’
‘“[A&&i&y’”
”
7.0 6.0 5.0 4.0 3.0 2.0 1.0 0.0
[Actinomycin],
Fig 3. Footprinting
p M
plots for selected sites on the 139-mer shown in Fig. 1
drug binds at the secondary sites, thus blocking probe binding and decreasing cleavage. Footprinting plots are like titration curves except that fractronal occupation is being plotted agamst total drug concentratron rather than against free-drug concentration. Although footprinting plots are not linear, it IS sometimes useful to fit their behavior at low drug concentration to a straight line. Then one can
tratlons,
4o
28
Dabrowiak et al.
calculate “mitial relative slopes,” i.e., the slope of the lme divided by the intercept. Plotted as a function of sequenceof the fragment, the mitral relative slopes clearly show the positions of drug binding. They may also point to possible druginduced structural changes and enhancements caused by the mass-action effect 3.2. Constructing the Model The first step m constructmg a model for drug bmdmg and tts effect on cleavage is to inspect footprmting plots or initial relative slopes One can deduce the size of the inhibition region, i.e., how many sites are blocked by binding of a drug molecule. One wants footprmting plots for as many sites as possible, but, for some sites, if DNase I is the cutting agent, mtensmes will be low, and reliable mformation on the effect of drug concentratton on cleavage will be difficult to obtam Another comphcation is that single-site resolution cannot be obtained over the entire sequencing autoradiogram. Resolution along the DNA helix decreases as ohgomer length increases, so one obtains less mformatton about bmdmg sites that are far from the radiolabel. The size of the mhibmon region depends on the drug as well as the probe. For ActD, the preferred intercalation site for the phenoxazone rmg 1s5’-GC-3’, with the two cychc pentapeptides displaced 1 bp to either side of the mtercalation site (9). A single ActD molecule would thus cover about 4 bp of DNA However, DNase I has a small loop, important to the binding process, that fits mto the minor groove of DNA, and spans 3-4 bp of DNA (20). Smce the catalytic site is located at the end of the loop, there ISan mhibmon region of 3-4 bp to the 3’ side of a bound ActD molecule. The enzyme-DNA contacts on the other side of the catalytic site are relatively weak, so the enzyme can probably cleave near the 5’ edge of a drug site. Thus, the inhibition region would be 7-8 bp m length. For an isolated drug-binding site j, the concentratton of bound drug is related to the bmdmg constant KJ by: K, =
cJ (c - c,>Do
Here, c, 1s the concentration of sites J at which drug is bound, c is the total concentration of sites J (equal to the concentration of DNA m molecules), and D, is the free-drug concentration The probability that a probe site i wtthm the inhibition region of drug site j is blocked by drug, v,, is equal to c,/c. Then [probe], is proportional to: 1- v, = (1 + K,D,)-’ If two drug sites j and k, with bmdmg constants K, and &, are near enough to each other so that a probe site 1may be blocked by drug bmdmg at either site J or site k:
29
Quantitative DNA Footprintmg l-vl=il-~h-y-~=(~
+KkD0>
+K,p):l0
If, however, two drug sites j and k are so close that drug binding at one prevents drug binding at the other, the probability of drug bmdmg at site j ISK,D,l (1 + K,D, + &D,,), with a similar expression for the probability of binding at site k. Then the probability that there is no drug blocking probe bmdmg at probe site i 1s: l-v*=
1
(1 + KJDo+K,D,)
Because the drug sites are not independent, one cannot srmply multiply together the probabilmes that each one is vacant. The total concentration of probe at all cleavage sites depends on the drugprobe competition. If the total cut IS constant as a function of drug concentration, the system behaves as if the amount of probe available for binding to DNA is unchanged by the addition of drug. Added drug decreasesprobe concentration at drug-bindmg sites of the DNA and increases it at other sites. If the number of avallable probe molecules is small compared to U, the number of unblocked sites, the concentration of probe at such sites should be inversely proportional to U. This effect IS represented by dividing [probe], by (1 -K.&, where cb IS the total concentration of drug bound to DNA and the “enhancement constant” K, is a parameter whose value is determined along with drugbindmg constants. If the probe and the hgand are specific for certain sites, or the DNA molecule IS so small that drug and probe compete for a common site, one can consider explicitly the competmve equilibrium between drug and probe. The probabtlity that probe is bound at a site is determmed by the stmultaneous equilibrium expressions* Cl
K, =
(c - cl - q,,)Do
, K,,
CPl
=
(c - Cl -
CpJPo
Here, c, is the concentration of sites I with drug bound and c,,,the concentration of sites i with probe bound, so that c-c, -cP, is the concentration of empty sites I. D, and PO are the concentrations of unbound drug and unbound probe, so tgb§, for isolated sites: Do=Dt-
cI c,
Po=Pt-C
cp1 I
with D, and Pt the (known) total drug and probe concentrattons. The above equations are solved simultaneously to get c, and c,,,.
30
Dabrowiak et al.
Often, unlabeled carrier DNA is present in addition to the DNA fragment whose cleavage products are measured. The carrier, if present m large excess over the fragment, determines the concentration of free drug present m the system. One has to model drug bmdmg by the carrier because the free-drug concentration enters the bindmg constant expressions for the radiolabeled fragment If the carrier DNA has approximately the same base-pair composition as the fragment, the number of strong drug-bmdmJpsites on the carrier can be estimated from the number on the fragment. Otherwise, one may represent drug bmdmg to the carrier in terms of an effective concentration of strong sttes on the carrier, c,, and an average binding constant for these sites, KC. Then the amount of drug bound to the carrier, cb, 1sgtven fi. .: Kc=
cb (cc
- Cb)&
where D, is equal to the total drug concentration minus the concentration of drug bound to the radtolabeled fragments and the concentration of drug bound to the carrier. Because the carrier is present in large excess,D, = D, - cb. The values of the parameters c, and Kc may be determined along with other constants in the mimmizatton (see Subheading 3.3.). Sometimes only the product of c, and Kc may be determined reliably. A fragment may have weak-bmding sites in addition to strong sites. If one goes to high enough drug concentration so that binding to the weaker sites 1simportant, one must consider similar weak sites on the carrier. To summarize, there are a number of causesfor an alteration m the cleavage rate of a probe in drug-DNA footprmtmg experiments. Although enhancements are often attributed to drug- or protein-induced structural changes in DNA, there are other factors that can affect the cleavage rate without changing the cleavage rate constant. 3.3. Parameter Search The individual site binding constants, K,, and other parameters are chosen to minimize the devtation between theoretical and experimental footprmtmg plots:
D=c (I,1 -i,,’ Here I,, is the jth measured intensity (corresponding to the jth drug concentration) for an ollgomer formed by cleavage at site 1 and i,j is the correspondmg intensity calculated using the parameters. To calculate i,,, [probe], 1sevaluated for thejth total-drug concentration using given values of the parametersK,, c, Kc, and K,, The drug-bmndmgconstantsdetermine the probability that site 1is blocked by drug, and [probe], is proportional to 1
Quantitative DNA Footprin ting minus thts probability. The free-drug concentration, required to calculate the probability of drug binding, must be calculated from the known total drug concentration Dt by combmmg 0, = D, - ,S,c,with the equiltbrmm-constant expresstons. If a carrier is present, binding to the carrier must also be considered usmg a single site of concentration c, and equilibrium constant Kc, unless the drug concentrations used are high enough to require modeling weak sites on the carrier as well. The cleavage rate constants k,, which multiply [probe], to give the cleavage rate, are additional parameters; smce these are linear, the best values to use for them can be determined analytically. For the nonlinear parameters, a systematic search algorithm in multiparameter space is required The search procedure used 1sthe Simplex Method. It is conceivable that there are several relative minima for D, and there IS no way to guarantee that the minimum found is the true absolute mmimum. To gain confidence in the result, one may carry out the simplex search several times with different starting points. If the deviations of the calculated i,] from the experimental intensities I,Jare no larger in sizethan the fluctuations of I,J from one drug concentratton to the next, the model is said to fit the data, Naturally, use of a model wtth more parameters (for example, describing cooperative or anticooperative drug bmdmg) will always give a smaller value of D, but it makes no senseto increase the number of parameters when the deviations )I,,-i,, ] are already smaller than the experimental error. The more parameters used, moreover, the less likely it will be that they will be mutually independent, which will make the search procedure work less well. To assign a precision to the values of parameters determined m this way, one can examme the effect of a change m the value of one parameter on the value of D. It is usually found that changing an equilibrium constant by a few percent changes D by 10% or more. Naturally, if the bmdmg constants have different magnitudes, D is least sensitive to the values of the smallest. Note also that one can generally change a parameter by more than a few percent without much changing D, if other parameters are allowed to adjust then values. 3.4. Application to a Multisite Problem The approach outlined in Subheadings 3.2.-3.3. is now applied to the multisite restriction fragment of Fig. 1. The authors’ first work concentrated (4,s) on the strong drug-binding sites, usmg only footprmtmg data for low drug concentration, but a later study, using data for more sites and for a wider range of drug concentration, obtained binding constants for the weaker sues as well (6). For this system, drug binding to DNA causesthe cleavage agent, DNase I, to redistribute to DNA sites not blocked by bound drug (11). The DNase I footprmtmg experiments were carried out in the presence of calf thymus DNA as a carrier (193 @4 in bp), usmg as many as 26 different
32
Dabrowiak et al.
ActD concentrations from 0 to 38.8 pJ4. The mtenstties of spots corresponding to cut fragments were obtained by microdensitometric scanning of the sequencmg autoradiogram. The resulting total-cut plot, shown m Fig. 2, was used to correct for lane-to-lane vartattons The linear fit, shown m Fig. 2, was 247 1 0.825c,, with a mean-square devtatton of 19.9; fittmg to a quadratic function gave a mean-square devlatton of 18.4. The average of the total cleavage was 239.1, with a mean-square devtatton of 22.2 The decrease m mean-square deviation with more complicated functtons is not stattsttcally significant, and it 1sconcluded that total cleavage IS essentially constant as a function of drug concentration. Total-cut corrected mtenstttes were used to construct footprmtmg plots for 69 sites on the 139-mer, a few of which are shown m Fig. 3. To determine the bmdmg regions, “imtlal relative slopes” were obtamed and plotted vs site. Drug-bmdmg regions were clearly apparent as negative initial relative slopes surrounded by large positive slopes. The sequencesat which the negative slopes appeared indicated that ActD binds most strongly to S-GC-3’ and that the mhibttion region extends from -3 bp to the 5’ side of G to -2 bp to the 3’ side of C, for a total length of 6-7 bp. The first study, focusing on the stronger drug-binding sites,included data from 32 sites, excluding sites for which spot mtensmeswere too low for reliable measurement. These sites were: 54-56, 60, 62-69, 71-72, 85, 87, 98, 99, 102, 103, 106, 112, 114, 120, 124, 128, 133, 136, 138, 143, 145, and 161 (Fig. 1). As mentioned, resolution decreasesfor the longer fragments. Sites 54-56, 85, 87, 106, 112, 114, 120, 143, and 145 behaved as enhancement sites, whereas the others showed inhibition of cleavage due to drug bmdmg. Cutting at sites from 6 1 to 72 was inhibited by drug binding to the GC’s at 63-64 and 69-70; cuttmg at sites from 98 to 105 was inhibited by drug binding to the GC’s at 101- 102 and 103- 104; sites from 133 to 138 were influenced by the GC drug-binding site at 137- 138; and site 161 was influenced by the GC site at 160-161. Sites 124 and 128 exhibited inhibition, but lessthan thosejust listed. It is believed they point to a weak drug-binding site that is not 5’-GC-3’, but has the sequence 5’-CGTC-3’. Note that the drug-binding sites at 101-102 and 103- 104 are expected to be mutually exclusive: they cannot bind drug simultaneously. However, the sites at 63-64 and 69-70 seem far enough apart to permit simultaneous drug binding at both. There is weak binding to the sequence 5’-GGC-3’. This is shown m the footprinting plots for sites having this sequenceon the 139-mer. Data were used for 19 drug concentrationsfrom 0 to 12.4 pM, so that there were 608 data points, to be used to determine rune nonlinear parameters, These were the seven drug-binding constants, for the six GC sites and the site at 124- 127, the drug binding constant to the caner, and an enhancement constant K,. The values of all the nme parameters were determined by calculating intensities to
33
Quantitative DNA Footprinting
be compared with all 608 measured intensities and minimizing D with respect to the parameters. Since the concentration of carrier DNA (193 @4 in bp) far exceeds the concentration of fragment DNA (estimated to be 0.2 FM m bp), the free-drug concentratton for any total-drug concentration IS mainly determined by the equihbrium for carrier DNA. The free-drug concentrations were used in the drug-fragment DNA equilibrium expressions to calculate fractional occupation of sites and hence inhibition of binding of cleavage agent. To estimate the concentration of strong drug-binding sites on the carrier, it is noted that, in a 114-bp segment of the 139-mer, there are five strong ActD sites (excluding the site at 124-127). Then, if the basesin the (calfthymus) carrier DNA are dtstributed like the bases in the fragment DNA, 193 pA4 bp concentration should provide a strong-site concentration of (5/l 14)( 193) = 8.5 pA4, or--considering the two mutually exclusive sites as a single s&-(4/1 14)( 193) = 6.8 PM If the carrier is considered as a random arrangement of base pairs with a fraction 0.6 being A or T and a fraction 0.4 G or C, the probability of tindmg a G or a C at an arbitrary position is 0.2, and the probabihty of finding a GC with no G to the 3’ side (i.e., not GGC) is (0.8)(0.2)(0.2) = 0.032. Then the concentration of strong actinomycin siteson the carrier is estimatedas (0.032) (193 PM) = 6.2 @4. One can also determine this concentration, c,, using the footprrntmg data, by making c, an additional parameter to be varied m the mmlmizatton of D. It was found that D went through a minimum as a function of c, at c, = 4.7 @4, In this case, c, and K, are not mutually dependent. The footprmting plots for the higher drug concentrations (> 10 PM) suggest there are many additional bmdmg sites on the fragment, with lower binding constants than those considered so far. Such sites must exist on the carrier as well, and be considered in a model to explain footpnntmg data for higher totaldrug concentrations. Their mclusion lowers the free-drug concentration D, for any total-drug concentration, and leads to higher apparent binding constants to fragment sites. Therefore, weak-binding carrier sites were added with total effective concentration c, and average binding constant K, to the model, If c, is the concentration of drug bound to weak sites: Kw = (cw ~&A7
The total drug concentration then satisfies: Dt = Do + cb + c = Do + ccKQO + cwKwDo 1 + K,D,,
1 + K,D,
In these calculations, c, = 5 @4 and first estimated c, from a consideratron of the relative numbers of strong and weak sites on the fragment. Later, c,, K,,
34
Dabrowiak et al.
and K, were determmed along with the other nonhnear parameters by mimmizing D, giving c, near 10 pM The values found for the fragment-binding constants for the strong sites were somewhat lower than those reported by Chen (12) for ActD bmdmg to small oligonucleotide duplexes, measured optically. Phasepartition studies of Winkle and Krugh (13) on polymeric DNAs such as poly dG-poly dG yielded bmdmg constants consistent with those obtained from the footprinting experiments. This suggests that small ohgomers have higher binding constants for this drug than do polymeric DNAs. As noted, the footprintmg data show that ActD binds to the sequence S-CGTC-3’, that does not contam a 5’-GC-3’ site. This is consistent with the report of Snyder et al. (14) that two ActD molecules bmd to the self-complementary duplex d(CGTCGACG)*. The binding is cooperative and the complex exhibits aberrant spectroscopic and calorimetric behavior, suggesting that binding at this site is different from that at sites having 5’-GC-3’. The apparent binding constant reported by Snyder et al. (14) is 1.5 x 107M-‘, about two orders of magnitude higher than this value, perhaps because of the effect of DNA length or to the fact that the spectroscopic/calorimetric experiments measure two events that are cooperative. The analysisdoes not consider drug-induced structural changesin DNA. If drug binding at onesite causesa structuralchange,it could affect cleavagewithin a second drug-binding site,and changethe appearanceof the correspondmgfootprintmg plots, There are, m most of the footprmtmg plots, noticeable at an ActD concentration of -2 rnM, which may be the result of structural changeson the fragment and/or the carrier DNA. For example, it is known that mtercalation of ActD bends the DNA helix (15). This could releasehgand to solution or decreasethe free-hgand concentration by enhancedbinding. The anomalous footprinting plots for sitessuch as 58 and 59 (Fig. 3) may also be the result of alterations m DNA structure.The mitral relative slopesof the plots for 58 and 59 are, respectively, above andbelow what is expected from the simple mass-action mechanism. A DNA-cleaving metalloporphyrm, like DNase I, shows anomalous cleavage rates m this region of the 139-mer in ActD footprinting experiments (4), Since groove width and DNA flexibility are known to affect DNase I cleavage, mtercalation by ActD at nearby sites could affect cleavage in this region A later analysis of footprinting data for this system used data for 26 actinomycin concentrations from 0 to 38.8 rnM, m order to identify the weaker binding sites and derive their binding constants. Since the actmomycin concentrations were large enough to show binding to the weak sites, it was necessary to include weak as well as strong sites in modeling the carrier. This work also allowed for closer consideration of possible structural changes m DNA. The HzndIIIINczI 139-bp restriction fragment from pBR-322 DNA was end-labeled at position 33(A) for one set of experiments and at position
Quan tita We DNA Footprin ting
35
172(G) for a second set (6). In the second set, the labeled fragments produced by cleavage at the higher-numbered sites were shorter, yielding better site resolution for these sites. However, only 10 drug concentrations were used in these experiments: 2.48, 3.40, 4.86, 6.93, 9.89, 14.1, 20.2,28.8,41.0, and 58.7 PM. After rejecting data for sites showing very low or unreliable spot intensities, data were retained for 54 sites for the A-label gel, and 43 sites for the G-label gel. For the A-label experiment, the footprinting plots were similar to those of the G-label experiment: some showed a decrease in cleavage with increased drug concentration, correspondmg to drug bindmg Interfering with cleavage by the enzyme. Those showing the most rapid decreases were associated with the strongest binding sites. Some sites showed an increase in cleavage for low drug concentration, followed by a decrease, explained by nearby weak drug sites not occupied by drug until the drug concentration reached a high value. Other sites showed a rapid increase or enhancement m cleavage with drug concentration, believed to be caused by the mass-action effect, bound drug displacing cleavage agent to sites where no drug 1sbound. A few satesshowed only a slow Increase in cleavage with drug concentration, interpreted as pointing to very weak drug sites for which drug bindmg canceled some of the enhancement effect because of mass action. The weak binding sites found from this qualitative analysis of the footprintmg plots had sequences*GGC (at 76-78), CCG (at 80-82), GGC (at 119-121), CCGT (at 123-126), CCC (at 129-131), GGC (at 143-145), GGC (at 149-151), GCCGG (at 160-164), and other sequencesnear 86 and 112. The strong binding sites were those identified m the previous work: the sequence GC at 63-64. 69-70. 101-102, 103-104, 137-138, and 160-161. The footprinting data from the G-label gel were analyzed using the model of strong and weak drug-binding sites developed from the analysis of the A-label gel. The data from the G-label gel showed more scatter than the data from the A-label gel, as can be seen on comparing the total-cut plots (6). Interestingly, there seems to be a drop-off in the total cut near drug concentration of 20 @4, suggesting that this is a real effect. Because there were fewer data points, fewer rehable values for binding constants were obtained from the G-label gel. The bmding constants are compared to those from the A-label gel in Table 1. It should be noted that site resolution for the A-label gel is highest for smaller site numbers and the reverse for the G-label gel. Therefore, the first few binding constants will be determined more reliably from the A-label gel, and the last few will be determined more reliably from the G-label gel, In general, binding constants from the two analyses agree to within a factor of two (note that the binding constants span two orders of magnitude), except for the TGCT site at 62-65, for which one must take the value from the Alabel gel as the valid one.
Dabrowiak et al.
36
Table 1 ActD-Binding Constants on 139-bp Restriction Fragment, in (@W-1 (6) Posrtion 62-65 68-71 76-79 80-83
100-103 102-l 05 118-1 21 123-1 26 128-1 31 136-1 39 143-1 46 149-152 159-162
Sequence
From A-label gel
TGCT CGCA GGCA CCGT TGCG CGCT CGGC CCGT ACCC TGCT GGCA GGCT TGCC
3 50
048
1 80 0.21 0 18
0 13 0 17
2.50 2.00 0.12
2 20 0.88 003 0.09 048 3 00 020 008 045
0.18 0.94 640 0.25
0 05 042
From G-label gel
The highest bmdmg constant found on the fragment, 6 x 106W1, occurs for the sequence S-TGCT-3’ at sites 136-139. The same sequence occurs at sites 62-65; the binding constant here 1sdetermined to be 4 x 1O6AR’. If, as 1sbelieved,
bmdmg constants can be determmed to better accuracy than 50%, the difference between these two values ts real, implying that basesflankmg the tetramer may change its binding constant. As another example, the binding constant for the 5’-GCGC-3’ sequence at sites 101-l 04 was determmed as 2 x 1O6 M-* in this work, and quantitatrve footprinting studies of ActD bmdmg to the fragment d(TAGCGCTA), returned a value double this The discrepancy may be because of flanking sequences again, or to end effects associated (12) with short pieces of DNA. Another problem 1sthat the values of all drug-binding constants depend to some
extent on how the carrier is modeled. In this work, the carrier was considered to have both strong and weak sites, requrrmg four parameters, two (average) bmding constants and two (effective) concentrations. The concentration of strong sites was fixed at 5 @4, based on earlier work, and the other three parameters were varied. Their values, determined by mmimtzatton of D, were 10 PM, 1.1 x 1O7W*, and 4.7 x 1O5M-i, respectively. Although the average deviation between experimental and calculated intensities approached the estimated experimental error, the deviations in certain footprintmg
plots remained
significant.
Some experimental
plots had shapes
that could not be explamed by the model. For example, mtensities for site 59, Fig. 3, modeled as an enhancement site, are roughly constant for drug concen-
Quan tita We DNA Foo tprin ting
37
trations ~20 pA4,and also constant, but at about double the original value, for concentrations ~30 piH. Other footprmting plots seem to be responding to drug binding, but are not near any site at which drug could reasonably be expected to bind. Also, many footprintmg plots show a small but abrupt decrease in Intensity near 2 PMdrug concentration, followed by an abrupt increase. These effects were considered in a second publication, which attempted to show how one could distmguish between enhancements caused by structural effects and the mass-action effect (II). 3.5. Single-Site Problem: ActD Binding to Dodecamers The analysis for cleavage of small, single-site, oligonucleotides by DNase I IS given here (16). Footprmtmg titration studies were performed on several different self-complementary 16-bp sequencescontaining actmomycm-binding sites. The sequences for a single strand were: GC 1: 5’-CTTTTTTGCAAAAAAG-3’ GC 1AT. S-CATATATGCATATATG-3’
Intensities corresponding to cut fragments of various lengths, as well as the full-length, uncut fragment, were measured for different concentrations of ActD. Several sets of intensities were collected for each olrgomer. Many included intensities for cleavage at all sites from 5 through 16 (uncut ohgomers); for some, lack of resolution made it necessary to combme intensities for several sites. The nucleotide positions on the duplexes are numbered from left to right on the sequences shown above. The concentration of DNase I was -0.1 @4, the concentration of hexadecamers was 0.625 uA4, and the concentration of actinomycin varied from 0 to 31 uLMm some data setsand from 0 to 100 ~IV m others. To correct for loading errors and differences in digest time, the total cut was calculated and fitted to a linear (decreasing) function of drug concentration. Intensities for each drug concentration were then corrected as discussed m Subheading 3.2. From plots of corrected intensities vs drug concentration, it was easy to determine which cleavage sites are blocked by drug. For GCl, intensities for sites 10 through 7 decreased strongly with mcreasing drug concentration, and intensities for sites 11 and 6 less strongly, mdicating the end of the blockage region. This means that the blockage region is less than 8 bp long, with GC (at sites 8 and 9) approximately in the middle, For GC 1AT, inhibition of cleavage by drug was evident for sites 5 through 12, and less evident for site 13. The data for the inhibition sites on GCl were analyzed according to the competitive-binding model, in which each site can be empty, occupied by drug, or occupied by probe (DNase I), and the probability of cleavage (and hence
Dabrowiak et al.
38
spot intensity) is proporttonal to the occupation by probe. For each total-drug concentration D,, one solves the stmultaneous equthbrmm expressions: Cvb
K= (C - CVb
- CVp)
CVP
andKp = (Dt
- CVb)
(C - Cvl,
-
C’.‘p)
(P,
-
Cvp)
to obtam the concentration of probe bound at a site. Here, c is the concentration of sites, nb and nPare the fraction of sites wtth drug and probe bound, respecttvely, and Pt IS the total probe concentration. The amount of fragment produced by cleavage at a site is assumed proportional to n,,.Binding constants for both probe (K,, assumed the same for all sites) and drug (K) are determmed by seeking the values of these parameters, whtch give the best fit of calculated to experimental intensities. Since only mhibttion sites are considered, t-t,,is the same for all sites, so the theoretical curves of spot mtensity vs drug concentration for different sites differ only by a multtphcative constant. It was found that mtenstties for cut fragments did not approach zero when the actinomycm concentration approached zero, mdicatmg that fragments of length less than 16 were present m the origmal DNA To represent this, it was assumed that the intensity of fragment I for total drug concentration D, is* Here A, and B, are constants (different for different sites) to be determined by fitting to experimental intenstttes, B, giving the intensity because of fragments of length i present in the original DNA For analyzing the GCI data, intensities for drug-bmdmg sites 6 through 11 were used. Most data sets mvolve 2 1 drug concentrations, so there are 126 data pomts. In addition to the drug-bindmg constant K and the probe-binding constant Z$,, there are 12 lmear parameters, A, and B, for each sue 1. Values of parameters are chosen to mnumize the sum of the squared deviations of calculated from expertmental mtensittes. For GC 1AT, data for five or six drugbmding sttes were used, since mtensmes for mdivtdual sites could not always be resolved. Most of the data sets include mtensities for 21 drug concentrations. Some representative results are shown m Fig. 4. The determined values of K for GCl (four sets of expertments used) and GCl AT (five setsof experiments) are given m Table 2. Values of tP determined from the GC 1AT experimentsare also gtven. For GC 1, the averageK 1s0.180 pm’ with the root-mean-square deviation from the average 0.082 PM-‘, For GC 1AT, the average K is 0 168 pm’ with the root-mean-square deviation from the average 0.021 pm’. It does not seem that there is a significant difference between the drug-binding constants for GC 1 and GC 1AT. In contrast, actinomytin binding constants for strong sttes on restrictton fragments vary widely, dependmg on the sttes netghbormg the GC
Quantitative DNA Footpnnting 4ooa
El
3000
i! t: JY zooc !a
150
ui
100
u” 1000 ii
SO
L1
0
in
[Actinomycin]
pM
[Actmomycm]
m WM
Fig 4. Footprintmg plots for several cleavage sttes on the hexadecamer GC 1, 5’-CTTTTTTGCAAAAAAG-3’, with a single bmdmg site for ActD. Table 2 Binding Constant to Oligonucleotide
K for ActD Binding Duplexes in @Pi (16)
Deternnnatton
GCl
A B C D E
0317 0.112 0 119 0 173
GCIAT 0 207 0 1.51 0 152 0 156 0.176
3.6. Measurement of Triple-Helix Dissociation Constant using a Type IIS Restriction Enzyme as Probe The footprinting method has been used to determme the dtssociatton constant of a triple heltx, formed by interaction of the ohgonucleottde dT,, and the 272%bp plasmid pA20 shown below (17). The plasmid was constructed to contain a target sequence for dT2a as well as three cleavage sites for the type IIS restriction enzyme Eco571, at bp 429, 1375, and 2423, the first lying wtthm the dTZOtarget sequence. Cleavage and end-labeling of the plasmid at the Me1 site (position 183) produced the doubly end-labeled lmeartzed plasmtd shown below. (The binding region for dT,, is shown by x’s) Eco571 183
429
Eco571 1375
Eco571 2423
NdeI 2728
xxxxxxx
Limited (single-hit) digests of linear pA20 with Eco571 could produce seven possible labeled fragments; m fact, they produced mostly fragments of lengths
Dabrowiak et al.
40
2728 (uncut plasmid), 488 (band l), and 246 (band 2) bp. Bands 1 and 2 are the result of Eco571 cleavage at positions 2423 and 429, respectively. Because site 429 lies within the target region for dT,, and site 2423 does not, the presence of dTZo decreases the intensity of band 2 whereas that of band 1 is unchanged. Band 1 was used as an internal standard to correct for lane-to-lane variances. Since the concentrations of dTZO for which intensities of band 2 changed markedly ranged from 0.065 to 1.OuMand the concentration of PA,,, was only 0.3 nA4,the free-ligand concentration could be assumed equal to the total hgand concentration for [dT,,] > 0.065 PM. This also held for lower concentrations, for which there was no appreciable bmdmg of dT,, to the duplex. It was also shown that one could neglect binding of lrgand to Lambda DNA, which contams 40 Eco571 sites and was added to the reactions as a carrier, buffering the endonuclease Eco571 Intensities of bands 1 and 2 were measured for fourteen values of [dT,,]: 0 and 13 concentrations from 0.001 to 4.16 PM. After subtracting background (intensities m the absence of enzyme), the intensity for band 2 for each [dT2e] was divided by the corresponding intensity for band 1 to produce the experimental points plotted m Figure 5. These were used to find the dissociation equilibrium constant Kd, where:
Kd= ([TWPIY[-U Here, D refers to duplex, T refers to triplex (i.e., duplex with dTZObound), and [TFO] is the concentration of free dT,, (TFO = triple-helix-forming oligonucleotide). If only duplex, and not triplex, can be cleaved by Eco571, the intensity of band 2 (I), divided by the intensity in the absence of drug (IO), should be equal to the fraction of duplexes with no dTZObound. Therefore: r=
[Dl
1’
[D] + [T]
=
Kd & + [TFO]
As indicated above, the concentration of free dTZOwas considered to be equal to the total concentration of dT2,. The assumption that I/I0 IS equal to the fraction of duplexes with no dTZO bound is valid when the binding constant of dT,a to the duplex is much larger than the binding constant of Eco571 to its sites on the duplex. Then bound ltgand always displaces probe. To show that this 1sthe case m these measurements, the mtensitres of bands 1 and 2 were measured for 15 concentrations of Eco571, in the absence of dT2e and in the presence of 0.076 pMdT,a. For band I, intensities were not changed by the dT,,; for band 2, dTZOreduced mtensmes by the same factor for all Eco571 concentrations, as should be the case tf bound ligand always displaces probe.
Quan tita We DNA Foo tpnn ting
41
h
x2.5 ii Tj2.0
Fig. 5. Intensity of band 2 as a function of concentration of triple-helix oligomer (Z 7)
forming
To find Kd, the 14 intensities were fitted to I = IO&/(& + [TFO]) by seeking the values of the parameters I0 and Kd, which minimized the sum of the squares of the deviations between calculated and measured values of I (a simplex search was used). The results were. I0 = 2.21~0.17andKd=0.172f0009@4(errors are standard deviattons). The fitted intensities are given by the curve in Fig 5. The sum of the squares of the deviations was 0.152. The value of Kd 1s consistent with values measured for similar triplexes, using quantitative affimty cleavage and DNase I footprmtmg (28). Since type IIS restriction enzymes like Eco571 cleave DNA with little sequence specificity, they should be useful probes for measuring other DNA-hgand interactions. The ease with which an internal standard 1s included (cleavage at nonligandbinding sites) and the simplicity with which the data may be mterpreted and analyzed constitute two reasons for further experimentation with these probes. Acknowledgment The authors wish to thank J. B. Chalres and Julio Herrera for kindly providing the footprinting data for the oligonucleotlde duplexes. References 1. Dabrowiak, J. C., Stankus,A. A., andGoodisman,J. (1992) Sequencespecificity of drug-DNA interactlons m “Nucleic acid targeted drug design” (Propst, C. L. and Perun, T. J., eds.), Marcel Dekker, New York, pp 93-149.
42
Dabrowiak et al.
2 Shubsda, M., Klshlkawa, H.. Goodisman, J , and Dabrowtak, J C (1994) Quantitative footprmtmg analysis J A401 Recogn 7, 133-139 3 Dabrowlak, J. C and Goodlsman, J (1989) Quantltatlve footprmtmg analysis of drug-DNA mteractlons m Chemistry and Physzcs of DNA-Lzgand Interactzons
(Kallenbach, N. P., ed ), Adenme, Gullderland, NY, pp 143-174 4 Rehfuss, R., Goodlsman, J,, and Dabrowlak, J C (1990) Quantitative footprmtmg analysis of the actmomycm D-DNA mteractlon, m Molecular Baszs of Speczjkzty zn Nuclezc Aczd-Drug Interactions (Pullman, B and Jortner, J., eds.), Kluwer Academic, Netherlands, pp 157-I 66 5 Ward, B , Rehfuss, R , Goodlsman, J , and Dabrowlak, J C (1988) Rate enhancements m the DNase I footprmting experiment. Nucleic Aczds Res 16, 135%1369 6 Goodlsman, J., Rehfuss, R., Ward, B , and Dabrowlak, J C (1992) Site specific bmdmg constants for actmomycm D on DNA determined from footprmtmg studles Blochemlstry 31, 1046-1058 7. Sambrook, J , Fntsch, E F , and Mamatls, T (1989) Molecular Clonmg, A Laboratory Manual, 2nd ed , Cold Sprmg Harbor Laboratory, Cold Sprmg Harbor, NY 8. Ward, B and Dabrowlak, J C (1988) Stablhty of DNase I m footprmtmg expenments Nucleic Aczds Res 16, 8724 9 Gale, E F., Cundhffe, E , Reynolds, P. E , Richmond, M H , and Warmg, M J (198 1) The molecular basis of antlblotlc action Wiley, London 10 Suck, D , Lahm, A., and Oefner, C. (1988) Structure refined to 2A of a mcked DNA octanucleotlde complex with DNase I Nature 332,465-468. 11. Goodlsman, J and Dabrowlak, J C. (1992) Structural changes and enhancements in DNase I footprintmg experiments. Bzochemzstry 31, 1058-1064. 12. Chen, F -M. (1992) Bmdmg specificities of actmomycm D to non-self-complementary XGCY-tetranucleotlde sequences. Biochemistry 31, 6223-6228 13 Winkle, S A. and Krugh, T R (1981) Equlhbrlum bmdmg of carcmogen and antitumor antiblotlcs to DNA site selectivity, cooperativlty, allosterlsm Nucleic Aczds Res. 9,375-3 186. 14 Snyder, J. G , Hartman, N G , D’Estantolt, B L , Kennard, 0 , Remeta, D P , and Breslauer, K. J (1989), Binding of actinomycin D to DNA evidence for a nonclassical high-affinity bmdmg mode that does not require GpC sites Proc Nat1 Acad. Scl USA 86,3968-3972 15 Kamitori, S. and Takusagawa, F (1992) Crystal structure of the 2.1 complex between d(GAAGCTTC) and the anticancer drug actmomycm D J A401 Bzol 225,445-456. 16 Herrera, J E (1993) Ph. D Dlssertatlon, University of Mississippi. 17 Ward, B. (1996) Type IIS restriction enzyme footprmtmg I. Measurement
a triple helix dlssoclatlon
constant with Eco57I at 25’C
of Nucleic Acids Res
24,2435-2440 18 Best, G C and Dervan, P. B (1995) Energetlcs of formation
of sixteen triple helical complexes which vary at a single position within a pyrlmldme motif J Am Chem Sac 117, 1187-l 193
Uranyl Photoprobing of DNA Structures and Drug-DNA Complexes Niels Erik Mdlegaard
and Peter E. Nielsen
1. Introduction The uranyl(IV) ion (UOZ2’) binds strongly to the phosphates of DNA and, upon irradiation with long wavelength ultraviolet light, the proximal deoxyriboses are oxidized by the photochemically excited state of the many1 ion, a very strong oxidant (1). Thus the uranyl ion is an efficient DNA photocleavage reagent (2,3) that has been used to study the sequence specific interaction with the phosphates of the DNA backbone of the respective DNA recogmtion sites of various proteins, such as the h-repressor/OR1 complex (3), RNA polymerasedeoP 1 promoter of Escherzchza coli (4), RNA polymerase/cyclic AMP receptor protein (CRP)-deoP2 promoter of E coli (S), CRP/CytR repressor-deoP2 promoter of E. colz (5), and transcription factor IIIAIXenopus 5s internal control region (6). It was also found that the sequence-dependent modulation of the uranylmediated DNA photocleavage is specifically influenced by the pH of the medium (7,s). Whereas the cleavage pattern is rather uniform at neutral pH, a strong modulation was observed at slightly acidic pH (pH 16.5), and this modulation reflects the conformation of the DNA helix since regions of narrowed minor groove--such as (A/T),, tracts-are cleaved several fold more efficiently than regions of widened minor groove (G/C-rich regions) (7,9). Consequently, the uranyl ion can also be exploited for DNA conformational analyses (7-9). Furthermore, metal ion binding sites, e.g., as found in the folded X-structure of the four-way Holliday DNA recombination junction (10) and in yeast tRNAPhe (II), have been probed by uranyl mediated photocleavage. The mechanism of uranyl cleavage is not yet fully understood, but it has been shown that uranyl bmds to the phosphates and oxidizes the proximal deoxyFrom
Methods m Molecular Bfology, Vol 90 Drug-DNA lnteractron Edlted by K R Fox Humana Press Inc , Totowa, NJ
43
Protocols
M&legaard and Nielsen
44
rlboses thereby generating 3’- and S-phosphate termmi m the DNA and hberatmg free nucleobases (2) This chapter describes how uranyl photoprobmg can be used to study the binding of small drugs, exemplified by dlstamycm, to DNA as well as to analyze DNA conformatlon and thus the connection, if any, between drug binding sites and DNA helix conformation. 2. Materials 1 Uranyl mtrate (U02[N0&) 100 mM stock solution m water, which has been shown to be stable for several years at room temperature. Restriction fragments 32P-end labeled at either the 3’ or the 5’ end by standard
techniques(12) When deciding which position to label, it IS important to note
4 5 6 7 8. 9 10 II 12 13
that the best resolution of the uranyl photocleavage pattern IS obtained m the first 70 bp from the labeling, because of some “fuzzyness” of the uranyl cleavage bands Buffer for drug footprmtmg* 0.5 M Tris-HCl, pH 7 2, and for uranyl probing of DNA structure. 0.5 M NaAc, pH 6 2 (see Note 1) 0.5 M NaAc, pH 4 5 Ethanol 96% Ethanol 70% Calf thymus DNA, 2 mg/mL Gel loading buffer 80% formamide m 1X TBE buffer, 0.05% bromphenol blue, and 0 05% xylene cyan01 1X TBE: 90 mM Tns-borate, 1 rnM EDTA, pH 8 3 Polyacrylamide gel* 8-lo%, 0 3% brs-acrylamlde, 7 Murea, 1X TBE buffer, Dlstamycm (or other drug). 1 mM stock solution (see Note 3) X-ray film Phillips TL 4OW/O3 fluorescent light tube.
3. Methods 3.1. Many/ Photoprobing 1. Approximately 10,000 cpm/sample of the radioactive labeled fragment IS mixed with the drug m mlcrofuge tubes m 50 mMTns-HCl, pH 7 2 (for the footprmtmg experiment), or m 50 mM NaAc, pH 6.2 (for the DNA structure analysis). Calf thymus DNA is added (0 5 pg/sample) The drug concentration should be varied from 1 to 30 pM to optimize protection A final sample volume of 100 pL IS recommended. The samples are equilibrated for 15 mm at room temperature prior of uranyl (see Note 1). 2. The 100 mMuranyl nitrate stock solution is diluted to 10 mM in water, and 10 yL IS added to the sample to obtam a final uranyl concentration of 1 mM
3 Irradiate the samplesfor 30 mm at 420 nm by placing the open tubes directly under the fluorescent light tube at a distance of approx 1 cm (see Note 2). 4. Add 20 pL of 0.5 M NaAc, pH 4 5, to prevent copreclpltatlon of the uranyl salts, which will interfere with the gelanalysis. Add 300 pL of 96% ethanol and place the tubes m dry ice for 15 mm and subsequently centrifuge for 15 mm at 20,OOOg
Uranyl Photoprobmg
45
5. 6. 7. 8
The pellets are washed with 70% ethanol and dried zn vacua (speedvac). Add 5-10 pL 80% gel loadmg buffer. Heat the sample to 90°C for 2 mm and subsequently place the tubes on ice Half of the samples are loaded on a polyacrylamide sequencing gel and run together with an A + G sequence ladder at appropriate voltage The remaining halves are saved at -20°C for further gel analysis if needed. 9 The bands are vlsuahzed by autoradlography using amplifymg screen 10. The results can be quantified by scanning of the autoradiograph, or using a phosphoimager.
3.2. Example An example is shown here of a dlstamycin footprint using uranyl photocleavage at pH 7.2 (which gives the most uniform DNA cleavage), and a probing of the narrow minor groove by uranyl photocleavage at pH 6.2. We have focused on the tyrT promoter, which hasbeen subject for several footprint studiesusmg different probes, including DNAseI and FeIEDTA (e.g., refs. 13 and 14). This makes a direct comparisonbetweenthe uranyl cleavagemethodandthe other methodspossible. The results of a uranyl photofootprinting experiment are presented m Fig. 1 (autoradiogram) and Fig. 2 (densitometry scannings of the autoradlogram). It is clearly seen that regions of protection (bars in Fig. 1) appear on both strands
as the concentration of distamycin 1s increased. Furthermore, it is observed that the regions of protection are shifted 2-3 bases to the 3’ side when comparing the two DNA strands (Fig. 3). This is typical of protection and thus bmding-as would be expected for dlstamycin binding-in the minor groove of the DNA helix. Finally, a comparison of the distamycin footprints with the uranyl photocleavage pattern at low pH (Fig. lA, lane 8, and Fig. lB, lane 7) reveals that the major regions of cleavage hypersensitivity coincide with dlstamycinbindmg sites (Fig. 3). This observation is fully consistent with the contention that both dlstamycin binding (15,16) and uranyl hypersensitivity (7,9) are functions of a narrowed minor groove of the DNA helix, which 1sparticularly pronounced at A/T-tracts. A comparison of the Fe/EDTA (hydroxyl radical) footprintmg results prevlously reported for dlstamycm and the tyrT promoter fragment (13) (Fig. 3) reveals that the uranyl photofootprmts reported here are more narrow than the Fe/EDTA footprints, In particular, it 1snoted that two binding sites are resolved around position 90, whereas only one combined site was detected with Fe/EDTA. Similarly, protein uranyl photofootprints are also more narrow than those obtained with Fe/EDTA (3,4). Thus, as previously noted (3,4), the mformatlon obtained from uranyl photoprobmg m spite of the similarity of the footprints complements that of Fe/EDTA footprint, since the former reflects the accessiblhty of the backbone phosphates as well as the electrostatic potential, whereas the latter reflects the accessibility of the deoxyriboses of the backbone.
3’4abeled A/G1234
S-labeled 56
78
60
50
40
30
Fig. 1. Uranyl photofootprint of distamycin binding and probing of minor groove width in the &rT promoter. Both strandsof the 160 bp EcoRI-AvaI 32P-labeledfragment, including the tyrT promoter regions, were incubated with varying concentrations of distamycin before uranyl photocleavage.The fragment labeled at the 3’-end (A): A/G: A+G sequenceladder. Lane 1, no distamycin; lane 2,0.5 ClM;lane 3, 1 @, lane 4,2 pM, lane 5,4 CUM; lane 6,8 cuz/I;and lane 7, 16 pA4distamycin.Lane 8, uranyl cleavagein NaAc pH 6.2. The fragment labeledat the 5’ end (B): A/G: A+G sequence ladder. Lane 1, no distamycin; lane 2, 1 pA4distamycin; lane 3, 2 ClM;lane 4,4 w, lane 5, 8 PA& lane 6, 16 pM distamycin. Lane 7, uranyl cleavagein 50 pM NaAc pH 6.2. The sampleswere run on a 8% polyacrylamide gel and subjectedto autoradiography. Regions of distamycin binding are shown by black bars.
Q’dabeled Control
Dlstamycm
pH62
Fig 2 Densitometric scans of the autoradiographs Lanes 1 (no distamycin) and lanes with the highest distamycin concentration (7 and 6) of the autoradlographs were scanned. In addition the lanes of DNA structure probing were scanned (lane 8 and 7) The numbers refer to the sequence of Fig. 3
4. Notes 1. The buffer for uranyl photocleavage is a very important parameter, because the sequence specificity change at different pH. Uranyl Itself is acidic, so the final pH should be checked if a certain pH IS important for the drug-binding capacity.
Mdlegaarci and Nielsen
48
TVT 0 Cl 0 q40ACGCA?mAGT+~AT-Tlffmc~~cG I GGCCAATGGAXYM'AGGCACCTAC CCGGTT*CCTTTAAT26)CG~cGG2&AAA
I
~TGCGTTGGT&AGT~AGW‘EAG
0 0 70 O100 TTTACAGC~~GGTCA~AT~A~CGCCCCGCT ~~GTCGCCGCCAGT~CTACGCGGGGCGCGGGGCG~GGGCTA~CCCTCGTCC~TCA0
0
I
: Distamyciduranyl
n -
q
: Uranyl hypersensitivity :Distamycitiydroxyl radical
Fig. 3 Dtstamycm protectton and many1 hypersensttrvtty displayed on a sequence The distamycm protected nucleotides are displayed as black boxes and uranyl hypersensmvity as open boxes Dtstamycm protection accordmg to the Fe/EDTA method (13) is shown by lines; broken lines indicate weak protection. For footprmtmg, a pH range of 7.0-7 2 1s appropriate, and for analysts of DNA structure, a pH range of 6.@-6 5 should be chosen. Furthermore, uranyl photocleavage IS most efficient m acetate, HEPES or PIPES buffers, lesser m Tns-HCl, and absent m phosphate buffers Finally, the photocleavage is not sensttive to temperatures 2 Any light source emittmg 300-420 nm can be used, and the Phillips TL 40 W/O3 tube (h max -420 nm) IS recommended, when reaction times of 20-60 mm are convenient However, if even shorter irradration times are required, the uranyl cleavage reaction can be performed with a Xenon lamp or a laser at appropriate wavelength The sample may be placed m a thermostated bath if required 3 Apart from distamycm, we have prevtously used uranyl photofootprintmg to study the bmdmg of the drug mttramycm, which m a complex with Mg*+ binds as a dimer m the minor groove of GC regions (17) In contrast, we have not been able to obtain footprmts wrth echmomycm. Thus uranyl photofootprmtmg may be limited to drugs that interact strongly and electrostatically with the DNA backbone.
References 1 Burrows, H. D. and Kemp, T. J (1974) The photochemtstry of the uranyl ton. Chem Sot Rev 3, 138-165 2 Nielsen, P E., Htort, C , Buchardt, 0 , Dahl, O., Sonmchsen, S. H., and Nordtn, B (1992) DNA Bmdmg and Photocleavage by Uranyl(V1) (UO,*‘) Salts J Amer Chem. Sot 114,4967-4975
Uranyl Photoprobrng
49
3 Nielsen, P. E., Jeppesen, C., and Buchardt, 0. (1988) Uranyl salts as photochemical agents for cleavage of DNA and probing of protein-DNA contacts. FEBSLett 235, 122-124 4 Jeppesen, C. and Nielsen, P (1989) Uranyl mediated photofootprmtmg reveals strong E cob RNA polymerase-DNA backbone contacts in the +lO region of the deoP1 promoter open complex. Nucleic Acids Res 17,49474956 5. Mollegard, N. E , Rasmussen, P B, Valentm-Hansen, P , and Nielsen, P E (1993) Charactertzatton of promoter recognition complexes formed by CRP CytR for repression and by CRP and RNA polymerase for acttvatton of transcriptton on the E. co11deoP2 promoter J &al Chem 268, 17,47 l-l 7,477 6 Nielsen, P E. and Jeppesen, C. (1990) Photochemtcal probing of DNA complexes. Trends Photochem Photoblol 1,39-47 7 Nielsen, P. E., Mollegaard, N E.. and Jeppesen, C. (1990) DNA conformational analysis in solutton by uranyl mediated photocleavage Nucleic Acids Res 18, 3847-385 1 8 Mollegaard, N E (1992) Uranyl photoprobmg of DNA structures and protein DNA mteracttons, Thesis 9 Sonnichsen, S H. and Nielsen, P E (1996) .I MO! Recognztion 9,219-227 10. Mollegaard N E , Murchte, A. I., Lllley, D M , and Nielsen, P. E (1994) Uranyl photoprobmg of a four-way DNA Junction. Evidence for spectfic metal ton bmdmg EA4BO J 13, 1508-1513 11 Nielsen, P. E and Mollegaard, N E (1996) J Mel Recognztzon 9,228-232 12 Sambrook, J , Fritsch, E. F., and Maniatls, T (1982) Molecular Clonuzg* A Laboratory Manual Cold Spring Harbor Laboratory, Cold Sprmg Harbor, NY 13 Portugal, J and Waring, M J. (1987) Eur J Bzochem. 167,28 l-289 14 Portugal, J. and Waring M J. (1987). Hydroxyl radical footprmting of the sequence-selective binding of netropsin and distamycin FEBS Lett. 225, 195-200. 15. Coll, M , Frederick, C A , Wang, A H., and Rich, A (1987) Proc Natl Acad Scl USA 84,8385-8389 16. Wood, A. A., Nunn, C. M., Boykm, D. W., and Needle, S. (1995) Nucleic Acids Res 23,3678-3684. 17 Nielsen, P E , Cons, B M G , Fox, K. R , and Sommer, V B (1990) Uranyl photofootprmtmg DNA structural changes upon bmdmg of mtthramycm, m Molecular Basis ofSpec&c@ in Nuclex Acid Drug Interactions, vol. 23 (Pullman, B and Jortner, J , eds ), The Jerusalem Symposmm on Quantum Chemistry and Btochemtstry, Dordrecht, pp. 423-432
4 Diethylpyrocarbonate and Osmium Tetroxide as Probes for Drug-Induced Changes in DNA Conformation In Vitro Christian
Bailly and Michael J. Waring
1. Introduction Chemical probmg of nucleic acids is a powerful and versatile approach to the detection and analysis of the structural and functional complexity of nucleic acids (I). Secondary structures of native DNA and RNA as well as ligandinduced changes in conformation can be probed by the use of a variety of chemical reagents, either in vitro with purified nucleic acids m a reconstituted acellular environment, or directly withm the framework of a cell Over the last 10 yr, new advances m technology and new chemical probes have been developed that allow for sensitive, high-resolution detection of variations m DNA and RNA secondary structures. Another aspect of chemical probing experiments concerns their application to investigate the effect of chemotherapeutic drugs on nucleic acid structures. A number of antitumor and antiviral drugs owe their efficacy to their capacity to interact with DNA and subsequently inhibit DNA replication, transcription, and other key steps in the proliferation of the cancer cell or of a virus. Therefore, it is of great importance to understand the mechanism by which drugs interact with DNA and whether or not (and how) these drugs distort the DNA double helix upon binding to it. Although many sophtsticated spectroscopic techniques such as NMR and X-ray crystallography have provided a large body of information about drug-induced structural changes in DNA, these techniques are limited with respect to the size of the DNA molecule that can be studied and have therefore been restricted to experiments employing short ohgonucleotides. In addition, it is sometimes necessary to use very high concentrations of both the DNA and the ligand or even to add chemicals in order to stabilize the dmg-DNA complex (e.g., dehydrating agents used From
Methods m Molecular Btology, Vol 90 Drug-DNA Interact/on Edlted by K R Fox Humana Press Inc , Totowa, NJ
51
Protocols
Bail/y and Waring
52
Table 1 Use of DEPC to Detect Unusual DNA Structures DNA sequence/structure
Refs
Polypurme polypyrlmldme sequences H-DNA, triple hehces, and duplex-triplex Junctions Parallel-stranded DNA Methylated DNA Curved DNA sequences Left-handed Z DNA and B-Z Junctions Smgle-stranded regions Cruciform and hairpin structures Protein-DNA interactions Branched DNA Drug-DNA interactions
10,16,34-41 42-58 59,60 61 10,20,62,63 51,54,64-73 43,74 75-77 74,78,79 8&83 see Table 3
for X-ray crystallography). The use of chemical probes does not suffer from such constraints so that both short and long DNA molecules can be probed under a variety of condltlons m vitro and m vlvo. Chemical probmg expenments are Ideally sulted to detect both local and propagated conforrnatlonal changes in DNA down to the atomic level A large variety of probes exist with diverse chemical and/or sterlc sensltivIty to analyze the structure of DNA and ligand-DNA interactions. This chapter
is not intended as a compilation of those different probes since comprehensive reviews on the subject have been published
previously
(2-5)
Rather we focus
on two specific probes, dlethylpyrocarbonate (ethoxyformic anhydride or dlethyloxydiformate,
usually
referred
to as DEPC)
and osmium
tetroxlde
(OsOJ, which are, together with potassium permanganate (KMnO,), the most frequently used chemical reagents for detecting particular DNA structures (Tables 1 and 2). Probes such as DEPC and Os04 have long been employed for characterizing
the structural
perturbations
of DNA induced by drug bmdmg,
particularly intercalating drugs (Table 3). In thrs chapter, the prmctpal features of the chemical
properties
of DEPC and Os04 will be rehearsed, the current
technical protocol from the authors’ laboratory described, together with recent examples that illustrate DNA recognition.
the appllcatlons
of these reagents m the study of drug-
1.1. Reactivity of Diethyipyrocarbonate and Osmium Tetroxide with DNA: Chemical and Structural Aspects DEPC and Os04 modify DNA in very different ways, reacting with purmes and pynmldines, respectively (Fig. 1). DEPC (6), which was mltlally mtro-
Drug-Induced Table 2 Use of 0~0,
Changes in DNA Conformation to Detect Unusual
53
DNA Structures
DNA sequence/structure
Refs
84
DNA sequencing Polypurme * polypyrtmtdme sequences H-DNA, triple hehces, and duplex-triplex junctions Parallel-stranded DNA Left-handed Z DNA and B-Z junctions Smgle-base-pan- mismatches Single-stranded regions Cructform and hatrpm structures Three-, four-way DNA junction Drug-DNA interactions
16,35-38,4&41,85,86
36,42-44,4?,5&52,54-58, 87-89 59,60 51,54,64,68,72,73,90-99 13,64,100,101 98 15,68,94,99,102-107 8&83,108-110
see Table 3
Table 3 Use of DEPC and Os04 to Study Drug-DNA
Interactions Refs
Drug Echmomycm TANDEM Actmomycin Mithramycm Ethrdium Acridine derivatives Bleomycm Nogalamycm Ellipttcine Lucanthone, hycanthone Tilorone Benzopyridomdole cu-Platinum Porphyrm
oso, 67,111,112
116,126,127
132 30 18 133,134
DEPC 32,67,112-121 122,123 124,125 121 114,116 116 128,129 130 131 132 30 18 133 135
duced as a reagent for modifying histidme and tyrosme residues m proteins (7,8), reacts strongly with the N-7 atom of purmes (9). The carbethoxylation reaction of A and G leads to the mtroductron of a posmve charge at the N-7 positron, which perturbs the electron resonance of the purine ring. The alkylated purine nucleus is unstable, which causes opening of the lmidazole rmg between atoms N-7 and C-8, thereby creatmg an alkali-labile adduct (Fig. 2).
Bail/y and Waring
54
NH,OH
NHz Fig. 1 Structure of the bases and sites of reactivity of chemical probes
At neutral pH, DEPC reacts much more strongly with adenosme residues compared to guanosmes. At acidtc pH, the reactlvlty of G IS increased. When the exocychc N6 ammo group of adenme IS accessible, tt forms a reactive posttron for DEPC as well. This chemical has proved useful as a probe sensitive to variation in DNA structure and has been applied successfully to detect Z-DNA, H-DNA, crucrform loops, and many other non-B DNA structures (Table 1). The reactton mechamsm by whtch DEPC attacks purmes IS not known with certainty, but models have suggested a form of proton catalysts. Hydrogen bond-donating ammo groups of DNA have the potential to acid-catalyze DEPC reaction at the N-7 position of purmes. The frequently observed higher reactlvlty of adenines compared to guanines might depend on the ability of the exocychc N6 amino group of adenme to rotate so as to attam the optimum geometry for promotmg hydrolysis of DEPC (20) 0~0, reacts with a sharp base specificity in the major groove of the double helix.
Although
0~0,
alone can attack
DNA
effrclently,
It 1s very often
premixed with a tertiary amme that accelerates the rate of formatton of base adducts. Pyrtdine, whtch mcreases the reaction of osmtum tetroxide with thymidmes by about lOO-fold, IS most commonly used, but other ammes have been employed suchasbrpyndine, phenanthrolme and tetramethylethylenedlamine
Drug-Induced DEPC 0
*c-o
55
Changes m DNA Conformatlon ,C&
,W%
O$>-”
NH>
,&eNH2 NeN
fc,WW20
\
majorgroove A H
Os04
\
2(C5HsN)
/
m/norgtwve Fig. 2 Reactlon of diethylpyrocarbonate and osmmm tetroxlde with an A * T base pair. Broken lines represent the hydrogen bonds between the palred bases Base adducts formed by reactlon of DEPC with adenine and of the 1.2 OsO,-pyrtdme complex with thymine are boxed. The major and minor grooves of the hehx are indicated
(TEMED) (II). The reaction requn-es much higher molar concentrations of pyrldine than of osmmm tetroxide. It IS plausible that, at least m the first stage of reaction, pyridine acts as a part of the solvent and may cause sequencedependent structural changes facllitatmg the subsequent formation of thymmeosmium adducts. The 2: 1 pyndine-Os04 complex attacks the 5-6 double bond of pyrlmldines to form a cyclic ester (12) (Fig. 2). The reactlon occurs prmcipally at thymme residues; only rarely at cytosmes. Osmium tetroxlde is known to react with cytosine basesat about one-fortieth the rate of reactlon with thymine (13). Parenthetically, it has recently been reported that 0~0, can be used for G-specific chemical sequencing of DNA. Treatment of native B-DNA with Os04 in the absence of pyrldine Induces cleavage predommantly and evenly at G residues, especially if the reaction ts conducted m the presence of CaC12to eliminate background T reactivity (14). In the B-DNA double hehx, the target C5-C6 double bond of thymme ts located in the major groove, where it is not easily accessible to the bulky electrophlhc osmmm probe (Fig. 2). Like DEPC, Os04 represents a useful tool to
56
Bail/y and Waring
sensevariations in DNA structure (Table 2). Os04 and DEPC share the property of reacting with the side of the basesthat is not involved m Watson-Crick hydrogen bondmg (Fig. 2). Indeed, the Os04-reactive C5-C6 double bond of thymme lies completely on the opposite side of the pyrimldme rmg from the substltuents that hydrogen bond to ademne. LIkewise, the N7 posltion of guanine that 1scarbethoxylated by DEPC lies on the opposite side of the purine ring from the hydrogen bonding to cytosme.Therefore, Os04 and DEPC reactions can proceed even if the base palrmg 1smaintained. In other words, these two reagents do not represent probes of base-pair dIsruptIon. However, adduct formation does require out-of-plane attack by the electrophlle and thus may be subject to sterlc hindrance by stacking of neighboring basepairs (explammg the poor reactlvity toward B-DNA) Os04 and DEPC are really probes of base stacking. The reason why the osmium probe cannot react, or can only react very weakly, with the C5-C6 double bond of thymme m the native B-form double helix 1sessentially stencal. The bulky Os04-pyndme complex, which must be added czsto the thymme rmg (12), would collide with the helix backbone and/ or the m-plane methyl group attached to the C5 posltlon. When the DNA structure 1s locally unwound, as 1sthe case m the presence of a DNA-intercalating drug, the C5-C6 double bond target becomes more readily accessible to the probe and the thymme-osmate-pyndme ester can thus be formed. Both expenmental and recent molecular mechamcs studies have shown that the addition of the osmmm-pyndine to the thymme restdues m DNA causes relatively mmor global structural changes m DNA conformation (15-17). As a result, the reactivity of both DEPC and OsO,,toward DNA, m common with most other chemical probes, depends partly on the primary nucleotlde sequence as well as to a considerable extent on the local conformation, thus allowing both structural and sequence mapping. The structural sensitivity as opposed to the chemical reactivity explains why DEPC and Os04 are frequently used for investigating all sorts of unusual DNA structures (Tables 1 and 2) The reactlvlty toward a chemical probe can also be affected by the charged environment of the molecule. The electrostatic contribution to the reactivity of DEPC and Os04 with DNA 1srelatively weak becauseboth probes are uncharged, but m other cases, such as that of KMn04, the electrostatic influence can be significant. Although Os04 and KMnO, generally exhibit comparable chemical reactivity, it has been observed that these two T-specific probes can sense drug-Induced changes in DNA conformation quite differently, probably as a result of their different electrical charge (18). A slgmficant advantage of the chemical probing experiment with reagents such as DEPC and Os04 compared to footprmting experiments is that the former yields positive results, whereas the latter IS essentially a negative technique. Footprmting experiments with DNAase I or hydroxyl radicals requn-e
Drug-Induced
Changes in DNA Conformat/on
57
the vast majority of the DNA molecules to have the test ligand bound at specific sites m order to detect a footprint, i.e., an absence of bands. By contrast, experiments with DEPC and 0~0~ detect the appearance of a posltlve signal corresponding to increased reactivity and consequent cleavage at specific sites. This peculiarity renders the signal detectlon much more sensitive, allowing accurate analysis of structural changes even if only a small proportion of the DNA molecules are affected. 7.2. Experimental Procedures The techniques for analyzing drug-induced DNA structural changes in vitro by chemical probing with DEPC and 0~0~ are stralghtforward and convenient. Briefly, the DNA (radloactlvely labeled at its 3’ or 5’ end) or drug-DNA complex is exposed to limited reaction with the chemical probe so that less than one chemical modification per DNA molecule can occur. The modified DNA molecules are then cleaved, and the resulting polynucleotides resolved as a ladder of bands on a denaturing polyacrylamlde gel. Llmltmg the extent of reaction to less than one cut per whole DNA molecule has the effect of lmposmg “single-hit” kinetic condmons so that the probe reactlvlty toward sites all along the sequence can be examined at a comparable level of sensitivity. The sites of attack by the probes, i.e., the distorted sites m the double helix, are located to nucleotlde resolution The followmg section describes the 0~0~ and DEPC chemical probing procedures m current use m the authors’ laboratory. These two fairly explicit protocols have been regularly and successfully used over many years. They have always yielded highly reproducible results. However, protocols are evolving and the reader can be referred for alternative procedures to the methods sections of articles cited m Tables 1 and 2. A variety of adaptations can be applied to the same purpose, each with its own merits. 2. Materials 2.7. Reagents Both DEPC and 0~0~ are commercially available and no special punfication is required. The DEPC reagent (97% solution purchased from any of several commercial suppliers, e.g., Sigma or Aldrich) 1s stored at 4°C and it IS recommended that it be renewed from time to time (at least once a year). Osmnun tetroxide is very toxic (strongly irritating) and unstable. It 1simportant to stress the fact that both DEPC and 0~0, are dangerous chemicals (DEPC IS considered to be carcinogenic) and must therefore be handled with care. All reactions involving the direct use of either DEPC or 0~0, should be carried out m a chemical fume hood while wearing gloves. 0~0~ can be purchased in a sealed ampoule contammg 250 mg (from Sigma or Aldrich for example). Because it
58
Bail/y and Waring
is volatile, the ampoule containing the pale yellow solid has to be cooled down before opening. Addrtion of 2 mL of deionized water immediately after openmg the ampoule gives a 500-W stock solution, which is then diluted 1O-fold and dispensed mto 50-uL aliquots for storage at -2OOC. Frozen solutions of 0~0~ are relatively stable (for at least 6 mo). 2.2. DNA An important facet of a successful chemical probing experiment is the quality of the DNA. A well-purified DNA fragment with high spectlic radioactrvtty will give the best results, be tt with DEPC or OsOQ,or any other probe. There is little point m proceeding with attempts to analyze drug-induced structural distorttons m DNA if the polymer IS impure and/or weakly labeled. DNA restriction fragments or synthetic oligonucleotides are labeled at the 3’ or 5’ end with 32Pand then purified on native polyacrylamtde gels using standard protocols (19). It is found that 150-200 bp is a good size for subsequent analysis. 3. Methods Although there is no strict requirement for a parttcular solvent medium, as a general rule buffers containmg free amino groups should be avoided to prevent artifacts arismg from the probe reacting with the buffer. It has been found convenient to use 10 mM Trls buffer adjusted to pH 7 0 with HCI and containing 10-50 mMNaC1. In several publications, sodium cacodylate buffer is also frequently used. Recently it has been reported that a side reaction can occur between Tris-HCI buffer and probes such as KMnO, producing new reactive species that apparently are liable to generate an extra set of piperidine-sensitive lesions, thereby obscurmg the specific reaction between KMn04 and susceptible thymmes (20). However, the authors have never observed such side effects when using DEPC and 0~0~ m a Tris buffer. Experiments are usually performed at 4°C 20°C (room temperature), or 37OC, but the chemical reactions are quite workable at different temperatures as well as m the presence of different salt concentrations so that the degree of stability and the conformation of the drug-DNA complexes can be examined under various functional conditions. The osmium tetroxide-pyrtdme complex is prepared fresh each time just prior to its addition to the DNA solution by mixing 50 uL of 50 mJ4 0~0~ with 30 uL water and 20 pL pyridine (99% analytical grade). This gives an Os04/pyridme mixture (4: 1, by vol) containing 25 mM 0~0,. The OsO,, solution turns yellow upon adding the pyridine. 3.1. DEPC Reaction The labeled DNA samples (100-500 cps) are diluted with the solution of the test drug prepared m 10 mA4Trts-HCl buffer (or other compatible buffer). The
Drug-induced
Changes in DNA Conformation
59
samples (20 pL) are left to equtlibrate for a mimmum of 30 mm at 37°C One microliter of DEPC is then added and the mrxture left at room temperature for a further 15 min with frequent mixing (DEPC 1snot mtscrble wtth water). The reaction is stopped by adding 200 pL of 0.3 M sodium acetate and the DNA IS precipitated with 3 vol of ethanol. The solution is chilled at -70°C for 10 mm before centrtfugation for 15 mm at 14,000 rpm. Using stlicomzed tubes may ard in recovermg material after the precrpttatton. The DNA pellet 1sthen redtssolved in 100 pL of 0.3 M sodmm acetate, reprecipttated with ethanol and washed once with 70% ethanol. The DNA pellet IS then briefly dried. 3.2. 0~0, Reaction The labeled DNA samples (100-500 cps) are exposed to the test drug in 10 mM Tris-HCI or other compatible buffer. The samples (45 pL) are left to equilibrate for a minimum of 30 mm at 37°C and cooled to 0°C (5 min) Then the reaction ISconducted by mixing the preequllibrated drug-DNA solution with 5 PL of a freshly prepared OsO$pyrtdine solution (4/l, v/v) to adJust the final 0~0~ concentratton to 2.5 n-&I. After 15 mm at room temperature, the reaction 1sstopped by extracting the reagent twice with 300 FL of dtethyl ether and the modified DNA ISrecovered by precipitation wrth 3 vol of ethanol. The solutton IS chilled at -70°C for 10 min before centrifugatton for 15 mm at 14,000 rpm. The DNA pellet IS then redissolved in 100 p.L of 0.3 M sodium acetate, reprectpitated with ethanol and washed once with 70% ethanol prior to drying. Although both DEPC and OsO,,react only weakly with unmodified DNA, a mandatory control for any probe is to treat the polynucleotide wtth the chemical reagent in the absence of the test drug so as to verify that the nucleic acid IS not partially denatured or distorted under the chosen experimental condttions (espectally at high salt concentrations or temperatures higher than 37°C) as well as to verify the quality of the DNA preparation. 3.3. Detection of Adducts DEPC-purme and osmmm-thymine adducts in DNA can be located by dtfferent methods including transcription termination assays,inhibition of primer extension, or inhibition of restriction enzyme cleavage (21). The primer extension method does not require an end-labeled DNA fragment and consequently can be used with large DNA molecules. But the most convenient, direct, and frequently used method for accurate single-nucleottde resolutton consists in the treatment of chemically modified DNA with hot ptpertdine. The sugarphosphate bonds 5’ and 3’ to the base adduct are alkali-labile and can easily be broken with dilute piperidme. However, a potential problem wrth the use of this procedure is that It causes weak, but noticeable, background cleavage in unmodified DNA probably becauseprpertdine, which IS a strong base, can pro-
60
Bail/y and Waring
duce high concentrattons of hydroxyl ions capable of reacting wrth the bases so as to mduce strand breaks. The background cleavage (usually observed at guanme residues) IS of little consequence if the level of specific chemtcally induced adducts IS large, but can be a problem if tt 1ssmall. To circumvent this problem, piperrdine may be replaced with other ammes capable of catalyzing p-elnnination reactions Accordmg to a recent study,NJ’-dtmethylethylenedlamine inflicts much less, tf any, background degradation on DNA Unlike prperidme, it catalyzes p-ehmmatron efficiently at neutral pH and phystologtcal temperature (100 mM solution buffered to pH 7.4, 15 min at 37°C) and does not have to be removed before samples are apphed to sequencing gels (22). 3.4. Piperidine Cleavage of DEPC- and Os04-Modified DNA The subsequent steps apply to both DEPC- and Os04-treated DNA samples as well as to the control samples Resuspend the air-dried pellet m 50 pL of freshly diluted plperrdine Although most protocols recommend the use of 10% prpertdme (about 1 M), in most cases, the percentage of piperidme can be reduced to 5% without noticeable loss of activity. Similarly there is little, If any, difference in using 25 pL instead of 50 pL dilute piperidme. Place the microfuge tubes (keep the lids of the tubes closed) in the sand bath or water bath and incubate at 90°C for 20 mm. Qurckly spin the tubes and place them on ice for about 30 s to cool the samples prior to openmg the tubes. Freeze the sample m dry ice and drive off the hqutd by lyophrlizmg (a Speed-Vat concentrator 1sconvenient). Once the prperrdine has completely evaporated, resuspend the dry pellet n-r 50 uL of dtstrlled water, and repeat the lyophilization at least twice. The pellet usually contains white traces after the first lyophihzation and becomes more or less translucent when all the prperidine has been removed. Dissolve the samples in 5 uL of sequencing dyes made with deromzed formamide (80% deionized formamide, 25 miI4 EDTA, 0.3% bromophenol blue, 0.3% xylene cyanol), botl for 4 mm at 9O”C, chill in Ice for 4 mm, and then load onto a standard sequencing gel An 8% acrylamrde contaming 7 Murea is typttally used, but of course this can be varied depending on the length of the DNA substrate. Electrophorests is usually performed using TBE buffer (89 rnitJTrrs base, 89 m boric acid, 2 5 mM Na,EDTA, pH 8.3) at 60 W (about 1600 V, BRL sequencers model S2) until the bromophenol blue marker has run out of the gel Gels are soaked in 10% acetic acid for 10 mm, transferred to Whatman 3MM paper, dried under vacuum at 8O”C, and subjected to autoradrography using either a phosphorlmager (Molecular Dynamics) or X-ray films exposed at -70°C with an intensifying screenif desired (the use of mtensrfying screensat -7O’C has been questioned [23J. Exposure ttmesof the X-ray films are adjusted according to the number of counts per lane loaded on each individual gel (usually 24 h).
