Soybeans : cultivation, uses and nutrition

AGRICULTURE ISSUES AND POLICIES

SOYBEANS: CULTIVATION, USES AND NUTRITION No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.

AGRICULTURE ISSUES AND POLICIES Additional books in this series can be found on Nova‘s website under the Series tab. Additional E-books in this series can be found on Nova‘s website under the E-books tab.

AGRICULTURE ISSUES AND POLICIES

SOYBEANS: CULTIVATION, USES AND NUTRITION

JASON E. MAXWELL EDITOR

Nova Science Publishers, Inc. New York

Copyright © 2011 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers‘ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Soybeans : cultivation, uses and nutrition / editor: Jason E. Maxwell. p. cm. Includes index. ISBN 978-1-61122-092-6 (eBook) 1. Soybean. 2. Soybean--Utilization. 3. Soybean--Nutrition. I. Maxwell, Jason E. SB205.S7S5543 2011 633.3'4--dc22 2010031753

Published by Nova Science Publishers, Inc. † New York

CONTENTS Preface Chapter 1

ix Soybean Seed Composition and Quality: Interactions of Environment, Genotype, and Management Practices Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns, Anne M. Gillen, Alemu Mengistu, Luiz H. S. Zobiole, Daniel K. Fisher, Hamed K. Abbas, Robert M. Zablotowicz and Robert J. Kremer

Chapter 2

Soy Food in Demand: A Present and Future Perspective M.K.Tripathi and S.Mangaraj

Chapter 3

Processed Foods from Soybean Seeds in Japan and the Characteristics Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe, Sayaka Shimojo and Takuji Ohyama

1

43

79

Chapter 4

Soybean Meal in Diets for Cultured Fishes Anne Marie Bakke

125

Chapter 5

Soybean, a Peroxidase Source for the Biotreatment of Effluents J.L. Gómez, M. Gómez and M.D. Murcia

155

Chapter 6

Soybean Peroxidase Applications in Wastewater Treatment Mohammad Mousa Al-Ansari, Beeta Saha, Samar Mazloum, K. E. Taylor, J. K. Bewtra and N. Biswas

189

Chapter 7

Soybean Germination and Cancer Disease María del Carmen Robles Ramírez, Eva Ramón Gallegos and Rosalva Mora Escobedo

223

Chapter 8

Glyphosate Interactions with Physiological, Microbiological, and Nutritional Parameters in Glyphosate-Resistant Soybeans Luiz Henrique Saes Zobiole, Robert John Kremer and Rubem Silvério de Oliveira Jr.

251

vi

Contents

Chapter 9

Oxidative Stress in Soybean: Role of Iron Andrea Galatro and Susana Puntarulo

Chapter 10

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance to Insects Milena Schenkel Homrich, Maria Helena Bodanese-Zanettini and Luciane M. P. Passaglia

Chapter 11

Chapter 12

273

291

Soybean Oil Deodorizer Distillate: An Integrated Isolation and Analyses System of Its Bioactive Compounds Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

309

Biofilm Formed on the Soybean Curd Residue Is Associated with Efficient Production of a Lipopeptide by Bacillus Subtilis Makoto Shoda and Shinji Mizumoto

333

Chapter 13

Extraction and Characterization of Soybean Proteins Savithiry S. Natarajan and Devanand L. Luthria

353

Chapter 14

Soybean Oil in Health and Disease Cristina M. Sena and Raquel M. Seiça

371

Chapter 15

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production M.W. Wilwert, J.C. Parizoto, M.R. Silva, S.M.F. Albani, M.M. Machado, G.S. Azarias, A.J. Silva, A.C.L. Horta, J. Cabrera-Crespo, T.C. Zangirolami, and M. Takagi

Chapter 16

Chapter 17

Chapter 18

Chapter 19

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara Protein Hydrolysates Produced with Pepsin Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque and Pilar Rupérez Use of Soy Peptones for Streptococcus Pneumoniae Cultivation for Vaccine Production C. Liberman, D. Kolling, R. S. Sari, M. Takagi, J. Cabrera Crespo, M. E. Sbrogio Almeida, J. G. C. Pradella, L. C. C. Leite and V. M. Gonçalves Production and Consumption of Green Vegetable Soybeans ―Edamame‖ Yoshihiko Takahashi and Takuji Ohyama Soybean as a Model to Study Defensive Responses Enhanced by Fungal Elicitors, Nitric Oxide and Elevated CO2 Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich, Luzia Valentina Modolo and Ana Paula de Faria

387

401

415

427

445

Contents

vii

Chapter 20

Applications of Soybean Peroxidase in Analytical Science Shuang Han, Lihong Shi and Guobao Xu

455

Chapter 21

Soybean Nutrition: Protein and Isoflavones Savithiry S. Natarajan, Devanand L. Luthria and Ronita Ghatak

465

Chapter 22

Nutritional Enhancement of Soybean Meal and Hull via Enzymatic and Microbial Bioconversion Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

Index

471

487

PREFACE Soybean is one of the major world crops. In 2008, the world consumption of soybean was over 221 million metric tons of which approximately 50% came from the U.S. Soybean seed is a major source of protein, oil, carbohydrates, isoflavones, and minerals for humans and animals. This book presents current research data from across the globe in the study of soybean cultivation, its uses and nutrition. Some topics discussed herein include soybean seed composition and quality; soybean peroxidase applications in wastewater treatment; soybean germination and cancer disease; soybean oil deodorizer distillate; soybean oil in health and disease; and the use of soybean peptone in bacterial cultivations for vaccine production. Chapter 1 – Soybean [Glycine max (L) Merr.] seed is a major source of protein, oil, carbohydrates, isoflavones, and minerals for human and animal nutrition. About one-third of the world's edible oils and two-thirds of protein meal are derived from soybean seed. Thus, improving soybean seed composition and quality is key to improving human and animal nutrition. Seed composition refers to major constituents found within the seed including protein, oil, fatty acids, carbohydrates, isoflavones, and mineral content which determine seed nutritional value. Soybean seed quality refers to viability, germination, and seedling vigor which directly impact yield. Seed composition and quality are known to be genetically controlled, and significant variability in seed quality and composition exist due to differences in the gene pool. The physiological and biochemical mechanisms by which this variability is expressed are still not completely understood, but are known to be significantly influenced by genotype (G), environment (E), management practices (MP), and their interactions. Understanding the interaction of these factors and how they impact seed composition and quality is crucial for maintaining high yield and quality. This review highlights the current research on seed composition and quality as influenced by G, E, MP, plant diseases, and their interactions from physiological, biochemical, and genetic perspective. This review also highlights major challenges in soybean seed composition and quality improvement, and examines how current research techniques have been used for improving seed nutritional value for conventional uses such as food and feed or for specialty uses such as tofu, soymilk, and other soy products. This information is beneficial as a source in soybean breeding, physiology, and biochemistry research. Chapter 2 – The soybean is widely believed to have originated 4000-5000 years ago in the north and central regions of China. Historically, soybeans have played an important part in Asian culture, both as a food and as a medicine. Soybeans have been consumed throughout

x

Jason E. Maxwell

Asia for more than 1000 years in a variety of traditional soy food products. Asian countries still utilize soybeans largely for traditional soy food production. In 1999, Asian countries accounted for nearly half of the 23 million tons of soybeans exported by the U.S. traditional soy foods, those foods prepared from whole soybeans, are typically divided into two categories: nonfermented and fermented. Traditional nonfermented soy foods include fresh green soybeans, whole dry soybeans, soy nuts, soy sprouts, whole-fat soy flour, soymilk, tofu, okara, and yuba. Fresh green soybeans and whole dried soybeans are prepared and consumed in much the same fashion as Western bean dishes, eaten plainly or serving as additions to soups and stews. In addition to the drying of soybeans to create whole dried varieties, dry roasting may also be employed to create a crunchier product known as a soy nut. Soy nuts can be eaten whole as a snack food, or used in food applications similar to dry roasted peanuts. Soy sprouts, prepared by the soaking, washing, and sprouting of soybeans, are consumed as a vegetable throughout the year in many Asian countries, and are used in soups, salads, and side dishes. Whole-fat soy flour, prepared from the grinding of whole dried soybeans, is used in bakery applications in the place of milk powder applications or as a substitute for wholewheat flour. Preparations of soymilk, tofu, okara, and yuba begin with the soaking of whole soybeans, followed by rinsing, grinding, and filtering. The insoluble residue at this point is called okara, it can be used in the making of a dish, salted as a pickle, or fermented in the production of tempeh. Further processing of the filtered soybean liquid includes cooking to yield soymilk. Tofu is made from the further processing of soymilk in which different coagulants are added to precipitate the protein from the soymilk. Traditional fermented soy foods include tempeh, miso, soy sauces, natto, and fermented tofu (sufu) and soymilk products. Tempeh is a product produced from the fermentation of dehulled, boiled soybeans by Rhizopus oligosporus. The process of fermentation yields a cake like product with a clean yeasty odor. Tempeh is usually served as meat substitute that, when sliced and deep-fried, has a nutty flavor, pleasant aroma, and crunchy texture. Miso is the Japanese term used for bean paste and refers to fermented paste like products. Miso production begins with making a starter culture, or koji, which consists of a cereal (rice, barley, or soybeans) which, is soaked, cooked, cooled, and inoculated with a mixture of strains of Aspergillus orzae and Aspergillus soyae. Soy sauce is a salty, sharp tasting, dark-brown liquid extracted from fermented mixture of soybeans and wheat. Natto is a sweet, aromatic product made from the fermentation whole soybeans with Bacillus natto. A number of traditional fermented soy food products also exist that are made from the fermentation of tofu and soymilk. Sufu, or Chinese cheese, is produced by the fermentation of fresh tofu by fungi, such as Mucor hiemalis or Actinomucor elegans. Soymilk is used to produce soybean yogurt, which is similar to western dairy yogurt, and is basically a mixture of soymilk, whey, and sucrose that has been cooked and cooled and inoculated with Lactcoccus acidophilus. Although soybeans were introduced to Europe in the 1700s, little interest developed until the early 1900s, primarily because of the plants inferior flavor quality compared to the native oil and meal products. Soybeans were introduced to the Eastern United States (U.S.) in the late 1800‘s with production spreading to the Midwest by 1920. Through the early 1930s, soybeans were grown primarily as a pasture and forage crop. However, by 1947, 85% of the crop was harvested for seed processing in the production of oil. As demand increased, markets developed for soybean oil and later for the high-quality soybean meal used as a protein source for animal feeds. Soybeans contain about 40 % fat and oil from soybeans is the world‘s leading vegetable oil and accounts for well over half the fats and oils going into food products in the U.S. The bulk of the soybean oil produced is

Preface

xi

consumed as salad oil. Industrial applications for soybean oil also exist and include soap manufacture, paints, resins, and drying oil products. The major uses domestically are cooking and salad oils, shortening, and margarine. Chapter 3 – The average life span in Japan was 83 years old (women 86.08, men 79.29) in 2009, and that of women was the longest in the world. This may be partly due to low fat Asian dishes with rice, soybean products, fish, and vegetables. Soybeans originated from East Asia, and Japanese people eat many traditional foods made from soybeans, such as Shoyu, Miso, Tofu, Natto etc. Soybean seed is one of the most important protein sources for humans and livestock all over the world. The amino acid composition of soybean is relatively well balanced, although soybean seeds contain a relatively low amount of sulfur amino acids, methionine, and cysteine. Soybean seeds contain a large amount of lipids, minerals, and vitamins. Soybean seeds also contain isoflavonoids, daidzein and genestein, and other components to keep human health well. The isoflavonoids are expected to play a role like a female hormone or to decrease fat in blood. In this chapter, the authors would like to introduce the nutritional value of soybean seeds, and the production, cooking and nutrition of some traditional Japanese soy foods, such as Shoyu (soy sauce), Miso (fermented soy paste), Tofu (soy curd), and Natto (fermented soybean with bacteria). In addition, recent advances in the physiological effects of soy protein and processed foods in Japan are introduced. Chapter 4 – According to the Food and Agriculture Organization of the United Nations (FAO), aquaculture‘s contribution to total global fisheries is increasing faster than capture fisheries, and aquaculture is now supplying about half the fish consumed by the human population worldwide. Capture fisheries of wild fish stocks, on the other hand, has shown zero or negative growth in recent years. Capture fisheries have been the main sources of fishmeal and fish oil, traditionally used as the main protein and lipid sources in formulated diets for many cultured fish species, especially carnivorous fish. However, the limited global supply of fishmeal and fish oil has led to the increasing use of alternative protein and lipidrich feed ingredients in aquafeeds, mostly from plant crops. Soybean meal is used for partial replacement of fishmeal in formulated aquafeeds for many species, due to the ample market supply, lower market price, high protein concentration and favorable amino acid composition. Among alternative feed ingredients, by far the most research on effects on growth performance as well as digestive and immune function in teleost fishes has been carried out with soybean products. This may partly be due to early reports of the negative impact that de-hulled, full-fat or de-fatted (hexane extracted) soybean meal (SBM)-containing diets have on some production animals, including salmonid fishes such as Atlantic salmon and rainbow trout. In salmonids, dietary inclusion of SBM can cause dramatic reductions in growth performance, nutrient digestibilities, and diarrhea. These can at least partially be explained by an inflammatory response in the distal intestine (hind gut), termed soybean meal-induced enteropathy. It is characterized by a high level of Tlymphocyte infiltration into the intestinal mucosa. However, the decreased nutrient digestibility and utilization of SBM in salmonid diets also appears to be due to decreased enzymatic digestion and assimilation of nutrients, and increased production and loss of endogenous secretions/enzymes in the more proximal regions of the intestine. The metabolic cost of the inflammatory response in the distal intestine may also lead to reduced growth performance. In salmonids, the inflammatory reaction in the distal intestine has been observed in all individuals exposed to dietary SBM at various stages of development. As for other fish species, SBM in diets for gilthead sea bream and common carp have also been shown to

xii

Jason E. Maxwell

cause an inflammatory response in the intestine. But salmonids appear to be the most sensitive species. There are indications that solvent-extracted SBM in diets can have negative consequences on the salmon‘s and also channel catfish‘s susceptibility to infectious diseases. The contribution of the intestinal microbiota and any changes in its species composition caused by SBM has not been clearly established. The long-term consequences to the health of the fish, as well as their response to orally or intestinally administered vaccines, medicines and other compounds of biological significance, may be compromised and merit further investigation. Although the causative agent(s) of the pathophysiological responses in salmonids has not been conclusively identified, some recent findings suggest that soy saponins may be involved, most likely in combination with other, as yet unidentified components. The alcohol extraction of soybean meal, a processing step used in the production of soy protein concentrate, appears to remove the causatory agents in most cases. This highly refined soybean product has generally been found to be a safe, high quality alternative protein source in salmonid feeds. But it is costly. Fermentation also appears to improve the acceptability of SBM for the fish. Further research on cost-efficient processing methods of SBM to remove antinutritional factors or development of soy strains with low levels of antinutritional factors can aid in reducing the negative impact on the health and welfare of cultured fish fed soybean products. Such efforts can potentially increase the use of soybean products in aquafeeds and thus contribute to developing a more sustainable aquaculture industry. Chapter 5 – Nowadays the massive industrialization of society has to deal with the efficient utilization and recycling of natural resources to achieve modern industrial manufacturing processes. Many industrial wastewater streams, mainly from producing polymers, resins, coatings, paints, dyes, agrochemicals, pharmaceuticals and oil refining are being discharged into the environment. Because of their toxicity level, higher than permitted, extensive research in economic and efficient technological treatments has been done recently without reaching a definitive solution. Among the numerous applications of soybean, its use as a source of soybean peroxidase is of particular interest in the area of bioremediation. Peroxidases are oxidoreductase enzymes with a wide variety of substrate specificity, that catalyze, in the presence of hydrogen peroxide, the oxidative polymerization of different pollutants widely found in industrial effluents, such as phenolic compounds, polycyclic aromatic hydrocarbons (PAHs), aromatic amines, non-phenolic aromatics and dyes. In general, these pollutants are highly toxic for both human beings and the environment, and they must be removed from wastewater before they are discharged into the environment. The use of enzymes is presented as an alternative method for the industrial wastewater treatment when conventional physical, chemical and biological methods such as adsorption in active carbon, chemical oxidation and microorganism treatment may be ineffective. Enzymes present several advantages: mainly they are easy to handle and store, operate within a wide range of conditions, present high specificity towards the targeted compounds and minimum environmental impact. In particular, in the presence of peroxidases, the previously mentioned pollutants are oxidised forming free radicals that subsequently polymerize until the formation of high molecular weight products, with the final products being insoluble polymers that can be easily precipitated from the wastewater without causing environmental problems. Soybean has the additional advantage of being a cheap and abundant source of peroxidase, easily extracted from soybean seed hulls that are a by-product

Preface

xiii

in the food industry, and capable of maintaining its enzymatic activity over a wide range of temperature and pH, which explains its increasing use over the last years in the biotreatment of effluents. In order to decrease the systems‘ costs, one important area for future research will be the study of the direct use of soybean seed hulls without any extraction of the enzyme. Chapter 6 – Soybean peroxidase (SBP) is an oxidoreductase-class enzyme extracted from soybean seed coats (hulls). SBP has been extensively studied in recent years for its role in various biotechnological applications. It has many attractive properties due to its structure, conformational flexibility, activity and stability under various environmental conditions. This review will focus on the application of SBP in industrial waste- and process-water treatment. SBP catalyzes oxidative polymerization of a wide range of hazardous aqueous aromatic pollutants which are present in wastewater streams of various industries such as petroleum refining, coal conversion, wood products and preservation, metal casting, pulp and paper, dyes, adhesives, resins, plastics and textile manufacturing. These pollutants can have adverse health effects on human, animal and aquatic life upon exposure by direct absorption through the skin, ingestion and/or inhalation. Hence, their discharge is regulated. The review will cover pollutants investigated with SBP, advantages of SBP over other enzymes, pretreatment methods to broaden the scope of SBP polymerization, use of additives/surfactants to enhance SBP activity, application of SBP in real industrial wastewater, immobilized SBP and its limitations. Chapter 7 – Cancer is one of the chronic diseases that has the highest incidence in the world. Extensive epidemiological, in vitro, and animal data suggest that soybean consumption reduces the risk of developing several types of cancer. To date, a number of nutrients and micronutrients with anticancer properties have been identified in soybean, including isoflavones, saponins, inositol hexaphosphate, and biologically active proteins and peptides such as protease inhibitors, lectins, low molecular weight peptides and the most recently discovered peptide lunasin. The anticancer properties of soybean may also be due to its amino acid balance since it has low methionine and high arginine content; both conditions are known to inhibit tumor development. The ability to block DNA damage caused by reactive oxygen species and/or carcinogens is the most direct strategy for preventing the initiation of cancer and for slowing down disease progression; studies have demonstrated the antioxidant capacity of soybeans due to their content of compounds such as isoflavones and other phenolic compounds, phytates, tocopherols, carotenoids, and peptides derived from its hydrolysis. Furthermore, soy may protect against cancer through other different mechanisms including increased cell differentiation, decreased activation of procarcinogens to carcinogens, and regulation of genes involved in signal transduction pathways critical in tumor initiation, promotion and /or progression. Germination is a simple, low-cost process that can improve the nutraceutical properties of plants by modifying metabolite content and generating peptides and amino acids with possible biological activity. A previous study from the authors laboratory showed that germination could improve the antiproliferative effect of soybean protein on HeLa and C-33 cervical cancer cells. In this chapter the authors will review the different components of soy with anticarcinogenic properties and how they are affected by germination. In addition, the authors will explore the possibility of using germination as a means to improve these properties. Chapter 8 – The crop area planted to conventional soybeans has decreased annually while that planted to glyphosate-resistant (GR) soybean has drastically increased, mainly due to the

xiv

Jason E. Maxwell

wide adoption of glyphosate in current weed management systems. With the extensive use of glyphosate, many farmers have noted visual plant injury in GR soybean varieties after glyphosate application. In fact, glyphosate has intensified deficiencies of numerous essential micronutrients and some macronutrients. The typical symptom is known as "yellow flashing" or yellowing of the upper leaves and, in some cases, has been attributed to the accumulation of the primary phytotoxic metabolite aminomethylphosphonic acid (AMPA); other reports suggest the symptom results from direct damage to chlorophyll, since glyphosate is a strong metal chelator which forms insoluble glyphosate-metal complexes, may immobilize essential micronutrients required as components, co-factors or regulators of physiological functions. Although glyphosate affected photosynthesis of some GR soybean cultivars, nutrient uptake from soil is also reduced indirectly through its toxicity to many soil microorganisms responsible for increasing plant availability of nutrients through mineralization, reduction, and symbiosis associations. Several reports show that glyphosate can directly affect the nitrogen fixing symbiont Bradyrhizobium japonicum. Since this microorganism possesses a glyphosate-sensitive EPSP synthase, some intermediate metabolites including shikimic, hydroxybenzoic and protocatechuic acids accumulate, which inhibit growth and induces death at high concentrations, due to inability of the organism to synthesize essential aromatic amino acids. The loss of energy and fixed N2 provided by B. japonicum may be significant factors responsible for reduced growth and yield in GR soybean. Glyphosate and other herbicides can influence nitrogen metabolism through direct effects on the rhizobial symbiont or through indirect effects on the physiology of the host plant. Glyphosate and root exudates released into the rhizosphere from GR soybean also influence microbial populations and/or activity in the rhizosphere. Previous findings that glyphosate and high concentrations of soluble carbohydrates and amino acids exuded from roots of glyphosate-treated GR soybean, suggest that promotion of rhizosphere and root colonization of GR soybean by specific microbial groups (i.e. Fusarium sp.) may be a combination of stimulation by glyphosate released through root exudation and altered physiology leading to exudation into the rhizosphere of high levels of carbohydrates and amino acids Limited data are available regarding effects of glyphosate on GR soybean physiology, especially those related to photosynthesis. This chapter aims to show that some GR soybeans can be extremely affected by glyphosate, not only by reduced photosynthesis but also decreased nutrient uptake, and reduced shoot and root biomass production, as well as by modified interactions with specific microorganisms, which may negatively impact soybean growth and production. Herbicides are advertised heavily in popular magazines, whereas relatively few publications inform farmers about weed management through the integrated use of cover crops, crop rotation, cultivation and other ecologically based tactics. Thus, with increased problems related to glyphosate use in GR soybean, an approach to minimize glyphosate effects based on increased efficiency of glyphosate by treating weed populations only where and when their densities warrant application, could greatly reduce glyphosate use with a likely decrease in glyphosate injury to GR soybean. However, management based on growth stage and weed population density will need to be considered if this strategy is undertaken. On the other hand, a strategy to decrease the use of glyphosate may involve the use of preemergent herbicides or the mixture of residual herbicides with glyphosate in burndown

Preface

xv

management, thus increasing the long-term weed control allowing farmers to spray the lowest glyphosate rate as possible. Chapter 9 – Plants are naturally exposed to a variety of environmental and physiological stress situations, such as the oxidative stress associated to growth and development. Soybeans require Fe as a nutrient, in a concentration higher than 10-8 M in solution, to meet their needs. Fe plays critical roles in biological processes, including photosynthesis, respiration and nitrogen assimilation. However, Fe has a dark side because it is toxic to the cell due to its capacity of being an active catalyst for the generation of reactive oxygen radical species that causes lipid peroxidation, DNA strand breaks, oxidation of proteins, and degradation of other biomolecules. Fe homeostasis is maintained by the coordinated regulation of its transport, utilization and storage. Fe traffic has to be strictly controlled, and ferritin is one of the main proteins involved. Moreover, ferritin can prevent Fe toxicity because of its ability to sequester several thousand of Fe atoms in their central cavity in a soluble, non-toxic bio-available form. However, anytime Fe uptake exceeds the metabolic needs of the cell and the storage capacity is overwhelmed, a low molecular weight Fe pool, referred to as the labile iron pool is increased. The Fe in this pool represents the catalytic active Fe, and its size needs to be closely restricted, mostly in chloroplasts and mitochondria since besides being important sites for Fe utilization, they also are specific places for free radical production through the electron transfer chains. The general aspects linked to oxidative metabolism in soybean embryonic axes both, under physiological and stress conditions, will be analyzed mostly in the early stages of growth. Fe function, its cellular distribution, and its participation in free radical reactions leading to cellular damage will be described and also analyzed under Fe overload condition. An integrative overview of these topics will provide information that could be the key to elaborate strategies to improve soybean development, and also human nutrition through biofortification strategies. Chapter 10 – Soybean (Glycine max (L.) Merrill) is one of the most important sources of edible oil and protein, resulting in special interest in the genetic improvement of this crop. The velvetbean caterpillar (Anticarsia gemmatalis Hübner) is a major soybean pest. It causes extremely high levels of defoliation when infestation is heavy and can severely damage axillary meristems, with a single caterpillar being able to consume up to 110 cm2 of soybean foliage. Various authors have reported that A. gemmatalis can be controlled by the deltaendotoxin (δ-endotoxin) produced by some strains of Bacillus thuringiensis. Several DNA delivery methods and plant tissues have been used in developing transgenic soybean plants. Such techniques include particle bombardment of shoot meristems, embryogenic suspension cultures, and Agrobacterium tumefaciens-mediated T-DNA delivery into cotyledonary nodes derived from five- to seven-day old seedlings, mature seeds, immature zygotic cotyledons, somatic embryos derived from immature cotyledons or embryogenic suspension cultures. Earlier studies have indicated that soybean regeneration is genotype-specific with differences in their responses to in vitro culture and transformation. There is no efficient transformation system for a wide range of soybean cultivars, which explains why very few reports on genetic transformation of commercial soybean cultivars are available. There are two major routes to improve embryogenic culture-based soybean regeneration and transformation protocols with the goal of increasing the recovery of transgenic fertile lines. One option is to screen large numbers of new soybean cultivars and genotypes for embryogenic potential, while another option is to use existing protocols and cultivars coupled with traditional breeding programs

xvi

Jason E. Maxwell

for introgressing transgenic traits into other genotypes. The Brazilian soybean cultivar IAS5 has commonly been used in genetic improvement programs and is recommended by the Brazilian Agricultural Ministry for commercial growing in the Brazilian states of Goiás, Minas Gerais, Paraná, São Paulo, and Rio Grande do Sul. This cultivar has shown good reliable response in embryogenic systems. In this Chapter will be described the development of transgenic soybean with resistance to A. gemmatalis larvae. Somatic embryos of the IAS5 cultivar growing on semi-solid medium were transformed with a synthetic Bacillus thuringiensis δ-endotoxin crystal protein cry1Ac gene by particle bombardment. The cry1Ac transgene insertion pattern in the transgenic plants was analyzed in the primary transformants. Transmission and expression of the transgene were also characterized in the T1, T2, and T3 generations. No significant yield reduction was observed in transgenic plants. The cytogenetical analysis showed that transgenic plants present normal karyotype (2n=40). The transgenic plants were also evaluated by in vitro and in vivo assays for resistance to A. gemmatalis. Two negative controls (non-transgenic IAS 5 and homozygous gusA isoline) were used. In a detached-leaf bioassay, cry1Ac plants exhibited complete efficacy against A. gemmatalis, whereas negative controls suffered significant damage. Whole plant-feeding assay data confirmed very high protection of cry1Ac plants against velvetbean caterpillar while non-transgenic IAS 5 and homozygous gusA isoline exhibited 56.5 and 71.5% defoliation, respectively. The bioassays indicated that the transgenic plants were highly toxic to A. gemmatalis, offering a potential for effective insect resistance in soybean. Chapter 11 – Soybean oil is the most consumed vegetable oil in the world, representing 30% of the consumption in the worldwide market. During the production of soybean oil, soybean deodorizer distillate (SODD) is produced as byproduct of a deodorization step. It represent about 3% of refined oil or 0.6% of soybean seed as feed in the refining process. Recent interest in the exploitation of SODD is due to its content of economically-valuable bioactive compounds. It has been suggested as an alternative to marine animals as natural source of squalene and as a good raw material for the production of fatty acid steryl esters (FASEs), free phytosterols, and tocopherols. The aim of this chapter is to discuss the isolation and separation techniques, and analysis methods of these bioactive compounds. SODD typically contains high level of free fatty acids (FFAs) and acylglycerols depending on the conditions of the oil refining process, and the efficient elimination of them is crucial for the enrichment of the bioactive compounds. There are several different methodologies for the elimination of FFAs and acylglycerols: hydrolysis, esterification, transesterification, distillation, crystallization, adsorption, and liquid-liquid extraction. The development of new isolation techniques has gained increasing importance in chemical, food, and pharmaceutical industries, due to the imposed environmental regulations and the necessity of minimizing energy requirement. The analysis methods of the bioactive compounds is also a challenging problem. Few analytical techniques are available to provide a detailed analysis. It will be of great importance if a method to identify individual compounds in SODD can be established. Chapter 12 – The authors previously showed that the soybean curd residue has efficient nutrients for higher production of a lipopeptide antibiotic, iturin A in solid-state fermentation (SSF) of Bacillus subtilis, and this cultured solid can be applied to soil to control plant diseases. The high production of iturin A in SSF may be due to biofilm formation of B. subtilis on the surface of the soybean curd residue. In order to prove this speculation, B. subtilis was grown both in an artificial air membrane surface (AMS) reactor where a biofilm was formed on the membrane and by liquid submerged cultivation (SmF) in suspended

Preface

xvii

culture by using the same nutrients. The iturin A production in AMS reactor was significantly higher than that in SmF and the iturin A productivity of each cell in AMS reactor was more enhanced than that in SmF. The cells from both cultures were analyzed by 2-dimensional electrophoreses and proteome analysis. As the cells were under local nutrient depletion in biofilm, some proteins associated with nutritional depletion and biofilm formation such as alkyl hydroperoxide reductases (AhpC and AhpF), 2-oxoglutarate dehydrogenase, and translocation-dependent spore component (TasA) proteins were specifically or strongly expressed in the cells in the ASM reactor. Moreover, the genes responsible for iturin A production (ituB and degQ) were highly transcribed by the cells in the AMS reactor. These results suggest that typical characteristics of biofilm formed on the soybean curd residue triggered the high iturin A production in biofilm by B. subtilis via elevated expression of specific genes. Chapter 13 – Proteins play an important role in many biological processes. The authors compare commonly deployed methods used for extraction of soybean proteins. In addition, the authors also discuss separation and identification of different classes of soy proteins (storage, allergens, and anti-nutritional) using current proteomic technologies. Soybean proteins are used in human food in a variety of forms such as baby formula and protein isolate concentrate because of unique physiochemical properties. Soybean storage proteins are grouped into two types, beta-conglycinin and glycinin based on their sedimentation coefficients. Three allergen proteins, Gly m Bd 60K, Gly m Bd 30K, and Gly m Bd 28K represent the major seed allergens. In addition to the above two protein classes, several proteins in soybean seeds are considered to be anti-nutritional (Kunitz trypsin inhibitor and lectins). Protein extraction was carried out by different methods and separation of proteins was achieved by two-dimensional polyacrylamide gel electrophoresis (2D-PAGE). Individual proteins were characterized by matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) coupled with liquid chromatography mass spectrometry (LC-MS/MS) analysis of tryptic fragments. The application of these proteomic tools can be extended to the analysis of proteins separated using different matrices. Chapter 14 – This review provides a scientific assessment of current knowledge of health effects of soybean oil (SO). SO is one of the few non-fish sources of omega-3 fatty acids and the primary commercial source of vitamin E in the U.S. diet. SO contains high levels of polyunsaturated fatty acids (PUFAs, 61 %), including the two essential fatty acids, linoleic and linolenic, that are not produced in the body. Linoleic and linolenic acids helps the body's absorption of vital nutrients and are required for human health. The PUFAs positively affect overall cardiovascular health, including reducing blood pressure and preventing heart disease. Epidemiological evidence has suggested an inverse relationship between the consumption of diets high in vegetable fat and cardiovascular risk factors such a blood pressure, although clinical findings have been inconclusive. In an experimental animal model of diabetes SO has been described to ameliorate lipid profile and improved glycemic control. Soybean oil contains natural antioxidants which remain in the oil even after extraction. Soybean oil also contains lecithin which lowers blood levels of cholesterol. As a result, the replacement of saturated fats with reasonable amounts of polyunsaturated fats, such as those found in soybean oil, may be useful in the dietary guidelines but the health claims remain controversial.

xviii

Jason E. Maxwell

Chapter 15 – The use of microbial and cell culture nutrient media based on hydrolyzed soybean meals has been increasing continuously, mainly for the production of human and animal pharmaceutical products, due to the risks related to the transmission of the prion diseases. Two kinds of bacteria have been studied: Haemophilus influenzae b (Hib), a bacterium that causes meningitides in children less than two years old, and Erysipelothrix rhusiopathiae (Erhu), the causative agent of swine erysipelas, a disease responsible for great worldwide losses in swine culture. The focuses of these projects are to develop vaccines based on polysaccharide against Hib and inactivated cells suspensions containing the protein SpaA, the main antigenic agent against Erhu infections, respectively. Several kinds of peptones, from animal and vegetal origin, were tested and the results concerning cells, polysaccharide or protein production were compared. For H. influenzae b cultivations, the following nutrients were used: i) from vegetal origin: Bacto Soytone (BD), HiSoy (Kerry), Soy peptone (Sigma); ii) from animal origin: Bacto casamino acids (BD) and casein acid hydrolysate (Sigma). Usually, E. rhusiopathiae is cultivated in complex media from animal origin. Two types of soybean peptones were tested: Bacto Soytone (BD) and soy peptone (Acumedia) as well as corn steep liquor (Milhocina from Corn Products, Brazil). The results for H. influenzae b showed that the peptone from vegetal origin promoted a 2~2.5 times better growth than that from animal origin. The best one was Bacto Soytone from BD, leading to OD540nm= 6.0 in shake flask and 16 in biorreactor. The production of polysaccharide was 296 mg/L in shake flask and 600 mg/L in bioreactor. Concerning E. rhusiopathiae, when cultivated in shaker flasks, an increase of 50% in biomass yield on glucose consumed and of 10% in the maximum specific growth rates (max) were observed with vegetal peptones. For E. rhusiopathiae bioreactor cultivation with animal peptone, a maximum OD420nm of 7.8 and max of 0.5 h-1 were achieved. However, these values were significantly higher, reaching 35 for OD420nm and 1 h-1 for max, with soybean peptone. The expression of SpaA was favored with soybeans peptone as nitrogen source as well. Production of vaccines usually involves cultivation of fastidious microorganisms in complex animal media. The results confirm that the soybean peptones can successfully replace the peptones from animal origin with improvements in biomass formation, growth rate, antigenic protein expression and yield of polysaccharide. Chapter 16 – Okara, a major by-product of the soymilk industry, is rich in proteins. The authors previous studies have shown that okara under physiological conditions may release potential bioactive peptides. Specifically, okara protein isolate has been digested sequentially with pepsin (60 min) and pancreatin (195 min) and the okara protein hydrolysates (OPHs) obtained at the end (255 min) of the in vitro digestion have been fractionated by ultrafiltration, characterized in terms of amino acids and Molecular Weight (MW) distribution, and tested for angiotensin-converting enzyme inhibition (ACE-I) and multifunctional antioxidant activities. As a result, a bioactive peptide from soybean lipoxygenase-1 with a calculated mass of 751.48 Da has been identified in the < 1 kDa ultrafiltrated (UF) fraction. On this frame, the ACE-I activity of the OPHs released during the first phase (pepsin) of the sequential in vitro digestion is the subject of this chapter. Further work focusing on the 60-

Preface

xix

min OPH released at the end of pepsin digestion is also described. Results indicated that pepsin digestion released OPHs showing relatively high inhibitory activity against ACE. The highest inhibition was exerted by the 5 min-OPH, showing an IC50 value of 1.523 ± 0.005 μg protein/μL. After ultra-filtration partitioning of the 60-min OPH, the effect of amino acid content and MW of UF fractions on ACE-I activity was discussed. The UF fraction containing the lower MW peptides showed the higher hydrophobic amino acid content and ACE-I activity. Concluding, the consumption of okara protein might exert health benefits on the basis of the bioavailability of the peptides released by pepsin. Further research on animal model is necessary to verify the tested potential ACE-I activity of these peptides released by in vitro pepsin digestion. Chapter 17 – S. pneumoniae is a pathogen that affects the human respiratory tract, causing otitis media, sinusitis, pneumonia, meningitis and sepsis. Pneumococcus is a fastidious anaerobic fermentative microorganism that produces mainly lactate. S. pneumoniae isolation and cultivation is commonly done using animal-sourced media, such as Brain and Heart Infusion, Todd-Hewitt, hydrolyzed casein derivates, etc., frequently supplemented with whole blood or serum. Although these media are appropriate for clinical diagnosis, they are unsuitable for vaccine production process, since they may cause prion related diseases. Hence, regulatory authorities such as FDA and WHO recommend replace all animal source medium whenever possible. In order to replace Todd-Hewitt (THY) and acid hydrolyzed casein (AHC) media, enzymatically hydrolyzed soybean meal (EHS) had been tested for pneumococcal vaccine production. The microorganism was cultivated in static flasks using three different media THY, AHC and EHS and in 10L-bioreactors using AHC or EHS media. In flasks, the biomass was 1.7 times higher in AHC and 2.3 times higher in EHS than in THY. In pH-controlled bioreactors, the biomass production using EHS was 2.5 times higher than that using AHC medium. Further improvement was obtained performing fed-batch culture using concentrated EHS in the feeding medium. The fed-batch strategy increased the biomass production twice when compared to the simple batch cultivation. This soy based medium was shown to be satisfactory for this fastidious bacterium and met the requirements for human vaccine production. Chapter 18 – The ―edamame‖ is a kind of soy food popular in Japan, and it is classified as a vegetable and not a grain crop as in the case of mature soybean seeds. Traditionally, the edamames were sold as a bunch of stems with pods in Japan. ―Eda‖ means stems, and ―Mame‖ means beans. The immature pods are boiled in salt water, and served after cooling. Edamames are usually taken as a snack or a relish with beer in Japan. It contains various nutrients, such as proteins, lipids, carbohydrates and minerals at similar levels to mature soybean seeds based on dry weight. In addition, edamames contain higher concentrations of vitamin A, C, K and folic acid than mature soybean seeds. There are many local varieties of Edamame soybean in Japan, and the cultivars for grain soybean are usually not delicious to eat as edamames. The flavor is excellent in edamame varieties but not in grain soybeans. Edamame varieties have a sweet taste and distinctive good flavor and aroma. The higher concentrations of sugars (e.g., sucrose) and free amino acids (e.g., alanine) are related to the good taste. The variety, cultivation methods and the stages of plants at harvest are very important factors for good quality. The bunch of stems with pods, or separated fresh pods in a plastic bag are marketed from early summer to late autumn in Japan. The market prices of the

xx

Jason E. Maxwell

edamames mostly depend on the freshness, taste, brand name and seasons. The edamame plants are cultivated in the greenhouse, or in a tunnel of double plastic sheets to keep them warm and harvest in the late spring and early summer (May to June) with a high price. Then soybean plants are cultivated in open fields and harvested from July to November. The freshness is very important for the taste of edamames; therefore, many farmers harvest the edamame plants at midnight or early morning and market them on the same day. The wrapping technology and the transportation system were improved and the market distribution of the fresh edamames has expanded in recent years. In addition to fresh edamames, the import of frozen cooked edamames from foreign countries is increasing, and people can eat edamames all year around. Chapter 19 – Soybean, Glycine max (L.) Merr., is one of the major world crops, occupying large acreages of land. Soybeans are grown in most countries and have become essential due to a multitude of food products they provide, which include oil and high-protein defatted meal. In recent years, soybeans have also been under intensive study because of their multiple health-enhancing properties. Although soybean breeding programs have developed varieties with improved yields, quality and disease resistance, every year substantial losses in soybean production still occur due to pathogen attack. Therefore, the understanding of defensive responses of soybean to pathogens is important not only to increase crop yield, but also to predict the consequences of climate changes on agricultural ecosystems. Much research on soybean defensive responses has been done using modifications of the classical cut-cotyledon assay. As soybean cotyledons have simple architecture and cellular uniformity, and show very sharp and localized responses to incompatible isolates of pathogens or to endogenous/exogenous signaling molecules, they represent a nearly ideal model to study these responses under variable environmental conditions. The authors group has been successfully using this assay to screen highly defensive soybean cultivars, to characterize phytoalexin-inducing molecules (elicitors) derived from microbes and plants, to evaluate the role of nitric oxide in defensive isoflavonoid metabolism, and to analyze the effects of elevated CO2 atmospheres on soybean responses to elicitors. Chapter 20 – Soybean peroxidase (SBP) belongs to class III of the plant peroxidase superfamily that also includes barley peroxidase, peanut peroxidase, and widely studied horseradish peroxidase (HRP). There is increasing interest in SBP as an alternative to HRP for analytical applications because of its conformational stability and good stability at high temperature and in acidic media. In this review, the applications of SBP in analytical science are demonstrated, such as the applications in chemiluminescence immunoassays, colorimetric immunoassays, rapid chemiluminescent detection, identification, and enumeration of microorganisms using SBP-labelled peptide nucleic acid probe, DNA probe assays, direct electrochemistry of SBP, as well as electrochemical biosensors for the determination of hydrogen peroxide, organic peroxide, phenol, glucose, and lactate. Chapter 21 – Soybeans and soy products provide an excellent source of multiple macro and micronutrients. The objective of this communication was to provide a brief overview of soybean storage proteins composition and its uses in different food preparation. In addition, the authors briefly summarize the authors knowledge of isoflavones compounds in soybean and their health benefits as it relates to cancer and bone health as described in recent peerreviewed publications. Chapter 22 – Soybean meal (SBM) and soybean hull (SBH) are generated after recovery of soybean oil from soybean processing. The protein content of SBM can be as high as 53.5

Preface

xxi

to 56.2% moisture-free basis (mfb). Soybean meal also has a favorable amino acid composition compared with other plant proteins. Because of its high protein content, SBM is primarily used as a commercial animal feed product. Soybean hull contains about 85.7% carbohydrates, 9% protein, 4.3% ash, and 1% lipids and is used as a fiber supplement in animal feed. Despite the recognized value of SBM and SBH, these components have some inherent disadvantages. The dietary energy value of uncooked SBM is relatively low because of antinutrional factors such as proteinase inhibitors and phytate. Oligosaccharides in the carbohydrate fraction, particularly raffinose and stachyose, could lead to flatulence and abdominal discomfort. Further, the widespread availability of distiller grains due to increaseed ethanol production from corn and other cereal grains has saturated the high-protein animal feed market. Microbial bioprocessing of SBM and SBH, along with protein enhancement and removal of antinutritional factors, will result in an enhanced sulfur amino acid profile and additional nutrients, such as vitamin B12. This chapter focuses on SBM and SBH conversion to premium animal feed products and reviews the latest developments in nutritional enhancement via enzymatic and microbial bioconversion.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 1

SOYBEAN SEED COMPOSITION AND QUALITY: INTERACTIONS OF ENVIRONMENT, GENOTYPE, AND MANAGEMENT PRACTICES Nacer Bellaloui1, Krishna N. Reddy2, H. Arnold Bruns2, Anne M. Gillen1, Alemu Mengistu3, Luiz H. S. Zobiole4, Daniel K. Fisher2, Hamed K. Abbas1, Robert M. Zablotowicz2 and Robert J. Kremer5 1

Crop Genetics Research Unit, USDA-ARS, Stoneville, MS, USA Crop Production Systems Research Unit, USDA-ARS, Stoneville, MS, USA 3 Crop Genetics Research Unit, USDA-ARS, Jackson, TN, USA 4 Center for Advanced Studies in Weed Science (NAPD), State University of Maringá (UEM), Paraná, Brazil 5 Cropping Systems and Water Quality Research Unit, USDA-ARS, Columbia, MO, USA

2

ABSTRACT Soybean [Glycine max (L) Merr.] seed is a major source of protein, oil, carbohydrates, isoflavones, and minerals for human and animal nutrition. About one-third of the world's edible oils and two-thirds of protein meal are derived from soybean seed. Thus, improving soybean seed composition and quality is key to improving human and animal nutrition. Seed composition refers to major constituents found within the seed including protein, oil, fatty acids, carbohydrates, isoflavones, and mineral content which determine seed nutritional value. Soybean seed quality refers to viability, germination, and seedling vigor which directly impact yield. Seed composition and quality are known to be genetically controlled, and significant variability in seed quality and composition exist due to differences in the gene pool. The physiological and biochemical mechanisms by which this variability is expressed are still not completely understood, but are known to be significantly influenced by genotype (G), environment (E), management practices (MP), and their interactions. Understanding the interaction of these factors and how they impact seed composition and quality is crucial for maintaining high yield and quality.

2

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al. This review highlights the current research on seed composition and quality as influenced by G, E, MP, plant diseases, and their interactions from physiological, biochemical, and genetic perspective. This review also highlights major challenges in soybean seed composition and quality improvement, and examines how current research techniques have been used for improving seed nutritional value for conventional uses such as food and feed or for specialty uses such as tofu, soymilk, and other soy products. This information is beneficial as a source in soybean breeding, physiology, and biochemistry research.

1. INTRODUCTION Soybean is one of the major world crops. In 2008, the world consumption of soybean was over 221 million metric tons of which approximately 50% came from the U.S. In the U.S, soybeans were planted on approximately 77 million ha in 2008 (Clemente and Cahoon, 2009). Soybean seed is a major source of protein, oil, carbohydrates, isoflavones, and minerals for humans and animals (Hou et al., 2009). Protein in soybean seed ranges from 34 to 57% of total seed weight, with a mean of 42%. The oil content ranges from 8.3 to 28%, with a mean of 19.5% (Wilson, 2004). The concentration of saturated fatty acids in soybean oil ranges from 10 to 12% palmitic acid (C16:0), and 2.2 to 7.2% stearic acid (C18:0) (Cherry et al., 1985). The mean concentration of unsaturated fatty acids in oil is 24% oleic acid (C18:1), 54% linoleic acid (C18:2), and 8.0% linolenic acid (C18:3) (Schnebly and Fehr, 1993). Higher oleic acid and lower linolenic acid are desirable traits for oil stability and longterm shelf storage. Another component of soybean seed composition is carbohydrates. Most of the carbohydrates are insoluble polysaccharides, including pectin, cellulose, hemicellulose, and starch (Liu, 1997). Soluble carbohydrates include monosaccharides (glucose and fructose), disaccharides (sucrose), and oligosaccharides (raffinose and stachyose) (Liu, 1997). Soybean seed contains 9 to 12% total soluble carbohydrates, which include 4 to 5% sucrose (C12H22O11), 1 to 2 % raffinose (C18H32O16), and 3.5 to 4.5% stachyose (C24H42O21) (Wilson, 1995). Many international and domestic soybean processors prefer soybean with at least 34% protein and 19% oil (Hurburgh et al., 1990). Although seed composition traits are genetically controlled, environmental conditions during seed development, especially seed-fill (R5-R6) stage, can lead to protein and/or oil deficits for processing and substandard seed protein concentrations (Rotundo and Westgate, 2009). Soybean seed quality is another essential component because it determines the germination rate, vigor, and ability of soybean seedlings to emerge and establish, and to avoid disease and other biotic and abiotic stresses. The soybean seed industry uses a standard germination test to determine seed quality. However, such a germination test may not provide information about seed vigor, beyond the ability of seed to germinate (Cartwright et al., 2009; Miller, 2009). Vigor assays were described in detail by Cartwright et al. (2009). Briefly, accelerated aging is achieved by stressing the seed before conducting the standard germination test. Initially the seeds are put into an incubation chamber at 41 ºC for 72 hours. Then, seeds are wrapped in special paper and placed under optimum conditions for two weeks. Seeds subjected to accelerated aging are also planted in the field to test their performance under field conditions (Cartwright et al., 2009). In Mississippi, U.S.A., the minimum germination for certified seed is 80%, and seedlots with less than 60% germination are declared illegal for sale (Keith and Delouche, 1999).

Soybean Seed Composition and Quality

3

Smith et al. (2008) reported that ideal soybean genotypes for seed quality would have standard and accelerated aging germination percentages of ≥ 90%, and would have low incidences of Phomopsis longicolla, low incidences of wrinkled or shriveled seed, and hardseededness. In spite of the yield benefits under irrigated and non-irrigated conditions (Heatherly, 1999), the Early Soybean Production System (ESPS) is challenged by lower seed quality and substandard germination in the midsouthern United States (Mayhew and Caviness, 1994; Mengistu and Heatherly, 2006; Keith and Delouche, 1999; Smith et al., 2008). Therefore, further research is needed to select high seed quality traits that are adapted to ESPS. In the current review, we will summarize the research on soybean seed composition and quality, and highlight challenges and possible solutions to improve seed composition and quality.

2. EFFECT OF ENVIRONMENT AND GENOTYPE ON SEED COMPOSITION The inverse relationship between protein and oil, and protein and yield remains a major challenge to soybean breeders to select for higher yield and higher protein (Burton, 1985; Rotundo et al., 2009). Attempts to breed genotypes for increased protein without reducing grain yield were previously reported by Wilcox and Cavins (1995). They showed in successive backcross populations that oil concentration increased from 14.8% in BC1 to 17.4% in BC3, suggesting a pattern of oil concentration recovery (20.4 %) of Cutler 71 cultivar. They demonstrated that high seed protein can be backcrossed into a soybean cultivar to fully recover the yield, suggesting the absence of physiological barriers to combine high seed protein with high seed yield. Another challenge for the soybean seed industry is to develop a model to predict the effects of environmental variability across regions and locations to obtain consistent high seed quality (Rotundo and Westgate, 2009). Generally, variability of soybean seed oil between different geographic regions in the U.S.A. (Brenne et al., 1988), Europe and China (Vollmann et al., 2000) was not significant. However, protein was found to be higher in the southern soybean production region than the northern region of the U.S.A. (Brenee et al., 1988; Yaklich et al., 2002). The effect of environment on seed composition has been extensively studied (Maestri et al., 1998; Piper and Boote, 1999; Zhang et al., 2005; Dardanelli et al., 2006). The effect of maturity group (MG) and its interaction with the environment (E) on protein and oil was investigated in 3-yr multilocation soybean trials across Argentina (Dardanelli et al., 2006). Several MGs from II to IX were evaluated in 14 to 24 environments in each year, and the environment was found to be the major contributor to variation for protein and oil content except for 1 yr, and the main effect of MG was greater than the effect of MG × E interaction for oil content, and oil + protein content. They found that all environments produced high oil for MGs II, III, and IV, while the MG × E interaction was seen in two MG × E combinations that maximized protein (i.e., in some environments MG VI had the highest protein and in others, MG II and III yielded more protein). Dardanelli et al. (2006) suggested that high temperature during seed fill could explain the consistent pattern of higher oil content across seasons and environments in early MGs. These results are consistent with those found by Piper and Boote (1999), who studied the effect of mean daily temperature

4

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

and cultivar on oil and protein concentration on 20 cultivars representing 10 MGs across 60 locations under temperatures from 14.6 to 28.7°C. They found a quadratic relationship between proteins and mean daily temperature during seed-fill, with higher concentrations of protein at temperatures below 20°C. In other studies, Maestri et al. (1998) found a negative correlation between oil content and mean temperature during seed maturation, but no effect was found on protein or fatty acids.

2.1 Quantification of Partial Contribution of Environmental Factors and Genotypic Backgrounds to Total Seed Protein and Oil The source of variability of seed composition in the previous studies could be attributed to MG, genotype within MG, and their interactions. In those studies the genotype and MG were confounded because the genotypes of the same MG did not have a common genotypic background. Recently, Bellaloui et al. (2009d), worked on two sets of isolines (Clark and Harosoy isolines), where each set has the same genotypic background, but differ in maturity genes. They found that year, maturity, and year × maturity were significant (p<0.0001) for seed protein and oil in the Clark isoline set, but in the Harosoy isoline set there was no year or year × maturity effect for protein and no year × maturity effect for oil. These results indicate that protein and oil in the two genotypic backgrounds (either Clark or Harosoy isoline set) responded differently to the environmental factors in each growing season. There also was a positive linear correlation between protein and maturity in Clark isolines, but no correlation between protein and maturity in Harosoy isoline set (Table 1). Both isoline sets had a linear negative correlation between oil and maturity. When maximum average daily air temperature 20 days before maturity was included in the regression, maturity was found to contribute more to the variability of protein and oil than temperature, and the contribution of temperature depended on the range of temperature of the growing season. When Clark and Harosoy isoline sets were analyzed in the overlap region (common set where pairs have common combinations of maturity genes), the contribution effects of each component was different. It was found that E-gene (maturity genes), E-gene × background (either Clark or Harosoy), and E-gene × year were the major source of variability for protein and oil. The common effect, using commonality analysis (Bellaloui et al., 2009d; Bellaloui et al., 2010), showed that genotypic background, maturity, and temperature also had significant contribution to protein and oil variability, and the proportion contribution of each component (genotypic background, maturity, temperature, and their interactions) was different (Table 2). The physiological and biochemical mechanisms of how these variables interact with each other and their effects on seed composition are still not understood (Bellaloui et al., 2009d; Bellaloui et al., 2010). Using near-isogenic lines could be an effective way to separate these variable components and obtain new knowledge of the interaction effects between environmental factors and genotypes for seed composition traits.

Soybean Seed Composition and Quality

5

Table 1. Regression analysis (probability, p, and level of significance) of seed composition constituents (%) on maturity, maximum temperature (MaxT), and photoperiod in all Clark and Harosoy near-isogenic lines in 2004 and 2005. The experiment was conducted at Stoneville Delta States Research Center, MS, U.S.A. Table was extracted from Bellaloui et al. (2009d). Isoline Set Clark Maturity MaxT Photoperiod Harosoy Maturity MaxT Photoperiod

p ***(-) ***(-) ***(+) **(-) *** ***

Palmitic C16:0 p ns ns **(+) ns ns ns

Stearic C18:0 p **(-) **(-) ***(+) ns ** **

Oleic C18:1 p ns ns *(-) ns ns ns

Linoleic C18:2 p **(+) ns 0.13 ns ** ns

Linolenic C18:3 p ns ns ns ns ns ns

*(+) **(-) ns **(-) * **

ns ns ns ns ns ns

ns ns ns ns ns ns

ns ns ns ns ns ns

ns ns ns ns ns ns

ns ns *(+) ns ns ns

Year

Protein

Oil

2004 2005 2004 2005 2004 2005

p ***†(+) ***(+) ***(-) **(+) *** ***

2004 2005 2004 2005 2004 2005

ns ns **(-) ns ns ns

* indicates significance at p ≤ 0.05, ** indicates significance at p ≤ 0.01, and *** indicates significance at p ≤ 0.001; (+) indicates positive relationship; (-) indicates negative relation ship; photoperiod has the same relationship as maturity, but inversely correlated; ns indicates not significant.

Table 2. Analysis of commonality to estimate the partial contribution of unique and common effects of genotypic background, maturity, and temperature to total soybean seed protein and oil as percentage (%) contribution of each component. The experiment was conducted in 2004 and 2005 at Stoneville Delta States Research Center, MS, U.S.A. Table was extracted from Bellaloui et al. (2009d)

Source Total (background, maturity, temperature) Unique background Unique maturity Unique maximum temperature Common (background, maturity, temperature)

Protein 2004 (%) 100 1.7 30.4 28.6 39.2

2005 (%) 100 8.9 39.6 19.4 32.4

Oil 2004 (%) 100 1.4 44.0 6.9 47.7

2005 (%) 100 0.0 46.8 4.5 48.7

2.2. Modified Seed Oils and their Stability across Environments Conventional genotypes generally contain 10% palmitic acid, 4% stearic acid, 22% oleic acid, 54% linoleic acid, and about 10% linolenic acid (Wilson, 2004). Low palmitic trait is

6

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

controlled by at least two recessive alleles in soybean (Erickson et al., 1988; Schnebly et al., 1994; Stojsin et al., 1998). Combination of these two alleles resulted in less than 4% palmitic acid, reducing the level of saturated fatty acid in soybean seed. There are also at least two recessive alleles controlling the expression of a low linolenic acid trait in soybean (Fehr et al., 1992). Combination of these alleles results in less than 3% in crude oil. Soybean genotypes with modified fatty acid seed composition have been considered for commercial production (Schnebly and Fehr, 1993; Bachlava and Cardinal, 2009), and soybean with novel fatty acid profiles, such as reduced linolenic acid, are currently available for commercial production. Cultivars with other modified fatty acid traits, such as mid-oleic acid, will likely be introduced for production in the near future. High oleic acid and low linolenic acid are desirable traits for soybean oil because of their contribution to the oxidative stability of soybean oil and nutritional value (Wilson, 2004). However, the stability of these fatty acids across environments and locations is still a challenge. Therefore, identifying the best growing conditions for these novel cultivars in terms of adaptation to different locations, planting dates, and other agronomic practices are important to ensure high fatty acid profile qualities. Bachlava and Cardinal (2009) reported that in spite of the development of high-oleate soybean germplasm, the instability of this germplasm across environment could represent a challenge. This instability is due mainly to temperature changes and its influence on the enzymes controlling biosynthesis of soybean seed fatty acids, especially at seed-fill (R5-R6) stage (Wilcox and Cavins, 1992; Bachlava and Cardinal (2009). Unsaturated fatty acids were found to be mainly influenced by temperature changes during seed development (Howell and Collins, 1957; Slack and Roughan, 1978). Wilcox and Cavins (1992) suggested that palmitic and linolenic acids may decrease with later planting date while stearic acid may increase. This may be due to temperature changes during seed maturation at later planting. They found that increasing temperature during the last 20 d of seed maturation decreased the level of linolenic acid. For example, linolenic acid concentration was inversely correlated with the average maximum and minimum temperatures during the periods of 45 to 31 d and 30 to 11 d before maturity (Howell and Collins, 1957). In an experiment under controlled conditions at a temperature of 33/28 °C day/night, cultivar Fiskeby MG V showed approximately 70% reduction in linolenic acid concentration and a 196% increase in oleic acid concentration compared with those grown at 18/13°C day/night (Wolf et al., 1982). It was suggested that temperature during seed-fill period, that coincides with oil deposition, affected linolenic concentration (Burton et al., 1983; Wilcox et al., 1993). The effect of temperature on oleic and linolenic acid was explained previously in that temperature may affect oleate and linoleate desaturases (Burton, 1991), and decrease oleyl and linoleyl desaturase activities at 35°C (Cheesbrough, 1989), and ω-6 desaturase enzyme, encoded by the FAD2-1A gene, degraded at high growth temperatures of 30 °C (Tang et al., 2005). On the other hand, Schlueter et al. (2007) studied the transcript level of the functional GmFAD2 isoforms, FAD2-1A, FAD2-1B, FAD2-2B and FAD2-2C, and found that only significant increase in expression was observed in FAD2 -2C when ‗Williams 82‘ was grown under controlled conditions of 18/12 °C day/night temperatures during pod development stage. Palmitic acid variability in reduced palmitic germplasm occurred between southern United States and Puerto Rico (Rebetzke et al., 2001), and much of this variability was related to changes in minimum temperatures (Ray et al., 2008). On the other hand, oleic acid levels increased and linoleic and linolenic acid levels decreased when soybeans were grown in warmer environments (Carver et al., (1986)).

Soybean Seed Composition and Quality

7

As consequence of reducing linolenic acid, low linolenic acid lines tended to be less sensitive to environmental variability compared with normal saturated and monounsaturated fatty acid lines (Carver et al., (1986)). Other researchers indicated that planting date and temperatures during the last 20 d of maturation could not definitely explain differences in seed composition differences (Schnebly and Fehr, 1993). For example, Ray et al. (2008), working on developed five low 16:0, two low 16:0 + 18:3, and one low 18:3 modified fatty acid breeding lines, investigated the effect of planting date on fatty acid content in the eight breeding lines and compared these lines to parental cultivars for seed composition. Planting date had a significant effect on protein, oil, and palmitic, and linolenic acid and that palmitic acid decreased at late planting and linolenic acid decreased at early planting. Oliva et al. (2006) studied the effect of temperature during reproductive stage on oil stability in 17 normal and modified oil composition profile in soybean. When they regressed fatty acid level on average temperature over the final 30 d of the reproductive period across 10 environments, they found that mid-oleic acid genotypes were less stable for oleic acid content than those of reduced oleic acid genotypes. They also found that there were significant differences in oleic acid level stability among mid-oleic genotypes, with N98–4445A and N97–3363–4 being the most unstable. For higher oleic acid lines such as M23, oleic acid was relatively stable. On the other hand, IA 3017 line, with 1% linolenic acid, was the most stable in linolenic acid content across environments than the higher linolenic acid genotypes, which were less stable. The authors concluded that since reduced linolenic genotypes are more stable than the normal linolenic acid levels genotypes, growing these genotypes across environments may ensure consistent, desirable fatty acid profiles (Oliva et al., 2006). Recently, Bachlava and Cardinal (2009) investigated the effect of three populations, segregating for high-oleic acid and maturity across environment, on the stability of oleic fatty acid. Bachlava and Cardinal, 2009 concluded that average, maximum, and minimum temperatures were highly correlated during the seed oil deposition in all environments, contrasting previous studies by Howell and Collins (1957) and Hou et al. (2006) in that differential effects of minimum and maximum daily temperatures occurred. They suggested that average, maximum, and minimum daily temperatures may not be independent variables in environments of the southern United States. Although the increase of temperature during seed oil deposition could result in higher oleic acid (Burton et al., 1983; Wilcox et al., 1993), Bachlava and Cardinal (2009) found that oleic acid concentration was positively correlated with the average daily temperature for some segregating populations for oleic acid, but negatively correlated with the early-maturing populations. They also found that oil was positively correlated with average daily temperature during seed-fill period in the three populations, regardless of their maturity. They concluded that since a negative correlation between oil and temperature was previously reported, the effect of photoperiod effect on oil during oil deposition should be taken in account. Recently, Graef et al. (2009) evaluated a high-oleic-acid and low-palmitic-acid soybean by growing transgenic soybean event 335-13 (increased oleic acid > 85% and reduced palmitic acid < 5%) across multiple environments in 2004 and 2005. They found that fatty acids were not influenced by environment, and the yield was not compromised under both irrigated and nonirrigated. They also found that the novel soybean event 335-13 seed characteristics, including total oil and protein, and amino acid profile were not altered. These findings are not in agreement with those reported by Bachlava et al. (2008); Bachlava and Cardinal (2009); Oliva et al. (2006) in that environment × genotype interactions were significant for oleic acid. Also, the findings of Graef et al. (2009) are not in agreement with those reported by Scherder

8

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

and Fehr (2008) in that yield in soybean event 335-13 did not decrease across environment. Graef et al. (2009) reported stable expression of 86%–87% oleic acid content in the oil, with no negative effects on yield, maturity, plant height, lodging, seed weight or oil content. The development of the transgenic soybean events 294-5, 325-61, 333-7 and 335-13 has been previously reported (Buhr et al., 2002), and the parental genotype was either A3237 (Asgrow® Seed Company, Dekalb, IL, U.S.A.) or Thorne (McBlain et al., 1993).

