Peptide Recognition Mechanisms of Eukaryotic Signaling Modules Chi-Hon Lee, David Cowburn,
and John Kuriyan
1. Introduction The formation of specific protem-protein interactions is one of the key mechanisms for signal transduction mediated by tyrosme phosphorylation. These intermolecular mteracttons target signaling proteins to particular cellular locations and modulate the enzymatic activities that further propagate the signal. A dtstmctive characteristic of the pathways that are mitiated by tyrosme phosphorylation is that target recognition and catalytic activity are usually functions of separate domains within the signaling molecules that participate m these pathways. Each of the signalmg molecules contains one or more of a set of modular peptide-bmdmg domains that are responsible for generating protein-protein interactions. Such peptide-recognition domains are modular in both structural and functtonal respects: They are capable of folding correctly when removed from the parent protein, and they can usually recognize their targets even when isolated. The first peptide-recognition modules to be identified were the Src homology 2 and 3 domains (SH2 and SH3 domains), so named because they share sequence similarity with two separate noncatalytic regions of the Src family tyrosme kmases (1,2). SH2 and SH3 domains are now well-known for their crittcal roles m eukaryotic signal transduction, and they function by recogmzing sites that contam phosphotyrosyl residues (for SH2) and prolme-rich sequences (for SH3) (reviewed in refs. 3-5). Several other peptide-bmdmg domains have been discovered recently, and the determinatton of their three-dimensional structures have provided some surprtses. The phosphotyrosme bindmg/phosphotyrosine interaction (PTB/PI) From
Methods
m Molecular Edlted
by
Bfology, Vol 84 D Bar-Sag1 0 Humana
3
Transmembrane Press
Slgnahng
Inc , Totowa,
NJ
Protocols
4
Lee, Cowburn, and Kuriyan
domain bmds to phosphopeptides containmg NPXY* motifs (Y*, phosphotyrosme) (6,7). The architecture and mode of peptide recogmtton of the PTB domains is unrelated to that of the SH2 domains, although both recognize phosphotyrosme. Most strikmgly, the architecture and topology of the PTB domams resemble closely that of another signalmg module, the plekstrin homology (PH) domain, although there IS no sequence similartty between these domams (8-10). Furthermore, the newly discovered PDZ domains, which recognize non-phosphorylated peptide sequences at the carboxyl-termmus of ronchannel proteins, have a core topology and peptide-binding mechanism with elements m common with the PTB domams (II). The WW domains, whose structure has been determined recently, represent an alternative mode of recognizing prolme-containing motifs when compared to the well-known SH3 domains (12) Again, the SH3 and WW domains are unrelated m sequence or structure. In this chapter, we focus on the structural aspects of these peptide-bmdmg domains, with emphasis on the sequence-specific recogmtton of targets. Much of the discussion is focused on the SH2 and SH3 domains, because more is known about them. The PTB and PDZ domains are discussed briefly m the context of their structural resemblance to PH domains. Newly characterized domams, such as the WW domam and the 14-3-3 protein, are not discussed. 2. SH2 Domains The SH2 domain was first recognized as a phosphotyrosme-binding module during studies of the mechanisms of viral oncogenes that interfere with cellular signaling (1,13,14). Subsequent experiments demonstrated that an individual SH2 domain binds to specific regions of tyrosme-phosphorylated proteins, such as particular sequences m the cytoplasmic regions of activated receptor tyrosme kinases (reviewed m ref. 15). The first three-dimensional structures of SH2 domains confirmed that the module corresponds to a well-folded domain with a defined peptide-binding surface (16-18). In addition, the crystal structure of the Src tyrosme kmase SH2 domain complexed with low-affinity phosphotyrosyl peptides revealed the mechamsm of phosphotyrosme recogmtion that has subsequently been found to be conserved in general terms among all SH2 domains of known structure (18). Compartsons of SH2-target sequences m tyrosme-phosphorylated proteins such as platelet-derived growth-factor (PDGF) receptor and the polyoma-virus middle-T antigen indicated that residues immediately surrounding the phosphotyrosme determme the binding specificity of SH2 domains (19-22). However, a general picture of SH2-target specificity did not emerge until an exhaustive investigation was carried out using a peptide library approach
Peptide Recognition Mechamsms
5
(23,24). This established that the three residues immediately C-terminal to the phosphotyrosme are the key determinants of specificity. The determination of the structures of high-affinity peptide complexes of Src and the closely related Lck-SH2 domains provided the fu-st view of sequence-specific peptide recogrutron (25,26) By combmmg the structural information with selecttvity data from the pepttde-library study, the sequence preference can be correlated with particular residues in the SH2 domain (23,27). Subsequently, the structures of peptrde complexes of the SH2 domams of the tyrosme phosphatase SH-PTP2 (28), phospholipase C-~(29) and the adapter protems GRB2 (30) and She (31) have further clarified the mechanism of peptide recognition and have extended our understanding of SH2 specificity. An additional level of complextty was added when the brochemtcal and structural analysts extended toward larger components of signaling molecules, containing more than one domain. Structures of the adapter-protein GRB2 (32) and the regulatory unit of Abl tyrosme kinase (33) have provided insights into spatial arrangements of multiple domains. Furthermore, structural analysis of multi-domain constructs of ZAP-70 (34), Lck tyrosine kmase (35), and the tyrosine phosphatase SH-PTP2 (36) revealed the cooperatrve recogmtton of peptides by larger-signaling molecules of which these domains are component parts.
2.1. General Architecture The SH2 domain is a compact a-@-structure comprised of around 100 residues (see Fig. 1 for a sequence alignment). The central scaffold is an antiparallel P-sheet formed by strands A, B, C, D, and G. Two a-helices, aA and aB, flank the central P-sheet (see Fig. 2 for a schematic diagram and the notation used). This P-sheet runs perpendicular to the peptide-binding surface, and divides the domain mto two functronally distinct regions. One region, comprrsmg helix aA, loop BC (the phosphate-binding loop), and the adjacent face of the central P-sheet, provides resrdues that interact with the phosphotyrosme. The other region includes helix aB, loops EF, BG, and the other face of the central P-sheet, and interacts with pepttde resrdues immediately followmg the phosphotyrosme; this regton accounts for the sequence-specific recognition. The peptide ligand lies across the surface of the domain approximately orthogonal to the central P-sheet (Fig. 2). The peptide ligands are usually in an extended conformatron and do not participate m secondary-structure formation with the domain. The phosphotyrosine residue appears to be the main anchor point of the SH2-peptlde complex, allowing the domain to read out the three to six residues immediately followmg the phosphotyrosme. The peptide residues N-terminal to the phosphotyrosine make limited and nonspectftc mter-
NJ AB
pB
BC
PC
CD
PD
PD’
EG3 BG4
II
HGQLKE
WC G IDVYIIGG
IRRFIS
lsLsDLIGYVsHVl
SCLL
KNGDVI
KGE KLL IYP I
Fig. 1. Alignment of SH2 sequences and defmmon of the residue notation The sequences of different SH2 domains are aligned, based on the secondary-structure definitions of Src and Lck (26). The boundaries of the secondary structural elements of Src are shown by solid boxes, and the notation for these elements is shown schematically at the bottom. The important residues are mdrcated by vertical lines at the top (Adapted with permrssron from ref. 28.)
6
7
Peptide Recognition Mechamsms
actions with the domain, and therefore most likely contribute little to the bmdmg specificity. The N- and C-termmi of the SH2 domain are located on the side of the domain opposite to the peptide-bmdmg surface. For this reason, the domain can be readily inserted into different molecular contexts without affecting the peptide-binding ability.
2.2. Peptide-Binding
Specificity
and Affinity
Several lines of evidence indicate that different SH2 domains bind to distinct phosphotyrosme contammg sites of their target proteins m vivo, and that the linear sequence surrounding the specific phosphotyrosine determines the binding specificity (19-22). To illustrate, a point mutation (Tyr 739 to Phe) in the PDGF receptor selectively elimmates the binding of the Ras GTPase activating protem (GAP) to the activated receptors, but the bmdmg of other SH2-containing proteins (such as PLC-y and PI-3 kmase) remains intact (37). It appears that the local sequence, rather than the tertiary structure, of the SH2-targets dominates the binding specificity. Tyrosine-phosphorylated peptides that contain sequences resembling the local sequence of the target protein (the Tyr 739 of PDGF receptor in this case) compete efficiently for the bmdmg of the target protein (PDGFR) to a particular SH2 domain (GAP) (37). In addition, the observation that a mutant PDGF receptor contammg a deletion near the GAP-SH2 binding site binds to the GAP-SH2 domain with nearly the same affinity as the wildtype PDGF receptor suggested that the tertiary structure is not a primary factor m determmmg bmdmg affmlty (38). These observations establish the relevance of studies usmg isolated peptides. A systematic search for optimal peptide sequences for SH2 domains had been carried out by screening a random phosphopeptide library (23,24). Of over 20 different SH2 domains tested, each showed distinct selectivity m the three residues immediately C-terminal to phosphotyrosme in the peptide ligand. Such sequence preference could be correlated with the side-chains of residues at several critical positions of the SH2 domain (24). The clearest example of this correlation is provided for the residue at the PDS position of the SH2 domain, which contacts the peptide side chains at position +l and +3. Certam SH2 domains, including Src-family tyrosme kmases as well as GAP and the adapter proteins GRB2 and Nck, have aromatic residues at pD5, and preferentially bmd to pepttdes contammg polar side chains at +l. In contrast, other SH2 domains (~85, phosphohpase C-y, the tyrosme phosphatases) contam hydrophobic side chains at pD5, and select for hydrophobic residues at +l. Quantitative analysis using isothermal-titration calorimetry and surfaceplasma resonance (39) mdicated that the SH2-peptide mteraction is of only moderate strength (Kd -0.1-3 0 pM> compared with strong mteractions
Lee, Cowburn, and Kuriyan
A
Fig. 2. (see also facing page) Schematic diagram of two SH2-peptide complexes (A) The Src-YEEI complex and (B) the N-terminal SH2 domain of SH-PTP2 complexed with a peptide derived from Tyr 895 of IRS-l, The view is from the peptide-binding surface and illustrates the secondary-structure elements and the notation used. The peptide is shown in a ball-and-stick representation and comprises phosphotyrosine (p-Tyr), residue +l, residue +2, and so on. ol-helices and P-strands are shown as ribbons and arrows, respectively. such as those between transcription factors and their specific DNA targets (Kd ~1 nil4). The phosphotyrosine is absolutely required for binding to SH2 domains (40).
Peptide Recognition Mechanisms
Fig. 2.
Peptide residues immediately following the phosphotyrosine (+ 1 to +6) are the critical determinants for binding to individual SH2 domains; however, a varying range of amino acids are tolerated at each site. Although the selectivity of individual SH2 domains is not sharply defined, the specificity and affinity can increase dramatically when cooperative binding interactions occur (see discussion Subheading 5.1. for tandem SH2 domains of ZAP-70). Kinetic analysis of SH2-peptide interaction has shown that the association and dissociation rates (k,,, and I&) are both very rapid even for high-affinity peptide ligands (41). Fast turnover rates could allow the rapid sampling of different binding sites and are observed for many protein-protein interactions involved in signal transduction.
IO 2.3. Recognition
Lee, Cowburn, and Kurtyan of Phosphotyrosine
The recognition of phosphotyrosme 1s the defmmg feature of the SH2pepttde interface. Although the details vary slightly from one SH2 complex to another, the overall features of the mteractron are strikmgly conserved. Restdues from aA, PB, PD, and the BC loop form the phosphotyrosine-bmdmg pocket and provide hydrophobtc mteractions with the phenoltc ring of phosphotyrosme and hydrogen-bonding interactions with the phosphate group
(Figs. 3A,B). The most critical interaction wtth the phosphotyrosine is provided by Arg PBS, which forms a bidentate-tome interaction with the phosphate group. This arginine is located at the bottom of the binding pocket and becomes completely maccessible to solvent upon binding. Arg PB5 is strictly conserved m all SH2 domams, and even the conservative mutation of this residue to lysine abolishes bmdmg (42). With the backbone of the phosphotyrosme residue held m postnon by the outer strand of the central P-sheet (PD), the ionic mteraction between the phosphate group and Arg PBS provtdes a stereochemical “ruler” that appears to be the key for discrimmatmg between phosphotyrosme and other restdues. The location of Arg PBS is such that, in a fully extended conformation, this side chain IS Just long enough to interact with the phosphate group of a fully extended phosphotyrosme side chain, thus excludmg phosphoserme or phosphothreomne. An interesting feature often observed in the SH2-peptide complexes is the presence of an ammo-aromatic interaction between an ammo nitrogen of Arg aA and the phosphotyrosine rmg (18). Ammo-aromatic interactions have been observed in a number of protein structures as well as m some small molecules structures (43). The ammo mtrogen of this argmme hydrogen bonds with the phosphate group and the backbone-carbonyl group of the peptide. These mteractions mediated by Arg aA appears to be optimal for phosphotyrosme and were first identified m the Src (18) and Lck structures (26) and later m other SH2-peptide structures, including ZAP-70 (34). However, the SH2 domains of the tyrosine phosphatases do not have Arg aA (it is replaced by glycme). In the SH2 structure of the phosphatase SH-PTP2 (28), the phosphate group rotates by -180”, facmg toward the BC loop (Fig. 3B), and the number of hydrogen bond with the phosphate group is almost the same as m Src or Lck. The ammo-aromatic mteraction is also not seen m other SH2 structures (such as p85 ref. 44) even when Arg aA 1s present.
2.4. Peptide Recognition The structures of the closely-related Src and Lck SH2 domams (25,26) m complex with a high-affmtty pepttde containmg the Tyr-Glu-Glu-Ile (YEEI) motif provided the first piece of structural mformation on sequence-specific
Peptide Recognition Mechanisms
11
Fig. 3. Stereoviews of the phosphotyrosine binding sites of (A) Src and (B) N-terminal SH2 domains of SH-PTP2. The polypeptide backbone of the peptide is shown as a tube and the phosphotyrosine side chain is shown in black. Hydrogen bonds are indicated by dashed lines. (Adapted with permission from ref. 28.) recognition by the SH2 domain (Fig. 3A). In these structures, the peptide binds to the SH2 domain in an extended conformation and the interaction resembles a two-pronged plug (the peptide) engaging a two-holed socket (the SH2 domain). The two prongs refer to the phosphotyrosine and the Ile +3 residue of the, peptide, which fit into the corresponding pockets on the SH2 surface. This type of interaction is also observed in several other SH2-peptide complexes.
72
Lee, Cowburn, and Kuriyan
2.4.1. Type 1: Src and Lck Previous studies using random-peptlde libraries indicated that the Src-family SH2 domains strongly select large hydrophobic residues at +3 and, to a lesser extent, prefer nonbasic polar residues at +l and +2, with the optimal motif being YEEI (two glutamates and one isoleucme followmg the phosphotyrosme) (24). A peptide containing this optimal motif, derived from the hamster polyomavlrus middle-T antigen, binds to Src-family SH2 domains with high affinity and has been used for the structural studies. The most important feature m the Src and Lck structures is that the Ile +3 residue of the YEEI peptlde engages a well-defined hydrophobic pocket of the SH2 domain. This interaction 1s responsible for the selection of large hydrophobic residues at +3 posltlon. The residues lmmg this pocket (which arise from PD, DE, loops EF and BG) are rather divergent. In particular, the two variable loops, BG and EF, shape the surface topography of this pocket. Mutations as well as large msertlons/deletlons are often found in this region, and these have been shown to be important for binding specificity. The glutamate residues at +l and +2 do not form extensive interactions with the SH2 domain, but are m the vlcmlty of basic residues that may account for the moderate selectivity against basic residues at these positions in the peptides (Fig. 2A). The prototypical two-pronged Interaction 1s also observed in two X-ray structures of the N-terminal SH2 domain of the ~85 subunit of PI-3 kmase (p85N), complexed separately with two high-affinity peptldes containing the optimal Y-M/V-X-M motif (44). Although m p85N SH2 the position of Met +3 shifts shghtly toward the central P-sheet, the interaction between this residue and the hydrophobic pocket 1s similar to that seen m Src and Lck. This resemblance is expected, because both SH2 domains favor large hydrophobic residues at this posltlon (although p85N shows a higher preference for Met). A unique feature of the p85N SH2 domain 1s that this hydrophobic pocket 1s blocked by the side chain of Tyr BG5 m the absence of hgand, and this side chain has to move by 8 8, to open up the pocket for hgand binding. The large movement of the Tyr side chain might account for the changes in circular dlchroism and fluorescence spectra that had been noted upon peptide bmdmg, because no other large-conformatlonal change induced by peptide binding was found. A notable difference in the binding speciflcltles of p85N and Src 1s that, at the +1 position, p85N SH2 prefers hydrophobtc residues, whereas Src SH2 favors nonbasic polar residues. Ile PDS (m p85N) appears to be the major determinant for this difference, since replacement of this residue by Tyr (found in Src) shifts the selectlvlty toward that of the Src-family SH2 domains (27). In the p85N structure, the less bulky side chain of Ile pD5 opens up a shallow-
Peptide Recognition Mechanisms
13
hydrophobic pocket for housing a hydrophobic residue such as Met or Val at the +1 position. Likewise, the SH-PTP2 and PLC-y SH2 domains (which have Ile and Cys at PDS, respectively) also prefer a hydrophobic residue at the +l position. In contrast, the bulky side chain of Tyr pD5 closes up this hydrophobic pocket m Src and Lck.
2.4.2. Type 2: SH-PTP2 and PLC-y The crystal structures of the N-terminal SH2 domains of the SH-PTP2 tyrosine phosphatase have been determined in separate complexes with two high-affinity peptides. A distinctive feature in these structures is that five residues following the phosphotyrosine of the peptide run through a hydrophobic groove on the SH2 domain (28). Mutagenesis studies confirmed the strong selectivity for hydrophobic residues at the +5 position (28); truncating the peptide or replacing the residue at +5 with a hydrophilic residue completely abolishes its interaction with the SH-PTP2 SH2 domain (45). This selectivity was unexpected because this residue had not been randomized in the peptide-library study, and consequently this enhanced selectivity had not been predicted. The differences m surface topography for the SH2 domains of Src and SH-PTP2 arise from the opening of pockets for housing peptide residues +l and +5. The presence of a shallow-hydrophobic pocket for +l m SH-PTP2 is primarily owing to the less bulky residue (Ile) at the PBS position, The +5 binding site is flanked by the two variable loops, EF and BG, and these are opened up relative to their positions m Src and Lck. Such significant changes could perhaps have been anticipated by examining the primary sequences of the SH2 domains, but the precise structural details would be difficult to model without mformation from crystallography or nuclear magnetic resonance (NMR). The binding of peptide to the C-terminal SH2 domain of phospholipase C-y1 (PLC-y) also mvolves extended interactions in a surface groove (29). The solution structure of this SH2 domain has been determined, revealing an interaction involving six peptide residues following the phosphotyrosine. Surprismgly, a bmdmg study mdicated that residues at the +2 to +6 positrons contribute little binding energy, although they make extensive contacts with the PLC-y-SH2 domain; truncation of the peptide to just the three residue DYI resulted in only a 15-fold reduction m binding affinity (46). The discrepancy between the structural results and the binding data has been further investigated by examining the changes m the dynamic properties of the SH2 domain upon peptide binding (46). This analysis demonstrates that the residues contacting the phosphotyrosine (which contribute to binding energy) undergo a sigmficant restriction m dynamic flexibility upon binding, whereas the residues interacting with C-terminal end of the peptide (which contribute little
14
Lee, Cowburn, and Kuriyan
binding energy) do not. The results have general implications for studying molecular interactions. It has been suggested that analysis of dynamic behavior m response to bmding could be used to distinguish the residues that contribute most to bmdmg energy (46).
2.4 3. Type 3. GRl32/Sem-5 Most SH2 domains show strong selectivity for particular side chains at the +l and +3 positions of the peptide, and the reason for this can be readily understood from the structural data. High-affinity peptides usually bmd to SH2 domains m an extended conformation and, as a result, significant contacts are only made by odd-numbered residues, including those at the +l, +3, and +5 positions. The GRB2 SH2 domain is unique m that it selects most strongly for an Asn at the +2 position, with the optimal motif being YVNX (24). This unusual target specificity is owmg to the presence of a Trp residue at the EFl position; strikmgly, replacement of Thr EFl by Trp m the Src SH2 domam shifts the binding specificity of Src SH2 toward that of GRB2 (47). The recently determined structure of a GRB2 SH2-peptide complex reveals an unusual mode of peptide recognmon and explains the binding selectivity (30). In the GRB2-peptide structure, the side chain of Trp EFl fills up the +3-bmdmg site and thus prevents the peptide from binding in an extended conformation. Instead, the peptide residues YVNV adopt a p-turn conformation, which is stabilized by a hydrogen bond between the carbonyl group of the phosphotyrosine residue and the backbone-amide group of Val+3 of the peptide. In addition, the carboxamide oxygen of the Asn +2 side chain forms a hydrogen bond with the backbone-amide group of Lys PD6, whereas the mtrogen atom of the Asn side chain is hydrogen bonded to the carbonyl groups of Lys PD6 and Leu PE4. The selection for Asn at +2 1s because of the formation of these hydrogen bonds that are specific for asparagine, and replacement of the Asn at the +2 position by Glu completely abolishes the bmdmg (30)
3. PTB, PH, and PDZ Domains The PTB/PI interaction domain is a component of the Src homology 2/collagen homology (SHC) adapter protem, shown to bind phosphotyrosyl peptides in a manner different from that of the SH2 domains (Fig. 4) (6,7,48). This domain m SHC is specific for NPXY motifs, and the N-terminal selectrvity is mconsistent with all known modes of SH2/phosphopeptide mteractions. The solution structure of the SHC-PTB domain m complex with a ligand first revealed the unique nature of the PTB-peptide mteractron (IO), and this was further illustrated by the solution and crystal structures of the PTB domam of msulm-receptor substrate- 1 (IRS- 1) in complex with hgands (8,9). The general
Peptide Recognition Mechanisms
Fig 4. Altgnment of PTB domain and PH domam sequences. The sequences of SHC-like PTB domains (mcludmg SHC, Xl 1, dNumb, mP96) and IRS-l PTB domam are aligned according to the secondary structure. The sequences of PH domains (PLCG and Dynamm) are listed for reference The boundaries of the secondary structural elements of Xl 1 are shown by solid boxes, and the notation for these elements is shown on the top The secondary structures for experimentally determined domains are Indicated by shadows Noted there is no detectable sequence homology among the three groups The residues m SHC and IRS-l that interact with phosphotyrosme are marked with asterisks at the top (Adapted with permission from ref. 8.)
architecture of the two domains is similar, with the SHC-PTB domain somewhat larger and more complex (Fig. SA). In both cases, the core architecture and topology of the protein fold is similar to that of the PH domain, a signaling module with various functions (4). In this PH-domain superfamily, two medium-size P-sheets pack against each other with inter-strand angles of about 60”, and a C-terminal a-helix lies along one edge of these sheets. PTB domains mcorporate their target ligands into the structure by extending one of the P-sheets, using antiparallel hydrogen-bonding mteractions. The NPXY motif, characteristic of the PTB-domain ligands, is at the C-terminus of this P-strand, and forms a p-turn. In the case of SH2 domains, it had been relatively easy to identify sequence homology, and the recognmon of phosphotyrosme proceeds by a mechanism that is common to all SH2 domains of known structure. The PTB domains do not, however, have such a conservation of sequence, even though the same structural mechanism for peptide recognition is used. For example, m the SHC- and IRS-l-PTB domains, different sets of residues recognize the phosphotyrosine. In addition, the Xl 1- and FE65PTB domains bmd to NPXY
Fig. 5. (A) The PTB domain of SHC (ZO). The peptide is shown in darker gray with the phosphotyrosine represented in a ball-and-stick model. The figure is generated using MOLSCRIPT (81). (B) Schematic diagram indicating the similarity in topology and peptide binding between FTB domains and PDZ domains. (Adapted with permission from ref. II.)
16
Peptide Recognition Mechanisms
17
motifs in the Alzheimer-precursor protein in the absence of phosphorylation. A crystal structure of this hgand bound to the X 11 -PTB domain reveals a binding mode essentially similar to that of the phosphorylated hgands to the SHC- and IRS-l-PTB domams (Zhang et al , to be submitted). Some PH domains have clear protein-protem interactions, mapped to a similar area of that molecule by fragment-expression methods, and identified as part of the extension of the highly positively charged sheet/helix interface by NMR (Fushman et al., to be submitted). In general, the peptide-recognmon mechanisms used by the SH2 and PTB domains differ in two major ways. First, the phosphotyrosine is deeply buried and tightly coordmated m the SH2 domains. This appears to be less so for the PTB domains. Second, the N-terminal region of the PTB ligands forms extensive backbone contacts with the PTB domains. No such interactions are observed in the SH2-ligand complexes. Recent studies of the PDZ domain have revealed a similar core architecture. These small (-100 residues) domains are components of several protems that are involved m synaptic junctions, and they bmd to short nonphosphorylated sequences at the C-termml of Shaker-type potassium channels, and N-methyl-o-aspartate (NMDA) receptor-ion channels. The crystal structure of the peptide complex of one PDZ domain has recently been reported (II). The peptide ligand is bound m a manner similar to that seen m the PTB domains, with the formation of antrparallel hydrogen bonds with the peptide, which packs against a C-terminal a-helix of the domain (Fig. 5B).
4. SH3 Domains Like the SH2 domams, the SH3 domains are small modules that mediate protein-protein interactions (reviewed in refs. 3 and 5). The characterization of cellular proteins that bind to SH3 domams has led to the identification of SH3 ligands as short proline-rich peptide sequences with a minimal PxxP motif (4950). Three-dimensional structures of SH3 domains were first determined for Src (51) and spectrm (52) in the unhganded form by NMR and X-ray crystallography, respectively. The highly conserved SH3 fold is composed of two small antiparallel P-sheets that pack against each other to form a barrellike structure. A notable feature of the unliganded SH3 structures is a shallow groove lined by several highly conserved aromatic residues; this forms the ligand-binding site. Determmation of the structures of peptide complexes of the SH3 domains of the ~85 subunit of phosphatidyl inositol3-kinase (53) and Abl tyrosme kmase (54) estabhshed that the prolme-rich peptide adopts a lefthanded polyprolme-type II (PP-II) helix that interacts with the SH3 domain using two of the three edges of the PP-II helix, as had been suggested previously based on modeling and mutagenesis (Fig. 7) (55). Further structural
18
Lee, Cowburn, and Kuriyan
analyses of peptide complexes revealed that the peptide can bind to the SH3 surface in two orientations, depending on the particular sequence of the ligand, providing an additional level of specificity (56-59). Biochemical and structural analyses of the interaction between the HIV- 1 Nef protein and Src family SH3 domains has revealed how tertiary interactions can further augment the binding affinity and specificity of SH3 domains (60,61).
4.1. PxxP Peptide Recognition The helical PP-II conformation adopted by SH3 ligands exhibits threefold pseudosymmetry in cross-section. When bound to the SH3 domain, two of its three edges provide six peptide residues (P-s, P-*, Pa, P-t, P,,, and P+3) that fit into corresponding binding pockets on the SH3 surface (see Fig. 6 for the notion used). The interface is pseudosymmetrical (P-t and Pa are equivalent, and so are P,,, and P+3), and an interesting consequence is that the peptide can bind in two opposite orientations, referred to as plus and minus (5657) (Fig. SA). The particular orientation utilized is determined primarily by an ionic interaction between a conserved-acidic residue of the SH3 domain (labeled g in Fig. 6) and a basic residue (usually an Arg) at the P-, position of the peptide. Peptide residues at the P-r, P,, P+2, and P,, positions interact with the hydrophobic-binding surface of the SH3 domain and are usually proline or other hydrophobic residues. The pseudosymmetry of the PP-II helix breaks down in the presence of nonproline residues in the helix (Fig. SB). Nonproline residues at one of the two edges can pack tightly against the SH3 surface, whereas nonproline resides at the other edge cannot. The selection of proline residues over nonproline at certain positions is linked to the orientation of the bound peptide. To illustrate, when a peptide binds to the SH3 domain in the minus orientation, nonproline residues are tolerated only at one edge (corresponding to positions, P-i and P+*), because at the other edge (PO and P+j) the side chain of the nonproline residue would extend away from the binding surface (Fig. SB). Thus, proline residues are required at one edge in one orientation but at the opposite edge in the reverse orientation, leading to the PxxP motif. Peptides containing the motif “PxxPxR” are likely to bind to SH3 domains in the “minus” orientation, whereas peptides containing the motif “RxxPxxP” will bind in the “plus” orientation (5657).
4.2. Binding Affinity
and Specificity
The binding of PxxP-containing peptides to SH3 domains is rather weak in general, with dissociation constants around 2-50 pM (53). This may be because of the relatively small interface area (typically -400 A*) between the peptide ligand and the SH3 domain. Residues of the SH3 domain that interact with the
Peptide Recognition Mechanisms
19 distal loop
DPH KDE GD NTE ES GE SSE GD NGE YNH KPE EQ GSL( :14)EIG STN KD KCS DG KKG QQG ELE DG VLE
Fig. 6. Sequence alignment of SH3 domains. The indicated secondary structure is based on the crystal structure of the Fyn-SH3 domain (82). The conserved acidic (b, d, f, and g) and hydrophobic (a, c, h, i, j, k, and 1) residues implicated in ligand binding are indicated on the top of the sequence.
peptide tend to be highly conserved. Two loops with highly variable sequence, the so-called RT- and n&c loops (so named because At-g and Thr residues in the first loop are critical for Src function, and because an insertion is found in the second loop in the neural form of Src), make limited contacts with the bound peptide, even though they border the interface. Because of the conserved nature of the interface, peptide-SH3 interactions can be relatively promiscuous. The relatively low affinity and low specificity of SHS-peptide interactions raises the question of how SH3 domains might achieve higher specificity. Some specificity in SH3-peptide recognition is in fact evident in considering certain peptide-SH3 interactions. For instance, the Abl-SH3 domain binds preferentially to peptides containing hydrophobic residues at the P-s position, whereas other SH3 domains favor basic residues at the same position (62,63). The unique specificity of the Abl-SH3 domain appears to be owing to the lack of the acidic residue in the RT loop that is found in most SH3 domains, and which mediates the ionic interaction with the peptide. In addition, the N-terminal SH3 domain of Crk binds specifically to a peptide derived from the guanine nucleotide-exchange factor C3G, with selectivity at the P-s position (64). C3G peptides contain Lys instead of the usual Arg at the P-s position, and the Lys side chain is tightly coordinated by three acidic residues in the RT-loop of the Crk-SH3 domain (65). As discussed above, one reason for a lack of specificity in many SH3-peptide interactions is owing to limited variation in the interaction surface. Selections with longer peptide segments and nonnatural analogs have demonstrated that higher affinity and selectivity can be obtained by exploiting
20
Lee, Cowburn, and Kuriyan
n
Fig. 7. SH3-peptide interaction, for the GRB2/Sem-5 SH3 domain complexedwith a peptide bound in the minus orientation (57). The bound-PxxPpeptide is shown in a ball-and-stick representation and the peptide residues are labeled according to Fig. 8A. The conserved hydrophobic residuesthat form the peptide-binding surface and the acidic residue that interactswith the Arg at P-3 of the peptide are shown in lightgray stick. nonconserved regions of SH3 (66). However, it is likely that many SH3 domains can only achieve high affinity and high specificity by cooperative and/or tertiary interactions. 4.3. Tertiary interactions Between HIV-1 Nef and Src-Family SH3 Domains HIV-l Nef is an early gene product of immunodeficiency viruses (including HIV-l, HIV-2, and SIV) and is essential for AIDS pathogenesis (reviewed in ref. 67). The molecular mechanism by which Nef promotes disease progress is not known in detail, although several lines of evidence suggest that Nef might function by interacting with cellular-signaling proteins. Nef contains an invariant PxxP motif which is critical for optimal viral replication and has been shown to mediate specific interaction with certain Src familySH3 domains (68).
A
P-
P-2
P-l
NNN-
R R M
K A P
L L P
P P P 0
‘Screen ‘Screen 3BPl
Pl3K Src Abl
CCC-
R R R
P R S
P P ,P
v L v
mSosl-i *Screen Dynamm
GrbZ/Sems Src ~85 Pl3K
R
L
P 3
v
Nef
Hck
Orlentatlon +
C-
B
Minus Orientation
PO
PI
J
N
Pz
P,
OngIn
Plus Orientation
SH3 cbmaln
C
C
Fig 8. (A) Alignment of the PxxP mottf of SH3 hgands accordmg to (57) The posttton P-s, P-t, PO,P,, and P, contam the hgand residueswhich interact with the SH3 domam. The spacmgof posmonsare also shown m the ribbon dtagram representing a left-handed PPII helix. (B) Two types of packmg geometries, with distmct preferences for prolme vs nonprolme residues In the mmus orientation (left panel), nonprolme restdue can adapt preferred conformatton at Pafor tight mteractton with SH3 domain; whereas,m plus ortentatton (right panel), nonprolme residueat POposttton ~111extend Its side chain away from the bmdmg surface of SH3 domam, resultmg m unfavorable interaction.
21
22
Lee, Cowburn, and Kuriyan
The interaction between Nef and the SH3 domain of Hck (which is a member of the Src family of kinases) is of high affinity and specificity (61). The affinity is among the tightest known for SH3-ltgand mteractrons (Kd = 0.25 @t4), Moreover, Nef is able to discriminate between the Hck-SH3 domam and the closely related Fyn-SH3 domain, with a selectivity of over loo-fold. Mutagenesis indicates that the differential bmdmg to Nef IS mediated by a single ammo acid m the RT-loop of the SH3 domain. Interestingly, the high affnnty and high specificity are only evident for the folded-Nef protem, because a peptide corresponding to the Nef-PxxP motif binds to SH3 domains only weakly. The crystal structure of the conserved core of HIV-l Nef m complex with a mutant (R961) Fyn-SH3 domain (to which Nef bind tightly) has been determmed recently (60). The Nef-PxxP motif adopts a PP-II-helical conformation, which interacts with the SH3 domain m a manner resembling closely the mteractions between the SH3 domain and isolated peptides. The Nef-PxxP motif forms a PP-II helix even in the absence of the SH3 domam, as revealed by the solution structure of Nef in an unliganded form (69). The SH3 domain thus Interacts with a preformed PP-II helix on Nef, which augments the bmdmg affinity by reducing the entropic penalty for forming the PP-II helix. A striking feature of the structure of the complex is that the interface of Nef with the SH3 domain includes elements that are distmct from the PxxP motif of Nef. Most important of these is a hydrophobic pocket on the surface of Nef that engages an isoleucine residue on the RT-loop of the SH3 domain (Fig. 9) It is this mteraction that allows Nef to distinguish between closely related SH3 domains. The Ile-binding pocket is formed by the antiparallel arrangement of two a-helices that follow the PxxP motif m sequence and bracket it m the tertiary structure of Nef. The observation that the RT-loop of the SH3 domam contributes to bmdmg specificity is not entirely unexpected. The RT-loop is very divergent among different SH3 domams, and it borders the peptide-bmdmg surface of the SH3 domain. It has been shown that the RT-loop plays an important role m substrate binding and auto-inhibition of Src-family tyrosine kmases (70-72). It is likely that other SH3 domams also uttlize the drvergent regions, such as the RT- and n-Src loops, to enhance the binding specificity in combination with the conventional PxxP-SH3 interaction.
5. Cooperative 5.1. Interaction
Interactions of Tandem SH2 Domains of ZAP-70 with the ITAM Motif
The activation of the T-cell receptor complex inmates a series of signaling events that are critical for T-cell function (reviewed in ref. 73). One such event mvolves the tyrosme-phosphorylation of the cytoplasmrc regions of the c-chain of CD3 complexes that contain immunoreceptor tyrosme activation motifs
Peptide Recognition Mechanisms
23
(ITAM). The ITAM motifs contain the sequence Y-X-X-L/l-X,-s-Y-X-X-L/I, and are phosphorylated on both tyrosmes upon receptor stimulatron, resulting m the formation of two contiguous SH2-binding motifs. The activated ITAM motifs serve as docking sites for several SH2-containing signalmg molecules, particularly the ZAP-70/Syk tyrosine kinase family. ZAP-70 consists of two SH2 domams connected by a 65-residue linker (the inter-SH2 region), followed by the catalytic kinase domain. The interaction between the tandem SH2 domains of ZAP-70 (ZAP-NC) and an ITAM are cooperative and of high affinity, for which both SH2 domams are required (74). A peptide with an ITAM motif that is phosphorylated on only one of the two tyrosines binds to ZAP-NC with an affinity that is 100-1000 times weaker than that of a doubly phosphorylated peptide (75). The crystal structure of the tandem SH2 domains of ZAP-70 complexed with a peptide contaming a complete ITAM motrf has been determined, which reveals the molecular basis for the cooperative binding (34). The ZAP-NC-ITAM complex IS Y-shaped, with the 65 residues of the inter-SH2 region forming a coiled coil structure that is the stem of the Y. The two SH2 domains (ZAP-N and ZAP-C) are positioned side by side and form the two upper branches of the Y. A contrguous peptide-bmdmg surface is formed by the adjacent SH2 domains at the tips of the Y. The peptide binds to the ZAP-NC SH2 domains m a head-to-tail orientation with the N-terminal phosphotyrosine of the ITAM motif bound to the C-terminal SH2 domain (ZAP-C). Both SH2-docking sites of the ITAM motif bmd to the corresponding SH2 domains in a manner resembling the prototyptcal two-pronged mteraction, with one important difference: the binding site for the C-terminal phosphotyrosine of the ITAM motif is composed of resrdues from both SH2 domains. This explains why the ZAP-N SH2 domains fails to bmd to phosphopeptides as an isolated domain, The linker region (7-8 residues) between the two SH2-binding motifs of the ITAM adopts a helical conformation and provides an appropriate spacmg that is critical for specificity; msertion or deletion of two or more residues in this region abolishes the cooperatrve Interaction. The total surface area burred between the ZAP-NC SH2 domains and the ITAM peptide is relatively large (around 1300 A*), which may account for the high affinity of the mteraction. In contrast, the interface between the two SH2 domains is relatively small (-200 A2), suggestmg that they are held m position by the bound peptide and the inter-SH2 coiled-coil.
5.2. Tandem SH2 Domains
of SH-PTP2-Tyrosine
Phosphatase
The SH-PTP2 tyrosine phosphatase belongs to a group of nonreceptor tyrosine phosphatases that contam two tandem SH2 domains followed by a
24
Lee, Cowburn, and Kuriyan
disordered lo’ip Fig. 9. Nef-SH3 interaction. The SH3 domain is shown in white, and the Nef protein is in gray. The invariant prolines of the Nef-PxxP motif and the critical Ile in the RT-loop of the SH3 domain that determine the binding specificity are shown in ball-and-stick representation. phosphatase catalytic domain. The SH2 domain(s) of SH-PTP2 have been shown to mediate the interaction of the phosphatase with activated receptor tyrosine kinases (76,77) and to downregulate the phosphatase enzymatic activity (78-80). Occupation of either SH2 domain by phosphopeptides stimulates the phosphatase activity, with much more potent activation resulting from peptides that contain double SHZbinding sites. The crystal structure of the tandem SH2 domains of SH-PTP2 complexed with phosphotyrosyl peptide has
Peptide Recognltlon Mechanisms
25
been determined (36). In contrast to the structure of the ZAP-70 tandem SH2 domains,
m which the two peptlde-binding
sites are in a linearly contmuous sites are widely separated (by about 40 A) and are antlparallel to each other. Phosphotyrosyl peptldes bmd to each SH2 domam as observed in the single SH2-peptide complex discussed above (28). Although only a relatively small hydrophobic interface was found between two SH2 domains, the relative orientation of two SH2 domains appears to be
arrangement, in the SH-PTP2 structure the two peptlde-binding
rigidly constrained by the presence of a buried dlsulflde bond that links two domams.
Dlsulflde bonds m cytoplasmlc proteins are unusual, but not without precedent. A possible function of this fixed orientation may be to position the tandem SH2 domains for mteractlon with phosphotyrosyl groups that are spaced appropriately in dlmerlc activated receptors.
6. Conclusions Each of the peptlde-bindmg modules described here binds to its target peptides utlllzmg a conserved mechanism. Although tertiary interactions appear to be important, the primary determinants of specificity appear to be the linear
sequence elements of the targets Thus, both the peptide-recogmtlon domains and their ligands are modular and self-contained, which allows for the constructlon of large slgnalmg molecules that integrate multiple domains and bmdmg sites within them. The “modular design” is economical and efficient, and
might account for the wide utllizatlon of peptide-recogmtlon mechanisms in various cell processes such as cell signaling
and sorting
References 1. Sadowskl, I , Stone, J. C , and Pawson, T. (1986) A noncatalytlc domain conserved among cytoplasmlc protein-tyrosme kmases modifies the kmase function and transforming activity of fuJmam1 sarcoma virus p130@‘g-fpsA4ol Cell Bd 6, 4396-4408 2. Moran, M F., Koch, C A., Anderson, D , Ellis, C , England, L., Martm, G S., and Pawson, T. (1990) Src homology region 2 domams direct protein-protein mteractlons in signal transduction. Proc Nut1 Acad SLJ USA 87,8622-8626 3. Pawson, T. and Schlessmger, J (1993) SH2 and SH3 domains Curr Bzol 3, 434-442. 4. Cohen, G B., Ren, R , and Baltimore, D (1995) Modular binding domains m signal transduction proteins Cell 80, 237-248 5 Pawson, T (1995) Protein modules and slgnallmg networks. Name 373, 573-580 6 Kavanaugh, W. M and Wllhams, L T (1994) An alternatlve to SH2 domains for bmdmg tyrosme-phosphorylated growth factor receptors Science 266, 1862-1865
26
Lee, Cowburn, and Kuriyan
7. Blarkre, P. et al. (1994) A region m She drstmct from the SH2 domain can bmd tyrosme-phosphorylated growth factor receptors. J Blol Chem 269, 32,03 l-32,034 8 Eck, M. J , Dhepaganon, S , Trub, T., Nolte, R T., and Shoelson, S E., (1996) Structure of the IRS-l PTB domain bound to the Juxtamembrane region of the Insulin receptor. Cell 85,695-705. 9. Zhou, M -M , Huang, B., GleJniczak, E. T , Meadows, R. P , Shuker, S B , Miyazakt, M., Trub, T., Shoelson, S. E., and Fesrk, S W. (1996) Structural basis for IL-4 receptor phosphopeptrde recogmtron by the IRS-l PTB domam. Nature Struct Blol 3, 388-393 10 Zhou, M M., Ravichandran, K S , OleJnlczak, E F , Petros, A M , Meadows, R. P , Sattler, M., Harlan, J E , Wade, W. S , Burakoff, S J., and Fesrk, S W. (1995) Structure and hgand recognitron of the phosphotyrosme bmdmg domain of She Nature 378,584592. 11 Doyle, D A , Lee, A., Lewis, J., Kim, E., Sheng, M , and MacKmnon, R (1996) Crystal structures of a complexed and pepttde-free membrane protein-bmdmg domain-molecular basis of peptide recogmtron by PDZ domains. Cell 85, 1067-1076 12. Chen, H. I. and Sudol, M. (1995) The WW domain of Yes-assoctated protein binds a prolme-rich hgand that differs from the consensus establtshed for Src homology 3-binding modules. Proc Nat1 Acad Scz USA 92,7819-7823. 13. Matsuda, M , Mayer, B J , Fukui, Y , and Hanafusa, H. (1990) Bmdmg of Transforming Protein, P47gag-crk, to a Broad Range of Phosphotyrosme-Containing Proteins. Sczence 248, 1537-1539. 14 Mayer, B J , Jackson, P. K , and Baltimore, D. (1991) The noncatalytic src homology region 2 segment of abl tyrosme kmase bmds to tyrosme-phosphorylated cellular proteins with high affinity. Proc Nat1 Acad Scz USA S&627-63 1 15. Pawson, T. (1992) Tyrosme kmases and their interactions with srgnallmg molecules. Curr Open Genet Dev 2,4-12 16. Overdum, M., Rros, C B., Mayer, B J , Baltimore, D., and Cowburn, D (1992) Three-dimensional solutton structure of the src homology 2 domain of c-abl. Cell 70,697-704 17. Booker, G W., Breeze, A L., Downing, A K., Panayotou, G., Gout, I., Waterfield, M. D., and Campbell, I D (1992) Structure of an SH2 domain of the p85a subunit of phosphatrdylmosrtol-3-OH kmase Nature 358,684-687. 18. Waksman, G., Kommos, D , Robertson, S. R., Pant, N , Baltimore, D., Barge, R B , Cowburn, D , Hanafusa, H., Mayer, B J , Overdum, M , Resh, M. D., Rtos, C. B., Silverman, L., and Kurryan, J. (1992) Crystal structure of the phosphotyrosme recognmon domam SH2 of v-src complexed with tyrosine-phosphorylated peptides Nature 358,64&653. 19. Cohen, B , Yoakrm, M , Prwmca-Worms, H , Roberts, T , and Schaffhausen, B S (1990) Tyrosme phosphorylatton 1s a signal for the traffickmg of pp85, a polypeptide associated with phosphatrdylmosrtol kmase activity. Proc Nat1 Acad SCL USA 87,4458-4462
Peptde Recogmtion Mechamsms
27
20. Kazlauskas, A., Kashishtan, A , Cooper, J. A., and Valius, M. (1992) GTPase activatmg protein and phosphattdylmositol 3-kmase bmd to a distinct region of the platelet-dertved growth factor receptor psubunit. Mol Cell Btol 12,2534-2544. 21. Talmadge, D A., Freund, R , Young, A. T , Dahl, J., Dawe, C. J., and Benjamin, T. L. (1989) Phosphorylation of middle T by pp60c-src: a switch for bmdmg of phosphatidylmosttol3-kmase and opttmal tumorigenests. Cell 59,5.5-65. 22 Cantley, L C , Auger, K. R , Carpenter, C , Duckworth, B., Graztam, A., Kapeller, R., and Soltoff, S. (1991) Oncogenes and signal transduction. Cell 64,281-302. 23. Songyang, Z , Shoelson, S E , McGlade, J , Olivter, P , Pawson, T., Bustelo, X R , Barbactd, M., Sabe, H., Hanafusa, H , Yt, T., Ren, R., Baltimore, D., Ratnofsky, S., Feldman, R. A., and Cantley, L. C. (1994) Specific motifs recognized by the SH2 domains of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk and Vav Mol. Cell Blol 14, 2777-2785. 24 Songyang, Z , Shoelson, S. E., Chaudhun, M., Gish, G., Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R. J , Neel, B. G., Birge, R. B , FaJardo, J E., Chou, M. M., Hanafusa, H., Schaffhausen, B., and Cantley, L C (1993) SH2 domains recognize spectfic phosphopeptide sequences. Cell 72,767-778. 25 Waksman, G , Shoelson, S E , Pant, N , Cowburn, D., and Kuriyan, J (1993) Bmdmg of a high affinity phophotyrosyl peptide to the src SH2 domain: crystal structures of the complexed and pepttde-free forms. Cell 72,779-790. 26. Eck, M., Shoelson, S E., and Harrison, S. C. (1993) Recogmtton of a high affinity phosphotyrosyl peptide by the Src homology 2 domain of ~56’“~ Nature 362, 87-91, 27. Songyang, Z , Gtsh, G., Mbamulu, G., Pawson, T., and Cantley, L. C (1995) A single point mutatton switches the specificity of group III src homology (SH) 2 domams to that of group I SH2 domains. J Blol Chem 270,26,029-26,032 28 Lee, C.-H., Kommos, D , Jacques, S , Margohs, B., Schlessinger, J., Shoelson, S. E , and Kurtyan, J. (1994) Crystal structures of peptide complexes of the aminoterminal SH2 domam of the Syp tyrosme phosphatase. Structure 2,423-438. 29. Pascal, S. M., Singer, A U , Gish, G., Yamazaki, T., Shoelson, S. E., Pawson, T , Kay, L. E., and Forman-Kay, J. D. (1994) Nuclear magnetic resonance structure of an SH2 domam of phospholipase C-y1 complexed with a high affimty bmdmg peptide Cell 77,461472. 30 Rahuel, J , Gay, B., Erdmann, D., Strauss, A., Garcia-Echeverrta, C., Furet, P., Caravattr, G., Fretz, H., Schoepfer, J., and Grtitter, M. (1996) Structural basis for specificity of GRB2-SH2 revealed by a novel ligand bmdmg mode. Nat Struct Biol 3,586-589. 31. Zhou, M. M., Meadows, R. P., Logan, T. M., Yoon, H. S., Wade, W. S , Ravtchandran, K S., Burakoff, S. J., and Fesik, S. W. (1995) Solution structure of the She SH2 domam complexed with a tyrosine-phosphorylated peptide from the T-cell receptor Proc Nat1 Acad Scl. USA 92,7784-7788. 32. Matgnan, S , Gurlloteau, J -P , Fromage, N., Arnoux, B , Becquart, J., and Ducruix, A (1995) Crystal structure of the mammahan GRB2 adaptor. Sczence 268,291-293
28
Lee, Cowburn, and Kuriyan
33. Gosser, Y. Q., Zheng, J., Overdum, M., Mayer, B. J., and Cowburn, D. (1995) The solutton structure of Abl SH3, and its relationship to SH2 m the SH(32) construct. Structure 3, 1075-1086 34. Hatada, M. H., Lu, X., Laird, E R., Green, J , Morgenstern, J P., Lou, M., Marr, C. S., Phdhps, T. B., Ram, M. K., Thertault, K., Zoller, M. J., and Karas, J. L. (1995) Molecular basis for the interaction of the protein tyrosine kmaseZAP-70 with the T-cell receptor Nature 377, 32-38 35 Eck, M., Atwell, S. K., Shoelson, S. E , and Harrison, S. C. (1994) Crystal structure of the regulatory domamsof the Src-family tyrosme kmaselck. Nature 368,
764-769. 36 Eck, M J., Pluskey, S , Trub, T , Harrison, S C , and Shoelson, S. E. (1996) 37
38.
39.
40.
Spatial constraints on the recogmtion of phosphoprotems by the tandem SH2 domamsof the phosphataseSH-PTP2. Nature 379,277-280 Fantl, W J , Escobedo, J. A , Martm, G A , Turck, C W , Rosario, M , McCormick, F., and Wtlhams, L T (1992) Dtstmct phosphotyrosmeson a growth factor receptor bmd to specific molecules that medtate different stgnallmg pathways. Cell 69,413-423. Kashishian, A., Kazlauskas, A , and Cooper, J. A (1992) Phosphorylation sitesin the PDGF receptor with different spectfictties for bmdmg GAP and PI3 kmasem VIVO. EMBO J 11, 1373-1381. Ladbury, J. E., Lemmon, M. A., Zhou, M., Green, J., Botfteld, M C., and Schlessmger,J (1995) Measurement of the bmdmg tyrosyl phosphopeptidesto SH2 domains: a reappraisal. Proc Nat1 Acad Scz USA 92,3199-3203. Lemmon, M A and Ladbury, J. E., (1994) Thermodynamic studies of tyrosyl-phosphopeptide bmdmg to the SH2 domain of p56tCk.Bzochemzstry 33,
5070-5076 41. Felder, S., Zhou, M , Hu, P., Urena, J , Ullrich, A , Chaudhuri, M , White, M., Shoelson, S. E., and Schlessmger,J. (1993) SH2 domams exhibit high-affinity bmdmg to tyrosme-phosphorylated pepttdes yet also exhibit rapid dtssoctation and exchange Mol Cell Blol 13,1449-1455 42 Mayer, B. J., Jackson, P. K , Van Etten, R A , and Baltimore, D. (1992) Point mutations m the abl SH2 domam coordmately impair phosphotyrosme bmdmg in vitro and transforming ability m vivo. Mel Cell Bzol 12,609-618 43 Burley, S. K and Petsko, G A (1986) Ammo-aromatic mteracttons m protems FEBS Lett 203, 139 44 Nolte, R. T., Eck, M J., Schlessmger, J , Shoelson, S E., and Harrison, S C. (1996) Crystal structure of the PI 3-kmase p85 ammo-termmal SH2 domain and its phosphopeptidecomplexes Nature Struct Bzol 3, 364-313 45. Case,R. D , Piccione, E., Wolf, G , Lechleider, R J., Chaudhuri, M , Neel, B. G., and Shoelson, S E (1994) SH-PTP2 SH2 domain bmdmg specifictty IS defined by direct mteracttons with PDGF P-receptor, EGF receptor, and IRS-l derived phosphopeptides J Blol Chem 269, 10,467-10,474. 46. Pascal, S. M , Yamazakt, T., Singer, A. U , Kay, L E , and Forman-Kay, J. D (1995) Structural and dynamic characterizatton of the phosphotyrosme bmdmg
PeptIde Recognition Mechanisms
47.
48
49
50 51.
52 53.
54.
55.
56.
57.
58.
59.
60.
29
region of a Src homology 2 domain-phosphopeptide complex by NMR relaxation, proton exchange and chemical shift approaches. Biochemzstry 34,11,353-l 1,362. Marengere, L. E. M , Songyang, Z., Gish, G D., Schaller, M D., Parsons, J T , Stem, M. J., Cantley, L C , and Pawson, T (1994) SH2 domam specificity and activity modified by a single residue Nature 369,502-505. Gustafson, T A., He, W , Craparo, A., Schaub, C. D., and O’Neill, T J (1995) Phosphotyrosme-dependent mteraction of SHC and insulin receptor substrate 1 with the NPEY motif of the msulm receptor via novel non-SH2 domain Mel Cell. Bzol l&2500-2508 Cicchetti, P , Mayer, B J., Then, G., and Baltimore, D (1992) Identification of a protein that binds to the SH3 region of abl and is similar to Bcr and GAP-rho. Science 257,803-806 Ren, R., Mayer, B. J., Cicchetti, P., and Baltimore, D. (1993) Identification of a ten-ammo acid prolme-rich SH3 bmdmg sate Sczence 259, 1157-l 161 Yu, H , Rosen, M K , Shin, T B , Seidel-Duggan, C , Brugge, J. S., and Schreiber, S. L (1992) Solution structure of the SH3 domam of Src and Identification of Its Ligand-Bmdmg Site. Sczence 258, 1665-1668 Musacchio, A., Noble, M , Pauptit, R , Wierenga, R , and Saraste, M. (1992) Crystal structure of a Src-homology 3 (SH3) domain Nature 359, 851-855 Yu, H., Chen, J K , Feng, S , Dalgamo, D. C , Brauer, A W , and Schreiber, S L (1994) Structural basis for the bmdmg of prolme-rich peptides to SH3 domains Cell 76,933-945. Musacchio, A., Saraste, M , and Wilmanns, M (1994) High-resolution crystal structures of tyrosme kmase SH3 domains complexed with prolme-rich peptides. Nature Struct Blol 1,546-55 1 Lim, W A. and Richards, F. M (1994) Crttical residues m an SH3 domam from Sem-5 suggest a mechanism for prolme-rich peptide recognition. Nature Struct Blol 1,221-225 Feng, S , Chen, J K., Yu, H., Simon, J. A., and Schreiber, S A (1994) Two binding orientations for peptides to the Src SH3 domain development of a general model for SH3-hgand mteractions Sczence 266, 1241-1247 Lim, W. A , Richards, F M , and Fox, R 0. (1994) Structural determinants of peptide-bindmg orientation and of sequence specificity in SH3 domains. Nature 372,375-379 Goudreau, N., Camille, F., Duchesne, M., Parker, F., Tocque, B., Garbay, C , and Roques, B. P. (1994) NMR structure of the N-terminal SH3 domam of GRB2 and its complex with a proline rich peptide from SOS.Nature Strucr Blol 1,898-907. Terasawa, H , Kohda, D., Hatanaka, H , Tsuchiya, S , Ogura, K , Nagata, K , Ishn, S., Mandiyan, V., Ullrich, A , Schlessmger, J., and Inagaki, F (1994) Structure of the N-terminal SH3 domain of GRB2 complexed with a peptide from the guamne nucleotide releasing factor SOS. Nature Struct Biol 1, 891-897. Lee, C.-H , Saksela, K., Mirza, U. A., Chait, B. T , and Kuriyan, J. (1996) Crystal structure of the conserved core of HIV-l Nef complexed with a Src family SH3 domain. Cell 85,93 l-942
30
Lee, Cowburn, and Kuriyan
61. Lee, C.-H., Leung, B., Lemmon, M A , Zheng, J , Cowburn, D , Kuriyan, J , and Saksela, K. (1995) A single ammo acid m the SH3 domain of Hck determines tts high affinity and specificity m binding to HIV-l Nef protein. EMBO J 14, 5006-5015. 62 Cheng, G , Ye, Z. S , and Baltimore, D. (1994) Bmdmg of Bruton’s tyrosme kmase to Fyn, Lyn, or Hck through a Src homology 3 domain-mediated mteraction. Proc Nat1 Acad. Scz USA 91,8152-8155. 63. Rtckles, R., Botfield, M. C., Weng, Z., Taylor, J., Green, 0. M., Brugge, J., and Zoller, M. J. (1994) Identification of Src, Fyn, Lyn, PI3K, and Abl SH3 domain hgands using phage display libraries EMBO J X3,5598-5604 64. Knudsen, B , Zheng, J., Feller, S. M., Mayer, J. P., Burrell, S. K., Cowburn, D , and Hanafusa, H (1995) Affinity and specificity requirements for the first Src homology 3 domain of the Crk protein. EMBO J 14, 2191-2198 65 Wu, X , Knudsen, B., Feller, S. M., Zheng, J., Sah, A., Cowburn, D , Hanafusa, H , and Kuriyan, J (1995) Structural basis for the specific interaction of lysmecontaming prolme-rich peptides with the N-terminal SH3 domain of c-Crk. Structure 3,2 15-226. 66. Feng, S., Kasahara, C , Rtckles, R. J., and Schretber, S. L. (1995) Specific mteractions outside the prolme-rich core of two classes of Src homology 3 hgands Proc: Natl. Acad Scl USA 92, 12,408-12,415. 67. Trono, D (1995) HIV accessory proterns. leading roles for the supportmg cast Cell 82, 189-192. 68 Saksela, K , Cheng, G., and Baltimore, D (1995) Prolme-rich (PxxP) motifs m HIV- 1 Nef bmd to SH3 domains of a subset of Src kmases and are required for the enhanced growth of Nef+ vu-uses but not for down-regulation of CD4. EMBO J 14,484-49 1 69. Grzesiek, S , Bax, A., Clore, G. M., Gronenborn, A. M., Hu, J -S., Kaufman, J , Palmer, I., Stahl, S J., and Wmgfield, P. T. (1996) The solution structure of HIV1 Nef reveals an unexpected fold and permits dehneation of the bmdmg surface for the SH3 domain of Hck tyrosme protem kmase. Nature Struct Blol 3, 340-345. 70 Alexandropoulos, K and Baltimore, D. (1996) Coordinate activation of c-Src by SH3- and SH2-binding sites on a novel pl30Cas-related protein, Sin Genes Dev 10,1341-1355 71 Abrams, C S. and Zhao, W (1995) SH3 domains spectfically regulate kmase activity of expressed Src family proteins J Bzol. Chem 270,333-339. 72. Superti-Furga, G. and Courtnetdge, S. A (1995) Structure-function relationships in Src family and related protem kmases. Bzoessays 17, 321-330 73 Weiss, A. (1993) T Cell Antigen Receptor Signal Transduction. A Tale of Tads and Cytoplasmic Protein-Tyrosme Kmases.Cell 73,209-212. 74 Wange, R. L , Malek, S N , Desiderio, S., and Samelson, L. E (1993) Tandem SH2 domains of ZAP-70 bmd to T cell antigen receptor zeta and CD3 epsilon from activated Jurkat T cells. J Bzol Chem 268, 19,797-19,801.
Peptide Recognition Mechanisms
31
75. Isakov, N , Wange, R L , Burgess, W H , Watts, J D., Aebersold, R., and Samelson, L. E (1995) ZAP-70 binding specificity to T cell receptor tyrosinebased activation motifs. the tandem SH2 domains of ZAP-70 bind distinct tyrosme-based activation motifs with varying affinity J Exp Med 181,375-380 76 Feng, G.-S., Hut, C.-C., and Pawson, T. (1993) SHZcontammg phosphotyrosme phosphatases as a target of protein-tyrosine kmases. Sczence 259, 1607-1614 77. Wolfgang-Vogel, Lammers, R., Huang, J., and Ullrich, A. (1993) Activation of a phosphotyrosme phosphatase by tyrosme phosphorylatton. Science 259, 1611-1614 78 Dechert, U , Adam, M., Harder, K W., Clark-Lewis, I., and Jrrrk, F (1994) Characterization of protein tyrosme phosphatase SH-PTP2. Study of phosphopepttde substrates and possible regulatory role of SH2 domams. J Bml Chew 25, 5602-5611. 79. Sugimoto, S , Lechleider, R. J , Shoelson, S. E., Neel, B G., and Walsh, C. T (1994) Expression, purtficatton and characterization of SH2-contammg protein tyrosine phosphatase, SH-PTP2. J. Biol Chem 268,22,77 l-22,776. 80 Lechletder, R. J., Sugtmoto, S , Bennett, A. M., Kashtshran, A. S , Cooper, J A., Shoelson, S. E , Walsh, C T., and Neel, B. G (1993) Acttvatron of the SH2contammg phosphotyrosme phosphatase SH-PTP2 by its binding site, phosphotyrosine 1009, on the PDGF receptor. J Biol Chem 268,21,478-21,481. 8 1 Krauhs, P. (1991) MOLSCRIPT: A program to produce both detailed and schematic plots of protein structures J Appl Crystallogr 24,946-950 82 Noble, M. E. M., Musacchto, A., Saraste, M., Courtneidge, S. A , and Wterenga, R. K (1993) Crystal structure of the SH3 domam m human Fyn; compartson of the three-dimensronal structures of SH3 domains m tyrosine kmases and spectrm EMBO J 12,2617-2624.
2 Protein-Protein
Interactions
in Signaling
Cascades
Bruce J. Mayer 1. Introduction The past decade has seen an explosion m our understanding of the mechamsms underlying the transmission of signals from outside the cell, and the ways m which those signals are interpreted and integrated within the cell. This progress comcides with an appreciation that regulated, stable protein-protein interactions are of central importance to signal transduction (see refs. I and 2) In the space of a few short years, the way m which we look at these processes has changed in a fundamental way from an emphasis on the regulation of enzymes and their substrate specificities to a new emphasis on the regulation and specificity of protein-bmdmg surfaces. We now appreciate that the cell is less like an aqueous solution m a test tube and more like a dense gel of interacting proteins, where the actual activity of an enzyme is as dependent on its binding partners and subcellular localization as it is on the kinetic parameters of its catalytic activity. Early biochemical work on metabolic pathways had emphasized concepts of pathways and cascades, m which one step leads to subsequent steps m a relatively linear fashion, often with amplification of a signal. These concepts often proved inadequate, however, when applied to the mechanisms of signal transduction. A good illustration is the case of receptor tyrosine kmases. In the early 1980s it was discovered that the receptors for many mitogenic growth factors, such as the epidermal growth factor (EGF), were transmembrane protein-tyrosme kinases. It seemed obvious that the key to understanding signal transmission would be to find and identify the substrate proteins phosphorylated by the liganded receptors, which must surely be the effecters responsible for stimulating the cell to proliferate. When lysates of growth-factor stimu-
From
Methods
m Molecular
Bfology,
Edlted by D Bar-Sagt
Vol
84
0 Humana
33
Transmembrane
Sgnalmg
Press Inc , Totowa,
NJ
Protocols
Mayer lated cells were analyzed with phosphotyrosme-specific antibodies, however, a problem arose. By far, the most promment tyrosme-phosphorylated protem was found to be the receptor itself. Clearly this was mconslstent with models in which the receptor mmates a signalmg cascade by phosphorylatmg many substrate proteins. What has become apparent is that the key to signal transmission m this case is the creation of bmdmg sites on the receptor, via autophosphorylation, for proteins containing Src homology 2 (SH2) domains; it is unclear whether the receptor needs to phosphorylate any protein other than itself to initiate mitogemc signalmg. From such studies, a new paradigm emerged m which an enzyme’s predominant function can be to alter its bmdmg activities in response to ligand. When closely
exammed
even “classical”
signaling
pathways
reveal the crltl-
cal importance of stable and regulated protein-protein interactions. Among the best understood signalmg cascades are those mediated by heterotrimeric G proteins (3). In the P-adrenergic pathway, for example, an agonist-stimulated receptor activates many molecules of a heterotrimeric G protein, each of which can then activate a molecule of the enzyme adenyl cyclase. The resultmg rise m mtracellular cychc adenosine monophosphate (CAMP) in turn activates many molecules of protein kinase A, which then phosphorylate many intracellular proteins on serine and threomne residues. The details of this relatively simple signaling apparatus reveal at least five critical protein-protein Interactions: The heterotrimeric G protein binds to the hganded (but not the unliganded) receptor; conformational changes brought about by receptor bmdmg and concomitant guanosine diphosphate (GDP) release and guanosine triphosphate (GTP) bmdmg induce the dissociation of the a-subunit of the G protein (G,) from its p and y-subunits (Gay), and from the hganded receptor; the released G, subunit binds to and activates the cyclase; meanwhile Gpy binds to and relocahzes the P-adrenergic receptor kmase (P-ARK), leading to receptor phosphorylation and desensmzatron; and finally, CAMP binding causes the drssocration of the regulatory subunit of PKA, thereby releasing the active catalytic subunit. Although enzymes (kinases, GTPases) are involved, it is obvious that changes m protem-protein interactions play a central role in signal transmission. Much of this volume is devoted to the many techniques now used to analyze protein-protein interactions. Such mteractions are now appreciated to be so important to understandmg the function of signalmg proteins that often one of the first experiments performed on a newly identified protein is a search for interaction partners. In this chapter, I briefly consider specificity and regulation of binding mteractions, review some of the classes of well-known protein-protein interactions known to be mvolved m intracellular signaling, and discuss how the significance of a particular interaction can be assessed.
interactions in Signaling Cascades
35
2. Specificity Two of the defining parameters of protein-protem mteractions are specificity and whether that specificity can be regulated. Specificity is, of course, a function of both the affinity for target sites and the affinity for “nonspeclftc” sites. In cases where specificity is very high for a single target molecule (for example, the regulatory subunit of PKA for its catalytic subunit), we might term the two proteins subunits of a holoenzyme. Clearly, however, there is no fundamental difference between such an interaction and one that is somewhat less specific, for example, the bmdmg of the same heterotrimeric G-protem P-subunit to several different a- and ‘y- subumts, or one that is much less specific, for instance, the binding of an Src homology 3 (SH3) domain to prolmerich sites m tens to hundreds of different protems. Specificity is usually thought of either m terms of dissociation constants or, in a more practical sense, of signal-to-background (e.g., a specific association gives a dark plaque or a blue colony in a sea of light plaques or colonies). It is worth thmkmg of specificity a bit more carefully m terms of concentrations of protems in a cell. A protein that represents l/10,000 of total-cell protein is present in the cytosol at a concentration on the order of 10M7M, simplistically, for two Interacting proteins at this level of abundance, the dissociation constant for the complex would have to be submicromolar for a significant amount of the complex to exist m VIVO. Dissociation constants for known complexes are usually in this range, for example 10d9 M for the assoctatton of the regulatory and catalytic subunits of PKA, and 1O-8-1O-7 M for complexes of SH2 domains with tyrosine-phosphorylated targets. Significant mteractions can certainly have less impressive dissociation constants, however; mdividual SH3 domain-peptide mteractions usually have affinities m the range of 10” to 10e5 M, but the presence of multiple-bmdmg sites and multtple SH3 domains in many actual bmdmg partners probably raises the overall affinity by mcreasing the avidity of binding. An extreme example is actin, for which the Kd for binding of monomers to the end of a filament is -10m5 M, but complex formation (polymerization) is favored because the total intracellular concentration of actm is very high. Regulation of specificity is often (but not always) critical if the complexes are to be important to signalmg. Whereas specific, unregulated protein complexes might be important for function, and are certamly worth knowing about, it is changes m binding that drive signal transduction. This is of practical importance because it can provide an experimental handle to identify mteractions involved in signaling (for example, proteins that bind to a G protem only when it is bound to GTP, and not to GDP, would be candidate-effector molecules).
36
Mayer
Changes m bmdmg specificity can be due to allosteric alterations m one of the binding partners, dependent for example on whether GDP or GTP is bound to a G protein, or to direct changes in the bmdmg site, for example dependent on tyrosine phosphorylatton to create an SH2-binding site. Obviously there are many cases m which such distmcttons are blurred; in one example, phosphorylation of the p47phox protein results m the dissolution of an intramolecular SH3-prolme-rich mteraction, thereby freeing both the SH3 domains and the proline-rich SH3-bmdmg site of p47phox for mteraction with other proteins m trans (4,5). This cisltrans swatch is critical for generating the oxidative burst m phagocytes.
3. Protein-Binding
Modules Involved
in Signal Transduction
It is now clear that not only are protein-protem mteractions important for signaling, but that many signalmg proteins contam recogmzable modules that confer bmdmg activity (Table 1). This 1s indeed fortunate, because it allows us m many cases to predict what type of bindmg mteracttons to expect based on the amino acid sequence of a novel protein. Such a modular system makes sense from an evolutionary point of view, in that domams can be shuffled and existing interaction pairs fine-tuned during evolution so that specific-binding surfaces don’t need to arose independently for each pan of interacting proteins. In this chapter, some relatively well-characterrzed intracellular-binding modules will be summarized. Protein-interaction modules that are recognizable by sequence similarity fall into two overlapping classes. First there are those such as the SH2 and SH3 domains, which are independently folding units that confer a characteristic and specialized type of binding interaction (tyrosine-phosphorylated peptides, for example). In these modules, the most conserved residues are those that are directly mvolved in bindmg to ligands. The other broad class are those m which the sequence similarity is owing to a common folded structure but does not necessarily predict the specific type of bmdmg mteraction, for example, WD repeats. Often these motifs are repeated many times in proteins containing them, and may assemble with other repeats mto higher order structures. Such motifs most hkely represent an evolutionary solution to the design problem of small, stable folded domams that can evolve to display variable-surface residues mvolved m specific-bmdmg interactions. An example, which will not be discussed further, is the variety of zinc-bmdmg “fmgers” that mediate protemprotein and protem-DNA interactions, m which metal binding stabilizes compact-folded structures. It should be noted that the list m Table 1 is far from comprehensive, and as our ability to analyze sequence mformatton improves and as three-dtmensronal structural information accumulates, it is likely that many other binding modules will emerge.
Interactions in Signaling Cascades
37
Table 1 Protein-Binding Module
Modules Implicated in Signaling No Repeats/ Core Sizea protein binding site” Regulated?
SH2
-100
l-2
Y(P)nnn
PTB
-160
1
NPxY(P)
SH3
-60
l-3
nxQPx@P
PH
2100
l-2
Ankyrm
33
4-24
or QPx0Pxn Unknown (Gpr; others?) Unknown
3-D structure?C
Tyrosine phosphorylatton Tyrosine phosphorylation Not direct
Many
Unknown
Many
Few Many
Unknown; None phosphorylatton? WD -31 4-8 Unknown Unknown One Armadillo -42 7-13 Unknown Unknown; tyrosme None phosphorylatton7 ONumber of ammo acrdsm module (not mcludmg spacersbetweenrepeats). bMnnmal bindmg site requtred for recogmtron (other residues might be involved m bmdmg to specific examples) Y(P), phosphotyrosme; x, any ammo acid, n, variable residue involved m specificity; a’, hydrophobic ammo acid ‘Number of different high-resolution three-dimensional structures of module available
3.1. SH2 Domains The discovery that SH2 domains bind specifically to tyrosine-phosphorylated peptrdes, but not to the correspondmg unphosphorylated site, focused attentron on the importance of regulated protein-protein interactions in signal transduction. SH2 domains consist of approx 100 amino acids and were first recognized as regions of homology between the Src tyrosme kinase and other distantly related kinases (hence the name Src Homology domain 2, or SH2)
(6). Their importance became apparent in light of several simultaneous discoveries: 1. Many proteins rmphcated m signaling contained SH2 domams; 2 These proteins could often be shown to bind tightly to hgand-activated growthfactor receptors; and 3. Bacterially expressed SH2 domams could be shown to bind to tyrosmephosphorylated proteins, including activated receptors (7-11). We now know that these domains serve a general role in signaling m complex eukaryotes, mediating the relocalization or assembly of SH2-containing proteins m response to changes m tyrosine phosphorylatron (because they are
38
Mayer
both lacking m yeast, SH2 domains and true tyrosine kinases must be relatively recent evolutionary innovations, presumably for dealing with the greater signaling demands of multicellular life). A great deal is known about the structure and binding interactions of these domains, and only a brief summary will be given here. Bmdmg to tyrosmephosphorylated sites is quite tight, with measured affinities in the range of 1O-8-1O-7 A4 (12), and is absolutely dependent on phosphorylation, because bmdmg to unphosphorylated hgands 1sundetectable. Bmdmg 1sdependent only on short peptide sequences and can be mtmtcked using synthetic peptides, so the interaction is largely independent of the larger protein containing a phosphorylated site. There is considerable speciftcity among SH2 domains for different phosphorylated peptide sites, and a degenerate peptlde-library approach allowed the bmdmg specificities of a number of SH2 domams to be determmed (13,14). Specificity was found to be dependent on the three (in rare cases up to five or six) ammo acids C-terminal to the phosphorylated tyrosme, with residues N-terminal to the phosphotyrosme having httle or no effect on binding. However, it should be remembered that all SH2 domains have a detectable affinity for phosphotyrosme itself (indeed, this can be used as a purificatron scheme to isolate SH2 domains), so specificity is relative rather than absolute. Which SH2 domains will bind to a particular site in vivo will depend on the local concentration, as well as the relative affinities of potential bmdmg partners. It has recently been shown that some SH2 domains can also bmd with high affinity to mosnol lipids phosphorylated on the 3’ position (IS), so it 1s worth remembering that protein-binding domains might have hitherto unappreciated activmes that will affect then behavior m vivo. 3.2. PTB Domains A less common domain that also binds tyrosme-phosphorylated sites was found during analysis of the She adaptor protein. She contains an SH2 domam and was known to bind to tyrosine-phosphorylated proteins, but it became apparent that many She-bmdmg sites consisted of an NPxY(P) motif (where Y(P) represents phosphotyrosme) quite different from known SH2-bmdmg sites. It was ultimately shown that binding to these sites mapped to an approx 160 ammo acid regton of She (termed the PTB [phosphotyrosine binding] domain) with no sequence homology to the SH2 domain (16-19). Apparent affinity for NPxY(P) peptides is m the range of 10e6 M (19,20), but because very few PTB domains have been Identified, the range of target specifrcmes and affinities is unknown. The degree of sequence similarity among PTB domains is weak, making tdenttfication from sequence problematrc; the IRS-l PTB was only identified by virtue of its binding activity (18,20). The tertiary structure of the She PTB is virtually identical to that of the PH domain (21)
interactions m Signaling Cascades
39
(dtscussed in Subheading 3.4.), so it is possible that the few known cases are actually a specialized subset of the larger PH-domain family.
3.3. SH3 Domains These small interaction modules were first identified in signaling proteins as a region of homology to the Src kinase, as m the case of the SH2 domain. They have subsequently been found in a wide range of protems including in yeast, in contrast to the SH2 (revtewed m ref. 22). They are often found in the same proteins as SH2 domains, but this does not reflect any structural or functional similarity in the domams themselves but is more likely related to the frequent involvement of these domains in signal-transduction complexes. Indeed, there is a class of proteins termed the SH2/SH3 adaptors that consist entirely of these two domams, and thereby serve as molecular “crosslinkers” to assemble complexes of signalmg protems. SH3 domams bind to short, prolme-rich bindmg sites in proteins (23-25). From structural studies and work using peptide libraries, it is known that the binding site consists of three turns of a left-handed prolinehelix, and that SH3 domains can bind ligands m either and N-C or a C-N terminal orientation, owing to the pseudosymmetry of the proline- helix (reviewed in ref. 26). Most SH3 domains bmd to core sites with the consensus +X@PX@P (class 1) or @PXQPX+ (class 2) where + represents a basic residue, 0 represents a hydrophobic residue, and X can be any amino acid. There is considerable specificity among different SH3 domains for different binding sites, but as in the case of SH2 domams the differences m affinity between high- and low-affinity sites can be quite small, so it is difficult to predict a priori which specific sites might bind in VIVO. Affinities are generally quite modest, with Kds m the range of 10-6-10-5 Mfor specific SH3-peptide interacttons. The best characterized role for the SH3 domain is m recruitmg the Ras exchange-factor SOS to the membrane leading to the activation of Ras (27). In flies and nematodes, this has been shown to be mediated by the SH2/SH3adaptor protein Grb2, whtch contains one SH2 and two SH3 domains. It is thought that SOS and Grb2 exist as a preformed complex in the cytoplasm, and that this complex is recruited to the membrane by binding of the Grb2/SH2 domain to phosphorylated sites generated by activated growth-factor receptors. As in this case, SH3-mediated binding in general has not been shown to be directly regulated. It is more likely that in most cases these domains bind constttutively, functioning as an intracellular adhesive and not as a switch. As mentioned m the previous section, however, there are examples such as p47phox where phosphorylation of a protein can allosterically regulate the availability of its SH3 domains and/or proline-rich target peptides.
40
Mayer
3.4. PH Domains This widely distributed and diverse class of protein modules was first tdentified in the platelet protein pleckstrin as a repeated segment, and was subsequently found by sequence comparison in a number of other proteins (28-30). Sequence identity among different pleckstrin homology (PH) domains is quite low (in the 20% range in many cases), making identification from primary sequence difficult. The size of the domain ranges up from -100 amino acids and varies considerably, owing to msertions m variable-loop regions. The three-dimensional structures of a number of PH domains have now been solved revealing that then overall folds are very similar (31), although the variable loops are likely to make the surface properties of different PH domains quite variable. All PH-domain structures currently available reveal a highly polarized electrostatic potential that may favor binding to membranes via the positively charged portion of the domain. The jury is still out on whether PH domains as a class mediate proteinprotein mteractions. The PH domain of P-adrenergic receptor kinase (P-ARK) has been shown to mediate binding to the P-r subunits of heterotrimeric G proteins (hence relocahzing P-ARK to the membrane in proximity to its substrate, the P-adrenergic receptor). However mutagenesis has shown that Gpy binding is confined to a long C-terminal alpha helix of the PH domain, and that most of the domain is, in fact, dispensable for bmdmg (32). On the other hand, several PH domains have been shown to bmd to polyphosphorylated mositols and mositol lipids with moderate affinity, and this may prove to be the more general role for PH domains in signalmg (33). In one case, the PH domain of PLC-6, the affinity for Ins (1,4,5) Pa is very high (&=210 nM) (34), but this appears to be an exception. The wide diversity of PH domains, and the fact that PTB domains (above) have a virtually identical fold but quite different binding specificity, suggest that the PH domain might be more properly described as a folding scaffold that has been adapted for many uses. Like different immunoglubulins, different PH domains might therefore bmd widely divergent ligands, which include both proteins and nonprotem molecules.
3.5. Ankyrin Repeats Ankyrm repeats were first identified as a repeating motif m the membranematrix protein ankyrm, and have subsequently been identified by sequence similarity m a wide variety of proteins, including a few prokaryotic and extracellular examples (35). The repeat itself consists of 33 residues and is always present m at least 4 (and up to 24) tandemly repeated copies. This small size and the presence of multiple copies suggest that mdividual repeats are relatively unstable and that multiple repeats fold mto a more stable higher order structure.
Interactions in Signaling Cascades
41
Many ankyrm-repeat proteins are known to participate m protein-protem mteractions, with perhaps some of the best examples being ankyrin itself (which binds to the anion transporter, Na/K adenosine triphosphatase [ATPase], tubulin, and the sodium channel) (36) and the inhibitory subunits of the NF-KB family of transcrtption factors that bmd to and inhibit the activity of the DNA-binding subunits (37). Phosphorylation has been shown to diminish binding of the inhibitor I-KB to NF-KB (38), but it is not known whether this is a general property of ankyrin repeat-mediated interactions. Because no sequence or functional similarity 1s apparent when known bmdmg proteins are compared, it is likely that the binding specificity of ankyrm repeats is conferred by variable-surface residues. A high-resolution structure of an ankyrin repeat-containing protein would be extremely useful to identify residues involved in binding mteractions.
3.6. WD Repeats WD repeats (so named for the characteristics tryptophan-aspartate [WD] dipeptide often found at then C-terminal border) were origmally noted m the P-subunits of heterotrtmertc G protems, and have subsequently been found m a wide spectrum of eukaryotic proteins mvolved in signaling, vesicle traffic, RNA processmg, and many other functions (39). A common thread is that most, if not all, of these protems are likely to be involved in the assembly of proteinprotein complexes. The repeats each consist of approx 3 1 residues with a vartable spacer between repeats, and are present between four and eight times in all known examples. The recent solution of the three-dimensional structure of the heterotrimeric G-protein P-subunit (together with its y-subunit in the presence and absence of the GTP-binding a-subunit) has revealed the structural organization of the repeat (4042). Each repeat forms a compact beta-sheet structure that forms a blade of a so-called P-propeller, which in the case of the Ga consists of seven blades. The conserved residues of the WD repeat are involved m inter- and intrablade interactions, so it is likely that all other WD-repeat proteins will form similar P-propeller structures. As might be expected, the residues involved in binding to the a-subunit or to effector proteins are localized on the surface in positions that are not conserved among disparate WD repeats. The dissociated Pr subunits of heterotrimeric G protems can function as effecters by binding to and modulating the activity of downstream stgnalmg proteins (3). This binding activity is regulated by the a-subunit because the effector-binding regions are sterically blocked by G, bmdmg; GDP release and GTP binding induce drastic conformational changes in the a-subunit, leadmg to the dissociation of the p--r subunits, and thereby making them able to bind their effecters (40-42). This is an excellent example of the wealth of func-
Mayer tronal mformation about whole classes of proteins that can be gleaned from a single three-dimensional structure.
3.7. Armadillo Repeats Another repeating motif imphcated in protein-protein association is the armadillo or “Arm” repeat, origmally identified in the armadillo protein implicated m the wingless-signaling pathway m Drosophzla (43). These repeats are found m mtercellular lunctton components such as p-catemn and plakoglobm, as well as several other proteins including the product of the tumor suppressor gene APC, nuclear pore protein SRPl, and smgGDS, a guanine-nucleotide exchange factor for small GTPases (44,45). The repeat consists of approx 42 residues, and is present m 7-13 copies in known examples. As m the case of the ankyrm repeat, it is likely that the Arm repeat encodes a structural scaffold that assembles together with other repeats, but confirmation of this awaits a three-dimensional structure. It IS known that several Arm-containing proteins can be tyrosine phosphorylated, raising the possibility that phosphorylation may directly or mdn-ectly affect their binding activity.
4. Is a Binding
Interaction
Significant?
Perhaps the most vexing question facing those of us working on signaling pathways 1s whether a potential interaction is significant. Because sequence inspection leads to predictions about potential interaction partners, and because the techniques for detecting potential interactions are so sensitive, there are often not one or two but hundreds of candidate-binding proteins for any given protem of interest. In some cases, this may actually reflect the messy reality that the protein of interest partitions among many different complexes m the cell, each of which might be important to some aspect of that protein’s function. But how can we evaluate the significance of any single proposed interaction? The problem 1s one of establishing the relationship between in vitro- (or in the case of two-hybrid screening, m yeast-) bmdmg data to the biological properties of the proteins m their normal cellular environment. Specific controls for different methods of detectmg potential interactions wrll be detailed m the following chapters, but it is worth considering some criteria at this time. At the very least, the two proteins should be present m the cell m the same subcellular compartment at a suitable concentratton for the interaction to occur. This would seem to require some detailed knowledge of the dissociation constant and the concentratron m various compartments, but in fact it can be quite easy to get the rough estimates of these parameters needed to evaluate an mteraction For example, if two interacting proteins are of very low abundance (a few thousand molecules per cell), and the apparent dissociation constant from simple m vitro-
Interactions in Slgnahng Cascades
43
bmdmg studies using recombinant protems 1s greater than 10m6M, the interaction is unlikely to occur m VIVO. But d immunofluorescence suggests that the two proteins are colocallzed mto a small fraction of the total volume of the cell (at the plasma membrane, for example, or at focal adhesions), it still might be possible for the interaction to be favored, owing to high local concentration. Coimmunoprecipitation of two proteins 1s often taken as strong evidence of in vivo binding, because the greater volume in the lysate relative to the intact cell and the repeated washing of the immune complexes would seem to ellmlnate all but the tightest mteractlons. Several caveats must be kept m mind, however. First, it 1s important to know what fraction of the total colmmunoprecipitating protein is associated with the complex, because the high sensitlvlty of detection (usually by lmmunoblotting of the immune complexes) means that a tiny fraction of the total pool of protem can be detected. It should also be kept m mind that by lysmg the cell m detergent-containing buffers, proteins that are normally in different subcellular compartments are mixed, and that the detergent can change binding properties relative to the Intracellular environment. The concentration of the protem of mterest vs concentrations of other competing cellular components should also be considered. Many papers present convincing evidence of assoclatlon between two proteins when one or both is highly overexpressed, as in comfected insect cells or transiently transfected tissue-culture cells. However, the extremely high levels of expression and concomitantly high intracellular concentrations mean that mteractlons might be favored that would not be seen at m vlvo levels of abundance. The most extreme example of this type of bias 1s when two purified protems are shown to interact m vitro. The “sticky” nature of proteins in general, especially in purified form where some may be partially denatured and aggregated, means that such results are meaningful only when very carefully controlled; for example, where bmdmg does not occur under the same condltlons with a point mutant predicted from genetics or structural studies to abolish bmdmg actlvlty. Experimental techniques that assay specific binding, under condltlons m which all potential binding partners are present at their in vivo levels of abundance relative to other cellular proteins, complement approaches using overexpressed or purlfled bmdmg partners. For example, a purified protein can be used to “fish” a total-cell lysate for bmding partners by affinity chromatography and the bound proteins displayed by staining or metabolic labeling. Another example would be “far-Western” filter-bmdmg assays where totalcell lysates are separated on sodium dodecyl sulfate (SDS) gels, transferred to nitrocellulose, and probed with purified proteins. In such experiments, all proteins in the cell lysate compete for binding at their natural relative level of abundance. The observation that this type of assay is often quite dirty owing to
44
Mayer
nonspecific binding to abundant proteins is sobermg when considered m light of coprecipitatton experiments as discussed above. In practice, many of the background bands might be eliminated by appropriate controls, and a protem that speciftcally binds to the protein of interest m such an assay 1slikely to be stgmficant. In a somewhat different way, interactions identified by screening expression libraries or via yeast two-hybrid screens have a good chance of being significant, because many thousands of plaques or colonies score negative for each that scores positive. It must be remembered, however, that potential binding proteins are being highly overexpressed, either m yeast or more extremely m phage plaques; this allows detection of interactions that might not occur at m vtvo levels of abundance. These assays, therefore, are biased toward tdentification of high-affinity binders, as opposed to those discussed in the previous paragraph which are biased toward high-abundance binders. In the case of yeast systems, libraries under the control of low copy-number plasmids will help in this regard. Genetics is perhaps the most unambiguous and unbiased test of sigmficance, where mutation or deletion of one protein can be shown to have phenotypic effects that are dependent on the interacting partner. It was genetic analysts that demonstrated the importance of Grb2-Sos interactions in activating Ras, and these results greatly strengthened in vitro biochemical data showmg that Grb2 and SOS could bind to each other. Unfortunately, tt is often difficult, if not imposstble, to test the importance of a proposed mteraction genetically, so pseudogenetic approaches using dominant mhtbttory mutants have become popular. These experiments are based on the prmciple that, d a recombmant protein is highly overexpressed via an expression vector, it will compete with its endogenous counterpart for bmding to other cellular proteins. If the exogenously derived protein is designed so that tts binding domain IS intact, but other functions (catalytic activity, for example) are impaired, then normal signaling through endogenous proteins that bind to the mutant will be blocked These approaches are useful, but must be interpreted carefully. One potential pitfall 1s illustrated by a situation where the overexpressed protein competes away not only its endogenous counterpart, but other more important endogenous protems that might bmd to the same site. For this reason, the effect of dominant negative mutants 1s best interpreted in comparison to overexpression of the wild-type protem. 5. Prospects The advent of powerful approaches to isolate bmdmg partners for mteracting proteins and the avatlabrhty of high-resolutton three-drmensronal Images of such interacting proteins has opened a fruitful approach to understanding stgnalmg pathways. Often the most efficient way to work up or down signaling pathways is through the identification of bmdmg partners. The next several
Interactions in Signaling Cascades
45
years should expand and deepen our understanding of the posstble types of binding interactions, and allow us to predict from the primary structure of a novel protein not only its catalytic or structural functions, but also its interrelationships with other proteins and other signaling pathways. The complexity of mtracellular signaling networks wtll surely rival the complexity of neural networks in the brain, and we must hope that, by understanding the rules governing the connectivity of the system, we will come to understand its overall logic.