Drug-induced Changes m DNA ConformatIon
61
4. Applications Prior to presenting examples that illustrate the applicattons of DEPC and 0~0, in the study of drug-DNA recognition, tt is worth giving an example of the utility of the probes for evidencing an unusual DNA conformatton. Very recently, the authors were seeking to charactertze the triple helix-stabthzmg effects of a benzo[flpyrtdoqumoxaline derivative structurally related to the previously reported benzo[e]pyridoindole compound BePI (24). For that purpose, two parallel triple helix model systems were investigated: one in which the third strand matched perfectly a 27-bp purine-pyrtmidme motif in the target DNA; another in which the third strand was one nucleotrde longer, i.e., a 2%mer. In the latter system, the pairing of the (Y)28 thn-d strand to the (YR),, target requires the formation of a bulge containing at least one unpaired base. Evidence for the formation of the bulge was gamed from chemical probing experiments with osmium tetroxtde (25). The gel in Fig. 3A shows that the three bases-Cl 3, T14, and TlS-are sensitive to 0~0~ attack, thus allowing unambiguous locatton of the bulge around nucleotide T14 within the trtplehelix structure (Fig. 3B). The fact that the two residues flanking the unpaired thymme T14 are also sensitive to the osmmm probe probably indicates that these two bases are not deeply inserted into the major groove and may not be fully engaged in triplex formatton with the target duplex As indicated m Table 3, DEPC and 0~0~ have been used to detect structural distorttons in DNA induced by both classical (e.g., ethrdmm, actmomycm) and threading mtercalators (e.g , nogalamycin) as well as more subtle conformatronal changes induced by minor groove binders such as mtthramycm. They have also been employed to look at the effects of drugs that cross-lmk DNA such as cu-platinum or DNA cleavers such as bleomycm. Hyperreacttvity of a drug-DNA complex toward DEPC and 0~0~ provides convmcmg evidence that upon binding to DNA the drug has affected the conformation of the double helix To illustrate the utility of DEPC and 0~0~ for detecting drug-induced structural changes m DNA, studies performed with the antitumor antrbrotic echmomycin will be referred to. Echmomycin has been extensively studied over many years in the authors’ laboratory. The anticancer actrvlty of this quinoxaline antibiotic is believed to result from its capacity to bmd tightly to DNA by a mechanism of bu-intercalation (26). Footprinting studies have established that echinomycm binds preferentially to sites surrounding CpG steps m DNA (27,28). The exocyclic 2-ammo group of guanme exposed m the minor groove is a crtttcal determinant for sequence-specific recognition of DNA by echinomycin, as it IS for several other antlbiottcs (2%31) Echinomycm powerfully potenttates the reactivity of the adenine nucleotides m DNA toward DEPC whereas it moderately enhances the oxtdatton of a subset of thymine residues by osmium tetroxide (Fig. 4). The adenme residues that
B ((Y*R)2r(Y)28)
bulge-containing
triplex
1 10 20 30 40 50 S’-AATTCGAGCTCGCCCGCCTCTAGAGCTCGCTC~TCTTTTTTCTTCTTCTTTTTTCTTCTT~CTCG~CGCCC~A 3’-
60
70
80 -3’
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I NlHl~~l I I I I I I I I I I I I I I I I I I I I I I I I I I I I AAGCTCGAGCGGGXCCTAGGAGATCTCGAGCGAGTTAGMaAAX, AAAAAAGAAGAATTGAGCCCGCGGGCCCTTCGA-5’ .. .. .. . . ... . .. . .. ... .. . .. .. 3’-TCTTTTTTCTTCTTCTTTTTTCTTCTT-5’ ITL
1
\
t
Fig. 3. (A) Probing wtth osmum tetroxrde of the triple helix formed between an 8 1-bp double-stranded target DNA and a 5’-labeled 28-mer ohgonucleottde. Lane 1 refers to the reaction with the labeled single stranded ohgonucleotrde m the absence of its double-stranded target; reaction is essentially complete and no macromolecular products are visible. In the lanes numbered 2-5, the target duplex was added at 1,2 5,5, and 10 pA4. The cleavage products were resolved on a 15% polyacrylamide gel containing 8 A4 urea. Pyrimidme-specific sequence markers obtained by treatment of the 5’-labeled 28-mer oligonucleotide with hydrazme followed by ptpendme were run m the lane marked T+C (B) Sequence of the [(Y R)*, (Y&j parallel bulge-containmg triplex. Arrows point to the three nucleotrde residues-C 13, T 14, and T 15-that are hyperreacttve toward osmmm tetroxtde (25)
Bail/y and Waring
64 DEPC
Fig. 4. Reaction of diethylpyrocarbonateand the osmium tetroxide-pyridine complex with a 133-bp DNA. The fragment was cut out of plasmid PBS with AvaI and PvuII restriction enzymesand 3’-end labeled at the AvaI site with [a-32P]dCTPin the presenceof AMV reversetranscriptase.The cleavageproducts were resolved on an 8% polyacrylamide gel containing 8 A4urea. Specific strand cleavagesoccur at the modified nucleotidesafter treatmentwith piperidine. Control lanes(Ct) show the products resulting from treatmentof the DNA with the chemical probesin the absenceof antibiotic. Laneslabeled G, T+C, and G+A show the productsresulting from the dim-
Drug-Induced
Changes In DNA Conformation
65
display enhanced reactivity toward DEPC he immediately adjacent to a CpG dmucleotide step. As can be seen m the densltometrlc profiles in Fig. 5, at low antibiotic concentration (1 PM), only the bases flanking a CpG step exhibit a very pronounced reactivity toward DEPC. At higher echinomycin concentration (5 @4) the adenmes on the 3’ side of the G remain especially sensitive to attack by DEPC, but other ademnes and some guanme residues distal to the bindmg sites also become reactive. The intensity of the bands m the echmomycin-containmg lanes 1sby no means uniform, mdlcatmg that the distortion of the helix, which is sensed by DEPC, varies locally according to the sequence to which the drug 1sbound. Yet it does seem that DEPC hyperreactlve sites are dlstnbuted all along the DNA sequence mdlcatmg that it 1sthe entire secondary structure of the DNA fragment which, to varying degrees, 1saffected by the bmdmg of echmomycm. Altogether the results indicate that Os04 reacts most strongly with thymmes located around, but not necessarily adjacent to, an echmomycin bmdmg site, whereas carbethoxylation reactions caused by DEPC occur pnmarily at the ademne residues lymg unmedlately adJacent to the dmucleotide that denotes a binding site for the antibiotic (30). The results are totally consIstent with those previously obtained with other DNA fragments (32). Recently, the cooperatlvity of binding of echmomycin to DNA by measurmg the strength of bmdmg to DNA fragments containing closely spaced CpG steps has been examined. Quantitative footprinting experiments using DNase I as cleaving agent were undertaken to demonstrate that the bmdmg of echinomycin to DNA can be highly cooperative and that the extent of cooperatlvity depends on the nature of the sequencesclamped by the antlblotic (33). These designed DNA fragments, each containing two pairs of classical echmomycm binding sites(ACGT and TCGA) in direct juxtaposition or spacedby two or four A * T bp, provide an ideal substrate for investigating the extent of conformatlonal effects associated with the bmdmg of echmomycm to DNA. The reactivity of the DNA fragments toward DEPC and Os04 m the presence and absence of the antibrotlc was examined, with the reactivity being detected via the sensitivity of the reacted site to plperidme-catalyzed hydrolysis. Results from an experiment m which the 5’-labeled 16%bp fragment contammg the designed 5%mer insert
ethyl sulfate/plperidine,hydrazine/pipendine,andformic acld/pipendinereactionsand Indicate the locatlon of guanine,pyrimldine, andpurine residues,respectively, wlthm the sequence The lane marked “DNA” contamsthe [32P]-labeledDNA alone, mcubated without antiblotlc or probe; this sampleservesas acontrol to assessbackground nicking of the DNA The remaining lanes show the products of chemical probing m the presence of increasing concentrations of echinomycin (expressed as mlcromolar). Numbers on the right side of the gels refer to the numbering scheme (112).
Bail/y and Waring
66 Echinomycin 1pM - DEPC
*.AGCAa, -
XA-s -
Y-AGCG.s y.AGCG-s l -
1
2
Nuckotide Position
3
5
6
.J
”
Echinomycin 5ph4- DEPC t s*.AGCG-s
t r.AGCA-s
x2
Nucleotide Pariiii
t KAGCA.5 t .
.J
w
Fig. 5. Densitometrictracesshowingtheproductsof diethylpyrocarbonate reactionwith the 3’-endlabeledstrandof thePBS fragmentcausedby addingechinomycinat 1 @4 (top panel)and5 cuz/i(bottompanel).Theadenineandguanineresiduesthatrespondto DEPCin the presenceof echinomycinareindicatedby tilled and opencirclesrespectively.Arrows point to theadenineresiduesmostsensitiveto carbethoxylationby DEPC;all theseadenines lie on the 3’ sideof an underlinedCpG dinucleotidestepdenotingan echinomycin-binding site.Barsnumberedl-6 belowthehorizontalaxisreferto thepositionof theDNAaseI and MPE * Fe” (shaded)footprintsof echinomycinon theDNA fragment(112).
CBl was exposed to DEPC and Os04 are shown in Fig. 6. In the absenceof antibiotic (lanes marked Ct), the DNA reactsweakly with the probes. By contrast, in the presenceof the antibiotic the DNA becomesincreasingly suscep-
Drug-Induced Changes in DNA Conformation
67 0904
DEPC echinomycin Ct 0.5 1 2.5 -----------em-mm---
5
(PM) 10
20
echinomycin Ct
GA
T+C
G
Ct
0.5
1
2.5
5
(pM) 10
20
Ct
‘;: T
Fig. 6. Reaction of a 168-bp DNA fragment containing the insert CBl with diethylpyrocarbonate(DEPC)andosmiumtetroxide(0~0~) in the absence(Ct) andpresenceof echinomycin(was indicated).The duplexDNA wasS-endlabeledat the EcoRI sitewith Y-[~~P]ATPin thepresenceof T4 polynucleotidekinase(33). The cleavageproducts were resolvedon an 8% polyacrylamidegel containing8 A4urea.LaneslabeledG, G+A and T+C show the productsresultingfrom the dimethyl sulfate/piperidine,formic acid/piperidine,and hydrazine/piperidinereactionsand indicatethe location of guanine, purine,andpyrimidine residuesrespectivelywithin the sequence.Numbersat the left side of the gelsrefer to the numberingschemeusedin Fig. 7. The sequenceson the right side showthe locationof the ACGT andTCGA sitesto which echinomycinbinds.
68
Bail/y and Waring
table to attack mdmatmg that the bmdmg of the drug has facilitated the access of the probes to substrtuents lying m the major groove of DNA. The few adenine and thymine restdues that become reactive toward DEPC and Os04 m the presence of echmomycin are indicated in the sequence in Fig. 7. It can be seen that the underlined adenine residues m the sequence TCGATATAACGT are strongly reactive toward DEPC, whereas none of the purines in the sequence ACGTACGT react with DEPC. Srmilarly, only the doubly underlined thymme m the former sequenceis reactive toward Os04, whereas the reactivity of pyrimidmes within the latter sequence 1salmost imperceptible. However, footprmting studies have revealed clearly that the antibiotic binds very efficiently (and cooperatively) to both CpG steps in each sequence (33). Therefore, it must be concluded that the nature and/or extent of structural perturbatrons produced upon intercalation of the quinoxalme chromophores into the double helix varies according to the recognized sequence. The present results highlight the importance of the sequence context and local conformatton m the reaction of chemical probes with DNA. It 1snoteworthy that, in Fig. 6, a weak level of reactrvtty wtthm the (AT), tract on the 5’ side of the CpG-binding sttes can be discerned. Weak bands at a few T and A residues can be detected suggesting that the local distortion produced by the mtercalation process can propagate some distance from the binding sites. Why do certain thymme or adenine residues become very sensitive to the chemical probes while the reactivity of other residues adjacent to the binding sites remains unaffected? At present it IS not possible to provide a definitive answer. Induced DEPC and Os04 sensitivity is a sure sign that the target DNA has been distorted into a non-B-form structure, but the further interpretation IS not straightforward. Hyperreacttvity can be accounted for by unwinding, strffenmg, local melting, kinkmg, and so on. Vn-tually any structural change that increases the exposure of the 5-6 thymme double bond or the N-7 atom of purme residues would be expected to provoke detectable sensitivity toward osmium tetroxrde or DEPC, respectively. In other words, drug-induced structural changes m DNA can be sensitively detected by chemical probes such as DEPC and Os04, but m the absence of complementary information one can only speculate about the exact nature of those changes. In the aforementioned examples, the reactivity of Os04 toward the double helix is enhanced by the binding of echinomycin, but only rather weakly. This is becauseof the drug, not the osmium probe, for the latter can react strongly with thymmes provrdmg that tt can gam accesseither above or below the plane of the pyrrmidine ring. A clearer example of the value of Os04 for detecting drugInduced changes in DNA conformation is given in Fig. 8. The gel shows the effect of two closely related benzopyrrdoindole derivatives, (BePI and BgPI) on the reacttvity of a 265-bp fragment toward the osmium-pyridme complex.
~-ATATATATATATATAGCTATATTGCATATATATATGCATGCATATATT w/m W//A I I 20 40
I 50
ETZZZI-
I 60
Fig. 7. Diagrammatic representation of the DNAase I footprints and DNA strand cleavages produced by DEPC and 0~0, on the 16%bp DNA fragment contammg the Insert CB 1. Only the region of the restictlon fragment analyzed by densltometry 1s shown. The sequences marked by hatched boxes indicate the posltlons of mhlbltlon of DNAase I cutting, representing echmomycm-binding sites. Superscript bars indicate sites of echmomycm-mediated reactivity toward DEPC (filled columns) and Os04 (open columns) The lengths of the columns are proportional to the intensity of cleavage.
Bail/y and Waring
BePl
BgPl
90.
80.
Fig. 8. Reaction of a 265-bp DNA fragment with the osmium tetroxide-pyridine complex in the absence(Ct) and presenceof the benzopyridoindole derivatives BgPI or BePI. The DNA fragment was cut out of plasmid PBS with the restriction enzymes EcoRI and PvuII and 3’-end labeled at the EcoRI site with [a-32P]dATP in the presence of avian myeloblastosisvirus reversetranscriptase.The concentration (pA4) of the drugs is shown at the top of the appropriategel lanes.The track labeled“Cl” representsa dimethylsulfate-piperidine marker specific for guanine residues.Numbers at the left side of the gel refer to the standardnumbering scheme(31).
Drug-Induced
Changes
m DNA Conformation
71
The two drugs, which selecttvely stabilize triple-helical DNA-oligonucleotide complexes, strongly enhance the susceptibility of the DNA to oxidation of its thymme residues by 0~0~. Although the two drugs are very comparable m structure, BgPI potentiates the reaction of Os04 with DNA more strongly than BePI. Indeed, at a concentration of 1 pA4 BePI, the reactivity of the probe is hardly enhanced at all, whereas under the same conditions 1 PM BgPI IS sufficient to induce the formation of a clear set of adducts susceptible to cleavage by piperidme. At higher concentrations (25 P!v!) both drugs strongly enhance the oxidation of thymidme residues m DNA. A detailed analysis of the reactive sites has revealed that pyrimldine residues located in the triplet sequences 3’-GTA and 3’-GCA provide a privileged target for 0~0~ attack. This sequence-dependent oxldative process is observed with BgPI, but not with BePI The sequence 3’-A-T-Pyr-Pur(A>G)-5’ appears as a kind of consensus showing hypersensrtivtty to 0~0~ attack in the presence of BePI. The use of probes such as 0~0~ has led to the finding that, despite their structural homology and mdlstmguishable selectivity Judged by footprmting, the two benzopyrldomdole derivatives induce distinct conformational changes m the structure of the double helix. These examples illustrate how chemical probes such as DEPC and 0~0, that require different base and DNA structural properties for reaction are tremendously valuable for exammmg discrete drug-induced conformatronal changes in the double helix By utilizing a variety of probes that can detect maJor and/or mmor groove interactions, considerable structural mformation can be obtained for virtually any drug-DNA complex.
References 1 Lilley, D. M J. (1992) Probes of DNA structures. Methods Enzymol 212, 133-139. 2 Ehresman, C., Baudm, F., Mougel, M., Romby, P., Ebel, J. P., and Ehresman, B. ( 1987) Probing the structure of RNAs in solution Nuclezc AczdsRes 15,9109-g 128. 3. Wells, R. D., Collier, D A , Hanvey, J. C., Shimrzu, M., and Wohlrab, F (1988) The chemistry and biology of unusual DNA structures adopted by oligopurmeoligopyrimidine sequences. FASEB J. 2,2939-2949 4. Nielsen, P. E. (1990) Chemical and photochemical probing of DNA complexes. J MOE Recognltlon 3, l-2.5. 5. Fox, K R. (1992) Use of enzymatic and chemical probes to determine the effect of drug binding on local DNA structure, in Advances zn DNA Sequence Speczfic Agents, vol. 1, JAI, pp. 167-214. 6 Boehm, T and Metha, D (1938) ester der pyrokohlensaure Chem Ber 71,1797 7. Milles, E W. (1977) Modification of histrdyl residues m protems by drethylpyrocarbonate Methods Enzymol 47,43 l-442. 8. Sams, C. F. and Mathews, K. S. (1988) Diethyl pyrocarbonate reaction with the lactose repressor protein affects both inducer and DNA binding Blochemzstry 27,2277-228 1.
72
Bailly and Waring
9 Vmcze, A, Henderson, R. E L., McDonald, F., and Leonard, N J. (1973) Reacnon of drethylpyrocarbonate wtth nucletc actd components. Bases and nucleosldes derrved from guanme, cytosine, and uractl .J Am Chem Sot 95,2677-2682 10. McCarthy, J G , Wtlhams, L D , and Rich, A (1990) Chemtcal reactrvtty of potassium permanganate and dtethyl pyrocarbonate wtth B-DNA specific reactivity with short A-tracts Bzochemzstry 29,607 l-608 1 11 Palecek, E. (1992) Probing DNA structure with osmmm tetroxrde complexes m vrtro Methods Enzymol 212, 139-l 55 12. Neidle, S. and Stuart, D. I. (1976) The crystal and molecular structure of an osmium btspyrtdme adduct of thymme Blochlm Blophys Acta 418,226-23 1 13. Cotton, R. G H., Rodrtgues, N R , and Campbell, R D. (1988) Reactrvtty of cytosine and thymme in single-base-pan mtsmatches with hydroxylamine and osmium tetroxtde and its apphcatron to the study of mutations. Proc Natl. Acad Scr USA 85,4397-440 1 14 Debt, A. L , Matsumoto, K , Santha, E., and Agoston, D V (1994) Guanme specific chemtcal sequencing of DNA by osmmm tetroxrde Nucleic Aczds Res. 22,4846-4847 15. Furlong, J C , Sullivan, K M., Murchre, A I H , Gough, G W , and Ltlley, D M. J. (1989) Localized chemical hyperreactivtty m supercotled DNA evtdence for base unpairing m sequences that induce low-salt cructform extruston Bzochemistry 28,2009-2017
16. Sulhvan, J. K. and Lebowttz, J (1991) Differential sequence dynamics of homopolymertc and alternating AT tracts m a small plasmtd DNA Bzochemzstry 30,2664-2673 17. Mejzltk, P. (1994) Complexes between osmmm tetraoxtde brspyrtdme and DNA a molecular mechanics study J Blomol Struct Dyn 12, 327-342 18. Bailly, C , Marchand, C , Nguyen, C H , Bisagm, E , Garestier, T , Helene, C , and Warmg, M. J (1995) Locahzed chemical reactrvny in double-stranded DNA associated with the mtercalative binding of benzo[e]pyndomdole and benzo[g]pyndomdole tnple-helix-stabrhzmg hgands. Eur J Blochem 232,66-76. 19. Sambrook, J , Frrtsch, E. F., and Mamatts, T. (1982) Molecular Clonzng, A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 20. McCarthy, J. G , Frederick, C. A , and Nrcolas, A (1993) A structural analysts of the bent kmetoplast DNA from Crlthzdiafasczculata by high resolution chemtcal probing Nucleic Aczds Res 21, 33093317. 2 1. Htun, H. and Johnston, B. H. (1992) Mapping adducts of DNA structural probes using transcrrptton and pnmer extension approaches Methods Enzymol. 212,272-294. 22. McHugh, P. J and Knowland, J (1995) Novel reagents for chemical cleavage at abasrc sues and UV photoproducts m DNA. Nucleic Aczds Res 23, 1664-1670. 23. Hengen, P. N. (1995) Cycle sequencmg through GC-rich regions. Trends Bzochem. SCL 21,33,34 24. Mergny, J. L., Duval-Valentm, G., Nguyen, C. H., Perrouault, L., Faucon, B., Rougee, M., Montenay-Garestrer, T , Btsagni, E , and Helene, C (1992) Triple helix-specific hgands Sczence 256, 168 l-l 684.
Drug-Induced
Changes in DNA Conformation
73
25. Marchand, C , Barlly, C , Nguyen, C H , Bisagni, E., Garestier, T., Helene, C , and Warmg, M. J. (1996) Stabthsatton of triple hehcal DNA by a benzopyridoqumoxaline mtercalator Biochemistry 35,5022-5032. 26 Waring, M. J. and Wakelm, L. P G (1974) Echmomycm: a brfuncttonal mtercalating antibiotic. Nature 252,653-657. 27 Low, C. M. L., Drew, H R , and Waring, M. J. (1984) Sequence-specific binding of echmomycin to DNA. evrdence for conformattonal changes affecting flanking sequences Nucleic Acids Res. 12,48654877 28. Van Dyke, M. W. and Dervan, P. B. (1984) Echinomycin binding sites on DNA. Sczence 225,1122-l 127 29. Marchand, C., Bailly, C., McLean, M. J., Moroney, S., and Waring, M. J. (1992) The 2-ammo group of guanine is absolutely required for specific bmdmg of the anti-cancer antibiotic echinomycin to DNA. Nucleic Acids Res 21,5601-5606. 30. Bailly, C and Waring, M J. (1993) Footprmting studies on the sequence-selecttve binding of trlorone to DNA. Antwzral Chem Chemother. 4, 113-126. 3 1 Barlly, C and Waring, M. J (1995) Transferring the purme 2-ammo group from guamnes to ademnes m DNA changes the sequence-specific bmdmg of antrbiotICS.Nucleic Acids Res. 23,885-892. 32. Batlly, C., Gentle, D., Hamy, F , Purcell, M , and Warmg, M J (1994) Locahzed chemical reactivity in DNA associated with the sequence-specific brsintercalation of echmomycm. Blochem J 300,165-173. 33. Bailly, C., Hamy, F , and Waring, M. J (1996) Cooperatrvrty m the bmdmg of echinomycin to DNA fragments containing closely spaced CpG sites Bzochemzstry35,1150--1161 34. Evans, T. and Efstratradts, A (1986) Sequence-dependent S1 nuclease hypersenstttvtty of a heteronomous DNA duplex. J Bzol Chem 261, 14,771-14,780 35. Collier, D. A., Grrffin, J A., and Wells, R. D. (1988) Non-B right-handed DNA conformations of homopurme homopyrrmldine sequences in the murme nnrnunoglobulin Ca switch region J Blol Chem. 263,7397-7405 36 Hanvey, J C., Klysrk, J., and Wells, R. D. (1988) Influence of DNA sequence on the formation of non-B right-handed hehces m ohgopurme + ohgopyrimtdine inserts in plasmrds. J Blol. Chem. 263,7386-7396. 37. Bern&s, J., Belt&n, R., Casasnovas,J M., and Azonn, F. (1989) Structural polymorphism of homopurine-homopymmdme sequences:the secondaryDNA structure adopted by a d(GA * TC)22 sequence m the presence of zinc ions. EMBO J f&2087-2094. 38 Fox, K. R. (1990) Long (dA), (dT), tracts can form intramolecular trtplexes under superhelical stress. Nucleic Acids Res. l&5387-5391. 39. Fox, K R (1992) Wrapping of genomic polydA * polydT tracts around nucleosome core particles. Nucleic Acids Res 20, 1235-l 242. 40. Panyutm, I. G. and Wells, R D. (1992) Nodule DNA m the (GA)37 * (CT),, insert m superhelical plasmids. J Biot. Chem. 267, 5495-5501. 4 1. Martinez-Balbas, A. and Azorin, F. (1993) The effect of zinc on the secondary structure of d(GA * TC), DNA sequences of dtfferent length. a model for the formation of *H-DNA Nucleic Aczds Res 21,2557-2562
74
Bail/y and Waring
42. Johnston, B. H, (1988) The Sl-senstttve form of d(C-T), * d(A-G),: chemical evidence for a three-stranded structure m plasmtds Scrence 241, 1800-l 804 43 Hanvey, J C , Shtmlzu, M , and Wells, R D (1988) Intramolecular DNA trtplexes m supercotled plasmtds Proc Nat1 Acad Scl USA 85,6292-6296. 44. Hanvey, J C , Shimrzu, M., and Wells, R D. (1989) Intramolecular DNA trtplexes m supercooled plasmtds II. Effect of base composmon and noncentral interrupttons on formation and stability. J B~ol Chem 264, 5950-5956 45 Voloshm, 0 N , Mirkm, S M , Lyamtchev, V I., Belotserkovskn, B P , and Frank-Kamenetskii, M. D (1988) Chemical probmg of homopurme-homopyrimtdme mirror repeats m supercoiled DNA Nature 333, 475-476 46 Voloshin, 0 N , Shlyakhtenko, L. S., and Lyubchenko, Y. (1989) Locahzation of melted regtons m supercotled DNA FEBS Lett 243,377-380. 47. Htun, H and Dahlberg, J E (1988) Single strands, triple strands, and kmks in H-DNA Sczence 241,1791-1796 48 Htun, H. and Dahlberg, J E. (1989) Topology and formation of triple-stranded H-DNA. Sczence 243, 1571-I 576 49 Parniewskt, P , Galazka, G , Walk, A., and Klysrk, J. (1989) Complex structural behavior of ohgopurme ohgopyrtmtdme sequence cloned wtthm the supercoiled plasmid. Nuclerc Acrds Res 17, 6 17-629 50 Shtmtzu, M., Hanvey, J C , and Wells, R. D (1989) Intramolecular DNA triplexes m supercotled plasmtds I. Effect of loop size on formation and stabihty J Blol Chem 264,5944-5949
51 Blancht, A , Wells, R. D , Hemtz, N H., and Caddle, M S (1990) Sequence near the ortgm of replication of the DHFR locus of chmese hamster ovary cells adopt left-handed Z-DNA and triplex structures J Blol Chem 265,2 1,789-2 1,796 52 Berm&, J., Beltran R , Casasnovas, J M., and Azorin, F. (1990) DNA-sequence and metal-ton spectficlty of the formatton of *H-DNA. Nuclezc Aczds Res 18, 40674073. 53 Collier, D. A , Mergny, J. L., Thuong, N. T , and Helene, C. (199 1) Site-spectfic intercalation at the triplex-duplex Junction Induces a conformational change which 1s detectable by hypersenstttvtty to dtethylpyrocarbonate. NucEezc Acids Res 19,42 19-4224. 54. Pestov, D G., Dayn, A , Siyanova, E Y ., George, D L , and Mtrkin, S. M. (199 1) H-DNA and Z-DNA m the mouse c-Ki-ras promoter. Nuclezc Acids Res 19, 6527-6532 55 Klyslk, J. (1992) Cruciform extrusion facilitates ibtramolecular triplex formation between distal ohgopurme ohgopyrtmidme tracts. long range effects J. Blol Chem. 267, 17,430-17,437 56. Hartman, D A, Kuo, S. R., Broker, T R., Chow, L T , and Wells, R D. (1992) Intermolecular triplex formatton distorts the DNA duplex m the regulatory region of human papillomavnus type- 11 J Blol Chem 267,5488-5494. 57 Dayn, A., Samadashwily, G M., and Mtrkm, S. M (1992) Intramolecular DNA trtplexes: unusual sequence requirements and influence on DNA polymertzatton Proc Nat1 Acad SCL USA 89, 11,406-l 1,410
Drug-induced
Changes In DNA Conformation
75
58. Pecinka, P., Huertas, D., Azorm, F., and Palecek, E (1995) Intramolecular TAT triplex m (dA)5s.(dT)58. Influence of tons. J Bzomol Struct Dyn. 13,29-46. 59 Klysik, J., Rippe, K., and Jovm, T M (1990) Reactivity of parallel-stranded DNA to chemical modification reagents. Bzochemlstry 29,983 l-9839 60 Klysik, J., Rippe, K , and Jovin, T M (1991) Parallel-stranded DNA under topologtcal stress: rearrangement of (dA) (dT),, to a d(A * A T), triplex. Nuclerc Aczds Res 19, 7 145-7 154
61. Guo, Q., Lu, M., and Kallenbach, N R. (1995) Effect of hemimethylatton and methylatton of adenine on the structure and stability of model DNA duplexes Bzochemzstry 34, 16,35916,364 62 McCarthy, J G. and Rich, A. (1991) Detection of an unusual distortion m A-tract DNA usmg KMnO, effect of temperature and dtstamycm on the altered conformation Nuclex Aads Res. 19, 342 l-3429. 63 Carrera, P. and Azorm, F (1994) Structural charactertzatton of mtrmstcally curved AT-rich DNA sequences Nucleic Acids Res 22,367 l-3680 64. Johnston, B H. and Rich, A (1985) Chemical probes of DNA conformation. detection of Z-DNA at nucleotide resolutton. Cell 42, 7 13-724 65. Herr, W. (1985) Diethyl pyrocarbonate: a chemical probe for secondary structure in negatively supercoiled DNA Proc Natl Acad Scl USA 82, 8009-80 13 66 Runkel, L. and Nordheim, A. (1986) Chemical footprmtmg of the interaction between left-handed Z-DNA and anti-Z-DNA antibodres by diethyl pyrocarbonate carbethoxylatton J Mol Biol 189,487-501, 67. McLean, M J and Waring, M J (1988) Chemical probes reveal no evrdence of Hoogsteen base pairing m complexes formed between echmomycin and DNA m solution. J Mol Recognrtron 1, 138-151 68. McLean, M. J. and Wells, R D (1988) The role of DNA sequence m the formation of Z-DNA versus cruciforms in plasmids. J Bzol Chem 263,7370-7377 69. Vogt, N , Rousseau, N , Leng, M., and Malfoy, B. (1988) A study of the B-Z transition of the AC-rich region of the repeat unit of a satelltte DNA from Cebus by means of chemical probes J Biol Chem 263,11,826-l 1,832. 70. NeJedly, K., Klysik, J , and Palecek, E (1989) Supercoil-stabihzed left-handed DNA in the plasmtd (dA-dT)16 insert formed m the presence of N12+ FEBS Lett 243,313-317. 71. Guo, Q , Lu, M., Shahrestanifar, M , Sheardy, R. D , and Kallenbach, N. R. (199 1) Drug bmdmg to a DNA BZ molecule* analysis by chemical footprintmg. Blochemzstry 30, 11,735-l 1,741 72. Johnston, B. H. (1992) Generatton and detection of Z-DNA. Methods Enzymol 211, 127-158.
73 Albert, A -M., Roman, A. M., Bouche, G., Leng, M., and Rahmouni, A R. (1994) Gradual and oriented B-Z transition m the 5’-untranscrtbed region of mouse ribosomal DNA J Blol Chem 269, 19,238-19,244. 74 Buckle, M and But, H (1989) Fine mapping of DNA smgle-stranded regions using base-specific chemical probes. study of an open complex formed between RNA polymerase and the lac UV5 promoter. Blochemlstry 28,4388-4396.
76
Bail/y and Waring
75. Furlong, J C and Ltlley, D M. J (1986) Highly selective chemical modtficatton of cructform loops by drethyl pyrocarbonate. Nucleic Aads Res 14,3995-4007 76 Scholten, P M and Nordheim, A. (1986) Dtethyl pyrocarbonate* a chemical probe for DNA cructforms Nucleic Aclds Res 14, 3981-3993 77. Nadel, Y , Wetsman-Shomer, P., and Fry, M (1995) The fragtle X syndrome single strand d(CGG), nucleottde repeats readily fold back to form ummolecular hanpin structures J Brol Chem 270,28,970-28,977 78 Heuer, C and Htllen, W (1988) Tet repressor-tet operator contacts probed by operator-modificatron Interference studies. J Mol BIOI 202,407-4 15 79 Bateman, E and Paule, M R. (1988) Events during eucaryotic rRNA transcrtption imtiation and elongation converston from the closed to the open promoter complex requrres nucleotrde substrates. Mol. Cell B~ol. 8, 1940-1946 80 Zhong, M , Rashes, M S , Marky, L A., and Kallenbach, N R (1992) T-T base mismatches enhance drug bmdmg at the branch sate rn a four-arm DNAJunctron Bzochemzstry 31,8064-807 1 81 Zhong, M , Rashes, M S , and Kallenbach, N R (1993) Effects of T-T base mismatches on three-arm DNA Junctions Bzochemistry 32,6898-6907. 82 Zhong, M , Rashes, M S , Leontis, N B., and Kallenbach, N R (1994) Effects of unpaired bases on the conformatton and stability of three-arm DNAJuncttons Blochemzstry 33,3660-3667 83 Welch, J. B , Duckett, D R , and Lrlley, D M. J (1993) Structures of bulged three-way Junctions Nucleic Aczds Res 21,4548-4555 84 Friedman, T. and Brown, D M. (1978) Base specific reactions useful for sequencing* methylene blue sensitized photooxtdatron of guanme and osmium tetraoxtde modificatron of thymme Nucletc Acids Res 5, 615-622 85 VoJtiskova, M and Palecek, E (1987) Unusual protonated structure in the homopurme * homopyrrmrdme tract of supercorled and linearized plasmtds recognized by chemrcal probes. J Bromol Struct Dyn 5,283-296 86. Vojttskova, M., Mirkm, S , Lyamtchev, V , Voloshm, O., Frank-Kamenetskn, M., and Palecek, E (1988) Chemical probing of the homopurme * homopyrrmtdme tract m supercotled DNA at single-nucleottde resolutron FEBS Lett 234,295299 87 Palecek, E., Rasovska, E , and Boublikova, P. (1988) Probing of DNA polymorphic structure m the cell with osmmm tetroxtde Bzochem Biophys Res Commun 150,73 l-738. 88 Karlovsky, P., Pecinka, P , Vojttskova, M , Makaturova, E , and Palecek, E (1990) Protonated trrplex m E colr cells as detected by chemical probmg FEBS Lett 274, 39-42 89. Peleg, M., Kopel, V., Borowrec, J. A., and Manor, H (1995) Formatton of DNA triple helices inhtbtts DNA unwinding by the SV40 large T-antigen helrcase Nucleic Aads Res 23, 1292-1299 90 NeJedly, K., Kwmkowski, M , Galazka, G., Klystk, J., and Palecek, E. (1985) Recognitron of the structural dtstorttons at the Juncttons between B and Z segments m negatively supercorled DNA by osmmm tetroxtde J Bzomol Struct Dyn 3,467478
Drug-Induced
Changes m DNA Conformatlon
77
9 1 Galazka, G., Palecek, E., Wells, R. D., and Klystk, J (1986) Site-specific 0~0, modification of the B-ZJunctions formed at the (dA-dC),, region in supercooled DNA J Blol Chem 261,7093-7098. 92. Palecek, E , Boubhkova, P , and Karlovsky, P. (1987) Osmium tetroxide recogmzed structural distortions at junctions between rtght- and left-handed DNA m a bacterial cell. Gen Physzof Bzophys 6, 593-608 93 Palecek, E., Boubhkova, P , NeJedly, K., Galazka, G , and Klysik, J (1987) B-Z junctton in supercooled pRW751 DNA contain unpaired bases or non-watsonCrrck base pairs J Bzomol Struct Dyn 5,297-306. 94 Blaho, J. A., Larson, J. E., McLean, M J., and Wells, R. D. (1988) Multiple DNA secondary structures in perfect Inverted repeat mserts m plasmtds J Bzol Chem. 263, 14,44614,455. 95 Rahmouni, A. R. and Wells, R D. (1989) Stabilizatton of Z DNA m vlvo by localized supercoilmg. Sczence 246,358-363. 96. Rahmouni, A. R. and Wells, R. D (1992) Direct evidence for the effect of transcription on local DNA supercoilmg in vzvo J MOE Bzol 223, 13 1-144 97. Albert, A.-C., Leng, M., and Rahmouni, A R. (1995) The size ofthe topological domam modulates the B-Z transition of a (TG), contaming repeat J Blomol Struct Dyn 13,47-56
98 Murchte, A. I H. and Lilley, D M J (1992) Retinoblastoma susceptibility genes contain 5’ sequences with a high propensity to form guanme-tetrad structures Nucleic Acids Res 20,49-53
99 Ltlley, D M J. and Palecek, E. (1984) The supercool-stabilized cruciform of ColE 1 1shyperreactive to osmmm tetroxide EMBO J 3, 1187-l 192 100 Cotton, R. G. H. and Campbell, R D (1989) Chemical reactivity of matched cytosme and thymme bases near mismatched and unmatched bases m a heteroduplex between DNA strands with multiple differences Nuclezc Aczds Res 17, 4223-4233 101. Bhattacharyya, A and Ltlley, D. M. J. (1989) Single base mtsmatches m DNA J. Mol Blol 209, 583-597
102 Greaves, D R , Patient, R K , and Lilley, D. M J (1985) Factle cructform formation by an (A-T)s4 sequence from a Xenopus globm gene. J, Mol. Bzol 185, 46 l-478 103. McClellan, J. A., Palecek, E., and Ulley, D M. J. (1986) (A-T), tracts embedded in random sequence DNA-formation of a structure which 1schemically reactive and torsionally deformable. Nucleic Acids Res 14,9291-9309. 104. McClellan, J. A., Boublrkova, P., Palecek, E., and Lilley, D. M. J. (1990) Superhelical torsion in cellular DNA responds directly to environmental and genetic factors. Proc. Nat1 Acad. Scl USA 87, 8373-8377. 105 McClellan, J A. and Ltlley, D. M. J. (1987) A two-state conformational equihbrtum for alternatmg (A-T),, sequences in negatively supercorled DNA. J. Mel Biol. 197,707-721.
106. Lyamichev, V. I., Mirkin, S. M , Danilevskaya, 0. N., Voloshm, 0. N., Balatskaya, S V., Dobrynm, V N , Filippov, S A , and Frank-Kamenetskti, M D
Sail/y and Waring
78
107. 108
109 110 111
112
113 114
115 116
117
118 119. 120
121
122
(1989) An unusual DNA structure detected m a telomeric sequence under superhelical stress and at low pH Nature 339,634-637 Palecek, E., Boubhkova, P , and Nejedly, K. (1989) Probing of DNA structure with osmmm tetroxrde. Effect of hgands Bzophys Chem 34,634s Duckett, D R., Murchie, A. I H., Diekmann, S , von Knzmg, E., Kemper, B , and Lilley, D M J (1988) The structure of the Holhday Junction and its resolution Cell 55,79-89. Duckett, D. R , Murchie, A. I H., and Lilley, D. M J (1990) The role of metal ions m the conformation of the four-way DNAJunction. EMBO J 9, 583-590 Duckett, D R and Lilley, D. M J. (1990) The three-way DNAJunction is a Y-shaped molecule m which there IS no helix-helix stacking EMBO J 9, l&5%1664 McLean, M J , Seela, F , and Waring, M. J (1989) Echmomycm-induced hypersensitivity to osmium tetroxide of DNA fragments incapable of formmg Hoogsteen base pairs Proc Nat1 Acad Scl USA 86.9687-9691 Bailly, C and Waring, M J (1995) Comparison of different footprintmg methodologies for detectmg bmdmg sites for a small ligand on DNA J Bzomol Struct. Dyn 12,869-898 Mendel, D and Dervan, P. B (1987) Hoogsteen base pairs proximal and distal to echmomycm Proc Nat1 Acad Scl USA 84,91&9 14 Portugal, J , Fox, K R , McLean, M J., Richenberg, J L , and Waring, M. J (1988) Diethyl pyrocarbonate can detect a modified DNA structure induced by the bmdmg of qumoxalme antibiotics. Nucleic Acids Res 16,3655-3670 Fox, K. R. and Kentebe, E. (1990) Footprmtmg studies on the effect of echmomycin on the structure of a bent DNA fragment. Blochem J 269,2 17-22 1 Jeppesen, C. and Nielsen, P. E (1988) Detection of intercalation-induced changes m DNA structure by reaction with diethylpyrocarbonate or potassium permanganate Evidence against the mduction of Hoogsteen base panmg by echmomycm FEBS Lett 231, 172-176. Fox, K. R and Kentebe, E (1990) Echmomycm bmdmg to the sequence CG(AT)nCG alters the structure of the central AT region. Nuclerc Acids Res 18, 1957-1963 Fox, K. R , Marks, J. N , and Waterloh, K. (1991) Echmomycin to alternatmg AT Nucleic Acids Res 19,6725-6730 Waterloh, K. and Fox, K. R. (1991) Interaction of echmomycm with A, * T, and (AT), regions flanking its CG binding site. Nucleic Acids Res 19,671%6724. Sayers, E W. and Waring, M. J (1993). Footprmtmg titration studies on the bmdmg of echinomycm to DNA incapable of formmg Hoogsteen base pairs Bzochemtstry 32,9094-9107 Fox, K. R. and Cons, B. M G (1993) Interaction of mithramycm with DNA fragments complexed with nucleosome core particles comparison with distamycin and echinomycm Bzochemlstry 32,7 162-7 17 1 Waterloh, K., Olsen, R K , and Fox, K. R (1992) Btfunctional intercalator [NMeCys3,N-MeCys’]TANDEM binds to the dinucleotide TpA Blochemzstry 31, 62466253
Drug-induced Changes in DNA Conformation
79
123 Lavesa, M., Olsen, R K., and Fox, K R. (1993) Sequence-specific binding of [N-MeCys3,N-MeCys7]TANDEM to TpA. &&em J 289,605-607. 124. Waterloh, K and Fox, K R (1990) Effect of actmomycm on a (TA), plasmtd insert, Anti-Cancer Drug Des 5,89-92. 125. Waterloh, K. and Fox, K R (1991) The effects of actmomycm on the structure of dA, dT, and (dA-dT), regions surroundmg its GC bmdmg site J Blol Chem 266,638 16388. 126. Bailly, F., Bailly, C., Waring, M J , and Hemchart, J P. (1992) Selective bmdmg to AT sequences m DNA by an acridme-linked pepttde contamlng the SPKK mottf Blochem Bzophys Res Commun 184,93O-937 127 Flock, S , Badly, F., Bailly, C., Waring, M J , Henichart, J P , Colson, P , and Houssier, C (1994) Interaction of two peptide-acrtdme comugates contammg the SPKK peptide motif with DNA and chromatm J Bzomol Struct Dyn 11, 881-900. 128 Fox, K R and Gregg, G W (1988) Diethylpyrocarbonate and permanganate provtde evidence for an unusual DNA conformation Induced by the bindmg of the antitumour antibiotics bleomycin and phleomycm Nucleic Acids Res 16, 2063-2075 129 Nightingale, K. P. and Fox, K. R. (1992) Interaction of bleomycm with a bent DNA fragment Blochem J 284,929-934. 130. Fox, K R. (1988) Footprmting studies on the mteractions of nogalamycm, arugomycin, decilorubicm and viriplanm with DNA Anti-Cancer Drug Design 3, 157-168 131. Bailly, C , OhUigm, C , Rivalle, C , Btsagm, E.. Hemchart, J. P , and Waring, M J. (1990) Sequence-selective binding of an ellipttcme derivative to DNA Nuclezc Aczds Res l&6283-6291 132 Batlly, C. and Waring, M J (1993) Preferenttal mtercalatton at AT sequences m DNA by lucanthone, hycanthone, and mdazole analogs, A footprmtmg study Blochemlstry
32, 5985-5993
133 Marrot, L and Leng, M. (1989) Chemical probes of the conformation of DNA modified by cis-diammmedxhloroplatmum(I1). Blochemlstry 28, 1454-1461 134 Schwartz, A., Marrot, L., and Leng, M. (1989) Conformation of DNA modified at a d(GG) or a d(AG) site by the antrtumor drug cu-d~ammmedichloroplatmum(II) Bzochemutry
28, 7975-1979.
135. Ford, K. G and Needle, S (1995) Perturbations m DNA structure upon interaction with porphyrms revealed by chemical probes. DNA footprmtmg a,ld molecular modelling BloOrg Med Chem 3,611-677
5 Footprinting Studies with Nucleosome-Bound
DNA
Philip M. Brown and Keith R. Fox 1. Introduction Although there have been many studies on the interaction of DNA-binding agents with both natural and synthetic nucleic acids, these have almost exclusively concerned their binding to naked DNA. In contrast, cellular DNA 1s packed into chromatm, generating higher order structures, which may alter the local DNA conformation and/or mask potenttal bindmg sites. This chapter describes the preparation of nucleosome particles contammg radlolabeled DNA fragments that can be used as substrates for footprmtmg experiments.
1.1. Nucleosomes The first level of orgamzatlon of cellular DNA involves the formation of nucleosomes. Each nucleosome contains about 145 bp of DNA that ISwrapped 1 8 times around a htstone octamer, containing two each of htstones H2A, H2B, H3, and H4. Although nucleosomes are associated with many different DNA sequences, there IS constderable evtdence that they adopt well-defined postttons on DNA sequences both m vivo and in vitro (I-5). The packaging of DNA around nucleosomes may be an important factor m gene acttvatton or repression (6). This posittonmg can be considered at two dtfferent levels: translational posmonmg and rotational positionmg. There has been considerable progress in the understanding of the latter, which depends on DNA amsotroprc bendability. Since the double helix must bend as it wraps around the protein, sequencesthat facilitate bending have been implicated m directing nucleosome formatton. In general, GC-rich regions are positioned with their wider than average minor grooves facing away from the protein core, whereas the narrow minor grooves of AT-sequences face towards the protein (1,3). Certain repetitive sequences,as well as double-stranded RNA, will not wrap around nucleoFrom
Methods
III Molecular
Edlted
by
Ebology, Vol 90 Drug-DNA
K R Fox
Humana
Press
Inferacbon
Inc , Totowa,
NJ
frofocols
82
Brown and Fox
somes (71, although recent studies have shown that long blocks of A,, * T, may not be excluded (8,9) Within each DNA fragment it is not possible to satisfy all the local preferences; sequences at the center of each nucleosome have a greater effect on rotational positioning than those toward the ends (10). The hehcal repeat of DNA also varies along the nucleosome from about 10.0 bp per turn at the ends to 10.7 at the dyad, compared with a value of 10.5 for DNA free m solution (5). Much less IS known about the factors mfluencmg translational positioning, but thts too is thought to be determmed by sequence dependent amsotroptc bendmg (II). Those sequences that are harder to bend are more likely to be excluded from the nucleosome
1.2, Interaction of Ligands with Nucleosome-Bound
DNA
Since DNA positioning is determined by its structure and flexibility, one might expect that hgands that distort the DNA hehx will alter the way m which it interacts with the nucleosome, or conversely that the protem core will affect ligand bmding One can imagine several ways in which the nucleosome might modulate the bindmg of hgands to DNA. At the simplest level, tt would not be expected that binding sites that face toward the core should be excluded from drug binding. Ligands that affect DNA bending may also alter the way m which it interacts with the protein. Intercalators that alter DNA persistence length and helical repeat are likely to affect positionmg. Since nucleosome-bound DNA is positioned so that narrow minor grooves tend to face toward the histone core, the best binding sites for hgands like dtstamycin will be maccessible. There have been few studies on the Interaction of ligands with nucleosome-bound DNA (22-26); many of these origmated from Waring’s group m the mid- 1980s. These studtes showed that echmomycm and the minor groove binding hgands alter DNase I cleavage patterns in a manner consistent with the DNA having rotated by 180” on the protein surface. However, this suggestion could not be confirmed wtth hydroxyl radical footprintmg (16). In these studies, although the drugs caused clear changes m the DNase I digestion patterns, no simple footprmts were evident, suggesting that they were occurrmg at low levels of occupancy. In contrast, actinomycm merely binds to accessible sites at low concentrations and displaces the DNA from the histone core at higher concentrations (23). Mithramycin also binds to nucleosomal DNA, but the exact location of the sites is modified by the interaction with the protein (16). Whatever the mterpretation of these results, it is clear that these hgands do not bind to nucleosomal DNA m the same fashion as naked DNA. Another recent example of hgand binding affecting nucleosome structure is that triple helix formation excludes nucleosome assembly and causes a rearrangement of DNA on the nucleosome (17).
83
Foo tpnnting Studres 2. Materials 2.1. Solutions for Nucleosome Preparation All the following solutions should be stored at 4°C.
1 Buffer A 15 mM potassium cacodylate, 60 mM potassium chloride, 15 mA4 sodmm chloride, 0 5 Wspermldme, 0.15 mM spermine, pH 6 0 This buffer can be made as a 10X stock soluhon and diluted to workmg concentrations as required for preparing solutions 1 and 2 2 Solution 1 Buffer A containing 0.34 Msucrose, 0 2 mMPMSF, 1 mn/ibenzamldme, 15 mM P-mercaptoethanol, pH 6.0. Four liters of this solution ~111be needed for each nucleosome preparation PMSF, benzamldme, and P-mercaptoethanol should be added immediately before use.
3 Solution 2. Buffer A containing 0.34 M sucrose,0 2 mM PMSF, and 15 mM P-mercaptoethanol, pH 6 0 One liter of this solution will be required As for solution 1, PMSF and P-mercaptoethanol should be added nnmedlately before use 4. Solution 3 10 mMTns-HCl, pH 8 0, containing 0 2 mM EDTA, 0 2 mM PMSF This solution ISused to lyse the nuclear envelope; no more than 500 mL needs to be prepared 5 Solution 4 20 mA4 sodmm cacodylate, pH 6 0, containing 0 63 M sodium chlorrde, 0.2 WPMSF, and 1 0 mMEDTA This solution IS used as a column buffer for nucleosome purification; 8-10 L should be prepared
2.2. Solutions
for Nucleosome
Reconsthtion
1 20 mhrPTns-HCl, pH 7.4, contamrng 1 mMEDTA This 1sused for dlssolvmg the radlolabeled DNA 2 30 mM Tris-HCl, pH 8 0, containing 4.5 M NaCl and 1 mA4 EDTA. 3 5 n-J4 PMSF (Phenyl methyl sulfony fluoride) 4 5 mM Tris-HCl, pH 8.0, containmg 1 mM EDTA and 0.1% Nomdet P40
2.3. Buffers for DNase I Digestion 1. 10 mMTns-HCl, pH 7.5, containing 100 mMNaC1, for preparing drug solutions. 2. DNase I buffer. 20 n& NaCl, 2 mM MgCl,, 2 mMMnC1,.
2.4. Solutions for Hydroxyl Radical Cleavage This should be prepared immediately before use m ultrapure water. 1. 0.2 mMEDTA 2. 0.2 tr& Ferrous ammonium sulfate. 3. 10 mM Ascorbic acid.
4. 0.1% Hydrogen peroxide. 2.5. DNase I Type IV enzyme,from bovine pancreas(Sigma, St. LOUIS,MO). This should be dissolved in 0.15 mMNaC1, at a concentrationof 7200 Kumtz units mI-‘. This can be stored at -2O”C, and ISstable to frequent freezing and thawing (seeChapter 1).
Brown and Fox
84
2.6. Reagents
for Electrophoresis
1 TBE electrophoresis buffer This should be made as a 5X stock soluhon contammg 108 g Tns, 55 g boric acid, and 9 4 g EDTA made up to 2 L with water 2 Gel loading buffer Formamide contammg 10 mM EDTA and 0 1% (w/v) bromophenol blue 3. Methods
3.1. Nucleosome
Preparation
Nucleosomes are prepared from chicken red blood cells by a method modified from Lutter (18) and Drew and Travers (1,19). All steps should be performed at 4OC unless stated otherwise. Approximately 50 mL of fresh chlckens blood 1s required This can usually be collected form a local abattou- and must be immediately mixed with l/7 vol of 84 mM sodium citrate pH 7.0 to prevent coagulation (see Note 4). 1 Dilute the blood to 500 mL with solution 1 2 Centrifuge the resulting mixture at 5008 (1 e., 2000 rpm m a Beckman JA20 rotor) for 3 mm and discard the supernatant. 3 Resuspend the pellet in a further 500 mL of solution 1, 4 This should be repeated three times. The supernatant will become clear with successive washes White blood cells form a thm layer on top of the red blood cells, and may be removed with a pipet 5 Two liters of solution 1 should now be adjusted to 0 1 % v/v Nomdet P40 and the pH then be adjusted from 6 0 to 7 5 with Trrs base 6 The pellet 1s resuspended m 500 mL of this solution, which will lyse the cell walls releasmg the cell nuclei Centrifuge at 1OOOg(I e ,300O rpm m a Beckman JA20 rotor) for 3 mm and discard the supernatant 7 Repeat this step a further three times to wash the nuclei The pellet should become white and contains the cell nuclei 8. The washed nuclei should be resuspended m solution 2 and centrifuged at 1OOOg (3000 rpm) for 3 min. Again the supernatant should be discarded 9. Resuspend the pellet m 100 mL of the same buffer, after adjustmg the pH to 7 5 using Trls base. Any material that does not dissolve should be broken Into smaller pieces by gentle pipetting The DNA concentration of the solution can be determined from the absorbance at 260 nm, measured in 0.1 M sodium hydroxide. The absorbance should then be adjusted to 50 U/mL of nuclei, correspondmg to about 5 mg/mL protem plus DNA. It is found that, with fresh chicken blood, the absorbance 1s usually close to this value and no adjustment is necessary. The next stage 1s mlcrococcal nuclease digestion. This 1s performed to release the DNA from the nuclear cell wall, so that when the nuclei are lysed
Footpnntmg Studies
85
the chromatm can be separated from the nuclear envelope. A trial digest (steps 10-11) should be performed to estimate the correct digestlon time (see Note 2). 10 One mllllllter of the mixture should be adjustedto 1 mA4calcium chloride and incubated at 37°C for 3 mm Micrococcal nuclease IS then added to a concentration of 40 U/mL Samples should be removed after digestion for O-20 mm. Digestion is stopped by adjusting the solution to 2 mA4 EDTA. 11 Centrifuge the samples at 3000g (5000 rpm) for 10 mm The supernatant is discarded and each of the pellets IS resuspended m solution 3 The pH must be kept above 7 5 to ensure that the chromatin stays m solution The solution should be kept on ice for at least 30 mm, shaking gently as required to bring the chromatic back into solution. The very low salt concentration m this step lyses the nuclear membrane, and thereby releases the dlgested material mto solution.