2.3. Effects of Environmental Factors and Genotypes and their Interactions on Seed Carbohydrates Soybean seed soluble carbohydrates include disaccharides (sucrose), and the oligosaccharides (raffinose and stachyose). Raffinose and stachyose are undesirable seed quality traits because they have detrimental effects on the nutritive value of food and feed, causing flatulence or diarrhea in nonruminants (Liu, 1997). Therefore, soybean seed with low raffinose and stachyose is desirable because of increased feed energy efficiency, mineral uptake, and reduce flatulence for nonruminant animals (Obendorf et al., 1998). Soybean seed with high sucrose is desirable because it improves taste and flavor in tofu, soymilk, and nato (Hou et al., 2009). Hymowitz et al. (1972) evaluated 60 plant introductions and found a positive relationship between stachyose and seed protein, suggesting possible difficulties for breeding reduced stachyose concentration with high seed protein. However, Hartwig et al. (1997) suggested that there is a possibility for developing soybean germplasm with high seed protein and lower stachyose + raffinose in the meal. In their experiment, they evaluated sucrose, raffinose, and stachyose in 20 soybean cultivars and breeding lines with high oil and 20 breeding lines with high protein and found nonsignificant negative correlation between protein and stachyose + raffinose, suggesting sugars in soybean seed vary among soybean genotypes and between maturity groups (Hymowitz et al., 1972; Hymowitz and Collins, 1974; Hartwig et al., 1997; Hou et al., 2009). Hymowitz et al. (1972) evaluated protein, oil, and total sugars (sucrose, raffinose, and stachyose) in 60 selected soybean lines from maturity group (MG) 00 through MG IV. They found significant variability (in units of g constituent per 100 g seed) among genotype and between MGs (5.6 to 10.9 total sugars; 2.5 to 8.2 sucrose; 0.1 to 0.9 raffinose; and 1.4 to 4.1 stachyose. They showed a positive correlation between total sugar and sucrose and raffinose, but a negative correlation was found between sucrose and stachyose. Other researchers evaluated 195 soybean cultivars from maturity groups 00 through IV for total sugars, sucrose, fructose, raffinose, and stachyose, and found significant variability in these sugars (Hymowitz and Collins, 1974), and concluded that sufficient variability exists for sugar selection. Carbohydrates in soybean seed has been found to be significantly altered by temperature (Wolf et al., 1982), genotype (Pattee et al., 2000), maturity (Bellaloui et al., 2010), and their interactions (Bellaloui et al., 2010). For example, when soybeans were grown at 18/13 ºC (day/night) and high temperature (33/28 ºC) (day/night), a decrease of sucrose (from 8.1% to 3.6%, a decrease of 56%) and stachyose were observed at higher temperature, but glucose, fructose, and raffinose levels were unaffected at the highest temperature. Recently, Ren et al. (2009) found that the concentrations of sucrose, raffinose, and stachyose did not change in mature seed grown at 37/30 oC compared with the control seed grown in 27/28 oC. However,

Soybean Seed Composition and Quality

9

combined sugars (sucrose+raffinose+stachyose) in seed grown under high temperature (37/30 o C) showed lower concentrations compared to the control seed (27/18 oC). Bellaloui et al. (2010) explained that the lack of change in sucrose, stachyose, and raffinose, found by Ren et al. (2009) under higher temperature (37/30oC), could be due to the sampling strategy since abnormally shaped or colored seed were discarded before analysis that may have reduced source of variability in the seed caused by temperature. Bellaloui et al. (2010) investigated the effect of temperature and maturity trait in two sets of near-isogenic lines of Clark and Harosoy for maturity genes. They found a negative linear relationship between days to maturity and the concentration of sucrose (r2=0.83 in 2004; r2=0.94 in 2005), stachyose (r2=0.51 in 2004; r2=0.51 in 2005), and combined sugars (sucrose+raffinose+stachyose) (r2=0.83 in 2004; r2=0.91 in 2005) in Clark isolines. There was a significant negative relationship between maturity and sugars in one year only for sucrose, stachyose, and combined sugars (Table 3). A significant positive relationship with sugars was found in one year, and the negative relationship in another year (Table 3). The Clark isolines showed a significant positive linear correlation between sucrose and raffinose, and sucrose and stachyose (Figure 1a,b), and stachyose and combined sugars (Figure 1c,d). No correlation was found between stachyose and raffinose (Figure 1c, d). A similar observation was recorded for the Harosoy isolines (Bellaloui et al., 2010). This observation was consistent in a two-year field experiment in both sets of near-isogenic lines. They also quantified the contribution of each component to the total sugars and concluded that the contribution of temperature or maturity to the total variability of sugars depended on type of sugar, and the contribution of maturity to total variability in sugars was greater than of temperature. Maturity × genotypic background × temperature interactions were also a major contributor (Bellaloui et al., 2010). Table 3. Regression analysis (level of significance of r2, coefficient of determination) of seed sucrose, raffinose, stachyose, and combined sugar on maturity (R8), and maximum temperature (MaxT) in all Clark and Harosoy near-isogenic lines in 2004 and 2005. The experiment was conducted at the Stoneville Delta States Research Center, MS, U.S.A. Table was extracted from Bellaloui et al. (2010) Isoline Set Clark Maturity MaxT Harosoy Maturity MaxT

Year

Sucrose

Raffinose

Stachyose

Combined sugars

2004 2005 2004 2005

***†(-) ***(-) *** (+) **(-)

ns ns ns ns

***(-) ***(-) *(+) *(-)

***(-) ***(-) **(+) **(-)

2004 2005 2004 2005

Ns **(-) Ns ***(-)

ns ns ns ns

ns **(-) ns **(-)

ns ***(-) ns ***(-)

* indicates significance at p ≤ 0.05, ** indicates significance at p ≤ 0.01, and *** indicates significance at p ≤ 0.001. (+) indicates positive relationships; (-) indicates negative relationships; ns indicates not significant.

10

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al. 140

140

a

2004

c

2004

Clark near-isogenic lines

Clark near-isogenic lines

120

120

sucrose vs raffinose sucrose vs stachyose

stachyose vs raffinose stachyose vs combined sugars 100

Concentration (mg g-1)

Concentration (mg g-1)

100

r=0.967, p<0.0001

80

60

80

60

r=0.857, p<0.0001 40

40

r=0.699, p<0.0001

20

20 0

r=-0.049, p=0.81 0

20

30

40

50

60

70

15

20

Sucrose concentration (mg g-1) 140

35

40

45

50

d

2005 120

sucrose vs raffinose sucrose vs stachyose

120

30

140

b

2005

25

Stachyose concentration (mg g-1)

stachyose vs raffinose stachyose vs combined sugars

Concentration (mg g-1)

Concentration (mg g-1)

100

100

80

r=0.969, p<0.0001 60

80

60

r=0.849, p<0.0001 40

20

40 0

r=0.695, p<0.0001

r=0.53, p=0.204

20

0

10

20

30

40

50

Sucrose concentration (mg g-1)

60

25

30

35

40

45

50

Stachyose concentration (mg g-1)

Figure 1. Pearson correlation coefficient (r) and level of significance (p) between sucrose and raffinose; sucrose and stachyose in Clark near-isogenic lines in 2004 (a) and 2005 (b), and stachyose vs. raffinose; stachyose vs. combined sugars in 2004 (c) and 2005 (d). Experiment was conducted in Stoneville, MS, USA. Figure was extracted from Bellaloui et al. (2010)

The biological functions of raffinose and stachyose are not clear (Ren et al., 2009), but soybean seed with low stachyose levels had poor germination (Wilson, 2004). Other researchers reported that oligosaccharides including sucrose and raffinose may be involved in desiccation tolerance during seed development and maturation, protection of seeds against damage during seed dehydration and aging, and seed survival and storability (Obendorf, 1997). Samarah et al. (2009) suggested that seed matured under water stress resulted in lower

Soybean Seed Composition and Quality

11

seed sucrose and lower seed vigor as estimated by germination after accelerated aging compared with well watered soybeans. Ren et al. (2009) reported that seeds with low stachyose concentration developed under higher temperatures may partially explain the low germination. Bellaloui et al. (2010) suggested that if this is the case, then one would postulate that warmer climates such as those of the midsouth U.S.A. would result in seed with lower sucrose and stachyose, leading to lower germination rates. Recent work by Dierking and Bilyeu (2009) showed no significant difference in germination between normal and low raffinose family oligosaccharides soybean seeds when imbibed/germinated in water. Further research is needed for conclusive results. Despite previous intensive research, no soybean cultivars with improved high sucrose and/or low raffinose and stachyose have been released or reported (Hou et al., 2009). More research is needed for germplasm development for desirable seed sugar quality traits.

2.4. Soybean Seed Storage Proteins 2.4.1. Significance Soy products such as tofu have been consumed for centuries in Asia. However, recently soy products have gained popularity in Europe and North America due to increased consumer awareness of the health benefits of these products (Nik et al., 2008). Using domestic elite lines to increase yield in soybean was a main focus in the last 60 years, and this resulted in narrowing the genetic base for improving other desirable seed quality traits such as protein quality (Nik et al., 2008). Because of the genetic inverse relationship between yield and protein, plant introductions with high protein traits as a parent in backcrossing or in recurrent selection were used as an alternative to overcome this challenge (Krishnan et al., 2007). One of the goals of the Better Bean Initiative, inaugurated in 2002 by the United States Soybean Board, was to develop soybean with high seed composition constituents (Durham, 2003) and to maintain a high quality protein and cost-efficient production of protein meal. Allergic reaction to cow milk in infants (Bock et al., 1978) in U.S.A. has been avoided using soy-based formulas as a substitute for cow milk. However, recent research showed that cross-reactivity of A5B3 glycinin peptides with cow milk specific antibodies occurred (Rozenfeld et al., 2002), indicating the A5B3 glycinin peptides could contribute to allergic reactions in infants fed soy-based formulas (Rozenfeld et al., 2002). Therefore, the use of Gy4 (the locus controlling A5, A4, and B3 peptide production) null soybean cultivars for soy milk production could minimize milk intolerance in infants (Kim et al., 2008), and give new valueadded opportunities to the soy products industry. New soybean lines were developed for low levels of anti-nutritional components such as trypsin inhibitor, and lines with reduced lipoxygenase levels (Kobayashi et al., 1995; Kumar et al., 2006), both of which are undesirable traits for human consumption. 2.4.2. Structure Although soybean seed contains about 40% protein, soybean protein is deficient in two major sulfur-containing amino acids, methionine and cysteine, lowering the protein quality. Currently, soybean meal is supplemented with these two amino acids, increasing production cost for the swine and poultry industry. Therefore, research to increase methionine and cysteine has been a major goal for breeding and biotechnology. The protein quality depends

12

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

on the composition of two major seed storage protein fractions, β-concglycinin and glycinin, and are designated as 7S and 11S, respectively (Nielsen et al., 1989). β-conglycinin has three subunits, designated as α, ά, and β (Yamauchi et al., 1991). The significant nutritional benefits of these proteins for human food and animal feed reside in their nutritional functionality. Glycinin protein contains about 40% of total protein, and its content methionine and cysteine are higher than those of β-conglycinin. β-conglycinin, on the other hand, contains only traces of these amino acids. An inverse correlation exists between βconcglycinin and glycinin, allowing for soybean breeders to select for higher glycinin and lower β-concglycinin. The structure of these two proteins has been extensively studied, for example, Adachi et al. (2003) and Nielsen et al. (1989). Glycinin subunits are three groups (group I: A1aB1b, A1bB2, A2B1a; group IIa:A5A4B3; group IIb: A3B4 (Adachi et al., 2003; Yagasaki et al., 1997).

2.4.3. Breeding and genetic engineering for seed storage proteins improvement It was reported that there are six functional genes encoding glycinin (Gy1, Gy2, Gy3, Gy4, Gy5, and Gy7) (Nielsen et al., 1989; Beilinson et al., 2002). Since higher tofu quality has been associated with the absence of A4 glycinin peptide (Chang and Hou, 2003), soybean breeders have used A4 null lines such as ‘Enrei and ‘Raiden as donor parents for higher tofu quality commercial cultivars. Both cultivars contain a point mutation in the Gy4 gene that alters the translation initiation codon from ATG to ATA (Yu et al., 2005). Several newly identified Gy4 mutants were also selected from the Soybean Germplasm Collection (Kim et al., 2008). The quality of soy products was affected not only by processing and environmental conditions (Nik et al., 2009), but also by protein composition (Poysa et al., 2006). For example, it was found that the ratio of glycinin to β-conglycinin affected soymilk protein and soy protein-based products (Tezuka et al., 2004), and soymilk samples containing group I (A1, A2) of glycinin had more particles than those without group I (Tezuka et al., 2000). Soymilk contains 8-10% total solids, which comprise 3.6% protein, 2% fat, 2.9% carbohydrates, and 0.5% ash, and the amount of each soymilk constituent was dependent on the water to soybean ratio during processing (Lakshmanan et al., 2006), processing method, and the soybean varieties (Lakshmanan et al., 2006; Mullin et al., 2001). Traditional breeding using quatitative trait locis (QTL) has been associated with protein accumulation, seed storage protein, cysteine and methionine content (Brummer et al., 1997; Panthee et al., 2006). Genetic engineering has been also used to increase protein quality by expressing proteins rich in limiting amino acids such as methionine and cysteine to increase the value of the seed (Krishnan, 2005). However, the accumulation of these proteins often occurred at the expense of endogenous sulfur-rich proteins, an undesirable trait that may affect endogenous sulfur availability for seed during seed development (Krishnan, 2005; Krishnan et al., 2007). It was concluded that the mechanisms by which these compounds are partitioned remain mostly unknown, and understanding the mechanisms of nutrient assimilation, amino acid synthesis, protein accumulation, and carbon partitioning may contribute to a better soybean management program for higher sulfur-containing amino acids (Krishnan et al., 2007). Recently, Nik et al. (2009) selected soybean genotype Harovinton, a variety of tofu type soybean, and 11 derived null soybean lines lacking specific glycinin and β-conglycinin subunits. The subunit null soybean genotypes were developed from crosses and back-crosses between Harovinton (Buzzell et al., 1991) and ‗‗Iwate-1‘‘ which lacks all glycinin subunits

Soybean Seed Composition and Quality

13

and ‗‗Iwate-3‘‘ which lacks the ά subunit of β-conglycinin and all glycinin subunits. They found that soymilk made from Harovinton and soybean lines lacking glycinin had higher total solid than other genotypes evaluated. Also, soymilk made from soybean genotypes lacking glycinin or glycinin group I (A1, A2) had a smaller particle size distribution compared to those having glycinin. In their studies, Nik et al. (2008, 2009) concluded that protein subunit can be used for breeding evaluation to select for desirable specific processing and functionality traits. According to Beilinson et al. (2002), the G1, G2 and G7 glycinin subunits contain higher amounts of methionine compared to G3, G4 and G5 glycinin subunits. Mutations leading to null traits (lack of either the G4, or the G5 genes, or genotypes deficient in all of group I subunits of glycinin) have been reported among Japanese soybean varieties (Takahashi et al., 2003; Yagasaki et al., 1997). The three null traits were controlled by independent recessive genes, and were incorporated into a single soybean breeding line (Takahashi et al., 2003). Null soybean cultivars lacking the α, or both the α and ά, or lacking the β subunit of βconglycinin were also identified in Japanese soybean germplasm collections (Takahashi et al., 2003). They showed that genotypes lacking β-conglycinin subunits, α, ά and β were found among wild Japanese genotypes and were controlled by a single dominant gene, Scg-1, which is a supressor of β-conglycinin. They concluded that it is possible to genetically alter the entire subunit composition of glycinin and β-conglycinin. Poysa et al. (2006) developed null soybean genotypes differing in seed storage glycinin and β-conglycinin subunit composition. The genotypes were developed by crossing and backcrossing Harovinton with Japanese genotypes lacking either all glycinin subunits or both the ά subunit of β-conglycinin and all glycinin subunits. Genotypes lacking the ά subunit of β-conglycinin and the A5A4B3 (G5) of glycinin, with increased levels of the A3B4 (G4) subunit of glycinin produced firmer tofu. Yaklich et al. (2002) used northern high seed protein (CX797-21, CX797-115, CX804-3, and CX804-108); southern high seed protein (D76-8070, D80-6931, D81-8259, and D818498), NC-2-62 (J. W. Burton, USDA-ARS, North Carolina); BARC-6, BARC-7, BARC-8, and BARC-9 (R. C. Leffel, USDA-ARS, Beltsville, MD); Normal seed protein lines (Essex, Williams, Miles, and Clark); non-nodulated line and nitrogen deficient during seed fill (Clark rj1); 76-48773. They found that the ranking of seed size and protein content of lines did not differ between years in only 1 out of 5, but oil, total protein, oil content, and the ratio of protein to oil differed, reflecting the contribution of environmental factors. They evaluated α, ά, and β subunits of β-conglycinin, the acidic A3 polypeptide of glycinin, the acidic polypeptides A1, 2, 4 of glycinin, and the basic polypeptides of glycinin. Yaklich et al. (2002) concluded that lines with high protein seem to contain more β-conglycinin and glycinin than normal-protein soybean lines, and the amounts of subunits and polypeptides differ among lines. Hirai et al. (1995) studied the expression of transgenic genes encoding the ά and β subunits of β-conglycinin in Arabidopsis thaliana (L.) Heynh under sulfate deficiency conditions. The results showed that there was an expression response of both the intact β subunit gene and the β subunit gene promoter fused to the β-glucuronidase. They concluded that the response to sulfate is mainly regulated at the transcription level, and the expression of β subunit gene promoter changes with sulfate availability. They also found there was a negative relationship between sulfur supply and β subunit of β-conglycinin, undesirable response because the the β-conglycinin is poor in sulfur-containing amino acids (Naito et al., 1994). El-Shemy et al. (2007) were able to obtain seed from transgenic soybean plants

14

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

expressing hpt and V3-1 genes. The transgenic soybeans were obtained by a modified Gy1 (A1aB1b) proglycinin gene with a synthetic DNA encoding four continuous methionines (V31). They showed higher accumulation of glycinin and protein expression compared with nontransgenic plants. The three subunit genes of the β-conglycinin responded differently to N and S induction (Holowach et al., 1984). In vitro experiments showed that the β-subunit protein was completely repressed when soybean cotyledons were supplied with methionine. However, ά and subunits were little affected (Holowach et al., 1984). This effect was reversible (Holowach et al., (1986)), indicating that the repression was at the mRNA level (Creason et al., 1983). It was also found that sulfur or potassium deficiency influenced seed storage protein composition (Gayler and Sykes, 1985), and under sulfur deficiency, more βconglycinin accumulation than glycinins occurred (Fujiwara et al., 1992). Paek et al. (1997) investigated the effect of nitrogen forms (KNO3, NH4NO3, N2, or urea) on seed storage proteins. They found that seed storage protein increased up to 4% by using reduced-N. The increase was due to disproportionate increase of the ß-subunit of ß-conglycinin. There was no change in the relative abundance of α- and ά-subunits, indicating that form of nitrogen affects the relative abundance of ß-subunit of ß-conglycinin and 11S/7S ratio. They concluded that the availability of relative abundance of S- and N-metabolites during seed development could be a source of variation in seed storage protein composition. Sexton et al. (1998) found a linear relationship between the amount of ß-subunit of ß-conglycinin and N:S ratio of cotyledon tissue, but glycinin fraction of storage protein showed a linear, negative relation to the N:S ratio. They concluded that poor quality storage protein was synthesized even in high S environments, suggesting the ability of plants to synthesize sulfur-containing amino acids during seed fill could be a limiting factor. Krishnan et al. (2007) investigated the biochemical and genetic mechanisms that regulate protein accumulation using proteomic and molecular analysis of LG00-13260 and its parental high-protein lines PI 427138 and BARC-6. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis and matrix assisted laser desorption ionization time-of-flight mass spectrometry showed that high-protein lines accumulated increased amounts of β-conglycinin and glycinins compared with Williams 82. Also, they found 38 protein spots, representing the different subunits of β-conglycinin and glycinin. They concluded that the increased higher protein accumulation may be due to higher accumulation of β-conglycinin and glycinin subunits, and this may be due to differential expression of these genes during seed development.

3. CROP MANAGEMENT EFFECTS ON SEED COMPOSITION 3.1. Planting Date Effects on Seed Composition Earlier planting date increases number of nodes (Wilcox and Frankenberger, 1987) and pods and seeds (Pedersen and Lauer, 2004). These developmental stages are related to vegetative and reproductive stages (Wilcox and Frankenberger, 1987) during R1 (Fehr and Caviness, 1977) through R8 stages (Wilcox and Frankenberger, 1987). Late planting increases floral abortion rate Heitholt et al. (1986), but set heavier seed, compensating for

Soybean Seed Composition and Quality

15

reduced seed number (Spaeth and Sinclair, 1984). Planting early can stimulate early initiation of R5 and lengthen the duration of the R5 through R6 period (Bastidas et al., 2008; Wilcox and Frankenberger, 1987). Early planting coincides with warmer temperature during R5 and R6 (critical stage of soybean) compared with soybean planted in late May or early June (Robinson et al., 2009). Kane et al. (1997) indicated that delaying planting in the southeastern U.S. from late April or early May to June or July usually leads to a higher seed protein concentration, and this is not consistent with results of Bastidas et al. (2008), who reported inconsistent effects of planting date on protein concentration. Although differences in protein and oil could be due to differences in maturity group (Yaklich et al., 2002) and cultivar (Bastidas et al., 2008), environmental conditions appeared to have the greatest effect (Oliva et al., 2006). Schnebly and Fehr (1993) studied the stability of modified fatty acid composition of soybean genotypes with elevated palmitic and stearic acids, or reduced linolenic acid. They used ten soybean lines with modified fatty acid composition and two common cultivars in 1988, 1989, and 1990 at the Iowa State University Agricultural Engineering and Agronomy Research Center near Ames, U.S.A. Planting dates were 2 May, 16 May, 30 May, and 13 June. They found that early planting dates resulted in lower linolenic acid concentration, and the maximum concentration differences between 2 May and 13 June for genotype with < 25 g kg–1 linolenic acid was 4 g kg–1. They also found that the average daily high temperature at R5-R6 stages (seed-fill period) did not consistently explain the differences in fatty acid content among planting dates or years. Schnebly and Fehr (1993) concluded that planting date could not be used to explain fatty acid stability across environment. On the other hand, Wilcox and Cavins (1992) studied the effect of planting date in normal and low linolenic genotypes during oil deposition using ‗Century‘, C1640, and 9509 (three genotypes differing in linolenic acid due to alleles at the fan locus) planted at four or five dates in each of 5 years near West Lafayette, IN, U.S.A. They found that fatty acid composition was not affected by planting date in either 1986 or 1990. However, in 1987 and 1988, palmitic acid levels decreased slightly and stearic acid levels increased slightly with later planting dates. Linolenic acid level was the most affected by planting date than the other fatty acid. Wilcox and Cavins (1992) found a decrease of 4.9 g kg–1 in Century and 3.0 g kg–1 in C1640 for each 1 °C increase in temperature when linolenic acid concentration had been regressed on the average maximum daily air temperature from 0 to 20 d prior to maturity. They concluded that late planting in Indiana, U.S., should not substantially increase linolenic acid in low linolenic acid genotypes. Recently, Robinson et al. (2009) studied the effect of six planting dates on seed oil and protein in Indiana and found that mean oil concentration decreased approximately 12 g kg−1 as planting was delayed in two years. Mean protein concentration increased 14 g kg−1 as planting was delayed in one year only. They concluded that delaying planting until late May or early June slightly altered seed composition. Research in the southern U.S. soybean growing region has shown that cultivar differences and planting date had a significant effect on seed protein, oil, palmitic, stearic, oleic, linoleic, and linoleic acids, and the effect of planting date on protein, oleic, and linolenic acid depended on year and cultivar differences (unpublished). Protein and oil, and oleic and linoleic acids, and oleic and linolenic acids had a consistent significant negative correlation at late planting across years, but protein and oil had no significant correlation at early planting (late April). Bear in mind the breeding lines DT97-4290 and DT99-16864 are moderately resistant to charcoal rot and were included in this experiment. Although the experiment was furrow irrigated, differences

16

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

in seed composition due to possible charcoal rot differential effects on these cultivars under possible water stress cannot be completely excluded.

3.2. Crop Rotation, Tillage, and Row Spacing Effects on Seed Composition Crop rotation can improve soil structure (Raimbault and Vyn, 1991), increase crop water use efficiency (Roder et al., 1989; Copeland and Crookston, 1992), increase soil organic matter (Campbell and Zentner, 1993; Reddy et al., 2006), and improve nutrient use efficiency (Karlen et al., 1994). However, crop rotation and its effects on soybean seed composition have yet to be thoroughly investigated. Temperly and Borges (2006) showed that soybean seed protein concentration decreased from 357 mg kg-1 in first-year soybean following five consecutive years of corn, to 351 mg kg-1 in fifth-year soybean following five consecutive years of corn. Soybean oil concentration increased as consecutive years of soybean production increased. Effect of rotation on seed composition could be indirectly affecting soil nutrients, and consequently seed composition and quality. Bellaloui et al. (2009b) showed that higher protein and oleic fatty acid percentages were accompanied with higher soil [N], [C], [K], [B], and [Zn], indicating that maintaining optimum nutrient concentrations in soil may result in higher seed protein and oleic acid. They also found a positive correlation of [C], [K], [B], and [Zn] in seed with seed protein and oleic acid, suggesting an indirect role of these nutrients with seed composition. Foliar B application was also shown to increase soybean seed protein and oleic acid concentrations (Bellaloui et al., 2009a). No-till had similar or higher palmitic acid than the other management systems, and the conventional system had as similar or lower linolenic acid when compared with other systems (Gao et al., 2009). They concluded that these four management systems had limited effect on total oil, oleic, and linoleic acids, but no-till did impact palmitic, stearic, and linolenic. Research on the effect of tillage and no-tillage on nitrogen metabolism and seed composition and mineral nutrition in soybean showed inconsistency effect on yield and saturated fatty acids, palmitic and stearic acids, but consistent effects on nitrogen metabolism, soil and seed mineral concentrations, seed protein, unsaturated fatty acids, and sugars were observed (unpublished data). Boydak et al. (2002) studied the effect of irrigation and row spacing on protein, oil, and fatty acids. They found that row spacing of 70 cm had the highest protein concentration, followed by 60, 40, and 50 cm, respectively. They also found that irrigation every 3rd day resulted in the highest level of protein, followed by 6th, 9th, and 12th day irrigation, respectively. A row spacing of 50 cm resulted in the highest oil concentration. Row spacing significantly affected oleic and linoleic acid concentrations, and row spacing and irrigation interacted for oleic and linoleic acid concentrations. In their experiment, they found significant interactions of row spacing × year, row spacing × irrigation, irrigation × year, and row spacing ×irrigation × year for protein and oil, indicating significant interactions between crop management and environment for seed composition.

3.3. Irrigation Effects on Seed Composition Soybean is produced under irrigated and non-irrigated conditions. To maintain a high yield and seed quality, irrigation management is essential to avoid severe water stress/drought

Soybean Seed Composition and Quality

17

that negatively impacts seed quality. The impact of environmental stresses on soybean, including drought and temperature, were previously documented (Howell and Cartter, 1958), and details about soybean irrigation management were intensively reviewed by Heatherly (1999). Severe drought can alter seed composition constituents (protein, oil, and fatty acids), leading to a decrease (Specht el al., 2001) or increase of protein and decrease of oil concentrations (Dornbos and Mullen, 1992). The decrease or increase in oil may depend on the level of drought (Specht et al., 2001), genotype (Maestri et al., 1998; Piper and Boote, 1999), and timing of full maturity of these cultivars (Zhang et al., 2005), or cultivar adaptability to irrigation management (Bellaloui et al., 2008). It was also reported that the interrelationships among seed quality components in soybean and lines × environment interactions were significant for seed yield, protein, and oil (Wilcox and Shibles, 2001). In the midsouth U.S., for example, the period from June to August coincides with initial bloom to full bloom (R1–R2) in June; beginning pod to full pod to beginning seed (R3–R4–R5) in July; and full seed to beginning maturity to full maturity (R6–R7–R8) in August-September. Bellaloui et al. (2008) showed that during July–August, water deficit reached -128, -136, and -131 mm, respectively, in 2002, 2003, and 2004. Under these conditions, the non-irrigated soybean must have grown under drought stress, as shown by soil water potential values that reached up to -100 to -198 kPa in June–August. Our current irrigation research, using water potential sensors, indicated that about -15 kPa represent the water field capacity for Sharkey clay (very-fine, smectitic, thermic chromic Epiaquert) soil (Bellaloui et al., 2008). At soil potentials of -50 to -60 kPa water stress occurs and irrigation needs to be applied for higher yield; <-100 kPa represent drought deficit that would impact yield and significantly alter seed composition. Our research showed that after a regular irrigation (once per 7–10 days), soybean need about 56.8 mm of water every 7 to 10 days to avoid water stress, and this amount could increase to 76.2 mm, depending on the stage of the crop, size of soil cracks, and irrigation water pressure. Bellaloui et al. (2008) investigated the effect of full-season irrigation (FS), reproductive stage irrigation (RI), and non-irrigation (NI) on seed composition in Dwight and Freedom cultivars. They found that Dwight had a higher seed protein under FS and RI than NI. Freedom, however, had a higher protein percentage under NI than under FS and RI. They concluded that cultivar selection and irrigation management affect yield and seed quality, and selecting certain cultivars that are adapted to dryland may benefit producers for higher protein. Supplemental irrigation at the reproductive stage for certain cultivars may also reduce production costs without compromising yield and seed quality.

3.4. Glyphosate Effects on Nutrient Uptake and Seed Composition in Glyphosate Resistant Soybean Global production of glyphosate [N-(phosphonomethyl)glycine]-resistant (GR) soybean continues to increase annually. Glyphosate is a wide-spectrum, foliar-applied herbicide that is extensivly used for weed control in GR soybeans. Many farmers report that some GR soybean varieties are injured by glyphosate (Zablotowicz and Reddy, 2007). Field observations in Brazil and the North Central United States also suggested that frequent applications of glyphosate induce Fe, Zn, and Mn deficiencies in soybeans (Huber, 2006; Johal and Huber, 2009). Visual injury symptoms, often known as ‗yellow flashes‘ develop in GR soybean

18

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

following glyphosate application that have been attributed to the accumulation of the phytotoxic metabolite of glyphosate, aminomethylphosphonic acid (AMPA) (Reddy et al., 2004). The yellow flushes are usually considered not detrimental, and soybeans recover within the first two weeks after herbicide application (Reddy and Zablotowicz, 2003). However, recent research noticed these symptoms until the R1 growth stage, long after herbicide application, suggesting that either glyphosate or its metabolite may have long term effects on the physiology of the plant (Zobiole et al., 2010a; 2010b). According to Eker et al. (2006), after glyphosate is absorbed by the plant, the uptake and transport of cationic micronutrients may be inhibited by the formation of poorly soluble glyphosate-metal complexes within plant tissues. If this is the case, micro-and macro nutrient deficiency may occur, affecting seed composition. The effect of nutrient deficiency on seed composition was previously reported. For example, Wilson et al. (1982) showed that severe Mn deficiency (leaf Mn <15 ppm) increased seed protein percentage and decreased seed oil percentage. During their experiment, higher linoleic, linolenic, and stearic acids, but lower oleic acid were observed in seed from plants grown under very low Mn deficiency conditions. Wilson et al. (1982) concluded that deficiency in Mn can alter seed composition, impacting soybean seed quality. Zobiole et al. (2010a) showed that younger plants (V4 growth stage) were more sensitive to glyphosate effects than plants receiving glyphosate at a later growth stage (V7). Because a single application contains the total dose, it differs from sequential application in which the same dose is fragmented (50%-50%). Thus when using a single application, the plant has less time to recover from the likely chelating effects of the higher glyphosate rate (Jaworski, 1972; Kabachnik et al., 1974; Madsen et al., 1978; Glass, 1984; Coutinho and Mazo, 2005; Eker et al., 2006). Moreover, Zobiole et al. (2010b) evaluated, at R1 growth stage (54 DAS – days after sowing; 24 days after glyphosate application) the nutrient concentration in the last fully expanded trifoliolate (diagnostic leaf) and at the R8 growth stage (136 DAS), the mineral and fatty acid composition. The data in Table 5 shows that glyphosate application affected the nutritional status of GR soybean at R1 growth stage. Comparing BRS 242 GR with BRS 242 + glyphosate, glyphosate resulted a significant decrease in concentrations of P, Ca, Mg, Zn, and Mn. These results demonstrated that glyphosate or one of its metabolites apparently remained active in soybean through the R1 growth stage or later, indicated by the decrease in mineral concentrations in leaf tissue. Zobiole et al. (2010b) also found that glyphosate decreased shoot and root biomass production. The lower biomass production in glyphosate-treated GR cultivars indicates that a higher level of nutrient may actually be required for GR cultivars to achieve physiological sufficiency. Other authors also reported reduced shoot and root dry weight in GR soybean, using glyphosate at 1680 g a.e. ha-1 (Reddy et al., 2000) and at 6300 g a.e. ha-1 (King et al., 2001), while other pointed out that glyphosate could cause a lower availability of nutrients in plants (Franzen et al., 2003; Eker et al., 2006; Huber, 2006; Bott et al., 2008). Nutrient balance is important because each element functions as part of a delicately balanced, interdependent physiological system with the plant‘s genetics and the environment (Johal and Huber, 2009).

Soybean Seed Composition and Quality

19

Table 4. Macro and micronutrient concentration in seed at R8 growth stage in GR soybean (BRS 242 GR) with and without glyphosate and its near-isogenic non-GR parental lines (Embrapa 58) without glyphosate a. Table was extracted from Zobiole et al. (2010b) Treatment BRS 242 GR BRS 242 GR +glyphosate Embrapa 58

a

P

Fe

Mn

26.02 a 21.94 b

Ca g kg-1 3.28 a 2.68 b

32.50 a 25.33 b

Zn mg kg-1 35.80 a 34.20 b

65.90 a 52.76 ab

27.58 a

3.38 a

49.80 b

Cu 8.86 a 7.73 b

26.56 b

35.13 ab

8.06 a

Data represents the average of six independent replicates. Means within a column followed by the same letter are not significantly different at the 5% level as determined by LSD test.

Table 5. Effect of glyphosate on fatty acid composition in seeds of GR soybean (BRS 242 GR) with and without glyphosate and its near-isogenic non-GR parental lines (Embrapa 58) without glyphosate a. Table was extracted from Zobiole et al. (2010b) Treatments

PUFA

BRS 242 GR BRS 242 GR +glyphosate Embrapa 58

69.70 a 66.32 b 69.21 a

MUFA n-6 % 16.67 b 60.37 a 20.89 a 58.79 b 15.29 b 61.17 a

n-3 8.33 a 7.53 b 8.04 a

n-6:n-3 ratio 7.25 c 7.81 a 7.60 b

Data represents the average of six independent replicates. Means within a column followed by the same letter are not significantly different at the 5% level as determined by LSD test. SFA=saturated fat acids; PUFA=polyunsaturated fat acids; MUFA=monounsaturated fatty acid; n6=sum of polyunsaturated fat acids with a double bond on carbon 6 from CH3 end; n-3= sum of polyunsaturated fat acids with a double bond on carbon 3 from CH3 end. a

Zobiole et al. (2010b) analyzed the seed nutrient concentration and reported that glyphosate application significantly altered seed nutrient concentrations, including P, Ca, Mn, Zn and Cu (Table 4), which were accompanied by the decreased nutrient concentrations found in diagnostic leaves (Zobiole et al., 2010b). In this case, glyphosate or AMPA probably remain in the plant tissue and contribute to the decrease in macro- and micronutrient concentrations in leaf tissues and seed by potential chelating effects to form glyphosate-cation complexes. In general, near-isogenic non-GR parental lines (Embrapa 58) and GR soybean plants without glyphosate treatment exhibited higher concentrations of macro- and micronutrients in leaves and seeds compared with GR soybeans receiving glyphosate (Zobiole et al., 2010b). In this same study, glyphosate affected the fatty acid composition in GR soybeans with glyphosate application (Table 5). Glyphosate treatment increased the percentages of monounsaturated fatty acid (MUFA), which are not essential to the human diet, and decreased the polyunsaturated fatty acids (PUFA). Polyunsturated fatty acids such as linolenic acid, omega-3 PUFA, have been associated with numerous benefits to human health (Simopoulos, 2004). Linolenic and linoleic (omega-3 and omega-6 PUFA, respectively), comprising the main group of PUFA in seeds, were affected by glyphosate treatment of GR soybean (Table 5). Bellaloui et al. (2008) also found that glyphosate decreased linolenic acid, which is one of

20

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

the PUFA found in seed soybean. They also found that glyphosate increased seed oleic acid (Bellaloui et al., 2008). Further studies should be conducted to understand the mechanisms of glyphosate effects on GR soybean physiology, especially those related to seed composition. As showed in this chapter, glyphosate can affect the mineral status and on seed composition of GR soybeans. In the future, research should consider the need for different fertilizer requirements for genetically modified and conventional soybeans.

3.5. Temperature Effects on Germination and Emergence Chilling injury is the inhibition of normal plant growth usually in tropical or sub-tropical plant species brought on by exposure to temperatures usually below 10 ºC but above freezing. The symptoms of chilling injury may vary across species but a common physiological and biochemical event in most chilling-sensitive species appears to be a temperature-induced phase transition of cellular and organelle membranes (Lyons and Breidenbach, 1979). Membranes of chilling sensitive plants transition from a normal fluid state to a restricted, less fluid state when exposed to sub-optimum temperatures. Cold temperature imbibition injury can occur rather rapidly. In soybean, membrane reorganization in the embryo occurs within the first few minutes of water uptake (Parrish and Leopold, 1977). Zong-ya et al. (1991) later discovered that soybean germinated for 6 d at 25 ºC after 3 h of imbibition at 5 ºC had hypocotyl cells with disrupted plasma membrane and the presence of undegraded lipid and protein bodies, particularly in the inner crista of the mitochondria. Guangkun et al. (2009) concluded that chilling during imbibition caused mitrochondrial damage at ultrastructual and metabolic levels. Further, Bramlage et al. (1978) found that one symptom of chilling injury to soybean seed is increased leakage of solutes from the embryo. Imbibition at 14 ºC or less reduced germination seedling vigor. This was also noticed at an exposure of only 5 minutes at 2 ºC. The leakage of solutes not only results in a loss of nutrients needed by the developing seedling, but sets up environmental conditions favorable to several damping off diseases. Cold temperature imbibition injury in soybean appears to be more of a potential problem in the northern production areas that have shorter growing seasons. Bohner (2003) described in detail some of the stand losses experienced in Ontario in 2003 were likely due to cold temperature imbibition injury. Planting dates, particularly in the Great Lakes region have been occurring earlier as increased yields are often obtained (Conely, 2006). However, soybeans planted in cold soils will take longer to emerge and run a greater risk from soilborne diseases and insect damage (Staton et al., 2009). Yang (2009) reported an increased risk for soybean sudden death syndrome (SDS) exists with planting in Iowa prior to 15 May. He states that it is likely due to the seedling remaining in the soil longer and therefore exposed to the pathogen longer, giving more time for the seed to be infected. The likelihood of cold temperature imbibition injury decreases as one moves further south in the production area. Few, if any cases, of such injury have been documented south of 40o latitude. Planting generally does not occur in this region until soil temperatures are above 12 ºC. However, chilling injury is still possible, particularly if cold cloudy weather persists for a week or more prior to planting, lowering the soil temperature to 10 ºC or less and if the seed that is planted is low in moisture or of poor quality. Seed that has a broken testa is more subject to chilling injury than sound seed because cold water will reach the embryo much quicker (Bohner, 2003). In ESPS soil temperatures at the 5 cm depth will average 16 ºC by 1

Soybean Seed Composition and Quality

21

April and the possibility of cold temperature imbibition injury is remote (Boykin et al., 1995) even with ESPS. Managing against cold temperature imbibition injury involves several factors that are not difficult to employ. First, select sound seed for planting. Seed that has come from drought stressed fields or that has a high amount of seed coat cracking is more subject to chilling injury during imbibition. Proper storage of soybean seed is important to reduce the possibility of imbibition injury. Low seed moisture (<15.0 g kg-1) is most likely to suffer chilling injury than seed that is above this level. Monitoring soil temperatures prior to plant appears key in preventing this type of injury as well as other potential problems such as SDS.

4. EFFECT OF PLANT DISEASE ON SEED COMPOSITION AND QUALITY Several fungi, viruses, and bacteria are capable of causing severe infections and discolorations of soybean seeds. The most common examples include among the fungi are: Phomopsis/Diaporthe (pod and stem blight), C. kikuchii (purple seed stain) (T. Matsu and Tomoyasu) Gardner, Macrophomina phaseolina (charcoal rot), Peronospora manshurica (Naun) Syd. ex Gaum (downy mildew), Fusarium spp, and Colletotrichum truncatum (anthracnose). Soybean mosaic virus and Bean Pod Mottle virus in the virus group and Psuudomonas savastanoi pv glycinea (bacterial blight), Xanthomonas axonopodis pv. Glycines (bacterial pustule), and Psuudomonas syringae pv. tabaci (wild fire) in the bacterial group. Some of these diseases can cause significant yield and quality losses, and/or create obstacles to seed export because of phytosanitary concerns (Kulik and Sinclair, 1999). These diseases also cause an economic loss to growers in that grain buyers may discount the price paid for soybeans if seed is discolored due to infection (Hill et al., 1987; Mengistu and Heatherly, 2006). Soybeans highly infected with Fusarium, Cercospora, Phomopsis, or Alternaria produce oil with higher free fatty acids concentrations with darker colors, lower oxidative stabilities, and poor flavors (List, 1980). Phomopsis sojae preferentially colonizes seed coat tissues, resulting in changes in seed protein and oil, and increasing free fatty acids, reducing seed quality. Low germination (12%) and high recovery of P. sojae on potato dextrose agar were found for symptomatic seed, but high germination (86%) and 22% infection by P. sojae for seeds without symptoms. Hepperly and Sinclair (1978) found that seeds with reduced recovery of P. sojae from both symptomless and with symptoms had higher oil and protein than symptomless seed. Phomopsis. sojae is considered as a major cause of moldy, poorly germinating soybean seeds in Brazil, Canada, and the United States (Wallen and Seaman, 1963). Phomopsis seed infection often exceeds 50% on susceptible cultivars when harvest is delayed (Wilcox et al., 1974). According to the U.S. Official Standards for soybeans, the threshold for off colors in a seed lot of No. 1 grade soybeans is < 1%, between 1 and 2% for No. 2 grade, between 2 and 5% for No. 3 grade, and between 5 and 10% for No. 4 grade (Wilson et al., 1995). Seed lots above 10% may be rejected under current discount schedules for contract sales. In Mississippi, the minimum germination for certified seed is 80%, and seedlots with less than 60% germination are declared illegal to sale (Keith and Delouche, 1999). Therefore, the ability of seed to germinate is essential quality trait (Smith et al., 2008).

22

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

4.1. Phomopsis Effects on Seed Composition and Quality Many factors affect seed quality. Seed-borne fungi, insect damage, adverse weather (such as frost), improper storage, and physiological aging and drought, all reduce seed vigor and viability. Any rough or excessive handling of dry or moist seeds at harvest or planting can cause cracked seed coats and kill seed embryos. These cracks may be microscopic, but they still can increase seed rot by undermining the integrity of the seed coat and seed nutrient content, and providing an entry for soil-inhabiting and/or seed-rotting fungi. Although yield benefit for ESPS has been observed in Arkansas (Taylor, 1999), Mississippi (Heatherly, 1999), Texas (Savoy et al., 1992), and Missouri (Wrather et al., 1996), seed quality has been a major concern in ESPS due to Phomopsis. The reason for this problem is that early maturing soybean cultivars mature under ESPS between mid-August and mid-September, when normal temperatures and relative humidity are high (Smith et al., 2008). These conditions provide favorable conditions for one of the major seed decay pathogens, Phomopsis longicolla Hobbs, leading to a substandard germination (TeKrony et al., 1996; Mengistu and Heatherly, 2006; Smith et al., 2008). High temperature with wet and dry conditions is conducive for seed coat wrinkling, contributing to reduced germination (Franca et al., 1988; Franca et al., 1993). Untimely delays in harvesting can result in increased levels of PSD and poor seed quality. Such weathering of soybeans leads to declining physiological integrity, as well as increased chances for fungal infection, seed staining, cracked seed coats with Phomopsis seed rot and decay. Planting diseased, poor-quality beans will result in reduced stands that may reduce yields (Mengistu et al., 2010). Although Phomopsis is spread throughout most soybean-growing states in the United States (Sinclair, 1999), yield losses due to Phomopsis vary with years and regions (Wrather et al., 2003). Phomopsis seed decay also lowers seed quality of seed processor (Wrather et al., 1996) by lowering the quality of oil derived from infected seed compared to healthy seed (Hepperly and Sinclair, 1978). Subsequently, research for developing Phomopsis resistant germplasm has been undertaken. In 1993 a soybean line resistant to Phomopsis (MO/PSD0259) was developed and registered (Minor et al., 1993). Two other high-yielding soybean lines, SS 93-6012 and SS 93-6181, resistant to Phomopsis seed decay were developed from a cross of MO/PSD-0259 and Asgrow 3834 (Pathan et al., 2009). Wrather et al. (2003) investigated the effect of planting dates on two Phomopsis highly resistant soybean lines SS 93-6012 and SS 93-6181, and on Asgrow 3834, susceptible cultivar. They found a significant negative correlation between germination of seed from mid-April planting of Asgrow 3834 and percentage of seed infected with Phomopsis spp., but there were no significant correlations between the percentage of seed infection and the percentage of oil and protein in seed from mid-April planted Asgrow 3834. On the other hand, there was a significant negative correlation between the percentage of seed infection and palmitic and oleic acids, but significant positive correlation between seed infection and linoleic acid and linolenic acids. No correlation was found between seed infection and stearic acid. These findings do not agree with those of Hepperly and Sinclair (1978), who observed significantly higher oil and protein percentages in seed with symptoms of Phomopsis sojae infection. Bradley et al. (2002) reported a significant relationship between incidence of seed infected with Phomopsis spp. and concentration of seed protein or oil at Champaign, IL in 1999, but not at Urbana, IL in 1998 or 1999. Bradley et al. (2002) suggested that the severity of the infection, was influenced by environment, and altered seed composition constituent. Linolenic acid

Soybean Seed Composition and Quality

23

concentration was increased as percentage of seed infected. A high level of this fatty acid is undesirable trait for oil quality because it is responsible for poor flavor and undesirable odors in soybean oil (Beare-Rogers, 1995). The possible explanation of the effect of Phomopsis on oil was reported by Hepperly and Sinclair (1978) in that the darker and rancid odor oil from seed with symptoms of Phomopsis sojae infection compared with oil from seed without symptoms could be due to the damage to seed coat tissue and the exposure of the underlying tissue to air and consequent oxidation of lipids. Oil, meal, soy flour, and carbohydrates were also impacted by Phomopsis. It was reported that oil, meal, and flour derived from infected seeds are of lower quality than those from non-infected seeds (Roy, 1976), and this could be due to the degradation of seed coat proteins by the fungal released enzymes (Ryley, 2004). Fungus infected soybean seed showed higher protein concentrations, lower carbohydrates, no change or increased oil concentrations (Pathan et al., 1989). Wilson et al. (1995) evaluated the effect of Phomopsis on seed composition on cv. Centennial by blending dried seed (10% moisture) with a series of fungal treatments (from 0 to 80% fungal damage). They found a positive correlation between fungal damage and both protein and oil concentrations (increase in oil from 19.5 to 22.8%, and protein from 43.7 to 50.8%). The positive correlation was explained as a consequence of residual seed mass loss. Also, Wilson et al. (1995) found that protein concentration of defatted meal increased from ca. 54 to 66% with a fungal damage of 0 to 80%. They concluded that damaged seed by the fungus may be blended with high quality soybeans to avoid the undesirable chemical composition accompanied with Phomopsis infection. Wilson et al. (1995) suggested that blending fungus-soybean seed with higher quality constituents may provide the processors to gain economic advantage. Although the mechanisms of the effect of Phomopsis on seed protein, oil, and saturated and unsaturated fatty acids are still not understood, the physiological explanation of fungal damage could be due to the disruption of cellular membranes, probably causing hydrolysis of hydratable phosphatides, principally lecithins, by phospholipase D activity (List et al., 1992). Crude soybean oil typically contains 5 to 10% (w/w) nonhydratable phosphatides (List, 1980). Other possible explanation is that Phomopsis may inhibit the uptake and assimilation of essential macro and micro nutrients involved in seed coat resistance against diseases, including Phomopsis. These nutrients include Ca, K, B, and Cu, Fe, Co, Zn, Mn, some of which are involved in membrane permeability and integrity such Ca and B and phenol metabolism and lignin biosynthesis such as B, Mn, and Cu (Marschner, 1995). Altering the balance of these nutrients in cell wall and cell membrane, and changing the cell membrane phospholipids, as a result of altered fatty acids, may undermine the integrity of cell wall and cell membrane to prevent disease from penetration (Marschner, 1995). Phomopsis infection is affected by environment (temperature, rain/irrigation (Mengistu et al., 2007a; Smith et al., 2008), genotype, and crop management. Since there are no commercial Phomopsis resistant cultivars available in the market, the management of these variables could minimize seed infection, avoiding substandard seed quality components (germination, cracking, split, vigor, and stand). TeKrony et al.(1984) investigated the effect of planting date on soybean seed quality (germination, vigor, and Phomopsis seedborne infection) in soybean cultivars with varying maturity group (MG) II to V. Planting dates were mid-May, mid-June, and early July. They found that approximately 25% of the 54 cultivarplanting date combinations had substandard seed germination and vigor. They reported that Phomopsis sp. was the major factor influencing seed quality, and Phomopsis sp. seed infected

24

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

was negatively correlated (r = –0.88) with seed germination. TeKrony et al. (1984) also found that seed from later maturing cultivars (‗Kent‘ and ‗York‘) had the highest seed quality regardless of planting date. They concluded that delaying planting date of early and midseason cultivars (‗Beeson‘, ‗Williams‘, and ‗Cutler 71‘) would lead to delayed harvest maturity, and consequently improving seed germination and vigor and reducing Phomopsis sp. seed infection. Heatherly (1996) reported that seed germination in ESPS, using MG IV and V, was lower under non-irrigation than irrigation when planted in June. The causes of lower seed quality in the ESPS are not known, although some possible explanations have been documented (Mayhew and Caviness, 1994). These findings were also supported by Mayhew and Caviness (1994) who reported that Phomopsis seed infection was observed in early soybean maturing soybean, leading to low germination. Since seed germination can be affected before and after physiological seed maturity (Dornbos, 1995), temperature, moisture and disease infection during reproductive growth and beginning of seed fill to full maturity can reduce seed viability and vigor (Fehr et al., 1971; TeKrony et al., 1980). Recently, Mengistu et al. (2009) studied the infection and development of P. longicolla on vegetative and reproductive tissues of six cultivars and determined the relationship between this infection and subsequent seed infection and seed germination under irrigated and non-irrigated conditions in resistant and susceptible breeding lines. In their experiment, P. longicolla was isolated from leaf, stem, pod, root, and seed. Diaporthe phaseolorum and three unidentified Phomopsis sp. They found that isolation of P. longicolla from seed was negatively correlated with seed germination percentage in irrigated environments but not in the nonirrigated environment, and pod infection was also correlated with seed infection in all three irrigation environments. Mengistu et al. (2009) demonstrated that recovery of P. longicolla from seeds was strongly affected by irrigation, and these findings were in agreement with previous studies (Mengistu and Heatherly, 2006). They also found that in 2003 Freedom, a late-maturing cultivar (MG V), had a lower seed infection and higher germination. Mengistu et al., 2009 suggested that this is may be due to the shifting of seed maturation of later maturing cultivar freedom to cooler, drier conditions (TeKrony et al., 1984). Also, they found that germination in Pioneer 9594 and Freedom was lower in both irrigated environments, may be due to induced seed infection by higher soil moisture (Mengistu and Heatherly, 2006). Their findings that significant negative correlation between percent hard seed and percent seed infection and percent germination in all irrigations were in agreement with those of Roy et al. (1994a, b). Although differences in percentage of hard seed of cultivars have been attributed to genetic variation (Kilen and Hartwig, 1978), the negative relationship between hard seed and seed infected was explained to be due to that impermeable seeds are less likely to be infected with Phomopsis,. It is likely that the environmental conditions were the major contributor to increased levels of hard seed, it remains difficult to determine which environmental factor(s) or combinations of factors were responsible for increased hard seed (Mengistu et al., 2009). In spite of the positive contribution of hard seeded trait to disease prevention and lowering level of infected seed, hard seed in soybean is an undesirable trait because of its negative impact on processed soybean into soy foods, leading to adverse quality and cost factor (Mullin and Xu, 2001).

Soybean Seed Composition and Quality

25

4.2. Charcoal Rot Effects on Seed Composition and Quality Charcoal rot is caused by the fungus Macrophomina phaseolina (Tassi) Goid. Charcoal rot is a disease of economic significance throughout the world (Mengistu et al., 2007b; Wyllie, 1976), especially under warm temperatures and drought (Smith and Wyllie, 1999). The pathogen reduces root volume and weight resulting in a decrease in plant height and loss of yield (Wrather, 1995) and seed quality (Gangopadhyay et al., 1970). Seed infected by charcoal rot often carries the fungus on its seed coat and have reduced germination (Integrated Crop Management, University of Iowa, 2010). Although planting dates, crop rotation, planting densities, and irrigation (Wyllie, 1988) have been used to control charcoal rot, development of soybean genotypes resistant to this pathogen may be the only feasible method to manage this disease (Smith and Wyllie, 1999; Kendig et al., 2000). Soybean genotypes such as ‗Delta and Pineland 3478‘, ‗Hamilton‘, ‗Jackson II‘, ‗Davis‘, and ‗Asgrow 3715‘ and ‗Asgrow 4715,‘ have been identified as either moderately resistant or tolerant (Smith and Carvil, 1997; Smith and Wyllie, 1999). A moderately resistant germplasm line, DT97-4290, was field-tested and released (Paris et al., 2006) at Stoneville, MS, USA. Mengistu et al. (2007b) evaluated twenty-four soybean genotypes in Maturity Groups III through V in 2002 and 2003 in naturally and artificially infested fields. They found, based on the colony-forming unit index, four genotypes (DT9916864, DT99-17483, DT99-17554, and DT 97-4290) were classified as moderately resistant to M. phaseolina. Despite efforts being made to identify charcoal rot resistance in soybean, no claims have been made for soybean charcoal rot resistance in commercial cultivars. The other aspect of M. phaseolina infection on soybean seed is its effect on seed composition. Very little information is available on the effect for charcoal rot on seed protein, oil, fatty acids, and isoflavones. Bellaloui et al. (2008) evaluated the effect of charcoal rot under irrigated and non-irrigated environments in a moderately resistant breeding line (DT974290) and susceptible cultivars (Egyptian and Pharaoh). They found that there was no change in seed protein concentrations in the moderately resistant germplasm line DT97-4290 under these irrigated environments. Protein concentration was significantly higher for the susceptible cultivars Egyptian and Pharaoh under non-infested than infested conditions. Nonirrigation conditions resulted in the opposite results for Pharaoh. Seed oleic acid was shown to be higher in susceptible cultivars under infested conditions, and the concentration of linolenic acid in susceptible cultivars was significantly lower under infested conditions. Also, in another experiment, that was conducted at the Stoneville, MS in 2004 and 2005, it was found that the moderately resistant breeding lines (DT97-4290 and DT99-16864) to charcoal rot had higher seed calcium, boron, and zinc concentrations than the susceptible variety Egyptian under non-irrigated-infested conditions. Isoflavones (glycitein, daidzein, and genistein: major isoflavones in soybean) percentages differ, depending on the cultivar/genotype, supporting Hoeck et al. (2000), irrigation, and charcoal rot infestation. This variability in seed isoflavones may be due to, in addition to cultivar/genotype differences and infestation treatments, environmental conditions (Hoeck et al., 2000), especially temperature (Lozovaya et al., 2005) and rainfall. Previous research has shown that planting high quality seed is important to an efficient soybean production system. Early planting, reduced seeding rates, and drill planting require high quality, vigorous seed to obtain optimum stands and yields. Strong seedlings grow faster than less vigorous ones, are more tolerant to adverse conditions in the seedbed, and are better

26

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

able to resist diseases. Diseases affecting seed quality and yield differ in severity among cultivars, years, and locations, but the pathogens responsible are well established in most production areas. Soybean seed produced in warm, wet seasons or where rain has delayed the harvest is often of poor quality. Using fungicide seed treatments provides cheap insurance against seedborne and soilborne seed rots and against seedling blights. Although fungicide seed treatments generally increase the stand, such treatments do not always insure higher yields.

5. BREEDING AND GENETIC ENGINEERING RESEARCH FOR ALTERED OILS In general, the healthiest oils are those rich in monounsaturated fatty acids, such as olive oil (Damude and Kinney, 2008), but olive oil is too expensive for many food applications. There is a strong need for a land-based, renewable, and sustainable source of heat-stable plant oil (Damude and Kinney, 2008). Soybean oil has poor oxidative stability due to naturally occurring levels of the polyunsaturated fatty acids linoleic acid (18:2) and linolenic (18:3) acid which are readily oxidized into compounds that give ―off flavors‖ in food (Howell and Collins, 1957). Partial hydrogenation converts polyunsaturated fatty acids to the more saturated fatty acids, oleic acid (18:1) and stearic (18:0) ,which reduces polyunsaturated fatty acids to about 18% of the total fatty acids, with linolenic acid generally below 2% (Clemente and Cahoon, 2009). Hydrogenation has the unwanted side effect of producing trans fatty acids, as opposed to the naturally occurring cis. fatty acids. The Food and Drug Administration, beginning January 1 2006, requires food products to carry trans-fat content on labels because they concluded that there is strong evidence for an adverse relationship between trans fat intake and coronary heart disease risk (Federal Register - 68 FR 41433 July 11, 2003). This has increased demand for low-linolenic soybean oil that allows food processors to reduce the need for hydrogenation, thus reducing trans fatty acids from oil in foods. Partially hydrogenated oils are commonly used for frying food because of their increased stability, but it was shown that low linolenic soybean oil is a good alternative for frying (Gerde et al., 2007; Mounts et al., 1994). Traditional breeding and transgenic biotechnology research is underway to develop cultivars with modified fatty acid profiles. Numerous low linolenic acid soybean oil (low lin) lines have been on the market for years. Low linolenic oil is defined as having 2.5 to 3% linolenic acid and ultralow low lin oil is ~1% (Fehr, 2007). Chemically and x-ray induced mutations of the gmFAD3A, gmFAD3B, and gmFAD3C genes have been extensively utilized by breeders (Fehr, 2007). Though low linolenic oil has improved stability, it is not as stable as high oleic acid (>80%) sunflower oil (Helianthuis annus) (Warner, 2009). High oleic acid (~80%) soybean oil will decrease trans fats in food products, therefore it is a target of many breeders to produce low linolenic soybeans. High oleic acid/reduced palmitic soybean oil has been shown to have more favorable characteristics for biodiesel production than standard soybean oil or low linolenic soybean oil (Graef et al., 2009). Natural variation has been exploited by Burton et al. (2006) to produce N98-4445A, a mid-oleic (50-60%), low-linolenic line with a mean across eight environments of 55% oleic

Soybean Seed Composition and Quality

27

acid, 3% linolenic acid, and 12.6% total saturates. However commercial lines of mid-oleic soybean have not been available. Obtaining commercial cultivars is difficult due to yield drag and sensitivity of oleic acid concentration to growing temperature which is associated with this source of the trait (Bachlava et al., 2008; Oliva et al., 2006). X-ray induced mutagenesis has produced genotype M23 with mid oleic acid trait (Rahman et al., 2001) which is associated with a mutation in one of the FAD2-1 genes (Alts et al., 2005) which convert oleic acid to linoleic acid (Heppard et al., 1996). Lines derived from M23 did not exhibit yield drag or temperature sensitivity (Oliva et al., 2006). However, modifying genes have a significant effect on the mutation from M23, which requires increased breeding effort to produce full expression of the trait (Alts et al., 2005). Down regulation of the FAD2-1 and FatB genes by transgenic methods have resulted in high-oleic acid (>85%) and low palmitic acid (<5%) soybeans (>80%) which are not sensitive to growing temperature, have high yield potential (Mazur et al., 1999, Buhr et al., 2002, Graef et al., 2009). The transgenic allele, inherited as a single dominant trait, which simplifies breeding. New non-GMO varieties IA1024 and IA2095 with low saturated fatty acids have been developed (Healthier Soybean Oils, Iowa State University, 2008). The saturated fatty acids palmitic acid (18:0) and stearic acid (16:0) have also been manipulated to increase the utility of oil. Reduced palmitic acid has been shown to improve the cold flow and ignition properties of biodiesel produced from it (Wilson 2004, Graef el al., 2009). For baking applications, the solid fat content at certain temperatures of oil is important to determine its utility. This property is directly related to saturated fat content. Increasing saturated fats in soybean oil to 30% to 35% would enable the production of margarine using non-hydrogenated oil (Wilson, 2004). Table 6. Recently filed petitions for permits to field-test transgenic soybean with altered lipid profiles (http://www.isb.vt.edu/cfdocs/fieldtests1.cfm) and petitions filed for deregulation (http://www.aphis.usda.gov/brs/not_reg.html) of transgenic soybeans not yet commercialized Transformation event / Line Petitions for field-testing Monsanto Not available Company

Phenotype (s)

Status

Confidential Business Information GM-FAD2, GM-FAD2-1, GM-FAD2-2, GM-FAD3,

Stearidonic acid, altered oil profile, increased oil content, Increased oil content, altered fatty acid level, altered lipid profile

Several petitions acknowledged / issued Several petitions Acknowledged

Petition for de-regulation Pioneer Hi- DP-305423-1 Bred

gm-fad2-1 and gm-hra

Pending

DuPont

GmFad2-1

High oleic acid and tolerance to ALS inhibitors High oleic acid

Pioneer HiBred

Not available

G94-1, G94-19, G-168

Gene (s)

Approved

28

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

In soybean, there are at least four recessive alleles which reduce for palmitic acid content at the fap locus (Wilson, 2004; Pantalone et al., 2004). Soybean N79-2077-12, with about 6% palmitic acid (versus about 16% in non-modified soybean), carries a natural mutation designated as fapnc (Wilson, 2004; Burton et al., 1994) which has been shown to be a genomic deletion of one isoform of the FATB1a gene (Cardinal et al., 2007). Other alleles that reduce palmitic acid include fap1 allele in C1726 (Erickson et al., 1988) which was shown to be a mutant of the FAT B gene (Wilson, 2004), fap3 in A22 (Schnebly et al., 1994), and fap* [in ELLP2 line (Stojsin et al., 1998)] and sop1 (in J3 line) (Kinoshita et al., 1998; Wilson, 2004; Cardinal et al., 2007). Chemically induced mutagenesis has produced alleles fap2 (Erikson et al., 1988), fap2b (Schnebly et al., 1994), fap4 (Schnebly et al., 1994), and fap5 (Stoltzfus et al., 2000b), fap6 (Narvel et al., 2000) and fap7 (Stoltzfus et al., 2000a) which increase palmitic acid above standard levels. These alleles are assumed to be mutants of FAP loci, but more genetic studies are needed to prove this (Wilson, 2004). Combinations of these alleles have been shown to increase palmitic acid content greater than 35% of crude oil (Fehr et al., 1991, Fehr, 2007). However, soybean yield was found to be significantly less in modified palmitic acid genotypes than in non-modified soybean and (Rebetzke et al., 1998; Wilcox and Cavins, 1990). Elevated stearic acid lines, developed by chemical or X-ray mutagenesis which contain homozygous recessive alleles of the Fas loci, include A6 (fasa) (Hammond and Fehr, 1983), FA41545 (fasb) (Graef et al., 1985), A81-606085 (fas) (Graef et al., 1985), KK-2 (st1) (Rahman et al., 1997), M25 (st2) (Rahman et al., 1997). The line FAM94-41 (fasnc) is a naturally occurring mutation (Pantalone et al., 2002) which increases stearic acid. Soybeans generally have a stearic acid content of 4%. Lines with >35% stearic acid have been produced. However, the production of commercial lines is hampered by significant environmental effects on stearic acid levels, and reduced seed emergence and seedling growth rates (Fehr, 2007). Genetic modification of oilseed crops such as soybean provides an opportunity to design the composition of seed oils for optimal dietary or processing characteristics. Until recently, modification of oil composition was achieved through conventional plant breeding, but transgenic technology has widened the scope for designing soybean lipid profile. Biotechnology has also played a part to increase oil content and to alter the relative abundance of individual fatty acids in seed oil for health and industrial purposes. The biotechnology offers a means of reducing saturated fatty acid content oil; increasing saturated fatty acids for greater stability in processing and frying; and increasing oleic acid in oil for food manufacturing. Biotechnology traits developed and commercialized to date have largely focused on pest control (insect resistance and herbicide resistance). While the improvement of agronomic characteristics in major crops has been highly successful, the soybean genetically engineered to meet the specific oil needs of either consumers or food processors have yet to be commercialized. Although genetically engineered crops with enhanced health and nutritional benefits have lagged behind agronomic applications, research on many such products is in the advanced stages of development. Soybean with transgenically modified high oleic acid and other altered lipids have reached field- testing, and some are close to commercial release. (Table 6). Pioneer Hi-Bred, a DuPont company, is developing soybeans under the brand Plenish™ with high oleic acid, low linolenic acid, and low saturated fats. These high oleic acid soybeans have been approved for cultivation and food and feed use in Canada as of May 2009 (DuPont Canada, 2009). Pioneer research efforts are also underway to develop soybean varieties with traits for

Soybean Seed Composition and Quality

29

increased oil content that are expected to be commercialized within the next decade. Monsanto is nearing release of Vistive® Gold soybeans which have mono-unsaturated fat levels similar to olive oil and low saturated fat content (Randal, 2010). Monsanto is also developing transgenic soybean modified to produce stearidonic acid (n-6 C18:0 fatty acid) which is converted in the human body to the long chain n-3 fatty acid eicosapentaenoic acid (EPA) (Monsanto, 2010). EPA and docosahexaenoic acid (DHA) which are naturally found in fish oil, not in plants, have been shown to be important for human health, especially cardiovascular health (Damude and Kinney, 2008). It should also be noted that there are soybean varieties with altered oil content developed through conventional breeding techniques currently on the market. Pioneer is marketing low linolenic acid soybean under the brand Pioneer® low linolenic soybean varieties and the company claims that the low linolenic oil can eliminate the need for partial hydrogenation in food processing (Pioneer, 2010). Similarly, Vistive™ soybean varieties developed and marketed by Monsanto provide oil with low linolenic acid and low saturated fats (Monsanto, 2010). Conventional breeding and biotechnology may give consumers the choice to use desirable fatty acids from modified GMO or non-GMO soybean. Also, soybean growers will have opportunities to gain a premium for growing soybean with higher protein and improved oil (Healthier Soybean Oil, Iowa State University, 2008).

ACKNOWLEDGMENTS Authors would like to thank Dr. Robert E. Hoagland, Dr. Vijay K. Nandula, and Dr. Linghe Zeng for reviewing the manuscript. We also thank Sandra Mosley for managing references list.

REFERENCES Adachi, M., Kanamori, J., Masuda, T., Yagasaki, K., Kitamura, K. & Mikami, B. (2003). Crystal structure of soybean 11S globulin: glycinin A3B4 homohexamer. Proceedings of the Natl Acad. Sci.U.S.A, 100, 7395-7400. Alts, J. L., Fehr, W. R., Welke, G. A. & Shannon, J. G. (2005). Transgressive segregation for oleate content in three soybean populations. Crop Sci., 45, 2005-2007. Bachlava, E., Burton, J. W., Brownie, C., Wang, S., Auclair, J. & Cardinal, A. J. (2008). Heritability of oleic acid content in soybean seed oil and its genetic correlation with fatty acid and agronomic traits. Crop Sci., 48, 1764-1772. Bachlava, E. & Cardinal, A. J. (2009). Correlation between temperature and oleic acid seed content in three segregating soybean populations. Crop Sci., 49, 1328-1335. Bastidas, A. M., Setiyono, T. D., Dobermann, A., Cassman, K. G., Elmore, R. W., Graef, G. L. & Specht, J. E. (2008). Soybean sowing date: The vegetative, reproductive, and agronomic impacts. Crop Sci., 48, 727-740. Beare-Rogers, J. (1995). Food fats and fatty acids in human nutrition. In: Development and processing vegetable oils for human nutrition. R. Przybylski, & B. E. McDonald, (Eds.), AOCS, 1-7, Champaign, IL.