References 1. Pawson, T. (1995) Protem modules and stgnallmg networks. Nature 373, 573-579. 2 Cohen, G. B. and Baltimore, D (1995) Modular bmdmg domains m signal transduction proteins. Cell 80,237-248 3 Neer, E J (1995) Heterotrtmertc G proteins. organizers of transmembrane stgnals. Cell 80,249-257. 4 Fman, P., Shtmtzu, Y , Gout, I , Hsuan, J., Truong, O., Butcher, C., Bennet, P., Waterfteld, M. D , and Kelhe, S (1994) An SH3 domam and prolme-rtch sequence mediate an mteractton between two components of the phagocyte NADPH oxtdase complex J Btol Chem 269, 13,752-13,755 5 Sumtmoto, H , Kage, Y , Nunor, H , Sasakt, H , Nose, T , Fukumakt, Y , Ohno, M , Mmakamt, S , and Takeshtge, K. (1994) Role of src homology 3 domains m assembly and acttvatton of the phagocyte NADPH oxidase Proc Nut1 Acad Scz USA 91,5345-5349 6 Sadowski, I., Stone, J C , and Pawson, T (1986) A noncatalytrc domain conserved among cytoplasmrc protein-tyrosme kinases modiftes the kmase functton and transformmg acttvtty of fuJmamt sarcoma virus P130RaR-fifp”. Mel Cell Bzol 6, 4396-4408. 7. Anderson, D , Koch, C A , Grey, L., Ellis, C., Moran, M. F., and Pawson, T. (1990) Bmdmg of SH2 domains of phospholipase Cyl, GAP, and src to activated growth factor receptors Science 250,979-982. 8 Margohs, B., Lt, N , Koch, A , Mohammadt, M., Hurwttz, D R , Ztlberstem, A , Ullrtch, A , Pawson, T , and Schlessmger, J. (1990) The tyrosme-phorphorylated carboxytermmus of the EGF receptor 1sa bmdmg site for GAP and PLC-y EMBO J 9,4375-4380
9 Matsuda, M , Mayer, B J , Fukut, Y , and Hanafusa, H (1990) Bindmg of transforming protein, P47”“R-““, to a broad range of phosphotyrosme-containing proteins. Science 248, 1537-1539. 10 Mayer, B J., Jackson, P K , and Baltimore, D. (1991) The noncatalyttc src homology region 2 segment of abl tyrosme kinase bmds to tyrosme-phosphorylated cellular protems with high affinity. Proc Nut1 Acud Scz USA S&627-73 1 11 Moran, M F , Koch, C A , Anderson, D , Ellis, C , England, L , Martm, G S , and Pawson, T (1990) Src homology region 2 domams dnect protein-protein mteracttons m signal transductton. Proc Nut1 Acad Scz USA 87,8622-8626
46
Mayer
12 Ladbury, J. E , Lemmon, M. A , Zhou, M , Green, J., Botfield, M. C., and Schlessmger, J. (1995) Measurement of bmdmg of tyrosyl phosphopepttdes to SH2 domains: a reappraisal. Proc Natl. Acad Scz USA 92,3 199-3202 13. Songyang, Z , Shoelson, S E., Chaudhurr, M., Grsh, G , Pawson, T., Haser, W. G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R J., Neel, B. G., Barge, R. B , FaJardo, J. E., Chou, M. M , Hanafusa, H , Shaffhausen, B., and Cantley, L C (1993) SH2 domams recognize specrftc phosphopeptrde sequences. Cell 72,
767-778 14. Songyang, Z , Shoelson, S E , McGlade, J., Ohvter, P., Pawson, T , Bustelo, X. R., Barbacid, M , Sabe, H , Hanafusa, H , Yi, T , Ren, R , Baltimore, D., Ratnovsky, S , Feldman, R A , and Cantley, L C (1994) Specific motifs recognized by the SH2 domams of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk, and Vav. Mel Cell Blol 14,2777-2785 15. Rameh, L. E , Chen, C -S , and Cantley, L. C (1995) Phosphatidylinositol (3,4,5)P, interacts with SH2 domains and modulates PI 3-kmase assocratron with tyrosme-phosphorylated proteins Cell 83,821-830. 16 Kavanaugh, W. M and Wtlhams L T (1994) An alternative to SH2 domains for binding tyrosme-phosphorylated proteins Sczence 266, 1862-1865. 17. Blatkie, P , Immanuel, D., Wu, J., Li, N., YaJnik, V., and Margohs, B. (1994) A region m She distinct from the SH2 domain can bmd tyrosme-phosphorylated growth factor receptors. J Blol Chem 269,32,03 l-32,034 18 Gustafson, T A , He, W., Craparo, A , Schaub, C. D , and O’Netll, T J (1995) Phosphotyrosme-dependent Interaction of SHC and insulin receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domam Mol Cell Blol 15,2500-2508. 19 van der Geer, P., Wiley, S , Ka-Man Lai, V , Ohvter, J. P., Gtsh, G. D , Stephens, R , Kaplan, D., Shoelson, S., and Pawson, T (1995) A conserved ammo-terminal She domain binds to phosphotyrosme motifs m activated receptors and phosphopeptrdes. Curr Blol 5,404-412. 20 Wolf, G., Trub, T., Ottmger, E., Groninga, L , Lynch, A , Whtte, M. F., Miyazakr, M , Lee, J., and Shoelson, S E (1995) PTB domams of IRS-l and She have distinct but overlapping bmdmg specrfxtttes. J Bzol Chem 270,27,407-27,410 21 Zhou, M -M., Ravrchandran, K. S., OleJniczak, E T , Petros, A M , Meadows, R P , Harlan, J. E , Wade, W S , Burakoff, S. J., and Fesrk, S W (1995) Structure and ligand recognition of the phosphotyrosme bmdmg domam of She Nature (London) 92,7784-7788 22. Musacchio, A , Gibson, T., Lehto, V -P , and Saraste, M (1992) SH3-an abundant protein domain m search of a functton. FEBS Lett 307,.55-61, 23 Gout, I., Dhand, R., Hues, I D , Fry, M. J., Panayotou, Z , Das, P., Truong, O., Totty, N. F., Hsuan, J., Booker, G. W., Campbell, I D , and Waterfreld, M. D (1993) The GTPase dynamin binds to and is activated by a subset of SH3 domains.
Cell75,25-36. 24 Ren, R , Mayer, B. J., Crcchetti, P., and Baltimore, D. (1993) Identification IO-ammo acid prolme-rich
SH3 bmdmg sue Sczence 259, 1157-l 161
of a
Interactions in Signaling Cascades
47
25 Yu, H , Chen, J. K , Feng, S., Dalgarno, D C , Brauer, A. W , and Schreiber, S. L (1994) Structural basis for the bmdmg of prolme-rich peptides to SH3 domams. Cell 76,933-945. 26 Mayer, B. J and Eck, M J (1995) Mmdmg your p’s and q’s. Curr Bzol 5, 364-367 27. McCormick, F (1993) How receptors turn ras on Nature (London) 363, 15-16 28. Mayer, B. J., Ren, R , Clark, K. L., and Baltimore, D. (1993) A putative modular domain present m diverse signaling proteins. Cell 73,629-630 29 Haslam, R J , Koide, H B , and Hemmings, B A (1993) Pleckstrm homology domain. Nature 363,309-3 10 30. Musacchio, A., Gibson, T , Rice, P , Thompson, J., and Saraste, M. (1993) The PH domain: a common piece m the structural patchwork of signallmg proteins. Trends Blochem Scz l&343-348. 31 Ferguson, K M , Lemmon, M A., Sigler, P. B , and Schlessmger, J (1995) Scratching the surface with the PH domam. Nature Struct Bzol 2,7 15-7 18. 32. Touhara, K., Inglese, J., Pitcher, J. A , SHaw, G., and Lefkowttz, R. J. (1994) Bmdmg of G protein beta gamma subunits to pleckstrm homology domains J Blol Chem 269, 10,217-10,220 33 Harlan, J E , HaJduk, P. J , Yoon, H. S., and Fesik, S. W (1994) Pleckstrm homology domains bmd to phosphatidylmositol4,5-bisphosphate. Nature (London) 371,168-170 34 Lemmon, M A , Ferguson, K M., Sigler, P. B , and Schlessmger, J. (1995) Specific and high-affinity bmdmg of mositol phosphates to an isolated pleckstrm homology domain. Proc Nat1 Acad Scz USA 92, 10,472-10,476. 35. Bork, P. (1993) Hundreds of ankyrm-like repeats m functionally diverse proteins: mobile modules that cross phyla horizontally? Protezns 17, 363-374 36. Lambert, S. and Bennet, V. (1993) From anemia to cerebellar dysfunction. a review of the ankyrm gene family Eur J Bzochem 211, l-6. 37 Liou, H. C. and Baltimore, D (1993) Regulation of the NK-KB/rel transcription factor and IKB mhibitor system. Curr Opwz Cell Bzol 5,477-487 38 Ghosh, S and Baltimore, D. (1990) Activation m vitro of NF-KB by phosphorylation of its Inhibitor. IKB Nature (London) 344,678-682 39. Neer, E. J , Schmidt, C J., Nambudripad, R , and Smith, T. F. (1994) The ancient regulatory-protein family of WD-repeat proteins Nature (London) 371,297-300 40 Sondek, J., Bohm, A , Lambrrght, D. G., Hamm, H E , and Sigler, P. B. (1996) Crystal structure of GA protein Bydimer at 2 1A resolution Nature (London) 3379, 369-379 41 Wall, M A , Coleman, D E , Lee, E , Imguez-Lluhi, J A , Posner, B A., Gilman, A G , and Sprang, S R (1995) The structure of the G protein heterotrimer G, alphalbeta,gamma2. Cell 83, 1047-1058 42. Lambnght, D. G., Sondek, J., Bohm, A , Sluba, N. P., Hamm, H. E., and Sigler, P B. (1996) The 2.0 8, crystal structure of a heterotrimeric G protein Nature (London) 379,311-319
48
Mayer
43 Rtggleman, B , Wreschaus, E., and Schedl, P (1989) Molecular analysts of the armadzllo locus uniformly distributed transcripts and a protems with novel internal repeats are assoctated with a Drosophila segment polartty gene Genes Dev 3,96-l 13 44. Petfer, M , Berg, S., and Reynolds, A. B (1994) A repeatmg ammo acid mottf shared by proteins with diverse cellular roles. Cell 76, 789-791, 45. Perfer, M (1995) Cell adhesion and signal transductron. the Armadillo connecnon. Trends Cell Blol 5,224-229.
3 Transmembrane Signaling by Receptor Oligomerization Mark A. Lemmon and Joseph Schlessinger 1. Introduction The coordmatron of cell growth, differentiation, and other activities in a multicellular organism is precisely controlled by a plethora of growth factors or cytokines that achieve then effects upon the cell by bmdmg to specific cellsurface receptors. The majority of these numerous receptors for growth factors and cytokines are bitopic integral-membrane proteins that contain an extracellular ligand-binding domain; a single transmembrane domain that is assumed to be an a-helix; and a cytoplasmic-effector domain (1,2). The cytoplasmiceffector domain may have enzymatic activity, as is the case for the growthfactor receptor tyrosine kinases (I); or it may require interaction with other cytoplasmic-signaling molecules-notably the Janus (JAK) kinases in the case of the cytokine-receptor superfamily (2,3). Over the years, several mechanisms have been suggested for how such bitopic-membrane proteins can transmit signals across the cell membrane upon binding of their cognate ligand (4). Intramolecular mechanisms that have been proposed involve ligand-induced conformational changes that are propagated through the single transmembrane a-helix or alter the association of the receptor with the membrane (a “pushpull” model). Objections to these models are based upon the stability of fully hydrogen-bonded transmembrane a-helices and the ease of deformability of a lipid bilayer. Any alteration in the membrane-spanning helix is likely to be “damped” by the readily deformable membrane that it spans (see ref. 4 for a discussion). In the late 1970s studies employmg fluorescence-photobleaching recovery demonstrated that several growth factors, most notably epidermalgrowth factor (EGF), induce ohgomerization of their specific receptors (5), and that this is necessary for a biological response (6). Yarden and Schlessmger From
Methods
m Molecular
Bology,
Vol
84
E&ted by D Bar-Sag1 0 Humana
49
Transmembrane
3gnakng
Press Inc , Totowa,
NJ
Protocols
50
Lemmon and Schlessinger
subsequently showed that the purified EGF receptor tyrosme kinase undergoes dimerization upon binding to EGF (7), and that the dimeric form of the receptor displays elevated tyrosme kmase activity (8). EGF-induced EGF-receptor dimerization was also demonstrated in intact cells, using chemical crosslinkmg approaches (9,10). As a result of these observations, a model for signal transduction by allosteric receptor oligomerization was proposed (II). This model has since been confirmed for many receptor tyrosine kinases m addition to the EGF receptor, as well as for many of the cytokine receptors. The general ohgomerization model holds that inactive receptor monomers are m equilibrium with active receptor dimers such that, m the absence of ligand, the eqmhbrium greatly favors the monomeric form. Upon hgand binding, the equilibrium is shifted m favor of the activated dimer (which may be a homo- or heterodlmer), with resultant biological effects. In the past 10 yr, our understanding of this process has developed greatly. Where tyrosine kinase activity is a property of the receptor (the receptor tyrosme kmases) or is associated with the receptor (as with JAK kinases bound to cytokine receptors), it appears that hgandinduced receptor oligomerization brings kmase molecules into close proximity such that they can phosphorylate one another. This trans-phosphorylation, together with additional possible conformational alterations upon ohgomerization, leads to stimulation of the kmase activity-coupling receptor oligomerization to receptor activation. In this chapter, we will concentrate primarily on the mechanistic aspects of ligand-induced receptor oligomerization, selecting examples for which the process has been most thoroughly studied. A common theme emerges from these studies, m which multivalent ligand binding provides the driving force to shift the monomer/oligomer equilibrium m favor of the oligomer. There are several variations on this common theme, which appear to be exploited to enhance signal diversity for a given combination of ligands and receptors. Details of the protein-protein interactions that are involved in coupling receptor activatron to the downstream-signaling cascades are discussed in the previous two chapters by Kuriyan and Mayer, respectively.
2. Modes of Ligand-Induced Receptor Oligomerization 2.1. Cytokine Receptor Oligomeriza tion Despite the fact that studies of a receptor tyrosine kinase led to the initial proposal of receptor dimerization as a mechanism for transmembrane signaling, the cytokme receptors have yielded most readily to detailed studies of its mechanism. Cytokme receptors can be separated mto three mam subclasses: type 1, the hematopoietic cytokine receptor family (distinguished by the presence of a WSXWS motif); type 2, the interferon (IFN) receptor family; and type 3, the tumor necrosis factor (TNF) receptor family (12). Signal transduc-
Receptor Oligomeriza tion
51
tion by most of these receptors involves the ligand-induced formation of heteromeric complexes (reviewed in refs. 2 and 3). However, the receptors for human growth hormone (hGH), erythropoietin (EPO), and granulocyte-colony stlmulatmg factor (G-CSF), all of which are type 1 receptors, undergo homodimerizatlon upon bmdmg of their respective ligands. This has facilitated analysis of then- activation mechanisms, and through crystallographic and other studies, hGH-induced dlmerizatlon of its receptor (hGH-R) has provided a structural paradigm for this process.
2.1. I Type 1: Human-Growth
Hormone (hGH) Receptor
HGH is a monomeric cytokme of the 4-helix bundle class (13). Its receptor, hGH-R, is a class I cytokme receptor (14) with an extracellular portion that contains two 7/3-stranded domains, each with similarity to fibronectm type III (FNIII) repeats. Cunningham et al. (1.5) have shown, unexpectedly, using sizeexclusion chromatography (SEC), isothermal titration calorimetry (ITC) and a fluorescence homoquenchmg assay, that dimerization of the hGH-R extracellular domain occurs in a 1.2 (hGH:hGH-R) complex, and that this complex 1s disrupted by the addition of large excesses of hGH. A subsequent X-ray crystallographic study (16) confirmed that a single molecule of hGH binds simultaneously to two molecules of the hGH-R extracellular domain in a dimer that shows approximate twofold symmetry, as depicted in Fig. 1. Both receptor molecules contribute approximately the same set of residues from between then two FNIII domains for interaction with hGH. However, because hGH 1s asymmetric, similar regions on the receptors contact two structurally distinct bmding sites (1 and 2) on the hormone. Site 1 on hGH is the most extensiveburying some 1300 A2 of surface upon interaction with the receptor. Site 2, on the opposite face of hGH, is less extensive and buries just 900 A2 upon receptor bmdmg. As is clearly seen in Fig. 1, there are also significant receptorreceptor contacts m the second of the two FNIII domains, leading to the burial of an additional 500 A2, These observations, together with analysis of binding by mutated forms of hGH, have led to a sequential model for hGH-induced hGH-R dimerlzatlon (15,17). In this model, hGH binds to hGH-R first through site 1, which buries the largest surface, to form a 1: 1 complex. This 1: 1 complex can be generated with hGH variants that are mutated in site 2, but not those that are mutated m site 1 (17,18). The second step involves the assoclation of the 1: 1 (hGH:hGH-R) complex with a second molecule of hGH-R, and involves the cooperation of both receptor-receptor contacts and interactions between site 2 of hGH and the second receptor As predicted by this model, it has proven possible (17) to generate potent antagonists to hGH by making both mutations m site 1 that strengthen interactions between hGH and the receptor,
52
Lemmon and Schlessinger
Fig. 1. Representation of the structure of the complex between hGH and the hGHR extracellular domain (16). All three molecules are represented as backbone worms, and the membrane would be at the bottom of the figure, in a plane perpendicular to the page. hGH is colored light gray, and the two molecules of the hGH-R are darker gray. Receptor binding site (RBS) 1 is on the left of the hGH molecule in the figure, whereas site 2 is on the right. The more extensive nature of the interactions involving site 1 is clear. Receptor-receptor contacts are made between the C-terminal FNIII domains of hGH-R, which are in the lower part of the complex. Coordinates were obtained from the Brookhaven Protein Data Bank, The figure was generated using the program GRASP (92).
as well as mutations in site 2 that reduce receptor binding. Such antagonists will compete efficiently with wild-type hGH for receptor binding via site 1, but are not capable of forming the 1:2 (hGH:hGH-R) complex. Biophysical studies of EPO binding to the extracellular domain of its receptor (19) suggest that EPO receptor homodimerization is induced via a mechanism very similar to that seen for hGH, although the balance between the interaction affinities of site 1 and site 2 is different. The other type 1 cytokine receptor that undergoes ligand-induced homodimerization is the G-CSF receptor. In this case, the monomeric cytokine has been reported to form both 1:2 and 2:2 (G-CSF:receptor) dimeric complexes in different studies (20,221).There have also been many studies aimed at addressing the mechanism of ligandinduced hetero-oligomerization of the other type 1 cytokine receptors. The details of these studies will not be discussed here. In brief, the hetero-oligomers involve one type of subunit that is ligand-specific, together with a second type of common subunit (2). For example, leukemia inhibitory factor (LIF), a
Receptor Oligomerization
53
4-helix bundle monomer (22), binds to the LIF receptor and induces its heterodimertzation with gp130 (although the stoichiometry of the complex is unclear). The complex induced by mterleukm-6 (IL-6) appears more complicated. IL-6 binds to the a-chain of its receptor (IL&-R@, and two 1: 1 (IL-6: IL&R@ complexes m turn bmd to two molecules of gp130, forming a final active stgnaling complex that 1s a hexamer, with a 2:2:2 (IL-6:IL-6-Ra:gp130) ratio (23,24). A modified generic cytokme model (25) suggests that a single cytokine molecule can have up to three receptor-binding sites. One of these binds to a receptor a-chain (such as IL-6-Ra). A second binds to a receptor pcham (such as gp130 or LIF-R), and the third binds to a second P-chain (such as gp 130). The complex may also be stabilized by mteractions between cytokme molecules where more than one is present, and by interactions between the receptor subunits. The complex would be built m a sequential mechanism analogous to that seen with hGH and its receptor (see also refs. 2,3,12, and 23). Figure 2 presents what is probably the most complicated situatton, exemplified by the hexameric complex formed by IL-6. In several cases, no a-chain has yet been identified.
2 1.2. Type 2: Interferon-y (IFN-fi Receptor The class-2 cytokine receptors are distinguished by a particular pattern of cyteines (14), and include the receptors for the mterferons. IFN-y binding to its cell surface receptor (IFN-y-Ra) induces its homodimerization and association with another receptor component, IFN-y-RPl, which is required for signaling through the JAK pathway. The final complex may resemble that seen with IL-6 and its receptor. A view of the mode of IFN-y-induced dimerization of IFN-y-Ra has been provided by an X-ray crystal structure of IFN-y bound to the isolated extracellular domain of the receptor subunit (26). IFN-y is a homodtmeric cytokme, with mterdigitation of the 6 hehces m each protomer. The receptor contains 2 FNIII-like domains that are similar to those seen in the hGH-R, but have a different relative orientation. One IFN-ydimer binds simultaneously to two molecules of IFN-y-Ra, contactmg the region between the FNIII-like domains. Because the IFN-y dimer is symmetrical, it binds identically to each receptor molecule (burying 960 A2 in each interface), by contrast with the situation seen for monomeric hGH binding to hGH-R. IFN-y-Ra dimerization is driven solely by bivalent binding of IFN-y, with no receptorreceptor contact m the dimeric complex. By contrast with the hGH/hGH-R complex, there is therefore no requirement for a sequential mechanism for IFN-y-induced receptor dtmerization. However, to generate the active signalmg complex, the IFN-y,:IFN-y-Ra2 complex observed m the crystallographic studies must interact with at least one molecule of IFN-y-RP.
54
Lemmon and Schlessinger
Activated Complex (Hexameric)
Fig. 2. A schematic representation of the assembly of an activated cytokine/receptor complex. The most complicated case so far described-that of IL-6 (23,24)-is taken as an illustration. In this case, it is proposed that the cytokine first forms a 1:l complex with a receptor a-chain. Two such 1:l complexes then bind to two receptor P-chains, which may be distinct or identical (both are gp130 in the case of IL6), to form the hexameric 2:2:2 cytokine:a-chain@chain complex shown. Similar complexes (although with different subunits) are proposed to form for CNTF, IL-5, GMCSF, IFN-y, among others, although have not been shown for cytokines such as LIF, which may more closely resemble the hGH/hGH-R complex. In the complex depicted here, the JAK kinases associated with the P-chains are brought into close proximity, and may autophosphorylate in truns, resulting in their activation. The JAKs phosphorylate the receptor as well as specific STAT molecules that are recruited to the activated receptor (see text).
27.3. Type 3: Tumor Necrosis Factor (TNF) Receptor The TNF receptor family is distinguished by a repeated sequence motif that contains 6 cysteines, There are two types of TNF receptor, with molecular
weights of 55 and 75 kDa respectively, each of which binds to the trimeric ligands TNF-a and TNF-P. Three receptor molecules can bind to a single trimer (27), although it is not clear that trimerization (as opposed to dimerization) is necessary for signaling. Banner et al. (28) have described the X-ray crystal structure of a TNF-P trimer bound to the extracellular domain of the 55-kDa TNF receptor. This study offered the first structural view of the TNF receptor cysteine-repeat domain that may have homologues in both the EGF and insulin receptor extracellular domains (29). It also showed how trivalent binding of
Receptor Oligomerizatton
55
the TNF-P trtmer results m trtmerizatton of the TNF receptor. Each of the three receptor molecules binds to a groove between adjacent subumts m the ltgand trimer (Fig. 3). The three bmdmg sites on the TNF-P trimer are identicalallowing multivalent bmdmg to the receptor to be symmetrical. In common with the IFN-yDFN-y-Ra complex, where symmetrical (bivalent) bmding is observed, there is no apparent contact between TNF-receptor molecules in the trtmer described by Banner et al. (28). The requirement for receptor ohgomertzatton in TNF-receptor signaling 1s supported by the fmdmgs that a mutated receptor with a cytoplasmtc-domain deletton functions as a dominant-negative inhibitor of TNF-receptor stgnalmg (30). Furthermore, signaling through the receptor can be induced by btvalent monoclonal antibodies (MAb) to the extracellular domain, but not their monovalent FAB fragments (31) These observattons argue that an oligomer containing at least two receptor molecules is required for stgnalmg. Couphng of the activation of this type of receptor to downstream events differs from the others discussed in this chapter. There is no apparent direct involvement of tyrosine kinases, but rather the TRAFs (tumor necrosis factor receptor-associated factors) are involved (see ref. 32 for a review).
2 1 4. Multwalent-L/gad Blndmg: A Common Theme in Cytokine Receptor Activation As 1s evident from the examples described earlier, together with many studies not considered here, simultaneous bmding of a smgle multivalent-ligand entity to two or more receptor molecules is responsible for cytokme-induced receptor oligomerization. The hgand entity may be a bivalent monomer, as in the cases of hGH and EPO, a blvalent dimer as in the case of IFN-)I; or a multivalent oligomer of higher order as seen with the TNF-P trimer. Where the ligand entity offers two or more identical receptor-binding sites (RBS) (IFN-y and TNF-P), no additional receptor-receptor contacts have been seen in crystal structures of the oligomeric ligand/receptor complexes; arguing that ligand multivalence alone can drive receptor oligomerization. An intermediate step in ligand-induced receptor oligomerization is likely to involve the binding of a single multivalent-ligand entity to a single receptor molecule. Receptor oligomerization will then occur as additional receptor molecules bind to the unoccupied sites on the multivalent hgand with identical affinities. In cases where the two sites on a bivalent ligand are distinct-differing m their receptor-binding affinity (as is the case for the hGH monomer)-formation of a 1: 1 intermediate complex also occurs, mvolvmg the highest-affinity RBS on the ligand. The affinity of the second receptor for this 1: 1 complex is defined by the weaker RBS on the asymmetric hgand, unless additional receptor-receptor mteracttons are also involved. In hGH-induced receptor dimertzation, these effects result in a sequential mechanism for ligand-induced receptor dtmertzation (15).
56
Lemmon and Schlessinger
Fig. 3. Representation of the structure of the complex formed between the TNF-P trimer and three molecules of the ~55 TNF-R extracellular domain (28). (A) A sideview of the complex, with the TNF-P trimer in light gray, and the three receptor extra-
Receptor Oligomerization
57
2.2. Receptor Tyrosine Kinases More than 50 different receptor tyrosine kinases (RTKs) have been identified, which can be divided into at least 16 different families. Each receptor has a cytoplasmic tyrosme kmase domain, a single transmembrane a-helix, and an extracellular hgand-binding domain-although ligands have yet to be identified for some of the putative receptors. Sequence analyses indicate that the extracellular domains of the RTKs contain a number of domains-includmg immunoglobulin-like (Ig-like), FNIII-like, and cysteme-rich domains-and the complement of these provides the primary basis for classification of RTKs into families. Ligand-induced receptor dimerization was first described as a mechamsm for activation of one such RTK, the EGF receptor (7,8). A number of studies have shown that dimerization of the EGF receptor (and others) is coincident with activation of its tyrosme kinase activity (3335). It has also been shown that activation of several RTKs can be inhibited in a dominant-negative manner by coexpression of a mutated receptor with a deleted cytoplasmic domain (36-38). Such dominant-negative Inhibition appears to be a universal property of RTKs, and targeted expression of dommant-negative receptor mutants has been exploited m the studies of the functional role of certain receptors in VIVO(38-41). It appears that nearly all known RTKs undergo a transition from a monomeric to a dimeric state upon binding of their cognate hgand, and that this provides the mechanism for activation. One exception to this is the insulin receptor, which exists as a disulfide-linked dimer of a-P pairs in its nonactivated state. Insulin bmdmg induces conformational changes that result in an allosteric change from an inactive dimer to an activated dimer. As with other RTKs, the active form is a dimer: The insulin receptor differs from other RTKs only in the oligomeric state of its inactive form. The fact that a functional chimeric receptor can be constructed with EGF-receptor intracellular portions and insulin-receptor extracellular portions argues that the signaling mechanism of the two receptors 1sthe same (42). As yet, there is no detailed structural information for the extracellular domain of an RTK in complex with its growth-factor ligand. However, the Ftg 3 (contznued) cellular domams in darker gray The C-terminus of each receptor molecule, to which the membrane spanning region is attached m the intact receptor, is at the bottom of the figure The membrane would lie in a plane perpendicular to the page, along the bottom of the complex as represented here. (B) A view down the threefold axis of the TNF-P trtmer/sTNF-R complex, looking from the top of the complex, toward the membrane. It is clear that each receptor molecule binds m a groove between two protomers of the TNF-P trimer, and that the three receptor molecules do not contact one another. Coordinates were obtained from the Brookhaven Protein Data
Bank, andfigures were generatedusmg the program GRASP (92).
58
Lemmon
and Schlessinger
mechanisms of hgand-induced dimerizatton of several RTKs have been studied through studies of the whole receptor and btophystcal analyses of the isolated extracellular domains. In common with the cytokme receptors, multivalent-ligand binding appears to be key for stabilization of the active receptor dimer or oligomer in most cases. As with the cytokmes, the growth factors that stimulate RTK ollgomerization may themselves be monomers or oligomers when free m solution. Despite the lack of detailed structural mformation, studies of RTK ohgomertzation have provided some additional variations on the theme of ohgomerization induced by multivalent-ltgand bmdmg, mcludmg the formation of heterodimers, which are discussed m Subheading 4. 2 2.1. Dimenc
Growth
Factors
(PDGF,
SCF)
One family of RTKs, termed type III (34), mcludes the receptors for platelet-derived growth factor (PDGF), the Steel hgand or stem-cell factor (SCF), and macrophage-colony stimulatmg factor (M-CSF or CSF-1). Each of these receptors contams five Ig-like domains m its extracellular domain. Each of the growth factors is a dimer: disulfide-linked m the cases of PDGF and M-CSF, and noncovalently linked m the case of SCF. It appears that dimerization of each of the type III receptors is induced by bivalent binding of the ligand dimer m a symmetrical manner, as seen with IFN-y bmdmg to IFN-y-Ra. PDGF contams two twisted pairs of antiparallel P-strands, and dimerizes in an anttparallel fashion with two symmetry-related mtermolecular disulfide bonds (43). Dimeric PDGF mduces dimerization of purified PDGF-R isoforms with a bell-shaped dose-dependence that indicates a bivalent mode of binding (44). Studies of PDGF bmdmg to the extracellular domain of PDGF-R show that maximal dimerization occurs when one PDGF dimer binds to two receptor molecules (45). Furthermore, heterodimers formed between wild-type PDGF and binding-defective mutants appear to bind only monovalently, and therefore do not activate the receptor (46,47). Mutational and antibody-mhibition studies suggest that each of the two receptors m the ligand/receptor complex contacts portions of both protomers of the PDGF dimer (45). The mechanism by which SCF induces homodimerization of its receptor, called Kit, is similar. SCF shows sequence similarity to helical-bundle cytokmes, and forms a noncovalently linked dimer. The membrane-distal 3 (of five) Ig-like domains m the Kit extracellular domain are sufficient to define the mteractions of the receptor with SCF (48,49), and SCF induces dimenzation of the isolated Kit extracellular domain (50). Although a mechanism for SCF-induced dimerization of Ktt by monovalent bmdmg of SCF to the receptor was mittally proposed (51), subsequent biophysical studies of SCF-induced dimerization of the Kit extracellular domain show that SCF binds m a bivalent manner to two Kit molecules (52,53). Inter-receptor mteractions contribute very little to SCF-induced Kit dimer-
Receptor Oligomeriza tion
59
ization (5253). Indeed, although it was mitially proposed that the fourth of the five Ig-like domains of Kit is cnttcal for coupling SCF binding to receptor drmerizatron (54), it was subsequently shown that both this domain and the fifth Ig-like domains can be removed with no detectable effect on SCF-induced dimerizatron of the Kit extracellular domain (53). Therefore, it appears that the SCF/Krt complex is likely to resemble the IFN-y/IFN-y-Ra complex described earlter. Ligand-induced dimerizatron of several other RTKs appears to occur through a srmtlar mechanism. For example, the hgands for the neurotrophm receptors of the Trk family all form dimers to which two receptor molecules can bind, resulting in receptor dimerization (55). In addition, an interesting class of ligands for the previously orphan EPH-related RTKs can only activate their receptors when membrane anchored as GPI-linked or integral-membrane proteins (56). Antibody-mediated clustering of soluble forms of these hgands also rendered them active (56), suggesting that anchoring in the cell membrane is required for oligomerization of the ligands, which in turn is required for multivalent-receptor binding and consequent receptor ollgomertzation.
2 2.2. Monomeric Growth Factors (FGF, EGF) Several growth factors exist as monomers m solution, yet then binding to cognate RTKs Induces receptor dimerization and activation. Members of the family of fibroblast-growth factors (of which there are at least rune) occur as monomers in solution, and bind with high affinity to a class of RTKs (FGF-R) that includes at least four distinct gene products (FGF-Rl to FGF-R4) as well as a vartety of differently spliced forms. Activation of FGF-R upon FGF binding requires the presence of heparm-sulfate proteoglycans (HSPGs) for which heparin can substitute (57-59). The FGFs bmd to HSPGs and heparm, and their oligomerrzation is induced as a result (594). Several proposals have been made for the mechanism of action of HSPGs m FGF-induced activation of FGF-R (57-63). Included in these proposals are that HSPGs are abundant low-affinity receptors that “present” FGF to the high-affinity FGF-R (62,63); that HSPG binding stabilizes FGF against degradation; and that HSPG binding induces a conformational change that increases the affinity of FGF for FGF-R. From our own studies of acidic FGF (aFGF) binding to FGF-Rl and FGF-R2 (61), we support a model m which HSPG bmdmg to FGF induces its oligomerization and the resultant formation of a multivalent ligand. FGF binds to the extracellular domain of its receptor m a 1: 1 complex, but does not induce dimerization of the receptor (61). The presence of heparm does not detectably alter the thermodynamics or stoichiometry of this mteraction, but does allow aFGF bmdmg to be coupled to FGF-R dimerization. A single heparm molecule binds several aFGF molecules, with one FGF binding per 4-5 saccharide units in heparin; aFGF oligomerrzatron is thus induced. We could detect no significant
60
Lemmon and Schlessmger
interaction of heparm with the free receptor, in contrast to other studies (e.g., ref. 64). Moreover, a monovalent heparm analog (sucrose octasulfate) that forms a 1: 1 complex with aFGF (61,65), mhibited the dimerization of FGF-R by aFGF/heparin. A recent crystal structure of basic FGF (bFGF) bound to a heparin-derived hexasaccharide (66) showed that no conformational changes m bFGF result from heparm bmdmg, and is consistent with a role for heparm in stabilizing FGF ohgomers. We therefore suggest that HSPGs function as accessory molecules m FGF activatton of its receptor. They bmd to the normally monovalent hgand to create an aFGF/heparm complex that is multtvalent in its interactions with the receptor, and resembles IFN-y, PDGF, or SCF m inducing FGF-R ohgomerization through the simultaneous mteractton with more than one receptor molecule. EGF is also monomeric m solution (67), and induces dimerization of both the intact-EGF receptor (II) and its isolated extracellular domain (67,68). In this case, no accessory molecule such as heparm is required for the abihty of the growth factor to activate its receptor. Several reports indicate that the stoichiometry of EGF binding to its receptor is 1:l (67,69,70). Recent detailed studies of EGF-induced dimerization of the EGF-R-extracellular domain (67) and activation of the mtact, detergent-solubihzed receptor (71), have converged on a model m which dimeric active EGF-R contams two molecules of EGF. A mechanism has been proposed (67) m which EGF first binds to EGF-R to form a monomeric 1: 1 complex, and this complex self-associates to form the active dimer. It is not clear whether the dimerization step is mediated by receptorreceptor mteractions or by simultaneous Interaction of both EGF molecules m the 2.2 (EGF:EGF-R) complex with both receptors. The former case would make EGF-R an exception to the theme of receptor ohgomerization by bivalent ligand binding, whereas the latter would make it simply another variation on the theme. If two bivalent EGF molecules stabilize the EGF-R dimer, tt would be expected that two EGF binding sites are present in a single EGF-R molecule. There is some evidence for this. The extracellular domain of EGF-R can be separated mto four subdomams on the basis of sequence analysis (72), two of which (domains 1 and 3, which show 37% sequence identity) have been implicated m EGF-bmdmg (73,74). Domain 3, prepared by proteolytic treatment of the EGF-R extracellular domain, bmds EGF and TGF-a with the same affinity as the monomer of the extracellular domain (67,75). We therefore suggest that, m an EGF-R dimer, one EGF may bind domain 3 of one receptor molecule and domain 1 of the other (67). The other EGF molecule would occupy the remammg two sites, such that each EGF resembles a molecule of hGH in its mteractions with the receptor dimer.
Receptor Oligomerization
61
Ligand
Monomers
Fig. 4. Schematicrepresentationof activation of an RTK by ligand-induced dimerization (after ref. II). Prior to ligand binding, the receptor existsin the cell membrane asaninactive monomer.Binding of a bivalent ligand (e.g.,SCF,PDGF,or two in the case of EGF) stabilizesa dimeric form of the receptor that is active. In the active complex, tyrosine autophosphorylationoccurs,in an intermolecular reaction (within or between dimers), leading to activation of the receptor’s kinase activity. Some of the autophosphorylation sitesserve asspecific binding sitesfor the recruitment of downstream signaling molecules that contain SH2 domains. 3. Coupling of Receptor Oligomerization to Tyrosine Kinase Activation Ligand-induced oligomerization of RTKs results in activation of their tyrosine kinase domain. Similarly, ligand-induced oligomerization of the type 1 and type 2 cytokine receptors results in activation of the receptor-associated JAK tyrosine kinases. It is generally considered that the mechanism of kinase activation that results from receptor oligomerization is similar in the two cases (76). It has been shown that ligand-induced RTK dimerization results in receptor autophosphorylation (8), which appears to occur in an intermolecular fashion, involving transphosphorylation within a receptor dimer (Fig. 4) or between two activated dimers (77). Structural studies of the tyrosine kinase domain of the insulin receptor have provided one view of how this may be stimulated (78). Tyrosine kinase activity in the inactive receptor is inhibited by the presence in the active site of a tyrosine side chain that represents a major autophosphorylation site (Y 1162). In this conformation, accessof ATP to the active site of the enzyme is also blocked. It is proposed (78) that two forms of the kinase exist in equilibrium: one with Y 1162 in the active site (plus blocked ATP site), and another with Y 1162 transiently accessible (and ATP site available). Alteration of the juxtaposition of the two kinase domains in the activated
62
Lemmon and Schlessinger
insulm-receptor dimer (analogous to dimerization of other RTKs) is proposed to allow Y 1162 (when transiently accessible) to be phosphorylated zntram by its partner m the receptor dimer (when transiently active). Upon phosphorylation of Y 1162, the catalytic activity of the tyrosine-kmase domain is increased, because the competing (inactivating) Interactions mvolving unphosphorylated Y 1162 are abolished Broadly similar mechanisms are expected for activation of other RTKs by trans-autophosphorylation m then activation loops. Thus, autophosphorylation of RTKs provides an important regulatory function, with phosphorylation of sites within the catalytic domain being important for control of kinase activity However, most sites for tyrosme autophosphorylation are located m regions outside the catalytic portion of the mtracellular domain. One important function of these autophosphorylation sites is to serve as bmdmg sites for Src-homology 2 (SH2) domains present in downstream-signaling molecules (Fig. 4). As discussed in Chapters 1 and 2, SH2 domains bind specifically to phosphotyrosines in a particular primary and tertiary structural context, and are responsible for the recruitment of downstream signaling molecules to an activated RTK or associated docking protem (79). For example, at least 10 autophosphorylation sites have been mapped m the cytoplasmic domain of the PDGF-/3 receptor, mcludmg specific bmdmg sites for the SH2 domains of phosphoinosmde 3-kmase (PI 3-kmase), c-Src, phosphollpase C-y, GAP, Nck, and Grb2/Sos (80). It is thought that the complement of downstream signaling molecules that is activated by a particular RTK is defined by its particular complement of tyrosme autophosphorylation sites. In the cytokine receptors, JAK kinases are thought to be activated by trans-autophosphorylation m the cytokine-induced receptor/JAK oligomer (Fig. 2). The activated JAKs phosphorylate the receptors with which they are associated, creating docking sites for SH2-containing signalmg molecules (3,76). The STATS, which are specifically recruited to the activated receptor, are phosphorylated by JAKs, causmg them to homo- or heterodimerize and subsequently migrate to the nucleus, where they function as transcription factors (2,3,76).
4. Increased Signal Diversity Through Ligand-Induced Receptor
Heterodimerization
A transmembrane-signaling mechanism that involves receptor oligomerizanon induced by multivalent-ligand bmdmg allows the formation of both homoand hetero-obgomers of receptors to be employed. The type 1 cytokme receptors clearly exploit this possibility, with the mvolvement of both general (such as gp130) and ligand-specific (such as IL-6-Ra) subunits m the activated receptor oligomers. There are several examples of the exploitation of ligand-induced receptor heterodimerization m signalmg by RTKs, which appear to increase the diver-
Receptor Ohgomerization
63
sity of signals that can be achieved with a given combination of ligand and receptor famthes. The first example of this was seen in PDGF receptor stgnalmg. Two forms (A and B) of PDGF exist, in addmon to two forms (a and p) of the PDGF-R. PDGF is found in vivo as AA and BB disulfide-lmked homodimers as well as AB heterodimers, which differ in then receptor-bmdmg characteristics (44,45,47,81). The PDGF-AA homodimer wtll induce only homodimerization of PDGF-Ra, whereas PDGF-BB can mduce the formation of aa, a& or pp drmers. The PDGF-AB heterodimer preferentially induces formation of the a0 heterodimer of the PDGF receptor. Because cell types differ in the combmation of PDGF-R isoforms that they express, this repertoire of receptor-hgand mteractions can increase the diversity of specific responses to PDGF. In addition, it has been reported that the combmation of sites autophosphorylated m the PDGF-R ap heterodimer 1s distinct from the sum of those autophosphorylated m either receptor homodimer, allowmg the recruitment of downstream stgnalmg molecules that are unique to the heterodimer (82). A second, more complicated, example of mcreased-signalmg diversity by hgand-induced receptor heterodimerization is seen with the EGF-R family. There are four members of this family: EGF-R itself (erbB l), and the homologous receptors erbB2, erbB3, and erbB4. There are at least six different ligands that bind directly to EGF-R: EGF, TGFa, betacellulin, amphiregulm, epiregulm, heparm-bindmg EGF, plus a host of differently spliced heregulms that bmd to erbB3 and erbB4 It was reported several years ago that EGF not only induces homodimerization and activation of EGF-R, but also causes phosphorylation of erbB2 (83,84), for which no hgand is yet known. It was subsequently found that EGF-R and erbB2 heterodimerize in an EGF-dependent manner (85,86), and that this could be recapitulated with the Isolated extracellular domains of EGF-R and erbB2 (85). More recent studies, details of which will not be descrrbed here, suggest that other erbB receptor heterodimers can be induced to form by members of the EGF or heregulin family of ligands. The different erbB receptors contain different complements of autophosphorylation sites in their intracellular domains, and so will recruit distinct complements of downstream-signalmg molecules when activated. Heterodimerization will further alter that complement, and, as with PDGF-R, there may be cases m which certain sites are phosphorylated m the context of a heterodimer, but not a homodimer. An illustration of the importance of heterodimerization in EGF-R signaling is seen m its ability to stimulate PI 3-kmase activity, which is puzzling because EGF-R cannot be seen to associate with PI 3-kinase, and does not contain an autophosphorylation site that would recruit PI 3-kinase SH2 domains. ErbB3 does contain such an SH2 binding site, and has been shown to become phosphorylated upon stimulation of cells with EGF. PI 3-kinase activity can be co-immunoprecipitated with erbB3 in an EGF-dependent manner,
64
Lemmon and Schlessinger Ligand
Signal 1
Signal l/2
Signal l/3
Signal l/4
Fig. 5. A schematic representation of the principle by which ligand-induced receptor heterodimerization can increase signaling diversity. Consider a ligand that can induce homodimerization of a given receptor (receptor I), as well as its heterodimerization with other members of a receptor family (receptors 2 to 4). Each of the four dimers shown will generate a distinct signal, defined by their complement of autophosphorylation sites. In cell-types that differ in the relative amount of receptors 1 to 4 that they express, the ratio of the four different dimers induced by the ligand will also differ. As a result, the different cell types will receive a different combination of the signals shown, and may respond in a qualitatively different manner.
that this signaling activity may be a consequence of erbB receptor heterodimerization (87). From many studies, the current data suggest that ligands in this family may induce the formation of different combinations of receptor hetero- and homodimers (schematized in Fig. 5). As a result, the response of a cell will be a complicated function of the complement of EGF and heregulin-family ligands to which it is exposed, and of the relative levels of the different erbB receptors that it expresses on its surface (88-91). Thus, receptor heterodimerization can greatly increase the diversity of responses. arguing
5. Conclusions From the examples discussed in this chapter, it appears that the receptors for cytokines and growth factors utilize a common mechanism for transmembrane signaling. Each receptor has a ligand-binding extracellular domain with a
Receptor Oligomeriza tion
65
modular structure, and binds to a hgand that is multivalent. Binding of two or more receptors to the multivalent ligand, together with addtttonal inter-receptor interactions in some cases,results m ohgomertzation of the receptor. For most of the receptors discussed in this Chapter, oligomertzatton m turn setsthe stage for trans-autophosphorylation of the tyrosine kmase that 1seither associated with, or an integral part of, the receptor. Multivalent ligands are monomers in some cases (hGH, and possibly EGF), stable dimers or trimers in others (IFNq, PDGF, SCF, TNF-P), and oligomers Induced by association with an accessory molecule m others (FGF). Through the binding of hetero-ohgomeric ligands (such as PDGF-AB) or bivalent monomeric ligands with different bmdmg specifictties (as 1s suggested for the EGF family), receptor heterodimerization can be Induced. Receptor heterodtmerization appears to play an important role m mcreasmg the diversity of cellular signals. References 1. Ullrich, A and Schlessmger, J. (1990) Signal transduction by receptors wtth tyrosme kmase acttvity Cell 61, 203-212. 2 Ktshtmoto, T , Taga, T., and Aktra, S (1994) Cytokme signal transductton Cell 76,252-262 3. Ihle, J. N (1995) Cytokme receptor signaling Nature 377,591-594 4. Bormann, B. J. and Engelman, D M. (1992) Intramembrane helix-helix assoctanon m ohgomertzatton and transmembrane signaling Ann Rev Blophys Bzomol Struct 21,223-242. 5. Schlessmger, J (1978) m Cell Surface Events zn Cellular Regulation (DeLisi, C. and Blumenthal, R., eds.), Elsevter, North Holland, pp 89-l 11. 6. Schechter, Y , Hernaez, L., Schlessmger, J., and Cuatrecasas, P. (1979) Local aggregatton of hormone-receptor complexes 1s reqmred for acttvatton by epiderma1 growth factor. Nature 278, 835-838. 7. Yarden, Y. and Schlessmger, J. (1987) Epidermal growth factor induces rapid, reversible aggregation of the purified epidermal growth factor receptor Bzochemzstry 26, 1443-145 1. 8. Yarden, Y and Schlessmger, J. (1987) Self-phosphorylation of epidermal growth factor receptor Evidence for a model of mtermolecular allostertc activatton. BLOchemistry 26, 1434-1442 9. Fanger, B. O., Austin, K S , Earp, H. S , and Ctdlowski, J. A. (1986) Cross-lmkmg of epidermal growth factor receptors m intact cells. Detection of initial stages of receptor clustermg and determmatton of molecular weight of high-affinity receptors. Bzochemzstry 25, 6414-6420 10 Cachet, C., Kashles, 0 , Chambaz, E. M., King, C. R., and Schlessmger, J (1988) Demonstration of eptdermal growth factor-induced receptor dtmerization m living cells using a chemical covalent cross-hnkmg agent. J Bzol Chem 263,3290-3295. 11. Schlessinger, J (1988) Signal transduction by allostertc receptor ohgomertzatton Trends Blochem Scl 13,443-447.
66
Lemmon and Schlessmger
12. Taga, T. and Kishimoto, T. (1993) Cytokine receptors and signal transduction FASEB J 7,3387-3396. 13. Sprang, S. R. and Bazan, J. F. (1993) Cytokme structural taxonomy and mechanisms of receptor engagement. Curr Open Struct Bzol 3,815-827. 14. Bazan, J. F. (1990) Haemopoietic receptors and hellcal cytokmes Zmmunol Today 11,350-354 1.5 Cunnmgham, B C , Ultsch, M , de Vos, A. M., Mulkerrm, M. G., Clauser, K. R , and Wells, J. A. (1991) Dimerization of the extracellular domam of the human growth hormone receptor by a single hormone molecule. Sczence 254, 821-825 16 de Vos, A. M., Ultsch, M., and Kossiakoff, A A (1992) Human growth hormone and extracellular domam of its receptor. crystal structure of the complex Scwnce 255,306-3 12. 17 Fuh, G , Cunningham, B. C , Fukunaga, R., Nagata, S , Goeddel, D. V , and Wells, J A. (1992) Rational design of potent antagomsts to the human growth hormone receptor. Sczence 256, 1677-1680 18 Kossiakoff, A. A , Somers, W., Ultsch, M , Andow, K., Muller, Y A , and de Vos, A. M. (1994) Comparison of the mtermediate complexes of human growth hormone bound to the human growth hormone and prolactm receptors. Prot Scz 3, 1697-1705. 19 Philo, J. S , Aoki, K. H., Arakawa, T , Narhi, L 0 , and Wen, J (1996) Dimerizanon of the extracellular domam of the erythropoietm (EPO) receptor by EPO One high-affinity and one low-affinity mteraction. Bzochemlstry 35, 1681-1691. 20 Horan, T , Wen, J , Narhi, L , Parker, V., Garcia, A., Arakawa, T , and Philo, J (1996) Dimerization of the extracellular domam of granulocyte-colony stimulatmg factor receptor by llgand bmdmg. A monovalent hgand induces 2 2 complexes Bzochemzstry 35,4886-4896. 21 Hnaoka, 0 , Anaguchi, H., Asakura, A , and Ota, Y (1995) Requirement for the immunoglobulm-like domam of granulocyte colony-stimulating factor receptor m formation of a 2 1 receptor-hgand complex. J Blol Chem 270,25,928-25,934 22. Robmson, R. C., Grey, L. M., Staunton, D , Vankelecom, H , Vernalhs, A. B , Moreau, J.-F., Stuart, D I , Heath, J K , and Jones, E. Y (1994) The crystal structure of leukemia mhibitory factor Implications for receptor bmdmg Cell 77, 1101-l 116 23. Paonessa, G., Graziam, R., De Servo, A., Savmo, R , Ciappom, L., Lahm, A., Salvati, A L , Tomatti, C , and Cihberto, G. (1995) Two distmct and independent sites on IL-6 trigger gp130 dimer formation and signaling EMBO J 14, 1942-195 1 24 Ward, L. D , Howlett, G. J , Discolo, G., Yasukawa, K., Hammacher, A., Moritz, R., and Simpson, R J (1994) High affinity mterleukm-6 receptor is a hexameric complex consistmg of two molecules each of mterleukm-6, mterleukm-6 receptor and gp130 J Bzol Chem 269,23,286-23,289. 25. Stahl, N. and Yancopoulos, G. D. (1993) The alphas betas, and kmases of cytokme receptor complexes Cell 74,587-590 26. Walter, M. R., Windsor, W T , Nagabhushan, T. L., Lundell, D. J., Lunn, C. A., Zauodny, P J., and Narula, S K. (1995) Crystal structure of a complex between Interferon-y and its soluble high-affinity receptor. Nature 376,230-235.
Receptor Oligomeriza tion
67
27. Loetscher, H. R., Gentz, R., Zulauf, M., Lustig, A , Tabuchi, H., Schlaeger, E J , Brockhaus, M., Gallati, H., Maanneberg, M., and Lesiauer, W. (1991) Recombrnant 55 kDa TNF receptor’ Stoichiometry of bmdmg to TNFa and TNFP and inhibition of TNF actrvrty. J Blol. Chem 266, 18,324-18,329. 28 Banner, D. W., D’Arcy, A., Janes, W., Gentz, R., Schoenfeld, H.-J., Broger, C., Loetscher, H., and Lesslauer, W. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNFP complex: Implmations for TNF receptor activation. Cell 73,43 l-445 29. Ward, C. W., Hoyne, P A., and Flegg, R. H. (1995) Insulin and epidermal growth factor receptors contam the cysteme repeat motif found m the tumor necrosis factor receptor. Proteins Struct , Funct , and Genet 22, 141-153 30. Tartagha, L A and Goeddel, D. V. (1992) Tumor necrosts factor signalmg: A dominant negative mutation supresses the activation of the 55 kDa tumor necrosis factor receptor. J Bzol Chem 267,4304-4307. 31 Engelmann, H , Holtman, H., Brakebusch, C , Avni, S. Y , Sarov, I., Nophar, Y , Hadas, E., Leitner, O., and Wallach, D. (1990) Antibodies to a soluble form of a tumor necrosis factor (TNF) receptor have TNF-like activity. J Blol. Chem 265, 14,497-14,504. 32. Baker, S. J. and Reddy, E P (1996) Transducers of life and death TNF receptor superfamily and associated proteins. Oncogene 12, 1-9. 33. Canals, F. (1992) Signal transmission by epidermal growth factor receptor* Coincidence of activation and drmerrzation Bzochemzstry 31,4493-4501, 34. Ullrich, A. and Schlessmger, J. (1990) Signal transduction by receptors with tyrosme kmase activity Cell 61, 203-2 12 35. Schlessinger, J. and Ullrmh, A. (1992) Growth factor signaling by receptor tyrosme kmases. Neuron 9, 383-391. 36. Kashles, O., Yarden, Y., Fischer, R., Ullrich, A , and Schlessmger, J. (1991) A dominant negative mutation suppresses the function of normal eprdermal growth factors by heterodimerrzation. A401 Cell. Bzol 11, 1454-1463. 37. Ueno, H , Colbert, H., Escobedo, J. A., and Williams, L. T. (1991) Inhibition of PDGFP receptor signal transduction by coexpression of a truncated receptor. Sclence 252,844-848. 38. Amaya, E., Musci, T. J., and Kirschner, M. W (1991) Expression of a dominant negative mutant of the FGF receptor disrupts mesoderm formation m Xenopus embryos. Cell 66,257-270 39 Werner, S., Wemberg, W , Liao, X., Peters, K. G., Blessmg, M , Yuspa, S , Werner, R. L., and Willlams, L T (1993) Targeted expression of a dommantnegative FGF receptor mutant m the epidermis of transgemc mice reveals a role for FGF m keratmocyte organization and differentiation. EMBO J 12. 40 Millauer, B , Shawyer, L K , Plate, K. H , Risau, W., and Ullrich, A. (1994) Glioblastoma growth inhibited zn vlvo by a dominant-negative FLK-1 mutant. Nature 367,576-579. 41 Murillas, R , Larcher, F , Conti, C J , Santos, M., Ullrmh, A., and Jorcano, J. L (1995) Expression of a dominant negative mutant of eprdermal growth factor
68
42
43
44.
45
46
47
48.
49.
50.
51
52
53.
54.
lemmon and Schlessinger receptor m the epidermis of transgemc mice elicits strikmg alterations m hair follicle development and skm structure EMBO J 14,5216-5223 Riedel, H., Dull, T J , Schlessmger, J , and Ullrich, A. (1986) A chimaeric receptor allows msulm to stimulate tyrosme kmase activity of epidermal growth factor Nature 324,68-70. Oefner, C , D’Arcy, A., Wmkler, F K., Eggimann, B , and Hosang, M (1992) Crystal structure of human platelet-derived growth factor BB. EMBO J 11, 3921-3926. Heldm, C.-H., Ernlund, A., Rorsman, C., and Ronnstrand, L (1989) Dimerization of B-type platelet-derived growth factor receptors occurs after hgand bmdmg and is closely associated with receptor kmase activation. J Bzol Chem 264,8905-8912 Herren, B., Rooney, B., Weyer, K. A., Iberg, N , Schmid, G , and Pech, M (1993) Dimerization of extracellular domains of platelet-derived growth factor receptors: A revised model of receptor-hgand mteractron J Blol Chem 268, 15,088-15,095 Vassbotn, F S., Andersson, A., Westermark, B , Heldm, C.-H., and Ostman, A (1993) Reversion of autocrme transformation by a dominant negative plateletderived growth factor mutant. Mol Cell Bzol 13,4066-4076. Fretto, L J., Snape, A. J., Tomlmson, J E , Seroogy, J J , Wolf, D. L., LaRochelle, W. J., and Geese, N A. (1993) Mechanism of platelet-derived growth factor (PDGF) AA, AB, and BB binding to a and p PDGF receptor. J Bzol Chem. 268, 3625-3631. Blechman, J. M., Lev, S., Brizzi, M. F., Leitner, O., Pegoraro, L., Givol, D , and Yarden, Y. (1993) Soluble c-Kit proteins and antrreceptor monoclonal antibodies confine the binding site of the stem cell factor. J Biol Chem 268,4399-4406. Lev, S., Blechman, J., Nishikawa, S -1 , Givol, D., and Yarden, Y. (1993) Interspecies molecular chimeras of Kit help define the binding site of the stem cell factor Mol Cell Biol 13,2224-2234. Lev, S., Yarden, Y., and Givol, D. (1992) A recombinant ectodomain of the receptor for the stem cell factor (SCF) retains hgand-induced receptor dimerization and antagonizes SCF-stimulated cellular responses. J Biol Chem 267, 10,86&10,873. Lev, S , Yarden, Y., and Givol, D. (1992) Dimerization and activation of the Kit receptor by monovalent and bivalent bmdmg of the stem cell factor. J Blol Chem 267, 15,970-15,977 Philo, J. S., Wen, J , Schwartz, M G , Mendiaz, E A , and Langley, K. E (1996) Human stem cell factor dimer forms a complex with two molecules of the extracellular domain of its receptor, Kit. J Bzol Chem 271,6895-6902. Lemmon, M. A., Pmchasi, D , Zhou, M , Lax, I , and Schlessmger, J. (1997) Dimerization of Kit is driven by bivalent binding of stem cell factor. J Bzol Chem 272,6311-6317 Blechman, J M., Lev, S , Barg, J , Eisenstem, M , Vaks, B , Vogel, Z., Givol, D., and Yarden, Y (1995) The fourth immunoglobulm domain of the stem cell factor receptor couples hgand bmdmg to signal transduction Cell 80, 103-l 13
Receptor
Oligomeriza
tion
69
55 Phrlo, J , Talvenhermo, J , Wen, J , Rosenfeld, R , Welcher, A , and Arakawa, T (1994) Interactions of neurotrophm-3 (NT-3), brain-derived neurotrophic factor (BDNF), and the NT3-BDNF heterodimer with the extracellular domain of the TrkB and TrkC receptors J Bzol Chem 269,27,840-27,846. 56 Davrs, S , Gale, N. W., Aldrrch, T H , Marsonprerre, P C , Lhotak, V , Pawson, T., Goldfarb, M., and Yancopoulos, G. D. (1994) Lrgands for EPH-related receptor tyrosme kmases that require membrane attachment or clustering for activity. Sczence 266,816-819. 57 Rapraeger, A C., Krufka, A, and Olwin, B B (1991) Requirement of heparan sulfate for bFGF-mediated frbroblast growth and myoblast drfferentratron Sczence 252,1705-1708 58 Yayon, A, Klagsbrun, M , Esko, J D., Leder, P , and Ormtz, D M (1991) Cellsurface heparm-like molecules are required for bmdmg of bFGF to its high-affinity receptor. Cell 64, 841-848 59. Ormtz, D. M., Yayon, A., Flanagan, J. G., Svahn, C. M., Levi, E., and Leder, P. (1992) Heparm is required for cell-free binding of bFGF to a soluble receptor and for mrtogenests m whole cells. Mel Cell Bzol 12,240-247. 60. Mach, H., Volkm, D. B., Burke, C. J., Mrddaugh, C. R., Lmhardt, R. J., Fromm, J. R., Loganathan, D., and Mattsson, L (1993) Nature of the mteractron of heparm wrth aFGF. Bzochemzstry 32,5480-5489. 61 Sprvak-Kroizman, T , Lemmon, M A , Drkrc, I , Ladbury, J E , Pmchasr, D , Huang, J , Jaye, M., Crumley, G , Schlessinger, J , and Lax, I. (1994) Heparminduced ohgomerrzatron of FGF molecules 1s responsible for FGF receptor drmerrzatron, actrvatron, and cell prolrferatron. Cell 79, 1015-1024. 62. Klagsbrun, M and Band, A (1991) A dual receptor system IS required for bFGF activity. Cell 67, 229-23 1 63. Schlessmger, J., Lax, I., and Lemmon, M A. (1995) Regulation of growth factor activation by proteoglycans What is the role of the low affinity receptors? Cell 83,367-360 64. Kan, M., Wang, F., Xu, J., Crabb, J. W., Hou, J., and McKeehan, W. L. (1993) An essentral heparm-bmdmg domain m the frbroblast growth factor receptor kinase. Science 259, 1918-1921 65 Zhu, X., Hsu, B. T., and Rees, D. C (1993) Structural studies of the anti-ulcer drug sucrose octasulfate bound to acidic frbroblast growth factor receptor. Structure 1, 27-34 66 Faham, S , Hrleman, R. E., Fromm, J R., Lmhardt, R. J., and Rees, D. C. (1996) Heparin structure and interactions with basic frbroblast growth factor. Science 271, 1116-1120 67 Lemmon, M A , Bu, Z , Ladbury, J. E., Pmchasr, D., Zhou, M., Lax, I., Engelman, D M , and Schlessmger, J (1997) Two EGF molecules contribute additively to stabrhzatron of the EGFR drmer. EMBO J 16, 28 l-294. 68. Lax, I , Mrtra, A. K., Ravera, C., Hurwrtz, D R , Rubmstem, M , Ullrrch, A , Stroud, R M , and Schlessmger, J (1991) Eprdermal growth factor (EGF) induces
70
69
70.
71 72
73.
74
75.
76. 77.
78. 79 80 81.
82.
83.
Lemmon and Schlessinger ohgomertzatton of soluble, extracellular, hgand-bmdmg domain of EGF receptor. J Bzol Chem 266, 13,828-13,833. Gunther, N., Betzel, C., and Weber, W. (1990) The secreted form of the epidermal growth factor receptor Characterizatton and crystallization of the receptor-hgand complex J Blol Chem 265,22,082-22,085 Weber, W., Bertics, P. J., and Gill, G. N. (1984) Immunoaffinity purtftcation of the epidermal growth factor receptor. Stomhiometry of bmdmg and kmetlcs of self-phosphorylation. J Blol Chem 259, 14,631-14,636. Sherrill, J M and Kyte, J (1996) Activation of epidermal growth factor receptor by epidermal growth factor Blochemlstry 35,.5705-57 18 Lax, I., Burgess, W. H., Bellot, F , Ullrtch, A., Schlessmger, J., and Givol, D (1988) Locahzatton of a maJor receptor-bmdmg domam for eptdermal growth factor by affinity labeling A401 Cell Bzol 8, 183 1-1834 Lax, I., Bellot, F., Howk, R., Ullrmh, A., Gtvol, D., and Schlessmger, J (1989) Functional analysis of the hgand binding site of EGF-receptor utihzmg chicken/ human receptor molecules. EMBO J 8,421-427 WoltJer, R. L , Lukas, T. L., and Staros, J. V. (1992) Direct tdenttfication of residues of the eptdermal growth factor receptor m close proximtty to the ammo terminus of bound eptdermal growth factor. Proc Nat1 Acad Scz USA 89,7801-7805. Kohda, D., Odaka, M., Lax, I., Kawasaki, H., Suzuki, K , Ullrtch, A., Schlessmger, J., and Inagaki, F. (1993) A 40-kDa epidermal growth factor/transformmg growth factor a-bmdmg domain produced by limited proteolysis of the extracellular domain of the epidermal growth factor receptor J Blol Chem 268, 1976-198 1, Tanigucht, T. (1995) Cytokme signaling through nonreceptor protein tyrosme kinases. Science 268,25 l-255. Honegger, A. M , Schmtdt, A., Ullrtch, A., and Schlessmger, J. (1990) Evidence for epidermal growth factor (EGF)-induced mtermolecular autophosphorylatton of the EGF receptors m living cells. Mel Cell Blol 10,4035-4044. Hubbard, S. R , Wet, L., Ellis, L., and Hendrtckson, W. A. (1994) Crystal structure of the tyrosme kmase domam of the human msulm receptor Nature 372, 746-754 Pawson, T. (1995) Protein modules and signaling networks Nature 373,573-580. Claesson-Welsh, L. (1994) Platelet-dertved growth factor receptor signals. J Blol Chem 269,32,023-32,026. KanakaraJ, P., RaJ, S , Khan, S. A., and Btshayee, S. (1991) Ltgand-induced mteraction between a- and P-type platelet-derived growth factor (PDGF) receptors’ Role of receptor heterodimers in kmase activation. Blochemlstry 30, 1761-1767 Rupp, E , Siegbahn, A., Ronnstrand, L., Wernstedt, C., Claesson-Welsh, L , and Heldm, C -H (1994) A unique autophosphorylation site m the platelet-derived growth factor a receptor from a heterodtmertc receptor complex Eur J Bzochem 225,29-4 1 Kmg, C R , Borrello, I , Bellot, F , Comoglio, P., and Schlessmger, J. (1988) EGF binding to its receptor trtggers a rapid tyrosme phosphorylation of the erbB2 protein in the mammary tumor cell lme SKBR-3. EMBO J 7, 1647-1651
Receptor Oligomerization
71
84 Stern, D. F and Kamps, M P. (1988) EGF-stimulated tyrosme phosphorylatton of p 185”eU A potential model for receptor interactions EMBO J 7,995-l 00 1, 85 Sprvak-Krotzman, T , Rotm, D., Pmchasr, D., Ullrtch, A., Schlessmger,J , and Lax, I. (1992) Heterodimertzatron of c-erbB2 with different eptdermal growth factor receptor mutants ehcrts sttmulatory or mhtbrtory responses.J Bzol. Chem 267,8056-8063. 86. Wada, T., Qian, X., and Greene, M I (1990) Intermolecular assoctatron of the ~185”~~protein and EGF modulates EGF receptor function. Cell 61, 1339-1347.
87 Soltoff, S. P., Carraway, K L , Prrgent, S A , Gulhck, W. G., and Cantley, L C (1994) ErbB3 is involved m acttvatton of phosphattdylmosrtol 3-kinase by eptdermal growth factor Mol Cell Bzol 14,3550-3558. 88. Reese,D. J II, van RaaiJ,T M , Plowman, G D , Andrews, G. C , and Stern, D F. (1995) The cellular responseto neuregulms IS governed by complex interactions of the erbB receptor family. Mel Cell Bzol 15,5770-5776. 89. Riese, D. J II, Bermingham, Y., van Raatj, T. M , Buckley, S , Plowman, G D , and Stern, D. F. (1996) Betacellulin activates the eptdermal growth factor and erbB4, and induces cellular responsepatterns distmct from those stimulated by eprdermal growth factor of neuregulm B Oncogene 12, 345-353 90. Beerh, R. R. and Hynes, N. E. (1996) Eptdermal growth factor-related peptrdes activate dtstmct subsetsof erbB receptors and differ m their brologrcal actrvmes. J Blol.Chem 271,6071-6076 91 Pinkas-Kramarski, R , Soussan, L , Waterman, H., Levkowrtz, G , Alroy, I , Klapper, L , Lavi, S., Seger, R., Ratzkm, B. J., Sela, M , and Yarder, Y. (1996) Diversification of Neu drfferentiation factor and epidermal growth factor srgnalmg by combinatorial receptor mteractrons. EMBO J 15,2452-2467. 92 Nicholls, A. and Homg, B J (1991) A rapid finite difference algorithm, utthzmg successiveover-relaxation to solve the Poisson-Boltzmann equation. J Comp Chem. 12,11,715-11,718
Use of Peptide Libraries to Determine Optimal Substrates of Tyrosine Kinases Perry M. Chan and W. Todd Miller 1. Introduction The substrate specificity of a protein tyrosine kmase m viva reflects both the intrinsic specificity of the kinase catalytic domain and the effective local concentrations of protein substrates. In many cases, the distribution of potential substrates 1s mfluenced by interactions with noncatalytic regions of the enzymes such as autophosphorylation sites, Src homology 2 (SH2) domains, and Src homology 3 (SH3) domains. These interactions may recruit substrates to the vicinity of the tyrosme kinase catalytic domain (1,2). For example, bmding of the SH2 domams of phosphohpase Cyl (PLCyl) to autophosphorylation sites on the activated eptdermal growth-factor receptor tyrosme kinase results in phosphorylation and activation of PLCyl (3). Nonreceptor tyrosine kinases such as Src and Abl are also targeted to subsets of cellular protems by virtue of specific interactions with their SH2 and SH3 domains. The Src SH3 domain recognizes a proline-rich motif m an actm filament-assoctated protein of 110 KDa; this interaction leads to phosphorylation of the protein by the catalytic domain of Src (4). Similarly, the SH2 domain of the Abl tyrosine kmase is required for hyperphosphorylation of rts substrate p130CAS (5). Substttutions of SH2 domains in nonreceptor tyrosme kinases with heterologous SH2 domains result in the phosphorylatton of alternative substrates m vivo (6). There is ample evidence that the mtrinsrc specificities of the kinasecatalytic domains are also important in signaling by tyrosme kinases. This has been shown dramatically for the RET receptor tyrosme kmase, where a Met9 18 + Thr mutation m the catalyttc domain that alters substrate specificity causes multiple-endocrme neoplasia type 2B (7-9). Studies with synthetic pepFrom
Methods
m Molecular
Bology,
Vol 84 Transmembrane
Slgnabng
Edited by D Bar-Sag1 0 Humana Press Inc , Totowa, NJ
75
Protocols
76
Chan and Miller
tides also mdicate that tyrosine kmase catalytic domains have distinct preferences for residues surrounding tyrosme. Thus, single amino acid changes in peptides containing Tyr-Met-X-Met motifs have different effects on recogmnon by the Src, Abl, and insulin-receptor tyrosme kinases (IOJI). Even for the closely related msulm and insulin-like growth factor (IGF-I)-receptor kinases, intrinsic differences m substrate specificity are apparent using synthetic peptides derived from insulin receptor substrate- 1 (IRS- 1) (12). Combmatorial-pepttde libraries have been used to search systematically for amino acids that confer recognition by tyrosine kmases. In thus experimental strategy, residues near tyrosme are randomized, and preferred substrates are selected from the pool of peptides. These experiments suggest that determinants for substrate recogmtron differ from kinase to kmase. Several experimental approaches have been used to identify the preferred substrates in pepttde libraries. Till et al. (13) employed a liquid chromatography-electrospray massspectrometry system to identify and quantify phosphopeptldes from library reactions with cyclic adenosme monophosphate (CAMP)-dependent protem kinase or v-Abl. An alternative strategy was described by Wu et al. (14, m which single peptides were synthesized on inert beads. After phosphorylation in the presence of [y-32P]-adenosine triphosphate (ATP), peptide-bound beads were dispersed m agarose and visualized by autoradiography. In both of these approaches, individual phosphopeptides are selected from the library. Another method was described by Songyang et al. (9), in which a ferric-chelating column was used to separate phosphopeptldes from unphosphorylated peptides. In this case, the entire mixture of phosphopeptides was sequenced to determine consensus sequences for phosphorylation. This approach has the advantage that a large number of degenerate positions may be screened simultaneously. The method described in this chapter to select phosphopeptides relies on immunoaffmity chromatography on a column containing monoclonal anttphosphotyrosine antibody (15). Further separation of the bound phosphopeptides 1s accomphshed using reverse-phase high-pressure hquld chromatography (RP-HPLC) (Fig. 1). In this manner, individual phosphopeptides are isolated prior to Edman sequencing.
2. Materials
2.1. Peptide-Library Synthesis 2.1.1. Reagents (see Note 1 for supplIers) 1. t-butoxycarbonyl (t-Boc) protected ammo acids, 25 g each, stored dry at -20°C 2 Boc-t-ammo acid-Merrlfleld resin with C-terminal residue attached, 0 3-0.5 meq/g (Peninsula Laboratories, Belmont, CA)
77
Optimal Substrates of Tyrosine Kinases Library of peptlde substrates containing “randomized” positions
Tyrosine
Kmase
[y32P]-ATP
Anti-phosphotyrosine agarose
HPLC Sclntlllatlon
counting
b
‘-_
b
Sequence
NHp
8 Xa - Xb - X, -Tyr-
-COOH
analysis
Fig 1 Studying kmase specificity
using peptlde libraries
3 Hydroxybenzotrlazole (HOBt) 4. Kaiser Test reagents (see Note 2). a. 200 mM KCN m pyndme. Dissolve 33 mg KCN m 50 mL water Add 0 2 mL of the aqueous solution to 9.8 mL pyndme. KCN IS highly toxic and poisoning may occur by mgestlon or absorption through 1nJured skin. The unused aqueous KCN solution may be stored at -20°C m the dark. Pyndme should be stored m the dark m a tightly closed container to prevent oxldatlon. Note that pyridme may cause irritation of skm and respiratory tract upon exposure or inhalation b. Ninhydrma Dissolve 500 mg mnhydrm m 10 mL n-butanol c Phenol: Dissolve 80 g phenol m 20 mL n-butanol or mix 80 g of liquid phenol m 10 mL n-butanol. Phenol 1s highly corrosive and can cause severe burns. Phenol should be kept m the dark at 4°C m a well-enclosed container 5. Solvents (see Note 3): a. Methylene chloride (CH,Cl,) b. 25% Trlfluoroacetlc acid (TFA) m CH2C12 c 5% N,N-dnsopropylethylamme (DIEA) m CH,Cl,. d. 33% Ethanol m CH2C12 e Anhydrous lsopropanol f. 100% Ethanol. g. N,N-dlmethylformamlde (DMF) h Dnsopropylcarbodnmlde (DIC). 1. Trifluoroethanol (TFE) J. Acetic anhydride.
Chan and Miller
78 2.1.2. Equipment 1 2. 3 4 5 6
DuPont RaMPS Multtple Pepttde Synthesis System (see Note 4) Dessicator. HPLC system Cl8 Semipreparattve column, 1 0 x 25 cm (Vydac, Hesperta, CA) Lyophthzer. Vacuum pump
2.2. Pep tide Phosphoryla
tion
1, Soluble tyrosme kmase, stored m 40% glycerol at -20°C. In our laboratory, the enzyme concentrattons for library experiments have ranged from 0.3-1.0 mg/ mL, with specific activtties of 1 O-10 0 nmol/mm/mg toward synthetic-peptide substrates Approx 50-100 PL of sucha solution is required to complete the studtes described here. 2. 5X kmase buffer 100 mM MgCl,, 150 r&f Trts-HCl, pH 7 4, 5 mg/mL bovme serum albumin (BSA). 3 5mMATP,pH74 4 [Y-~*P] ATP (10 mCi/mL) (New England Nuclear, Boston, MA) 5 P81 phosphocellulosepads (Whatman, Htllsboro, OR). 6. 10% Trichloroacetic acid (TCA). 7. 0.5% Phosphoric acid. 8. 100% Acetone. 9. MicroconU (Amicon, Beverly, MA).
2.3. Phosphopeptide 2.3.1 Reagents
Isolation
1. Monoclonal antiphosphotyrosme antibody-agarose (Upstate Btotechnology [Lake Placid, NY] or Sigma [St. Louts, MO]). 2. Wash buffer: phosphatebuffered saline (PBS) (pH 7.4) with 0.1% sodium aztde 3. Elution buffer. 0.1 M glycme (pH 3.0). 4. HPLC solvents* a 0.1% TFA m water. b 0.1% TFA m 3.1 acetomtrile.water. 5 Sequelon-AA Reagent Kit (Millipore, Bedford, MA).
2.3.2. Equipment 1 HPLC system 2. Analytical Cl8 reverse-phasecolumn, 0.46 x 25 cm (Vydac)
3. Methods As described tn detail below, peptide libraries are prepared by soltdphase peptide synthesis using a t-Boc protection strategy (16). At each
Optimal Substrates of Tyrosine Kinases degenerate position, the peptide-resin is divided into 20 equal parts by weight. Each part is coupled twice to a sixfold excess of activated HOBt ester of a unique amino acid. Qualitative ninhydrin tests (Kaiser tests; see ref. 17) are performed after each individual coupling to ensure complete reaction. After coupling, all parts are recombined before proceeding to the next cycle. Peptide libraries are designed to include two adjacent basic residues (argirune or lysine) at either the amino or carboxyl terminus. This allows for the quantification of phosphorylation by the phosphocellulose-paper assay (18). A minimal length of six amino acid residues is believed to be required for recognition by tyrosme kmases (19). The method for phosphopeptide isolation described here is suitable for libraries with four or fewer degenerate positions (using all 20 common ammo acids at each position). For more complex libraries, the concentrations of individual phosphopeptides in the kinase reactions are too low to be isolated and sequenced. More than four degenerate positions may be screened simul-taneously if a subset of the 20 amino acids are used at each position. Alternatively, the entire mixture of phosphopeptides eluted from the anti-phosphotyrosine column may be sequenced directly (see ref. 9) to determine selectivity at each randomized position.
3.1. Synthesis and Purification of Peptide Library 3.1.1. Deprotection and Neutralization of Peptide-Resin 1. Add CH2C12 to 0.4 mmol of peptide-resin, mix 1 minute, and drain. The volume of each wash should be 2 20 mL per gram resin. All washes are mixed for 1 mm unless otherwise indicated. Repeat wash four times. 2 Add 33% TFA m CH,Cl,, mix for 1 mm, and dram 3. Repeat step 2, mix for 30 mm, and dram. 4. Wash with CH2C12 twice 5 Wash with isopropyl alcohol once. 6. Wash with CH$l, three times. 7. Wash with 5% DIEA m CH&, mix for 2 min, and drain. 8 Wash with CH,Cl, twice. 9. Wash with 5% DIEA m CH,Cl,, mix for 2 min, and dram 10 Wash with CH& five times. 11 Proceed to Subheading 3.1.2. for incorporating defined positions or to Subheading 3.1.3. for incorporatmg random positions.
3.1.2. lncorporatlon
of Defined Positions
1 Dissolve an eightfold molar excess of Boc-ammo acid m CH2C12 at room temperature with stirring. The volume should be = 20 mL per gram resin. A mini-
80
2. 3. 4. 5 6 7 8 9 10 11.
Chan and Miller mum amount of DMF can be added (up to 10% of total volume) to drssolve BocLeu, Boc-Arg(Tos), Boc-H~s(Tos), and Boc-Trp. Move the ammo acid solutton to an ice bath and add a fourfold molar excess of DIC Stir for 20 mm m the me bath. Add this solutton to the pepttde-resm after step 10 of Subheading 3.1.1. and mix for 20 mm Do not dram after this step Make a solution containing a twofold excess of DIEA (with respect to peptide) m TFE Volume of this solutton should be about 20% of the volume in step 2. Add the DIEA/IFE solution to the peptide-resm mixture, mix for another 10 mm, and dram Wash with CH,C12 three times Wash with 33% EtOH m CHQ, three times Wash with 100% EtOH once Perform Kaiser test (see Subheading 3.1.4.). After couplmg, the peptide-resin is stable and may be stored dry at 4°C. For mcomplete couplmg (1.e , tf blue colored beads are detected m the Kaiser test), recouplmg with the same Boc-ammo acid is recommended, startmg at step 6 of
Subheading
3.1.1.
12 If mcomplete couplmg results even after recoupling, acetylation 1srecommended to terminate unreacted-peptide chains. Acetylatton 1sperformed accordmg to the following protocol a. Make a solution of 15-fold molar excess acetic anhydrtde and twofold molar excess DIEA m CH,Cl, The volume should be 20 mL per gram resm b Add solution to peptide-resin, mix for 20 mm, and dram c Perform Kaiser test to confirm completion of acetylation 13. The peptrde-resin 1s now ready for cleavage or mcorporatton of the next posttton For cleavage, proceed to Subheading 3.1.5. For mcorporation of the next posttion, begm again from Subheading 3.1.1.
3.1.3. Incorporation
of Randomized Positions
1 Dry the peptide-resm (from the end of the protocol in Subheading 3.1.1.) zrz vacua for 1 h 2 Divide the peptrde-resm mto 20 equal parts by werght and put each part mto an mdtvidual RaMPS reaction tube 3. Measure out a sixfold molar excess of each Boc-ammo actd 4 Make 40 mL of couplmg solutton with 6 molar equivalents of HOBt and 6 molar equivalents of DIC in CH.$l, containing 5% DMF 5 Dtssolve each Boc-ammo acid m 2 mL of couplmg solution 6 Add the ammo acid-couplmg soluttons to RaMPS reaction tubes containing the peptide-resin. 7. Rock m RaMPS apparatus for 1 h at room temperature 8. Wash all reaction tubes with 2 5 mL CH,Cl, Repeat wash four times.
Optimal Substrates of Tyrosine Kinases
81
9. Repeat steps 3-8. 10. Perform Kaiser test on all 20 reactions (Subheading 3.1.4.). If mdrvidual reactions show mcomplete coupling, they may be acetylated (refer to step 12 of Sub-
heading 3.1.2.). 11. Upon completion of coupling for all reactions (as confirmed by the Kaiser test), recombine the peptrde-resm and dry 112wxuo 12. The peptide-resin is now ready for cleavage or incorporation of the next posmon For cleavage, proceed to Subheading 3.1.5. For incorporation of the next position, begin again from Subheading 3.1.1.
3. I 4. Kaiser Test 1. Set a heat block to 98°C. 2. Using a Pasteur pipet, dispense 15-30 resin beads mto a culture tube (6 x 50 mm or comparable size). 3 Dispense two drops each from Kaiser reagents A, B, and C mto the tube. 4. Mix the tube contents and incubate at 98°C for 1 mm. Examine the color of beads and solution against a white background 5 The percent completion of coupling may be approximated by the color of the beads and solution (16,17) Percent completion 76 84 94 Near 100
Color Dark blue beads, dark blue solution Dark blue beads; moderately blue solution Moderately blue beads;trace of blue in solution Trace of blue of beads;yellow solutton
3.1.5. Cleavage of Peptxie Library from Resin 1. Cleave the peptide library from the Merrifield resin usmg either hydrogen fluoride (16) or the DePro Peptrde Cleavage Kit (Sigma) accordmg to the manufacturer’s spectfications. The latter method avoids the use of HF; we have obtained sattsfactory results for cleavage of peptide libraries with this method. 2 After cleavage, extract crude-peptide library from the resin four times with an aqueoussolutton of 10% acetic acid on a glassfunnel with a fretted disk.
3.1.6. Purification of Peptide Library 1. 2 3 4
Dissolve peptide library m water or an aqueoussolutron of 15% acetic acid Equilibrate a C 18 semipreparative HPLC column (1 .Ox 25 cm) m 5% buffer B Inject 0.5 mL peptide library solutton (approx 20 mg/mL) onto the HPLC column Run the column at 5% buffer B for an additional 10 mm Elute peptides using a 30-min gradient of 5 to 95% solvent B. Momtor absorbanceat 220 nm 5 Collect peaksof absorbancethat elute after the end of the void volume 6. Remove acetonitrile in vucuo and lyophilize peptide library
82
Chan and Miller
7 Dissolve lyophlhzed peptlde library m water at a concentration of 15-20 mg/mL. 8. Equal dlstrlbutlon of ammo acids m the randomized posltlons may be verified by ammo acid analysis, mass spectrometry, or peptlde sequencmg (13) The amounts of peptlde library needed for these analyses depends on the molecular weight of the peptide and the number of degenerate posltlons. As an example, about 100 pg of a 13-residue library with three degenerate posltlons 1s needed for each determination
3.2. Phosphorylation of Peptide Library by a Tyrosine Kinase 3.2.1. Determining Condltlons for Opt/ma/ Phosphorylation Condltlons for phosphorylatlon are determined using the phosphocellulose paper-binding assay (18). Small-scale test reactions are performed to optimize these variables: length of mcubatlon, concentration of peptide library, concentration of enzyme, and Mn2+ concentration (see Note 5) 1 Make up test reactlons as follows. prepare five kmase reactions 5X Kmase buffer 5mMATP Y-~*P ATP 100 mM MnCI, Peptlde hbrary (1.5 mg/mL final cone ) Water Tyrosme kmase Total volume
For the first test (varymg
mcubatlon time),
Kmase reaction, FL 50 10 01 1.0 20
Blank, pL 50 10 01 0.0 20
13 9 2.0
16.9 0.0
25 0
25 0
2 3 4 5 6
Incubate the reactions at 30°C for 30,60,90, 120, and 150 mm Add 45 pL ice-cold 10% TCA to each reactlon and vortex Spin for 2 mm in microcentrifuge (12,000g) Spot 35 FL of supernatants onto P81 filter circles Wash the spotted P81 filter cucles three times with 200 mL 0.5% Ice-cold phosphoric acid (5 mm per wash) (see Note 6) 7. Wash once with 200 mL acetone at room temperature for 5 mm (see Note 7)
8 Allow 5 mm for the filter circles to dry at room temperature 9 Put filter circles mto scmtlllatlon
vials and measure 32P mcorporatlon
by scmtll-
latlon counting (see Note 8). 10 Repeat above procedure to determine optimal concentrations of enzyme, peptlde library, and MnC12. The condltlons for a large-scale peptlde-hbrary phosphorylatlon reaction are taken from the reaction that shows maximal phosphate mcorporation (see Note 9)
83
Opt/ma/ Substrates of Tyrosme Kinases 3.2.2. Large-Scale Reaction of Peptide-Library by Protein Tyrosine Kinase 1 Perform a large-scale phosphorylation determined from Subheading 3.2.1. 5X Kmase buffer 5mMATP Y-~*P ATP 100 mM MnCl* Peptide library Water Tyrosme kmase
100 PL 20 pL 2YL Variable Variable Vartable Vartable
Total volume
500 l.tL
Phosphorylation
reaction as follows,
using condmons
2. Remove a 25+tL aliquot from the kinase reaction. 3. Follow steps 3-9 of Subheading 3.2.1. for the 25 l.t.L aliquot to quantify 32P incorporation. 4 Load the remainder of the kinase reaction into two Mlcrocon-10 U and spin m a microcentrtfuge at room temperature until the volume left above the filter is 520 pL At 14,000 rpm, the required time for centrifugation is approx 15 mm. 5. The Microcon- 10 filtrate contains phosphopepttdes and unphosphorylated peptides from the kinase reaction. It may be stored at -20°C at this point.