The absorbance of these solutions should be measured at 260 nm to determine the DNA content. After lys~sfor 30 min the solutions are again centrifuged for 10 min at 3000g (5000 rpm). An appropriate level of digestion should release 7040% of the total absorbance into the supernatant. 12 This process should now be repeated for the whole of the nuclei solution obtained m step 7, using the dlgestlon time obtained from steps 8 and 9 The supernatant should now contam about 300 mg of soluble chromatin
It should be noted that the activity of micrococcal nuclease 1sexpressed in two kmds of units, based either on prnoles of DNA released (Sigma, St. LOUIS, MO) or on the absorbance of DNA released (Boehrmger, Mannhelm). All concentrations of the enzyme hsted above are m units of absorbance released; to convert from units of pmoles to units of absorbance, multiply by 85. 13. The total volume of the supernatant should now be measured accurately and transferred to a flask at 4°C 4 M sodium chloride should now be added, dropwlse whrle strrring, so as to achieve a final concentration of exactly 0 65 M. The solutlon of chromatin should start clear, turn cloudy, and then go clear again as more salt 1s added. This step ensures the quantltatlve release of histones Hl and H5 from the chromosomal fiber. The solution now contams Hl/H5 stripped long chromatm, together with free histones Hl and H5. 14 The solution, which contams a mixture of Hl stripped chromatm, hlstone pro-
teins Hl and H5 and somefree DNA, 1snow applied to a column of Sepharose 6B (2.5 x 100 cm) that has been equlhbrated m solution 4 Hl stripped chromatm will elute after about 68 h (see Note 3). The absorbance of all column fractions need to be measured. A plot of absorbance versus fraction number should show two peaks; the first peak contams the HI stripped chromatm, whereas the second contams linker DNA and histone proteins Hl and H5. Small ahquots of representative fractions can be applied to a protein gel, contammg 18% acrylamlde and 0 1% SDS, to look for the presence of histones HI and H5 (see Note 1)
Brown and Fox
86
15. The fractions containing Hl stripped chromatm but not hrstonesH 1 and H5, are combmed mto a smgle volume and concentrated to 8 mg/mL by ultrafiltratton usmg a PM10 membrane If the nucleosome cores are to be stored m 50% glyc-
erol they should be further concentratedto 16mg/mL. Proteins H2A, H2B, H3, and H4 should be checked for proteolysrs after ultrafiltration, on an 18% polyacrylamrde gel. The total yield of this H 1-stripped chromatin IS typically about 80 mg protein Thus can be stored at 4°C for l-2 mo, or at -20°C for 3-6 mo m 50% glycerol, 1.0 mM benzamrdme. Some workers digest thusmaterial further with mrcrococcal nuclease,releasmg mononucleosomes, and requiring further column purrficatron (1,20). However, it 1sfound that thusis not necessaryfor preparing nucleosomesreconstituted with short (<200 bp) fragments. 3.2. Reconstitution with Radiolabeled
of Nucleosomes DNA Fragments
Radrolabeled DNA fragments can be prepared as described in Chapter 1. For proper reconstitutron these fragments should be about 140 bp long. However, It is found that shorter fragments (as short as 70 bp) can also be reconstrtuted onto nucleosome, though it ISnot certam how their structure compares to that of fulllength fragments, which are completely wrapped around the protein core. Radtoactrvely labeled DNA fragments can be reconstttuted onto nucleosome cores by a salt exchange method as previously described (2,2). In this procedure a suitable amount of radrolabeled DNA IS incubated with a large molar excess of Hl stripped chromatm or nucleosome cores m a high salt buffer. Under these conditions the DNA 1s m free exchange wtth the protein cores. Since the radiolabeled DNA represents only a tmy fraction of the total DNA, the vast majority of this ~111be bound by the protein. Although the unlabeled chicken DNA in the H 1-stripped chromatin is relatively long, containing several nucleosomes per DNA strand, the radioactive DNA will be released as mononucleosomes as Illustrated m Fig. lA,B. 1. Approximately 2000 cps of labeled DNA should be dissolved m 12 yL of 20 mM Tris-HCl, pH 7.4, containing 1 mA4 EDTA To ensure that all the DNA 1s m solution, and not attached to the walls of the tube, the DNA solution should be transferred to a fresh Eppendorf tube 2 60 pL of 30 mM Trts-HCl, pH 8.0, contammg 4 5 M NaCl and 1 mA4 EDTA IS mixed with 15 pL of 5 mMPMSF 8 yL of the resulting solutton IS then added to the labeled DNA and thoroughly mixed. 3 18 pL of stock HI-strtpped chromatin IS then added to the labeled DNA, m the htgh salt buffer and incubated at 37’C for at least 20 mm. Thts ensures that the radtolabeled DNA becomes mcorporated onto the nucleosome core parttcles The vast excess of nucleosome cores present compared to the added DNA moves the equtlibrmm so that vntually all the radtolabeled DNA IS nucleosome bound,
87
FNNN
C
l a* l
Fig. 1. (A,B) Reconstttutron of radiolabeled DNA onto nucleosome core partrcles. (A) shows the mrxture of the Hl-stripped chromatin and a short radlolabeled DNA fragment (shown m black), before salt exchange (B) After salt exchange The central histone octamer has dtssoclated from the HI-stripped chromattc, and has bound the short radiolabeled DNA fragment Smce the chromatin IS present in vast excess over the added DNA, virtually all the radlolabel will be bound on Isolated nucleosome core particles. (C) Agarose gel electrophoresis of free and nucleosome bound tyrT DNA. The nucleosome-bound DNA (N) has a lower mobrhty than the free (F)
4. The salt concentration should now be slowly lowered to 100 mA4 This ~111seal the DNA onto the nucleosome cores Thus IS achieved by slow, stepwlse addmon of 5 mMTns-HCl, pH 8 0, containing 1 mMEDTA and 0.1% Norudet P40; 4 additions of 10 uL and then 11 addmons of 20 uL leaving approx 5 mm between each addition
88
Brown and Fox
5. The integrity of the reconstituted nucleosomes can be checked by agarose gel electrophorests (see Fig. 1C). It can be seen that the reconstituted DNA has a lower gel moblhty than the free DNA, and that most (~95%) of the radroactivity is associated with this retarded species. However, tt should be remembered that this does not necessarily prove that the DNA has been properly reconstituted, but merely demonstrates a stable interaction between the DNA andprotem
This stock solutton of reconstttuted nucleosome core parttcles, which can be used as a substrate for DNase I digestion, should be stored at 4°C. It 1sfound that tt can usually be kept for about 1 wk before sigmficant degradation is apparent. 3.3. DNase I Digestion DNase I (Stgma D5025) 1sstored at -20°C at a concentration of 7200 U/mL. Thts ts diluted to an appropriate concentration in a solutton containing 20 mM NaCl, 2 mA4 MgQ, and 2 mM MnCl*, mrmedtately before use 1. Approxtmately 10 I.IL of reconstituted DNA is taken for each digestion This volume may be varied depending on how radioacttve the DNA 1s. approx 50 cps (on a hand held Geiger counter) are required for each digestion 2. Drug soluttons (typically 1O-20 pL), m 10 mM Trts-HCl, pH 7 5, contammg 100 mA4 NaCl, are then added to the reconstituted nucleosomes, and left to equthbrate for an appropriate time 3. DNase I is added at an appropriate concentration and digestion allowed to continue for 1 mm The exact amount of DNase I required to generate sufficient cleavage, whereas mamtammg single-hit kmetlcs will need to be determined from trial runs; 4 yL of 15 U/mL is typically appropriate 4. Digestton 1sstopped by adding 100 pL of phenol, after which the aqueous phase is increased to 100 ~.IL. This is extracted twtce with 100 pL phenol, followed by two extractions with 100 pL ether to remove any residual phenol The last traces of ether are removed by leaving at 37°C for a few minutes with the cap open. The DNA is then precipttated by adding l/9 vol of 3 M sodium acetate and 3 vol of ethanol After centrifugatron the pellet is washed twice with 70% ethanol, dried, and redissolved m a small volume of 80% formamide containmg 10 mM EDTA, 1 mMNaOH, and 0 1% bromophenol blue.
3.4. Hydroxyl Radical Cleavage Although DNase I 1s the most commonly used footprmtmg probe, on account of tts cost and ease of use, the dtgestton patterns are uneven and often dtfftcult to interpret. In contrast, hydroxyl radicals produce an even cleavage pattern with free DNA (20-22) and generate a clear 10 bp modulation m DNA fragments that have been complexed with nucleosome core particles (5,22,23).
Foo tprin ting Studies
89
The solutions for hydroxyl radical cleavage should be prepared immediately before use. 1 The reconstituted DNA-drug nuxtures should be prepared as n-r steps 1 and 2, Subheading 3.3. 2 Prepare the hydroxyl radtcal mixture immediately before use by mixing 0 2 mM ferrous ammomum sulphate, 0.2 n-J4 EDTA, 10 ITIM L-ascorbic acid, and 0.1% hydrogen peroxide m a ratio of 1 1.2 2, respectively 3 40 pL of thts mixture should lmmedtately be added to each of the reconstituted DNA-drug mixtures 4. Digestion 1sallowed to contmue for an appropriate length of time (about 8 mm) before stoppmg the reactron by adding 100 uL phenol The samples should then be prepared for electrophorests as m step 4 of Subheading 3.3. 5. If the HI stripped chromatin has been stored n-r 50% glycerol, then the concentration of each of the components m the hydroxyl radical mtx will need to be increased by about fivefold, since glycerol mhtblts thts free radical reactton. 3.5. Gel Electrophoresis
The samples are heated at 1OOOCfor 3 mm before loadmg onto a denaturmg polyacrylamide gel (610% depending on the length of the DNA fragment) contammg 8 A4urea. The samples can be loaded directly from the 100°C bath, or rapidly cooled by placing on ice. Forty-centimeter gels are run at 1500 V for about 2 h, after the gels are fixed m 10% (v/v) acetic acid, transferred to Whatmann 3MM paper, dried under vacuum at 80°C, and subjected to autoradiography at -7OOC with an mtensifymg screen. One to two days of exposure is usually sufficient. 3.6. A Worked Example Figure 2 shows DNase I and hydroxyl radical digestion of the tyrT DNA fragment when free and associated with nucleosome cores, m the presence of varying concentrations of the AT-selective antibiotic distamycm (12) The sequence of this DNA fragment is presented in Chapter 1, and has been widely used as a substrate for footprmtmg studies. The first panel of Fig. 2 shows DNase I digestion of tyrT DNA in the absence and presence of distamycm at 5, 10, and 25 $4 as indicated. As previously explained, the digestion pattern in the control lane 1s not even, particularly between bases 26-32 and 42-50, which are regions contammg blocks of A,, + T,. In addition, mdividual bonds are cut stronger than the surrounding regions (i.e., 38, 41, 69, and 90). In the presence of distamycm, clear protections can be seen at positions 26-32, 43-50, 56-68, 78-89, and around regions 110 and 125 compared to the control lane. All these are located m
Brown and Fox DNase I
hydroxyl radicals
Fig. 2. DNase I and hydroxyl radical footprinting of distamycin on free and nucleosome-boundtyrT DNA. Tracks labeled “GA” are Maxam-Gilbert formic acid-piperidine marker lanes specific for guanineand adenine.“con” indicates control digestion of the DNA in the absenceof addedligand. The concentrationof distamycin (ClM)is shownat the top of eachgel lane. The numbersrefer to the sequenceof the fragment in previous publications (1,12,14-1/j).
AT-rich regions. The second panel shows DNase I digestion of the DNA fragment when associated with nucleosome cores. Comparing the control lane with that of the free DNA it can be seen that the digestion pattern is modified by interaction with the nucleosomecore particles. The strong cleavage products are now spacedapprox 10 bp apart and can be seen at positions 4 1, 6 1, 7 1, 92, 102, and 112. The regions, which are accessible to DNase I,
91
Fig. 3 Densitometer scan of the hydroxyl radical cleavage pattern of vrT DNA reconstituted onto nucleosome core particles shown In Fig. 2.
must correspond to posttrons where the minor groove faces away from the protein surface. When distamycm 1s added to thts reconstituted DNA the cleavage pattern changes. However, this pattern does not reveal footprmts at the distamycm-bmdmg sites, but rather contams new bands that are not evrdent m the drug-free controls (see around positions 66,56,85, and 95). These new cleavage products are located approximately midway between the cleavage maxima observed for the core DNA, and have been interpreted as suggesting that distamycm has caused some of the DNA molecules to rotate by 180’ on the protein surface, so that regions that were facmg towards the protein core are now turned outwards and vice versa The thn-d and fourth panels show similar experiments usmg hydroxyl radicals as the DNA cleavage agents. The control pattern m the free DNA shows an even cleavage pattern as expected for this small cleavage agent. In the presence of distamycin clear footprmts can be seen around posttions 28-3 1,37-39,46-48,5 l-54,58-6 1,65-67, and 80-82, each of which 1sm an AT-rich region. When the DNA 1s wrapped around the nucleosomes the cleavage is attenuated and reveals a phasic pattern. The strongest bands are located at posttrons 2 1, 3 1, 40, 52, 62, and 72, which are approx 10 bp apart. This is more clearly seen in the densitometer traces presented m Fig. 3. These bands correspond to the positions of strongest DNase I cleavage, and confirm the rotational positionmg of the DNA. However, m contrast to the results wtth DNase I the cleavage pattern 1s hardly affected by addition of dlstamycm No
92
Brown and Fox
drug-mduced footprints are evident and the phased cleavage pattern 1s unaffected, suggested that the rotational posmonmg of the DNA is not altered by the antrbiotic. These results with DNase I and hydroxyl radicals are at variance and require more detailed investigation. 4. Notes 1 One problem that has been encountered IS mtcrococcal nuclease contammatton of the final nucleosome cores. The contammatton can only occur from the chromatography column fraction The presence of the micrococcal nuclease m the stock nucleosomes IS evident by the observatton of the DNA of Interest bemg dtgested before It has been exposed to DNase 1 Thts contammatton can be lowered by taking a smaller fractton range when the nucleosomes elute from the column. Mtcrococcal nuclease seems to elute wtth htstones HI and H5, therefore, these fractions should be discarded 2 The trtal mtcrococcal nuclease digestion does not always produce conststent results On average tt IS found that 5 mm dtgestton 1ssuffictent. 3 After repeated use the Sepharose column can become blocked, grvmg a very slow flow rate. This can be avorded by continuing to wash the column for 2-3 d with solutton 4 after elatmg the nucleosomes The sepharose can also be washed wtth 8 M urea The urea concentratton IS then gradually reduced by allowing the sepharose to settle and replacmg the buffer with lower concentrattons of urea. 4. Chicken blood can be stored frozen for further nucleosome preparations. However, it is found that the yield of nucleosomes from frozen blood 1s stgmficantly lower than from fresh blood
Acknowledgments Work m the authors’ laboratory 1sfunded by the Cancer Research Campatgn and the Medical Research Council. References 1. Drew, H. R. and Travers, A. A (1985) DNA bending and its relation to nucleosome posmonmg. J Mol BloE 186,773-790 2. Ramsey, N (1986) Deletron analysis of a DNA sequence that posmons itself precisely on the nucleosome core. J Mol Bzol 189, 179-188. 3 Satchwell, S C , Drew, H. R., and Travers, A A. (1986) Sequence pertodtcmes m chicken nucleosome core DNA J Mol Biol. 191,65!%575 4. Pennmgs, S., Muyldermans, S , Meersseman, G., and Wyns, L. (1989) Formatton, stabthty and core htstone posltlonmg of nucleosomes reassembled on bent and other nucleosome-derived DNA J Mol Bzol 207, 183-l 92 5. Hayes, J J., Tullms, T. D , and Wolffe, A P. (1990) The structure of DNA m a nucleosome Proc Nat1 Acad Scr USA 87,7405-7409. 6 Wolffe, A. P (1994) Nucleosome postttomng and modtfication. chromatin structures that potentlate transcription. Trends Biochem. Scz. 19,240-244
Footprin ting Studies
93
7 Kunkel, G. R. and Martmson, H. G. (1981) Nucleosomes will not form on doublestranded RNA or over polydA. polydT tracts in recombinant DNAs. Nuclezc AC&Y Res. 9,685%6888 8 Puhl, H L , Gudtbande, S R , and Behe, M J (1991) Poly[d(A T)] and other synthetic polydeoxynucleotrdes containing oligoadenosme tracts form nucleosomes easily J Mel Biol 222, 1149-l 160 9 Fox, K. R. (1992) Wrapping of genomic polydA polydT around nucleosome core particles. Nuclezc Acids Res. 20, 1235-1242 10 Shrader, T E. and Crothers, D. M (1989) Artificial nucleosome posmonmg Proc Natl. Acad SCL USA 86,7418-7422. 11 Sivolob, A. V. and Khrapunov, S N (1995) Translattonal positioning nucleosomes on DNA: the role of sequence dependent isotropic DNA bending stiffness J Mol Bzol 247,9 18-93 1 12 Low, C. M L., Drew, H R , and Waring, M. J. (1986) Echmomycm and dtstamycin induce rotation of nucleosome core DNA Nucleic Acids Res 14, 67856801. 13 Portugal, J. and Waring, M J (1986) Antibiotics which can alter the rotattonal orientation of nucleosome core DNA. Nuclecc Aczds Res 14, 8735-8754. 14. Portugal, J. and Waring, M. J (1987) Interaction of nucleosome core particles with distamycm and echmomycm; analysis of the effect of DNA sequences. Nucleic Aczds Res 15,885-903 15 Portugal, J. and Waring, M J (1987) Analysts of the effects of antibiottcs on the structure of nucleosome core particles determined by DNAase I cleavage. Biochimle 69,825-840 16. Fox, K R. and Cons, B M G (1993) Interaction of mithramycm with DNA fragments complexed with nucleosome core particles. comparison with dtstamycm and echmomycm. Blochemrstry 32,7 162-7 17 1 17 Westm, L., Blomquist, P., Milhgan, J F , and Wrange, 0 (1995) Triple helix DNA alters nucleosomal histone-DNA mteractions and acts as a nucleosome barrier. Nucleic Acids Res 23,2 184-2 19 1 18. Lutter, L. (1978) Kmettc analysts of deoxyribonuclease cleavages in the nucleosome core: Evidence for a DNA superhelix J. MoZ Bzol 124,391-420. 19 Drew, H R. and Calladme, C. R (1987) Sequence-specific positioning of core histones on an 860 base pair DNA: experiment and theory. J Mel Bzol 195,143-l 73, 20 Tullms, T D (1987) Chemical ‘snapshots’ of DNA using the hydroxyl radical to study the structure of DNA and DNA-protein complexes Trends Bzochem Scz 12,297-300.
21. Tulltus, T. D., Dombroski, B A., Churchtll, M E. A., and Kam, L (1987) Hydroxyl radical footprmtmg; A high resolution method for mappmg proteinDNA contacts. Methods Enzymol 155, 537-558. 22. Tullms, T. D. (1988) DNA footprmtmg with hydroxyl radical Nature 332, 663,664. 23 Tullms, T and Dombroski, B. A. (1985) Iron(II)EDTA used to measure the hehcal twist along any DNA molecule. Science 230, 679-68 1
A Gel Mobility Shift Assay for Probing the Effect of Drug-DNA Adducts on DNA-Binding Proteins Suzanne M. Cutts, Andrew Masta, Con Panousis, Peter G. Parsons, Richard A. Sturm, and Don R. Phillips 1. Introduction Desprte the widespread use of chemotherapeutic drugs m the treatment of various malignancies, m many casesthe mechamsm of tumor cell kill remains unknown There IS, however, much evidence that suggests that DNA IS the major cellular target for many of the agents in current clmical use. A number of physicochemical techmques are available to probe the reversrble and nonreversible interactrons of these drugs with DNA, and a wealth of information regarding the sequence specificity of these mteractrons has been documented usmg these procedures, as well as molecular-biology-based techniques such as DNA and RNA footprinting (1,2). These studies have also revealed that bindmg of these compounds to DNA can interfere with various aspects of DNA replrcatron, transcriptron, and translation. Since these intricate processesinvolve regulatory proteins and cofactors, another approach to characterizing drugDNA interactions is to ascertain the ability of DNA bmdmg proteins to recognize then drug-modified DNA consensus sequences (3-6). This approach is partrcularly relevant because such 5’untranslated regions are unwound when assembled on the nuclear matrix and thus accessrble to drugs during active gene transcription in cells (740). The sequence selectivity of the drug will therefore determine which DNA-binding proteins are affected, thus leading to a broad predictive index of which genes are more likely to be affected, and perhaps, more importantly, being able to identify the critrcal stageof gene expression at which these agents may be most active. Gel mobility shift assays are widely used in the analyses of nucleic acidprotein interactions and are based on the fact that most DNA-binding proteins From
Methods
m Molecular
Edlted
by
Bfology,
K R Fox
Vol 90. Drug-DNA
Humana
95
Press
Interact/on
Inc , Totowa,
NJ
Protocols
Cut& et al.
96
bind to a defined sequencewtthm DNA {11,12) These techniques can be readily adapted for use with drug-modified DNA substrates, and rely on the ability of
a drug to induce a structural perturbation to the DNA helix or Induce a DNA modification that modulates the DNA-protein mteractron (either rendering the site unrecognizable to DNA-binding proteins, or in some caseseven enhancing the interaction). These types of systems also have the additional advantage that the gentle techmques employed ensure that the integrity of the drug-DNA
mteractton is mamtamed, and this is extremely useful for short-lived or unstable DNA adducts. Two gel shift systems are presented here-the
octamer-binding
proteins,
which recognize the discrete DNA sequenceATGCAAAT, facilitated by bmdmg of then POU domains to the DNA sequence (13); and Escherzchza co/z RNA polymerase, which binds to a 70-bp sequence of the luc UV.5 promoter (14). These examples represent model systems for the use of the gel moblltty shift assay in studymg DNA-protein interactions (25,16). For a comprehensive study of any given drug, It would be necessary to probe then effect on a range of transcription factor assay systems (see ref. 17 for the options available) to ascertain which DNA sequences and transcrrption factors are most affected An example is shown m Fig. 1 of the effect of drug-induced adducts on the
bmdmg of transcription factors to their recognition sequences,where Adriamycm induced adducts at GpC sequencesmhtbtt the bmdmg of the transcrrptron factors (18). In Fig. 2, Adriamycin-induced
adducts also inhibit
the binding
of E. coli
RNA polymerase to the luc promoter sequences (I&, whereas this interactions is enhanced by sulfur mustard (19).
2. Materials 1. Phosphate-buffered saline (PBS) 2 A2058 cells (American Type Culture Collection, Rockvllle, MD). Prepare lo7 cells m 10 mL PBS (see Note 1) 3 Nonidet P-40 (Sigma, St Louis, MO) made as a 10% solution in Type I reagent water (see Note 2) 4. Buffer A: 10 mMHEPES, pH 7.9,lO &KC&O 1 nu’r4 EDTA, 0 1 mA4EGTA, 0.5 mA4 PMSF (Sigma), 1 mM DTT (Blo-Rad, Hercules, CA), 1 pg/mL aprotmm, 0.5 pg/mL leupeptm, 0 7 yg/mL pepstatm A, 40 pg/mL bestatin (all protease inhibitors are obtained m solid form from Sigma) (see Note 3). 5. Buffer B: 20 mMHEPES, pH 7.9,0.4 MNaCl, 1 mMEDTA, 1 mMEGTA, 1 mM PMSF, 1 mA4DTT, 1 pg/mL aprotinin, 0.5 ug/mL leupeptm, 0 7 pg/mL pepstatm A, 40 ug/mL bestatm (see Note 3). 6 Bradford protein assay kit (Bio-Rad). 7. Wildtype octamer consensus sequence, contained in the plasmid pUC 119H2Bbox+ (see Notes 4 and 5). 8 Lac UV5 promoter, contained in the plasmid pCC 1 (see Note 6).
Drug-DNA Adducts
97
A 0 6
8 24 48 72 96
I
N-Ott-3
free probe
40
60
60
100
Time (h)
Fig. 1. Inhibition of octamerprotein binding as a function of Adriamycin reaction time (18). The H2B probe was reactedfor O-96 h with 10 yM Adriamycin and 20 @4 FeCI, before exposureto the A2058 nuclearextract.Electrophoreticallyretardedbands denoteprote&DNA complexesdueto binding of Ott- I, N-Ott-3, andN-Ott-5 proteins that are present in the nuclear extract (A). Band intensities were quantitated on a Molecular Dynamics Model 400B PhosphorImager,as a percentageof the total band intensity (end-labeled probe) in each lane. The single exponential decay of Ott-1, N-Ott-3, and N-Ott-5 binding is shown in (B).
98
Cut& et al.
F C.5 15102050
F RNA polymerase
Freeprobe
0 0
I
,
30
60
I
90
120
Mustard alkylation time(min)
9. 10. 11. 12. 13. 14. 15. 16.
Agarose(DNase/RNasefree) (Kodak, New Haven, CT). EcoRl, HindIII, andPvuI1restrictionenzymes(New EnglandBiolabs,Beverly,MA). Biotrap DNA elution apparatus(Schleicher& Schuell, Germany). Phenol (IBI, Irvine, CA) molecular biology certified and saturatedwith 0.5 A4 Tris buffer, pH 8.0. 3 A4Sodium acetatesolution. Glycogen (Boehringer Mannheim, Mannheim, Germany). 1X TBE (Tris-borate-EDTA) buffer: 89 mA4Tris, 89 mM boric acid, and 2 rm!4 EDTA, pH 7.5. Store at 20°C as a 10X stock solution. TE buffer: 10 mMTris-HCl, pH 8.0, and 1 WEDTA.
Drug-DNA
Adducts
99
0
10
20
Adrlamycln
30
40
50
(FM)
Fig 2. (A) (opposztepage) Enhancement of the E. co11 RNA polymerase-DNA complex with increasing sulphur mustard alkylation time (19). Sulfur mustard (100 IIJW) was reacted with the labeled I88-bp fragment from 0 to 120 mm at 37°C prior to the formation of the RNA polymerase-promoter DNA complex Quantitation of the increase of these complexes with drug reaction time is shown m (C) (B) Inhibition of binding of E coli RNA polymerase to the lac UV5 promoter with increasing Adriamycm concentration (18). The 188-bp fragment was reacted with 0 5-50 yMAdriamycin m the presence of 40 w FeC13 prior to the addition of RNA polymerase. Quantitation of the loss of the transcription complex is shown in (D) as a functton of concentratton 17 Acrylamide and his-acrylamide made up to a 30% stock solution (29: 1) (electrophorests purity reagents, Bto-Rad) 18. TEMED, electrophoresis purity reagent (Bio-Rad). 19. Ammonium persulfate, electrophoresis purity reagent (Bio-Rad). 20. 2X Transcription buffer: 80 mM Tris-HCl, pH 8.0, 200 mM KCl, 6 mM MgCl,, 0.2 mM EDTA Store at 4°C 2 1. E colz RNA polymerase (Nuclease free, 7 U/yL) (Pharmacta, Uppsala, Sweden). 22 2 mg/mL Heparm (Sigma). Store at -2O’C 23. [cx-~‘P] dATP (3000 Wmmol, Amersham, UK). 24. Deoxynucleottde triphosphate mix containmg 7 nul4 of each of dATP, dCTP, dGTP, and dTTP (see Note 7). Individual nucleotides can be obtained as lOO-rnA4 stock soluttons from Pharmacia. 25. Klenow fragment, 5 U/pL (New England Biolabs). 26. BSA, 3 mg/mL (Pharmacia). 27. Acetylated BSA, 10 mg/mL (New England Biolabs) 28. DTT (electrophorests purity reagent, Bto-Rad). Make as a 200-W stock solution and store ahquots at -20°C (see Note 8). 29. Nensorb-20 Nucleic Acid Punficatron Cartridges (DuPont NEN, Boston, MA)
Cutts et al.
100 30
31
32 33 34 35 36 37
Poly (dI-dC) * poly(dI-dC) (Pharmacta) This 1sresuspended m TE buffer to give a final DNA concentration of 1 pg/pL 10X octamer bmdmg buffer This IS comprised of 100 mMHEPES buffer (pH 7 9), 625 mA4 KCI, 40 mM MgCI,, 1 mM EDTA, 2.5 mA4 DTT, 1 mg/mL acetylated BSA (see Note 9) Linearized plasmid (see Note 10) 5X Tris-glycme buffer. 125 mM Trts-HCl, pH 8 3, and 1 25 M glycme Glycerol (Sigma) Gel loading mix, comprised of 50% glycerol and 20 mM DTT. Prepare fresh dally Acettc acid (Sigma) made as a 7% solution for fixing gels Gel dryer (e g , Bio-Rad model 583).
3. Methods 3.1. Octamer-Binding Proteins 3.1.1. Preparation of Nuclear Extracts (20) 1 Spm 1 x 10’ A2058 cells for 5 mm at 2000g 2. Resuspend cells m 10 mL of PBS and transfer I mL to each of 10 Eppendorf tubes ( lo6 cells/tube) 3 Spin for 20 s at 15,OOOg m a benchtop centrifuge 4 Remove supernatant with a syringe and resuspend gently m 400 pL of ice-cold buffer A. 5 Sit cells on ice for 5 mm to allow cells to swell. 6 Add 25 pL of 10% nomdet P-40 and vortex vtgorously for 10 s 7 Spin for 30 s at 15,OOOgto pellet nuclei (see Note 11) 8. Resuspend in 50 pL of ice cold buffer B by tapping gently on the vortexer. 9 Sit on ice on a rotating platform for 15 mm (see Note 12) 10. Spin for 5 mm at 15,000g at 4°C 11 Determine the protem content using the Bradford assay kit. There should be approx 2-4 pg protein/p1 12 Freeze the supernatant at -70°C m 20-pL ahquots, which should be thawed once only, immediately before use
3.1.2. Purification of Octamer Probes 1 Digest approx 250 pg of pUCl19H2B-box+ using 300 U of HzndIII and 300 U EcoRI m buffer supplied (New England Btolabs) for 2 h at 37’C 2. To separate the two fragments of DNA, SubJect to electrophorests m 2% agarose (see Note 13) at 10 V/cm for 1 5 h (see Note 14) 3. View the gel under UV light, and excise a small portion contammg the lOO-bp fragment. 4. Electroelute the DNA for 3 h at 120 V usmg a Btotrap elution apparatus. 5. Collect the DNA from the Biotrap chamber (see Note 15) and sublect to two extractions with an equal volume of phenol followed by one chloroform extractton.
Drug-DNA
101
Adducts
6. To ethanol precipitate the DNA, add 0.1 vol of 3 A4 sodium acetate, 2 vol of ethanol, and 1 pL glycogen (see Note 16). 7. Resuspend m 150 pL TE buffer, and determine DNA concentration spectrophotometrically (see Note 17)
3.1.3. Labeling of Octamer Probe 1. Take 10 pL of lOO-bp fragment and subject to labeling with the Klenow fragment of DNA polymerase by adding a final concentration of 1 mg/mL acetylated BSA, 10 mM DTT, 100 $1 [u-~*P] dATP, 1X Klenow buffer (see Note IS), and 1 pL Klenow fragment m a total volume of 30 pL 2 Incubate at room temperature for 20 min. 3 Add each of the four deoxynucleotides to a final concentration of 2 mM, and incubate for a further 20 min at room temperature (see Note 7). 4. Purify the labeled DNA through a Nensorb 20 cartridge (see Note 19) 5. Dry the eluted DNA under vacuum. 6 Resuspend m approx 20 pL of TE buffer
3.1.4. Octamer-Binding
Assay
1 Add together 1 pL of 10X binding mix, 2 pL of 50% glycerol, 3 pL of poly (dI-dC) * poly (dI-dC), and 2 pL MllllQ H20 (see Note 20) 2. Ahquot 8 pL of octamer binding mixture per reaction tube (see Note 20) 3. Add 2 pL nuclear extract (2-4 pg protein/pL) and Incubate for 15 min at room temperature. 4 Add 5 pL of drug reacted probe and Incubate for 15 mm at room temperature (see Notes 21-24). 5. Add 4 pL of freshly made loading buffer (see Note 25).
3.1.5. Electrophoretic
Separation of Complexes
1. Prepare a 6% nondenaturing polyacrylamide gel (approx 20 x 20 cm) in Trisglycine buffer 2. Rmse wells with loading buffer and subject to pre-electrophoresis for 30 mm. 3 Load 10 pL sample per well, and subject to electrophoresis at 10 V/cm for 3.5 h. 4. Fix gel in 7% acetic acid for 5 mm. 5 Dry the gel in a commerctal gel dryer 6 Expose to phosphorrmage screen (2-4 h) or autoradrographic film (overnight).
3.1.6. Quantitation of DNA-Protein Complexes Quantitatlon of the relative amount of DNA-protein complexescan be performed by utilizing standard autoradiography or phosphorimager processmg. Since not all laboratories have accessto a phosphorimager, both methods are outlined. 3.1.6.1. AUTORADIOGRAPHY 1. Place the dried gel in contact with Amersham Hypertilm-betamax or Kodak XAR-5 X-ray film overnight, without intensifying screens, at room temperature
Cutts et al.
102
2 Scan the autoradlogram with a densitometer 3 Sum the total area of radloactlvlty m each lane, and express the retarded bands as a percentage of the total radloactlve probe
3.1 6.2. PHOSPHORIMAGING 1. Place the dried gel m contact with the phosphor plate for 2-4 h. 2 Scan the phosphor plate with a phosphorlmager system. 3 Sum the total area of radioactivity m each lane, and express the retarded DNAprotein bands as a percentage of the total radloactlve probe
3.2. RNA Polymerase-lac UV5 Promoter Binding 3.2.1. isolation and Labeling of the 188-bp Promoter DNA 1 Digest 10 pg of pCC 1 plasmid DNA with EcoRI (10 U) and PvuII (10 U) at 37°C for 2 h m the buffer supplied (see Note 6). 2. Separate the resultant 188-bp fragment m a 1% preparative agarose gel using a mml-submarine gel apparatus at 10 V/cm for 1 h in 1 X TBE (see Notes 13 and 14). 3. Further lsolatlon and purification of the 188-bp DNA is essentially the same as described for the octamer probe (see Subheading 3.1.2.)
3.2.2. Formation of the RNA Polymerase-Promoter
Complex
1 To 5 pL of drug reacted DNA (see Note 26) m 1X transcription buffer, add 8 pL of transcription mix (see Notes 27 and 28) 2 Incubate at 37°C for 15 mm 3. Add 5 pL of heparm and incubate at 37°C for a further 5 mm (see Notes 29 and 30) 4 Add 6 pL of the loadmg buffer (see Note 31)
3.2 3. Separation of DNA-Protein
Complex
1. Load 15 pL of the RNA polymerase-promoter complex on a 5% native polyacrylamlde gel m 1X Tns-glycme buffer at room temperature 2. Subject to gel electrophoresis, fixmg and drymg as described above (Subheading 3.1.5.).
3.2.4. Quantitation of DNA-Protein
Complex
1 Obtain autoradlographlc film or phosphorlmage of the DNA and DNA-protein bands as outlined above (see Subheading 3.1.6.) 2 Quantitate the percentage of each band as outlined above (see Subheading 3.1.6.)
4. Notes 1. Nuclear extracts from A2058 cells contam Ott-1, N-Ott-3 and N-Ott-5 proteins. However, HeLa cell extracts contain only the Ott- 1 protein and can be purchased from Promega. 2 All solutions should be made up m Type I water (e.g., Mllh-Q [Mllllpore], passed through a 0.22~pm filter) m order to mmlmlze trace amounts of dlvalent metal ions, organics, or bacterlal contammatlon.
Drug-DNA
Adducts
103
3. A stock protease inhtbttor cocktail should be prepared (containing leupeptm, aprotmm, pepstatm A and bestatm) and added fresh to buffer A and B each time they are used DTT and PMSF should also be added on the day required 4 Kits for specific transcription factors mcludmg the octamer-bmdmg protems and probes are also available commerctally (e.g., from Promega), but are relatively expensive. 5 The H2B promoter fragment was ligated into pUCl19 (21) 6. A 497-bp fragment containing the lac UV5 promoter was ligated into the PvuIIl Sal1 fragment of pSP64 to yield pCC 1 (22). The 188-bp DNA fragment contammg the -123 to +65 (with respect to the +l mRNA of the Zac UV5 promoter) fragment was excised with PvuII and EcoRl The iac UV5 promoter 1salso avatlable commercially m the vector pKK338-1 (Clonetech, CA). 7 Unlabeled dNTP’s are added to reduce the possibthty of exonucleolytic removal of deoxynucleottdes from the 3’-termmus of the template 8 Because of its mstabllity m solutions, DTT tt is normally made as a 200-W stock solutron and stored at -20°C in 1-mL ahquots. 9 The 10X binding mix is stored in lOO-pL ahquots at -20°C (because of the mstabihty of BSA and DTT) and a fresh tube used for each experiment 10. pSP64 is linearized with EcoRl followed by a phenol/chloroform extraction and ethanol prectpitatlon procedure. This DNA is used to supplement the labeled DNA up to the optimum concentration required for maximum bmdmg of drug Any linear plasmrd DNA or sonicated calf thymus DNA could be used as an alternative for this purpose. 11 The supematant must be removed carefully with a syringe to eliminate all traces of detergent that could Interfere with the subsequent protein binding assay 12. This step allows gentle condmons so that the high ionic strength envtronment facilitates dtssoctatton of the transcription factors from the pellet, but leaves chromatm intact. 13. Ethidium bromide 1sincluded in the gel at a concentratton of 2 x lo-“ mg/mL. 14. Molecular-weight markers should be included to ensure that the DNA fragment 1sof the desired length. 15 After collectmg DNA from chamber, irradiate the sample and entire apparatus with UV light to check that no DNA remains associated with the agarose or membranes This technique yields almost complete recovery of DNA fragments. Mnnmize exposure time of the DNA to UV light as ethtdium bromide can induce breaks in the DNA. 16 Glycogen acts as an inert carrier of the DNA m ethanol precipitattons, thus enhancing its recovery, and allows vtsualizatton of a DNA pellet when only small amounts of DNA are precipitated. 17. The DNA concentration should be approx 50 ng/pL. 18 Klenow buffer is supplied with the DNA fragment, but can be replaced by the followmg 10X stock solution: 0.5 M Tris-HCl, pH 7.6, and 0 1 MMgCl,. 19. The labeled DNA should be eluted within the first two fractions. Subsequent fractions (<SO00 cpm) are discarded.
104
Cut& et al.
20 The bmdmg solutton 1s made in bulk to mnnmtze sample errors, then 8 pL is placed m each reaction tube 21. Drug reactions include 500 cpm of labeled DNA fragment (DNA concentratton 1s assumed to be negligible) contammg pSP64 DNA at the desired DNA concentration for the drug reaction in a Tris or HEPES-based buffer If reagents are used that could mterfere with the subsequent protein binding assay, DNA should be subjected to a cleanup procedure (e g , 2X extractions wtth an equal volume of phenol, followed by a chloroform extraction and ethanol precipitation) 22 Other control probes are routinely used for the octamer assay (22,23) to ensure that nonspecific protein bindmg ISnot occurring Probes contammg variant sequences with differing aftimties for the Ott-bmdmg proteins also serve as useful controls 23 It is also possible to apply drug after adding protein to the DNA probe to assess the abiltty of drugs to displace the protein mteractton (6) 24 If the fragment is labeled wtth GTP instead of ATP, only the HzndIII sate 1s 3’-end labeled, and it IS possible to use lambda exonuclease digestion techniques to confirm that the transcription factor consensus sequence does m fact contain drug adducts (IS). 25 It is important to omtt bromophenol blue dye from the loadmg buffer because this may interfere with protem-DNA mteractions. To monitor electrophoresrs, the dyes can be run m separate lanes on the gel 26 The degree of purification of the drug-reacted DNA vartes with the charactertstics of each drug. For example, mustard-reacted DNA 1sethanol precipttated and resuspended m 5 l.tL of 1X transcription buffer to give a DNA concentration of approx 100 nM (19) However, as Adriamycm mtercalation inhibits RNA polymerase bmdmg to the promoter, the effect of these adducts is probed after a phenol/chloroform extraction and ethanol precipitation of the 188-bp fragment (18) 27 The transcription mix consists of 1X transcription buffer, 15 mA4 DTT, 240 pg/mL BSA, and 615 nM RNA polymerase. This solution IS made fresh daily 28 The concentratton of E co11 RNA polymerase can be calculated based on a molecular weight of 460 kDa. 29. Heparm 1sused to remove nonspecific bmdmg of the E co11RNA polymerase to the DNA, mcludmg ends of linear DNA, which have a modest affinity for the polymerase. 30, The effects of drugs on the formatton of the imttation and elongatton transcrtpnon complexes can also be analyzed and this can be achieved by subsequent addition of mitiation and elongation nucleotides to the binary complex (19,24) 31 Because of the instability of the protein--DNA complex, all samples are normally analyzed on native gels immediately after formation of these complexes
References 1. Netlsen, P. E. (1990) Chemical and photochemical probing of DNA complexes J Mel Recognztion 3, l-25 2. Phillips, D. R. (1996) Transcriptional assay for probmg molecular aspects of drugDNA mteracttons, in Advances m DNA Sequence Speczfic Agents, vol. 2 (Hurley, L. H. and Chatres, J. B., eds.), JAI, Texas, pp 101-134.
Drug-DNA
Adducts
105
3. Broggmt, M. and D’Incalci, M. (1994) Modulation of transcription factor-DNA interactions by anticancer drugs. Anticancer Drug Design 9,373-387. 4. Sun, D and Hurley, L H. (1994) Bindmg of Sp 1 to the 2 1-bp repeat region of SV40 DNA: effect of mtrmsrc and drug-Induced DNA bending between GC boxes. Gene 149, 165-172 5. Welch, J J., Rausher, F, J , and Beerman, T. A (1994) Targeting DNA-binding drugs to sequence-specific transcription factor-DNA complexes J Blol Chem 269, 3 1,05 l-3 1,058. 6. Wong, S. S. C., Sturm, R A., Michel, J., Zhang, X.-M., Danoy, P A. C., McGregor, K., Jacobs, J J., Kaushal, A., Dong, Y , Dunn, I S., and Parsons, P G. (1994) Transcripttonal regulation of differentiation, selective toxicity and ATGCAAAT binding of bisbenzlmidazole derivatives in human melanoma cells Biochem Pharmacol 47,827-837 7 Ciejek, E M , Tsai, M J , and O’Malley, B W (1993) Actively transcribed genes are associated with the nuclear matrix. Nature 306,607-609. 8. KraJewska, W M. (1992) Regulation of transcription m eukaryotes by DNA-bmdmg proteins. Int J Bzochem 24, 1885-1898 9. Wolffe, A P (1992) New insights into chromatm function m transcrtpttonal control. FASEB 6,3354-3361 10 Workman, J. L and Buchman, A. R (1993) Multiple functions of nucleosomes and regulatory factors in transcription. TIBS 18, 90-95. 11 Lane, D., Prentki, P., and Chandler, M (1992) Use of gel retardation to analyse nucleic acids-protein mteracttons Mlcroblol Rev. 56, 509-528 12 Carey, J (1991) Gel retardatton Methods Enzymol 208, 103-l 17 13 Klemm, J. D , Rould, M A , Aurora, R , Herr, W , and Pabo, C 0. (1994) Crystal structure of the Ott-I POU domain bound to a octamer site: DNA recognition with tethered DNA-binding molecules. Cell 77,2 l-32 14. Carpousrs, A J and Gralla, J D (1985) Interaction of RNA polymerase with lac UV5 promoter DNA during mRNA initiation and elongation. J Mel Bzol 183, 165-177. 15 Sturm, R. A , Bisshop, F., Takahashi, H., and Parsons, P G (1991) A melanoma octamer binding protein 1sresponsive to differentiating agents Cell Growth D@ 2,5 19-524. 16. Straney, D C. and Crothers, D. M. (1985) Intermediates in transcription imtiatton from the E co11lac UV5 promoter. Cell 43,449-459. 17 Wingender, E (1990) Transcription regulating proteins and then recognition sequences Crzt. Rev Eukaryotic Gene Expression 1, 1 l-48. 18. Cutts, S. M., Parsons, P. G., Sturm, R. A , and Phillips, D. R. (1996) Adriamycminduced DNA adducts inhibit the DNA interactions of transcription factors and RNA polymerase J. Blol Chem 271,5422-5429 19. Masta, A , Gray, P. J. and Phillips, D. R (1996) Effect of sulphur mustard on the initiation and elongation of transcription Carcznogeneszs 17, 525-532. 20 Schretber, E., Matthias, P., Muller, M. M., and Schaffner, W. (1989) Rapid detection of octamer protein with mini-extract, prepared from a small number of cells Nuclezc Acids Res 17. 64 19.
706
Cutts et al.
2 1 Baumruker, T , Sturm, R A., and Herr, W (1988) OBPlOO binds remarkably degenerate octamer mottfs through specific mteracttons wtth flankmg sequences Genes Dev 2; 1400-1413. 22 Cullmane, C. and Philhps, D. R (1993) Thermal stability of DNA adducts Induced by cyanomorpholmoadrtamycm Nuclezc Aads Res 21, 1857-l 862 23. Sturm, R. A , Baumruker, T., Franza, B R., and Herr, W. (1987) A 100-kD HeLa cell octamer bmdmg protein (OBPlOO) interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev 1, 1147-l 160 24. Gray, P and Phillips, D. R (1993) Effects of alkylating agents on the mutation and elongation of the lac UV5 promoter. Biochemistry 32, 12,471-12,477.
An Oligonucleotide Crosslinking Assay for the Analysis of Individual Drug-Binding
Sites
Suzanne M. Cutts, Con Panousis, Andrew Masta, and Don R. Phillips 1. Introduction Many agents used in the treatment of cancer are bifunctlonal m nature and are therefore able to crosslink cellular macromolecules. Despite these nonspecific reaction mechanisms, DNA appears to be the most Important cellular target for many of these anticancer agents. The formation of DNA mterstrand crosslmks have been suggested to be the most relevant cytotoxic lesions imparted by these agents (l-3), and this is presumably achieved by inhibition of the DNA-dependent polymerases and other proteins involved m the rephcatlon and transcriptional processes. Furthermore, it has also been documented that DNA interstrand crosslinks are more difficult to repair than monoadducts (by the various DNA repair mechanisms), thus leading to a greater cytotoxlc response (4). A number of direct and indirect biophysical and biochemical techniques have been developed for the measurement of DNA mterstrand crosslmks and these include the use of caesium chloride gradients (5), alkaline agarose gels (6), selective removal of single strand DNA by Sl nuclease (6), fluorescence renaturation (7), alkaline elution (8), and a number of chromatographlc techniques (9). More recently a simple electrophoretic technique has been developed to measure drug-induced interstrand crosslinks m heterogeneous DNA (20). In this chapter an oligonucleotide crosslink assay is presented that can be used for the measurement of interstrand DNA crosslinks at any defined DNA sequence. The basis for this technique 1sthat, upon exposure to denaturatmg conditions, an interstrand crosslink will prevent the complete denaturatlon of complementary DNA strands. A schematic outline of this assay is shown in Fig. 1, and an example of an application of this assay to determine the stability From
Methods m Molecular EJ/o/ogy, Vol 90 Drug-DNA Interact/on Edlted by K R Fox Humana Press Inc , Totowa, NJ
107
Protocols
Cutts et al.
708 * 5’-ATTTTAAAAGCTTTTAAAAT-3’
c
80°C 5 min cool slowly
* 5’-ATTTTAAAAGCTTTTAAAAT-3’ 3’-TAAAATTTTCGAAAATTTTA-5’
c
+DRUG
* 4
PAGE analysis
Fig. 1 Diagrammattc
representanon of the oltgonucleottde
crosslmkmg assay
of Adrramycin-mduced crosslmks at GpC sttes IS shown m Fig. 2 The formation of such DNA crosslmks can therefore be analyzed electrophoretically. Since details of the DNA sequence selectivity of most of the currently used antrcancer agents are known, specific olrgonucleotrde duplexes can be designed to probe the crosslmkmg ability of these agents. This assay IS particularly versatile and can be used to confirm the nature of crosslinkmg sequences of drugs where this sequence has only previously been tmphed. It IS also useful for probing the degree of bending induced by adducts, the role of crucial molecular contact points, as well as provtdmg a means of assessing the stability and chemical reactivity of the crosslmks. This assay offers the simplicity and convenience of readily being able to probe drug-induced crosslinks, and can be an invaluable aid in the rational design of more potent crosslmking agents.
2. Materials 1 Desalted and detritylated ohgonucleotide/s (0.2~nmol scale) (see Note 1). 2 Formamide (delomzed) (see Note 2) (Sigma, St. LOUIS, MO) 3. Acrylamide and his-acrylamide For nondenaturlng gels make up a 30% stock solution (29: l), and for denaturing gels make up a 40% stock solutron (19 1) (electrophoresis purny reagents, Bio-Rad, Hercules, CA) 4. 1X TBE (Trrs-borate-EDTA) buffer: 89 mM Tris, 89 mM boric actd, and 2 mM EDTA, pH 7 5 Store at 20°C as a 10X stock solutron
109
Oligonucleotide Crosslinking
A
0
4
16
24
46
72
96
120
XL
lime(h)
Time (h)
Fig. 2. Stability of Adriamycin-induced crosslinks at 37°C. (A) Crosslinks were formed using palindromic duplex DNA (see Subheading 3.1.) and a final Adriamycin concentration of 10 @I. The complexeswere separatedfrom free and intercalated Adriamycin by denaturing electrophoresis,and the crosslinked specieswas excised and purified by Biotrap electroelution.The complexeswere resuspendedin TE buffer and left to stand at 37’C for the times indicated, to monitor the stability of the crosslinks. (B) Quantitation shows the amount of crosslinks remaining with time of standingat 37°C with the zero time-point set at 100%crosslinking. A first-order plot of the decay is shown in the insert. 5. 6. 7. 8. 9. 10. 11. 12.
Ammonium persulfate,electrophoresispurity reagent(Bio-Rad). TEMED, electrophoresispurity reagent(Bio-Rad). Urea (Bio-Rad). Hand-held short-waveUV lamp (240-300 nm) (Bartelt, Victoria, Australia). FluorescentpreparativeTLC plates (Merck, Frankfurter, Germany). OPC oligonucleotidepurification cartridges(Applied Biosystems,FosterCity, CA). TE buffer: 10 n-J4Tris-HCl, pH 8.0, and 1 mMEDTA. 10X kinase buffer: OSMTris-HCl [pH 7.61,0.1MMgC12,50 mMdithiothreito1, 1 rmI4spermidineHCl, and 1 mMEDTA (pH 8.0). 13. [Y-~~P]ATP (3000 Ci/mmol, Amersham,UK). 14. Polynucleotide kinase, 10 U/pL (New England Biolabs, Beverly, MA). 15. Nick spin columns (Pharmacia,Uppsala, Sweden)or Nensorb-20 Nucleic acid purification cartridges (DuPont NEN, Boston, MA).
770
Cutts et al.
16 Denaturing loading buffer: 90% deiomzed formamide, 10 mM EDTA, 0 1% xylene cyanol, and 0 1% bromophenol blue 17 Nondenaturmg loadmg buffer 60% sucrose, 0 25% bromophenol blue, and 0 25% xylene cyan01 18 Exonuclease III, 20 U/pL (IBI, New Haven, CT) 19 Gel fixing solution. Denaturing gels comprise 10% glacial acetic acid and 10% methanol, and nondenaturing gels contain 7% glacial acetlc acid 20 Gel dryer (Blo-Rad) 2 1, PhosphorImager Model 400B (Molecular Dynamics, Sunnyvale, CA) 22 Gel sequencing apparatus (IBI)
3. Methods 3.1. Design of Oligonucleotides There are many options to consider when deslgnmg ohgonucleotides for these assays,but the simplest design 1sthat of a palmdromlc (i.e., self complementary) ohgonucleotide where the drug bmdmg site 1sthe central sequence, and this 1s surrounded by sequences with low affinity or reactivity with the drug For example, the sequence used frequently for the analysis of Adnamycm-induced crosslmks 1s S-ATTTTAAAAGCTTTTAAAAT, which when self-annealed creates a favorable crosslmkmg site for Adrlamycm at the central S-GC site. This sequence can be manipulated with the inclusion of nucleotlde derivatives such as mosine, which is used to probe the effect of the absence of the N-2 posltion of guamne on crosshnkmg. Alternatively, two complementary sequences can be utlhzed, and this offers the advantage that the extent of crosslinkmg can be quantitated more readily by radiolabeling only one of the strands. In addition, asymmetric crosslmkmg sites can be designed to define the crucial molecular sites of crosslinking. For example, tf the N-2 posltlon appeared to be involved m the crosslmk, the design could incorporate guanine on one strand, but mosine on the other m order to establish if the N-2 position is required on both ends of the crosslmk. There are many mampulatlons avallable in this assay,but they must be tailored to the agent m conslderatlon. The methods that follow provide an outline of the basic assay. 3.2. Purification
of Oligonucleotides
1. 2 3. 4.
Lyophilize 10 OD U of the desalted ohgonucleotlde (see Note 1) Resuspend in 100 pL delomzed formamide Denature at 90°C for 5 mm. Load onto a 19% denaturing sequencing gel that has been pre-electrophoresed for 1 h. 5. Run for 3 h at 2000 V.
6 Proseoff top glassplate, then carefully peel gel directly onto cling wrap. 7. Place gel on TLC plate and expose to overhead hand held UV lamp.
Oligonucleotide
111
Crosslmkmg
8 9 10 I1
Cut out major band (see Note 3). Place excised acrylamlde in Eppendorf tube and add 500 PL high purity water. Leave overnight at room temperature (see Note 4). Apply to OPC cartridges using the desalting procedure of Applied Blosystems (see Note 5). 12. Dry sample in a Speed-Vat apparatus, resuspend in 100 pL of TE and measure concentration spectrophotometrlcally (see Note 6) 13 Dilute sample to 200 pmol/pL with TE buffer.
3.3. Radioiabeiing
of Oiigonucieotides
1 Take 1 pL of the purified oligonucleotide, 2 pL of 10X kmase buffer, 5 pL of [c+~~P] ATP, and add 11 FL of high purity water. 2 Add 1 pL of polynucleotlde kinase 3 Incubate at 37°C for 30 mm (see Note 7) 4 Inactivate kinase by mcubatmg at 70°C for 10 mm. 5 Pass sample through a nick spm column, or purify more strmgently with a Nensorb 20 cartrldge (see Note 8). 6. Resuspend ohgonucleotlde in 20 pL of TE buffer. This yields a concentration of approx 100 @4-bp labeled 20-mer ohgonucleotlde.
3.4. Preparation
of Cross/inked
Oiigonucieotide
1 Add labeled oligonucleotide to drug reaction buffer at the desired concentration for subsequent reaction with drug (see Note 9) 2. Heat mixture to 80°C for 5 min and cool slowly to room temperature (see Note 10) 3. Aliquot mixture into small Eppendorftubes and add drug to a final volume of 10 pL. 4. Allow drug-oligonucleotide to react for the desired time 5 Add 10 pL of loading buffer (see Note 11).
3.5. Exonuciease Digestion Exonuclease III digestion 1sused for exolytlc degradation from the unlabeled 3’ end of DNA to confirm the exact site of crosslinkmg. It typically stalls 1-3 nucleotldes prior to the drug adduct (II). 1. Aliquot 10 pL of drug reacted oligonucleotide (see Note 12). 2. Digest for 1 h at 37’C.
and add 0.4 U of exonuclease III
3. Add an equal volume of denaturing loading buffer. 4. Heat at 90°C for 5 mm. 5. Subject to denaturing electrophoresis (see Subheading
3.6.1.).
3.6. Eiectrophoresis 3.6.1. Denaturing Electrophoresis 1. Prepare a 19% denaturmg polyacrylamlde sequencing gel in 1X TBE. 2 Subject to pre-electrophoresls at 750 V for 15 mm
112 3 4 5. 6
Cutts et al. Load 5 pL of each sample Subject to overmght electrophoresis at 750 V (see Note 13). FIX gel m 10% acetic acid/lo% methanol. Dry in gel dryer (see Note 14).
3.6.2. Nondenaturmg 1 2. 3 4 5 6
Electrophoresis
Prepare a 19% nondenaturing polyacrylamlde (29.1) sequencing gel m 1X TBE. Subject to pre-electrophoresis at 750 V for 15 mm at 4°C (see Note 15) Load 5 PL of each sample. Subject to overmght electrophoresls at 4°C. FIX gel m 7% acetic acid. Dry m gel dryer
3.7. Quan tita tion of Cross/inked 3.7.7. Autoradiography
Oligonucleo
tide
1 Place the gel m contact with Kodak XAR-5 X-ray film overmght at room temperature. 2. Scan the image with a densitometer coupled to an integrator 3 Sum the total area m each lane and express the area of the crosslmked band as a percentage of the total area
3.7.2. Phosphor-imaging 1 Place the gel m contact with a phosphorimage plate for 2 h 2 Scan the plate with a phosphorlmager 3. Quantltate by integrating the area of the total bands and then express the crosshnked band as a percentage area of the total ohgonucleotlde m each lane.
4. Notes 1. Oligonucleotldes can be purchased already purified by HPLC, but these are considerably more expensive than the detritylated, desalted form routinely supplied by most compames. 2. Deionized formamide 1sprepared by adding 0.2 g of delonizatlon beads to 20 mL formamide and stlrrmg for 1 h before filtering the solution and storing at -20°C. 3. Be very careful to only excise around the edges of the major ohgomer so as not to include failure sequences. 4 This step allows diffusion of the ohgonucleotlde from the acrylamide 5 The excised polyacrylamlde can also be applied directly to a Blotrap electroelutlon apparatus (Schelcher and Schuell, Germany) and the ohgonucleotlde should then be ethanol precipitated with glycogen With either method, there IS an at least 60% recovery of ohgonucleotlde. 6. The total OD units are determmed from the ohgonucleotlde concentration at 260 nm and the total amount of the double-stranded ohgonucleotlde estimated, assuming 33 pg DNA per OD unit.
Oligonucleotide Cross/inking 4836261612
113 8 4 2 0
XL DS -
Fig. 3. Time dependenceof crosslinking reaction.Adriamycin (10 $4) and 25 pJ4 bp of palindromic duplex DNA (see Subheading 3.) was reactedfor O-48 h. Complexes were resolved by electrophoresisthrough a native 19% polyacrylamide gel. Bands are shown as XL (crosslink), DS (double strand),and SS (single strand). 7. Efficiency of labeling can be determinedby retaining 0.5~pL aliquots before and after the labeling reaction and running thesesampleson polyethyleneimine cellulose TLC plates(0.5 Mammonium bicarbonateasthe solvent).The oligonucleotide will remain at the origin and unincorporatedlabel will migrate further (12). 8. The nick spin column will separatethe oligonucleotide from unincorporated radioactive nucleotides, but will not remove the polynucleotide kinase. This method gives a DNA recovery of approx 80%. Alternatively, a better, but more time-consuming method usesNensorb columns, which provide better purification (i.e., removal of protein and unincorporated oligonucleotide) and approx 90% recovery of DNA. 9. Palindromic oligonucleotides can be labeled to a high specific activity, and the reaction can,therefore,be supplementedwith unlabeledoligonucleotide and still yield a good radioactive signal on the dried gel. This also simplifies interpretation of the data since the possibility that two labeled strandsare involved in the double-strandedspeciesis considerably reduced. It is also possible to include only one labeled (nonpalindromic) strandand add an equal amount of unlabeled complementarystrandat this step. 10. This stepallows annealingof complementarystrandsto createthe requiredduplex substrate. 11. Usethe formamideor ureacontainingloadingbuffer when runningsampleson denaturinggels,andthesucrosebuffer for nondenaturinggels.Nondenaturinggelsareonly employedwhen exploringadduct-induced bendingandto comparethe double-strand specieswith the crosslinkedspecies(see,for example,the increaseof Adriamycininducedcrosslinksformed at GpC siteswith increasingreactiontime-Fig. 3).
114
Cutts et al.
12. The drug reactton buffer used for the work (40 n-& Trts, 3 mM MgCl,, 0.1 mM EDTA, 100 mM KCl, pH 8 0) is suitable for the exonuclease reaction If other buffers are used, it may be necessary to ethanol precipitate the DNA and resuspend m 1X exonuclease III reaction buffer (66 mA4 Tris-HCI, pH 8 0, 6 6 mM MgCl,). If CaCl, IS included m the reaction buffer, the apurmic endonucleolytic activity of exonuclease III will suppress its exonucleolytic activity. 13, The gels are run at 750 V to ensure that the temperature of the gel does not rise above 55°C This is necessary only if the adducts are labile above this temperature If the adducts are stable to higher temperatures, the voltage may be increased, and the run time therefore decreased. 14 The gel temperature must be kept to less than approx 60°C and there must be a good vacuum on the gel dryer or the high percentage gels ~111 fragment If this problem cannot be allevtated, the drymg step can be omitted and the wet gel wrapped securely m cling wrap and exposed to a phosphorimage plate for 2 h (it is particularly important that no moisture come m contact with the phosphor plate as long exposure to acidic solutions will destroy the phosphor surface) 15 The nondenaturmg gel is run at 4°C to ensure that the ohgonucleotide remams as a duplex structure
References 1 Hemminki, K. and Ludlum, D P. (1984) Covalent modification by antineoplastic agents J Nat1 Cancer Inst 73, 1021-1028 2 Wassermann, K (1994) Intragenomtc heterogeneity of DNA damage formation and repair A review of cellular response to covalent drug DNA mteracnons Crrt Rev Toxic01 24,281-322.
3 Kohn, K W. (1983) Biological Molecular
aspects of DNA damage by crosslinkmg agents, m Drug Actzon (Neidle, S and Waring, M J ,
Aspects of An&Cancer
eds.), Macmillan, Oxford. 4 Sancar, A. and Sancar, G B (1988) DNA repair enzymes Ann Rev Biochem 57, 29-67. 5. Verly, W. G and Brakier, L. (1969) The lethal action of monofunctional and bifunctional alkylatmg agents on T7 coliphage Bzochim Blophys Acta 174,674-685 6 FuJiwara, Y (1983) Measurement of mterstrand cross-lmks produced by Mitomycm C, m DNA Repaw-A Laboratory Manual of ResearchProcedures, vol 2 (Friedberg, E C and Hanawalt, P C , eds ), Marcel Dekker, NY, pp 143-160 7 Lown, W J , Begleiter, A , Johnson, D , and Morgan, A. R (1976) Studies related to antitumour antibiotics. Part V, Reactions of mitomycm C with DNA examined by ethidmm fluorescence assay Can J Blochem 54, 110-l 19 8 Kohn, K. W , Ewtg, R G A , Ere, L. C , and Zwelling, L A (198 1) Measurement of strand breaks and crosslmk by alkaline elution, m DNA Repazr (Friedberg, E. C and Hanawalt, P C , eds.), Marcel Dekker, NY, pp 379-401 9 Hartley, J A., Souhami, R L., and Berardim, M D (1993) Electrophoretic and chromatographic separation methods used to reveal mterstrand crosslmkmg of nucleic acids J Chromat Boomed Appl 618,277-288
Oligonucleotide
Crosslinking
115
10. Hartley, J A., Berardmt, M D., and Souhamt, R. L. (1991) An agarose gel method for the determmatton of DNA interstrand crosslmkmg applicable to the measurement of the rate of total and “second” arm crosslmk reactions Anal Bzochem 193,131-134 11. Cutts, S M. and Phtllips, D R. (1995) Use of ohgonucleottdes to define the site of mterstrand cross-links induced by Adrtamycm. Nuclezc Acid Res 23,245&-2456 12. Sambrook, J , Frnsch, F. E , and Martians, T. (1989) Molecular Cloning. A Laboratoly Manual (2nd ed.), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
8
DNA Polymerase Inhibition Assay (PIA) for the Detection of Drug-DNA Interactions Thomas P. Dooley and Katherine
L. Weiland
1. Introduction The authors have devised a simple method for the detection of drug-DNA interaction and sequence selectivity in vitro (I). The method 1sbased on the inhibition or termination of bacterial DNA polymerase(s) when it encounters modified DNA sequences. The DNA polymerase inhibition assay (PIA) has been successfully employed to study a variety of DNA bmdmg and bonding agents. The method was mmally validated for the detection of adducts formed by sequence-selective alkylators such as adozelesm and duocarmycm A (1,2). Subsequently, the method was modified to permit detection of nonbondmg mtercalators and nonintercalative binding agents, such as netropsm (unpublished results). This method is relatively safe for the user, as it employs less radioisotope than is required for the detection of alkylation products by conventional postlabeling or Maxam and Gilbert chemical cleavage techniques. PIA can be used effectively to determine the sequence specificity of drugDNA interactions. This method involves a modification of standard dideoxynucleottde chain termmatton sequencing (3) of drug-treated double-stranded DNA. The in vitro incubation times, temperatures, and concentrations of the test agent with double-stranded DNA in aqueous solution can be varied to permrt either mmlmal or maximal drug-DNA interaction. Bacterial DNA polymerase, dertved from eitherEscherz&a co& or bacteriophage T7, transits along the DNA template strand starting at the 3’-OH of an annealed synthetic oligonucleotide primer. The procession of the polymerase can be effectively mhibited or terminated at the sites of alkyl adducts. The products of the radiolabeled sequencing reactions are resolved by denaturing polyacrylamlde gel electrophoresrs (PAGE). Polymerase mhrbltion results m the accumulation of arrested From
Methods
m Molecular
&ology,
Edited by K R Fox
Vol
Humana
117
90
Drug-DNA
Interactton
Press Inc , Totowa,
NJ
Protocols
Dooley and Weiland
118
nascent radiolabeled DNA strands at or adjacent to the modified DNA resldues. In the case of adozelesm, the chain termination products accumulate at the complement to the deoxyrlbonucleotlde adjacent to (i.e., prior to) the bulky alkylation adduct. PIA was origmally designed to evaluate sequence selectivity of compounds that are capable of forming alkaline stable alkyl adducts (I). The method has since been modified for mvestlgation of compounds with unknown DNA reactivity, in terms of either mechanism of action (e.g., bmdmg or bonding) or sequence selectivity. The reactivity of netropsin, a nonmtercalattve DNA blnding agent, was observed by PIA using this modified protocol (see example m Fig. l), whereas it was not observed using the original method employing alkaline denaturatlon after drug-DNA interaction (I). Both mtercalatmg and
nonmtercalatmg DNA-bmding agents can be detected by PIA if their “stable” interactions
with DNA produce unfavorable
effects on DNA polymerase
tran-
sit. Possible examples of altered nucleic acid biochemistry include increased melting temperature, stabllizatlon of the double stranded complexes, mtercalation, and physical sterlc hindrance. By sequencing a large number of drug-DNA interaction sites along a
kllobase of DNA, one can generate a consensus sequence for bmdmg or bondmg of the agent to double-stranded DNA. The in vitro assay can also identify closely related permutations
of the consensus site that are Incapable of mterac-
tion with a chosen agent. In addition, If one desires to evaluate interaction with a specific DNA sequence, then a plasmld construct contammg this site can be obtained or constructed
by ligation
of a synthetic double stranded oligonucle-
otlde fragment mto a convenient restrlctlon enzyme site on a plasmld vector Thus, one can either derive the consensusfor bmdmg empirically by surveying a kilobase of DNA, or by specifically focusing on a variety of synthetic sites. 2. Materials 2.1. Reagents and Buffers 1. Prepare >I00 pg of a selected supercolled plasmld DNA from E colz by alkaline lysls, followed by phenol-chloroform extraction and ethanol preclpltatlon (4). The DNA should be stored m TE buffer (see Notes 1 and 2). 2 Obtam the followmg reagents commercially: a. SequenaseTM DNA sequencing kit (US Blochemlcals, Cleveland, OH) containing* I Sequenase, a modtfied form of bacteriophage T7 DNA polymerase 11 dNTPs and ddNTPs stocks 111 Sequencing reaction buffer (see Note 3). b [cz~~P] dATP m aqueous solution (Amersham or New England Nuclear) c Oligonucleotlde primers complementary to the bacterral plasmld (see Note 4)
119
Drug-DNA Interactions Control
Netropsin
GATC
GATC
Fig. 1. PIA autoradiogram of netropsin-treatedDNA: 100 yglmL netropsin was reactedwith the oligoprimed plasmid DNA for 2 h at 22”C, and then subjectedto PIA. The noncovalent interaction with DNA results in the accumulation of “Ns” within G:C rich segmentsof a DNA sequence.The strong netropsin PIA arrest site(s) on the gel at 5’-TTCCWCTCT (wherethe underlinedsitesappearasNs) correspondsto 5’-AGAGEGGAA on the template strand. The weaker arrest site(s) within the autoradiogram sequence5’-CCGAGCGCTGG correspondsto 5’-CCAGCGCTCGG on the template strand. The sequencesare read starting at the bottom, and the dots denoteNs or sites of DNA polymerasearrest. 3. Obtain or preparesufficient stock reagentsfor multiple experiments: a. 50 mL Dimethyl formamide (DMF). b. 50 mL Dimethyl sulfoxide (DMSO). c. 50 mL 2.0 A4Sodium hydroxide (NaOH); preparedfresh weekly. d. 50 mL 3.0 A4Sodium acetate(NaOAc) pH 7.0. e. 500 mL Ethanol (EtOH; at -2O’C). f. 500 mL 75% EtOH. g. Siliconizing agent. h. 10 mL 0.1X SSPE:15 mMNaC1, 1 mMNaH,P04, 0.1 mMEDTA, pH 7.4. i. 200 mL 38% Acrylamide/2% his-acrylamide.