30

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Beilinson, V., Chen, Z., Shoemaker, R. C., Fischer, R. L., Goldberg, R. B. & Nielsen, N. C. (2002). Genomic organization of glycinin genes in soybean. Theor. Appl. Genet., 104, 1132-1140. Bellaloui, N., Abbas, H. K., Gillen, A. M. & Abel, C. A. (2009a). Effect of glyphosate-boron application on seed composition and nitrogen metabolism in glyphosate-resistant soybean J. Agric. Food Chem., 57, 9050-9056. Bellaloui, N., Hanks, J. E., Fisher, D. K. & Mengistu, A. (2009b). Soybean seed composition is influenced by within-field variability in soil nutrients. Crop Management, doi:10.1094/CM-(2009)-1203-01-RS.

Bellaloui, N., Smith, J. R., Gillen, A. M. & Ray, J. D. (2010). Effect of maturity on seed sugars as measured on near-isogenic soybean (Glycine max ) lines. Crop Sci. in press. Bellaloui, N., Smith, J. R., Ray, J. D. & Gillen, A. M. (2009d). Effect of maturity on seed composition in the early soybean production system as measured on near-isogenic soybean lines. Crop Sci., 49, 608-620. Bellaloui, N., Zablotowicz, R. M., Reddy, K. N. & Abel, C. A. (2008). Nitrogen metabolism and seed composition as influenced by glyphosate application in glyphosate-resistant soybean. J. Agric. Food Chem., 56, 2765-2772. Bock, S. A., Lee, W. Y., Remigio, L. K. & May, C. D. (1978). Studies of hypersensitivity reactions to foods in infants and children. J. Allergy Clin. Immunol., 62, 327-334. Bohner, H. (2003). Do soil temperatures at planting impact soybean yield? Ministry of [Online] available at http://www.omafra.gov.on.ca/english/crops/field/news/croptalk/ 2003/ct_0903a7.htm Verified (3/20/2010). Bott, S., Tesfamariam, T., Candan, H., Cakmak, I., Romheld, V. & Neumann, G. (2008). Glyphosate-induced impairment of plant growth and micronutrient status in glyphosateresistant soybean (Glycine max L.). Plant and Soil, 312, 185-194. Boydak, E., Alpaslan, M., Hayta, M., Gercek, S. & Simsek, M. (2002). Seed composition of soybeans grown in the Harran region of Turkey as aVected by row spacing and irrigation. J. Agric. Food Chem., 50, 4718-4720. Boykin, D. L., Carle, R. R., Ranney, C. D. & Shanklin, R. (1995). Weather data summary for 1964-1993 Stoneville, MS. Mississippi Agric. & Forestry Exp. Sta. Tech. Bull., 201. Bradley, C. A., Hartman, G. L., Wax, L. M. & Pedersen, W. L. (2002). Quality of harvested seed associated with soybean cultivars and herbicides under weed-free conditions. Plant Dis., 86, 1036-1042. Bramlage, W. J., Leopold, A. C. & Parrish, D. J. (1978). Chilling stress to soybeans during imbibition. Plant. Physiol., 61, 525-529. Breene, W. M., Lin, S., Hardman, L. & Orf, J. (1988). Protein and oil content of soybeans from different geographic locations. J. Am. Oil Chem. Soc., 65, 1927-1931. Brummer, E. C., Greaf, G. L., Orf, J., Wilcox, J. R., & Shoemaker, R. C. (1997). Mapping QTL for seed protein and oil content in eight soybean populations. Crop Sci., 37, 370378. Buhr, T., Sato, S., Ebrahim, F., Xing, A., Zhou, Y., Mathiesen, M., Schweiger, B., Kinney, A. J., Staswick, P. & Clemente, T. (2002). Ribozyme termination of RNA transcripts downregulates seed fatty acid genes in transgenic soybean. Plant J, 30, 155-163. Burton, J. W. (1985). Breeding soybean for improved protein quantity and quality. In R. Shibles, (Ed.), World Soybean Research Conference III: Proceedings, 361-367. Ames, IA. 12-17 Aug. 1984. Westview Press, Boulder, CO.

Soybean Seed Composition and Quality

31

Burton, J. W. (1991). Recent developments in breeding soybeans for improved oil quality. Fat Sci. Technol., 93, 121-128. Burton, J. W., Wilson, R. F. & Brim, C. A. (1983). Recurrent selection in soybeans: IV. Selection for increased oleic acid percentage in seed oil. Crop Sci., 23, 744-747. Burton, J. W., Wilson, R. F. & Brim, C. A. (1994). Registration of N97-2077-12 and N872122-4, two soybean germplasm lines with reduced palmitic acid in seed oil. Crop Sci., 34, 313. Burton, J. W., Wilson, R. F., Rebetzke, G. J. & Pantalone, V. R. (2006). Registration of N984445A Mid-oleic soybean germplasm line. Crop Sci., 46, 1010-1012. Buzzell, R. I., Anderson, T. R., Hamill, A. S. & Welacky, T. W. (1991). Harovinton soybean. Can. J. Plant Sci., 71, 525-526. Campbell, C. A. & Zentner, R. P. (1993). Soil organic matter as influenced by crop rotations and fertilization. Soil Sci. Soc. Am. J., 57, 1034-1040. Cardinal, A. J., Burton, J. W, Camacho-Roger, A. M., Yang, J. H., Wilson, R. F. & Dewey, R. E. (2007). Molecular analysis of soybean lines with low palmitic acid content in the seed oil. Crop Sci., 47, 304-310. Cartwright, R., Rupe, R. & Ross, R. (2009). Vigor test helps determine soybean seed quality. I:\Manuscript January 2010\Manuscripts 2010-2\Manuscript January 2010\Chapter 2010\Vigor test helps determine soybean seed quality Plant Pathology, Bumpers College, UA.mht. Verified (4/23/2010). Carver, B. F., Burton, J. W., Carter, Jr., T. E. & Wilson, R. F. (1986). Response to environmental variation of soybean lines selected for altered unsaturated fatty acid composition. Crop Sci., 26, 1176-1180. Chang, K. C. & Hou, H. J. Science and technology of tofu making. (2003). In: Handbookof Vegetable Preservation and Processing, Y. H., Hui, S., Ghazala, D. M., Graham, K. D. & Murrell, W. Nip, Eds. Dekker, New York, 443-478. Cheesbrough, T. M. (1989). Changes in the enzymes for fatty acid synthesis and desaturation during acclimation of developing soybean seeds to altered growth temperature. Plant Physiol., 90, 760-764. Cherry, J. H., Bishop, L., Hasegawa, P. M. & Heffler, H. R. (1985). Differences in the fatty acid composition of soybean seed produced in northern and southern areas of the U.S.A. Phytochemistry, 24, 237-241. Clemente, T. E. & Cahoon, E. B. (2009). Soybean oil: genetic approaches for modification of functionality and total content. Plant Physiol., 151, 1030-1040. Conely, S. (2006). Coming sooner: Early soybean planting growing trend. Ag Answers. [Online]http://www.agriculture.purdue.edu/aganswers/story.asp?storyID=4178. Verified (3/20/2010). Copeland, P. J. & Crookston, R. K. (1992). Crop sequence affects nutrient composition of corn and soybean grown under high fertility. Agron. J., 84, 503-509. Coutinho, C. F. B. & Mazo, L. H. (2005). Complexos metálicos com o herbicida lyphosate: Revisão. Química Nova, 28, 1038-1045. Creason, G. L., Holowach, L. P., Thompson, J. F. & Madison, J. T. (1983). Exogenous methionine depress level of mRNA for a soybean storage protein. Biochem. Biophys. Res. Commun., 117, 658-662. Damude, H. G. & Kinney, A. J. (2008). Enhancing plant seed oils for human nutrition. Plant Physiol., 147, 962-968.

32

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Dardanelli, J. L., Balzarini, M., Martinez, M. J., Cuniberti, M., Resnik, S., Ramunda, S. F., Herrero, R. & Baigorri. H. (2006). Soybean maturity groups, environments, and their interaction define mega-environments for seed composition in Argentina. Crop Sci., 46, 1939-1947. Dierking, E. C. & Bilyeu, K. D. (2009). Raffinose and stachyose metabolism are not required for efficient soybean seed germination. J. Plant Physiol., 166, 1329-1335. Dornbos, D. L. Jr. (1995). Production environment and seed quality. In: Seed quality-basic mechanisms and agricultural implications, A. S. Basra, (Ed.), 119-152. New York, Food Products Press. Dornbos, D. L. & Mullen, R. E. (1992). Soybean seed protein and oil contents and fatty-acid composition adjustments by drought and temperature. J. Am. Oil Chem. Soc., 69, 228231. DuPont Canada. (2009). DuPont Receives Canadian Regulatory Approval for High Oleic Soybean Trait. http:// www2. dupont. com/ Media_ Center/ en _CA/pressrelease 2009 0511.html . Verified (5/13/2010). Durham, D. (2003). The United Soybean Board‘s Better Bean Initiative: Building United States Soybean Competitiveness from the Inside Out United Soybean Board. Ag. Bio. Forum, 6(1&2), 23-26. Eker, S., Ozturk, L., Yazici, A., Erenoglu, B., Romheld, V. & Cakmak, I. (2006). Foliarapplied glyphosate substantially reduced uptake and transport of iron and manganese in sunflower (Helianthus annuus L.) plants. J. Agric. Food Chem., 54, 10019-10025. El-Shemy, H. A., Khalafalla, M. M., Fujita, K. & Ishimito, M. (2007). Improvement of protein quality in transgenic soybean plants. Biol. Plant., 51, 277-284. Erickson, E. A., Wilcox, J. R. & Cavins, J. F. (1988). Inheritance of altered palmitic acid percentage in two soybean mutants. J. Hered, 79, 465-468. Federal Register - 68 FR 41433 July 11, (2003). Food labeling; trans fatty acids in nutrition labeling, consumer research to consider nutrient content and health claims and possible footnote or disclosure statements; final rule and proposed rule.http:// www. fda.gov/food/labelingnutrition/labelclaims/nutrientcontentclaims/ucm110179.htm Verified (5/18/2010). Fehr, W. R. (2007). Breeding for modified fatty acid composition in soybean. Crop Sci., 47, S72-S87. Fehr, W. R. & Caviness, C. E. (1977). Stages of soybean development. Spec. Rep. 80. Iowa Agric. Home Econ. Exp. Stn., Iowa State Univ., Ames. Fehr, W. R., Caviness, C. E., Burmood, D. T. & Pennington, J. S. (1971). Stages of development descriptions for soybeans, (Glycine Max (L.) Merrill). Crop Sci., 11, 929931. Fehr, W., R., Welke, G. A., Hammond, E. G., Duvick, D. N. & Cianzo, S. R. (1991). Inheritance of elevated palmitic acid content in soybean seed oil. Crop Sci., 31, 15221524. Fehr, W. R., Welke, G. A., Hammond, E. G., Duvick, D. N. & Cianzio, S. R. (1992). Inheritance of reduced linolenic acid content in soybean genotypes A16 and A17. Crop Sci., 32, 902-906. Franca Neto, J. B., Krzyzanowski, F. C., Henning, A. A., West, S. H. & Miranda, L. C. (1993). Soybean seed quality as affected by shriveling due to heat and drought stress during seed filling. Seed Sci. Technol., 21, 107-116.

Soybean Seed Composition and Quality

33

Franca Neto, J. B., West, S. H. & Vaughan, W. R. (1988). Multiple quality evaluation of soybean seed produced in Florida in (1986). Soil Crop Sci. Soc. Fla. Proc., 47, 201-206. Franzen, D. W., O‘Barr, J. H. & Zollinger, R. K. (2003). Interaction of a foliar application of iron HEDTA and three postemergence broadleaf herbicides with soybeans stressed from chlorosis. J. Plant Nutr., 26, 2365-2374. Fujiwara, T., Hirai, M. Y., Chino, M., Komeda, Y. & Naito, S. (1992). Effects of sulfur nutrition on expression of the soybean seed storage protein genes in transgenic petunia. Plant Physiol., 99, 263-268. Gangopadhyay, S., Wyllie, T. D. & Luedders, V. D. (1970). Charcoal rot disease of soybean transmitted by seeds. Plant Dis. Rep., 54, 1088-1091. Gao, J., Hao, X., Thelen, K. D. & Robertson, G. P. (2009). Agronomic management system and precipitation effects on soybean oil and fatty acid profiles. Crop Sci., 49, 1049-1057. Gayler, K. R. & Sykes, G. E. (1985). Effects of nutritional stress on the storage proteins of soybeans. Plant Physiol., 78, 582-585. Gerde, J., Hardy, C., Fehr, W. & White, P. (2007). Frying performance of no- trans, lowlinolenic acid soybean oils. J. Am. Oil Chem. Soc., 84, 557-563. Glass, R. L. (1984). Metal complex formation by glyphosate. J. Agric. Food Chem., 32, 12491253. Graef, G. L., Miller, L. A., Fehr, W. R. & Hammond, E. G. (1985). Fatty acid development in a soybean mutant with high stearic acid. J. Am. Oil Chem. Soc., 62, 773-775. Graef, G., LaVallee, B. J., Tenopir, P., Tat, M., Schweiger, B., Kinney, A. J., Van Gerpen, J. H. & Clemente, T. E. (2009). A high-oleic-acid and low-palmitic-acid soybean: agronomic performance and evaluation as a feedstock for biodiesel. Plant Biotech, J, 7, 411-421. Guangkun, Y., Sun, H., Xin, X., Qin, G., Liang, Z. & Jing, X. (2009). Mitochondrial damage in the soybean seed axis during imbibition at chilling temperatures. Plant Cell Physiol., 50, 1305-1318. Hammond, E. G, Fehr, W. R. (1983). Registration of A6 germplasm line of soybean. Crop Sci., 23, 192-193. Hartwig, E. E., Kuo, T. M. & Kenty, M. M. (1997). Seed protein and its relationship to soluble sugars in soybean. Crop Sci., 37, 770-773. Healthier Soybean Oils, Iowa State University. (2008). http://www.notrans.iastate.edu/ default.html). Mid- and high oleic fatty acid development is underway.Verified (4/26/2010). Heatherly, L. G. (1996). Yield and germination of harvested seed from irrigated and nonirrigated early and late planted MG IV and V soybean. Crop Sci., 36, 1000-1006. Heatherly, L. G. (1999). Early soybean production system (ESPS). In: Soybean Production in the Midsouth. L. G. Heatherly, & H. F. Hodges, (Eds.), 103-118. CRC Press, Boca Raton, FL. Heitholt, J. J., Egli, D. B. & Leggett, J. E. (1986). Characteristics of reproductive abortion in soybean. Crop Sci., 26, 589-595. Heppard, E. P., Kinney, A. J. , Stecca, K. L. & Miao, G. H. (1996). Developmental and growth temperature regulation of two different microsomal [omega]-6 desaturase genes in soybeans. Plant Physiol., 110, 311-319. Hepperly, P. R. & Sinclair, J. B. (1978). Quality losses in Phomopsis-infected soybean seeds. Phytopathology, 68, 1684-1687.

34

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Hill, J. H., Bailey, T. B., Benner; H. I.., Tachibana, H. & Durand, D. P. (1987). Soybean Mosaic Virus: Effects of primary disease incidence on yield and seed quality. Plant Dis., 71, 237-239. Hirai, M. Y., Fujiwara, T., Chino, M. & Naito, S. (1995). Effects of sulfate concentration on the expression of a soybean seed storage protein gene and its reversibility in transgenic Arabidopsis thaliana. Plant Cell Physiol., 36, 1331-1339. Hoeck, J. A., Fehr, W. R., Murphy, P. A. & Welke, G. A. 2000. Influence of genotype and environment on isoflavone contents of soybean. Crop Sci., 40, 48-51. Holowach, L. P., Madison, J. T. & Thompson, J. F. (1986). Studies on the mechanism of regulation of the mRNA level for a soybean storage protein subunit by exogenous Lmethionine. Plant Physiol., 80, 561-567. Holowach, L. P., Thompson, J. F. & Madison, J. T. (1984). Effects of exogenous methionine on storage protein composition of soybean cotyledons cultured in vitro. Plant Physiol., 74, 576-583. Hou, G., Ablett, G. R., Pauls, K. P. & Rajcan, I. (2006). Environmental effects on fatty acid levels in soybean seed oil. J. Am. Oil Chem. Soc., 83, 759-763. Hou, A., Chen, P., Alloatti, J., Li, D., Mozzoni, L., Zhang, B. & Shi, A. (2009). Genetic variability of seed sugar content in worldwide soybean germplasm collections. Crop Sci., 49, 903-912. Howell, R. W. & Cartter, J. L. (1958). Physiological factors aVecting composition of soybeans. II. Response of oil and other constituents of soybeans to temperature under controlled conditions. Agron. J., 50, 664-667. Howell, R. W. & Collins, R. F. (1957). Factors affecting linolenic and linoleic acid content of soybean oil. Agron. J., 49, 593-597. Huber, D. M. (2006). Strategies to ameliorate glyphosate immobilization of manganese and its impact on the rhizosphere and disease. In: N. Lorenz, & R. Dick, R (Eds.), Proceedings of the Glyphosate Potassium Symposium. Ohio State University, AG Spectrum, DeWitt, Iowa. Hurburgh, C. R., Brumm, T. J., Guinn, J. M. & Hartwig, R. A. (1990). Protein and oil patterns in U.S. and world soybean markets. J. Am. Oil Chem. Soc., 67, 966-973. Hymowitz, T. & Collins, F. I. (1974). Variability of sugar content of seed of Glycine max (L.) Merr. and G. soja Serb. and Zucco. Agron. J., 66, 239-240. Hymowitz, T., Collins, F. I., Panczar, J. & Walker, W. M. (1972). Relationship between the content of oil, protein and sugar in soybean seed. Agron. J., 64, 613-616. Integrated Crop Management, University of Iowa, USA, http://www.ipm.iastate.edu/ ipm/icm/2003/10-6-2003/charcoalrot.html Verified (4/14/ 2010). Jaworski, E. G. (1972). Mode of action of N-phosphonomethyl-glycine: inhibition of aromatic amino acid biosynthesis. J. Agric. Food Chem., 20, 1195-1198. Johal, G. S. & Huber, D. M. (2009). Glyphosate effects on diseases of plants. Eur. J. Agron., 31, 144-152. Kabachnik, M. I., Medved, T. Y., Dyatolva, N. M. & Rudomino, M. V. 1974. Organophosphorus complexones. Russian Chemical Review, 43, 733-744. Kane, M. V., Steele, C. C., Grabau, L. J., MacKown, C. T. & Hildebrand, D. F. (1997). Earlymaturing soybean cropping system: III. Protein and oil contents and oil composition. Agron. J., 89, 464-469.

Soybean Seed Composition and Quality

35

Karlen, D. L., Varvel, G. E., Bullock, D. G. & Cruse, R. M. (1994). Crop rotations for the 21st century. Adv. Agron., 53, 1-44. Keith, B. C. & Delouche, J. C. (1999). Seed quality, production, and treatment. In: Soybean production in the midsouth, L. G. Heatherly, & H. G. Hodges, (Eds.). 197-230.CRC Press, Boca Raton, FL. Kendig, S. R., Rupe, J. C. & Scott, H. D. (2000). Effect of irrigation and soil water stress on densities of Macrophomina phaseaolina in soil and roots of two soybean cultivars. Plant Dis., 84, 895-900. Kilen, T. C. & Hartwig, E. E. (1978). An inheritance study of impermeable seed in soybeans. Field Crop. Res., 1, 65-70. Kim, W., Ho, H. J., Nelson, R. L. & Krishnan, H. B. (2008). Identification of several gy4 nulls from the USDA soybean germplasm collection provides new genetic resources for the development of high-quality tofu cultivars. J. Agric. Food Chem., 56, 11320-11326. King, A. C., Purcell, L. C. & Vories, E. D. (2001). Plant growth and nitrogenase activity of glyphosate-tolerant soybean in response to glyphosate applications. Agron. J., 93, 179186. Kinoshita, T., Rahman, S. M., Anai, T. & Takagi, Y. (1998). Inter-locus relationship between genes controlling palmitic acid contents in soybean mutants. Breeding Sci., 48, 377-381. Kobayashi, A., Tsuda, Y., Hirata, N., Kubota, K. & Kitamura, K. (1995). Aroma constituents of soybean [Glycine-max (L) Merril] milk lacking lipoxygenase isozymes. J. Agric. Food Chem., 43, 2449-2452. Krishnan, H. B. (2005). Engineering soybean for enhanced sulfur amino acid content. Crop Sci., 45, 454-461. Krishnan, H. B., Natarajan, Mahmoud, A. A. & Nelson, R. L. (2007). Identification of glycinin and a-aconglycinin subunits that contribute to the increased protein content of high-protein soybean lines. J. Agric. Food Chem., 55, 1839-1845. Kulik, M. M. & Sinclair, J. B. (1999). Phomposis seed decay. In: Compendium of soybean diseases, 4 th edition, G. L., Hartman, J. B. Sinclair, & J. C. Rupe, (Eds.), 31-32. APS Press, The American Phytopathological Society, St. Paul MN, USA. Kumar, V., Rani, A., Pandey, V. & Chauhan, G. S. (2006). Changes in lipoxygenase isozymes and trypsin inhibitor activity in soybean during germination at different temperatures. Food Chem., 99, 563-568. Lakshmanan, R., De Lamballerie, M. & Jung, S. (2006). Effect of soybean to-water ratio and pH on pressurized soymilk properties. J. Food Sci., 71, E384-E391. Leffel, R. C. & Hanson, W. D. (1961). Early generation testing of diallel crosses of soybeans. Crop Sci., 1, 169-174. List, G. R. (1980). In: Handbook of soybean oil processing and utilization, American Soybean Association/American Oil Chemists' Society, 355-376. Champaign. List, G. R., Mounts, T. L. & Lanser, A. C. (1992). Factors promoting the formation of nonhydratable soybean phosphatides. J. Am. Oil Chem. Soc., 69, 443-446. Liu, K. (1997). Soybeans chemistry, technology, and utilization. Chapman & Hall, New York Lozovaya, V. V., Lygin, A. V., Ulanov, A. V., Nelson, R. L., Dayde, J. & Widholm, J. (2005). Effect of temperature and soil moisture status during seed development on soybean seed isoflavone concentration and composition. Crop Sci., 45, 1934-1940.

36

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Lyons, J. M. & Breidenbach, R. W. (1979). Strategies for altering chilling sensitivity as a limiting factor in crop production. In: Stress physiology in crop plants, H. Mussell, & R. C. Staples, (Eds.), 179-196. John Wiley & Sons. New York, NY. Madsen, H. E. L., Christensen, H. H. & Gottlieb-Petersen, C. (1978). Stability constants of copper (II), zinc, manganese (II), calcium, and magnesium complexes of N(phosphonomethyl)glycine (glyphosate). Acta Chem.Scand., 32a, 79-83. Maestri, D. M., Labuckas, D. O., Meriles, J. M., Lamarques, A. L., Zygadlo, J. A. & Guzman. C. A. (1998). Seed composition of soybean cultivars evaluated in different environmental regions. J. Sci. Food Agric., 77, 494-498. Marschner, H. Mineral nutrition of higher plants. (1995). 2nd edition, 313-369. Academic Press, San Diego, CA. Mayhew, W. L. & Caviness, C. E. (1994). Seed quality and yield of early planted, shortseason soybean genotypes. Agron. J., 86, 16-19. Mazur, B., Krebbers, E. & Tingey, S. (1999). Gene discovery and product development for grain quality traits. Science, 285, 372-375. McBlain, B. A., Fioritto, R. J., St Martin, S. K., Calip-Dubois, A. J., Schmitthenner, A. F., Cooper, R. L. & Martin, R. J. (1993). Registration of ‗Thorne‘ soybean. Crop Sci., 33, 1406. Mengistu, A., Castlebury, L. A., Smith, J. R., Ray, J. & Bellaloui, N. (2009). Seasonal progress of Phomopsis longicolla infection on soybean plant parts and its relashionship to seed quality. Plant Dis., 93, 1009-1018. Mengistu, A., Castlebury, L. A., Smith, J. R., Rossman, A. Y., & Reddy, K. N. (2007a). Identification and pathogenicity of Phomopsis isolates from weed hosts and their effect on soybean. Can. J. Plant Pathol, 29, 283-289. Mengistu, A. & Heatherly, L. G. (2006). Planting date, irrigation, maturity group, year, and environment effects on Phomopsis longicolla, seed germination, and seed health rating of soybean in the early soybean production system of the midsouthern USA. Crop Prot., 25, 310-317. Mengistu, A., Ray, J. D., Smith, J. R. & Paris, R. L. (2007b). Charcoal rot disease assessment of soybean genotypes using a colony-forming unit index. Crop Sci., 47, 2453-2461. Mengistu, A., Smith, J. R., Bellaloui, N., Paris, R. L. & Wrather, J. A. (2010). Irrigation and time of harvest effects on evaluation of selected soybean accessions against Phomopsis longicolla. Crop Sci., in press. Miller, F. (2009). Accelerated aging test offers better information to growers. Soybeans Today.http://division.uaex.edu/news_publications/soybean_tabloid_(2009).pdf Verified (4/15/2010). Minor, H. C., Brown, E. A., Doupnik, B., Jr., Elmore, R. W. & Zimmerman, M. S. (1993). Registration of Phomopsis seed decay resistant soybean germplasm MO/PSD-0259. Crop Sci., 33, 1105. Monsanto, (2010). R&D Pipeline. http://www.monsanto.com/products/pipeline/ soybeans/products.asp Verified (4/23/2010). Mounts, T. L., Warner, K., List, G. R., Neff, W. E. & Wilson, R. F. (1994). Low-linolenic acid soybean oil-Alternatives to frying oils. J. Am. Oil Chem. Soc., 71, 495-499. Mullin, J. W. & Xu, W. (2001). Study of soybean seed coat components and their relationship to water absorption. J. Agric. Food Chem., 49, 5331-5335.

Soybean Seed Composition and Quality

37

Mullin, W. J., Fregeau-Reid, J. A., Butler, M., Poysa, V., Woodrow, L., Jessop, D. B. & Raymond, D. (2001). An interlaboratory test of a procedure to assess soybean quality for soymilk and tofu production. Food Res. Int., 34, 669-677. Naito, S., Hirai, M. Y., Chino, M. & Komeda, Y. (1994). Expression of a soybean (Glycine max [L.] Merr.) seed storage protein gene in transgenic Arabidopsis thaliana and its response to nutritional stress and abscisic acid mutations. Plant Physiol., 104, 497-503. Narvel, J. M., Fehr, W. R., Ininda, J., Welke, G. A., Hammond, E. G., Duvick, D. N. & Cianzio, S. R. (2000). Inheritance of elevated palmitate in soybean seed oil. Crop Sci., 40, 635-639. Nielsen, N. C., Dickinson, C. D., Cho, T. J., Thanh, V. H., Scallon, B. J., Fischer, R. L., Sims, T. L., Drews, G. N. & Goldberg, R. B. (1989). Characterization of the glycinin gene family in soybean. Plant Cell, 1, 313-328. Nik, A. M., Tosh, S. M., Poysa, V., Woodrow, L. & Corredig, M. (2008). Protein recovery in soymilk and various soluble fractions as a function of genotype differences, changes during heating, and homogenization. J. Agric. Food Chem., 56, 10893-10900. Nik, A. M., Tosh, S. M., Woodrow, L. Poysa, V. & Corredig, M. (2009). Effect of soy protein subunit composition and processing conditions on stability and particle size distribution of soymilk. Food Sci. Technol., 42, 1245-1252. Obendorf, R. L. (1997). Oligosaccharides and galactosyl cyclitols in seed desiccation tolerance. Seed Sci. Res., 7, 63-74. Obendorf, R. L., Horbowicz, M., Dickerman, A. M., Brenac, P. & Smith, M. E. (1998). Soluble oligosaccharides and galactosyl cyclitols in maturing soybean seeds in planta and in vitro. Crop Sci., 38, 78-84. Oliva, M. L., Shannon, J. G., Sleper, D. A., Ellersieck, M. R., Cardinal, A. J., Paris, R. L. & Lee, J. D. (2006). Stability of fatty acid profile in soybean genotypes with modified seed oil composition. Crop Sci., 46, 2069-2075. Paek, N. C., Imsande, J., Shoemaker, R. C. & Shibles, R. (1997). Nutritional control of soybean seed storage protein. Crop Sci., 37, 498-503. Pantalone, V. R., Wilson, R. F., Novitzky, W. P. & Burton, J. W. (2002). Genetic regulation of elevated stearic acid concentration in soybean oil. J. Am. Oil Chem. Soc., 79, 549-553. Pantalone, V. R., Walker, D. R., Dewey, R. E. & Rajcan, I. (2004). DNA marker-assisted selection for improvement of soybean oil concentration and quality. In: Legume crop genomics, R. F., Wilson, H. T. Stalker, & E. C. Brummeral, (Eds.), 283-311, AOCS Press, Champaign, IL. Panthee, D. R., Pantalone, V. R., Sams, C. E., Saxton, A. M., West, D. R., Orf, J. H. & Killam, A. S. (2006). Quantitative trait loci controlling sulfur containing amino acids, methionine, and cysteine in soybean seeds. Theor. Appl. Genet., 112, 546-553. Paris, R. L., Mengistu, A., Tyler, J. M. & Smith, J. R. (2006). Registration of soybean germplasm line DT97-4290 with moderate resistance to charcoal rot. Crop Sci., 46, 23242325. Parrish, D. J. & Leopold, A. C. (1977). Transient changes during soybean imbibition. Plant Physiol., 59, 1111-1115. Pathan, M. A., Sinclair, J. B. & McClary, R. D. (1989). Effects of Cercospora kikuchii on soybean seed germination and quality. Plant Dis., 73, 720-723.

38

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Pathan, M. S., Clark, K. M., Wrather, J. A., Sciumbato, G. L., Shannon, J. G., Nguyen, H. T. & Sleper, D. A. (2009). Registration of soybean germplasm SS93-6012 and SS93-6181 resistant to phomopsis seed decay. J. Plant Reg., 3, 91- 93. Pattee, H. E., Isleib, T. G., Giesbrecht, F. G. & McFeeters, R. F. (2000). Investigations into genotypic variations of peanut carbohydrates. J. Agric. Food Chem., 48, 750-756. Pedersen, P. & Lauer, J. G. (2004). Response of soybean yield components to management system and planting date. Agron. J., 96, 1372-1381. Pioneer. (2010). Products and services. http://www.pioneer.com/web/site/portal/ products/soybeans/Verified (4/23/2010). Piper, E. L. & Boote, K. J. (1999). Temperature and cultivar effects on soybean seed oil and protein concentrations. J. Am. Oil Chem. Soc., 76, 1233-1242. Poysa, V., Woodrow, L. & Yu, K. (2006). Effect of soy protein subunit composition on tofu quality. Food Res. Int., 39, 309-317. Rahman, S. M., Kinoshita, T., Anai, T. & Takagi, Y. (2001). Combining ability in loci for high oleic and low linolenic acids in soybean. Crop Sci., 41, 26-29. Rahman, S. M, Takagi, Y. & Kinoshita, T. (1997). Genetic control of high stearic acid content in seed oil of two soybean mutants. Theor. Appl. Genet., 95, 772-776. Raimbault, B. A. & Vyn, T. J. (1991). Crop rotation and tillage effects on corn growth and soil structural stability. Agron. J., 83, 979-985. Randall, K. (2010). The Hunt for Gold. [Online] available at http://www.mon santo.com/monsanto_today/2010/classic10_vistive_gold.asp. (validated 05/13/2010). Ray, C. L., Shipe, E. R. & Bridges, W. C. (2008). Planting date influence on soybean agronomic traits and seed composition in modified fatty acid breeding lines. Crop Sci., 48, 181-188. Rebetzke, G. J., Pantalone, V. R., Burton, J. W., Carter, Jr., T. E. & Wilson, R. F. (2001). Genetic background and environment influence palmitate content of soybean seed oil. Crop Sci., 41, 1731-1736. Rebetzke, G. J., Butron, J. W., Carter, Jr. T. E. & Wilson, R. F. (1998). Changes in agronomic and seed characteristics with selection for reduced palmitic acid content in soybean. Crop Sci., 38, 297-302. Reddy, K. N., Hoagland, R. E. & Zablotowicz, R. M. (2000). Effect of glyphosate on growth, chlorophyll content and nodulation in glyphosate-resistant soybeans (Glycine max) varieties. J. New Seeds, 2, 37-52. Reddy, K. N., Locke, M. A., Koger, C. H., Zablotowicz, R. M. & Krutz, L. J. (2006). Cotton and corn rotation under reduced tillage management: impacts on soil properties, weed control, yield, and net return. Weed Sci., 54, 768-774. Reddy, K. N., Rimando, A. M. & Duke, S. O. (2004). Aminomethylphosphonic acid, a metabolite of glyphosate, causes injury in glyphosate-treated, glyphosate-resistant soybean. J Agric. Food Chem., 52, 5139-5143. Reddy, K. N. & Zablotowicz, R. M. (2003). Glyphosate-resistant soybean response to various salts of glyphosate and glyphosate accumulation in soybean nodules. Weed Sci., 51, 496502. Ren, C., Bilyeu, K. D. & Beuselinck, P. R. (2009). Composition, vigor, and proteome of mature soybean seeds developed under high temperature. Crop Sci., 49, 1010-1022. Robinson, A. P., Conley, S. P., Volenec, J. J. & Santini, J. B. (2009). Analysis of high yielding, early-planted soybean in Indiana. Agron. J., 101, 131-139.

Soybean Seed Composition and Quality

39

Roder, W., Mason, S. C., Clegg, M. D. & Kniep, K. R. (1989). Crop root distribution as influenced by grain sorghum-soybean rotation and fertilization. Soil Sci. Soc. Am. J., 53, 1464-1470. Rotundo, J. L., Borra, L., Westgate, M. E. & Orf, J. H. (2009). Relationship between assimilate supply per seed during seed filling and soybean seed composition. Field Crop. Res., 112, 90-96. Rotundo, J. L. & Westgate, M. E. (2009). Meta-analysis of environmental effects on soybean seed composition. Field Crop. Res., 110, 147-156. Roy, K. W. (1976). The mycoflora of soybean reproductive structures. Ph.D. thesis, Purdue University, West Lafayette, Indiana. 255 [cited by Abney, T. S. & Ploper, L. D. (1988). Seed diseases. In: Soybean diseases of the north central region (T. D. Wylie, & D. H. Scott, (Eds.), 3-6. APS Press, St. Paul MN, USA. Roy, K. W., Keith, B. C. & Andrews, C. H. (1994a). Resistance of hardseeded soybean lines to seed infection by Phomopsis, other fungi, and soybean mosaic virus. Can. J. Plant Pathol., 16, 122-128. Roy, K. W., Miller, W. A. & McLean, K. S. (1994b). Survey of pathogenic genera of fungi on foliage of weeds in Mississippi. Can. J. Plant Pathol., 16, 25-29. Rozenfeld, P., Docena, G. H., Anon, M. C. & Fossati, C. A. (2002). Detection and identification of a soy protein component that cross reacts with caseins from cow‘s milk. Clin. Exp. Immunol., 130, 49-58. Ryley (2004). Effects of some diseases on the quality of culinary soybean seed. http://www.docstoc.com/docs/32751896/Influence-of-diseases-on-the-quality-ofsoybean-seed Verified (4/11/2010). Samarah, N. H., Mullen, R. E. & Anderson, I. (2009). Soluble sugar contents, germination, and vigor of soybean seeds in response to drought stress. J. New Seeds, 10, 2, 63-73. Savoy, B. R., Cothran, J. T. & Shumway, C. R. (1992). Early-season production systems utilizing indeterminate soybean. Agron. J., 84, 394-398. Schlueter, J. A., Vasylenko-Sanders, I. F., Deshpande, S., Yi, J., Siegfried, M., Roe, B. A., Schlueter, S. D., Scheffler, B. E. & Shoemaker, R. C. (2007). The FAD2 gene family of soybean: Insights into the structural and functional divergence of a paleopolyploid genome. Crop Sci., 47, S14-S26. Schnebly, S. R. & Fehr, W. R. (1993). Effect of years and planting dates on fatty acid composition of soybean genotypes. Crop Sci., 33, 716-719. Schnebly, S. R., Fehr, W. R., Welke, G. A., Hammond, E. G. & Duvick, D. N. (1994). Inheritance of reduced and elevated palmitate in mutant lines of soybean. Crop Sci., 34, 829-833. Scherder, C. W. & Fehr, W. R. (2008). Agronomic and seed characteristics of soybean lines with increased oleate content. Crop Sci., 48, 1755-1758. Sexton, P. J., Naeve, S. L., Paek, N. C. & Shibles, R. (1998). Sulfur availability, cotyledon nitrogen:sulfur ratio, and relative abundance of seed storage proteins of soybean. Crop Sci., 38, 983-986. Simopoulos, A. P. (2004). Omega-6/omega-3 essential fatty acid ratio and chronic diseases. Food Rev. Int., 20, 77-90. Sinclair, J. B. (1999). Diaporthe-Phomopsis complex. In: Compendium of soybean diseases, 4th ed., G. L. Hartman, J. B. Sinclair, & J. C. Rupe, (Eds.), Pages 31-32. American Phytopathological Society Press, St. Paul, MN.

40

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Slack, C. R. & Roughan, P. G. (1978). Rapid temperature induced changes in the fatty acid composition of certain lipids in developing linseed and soya-bean cotyledons. Biochem. J., 170, 437-439. Smith, G. S. & Carvil, O. N. (1997). Field screening of commercial and experimental soybean cultivars for their reaction to Macrophomina phaseolina. Plant Dis., 81, 363-368. Smith, G. S. & Wyllie, T. D. (1999). Charcoal rot. In: Compendium of soybean disease, 4th ed, G. L., Hartman, J. B. Sinclair, & J. C. Rupe, (Eds.), 29-31. American Phytopathological Society, St. Paul, M. N. Smith, J. R., Mengistu, A., Nelson, R. L. & Paris, R. L. (2008). Identification of soybean accessions with high germinability in high-temperature environments. Crop Sci., 48, 2279-2288. Smith, J. R., Mengistu, A., Nelson, R. L. & Paris, R. L. (2008). Identification of soybean accessions with high germinability in high-temperature environments. Crop Sci., 48, 2279-2288. Spaeth, S. C. & Sinclair, T. R. (1984). Soybean seed growth. II: Individual seed mass and component compensation. Agron. J., 76, 128-133. Specht, J. E., Chase, K., Macrander, M., Graef, G. L., Chung, J., Markwell, J. P., Orf, H. H. & Lark, K. G. (2001). Soybean response to water: a QTL analysis of drought tolerance. Crop Sci., 41, 493-509. Staton, M., Thelen, K. & Bohner, H. (2009). Early-planted soybeans-benefits, risks and recommendations. Soybean facts. Michigan State Univ. Extension. Stojsin, D., Ablett, G. R., Luzzi, B. M. & Tanner, J. W. (1998). Use of gene substitution values to quantify partial dominance in low palmitic acid soybean. Crop Sci., 38, 14371441. Stoltzfus, D. L., Fehr, W. R., Welke, G. A., Hammond, E. G. & Cianzio, S. R. (2000a). A fap7 allele for elevated palmitate in soybean. Crop Sci., 40, 1538-1542. Stoltzfus, D. L., Fehr, W. R., Welke, G. A., Hammond, E. G. & Cianzio, S. R. (2000b). A fap5 allele for elevated palmitate in soybean. Crop Sci., 40, 647-650. Takahashi, M., Uematsu, Y., Kashiwaba, K., Yagasaki, K., Hajika, M. & Matsunaga, R. (2003). Accumulation of high levels of free amino acids in soybean seeds through integration of mutations conferring seed protein deficiency. Planta, 217, 577-586. Tang, G. Q., Novitzky, W. P., Griffin, H. C., Huber, S. C. & Dewey, R. E. (2005). Oleate desaturase enzymes of soybean: Evidence of regulation through differential stability and phosphorylation. Plant J., 44, 433-446. Taylor, O. (1999). ESPS method moves north. Soybean Dig., 59, 26-28. TeKrony, D. M., Egli, D. B. & Balles, J. (1980). The effects of the field production environment on soybean seed quality. In: Seed Production, P. D. Hebblewaite, (Ed.), 403-425. London: Butterworth and Co., Ltd. TeKrony, D. M., Egli, D. B., Balles, J., Tomes, L. & Stuckey, R. E. (1984). Effect of date of harvest maturity on soybean seed quality and Phomopsis. sp. seed information. Crop Sci., 24, 189-193. TeKrony, D. M., Grabau, L. J., DeLacy, M. & Kane, M. (1996). Early planting of earlymaturing soybean: Effects on seed germination and Phomopsis infection. Agron. J., 88, 428-433. Temperly, R. T. & Borges, R. (2006). Tillage and crop rotation impact on soybean grain yield and composition. Agron. J., 98, 999-1004.

Soybean Seed Composition and Quality

41

Tezuka, M., Taira, H., Igarashi, Y., Yagasaki, K. & Ono, T. (2000). Properties of tofus and soy milks prepared from soybeans having different subunits of glycinin. J. Agric. Food Chem., 48, 1111-1117. Tezuka, M., Yagasaki, K. & Ono, T. (2004). Changes in characters of soybean glycinin groups I, IIa, and IIb caused by heating. J. Agric. Food Chem., 52, 1693-1699. Vollmann, J., Fritz, C. N., Wagentrist, H. & Ruckenbauer, P. (2000). Environmental and genetic variation of soybean seed protein content under Central European growing conditions. J. Sci. Food Agric., 80, 1300-1306. Wallen, V. R. & Seaman, W. L. (1963). Seed infection of soybean by Diaporthe phaseolorum and its influence on host development. Can. J. Bot., 41, 13-21. Warner, K. (2009). Oxidative and flavor stability of tortilla chips fried in expeller pressed low linolenic acid soybean oil. J. Food Lipids, 16, 133-147. Wilcox, J. R. & Cavins, J. F. (1990). Registration of C1726 and C1727 soybean germplasm with altered levels of palmitic acid. Crop Sci., 30, 240. Wilcox, J. R. & Cavins, J. F. (1992). Normal and low linolenic acid soybean strains: Response to planting date. Crop Sci., 32, 1248-1251. Wilcox , J. R. & Cavins, J. F. (1995). Backcrossing high seed protein to a soybean cultivar. Crop Sci., 35, 1036-1041. Wilcox, J. R. & Frankenberger, E. M. (1987). Indeterminate and determinate soybean responses to planting date. Agron. J., 79, 1074-1078. Wilcox, J. R., Laviolette, F. A. & Athow, K. L. (1974). Deterioration of soybean seed quality associated with delayed harvest. Plant Dis. Rep., 58, 130-133. Wilcox, J. R., Nickell, A. D. & Cavins, J. F. (1993). Relationships between the fan allele and agronomic traits in soybean. Crop Sci., 33, 87-89. Wilcox, J. R. & Shibles, R. M. (2001). Interrelationships among seed quality attributes in soybean. Crop Sci., 41, 11-14. Wilson, D. O., Roswell, F. C., Ohki, K., Parker, M. B., Shuman, L. M. & Jellum, M. D. (1982). Changes in soybean seed oil and protein as influenced by manganese nutrition. Crop Sci., 22, 948-952. Wilson, L. A. (1995). Soy Foods. In: Practical handbook of soybean processing and utilization, D. R. Erickson, (Ed.), 428 - 459. AOCS Press, Champaign, IL and United Soybean Board, St. Louis, MO. Wilson, R. F. (2004). Seed composition. In: Soybeans: Improvement, production, and uses. 3rd edition, H. R. Boerma, & J. E. Specht, (Eds.), 621-669. ASA Monogr. 16. ASA, Madison, WI. Wilson, R. F., Novitzky, W. P. & Fenner, G. P. (1995). Effect of fungal damage on seed composition and quality of soybeans. JOACS, 72, 1425-1429. Wolf, R. B., Cavins, J. F., Kleiman, R. & Black, L. T. (1982). Effect of temperature on soybean seed constituents: Oil, protein, moisture, fatty-acids, amino-acids, and sugars. J. Am. Oil Chem. Soc., 59, 230-232. Wrather, J. A. (1995). Soybean disease loss estimates for the southern United States, 1974 to 1994. Plant Dis., 79, 1076-1079. Wrather, J. A., Kendig, S. R., Wiebold, W. J. & Riggs, R. D. (1996). Cultivar and planting date effects on soybean stand, yield, and Phomopsis sp. seed infection. Plant Dis., 80, 622-624.

42

Nacer Bellaloui, Krishna N. Reddy, H. Arnold Bruns et al.

Wrather, J. A., Sleper, D. A., Stevens, W. E., Shannon, J. G. & Wilson, R. F. (2003). Planting date and cultivar effects on soybean yield, seed quality, and Phomopsis sp. seed infection. Plant Dis., 87, 529-532. Wyllie, T. D. (1976). Macrophomina phaseolina. Charcoal rot. In: World soybean research: Proceedings of the world soybean research conference, L. D. Hill, (Ed.), 482-484. Danville, IL: Interstate Printers and Publishers Inc. Wyllie, T. D. (1988). Charcoal rot of soybean: Current status. In: Soybean diseases of the North Central region, T. D. Wyllie, & D. H. Scott, (Eds.), 106-113. American Phytopathological Society, St. Paul, MN. Yagasaki, K., Takagi, T., Sakai, M. & Kitamura, K. (1997). Biochemical characterization of soybean protein consisting of different subunits of glycinin. J. Agric. Food Chem., 45, 656-660. Yaklich, R. W., Vinyard, B., Camp, M. & Douglass, S. (2002). Analysis of seed protein and oil from soybean northern and southern region uniform tests. Crop Sci., 42, 1504-1515. Yamauchi, F., Yamagishi, T. & Iwabuchi, S. (1991). Molecular understanding of heat induced phenomena of soybean proteins. Food Rev. Int., 7, 283-322. Yang, X. B. (2009). Early planting and soybean disease considerations. Integrated Crop Management News [Online] http:// www. extension. iastate. edu/ CropNews/ 2009/ 0421yang.htm Verified (6/11/2010) Yu, K., Poysa, V., Haffner, M., Zhang, B. & Woodrow, L. (2005). Absence of the A4 peptide in the glycinin subunit of soybean cultivar Enrei is caused by a point mutation in the Gy4 gene. Genet. Mol. Biol., 28, 440-443. Zablotowicz, R. M. & Reddy, K. N. (2007). Nitrogenase activity, nitrogen content, and yield responses to glyphosate in glyphosate-resistant soybean. Crop Prot., 26, 370-376. Zhang, M., Kang, M. S., Reese, P. F. & Bhardwaj, H. L. (2005). Soybean cultivar evaluation via GGE biplot analysis. J. New Seeds, 7, 37-50. Zobiole, L. H. S., Oliveira Jr., R. S., Kremer, R. J., Muniz, A. S. & Oliveira Jr., A. (2010a). Nutrient accumulation and photosynthesis in glyphosate resistant soybeans is reduced under glyphosate use. J. Plant Nutr., in press. Zobiole, L. H. S., Oliveira Jr., R. S., Visentainer, J. V., Kremer, R. J., Bellaloui, N. & Yamada, T. (2010)b. Glyphosate affects seed composition in glyphosate-resistant soybean. J. Agric. Food Chem., 58, 4517-4522. Zong-ya, T., Qi, Z. & Bing-song, C. (1991). Effect of low temperature during imbibition on ultrastructure in hypocptyls. Acta Botanica. Sinica, 33, 511-515.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 2

SOY FOOD IN DEMAND: A PRESENT AND FUTURE PERSPECTIVE M.K.Tripathi* and S.Mangaraj Soybean Processing and Utilization Centre CIAE (ICAR), Nabi Bagh, Baresia Road, Bhopal M.P-462 038, India

SOYBEAN HISTORY The soybean is widely believed to have originated 4000-5000 years ago in the north and central regions of China (Liu 1997a). Historically, soybeans have played an important part in Asian culture, both as a food and as a medicine (Messina 1995). Soybeans have been consumed throughout Asia for more than 1000 years in a variety of traditional soy food products. Asian countries still utilize soybeans largely for traditional soy food production. In 1999, Asian countries accounted for nearly half of the 23 million tons of soybeans exported by the U.S. traditional soy foods, those foods prepared from whole soybeans, are typically divided into two categories: nonfermented and fermented. Traditional nonfermented soy foods include fresh green soybeans, whole dry soybeans, soy nuts, soy sprouts, whole-fat soy flour, soymilk, tofu, okara, and yuba. Fresh green soybeans and whole dried soybeans are prepared and consumed in much the same fashion as Western bean dishes, eaten plainly or serving as additions to soups and stews. In addition to the drying of soybeans to create whole dried varieties, dry roasting may also be employed to create a crunchier product known as a soy nut. Soy nuts can be eaten whole as a snack food, or used in food applications similar to dry roasted peanuts. Soy sprouts, prepared by the soaking, washing, and sprouting of soybeans, are consumed as a vegetable throughout the year in many Asian countries, and are used in soups, salads, and side dishes. Whole-fat soy flour, prepared from the grinding of whole dried soybeans, is used in bakery applications in the place of milk powder applications or as a substitute for whole-wheat flour. Preparations of soymilk, tofu, okara, and yuba begin with the soaking of whole soybeans, followed by rinsing, grinding, and filtering. The insoluble residue at this point is called okara, it can be used in the making of a dish, salted as *

Corresponding author: Email= [email protected]

44

M.K.Tripathi and S.Mangaraj

a pickle, or fermented in the production of tempeh. Further processing of the filtered soybean liquid includes cooking to yield soymilk. Tofu is made from the further processing of soymilk in which different coagulants are added to precipitate the protein from the soymilk. Traditional fermented soy foods include tempeh, miso, soy sauces, natto, and fermented tofu (sufu) and soymilk products. Tempeh is a product produced from the fermentation of dehulled, boiled soybeans by Rhizopus oligosporus. The process of fermentation yields a cake like product with a clean yeasty odor. Tempeh is usually served as meat substitute that, when sliced and deep-fried, has a nutty flavor, pleasant aroma, and crunchy texture (Liu 1997c). Miso is the Japanese term used for bean paste and refers to fermented paste like products. Miso production begins with making a starter culture, or koji, which consists of a cereal (rice, barley, or soybeans) which, is soaked, cooked, cooled, and inoculated with a mixture of strains of Aspergillus orzae and Aspergillus soyae. Soy sauce is a salty, sharp tasting, darkbrown liquid extracted from fermented mixture of soybeans and wheat. Natto is a sweet, aromatic product made from the fermentation whole soybeans with Bacillus natto. A number of traditional fermented soy food products also exist that are made from the fermentation of tofu and soymilk. Sufu, or Chinese cheese, is produced by the fermentation of fresh tofu by fungi, such as Mucor hiemalis or Actinomucor elegans. Soymilk is used to produce soybean yogurt, which is similar to western dairy yogurt, and is basically a mixture of soymilk, whey, and sucrose that has been cooked and cooled and inoculated with Lactcoccus acidophilus (Liu 1997d). Although soybeans were introduced to Europe in the 1700s, little interest developed until the early 1900s, primarily because of the plants inferior flavor quality compared to the native oil and meal products. Soybeans were introduced to the Eastern United States (U.S.) in the late 1800‘s with production spreading to the Midwest by 1920. Through the early 1930s, soybeans were grown primarily as a pasture and forage crop. However, by 1947, 85% of the crop was harvested for seed processing in the production of oil. As demand increased, markets developed for soybean oil and later for the high-quality soybean meal used as a protein source for animal feeds. Soybeans contain about 40 % fat (Messina 1997) and oil from soybeans is the world‘s leading vegetable oil and accounts for well over half the fats and oils going into food products in the U.S. The bulk of the soybean oil produced is consumed as salad oil. Industrial applications for soybean oil also exist and include soap manufacture, paints, resins, and drying oil products (Orthoefer 1978). The major uses domestically are cooking and salad oils, shortening, and margarine (Scott and Aldrich 1983).

SOYBEAN Seeds of soybean (Glycine max (L.) Men'.) have been used in Asia for many centuries to prepare a variety of fresh, fermented and dried foods (Probst and Judd, 1973). Based on historical and geographical evidence, Hymowitz (1970) concluded that soybean was domesticated in the 11th century B.C. in northern China. To locate the likely point of origin, the similarity between soybean and Glycine soja, its nearest wild relative, was investigated with a survey of land races throughout China. The two species were most similar in seed protein content, frequency of Tia (trypsin inhibitor) alleles and flowering date at 35°N latitude (Xu et al., 1989). They concluded that, the Yellow River Valley, which is the

Soy Food in Demand

45

birthplace of ancient Chinese civilization, was the probable place of origin. From there, it spread into southern China and east through Korea into Japan.

SEED CHARACTERISTICS Because protein meal and oil are the two commodities produced from grain-type soybeans, increasing both protein and oil concentration in seeds are breeding goals. Most research in recent years has been directed at protein concentration (Wilcox and Cavins, 1995). But protein and oil are negatively correlated, so there is the difficulty that increasing one usually results in a decrease in the other (Brim and Burton, 1979). Index selection has been used to simultaneously increase both (Burton, 1991). About 10% of soybean oil is the polyunsaturated fatty acid linolenic acid and another 10% is the saturated fatty acid palmitic acid. Soybean oil for food uses would be improved if both were reduced. Linolenic acid is subject to autooxidation, which gives the oil an undesirable odor and flavor (Chang et al., 1983). Palmitic acid is implicated as a contributor to coronary heart disease (Willett, 1994). Thus, reduction of palmitic acid should make soybean oil more healthful. Germplasms have been developed through mutagenesis and/or recombination, which decrease one, or the other and the traits are being bred into high yielding cultivars (Wilcox et al., 1994). Also of some interest are mutants which increase the saturated fatty acids, palmitic and stearic. Soy protein is low in the sulfur amino acids, methionine and cystine. These amino acids are routinely added to soy protein animal feeds to meet dietary requirements. Efforts to increase cystine and methionine in soy protein have been primarily aimed at increasing the concentration of protein subunits, which are known to have higher levels of the two amino acids (Burton, 1984).

COMPOSITION OF SOYBEANS Soybeans (Glycine max) are classified as oil seeds, not as dry beans. Whole dry soybeans contain about 40% protein and up to 20% fat. Soybean is a good source of calcium, iron, zinc, phosphorus, magnesium, thiamin, riboflavin, niacin and folacin. It was recently recognized that the human diet contains, in addition to essential macro and micronutrients, a complex array of naturally occurring bioactive nonnutrients called phytochemicals, significant in longterm health benefits (Setchell, 1998). Among these phytochemicals is the broad class of nonsteroidal estrogens called phytoestrogens. The major classes of phytoestrogens that are of interest from a nutritional and health perspective are the lignans and the isoflavones. Soybeans contain large amounts of the isoflavones diadzein, genistein a glycitein (1-3 mg/g) and their acetyl and malonyl conjugates (Song et al, 1998). Studies have shown that concentration and composition vary in different soybeans or soy protein products (Murphy, 1982) and that this variation is due to species differences (Franke et al, 1995), geographic and environmental conditions and the extent of the industrial processing of soybeans ( Coward et al, 1998). Soybean is composed of macronutrients such as lipids, carbohydrates and proteins. Soybean lipids, which are deprived of cholesterol, contain about 15% of saturated fat, 61% of

46

M.K.Tripathi and S.Mangaraj

polyunsaturated fat, and 24% of monounsaturated fat (USDA, 1979). Carbohydrates make up about 30% of the seed, with 15% being soluble carbohydrates (sucrose, raffinose, stachyose) and 15% insoluble carbohydrates (dietary fiber). The protein content of soybean varies from 36% to 46% depending on the variety (Garcia et al., 1997). Storage proteins are predominant, such as the 7S globulin (-conglycinin) and 11S globulin (glycinin), which represent about 80% of total protein content, as well as less abundant storage proteins such as 2S, 9S, and 15S globulins (Garcia et al., 1997). Interestingly, beta-conglycinin but not glycinin is capable of improving serum lipid profiles in mice and humans, in the absence of phytoestrogens (Kohno et al., 2006). Soybean also contains micronutriments, which include isoflavones, phytate, soyaponins, phytosterol, vitamins and minerals. Although beneficial effects of micronutriments such as saponins and phytosterols on cholesterol levels and absorption have been reported (Lukaczer et al., 2006), there is an increasing body of literature suggesting that isoflavones may additionally have a beneficial role in lipid and glucose metabolism. Soybeans are the most abundant source of isoflavones in food. Abiotic and biotic stresses such as variation in temperature, drought or nutritional status, pest attack or light conditions may modify isoflavone content and composition. As a consequence, total isoflavone content may vary up to 3-fold with growth of the same soy cultivar in different geographical areas and years (Wang and Murphy, 1994).

IMPORTANT HEALTH RELATED SOY CONSTITUENTS Protease Inhibitors Two prominent protease inhibitors from soybeans are Bowman-Birk inhibitor (BBI) and Kunitz-Trypsin inhibitor (KTI) are reported. BBI is a 71-residue inhibitor which has two independent inhibitory sites involving binding with the proteases, trypsin and chymotrypsin (Hatano et al., 1996) BBI has been found to inhibit expression of certain oncogenes in irradiated animal models (St Clair WH and St Clair DK. 1991) as well as inhibiting chemically induced carcinogenesis (St Clair et al.,1990). Both in vitro and in vivo animal models have demonstrated that BBI appears to exert its effects directly on the target organ rather than by a non-specific effect on metabolism.Some researchers have theorized the dietary intake of exogenous PIs indirectly increases endogenous PI formation (Oreffo et al., 1991).Other researchers have questioned the concept that PIs contribute significantly to the anti-cancer effects of soy(Schelp and Pongpaew 1988). This is due, in part, to the fact that both raw and cooked soy products are equally effective in reducing cancer incidence, even though heating virually destroys all protease activity. Another reason for skepticism is that ingested PIs (such as purified BBI) are very poorly absorbed from the digestive tract (Clawson 1996). Some researchers have postulated the formation of these protease: protease inhibitor complexes might interfere with protein absorption, offering some cancer protection (epidemiological studies indicate high fat and high protein diets increase cancer risk).Protease inhibitors in soy products have been implicated in pancreatic hypertrophy and hyperplasia in animal models(Kennedy 1995). Whether it is the protease inhibitors and whether this hyperplasia contributes to increased rates of pancreatic cancer in these animals is still a subject of debate.

Soy Food in Demand

47

Lignans: Lignans are capable of exerting a phytoestrogenic effect in humans. In addition, they exhibit anti-tumor and antiviral activity. The most prevalent lignans in mammals are enterolactone and enterodiol, formed by gut bacteria, from the plant precursor lignans, matairesinol and secoisolariciresinol, respectively. Oil seeds, such as flaxseed, contain about 100 times the lignan content of other plants. Other sources of lignans in decending order of importance are dried seaweed, whole legumes (including soy), cereal bran, legume hulls, whole grain cereals, vegetables, and fruit.1 Gender differences is urinary lignan excretion have been observed, with men excreting more enterolactone and less enterodiol than women. The researchers felt this implied a difference in colonic bacterial metabolism of lignans between the genders (Adlercreutz 1997). Phytosterols: Phytosterols, such as ßsitosterol, are found in high concentrations in soy products. Although poorly absorbed, they bind cholesterol in the gut.Dietary content of phytosterols differs widely among populations. The typical Western diet contains about 80 mg/day, while the traditional Japanese diet contains approximately 400 mg/day( Nair et.,1984). Coumestans: The phytoestrogen, coumesterol, as well as other coumestan isoflavonoids, have been found by some researchers in significant quantities in soy foods of all types, including soybeans, soy flour, soy flakes, isolated soy protein, tofu, soy drinks, and soy sprouts.On the other hand, Adlercreutz ( 1997) reports its presence only in soy sprouts.The most abundant source is mung bean sprouts. It is also found in significant quantities in other members of the Leguminosiae family, including Trifolium and Medicago spp. Saponins: Saponins are distributed widely in the plant kingdom, including in soybeans. They appear to have anti-cancer properties by virtue of their antioxidant and anti-mutagenic properties.They also bind cholesterol and bile acids in the gut (Elias et al., 1990).An invitro study demonstrated saponins isolated from soybeans exhibited potent antiviral effects on the HIV virus. Saponin B1completely inhibited HIV-induced cytopathic changes and virusspecific antigen expression within six days after infection. Saponin B2 exhibited similar, although less potent, effects. Phytates: Although phytic acid (inositol hexaphosphate) has been implicated in blocking the absorption of minerals, the phytate content of plants, including soy, seems to be responsible for some of the anti-cancer properties of vegetable-based foods. Phytic acid is a highly charged antioxidant, capable of scavenging hydroxyl radicals and chelating metal ions such as the pro-oxidant, iron. Graf and Eaton reported the iron-chelating ability of phytate to be more important than the fiber in dietary colon cancer prevention.Vucenik et al reported anti-tumor effects of phytic acid both in vitro and in animal models.Phytates also appear to enhance natural killer cell activity.

48

M.K.Tripathi and S.Mangaraj Table 1. Biochemical role of different soy constituents

S.No. 1. 2.

Components Protease Inhibitors (Bowman-Birk inhibitor, Kunitz-Trypsin inhibitor) Lignans

3. 4. 5. 6.

Phytosterols (-sitosterol) Coumestans (coumesterol) Saponins Phytates

7.

Isoflavones

8.

Lectin

9.

Phytic acid

Biochemical role -Inhibits chemically induced arcinogenesis, switch of oncogene expression - Phytoestrogenic effect, antiviral agent,antitumer agent -Binds cholesterol in the gut - Phytoestrogenic role - Antiviral (HIV) agent,antioxidant - Metal chelating agent, enhance natural killer activit,antioxidant -Antioxidant,phytoestrogen role,antiinflammatory,anti-mutagenic,antihypertensive Activates lymphocytes( T), destroy cancerous cell Anticancerous agent

SUMMARY OF SOY CONSTITUENTS AND THEIR FUNCTIONS Soy and Functional Foods Recently, the food industry has seen expansive growth in what is known as ―functional food‖. Recent growth of functional foods far outpace that of conventional foods and supplements, and has attracted the interests of both consumers and food producers (Locklear 1999). Functional foods can be defined as food that exerts a beneficial health effect beyond the recognized traditional nutritional value of such a food. Two major groups of functional foods are categories as; 1). Potential functional foods (those with the potential for use in human nutrition) 2). Established functional foods (those with proven benefits in human nutrition) Riaz (2001) categorized soybeans and soy products as established functional foods. As previously mentioned, soy foods have been consumed for centuries among Asian populations. It is not until recently that the Western world has seen an increased popularity in soy foods due to a unique and favorable cultural context (Levington 1987). Levington (1987) observed eight factors that have helped bring acceptance and retail success for soy foods and a foundation for continued market existence. The first observation was the fact that the aging Baby Boom population has welcomed and propelled the natural foods industry as the supportive context for soy foods. The next observation was the growth of the natural foods industry itself and the emergence of pioneered ―nutrition centers‖ within supermarkets. The third observation by Levington (1987) was the entrance of natural foods into mainstream markets as ―light‖, low-calorie, cholesterol-free has caught the interest of today‘s dieting and health conscious consumers. Fourth, the growing Asian population has influenced eating trends and founded an ethnic wave in prepared foods and restaurant fare. A fifth factor in the

Soy Food in Demand

49

recent growth in the soy foods market is a medical awareness and realization of the link between diet and disease. Sixth, the new found interest in gourmet cooking, exotic foods and new ―chic‖ foods has given rise to consumers searching for and uncovering new food like soy foods. Rising costs of living are seen as yet another factor in the rise in soy foods as people discover the comparatively inexpensive high quality protein soy foods offer. Although some soy products, especially analogs of meat, may not be cost comparative. Levingtons‘ eighth contributing factor was a summarization of the previous seven, and an observance of the fact that soy foods today are associated with being ―natural‖, ―organic‖,―wholesome‖, and ―simple‖. Functional foods include the subgroup nutraceuticals, which is defined as a substance considered a food or part of a food that provides medical or health benefits, including the prevention and treatment of disease (American Dietetic Association 1995). From 1995-1999 sales of nutraceuticals, had increased 28.5%, from $12.3 billion to $15.8 billion (Rogers 2001). Many foods made from soy, or those foods containing soy protein in various forms, carry the FDA soy protein health claim and fall into the category of nutraceuticals. Since the FDA approval of health claims associating soy protein with reduced risks of CHD, there has been much exploration into the development of new ways to include soy into established product formulations as well as new foods with soy (Berry 2000). In 2000, sales of soy products topped $161 million, with a majority of sales coming from mainstream retail grocery stores rather than natural foods outlets. Soy represents a considerable market with high margins and growth rates, educated customers, premium pricing, and a healthy food platform. While there are many acceptable soy products for health conscious consumers such as soy milk and soy ice cream, these products have not been accepted by other consumer groups, such as those that consume traditional dairy products (Berry, 2002).Additionally there exists consumer objection to soy products due to their characteristic ―beany‖ taste. An approach to overcoming this hurdle while still reaching customers with products containing soy is to use soy protein as an ingredient for fortification rather than a base for functional and nutraceutical food products (Berry 2000). Though few nutraceutical food producers offer dairy products fortified with soy protein, the idea is not new. In fact, a model category of nutraceutical foods that has seen tremendous growth is fortified beverages (Theodore 2001). Fortified, value-added beverages are thought to have the potential to be $2 billion market category. While new products continue to enter the market, many functional and nutraceutical products have existed on the market for years, though not recognized for their health benefits until recently (Hilliam, 1998). An example of this is milk, which is arguably the first functional/nutraceutical beverage, being one of the most commonly fortified foods over the years (Berry 2000). With constant media reminders aligning soy protein intake with good health, dairy food consumers are in search of ways to add soy protein into their diets. Dairy foods represent ideal carriers for soy protein (Berry, 2002).