3.3. Isolation The following 1 2. 3. 4. 5. 6 7 8 9. 10. 11. 12. 13. 14.
of Phosphopeptides
from Peptide Library
procedures are performed
at 4°C.
Dispense 0 5 mL of antiphosphotyrosme resin mto a 15-mL tube. Add 4 mL ice-cold PBS, rock for 2 min and centrifuge at 200g for 4 mm. Remove liquid supernatant without disturbmg the resin bed. Repeat steps 2 and 3 once more. Add the Microconfiltrate containing both phosphorylated and nonphosphorylated peptides to the resin and rock for 30 mm Load the filtrate and resin mixture onto a small glass column (0 5 cm ID). Collect flowthrough m a scmtillation vial. Wash column with 2 mL PBS and collect fractions Repeat wash 10 times. Elute phosphopepttdes with 2 mL 0 1 M glycine (pH 3.0) and collect. Repeat twice more Wash column with PBS and store m 4°C. Analyze collected fractions by liquid scinttllatton counting (see Note 10). Pool elution fractions with radioactivtty lo-fold greater than the last wash fraction The total volume will range from 2 to 6 mL Equilibrate an analytical Cl8 HPLC column in 5% buffer B. Apply pooled fractions to HPLC column
84
Chan and Mller
15. Elute phosphopeptides using a l-h gradient from 5 to 95% solvent B. 16 Collect peaks absorbing at 220 nm and analyze by liquid scintillation countmg to confirm the presence of 32P, 17 Concentrate the peaks of interest to approx 20 pL m a Speedvac concentrator 18 Lmk the peptides m collected peaks onto Sequelon-AA membranes (see Note 11) and SubJect to peptide sequencing
4. Notes 1. Peptide-synthesis reagents and solvents may be purchased from Advanced ChemTech (Louisville, KY) or Peninsula Laboratories (Belmont, CA) Solvents may also be obtained from Aldrich (Milwaukee, WI) or JT Baker (Phillipsburg, NJ) 2. Kaiser-test reagents should be stored m the dark and are stable for up to 3 wk These reagents are toxic and must be handled with care. Gloves, protective goggles, and a lab coat should be worn at all times. The reagents should be used only m a chemical fume hood. 3. Many of the organic solvents used m solid-phase peptide synthesis are highly volatile, toxic, and corrosive Handlmg should be confined to a chemical fume hood and protective gloves, lab coat, and goggles should be worn at all times. DMF should be stored with a layer of 4A molecular sieves for a week before use to remove contammatmg dimethylamme Prepare only small volumes of 5% DIEA/CH,Cl,, as this mixture is unstable. 4. Synthesis may be done with any system capable of multiple-peptide synthesis. A synthetic scheme suitable for either automated or manual synthesis 1s given m
Subheading
3.1.
5. Protein tyrosme kmases differ with respect to the concentration of Mn*+ required for maximal activity (20). For example, platelet-derived growth-factor receptor tyrosme kinase has maximal activity at 6 mM MnC12, whereas the catalytic domain of v-Abl does not require MnC12 (Chan et al, unpublished observations) 6. The progress of the washmg steps can be followed by removmg the P81-filter circle for the blank reaction and checking it with a Geiger counter. 7. Mark the filter circles with pencil, not pen. The acetone wash removes pen markings 8. The specific acttvity of ATP m a kmase reaction (e g , m cpm/pmol) can be determined by spotting a small sample (2-5 pL) of the reaction onto a P8 1-filter circle and countmg directly (no washing) Counts per mm obtained m the kmase reaction (minus blank) are then divided by the specific acttvity to determine the moles of phosphate transferred m the reaction. 9 In general, the earliest time point that gives high phosphorylatton should be chosen, as shorter reaction times predict relative k,,,/&, values for competmg substrates more accurately (13). When peptide-library reactions are carried out for extended periods of time, some phosphorylation of poorer substrates may be observed (13) 10 Expect high radioactivity m the first few washes due to free (Y-~*P) ATP 11 Peptides are linked via their C-termmt onto aryl amme-derivatized disks Reagents and protocols are provided by the manufacturer (Millipore, Bedford, MA)
Opt/ma/ Substrates of Tyrosrne Kinases
85
References 1. Pawson, T. (1995) Protein modules and signalling networks. Nature 373,573-580. 2. Cohen, G. B., Ren, R., and Baltimore, D. (1995) Modular binding domains m signal transduction proteins. Cell 80,237-248. 3 Rhee, S G. and Chow, K D. (1992) Multrple forms of phosphohpase C isozymes and then activatton mechanisms. Adv. Second Messenger Phosphoprotein Res 26,35-61. 4. Flynn, D. C., Leu, T. H., Reynolds, A. B., and Parsons, J. T. (1993) Identification and sequence analysts of cDNAs encoding a llO-kilodalton actm filamentassociated pp60src substrate. Mol. Cell. Biol 13,7892-7900. 5. Mayer, B. J., Hirai, H., and Sakai, R. (1995) Evidence that SH2 domains promote processlve phosphorylatron by protem tyrosine kinases. Curr Blol 5,296-305. 6. Mayer, B J. and Balttmore, D. (1993) Mutagenic analysis of the roles of SH2 and SH3 domains in the regulation of the Abl tyrosme kmase. Mol. Cell Blol 14,2883-2894.
7. Carlson, K. M., Dou, S., Chi, D., Scavarda, N., Toshima, K., Jackson, C. E., Wells, S. A., Jr., Goodfellow, P. J , and Doms-Keller, H. (1994) Single missense mutation m the tyrosme kmase catalytic domain of the RET protooncogene is associated with multtple endocrine neoplasia type 2B. Proc Nat1 Acad. Scz. USA 91, 1579-1583. 8. Hofstra, R. M., Landsvater, R. M., Ceccherim, I., Stulp, R. P., Stelwagen, T , Luo, Y., Pasmi, B , Hoppener, J. W , van Amstel, H. K., Romeo, G., Lips, C. M. J., and Buys, C. H. C. M. (1994) A mutation m the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcmoma. Nature 367, 375,376.
9. Songyang, Z., Carraway, K. L., III, Eck, M. J , Harrison, S. C., Feldman, R. A., Mohammadi, M., Schlessinger, J., Hubbard, S. R., Smith, D. P., Eng, C., Lorenzo, M. J., Poner, B. A. J., Mayer, B. J., and Cantley, L. C. (1995) Catalytic specificity of protein-tyrosme kmases IS crttical for selective signallmg. Nature 373,536-539. 10. Garcia, P., Shoelson, S E , George, S. T., Hinds, D. A., Goldberg, A. R., and Miller, W. T. (1993) Phosphorylation of synthetic peptides containing Tyr-Met-X-Met motifs by nonreceptor tyrosme kmases m vitro. J Blol Chem 268, 25,146-25,151. 11, Shoelson, S. E., ChatterJee, S., Chaudhuri, M., and White, M F. (1992) YMXM motifs of IRS-l defme substrate specificity of the insulin receptor kmase. Proc. Natl. Acad. Scl. USA 89,2027-203 1. 12. Bin, X., Bird, V G., and Miller, W. T. (1995) Substrate specificities of the insulin and insulin-like growth factor I receptor tyrosine kinase catalytic domains. J Bzol Chem 270,29,825-29,830.
13. Till, J. H., Annan, R. S., Carr, S. A., and Miller, W. T. (1994) Use of synthetic peptide libraries and phosphopeptide-selective mass spectrometry to probe protein kinase substrate specificity J Blol. Chem 269,7423-7428.
86
Chan and Miller
14 Wu, J , Ma, Q. N., and Lam, K S (1994) Identlfymg substrate motifs of protein kmases by a random library approach. Blochemlstry 33, 14,825-14,X33 15. Chan, P M , Keller, P R , Connors, R. W., Leopold, W R , and Mtller, W T (1996) Ammo-termmal sequence determmants for substrate recognition by plateletderived growth factor receptor tyrosme kmase FEBS Lett 394, 121-125 16. Stewart, J. M and Young, J. D. (1984) Soled Phase Peptzde Syntheses (2nd ed ), Pierce Chemical Co , Rockford, IL. 17. Kaiser, E , Colescott, R. L , Bossmger, C. D., and Cook, P. I (1970) Color test for detection of free terminal ammo groups m the solid-phase synthesis of peptides Anal Blochem 34,595-598. 18 Casnelhe, J. E. (1991) Assay of protem kmases usmg peptides with basic residues for phosphocellulose bmdmg Methods Enzymol 200, 115-120. 19 Edison, A. M., Barker, S. C , Kassel, D B , Luther, M. A., and Knight, W B (1995) Exploratton of the sequence specificity of pp60”-“” tyrosme kmase J Blol Chem 270,27,112-27,115 20 Geahlen, R. L. and Harrtson, M. L (1990) Protein-tyrosme kmases m Peptzdes and Protein Phosphorylatlon (Kemp, B., ed.), CRC, Boca Raton, FL, pp. 239-253.
5 Mapping the Specificity of SH3 Domains with Phage-Displayed Random-Peptide Libraries Andrew B. Sparks, James E. Rider, and Brian K. Kay 1. Introduction Recent inquu-res mto the molecular mechanisms underlying cellular behavior have underscored the importance of dynamic associations between proteins, or protein-protein interactions, in regulating a variety of brological processes. These protein-protem interactions are often mediated by conservedmodular domains, such as the Src Homology domains 2 and 3, known as SH2 and SH3 (1,2). Recently, combmatorral-peptrde libraries have been used to define high-affinity peptide hgands for a variety of modular domains (3-8). Ligands derived from these libraries often resemble sequences in natural-bindmg proteins. Thus, combinatorral-peptide libraries provide a means of mappmg modular domain-mediated protein-protein mteractrons, particularly where the natural target of the domain is a short linear stretch of ammo acids. To assess the ligand preferences of SH3 domains, we (and others) have used phage-displayed peptrde libraries (9-12). Based on the observation that all naturally occurring SH3 ligands contam at least one PXXP motif, we have constructed a library of peptrdes of the form X6PXXPX,, termed the PXXP library. Using this library, we have defined peptrde ligands for a number of different SH3 domains (13). Each SH3 domain selects peptrdes sharmg a drfferent proline-rich consensus motif, indicating that different SH3 domains prefer lrgands with distinct sequences surrounding the PXXP core. These preferences likely regulate the association of SH3 domain-containing proteins with particular mtracellular targets. Here, we describe the construction and screening of phage-displayed peptrde libraries, with an emphasis on the apphcation of these methods to the analysis of SH3-ligand preferences. From
Mefhods
m Molecular Bology, Vol 84 Edited by Cl Bar-Sag1 0 Humana
87
Transmembrane S/gna/mg Press Inc , Totowa, NJ
Protocols
Sparks, Rider, and Kay
88
2. Materials 1 Two synthetic oligonucleotides for generatron of the PXXP library 5’-ctgtgcctcgagk(nnk)6cca(nnk)2cca(nnk)6tctagacgtgtcagt-3’, HPLCpurified 5’-actgacacgtctaga-3’, where k = g + t and n = g + a + t + c. 2 SequenaseTM, Sequenase buffer, acetylated bovine serum albumin (BSA), dithiothreitol (DTT), deoxyribonucleotides (dNTPs), phenol, chloroform, restriction enzymes, Taq DNA polymerase US Biochemicals, Cleveland, OH 3 1X TE. 10 mM Tns-HCl, pH 7 5, 1 mM ethylene diamme tetra-acetic acid (EDTA) 4 100 mM NaHCO, (pH 8.5): 8.3 g NaHCO, dtssolved m 1 L ddH,O; autoclave 5 1X Phosphate buffered salme (PBS): 137 mM NaCl, 3 mJt4 KCl, 8 mA4 Na*HPO,, 1 5 mM KH,PO,; 10X stock solution. 80 0 g NaCl, 2 0 g KCl, 11.5 g Na2HP04 . 7H20, 2.0 g KH,PO, dissolved m 1 L ddHzO, then autoclave and dtlute 1 10 with sterile ddH20 6. PBS-Tween-20: Add 1 mL Tween-20 to 1 L PBS 7. 50 mM Glycme-HCl (pH 2 0), 1 M stock solution* 111 6 g glycme to 1 L ddH,O Adjust pH to 2 0 with HCl, then autoclave Dilute to 50 mM with sterile ddH,O 8 200 mA4 Sodium phosphate buffer, pH 7 5, 1M stock solution* 44 16 g NaH,PO, H20, 450 66 g Na,HP04 7H,O to 1 L ddH,O. Autoclave. Dilute to 200 mM with sterile ddH,O. 9. 2xYT media, 2xYT top Agar, and 2xYT bottom agar: 10 g tryptone, 10 g yeast extract, 5 g NaCl, 1 L ddH,O Add 15 g bacto-agar for 2xYT bottom agar, or 8 g Bacto-agar for 2xYT top agar Autoclave 10. 2% IPTG* 0.2 g isopropyl-P-n-thiogalactopyranoside m 10.0 mL sterile ddH*O Filter sterilize and store at -20°C. 11. 2% XGAL: 0.2 g 5-bromo-4-chloro-3-mdoyl-p-n-galactoside m 10.0 mL dimethylsulfoxide (DMSO) or dimethyl formamide (DMF). Limit exposure to light and store at -20°C 12. ABTS (2’,2’-azmo-bls 3-ethylbenzthrazolme-6-sulfomc acid) solution Prepare 50 n&! citric acid* 10 5 g citrate monhydrate m 1 L sterile ddHzO. Adjust pH to 4 with approx 6 mL of lOA NaOH, then add 220 mg ABTS. Filter sterilize, store at 4°C. Stable for at least 6 mo Immediately before use, add 30% H,02 to 0 05% final concentration. 13. Gene III sequencing primer for single-stranded template DNA. 5’ tgaattttctgtatgagg 3’ 14 1X Tris borate EDTA buffer (TBE)* 89 mM Tris-borate, 89 mM boric-acid, 2 mM EDTA; 10X stock solution 108g Tris-base, 55g boric acid, 40 mL 0 5 M EDTA dissolved m 1 L ddH,O; then dilute 1 10 with ddH20
3. Methods
3.1. Phage-Displayed Bacteriophage tions of peptides tides by affinity
Peptide Library Construction
Ml 3 has been adapted for the expression of dtverse populain a manner that affords the rapid purtflcatton of active pepselection (14-16) We describe herein the construction of
Phage-Displayed
Peptlde libraries
89
libraries of peptides expressed as N-terminal fusions to the Ml3 minor coat protein, ~111.The random peptides are encoded by a DNA insert assembled from synthetic degenerate oligonucleotides and cloned into gene III (Fig. 1). Using techmquesdescribed m this chapter, it is possible to construct libraries compnsmg billions of different peptide sequencesm aslittle astwo weeks (see Note 2). Our purpose m constructing the PXXP library was to generate a population of peptides biased for SH3 ligands. Thus, we designed the degenerate ohgonucleotides to encode a peptide of the form X6PXXPX6. However, the following protocol is readily adapted to the construction of any number of differentially biased peptide populations (see Note 1). 1 Prepare the insert DNA cassette by annealmg the degenerate ohgonucleotides a microcentrtfuge tube.
m
011go 1 (400 pmol) XCLL 011go 2 (400 pmol) Xcls, 5X Sequenase buffer (1X) 40 w ddH,O (200 pL total volume) XCLL Incubate the mixture at 75°C for 15 min. Allow the reaction to cool slowly to <35”C (-30 mm) 2 Convert the annealed oltgonucleotides to double-stranded DNA by adding the following
2.0 /AL 2.0 pL
[email protected] pL
20 mM dNTPs 10 mg/mL Acetylated BSA 100 mM DTT 13 U&L Sequenase
(02n3w (0.1 mg/mL) (1 mm GO w
Incubate the reaction at 37’C for 30 mm Heat inactivate the DNA polymerase by incubating the tube at 65°C for 1 h. 3. Prepare the restriction digestion reaction by adding the followmg. 40 CLL 4cLL 4cLL XW
10X Restriction enzyme buffer 10 mg/mL Acetylated BSA 100 rnM DTT ddHzO
(1X) (0.1 mg/mL) (1 mm (400 pL final volume)
Remove a 20-pL ahquot as a no enzyme control Divide the remaining solution mto two tubes and add 100 U XhoI to one tube and 100 UXbaI to the second tube. Remove all but 20 pL from each of the single-digest tubes and combme m a new tube. Incubate all tubes at 37°C for 3 h. 4. Purify the double-digested DNA fragment by nondenaturmg polyacrylamtde gel electrophoresis (PAGE) (17). Stain the gel with 0.2 pg/mL ethrdmm bromide and photograph the gel using a long-wavelength UV transdlummator. Excise the band of interest with a razor blade. Avoid exposure of eyes and skm to the UV hght and ethtdmm bromide.
90
Sparks, Rider, and Kay
4 displayed
b peptide
Ml3 Bacteriophage
Fig. 1. Library construction: One long oligonucleotide with fixed (black) and degenerate (gray) codons is annealed with a shorter oligonucleotide. This partially double-stranded DNA is converted into double-stranded DNA with T7 DNA polymerase (SequenaseTM). Sticky ends are generated at the fragment termini by cleavage with the restriction enzymes XhoI and XbaI. The fragments are then cloned into gene III of the vector mBAX to construct the library of bacteriophage M13-displayed peptides. 5. Recover the DNA insert by crushing the gel and resuspending it in 3.0-mL 0.5 M ammonium acetate. Incubate the suspension with gentle agitation overnight at 37°C. Pellet the gel fragments by centrifugation and recover the liquid. Filter the liquid through silanized glass wool to remove residual polyacrylamide fragments. Reduce the vol to 0.5 mL with repeated 1-butanol extractions. The DNA remains in the aqueous (lower) phase. Alternatively, use electroelution to recover the DNA from the gel fragment (27). 6. Extract the sample with an equal vol of 50:50 phenol/chloroform. Precipitate the DNA by addition of 0.1 vol 3 M sodium acetate, pH 5.2, plus 2.5 vol of cold 100% ethanol. Recover the DNA by centrifugation at 14,000 rpm (20,800g) in a microcentrifuge for 30 min at 4°C. Decant the supematant and wash the DNA pellet with 0.5 mL ice-cold 80% ethanol. Recentrifuge and remove the ethanol, being careful not to aspirate the DNA pellet. Air-dry the pellet and dissolve it in 200 pL TE. Aliquot the assembled insert into several tubes and store at -70°C.
Phage-Displayed
Peptide Libraries
91
Avoid SubJectmg the DNA insert to repeated freeze-thaw cycles, as this may lead to reduced cloning efficiency. 7. Assess the integrity and concentration of the DNA insert by running 10% of the sample on a nondenaturmg 15% polyacrylamtde gel. Run the double-digested DNA sample from step 3 as a control Estimate the concentration of the DNA insert by ethidmm bromide stammg The use of 400 pmol of each ohgo m this procedure should result m the recovery of at least 100 pmol of purified doubledigested insert DNA This corresponds to approx 5 ug of a 75-bp insert, for a final concentration of 25 ng/pL. 8. Large-scale preparation of Ml3 rephcative form (RF) DNA has been described elsewhere (17) Prepare RF DNA of an Ml 3 vector wherein gene III has been engineered to accept degenerate ohgonucleotide inserts In this example, we used the vector mBAX, which contams XhoI- and XbaI-recogmtton sites within its gene III (13) 9. Digest 25O+g Ml3 RF DNA with the appropriate enzymes. XW 100 pL 10 & 10 NXclL
RF DNA 10X Restriction enzyme buffer 10 mg/mL Acetylated BSA 100 mM DTT ddH*O
(250 k9 (1X) (0.1 mg/mL) (1 mw (to 1000 pL total volume)
Remove a 20-pL ahquot as a no enzyme control. Divide the remaining solution into two tubes and add 300 U XhoI to one tube and 300 U XbaI to the other. Remove all but 20 uL from the single digests and combme m a new tube. Incubate all tubes at 37°C for 3 h (see Note 3) 10. Phenol:chloroform extract, ethanol precipitate, and recover the DNA as m step 6. Resuspend the DNA m 500 pL TE. Confirm complete digestion using a 0.8% agarose/lX TBE gel, Determme the DNA concentration by measurmg its optical absorbance at 260 nm. 11 Ligate vector and Insert at a molar ration of 1 vector to 3 insert XCLL XW 200 pL 25 w XCLL
Linearized vector DNA Insert DNA 10X T4 DNA ligase buffer 5 Weiss U&L T4 DNA hgase ddHzO
(100 ug = 20 pmol) (60 pmol) (1X) (125 Weiss U total) (2000 pL total volume)
Incubate the reactton at 15°C overnight. Include ligation controls such as a no-insert reaction and a no-hgase reaction Phenol:chloroform extract, Ethanol precipitate, and recover the DNA as in step 10 Resuspend the ligation m 200 pL TE. 12. Electroporatron of hgated Ml3 vector DNA typically yields efficiencies of lo7 transformants&g, Thus, the 100 pg ligation performed m step 11 should result m at least lo9 unique transformants. Because transformation efficiency decays considerably with electroporatton of >2 j,tg ligated Ml3 vector DNA, electroporatron
92
13
14
15.
16.
17
Sparks, Rider, and Kay of the ligation entails 50 separateelectroporatrons of 2 l.tg hgated DNA into 100 p.L electrocompetent cells Thus, prepare at least 5 mL of electrocompetent cells of an appropriate stram (18). We use DHSaF’ for TAG suppressionor JS5 for TAG nonsuppression Mix the large-scale hgation with the electrocompetent cells en masse at a ratio of 2 pg ligated DNA/100 pL electrocompetent cells. Keep the cells on ice until electroporation. Set the followmg parameters on the electroporation apparatus (e.g , Bio-Rad GenePulser; Bio-Rad, Hercules, CA)* V=20kV C=25p R = 400 W This combination, when usedwith 0.2-cm cuvets, will yield a pulse of 10 kV/cm, and theoretical time constant of 10 p.s. Carefully transfer 100 pL of the cell-DNA mixture mto a cold cuvet, place the cuvet mto the cuvet chamber, and electroporate. Immediately add 1 mL 2xYT to the cells and transfer the cells to a flask containing 1 L sterile 2xYT Continue this processfor the remammg49 electroporations Amplify the library by growmg the culture with aeration at 37°C for 8-10 h Harvest the library phage as soonaspossibleafter the culture hasreachedstationary phase,becauseexpressed peptrdes may be susceptibleto proteolysis. Determine the library complexity by plating SIX lo-fold serral dilutions of one of the (unamplified) electroporations for isolated plaques. Also plate cells electroporated with uncut Ml3 vector DNA and no DNA as posittve and negative controls, respectively Transfer the culture to four sterile 250-mL centrifuge bottles. Pellet the bacterial cells by centrifugation at 6000g for 10 mm at 4°C Carefully decant the supernatant mto new sterile 250-mL centrifuge bottles Precipitate the phage by adding 0 20 ~0130% PEG 8000, 1 6 M NaCl Mix well and Incubate at 4°C for 1 h Pellet the precipitated phage by centrrfugation at 10,OOOgfor 20 mm at 4°C Carefully decant the supernatant, recentrifuge the tube for 5 mm, and prpet off any residual liquid. Gently resuspendthe pellets m 20 mL sterile PBS. Remove msolublematerial by centrifugation at 6000g for 10 mm at 4°C Dispense lOO- to 500~@ allquots of the hbrary into sterile microfuge tubes. Flash-freeze the ahquots using a dryicesethanolbath and store at -70°C. Thaw one ahquot and determme the phage titer by plating. The titer should be approx 1013PFU/mL
3.2. Preparation
of GST-SH3 Fusion Proteins
A common means of producing large (100-1000 pg) quantities of purified target protein IS the pGEX system pioneered by Smrth and Johnson (26) and commercialized by Pharmacta, Prscataway, NJ. This approach entails the cloning of an appropriate DNA segment m frame with the gene for a S Japzconlum glutathrone-S-transferase (GST). After bacterial expression of the GST-fusion
Phage-D/splayed
Peptlde Llbrarles
93
protein, it is conveniently purified by glutathtone-affinity chromatography of cell lysates. Further, the fusion protein 1s readily recovered under nondenaturing conditions by competmve elution with free glutathione. We have used this system successfully to express and purify a large number of SH3 domams. GST-SH3 fusion coding sequences are readtly assembled by cloning PCR products mto any of the pGEX bacterial-expression vectors sold by Pharmacia. We typically use the vectors pGEX-2T or pGEX-2TK, both of which contam in-frame BumHI and EcoRI restriction sttes near the 3’ end of the GST-coding region and allow for thrombm-cleavage of the fusion protein from the GST morety. 1. Destgn ohgonucleottde prtmers to anneal to the 5’ and 3’ ends of an SH3-codmg template DNA (usually a cDNA fragment) The 5’ prtmer should contam an m-frame 5’ BumHI sue, whereas the 3’ primer should contam a 5’ EcoRI sue A 40-nm scale synthesis produces more than enough ohgonucleotrde Use 20 cycles (typtcally 95°C for 1 mm, 55’C for 1 mm, 72°C for 2 mm) of PCR to amplify the SH3 insert from lo-100 ng template DNA. 2. Phenol chloroform extract, Ethanol precrpttate, and recover the DNA as described m Subheading 3.1. An-dry the pellet and resuspend m 50 uL TE. Assemble the restrrctron digestion reactron by combmmg the followmg m a mmrocentrifuge tube. 50 w 20 ClL 12opL
PCR product DNA 10X Restrictton enzyme buffer ddH,O
(10 I%) (1-v (to 180 p.L total volume)
Remove a lO+L ahquot as a no enzyme control Dtvtde the remammg solutton into two tubes and add 5 pL (50 U) BamHI to one tube and 5 pL (50 U) EcoRI to the second tube. Remove all but 10 uL from each of the single digest tubes and combine m a new tube. Incubate each tube at 37°C for 3 h. 3. Phenol chloroform extract, Ethanol precipitate, and recover the DNA Au-dry the pellet and dissolve it m 500 pL TE Confirm complete digestton by resolving the digested DNA on a 2 0% agarose gel. Run a molecular-weight marker and the undigested and single enzyme-digested DNA samples as controls. Vtsuahze the DNA by ethtdmm bromide staining Determine the DNA concentration by measuring its optical absorbance at 260 nm 4 Large-scale preparation of double-stranded (ds) plasmtd DNA has been described elsewhere (17) Prepare dsDNA of an appropriate pGEX vector Here, we use pGEX2T(K), which wtll express m-frame BamHIIEcoRI restrtctton fragments. 5. Digest 20 B pGEX2T(K) dsDNA with BumHI and EcoRI by combmmg the following m a mrcrocentrtfuge tube XCLL 30 PXW
RF DNA 10X Restrictron enzyme buffer ddH,O
(20 l&z> (1X) (to 280 pL total volume)
94
Sparks, Rider, and Kay
Remove a 20-l.& ahquot as a no-enzyme control. Divide the remaining solution into two tubes and add 10 pL (100 U) BumHI to one tube and 10 pL (100 U) EcoRI to the second tube. Remove all but 20 pL from each of the single-digest tubes and combme m a new tube. Incubate all tubes at 37°C for 3 h. 6 Phenol:chloroform extract, Ethanol precipitate, and recover the DNA. An-dry the pellet and dissolve it in 500 pL TE. Confirm complete dtgestion by resolvmg the digested DNA on a 0 8% agarose gel Run a molecular-weight marker and the undigested and smgle enzyme-digested DNA samples as controls. Vtsuahze the DNA by ethrdmm bromide staining. Determine the DNA concentration by measuring its optical absorbance at 260 nm. 7 Assemble a ligation of vector and insert at a molar ratio of 3 Insert to 1 vector:
8
9.
10.
11.
Linearized vector DNA (2 pg = 6 pmol) x+ Insert DNA (18 pmol) XW 10X T4 DNA ligase buffer (1X) 10 w 5 Weiss U&L T4 DNA ligase (10 Weiss U total) 2w ddH*O (100 pL total volume) XPJIncubate the reaction at 15°C overnight Include ligation controls such as a no-insert reaction and a no-hgase reaction Phenol.chloroform extract, Ethanol precipitate, and recover the DNA as m step 6 An-dry the pellet and resuspend it in 20 pI. TE. Store the large-scale ligation at -70°C Transform an appropriate host strain of chemtcally competent F’ E colz (we have had satisfactory results with DHSaF’) with half of each hgatlon and plate for isolated colonies on selective (ampicdlm) media. Test individual colonies for the presenceof the appropriate insert using an appropriate diagnostic (e.g., msertspecific PCR) Use positive colonies to produce 4 mL overnight cultures Isolate recombinant pGEX-2T-SH3 DNA from the overnight cultures by alkaline lysis (17). Confirm insert sequencesby DNA sequencing To express GST-fusion protein, use a positive clone to inoculate 50 mL of 2xYT broth supplementedwith 100 pg/mL ampicillm and 1% glucose Grow the culture at 37°C with shaking overnight Use the 50-mL overnight culture to moculate 500 mL 2xYT broth supplemented with 100 pg/mL ampicillm and 1% glucose. Grow the culture at 37°C with shaking to an OD,,, of 1.0 (usually 2-3 h) Induce expressionof the tat promoter-driven fusion gene by addition of isopropyl P-n-thiogalactopyranose (IPTG) to a final concentration of 0.1 mM, and grow the culture an additional 6 h. Chill the cells on ice. It is important to keep the cells/lysates at 4°C for the duration of the procedure. Transfer the culture to two sterile 250-mL centrifuge bottles Pellet the cells by centrifugatron at 6000g (6000 rpm m a GSA rotor m a Sorvall RC-5B centrifuge) for 10 mm at 4°C. Decant the supernatant Resuspendthe cell pellet m 25 mL ice-cold PBS. Lyse the cells by somcation using four to six 10-s bursts (17) To solubihze the fusion protein, add Trtton X- 100to a final concentrationof 1% and tumble the solution at 30 rpm for 30 min at 4°C. Pellet the cell debris by centrifugation at 10,OOOg (8,000 rpm m a GSA rotor in a Sorvall RC-5B centrifuge) for 20 mm at 4°C. Recover the supernatant.
Phage-Displayed
Peptide Libraries
95
Fig. 2. SDS-PAGE of several purified GST-SH3 fusion proteins: Coomassie blue stained 12% polyacrylamide gel resolving five different purified GST-SH3 fusions proteins. Apparent molecular weights (MW) are shown in kilodaltons of two size markers (resolved in an adjacent lane). 12. To recover the GST-SH3 fusion protein, tumble the supematant with 500 pL of a 50% slurry of glutathione-agarose beads (Sigma, St. Louis, MO) at 30 rpm for 30 min at 4’C. Recover the bead-bound fusion protein by centrifugation at 4’C for 5 min at 25OOg (4,000 rpm in a GSA rotor in a Sorvall RC-5B centrifuge). Wash the beads with at least 20-bed vol of ice-cold PBS. 13. Recover purified GST-fusion protein by competitive elution with lo-bed vol elution buffer (50 mMTris-HCl, pH 8.0,lOO n-J4 NaCl, 10 &reduced glutathione). Evaluate the purity and concentration of the eluted fusion protein by SDS-PAGE (Fig. 2) and Bio-Rad protein assay, respectively. Eluted-fusion protein is typically >99% pure and recovered at a final concentration of 0.2-2.0 pg/mL. Alternatively, the fusion moiety may be eluted from pGEX-2T or pGEX-2TKexpressed vectors by thrombin cleavage at an engineered thrombin-recognition site just N-terminal of the fusion site in GST. This approach allows the recovery of essentially native protein in a single step of purification.
3.3. Affinity Purification of Phage Displaying SH3-Binding Peptides Because phage-displayed random-peptide libraries provide a physical link between phenotype (displayed peptide) and genotype (encoding DNA), they lend themselves to a screening process in which binding clones are separated from nonbinding clones by affinity purification (Fig. 3). The GST-SH3 target
Sparks, Rider, and Kay
96
-&
Deduce peptIde sequence by DNA sequencing
Examine binding of phage isolates by ELBA
Fig. 3. Overview on the affinity selection procedure: Viral particles are incubated in microtiter plates that have GST-SH3-fusion protein immobilized on the bottom of the wells. Nonbinding phage is washed away and the bound phage is recovered by acid denaturation of the SH3-phage interaction. The released phage is used to infect bacterial cells and the titer of the virus is restored to 1012 PFU/mL. These four steps constitute one round of screening. After three rounds of screening, the released phage is diluted and plated out to yield isolates. Bacterial cultures are infected with isolates to establish clonal stocks whose binding properties are evaluated by ELISA (i.e., binding to target GST-SH3 protein vs GST alone). The identify of the displayed peptide is deduced upon sequencing the viral genome.
Phage- Displayed Peptide 1ibraries
97
protein is commonly immoblhzed onto an enzyme-linked immunosorbent assay(ELISA)-treated mlcrotlter plates. Passive adsorption is typically sufficient to immobilize the modest (-1 pg) quantities of protein required for successful isolation of binding phage. 1. Add l-3 pg of GST-SH3 fusion protem m 200 pL of 100 mM NaHC03, pH 8.5, to several wells of an ELISA microtiter plate Incubate for 2-3 h at room temperature or overmght at 4°C. To prevent evaporation, seal the wells with Scotch tape or Saran Wrap. 2 Block the wells by adding 150 w 1.0% BSA, 100 mM NaHCO,, pH 8.5, to each well. Seal the wells and incubate the plate at 25°C for l-3 h or at 4°C overnight. 3 Remove the hquld from the wells by flicking the contents of the plate mto the smk. Remove any residual hquld by slapping the plate against a stack of paper towels several times. Wash the wells three times with 200 pL PBS-Tween-20 Discard the hqmd as mentloned earlier 4. Add the appropriate titer (typically 1000 library equivalents) of each PXXP library fraction m 200 pL PBS-Tween-20 to separate wells Allow the phage to bmd for 2-5 h at room temperature Remove nonbmdmg phage by washing the wells five times with 220 & of PBS-Tween-20 5 Elute-bound phage with 50 pL 50 mM glycme, pH 2 0, for 10 min at room temperature Recover and neutrahze eluted phage by transferrmg the glycme solution to a mlcrofuge tube containing 50 cls, 200 mM NaHP04, pH 7.5. 6 Dilute 50 & of an overnight culture of F’ E. co/l (e.g., DHSaF’) m 5-mL sterile 2xYT Add the phage from step 5 and incubate the culture at 37”C, 220 rpm for 6-8 h (see Note 4). To mmlmlze proteolytlc degradation of displayed peptides, do not incubate longer than 8 h. Pellet the cells by centrlfugation and transfer the phage supernatant to a new tube 7. Immobilize GST-SH3 fusion protein onto two separate mlcrotiter plates as m step 1. Use one plate to perform the second round of affinity purlflcatlon by adding 200 pL of each phage supernatant from step 6 to a separate well. Incubate, wash, and elute/neutrahze the phage as m steps 4-5. 8 Transfer the recovered phage from the second round of affinity punficatlon to the third mlcrotiter plate Add 100 pL PBS-Tween-20 to each well and incubate, wash, and elute/neutrahze the phage as m steps 4-5 This represents the output from the screening process (see Note 5) The phage titer may be anywhere from 0 to lo5 PFU/mL. 9 To determine the phage titer, use a multlchannel plpeter to perform lo-fold serial dllutlons m a microtIter dish with sterile PBS Overlay a 2xYT-agar plate with 3 mL liquefied 1.2% top agar + 200 w DHSaF’ overnight + 25 pL 2% IPTG + 25 w 2% XGAL Allow the top agar to harden for 15 mm at 4°C 10 Use a 48-prong replica-plater to transfer -2 @ liquid from each mlcrotlter well onto the bacterial lawn from step 9. Allow the liquid to dry on the plate for five
mm, then invert the plate and incubate at 37°C overnight. Assuming 2 p.L 1s
98
Sparks, Rider, and Kay
transferred per prong, estimate the phage titer Based upon this titer, plate an appropriate amount (30-300 PFU) of each screening output onto a separate bacterial lawn (see Note 6). 11 Use isolated plaques to inoculate 3 mL of a 1.100 diluted DHSaF overnight culture, and incubate the culture at 37°C 220 rpm for 6-8 h. Pellet the cells by centrifugation at 4000g for 10 mm The cell pellet may serve as a source of double-stranded DNA for sequencing, whereas the supernatant may serve as a source of phage (-lOi PFU/mL) for binding experiments
3.4. Confirmation
of SH3-Binding
by Antiphage
ELISA
Although affinity purification selected phage represent bindmg
serves to enrich for binding clones, not all clones. For example, we have isolated plas-
tic-binding
of screenmg
phage from a varrety
experiments
(19). An antiphage
ELISA-detection system facilitates the simultaneous characterization of multiple-phage clones. Using this protocol, 48 clones may be screened m a single microtiter plate m as little as 4 h. 1. For each clone to be tested, immobthze -1 pg GST-SH3 protein m an ELISA microttter well as described in Subheading 3.1. As a negative control, coat a separate well with an equal amount of GST protein. 2 Add 100 pL PBS, 0 1% Tween-20 to each well contammg tmmobilized protein Add 100 pL phage stock representing each clone to a separate pair (positive/ negative) of wells Seal the wells and incubate the plate at 25°C for l-3 h Remove nonbinding phage by washing the wells as descrrbed m Subheading 3.1. 3. Dilute horseradish peroxidase-conjugated anttphage antibody (Pharmacia, Ptscataway, NJ) 1 5000 m PBS-Tween-20. Add 200 pL of the diluted conJugate to each well Seal the wells and incubate the plate at 25°C for 1 h. Wash the wells as described m step 2. 4. Add 200 pL ABTS solution to each well. Incubate the plate at room temperature until the color reaction develops (lo-30 mm). Quantify the reaction by measuring the absorbance at 405 nm with a mrcrottter plate reader. Positive interactions produce signals m the range of 0 5-3.0, whereas negative signals typically range between 0 05 and 0.3. Fig. 4 depicts the result of testmg of phage isolated from six different screening experiments with SIX different GST-SH3 fusion proteins. 5 Prepare single-stranded DNA from isolates and determine the nucleotide
sequence of the displayed peptides by standard dldeoxynucleotide sequencing (20) Figure 5 tabulates some of the SH3 pepttde hgand motifs that have been deduced with the PXXP library for eight different SH3 domains (13)
4. Notes 1 Synthesis of long (>40 nt) ollgonucleotides often results m a crude product containing a large fraction of contammatmg n-l and smaller products. We recommend purification of long ohgonucleotides by HPLC prior to their use m this protocol.
Phage- Displayed Peptide Libraries
Fig. 4. ELISA of phage isolates binding to different GST-SH3 fusion proteins: In order to confirm the binding specificity of phage isolates obtained from the library screen, an ELISA assay is performed. One to two micrograms of protein are immobilized on a plate. The nonspecific binding properties of the wells are then blocked with excess BSA; later the wells are washed with PBS-Tween-20. Approximately 50-100 pL of a clonal population of phage supernatant is added to the wells. Unbound phage are washed away with PBS-Tween-20. Bound phage are detected with an anti-M13-HRP conjugate. The color reaction is performed by adding the ABTS substrate. After letting the reaction proceed for 10-15 min, the plate is read with a spectrophotometer at 405 nm wavelength. This figure shows the testing of 48 phage isolates against various SH3-GST fusion proteins. GST negative controls are included in adjacent wells to eliminate GST binding phage. This figure shows the testing of PXXP phage isolated by affinity selection to six different GST-SH3 targets (Src, Abl, Crk, Nck, Grb2, Lyn). The majority of the clones bind to the desired target SH3, but not to the GST fusion partner. The binding profiles of several nonbinding phage are shown boxed.
2. Because the number of permutations of a peptide of given length scales exponentially with respect to the size of the peptide, a principal objective in library construction has been the maximization of library complexity. Assuming a poison distribution of sequences within the population, approx 5 x lo9 unique clones are required to represent all possible hexamer-peptide sequences with the NN (G/T) nucleotide-coding scheme at a 99% confidence level (22). Whereas libraries of this complexity are readily attainable, biological selection against sequences incompatible with phage propagation impose additional constraints upon representation. It is therefore important to construct as complex a library as possible.
Sparks, Rider, and Kay
100
SH3 domain Class I Src Yes Abl Grb2 N
Ligand Preference xpxppxp
LXXRPLPPYP YXXRPLPXLP PPxOxPPgYP +OdxPLPxLP
Class II
XPPXPPX
Cortactin p53bp2 PLCy Crk
+PPYPpKPwL RPxIPYR+SxP pPPVPPRPxxTL
‘l”p’I’LP’I’K
Ftg. 5. Alignment of SH3 &and consensus motifs deduced from the PXXP library As reported elsewhere (24-251, SH3 hgand pepttdes can bmd m two ortentations relative to the SH3 domain The consensus hgand sequences for eight different SH3 domains (13) are divtded here into either Class I or II motifs. Capital letters correspond to ammo acid residues conserved in over half of the Isolated phage, whereas lower case letters represent less common but stall promment ammo acid residues. The Greek letters Y and 8 correspond to hydrophobic (1 e , I, L, V, and P) and aromatic (1-e , F, W, and Y) resrdues, respectively 3. It 1s important to hmtt the number of parental clones among the recombmants m the hbrary Strategies to accomphsh this ObJective mclude the use of two restrtctton enzymes that produce noncompattble cohestve ends, the treatment of digested vector with alkalme phosphatase, and the gel purifrcatton of digested vector from undigested vector and parental insert fragments Addmonally, the fact that pII1 is requned for phage mfectton has given rise to several different vectors that are only capable of producing viable phage when they have acquired an appropriately designed recombmant insert (22). For example, we have used a vector (mBAX) possessing a TAG stop codon wtthm its parental insert (13). This vector may be propagated in strains (e g., DHSaF’) carrymg suppressor tRNAs (i.e., supE, supF), but not m nonsuppressor strains (e.g., JS5) Libraries constructed with mBAX and inserts lacking stop codons may be amplified m nonsuppressor hosts, rmposmg a strong selectron agamst parental clones We have observed better than 104-fold selection against parental clones m JS5 relative to DHSaF’. 4. One round of affinity purtficatron typically affects the recovery of approx 1% PFU representing any gtven bmdmg clone To ensure that bmdmg clones are not lost
Phage-Displayed Peptide Llbranes
101
to mcomplete recovery, we screen 100-1000 library equivalents (10’ ‘-1012 PFU) m the first round of affinity purification. However, the number of phage particles representing any given binding clone that are recovered from the first round is reduced to the point that binding clones may be lost if subJected to a second round of purification without mtervenmg amphfication Amphfication should result m a 105-107-fold increase m the titer of any given clone from the previous round of affinity purification. This amplified titer is generally sufficient to allow two subsequent rounds of affinity purification without intervening amplification. 5. One round of affinity purification with a target immobilized on ELISA plates typrcally results m a -103-fold enrichment of binding over nonbmdmg phage Thus, three rounds of affinity purification are generally sufficient for the isolation of binding phage from libraries with complexities of ~10~. However, rates of enrtchment will vary from target to target and must be taken into account when deciding on the number of rounds of affinity purification to perform For example, a mere lo-fold enrichment was reported for maJor histocompatabihty complex (MHC)-binding phage (23). 6. Enrichment of binding phage may be assessed by doping a library aliquot with an equal number of nonbinding phage which are dlstmguishable from library phage. For example, libraries encoded by a-complementmg lacZ-phage vectors may be doped with nonbinding, noncomplementmg phage. After affuuty purification, an increase m the ratio of blue vs white plaques indicates enrichment of phage from the library.
References 1. Cohen, G. B., Ren, R., and Baltimore, D (1995) Modular binding domains m signal transduction protems. Cell 80,237-248. 2. Pawson, T (1995) Protein module and signallmg networks. Nature 373,573-560. 3 Chen, J. K., Lane, W. S., Brauer, A. W., Tanaka, A., and Schreiber, S. L. (1993) Biased combinatorral libraries. novel ligands for the SH3 domain of phosphatidylmositol3-kmase. J Am Chem 115, 12,591-12,952. 4 Songyang, Z., Shoelson, S E , Chaudhuri, M , Gish, G., Pawson, T., Haser, W G., King, F., Roberts, T., Ratnofsky, S., and Lechleider, R J. (1993) SH2 domains recognize specific phosphopeptide sequences. Cell 72,767-778. 5. Sonyang, Z., Blechner, S , Hoagland, N , Hoekstra, M F., Piwmca-Worms, H, and Cantley, L. C. (1994) Use of an oriented peptrde library to determine the optimal substrates of protein kmases Curr Bzol 4,973-976 6. Wu, J., Ma, Q. N., and Lam, K. S. (1994) Identifymg substrate motifs of protein kmase by a random library approach. Biochemistry 33, 14,825-14,833 7. Cortese, R., Monaco, P., Nicosia, A., Luzzago, A., Felice, F., Galfre, G., Pessi, A., Tramontano, A., and Sollazzo, M. (1995) Identification of biologically active peptides using random hbrartes displayed on phage. Curr. Open Blotech. 6,73-80. 8 Kay, B K (1995) Mapping protein-protein mteractrons with biologically expressed random peptide libraries Persp Drug Dzscov Des 2,251-268.
102
Sparks, Rider, and Kay
9. Cheadle, C., Ivashchenko, Y., South, V , Searfoss, G H , French, S , Howk, R., Ricca, G A., and Jaye, M (1994) Identtficatton of a Src SH3 domam bmdmg motif by screenmg a random phage display ltbrary. J Blol Chem 269, 24,034-24,039 10. Rtckles, R J , Botfteld, M C., Weng, Z , Taylor, J A , Green, 0. M., Brugge, J S., and Zoller, M. J. (1994) Identificatton of Src, Fyn, Lyn, PI3K, and Abl SH3 domain hgands usmg phage display hbrartes. EMBO J 13,5598-5604 11. Rxkles, R J., Botfield, M. C , Zhou, X.-M., Henry, P. A., Brugge, J. S., and Zoller, M K (1995) Phage display selection of ligand residues important for Src homology 3 domain bmdmg specifxtty Proc. Nat1 Acad Scz USA 92, 10,909-10,913 12 Sparks, A B , Adey, N B , Qmllam, L A , Thorn, J M , and Kay, B K (1995) Screenmg phage-displayed random peptide hbraries for SH3 ltgands Methodr Enzymol 255,498-509 13 Sparks, A., Rider, J , Hoffman, N , Fowlkes, D , Quilllam, L , and Kay, B ( 1996) Dtstmct ltgand preferences of SH3 domams from Src, Yes, Abl, cortactm, p53BP2, PLCg, Crk, and Grb2 Proc Nat1 Acad Scz USA 93, 1540-1544. 14 Scott, J. K. and Smith, G. P (1990) Searching for peptide hgands wtth an epttope library. Sczence 249,386-390. 15. Cwirla, S E , Peters, E. A , Barrett, R W , and Dower, W J. (1990) Pepttdes of phage: a vast library of peptides for identifymg hgands Proc Nat1 Acad Scz USA 87,6318-6382. 16 Devlin, J. J., Panganiban, L. C , and Devlm, P E (1990) Random pepttde hbraries. a source of specific protem bmdmg molecules Sczence 249,404-406 17 Ausubel, F , Brent, R., Kmgston, R., Moore, D , Seidman, J , Smith, J., and Struhl, K (1994) Cw rent Protocols zn Molecular Bzology Wiley, New York. 18 Dower, W., Miller, J., and Ragsdale, C. (1988) Hugh efficiency transformation of E co11 by high voltage electroporatton. Nucleic Acids Res 16,6127-6145 19 Adey, N. B., Mataragnon, A H , Rider, J. E , Carter, J. M., and Kay, B. K. (1995) Characterization of phage that bmd plastic from phage-displayed random peptide libraries. Gene 156, 27-3 1 20 Sanger, F., Coulson, A R., Barrell, B G., Smith, A J M., and Roe, B A (1980) Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing J Mol. Bzol 143, 161-178. 21. Clackson, T and Wells, J A. (1994) In vztro selectton from protein and pepttde libraries TZBTECH 12, 173-184. 22. Smith, G. P and Scott, J. K. (1993) Libraries of peptides and proteins displayed on filamentous phage. Methods Enzymol 217,228-257. 23. Hammer, J , Takacs, B , and Smtgaglia, F (1992) Identificatton of a motif for HLA-DRl bmdmg pepttdes using Ml3 display libraries. J. Exp Med 176, 1007-1013 24. Feng, S., Chen, J., Yu, H , Summon, J , and Schreiber, S (1994) Two binding ortentations for pepttdes to the Src SH3 domain. development of a general model for SH3-hgand mteractions Sczence 266, 124 l-l 247
Phage-Displayed
Peptide Libraries
103
25 Llm, W. A , Richards, F. M., and Fox, R. (1994) Structural determinants of peptide-binding orlentatlon and of sequence speclficlty m SH3 domams Nature 372, 375-379 26 Smith, D B and Johnson, K S (1988) Single-step purlflcatlon of polypeptldes expressedm Escherzchm co11 asfusions with glutathlone-S-transferase. Gene 67, 31-40.
Selective Antagonism of Receptor Signaling Using Antisense RNA to Deplete G-Protein Subunits Paul R. Albert and Stephen J. Morris 1. Introduction 7.1. Genera/ Introduction The molecular identification and characterization of the components of receptor-signaling pathways has revealed a striking redundancy and diversity of signalmg elements. For example, G protein-coupled receptors bind to a diversity of ligands, rangmg from classical low-molecular-weight monoammes like serotonin (5HT) or dopamine, to large glycoprotems such as gonadotropins (I). Within a given receptor family, multiple subtypes of receptors have been identified: for example, the serotonin-receptor family comprises over 15 distmct receptors (2). An analogous multiplicity of subtypes extsts within the families of G proteins (34 and effecters, such as phospholipases, adenylyl cyclases, protem kinases, and ion channels (5-9). Indeed, low-stringency cDNA-screening techmques have led to the identification of homologs of unknown function, such as orphan receptors (10). Biochemtcal characterization of purified proteins in vitro, or by overexpression of then cDNAs in transfected cell lines has been instrumental m defmmg the properties of these signal-transduction elements. However, these approaches may distort the interactions that occur in sztu because of abnormally high expression of the various signaling components and nonphysiological optimtzation of assay conditions. Pharmacological approaches have been very useful in defining the physiological roles of cloned receptors, but are limited by the availability of specific receptor agonists and antagonists. Pharmacological manipulation of intracellular processes is even further restricted by a lack of specific mem-
From
Methods
m Molecular
Biology,
E&ted by D Bar-Sag!
Vol
84
0 Humana
107
Transmembrane
Slgnabng
Press Inc , Totowa,
NJ
Protocols
108
Albert and Moms
brane-permeant hgands. For example, the roles of various G proteins can be mvesttgated using pertussts and cholera toxins, an approach that can distmguish between the actions of Gs and G,G, proteins, but provides no mformation regarding the mvolvement of specific tsoforms of a-, p-, and y-subunits (II). Another strategy for examming the role of particular coupling elements (e.g., G proteins) or effecters in receptor signaling has employed antrsense approaches (12-14). Rather than overexpressmg a protein, the hrghly spectftc hybridization anttsense DNA or RNA to target-sense mRNA sequences permits a selective depletion of mdtvrdual signaling components. This depletion can result m a nearly complete knockout of an mdtvrdual signaling component, permitting the rdentiftcatron of its role m receptor signaling. This chapter presents stable transfectron of full-length antisense cDNAs as an antisense approach with the high specificity required to assess the role of individual coupling elements m receptor actron. The method, mechamsm, assessment, and ultimate usefulness of this anttsense approach as a tool for studymg receptor signaling are discussed.
7.2. Theory of Antisense 1 2.1 Delivery
Approaches
Several different anttsense approaches have been used to antagonize ductton of individual proteins m cultured cells.
the pro-
1 Incubatton of cells with short ohgonucleotides (>20 mers) that are complementary to the sense mRNA (1.5-17) The mam advantage of this approach 1s that ohgonucleotides are readily obtained and can be eastly applied to the cells. The disadvantages are that only certain antisense ohgonucleotides are effective Often sequences proximal to the translational mtttatton site are designed to provide effective dtsruptton of this process, but sometimes sequences 5’ or 3’ of the mittal ATG codon are more effective Furthermore, to control for toxic effects, it is
necessary to use erther scrambled or missense ohgonucleotrdes as well 2 Incubation of cells with oltgonucleottdes destgned to form triple heltxes wtth the gene of interest (18) This novel technique 1s hmtted to genes that contam large stretches of purme-rich sequence that are amenable to the formation of triple helixes, and requues high concentrations of ohgonucleottdes. 3 Transfection of cells with vectors expressing either short antisense sequences
alone, or short antrsense sequences with rtbozyme constructs (25,16). These approaches are labortous and, like the more conventtonal anttsense-ohgonucleottde approach, they suffer from the limited spectftctty of the short ohgonucleottde sequence 4 Transfectton of cells with full-length (or parttal) cDNAs expressed m the antisense ortentatton (19-21) This last method has the disadvantage that it is relatively labor-mtenstve, particularly if stable transfectton of cells is done Transient
Antisense RNA to Block Receptor Signahng
109
transfectton 1sonly efftctent in cell lines that have very high efftcienctes of transfectron to allow uniform expressron of the anttsense throughout the populatron In general, this 1s not feasible owing to the low-transfectton efftctenctes of most cells, and tt 1snecessary to proceed wrth stable transfectton A full-length cDNA subcloned mto an expressron vector m the reverse dnectton 1s transfected mto a cell line and stably expressmg cell lines are selected Thus technique 1svery useful because the resultmg stable cell lmes can be extensrvely charactertzed for the level of knockdown, and the functional consequences of knockdown can be analyzed m detail (12,22,23). Furthermore, as detarled below, thts technique holds the promise of being extremely specific owing to the length of sequence used
7.22. Efficacy vs Specificity Antisense approaches are based on the hybridization of antisense nucleic acids to the endogenous sense nucleic acids present m hvmg cells. Successful antisense knockdowns involve a balance between two opposing parameters of hybridization: the efficacy of hybridization and the specificity of hybridization (15-21). Efficacy is defined by the extent of hybridization (which is determined in part levels of antisense expression and the stringency of hybridization conditions), whereas specificity is determined by the relative free energies of hybridization of competmg RNA species (which is dictated by nucleotide semilarity, GC-content, and secondary structure). Of particular importance m determining hybridization stringency are the temperature and salt concentration (IO), both of which are similar among the intracellular environments of hvmg cells and correspond to a low-stringency environment that is relatively unfavorable to hybridization. In addition, hybridization m solution is governed by the extent of secondary structure formation in the target RNA and is relatively inefficient (24,25). Hence, the extent of antisense knockout is determined m part by the excess of antisense over sense RNA, which must be at least 20-fold (for antisense RNA) and up to several loo-fold (for oligonucleotides) for complete knockout (15,17,20,21). Using antisense approaches, it is generally more difficult to achieve a complete knockdown of expression of targetmRNA species that are expressed at high levels. Nevertheless, regulation of expression of c-fos (26) and polygalacturonase (27) has been observed even when the steady-state level of sense RNA was much greater than that of the antisense RNA. The simplest explanation is that fragmentation of the antisense transcripts restores stoichiometry; however, there is little conclusive evidence for this. Thus, even at low levels of antisense RNA, sufficient knockdown of sense RNA may be produced to elicit functional consequences. At high levels of antisense, crosshybridization to related sequences can occur, limiting the specrftctty of the approach. Specificity is opttmrzed by designing antisense probe to nonconserved (e.g., 5’- or 3’-untranslated [UT]
Albert and Moms sequences), nonrepetitive sequences to mmimtze crosshybrtdization. However, in order to inhibit translation of RNA mto protein, tt is destrable to include coding-initiation sequences. For antisense oligonucleotides directed against conserved proteins, there is over 70% identity of nucleotide sequence between different Ga subtypes, and this conservatton of the coding sequences can hmit the specificity of hybridization. By contrast, the use of full-length antisense RNA provides the additional specificity of the nontranslated regions, which are ~20% identical between Ga subunits (12). Parameters derived from nucleotide sequence, such as % identity or secondary structure predictions of target RNA, can give some indication of the specificity or efficacy (respectively) of a given antisense construct. However, it is impossible to predict a prior-z the efficacy or specificity of a given antisense sequence usmg currently available sequence-analysrs programs, and these parameters must be determined empirically for each antisense construct (16). The extent of knockout should be documented by quantitative determination of target-protein levels using binding or tmmunoblot analyses; the specificity may be assessed by monitoring the levels of proteins closely related to, or associated with, the target protein (22). The main requirements for successful antisense transfections are a promoter that is strongly active in the cells of interest, insertion of the cDNA in the antisense orientation, and the highest possible homology between the antisense and the target mRNA. Ideally, cDNA constructs that are derived from the same species as the host cell should be used to maximize the identity between the sense and antisense RNAs, although successful knockdowns can occur across species (e.g., ref. 12). For this reason, we focused mitially on the GH,C, rat piturtary-cell lines, using the cloned rat Ga cDNAs to generate anttsense constructs (23).
1.2.3. Sites of Action The sites of action of antisense nucleic acids depends m part on the method of mtroductton into the cell. Stable transfectton of the antisense construct, which becomes integrated mto chromosomal DNA, results m nuclear expression of the transcribed antisense RNA (Fig. 1). Alternately, intranuclear mjection of oligonucleotides also produces a nuclear localization. The nuclear localization allows for potential disruption of the transcription (24, sphcmg (Fig. 1, item l), or nuclear export (Fig. 1, item 2) of the targeted sense RNA by hybrtdization to the anttsense RNA m the nucleus. Depending on the system used, stable expression of antisense RNA has been observed to interfere with RNA splicing, transport of mature mRNA into the cytoplasm, mRNA stability, or mRNA transcription (28). These effects are mediated by either steric hindrance or by specific enzymes such as the double-strand RNA unwindase/
Antisense RNA to Block Receptor Signaling
111
Fig. 1 Potential sites of action for anttsense ohgonucleotrdes Introduction of the plasmtd antisense cDNA construct mto the nucleus via stable transfectton (frguratrvely shown via microptpet) allows for multiple sites of action. By formmg a stable double-stranded RNA species with the target sense RNA, the expressed antisense RNA may interfere with* 1, RNA transcriptton; 2, nuclear-RNA processmg or nuclear export; 3, the double-stranded RNA hybrid 1s also suscepttble to enhanced degradation; 4, mRNA translation in the cytosol; and 5, degradation of the target protein is retained following transfectron to clear any residual from the cytosol (See text for details.)
modificase activity (29). Expression of full-length antisense RNA to tissue inhibitor of metalloproteinases (TIMP) m murine cells results in a substantial knockdown that is accompamed by a dramatic increase in nuclear-unprocessed mRNA. Hence, it appears that the antisense message can Interfere with RNA splicing (30). Inhibition at the level of transport has been demonstrated in murme L cells transfected with the antisense thymidine kinase (31). Thymidme kinase is an mtronless gene; hence, splicing was not a factor. Interestingly, the mRNA was observed to accumulate in the nucleus hybridized with antisense message, indicating that transport out of the nucleus was impaired. The importance of a nuclear site of action for antisense RNA has been suggested by the observation that antisense constructs that lack polyadenylation signals, and are not transported out of the nucleus, provide a more effective depletion than constructs that are cleared to the cytoplasm (32). This suggests that dtsruption of the nuclear processmg of sense RNA (possibly by formation of stable double-stranded RNA-RNA hybrids) may be a key site of action for antisense RNA transcripts.
112
Albert and Morns
The mtroduction of the antisense mto the cytosol (via extracellular apphcatton of oligonucleotides or via nuclear export of transcribed antisense RNA) enables other potential sites of action. In particular, the antisense may eliminate cytosolic-sense RNA by forming DNA-RNA hybrtds that are degraded by RNAase H (for DNA oligonucleotides [IS-171) or by depurmatmg unwmdase or double strand-specific RNAase (20,21) for RNA-RNA hybrids formed wtth antisense RNA (Fig. 1, item 3). In addition, these hybrids may impair ribosomal recognition of the sense RNA stranded to inhibit the translation of the mRNA mto protein (Fig. 1, item 4). One key aspect of protein depletion by antisense approaches IS the rate of target protein turnover (Fig. 1, item 5). Even with 100% block of protem synthesis by antisense hybrids, no depletion of the target protein will occur until the remammg pool of previously synthesized protein is degraded The rate of protein degradation IS an important consideration for acute, transient antisense experiments (e.g., ohgonucleotide inJection), m which several days may be required for depletion of the target protein m order to produce optimal knockout conditions (15-17). In stable transfections (see Subheading 3.), sustained mhibition of de ylovo protein synthesis has been established for sufficient time that protein turnover has stabilized protein levels at a new steady state.
1.2.4. Functional Analysis of Clones In the experimental system used m our laboratory, the ultimate goal of the antisense transfections was to examme the consequences of GJG,2 knockout for receptor signalmg. In GH&, cells, mhibitory receptors mediate decreases m both basal and VIP-stimulated CAMP synthesis, and block calcium influx induced by BayK8644 (1 p,AJ), a dihydropyndme agonist of L-type calcium channels. The effect of each knockout on these responses was examined m GH&, cells transfected with dopamme-D2S or -D2L receptors. Endogenous muscarmic-M4 and somatostatin receptors served as controls to compare different clones. For each receptor, Ga,, antisense expression blocked receptor couplmg to mhtbmon of calcium channels. Using nuclear mlection of antisense Ga oligonucleotides, analogous observations of calcium currents m single cells have been made for the muscarinic and somatostatin receptors m GH, cells (33-35) and the endogenous dopamine-D2 receptors m cultured rat-pituitary cells (36,37), indicating that Ga, is essential for receptor-mediated mhibmon of calcium channels. Interestingly, clear differences between the closely related D2 receptors were observed: for negative couplmg to calcium-channel activation, the dopamineD2L receptor was only partially (70%) inhibited by depletion of Ga,, whereas the D2S receptor was entirely unresponsive. Furthermore, upon knockdown of Ga,2 protein, inhibitory couplmg to adenylyl cyclase of the D2L receptor was
Antisense RNA to Block Receptor Signaling
113
4-
Gao cDNA
Fig. 2. RT-PCR analysis of Ga, RNA in GH4 clones transfected with Antisense Ga,. Cytosolic RNA prepared from four randomly chosen antisense clones (A-D) were subjected reverse transcription using antisense (to transcribe from sense RNA) or sense (to transcribe from antisense RNA) Ga, oligonucleotides, followed by PCR with both oligonucleotides is indicated (see ref. 23 for details). The Ga, product was detected in antisense RNA lanes but not in sense RNA lanes. The Gibco-BRL DNA standards (MW) are indicated.
blocked, whereas the D2S receptor remained 70% coupled. This is consistent with indirect evidence that the D2L receptor, but not D2S, requires Go+2 to inhibit the stimulated state of adenylyl cyclase (38). In addition, ablation of Ga, did not alter receptor coupling to CAMP inhibition, a parameter that was not assessedin the single-cell studies. None of the ai-antisense clones displayed impaired coupling to inhibition of calcium influx, in agreement with others (33,364)). In the case of VIP-stimulated cyclase activity, the inhibition induced by somatostatin receptors was switched to a small (30%) stimulation by Gai2 knockout (23). This suggests that py-subunits released from remaining Gai or Ga, proteins potentiated G Gas-mediated stimulation of cyclase (Fig. 2), because AC-II is present in GH cells and Gpy-subunits have been shown to potentiate Gas-induced activation of AC-II (6). Whereas the stable transfection approach described has the advantage of generating stable-cell lines for the detailed study of downstream-biological mediators and actions of receptor activation, one caveat is that knockout of specific Ga-subunits could lead to subtle alterations in the expression of signaling components (such as degradation of specifically associated Pr subtypes) resulting in adherent-receptor specificity or signaling. In this regard, results from the stable knockout studies were consistent with findings in transient knockouts using antibody or antisense approaches (12,22). The general coherence of results obtained by these various approaches indicates that the knockout approach provides a valid method to examine receptor-G protein-effector specificity. completely
Albert and Moms
114 Table 1 Plasmids Plasmtd (source) pcDNAIh (Invltrogen) pcDNA3 (Invltrogen) RSV-neo (ATCC) pY-3 (ATCC)
Antibiotic
resistance
amp, tet amp, neoa amp, neoa teth, hyga
Bacteria MC1061/I’3b MC1061, XL-lb, and so on MC1061, XL-lb, and so on MC1061, JM-109
Oneoconfers G418 resistance, hyg confers hygromycm resistance to eukaryotlc cells !Yee Subheading 4.
In the followmg
section 1s presented
the stable transfectlon,
colony
screen-
mg, and characterlzatlon methodology that we have used to deplete the protein expression of specific rat G&subunits using stable transfectlon of antisense rat Ga cDNA constructs. These cells were used to study the consequences for receptor slgnalmg of the knockdown of speclflc Ga-subumts (22,23). 2. Materials
2.1. Transfection 1 Eukaryotlc expression plasmlds carrying antlsense cDNA and eukaryotlcantibiotic selectlon (m bold) are shown in Table 1. 2 Host cells m which antlblotlc sensltlvity has been tested (see Subheading 3.2.). 3 Calcmm/DNA solution (1 mL/transfectlon) IS shown m Table 2. 4 2X HBS solution (Table 3) (use 1 mL/transfectlon) Sterlhze by flltratlon through 0.22~pm filter m a tissue culture hood. 5 Transfectlon medmm (8-10 mL/transfectlon) growth medium + 20 mM HEPES, pH 7.0. (Filter-sterile HEPES [2 M], pH 7.0, can be added directly to the growth medium at 1 100 dilution ) 6 Growth medium (e.g , DMEM/lO% FCS), 20 mM HEPES, pH 7.0, Pemcllhn/ Streptomycm (optional). (Note Transfectlons proceed with highest efficiency when pH 1s stablhzed at 7 0 by HEPES buffer.) 7 Sterile phosphate-buffered saline (PBS). 8. 10% (v/v) dlmethylsulfoxlde m sterile PBS or 20% autoclaved glycerol m sterile PBS.
2.2. Selection Growth
medium
with appropriate
concentration
(see Note
1) of fllter-
sterilized selection antibiotlc: for neo’, G418 (Glbco-BRL); for hygr, hygromycin (Calblochem). Freezing medlum* 5% dlmethyl sulfoxide (DMSO) m
sterile antibiotic-free
growth medium.
115
Ant/sense RNA to Block Receptor Signaling Table 2 Calcium/DNA
Solution
Reagent 1 M sterile CaC12 20-200 pg Expression plasmldU (e g., pcDNA) 2-20 pg Selection plasmida (e.g , RSV-neo) Sterile water
Volume
0.25 mL 20-100 /.lL 2-10 pL (to final vol of 1 mL)
“The ratlo of Expresslon/Selectlon plasmld should be at least 1 10 (see Note 2). The amount of plasmld can be increased provided the ratio remains 1.10 (see Note 1) Ethanol-preclpltated plasmld resuspended m autoclaved water 1ssufficiently sterile for use m tissue culture.
Table 3 SXHBS Solution 50 mA4 HEPES (pH 7 0) 10mMKCl 280 m&l NaCl 12 nUI4 D-glucose 1.5 n-&I NaP04 (can be varied [e.g., l-2 mM] for optimal precipitate [see Note 31)
2.3. Screening 1. Cytosohc RNA extract from clones (RNAzol kit, and so on). 2. Synthetic-ollgonucleotide pans directed at desu-ed cDNA (Glbco-BRL, and so on). 3 Reverse Transcrlptase/buffer (Promega, Pharmacla, Amersham). 4. Taq DNA Polymerase/buffer (Promega, Pharmacla, Amersham). 5. Programmable Thermal Cycler (MJ Research, Perkm-Elmer). 6 1.2% Agarose melted m TEA buffer (Tns-HCl, pH 7.4,40 n&I EDTA, 40 mM sodium acetate) 7. Horizontal gel electrophoresis apparatus (Blo-Rad) 8 Sodium dodecyl sulfate polyacrylamlde gel electrophoresls and transfer apparatl (Blo-Rad)
3. Methods 3.1. Transfection Transfections are done using a standard calcium-phosphate coprecipltation protocol. The host eukaryotlc cell IS ideally of the same (or closely related) species as the antisense, and must be a mitotlc cell in order to stably incorporate the DNA mto the genome. Nonmltotic cells can acquire antisense using transgemc techniques or by using replication-deficient viral constructs (e.g., in adenovirus).
116
Albert and Morris
1 Grow cells to 20-50% confluence on a lo-cm plate (1 plate/transfectlon). If the cells are too dense, the antibiotic selectlon will be poor, because growmg cells, rather than stationary cells, are killed by the antlblotlcs 2. Change growth media the day before transfectlon This optimizes cellular responsiveness and increases transfectlon efficiency. 3. In sterile polypropylene/polystyrene tubes, add the CaDNA solution dropwise to the 2X HBS with constant mixing. Mixing can be done by constantly bubbling the 2X HBS with a plpetald (our preference) or by constant vortexmg of the 2X HBS. The latter method may require more phosphate m the 2X HBS to attam optimal preclpltatlon (see Note 3). 4. Allow the mixture to stand for 5-10 mm for precipitate to develop. The nature of the precipitate 1s crucial to successful transfectlon The precipitate solution should appear slightly opaque to the eye, and not flocculant (1 e , particles should not be visible to the eye). If the precipitate is opaque, proceed directly to the next step. If the solution remains clear and few particles are observed mlcroscoplcally, repeat the preclpltatlon with a slightly higher concentration of phosphate (0.5 mM increment) m the 2X HBS 5. Aspirate medium from the plate of cells, add the precipitate to the cells, and allow 5 mm for the precipitate to settle onto the plate surface. Examine the precipitate mlcroscoplcally. ideally there should be small particles which can be easily pmocytosed by the cells-large aggregates are undesirable 6 Carefully add transfectlon medium to the plates and place m the CO* incubator for 6-24 h 7. Following incubation, it is important to wash the precipitate off completely with PBS, because it inhibits cell growth and antibiotic selection (see Note 4) If the cells ~111tolerate it, treatment with glycerol (20%) or DMSO (10%) m PBS followed by PBS wash can improve transfectlon efficiency
3.2. Selection In order
to obtain
stable
clones,
the cells transfected
by the procedure
described above must be selected for antibiotic resistance conferred by the chosen selection plasmid (see Subheading 3.1., step 1). For each antibiotic and cell line, a kill curve (i.e., concentration-dependence for cell death) should be done prior to transfection to establish the minimum-selection antlblotlc concentration for complete cell death within 1 wk in nontransfected cells. A concentration 1.5 to 2-fold of the minimal effective dose will be used for the metal selection of antibiotic-resistant clones. 1 Gently add growth medium contammg the selection antlblotlc at a concentration which kills all nontransfected cells. 2. Continue to grow the cells until colonies appear. a mock-transfected plate can be useful to insure that the selection has killed all nontransfected cells. Depending on the cell-prohferation rate and antibiotic, it may take from 5 to 20 d for discrete colonies to appear
Antisense RNA to Block Receptor Slgnahng
117
3. Once the colonies are easily visible by ttltmg the plate (i.e., the 100-200 cell stage), pick the colonies usmg a sterile 2O+L pipet m 3-5 l.tL of medmm and propagate m 24-well plates If the colonies are dtffrcult to see by eye, then location can be marked using mrcroscoprc vrsuahzatron. This 1s a harsh procedure that results m slgmfrcant cell damage. To optimize cellular recovery following picking, we omit selection antrbrotrc and add lo-15% FCS to the growth medmm for 24-48 h, or until the cells have attached and appear healthy. 4 Spin and freeze 50% of the cells from each well m 0 5 mL of freezing medmm at -80°C or preferably colder (e.g , -140°C). Do two Independent freezes for each well.
3.3. Screening There are a variety of ways to screen for overexpression of antisense: Northern blot, RNase protection, and RT-PCR analyses screen for antisense RNA may detect sense RNA as well. We have suggested a rapid RT-PCR-based approach that allows detection of both sense and antisense RNAs in the same RNA samples. The first screen should ideally be rapid and require the minimum-cell number, so that clones of interest can be rapidly identified to minimize the expense of carrying multiple clones. In some cases (e.g., antisense to receptors), a functional assay may be useful as a primary screen, but generally protem and functional analyses are done as secondary screens.
3.3.1. Primary Screen: RT-PCR An example of one useful approach to screen for both overproduction of antisense and for decrease m sense mRNA is using RT-PCR as shown m Fig. 2. Total cytoplasmic RNA was prepared from four randomly chosen clones of GH&, cells transfected with antisense-Gia, cDNA plasmid (23). Specific oltgonucleottdes internal to the antisense Go, cDNA were used to detect sense and antisense Go, RNAs. To detect antisense mRNA, the S-sense oligonucleotide was used to initiate reverse transcription from the antisense mRNA only. Priming of reverse transcrrptron from the sense RNA was done with another aliquot of the identical RNA samples, this time using the 3’-antisense oligonucleotide to inmate transcrtption from the sense RNA-strand. Followmg the reverse-transcription step, both samples were amplified using PCR by mcludmg both sense and antisense oligonucleottdes to permit amplification. The DNA product was electrophoresed on an agarose gel and stamed to reveal the specific amplified Ga, cDNA product (500 bp). As shown m Fig. 2, several colonies displayed various levels of the antisense-Ga, cDNA product, but the sense product was not detected. Although nonquantitative, this approach mdicates putative clones that over-express antisense-Ga, RNA, and have mhrbition of sense-RNA levels. Thus, overexpression of antisense RNA coincides
118
Albert and Morris
with inhibition of sense RNA, suggesting that the antisense may inhibit senseRNA production and export, or enhance, its degradation. Extract RNA from cells grown m 24- or 6-well dishes and analyze RNA by RT-PCR or Northern blot analysis for expression of sense and antisense mRNA (see Note 3). Select positive clones for further propagation and analysis.
3.32. Secondary Screen: Western Blot Even at depleted levels of RNA, protein levels may not be greatly inhibited if translational efficiency 1s enhanced or protem degradation 1s decreased. It 1s therefore necessary to examme the level of target protein in the antisense clones. For this purpose, Western blot analysis with a specific antibody must be used, Alternately, a ligand-binding or enzymatic assay that is sufficiently specific to identify only the targeted- (and not related- ) gene product can be used. The close homology between Ga-subunits has complicated the development of specific antibodies. Nevertheless, antibodies selective for Ga, have been raised and were used to assess the level of Ga, protein (23). As shown in Fig. 3, the level of Ga, protein m three different antisense-Ga, clones was greatly depleted compared to nontransfected controls (>95%, the limit of detection followmg image intensification and analysis). Thus, overexpression of antisense m GH,C, cells was associated with nearly complete depletion of Ga,-subunits. By contrast, levels of Ga,-subunits were not inhibited (23). Thus, a relatively selective mhibltlon of Ga protein subunits was produced. 4. Notes 1, The plasmld vector used for transfectlons was mitlally the pcDNA-I (Invltrogen), which contains a cytomegalovlrus (CMV) promoter driving expression of the inserted cDNA, and an SV40 (simian virus 40) polyadenylatlon signal to per-
mit export of the RNA produced mto the cytoplasm
More recently, we have
used the pcDNA-3 vector with similar results. Indeed a variety of eukaryotlcexpression vectors containing viral promoters like the CMV promoter are now available 2 The pcDNA-I plasmld must be transformed into competent MC1061-P3 bacteria. It 1s important that these bacteria have not lost the P3 episome, which can be selected for m kanamycm (10 pg/mL) and confers the SUP-F gene required to suppress the amber mutations m the amp’/tet’ genes of pcDNA-I and allow selection. An advantage of pcDNA-3 1s that it has a standard amp’ gene, and can be selected for in a variety of amps bacteria In addition, the pcDNA-3 plasmld contams the neo’ gene that confers resistance to G418 in transfected eukaryotlc cells 3. The PY-3 plasmld was transformed into tetracycline-sensitive bacteria (e g , JM-109,
MC1061-P3): do not use XL-l bacteria, which are tetracycline-resistant. Other selection plasmids that contam more standard amp’ genes include those conferring neomycin (G418) resistance, puromycin resistance, and zeomycin resistance.
Antisense RNA to Block Receptor Signaling
119
Antisense Clones GH4ZR7
Gao-8
Gao-9
Gao-11
Fig. 3. Immunoblot analysis of Ga, protein in GH4 cells transfected with antisense Ga,. Membranes prepared from control (C: GH4ZR7) and three antisense clones (AS- Ga,: GH4D2L-8, -9, -11) were subjected to immunoblot and probed with antibodies to Gal,, digitally-analyzed and reconstructed as images using the Masterscan analysis system. The migration of the (43Kd) 43-kDa molecular-weight marker and the predicted migration of Ga, are indicated. (See ref. 23 for further details.) 4. Successful stable transfection can be achieved even at low efficiency of transfection by increasing the amount of plasmid DNA. Because the level of antisenseGa RNA must be high to permit effective knockdown, we have used high amounts of DNA to obtain large numbers of colonies. 5. When transfecting with a plasmid that contains the selectable antibiotic-resistance gene, much lower amounts of DNA are required than when two plasmids (i.e., the antisense and the selectable marker) are used. When cotransfecting two plasmids, it is important that the ratio of antisense:selection plasmid be at least 1O:l to obtain reasonable yield of colonies that contain high levels of the antisense. It should be noted, however, that the level of antisense-RNA expression does not correlate with the number of copies of the plasmid inserted in the genome, but is more dependent on other random factors, such as the site of integration in the genome. In general, we find that cotransfection of two plasmids yield more clones with high-level expression than transfection of single plasmid. The high ratio of antisense to selection plasmid may allow multiple sites of integration of the antisense plasmid. 6. Note that the phosphate concentration in the 2X HBS is critical for fine precipitate: 1.5 miV seems to work the best, but the concentration can be varied by
120
Albert and Morris
adding from a sterile stock of 100 mA4 sodium phosphate Depending on the method of agitation more or less phosphate may be necessary (e g , for vortexmg compared to bubblmg). 7 After 16-24 h of mcubation, the calcmm phosphate precipitate may become too adherent to the plate surface to be removed by PBS. In this case, we use a rinse with PBS + 5 mM EDTA at room temperature for 5 mm Use microscopic examination to verify that the precipitate has been removed, but that the cells remam attached It may be necessary to repeat with a short second rinse
Acknowledgments This work
was supported
by the MRC,
Canada and the NCI,
Canada.
References 1 Strader, C. D , Fong, T. M , Tota, M. R , Underwood, D., and Dixon, R. A (1994) Structure and function of G protein-coupled receptors. Annu Rev Bzochem 63, 101-132. 2 Hoyer, D , Clarke, D. E., Fozard, J. R , Hartig, P. R , Martin, G. R , Mylecharme, E J., Saxena, P R., and Humphrey, P. P. A (1994) International union of pharmacology classification of receptors for 5-hydroxytryptamme (serotonm) Pharmacol Rev 46,157-203 3 Birnbaumer, L. (1992) Receptor-to-effector slgnalmg through G protems roles for @ydimers as well as a subunits. Cell 71, 1069-1072. 4. Neer, E J (1995) Heterotrimeric G protems* organizers of transmembrane slgnals Cell 80, 249-257. 5. Exton, J. H. (1994) Phosphomosltlde phosphohpases and G proteins m hormone action Annu Rev Physlol 56, 349-369. 6. Tang, W. and Grlman, A. G. (1992) Type-specific regulation of adenylyl cyclase by G protein & subumts. Cell 70, 869,870. 7. Sterne-Marr, R. and Benovic, J. L. (1995) Regulation of G protein-coupled receptors by receptor kmases and arrestms Vztam Horm 51, 193-234. 8. Newton, A. C. (1995) Protein kmase C: structure, function, and regulation. J Biol Chem 270, 28,495-28,498. 9 Wickman, K and Clapham, D. E (1995) Ion channel regulation by G proteins Physiol. Rev 75,865~885. 10. Albert, P. R. (1992) Molecular biology of the 5-HTIA receptor low strmgency cloning and eukaryotic expression. J Chem Neuroanat $283-287. 11. Clapham, D E. and Neer, E J. (1993) New roles for G-protein fiy-dimers m transmembrane signallmg. Nature 365,403-406. 12. Albert, P. R and Moms, S J. (1994) Antisense knockouts* molecular scalpels for the dissection of signal transduction. Trends Pharmacol See 15, 250-254 13. Hescheler, J. and Schultz, G. (1994) Heterotrimeric G proteins mvolved m the modulation of voltage-dependent calcium channels of neuroendocrme cells Ann N.Y. Acad. Scz 733,306-312
Antisense RNA to Block Receptor Slgnahng
121
14. Paternak, G. W. and Standlfer, K. M. (1995) Mapping op1o1d receptors using antisense ollgodeoxynucleotides* correlating their molecular biology and pharmacology Trends Pharmacol Scl I&344-350. 15 Crooke, S T (1992) Therapeutic appllcatlons of ollgonucleotldes Anna Rev Pharmacol Tox~ol 32,329-376 16. Wahlestedt, C (1994) Antisense oligonucleotlde strategies 1n neuropharmacology. Trends Pharmacol Scl 15,42-46. 17 Wagner, R. W (1994) Gene 1nh1blt1on using antisense ollgodeoxynucleotldes Nature 372, 333-335. 18. Helene, C., Thuong N. T , and Harel-Bellan, A. (1992) Control of gene expression by triple helix-forming oligonucleotldes The antigene strategy. Ann N Y Acad Scl 660,27-36 19 Izant, J G and Welntraub, H (1985) Constitutlve and condltlonal suppression of exogenous and endogenous genes by anti-sense Science 229,345-352. 20 Helene, C and Toulme, J.-J. (1990) Specific regulation of gene expression by antisense, sense, and antigene nucleic acids Biochlm Blophys. Acta 1049, 99-125. 21 Murray, J A H and Crockett, N (1992) Antisense techniques, an overview, 1n Antisense RNA and DNA (Murray, ed ), Wiley-Liss, New York. 22 Albert, P. R. (1994) Heterologous expression of G protein-linked receptors in pituitary and flbroblast cell lines Vltam Horm 48, 59-109. 23. Liu, Y. F , Jakobs, K H , Rasenick, M. M., and Albert, P R (1994) G protein specificity 1n receptor-effector coupling. Analysis of the roles of Go and G12 1n GH4Cl pituitary cells. J Blol Chem 269, 13,880-13,886. 24 Brantl, S. and Wagner, E. G. (1994) Antisense RNA-mediated transcriptional attenuation occurs faster than stable antlsense/target RNA pairing. an 1n vitro study of plasmid pIP501 EMBO J 13,3599-3607 25 Wang, S and Dolnlck, B. J (1993) Quantitative evaluation of intracelluar sense:antlsense RNA hybrid duplexes. Nut Acids Res 21,4383-4391. 26 Nishikura, K and Murray, J. M. (1987) Antisense RNA of proto-oncogene c-fos blocks renewed growth of quiescent 3T3 cells Mol Cell Blol 7,639-649 27. Sheey, R. E., Kramer, M , and Hlatt, W. R. (1988) Reduction of polygalacturonase activity 1n tomato fruit by antisense RNA. Proc Nat Acad Scl 85,
8805-8809 28 Denhardt, D. T (1992) Mechanism of action of antisense RNA Sometime 1nh1b1t1on of transcription,
processing,
transport,
or translation
Ann N Y Acad Scl
660,70-76. 29 Rebagllatl, M. R. and Melton, D A (1987) Antisense RNA inJections 1n fertilized frog eggs reveal an RNA duplex unwinding activity Cell 48,599-605 30. Feng, B. and Denhardt, D T (1992) Inhlbltlon of processing of the primary transcript of the gene encoding tissue inhibitor of metalloprotelnases (TIMP) by antisense TIMP RNA 1n mouse 3T3 cells. Ann N Y Acad SCL 660,280-282 3 1 Kim, S K and Wold, B J. (1985) Stable reduction of thymldlne k1nase activity 1n cells expressing high levels of anti-sense RNA. Cell 42, 129-138
122
Albert and Moms
32 Lm, Z. and Carnnchael, G G (1994) Nuclear antisense RNA An efftctent new method to inhibit gene expresston. Mel Bzotechnol 2, 107-l 18. 33 Kleuss, C., Hescheler, J , Ewel, C , Rosenthal, W , Shultz, G., and Wittig, B. (1991) Assignment of G-protem subtypes to specific receptors mducmg mhrbtnon of calcmm currents. Nature 353,43-48. 34. Kleuss, C., Scherubl, H., Hescheler, J., Shultz, G , and Wrttrg, B (1992) Different P-subunits determme G-protein interaction with transmembrane receptors. Nature 358,424-426. 35 Kleuss, C., Scherubl, H , Hescheler, J , Shultz, G., and Wittrg, B. (1993) Selecttvtty m signal transductron determined by y subumts of heterotrtmertc G proteins Science 259,832-834 36. Lledo, P -M., Homburger, V , Bockaert, J , and Vincent, J -D (1992) Differential G protein-mediated couplmg of D2 dopamme receptors to K+ and Ca*+ currents m rat anterior pmutary cells. Neuron 8,455-463 37 Baertscht, A. J., Audrgrer, Y , Lledo, P.-M., Israel, J -M , Bockaert, J., and Vincent, J.-D. (1992) Dtalysts of lactotropes with anttsense ohgonucleottdes assigns guanme nucleottde bmdmg protein subtypes to their channel effecters Mol Endocrlnol ($2257-2265. 38 Montmayeur, J.-P., Guiramand, J , and Borrelh, E (1993) Preferential couplmg between dopamme D2 receptors and G-protems Mol Endocrznof 7, 161-170 39 Campbell, V , Berrow, N , and Dolphin, A. C (1993) GABAB receptor modulation of Ca2+ currents m rat sensory neurones by the G protein G(0): antisense ohgonucleottde studies J Physzol London 470, l-1 1. 40 Berrow, N. S., Campbell, V., Fitzgerald, E. M., Brickley, K , and Dolphm, A C (1995) Antisense depletron of beta-subumts modulates the brophysrcal and pharmacologtcal properties of neuronal calcmm channels. J Physlol London 482, 481-491.
7 Microinjection of Antisense Oligonucleotides and Electrophysiological Recording of Whole-Cell Currents as Tools to identify Specific G-Protein Subtypes Coupling Hormone Receptors to Voltage-Gated Calcium Channels Vadim E. Degtiar, Burghardt and Frank Kalkbrenner
Wittig, Giinter Schultz,
1. Introduction Heterotrimeric guanosine triphosphate (GTP)-bmdmg proteins (G proteins) act as transducers and amplifiers between activated heptahelical membrane receptors and effector systems such as enzymes, ion channels, and transporters to mediate signals from the outside to inside of cells. The G-protein subtypes are defined by the a-subunits, of which 23 are known by now. Functional, active heterotrimeric G protems include p- and y-subunits as well. Currently, at least five different p- and 11 different y-subforms are known (for review, see ref. I) In many cases, the coupling between receptor and G protein is not selective; one given receptor activates more than one G protem and thus mitiates more than one signal-transduction pathway. On the other hand, there are numerous examples showmg that different receptors activate one type of G protein to regulate the same effector system; e.g., there is mhibition of voltagegated calcium channels by various hormones m neuronal and endocrine cells via G, (for review, see ref. 2). In all cases, the question arises whether the different receptors recognize the same heterotrimeric G protems or whether the receptors see different specific heterotrimers, varying in the subform composttion of the p- and y-subunits. Free combmation between all subforms of G-protein subunits would result in several hundreds of specific heterotrimers.