Dooley and We/land
720 J k 1 m. n o
10 mL 10% Ammonmm persulfate (APS); prepared fresh weekly 10 mL TEMED 500g Urea 2.0 L 10X TBE buffer* 0 89MTns base, 0.89Mbonc acid, 20 mMEDTA, pH 8 0 100 mL 1X TE buffer 10 mMTrts-HCl, 1 mMEDTA, pH 8 0 1 mL 1 5X Sample loadmg buffer 95% formamtde, 20 mM EDTA, 0 05% xylene cyanol FF, 0 05% bromophenol blue
2.2. Equipment 1 2000+ V electrophorests power transformer 2 DNA Sequencing polyacrylamide gel electrophoresis apparatus (mm of 40 cm long, e g., IBI or Jordan Scientific). 3 PAGE gel spacers and well-forming combs (0 4-mm thickness) 4 Whatman 3MM blotter paper 5 Autoradiographic film (e g , Kodak BioMax or XAR film) 6 Autoradiographic film cassette (Spectromcs). 7. Vacuum- and heat-asststed gel dryer (Blo-Rad). 8 Vacuum pump with refrigerated organic phase trap (Savant) 9 Plastic wrap (e g , Saran wrap) 10. 20,200, and 1000 pL Pipetman and disposable tips (Ramm) 11 Disposable gloves 12 60 mL disposable syrmges and 18-gage needles. 13 Microfuge (Eppendorf or Brmkmann). 14 Microfuge tubes (1.5 mL) 15 Plexiglass p-emitter shield (Jordan Scientific). 16 Gel-sealing tape
3. Methods 3.1. Denaturation
of DNA
1 For each set of sequencing reactions, denature 1 or 2 pg of double-stranded plasmid DNA in 20 uL of 0 2 MNaOH m a 1 5-mL microfuge tube for 5 mm at 22°C (for each sample) If more than one test agent, differing agent concentrations, or ohgonucleotide primers are to be studied, then set up sufficient additional samples m an identical manner A negative control reaction m which no agent is added should always be included for each primer. 2 Add 0 1 vol of 3 MNaOAc, pH 7 0, and 2 vol of chilled EtOH, 3. Precipitate at -70°C for 10 mm, then spm in a microfuge for 5 mm at 16,000g. 4 Remove supernatant and rinse pellet by vortexmg in 1.O mL 75% EtOH at room temperature, then spm m a mlcrofuge for 2 mm (see Note 5) 5. Remove the rinse supernatant and vacuum dry the pellet (see Note 6)
3.2. Preparation
of Polyacrylamide
Gels
1. Clean glass plates with detergent, rinse with dH,O, and rub with Kimwipes and ethanol Apply smconizmg agent to one surface of only one plate Assemble
Drug-DNA
121
Interactions
glass plates and spacers (ca. 0 4-mm thrckness). Taping of edges may be necessary to prevent leaks 2. Prepare acrylamide gel mix by dissolvmg 48 g urea m 50 mL dH,O by heatmg at 65OC briefly in a microwave (final concentration IS 8 M urea), then cool to room temperature For a 6% acrylamide gel, add 15 mL of acrylamidelbu-acrylamtde stock (acrylamide is toxtc and requires gloves when handling), 10 mL of IOX TBE, and adjust volume to 100 mL with dH,O. 3 When ready to “pour” the gel (standing upright and tilted back), add 0.5 mL 10% APS and 5 yL TEMED to the gel solution, qutckly mtx without producing air bubbles, and fill immediately between the plates using a 60-cc syringe and steady pressure Lay the gel horizontal on the benchtop and insert the comb Cover the gel top with a piece of plastic wrap The gel should polymerize within 30 mm.
3.3. Oligonucleotide
Priming and Drug-DNA interaction
1 Resuspend the denatured DNA m 2 pL of 5X Sequenase buffer and 6 uL of water containing 10 ng of the appropriate ohgonucleotide primer (without delay) and vortex to mrx 2. Anneal the primer to the denatured DNA by mcubation at 37 C for 1 h 3 Add 2 yL of the DNA-interactive test compound m solutton (see Notes 7 and 8). 4. Incubate at 37°C for 1 h, followed by an optional mcubation at room temperature (ca. 22°C) for an additional 2 h (see Note 9) 5 (Optional) If the agent IS suspected to form stable alkyl adducts, then the drugtreated samples can be precipitated m 0 1 vol of 3 0 MNaOAc, pH 7 0, and 2 vol of EtOH to remove unbound excess agent Following precipitation and centrifugation, the samples should be resuspended and primer annealed as per steps 1 and 2 (and skip steps 3 and 4) Thus, by simply ethanol precipitating the drugtreated samples prior to the PIA reactions, one can remove the noncovalently bound portion of the agent This option can help discrtmmate between DNA bonding and DNA-binding agents (i e., binding agents are likely removed by EtOH precipitation).
3.4. DNA Sequencing Reactions and Gel Electrophoresis 1. The ohgonucleotide-primed, agent-treated DNA samples are subjected to routine dideoxynucleottde chain termination sequencing (3), using [cL-~~P] dATP and the Sequenase protocol outlmed by the manufacturer (US Biochemicals, Cleveland, OH), contained within the commercial DNA sequencing kit Do not repeat the denaturation step(s) described by the manufacturer All reactions should be done using appropriate radtotsotope shieldmg (see Notes 3 and 10) 2. Remove the seal and spacer at the bottom of the polymerized 6% gel. Then mount the gel in the electrophoresis apparatus, fill the reservoirs with 1X TBE, remove the comb, and flush all air bubbles from the gap between the plates at the bottom of the gel using a 1X TBE-filled syringe and bent needle. Prewarm the gel at constant current (suggested 30 mA) for 30 mm to ca 55°C. Prior to loading samples, the wells must be manually rinsed using a Pasteur pipet to remove urea
Dooley and Weiland
122
3. Add 4 pL of the 1.5X runnmg dye mtxture to each reaction (G, A, T, C), and boll the samples for 5 mm prror to loading the prewarmed polyacrylamtde gel. 4 Load l-2 pL of each sample onto the gel from left to rrght with the G, A, T, C lanes of the untreated control DNA, followed by a space and the next set of samples (1.e , the test agent-treated samples) Then, maintain constant current durmg electrophoresls One may also do a second loadmg m other wells on the gel l-2 h later, to permtt “readmg” further on the gel 5 After the bromophenol blue dye (faster mobrlny than xylene cyanol) has run off the bottom of the gel, turn off the current and dtsassemble the gel plates The gel will adhere to the nonsilrconized plate and should be delicately transferred to Whatman paper, covered wrth plasttc wrap, and drred m a vacuum- and heat-
assistedgel dryer 6 Expose X-ray film overnight (8 h) to the plastic-wrapped surface of the gel (wrthm a film cassette) Develop the autoradlogram the followmg mornmg If the exposure mtensrty is too low, then re-expose longer or wrth the atde of an mtenstfier screen at -70°C
3.5. Interpretation
of Results
The radtoacttve products of the DNA sequencing reactions wtthin the drted gel will produce an Image on the X-ray film that ISvery similar to conventtonal Sanger drdeoxynucleottde chain termmation DNA sequencing (Fig. 1). The smaller fragments migrate faster than the larger fragments (htgher up the gel). One reads the DNA sequence startmg at the bottom of the autoradiogram, whrch corresponds to the ohgonucleottde prtmer-proxtmal sequence The mformatron will be revealed
in a 5’- to 3’-dn-ectron,
and will correspond
to the
complement of the template strand being read by the DNA polymerase. The sttesat which polymerase is inhibited or terminated on the template strand will result m an accumulation of nascent radrolabeled DNA molecules in the drugtreated samples relative to the untreated control. In the case of bulky adducts (e.g., adozelesin), the accumulatron appears at the nucleotrde posttton tmmedtately adjacent (5’) to the adduct site. However, the sequence information read from the actual gel corresponds to the complement of the template strand (1.e, the displaced strand) being synthesizedby the polymerase. Therefore, one Infers the polymerase arrest sites as the complement of the actual autoradiographic data. By way of example, the following adozelesm alkylatlon
result has been reported
(I): the untreated control sequence 5’-GAGTAT appears wtthm the gel m the drug-treated sequence as 5’-GANTAT, where the “N” mdtcates the site of terminated nascent molecule accumulatron m all four lanes. This result mdtcates that the actual template adduct is located at the adenosme nucleottde denoted by the asterisk m the complementary sequence 5’-ATA*CTC. Adozelesm 1sa known minor groove N3 adenosine alkylator with reactivity to the consensus sequence S-ATA* or S-TTA*. Another example of polymerase inhibition by
Drug-DNA
Interactions
123
netropsin, a nonbonding agent, 1sdemonstrated m Fig. 1. In this case, netropsm m interacting at G-C rich regions of double-stranded DNA. It 1srecommended that all sequences flanking the “Ns” be recorded for results obtained from approx 1 kb of sequence. Then, ahgnment of the multiple Ns can reveal the consensus for binding or bonding of the agent. One must always compare the drug-treated and control samples, as some polymerase inhibition sites are often observed without any agent binding or bonding, because of inherent structural constraints of the template (e.g., G:C rich regions or secondary structure). In some instances, multiple consecutive Ns can be observed wtthm a short sequence on the gel. It is possible that selected less bulky alkyl adducts, mtercalators, and nonintercalattve bmdmg agents arrest at the bonding or bmding sttes per se, whereas adozelesin arrests polymerase at the adjacent nucleotrde posttion (i.e., prior to the adduct). The tttration of the test agent can be adjusted to yield etther mmimal or complete polymerase termmation, as has been observed for adozelesin (1) and melphalan (unpublished results) A caveat should be noted: rf no “background” sequencmg ladder 1sproduced m the drug-treated samples, tt IS formally possible that the test agent has a direct effect on the DNA polymerase enzyme, independent of DNA interaction. Furthermore, tt has been noted that some target sites wtthm a DNA sequence react better than others, resulting in quantitative differences m PIA band density (see example in Fig. 1). These differences could be quantrfied by densitometrtc scannmg for rank ordering. If necessary, the PIA-derived mteractlon sates can be confirmed using other techniques (e.g., Maxam and Gilbert chemical cleavage sequencing or postlabelmg methods).
4. Notes 1. Purification of supercoiled plasmid DNA via CsCl gradient ultracentrifugation IS preferred, although ion exchange chromatography (e.g., DEAE resin or Elutip-d columns from Schleicher and Schuell, Keene, NH) may be used following the phenol-chloroform extraction. The plasmid concentration should be determined spectrophotometrically. 2. The plasmid choice is largely irrelevant, although the following guidelines might be helpful. a. It is convenient to use a known plasmid for which a variety of ohgonucleotlde primers are either already avallable in one’s laboratory or else commercially available (e.g , pUC 19, pGEM vectors). b The primers should not bind precisely at the sequences suspected to be sites for alkylation adduct formation c. Depending on the anticipated sequence selectivity of an agent, one should select a plasmid known to contam several permutations of the putative interaction sequence flanked by available oltgonucleotide primers, or else create test plasmids by hgation of synthetic double stranded ohgonucleotides contaming the desired sites into a convenient vector restriction cleavage site
Dooley and Weiland
3
4
5 6
7
8
9.
10
d Use a common bacterial plasmid vector contaming a ColE 1-related multicopy replication ortgm (5) It has been determmed that the Klenow (large) fragment of E toll DNA polymerase I also works well m the PIA method. Therefore, one can substttute the Sequenase enzyme (and kit) for other bacterial polymerases (and kits), provided the reaction buffers are compatible with PIA The ohgonucleottde primers should be ca. 15-25 deoxyrtbonucleottdes m length, capable of forming approx 50% G C bp with the template, and each should bmd specifically to only one site on the plasmid vector The 75% EtOH rmse is likely necessary to remove the excess NaOH and salts If the agent is suspected to produce bulky alkyl adducts on DNA, then the method may be modtfied to permit mcubatton and alkylatton of the DNA prior to denaturation The denaturatton step merely allows the ohgonucleotide primer to bind for use as the free 3’-OH for DNA synthesis Simply premcubate the DNA and the test agent in the approprtate aqueous solutton (e.g , 0.1X SSPE) prior to ethanol rmsmg and denaturatton by 0 2 MNaOH However, note that denaturatton m NaOH might affect the adduct, resultmg m its cleavage. If totuc strength ts constdered as a stgmficant vat-table for bmdmg or bonding, then the drug-DNA mteraction may be supplemented with MgCl,, NaCl, or KC1 (although not tested m our hands) The stock solution of the test compound should be prepared fresh by dtssolvmg it m either dHzO, DMSO, or DMF (in which the agent is known to be readily soluble) The suggested concentration of the agent m the stock solution should be > 100 I~V and < 100 n&f. The stock solution should be serially diluted m the same solvent, and several concentrations of the agent should be used to treat the DNA samples, m order to determine empirically the optimal amounts needed to detect mteracttons with the DNA For instance, the extremely potent N3-adenosme alkylator adozelesm (U-73975) is easily detected m this assay at 20 ph4 final concentration, at a drug plasmtd DNA molecule ratio of approx 200: 1 A typical 3.0-kb plasmid contains approx 47 copies of a umque 3-bp recogmtton sequence. If the test agent has sequence selecttvny for less than 3 bp, then the number of potential target mteractton sites can exceed several hundred per template molecule, and would likely require higher concentrattons of the test agent to produce the same relative levels of mhibttion. These mcubatton times and temperatures are suggested for the mttral attempts However, one should empirically determine the opttmal drug-DNA mcubatton times, temperatures, and concentrattons for mdtvldual agents In the authors’ hands, most agents Interact, or at least alkylate, better at elevated temperatures (e g., ca. 37°C relative to room temperature). One can also use the Sequenase kit wtth the deaza-dNTPs to assist m resolutton of normal polymerase mhibition sates (not test agent related).
Acknowledgments The authors are grateful to Dr. Mark Mitchell encouragmg dlscussrons.
(Upjohn)
for mslghtful
and
Drug-DNA
Interactions
125
References 1 Weiland, K. L and Dooley, T. P. (1991) In vztro and zy1vzvo DNA bonding by the CC-1065 analogue U-73975. Biochemistry 30,7559-7565. 2. Mitchell, M. A., Wetland, K. L., Aristoff, P. A., Johnson, P. D., and Dooley, T P. (1993) Sequence-selective guanme reacttvtty by Duocarmycm A. Chem Res Toxic01 6,42 l-424 3 Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chamtermmatmg mhibltors Proc Nat1 Acad Scl USA 74,5463-5467. 4. Sambrook, J , Frtsch, E F., and Mamatis, T. (1989) Molecular Cloning A Laboratory Manual (2nd ed ), Cold Sprmg Harbor Laboratory, Cold Spring Harbor, NY 5. Dooley, T. P., Tamm, J , and Pollsky, B (1985) Isolatton and charactertzatlon of mutants affecting functional domains of ColEl RNA1 J A4ol &ol 186, 87-96
a Transcriptional Footprinting of Drug-DNA Interactions Don R. Phillips and Carleen Cullinane 1. Introduction There are now approx 50 registered anticancer drugs that are m routme cln-ncal use as chemotherapeuttc agents (1-3). Of these, over half are known to interact with DNA, either by mtercalation (e.g., doxorubicm, mitoxantrone), groove bmdmg (e.g., distamycm), formation of adducts or crosslmks (e.g., melphalan, cisplatm, mitomycm C), or by mcorporation of modified bases (e.g., 5-fluorouracil, 6-thioguanme). There has therefore been a great effort over many years to establish where on the DNA these drugs interact, with the expectation that a good understanding of the nature of the DNA receptor site would lead to the design of a new generation of these drugs. The early attempts to elucidate the sequence specificity of DNA-binding drugs relied largely on physicochemical techniques such as detergent sequestration dissocration kmetics (4,5), equilibrium dialysis (61, and spectrophotometric and spectrofluorometric binding studies (7,s). Whereas these approaches were successful in defining the overall sequence specificity of reversibly binding drugs (i.e., the average of a multitude of binding sites on heterogenous DNA), they do not generally provide details of the drug-DNA interaction at individual sites on the DNA (8). For this reason a variety of DNA footprintmg procedures evolved, such as DNaseI, MPE-Fe(H), and hydroxyl radical footprmtmg, and these have been reviewed extensively (P-12). Alternative techniques have since emerged that yield similar sequence specificity mformation of the location of drug sttes m a pseudophysiological situation where drug sites are revealed by blockage to the processivity of either exonuclease (13,14), DNA polymerase (15,16), or RNA polymerase (17-21). Procedures that are dependent on blocking the progression of RNA polymerase along dsDNA are From
Methods
w Molecular Bo/o~y, Vol 90 Drug-DNA lnteracbon Edlted by K R Fox Humana Press Inc , Totowa, NJ
127
Protocols
128
PhillIps and Cullinane
now referred to as an “in vitro transcrrption assay” or alternatrvely as “transcrrptlonal footprintmg.” The term “brdrrectlonal transcrtptron footprmtmg” denotes the use of two counterdnected promoters, such that truncated transcrrpts to both srdesof the drug site define the physlcal sizeof the drug-occupred region (20-22). The m vitro transcrrptronal analysrs of drug-DNA mteractlons reqmres a synchromzed populatron of mmated transcrrption complexes, all of whrch contam the nascent RNA of the same length, with all of these transcrrpts beginning from the same mmatron nucleotide. In order to ensure that this assay IS as versatile as possible (i.e., so that it can be applied to both reversibly and n-reversrbly bmdmg drugs), these condrtions restrict the number of promoters that can be employed to those with the followmg characterrstrcs’ 1, They should not requne additional actlvatmg elementssuchas CAP and CAMP, smcetheseadd an unnecessarydegreeof complexrty to the assay 2. They should be “strong” promoters (I e , the RNA polymerase should have a hrgh aftimty for the promoter region) 3 “Shppage” at the start sate of transcrrptron should be mmtmal-the fidehty of the start sate of transcrtptlon should be >99%, or must be able to be “forced” to that level of fidelity 4 The rate of formatron of the mittated transcripts should be raptd (for expertmental convenience) 5 The sequence of the nascent RNA must be such that a stable mrtiated complex can be formed with only three (or less) nucleotrdes 6. The half-life of the initiated transcriptron complex should be at least several hours
Several promoters satisfy all of these criteria (Table 1). Since the luc UV5 promoter has been extenstvely characterized, rt has been used for all initial work m this assay, and has continued to be the promoter most widely used. Stable inmated complexes of UV5 exist when the nascent RNA IS 10 nucleottdes (yteldmg a complex with a half-life of 23 h) (29, with increasing stabrlity resulting from longer transcripts formed by the use of longer initiating olrgonucleotrdes (26). Once the inmated transcription complex has been formed, rt IS then reacted with the drug of interest. Subsequent elongatton of the transcrrptron complex yields RNA of lengths up to the drug blockage sites, and defines the location of each drug binding site-the physical size of the drug site 1s also revealed if transcription IS initiated from two counter-directed promoters, which yield transcripts up to both sides of the drug site. Quantitation of the relative amount of each blocked transcript, as a functton of elongatron time, yields the relative drug occupancy at each site, the dissociatron rate constant of drug from each site, and the probability of termination of transcription at each site.
Footprinting of Drug-DNA Table 1 Promoter Systems that Yield Synchronized Promoter uv5 N25 TetR SP6 T3 T7 W.
Interactions
Initiated
Transcription
129
Complexes
Imtiation dmucleotide
Nucleotide absent during mltiatlon
Length of nntlated transcript
Ref
GA AU AG AG AG AG AU
CTP CTP GTP GTP CTP UTP UTP
10 29 11 9 12 13 15
23 22 23 24 24 24 23
2. Materials
2.1. Unidirectional Transcription The following items are required for in vitro transcription from the E colz lac UV5 promoter contained from the plasmid pCC 1 1 2 3 4
5 6. 7. 8 9 10.
11. 12.
on the 512-bp PvuIIIHindIII
fragment
derived
Lac UV5 promoter, contained in the plasmid pCC1 (see Notes 1 and 2). Agarose, electrophoresls purity reagent (Blo-Rad, Hercules, CA). Blo-Trap electroelutor (Schleicher and Schuell, Dassel, Germany). Phenol/chloroform* redistilled phenol (Kodak, molecular biology certified), equilibrated with TE buffer and containing 0.1% hydroxyqumolme and 0.2% P-mercaptoethanol, in 1.1 mixture with chloroform (BDH)/lsoamylalcohol (BDH) (24: 1, v/v) Store at 4°C 5 Mammomum acetate m Type I water from a M&-Q water purlficatlon system (Mllllpore, Bedford, MA). Urea, electrophoresis purity reagent (Blo-Rad) Acrylamide and bu-acrylamlde (electrophoresis purity reagent, Blo-Rad) as 30% stock solution (19 1) m MI&Q water (see Note 3). TEMED, electrophoresls purity reagent (Bio-Rad) Ammomum persulphate, electrophoresis purity reagent (Blo-Rad) Transcription buffer 40 mM Tns-HCl, pH 8.0, 100 mA4 KCI, 3 mM MgC&, 0 1 mA4 EDTA, 5 mM DTT (electrophoresis purity reagents, Blo-Rad), 125 pg/mL BSA (RNase and DNase free, Pharmacla, Plscataway, NJ), 1 U/pL RNase mhtbltor (human placenta, Pharmacla). Make as a 10X stock solution In M&-Q water and store at -20°C (see Notes 4-6) E cd RNA polymerase (1 U/pL, New England Blolabs, Beverly, MA). Rlbonucleotides ATP, CTP, GTP, and UTP (ultrapure reagents, Pharmacla): 100 @4 stock solutions m Milli-Q water Store at -20°C.
Phillips and Cullinane
130
13 Dinucleottde GpA (ultrapure reagent, Pharmacia) 2-mM stock solutton m Mtlh-Q water. Store at -20°C 14 10% Methoxy CTP/90% CTP, 3’-methoxy CTP (Pharmacia, 0.02 mA4) and CTP (0 18 mM) m transcriptton buffer containtng 0.8 M KCl, and 5 m/r4 of each of ATP, GTP, and UTP Store at -2O’C (see Note 7) 15. 10% Methoxy GTP/90% GTP* 3’-methoxy GTP (Pharmacia, 0 02 mM) and GTP (0 18 mA4) m transcription buffer contammg 0 8 M KCl, and 5 mM of each of ATP, CTP and UTP. Store at -20°C (see Note 7) 16 2 mg/mL grade 1 heparm (Sigma, St Louis, MO) dissolve in Milli-Q water. Store at -20°C 17 Elongation nucleotides ATP, CTP, GTP, and UTP (all 5 mM) m transcription buffer containing 0 8 M KC1 18 CX-[~~P]UTP (3000 Ci/mmol, Amersham, UK) (see Notes 8 and 9) 19
20 21 22 23 24 25. 26 27
1X TBE (Trwborate-EDTA)
buffer
90 mM Trls, 90 mA4 boric acid, 2 mh’
EDTA, pH 8 3 Store at 4°C as a 10X stock solutton 1X TE (Tris-EDTA) buffer. 10 mMTrn+HCl, 1 mM EDTA, pH 8.0, made up m Milli-Q water Store at 4°C as a 1OX stock solutton Termmation/loadmg buffer. 10 Murea, 10% sucrose, 40 mA4 EDTA, 0.1% xylene cyanol, 0 1% bromophenol blue m 2X TBE buffer, pH 7 5 Fixing solution. 10% acetic acid/lo% methanol (v/v) Hyperfilm-pmax X-ray film (Amersham, UK) and laser densttometer, or alternatively, a Molecular Dynamics 400B PhosphorImager or equivalent Restrictton endonucleases PvuII and Hind111 (Boehrmger Mannhelm, Germany). High-resolution DNA-sequencing electrophoresis apparatus and power supply (preferably constant wattage supply up to 3000 V, 150 W). Transilluminator (Spectroline, Spectrontcs [New York], Model TVC3 12A, 3 12 run) Speed Vat Concentrator (Savant, NY)
2.2. Bidirectional
Transcription Footprinting
For bidirectional transcrlptlon footprinting, most of the Items llsted m Subheading 2.1. are required, together with the following items. 1 Counter-directed UV5 and N25 promoters contained m the plasmtd pRW2 (see Note 10).
2. Restrtctton endonucleases DraI, BstNI, PvuII, and XhoI 3 Dmucleottde ApU (ultrapure reagent, Pharmacia) 2-&stock solution in MilltQ water. Store at -20°C 4 Trmucleottde dGGA. Synthesize using any DNA synthesizer (0.2 or 1.O umol scale) 2-mh4 stock solution m Milli-Q water Store at -20°C
3. Methods The formation of drug-induced transcrtptronal blockages requires a range of distinct steps-to aid the understanding of these steps they have been represented diagrammattcally in Figs. 1 and 2 and are described in Subheadings
Footprinting of Drug-DNA
interactions
131
RNA POLYMERASE
HEPARIN
INITIATE
ELONQAlE
Fig. 1 Overview of the transcription assay. The major steps are: (1) formation of a synchromzed mrtiated transcrrptron complex (see Fig. 2 for details), (2) reactron of the imtrated transcrtptron complex with drug; (3) elongatron of the transcription complex to yield drug-induced blocked transcripts.
3.1.-3.5. Details of a rigorous analysis of the kinetics of RNA polymerase progression past each drug-induced blockage site are outlined m Subheading 3.6.
A method for obtaining a brdirectlonal transcriptional footprint of drug sites IS presented in Subheading 3.7.
Phillips and Cullinane
132 5 I ----w-w-----3 9-------m-m---
GGAATTGTGAGCGGATAACAATTTCACACA CCTTAACACTCGCCTATTGTTAAAGTGTGT
GPA [3*P]-UTP,ATP,GTP E.coli RNA polymerase
5'------------3 I -I-----------
+l I
*
GGAATTGTGAGCGGATAACAATTTCACACA CCTTAACACTCGCCTATTGTTAAAGTGTGTGT
**
*
5 ’ - GAJLuuGuGAG \ 2
Template NascentRNA
strand
Fig 2 The synchronized imtlated transcription complex Imtlatlon of the luc UVS promoter with GpA, ATP, GTP, and CI-[~~P]UTP results m a stable transcnptlon complex contammg a nascent RNA mainly 10 nucleotides m length, up to C of the nontemplate strand (denoted with an arrow), since CTP IS absent from the mltlatlon nucleotlde mixture The nascent RNA begins at the - 1 position with G of GpA present m the mltlatlon mixture The first nucleotlde of the transcript formed under normal condltlons IS denoted as +I, RadIolabel (32P) IS Incorporated into the nascent RNA at three sites, denoted with an asterisk.
3.7. Isolation of 512 bp lac UV5 DNA Fragment (see Notes 2, 17, and 72) 1 Digest 10 pg of pCC1 (1 h, 37°C) with PvuII (10 U) and Hind111 (10 U) in 50 pL of buffer supplied with the restrictlon enzymes (see Note 2) 2 To separate the resultant two DNA fragments, SubJeCt the restriction digest to electrophoresls usmg a 1.5% mimsubmarme agarose gel contammg 0 5 pg/mL ethldmm bromide at 10 V/cm for 2 h (TBE buffer) 3 Vlsuahze the locatlon of the 5 12-bp fragment with a translllummator (see Note 11) 4 Cut out the sectlon of agarose contammg the 5 12-bp DNA 5 Place the agarose into a Blo-Trap apparatus and electroelute the DNA fragment 6 Purify the DNA further by extracting with an equal volume of phenol/chloroform. 7 Transfer the upper aqueous phase to a fresh tube 8. Add an equal volume of 5 M ammonmm acetate followed by 2 vol of ethanol. Leave at -70°C for 30 mm and then collect the DNA pellet by centrlfugatlon m 1.5mL tubes at approx 12,OOOgfor 15 mm
Footprin
ting of Drug-DNA
in &t-actions
133
9 Redissolve the DNA m TE buffer to a concentration of approx 100 ng/pL (see Note 12)
3.2. Synchronized lnifiafed (see Notes 73-78)
Transcription
Complexes
1. To a 1.5-mL microcentrlfuge tube add 1.5-2.0 yg of lac UV5 DNA fragment (approx 50 r&I), 50 pL of 2X transcription buffer and add MIIII-Q water to a total volume of 100 PL. 2 Add 1 PL of E colz RNA polymerase, mix gently, and Incubate for 15 mm at 37T (see Note 13) 3. Add 10 PL of heparm and incubate for 5 mm at 37 “C (see Note 14) 4 Add 20 pL of GpA, 10 pL of ATP, 10 PL of GTP, and 100 ~CI w[~~P]UTP (dried in a Speed Vat Concentrator and redissolved m 50 JJL of 2X transcrlptlon buffer) and Incubate for a further 5 mm at 37°C (see Notes 15-17) The resulting initiated transcription complex comprises a nascent RNA predominantly 10 nucleotldes long (see Fig 2), and 1svery stable with a half-hfe of 23 h at 37°C (see ref. 25; Note 18). 5 Take a 5-pL ahquot of the mitiated complex and add to 5 yL of termmatlon/ loadmg buffer on Ice.
3.3. Formation of Drug-Induced (see Notes 7, 19-27)
Blocked Transcripts
1. Take two 5-yL aliquots of the mltlated transcript, add 5 PL of 10% 3’-methoxyCTPI90% CTP to one and 5 pL of 10% 3’-methoxy-GTP/90% GTP to the other, incubate at 37°C for 5 mm (see Note 19), then add 5 JJL of termmation/loadmg buffer to both samples 2. Divide the remaining Initiated transcription complex mto two equal parts. To one half add the drug of Interest (see Note 20) for a sufficient length of time to ensure that an equilibrium has been estabhshed-typically 5-60 mm for a reversibly reacting drug, but up to 48 h for slow, irreversible processes such as some alkylatlon events (25). To the other half add a similar volume of buffer used for the drug solution. 3. Add an equal volume of elongation nucleotldes to both control and drug-treated initiation mixtures (see Note 21) and mix rapldly (this IS zero time for subsequent kinetic analysis) 4. Take 10-PL ahquots for kinetic studies of drug-DNA dlssoclatlon from both reaction mixtures at appropriate time intervals (e.g., 5 or 6 data points m the first halflife) and add to 10 pL of termmatlon/loadmg buffer on Ice
3.4. Separation
of Blocked Transcripts
(see Notes 22 and 23)
The RNA transcripts are separated using high resolution sequencing gels (see Note 22). An example is shown in Fig. 3 for the preclmlcal anthracyclme derivative, cyanomorpholmoadrlamycin (27).
134
Phillips and Cullinane
Fig. 3. Transcriptional blockagesinducedby cyanomorpholinoadriamycin(CMA). The initiated transcription complex was reactedwith 1 pJ4 CMA for 1 h, 37”C, in transcription buffer, pH 8.0, and then elongated for l-240 min prior to separation of transcripts by sequencinggel electrophoresis(2 7). The lane representingthe initiated transcript is shown as I, and the 3’-methoxy-CTPand 3’-methoxy-GTP sequencing lanes denoted as C and G, Control lanes of DNA not subjectedto reaction with CMA, but elongatedfor l-240 min, are denotedas CONT.
Footprmtmg of Drug-DNA
FRACTION
135
InteractIons
0 01
Ftg. 4. Sequence speclfictty of CMA adducts The mole fraction of blocked transcripts was determined from the I-mm elongation lane of Fig. 3 (27) Numbermg IS from G of the GpA dinucleotlde used to mltlate transcription 1 Prepare a conventtonal 12% acrylamide denaturmg gel (19.1 acrylamlde.bzsacrylamlde, containmg 7 M urea) m TBE buffer 2. SubJect gel to pre-electrophoresls for 1 h to heat to approx 60°C (typlcally 2000 V, approx 100 W) 3. Heat all samples m termmatlon/loadmg buffer at 90°C for 5 mm, then place on ice 4. Load 10 pL of each sample onto the gel and contmue electrophoresls until the bromophenol Just migrates off the bottom of the gel (approx 2 h) 5 Fix gel in 10% acetic acid/lo% methanol for 20 min (see Note 23). 6. Dry gel using a commercial gel dryer.
3.5. Quantitation
of Blocked Transcripts
(see Notes 2&26)
Quantitation of the relative amount of each length of RNA can be performed either by conventional autoradiography, or by a phosphorimaging process. Both procedures are outlined stnce the former is routinely avatlable to all laboratories, whereas the imaging process, although being preferable since it is faster, more sensitive and fully computerized, involves a large initial expenditure for the phosphorlmager Itself and IS therefore not yet routinely available to all laboratories. A histogram of the mole-fraction of blocked transcripts induced by cyanomorpholinoadrlamycin IS shown in Fig. 4 as analyzed from the 1-mm elongation lane of Fig. 3.
3.5.1. Autoradiography I. Place the dried gel m contact with Amersham HyperfilmJ3max or Kodak XAR-5 X-ray film overnight, without mtenslfjring screens,at room temperature (see Note 24)
Phillips and Cd/inane
136
2. Scan the autoradlogram with a densitometer (laser light source to maximize resolution) coupled to an integrator 3 Sum the total area (proportional to radloactlvlty) m each lane and express each band as a fraction of the total-this yields the mole fraction of blocked transcripts m each reaction mixture (see Note 25)
3.52. Phosphorimaging
(see Note 26)
1 Place the dried gel m contact with phosphor plate for l-2 h 2 Scan the phosphor plate with a phosphorlmagmg system 3 Normalize each transcript with respect to the total intensity m each lane, to yield the mole fraction of each transcript m each reaction mixture
3.6. Relative
Occupancy
and Drug Oissocia tion Kinetics
The mole fraction of RNA blocked at each drug site IS an mdlcatlon of the relative occupancy of drug at each site. However, a true correlation between these two parameters exists only at mfirnte dilution of the drug. In practice this means using the lowest drug level possible to detect blockages. Under these conditions most drug sites will not be occupied, and the majority of RNA polymerases in the mltiated transcrlptlon complex will elongate fully to yield a full-length transcript 1 Form Initiated transcrlption complexes as outlined m Subheading 3.2. 2 React the mltlated complexes with a range of drug concentrations (typically 0 l100 @4for a prehmmary study) for the reqwred time, asoutlined m Subheading 3.3. 3. Measure blocked transcripts as outlmed m Subheadings 3.4. and 3.5. 4 Repeat steps l-3 using a drug level that yields approx 90% of full-length transcripts (i.e., only approx 10% of the total drug sites are occupied), but use a range of elongation times 5 Plot ln[RNA] (where [RNA] IS the mole-fraction of blocked transcript) agamst elongation time for the first few drug-induced blockages. The slope of these plots, if linear, yields the rate constant for the bypass of RNA polymerase past a drug site (generally reflecting dlssoclatlon of drug from each site) (1%21) (see Note 27) An example 1s shown m Fig. 5 for the first-order by-pass of enzyme past cyanomorpholmoadrlamycm snes (the first three shown in Fig. 3).
3.7. Bidirectional
Transcription
Footprin ting
The in vitro transcription assay described in Subheadings 3.1.-3.5. has been remarkably successful m detecting the locatlon of one end of drug-induced blockage sites on DNA, but does not indicate the physical size of the blocking unit. In order to obtain this information, the blockage can be probed by RNA polymerase from both directions. This assay, in which two counter-dlrected promoters are employed 1s summarized in Fig. 6 For example, the blockages induced by cyanomorpholmoadrlamycm are shown m Fig. 7, and the resulting
Footpnntmg of Drug-DNA -2.000
137
Interactions , t;’
I .
I
*
In [RNA]
I I
I
! 1 )
-8.000 0
I
I
I
I
30
80
90
120
/
TIME(mln)
Fig 5 Ftrst-order decay of transcrtptional blockages induced by CMA The RNA concentratton IS represented as the mole fraction of blocked transcripts (after elongation for 1 min) at sites 1 (D, 29/30-mer), 2 (0, 37-mer), and 3 (+, 43/44-met) of the data shown m Fig. 3 (27)
footprints revealed as a histogram m Fig. 8, where eight of the rune sites probed reveal an intrastrand crosslink at GpG sequences (27). 1 Digest 10 pg pRW2 wtth PvuII (10 U) and XhoI (10 U) and isolate the 3 15-bp fragment containing counter-directed UV5 and N25 promoters (see Note 28) as described m Subheading 3.1. 2. Digest 315-bp fragment with DraI (2 U), as described m Subheading 3.1., to deactivate N25 promoter 3 Initiate UV5 promoter with dCGA (200 p&f), UTP, GTP, and ATP (1 CUM),and 100 $I IX-[~~P]UTP as described m Subheading 3.2. 4. React initiated UV5 fragment with drug and elongate and quantttate blocked transcrtpts as outlined m Subheading 3.3. 5. Digest 3 15-bp fragment with BstNI (2 U), as described m Subheading 3.1., to deactivate UV5 promoter. 6. InitiateN25 promoterwith ApU (200 @4), UTP, GTP, and ATP (1 pA4), and 100 ~0 a-[32P]UTP. 7 React initiated N25 promoter fragment with drug and elongate and quantitate blocked transcripts as outlined in Subheadings 3.2.-3.5. 8 Correlate mole fraction of blocked transcripts from both promoters m a htstogram to reveal bidtrectional transcrtption footprints (22,2X27)
4. Notes 1 The Iac UV5 promoter was from the plasmid pHWO1 and contained a single copy of the L8UV5 double mutant, 203-bp lac promoter at the EcoRI site of
Phillips and Cullmane
738
F
=,’ -4-
Fig 6 Schematic representation of brdrrectronal transcription footprmtmg. The DNA fragment contammg the counter-drrected UV5 and N25 promoters is shown in (A). Selective deactrvatron of either one of the promoters yrelds (B), additron of E colz RNA polymerase and mmatron nucleotides yields the mrtrated transcrrptron complex (C) Reactron with drug yrelds (D) and subsequent elongatron results m a range of drug-Induced blocked transcripts (E). The two sets of blocked transcrrpts are summarized together m (F) to reveal bidrrectronal transcription footprints of drug sites. pHW 1 (28). Only the UV5 mutatron at -9 (numbermg with respect to the mRNA start site at +l) IS sigmficant for this work smce this confers strong “up” promoter characterrstics to the promoter and inmatron of transcrrptron does not require actrvatron by CAP (29). A good summary of the sequences drfferences between the famrly of four 203-bp fragments, only two of which contam the UV5 promoter, is available (30). 2 The 203-bp fragment was ligated into the umque EcoRI sateofpBR322, removed as a BamHIIHzndIII fragment, the 5’-overhanging ends filled with Klenow DNA polymerase and the blunt ends ligated usmg standard procedures to yreld pRW 1. The UV5 promoter can be excised as a 497-bp PvuIIISulI fragment However, since the yield from thus promoter IS low the 497-bp fragment
Footprinting of Drug-DNA Interactions
139
A I
CONT 1 515
CMA C G 1 515 I
1
CONT 515
CMA C G 1 515
-76
-55
Fig. 7. Bidirectional transcription footprinting of CMA. The restriction digested (modified) 3 15-bpDNA fragmentwas initiated from either the UV5 or N25 promoter (A) and (B), respectively,andthe initiatedtranscriptioncomplexthenreactedwith 2 $4 CMA for 60 min and was then subjectedto elongation for 1-15 min (27). containing the UV5 promoter hasbeenincorporateddirectionally into the PvuIIl Sal1site of pSP64to yield a much higher copy numberplasmid, pCC 1. The plasmid yield from this vector is significantly greater than from pBR322-derived vectors. The UV5 promoter is then excisedas a 5 12-bpPvuIIIHindIII fragment (31). The ZucUV5 promoteris alsoavailablecommercially in the vector pKK3381 (Clonetech, CA). Another sourceof the 203-bp fragment is from the plasmid pMB9-UV5 (32).
Phillips
140
and Cullmane
OG2 uv5 * 0.15
-
0.10
3 I
9 5
0.05
-
0.0
-
1
4 2
MOLE FRACTION
0.0 1 0.05
&
IL
A
l-
A
I
I
0.10
0.15
#N25 0.2
Fig 8. Bidirectional transcription footprint of CMA The mole fraction of blocked transcripts from either the UV5 promoter (upper sequence, which represent the 5’3’-nontemplate strand) or N25 promoter were determined from the data shown m Fig. 7 (27). 3 It is important to use high purity, sterile water to prepare all solutions m this assay The presence of trace amounts of metal ions, bacteria, or nucleases can completely destroy the assay 4 Because of the limited hfettme of DTT, especially under alkaline condtttons, add the required
DTT
on the day of the experiment
5. The use of RNase inhibitor is optional for short reaction and elongation ttmes, but becomes increasingly necessary for reactions m the 2- to 20-h time range. 6. The exact MgCl* concentration IS critical to ensure efficient transcription and mmimal natural pausing (32). Different buffer condittons are required for bacteriophage RNA polymerases (24)
Footprinting of Drug-DNA Interactions
141
7 Dideoxy CTP and dideoxy GTP can be used as an alternative to 3’-methoxy nucleotrdes to generate sequencmg lanes, but require a higher percentage in the mixture (compared to the respective CTP and GTP ribonucleotides) to ensure adequate incorporation of the modified nucleotide. 8. Any suppher of 32P-labeled rrbonucleotrdes will be satisfactory, provided the nucleotides have been purified by HPLC to remove ATP (required by some suppliers m the 32P labeling process) and trace levels of other nucleotides 9. In general, the fresher the 32P nucleotides the better for transcriptional studies since radiolytic degradation products can inhibit the process of transcription, especially when mvolvmg bacteriophage RNA polymerases (33) 10. Details of construction and use of the plasmid pRW2 have been described m detail elsewhere (22) 11 Exposure of the DNA to UV light should be as brief as possible to mnumize any possible damage to the DNA. 12 The DNA concentration can be determmed by several means, mcludmg drrect absorbance at 260 nm, by the relatrve fluorescence compared to calf thymus DNA standards in the presence of an excessof ethrdmm bromide, or by capillary electrophoresis, using a series of standards of known concentration (momtormg peaks at 260 nm). 13 An mcubation of as little as 1 mm will suffice if necessary 14. Heparin displaces bacterial RNA polymerase from nonspecrtic binding sites on the DNA, including the ends of the linear DNA which have modest affinity for the polymerase. This procedure ensures that only single-copy transcripts result from the subsequent elongation step since the RNA polymerase will be unable to rebind to the promoter because of competition with heparin 15 It is convenient to keep a series of each of the required amounts of GpA (20 pL), ATP ( 10 pL), and GTP (10 pL) frozen at -20°C as previously dispensed ahquots 16. The CX-[~~P]UTP is supplied at 10 mCi/mL in aqueous solutron and the required amount is usually dried m a Speed Vat Concentrator prior to redissolvmg m the ribonucleotide solution. 17. Transcription from the UV5 promoter does not begin exclusively from the +I site-when all four nucleotides are present only 59% of transcripts begin at the +l site, with 29, 7, and 9% beginning from the -1, +2, and +5 positions, respectively (34) To ensure that transcription begms from one site only, all nucleotides are maintained at ~5 @4 Since these levels are too low for mcorporation of the first nucleotide mto the transcription complex, little mitiation occurs Innration is therefore achieved with great selectivity from the high concentration of dmucleotide, GpA, with the nascent RNA starting from the -1 location (see Fig. 2) 18. Additional stability of the transcription complex may be achieved by ensuring that the nascent RNA is longer than a IO-mer This can be achieved by imtiatmg the transcription complex with the trinucleotide dGGA, or by using other promoters that have early transcribed regions of appropriate sequence to yield long nascent RNA from only three nucleotides m the nntiation mixture (23,24,26) 19. The methoxy-nucleotides provide a statistical probabrhty of terminating the elongation phase m transcription, and yield C and G sequencing lanes analogous to
142
20.
21
22
23.
24 25. 26
27.
Phillips and Cullmane dtdeoxy-termmated DNA sequencing lanes If sequencing lanes are required for RNA longer than approx 150 nucleottdes, the ratto of the 3’-methoxynucleottde.nucleottde must be reduced to enable the RNA polymerase to be able to transcrtbe further along the DNA before transcription IS termmated by incorporation of the methoxynucleotide mto the nascent RNA. Subsaturatmg levels of drug are normally used to ensure that most drug sites are not occupied This precaution results m a range of different drug sites bemg detected subsequently m the elongation phase If high drug loadings were employed, the first drug site would be completely occupied-RNA polymerase would not proceed past that sate and therefore be unable to probe addtttonal downstream drug sates(2135) Natural pausing of RNA polymerase IS muumized by the use of high levels (2 5 mM) of all four nucleottdes during the elongation process, as well as by high tonic strength (0 4 A4 KCl) (22) The high level of nucleottdes also ensures that additional mcorporatton of cQ3*P] mto the growing RNA cham is effectively ehmtnated, and ensures that all transcrtpts, trrespecttve of length, have the same amount of radtolabel If low levels of transcrtptton or high levels of background occur (i e , resultmg from pausing of the transcrtptton complex prior to formatton of full-length transcripts) the most ltkely cause IS msuffictent purity of the promoter-contarnmg DNA fragment This can often be recttlied by SubJectlng the DNA to an addtttonal purification step, such as a NENSORB 20 nucletc acid purtlicatron cartridge (NEN Research Products, DE) Other sources of the problem may be degradatton of one of the nucleottdes, or bacterial contammatton of the transcrtpnon buffer. In etther case, It IS prudent to make fresh stock soluttons of all reagents as this has mvartably proven to be quicker than trying to identify the individual contaminated component Fixing and drying the gel improves resolution of the autoradtogram. The washing step m this procedure also serves to remove almost all background m the gels arising from radtolyttc degradatton products of the labeled nucleotide-these contaminants would otherwise obscure the bottom one third of the gel Amersham Hyperfilm-P max X-ray film is routmely used for final quantitative work because of the low background absorbance and high contrast of thts film. The time of exposure of the gel must be modified to ensure that photographic lmeartty is mamtamed-for Kodak XAR X-ray film lmeartty IS restricted to the O-1 absorbance range (36). The phosphortmaging process offers two major advantages over the photographic process: It 1s up to 250-fold more sensmve for the detection of 32P, and tt has a linear dynamic range at least 400 times greater than that of film processes (3 7) A true dtssoctation rate constant is revealed only from the first drug sate encountered by the initiated transcription complex All subsequent dtssociatton rate constants are distorted to some degree by read-through of RNA polymerase from earher (upstream) sites, and by the fact that all sites downstream of the first site are underestimated because less RNA polymerase reaches them compared to the
Footprinting of Drug-DNA
interactions
143
first site For these reasons, estimates of drug occupancy and dissociation kmetICS are only good approxtmattons (except for the first site) If the drug occupancy at each site IS low For a more rtgorous approach, Monte-Carlo (38) and kinetic modellmg (35) simulations have been employed with the latter bemg partrcularly rapid and effective 28. If the kmetlcs of read-through past occupied drug sites are not of interest then any counter-directed commercral promoter systems could be employed (e g , SP6/ T7 or T3/T7, both of which are available from a variety of molecular biology suppliers, as are the bacteriophage SP6, T3, and T7 RNA polymerases). The ternary transcription complexes formed with these polymerases are generally less stable than those mvolvmg bacterial RNA polymerase, and they are, therefore, well-suited to definmg the location of covalent adducts on DNA, but less suited to the study of reversibly bound drugs (24)
References I Schacter, L. P., Anderson, S., Canetta, R. M., Kelley, S., Nicaise, C , Onetto, N , Rozencweig, M., Smaldone, L , and Winograd, B (1992) Drug discovery and development tn the pharmaceutical industry. Semen Oncol 19,613-62 1 2. Loxman, N R and Narayanan, V. L. (1988) Chemtcal Structures oflnterest to the Dtvtston of Cancer Treatment, Drug Synthesis and Chemzstry Branch, Developmental Therapeutics Program, Nattonal Cancer Institute, Bethesda, vol. VI 3 Chabner, B A (1993) Cancer drug discoveries and development, m Cancer Prtnctples and Practice of Oncology, 4th ed (Devrta, V. T., Hellman, S , Rosenberg, S A., and eds ), Lippmcott, Philadelphia, PA, pp. 325-417. 4 Warmg, M. J and Fox, K. R (1983) Molecular aspects of the mteractton between qumoxalme antibiotics and nucleic acids, m Molecular Aspects of Anttcancer Drug Action (Needle, S and Waring, M J., eds ), Macmillan, London, pp 127-l 56 5. Wakelm, L. P. G. and Denny, W. A. (1990) Kmetics and equihbrmm bmdmg studies of a series of intercalating agents that bmd by threading a sidecham through the DNA helix, in Molecular Basis of Spectfictty tn Nucletc Aced-Drug Interactzons (Pullman, B. and Jortner, J., eds.), Kluwer Academic, Dordrecht, pp 19 l-206. 6 Chaires, J. B (1992) Application of equilibrium binding methods to elucidate the sequence specificity of antibiotic binding to DNA, m Advances tn DNA Sequence Speczfic Agents, vol 1 (Hurley, L H , ed.), JAI, CT, pp 3-23 7. Dougherty, G. and Pigram, W. J. (1982) Spectroscopic analysis of drug-nucleic acid Interactions CRC Crtttcal Rev Biochem 12, 103-132 8. Chaires, J. B. (1990) Daunomycin bmding to DNA: from the macroscopic to the microscopic, m Molecular Basts ofSpect&ty m Nucleic Acid-Drug Interactton (Pullman, B and Jortner, J , eds ), Kluwer Academic, Dordrecht, pp 123-136 9 Dabrowiak, J. C. and Goodisman, J (1989) Quantitative footprmtmg analysis of drug-DNA mteractions, m Chemistry and Physzcs of DNA-Ltgand Interacttons (Kallenbach, N. R , ed ), Adenine, NY, pp 143-174. 10 Nrelsen, P E (1990) Chemrcal and photochemical probing of DNA complexes J Molec. Recognttton 3, 1-25
Phillips
144
and CM/inane
11 Leupm, W (1990) Experimental proofs of a drug’s DNA spectfictty, m M&ecular Basis ofSpeczj%ty zn Nuclezc Acid-Drug Interactzons (Pullman, B and Jortner, J., eds.), Kluwer Academic, Dordrecht, Holland, pp 579-603 12 Goodtsman, J and Dabrowlak, J C. (1992) Quantltattve aspects of DNaseI footprmtmg, in Advances zn DNA Sequence Speczjk Agents, vol 1 (Hurley, L H., ed.), JAI, CT, pp l-37 13 Mymryk, J. S and Archer, T. K. (1994) Detection of transcrrptton factor bindmg m vtvo usmg lambda exonuclease Nucleic Aczds Res 22,434+4345 14. Cullmane, C and Phillips, D R. (1994) The sequence specificity ofcyanomorpholmoadrlamycm m human cells. Bzochemzstry 33, 6207-62 12 15 Murray, V , Motyka, H., England, P. R., Wtckham, G., Lee, H. O., Denny, W A , and McFadyen, W D (1992) The use of Taq DNA polymerase to determine the sequence specificity of DNA damage caused by Cw-dtammmedtchloroplatmum (II), acridine-tethered platmum (II) dlammme complexes or two analogues J Bzol Chem 267, 18,805-l 8,809. 16 Murray, V., Motyka, H , England, P. R , Wtckham, G , Lee, H. 0 , Denny, W A , and McFadyen, W D (1992) An mvestigatton of the sequence specific mteractton of Czs-dtammmedtchloroplatmum (II) and four analogues (mcludmg two acridme-tethered complexes) with DNA inside human cells. Bzochemzstry 31, 11,812-l 1,817 17 White, R J and Phillips, D R (1988) Transcrtpttonal analysis of multi-sue drugDNA dtssoctation kmettcs. Delayed termmatton of transcription by actmomycm D Bzochemzstry 27,9 122-9 132 18 PhillIps, D R , Whtte, R J , Trist, H., Cullmane, C , Dean, D., and Crothers, D M (1990) New insight into drug-DNA interactions at indivtdual drug sites probed by RNA polymerase during active transcrtption of the DNA. Antz-Cancer Drug Deszgn 5, 2 l-29. 19. Phtlhps, D. R , Cullmane, C., Trust, H., and White, R. J (1990) In vztro transcrtptton analysts of the sequence spectficrty of reversible and irreversible complexes of Adriamycm wtth DNA, m Molecular Baszs of Speczjkzzy zn Nuclezc Aced-Drug Interactzons (Pullman, B and Jortner, J., eds ), Kluwer Academic, Dordrecht, Holland, pp. 137-155. 20. Phtlhps, D. R. and Crothers, D. M. (1995) An zn vztro transcriptton assay for probmg drug-DNA mteracttons durmg active transcrtptton of DNA, m Methods zn Molecular
Bzology, vol 37 In Vitro Transcrzptzon and Translation
Protocols
(Tymms, M J , ed ), Humana, Totowa, NJ, pp. 89-105. 2 1 Phillips, D R. (1996) Transcrtptton assay for probmg the specifictty of drug-DNA interactions m Advances zn DNA Sequence Specific Agents, vol. 2 (Hurley, L H and Chaues, J B , eds ), JAI, Connecticut, pp 101-134 22 Whtte, R. J and Philhps, D. R (1989) Bidirectional transcription footprmtmg of DNA bindmg hgands Bzochemzstry 28,6259-6269 23. Trust, H. and Phtlhps, D R (1989) In vztro transcription analysis of the role of flanking sequences on the DNA sequence spectficlty of Adrlamycm Nuclezc Aczds Res 17,3673-3688
Footprinting of Drug-DNA
Interactions
145
24. White, R J and Phtllrps, D R. (1989) Sequence-dependent termination
of bacteriophage T7 transcrtptton m vitro by DNA binding drugs Bzochemistry 28,4277-
4283 25. Cullinane, C and Phillips,
26. 27 28 29 30
31 32
33
D R. (1990) Induction of stable transcripttonal blockage sites by Adrtamycm. GpC specificity of apparent Adrtamycin-DNA adducts and dependence on non (III) tons Bzochemistry 29, 5638-5646. Straney, D C and Crothers, D M (1985) Intermedtates in transcrtptton mmatton from the E colr lac UV5 promoter. Cell 43,449-459 Cullmane, C and Philltps, D. R. (1992) In vttro transcription analysis of DNA adducts by cyanomorpholmoadriamycm Bzochemzstry 31, 95 13-95 19. Wu, H and Crothers, D. M (1984) The locus of sequence-directed and proteminduced DNA bmdmg Nature 308, 509-5 13 Silverstone, A E , Ardittr, R R., and Magasmk, B (1970) Catabohte-msensttrve revertants of lac promoter mutants Proc Nat1 Acad Scl USA 66, 773-779 Schaeffer, F , Kolb, A , and But, H (1982) Point mutattons change the thermal denaturation profile of a short DNA fragment contammg the lactose control elements Compartson between experiment and theory EMBO J 1,99-105 Cullinane, C (1993) Detection and Characterzsatlon ofAdrzamyczn-DNA Adducts, PhD Thesis, La Trobe Umverstty, Bundoora, Vie , Australia Stefano, J E. and Gralla, J (1979) Lac UV5 transcription m vitro. Rate limitation subsequent to formation of an RNA polymerase-DNA complex Bzochemzstry 18, 1063-1067 Melton, D A , Kretg, P A , Rebaghatt, M R , Mamatts, T , Zmn, K , and Green, M R (1984) Efficient zn vztro synthesis of btologtcally active RNA and RNA hybrtdisatton probes from plasmtds containing a bacterrophage SP6 promoter
Nucleic Acids Res 12, 7035-1056 34 Caprousts, A J., Stefano, J E , and Gralla, J D (1982) 5’-Nucleottde heterogeneity and altered imtiatton of transcription at mutant lac promoters. J Mol. Bzol 157,619-633 35 Philltps, D R., Moate, P J , and Boston, R C (1994) A modellmg procedure for
the analysts of dynamic drug-DNA mteracttons probed durmg active transcrrpbon of the DNA An&Cancer Drug Deszgn 9,20%219. 36 Dabrowtak, J. C., Skorobogaty, A , Rich, N., Vary, C. P H., and Vournakts, J N (1986) Computer assisted mtcrodensitometrrc analysts of footprintmg autoradtographic data. Nucleic Aczds Res 14,489-499. J I. Johnston, R F., Ptckett, S. C , and Barker, D L (1990) Autoradtography using storage phosphor technology Electrophoreszs 11,355-360. 38. Phillips, D. R., White, R J , Dean, D., and Crothers, D M (1990) Monte-Carlo stmulatton of multtstte echinomycm-DNA interactions detected by zn vztro transcription analysts Bzochemlstry 29,4812-4819
Determination of the DNA Sequence Specificity of Alkylation Damage Using Cleavage-Based Assays John A. Hartley and Michael D. Wyatt 1. Introduction Many agents that possess antitumor activity have been shown to bmd to DNA. Several chnlcally used chemotherapeutic drugs are alkylatmg agents, which are known to bind covalently to, and m many casescrosslmk, the bases of DNA. These include the nitrogen mustard, chloroethyl-mtrosourea, tnazene, and dlmethanesulfonate classes of agents. Most simple alkylatmg agents of this type show a base specificity for guanine, bmdmg primarily to the guamneN7 posltlon m the major groove of DNA (2). In contrast, more complex agents such as the natural product CC-l 065 and the novel agent talhmustme bmd primarily to adenine bases at the N3 posltlon m the minor groove (2,3). In addition to this base speclficlty it is now apparent that many, if not all antltumor agents that bind to DNA, do so with some degree of base-sequence selectivity. This can vary from agents such as mtrogen mustards, which show a limited dlscrlmmatlon between the target base in different sequence contexts, to those such as CC-l 065 and talhmustme, which show a high degree of selectlvlty to certain unique sequences,with the corresponding avoidance of others. The DNA sequence selectivity of alkylatlon for agents that react at the guarune-N7 or adenine-N3 positions can be measured relatively easily using modlficatlons of DNA sequencing-based techmques. The principle of the technique is shown in Fig. 1. A singly end-labeled fragment of DNA of known sequence is used to pinpoint the precise posltlon of drug binding followmg the quantltative production of a strand break at the alkylatlon site. This can be achieved at sites of guanine-N7 alkylation by treatment with hot piperldme (4), or by thermal cleavage at sites of adenine-N3 or guanme-N3 alkylation (3). In the case of the plperldme reaction, the alkaline conditions cause rupture of the C&N9 From
Methods
In Molecular B/ology, Vol 90 Drug-DNA InteractIon Edfted by K R Fox Humana Press Inc , Totowa, NJ
147
Protocols
Hartley
148
-m singly end-labeled DNA fragment
-
w
+ covalently bIndIng drug P )
* w
C *llTif nrlIIIIIIlmlT -11111111111111111111II cleavage at -rrrm-msites of 111111(11111111(111111 damage wulluduu
and Wyatt
D
I-
denaturing polyacrylamide gel electrophoresk3
-
Fig 1, Outlme of the cleavage-based methods. C and D are control and drug-treated samples, respectively
bond of the N7-alkylated base producing a formamido-pynmldine structure. Plperldme displaces the formamido-pynmidme structure from its sugar and catalysesp-ehmmatlon of phosphatesfrom the sugar, breaking the phosphodiester backbone (4) (see Note 1). Prowded the drug reactlons employed produce single hit kinetics (i.e., each DNA molecule receives at most one alkylatlon) the Intensity of a band produced on a DNA sequencing gel IS proportional to the extent of alkylation at that base position. 2. Materials 1. 2 3 4 5. 6 7. 8 9. 10 11. 12
Restrlctlon enzymes and their appropriate reaction buffers Plasmld DNA As an example we use the pBR322 plasmld (5) MIcrocentrifuge. Bacterial alkaline phosphatase (BAP)* 100 LJ/pL m 10 mA4 Tris-HCl, pH 8 0, 0 12 M NaCl, 50% v/v glycerol (Glbco-BRL) Bacterial alkaline phosphatase buffer (5X): 10 mA4 Tris-HCl, pH 8.0, 120 mM NaCl (Gibco-BRL, Galthersburg, MD) Buffer saturated phenol (Appllgene, Oncor, Chester-le-St, UK) Chloroform (Fluka, Glllmgham, UK) Isoamyl alcohol (Sigma, St. LOUIS, MO) 95% Ethanol. Lyophlllzer or vacuum dryer T4 polynucleotlde kinase (PNK)* 5 U/pL in 50 mM Tns-HCI, pH 7.5, 25 mM KCl, 5 mM DTT, 0 1 p&f ATP, 50% v/v glycerol, 0 2 mg/mL BSA (Glbco-BRL). Forward reactlon buffer (5X) 200 mMTns-HCl, pH 8 0,75 mA42-mercaptoethanol,
50 mM MgC12,1.65 @I ATP (Glbco-BRL) 13. Sucrose loading buffer: 0.6% sucrose, 0 04% bromophenol blue, and 0.04% xylene cyan01 in dIstIlled and deionized water. 14 Tris-acetate EDTA (TAE) agarose gel runmng buffer: 40 mA4Trq 20 Wacetlc acid, 2 mM Na,EDTA, pH 8.1
DNA Sequence Specificity 15. 16 17 18 19 20 21 22 23 24. 25 26 27 28 29 30 31 32 33 34. 35 36
149
Low-melting-pomt (LMP) agarose (BRL) Long-wave UV transillummator Ethldmm bromide solution (10 mg/mL stock) Heat block capable of running at 90°C. Water baths GELaseTM (Eplcentre Technologies) 50X GELase buffer (Eplcentre Technologies) TEOA buffer 25 mA4 tnethanolamme, 1 mMNa,EDTA, pH 7.2 Alkylation stop solution. 0 6 Msodmm acetate, 20 mMNa,EDTA, 100 pg/mL tRNA Sodium citrate buffer 1.5 mA4 sodium citrate, 15 mMNaC1, pH 7 2. Piperidme (Sigma) 10% Plperidme solution m distIlled and deionized water 1s made up fresh (see Note 11). Formamide loading dye* 0.04% bromophenol blue, 0.04% xylene cyanol, 98% deionized formamlde. Tris-boric acid EDTA (TBE) polyacrylamlde gel running buffer 90 mMTns-HCl, 90 mM boric acid, 2 mA4 EDTA, pH 8.3 Sequencing gel mix is purchased as a kit called Sequagel-6 (National Dlagnostlcs, Hessle, UK) Ammonium persulfate (APS) (Sigma). Stock solution of APS (0.25 mg/mL) IS made up fresh. Tetramethylethylenedlammme (TEMED) (Sigma). Standard DNA sequencing gel electrophoresls equipment. In our case a gel apparatus that IS 80 cm x 20 cm x 0 4 mm for maximum resolution was used 3MM filter paper (Whatman, Maidstone, UK) DE 8 1 filter paper (Whatman) Standard vacuum gel drying equipment. Autoradiography cassettes X-ray film and developing faclhtles
3. Methods 3.1. Preparation of 5’-Sing/y End-Labeled Fragment This protocol describesthe lmeanzation, S-end labeling and second restriction enzyme cleavage of plasmld DNA to produce a 5’-singly end-labeled fragment. For alternatwe methods of producing singly end-labeled fragments see Note 2. 3.1.1. Restriction Digest and 5’-End Labeling 1 Lmemze the closed circular plasrmd (20 pg) with the first of the two restnctlon enzymes m its appropriate buffer, per manufacturers speclficatlons (for suitable choice of restnctlon enzymes, see Note 3). Following the incubation, add one tenth ~013 M sodium acetate and precipitate the DNA by addition of 3 vol of 95% ethanol (see Note 4) Chill the samples in a dry Ice/ethanol bath for 10 min and then spin m a rmcrofuge for 10 mm at 16,000g. After centrifugatlon, remove the supematant and lyophthze the DNA pellet to remove all ethanol Resuspend the dry DNA pellet m dlstllled and deionized water
150
Hartley and Wyatt
2. Dephosphorylate the DNA with bactertal alkaline phosphatase (BAP, 3 U/pg) for 1 h at 65°C m BAP reaction buffer, m a final volume of 100 pL Followmg the mcubatton, add 100 yL of phenol, vortex the sample thoroughly and spin for 5 mm at 16,000g m a mtcrofuge to separate the phases Remove the aqueous phase (top layer) to an Eppendorf tube and vortex with 100 pL of 24:l chloroform/tsoamyl alcohol Remove the aqueous phase and repeat the step a second time Back extract the organic layers with 50 pL of dtsttlled water, combme the aqueous layers, and precipitate the DNA as described in step 1 3 5’-end label 5 pg of the DNA with T4 PNK (2 U/pg), [Y-~~P]ATP (10 @I), m forward reaction buffer (20 pL final vol) at 37°C for 30 mm. Followmg mcubatton, add one vol of 7 5 Mammonmm acetate and precipitate the DNA with 3 vol 95% ethanol After chlllmg, centrtfugatton and lyophtllzatton, as described m step 1, resuspend the dry DNA pellet m 50 pL of distilled and detomzed water Precrpttate the DNA a second time wtth 5 pL of 3 A4 sodmm acetate and 165 pL 95% ethanol, and dry the samples by lyophdlzatton 4 Cleave the DNA with a second restrictron enzyme (see Note 3) After mcubatmg under the appropriate condmons for the restrlctlon enzyme, precipitate the DNA with sodmm acetate and ethanol, dry by lyophtltzatton as descrtbed m step 1, and resuspend m 15 pL of sucrose loading buffer
3.1.2. Purification of the 5’-Singly End-Labeled This protocol
describes one suitable method.