Soybean: Nutritionally Balanced Diets The major aim of nutritional and medical sciences is to encourage and promote the consumption of nutritionally balanced diets: balanced diets in terms of total protein, amino acid pattern, fat, carbohydrate, fiber, vitamins, minerals, and total calories. Health professionals have at their dances (RDA) and requirements published by the U National

50

M.K.Tripathi and S.Mangaraj

Academy of Science and the World Health Organization (WHO,1985). In addition, the US Department of Agriculture (USDA) has published seven bulletins to cornplernent and helps implement the USDA dietary guidelines (USDA,1986). The guidelines are as: 1). 2). 3). 4). 5). 6). 7). 8).

Eat a variety of foods Maintain desirable weight Avoid too much fat Avoid saturated fatty acids and cholesterol Eat foods with adequate starch and fiber Avoid too much sugar Avoid too much sodium; and If you drink alcoholic beverages, do so in moderation.

One desirable way to alter typical American diet patterns to meet the above dietary recommendations involves partial replacement of foods of animal origin with cereals and legumes. Moderate substitutions of cereals and legumes in the diet can improve nutritional status with regard to desirable weight, total fat, saturated fatty acids, cholesterol, starch, and fiber, i.e. most of the USDA dietary recommendations for Americans. Soy-protein foods fit well into a modified diet. Soy foods contain a good amino acid profile, an array of minerals and vitamins, and in full-fat products a high polyunsaturated fatty acid content. The amino acid profile of soy protein is unusually well rounded for a plant protein. Comparison of a vanity of soy proteins with ideal patterns published by the Food and Nutrition Board or the Food and agriculture Organization demonstrates adequate quantities of the essential amino acids histidine, isoleucine, leucine, lysine, phenylalanine plus tyrosine, threonine, tryptophan, and valine. Only the combined amount of the essential sulfur amino acids methionine plus cystine fall below recommended patterns in most soy proteins. Lysine concentration is particularly high in soy protein. Its abundance in this inexpensive legume thrusts soy protein into the forefront of protein nutriture worldwide. Lysine is limiting in most staple sources of plant protein consumed in areas where protein malnutrition is found. Complementation of cereals, such as rice, wheat or corn, with soy protein improves protein status. Excellent reviews of the protein quality of various soy products for human nutrition were published by Torun et al (1981) and Scrimshaw and Young (1979). Research in the protein quality area has focused upon the utilization of various types of soy protein for adults, children, and full-term and premature infants. The use of soy protein as the sole source of protein has been investigated in many studies. Rat bioassays, such as the protein efficiency ratio (PER), generally underestimate the protein quality of soy protein for humans (Bodwel,1979) because the rat has higher relative amino acid requirements for the sulfur amino acids methionine and cystine, the limiting amino acids of soy protein. A number of human studies published over the last 15 year investigated protein quality of soy products for adults, children, and infants. Many have tested soy concentrate or soy isolate as the sole source of dietary protein. Kies and Fox (Kies and Fox ,1971) compared nitrogen balance of adults consuming textured soy protein, with and without methionine supplementation, and ground beef. For full-term infants it is generally accepted that modern soy-protein-based infant formulas promote growth to the same extent as do cow-milk-based formulas (Brady et al.,1986). In addition, soy formulas may be less allergenic than cow milk. Special problems exist with preterm infants. Premature infants with low gestational age and weight expenence relative malabsorption of lactose and

Soy Food in Demand

51

fats secondary to immaturity. Soy-protein-based formulas offer the benefit of being lactose free and providing digestible fat. However, soy-based formula may not be the ideal protein source for these infants. Naude et al (1979) found infants weight gain and depressed serum albumin in soy/ vs milk-fed infants of very low birth weight after 32-35 d feeding. Brady et al (1986) noted that recent advances in the knowledge of nutritional requirements of preterm infants have led to modifications in formula to contain more protein than contained in human milk and standard infant formulas. Common preterm formulas contain demineralized whey with a 0:40 whey-to-casein ratios. Whey contains more cystine and less methionine than casein does and appears to be more suitable for the immature infant .It can be concluded that, except for premature infants, soy protein can serve as a sole protein source in the human diet. Methionine supplementation may be warranted in infant formula (Ausman et al,1986); however, it is not needed in the mixed diets of children and adults. This conclusion is based on the assumption that the soy protein is adequately processed. Heat processing of soy protein is necessary for optimizing digestibility of the protein and reducing heat-labile protein inhibitors. Digestibility of protein refers to the ability of man or animal to hydrolyze proteins with stomach acid and proteolytic enzymes to yield small peptides and free amino acids. Essentially all food proteins, especially plant proteins, require some heat treatment to denature the protein sufficiently to allow an adequate enzyme cleavage and digestion. Digestibility can be measured in man by feeding known quantities of protein and measuring fecal losses of. After adjustment for normal turnover of protein in the intestine, a percent digestibility can be estimated. For adequately processed soy-protein products, true digestibility of 92-100% can be expected (Bodwell et al., 1986). In one study (Wayler et al., 1983) young men were provided soy-protein isolate, beef, or three combinations of soy and beef as their protein source for lO-d metabolic balance periods. The digestibility of protein during all metabolic periods was found to be 98%, indicating equivalent digestibility of he soy protein isolate and beef. The above studies were all performed with adequately heatprocessed soy protein. As noted earlier, heat treatment partially denatures the protein and increases its digestibility. Overheating can result in oxidation of amino acids and can reduce protein quality; however, overheating can be controlled with adequate process control.

Glucose Tolerance There is a large difference in the degree of blood glucose elevation in normal and diabetic persons after ingestion of various foods with equal carbohydrate and caloric content. A number of factors affect serum glucose response to a food or meal. They include composition of the food, digestibility of the components of the food, presence of some forms of fiber in the food, physical form of the food (eg, raw vs cooked), and interaction of cornponents of the food (eg, starch-protein interactions). A great deal of the research efforts in this area has been focused upon the effects of different types of dietary fiber and type of starch on the glycemic response to a food or meal. Legumes were shown to be particularly useful in decreasing blood glucose responses compared with other high-fiber foods (Jenkins et al.,1981). The beneficial effects of legumes are thought to be derived from various components of the beans including their slow starch digestion and their fiber content. Unlike many Iegues soybeans do not contain significant quantities of starch. However, recent results suggest that soy holds promise for diabetics. Madar (1983), with streptozotocininduced diabetic rats, reported

52

M.K.Tripathi and S.Mangaraj

beneficial blood glucose affects of soybean fiber. Eizirik and Migliorini (Eizirik and Migliorini,1985) showed protective and restorative effects of high protein diets containing soy protein isolate versus casein against the diabetogenic action ofstreptozotocin-treated rats.

Caloric Reduction Substitution of soy protein for a protein source of animal origin can result in a reduction of calories (on an equal protein basis). Defatting full-fat soy flour reduced the caloric content of 100 g flour from 439 to 327 kcal . Soy-protein concentrates and isolates also contain 330kcal/100 g. These defatted products are ideal for extenders or replacements of meat products, which are considerably higher in caloric content when compared on an equivalent protein basis. For example, 100 g cooked all-beef hamburger contains ı-300 kcal and is ı-23% fat and 22% protein. A small, 20% replacement of beef with rehydrated soy concentrate results in a beef soy product with similar protein content but with a 9% reduction of calories (Miles et al., 1987). Additional calorie savings can be gained by using soy fiber supplementation in appropriate food systems. This can be achieved with a soybean hull fiber or cotyledon fiber source. Mineral bioavailability with an increased utilization of a specific food in the diet, consideration should be given to the effects that the food may have on the overall nutriture. This becomes a very important concern if that food provides a significant quantity of the calories of a diet or if that food replaces another that contributed important amounts of nutrients to the diet. As discussed earlier, soy protein products provide a good balance of nutrients, including minerals. Of concern, however, is the relative bioavailability of those minerals for humans. It is well recognized that minerals from cereals, Iegumes, and other plant foods in contrast to minerals from animal sources are generally poorly utilized by man and other monogastric animals (Forbes and Erdman 1986). In this regard soy and wheat are probably the most studied of the plant foods. The results from numerous publications demonstrate lower mineral bioavailability from these two food sources compared with animal protein sources.

Zinc Bioavailability Solomons (104) estimated from various dietary surveys that the average intake of Zn for different age groups range from 47% to 67% of the RDA. Thus, for this mineral, bioavailability is an important issue because consumption of foods containing highly available Zn is the key to adequate Zn nutriture. There are many published reports with experimental animals that point to a general poor bioavailability of Zn from soy-based foods . For example, collaborative efforts from the laboratories of Connie Weaver at Purdue University and this laboratory at the University of Illinois have utilized hydroponically grown soybean plants to study Zn bioavailability. In these studies 65Zn was added to the growth solution and the label was incorporated into the soybean and thus into the final soy-protein product. In one study (Stuart et al., 1986) the retention of 65Zn from a mixed soy and chicken test meal was midway between the retention values for the chicken meat and the soy meal. A second study (Ketelsen et al.,1984) demonstrated that Zn bioavailability is not low for all soyprotein products; Ketelsen et al showed that whole-body retention of 65 Zn in rats given

Soy Food in Demand

53

meals containing acid-precipitated soy-concentrate based meals was significantly higher than that for rats given meals based upon neutralized soy concentrate. Thus the type of food processing utilized in the preparation of soy products is not benign but affects mineral bioavailability from the final product. Thus, fortification of soy protein foods should overcome the lower bioavailability of the zinc endogenous to the soy. Finally, we investigated the interactions of phytic acid and Ca on Zn bioavailability from soy foods (Forbes et al.,1984 and Fordyce et al., 1987). Both the elevated dietary phytic acid (which is present in most soy products) and high dietary levels of Ca (in the presence of phytic acid) lower Zn bioavailability for rats. Phytate-Zn, phytate-Zn-Ca, or phytate-Zn-Ca-amino acid side-chain complexes are thought to form during the processing of soy-protein products or in the upper gastrointestinal tract during normal digestion of a soy-containing meal These complexes are poorly soluble, poorly digested, and poorly absorbed and may account for the low Zn bioavailability associated with high-phytate foods, such as soy and wheat. It should be noted that fermentation of soy to make tempeh and wheat during bread making hydrolyzes much of the phytate and enhances bioavailability . In an evaluation of refeeding marasmic children either cow milk or a soy-protein-based diet, Golden and Golden (1981) found less weight gain and lower plasma Zn in children fed the soy formula. In this study the diets were not fortified with Zn and the soy diet contained 25% less Zn than the cow-milk diet. Cossack and Prasad (1983) found that soy protein reduced absorption of extrinsically labeled 65Zn in adult humans. However, neither Solomons et al (1982) nor Sandstrom and Cederblad (1980) found an adverse effect of soy protein on cxtrinsic 65 Zn label absorption in humans. Bodwell et al (1983) found no change in serum Zn in girls (premenarcheal or postmenarcheal), menstruating women, or adult men fed soy-protein-extended ground beef daily for 6 month. When human ileostomy subjects were fed diets with 25% soy replacement of meat, rice, and bread protein, Sandstrom et al (1983) found no obvious effect upon apparent mineral absorption. However, when almost all of the protein was derived from soy, a negative apparent absorption of Zn was found. Further work by this group revealed that total replacement of meat in meals with soy protein resulted in a significantly lower absolute absorption of Zn in healthy human subjects (Sandstrom et al.,1987). This Swedish group then concluded ―the effect of soy protein on zinc absorption depends on the degree of replacement (for meat), the phytic acid and zinc content of the soy product and the protein content of the meal. The Committee on Nutrition, American Academy of Pediatrics (1983) in their examination of soy-protein formulas for children recognized (primarily from rat studies previously cited in this review) that Zn absorption appeared to be lower from soy formulas than from cow milk or human milk. This committee suggested that supplemental Zn absorption did not appear to be impaired, thus leading one to the conclusion that soy-based infant formulas should be fortified. They also stated that, ―The amount of phytic acid in these formulas and its effect on mineral and trace element availability needs to be more clearly delineated.‖ Young healthy adults were fed 65Zn extrinsically labeled meals containing human milk, cow milk, or one of a variety of cow-milk or soy formulas. Some formulas were fortified with phytate, Ca, or citrate. Phytate was found to have a strong inhibitory effect on Zn absorption; addition of phytate to cow-milk formula depressed whole-body 65 Zn absorption from 3 1% to 16%, similar to the absorption for soy formula (14%). These investigators concluded that the major factor responsible for the low absorption of Zn from soy formula was phytic acid. In addition, because their results showed that increasing the Zn concentration of soy formula (above that recommended and currently used) did not yield Zn

54

M.K.Tripathi and S.Mangaraj

absorption equivalent to that from human milk, these researchers suggested that reduction of phytate content of soy formulas by new technological processes may be preferable to increasing Zn supplementation. It was shown by Erdman, Fordyce, and Dickinson (unpublished observations, 1988) that reduction of phytic acid concentration in soy flour, which was accomplished by restriction of P during the growth of soybean plants, resulted in enhanced Zn bioavailability to rats. It is quite clear that Zn bioavailability is an issue of concern for soy products, especially for infant formulas, where they may be the sole source of nutrition for an infant. Manufacturers commonly fortify soy-based formulas with Zn (and with Fe, Ca, and other minerals) to adjust for the lower bioavailability. Phytate reduction by food-process technology, plant breeding, and growing practices or by bioengineering may also be advisable not only for its affect on Zn and perhaps other minerals but also because of the questionable bioavailability of P from phytic acid. For other soy foods Zn bioavailability is less of an issue unless that soy food contributes a large percentage of food calories or Zn to the dietary.

Iron Bioavailability Fe, like Zn, is poorly absorbed from legumes and cereals. Areas of the world that rely upon these foods as a staple part of the diet have the greatest prevalence of nutritional Fedeficiency anemia (I NAC, 1982). Fe deficiency is less common in areas where meat is commonly eaten. Not only does meat (meat, fish, and poultry) contain a portion of its Fe as heme Fe, which is much better absorbed than non heme Fe, but meat enhances the absorption of non heme Fe as well (Taylor et al.,1986). Soy protein per se has received considerable attention since the initial reports of Cook et al (1981) from the University of Kansas Medical Center showing an inhibitory effect of a variety of different types of soy-protein products on Fe absorption. In these studies adult males were provided a test meal containing one or more protein sources along with an extrinsic 59Fe or 55Fe label. A blood sample was taken 2 weak after the test meal and Fe absorption was calculated by evaluating the incorporation of the Fe label into red blood cells. These workers found that when soy protein replaced egg albumin, casein, or a portion of meat, Fe absorption dropped dramatically (Cook et al., 1981)); however, when 100 mg vitamin C was added to a soy-protein-containing meal, Fe absorption improved. Of practical concern with soy-extended meat are two factors: when soy replaces meat, highly available heme-Fe from meat is replaced with less available nonheme Fe from soy and, secondly, the soy nonheme Fe is known to be less well absorbed than some other sources of non heme Fe. As pointed out by Lynch et al (1985), the influence of soy protein on Fe balance is not entirely negative because the absolute quantity of nonheme Fe contributed to a meal by soy is usually high because most soy products contain considerable amounts of Fe. Lynch et al (1985) found another positive effect of soy: a higher proportion of the highly bioavailable heme Fe from a mixed meat and soy meal was absorbed when soy was included in the meal. Recently Lykken et al (Lykken et al.,1987) reported that Fe from soy hulls was highly bioavailable for humans and suggested that soy hulls would be an excellent source of Fe for bread enrichment. From the above it is easy to see that the prediction of the net Fe absorption from meals containing soy protein is extremely difficult. The soy-extended meat example points out the complexity of the factors that come into play to affect total Fe absorption from a meal.

Soy Food in Demand

55

Soy-Fiber-Enhanced Diets Soy fiber, whether derived from soybean hulls or from soybean cotyledons during the manufacture of soy concentrate and isolates, has only recently been studied in humans. Traditionally, soy fiber has been used almost exclusively for animal feed; only those persons consuming whole soybean products, such as tofu, ingested much soy fiber (Erdman and Weingartner ,1981).

Soy Protein Soy is the most widely used vegetable protein source. The soybean, from the legume family, was first chronicled in China in the year 2838 B.C. and was considered to be as valuable as wheat, barley, and rice as a nutritional staple. Soy‘s popularity spanned several other countries, but did not gain notoriety for its nutritional value in The United States until the 1920s. The American population consumes a relatively low intake of soy protein (5g · day-1) compared to Asian countries (Hasler, 2002). Although cultural differences may be partly responsible, the low protein quality rating from the PER scale may also have influenced protein consumption tendencies. However, when the more accurate PDCAAS scale is used, soy protein was reported to be equivalent to animal protein with a score of 1.0, the highest possible rating (Hasler, 2002). Soy‘s quality makes it a very attractive alternative for those seeking non-animal sources of protein in their diet and those who are lactose intolerant. Soy is a complete protein with a high concentration of BCAA‘s. There have been many reported benefits related to soy proteins relating to health and performance (including reducing plasma lipid profiles, increasing LDL-cholesterol oxidation and reducing blood pressure), however further research still needs to be performed on these claims.

Types of Soy Protein The soybean can be separated into three distinct categories; flour, concentrates, and isolates. Soy flour can be further divided into natural or full-fat (contains natural oils), defatted (oils removed), and lecithinated (lecithin added) forms. Of the three different categories of soy protein products, soy flour is the least refined form. It is commonly found in baked goods. Another product of soy flour is called textured soy flour. This is primarily used for processing as a meat extender. Soy concentrate was developed in the late 1960s and early 1970s and is made from defatted soybeans. While retaining most of the bean‘s protein content, concentrates do not contain as much soluble carbohydrates as flour, making it more palatable. Soy concentrate has a high digestibility and is found in nutrition bars, cereals, and yogurts. Isolates are the most refined soy protein product containing the greatest concentration of protein, but unlike flour and concentrates, contain no dietary fiber. Isolates originated around the 1950s in The United States. They are very digestible and easily introduced into foods such as sports drinks and health beverages as well as infant formulas.

56

M.K.Tripathi and S.Mangaraj

Nutritional Benefits of soy For centuries, soy has been part of a human diet. Epidemiologists were most likely the first to recognize soy‘s benefits to overall health when considering populations with a high intake of soy. These populations shared lower incidences in certain cancers, decreased cardiac conditions, and improvements in menopausal symptoms and osteoporosis in women (Hasler, 2002). Based upon a multitude of studies examining the health benefits of soy protein the American Heart Association issued a statement that recommended soy protein foods in a diet low in saturated fat and cholesterol to promote heart health (Erdman, 2000). The health benefits associated with soy protein are related to the physiologically active components that are part of soy, such as protease inhibitors, phytosterols, saponins, and isoflavones (Potter, 2000). These components have been noted to demonstrate lipid lowering effects, increase LDL-cholesterol oxidation, and have beneficial effects on lowering blood pressure.

Protein Assessment The composition of various proteins may be so unique that their influence on physiological function in the human body could be quite different. The quality of a protein is vital when considering the nutritional benefits that it can provide. Determining the quality of a protein is determined by assessing its essential amino acid composition, digestibility and bioavailability of amino acids (FAO/WHO, 1990). There are several measurement scales and techniques that are used to evaluate the quality of protein.

Protein Rating Scales Numerous methods exist to determine protein quality. These methods have been identified as protein efficiency ratio, biological value, net protein utilization, and protein digestibility corrected amino acid score. Table 2. Protein composition of soy protein forms. Soy Protein Form Soy Flour Soy Concentrate Soy Isolate

Protein Composition 50% 70% 90%

Protein Efficiency Ratio The protein efficiency ratio (PER) determines the effectiveness of a protein through the measurement of animal growth. This technique requires feeding rats a test protein and then measuring the weight gain in grams per gram of protein consumed. The computed value is then compared to a standard value of 2.7, which is the standard value of casein protein. Any

Soy Food in Demand

57

value that exceeds 2.7 is considered to be an excellent protein source. However, this calculation provides a measure of growth in rats and does not provide a strong correlation to the growth needs of humans.

Biological Value Biological value measures protein quality by calculating the nitrogen used for tissue formation divided by the nitrogen absorbed from food. This product is multiplied by 100 and expressed as a percentage of nitrogen utilized. The biological value provides a measurement of how efficient the body utilizes protein consumed in the diet. A food with a high value correlates to a high supply of the essential amino acids. Animal sources typically possess a higher biological value than vegetable sources due to the vegetable source‘s lack of one or more of the essential amino acids. There are, however, some inherent problems with this rating system. The biological value does not take into consideration several key factors that influence the digestion of protein and interaction with other foods before absorption. The biological value also measures a protein‘s maximal potential quality and not its estimate at requirement levels.

Net Protein Utilization Net protein utilization is similar to the biological value except that it involves a direct measure of retention of absorbed nitrogen. Net protein utilization and biological value both measure the same parameter of nitrogen retention, however, the difference lies in that the biological value is calculated from nitrogen absorbed whereas net protein utilization is from nitrogen ingested. Table 3. Protein quality values. Protein Soy protein Whey protein Milk Egg Casein Wheat gluten

Biological Value 74 104 91 100 77 64

Protein Efficiency Ratio 2.2 3.2 2.1 3.9 2.5 0.8

Net Protein Utilization 61 92 82 94 76 67

Protein Digestibility Corrected Amino Acid Score (PDCAAS) 1.00 1.00 1.00 1.00 1.00 0.25

Protein Digestibility Corrected Amino Acid Score In 1989, the Food & Agriculture Organization and World Health Organization (FAO/WHO) in a joint position stand stated that protein quality could be determined by expressing the content of the first limiting essential amino acid of the test protein as a

58

M.K.Tripathi and S.Mangaraj

percentage of the content of the same amino acid content in a reference pattern of essential amino acids (FAO/WHO, 1990). The reference values used were based upon the essential amino acids requirements of preschool-age children. The recommendation of the joint FAO/WHO statement was to take this reference value and correct it for true fecal digestibility of the test protein. The value obtained was referred to as the protein digestibility corrected amino acid score (PDCAAS). This method has been adopted as the preferred method for measurement of the protein value in human nutrition (Schaafsma, 2000). Table 3 provides a measure of the quantity of various proteins using these protein rating scales. Although the PDCAAS is currently the most accepted and widely used method, limitations still exist relating to overestimation in the elderly (likely related to references values based on young individuals), influence of ideal digestibility, and antinutritional factors (Sarwar, 1997). Amino acids that move past the terminal ileum may be an important route for bacterial consumption of amino acids, and any amino acids that reach the colon would not likely be utilized for protein synthesis, even though they do not appear in the feces (Schaarfsma, 2000). Thus, to get truly valid measure of fecal digestibility the location at which protein synthesis is determined is important in making a more accurate determination. Thus, ideal digestibility would provide a more accurate measure of digestibility. PDCAAS, however, does not factor ideal digestibility into its equation. This is considered to be one of the shortcomings of the PDCAAS (Schaafsma 2000). Antinutritional factors such as trypsin inhibitors, lectins, and tannins present in certain protein sources such as soybean meal, peas and fava beans have been reported to increase losses of endogenous proteins at the terminal ileum (Salgado et al., 2002). These antinutritional factors may cause reduced protein hydrolysis and amino acid absorption. This may also be more affected by age, as the ability of the gut to adapt to dietary nutritional insults may be reduced as part of the aging process (Sarwar, 1997).

Evaluation of Soy Protein Products in Human Nutrition The nutritional value of soy protein products in the human diet has been established by extensive nutritional research with infants, children and adults at research institutes worldwide (Scrimshaw and Young1979). The significance for human nutrition of the sulfurcontaining amino acid content of soy protein products has also been examined. It has been concluded that, for young children and adults, methionine supplementation of products containing soy protein products is not necessary; nor is methionine supplementation of the soy protein products themselves necessary for an adult diet, as was previously thought . More specifically, in studies with children in the critical age period of 2 to 4 years, commercial soy protein isolates were shown to have 80% to 100% of the protein nutritional value of milk protein. The studies also indicated that these isolates were of high nutritional quality when they were the sole source of dietary protein (without amino acid fortification), using whole milk and whole egg as reference proteins. This was so even at levels lower than those recommended for this age group by FAO/WHO (Torun etal., 1981)). For the newborn, the limited data available suggest that supplementation of soy-based formulas with methionine may be beneficial. However, studies show that for adults with diets adequate in total nitrogen, methionine supplementation is unnecessary. These studies assessed the minimum amount of soy protein, with and without methionine, required to meet the amino acid needs of adults with diets adequate in nitrogen. It was shown that with methionine supplementation the soy

Soy Food in Demand

59

protein utilization was improved only at protein intake levels lower than 0.6 grams per kilogram (kg) of body weight per day ( Torun, B. (1979)). At intakes of about 0.6 gram of soy protein per kilogram of body weight per day, nitrogen balance was similar to that achieved with 0.4 gram of egg white protein per kilogram of body weight per day, and the protein and methionine requirements were met. Further, supplementation of soy isolate with Lmethionine showed no beneficial effects in young men when protein intake was adequate. Other tests with adults also indicate that the protein quality of soy protein products is comparable to that of high-quality animal proteins such as milk and beef (Inoue et al., 1984). Studies of protein quality conducted with young male adults have also shown that soy protein isolate is comparable in protein quality to milk and beef, and 80 to 90% to that of whole egg, in spite of the fact that again protein intakes were at suboptimal levels in these studies (Young et al., 1984). Long-term studies with adult volunteers who consumed soy isolates as the sole source of protein and amino acids for long periods at the FNB minimum recommended protein level have indicated that, for normal, healthy adults, soy protein isolate is comparable to animal protein sources . In two metabolic tests, soy protein concentrates were fed to healthy young men (Istfan et al., 1983). Nitrogen equilibrium based on nitrogen balance was attained with a mean daily nitrogen intake (95 milligrams per kilogram of body weight) that was not significantly different from that of egg protein (92 milligrams nitrogen per kilogram). In a second study, soy concentrate was fed as the sole source of protein for 82 days at a daily intake of 0.8 gram of protein per kilogram. Mean nitrogen balances were slightly positive for all subjects. It was concluded that soy concentrates could serve as the sole source of protein in providing nitrogen and amino acids for maintenance in adults. In general, both long- and short-term human assays suggest that soy protein products are of high nutritional value for humans.

EVALUATION OF SOY PROTEIN PRODUCTS IN SPECIFIC FOODS Infant Formulas The nutritional adequacy of soy protein products has been clearly demonstrated in infant formulas, where protein and other nutrient requirements are most critical (Torun, 1981)). A formula based on soy isolate may serve as the primary source of protein from birth to six months. In infant formulas, milk protein and soy protein isolate digestibilities are similar. Two grams of soy protein isolate per 70 kilocalorie of formula meets or exceeds the amino acids provided by human milk at an equivalent caloric intake (Kolar, 1982)). When vegetable proteins contribute a major portion of the daily protein intake for infants, one should consider fortification with nutrients, such as vitamins, minerals and perhaps amino acids.

Meats and Fish Soy protein products can also be used to increase the total amount of dietary protein available, thus improving human nutrition in mixed food systems containing animal protein. Various beef/soy combinations will affect protein utilization differently, depending on

60

M.K.Tripathi and S.Mangaraj

whether the measurements are done at deficient or adequate levels of protein intake (Kies and Fox 1971). For example, at levels of 0.6 to 0.7 gram protein per kilogram of body weight, no difference has been found in nitrogen utilization between meat protein and highly extended beef/soy blends. A study of young men consuming beef; a 50/50 mixture of beef and isolate; and milk showed equal nutritional value for the three protein sources (Hopkins and Steinke 1981). Data on the nutritional qualities of textured protein products in meat/soy mixtures indicate that textured soy proteins, when blended with meat protein at a 30% level, exceed the nutritional value of casein (Wilding, 1974). When soy isolate was compared to fish as the sole protein source for humans, equal amounts of protein from both sources elicited a similar nitrogen balance. These results are supported by another study in which a 50/50 mixture of fish and soy isolate was found to be equivalent to fish (Inoue et al., 1981). The low fat and cholesterol content of fish/soy combinations are claimed as additional benefits of these products.

Special Nutritional Products Amino acid, vitamin, and mineral fortification of soy protein products is both feasible and nutritionally sound. Special fortification offers an opportunity to provide highly nutritional meals that would otherwise not be available for reasons of cost, stability, ease of preparation, or medical considerations (e.g., hypoallergenic infant formulations). Therefore, soy protein products offer opportunities for special formulas for geriatric, infant, hospital, and postoperative feeding. These formulas can be designed to provide complete nutrition, specific caloric content and a balance between calories provided by protein, fat and carbohydrate. At limited protein intake levels (the FAO/WHO and FNB patterns), the nutritional quality of both concentrates and isolates can be improved by adding 0.5% to 1.5% methionine (Rakosky, and Sipos, 1974 ).

Nutritional Significance of Protease Inhibitors Inhibitors of proteolytic activity of many enzymes (e.g., TI) are found throughout the plant kingdom, particularly among the legumes. Cereal grains, grasses, potatoes, sweet corn, fruits and vegetables, peanuts, and eggs also contain protease inhibitors . The evidence to date suggests that any residual TI in soy products is most likely of little consequence in human food when properly processed soybean products are used (60). Proper heat processing is necessary if maximum nutritional value is to be realized from legume proteins, such as the soybean. Maximum PER is reached when 79% of TI activity is destroyed. With only a 50 to 60% destruction of TI activity, pancreatic hypertrophy no longer occurred in rats (Liener, I.E. 1981). More recent studies have shown that most of the problems previously reported involving pancreatic enlargement are eliminated by moist heat treatment of the raw flour. Enlargement of the pancreas in response to raw soy flour varies with species, but the response of rats, pigs and monkeys to properly heated soy flours and isolates is little different from their response to a casein diet . In a primate study, monkeys were fed, from infancy, purified diets containing lactalbumin, soy isolate, casein, or soy concentrate as the sole source of protein. Hematologic and clinical chemistry values were similar for all groups. No evidence

Soy Food in Demand

61

of pancreatic hypertrophy or hyperplasia, as measured by RNA, DNA, and protein/DNA ratios, respectively, was seen in any diet group (Ausman et al., 1985). In humans, gastric juices will inactivate much of the soy TI activity except the Bowman-Birk inhibitor. The latter appears to be more resistant to both heat and gastric juice inactivation. If soy TI did inhibit human trypsin and chymotrypsin, then raw soy protein would be a problem only for individuals with low stomach acid levels, pancreatic dysfunction, or who ingest large amounts of fat in their diet. Furthermore, the newborn would also be more susceptible to TI inhibition from raw soy protein because of higher stomach pH and faster gastric emptying than adults . As stated before, these concerns will not apply to most commercial products, which have been heat-treated. Many safe, nutritious dietary components with long histories of human consumption possess TI activity. Because heat processing destroys most of the TI activity, most foods, as consumed, would be expected to be virtually free of TI. For these reasons, most scientists agree that TI in properly processed vegetable products should not pose a hazard to human health.

Safety and Microbiology Issues Toxic factors and biologically active components must be controlled to ensure safety. Toxic factors may be extrinsic or intrinsic to a given protein source. Examples of the intrinsicly toxic, or antinutritional, factors, found in plants include protease inhibitors, allergens, etc. (Liener 1980)). Toxic factors of extrinsic origin include materials formed or introduced during processing, such as browning reaction products, oxidized lipids, solvent residues, fumigants, detergents, and lubricants. Improper storage and processing can result in the growth of naturally occurring microorganisms (aflatoxin production in peanut and cottonseed) or introduction of pathogenic bacteria (e.g., Salmonella). The manufacturers work constantly with industry associations and government groups to ensure that processing conditions minimize the risk of contamination of soy protein products with these substances.

Microbiology and Sanitation All edible-grade soy protein ingredients produced in the United States are made according to FDA guidelines for good manufacturing practices. Considerable attention is given to plant design and sanitary practices in making soy protein products to ensure proper microbiological profiles for food use. Emphasis is also placed on control of moist heat processing and related treatments in order to achieve functional and nutritional properties. Once hydrated, soy ingredients must be handled under the same conditions as meat or any other perishable food. If a food mix containing hydrated soy ingredients is to be stored for further processing, it should be kept at temperatures not exceeding 35°F. The microbial count for finished soy protein products can vary by process conditions used and among manufacturers. A typical range of specifications may look like the following; Standard Plate Count (5000 to 50,000), Salmonella (per g) will be negative and E. Coli (per g) will be negative.

62

M.K.Tripathi and S.Mangaraj

Important Soy Foods and Ingredients Partially hydrolyzed soy protein products are products obtained by cleavage of the protein by proteolytic enzymes obtained from animal, plant, and microbial peptidases such as pepsin, papain, and bromelain to reduce the molecular weights of proteins to a range of 3,000 to 5,000 daltons. Molecular weight reduction improves whipping properties and acid solubility. Fully hydrolyzed proteins used as flavoring agents can be prepared from soy grits by acid hydrolysis. A number of enzyme hydrolysates are also available as flavoring agents. Oriental soy foods, both fermented and nonfermented products are part of the daily diet in many areas of the world. Products such as soy sauce (shoyu), tofu, tempeh, and others are becoming more popular in the United States and Europe. Preparation and uses of these soy foods are described in Table.4. Table 4. Uses of Soy Flour Type Full-fat flours (40% protein) High enzyme flours (52–54% protein) Defatted flours (52–54% protein) Lecithinated flours

Uses Production primarily in Europe and Asia for the baking industry and the production of soy milks. Increasing mixing tolerance and bleaching in bread; preparation of functional concentrates and isolates. Varied uses requiring a wide range of protein solubilities. Improving water dispersibility and emulsifying capability in baking applications.

EFFECTS OF PROCESSING CONDITIONS ON SOYBEAN COMPONENTS Processing of soybeans, whether by traditional or Western methods, is necessary to produce animal feed ingredients, food for human consumption or functional protein ingredients intended for incorporation into a wide variety of human foods. During the course of soybean processing to change properties, the chemical composition may change as well. In this review we summarize the compositional changes that occur in trypsin inhibitors, phytate, saponins and isoflavones as a result of processing.

Proteins The content and properties of oil and protein are the primary determinants of whole soybean value. Oil and protein are separated from each other early in most Western processing; in some traditional Oriental soy foods, oil and protein remain together whereas in others they are separated. Soybean oil is not included in this discussion. The proteins of soy contribute to the nutritional value of foods and feeds and are responsible for a number of functional characteristics in a variety of foods. Heating is necessary to attain maximum nutritional value and to modify functional properties of soybean protein. Kakade et al. (1973), using immobilized trypsin to remove trypsin inhibitors from a raw soy flour extract followed by rat feeding experiments, concluded that approximately 40% of the growth-depressing

Soy Food in Demand

63

effect of the unheated extract was due to the trypsin inhibitors. The remainder of the growth depression was attributed to poor digestibility of the undenatured protein.

Processing and Trypsin Inhibitors Although soybean protein products require heat processing to achieve maximum nutritional value, partly through trypsin inhibitor denaturation, trypsin inhibitors also display anticarcinogenic properties (Messina and Barnes 1991). The predominant trypsin inhibitors in soybeans and derived materials are proteins and they are located, for the most part, with the main storage proteins in the protein bodies of the cotyledon (Horisberger et al. 1986). This being the case, trypsin inhibitors tend to fractionate with the milieu of storage proteins as soybeans are processed into ingredients and foods. There are exceptions to this generality that will be discussed as they arise. Rackis et al. (1986) reviewed the literature through 1985 on protease inhibitor content of some plant foods Based on 19 varieties and strains, whole soybeans were reported to contain 17-27 mg of trypsin inhibitor/g (Hafez 1983) according to activity assays with the results expressed as though all activity resided in the main species, the Kunitz trypsin inhibitor. Soybeans contain approximately 40% protein (Kakade et al., 1972). After analyzing 108 strains and cultivars, it was reported that soybean contain 35-123 mg trypsin inhibitor/g of protein. When soybeans are processed into raw defatted flour, a process in which the hulls and oil are removed, none of the trypsin inhibitors are removed but they become enriched in the flour to levels of 28-32 mg/g of flour, which equates to approximately 58 mg trypsin inhibitor/g of protein (Table 1). Trypsin inhibitors, being proteins, are subject to denaturation and inactivation by heat. Heated or toasted flours are produced having a range of trypsin inhibitor activities depending upon their intended use. A fully toasted soy flour will have a trypsin inhibitor level of only 8-9 mg/g of flour or approximately 16 mg/g of protein. Soy protein concentrates are produced by washing defatted flours with either aqueous ethanol or acidified water. In these processes oligosaccharides and other constituents are removed but most of the protein is not; the protein content is therefore in creased to >65%. The ranges of trypsin inhibitor activity are given in Table 1, 5-7 mg trypsin inhibitor/g of concentrate or 811 mg/g of concentrate protein. Soy protein isolates are processed to contain >90% protein. Depending upon the amount of washing of the precipitated curd as well as the trypsin inhibitor content of the starting soybeans, isolates contain trypsin inhibitor levels in the range of 1-30 mg/g or, because nearly all of this product is protein, the same range per gram of protein (Table 1). Oriental and other soybean foods are generally low in trypsin inhibitor (Table 2). Soy sauce, produced by enzymic or acidic hydrolysis of a mixture of soybeans and wheat, is low in trypsin inhibitor content at 0.3 mg/g of sample or 3.3 mg/g of protein equivalent. It is unlikely that these values represent activity from the protein inhibitors but the origin of the measured activity is uncertain. Miso is a product made by fermentation of soaked and steamed soybeans. Table 2 shows a value of 4 mg/g of sample or 23 mg/g of protein for miso. However, when lipids are removed from miso by extraction, the trypsin inhibitor level falls to 4 mg/g of protein and it will decrease further if the miso is heated. Tofu, which is made from heated soybean milk by coagulation of the proteins with a salt such as calcium sulfate followed by cooling, has a trypsin inhibitor content (9 mg/g of protein, Table 2) near to that as associated with a fully toasted soy flour (16 mg/g of protein, Table 1). Soy infant formula is made from soy protein isolate with the addition of other nutrients. The

64

M.K.Tripathi and S.Mangaraj

trypsin inhibitor level in these products falls in the range of 0.3-3 mg/g of sample or 2-16 mg/g of protein. Di Pietro and Liener (1989) differentiated between the Kunitz and BowmanBirk inhibitor content of soybean flours, concentrates, isolates and a variety of foods. The Kunitz soybean trypsin inhibitor present was quantitated by rocket immunoelectrophoresis and the Bowman-Birk inhibitor was measured by chymotrypsin inhibition. Soy flours were found to contain from 1.1 to 19.6 mg/g and from <0.2 to 4.9 mg/g of Kunitz and BowmanBirk inhibitors, respectively. Concentrate samples contained a range of <0.5-6.1 mg/g of Kunitz and <0.2-1.0 mg/g of Bowman-Birk inhibitors whereas soy protein isolate inhibitor contents ranged from <0.5 to 3.6 mg/g and from 0.3to 2.0 mg/g, respectively, for Kunitz and Bowman-Birk inhibitors. A dehydrated soymilk was found to contain 11.3 mg Kunitz inhibitor/g and 1.9 mg/g Bowman-Birk inhibitor whereas a wheat-soy pancake mix had 1.0 mg/g of Kunitz and 0.4 mg/g of Bowman-Birk inhibitors. A variety of other soy containing foods were found to have no more than approximately 1% of the quantity of these inhibitors present in raw soy flours. The ratio of Kunitz inhibitor to Bowman-Birk inhibitor ranged between 0.5 and 8.1.

Processing and Phytic Acid Phytic acid has long been recognized to interfere with the absorption of minerals, especially zinc. Re cent work suggests that phytic acid may have anticarcinogenic properties as well (Messina and Barnes 1991); consequently, there is renewed interest in this compound. Phytic acid content of soybeans can vary considerably (Table 4). Field type cultivars, which are the usual items of commerce, fall into the range of 1.0-2.3%. The hulls contain only 0.10.5% phytic acids whereas the hypocotyls contains 0.9%. However, the hulls (8%) plus the hypocotyl (2%) represent only approximately 10% of the seed; thus the bulk of the phytic acid occurs in the cotyledons. The cotyledons contain 1.6% phytic acid, which is localized in the protein bodies and appears to be distributed between soluble protein-phytate salts and insoluble globoid inclusions (Prattley and Stanley 1982). Full-fat flour, which is essentially the cotyledon fraction, contains 1.5-1.8% phytic acid. Values for defatted flours, concentrates and isolates likewise are in the range of 1-2% phytic acid despite considerable additional processing as compared with full-fat flours. Texturized flours and concentrates are also in this range; phytic acid is stable to cooking (Davies and Reid 1979) and probably is not degraded during texturization by extrusion. The phytic acid values fall in the range of 1-3% except for okara and tempeh, which contain only 0.5- 1.2% phytic acid. The lower values for tempeh are attributed to partial hydrolysis by phytase elaborated by Rhizopus oligosporus, the organism used in fer- menting cooked soybeans to produce tempeh (Sutardi and Buckle 1985).

Processing and Saponins Most listings of soybean antinutritional factors in the past included saponins, although with little or no justification. Toxicity was attributed to them simply by analogy with saponins from other sources that, in deed, are toxic. However, most reviewers have ignored studies reported 25 years ago showing that feeding soybean saponins to chicks, rats and mice failed to inhibit growth even when fed at levels three to five times those of a normal soybean meal

Soy Food in Demand

65

diet. More recently, hypocholesterolemic and anticarcinogenic effects have been attributed to soybean saponins (Messina and Barnes 1991). Consequently, there is justification for removing saponins from the list of antinutritional factors in soybeans (Liener 1981). Soybean saponins are complex compounds consisting of nonpolar triterpenoid alcohol aglycones linked to one or more polar oligosaccharides resulting in molecules with amphiphilic properties similar to detergents. Early studies resulted in confusion about the number and structures of the aglycones but it is now believed that only three aglycones, soyasapogenol A, Band E, occur in intact saponins. Other soyasapogenols reported earlier evidently were artifacts of hydrolysis conditions (Price et al. 1987). Five major saponins have been isolated and structurally characterized (Kitagawa et al. 1988b). The main complexity arises from the structures of the attached oligosaccharides, which may be free or acetylated. Additional complexity has been reported recently in the form of 2,3-dihydro-2,5-dihydroxy-6-methyl4Hpyran-4-one attached to the C-22 hydroxyl group of isoyasapogenol B; this group is removed with the for mation of maltol when the saponins are heated (Kudou et al. 1993). This diversity of structure and composition has also made it difficult to analyze for soybean saponins. A variety of methods have been reported but at present high performance liquid chromatography techniques are available for analysis of the intact saponins (Kudou et al. 1993) as well as the aglycones obtained upon acid hydrolysis of the saponins (Ireland et al. 1986). The latter method assumes that the ratio of aglycone to sugars is 1:1 and this is not always justified (Price et al. 1986); hence, results may not always agree with analysis of intact saponins. Attention is also called to the fact that some of the early results obtained by thin layer chromatography (Fenwick and Oakenfull 1983) gave values that were almost 10-fold too high. Table 6 shows saponin contents for soybeans, seed parts and derived protein products. Soybeans contain 0.1-0.5% saponins; the high end of the range depends on a value determined by analysis of the sapogenols. The cotyledons contain 0.2-0.3% saponins whereas the level in the hypocotyl approaches 2%. However, the hypocotyl represents only approximately 2% of the seed; hence, it has little effect on the composition of flours and related products that may contain this fraction. The seed coat (hull) contains no saponins. Unheated and heated full-fat flours contain approximately 0.5% saponins; the results indicate that the saponins are heat stable . No saponins were detected in a protein concentrate prepared by aqueous alcohol extraction as would be expected based on the solubility properties of the saponins. Isolates have been reported to contain 0.8% saponins. Although water soluble, the saponins apparently complex with the proteins and hence are retained with the proteins during the isolation process. Saponin content of several Oriental foods such as soymilk, yuba, tofu and natto is in the range of 0.3-0.4%, about the same as in soybeans. Okara (the insoluble residue remaining after preparation of soymilk), miso (fermented soybean paste) and natto (fermented, cooked soybeans) tend to be somewhat lower in saponin content at 0.1-0.3%. With the exception of alcohol-extracted concentrates, the saponins tend to remain with the protein products derived from soybeans. Fermentation, as in the preparation of miso, results in some degradation of the saponins and thus lower saponin content as compared with soybeans.

66

M.K.Tripathi and S.Mangaraj

Processing and Isoflavones Although long considered to be antinutritional factors, because of their estrogenic properties soybean isoflavones are now of great interest because of their anticancer activities (Coward et al.1993). Soybeans contain two major isoflavones, genistein and daidzein, and a minor one, glycetein. In the seed, the isoflavones are present primarily as /3-glucosides and a portion of the glucosides also is substituted on the C-6 hydroxyl of the glucose by a malonyl group, especially in the hypocotyl (Kudou et al. 1991), which represents only approximately 2% of the seed. Acetyl derivatives also have been reported (Wang and Murphy 1994b) but these may be degradation products resulting from decarboxylation of themalonylisoflavones during extraction and workup of the extracts (Horowitz and Asen 1989). The low and high values for isoflavone contents of soybean varieties reported by Wang and Murphy (1994b); these values range from 1200 to 4200 Mg/g-For additional information on variations of isoflavones with soybean varieties, crop year and location of growth, (Eldridge and Kwolek ,1983). The glucoside forms of the isoflavone predominate. In contrast, the aglycones (genistein, daidzein and glycetein) make up only 2% of the total isoflavones. Soy flour, made by defatting dehulled flakes and grinding, has an isoflavone profile approximating that of soybeans. Granules and textured vegetable protein products contain appreciable quantities of the 6"-Oacetyl derivatives of genistin and daidzin, presumably because of heat treatment during processing, which decarboxylates the malonyl glucosides. Protein isolates contain reduced levels of isoflavones (600-1000 Mg/g) as compared with soybeans and flours as a result of the aqueous processing used during manufacture. A concentrate made by aqueous alcohol extraction is very low in isoflavones (73 Mg/g) because the isoflavones are soluble in aqueous alcohol and are thus largely removed during processing. Additional data on flours, concentrates and isolates were reported by Eldridge (1982) and Coward et al. (1993), although these workers did not report values for the acetylated or malonylated derivatives. Roasted soybeans are low in the malonyl derivatives but higher in the acetyl forms as a result of the heat treatment. Beverage products approximate the composition for soybeans except for reduced levels of the malonyl derivatives. Tofu is greatly reduced in isoflavones because of the aqueous processing during manufacture. Tempeh is somewhat lower in isoflavone content than tofu and contains elevated levels of the aglycones formed by enzymatic hydrolysis during fermentation. Similar trends are noted for bean paste (miso) and the other fermented soy foods. Content of isoflavones in Western-style soy foods falls into the range of 43 ug/g for cheddar cheese-like product to 386 ug/g for tempeh burger. The values for these foods are considerably lower than those of soybeans because soy is only one of several ingredients used, including fat and water (Coward et al. 1993). It is apparent that processing generally does not remove the isoflavones during fermentation but the isoflavones remain. Lowering of isoflavone from soybean protein products and foods, except for concentrates prepared by alcohol extraction. The form may be altered by heat treatment and by enzyme reactions contents of some soybean foods also results from dilution because of the addition of other ingredients, e.g., salt in miso.

Soy Food in Demand

67

Biotechnology Aspects of Soybean Improvement Amongst the legumes, soybean occupies a unique position. Its dual utility as a protein and oilseed crop, as well as the extensive acreage devoted to its cultivation, established soybean as the premier target for genetic engineering. Some important traits such as herbicide resistance were considered to be very attractive to agrichemical and seed companies, whereas food processing and industrial raw material companies regarded soybean as the ideal system for testing the concept of 'value-added crops'. Success in any one of the above areas would yield significant returns to the party. Soybean genetic engineering is the most advanced amongst all grain legumes, and this reflects the economic importance of the crop in the industrialized world, particularly the US and Japan. Field trials of genetically engineered soybean have been ongoing for the last several years and the first transgenic plants have already been commercialized in 1996 (Asgrow/Monsanto, Roundup Ready TM soybean).

Gene Transfer Early attempts in soybean engineering focused on regeneration of protoplasts and embryogenic suspension cultures. However, despite some initial successes, progress was very slow and the prospects for recovering transgenic soybean remained a distant and elusive objective. Soybean genetic engineering became a reality following the invention and optimization of the technique of particle bombardment (Christou et al., 1990). In fact, soybean was used as a model system to develop the technology for a large number of crop species that were shown to be extremely recalcitrant to genetic manipulation (McCabe et al., 1988).

Agrobacterium-Mediated Gene Transfer The first experiments describing successful transformation of soybean plants using Agrobacterium were reported by Hinchee et al. (1988). The procedure relies on shoot organogenesis from cotyledons of a soybean genotype selected for susceptibility to Agrobacterium infection (cultivar Peking). Cotyledon explants from this specific cultivar were inoculated with Agrobacterium plasmids conferring kanamycin resistance and glucuronidase (GUS) activity, or kanamycin resistance and glyphosate tolerance. Three parameters were critical in developing this particular soybean transformation method: 1). Use of the one cultivar (Peking) susceptible to Agrobacterium infection 2). Development of a regeneration response from soybean cotyledons, and 3). Enrichment for transformed tissue by kanamycin selection.

DNA Transfer Into Protoplasts (Direct Transfer) Soybean protoplasts can be transformed effectively using routine procedures. However, no plants have been recovered, and regeneration still remains a formidable hurdle in the

68

M.K.Tripathi and S.Mangaraj

recovery of transgenic soybean plants from transformed protoplasts. Several works claiming recovery of transgenic soybean plants following electroporation of protoplasts (Widholm, 1993).

Particle Bombardment By combining a simple genotype-independent regeneration protocol based on the proliferation of multiple shoots from the general area of the meristem of soybean embryonic axes and electric discharge particle acceleration for the delivery of foreign DNA, a commercial process for the introduction of genes into soybean was developed . Many hundreds of independently derived soybean plants representing a wide phenotypic spectrum of transformation events were obtained and analyzed. Generally the transgenic soybean lines include multiple copies of the engineered genes. Copy numbers ranging from one to probably over one hundred have been observed, but usually the copy number is between two and ten. Analysis by Southern blots of the inheritance of the multiple gene copies shows that all of the copies cosegregate i.e. they are genetically linked to one another (Christou et al., 1989). The same is also true for co transformation with different genes introduced on separate plasmids. These results indicate that each R0 plant represents only one independent transformation event and suggest that integrative recombination is an infrequent occurrence. These analyses also demonstrate that the entire complement of transgenes is stably transmitted to progeny (Christou et al., 1989). By circumventing the normal feedback regulation of two enzymes involved in lysine biosynthesis, aspartokinase (AK) and dihydrodipicolinic acid synthase (DHDPS), Falco et al., 1995, determined that transgenic soybean plants generated by bombardment exhibited several hundred-fold increases in free lysine and contained up to 5fold increased levels of the amino acid in seed. Lysine-feedback-insensitive bacterial genes (DHDPS and AK) were linked to a chloroplast transit peptide and expressed from a seedspecific promoter in transgenic seed. Accumulation of saccharopine in transgenic soybean, which is an intermediate in lysine catabolism, was also observed.

Critical Assessment of Gene Delivery Methods Particle bombardment is the only method, at present that can be used commercially for the engineering of soybean in a variety-independent fashion. Genes can be introduced into any soybean variety, and hundreds of transgenic plants can be recovered following a simple screening procedure. The Agrobacterium procedure has not been transferred to other varieties, besides Peking. In addition, a number of other laboratories attempting to reproduce the Agrobacterium-mediated gene transferred system have not been able to do so.

Selection of Targets for Biotechnology Improvement The development of an efficient transformation system for soybean, allows a shift of research effort away from developing tissue culture systems, and labor intensive and time consuming transformation procedures for the introduction of foreign genes into this crop. The

Soy Food in Demand

69

emphasis of basic research in the area of soybean improvement should now be directed towards the isolation and characterization of genes that control agronomically useful qualitative and quantitative traits. Introduction of herbicide resistance genes has been accomplished and practical levels of herbicide tolerance have been demonstrated in the field. Marketing of genetically engineered soybeans expressing herbicide resistance occurred in 1996. Efforts to modify seed storage proteins for improved nutritional value for human food and animal feeds are currently underway. Targets such as disease and drought resistance, as well as tolerance to other stress factors that influence productivity will be the next challenge. Modification of oil composition to suit diverse applications will become a realistic target for soybean improvement as key enzymes involved in fatty acid and triglyceride biosynthesis are identified and the corresponding genes isolated and characterized. Exciting progress in these areas has been achieved over the last several years and should proceed at accelerating rates.

Role of Biotechnology in Modification to Soybean Seed and Enhance Animal Feed The majority of soybean meal is used to provide amino acids to poultry and swine. Typically, soybean meal is used to meet the animal‘s requirement for limiting amino acids, because soybean meal is usually the most cost-effective source of amino acids. Soybean meal is also one of the best protein sources for complementing the limiting amino acid profile of corn protein. However, the use of soybean meal in a corn-based diet to meet the animal‘s requirement for the most limiting amino acid results in the overfeeding of nonlimiting amino acids. The amino acids overfed are metabolized by the animal to carbon dioxide and urea, with the urea contributing to nitrogen excretion. Further, the protein is not completely digested by the animal, with the undigested protein being eliminated in the feces and contributing to nitrogen waste. The incomplete digestion of protein by the small intestine renders the protein susceptible to fermentation by the colonic microflora. Fermentation, in turn, plays an important role in malodor of animal waste. The regulatory pressures of nitrogen excretion and malodor abatement present a cost associated with feed ingredients that contribute to excess nitrogen excretion or malodor production. Thus, the economics of soybean meal use in animal diets has changed from the original requirement of the lowest cost source of amino acid. To adjust to market economics, the primary structure of soybean protein needs to be altered and its digestibility needs to be improved. The amino acid requirements for poultry and swine are reasonably well elucidated. Using this information and the digestible amino acid profile of corn (the major energy feedstuff used in poultry and swine diets), the ideal amino acid profile of soybean protein can be targeted. When designing the optimum amino acid profile for soybean meal, consideration should also be given to market dynamics of alternative amino acid sources. In other words, there is more value in targeting increased concentrations of amino acids that are priced over $30/ kg than amino acids priced at less than $1/kg. Specific amino acids that should be targeted are tryptophan, isoleucine, and valine for the pig, and the additional amino acid arginine for the chick. Improvement in protein digestibility would also enhance the value of soybean meal. Soybean meal protein digestibility is approximately 85% (Woodworth et al., 2001), ranging between 82% and 94% for individual amino acid digestibility. Improving intestinal availability of the amino acids to 95% or greater concomitantly with modifications of the

70

M.K.Tripathi and S.Mangaraj

amino acid profile would substantially improve the value of soybean meal protein for animal feed use. The availability of phosphorus from soybean meal and other grains is compromised by the presence of phytic acid. The phytic acid binds the phosphorus, preventing its absorption by the animal‘s intestinal tract. The failure of phytic acid phosphorus to be available to the animal results in supplemental phosphorus required in the diet and substantial quantities of phosphorus excreted into the environment. If phytic acid were removed, as is accomplished by phytase addition to the diet, phosphorus retention is increased by 50% and excretion is reduced by 42% (Lei, Ku, Miller, & Yokoyama, 1993). Modifying soybeans to prevent the synthesis of phytic acid would have substantial value for animal feed applications. Digestible and metabolizable energy value of soybean meal could be improved by alleviating carbohydrates in the meal. Removal of raffinose and stachyose improved metabolizable energy content 12% (Graham, Kerley, Firman, & Allee, 2002). Other oligosaccharides, as well as structural carbohydrates, are contained in soybean meal. These carbohydrates are incompletely digested by colonic micro biotic of the chick. Reduction of these carbohydrates could improve energy density of the soybean meal and reduce hydroscopic nature of the litter.

Future Prospect of Biotechnology in Soybean Foods Development The role of soy in preventing a wide range of diseases such as coronary heart disease, cancer, and osteoporosis (Messina, Gardner, & Barnes, 2002) and nutritional requirement is need of present time. This value of soybean is increasing consumer demand for soy-based foods and food ingredients. In response, major food companies are increasingly finding new ways to incorporate soy protein into mainstream products such as energy bars, breakfast cereals, meat alternatives, and beverages. Soy is now commanding an unprecedented position as a preferred food ingredient in the products on the grocery shelves of the United States. A recent joint study by SPINS and Soyatech (http://www.soyatech.com) has indicated that US retail sales of soy foods has grown by more than 10% a year for the last seven years to an estimated retail market in 2002 of $3.65 billion (Soyatech, 2003). This growth in consumer demand for soy is only limited by the negative flavor connotations of soybeans and soy products. It is not hard to understand why consumers may have difficulty meeting the US Food and Drug Administration‘s recommended intake of 25g of soy protein per day when the major flavors associated with these products include painty, grassy, beany, metallic, and beany. Even when consumers have a good understanding of the health benefits, nutritionally educated consumers will not eat something if it does not taste good. There are, however, a number of ways in which biotechnology could improve soy-based foods and help increase consumption. The obvious example would be to make soy flours, concentrates, and isolates taste better or, at least, remove some of the most objectionable flavors so that flavorists could make the foods taste better. If the compounds causing the volatile and nonvolatile off-flavors could be identified, then metabolic engineering might be used to prevent or reduce the formation of these compounds. A well-documented example of this is the reduction in beany flavor associated with the removal of Lipoxygenase activity from soybeans (Kitamura, 1995). A less intuitive but equally important approach would be to change the functional properties of soy proteins. These functional properties include solubility, water absorption, viscosity, gelation, emulsification, and flavor binding. Increasing the solubility of soy proteins at acidic pH ranges, for example, would allow whole, rather than hydrolyzed, proteins to be added to

Soy Food in Demand

71

fruit juices with a consequent reduction in the bitter flavors associated with small peptides. Improving the gelation properties of soy proteins could result in reduced processing and consequently reduce any possible off-flavors developed during the extended processing required for some soy ingredients (Kitamura, 1995). Finally, because the main driving force of the soy food business is the health properties of soy components, improving or enhancing these health properties may provide a additional incentive to consume soy products. Removing non- nutritional compounds such as protease inhibitors (Friedman & Brandon, 2001), indigestible oligosaccharides (Hitz, Carlson, Kerr, & Sebastian, 2002), or allergens (Herman, Helm, Jung, & Kinney, 2003) are obvious examples. But one could also envisage increasing the content of nutraceutical compounds such as isoflavones (Jung et al., 2000) or augmenting the positive health effects of soy with bioactive soy proteins (Kitts & Weiler, 2003) and bioactive fatty acids (Cahoon et al., 1999).

REFERENCES Adlercreutz, H; Mazur, W. Phyto-oestrogens and Western diseases. Ann Med, 1997, 29, 95120. Anon, Expert Consultation. Energy and Protein Requirements.Geneva: World Health Organization,. (FAO/WHO/UNU; WHO technical report, series, 1985. 724.) Anthony, MS; Clarkson, TB; Hughes, CL; etal. Soybean isoflavones improve cardiovascular risk factors without affecting the reproductive system of peripubertal rhesus monkeys. J Nutr, 1996, 126, 43-50. Ausman, LM; Gallina, DL; Hayes, KC; Hegsted, DM. Comparative assessment of soy and milk protein quality in infant cebus monkeys. Am J Clin Nuts, 1986, 43, l 12-27. Ausman, LM; Harwood, JP; King, NW; Sehgal, PK; Nicolosi, RJ; Hegsted, DM; Liener, IE; Donatucci, D; Tarcza, J. J. Nutr, 1985, 115, 1691. Barnes, S; Sfakianos, J; Coward, L; Kirk, M. Soy isoflavonoids and cancer prevention. Underlying biochemical and pharmacological issues. Adv Exp Med Biol, 1996, 401, 87100. Baten, A; Ullah, A; Tomazic, VJ; Shamsuddin, AM. Inosito-phosphate-induced enhancement of natural killer cell activity correlates with tumor suppression. Carcinogenesis, 1989, 10, 1595-1598. Berry, D. Fortification Update: Beyond Ca2+, A & D. Dairy Foods, 2000, 101(12), 29-31. Berry, D. Healthful Ingredients Sell Dairy Foods. Dairy Foods, 2002, 103(3), 54-56. Bodwell, CE; Miles, CW; Morris, ER; Mertz, W; Canary, JJ Prather, ES. Longterm consumption by children, women and men of beef extracted with soy protein: serum ferritin and zinc levels. Fed Proc, 1983, 42, 529(abstr). Bodwell, CE. Human versus animal assays. In: Wilcke HL; Hop-Ides DT; Waggle DH; eds. Soy protein and human nutrition. New York: Academic Press, 1979, 331-9. Bodwell, CE. Effects of soy protein on iron and zinc utilization in humans. Cereal Foods World, l983, 28, 342-8. Bodwell, CE; Satterlee, LD; Hackler, LR. Protein digestibility of the same protein preparations by humans and rat assays and by in vitro enzymic digestion methods. J Nutr, 1980, 33, 677-86.

72

M.K.Tripathi and S.Mangaraj

Brady, MS; Rickard, KA; Fitzgerald, JF; Lemons, JA. Specialized formulas and feedings for infants with malabsorption or formula intolerance. J Am Diet Assoc, 1986, 86, 19l-200. Brim, CA; Burton, JW. Recurrent selection in soy-beans. II. Selection for increased percent protein in seeds. Crop Sci., 1979, 19, 494-498. Burton, JW. Breeding soybeans for improved protein quantity and quality. In: ed. R. Shibles, Proc. of the World Soybean Res. Conf. III; Westview Press, Inc; Boulder, CO, 1984, 361-367. Burton, JW. Development of high-yielding, high protein soybean germplasm. In: ed. R.F. Wilson, Designing Value-Added Soybeans for Markets of the Future. AOCS, Champaign, IL, 1991, 109-117. Cahoon, EB; Carlson, TJ; Ripp, KG; Schweiger, BJ; Cook, GA; Hall, SE; Kinney, AJ. Biosynthetic origin of comnjugated double bonds: production of fatty acids compo- nents of high-value drying oils in transgenic soybean embryos. Proceedings of the National Academy of Sciences, USA, 1999, 22, 12935-12940. Chang, SS; Shen, GH; Tang, J; Jin, QZ; Shi, H; Carbin, JT; Ho, CT. Isolation and identification of 2-pentenyl-furans in the reversion flavor of soybean oil. J. Am. Oil Chem. Soc, 1983, 60, 553-557. Cheryan J. Phytic acid interactions in food systems. CRC Cm Rev Food Sd Nutr., 1980, 13, 297-335. Christou, P; McCabe, DE; Martinell, BJ; Swain, WF. Soybean genetic engineeringcommercial production of transgenic plants. Trends in Biotechnol, 1990, 8, 145-151. Christou, P; Swain, WF; Yang, NS; McCabe, DE. Inheritance and expression of foreign genes in transgenic soybean plants. Proc. Natl. Acad. Sci. USA, 1989, 86, 7500-7504. Clawson, GA. Protease inhibitors and carcinogenesis: a review. Cancer Invest, 1996,14, 597608. Cook, JD; Morck, TA; Lynch, SR. The inhibitoryeffect ofsoy products on non-heme iron absorption in man. Am J Gin Nutr., 1981, 34, 2622-9. Cossack, ZT; Prasad, AS. Effects ofprotein source on the bioavailability ofzinc in human subjects. Nutr Res., 1983, 3, 23-31. Coward, L; Barnes, NC; Setchell, KDR; Barnes, S. Genistein, daidzein, and their /3-glycoside conjugates: antitumor isoflavones in soybean foods from American and Asian diets. Agrie. Food Chem., 1993, 41, 1961-1967. Eizirik, DL; Migliorini, RH. Protection against streptozotocin dinbetes by high protein diets: effect of a vegetable protein source (soya). Nutr Rep Int., 1985, 32, 41-7. Eldridge, AC; Kwolek, WF. Soybean isoflavones: effect of environment and variety on composition. J. Agrie. Food Chem., 1983, 31, 394-396. Eldridge, AC. Determination of isoflavones in soybean flours, protein concentrates, and isolates. J. Agrie. Food Chem., 1982, 30, 353-355. Elias, R; De Meo, M; Vidal-Ollivier, E. Antimutagenic activity of some saponins isolated from Calendula officinalis L; C.arvensis L. and Hedera helix L. Mutagenesis, 1990, 5, 327-331. Erdman, JW; Jr, Weingartner, KE. Nutritional aspects of fiber soyaproducts. JAmOilChemSoc, l98l, 58, 5l1-514. Erdman, JW. Jr. Soy protein and cardiovascular disease. A statement for healthcare professionals, 2000.