From
Methods
m Molecular hology, Edlted by D Bar-Sag1
Vol 84 0 Humana
723
Transmembrane Press
S/gna/mg
Inc , Totowa,
NJ
Protocols
124
Degtiar et al.
Antisense ollgonucleotldes for selective knockout of cellular protems have become a powerful tool for studies on signal transduction pathways (for review see refs. 3 and 4). So far, mlcromJectlon IS the only method available that allows for controlled intranuclear application of antisense oligonucleotldes. Using the combination of the two methods-I.e., mlcroinjection of antlsense ollgonucleotldes and determination of hormonal-mduced inhibition of voltagegated Ca2+ channels-we found that somatostatin, muscarmlc M4, and galanin receptors couple via G-protein heterotrimers composed of the subunits a,2Ply,, a,lP3~4, and a,,P,y,, respectively, to voltage-gated Ca2+ channels m rat pituitary cell line GH3 and rat msulmoma cell lme RINmSF cells (5-S). Here, we present data on the methodological aspects of this powerful technique. In particular, we discuss m detail important control experiments demonstrating unequivocally the specificity of the injected antisense ollgonucleotldes with respect to selective repression of the targeted G-protem subunit.
2. Material 2.1. Selection and Microinjection
of Oligonucleotides
The sequences of oligonucleotldes used m this study and in previous pubhcations (S-11) and corresponding target sequences m mRNAs of G-protein subunits are given m Table 1. 1. Ohgonucleotlde sequences were chosen by sequence comparison and multiple alignment using MacMolly Tetra software (Soft Gene, Berlin, FRG) The base sequences of rat mRNAs are not known for all G-protein subumts studied here Therefore, we used the statistical approach of preferred codon usage m the rat to obtain the most likely sequences (see Note 1) 2. Ohgonucleotides were synthesized m a DNA synthesizer (Milhgen model 8600), chlmerlc phosphorothloate-phosphodlester ohgonucleotldes were synthesized using the method described by Iyer et al (12) We used unprotected ohgonucleotldes for intranuclear mJectlon m GH3 cells. In RINmSF cells we used partially protected, and m rat phaeochromocytoma cell line PC-12 cells we used completely protected, phosphorothloate ohgonucleotldes (see Note 2). 3 For mlcromJectlon, we used commercial plpets (Femtotlps, Eppendorf, Hamburg, FRG) or pulled them from boroslhcate-glass plpets (outer diameter 1.12 mm, inner diameter 0.96 mm, with filament, Hllgenberg, Malsfeld, FRG) by using a horizontal puller P-87 @utter Instrument, Novato, CA) The outlet-tip diameter was approx 0 5 pm for the Eppendorf plpets and 0.5-l .O pm for the Hilgenberg pipets
2.2. Electrophysiological
Measurements
Plpets were filled with Cs+-containing internal solutions m order to block K+ conductance (solution 11: 125 mM CsCl, 1 mM MgC12, 3 n&’ MgATP, 10 mM
Table 1 Sequences Name Sense-a,,, Anti-a,,, Antr-aOcom Ann-a,,,, Ann-a,, Ann-a,, Ann-a, Anti-a, t Ann-a, Ann-at4 Anti-a,, Sense-p, Ann-P, Ant& t Anti-P, 2 Anti-P, , Ant& 2 Anti-P, 3 Anti-P, Antl-Pcom Ann-y, Anti-y, r Anti-y2 2 Ann-y, Ann-y, t Ann-y4 2 Ann-y, Anti-y,
of the Antisense Previous
name
Sense-a 5’03 1corn
to1 to2 tq t11 tz t14 t15
Oligonucleotides
Used for Injection
Target sequence 137-170 ofa,* 137-170 of a02 (-35)-(-l) of both a, 51-67 of all three a, 882-907 of a,t 882-907 of ao2 3 lo-330 of aql 287-3 15 of a, 1 3 17-343 of a, 553-578 of aI4 -178--155 of a,5 70-89 of p3 75-93 of p, 76-94 of p2 753-773 of pz 90-109 of p3 64-83 of p3 1010-1029 of p3 76-94 of p4 825-844 of 0, 62-85 of yt 23-44 of y2 122-141 of y2 31-52 of y3 37-59 of y4 108-129 of y4 4-28 of ys 4-27 of y7
mRNA
sequence
GAATCYGGRAARAGYACCATTGTGAAGCARATGA= TCATYTGCTTCACAATGGTRCTYTTYCCRGATTCn GGTGGCCCCTTCCCTGCCACAGCCCGCACGACTCG ARGTTSYKGTCGATCAT’I AGGCAGCTGCATCTTCATAGGTGTT GAGCCACAGCTTCTGTGAAGGCACT CAACCTCTCGAACCAATTGTG GGAGTGCATTGGCCTTGTTCTGCTCATAC TCAGCGGGGCCCGTCAGCGCAAAGAGC CAGAGTCTGACAGTTGGTACTCCCGC CGTTATTGCTCAATCTCGGGTGGC AGATTGCAGATGCCAGGAAA GAGAGAGAGTTGCATCTGC GGGTCAGTGTTGAGTCCCC TCGGCCCGCARGTCRAAGAGGn GGCCAGACACCAGCTCTGCC ACGTCAGCACAGGCTTTCCT CCTCCTCAGTTCCAGATTTT GAACCAGCGTGGCATCGTT TTGCAGTTGAAGTCGTCRTAU TCCAGCGTCACTTCTTTCTTGAGC AGTTTCCTGGCTTGTGCTATGC TTCCTTGGCATGCGCTTCAC TGCGGGCTTGCCCAATACTCAT CTGAGGCAGCCTGGGAGACCTTC TCGGAGGCGGGCACTGGGATG TGGCGGCGACGCTAGAAGAACCCGA CTGGGCTATGTTGTTAGTGGCTGA
a Abbrevratrons for wobbled posrtrons are R (G or A), Y (T or C), K (G or T), S (G or C) Prevrous names mdrcate the names for antrsense olrgonucleotrdes used m prevrous publrcatrons (S-7,9)
126
Degtiar et al.
EGTA, 10 mM HEPES, pH 7.4 at 37°C or solution 12 containing: 115 mM CsCl, 1 mM MgQ, 3 mM MgATP, 20 rnk! BAPTA [ 1.2~hzs (2-AmmophenoxylethaneN,N,N,N,-tetraacettc acid], 10 mM HEPES, pH 7.4 at 37°C). Before and after an experiment, cells were superfused with extracellular solution El (140 mM NaCl, 1.8 mM CaCl*, 1.O mM MgC12, 5.4 mM KCI, 10 mk! glucose, 10 mM HEPES, pH 7.4 at 37°C). The whole-cell currents through voltage-gated Ca2+ channels (I,,) were measured using Ba2+ as divalent charge carrier m solution E2 (125 mM NaCl, 5.4 mM CsCl, 10 mM BaCl,, 1 mM MgCl,, 10 mM glucose, 10 mM HEPES, pH 7.4 at 37°C) for GH, cells, or m solution E3 (10 mM BaCl,, 1 mM MgC12, 5.4 mM CsCl, 10 mM glucose, 10 mM HEPES, 125 mM N-methyl-D-glucamme, pH 7.4 at 37°C) for RINmSF cells. Patch pipets were prepared from glass capillaries (Jencons, Leight Buzzard, UK); the average resistance of the pipets was 2.5-3.5 MR. The series resistance was compensated by 40-70%. The mean capacitance of the GHs cells was 14.1 f 4.7 pF (n = 803, mean f SD), and that of the RINmSF cells was 13.3 f 3.9 pF (n = 472)
3. Methods 3.1. Microinjection and Electrophysiological Measurements 3.1.7. Microrqection of Ant/sense Ol/gonucleotides 1. One day prior to inJection, GHs or RINmSF cells were seeded at a density of about 1 x lo3 cells per mm* on cover shps tmprmted with squares for localization of InJected cells.
2. InJections of ohgonucleotides were performed either by using an automated (AIS, Zeiss, Oberkochen, FRG) or a manual mjectton system (Eppendorf, Hamburg, FRG) 3 The tnjectron solutton routmely contained 10 cl.n/r ohgonucleottdes m water; use of other concentrattons (5 or 15 FM) for some expertments dtd not influence the results. 4 The increase m nuclear- and entire-cell volumes were used as a visual control for successful injection (presumably lo-20 fL were inJected) To measure mtcromjectton efficiency, cells were inJected with a IO-uM solution of fluorescem tsothtocyanate (FITC)-marked oltgonucleottdes. The fluorescence signal was remained for 2 d m the nuclei of about 90% of injected cells, although its mtenstty (reflecting the amount of injected ohgonucleottdes) varied from cell to cell 5. Followmg mjectton, cells were usually cultured for 40-54 h (GH, cells), for 4676 h (RINmSF cells), or for 72-96 h (PC-12 cells) (see Note 2) before electrophystologlcal measurements. About 20-60% of the injected cells were suitable for electrophystologtcal measurements with respect to leak, I,, amphtude, and stability
3.7.2. Electrophysiological
Measurements
1. Glass slides with inJected cells were transferred into a perfuston chamber (0.2 mL vol, 4 mL/mm perfusion rate) and mounted on an inverted mtcroscope.
127
MIcroinjection of Antisense Ohgonucleotides Table 2 Summary Hormone
of the G-protein Heterotrimers Coupling Receptors to Voltage-Gated Ca2+ Channels
Receptof
G-protein heterotrtmer
M, receptor Sst receptor Gal receptor a2 receptor
%P3Y4 %2P
Iy3
%I
P2Y2
%l
P3Y4
%l
P3Y4
Cell Line GH,, PC-12 GH3, RINmSF GH,, RINm5F PC-12
‘Abbrevratrons Gal receptor, galamn receptor, M, receptor,muscarmlcM, receptor, a2 receptor,a2 adrenoreceptor, Sst receptor,somatostatrn receptor
2 Whole-cell membranecurrents were measuredat 37°C according to Ham111 et al, (13), using a List LM/EPC7 patch-clamp amphfrer (List Electronics, Darmstadt, FRG) 3. The maximal amphtude of Ba2+ currents was recorded durmg 20-ms-long voltage pulses from the holdmg potential of -80 to 0 mV; the stimulation rate was 0 5 Hz. Ba2+current amplnude was determmed as peak inward current To take run-down of channel actrvny mto account, the control current was determined as mean value of Ba2+current amplitudes before galanm application and after washout of the hormone 4. The mhrbmonof Ba2+current by galamnwas determmedas difference (m percent) between the peak current amphtude of the control current and the peak current amplitude(reachedafter 6-10 s) during superfusionof the cells with hormone 5. The significance of the results was determined usmgStudent’s t-tests assuminga Gaussiandistribution of data. Standard errors are given as SEM.
3.2. Analysis
of Data Distribution
Galanin-induced inhibition of voltage-gated Ca2+ channels is mediated by heterotrimeric G proteins composed of the subunits a,tp2y2, and a,1/3,y4, m the ratmsulinoma cell line RINmSF as well as in the rat pituitary cell line GH, (ref. 8 and seeTable 2). In RINmSF cells, galanin caused an inhibition of Ic,, which was more pronounced (up to 60% of the control amplitude) than galanm-induced Ica inhibitlon in GH, cells. In mean inhibition was between 27 and 33% (Fig. 1A and ref. 8).
1. Figure 1B showsthe drstributton of data points of galamn-induced Ica mhrbmon measured in RINmSF cells mlected with antisense ohgonucleotides against pertusslstoxme (PT)-msensmve Go subunits(a,, a, t, a14,a15, a,) or with sense a ocomohgonucleotides Inhrbmon of Ica induced by galanm was not affected by these ohgonucleotrdes. A srmrlar I,-, drstrrbution was observed in noninjected cells (data not shown) and in cells iqected with anti-a,,,, and anti-a,, ohgonucleotrdes (Fig. lC, E)
sense-a anti-a,, antt-a,, antka, ,, z
,
0
0
20
40
60
80
antI-a,,,,
60
I 80
an&a,,
F
8
’
*’
4o 6o a’ antkcL,,,
Fig 1. I,, mhibitton by galamn m RINm5F cells injected with antisense ohgonucleottdes directed agamst the mRNAs of a-subunits of heterotrtmertc G proteins, anti-ag,li,z indicates a mtxture of anti-a,, anti-a, i, and arm-a, (A) In, mhibmon in cells inJected wtth ohgonucleottdes used for suppression of a-subunits (data taken from ref. 8) (B-F) Distrtbuttons of Ina mhtbttton m control cells injected with sense-a,,, ohgonucleottdes or ohgonucleottdes annealmg to the mRNA of PT-msensmve Ga-subumts (arm-a,, anti-a,,, arm-a,, anti-cq4, anti-a,,), (B) m cells inJected with arm-a,,,, (C), with arm-o&i (D), wtth antt-q,2 (E), and with arm-a,,,, or anti-a,,, (F) oligonucleottdes. The ordinates show the number of measurements that yielded the same range of mhrbmon (bin width 5%) The data were fitted to a Gaussian dtstrtbutton (data were taken from ref. 8)
Microinjection of Antisense Oligonucleotides
129
2. The dlstrlbutlon of galanin-induced I,, inhibition m cells injected with anti-a,,,, anti-a,,,, and anti-a,,, antisense ohgonucleotldes was clearly shlfted to the left, demonstrating a reduced galanm-induced Ica inhlbltlon (Fig. lD, F). 3 In the case of anti-a,,-injected cells a blmodal distribution of the data was observed (see Fig. 1D). The peak representmg most cells was shifted to lower inhibitions A smaller part of the cells, however, showed a dlstrlbutlon of Ica mhlbltion similar to non- or control-inJected cells, thus probably representing cells m which mhlbltlon was not affected. Cells showing small (~15%) inhibition of I,, were practically absent m control cells and m cells injected with ohgonucleotides not affecting galamn-induced mhlbltion of I,, (see Note 3)
3.3. Internal Controls of Specificity of the Antisense Oligonucleotides To further confirm the specificity and effectiveness of antisense ohgonucleotldes, an assay demonstrating the reduction at the protein and/or mRNA levels caused by antisense suppression of the respective target would be desirable. Suppression of Ga, lmmunoreactlvlty in cells injected with antisense ohgonucleotides has been demonstrated (5,14). More important, the selective mhlbition of Ga,,-subtype proteins could be demonstrated in antl-aOl- and anti-a02-injected RINmSF cells by immunofluorescence using subtype-specific antlbodies (8). Unfortunately, experiments showing a suppression of p- and ‘y-subunits have not been performed so far, because specific antlbodles suitable for immunochemical detection of each subunit are apparently not available. 1 We used another and even more stringent control of efflclency and specificity of the antisense effect m almost every cell studied. The effects of two different hormones mhlbltmg La m the particular cell under mvestigatlon were compared, i.e , m addltlon to galamn either carbachol (acting via M4 receptors) or somatostatm were applied (see Note 4). 2. Figures 2 and 3 show the results of mdlvldual measurements of galanm- and carbachol-induced mhlbltlon of I,, m GH3 cells injected with ohgonucleotides annealing to the mRNAs of G-protein p- and y-subunits. The data shown were derived from cells to which both hormones were subsequently applied (examples in Fig. 2A, B and Fig. 3A, B). In cells injected with an&P1 ohgonucleotldes, the inhibition of the Ca*+ current induced by galanin, as well as the inhibition by carbachol, were unchanged (data not shown). In anti-P2-injected cells, the galanin-induced mhlbltlon of Ica was decreased, whereas the carbachol effect was not disturbed (Fig. 2A) In cells injected with antI-& ohgonucleotldes, the carbachol-induced mhlbltlon of I,, was completely abolished, whereas the inhlbltlon by galamn was still detectable, indicating that P-subunit other than p2 1s involved (Fig. 2B). 3. Equivalent experiments were performed with ollgonucleotldes suppressing y-subunits expression. In cells injected with antl-y2 ohgonucleotldes, galanm
130
Degtiar et al.
tlmln)
B
I/I,
1200 10ms
antl-p, 7 06.
T-zv
v -6
c
-
z
i
antI-P,,P4
20
30
galanln-IndUCed
G
f
f
anti-p, 30 I
10
^
0
:
10
30
20
lnhlbltlon
30
0
Of
I&
[%]
Fig 2. Carbachol-and galanm-inducedIBamhibmon in GHs cells injected with ohgonucleotidesannealingto the mRNAs of G-protein P-subumts.I,, tracesare selectedat the indicated points on the correspondmgtime coursesof IBa m representativecells which were injected wtth anti-P* (A) or antt-P3oligonucleottdes(B). Bars denotethe time during which galanm (G) or carbachol (C) were present (C) Distrtbutton of the hormonal responsesm three groupsof cells inJectedwith anti-P, or anti-p, ohgonucleottdes(control for thesehormones,left panel), arm-p2(middle), and anti& ohgonucleotides(right) Open circlesrepresentvaluesfor mdtvtdual cellson carbachol-induced(verttcal coordinate)and galanin-induced(horizontal coordinate) I,, mhibmon. Filled trianglesshowthe meanvalues for carbachol- and galamn-mducedmhtbmon with standarddeviations for the data presented(data were taken from ref. 8) causedonly weak mhibition of Ica; no change m I,, mhibition was observed with carbachol (Fig. 3A). Cells injected with anti-y4 ohgonucleotides showed no mhtbitton of I,, by carbachol, but galanm was still able to mhtbtt I,, (Fig. 3B) Iqectton of anti-y, oligonucleotides had no influence on either galanm- or carbachol-induced mhtbtttons of I,, (data not shown). 4 The distribution of data points of Ica mlnbmonsinduced by galanm and carbachol showeda stgmftcant shift to the left toward zero for the galanmeffect m ant&- and
Microinjection
of Antisense
Oligonucleotides
131
ant I-
4
t[mm]
antl-
T @
2 22 2
antl-y,
anti-3, !y5,y7
0’
10
20
30
0
galanin-Induced
10
20
antr-y,
30
inhibition
0
10
of
IBa
20
30
[%]
Fig. 3. Carbachol- and galanm-induced I,, mhlbltlon in GH, cells inJected with ollgonucleotides annealing to the mRNAs of G-protein y-subunits. I,, traces and time courses of carbachol- and galanm-mduced inhlbltlons m representative cells injected with antl-y2 (A) or antl-y4 ohgonucleotldes (B) are shown. (C) Distnbutlon of the hormonal responsesm individual cells injected with antl-yl, anti-y,, or anti-y7 oligonucleotides (left), anti-y2 oligonucleotides (middle) and anti-y, ollgonucleotides (right) are shown Other deslgnatlons are similar to Fig. 2 (data were taken from ref. 8).
anti-‘y2-inJectedcells, 1e., reduced mhlbitlon by galanm with unchangedmhlbltlon by carbachol (Fig. 2C and 3C, middle panels) For anti&- and anti-y,injected cells, the left shift for galanin-induced mhlbltlon was lessobvious, but still significant, compared to cells injected with pl, p2, yl, y5, and y7 antisense oligonucleotldes (Figs. 2C and 3C, right panels). For carbachol-mduced mhlbltlon of ICata slgmflcant down shift of hormone-mducedmhlbltlon toward zero was exclusively seenm anti-& and anti-y4-injectedcells (Fig. 2C and 3C, nght panels)
132
Degtiar et al.
3.4. Conclusions Injected and noninjected cells reacted identically to physiological stimuli with regard to hormone-induced inhibition of voltage-gated Ca2+ channels (8) (see Note 5). Recently, three studies were pubhshed m which suppression of Go,, GQ and Ga,, expression and of the related function were reached by adding the antisense ohgonucleotides to the cell-culture medium. In these studies, effects on cellular differentiation, adenylyl cyclase inhibition and K+ channel stimulation were measured (15-17). In contrast, we have not been able to observe reduction of Go-mediated inhibition of Ca2+ channels by applying antisense ohgonucleotides at concentrations up to 100 l-04 to the culture media of GHs or RINm5F cells. Even by addition of catiomc hposomes, the concentrations of antisense ohgonucleottdes reaching the nucleus were obviously not high enough to see cellular effects (data not shown). However, it IS well-known that transfection efficiency of antisense oligonucleotides varies with cell types used. Thus, mtranuclear microinjection of antisense ohgonucleotides is so far the only way of introducmg antisense oligonucleotides into cell independently of the cell type used. Table 2 shows a summary of the G-protein heterotrimers detected by using the methods described in this paper. In summary, we demonstrated the statistical sigmficance and the specificity of suppression of G-protein subunit expression by antisense ohgonucleotides if microinjected mto the nuclei of GHs and RINmSF cells. In particular, suppression of one subtype of G-protein subunits selectively blocked signal transduction from one receptor sigmficantly, whereas signalmg from another receptor through a closely related pathway to the same effector system, i.e., voltage-gated Ca2+ channels, remained unaffected. Using subsequent apphcations of at least two different hormones, we were able to prove, in each cell under mvestigation, the specificity of the injected oligonucleotides in one and the same cell. In addition, reaction of cells to the control hormone demonstrated the viability of the cells In our opinion, antisense experiments should generally mclude the comparison of two related pathways m one and the same cell, allowmg for internal controls described m this chapter.
4. Notes 1. First, we translated the respective mRNA base sequence as sequenced from one species into the corresponding ammo acid sequence. This step does not create uncertainty because the genetic code is definite in translation. Second, we translated the unambiguous amino acid sequence back into mRNA-base sequence. Here, we used the evolutionary preferred-codon usage of the rat. By using the targeted species’ codon usage, the degeneracy of the genetic code is reduced considerably. The obtained nucleotide sequence is unambiguous in about 95% of
Microinjection of Antisense Oligonucleotides
133
the bases, compared to ~60 % tf the umversal codon usage 1s used. The resulting nucleotrde sequence was used to run an anttsense oltgonucleottde search program under hrghly stringent condtttons, which allowed a choice of either unambiguous antrsense sequences or sequences with wobblmg in as few postttons as posstble. The resulting antrsense ohgonucleotrdes, espectally those designed to suppress p- and y-subunits, were used m anttsense experiments and m reverse transcrtptton-polymerase chain reactton assays (RT-PCR) RNA was reversely transcribed mto cDNA, and PCR was performed using an anttsense ohgonucleotrde as one of the specific prtmers Spectficity of annealmg and identity of PCR products were proven by usmg a plasmtd as template contammg the respective cDNA sequence for the correspondmg subunit from which the sequences of the primers were obtained. The ohgonucleottde named anti-a,,, IS able to anneal to a nucleottde sequence common to the mRNAs of all PT-sensitive G proteins, tt 1s reverse-complementary to sense-a,,, These oligonucleottdes as well as antta ocom,anti-a,,,,, anti-a,,, anti-a,,, anti-ag, anti-all, and antr-a, are Identical to those used in previous studies (5,8). The oltgonucleottdes sense-p,, anti-p,, antI&, ant]&, anti& anti-y,, anti-y,, antr-ys, anti-y4 were also used before (6-8). 2. In RINm5F cells, the relative size of the nucleus IS much smaller. As a consequence, the probabthty of hitting the nucleus 1s lower, and mjectton will more often target the cytoplasm. To prevent degradation by exonucleases during transport into the nucleus, parttally protected ohgonucleottdes were used m RINmSF cells, i.e., m the last two nucleotrdes at each the 5’ and 3’ end one of the nonbridgmg oxygens of the phosphate group was replaced by sulfur (phosphorothtoates). In PC-12 cells, we detected the maximal anttsense effect, 1 e , lowest mhrbmon of calcium channels by the tested hormones 72-96 h after mrcromjectton of the antisense ohgonucleottdes compared to 40-54 h m GH, cells and 46-76 h m RINm5F cells. Therefore, for the mjectron mto the nuclei of PC- 12 cells, we used completely phosphorothtoate-protected ohgonucleotides m which in each phosphate group one oxygen was replaced by a sulfur With these completely protected ohgonucleottdes, we observed nonspectftc effects only at concentrattons above 50 p&f. 3 The wide drstrtbutton of hormonal responses m cells injected with anti-a,, ohgonucleottdes in RINm5F lme (see Fig. 1D) 1s ltkely to reflect varrabthty m Gao, depletion among mdtvtdual cells. The simplest explanation would be contammatton by unsuccessfully mjected cells In addrtron, even under apparently tdenttcal condmons wtth respect to injectton pressure, tnjectron time, ohgonucleottde concentration, and so forth mdrvtdual differences from cell to cell m cellular size may cause variation of the inJected volume Thts may produce varying amounts of antrsense ohgonucleottdes mstde cells resulting m different efftctenctes of the anttsense effect Such btologtcal variability may lead to the overlapping dtstrtbutions of data points obtained with ohgonucleottdes not affecting function, compared to those obtamed with ohgonucleottdes affectmg the galanm stgnaltransduction pathway
134
Degtiar et al.
Table 3 Density of Iga in GHB and RINm5F Ceils Injected With Antisense Oligonucleotides Annealing to the mRNAs of Different Subunits of Heterotrimeric G Proteinsa Treatment
GH, (PA/PF)
Control PT Sense-a,,,, Anti-a,,, Anti-a,,,, Anti-a,com Anti-a,, Anti-a, Antl-qll,z
44.4 IL 3.2 (n = 29) 43 0 IL 5 4 (n = 16) 30 6 k 2 4 (n = 57) 34 5 k 6 1 (n = 10) 31.9&27@=48) 28.3 f 3.0 (n = 24) 29.0 f 2.3 (n = 43) 228 2 + 2 3 (n = 46) 29.6 f 3 6 (n = 28)
Anti-at, Anti-al5 Antl-Pcom Anti-P Ann-y
26.3 AI 3 2 (n = 8) 26 9 f 1 04 (n = 282) 25 5 3~1 1 (n = 212)
RINmSF (pA/pF) 37 3 2~6.6 (n = 24) 39.4 f 7.2 (n = 18) 21 1 + 6 2 (n = 9) 256+ 11 (n=6) 8.5 319.2 (n = 9) 20.9 3~4.0 (n = 9) 25 2 zk2 2 (n = 62) 31 9 f 4.6 (n = 32) 27 8 AI5 5 (n = 8) 38 1 + 8 3 (n = 6) 32.0 rk 7.9 (n = 15) 214 k 2 2 (n = 14) 26.2 f 1.9 (n = 141) 26.8 k 1 7 (n = 111)
OData represent current densltles, I e , I,, peak amplitudes, which were maximal for the cells (measured m the first mmutes of an experiment), divided by the cell capacity Ica are given m pA/ pF as mean + SEM for each group of cells, m parentheses are the numbers of cells studied Anti-P and anti-yglve the mean values for all experiments with cells injected with various ohgonucleotldes annealing to p and y subunit mRNAs, respectively
4 For these two receptors, the subunit-composrttonsof the interacting G proteins are known (ref. 7 and seeTable 3). Only a few cells were not stable enough for subsequentapphcations of two hormonesduring one recording. 5. However, tt 1simportant to note that the mean of I,, amplitudes normalized to cell capacity (I,, densities)was srgnifrcantly (p < 0.01) lower in almostall groups of injected cells compared to nonmjected cells (Table 3). Nevertheless, no srgmficant differences m I,, densities were observed by comparmg the different groups of cells injected with antisenseohgonucleotrdes annealing to the mRNAs of a-, p-, or y-subunits (seeTable 3). In addition, I,, densttles m PT-pretreated cells were not srgmfrcantly different from I,-, densities in control (noninJected) cells The fmdmg that differences m I,, densrtresbetween noninJectedcells (control as well as PT-pretreated cells) and cells injected with antisenseoligonucleotrdes exist, indicates that the membranesof injected cells may be damagedby the mrcrotnjectton procedure (data not shown) This demandsfor proper controls in microinjection studies, 1e , to compare injected cells only to other injected cells This condrtron was definitely fulfilled m all our studies, by comparmg groups of cells to each other from which each was inJected with antisenseoh-
Microinjection of Antisense Oligonucleotides
135
gonucleotldes destgned to anneal selectively to one particular species among htghly related mRNAs In addttton, we used sense oligonucleotides as controls
Acknowledgments We thank Susanne Brendel for excellent technical assistance and Katrm Btittner for synthesis of oligonucleotides. This work was supported by grants of the Deutsche Forschungsgememschaft and Fonds der Chemlschen Industrie. References 1. Neer, E. J. (1995) Heterotrimeric G proterns. organizer of transmembrane signals Cell 80, 249-251. 2. Gudermann, T , Kalkbrenner, F., and Schultz, G (1996) Diversity and selectivity of receptor-G protein interaction. Ann Rev Pharmacol Toxlcol. 36,429-459 3. Albert, P R. and Morris, S. J (1994) Antisense knockouts. molecular scalpels for the dissection of signal transduction. Trends Pharmacol. Scz 15,250-254 4 Kalkbrenner, F , Dtppel, E., Wlttlg, B., and Schultz, G. (1996) Speciftcity of the receptor-G-protem mteraction. Using antisense techniques to identify the function of G protein-subunits Blochzm Biophys Acta, 1314, 125-139. 5 Kleuss, C , Hescheler, J , Ewel, C , Rosenthal, W., Schultz, G., and Wmig, B. (1991) Assignment of G-protein subtypes to specrfic receptors mducmg mhrbinon of calcium currents Nature 353,43-G?. 6. Kleuss, C., Scherubel, H , Hescheler, J., Schultz, G , and Wntig, B. (1992) Dtfferent P-subunits determine G-protem mteraction with transmembrane receptors. Nature 358,424-426. 7 Kleuss, C., Schertibel, H., Hescheler, J., Schultz, G , and Wittig, B. (1993) Selectivity m signal transduction determined by y subunits of heterotrimeric G proteins. Sczence 258, 832-834 8. Kalkbrenner, F., Degtiar, V E , Schenker, M., Brendel, S , Zobel, A , Hescheler, J , Wittig, B., and Schultz, G (1995) Subumt composition of G, proteins functionally couplmg galanm receptors to voltage-gated calcmm channels. EMBO J 14,4728-4737. 9 Gollasch, M , Kleuss, C., Hescheler, J , Wittig, B , and Schultz, G. (1993) G,2 and protem kmase C are requtred for thyrotropm-releasmg hormone-mduced stimulation of voltage-dependent Ca 2+ channels in rat pituitary GH, cells. Proc Nat1 Acad Set USA 90,6265-6269. 10. Dippel, E., Kalkbrenner, F , Wlttig, B., and Schultz, G (1996) A heterotrimeric G-protein complex couples the muscarmic ml receptor to phosphohpase C-p Ptoc Nat1 Acad Scz USA 93, 1391-1396. 11. Degtiar, V.E., Wittig, B , Schultz, G., and Kalkbrenner, F. (1996) A specific G, heterotrimer couples the somatostatm receptor to voltage-gated calcium channels m RINmSF cells FEBS Lettr 380, 137-141 12. Iyer, R. P., Egan, W., Regan, J. B., and Beaucage, S. L. (1990) 3H-1,2Benzodithiole-3-one 1,l -dioxide as an improved sulfurizing reagent m the sohd-
136
13
14.
15.
16
17.
Degtiar et al.
phase syntheses of ohgodeoxyrrbonucleosrde phosphorothtoates J Am Chem Sot 112, 1253,1254 Hamrll, 0. P , Marty, A., Neher, E , Sakmann, B., and Srgworth, F J (198 1) Patch-clamp techniques for high-resolutron current recording from cells and cell-free membrane patches. PfZugers Arch. Europ. J Phys~ol 391,85-100. Campbell, V , Berrow, N., and Dolphm, A. C (1993) GABA, receptor modulation of Ca2+ currents m rat sensory neurones by the G protem G; antisense ohgonucleotrdes studies J Physlol London 470, l-l 1 Wang, H.-Y., Watkins, D C , and Malbon, C C (1992) Antisense ohgodesoxynucleottdes to G, protein a-subumt sequence accelerate drfferentratton of frbroblasts to adlpocytes Nature 358, 334-331 de Mazancourt, P , Goldsmith, P K , and Wemstem, L. S. (1994) Inhtbrtron of adenylate cyclase activity by galanm m rat msulmoma cells 1s mediated by the G-protein G,3 Biochem J 303, 369-375. Ffrench-Mullen, J M., Plata-Salaman, C R , Buckley, N. J., and Danks, P (1994) Muscarmrc modulation by a G-protein alpha subunit of delayed rectifier current m rat ventromedial hypothalamic neurones. J Physlol London 474,21-26.
Oocytes Microinjection Assay to Study the MAP-Kinase Cascade Juan Carlos Lacal 1. Introduction 1.1. The Oocyfe System The oocytes of several organisms-most frequently those of the African clawed toad Xenopus laevzs-have been used for many years as an excellent system to study regulation of transcription, translation, protein modification processes, secretion, and protem compartmentalization, as well as the expression of heterologous-membrane receptors and their association to specific signaling cascades. Full-grown oocytes are large cells (over 1.2 mm m diameter) that are arrested in late-G2 phase of the first meiosis (Meiosis I), and must progress after physiologrcal stimulus by progesterone to the second meiotrc metaphase (Meiosis II) before fertilization takes place. This process, called oocyte maturation or germinal vesicle breakdown (GVBD), can be easily visualized by the appearance of a small white spot m the animal pole, a consequence of the dissociation of the nuclear envelope. After GVBD is completed, if the oocytes have been fertilized, DNA synthesis takes places with the consequent initiation of the Meiosis II. Physrological reinitiation of meiosis in vivo in the oocyte is triggered by progesterone, which is produced by the action of the gonadotropic hormone on the ovarian follicle cells. Progesterone can also induce GVBD in vitro m oocytes excised from their ovarian follicles. This process mimics the signaling pathways involved m the mitotic induction m other eukaryotic cells. The large size and easy manipulatron of the oocytes, along with the availability of the complete transcriptronal/translational machinery and a large set of transduction molecules, has made this system an excellent tool to study the potential From
Methods m Molecular Bology, Vol 84 Transmembrane S/gna/mg Edlted by D Bar-Sag1 0 Humana Press Inc , Totowa, NJ
139
Protocols
140
Lacal
role of any type of molecule in signaling pathways involved in cell-cycle regulation, and therefore is an excellent model system to study mitogenic-stgnalmg pathways. In this chapter, I describe the use of Xenopus oocytes for the study of intracellular-kmase cascades and in particular for the activation of the mitogenactivated protein kinase (MAPK) pathway. A detailed description of Xenopus oocytes and micropipets preparation, as well as the mtcromJection technique itself, is included. Finally, descrtpttons of various protocols for the evaluation of maturation-promoting factor (MPF), MAPK, Raf-1 kinase, and S6 kmase, II (S6 KII) activation in oocytes are reviewed.
1.2. Oocyte Maturation:
An Overview
The mduction of oocyte maturation under physiologtcal conditions (i e , by progesterone treatment) is mediated by the engagement of the hormone receptor and the subsequent activation of a cytoplasmic MPF, which activates an intracellular-kmase cascade ending into the breakdown of the germinal vesicle. Several hours after progesterone treatment, the oocyte nucleus (the germinal vesicle), located near the center of the oocyte m the unstimulated oocyte, starts to migrate toward the animal hemisphere surface. This causes the pigment m the animal pole to be displaced, producing a white circular spot. This white spot constitutes, in fact, the first visible indication that oocyte maturation is taking place. After dtssolution of the nuclear membrane, known as GVBD, the condensed chromosomes complete Meiosis I, and then progress to the second meiottc metaphase continues until fertilization is accomplished (reviewed in
refs. 1-3). Although the appearance of a white spot in the animal pole is usually considered the hallmark of oocyte maturation, it is not always an mdication of a complete GVBD, a fact that should be taken mto consideration when analyzmg the activity of new compounds or proteins. Manual dissection of the fixed oocytes (incubated for 10 mm on 10% TCA or boiled briefly) should always be performed to determine with certainty if the vesicle has been dissolved. Also, tt must be taken mto consideration that the timing of GVBD after treatment can vary considerably in oocytes from different females. This can result m part from different environmental conditions under which the animals are maintamed m laboratories, the buffers used for oocyte manipulation, or if the females have been hormonally treated. Based on the recent knowledge of the components of the signalmg cascade involved in this process, endogenous biochemical markers have been shown useful in determining unambiguously the induction of oocyte maturation. After progesterone treatment, activation of MPF from inactive stores takes place prior to observance of GVBD. MPF 1s a complex of cyclin (A or B) and Cdc2-
Oocytes Microinjection Assay
141
protein kmase; activatton leads to a burst of protein phosphorylation 30-60 min prior to GVBD. Two peaks of MPF activity can be readily detected after progesterone stimulation. The first comcides with metaphase I and needs synthesis of the Mos-protein kmase. The second peak appears m metaphase II and needs the resynthesis of cyclins, which are destroyed at the end of the first mttosrs. All mitogemc-signalmg pathways so far identified m oocytes lead to the phosphorylation of ribosomal S6 protein on Ser residues. In Xenupus oocytes this effect 1s made by the S6 K II, a homolog to mammalran rsk. S6 K II is activated by phosphorylation by MAP kmases, also called ERKs. The MAPK itself is also activated by direct phosphorylation on Tyr and Thr/Ser residues by the MAP kmase kmase (also known as MEK) which is itself a substrate of the Raf kinase (reviewed m ref. 4). This cascade m Xenopus is similar to that observed
m mrtogenically
stimulated
mammalian
cells, and it has been used to
characterize the srgnalmg pathways activated by oncogenes such as ras. Fmally, it is important to note that, m addition to progesterone (which is the physiological inducer of maturation), several other steroid hormones (5) msulm, and IGF-I (6), as well as a number of diverse drugs, ions, chemicals, and proteins (5,7-13), have been reported to induce oocyte maturation. It should be emphasized that, m most cases, the only assay for maturation that has been used is GVBD, and therefore some of these previous works may need re-evaluation with new molecular markers. 2. Materials 2.1. Equipment There is an enormous because many techniques
options available
flexibility
in the choice of equipment
give quite satisfactory
and methods,
results. Only a few of the many
are described.
1 MicroinJections: Almost any type of stereo mtcroscope can be used I have used either C. Zeiss GSZ, C Zeiss Stem1 SR, or Nrkon SMZ-2B stereo mtcroscopes. An approprtate source of light such as KL 1500-Z (C Zetss) or equivalent should be used to avoid overheatmg the oocytes 2 Mtcromampulators Many different set-ups are commercrally available I have used either a vertical mmromampulator from Narrshrge, or the MK I mrcromanipulator (Singer Instruments) 3 Pressure system. Several pumps are available on the market I have used the InJect+Matic an pump (A Gabay, Geneve, Switzerland), which does not require pressurrzed tanks and 1striggered by a foot pedal, and the PLIlOO Pressure Source (Medical Systems), which 1s connected to a nitrogen tank for pressure. The pressure and time of rnJectton will be experrmentally determined by cahbratron of each capdlary usmg some oocytes that wdl be discarded afterward
142
Lacal
2.2. Oocyte-lncubafion Buffers The following buffers are recommended to be used for the dissection and conservation of oocytes for short-term experiments (2-3 d) at room temperature (see Notes 1 and 2 for additional information): Ringer’s: 100 mM NaCl, 1.8 mM KCI, 2 mM MgCl,, 1 mM CaCl,, 4 mM NaHC03, pH 7.8. This buffer is stable for months at room temperature and it is my personal choice. OR2: 82.5 mM NaCl, 2.5 mJ4 KCl, 1 mM MgC12, 1 mM CaC12, 1 mM Na,HPO,, 5 r&4 HEPES, pH 7.8. This buffer should be prepared m two 10X stock solutlonsA (NaCl, KCl, Na,HPO,, HEPES, and NaOH to pH 7.8) and B (CaCl,, MgC12)-and mixed immediately before use, checking that the pH of the resulting solution is 7.8
2.3. Microinjection
Buffers
Essentially the same aqueous buffers required to keep the actlvlty of the proteins or the test compounds can be used for mlcromJectlon, provided that an excessive concentration of ions 1s avolded. (We have seen that high concentrations of some ions are able to induce GVBD themselves.) It is also critical that pH values are kept between 6.8 and 7.2. Usually I use one of the followmg buffers: 20 mM MES, pH 7.0; or 50 mMTns-HCl, pH 7.0. These buffers can be supplemented with fatty-acid-free bovine serum albumin (BSA) (0.5-l mg/mL).
2.4. MPF, MAPK, and Raf-I Kinase-Assay
Buffers
1. BLO buffer For the analysis of the MPF assay the following buffer IS used. 20 mM HEPES pH 7.0, 10 mM P-glycerophosphate, 5 mM EGTA, 5 mM M&l*, 50 mM NaF, 2 mM DTT, 25 pg/mL aprotmm, 10 pg/mL leupeptm, and 100 JJJ!~ phenylmethylsulfonyl fluoride (PMSF) 2. Lysls buffer* For the determination of MAPK and Raf-1 kmase assays, the followmg buffer 1s used to resuspend the samples 50 mM Tris-HCl, pH 7 5, 5 mM EDTA, 0 5% Trlton X-100,0.5% sodium deoxycholate, 10 mM Na4P20,, 50 mM NaF, 0.1 mM Na3V04, 20 pg/mL leupeptm, 20 pg/mL aprotmm, 1 mM PMSF. 3 Western blot For Western-blotting of the MAPK and Raf-1 kmase, I use T-TBS 20 mM Tns-HCl, pH 7 5, 150 mM NaCl, 0 005% Tween-20
3. Methods 3.7. Preparation
of the Oocytes
Xenopus laevzs females can be purchased from any of several supply companies in Europe, Africa, or USA. After arrival, they should be placed m their
final destination for at least l-2 wk before use to reduce stress (see Note 3). They should be kept at 23°C m tanks or aquaria with a clrculatmg dechlonnated water supply, which is tap water aged in another tank for several days.
Oocytes Microinjection Assay
143
Circulation can be achieved with an electric immersion pump at the bottom. For appropriate maintenance, the animals should be fed granulated food twice a week, and the water changed entirely the followmg day. Oocytes can be used from either untreated females or females treated by injection with human chorionic gonadotropin (hCG). If treated oocytes are desirable, injections should be done into the dorsal lymph sac. HCG 1s available from several companies (Sigma, Organon, and so on). Usually 100-200 U of hCG are injected 2 wk prior to when oocytes are needed. hCG stimulates steroid production by the gonads and facilitates maturation of the oocytes (see Note 4). In any case, oocytes are selected as follows: 1 Animals are anesthetized by immersion mto a 0.2% solutton of ethylammo benzoate for lo-20 mm or by a cold shock m ice for 30-40 mm 2 Once anesthetized, the animal is placed on Its back on a clean surface covered with alummum foil. Wipe the abdomen wtth 70% ethanol
3. Using sterilized tools (scalpel, forceps, scissors) make a small lateral incision about 1 cm m length through the skin and body wall Just above the leg Pool out the ovary through this ventral inciston with a watchmaker’s forceps and cut as many pieces as required with scissors 4. After operation, wounds m both the body wall and the skm are sutured separately with several stitches of sterile catgut, and the ammal 1s left to recover m a water bath at room temperature. Females can be operated on several times before being sacrificed under anesthesia 5 Each fully mature Xenopus laevls female carries several thousand oocytes of >l mm m diameter InJecttons are usually performed with stage-VI oocytes, which are charactertzed by then size and appearance: over 1.2 mm m diameter, unptgmented equatorial band, and a dark animal hemisphere 6 Oocytes can be microinlected after selection with no further treatment However,
they can be itqected more easily after defolhculation
This can be achieved by
incubating small pieces of the ovaries cut with scissors m Ringer’s medium containmg 0.2% collagenase (type I Sigma) at 18-22°C under low agitation (see Note 5). Usually, after 2-3 h of mcubation, individual oocytes start to separate from the follicular tissue At this time, they should be washed exhaustively and transferred to flat dishes with fresh medium and kept at least several hours before mlecttons Oocytes can be also stored overnight at room temperature to allow them to fully recover and to avoid usage of those damaged during treatment. Oocytes should always be transferred by wide-mouthed ptpets to avoid stress and lysis. 7 Alternatively, oocytes can be manually dissected by pullmg mdividual oocytes away from the folhcles For this, a small piece of the ovary containing a few hundred follicles is cut with scissors with a mtcrobiologrcal sterile loop while holding the piece of the ovary with a watchmaker’s forceps Grasp gently to free individual oocytes and select those with an intact appearance
144
Lacal
8. Oocytes are then selected accordmg to their size and their appearance. Selected oocytes are then transferred carefully to a fresh dish with a wide-mouthed plpet, taking care to avoid taking buffer if turbid, and mdicatlon of oocyte lysls or leaklness. Only stage-VI oocytes are selected with a diameter of at least 1.2 mm, ehmlnatmg those that have turned white At this point, medium can be supplemented with antlblotlcs (see Note 1). Gentle vibration of the dish usually 1s sufficient to turn the oocytes to the appropriate posltlon for mlcrolnJectlons. Otherwise, a gentle buffer purge from the plpet toward the oocytes will have the same effect
3.2. Preparation
of Micropipe ts
Injection caplllarles are one of the most Important aspects of the technique. There are many commercially available instruments suitable for fabrlcatlon of inJection plpets for oocytes. All of them essentially consist of an electrically heated solenoid and a pulling device. Avallable pullers must always be evaluated with respect to the glass used, tip diameter, open or closed tip, and shape of the capillary. I have used satlsfactorlly the Narishlge PP-83 puller. 1 Glass caplllanes. Use boroslhcate-glass captllarles (Klmble) with 1 0 mm OD and 0 7 mm ID Also boroslhcate-glass caplllarles Clark GC 120F-10 (1 2 mm OD; 0.69 mm ID) give excellent results 2 Pulling procedure. The glass plpet 1splaced through the solenoid, clipped by two clamps, and heated under stress until the pulling force pulls out the two pieces 3 Ensure that the lowest pullmg tension obtamable 1s applied 4 Adjust heather. number 1 heather, 15, number 2 heather, 13 5 Insert and clamp a glass capillary carefully mto the puller The capillary must not touch the heating filament 6. Switch on the heaters. 7 Caplllarles are drawn with tip diameters of around 0 5-l pm They may be closed as they come out from the puller 8. Check caplllarles under the microscope for their shape 9 Openmg the plpet The tip of the plpets should be open after pullmg and should have an external diameter of lo-20 pm Best results are achieved d the tip 1s polished once pulled using a special ground mill with a 45” openmg (Nanshlge EG-4) However, breakmg the tip with a watchmaker’s forceps 1s sufficient to generate efficient plpets of about lo- to 20-pm tips. Store capdlarles m a dustfree and dry environment until use A plastic plate contammg a small piece of artist’s clay 1s an excellent way to hold them safely 10 Filling caplllarles with sample Plpets are loaded by sucking about l-3 pL of the experimental solution (proteins, enzymes, hpld metabohtes, and so on). In order to avoid capillary clogging, the sample 1s centrifuged 10 min at 10,000 rpm A drop (2-5 pL) of the solution 1splaced on a piece of parafllm under the binocular, and the tip of the plpet introduced until it reaches the bottom of the drop. This can be achieved directly with the Medical System mlcrolnJector unit and the
Oocytes Microinjection Assay
145
Inject+Matlc system or connecting a vacuum pump to the Eppendorf mlcromJectlon apparatus. Asplratlon 1scontrolled by keeping the meniscus within the visual range of the binocular. 11. Capillary cahbratlon: For proper estimation of the inJected amounts, use a homemade graduated lens carrying a grid divided into millimeters and l/10 mm. When the meniscus of the capillary 1s focused, the grid indicates the amount by direct comparison to the scale. Because the capillaries used have an Internal diameter of approx 0.7 mm, marks on the scale are equivalent to 38 nL of sample per l/10 mm. 12. Injections. With a defined pressure, inject and visualize the volume inJected followmg the length of the graduated scale. Modify pressure accordmgly to the desired volume. Usually only one calibration IS needed for each plpet
3.3. injection
Procedure
1. The oocytes are placed on a dish with the plastic grid glued to it Injections are controlled by a mlcromJector pump that provides the required pressure. There are different types of pumps, those that require pressurized tanks or those that do not. The pump must have a foot switch, m order to easily perform injections The pipets are controlled by a mlcromampulator that can be either verttcal or tilted at approx 45”. 2. Usually, cytoplasmlc mlcrolnJections are performed with volumes of less than 50 nL per oocyte (see Note 6) This amount accounts for one-tenth of the total cytoplasmlc volume, estimated m 500 nL for stage VI oocytes. Injections of more than 50 nL will be detrimental for the oocyte 3. Injections are achieved by hand pressure until the needle penetrates mto the oocyte by a fifth of Its diameter (see Note 7) A qmck movement of the hand, combined with the foot pedal, makes the injection effective at the same time that it carries the oocyte to a distant part of the dish, where it 1s released from the surface tension by completely pulling the plpet out of the buffer 4. Injections. Wtth a defined pressure, inject and visualize the volume injected following the length of the graduated scale. Modify pressure accordmgly to the desired volume. Usually only one calibration 1s needed for each plpet 5 Once mlcromJectlon has been completed, oocytes are transferred to a multiwell dish contammg fresh medium at a rate of 200 pL/oocyte. Results are analyzed at different times after injection, depending on the experlmental procedures.
3.4. Oocyte-Maturation
Assay (GVBD Assay)
1 Stage-VI oocytes are selected as previously described by manual dissection Series of 30-50 oocytes are treated for hormonal mductlon of GVBD with 1 pg/ mL progesterone or 50 p.g/mL msulm m Ringer’s buffer as controls GVBD 1s assessed followmg either 16 h mcubatlon at room temperature or at different times after inductlon if a time-course experiment 1s performed. First, visual evaluation 1saccomplished by the appearance of a white spot in the ammal pole Venfica-
146
Lacal
tlon of nuclear vesicle breakdown 1sperformed by splrtting the oocytes with a scalpel after treatment with 16% trichloracetic acid. Mature oocytes show no germinal vesicle, whereas Immature oocytes have a clear whitish vesicle still intact. 2 Maturation of oocytes microinjected with aqueous solutions contammg different substances under mvestlgatlon 1s followed m a similar manner usmg 25 nL per oocyte (see Note 9). Substances such as purified proteins (MPF, Mos, Ras, Rho, and so on), enzymes such as phosphohpases A2 (PLA2), PLC, or PLD; kmases such as Rafl, MEK, and MAPK, or different members of the PKC family, such as PKCC (see Note 8); different phophollpld-derived second messengers such as LPA, PA, DAG, fatty acids, and so on; or any other molecule under mvestlgatlon Each substance must be tested first m a dose-response experiment, because each one can show a different range of activities
3.5. MPF Assay As indicated in the Introduction, analysis of oocyte maturation can be performed by the actlvatlon of specific intracellular enzymes such as the Cdc2 kmase, one of the components of the maturation promotmg factor (MPF). There are several alternative protocols to assay the activation of cdc2 kinase. Here, I describe two of them: determination of the m vitro MPF activity in wholeoocyte extracts and determination of the m vitro MPF activity after preclpltation with ~13~“~ bound to Sepharose beads. In both cases, series of 20 oocytes are treated or microinJected with the compounds under investigation. At the desired times, whole oocytes are transferred to a mlcrocentrlfuge tube, and buffer is completely removed. Oocytes are then homogemzed using the tip of a I-mL Eppendorf dlsposable plpet and, after homogemzation, resuspended m a small volume of BLO buffer (see Subheading 2.4., item 1).
3.5.1. Whole Extract Protocol 1 Samples prepared as above are centrifuged at 13,000g for 15 mm to eliminate msoluble material, and supernatants are assayed for 10 mm at 30°C m a final reaction volume of 50 PL contammg 20 mA4 HEPES, pH 7 0, 5 mA4 P-mercaptoethanol, 10 mM MgCl,, 10 yM Y-~*P-ATP (2-5 dpm/fmol), 0.2 pg of PKA inhibitor, and 1 mg/mL of type III-S calf thymus hlstone (Sigma) as substrate 2. ReactIons are stopped by addition of PAGE-sample buffer and samples are kept on ice Boil samples for 2 mm and then resolve them by a 15% polyacrylamlde gel electrophoresls (PAGE). Dry the gel and expose for several hours at -70°C to a sensltlve autoradlographlc film To estimate the radioactlvlty incorporated mto the substrate (histone) each band can be excised from the gel and counted m scmtlllatlon liquid Alternatively, any other equivalent method for radloactlvlty estimation can be used
Oocytes Micromjection Assay
147
3.5.2. Precipitation Protocol ~13”“” 1s a protein that specrftcally binds to the cdc2-protein kmase. ~13~“~ is purified as follows: the E. colz line BL21.DE3 containing the pRK172,sucl+ (14) plasmid IS grown m LB-broth containing 100 pg/mL amprcrllm, and ~13~“” expression induced by 0 4 mM IPTG. The soluble fraction of a 400-mL bacterial culture lysed m buffer (50 mM Trrs-HCl, pH 8.0, 2 mM EDTA, 10% glycerol) is loaded on a 1.5 x 80 cm Sepharose CLGB column and eluted m a gradient of O-500 mM of NaCl in the buffer 50 mM Trrs-HCl, pH 8.0, 2 mM EDTA. Fractions of 2 mL are collected and analyzed by SDS-PAGE. ~13’“~ is lmked to sheparose CNBr-4B according to the manufacturer (Pharmacia). MPF assay is performed after precipitation using pl 3-Sepharose beads. After treatment with progesterone or microinlections, oocytes are lysed, resuspended m BLO buffer, and centrrfuged at 13,OOOg as indicated above. The resulting supernatants are incubated for 2 h under constant agrtation at 4°C with 50 FL of the pl3-Sepharose solution m a final volume of 1 mL. The p13Sephasore pellets are washed once with BLO and twice with 20 n-J4 HEPES pH 7.0, 5 mM P-mercaptoethanol, 10 mM MgC12. The kinase assays using the pl3-Sepharose precrpitates are performed and quantified as described m Subheading 3.51. for total extracts. This second protocol has the advantage in that it provides a more specrfic assay, owing to the specific bindmg of ~13”“” to the MPF-complex kmase Cdc2, with no effects on other kmases.
3.6. Analysis
of MAPK Activation
There are several assays to follow the actrvatron of MAPK. Most of these assays rely upon specific recognition of the MAPK by antibodies either raised against this kmase, or else capable of recognizmg P-Tyrosme residues. Alternatively, MAPK activity can be determined by an zn situ kmase assay or after partial purificatton. For Western-blot determmatrons, I have used either a polyclonal antibody raised m my laboratory against MAPK or a commercial anti-P-Tyr antibody, but many companies sell excellent antibodies against both MAPK and P-Tyr residues. Generation of the MAPK-polyclonal antibody was achieved by standard procedures using a peptrde correspondmg to the C-terminus of MAPK (KERLKELIFQETAR) conjugated to tyroglobulin by crosslmkmg with glutaraldehide. The conjugated peptrde was used to immumze rabbits, and the generated antiserum was analyzed by Western blot. The antiserum was found to recognize m whole-cell lysates only two bands (~44 and ~42) correspondmg to both rsoenzymes of the MAPK family. The specific protocols for the alternative assays for MAPK are described m Subheadings 3.6.L3.6.4.
148
Lacal
3.6.1. Assay for MA PK Based on Mobility Shifts 1. After treatment wtth hormones or mlcromjectlons, terminate mcubatlons by homogenization of the oocytes as described for the MPF assay. 2. To each sample, add 300 PL of ice-cold lys~s buffer 3. Nuclei and detergent-insoluble material are removed by centrlfugatlon at 10,OOOg for 10 mm The resulting supernatants are assayed for estimation of total cell protein (Blo-Rad), and equal amounts of cell lysate (typically 40 pg) are boiled at 95°C for 5 mm m SDS-PAGE sample buffer. 4. For Western-blot analysis, proteins are electrophoresed onto 10% SDS-PAGE gels poured m 20 x 20-cm glasses. Separated proteins are transferred to mtrocellulose and blots are blocked for 2 h m 2% nonfat dried milk m T-TBS. Blots are washed once m T-TBS and Incubated 4 h with a 1’ 1000 chlutlon of the polyclonal anti-MAPK antibody. Blots are washed three times for 10 mm m T-TBS, mcubated 1 h with 1: 1000 antirabbit Ig blotmylated (Amersham), washed three times for 10 mm with T-TBS, and incubated 30 mm with streptavldin-horseradish peroxidase (Amersham) I*1000 m T-TBS. After washing three times with T-TBS 10 mm, both MAPK enzymes are detected by the ECL system (Amersham). 5. The activations of MAP kmases m response to different stimuli are assessed by the mobility shift produced as a consequence of the hyperphosphorylatlon of these kmases
3.6.2. MAPK Assay Determmed by Tyrosine Phosphorylation 1. Follow the same protocol as described m steps l-3 m Subheading 3.6.1. Then proceed as indicated 2. Proteins are resolved onto 10% SDS-PAGE gels poured m 20 x 20-cm glasses Resolved proteins are transferred to mtrocellulose, and filters are blocked m buffer containing 25 mM Tns-HCl, pH 7 5, 0 05% Tween, 150 mM NaCl, and 5% BSA for 2 h at 50°C Phosphotyrosme-containing proteins are detected by incubating the blot for 2 h m the same buffer with 1:500 dilution of antlphosphotyrosme-specific antlbody (Upstate Biotechnology) followed by incubation for 1 h in the same buffer containing [125I] protem A (2 x lo5 dpm/ mL). Wash the filter three times with same buffer without radloactlvlty, and expose for several hours at -70°C to a sensltlve-autoradlographlc film 3. The actlvatlon of MAP kmases m response to different stIrnull 1sassessed by the appearance of specific bands showing the P-Tyr forms of these kinases
3.6.3. In Situ MAP-K/nase Assay For the in-gel kmase assay, samples are processed as indicated in steps l-3 m Subeading 3.6.1. Proteins are then resolved by PAGE as indicated in Subeading 3.6.1., step 4, but the polyacrylamide gel is polymerized along with 0.25 mg/mL MBP as substrate for the MAPK enzymes. After elec&ophoresls, the gel is denatured in 6 M guanidme-HCl and washed as described by
Oocytes Microinjection Assay
149
Kameshita and FuJisawa(15). The kinase activity is then assayedwith 50-150 pCi of [Y-~~P]-ATPand 10 lU4 ATP. Dry the gel and exposefor several hours at -70°C to a sensitive autoradiographic film. MAPK activation is determined by the appearance of phosphorylated bands to which each MAPK migrates. 3.6.4. MAPK Assay by Chromatography
on a Mono-Q Column
MAPK can also be determined by a more elaborate protocol, which includes a preliminary purification of the MAPK enzymes using a Mono-Q column step. For this, I use the followmg procedure: 1 After treatment or mrcromjectron, oocytes are lysed m 50 mM P-glycerophosphate pH 7.3, 1.5 mM EGTA, 1 rr1J4 D’IT, 400 pJ4 PMSF, 2 p~I4 leupeptm, 25 pg/mL aprotmin, 5 m&I NaPPi, and 1 mM NaF. 2. Extracts are centrifuged at 100,OOOgm a TLIOO centrifuge and filtered m 0.2~pm filters Samples of 2 mg of total protein are applied to a Mono-Q column that has been equthbrated m the same buffer without NaF. The columns are washed m the equilibrating buffer and proteins eluted with a linear gradient of NaCl (O-500 mil4) collecting fractions of 2 mL 3. Ahquots of 30 FL from each fraction are assayed for MAPK actrvtty usmg 0 25 mg/mL MBP as substrate m 50 mIt4 Tns-HCl, pH 7.4, 1 mM DTT, 10 mM MgCl,, 50 pM [Y-~*P]-ATP (3000 Cr/mmol), and 2.5 w PKA mhlbrtor m a final volume of 50 pM After 15 min at 30°C samples are spotted onto Watman p8 1 phosphocellulose paper filters, washed extensively wrth 1% ortophosphorrc acid, and once wtth 95% ethanol. The radioactrvtty retained on the filters is then quantified in a scmtrllatlon counter.
3.7. Assay for Activation
of Raf-I Kinase
Raf-1 kinase activation is assayed by its mobrhty shift on a PAGE essentially as described for the MAPK enzymes using specific antibodies to the Raf1kinase. I use a polyclonal antibody raised in rabbits against the Raf- 1 peptide CTLTTSPRLLPVF as described for the MAPK peptide. 1. After treatment with hormones or mtcromjections, termmate mcubatrons by homogemzatron of the oocytes as described above for the MPF assay. 2. To each sample, add 300 PL of ice-cold lysis buffer 3 Nuclei and detergent-msoluble material are removed by centrrfugatron at 10,OOOg for 10 mm. The resulting supernatants are assayed for estimation of total-cell protein (Bra-Rad), and equal amounts of cell lysate (typically 40 pg) are boiled at 95°C for 5 mm m SDS-PAGE sample buffer. 4. Proteins are resolved onto 8% SDS-PAGE gels poured m 20 x 20-cm glasses. Separated proteins are transferred to mtrocellulose and blots are blocked for 2 h m 2% nonfat dried milk m T-TBS. Blots are washed once m T-TBS and mcu-
750
Lacal
bated for 4 h with a 1 1000 dilution of the polyclonal an&-Raf-I kmase antibody Blots are washed three times for 10 mm m T-TBS, incubated for 1 h with 1: 1000 anti-rabbit Ig biotmylated (Amersham), washed three times for 10 mm with T-TBS, and incubated for 30 mm with streptavidm horseradish peroxidase (Amersham) l*lOOO m T-TBS After washing three times with T-TBS for 10 mm, Raf-1 kmase is detected by the ECL system (Amersham) 5. The activation of the Raf-1 kmase m response to different stirnull IS assessed by the mobihty shift produced as a consequence of its phosphorylation
3.8. SG-Kinase Assay Activation m whole
of the S6 KII
extracts
enzyme is achieved by analysis of the activity the specific peptlde AKRRRLSSLRA #17-136).
usmg as a substrate
(Upstate Biotechnology,
1 Series of 20 oocytes are homogenized as described for the MAPK assay and resuspended m a final volume of 20 l.tL of BLO buffer. 2 Extracts are centrifuged at 14,000g for 15 mm to eliminate msoluble materials 3. Ahquots of 30 pL of the resulting supernatants are assayed with S6 KII-substrate peptide (8). The reaction mixture, m a final volume of 50 FL, contams 250 pM rsk-substrate peptide (UBI), 50 mM glycerophosphate, pH 7.3, 7 nu’r4 NaF, 0.3 mM EDTA, 150 nA4 MgCl*, 2 mM DTT, 50 pM [Y-~~P]-ATP (3000 Ci/mmol, Amersham), and 7 l.nV PKA-inhibitor peptide (Sigma). 4. The assays are Incubated at 30°C for 20 mm and stopped with Ice-cold TCA to a final concentratton of 16% TCA 5. Samples are maintained for 1.5mm at 4°C and centrifuged at 14,000g for 15 mm. 6. The supernatants are spotted onto Whatman p8 1 phosphocellulose-paper filters, washed extensively with 1%-orthophosphoric acid, and once with 95% ethanol 7. The radioactivity retained on the filters is quantified in a scmtillation counter.
4. Notes 1 Both buffers recommended for handling oocytes can be supplemented with antlbiotics prior to use to avoid contammations (pemcillin 50 U/mL, streptomycm 50 pg/mL, amphotericm B 125 ng/mL), and fatty-acid-free BSA (1 mg/mL) to prevent the oocytes from sttckmg to each other. 2. If micromIectlon buffers are supplemented with BSA, it is critical that the BSA is free of fatty acids, because we have observed that some fatty acids have mitogemc activity m this system. Thus, use of BSA containing fatty acids will interfere with the assays
3 In order to obtam high-quality
oocytes, the ammals should be maintained under
appropriate conditions We have noted that noisy rooms should be avoided because this conditton ~111negatively affect the quality of the oocytes Also, use of the oocytes soon after arrival to destination should be avoided. A mmimum of 2 wk should be appropriate to reduce stress
Oocytes Microrqectron Assay
157
4 Treatment with hCG hormone should be used with care By affectmg the metabolic activity of the treated oocytes, hCG may alter the response to other stimuli, and therefore this fact must be taken into conslderatlon when mvestigatmg signaling pathways I do not use hCG for the type of experiments described m this chapter 5 Because collagenase may damage oocyles and may interfere with their maturation process If used a few hours after treatment, I usually do not use collagenasetreated oocytes If collagenase has to be used, I recommend using the oocytes after overnight recovery. 6. Usually, cytoplasmlc mlcrolnJectlons are performed with volumes of less than 50 nL per oocyte. This amount accounts for one-tenth of the total cytoplasmlc volume, estimated m 500 nL for a stage-VI oocyte. InJection of a large1 volume can damage the oocyte. 7. Erroneous consideration of GVBD owmg to the appearance of a white spot m the animal hemisphere can be generated. A white spot may also be a consequence of the damage mfrmged by inJections To avoid this problem, It IS best to mJect the oocytes m the interfaces 8. For best results, oncogemcally activated Ras protems are used with at least 10 ng of active protein injected per oocyte (26), PKC< 1s used with at least 30 pg of active enzyme per oocyte (27), phosphohpases are used with solutions contammg 1 U/mL of each enzyme (thus 25 plJ inJected per oocyte), and llpld metabohtes are used m doses of at least 100 ng mJected per oocyte (12). 9. Essentially, any substance can be tested for activity as a potential mltogen or cellcycle regulator m Xenopus laevls oocytes d the appropriate aqueous buffer can be used. All proteins and metabohtes tested m my laboratory have been performed using 20 mM MES, pH 7 0 as buffer. However, other buffers can be also successfully used If required for the stability of the protein or substance under mvestlgatlon
Acknowledgments This publication has been possible thanks to specific support from DGICYT (Grant
#PB94-0009)
and FIS (Grant #96/2136).
References 1 Maller, 3. L (1990) Xenopus oocytes and the biochemistry of cell dlvlslon chemutry 29,3 157-3 166 2 Norbury, C and Nurse, P (1992) Animal cell cycles and their control Annu Blochem
BloRev
61,441-470
3 Jacobs,T (1992) Control of the cell cycle Devl Bzol 153, l-15 4 Lacal, J C. and Carnero, A (1994) Regulation of Ras proteins and then mvolvement in signal transduction pathways Oncology Reports 1,611493. 5 Bauheu, E. E , Godeau, F , Schorderet, M., and Schorderet-Slatkme, S (1978) Steroid-mduced melotlc dlvlslon m Xenopus laevls oocytes surface and calcium Nature,
275,593-598
752
Lacal
6 Maller, J L and Koontz, J. W (198 1) A study of the mduction of cell divrsion m amphibian oocytes by msulm. Devl Bzol f&309-316. 7. Masui, Y. and Markert, C L (1971) Cytoplasmic control of nuclear behavior during meiotic maturation of frog oocytes J Exp Zoo1 177, 129-146 8 Smith, L D (1989) The mduction of oocyte maturation. transmembrane signalmg events and regulation of the cell cycle. Development 107, 685-699. 9 Sagata, N., Daar, I , Oskarsson, M., Schowalter, S. D , and Vande-Woude, G. F (1989) The product of the mos proto-oncogene as a candidate “mitiator” for oocyte maturation Science 245, 643-645 10. Btrchmeyer, C , Broek, D , and Wigler, M. (1985) Ras proteins can induce meiosis m Xenopus oocytes Cell. 43,615-620 11 Hollmger, T. G. and Alvarez, I M. (1982) Trifluoperazme-induced meiotic maturation m Xenopus laevis J Exp Zoo1 224,461-464 12. Carnero, A. and Lacal, J C (1993) Phospholipase-induced maturation of Xenopus laevrs oocytes. Mitogemc activity of generated metabolites. J Cell Blochem 52,440-448 13. Cicirelli, M. F and Smith, L D. (1987) Do calcmm and calmodulm trigger maturation m amphibian oocytes? Devl Bzol 121,48-57 14 Brizuela, L , Draetta, G , and Beach, D. (1987) p13s”cl acts m the ftsston yeast cell division cycle as a component of the p34cdc2 protein kmase EMBO J 6, 3507-35 14. 15 Kameshita, I. and FuJisawa, H. (1989) A sensitive method for detection of calmodulm-dependent protein kmase II activity m sodmm dodecyl sulfate polyacrylamide gel. Anal Bzochem 183, 139-143 16 Lacal, J. C (1990) Diacylglycerol production m Xenopus laevls oocytes after mmromJection of p2lras proteins is a consequence of activation of phosphatidylcholme metabolism. Mol Cell Bzol 10,333-340. 17 Carnero, A., Liyanage, M., Stabel, S., and Lacal, J. C. (1995) Evidence for different signallmg pathways of PKC!< and ras-p21 m Xenopus oocytes. Oncogene 11, 1541-1547
9 Mammalian Cell Microinjection the Function of Rat and Rho
Assay to Study
Anne J. Ridley 1. Introduction Mtcroinjection has been widely used as a technique to introduce proteins and DNA into mammalian cells. A major advantage of mrcroinjection over transfection approaches IS that tt is possible to analyze very early responses to proteins; responses to microinjected proteins can be detected within minutes, and expression of protein encoded by microinjected DNA can often be detected within 2 h. In addition, most cells, including primary cells, are microinjectable, whereas many cell types are not readily transfectable. Analysts of responses m microinjected cells 1s usually based on immunocytochemtcal approaches because, in general, it is not posstble to inject sufficient numbers of cells to carry out biochemical studies. In some cases, however, microinjection has been used to analyze changes m protein phosphorylation, for example, followmg injection of fibroblasts with cyclic adenosme monophosphate (CAMP)-dependent protein kmase (I). Microinjection of DNA also provides a rapid means of assessing the locahzation of proteins in cells, and by tagging a protein with an epnope, it is possible to follow tts localization independently of endogenous proteins (2,3). Microinjection approaches have been important m defining the early responses of cells to a number of small Ras-related GTP-binding proteins. Injection of recombinant Ras protem showed that rt stimulated DNA synthesis, morphological transformation, and membrane ruffling (4,5). More recently, mjectton studies have established the roles of three members of the Rho family of Ras-related proteins in regulatmg actm organization. Rho was shown to
From
Methods
m Molecular
Ed&d
by
B/ology,
D Bar-Sag1
Vol 84 Transmembrane 0 Humana
153
Press
Sgnalmg
Inc , Totowa,
NJ
Protocols
154
Ridley
regulate actin stress-fiber formation, whereas Rat regulates membrane ruffling and the formation of lamelhpodia, and Cdc42 regulates filopodmm formation (6-10). In addition, micromjection of Ras, Rat, and Rho proteins mto MDCKepithelial cells has shown that Ras and Rat are required for motility responses of these cells to scatter factor/hepatocyte growth factor (II). Mlcromjection of plasmids has also been used to analyze Rho and Rat function and mtracellular localization (2,3,8,12) Here, the method used to microinject recombinant Rho and Rat proteins mto Swiss-3T3 cells and MDCK cells is presented. The approach is very semilar when Injecting DNA, as has been described for Rho-encoding plasmids (12). The micromjection technique was untially described m detatl by Graessmann and Graessmann (13). Protein solution is loaded into glass pipets that have been pulled to a fme point of approx 0.5-l pm diameter at one end. A micromampulator is used to positron the point of the glass pipet very close to the cells to be injected. The other end of the pipet is attached via tubing to a pressure regulator. Air pressure applied to this end of the pipet forces the protem solution out of the pointed end of the pipet. The pipet is manipulated so that it transiently pierces the plasma membrane of a cell, allowmg the solution m the pipet to enter the cell. The pipet remains within the cell for only a very short period (co.5 s) and then is removed, allowing the membrane to reseal. The volume of solution mtroduced mto cells is 5-10% of then total volume, or approx lo-l4 L. In microinjection experiments with Rho and Rat, recombinant protein is injected into loo-150 cells, within 10 min. The cells are subsequently mcubated for varying lengths of time with or without addition of growth factors, then fixed, permeabilized, and stained to show injected cells together with either phalloidm to show actm filaments, or with various other reagents to detect, for example, focal adhesion proteins.
2. Materials 2.7. Cell Culture 1. Dulbecco’s modified Eagle’s medium (DMEM) containing 0.11 g/L Sodium pyruvate, 4 5 g/L glucose can be purchased from Grbco-BRL Anttblotics are stored m ahquots at -20°C, and added to a final concentratton of 100 U/mL pemctllm, 100 pg/mL streptomycm Medium IS stored at 4°C. 2. Fetal calf serum (FCS) is batch tested and selected from vartous sources (see Note 4) It is stored m 50-mL altquots at -20°C 3 PBS-A 137 mM NaCl, 2.7 m&Z KCl, 8.1 mM Na,P04, 1.47 mM KH2P04. 4 13-mm Diameter glass cover slips (Chance Propper, no lV2) are cleaned by washmg first with nitric acid, then extensively with dtstilled water, and finally with ethanol. They are then baked prior to use
Mcroinjectlon
of Rae and Rho
2.2. Injection
of Proteins
155
1. Rat IgG (1mmunoglobulln) (10 mg/mL) 1s stored at 4°C. It can be obtained from Pierce 2. Protein injection buffer: 10 mil4 Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgC& 3. The programmable pipet puller (Model no. 773) used 1s obtained from Campden Instruments. 4. Glass pipets are 1.2 mm bore, they can be obtained from Clark Electromstruments, Reading, UK 5 The mlcromjectlon station consists of an inverted phase-contrast microscope fitted with a heated stage and an enclosed Perspex chamber. The temperature and CO, concentration 1n the chamber are maintained by the temperature regulator TRZ3700 and CT1 controller 3700, obtained from Zeiss Humidity 1s provided by placing a Perspex dish containing sterile distilled water 1n the chamber Cells are injected using an Eppendorf m1crolnJector (Model no 5242) and mlcroman1pulator (Model no 5 170)
2.3. Fixing and Staining
Cells
1 Formaldehyde can be obtained from BDH as a 40% solution containing 9-l 1% methanol. It is toxic by inhalation; therefore, to minimize exposure, fixing cells are placed m a fume cupboard and formaldehyde 1s disposed of 1n the fume cupboard outlet. Dilute fresh 1 10 (v/v) 1n phosphate-buffered saline (PBS) 1mmed1ately before use. 2. PBS: PBS-A (see above) containing 0.9 mM CaC12 and 0.5 mM MgCl*. It can be obtained from Gibco as a 10X stock solution, and diluted with sterile distilled water. 3. A 0.2% Tr1ton X-loo/PBS. A stock solution of 10% Tr1ton X-100 is used. 4. TRITC (tetramethylrhodamme lsothiocyanate)-labeled phalloidln 1s toxic 1n high quantities, but not at the levels used here for staining cells Dissolve 1n sterile distilled water at a concentration of 50 pg/mL, and store in small allquots at -20°C 1n a light-sealed container. 5. FITC (fluorescem lsothlocyanate)-labeled goat antirat IgG can be obtained from Sigma. 6. Mountant: 0.1% p-phenylenedlamme (antiquench), 10% (w/v) Mowiol (obtained from Calblochem), 25% (w/v) glycerol, 100 mM Tns-HCl, pH 8 5 Mow101 1s stored at 4°C without p-phenylenediamlne, but once the p-phenylenedlamine 1s added, it 1s stored 1n 100~pL aliquots at -70°C Once thawed, these allquots can be kept wrapped 1n alurmnlum foil at -20°C for approx 1 wk; however the p-phenylenediamlne 1s light- and temperature-sensitive 7. 1.O- to 1.2-mm-thick glass slides can be obtained from Chance Propper
3. Methods 3.1. Preparation
of Cells for Microinjection
1. Grow Swiss-3T3 cells and MDCK cells 1n DMEM containing Note 4) 1n a humldlfed incubator at 37°C with 10% (v/v) CO2
10% FCS (see
156
Ridley
2. Passage SWISS-3T3 cells (see Note 3) and MDCK cells every 3-4 d by washing with PBS-A, then incubating for 2-3 m1n with 0 05% trypsln, 0.02% EDTA Swiss-3T3 cells are seeded 1n go-cm* flasks at a density of 3 x lo5 cells per flask. MDCK cells are seeded 1n 25cm* flasks at a density of 1-2 x lo5 cells per flask 3 Prepare cover slips by drawing a cross with a diamond-tipped marker pen This fac111tates locahzat1on of inJected cells Sterihze by dipping 1n 100% ethanol and flaming Place 1n 18-mm diameter wells 1n 4-well dishes 4. For m1crolnJectlon of SWISS-3T3 cells, seed at a density of 3 x lo4 per 18-mm well. At this density, Swiss-3T3 cells reach confluence 1n 3 d. After 5-7 d, remove medium and replace with DMEM (no FCS) for approx 16 h. Transfer each cover slip to a separate 35-mm dish containing 2 mL DMEM, using fine forceps and a 21-gage needle, bent at the end to facilitate lifting the cover slip 5. For m1cro1nJect1on of subconfluent MDCK cells, seed at a density of lo4 cells per well They are microinJected 3 d following seeding, when the majority of cells are 1n colonies of 16-80 cells. Alternatively, to analyze confluent cells, they are seeded at a greater density and inJected 4-5 d after seeding. Transfer each cover slip to 35-mm dishes containg 2 mL of DMEM/S% FCS approx 1 h before microinJection 6 Keep cells 1n an incubator close to the mlcro1nJector to minimize changes 1n temperature and medium pH during transfer to and from the m1crolnJector.
3.2. Injection
of Proteins
1 The methods for purifying recombinant proteins for mlcro1nject1on have been previously described 1n detail (8,14). Proteins are expressed as glutathioneS-transferase fusion proteins in Escherichza cob. In general, from a 1-L culture of E ~011, approx 100 pL of concentrated protein 1s obtained Proteins are stored 1n lo-yL allquots 1n liquid nitrogen, and the activity of each protein preparation 1s determined by GTP/GDP-binding assay after thawing an allquot (14) 2 Thaw protein ahquots on 1ce After thawing, the protein can be used for several days provided 1t 1s kept at 4°C It should not be refrozen, as this results 1n loss of activity 3 Turn on the temperature regulator and CO, controller at least 20 mm prior to beginning m1croinJectlon to allow the temperature to reach 37°C and CO2 levels to reach 10% 4 Pull pipets on a p1pet puller, according to the manufacturer’s instructions (see Note 5) P1pets can be stored by pressing the middle of each p1pet onto a strip of Blu-Tak adhesive, 1n a 150-mm diameter plastic dish with a lid. 5. Dilute rat IgG to 1 mg/mL 1n protein injection buffer Centrifuge the proteins, protein InJection buffer, and diluted rat IgG for 5 m1n at 4’C, 13,OOOg, to pellet small particles that will block up the m1croinJectlon p1pets M1x proteins, buffer, and rat IgG 1n sterile 600~FL mlcrofuge tubes to give the required concentrations of proteins and a final concentration of 0.5 mg/mL rat IgG Store proteins on 1ce until adding to the microinJection needle. Proteins are normally inJected at concentrations between 5 and 500 ,ug/mL.
Mcrottyection
of Rat and Rho
157
6. Take a dish containing cells on a cover slip from the Incubator. Gently press down the cover shp at the edge onto the dish with a yellow tip, to exclude au bubbles and prevent the cover shp from moving during mrcromjection. Place the dish on the microscope stage and locahze the etched cross using a lowpower objective. 7 Load approx 1 pL of protein or DNA solution into an Eppendorf mrcroloader tip; then load this mto a glass prpet. Care should be taken to ensure that bubbles are not present m the solutron m the prpet. 8. Insert the prpet mto the holder, then usmg the joystick, move it to the center of the cover slip, looking from above the stage (see Note 1). Subsequently, looking down the microscope, bring the prpet down so that it is nearly m focus above the cells. A bright spot, representing the meniscus, should appear first. On higher power, again bring the prpet to be nearly in focus but just above the surface of the cells. 9 Cells are normally inJected in manual mode (see Notes 1 and 2) using a x32/0.4 ObJective lens and x10/18 eyepreces Clear the pipet at high pressure (3000-6000 hPa) briefly (~5 s) before mjectmg cells at a workmg pressure of 100-1000 hPa (see Note 6) If the arm 1s to mject all cells m a given area, use the photoframe as a guide to work around all the cells m view Between 100 and 150 cells are normally injected over 10 min, then the dish 1s returned to the incubator 10. To determine the effects of InJected proteins on growth factor responses, add growth factors to the medium 15-30 mm after fnushmg mjections, and mrx gently
3.3. Fixing and Staining
Cells
For analysis of responses to proteins, fix cells at time points after mjectron ranging from 5 mm to 24 h (see Notes 7 and 10). At the appropriate trme point, wash the cells with PBS, then fix m 4% formaldehyde/PBS for at least 15 mm (see Note 9). Cells can be left u-r frxmg solutron for up to 2 h wrthout detrimental effects on the staining with phallordm Followmg ftxation, transfer cover slips to 18-mm diameter wells contammg PBS, then wash six times with PBS. An optional mcubatron step with 50 mM ammomum chlorrde m PBS (10 mm) can be included to quench residual formaldehyde. Permeabilrze for 5 mm wrth 0 2% Trrton X-100 m PBS, then wash two times wrth PBS To stain for inJected cells containing rat IgG and for actm filaments (see Note ll), incubate each cover shp wrth 200 yL of a 1,400 dilution of FITC-labeled goat antrrat IgG together with 0 1 pg/mL TRITC-phalloidm m PBS for 30-60 mm. Durmg this mcubatron, place dishes on a rocker at low speed When mcubating with TRITC-phallordm, keep the dishes m the dark by covering with aluminum for1 (see Note 8). To stam with primary antibodies (e g., to focal adhesion protems such as vmculm) m which antibody stocks are hmmng, remove cover slips from the wells usmg fine forceps and a 21-gage needle bent at the end. Immedtately invert onto a 15-pL drop of antrbody solutron on parafrlm. Place the parafrlm on top of a
dish m a sandwich box contammg a small amount of distilled water, to maintain humidity 6. Wash cover slips in multiwell dishes s1x times with PBS, and place on a rocker for a final wash 1n PBS for 5 m1n Mount cover slips on slides with Mow101 solution containing p-phenylenedlamlne as antiquench This mountant takes about 1 h to set permanently at room temperature Before this, cover slips cannot be viewed using oil-immersion objectives 7. Store slides at 4’C, 1n a light-tight slide container Cells are viewed and photographed on a conventional eplfluorescence microscope or on a confocal microscope. Locate the etched cross under phase-contrast microscopy at low power, and subsequently locate microinjected cells using epifluorescence. It 1s advisable to photograph cells within 1 wk of staining, as nonspecific background fluorescence increases gradually over time
4. Notes 1. Mlcrolnjectlon 1s a technique that requires demonstration by an experienced person. Companies that supply mlcroinjectlon equipment, such as Zeiss, often run training courses. Intensive workshops are also run occasionally by various organizations, for example, the European Molecular Biology Organlzatlon (EMBO) 2. Most mlcrolnjectlon setups allow the researcher to use either a semi-automatic or manual mode of injection Some setups are completely automatic Our expenence 1s that injecting on manual mode 1s by far the preferred mode. Although 1t takes more practice to learn the muscle coordmation, the user learns to inject each cell according to 1ts morphology and takeup of protein, and the survival rate 1s far better than on semi-automatic mode. For injections into confluent, serumstarved Swiss-3T3 cells, no other method 1s appropriate, as 1t 1s essential that as few cells as possible are killed If many cells are killed, the cells are no longer confluent. 3 Swiss-3T3 cells change 1n morphology during passaging m culture. They gradually lose their contact inhibition and grow to greater densities, preventing the accurate analysis of the actin cytoskeleton for which they have been favored Eventually, spontaneously transformed cells will multiply more rapidly and take over the culture It 1s important to monitor their growth very carefully. We routinely only passage the cells about 8-10 times following thawing 4. Batch testing of FCS. This 1s crucial for the successful maintenance of Swiss3T3 cells and MDCK cells. For Swiss-3T3 cells, some batches inhibit growth almost completely, whereas other stimulate very rapid prollferatlon To maintain the cells for up to 10 passages 1n culture, 1t 1s important to have a batch of FCS which 1s intermediate (1 e., does not support the most rapid proliferation), as this leads more rapidly to loss of contact inhibition and a more transformed phenotype. For MDCK cells, some batches of serum promote a more “scattered” phenotype, so that the analysis of scatter factor-induced scattering 1s not as tight.
Microqection
5.
6
7.
8.
9
10
11.
of Rat and Rho
159
We routinely test six batches of serum from various sources, every 15-18 mo, and select one from these The optimal program for pipet pullmg has to be determined by trial and error. With the Campden Instruments programmable pipet puller, each instrument behaves differently and must be mdividually programmed to obtam a certain shape of pipet. It is advisable to optimize the program with pipets contammg a solution of IgG, rather than buffer alone, as buffer flows more easily than protem. Difficulties m gettmg the protein to flow out of the pipet may have several causes: a. The protem or IgG may be contammated. The IgG should be ahquoted and stored at 4’C Ahquots of Rat and Rho proteins can be used for several days after thawmg, but no longer than 1 wk. b. The microfuge tube used to make up the final injection mix contams some dust/particulate matter. Often Just respmning the protem solutions and mixmg the components agam m a fresh tube can solve the problem. c. At high concentrations, it IS difficult to mJect protein or DNA For protein, difficulties occur at above approx 5 mg/mL; whereas for DNA, concentrations of 0.5 mg/mL and greater can be problematic During micromJection, the cells are exposed to a strong light source for lo-15 mm, and this has to be taken mto account when analyzing the effects of added drugs, for example tyrosme kmase mhibitors, on the responses to Rho/Rat proteins. Controls are performed where the effects of the drugs on growth factor responses are tested on the microinJection microscope with the light source on We have found that TRITC-phalloidm (obtained from Sigma) is hght-sensitive, so weak actin filament stammg can be owmg to excessive exposure to light. We only freeze-thaw ahquots a maximum of three times During mcubation of cover slips with TRITC-phalloidm, the dishes are wrapped in aluminmm foil. It is important to use PBS with Mg2+ and Ca2+ for fixmg and stammg because Ca2+ is required for many cell-cell and cell-extracellular matrix mteractions, and Mg2+ is required to maintam cytoskeletal organization Rho and Rat effects on the actm cytoskeleton can be detected within 5 mm of microinJectmg the protems The extent and timescale of the response will depend on the concentratton of protein mJected (8,9,12,15) The methods for stammg cells described here work for localization of actm filaments and inJected cells. Many variations exist for immunocytochemical stammg techniques, and when usmg other antibodies it is necessary to test different blockmg steps and different dilutions to obtain optimal results
References 1. Lamb, N J C , Fernandez, A , Conti, M A., Adelstein, R., Glass, D. B., Welch, W J., and Feramisco, J R (1988) Regulation of actin microfilament integrity m living nonmuscle cells by the CAMP-dependent protem kmase and the myosm hght chain kmase J. Cell Blol 106, 1955-197 1.