Fragment
For alternattves
see Note 5.
1 Prepare a 1 0% LMP agarose gel in TAE buffer 2 Dissolve the DNA tn the sucrose loading buffer, load onto the gel and electrophorese for 90 mm at 75 V m TAE buffer 3 After electrophorests, stain the gel with ethtdmm bromide (0 5 pg/mL) and locate the band of interest by UV fluorescence. Excise the shce of gel contammg the fragment and collect m a prewelghed Eppendorf tube, weigh, and add the appropriate amount of GELase 50X buffer for a final 1X concentratton 4 Completely melt the gel slice m a 65’C water bath for 1O-l 5 mm and then place m a 45°C bath for 10 mm Add the appropriate amount of GELase and digest the agarose for 3 h at 45°C (see Note 6) 5 At the end of the dtgestton, add one vol of 7 5 M ammomum acetate and 3 vol of 95% ethanol, mtx, and spin m a mtcrofuge for 30 mm at 16,000g Remove the supernatant and dry the DNA pellet by lyophtltzatton Resuspend the pellet m 100 pL water, mix with an equal vol of chlorofotm/tsoamyl alcohol (24. l), remove the aqueous layer, prectpttate the DNA and dry by lyophthzatlon (see Note 7)
3.2. Drug-DNA
Incubations
1 Dissolve the 5’-end labeled DNA from Subheading 3.1.2. m suffictent TEOA buffer to give 10 pL per reaction tube (see Note 8) 2 Make dtluttons m TEOA buffer from a freshly prepared stock solutton of drug (usually 10 mM) m the approprtate solvent for the drug Prepare drug dtluttons at
151
DNA Sequence Specifmty
10X final required concentration and add 5 pL to the DNA and buffer to give a final vol of 50 pL 3 Incubate at 37°C for the approprrate time (see Note 9) 4. Terminate the drug-DNA mcubatlon by the addition of an equal vol of alkylation stop solution (see Note lo), followed by 3 vol of 95% ethanol Chtll and spm the samples, remove the supernatant, and add 75 ltL of 70% ethanol. Spm the samples for a further 10 mm, remove the supernatant and dry the DNA pellets by lyophihzatton
3.3. Piperidine
Cleavage
Assay
1 Prepare a 10% ptperidine solution in Ice cold water fresh for each experiment and keep on ice until use (see Note 11) 2. In a fume hood, quickly add 100 ltL of the 10% pipertdme solution to the Eppendorf tubes contammg the dried DNA pellets and reseal the tubes Vortex the tubes to completely dissolve the DNA 3. Place the samples in a 90°C heating block for 15 mm (see Note 12) 4 Immediately snap freeze the samples m a dry ice/ethanol bath and lyophihze the samples to dryness 5 Add distilled water (20 pL) and dissolve the DNA, snap freeze, and lyophilize to dryness Repeat a second time (see Note 13) 6 Wash the samples with 70% ethanol (75 pL), spm for 10 mm, remove the supernatant, and dry by lyophdtzatlon
3.4. Thermal Cleavage
Assay
1 Dissolve the dry DNA pellets from the drug-DNA mcubattons m 100 pL of sodium citrate buffer, pH 7 2 2. Incubate the samples m a 90°C heatmg block for 30 mm 3 Followmg heat treatment, chill the samples in an ice bath 4. Prectpitate the DNA with sodium acetate and 95% ethanol, and then dry by lyophihzation.
3.5. Maxam and Gilbert Marker Lane (5) A sample of the 5’-singly end-labeled fragment IS always reserved for a marker lane. For a G+A ladder, add 7 PL of formic acid to a 10 PL DNA sample and react for 7 min at room temperature. Terminate the reaction by adding an equal vol of alkylatton stop solutron, followed by 3 vol of 95% ethanol. Chill the sample, spm and remove the supernatant, then dry by lyophtltzatton. Perform the steps described in Subheading 3.3. for the pipertdme treatment. 3.6. Po/yacry/amide
Gel Electrophoresis
1 Prepare a standard 6% polyacrylamide, 8 Murea, sequencing gel and prerun with the TBE runnmg buffer until the temperature has reached approx 55°C
152
Hartley and Wyatt
2 Dissolve the samples m 3 pL of the formamtde loading dye by vigorous vortexing, and pulse spm to collect the sample m the bottom of the Eppendorf tube. 3 Heat the samples m a 90°C heating block for 2 mm to denature the DNA, and immediately place m an ice water bath to prevent renaturatton 4. Load the samples onto the gel using a Hamilton syrmge (see Note 14) and during the electrophoresis maintain the gel temperature between 5@-6O”C to ensure the DNA remains denatured. 5. Terminate electrophoresis when the bromophenol blue marker has migrated nearly the length of the gel. A typical 80-cm gel takes approx 3 h. 6 Remove one glass plate and carefully peel the gel from the other plate using a sheet of 3MM paper. Place this on a sheet of DE 81 paper and cover the gel with Saran wrap (see Note 15) Dry the gel on a vacuum dryer at 80°C 7 Expose X-ray film to the dried gel to vtsuahze the DNA fragments Exposure times vary, depending on the amount of radioactivity m each lane and the size of the fragment studied. Overnight exposure of the gels is usually possible using an mtensifymg screen at -7O“C Sharper images are obtained without a screen, but exposure times are longer Densuometry of the autoradiograms can be carried out using high resolutton imaging densitometers
3.7. Examples Figure 2 shows examples of the ptperrdme cleavage method showing the sequence spectfictty of guanme-N7 alkylatton of DNA modified by two chloroethyl-mtrosoureas (Fig. 2A) or three nitrogen mustards (Fig. 2B). Figure 3 shows an example of the thermal cleavage method showing the sequence spectticity of adenine-N3 or guanme-N3 alkylatton of DNA modified by novel mlnor groove alkylatmg agents. 4. Notes 1. The formation of a covalent bond is necessary to destabtltze the N-glycostdtc bond for subsequent cleavage The antitumor drug ctsplatin cannot be examined for its sequence specitictty using either method because the coordination complex formed with purme-N7 positions does not sufficiently destabilize the basesugar bond. Bleomycm degrades the DNA sugar backbone via a metal and oxygen-dependent process Caltcheamicm, upon an internal Bergman cycbzation, and certain chromophores, upon photoacttvatton, produce free radicals that degrade the DNA sugar backbone via hydrogen abstraction. In these cases, smgly end-labeled fragments can be used to determine the sequence specificity of cleavage directly and the cleavage step is not required 2 Smgly end-labeled fragments can be prepared by a number of methods 3’-end labelmg can be achieved using the Klenow fragment of DNA polymerase (5) Alternatively, the authors have found PCR amplification using a plasmid template and two primers, one of which is 5’-end labeled, to be a useful method. By choosmg appropriate primers, this allows control of the size and composition of the fragment, but tt 1s important to optimize PCR condittons carefully for the
153
DNA Sequence Specificity
A
B
abed
abed
-240 -220 -200
-160 -170 -160 -150 -140 -130
-120
-110
Fig. 2. (A) Example of the piperidine cleavage method showing guanine-N7 alkylation produced in a 622 bp liindIII-Sal1 fragment of pBR322, 5’ end labeled at the Hind111site, by 2 chloroethylnitrosoureas: 1-(2-chloroethyl)-3-(cis-2-hydroxy) cyclohexyl- 1-nitrosourea (500 uA4, lane b), l -(2-chloroethyl)- 1-nitrosourea (500 uA4,lane c). Lane a is control, unalkylated DNA, and lane d is DNA treated with the guanine-N7 methylating agent dimethylsulfate (1 mM). The runs of three or more consecutive guanines within the sequenceare indicated by arrows. A clear preference of the two chloroethylnitrosoureas for the runs of guanines is evident. (B) Example of the piperidine cleavage method showing guanine-N7 alkylation produced in a 276-bp BarnHI-Sal1fragment of pBR322 DNA, 5’-end labeled at the BamHI site, by the nitrogen mustards melphalan (100 PM, lane a), quinacrine mustard (0.1 @4, lane b), and uracil mustard ( 20 @4, lane c). Lane d is the G+A (formic acid) marker lane. The three nitrogen mustardsgive different patternsof guanine-N7 alkylation. In both figures the numbersrefer to the sequenceas listed in ref. 5.
Hartley and Wyatt
154 abcde
Fig. 3. Example of the thermal cleavagemethod showing purine-N3 alkylation produced in a 213-bp fragment of pBR322 DNA (bases3090-3303), generatedby PCR amplification and S-end labeled at the 3090 site, by a series of benzoic acid mustard(BAM) andpyrrole (Py) containing conjugatesrelatedto distamycin. Lane a, control unalkylated DNA; lane b, G+A marker lane; lane c, BAM-Py,, 5 pLM;lane d, BAM-Py2, 5 pM; lane e, BAM-Py3, 5 @4. The BAM-Py, conjugateclearly alkylates at severaladeninesandoneguanine.The BAM-Py, conjugate,becauseof its enhanced sequencespecificity, only strongly alkylates at one site on the strand. Taken with permission from ref. 6.
DNA Sequence Specificity
3
4. 5,
6 7.
8
9.
10. 11 12.
155
template and primers with regard to magnesium concentration and cycling condltlons prior to generating labeled fragments It 1s helpful to consider the restriction enzymes when choosing a smtable plasmrd The first restriction enzyme ideally should cut at only one site on the plasmid The second enzyme should produce fragments sufficiently different m size so that the fragments can be easily separated by electrophoresls and isolated Since the resolution of a 6% polyacrylamlde sequencmg gel is between 200 and 300 bp, this ts the ideal size for the fragment to be studied As an alternative to isolating and purifying a singly end-labeled fragment, the second restriction enzyme can be chosen that cuts l&30 bp from the first cut (e g , pBR322 cut with EcoRI and MndIII) The very long and short labeled fragments can then be used wlthout separation and lsolatlon, and the short fragment IS run off the bottom of the sequencing gel during electrophoresls (see Note 8) In this case care should be taken m disposing of the electrophoresls buffer, which will be radloactlve It 1sImportant that the samples are thoroughly vortexed before chilling so that the water does not freeze There are many different procedures published for the purlficatlon of end-labeled fragments, each of which vary m yield, purity, and ease, includmg preparatory gels, glass wool columns, and electroelution The particular method described was chosen because of its high yield. It IS important that the agarose dIgestIon goes to completion Small agarose fragments remaining can cause problems later It 1simportant to include the chloroform wash step If ethldmm bromide IS used to visualize the DNA The presence of ethldlum bromide might possibly Interfere with drug binding, and If this 1sa concern, then it 1s suggested that the fragment be located by exposing X-ray film to the wet gel covered with plastic wrap Normally, 5 pg of labeled DNA IS enough for 10-15 samples When runnmg a very short fragment off the gel (see Note 3), however, many more counts per sample are required because the counts will be distributed over two fragments, one of which ~111 be very large The drug doses are chosen over a broad range initially, but for accurate determination of sequence speclficlty the dose of drug must produce “single-hit” kmetits. In other words, a drug dose should be chosen that provides no more than one drug lesion per DNA molecule. It is important to include the tRNA in the stop solution m order to faclhtate the DNA precipitation. It 1s important that the plperldine stock 1scolorless (it can yellow with age), the 10% solution be prepared fresh, and the piperidme added to Ice cold water Because of the volatility of the plperidme, it 1s important to ensure that the reaction tubes remain sealed while being heated, either by using screw-cap Eppendorf tubes or by placing a weight on the caps of the Eppendorf tubes The plperidme incubation time and temperature are important m order to keep background strand breaks to a mmlmum, which can occur above 95°C and at longer mcubatlon times (4)
156
Hartley and Wyatt
13 It IS tmportant to include both 20-pL wash steps m order to remove all residual traces of ptpertdine The presence of residual piperrdme can severely affect the electrophoresrs 14. It IS important to purge the wells of urea immedtately prior to loading the samples on the gel m order to ensure proper loadmg and electrophoresrs 15 In order to ensure easy removal of the sequencmg gel from the glass plates, the front plate is srhcomzed so that this can be removed, leavmg the gel on the back plate The DE 8 1 filter paper is necessary to capture the smaller DNA fragments, which can pass through the 3MM paper durmg gel drying
References 1 Hemmmkr, K and Ludlum, D. B (1984) Covalent modrfication of DNA by anttneoplastic agents. J Nat1 Cancer Znst 73, 1021-1028 2 Broggmr, M , Coley, H , Mongelh, N., Grandr, M , Wyatt, M D , Hartley, J A , and D’Incalcr, M. (1995) DNA sequence spectfic ademne alkylatton by the novel antitumor drug talhmustme (FCE245 17), a benzoyl nitrogen mustard derivative of distamycm Nuclerc Acrds Res 23, 8 1-87. 3 Reynolds, V L , Molmeux, I J , Kaplan, D. J , Swenson, D H , and Hurley, L H (1985) Reaction of the antitumor antrbrottc CC- 1065 with DNA. Location of the site of thermally induced strand breakage and analysrs of DNA sequence spectticrty Blochemlstry 24,6228-6237 4. Mattes, W B., Hartley, J A , and Kohn, K W (1986) Mechamsm of DNA strand breakage by prperrdme at sites of N7-alkylguanmes Bzochzm Brophys Acta 868, 7 l-76 5. Sambrook, J , Frrtsch, E F , and Mamatrs, T (1982) Molecular Clonrng. A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 6 Wyatt, M D , Lee, M , Garbnas, B J , Souhamr, R L , and Hartley, J. A (1995) Sequence specrticrty of alkylation for a series of nitrogen mustard-containing analogues of drstamycin of mcreasmg bmdmg site size. evidence for increased cytotoxicity with enhanced sequence specificity. Blochemlstry 34, 13,034-l 3,04 1
PCR-Based Methods for Detecting DNA Damage and Its Repair at the Subgene and Single Nucleotide Levels in Cells Keith A. Grimaldi and John A. Hartley 1. Introduction A large category of anticancer drugs owe their cytotoxicity to their abihty to Interact with, and damage, DNA. Many agents form bulky adducts that block RNA and DNA polymerases, inhibiting transcription, and DNA rephcation. It is well-known that cancer chemotherapy is far from satisfactory. The many problems include unpleasant, sometimes life threatening side effects, tumor resistance to drugs, and mutagenic effects of the drugs themselves that can cause secondary cancers and can increase the mutation rates of existing tumors leading to the emergence of more invasive and aggressive disease. DNA damage and repair is central to many of these problems and therefore studying this process at fine levels of resolution m mammalian cells, both transformed and normal, will be important. Also, with the aim of improving the specificity of cancer therapy, novel sequence specific cytotoxic agents are being developed that may allow some degree of gene targeting. Clearly, for the development and rational design of such agents, it is important to have methods that will allow the sequence selectivity of binding to be studied m cells to see if the intended target sequence is being hit and to what extent individual lesions are repaired. Since its first description in 1985 (I), the polymerase chain reaction (PCR) has been adapted for use m Just about every branch of molecular biology and beyond. It is no surprise then that it should find a place in the study of DNA damage and repair resulting from drug-DNA interactions. This chapter will focus on uses of PCR developed m the authors’ laboratory that allow drugDNA interactions to be studied at various levels of resolution from gene regions From
Methods
m Molecular Biology, Vol Edlted by K R Fox Humana
157
90 Drug-DNA Interacbon Press Inc , Totowa, NJ
Protocols
Grimaldi and Hartley
158 Template DNA (genomic)
EXPONENTIAL AMPLIFICATION
EXPONENTIAL AMPLIFICATION OF ONE STRAND ONLY
+ --
-
NO EXPONENTIAL AMPLIFICATION
Fig 1 QPCR method
(300-3000 bp) (2,3) right down to the ultimate level of detection-mdividual nucleottdes m smgle-copy genes m mammalian cells (4) The overall PCR method to be described m this chapter exploits the fact that covalent drug-DNA adducts can block taq polymerase. It can be separated into three parts and used accordmg to the level of resolution desired by the investigator Quantitative PCR (QPCR) will measure the aggregate damage on both strands in a gene region of choice. It is sensitive enough to be used to look at subgene functional regions such as mtrons, exon, promoters, and so forth. Currently, a convenient size would be between 300-3000 bp, however, with new reagents allowmg “long-PCR” becoming available the upper limit may be extended up to 20-30 kbp allowing QPCR to be used to study entire genes. Strand-specific QPCR (ss-QPCR) mcorporates adaptations that allow damage to be measured m the same region as QPCR, but m a strand specific way This 1sparticularly important m the light of recent discoveries showing heterogeneity of repair among gene regions and that by means of transcription coupled repair the transcribed strand of an expressed gene can be repaired more efficiently than the nontranscrtbed strand (5). Smgle-strand ligation PCR (sslig-PCR) extends further the method to allow the detection of adduct formation at the level of single nucleotides, on mdividual strands, in a single copy gene m mammalian cells. 1.7. Overview of the Protocols 7.1.7. QPCR (see Fig. 7) A pair of ohgonucleotide primers 1sused that defines the region of the gene selected for study. In the PCR each strand of genomtc DNA serves as a potential template for exponential amplification and the presence of one or more
DNA Damage Detected by PC/?-Based Methods
159
adducts will block the ampliticatton of that strand. Therefore, when drugtreated DNA 1samphfied, and the reaction 1sstopped m the exponential phase, the amount of product will be reduced compared to untreated DNA. Furthermore, the extent of the reduction will be proporttonal to the amount of damage caused by the drug treatment and by mcludmg a radtoacttve nucleottde m the PCR the extent of damage caused by particular treatments (and subsequent repair) can be accurately quantified. 1.1.2. SS-QPCR The method is outlined m Fig. 2 (as set up to measure lesions on the transcribed strand). DNA extracted from drug-treated and untreated cells is subjected to a first round “linear” PCR using a single btotmylated primer (5 1tB), complementary to the transcribed strand. This PCR generates a family of single-stranded molecules, some of which will be truncated because of the presence of a blocking leston on the transcribed strand of the template DNA. All are captured on streptavidm-coated paramagnetic beads and washed with NaOH to remove genomic DNA including any hybridized to the PCR products. After neutraltzation, the single-stranded molecules, while stdl attached to the beads, serve as templates m a second, exponential, PCR In the exponential amphfication the downstream primer (primer 2) is complementary to the transcribed strand and is nested with respectto primer 1 The upstream primer (primer 3) is complementary to the nontranscrtbed strand and its bmdmg site determines the length of the gene region m which damage is to be measured. In this PCR only those DNA molecules that were extended past the site of primer 3, ~.e., those that were not blocked by lesions on the genomtc DNA, will be exponentially amplified. Thus, provided the PCR remains m the exponential phase when stopped, the amount of product wtll be directly proportional to the amount of undamagedtemplate presentm the region under studyof the origmal genomic DNA. 1.1.3. Sslig-PCR The method of ssltg-PCR 1soutlined m Fig. 3. As with ss-QPCR tt mvolves a first round PCR usmg a single 5’-biotmylated primer, which defines the area of the gene to be investigated. Thirty cycles of linear amplificatton by PCR generates a family of single-stranded molecules of varying length for which the 5’ end is defined by the primer and for which the 3’ ends are defined by the posittons of the DNA-drug adducts. In order to exponenttally amplify these molecules, which are captured and isolated by binding to streptavtdm coated magnetic beads,a single stranded, 5’-phosphorylated, oligonucleotide is ligated to their 3’-OH ends usmg T4 RNA ligase. This oligonucleottde also bears a 3’-terrmnal amine group to block self-ligation. With both ends of the DNA molecules defined, they can then be exponentially amplified and detected. The sequence
160
-Capture on beads, - NaOH wash to remove hybndlzed DNA - TE wash
1 3-J i-
------
+tp@J
3-
-----,.,
-2
3
-------
W4-tB-@ Denature
Exponential Quantlftcatlon
I+.@ -2
and anneal
Amplification and of PCR product
Fig 2.
No Product
DNA Damage Detected by PCR-Based Methods
161
positions of the adducts are determined by electrophoresmg the sshg-PCR products on a sequencing gel. 2. Materials The followmg
lists equipment
and reagents required to detect damage at all
levels, i.e., from gene region down to single bases.Individual needs will determme what is necessary. For example, if damage and repair IS to be studied at the level of a gene region (300-2000 bp) and without any strand specificity then only those items necessary for QPCR will be needed. 2.1. Cell and DNA Treatment 1. Cells m suspensron or monolayer culture (see Note 1) 2 DNA-binding drug, e.g., Cisplatm, mechlorethamme, and so on 3 10X Teoa (store at 4’C; for treatment of naked DNA)* 250 mMTriethanolamme, pH 7.2, 10 mMEDTA 4 Drug stop solutron. 0.6M Sodium acetate, pH 5.2 5. Tissue culture plates (6-well, 24-well, and/or Petri dishes)
2.2. DNA Isolation 1 Cell lys~s buffer (store at room temp): 400 mMTrrs-HCl, pH 8.0,60 mM EDTA, 150 mMNaC1, 1% (w/v) sodium dodecyl sulfate (SDS) 2 5 M Sodium perchlorate (store at room temperature) 3, Chloroform. 4 37 and 65OC water bath 5 Rotary mixer 6 Mrcrofuge 7. Vacuum dryer
2.3. Oligonucleo tides Oligonucleotides were obtained from Genosys UK, or Pharmacia. Store all oligonucleotrdes at-20°C. The olrgonucleotrde sequences ~111 obvrously depend on the region of the gene to be studied. Those described here were used to
study damage and repair m a region comprismg mtron 1 of the human N-ras gene (see Table 1 for sequence). 2.3.1. QPCR 1. NRAS-A 5’-CCT AAA TCT GTC CAA AGC AGA GGC from the coding strand. 2. NRAS-B: 5’-CAG CAA GAA CCT GTT GGA AAC CAG from the noncoding strand Thus primer pan defines a 523-bp region of the N-ras gene mtron 1 Fig 2 (opposztepage) scrrbed strand)
Ss-QPCR method (as set up to measure lessons on the tran-
162
Amplnl**tOp
strand
.
.
Fig. 3.
DNA Damage Detected by PCR-Based Methods 2.3.2. Strand-Specific The following gene mtron 1.
163
QPCR (ss-QPCR)
primers ~111 measure damage in a 350-bp region of the N-ras
2.3.2 1. STEP 1 I To measure damage on the nontranscribed strand ofN-rus: 3 1nB (5’-Blotinylated): 5’-CAG CAA GAA CCT GTT GGA AAC CAG. 2 To measure damage on the transcribed strand of N-ras. 5 ItB (5’ Biotmylated): 5’-GGT CCT TCC ATT TGG TGC CTA CG. (These primers were obtained synthesized with blotin incorporated at the 5’-end) 2.3.2 2. STEP 2 3 Oligo 3.2, 5’-CCA GTA ATC AGG GTT AAT TGC GAG C 4 Ollgo 5 2 5’-ACG TGG GGA GAT CTT CGA GA
2.3.3. Single-Strand Ligation PCR (sslig-PCR, to measure damage on individual nucleotides) The following primers are required m addition to the primers above for ss-QPCR (3 lnB, 5.ltB, Oligo 3.2, Ohgo 5.2):
described
1 To measure damage on the nontranscrlbed strand. Oligo 3 3. 5’-GCG AGC CAC ATC TAC AGT AC 2 To measure damage on the transcribed strand Oligo 5 3 5’-TGG AGA CAG AAG GGA GAA TG 3 “Ligation Ohgonucleotlde ” 5’-p-ATC GTA GAT CAT GCA TAG TCA TA-n This ollgonucleotlde should be supplied gel or HPLC purified. It must also be 5’-phosphorylated (p) and bear a 3’-termmal amine group (n) to block self-hgatlon (these modifications should be incorporated at synthesis) 4. “Ligation Primer”* 5’-TAT GAC TAT GCA TGA TCT ACG AT This ollgonucleotlde, which 1s complementary to the “ligation oligonucleotlde,” must be gel or HPLC purified.
2.4. End Labeling
Oligonucleotides
(at 5’ end)
Oligonucleotides were end-labeled with T4 polynucleotide kinase using Glbco-BRL (Gaithersburg, MD) kits with forward reaction buffer 1. [Y-~~P]-ATP 10 #Z!lIpL (Amersham). 2. Forward buffer* 300 mM Tns-HCl, pH 7.8, 75 mM 2-mercaptoethanol, M&I,, 1.65 @4ATP
50 mM
Fig. 3. (opposite page) Sshg-PCR method (as set up to measure lesions on the nontranscribed strand).
Table 1 Human h-as, 484 434 384 334 284 234 184 134 84 34
lntron
CCTAAATCTG ATGCAGAGTG GCCAGAAATG GGTCCTTCCA AATGGGAAGG CGGGGAGTAA CCAAGGACTG CCAGAAGTGT CTTTAAGAAC ATAGAAGCTT TGGTTTCCAA
Numbermg
1 Sequence:
Nontranscribed
TCCAAAGCAG TTCGGCTTTG GAGCAGAATC TTTGGTGCCT AGTTGCGGCC TAGGAAGGGG TTGAAAAATA GAGGCCGATA CAAATGGAAG TAAAGTACTG CAGGTTCTTG
Strand AGGCAGTGGA GGATGTGGAA TATCAGCTGG ACGTGGGGAG TGGAGGTTCC GATCTCCATT GCTAAGGATG TTAATCCGGT GTCACACTAG TAGATGTGGC CTG
starts from the first base of the bmdmg site of Ohgo 3 3 (the underlmed
GCTTGAGGTA TGTTCAGGCG AGACAAAGGC ATCTTGGAGA TGCTAGAGCT GCTTAGGCTG GGGGTTGCTA GTTTTTGCGT GGTTTTCATT TCGCAATTAA
AGTTTATCTC TTTCACTGAT CTTGGGCGGG CAGAAGGGAG GAGAAGCCTT AGGGCGGGGC GAAAACTACT TCTCTAGTCA TCCATTGATT CCCTGATTAC
base) and corresponds to that In Fig. 6
DNA Damage Detected by PCR-Based Methods
165
2.5. PCR 2.5.7. All Reactions 1. TagPolymerase (Perkin-Elmer, Promega, Advanced Brotechnologtes, UK, and so on). 2 10X PCR buffer (see Note 5). 200 mM (NH&SO,, 750 mA4 Tris-HCl, pH 9.0, 0.1% (w/v) Tween 3. 25 mA4 MgC& (store at 4°C). 4 10X dNTP’s (Pharmacra): make a mixture containing 2 mA4 concentration each of dATP, dGTP, dCTP, and dTTP; store at -20°C 5 Thermal cycler (e g , MJ PTC-100 with heated lid see Note 6) 6. Mineral oil (if thermal cycler is without heated Itd facthty) 7 PCR tubes-O 5 or 0.2 mL
2.5.2. QPCR and ss-QPCR [c+~~P]-ATP be performed by TCA precipitation tive (item 2) is phosphor image
10 @Zi/~L (Amersham). Quantrtatron of the PCR product may one of two methods (see Note 13). One method (item 1) mvolves of the PCR product and scmtillation counting. The alternaquantitation by densitometric scannmg of autoradiographs or analysis after agarose gel electrophoresrs.
1. TCA precipitation. a. Whatman GFC filters (24~mm diameter) b, Multiple filtration mamfold (Mtlhpore) c. 5% TCA. 5% (w/v) trichloroacetic acid, 20 mM tetrasodmm pyrophosphate (store at 4°C) d. Scmtillatron flurd (Ecoscmt, National diagnostics) e. Scintillation counter (e g., Beckman LS 1800) 2. Agarose gel electrophoresis and densitometnc scanning or phosphor image analysts. a Equipment for horizontal agarose gel electrophoresis. b. 50X TAE: 2 M Tris-acetate; 0 05 M EDTA (per L 242 g Tris base; 57 1 mL glacial acetic acid; 100 mL, 0 5 A4 EDTA, pH 8 0) c Agarose. d 6X Agarose gel loading buffer. 0.25% bromophenol blue, 4% (w/v) sucrose in water. e. Gel dryer (suitable for agarose and acrylamide gels, e g , Hoeffer). f. Autoradiography cassette or phosphor Image cassette. g. Autoradrography film h. Standard equipment for X-ray film development 1. Gel Scanner or Phosphor Image analyzer,
2.5.3. ss-QPCR Only 1. Freshly prepared 0.4 M NaOH.
166 2.5.4. ss-QPCR and sslig-PCR 1 Streptavidm M-280 Dynabeads (Dynal, UK) 2 Magnet to capture beads-capacity at least six Eppendorf tubes, e g , MPC-E6 (Dynal, UK) 3 5X Washing and binding buffer (WBB, store at 4°C) 25 mMTris-HCl, pH 7 6, 5 mM EDTA, 5 M NaCl. 4 TE (pH 7 6) (store at 4’C) 10 n&f Tris-HCl, pH 7 6, 1 mM EDTA
2.5.5. sslig- PCR On/y 1 PEG (store at 4°C) 50% (w/v) PEG 8000 2 10X Ligation Buffer (store at -70°C): 0.5 MTns-Cl, pH 8.0,lOO mMMgCl,, 10 rnJ4 hexammme (III) cobalt chloride, 100 yg/mL bovme serum albumm, 200 w ATP. To make 1 mL 500 pL 1 MTris-HCl, pH 8 0,100 uL 1 MMgCl,, 10 pL 10 mg/mL BSA, 2.68 mg hexammme (III) cobalt chloride, 2 uL 100 mh4ATP, 388 pL H,O. 3 T4 RNA Llgase (New England Biolabs, activity = 20 U/pL, store at -20°C) 4. Sequencmg gel loading buffer. 96% (v/v) formamide (deionized), 20 mMEDTA, 0.03% (w/v) xylene cyanol, 0.03% (w/v) bromophenol blue. 5. Sequencing gel* 6% sequencing gels were prepared wtth Sequagel (National Diagnostics) Composition ,5 7% acrylamrde, 0.3% bu-acrylamide, 8 3 MUrea, 0 1 A4 tris-borate, pH 8 3, 2 mMEDTA 6. TEMED. 7 50% (w/v) ammonium persulfate (store at 4’C) 8. Sequencmg gel apparatus: at least 60 cm long, 20 cm wide, and 0 4 mm thick Suppliers include Kodak-IBI and Life Technologtes 9. 10X TBE: 0.9 M Trrs-borate; 0.02 M EDTA (per La 108 g trrs base; 55 g boric acid, 7.44 g Na-EDTA) 10 Equipment for horizontal agarose gel electrophoresis. 11 Gel dryer (suitable for acrylamide gels; e.g., Hoeffer) 12 Autoradiography cassettes (43 x 35 cm) 13 Autoradrography film 14. Standard equipment for X-ray film development
3. Methods 3.1. Treatment
of Isolated DNA
1 Use 0.5 pg DNA for QPCR and ss-QPCR and 3 pg DNA for sslig-PCR per reaction. 2. Incubate DNA with drug for 1 h at 37°C m Teoa ma total volume of 50 pL m 1.5~mL microfuge tubes 3. Add 50 pL 0.6 M sodium acetate “drug stop” solution and precipitate DNA with 3 ~0195% ethanol 4. Wash DNA pellet with 2 x 1 mL 75% ethanol (room temperature) and dry under vacuum 5 Resuspend DNA m deionized 10 pL Hz0 ready for PCR.
DNA Damage Detected by PCR-Based Methods
767
3.2. Treatment of Cells 3.2. I. Suspension Cultures 1. Count cells and resuspend at a density of 2 x IO6 cells/ml m tissue culture medium with or without fetal calf serum as requn-ed (see Note 2). 2 Add required amount of drug (dissolved m tissue culture medium or Isotonic solution) to the wells of 24-well tissue culture plates. 3. Add tissue culture medium to make the volume up to 0.5 mL 4 Add 0.5 mL of cell suspension (1 x 1O6cells) and incubate at 37°C for appropnate time 5 Transfer cells to 1.5-mL mlcrofuge tubes, wash out wells with 0 4-mL tissue culture medium and add to tubes Spm for 5 mm at 27Og, 4°C 6 Remove supematant and wash cells-by resuspendmg and spmnmg-with 3 x 1 mL tissue culture supernatant 7 After washmgs remove supematant At this pomt the cell pellet may be stored at -20°C untd DNA isolation For repalr experiments the cells are resuspended in 1 mL tissue culture medium, with fetal calf serum, transferred to a fresh 24-well plate and incubated at 37°C for appropriate times before harvesting the cells.
3.2.2. Adherent Cells 1 Grow cells to almost confluence m 2-cm diameter wells 2 Treat with drug as for suspension cells except the drug is added together in I-mL tissue culture medium to avoid adding concentrated drug directly to the cells. 3. Incubate as for suspension cells 4. Remove drug medium and gently wash cells three times with 1 mL fresh tissue culture medium (see Note 3). 5 If repair experiments are to be carried out, add tissue culture medmm with serum and incubate for appropriate times. 6 Harvest the ceils by trypsmlzatlon and spin as for suspension cells These cells may be stored at -20°C
3.3. DNA Isolation 1. 2 3. 4. 5. 6. 7. 8
9.
Resuspend cell pellet m 340 yL cell lysis buffer Add 100 pL 5 A4 sodium perchlorate. Incubate at 37°C for 20 min, mixing occasionally Transfer to a 65°C water bath and incubate for 20 min with occasional mixing by inversion Add 580 yL chloroform precooled to -20°C. MIX by rotation for 20 min at room temperature. Spin in microfuge at 11,600g for 10 mm. Remove half (220 pL; equivalent to 5 x lo5 cell from suspension cultures) upper aqueous layer, transfer to fresh 1.5-mL microfuge tube and add 440 PL absolute ethanol (kept at -2O’C) to precipitate DNA (see Note 4). Spin at top speed m a microfuge for 20 min and wash DNA pellet with 2 x 1 mL 75% ethanol (kept at room temperature).
Gritnaldi and Hartley
168
10 Dry the DNA pellet under vacuum 11 Resuspend pellet in H,O. The amount of H,O to use depends on which experiment is to be carried ouk-QPCR* resuspend in 250 pL H,O, use 50 pL per PCR; ssQPCR and sshg-PCR. resuspend m 50 PL H,O, use 10 yL per PCR
3.4. QPCR The efficiency and specificity of PCR often depends on the MgCl, concentration m addition to the annealmg temperature. These parameters should, therefore, be established by titration before proceeding with damage experiments. Initial
optimization
of PCR can be performed
without radioactivity,
the
performance being assessedby ethidium staining of agarose gels. With QPCR (and ss-QPCR, see Subheading 3.5.) DNA damage m the region of the gene under study leads to a reduction m the amount of PCR product, (see Subheading 1.). It is essential to ensure that the only hmitmg component of the PCR 1sthe template DNA and that the reaction remains in the exponential phase when terminated so that any damage to DNA will cause a directly proporttonal reduction m the amount of radioactive product. The important factors are cycle number and quantity of DNA, so prehmmary experiments must be performed to determine the condrtions required. The first experiment to do is to keep the amount of DNA constant at, for example, 0.5 pg and vary the number of cycles between 20 and 30 cycles. After quantitation of the radtoactive product, the results should show an exponential mcrease in the amount of amplified product with increasing cycle number (see Fig. 4A) A cycle number is then chosen, which is well wtthm the exponential range but which generates sufficient amplified DNA to be easily measured. In the N-vus example 26 cycles were chosen. Next a DNA titration is performed using this fixed number of cycles, the amount of DNA is varied between 0.1 and 1.O pg and the amount of amplified product should increase linearly m direct proportion to the amount of starting DNA (see Fig. 4B). These experiments thus establish the conditions under which QPCR and ss-QPCR will give a quantitative measurement of the amount of DNA template available for amplification (i.e., free of damage) and DNA damage experiments can be performed. 1. Reaction components and template DNA are mixed in a volume of 100 pL containing 50 pmol of each primer NRAS-A and NRAS-B; 2 U tuq polymerase; 2 pCi [a-32P]-dATP; 200 pMeacb dATP, dGTP, dCTP, dTTP; 1 5 mMMgC1, (see Note 7), 10 pL 10X PCR buffer. If necessary, add 40 pL mineral oil overlay. 2. Place tubes m thermal cycler and carry out cycling as follows. 3 min at 94OC initial denaturation then 26 cycles of: 1 mm at 94”C, I mm at 60°C (annealing temp-+ee Note g), 1 min at 72OC This is followed by a final incubation of 4 min at 72°C 3. For quantitative results each PCR should be carried out m triplicate and the followmg controls are essenttal: a. No DNA m PCR.
DNA Damage Detected by PCR-Based Methods
20
22
24
26
169
28
30
Cycles
0
Fig. 4. (A) Exponential QPCR. 0.5 ug untreated genomic DNA was subjected to QPCR usmg primers to amplify a 523-bp region of intron I of the N-ras gene The reaction was stopped after varying numbers of cycles and the product wasmeasured by scintillation countmg after TCA precipitation. (B) DNA tttration. Varymg amounts ofuntreated genomic DNA were subjected to 27 cycles of QPCR, the PCR product was measured as above b. Untreated DNA c. Samples contammg l/3 and 2/3 amounts of untreated DNA. If the reaction 1s stopped in the exponential phase, then these samples should yield l/3 and 213 amounts of PCR product and thus control for the linearity of the PCR and guarantee Its quantitative nature
Grimaldi and Hartley
170
3.4 1 Quantitation of QPCR Product One of two methods can be employed
(see Note 13).
1 TCA prectpttatton a Transfer 40 uL PCR product to 1 5-mL mtcrofuge tubes and add 1 mL 5% TCA mix b Load Whatman GFC filters mto vacuum filtratton manifold c Rinse filters with 1 mL 5% (ice-cold) TCA mix d Load PCR product/TCA mix on filters. e Wash filters with 10 mL 5% TCA mix (ice-cold) and 10 mL absolute ethanol (ice-cold) f. An-dry filters, place m scinttllatron vials, and add 5 mL scintillatton flutd g Count on scintillation counter 2 Autoradrography and densttometrtc scanning or phosphor Image analysis a MIX 10 pL PCR product with 2 pL 6X agarose gel loading buffer and electrophorese in 1 5% agarose gel (see Note 9) b Dry gel on slab gel dryer and expose gel to X-ray film or phosphor image cassette c Develop film or cassette and quantttate bands by scannmg or phosphor image analysis
3.4.2 Expression of Results 1 The simplest way of expressmg results is as a percentage decrease of PCR product (compared to untreated DNA control) as drug concentratton increases (Fig. 5A) Repan of damage IS seen as a recovery of the amount of PCR product wtth time (Fig. 5B) 2 With relattvely nonsequence specific drugs such as cisplatm and mechloethamine, the dtstrtbutton of DNA adducts can be considered to be random and the number of lesions per strand m the region defined by the primers can be calculated using the Poisson equation Lesions/strand = -In (Ad/A) where A 1sthe amount of PCR product from undamaged template and Ad 1s the amount from damaged template. In this way, quantttative compartsons between drugs can be made. It 1s Important to remember that each strand is a template m the PCR and, therefore, the Poisson formula gives results and lesions per strand This should be doubled to arrtve at a figure for the number of lesions per doublestranded region of the gene under study 3.5. ss-QPCR
Preliminary experiments need to be carried out to establish condltlons for the speciklty and efficiency of the PCR and for linearity of the assay. These are exactly the same as described for QPCR (Subheading 3.4.) ss-QPCR m fact, measuresDNA damage in the sameway as QPCR, the rationale IS the same,and the amount of DNA used as template 1sthe same. Extra steps are required to make
RNA Damage Detected by PCR-Based Methods
1
QM
3
Cont.
(PM;
7oooo -B 60000 $1 z 50000 0 40000 -
Repair
Time
(Hours)
Fig. 5. (A) Inhibition of QPCR. K562 cells were treated with qumacrme mustard for 1 h at the doses indicated, DNA damage was measured by QPCR and the 523-bp N-m PCR product was measured by scintillation counting after TCA precipltatron (B) Repair of Quinacrine Mustard lesions K562 cells were treated for 1 h with 1 ).&f qumacrme mustard and allowed to repair for the indicated time periods. Damage and repair was measured by QPCR and the amount of PCR product was determined as above. The data point at around 60,000 cpm (0 h) represents DNA from untreated cells.
this assaystrand specific (see Fig. 2). The protocol described here usespnmers that measure damage in a 350-bp region of intron 1 of the human N-rus gene.
172
Grimaldi and Hartley
3.5.1. PCR-1 1. The single primer used m the first round determmes on which strand the damage will be measured (I.e., using a primer complementary to the transcribed strand will detect damage on the transcribed strand). First round “linear” PCR 1scarried out m a volume of 40 pL contammg 0.6 pmol of 5’-blotmylated primer 5. ItB, I U taq polymerase, 200 pA4 each dATP, dGTP, dCTP, dTTP; 2.5 mA4 MgCI, (see Note 7), 10 yL 10X PCR buffer If necessary, add 40 p.L mmeral oil overlay 2 Place tubes m thermal cycler and carry out the followmg: an initial denaturatlon step of 3 mm at 94°C and then 20 cycles of 94°C for 1 mm, 60°C (see Note 8) for 1 mm and 72°C for 1 mm This IS followed by a final mcubatlon of 4 mm at 72°C 3 If mineral oil was used this needs to be removed as follows Add 60 pL Hz0 and 100 pL water-saturated chloroform. Spm tubes bnefly, remove upper aqueous layer and transfer to 1.5-n& microfuge tubes. Add a further 100 pL Hz0 to the original PCR tubes, spm agam, and remove the aqueous layer and add to the 1.5~mL microfuge tubes Precipitate DNA with ethanol and after drying resuspend m 50 pL 1X WBB
3.5.2. Capture of PCR Products 1 Transfer streptavldm-coated Dynabeads to a 1 5-mL mlcrofuge tube Use 5 pL per PCR plus an extra 5 pL (e g , for 10 reactions transfer 55 pL beads) 2 Place tube m magnetic rack to sediment beads (about 30 s) and then remove supernatant-keep tubes m magnetic rack’ 3 Remove tube from magnetic rack and resuspend beads in 200 pL 1X WBB Replace m rack to sediment beads and remove supernatant Repeat this washing process one more time 4 Resuspend beads m 1X WBB using 40 pL per PCR (1 e., for 10 tubes resuspend m 400 pL). Mix well and transfer 40-)1L ahquots to 1 5-mL tmcrofuge tubes 5. Place tubes in rack to capture beads and remove supernatant. The beads are now ready for the addition of the PCR mix. 6 To the 40 pL PCR mix add 10 yL of 5X washing and binding buffer (WBB) and transfer mixture to the washed beads. If mineral 011was used m PCR- 1, transfer the resuspended DNA (from step 3, Subheading 3.5.1.) directly to the beads without adding 5X WBB 7 Incubate at 37°C (not m magnetic rack) for 30 min with occasional agitation to resuspend the beads. 8. Place tubes in rack to sediment beads, remove supernatant, and wash three times with 200 pL freshly prepared 0.4 A4 NaOH and then 1X with 200 pL TE 9 Resuspend beads in 40 pL H,O and transfer to PCR tubes
3.5.3. PCR-2 1 The second round, exponential PCR is carried out m a volume of 100 pL contammg the DNA template still attached to the beads The reaction 1sthe same whether
DNA Damage Detected by PCR-Based Methods
173
damage 1sto be measured on the transcribed strand or the nontranscrtbed strand smce this spectfictty was determmed by PCR- 1. The components of the PCR are as for PCR- 1 (Subheading 3.5.1.) except for 50 pmol each primer Oligo 3 2 and Oligo 5.2, 2 U taq polymerase, 2 uCi [a-32P]-dATP. 2. Cyclmg condrtions An mittal denaturatron step of 2 min at 94’C and then 26 cycles (see Note 12) of 94°C for 1 min, 60°C (see Note 8) for 1 min and 72°C for 1 mm with a final mcubatron of 4 min at 72°C. 3. The controls required are the same as those for QPCR (Subheading 3.4., step 3) with one addition to control for the efficiency of the washing of the beads after PCR- 1 Thrs is vital as any carry-over of genomic DNA would provrde template for the exponential PCR-2 and lead to abnormally high results. Therefore, m PCR- 1, control samples must be included that contain all components except taq polymerase and in the PCR-2 they are treated as for the test samples, 1.e , with taq polymerase Values above background with these samples would indicate genomic DNA carry over and invalidate the assay 4. The PCR product IS quantified, and the results expressed, m exactly the same way as for QPCR-see Subheadings 3.4.1. and 3.4.2.
3.6. sslig-PCR 3.6.1. PCR-1
(see Notes 18 and 19)
Follow exactly the same protocol 3.5.1., steps l-3).
as for PCR-1 in ss-QPCR
(Subheading
3.6.2. Capture of Biotinylated PCR Products 1 Follow steps l-7 in Subheading 3.5.2. 2. Place tubes in magnetic rack, remove supernatant, and wash beads three times wrth 200 pL TE. 3. Resuspend beads in 50 pL Hz0 and spin briefly in a microfuge to bring all the hqmd to the bottom of the tubes
3.6.3. Ligation of Ligation Oligonucleotide 1. Prepare ligation mix The ligation is carried out in a volume of 10 pL Sufficient mix IS prepared to give 10 pL more than required, t.e , for ten tubes a mix of 110 pL is prepared. The cornpositron of the mix (per tube) is as follows: 5 PL 50% PEG, 1 uL ligation Ohgonucleotide @ 20 pmol/pL, 1 pL 10X ligation buffer, 2 pL H20, 1 pL T4 RNA Ltgase @ 20 U/pL. 2. Place the tubes contammg the bead suspension in the magnetic rack to sediment the beads and remove supernatant. 3. Resuspend the beads in 10 pL ligation mrx and ligate overnight at room temperature. 4. After hgatron add 180 pL TE and place tubes in magnetic rack 5. Remove supernatant and wash beads three times with 200 pL TE. 6 Resuspend beads m 40 PL Hz0 ready for PCR-2
174
Gnmalcli and Hartley
3.6.4. PCR-2 and PCR3 1 The second round PCR is carried out in a volume of 100 uL contaming the DNA template on the beads Two primers are used hgatton primer and either Ohgo 3 2 or Ohgo 5 2, dependmg on which strand adducts are to be measured In the N-ras example, to measure adducts on the nontranscribed strand Ohgo 3 1nB is used m PCR-1 and, therefore, Ohgo 3.2 wtll be used m PCR-2 (and 3 3 m PCR-3) 2 The beads, suspended m 40 uL H20. are transferred to PCR tubes contammg the PCR mrx. The reaction composition is as follows 10 pmol Oligo 3 2, 10 pmol ligation primer, 2 5 U taq polymerase, 200 luV each dATP, dGTP, dCTP, dTTP, 2 5 mM MgCI, (see Note 7), 10 uL 10X PCR buffer 3. The cycling conditions are an mmal denaturatron at 94°C for 5 mm then X cycles of 94°C for 1 mm, 58’C for 1 mm (see Note 8), 72°C for 1 mm + 1 s extension per cycle with a final 5-mm step at 72°C The number of cycles (X) m this step has to be determmed empirically for each set of prtmers It generally falls between 22-28 cycles (see Note 16) 4 PCR-3 is carried out untnediately after PCR-2 is finished Add to the tubes 10 uL of PCR mix contammg 1 uL 10X PCR buffer, 5 uL (5 pmol) 32P 5’-end labeled Ohgo 3 3 (see Subheading 3.6.6.), 1 U taq polymerase, 1 pL 10X dNTP mtx, 2 5 mM MgCl* (see Note 7) 5 A further four cycles are performed* 94’C for 1 mm, 64°C for 1 mm (see Note 8), and 72°C for 1 mm with a final 5-mm step at 72°C 6 Spin PCR tubes briefly m a microfuge (remove mmeral oil at this pomt if necessary) and transfer supernatant to 1 5-mL microfuge tubes Rinse the PCR tubes with 100 uL H20, spin, and add to the mrcrofuge tubes Precrpitate with 3 vol 95 ethanol (kept at -20°C) and dry under vacuum.
3.6 5. Sequencing Gel 1. Resuspend DNA (radtoactive) in 5 uL sequencing gel-loading buffer and electrophorese m 6% acrylamtde sequencing gel at 2500-3000 (see Note 17) 2 Dry the gel onto Whatman 3MM paper, supported by a layer of Whatman DE 8 1 paper to bmd the shorter fragments, whtch ~111 pass through the 3MM 3 Expose gel to X-ray film, usually overnight is sufficient to give a srgnal Sometimes an intenstfymg screen may be requtred and if so the film IS exposed at -70°C
3.6.6. Oligonucleotide
5’ End Labeling
1 Five picomoles of end-labeled ohgo 3.3 or 5 3 are required for each tube m PCR3. For 10 samples label 55 pmol: In a 1.5~mL microfuge tube, add 12.5 uL H20, 5 5 pL Oligo 3 3 or 5 3 (at a concentration of 10 pmol/uL), 1 uL T4 polynucleotide kmase (5 U/pL), 1 yL [T-~*P]-ATP (10 uCt/uL), 5 uL 5X reaction buffer. 2 Incubate at 37°C for 30 mm, add 25 uL H20 and separate unmcorporated nucleottde from the labeled ohgonucleotide either by ethanol prectpltatton or by usmg a spin column (e g , Bio-Spm-6; Bio-Rad) Use labeled ohgo as directed m Subheading 3.6.4.
175
DNA Damage Detected by PCR-Based Methods “Naked” DNA
cells 10
@IAT436
pM Cisplatin
IO
_ , s 300-
t
Pvu II Site
““; i y& 9<“% %&$ bX s j9
i
*;j&
i
i $i,”
J
2 c:*. &g 1 i *
‘i* fi* *A /
\
250-
1 I e
: i
* . #l bem (we ‘“x”’ “%
t-02 f-
200 -
/*n*
05
*f q&
,-
ve a
b-63
i //
a
’
c-
: ; ‘.
r
02
5
1)
* *
/
is/ 4
**
150-
1 ‘*
‘702
-‘/
3105
=
’ 1 n
F :
AGA
7*5’T&!x3
1 I"
llO-
“f :
7
: G 3
Fig. 6. Sslig PCR: Concentration-dependentformation of cisplatin and AT-486 adductson the nontranscribedstrandof intron I of the N-rus gene.For cisplatin adduct formation is compared in cells and naked DNA. The bands on the autoradiograph representadductsformed in cells treated for 18 h with cisplatin or 2 h with AT-486. DNA extractedfrom cells was cut with PvuII before sslig-PCRto createa defined stop site on lesion free templates. The asterisk next to the sequence5’-TACT indicates cisplatin lesion sitesthat were cell specific and were not found in treatednaked DNA. For AT-486, the arrow indicatesthe sequence5’-GATC.
176
Grimaldi and Hartley
3.6.7. Interpreting the Data 1 The resulting autoradlograph ~111 be similar to that of a sequencing gel except that the bands will not be regularly spaced. Figure 6 shows the results from treating cells with clsplatm and AT-486 (a novel sequence selective cytotoxlc agent). The bands seen in treated cells and not m untreated controls correspond to the position of the adducts in the sequence of mtron 1 of the N-ras gene, and the sequence selectlvlty of AT-486 IS clearly demonstrated The intensity of the bands IS dose-dependent and the amount of damaging agent to use m the treatment 1s important; it should produce at most 1 adduct per strand m the region studled. The reason for this IS that the taq polymerase ~111 be blocked by the first adduct it encounters and, therefore, If more than one adduct per strand IS present, the final result ~111 not give an accurate representation of the dlstnbutlon of adducts. 2. There are several ways to determine the nucleotlde position of the adduct Generally an overexposure of the autoradlograph will give enough background to produce a ladder of bases so that the posltlon of the adduct bands can be counted from the primer This IS the easiest way-the size of the ligation ohgonucleotlde must be taken into account as this will add 23 bases (m the example descrtbed m Subheading 2.3.3.) to the posltlon of the adduct. Sslig-PCR can also be used for genomic sequencmg so this can also be used as a method of assignmg the posmon of the adduct Genomlc sequencing reactions are performed on isolated DNA and the sshg-PCR carried out together with the drug-treated samples The sequencmg samples are then run on the gel alongslde the treated samples The descnptlon of the genomic sequencing reactions IS beyond the scope of this chapter, but details can be found m Pfeifer et al (6) 3 Quantltatlon of the Intensity of mdlvidual adducts can be carried out by Image densltometry or phosphorlmaging
4. Notes 4.7. Cell Treatment 1 The methods described are apphcable to the study of DNA damage m any type of cell, not Just transformed lines m culture For example, damage can be studied m freshly Isolated lymphocytes or cell preparations from sohd tissue 2. Cells are treated m tissue culture medium m the presence or absence of fetal calf serum according to the agent used and the length of mcubatlon Short mcubatlons (e g , l-5 h) may be carried out m serum-free medium If the damaging agent IS also likely to react with serum proteins. Depriving the cell of serum ~111, however, disrupt the cells homeostatlc environment and this should be taken mto account when designing experiments and interpreting results It has been found that the DNA-damaging effect of clsplatin 1s not slgmficantly diminished when cells are treated m the presence of 5% serum despite the known reactlvlty of clsplatin with protein Different agents WIII no doubt behave m different ways, and whether or not to Include serum ~111 have to be determmed empirlcally
DNA Damage Detected by PC/?-Based Methods
177
3. It might be found that during the treatment of adherent cultures some cells have detached themselves from the wells. If so, these should be harvested by centrifugation and washed as for suspension cells before addmg them to the cells harvested from the wells by trypsinization. 4. When DNA 1sprepared from adherent cultures, the amount of the aqueous DNA contammg layer to be removed will depend on cell size smce a monolayer culture of large cells wrll obviously yield less DNA than a culture of smaller cells With care it is possible to remove up to 400 pL without disturbmg the Interface
4.2. General PCR 5
6. 7 8 9.
10.
10X PCR buffer is supplied with the taq polymerase. Of those tried, good results have been obtained with the Advanced Biotechnologies (UK) enzyme using their Buffer IV-buffers that contam a small amount of detergent tend to grve the best results The heated hd feature is very useful as it removes the need to extract PCR samples with chloroform to remove the mineral oil The amount of MgCl, to use depends on the primers and the gene region being amplified. The concentration used here is optimum for the N-ras primers used for QPCR The annealing temperature ~111depend upon the primers being used The percentage agarose to use in electrophoresis of PCR products depends on the size of the amplified DNA fragment-m this case 1.5% is appropriate for a 523-bp molecule. Hot Start is a simple procedure that can improve specificity The idea ts that all the components of PCR come together at a high temperature to avoid nonspecific priming at lower temperatures The technique 1sas follows The PCR mixture is prepared with all the components except taq polymerase and the tubes are placed in the cycler block. The machine is programmed so that before cyclmg starts, there will be an initial denaturation step of 3 mm at 94°C followed by a 5-mm pause at 80°C at which pomt the taq polymerase IS added. It IS convement to add the quantity of tuq required m a volume of 5 uL. Place the tip of the pipet on the mstde wall of the tube and lower it carefully to the bottom, expel the contents, then remove the tip carefully keeping it pressed up against the tube wall. The cycling then commences with the first step being 1 mm at 94°C.
4.3. QPCR (see also notes above for general PCR) 11. The titration experiments are carried out under saturating PCR conditions The ethidium-stained gels and autoradiographs may show some secondary bands in addition to the expected product. If their intenstty is low it is often found that they are not present at the lower cycle number used in the quantitattve PCR expenments. This should be confirmed as the generation of a single specific product is particularly important if quantitation by TCA precipitation is used (Subheading 3.4.1.). 12. The number of cycles to use to ensure that the reaction is stopped during the exponential phase must be determined empirically. The example here IS appropriate for the N-ras regron amplified.