Soy Food in Demand

73

Falco, SC; Guisa, T; Locke, M; Mauvais, J; Sanders, C; Ward, RT; Webber, P. Transgenic canola and soybean seeds with increased lysine. Bio/technol, 1995, 13, 577Fenwick, DE; a Oakenfull, D. Saponin content of food plants and some prepared foods. J. Sci. Food Agrie, 1983, 34, 186-191. Food and Agriculture Organization/World Health Organization. Protein quality evaluation;report of the joint FAO/WHO expert consultation. FAO Food and Nutrition Paper, 1990, 52, Rome, Italy. Forbes, RM; Parker, HM; Erdman, JW. Jr. Effects ofdietary phytate,calcium and magnesium levels on zinc bioavailability to rats. JNutr., l984, ll4, l42l-5. Fordyce, El; Forbes, RM; Robbins, KR; Erdman, JW. Jr. Phytate X calcium/zinc molar ratios: arethey predictive of zinc bioavailability? J Food Sci., 1987, 52, 440-4. Franke, A. Isoflavone content of breast milk and soy formula: Benefits and risks [letter].Clin Chem, 1997, 43, 850-851. Franke, AA; Custer, LJ. Daidzein and genistein concentrations in human milk after soy consumption. Clin Chem, 1996, 42, 955-964. Friedman, M; Brandon, DL. Nutritional and health benefits of soy proteins. Journal of Agricultural and Food Chemistry, 2001, 49, 1069-1086. from the Nutrition Committee of the AHA. Circulation, 102, 2555-2559. Fukutake, M; Takahashi, M; Ishida, K; et al. Quantification of genistein and genistin in soybeans and soybean products. Food Chem Toxicol, 1996, 34, 457-461. Golden, BE; Golden, MHN. Plasma zinc, rate of weight gain and the energy cost of tissue deposition in children recovering from severe malnutrition on a cow‘s milk or soya protein based diet. Am J Clin Nutr, 1981, 34, 892-9. Graf, E; Eaton, JW. Dietary suppression of colonic cancer. Fiber or phytate? Cancer, 1985, 56, 717-718. Graham, KK; Kerley, MS; Firman, JD; Allee, GL. The effect of enzyme treatment of soybean meal on oligosac-charide disappearance and chick growth performance. Poultry Science, 2002, 81, 1014-1019. Hafez, YS. Nutrient composition of different varieties and strains of soybean. Nutr. Rep. Int., 1983, 28, 1197-1206. Hasler, CM. The cardiovascular effects of soy products. Journal of Cardiovascular Nursing, 2002, 16, 50-63. Hatano, K; Kojima, M; Tanokura, M; Takahashi, K. Solution structure of bromelain inhibitor IV from pineapple stem: structural similarity with Bowman-Birk trypsin/chymotrypsin inhibitor from soybean. Biochemistry, 1996, 30, 5379-5384. Herman, EM; Helm, RM; Jung, R; Kinney, AJ. Genetic modification removes an immunodominant allergen from soybean. Plant Physiology, 2003, 132, 36-43. Hilliam, M. The Market for functional Foods. Intl Dairy Journal, 1998, 8, 349-353. Hinchee, MAW; Connor-Ward, DV; Newell, CA; McDon- nell, RE; Sato, SJ; Gaser, CS; Fischhoff, DA; Re, DB; Fraley, RT; Horsch, RB. Production of transgenic soybean plants using Agrobacterium-mediated DNA transfer. Bio/Technol, 1988, 6, 915-922. Hirano, T; Oka, K; Akiba, M. Antiproliferative effects of synthetic and naturally occurring flavonoids on tumor cells of the human breast carcinoma cell line, ZR-75-1. Res CommunChem Pathol Pharmacol, 1989, 64, 69-78.

74

M.K.Tripathi and S.Mangaraj

Hitz, WD; Carlson, TJ; Kerr, PS; Sebastian, SA. Biochemical and molecular characterization of a mutation that confers a decreased raffinosaccharide and phytic acid phenotype on soybean seeds. Plant Physiology, 2002, 128, 650-660. Hopkins, DT; Steinke, FH. J. Am. Oil Chem. Soc., 1981, 58, 452. Horisberger, M; Clerc, MF; a Pahud, JJ. Ultrastructural localization of glycinin and /3conglycinin in Glycine max (soy bean) cv. Maple Arrow by the immunogold method. Histochemistry, 1986, 85, 291-294. Hutchins, AM; Slavin JL; Lampe, JW. Urinary isoflavonoid phytoestrogen and lignan excretion after consumption of fermented and unfermented soy products. J Am Diet Assoc, 1995, 95, 545-551. Hymowitz, T. On the domestication of the soybean. Econ. Bot, 1970, 24, 408-421. in the Food Supply, Dupont J, Osman EM (Ed). Iowa State University Press:Ames, IA. 91-96. Inoue, G; Takahashi, T; Kishi, K; Komatsu, T; and Niiyama, Y. in Protein-Energy Requirements of Developing Countries: Evaluation of New Data, 1981, 36. International Nutritional Anemia Consultative Group. The effects of cereal and legumes on iron availability. Washington,DC: The Nutrition Foundation. 1982. Ireland, PA; Dziedzic, SZ; Kearsley, MW. Saponin content of soya and some commercial soya products by means of high-performance liquid chromatography of the sapogenins. J. Sci. Food Agrie., 1986, 37, 694-698. Istfan, N; Murray, E; Janghorbani, M; Evans, WJ; Young, VR. J. Nutr., 1983, 113, 2524. Jenkins, DJA; Wolever, TMS; Taylor RH; et al. 1981. Glycemic index of foods; a physiological basis forcarbohydrate exchange. Am J Clin Nutr,34,362-6. Jung, W; Yu, O; Lau, SM; O.Keefe, DP; Odell, J; Fader, G; McGonigle, B. 2000. Identification and expression of isofla vone synthase, the key enzyme for biosynthesis of isoflavones in legumes. Nature Biotechnology, 18, 208-212. Kakade, ML; Hoffa, DE & Liener, IE. 1973. Contribution of trypsin inhibitors to the deleterious effects of unheated soy beans fed to rats. J. Nutr. 103, 1772-1778. Karr SC; Lampe JW; Hutchins AM; Slavin JL. 1997.Urinary isoflavonoid excretion is dose dependent at low to moderate levels of soy-protein consumption. Am J Clin Nutr,66,4651. Kennedy AR. 1995. The evidence for soybean products as cancer preventive agents. J Nutr,125,733S-743S. Ketelsen SM; Stuart MA; Weaver CM; Forbes RM; Erdman JW Jr. 1984 Bioavailability of zinc to rats from defatted soy flour, acidprecipitated soy concentrate and neutralized soy concentrate as determined by intrinsic and extrinsic labeling techniques. J Nutr, 14,53642. Kies C; Fox HM. 1971. Comparison ofthe protein nutritional value of TYP, methionineenriched TVP, and beefat two levels of intake for human adults. J Food Sd,36,84l-5. Kies, C; and Fox, H.M. 1971. J. Food Science 36, 841. Kirkman LM; Lampe JW; Campbell DR; et al. 1995.Urinary lignan and isoflavonoid excretion in men and women consuming vegetable and soy diets. Nutr Cancer,24,1-12. Kitagawa, I; Wang, H. K; Taniyama, T. &.Yoshikawa, M.1988b. Saponin and sapogenol. XLI. Reinvestigation of the structures of soyasapogenols A, B, and E, oleanenesapogenols from soybean, structures of soyasponins I, II, and III. Chem. Pharm. Bull. (Tokyo) 36, 153-161.

Soy Food in Demand

75

Kitamura, K. 1995. Genetic improvement of nutrional and food processing quality in soybean. Japan Agricultural Research Quarterly, 29, 1-8. Kitts, DD; Weiler, K. 2003. Bioactive proteins and peptides from food sources. Applications of bioprocesses used in isola- tion and recovery. Current Pharmaceutical Design, 9, 1309- 1323. Kolar, CW. 1982. Isolated Soy Protein, Central States Section, Twenty Third Annual Symposium, Am. Assoc. of Cereal Chemists, St. Louis. Kudou, S; Tonomura, M, Tsukamoto, C; Uchida, T. Sakabe, T; Tamur, N; Okubo, K. 1993. Isolation and structural elu cidation of DDMP-conjugated soyasaponins as genuine saponins from soybean seeds. Biosci. Biotechnol. Biochem. 57, 546-550. Lei, XG; Ku, PK; Miller, ER; Yokoyama, MT. 1993. Sup-plementing corn-soybean meal diets with microbial phytase linearly improves phytate phosphorus utilization by weanling pigs. Journal of Animal Science, 71, 3359-3367. Levington, R. 1987. Use of Whole Soybeans by the Consumer. In Cereals and Legumes Liener, IE. 1981. Factors affecting the nutritional quality of soya products. J. Am. Oil Chem. Soc. 58, 406-415. Liu K. 1997a. Agronomic Characteristics, Production, and Marketing. In Soybeans:Chemistry, Technology, and Utilization, Liu K. Chapman & Hall: New York, NY.p 1-24. Liener, IE. 1981. J. Am. Oil Chem. Soc. 58, 406. Liener, LE. 1980. Toxic Constituents of Plant Foodstuffs, Academic Press, New York. Liu, K. 1997c. Non fermented Oriental Soyfoods. In Soybeans: Chemistry, Technology,and Utilization, Liu K. Chapman & Hall: New York, NY. p 137-217. Liu, K. 1997d. Fermented Oriental Soyfoods. In Soybeans: Chemistry, Technology, and Utilization, Liu K. Chapman & Hall: New York, NY. p 218-296. Locklear, M. 2000. Functional Foods: The Road Ahead. Food Product Design. September 712. Lykken, GI; Hunt, JR. Nielsen, EJ; Dintzis, FR. l987. Availability of soybean hull iron fed to humans in a mixed, Western meal. J Food 5th,52,1545-8. Lynch, SR; Dassenko, SA ; Morck, TA; Beard, JL; Cook, JD. l985. Soy protein productsand heme iron absorption in humans. Am J Clin Nutr,4l,13-20. Madar, Z. 1983. Effects of brown rice and soybean dietary fiber on the control of glucose and lipid metabolism in diabetic rats. Am J Clin Nutr, 38,388-93. McCabe, DE; Swain, WF; Martinell, BJ; Christou, P; 1988. Stable transformation of soybean (Glycine max) by particle acceleration. Bio/Technol; 6, 923-926. MC, Toullec, R.; Lalles, JP. 2002. Legume grain enhances ileal losses of specific endogenous serine-protease proteins in weaned pigs. Journal of Nutrition 132, 1913-1920. Messina M; Barnes S. 1991. The role of soy products in reducing risk of cancer. J Natl Cancer Inst,83,541-546. Messina M. 1995. Modern Applications for an Ancient Bean: Soybeans and the Prevention and Treatment of Chronic Disease. First International Symposium on the Role of Soy in Preventing and Treating Chronic Disease. 1994. Feb. 20-23, Mesa, AZ. J Nutr 125,567S569S Messina, M; Gardner C; Barnes, S. 2002. Gaining insight into the health effects of soy but a long way still to go. Journal of Nutrition, 132, 547S-551S

76

M.K.Tripathi and S.Mangaraj

Messina, M; a Barnes, S. 1991. The role of soy products in re ducing risk of cancer. J. Nati. Cancer Inst. 83, 541-546. Miles CW; Bodwell CE; Morris E; et al. 1987. Long-term consumption ofbeefextended with soy protein by men, women and children. I Study design, nutrient intakes and serum zinc levels. Plant Foods Hum Nutr, 37,341-59. Morton MS; Wilcox G; Wahlqvist ML; Griffiths K. 1994. Determination of lignans and isoflavonoids in human female plasma following dietary supplementation. JEndocrinol,142,251-259. Nair PP; Turjman N; Kessie G; et al. 1984. Diet, nutrition intake, and metabolism in populations at high and low risk for colon cancer. Dietary cholesterol, beta-sitosterol, and stigmasterol. Am J Clin Nutr,40,927-930. Naude SPE; Prinsloo JG; Haupt CF; 1979. Comparison between a humanized cow‘s milk and a soy product for premature infants. S Afr Med J,55,982-6. Oreffo VI; Billings PC; Kennedy AR; Witschi H. 1991. Acute effects of the Bowman-Birk protease inhibitor in mice. Toxicology, 69,165-176. Ortheofer FT. 1978. Processing and Utilization. In Soybean Physiology, Agronomy, andUtilization, Norman AG. (Ed). Academic Press, Inc. p 219-246. Potter, SM. 2000. Soy—new health benefits associated with an ancient food. Nutrition Today 35, 53-60. Prattley, CA; Stanley, DW. 1982. Protein-phytate interact tions in soybeans. I. Localization of phytate in protein bodies and globoids. J. Food Biochem. 6, 243-253. Price, KR; Johnson, IT; a Fenwick, G. R.1987. The chemistry and biological significance of saponins in foods and feedingstuffs. Crit. Rev. Food Sci. Nutr. 26, 27-135. Probst, AH; Judd, RW. 1973. Origin, US History and Development, and World Distribution. In: ed. B.E. Caldwell, Soybeans: Improvement, Production, and Uses. Agron. Mongr.16, 1st ed. ASA, CSSA, and SSSA, Madison, WI, pp. 1-15. Rackis, JJ; McGhee, JE; Booth, AN. 1975. Biological threshold levels of soybean trypsin inhibitors by rat bioassay. Cereal Chem,52,85-92. Rackis, JJ; Wolf, WJ; a Baker, EG. 1986. Protease inhibitors in plant foods: content and inactivation. In: Nutritional and Toxicological Significance of Enzyme Inhibitors in Foods (Fried man, M; éd.), pp. 299-347. Plenum Press, New York, NY. Rakosky, J, Jr; and Sipos, E.F. 1974. in Food Service Science, S. Smith and T.J.Minor, AVI Publishing Company, Westport, CT, p. 383. Rao, PS; Liu, XK; Das, DK; et al. 1991. Protection of ischemic heart from reperfusion injury by myo-inositol hexaphosphate, a natural antioxidant. Ann Thorac Surg, 52,908-912. Reinli, K; Block, G. 1996. Phytoestrogen content of foods a compendium of literature values. Nutr Cancer,26;123-148. Riaz, MN 2000. Functional Foods for a Modern Health Program. American Soybean Association. Presented at the Third Annual Soy Conference-Japan, May 13, Rogers, P. 2001. Helping The Medicine Go Down-Part I. Candy Industry. 166,36-40. Salgado, P; Montagne, L; Freire, JPB; Ferreira, RB; Teixeria, A; Bento, O; Abreu, Sandstrom, B; Anderson, H; Kivisto, B; Sandberg, AS. 1986. Apparent small intestinal absorption ofnitrogen and minerals from soy and meat protein-based diets. A study ofhuman ileostomy subjects. J Nutr, 1 16,2209-18. Sandstrom B; Cederblad A. l980. Zinc absorption from composite meals. II Influence of the main protein source. Am J Clin Nutr,33,1 178-83.

Soy Food in Demand

77

Sandstrom, B; Kivisto, B; Cederblad, A. 1987. Absorption ofzinc from soy protein meals in humans. J Nutr, 1 17,32 1-7. Sarwar, G. 1997. The protein digestibility-corrected amino acid score method overestimates quality of proteins containing antinutritional factors and of poorly digestible proteins supplemented with limiting amino acids in rats. Journal of Nutrition 127, 758-764. Schaafsma, G. 2000. The protein digestibility-corrected amino acid score. Journal of Nutrition 130, 1865S- 1867S. Schelp, FP; Pongpaew, P. 1988. Protection against cancer through nutritionally-induced increase of endogenous proteinase inhibitors a hypothesis. Int J Epidemio,17,287-292. Scott, WO; Aldrich, SR. 1983. Soybeans, Food, Feed and Future. In Modern Soybean Production, Scott WO, Aldrich SR. S & A Publications, Inc.: Champaign, IL. P 209-219 Scrimshaw, NS; Young, YR. 1979 Soy protein in adult human nutrition: a review with new data. In: Wilcke HL, Hopkins DT, Waggle DH, eds. Soy protein and human nutrition. New York: cademic Press:121-43. Scrimshaw, NS; Young, VR. 1979. in Soy Protein and Human Nutrition, Setchell KD; Zimmer-Nechemias L; Cai J;Heubi JE. 1997. Exposure of infants to phytooestrogens from soy-based infant formula. Lancet,350,23-27. Solomons NW; Janghorbani M; Ting BTG, et al. 1982. Bioavailability of zinc from a diet based on isolated soy protein. Application in young men on the stable isotope tracer, 70ZN. J Nutr, 112, 1809-21. Soy Protein Council (1984) Assessment of the Significance of Trypsin Inhibitors in Foods for Humans, Position Paper, Washington, D.C. Soyatech. 2003. New soyfoods market study shows Americans love their soy. Available on the World Wide Web: http:// www.soyatech.com. St Clair, WH; Billings, PC; Carew, JA; 1990 .Suppression of dimethylhydrazine-induced carcinogenesis in mice by dietary addition of the Bowman-Birk protease inhibitor. Cancer Res,50,580-586. St Clair, WH; St Clair, DK. 1991. Effect of the Bowman-Birk protease inhibitor on the expression of oncogenes in the irradiated rat colon. Cancer Res,51,4539-4543. Stuart, MA; Ketelsen, SM; Weaver, CM; Erdman, JW Jr. Bioavailability of zinc to rats as affected by protein source and previous dietary intake. J Nutr 1986; 1 16,1423-3 1. Sutardi & Buckle, KA. 1985. Phytic acid changes in soybeans fermented by traditional inoculum and six strains of Rhizopus oligosporus.}. Appi. Bacteriol. 58, 539-543. Taylor, PG. Martinez-Torres C; Romano EL Layrisse M. l986. The effect of cysteinecontaining peptides released during meat digestion on iron absorption in humans. Am J Gin Nutr, 43,68-71. Tew BY; Xu X; Wang HJ; et al. 1996 A diet high in wheat fiber decreases the bioavailability of soybean isoflavones in a single meal fed to women. J Nutr,126,871-877. Theodore, S.2001. Fortified beverages with staying power. Beverage Industry,92,57-62. Tischle,r L. 2002. Deep pockets, open minds. Fast Company. 58,32-34. Torun, B; Viteri, FE; Young, YR. 198l. Nutritional role of soya protein for humans. 3 Am Oil Chem Soc; 58,400-6. Torun, B198l Soybeans and soy products in the feeding of children. J Am Oil Chem Soc,58,460-4. Torun, B. 1979.in Soy Protein and Human Nutrition Torun, B. 1981. J. Am. Oil Chem. Soc. 58, 460.

78

M.K.Tripathi and S.Mangaraj

Torun, B; Pineda, O; Viteri, F.E; and Arroyave, G. 1981. in Protein Quality inHumans: Assessment and In-Vitro Estimation, Bodwell, C.E; Adkins, J.S; and Hopkins, D.T; AVI Publishing Company, Westport, CT, p. 374. United States Department of Agriculture 1986. Dietary guidelines for americans. Washington, DC USDA,. (Home and garden bulletins 232-I through 232-7). Vucenik I; Tomazic VJ; Fabian D; Shamsuddin AM. 1992. Antitumor actitivity of phytic acid (inositol hexaphosphate) in murine transplanted and metastatic fibrosarcoma, a pilot study. Cancer Lett,65;9-13. Wang, H; Murphy, PA. 1994b.Isoflavone composition of American and Japanese soybeans in Iowa: effects of variety, crop year, and location. J. Agrie. Food Chem. 42, 1674-1677. Wayler, A; Queiroz, E; Scrimshaw, NS; Steinke, HI; Rand, WM; Young, YR. 1983 Nitrogen balance studies in young men to assess the protein quality of an isolated soy protein in relation to meat proteins. J Nuts, 113,2485-91. Widholm, JM; 1993. Retraction. Plant Physiol; 102, 331. Wilcke, HL; Hopkins, DT; and Waggie, DH; Academic Press, New York, p. 121. Wilcox, JR; Cavins, JF. 1995. Backcrossing high seed protein to a soybean cultivar. Crop Sci; 35, 1036-1041. Wilcox, JR; Burton, JW; Rebetzke, GJ; Wilson, RF. 1994. Transgressive segregation for palmitic acid in seed oil of soybean. Crop Sci; 34, 1248-1250. Wilding, MD. 1974. J. Am. Oil Chem. Soc. 51, 128A. Willett, WC; 1994. Diet and health: What should we eat? Science, 274, 532-537. Woodworth, JC; Tokach, MD; Goodband, RD; Nelssen, JL; O.Quinn, PR; Knabe, DA; Said, NW. 2001. Apparent ileal digestibility of amino acids and the digestible and metabolizable energy content of dry extruded-expelled soybean meal and its effects on growth performance of pigs. Journal of Animal Science, 79, 1280-1287. Xu, Ban; Zhen, Huiyu; Lu, Qinhua; Zhao Shuwen; Hu Ziang, 1989. Three evidences of the original area of soybean. In: Proc. of World Soybean Res. Conf. IV. Assoc. Argentina de la Soja, Buenos Aires, Argentina, pp. 124-128. Xu, X; Harris, KS; Wang, HJ; et al. 1995.Bioavailability of soybean isoflavones depends upon gut microflora in women. J Nutr,125,2307-2315. Yavelow, J; Finlay, TH; Kennedy, AR; Troll, W. 1983.Bowman-Birk soybean protease inhibitor as an anticarcinogen. Cancer Res,43,2454S-2459S. Young, YR. Wayler, A; Garza, C; et al. 1984. A long-term metabolic balance study in young men to assess the nutritional quality of an isolated soy protein and beef protein. Am 3 Clin Nuts;39,8-15. Young, VR; Puig, M; Queiroz, E; Scrimshaw, NS; Rand, WM. 1984. Am. J.Clin. Nutr. 39, 6. Young, VR; Wayler, A; Garza, C; Steinke, FH; Murray, E; Rand, WM; Scrimshaw, NS. 1984 Am. J. Clin. Nutr. 39, 8. Zezulka, AY; Calloway, DH. 1976 Nitrogen retention in men fed varying levels of amino acids from soy protein with or without added L-methionine. J Nutr , 106,212-21.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 3

PROCESSED FOODS FROM SOYBEAN SEEDS IN JAPAN AND THE CHARACTERISTICS Toshikazu Nishiwaki*1, Keiko Morohashi≠1, Satoshi Watanabe±1, Sayaka Shimojo‡1 and Takuji Ohyama¥2 1

Food Research Center, Niigata Agricultural Research Institute, Niigata, Japan 2 Faculty of Agriculture, Niigata Universtity, Niigata, Japan

ABSTRACT The average life span in Japan was 83 years old (women 86.08, men 79.29) in 2009, and that of women was the longest in the world. This may be partly due to low fat Asian dishes with rice, soybean products, fish, and vegetables. Soybeans originated from East Asia, and Japanese people eat many traditional foods made from soybeans, such as Shoyu, Miso, Tofu, Natto etc. Soybean seed is one of the most important protein sources for humans and livestock all over the world. The amino acid composition of soybean is relatively well balanced, although soybean seeds contain a relatively low amount of sulfur amino acids, methionine, and cysteine. Soybean seeds contain a large amount of lipids, minerals, and vitamins. Soybean seeds also contain isoflavonoids, daidzein and genestein, and other components to keep human health well. The isoflavonoids are expected to play a role like a female hormone or to decrease fat in blood. In this chapter, we would like to introduce the nutritional value of soybean seeds, and the production, cooking and nutrition of some traditional Japanese soy foods, such as Shoyu (soy sauce), Miso (fermented soy paste), Tofu (soy curd), and Natto (fermented soybean with bacteria). In addition, recent advances in the physiological effects of soy protein and processed foods in Japan are introduced.

* Toshikazu Nishiwaki: [email protected] ≠ Keiko Morohashi: [email protected] ± Satoshi Watanabe: [email protected] ffi Sayaka Shimojyo: [email protected] ¥ Takuji Ohyama: [email protected]

80

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

1. NUTRITION OF SOYBEAN SEEDS 1) Introduction The world population is increasing and sufficient supply of food is essentially important in the whole world as well as in each country. The world population was 6.8 billion in 2009, and the total amounts of annual crop production have met the demand of total human nutrition. However, about 800 million people faced severe hunger due to poverty. The world population is still increasing and it is estimated to be 9.1 billion in 2050. Sufficient supply of sustainable food is essential.. Food balance sheets in 2003 showed that self-suffiency rate of grain (percentage of total grain production per total amout of production + import – export) in Australia (333), and Argentina (249) were the highest. Thailand (162), Myanmar (131), Vietnam (127), Laos (123) and Cambodia (122) were relatively high in Asia. China (100), India (98) Indonesia (89), the Philippines (82) were well balanced. However, Japan (27) and Korea (28) are in a critical situation. Meat consumption increases rapidly in developing countries. However, meat production requires a large amount of crops. The production of 1 kg of chicken, pork, and beef require about 2, 5 and 8 kg of crops. Therefore, it is important that humans depend directly on the proteins from plant sources rather than animal sources to provide sufficient foods for the increasing population. Human happiness depends on a long life span and a healthy life. The average life span in the world varies widely; 60-80 years old in most Asian, European, and American countries, but only about 40 years old in many African countries due to malnutrition, diseases, and war. In 2009, the average life span in Japan was 83 years old (women 86.08, men 79.29) and that of women is the longest in the world. About 36,000 people are over 100 years old in Japan. This is mainly due to sufficient supply of food, especially protein after World War II, about 1950, and to the low fat Asian dishes with rice, soybean products, fish, and vegetables. However, Westernization of the Japanese diet causes geriatric disorders, such as corpulence (fat), hypertension (high blood pressure), diabetes, heart attack, and colon (the large intestine) cancer. In Japan, the percentage of lipid intake changed from 15% to 28%, and that of carbohydrate decreased 72% to 58% from 1965 to 1990 (Fushiki et al. 2005). During this time, the number of patients with hypertension, anemia of the brain, cancer, and diabetes has increased twice as much. Human needs to take five nutrient components: carbohydrates (sugar), lipids, proteins, vitamins, and minerals at certain levels. The amount of each nutrient should be adequate between deficient and excess levels. The first function of food is its ―nutrition‖. The second function of food is its good taste and flavor. The third function of food is proposed that ―nonnutritional function‖, which is beneficial for human health except for nutrition or medicine. Soybean originates from East Asia, and Japanese people eat many traditional foods made from soybean, such as Shoyu (soy sauce), Miso (fermented soy paste), Kinako (ground powder of parched soybean seeds), Natto (fermented soybean seeds by bacteria), boiled beans, Soymilk, Okara (residues of soymilk extraction), Tofu (soymilk curd), Yuba (Thin surface membrane produced in boiling soymilk for Tofu production), Ganmodoki (Fried Tofu with sea weeds and other materials), Abura-age (fried Tofu), soybean oil, etc (Figure 1).

Processed Foods from Soybean Seeds in Japan and the Characteristics

Kinako

81

Natto Boiled bean

Miso

Soymilk

Okara

Shoyu Soybean

Tofu Oil Fried Tofu

Ganmodoki

Yuba

Figure 1. Traditional soybean foods in Japan.

Soybean seed is one of the most important protein sources for humans and livestock all over the world. The amino acid composition of soybean is relatively well balanced, although soybean seeds contain a relatively low amount of sulfur amino acids, methionine, and cysteine. Soybean seeds also contain a large amount of lipids, and minerals and vitamins. The third function of soybean is interesting. Soybean seeds contain isoflavonoides, daidzein, and genestein. These isoflavonoids play a role similar to a female hormone. They also decrease fat in blood.

2) Soybean as an Important Crop for Nutrition and Improving Human Health Soybean (Glycine max (L.) Merr.) seed production was 231 million t year-1 in 2008 (FAOSTAT), accounting for half of all the leguminous grain crops due to its nutritional value both for human and livestock. Major soybean production countries include (annual production million t year-1 in 2008), USA (81), Brazil (60), Argentina (46), China (16), and India (9). The world average seed yield was 2.38 t ha-1 in 2008. Soybean production in Japan was 227,000 t, and the seed yield was 1.64 t ha-1 in 2008. Soybean seeds contain an extraordinary high concentration of protein. Therefore, they require a large amount of N through growth stages. They can fix dinitrogen (N2) in the air by the symbiotic association with soil bacteria rhizobia. Authors have published the book entitled ―Nitrogen Fixation and Metabolism in Soybean Plants‖ (Ohyama et al. 2009). Soybean originates from East Asia, and Japanese people eat many traditional foods made with soybean, (Figure 1). Soybean seeds contain storage protein in the protein body (Figure 2)

82

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

and lipid in the lipid body in the cotyledon cells. Different from cereal crop seeds, starch is usually not included in mature soybean seeds. The composition (per 100 g of edible part) of soybean seeds produced in Japan is as follows; Energy 417 kcal (1,745 kJ), water 12.5 g, protein 35.3 g, lipids 19.0 g, carbohydrate 28.2, minerals 5 g. The composition is quite different from cereal crop seeds, such as paddy rice (Figure 3A); Energy 350 kcal (1,464kJ), water 15.5 g, protein 6.8 g, lipids 2.7 g, carbohydrate 73.8 g, minerals 1.2 g: wheat; Energy 337 kcal (1,410 kJ), water 12.5 g, protein 10.6 g, lipids 3.1 g, carbohydrate 72.2 g, minerals 1.6 g,: and corn; Energy 350 kcal (1,464 kJ), water 14.5 g, protein 8.6 g, lipids 5.0 g, carbohydrate 70.6 g, minerals 1.3 g per 100 g of edible part (All Guide, Standard Tables of food composition in Japan, 2009).

A

B Figure 2. Accumulation of storage protein body in cotyledon cells of soybean seeds. A: Soybean seeds, B: Microphotograph of soybean seed slice in which protein was stained by Coomassie Brillant Blue. Red circle shows a cell. Yellow circle shows a protein body, which accumulate storage protein.

Soybean seed is one of the most important protein sources for human and livestock. The amino acid composition of soybean is relatively well balanced, although soybean seeds contain a relatively low amount of sulfur amino acid methionine and cysteine (Figure 3B). On the other hand, rice protein contains higher levels of methionine and cysteine, although a low

Processed Foods from Soybean Seeds in Japan and the Characteristics

83

level of lysine. Therefore, by eating soybeans and rice together, the balance of amino acid composition compensates for each other, and becomes very good. The storage protein of soybean seeds mainly consists of glycinin and -conglycinin, and the level of sulfur amino acids is quite low in -conglycinin. The -conglycinin comprises three subunits, designated as ‘, and -subunits. The -subunit of -conglycinin is especially low in sulfur amino acids, containing only one cysteine and no methionine residue in its mature form. Of the three subunits of -conglycinin, the -subunit genes are known for their unique expression. The accumulation of -subunit of -conglycinin is reported to be affected by S-nutrition, it increased under S-deficient conditions, and it decreased under S-sufficient conditions. On the other hand, the accumulation of -subunit of -conglycinin is depressed by N deficiency (Ohtake et al. 1996, 1997). Soybean

13 5

35

28

Protein Lipid Carbohydrate Minerals Water

19

Rice

16

7

3

1 Protein Lipid Carbohydrate Minerals Water

73

A Figure 3. Continued

84

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

180 160 140 120 100

Soybean Rice

80 60 40 20

al in e V

ip to ph an e

Tr

Th

re o

ni ne

yp ro H

ys Pr o+

sin e Ly

Le uc in e

M et +C

Is

ol eu ci

ne

0

B

C Figure 3. Nutrition of soybean seeds. A: Comparison of seed nutrient composition in soybean seeds and rice grains. B: Comparison of essential amino acids in soybean seeds and rice grains. C: Snacks and supplementary foods using soybean seeds.

Although soybean seeds contain about 28% carbohydrates, most of it is a structural carbon-like cell wall, and oligosaccharides (sucrose 5%, stachyose 4%, raffinose 1%). Starch is accumulated in young soybean seeds before maturation. However, it decreases and is converted to lipid and protein at maturity. Stachyose is an effective sugar that promotes the proliferation of good intestine bacteria and bacillus for Natto fermentation. Soybean seeds contain a large amount of lipid (20%), and the composition is 80% of unsaturated fatty acid (linoleic acid 54%, oleic acid 34% and linolenic acid 5%) and saturated fatty acid (palmitic acid 5%, stearic acid 5% ). Linoleic acid and linolenic acid are essential lipids, which we cannot synthesize by ourselves. Soybean seeds contain a relatively high amount of minerals (5%) compared with cereal seeds (about 1%), especially abundant in potassium (1900 mg), calcium (240 mg), Magnesium (220 mg), Phosphorous (220 mg), iron (9.4 mg), and Zinc (3.2 mg) per 100 g seeds. Soybean seeds contain vitamins, lipid soluble vitamin (Vitamin E (1.8 mg)), and water-soluble vitamins (V B1 (0.83 mg) and V B2 (0.30

Processed Foods from Soybean Seeds in Japan and the Characteristics

85

mg)). Snacks and supplementary foods made from soybeans have become popular in Japan (Figure 3C). As a secondary function (taste and flavor), soybean seeds contain a specific bean odor due to various volatile compounds. Lipoxygenase catalyzes linoleic acid to n-hexanal, which is an unpleasant odor of bean and soymilk. There are several lines of soybean, which lack lipoxygenase by gamma-ray irradiation. The third function of soybean has attracted many food companies. Soybean seeds contain isoflavonoids, daidzein, and genestein (Figure 4). Due to the structural resemblance, isoflavonoids have female hormone-like activity at 1/1000 of estrogen (Solomon, et al. 2000). These flavonoids appeared to be effective for female steroid hormone related disease and to decrease the risk of breast cancer, heart disease, and osteoporosis (Solomon, et al. 2000). The flavonoids seem to work as estrogen blockers in the human body, which bind to receptors of estrogen. On the other hand, flavonoids improve menopausal symptoms, substituting for the human steroid. In this chapter, we would like to introduce traditional foods produced from soybean, Shoyu, Miso, Tofu, Natto, and current uses of soy protein for health promoting materials in Japan.

Figure 4. Structures of isoflavonoids in soybean seeds and estrogen. Soybean seeds contain high amounts of isoflavones, daizein and genistein. These compounds act like female hormone estrogen, although activity is 1/1000.

2. SHOYU (SOY SAUCE) 1) Introduction ―Shoyu‖ (Soy sauce) is a traditional liquid seasoning in Japan and is now used as allpurpose seasoning worldwide. The term ―Soy‖ was originated from ―Shoyu‖ via Dutch ―Soja‖ (Tochikura, 1988). Shoyu is a fermented liquid seasoning from soybean seeds essential for various Japanese-style dishes. Shoyu contains salt and has a special taste and flavor. It is produced through fermentation. Shoyu is directly used to put in a dish for dipping Sushi or Sashimi (sliced raw fish). It is also used to give taste and flavor to soup or to cook meat, fish, and vegetables. Shoyu originated in China 2,500 years ago, spreading to East and

86

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Southeast Asia. ―Kokubishio‖, which is the origin of Shoyu made from bean seeds or cereals, was recorded in Japan about 700 AC (Soy sauce, URL). It is thought that the production of Shoyu had been established around 1500 AC (Tochikura, 1988). The export of Shoyu started in 1647 by Dutch East India Company. In 1957, Japanese company started to sell soy sauce in the US. They built a soy sauce factory in Wisconsin in 1973 (Hamano and Origasa, 2010). At present, about 20% of total consumption of Shoyu is outside Japan.

2) Types of Shoyu According to Japanese Agricultural Standard (JAS), there are five types of Shoyu as follows. Figure 5 shows the color of these soy sauces.

Figure 5. Diagram of shoyu (soy sauce) production.

1. Koikuchi-shoyu (dark color): Koikuchi-shoyu is a typical soy sauce in Japan and shares about 83% of total production. The color of Koikuchi-shoyu is dark brown, which is made from almost equal amounts of soybean seeds and wheat cereals. Koikuchi-shoyu can be used for every purpose, and it has well balanced salt, acidity, umami, taste, and flavor. 2. Usukuchi-shoyu (light color): Usukuchi-shoyu is a light color soy sauce and shares about 13.9 % of total production in Japan. Usukuchi-shoyu is made from almost equal amounts of soybean seeds and wheat cereals with a higher salt concentration and less flavor. Usukuchi-shoyu is often used for cooking since it does not disturb the original colors and taste of ingredients.

Processed Foods from Soybean Seeds in Japan and the Characteristics

87

3. Tamari-shoyu (black color): The color of Tamari-shoyu is darker than Koikuchishoyu and almost black. It is made from only soybean seeds, and has a strong taste and is more viscous than Koikuchi-shoyu. Tamari-shoyu shares about 1.5 % of total production in Japan, and is used for Sashimi. 4. Shiro-shoyu (transparent): Shiro-shoyu is transparent liquid soy sauce and shares about 0.7% of total production in Japan. Shiro-shoyu is made from only wheat cereals, has less taste and flavor, and more sweetness than Koikuchi-shoyu. Shiroshoyu is mainly used for pickles. 5. Saishikomi-shoyu (twice-blewed): Saishikomi-shoyu is made from almost equal amounts of soybean seeds and wheat cereals, and fermented with soy sauce instead of salt water. The color, taste, and flavor are stronger than Koikuchi-shoyu. Saishikomi-shoyu shares about 0.8 % of total production in Japan, and is used for dipping Sashimi. According to salt concentration, varius type of soy sauce is provided as follows: 1. Gen-en-shoyu (reduced salt): This Shoyu contains 50% less salt than regular soy sauce. 2. Usu-jio-shoyu (light salt): This type contains 20% less salt than a regular soy sauce.

3) Processing Method of Soy Sauce There are three processing methods of Shoyu by JAS (Japan Agricultural Standard), Honjyozo, Kongojyozo, and Kongo. Chemical Shoyu (amino acid liquid) is made without fermentation but is produced by chemical hydrolysis with hydrochloric acid or enzymatic hydrolysis of beans or other protein materials, then neutralized with sodium hydroxide. 1. Honjyozo (Genuine fermented): Contains 100% genuine fermented product. 2. Kongojyozo (fermentation of the mixture of fermented and chemical Shoyus): Contains genuine fermented soy sauce mixed with 30-50% of chemical hydrolysate of plant protein and then fermented again. 3. Kongo (mixture of fermented and chemical Shoyu): Contains Honjyozo or Kongojyozo soy sauce mixed with 30-50% of chemical hydrolysate of plant protein. All types of Koikuchi-shoyu are graded with three official levels of quality. 1. Standard grade: Contains more than 1.2% of total nitrogen. 2. Upper grade: Contains more than 1.35% of total nitrogen. 3. Special grade: Contains more than 1.5% of total nitrogen. In this chapter, we would like introduce the most popular method for Honjyozo Koikuchi-shoyu (Figure 6,7).

88

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Figure 6. Various kinds of shoyu (soy sauce). A: Various kinds of shoyu are sold in a pet bottle. B: Comparison of the color of five types of shoyu. Upper cups: From left to right, Siro-shoyu, Usukuchishoyu and Koikuchi-shoyu, respectively.Lower cups: Saishikomi-shoyu and Tamari-shoyu, respectively.

Figure 7. Photographs of microorganisms essential for fermentation of Shoyu A: Koji fungi (Aspergillus sojae), B: Lactic acid bacteria (Tetragenococcus halophilus) C: Yeast (Zygosaccharomyces rouxii) Photoes are kindly privided by Kikkoman Institute for International Food Culture) URL: http://kiifc.kikkoman.co.jp/tenji/tenji01/hakkou.html)

Processed Foods from Soybean Seeds in Japan and the Characteristics

89

1. Treatment for Soybean Seeds Soybean seeds, or the defatted soybean cake, are steamed in a pressure cooker. One typical factory method uses a rotating tank, in which 120-130% of cold water against seed weight is added to the soybean material, and steamed at about 120oC for 40-60 minutes (Figure 7A). Soybean seeds become soft and proteins are denatured and sterilized. 2. Treatment for Wheat Seeds Wheat seeds are parched at about 170oC, and broken into 3 mm pieces (Figure 7B). This treatment promotes -starch formation, sterilization, and decreasing water content in wheat seeds. 3. Store in Container and Making “Koji” Koji is the microbial product, in which crops, such as rice, barley, or soybean were inoculated with fungi like ―Koji-kabi‖ (Koji fungi). Koji is used for fermentation of ―Sake‖ (rice wine), Shoyu (soy sauce), and Miso (soybean paste). In shoyu production, treated soybean is mixed with parched wheat, and sprayed with a suspension of Koji-kabi Aspergillus genus. (Figure 8A) It is incubated at 25-30oC for about 45 hours under 95% moisture conditions (Figure 7C)). Often, materials are mixed until the Koji is made (Figure 7D).

Figure 8. Practical production of shoyu in factory. A: The rotating tank for steaming soybean seeds or defatted soybean cake at about 120 oC for 40-60 min. B: Parching apparatus of wheat seeds. C: The apparatus for making Koji. It is incubated at 2530°C for about 45 hours under 100% moisture conditions. D: Koji from defatted soybean (left) and whole soybean seeds (right). E: Moromi is fermented and incubated for 4-10 months in a large size tank. F: A fermenting Moromi in a tunk. G: A filtration apparatus for soy sauce production. The fermented materials are filtered by several layers of filter cloth by pressing. H: A bottling machine for putting soy sauce in a pet bottle.

90

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

4. Mixing with Salt Water Koji is mixed with salt water (salt concentration at 20-30%) under 15 oC. 5. Fermentation and Incubation Proteins and carbohydrates in soybean seeds and wheat seeds are hydrolyzed by the enzymes of microorganisms in Koji. Temperature is kept at 15 oC during initial phase of incubation. Lactic acid bacteria from Koji or inoculated bacteria, like Tetragenococcus halophilus, (Figure 8B) decreases the pH. After a two-month incubation, the inoculant of salt tolerant yeast（Zygosaccharomyces rouxii） (Figure 8C) is added to the Koji and it continues to incubate at 30 oC for 4-10 months in a large size tank (Figure 7E). Sometimes, the inoculant of yeast （Candida etchellsii, Candida versatilis）is added after incubation. During the incubation period, most of the proteins are broken down to peptides or amino acids, and carbohydrates are degraded into sugars such as glucose or oligosaccharides. Some kinds of yeast ferment these sugars into various types of alcohol, and fragrance. During the incubation period, some amino acids and sugars react to make a brown color through a Maillard reaction, and the product is called ―Moromi‖ mash (Figure 7F). 6. Filtration The fermented materials are filtered by several layers of filter cloths (Figure 7G). The filtrate is called ―Ki-shoyu‖ which means raw Shoyu. 7. Pasteurization The filtrate liquid is pasteurized over 85oC in order to decrease the activities of microorganisms and enzymes. With the addition of a fragrant such as pyrazine, franone is formed during pasteurization, and it will make a rich flavor. 8. Bottling Shoyu is bottled in a PET bottle (Figure 7H) or a paper bag, and sold in grocery stores or super markets (Figure 5A).

4). Materials 1. Soybean In 2005, Shoyu was produced from defatted soybean cake (140,000t which is equivalent to soybean seeds 175,000t) and whole soybean seeds (40,000t). Most of the soybean materials are imported. Only 3,600t (1.7% of total) was used as Shoyu materials from domestic soybean. The taste of Shoyu depends on the amino acid content. Therefore, soybean seeds with higher protein content are desirable. Lipids in soybean seeds are discarded after filtration, producers prefer the defatted soybean cakes as a starting material. Shoyu made from defatted soybean cake is rather tasty due to the high protein content in the original material. On the other hand, the Shoyu from whole soybean seeds is mild and flavorous. The non-GMO soybean seeds are imported from the US or India, because Japanese consumers refuse the foods produced from GMO soybean.

Processed Foods from Soybean Seeds in Japan and the Characteristics

91

2. Wheat In 2005, 147,000 t wheat seeds were used for soy sauce production, where 118,000 t were imported and 29,000 t were domestic wheat. The size of the crushed wheat, after being parched, is more important than the chemical components.

5) Nutrients and Health Promoting Components 1. Nutrients Table 1 shows the compositions of five types of Shoyus. Protein concentration is high in Tamari-shoyu and Saishikomi-shoyu and low in Siro-shoyu. Most of the protein in Shoyu is broken down into amino acids and low molecular weight compounds, and the protein concentrations correlate with ―Umami‖. The term umami is one of the basic taste in Japan together with sweet, sour, bitter and salty. Umami means ―delicious taste‖ and it is due to amino acids (glutamate) and ribonucleotides (inosine monophosphate, guanosine monophosphate). Tamari-shoyu and Saishikomi-shoyu contains high concentrations of protein, and they have a strong Umami. The protein concentration is medium in Koikuchishoyu and Usukuchi-shoyu and very low in Siro-shoyu. Siro-shoyu is sweeter than other Shoyu. Na concentration is high about 4.9-6.3 g per 100 g, which is equivalent to 12.4-16 g of NaCl. Sodium chloride concentration is relatively high due to the salt additive. The concentrations of K, Ca, Mg, P are high in Tamari-shoyu and low in Siro-shoyu. Shoyu Table 1. Concentration of nutrients in various kinds of Shoyu. (per 100g) Energy (kcal) Water (g) Protein (g) Lipid (g) Carbohydrate(g) Ash (g) Minerals Na (mg) K (mg) Ca (mg) Mg (mg) P (mg) Fe (mg) Zn (mg) Cu (mg) NaCl equivalent (g) Vitamin B1 (mg) B2 (mg) Niacin (mg) B6 (mg) B12 (g) Folic acid (g) Pantothenic acid (mg) C (mg)

Koikuchi-shoyu 71 67.1 7.7 0 10.1 15.1

Usukuchi-shoyu 54 69.7 5.7 0 7.8 16.8

Tamari-shoyu 111 57.3 11.8 0 15.9 15

Saishikomi-shoyu 102 60.7 9.6 0 15.9 13.8

Siro-shoyu 87 63 2.5 0 19.2 15.3

5700 390 29 65 160 1.7 0.9 0.01 14.5

6300 320 24 50 130 1.1 0.6 0.01 16

5100 810 40 100 260 2.7 1 0.02 13

4900 530 23 89 220 2.1 1.1 0.01 12.4

5600 95 13 34 76 0.7 0.3 0.01 14.2

0.05 0.17 1.3 0.17 0.1 33 0.48 0

0.05 0.11 1 0.13 0.1 31 0.37 0

0.07 0.17 1.6 0.22 0.1 37 0.59 0

0.17 0.15 1.3 0.18 0.2 29 0.57 0

0.14 0.06 0.9 0.08 0.2 14 0.28 0

From "2009 All Guide Standard Tables of Food Composition in Japan, Fifth revised and enlarged edition"

92

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

contains vitamin B1, B2, niacine, B6, folic acid, pantothenic acid, but not vitamin C. Most of N compounds are peptides and amino acids and no lipid is included.

2. Health Promoting Components In Shoyu. 1. Franones（HEMF: hydroxyethylmetylfranone, HDMF: hydroxydimethylfranone, HMF: hydroxymethylfranone）are fragrant components of Shoyu. They have an antioxidizing effect and reduce active oxygen species, and helps to protect us from cancers. Honjyozo-shoyu specifically contains a high concentration of HEMF, HEMF is used for the indicator for identifying the Honjyozo-shoyu from Chemical shoyu imported from abroad. Melanoidins are colored materials and they have an antioxidizing effect. In addition, they strongly inhibit trypsin activity and prevent the increase in blood pressure. 2. Nicotianamine is a kind of amino acid from soybean protein degradation, and it decreases the blood pressure. 3. Polyamines (spermine and spermidine) reduce the risk of developing atherosclerosis caused by the attachment of macrophage to the inner surface of blood vessels. 4. Fravones in Shoyu are aglycones of isoflavones from soybean seeds They have estrogenic activity which assists in protection from osteoporosis (in which bones are easily broken), and menopause. 5. Shoyu is allergen free, because most proteins are decomposed by enzymatic activities of microorganims during an incubation period of over 6 months.

6) Use of Shoyu for Cooking and Sauce 1. Sauce for Sushi and Sashimi Shoyu is used for dipping sushi or sashimi to add taste and flavor to raw fish (Figure 9A, B). Sometimes soy sauce is mixed with ground Wasabi (Japanese horseradish), which makes a spicy taste. 2. Cooking Fish, Meat or Vegetables with Soy Sauce. Shoyu is used for seasoning meat, such as BBQ sauce like ―Yakitori‖ (BBQ chicken) (Figure 9C) or beef or pork steaks. Fish is boiled with Shoyu. 3. Use for Soup of Nabe Shoyu is used for the soup of ―Nabe‖ (Japanese steamboat dishes), in which meat, fish and vegetables are cooked in a clay pot or thick cast iron pot. ―Sukiyaki‖ (Figure 9D) is Nabe cooking with thin sliced beef and tofu and vegetables flavored with soy sauce. Sugar is mixed with soy sauce for this purpose.

Processed Foods from Soybean Seeds in Japan and the Characteristics

93

4. Use for Soup of Noodles Shoyu is diluted with water and used for noodle soups such as ―Udon‖ (wheat noodles) （Figure 9E）, ―Soba‖ (buckwheat noodles) （Figure 9F）, or ―Sumashi-jiru‖ (soy sauce soup). Usually umami （savoriness）is added by Konbu (dried seaweed: Saccharina japonica) or Katuobushi (dried, fermented and smoked skipjack tuna) for soy sauce soup. A

B

Figure 9. Cocking and dishes with shoyu. A: Shoyu used for dipping raw fish slice on the cool steamed rice with rice vinegar. B: Shoyu for dipping salmon sashimi (raw fish slice). C: Shoyu is used for Yakitori (BBQ chicken). Soy sauce is used for seasoning for cooking any meat or fish, as BBQ sauce . D: Sukiyaki is a kind of Nabe cooking with thin sliced beef and tofu and vegetables tasted by shoyu. E: Udon is a wheat noodle. After boiling udon with hot water, udon is cooled with water, and eaten by dipping in shoyu based soup and some seasoning (onion, wasabi, ginger). F: Shoyu is used for soup of hot noodles of Soba (buckwheat noodle) or Udon.

94

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

3. MISO (FERMENTED SOYBEAN PASTE) 1) Introduction ‗Miso‘ is a salty fermented soybean paste, and it is a very important traditional savory seasoning for Japanese dishes. Miso is produced by fermention and maturation of soybean seeds with Koji made from rice or barley. Miso is uniqe in the East, and it has no equivalent in the West (Shurtleff and Aoyagi, 1981). The origin of Miso is disputable. The word ‗Miso‘ was initially recorded in Heian era (794-1192 AC) in Japan. In the Kamakura era (1192-1333 AC), a samurai (warrior) government was established, and samurai soldiers usually eat a meal with miso and rice. Miso was then used not only as a seasoning but also as an important protein source, since it could be stored for a long time and soldiers could carry it as travel foods. This style of meal has been considered the root of Japanese cooking until now. The annual production of Miso in Japan was about 506,000 t in 2007, and it is slightly decreasing (Ministry of Agriculture Forest and Fishery, Japan. 2010). On the other hand, the amount of exports of Miso increased to about 9,252 t year-1 in 2007, from 1,380 t year-1 in 1980. About 50% of Miso is exported to North America, and nearby Asian countries, while only a small amount is exported to EU countries (Ministry of Finance, Japan, 2010). Miso is produced in local factories. Farmers also produce Miso by themselves. Therefore, there are many kinds of Miso in Japan.

2) Types of Misos Five types of Misos are classified by the materials and their proportion.

1. Kome-Miso (Rice Miso) Kome-miso is produced from rice grain by fermentation, and this accounts for 78% of the total Miso production in Japan (Ministry of Agriculture Forest and Fishery, Japan. 2010). Kome-miso is divided into three sub-groups. 1. Ama-miso (sweet miso) Ama-miso is white or yellow miso. For Ama-miso production, 1.5-3.0 times as much rice grain than soybean seeds are treated with a 6-10% salt (sodium chloride) solution. The materials are incubated under high temperature, about 50-60oC, so fermentation microorganisms do not grow during the incubation period for several days. Therefore, the degradation of materials depends mainly on enzymatic degradation by Koji, and microorganisms doesn‘t ferment. Ama-miso is sweet, because it contains a relatively high concentration of glucose originated from rice grain, and a low concentration of salt. This is used for Miso soup and pickled fish and meat. 2. Amakuchi-miso (semi sweet miso) For Amakuchi-miso production, 1.2-2.0 times as much rice grain than soybean seeds are treated with a 7-10 % salt (sodium chloride) solution. The materials are incubated under high temperature like Ama-miso, so fermentation microorganisms cannot grow. Therefore, the

Processed Foods from Soybean Seeds in Japan and the Characteristics

95

degradation of materials is mainly with enzymatic degradation by Koji, rather than fermentation by microorganisms. Amakuchi-miso has a well-balanced taste with sweetness, umami, flavor, and saltiness. This is used for Miso soup and pickles. 3. Karakuchi-miso (salty miso or full bodied miso) For Karakuchi-miso production, 0.6-1.2 times as much rice grain than soybean seeds are treated with a 10-13 % salt (sodium chloride) solution. The degradation of materials is mainly with fermentation by microorganisms such as salt tolerant yeast and lactic acid bacteria. Karakuchi-miso contains a large amount of umami and flavor produced by fermentation. This is the most popular Miso used for Miso soup and pickles. Tansyoku-karakuti-miso is yellow or white miso, and ―Shinsyu-miso‖, produced in Nagano prefecture, is an example of this type. Sekisyoku-karakuti-miso (Aka-miso) is brown or red miso. The color is due to browning during fermentation.

2. Mugi-Miso (Barley Miso) There are two types of Mugi-miso. Non-fermented Mugi-miso is produced with 1.5-2.5 times as many barley grains than soybean seeds treated with a 7-10 % salt (sodium chloride) solution. Another type is fermented Mugi-miso with 0.8-1.5 times as much wheat grain than soybean seeds. Mugi-miso is mainly produced and consumed in Japan‘s western area (Kyushu and Shikoku islands), and it accounts for about 6.5% of total Miso production. 3. Mame-Miso (Soybean Miso) Mame-miso is produced with soybean seeds alone treated with a 10-12% salt (sodium chloride) solution. Mame-miso is black or dark brown in color and has an extraordinarily high concentration of umami due to amino acids. Mame-miso is mainly produced in the central area (Aichi prefecture) in Japan, and it accounts for about 5.3% of total Miso production in Japan. 4. Chogo-Miso (Mixed Miso) Chogo-miso is produced by blending Kome-miso, Mugi-miso, or Mame-miso in varying proportions. Alternatively, another type of Chogo-miso is fermented by mixing rice, wheat, or soybean Koji. Chogo-miso accounts for about 10.2% of total Miso production in Japan.

3) Preparation of Miso Figure 10 shows a flow chart of Miso preparation. ―Koji‖ for Miso is produced from rice grain mixed with fungi, and then mixed with steamed soybean seeds. The materials are mixed with salt and water and yeast and fermented and matured in a tank for a certain period (usually 6 -12 months).

1. Treatment of Rice Grain The surface of the rice grain is polished, and about 10% of its original grain weight is removed. Rice grains are soaked in water over night, and excess water is removed. Soaked

96

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

rice grain is steamed for 1 hour (Figure 11A, B, C) in order to change the starch status to astarch and for sterilization. Procedure for making Koji. After the temperature of steamed rice reaches about 30oC, special fungi (Aspergillus oryzae) for making Koji is inoculated uniformly. Then it is incubated in the Koji making room at 30-35oC with relative humidity over 90%. Figure 11D shows the room for making Koji and Figure 11C shows the apparatus making Koji in the Miso factory.

Figure 10. Diagram of Miso (fermented soybean paste) production

Figure 11. Continued

Processed Foods from Soybean Seeds in Japan and the Characteristics

97

Figure 11. Procedures for Miso processing. A: Continuous steaming apparatus for soaking rice grain in Miso factory. B: Steamed rice come out (right) and cooled (left). C: Cooling of steamed rice below 40°C. D: Special ―Koji‖ making room in Miso factory. E: Automatic Koji maker. Koji is mixed during preparation. F: Photograph of Koji. Left; Koji produced from whole rice grain. Right; Koji produced from crushed rice grain. G: Soybean seeds for Miso production: Cultivar Enrei large size seeds. H: soaking soybean seeds in a tank. I: High-pressure steaming apparatus for soybean seeds. J: Soybean seeds after steaming. K: Mixing apparatus of steamed soybean seeds, rice Koji, salt water, and yeast. L: A tank for fermentation and maturation of Miso. M: A new type of container, which is used for fermentation and maturation by controlling temperature. N: Transfer and mixing of completed Miso after maturation. O: Packing of Miso into plastic bag. P: Various types of Miso in a plastic bag or tray.

98

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

During incubation, materials are mixed by hand or mechanically several times in order to cool the temperature and supply oxygen to the Koji fungi (Figure 11E). After 40-48 hrs of incubation, a hyphae of fungi covers the surface of rice grain, and the Koji formation is completed (Figure 11F). The Koji contains various kinds of enzymes such as amylase, protease, and lipase.

2. Treatment of Rice Grain The surface of the rice grain is polished, and about 10% of its original grain weight is removed. Rice grains are soaked in water over night, and excess water is removed. Soaked rice grain is steamed for 1 hour (Figure 11A, B, C) in order to change the starch status to astarch and for sterilization. Procedure for making Koji. After the temperature of steamed rice reaches about 30oC, special fungi (Aspergillus oryzae) for making Koji is inoculated uniformly. Then it is incubated in the Koji making room at 30-35oC with relative humidity over 90%. Figure 11D shows the room for making Koji and Figure 11C shows the apparatus making Koji in the Miso factory. During incubation, materials are mixed by hand or mechanically several times in order to cool the temperature and supply oxygen to the Koji fungi (Figure 11E). After 40-48 hrs of incubation, a hyphae of fungi covers the surface of rice grain, and the Koji formation is completed (Figure 11F). The Koji contains various kinds of enzymes such as amylase, protease, and lipase.

3. Treatment of Soybean Seeds Soybean seeds (Figure 11G, cultivar Enrei) are soaked in water over night (Figure 11H), and they are steamed for 20-30 minutes or boiled for 10 minutes to become soft under a high pressure condition of about 0.7 kg/cm2 and 1.0 kg/cm2, respectively (Figure 11I). Steamed beans with low water content are generally used for standard Miso production (Figure 11J). Boiled beans with high water content decrease the color, and some components, and the Miso looks smooth and bright in color compared with steamed bean Miso. After heating the seeds, they are crushed through a 1-5 mm mesh like a mince.

4. Preparation for Fermentation Koji, soybean minces, salt, and water are mixed (Figure 11K). Usually salt tolerant yeast (Zygosaccharomyces rouxii), and salt tolerant lactic acid bacteria （Tetragenococcus halophilus）is inoculated to the mixture. Materials are packed in a tub without air space. The lid of container presses the materials inside by using heavy stones on it. Figure 11L shows a tub for fermentation, and Figure 11M is a new type of container for Miso fermentation, which is kept under very hygienic conditions.

Processed Foods from Soybean Seeds in Japan and the Characteristics

99

5. Fermentation and Maturation Proteins are degraded to peptides and amino acids, and starch and polysaccharides are degraded into disaccharides or monosaccharide such as glucose by the action of enzymes in Koji. Yeasts use these compounds for fermentation, and they produce ethanol, higher alcohol, franone and various flavor compounds. During fermentation and maturation, the mixture becomes dark by production of melanoidin through amino-carbonyl reaction. Different types of Miso are produced by temperature and period of fermentation and maturation. Generally, Miso is mature after 6 to 12 months. Miso is transferred from the tank to the mixer and mixed (Figure 11N), and packed (Figure 11O) in a plastic bag or tray (Figure 11P). Miso can be stored in a refrigerator for 6-12 months.

4) Characteristics of Materials 1. Soybean Seeds About 139,000 t of soybean seeds were used for Miso production in 2004 in Japan. Only whole seeds are used for miso production and this is different from soy sauce, which is made mainly from defatted soybean cake. About 11,000 t of domestic soybean was used for Miso production, which accounts for 8% of total soybean seeds. The suitable characteristics of soybean seeds are as follows (Yasuhara, 1996): a. b. c. d. e. f. g.

Large size seeds are preferred. Seed coat is thin and yellow white. Hilum color is not dark. High concentration of carbohydrates Uniform size and not broken. Good water soak. Good germination rate.

At present (2010), Japanese consumers usually dislike genetically modified soybean. Therefore, the special ordered soybean cultivars (variety soybean) are mainly used, mostly from North America, China, and Brazil and India.

2. Rice and Wheat About 83,000 t of rice and 15,000 t of wheat were used for Miso production in 2005 in Japan. Standard class Miso is produced with imported rice. Premium Miso is produced with domestic rice grain.

5) Nutrition and Functional Components 1. Nutrition of Miso Table 2 shows the nutrient composition of various types of Misos. Miso contains energy of about 200 kcal in 100 g. Water concentration is about 43-46 %. Protein concentration is

100

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

high in Mame-miso, about 17 %, and low in Ama-miso and Mugi-miso, about 10 %. The proteins in soybean seeds are degraded into peptides and amino acids, although degradation is not as strong as soy sauce. Carbohydrate concentration is high in Ama-miso (38%) and Mugimiso (30%), and low in Mame-miso (15%). Starch in rice is converted to glucose, and some part is further metabolized to ethanol and other compounds. Salt concentration is high in Kara-miso (12-13 %) and low in Ama-miso (7 %). Salt concentration is relatively high however, when Miso is used for miso soup, Miso is diluted about 10 times with hot water. The salt concentration of Miso soup is about 1% and similar to western soups, such as clear soup. Various kinds of vegetables, seaweed, and Tofu are used for Miso soup. Therefore, the nutritional value is high with the additional ingredients. Miso soup is one of the best foods originated in Japan. Miso contains various minerals, such as K, Ca, Mg, P, Fe, Zn, and Cu. The concentrations of these minerals are high in Mame-miso. Miso contains vitamin E, K, B1, B2, B6, niacin, folic acid, but not vitamin C. Miso has no cholesterol, and contains about 4-7 % dietary fiber. Table 2. Concentration of nutrients in various kinds of Miso. (per 100g) Ama-miso Tansyoku-kara-miso Sekisyoku-kara-miso Mugi-miso Energy (kcal) 217 192 186 198 Water (g) 42.6 45.4 45.7 44 Protein (g) 9.7 12.5 13.1 9.7 Lipid (g) 3 6 5.5 4.3 Carbohydrate(g) 37.9 21.9 21.1 30 Ash (g) 6.8 14.2 14.6 12 Minerals Na (mg) 2400 4900 5100 4200 K (mg) 340 380 440 340 Ca (mg) 80 100 130 80 Mg (mg) 32 75 80 55 P (mg) 130 170 200 120 Fe (mg) 3.4 4 4.3 3 Zn (mg) 0.9 1.1 1.2 0.9 Cu (mg) 0.22 0.39 0.35 0.31 NaCl equivalent (g) 6.1 12.4 13 10.7 Vitamin E (mg) 0.3 0.6 0.5 0.4 K (g) 8 11 11 9 B1 (mg) 0.05 0.03 0.03 0.04 B2 (mg) 0.1 0.1 0.1 0.1 Niacin (mg) 1.5 1.5 1.5 1.5 B6 (mg) 0.04 0.11 0.12 0.1 B12 (g) 0.1 0.1 Tr. Tr. Folic acid (g) 21 68 42 35 Pantothenic acid (mg) Tr. Tr. 0.23 0.26 C (mg) 0 0 0 0 From "2009 All Guide Standard Tables of Food Composition in Japan, Fifth revised and enlarged edition" Tr: trace amout Amamiso, Tansyoku Karamiso, and Sekisyoku Karamiso are the kinds of Komemiso.

Mame-miso 217 44.9 17.2 10.5 14.5 12.9 4300 930 150 130 250 6.8 2 0.66 10.9 1.1 19 0.04 0.12 1.2 0.13 Tr. 54 0.36 0

Processed Foods from Soybean Seeds in Japan and the Characteristics

101

2. Function of Miso 1. Compounds originated from soybean seeds and rice grains. Saponin and trypsin inhibitors originated from soybean seeds. It is thought that saponin decreases cholesterol concentration in blood, and increases bile acid excretion (Dr. Misoshiri Q & A. URL). 2. Enzymatically changed compounds in original materials by the action of Koji. Isoflavon agricon, melanoidin, -amino butyric acid (GABA), and vitamin B2 are compounds formed by the action of Koji. From a large-scale epidemiological research and experiment on mice, the intake of Miso soup decreases mammary tumors. It is thought that the isoflavon in Miso soup interferes with estrogen production, which may induce mammary tumors (Dr. Misoshiri URL). 3. Changed compounds by fermentation. Franones, Ethyllinolate, vitamine B12 are produced through fermentation. Franones (HEMF: hydroxyethylmetylfranone, HDMF: hydroxydimethylfranone, HMF: hydroxymethylfranone) are fragrant components of Miso. These compounds have antioxidation properties and decrease the active oxygen species. HEMF appears to decrease the risk of cancer (Miso: URL, Watanabe, and Taiyoji, 2006).

Figure 12. Cooking and dishes with Misos. A: A photograph of Miso soup with Tofu. B: A photograph of ―Tonjiru‖ with pork slices and vegetables. C: Saba miso. A dish of fish cooked with Miso. D: Raw salmon fish slices pickled with Miso. Fish can be eaten after being grilled. E: Miso-ramen. Chinese noodle with Miso soup.

102

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

In addition to the above functions, it was confirmed by large-scale epidemiological research that the intake of Miso soup decreased death from stomach cancer. Men who did not eat Miso soup had a 48% higher stomach cancer death rate compared with men eating Miso soup every day, although the specific compounds that depress stomach cancer are not yet identified. A wide variety of foods (Vegetables, fish, seashells, meats) can be cooked in Miso soup, so it is nutritional food. Miso soup is an important Ca source for the Japanese people.