160
Ridley
2 Adamson, P , Paterson, H F , and Hall, A (1992) Intracellular locahzatton of the p21Thoproteins J Cell Bzol 119,617-627. 3. Paterson, H , Adamson, P., and Robertson, D. (1995) MicroinJection of epitopetagged Rho family cDNAs and analysis by immunolabelmg. Methods Enzymol 256, 162-173. 4. Feramisco, J R., Gross, M., Kamata, T , Rosenberg, M., and Sweet, R W (1984) MicrotnJection of the oncogene form of the human H-ras (t-24) protem results in rapid proliferation of qmescent cells. Cell 39, 109-l 17 5 Bar-Sagi, D and Feramisco, J R (1986) Induction of membrane ruffling and fluid-phase pmocytosis m quiescent fibroblasts by ras proteins Sczence 233, 1061-1068 6 Paterson, H. F , Self, A J , Garrett, M D , Just, I , Aktories, K., and Hall, A (1990) MicroinJection of recombinant p2 lrho induces rapid changes m cell morphology J CellBlol 111, 1001-1007. 7 Ridley, A. J and Hall, A (1992) The small GTP-bmdmg protein rho regulates the assembly of focal adhestons and actm stress fibers m response to growth factors Cell 70,389-399 8 Rtdley, A J , Paterson, H F , Johnston, C L , Diekmann, D , and Hall, A (1992) The small GTP-binding protein rat regulates growth factor-induced membrane ruffling. Cell 70,401-410 9. Nobes, C and Hall, A (1995) Rho, Rat, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actm stress fibres, lamelhpodta, and filopodia Cell 81,53-62 10. Kozma, R., Ahmed, S , Best, A., and Lim, L. (1995) The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actm microspikes and ftlopodta m Swiss 3T3 ftbroblasts Mel Cell Blol 15, 1942-1952 11. Ridley, A J , Comogho, P. M , and Hall, A (1995) Regulation of scatter factor/ hepatocyte growth factor responses by Ras, Rat and Rho proteins m MDCK cells Mel Cell Blol 15, 1110-l 122 12 Graessmann, M and Graessmann, A. (1983) MicroinJection of tissue culture cells Meth Enzymol 101,482-492. 13. Self, A J , Paterson, H F , and Hall, A. (1993) Different structural organization of Ras and Rho effector domains. Oncogene 8,655-661 14 Self, A J. and Hall, A. (1995) Puriftcatton of recombinant Rho/Rac/G25K from Escherlchza co11 Meth Enzymol256,3-10. 15. Ridley, A J (1995) MicroinJection of Rho and Rat into quiescent Swiss 3T3 cells. Meth Enzymol 256,3 13-320
Identification and Functional Reconstitution of Effector Proteins for the GTPases Rat and CDC42Hs Arie Abo 1. Introduction Rho-related GTPase proteins, Rat 1,2, Rho A, B, G, and CDC42Hs, constttute a distinct subfamily in the Ras super family of GTPases (I) During the last few years a large body of evidence has been accumulated that suggests that Rho-like proteins play a critical role in the organization of the actm cytoskeleton and are tmpltcated m cell growth and transformatton (2). Like other GTPases, Rho-family members cycle between the inactive guanosme drphosphate (GDP)-bound form and the active guanosine triphosphate (GTP)-bound form. By virtue of this molecular activity, these protems can act like molecular switches. The cycling between the “on” and “off” states IS regulated by GTPGDP exchange factors (GEFs) and GTPase-activating proteins (GAPS), respectively (3) (Fig. 1). Once a GTPase is activated, rt binds rapidly to an effector molecule that subsequently is activated to initiate a specific response. The diversity of cellular responses that are implicated by Rho GTPases suggests that each GTPase protein activates multiple-effector proteins. Thus, to delineate the signal transductions that are regulated by GTPases, it IS essential to identify the molecular targets for these GTPases. Thus far, several effecters were identified for each member of the family of Rho-like proteins. Rat effectors include the p21-activated kmases (PAK) (4,5), and the p67-phox of nicotrnamide adenine dinueleottde phosphate (reduced form) (NADPH) oxrdase (6). CDC42Hs effecters include PAK kinases and the Wiskott Aldrich Syndrome Protein (WASP) (7,8). Rho was recently shown to interact with several protein kinases related to protein kmase N (9,IO). From
Methods
m Molecular
E&ted
by
Biology,
D Bar-Sag1
Vol 84 Transmembrane 0 Humana
163
Press
S/gna$ng
Inc , Totowa,
NJ
Protocols
164
Abo Exchange
Factors
off Effecters
lntrenslc
GTPase
GAPS
Fig. 1. Cycling between the “on” and “off” states of Ras-like GTPases is regulated by GEFs and GAPS. GTP/GDP exchange factor catalyzes the exchange of GDP to GTP. The GTP “on” statebinds to an effector protein. Conversion to the inactive state ISregulated by mtrmslc-GTPase activity of the GTPase and by GAPS
In this chapter, I descrtbe a method for the identification of molecular targets for Rat and CDC42Hs. By the use of an overlay assay, it is possible to detect proteins that interact with CDC42Hs and Rat on a filter. The method is outlined m Fig. 2: punfled proteins or cell lysate are separated by SDS electrophoresis and subsequently transfered to a filter. After blocking the filter with a blockmg solution, a GTPase preloaded with radioactive GTP is used to probe the filter. Molecular targets can interact with the GTPase and are visualized as dark bands. In contrast, proteins that have an effect on the GTPase-hydrolysis GAPS are vtsualized as clear bands over the background. Because the GTPase acts as a switch, it is relatively simple to measure the effect of the GTPase on targets that contain a functional motif, such as a kinase domain, and to reconstitute the enzyme activity in vitro. Described here is how PAK and WASP were identified by overlay methodology and the kmase activity of PAK was reconstituted with CDC42Hs. In addition, based on a consensus sequence found on PAK-related proteins, we designed a database search
to identify other Rat- and CDC42Hs-effector protems. 2. Materials 2.1. Overlay Assay 1 Stock solutions of 5 M NaCl, 2 M Tns-HCl, pH 7 5, 1 M EDTA, and 10% Trlton X-100, can all be stored up to 1 yr at 4’C The followmg should be stored at
Rho-Related
GTPase Proteins Lyrste
165 or Purified SDS PAGE
Western
Blocking
1 1
Blot
and
Probe
Renaturstion
S-B
1
IUash and Expose
Effector-
GAP
Fractions
min
to a Film
~GAPs
W
Fig. 2. Schematic representation of the overlay assay for GTPases. Cell lysate or purified proteins are separated on SDS-PAGE and transblotted to a PVDF membrane. The filter is probed with a recombinant GTPase preloaded with [y3*P]GTP and exposed to a film. As indicated, effector proteins are visualized as dark bands, and GAPS as clear bands. -20°C as 500-pL frozen aliquots: 1 M dithiothreitol (DTT), 100 mM GTP, and 100 mM GDP. 2. Blocking buffer: Dulbeco’s phosphate buffered saline (PBS) without calcium chloride contains 1% bovine serum albumin (BSA), 0.5 mM MgC12, 0.1% Triton X-100, 5 rmI4 DTT. The PBS solution containing MgCl,, and Triton X-100 can be stored at 4’C for up to 2 mo. Prior to use, fresh DTT and BSA should be added to the buffer. 3. GTPase-binding buffer: 25 mM 2-(N-morpholino)ethanesulfonic) (MES), pH 6.5,50 mM NaCl, 5 mit4 MgC12, 0.5 n&f GTP, and 5 m&I DTT. The basic MES buffer without GTP and DTT can be stored at 4°C for up to 2 mo; however, fresh GTP and DTT need to be added to the buffer before each use.
166
Abo
4. GTP-GDP exchange buffer 20 mM Tris-HCL, EDTA. Store at 4°C
pH 7.5,50 mM NaCl, and 10 mM
5. Washing Buffer 25 mM buffer MES, pH 6 5, 5 mM MgCl,, and 0 05% Trlton X-100 Store at 4°C 6 Lysls Buffer. 50 n-J4 Tns-HCl, pH 7 5, 150 mM NaCl, 5 mM MgCl,, 200 pM GDP, and the followmg protease inhibitors at 10 pg/mL (Boehrmger Mannhelm) Pefabloc, Leuopeptm, and aprotmm Fresh GDP and the protease mhlbltors are added to the buffer before use. 7. Coomassle blue stain. 50% Methanol, 10% acetic acid, 0.2% (w/w) Coomassle blue R. 8. Destain: 50% Methanol and 10% acetic acid 9. Sample buffer 1 M Tns-HCl, pH 6 8, 20% glycerol, 20% SDS, 20% P-mercaptoethanol, and 0.0 1% bromophenol blue 10. [y32P]GTP (10 mCl/mL, 6000 Cl/mmol, ICN)
11 [/332P]GDP (10 mCl/mL,
6000 Wmmol,
ICN)
12 Polyvmyhdene dlfluorlde (PVDF) membrane (Schlelcher and Schuell) 13 Protein G Sepharose Semidry Western-blotter apparatus (Pharmacla).
2.2. PAK-Kinase
Assay
1 Stock solutions of 1 M MnCI,, 5 M MgC12, 2 M Tns-HCI,
pH 7 5, and 100 mM
ATP should be stored m 200~FL aliquots at -20°C 2. Kmase buffer* 50 mM Tns-HCl,
pH 7.5, 100 mM NaCl, 10 mM MgCl,,
1 mM
MnC12 can be stored at 4°C up to 2 mo. 3 Kmase mmatlon buffer. 50 PM ATP and 5 pCl [Y~~P]ATP are added freshly to the kinase buffer
4 Mylme basic protein (Sigma, MBP). 5 [Y~~P]ATP (10 mCl/mL, 3000 Ci/mmol,
ICN).
6 37°C incubator 7. P32 shield
3. Methods 3.1. Identification of GTPase Effector Proteins by an Overlay Assay 3.1.1. Preparatron of Recombinant GTPases A large amount of recombinant protein can be prepared m E Co11 using the pGex expression vector or as a tagged protein in Sf9 cells as previously described m detail (5,12). The GTPase bound to a radlolabeled GTP serves as a probe in this assay. Thus, the quality of the GTPase will affect the sensltlvlty quite significantly. The concentration of the purified proteins 1s determined by the Bradford method, the proteins are concentrated to 500 pg/mL, and are stored at -7OOC.
Rho-Related
GTPase Proteins
167
KDa
St.91011121314151617191920
Fraction
Number
Fig. 3. Detection of effector proteins for CDC42Hs by the overlay assay. Neutrophi1 cytosol was applied on a Mono Q column (10 mL, 10 mg/mL) and was eluted with a 30-mL NaCl gradient (O-O.5 M). Collected fractions were anlayzed by the overlay assay and probed with CDC~~HS-[~~~P]GTP.
3.1.2. [f2]P GTP Loading l-5 pg (50 pL) of pure GTPase are incubated at room temperature for 15 min in 100-200 pL of GDP/GTP exchange buffer containing 2-l 0 pL of [y3*P] GTP corresponding to 20 pmol of GTP. The exchange reaction is stopped by adding 15 mM MgCl,, or 5 n&J excess of MgCl, over the EDTA. The protein is placed on ice and should be used within 1 h. To determine the specific activity, take 2 pL of the loaded protein, dilute it in 1 mL of cold-wash buffer and immediately filter through a prewetted filter. Wash with 5 mL of cold-wash buffer. The filter is allowed to dry and is immersed in 5 mL scintillation fluid, and the radioactivity is counted by a scintillation counter. The specific activity is determined by calculating the amount of radioactive [r3”P]GTP bound (retained on the filter)/to the amount of applied protein (mole/mole). To ensure reproducibility, it is recommended to determine the specific activity of the GTPase for every new batch of pure protein. Acceptable probes should give values of -0.2-l mol [y32P]GTP/mol GTPase (see ref. 12). 3.1.3. Probing the Filter Putative effecters for GTPase either in all lysate, partially purified, or purified proteins are solubilized in sample buffer and are applied to an sodium dodecyl phosphate-polyacrylamide gel electrophoresis (SDS-PAGE). It is important to apply a maximum amount of proteins/lane to ensure detection of effecters that are not abundant (Fig. 3).
168
Abo
1, Cell lysate IS prepared in lys~s buffer contammg protease mhlbltors Undissolved cell debris are removed by 10 mm centrlfugatlon at maximal speed using an Eppendorf centrifuge at 4°C. The protein concentration should be between 5-10 mg/mL. 2. 10 FL of 5X sample buffer IS added to 40 pL of cell lysate, mixed vigorously, and boiled for 5 mm 3. 20-50 FL of sample (50-150 yg lysate protein, l-4 pg pure-effector protein) are loaded on a 14% SDS PAGE and samples are separated on a mmigel. 4 The gel 1s transblotted for 1 h onto a PVDF membrane using a semidry blotter. 5 The PVDF membrane 1s stained with Coomassie blue stain for 4 mm and immediately destained. 6 The membrane IS washed three times with 10 mL of TBS for 5 mm and incubated with blocking buffer for 30-60 mm containing fresh DTT During these procedures, the filter IS placed on a container that IS shaken gently to allow contmuous mixing with the buffer 7 The blocking buffer IS discarded and 10 mL of GTPase-bmdmg buffer contammg 500 w GTP, and 5 mM DTT are added to the filter 8. The preloaded GTPase with radlolabeled GTP IS added to the mixture and the filter 1sincubated with the probe for 5-8 mm 9. The filter 1swashed with washmg buffer for 5 mm with a total of three changes of washing buffer 10. The filter IS placed between plastic (Saran) wrap, exposed to a film for 2 h, and kept at -70°C. (see Note 1).
3.2. Identification
of GTPase Effector Proteins By Database Search
Recently, several protems related to PAK65 were shown to interact with CDC42Hs and Rat, including several PAK isoform and PAK-related kmases in yeast STE20 and CLA4 (14,lS). The binding region of Rac/CDC42Hs was mapped to 75 amino acids in the PAK-regulatory domain (4). By comparing the putatltve GTPase-bmding domain (GBD) of PAK-related proteins, we developed a consensus of 14 amino acids as shown in Fig. 4. The derived consensus sequence PXXXHXXHVGXXXXG IS used as a query to search the database. To identify putatitve effecters for Rac/CDC42Hs, we used BLASTP and TBLASTN programs to search the nonredundant-sequence database and the expressed sequence-tag database. As shown m Fig. 4, in addition to PAK-related kmases, we identified in the database three other sequences that contain the GBD, including WASP and two other prolme-rich proteins. To identify novel effecters for Rac/CDC42Hs, it is advisable to search various databases routinely. Smart database searches can save the process of lsolatlon and purification of a putative-effector protein. A sequence identified in the database as containing the GBD can rapidly be cloned by simple PCR methodology.
Rho-Related
DRODPR? -1 HRA65? CELCO9UB-I f'N03 .CAEEL CFLF09F7 1 IliAS I'
G TPase Proteins
QTPase Blndinu Domain EI8PPSDFEHTIHVQFDTVTQ EISPPSDFEHTIBVQFDAVTQ EISPPSDFEBTIBVQFDAVTQ EISLPSDPEHTIRVQFDAVTQ EISLPSDFEETIIIVQFDACTQ EISLPSDFEHTIEVQFDAVTQ ISTPYNAKRIHHVQVDSKTG ISSPFDPKBVTBVQFNYDTQ VSSPTNFTEKVHVQFDPETQ NDFKBTGRVGIDGAT VSSPTNFTHKVRVQFDPKVG ISRPSNFEHTIHVQYDPKTQ ISLPRNFTEIAHVOWNGAS ISLPSDFRBLAHVQ DIGAPSGFKHVSBVQWDPQNQ
IS
PSDF
H
HVGFD
169 ~21 activated n' i,'i\, human ~21 activated k,'ixs, , human lsoform of hPAK65 ~21 activated k.ri
%sSte20 related n,r>,z, Ste20 related i-i 1< E' D menogaster 'Iyrosu~e xt \
TG
Fig 4 The putative GTPase bmdmg domain (GBD) 1sconserved m several proteins 3.3. Functional
Reconstitution
of GTPase Effecters
By the use of overlay methodology, we identified two protems that directly interact with the activated form of CDC42Hs. Both proteins, PAK65 (~65) (5) and WASP (~62) (Fig. 3) (8), contam a sequence motif that suggests a distinct brochemtcal
functron:
PAK
contains
a serme/threonme
kinase domain
and
WASP contains two novel domains, WHl/WH2, that are conserved among several prolme-rich proteins tmpltcated in actm polymerrzatton. Using the structural information of the identified effecters, we have designed an m vitro assay to study the role of the GTPase on the putative-biochemrcal function of
PAK and WASP. We have recently shown that actm polymenzation induced by WASP is regulated by CDC42Hs m various cells (8). We are currently developing a cell-free assayfor actm polymenzatron that is WASP- and CDC42Hs-dependent. To study the effect of the GTPases on PAK actrvatron, we have developed the following kinase assay. 1. Recombmant PAK65 IS prepared m Sf9 cells as described m detail (5) l-2 pg of purrfred recombinant PAK65, bound to 50 PL of protein G-Sepharose, conjugated with monoclonal myc anttbody, IS washed once with 1 mL of kmase buffer 2 The washed beads are resuspended m 40 FL kmase To test the phosphorylatton of exogenous substrate, 5 PL of MBP (5 pg) are added to each tube. 3 l-2 pg (5 pL) of recombinant GTPase prevtously loaded wrth GTP or GDP IS added to each tube. 4 The reaction mixture 1sready to be tested by adding 10 FL of kmase buffer containing 50 pJ4 ATP and 5 pCt [yszP] ATP 5. The mixture IS incubated for 20-30 min at 30°C
170
Abo
.E 6 2
Rho
--
Racl
cDc42
Fig. 5. Activation of hPAK65 autophosphorylation by Rho-like GTPases. Recombinant hPAK65 was incubated with the indicated GTPase preloaded with GTP or GDP. The reaction mixture was incubated with [y3*P]ATP for 30 min at 30°C. Phosphorylated proteins were analyzed by SDS-PAGE followed by autoradiograph. 6. 7. 8. 9.
The reaction is stopped by adding 10 pL of 5X sample buffer and boiled for 5 min. Samples are applied to a 14% SDS-PAGE and are transferred to a PVDF filter. The filter is stained for 4 min with Coomassie blue and destained for 5 min. The filter is placed between plastic wrap and is exposed to a film for 2-16 h and kept in -70°C (Fig. 5) (see Note 2). 10. The phosphorylated band is excised and the incorporated labeled phosphate is counted in 1 mL scintillation fluid (Fig. 6).
4. Notes 1. It is important to be able to predict the exposure time. Several exposures are possible, however, a diffused signal is detected after multiple exposures. As demonstrated in Fig. 2, two types of interactions are detected by this assay. Proteins that bind the GTPase and activate the GTPase hydrolysis catalyze the release of y3*P from the GTP bound to the probe. The loss of radiolabeled 32P from the GTPase probe can be visualized as a clear band over a dark background. In addition, dark bands are also detected and represent effector or GAP-inhibitors proteins (13). By monitoring the probing condition (i.e., pH, salt and detergent concentrations, and incubation time), it is possible to detect a different set of proteins. However, specificity should be determined whenever novel proteins are detected. Thus, the filter should be incubated with various GTPases preloaded with either [r3*P]GTP or [P3*P]GDP. In general, a better signal is obtained on partially purified cell lysate then on total-cell lysate. As shown in Fig. 3, when neutrophil cytosol was fractionated on a Mono Q column, and the filter was probed with
Rho-RelatedGTfase CDC42
GTP
COC42
GDP
racl
GTP
racl
60P 0
Proterns
2oooo
4oam
60000
aocum
CPM
Fig. 6 Acttvation of hPAK65 activity. Exogenous-substrate MBP was mcluded m the hPAK65 kmase-reaction Proteins were separated on an SDS-PAGE Phosphorylated MBP was excised and the radioactrvny was counted. CDC42Hs-[y3*P]GTP, three distmct bands (~62, ~65, ~68) were detected In contrast, under the same conditions, one diffused band is visualized m totalneutrophrl cytosol When attempting to identify novel proteins that interact with a specific GTPase, it is highly recommended to probe cell lysate obtained from different tissues For example we have recently tdenttfred the p62 protem WASP as a novel effector for CDC42Hs m neutrophil(81. WASP expression is restricted to the hematopetic cells. 2 The mduction of PAK autophosphorylation is quite strong and could be detected simply by mobilny shift; under optimal conditions, all of the PAK protem migrate slower and can be easily detected by Coomasste blue stammg. The conventional kinase assay 1s analyzed on a dry gel. The staining, destaining, and gel drying can take several hours. A rapid way to analyze the phosphorylation is on a PVDF filter The filter can be stained and destamed mstantly and IS ready to be exposed to a film
References 1 Nobes, C and Hall, A (1994) Regulation and function of the Rho-subfamily of small GTPases. Cur? Open Genet Dev 4,77-81 2 Chant, J. and Stowers, L (1995) GTPase cascades choreographmg cellular behavior: movement, morphogenests, and more Cell 81, 1-4. 3 Boguski, M S and McCormick, F. (1993) Proteins regulating Ras and its relatives. Nature 366,643-654. 4 Manser, E., Leung, T., Sahhuddm, H , Zhao, Z., and Lim, L (1994) A brain serme/ threonme protein kmase activated by cdc42 and racl . Nature 367,40-46. 5 Martin, G. A , Bollag, G , McCormtck, F , and Abo, A. (1995) A novel serme kmase activated by Rat l/Cdc42Hs-dependent autophosphorylation is related
172
6.
7
8
9.
10
11.
12.
13.
14.
15
Abo
to PAK65 and STE20. EMBO J 14, 1970-1978 (see Corrigenda, EMBO J 14,4385). Dlekmann, D., Abo A., Johnston, C., Segal, A W., and Hall, A. (1994) Interaction of Rat with p67-phox and regulatron of phagocyttc NADPH oxtdase activity Science 265,53 1-533. Aspenstrom, P , Lmdberg, LJ , and Hall, A (1996) Two GTPases, Cdc42 and Rat, bmd directly to a[protem tmphcated m the tmmunodefrctency disorder WtskottAldrich syndrome, Curr Biol. 6,70-75 Symons, M., Derry, M J D., Karlak, B., Jtang, S., Lemahleu, V , McCormtck, F , Francke, U , and Abo, A (1996) Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, 1s tmphcated m actin polymertzation Cell 84,723-734. Watanabe, G , Satto, Y , Madame, P., Ishtzakr, T., FuJlsawa, K., Morn, N., Mukar, H., Ono, Y , Kaktzuka, A , and Narumtya, S. (1996) Protein kmase N (PKN) and PKN-related protein rhophdm as targets of small GTPase Rho. Sczence 271, 645-648. Amano, M , Mukat, H , Ono, Y , Chihara, K , Matsut, T , HamaJima, Y., Okawa, K , Iwamatsu, A , and Kalbrchr, K (1996) Identtftcatton of putative target for rho as the serme-threonme kmase protein kmase N Science 271, 648-650 Manser, E , Leung, T., and Llm, L (1995) Identtficatton of GTPase-acttvatmg proteins by mtrocellulose overlay assay, m Methods uz Enzymology Small GTPases and theu regulators (Balch, W E, et al , eds ), Academic, San Diego, CA, pp. 215-227 Self, A J and Hall, A (1995) Purtftcatton of recombmant Rho/Rac/G25K from Escherichia cob, in Methods in Enzymology* Small GTPases and their regulators (Balch, W E , et al , eds ), Academic, San Diego, CA, pp 3-10. Manser, E., Leung, T , Monfrtes, C., Teo, M , Hall, C., and Ltm, L. (1992) Diversity and versatility of GTPase activating proteins for the p2lrho subfamily of ras G proteins detected by a novel overlay assay J Blol Chem 267, 16,025-16,028. Cvrckova, F., Virgillo, C D , Manser, E., Prmgle, J R., and Nasmyth, K (1995) Ste20-like protein kmases are required for normal locahzatron of cell growth and for cytokmesrs m budding yeast. Genes Dev 9, 1817-l 830. Ramer, S W and Davis, A (1993) A dominant truncation allele identifies a gene, STE20, that encodes a putative protein kmase necessary for mating in Saccharomyces cerevlslae. Proc Nat1 Acad Scl USA 90,452-456
11 Cell-Free Assay System for Ras- and Rap1 -Dependent Activation of MAP-Kinase Cascade Kazuya Shimizu, Toshihisa
Ohtsuka, and Yoshimi Takai
1. Introduction It IS well-established that Ras activates the mitogen-activated protein (MAP) kmase cascade consistmg of MAP kinase, extracellular signal-regulated kmase (ERK), ERK kmase (MEK), and MEK kmase m mammals (for reviews, see refs. 1-4). MAP kmase is phosphorylated at both serme/threonme and tyrosine residues by MEK and this phosphorylation causes the MAP-kinase activation (1-3). MEK is also phosphorylated at serine/threonme residues by MEK kmase, and this phosphorylation causes the MEK activation (S-7). Many MEK kinases have been identified: these include c-Raf-I (8-IO), B-Raf (11~15), Mos (16,17), and mStel1 (11,18). There are several lmes of evidence that Ras is an upstream regulator of c-Raf- 1: 1 The antisense c-Raf-1
RNA and dominant negative c-Raf-1 mhrbtt the Rasinduced DNA synthesis and growth (19); 2. Ras genetically posmons upstream of c-Raf-1 m Drosophzla (20) and Caenorhabdltls elegans (21); 3 Dominant negattve c-Raf-1 mhtbtts the Ras-induced MAP kmase actrvatton m
intact cells (221, and 4. GTP-Ras directly interacts with c-Raf-1 (23-28)
Similarly, regulator
there are also several lines of evidence
that Ras is an upstream
of B-Raf:
1. GTP-Ras directly interacts with B-Raf (13,14), 2. MAP kmase IS activated by B-Raf, but not by c-Raf-1, response to NGF (13); From
Methods
m Molecular
Bology,
Vol
84
Edited by D Bar-Sag1 0 Humana
173
Transmembrane
in intact PC12 cells m
Slgnabng
Press Inc , Totowa,
NJ
Protocols
174
Shimizu, Ohtsuka, and Takai
3. The assoctatton of MEK with tmmobthzed Ras is dependent on B-Raf, but not on c-Raf- 1, m rat brain (14); and 4. The MEK-acttvatmg acttvny IS accompanied with B-Raf, but not with c-Raf-1, m bovine bram or chromaffm cells (15) However, it has not been shown that GTP-Ras directly activates these MEK kinases in a cell-free assay system usmg the purrfred samples of Ras and MEK kmases. To identify the direct-target molecule of Ras, we have developed a cell-free assay system in which GTP-Ras activates the MAP-kmase cascade using the cytosol of Xenopus oocytes and eggs, and rdentifted Ras-dependent ERKKinase Sttmulator (REKS) as a Ras-dependent MEK kmase (29,3/I). Moreover, we have found that GTP-Ras directly interacts with B-Raf and activates tt tn a ceil-free assay system using the cytosol of bovme brain (31), and that
GTP-Rap1 , a small GTP-binding protein having the same amino acid sequence at its putative-effector domain as that of Ras (3%34), also actrvates B-Raf m the cell-free assay system (35). Because we descrrbed the method for the cell-free assay system using the cytosol of Xenopus oocytes and eggs (36), this chapter describes the procedures for the purrfrcatron of B-Raf from the cytosol of bovine brain and its characterlzatron by use of the cell-free assay system m which GTP-Ras activates MEK
2. Materials 1 EGTA and dtthtothrettol (DTT) (Nacalai Tesque, Kyoto, Japan) 2. Leupeptm, aprotmm, pepstatm A, and myelm basic protein (MBP) (Sigma, St. LOUIS, MO) 3. (p-Amzdlnophenyljmethanesulfonyl fluoride (APMSF), glutathtone (reduced form) (GSH), and isopropyl-P-o(-)-thiogalactopyranoside (IPTG) (Wako Pure Chemicals, Osaka, Japan). 4 4-(2-Hydroxyethyl)-1-ptperazme ethanesulfomc acid (HEPES), 3-[(3-cholamldopropyl)dtmethylammon~o]1-propanesulfontc actd (CHAPS), and EDTA (DoJmdo Laboratories, Kumamoto, Japan). 5. Adenosme triphosphate (ATP), GDP, and guanosine 5’-(30thto)trtphosphate (GTPyS) (Boehrmger Mannhetm, Indianapolls, IN). 6. [3sS]GTPyS (Du Pont-New England Nuclear, Boston, MA) 7. [y-32P]ATP (Amersham, Buckmghamshtre, UK) 8 FPLC system and Mono S HRlO/lO column (Pharmacia P-L Btochemtcals, Mtlwaukee, WI) 9 A GST-expression vector, pGEX-2T, and glutathtone Sepharose 4B (Pharmacta P-L Btochemtcals). 10. Lipid-modtfted and -unmodtfted forms of Kt-Ras, Ha-Ras, and RaplB (see Note 1)
Activation of MAP- Kinase Cascade
175
11 pGEX-2T-ERK2 and pGEX-2T-MEK (see Note 2). 12 Nltrocellulose filter BA-85 (Schlelcher and Schuell, Bassel, Germany). 13. Prefllter of 2 O-pm pore size (Mlllex AP20 prefllter, M&pore Corporation, Bedford, MA). Prefllters of 0.8-, 0 45, and 0 2-pm pore sizes (Mmlsart, Sartorms AG, Gottmgen, Germany). 14. Phosphocellulose sheet P8 1 (Whatman International, Maidstone, UK) 15. The buffers used m the preparation of GST-ERK2 and GST-MEK, a. Buffer A 20 mM Tris-HCl, pH 8.0,6 mM EGTA, 10 mM MgCl,, 1 mM DTT, 10 pfV APMSF, 10 pg/mL leupeptm, and 10 yg/mL aprotmm. b. Buffer B* 20 mM Tns-HCl, pH 8 0,lO mM EGTA, 5 mk! MgCl,, 1 mM DTT, 10 @4 APMSF, 10 yg/mL leupeptm, and 10 pg/mL aprotinm 16. The buffers used m the purlficatlon of B-Raf. a Buffer C. 20 mk! Tns-HCl, pH 7.9, 2 mk! EDTA, 5 @4 APMSF, 1 pg/mL leupeptm, and 1 bg/mL pepstatm A. b. Buffer D: 200 mM Tns-HCl, pH 8.0, 100 mM EGTA, 50 mM MgCl*, and 10 mM DTT. c. Buffer E: 20 mM HEPES/NaOH, pH 7.0, 10 mM EGTA, 5 mM MgCl*, 1 mM DTT, and 10 kfV APMSF All other chemicals are of reagent grade
3. Methods 3.1. Preparation
of GTPyS-Ras and -RaplB
1 The GTPyS-bound form of lipid-modified or -unmodified Kl-Ras is made by incubating Ki-Ras with 100 pM GTP@ at 30°C for 20 mm m a 75-pL mixture containing 20 mk! Tris-HCl at pH 7 5, 10 mM EDTA, 5 mM MgCl*, 1 mk! DTT, and 0 4% CHAPS 2. After the mcubatlon, 1 4 pL of 1 M MgCl* are added to give a final concentration of 23.1 mM and the reaction mixture 1s chilled on ice m order to prevent the dlssoclatlon of GTP@ from Ki-Ras (see Note 3). 3 To measure the GTPyS-bmdmg activity, [35S]GTPyS is used under the same conditions 4. The [35S]GTPyS-bmdmg activity is assayed by measuring the radloactlvlty of [35S]GTPyS bound to Kl-Ras trapped on a mtrocellulose filter BA-85 5. A 5-yL allquot of [35S]GTPyS-K1-Ras is filtered with 2 mL of an ice-cold stopping solution contammg 20 mM Tris-HCl at pH 7 5, 25 mM MgCl,, and 100 mM NaCl. 6 The filter 1s washed five times with the same ice-cold stoppmg solution 7 After filtration, the radloactlvlty 1s counted. 8 GTPyS-Ha-Ras and GTPyS-Rap1 B are prepared under the same conditions
3.2. Preparation
of GST-ERK2
1. An E. co/z strain, JM109, transformed with pGEX-2T-ERK2 of 0.2 at 37°C m 4 L of LB medium
1s grown to an OD,,,,
176
Shimizu, Ohtsuka, and Takal
2 After a 3-h incubation m the presence of 0 1 mM IPTG, bacteria are collected and suspended m 20 mL of buffer A with 0.25 M sucrose and somcated for 30 s four times 3 The supernatant 1s obtained by centrlfugatlon at 100,000 g for 1 h. 4 After centrtfugatton, the supernatant 1s loaded onto a glutathtone Sepharose 4B (2 mL) column equilibrated with 20 mL of buffer A 5 After washing the column with 20 mL of buffer A, GST-ERK2 1s eluted with 10 mL of buffer A with 5 mM GSH, adjusted to pH 8 0 with 1.5 M Trls-HCl 6. Purified GST-ERK2 1s dialyzed against buffer A (see Note 4).
3.3. Preparation
of GST-MEK
1 An E toll strain, DHSa, transformed with pGEX-2T-MEK 1s grown to an OD,,, of 0.5 at 37°C m 4 L of LB medium. 2 After a 4-h incubation m the presence of 0.1 mM IPTG, bacteria are collected and suspended m 20 mL of buffer B with 0 25 M sucrose and somcated for 30 s four times. 3 The supernatant IS obtained by centrlfugatlon at 100,OOOg for 1 h 4. After centnfugatlon, the supernatant 1s loaded onto a glutathlone Sepharose 4B (2 mL) column equilibrated with 20 mL of buffer B 5 After washing the column with 20 mL of buffer B, GST-MEK is eluted with 10 mL of buffer B with 5 mM GSH, adjusted to pH 8 0 with 1.5 M Trls-HCl (see Note 5)
3.4. Partial Purification
of B-Raf from the Cytosol of Bovine Brain
1 Bovine brams are obtamed from the heads of freshly slaughtered cattle (see Note 6) 2 Gray matter of cerebra (about 1 6 kg wet weight) are homogenized m a Waring blender with 1 7 vol of buffer C 3 The homogenate is centrifuged at 100,OOOg for 1 h. 4 After one-ninth vol of buffer D 1s added to the supernatant, one-ninth vol of ethylene glycol 1s added to give the final concentration of 10% (v/v) 5 The cytosol fraction 1s Immediately frozen m liquid nitrogen and stored at -80°C until use (see Note 7) 6 The cytosol fraction (200 mL, 1.4 g of protein) 1s thawed on ice and the supernatant IS obtained by centrlfugatlon at 100,OOOg for 1 h. 7 The supernatant IS sequentially filtrated through 2 0-, 0.8-, 0 45-, and 0.2~pm prefilters 8 The filtrated supernatant (160 mL, 1 1 g of protein) 1s then applied to a Mono S HRlO/lO column equilibrated with 80 mL of buffer E using FPLC system 9. After the column 1s washed with 80 mL of buffer E, elutlon 1s performed with a 240-mL linear gradient of NaCl (O-l.0 M) m buffer E The column 1s run at a flow rate of 2 mL/mm and fractions of 4 mL each are collected 10 Fifteen mlcrohters of each fraction are assayed for the B-Raf actlvlty in the presence or absence of 100 nM GTPyS-Kl-Ras as described below As shown m Fig. 1, the Kl-Ras-deuendent B-Raf actlvltv annears m Fractions 80-90 (see Note 81
Activation of MAP-Kinase Cascade
1
20
40
60
177
60
100
120
Fraction Number Fig. 1. Mono S-column chromatography. Five mlcrohters of each fraction of Mono S-column chromatography were assayed for the B-Raf activity. (*), in the presence of GTPyS-Kl-Ras; (0), m the presence of GDP-Kl-Ras; (A), in the absence of Kl-Ras. -), NaCl concentration (----), absorbance at 280 nm (Adapted from Yamamorl ( et al [31] with permission from the Journal of Bzological Chemistry and the American Society for Biochemistry and Molecular Biology.)
3.5. Cell-free Assay for Razz-dependent Activation of MAP Kinase Cascade 1 The Ki-Ras-dependent B-Raf activity 1s detected by the phosphorylatlon of MBP as a model substrate for ERK with GST-MEK and GST-ERK2 in the presence or absence of GTPyS-Ki-Ras (see Note 9). 2. Five mlcrohters of 400 nM GTPyS-I&Ras are mixed with 15 pL of each fraction of Mono S-column chromatography 3 Fifteen microliters of a reaction mixture (22 3 m/l4 Tris-HCl, pH 8 0, 10 mM MgCl,, and 400 p.!V ATP) are added, and the mixture 1s incubated for 5 mm at 30°C 4. After the mcubatlon, 15 PL of 250 nM GST-MEK 1s added and the mcubation 1s continued for 10 mm at 30°C. 5 After the lo-mm mcubatlon, 10 pL of 3 pM GST-ERK2 are added The reaction mixture is incubated for addItiona 20 mm at 30°C. 6. Then, 20 p,L of a reaction mixture (20 mM Trls-HCl, pH 8.0, 6 mM EGTA, 10 mM MgCl,, 100 w [Y-~*P]ATP [300 cpm/pmol], and 220 pn/r MBP) are added. Incubation is continued for another 10 min at 30°C 7 After the incubation, 30 j.tL of the reaction mixture are spotted onto a 2.5 x 2 5-cm phosphocellulose sheet P8 1 8 The sheet 1s washed m 75 mM phosphoric acid (10 mL per sample) for 15 mm three times with gentle agitation. 9 The radloactlvlty IS measured by liquid scmtlllatlon spectrometry by measuring Cerenkov radiation (37). 10 Slmllar results are obtained when Ha-Ras or Rap 1B 1s used instead of Ki-Ras
178
Shimizu, Ohtsuka, and Takai
QDP QTP)s QDP-KCRM QTP,S-KI-RM QST-MEK B-Rti
+ + +
+ + +
+ + +
_ -
-
-
: +
+ +
: -
Fig. 2. Activation of ERK through MEK by B-Raf. The B-Raf activity was assayed in the presence of various combinations of 10 pkf GDP, 10 pJ4 GTPyS, 100 rut4 GDP-Ki-Ras, 100 r&f GTPyS-Ki-Ras, 75 nit4 GST-MEK, and a 15pL aliquot of Fraction 85 from the Mono S-column chromatography (B-Raf).
3.6. Properties of B-Raf 3.6.1. Activation of ERK through MEK by B-Raf The B-Raf activity is examined in the presence of various combinations of Ki-Ras, GST-MEK, GST-ERIC& and B-Raf. The results are summarized in Fig. 2.
In the presence of GST-MEK, GTPyS-Ki-Ras, but not GDP-Ki-Ras, enhances the B-Raf activity.
However,
the basal activity
is detected in the presence of
GDP-Ki-Ras, GDP, or GTPyS. This basal activity decreases in the absence of GST-MEK
or B-Raf. These results indicate that B-Raf stimulates ERK through
the activation of MEK and that the basal activity is derived from GST-MEK and B-Raf. It is possible that the basal B-Raf activity observed in the absenceof Ki-Ras is either a real basal activity of B-Raf, or is a result of the artificial activation of B-Raf during its preparation. Similar results are obtained when Ha-Ras or RaplB is used instead of Ki-Ras. 3.6.2. Effect of the Lipid Modifications on the Activation of B-Raf
of Ras and Rap1
Five microliters of various concentrations of the lipid-modified or -unmodified form of GTPyS-Ki-Ras or GTprS-Rap 1B are assayed with a 15-PL aliquot of
Activation
of MA P-Kinase
Cascade
179
Ki-Ras or Rap1 B (nM) Fig. 3. Effect of the lipid modtftcattons of Kt-Ras and RaplB on the actrvatron of B-Raf The B-Raf activity was measured with various concentrations of lipidmodified or -unmodrfred form of GTPyS-Ki-Ras or GTPyS-RaplB (A), with lipid-modified GTPyS-Kt-Ras, (@), with ltprd-modrfred GTPyS-RaplB; (A), with lipid-unmodrfred GTPyS-Kr-Ras; (0), with lipid-unmodified GTPyS-RaplB (Adapted from Ohtsuka et al [35] with permission from the Journal ofBzologzca1 Chemistry and the Amerrcan Society for Biochemistry and Molecular Brology.) Fraction 85 from the Mono S-column chromatography for the B-Raf activity. Lipid-modified Kl-Ras activates B-Raf with the K, value, glvmg half maximal
activation of B-Raf, of about 6 ti, whereas the lipid-unmodified one IS far less effective. Similarly, lipid-modified RaplB activates B-Raf with the K, value of about 25 mI4, whereas
the lipid-unmodrfied
one is far less effective
(see Fig. 3). The similar results are obtained when Ha-Ras IS used instead of Kl-Ras (see Notes 10 and 11). 4. Notes 1. Liptd-modified Kt-Ras, Ha-Ras, and RaplB are purified from the membrane fraction of Spodoptera fruglperda cells (Sf9 cells), which are infected wrth baculovrrus carrying each cDNA Ltpid-unmodrfred forms are purified from the cytosol fraction (38). These purified samples are stable at -80°C up to4mo 2 A rat-ERK2 cDNA is cloned from a rat-bram cDNA library using a polymerase chain reaction (29). A mouse-MEK cDNA 1s cloned from a D9 cDNA library using a polymerase chain reaction (39). These cDNA are inserted into pGEX-2T
Shlmlzu, Ohtsuka, and Takal
180
3. 4 5
6 7 8
9
10.
11.
to yield pGEX-2T-ERK2 and pGEX-2T-MEK for the productron of the GST-ERK2 and GST-MEK fusion protein (GST-ERK2 and GST-MEK), respectively (29,391. GTPyS-Kr-Ras is stable on tee up to 2 h. GST-ERK2 can be stored for at least 3 mo at -80°C untrl use Repeated freezmg and thawing of this sample should be avoided. GST-MEK 1s heat-labile and 1s inactivated by repeated freezing and thawmg Induction and purtftcatton should be prompt Purlfred GST-MEK should be immediately frozen m hqurd nitrogen and kept at -80°C as soon as possible If the cell-free assay cannot detect the Ras-dependent MEK activity, rt may be Judged that GST-MEK is inactivated during its preparation. All the purrfrcatton procedures are performed at 0-4”C Unless ethylene glycol is added, B-Raf loses rts actrvrty The Ras-dependent B-Raf actrvrty 1s detected on Mono S-column chromatography even using the cytosol of other rat tissues However, rf the cytosol 1s used as the sample to be assayed, the activity cannot be detected. The reason 1snot known, however, some interfering materials m the crude cytosol may mhrbn the B-Raf activity, because the activity can be detected after Mono S-column chromatography Because the Ras-dependent B-Raf activity 1s very labrle, purified B-Raf should be immediately used after rt 1s thawed This cell-free assay 1s very sensitive to detergents. If it is necessary to use any detergent, check the effect Several groups have reported that lipid-unmodtfied Ras activates ERK m cellfree systems using crude lysates (40-42) The hrgher concentrations of Ras (4.0-5-O yM) are, however, needed to activate MAP kmase m then experiments. These results are consistent with our observatton that lipid-modified Ras 1s far more effective than lipid-unmodrfred one on the acttvatton of B-Raf. By use of the cell-free assay system which we have developed, we have clarified that both Ras and Rap1 dtrectly interact with B-Raf and activate it (35). The llprd modiftcations of Ras and Rap1 are essential m thus actron However, a cell-free assay system m which Ras activates c-Raf-1 has not yet been established It IS important to develop this assay system for our understandmg of the mode of action of Ras or Rap1 on the c-Raf-1 activation
References 1 Davis, R. J. (1993) The mrtogen-activated protem kmase signal transduction pathway. J Blol Chem 268, 14,553-14,556 2. Blems, J. (1993) Signal transductton vta the MAP kmases: proceed at your own RSK Proc Nat1 Acad Scl USA 90,5889-5892. 3. Johnson, G. L and Varllancourt, R R (1994) Sequentral protem kmase reactions controlling cell growth and differentiation Curr Opin Cell Biol 6,230-238. 4 Daum, G., Ersenmann-Tappe, I., Fries, H.-W., Troppmarr, J , and Rapp, U. R. (1994) The ms and outs of Raf kmases. Trends Blochem Scl 19,474-480
Activatmn of MAP- Kinase Cascade
181
5. Zheng, C.-F. and Guan, K.-L. (1994) Activation of MEK family kmases requires phosphorylatton of two conserved Ser/Thr residues EMBU J 13, 1123-l 13 1 6 Alessi, D R , Sarto, Y , Campbell, D. G., Cohen, P , Srthanandam, G , Rapp, U , Ashworth, A , and Marshall, C J. (1994) Identtftcatton of the sites m MAP kinase kmase- 1 phosphorylated by p74raf- 1. EMBO J 13, 16 10-l 6 19. 7 Gardner, A M., Varllancourt, R. R., Lange-Carter, C. A., and Johnson, G L (1994) MEK- 1 phosphorylatron by MEK kmase, Raf, and mrtogen-activated protem kmase. analysis of phosphopeptrdes and regulation of activity. Mol Blol Cell 5, 193-201. 8. Dent, P , Haser, W., Haystead, T A J , Vincent, L. A , Roberts, T. M., and Sturgrll, T W (1992) Activation of mttogen-activated protein kinase kmase by v-Raf m NIH 3T3 cells and in vitro Sczence 257, 1404-1407. 9. Howe, L. R., Leevers, S J., Gomez, N , Nakrelny, S., Cohen, P., and Marshall, C J. (1992) Actrvatron of the MAP kmase pathway by the protein kmase raf. Cell 71,335-342 10. Kyriakts, J. M , App, H., Zhang, X. F , BanerJee, P., Brautrgan, D. L., Rapp, U., and Avruch, J. (1992) Raf-1 activates MAP kranse-kmase Nature 358,417-421 11 Lange-Carter, C A and Johnson, G L (1994) Ras-dependent growth factor regulation of MEK kinase m PC12 cells Science 265, 1458-1461 12. Varllancourt, R R., Gardner, A M , and Johnson, G L (1994) B-Raf-dependent regulation of the MEK- l/mrtogen-activated protein kinase pathway in PC 12 cells and regulation by cychc AMP. Mol Cell Blol 14, 6522-6530 13 Jatswal, R. K , Moodre, S. A , Wolfman, A., and Landreth, G. E. (1994) The mttogenactivated protein kmase cascade IS activated by B-Raf in response to nerve growth factor through interaction with p2lras. Mu1 Cell Bzol 14,6944-6953 14 Moodie, S. A., Pans, M J., Kolch, W., and Wolfman, A. (1994) Assocratron of MEKl with p2lras GMPPNP 1s dependent on B-Raf. Mol Cell Bd 14,7153-7162. 15. Catlmg, A. D , Reuter, C W , Cox, M E., Parsons, S. J , and Weber, M. J (1994) Partial purtficatton of a mttogen-activated protem kinase kmase activator from bovine brain Identificatton as B-Raf or a B-Raf-associated activity. J Biol Chem 269, 30,014-30,021 16 Nebreda, A R and Hunt, T (1993) The c-mos proto-oncogene protein kinase turns on and maintains the actrvrty of MAP kmase, but not MPF, m cell-free extracts of Xenopus oocytes and eggs. EMBO J 12, 1979-1986. 17. Posada, J., Yew, N , Ahn, N G., Vande Woude, G. F., and Cooper, J A. (1993) Mos stimulates MAP kmase m Xenopus oocytes and activates a MAP kmase kmase m vitro Mu1 Cell Bzol 13,2546-2553. 18. Lange-Carter, C. A , Pleiman, C. M., Gardner, A M., Blumer, K J , and Johnson, G. L. (1993) A divergence m the MAP kmase regulatory network defined by MEK kmase and Raf Science 260, 315-319. 19. Kolch, W., Heidecker, G., Lloyd, P , and Rapp, U. R. (1991) Raf-1 protein kmase is required for growth of induced NIH/3T3 cells. Nature 349,426-428
182
Shimizu, Ohtsuka, and Takai
20 Dickson, B., Sprenger, F , Morrison, D , and Hafen, E. (1992) Raf functions downstream of Rasl m the Sevenless signal transduction pathway Nature 360,600-603 21 Han, M., Golden, A, Han, Y., and Stemberg, P. W. (1993) C. elegans lm-45 raf gene participates m let-60 ras-stimulated vulva1 differenttation. Nature 363, 133-140 22 Schaap, D , van der Wal, J , Howe, L R , Marshall, C. J., and van BhtterwtJk, W. J. (1993) A dominant-negative mutant of raf blocks mttogen-activated protein kinase activation by growth factors and oncogemc p2lras. J Blol Chem 268,20,232-20,236. 23 Moodie, S. A., Willumsen, B M., Weber, M. J., and Wolfman, A (1993) Complexes of Ras GTP with Raf-1 and mitogen-activated protein kmase kmase Sczence 260, 1658-1661 24 Zhang, X. F., Settleman, J., Kyriakts, J M , Takeuchi-Suzukt, E., Elledge, S. J., Marshall, M S , Burder, J T , Rapp, U. R., and Avruch, J. (1993) Normal and oncogemc p2lras proteins bmd to the ammo-termmal regulatory domam of c-Raf- 1. Natur e 364,308-3 13 25 Warne, P H , Vtciana, P R , and Downward, J (1993) Direct interaction of Ras and the ammo-terminal region of Raf-1 m vitro. Nature 364, 352-355. 26 Van Aelst, L , Barr, M , Marcus, S , Porvermo, A , and Wigler, M. (1993) Complex formation between RAS and RAF and other protein kmases Proc Nat1 Acad SCI USA 90,6213-6217 27 VoJtek, A B , Hollenberg, S. M , and Cooper, J. A (1993) Mammalian Ras mteracts directly with the serme/threomne kmase Raf. Cell 74,205-214. 28 Koide, H., Satoh, T , Nakafuku, M , and Kazno, Y (1993) GTP-dependent association of Raf- 1 with Ha-Ras* identtficatton of Raf as a target downstream of Ras m mammalian cells Proc Nat1 Acad Scl USA 90,8683-8686 29 Itoh, T., Katbucht, K , Masuda, T , Yamamoto, T., Matsuura, Y , Maeda, A., Shimizu, K , and Takai, Y (1993) A protein factor for ras p21-dependent activation of mttogen-activated protein (MAP) kmase through MAP kmase kmase. Proc Nat1 Acad Scz USA 90,975-979 30 Kuroda, S , Shimizu, K., Yamamort, B., Matsuda, S , Imazumi, K , Kaibuchi, K., and Takai, Y (1995) Purification and charactertzation of REKS from Xenopus eggs. Identtfication of REKS as a Ras-dependent mitogen-activated kmase kmase kinase J Blol Chem 270,2460-2465 31 Yamamori, B., Kuroda, S , Shimizu, K., Fukm, K , Ohtsuka, T., and Takai, Y (1995) Purification of a Ras-dependent mitogen-activated protein kmase kmase kmase from bovine brain cytosol and its tdenttfication as a complex of B-Raf and 14-3-3 proteins. J Bzol Chem 270, 11,723-l 1,726 32 Kawata, M , Matsm, Y., Kondo, J , Hishtda, T , Teramshi, Y., and Takat, Y (1988) A novel small molecular weight GTP-bmdmg protein with the same putative effector domain as the ras proteins in bovine brain membranes. Purification, determination of primary structure, and characterization. J Bzol Chem 263, 18,965-18,971 33 Ptzon, V , Chardm, P , Lerosey, I., Olofsson, B , and Tavitian, A (1988) Human cDNAs rap1 and rap2 homologous to the Drosophila gene Dras3 encode proteins closely related to ras m the “effector” region. Oncogene 3, 201-204
Activation of MAP-Kmase Cascade
183
34. Krtayama, H , Sugtmoto, Y , Matsuzaki, T , Ikawa, Y., and Noda, M. (1989) A ras-related gene with transformatron suppressor actrvrty Cell 56, 77-84. 35. Ohtsuka, T., Shtmrzu, K , Yamamorr, B., Kuroda, S , and Takar, Y (1996) Actrvatron of brain B-Raf protein kmase by RaplB small GTP-binding protein. J Bzol Chem 271, 1258-1261. 36 Kuroda, S., Shimrzu, K , Yamamorr, B., and Takar, Y. (1995) Cell-free assay system for Ras-dependent MEK activation, m Methods zn Enzymology (Balch, W. E , Der, C. J , and Hall, A., eds )%Academic, San Diego, CA, pp. 257-265. 37 Roskoskr, J. R (1983) Assays of Protein Kmase, m Methods zn Enzymology (Corbin, J D and Hardman, J G., eds ), Academic, San Diego, CA, pp. 3-6. 38. Mrzuno, T., Karbuchr, K., Yamamoto, T , Kawamura, M., Sakoda, T , FuJioka, H , Matsuura, Y , and Takar, Y, (1991) A strmulatory GDP/GTP exchange protein for smg p21 IS active on the post-translatronally processed form of c-Ki-ras p21 and rhoA ~21. Proc Nat1 Acad Scl. USA S&6442-6446. 39. Shimrzu, K., Kuroda, S., Yamamorr, B., Matsuda, S., Karbuchr, K , Yamaucht, T., Isobe, T., Irre, K., Matsumoto, K., and Takai, Y (1994) Synergistic activation by Ras and 14-3-3 protem of a mitogen-activated protein kmase kinase kmase named Ras-dependent extracellular signal-regulated kinase kmase stimulator J Blol Chem 269,22,911-22,920 40 Hattort, S., Fukuda, M , Yamashrta, T , Nakamura, Y., Gotoh, Y., and Nrshrda, E. (1992) Actrvatron of mitogen-activated protem kmase and its activator by ras m intact cells and m a cell-free system. J Blol Chem 267, 20,346-20,35 1 41 Shibuya, E K , Chang, E., Wrgler, M., and Ruderman, J V. (1992) Oncogemc ras triggers the actrvatron of 42-kDa mrtogen-activated protein kmase m extracts of quiescent Xenopus oocytes. Proc Nat1 Acad Scl USA 89,983 l-9835 42. VanRenterghem, B., Gibbs, J. B., and Maller, J. L. (1993) Reconstitution of p2 lras-dependent and -independent mrtogen-activated protein kmase activation m a cell-free system. J Blot Chem 268, 19,935-19,938.
12 Reconstitution System Based on Cytosol-Depleted Cells to Study the Regulation of Phospholipases C and D Shamshad
Cockcroft
1. Introduction Cell-surface receptors regulate hydrolysis of cellular phospholipids that are catalyzed by different classes of phosphohpases havmg distmct specificities. Depending on cell-type and stimulus, multiple lipid signaling pathways are recruited to allow for the physiological response of the cell to be manifested. Thus, receptors can be coupled to activation of the inositol lipid-specific phospholipase C (PLC), phosphohpase A2 (PLA& and phosphohpase D (PLD) and give rise to multiple second messengers and bioactive metabolites. PLC is the most widely studied lipid-signaling system where hydrolysis of phosphatidylinosrtol bisphosphate (PIP2) is responsible for generatmg two well-established second messengers, mositol trisphosphate (IP,) and dracylglycerol (DAG). IPs raises cytosol Ca2+ and DAG activates a large and growing family of protein kinase Cs (PKCs). The regulation of PLCs by hormones, neurotransmitters, and growth factors is a matter of great importance, and several outstanding questions remam. Although some of the major components that constitute this signaling pathway are well-established at a molecular level, many aspects of their regulation within the cell milieu remam poorly defined. PLCs belong to three families, designated PLCP, PLCy, and PLCG. Each family contains several members that are products of different genes expressed in a tissue-specific manner. The PLCP family is regulated by Ga, and/or py-subunits of heterotrimeric G proteins and the PLCyfamrly associates to phosphotyrosine residues on target molecules such as the EGF receptor by interactions between the SH2 domains present m PLCy. Subsequent phosphoFrom
Methods m Molecular Bology, Vol 84 Transmembrane Signahng Edtted by D Bar-Sag! 0 Humana Press Inc , Totowa, NJ
185
Protocols
186
Cockcroft
rylation of PLCy on serine and tyrosme residues is known to occur, but how it affects activity is not established. Thus, heptahehcal receptors that couple to G proteins activate PLCP family, whereas receptors that are mtrmsic tyrosme kinases or those that regulate tyrosme kmases have the potential to activate the PLCy famtly. Regulation of PLCG is currently unknown, but a potential candidate is changes in cytosol Ca2+. Another lipid-signaling pathway is PLD, an enzyme that catalyzes the hydrolysis of phosphatidylcholme (PC) to the lipid-soluble phosphatidic acid (PA) metabohte, and the water-soluble headgroup, choline. PLD activity is increased when G-protein-coupled receptors or receptors that regulate tyrosme kmase are occupied by appropriate agonists. The regulatory mechanisms as well as the enzymology concermng PLD are still being elucidated. ARF and Rho, two families of low-molecular-weight GTP-binding protein have been identified as regulators of mammalian PLD (1-3). In addition, conventtonal isoforms of PKC (a, PI, PII, and $ are also responsible m part for activation of PLD (4). The three regulators (ARF, Rho, and PKC), act m a synergistic fashion. The cloning of the ARF-regulated human PLD (hPLD1) was reported recently, and it defines a new and highly conserved gene family (5), To study these phospholipases, it is essential to set up assays in which it is possible to study their regulation by cell-surface receptors and their modulation by other cellular factors. An additional parameter that has to be taken into consideration when studying phosphohpases is the presentation of substrates to these enzymes. By using cells, the lipid substrates for these enzymes are presented m then native state. Very often, the use of lipid micelles or vesicles m the presence of detergents leads to loss of many subtle aspects of PLC and PLD regulation. Finally, because many G-protein-coupled receptors and receptor tyrosine kinases activate both PLC and PLD simultaneously, assays that allow the independent regulation of either phospholipase in cells are desirable. Here, the use of reconstitution systems based on prior depletion of cytosohc protems has proved useful m these studies. Depletion of cytosohc protems leads to loss of G-protein-activated PLC and PLD acttvmes, and both activities can be restored by addition of exogenous cytosol. Fractionation of the cytosol reveals that regulated PLC activity can be restored by two cytosohc factors identified as PLCP and phosphatidylmositol transfer protein (PITP) (6-8). PLD activity is restored by ARF, a small GTP binding protein (2). Permeabilization is achieved by using streptolysm 0, a bacterial (streptococcal) cytolysin that generates large lesions (approx 15 nm rn diameter) m the plasma membrane of cells to allow the efflux of cytosohc proteins. The protocol detailed in Subheading 3. is written for studying G-protein-coupled receptors (7) and can be adapted for studying tyrosme-kmase receptors (9). To activate GTP-bmdmg proteins, GTP@, the nonhydrolyzable analog of GTP, is
Regulation of Phospholipases
C and D
187
mcP GVS a?\
+
A
~y~tnl
actlvatlon
“ACUTELYPERMEABILIZED”
I I
{,6Tpr,g,li -4 /I
SL-O 10 mln
with
+
GTPYS
exogeno”s
proteins
(eg PITPI
1
-
Restoration of PLC acWty
Fig 1. Illustratton of the method employed for restoration of G-protein-regulated PLC acttvtty m permeabtlized cell preparations Two of the components, PLCP and the heterotrtmeric GTP-binding protein requtred by this pathway, are shown as assoctated with the plasma membrane. Three steps are described. (A) PLC acttvtty is momtored m acutely permeabihzed cells, conditions where GTP’yS and the permeabrhzmg agent, SLO are added stmultaneously Activation by GTP@ occurs m the presence of cytosolic proteins and maximal stimulation is observed. (B) When cells are incubated with SLO first to deplete the cytosohc proteins, the abthty of GTP$3 to stimulate PLC actrvtty m the cytosol-depleted cells is impaired despite the presence of PLCP and G-protein with the plasma membrane. (C) Cytosol-depleted cells are reconstituted with addmon of exogenous cytosol (or purified proteins, e.g., PITP) GTP@ now sttmulates PLC activation. used. Thts activates both heterotrimertc as well as monomeric GTP-binding proteins of the Ras superfamily Activation of phospholtpases is examined under different states of the cell
(see Fig. 1). In the first instance the responsiveness of the system 1sestablished by examining “acutely permeablhzed” cells. This determines the extent of the response one is likely to obtain under the most optimal condtttons. Here the agonist for the G protein (or the receptor) is added stmultaneously with the
permeabilizmg agent. Under these conditions, the activation of the G proteins occurs while the majority
of the cellular
proteins are still present tn the cells.
Entry of GTP@ into the permeabilized cells occurs within seconds but the loss of the cytosolrc proteins from the cells occurs m 5-10 min. This is simply owing the size of the molecules.
188
cockcrofi
The second step establishes conditions that lead to “run-down” so that the ability of the cells to respond to GTP’yS (or a receptor-directed agonist) becomes refractory. This refractory state is achieved by permeabihzmg the cells first to deplete the cytosolic proteins. These cells are referred to as “cytosol-depleted” cells, Condltlons for run-down should be empn-lcally determmed for each cell type, Some proteins are freely diffusible and ~111 be released within 5-10 mm, but other proteins are associated with the membrane or cytoskeleton and are only released over a longer period of time (30-45 mm) (see Notes 1 and 2). The third and final step 1s to restore activation by re-adding exogenous cytosol or known protems that are suspected to be required for signaling. If the identity of the protems is not known, then the cytosol can be fractionated and the reconstltutmg factor(s) purlfled for ldentlflcatlon. Actlvatlon of PLC or PLD can be selectively restored by re-addition of cytosol. The cytosolic proteins that restore G-protein-regulated PLC activity have been identified as PLCP and phosphatidylmosltol transfer protein (7,d). PLD activity can be restored by addition of ARF proteins in cytosol-depleted cells (2).
2. Materials 2.1. Studying
PLC and PLD Pathways in Permeabilized
Cells
1 Streptolysin 0 (SLO) 1s commercially available and the two sources m our research that give reproducible results are Murex Diagnostics (Temple Hill, Dartford, UK [Product No MR16]) and Research Blochemlcals (RBI) (Natlck, MA [Product No. S-1551). There are other commercial sources of SLO that we have not examined Both formulations are supplied m powder form. The powder 1s suspended m 2 mL (2.5 mL for RBI SLO) of distilled water to give a stock solution of 20 International Units (IU)/mL (Internatlonal umts are the manufacturer’s arbitrary units.) This solution can be kept at 4°C for l-2 wk The solution can get cloudy with time and can be partially clarlfled on warming at 37°C. However, the cloudmess does not affect permeabllizatlon. 2 Both primary and cultured cells have been successfully used. We routmely use I-IL60 cells or human neutrophds m suspension. Attached cells can also be used (9), but depletion of cytosohc protems is better achieved in cells m suspension Attached cells can be detached by trypsinizatlon or scraping and used in suspension (10). 3. Permeabdlzatlon buffer: 20 mM Na-PIPES, 137 mM NaCl, 2 7 n-J14KCl, pH 6.8 Stock solution of piperazme-N,N’ bzs[2-ethylsulfonic acid] (Na-PIPES) (1 M) and a 20X stock of NaCl/KCI are kept at 4°C till reqmred 2 mL of stock Na-PIPES and 5 mL of stock NaCl/KCl are diluted to 100 mL and made fresh and the pH adjusted to 6 8 This ~111be referred to as the PIPES buffer. Glucose1 mg/mL (5.6 mM) and bovine serum albumm-1 mg/mL are added to the PIPES buffer to obtain the permeablhzatlon buffer.
189
Regulation of Phosphollpases C and D Table 1 Recipe for Ca2+ Buffer Solutions Vol (mL)O
Vol (mL)
@a
Ca/EGTA
EGTA
8 7 6.5 6 55 5
0.112 0.996 2.48 1 4.698 6.552 7 501
7.888 7.004 5.519 3.302 1.448 0 499
“Ca/EGTA and EGTA solutions (100 mM) are mtxed m the proporttons Indicated to obtain 8 mL of each buffer stock (100 mM) at the approprtate pCa When diluted to a final WTAltota~ as 3 mM, these quanttttes are calculated for [MgCI,] as 2 mM, pH 6.8. 4 Calctum/ethyleneglycol-bl.+p-ammoethylether N,N,N,N, tetra-acettc acids (Ca/EGTA) buffers-It is necessary to control the concentratton of Ca2+ between 10 nM and 10 lU4 (pCa 8-pCa 5). Resting levels of cytosol Ca2+ 1s 100 n/t4 m most cells and increases to micromolar levels upon sttmulatton Both phosphohpases are sensitive to calcmm m the phystologtcal range; tt 1s therefore important to clamp the Ca*+ concentratton to a known value by usmg Ca-EGTA buffers. The final EGTA concentration ts maintained at 3 n-&4. Stock Ca-EGTA buffers (100 mM) at specific free-Ca2+ concentrations are prepared and stored at -20°C Ca2+/EGTA buffer stocks (100 mM) m the range of pCa 8 (10 nM) to pCa 5 (10 w) are prepared from stock solutions of Ca-EGTA and EGTA of 100 n-u!4 concentration, which are then combined m varying proportions to achieve the desired value of free Ca*+ (see Table 1). These values have been obtained using the program CHELATE (II). The two stock solution are prepared m PIPES buffer (20 mM Na-PIPES, 137 mM NaCl, 2.7 mM KCl, pH 6.8). EGTA 1s purchased from Fluka because of high purity, and CaCl, 1s analytical grade obtained from Sigma. 5. Magnesium salt of adenosme-5’ trtphosphate (MgATP) 1s made up as a stock solutton of 100 mM and can be kept at -20°C for months. ATP is purchased as a disodmm dthydrogen salt To prepare 10 mL of 100 mM stock solution of MgATP, dissolve 60.5 mg m 10 mL of a solutton containing 2 mL of 1 M Trts and 1 mL of 1 M MgCl,. The use of 200 mM Trts effectively results m a neutral solution (pH 7 0). This should be checked with a pH electrode and adjusted accordmgly. Freeze-thaw of the solution 1s not detrimental, and lo-mL altquots can be kept at -20°C and used repeatedly 6. [3H]mosttol and [methyl-3H]cholme are purchased from Amersham and kept sterile
190
Cockcroft
7. Dowex resm (chloride form, mesh size 1 x 8 -2OO), 1 A4 formic acid, 1 M NaOH, 1 M ammomum formate, 5 mM sodmm tetraborate/5 nu’~Z sodmm formate 1s obtained from Srgma. Bra-Rex 70 canon exchange resm (sodium form, mesh stze 200-400) 1s obtained from Bra-Rad 8. GTP@’ 1s obtamed as a IO-miV solution from Boehrmger.
3. Methods 3.1. Reconstitution of PLC Activity in Cytosol-Depleted Cells Procedures are described for reconstitution of PLC actlvlty in permeabihzed cells (see Fig. 1). Three steps are described: The first step outlines the expenmental procedure for working with: 1 Acutely permeabrhzed cells, 2 Condrttons to establish run-down, 3. Restoration of PLC activity.
and
3.1.1. Assay of PLC Activity in “‘Acute/y Permeabilized”
Cells
1 Labeling of cells-To measure PLC activity, the release of mosttol phosphates 1s momtored. The cells are labeled with [3H]mosrtol for 48 h HL60 cells grow in RPMI-1640 medium with heat-inactivated 12 5% (v/v) fetal calf serum (FCS), 4 mM glutamme, 5000 IU/mL pemcillm, and 500 l.tg/mL streptomycm Because RPM1 contains a high level of mosrtol, the cells are labeled m Medium 199, supplemented with glutamme, penicrllm, and streptomycin and labeled with 1 @!r/mL [3H]mosnol for 48 h FCS 1s also excluded as this contains high levels of mosnol, and instead Medium 199 is supplemented with msulm (5 pg/mL) and transferrin (5 clg/mL) as growth factors. HL60 grow to a density of l-2 x lo6 cells/ mL and each assay tube has approx l-2 x lo6 cells. Fifty mrlhhters of cells 1s therefore sufficient for 50 separate assay conditions. The experiment is always carried out m duplicate. Incorporation of [3H]mosuol into the mositol lipids can be determmed by extractmg the mosltol hprds (see step 5) and measuring the level of mcorporatron m the total hptd extract To obtain a good signal, each assay tube should contain approx lo5 DPM (drsmtegratrons per minute) mcorporated in the hprd extract 2 Labeled HL60 cells (50 mL, l-2 x IO6 cell/mL) are centrifuged at IOOOg for 5 min at room temperature. The medium 1s discarded and the cells resuspended m 40 mL permeabthzatron buffer (PIPES buffer containing albumin and glucose) The cells are recentrlfuged and washed once again. After the final centrrfugatron, the cells are resuspended m 2-3 mL of permeabthzation buffer The washed radtolabeled cells are equthbrated at 37°C for 10-15 mm. 3. 1.5-mL Eppendorf tubes are used for the assays The final assay volume is 100 pL. 50-pL cells are transferred to tubes containing an equal volume of permeabdlzatron buffer supplemented with: a SLO (0 4 IU/mL final) b. MgATP (1 m&Y final). c. MgC12 (2 mM final)
Regulation of Phospholipases
4.
5.
6.
7.
C and D
191
d. Ca*+ buffered with 3 mM EGTA (pCa 6). e. LiCl (10 mM final) (to inhibit conversion of mosltol phosphates back to free mosltol). f. GTP@ (10 @! final). The Eppendorf tubes containing the appropriate reagents are prepared at 4°C and put into the water bath at 37°C for 5 mm prior to addition of the cells. 50-m ahquots of cells are transferred to the Eppendorf tubes and incubated further for 20 mm. Two procedures can be used to terminate the reaction (see Note 3): a. Procedure 1: The samples are quenched with 375 pL of a mixture of chloroform:methanol (1 2 by vol). The sample 1s vigorously vortexed and a single phase obtained A further addition of 125 $ of chloroform and 125 pL of water is then added to obtain a two phase system After vigorous mixing, the samples are centrifuged for 5 min at 1OOOg. The lipids are present m the lower-chloroform phase, and the top aqueous phase contams the water-soluble components, including the mosltol phosphates. An ahquot of the top phase 1s used to analyze the presence of mositol phosphates. The aqueous must be neutral, otherwise the mosltol phosphates will not stick to the amon exchange resm b Procedure 2. The samples are quenched with 500 pL of ice-cold salme (0.9% NaCl) and centrifuged at 2000g (Note that the permeablllzed cells needs to be centrifuged at 2000g [3000 rpm] to sediment the cells.) The mosltol phosphates will be present m the medium, and a 400~pL allquot can be removed carefully for analysis of mosltol phosphates. Inosltol phosphates are separated from free mosltol and glycerophosphomosltol by passage through Dowex l-X8 amon exchange resin (formate form) The resm can be purchased as the chloride form (Sigma) The followmg procedure 1s used to convert It to the formate form. a Add the Dowex resin (100 g) into a beaker. b Add 1 M NaOH (400 mL) and stir with a glass rod. c. Allow the resm to settle (l-2 h). d. Carefully decant the NaOH solution. e. Add 400 mL of 1 M-formic acid and stir with a glass rod. f Allow the resm to settle and decant the formic acid. g. Wash the resin 5X with 400 mL of distilled water. h. Leave the resin as a 50% slurry m distilled water at 4°C and use as required The Dowex resin is transferred to Pasteur plpets (0.5 mL bed volume) equipped with a plug of glass wool. (The glass wool 1s rolled mto a ball and pushed to the bottom usmg the long form of the Pasteur plpet [gloves should be worn].) Alternatively, columns can be purchased from Bio-Rad. The sample 1s then loaded on the column obtained from either procedure a The column is washed with 6 mL of water to elute [3H]mosltol. b. Glycerophosphomosltol is removed with 6 mL of 5 m M sodium tetraborate/ 5 m M sodium formate c. The total mositol phosphates are eiuted together with 3 mL of 1 A4 ammomum formate/O 1 M formic acid directly into scmtlllatlon vials
Cockcroft d. The radioacttvtty 1s measured after addmon of a scinttllation cocktail that is able to accommodate 1 M salt. Phase combining system (PCS) from Amersham or Ultima Gold from Canberra Packard are both suitable Columns are regenerated by washing with 2 M ammonium formate/O 1 formtc acid followed by extensive washing with water (15 mL). 8 Calculation of data-The Increase in mosnol phosphates can be expressed as a function of the total radtoactivity (DPM) mcorporated m the mositol lipids This allows the results to be calculated as a percentage of the total lipids and allows comparisons to made from drfferent experiments. The total lipid chloroform extract obtained from the first procedure IS carefully removed from the Eppendorf tube and transferred to a clean scmttllatton vial, and the chloroform 1s allowed to evaporate by leavmg it overnight on the bench (or the fume hood). Add 500 pL of methanol to the dried lipids followed by 2 mL of scmttllatron cocktatl
3.1.2. Establishing Condltlons for Run-Down of PLC ActWy 1 To establish condtttons for run-down of regulated PLC acttvrty, 4 mL (l-2 x lo6 cells/ml) of washed [3H]mosttol-labeled HL60 cells are required. 2 A cocktarl contaming streptolysm 0 (0.4 IU/mL final), MgATP (1 mM final), and Ca*+ (100 nM) (buffered with 100 pM EGTA final) in 1 mL 1s added to the labeled cells. During the period of cytosol depletion, calcmm levels are mamtamed at pCa 7 and are ovemdden to pCa 6 during assay of PLC activity Therefore, calcmm 1s buffered with 100 pM EGTA durmg the depletion of cytosol rather than 3 mM EGTA 3 At trmed permeabilrzatron intervals (0, 2, 4, 8, 12, 16, 20, 30, 40,45, 60 mm), 4 ahquots of cells are withdrawn (50 pL) and transferred to duplicate assay tubes containing 50 pL of Ca*+ (pCa 6 [ 1 pM] buffered with 3 mM EGTA final), LtCl (10 mM final), MgATP (1 mM final), MgCl, (2 mM) + GTP@ (10 pM final) 4 Assay tubes are incubated at 37°C for an addmonal20 mm to monitor the extent of G-protein-stimulated PLC activrty. 5. At the end of the incubation, the reactions are quenched, as described earlier, for acutely permeabilized cells and the levels of [3H]mosttol phosphates formed are determined. 6. The data are plotted as the extent of the GTPyS-stimulated PLC activity as a function of the permeabiltzatton interval The run-down of activity IS seen as the permeabilization interval increases and the optrmum time for run-down determined Run-down 1s typically 80-90s for GTPyS-stimulated PLC activity (see Notes 4 and 5)
3.1.3. Reconstitution of G-Protein-Stimulated by Cytosolic Factors in Run-Down Cells
PLC
Having established the optimum period for observing run-down, the restoration of G-protein-stimulated PLC actrvtty can be attempted ustng exogenously added proteins.
Regulation of Phospholpses
C and D
193
1. 4 mL (l-2 x lo6 cells/ml) of washed [3H]mosltol-labeled HL60 cells m permeablllzatlon buffer are Incubated with a cocktail containing SLO (0 4 IU/mL final), MgATP (1 mM final) (see Note 4), and Ca*+ (100 nM buffered with 3 mM EGTA final) m 1 mL for the appropriate time that achieves run-down (lo-40 mm). 2. After permeabllizatlon, the cells are diluted with 40 mL ice-cold permeablhzatlon buffer and centrifuged at 2000g (3000 rpm) for 5 mm at 4°C to pellet the cells 3 The cells are resuspended m ice-cold permeablhzatlon buffer (2 mL) supplemented with Ca*+ (pCa 6 [ 1 @4] buffered with 6 mM EGTA final), LlCl (20 mM final), MgATP (2 mM>, MgC12 (4 mM). Assay tubes are prepared m advance which contam 50 pL of & GTP$S (10 p&Yfinal) and rat brain cytosol (l-3 mg/mL) or purlfled proteins (PLCP or PITP) on Ice 50-p.L ahquots of cells are then transferred to assay tubes on ice The final concentration during the assay 1s Ca*+ (pCa 6 buffered with 3 mM EGTA), LiCl(l0 mM final), MgATP (1 mM), MgCI, (2 mM), and GTPyS (10 l.uV). 4. Assay tubes are transferred to a waterbath and further incubated at 37°C for 20 mm to monitor the extent of G-protein-stimulated PLC activity. 5 At the end of the mcubatlon, the assay tubes are transferred to ice and reactions quenched as described earlier for acutely permeablllzed cells.
3.2. Restoration of ARF-Dependent in Permeabilized HL60 Cells
PLD Activity
A similar procedure is used for the reconstitution of PLD activity in permeabillzed cells (see Fig. l), except that the release of [3H]cholme IS measured as an indicator of PLD activity. Three steps are described: The first step outlines the experlmental procedure for working with: 1. Acutely permeablhzed cells, 2. Condltlons to establish run-down, 3. Restoration of PLD activity
and
3.2.1. Assay of PLD Actiwty in Acutely Permeabilized
Cells
1 Labeling of cells-To measure phosphatldylcholme-hydrolyzing PLD actlvlty, the cells are labeled with [methyl-3H]cholme’ and release of radlolabeled choline 1s used as a monitor of activity HL60 cells are normally grown m RPMI-1640 medmm with heat-mactlvated 12.5% (v/v) FCS, 4 mM glutamme, 5000 IU/mL peniclllm, and 500 pg/mL streptomycin. Radiolabelmg of HL60 cells is performed m Medium 199 contammg 10% FCS This medium 1s used because of its low choline content HL60 cells are labeled with 0 5 FCl/mL for 48 h HL60 grow to a density of l-2 x lo6 cells/ml and each assay tube has approx l-2 x lo6 cells 50 mL of cells 1s therefore sufflclent for 50 separate assay condltlons The experiment IS always carried out m duplicate [3H]cholme 1s mamly incorporated into phosphatidylcholme (87%) and sphingomyelm (13%) Incorporatlon Into the cholme-contammg hplds can be determined by extracting the total lipids (see
194
2
3
4. 5.
6.
7
8
Cockcroft abovei and measuring the level of incorporation m the extract. To obtain a good signal, each assay tube should contain approximately lo5 DPM Labeled HL60 cells (50 mL, l-2 x lo6 cell/mL) are centrifuged at IOOOg for 5 mm at room temperature. The medium 1s discarded and the cells resuspended in 40 mL permeablllzatlon buffer (PIPES buffer containing albumin and glucose). The cells are pelleted by centrifugation and process repeated once more After the final centrlfugatlon the cells are resuspended m 2 mL of permeablhzatlon buffer The washed, radlolabeled cells are equdlbrated at 37°C for lo-15 mm 1.5-mL Eppendorf tubes are used for the assays. The final assay volume IS 100 @. 50 pL of reaction mixture are prepared m the Eppendorf tubes contammg twice the concentration of SLO (0.4 IU/mL final), MgATP (1 mM final), MgCl, (2 mM final), Ca2+ buffered with 3 mM EGTA (pCa 5), and GTP@ (10 p&! final). The Eppendorf tubes containmg the appropriate reagents are prepared at 4°C and put mto the water bath at 37’C for 5 mm prior to addltlon of the cells 50-K ahquots of cells are transferred to the Eppendorf tubes and incubated further for 30 mm The samples are quenched with 375 w of a mixture of chloroform.methanol (l-2 by vol). The sample 1s vigorously vortexed and a single phase obtained A further addition of 125 @ of chloroform and 125 JJL of water 1s then added to obtain a two phase system After vigorous mixing, the samples are centrifuged for 5 mm at 1OOOg The lipids are present m the lower chloroform phase, and the top aqueous phase contains the water-soluble components including free [3H]choline. An ahquot of the top phase is used to analyze the presence of [3H]cholme. [3H]cholme is separated from glycerophosphocholme and phosphorylcholme by catton chromatography. The aqueous phase containing the choline metabohtes are applied to a 1-mL bed volume of Blo-Rex 70 cation exchange resin (sodmm form, mesh size 200-400 purchased from Bio-Rad) in a Bio-Rad column. The column 1s rinsed with 3 mL water to elute phosphorylated choline metabohtes Radlolabeled choline 1s quantitatively eluted with 3 mL 50 mM glycme contammg 500 mM NaCl, pH 3.0, directly into scmtlllatlon vials The Blo-Rex resin 1s regenerated by extensively washing the resin with 0 5 M NaOH, pH 9 0, followed by washing with water. The resin 1s then washed with 0.1 M sodium phosphate, pH 7 0, and finally washed with water. The radioactivity 1s measured after addition of a scmtillatlon cocktail that 1s able to accommodate high salt. PCS from Amersham or Ultlma Gold from Canberra Packard are both suitable Calculation of data-The Increase in labeled choline IS expressed as a function of the total radioactivity (DPM) incorporated m the choline lipids. The total lipid chloroform extract obtamed from the first procedure IS carefully removed from the Eppendorf tube and transferred to a clean scmtlllatlon vial and the chloroform allowed to evaporate by leaving it overnight on the bench (or the fume hood). Add 500 /JL of methanol to the dried hplds followed by 2 mL of scmtlllatlon cocktall
Regulation of Phospholipases
C and D
195
3.2.2. Establishing Conditions for Run-Down of PLD ActMy 1 To establish conditions for run-down of regulated PLD actlvlty, 4 mL (l-2 x lo6 cells/ml) of washed [3H]-cholme-labeled cells are reqmred. 2. A cocktail containing SLO (0.4 IU/mL final), MgATP (1 mM final), and Ca2+ (100 nM buffered with 100 p&f EGTA final) in 1 mL is added to the labeled cells 3. At timed permeablhzation intervals (0,2,4,8, 12, 16,20,25,30,40,45,60 mm), four allquots of cells are withdrawn (50 /JL) and transferred to duplicate assay tubes containing 50 pL of Ca2+ (pCa 5 [ 10 /.&f] buffered with 3 mM-EGTA final), MgATP (1 mM final), MgCl, (2 mA4) + GTP$? (10 pA4 final) 4. Assay tubes are incubated at 37°C for an additional 30 mm to monitor the extent of GTPyS-stimulated PLD activity 5. At the end of the mcubatlon, the reactions are quenched, as described earlier, for acutely permeablllzed cells 6. The data are plotted as the extent of the GTPyS-stimulated PLD activity as a function of the permeablhzatlon interval. The run-down of activity is seen as the permeabllizatlon interval increases and the optimum time for run down determined.
3.2.3. Reconstitution of GTPgS-Stimulated by Cytosok Factors in Run-Down Cells
PLD
Having established the optimum period for observing run-down, the restoration of GTPyS-stimulated PLD activity can be performed using exogenously added proteins. 1. Four mllhllters of washed [3H]choline-labeled HL60 cells m permeablhzatlon buffer are incubated with a cocktail containing SLO (0.4 IU/mL final), MgATP (1 mM final), and Ca2+ (100 ti buffered with 100 @4-EGTA final) m 1 mL for the appropriate time that achieves run-down (lo-40 mm). 2 After permeablhzation, the cells are diluted with 40 mL ice-cold permeablhzatlon buffer and centrifuged at 2000g (3000 rpm) fol 5 mm at 4°C to pellet the cells 3 The cells are resuspended m Ice-cold permeablllzation buffer and 50-pL ahquots are transferred to assay tubes on Ice. Assay tubes contain 50-F of Ca2+ (pCa 5 [ 10 @] buffered with 3 mA4-EGTA final), MgATP (1 mM final), MgCl, (2 mM) + GTP@ (10 pA4 final), and rat bram cytosol (l-3 mg/mL) or purified proteins (such as ARF or PKC). 4 Assay tubes are transferred to a water bath and further incubated at 37°C for 30 mm to monitor the extent of GTPyS-stimulated PLD activity. 5. At the end of the mcubatlon, the reactions are transferred to Ice and reactions quenched as described above for acutely permeablhzed cells
4. Notes 1. Depletion of proteins from the cytosol is dependent on their interactions with membranes or cytoskeleton Truly cytosohc proteins exit with a faster time-
796
2
3 4.
5.
6.
Cockcroft course compared to some proteins, which are loosely anchored m cells. For example, release of PITP occurs withm 5 mm whtle release of PLCP takes 45 mm (8). The PLCP does not ever completely exit from the cells, mdrcatmg some relatively tight association with a cellular structure The length of time used for the depletion of cytosohc proteins is therefore important as it will dictate which proteins leak out For any known protein, it is worthwhile Western blotting for the presence of the protein m the supernatants obtained after pelleting the permeabthzed cells It should never be assumed that a protein that 1s recovered m the cytosol when cells are homogenized will leak out of the cells Rho GDI 1s one such protein that does not leak out of extensively permeabthzed cells Unlike PLCP, PLCy 1s truly cytosoltc and exits from the permeabthzed cells wtthm 10-20 mm. Therefore, reconstttutron studies have to be designed to include purified PLCy, as well as PITP, when receptors that are tyrosine kmases (or regulate tyrosme kmases) are studied The chotce of whrch method 1s used to termmate the reaction 1slargely empnrcal Both methods were used m our laboratory extensively and gave similar results Durmg the step for cytosol depletion, we routmely have MgATP (1 mA4). It 1s possible that n-r its presence some protems may be retarded d their phosphorylatton state 1s important m attachment to Intracellular structures. Depletion of proteins can also be carried m the absence of MgATP and may influence the time-course of run-down. Run-down 1s variable, and therefore tt is important to work under well-defined cell densmes and SLO concentratrons routmely. The concentratton of SLO can be increased to 0.6 IU/mL tf run-down 1s msufftctent Normally, run-down 1s partial and routmely ranges from a loss of 70-90% of the response seen m acutely permeabrhzed cells. This protocol can be applied to any cellular response and not Just phosphohpases We have applted thus protocol for purrfymg proteins requrred for G-protemregulated exocytosts m HL60 cells (12) In this case, run-down of the secretory response is dependent on the absence of MgATP during the cytosol-depletion step In tts presence, run-down 1s slow
References 1. Brown, H. A., Gutowskr, S , Moomaw, C. R., Slaughter, C., and Sternwers P. C. (1993) ADP-rtbosylation factor, a small GTP-dependent regulatory protein, strmulates phosphohpase D activity. Cell 75, 1137-l 144. 2 Cockcroft, S , Thomas, G. M. H., Fensome, A., Geny, B., Cunningham, E., Gout, I, Htles, I., Totty, N. F , Troung, 0 , and Hsuan, J. J (1994) Phosphohpase D A downstream effector of ARF m granulocytes. Science 263, 523-526. 3 Singer, W D , Brown, H A , Bokoch, G. M , and Sternwers, P C (1995) Resolved phosphohpase D acttvrty is modulated by cytosohc factors other than Arf. J Blol. Chem 270, 14,944-14,950.