178
Grimaldi and Hartley
13 Two methods are given for quantitatton TCA prectpttatron is the simplest and quickest, however, rt 1s important to ensure beforehand (by electrophorests and autoradiography) that the condmons of the PCR yield a single speclftc product of the expected size. If this IS not the case then electrophorests and quantttatton by densrtometry or phosphor imaging would be appropriate
4.4. ss-QPCR (see also notes above for general PCR and Notes 11-13) 14 The acttvtty of the thermostable polymerase, efficiency of pnmers, quality of the genormc DNA template, and appropnate annealing temperatures can be determined by conventional PCR If the pnmers are inefficient the presence of formamide (l-l 0%) and/or DMSO (l-10%) in the PCR can often improve both effictency and spectfictty. 15 It has happened that primers that should have been btotmylated were not Also there was one batch of paramagnettc beads that dtd not bmd efficiently These are rare occurrences, but nevertheless possible and quite easy to test for a Incubate 10 pmol of btotmylated primer with 5 pL of washed beads, m PCR buffer for 10 min, sediment the beads and use the supernatant m a conventional PCR Most of the btotinylated primers should be removed by the beads and, therefore, the quantity of product should be stgmficantly reduced (usually by at least 50%) compared to the product obtained with uncaptured pnmers It may not be completely reduced unless pure primers are used because the “failure sequence” oltgonucleottdes present (which would not bear the 5’-btotm), although being shorter can still participate m the PCR It IS also a good idea to perform this test m parallel using an unbtotmylated primer pair (of the same sequence) to control for any dilution or loss of primer that may occur when mcubatmg with the beads or: b Carry out a conventional PCR with 10 pmoles of each primer, one of which being btotinylated Then capture the product on the beads, run the unbound fraction on an agarose gel and a reduction m product after capture (of around 50%) will be observed if all 1sfunctlonmg correctly Again it 1sa good idea to run a parallel test with unbtotmylated primers
4.5. sslig=PCR (see also notes above for general PCR and Notes 14 and 15) 16. The optimum number of cycles will give the best signal-to-noise ratio. This falls within the exponential range of the reaction, which 1s important when quantltation of mdivtdual adducts 1s to be carried out-espectally m repair experiments 17. Gels should be as long as possible, preferably 80 cm rather than the usual 40-cm gels used for sequencing This is because 32P 1sused as the isotope, which gives less resolutton compared to 35Sas used m dtdeoxy sequencing. If long gel equtpment IS not available, the shorter gels can be run for longer, rtmnmg the shorter fragments off the bottom of the gel. It should be remembered that the buffer m the lower chamber will become radtoacttve
DNA Damage Detected by PCR-Based Methods
179
18. It is often useful to digest the DNA after isolation and before sslig-PCR wtth a restriction enzyme that cuts around 200-400 bases upstream of the primers used This creates a full-length stop site where taq polymerase will be stopped m the absence of downstream damage. As shown m Fig. 6, the intensity of thts band reduces as drug concentration mcreases because of the downstream drug-DNA adducts This reduction can be quantitated by densttometry or phosphor imagmg and the values can be used with the Poisson equation to give an estimate of the average number of lessons per strand (see Subheading 3.4.2., step 2). 19. The restrictton digested DNA IS also useful in the mmal stages of settmg up the sshg-PCR for new gene regions The intensity of the full-length band will give a measure of the efficiency of the sshg-PCR when using untreated DNA 20. One batch of T4 RNA hgase was apparently contammated with exonuclease activity, which removes the 3’-termmal amine block on the ligation ohgonucleotide. The result on the autoradiograph is a ladder of intense bands at intervals of 20-23 bp because of serial self-ligation (the ligation ohgonucleotide is 23 bp). The efficiency of the ligation step can be tested using donor and acceptor nucleotides as described m Tessier et al (7) If exonuclease IS present the labeled ohgonucleotide will be degraded. 21. The mam reason for poor resolutton of bands on the autoradiograph is inadequate drying of the sequencing gel before autoradiography 22. A common problem encountered when setting up sshg-PCR is too much background, that IS, nonspecific bands on the autoradiograph caused either by spontaneous premature termmation of primer extension, or nonspecific primer bmdmg, m the first round of PCR There are several possible reasons why this may occur: a Nonoptimal MgCl, concentration especially m the first round, lmear PCR, b Annealing temperatures too low, c Too much genomic DNA template m the first round PCR; d. Too many cycles m the second round PCR (As with all PCR assays a small level of background IS inevitable This level ~111 be exaggerated if too many cycles are used m the exponential second round PCR )
References Satki, R. K., Scharf, S , Faloona, F , Mulhs, K. B., Horn, G T., and E&h, H A. (1985) Enzymatic amplification of beta-globm genomic sequences and restriction site Analysis for diagnosis of sickle-cell anemia Sczence 230, 13X-1354. Grimaldi, K A , Bingham, J P , Souhamr, R. L., and Hartley, J. A (1994) DNA damage by anticancer agents and its repair: mappmg m cells at the subgene level wrth quantitative polymerase chain reaction. Anal Blochem 222,23&242 Bingham, J P, Hartley, J A., Souhami, R L., and Grimaldt, K A (1996) Strandspecific measurement of ctsplatm-induced DNA damage and repair using quantitative PCR. Nucleic Acrds Res 24,987-989. Grimaldi, K A., McAdam, S R., Souhamt, R L , and Hartley, J A. (1994) DNA damage by anti-cancer agents resolved at the nucleotide level of a single copy gene. evidence for a novel binding site for cisplatm in cells Nuclezc Aczds Res 22,231 I-2317
180
Grimaldi and Hartley
5. Lommel, L. and Hanawalt, P C. (1993) Increased UV resistance of a xerodermapigmentosum revertant cell-line is correlated with selecttve repair of the transcribed strand of an expressed gene A401 Cell. Bzol. 13,970-976. 6 Pfeifer , G P , Stetgerwald, S D , Mueller, P R., Wold, B , and Riggs, A D (1989) Genomic sequencing and methylation analysis by ligation mediated PCR. Science 246,8 1O-8 13 7. Tessier, D., Brousseau, R , and Vernet, T (1986) Ligation of smgle stranded oligodeoxyrtbonucleotides by T4 RNA hgase. Anal Bzochem 158, 17 l-l 78
12 Analysis
of DNA-Binding
Antibodies
Jeremy S. Lee, Laura J. P. Latimer, and Jamshid Tanha 1. Introduction DNA-binding antibodies are produced spontaneously in the autonnmune dlsease systemiclupus erythematosus(1). The origin of these antlbodies IS obscure, but they are involved in the pathogenesls of the diseasethrough the formation of immune complexesthat mdlrectly causetissuedamage.Alternatively, the antibodies may crossreactwith cell surface antigens and cause tissue damage directly. Thus, understandmg the specificity of autounmune antIbodIes 1simportant. Antibodies that bind unusual DNA structures can also be used as probes. For example, with the aid of immunofluorescence techniques, “2” DNA and triplex structures can be found In eucaryotlc chromosomes (2,3). Again, these studies are only possible if the specificities of the antibodles are well-defined. In this chapter,three techniquesfor the analysisof DNA-bmdmg antibodieswill be described.The simplest is a direct Solid PhaseRadio-Immune Assay (SPRIA) The antibodies arebound to a nucleic acid, which is coated on the wells of a plastic plate. In turn, the nucleic acid-binding antibodies are detectedwith an ‘251-labeledsecond antibody. The wells areexcisedand the radioactivity is measuredin a y-counter The assayis applicable to most nucleic acids,but can only give arough measureof specificity becausethe amount of antibody bound to the well depends on the amount of fixed nucletc acid, and this tends to be quite vanable. The sensitivity of the assayIS excellent (1O-l 00 ngknL of antlbody) especially if high-mol-wt nucleic acids are employed. For this reason, a snnple method for the preparation of synthetic repeatmg-sequenceDNAs with bacterial polymeraseswill be described first. The template for the polymerase is a duplex oligonucleotlde that only need be 10-20 bp m length. Because the sequence is repeated, the two strands can slip giving nse to free 5’ overhangs containing a free 3’-OH, which will be filled in by the polymerase. This processcan be repeated many times resulting m polymers up From
Methods
III Molecular &logy, Vol Edlted by K R Fox Humana
181
90 Drug-DNA Interact/on Press Inc , Totowa, NJ
Protocols
182
Lee et al. DIRECT SPRIA
COMPETITIVE
L
SPRIA
b--
DNA
2
DNA
Wash and add 12’1labelled second antibody
DNA
Wash and add ‘2sIlabelled second antlbody
Fig 1. Diagram of the key steps m the direct and competitive SPRIA
to 1000 bp m length. These DNAs are excellent antigens for use rn SPRIA and also m T, measurements(seeChapter 15) sincethey give rise to very sharp transmons Some repeating sequence DNAs can be made by PCR (e.g., poly[d(TG)] . poly[d(CA)]), but most cannot (e.g., poly[d(TC)] * poly[d(GA)] or poly[d(AT)]) The second technique IS a modtfied SPRIA. A competing DNA IS added to the aqueous phase that, tf the anttbody binds, will reduce the amount bound to the solid phase (Fig. 1). This competitive SPRIA allows the measurement of relatrve binding constantsand, thus, comparatrve spectficmes can be determmed Fmally, fluorescence polarization spectroscopy will be described. Briefly, the polarization of a chromophore such as fluorescein 1sdependent on the tumbling time and, thus, on the molecular mass of the molecule to which the fluorescem is attached. A fluorescem-labeled olrgonucleotlde has a low polarlzatron that increases when it 1scomplexed with an antibody. Antlbody + Fluorescem-labeledOhgo Low polarization
-
Complex High Polarization
DNA-Binding Antibodies
183
Binding curves can be constructed by measuring the polarization as a function of antibody concentration. From theseplots, absolute binding constantsand other binding parameters can be calculated. The method is very powerful smce bmdmg can be measured under a variety of conditions and fluorescein-labeled ohgonucleotides can be made at most DNA synthesisfacilities. It is applicable to Fab fragments, smgle-chain variable region fragments (scFv), or indeed any DNAbinding protein One disadvantage is that fluorescem-labeled ohgonucleotides are expensive and a fluorescence polartmeter may not generally be available. 2. Materials 2.7. Repeating Sequence DNA All solutions should be stored frozen unless otherwise stated. 1. TE buffer pH 8 10 mMTris-HCI, pH 8 0,O 1 mMEDTA 2 1M KPi buffer, pH 7 2 50 mL of 1 M K,HPOQ with 25 mL of 1 A4 KH*PO, 3 100 mA4of each deoxynucleotide trtphosphate in TE buffer 4 1 MM&I, 5 DNA template e g , d(TC)s and d(GA)s at l-5 Az6a(50-250 pg/mL) (see Note 2) 6 10 mg/mL of boiled gelatm (This will solidify on coolmg, but can be reliquefied by heatmg ) 7. E co/l or M luteus DNA polymerase I (100 U/mL) 8 5 mg/mL Pronase or protemase K. 9. Biogel 1.5 A4 50-100 mesh for DNA purification (store at 20°C)
2.2. Solid Phase Radio Immune Assay (SPRIA) 1. 1OX PBS buffer: 80 g NaCI, 2 g KCl, 14 2 g anhydrous Na,HPO, and 2 g anhydrous KH,PO, in 1 L (store at 4°C) 2 PBS/Tween. IX PBS with 0.05% Tween-20 (store at 4°C) 3. lz51-labeled goat antimouse IgG. This should be diluted m PBS/Tween to give 1000 CPM/uL (store at 4°C). 4 PVC flat-bottomed 96-well plates or polystyrene strip wells 5 An 8- or 12-channel multibarelled pipettor is virtually essential for this procedure
2.3. Fluorescence
Polarization
1 A convement buffer is TE with 50 mA4 NaCl. 2. Fluorescent-labeled 20-mer oltgonucleottdes. For a duplex, only one of the strands needs to carry a label. The two strands are annealed by mixing eqmmolar amounts in TE with 50 mMNaC1 and Incubating at 20°C for at least 1 h
3. Methods 3.7. DNA Synthesis 1, Make up a 1-mL solution in this order contammg a 50 mM potassium phosphate buffer, pH 7 2. 50 pL 1 A4 potassium phosphate buffer, pH 7.2
184
Lee et al. b 0 5 mg/mL gelatin 50 IJL 10 mg/mL gelatm c 2 mM of each dXTP. 50 PL of 100 mil4 XTP d 0 1 Az6e of each template oligonucleottde strand (see Note 2). e 16 mA4MgCI, 16 uL 1 MMgCI, f 5 U of DNA polymerase I e Add water to 1 mL The gelatin helps to prevent nonspecttic losses of the polymerase If the DNA to be synthesized is not 50% (G + C), the ratio of each dXTP should be adjusted accordmgly. Incubate at 37°C for 24 h (see Note 1) It is best to follow the extent of the reactton because at the end of syntheses the lack of dXTPs stimulates the exonuclease activities of the enzyme Polymer synthesis can be momtored by measurmg the drop m A,,, of a loo-fold dilution. Alternattvely, a simple qualitative fluorescence assay can be used, e g , take 10 PL of the reaction with 10 PL of 0 5 pg/mL ethidmm bromide and observe under an ultraviolet light as for agarose gel electrophoresis Quantitative fluorescence assayshave also been published (4) To stop the reaction add EDT4 to 20 rr& This should cause any precipttate of magnesium pyrophosphate to redissolve Add pronase at 50 pg/mL and mcubate at 37°C for 2 h to digest proteins Add 100 uL of 5 MNaCl This ensures that lysine- or argmme-rich oligopepttdes do not copurify with the DNA Purify the DNA on a 25mL Biogel column with TE as the runnmg buffer. The column can be made from a 25-mL pipet with glass wool at the bottom. The highmol-wt DNA elutes m the excluded volume (10 mL) followed by the unmcorporated triphosphates, and so on The A,,,, of the eluate is followed with a UV monitor or alternatively 0.5-mL fracttons can be collected. The usual yield is 5 Az6eU (for most duplex DNA 1 Az6,,= 50 pg/mL = 150 mA4 [PI)
3.2. Direct S/W/A (see Note 8) 1 Make up DNA at 2 pg/mL m PBS 2. Add 50 pL to each well of the plate and leave at least 18 h at 4°C covered with parafilm (see Note 5) 3 Wash plate three ttmes with PBS/tween (200, 100, 100 pL). 4 Add 50 pL of antibody solution (e.g , hybrtdoma supernatant) It IS a good idea to add 50 PL of PBS or media to a few wells to serve as a negative control Incubate at 20°C for 2 h 5. Alternattvely, the antibody solution can be titered with doublmg dilutions as follows To all the wells except the first in each row add 50 uL PBS with 1% fetal calf serum To the first well of each row add 100 PL of the antibody solution Remove 50 FL from the first well and add to the 50 pL PBS m the second well. Mix thoroughly by repeatedly sucking the contents of the well up mto the pipet Then remove 50 uL and mix with the third well, and so on (see Note 3). Leave the last well of each row unmixed to serve as a negative control. Incubate at 20°C for 2 h
DNA-Binding Ant/bodies
185
6. Wash three times with PBS/Tween (200, 100, 100 pL) 7. Add 50 pL of goat antimouse IgG to each well (50,000 CPM) and mcubate at 20°C for 2 h 8 Wash three times with PBS/Tween (200, 100, 100 FL) 9 After the last wash, draw off all liquid from the wells For PVC plates the wells are stuck onto plastic and then cut out with a hot-wire cutter For polystyrene strips the mdivrdual wells can be snapped off manually. Count m a y-counter for 1 min 10 The maxrmum CPM should be m the range of 200&10,000 for an IgG and 200& 4000 for an IgM. The background should be less than 200 CPM (see Note 4).
3.3. Competitive
SPRIA
1 Perform steps l-3 as above It IS often most convenient to coat the plates with calf thymus DNA and use this as the standard competrtor (see Note 6) 2 To all the wells except the first, m each row add 50 pL PBS. To the first well of each row add 100 nL of the competing DNA (1 AZ6,, m PBS). Remove 50 pL from the first well and add to the 50 pL PBS m the second well. Mix thoroughly and continue doubling dilutions as above, Leave the last well of each row to serve as a posmve control (see Note 7). 3. Add 50 pL of a suitable dtlutton of the anttbody to each well. The most sensitive competition occurs with the highest antibody dilution that still gives maximum CPM Incubate at 20°C for 2 h 4. Perform steps 6-9 as above 5 The percent binding IS calculated as 100X (measured CPM-background)/(maximum
CPM-background)
A plot ofpercent bmdmg against [DNA] will result m a stgmotdal curve as shown m Fig. 2 The [DNA] required to reach 50% binding is inversely proportronal to the binding constant. For Jel229,500 nMcalf thymus DNA 1srequired compared to 25,000 tifor poly(dA) poly(dT) Thus, the binding constant to calf thymus DNA is 50-fold higher than to poly(dA) poly(dT).
3.4. Fluorescence
Polarization
(see Note 9)
1. Dilute fluorescem-labeled DNA to 0.1-10 nM (depending on the senstttvtty of the instrument) m 1 mL of an appropriate buffer 2. Make up three IO-fold dilutions of antibody m the same buffer a. 1 5 A,,, = 1 mg/mL= 6.7 pA4 for an IgG b 067pM c. 0.067 pA4. 3. Measure the polarization of the unbound DNA 4. Serially add 10 pL of dtlutron c. m 1-yL steps measuring the polartzatton after each addition. The trme required to reach equrlibrrum is usually rapid, he,
Lee et al.
186 COMPETlTlVE
SPRIA
60 -
2
2 ‘s .-c P s s
60 40 20 0 10°
10’
““.“L
i I ..‘..~r
lo2
DNA
lo3
(nM)
Fig 2. Competmve SPRIA between Je1229 and calf thymus DNA (0) and poly(dA) poly(dT) (0) The amount of competitor required to reach 50% bmdmg is inversely proporttonal to the bmdmg constant FLUORESCENCE 400
‘. ’
POLARIZATION
-
‘.-I
‘.‘-l
ASSAY ..‘-T -
0l - o”00. 0 O0
300
200 2 100
[Jel
2411 (nM)
Frg. 3. Plot of millipolarizatlon (mP) agamst antibody concentration. The [anttpoly(d[CA]) = (O), body] at 50% change m mP IS related to the Kd Poly(d[TG] poly(dA) * poly(dT) = (0) 6 Plot millipolarization against log[anttbody], which is called a Klotz plot (Fig. 3). The [antibody] at 50% change in polarization IS equal to Kd or more exactly Kd1/2[DNA] The latter correctton only becomes stgmlicant when the Kd 1s in the
DNA-Binding Ant/bodies
187
range of the DNA concentration. For Jel 241 with poly(dA) * poly(dT) the [DNA] IS much less than the K, so no correction IS necessary; therefore, Kd = 75 nA4 (K, = 1 3 x 107M-‘) With poly(d[TG]) poly(d[CA]), the [antlbody] at 50% change m polarization 1s equal to 1.4 nA4, but the [DNA] IS 1 nM; therefore, Kd = 1.4 - (0.5 x 1) = 0 9 nA4 (K, = 1 1 x 109M-‘) The dilution of the DNA by repeated addition of antibody as described gives a maxlmum error of 3%
4. Notes 1 0.1% Sodium azlde may be added to prevent bacterial growth during long mcubatlons with DNA polymerase 2 The followmg polymers have been made successfully with this technique
poMd[A’W, pWWCIh pMW *wly(dT), wMW *poly(dQ poMW-GI) PMWAI), poMd[TCI) * poly(WAl), poMd[TTGl) pMd[CAAl), WCd[A’W) poly(WATlh pW4?‘AGI) * pMcW’Al), poMU”W)
3. 4 5 6 7.
8
9
poly(d[GAA]), poly(d[TCC]) poly(d[GGA]) As well, by using the appropriate dXTP, the followmg substitutions can be made* U for T, B&J for T, m5C for C, m6A for A, c7A for A, c7G for G, I for G Finally, a-SdXTPs are readily mcorporated while rXTPs are slowly incorporated m the presence of Mn2+ (5,6) For SPRIA, a 12-barrelled sucker can be made by glumg 12 pipet tips to a hollow tube and connecting to a water pump. If the background CPM IS unacceptably high, It can often be reduced by blocking the plates wrth PBS and 1% fetal calf serum after coating with the DNA The stlckmg of some nucleic acids (e.g , poly[rGdm5C]) to the plates can be improved by first coating the plates with 2 pg/mL of poly(lysme). To reduce the amount of competitor which 1s required, the plate can be coated with a DNA to which the antlbody binds weakly Some antlbodies particularly JgMs cannot be competed even at the highest DNA concentrations. Presumably, multiple attachment points on the solid phase results m very high avidity. An ELISA can be performed in essentially the same manner Instead of an 1251-labeled second antibody, a phosphatase-lmked second antlbody 1s added. Bmdmg can then be estimated by addmg a dye such asp-nitrophenolphosphate, which gives a yellow color upon cleavage by the phosphatase The bmdmg of most antibodies is strongly dependent on iomc strength so buffers of low ionic strength are preferred for fluorescence polarlzatlon Also a pH above 6.0 1srecommended because at low pH the fluorescence of fluorescem is severely quenched.
References 1 Voss, E W. (1987) Antz-DNA Antzbodm zn SLE CRC, Boca Raton, FL 2 Stollar, B D. (1994) Molecular analysis of anti-DNA antibodies FASEB J 8, 337-342.
188
lee et al.
3. Lee, J S , Burkholder, G D , Lattmer, L. J P., Haug, B. L., and Braun, R P (1987) A monoclonal antibody to trtplex DNA binds to eucaryottc chromosomes Nucleic Acids Res 15, 1047-I 06 1 4. Morgan, A R , Lee, J S , Pulleyblank, D E., Murray, N L , and Evans, D H (1979) Ethrdmm fluorescence assays, Part I Nuclezc Aczds Res 7,547-570 5 Lattmer, L J P , Hampel, K., and Lee, J S (1989) Synthetrc repeating sequence DNAs contammg phosphorothtoates Nucleic Acids Res 17, I 549-l 56 1 6 Lee, J S., Woodsworth, M L , Lattmer, L J. P , and Morgan, A R (1984) Poly(pyrtmtdme) poly(purme) synthetic DNAs contammg 5-methylcytosme form stable triplexes at neutral pH Nucleic Acids Res 12, 6603-66 14
13 lmmunofluorescent Staining of Chromosomes with DNA-Binding
Antibodies
Jeremy S. Lee, Laura J. P. Latimer, and Gary D. Burkholder 1. Introduction Immunofluorescent stammg techmques can be used to probe the DNA structure of chromosomes. The primary requirement IS a sequence- or structurespecific antrbody. Most DNA is not immunogemc, although DNA-binding antibodies are produced spontaneously m the autoimmune drsease systemrc lupus erythematosus (I). In general, these antibodies exhtbtt little sequence or structural specificity and, therefore, are not useful for probmg chromosomes except perhaps as controls. On the other hand, nucleic acids that are resistant to serum nucleases are immunogenic, and specific antibodies can be produced either m animals or by the hybridoma technology. Thus, antibodies agamst “2” DNA, triplex DNA, and DNA-RNA duplexes have been reported (2) For example, distmctive staining patterns are produced with antitriplex DNA antibodies on both metaphase and polytene chromosomes (3,4). As well, DNA that is modified by covalent drug binding or irradiation damaged DNA is nnmunogenrc (5). The resulting antibodies are spectfic for the modification and will not bmd to native DNA. Thus, they can serve as useful probes of damaged DNA. In the future, the advent of phage display libraries may allow the development of antibodies against sequences or structures that are not immunogenic m the conventronal sense.Consequently, the use of tmmunofluorescent stammg will likely become more widespread. In the first step of this technique, chromosomes are fixed to a microscope slide. Next, they are incubated with the antibody probe followed by a fluorescem-labeled second antibody that binds the probe. At this stage, it is often useful to counterstam with a drug such as Hoechst 33258, which has a fluoresFrom
Methods
m Molecular B/o/ogy, Vol 90 Drug-DNA Interacbon Edlted by K R Fox Humana Press Inc , Totowa, NJ
189
Protocols
Lee et al.
190
cence spectrum different from that of fluorescem Thus, the two stains can be localized independently by viewing in a fluorescent microscope. 2. Materials All solutions should be stored at 4°C unless mentioned otherwise
2.1. Cell Culture 1. Colcemld (demecohcme)
2.2. Chromosome
1 mg/mL m ethanol.
Preparation
1 0 075 M KC1 (hypotomc solution) 2 3 1 (VV) Methanol*glaclal acetlc acid (fixative) Freshly made immediately before use
2.3. Staining 1 10X Phosphate-buffered salme (PBS) buffer. 80 g NaCl, 2 g KCl, 14 2 g anhydrous Na,HP04 and 2 g anhydrous KH2P04 in 1 L 2 1X PBS and PBS+ 1% fetal calf serum (FCS) (see Note 5) 3 DNA-binding antibody, 1 to 100 pg/mL in PBS + 1% FCS (store frozen) (see Note 5)
4 Fluorescem lsothlocyanate conjugated goat antimouse IgG (FITC IgG) This should be diluted in PBS + 1% FCS to give 10 pg/mL (store frozen) 5 0 5 pg/mL Hoechst 33258 m PBS (store frozen). 6 10% Glycerol m PBS + 1% FCS with 0 1% p-phenylenedlamme as an antlfade reagent (Store frozen). 7 Permount or other type of sealant
3. Methods 3.7. Chromosome
Preparation
Monolayer or suspension cultures of logarlthmically growing cells (e g., mouse LM cells or human HeLa cells) are used as a source of chromosomes Mltotlc cells are accumulated m culture by the addition of colcemid, at a final concentratlon of 0 05 pg/mL, to the normal cellular growth medium, followed by mcubatlon at 37’C for 2-4 h (see Notes l-3). Scrape the cells from monolayer cultures mto the medium with a rubber or plastic scraper and collect these or cells m suspension culture by centrlfugation at 25Og for 5 mm Add 2-10 mL of 0 075 M KCl, at 37”C, to the cell pellet, resuspend the cells by gentle plpettmg and mcubate at 37’C for 5-l 5 mm (see Note 4). Recentrlfuge the cells and discard all but about 0 1-O 2 mL of KC1 overlying the cells. Resuspend the cells m the remaining KC1 by tapping the centrifuge tube with a finger Add 2-10 mL of fixative, at room temperature, dropwlse with tappmg m order to quickly mix the fixative with the cells Leave at room temperature (=20°C) for 20 mm (see Note 4)
DNA43mdrng Ant/bodies
191
5 Centrifuge the cells, discard the enttre supernatant, resuspend the cells m 2-10 mL of fixative, and leave for 20 mm. Recentrtfuge and repeat this step usmg 0.5-2 mL of fixative 6. Using a Pasteur ptpet, allow two to three drops of cell suspension to fall onto a clean glass mtcroscope sltde from a distance of about 10 cm in a humidified atmosphere. Let the slides au-dry and store m the dark for up to 24 h at room temperature before use 7. Monitor the degree of chromosome spreading by examuung the slides with a phase contrast microscope Chromosomes should be well-spread with no overlymg cytoplasm 8 The remammg cells m fixative can be stored m a stoppered tube m a dark refrtgerator (=S’C) Before re-use, centrifuge and resuspend the cells m fresh fixative prior to making chromosome preparations as m step 6. 3.2. Immunofluorescent
Staining
1. Rinse the slides m two changes of 1X PBS, for 5 mm each at room temperature 2. Briefly dram the slides (but do not allow the slide to dry), apply 300 mL of prtmary antibody probe to the slide surface and cover with a flexible ptece of plastic cut to fit the slide. Place m a humtdtfied chamber at room temperature and leave for l-6 h It is advisable to run suitable controls with no primary antibody and/or no secondary antibody. 3. Carefully peel off the coverslip with a pair of forceps and rinse the slides m two changes of 1X PBS, for 5 mm each at room temperature (see Note 8) 4 Dram the slides, apply 300 mL of secondary anttbody, cover, and incubate at room temperature for 1 h as in step 2. 5 Rinse the slides as described in step 3. 6. Drain the shdes and counterstain by floodmg the slide with 300 mL of Hoechst 33258; leave for 5 min at room temperature. 7 Rmse the shdes in two changes of 1X PBS, 5 mm each 8. Dram each slide and add a drop of 10% glycerol contammg anttfade agent. Cover with a glass cover slip, press out excess fluid with a tissue, and seal the cover slip to the slide wrth a bead of Permount (see Note 9). 9. Store the slides m a light-proof box m a refrigerator until exammatron with a fluorescent microscope (see Notes 10 and 11)
3.3. Microscopy 1. A Zeiss photomicroscope equipped with an epifluorescence system is used for photography; however, any good fluorescent photomrcroscope ~111 suffice provided that the proper filter combmattons are avarlable. Fluorescence microscopy of FITC-stamed chromosomes IS performed with a filter set consrstmg of a 450to 490-nm exciter filter, 5 IO-nm chromatrc beam splitter, and 520-nm longwave pass barrier filter. Fluorescence mtcroscopy of Hoechst-stained chromosomes 1s performed with a filter set consisting of a 365-nm exciter filter, 420-nm chromatic beam splitter, and 4 18-nm longwave pass barrter filter.
192
Lee et al.
2 Chromosomes are photographed on Ilford XP2 (IS0 400) 35 mm film Proper exposure times must be determined by runnmg a test film For FITC-stained chromosomes, an exposure time of l-2 mm is required with the Zeiss photomicroscope when 100% of the light enters the camera, for Hoechst-stained chromosomes, a 2- to 5-s exposure is sufficient 4. Notes Any type of actively dtvtdmg mammahan cell, mcludmg human lymphocytes, may be employed as a source of metaphase chromosomes for nnmunofluorescent stammg Colcemtd serves to block the cells in metaphase and also causes chromosome contraction Some experimentation may be required m the duration of colcemid treatment m order to obtain sufficient mitotic cells with chromosomes that are not overly contracted Highly contracted chromosomes are not ideal for immunofluorescent staining. Other types of chromosomes can also be stained with this technique e g , polytene chromosomes from Drosophda or Chu-onomus salivary glands (4) It is also possible to stain unfixed, isolated chromosomes (3). To obtain exceptionally large numbers of mttotic cells, the cell culture may be synchronized prior to chromosome preparation This is achieved by the addition of 10 mM thymidme to the culture durmg the log phase of cell growth For LM cells, the culture is washed 24 h later and remcubated m fresh medium for 8 h, colcemid (0.05 pg/mL) IS added for an addmonal 16 h. Mitotic cells are then collected from the monolayer by dislodgmg them mto the culture medium by repeatedly shaking the culture dish against the palm of the hand The treatment times for this procedure may vary depending on the cell cycle time of the particular cell type used The method of cell harvesting is the conventional technique used m cytogenetic laboratories to prepare metaphase chromosomes for light microscopy and mvolves exposure to hypotonic solution (KCl) followed by fixation (6,7) Some variation in the time of exposure to KC1 or fixative may be required for different cell types and the amount of hypotomc and fixative used depends on the size of the cell pellet. The proper conditions can only be ascertarned by experimentation After spreading and drymg, the chromosomes should appear well-spread, flat, and free of background cytoplasm when examined by phase contrast microscopy, otherwise, the stammg will be poor. Proper atmospheric humidity IS required for good spreading and best results are obtained at ~50% relative humidity 1% FCS is added to the buffer containing the primary and secondary antibodtes in order to block background fluorescence. Alternatively, skim milk powder may be used at a final concentration of 2% If the antrbody staining is faint, the time of exposure to the primary and secondary antibodies can be varied. In some cases, it may be necessary to incubate the slides at 37°C during the primary and/or secondary antibody reactions. If long staining times are required, evaporation of the antibody solutions can be curtailed by placing the slides in a humidified chamber made with a Petri dish con-
DNA-Bmdmg Antibodies
7
8 9.
IO
11
193
taming water-motstened filter paper The slides are placed on a rack made with two Pasteur pipets For the best staining results, the shdes should be freshly made and stained withm 12-24 h of chromosome preparation. Unused cells, m fixative, may be stored m a refrigerator for up to a week for sltde preparatton Slides are rinsed by placing them in a Coplin jar filled with PBS and occasionally lifting and lowermg them m the solution Permount takes about 12 h to dry and care must be exercised not to get wet Permount on the microscope obJecttve Alternatively, the slides can be sealed with melted beeswax or clear finger nail polish. An antifade agent, such asp-phenylenediamme must be used to prevent fading of the fluorescence image during photography. Several agents are available on the market Slides can be stored m the dark in a refrigerator for several days before viewmg or between intermittent viewings This does not affect the quality of fluorescent staining
References Voss, E W (1987) Anti-DNA Antzbodres in SLE CRC, Boca Raton, FL Stellar, B D (1994) Molecular analysis of anti-DNA antibodies FASEB J 8, 337-342
Burkholder. G. D , Latimer, L J. P., and Lee, J. S (1988) Immunofluorescent stammg of mammalian nuclei and chromosomes with a monoclonal antibody to triplex DNA Chromosoma 97, 185-192 Burkholder, G D , Lahmer, L J P , and Lee, J S (199 1) Immunofluorescent localization of triplex DNA m polytene chromosomes of Chzronomus and Drosophda. Chromosoma 101, 11-18 Sundquist, W I , Lippard, S J., and Stollar, B. D (1987) Monoclonal antibodies to DNA modified with CIS- or trans-diammmedichloroplatmum II Proc Nut1 Acud Scl USA 84,8225-823 1 Hsu, T C. (1972) Procedures for mammalian chromosome preparations, m Methods zn Cell Physzology (Prescott, D M , ed.), Academtc, New York, pp. I-40. Verma, R. S and Baba, A (1989) Human Chromosomes Manual of Basic Technzques Pergamon, New York.
Optical Absorbance and Fluorescence Techniques for Measuring DNA-Drug Interactions Terence C. Jenkins 1. Introduction Complexation between a hgand molecule and a nucleic acid leads to optical changes that can be used to monitor the bindmg process. As these host-drug interactions frequently involve a reversible mechanism, a determination of the equilibrium bmdmg constant can provide Insight mto the nature and strength of the underlymg mtermolecular events. Analysis of the induced spectral effects can also reveal considerable detail about the host--drug stotchiometry, binding site size, and the thermodynamics of complex formation. Extension of these techmques to defined-sequence oligonucleotides can highlight possible site- or sequence-specific bmdmg, a key factor in the rational design of drugs for potential use in gene-targeted chemotherapy. Successful studies have been reported for both RNA and DNA systems,including condensed triple- and four-stranded systems.The present discussion, restricted to examples involving duplex DNA, Illustrates the general prmcrples involved m these powerful optical techniques. Monitoring of DNA-drug mteractrons using spectroscopic methods relies on the fact that the fluorescence and electronic absorption spectra of the free hgands are altered upon binding (J-4). Thus, fluorescence emissions of the DNAbound drugs are either enhanced, for example with ethidmm bromide (5’, or efficiently quenched, as seen with certain ammoacridmes and anthracyclmes, including daunomycm and adriamycin (6-9). Such behavior has resulted in frequent use of such ligands as DNA-specific stains or contrasting agents in optical microscopy (10,II). In contrast,the UV-visible absorption spectrum of the DNA-bound drug is simultaneously shifted to longer wavelength (bathochromic shift) and the molar extinction coefficient E,,, at the 3LmaX value IS depressed (hypochromic effect). However, observation of such behavior does not indicate From
Methods
/n Molecular
Edtted
by
B/ology,
K R Fox
Vol 90 Drug-DNA
Humana
195
Press
lnteractron
Inc , Totowa,
NJ
Protocols
Jenkins
196
CONHCH,CH2NMe,
acridine
AC-2
0
c-1310
+ NHCO(CH2),NHMe2
BSU-1069
ri Hoechst
33258
propamidine
Fig. 1 Structures of the ligand molecules discussed Acridme, AC-2, C-l 3 10, and BSU- 1069 bind to DNA through mtercalative or “mixed” processes, whereas Hoechst 33258 and propamldme behave as minor groove-bmdmg hgands.
the bmdmg mode; DNA mtercalatton, groove bmdmg, and external drug association can all induce qualitatively
slmllar effects (12). In this respect, the only
rehable means to drstmgutsh binding processes mvolves hydrodynamic methods such as viscometry, sedimentatron, and gel electrophorettc techniques (13) Many quantttatlve optrcal techniques have been developed to determine the bmdmg affinity and site stze, likely bmdmg process and any posstble DNA base site/sequence preference. Major procedures are outlined for a number of hgands (Fig. 1) that differ m DNA-bmdmg mechanism and/or optical behavior. UV-vtsible absorptron methods are described for compounds spannmg a wide range of binding affinity, and fluorescence experiments are detatled for Hoechst 33258 as this ligand provides a typical fluorescent DNA complex. 1.1. Concentration
Dependence
of Spectra
Reliable quantrtatron of binding requires that the optrcal behaviors of the free and DNA-bound drug forms are linear over the range of concentrattons used m the assay (1,14). Thus, the absorbance/fluorescence of the free drug and DNA must be lmearly dependent upon concentratton (Beer-Lambert Law),
Optical Absorbance and Fluorescence
,-
Techniques
8000
8 *
6000
,” w” 4000 I...,,.,.,,,,,,,-
-6
-5
-4
-3
log tdwl Fig. 2. Concentration dependenceof the &355value for DNA-free BSU- 1069 solutions in the l- to 1000-m range (CNE buffer, pH 6 0) The curve indrcates hgand self-association,with a dimerrc structureat low drug concentrattons.Analysrsin terms of a reversrble dimerrzatronmodel grves K2 = (3 2 f 0 1) x lo3 W’ at 25°C (16) and the extmctton coefficients (E) or normahzed fluorescence mtensity (15) must be Invariant. This relationship should be established for a wide concentration range, parttcularly for equthbrium-based assays(see Subheadings 1.2. and 1.3.) where free drug concentrattons are calculated indirectly from experimental data. Nonlinear concentration-dependent absorbance or fluorescence effects may result from polymerizatron, aggregation, or simple precipitation. To illustrate, the variation of opttcalabsorptionat 355 nm seenfor BSU- 1069over a 1- to 1000~@4 range (Fig. 2) shows that quantitation may be difficult in more complex solutions. In this case, the curvature can be ratronahzed in terms of ligand dtmerization (16), but this is likely to compromise optical effects seen during complexation with a DNA sample. Mathematical treatments to accommodate such effects are beyond the immediate scope of thts article. In general, quantrtative analysis of DNA binding 1snot recommended for situations in which a linear concentration dependence cannot be assured. 7.2. Equilibrium
Binding
Titration
This technique has found universal application in DNA-drug binding studies. Essentially, a drug solution of fixed concentration is transferred to a thermostated cuvet and the progressive absorbance or fluorescence changes
198
Jenkins
bathochromic
0.8
350
400 wavelength
450
500
/nm
Fig. 3. Simulated absorptionspectrafor binding-induced effects upon a ligand. The bathochromic shift for the fully bound vs free drug is (Lb - hr) = 30 nm, and the hypochromic effect is here 40% [i.e., 100 x (1.&0.6)/1.0] from the h,,,, values. For intermediate DNAtlrug mixtures, the absorbance at any wavelength is given by the summedcontributions from the free and bound drug species.In this example, showing an isosbesticpoint at 417 nm (0) the spectrum for a nonsaturating mixture has also been decomposed.Titrations can be monitored for either free drug removal (at h = hr) or bound drug appearance(at h = I+,); wavelength choice is dictated by spectral behavior and the need to minimize contributions from the DNA titrant.
are recorded after addition of serial aliquots of a DNA or oligonucleotide solution. Optical changes are normally analyzed only for the drug component in terms of the free drug and the resulting complex (14). Addition of the DNA solution to the drug solution results in a drop in absorbance (Fig. 3) and a fluorescence change that depends on the optical behavior of the drug being examined. Thus, a nonfluorescent drug forming a fluorescent complex will cause a fluorescence increase upon binding (51, whereas quenching of a fluorescent drug will lead to a reduction on binding (7,9,15). Data analysis will be outlined for absorbance changes although the mathematical treatments are broadly analogous (15). The absorbance A measured at any wavelength (Fig. 3) reflects both the free and DNA-bound drug species:
where C is the fixed drug concentration (i.e., Cr + CJ and sf and &b represent the respective extinction coefficients. Binding analysis requires a determination of Cf and, hence, the amount r of drug bound per unit of DNA as a function
Optical Absorbance and Fluorescence Techniques
199
0.6
I’
1.. 300
.I 400 wavelength
500 /nm
600
Fig. 4. Titration UV-visible absorption spectra for addition of aliquots of calf thymus DNA solution (8.77 mM in bp) to a buffered C- 13 10 solution (100 $4) at 25°C. The bathochromic shift induced upon the drug is 4 nm, and the hypochromic effect is 55%. Note the clear isosbestic behavior at 310, 337, and 487 nm, suggesting optical contributions from two distinct species. A wavelength of 435 nm, showing maximal change because of free ligand depletion, was selected to monitor the DNA-binding process (see Fig. 5). Equivalent behavior, although often limited by practical difficulties, can be established at other wavelengths.
of added DNA titrant. Determination of s,,requires extrapolation to high DNA concentrations to ensure that all drug is bound, but care must be taken to ensure that excessDNA does not causefurther absorption increase beyond the saturation point. In practice, further aliquots of titrant are added until either the decreased visible absorbance becomes constant, or the increasing concentration of DNA itself causesa slight increase. Separate spectra are recorded for DNAfree and DNA-saturated drug solutions (e.g., for titration of C-13 10 in Fig. 4) to give both the binding-induced bathochromic shift and the sf and &b drug parameters required for quantitation. Many elegant methods have been used to determine Cf and r values during the titration course (7,15,17,18), although most are variants of an earlier treatment of Peacockeand Skerrett (I). Thus, the drug binding fraction a (on a O-l scale) and, hence, the equilibrium distribution at each titration position is calculated from: a=Cb/C=(i-Cf/C)=(AP-A)/(AP-Ab’) where Arc and At,’ are the measured absorptions for the free and fully bound drug at the monitoring wavelength. Then, r = a * C/CDNAand Cf = (1 - a) * C,
200
Jenkins
where CDNAis the total concentration of DNA or oligonucleotide titrant at that point. Bmdmg analysis of the experimental r and C, data has received much attention, and the treatment employed depends on the host-drug model used. Thus, for a simple (two-state) binding model, the data can be fitted to the Scatchard equation by plotting r/C, vs r: rlC,=K,(n-r)
where K, is the intrmsic equilibrium bmding constant, and n represents the number of DNA binding sites (usually nucleotides or basepans) occupied by the bound drug. However, such a linear relationship is rare for nucleic acid systems and it is more usual to use the excluded site (“neighbor exclusion”) model developed by McGhee and von Hippel (19) and Crothers (20) to consider occupancy of multiple bmdmg sites* The two equations are identical if n = 1 A more extended form of the McGhee-von Hippel equation mtroduces a cooperativity factor (0) to account for Interaction between bound drug molecules, with values co>1 and o
OpticalAbsorbanceandFluorescence
201
Techniques
McGhee-von Hlppel frt (62~Ol)xiO~M(bp)~
0.15
0 20
0.25
0.30
0.35
r Fig. 5. Analysis of absorbance data at 435 nm (cf. Fig. 4) for binding of C-l 3 10 to calf thymus DNA Data are plotted as r/Cfvs rat each titration point (see Subheading 1.2.) The binding Isotherm extremes are limited by data scatter in determining the fractional saturation a of the DNA host. Nonlmear fitting to the McGhee-von Hippel excluded site model (19) for 0 001 I a I 0.999 data gives the curve shown No tmprovement 1s achieved ustng the extended cooperattve bmdmg model titrattons because of the inherently greater senstttvity and/or selecttvtty that is achieved, but can only be used tf the drug or DNA--drug complex is fluorescent. Simrlarly, UV-vrsible titrations become drfficult if the drug only weakly absorbs at wavelengths beyond those associated with the DNA trtrant.
7.3. Equilibrium Binding Tifrafion at Difhrenf Drug Concentrations It is recommended that equilibrium binding studies are performed for a range of different imtial drug concentrations smce such experiments provide a more complete description of the interaction (21). The shape of the titration bmding isotherm is sensitive to the bmding affimty, such that curves become mcreasingly characteristic of very tight bmdmg as the concentratron of titrated drug ts increased. This feature is important to judge the sunability of an applied bmding model and, hence, the determmatton of the mtrmsic binding constant; indeed, accurate values can only be determined if l/K, < [ligand] (21). Figure 6 shows fluorescence titration data obtamed for three different fixed concentrations of the groove-binding ligand Hoechst 33258 (Fig. 1) with the d(CGCAAATTTGCG)* duplex. Increasing the ligand concentratton results m both a shift of the isotherm toward a higher DNA concentration, and a narrower curve, indicating tight binding. Nonlinear curve fittmg (18) of each iso-
202
Jenkins
.-g H 3 5
0.8
=s
04
‘7 2 t
0.2
0.6
--cl--
100 nM
0.0 -9
-8
-7
-6
-5
-4
log [DNA]
Fig. 6 Fluorescence titratton for bindmg of Hoechst 33258 to d(CGCAAATTTGCG& at 25°C m BPES buffer, pH 7 0 The concentratton of hgand was kept constant at 10 ti (0), 100 nIt4 (Cl), or 1000 nA4(e), whereas [DNA] was varted between 1 n44and 100 pA4 The fractional saturation 8 = (F - F,)I(F, - F,,), where F IS the apparent fluorescence intensity, and F,, and Fb are the fluorescences of the free dye and fully bound ltgand The isotherms become narrower and the mtdpomts are shtfted toward higher [DNA] with increasing ligand concentratron, such behavror IS characterrsttc only when [hgand] > l/K, (21).
therm gives K, = (3.2 + 0.6) x lo* A4(duplex)-‘, m good agreement with data for a similar AT-tract dodecamer (21). 1.4. Continuous Variation Binding Analysis The method of contmuous variation, suggested by Job in 1928 (22) and later developed by Likussar and Boltz (23) and Cantor and Schimmel(24), provides a rapid and reliable means to determine DNA-drug binding stotchiometry Optical measurements are recorded for solutrons where the concentrattons of both the host DNA (or ohgonucleotrde) and drug are varted whereas the sum of the concentrations IS kept constant. The signal change, absorption or fluorescence, IS plotted against the mput mole fraction of hgand (xL); the mflectton m the plot yields the storchtometry directly (18,22,25). Only few drug-binding results have been reported using natural or synthetic DNAs (26), but the method has been analyzed and vertfied (21); in certain cases, the data can be fitted to the McGhee-von Hrppel(19) neighbor exclusron model (see Subheading 1.2.). The interpretation and significance of curved Job plots or multiple inflection behavior have been discussed (21).
203
Optical Absorbance and Fluorescence Techniques
0.0
0.2 XL
04
06
mole fraction
0.8
1.0
of ligand
Fig 7 Contmuous varratron or Job plot for the interactron of Hoechst 33258 with d(CGCAAATTTGCG), at 25°C m BPES buffer, pH 7.0. The fixed concentration sum for dye and duplex is 0.9 rnA4. AF represents the difference In measured fluorescence between mole fractions (xL) of drug with DNA and drug In buffer alone Linear leastsquares fitting gtves an x = 0 509 mflectron point (see Subheading 1.4.)
Figure 7 shows a fluorescence Job plot for mteractron of Hoechst 33258 wtth the d(CGCAAATTTGCG), duplex, showing a clear inflection point at xL = 0 509 that indicates a strict 1: 1 (or 2:2, 3:3, and so on) stoichtometry for the bound complex. This value agrees wtth reported X-ray crystallographtc studies (27).
7.5. Reverse
Salt Titration Interactions between nuclerc acids and charged drugs are sensitive to cattondependent electrostatic effects (28). Thus, K, values typically decrease wtth mcreasmg salt (NaCI) concentration or htgher lonrc strength as a result of a stoichiometrtc
release of counterion upon binding of a charged ligand, such that: 61ogK,/61og[Na+] = -ZY
where Z is the formal positive charge on the ligand and Y IS the proportion of counterlons
assoctated with each DNA phosphate, normally
0.88 for a B-type
DNA duplex (28). Thus, measurement of K, values at different concentratrons of added NaCl cosolute provides direct mformation about the ligand charge Z or protonation
status at the pH used for the experiments.
Bindmg constants can be determined at different salt concentratrons, as detailed in Subheading 1.2., but the method of “reverse salt titration” has also
Jenkins
204
83
ii i!
5'-CGCAAATTTGCG GCGTTTAAACGC-
5 '
-
8.2
81 -1 05
-1 00
-0 95
-0.90
-0.85
log [Na+] Fig 8. Reverse salt tttratton of the d(CGCAAATTTGCG),-Hoechst 33258 bmdmg constants obtained by fluorometry usmg added 0 084 20 A4 NaCl at 25°C. The slope of this salt dependence 6logK,Blog[Na+] mdtcates a monoprotonated ltgand at pH 7 0. Using this mformatron, the bmdmg free energy AGObS= -RT In& = -11 7 + 0 7 kcal mol-’ at [NaCl] = 50 mA4 can be dtssected to the electrostattc (-1.8 f 0 7 kcal molP’) and nonpolyelectrolyte (-9 9 f 0 7 kcal mol-I) terms found recent appltcatton
(18,29,30).
In this assay, mcreastng molar amounts of
NaCl are added to a nonsaturated DNA-drug complex and the opttcal changes are monitored directly. Least-squares analysts of the resulting binding data gives the slope value -2Y and an estrmate of the molecular charge This pa-
rameter can also be used to dissect the bmdmg free energy mto its electrostattc and nonelectrostattc components usmg polyelectrolyte theory (18,28,29). Figure 8 shows reverse salt trtratton data for the d(CGCAAATTTGCG)*Hoechst 33258 complex, tllustratmg the Influence of tonic strength on K,. The salt dependence gives a slope of -0 99, indicating 2 = + 1.1, a charge value that agrees with the monoprotonated status expected for this drug at neutral pH (Fig. 1). More detarled energy analysts (not shown) indicates that some 80% of the total free bmdmg energy IS caused by nonpolyelectrolyte effects. Details of such energy dissecttons have been descrtbed (7,18,29,30). 1.6. Competitive Ethidium Displacement This mdn-ect fluorescence-based competttton technique, ortgmally described by Morgan and colleagues (31), has been used to determine apparent binding constants KapPfor a wide spectrum of DNA-binding hgands The procedure provtdes a quick, flexible, and rehable indtcator of relattve bmdmg affinity
Optical Absorbance and Fluorescence Techniques
205
that can be used to rank either mdivtdual hgands or drug families. DNA samples of different complexton, including triple-stranded DNA (31) and synthetic polyoligonucleotides, have been used to examine mtercalants and groove-binding or hybrid combtlexin-type hgands (e.g., refs. 31-36). Quantitative trtratton methods are used to measure C,, values for 50% dtsplacement of an initially bound ethidmm reporter mtercalant by the candidate hgand, under conditions where the ethidmm IS effectively present m excess (32). Competitive binding leads to a loss of fluorescence because of depletion of the DNA-ethldium bromide complex (free ethtdmm IS poorly fluorescent) that can be used to assessthe relative binding m terms of an apparent bmding constant (31-35). The original report (31) suggested that the CsOvalues are approximately inversely proporttonal to the DNA-drug-bmding constant. Subsequent work by Baguley and coworkers (32,33) demonstrated an excellent correlation between I&,,, values and mtrmsrc K, binding constants obtained from spectrophotometric and equrlibrium dtalysts studtes. Recent molecular modeling studies have shown that the I&, values also correlate with the binding enthalpies computed for DNA-drug complexes for defined DNA sequences(35). The method is not suitable for weakly binding hgands (i.e., K < 1O4M-t) or htghly fluorescent drugs that prevent reliable measurement of the DNAethldmm fluorescence. Ideally, the bgand should show negligible absorption at the excitation wavelength used for the assay,although such drfficultles may be reduced by changing the wavelength and/or instrument slit parameters used. Experimental data may also require correctron for drug-induced quenching effects (32). Highly DNA-affimc lrgands can also be examined, and the author has determined Z&r values in the 109-1 0”’ M* range, although proportionally lower concentrations of drug tltrant are required at this extreme. Figure 9 shows comparative dtsplacement data obtained for four drugs with calf thymus DNA, illustrating the DNA-binding affinities of three different ligand classes(see Fig. 1). 1.7. DNA-Ethidium Fluorescence Quenching Fluorescence quenching assaysunder conditions of limited ethrdmm bound to an excess of DNA (usually poly[d(A-T)lz) have been used to dlstingursh intercalating and nonintercalatrve ligands (32,33). Solute quenching is determined by accessibility of the DNA-bound fluorophor to a probe ligand (37), hence groove-binding drugs would be expected to be efficient quenching agents because of their larger DNA footprints. Suh and Chaires have recently shown (13) that this argument IS invalid for quenching of disparate bound ligands by iodide ions. However, results obtained for ethidmm quenching by a spectrum of DNA-binding drugs, under conditions that effect minimal displacement of the bound fluorophor, suggestthat inferences can be made for structurally related compounds and/or molecular fragments. This information should only be used
Jenkins
206
0
2
4
6
8
10
I2
[added drug] /pM Ftg 9. Competittve fluorescencedtsplacementexpertmentsfor drug addttton (in DMSO solution) to a mixture containing calf thymusDNA (1 PM) and ethtdtum bromide (1 26 pA4)at pH 5 0 in NaOAc buffer (see Subheading 3.4.). Binding data are shown for acridme (0). propamtdme (O), BSU-1069 (Cl), and AC-2 (m) The rank order for bmdmg is gtven by the C,, valuesor drug concentrationsrequired to effect a 50% reductton of the inittal fluorescence(here 5000+2500 arbitrary untts), acridine: 142 pA4,propamidme 23 @4, BSU-1069.2 1 yA4,and AC-2: 1 1 r.tJ4 to augment hydrodynamic or structural studies designed to establish the mode of DNA interaction. Quenchmg assaysare normally performed at pH 5.0 to ensure that the added drugs are present chiefly as then catiomc specieswhere protonatable (32,36,38). Experimental details closely parallel those used for ethtdtum displacement assays (see Subheading 3.4.), with the Q value determined by the added drug concentration required to effect 50% quenchmg of the drug-free control fluorescence. High Q values (>20 @4) are found for “classical” DNA mtercalants, whereas lower values of 2-l 5 I.&! are typically obtained for minor groove ligands or hybrid molecules (36,38). The Q values determined using native or synthetic DNAs of different base composition can also give mformatton relating to base- or sequence-preferenttal binding (36,38). Thus, for example, comparative studies with poly[d(A-T)], calf thymus DNA, and poly[d(G-C)lz show that the intercalant proflavine has an approx twofold GCYAT specificity. In contrast, Fig. 10 shows raw quenching data for propamidine (see Fig. l), an established DNA minor groove-binding hgand (39,40), mdicatmg that this drug shows marked AT-preferential binding.
Optical Absorbance and Nuorescence
0
50 volume
100 of added
207
Techniques
drug
200
150 solution
/pL
Fig 10. Fluorescence quenching experiments for addition of ahquots of propamidme soluhon (1.635 mM) to a mixture contammg DNA (20 pA4) and ethldlum bromide (2 @4) at pH 5.0 m NaOAc buffer (see Subheading 3.5.) Quenching of ethldmm fluorescence is m the order. poly[d(A-T)], > calf thymus DNA > poly[d(G-C)12, with e values that effect a 50% removal of the initial flllorescence (here 5000-+2500 arbltrary units) at A-T (!I)* 5 0 + 0 1 pL (4 1 zk0.1 PM), CT-DNA (0): 40 8 f 3 2 pL (33 + 3 p&f), and G-C (0) 140 + 3 pL (107 f 2 @f) These data indicate AT-preferential bmdmg.
1.8. Other Methods Many other absorbance or fluorescence techniques have been applied to DNA-drug binding studies, but are beyond the scope of the present article For example, equlhbrium or competition dialysis methods can be used to examine binding by direct measurement of drug concentration in the DNA-free compartment and/or after detergent-induced disruption of the DNA complex (e.g., refs. 7,16, and 41). Similarly, fluorescence polarization and contact energy transfer methods have been developed to probe dlstinctlons between mtercalatlve and groove-bmdmg modes. Details of these methods are avallable elsewhere (13,18,42,43). 2. Materials 2.1. Aqueous
Buffers
Many different aqueous buffers have been used successfully m DNA-ligand binding studies, with choice based largely upon the pH and ionic strength requirements of the assay. Other factors include solubllity and/or counter-ion
Jenkins
208
effects; for example, high phosphate concentrations are not approprrate for bis(benzamrdine) ligands, including berenrl and propamidine (Fig. l), because of preclprtatron of an insoluble addition salt. EDTA 1susually added as cosolute to mmtmrzethe deletenous effects of adventitious cations,particularly Fe2+and Cu2’, present m the buffer media. Buffer solutions can be supplemented with NaCl to either increase the ionic strength (u) or examine the effects of added salt upon the bmdmg behavior. Selectedcommonly used aqueous buffers are listed below. 2.7. I. Phosphate Buffers 1. 2 mA4Na2HP04/NaH2P04, l&250 mh4 NaCl, 0 1 mM Na*EDTA, pH 7 0 (44) 2 BPE* 8 mh4 Na,HPO,/NaH,PO,, 1 m&I Na*EDTA, pH 7 0, or a supplemented buffer version (BPES) contammg 185 mh4 NaCl (7,45) 3 PBS 10 mA4Na2HP04/NaH2P04, O-100 mMNaC1, pH 7 &7 2 (27.41)
2.1.2.CNE
Buffer
1. 10 rnk4 sodmm cacodylate, &300
mM NaCl, 0 1 mM Na,EDTA,
pH 6 O-7 0
(16.46).
2.1.3. Tris-/-ICI Buffers 1 10 mk! Tris-HCI, pH 7 0 (25) 2 5 mMTrwHCI, O--50 mMNaC1, &l mhINa,EDTA,
pH 7 O-8 0 (l&34,41,47)
2.7.4. TES Buffer 1 10 mA4TES, 0.1 mh4Na,EDTA, pH 7.0 (35)
2.7.5. Acetate Buffer 1 2 mA4NaOAc, 9.3 mMNaC1, 0 1 mi14Na2EDTA, pH 5 0 [p = 0 01 M] (32,36,38)
Other buffer variants based upon HEPES (pH 7.0, p = 0.01 J4), MES (pH 6.4, u = 0.1-0.5 M) and supplemented Tris-HCl (pH 8 0) have also been reported (48). 2.2. Purification
and Quantitation
of the DNA
Many different natural and synthetic DNAs have been used in drug binding studies Calf thymus DNA (CT-DNA) or herring sperm DNA (BoehringerMannheim, Germany or Sigma, St. Louis, MO) are frequently used as a source of pseudo-random or mixed-sequence duplex DNA. These DNAs can be used as supplied, but solutrons should be dialyzed for 48 h against the selected buffer (see Subheading 2.1.) with a mol wt 10,000 cutoff membrane prior to use. Sonicatton treatment and electrophoretrc purr&cation (7) IS preferred for quantrtative studies; thusprocedure results m a more uniform DNA duplex sample with an average -200-bp length (- 100 kDa). CT-DNA solutrons may be quantitated spectrophotometrrcally using &26O = 12,824 M(bp)-’ cm-’ (7,13). A less
Optical Absorbance and Nuorescence Techmques
209
precise value of 13,200 M(bp)-’ cm-t has been commonly used (e g., refs. 17,48,49). Bacterial DNAs from Clostridium perfringens (CP-DNA) and Mzcrococcus lysodeikticus (ML-DNA) have also been used, with respective &2@ values of 12,450 and 13,846 M(bp)-’ cm-‘, to enable comparative studies with a wide 28-72% spectrum of G+C base content (7,48). Polyoligonucleotide duplexes of various complexion have received parttcular attention e.g., poly(dA) * poly(dT), &26O = 12,000 M(bp)-’ cm-i; poly[d(AT)12, s260= 13,100 M(bp)-’ cm-‘, and poly[d(G-C)]2, s260= 16,800 M(bp)-I cm-’ (44,50,51). Defined-sequence or -length ohgonucleotide duplexes and triplexes such as d(CGCGAATTCGCG)2 and d(T,s),, * d(A,s) have also been used (16,21). In such cases, DNA quantitation is always determined by UV spectrophotometry usmg experimental E values. On a cautionary note, DNA concentrations are often confusingly reported m terms of either nucleotides, basepaw, strands or entire duplex/triplex molecules. The reader should be aware of these distmctions, particularly for the associated E values; thus, for example, a 1-mA4 12-mer duplex solution is equivalent to 24 mM nucleotides (usually denoted DNAp), 12 mM basepans, and 2 mM strands! The concentration unit used should be stated explicitly. 2.3. Preparation of Ligand Solutions Ltgand (drug) solutions for bmdmg studtes should preferably be prepared m the same aqueous buffer as the DNA bemg exammed. If this cannot be achieved reliably because of aggregation or solubihty hmitations, then a misctble organic solvent (e.g., MeOH, DMSO, and so on) can mstead be used. It IS, however, important to prevent the ultimate concentration of cosolvent becommg > l-2% v/v in experiments as these levels may effect partial denaturation or structural rearrangement of the host nucleic acid. Ligand adsorption effects can be problematic for quantitation of DNAdrug binding. Thus, for example, the dye Hoechst 33258 (Fig. 1) is known to adhere strongly to glass, quartz, and polypropylene surfaces, thereby preventing any estimation of reliable binding data (21). Fortunately, this can be avoided by using polystyrene cuvets and plasticware; Quartz cells necessary for UV experiments can be precoated with inert SigmaCote (Sigma) that does not mterfere with the DNA-bmding process. The appearance of glassware and cuvets should always be examined during bmdmg experiments to establish that such effects will not interfere with the optical measurements. 3. Methods 3.1. Equilibrium Binding Titrations The following procedure is typical for absorbance studies for titration of a candidate ligand with a DNA solution. A stmllar protocol IS used for equtva-
210
Jenkins
lent fluorescence-based titration experiments, where either free drug fluorescence 1sdiminished upon binding, or the DNA-drug complex 1sused drrectly for quantltation (see, for example, ref. 7). In such experiments, the fluorescence emission spectra may require correction for absorption effects because of the reactant/product species before the measured fluorescence mtenslties can be used directly in binding analyses (7,37). 1 Preparea solution contalnlng the ligand in the chosenaqueousbuffer (see Subheadings 2.1. and 2.3.) to give a 0 5-l absorbance reading at the wavelength maximum for the free drug (typlcally 30-100 $4’) After transferring a known volume (1 0 mL) to a cuvet, record the UV-vlslble absorption spectrum m the 200- to 600-nm range and determme the molar extinction coefficient (Ed, see Fig. 3) for the unbound drug The spectrum of a buffer solution (blank) is used to correct optical readings Care should be taken to “zero” the instrument at a wavelength beyond absorbance bands associated with either the free or fully DNAbound drugs The cuvet should be maintained at a constant temperature (e g , 20--3O”C), and a suitable period allowed for thermal eqmhbratlon prior to measurement (see Note 2) 2 Prepare a concentrated solution of the DNA (typically I-10 mM(bp) for duplex DNA) in the same buffer (see Subheadings 2.1. and 2.2.) Record the UV-vlslble spectrum of this solution to establish the titrant concentration usmg the appropnate E value. 3 Add an ahquot containing an excess amount (e g., four- to slxfold molar excess, determined by experiment) of DNA to the drug solution m the cuvet If magnetic stirring cannot be achieved within the cuvet, ensure thorough mlxmg with a PTFE (e.g , Teflon) stirrer rod where the nonwetting propertles cause no volume losses from the reaction Record the UV-visible spectrum corresponding to the fully bound drug (see Fig. 3) All spectral data should be corrected for the dllutlon effect; this factor can be neglected If the introduced volume change 1s ~5% Determine the bathochromlc shift (&,- hf) and tsosbestlc behavior, together with the E values at the shifted maxlmum and lsosbestic point The momtormg wavelength should be selected to maximize the optical change seen during binding. For fluorescence tltratlons this would normally correspond to the emlsslon maxlmum wavelength 4. Empty, wash, and recharge the cuvet as per step 1. If required, repeat steps 1 and 3 to improve the precision of the determined optical parameters. 5 Add a small ahquot (see Note 1) of the DNA to the drug solution, stir, and watt for thermal equlllbratlon (see Note 2) Record the UV-vlslble spectrum Separately read the absorbance values at the monrtormg wavelength (usually &or h,,) and at the lsosbestic point The ahquot size should be sufficiently small to allow 20-30 sertal steps, any spectral effect ~11 depend upon the bmdmg strength and stolchiometry, and response 1snot normally linear 6. Repeat step 5 until no further change m dilution-corrected absorbance (see step 7 below) is observed If required, adjust the ahquot size to effect a constant change
OpticalAbsorbanceandFluorescence
Techmques
211
in optlcal response per serial addition Large changes are evident at the early stages of titration (i e., high [free drug]), whereas only small changes are found as plateau-level equivalence IS approached (i.e., low [free drug]). At reaction completion the spectrum should be identical to that from step 2 (cf. Fig. 4) 7. Correct all spectral readings for ddutlon effects usmg A,,, = Aexpx (1000 + y)/lOOO, where V IS the volume (m pL) of drug solution added Again, this correction factor can be Ignored If the total volume change IS ~5%. From the spectral changes at the monitoring wavelength, calculate the concentration of free drug present at each titration point and hence the equllibrlum posltlon (a) 8 Calculate the r and r/Cf values at each point for binding analysis (see Subheading 1.2.) Curve fitting of these data should first be applied to a linear equation for the simple independent site model (Scatchard, to give K,), and increased m complexity to the nonlinear equations for the neighbor exclusion model (K, and n) or extended (K,, n, and w) models of McGhee and von Hlppel (19). Suitable nonlinear curve-fitting packages are available for all popular computer platforms (e g., KaleidaGraph, IgorPRO. FitAll, and so forth) The fitting equation choice is dictated by the “goodness of fit” provided by least-squares coefficients or statistical x parameters, together with the data quality (cf. Fig. 5). In the experience of the author, binding data should mitlally be fitted for a practical 0 01 <: a s 0 99 range, wider 0 001-O 999 range data should be introduced with caution because of the significant errors involved. Further experiments may be reqmred to provide data at additional points during the titration course. Replicate experiments are recommended
3.2. Continuous
Variation Binding Analysis
The followmg procedure for a fluorescence Job plot IS adapted from published methods (I&22) where a fluorescmg DNA-drug complex is monitored. Equivalent protocols can be used to obtain an absorption Job plot for contmuous variation analysis (e g., ref. 21). 1. Separately prepare equlmolar concentrated stock solutions of the DNA and drug m the required aqueous buffer (see Subheadings 2.2. and 2.3.). 2 MIX different volumes of each reactant stock solution to give a final volume of 250 PL and a constant summed concentration of 80-I 000 pA4 (in terms of bp for the DNA). Volumes should be selected to achieve hgand mole fractions (xL) m the 0.05-l range The exact fixed concentration sum used will depend on hgand fluorescent activity. 3. Empty and refill the cuvet with each mixture, equilibrate at 25°C for 10-l 5 mm (see Note 2) and record the fluorescence intensity. 4 To correct for dilution effects, repeat steps 2 and 3 replacing DNA solution with buffer. 5. Plot the difference m fluorescence (0 between the two experiments against the mole fraction of drug (xL) in each nuxture Use a linear least-squares fitting routme for each portion of the resulting Job plot to determine the mean Inflection or mtersectlon pomt x (cf. Fig. 7). The [DNA]:[drug] stoichiometry 1sgiven by the xl( 1 - x) value 6 If necessary, further DNA-drug mixtures should be used for additional data points.
212
Jenkins
3.3. Reverse Salt Titration The following reverse salt procedure monitors NaCl-induced effects upon the equthbrium posrtton for a fluorescent complex (18,29,30). Equivalent protocols can be developed for either absorptton studies or release of a fluorescent drug. 1 Preparea 5-MNaCl solutton m the appropriate aqueous buffer 2 Prepare an aqueous solutton m low-salt buffer containing both the drug and DNA, at a mole ratio where 70% of the drug is mrtially bound 3 Place 0.5-l 5 mL of this solutton mto a cuvet, equrlibrate at 25°C (see Note 2) and record the fluorescence 4 Add 0 5-pL abquots of the NaCl solution for [NaCl] I 0 2 A4 m the cuvet After thermal equiltbratton, record the decreased fluorescence emrsston at each step 5. From the relative fluorescence of the free and bound forms of the drug, obtained from independent experiments, determine the free and bound ligand concentrations at each titration step These data enable a determination of the bmdmg constant K, at each salt concentration using the McGhee-von Htppel(I9) model (see Subheading
1.2.)
6. From a plot of log K, vs log[Na+] determine the 610gK/610g[Naf] slope value by linear least-squares fitting The hgand charge is estimated from the slope value as described m Subheading 1.5.