6) Cooking Foods with Miso 1. Miso soup: Miso soup is the most popular food using Miso (Figure 12A). The combination of rice and Miso soup with some side dishes is common in the Japanese meal. Therefore, many Japanese eat Miso soup once or more at a day. Many ingredients can be used in Miso soup. Tofu and Wakame are among the most popular. Ingredients boiled with Dashi from umami compounds are extracted from dried small fish such as baby sardines, Katuobushi (Dried skipjack tuna) or dried sea weed Konbu（Most of Konbu is from the species Saccharina japonica (Laminaria japonica). Alternatively, glutamic acid and inosinic acid seasoning can be used as substitutes. Miso is mixed into the soup after ingredients have been cooked. Boiling Miso soup after adding Miso is not good since it will decrease the flavor. ―Tonjiru‖ is a one kind of Miso soup with pork meat slices and slices of vegetables (carrot, gobo, radish, mushrooms, Tofu etc.) , (Figure 12B). 2. Use for Nabe Soup Miso is used for ―Nabe‖ soup (Japanese steamboat dishes), in which meat, fish and vegetables are cooked in a clay pot or a heavy cast iron pot. 3. Use of Miso for Various Foods ―Saba miso‖ (Figure 12C) is a dish of fish, mackerel, cooked with Miso. Slices of fresh fish are washed with hot water to remove odor. 100 mL of water, 50 ml of sake (Japanese rice wine), 45 ml of mirine (a kind of Japanese sake with alcohol concentration of about 14% and containing 40-50% sugar), 30 g of sugar, 18 mL of soy sauce, and 50 mL of Miso in a pan and heat until boiling. Put 4 slices of fish and ginger slices and boil for about 10 minutes, pouring the soup on the fish. Miso paste is used as a topping on tofu (Miso dengaku), or on fried eggplant (Nas umiso). Raw fish is pickled with Miso (Figure 12D) to add taste and flavor. The fish is grilled in the oven. Miso ramen is a Chinese noodle with miso soup (Figure 12E).

4. Tofu (Soybean Curd) 1) Introduction Tofu is a very popular food in all of Japan. Tofu is a soft white food made by coagulating ―Tonyu‖ (soymilk) and pressing the curd. The texture and taste of Tofu is like pudding or

Processed Foods from Soybean Seeds in Japan and the Characteristics

103

cottage cheese. Tofu has little flavor, smell or taste, so it can be used in many types of cooking. Tofu production seems to have originated in China about 2 centuries BC, and the production was transferred to Japan about 700 AD during the Nara era (710-794 AD). Tofu production propagated all over Japan in the Muromachi era (1336-1573 AD), and it became popular for common people in the Edo era （1603-1863 AD）(Watanabe et al. 1987, Tofu URL, 2010). At present, about 500,000 t year-1 (48% of total soybean consumption as food) is used for Tofu production including ―Abura-age‖ (fried Tofu) in Japan (MAFF URL, 2010).

2) Procedures of Tofu Production Figure 13 shows a flow chart of the production of various types of Tofu. Tofu is made from soymilk solidified with ―Nigari‖ (magnesium chloride salt from seawater) or other materials. Types of Tofu were classified by solidification methods, Momen-tofu, Kinugoshitofu, Soft-tofu, Jyuten-tofu (packed tofu). The procedures of Tofu production are fundamentally similar irrespective of types of Tofu.

Figure 13. Diagram of Tofu (soybean curd) production.

Production processes (Watanabe et al. 1987)

1. Soaking Soybean Seeds Soybean seeds are selected, washed in water, and soaked in water for about 12 hours (Figure 14A). During the soaking treatment, the seeds soak up water and the tissues soften so they can grind easily. When the fresh weight of soaked seeds becomes 2.2-2.3 times of the original seed weight, the soaking is ended and the excess water is removed (Figure 14B).

104

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

2. Grinding the Soaked Seeds After soaking the seeds, they are ground with an addition of water (Figure 14C). About 34 times volume (L) of water over seed weight (kg) is added for Momen-tofu, and about 1.2 times volume of water over seed weight is added for Kinugoshi-tofu. By grinding with a stone mill (Figure 14D), the tissues and cells are broken into fine pieces, which helps to extract compounds from the cells. For this purpose, fine grinding is preferred, but excess grinding can sometimes make it difficult to separate the soymilk from Okara (residues). 3. Boiling the Soymilk Soybean seed macerate ―Namago‖ is mixed with water and heated for a few minutes after reaching at 100 oC in a pan (Figure 14E), for extraction of seed components, denaturation of protein, sterilization, inactivation of toxic or unfavorable compounds, and removal of smells such as hexanal and hexanol. The amount of additional water is different among different types of Tofu; 5-6 times of seed weight for Kinugoshi-tofu, 10 times for Momen-tofu, 7-8 times for Soft-tofu. Defoamer is sometimes added to decrease the foaming of soybean saponin during heating. 4. Filtration ―Nigo‖ (boiled soybean seed macerate) is filtered through a cloth by compression or centrifugation, to separate the extract ―Tonyu‖ (soymilk) and the residues ―Okara‖ (Figure 14F, G). Okara can be cooked with seaweed and vegetables, or used for animal feeds. 5. Coagulation of Soymilk Coagulation of the protein and oil suspended in the boiled soymilk is the most important step in the Tofu production. A solution of calcium sulfate (gypsum), ―Nigari‖ (magnesium chloride), or glucono--lactone (GDL) is added to the separated soymilk to coagulate to make curd in a tub (Figure 14H) or in a box (Figure 14I). In the past, Nigari was a major coagulant for Tofu production, but calcium sulfate has become popular recently. Textures of Tofu are different by concentration of soymilk, kinds of coagulating solution, amount of coagulator, temperature, and method of adding coagulator. When water concentration is high (soymilk concentration is low), and the temperature is high, Tofu becomes hard and the volume becomes small. Tofu is taken out from the box (Figure 14J) and cut (Figure 14K), and put into a water bath to cool down and decrease the excess coagulators (Figure 14L). Then Tofu is cut into blocks to pack in a plastic tray (Figure 14 M,N,O).

3) Types Of Tofu And Coagulation Methods１） Figure 14P shows various types of Tofu.

1. Momen-tofu (Firm Tofu) Coagulator is added to the soymilk, and kept in a tub to be coagulated. Because the concentration of soymilk for Momen-tofu is diluted, the curd is not uniformly coagulated, and it is separated into the curd and the top is clear water. The curd is poured into a filtration sheet in a steel box with holes in the bottom. The curd is pressed by weight to decrease the water

Processed Foods from Soybean Seeds in Japan and the Characteristics

105

content. The Tofu is not uniform and has cracks in the curd. The texture is relatively hard but brittle compared with Kinugoshi-tofu. Momen-tofu has a cloth pattern on the surface, so it is easy to distinguish from the other types of Tofu. Momen means cotton, Momen-tofu tastes firm like cotton cloth. ―Yaki-tofu‖ is a kind of Momen-tofu. The surface is grilled, and is usually used for ―Sukiyaki‖ with beef and vegetables.

Figure 14. Continued

106

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Figure 14. Procedures of Tofu production. A: Soaking of soybean seeds. After soybean seeds are selected and washed, seeds are soaked until the weight becomes 2.2-2.3 times of the original seed weight. B: Grinding apparatus from upper direction. After soaking soybean seeds, water is drained and seeds are put into grinding apparatus. C: Grinding apparatus from side direction. Seeds drop from the outlet, and they are ground by the stone mill to become ―Namago‖. D: Inside of stone mill. Grinding apparatus and boiling pan. Left; boiling pan, Right; grinding apparatus. E: The pan for boiling Namago. Namago is transferred from the mill to the pan through a pipe. Namago is boiled for a few minutes after reaching at 100°C. The temperature becomes 100°C three to five minutes after boiling starts. F: Separation of soymilk and Okara. Soymilk is taken to a bucket and okara is in a paper bag. G: Okara (residues of filtration of soymilk) is separated from ―Nigo‖ (boiled Namago). H: A worker adds the coagulator carefully to soymilk to prepare soft tofu. Soft tofu is solidified uniformly. On the other hand, Momen-tofu separates into solid and liquid portions. I: Put soymilk in a container to solidify the curd to prepare Kinugoshi-tofu. Coagulator solution was put into a box, before putting in soymilk. J: Solidified curd is separated from the box. K: Solidified curd is cut into large cubes. The cubes are put into a water bath. L: Putting Tofu into water bath. M: Packing Tofu in a plastic tray. N: Sealing Tofu tray by heating. O: Completed Tofu production for sale. The package is cooled in water to suppress microbial growth. P: Various types of Tofu Left; Kinugoshi-tofu, Right; Soft-tofu, Center; Jyuten-tofu. Jyutentofu is coagulated in a package.

2. Kinugoshi-tofu (Smooth Tofu) Soymilk is mixed with coagulator and coagulated in a container. The concentration of soymilk is high and it coagulates uniformly without making clear water on top. Therefore, Kinugoshi-tofu is smooth and soft. Kinugoshi means filtration through silk cloth due to its smooth texture like silk, although silk cloth is not actually used for filtration. 3. Soft-tofu Soft-tofu has characteristics in between Momen-tofu and Kinugoshi-tofu. The concentration of soymilk is higher than Momen-tofu, but lower than Kinugoshi-tofu. The soymilk is mixed with coagulator, and put into a container to make curd (Figure 15). The curd is then put into a filtration sheet in a steel box for Momen-tofu production, and more

Processed Foods from Soybean Seeds in Japan and the Characteristics

107

lightly pressed than Momen-tofu. The texture of Soft-tofu is soft and smooth, but it is not easy to break compared with Kinugoshi-tofu due to its lower water concentration.

Figure 15. Procedures of producing soft tofu. A: Boxes of Soft-tofu curdling. There are holes in the bottom of the box and a cloth is put under the curd to remove excess water. B: Soymilk is put into a tub for coagulation of soft tofu. Soft-tofu as well as Momen-tofu is once coagulated in a tub, before solidification in a box. C: Curdling of Soft-tofu by adding coagulator. D: Put the solidified curd into the boxes. The curd is not broken into fine pieces. E: Flatten the surface of the curd in the box. F: Put a cloth on the curd. G: Put a lid on the container. H: Press the containers to drain excess water.

4. Packed-tofu Soymilk is mixed with coagulator and put into a plastic tray. It is then heated to coagulate after sealing the package (Figure 14P). The concentration of soymilk is the same as Kinugoshi-tofu, and the texture is similar to Kinugoshi-tofu.

4) Characteristics of Soybean Seeds for Tofu The materials for Tofu are soybean seeds, water, and a coagulator. Therefore, the characteristics of soybean seeds affect the taste and flavors of Tofu, as well as the successful coagulation of the curd. Large soybean seeds with high protein concentration are preferred for Tofu production, because of the success in making curd (Watanabe et al. 1987, Taira, 1983, Saio, 1985) and hardness of Tofu (Saio, 1985, Okabe and Matsukura, 1994). In 2005, 495,000 t of soybean seeds were used for soybean production in Japan. Only 60,000 t was domestic soybean and it accounts for only 12% of total consumption. Special cultivation of soybean by contract (Variety soybean) and non-GMO soybean seeds are generally imported and used for Tofu production.

108

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

5) Nutrients and Functions of Tofu Table 3. Concentration of nutrients in various kinds of Tofu, Tonyu and Okara. (per 100g) Momen Tofu Energy (kcal) 72 Water (g) 86.8 Protein (g) 6.6 Lipid (g) 4.2 Carbohydrate(g) 1.6 Ash (g) 0.8 Minerals Na (mg) 13 K (mg) 140 Ca (mg) 120 Mg (mg) 31 P (mg) 110 Fe (mg) 0.9 Zn (mg) 0.6 Cu (mg) 0.15 NaCl equivalent (g) 0 Vitamin B1 (mg) 0.07 B2 (mg) 0.03 Niacin (mg) 0.1 B6 (mg) 0.05 0 B12 (g) 12 Folic acid (g) Pantothenic acid (mg) 0.02 C (mg) Tr.

Kinugoshi-tofu 56 89.4 4.9 3 2 0.7

Soft-tofu 59 88.9 5.1 3.3 2 0.7

Jyuten-tofu 59 88.6 5 3.1 2.5 0.8

Tonyu 46 90.8 3.6 2 3.1 0.5

Okara 89 81.1 4.8 3.6 9.7 0.8

7 150 43 44 81 0.8 0.5 0.15 0

7 150 91 32 82 0.7 0.5 0.16 0

5 200 28 62 83 0.8 0.6 0.18 0

2 190 15 25 49 1.2 0.3 0.12 0

4 230 100 37 65 1.2 0.6 0.17 0

0.1 0.04 0.2 0.06 0 11 0.09 Tr.

0.07 0.03 0.1 0.07 0 10 0.1 Tr.

0.15 0.05 0.3 0.09 0 23 0.12 Tr.

0.03 0.02 0.5 0.06 0 28 0.28 Tr.

0.11 0.04 0.3 0.04 0 12 0.16 Tr.

From "2009 All Guide Standard Tables of Food Composition in Japan, Fifth revised and enlarged edition"

Table 3 shows the nutrient components in Tofu. Except for water, protein accounts for about 50% of dry matter. Humans can digest more than 90% of the proteins in Tofu, and the nutritional value is about 75-80% than that of animal protein. Tofu is good for improving corpulence, because it is lower in calories and has no cholesterol. Recently hamburger has been made with Tofu instead of meat, and the taste is similar to regular hamburger, but with lower calories and fat. Tofu contains isoflavon, and it has anti-tumor effect and alleviates the critical age symptoms of women such as postmenopausal hot flashes (Ministry of Agriculture, Forestry and Fishery, 2010). It is suggested that the recommended daily intake of isoflavon is about 40-50 mg, and 150 g of Tofu contains this level (Sawayama, 2010).

Processed Foods from Soybean Seeds in Japan and the Characteristics

109

Figure 16. Tofu and dishes with tofu. A: Momen-tofu and Kinugoshi-tofu Left; Momen-tofu, Right Kinugoshi-tofu. B: Hiyayakko (cool raw Tofu). The topping with soy sauce and onion. C: Miso soup with Tofu. D: Tofu salad. Tofu can be used like cottage cheese. E: Abura-age and Inari-sushi. Left. Abura-age, Right; Inari-sushi. Abura-age was made by frying Momen-tofu slices. Slices are swollen by frying at low temperature, and then surface becomes brown by frying at high temperature. Inari sushi is made by wrapping steamed rice with vinegar by cooking Abura-age with soy sauce and sugar. F: Atsuage. Thick slices of Momen tofu is fried at high temperature once. G: Tofu-steak. Tofu is grilled on an iron pan, and thin slices of Katsuobushi (dried, fermented and smoked skipjack tuna or bonito).

6) Traditional Tofu Cooking 1) Hiyayakko: Fresh cool Tofu is served with soy sauce as a side dish of a meal. Sometimes, ground ginger rhizomes or sliced Welsh onion are added as spice (Figure 16A, B). 2) Yu-Tofu: Tofu is warmed in hot water and the pieces are dipped in a diluted soy sauce. 3) Miso soup: Tofu is often used in Miso soup (Figure 16C), Sukiyaki, or Nabe (Japanese steamboat dishes). 4) Tofu salad: Recently, Tofu is used for salad with fresh vegetables and dressing (Figure 16D). 5) Abura-age : (Thin fried Tofu about 1 cm thickness) is also a traditional food in Japan. Abura-age is grilled and served with soy sauce and sometimes ground ginger rhizomes. Aburaage is boiled in soy sauce soup with sugar, and it is used for Inari-sushi (Rice ball is covered with Abura-age) (Figure 16E).

110

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

6) Atsu-age: Atsu-age (thick fried Tofu about 3cm thickness) is used like Tofu and Abura-age (Figure 16F,G). The inside of Atsu-age remains Tofu texture, but the outside tastes like Abura-age. 7) Koori-tofu: Koori-tofu (Dried tofu) is dried for long storage. Koori-tofu looks spongy and relatively hard. Before cooking, it is put in water to soak up the water and become soft. 8) Yuba: Yuba (Tofu skin) Yuba is produced during the boiling of soymilk. The thin film formed on the soymilk is collected and dried into yellow sheets. Yuba is cooked in soup or with various dishes. 9) Tofu-yo Tofu-yo (Fermented Tofu) is produced locally in Okinawa. Usually Tofu is made without fermantation, but Tofu-yo is fermented Tofu and tastes and smells like cheese.

5. NATTO (FERMENTED SOYBEAN SEEDS BY BACILLUS) 1) Introduction Natto is a typical breakfast food with steamed rice in Japan (Natto, URL). There are many legends as to the origin of Natto, but Natto has possibly been made as early as the Yayoi Era （around 1,000 BC to 300 AD）in Japan, when soybean cultivation started. Natto might originally have been made from boiled soybean seeds by wrapping them in rice straw and keeping it in a warm place. The bacteria, Bacillus natto, that live in rice straw, naturally fermented the soybean seeds to make Natto. At present, Natto is fermented with inoculation of selected Bacillus natto strains under temperature and humidity controlled conditions. Bacillus natto is a kind of popular soil bacteria Bacillus subtilis, but the strains have been selected not to produce toxic compounds. On the other hand, the inoculation of Bacillus subtilis strains, except for Bacillus natto, makes unpleasant odors and not a Natto fragrance. Because there are many small local Natto producers in Japan, there are no accurate statistics for Natto production. The use of soybean seeds for Natto is about 130,000 t per a year, which means that Natto production may be about 260,000 t per year.

2) Kinds of Nattos There are two kinds of Natto; one is Itohiki-natto, which means glutenous Natto fermented by Bacillus natto, and the other is Shio-natto (salty Natto) which is fermented with Koji fungi and mellowed in salt water. Itohiki-natto is popular in Japan.

Processed Foods from Soybean Seeds in Japan and the Characteristics

111

1) Itohiki-natto (Figure 17A) They are glutenous and sticky due to lots of sticky gossamer-like strings. There are Marudaizu-natto, Hikiwari-natto, and local Goto-natto. 1. Marudaizu-natto (Figure 17A): Whole soybean seeds are boiled and fermented by Bacillus natto (Figure 18). Natto producers in Japan classify the Marudaizu-natto to four size grades. The large size uses soybean seeds bigger than 8 mm in diameter, the medium size about 7.4-7.9 mm, the small size uses 5.6-7.3 mm and the extremely small size uses smaller than 5.5 mm seeds. 2. Hikiwari-natto (Figure 17B): Soybean seeds are parched and broken into pieces, then steamed after removing the seed coats. The fermentation of Hikiwari-natto completes faster than Marudaizu-natto. 3. Goto-natto: This Natto is a local food in Yonezawa area, Yamagata prefecture (Figure 17C). Hikiwari-natto is mixed with Koji and salt, and mellowed in a wooden vat. This Natto can be preserved for a longer time than Itohiki-natto and Hikiwarinatto.

2). Shio-natto (Salty Natto) or Tera-natto (Temple Natto) (Figure 17D) There is no glutinous matter, because this is not fermented by Bacillus natto. This type of natto might be transported from ancient China. It is also called ―Tera-natto‖ (temple natto), because it was made by monks in Temples long ago. Shio-natto is black, dry and salty and eaten with tea or wine, or used as a seasoning for Chinese dishes.

Figure 17. Photographs of various types of Natto (fermented soybean). A: Itohiki-natto B: Hikiwarinatto C: Goto-natto (Shio-natto). Left: Natto from Yamagata Prefecture, Right: Natto from Niigata Prefecture D: Tera-natto (Shiokara-natto)

112

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Figure 18. Microscopic photograph of Bacillus natto. A: Photograph of cultured Bacillus natto B: Photograph of Bacillus natto in natto.

3) Production Procedures of Natto We would like to introduce the standard procedures of Marudaizu-natto,the most popular is Itohiki-natto (Figure 19).

Figure 19. Diagram of Natto processing.

1) Treatment of Soybean Seeds: Soybean seeds are selected and cleaned (Figure 20A). The seeds are soaked in water, and boiled in a pressure pan (Figure 20B,C). The time and pressure is changed according to the soybean seed varieties, water contents and other characteristics. The purpose of this treatment is to soften the seeds and sterilize the surface microbes, and it is easy for Bacillus natto to grow in the soybean seeds. Another purpose is to degenerate the proteins in soybean seeds, to promote the proteolysis by the enzymes produced by Bacillus natto. 2) Inoculation of Bacillus natto: Because Bacillus natto is tolerant of high temperature, the Bacillus natto suspension is inoculated to the boiled soybean seeds (Figure 20D,E) immediately after boiling above 80oC to prevent the contamination of microbes. Usually 5 ml of inoculant of

Processed Foods from Soybean Seeds in Japan and the Characteristics

113

Bacillus natto (spore number is 108 mL) is diluted in 3-5 L or sterilized water is added and mixed with boiled soybean seeds of 60 kg original seed weight. 3) Fermentation: Seeds were put in containers and incubated at 40oC for 20 hrs under relative humidity above 80% (Figure 20F). 4) Mellowship: After fermentation, materials are stored in 5oC overnight or longer. During this mellow period, proteins are decomposed by proteolytic enzymes produced by Bacillus natto, and the smell and gulutenous materials are produced. 5) Packaging: Natto are put into a plastic tray (Figure 20H), and sold with special soy sauce and mustard (Figure 20I, J). A package of Natto is preserved about one week in a refrigerator.

Figure 20. Practical procedures of Natto production in Natto factory.A: Cleaning apparatus for soybean seeds. B: Pressure pan for steaming soybean seeds. C: Soybean seeds are steamed in a pressure pan. D: Soybean seeds just after steamed. E: Steamed soybean seeds are inoculated with a spray of diluted Bacillus natto inoculant. A worker puts out the steamed seeds. F: Steamed soybean seeds are inoculated with a spray of diluted Bacillus natto inoculant. G: Soybean seeds inoculated with Bacillus natto are fermented under controlled conditions. H: After fermentation and mellowing, natto is packed into a plastic tray. I: Special soy sauce and mustard was packed in Natto package. J: Special soy sauce and mustard was packed in Natto package. K: Natto is sold in a plastic tray with 30-45 g per tray. Natto in a tray is sealed with plastic film and special soy sauce and mustard are packed.

4) Characteristics of Soybean Seeds The characteristics of seed materials influence the quality of Natto compared with other processed soybean foods such as Tofu, Miso, and Shoyu. In 2005, about 130,000 t of soybean was used for Natto production in Japan. Over 90% was imported soybean

114

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

seeds, and most of them were from the USA and Canada due to stable production. Only 8% of seed materials are used by domestic soybean. The use of domestic soybean seeds tends to increase, because the Natto made from domestic seeds is sweet, tasty and soft compared with Natto made from the imported seeds. When the small seeds are used as material, fermentation is faster than bigger seeds, and gives more taste and glutenous characters. On the other hand, when the bigger seeds are used as a material Natto taste is milder and maintains the sweetness and taste of soybean seeds. (Watanabe, 2002).

5) Nutrient Components and Functional Components in Natto 1) Nutrient Components in Natto Table 4 shows the nutrient components in Natto compared with soybean seeds and boiled soybean. They contain proteins and other nutrients originating from soybean seeds. However, under fermentation the components are easy to digest, up from 65% in the boiled seeds to over 80% in Natto. The content of Vitamin B2 increases 3-6 times higher than original boiled seeds through fermentation. Itohiki-Natto and Hikiwari-natto do not contain salt, so soy sauce is mixed in. Sometimes natto, raw egg and some drops of soy sauce is mixed with steamed rice (Figure 21). Shio-natto contains a high concentration of salt (14%).

Figure 21. Natto with steamed rice and Natto, raw egg with steamed rice. A: Natto, rice, raw egg, and shoyu. B: Put shoyu and mustard on Natto. Sliced fresh welsh onion (Japanese bunching onion) is sometimes mixed with Natto. C: Stir the Natto with chopsticks. Natto becomes viscous by stirring. D: Put the stirred Natto on rice. Natto with rice is very good for nutrient balance. E: Sometimes, raw egg is mixed in the Natto rice. F. After mixing Natto and raw egg with steamed rice.

Processed Foods from Soybean Seeds in Japan and the Characteristics

115

Table 4. Concentration of nutrients in various kinds of Natto. (per 100g)

Energy (kcal) Water (g) Protein (g) Lipid (g) Carbohydrate(g) Ash (g) Minerals Na (mg) K (mg) Ca (mg) Mg (mg) P (mg) Fe (mg) Zn (mg) Cu (mg) NaCl equivalent (g) Vitamin E (mg) K (g) B1 (mg) B2 (mg) Niacin (mg) B6 (mg) B12 (g) Folic acid (g) Pantothenic acid (mg) C (mg)

Itohiki natto 200 59.5 16.5 10 12.1 1.9

Hikiwari-natto 194 60.9 16.6 10 10.5 2

Goto-natto 227 45.8 15.3 8.1 24 6.8

Shio-natto 271 24.4 18.6 8.1 31.5 17.4

Soybean 417 12.5 35.3 19 28.2 5

Boiled Soybean 180 63.5 16 9 9.7 1.8

2 660 90 100 190 3.3 1.9 0.61 0

2 700 59 88 250 2.6 1.3 0.43 0

2300 430 49 61 190 2.2 1.1 0.31 5.8

5600 1000 110 140 330 5.9 3.8 0.8 14.2

1 1900 240 220 580 9.4 3.2 0.98 0

1 570 70 110 190 2 2 0.24 0

0.5 600* 0.07 0.56 1.1 0.24 Tr. 120 3.6 Tr.

0.8 930* 0.14 0.36 0.9 0.29 0 110 4.28 Tr.

0.6 9 0.08 0.35 1.1 0.19 ND 110 2.9 Tr.

0.9 9 0.04 0.35 4.1 0.17 ND 39 0.81 Tr.

1.8 18 0.83 0.3 2.2 0.53 0 230 1.52 Tr.

0.8 7 0.22 0.09 0.5 0.11 0 39 0.29 Tr.

From "2009 All Guide Standard Tables of Food Composition in Japan, Fifth revised and enlarged edition" * including menaquinone-7

2) Functional Components of Natto Natto contains the functional components originating from soybean seeds as well as those produced by fermentation. 1: Natto kinase: Natto kinase is the enzyme used to dissolve thrombi directly as well as to promote activities in blood components. 2: Vitamin K2: Vitamin K2 plays a pivotal role in making bone, helping the binding of calcium and proteins, as a result it provides protection from osteoporosis. 3: Isoflavones: Isoflavones are a natural part of soybean seeds. Some isoflavones are changed through the fermentation process. Isoflavones are expected to prevent bone loss and prevent osteoporosis. 4: Polyamines: Polyamines, spermine and spermidine are contained in Natto as well as other processed soy foods. These compounds are thought to prevent atherosclerosis. 5: Dipicolinic acid (DPA): Natto contains DPA (Sumi and Ohsugi, 1999). DPA is a pyridene derivative and has anti-microbiotic activity, which prevents foodborne illnesses caused by eg. Escherichia coli O-157. 6: Decrease of allergen: Some allergens contained in soybean seeds can be decomposed through the fermentation process by the enzymes of Bacillus natto.

116

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

6. PHYSIOLOGICAL EFFECTS OF SOY PROTEIN AND PROCESSED FOODS 1) Introduction Soy protein has a high nutritional value containing large amounts of all essential amino acids. Further, it also has various functional properties. For example, it is reported to lower plasma cholesterol levels, and to prevent osteoporosis, etc. In this section, the physiological effects of soy protein and ―food for specified health use‖ (FOSHU) in Japan are described.

2) Cholesterol Metabolism Soy protein has various functional properties such as emulsification, water solubility, moisture retention, and foaming. Therefore, it is extensively used in traditional Japanese foods and processed foods. Soy protein contains significant amounts of all essential amino acids. Moreover, it has a higher hypocholesterolemic potential than animal protein, and may therefore reduce the risk of developing atherosclerosis (Anderson, et al. 1995, Potter, 1995). Anderson et al. (1995) reviewed medical literature seeking studies on the effect of soy protein on serum cholesterol concentration in humans, and conducted a meta-analysis of 38 controlled clinical trials; they determined the relationship between soy protein intake and serum lipid concentration in humans. They observed that consumption of soy protein, rather than animal protein, significantly decreased the serum concentration of total cholesterol, lowdensity lipoprotein (LDL) cholesterol, and triglycerides. Daily intake of 25 g of soy protein is estimated to decrease serum cholesterol concentration by 8.9 mg/dL. As a result, the United States (US) Food and Drug Administration (FDA) approved the labeling of food with the health claim that daily consumption of 25 g of soy protein isolate (SPI) reduces the risk of heart disease (Food and Drug Administration, 1999). The relation between soy intake and serum total cholesterol concentration was studied in 1,242 men and 3,596 women who had participated in an annual health checkup program in Takayama City, Japan, conducted by the municipality in 1992. The serum total cholesterol concentration decreased with the increase in the amount of soy products consumed (Nagata, et al. 1998). In addition, the replacement of meat with tofu is usually associated with a decrease in the level of saturated fats and an increase in the level of polyunsaturated fats; this would enhance some minor beneficial effects of soy protein (Ashton and Ball, 2000). A variety of soy components such as amino acids, peptides, saponins, phytic acid, trypsin inhibitors, fiber, and isoflavones may affect cholesterol metabolism either individually or in combination (Potter, 1995). Isoflavones are thought to be an important hypocholesterolemic component of soy protein. To determine whether isoflavones are responsible for the hypocholesterolemic effect of soy protein, Fukui et al. studied the effect of isoflavone-free soy protein prepared by column chromatography on the plasma cholesterol levels in rats (Fukui, et al. 2002) (Figure 22). A significant portion of the cholesterol-lowering effect of SPI observed in rats could be attributed to the protein content of the SPI, but isoflavones and other minor constituents may also play a role in lowering the cholesterol level (Fukui, et al. 2002).

Processed Foods from Soybean Seeds in Japan and the Characteristics

117

Figure 22. Plasma cholesterol levels of rats fed experimental diets. Values are means and SE for six rats. Values not sharing a common superscript letter are significantly different at P<0.05 by Tukey‘s honestly significant test. Cas, casein; SPI, soy protein isolate; IF-SPI, isoflavone free SPI; IC, isoflavone concentrate.

It is elucidated that the mechanisms underlying the soy protein-induced decrease in serum cholesterol levels are as follows: The peptide fragments produced by the digestion of soy protein in the intestinal tract interact with bile acid and cholesterol, resulting in enhancing the excretion of cholesterol, cholesterol metabolites, neutral steroids, and bile acids in feces (Sugano, et al. 1988). In addition, LDL-receptor activity in the liver is increased by soy peptides and cholesterol is transferred from the blood to the liver; thus, the amount of cholesterol used for the synthesis of bile acid is increased (Sugano, et al. 1990).

3) Antiobesity Effect Hypercholesterolemia is a major risk factor for cardiovascular disease. However, the metabolic syndrome has recently been recognized as a highly atherogenic condition, irrespective of the presence of hypercholesterolemia (Kohno, et al. 2006). As mentioned above, SPI is known to decrease plasma cholesterol levels, and processed foods containing SPI are effective in reducing plasma cholesterol levels in humans (Kito, et al. 1993). The body fat-decreasing effect of SPI in mice has also been reported in a previous study (Figure 23), and it was suggested that SPI might affect factors of lipid metabolism other than the plasma cholesterol level (Aoyama, et al. 2000). The mechanism underlying such effects has been investigated in some studies (Komatsu, et al. 1990, Saito, 1991). Many studies on the hypocholesterolemic effect of SPI support the hypothesis that polypeptides with a high bile acid-binding capacity inhibit the reabsorption of bile acid in the ileum or decrease the micellar solubility of cholesterol in small intestinal epithelial cells and decrease serum cholesterol levels (Sugano, 1988, 1990, Nagaoka, et al. 1999). Soy protein has two major components—glycinin and ß-conglycinin—that constitute approximately 70% of the protein content in soybean seeds. ß-Conglycinin is reported to decrease plasma triacylglycerol concentration in young and adult rats (Kohno, et al. 2006); it also reduced triacylglycerol levels in patients with hyperlipidemia who had consumed ß-conglycinin for 4 weeks in a small-scale clinical trial (Kambara, et al. 2002). Moreover, in a randomized controlled trial,

118

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Kohno et al. evaluated the efficacy of soybean ß-conglycinin in lowering the serum triacylglycerol level in humans and in reducing visceral fat around the umbilicus; the reduction in visceral fat was observed by using computed tomography (CT) (Kohno, et al. 2006). Daily consumption of 5 g of ß-conglycinin significantly lowered the serum triacylglycerol concentration and decreased visceral fat. This study showed that the ßconglycinin in food is effective in reducing high serum triacylglycerol concentrations and preventing obesity. Visceral fat is now recognized as a key factor related to metabolic syndrome (Matsuzawa, 1997, 2006). The effectiveness of the daily intake of 5 g of ß-conglycinin may support the US FDA recommendation for the daily intake of 25 g of SPI, because this amount of SPI contains 5 g of ß-conglycinin (Samoto, et al. 2007). Therefore, ß-conglycinin might be an important food component for the prevention and/or amelioration of visceral fat syndrome, i.e., metabolic syndrome (Kohno, et al. 2006).

Figure 23. Effects of SPI on the rate of body fat. SPI, soy protein isolate; SPI-H, soy protein isolate hydrolysate.

4) Antihypertensive Effect The peptides that inhibit angiotensin I-converting enzyme (EC 3.4.15.1; ACE) have been studied using food protein hydrolysates prepared with proteolytic enzymes (Miyoshi, et al. 1991, Yokoyama, et al. 1992, Matsui, et al. 1993, Nakamura, et al. 1995, Yang, et al. 2003, Marczak, et al. 2003). ACE, a dipeptidyl carboxypeptidase, catalyzes the conversion of angiotensin I to the potent vasoconstrictor angiotensin II and plays an important physiological role in regulating blood pressure. ACE inhibitors derived from food proteins are used in FOSHUs (Matsui, et al. 1993, Nakamura, et al. 1995). Highly active proteolytic enzymes are found in the fruiting bodies of Grifola frondosa, a popular edible mushroom known as Maitake in Japan (Nonaka, et al. 1995, Nishiwaki and Hayashi, 2001, Hiwatashi, et al. 2003, Nishiwaki, et al. 2009). Large amounts of waste are generated while packing this mushroom in trays for sale, and the effective use of this waste material is desirable. Therefore, we attempted to produce ACE inhibitory peptides from the enzymatic hydrolysates of soy protein obtained using proteolytic enzymes from G. frondosa. We suspended 5% (w/v) SPI in water. Freeze-dried powdered G. frondosa was added to this suspension, and the mixture was incubated at 60ºC. During incubation, we monitored the

Processed Foods from Soybean Seeds in Japan and the Characteristics

119

changes in the inhibition of ACE in the reaction solution. ACE inhibition increased during the first 6 h of incubation, but no further increase was observed for the additional incubation period. Although the peptide concentration in the reaction solution increased for 24 h, the addition of a high concentration of powdered G. frondosa over 1% (w/v) did not affect the inhibition of ACE (Figure 24). The ACE inhibitors in the reaction solution were identified as Leu-Gln, Ala-Val-Glu, Thr-Ala, Val-Thr-Ala, and nicotianamine. We synthesized these peptides and analyzed their ACE inhibitory activity. However, the ACE inhibitory activities (IC50 values) of these peptides were lower than that reported previously for ACE inhibitory peptides. In contrast, nicotianamine had a high ACE inhibitory activity (IC50 = 0.30 µM). These results indicate that ACE inhibition in the reaction solution was affected by the presence of many peptides and nicotianamine (unpublished data).

Figure 24. Change in the inhibition of ACE in the SPI suspension. Added amount of Maitake powder:

5. Food for specified health use (FOSHU) The Japanese Ministry of Health, Labor and Welfare introduced a system for regulating FOSHU in 1991, under which the use of health claims was permitted (Food for Specified Health Uses (FOSHU): URL, 2010). (Table 5). In Japan, FOSHU is defined as a food that (1) is derived from naturally occurring substances (not a capsule or powder), (2) can be consumed as a part of the daily diet, and (3) regulates a particular physiological process on consumption. Since FOSHU started in 1991, more than 800 products were approved as FOSHUs, and the market value was almost 680 billion yen in 2007 (Tokuho: URL). It is widely expected that these food products will help in disease prevention. In addition, such products are expected to help in treating life-style related diseases, even though they are only food substances. Experimental data and other submitted documents are thoroughly evaluated by a committee of experienced specialists. The use of logos (Figure 25) and health claims is only approved for those foods that are scientifically proven to be effective in the maintenance and improvement of health. Processed foods, which contain soy protein, have been introduced into the market. These products, such as yogurt and fried chicken and functional beverages containing osteogenesisrelated soybean isoflavones, e.g., tea, soymilk, etc., are purported to lower plasma cholesterol levels.

120

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al. Table 5. Approved FOSHU Products

Figure 25. Seal for FOSHU Approval

ACKNOWLEDGMENT The authors appreciate Mr. Masashi Kobayashi, Chief of Quality Control section, Niigatakenshoyukyogyokumiai, (1901-1 Tokamachi, Nagaokashi, 940-1131, Japan), Mr. Tomoyoshi Haneda, Chief of Quality Control and Development, Yamasakijyozo、Co. Ltd. (3-7-4 Higashisakaemachi, Ojiyashi, 947-0004, Japan), Tohru Sohma, Hiranoya Tofuten (946 Maki Kou, Nishikanku, Niigatashi, 953-0041, Japan), and Mr. Yukio Sato, cheif director of Yamanoshitanatto. Co. Ltd. (7-6-47, Yamakido, Higashiku, Niigatashi, 950-0871, Japan) for their kind cooperation in showing us their production processes and allowing us to take pictures for this chapter. We are grateful to the Kikkoman Institute for International Food Culture for permitting us to use their photographs.

Processed Foods from Soybean Seeds in Japan and the Characteristics

121

REFERENCES All Guide, Standard Tables of food composition in Japan, Jikyo Syupan Ltd. Japan (2009), (in Japanese) Anderson, J. W., Johnstone B. M., and Cook-Newell M. E., Meta-analysis of the effect of soy protein intake on serum lipids. New Engl. J. Med. 333：276-282 (1995) Aoyama, T, Fukui, K, Takamatsu, K, Hashimoto, Y and Yamamoto, T. Soy protein isolate and its hydrolysate reduce body fat of dietary obese rats and genetically obese mice (yellow KK). Nutrition 16: 349-354 (2000) Ashton, E. and Ball, M., Effects of soy as tofu vs meat on lipoprotein concentrations, European Journal of Clinical Nutrition, 54, 14-19, (2000). Dr. Misoshiri Q & A. URL, http://www.miso.or.jp/dictionary/q_a/book/index.html#1 (in Japanese), (2010) FAOSTAT, http://faostat.fao.org/default.aspx Food and Drug Administration, Food labeling health claims; soy protein and coronary heart disease. Fed Regist, 64, 57699-57733 (1999) Food for Specified Health Uses (FOSHU): URL, http://www.mhlw.go.jp/english/topics/foodsafety/fhc/02.html, (in English), (2010) Fukui, K., Tachibana, N., Wanezaki, S. and Tsuzaki, S., Takamatsu K., Yamamoto T., Hashimoto Y., and Shimoda T., Isoflavone-Free Soy Protein Prepared by Column Chromatography Reduces Plasma Cholesterol in Rats, J. Agric. Food Chem., 50, 57175721, (2002). Fushiki, T., et al. Nutritional Functional Chemistry, 2nd ed. (Asakura, 2005) Hamano M. and Origasa, K., Section6: Shoyu, in ―All about soybean‖ 275-285, Edited by Keisuke Kitamura, Science Forum (Tokyo), 2010, (in Japanese) Hiwatashi, K., Hori, K., Takahashi, K. and Kagaya, A., Inoue S., Sugiyama T., and Takahashi S., Purification and characterization of a novel prolyl aminopeptidase from Maitake (Grifola frondosa), Biosci. Biotech. Biochem., 68 (6), 1395-1397 (2003) Kambara, H., Hirotsuka, M., Takamatsu, K., and Kito, M., A lowering effect of soybean ßconglycinin on serum triglyceride level in humans, Ther. Res., 23, 85-89 (2002) Kito, M., Moriyama, T., Kimura, Y., and Kambara, H., Changes in plasma lipid levels in young healthy volunteers by adding an extruder-cooked soy protein to conventional meals, Biosci. Biotechnol. Biochem., 57, 354-355, (1993). Kiuchi, K., Nagai, T. and Kimura, K., Science of Natto, Kenkosya Publisher, (2008) Kohno, M., Hirotsuka, M., Kito, M., and Matsuzawa, Y., Decreases in serum triacylglycerol and visceral fat mediated by dietary soybean ß-conglycinin, J. Atheroscler. Thromb., 13, 247-255, (2006). Komatsu, T., Komatsu, K., Matsuo, M., Nagata, M., and Yamagishi, M., Comparison between effects of energy restricted diets supplemented with soybean peptide and lactalbumin in energy, protein and lipid metabolisms in treatment of obese children, Nutr. Sci. Soy Protein, 11, 98-103 (1990), (in Japanese) Marczak, E. D., Usui, H., Fujita, H., Yang, Y., Yokoo, M., Lipkowski, A.W., and Yoshikawa, M., New antihypertensive peptides isolated from rapeseed, Peptides, 24, 791-798, (2003)

122

Toshikazu Nishiwaki, Keiko Morohashi, Satoshi Watanabe et al.

Matsui, T., Matsufuji, H., Seki, E., Osajima, K., Nakashima, M., and Osajima, Y., Inhibition of angiotensin I-converting enzyme by Bacillus licheniformis alkaline protease hydrolyzates derived from sardine muscle, Biosci. Biotec. Biochem., 57, 922-925, (1993) Matsuzawa, Y., Pathophysiology and molecular mechanisms of visceral fat syndrome: the Japanese experience, Diabetes. Metab. Rev., 13, 3-13, (1997) Matsuzawa, Y., Therapy insight: adipocytokines in metabolic syndrome and relate cardiovascular disease, Nat. Clin. Pract. Cardiovasc. Med., 3, 35-42, (2006) Ministry of Agriculture, Forestry and Fishery, Japan: Statistical researches of rice, wheat processed food production. (in Japanese), (2010) Ministry of Agriculture Forestry and Fishery, Japan. Changes in soybean uses for foods, URL, http://www.maff.go.jp/j/seisan/ryutu/daizu/d_data/index.html (in Japanese), (2010) Ministry of Finance, Japan: Monthly foreign trade table. (in Japanese), (2010) Miso: URL, Wikipedia in English, http://en.wikipedia.org/wiki/Miso (in English), (2010) Miyoshi, S., Ishikawa, H., Kaneko, T., Fukui, F., Tanaka, H., and Maruyama, S., Structures and activity of angiotensin-converting enzyme inhibitors in an zein hydrolysate, Agric. Biol. Chem., 55(5), 1313-1318, (1991) Nagaoka, S., Miwa, K., Eto, M., Kuzuya, Y., Hori, G., and Yamamoto, K., Soy protein peptic hydrolysate with bound phospholipids decreases micellar solubility and cholesterol absorption in rats and caco-2 cells, J. Nutr., 129, 1725-1730, (1999) Nagata, C., Takatsuka, N. and Kurisu, Y., and Shimizu H., Decreased Serum Total Cholesterol Concentration is Associated with High Intake of Soy Products in Japanese Men and Women, J. Nutr., 125 (2), 209-213, (1998) Nakamura, Y., Yamamoto, N., Sakai, K., and Takano, T., Antihypertensive effect of sour milk and peptides isolated from it that are inhibitors to angiotensin I-converting enzyme, J. Dairy Sci., 78, 1253-1257, (1995) Natto: URL, Wikipedia, http://en.wikipedia.org/wiki/Nattō (in English), (2010) Nishiwaki, T. and Hayashi, K., Purification and characterization of an aminopeptidase from the edible basidiomycete Grifola frondosa, Biosci. Biotech. Biochem., 65 (2), 424-427, (2001) Nishiwaki, T., Asano, S., and Ohyama, T., Properties and substrate specificities of proteolytic enzymes from the edible basidiomycete Grifola frondosa, J. Biosci. Bioeng., 107 (6), 605-609, (2009) Nonaka, T., Ishikawa, H., Tsumuraya, Y., Hashimoto, Y., Dohmae, N., and Takio, K., Characterization of a thermostable lysine-specific metalloendopeptidase from the fruiting bodies of a basidiomycete, Grifola frondosa, J. Biochem., 118, 1014-1020, (1995) Ohtake, N., Suzuki, M., Takahashi, Y., Fujiwara, T, Chino, M., Ikarashi, T. and Ohyama, T., Differential expression of -conglycinin genes in nodulated and non-nodulated isolines of soybean. Physiol. Plant., 96, 101-110, (1996) Ohtake, N., Yamada, S., Suzuki, M., Takahashi, N., Takahashi, Y., Chinushi, T. and Ohyama, T., Regulation of accumulation of -subunit of -conglycinin in soybean seeds by nitrogen. Soil Sci. Plant Nutr., 43, 247-253, (1997) Ohyama, T., Ohtake, N., Sueyoshi, K., Tewari, K., Takahashi, Y., Ito, S., Nishiwaki, T., Nagumo, Y., Ishii, S., and Sato, T. Nitrogen Fixation and metabolism in soybean plants, Nova Scientific Publishers, Inc., New York, 2009 Okabe, A. and Matsukura, U., Analysis of soybean seed composition related with processing adaptability for Tofu., Japanese Journal of Breeding, 44, Supplement 2, 255, (1994)

Processed Foods from Soybean Seeds in Japan and the Characteristics

123

Potter, S. M., Overview of proposed mechanisms for the hypocholesterolemic effect of soy, J. Nutr., 125, 606S-611S (1995) Saio, K., Association of researches on Tofu. Characteristics of Soybean seeds for Tofu processing. ep. Nat’l Food Res. Inst, 47, 128-149, (1985) Saito, M., Effect of soy peptides on energy metabolism in obese animals, Nutr. Sci. Soy Protein (in Japanese), 12, 91-94 (1991) Samoto, M., Maebuchi, M., Miyazaki, C., Kugitani, H., Kohno, M., Hitorsuka, M. and Kito M., Abundant proteins associated with lecithin in soy protein isolate, Food Chem., 102, 317-322, (2007) Sawayama, S., Taste, materials, processing, Science of Cooking. Shurtleff, W. and Aoyagi, A., The book of Miso, Food for mankind, Ballantine Books, New York, (1981) Solomon, N.M.D., Passwater, R. and Elkins, R.M.H., Soy Smart Health. Woodland Publishing (Pleasant Grove, Utah, USA), 2000 Soy sauce: URL, http://en.wikipedia.org/wiki/Soy_sauce (in English), (2010) Sugano, M., Yamada, Y., Yoshida, K., Hashimoto, Y., Matsuo, T., and Kimoto, M., The hypocholesterolemic action of the undigested fraction of soybean protein in rats, Atherosclerosis, 72, 115-122, (1988). Sugano, M., Goto, S., Yamada, Y., Yoshida, K., Hashimoto, Y., Matsuo, T. and Kimoto, M., Cholesterol-lowering activity of various undigested fractions of soybean protein in rats, J. Nutr., 120, 977-985, (1990) Sumi, H., and Ohsugi, T., Anti-bacterial Component Dipicolic Acid Measured in Natto and Natto Bacilli, Journal of the Agricultural Chemical Soceitey of Japan, 73 (12) 12891291, (1999) Taira H., Quality of domestic soybean III. Interrelationship among the texture, chemical composition, and processing characters., Rep. Nat’l Food Res. Inst, 42, 27-39, 1983 Tochikura, S., Science and Technology of soy sauce (2nd Edition), Brewing Society of Japan, 1988 (in Japanese) Tofu: URL, http://en.wikipedia.org/wiki/Tofu Tokuho:, URL, http://www.jhnfa.org/tokuho.html (in Japanese), (2010) Watanabe, S., Series of food processing 5, Natto, Nobunkyo Publisher, (2002) Watanabe, S. and Taiyoji, M., Techniques to Increase 4-Hydroxy-2(or 5-ethyl-5(or 2)methyl-3(2H)-franone (HEMF) Concentration in Salty rice-miso Brewing, Journal of the Brewing Society of Japan, 101, 161-170, (2006) (in Japanese) Watanabe, T. and Saio, K. and Hashizume, K., Soybean and its processing. I, Kenpakusya, Tokyo, (1987) Yang, Y., Marczak, E. D., Yokoo, M., Usui, H., Kawamura, Y., and Yoshikawa, M., Isolation and antihypertensive effect of angiotensin I-converting enzyme (ACE) inhibitory peptides from spinach rubisco, J. Agric. Food Chem., 51 (17), 4897-4902, (2003) Yasuhira, H., Suitable treatment for soybean for Miso production, Journal of the Brewing Society of Japan, 91, 854-, (1996), (in Japanese) Yokoyama, K., Chiba, H., and Yoshikawa, M., Peptide inhibitors for angiotensin I-coverting enzyme from thermolysin digest of dried bonito, Biosci. Biotech. Biochem., 56 (10), 1541-1545, (1992)

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 4

SOYBEAN MEAL IN DIETS FOR CULTURED FISHES Anne Marie Bakke* Aquaculture Protein Centre, a CoE (Norway), Department of Basic Sciences and Aquatic Medicine, Norwegian School of Veterinary Science, Oslo, Norway

ABSTRACT According to the Food and Agriculture Organization of the United Nations (FAO), aquaculture‘s contribution to total global fisheries is increasing faster than capture fisheries, and aquaculture is now supplying about half the fish consumed by the human population worldwide. Capture fisheries of wild fish stocks, on the other hand, has shown zero or negative growth in recent years. Capture fisheries have been the main sources of fishmeal and fish oil, traditionally used as the main protein and lipid sources in formulated diets for many cultured fish species, especially carnivorous fish. However, the limited global supply of fishmeal and fish oil has led to the increasing use of alternative protein and lipid-rich feed ingredients in aquafeeds, mostly from plant crops. Soybean meal is used for partial replacement of fishmeal in formulated aquafeeds for many species, due to the ample market supply, lower market price, high protein concentration and favorable amino acid composition. Among alternative feed ingredients, by far the most research on effects on growth performance as well as digestive and immune function in teleost fishes has been carried out with soybean products. This may partly be due to early reports of the negative impact that de-hulled, full-fat or de-fatted (hexane extracted) soybean meal (SBM)-containing diets have on some production animals, including salmonid fishes such as Atlantic salmon and rainbow trout. In salmonids, dietary inclusion of SBM can cause dramatic reductions in growth performance, nutrient digestibilities, and diarrhea. These can at least partially be explained by an inflammatory response in the distal intestine (hind gut), termed soybean meal-induced enteropathy. It is characterized by a high level of T-lymphocyte infiltration into the intestinal mucosa. However, the decreased nutrient digestibility and utilization of SBM in salmonid diets also appears to be due to decreased enzymatic digestion and assimilation of nutrients, and increased production and loss of endogenous secretions/enzymes in the more proximal regions of the intestine. The metabolic cost of the inflammatory response in the distal intestine may also lead to reduced growth *

Corresponding author: E-mail: [email protected], Tel.: +47 22 96 45 59.

126

Anne Marie Bakke performance. In salmonids, the inflammatory reaction in the distal intestine has been observed in all individuals exposed to dietary SBM at various stages of development. As for other fish species, SBM in diets for gilthead sea bream and common carp have also been shown to cause an inflammatory response in the intestine. But salmonids appear to be the most sensitive species. There are indications that solvent-extracted SBM in diets can have negative consequences on the salmon‘s and also channel catfish‘s susceptibility to infectious diseases. The contribution of the intestinal microbiota and any changes in its species composition caused by SBM has not been clearly established. The long-term consequences to the health of the fish, as well as their response to orally or intestinally administered vaccines, medicines and other compounds of biological significance, may be compromised and merit further investigation. Although the causative agent(s) of the pathophysiological responses in salmonids has not been conclusively identified, some recent findings suggest that soy saponins may be involved, most likely in combination with other, as yet unidentified components. The alcohol extraction of soybean meal, a processing step used in the production of soy protein concentrate, appears to remove the causatory agents in most cases. This highly refined soybean product has generally been found to be a safe, high quality alternative protein source in salmonid feeds. But it is costly. Fermentation also appears to improve the acceptability of SBM for the fish. Further research on cost-efficient processing methods of SBM to remove antinutritional factors or development of soy strains with low levels of antinutritional factors can aid in reducing the negative impact on the health and welfare of cultured fish fed soybean products. Such efforts can potentially increase the use of soybean products in aquafeeds and thus contribute to developing a more sustainable aquaculture industry.

INTRODUCTION According to FAO, aquaculture is the fastest growing food-producing sector globally and now supplies about half of the fish consumed by humans. With this growth, there has been a general shift from extensive to intensive farming strategies, also by small producers in developing countries. An immediate effect of this intensification is an increased demand for formulated feed. One of the constraints for continued growth in the aquaculture sector is the supply of appropriate feed ingredients. For many farmed fish, especially carnivorous and omnivorous species, fishmeal and fish oil have traditionally been the main sources of dietary protein and lipid, respectively. However, stagnation or reduction in capture fisheries has lead to a limited global supply of these resources and therefore increasing costs for these feed ingredients. Thus, fish feed producers have seen their production costs rise and are therefore attempting to limit dependence on fishmeal. Some success has been achieved – more costeffective feedstuffs are being increasingly used as nutrient sources in formulated feeds for farmed fish and the inclusion level of fishmeal and fish oil has dropped, even for farmed carnivorous fish species. In the longer term, demand for alternative feed ingredients will depend on scientific research regarding consequences of these on growth, feed utilization, health and welfare of the fish, as well as sustainability issues. However, with global population and economic growth, the subsequent increased demand for high quality food is driving all animal production systems to compete in a limited feed ingredient market. Losses due to disease represent a major cost in the aquaculture industry internationally, and diet composition is among several factors that may influence disease susceptibility. Optimal health and disease resistance is dependent not only on an optimal balance of nutrients

Soybean Meal in Diets for Cultured Fishes

127

available for all systemic needs, but also on optimal function of the gastrointestinal tract (GIT) and associated organs. The GIT is constantly exposed to a conglomeration of nutrients, antinutritional factors (ANFs) and non-nutrients, the latter also comprising food antigens and microorganisms. The digestive apparatus has the capacity to adjust to changing diet composition to some degree, and the mucosal defense system provided by the GIT must protect the body from injurious agents and at the same time develop oral tolerance to antigens from the diet and commensal microbiota (see reviews by Chehade and Mayer, 2005; Sansonetti, 2004). The microbiota‘s species composition, which may be influenced by various dietary nutrients, non-nutrients and anti-nutrients, is also of importance for the host‘s gut and general health (Bauer et al., 2006). Regarding cultured fish, many knowledge gaps exist in this area which needs to be filled. The following are some: Basic elements of digestive functions and suitable indicators of malfunction is a major hindrance for the understanding of diet-health interactions The gut‘s immune system and its role in disease susceptibility Effects of bioactives/ANFs, on fish production, digestive function and disease susceptibility The role of the intestinal microflora in fish and differences between fish species. Inclusion of various ―novel‖ ingredients from plant, microbial, and other animal sources in fish feeds have been investigated. At least some of these alternative feed ingredients have often been reported to have negative consequences on the nutrition, growth, feed utilization and gut health of farmed fish, depending on fish species and inclusion level in their diets. The causes, to name some possibilities that have been studied and documented, may lie in low levels of protein and omega-3 fatty acids, unfavourable amino acid and mineral profiles, high levels of fibre and starch, and – perhaps most consequential – the presence of ANFs and/or antigens. Specific effects of alternative protein sources on the digestive physiology of fish have been most closely studied in the case of soybean products in feeds for farmed salmonids. In the case of salmonids, inclusion levels above 5-10% full-fat or defatted (hexane-extracted; standard) soybean meal (SBM) – depending on processing level and strain – lead to reduced growth and an apparent inflammatory response in the distal intestine. Effects on many specific digestive processes, from feed intake to enzyme activities to nutrient transport to gut histology, have been reported and are described in this chapter. The causatory agent(s) are still being investigated and some advances appear to have been made. However, the longterm implications of soybean meal in diets on fish production, health, and product quality are largely unknown, and this topic deserves continued, substantial investments in further research to contribute to preserving the sustainability of the aquaculture industry. The current report summarizes reported effects of various qualities of soybean products on gastrointestinal digestive function and health of teleost fish. If not otherwise stated, reported effects of the various protein sources on digestive function are in comparison to a fishmeal-containing diet, the protein source of choice for a control diet. Seemingly conflicting results from different studies as well as quantitative and qualitative differences in effects may be due to:

128

Anne Marie Bakke Varying practices of fasting prior to sampling intestine for histological and physiological investigation (see Baeverfjord and Krogdahl, 1996; Krogdahl and Bakke-McKellep, 2005 for effects of fasting and re-feeding) Tolerance level of a fish species Developmental stage of the fish Genetic and environmental influences that may govern the plant, microbe, and aquatic materials‘ composition Type and degree of processing used for the alternative protein source Protein level of the diets Quality of the fishmeal (see Hardy, 1996) or other protein source in the control diet

Due to this number of unknowns that can influence results of a particular study, little specific data is presented and the results of studies are discussed in more general terms.

EFFECTS ON GROWTH AND FEED UTILIZATION Soybean meal (SBM) is one of the most commonly used protein sources in animal feeds due to its high protein content and favourable amino acid profile. However, even when heattreated, standard (solvent-extracted) and full-fat SBM containing feeds were supplemented with limiting amino acids, decreased growth in salmonids was observed early on (Sandholm et al., 1976; Tacon et al., 1983; Davies and Morris, 1997). More specifically, SBM inclusion in the diet causes lower feed intake, weight gain, fecal dry matter, and energy and fat digestibilities in all salmonid species studied (Dabrowski et al., 1989; Rumsey et al., 1993 and 1994; Olli et al., 1994b; Olli and Krogdahl, 1994; Kaushik et al., 1995; Refstie et al., 1997, 1998; Bureau et al., 1998; Storebakken et al., 1998a; Arndt et al., 1999; Burrells et al., 1999; Krogdahl et al., 2003). De-hulled SBM as the sole protein source in diets for rainbow trout, Oncorhynchus mykiss was reported to lead to growth arrest and increased mortality (Dabrowski et al., 1989; Rumsey et al., 1994). Full-fat SBM, however, appears to support better growth than solvent-extracted SBM in rainbow trout (Smith, 1977; Tacon et al., 1983; Oliva-Teles et al., 1994; Olli and Krogdahl, 1994) and Atlantic salmon, Salmo salar (Olli et al., 1994b). De-hulled, solvent-extracted SBM caused similar negative effects on growth and nutrient digestibility in Atlantic salmon as SBM produced from hulled soybeans (Olli et al., 1994b). White flakes, which are de-hulled, moderately toasted solvent-extracted SBM, have been reported to cause similar reductions in growth, feed efficiency ratio, and nutrient digestibilities as standard SBM in Atlantic salmon (Refstie et al., 2005). Apparent protein and energy digestibilities in Atlantic cod (Gadus morhua) for standard soybean meal has been estimated to be 92.3 and 88.1%, for soy protein concentrate 98.6 and 94.9%, and for soy protein isolate 97.4 and 92.1%, respectively (Tibbetts et al., 2006). One and two-year old Atlantic cod appear to tolerate up to 24% dietary inclusion of extracted soybean meal as well as a bioprocessed SBM (BPSBM), a process that reduces oligosaccharide and phytic acid content (Førde-Skjærvik et al., 2006; Refstie et al., 2006a and b). No effect was found on growth, nutrient utilization or body composition although digestibility of crude protein, amino acids and lipid, feed efficiency ratio, and protein retention were somewhat reduced in fish fed the soy containing diets following the 84 day

Soybean Meal in Diets for Cultured Fishes

129

trial (Førde-Skjærvik et al., 2006; Refstie et al., 2006a). Cod appear to compensate for lower digestibility of macronutrients in the diet by increasing feed intake (Hansen et al., 2006; Refstie et al., 2006a). Similar findings were observed in cod fed full-fat SBM at inclusion levels up to 36%. In these fish the fatty acid composition of the muscle and liver were affected by the diet in a linear relationship (Karalazos et al., 2007). Apparent protein and energy digestibilities of dehulled soybean meal in juvenile haddock (Melanogrammus aeglefinus) were calculated to be 96.1 and 88.0%, respectively. There were no significant differences in nutrient digestibilities in the diets with SBM inclusion levels ranging from 10 to 40% (Kim et al., 2007). Lower growth performance and/or apparent digestibility coefficients for dry matter, energy, lipid, and/or protein in SBM-containing diets for other carnivorous species such as European sea bass, Dicentrarchus labrax (Tibaldi et al., 2006), largemouth bass, Micropterus salmoides (Portz and Cyrino, 2004), gilthead sea bream, Sparus aurata (Robaina et al., 1995; Venou et al., 2006), yellow perch, Perca Flavescens (Kasper et al., 2007), fingerling red drum, Sciaenops ocellatus (Reigh and Ellis, 1992), Australian snapper (red sea bream; squirefish), Pagrus (Chrysophyrs) auratus (Quartararo et al., 1998) and Japanese flounder, Paralichthys olivaceus (Deng et al., 2006) have also been observed. Lower weight gain, feed efficiency, and protein efficiency ratio at higher inclusion levels of SBM have been reported in juvenile cobia, Rachycentron canadum (Chou et al., 2004; Zhou et al., 2005), although specific effects on digestive function are not known. In more omnivorous and herbivorous fish species, adequately heat-treated SBM does not always negatively affect digestive function, as indicated by weight gains, protein efficiency ratio (PER), net protein utilization (NPU), and/or protein and energy retention, in common carp, Cyprinus carpio (Viola et al., 1982), various tilapia (Oreochromis) species (Davis and Stickney, 1978; Shiau et al., 1987; El-Sayed, 1999), channel catfish, Ictalurus punctatus (Peres et al., 2003), and pacu, Piaractus mesopotamicus (Ostaszewska et al., 2005). However, growth performance of grass carp (Ctenopharyngodon idellus) fry (Dabrowski and Kozack, 1979) and tilapia, Oreochromis mossambicus (Jackson et al., 1982) declined with increasing SBM inclusion. It has been suggested that earlier heat-treated, solvent-extracted or full-fat SBM can completely replace fishmeal in common carp diets as long as limiting amino acids and minerals are supplemented (Viola et al., 1982; Abel et al., 1984). However, this conclusion has more recently been put into question (Urán et al., 2008; see below). Studies in fingerling channel catfish in aquaria conducted in a similar time period by one group of scientists, however, suggest that dietary heat-treated, extracted SBM can result in considerably lower rates of weight gain (Gatlin and Wilson, 1984; Wilson and Poe, 1985), compared to fish fed comparable, purified casein diets (Gatlin et al., 1982; Wilson et al., 1983) in 10-week feeding trials. A more recent study confirms this: soy protein concentrate (SPC) as the sole protein source (41% of the diet) led to a 606% weight gain in an 8-week feeding trial. Substituting the SPC incrementally with SBM from 14-55% of the diet led to dose-dependent reductions in weight gain (582-217%, respectively; Twibell and Wilson, 2004). Much of the differences in growth were explained by a negative impact of SBM on feed intake. Interestingly, the authors found that supplementing a diet with SBM as the sole protein source with 1% cholesterol significantly increased weight gain and feed intake. In another study, reducing the dietary content of solvent-extracted SBM from 45 to 22.5% led to improved growth and feed efficiency in channel catfish fingerlings (Barros et al., 2002).