Regulation of Phospholipases
C and D
197
4. Singer, W. D., Brown, H A , Jiang, X., and Sternweis, P. C (1996) Regulation of phospholipase D by protein kinase C is synergistic with ADP-ribosylation factor and independent of protein kmase activity. J Biol. Chem 271,4504-45 10 5. Hammond, S. M., Altshuller, Y M , Sung, T., Rudge, S. A., Rose, K., Engebrecht, J., Morris, A. J., and Frohman, M A. (1995) Human ADP-ribosylation factoractivated phosphatidylcholme-specific phosphohpase D defines a new and highly conserved gene family J Blol Chem 270,29,640-29,643. 6 Thomas, G M. H., Geny, B , and Cockcroft, S. (1991) Identification of a cytosolit polyphosphomositide-specific phosphohpase C (PLC-86) as the maJor G-protein-regulated enzyme. EMBO J 10,2507-25 12. 7. Thomas, G. M. H , Cunningham, E., Fensome, A., Ball, A., Totty, N. F , Troung, O., Hsuan, J. J., and Cockcroft, S (1993) An essential role for phosphatidylmositol transfer protein m phosphohpase C-mediated mosnol lipid signallmg. Cell 74, 919-928. 8. Cunnmgham, E , Thomas, G M. H., Ball, A., Hiles, I., and Cockcroft, S. (1995) Phosphatidylmositol transfer protein dictates the rate of mosnol trisphosphate production by promoting the synthesis of PIP2. Current Bcol 5,775-783 9. Kauffmann-Zeh, A., Thomas, G M. H., Ball, A., Prosser, S., Cunningham, E., Cockcroft, S., and Hsuan, J. J. (1995) Requirement for phosphatidylmosnol transfer protein m Epidermal Growth Factor signalling. Sczence 268, 1188-l 190 10 Cunnmgham, E., Ball, A , Tan, S W , Swigart, P., Hsuan, J., Bankaitis, V., and Cockcroft, S. (1996) The mammalian isoforms, PITPa, PITPb and yeast PITP, SEC14p all restore phospholipase C-mediated mositol lipid signallmg m HL60 cells and RBL-2H3 cells. Proc Nat1 Acad Scl. USA 93,6589-6593 11 Tatham, P. E. R. and Gomperts, B. D. (1990) Cell permeabihsation, m Pepttde Hormones-A Practzcal Approach (Siddle, K. and Hutton, J. C , eds.), IRL, Oxford, pp. 257-269. 12. Fensome, A., Cunningham, E , Prosser, S., Tan, S. W., Swigart, P., Thomas, G., Hsuan, J., and Cockcroft, S. (1996) ARF and PITP restore GTPyS-stimulated protein secretion from cytosol-depleted HL60 cells by promoting PIP2 synthesis Current Blol 6,730-738
13 Two-Hybrid
Analysis
of Ras-Raf Interactions
Linda Van Aelst 1. Introduction The yeast two-hybrid system (I) is a genetic method that enables the experimentor to determine whether two proteins can form complexes within yeast cells. The method comprises expressmg the protems of interest as “hybrid” proteins, one fused to a DNA-binding domain and the other protein fused to a transcription-activating domain. If the fusion protems interact, a reporter gene IS transcribed (see Fig. 1). The two-hybrid system has been shown to have numerous useful applications. It can be used to detect interactions between candrdate proteins whose cDNAs are available by constructmg the appropriate hybrids and testing for reporter-gene activity. If an interaction is observed, the minimum domain required for interaction can be determined by creating deletions withm the DNA encoding one of the interacting protems. Furthermore, point mutations can be assayed to identify specific ammo acid residues critical for interaction. A very powerful application of the two-hybrid system IS the ability to rapidly isolate novel genes encoding proteins that associate with a known protein of interest. The two-hybrid system can also be employed as a tool to evaluate the biological significance of the interaction between two proteins and to dissect the roles played by proteins that have multiple functions. The different applications of the two-hybrid system will be described in detail in Subheading 3. A variety of versions of the two-hybrid system exist, commonly involving DNA-binding domains that derive from the yeast Saccaromyces cerevwzae GAL4 protein or the Escherichia coli LexA protein. In the system originally described by Fields and Song (I), one plasmid encodes the DNA-bmdmg domain of the GAL4 transcription factor (GBD) fused to the N-terminus of a protein of mterest. The other plasmid encodes the From
Methods
m Molecular Bology, Vol 84 Edlted by D Bar-Sag1 0 Humana
201
Transmembrane Slgnabng Press Inc , Totowa, NJ
Protocols
202
Van Aelst
His- and white Binding
site
TATA
B OFF
His- and white Binding
site
TATA
Binding
site
TATA
C His+ and blue
Fig. 1. The two-hybrid system. (A) The hybrid of the DNA-binding domain (BD) and protein X does not activate transcription if protein X does not contain an activation domain. (B) The hybrid of the activation domain (AD) and protein Y does not activate transcription because it does not localize to the DNA-binding site. (C) Interaction between proteins X and Y brings the activation domain into close proximity to the DNA-binding site and results in transcription of the reporter genes: L&Z and HZS.3. GAL4-activation domain (GAD) fused to the N-terminus of a second protein. The two plasmids are introduced into a yeast strain that is deleted for the GAL4 and GAL80 genes and contains two reporter genes, HIS3 and lac.2, that are under control of GAL4-binding sites. The separately expressed domains of the GAL4 proteins are unable to activate transcription of the reporter genes unless the two proteins of interest are able to interact. In a modified two-hybrid system, described by Hollenberg and Weintraub (2), one plasmid encodes the LexA DNA-binding domain (LBD) fused to the N-terminus of a protein of interest. The other plasmid encodes the VP16activation domain fused to a second protein. In our hands, the GALA-activation domain functions as well as the VP16-activation domain in this system. The two plasmids are introduced into a yeast strain containing two reporter genes, HIS3 and Lad, that are under control of LexA-binding sites. The tester strain used in this system can be GAL4+.
Analysis of Ras-Raf Interactions
203
We have made use of both two-hybrid systemsto demonstrate that Ras forms a complex with Raf (3), to provide genetic evidence for the physiological importance of the Ras-Raf interactron (4,5), to isolate novel Ras-binding partners (5) and to identify complementary Ras mutants that have different downstream actrvrtres m mammahan cells (4-6) (see Tables 1 and 2). 2. Materials 2.1. Media 2.7.1.
Yeast Growth
1 YPD medium. Bacto-yeast extract (1%) (log/L), Bacto-peptone (2%) (20 g/L) [Bacto-agar (2%) 20 g/L for plates only]. Add 950 mL of water. Adjust pH to 6.0, autoclave, and cool to 55°C Add glucose to 2% (50 mL of a sterile, 40% stock solution per liter). 2 SD medium: Bacto-yeast nitrogen base without ammo acids (0.67%) (6 7 g/L), Drop-out mix (0.2%) (2 g/L), [Bacto-agar (2%) 20 g/L for plates only] Add 950 mL of water Adjust pH to 6 0, autoclave, and cool to 55’C Add glucose to 2% (50 mL of a sterile, 40% stock solution per liter) Drop-out mix. is a combmatton of the followmg mgredients minus the appropriate supplement It should be mixed very well by turning end-over-end for at least 15 mm. Ingredrents. adenme (0.5 g), alanine (2.0 g), argmme (2.0 g), asparagme (2 0 g), asparttc acid (2.0 g), cysteme (2 0 g), glutamme (2 0 g), glutamtc acid (2.0 g), glycme (2.0 g), htsttdme (2.0 g), mosrtol (2.0 g), tsoleucme (2 0 g), leucme (10 0 g), lysme (2.0 g), methiomne (2.0 g), phenylalanme (2.0 g), prolme (2.0 g), serme (2.0 g), threonme (2.0 g), tryptophan (2.0 g), tyrosme (2.0 g), uracrl (2.0 g), valine (2 0 g) In some cases, addmon of 3-ammo- 1,2,4-triazole (3-AT) (20-30 m&Z) to the SD-medium IS required (see Subheading 3.). Make a stock solution of 1 M 3-AT (Sigma # A-8056). Filter sterrhze, do not autoclave.
2.1.2. Bacterial Growth 1 Lurta-Bertam
(LB) broth bacto-tryptone
(10 g/L), bacto-yeast
extract (5 g/L),
NaCl (5 g/L), agar (15 g/L for plates). Adjust to pH 7 0 with 5 IV NaOH. Autoclave 2. LB Amp: Prepare LB broth, autoclave, cool to 50°C, and add ampicilm to 50 pg/mL. 3 M9 medium: 10 X M9 salts (100 mL), water (887 mL), agar (15 g), Autoclave, then add* 10 mL of 20% glucose, 1 mL of 100 mM CaCl,, 1 mL of 1 M MgS04, and 1 mL of 1 M thiamine-HCl. 10X M9 salts 1s made by dissolvmg the followmg salts m water to a final volume of 1 L. Na2HP04 (58 g), KH2P04 (30 g), NaCl (5.0 g), NH&l (10 0 g)
204 Table 1 Two-Hybrid
Van Aelst Plasmids
1 GAL4-based
(see also Fig. 2)
system
Cloning vectors
Descrrptron
pGBT9, pGBTI0, and HP5 pGADGH and pGAD1318
GAL4( 1- 147) DNA-bmdmg domam, TRPI, amp’ GAL4(768-881) activation domain, LEU2, amp’
Size
Ref.
-5 4 kb
3, 7
-7 2 kb
398
2 Lex A-based system Cloning vectors pBTMll6, LexVJlO, and LexVJl 1 pGADGH and pGAD I3 18 VP16
Descrtptron LexA DNA-binding TRPI, amp’ GAL4(768-88 1) actrvatron domain LEU2, amp’ VP16 activation domain, LEU2. amn’
Size
Ref
-5 5 kb
739
-7 2 kb
338
-7.5 kb
10
2.2. Yeast Transformation 1 0.1 M LtOAc, TE (pH 7 5) 0 1 M llthmm acetate (LiOAc) (Sigma # L-6883), 10 mM Trts-HCl, pH 7 5, 1mM Na, ethylenedramme EDTA 2 40% PEG 3300,O 1 M LiOAc, TE (pH 7.5): Autoclave a stock solutron of 44% polyethylene (PEG) 3300 and add l/10 volume of sterrle solutron of 10 mM Na, EDTA after it cools 3 TE (pH 7 5). 10 mM Tris-HCl, pH 7.5, 1 mM Nar2 EDTA 4 10 mg/mL Carrier DNA Purchase sheared and denatured herring-testes DNA from Clontech (# K1606-1) or prepare using a standard method (13). Dissolve lg of salmon-sperm DNA (Sigma type III sodmm salt) m 100 mL of TE, pH 8.0 Leave overnight at 4°C on mild-magnettc stirring because it takes some time to get the DNA mto solutton If necessary, further dtssolve the DNA by drawing it up and down m a lo-mL prpet Fragment the DNA by somcatton with four bursts of 20 s with the somcator set at moderate power Extract the solution with 1 vol of phenol/chloroform The DNA m the aqueous phase is precipitated with 2 5 vol of me-cold ethanol, collected by centrtfugation, and dissolved m TE, pH 8.0, to a final concentratton of 10 mg/mL The solution 1s then boiled for 10 mm and stored at small ahquots at -20°C
2.3. /?-galactosidase-Filter
Assays
1 Z buffer Na,HPO, 7H20 (16.1 g/L), NaH,PO, Hz0 (5.5 g/L), KC1 (0.75 g/L), MgSO, 7 Hz0 (0.246 g/L). Adjust pH to 7.0 and autoclave. 2. X-gal stock solution Dtssolve 20 mg of 5-bromo-4-chloro-3-mdolyl-b-n-galactopyranoside(X-gal) (Boebrmger# 745 740) m 1mL N,N-drmethylformamrde(DMF). Store at -20°C m the dark
Analysis of Ras-Raf interactions
205
Table 2 Yeast Strains 1 GAL4-based
system
Stram HF7c
Genotype Mata, ura3-52, hls3A200,lys2-801, ade2-101, trpl-901, leu2-3,112, ga14-542, gal 80-538, LYS2 GALl-HIS3, URA3 (GAL4 I 7-mersJ3CYCl-1acZ
Reporters
Ref
HIS3 LacZ
11
2 Lex A-based system Strain L40 JCl
Genotype Mata, hls3A200, trpl-901, leu2-3,112, ade2 LYS (lexAop),-HIS3, URA3 (lexAop)s-LacZ Mata, leu2, ade2, wa3, trpl, hls3,lys2
Reporters
Ref.
HIS3 LacZ
10 12
3 Z buffer/X-gal solutton: This solution should be prepared fresh as needed. To 100 mL-Z buffer add* 270 PL P-mercaptoethanol (Sigma cat. no M-6250), 1.67 mL of X-gal stock solution. 4. Whatman no, 50 90 mm (cat, no 1450 090) and 125mm (cat. no. 1450 125). 5 Whatman no 3 90 mm (cat no 1003 090) and 125mm (cat. no 1003 125).
2.4. P-galactosidase-Liquid
Assays
1 Z buffer (see preceding section) + P-mercaptoethanol (270 /,tL/lOO mL) 2 o-nitrophenyl P-n-galactopyranoslde (ONPG). 4 mg/mL of ONPG (Sigma no N-l 127) m water. 3. 0.1% (w/v) Sodium dodecyl sulfate (SDS) 4. 1 M Na&?Os.
2.5. Plasmid Isolation
from Yeast
1. Yeast-lysts buffer 2% Trtton, 1% SDS, 100 mM NaCl, 10 mM Trts-HCl, pH 8.0, 1 0 mM EDTA. 2. Phenol/Chloroform/isoamyl alcohol (25/24/l). 3. Acid-washed glass beads (Sigma no. G-8772; 425-600 pm).
4 3MNaOAc. 2.6. Isolation
of Proteins
from Yeast
2X Laemmli Sample buffer: 10% P-mercaptoethanol (1 mL BME/lO mL), 6% SDS (6 mL 10% SDS/10 mL), 20% glycerol (2 mL glycerol/l0 mL), 1/40X stacking buffer (100 mL stacking buffer/l0 mL), 0.2 mg/mL bromopheno1 blue (400 mL of 10 mg/mL BPB).
Multi-cloning
site sequence
Multi-cloning
for:
site sequence
for:
pBTMl16 GAA l-K CCG G$Xi ATC CGT CGA CCT GCA GCC EcoRl Smal BamHl Sal1 Pst1
GAA TTC CCG GGG ATC CGT CGA EcoRl Smal BamHl Sal1
pGBTl0
pLexVJl0
GAA TTC GGA TCC CAT ITA SWd EeoRl BarnHI
AAT GTC GAC CTG CAG CC Sal1 Pstl
pLexVJl1
GAA TTA ATT CCCGGGGATCCS;TCGACCTGCAGCC Sal1 PSI 1 Smal BamEl
CAA EcoRl
5’ end 3’ end
Fig. 2. Two-hybrid
GCC
GAA TTC GGA TCC CAT TTA AAT GTC GAC CTG CAG Pstl Swal Sal1 F.coRl BamHl
HF5
5’ end 5’ CAG CAT AGA ATA AGT GCG-3’ and 3’ end 5’ GTA ATA CGA t-K ACT ATA GGG C
CCT GCA PU I
plasmlds
GCG GAT CCA Tl-l- AAA BamEl SW1
TCCg TCG ACC TGC ACi Pst I Sal1
5’ C-l-I CGT CAG CAG AGC TTC 3’ ATA ACT TAT ‘ITA ATA ATA
Multi-cloning
site
sequence
for:
DGADGH
mcs
GAA CTA GTG GAT CCC CCG GCjC TGC AGG AAT TCG ATA TCm BamHl SWil Psr 1 EcoRl EcoRV Spel TTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAAT Clal Sal1 Xhol Apal
Kpn 1
W-1318 GA-C
WA Spel
5 end 3’ end
ATT C-IT GGA TCC GCG GCC GCT CGA G EcoRl BamHl Not1 Xbol
5’ ACC ACT ACA ATG GAT GT and 5’ 1TG TAA AAC GAC GGC CAG
Fig 2 (cont’d)
208 3. Methods 3.1. Monitoring
Van Aelst
Interactions
Between Known Proteins
Both the GAL4- and LexA-based systems have been used successfully to detect interactions between two proteins. The LexA- and GAL4-based systems each have different properties that must be considered before selecting a system (see Note 1).
3.1.1. Construct/on of Plasmids and Controls If the GAL4-based system is used, insert the DNA encoding one of the proteins mto the polylmker of the GBD-fusion vector, and the DNA codmg for the other protein mto the polylmker of the GAD-fusion vector to make m-frame protein fusions (see Fig. 2). Introduce the GBD and GAD fusron vectors into the yeast tester strain, HF7c. If the LexA-based system is used msert the DNA encoding one of the proteins mto the polylmker of the LBD-fusion vector (see Fig. 2) and the DNA coding for the other protein m the polylmker of the GAD-fusion vector Introduce the LBD and GAD fusion vectors mto the yeast-tester strain, L40. To verify that cDNAs are inserted m frame, DNA sequencing can be performed usmg DNA bmdmg or activation domain junction primers (see Fig. 2). For each interaction tested, appropriate controls should be mcluded (see also Note 2). It is critical to test whether the DNA binding domam and activationdomain fusion proteins do not autonomously activate the reporter genes. Therefore, each plasmid encoding the DNA-binding and activation-domain hybrids should be cotransformed with control plasmids. Frequently, pGBD-lamm (or pLBD-lamm) are used as controls for GAD-fusion constructs; and pGADlamm for GBD (or LBD) fusion constructs. Instead of lamm, any protein unrelated to your protein of interest can be used. It is important to note that unfused LexA from pLBD can not be used as control plasmid because it gives background activity. Hence, fusions to LexA will abolish this background It is advisable to mclude as positive control two proteins previously shown to interact m the two-hybrid system (such as Ras and Raf), to ensure that the assay to evaluate interaction 1s working properly. For introduction of DNA into yeast, follow the yeast transformation procedure described below.
3.1.2 Yeast Transformation The following protocol et al. (14) and 1s applicable
1s a modification of the method described for both yeast strains HF7c and L40.
by Ito
Analysis of Ras-Raf 3.1.2.1.
interactlons
209
MAKE COMPETENT YEAST CELLS
1. Inoculate a yeast colony mto 10 mL of YPD and grow overnight at 30°C with shaking. 2. Transfer the overnight culture into 100 mL YPD and incubate the culture at 30°C with shaking at 230 r-pm untrl an OD6s0 of 0.5-0.8 IS reached 3. Centrifuge the cells at 1500~ for 5 mm at room temperature 4 Discard the supematants and resuspend the pellet in 25-50 mL of 0 1 M LiAc m TE. 5. Centrifuge the cells again (as in step 3) and resuspend the washed cells m 1 mL of 0.1 M LiAc m TE. 6 Incubate the cells for 1 h at 30°C with shaking at 230 ‘pm. The cells are now
competent for transformation. One mrllllner
of cells 1ssufficient for 10 mdepen-
dent transformations If more transformattons culture mto a larger volume of YPD.
are required, transfer the overnight
3.1.2.2.
TRANSFORM COMPETENT YEAST CELLS
1. Add 100 pL of competent yeast cells for each transformation mto a 1.5-mL microcentrifuge tube. 2 Add the plasmid DNAs (approximately 0.5 to 2 p.g of each plasmid) and 100 pg of sheared, denatured salmon-sperm DNA to 100 pL of competent yeast cells and mix. 3. Add 600 pL of sterde PEG/LiAc solutton to each tube and mix well by inversion. 4. Incubate at 30°C for 30-60 min (shakmg is not required). 5. Heat shock for 15-30 mm m a 42°C water bath. 6. Pellet the cells by centrifugatton for 15 s m a microcentrtfuge. 7. Remove the supematants and resuspend the cells m 100 /.tL of sterile TE 8 Spread onto 100 x 150-mm plates containmg the appropriate SD medium (SD-Leu-Trp). 9 Incubate plates at 30°C until colonies appear (usually 2-4 d).
3.1.3. Assays to Evaluate Interaction Yeast colomes are replica plated directly (or first picked wrth sterile, flat toothpicks from transformatton plates and spread as small patches on SD-LeuTrp plates and then replica plated) on SD-Leu-Trp-His plates and on frlterpaper circles (90-mm Whatmann #50) placed onto SD-Leu-Trp plates. The plates are incubated at 30°C for l-2 d. Monitor growth of transformants on Do-Leu-Trp-His plates and perform a P-galactosrdase filter assay (15), as described below. 3.1.3.1.
P-GALACTOSIDASE FILTER ASSAY
1 Allow the yeast colonies or yeast patches replica plated on Whatmann #50 filter paper to grow overnight
210
Van Aelst
2. Remove the filter paper from the plate and permeabtlize the yeast cells by freezmg the filter paper m hqurd nitrogen (about 20 s) 3. Place the filter paper carrying the permeabrhzed-yeast cells (yeast cells facmg up) mto a Petri plate contammg a second filter-paper circle (90-mm Whatmann #3) that has been soaked m a Z buffer/X-gal solution (2 5 mL Z buffer/X-gal solution per Petri plate) 4 Incubate at 30°C and check perrodically for the appearance of blue colonies. Strong posmves may appear blue as soon as 30 mm, whereas weaker posrtrves may take up to 10 h to turn blue 3.1.3.2.
LIQUID CULTURE P-GALACTOSIDASE ASSAY
The liquid activity
culture assay IS used to quantify
by measuring
the generation
the P-galactosldase
of the yellow
(ONP) from the colorless substrate ONPG
compound
enzymatic o-nitrophenyl
(16)
1 Inoculate a yeast colony m selective media (SD-Leu-Trp) and grow overnight with shaking 2. The followmg day, dilute 5- to lo-fold mto 5 mL fresh medium and incubate further until OD,,, is approx 0.8-I. 3 Record the OD,,, for 1-mL samples taken from each culture 4. Transfer three ahquots of 1 mL to 12 x 75-mm polypropylene tubes and pellet the cells by centrrfugatron 5 Discard the supernatants and add 1 mL of Z buffer to each tube. Include triphcate 1-mL ahquots of Z buffer without cells as control 6 Add 50 pL of CHCl, and 50 PL of 0.1% SDS to the tubes and vortex vigorously for 10 s to resuspend and lyse the cells 7 Prewarm the samples to 30°C for 5 mm and add 0 2 mL of ONPG solutron to each tube 8. MIX the solutions by quick vortexmg and incubate the reactions at 30°C The time of mcubatron depends on the speed with which color develops (between 10 mm and 6 h). If color develops quickly, the reaction should be stopped, because depletion of the ONPG substrate may reduce the lmeartty of the reactton. 9 Stop the reaction by adding 0.5 mL 1 M Na&Os followed by quick vortexmg. 10. Centrifuge the samples to spm down the cell debris and remove 1 mL of each sample to a disposable cuvet. Determine the OD at 420 for each of the samples 11 P-galactostdase actrvity is calculated using the followmg equation: Activity
(in U) = lOOO[(OD,,,
- OD,,,,,)]
/ (tV OD600]
where OD,,, is adsorbance at 420 nm of the sample; ODblank is adsorbance at 420 nm of the triplicate blanks, t is time of incubation; V is the volume (mL) of mmal cells ahquoted, and OD,a, 1s cell density of the culture
Analysis of Ras-Raf
Interactions
3.1.4. Further Characterization Between Two Proteins
211 of the Interaction
The two-hybrid system can be used to define the mmlmal domain of mteraction by assaying protein fragments for their ability to bind to their partner. This allowed us to demonstrate that the N-terminus of Raf 1s sufficient to interact with Ras (3). DNA fragments encoding portions of the interacting protein can be generated by restriction enzyme digestion or by PCR and these can be cloned m the appropriate vectors. It is important to note that the GBD and LBD vectors do not have a stop codon, while the pGAD vectors have stop codons m all three frames. For identifying specific ammo acid residues in a protein of interest essential to interact with its partner, a library of hybrid proteins containing point mutations can be screened for mutants that have lost their ability to interact with their partner as described in Subheading 3.3.
3.2. Two-Hybrid
Screens
We used the two-hybrid system to screen two-hybrid libraries for Rasbinding partners. In particular, we screened libraries in which cDNA inserts were fused to the carboxyl terminus of the trans-actlvatmg domain of GAL4 to fmd genes coding for proteins that could interact with either Ras fused to the GBD or the LBD (5). Some of the cDNAs we isolated encoded members of the Raf family. In addition, five other genes were Identified, each multiple times (5). Below are given the different steps to perform a two-hybrid screen.
3.2.1. Characterizing the Target Protein The first step in a two-hybrid screen is to construct a protein in which the LBD or the GBD is fused to the protein of interest. In some cases, it can be useful to use a particular domain or mutant form of the target protein to perform the screen. The use of a particular domain or mutant form of the target protein can result in a stronger interaction than otherwise could have been missed if the full-length target protein was used. A series of control expenments need to be performed first to establish whether the construct is suitable as is or needs to be modified. 1, The target protem must not autonomously activate the reporter genes (HIS3 or LacZ) when fused to GBD or LBD. Therefore, when the target plasmld is introduced alone or in combmatlon with control plasmids such as pGADGH or pGADlamm, the strains that contam the target plasmid alone or together with the control plasmids should not grow in the absence of hlstldme and should not contain
212
Van Aelst detectable P-galactosidase activity. Test the extent of nonspeciftc acttvation of the reporter constructs by the target plasmtd as outlined: a Introduce the target plasmid (GBD-target or LBD-target) alone or together with control plasmid m the yeast strains HF7c and L40 respectively, using the transformation protocol described m Subheading 3.1.2. Plate the transformed yeast on SD-Trp or SD-Leu-Trp plates (target alone or target with control plasmid, respectively) and incubate the plates at 30°C for 2-3 d b Replica plate transformants on SD-Trp-Hts or on SD-Leu-Trp-Hts plates and on a filter paper circle (Whatmann #50) placed onto a SD-Trp or SD-Leu-Trp plates (target alone or target with control plasmid, respectively) The plates are incubated at 30°C Momtor growth on SD-Trp-His or SD-Leu-Trp-His plates and perform a P-galactosidase filter assay as described m Subheading
3.1.3. A suitable target ~111not enable the yeast to grow m the absence of htstidme and the yeast contammg thts target will not express detectable P-galactosidase activity If activatton is observed, addition of 3-aminotriazole (between 10 and 40 mM) may be sufficient to reduce the background signal so that the target can be used. Alternatively, it may be posstble to delete the activating regions from the target molecule before using m the screen, 2. Before starting a two-hybrtd screen with a target, it is also highly advisable to test whether a functional-fuston protein IS made. One posstbtle way to examme expression of the target in yeast is to test for interaction between the target, and a known partner prevtously shown to bmd to the target. If no such partner IS avatlable, Western-blot analysis can be performed usmg antibodies agamst the target or antibodies against LBD or GBD Antibodies against LBD can be requested from Ertca Golemts (Fox Chase Cancer Center, Philadelphia, PA). Antibodies against GBD are available from Clontech (cat #5398-l). However, these antibodies give only a very weak signal when the vectors pGBT9, pGBT10, or pHP5 are used. A stronger signal can be observed when the GBD-vector pAS2 (18) is used. The protocol below can be used to extract proteins from yeast. Follow standard procedures to perform Western blot (19). Protocol for making protein extracts from yeast. a. Grow yeast cells containing GBD-target or LBD-target m 5 mL SD-Trp medium until OD6s0 = 0 5-0.6. b. Spm cells (1 mL) for 3 mm m a microcentrifuge. c Add 50 pL 2X Laemmh buffer to pellet and freeze at -70°C. d Boil 5 mm and load on gel 3. Target proteins contammg signal sequences that direct them to discretecellular compartments, such as the plasma membrane, may not enter mto the nucleus As demonstrated for Ras, modificatton of the CAAX motif, sequence responsible for membrane localization, was essential to detect interaction wtth Raf using the GAL4-based two-hybrid system and YBP2 as the reporter strain (3). Thus, modification of signal sequences present m the target may be required.
Analysis of Ras-Raf Interactions
273
3.2.2. Performmg a Library Screen A two-hybrid screen involves the introduction of both the DNA-BD target and the AD-cDNA library plasmids into a yeast-reporter strain by transformation, either simultaneously or sequentially. If the target protein is toxic to the yeast cells it is advisable to perform a simultaneous transformation, otherwise a sequential transformation can be performed. Several two-hybrid cDNA libraries are available. Based on our experience using Ras as a target in the two-hybrid screen, it is most likely that different interacting clones will be isolated if different libraries are screened. We have made use of a Hela, mouse brain, 12-d-old rat embryo, and Jurkat cDNA libraries (5). All these cDNA libraries are constructed in the vector pGADGH or pGAD1318, which contain a complete ADH promoter. We found that the libraries constructed m pGAD 10 (which contains a partial ADH promoter and therefore gives lower expression of the protein) resulted m very low yield of positive isolates. It is also a good idea to start with a library from a tissue source m which the target protein is known to be brologically relevant. To represent a mammalian-cDNA library, approx l-5 x lo6 yeast transformants need to be screened. Therefore it is very important to optimize transformation conditions before attempting a two-hybrid screen and perform first small-scale pilot transformations. The transformation protocol described m Subheading 3.1.2. produces up to 104-lo5 transformants per 1.18of plasmrd DNA. When two plasmids are mtroduced simultaneously mto the yeast-tester strain, the transformation efficiency reduces to -103-1 O4transformants per pg of plasmrd DNA. 3 2 2.1. LIBRARY TRANSFORMATION 1. Grow a lo-mL culture of HF7c (or L40) containing GBD-target (or LBD-target) in SD-Trp medium overmght at 30°C. For stmultaneous cotransformatton, grow a 10 mL culture of HF7c (or L40) m YPD overnight. 2 In the morning, transfer the overnight culture mto 600 mL SD-Trp medmm (or YPD for stmultaneous cotransformatlon) and incubate the cells at 30°C until an OD600 of -0.5-O 8 1s reached 3. Centrifuge and wash the yeast cells with 300 mL 0 1 M LtAc m TE as described in Subheading 3.1.2. (steps 3 and 4). Resuspend the cells m 6 mL 0.1 M LlAc m TE and transfer into a 50-mL conical tube Incubate for 1 h at 30°C with shaking at 230 rpm 4a. Altquot 100 mL of competent yeast cells mto 60 mlcrocentrtfuge tubes Add 1 mg library DNA and 50 mg sheared, denatured salmon sperm DNA and 600 mL of PEG/LIAc solution to each tube Invert the tubes several times to mix thoroughly. (For stmultaneous cotransformatton, 0.5 to 1 mg of GBD-target [or LBD-target] plasmtd IS added )
214
Van Aelst
4b Alternatively, a large-scale transformation can be performed. Add 60 pg library DNA, 3 mg sheared, denatured salmon sperm DNA (and 30 yg of target plasmid for simultaneous transformation), and 36 mL of PEG/LiAc to the 6 mL of competent yeast cells. Invert the tube several times to mix thoroughly. We experienced, however, that transformations m small ahquots provide significantly better transformation efficiency than scaled-up versions. In addition, doing transformations m small ahquots reduce the likelihood of contammation It is important not to use an excess of plasmid library DNA smce each competent yeast cell can take up multiple plasmids, which would comphcate subsequent analysis. 5. Incubate for 30-60 mm at 30°C and heat shock for 30 mm m a 42°C water bath. 6. Pellet the cells by centrifugation for 15 s m microfuge and resuspend cells m 100 FL of TE. (For large-scale transformation* pellet cells by centrifugation at 1OOOg for 5 mm and resuspend cells m 6 mL of TE.) 7 Plate 200 FL of competent cells on large (150 x 150-mm) SD-Leu-Trp-His plates Save one ahquot of 100 pL of competent cells to estimate transformatron efficiency. To estrmatethe efficiency, make a seriesof l/10 dilutions m sterile water and plate on large SD-Leu-Trp plates. The dilution series~111allow an accurate estimation of the number of transformantsobtained and will give an idea whether additional transformations are required to obtain l-5 x lo6 clones (if a mammalian cDNA library is used). 8. Incubate all plates at 30°C After 3 d, some HIS+ colonies may be visible, but keep the plates up to 8 d at 3O”C, to allow slower growing colomes to appear. Addition of 3-AT to the yeast plates is not required if using Hf7c or L40 as tester strains. Other strains might require addition of 3 AT (between 10 and 40 mM) to reduce the background. Addition of 3-AT to the media slows down the growth of yeast and thus a longer incubation time is required. 3 2.2.2. TEST FOR GAL DEPENDENCY 1. Ptck the His+ colomes with toothpicks and spread as small patches on a small SD-Leu-Trp-His plate (100 x 150-mm). Replica plate the yeast patcheson a filter paper circle (Whatmann #50, 90-mm) placed on a small SD-Leu-Trp plate (In case a lot of His+ colomes are obtamed, the transformants may be replica plated directly on large Whatmann #50 filter paper placed on 150 x 150-mm SD-LeuTrp plates ) 2. Perform a P-galactosidasefilter assay asdescribed m Subheading 3.1.3. 3 Evaluate the appearanceof blue colonies (up to 10 h), pick the correspondmg positive colonies from the origmal plates and transfer them to fresh SD-Leu-TrpHis plates. 4 Inoculate the yeast cells in 2 mL SD-His liquid medmm. Grow the yeast for 2 d at 30°C with shakmg and plate 50 yL of the yeast cells (1000 times diluted) on SD-Leu-Trp plates. Reassaycompletely isolated colonies to verify the P-galactosidasephenotype Step 12 is advisable, but not essential. Yeast cells can take up multiple plasmids Growth m SD-His medium will result m lossof AD/library plasmids which do not interact with the target
Analysis of Ras-Raf lnteractlons 3.2.2.3.
ASSESS POSITIVE H/S3+
215
hcZ+ COLONIES WITH SPECIFICITY TESTS
True positives should interact specifically with the orlgmal target, but not with other unrelated fusion proteins (see Notes 3 and 5). To eliminate false positives and to identify clones of interest, the followmg two procedures can be followed: 1 Isolation of AD/library plasmlds from posltlve clones and retransformation m yeast contaming either the target plasmld or a control plasmld. a. Plasmld lsolatlon of yeast cells This procedure 1s based on the methods of Hoffman and Winston (20) and Kaiser and Auser (21) i Grow the positive clones overnight m an mlcrofuge tube containing 1.5 mL SD-Leu-Trp media ii. Collect the cells by a 30 s centrlfugatlon m a mlcrofuge iii. Decant the supernatant and briefly vortex the tube to resuspend the pellet m the residual liquid. iv Add 200 FL lysls buffer, 200 pL phenol/chloroform/lsoamyl alcohol (25/24/l), and 0.3 g of acid washed glass beads. Vortex for 2 mm v Centrifuge at 14,000 rpm for 5 mm and transfer the supernatants to a clean mlcrofuge tube. vi. Precipitate the DNA by adding 2.5 volumes of ethanol and l/10 volume of 3 M NaOAc, pH 5 2 Wash with 70% ethanol, dry, and resuspend m 30 PL of sterile water b. Transformation of plasmids m leuB- E colz strain MH4 (22) and HB 101 (BRL) have a defect m the 1euB gene, which can be complemented by the LEU2 gene of yeast. This strain is useful to dlstmgulsh the library plasmld, which carries the yeast LEU2 marker, from the target plasmld 1. Transform competent MH4 or HBlOl cells (using standard chemical transformation procedures or electroporatlon [13]) with the isolated DNA and plate on LB/amplclllm plates. We experienced that for transformation of E colz with plasmlds isolated from yeast, electroporatlon yielded the highest transformation efficiency 11. Replica plate on M9 medium Pick three colonies able to grow on M9 media and inoculate m 1.5 mL LB/amplcllhn media (see Note 4). Isolate plasmlds using a standard mml-prep procedure (13) c Transformation of recovered plasmids m the yeast tester strain 1 Retransform the isolated plasmlds mto the yeast host strain (HF7c or L40) in combmatlons with the target plasmld (GBD-target or LBDtarget) and with control plasmids. As control plasmids, LBD-lamm and GBD-lamm are often used m the LexA and GAL4-based system respectively. Piate transformants on SD-Leu-Trp plates II. Assay transformants for growth on SD-Leu-Trp-His and for fi-galactosldase activity. 2. “Cure” the AD/library plasmld of the target plasmld and mate to a tester strain containing either the original target or control plasmld.
216
Van Aelst a. Plasmid segregation to remove orlgmal target plasmld 1 Inoculate 2 mL of SD-Leu with His+LacZ+ transformants Grow for 2-3 d at 30°C. 11 Plate 50 yL of a 1: 10,000 dilution of the 2-3 d culture on DO-Leu plates and incubate plates for 2 d at 30°C. in. Replica plate the SD-Leu plates from step two, first to fresh SD-Leu and then to SD-Trp plates. Incubate for 2 d at 30°C Transfer colonies that grow on SD-Leu, but not on SD-Trp plates to 1 mL SD-Leu medium These colomes (Leu+Trp-) have segregated the target plasmld. b. Mating assay. 1. Transform a yeast strain, contaimng the opposite mating type of the tester strain used to perform the screen, with the original target plasmid and with control plasmids using the protocol described m Subheading 3.1.2. Plate the transformants on SD-Trp plates. The strain JCl can be employed when L40 is used as tester stram for the screen. We have not tested mteraction specificity by mating using the GAL4-based system In this case, a yeast strain has to be used that possesses the opposite matmg type and is ga14- (see ref. 18) il. Inoculate 10 mL of SD-Trp with JCl containing the original target plasmid (LBD-target) and JCl containing control plasmlds (such as LBDlamm) and grow for l-2 d at 30°C. iii Spot 2 pL of each of the JCl strains on YPD plates m an orderly grid. Overlay each of the JCl strains with 2 j.tL of each hbrary clone segregant (from step 3). Grow overnight at 30°C. IV Replica plate to SD-Leu-Trp plates to select for dlploids. v After 2 d, replica plate to SD-Leu-Trp-His plates to test for transactlvatlon of the histidme reporter construct, and to a filter-paper circle (Whatmann #50) placed onto a SD-Leu-Trp plate for P-galactosldase filter assays.
3.3. Evaluate the Biological Significance of the Interaction Between Two Proteins It can be a major task to define the biological role of a novel protein, Isolated in a two hybrid screen, which does not show any homology with characterized proteins or motifs in the database. We previously employed a genetic approach, using two-hybrid interactions, to provide genetic evidence for the physiologlcal importance of the Ras-Raf interaction in transformation (45). We created a mutant Ras library by PCR mutagenesis and looked for mutants that abolished binding to Raf but still interacted with other Ras interacting protems. One of these mutants, Ras (V12, G37), failed to induce foci of NIH-3T3 cells. Subsequently we looked for Raf mutants that restored binding to Ras (V12, G37). These mutant Rafs could cooperate with Ras (V12, G37), m the mductlon of transformed foci, mdlcatmg the importance of Ras-Raf interaction for
Analysis of Ras-Raf
Interactions
217
transformation. The approach, described below, can be used more generally to evaluate the biological significance between two proteins. 3.3.1. Screening for Mutations That Affect Bin&g of Target Protein to Its Partner and Testing for Altered Phenotype of the Mutant Target Protein 3.3.1 1. CONSTRUCTION OF MUTANT TARGET LIBRARY Several methods can be employed to construct a mutant library of the protein of interest. We created a mutant Ras library by PCR mutagenesis (see below), taking advantage of the inherent nucleotide mismcorporation of Taq polymerase as described by Zhou et al. (24). 1. A DNA molecule contammg the DNA sequence of interest is subjected to 30 PCR cycles usmg the following conditions: reaction volume: 200 l.tL, reaction composition: 10 mM Tris-HCL, pH 8.3, 50 mM KCL, 1.5 mM MgC12, 50 l.r~V each dNTP, 2 fmol template, 30 pmol each primer (the primers used should contam restriction enzyme sites suitable for directional clonmg in the GBD or LBD two-hybrid vectors) and 5 U AmpliTaq DNA polymerase (Perkm Elmer Cetus), cycle profile: 1 mm 94”C, 2 mm 59’C, 3 min 72°C 2. Digest the amplified DNA and hgate mto restriction endonuclease digested GBD or LBD two-hybrid vectors to create m frame fusions with the GAL4 or LexA DNA-binding domain. 3. The resulting recombinant DNA molecules are introduced into E. colr cells (DHIOB or DHSol) by transformation or electroporation and plated on LBamp plates The transformants are pooled together, resuspended m 500 mL LBamp and grow for 6 h with shaking at 37’C 4. Isolate plasmid DNA using qiagen or CsCl gradient purification (13). It is important for this type of screen that a fully representative library is made. According to Zhou et al. (24) for a template which is 633 bp in length, the emperically determmed percentage of mutant templates generated after 30 PCR cycles at a starting concentration of 2 fmol is 35%. Our approximate estimation for the frequency of transversions is 5% of all mutations and we estimate A to G and C to T transitions to occur on average 3-10 times more frequently than transversions.
3.3.1.2. LOOKING FOR TARGET MUTANTS 1 Introduce the hbrary of mutant target genes fused to GDB (or LBD) (step 4) together with its partner fused to GAD m the yeast strain HF7c (or L40) using the transformation protocol described m Subheading 3.1.2. Plate the transformants on 150 x 150-mm SD-Leu-Trp plates. 2. Place a sterile 125-mm Whatmann #50 filter over the surface of the agar plate contammg the transformants Perform a filter P-galactosidase assay as described in Subheading 3.1.3. 3 Pick those colomes from the filter that are white or light blue, restreak them on a fresh SD-Leu-Trp plate and incubate the plate for l-2 d at 30°C.
218
Van Aelst
4. Isolate the GBD (or LBD) plasmtds following the protocol descrtbed m Subheading 3.2.2.3., however, m thts case ptck colonies able to grow on LBamp but not on M9 plates, because the GBD and LBD vectors contain a Trp marker 5 Retransform the isolated plasmtds from step 8 with the novel partner (and tf available other proteins previously shown to interact with the target) and assay transformants for P-galactostdase activity 6. Select those mutants of the target that do not or very weakly bmd to the novel partner (but retam then abthty to bmd to other proteins known to interact with the target, assurmg that a functtonal protein IS made). Alternatively, test for expression of the mutant target protein by Western blot analysts. Subject these mutants to sequence analysis 3.3.1.3. TESTINGFORALTEREDPHENOTYPEOF THEMUTANTTARGETPROTEIN
Test the mutant target proteins for altered phenotype. For example, to explore the phenotype of the Ras (37G) mutant that IS unable to interact with Raf m the two-hybrid system, we mtroduced the activating mutation G12V, subloned the Ras (12V, 37G) mutant in a mammalian expression vector and tested whether this mutant is stall able to induce foci when transfected m NIH-3T3 cells. We observed that this mutant was unable to induce foci tn NIH-3T3 cells (4,5).
3.3.2. Looking for Bindmg Suppressor Mutants of Partner and Testmg Whether the Binding Suppressor Mutants Can Restore Altered Phenoype 3 3 2 1 LOOKINGFORBINDINGSUPPRESSOR MUTANTS
1, Create a mutant library of the partner of interest (as described above) and ligate m the vector pGAD to create m frame fusions with the GAL4-acttvatton domain 2 Transform this mutant library together with the given target mutant fused to GBD (or LBD) in the yeast tester strain HF7c (or L40) Plate the transformants on SD-Leu-Trp-His 3 Test whether the His+ transformants give also blue color in the filter P-galactostdase assay. 4 Recover the GAD-fusion plasmrds from HIS+, LacZ+ colonies as described m Subheading 3.2.2.3. and retest them for their ability to interact with the given target mutant 5 Sequence these mutants that restore the ability to bmd to the given target 3 3.2 2 TESTINGWHETHERTHEBINDINGSUPPRESSOR MUTANTS CAN RESTOREALTEREDPHENOTYPE
Before exammg whether a binding-suppressor mutant can restore the altered phenotype of the given target mutant, test whether the suppressor mutant by itself cannot induce the particular phenotype. Then test whether co-expression
Analysis of Ras-Raf Interactions
219
of the binding suppressor mutant with the given target mutant can restore its altered phenotype. For example, Raf mutants which restored binding to the Ras (V12, E37) mutant were subcloned m a mammalian expressron vector and transfected alone or m combinatton with the Ras (V12, E37) mutant m NIH-3T3 cells. Only when both mutants were co-expressed m NIH-3T3 cells, foci could be observed (4,s). Lack of rescue or partial rescue by the “suppressor” mutant will leave ambrgmty as to whether other functions (bindmg to other target-mteractmg proteins), aside from its inability to interact with the target assayed, are responsible for the loss of function phenotype. Partial rescue, however, will be sufficient proof to implicate the assayed suppressor as essential for the target-protein function m the respective assay. Lack of rescue of the altered phenotype by a bmding suppressor mutant can also be explained by other reasons. For example, the mutation introduced in the target suppressor might abolish its activny or rt might disrupt its mteractron with other proteins required for this activity. A srmilar approach as described above can be used to dissect the roles played by a protein that has multiple functions, as illustrated for Ras (4--6,25). 4. Notes 1. Because the LexA and the GAL4-based two-hybrid systems have different properttes, it 1s not unreasonable to rmagme that some mteracttons mtght be detected differently m these systems. The reporter strams, L40 used m the LexA based system and the HF7c strain used m the GAL4-based system, contam a different
number of DNA bindmg sites for their respective DNA-binding
domams. The
L40 strain has more DNA-binding sites upstream of the transcrrptton start site of the HIS3 and Lad genes as compared to the HF7c strain (see Fig. 2). We expertenced the LexA based system to be more senstttve as the GAL4 based system. For example, while mteractton between STEll and STE7 could be observed usmg the LexA based system, no mteractron could be observed usmg the GAL4 based system The use of the LexA based system, however, might result m higher background Furthermore, the differences m the structure of LexA and GAL4 may result m differential conformatton of the fusion domains Thus mtght lead to detection of interactton between two proteins using one system but not the other The extent to which protein mteractron determined by two-hybrid approaches parallels the degree of mteractton determined by standard btochemrcal techniques 1s descrtbed m detail by EstoJak et al. (17). 2. A negative result m a two-hybrid system does not necessarily mean that the two protems tested do not mteract under all condmons Several explanations can be given for lack of mteractlon the fusion proteins are not expressed or are expressed at a very low level m the yeast strain used, the fusion protems fold improperly,
Van Aelst
220
the fusion proteins cannot be localized to the yeast nucleus, or the fused GAL4/LexA domains occlude the site of interaction To confirm that the fusion proteins are being expressed and that they have the expected molecular weight, a Western blot analysis using GAL4 or LexA antlbodies or antibodies against the protein of interest when available, can be performed (see Subheading 3.2.1., step 2). For localization of the proteins to the yeast nucleus, see Subheading 3.2.1., step 3. The conflguratlon of the plasmid constructs can affect the detection of mteraction between two proteins. For example, interaction between STE7 and STEl 1 can be observed when STE7 IS fused to LBD and STEl 1 to GAD. However, no interaction 1s observed when STE7 1s fused to GAD and STEl 1 to LBD, mdicatmg that the conflguratlon of the plasmld constructs may be Important for observing protein-protein mteractions If the ammo-terminal residues of one of the proteins must remam unblocked for interaction with Its partner to occur, it 1s essential to fuse the 3’ end of the protem to the 5’ end of the DNA-binding or activation domains 3 It can occur that an isolated AD/hbrary plasmld (from an original Hd LacZ+ clone 1s D-gal negative when retransformed with the target plasmtd. One explanatlon :s that the orlgmal HIS+ LacZ+ clone was transformed with multtple library plasmlds and that the plasmtd encodmg the Interacting hybrid protein was lost during the segregation process We encountered that, when using the GAL4-based system, an isolated AD/library plasmld from an original HIS+ LacZ+ clone when retransformed with the target plasmld (but not with the control plasmld) m the tester strain HF7c resulted m transformants able to grow on medium-lacking hlstldlne but showed almost no P-galactosldase activity m comparison with the original lsolate. We experienced these Isolates to be true posltlves The reason for the weak P-galactosldase activity 1s unclear It may be because of different expression levels of the hybrid proteins. 4 If a large number of posltlves are obtamed from a two-hybrid screen, it 1s a good idea to try to sort them into classes. For example, PCR amphfy the cDNA inserts m the AD/library plasmld, using AD Junction primers (see Subheading 2.), digest the product with a frequent cutter, such as Alul, and compare restnctlon-digest patterns 5 We experienced that the avallablhty of well-characterized mutants of the target 1s a useful tool for ehmmating false posltlves and identifying clones of interest For example, mutations in Ras, known to abolish binding to well-characterized effecters of Ras (5) and to guanine-nucleotlde exchange factors of Ras (23), have been ldentlfied Studymg the bmdmg profiles of novel isolated Ras-bmdmg proteins toward these mutants might give an Idea whether the novel proteins are likely to be effecters or regulators of Ras.
Acknowledgments I thank Michelle McDonough, ments on the manuscript.
Robert Luclto,
and Javor Stolarov
for com-
Analysis of Ras-Raf Interactions
221
References 1 Fields, S. and Song 0. K. (1989) A novel genetic system to detect protein-protein Interactions. Nature 340,245 2 Hollenberg, S. M , Sternglanz, R., Cheng, P. F , and Wemtraub H. (1995) Identtfrcatron of a new famtly of trssue-specific basic helix-loop-helix protems with a two-hybrid system Mel Cell Blol l&3813-3822 3 Van Aelst, L., Barr, M., Marcus, S., Polvermo, A , and Wigler, M H. (1993) Complex formation between RAS and RAF and other protein kinases. Proc Nat1 Acad Scz., USA 90,6213-6217. 4. White, M. A., Nicolette, C , Mmden, A , Polvermo, A., Van Aelst, L., Karin M , and Wigler, M. H. (1995) Multrple Ras functions can contribute to mammalian cell transformation Cell 80,533-541 5. Van Aelst, L., White, M A., and Wrgler, M. H. (1994) Ras Partners. Symp Quant. Blol 59,181-186 6. Khosravr-Far, R., White, M A , Westwick, J. K , Solskr, P A., ChrzanowskaWodmcka, M., Van Aelst, L , Wrgler, M. H., and Der, C. J. (1996) Oncogemc Ras actrvatron of Raf/MAP kmase-independent pathways 1s sufficient to cause tumongenrc transformatron. Mol Cell Blol 16, 3923-3933 7 Bartel, P L , Chien, C T , Sternglanz, R., and Fields, S (1993) Using the twohybrid system to detect protein-protein mteractrons, in Cellular Interactions In Development A Practical Approach (Hartley, D. A., ed ), Oxford University Press, Oxford, UK, p. 153 8. Hannon, G. J., Demetrtck, D , and Beach, D. (1993) Isolation of the Rb-related ~130 through Its Interaction with CDK2 and cyclms. Genes and Deveopment 7, 2378-2391. 9. Chang, E. C., Barr, M., Wang, Y., Jung, V , Xu, H-P., and Wigler, M H. (1994) Cooperatrve interaction of S. pombe protems requrred for mating and morphogemsrs. Cell 79, 13 1-14 1 10. Vojtek, A., Hollenberg, S M., and Cooper, J A (1993) Mammalian Ras interacts drrectly with the serme/threonme kmase Raf. Cell 74,205-214. 11 Feilotter, H J , Hannon, G J , Ruddell, C. J , and Beach, D. (1994) Construction of an improved host strain for two hybrid screening Nuclezc Acids Res 22, 1502-1503. 12. Colicellr, J. and Wrgler, M , unpublished data. 13 Sambrook, J., Frrtsch, E F , and Mamatis, T. (1989) Molecular Clonzng A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 14. Ito, H., Fukada, Y., Murata, K., and Krmura, A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacterlol 153, 163-168. 15 Breeden, L and Nasmyth, K (1985) Regulation of the yeast HO gene, in Cold Sprzng Symposia on Quantltatwe Bzology, vol 50, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp 643-650. 16. Miller, J. H. (1972) Experiments m Molecular Genetzcs, vol. 50, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 17 Estojak, J., Brent, R , and Golemrs, E. A (1995) Correlation of two-hybrid affinity data with in vitro measurements. Mol. Cell Bzol 15,5820-5829
222
Van Aelst
18. Harper, J W., Adamt, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. (1993) The ~21 Cdk-interacting protein Cipl 1s a potent inhrbrtor of Gl cyclm-dependent kmases Cell 75, 80.5-816. 19. Harlow, E. and Lane, E (1988) Antlbodles A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 20 Hoffman, C S. and Wmston, F (1987) A ten mmute DNA preparation from yeast efficiently releases auttonomous plasmtds for transformation of Eschemhza colz Gene 57,267-272 21 Katser, P and Auer, B. (1993) Raptd shuttle plasmtd preparation from yeast cells by transfer to E co11 Blo Techniques 14,552 22. Hall, M. N., Hereford, L , and Herskowitz, I (1984) Targeting of E colz betagalactosidase to the nucleus m yeast. Cell 36, 1057-1065. 23 Mosteller, R D , Han, J , and Broek, D (1994) Identification of resrdues of the H-ras protein crtttcal for functional mteractron with guanine nucleotide exchange factors. A401 Cell Bzol 14, 1104-l 112. 24. Zhou, Y., Zhang, X , and Ebrtght, R. H (1991) Random mutagenesis of genesized DNA molecules by use of PCR with TAQ DNA polymerase. Nucl AC& Res 19, 6052. 25. Joneson, T , White, M A., Wigler, M. H , and Bar-Sagi, D. (1996) Stimulation of membrane ruffling and MAP Kmase activation by distinct effecters of Ras Science 271,810-8 12.
14 Cloning and Mutational Analysis of the She-Phosphotyrosine Interaction/ Phosphotyrosine-Binding Domain Vijay Yajnik, Pamela Blaikie, and Ben Margolis 1, Introduction The interaction between tyrosme phosphorylated growth-factor receptors and Src Homology 2 (SH2)-domam-contammg proteins plays a critical role m growth-factor mediated slgnal transduction (I). The SH2 domains bind to receptors at phosphotyrosine residues with specificity dictated by ammo acids that lie carboxy-terminal to the phosphotyrosme. Identification of new SH2domain proteins has provided great insight into signaling by growth-factor receptors. Our work has focused on cloning new SH2-domain proteins by screening bacterial-expression libraries with tyrosine phosphorylated epiderma1 growth-factor receptor (EGF-receptor). We call this method CORT for cloning of receptor targets and the proteins isolated Grbs for growth-factor receptor bound (2-6) The clomng of Grb2 with this technique helped to elucldate the signaling pathway that leads from growth-factor receptors to Ras (7), The methodology used in the CORT technique has been previously reviewed (8,9). In this technique, a radioactive probe 1s generated using a baculovlrusproduced intracellular domain of the EGF-Receptor. This intracellular domain contains an active tyrosme kinase, and incubation of the domain with radloactive adenosme triphosphate (ATP) leads to autophosphorylation and labeling of the protein in the carboxy-terminal region. The intracellular domain 1s cut with cyanogen bromide, yielding an intact carboxy-terminus containing all the autophosphorylatlon sites of EGF-Receptor. It is then possible to clone genes encoding SH2-domain proteins by screening bacterial-expression hbraries with this radioactively labeled EGF-Receptor probe. From
Methods
m Molecular Biology, Vol 84 E&ted by D Bar-Sag1 0 Humana
223
Transmembrane S/gnaJmg Press Inc , Totowa, NJ
Protocols
224
Yajmk,
Blalkle,
and Margohs
More recently, our work has turned to screening a randomly primed hExlox library from National Institutes of Health (NIH) 3T3 cells. The advantage and disadvantages of the hExlox system have been previously described (9). This phage, which utllrzes T7 polymerase to drive protein expression, appears to give higher expression than hgtl 1 However, the plating of such libraries is more difficult. The ortgmal hExlox vector we used was obtained from Novagen (Madison, WI; where it is now replaced by XSCREEN-1 vector) or can be obtained from Amersham (Arlington, IL) as the hMOSElox vector. Because SH2 domains can be encompassed in approx 300 bases, we have generated the NIH-3T3 library using randomly primed cDNA, wherein both carboxy-terminal and amino-terminal protein domains would be equally represented. This randomly primed library was instrumental in our recent clonmg of a new domain present in the amino-terminus of the She protein. This domain, origlnally cloned as Grb 12, bound to the EGF-Receptor probe with a similar intensity as that seen with other clones that encoded SH2 domains (5). However, Grbl2 did not encode an SH2 domain, but rather the first 209 amino acids of the ~52 form of She. This domain in She proved to be a unique phosphotyrosine mteraction/phosphotyrosine-binding (PI/PTB) domain. These results left She with two domains that could interact with phosphotyrosine, an amino-terminal PI/PTB domain and a carboxy-terminal SH2 domain. In order to delineate the importance of the different domains in She signaling, we wished to isolate mutants that would eliminate the binding activity of the PI/PTB domain. In this chapter, we describe a method to identify point mutations in the She PI/PTB domain that eliminate binding to phosphopeptldes. However, it can also be used as a general method to identify point mutants in other binding domains using different probes (9). This method is based on the CORT technique and uses the same EGF-Receptor probe. The method first generates random mutations within the She-PI/PTB domain and then screens the mutants for their ability to bmd EGF-Receptor. For this method, a construct was generated m which an m-frame myc epitope was added at the carboxy-terminus of the She-PI/PTB domain. This myc tag allows detection of full-length PI/PTB domains permitting selection of those mutations that affect binding of fulllength PI/PTB domains rather than those that induce stop codons. This construct was placed in the pTOPE plasmid that, like hExlox, expresses large amounts of protein when transformed into bacteria that harbor T7 polymerase. The PI/PTB domains, but not the vector or the myc tag, were then mutated by random mutagenesis using the protocol described by Cadwell and Joyce (10). This protocol results m mutations m approx 1 m 200 nucleotrdes with the frequency of transitions equaling that of transversions. Bacterial colonies contaming the mutagemzed She-PI/PTB domain were then plated, transferred to
Analysis of the She PVPTB Domain
225
nitrocellulose and probed with radioactively labeled EGF-Receptor. The bindmg to EGF-Receptor was assessedby autoradlography. The filters were then reprobed with anti-myc antibody and binding detected using a colorlmetric assay.We isolated those colonies that bound the myc antibody but did not bind the EGF-Receptor. In colonies with this phenotype, the binding of the myc antibody indicates full-length expression of the She PI/PTB domain. However, the lack of binding of the EGF-Receptor indicates the presence of a mutation that eliminates the ability of the She PI/PTB domain to bind phosphotyrosine. The plasmids from colonies that met this criteria were isolated and sequenced to identify the site of the mutation(s). The protocol allowed us to isolate many different point mutants with impaired EGF-Receptor binding. 2. Materials 1 Baculowrus-expressed intracellular domam of EGF-Receptor (Stratagene, La Jolla, CA) 2. fzP-ATP (Dupont/NEN, Boston, MA #NEG-002Z, 6000 Ci/mmol, 10 PC&L). 3 1 M MnCl,. Store at room temperature. 4 1 m&Z ATP m H,O. Store at -20°C m small allquots. 5 Centrlcon 30 (Amlcon; Beverly, MA). 6. 20 mM HEPES, pH 7 5. 7 Bovme serum albumm (BSA)-radlolmmunoassay grade or equwalent. 8 Cyanogen bromide-store m desiccator at 4°C. 9. Formic acid (88%). 10 Nitrogen gas Il. Probe solublllzatlon buffer. 50 mA4 HEPES, pH 7 5, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 200 w sodium vanadate Add PMSF and vanadate fresh each time Sodium vanadate is made as a 200~mM stock m H,O and stored at -20°C. PMSF is prepared as a 100 mM stock m ethanol and stored at 4°C. 12. Syringe filter (Mllhpore, Bedford, MA, #SJHVOO4NS) 13. LB-agar plates (10 cm) containing 50 yg/mL carbemclllm and LB-agar plates (10 cm) 50 bg/mL carbemclllm and 15 pg/mL tetracycline 14. LB Broth 15 pTOPE vector (Novagen) 16. Polymerase chain reaction (PCR) core reagents (Perkm Elmer; Branchburg, NJ). 17 Restriction enzymes Depending on the DNA msert used, restrlction enzymes required will vary. 18 T6DNA ligase (Boehrmger Mannheim, Indianapolis, IN). 19. Alkaline phosphatase (Boehrmger Mannheim). 20. Hind111 digested hDNA markers 21. Competent DHSa E cdl 22 T7-gene IO primer (TGAGGTTGTAGAAGTTCCG; Novagen).
Vain/k, Blaikie, and Margolis 23 24. 25. 26 27. 28. 29. 30 31. 32. 33 34 35 36 37. 38. 39
T7-terminator primer (GCTAGTTATTGCTCAGCGG; Novagen). Qiaex Gel Extraction Ktt (Qtagen; Chatsworth, CA) Novablue DE3 E co/l transformation kit (Novagen) Chloroform Colony-denaturation solution. 20 mM Trts-HCl, pH 7.9, 6 M urea, 0 5 M NaCl. Whatman 3MM filter paper TBS/‘I’ween* 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0 5% Tween-20. Glutathione-S-transferase (GST) fusion protein contammg both SH2 domains of phosphohpase C-gamma (Santa Cruz Btotechnology; Santa Cruz, CA) Block buffer: 20 mM HEPES, pH 7.5, 5 mM MgCl,, 1 mM KCl, 5 mM DTT, 5% nonfat dry milk, 0 02% sodmm aztde 100 and 150 mil4 crystalhzmg dish (Pyrex 3 140). TBS/Triton* 50 mM Trls-HCI, pH 8 0, 150 mM NaC1, 0 1% Trlton X-100 Ann-myc 9ElO monoclonal antibody (MAb) (Oncogene Research Products, Cambridge, MA). Pyrex Glass Tray (approx 18 by 12 m). Vectastam ABC-AP kit for mouse MAbs (Vector Laboratories; Burlingame, CA). Alkaline phosphatase substrate II kit (Vector Laboratones). Qiaprep spm columns (Qtagen). Sequenase Version 2.0 DNA Sequencing Kit (Amersham Life Sciences)
3. Methods 3.1. Preparation
of the EGF-Receptor
Probe
1. Baculovnus-expressed cytoplasmtc domain of the EGF-Receptor (1 pg) that contains the tyrosme kmase and the cytoplasmtc tall is mixed with 400 pCi ys2P-ATP and 2 ,uL 1 M MnC12 (Fig. 1). This yields a final ATP concentratton of approximately 1 pM 2 The phosphorylatton reaction IS allowed to proceed at room temperature, with gentle agitation for 30 mm 3 2 5 lrL of 1 mM ATP is added and the mcubation continued for another 5 mm
(see Note 1) 4 Free ATP is removed by ultracentrtfugation using a Centricon 30. The Centricon 30 is prepared by addmg 1 mL of 20 mM HEPES, pH 7 5, containing 100 pg of BSA to the upper chamber and spmnmg for 20 mm at 5000g m a fixed angle rotor This reduces the nonspecific binding of the kinase The kinase is then added to the upper chamber of the Centrtcon m a fresh 1-mL ahquot of 20 mM HEPES with BSA. Precautions should be observed during handling and centrifugatton as the Centricon now contams a large quantity of radioacttvity The Centricon is centrifuged at 5000g for approx 30 mm until 50 pL remains m the upper chamber. The process 1s then repeated using 1 mL of 20 mA4 HEPES without BSA After the second spm, the liquid m the upper chamber contams the phosphorylated kinase. The free-radioactive ATP contained m the lower chamber 1s discarded m radtoactive waste.
Analysis of the She PVPTB Domain
227
Baculovlrus expressed EGF-Receptor Intracellular Domaln
I
+50pMATP+ MnCl2, 5 minutes room temperature
Spun in Centricon 30 to remove free ATP 4
Add formic acid and cyanogen bromide to labeled receptor Cleave overnight at room temperature In the dark I Wash 3 times with Flnal Probe
Fig. 1 Preparationof the EGF-Receptor probe. Baculovnus expressedEGF-Receptor waslabeledm vitro usingf2P-ATP m the presenceof 5 mM MnCl*. The storchiometryof phosphorylation was then increasedby rarsmgthe concentration of cold ATP to 50 p.iU. The kinase was separatedfrom the radroactrve ATP by spmmngm a Centrrcon 30. This Centrrconhasa 30,000mol-wt cutoff membranethat trapsthe EGF-Receptor m the upper chamberand collects the radioactive ATP in the lower chamber.The EGF-Receptor was then cleaved with cyanogen bromide overnight This left the carboxy-terminal autophosphorylationsitesintact, but cut the restof the receptor into smallerpiecesthat did not interfere with the subsequentscreeningprocess Finally the probe was washedm a Speedvacto remove the remainingformic acid. The probe was filtered prior to use. 5. The kmaseis transferred to a mrcrocentrrfuge tube where four vol of 88% formic acid is added. This should give a final vol of at least 250 pL and a formic acid concentration of approx 70%. If the volume is larger after the Centrrcon step, a proportronate increase m the volume of formic acid 1snecessary 6 A small (l-2 mm diameter) crystal of cyanogen bromide 1saddedto the kmase. After gentle mixing to dissolve the cyanogen bromide, the tube 1sflooded with
228
7.
8.
9 10.
Yajnik, Blaikie, and Margohs nitrogen gas and closed The cyanogen bromide reaction is allowed to proceed at room temperature overnight m the dark. The next day, 750 ltL of water is added and the sample is placed m a Speed-Vat concentrator (Savant Instruments, Farmmgdale, NY). The sample 1sconcentrated to 50 FL and the process 1s repeated with 500 pL and then 300 pL of water (see Note 2). The probe is resuspended m probe solubthzatton buffer by vortexmg for 5 mm The liquid is removed to a new mtcrocentrifuge tube and the step is repeated leaving the probe m a final volume of approx 900 pL (see Note 3). Check the labeling efficiency by counting 2 pL of the probe The probe should have a specific acttvtty of approx 5 x 10’ dpm/pg Just prior to use, filter the probe using a 1-mL syringe and the Milhpore syringe filter Perform this step slowly so as not to dissociate the syringe and filter due to pressure buildup (see Note 4)
3.2. Random Mutagenesis
of the She-PUPTB Domain
1 She l-209 was amplified using the ohgonucleottdes (forward S’CCG GAA TTC ATG AAC AAG CTG AGT GGA3’ and reverse 5’CCG CTC GAG TCA CAG GTCCTCCTCGCTGATCAGCTTCTGCTCCTGCAGATTCCTGAG ATA CTG TTT GAA3’) and plasmtd She 1-209/pGSTag as a template (5) m a PCR reaction (see Note 5) Standard PCR conditions were 20 fmol DNA template, 100 pmol of each ollgonucleotide, 50 mM KCl, 10 mM Tris-HCl (pH 8 3), 200 ltM of each dNTP, AmphTaq 2.5 U, 1.5 mM MgCl, in 100 pL reaction volume. For these ollgonucleotides we used the followmg cycling condmons 94°C for 1 mm, 50°C for 1 mm, 72°C for 1 mm, 30 cycles. 2. Four such PCR reactions (400 pL m total) were pooled mto a 1 5-mL microcentrifuge tube, extracted with an equal volume of phenol/chloroform and precipitated with 2 vol ethanol After incubatton at -70°C for 30 mm, the PCR products were centrifuged for 30 mm in a microfuge. 3. The pellet was washed with 70% ethanol, resuspended in 20 pL H,O, cut with X/z01 and EcoRI and run out on a 1% agarose gel. 4 Stmultaneously 5 pg of pTOPE vector was cut with EcoRI and XhoI. After cutting, the fragments were treated with alkaline phosphatase for 20 min then loaded directly onto the same 1% agarose gel as the PCR insert. 5 The bands corresponding to the PCR insert and the cut vector were extracted from the gel with the Qtaex kit according to manufacturer’s mstructions 6. After puriftcatton, the vector and insert were resuspended m 20 PL of water and quantitated by agarose electrophorests using HlndIII 3LDNA markers as a standard 7 The EcoRI and XhoI cut pTOPE vector (40 fmol, about 100 ng) was mixed with 40 fmol of EcoRI and XhoI cut PCR product and ligated overnight at 16°C using T6DNA-hgase. 8 The ligation reaction was transformed into competent DHSa E ~011 and grown on carbemcillm LB-agar plates
Analysis of the She PVPTB Domain 9. Posmve colomes were selected and the presence of the appropriate insert confirmed by restriction analysis In our case BumHI digestion detected the presence of the insert and allowed confirmation that these clones had proper orientation We term this vector She l-209/Myc pTOPE (Fig. 2A) 10. The insert m She 1-209/Myc pTOPE was then amplified by mutagenic PCR usmg oligonucleotides that anneal to the pTOPE vector The forward obgonucleotide is the T7-gene 10 primer and the reverse oligonucleotide is the T7-termmator primer. The mutagemc-PCR reactions (100 yL) contained* 20 fmol DNA, 30 pmol of each T7 primer, 50 mM KCl, 10 mM Tris-HCI (pH 8 3), 7 n-&f MgCl*, 0.5 mM MnCl,, 5 U AmpliTaq polymerase, 0.2 mM deoxyguanosme triphosphate (dGTP), 0.2 mM deoxyadenosme triphosphate (dATP), 1 mM deoxycytidine triphosphate (dCTP), 1 mM deoxythymidme triphosphate (dTTP) The MnCl* must be added Just before the enzyme to prevent precipitation (IO). For these oligonucleotides, we used the followmg reaction conditions. 94°C for 1 min, 50°C for 1 mm, 72°C for 1 mm 30 cycles. 11 The mutagenized-PCR reactions were then pooled as m Subheading 3.2., step 2 and cut with BstEII and PstI 12 The She l-209Myc pTOPE vector was cut with BstEII and PstI and treated with alkaline phosphatase as m Subheading 3.2., step 4. 13 The mutagemzed-PCR product and the She l-209/Myc pTOPE vector, both cut with BstEII and PstI, were purified on a 1% agarose gel and ligated as in Sub-
headings 3.2., steps 5-7. 14 The ligatton products were used to transform competent Novablue DE3 E cdl stram using the Novagen transformation kit according to the supplied protocol
3.3. Plating and Screening
the Mutagenized
PI /PTB Domain
1. Using the Novagen transformation kit, a final volume of 100 pL IS obtained. Two to five microliters of this volume were diluted with 100 yL LB, spread on carbenicillin/tetracyclme LB-agar plates, and incubated overnight at 37°C. The remammg transformation was stored at 4°C without significant loss of recombmants. 2 The number of colonies were counted and appropriate amount of transformation was plated the next day to get 100 recombmants on a lo-cm plate. This avoids problems with overcrowdmg and each recombinant can be easily identified following screening. We typically plated 6-10 plates at a trme 3 Colonies were grown on carbemcillm/tetracyclme LB-agar plates and Incubated for 16-17 h at 37°C. Colonies that appear small still make detectable amounts of protein (see Note 6) 4. Plates were chilled at 4°C for 1 h 5. Nitrocellulose filters (82.5 mM, BA85, Schleicher and Schuell; Keene, NH) and plates were numbered with a ballpomt pen and a Sharpie marker, respectively. Latex gloves were used when handling the filters. 6. The filters were placed on the plate by bending the filter up mto a “U” shape and allowing only the filter’s center to touch the plates. Gradually the filter was lard
230
Yajnik, Blaikie, and Margolis
A
Ib
ShCl-209 I+--She
IRegion
EcoRI
4 I4Zl
-*
PIdomain+ of
Mutagenesir
II
B&E11
PstI
XhOI
m=
Fig. 2. Screening a library of random mutants. (A) She l-209/myc pTOPE vector. She l-209 was subcloned into the pTOPE vector with a myc epitope at its carboxyterminus. The pTOPE vector allows protein expression in bacteria expressing T7 polymerase. cDNA-encoding She 76-209 that had been subjected to random mutagenesis by PCR was cloned into the BstEII and PsrI site. The mutagenesis did not include the myc tag or pTOPE vector. (B) Screening of bacterial colonies expressing the mutagenized She PI domain. The mutagenized She l-209/myc pTOPE plasmids were used to transform bacteria and plated to yield approx 100 colonies per lo-cm plate. After overnight growth, the colonies were transferred to nitrocellulose and lysed. After blocking the filters, they were probed with 32P-labeled carboxy-terminus of the EGFReceptor (EGFR), washed and exposed to film. After autoradiography, the filters were reprobed with an anti-myc antibody using calorimetric detection. The autoradiograms were then aligned with the myc-antibody-stained filters. The panel on the right shows screening for myc-tag expression using MAb 9ElO against the myc epitope. The panel on the left shows binding of labeled EGF-Receptor to the same filter. The arrow depicts a colony selected for further analysis with normal binding of the myc antibody but defective EGF-Receptor binding (II). (Adapted with permission from the Journal of Biological Chemistry.)
Analysis of the She PVPTB Domain
10
11.
12. 13.
14
flat across the plate from the center to the outside, trymg to mmimizmg the trapping of an bubbles beneath the filter. To estabhsh orientatron, the filters were marked asymmetrically with an l&gage needle Correspondmg marks were made on plates with a Sharpie marker while transillummatmg plates over a light box Filters were peeled off using a flat-tipped forceps and placed colony-stde up on Whatman 3MM-filter paper (see Note 7). The colonies were lysed m a chloroform vapor chamber. This was prepared by placing a large Pyrex tray m the fume hood. Paper towels were lightly dampened with water and placed over the entire bottom of the Pyrex tray. Filters, with the colony-side up, were then placed gently over the paper towels A lo-cm glass Petri dish without its lid was placed m one corner of the Pyrex tray. Three or four Kimwipes were soaked m chloroform and placed in the Petri dish. The entire tray was covered and sealed with plastic wrap and left m the hood for 15 min (see Note 8). Whatman paper was cut to fit a plastic tray and soaked m colony-denaturation solution. Excess fluid was drained, because it can cause smearmg of the signal. Also, any air bubbles trapped between the tray and the Whatman filter were removed. The filters were taken from the chloroform vapor chamber and placed colonyside up on Whatman paper saturated with colony denaturation solution for 15 min at room temperature. Filters were then washed m a 150-mm crystalhzmg dish with TBS/Tween at room temperature with gentle agitation on a platform shaker for 15 mm. Washing was repeated three more times. Filters were transferred one by one mto a clean dish with fresh buffer If colonies were still visible, they were gently removed with a Kimwipe and washed with TBS/Tween one more time. At this pomt, we added a positive control to ensure the remammg steps proceeded correctly and that the probe was of high quality. We routinely spotted 50 ng (2 /.tL) of a GST-fusion protem encoding both SH2 domains of phosphohpase C-gamma onto mtrocellulose. We used GST alone as a negative control We added this small piece of mtrocellulose containing the controls to the other filters m the final TBS/Tween wash.
3.4. Incubation
with Probe and Auforadiography
1. Washed filters were next mcubated for at least 3 h in block buffer at 4°C. Filters can be stored m this block buffer for at least a week at 4°C. We used a loo-mm crystallizing dish for blockmg and incubation and a 150-mm crystalhzmg dish for washing. Unless otherwise stated, always move the filters one at a time from one solution to the next 2. The block buffer was changed and the filters were incubated with the probe (l-2 million dpm/mL) overnight at 4°C. We probed 10 filters at a time by mcubating m 25 mL of block buffer. We used the probe solution for two such screenings before discarding The probe was removed and saved for a second screening at 4’C
232
Yapik, Blaikie, and Margolis
3. The filters were rinsed twice with TBS/Tnton without changmg containers to remove the bulk of the unbound radloactlvlty. The filters were washed m TBS/ Trlton three more times for 15 mm each at room temperature. In the final three washes, the filters were transferred mdivldually from one washing container to the other. 4. The filters were dried and exposed to film for 12 h at -70°C with mtenslfymg screens It is important to check that the probe has given a strong signal with the SH2-domain posmve control. 5. After autoradiography was complete, the filters were washed m TBS/Tween four times for 15 mm each with gentle shaking at room temperature 6. The falters were incubated with an anti-myc MAb, 9E10 (1 pg/mL) for 30 mm at room temperature. 7. Filters were washed four times with TBS/Tween for 15 mm at room temperature 8. Bound Myc antibody was detected using the Vectastam ABC-AP kit for mouse MAbs using the protocol for mtrocellulose staining provided with the kit. In brief, this involves incubating the mtrocellulose filters for 30 mm m blotmylated antimouse antibody (one drop per 10 mL, approx 5 pg/mL) m TBS/Tween. The filters were washed four more times with TBS/Tween and then incubated with the alkaline phosphatase-linked avidm-blotm complex for 30 mm at room temperature. 9 After washing four more times with TBS/Tween, the 9E10 bmdmg was detected using alkaline phosphatase substrate II kit. Most of the colonies should turn dark brown within 2 min (see Note 9). 10. After the filters were washed in Hz0 and dried, the autoradlogram from the EGFReceptor bmdmg screen and the correspondmg filters from the anti-myc blottmg were placed side by side (Fig. 2B) Each bacterial clone was scanned for myc expression and correspondmg EGF-Receptor bmdmg (Fig. 2B). Colonies that did not bmd to the EGF-Receptor yet were posltlve for myc-antlbody bmdmg were selected. 11. Once colonies were selected for further study, the orlgmal plates were re-incubated at 37°C for 4-10 h to allow the colonies to regrow Using the needle marks in the filters and the Sharple marks on the bacterial plates, it was possible to select the correct colonies for further study The colonies were picked and grown to saturation m 5 mL of LB with 50 pg/mL carbemclllm and 15 pg/mL tetracycline. 12. These 5-mL bacterial cultures were then used to prepare plasmld DNA suitable for sequencing using Qiaprep spm columns 13 Plasmld DNA was sequenced using Sequenase Version 2.0 DNA Sequencing Kit to ldentlfy sites of mutation 14 The technique described earlier 1s qualitative, but not quantltatlve, and as such companion techniques are necessary to define more carefully the degree of bmdmg impairment of mdlvldual mutants (II). In our studies, bmdmg defects were confirmed and quantitated by expressing the She-PI/PTB domain mutants as GST-fusion proteins (see Note 10 and Fig. 3)
Analysis of the She PVPTB Domain
wl
233
w-r
11281
Fl98V
L84F
P158L
F152L
Fig. 3. Binding of EGF-Receptor to She PI/PTB mutants. Mutants isolated as shown in Fig. 2 were subcloned into pGEX 4T-1 vector to generate GST-fusion proteins. These proteins were then purified on glutathione agarose. The GST protein was eluted off the glutathione agarose and quantitated using SDS-PAGE in combination with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA). The PI/PTB-domain proteins were spotted on nitrocellulose (50,100,200 ng) and probed with the labeled EGF-Receptor. This figure compares the binding of five mutants to the binding of wild-type She PI/ PTB domain. Minor binding defects were best seen when 100 ng of fusion protein was used, but the pronounced defect in the binding of the F198V mutant is also seen at 200 ng. After our mutagenesis studies were completed, the structure of the PI/PTB domain of She was published (13). It revealed that F198 of She directly interacted with phosphopeptide confirming our mutagenesis methodology. This indicates the value of the random mutagenesis approach to detect critical residues involved in proteinprotein interactions.
4. Notes 1. The ATP concentration is raised to 50 piW, ensuring that the kinase is completely phosphorylated. This increases the stoichiometry of phosphorylation allowing each labeled kinase to bind to a variety of SHZdomain proteins. 2. The probe should not be completely dried, because it may become difficult to resuspend. After the kinase has been cleaved, the majority of the radioactivity should be contained in a 203 amino acid cleavage product that encompasses the EGF-Receptor carboxy-terminus (Fig. 1). 3. Using a Geiger counter, the residual radioactivity left in the initial microcentrifuge tube should be checked. If more than 20% of the counts remain in the tube, it may indicate poor cyanogen bromide cleavage as the uncleaved cytoplasmic domain can bind nonspecifically to plastic. 4. This step will assist in eliminating background that can lead to false positives. The probe can be filtered directly into block buffer. The probe can be used for up to 3 wk when stored in block buffer at 4”C, although it will undergo some radioactive decay. 5. The forward oligonucleotide allows in frame fusion of She l-209 to the gene 10 protein using an EcoRI site. The reverse oligonucleotide puts a myc epitope
Yajnik, Blaikie, and Margolis
6.
7
8 9.
10.
(EQKKLISEEDL) on the carboxy-terminus of She l-209. It places a PstI site (CTG CAG) between She and the myc epitope, a stop codon after the epitope and then an XhoI (CTC GAG) site (Fig. 2A) Novablue DE3 E. co/z contam T7-RNA polymerase, whtch drives the expression off the T7 promoter of the pTOPE vector. The T7-RNA polymerase 1s under lacUV5 control, but sufficient quantities of protein are expressed m the absence of IPTG In fact m our hands, there is no sigmftcant change m signal when clones are plated m the presence of IPTG. Typically, fusion proteins precipitate in bacteria as inclusion bodies and are relatively resistant to proteolyttc degradation The filters do not need prolonged contact with bacteria; 3 mm being sufficient Some colonies and small pieces of agar were stuck to the filter, but they came off m subsequent washing steps Colonies that are not obviously stuck on the filter may still deposit sufficient protem to give a positive signal Within mm, there were stretch marks on the plastic wrap suggesting that the chloroform vapor chamber was working. In our experience, the filters need to be incubated with the substrate for 30-l 80 s. We do each filter separately and use the same substrate solution for three filters before making it fresh. The generation of GST fusion proteins containing the mutant PI/PTB domains 1s beyond the scope of this chapter. However the basic methods are described in other publlcattons and references therem (II ,12) Basically the EcoRI and XhoI insert from pTOPE can be subcloned directly mto pGEX 4T-1 (Pharmacia, Uppsala, Sweden) yielding a plasmtd that will encode an inframe GST-fusion protein The wild-type and mutant PI/PTB domains can then be generated and purified on glutathione agarose The purified proteins can be eluted from the glutathtone agarose and known amounts of the purified proteins spotted onto nitrocellulose. The wild-type and mutant fusion proteins can then be probed with EGF-Receptor and 9ElO antibodies as described m Subheading 3.4. Whereas all mutants looked fairly similar m the colony screening, the generation of the GST-fusion protein revealed differences m the bmdmg affinity of the mdtvtdual mutants (Fig. 3)
References 1. Pawson, T (1995) Protein modules and signallmg networks. Nature 373, 573-580 2. Skolmk, E. Y , Margobs, B , Mohammadi, M , Lowenstem, E., Fischer, R , Drepps, A., Ullrtch, A , and Schlessmger, J. (1991) Cloning of PI3 kmase-assoctated p85 utthzing a novel method for expression/clonmg of target proteins for receptor tyrosme kinases Cell 65,83-90. 3 Lowenstem, E J., Daly, R J , Batzer, A G., Lt, W., Margohs, B., Lammers, R , Ullrtch, A , Skolmk, E Y , Bar-Sagl, D , and Schlessmger, J (1992) The SH2 and SH3 domain-contammg protein GRB2 lurks receptor tyrosine kmases to ras signaling Cell 70,43 l-442
Analysis of the She PVPTB Domain
235
4 Margolts, B , Stlvennomen, O., Comoglto, F , Roonprapunt, C., Skolnik, E , Ullrich, A., and Schlessmger, J (1992) High-efficiency expresston/clomng of epidermal growth factor-receptor-binding proteins with Src homology 2 domams. Proc Nat1 Acad Scz USA 89,8894-8898 5. Blaikte, P., Immanuel, D , Wu, J., Li, N., YaJmk, V., and Margohs, B. (1994) A region in She distinct from the SH2 domain can bmd tyrosme phosphorylated growth factor receptors. J Blol Chem 269,32,03 l-32,034. 6. Ooi, J., YaJmk, V., Immanuel, D., Gordon, M , Moskow, J J., Buchberg, A. M , and Margohs, B. (1995) The cloning of GrblO reveals a new family of SH2 domain proteins. Oncogene 10, 1621-1630 7. Schlessinger, J. (1993) How receptor tyrosme kmases activate Ras. Trends Blochem Scz 18,213-275. 8. Margohs, B., Skolmk, E Y , and Schlessmger, J. (1995) The use of tyrosmephosphorylated proteins to screen bactertal expression libraries for SH2 domains Methods Enzymol 255,36O-369. 9 Margohs, B. and Young, R. A. (1995) Screenmg lambda expresston libraries with antibody and protein probes m DNA Clonzng 2 (Glover, D. M. and Hames, B. D., eds ), IRL, Oxford, UK, pp. 1-14 10 Cadwell, R C and Joyce, G F. (1992) Randomtzation of genes by PCR mutagenesis. PCR Methods Appl 2,28-33. 11. Yajnik, V., Blaikte, P., Bork, P., and Margolis, B (1996) Identtfication of restdues within the She phosphotyrosme bmding/phosphotyrosme mteractlon domam crucial for phosphopeptide mteraction. J Bzol Chem. 271, 18 13-l 8 16 12. Ausubel, F. M., Brent, R , Kmgston, R. E., Moore, D. D , Seidman, J. G., Smith, J. A., and Struhl, K (1996) Current protocols in molecular bzology. Wiley Interscience, New York. 13 Zhou, M. M., Ravmhandran, K. S., OleJnlCZak, E. F., Petros, A. M., Meadows, R P., Sattler, M., Harlan, J E., Wade, W. S., Burakoff, S J , and Fesik, S. W (1995) Structure and hgand recognmon of the phosphotyrosme bmdmg domam of She. Nature 378,584-592.
15 Use of Fluorescence Spectroscopy to Study the Regulation of Small G Proteins Tyzoon Nomanbhoy
and Richard A. Cerione
1. Introduction The Ras-like low-molecular-weight guanosine triphosphate (GTP)-binding proteins form a superfamily whose members participate in a variety of biological pathways, including the regulation of cell growth and differentiation, vesicular transport, and cytoskeletal organization (1). In all cases, these GTPbmdmg protems appear to act as molecular switches by cycling between an inactive guanosme diphosphate (GDP)-bound state and an active GTP-bound state. This cycle is tightly regulated by distinct proteins; m particular, the exchange of GDP to GTP is stimulated by guanine nucleotide exchange factors (GEFs), and the hydrolyses of GTP back to GDP is catalyzed by GTPaseactivating proteins (GAPS) (2). In some cases, a third class of proteins participates in the regulation of the GTP-binding/GTPase cycle by mhibttmg GDP dissociation (and thus have been designated the GDP-dissociation inhibitors or GDIs) and GTP hydrolysis and stimulating the dissociation of the GTPbinding protein from membranes (2,3). A major interest of our laboratory has been the Cdc42Hs GTP-binding protein, which is the human homolog of the Saccharomyces cerevzslae celldivision cycle product. In S. cereviszae, Cdc42 has been implicated in the regulation of bud-site assembly through the establishment of cell polarity (4). In mammalian systems, Cdc42 has been implicated in the regulation of the actin cytoskeleton (5,6), as well as the stimulation of the nuclear MAP-kinases Jnk and p38 (7-10). Work from a number of laboratories, including our own, has identified various proteins that can serve as GAPS for Cdc42Hs (II), including the origmal Cdc42-GAP (12), and has demonstrated that the Dbl-oncogene From
Methods
m Molecular
Edlted
by
Biology,
D Bar-Sag1
Vol 84 Transmembrane 0 Humana
237
Press
Sgnabng
Inc , Totowa,
NJ
Protocols
238
Nomanbhoy and Cerione
product serves as a prototype for a family of growth-regulatory proteins and oncoproteins that act as GEFs for Cdc42 and related GTP-binding proteins (13). Recently, rt also has been demonstrated that potentially important targets for Cdc42Hs are members of the p21-activated kinases (PAK) family (14), which may mediate (through the mmation of a protein-kinase cascade) the activation of the Jnk and p38 kinases. In order to study in detail the interactions between Cdc42Hs and its different regulators (GEFs, GAPS) and target molecules (e.g., PAK), we have set out to develop real-time fluorescence-spectroscopic assays for each of these reactions. An mmal approach was to take advantage of a single tryptophan residue on Cdc42Hs as an mtrmsic-reporter group for monitoring GTP hydrolysis (15). In addition, the fluorescence of Mant-derivatized guanine nucleotides has been used to momtor the bmdmg of GDP and GTP to Cdc42Hs. However, each of these approaches has some disadvantages. The use of intrinsic-tryptophan fluorescence as a readout for the guanine nucleotide state of Cdc42Hs limits the concentration of regulatory protems (which also contam tryptophan residues) that can be added to the cuvet, thus precluding a full examination of the effects of these regulators on the GTP-bmdmg/GTPase cycle. The use of fluorescent (Mant) guanme nucleotides can overcome this problem, but does not provide a very sensitive readout for real-time changes in the nucleotide state of Cdc42Hs, such as the hydrolysis of GTP to GDP. Thus, below, we describe an alternative approach that does not suffer from these disadvantages. Specifically, this mvolves the use of an extrinsic reportergroup for monitoring the GTP-bindmg/GTPase cycle for Cdc42Hs. Here we describe procedures for covalently attaching an exogenous-fluorescence probe, succmlmidyl 6-[(7-mtrobenz-2-oxa-1,3-diazole-4-yl)ammo] hexanoate (sNBD), with a stoichiometry of 1 probe molecule per GTP-binding protein, As we have recently reported, the sNBDCdc42 molecule provides a highly sensitive readout for GTP bmdmg, GTP hydrolysis, and the functional mteracttons of GAPS and GEFs with Cdc42Hs (16).
2. Materials 1 Cdc42Hs was expressed as a GST-fusion protein in Escherich~2 toll The specific protocols for the expression and purification of the protein are described in Subheading 3.1. 2 sNBD is available from Molecular Probes. For the fluorescent modification of Cdc42Hs, a 20-mM solution of sNBD was prepared in dimethyl formamide (DMF). This can be stored at -20°C for at least 6 mo. 3 Lyophlhzed human-plasma thrombm IS available from Sigma. This was dissolved m 20 mA4 MES, pH 6.6, so that the final thrombin concentration was 1 U&L The thrombin solution was stored at -20°C.