3.4. Competitive
Ethidium
Displacement
Serial ahquots of drug solutton are added to a DNA solutton containmg a saturating amount of reporter ethidmm fluorophor until 50% of the mttral fluorescence 1s lost, then I&,,-bmdmg constants are calculated from the experrmental CsOvalues. The following experimental procedure, based on published reports (32,36), may be readily adapted for other DNA samples or altered solution conditions (see Note 4). 1 Prepare a working solutton containing 1 26 @Iethtdmm bromtde (Sigma) and 1 p&! (in DNAp) of the DNA (usually CT-DNA) by dilution of separate solutions in the chosen aqueous buffer For experiments at neutral pH, TES buffer (10 n-n!4 TES, 0.1 nuI4 Na,EDTA, pH 7 0) IS commonly used, whereas acetate buffer (2 mM NaOAc, 9.3 mA4NaC1, 0.1 mMNa,EDTA, pH 5 0) 1s used for more actdtc pH condittons. Working mixtures can be kept in the dark at 5°C for l-2 d, but storage of low-pH soluttons should be avoided to mmtmtze DNA hydrolyses (see Subheading
2.2., Note 4)
2 Accurately prepare a concentrated solutton (l-5 mA4) of the candidate drug solution m the same buffer, or m DMSO tf aqueous solubihty 1shmited (see Subheading 2.3.) 3. Two milbliters of the DNA-ethtdmm solution are placed m a 1O-mm pathlength quartz cuvet (-3 mL) posttroned m a temperature-controlled (20°C) spectrofluorometer Excitation and emrsston wavelengths are set to 546 and 595 nm, respectively
Optical Absorbance and fluorescence
Techniques
213
4 After thermal equihbratton (see Note 2), the instrument should be calibrated to give a large fluorescence reading of e.g., 5000 arbitrary units Integrating instruments using a 5- to 30-s acqmsrtion period are preferred Automatic zero correction, for the experimental cuvet containing buffer only, should be applied tf this feature 1savailable. 5. An aliquot (0 02-10 pL) of drug solutton is added to the cuvet usmg a precision mrcropipet (see Note I), and the mixture is stirred efficiently. Use of a PTFE (Teflon) stirrer is recommended, particularly if magnetic stnrmg cannot be achieved within the cuvet It is important that no volumetric losses are mtroduced at this stage. 6 After equilibration for l-l 5 mm (governed by the drug binding kmettcs) the fluorescence reading is recorded Repeat readmgs should be taken until a steady value 1sobtained 7 Steps 5 and 6 are repeated until the fluorescence is 2@-40% of the mmal control reading The cuvet should be examined periodically to ensure that no precipitation has occurred, titration should be stopped tf the mixtures are no longer homogeneous. 8 Readings should be corrected for dilutton effects usmg F,,, = FeXpx (2000 + c32000, where V 1sthe volume (m pL) of drug solution added Volumetric correction can be ignored if the volume change IS less than 5% 9. Plot the corrected fluorescence readings as a function of the added drug concentration (see Fig. 9) The C,, value is given by the concentration that reduces the initial fluorescence by 50%. Exponential or nonlmear curve fitting procedures can be used, although biphasic behavior frequently arises during such competltive titrations. Duplicate or trtphcate titrations should be performed. Apparent binding constants can be calculated (31) using Kapp = K, x 1 26/C,,, where K, = 2 1 x 1O6or 9.5 x 1O6M(bp)-’ for ethidium bmdmg to calf thymus DNA at pH 5 0 (32) or pH 7.0 (32,33), respectively. 10. The absorption and fluorescence spectra of the drug and tts DNA-drug complex should be recorded under the same conditions to ensure that no spectral mterference is mvolved. Additional correction terms can (in principle) be introduced for these effects, although practical difficulties may often be overcome by altering the wavelength parameters used
3.5. DNA-Ethic&m
Fluorescence
Quenching
The titration-based procedure is closely similar to that used for competitive ethrdmm displacement assays (see Subheading 3.4.), but differs m that only a limited amount of the reporter fluorophor is used. The Q value is given by the concentratton of added drug tttrant required to effect 50% quenchmg of the drug-free control fluorescence. A representative experimental protocol is described for quenching studies in a pH 5.0 buffer used to ensure full protonation of a candidate ltgand (36). 1. A working solutton containing 2.0 pMethidium bromide (Sigma) and 20 pM(m DNAp) of the DNA or polyoligonucleottde is prepared from fresh solutions Experi-
214
Jenkins
merits are normally conducted at low pH to ensure drug protonanon, usmg aqueous acetate buffer (2 mM NaOAc, 9 3 mM NaCl, 0 1 mM Na,EDTA, pH 5.0) Most assays are performed with the poly[d(A-T], duplex 2 Accurately prepare a concentrated drug solution (1-5 mM) in the same buffer, or m DMSO if aqueous solubihty IS limited (see Subheading 2.3.) 3 Subsequent steps m the titration procedure are identical to those used for ethidmm displacement (see Subheading 3.4.) 4 From a plot of the dilution-corrected fluorescence readmgs vs added drug concentration, the Q value is given by the concentration required to effect a 50% removal of the mitral fluorescence (see Fig. 10) Rephcate titrations should be performed
4. Notes 1 Use of a precision electronic or digital micropipet is recommended for volumetric dispense m all titration-based bmdmg experiments Small ahquot volumes of 0 02-O 1 pL are often used to mmimize dilution effects and overcome the requuement for volume corrections Clearly, it is essential that measurements are both reliable and reproducible 2 Extreme care IS required m all optical experiments to ensure that thermal and/or reaction equihbration is achieved before measuring either the absorption or fluorescence mtensity. Titration-based methods are particularly sensitive to problems associated with eqmhbrmm, with the kinetic approach to a steady optical reading dictated by the concentrations and bmdmg affimties of the reactants Late stages m the equihbrmm process mvariably proceed more slowly than the mitral association or dissociation phases, and the correspondmg optical change may also be smaller. Lower temperatures also slow the equihbration In such cases, it IS recommended to take readings at 5-mm intervals until a steady value IS obtained 3. During fluorescence experiments it is essential to minimize chemical photo-bleachmg effects. Possible degradation should be momtored by recording absorption spectra at either periodic intervals or after prolonged exposure to the excitation beam Photodegradation should never exceed -5% durmg any assay Baseline fluorometer spectra for buffer alone should be recorded and subtracted from all subsequent readings Measurements should be recorded against an internal reference solution such as rhodamme (25) to allow correction for fluctuations m lamp intensity 4 The ethidmm displacement assay (see Subheading 3.4.) can be used for a wide spectrum of DNA samples, although Kapp values can only be established if the bmdmg constant for the reporter llgand (1 e , ethidmm) is known Thus, for example, bmdmg affinities can m prmciple be compared for a candidate hgand with A/T- or G/C-rich DNAs, or with defined ohgonucleotides, to assess possible base site- or sequence-dependent bmdmg properties As the technique provides relatwe bmdmgconstants,the method is valuable for rapid assaysof affinity for closely related hgand families or structural homologs (32,33,35,36) Changmg the solution pH can also provide valuable mformatron about the protonanon statusof a hgand For comparison, C,, assaysare usually conducted at pH 5 0 so
Optical Absorbance and Fluorescence Techniques
215
that basic hgands are fully protonated, however, such values are likely to be of poor slgmficance at pharmacological pH unless fUrther bmdmg data are avallable C,, values measured at pH 7 0 (or higher) can be Invaluable in probing the mechanism of DNA mteractlon. Caution should be taken to ensure that such measurements do not cause partial DNA hydrolysis or depurmatlon. For these experiments, DNA solutions should be freshly prepared and used quickly to avoid untoward deterloratlon
Acknowledgments Research m the author’s laboratory is supported by the Cancer Research Campaign of the UK. The author is particularly grateful to Dr. Ihtshamul Haq (University of Greenwich) for the optlcal experiments mvolvmg BSU- 1069 and Hoechst 33258.
References
4
5
6
7.
Peacocke, A. R and Skerrett, J N H (1956) The interactton of ammoacridmes with nucleic acids J Chem Sot Faraday Trans 52,261-279 Dougherty, G and Pllbrow, J R (1984) Phystcochemlcal probes of intercalation Int. J Blochem 16, 1179-l 192. Wilson, W. D (1990) Reversible interactlons of nucleic acids with small molecules, m Nucleic Acids m Chemistry and Bzology (Blackburn, G M and Gait, M J , eds ), IRL, Oxford, pp 297-336 and references therem. Gale, E F , Cundhffe, E , Reynolds, P E , Richmond, M H., and Waring, M J. (1972) Inhlbltors of nucleic acid synthesis, in The Molecular Basis of Antzbzotzc Actzon, Wiley-Intersclence, London, pp 173-277 Le Pecq, J-B. and Paolettl, C (1967) A fluorescent complex between ethldmm bromide and nucleic aclds* physical-chemical charactenzatlon J Mol Blol 27,87-l 06. Plumbridge, T W and Brown, J. R. (1978) Studies on the mode of mteractlon of 4’-epladnamycln and 4-demethoxydaunomycm Blochem. Pharmacol 27, 1881,1882. Chaires, J. B , Dattagupta, N., and Crothers, D. M (1982) Studies on Interaction of anthracyclme antlblotlcs and deoxyrlbonuclelc acid: equlllbrmm bindmg studies on mteractlon of daunomycm with deoxyrlbonuclerc acid. Blochemlstry 21,
3933-3940 8 Valentini, L , Nicolella,
V., Vannim, E., Menozzi, M , Pence, S , and Arcamone, F (1985) Assoclatlon of anthracyclme derivatives with DNA a fluorescence study. I1 Farmaco 40,377-390 9 Chalres, J B (1996) Molecular recognition of DNA by daunorublcin, m Advances zn DNA Sequence Specific Agents, vol. 2 (Hurley, L H. and Chaires, J B., eds ), JAI, Greenwich, CT, pp 141-167 10 Welsblum, B. and Haenssler, E (1974) Fluorometnc propertles of the blsbenzlmldazole dertvatlve Hoechst 33258, a fluorescent probe specific for AT concentration m chromosomal DNA Chromosoma 46,255-260
216
Jenkins
11, Latt, S. A and Wohleb, J C (1975) Optical studies of the interaction of Hoechst 33258 wtth DNA, chromatm, and metaphase chromosomes. Chromosoina 52,297-3 16. 12 LI, H J. and Crothers, D M. (1969) Relaxation studies of the proflavme-DNA complex the kinetics of an intercalation reaction J Mol Bzol 39,46 l-477 13 Suh, D. and Chanes, J, B. (1995) Criteria for the mode of bmdmg of DNA bmdmg agents Bloorg Med Chem 3,723-728. 14 Bloomfield, V A., Crothers, D M , and Tmoco, I. (1974) Physzcal Chemrstry of the Nuclex Acids, Harper & Row, New York 15. Roche, C J , Thomson, J. A., and Crothers, D. M (1994) Site selecttvtty of daunomycm Bzochemutry 33, 92&935 16 Haq, I , Ladbury, J E., Chowdhry, B Z., and Jenkins, T C. (1996) Molecular anchormg of duplex and triplex DNA by disubstituted anthracene-9,10-drones calorimetric, UV meltmg, and competition dialysis studies. J Am Chem Sot 118, 10,693-10,701 17 Arnutage, B , Yu, C , Devadoss, C , and Schuster, G B (1994) Cationic anthraqumone derivatives as catalytic DNA photonucleases mecharusms for DNA damage and qumone recyclmg J Am Chem Sot 116,9847-9859. 18 Haq, I , Lmcoln, P , Suh, D , Norden, B., Chowdhry, B Z , and Chanes, J B (1995) Interaction of A- and A-[Ru(phen)2DPPZ]2+ with DNA* a calorimetric and eqmllbrmm bmdmg study J Am Chem Sot 117,4788-4796 19 McGhee, J. D and von Hippel, P. H. (1974) Theoretical aspects of DNA-protem mteractions cooperative and non-cooperative bmdmg of large ligands to a onedimensional heterogeneous lattice J Mol Blol 86,469-489 20 Crothers, D M (1968) Calculation of bmdmg isotherms for heterogeneous polymers Blopolymers 6, 575-584 21 Loontiens, F G , Regenfuss, P , Zechel, A., Dumortier, L., and Clegg, R M (1990) Bmdmg characterrstics of Hoechst 33258 with calf thymus DNA, poly[d(A-T)], and d(CGCGAATTCGCG) multiple stoichiometries and determination of tight bmdmg with a wide spectrum of site aftinmes Bzochemzstry 29, 902%9039 22 Job, P (1928) Formation and stability of morgamc complexes m solution
23
24. 25
26
Ann Chum (Pans) 9, 113-203 Likussar, W. and Boltz, D F. (1971) Theory of contmuous variation plots and a new method for spectrophotometrtc determmatton of extraction and formation constants Anal Chum 43,1265-1272 Cantor, C. R and Schimmel, P. R. (1980) Bzophyslcal Chemutry, part III, W H Freeman, New York, pp 1135-l 139. Fan, J-Y , Sun, D , Yu, H , Kerwin, S M , and Hurley, L. H (1995) Self-assembly of a qumobenzoxazme-Mg2’ complex on DNA a new paradigm for the structure of a drug-DNA complex and implications for the structure of the qumolone bacterial gyrase-DNA complex. J Med Chem 38,408-424 Chou, W Y., Marky, L A, Zaunczkowski, D , and Breslauer, K J (1988) The thermodynamics of drug-DNA mteractions ethtdmm bromide and propidmm iodide J Blomol Strut Dyn 5,345-359
Optrcal Absorbance and Fluorescence
Techniques
217
27 Spmk, N , Brown, D G , Skelly, J V., and Needle, S. (1994) Sequence-dependent effects m drug-DNA mteractton the crystal structure of Hoechst 33258 bound to the d(CGCAAATTTGCG), duplex Nucleic Acids Res 22, 1607-l 6 12 28 Record, M. T , Anderson, C F , and Lohman, T M. (1978) Thermodynamic analysis of ton effects on the bmdmg and conformational equthbria of proteins and nuclerc acids. the roles of ion association or release, screening, and ion effects on water activity Q Rev Bzophys 11, 103-178 29. Lohman, T M and Mascot& D P. (1992) Thermodynamics of hgand-nucleic actd mteracttons Methods Enymol 212,40@-458 30 Misra, V K , Sharp, K A , Friedman, R A , and Homg, B (1994) Salt effects on ligand DNA binding Minor groove binding anttbiotics J Mel Bzol 238, 245-263 31 Morgan, A R., Lee, J S , Pulleyblank, D E , Murray, N L., and Evans, D. H (1979) Review ethidium fluorescence assays. Part 1 Physicochemical studies Nucleic Acids Res 7, 547-569 32 Baguley, B C , Denny, W A , Atwell, G. J , and Cam, B F (1981) Potential antitumor agents 34. Quantitattve relattonships between DNA bmdmg and molecular structure for 9-anilmoacridines substituted m the anilmo ring J Med Chem 24, 170-177 33 Baguley, B. C. (1982) Nonmtercalative DNA-binding antitumour compounds Mol Cell Blochem 43, 167-18 1 34. Lown, J W., Krowicki, K , Balzarmi, J , Newman, R A , and De Clercq, E (1989) Novel linked antiviral and antitumor agents related to netropsm and distamycm synthesis and biological evaluation J Med Chem 32, 2368-2375 35 Jenkins, T. C , Parrick, J , and Porssa, M (1994) DNA-bmding properties of mtroarene ohgopeptides designed as hypoxia-selective agents An&Cancer Drug Des 9,477-493 36. McConnaughie, A W and Jenkins, T. C (1995) Novel acridme-triazenes as prototype combilexms synthesis, DNA binding, and biological activity J Med Chem. 38,3488-3501 37. Eftink, M. R (1991) m 7’opzcsin Fluorescence Spectroscopy, vol 2 (Lakowicz, J R., ed ), Plenum, New York, pp. 53-l 27 38. Bailly, C , Pommery, N , Houssm, R., and Hemchart, J -P. (1989) Design, synthesis, DNA binding, and btological activity of a series of DNA minor groove-bmding mtercalatmg drugs. J Pharm Scz 78,910-917. 39. Nunn, C. M., Jenkins, T. C., and Needle, S. (1993) Crystal structure of d(CGCG AATTCGCG) complexed with propamidme, a short-chain homologue of the drug pentamidme Bzochemzstry 32, 13,838-13,843. 40 Jenkins, T. C. and Lane, A N. (1997) AT selectivity and DNA minor groove bmdmg: modellmg, NMR and structural studies of the mteractions of propamidme and pentamidine with d(CGCGAATTCGCG)2. Bzochlm Bzophys Acta, 1350, 189-204 41. Satyanarayana, S , Dabrowiak, J C., and Chanes, J. B (1993) Trts(phenanthrolme) ruthenium(I1) enantlomer interactions with DNA mode and specificity of bindmg Blochemlstry 32, 2573-2584.
218
Jenkins
42. Prlch, D S , Waring, M J , Sun, J-S , Rougte, M , Nguyen, C H , Brsagm, E , Garestter, T., and Helene, C (1993) Charactertzatron of a triple helix-specific hgand BePI mtercalates mto both double-hehcal and triple-helical DNA J A401
Blol 232,926-946. 43 Scarra, P V and Shafer, R H (1991) Bmdmg of ethtdmm bromide to a DNA triple helix evidence for mtercalatron J Bzol Chem 266, 5417-5423 44 Schmrtz, H.-U and Hubner, W. (1993) A thermodynamtc and spectroscoptc study on the bmdmg of bereml to poly d(AT) and to poly(dA) poly(dT) Bzophys Chem 48,6 l-74 45 Chanes, J B , Leng, F , Przewloka, T , Fokt, I , Lmg, Y-H., Perez-Soler, R., and Pnebe, W (1997) Structure-based design of a new brsmtercalatmg anthracyclme antrbrotrc J Med Chem 40,261-266 46. Durand, M , Thuong, N T , and Maurtzot, J. C ( 1992) Bmdmg of netropsm to a DNA trtple helix J B~ol Chem 267,24,394-24,399 47 Waring, M J ( 1974) Stabtltzation of two-stranded rtbohomopolymer hehces and destabrllzatron of a three-stranded helix by ethtdmm bromide Bzochem J 143, 483486 48 Agbandje, M , Jenkms, T C , and Needle, S (1992) Anthracene-9, lo-dtones as potential anticancer agents Synthesis, DNA-binding, and brological studies on a series of 2,6-dtsubstrtuted dertvatrves J Med Chem 35, 14 18-1429. 49 Mahler, H R . Klme, B , and Mehrotra, B D (1964) Some observatrons on the hypochromrsm of DNA J A401 Blol 9, Sol-81 1 50 Marky, L A and Macgregor, R B (1990) Hydration of dA dT polymers: role of water m the thermodynamrcs of ethrdmm and proprdmm mtercalatton Blochemzstry 29,4805-48 11, and references therem 5 1 Muller, H.. Ztegler, B , and Schwelzer, B (1993) UV-VIS spectrometrrc methods for quahtattve and quantttatrve analysis of nucleic acids Int Spectroscopy Lab 4,4-l 1
15 Evaluation of Drug-Nucleic by Thermal Melting Curves
Acid Interactions
W. David Wilson, Farial A. Tanious, Maria Fernandez-Saiz, and C. Ted Rig1 1. Introduction If the temperature of a solution contaimng a hehcal nucleic acid is raised sufficiently, strand separation, or “meltmg,” occurs (Z-3) (Fig. 1) (see Note 1) The temperature that marks the midpoint of the melting process is called the melting temperature (or r,,,) (Fig. 2). At the T,,,, half of the nucleic acid exists in the helical state and the other half exists in the single-stranded state and the two species are m equilibrium (Eq. 1). helical nucleic acid c
single-stranded nucleic acid
(1)
Numerous drugs are known to bind directly to nucleic acids and, in many cases,these binding mteractions have been shown to be the mechanism behind the therapeutic effect of the drug (45) (see Note 2). Drug-nucleic acid binding interactions generally stabilize the structure of helical nucleic acids and this has a direct effect on the T,. For this reason, studies of the effect of drugs on the T,,, values of nucleic acids are performed when evaluatmg drug/nucleic acid interactions. Melting transitions can be detectedby UV absorbance,circular dichroism (CD), NMR, viscosity, electrophoresis, or calorimetry (1,2). However, UV absorbance is by far the most commonly used technique because of the method’s simplicity, sensitivity, and reproductbility. A list of the advantages and disadvantages of T,,, determinations made by UV absorbance 1s shown as follows: Advantages: 1. UV absorbance measurements are simple, sensltwe, and reproducible 2 Spectrophotometers are economical and are commonly found in research laboratones From
Methods III Molecular &o/ogy, Vol 90 Drug-DNA lnteractron Edtted by K R Fox Humana Press Inc , Totowa, NJ
219
Protocols
220
Wilson et al.
A-T -rich regions G-C -rich regions A-T -rich regions
Fig 1 Scheme descrlbmg the meltmg process of a DNA or RNA double-helix A-Trich regions melt first, then additional basepairs melt and unwind the helix Finally GC-regions melt and the twist IS taken up by the single-stranded regions 3 Only small amounts of nucleic acid and drug are required 4 No spectral slgnal from the drug IS necessary 5 The method IS reliable for screening, as well as for rank ordering of drugs wlthm a family of related drugs 6. A single T, value can provide an estimate of the association constant between drug and a helical nucleic acid
Disadvantages: 1. Drugs might have to be stable at temperatures as high as 95-100°C 2 Drugs must be soluble in buffers that are optically transparent 3 Binding interactions of drugs are compared at the T,,,, not at standard (25°C) or physlologlcal(37V) temperatures 4. r,,, values do not give specific mformatlon about the structure of the nucleic acid/ drug complex nor about the kinetics of the nucleic acid/drug interaction
7.1. Helical Nucleic Acids Targeted By Drugs Most studies of nucleic acid-bmdmg drugs to date have focused on stab& zatlon of double-helical DNA, which dissociates into two strands. In the past, these DNAs tended to be polymeric; however, recent studies have focused pnmarily on readily synthesized ohgomers of specific sequence. More recently there 1sinterest in the formation of triple-helical DNA for specific recognition of sequences in chromatm and for selective control of gene expression by antlgene therapeutic strategies (68). The development of triplex-forming, antlgene ohgomers has led to interest m dlscovermg drugs that selectively bmd to and stabilize triplexes (6-8). Quadruple-helical DNA (quadraplex or tetraplex DNA) IS also of growing interest because of the presence of potential quadraplex-forming sequences m telomeres and the potential for therapeutic
Drug-Nucleic
221
Acid Interactions
-I--l---c-
Helical DNA 25
35
40 Temperature
45
55
(“C)
Rg 2 The effect of mcreasmg temperature on the 260 nm absorbance of polyd(A-T), The left ordinate shows normahzed absorbance (-), where Anorlnallzed= (A,, - A,)/ (AT - A,); A,, 1s the absorbance for the single-stranded state (occurs at the htghest temperature), Ah IS the absorbance for the helical state (occurs at the lowest temperature), and AT IS the absorbance at temperature 2’. The rtght ordinate shows an approxrmation of the first derivative of normalized absorbance (A&,rmal,zedlAT, - - - -) The temperature that marks the mtdpomt of the melting process IS called the melting temperature (r,)
applications (9-11); however, very few studies have been conducted on interactions of low molecular weight compounds with quadraplexes (!L11). In recent years there has been an explosive interest in RNA structures and drugs that act to stabilize or destabiltze these structures. In nature, ribosomal (r), messenger (m), transfer (t), and viral RNAs, which are typically smglestranded molecules, fold to give a diverse array of double-helical and even triple-helical regions. Each of these structures is capable of dissociatmg (melting) into single-stranded regions. However, the helical regions of native RNAs can be exceedingly complex with multiple T,,,sper molecule. Attributing a particular melting transition to a specific helical region 1snot often possible; however, the stability of distinct regions and the overall stability of the helical RNA can be assessed. In addition to directly stabilizing and destabilizing helical RNA, drugs can also interact with viral RNA to disrupt RNA-protein complexes that are crrtrcal to replication of the virus (12). RNA-binding proteins usually recognize
Wilson et al.
222
specific RNA primary, secondary, or even tertiary structures. Drugs that destabilize these structures are likely to destabilize RNA-protein interactions. T,,, studies are an excellent method to investigate these interacttons (13) It should be mentioned at this time that numerous factors such as transport and metabolism that are not related to drug-nucleic acid-binding affinity enter mto the biological actrvity of a drug. For this reason, T,,, values for drug-nuclerc acid complexes, which are related only to bindmg affimty, generally cannot be directly correlated with the drug’s brological activity. However, the drugnucleic acid-bmdmg affinity must be suffcrently high to cause sufficient drug to bind at the receptor sateof the nucleic acid and exert the desired biologrcal effect. 1.2. Parameters that Affect the T, of Nucleic Acids The melting temperatures (T,,,s) of helical nucleic acids (mcludmg han-pms of RNA) increase with the number of bas e pans in the base-paired regrons. There 1s also a general lmear relatronshtp between the T, and nuclerc acid basepan composmon, which is demonstrated in the empmcally derived equation for DNA (3) (Eq. 2) T,,(T)
= 69 3 + 0.41 (%GC)
(2)
where %GC = [(# of G-C basepans) + (# of G-C basepans + # of A-T basepans)] x 100. Note that the equation only holds for random sequences of double-helical DNA under a specific set of buffer and salt condmons. Also worth noting IS a growing array of noncanonical Watson-Crick basepans that can affect the T,s of nucleic acids. These unusual basepanings can lead to unanticrpated results, particularly m RNA. For example, an unexpected G * A basepan can cause a predicted single-stranded nucleic actd to favor a drmerrc structure (14). The storchlometry of the meltmg reactron affects the concentranon dependence of the T,,, (see Note 3). T,,,s are affected by the romc strength of the medium (15): At salt concentratrons below 0.2 M, T,s are directly related to the logarithm of the salt concentratron; at very htgh salt concentrattons T,,,s can actually decrease (15) (see Note 4). The relationship between T,,, and lomc strength can be exploited to change a T,,, to a more convenient temperature, for example, in the case of a heat-labile drug or a particularly stable or unstable hehcal nucleic acid (see Note 5) The pH of the medium has a marked effect on the formatron of certain triplexes (16). 1.3. Estimation
of the T, of Nucleic Acids Using Databases Free energtes (AGO) for basepanmg have been experimentally determined for DNA (17) and RNA (28). These values, when applied to standard thermodynamtc relationships, can be used to esttmate the T,,, of helical DNA or RNA of a specified sequence. There IS also a growing, albeit mcomplete, body of
Drug-Nucleic Acid Interactions
223
Table 1 Extinction Coefficients for Double-Strand DNA DNA
Emax
hmax (nm)
PH
polydA polydT pob-W% poW(G-C), Salmon Sperm Calf Thymus PWW), polyd(A-C) polyd(G-T) polydG ’ polydC polyd1 polydC
6000 6600 8400 6600 6600 6900 6500 7400 5300
260 262 254 260 260 251 258 253 254
7.5 6.4 80 70 75 7.5 8.0
Adapted from ref. 33
data for the determmatton of T,,,sof hatrpin RNAs, as well as for RNAs that feature noncanomcal bases pairs or basepairs that feature modified bases. For reasons described in Subheading 1.2., the condtttons under which the free energies were determined are always specified; usually 25 or 37OC and 1 M salt. Deviations from these conditions must be taken into account when esttmatmg a T,,,using databases. 1.4. Determination of the T, of a Nucleic Acid by UV Absorbance Nucleic acids characterrsttcally absorb light in the UV region with a maxlmum absorbance at 250-280 nm. Note that 260 nm IS the most commonly monitored wavelength, and tt works well with heterogeneous sequences.Table 1 shows that the wavelength of maximal absorbance (I.,,,) depends on the nucleic acid Itself, as well as its sequence. Likewise, the molar extmction coefficient (a), depends on the nucleic acid, its sequence, and whether or not the nucleic acid IS single stranded or double helical. Thrs is because the absorbance of the solution increases as double-helical nucleic acids melt into single strands (hyperchromtc shift) (Fig. 2). Note that the melting curve shape IS sigmoidal, which is indicative of a cooperative process-a hallmark of a melting helical nucleic acid (1,2). This increase in absorbance is because of a reduction of electronic interactions in base stacking and the final absorbance approaches that of the nucleic acid taken as monomers (1,2). The change m absorbance, termed hyperchromicrty, is the physical property that IS followed when determining the r, of a nucleic acid by UV absorbance. The inflection point in this curve in general marks the r,,, (Fig. 2). Since 7&s of short olrgomers are concentratron dependent (see Note 3), UV absorbance measurements are first used to adjust the concentratton of the
Wilson et al.
224 Table 2 Extinction Coefficients at 260 nm, 25OC, and pH 7.0 for Single-Strand RNA and DNA E260
RNA
PA PC PG PU APA APC APG APU CPA CPC CPG CPU GPA GPC GPG GPU UP A UPC
UPG UPU
&260
AR’ cm-’ x 1c3
DNA
M-l cm-’ x 10”
154 72 115 99 13 7 105 12.5 12 0 10 5 71 89 81 26 8.7 08 06 12 3 8.6 100 9.8
pdA PdC PdG MT
154 74 11.5 87 13 7 10 6 12 5 II 4 106 73 9.0 76 26 88 08 00 117
dApdA” dApdC dApdG dApdT
dCpdA dCpdC
dCpdG dCpdT dGpdA dGpdC dGpdG dGpdT dTpdA
dTpdC dTpdG
81 9.5 84
dTpdT
“Calculated from the deoxymononucleotlde monophosphate values assuming that cognate dldeoxy- and monophosphates have Identical hypochromwtles Appropriate extmctlon coefficients for single-strand ohgonucleotldes of chamlength, m and base sequence, DpEpFpGp KpL, may be calculated accordmg to the formula &DpEpFpGp
KpL
= d
[~(EJ~~E + EE~F
+ &F~G +
+ EK~L)
-
EE -
&F -
EG
-
EK]
This approxlmatlon yields extmctlon coefficients accurate to better than 10% for most single-strand sequences Adapted from data m ref. 34
nucleic acids under study. For this purpose, molar extinction coefficients have been emplrlcally determined for numerous double-helical DNA and RNA sequences (Table l), as well as for mono- and dinucleotides of DNA and RNA (Table 2). It IS important not to confuse extmctlon coeffclents used for double and single-stranded nucleic acids since large concentration errors result (see Notes 6 and 7). The percent hyperchromwty (%H) for a melting transition (helical state to single-stranded state) is derived from the melting curve and calculated as (Eq. 3). %H = [(A,, -A,,) /A,,] x 100 (3)
Drug-Nucleic
Acid Interactions
225
where Ah IS the absorbance of the helical nucleic acid and A,, is the absorbance of the single-stranded nucleic acid. Note that at 260 nm, a preparation of Escherichla coli DNA containing essentially only double-helical DNA displays a hyperchromlcity of 28% upon melting. A hyperchromlcity of less than 25% means that a substantial fraction of the DNA was already dissociated into single strands prior to heating (see Note 8). 1.5. Determination
of AH0 for a Nucleic Acid
The molar enthalpy (AH”) of the transition from helical to single-stranded state must first be determined in order to apply T, data from drug-nucleic acid binding studies to the calculation of an association constant for the drug with helical nucleic acids (K,,). (The calculation of these association constants is described m Subheading 1.7.) Note that AH” values are often available for common nucleic acids used in drug-binding studies and, m addition, AH0 values can be estimated from the free energy data found m Subheading 1.3. However, AH” values are often not known for hairpin structures from newly sequenced vu-uses, for example, and energy contrlbutlons by many bulges, open loops, and noncanonical basepairs are not addressed in the tables of empirical data referred to in Subheading 1.3. Experimental T,,,s of helical nucleic acids can be used to determine AH”, as well as AG” and AS” values, for the melting process. The van? Hoff equation can be used for this purpose, and the specific form of the equation used depends on the stolchiometry of the melting reaction (19) (see Note 9). A hairpin structure, for example, undergoes a ummolecular melting reaction, therefore, an appropriate derivation of the van? Hoff equation for this two-state process IS (Eq. 4) (see Note 10):
1nK= -(AH’/R)( l/T) + AS”/R
(4) where K = [hNA]/[ssNA] = f/( 1-f) and f is the fraction of helical nucleic acid at a given temperature (hNA is the helical nucleic acid, ssNA is the smglestranded nucleic acid). Note that f begins at 1.Oat low temperatures, decreases to 0.5 at the T,,,, and ends at 0.0 at elevated temperature (Fig. 2). The temperature gradient typically runs from 0 to 100°C, but this range can be narrowed depending on the nucleic acid under study m order to save time. A plot of 1nK vs l/T yields a straight line with a slope of -AH’/R and y-intercept of AS”/R. The temperature must be in degrees Kelvin (“K). Note that the T, IS independent of concentration for harrpm transitions. An analogous equation ISused for the two-state melting of double-stranded nucleic acids: l/T,.,, = (R/AH“)ln[NA,,,,,]
+ (AS’ - Rln[n])/AH’
(5)
226
Wilson et al.
where II IS 1 for self-complementary helices, and 4 for nonselfcomplementary helices. The bimolecular melting of ohgomers is concentration-dependent, so meltmg curves must be obtained at several concentrations of helical nucleic acid. A plot of I/T, vs ln[NA,,,,] yields a straight lme with a slope of EUAH” and an intercept of (AS”-Rln[n])IAH”. Analogous expressions for triple- and quadruple-helical nucleic acids are available (1,2,19).
1.6. Influence of Drugs on Nucleic Acid T, Values The difference between the T, of a nucleic acid (denoted T,,,“) and the T,,, observed m the presence of drug (denoted T,) 1stermed AT,. AT, 1srelated to the affinity of binding of the drug to the nucleic acid. Drugs that bind nucleic acids generally bmd to the helical state with greater affinity than to the smglestranded state. This stabilizes the hellcal nucleic acid, the equlllbrlum relatlonship shifts to the left (Eq. l), and the T,,, increases since more heat energy must be applied to the solution to melt the stablhzed strands (Fig. 3). The addition of drugs to nucleic acid solutions can also cause changes in the shape of the melting curve. For most nucleic acid polymers, the meltmg curve 1ssharp m the presence or absence of drug because of the homogeneity of base composition in polymers. In more heterogeneous systems,the addition of drugs may cause an increase in the breadth of the transition and, at ratios below saturation of bmdmg sites, drugs can cause a biphaslc transition (Fig. 3) Such transition broadening 1sfrequently related to stronger binding of a drug to a specific nucleic acid sequence or structure such that it 1sstabilized more than other regions of the nucleic acid 1.6.1. lntercalators Drugs generally bmd to helical nucleic acids over single-stranded nucleic acids because helical nucleic acids have uniform structural features with favorable free energies for complex formation. A good example of these structural features 1s the base stacking found m both double-helical DNA and RNA. Stacked bases provide an environment for mtercalatlon of a drug, which stablhzesthe double helix and increases the T,. Classical mtercalators, like ethldium bromide, markedly increase the T, of double-helical DNA and RNA (13). Stacking of drug with bases of single-stranded nucleic acids is much weaker, therefore, mtercalators do not lower the T,. Intercalators do not generally have a pronounced interaction with specific base sequences, therefore, the AT,,, values for GC-rich and AT-rich DNA are roughly the same (4,5,15). 7.6.2. Groove-Binders The major and minor grooves of double-helical DNA and RNA are other examples of structures that are recognized by drugs. The grooves m helical
Drug-Nucleic
Acid Interactions
227
1
0 20
30
40
50
60
70
80
go
Temperature (“C)
0.014 0.012
s
0.01
g 0.008 .r 8 a 0.006
20
30
40
50
60
70
80
go
Temperature (“C)
Fig. 3. (A) The effect of phenyl-benzrmidazole on the melting curve of d(CGCAAA TTTGCG), The concentratton of duplex was 3 x IO4 mol of duplex per hter. The plot shows normaltzed absorbance versus temperature The molar rattos of drug to duplex were 0 (-), 0 5 (0) 1 0 (A), 1 5 (Ci), and 2 (H) (B) The plot shows an approximation of the first dertvative of normalrzed absorbance (AAnormal,zed/Ar)versus temperature Expertments were conducted in MES buffer with 0 1 MNaCl.
nucleic acids have a specific geometry with uniformly positioned, negatively charged phosphate groups that run along the length of the hehx. Classical groove-bmders like distamycm (as well as pentamldme, netropsm, and related
228
Wilson et al
unfused aromatic heterocycles) are positively charged and bmd electrostatically in the minor groove of AT-rich sequences of DNA (2/J), thus stabtlrzmg these sequences and raising the T,. Smgle-stranded DNA, on the other hand, does not have a specific groove; tt exists as a random coil that is dynamic. Dtstamycm fails to bmd single strands with high affimty Note that double-helical RNA (A-form helix) also has a minor groove, but its dimensions differ from the B-form helix of DNA Distamycm does not bmd to RNA, and has a negligible effect on the r, (13). Thts means that distamycm and other helix-specific compounds can serve as probes of A- or B-form structure (21). 1 6.3 Dual-Mode Binding of Drugs to Nucleic Acids Some unfused aromattc cations such as furamldme (22X24), the antltrypanosomal agent, bereml (29, and DAPI bind strongly in the minor-groove of DNA and have high AT,,, values with polydA * polydT (26). They also bind to GC sequencesof DNA, but m these sequences the mode is predicted to be mtercalation. In general, their mteractions m G-C sequences of DNA are weaker and the AT, values reported are lower than AT,,,values for A-T repeated sites These compounds can also have significant RNA interactions through mtercalation complexes (26). 7.6 4. Antigene and Antisense O//gonucleotides Anttgene and antisense ohgonucleotides form a new class of nucleic acidbmdmg drugs. The oligonucleotides usually have modified backbones that are stable and nuclease-resistant. They are designed to associate with (m the Watson-Crick sense) and stabilize naturally occurring nucleic acid “targets” (6-8). Low-mol-wt compounds (drugs) are often added to further stabilize the resulting double- and trlple- “chimeric” helices (one synthetic strand, the others being natural strands) (Fig. 4) (6-8). Chtmertc helices by themselves, as well as chimers complexed with drugs, can pose new variables such as markedly elevated helix T,,,sand changestn overall helical conformation (e.g., B- to Aform) (21). 1.6.5. Drugs that Lower the T, of Nucleic Acids If the drug binds to the single-stranded state more strongly than the helical state, then the equilibrium shifts to the right (Eq. 1) and the T,,, decreases. A cattomc azoniacyclophane (27), for example, destabilizes RNA duplexes because of the formation of an insertion complex with the bases of the single strand. This compound destabilizes RNA (Fig. S), as well as RNA-DNA hybrid polymers, but it stabilizes DNA polymers. The fact that the compound spectfitally and strongly complexes adenine rtbonucleotides m solution suggests a
Drug-Nucleic
229
Aod In teractlons 1
0.025
0” 50.8
f z =0.6 a
Jjo.4
.z E0.2 0’ z
0 20
30
40
50
60
Temperature
70
(“C)
80
90
Fig 4 The effect of a qumolme derivative on the melting curve of a polydA * 2polydT triplex. The concentration of triplex was 1 x 1o-6 mol of triplex per liter The left ordinate shows normalized absorbance where molar ratios of drug to triplex are 0 (0) and 0 2 (A) The right ordinate shows an approxlmatlon of the first derlvatlve of normalized absorbance(hA noma,,zed/A7’) vs temperature for molar ratios of drug to triplex of 0 (0) and 0.2 (A) Experiments were conducted m PIPES buffer with 0 2 MNaCl
specific complex with the purme bases of the RNA polymer. Clsplatm (cudlaminedlchloroplatmum [II]) IS another drug that destablhzes DNA, however, the mechanism depends on the formation of mtrastrand covalent linkages between bases (28,29). 1.7. Association Constants for Drug-Nucleic Acid Interactions Association constants for drug-helical nucleic acid mteractlons can be calculated from T, results (3&32) (Eq. 6):
where Tmois the meltmg temperature in the absence of drug and T,,, is m the presence of drug; AH” 1s the enthalpy change associated with meltmg of the helical nucleic acid alone; Kh and KS, are the bmdmg constants of the drug to the helix and the smgle strands, respectively; A$,and IV,, are the number of binding sites (see Note 11); and R IS the gas constant. The activity, a, relates to the amount of free drug at T,. Note that the equilibrium constants, Kh and KS,, are for complex formation at T,,, and to extrapolate these values to some standard temperature such as 25 or 37°C requires knowledge of the enthalpy for complex
Wilson et al.
230
0.8 0.6
20
30
40 Temperature
50
60
70
(“C)
Fig. 5. The effect of two closely related azoniacyclophanes (CP33 and CP66) on the melting curve of poly r(A-U),. The concentration of duplex was 9 x lop5 mol of duplex per liter. The ordinate shows normalized absorbance versus temperature where duplex alone is (0), duplex with CP33 (m), and duplex with CP66 (X). The molar ratio of drug to duplex was 0.2 for both CP33 and CP66. Experiments were conducted in MES buffer. formation (as opposed to the enthalpy for helix melting in Eq. 6) and use of the van? Hoff equation. Equation 6 has five unknowns: A$,, Kh, N,,, KS,,and “a” (the free-drug concentration or activity). In many cases the term KS, * a is much less than one (ccl) and the second term in Eq. 6 disappears. For example, if the drug concentration is 1c5 A4 or less, and KS,is ~10~ M-l, then binding to the single-
stranded state is insignificant under the selected experimental conditions and Eq. 6 reduces to:
(7) Typically, Nh is determined by a titration experiment under conditions that enhance the binding of the drug to the helical nucleic acid, such as a low salt concentration (e.g., 10 mM NaCl). Under these conditions, 7’,s are plotted against increasing drug-nucleic acid ratio. As the binding sites on the nucleic become saturated, the effect of increasing the drug-nucleic acid ratio has a diminishing effect on the T,,,.The change in T,,,levels out to a plateau and Nh is the drug-nucleic acid ratio that corresponds to the breakpoint (see Note 12). During the Kh experiment, if T, is determined under saturated conditions with
Drug-Nucleic
Acid Interactions
231
no excessdrug (all sites are filled prior to heating), then, for drugs with high K,, values (>l 06), the activity, a, can be approximated as one-half of the total drug concentration (i.e., since, at T,, one-half of the helix has melted, the only free drug, a, is a drug that was bound to the now melted helix). With Nh and AH” determined independently, Eq. 7 can be used to calculate Kh. It should be remembered that Kh is the association constant at the T,,, and no significant binding to the single-stranded species has been assumed. Although it is possible to determine both K,, and Nh from a plot of T,,, vs drug concentration and use the of a curve fitting routine, an independent determination of Nh generally gives more accurate results. 2. Materials 2.7. Specfrophofomefer and Temperature Control Any good quality spectrophotometer capable of absorbance measurements in the UV region as a function of temperature may be employed. Double-beam spectrophotometers provide a stable, referenced signal that is not affected by fluctuations in lamp intensity over the extended periods of time that are commonly covered in T, determinations. For optimal results, the experiment should be controlled by computer since the signal to noise ratio can be significantly improved by computer averaging of absorbance and temperature readings. Cary (Varian, Melbourne, Australia) and other commercial spectrophotometers are readily equipped for the determination of T,s and temperatures can be controlled with vendor-supplied accessories.A cuvet equipped with a sealed, calibrated thermistor probe is an essential reference for accurate temperature readings. Thermister probes can be fitted through a hole in the Teflon stopper of the cuvet, which contains buffer solution. Heating rates are generally 0.5”C/ min. To verify that the heating rate is sufficiently slow, melting curves can be repetitively run from faster heating rates to slower heating rates. The heating rate at which no further changes in the melting curves occur marks the appropriate heating rate for the nucleic acid under study. If the selected starting temperature is below 20°C, nitrogen gas should be continuously passed through the sample compartment to prevent water from condensing on the faces of the cuvet. 2.2. Cuvefs Low-volume, masked (black sides reduce the effect of stray light at very low and high absorbances) quartz cuvets of 1-cm path length with tight-fitting Teflon stoppers give the best results (Starna Cells, Atascadero, CA). One milliliter of solution is satisfactory for most measurements. Loss as a result of evaporation is usually less than 2% of the initial volume, and this can usually be neglected since most of this loss occurs after the critical T,,, region has been
Wilson et al.
232
passed. However, the repettttve cyclmg of a tttratron experiment can lead to further evaporatton. Always check the absorbance at 25OC before and after the run to rule out the effects of evaporation. A small amount of Dow silicone 011
can be added to the top of the sample tf the experiment requires temperatures near 100°C. This reduces evaporation; however, the silicone oil may extract the drug from solution. Cuvets are cleaned by soakmg m glassware detergent. The detergent solution can be heated to remove any material adsorbed onto the quartz surfaces. If necessary, the cuvets can be cleaned by soaking m mtrtc acid to remove drugs that adsorb to the glass walls. Washing IS followed by rinses wtth purified
water followed by ethanol, Never use ethanol as a first rinse since this will precipitate onto the cuvet surfaces some nucleic acids and drugs, as well as all proteins Cuvets are drained and dried prior to use The faces of the cuvets are part of the optical system of the spectrophotometer and should never be touched or rubbed with paper towels or other abrasive materials. Lens paper or labora-
tory ttssues are appropriate. Maintenance of clean, matched cuvets is a critical part of the experiment. 2.3. Buffers
The selected buffer should be compatible with the drugs under study. The followmg buffers have pKa values near 7.0: 1 PIPES (pKa = 6.8) buffer 0 01 MPiperazme-N, N’-bu[2-ethane sulfonlc acid], 1 x 1O-3 MEDTA, pH 7 0; 2. MES (pKa = 6 15) buffer: 0 01 M%-(N-morphohno) ethane-sulfonic acid, 1 x 1Cr 3 A4 EDTA, pH 6 25, 3. Phosphate (pKa = 6.8) buffer: 7.5 nnI4 sodturn phosphate monobastc [NaH,PO,], 1 x 1O-3 MEDTA, pH 7.0, 4 Cacodyhc (pKa = 6 27) buffer 0 01 MCacodyhc acid, 1 x 1w3 M EDTA, pH 7 0 Other similar
buffers may be used. Trts buffer is not commonly
used m T,
measurements since Trrs interacts with nucleic acids, absorbs light at 260 nm, and its pKa changes substanttally with temperature. The ionic strength of buffers can be adjusted by addmon of NaCl or other desired salt. The buffer should be filtered through a clean 0.45urn filter fitted on a vacuum flask. Vacuum filtration sufficiently degassesthe buffer as well. r,,, values are dependent on salt concentration and pH so it is important that buffer solutions be carefully prepared for these expertments. Some buffersprecipitate the drugsunderstudy and this can only be determined
m general by trial and error (see Note 13).
In working wrth RNA, distilled or deiomzed water must be further treated with drethylpyrocarbonate
(DEPC) to ensure that the water IS free of RNase contamma-
tion. Add 1% DEPC (Sigma, St. Louis, MO) to the water (i.e., 1mL DEPC /L) and
Drug-Nucleic Acid Interactions
233
stir at room temperature overmght. Autoclave for at least 20 min to decompose remaining DEPC (see Note 14). Use this treated water to prepare your buffer. Glassware can be filled with DEPC-containing water, stored overnight, autoclaved and decanted. Alternatively, glassware can be heated at 180°C for 8 h. 2.4. Nucleic Acid Samples Purified nucleic acid samples are dissolved m small volumes of the selected buffer and kept frozen when not in use. Concentrations are determined using extmction coefficients for polymers (Table 1 [33/) or short single-stranded oligomers (Table 2) (34) 2.5. Drug-Stock Solutions Purified drugs are dissolved m small volumes of buffer, purified water, or organic solvent and kept m the refrigerator when not m use. The concentration of the stock solutions are typically near 1 n&L If the drug is kept in the refrigerator for some time, it is important to redetermine the concentration of the drug solution before use. Many drugs adsorb to glass or plastic surfaces and this alters the drug concentration. If the drug is not very soluble in buffer or water, the drug can be made more dilute or dissolved m an organic solvent such as DMSO, which has a high boiling point (see Note 15). 3. Method 3.1. Sample Preparation 1 Dilute the concentrated nucleic acid to 1 mL with the desired buffer. The stock solutions are drluted to an absorbance of -0.5 to give the most accurate results, however, higher or lower absorbances can be used depending on the quality of the spectrophotometer. 2. Determine the exact concentration of the nucleic acid by measuring the absorbance at 260 nm (see Note 6 and 7) and then apply Beer’s law (A = ale, where A is the absorbance, E is the molar extinction coefficient at 260 nm, 1 is the pathlength m cm (usually 1 cm) and c is the molar concentration of the nucleic acid). Note that the concentration units used in Tables 1 and 2 are m moles of phosphate per liter. 3. In general the drug is added to the nucleic acid sample at a ratio that will saturate the binding sites (see Subheading 1.7.; Note 12).
3.2. T,,, Measurements 1. A Cary 3 spectrophotometer is a double-beam instrument that handles SIX cuvets concurrently m a B-position automated cell changer. The first position holds a cuvet fitted with a temperature probe (see Subheading 2.1.). The second position holds a cuvet filled with the buffer as a reference. Posttions 3,4, 5, and 6 hold samples.
Wilson et al. 2 Olrgonucleotide samples should be heated above their meltmg temperature (which usually means up to SO-9O’C) and allowed to slowly cool to the starting temperature before the actual meltmg curve IS performed. Such pretreatment not recommended for heterogeneous natural DNAs, which may not easily reanneal. 3. T,, measurements are typrcally mmated near 0°C for ohgonucleottdes and near 25°C for polymers (the latter generally melt at higher temperatures). At temperatures below 20°C nitrogen gas IS contmuously passed through the sample compartment to prevent condensatton. The temperature is increased at the desired rate until complete melting curves are obtamed for all samples. Exammatron of meltmg reverstbrhty (helix formatron) 1saccomphshed by reversing the temperature gradient (hrgh to low) 4. The spectrophotometer collects absorbance readings as a function of temperature and the data are stored m the computer memory Averaged absorbance readings are typltally collected every 0 5’C for each sample and this grves a total of over 150 points for most meltmg curves For very steep meltmg curves, such as those obtamed for polymers, absorbance readmgs should be collected at shorter temperature intervals 5 The data can be reduced using approprrate software packages provided by the spectrophotometer manufacturer, or the data can be transferred to a diskette and reduced by graphical analysts (e g., KaletdaGraphTM, Synergy Software, Reading, PA) or by stattstical software packages 6. Remember to subtract the absorbance of the buffer reference to obtain the sample absorbance 7 The T,,, value for each melting transitton is determmed by Frrst derrvatrve analySIS (plot AA/AT vs T as an approximation) where the maximum marks T, at the mflectton point m the stgmordal melting curve (A vs 7’); or the temperature at whtch the absorbance has increased by 50% (see Fig. 2; Note 16)
4. Notes 1 Helical nuclerc acid refers to one or more strands of nucleic acid polymers or ohgomers that are hydrogen bonded (basepaned) m the canonical or noncanomcal Watson-Crick sense. Helical nuclerc acid refers to double-, triple-, or quadruplestranded, helical DNA or RNA, as well as intrastrand hanpms and pseudoknots The term “hehcal” IS to nucletc actds as “folded” IS to proteins (wrth a noted exception bemg the a-hehx m protems) Helix-to-single-strand transmons for nucleic acids are also descrrbed m the literature as* hehx-to-cotl, double-strandedto-single-stranded, native-to-denatured, folded-to-unfolded, and so forth. 2 The convenient term “drug” m this dtscusston represents any organic compound that has a potential therapeuttc effect based on Its potenttal ability to bmd to a nucleic acid and exert a btologtcal effect 3 The meltmg temperature of long duplexes, such as polydA . polydT (or polyrA polyru), IS concentratton Independent The concentratron-dependent T,,, IS only for short helical ohgomers (<20 bp); this 1s drscussed m Subheading 1.5. 4 The general relattonshrp between the T,,,and salt concentratron (IS) 1sgtven in Eq. 8 dT,,,ldln[M]
= - An RT,,,2/AHo
(8)
Drug-Nucleic
5
6
7.
8.
9
Acid Interactions
where M is the molar concentratton of an ion such as sodium, An IS the net difference in salt ion (single strands - duplex) per mole of helix that has melted mto single strands, and AH” is the standard enthalpy change of strand dissociation (meltmg). With high-mol-wt DNA, the T,,, generally increases 15-20°C for every 1O-fold Increase m the salt concentration. There IS a playoff when adJusting the iomc strength to achieve a more convenient T,, because the affinity of drugs that bind electrostatically to nucleic acids is markedly affected by ionic strength. The nearest-neighbor approximation states that the extinction coefficient of a base m nucleic acid smgle strands depends on the extmctton coefficient of the individual base (an intrinsic property with a constant value), as well as the effect that neighboring bases have on this extmctron coefficient (a variable contribution that depends on the sequence) (Table 2). It is also important to note that selfcomplementary and hairpin oligomers have a single-strand sequence, but can be double helical in solution at room temperature and, therefore, could be hypochromically shifted at 260 nm because of helical stacking This means that when determining strand concentrations, A2,0c values cannot be used with &250c constants (Table 2) without correctmg for the hypochromic shift. To determme a correction factor, perform a meltmg curve and extrapolate the single-strand portion of the curve, which is at high temperature, back to 25°C The ratio of the absorbance of the single strands (Ass,250c, extrapolated) over the observed absorbance of the nucleic acid at 25°C (A ,,,.& IS the correction factor This enables one to take any AzsoC value and get a corrected determination of strand concentraextrapolated/A,,, 25°C)]/~25oC = mol phosphate/L This tion as. lA25”C x (b,25”C9 correction factor can only be used for helical nucleic acids that give a fairly linear tracing m the smgle-strand portion of the curve Moreover, the correction factor applies only to a specific buffer condition. Always remember to subtract the buffer reference absorbance taken at the appropriate temperature. A number of rules-of-thumb exist for approximatmg the concentration of nucleic acids. For example, one absorbance unit (AU or optical density umt [OD]) of double-helical DNA equals 50 yg of double-stranded DNA or 40 pg of singlestranded RNA When these masses are diluted m exactly 1 mL of buffer, the resulting solutions will have an absorbance of 1.O at 260 nm in a l-cm cell This works out, m the case of DNA, to roughly 150 l.tM of phosphate groups It must be understood, however, that these rules-of-thumb are approximations and apply only for random sequences of DNA or RNA They should not be used in place of calculations that properly take nucleic acid sequence into account Helical nucleic acids have umque %H values that depend on base composmon and sequence These %H values are helpful especially when working with RNA. RNA is labile and subject to digestion by RNases (see Subheading 2.3.). % H values should remain constant for a given nucleic acid; a sudden reduction in this value is a sure sign of decomposition of the nucleic acid It is important to point out that AH” determined by UV absorbance is based on the assumption that all species are being accounted for by the meltmg curve
Wilson et al.
236
10
11.
12
13
14.
15.
16.
Intermedtates that do no exhtbtt a chromtc shaft at 260 nm, for example, ~111not be accounted for and the resulting AH” will be less than the true value Calortmetrtc determmattons of AH’, on the other hand, are direct determmattons of enthalpy and take all such “hidden” mtermedtates mto account. Therefore, tf AH”,,, /AH”,,, is less than 1 0, then “hidden” mtermedtates extst m the dtssoctation (melting) process Complex meltmg curves, for example, m RNAs wtth several hanpms or other conformattons, frequently can be analyzed on the basts of several two-state meltmg transmons Also note that the dtssoctatton of triplex nucleic acids into one duplex plus one single strand is constdered a two-state transition The values of Nh and N,, can be expressed as per base (nucleottde). per basepatr, or per molecule Expression as per base or per basepatr IS generally preferred for polymers that contarn many basepairs and have a dtstrtbutton of molecular lengths For synthetic ohgomers of a specific sequence, as well as for mtrastrand hehces formed wtthm an RNA molecule, tt IS common to express Nh and N,, as binding sites as per molecule All of these expressions of N are satisfactory, but they affect the magmtude of the numerical value reported as K If the drug 1san mtercalatmg chromophore, then a solutton of drug can be momtored at its h,,, and tnrated with helical nucleic actd In many cases the process of mtercalatton will reduce the absorbance of the drug and shift h,,, to a longer wavelength A plot of l/A vs drug-nucleic acid ratto ~111level out to a plateau as saturation occurs N,, IS the drug-nucleic acid ratio that corresponds to the breakpoint A wade range of pH and salt concentrations can be used, but condmons of pH 7.0 and 0.1 M salt (e g , NaCl) are most common m the literature Typically, lop3 A4 EDTA IS used m T,,, buffers to prevent artifacts because of the strong bmdmg of multivalent metal ions wtth nucleic acids DEPC reacts with RNA, so tt needs to be decomposed by heat treatment before RNA IS added (DEPC breaks down to CO;! and ethanol). Compounds containing primary amme groups, such as TRIS will also react wtth DEPC Such compounds should be added only after DEPC treatment 1scomplete The drug m DMSO 1sadded to the nucleic acid solutton wtth mixing and tf most of the drug IS bound, the solutton will be clear To get accurate T,,, results, the same amount of DMSO solvent should be added to the blank sample (buffer cell), as well as to the free nucletc acid sample. Any prectpttatton (cloudmess) m the solutton makes the absorbance reading unrehable Note that volattle solvents ~111 evaporate at elevated temperatures, which can lead to unexpected prectpttation To determine by hand the r,,, for a meltmg curve drawn by a strtpchart recorder (Fig. 6)
a Draw a lme (1) through the steepest portion of the absorbance increase b Draw a line (2) from the final portion of the curve to intersect line 1, creating pomt A. c Draw line (3) from the mrtial portion of the curve to intersect line 1, creating point B.
Drug-Nucleic
Acid interactions
237
Fig 6 Method for determmmg a melting temperature by hand (see Note 16)
d Through A, draw a lme parallel to the absorbance axis This is lure (4) e Through B, draw a line parallel to the absorbance axis This 1s line (5) f. Through B, draw a lure parallel to the temperature axrs, creating pomt C Thts IS lme lme (6) g Through A draw a lme parallel to the temperature axes, creating point D This IS line lme (7) h Connect pomts D and C with a stratght line. This IS lme lme (8) The mtersectton of (8) with line (1) marks the T,,,
Acknowledgments The authors acknowledge the work done by all members of our laboratory over the years to develop the procedures described in this chapter. The research m the authors’ laboratory is supported by NIHID AI-33363 and the Car-y spectrophotometers were purchased with support from the Georgia Research Alliance.
Further Reading Puglisr, J D. and Tinoco, I , Jr (1989) Absorbance Melting Curves of RNA, m Methods zn Enzymology, vol. 180 (Grossman, L and Moldave, K., eds ), Academq pp 304-325.
References 1. Saenger, W. (1984) in Prwzczples of Nuclezc Acid Structure (Cantor, C. R , ed.), Chapter 6, Springer-Verlag, New York, pp. 141-149. 2. Cantor, C. R. and Schrmmel, P. R. (1980) Bzophyszcal Chemzstry Part I The Conformation of Blologzcal Macromolecules (Bartlett, A. C., Vapnek, P. C., and McCombs, L. W., eds.), W H Freeman, New York
Wilson et al.
238
3 Mandel, M and Marmur, J (1968) Use of Ultraviolet Absorbance-Temperature for Determmmg the Guanme plus Cytosine Content of DNA, m Methods zn Enzymology, vol XXII (Part B) (Grossman, L. and Moldave, K , eds ), Academtc, pp 195-206 4 Waring, M. J (198 1) m The Molecular Basis ofAntzbzotzc Actzon. 2nd ed (Gale, E F , Cundhfe, E , Reynolds, P E , Richmond, M H , and Waring, M J , eds >, Wiley, New York, p 287. 5 Bell, C A, Dykstra, C C , Aiman, N A I., Cory, M , Fatrley, T A, Tidwell, R R (1993) Structure-activity studies of dicatiomcally substituted bis-benzimidazoles against Gzardza lamblza correlation of antigiardial activity with DNA bmdmg affinity and Giardial Topoisomerase II mhibition Antzmzcrob Agents Chemother. 32,2668-2673 6 Sun, J.-S. and Helene, C (1993) Ohgonucleotide-directed triple-helix formation Curr Opzn Str Bzol 3, 345-356 7 Wilson, W D , Tamous, F A, Mizan, S., Yao, S , Kiselyov, A S., Zon, G., and Strekowski, L (1993) DNA triple-hehx specific mtercalators as antigene enhancers. unfused aromatic cations Bzochemzstry 32, 10,61410,621 8 Chandler, S P , Strekowski, L , Wilson W D , and Fox, K R (1995) Footprmtmg studies on hgands which stabihze DNA triplex. effects on stringency within a parallel triple helix Bzochemzstry 34, 7234-7242. 9 Murchie. A I H and Lilley, D M J. (1994) Tetraplex folding of telomere sequences and the mclusion of ademne bases. EMBO J 13,993-1001. 10 Williamson, J R., Raghuramen,M K.. and Cech, T R (1989) Monovalent cation-induced structure of telomeric DNA* the G-quartet model Cell 59, 87l-880. 11. Feng, J , Funk, W. D , Wang, S -S., Wemrich, S L , Avihon, A. A , Chm, C -P , Adams, R R , Chang, E , Allsopp, R C , Yu, J , Le, S , West. M D , Harley, C B , Andrews, W H , Greider, C W , and Villeponteau, B (1995) The RNA component of human telomeraase Sczence269, 1236124 1 12. Zapp, M L , Stern, S , and Green, M R. (1993) Small moleculesthat selectively block RNA bmdmg of HIV-I Rev protein inhibit Rev function and vu-al production. Cell 14,969-978 13 Wilson, W. D., Ratmeyer, L , Zhao, M , Strekowski, L , and Boykm, D (1993) The search for structure-specific nucleic actd-Interactive drugs: effects of compound structure on RNA versus DNA mteraction strength Bzochemzstry 32, 40984104. 14. Li, Y , Zon, G , and Wilson, W D (1991) Thermodynamics of DNA duplexes with adJacentGA mismatches Biochemzstry 30,7566-7575 15. Wilson, W D. (1990) in Nucleic Aczds zn Chemzstry and Bzology Reverszble Interactions of Small Molecules wzth Nucleic Acids (Blackburn, M and Gait, M , eds.), Chapter 8,Oxford-IRL, Oxford, UK, pp 295-336 16. Wilson, W D., Hopkins, H. P., Mtzan, S., Hamilton, D. D., and Zon, G. (1994) Thermodynamics of DNA triplex formation in ohgomers with and without cytosme bases.influence of buffer species,pH, and sequence.J Am Chem Sot 116,3607,3608
Drug-Nucleic
239
Acid Interactions
17. Breslauer, K. J., Frank, R., Blocker, H., and Marky, L A (1986) Predtcting DNA duplex stability from the base sequence Proc Nat1 Acad Scl USA 83, 3746 3750
18. Turner, D. H. and Sugimoto, N (1988) RNA structure predictton Ann Rev Biophys Blophys Chem 17, 167-192 19 Puglisi, J. D and Tinoco, I , Jr (1989) Absorbance melting curves of RNA, in Methods zn Enzymology, vol 180 (Grossman, L and Moldave, K. eds ), Academic, pp 304-325 20. Zimmer, C. and Wahnert, U. (1986) Nomntercalatmg DNA-bmdmg hgands specificity of the interaction and then use as tools m btophysica, biochemical and btological mvestigations of the genetic material. Prog Biophys. Mel Brol 47,3 l-l 12 21 Gryaznov, S. M , Lloyd, D H , Chen, J-K., Schultz, R. G., DeDtomsio, L A , Ratmeyer, L , and Wilson, W. D. (1995) Oligonucleotide N3’-P5’ phosphoramtdates Proc Nat1 Acad Scl USA 92,5798-5802 22. Wilson, W. D , Tamous, F. A , Barton, H. J., Jones, R. L., Fox, K , and Strekowski, L. (1990) DNA sequence dependent bmdmg modes of 4’,6-diamtdmo-2-phenylmdole (DAPI) Blochemzstry 29, 8452-846 1 23 Tanious, F. A., Spychala, J., Kumar, A , Greene, K., Boykin, D. W., and Wilson, W D (1994) Different bmdmg mode in AT and GC sequences for unfusedaromatic dtcations J Bzomol Structure Dyn 5, 1063-1083. 24 Wilson, W D , Tamous, F A , Buczak, H , Ratmeyer, L S., Venkatramanan, M K , Kumar, A., Boykm, D W , and Munson, B. R (1992) Molecular factors that control the nucleic acid bmdmg mode selection by unfused aromatic cations, m Structure & Functzon, vol 1 Nuclezc Aczds (Sarma, R H and Sarma, M H , eds.), Adenme, New York, pp 83-105 25 Pilch, D S , Kirolos, M A , Lm. X , Plum, G E , and Breslauer, K J (1995) Bereml [ 1,3-bls(4’-amidmophenyl)triazene] bmdmg to DNA duplexes and to a RNA duplex evidence for both mtercalative and mmor groove bmdmg properties Biochemzstry 34, 9962-9976. 26 Czarny, A., Boykm, D W , Wood, A. A, Nunn, C M., Needle, S , Zhao, M , and Wilson, W. D. (1995) Analysts of van der Waals and electrostatic contrtbuttons m the interactions of minor groove binding benzlmldazoles with DNA J Am Chem sot 117,471&4717 27 Fernandez-Saiz, M , Schneider, H -J , Sartorms, J , and Wilson, W D (1996) An azomacyclophane causes base flipping m RNA duplexes J Am Chem Sot 118, 4739-4745 28. Brabec, V., ReediJk, J , and Leng, M (1992) Sequence-dependent distortions mduced in DNA by monofunctional platmum(I1) binding. Blochemzstry 31, 12,39712,402. 29. Takahara, P. M , Rosenzweig, A. C., Frederick, C. A., and Ltppard, S J (1995)
Crystal structure of double-stranded DNA contammg the major adduct of the anticancer drug ctsplatm. Nature 377,649--652. 30 Crothers, D. M. (1971) Statisttcal thermodynamics of nucleic acid melting transitions with coupled bmdlng equillbrla
Bzopolymers
10,2 147-2 160
240
W//son et al.