130

Anne Marie Bakke

PATHOPHYSIOLOGICAL CHANGES Morphological changes in the distal intestine of salmonids are caused by dietary inclusion of full-fat as well as solvent-extracted SBM, with and without hulls, and also by the alcoholextract (molasses) which is a biproduct from alcohol extraction of SBM to produce soy protein concentrate (van den Ingh et al., 1991, 1996; Rumsey et al., 1994; Krogdahl et al., 1995; Baeverfjord and Krogdahl, 1996; Bureau et al., 1998; Ostaszewska et al., 2005; Aslaksen et al., 2007). The changes have been described in Atlantic salmon as follows: shortening of the primary and secondary mucosal folds with a widening of the central stroma (lamina propria) and submucosa, shortened microvilli of the brush border membrane and increased formation of microvillar vesicles, and a dramatic decrease or absence of the normal supranuclear absorptive vacuoles in the enterocytes (van den Ingh et al., 1991 and 1996; Baeverfjord and Krogdahl, 1996 ; Urán et al., 2009). The lamina propria is widened with a profound infiltration of a mixed population of inflammatory cells such as lymphocytes, neutrophilic granulocytes, cells of monocytic lineage, including macrophages, eosinophilic granular cells (mast cells), and diffuse IgM (Baeverfjord and Krogdahl, 1996; BakkeMcKellep et al., 2000; Urán et al., 2009) as well as a mixed population of putative T-cells, including CD4+ T helper cells and CD8+ cytotoxic cells, (Bakke-McKellep et al., 2007a). RNA expression studies indicate that cytokines and other signaling and regulatory factors involved in recruitment and activation of immune cells, including T cells, and maintenance of normal mucosal integrity may also be involved in the development of the enteropathy (Lilleeng et al., 2009 ; Urán et al., 2009; Valen et al., 2010). Interestingly, increased trypsin activity and trypsin mRNA expression levels have been observed in the distal intestinal tissue of Atlantic salmon fed SBM (Lilleeng et al., 2007). The implications are not clear, but the authors suggest that serine proteinases such as trypsin may be involved in the pathogenesis of the inflammation by way of the inflammatory mediators protease-activated receptors (PAR2), as demonstrated in the intestine of humans and mammals. The gene expression level of PAR2 is indeed up-regulated in the distal intestine of SBM-fed salmon (Thorsen et al., 2008). Two isoforms appear to be present and may have differing roles at the onset and during later stages of the enteropathy. In rainbow trout, the condition has been described similarly, but with more variable effects on the epithelial cell vacuolization, which appears to increase in some trials (Rumsey et al., 1994; Burrells et al., 1999), whereas a loss of vacuolization was observed by Romarheim and co-authors (2006) in rainbow trout fed 25% solvent-extracted SBM as well as solvent-extracted, untoasted white flakes. In the hind gut of common carp, a similar inflammatory response as described in salmonids has been reported (Urán et al., 2008b). Due to the infiltration of inflammatory cells and rapid regression of the condition following withdrawal of soybean meal from the diet, the condition has been classified as a non-infectious, subacute enteritis (Baeverfjord and Krogdahl, 1996). The pathogenesis may involve immunological mechanisms similar to that of a hypersensitivity reaction (Rumsey et al., 1994; Baeverfjord and Krogdahl, 1996; Bakke-McKellep et al., 2007a; Lilleeng et al. 2007 and 2009; Thorsen et al., 2008). However, the plasma of rainbow trout fed SBMcontaining diets was negative for specific antibodies against soy protein (Kaushik et al., 1995; Burrells et al., 1999) despite increased total immunoglobulin levels (Rumsey et al., 1994). Serum and head kidney macrophage activities were depressed in trout fed diets containing

Soybean Meal in Diets for Cultured Fishes

131

high levels (60-80%) de-hulled extracted SBM (Burrells et al., 1999). In this same doseresponse study, no histological alterations in the distal intestine were observed until the SBM inclusion level had reached 60%, at which level growth depression also became evident. These latter investigations on systemic immunoglobulin and macrophage activities have not been carried out in Atlantic salmon. The distal intestine of rainbow trout may, however, not be as detrimentally affected by soybean meal as Atlantic salmon. Rainbow trout have in fact been reported to adapt to soybean meal and resume acceptable growth and feed consumption rates following a period of acclimatization to the diet (Olli and Krogdahl, 1994; Refstie et al., 1997 and 2000). In common carp, the inflammatory response appears to regress after four to five weeks of feeding SBM (Urán et al., 2008b). There are no reports of Atlantic salmon adapting to soybean meal. In recent studies, supplementation of bovine bile salts to extracted SBM-based diets (Yamamoto et al., 2007) as well as diets containing ethanol extract from defatted SBM (Yamamoto et al., 2008) for rainbow trout was reported to ameliorate the inflammatory response in the distal intestine. Bile salt supplementation also restored growth, feed efficiency and intestinal maltase activity to comparable levels reported in the control group. This type of investigation has not been reported in Atlantic salmon. Morphology has been studied but changes have not been observed in the intestine of Atlantic cod fed up to 24% dehulled, extracted SBM, bioprocessed SBM or soy concentrate (Hansen et al., 2006; Refstie et al., 2006b), mangrove red snapper (Lutjanus argentimaculatus Forsskal 1775) fed up to 48% defatted SBM (Catacutan and Pagador, 2004), Atlantic halibut (Hippoglossus hippoglossus) fed up to 36% toasted full-fat SBM (Grisdale-Helland et al., 2002), Egyptian sole (Solea aegyptiaca) fed up to 30% SBM (48% crude protein), pacu fed 50% extracted SBM (Ostaszewska et al., 2005), or European sea bass fed toasted, extracted SBM (Bonaldo et al., 2008). In gilthead sea bream fed toasted, extracted SBM (Bonaldo et al., 2008), the lamina propria of the distal intestine was infiltrated with mononuclear cells and diffusely expanded in some fish. The incidence of the inflammation increased with increasing SBM inclusion (up to 30%). However, growth, feed intake and feed conversion were not affected by any inclusion level. In the distal intestine of channel catfish fed 45% de-hulled, solvent-extracted SBM, raw SBM, and SBM autoclaved for 5, 10, 20, and 40 min, only a mild loss of supranuclear vacuolization was observed (Evans et al., 2005), whereas pancreatic necrosis and splenic congestion was evident in all treatment groups. The histology of the distal intestine of the catfish fed non-heat-treated SBM suggests hypertrophic growth of the villous ridges, however. This is supported by increased visceral index of these fish (Peres et al., 2003). As mentioned above, SBM causes shortening of microvilli of the brush border membrane in Atlantic salmon (van den Ingh et al., 1991; Urán et al., 2009). Concomitantly, the activity of digestive enzymes in the epithelial cells‘ brush border membrane (e.g. alkaline phosphatase, maltase, leucine aminopeptidase, 5'-nucleotidase, and Mg2+-dependent ATPase) of the salmon distal intestine are significantly and dose-dependently reduced by including soybean meal in the diet (Krogdahl et al., 1995; Bakke-McKellep et al., 2000; Krogdahl et al., 2003). Cytosolic enzyme activities – alkaline and acid phosphatase, non-specific esterase, and alanine aminopeptidase – are also decreased (Bakke-McKellep et al., 2000), suggesting reduced supranuclear vacuole formation, number, size, and/or enzyme activity. These vacuoles have been suggested to function during endocytosis (McLean and Ash, 1987; Sire et al., 1992; Sire and Vernier, 1992). Macromolecular uptake of horseradish peroxidase (MW 44

132

Anne Marie Bakke

kDa) and ferritin (MW 450 kDa) from the distal intestine is reduced or slowed down in SBMfed Atlantic salmon (Bakke-McKellep, 1999; Urán et al., 2008a), further suggesting that endocytosis is diminished during inflammation. Reduced distal intestinal weight, along with an apparent decreased in carrier-mediated transport, causing reduced activity and total capacity to absorb nutrients in both freshwater and seawater-adapted rainbow trout and Atlantic salmon (Nordrum et al., 2000), are most likely also contributing factors to lower nutrient digestibilities as well. Dabrowski and coauthors (1989) also observed lower amino acid absorption in SBM-fed rainbow trout. The decreased digestive enzyme and nutrient absorptive capacity of the distal intestine, in conjunction with the increased trypsin activity in the feces in SBM-fed trout and salmon (Dabrowski et al., 1989; Krogdahl et al., 2003; Romarheim et al., 2006; Lilleeng et al., 2007) indicate increased losses of both dietary nutrients as well as a loss in the ability to reabsorb endogenous digestive secretions. Numbers of proliferating cells lining the villous folds of the distal intestine of Atlantic salmon parr increased with even low levels (12.5%) of full-fat soybean meal (Sanden et al., 2005; Bakke-McKellep et al., 2007b), and from both genetically modified and traditionally cultivated varietals (Sanden et al., 2005). Thus the number of cells in early stages of development are significantly increased. The number of cells undergoing cellular repair as indicated by heat shock protein expression in cells, as well as cells undergoing programmed cell death (apoptosis) are also increased (Bakke-McKellep et al., 2007b). This suggests that the digestive hydrolases, nutrient transporters, and possibly other components located in the brush border membrane and cytoplasm, are disturbed by alterations in cell turnover and degree of maturation of the enterocytes caused by the SBM-induced inflammatory changes. Immature cells have also been reported to have reduced function or number of integral proteins (enzymes, transporters, etc.) inserted in their apical membranes in rats (Pusztai et al., 1995). Reports of histological changes in the pancreas and liver (Ostaszewska et al., 2005) and metabolic changes in the liver (Martin et al., 2003) of SBM-fed rainbow trout have been reported. The histological changes in the pancreas include adipose cell accumulation, and increased cytoplasmic density and reduced nucleus size in the exocrine cells of fish fed 32% soy protein concentrate and 44% SBM in their diets. These changes in the exocrine cells suggest a depletion of the enzyme-containing granules at high dietary levels of SBM as indicated by the concomitant drop in faecal trypsin activity (Krogdahl et al., 2003). In the liver, irregularly sized hepatocytes with pyknotic nuclei were observed in trout fed soy protein concentrate, and fatty accumulation in hepatocytes was seen in fish fed SBM (Ostaszewska et al., 2005). Protein profiling of liver proteins indicates shifts toward hepatic catabolic pathways, increased or inefficient protein turnover, down-regulation of some structural protein expression, heightened immune response, altered levels of several stress proteins, and changes in cholesterol metabolizing enzymes in the SBM-fed fish (Martin et al., 2003). The significance this may have on digestive function, i.e. production of pancreatic enzymes and bile in the liver, as well as their respective secretions from these organs, are yet to be elucidated. In Atlantic cod, 24% extracted SBM or bioprocessed SBM (BPSBM) did not cause inflammatory responses in any intestinal regions (Refstie et al., 2006b). The SBM diets did, however, increase the weight of intestinal regions proximal to the hindgut. Trypsin and

Soybean Meal in Diets for Cultured Fishes

133

leucine aminopeptidase activities were not affected by SBM, nor was apparent nutrient absorption. BPSBM did slow absorption rates, however (Refstie et al., 2006b).

THE ROLE OF ANTI-NUTRITIONAL FACTORS Soybean meal contains the antinutritional factors proteinase inhibitors, lectins, saponins, phytoestrogens, fiber, oligosaccharides, phytic acid, some glucosinolate and potential allergens. The nondescript term ―antinutrients‖ or antinutritional factor is commonly used to refer to those substances found in foods that produce negative effects on nutritional balance and therefore health when ingested. Although some plant toxins are known to produce obvious systemic signs of poisoning, more subtle effects only observed following prolonged ingestion of a given plant are referred to as antinutrient effects. Such effects might include inhibition of growth, decreased feed efficiency, goiterogenesis, pancreatic hypertrophy, hypoglycaemia, and liver damage. Factors that should be taken into consideration when assessing antinutrient effects include the species of animal, its age or stage of development, size, sex, state of health and plane of nutrition, and any stress factors that might be superimposed on these variables. Most of our knowledge regarding antinutrient effects in fish has not been gained through studies using pure antinutrients, but rather using whole, or more or less refined, feed ingredients. Although some plant ingredients contain only one or a few antinutrients, others – including soybeans – contain many different antinutrients. They may all have their distinct effects and may also interact to cause significant effects not observed when they are alone. Very few reports exist that can form the basis for dose-response considerations and estimation of maximum levels. These conclusions are in line with those made by Francis et al. (2001) in a review regarding antinutritional factors in plant-derived fish feed ingredients and their effects. As concluded by Francis et al. (2001) nine years ago and still valid now: There is an urgent need for studies concerning the effects of the individual antinutrients and effects of antinutrients in combination. Most likely antinutrients are the cause of lowered growth performance and feed utilization in many fish species fed SBM and are possibly involved in the development of soybean meal-induced enteropathy in salmonids and the related gut function and immunological alterations. While the ANFs that are proteins, such as proteinase inhibitors and lectins, are assumed to be deactivated during heat treatment of SBM and/or heat generated by feed processing methods, biological effects of their purified forms in fish are still included here. Despite heat treatment, they may still illicit an antigenic effect which may be of significance in explaining functional, structural and/or immunological responses to dietary SBM in fishes. However, further research is needed to investigate the significance of heat treatment of theses ANFs on these responses.

Proteinase Inhibitors Inhibitors of proteinases, i.e. of trypsin, chymotrypsin, elastases and carboxypeptidases, are proteins that form stoichiometric complexes with the enzymes and inhibit their activity in the gastrointestinal (GI) tract. Soybean proteinase inhibitors belong either to the Kunitz

134

Anne Marie Bakke

inhibitor family or the Bowman-Birk inhibitor, first observed in soybeans (Liener, 1980). The latter has a molecular weight of about 8,000 kD and is characterized by the 7 S-S bridges which stabilize the molecule. This inhibitor may bind one trypsin and one chymotrypsin at the same time. Inhibitors of similar structure are found in several legumes. The larger (21,000 kD) Kunitz inhibitor with a specific site for trypsin also binds chymotrypsin but in a less stable complex. By binding trypsin and chymotrypsin, the functional activities of these pancreatic digestive enzymes are decreased. In studies with salmonids, proteinase inhibitors have been found to reduce apparent digestibility not only of protein but also of lipid (Berg-Lea et al., 1989; Krogdahl et al., 1994; Olli et al., 1994a). The effects on digestibility correspond to a decrease in trypsin activity and presumably chymotrypsin (Figure 1). Saturated fatty acids were more severely affected than unsaturated. Results indicate that the proteinase inhibitors stimulate pancreatic enzyme secretion causing the enzyme level of the intestinal content (trypsin protein) to increase. However, the activity in the intestinal content was not increased. The enzyme activity seems unaffected when fed diets with the lower inhibitor levels and short-term feeding (12 days), but higher levels decreased the activity. After longer-term feeding (30 days), the pancreas was no longer able to compensate for decreased enzyme activity by increasing secretion. Thus enzyme production did not appear to keep up with the increased demand. The contribution of the purified protease inhibitors to the inflammatory response in the distal intestine was not investigated.

Figure 1. Effects of increasing levels of proteinase inhibitors on trypsin activity and trypsin protein in intestinal contents of rainbow trout. The samples were taken from the mid intestine between the distal most pyloric caecum and the distal intestine (modified from Olli et al., 1994a).

Soybean Meal in Diets for Cultured Fishes

135

Lectins Lectins (previously known as agglutinins or hemagglutinins) are a group of soluble, heterogeneous (glyco)proteins that bind reversibly to a specific mono- or oligosaccharide residue (Peumans and Van Damme, 1995). Ssoybean agglutinin (SBA), are hololectins, which have two or more identical or homologous carbohydrate-binding domains, and therefore have agglutinating activity, distributed on one or more (usually 2 or 4) subunits or protomers. SBA binds to N-acetyl-d-galactosamine residues, and less efficiently to galactose. By binding to glycated membrane proteins, such as transport proteins, brush border enzymes and various receptors, as well as other glycoconjugates, lectins can have striking biological activities dependent on animal, developmental stage and other factors that affect glycation profiles of these substances. Binding of SBA to the intestinal brush border membrane of Atlantic salmon and rainbow trout has been demonstrated (Hendricks et al., 1990; Buttle et al., 2001). Higher maximum binding and lower dissociation constants were observed in the distal intestine relative to the more proximal intestinal regions in salmon (Hendricks et al., 1990). These authors suggested that this could indicate that the distal intestine would be more sensitive to an effect of soybean lectin or other antinutritional factors or antigens. This was supported by the follow-up study by the same group of scientists in which full-fat soybean meal, but not soy protein concentrate, was found to cause morphological changes in the distal intestine of Atlantic salmon (van den Ingh et al., 1991). Lectins, like soybean trypsin inhibitors, have largely been ruled out as the sole cause of reduced digestive function and the inflammation (van den Ingh et al., 1996; Bureau et al., 1998; Iwashita et al., 2009) since very little if any lectin activity is present in the alcoholextract from soybeans. This extract, however, did cause the morphological changes when added to the salmonid diet. They suggested that alcohol-soluble oligosaccharides and saponins are the most likely causatory compounds. Furthermore, Iwashita et al. (2009) demonstrated that diets that did not contain SBM, but were spiked with SBA did not cause inflammatory responses in the distal intestine of rainbow trout. This, however, is in contradiction to data presented by Buttle and co-workers (2001), who observed morphological changes, especially damage to the villous tips and cellular infiltration in the submucosa/lamina propria, in the distal intestine of Atlantic salmon when 3.5% purified SBA was added to a fishmeal-based diet. Bakke-McKellep and co-workers (2008) indicated that phytohemagglutinin (PHA) from kidney beans (Phaseolus vulgaris) inhibit glucose transport into the intestinal epithelium of Atlantic salmon when tissue is exposed in vitro. SBA, however, did not have this effect. Thus, PHA appears to be a more toxic lectin for Atlantic salmon enterocytes than SBA. More work is needed to establish any role SBA may have in the development of SBM-induced enteropathy.

Saponins Saponins are heat-stable, alcohol-soluble, amphipathic glycosides, containing a hydrophobic steroidal or triterpenoid aglycone to which one or more (hydrophilic) sugar chains are attached. They are a highly diverse group of glycosides produced primarily by plants, particularly legumes, but also a few lower marine animals and some bacteria. The mature soybean seed contains triterpenoid saponins divided into group A and group B

136

Anne Marie Bakke

soyasaponins based on the aglycone structure. The group A soyasaponins are bisdesmosidic (Shiraiwa et al., 1991a) and are found predominantly in the germ of the seed, which accounts for only 3% of the total bean, resulting in low levels of this group in extracts from whole beans (about one fifth the level of group B soyasaponins). The group B soyasaponins are nearly equally distributed between the germ and the cotyledons of the seed (Shiraiwa et al., 1991b; Berhow et al., 2006). Saponins are reported to have diverse biological effects including antifungal and antiviral activity, immune stimulation (adjuvant effect), anticancer effects, antioxidant properties, inhibition of protein digestion and vitamin absorption, and glucocorticoid-like effects (reviewed by Francis et al., 2002). The amphipathic nature of saponins is directly related to many of their biological activities. Saponins form micelles and can intercalate into cholesterol-containing membranes forming holes. Saponins also affect functions of mammalian intestinal epithelia by increasing the permeability of intestinal mucosal cells, inhibiting active mucosal transport and facilitating uptake of substances that are normally not absorbed, as shown by Johnson et al. (1986), and in the case of allergens by Gee et al., (1996). Saponins when added to water are highly toxic to fish. They are the active ingredient in several traditional fish poisons, including mahua oil cake, and act by damaging the gill epithelium via their surface active and membranolytic activities. In mammals, orally administered saponins that are incorporated into cell membranes will eventually be lost in the normal process of intestinal epithelial cell replacement (Sjolander and Cox, 1998). They can also be degraded by acid and alkaline hydrolysis (Cleland et al., 1996) and glucosidases of bacterial origin (Gestetner et al., 1968). Saponins are also lost due to binding with cholesterol, forming an insoluble complex that cannot be absorbed (Malinow et al., 1977). In the only report of the fate of orally administered saponins in fish, Knudsen et al. (2006) demonstrated that soyasaponins were not degraded during passage through the gastrointestinal tract in Atlantic salmon. The authors found a higher concentration (approximately 2.6 times) of saponins in feces than in the diet, suggesting that bacterial degradation may be limited in fish. Saponins have been implicated in the distal intestine eneteropathy caused by SBM in Atlantic salmon. Their effects on protein digestion, cholesterol metabolism, and on functions of the immune and nervous systems (Francis et al., 2002) also suggests possible involvement. Knudsen et al. (2007) performed two feeding trials with Atlantic salmon in which three fractions of soybean molasses (butanol phase, water phase and precipitate) were supplemented to diets. The authors confirmed, as had been previously found (van den Ingh et al., 1996), that soy molasses induced the inflammatory response. Additionally, components in the butanol phase also elicited changes in the distal intestine consistent with those of soybean enteropathy, suggesting that the yet to be identified responsible component(s) resists fractionation with butanol and drying at 70°C. However, saponins are not the only compound found in the butanol fraction. According to Kitagawa et al. (1985) the butanol phase is expected to contain approximately 30% saponins only. The findings of Knudsen et al. (2007) did support the previously reported findings of Bureau et al. (1998), who showed that partially purified alcohol extracts (butanol soluble fraction of soy molasses), when added to the diet of Chinook salmon (Oncorhynchus tshawytscha), in amounts equivalent to a 300 g kg-1 soybean meal diet, caused reduced feed intake and growth, and morphological changes in the distal intestine. However, in contrast to these findings, Krogdahl et al. (1995) did not observe adverse effects of purified saponins included in the diet of Atlantic salmon equivalent

Soybean Meal in Diets for Cultured Fishes

137

to a diet containing soybean meal at 300 g kg-1. More recently, Knudsen et al. (2008) and Iwashita et al. (2009) also demonstrated that diets that did not contain SBM, but were spiked with purified soyasaponin did not cause inflammatory responses in the distal intestine of Atlantic salmon and rainbow trout, respectively. However, in combination with other components – lupin kernel meal in the Knudsen et al. (2008) study and soybean lectin (SBA) in the Iwashita et al. (2009) study – an inflammatory response was induced. Furthermore, increased in vitro epithelial permeability was observed in intestinal tissue from the salmon fed 25% defatted SBM as well as from fish fed the purified soysaponin, with and without the presence of the lupin kernel meal (Knudsen et al., 2008).

Phytoestrogens Oestrogenic activity of SBM is attributed to the isoflavones (glucosides) genistein, daidzein, coumestrol, formononetin, biochanin A, and equol. The total isoflavones content of soybeans has been reported to vary and can reach levels as high as 4200 mg kg-1 (Wang and Murphy, 1994a), but considerable variation exists and is influenced by variety, location and growing conditions (Wang and Murphy, 1994b). Interestingly, Mambrini et al. (1999) found high levels of isoflavones in soy protein concentrate (6,000 and 2,000 mg kg-1 of genistein and daidzein, respectively), produced by aqueous alcohol extraction. One of the concerns regarding oestrogenic effects of phytoestrogens is their effect on reproductive performance, but only a few studies have addressed this issue. Oestrogen activity of plant feed ingredients in fish feeds was first reported in Siberian sturgeon (Acipenser baeri). Pelissero et al. (1991a) demonstrated increased vitellogenin in blood plasma of juvenile male and non-vitellogenic females fed diets containing soybean meal compared to individuals fed a casein-based control diet. Pelissero et al. (1991b) subsequently reported direct evidence for oestrogenic activity of daidzein, biochanin A, genistein, equol and coumestrol after intraperitoneal injection. However, the activity was considerably less compared with estradiol. The affinity of genistein for blood plasma binding proteins in fish is much lower than endogenous oestrogens as shown by Tollefsen et al. (2004) and Milligan et al. (1998). Milligan et al. (1998) concluded that the phytoestrogens coumestrol, genistein and daidzein are unlikely to produce effects by displacing endogenous steroids from plasma binding proteins in rainbow trout. No differences in blood plasma estradiol concentrations were found in female rainbow trout fed diets containing 500 or 1,000 mg aglycone genistein kg-1 for one year (Bennetau-Pelissero et al., 2001). Reproductive performance was affected, but only in females fed the diet containing genistein at 500 mg kg -1 However, male rainbow trout had decreased levels of 11-ketotestosterone and testosterone and reduced sperm motility but increased sperm volume. Spermatocrit was reduced in males at the higher dietary level of genistein. Inudo et al. (2004) found no effect on fecundity or fertility of Japanese medaka (Oryzias latipes) fed diets containing up to 58.5 mg kg-1 genistein and 37.3 mg kg-1 daidzein for over a 28-day period, although vitellogenesis was induced in males. The information necessary to understand the significance of dietary isoflavonoids on other physiological processes in fish is incomplete. Rainbow trout fed diets in which 75% or higher of the fishmeal was replaced with soy protein concentrate (Mambrini et al., 1999) exhibited reduced growth. Genistein and daidzein contents in the diet with 100% replacement of fishmeal were 4042 and 1476 mg kg-1, respectively; levels in the 75% replacement diet

138

Anne Marie Bakke

were not reported. Growth of fish fed a diet with 50% replacement of fishmeal by soy protein concentrate, containing 1804 and 594 mg kg-1 of genistein and daidzein, respectively, performed similar to controls. It appears rainbow trout can tolerate these levels. However, the authors did not examine oestrogenic effects. It is not known if different species vary in their sensitivity to dietary phytoestrogens. Investigations regarding possible isoflavone involvement in reduced digestive functions or inflammatory responses to SBM are absent.

Fiber Fibers, or non-starch polysaccharides (NSP), are not digested by endogenous enzymes in monogastric animals. The level of NSPs in diets for salmonids has increased due to the increased use of plant ingredients. In plants, fibers have structural functions, bind water to variable degrees, act as ion exchangers, adsorb organic compounds and function as antioxidants. These characteristics are also observed in the GI tract of animals ingesting the fibers. Effects of fibers on digestive function and physiology have been the focus of numerous studies in man and other monogastric, omnivorous homeothermic animals, and the effects are described in numerous papers. Less is known regarding effects in salmonids and other carnivorous fish species, and it is not known to what extent our knowledge regarding the effects in other animals is applicable to fish. In a recent study of effects of cellulose and a fibre fraction from soybean meal (soyNSP), dietary inclusion of soy-NSP up to 100 g kg−1, did not result in reduced digestibility of main nutrients or cause enteritis in the distal intestine of Atlantic salmon (Kraugerud et al., 2007). However, inclusion of soy-NSP in the diets did result in decreased faecal dry matter and increased faecal excretion of sodium, with a significant correlation between these two parameters, possibly indicating that increased drinking was causing the high levels of sodium in faeces. Extruding the soy-NSP did not significantly alter the properties of the native soyNSP. The diets with cellulose lowered the digestibility of starch when compared to the native soy-NSP diet. When diets with 75 or 100 g kg−1 of native NSP and extruded soy-NSP were compared, fish fed native soy-NSP had reduced faecal dry matter, higher digestibility of starch, and increased faecal output of Cu, Fe, and K. Dry matter in faeces and faecal output of Cu was lower for the highest inclusion level, while digestibility of starch and faecal output of Mn and K were higher. In conclusion, soy-NSP was inert compared to the fishmeal reference, with respect to nutrient digestibilities and intestinal pathologies, but affected faecal mineral excretion in Atlantic salmon. Research showing effects of dietary NSP on the microflora in the fish intestine is limited. However, one study (Bakke-McKellep et al., 2007b) investigated the microflora of seawateradapted Atlantic salmon fed diets containing fishmeal as the sole protein source (FM), 250 g kg-1 dehulled, extracted and toasted soybean meal partially replacing the fishmeal (SBM), or a diet containing 75 g kg-1 inulin (IN), a polymeric fructan in which the monomers are linked by β (2-1) bonds indigestible to digestive enzymes of animals but fermentable by beneficial bifidobacteria and other lactic acid-producing bacteria in the large intestine of mammals (Pool-Zobel et al. 2002). The SBM and IN diets contained comparable levels of nitrogen-free extract (NFE) – 9.4 and 8.9%, respectively – whereas the FM diet contained only 3% NFE. Interestingly, the IN fed fish had the lowest number of total viable bacterial counts in the digesta of both mid and distal intestine. The SBM fed salmon had the highest counts whereas

Soybean Meal in Diets for Cultured Fishes

139

the FM-fed fish had intermediate counts. There were diet-dependent differences in the diversity of bacterial strains identified. The IN fed fish also had the lowest diversity (16 genera and strains) compared to SBM-fed (26) and FM-fed (24) fish. The number of isolated lactic acid species, Marinilactibacillus psychrotolerans and Carnobacterium piscicola were highest in the FM fed salmon compared to the SBM and IN-fed fish. However, Brevibacterium and Enterococcus spp. were detected in the latter two groups but not in the FM groups. Similar findings have been reported in Arctic charr (Salvelinus alpinus L.) fed a diet containing inulin (Ringø et al., 2006a). Thus, as opposed to findings in mammals (Gibson and Roberfroid, 1995; Pool-Zobel et al. 2002; Xu et al., 2002), fibre may decrease the numbers and diversity of bacterial strains present in the intestines of fish. More studies are needed, however, to further investigate this and elucidate the impact on fish health.

Oligosaccharides Soybeans contain high levels of oligosaccharides, which are important constituents of a wide variety of grain legumes and cereals and refer to a variable mix of alpha-galactosyl homologues of sucrose (Saini, 1989). The main oligosaccharides in soybeans are the trisaccharide raffinose, the tetrasaccharide stachyose, and the pentasaccharide verbascose (Bach-Knudsen, 1997; Petterson, 2000). Legumes and oilseeds commonly used in fish feeds typically contain 4-14 g raffinose, 12-50 g, stachyose and 0-34 g verbascose per per kg dry matter (Bach-Knudsen, 1997). High dietary levels of alpha-galactoside oligosaccharides can have negative nutritional effects, some of which may be applicable to fish. These include interference with the digestion of other nutrients, osmotic effects in the intestine and anaerobic fermentation of the sugars resulting in increased gas production (Wiggins, 1984; Cummings et al., 1986; van Barneveld, 1999). Although utilisation of α-galactoside oligosaccharides has not been well defined in fish, studies with swine and poultry have shown that oligosaccharides are indigestible in the stomach or small intestine, primarily due to a lack of the enzyme alpha-galactosidase (Gdala et al., 1997). It has been suggested that dietary alpha-galactoside oligosaccharides is at least partly responsible for causing the diarrhoea resulting from feeding soybean meal to fish (Refstie et al., 2000, 2005, 2006b) due to elevated intestinal osmotic pressure. Other reported effects of oligosaccharides in fish are, however, somewhat conflicting. Arnesen et al. (1990) attributed decreased apparent nutrient digestibility in Atlantic salmon fed soybean meal to negative effects of alcohol-soluble soy carbohydrates, but did not find similar effects in rainbow trout. Krogdahl et al. (1995) on the other hand found no effects of purified raffinose included at a level corresponding to 30-40% dietary soybean meal on apparent nutrient digestibility and growth in Atlantic salmon. This may indicate that the trisaccharide raffinose is not particularly problematic, while the tetra- and/or pentasaccharide stachyose and verbascose may be more potent antinutritional factors in fish. Interestingly, Refstie et al. (2005) found surprisingly high apparent digestibility of raffinose in Atlantic salmon, ranging from 85% when the diet contained 1 g raffinose kg-1 to 55% when the diet contained 22 g raffinose kg-1. At the same time, the concentration of polysaccharides potentially originating from bacterial cell walls increased in the intestine of fish fed high levels of oligosaccharides and plant non-starch polysaccharides. This strongly indicates that oligosaccharides are utilised by intestinal bacteria in the salmon gut.

140

Anne Marie Bakke

Phytic acid Phytic acid (myoinositol, 1, 2, 3, 4, 5, 6 hexakis-dihydrogen phosphate) and phytate (a mixed cation salt of phytic acid) are found in significant amounts in plant material, and are generally regarded as the primary storage form of both phosphate and inositol in seeds. Common plant feedstuffs such as soybean and rapeseed meal contain 10 - 15 and 50 - 75 g phytate kg-1, respectively (Francis et al., 2001), which are moderate levels compared to levels found in oilseeds such as rapeseed and sunflower. Negatively charged sites bind mainly K+ and Mg2+, but may also form salts and precipitate with other cations including Ca2+, Mn2+, Zn2+, Ba2+, or Fe3+ at alkaline pH (Lott et al., 2000; Hídvégi and Lásztity, 2002). Phytic acid may also complex with protein at low pH, below the isoelectric point of the protein, and when phytic acid is soluble (Hídvégi and Lásztity, 2002). Thus, phytic acid-protein complexes are only partially hydrolysed by pepsin (Spinelli et al., 1983). Furthermore phytic acid furthermore reduces the stability of trypsin (Caldwell, 1992). In fish, a supplement of 5 g phytic acid kg-1 diet slowed growth by 10% in rainbow trout (Spinelli et al., 1983), while a dietary supplement of 26 g phytic acid kg-1 dramatically depressed growth in Chinook salmon (Richardson et al., 1985). Richardson et al. (1985) found an increased incidence of cataracts when feeding diets high in phytic acid but low in Zn. Dietary supplementation of 5 - 10 g phytic acid kg-1 diet furthermore slowed growth in common carp (Hossain and Jauncey, 1993). In line with this, improved growth and higher digestibility and retention of protein and mineral elements was shown in rainbow trout when comparing dephytinised with standard soy protein meal (Vielma et al., 2004) or soy protein concentrate (Vielma et al., 2002 and 2004). Richardson et al. (1985) found abnormalities in thyroid, kidney and alimentary tract morphology of rainbow trout fed 26 g phytic acid kg-1 diet. Furthermore, the pyloric caeca were found to be abnormally hypertrophied and showing cytoplasmic vacuolation. Supporting this, Hossain and Jauncey (1993) found hypertrophy and vacuolisation of the cytoplasm of the intestinal epithelium in common carp fed 10 g phytic acid kg-1 diet. Thus, dietary phytic acid may affect tissue mass and potentially functionality of digestive organs in fish, and may potentially be toxic at very high dietary levels. Feeding up to 21 g phytic acid kg-1 diet did not, however, induce any inflammatory changes in the distal intestine of Atlantic salmon (Denstadli et al., 2006). Although this dietary level of phytic acid lowered the mineral content of the fish, it did not induce any skeletal malformations, at least not after 80 days of feeding and a tripling of the body weight, starting at 36 g (Helland et al., 2006). It follows from the data summarized here that the dietary levels of phytic acid in fish feeds should be monitored, and should probably not exceed 5 g kg-1 diet. When using feed ingredients originating from crops with moderate phytic acid content such as cereals and legumes this should be unproblematic. However, soy protein concentrate does contain higher levels of phytic acid than fullfat and extracted SBM. When comparing standard (18 g phytic acid kg-1) to dephytinised soy protein concentrate at 50% dietary inclusion in Atlantic salmon, Storebakken et al. (1998b) found no effects on growth. Still, in line with the expected effects of dietary phytic acid, the apparent digestibility and retention of both protein and phosphorus as well as whole body concentrations of total ash, Ca, Mg, and Zn were lowered. Supporting this, Denstadli et al. (2006) found a tolerance for sodium phytate with regard to feed intake and growth in Atlantic salmon between 4.7 and 10 g kg-1 diet. The apparent digestibilities of Mg and Zn were reduced by the dietary phytic acid in a dose-dependent manner, and this resulted in lower

Soybean Meal in Diets for Cultured Fishes

141

whole body concentrations of Ca and Mg, and a lower concentration of Zn in the vertebral column (Helland et al., 2006). The apparent digestibility and retention of protein was little affected. However, when feeding as much as 21 g phytic acid kg-1 diet the intestinal trypsin activity was significantly depressed in the Atlantic salmon (Denstadli et al., 2006).

Glucosinolates Glucosinolates disrupt thyroid hormone production and thus can cause goiter. Major deleterious effects of glucosinolates ingestion in animals in general are reduced palatability, and decreased growth and production. Specific effects of glucosinolates and their metabolites in soybeans have not been investigated in fish, whereas some investigations concerning rapeseed glucosinolates have been carried out.

Allergens Feed or food allergens are defined as substances that react with IgE antibodies and induce allergic sensitization/reactions, usually via mast cell degranulation and histamine release. No common structure can predict whether an antigen may be an allergen but generally allergens resist enzymatic hydrolysis in the gastrointestinal tract (see review by Aalberse, 1997). Whether fish react allergically, i.e. with a type I hypersensitivity reaction, has not been demonstrated. With the exception of Perciformes (tilapia, sea bass and sea bream; Mulero et al. 2007), mast cells of salmonids and most other orders of finfish investigated do not contain histamine (Reite, 1965 and 1972; Dezfuli et al., 2000; Mulero et al., 2007) and the fish do not react to intravascular injection of histamine (Reite, 1972). Also, teleosts do not appear to have an analogous structure to monomeric IgE, only tetrameric IgM and possibly monomeric IgD (Wilson et al., 1997; Choi et al., 2007). On the other hand, the distal intestine of at least some fish appears to be sensitive to antigen stimulation and strong immune responses are achieved with antigens delivered to this region (Ellis, 1995). A few protein components of some legume seeds and cereals elicit antigenic effects in animals and these compounds are capable of inducing intestinal mucosal lesions, abnormalities in the villi, specific and non-specific immune responses and abnormal movement of digesta through the gut (D‘Mello, 1991; Lalles and Peltre, 1996). Soybean protein contains compounds such as glycinin (G) and beta conglycinin (bC), which act as allergens to several animals and man. Rumsey et al. (1993 and 1994) reported that high levels of immunologically active G and bC in different soy preparations seemed to negatively affect growth performance in rainbow trout. They assumed that the comparatively underinvestigated effects of allergens may provide answers to why conventionally processed soybean, in which the proteinase inhibitors and lectins have been largely inactivated, results in poor growth of salmonid fish. Haemagglutination inhibition assays (HIA) by the same authors showed that normal processing measures like toasting and de-fatting did not significantly reduce antigenicity levels in soybean meal. However, the evidence was not directly conclusive that it indeed was glycinin, beta-conglycinin or any other allergen/antigen in the soybeans that were the cause of the inflammation. Kaushik et al. (1995) failed to detect any antigenic proteins in soy protein concentrate but glycinin and beta-conglycinin were

142

Anne Marie Bakke

detected in defatted, toasted soy flour. Following a 12-week growth trial feeding rainbow trout the two soy products at various levels, neither soy product elicited detectable levels of antibodies against soybean protein in the sera of the fish. Nor were growth or apparent digestibility coefficients for dry matter or protein significantly different for the different soy products. Thus rainbow trout do not appear to react allergically to soybean meal may be caused by. The observed enteritis-like changes in the distal intestine of Atlantic salmon fed diets containing full-fat and solvent-extracted soybean meal or an alcohol extract of soybean meal may be caused by antigenic compounds present, triggering a variety of non-specific and specific immune responses in the fish intestine (Baeverfjord and Krogdahl 1996; BakkeMcKellep et al. 2000 and 2007a). The presence of allergens or antigens that fish may react to in common plant-derived feed ingredients, however, remains a matter of controversy. Recently, however, the involvement of mast cells (Urán et al., 2009) and T cells positive for an antibody against human CD3-epsilon (Bakke-McKellep et al., 2007a) have been suggested in Atlantic salmon exhibiting SBM-induced enteropathy (Bakke-McKellep et al. 2007a). Furthermore, significant up-regulation of CD4 and CD8-beta mRNA expression in the tissue indicated a mixed population of T cells present. The presence of T cells and involvement of PAR2 (Thorsen et al., 2008) suggests that the inflammation has similarities to a type IV hypersensitivity reaction, involving cytotoxic (CD8+) as well as T helper cells (CD4+). The specific pathogenesis and cause of the soybean meal-induced enteropathy in salmonids remains to be clearly illucidated.

Combined Effects of ANFs Knowledge regarding interactions between ANFs on digestive functions and gut health in fish are very limited in general, but it appears that this may be of interest in unraveling the cause of intestinal functional, structural and immunological disturbances caused by SBM in various fish species. Furthermore, mixes of different plant protein ingredients, with their differing ANF profiles, are often used in practical feed formulations. Studies are needed to expose the effects of mixtures of antinutrients with these mixtures of ingredients. Alvarez and Torres-Pinedo (1982) suggested that soybean lectin bound to rabbit jejunal enterocyte apical membranes had a potentiating effect on saponin‘s detrimental influence on epithelial barrier function. Following this lead, Knudsen et al. (2008) recently demonstrated in Atlantic salmon that adding purified saponins from soybeans to a fishmeal-based diet did not elicit an inflammatory response in the distal intestine or changes in faecal dry matter, and caused only minor changes in in vitro intestinal permeability compared to the same diet without saponins added. Nor did lupin kernel meal from sweet lupins (L. angustifolius) elicit inflammation. However, the combination of soysaponins and lupin kernel meal did cause an inflammatory response in the distal intestine similar to the one observed in the defatted (extracted) soybean meal control group. This combination of saponins and lupin meal also increased in vitro intestinal permeability compared to the fishmeal control group, but not to the same extent as that measured in the soybean meal control group. The authors concluded that the combination of saponins and an unidentified factor or factors in the lupin meal caused the inflammation and increased tissue permeability. However, changes in the intestinal microbiota due the different feed ingredients and an interaction between the saponins and microbiota could not be ruled out.

Soybean Meal in Diets for Cultured Fishes

143

Iwashita et al. (2009) concluded similarly in a study with rainbow trout: soy saponins added to a semi-purified diet without SBM did not cause an inflammatory response, whereas signs of this were observed in a diet containing bot soy saponins and lectins. Bakke-McKellep et al. (2008) found that the combination of soybean lectin (SBA) and soybean trypsin inhibitor severely reduced intestinal epithelial function of Atlantic salmon, as assessed by glucose absorption in an in vitro system. SBA and the trypsin inhibitors individually did not affect glucose absorption in intestinal tissue when compared to that of tissue not exposed to ANFs. Interestingly, PHA (phytohaemagglutinin, lectin) from kidney beans reduced glucose absorption in a similar manner as the SBA/trypsin inhibitor combination in the same experiment.

SUMMARY Knowledge regarding responses to various qualities/processing methods of soybean meal in feeds for fishes, as well as to purified soy ANFs and/or various extracts from soybeans has resulted in some insights in effects of soybean meal and the possible role of various ANFs in decreased growth performance, feed utilization, digestive disturbances and/or inflammatory responses observed in at least some fish species, most natably the salmonids Atlantic salmon and rainbow trout. Saponins, lectins, proteinase inhibitors, non-starch poly-/oligosaccharides, phytoestrogens, and/or antigenic peptides may potentially have a role in inducing the inflammation. However, it cannot be ruled out that as yet unidentified components as well as the gut microbiota may be involved. Various processing measures presently employed in feed manufacturing decrease activity/concentration of individual ANFs more or less effectively. However, recent findings suggest combinations of various ANFs, most notably soy saponins, may have particular significance in causing detrimental effects on intestinal structure, function and defense mechanisms. More research is needed to investigate ANF and antigenic peptide involvement in the digestive disturbances in various farmed fish, as well as the longterm effects of SBM-induced enteropathy in salmonids. This will aid in identifying steps needed to reduce these problems and prevent detrimental health effects to the fish. Moreover, during investigations on the effects of soybean meal as well as other plant ingredients in feeds for fish, greater efforts to characterize, quantify and report the antinutrients present would provide valuable information on their potential involvement in the digestive and inflammatory disturbances. Similarly, it would be helpful if the fish feed industry would provide such information. This would be a powerful tool in assessing longer-term effects of antinutritional factors on fish health.

REFERENCES Aalberse, Rr.C. (1997. Food allergens. Environ. Toxicol. Phar., 4, 55-60. Abel, H. J., Becker, K., Meske, C. H. R. & Friedrich, W. (1984). Possibilities of using heattreated full-fat soybeans in carp feeding. Aquaculture, 42, 97-108. Alvarez, J. R. & Torres-Pinedo, R. (1982). Interactions of soybean lectins, soyasaponins, and glycinin with rabbit jejunal mucosa in vitro. Pediatric Res., 16, 728-731.

144

Anne Marie Bakke

Arndt, R. E., Hardy, R. W., Sugiura, S. H. & Dong, F. M. (1999). Effects of heat treatment and substitution. Aquaculture, 180, 129-145. Arnesen, P., Brattås, L.E., Olli, J. J. & Krogdahl, Å. (1990). Soybean carbohydrates appear to restrict the utilization of nutrients by Atlantic salmon (Salmo salar L.). In: M. Takeda, & T. Watanabe, (Eds.) The Current Status of Fish Nutrition in Aquaculture. Tokyo Univ. Fisheries, Tokyo, Japan, 273-280. Aslaksen, M. A., Kraugerud, O. F., Penn, M., Svihus, B., Denstadli, V., Jørgensen, H. Y., Hillestad, M., Krogdahl, Å. & Storebakken, T. (2007). Screening of nutrient digestibilities and intestinal pathologies in Atlantic salmon fed diets with legumes, oilseeds, or cereals. Aquaculture, 272, 541-555. Bach-Knudsen, K. E. (1997). Carbohydrate and lignin contents of plant material used in animal feeding. Anim. Feed Sci. Technol., 67, 319-338. Baeverfjord, G. & Krogdahl, A. (1996). Development and regression of soybean meal induced enteritis in Atlantic salmon, Salmo salar L., distal intestine: a comparison with the intestines of fasted fish. J. Fish Dis., 19, 375-387. Bakke-McKellep, A. M. (1999). Intestinal nutrient absorption in Atlantic salmon (Salmo salar L.) and pathophysiological response of the intestinal mucosa to dietary soybean meal. Ph.D. thesis, Norwegian School of Veterinary Science, Oslo, Norway. Bakke-McKellep, A. M., Press, C. M., Krogdahl, A. & Landsverk, T. (2000). Changes in immune and enzyme histochemical phenotypes of cells of the intestinal mucosa of Atlantic salmon (Salmo salar L.) with soybean-meal induced enteritis. J. Fish Dis., 23, 115-127. Bakke-McKellep, A. M., Froystad, M. K., Lilleeng, E., Dapra, F., Refstie, S., Krogdahl, A. & Landsverk, T. (2007a). Response to soy: T-cell-like reactivity in the intestine of Atlantic salmon, Salmo salar L. J. Fish Dis., 30, 13-25. Bakke-McKellep, A. M., Penn, M. H., Salas, P. M., Refstie, S., Sperstad, S., Landsverk, T., Ringo, E. & Krogdahl, A. (2007b). Effects of dietary soyabean meal, inulin and oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and proliferation in the teleost Atlantic salmon (Salmo salar L.). Br. J. Nutr., 97, 699-713. Bakke-McKellep, A. M., Penn, M. H., Chikwati, E., Hage, E., Cai, C. & Krogdahl, A. (2008). In vitro effects of various anti-nutritional factors on intestinal glucose absorption and histology in Atlantic salmon. Book of Abstracts from XIII ISFNF - International Symposium on Fish Nutrition and Feeding, June 1-5 2008, Florianopolis. Barros, M. M., Lim, C. & Klesius, P. H. (2002). Effect of soybean meal replacement by cottonseed meal and iron supplementation on growth, immune response and resistance of Channel Catfish (Ictalurus punctatus) to Edwardsiella ictaluri challenge. Aquaculture, 207, 263-279. Bauer, E., Williams, B. A., Smidt, H., Mosenthin, R. & Verstegen, M. W. A. (2006). Influence of dietary components on development of the microbiota in single-stomached species. Nutr. Res. Rev., 19, 63-78. Bennetau-Pelissero, C., Breton, B., Bennetau, B., Corraze, G., Le Menn, F., vail-Cuisset, B., Helou, C. & Kaushik, S. J. (2001). Effect of genistein-enriched diets on the endocrine process of gametogenesis and on reproduction efficiency of the rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol, 121, 173-187. Berg-Lea, T., Brattås, L. E. & Krogdahl, A. (1989). Soybean proteinase inhibitors affect nutrient digestion in rainbow trout. In: J., Huisman, T. F. B. van der Pool, & I. Liener,

Soybean Meal in Diets for Cultured Fishes

145

(Eds.), Recent Advances of Research in Antinutritional Factors in Legume Seeds. Pudoc, Wageningen, 99-102. Berhow, M. A., Kong, S. B., Vermillion, K. E. & Duval, S. M. (2006). Complete quantification of group A and group B soyasaponins in soybeans. J. Agric. Food Chem., 54, 2035-2044. Bonaldo, A., Roem, A. J., Pecchini, A., Grilli, E. & Gatta, P. P. (2006). Influence of dietary soybean meal levels on growth, feed utilization and gut histology of Egyptian sole (Solea aegyptiaca) juveniles. Aquaculture, 261, 580-586. Bonaldo, A., Roem, A. J., Fagioli, P., Pecchini, A., Cipollini, I. & Gatta, P. P. (2008). Influence of dietary levels of soybean meal on the performance and gut histology of gilthead sea bream (Sparus aurata L.) and European sea bass (Dicentrarchus labrax L.). Aquacult. Res., 39, 970-978. Bureau, D. P., Harris, A. M. & Cho, C. Y. (1998). The effects of purified alcohol extracts from soy products on feed intake and growth of chinook salmon (Oncorhynchus tshawytscha) and rainbow trout (Oncorhynchus mykiss). Aquaculture, 161, 27-43. Burrells, C., Williams, P. D., Southgate, P. J. & Crampton, V. O. (1999). Immunological, physiological and pathological responses of rainbow trout (Oncorhynchus mykiss) to increasing dietary concentrations of soybean proteins. Vet. Immunol. Immunopathol, 72, 277-288. Buttle, L. G., Burrells, A. C., Good, J. E., Williams, P. D., Southgate, P. J. & Burrells, C. (2001). The binding of soybean agglutinin (SBA) to the intestinal epithelium of Atlantic salmon, Salmo salar and rainbow trout, Oncorhynchus mykiss, fed high levels of soybean meal. Vet. Immunol. Immunopathol, 80, 237-244. Caldwell, R. A. (1992). Effect of calcium and phytic acid on the activation of trypsinogen and the stability of trypsin. J. Agric. Food Chem., 40, 43-47. Catacutan, M. R. & Pagador, G. E. (2004). Partial replacement of fishmeal by defatted soybean meal in formulated diets for the mangrove red snapper, Lutjanus argentimaculatus (Forsskal 1775). Aquacult. Res., 35, 299-306. Chehade, M. & Mayer, L. (2005). Oral tolerance and its relation to food hypersensitivities. J Allergy Clin. Immunol, 115, 3-12. Choi, D. H., Jang, H. N., Ha, D. M., Kim, J. W., Oh, C. H. & Choi, S. H. (2007). Cloning and expression of partial Japanese flounder (Paralichthys olivaceus) IgD. J. Biochem. Mol., Biol., 40, 459-466. Chou, R. L., Her, B. Y., Su, M. S., Hwang, G., Wu, Y. H. & Chen, H. Y. (2004). Substituting fish meal with soybean meal in diets of juvenile cobia Rachycentron canadum. Aquaculture, 229, 325-333. Cleland, J. L., Kensil, C. R., Lim, A., Jacobsen, N. E., Basa, L., Spellman, M., Wheeler, D. A., Wu, J. Y. & Powell, M. F. (1996). Isomerization and formulation stability of the vaccine adjuvant QS-21. J. Pharm. Sci., 85, 22-28. Cummings, J. H., Englyst, H. N. & Wiggins, H. S. (1986). The role of carbohydrates in lower gut function. Nutr. Rev., 44, 50-54. Dabrowski, K. & Kozak, B. (1979). The use of fishmeal and soybean meal as a protein source in the diet of grass carp fry. Aquaculture, 18, 107-114. Dabrowski, K., Poczyczynski, P., Köck, G. & Berger, R. (1989). Effect of partially or totally replacing fishmeal protein by soybean meal protein on growth, feed utilisation and

146

Anne Marie Bakke

proteolytic enzyme activities in rainbow trout (Salmo gairdneri). New in vivo test for endocrine pancreatic secretion. Aquaculture, 77, 29-49. Davies, S. J. & Morris, P. C. (1997). Influence of multiple amino acid supplementation on the performance of rainbow trout, Oncorhynchus mykiss (Walbaum), fed soya based diets. Aquacult. Res., 28, 65-74. Davis, A. T. & Stickney, R. R. (1978). Growth responses of Tilapia aurea to dietary protein quality and quantity. Transactions Am. Fisheries Soc., 107, 479-483. Deng, J. M., Mai, K. S., Ai, Q. H., Zhang, W. B., Wang, X. J., Xu, W. & Liufu, Z. G. (2006). Effects of replacing fish meal with soy protein concentrate on feed intake and growth of juvenile Japanese flounder, Paralichthys olivaceus. Aquaculture, 258, 503-513. Denstadli, V., Skrede, A., Krogdahl, Å., Sahlstrøm, S. & Storebakken, T. (2006). Feed intake, growth, feed conversion, digestibility, enzyme activities and intestinal structure in Atlantic salmon (Salmo salar L.) fed graded levels of phytic acid. Aquaculture, 256, 365376. Dezfuli, B. S., Arrighi, S., Domeneghini, C. & Bosi, G. (2000). Immunohistochemical detection of neuromodulators in the intestine of Salmo trutta L. naturally infected with Cyathocephalus truncatus Pallas (Cestoda). J. Fish Dis., 23, 265-273. D‘Mello, F. J. P. (1991). Antigenic proteins. In: F. J. P., D‘Mello, C. M. Duffus, & J. H. Duffus, (Eds.), Toxic Substances in Crop Plants. The Royal Society of Chemistry, Thomas Graham House, Science Park, Cambridge CB4 4WF, Cambridge, 108-125. Ellis, A. E. (1995). Recent development in oral vaccine delivery systems. Fish Pathol, 30, 293-300. El-Sayed, A. F. M. (1999). Alternative dietary protein sources for farmed tilapia, Oreochromis spp. Aquaculture, 179, 149-168. Evans, J. J., Pasnik, D. J., Peres, H., Lim, C. & Klesius, P. H. (2005). No apparent differences in intestinal histology of channel catfish (Ictalurus punctatus) fed heat-treated and nonheat-treated raw soybean meal. Aquacult. Nutr, 11, 123-129. Førde-Skjærvik, O., Refstie, S., Aslaksen, M. A. & Skrede, A. (2006). Digestibility of diets containing different soybean meals in Atlantic cod (Gadus morhua); comparison of collection methods and mapping of digestibility in different sections of the gastrointestinal tract. Aquaculture, 261, 241-258. Francis, G., Makkar, H. P. S. & Becker, K. (2001). Antinutritional factors present in plantderived alternate fish feed ingredients and their effects in fish. Aquaculture, 199, 197227. Francis, G., Kerem, Z., Makkar, H. P. S. & Becker, K. (2002). The biological action of saponins in animal systems: a review. Br. J. Nutr., 88, 587-605. Gatlin, D. M., Robinson, E. H., Poe, W. E. & Wilson, R. P. (1982). Magnesium requirement of fingerling channel catfish and signs of magnesium deficiency. J. Nutr., 112, 11821187. Gatlin, D. M. & Wilson, R. P. (1984). Zinc supplementation of practical channel catfish diets. Aquaculture, 41, 31-36. Gdala, J., Jansman, A. J. M., Buraczewska, L., Huisman, J. & van Leeuwen, P. (1997). The influence of α-galactosidase supplementation on the ileal digestibility of lupin seed carbohydrates and dietary protein in young pigs. Anim. Feed Sci. Technol, 67, 115-125. Gee, J. M., Wortley, G. M., Johnson, I. T., Price, K. R., Rutten, A. A. J. J., Houben, G. F. & Penninks, A. H. (1996). Effects of saponins and glycoalkaloids on the permeability and

Soybean Meal in Diets for Cultured Fishes

147

viability of mammalian intestinal cells and on the integrity of tissue preparations in vitro. Toxicol. In Vitro, 10, 117-128. Gestetner, B., Birk, Y. & Tencer, Y. (1968). Soybean Saponins - Fate of Ingested Soybean Saponins and Physiological Aspect of Their Hemolytic Activity. J. Agric. Food Chem., 16, 1031-1035. Gibson, G. R. & Roberfroid, M. B. (1995). Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr., 125, 1401-1412. Grisdale-Helland, B., Helland, S. J., Baeverfjord, G. & Berge, G. M. (2002). Full-fat soybean meal in diets for Atlantic halibut: growth, metabolism and intestinal histology. Aquacult. Nutr., 8, 265-270. Hansen A. C., Rosenlund, G., Karlsen, R., Olsvik, P. A. & Hemre, G. I. (2006). The inclusion of plant protein in cod diets, its effects on macronutrient digestibility, gut and liver histology and heat shock protein transcription. Aquacult. Res., 37, 773-784. Hardy, R. W. (1996). Alternate protein sources for salmon and trout diets. Anim. Feed Sci. Technol., 59, 71-80. Helland, S., Denstadli, V., Witten, P. E., Hjelde, K., Storebakken, T., Skrede, A., Åsgård, T. & Baeverfjord, G. (2006). Hyper dense vertebrae and mineral content in Atlantic salmon (Salmo salar) fed diets with graded levels of phytic acid. Aquaculture, 261, 603-614. Hendricks, H. G. C. J. M., van den Ingh, T. S. G. A. M., Krogdahl, A., Olli, J. & Koninkx, J. F. J. G. (1990). Binding of soybean agglutinin to small intestinal brush border membranes and brush border membrane enzyme activities in Atlantic salmon (Salmo salar). Aquaculture, 91, 163-170. Hídvégi, M. & Lásztity, R. (2002). Phytic acid content of cereals and legumes and interaction with proteins. Periodica Polytechnica Ser. Chem. Eng., 46, 59-64. Hossain, M. A. & Jauncey, K. (1993). The effect of varying dietary phytic acid, calcium and magnesium levels on the nutrition of common carp, Cyprinus carpio. In: S. J. Kaushik, & P. Luquent, (Eds) Fish Nutrition in Practice. Proceedings of International Conference, Biarritz, France, June 24–27, 1991, 705-715. Inudo, M., Ishibashi, H., Matsumura, N., Matsuoka, M., Mori, T., Taniyama, S., Kadokami, K., Koga, M., Shinohara, R., Hutchinson, T. H., Iguchi, T. & Arizono, K. (2004). Effect of estrogenic activity, and phytoestrogen and organochlorine pesticide contents in an experimental fish diet on reproduction and hepatic vitellogenin production in medaka (Oryzias latipes). Comp. Med., 54, 673-680. Iwashita, Y., Suzuki, N., Matsunari, H., Sugita, T. & Yamamoto, T. (2008). Influence of soya saponins, soya lectin, and cholyltarine supplemented to a casein-based semipurified diet on intestinal morphology and biliary bile status in fingerling rainbow trout Oncorhynchus mykiss. Fish. Sci., 75, 1307-1315. Jackson, A. J., Capper, B. S. & Matty, A. J. (1982). Evaluation of some plant proteins in complete diets for the tilapia Sarotherodon mossambicus. Aquaculture, 27, 97-109. Johnson, I. T., Gee, J. M., Price, K., Curl, C. & Fenwick, G. R. (1986). Influence of Saponins on Gut Permeability and Active Nutrient Transport Invitro. J. Nutr., 116, 2270-2277. Karalazos, V., Treasurer, J., Cutts, C. J., Alderson, R., Galloway, T. F., Albrektsen, S., Arnason, J., MacDonald, N., Pike, I. & Bell, G. (2007). Effects of fish meal replacement with full-fat soy meal on growth and tissue fatty acid composition in Atlantic cod (Gadus morhua). J. Agricult. Food Chem., 55, 5788-5795.

148

Anne Marie Bakke

Kasper, C. S., Watkins, B. A. & Brown, P. B. (2007). Evaluation of two soybean meals fed to yellow perch (Perca flavescens). Aquacult. Nutr., 13, 431-438. Kaushik, S. J., Cravedi, J. P., Lalles, J. P., Sumpter, J., Fauconneau, B. & LaRoche, M. (1995). Partial or total replacement of fish-meal by soybean protein on growth, proteinutilization, potential estrogenic or antigenic effects, cholesterolemia and flesh quality in rainbow-trout, Oncorhynchus-mykiss. Aquaculture, 133, 257-274. Kim, J. D., Tibbetts, S. M., Milley, J. E. & Lall, S. P. (2007). Effect of the incorporation level of dehulled soybean meal into test diet on apparent digestibility coefficients for protein and energy by juvenile haddock, Melanogrammus aeglefinus L. Aquaculture, 267, 308314. Kitagawa, I., Saito, M., Taniyama, T. & Yoshikawa, M. (1985). Saponin and sapogenol . Structure of soyasaponin-A2, a bisdesmoside of soyasapogenol-A, from soybean, the seeds of Glycine max Merrill. Chem. Pharm. Bull, 33, 598-608. Knudsen, D., Ron, O., Baardsen, G., Smedsgaard, J., Koppe, W. & Froklaer, H. (2006). Soyasaponins resist extrusion cooking and are not degraded during gut passage in Atlantic salmon (Salmo salar L.). J. Agric. Food Chem., 54, 6428-6435. Knudsen, D., Uran, P., Arnous, A., Koppe, W. & Frokiaer, H. (2007). Saponin-containing subfractions of soybean molasses induce enteritis in the distal intestine of Atlantic salmon. J. Agric. Food Chem., 55, 2261-2267. Knudsen, D., Jutfelt, F., Sundh, H., Sundell, K., Koppe, W. & Frøkiær, H. (2008). Dietary soya saponins increase gut permeability and play a key role in the onset of soyabeaninduced enteritis in Atlantic salmon (Salmo salar L.). Brit. J. Nutr., 100, 120-129. Kraugerud, O. F., Penn, M., Storebakken, T., Refstie, S., Krogdahl, A. & Svihus, B. (2007). Nutrient digestibilities and gut function in Atlantic salmon (Salmo salar) fed diets with cellulose or non-starch polysaccharides from soy. Aquaculture, 273, 96-107. Krogdahl, Å., Berg Lea, T. & Olli, J. J. (1994). Soybean proteinase inhibitors affect intestinal trypsin activities and amino acid digestibilities in rainbow trout (Oncorhyncus mykiss). Comp. Biochem. Physiol. A, 107A, 215-219. Krogdahl, A., Roem, A. & Baeverfjord, G. (1995). Effects of soybean saponin, raffinose and soybean alcohol extract on nutrient digestibilities, growth and intestinal morphology in Atlantic salmon. Proceedings of the International Conference of Aquaculture '95 and the Satellite Meeting Nutrition and Feeding of Cold Water Species , pp. 118-119. Ghent, Belgium, European Aquaculture Society. European Aquaculture Society Special Publication, no. 23. Krogdahl, A., Bakke-McKellep, A. M., Røed, K. H. & Baeverfjord, G. (2000). Feeding Atlantic salmon (Salmo salar L.) soybean products: Effects on disease resistance (furunculosis), and lysozyme and IgM levels in the intestinal mucosa. Aquacult. Nutr., 6, 77-84. Krogdahl, A., Bakke-McKellep, A. M. & Baeverfjord, G. (2003). Effects of graded levels of standard soybean meal on intestinal structure, mucosal enzyme activities, and pancreatic response in Atlantic salmon (Salmo salar L.). Aquaculture Nutr., 9, 361-371. Krogdahl, Å. & Bakke-McKellep, A. M. (2005). Fasting and refeeding cause rapid changes in intestinal tissue mass and digestive enzyme capacities of Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol., 141A, 450-460. Lalles, J. P. & Peltre, G. (1996). Biochemical features of grain legume allergens in humans and animals. Nutr. Rev., 54, 101-107.

Soybean Meal in Diets for Cultured Fishes

149

Liener, I. (1980). Toxic Constituents of Plant Foodstuffs. Academic Press, New York. 502. Lilleeng, E., Froystad, M. K., Ostby, G. C., Valen, E. C. & Krogdahl, Å. (2007). Effects of diets containing soybean meal on trypsin mRNA expression and activity in Atlantic salmon (Salmo salar L). Comp. Biochem. Physiol. A-Mol. Integrative Physiol, 147, 2336. Lilleeng, E., Penn, M. H., Haugland, O., Xu, C., Bakke, A. M., Krogdahl, Å., Landsverk, T. & Froystad-Saugen, M. K. (2009). Decreased expression of TGF-ß, GILT and T-cell markers in the early stages of soybean enteropathy in Atlantic salmon (Salmo salar L.). Fish Shelfish Immunol, 27, 65-72. Lott, J. N. A., Ockenden, I., Raboy, V. & Batten, G. D. (2000). Phytic acid and phosphorus in crop seeds and fruits: a global estimate. Seed Sci. Res., 10, 11-33. Malinow, M. R., Mclaughlin, P., Papworth, L., Stafford, C., Kohler, G. O., Livingston, A. L. & Cheeke, P. R. 1977. Effect of alfalfa saponins on intestinal cholesterol absorption in rats. Am. J. Clin. Nutr., 30, 2061-2067. Mambrini, M., Roem, A. J., Cravedi, J. P., Lalles, J. P. & Kaushik, S. J. (1999). Effects of replacing fish meal with soy protein concentrate and of DL-methionine supplementation in high-energy, extruded diets on the growth and nutrient utilization of rainbow trout, Oncorhynchus mykiss. J. Anim. Sci., 77, 2990-2999. Martin, S. A. M., Vilhelmsson, O., Médale, F., Watt, P., Kaushik, S. & Houlihan, D. F. (2003). Proteomic sensitivity to dietary manipulations in rainbow trout. Biochim. Biophys. Acta-Prot. Proteom., 1651, 17-29. McLean, E. & Ash, R. (1987). Intact protein (antigen) absorption in fishes: mechanisms and physiological significance. J. Fish Biol., 31 (Suppl A), 219-223. Milligan, S. R., Khan, O. & Nash, M. (1998). Competitive binding of xenobiotic oestrogens to rat alpha-fetoprotein and to sex steroid binding proteins in human and rainbow trout (Oncorhynchus mykiss) plasma. Gen. Comp. Endocrinol., 112, 89-95. Mulero, I., Sepulcre, M. P., Meseguer, J., García-Ayala, A. & Mulero, V. (2007). Histamine is stored in mast cells of most evolutionarily advanced fish and regulates the fish inflammatory response. PNAS, 104, 19434-19439. Nordrum, S., Bakke-McKellep, A. M., Krogdahl, Å. & Buddington, R. K. (2000). Effects of soybean meal and salinity on intestinal transport of nutrients in Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol., (125B), 317-335. Oliva-Teles, A., Gouveia, A. J., Gomes, E. & Rema, P. (1994). The effect of different processing treatments on soybean meal utilization by rainbow trout, Oncorhynchus mykiss. Aquaculture, 124, 343-349. Olli, J. J., Hjelmeland, K. & Krogdahl, Å. (1994a). Soybean trypsin inhibitors in diets for Atlantic salmon (Salmo salar L.): effects on nutrient digestibilities and trypsin in pyloric caeca homogenate and intestinal content. Comp. Biochem. Physiol., 109A, 923-928. Olli, J. J., Krogdahl, Å., van den Ingh, T. S. G. A. M. & Brattås, L. E. (1994b). Nutritive value of four soybean products in diets for Atlantic salmon (Salmo salar, L.). Acta Agricult. Scand., Sec. A, Anim. Sci., 44, 50-60. Olli, J. J. & Krogdahl, Å. (1994). Nutritive value of four soybean products as protein sources in diets for rainbow trout (Oncorhynchus mykiss, Walbaum) reared in fresh water. Acta Agricult. Scand., Sec. A, Anim. Sci., 44, 185-192.