239
Regulation of Small G Proteins
4. Buffer A: 20 mM Tns-HCl, pH 8.0, 50 mM EDTA, 0.2 mM phenylmethanesulfonylfluoride (PMSF), 10 pg /mL aprotmm, and 10 p.g/mL leupeptm. 5 Buffer B. 20 mM Tris-HCl, pH 8 0, 1 mM EDTA, and 2 yM GDP 6 Buffer C 20 mM HEPES and 50 mM K,HP04, pH 8 7 7. Buffer D 50 r& Trts-HCl, pH 8 3, 150 mM NaCl, 5 n-uV MgCl,, 2.5 mM CaCI,, and 2 l.tM GDP 8 Buffer E. 20 mM Tris-HCl, pH 8.0,50 mM NaCl, and 2 mM MgC12 9 Glutathrone agarose was obtained from Sigma. The agarose was eqmhbrated m Buffer B prior to use
3. Methods 3.1. Preparation of sNBD-Labeled 3.1 1. Expression of GST-Cdc42Hs
Cdc42Hs in E. coli
1. A 5-mL overnight culture of E colr containing the expression plasmid for GST-Cdc42Hs is used to seed 2 L of superbroth This 1s grown m a standard shaker at 37°C 2. Protem expression IS induced at an ODs6enm of -0.6 with 200 yM isopropyl B-o-thiogalactoside (IPTG), for 90 mm. 3. Cells are harvested by centrifugation (5000 rpm, 5 mm), qmck frozen m hquid nitrogen, and stored at -8O’C
3.1 2. Purification of GST-Cdc42Hs 1. Cells from a 2-L culture are thawed into Buffer A, and lysed by the addmon of lysozyme to a final concentratron of 1 mg/mL. Lysis of the cells is accompanied by an increase m the vtscosny of the mixture 2. After lysis is complete (-15 mm), DNase is added to 0.05 mg/mL, and the MgCl, concentration adjusted to gave a final concentratton of 2 mM. 3. After DNase treatment is complete (-20-30 mm, as Judged by a decrease m the viscosity of the mixture), the lysate is clarified by centrifugation (14O,OOOg, 30 mm). 4 The supernatant from the spm 1s transferred to a 15-mL centrifuge tube Glutathione agarose 1s added to the supematant (300 pL agarose/l5 mL supernatant), and the mixture IS incubated on a rockei at 4°C for 15 mm. 5. The mixture is then apphed to a 2 0-mL microcolumn (Krackler Scientific). The agarose is washed extensively with buffer B to remove nonspecifically bound proteins. GST-Cdc42Hs complexed to glutathione agarose can be stored at 4°C for at least 1 wk
3.1.3. Covalent Modification of GST-Cdc42Hs
with sNBD
1. GST-Cdc42Hs, complexed to glutathtone agarose m a 2-mL microcolumn, washed with about 10 mL Buffer C.
is
240
Nomanbhoy and Cenone
2. A micro stirbar 1s inserted mto the column, and the column 1s placed over a strrrer sNBD from the 20-d stock solution IS added to the column so that the final sNBD concentration IS -250-500 PM. The reaction of sNBD to GST-Cdc42Hs IS carrred out for about 1 h at room temperature, wtth continuous stnrmg 3 After 1 h, the column IS washed with Buffer B to remove free probe.
3.1.4. Release of sNBD-Cdc42Hs
from Glutathione Agarose
1 sNBD-labeled GST-Cdc42Hs, complexed to glutathrone agarose, is washed with 10 mL Buffer D 2 5 pL thrombm from the 5-U&L stock solutron is added to the column Thrombin dtgestron 1s carrted out for 90 mm at room temperature, with continuous sturmg This results in the release of sNBD-Cdc42Hs from GST. 3 sNBD-Cdc42Hs IS released from the column by washing the column with about 0 5 mL Buffer D PMSF is added to a final concentration of 0.2 mM to mhrbrt further thrombm action. 4. sNBD-Cdc42Hs can be stored at 4°C for about 48 h, after which the GTP-bmdmg activity of sNBD-Cdc42Hs noticeably decreases Alternately, sNBD-Cdc42Hs can be dialyzed into Buffer B containing 40% glycerol, and stored at -20°C for 1 mo m the presence of 0.2 m&I PMSF
3.2. Characterization
of sNBD-Cdc42Hs
1 A sample of sNBD-Cdc42Hs (-10 p.g) 1s electrophoresed on a polyacrylamtde gel. The gel IS then placed over a transrllummator to drsplay the fluorescent species on the gel. Typically a smgle band IS seen at a molecular werght of about 24 kDa, correspondmg to sNBD-Cdc42Hs. Occasronally, a fluorescent band can be detected close to the dye-front, mdrcatmg that the removal of free probe after the labeling of GST-Cdc42Hs by sNBD was not completely successful (see Subheading 3.1.3.). 2. The storchrometry of the labeling of Cdc42Hs by sNBD 1s determined by comparing the concentration of the sNBD morety m a sample of sNBD-Cdc42Hs to the protein concentratron. The molar concentratton of the sNBD moiety is obtained from the relationship c = A/(& x 1), where A is the absorbance of the moiety as determined on a spectrophotometer, e IS the molar absorbtrvrty of sNBD for which we use the pubhshed value of 22,00O/Mlcm, and 1 IS the path length m the spectrophotometer. The protein concentratron IS determined by the Cu+/ bicinchommc acid complex (Prerce Chemrcals), using bovine serum albumin (BSA) as a standard. Under the conditions of the labeling of Cdc42Hs by sNBD that have been described m Subheading 3.1.3., we obtain a storchiometry of 1 f0.1
3.3. Fluorescence
Spectroscopy
1. The fluorescence measurements on sNBD-Cdc42Hs are made using an SLM 8000~ spectrofluorometer operated m the photon-countmg mode. The sample 1s
Regulation of Small G Proteins
241
Fig 1. Normalized emission spectra of sNBD-Cdc42Hs in the GTP- and GDPbound states. sNBD-Cdc42Hs (350 nM) is incubated m Buffer E m the presence of 6.7 mM EDTA and 12.5 pM GTP or GDP. The emission spectra are obtained by exclting the samples at 488 nm placed in a I-mL quartz cuvet (Hellma) m Buffer E, stirred continuously, and thermostated at 30°C 2. To momtor the sNBD fluorescence of sNBD-Cdc42Hs, we generally use between 50 and 500 nM sNBD-Cdc42Hs in the cuvet The excitation monochromator 1s set to 488 nm, and the emission monochromator is set to 545 nm; corresponding to the excitation and emission maxima of sNBD-Cdc42Hs.
3.3.1. Fluorescence Spectroscopy as a Tool to Monitor the GTP-Binding/GTPase Cycle of sNBD-Cdc42HS 1. The sNBD fluorescence of sNBD-Cdc42Hs when it IS in the GTP-bound state is about 20% greater than when it is in the GDP-bound state (Fig. 1). Thus, by following changes in sNBD fluorescence, we are able to follow changes in the nucleotide-state of sNBD-Cdc42Hs in real time. 2. To monitor the exchange of GDP for GTP on sNBD-Cdc42Hs, we generally start out with 350 nM sNBD-Cdc42Hs, mmally in the GDP-bound state, m buffer E, and include GTP to 10 PM. Exchange is initiated either by the addition of EDTA, pH 8.0, to 6 7 mM, or by the addition of a specific guamne nucleotide exchange factor (GEF) for Cdc42Hs (Fig. 2). In the latter case, the S cerevzszae Cdc24-gene product has typically been used. The Cdc24 protein has been expressed and purified as a glutathione-S-transferase (GST)-fusion protein from Spodopterafrugzperda cells (17). Typically, we can promote the GEF-catalyzed
242
Nomanbhoy and Cerione EDTA exchange
Cdc24p exchange
09
‘1 0
, 50
I 100 Time km)
I 150
, 200
I
Fig 2. Time-coursefor the exchangeof GDP for GTP on sNBD-Cdc42Hsusingeither EDTA or Cdc24p sNBD-Cdc42Hs (350 nM) is incubated m buffer E m the presenceof 12 5 pJ4 GTP. The ttme-course for sNBD fluorescence is momtored (ex = 488 nm, em = 545 m-n)and at the indicated time (arrow), EDTA is addedto 6 7 mM, or Cdc24p 1s addedto a fmal concentrattonof 62.5 nM (Inset) The increasem sNBD fluorescencedue to GTP binding is estimatedby single-exponentialfits usmgIgorPro wavemetrics exchange of GTP for GDP by adding GST-Cdc24 to a final concentratron of 60-350 nA4 in the cuvet (when [Cdc42] = 350 nM). The addition of EDTA (or a GEF) results m an increasem sNBD fluorescence as GTP binds to Cdc42Hs. 3. To monitor GTP hydrolysis on sNBD-Cdc42Hs, we typically start with 350 r-&J sNBD-Cdc42Hs m buffer E, and include GTP to 10 @Z Exchange is initiated by the addition of EDTA to 6.7 n-&f. When all of the sNBD-Cdc42Hs is m the GTP-bound state (i.e., no further increasein sNBD fluorescence), MgC12is added to block the further binding of GTP to Cdc42Hs This is followed by a gradual decrease m sNBD fluorescence as GTP is hydrolyzed to GDP The rate of decreaseof sNBD fluorescence can be greatly increasedby the addition of specific GAPS for Cdc42Hs. The limit-GAP domain for the Cdc42-GAP (which contams 234 ammo acids) hasbeen expressedm E colz as a GST-fusion protein and shown to be fully functronal(12). Typically, the GAP-catalyzed GTP hydrolysis reaction can be mltlated by mtxmg the purified GST-GAP (final concentration of 25 ml4 m the cuvet) with Cdc42Hs (350 nM) (Fig. 3). 4. The raw data obtained from the fluorometer 1susually quantrtated using IgorPro wavemetrics software. Generally, we estimate the rate of change of sNBD fluorescence owing to either GTP bmdmg or GTP hydrolysis using single expo-
243
Regulation of Small G Proteins
EDTA 0.9 , 0
I 200
I 400
I 600
I 800
1000
Ftg 3. Ttme-course for GTP hydrolyses on sNBD-Cdc42Hs m the presence or absence of Cdc42Hs-GAP sNBD-Cdc42Hs (350 nM) 1s incubated m buffer E m the presence of 12.5 ~u’t!fGTP sNBD fluorescence is momtored (ex = 488 nm, em = 545 nm) and, at the indicated time, EDTA 1s added to 6.7 mM to allow for the exchange of GDP for GTP on sNBD-Cdc42Hs. MgC12 is then added so that the fmal MgCl, concentratton is 2 mM Cdc42Hs-GAP (25 nM) is added 10 s after the addrtton of MgClz (Inset) The decrease m sNBD fluorescence owmg to GTP hydrolysis is estimated by single-exponenttal fits usmg IgorPro wavemetrtcs nential fits (Figs. 2 and 3, insets) Thts allows for the accurate descrtptton of the rate of change in sNBD fluorescence m response to the nucleottde state of sNBD-Cdc42Hs.
3.3.2. Fluorescence Spectroscopy as a Tool to Characterize the Interaction Between sNBD-Cdc42Hs and Effecters of Cdc42Hs 1. We have recently demonstrated that the sNBD fluorescence of sNBD-Cdc42Hs is sensitive to the bmdmg of mPAK-3, a member of the p21-acttvated kmase family, to sNBD-Cdc42Hs (Nomanbhoy, T. K., unpublished data). Specifically, the sNBD fluorescence 1s quenched on the bmdmg of mPAK-3 to sNBD-Cdc42Hs m the GTP-bound or the GTPyS-bound form. 2 To charactertze the bmdmg of mPAK-3 to sNBD-Cdc42Hs, we usually start wtth -60 nM sNBD-Cdc42Hs bound to GTPrS m Buffer E; 50-nM altquots of mPAK-3 are then added to the cuvet, unttl the quench m sNBD fluorescence 1s saturated (Fig. 4A). mPAK-3 is expressed m E toll as an His-fusion protein (Bagrodta, S., unpublished data)
Nomanbhoy and Cerione
244 ‘“=]A
0
100
200
300 Time
0
50
100 lmPAK31
400 (set)
150 hM)
500
600
200
700
250
Fig. 4. Determmatton of the Kd for the binding of mPAK-3 to sNBD-Cdc42Hs (A) sNBD-Cdc42Hs (-60 nM), m the GTPyS-bound state, IS incubated m buffer E. sNBD fluorescence IS momtored (ex = 488 nm, em = 545 nm) and ahquots of mPAK-3, approx 50 nM each, are then added until the quench of sNBD fluorescence is saturated. (B) The change in fluorescence after the addrtion of each aliquot of PAK (-AFI Fa), is plot as a function of mPAK-3 concentration. The points are fit to calculate the K, for the binding of mPAK-3 to sNBD-Cdc42Hs (see Subheading 3.3.2.)
3. The change m sNBD fluorescence is plot as a function of mPAK-3 concentration Assuming a smgle class of bmdmg sites on Cdc42Hs for mPAK-3, we determme the Kd for the bindmg of mPAK-3 to Cdc42Hs using the equation’ F = F, + Ff [((Kd + ,!,T + RT) - (Kd + LT + RT)* - ~RT,!J#~)/~RT] where F is the change m fluorescence over mtttal fluorescence (-AFIF,), F, is the initial value of (-AFIF,), F, is the final value of (-AFIF,), Lr is the total concentration of mPAK-3, and RT is the total concentration of sNBD-Cdc42Hs (18) Fits are generated usmg IgorPro wavemetrics software We estimate the Kd for the bmdmg of mPAK-3 to sNBD-Cdc42Hs to be -25 nM.
Regulation of Small G Proteins
245
4. Notes 1. The preparation of sNBD-labeled Cdc42Hs enables the use of the environmentally sensitive NBD moiety to momtor directly GTP-binding to Cdc42Hs and GTP hydrolysis. 2. This readout is especially useful for assaymg the mteractrons of different regulatory factors with Cdc42Hs and provides a strong advantage over tryptophan fluorescence m terms of “signal-to-noise” because the regulatory proteins (GEFs and GAPS) all contribute to the total-tryptophan emission. 3. As far as we can tell, only a single-lysine residue is reacted with sNBD on Cdc42Hs (this appears to be lysine 150). Thus, it is possible to measure changes in the distance between this reactive lysme and the guanme nucleotide-bmdmg site, as measured by resonance energy transfer, upon the bmdmg of different regulators or targets for Cdc42Hs. 4. Our preliminary results suggest that the fluorerscence emission of the sNBD moiety is altered upon the bmdmg of the Cdc42Hs-target molecule, mPAK-3. This suggests that the label may be located at a region of the Cdc42Hs molecule that is close to or mvolved in the binding of targets. Thus, sNBD-Cdc42Hs molecule may provide particularly sensitive read-outs for target mteractions 5. Whereas the sNBD reporter group works well and provides a number of advantages when studying the E colr-expressed Cdc42Hs protein, thus far, it has been less useful for studying the isoprenylated (geranyly-geranylated Cdc42Hs protein). At present, we do not know the reasons for the difficulty, although it may be the outcome of conformational changes that are Induced by the geranyl-geranyl moiety and that thereby interfere with our ability to detect additional changes m the fluorescence of sNBD. Because of these technical difficulties, we have not yet been able to use sNBD-labeled Cdc42Hs to monitor the bmdmg of the GDP-dissociation-mhibitor (GDI).
5. Summary At present, there are a number of questions concerning the abilrtres of dtfferent regulators (GEFs, GAPS) and target molecules to bind to Cdc42Hs and related GTP-binding proteins. The ability to label Cdc42Hs with an extrmstcreporter group (sNBD) wrth a 1: 1 stoichiometry of probe incorporation per protein molecule, and without any loss of functional actrvrty, provides a powerful reagent for quantitative assays of regulatory protem and target bmdmg. The expectation is that the sNBD-labeled Cdc42Hs will be useful in defmrtively determining whether GAPS and mdrvrdual targets compete with one another for bmdmg to Cdc42Hs, or d multiple-target molecules can complex simultaneously with a single GTP-binding protein. Given the success m labelmg Cdc42Hs with an extrmsrc-reporter group, tt seems likely that stmtlar labeling approaches would be successful with other members of the family, such as the Rat and Rho proteins.
246
Nomanbhoy and Cerione
References 1. Macara, T. G., Lounsbury, K. M., Richards, S. A., McKternan, C., and Bar-Sagt, D. (1996) The Ras superfamily of GTPases. FASEB J 10,625630. 2 Boguskl, M S and McCormick, F. (1993) Proteins regulating Ras and Its relatives. Nature 366,643-654. 3. Hart, M J., Yoshuo, M., Leonard, D , Witte, 0. N., Evans, T , and Cerrone, R A. (1992) A GDP dissociation mhtbrtor that serves as a GTPase mhrbrtor for the Ras-like protein Cdc42Hs Sczence 258,8 12-8 15 4 Johnson, P. I. and Prmgle, J R (1990) Molecular characterization of CDC42, a Saccharomyces cerevzszae Gene involved m the development of cell polarity J Cell Bzol. 111, 143-152. 5 Kozma, R., Ahmed, S., Best, A., and Ltm, L (1995) The Ras-related protem Cdc42Hs and bradykmm promote formation of peripheral actm mrcrosprkes and frlopodia m SWISS3T3 ftbroblasts Mol. Cell Blol 15, 1942-1952. 6 Nobes, C. D. and Hall, A. (1995) Rho, Rat, and Cdc4 GTPases regulate the assembly of multrmolecular focal complexes assocrated with actm stress fibres, lamellipodra, and frlopodta. Cell 81,53-62 7 Bagrodra, S , DeriJard, B , Davrs, R. J., and Cerrone, R. A. (1995) Cdc42 and PAK-mediated signaling leads to Jun kmase and p38 mrtogen-acttvated protein kmase activaton. J Blol Chem 270,27,995-27,998 8 Coso, 0. A., Chiartello, M., Yu, J., Teramoto, H., Crespo, P., Xu, N., Mrkt, T., and Gutkind, J S. (1995) The small GTP-bmdmg proteins Rat 1 and Cdc42 regulate the activity of the JNK/SAPK srgnaling pathway. Cell 81, 1137-l 146 9. Minden, A., Lin, A., Claret, Abo, A , and Karm, M. (1995) Selectrve activatton of the JNK srgnallmg cascade and c-Jun transcriptional actrvtty by the small GTPases rat and Cdc42Hs. Cell 81, 1147-l 157. 10. Olson, M E , Ashworth, A., and Hall, A. (1995) An essential role for Rho, Rat, and Cdc42 GTPases m cell cycle progression through G,. Science 269, 1270-1272. 11. Hall, A. (1992) Signal transduction through small GTPases-A tale of two GAPS Cell 69, 389-391. 12. Barford, E. T., Zheng, Y., Kuang, W., Hart, M J., Evans, T., Cerione, R. A., and Ashkenazi, A. (1993) Cloning and expression of a human CDC42 GTPase-acttvatmg protein reveals a functional SH3-bindmg domain. J Blol Chem 268,26,059-26,062. 13 Hart, M. J., Eva , A , Evans, T., Aaronson, S. A., and Cerione, R. A. (1991) Catalysis of guanme nucleotide exchange on the CDC42Hs protein by the dbl oncogene product Nature 354,3 1 l-3 14 14. Manser, E., Leung, T., Sahhuddm, H., Zhao, Z., and Lim, L. (1994) A bram serme/ threomne protein kinase activated by Cdc42 and Rat 1. Nature 367,40-46. 15. Leonard, D. A , Evans, T., Hart, M J , Cerrone, R A , and Manor, D (1994) Investtgatton of the GTP-bmdmg/GTPase cycle of Cdc42Hs using fluorescence spectroscopy Blochemzstry 33, 12,323-12,328.
Regulation of Small G Proteins
247
16. Nomanbhoy, T. K , Leonard, D. A., Manor, D., and Certone, R. A. (1996) Investigation of the GTP-bmding/GTPase Cycle of Cdc42Hs using extrinsic reporter group fluorescence. Bzochemistry 354602-4608. 17. Zheng, Y , Cerrone, R A., and Bender, A (1994) Control of the vYeast bud-site assembly GTPase Cdc42 J Bzol Chem 269,2369-2372 18 Nomanbhoy, T K. and Certone, R A (1996) Characterization of the interaction between RhoGDI and Cdc42Hs using fluorescence spectroscopy J Blol Chem 271, 10,004-10,009.
16 Prenylation Assays for Small GTPases Miguel C. Seabra and Guy L. James 1. Introduction Protein prenylation involves the covalent attachment of Cl5 farnesyl or CZO geranylgeranyl (GG) isoprenoids to cysteine resrdues located at or near the COOH-terminus of various proteins. The majority of cellular proteins that are known to undergo this modtfrcation are small guanosme triphosphate phosphohydrolases (GTPases) belonging to the Ras, Rho/Rat, and Rab families. Each of these proteins require one or more COOH-termmal prenyl groups for proper subcellular localization and function (I). Three enzymes that attach prenyl groups to protems have been identified and characterized to date (2,3). CAAX farnesyltransferase (FTase) and CAAX geranylgeranyl transferase (GGTase) transfer prenyl groups to proteins whose sequences terminate with the consensus CAAX, where C is cysteine, A is an ahphatic amino acid, and X is a variable amino acid. The X residue in the CAAX-containing protems determmes which prenyl transferase will recognize it, and therefore which prenyl group will become attached to the protein: substrates for FTase usually contain methronine or serme at the X posrtron, whereas in most substrates for CAAX GGTase, the X position is occupied by a leucine residue. Small GTPases that are known to be substrates for FTase include the four Ras proteins and Rap2A, whereas CAAX GGTase substrates include the Rho, Rat, and Rap proteins (other than Rap2A). Rab geranylgeranyl transferase (GGTase) transfers GG groups to Rab proteins, most of which terminate in a CC, CXC, or CCXX consensus, where C is cysteine and X is any ammo acid. Following prenylation, small GTPases that terminate in CAAX sequences undergo two additional modifications. The -AAX tripeptide is cleaved by a protease and the newly exposed cysteine COOH group is methylated. These modrFrom
Methods m Molecular Biology, Vol 84 Transmembrane Sfgnakng Edlted by D Bar-Sag1 0 Humana Press Inc , Totowa, NJ
251
Protocols
252
Seabra and James
fications further increase the hydrophobicrty of the COOH-terminus and are also believed to be important for binding of these protems to cellular membranes (I). The mammalian enzymes that catalyze -AAX proteolysis and COOH-terminal methylation of small GTPases have not yet been purified to homogeneity, nor have their cDNAs been cloned. Methods for the m vitro modification of small GTPases by these two enzymes, usmg crude sources, can be found elsewhere (4-6). This chapter descrtbes assays that enable m vitro prenylation of small GTPases. These assays mvolve mcubation of the desired unprenylated GTPase and a radiolabeled-prenyl donor, either farnesyl pyrophosphate (FPP) or geranylgeranyl pyrophosphate (GGPP), with the appropriate protein prenyltransferase under appropriate buffer conditions. Incorporation of radiolabeled-prenyl groups into protem is determmed by ethanol/I-Xl precipitation and collection of precipitated protein onto glass-fiber filters by vacuum filtration.
2. Materials 2.1. Prenyl Pyrophosphates Tritium-labeled prenyl pyrophosphates are commercially available from several sources including Sigma (St. LOUIS, MO), DuPont-New England Nuclear (Boston, MA), and Amersham (Arlington Heights, IL). All prenylpyrophosphate stock solutions are stored at -20°C. We typically use: 1. [ 1-3H] all-trans-FPP, 15-30 Cr/mmol (DuPont-New England Nuclear Cat # NET- 1042) 2. [1-3H] all-trans-GGPP, 15-30 Ci/mmol (DuPont-New England Nuclear Cat. #NET-1052) 3 Unlabeled all-trans-FPP (Sigma Cat. # F-6892) 4. Unlabeled all-trans GGPP (Sigma Cat # G-6025).
2.2. Preparation
of Recombinant
Small-GTPase
Proteins
1. BL2 1 (DE3) bacteria (Novagen, Madison, WI) and a cDNA encoding the desired GTPase cloned into a PET (Novagen) or pRSET (Invttrogen, San Diego, CA), bacterial-expression vector 2. Standard Bacteriological Media, Reagents, and Equipment Isopropylthio-gn-galactoside (IPTG) 1sfrom Gibco-BRL (Grand Island, NY) French Press IS an SLM-Ammco from Spectromc Instruments, Rochester, NY. 3 Bacterial wash buffer. 50 m~‘!4 Tris-HCl, pH 7 5, 0 1 A4 NaCl (all buffers are filtered through a 0.22~urn filter and stored at 4°C) 4. Bacterial lysts buffer: 20 mM Trts-HCl, pH 7.5, 0.5 M NaCl, 5 mM Imidazole, 10% (v/v) glycerol, 1 mM PMSF, 5 ug/mL Pepstatm, 5 ug/mL Leupeptm, 0 5%
Prenyla tion Assays for Small GTPases
253
(v/v) Aprotinm Add 0.1 mM P-mercaptoethanol and 3 U/mL DNAse I immediately before use. 5 Fast Protein Liquid Chromatography (FPLC) system (Pharmacia, Uppsala, Sweden) and Pharmacla FPLC HR columns. 6. Nickel sepharose column buffers and reagents. a. Fast-flow chelating sepharose (Pharmacia, Cat. #17-0575-02) b. Charge buffer: 50 mM NrS04. c. Bmdmg buffer. 20 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 5 mM Imidazole. d. Column buffer A: 20 mM Tris-HCl, pH 7 5, 0.5 M NaCl, 20 mM Imidazole, 10% glycerol, 1 mM P-mercaptoethanol. e Column buffer B Column buffer A containmg 0.5 M Imtdazole. 7 GTPase dialysis buffer: 20 mM Trts-HCl, pH 7.5,O.l M NaCl, 5 mM DTT, 3 mM MgClz, 1 mM EDTA, 0 1 mM GDP
2.3. Preparation of Recombinant Prenyltransferases and REP
Protein
1. Recombinant baculovuuses encodmg: a. a-subunit of CAAX FTase/GGTase with an NH-termmal hexahistidmeaffinity tag (His-tagged). b. P-subunit of FTase. c. P-subunit of CAAX GGTase d a-subumt of Rab GGTase. e. P-subunit of Rab GGTase. f His-tagged REP- I or REP-2 2. Standard Sf9-cell media, reagents, and equipment. Parr-cell disruption bomb 1s from Parr Instruments, Mohne, IL. 3 Sf9-cell wash buffer 50 mM Trrs-HCl, pH 7 5,0.1 M NaCl 4 Sf9-cell lysis buffer: 50 mM Tris-HCl, pH 7.5,0.5 M NaCl, 2 mM MgClz, 5 mM Imidazole, 20 pM ZnC12, 1 mM PMSF, 5 pg/mL Pepstatin, 5 pg/mL Leupeptm, 0.5% (v/v) Aprotinin Add 1 mM P-mercaptoethanol and 3 U/mL DNAse I immediately before use 5 Nickel sepharose column buffers and reagents* same as listed in Subheading 2.2. 6. Prenyltransferase dialysis buffer: 50 mM Tris-HCl, pH 7.5, 0.1 M NaCl, 1 mM DTT, 20 FM ZnCl* (use 0.1 mM NP-40 for Rab GGTase and REP instead of ZnC12)
2.4. FTase Assay 1 Stock solutions for reaction buffer: 1 M Tris-HCl, pH 7.2,2 M KCl, 0 5 M MgClz, 0.1 M DTT, 1 mM ZnCl,, 10% (w/v) octyl-fi-o-glucopyranoside 2 Reaction buffer (2.5X) (prepared fresh from concentrated stock solutions for each experiment). 0 125 M Tris-HCl, pH 7.2, 0 375 M KCl, 7 5 mM MgCl,, 2 5 mM dithiothreitol (DTT), 25 pM ZnCl,, 0 5% octyl-P-o-glucopyranoslde. 3. Stop solution Absolute ethanol contammg 10% concentrated HCl.
254
Seabra and James
4 Wash solution: Absolute ethanol. 5. G4 Glass-fiber filters (Ftsher Screntrfrc, Pittsburgh, PA, Cat. #09-804-24C). 6. Vacuum filtration unit, 10 place (Hoefer Sctentrfrc, San Francisco, CA, Cat #FH224 or FH225) 7. Scmtrllatron fluid, complete-counting cocktail 3a70B and Scmtrllation Vials (Research Products International, Mount Prospect, IL).
2.5. CAAX GGTase Assay 1. Stock solutrons for reaction buffer. 1 M sodium HEPES, pH 7 MgCl*, 0 1 M DTT, 10 mM NP-40 2 Reaction buffer (2.5X) (prepared fresh from concentrated stock experiment) 0 125 M sodmm HEPES, pH 7 2,0 375 M KCl, 2 5 mM DTT, 0 75 mM NP-40 3 All other solutrons and materials required for this assay are listed m Subheading 2.4.
2,2 M KCl, 0 5 M solutions for each 12.5 mM MgCl,, identrcal to those
2.6. Rab GGTase Assay 1 Stock solutions for reaction buffer. 1 M sodmm HEPES, pH 7.2, 0 5 M MgCl*, 0 1 MDTT, lOmMNP-40 2 Reaction buffer (2 5X) (prepared fresh from concentrated stock solutions for each experiment) 0.125 M sodmm HEPES, pH 7.2, 12 5 mM MgC12, 2 5 mM DTT, 2 5 mM NP-40 3 All other solutions and materials required for this assay are identical to those listed in Subheading 2.4.
3. Methods 3.1. Preparation Small
GTPases
unprenylated
form
of Recombinant used m in vitro rn bacterra,
Small GTPase Proteins prenylation
because
prokaryotes
assays are produced lack
in
protem-prenyl-
transferase enzymes. Thus, a bacterial-expression construct contammg a cDNA for the small GTPase of interest is required, preferably with an NH2terminal affinity tag to facilitate purification. We typrcally use either the PET (Novagen) or pRSET (Invitrogen) series of bacterial-expression vectors. Protems expressed from these vectors contam an NH-terminal hexahistidme sequence
that allows
sepharose columns
one-step
affmrty
purification
of the protein
on nickel-
(see Note 1).
3.1.1. Growth of Bacteria and Preparation of Bacterial Lysate 1 Inoculate 4 x 50-mL cultures of LB/Amprcrllm with BL21(DE3) bacteria contaming the desired plasmtd and mcubate overnight m a 37°C shaker
255
Prenylation Assays for Small GTPases
2. Inoculate 4 x 1-L cultures of LB/Ampicllhn with 20 mL each of saturated overnight bacterial culture and incubate m 37°C shaker until the absorbance at 600 nm (OD6& reaches 0 5-l .O, usually -2-3 h. Add IPTG to a final concentration of 0.5 mM and incubate cultures an additional 2-3 h. 3. Collect bacteria by centrlfugation at 2000 rpm for 20 mm at 4’C. Resuspend m a total of 200 mL of ice-cold bacterial wash buffer and centrifuge as above 4 All steps are carried out at 0-4°C. Resuspend washed bacterial pellet in 20 mL of bacterial lysls buffer and add 0.1 mM P-mercaptoethanol and 3 U/mL DNAse I. Pass cells twice through a French Press, collectmg the lysate on ice. 5. Centrifuge the lysate at 100,OOOg for 30 mm. Transfer supernatant to a fresh tube and keep on ice until ready to apply on the nickel sepharose column.
3.1.2. Purification by Nickel Sepharose-Affinity
Chromatography
1. Pack a Pharmacla HRlO/lO column with lo-12 mL of fast flow chelating sepharose, prewashed with 3 x 50 mL ddH20. 2. Charge the resin with nickel with 50 mL of charge buffer, wash with 50 mL of binding buffer, and equlhbrate column with 50 mL of column buffer A, at a flow rate of 1 mL/mm. 3. Apply the entire bacterial-lysate supernatant from Subheading 3.1.1., step 5. (20-30 mL) and wash column with 100 mL of column buffer A, followed by a 25-mL linear gradient from O-5% m column buffer B, at a flow rate of 1 mL/min. Increase the flow rate to 2 mL/min and wash with 100 mL of 5% buffer B Bound proteins are eluted with a 150-mL gradient from 5%-100% buffer B and collected in lo-mL fractions. Elutlon of protein from the column is monitored by absorbance at 280 nm. 4. An allquot of each fraction (lo-50 p.L) spanning the peak detected at ODzso 1s analyzed by SDS-PAGE followed by Coomassle blue staining. 5. Pool peak fractions and dialyze overnight in 6 L of GTPase dialysis buffer (see Note 2). 6. Concentrate dialyzed material (Centriprep 10 Concentrator, Amicon, Beverly, MA) to l-2 mL accordmg to the mstructions of the manufacturer and determine protein concentration after concentration. Freeze m multiple aliquots at -80°C.
3.2. Preparation of Recombinant Prenyltransferases and REP
Protein
We prepare recombinant-protem prenyltransferase enzymes by infection of Sf9 cells with recombinant baculovlruses encoding each subumt of the desired enzyme (ref. 7; see Note 3). Alternatively, purified or partially purified preparations of the native enzymes can be obtained by procedures described elsewhere (see Note 4).
256
Seabra and James
3.2 1. Preparation of Recombinant FTase, CAAX GGTase, Rab GGTase, and REP 1. Infect a 0.25 to 1-L culture of Sf9 cells (1 x lo6 cells/ml) with recombinant baculoviruses encodmg the a- and P-subunits of FTase, CAAX GGTase, and Rab GGTase, or REP. When producing protein prenyltransferases, Sf9 cells are comfected with both the a- and P-subumt-encodmg viruses at a multiplicity of infection of two a-subumt and two P-subumt viruses per Sf9 cell. When producmg REP, the multlphcity of infection should be 0.5 viruses per cell. 2 Forty-eight hours postinfectlon, the cells are harvested by centrifugation at 1lOOg for 10 mm at 4°C and washed once with 200 mL of ice-cold Sf9 cell-wash buffer All subsequent manipulations are performed on Ice. The cell pellet IS resuspended m 25 mL of ice-cold Sf9 cell-lysls buffer and 1 mM P-mercaptoethanol and 3 U/mL DNAse I are added. 3 The cells are lysed by two passages through a French Press or by nitrogen cavlta-
tlon in a Parr-cell dlsruptlon bomb. The lysate 1s centrifuged at 100,OOOg for 30 mm, and recombinant proteins are purlfled from the supernatant by nickel sepharose-affinity chromatography exactly as described above for the punficatlon of small GTPases (see Subheading 3.1.2.) 4. Peak fractions are pooled and dialyzed overnight m 6 L of protem-prenyltransferase dialysis buffer The dialyzed enzyme IS concentrated to -1 mg/mL (Centriprep 10 Concentrator, Amlcon) and stored at -80°C m multiple ahquots
3.3. FTase Assay Reactions should be performed m duphcate 12 x 75 borosilicate glass tubes m a total volume of 50 FL. The example given below is for an assay in which the amount of FTase and [3H]FPP is held constant and the amount of small GTPase is varied. (See Note 5 for a description of different variations of this assay.) 1 Prepare 2.5X reaction buffer (see Subheading 2.4.) on ice. In addition to the components listed m Subheading 2.4. include 2.25 pM unlabeled FPP, 0.75 /AM [3H]FPP, and 20 ng recombinant FTase. The speclflc actlvlty of r3H]FPP m the assay 1s 12,375 dpm/pmol. A 5-10% excess of reaction mixture is prepared to prevent losses upon ahquotmg. The order of addltlon of the reaction buffer components 1s usually the following* ddH,O, buffer, detergents, metals, DTT, prenyl pyrophosphate, and enzyme. Dispense 20-FL ahquots of 2.5X reaction buffer into each 12 x 75 tube on ice 2 The GTPase to be assayed 1s added to the reaction m a volume of 30 FL. Serial dilutions are prepared m GTPase dialysis buffer (Subheading 2.2.) ranging from 0 5-50 @4 m threefold increments (on Ice) Thirty mlcrohters of each dilution are combined with 20 p.L of 2.5X reaction buffer on ice. This represents a 1 67fold dilution of the small GTPase, so that the fmal concentration in the assay will range from 0 3 to 30 pA4. Broader concentration ranges may be tested as needed.
Prenylation Assays for Small GTPases
257
3. Reactions are initiated by placing the tubes m a 37°C water bath for the desired length of time. Usually prenylation assays are linear up to 30 mm, and therefore incubation times of 10-30 mm are commonly used. 4 Reactions are stopped by the addltlon of 1 mL of stop solution, vortexed for 5 s, and incubated at room temperature for 30 min. Longer mcubatlons ~111not affect the measurements. Two milliliters of wash solution are added to each tube and the precipitate is collected by vacuum filtration onto G4 glass-fiber filters. Each filter is subsequently washed twice with 2 mL each of wash solution, allowed to dry briefly under vacuum, and then placed m scmtillation vials. Five milliliters of scintillation fluid are added, and the vial is capped and counted on a scintillation counter (see Note 6). 5. Blank reactions containing FTase and C3H]FPP, but lackmg small GTPase substrate, should be performed m parallel and the values obtained from these reactions subtracted from each of the other values to determine specific mcorporatlon of [3H]farnesyl into protein. The results are usually expressed as pmol of [3H]farnesyl incorporated mto protem/umt of time.
3.4. CAAX GGTase Assay 1. The 2.5X reaction buffer (Subheading 2.5.) is prepared with 1.25 pJ4 r3H]GGPP and 100 ng recombinant CAAX GGTase. The specific activity of [3H]GGPP m the assay is 33,000 dpm/pmol. All other steps are identical to those described above for the FTase assay (see Note 7).
3.5. Rab GGTase Assay 1. The 2.5X reaction buffer (Subheading 2.6.) is prepared with 12.5 @J unlabeled GGPP, 125 pM [3H]GGPP, 100 ng recombinant Rab GGTase, and 100 ng of REP. The specific activity of [3H]GGPP in the assay is 3000 dpm/pmol. All other steps are identical to those described above for the FTase assay (see Note 8).
4. Notes 1. Partial proteolysis of the COOH-termini of small GTPases will generate truncated protems which lack the prenyl-acceptor cysteine residues. Truncated Rab proteins are especially problematic because they are competitive mhlbltors of the reaction. Although COOH-terminal truncation of CAAX-containing GTPases does not generate competitive Inhibitors of prenyl transferases, their presence in the assay lowers the concentration of functional substrate and thus interferes with kinetic analysis. To mmlmlze proteolysis m vivo, harvest the bacteria after the shortest possible induction time with IPTG. To avoid the generation of truncated forms m vitro, fresh protease mhlbltors should be added to the lysis buffers and the bacterial lysates should be carefully maintained at 0-4”C throughout the purification procedure. 2. The GTPase-dialysis buffer requires GDP, an expensive chemical. A cheaper alternative is as follows. Incubate the peak fractions from nickel-sepharose chro-
258
3.
4.
5.
6
7.
8
Seabra and James matography with 10 nnl4 GDP for 30 mm on ice. Dialyze the protein pool with 6 L of GTPase-dialysis buffer m the absence of GDP overnight, then dialyze for 3 h with 1 L of complete GTPase-dialysis buffer. Concentrate protem sample and store at -80°C m multiple ahquots. Recombmant Rab GGTase does not contam a His-tag and therefore cannot be purified by nickel-sepharose chromatography A detailed procedure for the preparation of recombinant Rab GGTase from baculovirus-infected Sf9 cells has recently been published elsewhere and should be apphed to Rab-GGTase purification (7). Many labs do not have the capabrhty of producing recombmant proteins from insect cells. An alternative approach is to use purified enzyme from tissue sources. Procedures to purify FTase (8,9), CAAX GGTase (10,11), Rab GGTase, and REP (12,13) have been published and should be followed. However, these protems are not abundant and only small amounts of enzyme can be purified m this way. The simplest alternative to obtain these enzymes m order to perform m vitro prenylation assays is to use partially purified preparations. A simple procedure involvmg ion-exchange chromatography of soluble extracts from rat bram has been published elsewhere (13) The concentration of salt, detergent, lipid substrate, and protein substrate m the prenylation assays affect the rate and extent of the reactions. Therefore, the general conditions given in the Subheading 3. should serve as a reference, and it is important to keep m mind that the assay for novel substrates will need to be optimized The prenylation assays described m this chapter are simple and reliable Nevertheless, the precipitation step has been the source of problems m the past. The older procedure used TCA/SDS prectpitation, which proved unreliable when the total protem concentration m the assay was low. We have not experienced any problems with the ethanol/HCL precipitation method described. However, an alternative semiquantitative method for analyzing the product of the reaction IS to SubJect the prenylation mixtures after mcubation to SDS-PAGE and autoradiography. In vitro prenylated proteins contam covalently bound radiolabel-prenyl groups that can be quantified by measuring the radiolabel associated with the protein band (14). In in vitro assays, FTase has only been observed to transfer farnesyl groups to the appropriate GTPase substrates However, CAAX GGTase has been shown to transfer farnesyl as well as geranylgeranyl to the small GTPases RhoB, RaplA and RaplB (ref. 15, G.L.J., unpublished observations). In cases m which ambiguity exists, the structure of the prenyl group attached to the small GTPase should be determined after purification from cultured cells or tissue extracts. The concentration of detergent m the Rab GGTase assay should be raised above the critical-micellar concentration so that micelles are formed. Detergent mmelles stimulate the reaction because they serve as acceptors for prenylated Rab, the product of the reaction (Id). Detergents that stimulate the reaction are NP-40 and Trnon X-100 Detergents that are mhibitory include sodmm cholate, zwittergent
Prenylation Assays for Small GTPases
259
3-14, and octyl-P-glucopyranosrde. An alternatrve to detergents are phosphohprd vesicles. Phosphatydilcholme vesicles (25 pg/reaction) stimulate the reaction as well as NP-40 (17)
References 1. Glomset, J. A. and Farnsworth, C. C. (1994) Role of protein modification reactions in programming interactions between ras-related GTPases and cell membranes. Annu. Rev Cell Btol 10, 181-205. 2. Brown, M S. and Goldstein, J. L. (1993) Protein prenylatton. Mad bet for Rab. Nature 366, 14,15. 3. Casey, P. J. and Seabra, M. C. (1996) Protein prenyltransferases. J Bzol Chem.
271,5289-5292. 4 Lm, L., Jang, G F , Farnsworth, C. C., Yokoyama, K., Glomset, J. A., and Gelb, M H. (1995) Synthetic prenylated peptides studymg prenyl protem-specific endoprotease and other aspects of protein prenylation. Methods Enzymol. 250, 189-206. 5 Ma, Y. T., Gilbert, B. A., and Rando, R R (1995) Farnesylcysteme analogs to probe role of prenylated protein methyltransferase. Methods Enzymol 250, 226-234 6 Gilbert, B. A., Ma, Y. T., and Rando, R. R. (1995) Inhibitors of prenylated protem endoprotease Methods Enzymol 250,206-2 15. 7. Armstrong, S. A., Brown, M. S., Goldstein, J. L., and Seabra, M C. (1995) Preparation of recombinant rab geranylgeranyl transferase and rab escort proteins. Methods Enzymol 257,30-41. 8. Reiss, Y , Seabra, M. C , Goldstein, J L , and Brown, M S. (1990) Purification of ras Farnesyl:Protem transferase Methods Companion Methods Enzymol 1, 241-245. 9. Reiss, Y., Goldstein, J. L., Seabra, M. C., Casey, P J , and Brown, M S. (1990) Inhibition of purified p2lras farnesyl:protein transferase by Cys-AAX tetrapeptides. Cell 62, 8 l-88 10. Yokoyama, K. and Gelb, M. H. (1993) Purification of a mammalian protein geranylgeranyltransferase. Formation and catalytic properties of an enzymegeranylgeranyl pyrophosphate complex. J Blol Chem 268,4055-4060 11 Moomaw, J. F and Casey, P. J. (1992) Mammalian protein geranylgeranyltransferase. Subunit composition and metal requirements J Biol Chem 267, 17,438-17,443. 12 Seabra, M. C., Brown, M. S , Slaughter, C A., Sudhof, T C , and Goldstein, J. L. (1992) Puriftcation of component A of Rab geranylgeranyl transferase: possible identity with the chorotderemia gene product. Cell 70, 1049-1057. 13. Seabra, M. C., Goldstein, J. L., Sudhof, T C , and Brown, M. S (1992) Rab geranylgeranyl transferase. A multisubunit enzyme that prenylates GTP-bmdmg proteins terminating m Cys-X-Cys or Cys-Cys. J Bzol Chem 267, 14,497-14,503.
Seabra and James 14 Farnsworth, C. C , Casey, P. J , Howald, W. N , Glomset, J A , and Gelb, M. H (1990) Structural analysis of prenyl groups Methods Companion Methods Enzymol 1,23 l-240 1.5 Armstrong, S. A., Hannah, V. C., Goldstein, J. L , and Brown, M S. (1995) CAAX geranylgeranyl transferase transfers farnesyl as efficiently as geranylgeranyl to RhoB. J Blol Chem 270,7864-7868. 16 Andres, D A., Seabra, M C , Brown, M S., Armstrong, S. A., Smeland, T E , Cremers, F. P M , and Goldstein, J. L. (1993) cDNA cloning of component A of rab geranylgeranyl transferase and demonstration of its role as a rab escort protein. Cell 73, 1091-1099. 17. Shen, F. and Seabra, M. C. (1996) Mechanism of drgeranylgeranylatron of Rab proteins: Formatron of a complex between mono-geranylgeranyl Rab and Rab escort protein. J Blol Chem 271,3692-3699
17 Analysis of Myristoylated and Palmitoylated Src Family Proteins Amy Wolven, Wouter van’t Hof, and Marilyn D. Resh 1. Introduction Several hundred viral and cellular proteins have been shown to be covalently modified by fatty acids (1-3). The two most common modifications, myristoylatron and palmitoylatron, differ with respect to the type and chemical nature of fatty acid attachment to the polypeptide backbone. Most proteins destined to become N-myrrstoylated contain the sequence: Met-Gly-X-X-X-Ser/ Thr at their N-terminn. After the mrtratmg methionine 1s removed, the 14-carbon fatty acid myristate is attached via amide linkage to the N-terminal glycme residue. The reaction occurs cotranslationally and 1s catalyzed by the soluble enzyme N-myristoyl transferase (NMT). NMT exhibits strict specificity for an N-terminal glycme and mutation of this glycine to alanme abrogates myristoylation. In contrast, palmitoylated proteins contam the 16-carbon fatty acid palmttate attached via throester linkage to one or more cysteme residues. Palmrtoylation is a posttranslational reactron that appears to be mediated by a membrane-bound palmrtoyl acyl transferase. Unlike myristoylation, whrch 1s generally a relatively stable modification, palmitoylatron can be reversed by the action of thioesterases. Dynamic palmrtoylation has recently been shown to play key roles in the regulation of protein localization and function. The Src family of tyrosme kmases have proved to be excellent model systems for studying the enzymology and biochemistry of protein fatty acylatron (4-6). All mne family members are N-myrrstoylated, and N-myristoylation is necessary, but not sufficient, for membrane binding of these proteins. In addition, seven of the rune Src family members contain the sequence: Met-Gly-Cys at their N-terminii. Cysteme-3 has recently been shown to be a site for From
Methods
m Molecular Bology, Vol 84 Transmembrane Slgnabng Edlied by D Bar-Sag! 0 Humana Press Inc , Totowa, NJ
261
Protocols
262
Wolven, van? Hof, and Resh
palmltoylation (4-&J, thereby generatmg a dually fatty acylated N-terminal region. Here we present methods for analyzmg fatty acid mcorporatlon mto cellular proteins, using Src family members as examples. The analyses are enhanced when cells overexpressing Src family members in a transient (Cos cells) or stable (National Institutes of Health [NIH] 3T3 cells) manner are used as source material. Two types of Isotopic-labelmg methods are discussed, which use either commercially available 3H-labeled myristate and palmitate, or 1251-labeled synthetic fatty acid analogs of myrlstate and palmitate containmg 1251at the a-carbon of the fatty acid (9). Use of the lz51-labeled fatty acids slgmficantly shortens the radloautographic-exposure times required to vlsuallze acylated proteins.
2. Materials 1 Radioactive fatty acids: a. The synthesis and radlolodmatlon of lodo-fatty acid analogs has been described (9,10) The lodo-fatty acid 1s stored lyophkzed m glass vials at -20°C until use
b. 9,10-[3H]myrlstlc and palmitic acid can be purchased from DuPont NEN 2. Dulbecco’s modified Eagle’s medium (DMEM) containing 2% dialyzed fetal bovine serum (FBS), stored at 4°C 3. Reagents for cell lysls and immunoprecipltatlon: a. STE buffer, 100 mi’V NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA. Store at 4°C. b. Aprotinm and leupeptin, 10 mg/mL, dissolved m 100 mM Tris-HCl, pH 8.0 and stored at -20°C. c. Phenylmethylsulfonyl fluoride (PMSF), 100 mM, dissolved m isopropanol and stored at room temperature. d. Lysis buffer, 50 mM Tns-HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 2 mM EDTA, 5 mM NaF Add aprotmin and leupeptin to a final concentration of 10 pg/mL and PMSF to a final concentration of 1 nuI4 right before use. Lysls buffer can be stored at 4°C e. Protein A agarose can be purchased from Santa Cruz Biotechnology. 4. Reagents for thm layer chromatography (TLC) analysis: a. RPS-F plates can be purchased from Analtech b TLC solvent system of wateracetic acld:acetomtnle at 1.1.75: 1 75, v/v/v. c. EN3HANCE spray for 3H-labeled proteins can be purchased from DuPont.
3. Methods 3.1. Cell Labeling
and lmmunoprecipitation
1. Grow adherent cells such as flbroblasts (NIH 3T3) and Cos-1 expressmg transfected Src family members m DMEM containing 10% calf serum (NIH 3T3) or FBS (Cos- 1) until 80-90% confluent, corresponding to roughly 10 x lo6 cells per 60-mm dish.
Fatty Acylation of Src Proteins
263
2. Wash cells rapidly once with DMEM, 2% dialyzed FBS warmed to 37”C, and starve for 1 h at 37°C m l-2 mL DMEM, 2% dialyzed FBS. 3 Typrcally, 25-50 yCi/mL of radrolabeled-fatty acid 1s used to label cells. Drssolve the iodo-fatty acid analog (16-[1251]iodohexadecanoic acid [IC16] or 13-[ ‘25]todotridecanoic acid [IC 131) m 10 yL ethanol per plate to be labeled. For each plate, add 100 pL of DMEM, 2% dialyzed FBS to the analog and mix to allow the analog to equihbrate with the medmm. Then add the mixture to the starvation medium on the cells. 4 Alternatively, 9,10-[3H]palmnrc acid or 9,10-[3H]myristic acid (25-50 @/mL) can be used to label cells Transfer the fatty acid to a vial and dry using a gentle stream of nitrogen. Resuspend the fatty acid in ethanol and DMEM, 2% dialyzed FBS, and add to the cells as described for the iodo-fatty acid analogs. Alternatively, fatty acid can be resuspended m medium by brief somcation. 5. Label cells for 4-12 h with the iodo-fatty acid analogs or 4-5 h with the 3H fatty acids m a 37°C 5% CO2 mcubator. 6. For pulse-chase experiments, wash cells twice after cell labeling with chase media (DMEM, 10% calf serum, lo-fold excess of nonradioactive-fatty acid) and then incubate for various times in chase media For example, a concentratron of 200 FM palmitic acid is approx 10 times the amount of original IC 16 added to cells if 50 pCi/mL is used 7. After labelmg, place cells on ice and wash twice with cold STE buffer. Lyse each plate of cells m 1 mL lys~s buffer by incubating on ice for 5-10 min. Scrape the lysed cells off of the dish and transfer the lysate into a centrrfugation tube and clarify by centrifugation for 15 mm at 100,OOOg at 4°C. 8. Transfer the clarified lysate to a 1 5 mL Eppendorf tube and rmmunoprecipnate with the appropriate amount of anti-Src family member antibody and protein A agarose for 2 h at 4°C. 9. Wash rmmunoprecrpnates three times with 1 mL of lysis buffer by spmmng for 1 mm at 14,000g in a microfuge at 4°C. 10. Resuspend the final protem A pellet m 30 pL 2X SDS sample buffer contammg 0.1 M dithiothreitol (DTT) and load onto an sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE). 11. Dry the gel and subject it to phosphorimager analysis or autoradiography
3.2. Analysis
of Fatty Acids Incorporated
into Acylafed
Proteins
1. Locate the region of the gel containing the fatty acylated protein by ahgmng dried gel with the fluorogram Excise the band and soak m 0.5 mL H20 30 mm to rehydrate Remove solution and filter backing paper. 2. For acid hydrolysis: Crush the gel piece with a glass rod and hydrolyze m 0.5 of 6 N HCI at 100°C for 18 h. Neutralize wrth 0.5 mL of 6 N NaOH 3. For base hydrolysis: Crush the gel piece with a glass rod and hydrolyze m 0.5 of 1 5 N NaOH for 24 h at 25°C Neutralize with 0 75 mL of 1 N HCl
the for mL mL
264
Wolven, vat-0 Hof, and Resh
4 Extract the hydrolysate twice wrth 1 mL of chloroform. Dry the pooled-chloroform fractions under a stream of mtrogen, and then redissolve in a small volume of acetone. 5 Fatty acid analysis is performed by reversed phase thin-layer chromatography on reversed phase silica-F (RPS-F) plates. Develop the plate with a mobile phase of water:acetic actd:acetomtrile at 1: 1 75.1.75 v/v/v. Dry the plate with a hair dryer and SubJeCt to autoradiography (1251)or fluorography with EN3HANCE spray Be sure to include fatty acid standards.
4. Notes 1. Certain modtfrcations of the synthesis of the rodo-fatty acid analog have been made from the original procedures(9,10). High-pressure hqutd chromatography (HPLC) purification of radiolabeled analog is no longer routinely performed TLC analysis of the unpurified product has shown that it is as pure as HPLC fractions previously used (unpublished results) In addition, yield is increased becausethere is normally lossof product during the HPLC procedure. Typically, 2 pmol of fatty acid is iodmated with 5 mCr of Na’251.Without the HPLC procedure, 90-100% yield is obtained, giving a specific activity of 2.5 mC1per pmol fatty acid. The fatty acid should be used within 60 d, before it has decayed one half-life, to obtam the best labeling. 2. The rodo-fatty acid analogsstick to plastrc. When possible, useglassmicropipets and vials for transfer and storage of the iodo-fatty acid analogs. 3. Iodo-fatty acid is superior to 3H fatty acid m that the exposure time for autoradiography is reduced. In addition, the phosphorrmager(Molecular Dynamics) can be used with the iodo-fatty acids and quantitation of the gel can be performed Exposure times for phosphorimager range from 1 to 4 d. 4. The amount of iodo-fatty acrd analog or 3H fatty acid used in cell labeling varies depending on the level of expression of the protein of interest In transiently transfected Cos-1 cells, for example, 25 pCi/mL is sufficient. However, stable NIH-3T3 cell lines may not be expressing as much protem as Cos-1 cells and 50 pCr/mL is needed m order to vrsuahze protein in a reasonable amount of time. We have found that the level of overexpression m stable cell lines of p59funis 5-10 times that of endogeneousprotem, whereas m transiently transfected Cos-1 cells, the level of overexpression is 20-50 times that of endogeneous protein. 5. In the case of transiently transfected Cos-1 cells, the best results have been obtamed by followmg this schedule d 1, transfect cells, d 2, split cells into 60-mm dishes; d 3, perform cell labelmg. 6 Cell labeling times must be kept short when 9,10-[3H] fatty acids are used m order to prevent breakdown of the fatty actd and mcorporation mto the polypeptide backbone of newly synthesized proteins. In the case of the iodo-fatty acid analogs,the iodine doesnot becomeincorporated mto the polypepttde backbone after lo-12 h incubations (unpublished results)
Fatty Acyla tion of Src Proteins 7. If low-serum media 1s used durmg chase condltlons, then the excess fatty acid may come out of solution upon addition to media A 1.1 molar ratio of bovine serum albumin (BSA) can be added to the media to promote solublhzatlon of the fatty acid. 8. If expression levels of the protein of interest are low, the followmg precaution should be taken to reduce background levels. Before cell lysls, cells should be washed at least two times with STE buffer. Otherwise the label may run as a smear at 60-70 kDa on the gel, presumably because it is bmdmg to BSA present m the cell media. 9. Immunoprecrpltatlon should be performed for short periods of time (2-6 h) If the expression levels of the protein of interest are low, because loss of the palmltate label can occur over long periods of time. Currently, no Inhibitors of fatty acid thioesterases are known. 10. Owing to the labde nature of the thloester bond, samples labeled with IC16 or 3H-palmltlc acid should not be boiled before loading onto SDS-polyacrylamide gels, as these condltlons will result in significant loss of label from the protein. 1 I To shorten exposure times of lodo-fatty acid-labeled protems, gels can be dried between two sheets of cellophane which have been wetted by soaking in 10% glycerol for 5-10 mm. The dried gel can then be sandwlched between two mtenslfying screens and exposed at -80°C. 12 Acid hydrolysis 1s used to analyze N-myristoylated proteins contammg amldelinked fatty acid. Base hydrolysis removes ester-lmked fatty acids (e g., palmltate); amide-linked fatty acid 1s resistant to base treatment. 13 In the summer, we found that TLC plates absorb moisture when the humidity 1shigh, resulting m aberrant-migration patterns. Predrymg the plates with a hair dryer Just prior to loadmg the samples promotes umform chromatography condltlons
References 1. Johnson, D R., Bhatnagar, R. S , Knoll, L. J , and Gordon, J. I. (1994) Genetic and blochemlcal studies of protein N-mynstoylatlon. Annu Rev Bzochem 63, 869-914. 2 Casey, P. J (1995) Protein lipldation m cell signaling. Science 268, 221-225 3 Mllllgan, G., Parentl, M., and Magee, A. I. (1995) The dynamic role of palmltoylation in signal transduction. Trends Bzochem. Sci 20, 18 l-l 86 4. Resh, M. D (1994) Myrlstylatlon and palmltylatlon of Src family members The fats of the matter. Cell 76,41 l-413. 5. Alland, L , Peseckls, S M , Atherton, R. E., Berthlaume, L , and Resh, M. D (1994) Dual myrlstylatlon and palmltylation of Src family member p59fyn affects subcellular locahzatlon J Bzol Chem 269, 16,701-16,705 6. Koegl, M., Zlatkme, P., Ley, S. C , Courtneldge, S A , and Magee, A. I (1994) Palmitoylation of multiple Src-family kinases at a homologous N-terminal motif
Blochem .I 303,749-753 7 Robbms, S M., Qumtrell, dlfferentlal palmltoylatlon
N A , and Bishop, J. M (1995) Myrlstoylatlon and of the HCK protem tyrosme kmases govern then
266
Wolven, w-0 Hof, and Resh
attachment to membranes and association with caveolae. Mol. Cell. Bzol. 15, 3507-3515. 8. Shenoy-Scarta, A. M., Dietzen, D. J., Kwong, J., Lmk, D. C., and Lublm, D. M. (1994) Cysteme-3 of Src family protem tyrosme kinases determmes palmitoylation and localization in caveolae. J. Cell Blol 126, 353-363. 9. Peseckis, S M., Deichaite, I., and Resh, M. D (1993) Iodmated fatty acids as probes for myristate processing and function J. Bzol Chem 268,5 107-5 114 10. Berthiaume, L., Peseckis, S. M., and Resh, M. D (1995) Synthesis and use of todo-fatty actd analogs Meth Enzymol 250,454-466
18 Ultracentrifugation Technique for Measuring the Binding of Peptides and Proteins to Sucrose-Loaded Phospholipid Vesicles Carolyn A. Buser and Stuart McLaughlin 1. Introduction The binding of extrinsic proteins to membranes is important for their biological activity m many different systems. Consider a few examples from the calcium/ phospholipid second-messenger system (reviewed m refs. I and 2). First, membrane binding facilitates interactton of the Gg protein with both its activated receptor and its membrane-bound effector, phosphoinositide-specific phospholipase C (PLC-p). Second, it enhances the ability of PLC to hydrolyze its membrane-bound substrate phosphatidylmositol 4,5&s-phosphate (PIP,) in a precessive manner (i.e., the enzyme can “scoot” over the surface, hydrolyzing many PIP2 molecules before desorbing from the membrane). Third, membrane binding increases the probability that protem kinase C (PKC) will phosphorylate its membrane-bound substrates, which include ~~60s” (Src) and MARCKS (mynstoylated alanine-rich C kinase substrate). Fourth, membrane binding is required for the biological activity of proteins such as Src and Ras. All these proteins bind to the membrane by a combination of electrostatic and hydrophobic interactions (see refs. 3 and 4 and references therem). This chapter describes a simple ultracentrifugation technique for measurmg the binding of extrinsic proteins and peptides to membranes. Bindmg to membranes can be measured either by distinguishing bound from free protein spectroscopically (e.g., by monitoring changes m fluorescence of labeled lipids or proteins) or by physically separating bound from free protein (5). Methods of separation include dialysis (5,6), ultrafiltration (7-9), and ultracentrifugation (10-15). In each case, the free and bound protein concentrations can be measured by standard methods, e.g., functional assays, spectroscopic From
Methods m Molecular Biology, Vol 84 Transmembrane S/gna/mg Edlted by 0 Bar-Sag1 0 Humana Press Inc , Totowa, NJ
267
Protocols
268
Buser and McLaughlin
(vesicles
+ bound
peptides)
Fig. 1. Cartoon of the sucrose-loaded vesicle-bmdmg assay. Circles represent sucroseloaded vesrcles, and wavy lures show peptrdes in the salt buffer. See text for detarls analysis, chemical derivnization, radioactive labels, or quantrtatrve high performance liquid chromatography (HPLC). The cartoon m Fig. 1 depicts the sucrose-loaded vesicle-binding assay: large unilamellar vesicles (LUVs) loaded with sucrose buffer are mixed with the protein or peptrde of interest (left); once bmdmg has reached equihbrmm, the solutron is centrifuged to separate the membrane-bound peptide/protein (pellet) from free peptide/protein (supernatant). The sucrose solution inside the vesicles is iso-osmotic, with the salt solution outside the vestcles. The difference in density of the solutions, however, causes the vesicles to sediment. This technique has been used to measure the membrane binding of the protems PLC-6r (IO), PKC (I&19), MARCKS (II), and Src (14), as well as peptrdes corresponding to the membrane-binding domains of MARCKS (12) and Src (13). The sucrose-loaded vesicle-binding assay is conceptually similar to equilibrium dralysis but is faster, requnmg only l-2 h. Protein adsorption to the centrifuge tube does not affect the measurement of the bmdmg constant. Lipid concentration (see Note 1) and temperature are easily controlled. Once separated, the free- and bound-pepttde/protem concentrations can be determined by any appropriate technique. For example, the measurements we describe in Subheading 3. use either a fluorescence assay (see Subheading 3.2.) or radioactive label (see Subheading 3.3.) to determine the concentration of membrane-bound peptrde (pellet) and free peptrde (supernatant). Fluorescamine, a fluorophore that reacts with primary amines, is most useful m the quantitation of Lys-containing peptides in the ~k&mkI concentration range. Radioactive labels or other techniques are generally required to quantitate sub-mrcromolar peptide or protein concentratrons.
Binding of Proteins to Phospholipid
269
Vesicles
For simplicity, we restrict our theoretical discussions to the case where the molar concentration of peptide bound to the membrane, P,, is much lower than the molar concentration of lipid accessible to the peptide, L. That is, we consider only the case where there is no interaction between the adsorbed peptides and all adsorption isotherms reduce to the simple form: [PI,/
(1)
m = K [PI
where K is a molar partition coefficient (see ref. 6), and [P] is the molar concentration of the peptlde in the bulk aqueous phase. Note that Eq. 1 has the same form as the limiting version of a mass actlon equatron or Langmuir adsorption isotherm, which assumes that the peptlde forms a 1: 1 complex with a lipid (which is generally not true). Thus, l/K may be regarded as an apparent dissociation constant. By defining [PI,,, = ([PI + [PI,) and adjusting experimental conditions to [L]>> [PJm, the percent peptlde bound (%P bd) is: %Pbd=
lOOx[P],/[P],,,=
lOOxK[L]/(l
+K[L])
(2)
K is determined from a least squares fit of Eq. 2 to the data, which 1s conventionally plotted as %P bd vs log [L]. In Subheading 3., we show how the sucrose-loaded vesicle technique has been used to measure the membrane binding of peptides correspondmg to the NH2 terminus of v-Src, the product of the v-src gene of Rous sarcoma virus (for reviews of Src, see refs. 20 and 21). The NH2 terminus of Src 1s mynstoylated and contams a hydrophilic amino acid sequence rich in positively charged residues (myr-GSSKSKP_KDPSQm, denoted myr-Src[2-161). Src binds to the membrane by both the hydrophobic insertion of the mynstate into the bdayer and the electrostatic interaction of NH,-terminal basic residues with acidic lipids (13,14).
2. Materials 2.1. Equipment 1 Lipex Blomembranes Extruder (Vancouver, Canada) 2. Scintillation vials (5 mL) and cocktail. 3 Polyallomer Beckman mlcrofuge tubes (1.5 mL; Beckman Instruments,
Palo
Alto, CA).
4. Ultracentrlfuge for centrifugatlon at 100,OOOg (e g., Beckman TL-100) and rotor (TLA-45) that holds 1 5-mL Eppendorfs. 5. Borosdicate field, NJ)
glass culture tubes (OD x L = 12 x 75 mm; Fisher Scientific, Sprmg-
6. Fluorometer. 7. Semi-micro ELKAY Ultra-Vu MA). 8. Scmtlllation counter.
disposable cuvets (ELKAY
Products, Shrewsbury,
270
Buser and McLaughlin
2.2. Reagents and Buffers 1 Salt buffer prepare 100 n&f KCl, 1 nu!4 3-(N-morpholmo) propane sulfomc acid (MOPS), pH 7 0. Store at 20°C and use within 2 wk. 2 Sucrose buffer prepare 176 mM sucrose, 1 mM MOPS, pH 7 0. Store at 20°C and use within 1 wk. 3 Prepare aqueous solutrons with 18 MQ H,O (Milhpore, Bedford, MA) If avadable, remove trace orgamcs m this Hz0 by brdistillation m an all-quartz still. 4 Fluorescamine solution: prepare 30 mg fluorescamine (Sigma, St. LOUIS, MO) m 50 mL of 1,Qdioxane (0.007% H20; Baxter Healthcare Corp, Muskegon, MI), this solvent is a carcinogen. Fluorescamme IS light-sensttrve and must be stored m the dark at room temperature, use wrthrn 2 wk 5 Lipids: Use zwitterionm lipids, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholme (PC) and 1palm~toyl-2-oleoyl-sn-glycero-3-phophosethanolam~ne (PE), and acidic lipids, 1-palmitoyl-2oleoyl-sn-glycero-3-phosphoserme (PS), and l-palm~toyl-2-oleoyl-sn-glycero-3-phosphoglycerol (PG), from Avant1 Polar Lipids (Birmmgham, AL). Use the triammonium salt of phosphatidylmositol 4,5-bzs-phosphate (PIP,) from Calbrochem (La Jolla, CA). Obtain radiolabeled 1,2-di[l-14C]oleoyl-~-phosphatidylcholme (14C-PC) from Amersham (Arlington Heights, IL); use appropriate procedures for handling of radroactrve materials Ship lipids on dry ice and store at -20 or -70°C 6. High-purity, solvent-grade chloroform from Burdock and Jackson (Muskegon, MI); chloroform is a carcinogen and should be used only in the fume hood.
3. Methods 3.1. Preparation of Sucrose-Loaded Large Unilamellar Vesicles In this section, we describe the preparation of LUVs with sucrose buffer in the vesicle interior and salt buffer on the exterior. 1. Stock lipid solutions are generally in CHC13 or CHCls:alcohol mixtures and require special handling a. Use a glass pipet tip for lipid transfer (e.g., a Drummond prpetor), b. Wear gloves to protect hands from CHCl, and to protect the lipid solutions from the skin’s fatty acids; c. Make sure all glassware is clean (rinse once with solvent-grade CHCl, immediately prior to use), d. Transfer stock lipids into glass or teflon containers (do not use plastic); and e. Cap the stock lipid solution immediately after use to avoid evaporation of CHC13 and possible oxidation of lipid headgroups. (For long-term storage, flushing with Ar helps prevent oxidation of lipids.) 2 Determine the mmal lipid concentration m CHCl, by measuring the dry weight of small ahquots of solutron (25 pL) on a Cahn electrobalance. This method gives the same results as phosphate analysis (6,7).
Binding of Protems to Phospholipid Table 1 lsoosmotic
Sucrose
KCl, mM 25 50 100 150 200 300 500
Vesicles
271
and KCI Concentration@ Sucrose, rGl4 48 92 176 256 331 471 714
5’ee ref. 26 for detads
3. Prepareabout twice the calculated amount of lipid necessaryfor the actual bmdmg experiment to compensatefor the loss of lipid during the preparation of sucroseloaded LUVs. Combme the phosphohpidsfor the final vesicle composition m a pear-shapedflask and add about 3 uL of r4C-PC per 1 mL of vesicles. The relative lipid concentration throughout the experiment is monitored by the mcorporatton of trace amountsof r4C-PC. Completely dry the CHCl, solution of lipids m a rotary evaporator equippedwith a water bath at 30°C. Somehprd mixtures require special care. For example, if PIP, 1srequired, usethe triammomumsalt 4 Resuspendthe dry lipid film in sucrosebuffer containing 1 mM MOPS at pH 7.0 to the calculated volume for a given final lipid concentration Adjust the sucrose concentration to be isoosmotic with the salt buffer usedm the measurement(see Table 1). Vortex the flask to make multilamellar vesicles (MLVs). Transfer the MLVs to a biofreeze vial designed for freezmg in liqutd N2 and purge the vial with clean, dry gaseousN, (or Ar) before sealing. 5. Reduce the size and increasethe total entrapped volume of the MLVs by taking the lipid solution through five cycles of freezing (77 K, liquid NJ and thawing (3O“C, water bath). 6. Place 20 l.tL of the MLV solution into each of three scintillation vials for determtnation of the pre-extrusion cpm/pL (see step 11) If the aqueousresuspension and transfer of lrpids are performed carefully, the lipid recovery at this point is nearly complete. The pre-extrusion counts of radtoactivity (cpm&L) serve asthe reference point for the determination of liprd concentration m all subsequent steps. If this step is deleted, a phosphateanalysis is necessaryto determme the final liptd concentrations m the binding assay. 7. PrepareLUVs by extruding the vesicles 10 times at a N, pressureof 350-400 psi through a stack of two polycarbonate filters (0.1 pm diameter pore size) m a Lipex BiomembranesExtruder (or a hand-held extruder; seeNote 2). (Steps 4-7 m this section basically follow the procedure first described by Hope et al., ref. 22.) Vesicles of this size are umlamellar (23). Follow the manufacturer’s direc-
272
Buser and McLaughlin
ttons for the assembly of the extruder Before lipid extrusion, extrude two volumes of 2.5 mL sucrose buffer. After the 10 lipid extrusion cycles, extrude several vol of H,O (remember that these washes go mto radioactive waste). Dismantle the extruder and wash the stainless-steel components with MeOH, CHC13, MeOH, and Hz0 (m the given sequence), wash the o-rings briefly with MeOH followed by H,O, and wash the filter support with MeOH followed by H,O (pull the solvent/H20 through the filter support with a vacuum) Certam lipids (e.g., PIP,) are difficult to clean from the filter support, and it may be advantageous to dedicate a given filter support to a certam type of lipid or lipid mixture. 8 After extrusion, place 20 pL LUVs mto each of two scmttllation veals for determmation of the postextrusion cpm (see step 11) 9 Remove the sucrose solution on the outside of the LUVs by a fivefold dilution of the LUV solution into the salt buffer and ultracentrifugatron (1 h, lOO,OOOg, 25°C) For example, for small hptd volumes (2 2.4 mL), dtlute 200 l,tL of lipid solution m 1 mL salt buffer into each of 12 Beckman centrifugatton Eppendorfs (1.5 mL capactty) 10 Immedtately after centrifugatton, remove (and save) as much supernatant from each sample as possible with a plasttc ptpet tip without disturbing the pellet. Resuspend the pellets by vortexmg vigorously. Depending on the lipid composttion and concentration, the pellet may be difficult to resuspend immediately, tf necessary, let the pellets sit for about 15 min to soften. Combme the pellets mto one tube, wash the tubes with a small amount of salt buffer (be careful to maintain a higher lipid concentration than used m the binding measurement), and vortex The washed sucrose-loaded vesicles are stable for l-2 d (see
Note 3) 11 Place 20 pL of pellet solution into each of two scmtlllation vials for the determination of the lipid concentration m the pellet. Prepare one 20-yL background sample contammg only salt buffer. Add 4 mL of scmttllation cocktail to the pre-extrusion (see step 6), postextrusion (see step S), pellet (see step ll), and background (denoted bck, see step 11) scmttllation veals. Vortex each vial and determine the 14C-PC cpm m a scinttllation counter (lower channel hmit = 1 and upper channel limit = 670) Subtract the background cpm from each measurement, divide by the volume of sample measured (i.e., 20 pL), and calculate the final hptd concentration m the resuspended pellet [L]f = [L], ic (pellet 14C cpm&L)
/ (pre-extruston
t4C cpm&L)
(3)
where [If and [L], are final and mitral hpid concentrattons. Substitute the postextrusion cpm/pL for the pellet cpm&L m Eq. 3 to determine the percent lipid lost during extrusion. Generally, 520% of hptd 1s lost during extruston and about 20% of hptd is lost durmg centrifugatton. If the final lipid concentration is unexpectedly low, measure the radtoacttvny of a 300~pL ahquot of the mixed supernatant to determine whether the lipid was lost during centrtfugation or during resuspension of the pellet
Binding of Proteins to Phospholipld
0 10-B
IO"
10-7
106
IO-5
IO-4
IO-3
Vesicles
lo-2
273
10-S
IO-4
DPW(M)
IO-3 IWdJ
IO"
IO-'
04
Fig. 2 Membrane binding of myrlstoylated (A) and nonmyrlstoylated (B) peptldes correspondmg to residues 2- 16 of Src (Gly-Ser-Ser-Lys-Ser-Lys-Pro-Lys-Asp-ProSer-Gln-Arg-Arg-Arg) The results were obtamed with a sucrose-loaded veslclebinding assay, using LUVs formed from PC (open symbols) or 2.1 PC:PG (closed symbols) m 0.1 M KC1 buffered to pH 7.0 with 1 or 10 mkI MOPS. Replacement of PG with PS did not affect the membrane
binding
of myr-Src(2-
16) and data from both
PC.PG and PC:PS hpld mixtures are shown m panel A. The pep&deconcentration was assayedby fluorescamme (circles, Subheading 3.2.) or by radioactivity (squares; Subheading 3.3.); identical results were observed for the bmdmg of peptlde to PC. [lipid] = acessiblehpid concentration = one-half the total hpld concentration Error bars representthe standarddeviations of duplicate measurementsat the mdlcated lipid concentration. The data were fit with Eq. 2 to determine the partition coefficient, K. The apparent assoclatlon constants for the two mdlvidual interactions are K = IO4 M-l for the hydrophobic insertion of the myrlstate (binding of myr-Src(2-16) to PC) and K = lo3 M-l for the electrostatic interaction of basic residueswith acidic lipids (binding of nonmyr-Src(2-16) to 2:l PC:PG). The synergism or apparent cooperatlvlty between the hydrophobic and electrostatic interactlons results m the high affinity binding of myr-Src(2- 16) to LUVs containing 33% acidic lipids: K = lo7 M-' (bmdmg of myr-Src(2-16) to 2:l PC.PG) SeeBuser et al. (23) for details
3.2. Sucrose-Loaded with Fluorescamine
Vesicle-Binding Assay
Measurement
In this section, we describe the sucrose-loaded vesicle-bmdmg assay. We measure the free and bound peptlde concentration after ultracentrifugation by
a modified fluorescamme assay (13,24). Because fluorescamme reacts with primary ammes, avoid using amme-containing lipids, such as PE or PS; instead, use PC for a zwitterlomc lipid and PG for an acidic lipid. Figure 2 illustrates this assaywith the binding of myr-Src(2- 16) to PC LUVs and the binding of its nonmyristoylated
analog, nonmyr-Src(2-16),
to 2:l PC:PG LUVs.
274
Buser and McLaughlin
1 For peptide measurements, prepare a stock-peptide solution m H,O If the peptide is msoluble m H20, prepare a concentrated stock solution (e g., 5 mM) m a solvent such as dimethyl sulfoxide (DMSO) and then prepare a second drlution into H,O. Adjust the stock concen-tration such that the volume of added peptrde is about 10 pL. Be sure to check that small solvent amounts do not affect vesicle mtegrity. For protein measurements, munmize the amount of detergent, because most detergents can affect the bmdmg constant and, at higher concentrations, can solubrlrze the LUVs 2. If the binding of the peptrde to membranes involves an electrostatic interaction, it is crucial to work n-r the limit of [peptrde] << [lipid] (see Eq. l), so that the peptrde does not bmd a sigmficant fraction of the acidic lipid and change sigmficantly the charge density of the vesicle The concentration of peptide is within the correct limit rf the same partition coeffrcrent, K, IS observed for two peptide concentratrons 3 The followmg samples and controls should be together in the same centrifugation cycle. a Duplicate (or triplicate) peptlde-hprd samples, b. One lipid only control, c One buffer control; and d Two peptide only controls (to check that the peptrde does not sediment m the absence of lipid). Prepare a second lipid only control (which is not centrifuged and labeled NS for “no spin”) to determine the final lipid concentration (see step 5) Adjust the salt buffer volume such that each sample has a final assay volume of 1000 pL (this may be adjusted according to the experiment, but generally volumes between 300 and 1200 pL are used) Notes 4-6 provide a few suggestions toward munmizmg the loss and/or aggregation of peptide or protein For a 12-positron rotor (e.g., Beckman TLA-45), it is convenient to measure the peptide binding for three lipid concentrations as described m Table 2 4. Vortex each sample gently and equilibrate for 15-30 mm at room temperature or m a temperature-controlled water bath. Vortex once more after equihbratron and centrifuge samples a--d. of step 3 for 1 h, lOO,OOOg, at 25°C (adjust temperature to the experiment) 5. Immediately after centrifugation, place 900 pL of each supernatant into a labeled 5 mL test tube. While the pellets soften, transfer 300 pL of the supernatant from each test tube to correspondmg scmtillatron vials (for determmatlon of the percent lipid remammg in the supernatant after centrifugation). Also place 300 yL of the NS lipid-only control from step 3 into each of two scintillation vials Add 4 mL of scmtillatron cocktail to each vial, vortex, and determme the 14C-PC cpm m a scmtillatron counter (over one channel from l-670) Subtract the background cpm from each measurement, divide by the volume of sample measured (to obtain cpm/pL), and calculate the final lipid concentration by:
Binding of Proteins to Phospholipld Table 2 Description of Samples for a Sucrose-Loaded Vesicle-Binding Sample # Sample name 192 3,4 56 7, 7NSa 8,8NS 9,9NS
10,ll 12
Ll +P L2+P L3+P Ll L2 L3 P B
Vesicles
275
Experiment Description
Lipld at first concentratmn + pep&de (m duplicate) Lipid at second concentration + peptlde (m duplicate) Lipid at third concentration + peptide (in duplicate) Lipid only at first concentration Lipid only at second concentration Lipid only at third concentration Peptide only (in duplicate) Buffer only
aNS denotes “no spin”, these samples are for the determmatlon of the lipld concentration and are not centrifuged [L]f = [L],
x
(NS lipid only 14Ccpm/pL) / (pre-extrusion 14Ccpm/yL) (4)
and calculate the percent lipid (L) remaimng in the supernatant (sup) by: %L m sup = 100 x (sup 14C cpm&L) / (NS lipid only 14C cpm/yL)
(5)
6. Gently resuspend the pellets from step 5 and transfer each 100~PL pellet volume into a 5 mL, labeled test tube. If the loss of peptlde to the Eppendorf tubes or pipet tips 1s significant and/or if its concentration is low (< 1 PM), resuspend the pellets with a plpet tip by sucking and expelling the pellet solution several times (rather than vortexmg), before transferring into the test tube. Add 500 VL of salt buffer to each test tube. Both the pellet- and supernatant-containing test tubes now have Vtot = 600 yL. 7. Determine the peptlde concentration m the supernatant and pellet fractions by a fluorescamme assay. Proceed with one sample at a time smce the fluorescence signal decreases slowly with time. First, raise the pH of the sample (V = 600 pL) from 7 to about 10 by the addition of 5 PL of 0 1 N KOH. Then, add 250 FL of fluorescamine (2.2 mM m dioxane) to the test tube while vortexmg. Transfer the sample from the test tube to a semi-micro cuvet, and measure the fluorescence mtenslty (I) of the sample (h,, = 390 nm, h,, = 475 nm) wlthm l-2 mm of the two additions. To increase the fluorescence signal m this assay, see Note 7 8. Calculate the percent peptlde bound to LUVs (%P bd) from* %P bd = 100
x
[ 1 - (Z(sup) / (I(sup) + Z(pellet)))]
(f-3)
This calculation requires a number of corrections, which include the removal of supernatant for scmtillation counting, the presence of supernatant remaining with the pellet, the background light scattering of the lipids, and the percent lipid m
276
Buser and McLaughlin
the supernatant. Thus, the easiest method to calculate the %P bd m Eq. create a spreadsheet according to the format m Table 3, m which one row lates the %P bd for one sample at a given lipid concentration. 9. Check that the peptlde did not spin down during centrlfugatlon (%P spin by subtractmg the fluorescence mtenslty of the buffer background from the peptlde and calculatmg %P
spin
down
=
100
x
(l-W,,,
/ Vsup
,,,d
/ &.IM
/ Vpe~~et
6 is to calcudown) that of
,,,,>I 1
(7)
where Lp meaSand VpelletmeaSare the volumes of supernatant (600 pL) and pellet (100 pL) measured m the fluorescence assay. The %P spm down should be between -10 and +lO%. Refer to Subheading 4. for hints to avoid sedimentation of the peptlde or protein 10 Plot the %P bd versus [L] on a semi-log plot (Fig. 2) Determme the bmdmg constant, K (the apparent assoclatlon constant), from a least squares fit of Eq. 2 to the data The reciprocal of the molar partition coeffclent, l/K, can be regarded as an apparent dlssoclatlon constant. It is apparent from Eq. 2 that l/K 1s equal to the accessible lipid concentration that binds 50% of the peptlde
3.3. Sucrose-Loaded Vesicle-Binding and Radioactivity Assay In this section,
we describe
Measurement
the sucrose-loaded
vesicle-binding
assay for
radiolabeled peptides; the radioactive label allows for quantltation of peptlde concentrations
Bindmg of Proteins to Phospholipid
Vesicles
Table 3 Method to Calculate
Bound
Column
Percent
Peptide
Eauation
col(l) col(2) col(3) col(4) col(5) col(6)
col(7) col(8) col(9) col( IO) col(l1) col(12) col( 13)
=w+e,,, =WJ,“, =w+~)pellet = col(3)/(col(3)-col(4)) = (col(2)-col(6))/col(5) = (co1(7)-col(8)) x col( 11) + (col(9)-col( 10))
col( 14)
= (co1(7)-col(8))
col( 15) col( 16)
= (1 - (col( 14)/col( 13))) x 100 = %L in sup
col( 17)
= col(15) x lOO/(lOO - col(16))
“Sup = supematant.
x col( 12)
277
in a Fluorescamine
Assay
Descrmtion Final [L] m umts of M calculated by Eq. 4 Total sample volume durmg assay Volume of supa removed after centrifugation Volume of sup used for scmtillation counting Volume of sup m the fluorescence assay True volume (pL) of the pellet, this value depends on the lipid concentration; a useful empirical formula is Vpel = 2000 x [Ljf Fluoresence I of the lipid-peptide sup Fluorescence I of the lipid sup Fluorescence I of the lipid-peptide pellet Fluorescence I of the hpid pellet Multiphcation factor for col( 13) Multiplication factor for col( 14) Calculation of the total fluorescence I (pellet and sup, corrected for the amount of sup used m scmtillation counting) Calculation of the sup fluorescence intensity, corrected for the Vs,,,t and the volume of sup remammg m the pellet fraction Percent peptide bound Percent lipid m sup, calculated by Eq. 5 Percent peptide bound, corrected for the % lipid m the sup
Buser and McLaughlin
278 5 Immediately after centrrfugatlon,
place 200 pL of each supematant mto a labeled scintillation vial. 6 Gently resuspend the pellets and transfer each 200 pL pellet into a labeled scmttllation vial. 7 Add 4 mL of scmtillatton cocktail to the pre-spm samples (step 3), the post-spm supernatants (step S), and the post-spin pellets (step 6) and measure the radroacttvtty in two channels (l-400 and 401-670). Subtract the cpm of channels 1 and 2 of the buffer background control from the cpm of channels 1 and 2 of each sample. Deconvolute the 3H and t4C signals by followmg the protocol described in the scmtillation counter manual and calculate the 3H and t4C cpm/pL for each sample. 8 Calculate the final hptd concentratton by. [LJf = [LJ, x (pre-spm t4C cpm/pL) / (pre-extrusion
14C cpm/pL)
(8)
If the deconvolution procedure 1s correct, then [LJf calculated from a lipidpeptide sample equals [L], from a lipid-only control sample (for a given lipid concentration) 9 Calculate the percent hprd in the supernatant (%L in sup) by: %L in sup = 100 x (sup r4C cpm/pL) / (pre-spin 14C cpm/p.L)
(9)
10. Calculate the percent pepttde bound (%P bd) by first calculating the total trrtmm counts from the peptrde dtvtded by the total volume (3HP,): 3HP,,t = (sup 3H cpm/p L x Vsup + pellet 3H cpm/pL x Vpellet> / Kup + Vpellet) ( 10) where Vpelletand VSUpare the pellet and supematant volumes, respectively. calculate the percent peptrde bound (%P bd) by. %P bd = 100 x [ 1 - ((sup 3H cpm/pL) / 3HP,J]
Then (11)
and correct for the %L in sup (Eq. 9) by: %P bd,,, = %P bd x (100 / (100 - %L m sup))
(12)
Note that m the case of negligible loss of peptrde to the eppendorf and prpet tips, 3HPt0t cpm/pL = prespm 3H cpm/pL. 11. Plot the %P bd,,, vs the log of [L]; see Fig. 2
4. Notes 1. The sucrose-loaded vestcle-bindmg assay 1s limited to lipid concentrattons m the range lo-* M < [L] < 6 x 1OW2 M, becauseof hptd adsorption to Eppendorf tubes, and so on at low concentratrons, and difficulties m resuspendmgthe membrane pellet at high concentrattons. 2. A handheld extruder (Nucleopore swm lok Falter holder by Nucleopore Corp, Pleasanton,CA) can be usedm lieu of the Lrpex BromembranesExtruder m Subbeading 3.1. for lipid volumes of <2 mL and concentratrons
Bindmg of Protems to Phospholipici Vesicles
3.
4.
5.
6.
7. 8.