3 1. MC Ghee, J. D. ( 1976) Theorettcal calculations of the hehx-coil transition of DNA m the presence of large, cooperatively bmdmg ligands Bzopolymer 15, 1345-l 375 32 Basu, H S and Mat-ton, L J (1987) The interaction of spermme and pentamines wtth DNA Blochem J 244,243-246 33 The World of Pharmacla Blotech ‘95 (and references therein) 34. Fasman, G. D (1975) Nucleic acids, m the Handbook of Bzochemlstry and Molecular Bzology, vol I (Fasman, G D , ed ), CRC, Cleveland, OH
16 Electric Dichroism Dietmar Porschke 1. Introduction Among the methods avallable for the analysis of structures of drug-DNA complexes m solution, the electrtc dtchrolsm 1s particularly simple, does not require much material, and provtdes information, which cannot be obtained as conveniently
by other methods
The prmctple
of the electric
dlchrolsm
IS
straightforward: electric field pulses are used to align DNA molecules in the direction of the electric field vector, the molecular alignment 1s analyzed by measurements of the absorbance of polarized light (cf. Fig. 1). One of the advantages of the method IS the fact that some important information may already be derived without using any complex theory. In addition, more detailed concluslons may be derived on the basis of appropriate theones, which have been developed up to a rather high degree of sophistication. Three different types of Information are available: 1. The direction and the magnitude of the absorbance change induced by the field pulses indicates the orientation of the light-absorbing chromophor with respect to the long axis of the DNA, 2 The time constant(s) of the molecular rotation process mdlcate(s) the hydrodynamic dimensions of the complex, 3. The electric parameters of the complexes are usually not a target of mvestigatlons on drug-DNA complexes and, thus, are not discussed in this contribution
Among the books (14) published on the method, the one of Fredericq and Houssler (I) 1sstill the most advisable one for an introduction, although the examples are not up to date. The molecular alignment by electric field pulses requires an electric amsotropy: In the case of DNA, a large dipole moment is induced along the long From
Methods
m Molecular Biology, Vol Edlted by K R Fox Humana
241
90 Drug-DNA Interaction Press Inc , Totowa NJ
Protocols
242
Porschke
+ I3t + 1 ‘, I I I I I 1 ,-\ ‘A \ \\I A
Fig 1. Schematic representation of the onentatron of rodhke molecules by an external electric field (A) In the absence of an external electric field the molecules are distributed randomly in all dnectrons of space, (B) partial orientation of molecules in the presence of an external electric field, (C) complete orientation in the limit of ntfimtely high electric field strength axis, leading to a high degree of orientation of the molecules with then long axes parallel to the field vector already at relatrvely low electric field strengths A second requirement is the existence of an optical anisotropy* in the case of DNA the absorbance of UV light is highly arnsotropic, because the bases are stacked perpendicular to the long axts of the molecules. Thus, the alignment of DNA molecules by electric field pulses can be easily followed by measurements of the absorbance of polarized light
2. Theory 2.1. The Dichroism
Amplitude
When DNA 1s aligned m the direction of the electrrc field, the absorbance of light, which is polarized parallel to the electric field, is decreased relative to the state, where the DNA is m the usual random spatial drstribution The change of the absorbance of light polarized parallel to the field vector A,4 111sa measure of the degree of orientation. The theory predicts that the change of the absorbance of light polarized perpendicular to the field vector dAl measured under the same conditions fulfills the relation. A‘4,,=-2
AAl
(1)
The relative change of the absorbance defined by: dAll-A& A
_ 15 dAll -AA --A
A
is the reduced electric dichroism, where A is the isotropic sured m the absence of an electric field.
(2)
absorbance mea-
243
Electric Dlchroism
The degree of molecular orientation and, thus, the magnitude of electric dichroism increases with the electric field strength E. Complete orientation in the direction of the electric field may be expected only m the limit of mfimtely htgh E The dependenceof A,4/Aon E is determined by the type and the magnitude of the electric dipole moment. The degree of orientation at a given field strength increases with the magnitude of the dipole moment. At low E-values the electric dichroism AA/A increases with E*. The complete dependence of AA/A on the field strength E IS described by the “orientation function” @ accordmg to* (AA/A) = 0 (AA/A), (3) where (AA/A), is the limit value of the electric dichroism at infinite field strength. In the case of induced dipoles, the orientation function is given by: (4)
where y = (aE2)l(2 kT), a is the polarizability, k the Boltzmann constant, and T the absolute temperature. In the case of permanent dipoles the orientation function is given by.
where p = ,up * EIkT and CL,IS the permanent dipole moment. The orientation functions may be used to determine the limit value of the electric dichrorsm, corresponding to complete molecular orientation, by least-squares fitting of dichroism values measuredat dtfferent field strengths.The limit value of the electric dichroism provides direct information about the orientation of the chromophors with respectto the dipole vector according to the following equation: &o A
= -3 +(3cos*((p) - 1) 2
where cpis the angle of the transition dipole moment of the chromophor relative to the dipole vector. When the chromophor is bound to the surface of the DNA, and its transrtion dipole moment is oriented parallel to the long axis (cf. Fig. 2), correspondmg to 50= 0, the limit value of the dichroism is +3. In the other limit case,where the chromophor is intercalated between the basepairs and the transrtron dipole moment ISm perpendicular directron to the long axes(q = 90), the limit value of the d&roism is -1.5 Thus, the limit value of the electric dichrotsm can be used to calculate the angle 50of the optical transitton dipole with respect to the direction of the electric dipole, which corresponds to the long axis m the case
Porschke
244
Fig 2 Schemattc SchematIc representation representation of two two cases cases of drug mteractions mteractions with with DNA DNA (A) (A) the drug is intercalated between the basepatrs with the transmon dtpole perpendicular to the long axis, m this case the dlchrolsm IS negative and the length of the double helix IS increased; (B) the drug 1sbound to the surface of the DNA with the transttton dipole moment parallel to the long axis of the DNA, m this case the drchrotsm 1s posmve and the length of the double helix remains unchanged
of DNA (cf. Fig. 3). Actually the first evidence for the tilt of the basepatrs in B-DNA double hehces, i.e., the devtatton of the basepan ortentation from 90” relative to the hehx axis, came from measurementsof the electrtc drchroism (5). When the electric dtchrotsm of drug-DNA complexes 1smeasured at wavelengths around 260 nm, where both the drug and the DNA contribute to the absorbance, the dlchrotsm
contams contributions
from both components.
Sepa-
ration of these contrrbuttons may be drfficult. However, most drugs absorb light at longer wavelengths than DNA. Thus, the electric dtchrorsm of the drugs may be measured selecttvely m the long wavelength range and may be used to determine the ortentatton of the drug in the complex.
2.2. The Dichroism Decay Time Constant When an electric field pulse IS termmated, the molecules, whtch have been aligned under the influence of the electric field, turn back to then random
245
Electric Dlchroism
2.5 I
(M/do1.5 1.0
0.5 0.0
Fig. 3 Limit value of the electrx dlchrolsm (AA/A), as a function of the angle rp between the direction of the electric dipole moment and the directlon of the optical transition dipole moment. accordmg to Eq. 6
drstrtbution by rotational dlffuslon. The process of rotational dtffuslon IS very strongly dependent on the molecular stze* the time required for the transitton from the aligned to the random state increases with the cube of the length of rtgrd rodltke molecules Thus, the dlchrorsm decay time constant, which reflects the rotational diffusion process, IS a very sensmve Indicator of the length. Short DNA molecules up to chain lengths of -100 bp behave like rigid rods. Rotational dtffuslon of these rigid rods IS mamly determined by the length e of the rod, whereas the width of the rod, described by the radius r, IS of marginal influence only, except for very short rods. The dlchrolsm decay time constant 02’ for such rods may be described by refs. 6 and 7. TZ’=
7LT-p 18 kT [in(q) - 0.662 + 0 917/q - 0 050/q*]
(7)
where q = C/(2r), k the Boltzmann constant, T the absolute temperature, and n0 IS the viscosity of the solvent. This equation may be used to calculate the length e of a rigid rodllke molecule from tts dichrotsm decay time constant.
246
Pm-schke Polarizer
Cell
Mono chromator
Detector
Transient recorder High Voltage Pulse Generator
-
Computer &
Fig 4 Schemattcrepresentationof the componentsrequired for measurementsof the electric drchrorsm (seetext). 3. Experimental Setup 3.1. General As shown in Fig. 4, measurements of the electric dtchroism require a device for the generation of electric field pulses and a spectrophotometrlcal detection system with a sufficiently htgh time resolution, together wrth a system for transient storage of data and for subsequent processing of these data The details of the equipment depend very much on the type of the mvesttgatrons. Measurements m the fast time range, correspondmg to T << 1 p-s, require more sophtsttcated and, thus, also more expensive equipment than measurementsm the range z 2 1 ps Becauseof the progress m electronics, the fast time domain IS now more easily accessible than previously. Usually small molecules require htgher electric field strengths for a sufficient degree of orlentatron than large molecules. Obviously, the dlfficultres and the expenses associated with the constructton of pulse generators for high electric field strengths increase with decreasing rise and decay times of the pulses to be generated. The followmg summary presents a brief descrtpnon of the standard equipment used m many different laboratories Unfortunately, a complete setup for measurements of the electric dichroism IS not commerctally available. However, the parts required for an instrument are available from various companies 3.2. Pulse Generator Most of the electric dichroism data described m the literature have been obtained by use of commercral pulse generators These devices generate pulses with amplitudes up to a few krlovolts; the rise and the decay times of the pulses are m the range around 20 us. Generators of this type are distributed by, e.g., Velonex, Santa Clara, CA
247
Electric Dichroism
Fig. 5. Cell for measurements of the electric dichroism: the cell body machined from Teflon holds electrodes from platinum and is inserted into a standard cuvet containing the solution.
3.3. The Measuring Cell A relatively simpleversionof a cell for measurements of the electricdichroism consistsof a standardcuvet with an insert machinedfrom syntheticmaterial,e.g., Teflon or Dynal, holdingplatinumelectrodes.A pictureof sucha cell shownin Fig. 5. 3.4. Spectrophotometric
Detection
Standard commercial spectrophotometersare not sufficient for measurements of the electric dichroism, becausetheir time resolution is usually limited to the range between s and ms. However, parts for the assemblyof a fast spectroscopic detection systemare available from various sources.For optimal signal-to-noise ratios, the light used for the measurementsshould be of high intensity. Light sourcesof high intensity arearc lamps,which are offered in many different variations. Monochromators,polarizers,and detectorheadsivith appropriate power suppliesare also offered in various forms by different companies.
248
Porschke
Because the electric dtchrotsm IS induced by field pulses m the ktlovolt range, whereas the absorbance changes after photoelectrrc conversron are usually m the mtlhvolt range, the detection system has to be protected efficiently against perturbations by mductton effects For this purpose the photomultrpller IS shielded in a cover made from u-metal, protecting mainly against magnettc perturbattons, and the multrpher head including the amplifier IS mounted m another cover made from metal, protectmg mainly against electric mductron effects. The connectton between the photomultiplier head and the transient data storage unit has to be shielded as well. 3.5. Transient Data Storage and Data processing Owmg to the progress m electromcs, transient dtgttal storage of expenmental data in the time range of mtcrosecondsand below ISnot a problem anymore The transrently stored experimental data can be easily transferred to PCs, which are sufficient for evaluatton of the data. Usually, the software required for the evaluation IS prepared mdtvtdually. (However, standard software for evaluatton of exponenttals may be obtained free from: StephenProvencher, Max Planck lnstrtut fur blophysrkahsche Chemre, Am Fassberg 11, D-37077 Gbttmgen, Germany.) 3.6. Automatic Data Acquisition Under many condrttons, the electric dichroism of DNA is large enough, such that single shots are suffictent for data analysis. However, it IS often useful to extend measurements to condrtrons of, e.g., low DNA concentratton or low electric field strengths, where an increase of the signal to noise ratio by averagmg of many transients 1sdesirable. For this purpose, automatrc acqutsmon of data IS very useful. An mstrument for automatic measurements of the electric dlchrotsm may be constructed relatively easily. Standard PCs are sufficient as control units for ttmmg of the field pulses, activating, and reading of the transient data storage and averagmg. For construction of an efficient automatic instrument, perturbations should be avoided by galvanic separation of the different units using optoelectronic couplmg as much as possible. Apphcatton of many field pulses of a gtven polarity will lead to electrophoretic motion toward one electrode and, thus, the polarrty of subsequent pulses should be changed. Another potential source of problems are photochemlcal reactions. These reactions may be avoided by usmg a shutter, which 1sopened only during recording of transients. 4. Experimental Procedures 4.1. Preparation of Samples The electric dtchrotsm IS usually measured at low salt concentrations in order to keep the electric conductrvrty of the samples as low as posstble. At low
Electric Dichroism conductivmes the temperature increase of the samples caused by Joule heating during the pulses remains low; furthermore, the decay of the field strength resulting from current flow IS also minimized; finally electric polarizabilmes of polyelectrolytes are usually maximal at low salt concentrations. In most casesthe requirement of low salt concentrations does not impose restrictions. DNA double helices, for example, are quite stable down to low salt concentrations. In most casesthe bmdmg of drugs to DNA is stabilized at low salt concentrations, because of an increase of electrostatic mteractions. Because the electric dichroism is very much dependent on the ionic strength, it is very important to do the experiments at a well-defined salt concentration. Of course, the pH of the solutions also must be well-defined Because of the high charge density of DNA, ions of different types are bound with high affinity The most effective procedure for removal of different ions, mcludmg other contaminations of low molecular weight, is dialysis. Because multivalent ions bmd very strongly to DNA, m particular at low salt concentration, removal of these ions like Mg2+ or Ca2+requires extensive dialysis agamst buffers containmg EDTA. It IS recommended either to exclude bivalent ions by dialysis and addition of a sufficient concentration of EDTA, or to add a well-defined concentration of bivalent ions, e.g., 100 @4 Mg2+ According to this procedure it is easily possible to get a sufficiently well-defined iomc miheu, which is important, becausesmall variable residual bivalent ion concentrationsmay strongly affect electro-optical results. Among the different buffers available, cacodylate proved to be useful (pH range 5 3-7.3), because of the small temperature dependence of its pK and because of the strong suppression of bacterial growth. 4.2. Measurements Some of the technical precautions to be used for unperturbed measurements have been mentioned already above and are not repeated here For any measurement of the electric dichroism, first the sample should be at a well-defined temperature. An accurate control of the temperature is essential for evaluation of the time constants: the viscosity of aqueous solutions is very much dependent on the temperature and, thus, comparison of data and any quantitative evaluation require strict control of the temperature. Usually, the electric field pulse is adjusted to a length, which is sufficient to drive the dichroism to its stationary level. Evaluation of data by any orientation function requires stationary values of the electric dichroism. It is useful to collect data over a broad range of electric field strengths, as broad as possible under the given experimental conditions, which are defined by the pulse generator and the signal-to-noise ratio Usually it is sufficient to determine the electric dichroism by measurements with light that is polarized parallel to the field vector. However, it is important
250
Porschke
to check whether the condltton defined by Eq. 1 IS satisfied. Thus, some transients should also be obtained with light polarized perpendicular to the field vector. Deviations from Eq. 1 may indicate either problems of the optical setup, e.g., strain m the windows of the measuring cell, or some field induced reaction, e.g., dlssoclatlon of a hgand or some change of the DNA structure. A further exammatlon IS possible by measurements at the “magic angle,” corresponding to an angle of 54.7” of the plane of polarized light with respect to the field vector (8). Under these condttlons dichroism effects should disappear and, thus, any remammg field induced changes of the light intensity should be caused by reaction effects The electric dlchrolsm may be characterized at any wavelength that may be convenient for the measurements. One of the crlterla for the selectlon of an appropriate wavelength IS the avallabillty of sufficient light intensity. The slgnal-to-noise ratlo increases with the square root of the light intensity. The hlghest light intensities are provided at the mercury lines of xenon/mercury high pressure arc lamps. Mercury emlsslon lines are at 248.2, 265 2, 280.4, 289.4, 302.2, 313.2, 334.2, 366.3, 404.7, 435.8, and 546 1 nm; thus useful lmes are available for most apphcatlons A second crlterlum IS the posltlon m the absorbance band. Usually (7c*t x)-transitions are polarized in the plane of aromatic chromophors, but there are also (x” c n)-transitions that are usually polarized m perpendicular direction to the aromatic plane. Thus, the wavelength used for measurements should be selected carefully. As usual the signal-to-noise ratio may be increased by averaging of transients. Because the signal-to-noise ratio value increases with the square root of the number of transients, an increase of signal-to-noise ratio by a factor of 5, for example, requires 25 transients In order to check for any potential damage of the solutions after a series of measurements, the first shot should be repeated at the end, and the results should be compared. Another useful control is a comparison of absorbance spectra before and after the measurements of the electric dichrolsm 4.3. Evaluation
of Data
4.3.1. Stationary Dchroism Measurements of the dichroism transients provide changes of an optical signal induced by application of an electric field pulse The difference AI between the optical signal approached during a pulse, which IS sufficiently long to drive this signal to its stationary level, and the optical signal before the pulse may be determined by some computer graphics procedure Another parameter required for the evaluation is the (absolute) level of the optical signal Z, before pulse apphcatlon Usually I, IS measured directly by some voltmeter, whereas AI IS
251
Electric Dlchroism
read from a digital recording with an unknown offset. Combination of these values, measured with light polarized parallel to the field vector, provides the absorbancechange
4 = -bK 1; + ~41Yd11
(8)
Using the isotropic absorbance A measured at the same wavelength, the electric dichroism is given by AA/A = (1 S. * AA$/A These values are determined at different electric field strengths E, where E is the voltage of the applied pulse divided by the electrode distance. 4.3 2. Transients Transients of the electric dichroism are evaluated m terms of exponentials: Z(t) = 2
(AZn + e+“n) + I,
(9)
where 1(t) IS the light intensity measured in mV or V at time t. n is the number of relaxation processes required to fit the data, I, is the light mtensity at time t = 00,AI” is the change of the light intensity associated with the nth relaxation process and T, the relaxation time constant associated with the nth relaxation process. The data I(t) = f(t) are subjected to a least squares fitting procedure for evaluation of the parameters AZ,,, z,, and Z,. The decision on the number of relaxation processes may be based on visual mspection of the quality of the tit(s), but also on the sum of squared residuals:
where I,,,(t) and I&j are the measured and the fitted values of the light mtensmes at different times t, respectively. Usually S decreasesfor fits with an increasing number of relaxation processesn. The decision on the number of “sigmficant” relaxation processes is usually simply operational: if S does not decrease significantly upon going from IZto n + 1, the number n is selected as significant. As often in science, a decision on significance requires some experience. Usually a decrease of S by 50% is significant, at least if it is reproducible. If the decrease of S is smaller, the available experimental data may not be sufficient to define an additional relaxation process at a sufficient accuracy and then fitting of the additional process does not make sense. The program “Discrete,” written and distributed by Provencher (cf. above), offers an automatic decision on the number of relaxation processes. Obviously, the most convenient systemsare those, where the dichroism decay can be represented by single exponentials. The observation of more than a
252
Porschke
single relaxation process may indicate a special, nonsymmetric shape, internal flexibility, or heterogeneity of the sample under mvestlgatlon The last posslblllty may be easily checked, e.g., by gel electrophoresls. A decision between the first two posslblhties IS usually more difficult. It should be mentioned that the theory predicts five exponentlals for the dlchrolsm decay of rigid particles without symmetry (9). However, usually most of these exponentials are associated wrth undetectably low amplitudes The number of clearly detectable processes obtained in many simulations m the author’s laboratory on rrgld macromolecules of very different shape did not exceed two. Evidence for the case of internal flexlblhty may be obtained from a dependence of the observed amplitudes on the electric field strength, because flexible molecules may be stretched under the influence of high electric field pulses. DNA double hehces are known to behave like rigid rods up to chain lengths m the range around 100 bp. The decay of the electric dlchrolsm of rlgld rods IS represented by single exponentlals The observation of single exponential decays of the electric dichrolsm for much longer DNA chams reported m the literature appears to be partly because of experimental condltlons (limited electric field strength) and partly because of a limited experimental accuracy. 4.3 3. Approximate Procedures Although a complete characterization of the parameters of a system under mvestlgation is always desirable, it often happens that this is rather difficult or even impossible for various reasons. Under such condltlons, approximate procedures may be very useful. For the case of drug-DNA complexes such an approximate procedure has been used by Colson et al. (20) for the determmatlon of the orientation of drugs relative to that of the DNA base pairs. Colson et al. (IO) did not determine the limit value of the electric dlchrolsm, which requires the characterization of the orientation function by measurements over a broad range of electric field strengths They restricted their measurements to a given electric field strength E, but measured at this E value the dichroism for the free DNA in the absorbance band of the bases (dA/A) DNA and for the DNA-drug complex m the absorbance band of the (*A/A) drug. They define a dichrolsm ratio: (11) which is a measure of the orientation of the drug relative to that of the DNA base pairs. This procedure implies that the orientation function at the given E value IS the same for the free DNA and for the DNA-drug complex, which IS reasonable according to Colson et al. (IO) at low degrees of drug bmdmg. For
253
Electric Dichroism 300
25
E :kV/cm]
Fig 6. Fteld induced change of the light mtensrty AZ transmitted by a solutron of a complex formed from a DNA fragment with 256 bp and ethldmm bromide as a funcnon of time t (continuous lme with noise), the trme dependence of the electric field strength E IS represented by the dashed Ime, the lrght at 3 13 nm was polarized parallel to the field vector; DNA concentratron 20 pM in units of nucleotide resrdues, ethrdium concentratron 2 CUM,buffer 1 mM NaCl, 1 mMNa-cacodylate, pH 7 0,200 pM EDTA, measurement at 20°C. the experrment was performed using a cable field Jump instrument with a pulse generator described by Grunhagen (12) and an optrcal detectron system assembled by the author
the case of intercalatton, the DR value IS close to 1, as demonstrated, e.g., for ethrdium
and proflavme,
whereas drugs bound to the outside of DNA
like
netropsin and distamycm show DR values in the range around -1. Colson et al. (ZO) have also demonstrated sequence.
that the type of binding
IS dependent on the DNA
5. Example An example of a dichrotsm experiment on a drug-DNA complex IS given m Fig. 6. The DNA double helix IS a restriction fragment with 256 bp and the drug is ethrdmm, which has the capactty to tntercalate between the base pans.
The light used for detectton, 3 13 nm, is m a range of wavelengths, where the absorbance of the solution 1s not caused by the DNA, but only because of ethidmm. A control expertment using the same solutton as described m the legend to Fig. 6, but without ethidtum,
does not show any electrtc drchrotsm at
254
Porschke
all. Another control experiment with the same solution as described in the legend to Fig. 6, but this time without DNA, also does not show any electric dichroism. Thus, the electric dichroism demonstrates binding of ethidmm to the DNA. If the electric dichroism is measured at different concentrations, it may also be used to determme the binding constant. During application of the electric field pulse, the DNA-ethidium complexes in the solution are aligned to a stationary state, which is characterized by a clear increase of the light transmission, correspondmg to a negative electric dichroism (cf. Eq. 8). For an interpretation of this observation, mformation derived from Independent experiments on DNA IS used: It is known that DNA double helices are aligned by electric field pulses with their helix axis parallel to the direction of the electric field. In addition, we use the fact that absorption of light m the main absorbance band of aromatic compounds like ethidmm IS polarized m the aromatic plane. In summary, this means that the aromatic planes of the ethtdmm molecules bound to the DNA must be oriented preferentially in perpendicular dn-ection to the axis. The stationary increase m the light mtensity AZ, Induced by the electric field pulse is 24 1 mV; using the light intensity before application of the field pulse, 8370 mV, according to Eq. 8 and 2, a stattonary value of the reduced electric dichrotsm of Xl.63 1 (using the isotropic absorbance 0 0293 of ethidium m the complex at 3 13 nm) is obtained. Such values have been measured for different electric field strengths, and the combined set of data has been subjected to least squares tittmg to the orientation function for permanent dipoles (Eq. 5) Accordmg to this fit (cf Fig. 7) the limit value of the electric dichroism is -1.2, correspondmg to an almost perpendicular orientation of ethidmm with respect to the helix axis Finally, the dichroism decay time constants of the complex may be used, m order to get more information about the structure of the complex. As shown in Fig. 8, two exponentials are required for a sattsfactory fit of the dichroism decay. The faster relaxation process with a time constant of 1.3 ps reflects bending of the DNA-ethidium complex and will not be discussed in the present context (for a detailed discussion of this type of process, see ref. II>. The slower processwith a time constant of 10 1 ps reflects overall rotational diffusion of the complex. A comparison with the correspondmg time constant of the free 256-bp DNA fragment. 7.36 ps, demonstrates that the contour length of the complex is clearly higher than that of the free DNA. Because both the free DNA and the DNAethidmm complex are flexible, interpretation of the relaxation time constants for overall rotational dtffusion requires a model with consideration of this flexibility. A general model for the flexibihty of polymer molecules hke DNA double helices is the wormhke chain (cf. textbooks on polymer chemis-
255
Electric Dichroism 0.0 -0.2WA -0.4-
-0.6-
-0.6-
-1.0 0
I’
10
I
20
‘I’,’
30
40
I
50
60
‘I
70
’
60
E [kV/cm] Fig. 7. Electric dichrolsm AA/A of an ethidium-DNA complex as a function of the electric field strength E; the experimental conditions are those described in the legend to Fig. 6, the line represents a least-squares fit of the data according to the orlentatlon function for permanent dipoles (Eq. 5; (AA/A)m = -1 2, p = 8.4 lo-*’ Cm) try). According to Monte Carlo simulations on wormhke chains (13), the rotational time constant of a wormlike chain T$‘~ may be calculated from the time constant 2:’ of the corresponding rigid rod (cf. Eq. 7) with the same contour length L according to. TX”= {[1.O12O-O24813(L/p)+O.O337O3(Llp)2-OOO19177(Llp)3]~ d’ [ 1 - 0,06469(Llp) + O.O1153(Llp)* - 0.0009893(L/p)3]}
(12)
wherep IS the persistence length, a measure of the flexibility, which 1sdependent on the nature of the polymer and also on the solvent conditions. Based on the time constant for the free 256-bp fragment, the persistencelength isp x800 bp in the low-salt buffer used m the experiment shown m Fig. 6. In a first approximation, the same persistence length for the DNA-ethidium complex 1s used and then an effective hydrodynamic length for the complex of ~300 bp 1s obtained. According to the molar ratio of ethidium to DNA helices of about 50 used in the experiment, almost all ethidmm molecules bound to the DNA double helix contribute to an increase of the length by an increment corresponding to that of a base pair. This 1s clear evidence for mtercalatlon of ethidium
molecules
into the DNA double helix.
Porschke
256
50 -
O0 0 12
10 20
1 40
20
,
60
80
30
I 100
t [PSI
1% -a 12 lf$ -a
0
t [PSI Fig. 8. Least-squares exponential fit of the drchroism decay shown m Fig. 6 by two exponentrals (rl = 1.3 ps, z2 = 10 1 ps AZ, = 153 mV, AZ2= 84 mV), the data are given m two drfferent time scales, denoted above and below the abscissa, the lme marked with circles 1s a reference curve, which represents the birefrmgence of the buffer (measured with the same adjustment of the electronics of the instrument as used for the measurement of the drchroism decay) and is used for deconvolutron (28, the resrduals ANof the fit are given below for the fast and the slow time scale separately
The analysis of the experrmental data may be driven mto more detail. For example, the degree of ethidmm bmdmg to the DNA should be considered. According to a bmdmg constant obtained for a similar buffer (15), =98% of the ethidium molecules are bound to the DNA. If the accuracy of all the experimental data 1ssufficrently high and all correctrons are taken mto account, rt is possible to determine the fraction of intercalatedethidwn molecules precisely, and also get the relatively small fraction of ethidium molecules attachedto the outside of the helix
Electric
Dchroism
257
6. Related Experimental Techniques 6.1. Electric Birefringence The electric birefrmgence (1-4) 1s very simrlar to the electrtc dichrotsm. The only difference 1sthe optical parameter used for detection of field-induced ortentatton. In the case of the brrefrmgence, orlentatton of the molecules IS detected by measurements of the amsotropy of the refraction, whereas the anisotropy of the absorbance is used m the case of the dichroism Measurements of the bnefringence can be very sensitive; some authors even conclude that the birefringence is more sensmve than the drchrorsm; obviously the sensitivity depends very much on the technical details of the mstrument used for the measurements and, thus, general statements are hardly justtfied. A clear advantage of the dichrolsm ISthe fact that its mterpretatlon m terms of molecular structure IS more simple and straightforward 6.2. Linear Dichroism Induced by Flow Velocity Gradients Macromolecules may be ahgned by flow velocity gradients and this altgnment may be studied by measurements of the linear dtchrolsm (16). Various forms of this technique have been used. An advantage of the method 1sthe fact that it may be used at any salt concentration. However, applications are restricted to relatively long polymers. Furthermore, the flow dlchrotsm cannot be used to get information about rotational diffusion m the time range below mrlhseconds. 6.3. Fluorescence Detected Dichroism Drugs containing an aromatic component often emit fluorescence, which may be used for a selective measurement of the dichrotsm (I 7). Various experimental procedures are possible. One of them is use of polarized light for excrtation, as usual m measurements of the dichrolsm, and detection of the dtchrotsm by collectton the fluorescence light under magic angle condtttons, i.e., behind polarizers orientated at an angle of 54.7” with respect to the field vector (28). Use of magic angle conditions stmplifies the evaluatton to the standard procedure, because under these conditions the measured fluorescence intensity is dependent on the molecular orientation only because of the angular dependence of the excitation process, whereas the light intensity resulting from emission itself is independent of the molecular ortentatton. References 1 Fredericq,E. andHoussrer,C (1973) Electric dichroismandelectrrcbirefrmgence. Clarendon, Oxford, UK 2. O’Konskl, C T (1976) Molecular Electrooptm Part I Theory and Methods Marcel Dekker, New York
258
Porschke
3. O’Konskt, C. T (1978) Molecular Electrooptlcs. Part II Appllcatlons to blopolymers Marcel Dekker, New York. 4 Stoylov, S P (1991) Collotd electrooptlcs. Academic, London. 5 Hogan, M , Dattagupta, N , and Crothers, D. M. (1978) Transient electric dmhrotsm of rod-like DNA molecules. Proc Null Acad Scz USA 75, 195-199 6 Ttrado, M M and Garcia de la Torre, J. (1980) Rotattonal dynamics of rigid, symmetrtc top macromolecules Application to circular cylinders. J Chem Phys 73, 1986-1993 7 Tnado, M. M. and Garcia de la Torre, J. (1984) Compartson of theories for the translational and rotational dtffusion coefticrents of rod-like macromolecules. Apphcation to short DNA fragments J Chem Phys 81,2047-2052 8. Porschke, D. (1996) Analysis of chemical and physical relaxatron processes of polyelectrolytes by electric field pulse methods a compartson of crtttcal comments with facts Ber Bunsenges Phys Chem 100,7 15-720. 9 Wegener W A , Dowben, R M., and Koester, V J (1979) Time-dependent btrefrmgence, lmear dichrotsm, and opttcal rotation resultmg from rigid-body rotational dlffuston J Chem Phys 70,622432 10. Colson, P., Badly. C , and Housster, C. (1996) Electrtc linear dlchrotsm as a new tool to study sequence preference m drug bmdmg to DNA Bzophys Chem 58, 125-140. 11 Porschke, D (1989) Electric dlchrorsm and bending amphtudes of DNA fragments accordmg to a simple ortentatton function for weakly bending rods Blopolymers 28, 1383-l 396 12 Grunhagen, H H (1974) Entwlcklung etner E-Feldsprung-Apparatur mlt optrscher Detektton und thre Anwendung auf dre Assoztatron amphlphtler Elektrolyte. Dtssertatton, Techmsche Umversttat Braunschwetg 13 Hagerman, P J (1981) Monte Carlo approach to the analysts of the rotational dtffuston of wormhke chains. Bzopolymers 20, 148 l-l 502. 14. Porschke, D. and Jung, M (1985) The conformation of single stranded ohgonucleottdes and of ohgonucleottde-ohgopepttde complexes from then rotation relaxation m the nanosecond time range J Bzomol Struct Dyn 6, 1173-l 184 15. Hogan, M , Dattagupta, N , and Crothers, D M (1979) Transtent electric dichrotsm studies of the structure of the DNA complex with Intercalated drugs. Bzochemistry 18,280-288. 16. Norden, B , Kubtsta, M , and Kurucsev, T (1992) Linear dmhrotsm spectroscopy of nucleic acids Quart Rev Bzophys 25,51-170 17 Rtdler, P. J. and Jennmgs, B. R. (1980) Polarized fluorescence studies of electrttally oriented DNA-dye soluttons. Znt J Bzol Macromol. 2,3 13-3 17. 18 Porschke, D. and Grell, E (1995) Electric parameters of Na+/K+-ATPase by measurements of the fluorescence-detected electrtc dtchrotsm. Bzochzm. Bzophys Acta 1231, 181-188
17 Calorimetric Techniques for Studying Drug-DNA Interactions Harry P. Hopkins, Jr. 1. Introduction Calorimetric techniques can be used to measure the heat effects accompanying a drug-DNA interaction (I-3); m prmciple, one can calculate from these measurements both (4) the affinity (AG) and enthalpy change (AH) for the process. There are, however, many sites on the DNA lattice for mteractrons and assigning AH values for each ISdependent on the model used m the mathematical analysis. What can be obtained m most casesfrom careful calorrmetrrc measurements ISthe AH for transferrmg a drug molecule from the aqueous environment to a site of high affinity on an unoccupred DNA lattice. Currently available calorimeters can be used at concentratrons approaching levels used m UV-visible studies (I-5). Combmatton of the calorimetrrc measurements with an analysrs of the correspondmg binding isotherm can provide both the enthalpy and entropy changes (AG = AH - TAS) for attaching a drug to a DNA lattice site (I-3,5).
1.1. Principles of AH Measurements and Instruments Heat effects associated with a process can be calculated by monitormg the temperature during the process and convertmg the temperature changes (AT) mto heats by multiplymg these by the known or measured heat capacity of the system (6). Very sensitive thermometers are available, and solutions volumes of 2 mL can be used in commercial instruments to measure heats to the nearest 0.1 meal (0.0001 cal) (61, but the concentratrons needed in these type calorrmeters can produce aggregation of both the drug and DNA. An alternative procedure with considerably more sensitrvity mvolves monitoring the heat flowing (45) into or out of the calorimeter cell. In a heat-flow calorimeter, small voltage changes induced by heat flowing across a set of From
Methods /n Molecular Bology, Vol 90 Drug-DNA /nteract/on Edlted by K R Fox Humana Press Inc , Totowa. NJ
259
frotocols
Hopkms thermocouples or thermopiles are mcreased dramatically with high-sensmvity voltage amplifiers and monitored dtrectly (5) during the reaction. An mstrument (5) usmg thermopiles in this manner and using stopped-flow mixing has been reported to have a resolution of 0.01 peal for heats as small as 1 peal. In a dtfferenttal calorimeter designed to keep a reference and sample cell at the same temperature, voltages produced by thermocouples or thermoptles connecting the reference and sample cells are applied to a feedback cncutt (4) providing power to the cells. Power is added automattcally to the sample cell tf the process is endothern-nc or to the reference cell if the process 1sexothernnc. With one of the commercial instruments that operates on the latter principle (4), heats as small as 10 peal can be measured to the nearest 0.5 peal. In prmciple, differential scanning calortmeters (DSC) can be used to assess heats associated with the melting of the DNA structure m the presence and absence of the drug (7) Subtractton of the former quantity from the latter produces the desired heat associated with the drug-DNA mteraction. Several comphcattons arise* endotherms for the bound and empty sttesmay be seen at low coverage, and the calculated AH is not for 25°C but for temperatures approachmg 90°C m many cases. Only a few of the commercial DSC instruments (47) have the requisite sensitivity needed to do the measurements. 7.2. Concentration and Affinity Limitations When the drug aggregates at the concentrations of the measurements, the observed heats are a sum of at least two terms (5.8): AHots= &mdmg + (aggregation fractron)AHdeagg In many cases, AHblndlng1s exothermtc (negative thermodynammally) and AH deagg,the enthalpy change for the productton of monomers from the aggregate, 1susually endothermtc. Problems associated with this phenomenon can be avoided by preforming the measurements at concentrattons at which the fraction of drug m the monomer state ts close to one. A complete analysts of the observed heats when aggregation happens requnes the eqmhbrmm constant for the aggregation process ($8). Most AH values for drug-DNA mteractions are m the 5 to -15 kcal/mol range. Assummg a value of -2 kcal/mol for a hypothetical drug-DNA interaction, 0.005 pmol of the drug must bmd to the DNA lattice to produce 10 peal of heat. Using a volume of 1.5 mL m the calorimeter cell, the minimum requtred concentration of sites would be 3.3 pM. Intercalation requires at least 2 bp per bmdmg site and groove bmdmg may require more, thus, the mmtmum concentration of basesm the calorimeter cell in this example would be 13.3 pil4 (6.6 PM m basepans). If posstble, the number of sites should be 50-200 times the number of drug molecules added at the beginning of the tttration. When the drug is
Calorimetric Techniques
261
added to the DNA solution m IO-yL volumes m a titration, then the concentration of the drug must be in the 1.O-mmol range. In a the heat-flow instrument described (5) m the literature with stopped-flow inlection, the DNA and drug solutions are mixed in a 1:1 volume ratio, and one can use drug concentrations that are only twice as large as the concentration of occupied DNA sites after mixing. However, the drug-to-basepair ratio is not easily changed m this instrument, and measuring the AH over a wide range of ratios requtres many individual experiments If the binding constant for the mteraction is lo6 or larger, then over 98% of the drug will be bound after the mitial addition. With smaller binding constants or very low concentrations, the fraction bound at each addition of drug must be calculated from known binding constants (see Note 4). The apparent AH, calculated from the heat for bmdmg, must be divided by the calculated fraction to give the correct AH for attachment of the drug to the site on the DNA lattice.
1.3. Heat-Pulse Analysis One commercial (4) instrument determmes the differential power (peal/s) needed to keep a reference and sample cell at the same temperature while very slowly increasing the temperature of both cells. The observed differential power values measured with such an mstrument are plotted vs time m Fig. 1 Data are shown for two injections of propidmm iodide mto a poly(dA) * poly(dT) solution at the beginning of a titration. When the solutton containing proprdmm iodide was injected mto the sample cell, the production of heat caused by the association of propidium iodide with the DNA duplex caused a series of deflections on the power axis (heat-pulse). When the rate of attachment of the drug to DNA is fast and efficient stirrmg is present, the shape of the pulse is determined by the electrical response of the calorimeter (approx 6 s in this case). The areasunder the pulses are the total heatsassociatedwith all processesin the calorimeter cell. These areas are determined by connecting the regions before and after the injection by a straight line, and performing an integration of the curves by a numerical procedure, which for the data shown produces heats of 38.1 peal. In the commercial instrument (see Subheading 2.1. for company address) used to produce the data shown m Fig. 1, programs automatically perform the tasksfor the investigator. Similar shapedheat pulses are observed in heat-flow calorimeters (5) without differential feedback. Both type of calorimeters must be calibrated routmely with known heats produced by electrical currents m resistors on the calorimeter cells and periodically with a chemical or physical process(seeNote 7).
1.4. Calorimetric Data and Analysis for AHbinding In a separate titration, the heats associatedwith the dilution of the drug in the sample cell with only the buffer present is determmed for a series of injections.
Hopkins
262 02
&!I
80-
8
00
0
0
00
78-
0
0 O
760
74-
0
72-
0
0
0
0
0 0 0
0
0
0
0 0 0 0
0
0 0 0 0
66 0
2
4
Time (min) Fig. 1 Power plotted vs time for two qections (2 5 pL each) of propldlum iodide poly(dT)(O.OOl M m dA) m PIPES buffer at (0.0024 M) mto 1 43 mL of poly(dA) pH = 7.0 and 300 IS with [NaCI] = 0 015 A4 The areas under the two pulses are 38 1 peal and are for endothermic heats If these heats are small relative to the heats observed when DNA is present, one assumesthat the average of these values 1sthe best estimate for the heat of dilution correction. When better estimates of the heats of drug-DNA mteraction are required, the aggregation constants must be determined and used in the analysis for the heat of dllutton correction ($8). The observed heats (I-5,8) minus the dilution heats are converted to the apparent AH of binding values by dividing these heat values by the number of moles of drug delivered in the injections. When the binding constant IS available or can be estimated from literature values, the apparent AH values can be converted to the thermodynamic parameter for attaching a drug molecule to the DNA latttce at this point m the titration. The apparent AH values can be plotted vs the mole ratio of drug to DNA base pair, as IS shown in Fig. 2 for the titration (9) of propidmm iodide mto poly(dAdT) at low [NaCI] at 308 K. From a mole ratio of 0.002 all the way to 0.15, the AH IS nearly constant at -7.5 kcal/mol of propldium added. Between 0.15 and 0.25, the AH rapidly approaches -1 kcal/mol and remams near this value out to a ratio of 0.4. This plot IS in accord with there being one highaffinity site on the DNA lattice, which is saturated after a mole ratio of 0.3.
6
Calorimetric Techniques
263
. .
m
.
.
003
004
.
. 0 -2 -4
. .rn 1 00
-6 .5-
m
n
8
.
I 000
.1(1m 001
9 002
005
I
I
I
1
01
02
03
04
Ratio
(mol Propidium
lodidelmol
dA)
Fig 2 Plot of the apparent AH for binding of propidium dication to poly(dAdT) in PIPES buffer at pH = 7.0 and 308 K with [NaCl] = 0 015 M The Insert IS a plot for ratios below 0.05 and 1s used to determine the intersection of the curve at zero ratio, I.e., the AH for attachment of the drug to the unperturbed DNA lattice
Assuming this site to be intercalatton, the apparent AH value for the mtercalation of a propidium dication into the unperturbed lattice IS easily evaluated from the mtersectton of the curve with the y-axis near zero ratio (see the insert). At 16°C lower (292 K) proprdium iodide titrated (9) into poly(dAdT) at low [NaCl] (Fig. 3) produces a AH vs mole ratio curve that is similar in shape at the beginning and end to the curve shown in Fig. 2. However, between 0.04 and 0.20 mol ratio, the AH becomes dramatically more negative before sharply rising to near zero at 0.25 mol ratro. This unexpected shape observed in similar experiments (3,9) may be because of interactions between occupied sites or a distribution between different type sttes. Nevertheless, rt is seen that all the high-affinity sites are nearly saturated, and that the AH can be calculated for attachment of the drug to a single site on the unperturbed DNA lattice (see insert at left of Fig. 3). The two plots shown in Figs. 2 and 3 for the tttratton of proptdium iodide into poly(dAdT) also illustrate the dramatic variations that can be observed by varying the temperature by only 15OC.Apparently, the AH for attachment of propidium iodide to this particular DNA lattice IS very dependent on temperature and the AC,, for the process is large.
264
n 8
8
%.
.
-6-
. I
= d
.
.
-
88
88
-6 -
1 01
00
I 02
Ratio (mol Propidium
1 03
lodidelmol
t
t
dA)
Fig. 3 Plot of the apparent AH for bmdmg of proptdtum dicatton to poly(dAdT) in PIPES buffer at pH = 7 0 and 292 K with [NaCl] = 0 0 15 M The Insert left 1sa plot for ratios below 0 05 and is used to determme the mtersectton of the curve at zero ratio, I e , the AH for attachment of the drug to the unperturbed DNA latttce
2. Materials 2.1. Calorimetric Apparatus Only the recently developed calorimeters (4,s) with microcalorie or better resolution and small total volumes can be used effectively m drug-DNA studies. Several manufacturers
have offered calorimeters
that can perform heat measure-
ments at the low levels needed for evaluating AH for drug-DNA interactions. A titration
Instrument,
such as the one produced by Mtcrocal (Northampton,
MA),
can perform (see Fig. 1) many injections mto a DNA solution to quickly produce the entire tttratton curve. Breslauer and coworkers (10) used a Mtcrocal, mstrument m their recently reported studies on bereml binding to DNA and RNA du-
plexes, instead of the stopped-flow mstrument used by Breslauer and coworkers (5) m earlier studies. The stopped-flow instrument (5) can perform multiple mjections at a fixed drug-to-DNA
ratio with a total volume after mixing
nearly 200
pL. The volume of drug and DNA solutions needed in this instrument to fill the syringe and lines connecting
the mixing
chamber is much larger.
2.2. Buffers and Salts All buffers and salts should be analytical grade, and any of the buffers (e.g., PIPES) that do not interact appreciably with metal ions can be used (see Note 1).
Calorimetric Techniques
265
The preferred buffer for these thermodynamtc studies is cacodylate (10 mM, pH 6.8) which may mhtbtt microorganisms from growing m the calorimeter. Heat effects from mtcroorgamsm in the soluttons or on the walls of the calortmeter cells can cause very erratic baselmes (see Note 2). All soluttons should be prepared with water that has been treated to remove organic matter, and which has been degassed (see Note 3). 2.3. DNA and Drug Characterization As with all thermodynamtc studtes, it is extremely important to work with well-characterized systemsbecause all heat effects will be observed m the calorimeter. For some studies, a random sequence DNA such as calf thymus DNA can be used, but the AH calculated from the heat effects is the average for all possible basepair sequences for a binding site. Most studies today are being performed with specific polymers, e.g., poly(dAdT), and some studies are possible with ohgomers. Complimentary strands that form duplexes have the advantage that dissolving these m a buffer with the appropriate salt concentration produces primartly duplexes. Any change m DNA structures durmg the calorimetrtc titration may produce heat effects that cannot be easily separated from the drug-DNA interaction heats. 3. Methods
3.1. Preparation of Samples In order for one to do calorimetric studies successfully on drug-DNA mteracttons, the composition of the buffer-salt solution containing the DNA must be exactly the same as the solutton contammg the drug. One way to do this is the classical method of dtalysts of the DNA solution against the buffer-salt solution used m the experiments. There are several disadvantages to this procedure: Small volumes are involved, making it difficult to perform the dialysis without losing some solutton; the DNA samples can stick to the dialyses materials and oligomers will pass through most dialysis membranes. A much easier procedure involves a lyophihzation of both the DNA and drug sample before dtssolvmg these samplesm the buffer-salt solutton employed in the calorimeter. If the DNA sample has been purchased as a solid salt material, thts can be dissolved m water to form a stock solutton. A stock solutton for the drug can also be prepared m pure water (see Subheading 1.2. for estimating the required drug and DNA concentrattons). Determine the concentratton of each of the stock solutions and calculate how many microliters of each is neededto prepare the calortmetric solutions (see Note 6). Transfer each solutton mto a vial of suffictent volume to hold the final solution. Place these vials mto a tube that can be attached to a vacuum system, attach the tube to the vacuum system, freeze the soluttons wtth hqutd nitrogen,
266
Hopkins
and evacuate. After all water has been removed, add the required amount of buffer/salt solution to each vial. Wtth this procedure, the two solutions that are to be mixed m the calortmeter have the same buffer and salt composition, and any heat effects associated wtth changes m salt concentrattons will be mmtmum. This 1sextremely tmportant because the heats accompanying changes m salt, DNA, buffer, and drug concentrations can be large relative to the heats for the drug-DNA mteractions (see Note 7). If the concentrations of all these components are low, the effects are mmimal. When the [NaCl] or concentration of other salts are above 0.1 A4, small changes m the concentration can produce peal levels of heat (see Note 4) 3.2. Calorimeter Operation All calorimeters are dehcate mstruments, so be prepared to allocate some space for it where there is little passage of people, minimal airflow, and small temperature variations. Allow the calorimeter to be operational for several days before starting a study with a valuable sample. Measure tts heat capacity many times durmg this period; this will probably be called a calibration procedure by the manufacturer. Also remember that a stable baselme IS required and, if the baseline is not stable for a long period before startmg, the titration will probably fail to produce acceptable data (see Note 3). 3.3. Heats of Dilution for the Drug Before attempting a titration of the drug mto the DNA sample, determine the heat of dilution associated with the change in concentration accompanying the injection of the drug into the DNA solution Place the drug solutton mto the syringe used to inject rt mto the sample solution, load the sample compartment with a solutton contammg only the buffer-salt solution, watt unttl the baseline is level, and inject a volume of the drug solution mto the sample cell. In some casesheat will be below the detection hmits of the mstrument, and one will not observe a heat pulse for the mjection. If a flow system is bemg used, also determme the heat of dtlutton for the DNA solution because the DNA system is also being diluted by a factor of one-half. 3.4. Calorimetric Reaction Place the DNA and drug solutions prepared as described m Subheading 3.1. m the sample and reference compartments (see Note 5) At least two of the commercial calorimeters have stirrers m the sample cells and these must be activated properly. Normally one should wait approx 1 h for the calorimeter to come to a steady state and the baselme to stabilize. If a computer is mcorporated mto the measurement circuit, a numerical value can be used to decide when the instrument is ready for the titration to begin. Make a small injection
Calorimetric
Techniques
267
to ensure that the calorimeter is functioning and that mixing at the end of the syringe has not caused changes in concentrations. Now start the injection of the desired volume, or for the stopped-flow instrument a series of mixing events. If sufficiently large heats are observed, continue the procedure. In order to mcrease the relative preciston when the AH values are low in magnitude, the size of the injection volume must be increased or the concentrations must be increased accordingly. 4. Notes 1 The chelation agent EDTA is added to the buffer solutions at 0 1 mA4 m order to bmd divalent cations that might affect the DNA lattice structures 2 If any microorgamsms enter the calorimeter cells, these can produce heat effects that vary with time. When this happens the baseline on the instrument will not be stable. A thorough cleanmg of the cells with a commercial detergent must be performed to remove all living matter m the solutions in the cell and possibly on the walls Using a buffer made from cacodyhc acid can mmimize this problem, but it is toxic and must be used with caution. 3 Tmy an bubbles m the calorimeter cell ~111cause the baseline to fluctuate and all solutions should be routinely degassed with a small vacuum desiccator before bemg placed m the syringes and cells of the calorimeter If an an bubble is present in a syringe, then an erroneous heat will be observed sometime during the experiment 4 At high [NaCl] the bmdmg constants for the drug-DNA mteractions decrease dramatically (3) compared to the [NaCl] = 0 015 used m experiments used to construct Figs. 2 and 3; thus, a substantial fraction of the drug molecules added may not bmd to a DNA site 5 Recent experience (1,3,9) with ethidmm and propidmm binding studies m the calorimeter have demonstrated that the observed AH for drug-DNA interactions can depend on the salt concentration, DNA concentration, and temperature Making measurements at only one set of conditions may provide misleadmg information 6. If the drug IS not sufficiently soluble in water to perform the studies, then ethanol can be added to increase the solubility Up to 20 mass percent ethanol m an aqueous solution did not effect the AH for dissociation of poly(dA) * poly(dT) and poly(dAdT), but did lower the meltmg temperatures (11) for these duplexes 7. Protonation of the hydroxide ion (6) (addition of a small quantity of HCl into excess NaOH) or the standard base THAM (1) (addition of a small quantity of HCl into excess THAM that is 50% protonated) has been used because both reactions have large eqmhbrmm constants and substantially negative AH values Careful preparation of the solutions are required when using either of the aforementioned processes for producing a known heat m the calorimeter cell A simpler procedure involves dilution (5,lU) of a solution of NaCl, sucrose, or HCl m the calorimeter
268
Hopkins
References 1 Hopkins, H P , Jr, Fumero, J , and Wilson, W D (1990) Temperature dependence of enthalpy changes for ethldtum and propldmm bmdmg to DNA: Effect of alkylamme chains Btopolymers 29,449-459 2 Hopkms, H P , Jr., Mmg, Y , Wilson, W D , and Boykm, D W (1991) Intercalation binding of 6-substituted naphthothlopheneamldes to DNA* enthalpy and entropy components. Bzopolymers 31, 115&l 114 3 Marky, L. A and Macgregor, R B (1990) Hydration of dA*dT polymers role of water m the thermodynamics @f ethldmm and propldmm mtercalatlon Bzochemlstry 29,4805-48 1 1 4 Wiseman, T , Brandts, J F , dllhston, S , and Lm, L N (1989) Rapid measurement of binding constants and heats of bindmg using a new tltratlon calorimeter Anal Biochem 179, 13 1-137 5 Remeta, D P., Mudd, C P , Berger, R L , and Breslauer, K J (199 1) Thermodynamic characterization of daunomycin-DNA interactions mlcrocalorlmetrlc measurements of daunomycm-DNA bmdmg enthalples. Bzochemwtry 30,9799-9807 6 Vlckers, L P , Hopkins, H P., Jr., Ah, S Z , and Carey, V (1984) Error analysis m titration mlcrocalonmetry of biochemical systems Anal Blochem 145,257-265. 7 Marky, L A , Blumenfeld, K S , and Breslauer. K J (1983) Calorlmetrlc and spectroscoptc mvestlgatlon of drug-DNA mteractlons I Bmdmg of netropsm to poly d(AT). Nucleic Acrd,v Res 11,2857-2870 8 Hopkins, H P , Jr , Stevenson, K. A., and Wilson, W D. (1986) Enthalpy and entropy changes for the intercalation of small molecules to DNA. I. Substituted naphthalene monolmldes and naphthalene dlimldes J Sol Chem 15, 563-579 9 Morgan, W B and Hopkins, H P , Jr (1995) Calorimetric studies on the mteractlon of ethldmm and propldmm with duplex and triple helix structures formed with poly(dA), poly(dT) and poly(dAdT) Unpublished data from M S Thesis at Georgia State University 10 Pllch, D S , Klrolos, M. A. Llu, X Plum, G E , and Breslauer, K J (1995) Bereml [ 1 3-Bis(4’-amldmophenyll)tnazene] binding to DNA duplexes and to a RNA duplex evidence for both mtercalatlve and minor groove bmdmg properties. Blochemlstry 34,9962-9976 11 Hopkins, H P , Jr, Hamilton, D D , Wilson, W D , Campbell, J , and Fumero, J (1993) Effect of C2HSOH, Na+(aq), N(CH$H#(aq) and Mg2+(aq) on the thermodynamics of double-helix-to-random-coil transitions ofpoly(dA)*poly(dT) and poly(dAdT) J Chem Therm 25, 111-126
Methods for the Studies of Drug Dissociation from DNA Fu-Ming Chen 1. Introduction In addition to bmdmg affinity, the on and off rates of drug-DNA mteractions are important in determining the biological activities of a drug For example, the rate of dissociation of a drug from DNA has been shown to be related to its pharmacological activities (1). Various techniques have been employed to study the dissociation kinetics of drugs from DNA. These include detergent sequestration technique pioneered by Muller and Crothers (I), a modification of the footprinting technique for examming the dissoclatlon of ligands from mdlvldual binding sites (2), relaxation methods such as T-Jump for measuring fast kinetics (3), and a procedure that can yield drug-DNA dissociation kinetics under conditions of active transcrlptlon of the DNA (4). The simplest and most widely used method IS detergent-induced dissociation rate measurement incorporating the detergent sodium dodecyl sulfate (SDS). This chapter will thus focus on the SDS-sequestration technique and include only conventional spectrophotometric and stopped-flow methods. An example of an actinomycin D dissociation measurement from the author’s laboratory will be used to illustrate the methodology 2. Materials 1 Appropriate buffer for the system of interest For example, a buffer of pH 2X 0 that contains (l-10 mM) Mg*+ wdl be reqmred for the studies of chromomycm A, and mithramycm. 2. A 20% SDS solution can be prepared by dlssolvmg 20 g SDS m 80 mL of buffer solutlon (see Note 7). From
Methods
m Molecular
Edlted
by
Bfology,
K R Fox
Vol 90 Drug-DNA
Humana
269
Press
Interact/on
Inc , Totowa.
NJ
Protocols
Chen
270 3. Method 3.1. Non-Stopped-Flow
Technique
A drug-DNA solutton mtxture IS either obtained as an end product of the association kmettc measurement or prepared by mrxmg together appropriate amounts of drug and DNA solutions The solutton mrxture IS usually allowed to reach equtlibrmm The waiting time depends on the rate of assoctatron. A time period of 25 x z, (the characterlstrc assocratton time) should be sufficrent (see Note 4) Record the mmal value A,, where A represents any measurable physical properties such as absorbance, fluorescence, or elhptrcrty at the wavelength of Interest (see Note 3) The dtssoctatton of the drug IS imtiated by the addition of an appropriate volume of 20% SDS to the DNA&ug mrxture to result in a 1% final SDS concentratron (see Note 5) The solutron 1sthen thoroughly mrxed by either rtgorous manual shaking or mechamcal stnrmg (see Notes 1 and 2). Data collectron should commence as soon as rt IS feasible, via computer or chart recorder. The run IS terminated when reasonable A, can be estimated, usually with t > 2-3 rd (charactertsttc dtssociatton time).
3.2. Stopped-Flow
Technique
1 Prepare a 2% SDS solution vta a lo-fold dilution from the 20% stock. 2. F111the two reservoir syringes with the drug-DNA and 2% SDS solutions, respectively 3 Carefully fill the driving syringes (see Note 8) and wait until the temperature reaches eqmlibrmm (see Note 6) 4. Actuate the plungers via pressured gas and commence the data collection 5. The run 1s terminated when the decay curve shows sign of leveling
3.3. Data Analysis 3 3.1. Manual Graphical Method (see Fig. 1) 1 A, at the monitoring wavelength 1sfirst estimated or obtained experimentally by wattmg until there 1sno longer any change m the value of A 2 Values of L4 E IA, - AmI are then calculated and plotted vs time on a semtlogrithmic graph paper, where A, 1sthe value of A at time t. 3. A reasonable value of A, will yield a straight lme plot for a single-exponenttal rate process and the rate constant 1sthen obtained by -2 303 x (slope) Extrapolation to t = 0 will yield A,4,, the total measurable change of A as a result of this process 4 The percentage contrtbutton of this process can then be obtained by the followmg formula. 100 x A& / 1A, - A,(dtlution corrected)1 5. For a multiexponential process, a curved plot with a straight line portion at the longtime data region will result. The slowest rate constant k( 1) and the measur-
271
Drug Dissociation from DNA
a
-24
d, $ A
-2 6
0.3
0
5
10
15
20
25
TIME (set)
Fig 1 An example tllustratmg how kinetic parameters can be extracted via graphtcal method for a multtexponenttal kinetic profile 1 Estimate a reasonable A, 2 Calculate AA = IA --&I 3 Plot A.4 vs t on a semtlogrtthmtc graph paper (Note: The vertical scale 1s a lmear scale of log A.4 and not the logrtthmtc scale of a semtlog graph paper ) 4 Repeat steps l-3 untd a linear plot IS obtained for the long-ttme region (s) 5 A best stratght lme 1s drawn through these long-time data points and extended to t = 0 (connected line) to obtam k and aA, for this process 6 AA value correspondmg to each experimental time point IS read directly from the stratght lme and subtracted from the experimental value to obtain new AA 7 These new AA values are replotted on the semilog paper (open squares) 8 Repeat steps 5-7 with this new data set 9. The process 1s contmued until the new plot IS a straight lme without the presence of a curvature at the short-time region able total change associated with this process AI!,, are then obtamed from the slope of the straight lme and its intercept at zero time, respectrvely The values of the straight lme at each time-point are read dtrectly from the graph and then subtracted point-by-point from the ortgmal A,4 These new values are then replotted to obtain k(2) and AA,, and the process continues unttl the last straight line plot IS obtained
3.3.2. Nonlinear Least-Squares
Curve Fit (see Figs. 2 and 3)
1 The kmettc data can be fitted dnectly with any commerctally available nonlmear least-squares program The equations to be used are AA = aA,e-kt + B for a smgleexponenttal and AA = AA,,e- k(l)t + M02e-k(2)t + B for a double-exponenttal process, and so forth
272
Chen
00425
, I
d TIME
(WC)
Fig 2 (A) Compartson of experimental data and a smgle-exponential fit (B) The corresponding residual plot It is apparent that the kmettcs cannot be adequately described by a single exponential process 2 The kmettc parameters k’s and A&‘s are obtamed directly from the fit 3 The goodness of the fit can be appraised by visual comparison of the experimental data with the fitted curve, the value of sum of square deviation, or the restdual plot 4. Since a higher order exponential mode1 will m general result m a better fit because of the larger number of parameters, use of a higher order mode1 may not be warranted unless significant improvement, such as several-fold reduction m the sum of square deviation, IS obtained
Drug Dlssoclatlon from DNA
0 002
d 9 YE %
273
L
B
0 000
K
I
-0 yj. 50
TIME (set)
Ftg. 3. (A) Comparison of expertmental data and a two-exponenttal nonlinear leastsquares fit The extracted parameters are k( 1) = 0.038 1 + 0.00 16 ss’, A,4,, = 0 0064 1 f 0.00005; k(2) = 0.444 iT 0 015 s-1, Aid02 = 0.00548 * 0.00009. (B) The correspondmg residual plot 5 Judgmg the goodness of fit IS best done by restdual plot, since the vtsual comparison of the experrmental data and the fitted curve can sometrmes gave an erroneous Impressron of a good fit
3.3.3. Global Analysis If a serves of spectra can be measured during a kinetic run, kinetic profiles at different
wavelengths
can be obtained
and analyzed after the experiment
274
Chen
Furthermore, global analysis using the data at every wavelength can be performed which can sometimes help eliminate or suggest certain mechanistic models.
4. Notes 1 A gentle mversion of the cuvet after rigorous manual shaking may help mmtmize the numbers of tmy au bubbles sticking on the cell walls 2 The use of a mechanical stirrer is preferable as it shortens the dead time, mmimizes the bubble generation, and assures contmuous uniform mixing during the course of a kinetic run 3 Absorbance momtormg should preferably be at the wavelength that corresponds to the isosbestic point of free and SDS-sequestered drug spectra so that the measured intensity changes reflect the drug dtssocration from DNA more accurately This can be determined via spectral titrations of drng-vs-stock SDS solutions 4 Smce reaction kinetics are temperature sensitive, maintaining a constant temperature during the run is essential. 5. Although the 1% SDS strength is usually sufficient for most purposes, it may be a good idea to experimentally confirm it for a particular system of interest 6 Measurements should not be made below 15°C as SDS forms precipitates near or below this temperature 7. SDS powders are extremely fine and can easily get mto the nasal passages to cause irritation Thus, SDS should be handled very gently during weighing and the use of a nose-mask is strongly recommended 8 Careful and slow tillmg of the driving syringes can help minimize the bubble formation in the stopped-flow experiment.
References 1 Muller, W. and Crothers, D. M. (1968) Studies of the Binding of Actmomycm and Related Compounds to DNA. J MOE Bzol 35,25 l-290. 2. Fletcher, M. C and Fox, K. R. (1993) Visuahsmg the Kinetics of Dissociation of Actmomycm from Individual Sites m Mixed Sequence DNA by Dnase I Footprmtmg Nuclezc Aczds Res 21, 1339-1344 3 Chaires, J. B , Dattagupta, N , and Crothers, D. M (1985) Kinetics of the Daunomycm-DNA Interaction. Bzochemzstry 24,26&267. 4. Phillips, D R and Crothers, D. M (1986) Kmetics and Sequence Specificity of Drug-DNA Interactions An in Vitro Transcription Assay Bzochemzstry 25,73557362.