279
centratrons may be used, but the back pressure becomes quite high and leaks occur). Handheld extruston 1sdescribed in MacDonald et al. (25). The binding experiment has a few convenient “stoppmg” places: the resuspended lipids can be kept frozen for l-2 wk within the freeze/thaw cycle in step 5 of Subheading 3.1., and the pelleted sucrose-loaded vesicles from step 10 in Subheading 3.1. are generally stable at 20°C for l-2 d To decrease the loss of peptide or protein during the bmdmg experiment, choose the order of additions carefully (buffer first, then lipid, then peptide). In some cases, it may help to pretreat the polyallomer Beckman tubes with Srgmacote from Stgma, and/or use slhcomzed pipet tips. It is often necessary to add carrier proteins, such as bovine serum albumin (BSA) or gelatm, to reduce the loss of protein and/or to add reductants, such as dtthlothreitol, to maintam protein stability. These additions did not compromrse the brological assay used m the membrane binding measurements of PLC-6r (10). In some cases, the pepttde or protein may aggregate. This wrll confound any binding measurement. To prevent aggregation and spin-down of peptide/protein m the absence of lipid, add small amounts of suitable solvent (e.g., 2% DMSO) or detergent (e.g , TX-100) (13,141. If either addition is necessary, check whether it affects the vesicle integrity and the partitioning of the peptide by measuring the binding for at least two drfferent concentrations of solvent or detergent The sensitivity of the fluorescamine assay can be increased by complete acid digestion of the peptrde, but this is not recommended for routine measurements When workmg at low peptide (or protein) concentrations and momtormg peptlde radioactivity, prepare a stock mixture of radioactive and nonradioactive pepttde to minimize the loss of peptide to the tubes and pipet tips. If pep&de sedrmentation is a problem, pre-spm this mixture under the same centrifugation conditions as used m the bmdmg assay and use the supernatant from this prespm in the binding experiments.
Acknowledgments Stuart McLaughlin acknowledges the support of NSF grant MCB-94-19175 and NIH grant GM-2497 1, and the Damon Runyan / Walter Wmchell Cancer Research Fund grant #1267 to CAB.
References 1. Berrtdge, M. J. (1993) Inositol trrsphosphate and calcium slgnallmg. Nature 361, 3 15-325. 2. Clapham, D. E. (1995) Calcium signaling. Cell 80,259-268. 3. Buser, C. A., Kim, J., McLaughlin, S., and Pertzsch, R M. (1995) Does the bmdmg of clusters of basic residues to acidic lipids induce domain formation m membranes? Mol Membr Blol. 12,69-75. 4. McLaughlm, S , Buser, C., Denisov, G., Glaser, M., Miller, W. T , Morris, A., Rebecchi, M., and Scarlata, S. (1996) The importance of hprd-protein interactions
280
5
6
7.
8. 9.
10.
11.
12.
13
14.
15
16. 17
18
Buser and McLaughlin m signal transduction through the calcium-phosphohprd second messenger system, m Molecular Dynamzcs of Membranes (Op den Kamp, J A., ed ), Springer Verlag, Berlm, pp 229-244 Wrmley, W C. and White, S H. (1993) Quantttatton of electrostatrc and hydrophobic membrane mteractrons by eqmhbrmm dialysis and reverse-phase HPLC. Anal Blochem 213,213-217 Pertzsch, R M and McLaughlin, S (1993) Binding of acylated peptrdes and fatty acrds to phospholrprd vesicles: Pertinence to myrrstoylated proteins Bzochemzstry 32, 10,436-10,443. Kim, J., Mostor, M , Chung, L A., Wu, H., and McLaughlin, S (1991) Bmdmg of pepttdes with basic residues to membranes containing acidic phospholiptds Biophys J 60,135-148 Mosror, M. and McLaughlin, S. (1991) Peptides that mrmtc the pseudosubstrate region of protein kmase C bmd to actdtc lipids in membranes. Bzophys J. 60, 149-159 Mostor, M and McLaughlm, S (1992) Bmdmg of baste pepttdes to acidic lipids m membranes Effects of msertmg alanme between the basic residues Blochemutry 31, 1767-1773 Rebecchr, M , Peterson, A., and McLaughlin, S (1992) Phosphoinosrttde-specific phosphohpase C-6, binds with high affmtty to phospholrptd vesicles containing phosphattdylmosrtol4,5-brsphosphate. Bzochemlstry 31, 12,742-12,747 Kim, J , Shrshodo, T., Jrang, X , Aderem, A., and McLaughlin, S (1994) Phosphorylatton, high romc strength and calmodulin reverse the bmdmg of MARCKS to phosphohptd vesicles. J B~ol Chem 269,28,214-28,219. Kim, J., Blackshear, P. J., Johnson, J D., and McLaughlin, S (1994) Phosphorylatron reverses the membrane assocratton of pepttdes that correspond to the basic domains of MARCKS and neuromodulin Blophys J 67,227-237 Buser, C. A., Stgal, C T., Resh, M. D., and McLaughlin, S. (1994) Membrane bmdmg of myrtstylated peptrdes correspondmg to the NH, terminus of Src. Blochemlstry 33, 13,093-13,101 Sigal, C T., Zhou, W., Buser, C A , McLaughlin, S., and Resh, M. D (1994) Ammo-terminal basic residues of Src mediate membrane binding through electrostatic mteractton with acrdtc phospholrptds. Proc Nat1 Acad Scl USA 91, 12,253-12,257 Hetmburg, T. and Marsh, D. (1995) Protein surface-dtstrtbutron and protemprotein mteracttons in the bindmg of pertpheral proteins to charged hptd membranes. Blophys J 68,536-546. Mostor, M. and Epand, R. M. (1993) Mechanism of acttvatton of protein kmase C* Roles of drolem and phosphatrdylserme Blochemcstry 32,66-75 Mosror, M and Epand, R. M (1994) Characterrzatron of the calcmm-bmdmg site that regulates assocratton of protein kmase C wrth phospholtprd bilayers. J Bzol Chem 269,13,798-13,805. Mosior, M and Newton, A C (1995) Mechamsm of mteractron of protein kmase C wtth phorbol esters. Reverstbtlny and nature of membrane association. J Blol Chem 270,25,526-25,533.
Binding of Proteins to Phospholipid
Vesicles
281
19. Mosior, M. and Newton, A. C. (1996) Calcmm-independent binding to mterfacial phorbol esters causes protein kmase C to associate with membranes m the absence of acidic lipids. Bzochemzstry 35, 1612-1623. 20. Parsons, J. T. and Weber, M. J (1989) Genetics of src: structure and functional organization of a protein tyrosine kinase Curr Top Microbial Immunol 147, 79-127. 21. Resh,M. D. (1990) Membrane mteractions of pp60V-STC. a model for myristoylated tyrosine protein kineses.Oncogene 5, 1437-1444. 22. Hope, M. J., Bally, M B., Webb, G., and Cullis, P. R (1985) Production of large umlamellar vesicles by a rapid extrusion procedure. Characterization of size distribution, trapped volume and ability to mamtam a membranepotential Bzochzm Blophys Acta. 812,55-65. 23. Mm, B. L., Culhs, P. R., Evans, E A., and Madden, T. D. (1993) Osmotic properties of large umlamellar vesicles prepared by extrusion. Bzophys J 64,443-453 24. Wetgele, M., DeBernardo, S. L., Tengi, J. P., and Leimgruber, W. (1972) A novel reagent for the fluorometric assayof primary ammes J Am Chem Sot 94, 5927-5928
25 MacDonald, R C , MacDonald, R I, Menco, B P , Takeshita, K , Subbarao,N K , and Hu, L.R. (1991) Small-volume extrusion apparatusfor preparation of large, unilamellar vesicles Biochzm Blophys Acta 1061, 297-303. 26. CRC Handbook of Chemistry and Physuzs (1980) CRC Press,Boca Raton, FL
19 Biochemical and Biological Analyses of Farnesyl-Protein Transferase Inhibitors Nancy E. Kohl, Kenneth S. Koblan, Charles A. Omer, Allen Oliff, and Jackson B. Gibbs 1. Introduction Farnesyl-protein transferase (FPTase) catalyzes the posttranslational addition of the IScarbon isoprenoid, farnesyl, to approx 20 cellular proteins. Farnesylation is essential for the membrane localization and function of the modified proteins. Among these proteins are the products of the 1-0soncogenes, Harvey (Ha), Kirsten (Ki), and N-Ras. Ras is synthesized in the cytoplasm as a biologically inactive precursor that localizes to the plasma membrane and attains cell-transforming activity upon famesylation (I-4). FPTase has therefore become a target for the development of inhibitors of Ras function, which will be effective against human tumors (5-7), particularly leukemias and pancreatic and colon carcinomas where oncogenically mutated MS genes are frequently found (8). Here, we describe a series of in vitro, cell-based, and in vivo assays that permit the identification and characterization of inhibitors of FPTase. The two substrates of the farnesylation reaction, the isoprenoid-donor famesyl diphosphate (FPP) and the protein acceptor (i.e., Ras), have been used as the basis for the design of FPTase inhibitors (9-13). The peptide-derived inhibitors are mimetics of the C-terminal Ras CAAX (C, cysteine; A, usually aliphatic amino acid; X, any amino acid; for FPTase substrates, X is usually methionine or serine) tetrapeptide that is the signal for protein prenylation. In addition, potent inhibitors have also been discovered by screening chemical collections and natural products (5,14). The general approach used by our laboratory and others is to identify a potent and selective inhibitor of the FPTase enzyme, demonstrate that the inhibitor From:
Methods
in Molecular Biology, Vol. 84: Transmembrane Signaling Edited by: D. Bar-Sagi 0 Humana Press Inc., Totowa, NJ
283
Protocols
Kohl et al.
284
blocks intracellular-protein farnesylation, and then test the ability of the inhibitor to block ras-mediated cellular transformation in cell culture and m animals. A first step in the characterization of a potential inhibitor 1sthe determination of the compound’s intrinsic FPTase inhibitory potency. The selectivity against the structurally and functionally related geranylgeranyl-protein transferase (GGPTase) type I IS also determined. Several assays have been used to evaluate the ability of a compound to inhibit intracellular FPTase, including inhibition of Ras processing (10,12) and inhibition of [3H]mevalonate (a precursor of FPP) mcorporation into prenylated proteins (II). Because farnesylation affects the mobtlity of Ras on denaturing gels, Ras processing is readily monitored by SDS-PAGE. Thus, both immunoprecipitation and tmmunoblotting techniques can be used to monitor Ras processing in treated cells. Intracellular specificity of the compound for mhibition of FPTase vs GGPTase I can be monitored by using a GGPTase I substrate, such as Rapl, in the same assays(10). The ability of cell-active FPTase inhibitors to reverse the ras-transformed phenotype m mammalian cells has been evaluated in several ways, mcludmg inhibition of anchorage-dependent growth (11,15), anchorage-independent growth (12), and morphological reversion (11,15). All of these assaysmonitor a unique characteristic of a ras-transformed cell, which distinguishes the transformed cell from a normal cell. Cell-active FPTase inhibitors can then be evaluated m mouse-tumor models of cancer, including the nude-mouse xenograft model and in a ras transgenic mouse-tumor model (MMTV-v-Ha-rus Oncornice). The first animal model monitors tumor formation followmg subcutaneous implantation of rastransformed cells; thus, the ability of FPTase inhibitors to block ras-tumor formation is ascertained. The Oncornice develop mammary- and salivary-gland carcinomas that have genetic and pathological features that more closely resemble real human cancers. The FPTase inhibitors are tested in Oncomice having established tumors, and the efficacy of FPTase inhibitors in this model may be more predictive of clinical utility. 2. Materials 2.1. FPTase Assay 1. Purified recombinant-human FPTase. The enzyme IS produced m E. co/l and purified as described (16,17).
2. [3H] FPP,40 Ci/mmol (American Radiolabeled Chemicals,St. Louis, MO). 3 An unprenylated FPTase substrate such as E c&produced
ras-cysteme valine
isoleucine methiotune (CVIM). This protein is expressedfrom the plasmid [Leu68lrasl (term.)-serine leucme Lysme (SLKCVIM) and is purified as described
Analyses of FPTase Inhibitors
4. 5. 6. 7. 8.
(18). Because E cofz lacks prenyltransferases, the recombinant prenylated. Assay buffer (10X): 500 mM HEPES, pH 7.5, 50 mM MgCl,, 100 @U ZnC12, 1% (w/v) PEG 20,000 Whatman (Clifton, NJ) GF/C filters. Brandel cell harvester (Model MB-24L, Gaithersburg, MD). Scmtillation fluid (1 e , ReadiSafe, Beckman, Fullerton, CA) Scintillation counter.
285 protem is not 50 mM DTT,
2.2. GGPTase I Assay 1. [3H]geranylgeranyl pyrophosphate (GGPP), 15 Cr/mmol (American Radiolableled Chemicals) 2. An unprenylated-GGPTase I substrate such as E. co/z-produced Ras-CAIL (A, alanine) (IS). 3. Partially purified recombmant-human GGPTase I (16,19).
2.3. Ras Processing
Assay
1. Rodent fibroblasts transformed by an activated H-ras, such as Rat l/t-as cells (20) 2. Labeling medium: methiomne-free medium supplemented wrth 10 pL/mL, 200 mil4 glutamme (Grbco), 10% regular media, 2% fetal bovine serum (FBS), and 133 pCr/mL [35S]methionine (Amersham, Arlington Heights, IL, cell-labelmg grade). 3. Lysis buffer: 1% Nomdet P-40, 20 mM HEPES, pH 7.5, 5 mM MgCl*, 1 mM DTT, 0.5 mA4 PMSF, 10 pg/mL aprotinin, 2 pg/mL leupeptm, and 2 j,tg/mL antipain. 4. The anti-Ras rat monoclonal antibody (MAb), Y 13-259 (Santa Cruz Biotechnology, Santa Cruz, CA) (21). 5. Protem A-Sepharose beads(Pharmacia, Piscataway, NJ). 6 Rabbit antiserum to rat immunoglobulin G (IgG, Cappel, Malvern, PA). 7. Wash buffer: 20 mM HEPES, pH 7.5, 1 mM EDTA, 1% Trrton X-100, 0.5% deoxycholate, 0.1% SDS, 0 1 M NaCl.
2.4. Soft-Agar
Assay
1. Transformed cell lmes capable of anchorage-independentgrowth. Human-tumor cell lines, as well as oncogene-transformedrodent fibroblasts, can be used. Cell lines transformed by an oncogenethat is dependent on farnesylation for transformation, such as an activated ras allele, would be expected to be sensitive to the test compound, whereas cell lines transformed by an oncogene that is mdependent of farnesylation for transformation, such as v-r@, would be expected to be nonresponsive. 2. Low gellmg-temperature agarose(type VII, Sigma, St. Louis, MO). 3 Six-well trssueculture clusters (i.e., #152795, Nunc, Naperville, IL). 4. p-iodonitrotetrazolium violet (Sigma).
286
Kohl et al.
2.5. Nude-Mouse
Xenograff
Assay
1. Female nude mice 6-10 wk old (Harlan Laboratories, Haslett, MI or Charles River Laboratories, Wilmington, MA). 2 Transformed cell lines capable of forming tumors in nude mice. Because there is a good correlation between cells that exhibit anchorage-independent growth and those that form tumors m vtvo, the cell lines used for the soft-agar assay can be used for the nude-mouse xenograft assay.
2.6. Ras-Oncomouse
Assay
1. Female MMTV-v-Ha-rus oncornice (Charles River Laboratories, Wilmmgton, MA). These animals harbor the viral Ha-ras oncogene under the control of the mouse mammary tumor virus (MMTV) long-terminal repeat and develop spontaneous mammary and, to a lesser extent, sahvary tumors with a latency of 12 wk-yr. 2. Calipers (i.e., Fisher Scientific #12-120).
3. Methods 3.1. FTPase Assay 1. To an Eppendorf tube on me add: the test compound, 5 pmol [3H]FPP, 5 pmol ras-CVIM, 0.05 pmol human recombinant FPTase, 5 PL 10X assay buffer, and water to bring the volume to 50 i.tL. 2. Initiate the reaction by tmmersion m a 30°C water bath. 3. Following incubation for 30 min, add 1 mL of 10% HCl in EtOH to precipitate the radioactive farnesylated ras-CVIM and to hydrolyze the remammg tsoprenoid substrate. 4. After allowing the quenched reactions to stand at room temperature for 15 min, add 2 mL of EtOH. 5. Filter each reaction through a Whatman GF/C filter using a Brandel-cell harvester. Wash each filter four times with EtOH. 6. Mix each filter with scintillation fluid and count m a scintillation counter
3.2. GGPTase Assay Perform
the assay as outlined
above, substituting
[3H]GGPP
for the [3H]FPP
and using 50 pmol E. co&produced ras-CAIL as the protein substrate and 0.34 pmol partially purified human-recombinant GGPTase I as the enzyme. 3.3. Ras-Processing
Assay
1 To subconfluent ras-transformed cells m loo-mm dishes, add 3 mL of fresh media containing the desired concentration of test compound. Cells treated with lovastatin (15 FM), a compound that blocks Ras processing m cells by inhibitmg a rate-hmmng step in the tsoprenoid-biosynthetic pathway (1,22,23), serve as a positive control m this assay
Analyses of FPTase Inhibitors
287
2 Followmg mcubation at 37°C for 4 h, replace the media with 3 mL of labeling media contaming fresh compound. 3 Followmg Incubation at 37°C for 20 h, remove the media and wash the cells once with cold phosphate buffered saline (PBS). Scrape the cells mto 2 mL of cold PBS and collect them by centrtfugation (1OOOg for 5 mm at 4°C). 4. Add 1 mL of lysrs buffer to each cell pellet and vortex to lyse the cells 5. Clear the lysate by centrifugatron (100,OOOg for 45 mm at 4°C). Save the supernatant. 6. For immunoprecipitation, use an equal number of acid-precipitable counts Brmg the appropriate volume of lysate to 1 mL with lysis buffer lacking dlthiothreitol (DTT) and add 10 pg of the MAb to Ras, Y13-259. Gently rock the sample at 4°C for 2-24 h. 7. Collect the immune complex on Protein A-Sepharose beads coated with rabbit antiserum to rat IgG by incubation at 4’C for 45 min with gentle rocking. Wash the pellet four times with 1 mL of wash buffer. After each addition of buffer, invert the samples to resuspend the beads, then pellet the beads by centrifugatton in a microfuge for 30 s. 8 Resuspend the pellet in Laemh sample buffer Elute the Ras from the beads by placing the tubes m boilmg water for 3 mm. Pellet the beads by centrifugmg the samples in a microfuge for 1 mm. 9. Fractionate the proteins in the supernatant by electrophoresis on a 13% denaturmg acrylamide gel. Visualize the Ras by fluorography
3.4. Soft-Agar
Assay
1 Melt a 3% solution of low gelling-temperature agarose m PBS m a microwave. Autoclave the solution for 15 min and place m a 55°C water bath 2 For the bottom layer, dilute the 3% agarose 1:5 mto warmed media, add the test compound, and pipet 1 mL of the solution mto each of three wells of a six-well cluster. Allow the agarose to solidify at 4°C and then warm to 37°C 3 For the top layer, dilute the 3% agarose solutton 1.10 mto warmed media, add the cells (1 x lo4 cells per well) and test compound and pipet 1 mL evenly over the bottom layer. Allow the agarose to solidify at 4°C as above 4. Incubate the trays at 37’C for 2-4 wk or until colonies are apparent m the control (untreated) cultures. Feed the cultures twtce a week with 0.5 mL per well complete media containing the test compound. To maintain the integrity of the agarose, aspirate any residual hquid from the well prior to each feeding. 5. Stain the colonies by adding 0.5 mL of a 0.5 mg/mL solution of p-iodomtrotetrazolmm violet m water to each well. Followmg incubation overnight at 37’C, overlay each culture with a filter-paper disk the size of the well. Invert the plate. Remove the disk and the attached agar plug with a spatula and allow to dry at room temperature overnight. The disks provide a permanent record of the assay.
Kohl et al.
288 PBS
65 mpk L-744,832
Fig. 1. Inhibition of the growth of a rus-dependent tumor in nude mice by the FPTase inhibitor, L-744,832. 1 x lo6 Rat1 cells transformed by oncogenically activated human H-ras (Ratl/huH-ras cells [20]) were injected subcutaneously into the flank of 8- to lo-wk-old female nude mice. Animals were dosed orally with 65 mg/kg L-744.832 (24) or, as a control, phosphate-buffered saline, twice daily for 16 d. There were 10 mice per treatment group. On d 17, the tumors were excised and weighed. The average decrease in tumor weight for the animals treated with L-744,832 was 60% relative to the control group. The figure shows one mouse from each of the treatment groups prior to sacrifice, together with the excised tumor from that animal.
3.5. Nude-Mouse
Xenograft
Assay
1. Prepare a suspension of the cells to be injected in cold growth medium salts. The number of cells to be injected will vary from cell line to cell line and will affect the time required to achieve a 1000 mm3-volume tumor. For transformed fibroblasts, prepare a suspension of cells at 1~10~ cells/ml. 2. Inject 1 mL of cell suspension subcutaneously into the left flank of the mouse. 3. The following day, begin treatment of the animals. Compound can be administered by several routes, including orally, subcutaneously, and intraperitoneally. The concentration of the compound can also be varied. One group of animals should be designated as the control group and receive the vehicle. The number of animals per treatment group required to achieve statistical significance relative to the control will depend on the variability in tumor size and the magnitude of the effect of the compound. 4. When the tumors in the control animals have reached a size of 500-1000 mm3, excise the tumors and weigh them. Determine the average tumor weight for each treatment group. Calculate the percent inhibition relative to the control (see Fig. 1).
3.6. Ras-Oncomouse
Assay
1. Monitor each animal for the formation of mammary- and salivary-gland tumors by twice-weekly palpation. 2. When a mouse develops a tumor, initiate tumor measurement. Using the calipers, determine the length and width of the tumor (perpendicular measurements). Cal-
Analyses of FPTase lnhlbltors culate the tumor volume according to the formula (W2x L)/2, where W and L are m mtlhmeters and L 2 W. 3. When an animal develops a tumor having a volume of 50-350 mm3, assrgn the animal to a treatment group Initiate treatment the following day. Continue twiceweekly tumor measurements throughout the course of treatment. 4. The data can be quantified by determining the area under the curve (AUC) for a particular tumor according to the formula [(volt + vo12)/2] x (d2 - d,), where volt and vo12 are the tumor volumes from consecutive measurements The AUC can then be used to calculate a mean-growth rate (MGR) or the change in tumor volume (m cubic mtlhmeters) per day according to the formula [(sumAUC) -
(~011x (4 - WI/(4
- W2.
4. Notes 1. In vitro prenylatron assays. when a large number of samples 1s bemg assayed, it is advantageous to prepare a “master mix” consisting of the substrates, enzyme, and assay buffer, which 1s then ahquoted mto individual assay tubes. 2. Ras-processmg assay: other anti-Ras antibodies capable of rmmunoprectprtatmg Ras are available from Oncogene Science (Uniondale, NY) and Santa Cruz Biotechnology (Santa Cruz, CA). 3. Soft-agar assay: Assay each variable m trrphcate, such that there are two vartables per 6-well cluster. 4 Nude-mouse xenograft. Addrtronal mJecttons of the same or different cells can be made into the right flank and into the right and left shoulders.
5. Summary The methods outlined in Subheading 3. provide a logical sequence of assays with which to evaluate the biochemical and blologlcal properties of potential FPTase inhibitors. The clinical predictability of these assays must await the evaluation of one or more of these compounds in humans. References 1 Hancock, J. F., Magee, A I , Childs, J E , and Marshall, C J. (1989) All rus proteins are polytsoprenylated but only some are palmitoylated. Cell 57, 1167-l 177. 2 Jackson, J. H., Cochrane, C G , Bourne, J. R., Solskt, P. A., Buss, J. E., and Der, C. J. (1990) Famesol modiftcatton of Ktrsten-ras exon 4B protein 1s essential for transformanon. Proc Nat1 Acad Scl USA 87, 3042-3046. 3. Willumsen, B. M., Norris, K., Papageorge, A. G , Hubbert, N L , and Lowy, D. R (1984) Harvey murme sarcoma virus p21 ras protein. biologtcal and brochemical significance of the cysteme nearest the carboxy termmus EMBO J 3,2581-2585
4. Kato, K., Cox, A. D., Hrsaka, M. M., Graham, S. M., Buss, J. E., and Der, C. J. (1992) Isoprenord addition to Ras protein is the crrttcal modtftcatton for
Kohl et al.
290
5.
6. 7. 8. 9.
10
11.
12.
13.
14.
15
16.
17.
its membrane association and transforming activity. Proc Nat1 Acad. Sci USA 89, 6403-6407. Tamanoi, F. (1993) Inhibitors of Ras farnesyltransferases. TZBS 18,349-353. Hancock, J. F. (1993) Anti-Ras drugs come of age. Curr Bzol 3,770-772. Gibbs, J. B., Ohff, A., and Kohl, N. E. (1994) Famesyltransferase inhibitors Ras research yields a potential cancer therapeutic. Cell 77, 175-178. Bos, J. L. (1989) ras oncogenes m human cancer: a review Cancer Res 49, 4682-4689. Gibbs, J. B., Pomphano, D. L., Mosser, S. D., et al. (1993) Selective mhibrtion of famesyl-protein transferase blocks Ras processing in vivo. J Blol Chem 268, 7617-7620. Garcia, A. M , Rowell, C., Ackermann, K., Kowalczyk, J. J , and Lewis, M D. (1993) Peptrdomrmetic mhibitors of Ras farnesylation and function m whole cells. J Bzol Chem. 268, 18,415-l&418. James, G. L., Goldstein, J. L., Brown M. S., Rawson, T. E., Somers, T. C., McDowell, R. S , Crowley, C. W., Lucas, B. K., Levmson, A. D., and Marsters, J. C. Jr. (1993) Benzodiazepine peptidomimetics: potent inhibitors of Ras farnesylation m animal aells Science 260, 1937-1942. Kohl, N. E , Mosser, S. D., deSolms, S. J., Gmham, E. A , Pomphano, D L., Graham, S. L., Smith, R L , Scolmck, E. M., Ohff, A., and Gibbs, J. B. (1993) Selective inhibition of ras-dependent transformation by a farnesyltransferase mhtbrtor. Sczence 260, 1934-1937. Nrgam, M., Seong, C.-M., Qian, Y , Hamilton, A. D , and Sebti, S. M. (1993) Potent inhibition of human tumor ~21”~ farnesyltransferase by A1A2-lacking ~21”~ CA1A2X peptidomrmetrcs. J Biol. Chem. 268,20,695-20,698. Bishop, W. R., Bond, R., Petrm, J., Wang, L , Patton, R., Doll, R., NJoroge, G , Catino, J., Schwartz, J., Windsor, W., Syto, R., Schwartz, J , Carr, D., James, L , and Kuschmeler, P (1995) Novel tricychc mhibnors of famesyl protein transferase J Blol Chem 270, 30,61 l-30,618. Prendergast, G C., Davrde, J P., deSolms, S J , Gmham, E A., Graham, S L , Gibbs, J B , Oliff, A , and Kohl, N. E. (1994) Famesyltransferase mhibition causes morphological reversion of ras-transformed cells by a complex mechanism that mvolves regulation of the actm cytoskeleton. Mel Cell Blol 14,41934202 Omer, C. A., Diehl, R. E., and Kral, A. M (1994) Bacterial expression and purification of human protein-prenyltransferases using epitope-tagged, translationally coupled systems. Meth zn Enzymol 250,3-12. Omer, C. A., Kral, A. M., Drehl, R. E., Prendergast, G C., Powers, S , Allen, C. M., Gibbs, J. B., and Kohl, N. E. (1993) Characterization of recombinant human famesyl-protein transferase: cloning, expressron, famesyl diphosphate bmdmg and functional homology with yeast prenyl-protein transferases. Bzochemlstry
32,5167-5176. 18. Moores, S. L., Schaber, M. D., Mosser, S. D., Rands, E., O’Hara, M. B., Garsky, V. M., Marshall, M. S., Pomphano, D. L., and Gibbs, J. B. (1991) Sequence dependence of protein isoprenylation. J Blol Chem 266, 14,603-14,610.
Analyses of FPTase lnhlbltors
291
19. Zhang, F. L., Diehl, R. E., Kohl, N. E., Gibbs, J. B., Giros, B., Casey, P. J., and Omer, C A. (1994) cDNA cloning and expression of rat and human protem geranylgeranyltransferase type-I. J Biol Chem. 269,3 175-3 180 20. Kohl, N. E., Wilson, F R , Mosser, S. D., Gmhani, E , desolms, S J., Conner, M. W., Anthony, N J., Holtz, W. J., Gomez, R. P., Lee, T.-J., Smith, R. L., Graham, S. L., Hartman, G. D., Gibbs, J B., and Oliff, A. (1994) Farnesyltransferase inhibitors block the growth of ras-dependent tumors m nude mice. Proc. Nut1 Acad Scz. USA 91,9141-9145. 21. Furth, M. E., Davis, L. J., Fleurdelys, B., and Scolnick, E. M (1982) Monoclonal antibodies to the p21 products of the transformmg gene of Harvey murme sarcoma virus and of the cellular ras gene family. J. Viral 43,294-304. 22. DeClue, J. E., Vass, W. C., Papageorge, A. G., Lowy, D R., and Willumsen, B M. (1991) Inhibition of cell growth by lovastatin is independent of ras function. Cancer Res 51,712-717
23. Sinensky, M., Beck, L. A., Leonard, S., and Evans, R. (1990) Differential inhibitory effects of lovastatm on protein isoprenylation and sterol synthesis. J Bzol. Chem. 265, 19,937-19,941. 24. Kohl, N E , Omer, C. A., Conner, M W , Anthony, N. J , Davide, J. P., deSolms, S. J., Gmliam, E. A., Gomez, R P , Graham, S. L., Hamilton, K., Handt, L K., Hartman, G. D , Koblan, K. S , Kral, A. M., Miller, P. J , Mosser, S. D., O’Netll, T J , Rands, E , Schaber, M. D., Gibbs, J. B., and Oliff, A. (1995) Inhibition of farnesyltransferase mduces regression of mammary and sahvary carcinomas m ras transgenic mice. Nature Med 1,792-797.
20 Identification and Characterization of Small GTPase-Associated Kinases Edward Manser, Thomas Leung, and Louis Lim 1. Introduction Rho-family signal-transduction cascades, which appear to be conserved in all eukaryotes, probably coordinate cytoskeletal reorganization and transcrrptional activation via a variety of protein and lrprd kmases, and other as-yet-undefined target proteins. The dissectron of these cascades has begun with the identification of a growing number of Rho-p21 interacting proteins, though for the most part it remains to be established which of these proteins represents bonafide targets. Here we describe a method that was developed to analyze p21-interacting proteins in total protein extracts after their separation on sodium dodecyl sulfate (SDS)-polyacrylamide gels. In fact, both guanosine Striphosphatase (GTPase)-activating proteins and GTPase-inhibitory proteins can be detected in situ, and the latter class have been successfully identified in expression screens. Novel p21-targets have now been characterized by this method, including the Cdc42-binding tyrosine kinase (ACK) (I); the p21activated kinase (PAK) (2,3); the ~160 RhoA-associated kinase (ROK) (4,s); and the neutrophil Wiscott-Aldrich Syndrome protem (WASP) (6). Deletion analysis of a number of cDNAs encoding these proteins have shown the p2 lbinding domains encompass less than 60 amino acid residues (1,2). The homology of PAK to the Saccharomyces cerewsiae kinase Ste20p lead to the identification of Ste20p as a Cdc42-regulated kmase (7,8) which lies downstream of the heterotrimeric G-protein-coupled yeast pheromone receptor (9). Coupling of receptor occupation to the transcriptional changes required for yeast mating is achieved via a mitogen-activated protein (MAP)-kinase module, which perhaps is regulated similarly in mammalian cells where Cdc42 From
Methods
m Molecular B/ology, Vol 84 Edlted by D Bar-Sag1 0 Humana
295
Transmembrane Sgnakng Press Inc , Totowa, NJ
Protocols
Manser, Leung, and Lim
296
and Racl mediate both JNK and p38 MAP-kmase activation (10-12). The underlying conservation of components m signal-transduction pathways among eukaryotes is therefore a powerful tool for the further characterization of the Rho-p21 targets, of which the maJority appear to be protein kinases. Although protein overlays are a common method to detect direct interactions, the sensitivity of the technique described m this chapter lies in the ability to radiolabel ~21s to high specific activity with [y32P]GTP. These can be used as probes m both Western overlays or as substrates in GTPase activating protem (GAP) overlays. GTP can be obtained with a specific activity of c5 pCi/ pmol (1 pmol of GST/p21 -20 ng of recombinant protein): routinely 30-80% of [Y~~P]GTP is mcorporated into Rho-p2ls durmg the nucleotide exchange step. Because the guanosme 5’-diphosphate (GDP)-p21 does not participate m binding to the target proteins, the method has an added advantage over other protein-labeling techniques as bmding of [T~~P]GTP p21 is not competed by cold-unlabeled protein. In the GAP-overlay technique, autoradiography of a nitrocellulose overlaying the primary filter holds an image of the nucleotide state (i.e., GTP or GDP) of the test p21 in the vicinity of interacting protein (bands). Such analysis can provide information on the p21-specificity, molecular weight, and abundance of GAPS (13), and readers should refer to our previous discussion of the use of this technique (14). Proteins with opposite activity (i.e., GTPase mhtbitors such as PAKs; see ref. 13) appear to stabilize the active GTP-bound conformation of the p21 (2). In [~~~p]GTP-p21 overlays, wild-type, rather than GTPase-deficient p21s, are also the preferred probes, because GTPase inhibition by the binding proteins tends to enhance the bound signal relative to background. The use of an znsztu detection method for the analysis,punficatron, and cloning of GTP-p21 bmdmg proteins has a number of advantages (outlined below) over methods such as solution assays,immobilized biomolecular-interaction analysis, or yeast two-hybrid for primary screens. Advantages include: 1. Many cells or tissue extracts can be analyzed and compared simultaneously. 2. Sample handling time is minimal (with less chance of protein degradation) because tissue extracts are immediately denatured and analyzed. 3. Major p21 targets can be detected, without need for specific reagents (e.g , antibodies) 4 Potential
Inhibitor
proteins
present
In the extracts
are dissociated
during
SDS-polyacrylamide electrophoresis. 5 It allows mformed selection of an appropriate source of cDNA library before screening for target proteins.
In addition, protein overlays can complement less-direct techniques as “secondary” tests of the specificity of interactions between ~21 and their targets.
Detection and Cloning of Rho-p21 Effecters
297
In this chapter, we describe its application to analysis of p21 “effectors” in cell and tissue extracts and in the cloning of corresponding gene products from appropriate expression libraries. Because the Rho-p21 binding domains are relatively small and apparently do not require modification (I), they are ideal targets for screening with expression libraries in bacterial hosts. Furthermore,
our experience is that although a target protein like ROK gives weak signals in SDS-fractionated plaques identified
trssue extracts probed with [f2P]GTP-RhoA (4), positive in library screens gave strong signals. This suggests that the
technique can even be applied to clone proteins undetected in Western overlays owing to their lability during electrophoresis.
2. Materials 2.1. Expression
and Purification
of Recombinant
p21 s
Recombinant glutathrone-S-transferase (GST)/p2 1s are expressed from pGEX vectors (see Note 1) in E. colz, induced, and purified according to the usual protocol (Pharmacra-LKB), except for the use of GST buffer, which contains magne-
sium and Triton X-100 to stabilize the ~21s dunng purification and storage. 1. GST buffer: phosphate-buffered saline (PBS) contammg 50 nnI4 Tris-HCl, pH 8.0, 0 5 mM MgCl,, and 0.1% Trrton X-100 replaces PBS or 50 n&Z m the cell lysls, washing, and elution steps. 2. Nucleotide exchange buffer to effect mcorporation of [Y~~P]GTP mto the ~21: 50 n&f NaCl, 25 n-&I MES-NaOH, pH 6.5, 2.5 r&I EDTA (make 2X buffer and store at 4°C). Keep stock 1 M MES-NaOH in the refrigerator to prevent detenoration (yellowing).
2.2. Cell/Tissue Extraction and Electrophoresis The buffer used to make the extract will depend on the type of target protein under consideration. For the Rho-p21 binding proteins, we found that the proteins appear to be completely represented in soluble (nondetergent containing) extracts. Other target proteins may require use of ionic detergents such as deoxycholate or (SDS) for extraction. 1. We routinely use the following extraction buffer, which contains noniomc detergent to aid cell lysrs (PBS) containing 25 mA4 HEPES, pH 7.3, 20 nuI4 P-glycerophosphate, 10 mM NaF, 2 mM sodium orthovanadate, 5 mM DTT, 0 5 mM MgC12, 0.5% Triton X-100, 0.5 mM phenylmethylsulfonyl flounde, 1 j.tg/mL of aprotmm, and pepstatm, made fresh before use. 2. The polyacrylamide separating gel of requned percentage (using premixed 29.2% acrylamide/0.8% bzs-acrylamrde from Millipore, which gives excellent results) IS cast in buffer containmg 125 mM Tns-HCI, pH 8.8, 10% glycerol, 5 mM DTT, 0.5 mA4 MgCl,, 0 1% SDS.
298
Manser, Leung, and Lim
3. The stachng gel (4%) contams 125 mMTns-HCl, pH 6.8,10% glycerol, 0.1% SDS 4. Western transfer buffer 50 mM Trls (base), 40 mM glycme, 10% MeOH.
2.3. Reagents
for p21 Overlay
1. Blocking buffer: PBS containing 1% bovine serum albumin (BSA) (Sigma, protease-free), 5 mM DTT, 0.5 mM MgC12, 0.1% Tnton X-100. Store at 4°C for l-2 d (discard If cloudy). 2 Binding/wash buffer: PBS containing 25 mM HEPES-NaOH, pH 7 3, 2.5 mM MgCl,, 0.05% Trlton X-100. 3. Agarose plates: 1% agarose is melted m PBS, cool to 60°C add from stock solution to give fmal concentrations of 25 rmI4 HEPES-NaOH, pH 7.3, 5 mM DTT, 2.5 n&I MgQ. Pour mto 12 x 12 x 1.7-cm square Petri dishes (Gremer). For expression screening use 25 x 25 x 2-cm dishes.
3. Methods 3.7. Labeling
of Recombinant
Rho-p21 Proteins
Rho-p2 1 proteins are extremely well-conserved among eukaryotes For this reason, the origin of the mammahan p21 cDNAs to generate recombinant protein for the assays is of no consequence to the final results. Indeed, mammalian Cdc42 has been shown to bind to both S. cerevzslae PAK-related kinases Ste20p (7) and Cla4p (15) in p21 overlays. We have not detected any significant differences in binding of GST-p21 fusion proteins vs the cleaved proteins: for simplicity, we use fusion proteins, thus avoiding mtroduction of proteases into the system. Ras-related G proteins have extremely high affinity for GTP (and GDP) in the presence of millimolar magnesium (16). In order to facilitate exchange with [YELP] GTP, the ~21s are incubated for a short time in an EDTAcontaining buffer. When magnesium is returned, the labeled nucleotlde becomes locked mto the guanine nucleotlde-binding site. 1. Purified GST-p21 fusion protein (1 mg/mL) or cleaved ~21 (0.5 mg/mL) are stored in ahquots at -70°C 2. For each labeling, add 5 PL of 1 mg/mL GST/p21 (=lOO pmol) to 20 PL of nucleotide exchange buffer (1X) and add 1 fi [Y~~P]GTP per filter (NEN -6000 Cl/mmol, 1 pL = 1.5 pmol). One can compensate for the decay in specific activity of [Y~~P]GTP by adding more [Y~~P]GTP, because the molar amounts of label are well below that of the ~21. Tnton X-100 is present to stabilize the diluted p21 protein. 3 Mix and leave at room temperature for 4 mm. Add 25 p.L of bmding buffer Put the labeled p21 mixture back on ice and use wlthm 15 mm
3.2. Western Overlays with [y3*P]GTP-~21s 3.2.1. Sample Preparation and SDS-PAGE Electrophoresis 1. Tissues or cells are homogenized in 4 vol of a suitable extraction buffer (for example, see Subheading 2.) with 20 strokes of a hand-held dounce homogenizer.
Detection and Cloning of Rho-p21 Effecters
299
2. The cytosol 1s clartfled by spmn1ng at 30,000 rpm for 40 min (Beckman T150 rotor), made 5% in glycerol or diluted with an equal volume of SDS-sample buffer (containing a final concentration of 1% SDS), and stored at -70°C. 3. Polyacrylamrde gels are cast using the Bra-Rad mini-protean system or equivalent using a recipe that includes DTT, magnesium, and glycerol, which prevents oxidation of the proteins and produces sharper bands. Usually 9% gels or less are run in order to allow good protein resolution and efficient transfer of proteins >30 kDa. Use of a “semi-dry” blotting apparatus (e.g., Bio-Rad) allows efficient transfer of high-molecular-weight proteins (>lOO kDa) 1f longer times are used. 4. Transfer proteins to mtrocellulose (Schleicher and Schuell, BA85) or polyvinylldene difluoride (PVDF) (DuPont-NEN) overnight at 4°C using at 20 mA per minigel (set maximum voltage at 10 V). For PVDF membranes, SDS should be omitted from the transfer buffer. The use of prestamed protein markers (GibcoBRL) is convenient to momtor transfer, although the mobrlities of these modified proteins may differ from the native proteins. Use of a semi-dry blotting apparatus (e.g., Bio-Rad) allows efficient transfer of high-molecular-weight proteins (>lOO kDa) if longer times are used. PVDF filters can be stained (see Note 2). 5. The membranes are placed 1n the blocking buffer for 2-24 h at 4°C.
3.2.2. GTP-p21 Western Overlays 1. Make up enough binding buffer containmg 0.5 mM GTP (1 mL per filter) and add the [y3*P]GTP-labeled p21 prepared as described 1n Subheading 2.1. 2. Place 1 mL of this m1x into the center of the a dish (e.g , Greiner 12 x 12 x 1.7-cm square Petri dish). Take the filter from the blocking buffer and blot, but do not allow to dry. Place immediately into the container and turn the filter over several times to evenly distribute the “hot” solution. Remove excess by scraping against the side of the container, and lay the filter carefully onto the agarose plate (excess liquid is absorbed, thus producing a more even background). Replace the lid 3. Transfer the plate(s) to the cold room and leave for 10 mm. 4. Remove filters from the agarose and wash in three 50-mL changes of wash buffer with shaking (3 x 2 min). 5. Blot and cover with plastic wrap, and arrange 1n a precooled X-ray cassette. Check the level of radioactivity using a hand-held monitor; 1t should register 50-200 cpm. 6. The filter is exposed to a high-resolutton film such as Hyperfilm (Amersham) or Biomax (Kodak) for an appropriate time (see Note 3).
3.3. Expression
Screening
with [f2P]GTP=Labeled
~21s
We have successfully isolated clones from both hgtll and hZAP (Stratagene) libraries; the former gave expression products as P-galactosidasefusion proteins, whereas the latter contained only a small polylinker-derived leader peptide; however, signals are comparable. The number of clones that need to be screened for a given target is dependent on both the quality of the library and the abundance of the mRNA in question. It is essential to first test
300
Manser, Leung, and Lim
the library by PCR of random clones using common flanking primers to check insert sizes (rather than relying on the supplier’s mformation). Preferably screen (10,000 plaques m a 25 x 25-cm plate) with a DNA probe of a mediumabundance mRNA and check sizes of the inserts derived from positives clones by PCR of the plaques. Previous successin expression screening is the best recommendation for a given library. 1 Titer the bacteriophage library stock using appropriate bacterial-host cells that have been prepared 1 d before (usually stored m 10 n-uV MgClJ, according to the supplier’s protocols. 2. Plate out bacteriophage early m the mommg at -40,000 PFU per 25 x 25-cm plates.
3. When the plaquesreach avisible size,leave for 1h more, then overlay with damp mtrocellulose membranes (20 x 20 cm) wetted with 10 mM IPTG and blotted with Whatman 3MM paper. The ftlter is left overmght at 30°C (see Note 4). 4 The next day, mark filters (a 25-gage needle containing Indta mk can be used to pierce the filter and underlying agarose) and block m blockmg buffer for at least 1 h. The filters are probed wtth [y32P]GTP-labeled p21 (see Subheading 2.1.) using 5 l.tL of [Y~~P]GTP, and diluted m 10 mL of binding buffer (see Note 5 for precaution against false posittves) 5. Follow Subheading 3.2.2., steps 2-6 using 25 x 25 plates, usmg three changes of 200 mL wash buffer m the final step. 6 Regions from the primary plate correspondmg to putative positive-phage plaques
are excised(cut out a 1x 1-cm squareof top agaroseover the positive signal and place mto 1 mL of buffer) and replated for titermg and secondary screenmg. Before determmmg the sequence of the inserts, it is possible to obtain conftrmatory data as to the nature of the cDNA using the protocol described in Note 6. 7 Once positive cDNAs are Isolated, they should be grouped accordmg to restnctton pattern, and full-length cDNAs isolated by conventional DNA-screenmg methods
Information about the region of the cDNA involved in binding to the GTP-p21 can sometimes be deduced from analysis of the overlappmg clones obtained by expression screening. For example, the domain of ROKa which binds to GTPRhoA was obtained in such a manner (4). Identification of the residues that might mediate the interaction with the GTP-p21 can be aided by comparison with related proteins. In Fig. 1 this interacting region of ROKa has been aligned to the corresponding sequence of the related ROCK kinase, which also binds RhoA (5). Analysis of conserved residues in these proteins suggests that two blocks of sequence might be important for the p21 interaction (underlined sequences). Interestingly, this sequence does not have similarity to the region of yeast PKCl which binds to Rho1 (17) or to mammalian PKN which IS also selective for Rho (I8,19). All these Rho-associated kinases show only weak activation in vitro with GTP-RhoA, and probably have different modes of activation to the direct and potent activation of PAK by dc42/Rac.
Detection and Cloning of Rho-p21 Effecters ROKa ROCK
307
TSDVANIANEKEELNNKLKDTQEQLSKLKDEEISAAAIICAQFEKQLLTER 949 TKDIEILRRENEELTEKMKKAEEEYKLEKEEEIS--NLK -lJ 893
ROKCt ROCK
TLKTQAVNKLAEIMNRKEP---VKRFSDTDVRRKEKENRKLHM ~AVNK~WNRKDFKIDRKKANTQ m
Fig 1. The RhoA-bmding domam of ROKa, as defined from analysis of overlapping clones obtained in expression screens with [y32P]GTP-RhoA (4), was aligned with the correspondmg region of the related kinase ROCK (5). Conserved residues are prmted n-r bold. The underlmed sequence defines two regions that are highly conserved and are probably important for mteraction with the GTP forms of RhoA, RhoB, and RhoC The first 20 ammo acids of the sequence are probably not Involved m p21-binding, because they form the C-terminal part of a coiled-coil motif.
The p21-binding domam can also be mapped by N- and C-terminal deletions of the cDNA cloned into an appropriate expression vector, with analysis of purified protein products or total induced E. coli lysates by [y32P]GTP-p21 overlay. Such an analysis for the p2 1-binding domain of a-PAK (20) is shown in Fig. 2. Equimolar loadings of the various GST fusion proteins (100-200 ng) were probed with [y32P]GTP-Cdc42 according to the protocol described in Subheading 2. In this case, the information was confirmative because the p21-binding domain had been correctly identified on the basis of ammo acid sequence homologies between ACK, PAK, and Ste20p (2), A number of other gene products identified in the Genbank DNA database on the basis of the presence of such a conserved ammo acid motif (termed Cdc42/Racl interaction/ binding or CRIB) were shown to associate with these ~21s (21). Because the overlay technique is more sensitrve to changes in affinity than column-binding methods, it is useful when comparing relative affinities (for example, in the analysis of the effects of mutations introduced to the p21-binding domain). In this regard, it IS important first to perform a Western overlay with varying amount of wild-type binding domain (in the 10 ng-10 pg range), quantify the radiolabeled signal obtained, and plot signal vs concentration. One should then perform overlays using the mutant proteins at a concentration in which the strongest signal remains in the linear region of the graph. In the case of PAK, 200 ng of GST-fusion protein per lane was found to be acceptable. 4. Notes 1. If the Rho-p2ls cDNAs are cloned into pGEX 2T or pGEX 4T using the vector 5’ BamHI sate, where the mmator methionine is directly adJacent to the restriction site, it is very difficult to subsequently cleave the purified fusion protein with thrombm. However the pGEX-2TK vector contains an additional four ammo acids of “spacer” sequence (the PKA site), allowing efficient proteolysis.
302
Manser, Leung, and Lim
kD 97 68 43
Kinase
construct
0
100
200
300
400
500
61-150 l-150 l-250 l-544
Fig. 2. Autoradiogram showing a [y32P]GTP-Cdc42 overlay of GST/a-PAK fusion proteins separated on a 12% SDS polyacrylamide gel and transferred to PVDF. The lanes as indicated contained 100 ng of GST, GST/PAK6L-*50, and GST/PAK’-150 or 200 ng of GST/PAK’950 and full-length GST/PAK’“44 (breakdown products were not included for estimation of the protein loading). Beneath the photograph, the region covered by each of the constructs is shown schematically. The shaded areas represent regions that are highly conserved between PAK and Ste2Op. 2. PVDF membranes can be stained with Coomassie blue to determine the quality of transfer. In our hands, the final Rho-p21 binding signal is unaffected by such staining, which can effect a reduction of nonspecific binding. Other p21-binding proteins may not be so resilient to such treatment. Mark the position of the corners of the gel and the top of the separating gel on the filter. Immerse the filter in 0.1% Coomassie blue dissolved in 40% MeOH/IO% acetic acid for 3 min and destain in the same buffer. For convenience, a record of the blot can be made on a photocopy machine. Completely destain the proteins by washing in methanol for 5 min and place in PBS containing 0.1% Triton X- 100. 3. Because [T32P]GTP-p21 bound to the filter continues to hydrolyze the GTP, it is necessary to freeze the filter as soon as possible by immediately placing the cassette at -70°C. After 4 h exposure, remove the film from the frozen cassette and
Detection and Cloning of Rho-p21 Effecters
303
place m an empty cassette for developing. Expose new film to the filter according to desired signal, but do not allow the filters to thaw between changes. Bands are better resolved without the use of an intensifying screen. 4. We have found that although it is desirable to rule out false positive signals by the use of duplicate filters, this method is not reliable m expression screenmg because msufficient protein is bound to the second membrane. 5. False-positive signals owing to nonspectfic binding of the probe to particulate matter m the [y3*P]GTP-labeled p21 mix can be elimmated by passmg it through a standard 0.45pm filter attached to a syrmge prior to use. 6. Once positive clones are purified, the p21-specificity, and stze of the expression product can be established by extracting the phage-derived proteins for SDS-PAGE and p21-binding analysis. Grow up and induce a confluent layer of the pure bacteriophage (-5000 PFU for a lo-cm plate in top agarose). Harvesting 0.5 mL of the top agarose only scraped from the surface into an Eppendorf tube. Add an equal volume of 2X SDS sample buffer, vortex, and incubate for 1 h at room temperature. spm for 5 min at full speed and run 50 yL on a 7.5% (for hgtl 1 derived extracts) or 12% polyacrylamide gel (for AZAP), then transfer and probe the blotted proteins for [y32P]p21-bmdmg. For &ZAP librarres, the cDNA can be excused m VIVO as plasmid (according to the Stratagene protocol), then 1 mL of bacterta harboring the plasmid grown to an OD of 0 6 (600 nm) induced with 0.5 mM IPTG for 2 h at 37°C. Pellet cells and suspend in 100 pL of GST buffer + 1 mg/mL lysozyme and leave for 10 mm. Somcate the sample, add an equal volume of 2X SDS sample buffer, and run 20 pL on a 12% mini-gel.
Acknowledgments We thank the Glaxo Singapore Research fund for support. References 1. Manser, E., Leung, T., Salihuddin, H., Tan, L., and Lim, L. (1993) A non-receptor tyrosme kmase that inhrbrts the GTPase activity of p21CdC4*.Nature 363,364-367. 2. Manser, E., Leung, T., Salihuddin, H., Zhao, Z-S., and Lim. L. (1994) A brain serine/threonine protein kmase activated by Cdc42 and Racl. Nature 367,40-46. 3. Martin, G. A., Bollag, G., McCormick, F. A., and Abo, A. (1995) A novel serine kmase activated by Rac/Cdc42Hs-dependent autophosphorylation is related to PAK65 and Ste20. EMBO J 14, 1970-1978. 4. Leung, T., Manser, E., Tan, L., and Lim, L. (1995) A novel serine/threonine kmase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes J. Blol. Chem 270,29,05 l-29,054. 5. Ishizaki, T., Maekawa, M , Fujisawa, K., Okawa, K , Iwamatsu, A., FuJita, A., Watanabe, N., Saito, Y., Kakizuka, A., Morn, N., and Narumiya, S. (1996) The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotomc dystophy kinase. EMBO J 15, 1885-1893. 6. Symons, M., Derry, J. M J , Karlak, B., Jrang, S., Lemahieu, V., McCormick, F , Francke, U., and Abo A (1996) Wiskott-Aldrich Syndrome protein, a novel
304
7.
8.
9.
10
11.
12.
13.
14
15
16. 17.
18.
19.
Manser, Leung, and Lim effector for the GTPase Cdc42Hs, is imphcated m actm polymertzation Cell 84,723-734. Zhao, Z-S., Leung, T , Manser, E., and Lim, L. (1995) Pheromone stgnalling m Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24 Mol. Cell. Bzol l&5246-5257. Simon, M-N , de Virgtllo, C., Souza, B., Prmgle, J R , Abo, A , and Reed, S. I. (1995) Role for the Rho-family GTPase Cdc42 m yeast mating pheromone signal pathway. Nature 376,702-705 Leberer, E., Dtgnard, D., Harcus, D , Thomas, D. Y., and Whtteway, M (1992) The protein kmase homologue Ste20p is required to lmk the yeast pheromone response G-protein pr subumts to downstream signallmg components. EMBO J 11,4815-4824 Bagrodia, S , Derijard, B , Davis, R J , and Cerlone, R A (1995) Cdc42 and PAK-mediated stgnalling leads to JNK and p38 mttogen-activated protein kmase activation. J Biol Chem 270, 27,995-27,998. Brown, J. L., Stowers, L., Baer, M., Trejo, J. A., Coughlm, S., and Chant, J. (1996) Human Ste20 homologue hPAK1 links GTPases to the JNK MAP kmase pathway. Current Bzol 6,598-605. Coso, 0. A., Chiariello, M., Yu, J-C , Teramoto, H , Crespo, P., Xu, N , Mike, T , and Gutkmd J. S. (1995) The small GTP-binding protems Racl and Cdc42 regulate the activity of the JNK/SAPK signalling pathway. Cell 81, 1137-l 146. Manser, E., Leung, T., Monfries, C , Teo, M., Hall, C., and Lim, L. (1992) Dtversity and versatility of GTPase activating protems for the p2lrho subfamily of ras G proteins detected by a novel overlay assay. J Blol Chem 267, 16,025-16,028. Manser, E , Leung, T., and Lim, L (1995) Identification of GTPase-activating proteins by mtrocellulose overlay assay. Methods UI Enzymology 256, pp 130-139. Academrc press. Cvrckova, F , de Virgillo, C., Manser, E , Pringle, J. R , and Nasmyth, K (1995) Ste20-like protem kineses are required for normal locahzation of cell growth and for cytokinesis m budding yeast Genes Dev 9, 18 17-1830. Goody, R. S., Frech, M., and Wittinghofer, A. (1991) Affinity of guanme nucleotide binding proteins for their hgands: facts and artefacts. TZBS 16, 327-328. Nonaka, H., Tanaka, K., Hirano, H., FuJlwara, T., Kohno, H., Umikawa, M., Mmo, A., and Takai, Y. (1995) A downstream target of RHOI small GTP-14 bmding protem PKCl, a homolog of protein kinase C, which leads to acti-vation of the MAP kmase cascade m Saccharomyces cerevwlae. Eh4BO J 14,5931-5938. Amano, M., Mukat, H , Ono, Y., Chthara, K., Matsui, T., HamaJima, Y., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Identtfication of a putatattve target for Rho as the serme-threonme kmase protein kmase N. Sctence 271,648-650. Watanabe, G., Saito, Y , Madaule, P., Ishizaki, T , Fujisawa, K., Morii, N , Mukai, H., Ono, Y., Kakizuka, A., and Narumlya, S. (1996) Protein kmase N (PKN) and PKN-related protein Rhophilm as targets of the small GTPase Rho. Science 271,645-648.
Detection and Cloning of Rho-p27 fffectors
305
20. Manser, E., Chong, C., Zhao, Z-S., Leung, T., Michael, G., Hall, C., and Lim, L. (1995) Molecular clonmg of a new member of the p21-Cdc42/Rac-activated kmase (PAK) family. J Bzol Chem. 270,25,070-25,078. 21. Burbelo, P. D., Drechsel, D , and Hall, A. (1995) A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rat GTPases. J Biol. Chem 270,29,071-29,074.
21 Functional Studies of Dual-Specificity
Phosphatases
Hong Sun 1. Introduction Dual-speclflcity phosphatases, a subfamily enzymes of protein tyrosme phosphatases, play important roles m signal transduction and cell-cycle regulation during cell growth and differentiation (I). Unlike classic tyrosme phosphatases which are specific for phosphotyrosine, dual-specificity enzymes can dephosphorylate both phosphotyrosme and phosphoserme/phosphothreomne. All tyrosine phosphatases, including dual-specificity enzymes, are characterized by a conserved-sequence motif HCXXGXXRS/T (2). Besides this actlvesite region, dual-specificity phosphatases have little primary-sequence homology to classic tyrosine phosphatases, but they do bear remarkable slmilarity at the three-dimensional structure level, especially around the catalytic center (3,4). Dual-specificity enzymes appear to use the same catalytic mechanism as the classic tyrosine phosphatases, and catalysis is proceeded by formation of a cysteine-phosphate intermediate (5~5). Mutation of the essential cysteine at the active site in dual phosphatases abolishes the phosphatase activities toward both phosphotyrosine and phosphoserine/phosphothreonine. MKP-1 (also known as 3CH134, CLlOO, HVHl, or ERP) belongs to a growing family of dual-specificity phosphatases which show selectivity both in vitro and in vtvo toward MAP kinases (7-12). MAP kinases are protein serine-threonine kinases that are transiently activated by diverse growth stimuli (13). The most well-known lsoforms of MAP kinases are p42mapkand p44mapk (hereafter referred to as MAPKs) and these enzymes are central components in the signaling pathways that involve receptor-protein tyrosme kmases and gene products encoded by the protooncogenes Ras and Raf. Activation of MAPKs requires phosphorylation of both the critical threonine- and tyrosine-regulatory From
Methods
m Molecular
Biology,
Vol
84
E&ted by D Bar-Sag1 0 Humana
307
Transmembrane
Signalmg
Press Inc , Totowa,
NJ
Protocols
Sun
308
sites in the enzymes. MKP-1 specifically dephosphorylates both these regulatory sites and consequently inactivates MAPKs. Remarkably, substitution of the critical cysteinyl residue with a serine residue m MKP-1 (Cys258+Ser) allows the mutated enzyme to retain its ability to bind Its substrate MAPK, although it fails to dephosphorylate it (8). Molecules closely related to MKP- 1 have also been identified, such as PACl(14), MKP-2 (also known as hVH-2 or TYPl) (IS-17), hVH-3/B23 (18,19), MKP-3 (also known as rVH6 or Pystl) (20-22), and hVH-5 (23). These molecules have also been shown to exhibit high selectivity toward MAPKs. Interestingly, while MKP- 1, MKP-2, or PACl are primarily localized in the nucleus, MKP-3 is primarily localized in the cytoplasm, suggesting that these structurally related molecules may perform distinct physiological functions in different cellular compartments. Additional members of dual-specificity phosphatases include VHl , an openreading frame encoded by vaccinia virus (24); VHR, a phosphatase identified by expression-cloning method (25); PRL- 1, its gene highly induced following liver surgery (26); and Cdil/KAP (27,28). KAP, first Identified as a molecule Interacting with cyclin-dependent kmase Cdk2 by the yeast two-hybrid screen, is recently shown to dephosphorylate threomne 160 of Cdk2 (29). Another well-known dual-specificity phosphatase is cdc25 (30), which dephosphorylates the inhibitory phosphotyrosine and phosphothreonine residues in Cdc2, a cyclin-dependent kinase required for G2 to M-phase transition during cell-cycle progression. This chapter describes methods to assay the activities of dual-specificity phosphatasestowards phosphotyrosine- and phosphoserine/phosphothreoninecontaining proteins. Methods are described with an emphasis on characterization of MKP-l-like phosphatases that show high selectivity toward MAPKs. 2. Materials 2.1. Phospho-Tyrosyl
Substrate
1. RCML (Lysozyme, carboxy-methylated-maleylated, reduced form) (Sigma, L 1526) is dissolved in water at a concentration of 20 mg/mL. Store at -20°C. 2. BIRK, a baculovnus-msulm-receptor-kinase, 1spartially purlfled from the recombinant baculovirus infected Sf9 cells according to Vlllalba et al. (31). One unit of enzyme is defined as the kmase activity that incorporates one nmol phosphate into substrate per minute. 3. Imidazole (Sigma, I-0125). 4. RCML-labeling buffer: 50 mM Trls pH 7.5,4 rniW MnCl, 10 mM MgS04, 2 r&f DTT, 2 mM ATP, 0.1 mM vanadate. 5. TCA (trichloroacetic acid) (Baker 0414-01); reconstitute with water to 100% stock solution
Dual-Specificity
Phosphatases
2.2. Dephosphorylation
309
Reactions
1. Charcoal termination mix: Add activated charcoal (Sigma, C-5260) and Celit (or dtatomaceous earth, Sigma, D-5509) separately m water and let them settle down. Aspirate the top liquid. Repeat the process five times to define the material. Combine -60 mL of settled charcoal with -15 mL of settled Ceht Wash the mixture two times with stop solutton (0.9 N HCI, 90 mh4 Na4P,0,, 2 nut! NaH,PO,) and then resuspend m 750 mL of stop solution. Store at room temperature. Mix the suspenston thoroughly before use. 2. Sodium orthovandate 1s from Sigma (S-6508) and dithtothreitol (DTT) is from Boehringer Mannheim (Cat. no 100032). 3. Phosphatase assay buffer 50 mM HEPES, pH 7.5,2 mA4 DTT, 0.1 mg/mL bovine serum albumin (BSA)
2.3. Dually Phosphorylated-MAPK 1. Histidme-tagged MAP kmase, His6-MAPK (also called His6-ERK2) (32), is expressed m E co11 and purified by affinity chromatography on Ni-NTA-agarose (Qiagen, cat no. 30210) 2. Xenopus extracts from metaphase-II arrest eggs are prepared accordmg to Shibuya et al. (32) 3. Okadatc acid, ammonmm salt (LC Laboratory, O-6410), is dissolved m dimethyl sulfoxide at a concentration of 500 p&l. Aliquot and store at -20°C in dark 4. [r3*P]ATP, end-labelmg grade, >7000 Cr/mmol and >160 mCr/mL (ICN, Cat. no. 35020). 5. ATP regenerating system consists of 20 mM adenosine triphosphate (ATP), 20 mM MgC12, 0.2 M creatme phosphate (Boehrmger Mannheim, Cat. no. 127-574) and 1 mg/mL creatme kmase (Boehrmger Mannheim, Cat. no. 126-969)
2.4. Dephosphorylation
of MAPK
1. Immobilon-P PVDF transfer membrane (Millipore, IPVH- 15 150). 2 Two-dimensional (2D) electrophoresis technique to analyze phosphoamino acids is carried out according to Boyle at al. (33). 6 N HCL (constant-boilmg grade) is from Sigma (H 0636), thin-layer cellulose (TLC) plate 1s from VWR (EM5716-7). Ninhydrin (Sigma, N4876) is dissolved m acetone as a 0 2% solution Cold phosphoammo-acid standards are prepared as a mixture of o-phospho+serine (Sigma, P5506), o-phospho-L-threonme (Sigma, P1053), and o-phospho-Ltyrosme (Sigma, P9405), each at 1 mg/mL in HzO. pH 1.9 buffer (consists of 5 mL of 88% formic acid, 15.6 mL glacial acetic acid, 179. 4 mL H,O), and pH 3 5 buffer (consists of 10 mL glacial acetic acid, 1 mL pyrtdine, 189 mL H,O) are prepared accordmgly (33) 3. 2D electrophoresis umt (Pharmacia/LKB, Multiphor II electrophoresis unit) with an attached cooling unit. 4. 2X Lammali sample buffer consists of 4% SDS, 20% glycerol, 120 mM Trts pH 6.8,O 01% bromophenol blue
Sun
310
5 Myelin basic protein (Sigma, M 1891) 1s dissolved m water at concentratton of 10 mg/mL. Store at -20°C. 6. P81 filters, 2-cm circles are obtained from Whatman (Cat. no 3698021) 7. 2X kmase assay mixture is composed of 80 mZt4 HEPES pH 7.5,20 n&f MgCl,, 100 luV ATP, 0.4 mg/mL myelm basic protein, 10 n-J4 vanadate, and [Y-~~P]ATP (5 @i per reaction).
2.5. Detection of Physical Complex of the Phosphatase and MAPK 1. COS cells are maintained m Dulbecco’s modified Eagle’s medium (DMEM, from Grbco-BRL) supplemented with 5% fetal bovine serum (FBS, from Grbco-BRL) 2 Protein A-Sepharose (Pharmacta, no. 17-0780-01) 1s swollen m water, washed with phosphate-buffered salme (PBS), and stored m PBS as 1: 1 suspension at 4°C 3 Leupeptm, aprotmm, and PMSF are obtained from Boermgher Mannhetm Benzamidme, sodium fluoride (NaF), and sodium pyrophosphate (NaPPr) are from Sigma 4 NP40-contammg lysrs buffer. 50 mM Trts-HCl, pH 7 5, 150 mM NaCl, 0.5% NP40, 10 @/mL leupeptm, 10 pg/mL aprotmm, 1 mM benzamtdme, 1 mM PMSF, 10 mM NaF, 1 n-&f NaPPt, 0.5 l&J okadaic acid.
3. Methods
3.1. Preparation of 32P-Labeled Phospho-Tyrosyl Choosmg
a substrate
to assay the activity
Substrate
of a phosphatase
is quite impor-
tant, especially for MKP- 1 like dual-specificity phosphatases, which usually have low activity toward artificial substrates. RCML, a chemically modified form of lysozyme, has excellent solubility and can be phosphorylated by tyrosine kinases to high stoichiometry (34). We have used RCML successfully to measure the tyrosme phosphatase activity of MKP-1 (7). Other potential substrates, including myelm-basic protein or peptide substrates, can also be used and they have been discussed in detail by Tonks (34). The choices for tyrosine kinases to phosphorylate the substrates include BIRK (31) that has been used successfully for phosphorylation of RCML. There are also commercial sources for tyrosine kinase abl or src The procedure to phosphorylate RCML using BIRK IS described below. Precaution should be taken to handle radioactive material. 1. In an Eppendorf tube, set up a labeling reaction contammg RCML 2 mg/mL, 32P-y-ATP 1 mCi/mL, and BIRK 200 mU/mL m RCML-labeling buffer. To calculate the spectficrty of 32P-y-ATP in the reaction (t.e., cpm/pmol), remove an ahquot of the reaction mixture, dilute, and count by hqurd scmtillanon. Perform the dilution and counting m triplicates. Dtvtde the total cpm by the expected pmol of ATP m the counted sample to get the value of cpm/pmol.
Dual-Specificity
311
Phosphatases
2. Incubate the reaction at 30°C for 6 h. 3. Stop the labeling reaction by addition of chdled 100% TCA to final 10% Incubate on ice for 30 mm. White precipitate will be observed at this point. Centnfuge at 12,000g at 4°C for 10 min. Carefully remove the supernatant. Wash the pellet with cold 10% TCA, centrifuge again, and remove the supernatant. Repeat wash two more times. 4. To the pellet add 2 M Tris base to 0.4 vol of the initial reaction volume. Incubate the tube on ice overnight to completely dissolve the pellet 5. Transfer the mixture to a dialysis tubing. Dialyze against 1 L of 50 mM Imldazole pH 7 2 with three exchange of buffer in a 48-h period. 6. Recover the substrate from the dialysis tubing. Centrifuge at 12,000g for 10 min to remove any msoluble material. Transfer the supernatant to a new tube and store at 4°C in a shielded container. Count an aliquot (dilute if necessary) by liquid scmtlllatlon. From the specificity of 32P-y-ATP m the reaction (step l), one can calculate the substrate concentration (i.e., pmol/pL or p.mol/L)
3.2. In Vitro Dephosphorylation
of 32P-Tyr-RCML
Dephosphorylation reactlon IS carried out m a pH buffer containing a reducing agent, the enzyme to be assayed, and the 32P-labeled substrate. Reducing agent is crucial for the phosphatase activity because catalysis by a tyrosine phosphatase or a dual-specificity phosphatase is mediated through an essential-cysteinyl residue. In fact, preincubation of these phosphatases with a cysteinyl residue-modification agent such as iodoacetic acid will abolish the phosphatase activities. When characterizing a novel phosphatase, it is recommended to initially test the phosphatase activity in different pH conditions, because many phosphatases are quite sensitive to pH (see Note 1). 1. Set up a 60-p.L reaction m an Eppendorf tube contammg the phosphatase assay buffer, l-5 w 32P-Tyr-RCML and the phosphatase (the enzyme should be added last). Incubate at 30°C for 10 min. Assays should be performed m duplicates or triplicates. A reaction containing buffer alone should be performed to serve as blank control. 2. Stop the reaction by adding 290 p.L charcoal-termination mix. Mix thoroughly and let sit for 5 mm at room temperature. Centrifuge at 12,000g for 5 mm. The released inorganic phosphate will remam m the supematant. 3. Carefully remove 250 p.L of the supernatant. Add to a scintillation vial contaming 2 mL scmtillatlon fluid and count cpm. Also count cpm of one whole reaction mixture (total cpm). The following equation can be used to calculate the percentage of dephosphorylation: (cpm - blank) x 1.4 total cpm
312
Sun m which cpm represents the counts released from the phosphatase contaming sample, blank represents cpm released from the buffer only sample, and total cpm represents counts present m the whole reaction. A factor of 1.4 accounts for the fact that 250 pL out of 350 pL has been counted To calculate the number of phosphate molecules released m the assay, multiply the percentage of dephosphorylation by the total pmols of substrates present in the reactton.
3.3. Preparation
of Dual-Phosphorylated
and 32P-Labeled MAPK
Although MKP- 1 exhibits tyrosine-phosphatase activity toward the artificial substrate RCML, it has very poor activity toward seryl- or threonylphosphorylated artificial substrates such as RCML, casein, or phosphorylase a (7). However, when assayed on dual-phosphorylated MAPK, MKP-1 IS very active toward both phosphotyrosme and phosphothreonme (Fig. 1 and ref. S), reflecting the substrate selectivity of the enzyme. Therefore it is important to assay phosphatase acttvity on a physiologically relevant substrate. Phosphorylation of MAPK, carried out by MAPK kinase (MAPKK), takes place on both tyrosyl and threonyl regulatory sites. In p42mark,these residues are Y 185 and T183. Metaphase II-arrestedxenupus extracts can phosphorylate and activate MAPK highly efficiently (32). Other sources of active MAPKK preparations have also been described, most notably are the recombinant, constitutively activated mutant forms of MAPKK (35). The following is a protocol that we have modified after Shibuya et al. (32) to obtain dualphosphorylated and 32P-labeled MAPK. 1. Set up a reaction contammg 100 pL of metaphase II extract, 25 yL of 2 mg/mL His,-MAPK, 20 yL of 160 mCi/mL [Y-~*P]ATP (ICN) and 0.5 lrL of 500 l.W okadaic acid (see Note 2). Incubate at room temperature for 1 h. 2. To the reaction mixture, add 40 pL of 1:l suspension of Ni-NTA-agarose and 1 pL 10% Triton X-100. Rock at 4°C for 30 min 3. Beads are collected by centrifugatron at 3000g for 3 mm and washed three times with 1 mL PBS. Elute His6-MAPK by adding 50 ~.LL of 250 mA4 Imidazole pH 7.0, centrifuge, and collect supernatant. Repeat elution once and pool the eluate. The phosphorylated and activated MAPK can be temporally stored at 4°C. For long-term storage, add equal volume of 100% glycerol and store at -20°C.
3.4. In Vitro Dephosphorylation of MAPK and Phosphoamino Acid Analysis 1 Activated and 32P-labeled His,-MAPK (l-2 pL per reaction) is incubated with a dual-specificity phosphatase m phosphatase-assay buffer at 30°C for various times. 2. The reaction is terminated with addition of 2X Laemmh sample buffer and reaction products were resolved by SDS-PAGE, blotted to Immobilon membrane and visualized by autoradiography (see Note 3).
Dual-Specificity
T
Phosphatases
313
I)
Y
oH3.5 pH1.9
Fig. 1. Analysis of phosphoamino acids dephosphorylated by MKP-1. Activated and 32P-labeled histidine-tagged p42”qk was incubated with recombinant MKP-1 enzyme for 5-30 min. Alternatively, MAPK was incubated with buffer alone (lane C) or with MKP-1 in the presence of 5 m&f vat&ate (lane V) for 30 min. The reaction products were resolved by SDS-PAGE, transferred to Immobilon membrane and exposed to X-ray film (upper panel). The 32P-labeled p42”“Pk band was excised and subjected to phosphoamino acid analysis with electrophoresis in the first dimension at pH 1.9 and the second dimension at pH 3.5. The image obtained after exposure to a Fuji imaging plate is shown (bottom panel). Phosphothreonine (T) and phosphotyrosine (Y) are indicated.
3. The radioactive band on the Immobilon membrane is excised and subjected to two-dimensional phosphoamino acid analysis according to Boyle et al. (33). Briefly, the excised membrane is subjected to acid hydrolysis (6 N HCL, boiling grade) at 110°C for 1 h. The liquid sample is then lyophilized and redissolved in pH 1.9 electrophoresis buffer mixed with unlabeled phosphoamino acid standards (1: 1 mixture of pH 1.9 buffer with 1 mg/mL cold phosphoamino acid standards). After spotting the samples on a TLC plate, electrophoresis is carried out at 1500 V for 45 min in pH 1.9 buffer for the first dimension, and then at 1300 V for 30 min in pH 3.5 buffer for the second dimension, using a Pharmacia/ LKB Multiphor II electrophoresis unit that is cooled to 4°C. 4. The TLC plate is air-dried and sprayed with ninhydrin (0.2% in acetone) to visualize the amino acid standards. The plate is then either exposed to an X-ray film at -7O’C with an intensifying screen or to a phosphor-imaging plate. An example of such analysis is shown in Fig. 1. MKP-1 exhibits activities towards both phosphotyrosine and phosphothreonine residues in MAPK. Both dephosphorylation events are proceeded at similar rates and both are inhibited by vanadate. In addition, both of the tyrosine phosphatase and serinekhreonine
314
SlJl7 phosphatase activities can be abolished by Cys258+Ser center m MKP- 1 (8).
mutation at the catalytic
3.5. Detection of Physical Complex Formed by the Phosphatase and MAPK The specificity of MKP-1 for MAPKs IS hlghlighted by the fact that the Cys258-+Ser mutant of MKP-1 (MKP-1CS) can form a high-affinity complex with the phosphorylated forms of p42mapkand p44mapk(8). Such complexes can be revealed by coimmunoprecipitation of MKP- 1CS and p42mapk,as illustrated m Fig. 2. 1 Transfectron of COS cells IS performed usmg a standard calcrum phosphate method with plasmids allow expression of either wild-type or Cys+Ser mutant phosphatase, or a vector control (10 pg plasmtd DNA for each 6-cm plate) Precipitates are removed after -12-h mcubation, cells are left to recover in DMEM containing 5% FBS for 24 h. Cells are then serum-depraved by maintammg m serum-free DMEM medium for 24 h. yen necessary, cells are stimulated with 20% FBS for 10 min tmmediately prior to harvesting. 2 All subsequent washes or mcubattons are performed at 4°C. Cells on plates are washed with PBS, and lysed with NP40-containmg lysis buffer. Lysates are clarrfled by centrifugatton at 12,000g for 5 mm. 3. Lysates are premcubated with protein A-Sepharose for 30 min and centrifuged. The precleared lysates are then incubated with antiphosphatase antibody (e.g., anti-MKP- 1 antibody), precoupled to protein A-Sepharose beads, and rmmunoprecipitation is proceeded for 4-6 h at 4°C. Immunoprectpttates are then collected by centrtfugation at 3000g for 2 min, washed four times with lysis buffer, resuspended m 1X Laemmh sample buffer, resolved by SDS-PAGE and transferred to mtrocellulose. The proteins on the blot are detected by immunoblottmg analysis using antibody specific for the coimmunoprecrpitated protein (e g., anti-MAPK antibody).
4. Notes 1. Initially a time-course of reaction should be performed in the range of l-30 mm interval. Dephosphorylation percentage should be calculated and plotted on a graph as the function of time. A time point in the linear range of dephosphorylation (usually ~20% of dephosphorylatton) should be chosen for more detailed characterrzatron of the phosphatase, e.g., us sensitivity to various inhibitors. Dual-specificity phosphatases should behave srmilarly as tyrosme phosphatases, i.e., sensitive to iodoacetic acid (10 n-H), a cystemyl-modtfying agent, and vanadate (1 mM), a commonly used tyrosme phosphatase inhibitor, but not sensttive to okadarc acid (1 l&r), an inhibitor for mammalian serine/threonine phosphatase 1 and 2A. An example of biochemical characterization of dual-specificity phos-
Dual-Specificity
Serum
Phosphatases
ITIT
_
315
_
_
12345676
Fig. 2. Immunodetection of physical complex between MKP-1CS and p42mapk. COS cells were transfected either with plasmid pSG5 (vector) (lane 1 and 2), pSG5MKP-l(myc) (lane 3 and 4) or pSG5-MKP-lCS(myc) (lane 5 and 6), serum-deprived, then either stimulated with serum (+) for 10 min or left untreated (-). In lanes l-6, myc-epitope-tagged MKP-1 or MKP-1CS were immunoprecipitated with antibody 9ElO. In lanes 7 and 8, an aliquot of the cell lysate each corresponding to that in lanes 5 and 6 respectively, were subjected directly to SDS-PAGE. The presence of p42”“Pk was detected by immunoblotting with anti-MAPK antibody B9. The arrows denotes the position of immunoglobin heavy chain (IgG H) and the phosphorylated (p42”“pk-P) and unphosphorylated (p42 ““Pk) forms of MAPK. (Adapted with permission from Cell 75,490, 1993.)
phatase can be found in Charles et al. (7). To verify that the dephosphorylation activity is intrinsic to the recombinant phosphatase, a Cys+Ser mutant derivative should be used as control. 2. If 32P-labeling of MAPK is not required, more efficient activation of MAPK can be obtained by substituting 20 pL of 160 mCi/mL [Y-~~P]ATP with 6 pL of ATP-regenerating system. 3. The phosphatase-treated MAPK can also be subsequently assayed for kinase activity using myelin-basic protein. Instead of adding Laemmli sample buffer to terminate the dephosphorylation reaction at Subheading 3.4., step 2, an equal volume of 2X kinase assay mixture can be added to the phosphatase-pretreated MAPK. The reaction mixture is further incubated at 30°C for 20 min, and a 20-p.L aliquot is spotted on P81 filters, which are then washed extensively in 0.4% v/v phosphoric acid. The protein-bound 32P is subsequently counted by liquid scintillation. It is recommended that the reactions to be carried out in duplicates or triplicates to reduce sample fluctuations.
Slln
316
Acknowledgments The author, who is a Pew Scholar in Biomedical Sciences, would like to thank Nicholas Tonks m whose laboratory many of the experiments described here were initially carried out.
References 1. Sun, H. and Tonks, N. K (1994) The coordinated actlon of protein tyrosme phosphatases and kmases m cell slgnalling. Trends Blochem Scl 19,4&Q-485. 2. Charbonneau, H. and Tonks, N. K (1992) 1002 protem phosphatases? Ann Rev Cell Blol 8,463-493.
3. Barford, D., Flint, A J., and Tonks, N. K. (1994) Crystal structure of human protem tyrosme phosphatase 1B. Science 263, 1397-1404. 4. Yuvaniyama, J., Denu, J M., Dixon, J. E., and Saper, M. A. (1996) Crystal structure of the dual speclficlty protein phosphatase VHR. Science 272, 1328-1331. 5. Guan, K. and Dixon, J. E (1991) Evidence for protein-tyrosme-phosphatase catalysis proceeding via a cysteme-phosphate intermediate. J Biol Chem 266, 17,026-17,030. 6. Zhou, G., Denu, J. M , Wu, L., and Dixon, J. E. (1994) The catalytic role of Cys124 m the dual specificity phosphatase VHR. J. Bzol. Chem. 269,28,084-28,090. 7. Charles, C. H., Sun, H., Lau, L F., and Tonks, N. K. (1993) The growth factor inducible Immediate early gene 3CH134 encodes a protein tyrosme phosphatase Proc. Nat1 Acad. Sci. USA 90,5292-5296.
8. Sun, H., Charles, C., Lau, L. F., and Tonks, N. K. (1993) MKP-1(3CH134), an immediate early gene product, 1sa dual speclficlty phosphatase that dephosphorylates MAP kmases in vivo. Cell 75,487-493. 9. Alessl, D R., Smythe, C., and Keyse, S M (1993) The human CL100 gene encodes a Tyr/Thr-protein phosphatase which potently and specifically inactivates MAP kmase and suppresses its activation by oncogemc ras in Xenopus oocyte extracts. Oncogene 8,2015-2020. 10. Zheng, C. F. and Guan, K. L. (1993) Dephosphorylation and inactlvatlon of the mitogen-activated protein kmase by a mitogen-induced Thr/Tyr protein phosphatase. J Bzol Chem. 268, 16,116-16,119. 11. Noguchi, T., Metz, R., Chen, L., Mattei, M. G., Carrasco, D., and Bravo, R. (1993) Structure, mapping, and expresslon of erp, a growth factor-mduclble gene encoding a nontransmembrane protein tyrosme phosphatase, and effect of ERP on cell growth Mol Cell Blol 13,5195-5205 12. Sun, H., Tonks, N. K., and Bar-Sagl, D. (1994) Inhlbltlon of Ras-induced DNA synthesis by expression of the phosphatase MKP-1. Sczence 266,285-288. 13. Cobb, M. H. and GoldsmIth, E. J. (1995) How MAP kmases are regulated. J Blol. Chem 270, 14,843-14,846.
Dual-Specificity
Phosphatases
317
14. Ward, Y., Gupta, S., Jensen, P., Wartmann, M., Davis, R. J., and Kelly, K. (1994) Control of MAP kinase activation by the mitogen-Induced threonine/tyrosme phosphatase PACl. Nature 367,651-654. 15. Misra-Press, A , Rim, C S , Yao, H., Roberson, M. S., and Stork, P J. (1995) A novel mitogen-activated protein kinase phosphatase. Structure, expression, and regulation, J Biol. Chem 270, 14,587-14,596 16. Guan, K-L. and Butch, E (1995) Isolation and characterization of a novel dual specific phosphatase, HVH2, which selectively dephosphorylates the mitogenactivated protein kinase. J Blol Chem. 270,7197-7203. 17. King, A. G., Ozanne, B. W., Smythe, C., and Ashworth, A. (1995) Isolatton and characterisation of a uniquely regulated threonme, tyrosme phosphatase (TYP 1) which inactivates ERK2 and p54Jnk. Oncogene. 11, 2553-2563. 18. Kwak, S. P and Dixon, J E (1995) Multiple dual spectftcity protein tyrosine phosphatases are expressed and regulated differenttally in liver cell lines. J Biol Chem. 270,1156-l 160. 19. Ishibashi, T., Bottaro, D. P., Chan, A , Mikt, T., and Aaronson, S. A. (1992) Expression cloning of a human dual-specificity phosphatase. Proc Nat1 Acad. Scz. USA 89, 12,170-12,174. 20. Muda, M., Boschert, U., Dickinson, R., Martinou, J. C., Martmou, I., Camps, M., Schlegel, W., and Arkinstall, S (1996) MKP-3, a novel cytosolic protein-tyrosme phosphatase that exemplifies a new class of mitogen-activated protein kinase phosphatase. J Biol Chem 271,4319-4326. 21. Mourey, R. J., Vega, Q. C., Campbell, J. S., Wenderoth, M. P., Hauschka, S. D., Krebs, E. G., and Dixon, J. E. (1996) A novel cytoplasmtc dual-specificity protein tyrosine phosphatase implicated in muscle and neuronal differentiation. J. Blof. Chem. 271,3795-3802.
22. Groom, L. A., Sneddon, A, A , Alessi, D. R., Dowd, S , and Keyse, S. M. (1996) Differential regulation of the MAP, SAP, and RK/p38 kmases by Pystl, a novel cytosolic dual-specificity phosphatase EMBO J 15, 3621-3622. 23. Martell, K. 3. Seasholtz, A. F., Kwak, S. P., Clemens, K. K., and Dixon, J E. (1995) hVH-5: a protein tyrosme phosphatase abundant m brain that inactivates mitogen-activated protein kmase. J Neurochem 65, 1823-1833 24. Guan, K., Broyles, S S., and Dixon, J. E. (1991) A Tyr/Ser protein phosphatase encoded by vaccima virus. Nature 350,359-362. 25. Ishibashi, T., Bottaro, D. P., Michieli, P., Kelley, C. A , and Aaronson, S. A. (1994) A novel dual specificity phosphatase induced by serum strmulation and heat shock. J. Biol Chem 269,29,897-29,902. 26. Diamond, R. H., Cressman, D. E., Laz, T. M., Abrams, C S., and Taub, R. (1994) PRL-1, a unique nuclear protein tyrosine phosphatase, affects cell growth. Mol Cell Blol 14,3752-3762.
27. Gyuris, J., Golemts, E., Chertkov, H., and Brent, R. (1993) Cdil, a human Gl and S phase protein phosphatase that associates with Cdk2. Cell 75, 791-803.
318
Sun
28. Hannon, G. J., Casso, D., and Beach, D. (1994) KAP. a dual specificity phosphatase that mteracts with cyclm-dependent kmases. Proc Nat1 Acad Scl USA 91,1731-1735. 29. Poon, R. Y. C. and Hunter, T. (1995) Dephosphorylation of Cdk2 Thr160 by the cyclin-dependent kmase-mteractmg phosphatase KAP in the absence of cyclm Science 270,90-92.
30. Millar, J. B. A. and Russell, P. (1992) The cdc25 M-phase inducer: an unconventional protein phosphatase. Cell 68,407-410. 31. Villalba, M., Wente, S. R., Russell, D. S., Ahn, J. C., Reichelderfer, C. F., and Rosen, 0. M. (1989) Another version of the human msulm receptor kinase domain: expression, purification, and characterization. Proc Natl. Acad. Scl. USA 86,7848-7852. 32 Shibuya, E. K., Polvermo,
A. J., Chang, E., Wtgler, M., and Ruderman, J. V. (1992) Oncogemc Ras triggers the activation of 42-kDa mitogen-activated protem kmase m extracts of quiescent Xenopus oocytes. Proc Nat1 Acad Scz USA
89,9831-9835. 33. Boyle, W. J , Van Der Gee, P , and Hunter, T. (1991) Phosphopeptide
mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Meth. Enzymol 201, 110-149. 34. Tonks, N. K. (1993) Characterization of protein tyrosine phosphatases, m Protein Phosphorylatron’A PractzcalApproach (Hardie, D. G., ed.), IRL Press, pp. 231-252. 35. Mansour, S. J., Resing, K. A., Candi, J. M., Hermann, A. S., Gloor, J. W , Herskind, K. R., Wartmann, M., Davis, R. J., and Ahn, N. G. (1994) Mitogenactivated protein (MAP) kinase phosphorylatton of MAP kmase kinase. determlnation of phosphorylation sites by mass spectrometry and site-directed mutagenesis J Biochem 116,304-3 14