150

Anne Marie Bakke

Olli, J. J. & Krogdahl, Å. (1995). Alcohol soluble components of soybeans seem to reduce fat digestibility in fish-meal-based diets for Atlantic salmon, Salmo salar L. Aquacult. Res.., 26, 831-835. Ostaszewska, T., Dabrowski, K., Palacios, M. E., Olejniczak, M. & Wieczorek, M. (2005). Growth and morphological changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) and pacu (Piaractus mesopotamicus) due to casein replacement with soybean proteins. Aquaculture, 245, 273-286. Pelissero, C., Lemenn, F. & Kaushick, S. (1991a). Estrogenic effect of dietary soya bean meal on vitellogenesis in cultured Siberian sturgeon Acipenser baeri. Gen. Comp. Endocrinol. 83, 447-457. Pelissero, C., Bennetau, B., Babin, P., Lemenn, F. & Dunogues, J. (1991b). The estrogenic activity of certain phytoestrogens in the Siberian sturgeon Acipenser baeri. J. Steroid Biochem. Mol. Biol., 38, 293-299. Peres, H., Lim, C. & Klesius, P. H. (2003). Nutritional value of heat-treated soybean meal for channel catfish (Ictalurus punctatus). Aquaculture, 225, 67-82. Peumans, W. J. & Van Damme, E. J. M. (1995). Lectins as plant defense proteins. Plant Physiol., 109, 347-352. Pool-Zobel, B., Van Loo, J., Rowland, I. & Roberfroid, M. B. (2002). Experimental evidence on the potential of prebiotic fructans to reduce the risk of colon cancer. Br. J. Nutr., 87, 273-281. Portz, L. & Cyrino, J. E. P. (2004). Digestibility of nutrients and amino acids of different protein sources in practical diets by largemouth bass Micropterus salmoides (Lacepede, 1802). Aquacult. Res., 35, 312-320. Pusztai, A., Ewen, S. W. B., Grant, G., Peumans, W. J., Van Damme, E. J. M., Coates, M. E. & Bardocz, S. (1995). Lectins and also bacteria modify the glycosylation of gut surface receptors in the rat. Glycoconjugate J, 12, 22-35. Quartararo, N., Allan, G. L. & Bell, J. D. (1998). Replacement of fish meal in diets for Australian snapper, Pagrus auratus. Aquaculture, 166, 279-295. Refstie, S., Helland, S. J. & Storebakken, T. (1997). Adaptation to soybean meal in diets for rainbow trout, Oncorhynchus mykiss. Aquaculture, 153, 263-272. Refstie, S., Storebakken, T. & Roem, A. J. (1998). Feed consumption and conversion in Atlantic salmon (Salmo salar) fed diets with fish meal, extracted soybean meal or soybean meal with reduced content of oligosaccharides, trypsin inhibitors, lectins and soya antigens. Aquaculture, 162, 301-312. Refstie, S., Korsoen, O. J., Storebakken, T., Baeverfjord, G., Lein, I. & Roem, A. J. (2000). Differing nutritional responses to dietary soybean meal in rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Aquaculture, 190, 49-63. Refstie, S., Sahlström, S., Bråthen, E., Baeverfjord, G. & Krogedal, P. (2005). Lactic acid fermentation eliminates indigestible carbohydrates and antinutritional factors in soybean meal for Atlantic salmon (Salmo salar). Aquaculture, 246, 331-345. Refstie, S., Førde-Skjærvik, O., Rosenlund, G. & Rørvik, K. A. (2006a). Feed intake, growth, and utilisation of macronutrients and amino acids by 1- and 2-year old Atlantic cod (Gadus morhua) fed standard or bioprocessed soybean meal. Aquaculture, 255, 279-291. Refstie, S., Landsverk, T., Bakke-McKellep, A. M., Ringø, E., Sundby, A., Shearer, K. D. & Krogdahl, Å. (2006b). Digestive capacity, intestinal morphology, and microflora of 1-

Soybean Meal in Diets for Cultured Fishes

151

year and 2-year old Atlantic cod (Gadus morhua) fed standard or bioprocessed soybean meal. Aquaculture, 261, 269-284. Reigh, R. C. & Ellis, S. C. (1992). Effects of dietary soybean and fish-protein ratios on growth and body composition of red drum (Sciaenops ocellatus) fed isonitrogenous diets. Aquaculture, 104, 279-292. Reite, O. B. (1965). A phylogenetical approach to the functional significance of tissue mast cell histamine. Nature, 206, 1334-1336. Reite, O. B. (1972). Comparative physiology of histamine. Physiol. Rev., 52, 778-819. Ringø, E., Sperstad, S., Myklebust, R., Mayhew, T. M. & Olsen, R. E. (2006a). The effect of dietary inulin on the aerobic bacteria associated with hindgut of Arctic charr (Salvelinus alpinus L.). Aquacult. Res., 37, 891-897. Ringø, E., Sperstad, S., Myklebust, R., Refstie, S. & Krogdahl, Å. (2006b). Characterisation of the microbiota associated with intestine of Atlantic cod (Gadus morhua L). The effects of fish meal, soybean meal and a bioprocessed meal. Aquaculture, 261, 829-841. Robaina, L., Izquierdo, M. S., Moyano, F. J., Socorro, J., Vergara, J. M., Montero, D. & Fernandez-Palacios, H. (1995). Soybean and lupin seed meals as protein-sources in diets for gilthead seabream (Sparus aurata): nutritional and histological implications. Aquaculture, 130, 219-233. Romarheim, O. H., Skrede, A., Gao, Y. L., Krogdahl, Å., Denstadli, V., Lilleeng, E. & Storebakken, T. (2006). Comparison of white flakes and toasted soybean meal partly replacing fish meal as protein source in extruded feed for rainbow trout (Oncorhynchus mykiss). Aquaculture, 256, 354-364. Rumsey, G. L., Hughes, S. G. & Winfree, R. A. (1993). Chemical and nutritional evaluation of soya protein preparations as primary nitrogen sources for rainbow trout (Oncorhynchus mykiss). Anim. Feed Sci. Tech., 40, 135-151. Rumsey, G. L., Siwicki, A. K., Anderson, D. P. & Bowser, P. R. (1994). Effect of soybean protein on serological response, non-specific defense mechanisms, growth, and protein utilization in rainbow trout. Vet. Immunol. Immunopathol, 41, 323-339. Saini, H. S. (1989). Legume seed oligosaccharides. In: J., Huisman, A. F. B. Van der Poel, & I. E. Liener, (Eds) Recent Advances of Research in Antinutritional Factors in Legume Seeds. Pudoc, Wageningen, 329-341. Sanden, M., Berntssen, M. H. G., Krogdahl, Å., Hemre, G. I. & Bakke-McKellep, A. M. (2005). An examination of the intestinal tract of Atlantic salmon (Salmo salar L.) parr fed different varieties of soy and maize. J. Fish Dis., 28, 317-330. Sandholm, M., Smith, R. R., Shih, J. C. H. & Scott, M. L. (1976). Determination of antitrypsin activity on agar plates: relationship between antitrypsin and biological value of soybeans for trout. J. Nutr., 106, 761-766. Sansonetti, P. J. (2004). War and peace at mucosal surfaces. Nat. Rev. Immunol, 4, 953-964. Shiau, S. Y., Chuang, J. L. & Sun, C. L. (1987). Inclusion of soybean meal in tilapia (Oreochromis aureus  O. niloticus) diets at two protein levels. Aquaculture, 65, 251261. Shiraiwa, M., Kudo, S., Shimoyamada, M., Harada, K. & Okubo, K. (1991a). Composition and structure of group-A saponin in soybean seed. Agric. Biol. Chem., 55, 315-322. Shiraiwa, M., Harada, K. & Okubo, K. (1991b). Composition and structure of group-B saponin in soybean seed. Agric. Biol. Chem., 55, 911-917.

152

Anne Marie Bakke

Sire, M. F. & Vernier, J. M. (1992). Intestinal absorption of protein in teleost fish. Comp. Biochem. Physiol., 103A, 771-781. Sire, M. F., Dorin, D. & Vernier, J. M. (1992). Intestinal absorption of macromolecular proteins in rainbow trout. Aquaculture, 100, 234-235. Sjolander, A. & Cox, J. C. (1998). Uptake and adjuvant activity of orally delivered saponin and ISCOM (TM) vaccines. Adv. Drug Deliver. Rev., 34, 321-338. Smith, R. R. (1977). Recent research involving full-fat soybean meal in salmonid diets. Salmonid, 1, 8-18. Spinelli, J., Houle, C. R. & Wekell, J. C. (1983). The effect of phytates on the growth of rainbow trout (Salmo gairdneri) fed purified diets containing varying quantities of calcium and magnesium. Aquaculture, 30, 71-83. Storebakken, T., Kvien, I. S., Shearer, K. D., Grisdale-Helland, B., Helland, S. J. & Berge, G. M. (1998a). The apparent digestibility of diets containing fish meal, soybean meal or bacterial meal fed to Atlantic salmon (Salmo salar): evaluation of different faecal collection methods. Aquaculture, 169, 195-210. Storebakken, T., Shearer, K. D. & Roem, A. J. (1998b). Availability of protein, phosphorus and other elements in fish meal, soy-protein concentrate and phytase-treated soy-proteinconcentrate-based diets to Atlantic salmon, Salmo salar. Aquaculture, 161, 365-379. Tacon, A. G. J., Haastler, J. V., Featherstone, P. B., Kerr, K. & Jackson, A. J. (1983). Studies on the utilization of full-fat and solvent extracted soybean meal in a complete diet for rainbow trout. Bull. Jap. Soc. Sci. Fisheries, 49, 1437-1443. Thorsen, J., Lilleeng, E., Valen, E. C. & Krogdahl, A. (2008). Proteinase-activated reseptor-2: two potential inflammatory mediators of the gastrointestinal tract in Atlantic salmon. J. Inflamm, 5, 18. Tibaldi, E., Hakim, Y., Uni, Z., Tulli, F., de Francesco, M., Luzzano, U. & Harpaz, S. (2006). Effects of the partial substitution of dietary fish meal by differently processed soybean meals on growth performance, nutrient digestibilitiy and activity of intestinal brush border enzymes in the European sea bass (Dicentrarchus labrax). Aquaculture, 261, 182193. Tibbetts, S. M., Milley, J. E. & Lall, S. P. (2006). Apparent protein and energy digestibility of common and alternative feed ingredients by Atlantic cod, Gadus morhua (Linnaeus, 1758). Aquaculture, 261, 1314-1327. Tollefsen, K. E., Ovrevik, J. & Stenersen, J. (2004). Binding of xenoestrogens to the sex steroid-binding protein in plasma from Arctic charr (Salvelinus alpinus L.). Comp. Biochem. Phys. C, 139, 127-133. Twibell, R. G. & Wilson, R. P. (2004). Preliminary evidence that cholesterol improves growth and feed intake of soybean meal-based diets in aquaria studies with juvenile channel catfish, Ictalurus punctatus. Aquaculture, 236, 539-546. Van Damme, E. J. M., Peumans, W. J., Pusztai, A. & Bardocz, S. (1998). Handbook of Plant Lectins: Properties and Biomedical Applications. John Wiley & Sons, West Sussex, UK. Van den Ingh, T. S. G. A. M., Krogdahl, A., Olli, J., Hendricks, H. G. C. J. M. & Koninkx, J. F. J. G. (1991). Effects of soybean-containing diets on the proximal and distal intestine in Atlantic salmon (Salmo salar): a morphological study. Aquaculture, 9, 297-305. Van den Ingh, T. S. G. A. M., Olli, J. J. & Krogdahl, A. (1996). Alcohol-soluble components in soybeans cause morphological changes in the distal intestine of Atlantic salmon, Salmo salar L. J. Fish Dis, 19, 47-53.

Soybean Meal in Diets for Cultured Fishes

153

Venou, B., Alexis, M. N., Fountoulaki, E. & Haralabous, J. (2006). Effects of extrusion and inclusion level of soybean meal on diet digestibility, performance and nutrient utilization of gilthead sea bream (Sparus aurata). Aquaculture, 261, 343-356. Vielma, J., Ruohonen, K. & Peisker, M. (2002). Dephytinization of two soy proteins increases phosphorus and protein utilisation by rainbow trout, Oncorhynchus mykiss. Aquaculture, 204, 145-156. Vielma, J., Ruohonen, K., Gabaudan, J. & Vogel, K. (2004). Top-spraying soybean mealbased diets with phytase improves protein and mineral digestibilities but not lysine utilisation in rainbow trout, Oncorhynchus mykiss (Walbaum). Aquacult. Res., 35, 955964. Viola, S., Mokady, S., Rappaport, U. & Arieli, Y. (1982). Partial and complete replacement of fish meal by soybean meal in feeds for intensive culture of carp. Aquaculture, 26, 223236. Wang, H. J. & Murphy, P. A. (1994a). Isoflavone content in commercial soybean foods. J. Agric. Food Chem., 42, 1666-1673. Wang, H. J. & Murphy, P. A. (1994b). Isoflavone composition of American and Japanese soybeans in Iowa - Effects of variety, crop year, and location. J. Agric. Food Chem., 42, 1674-1677. Wiggins, H. S. (1984). Nutritional value of sugars and related compounds in the small gut. Proc. Nutr. Soc., 43, 69-75. Wilson, R. P., Bowser, P. B. & Poe, W. E. (1983). Dietary pantothenic acid requirement of fingerling channel catfish. J. Nutr., 113, 2124-2128. Wilson, R. P. & Poe, W. E. (1985). Effects of feeding soybean meal with varying trypsin inhibitor activities on growth of fingerling channel catfish. Aquaculture, 46, 19-25. Wilson, M., Bengten, E., Miller, N. W., Clem, L.W., DuPasquier, L. & Warr, G. W. (1997). A novel chimeric Ig heavy chain from a teleost fish shares similarities to IgD. PNAS, 94, 4593-4597. Xu, Z. R., Zou, X. T., Hu, C. H., Xia, M. S., Zhan, X. A. & Wang, M. Q. (2002). Effects of dietary fructooligosaccharides on digestive enzyme activities, intestinal microflora and morphology of growing pigs. Asian Austral. J. Anim. Sci., 15, 1784-1789. Yamamoto, T., Suzuki, N., Furuita, H., Sugita, T., Tanaka, N. & Goto, T. (2007). Supplemental effect of bile salts to soybean meal-based diet on growth and feed utilization of rainbow trout Oncorhynchus mykiss. Fisheries Sci., 73, 123-131. Yamamoto, T., Goto, T., Kine, Y., Endo, Y., Kitaoka, Y., Sugita, T., Furuita, H., Iwashita, Y. & Suzuki, N. (2008). Effect of an alcohol extract from a defatted soybean meal supplemented with a casein-based semi-purified diet on the biliary bile status and intestinal conditions in rainbow trout Oncorhynchus mykiss (Walbaum). Aquacult. Res., 39, 986-994. Zhou, Q. C., Mai, K. S., Tan, B. P. & Liu, Y. J. (2005). Partial replacement of fishmeal by soybean meal in diets for juvenile cobia (Rachycentron canadum). Aquacult. Nutr., 11, 175-182.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 5

SOYBEAN, A PEROXIDASE SOURCE FOR THE BIOTREATMENT OF EFFLUENTS J.L. Gómez 1*, M. Gómez 1 and M.D. Murcia 1 Department of Chemical Engineering, Murcia University, Spain

ABSTRACT Nowadays the massive industrialization of society has to deal with the efficient utilization and recycling of natural resources to achieve modern industrial manufacturing processes. Many industrial wastewater streams, mainly from producing polymers, resins, coatings, paints, dyes, agrochemicals, pharmaceuticals and oil refining are being discharged into the environment. Because of their toxicity level, higher than permitted, extensive research in economic and efficient technological treatments has been done recently without reaching a definitive solution. Among the numerous applications of soybean, its use as a source of soybean peroxidase is of particular interest in the area of bioremediation. Peroxidases are oxidoreductase enzymes with a wide variety of substrate specificity, that catalyze, in the presence of hydrogen peroxide, the oxidative polymerization of different pollutants widely found in industrial effluents, such as phenolic compounds, polycyclic aromatic hydrocarbons (PAHs), aromatic amines, non-phenolic aromatics and dyes. In general, these pollutants are highly toxic for both human beings and the environment, and they must be removed from wastewater before they are discharged into the environment. The use of enzymes is presented as an alternative method for the industrial wastewater treatment when conventional physical, chemical and biological methods such as adsorption in active carbon, chemical oxidation and microorganism treatment may be ineffective. Enzymes present several advantages: mainly they are easy to handle and store, operate within a wide range of conditions, present high specificity towards the targeted compounds and minimum environmental impact. In particular, in the presence of peroxidases, the previously mentioned pollutants are oxidised forming free radicals that subsequently polymerize until the formation of high molecular weight products, with the final products being insoluble polymers that can be easily precipitated from the *

Corresponding author: Email: [email protected], 30071 Murcia, Spain; tel. +34 868887351, fax: +34 868884148.

156

J.L. Gómez, M. Gómez and M.D. Murcia wastewater without causing environmental problems. Soybean has the additional advantage of being a cheap and abundant source of peroxidase, easily extracted from soybean seed hulls that are a by-product in the food industry, and capable of maintaining its enzymatic activity over a wide range of temperature and pH, which explains its increasing use over the last years in the biotreatment of effluents. In order to decrease the systems‘ costs, one important area for future research will be the study of the direct use of soybean seed hulls without any extraction of the enzyme.

INTRODUCTION Massive discharges of industrial wastewater without appropriate treatment commonly occur in many developing countries, causing severe damage to both human beings and the environment. As a result, over the last decades, environmental and health concerns have arisen and bioremediation has become an area of great interest for all modern industrial processes generating contaminated effluents. In this sense, numerous efforts have been focused on the search of convenient and cost effective wastewater treatments. Among the different wastewater treatments, enzymatic treatments have proven to be good alternatives to traditional biological treatments, showing some important advantages like their applicability to a wide range of compounds, catalytic ability over wide ranges of pH, temperature and substrate concentration, minimal environmental impact, etc. In particular, peroxidases are a type of oxidoreductases enzymes that catalyze bisubstrate reactions based on the reduction of peroxides and the oxidation of a wide variety of organic and inorganic compounds. Among these compounds, peroxidases show affinity towards different pollutants commonly found in industrial wastewater, such as phenolic compounds, polycyclic aromatic hydrocarbons, aromatic amines, non-phenolic aromatics and dyes. Soybean peroxidase (SBP) belongs to the Class III plant peroxidases family. It can present high activity and concentration in soybean seed hulls, from which it is usually extracted. And since the seed coat is a by-product of the soybean food industry, SBP has a high potential of being a cost effective alternative in wastewater treatment, with its high thermostability being another significant advantage. The present work shows a review of the current state of use of soybean peroxidase in bioremediation of wastewater, and, particularly, in the removal of the following groups of pollutants: phenolic compounds, polycyclic aromatic hydrocarbons, aromatic amines, nitroaromatics, benzothiazoles and paper dyes. The chapter is divided into different sections for a detailed explanation of the most relevant aspects related to this research area, such as the following: The main characteristics and toxic effects of the different pollutants that have been successfully degraded by soybean peroxidase; The advantages of wastewater treatment using enzymes and, particularly, peroxidases; Catalytic properties and main sources of peroxidases; Main properties and characterization of soybean peroxidase for wastewater treatment; Review of the current state of research in bioremediation using SBP as catalyst for the removal of different pollutants, such as phenolics, PAHs, aromatic amines, etc. Future trends.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

157

POLLUTANTS FROM INDUSTRIAL EFFLUENTS THAT HAVE BEEN SUCCESSFULLY DEGRADED BY SBP Phenolic Compounds Phenolic compounds are a large group of aromatic compounds widely present in industrial effluents. Environmental contamination with phenolics occurs from wastewater generated by high-temperature coal conversion, petroleum refining and the manufacture of plastics, resins, textile, iron, steel and paper [1, 2]. Among the numerous groups of pollutants present in industrial effluents, phenolic compounds are widely known to be priority pollutants. They have a low biodegradability and are harmful for organisms even at ppb levels, with most of them being toxic and some suspected to be carcinogens [3]. Chlorinated phenols (CPs) are particularly dangerous since an increasing number of chlorine atoms in the benzene ring raise the toxicity of CPs, their stability against decomposition, and the capability for bioaccumulation. Some of them have mutagen and carcinogenic properties. Additionally, CPs are the precursors of more dangerous ecotoxicants, dioxins [4]. They are classified as hazard chemicals [5, 6] and constitute a particular group of priority toxic pollutants listed by the US EPA in the Clean Water Act [7] and by the European Directive 2455/2001/EC [8].

Polycyclic Aromatic Hydrocarbons Polycyclic aromatic hydrocarbons (PAHs) are among the most common pollutants in the world. They are a group of over 100 different chemicals formed during the incomplete burning of coal, oil and gas, garbage, or other organic substances [9]. They generally exist as complex mixtures although some of them are manufactured. As pure chemicals, PAHs are colorless, white, or pale yellow-green solids. They can have a faint, pleasant odor. A few PAHs are used in medicines and to make dyes, plastics, and pesticides. Others are contained in asphalt used in road construction. They can also be found in substances such as crude oil, coal, coal tar pitch, creosote, and roofing tar. They are present in the air, water, and soil. They enter water through wastewater discharge, and, due to their low solubility, they stick to solid particles and settle to the bottoms of lakes or rivers. Studies in animals have shown that PAHs can cause harmful effects on skin, body fluids, and the body‘s system for fighting disease after both short- and long-term exposure. These effects have not been reported in people. However, The U.S. Department of Health and Human Services (DHHS) has determined that some PAHs may be carcinogens to human beings as a result of long-term exposure by breathing or skin contact. PAHs of low molecular weight are easily biodegradable [10] but those with high molecular weight (normally with four or more aromatic rings) are usually quite recalcitrant and toxic [11, 12].

158

J.L. Gómez, M. Gómez and M.D. Murcia

Aromatic Amines Aromatic amines constitute a wide group of chemicals derived from aromatic hydrocarbons, such as benzene, toluene, naphthalene or anthracene, by substituting at least one hydrogen atom for an - NH2 amino group. They are present in the wastewater of numerous industries such as the manufacturing of dyes and other organic chemicals, the coal conversion industry, resins and plastics manufacturing or the textile industry [13]. Nearly all aromatic amines are toxic and though their effects must be considered individually most of them share some characteristics: they have been reported to be carcinogens, hemotoxicants and to cause skin damage [14, 15].

Nitroaromatics Nitroaromatics (NACs) are massively produced, being among the most common anthropogenic pollutants. They are used as munitions, herbicides, insecticides, pharmaceuticals, solvents and in the manufacture of dyes and plastics [16]. They can also be formed in the environment from aromatic contaminants. Nitroaromatics are highly toxic and hazardous and some of them have been identified as human carcinogens. The list of 129 priority pollutants from the U.S. Environmental Protection Agency includes seven NACs: nitrobenzene; 2,4- and 2,6-dinitrotoluene; 2- and 4nitrophenol; 2,4-dinitrophenol; and 4,6-dinitro-2-methylphenol [17]. Among them, dinitrotoluene is of particular interest. It is toxic by all routes (inhalation, ingestion, and dermal absorption) and it is known to be a carcinogen and a cause of anaemia, nerve and liver damage [18].

Benzothiazoles Benzothiazoles are a wide class of compounds that result from natural processes or chemical manufacturing. They are commonly used as fungicides, herbicides, corrosion inhibitors and mainly as vulcanization accelerators in rubber production, being present in wastewaters from rubber additive manufacturing and tanneries [19]. Benzothiazoles inhibit microorganisms activity in conventional biological wastewater treatments, being most of them hardly biodegradable. They are adsorbed into cell membranes, leading to bioaccumulation [20]. Among the benzothiazoles, 2-mercaptobenzothiazole is one of the most important members, being highly recalcitrant, toxic and allergenic [21].

Paper Dyes Dyes are coloured, ionising and aromatic organic compounds which show an affinity towards the substrate they are being applied to. These substrates are mainly textiles, leather, plastic, paper etc. As a result, dyes are commonly found in wastewaters and, once released into the receiving water bodies, can be extremely dangerous to aquatic life, as toxicants and

Soybean, a Peroxidase Source for the Biotreatment of Effluents

159

as substances that reduce penetration of photosynthetic radiation curtailing biological activity [22]. In particular, decolorization of paper dyes is of great interest since it can allow paper recycling. Concern about recyclability of natural resources has become a main aspect of modern industrial manufacturing processes and a major difficulty in recycling paper is the problem associated with decolorizing the dyes present in the paper [23]. The most common dyes in paper industry are basic and direct dyes, which present high affinity for lignin and cellulose, respectively. Many basic dyes exhibit high aquatic toxicity. However problems are more often attributable to improper handling procedures, spill cleanup and other upsets [24]. Direct dyes are generally less toxic although they exhibit a lower fixation degree than basic dyes and as a result additives are usually required in the dye formulation, increasing the final toxicity.

TREATMENT OF EFFLUENT USING ENZYMES Main Pollutant Treatments There is a wide variety of treatments that can be used for the removal of the previously mentioned pollutants [25]. The most relevant, classified as chemical, physical and biological treatments, are indicated in Table 1. Table 1. Pollutant treatments classification. Chemical Treatments

Non photochemical processes  Ozonation  Fenton processes (Fe2+/H2O2)  Electrochemical oxidation  Radiolysis  Plasma processes  Ultrasounds Photochemical processes  Oxidation in sub/supercritical water  Water photolysis in UV and vacuum UV (UV/UVV)  Ultraviolet/Hydrogen peroxide (UV/H2O2)  Ultraviolet/ozone (UV/O3)  Photo-Fenton  Heterogeneous photocatalysis

Physical Treatments

 Adsorption  Extraction  Membrane technology

Biological Treatments

 Microorganisms  Enzymes  Plants (Phytoremediation)

160

J.L. Gómez, M. Gómez and M.D. Murcia

Advantages of Enzymatic Treatments The use of enzymes in wastewater treatments has become very popular over the last decades [26]. They can act on specific contaminants and eliminate them either by precipitation or by forming new products that can be more easily removed [27]. The main advantages of enzymatic treatments [28] are listed as follows: Applicability to a wide range of compounds Low energy requirements High degree of substrate specificity High reaction rates Mild operation conditions Easy to handle processes Applicability to a wide range of compound concentrations Catalytic ability over wide ranges of pH, temperature and substrate concentration Appropriate to treat recalcitrant compounds Minimal environmental impact

Enzyme Immobilization Frequently enzymes are immobilized on different kinds of supports. Immobilized enzymes show some advantages compared with their soluble forms. They present higher operational stability and can be easily separated from the solution for reuse, which allows continuous treatment and development of cheaper processes [29]. However, immobilization of enzymes presents some risks, mainly the alteration of the enzyme conformation and the activity loss during the immobilization procedure. There are many different methods for enzymes immobilization, such as physical adsorption, covalent bonding, crosslinking, inclusion and encapsulation. They are usually classified according to the nature of the interactions responsible of the process [30, 31] or the type of support used [32]. The use of immobilized soybean peroxidase in wastewater treatment will be in depth discussed in the following sections of this chapter.

PEROXIDASES: PROPERTIES AND MAIN SOURCES Catalytic Cycle of Peroxidases Peroxidases are oxidoreductases enzymes that catalyze bisubstrate reactions based on the reduction of peroxides and the oxidation of a wide variety of organic and inorganic compounds, including phenols, aromatic amines, etc. Most peroxidases are hemoproteins and have hydrogen peroxide as common substrate [33]. The catalytic cycle of peroxidases involves distinct intermediate enzyme forms. There is a two-electron oxidation of the heme group by hydrogen peroxide that leads to the formation

Soybean, a Peroxidase Source for the Biotreatment of Effluents

161

of an unstable intermediate known as compound I. Two successive one-electron reductions in the presence of two molecules of the electron donor substrate return the enzyme to its resting state using a second intermediate, compound II. As a result of this process, free radicals are formed that will subsequently lead to the formation of high molecular weight products that can be easily removed by precipitation due to their low solubility. This is one of the main advantages of the use of peroxidases in wastewater treatments [34]. This catalytic cycle will be described in detail in the section of kinetics of this chapter.

Main Sources of Peroxidases Peroxidase activity has been identified in plants, microorganisms, fungi and even in animals. They all belong to a family consisting of three major classes, where Class III peroxidase is the most important one.

Microbial and fungi peroxidases The main microbial and fungi peroxidases used for the removal of organic pollutants and dyes are peroxidases from Arthromyces ramosus [35, 36], Coprinus cinereus [37-39], Coprinus macrorhizus [40, 41], chloroperoxidase from Caldariomyces fumago [42-45], and manganese and lignin peroxidases from the white-rot fungus Phanerochaete chrysosporium [46-53]. Microbial and fungi peroxidases present some important disadvantages, like their inactivation and, mainly, their low concentration in the production sources. For this reason, plant peroxidases are usually preferred. Plant peroxidases Peroxidases play an important role in plants, participating in the lignification process and in the mechanism of defence in physically damaged or infected tissues. They possess a wide variety of substrate specificity and can oxidise a large number of aromatic compounds in the presence of H2O2 [54]. The most popular family of plant peroxidases, with more than 3000 members [55], is known as Class III plant peroxidase (POX) and consists of the secretory plant peroxidases. POXs exist as isoenzymes in individual plant species and each isoenzyme has variable amino acid sequences and expression profiles which make them appropriate for specific physiological processes [56]. Horseradish peroxidase (HRP), extracted from horseradish roots, is the most studied Class III plant peroxidase and has offered promising results regarding wastewater treatment at industrial scale. In particular, HRP has shown high affinity towards phenolic compounds and aromatic amines [57-63]. The high costs of the treatment together with enzyme inactivation are the main problems concerning the use of HRP. Trying to minimize these factors, many authors have worked to optimize reaction conditions through different methods: optimization of pH and temperature [64-66], use of additives to reduce enzyme inactivation [67-70], enzyme immobilization [7175] or selection of the most appropriate reactor configuration [76-78].

162

J.L. Gómez, M. Gómez and M.D. Murcia

Other plant peroxidases used in wastewater treatment, mainly in the removal of phenolic compounds, are artichoke [79], turnip [80, 81], barley [82], plant root surface peroxidases [83], etc.

SOYBEAN PEROXIDASE Main Properties of SBP Soybean peroxidase (SBP) belongs, like HRP, to Class III plant peroxidases. It can be detected in root, leaf and seed hulls of the soybean. However it is extracted from seed hulls where it presents the highest activity and can be found at high concentrations [54, 84]. SBP was first identified in 1991 as a rich source of a single peroxidase isoenzyme with a molecular weight of 37 KD [84]. Both SBP and HRP present a very similar three-dimensional structure with a sequence homology of 57%, according to the results of different spectroscopic studies [85-87]. And since the seed coat is a by-product of the soybean food industry, SBP has high potential of being a cost effective alternative to HRP in wastewater treatment, where it presents high affinity towards aromatic compounds such as PAHs or phenolics. In fact, raw soybean hulls have successfully been tested for the removal of phenolic compounds, which proves that SBP can be used without extraction or purification [88]. Together with its low cost, the main advantage of the use of SBP is its high thermostability. As a result, it has proven to be of great interest for many applications, not only as biocatalyst for the removal of pollutants from industrial effluents, but also to be used in medical diagnostic tests, replacement of formaldehyde in adhesives, abrasives and protective coatings, synthesis of phenolic resins, etc. [89]

Characterization of SBP for Wastewater Treatment The biocatalytic properties of soybean peroxidase have been widely investigated and most authors have concluded that SBP is able to retain its catalytic properties under wide ranges of pH and at elevated temperatures [54]. In particular, thermal inactivation of SBP occurs at 90.5 ºC, nine degrees above HRP and more than 25 ºC above other peroxidases [89]. Wright and Nicell developed a detailed study, determining the enzymatic activity of SBP using phenol as substrate and under different conditions and periods of incubation [90]. They concluded that activity can be observed between pH 3 and 9, being pH 6.4 the optimal one. SBP incubated at 25 ºC is very stable at neutral and alkaline conditions. However, rapid inactivation occurs below pH 3. Besides, acid and alkaline conditions can generate different reaction products, such as soluble oligomers of unknown nature and toxicity. On the other hand, when SBP is incubated at 80ºC and pH between 5 and 10.5 the enzyme shows a thermal deactivation depending on pH. The enzyme can also be deactivated for its incubation in hydrogen peroxide. In comparison with HRP, SBP has lower catalytic activity and is slightly more sensitive to pH, but it is more stable at elevated temperatures and less susceptible to inactivation by hydrogen peroxide.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

163

Similar studies of SBP activity and stability can be found in the literature. Geng et al. [54] report enzymatic activity between pH 2.2 and 8, with pH 6.0 as the optimal one. According to their research SBP shows three times higher activity at an elevated temperature (80 ºC) at pH 6.0 when compared to the activity at room temperature. They tested different organic solvents, proving that SBP is fairly active in them, with the highest activity in the presence of 16.67% (w/v) ethanol followed by acetone, methanol and acetonitrile. Amisha and Behere [91] have calculated a conformational stability of SBP under physiological conditions of 43.3 kJ/mol, which is much higher than the 17 kJ/mol reported for HRP. Maximum catalytic activity and conformational stability of SBP was observed at pH 5.5. They also compared the thermal stability of HRP and SBP at pH 7.0, being considerably higher for SBP (86 ºC versus 74 ºC). It has been reported that after the enzymatic reaction the formed particles precipitate out of the solution entrapping the SBP and thereby reducing its activity. Many authors have demonstrated the efficiency of the use of additives to prevent the entrapment and reduce enzyme inactivation, being polyethylene glycol (PEG) the most commonly used [92, 93]. It was concluded that the effectiveness of PEG increased with molecular weight, being 35000 the most effective. PEGs with molecular weighs of 1000 and below were ineffective in protecting SBP.

REMOVAL OF PHENOLIC COMPOUNDS WITH SBP Free SBP Soybean peroxidase (SBP) [84] has proved to be very effective in removing phenolic compounds from wastewater [92-98]. It has been characterized and has been shown to effectively treat phenolic compounds such as, phenol, 2-chlorophenol, 3-chlorophenol, 4chlorophenol, 2,4-dichlorophenol, and 3-methylphenol [90]. Besides, being soybean a cheap and abundant source of peroxidase, the use of SBP would help to convert a waste into a value-added product [99-100]. McEldoon et al. [97] have examined the substrate specificity of a peroxidase isolated from soybean hulls. In their study, they found that vegetable peroxidases possess wide substrate specificity than can be dramatically broadened at low pH values to include nonphenolic compounds. Taylor et al. [101] provided a limited comparison of HRP and SBP for treatment of phenols and concluded that SBP was an effective alternative. After that, Caza et al. [92] studied the removal of different phenolic compounds such as phenol, chlorinated phenols, cresols, 2,4-dichlorophenol and bisphenol A, with soybean peroxidase. The reaction parameters, optimized to achieve a removal efficiency of at least 95% were pH of 8, SBP dose without PEG of 0.20 U/mL, SBP dose with PEG of 0.15 U/mL and different [H2O2]/[substrate] optimum depending on the chosen substrate. The results of the study have demonstrated the applicability of using SBP for treating synthetic phenolic wastewater. The study recommended the necessity of investigating the potential use of soybean hulls instead of purchasing the enzyme from a chemical manufacturer. After the enzyme has been extracted from the hulls, they could then be used as animal feed. This would greatly reduce the amount of solid waste that is produced and would also reduce the costs. Similarly, some researchers

164

J.L. Gómez, M. Gómez and M.D. Murcia

have also suggested using crude HRP [59, 61, 102] to reduce treatment cost. In contrast to crude SBP, the amount of solid waste produced with the use of crude HRP is much greater. Another advantage of using soybeans is that they are more readily available than horseradishes. Kenedy et al. [103] studied the removal of 2,4-dichlorophenol (2,4-DCP) with soybean peroxidase. They found that in the presence of additive PEG-3350 and PEG-8000 2,4-DCP removal efficiency of SBP increases by factor of 10 and 50 respectively compared to no PEG addition. Optimum pH for removal of 2,4-DCP without PEG was pH 8.2. The pH operating range of SBP was from 2.5 to 9.4 which is wider than reported for horseradish peroxidase. A new pH optimum of 6.2 was also found when SBP was used with PEG. By using optimum pH conditions, PEG-8000 and SBP concentration can be optimised coincidentally to minimise the amount of SBP needed while simultaneously limiting the residual PEG that might be released to the environment. Bódalo et al. [75] have compared the efficiency of HRP and SBP in phenol removal, proving they are both quite active in a pH range of between 6.0 and 8.0, with maximal removal efficiency at neutral pH. HRP acts faster than SBP but is more susceptible to inactivation, although it is better protected by PEG. The same authors [104] studied the removal of 4-chlorophenol using free soybean peroxidase and hydrogen peroxidase in a discontinuous tank reactor in a first step to reduce the concentration of buffer solutions used and to avoid adding polyethylene glycol. Most of the assays provided good removal percentages, which reached almost 90% for an enzyme concentration of 7.5 10-3 mg/cm3 and a stoichiometric ratio of 1:1 for both substrates, when concentrations of 1.5 mmol/dm3 or less were used. Parra et al. [105] studied the removal of 2,4,6-trichlorophenol (TCP) with SBP. They found that the best conditions for the biodegradation in 15 min of 1mM TCP were 27 nM SBP, 1 mM hydrogen peroxide and 50 mM pH 5.0 sodium citrate buffer at 25 ºC.

Immobilized SBP As it has been previously commented the most important drawback of enzymatic methods for phenolic compounds removal is the short catalytic lifetime due to enzyme inactivation by various side reactions of the treatment process. In this regard, the use of protective additives that decrease enzyme deactivation, while being inexpensive and nontoxic, has been described [68, 106, 107]. Polyethylene glycol (PEG) was found to be one of the best additives [106, 108] and its addition has been demonstrated to be effective in diminishing HRP inactivation. However, the use of PEG in the reaction medium may have negative effects. Although it has been demonstrated that PEG is removed with the phenol polymers, Kinsley and Nicell [93] established that a great part of PEG added to the reaction medium remains in the solution after the enzymatic treatment. This impact of residual soluble PEG on downstream processes or on receiving water bodies may restrict its practical application during wastewater treatment. Another approach which has been utilized to increase the potential use of enzymes in wastewater treatment is immobilization. For the treatment of large volumes of wastewaters, reactors containing immobilized enzymes are desirable because of the high cost of enzymes

Soybean, a Peroxidase Source for the Biotreatment of Effluents

165

[106]. Although many supports and methods have been used for HRP immobilization very few papers have been found concerning the use of immobilized SBP for phenolic compounds removal. Gomez et al. [109] studied the immobilization of soybean and horseradish peroxidases on glutaraldehyde-activated aminopropyl glass beads and its application to phenol removal. Glass beads were selected as immobilization matrix because of their excellent mechanical properties and because they can be modified to include a variety of functional groups. The alkylamine-support was obtained by aqueous silanization which appears to produce a monolayer of silane across the carrier surface of high hydrolytic stability, providing greater support and a sufficient degree of enzyme loading. The modified support was then activated with glutaraldehyde and covalently linked to the enzymes via available amino functions. Cross-linking was avoided by washing the support thoroughly adding the enzyme to remove all excess glutaraldehyde. They found that immobilized SBP is less susceptible to inhibition/inactivation than HRP and so provides higher conversions. The same research group [110] used the same method and support for SBP immobilization in order to study 4chlorophenol removal. They found that SBP was less susceptible to inactivation than HRP providing higher 4-chlorophenol removal. Besides, the immobilization exerts a protective effect against the enzyme inactivation by hydrogen peroxide. Lately, this research group has used the same immobilization procedure publishing numerous papers about phenolic compounds removal with soybean peroxidase in different types of reactors. Apart from this research group, papers using the peroxidase seed hulls entrapped within hybrid (silica sol gel/alginate) particles directly as a catalyst were found [88, 111, 112]. Gacche et al. [113] studied the removal of phenol from industrial wastewaters using immobilized soybean peroxidase on fibrous aromatic polyamide. They achieved a phenol removal percentage of 91.25%, reducing phenol concentration from 0.720 to 0.063 mg/mL after 5 hours of treatment. Magri et al. [114] immobilized soybean peroxidase on different polyaniline polymers previously treated with glutaraldehyde. Good immobilized derivatives were obtained with 8.2 mg SBP/g support and with 82% of retained activity.

Continuous Reactors for the Removal of Phenolic Compounds In most of the previous studies free enzymes were used in discontinuous tank reactors, which made them impossible to reuse and eliminate from the bulk reaction. As mentioned above, the use of immobilized enzymes has several advantages. For instance, they can be easily separated from the reaction products and reused. They also work better in continuous processes. Continuous processes with immobilized enzymes can be carried out in different reactor configurations, although fluidized bed reactors have certain advantages over conventionally used tank and packed bed reactors. Fluidized beds are specially recommended when the substrates are viscous or contain suspended particles. The pressure drop is smaller when using fluidized bed reactors and the flow distribution through the reactor radial section is more uniform, which minimizes the formation of preferential channels. Also, since mechanical stirring is not necessary, the support particles are less damaged by abrasion. All these advantages are of special interest in the phenolic compound

166

J.L. Gómez, M. Gómez and M.D. Murcia

oxidation process using immobilized peroxidase, since most of the products formed are insoluble, while in packed bed reactors this would lead to clogging phenomena and to an increase in the pressure drop. However, despite the many papers published on the use of fluidized bed reactors for the removal of phenolic compounds with immobilized microorganisms, very few works have used immobilized enzymes for the same purpose. Wu et al. [78] compared the behaviour of phenol removal with free peroxidase in the presence of PEG in different types of reactors: batch-mixed, continuous stirred tank reactor and plug flow. They used a previously developed model in a batch reactor to predict the process in different types of reactor system. Another work developed by Gomez et al. [115] studied the removal of 4-chlorophenol with free soybean peroxidase and hydrogen peroxide in a continuous tank reactor. They concluded that the continuous operation of a tank reactor without using buffered media provided a good degree of 4-chlorophenol elimination under all the experimental conditions assayed. As regards published papers related to fluidized bed reactor with immobilized peroxidases, Trivedi et al. [112] tested soybean peroxidase entrapped on a hybrid silica/alginate gel, for the removal of 85% of phenol. This study concluded that the obtained particles can be used in packed bed and fluidized bed reactors. The same authors [116] used the same immobilized particles in a fluidized bed reactor obtaining phenol removal percentages of 54% with molar ratio phenol/hydrogen peroxide of 1/2. Gomez et al. [117] used immobilized derivatives of soybean peroxidase, covalently bound to glass supports with different surface areas, in a laboratory scale fluidized bed reactor to study their viability for use in phenol removal. 80% phenol removal was achieved when derivatives immobilized on supports with the highest surface area were used. The same authors [118] worked with the same immobilized derivative of soybean peroxidase to study phenol removal in a continuous tank reactor. Efficiency of about 80% was attained in phenol removal for the best operational conditions assayed. With the aim of scaling up the process to pilot-plant scale, the influence of the main plant operational variables, enzyme and substrate concentrations and flow rate, on the removal efficiency was studied. The continuous reactor was operated under isothermal conditions at the optimal temperature established in the literature for this system. As a first approximation to the industrial application of the process, no buffer solutions were used.

Ultrafiltration Continuous Tank Reactors For the continuous operation of economically viable processes in enzymatic reactors, the biocatalyst must be separated from the reagents. Ultrafiltration has proved to be a very versatile separation process for biocatalysts, and the development of asymmetric membranes composed of an ultra-thin microporous layer supported by a macroporous structure allows this technique to be applied to the separation of enzymes. The concept of ultrafiltration membrane reactors (UFMR) is based on the potential of semipermeable membranes to retain the biocatalyst but not the products formed during the reaction. The main advantages of continuous operation with soluble enzymes are that:

Soybean, a Peroxidase Source for the Biotreatment of Effluents

167

the catalyst can be homogeneously distributed, thereby avoiding transport limitations; almost all the native activity can be used; no special immobilization know-how is needed; while immobilization on carriers is normally expensive and time consuming. Normally, both immobilized and soluble biocatalysts lose activity with time, and so, one additional advantage of UFMR is that fresh enzyme can be added easily to maintain productivity. This reactor configuration has also been used for 4-chlorophenol removal. Murcia et al. [119] developed an intensive combined treatment for removing 4-chlorophenol, consisting of its oxidation with soluble soybean peroxidase and hydrogen peroxide in a continuous tank reactor, followed by purification of the effluent in an ultrafiltration membrane module in series. High 4-chlorophenol conversion percentages were reached in all cases. Although the conversion percentages in the reactor were only maintained for 40 min in some cases, they remained practically constant throughout the operational time in the permeate stream, where the membrane somehow acted as a support for successful enzyme immobilization.

Direct Use of Soybean Seed Hulls without Extraction One of the advantages of soybean peroxidase versus other enzymes is the potential use of the direct soybean hulls instead of purchasing the enzyme from a chemical manufacturer. In this sense Gijzen et al. [120] observed that seed coat of soybean presented higher activity than in the soybean roots. Besides, due to the easy extraction of the enzyme from the seed coat of soybean its use looked feasible. Flock et al. [88] studied the removal of phenol and 2chlorophenol using soybean seed hulls in the presence of hydrogen peroxide. The following conclusions were obtained from this paper: The direct use of soybean seed hulls reduces the biocatalyst cost, because extraction and purification steps are removed. The hulls act as an enzyme protector agent preventing the enzyme from adsorbing in the formed polymer. It has been proved that the hulls do not adsorb phenolic compounds. So their removal is only due to enzymatic reaction. Removal percentages of 60% were obtained in discontinuous tank reactors, whereas four sequential batch reactors achieved greater than 96% removal of phenol with a retention time of 20 min in each reactor. The stability of the soybean peroxidase enzyme was examined in the presence of detergents. Low concentrations of the detergents (0.1% w/v) increased the enzyme activity and higher concentrations of detergents (> 0.1% w/v and up to 20% w/v) did not activate the SBP enzyme. Bassi et al. [111] studied the direct use of soybean seed hull extracts for the bioremediation of phenolic wastes. The crude SBP extracted from the hulls, like pure soybean peroxidase, was catalytically active in a broad range of pH and temperatures. Besides, the direct use of soybean seed hulls can reduce SBP inactivation by H2O2 and enhance the

168

J.L. Gómez, M. Gómez and M.D. Murcia

utilization efficiency of SBP through the slow release of the enzyme from the seed hulls. As the crude extract contains a mixture of multiple soybean proteins, soybean seed hull slurry required a higher concentration of H2O2 to remove the phenolic substrates than did the purified enzyme. Experiments carried out in a batch reactor removed 80% of phenol (10.6 mM), 96% of 2-chlorophenol (3.9 mM), 95% of 2,4-dichorophenol (3.1 mM) and 94% of mixed phenol and chlorophenols. Although the results were satisfactory the authors suggest doing more studies to choose the adequate type of reactor. Lately, the same research group [112] has continued with this research line. They studied the phenol removal using sol-gel/alginate immobilized soybean seed peroxidase in fluidized bed reactors. The main conclusions obtained from this work were the followings: The seed hull of soybean is a peroxidase enzyme source and can be applied for the removal of phenolic compounds. The alginate incorporation to the immobilized derivative is a good method to obtain particles of uniform size which are suitable for their use in fluidized bed reactors. The immobilized SBP can be reused for its application in discontinuous processes after a regeneration treatment. The immobilized derivative retains almost 90% of its activity after 3 weeks being stored at 4 ºC. The same authors [116] studied the reaction and regeneration of immobilized SBP particles in fluidized bed reactors, proving that this reactor configuration is suitable for processes in which the biocatalyst deactivation is an important issue.

Real Wastewaters After the removal of phenolic compounds with free and immobilized soybean peroxidase in different types or reactors, discontinuous and continuous, the next step should be to try with real wastewaters instead of synthetic ones. In this sense, few real wastewater matrices have been investigated mainly due to the fluctuating pH, temperatures and pollutant concentrations, number of other compounds such as heavy metals, inorganic salts and organic compounds presented in the medium in various ratios. Steevensz et al. [121] compared two enzymes, soybean peroxidase and laccase, to convert phenol in synthetic and refinery wastewater, with and without the influence of possible interferents. Taking into account the obtained results for soybean peroxidase it is possible to point out that the broad operating pH range would allow direct treatment of the refinery stream. Refinery samples need higher enzyme concentration (1.2 to 1.8 fold) than synthetic samples for removing 1.0 mmol/L of aqueous phenol in 3 hours. This study concluded that enzymatic treatment is suitable for phenol removal from refinery wastewater.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

169

Kinetics of the Enzymatic Reaction Mechanisms Usually, the oxidation of aromatic compounds with hydrogen peroxide, catalyzed by peroxidase, has been described through the mechanism postulated by Chance-George, also known as the Dunford mechanism [122, 123], which is referenced in most of the papers found in the literature. Although the kinetic model has been validated with horseradish peroxidase, it is accepted for the rest of the peroxidases as well. The steps of this mechanism are the following ones:

E  H2O2  E1

E  H  E  H  1

2

2

E  H  E  H  2

2

H  H  HH The native enzyme, E, in the presence of hydrogen peroxide, forms a compound, E1, called Compound I, which, in turn, accepts an aromatic compound, ΦH2, oxidizing it and giving the free radical H . This radical is released to the reaction bulk and the enzyme changes to the E2 state, Compound II, which is able to oxidize another molecule of ΦH2, giving another free radical and returning to the native state, E, so that the cycle is closed. The overall reaction is:

E H2O2  2H  2H   2H O 2

2

The above mechanism is based on the discovery of species E1 and E2 and the additional observation of the spontaneous transformation of E1 in E2, being this transformation favoured in the presence of reductive species in the reaction media. Stoichiometric studies [122] have shown that the species E2 only contains one of the two oxidation equivalents of the hydrogen peroxide molecule and that it is a covalent compound. In this sense, it has been proved that using CH3OOH instead of H2O2 a similar reaction takes place in the first step of the above mechanism. However, the definitive structure of this species has not been well established until now [76] and is usually described by the above mentioned Chance-George mechanism. As described in the literature [122, 124, 125], in an excess of hydrogen peroxide E2 can be oxidized to E3, which appears as an inactive form of the enzyme:

E2 H2O2  E3 H2O This is not an irreversible deactivation because E3 breaks down spontaneously to the native form [126], although with a low reaction rate:

170

J.L. Gómez, M. Gómez and M.D. Murcia

E3  E   O 2 Buchanan and Nicell [127] also proposed other secondary reactions, where E3 can be reduced accepting an electron from phenol:

E3  H2   E1  H Baynton et al. [128] observed that, for peroxide concentrations below 1 mM and in the absence of phenol, a reversible inactivation took place through formation of an intermediate compound of the enzyme, called Compound III, from which the native enzyme can be regenerated. On the other hand, in the presence of aromatic substrates, an irreversible inactivation that depends on the substrate concentration, phenol in this case, was observed, due to the reaction of the native enzyme and the intermediates Compounds I and II with phenolic radicals. Nicell et al. [76] used horseradish peroxidase in simple and sequential continuous tank reactors to oxidize phenol and 4-chlorophenol. These authors described three enzyme inactivation pathways. Besides the formation of E3 in excess of peroxide, they believe that a permanent inactivation, by the union of a free radical to the active centre of the enzyme, can take place, as well as an adsorption in the formed polymer. In another work [70], also with HRP and phenol, Nicell et al. established that polyethylene glycol has a protective effect on these two inactivation modes, and consequently the same authors determined the minimum amount of polyethylene glycol necessary to achieve maximum protection of the enzyme, as a function of the initial phenol concentration. Patel et al. [129] focused their research on the oxidation of substituted phenolic compounds by the HRP Compound II. According to these authors, the HRP in this compound is in the form HRPFeIV =O, with an oxidation state above that of the native enzyme, which is a hemo-protein with a FeIII nucleus. When reacting with the phenolic substrate an intermediate complex of very low stability is obtained. From the complex, the native enzyme is again released, as well as the oxidation products, according to the following scheme: HRPFeIV = O + S ↔ [HRPFeIV = O − S] → HRPFeIII + P where S is the phenolic substrate and P the reaction products. As regards to those reaction products, dimeric compounds can appear in the bulk reaction as a result of the binding of two of the radicals formed from the aromatic compound. Although the resulting dimer is less soluble, it remains in the aqueous solution where it can be oxidized again in successive steps, leading to the formation of a longer chain polymer whose precipitation is favoured. This requires additional consumption of hydrogen peroxide and influences the stoichiometry of the overall process, which moves towards gradually higher hydrogen peroxide/phenol molar ratios, depending on the degree of polymerization achieved. Although many works based on possible mechanisms have been found in the literature, only a few have proposed kinetic models and tried to solve the corresponding equations, fitting the model predictions with the experimental data. In this sense, it can be said that almost all the kinetic models developed and solved until now have been proposed by Nicell et al.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

171

Models Accepting the Chance-George mechanism and the deactivation phenomena previously described, Nicell proposed three kinetic models for the HRP/hydrogen peroxide/4chlorophenol system, in the steady-state, fully transient and pseudo-steady-state, respectively [130]. As Nicell pointed out, the steady-state model led to an equation similar to the one obtained in a ping-pong bisubstrate enzymatic kinetic. The transient-state model was formulated as a series of nine simultaneous differential equations, containing ten kinetic parameters to be determined by fitting. Due to its complexity, the model must be solved by the Runge-Kutta method and required long computing times, although there may be problems of convergence if the step size is not correctly chosen when applying the mentioned numerical method. Despite these drawbacks, the model provided a good fit of the experimental data. The pseudo-steady-state used the steady-state approximation only with some reaction intermediates and, despite certain simplifications, it remains complicated and it is still necessary to use numerical methods and a long computation time. The fitting of the model to the experimental data is 2% less precise than with the fully transient model, but in the authors‘ opinion, this loss of precision can be justified in order to achieve simplicity and to reduce the computation time. Later, Buchanan and Nicell [127] and Buchanan et al. [77] applied the above model equations to obtaining the design equations for plug flow and continuous tank reactors in steady-state. Good fitting was achieved between the experimental data and the equations obtained for the HRP/phenol system, the enzyme inactivation rate in the continuous tank being lower than the one calculated in the plug flow reactor, working with PEG excess and keeping the complexity grade of the models as explained previously. Later, Buchanan and Nicell [131] produced a simplified model where the active species of the enzyme are gathered in the so-called ―active enzyme‖, Ea, which reduces the number of constants and simplify the calculation. Choi et al. [132] proposed a modification of the Chance-George mechanism, for the HRP/pentachlorophenol (PCP) system. According to these authors, intermediate enzyme substrate complexes (EH2O2, E1PCP and E2PCP) are produced in the first three steps of the mechanism. These authors obtained the initial reaction rate by using the steady-state approximation, checking that oxidation of pentachlorophenol with HRP follows a bisusbstrate ping-pong mechanism. A phenol oxidation process by HRP involving intermediate complex formation has also been proposed by Gilabert et al. [133], according to the following scheme:

172

J.L. Gómez, M. Gómez and M.D. Murcia

By using a quantitative initial rate analysis, these authors determined the values of the Michaelis-Menten constants for phenol and hydrogen peroxide, as well as the enzyme catalytic constant value. Tong et al. [134] have also described the oxidation reaction of phenol, 4-chlorophenol and 3-chlorophenol, catalyzed by horseradish peroxidase, as a bisubstrate ping-pong mechanism, and calculated the kinetic constants for different hydrogen peroxide concentrations, demonstrating that an optimum peroxide concentration exists, above which peroxide becomes a reaction inhibitor. On the other hand, Wu et al. [78] developed a kinetic model for the phenol/horseradish peroxidase system in the presence of polyethylene glycol. The phenol oxidation was described by using a Michaelis-Menten bisubstrate equation. Although most kinetic studies have been carried out with horseradish peroxidase, some of them apply the Chance-George mechanism to the oxidation of phenols with soybean peroxidase [88, 90, 98, 135]. In this sense, Nicell and Wright [98] developed a model showing the dependence of the enzyme activity on the H2O2 concentration and they have also calculated the kinetic constants, which were lower than those obtained for HRP. They also noticed that soybean peroxidase, through the E3 form, is more susceptible to permanent inactivation with hydrogen peroxide than HRP. Nissum et al. [135] found that, in the presence of hydrogen peroxide, the mechanisms of both HRP and SBP are very similar, although Compound I of SBP is less stable at neutral pH. According to the Chance-George mechanism, the stoichiometric peroxide/phenol ratio must be 1:2. However, some studies have been found in the literature that obtained different values for this relation. For example, Al-Kassim et al. [95] obtained values within the range 0.5-0.83. A result approaching unity was obtained in other works [78, 127]. Furthermore, Buchanan and Han [35], working with Arthromyces ramosus peroxidase obtained and average value of 1.22 at high enzyme and phenol concentrations and a value of 1.01 at low concentrations. These different stoichiometries observed might be attributed to differences in the average number of monomers in the precipitated polymer. As regards the nature of polymers, five dimers and a trimer were identified in the reaction solution by Yu et al. [136] working with the horseradish peroxidase/phenol system. They showed that three of these dimers are also peroxidase substrates and can be oxidized like phenol, following first-order kinetics obtained by simplifying a bisubstrate model. The dimers are p-phenoxyphenol, p,p-bisphenol and o,o-bisphenol, the oxidation rate of the first being higher than the phenol oxidation rate. According to these authors, the extra-consumption of hydrogen peroxide that takes place above the stoichiometric relationship can be explained by the oxidation of the mentioned compounds. Finally, a deactivation enzyme model, based on the attack of phenoxy radicals on the enzyme active centre following second order kinetics and depending on the PEG concentration, is also proposed in this work. As it has been commented, almost all the authors have agreed that the removal of phenolic compounds in the presence of peroxidases follows a bisubstrate kinetic and a pingpong mechanism. In this sense the research group leaded by Professor Bodalo developed several works with preliminary models. Gomez et al. [137] developed a new method for the determination of the intrinsic parameters of reaction in processes involving a high initial reaction rate. The usefulness of this alternative, which consists of determining several sets of apparent parameters at different times and then extrapolating these to time zero, is demonstrated by the linear dependence obtained between the apparent parameters and the reaction time. The method calculated the

Soybean, a Peroxidase Source for the Biotreatment of Effluents

173

values of the intrinsic parameters (enzyme specific activity and Michaelis-Menten constants of both substrates) for the system under study and was checked with experimental reaction rate data for the soybean peroxidase/phenol/hydrogen peroxide system. Using the above methodology the same authors [138] developed a kinetic model based on the Ping-Pong Bi-Bi mechanism and applied for the removal of 4-chlorophenol with soybean peroxidase and hydrogen peroxide. The developed model was firstly applied to the obtained results in a discontinuous tank reactor. To check the viability of such a mechanism they used their alternative method for determining the intrinsic parameters. The next step was to study the removal of the same compound, 4-chlorophenol, but in a continuous tank reactor. In another work [115] a continuous tank reactor was used to study the 4-chlorophenol removal process using soybean peroxidase and hydrogen peroxide. A simplified steady-state design model for the continuous tank reactor was formulated and an expression for the steady-state conversion as a function of the operational conditions and of the intrinsic kinetic parameters was obtained. By using the values of the intrinsic kinetic parameters obtained for the discontinuous reactor the theoretical values of the steady-state conversion were calculated for all the experimental conditions assayed. The good approach between the experimental and calculated values of the steady-state conversion confirmed that the proposed design model and the kinetic law used, as well as the values of the intrinsic kinetic parameters, were useful for predicting the behavior of the continuous reactor. After this first attempt to modelise the kinetics of the phenolic compounds with soybean peroxidase the same research group proposed an extended kinetic model applied to the removal of phenolic compounds in discontinuous and continuous reactors. According to the original Chance-George mechanism and accepting the intermediate complex formation proposed by Choi et al. [132] and Gilabert et al. [133], Gomez et al. [118] proposed an extended version of the mentioned mechanism taking into account the following points: The overall process consists of an indetermined number of catalytic cycles that depend on the operational conditions. The initial cycle corresponds to the Dunford mechanism, in the enhanced version of Gilabert et al. [133], which takes into account the formation of enzyme-substrate intermediate complexes and produces monomer radicals that, by coupling, can form dimers with several isomeric structures [136]. The dimers formed in the first step remain soluble and react in the same cycle as phenol, leading to the formation of higher oligomers with higher peroxide consumption. Although the different dimers have different reactivities with the enzyme, only one average reaction rate for all of them is assumed. This cycle continues to run as long as there is hydrogen peroxide in the reaction medium, with the trimer, tetramer, etc, acting as the new substrate that takes part in the cycle, whose sequence remains the same as in the initial cycle. The initial cycle for phenol and the one corresponding to the dimers are described below: 1 EH2O2 2 EO H2O Steps 1 & 2: E  H2O2 

K

k

174

J.L. Gómez, M. Gómez and M.D. Murcia 3 EOH2 4 *EOH*H Steps 3 & 4: EO  H2 

K

k

5 *EOHH2 6 E  H2O*H Steps 5 & 6: *EOH H2 

K

k

7 H  H Step 7: *H  *H  k

Steps 8 & 9:

K8 k9 EO  H  H EOH  H  *EOH*  H

K10 k11 Steps 10 & 11: *EOH H  H  *EOHH  H  E H2O*  H

Step 12:

k12 *  H*  H  H      H

From these equations it is possible to obtain the correspondent reaction rates for phenol, dimer and hydrogen peroxide with the equation that calculates the concentration variation of active species of the enzyme in the reaction medium. Following these premises they presented a model for the kinetic study of the immobilised SBP/phenol/hydrogen peroxide system that extends the peroxidase cycle to the reaction products, which permits to obtain a more general kinetic equation than the previously proposed. At time zero, the equation is reduced to a ping-pong bisubstrate kinetic, which agrees with previous studies. Using an initial rate procedure [137], the three parameters of the initial rate equation can be determined. In addition, the phenomenon of radical deactivation and/or enzyme-sequestration with the precipitated olygomers/polymers, widely described in the literature, was also modelled for the studied system, being the result of the gradual covering of the catalytic particles that contain the enzyme, which determines a progressive loss of activity. The deactivation model is included in the kinetic model. Additionally, to check the validity of the generalized Ping Pong bisubstrate kinetics for the enzymatic reaction, obtained from an expanded version of the Dunford mechanism in the discontinuous tank reactor, a transient design model for removing phenol with immobilized soybean peroxidase and hydrogen peroxide in a continuous tank reactor assuming an ideal mixing flow was developed [118]. The experimental data of the phenol conversion at the reactor outlet were fitted to the model and the additional parameters were also calculated. The model was solved by numerical calculations and the experimental data were fitted to the model with a good degree of agreement between experimental and calculated values of the phenol conversion. This confirmed the validity of the design reactor model as well as the kinetic rate equations and intrinsic parameters used, despite the fact that they were obtained in assays carried out in a batch reactor. The same authors [117] also studied the removal of phenol in fluidized bed reactor and developed a reactor model based on the experimental results that predicts the system‘s behavior both in steady and transient state. This model considers the fluidized bed reactor as a plug flow reactor in series with an ideal mixer and follows a kinetic law based on the observed external mass transfer resistances in order to work out the process rate. The good agreement obtained between the experimental and calculated values of phenol conversion demonstrates that the model is valid as a predictive model for using this reactor configuration.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

175

Finally, this research group [119] also developed a model to the reactor configuration consisted in the combination of a continuous tank reactor followed by purification of the effluent in an ultrafiltration membrane module in series. This reactor configuration was applied to the removal of 4-chlorophenol by means of its oxidation with soybean peroxidase in the presence of hydrogen peroxide. The model assumes that the reaction between the phenolic compound and hydrogen peroxide follows the free radical mechanism proposed by Dunford, according to which phenol consumption rate law is a bisusbstrate Ping-Pong kinetics equation. The reaction products also follow the same reaction mechanism, which involves additional hydrogen peroxide consumption. The results obtained from comparing the model predictions and experimental results allowed the authors to affirm that both the kinetics law and the reactor design model were adequate for describing the behavior of the system.

REMOVAL OF NON-PHENOLIC COMPOUNDS WITH SBP Removal of PAHs Kraus et al [139] tested the ability of soybean peroxidase to catalyze a variety of polycyclic aromatic hydrocarbons in the presence of water-miscible organic cosolvents. Optimal pH values were between 2.0 and 2.5, with SBP half-life of 120 h at pH 2.5. Anthracene and 9-methylanthracene attained more than 90% conversion in the presence of 50% (v/v) dimethylformamide. Anthraquinone was the main product of anthracene oxidation, while 9-methylanthracene produced anthraquinone and 9-methanol-9,10-dihydroanthracene. In both cases the resulting products are less toxic than the original compounds.

Removal of Aromatic Amines Crude soybean peroxidase isolated from soybean seed hulls has been successfully applied to the removal of aromatic amines. Al-Ansari et al [140] worked with crude dry solid SBP to catalyze the oxidative polymerization of phenylenediamines in the presence of hydrogen peroxide. They worked out the optimum operation conditions: acidic pH, between 4.5 and 5.6; molar ratio H2O2: substrate from 1.5 to 2.0; Minimum SBP concentration required for 95% conversion of 1.0 mM substrate from 0.002 to 0.01 U/mL. Additionally, it was shown that the resulting polymers could be removed by using a surfactant, sodium dodecyl sulphate (SDS), with minimum SDS required for the removal of polymeric products determined to be between 0.2 and 0.25 mM. In this case, addition of polyethylene glycol (PEG) did not enhance the removal efficiency. The same authors utilized crude SBP again to catalyze the removal of various aromatic compounds from synthetic and refinery wastewater, including aryldiamines [141] and obtaining conversions higher than 95%. Some patents can be found in the literature about biocatalytic oxidation of different pollutants, including aromatic amines, using soybean peroxidase. U.S. Pat. No. 5,508.180 mentions both N-dealkylation and polymerization of aromatic amines, giving especific examples of N-dealkylation of N,N-dimethyl aromatic amines and polymerization of aniline

176

J.L. Gómez, M. Gómez and M.D. Murcia

[142]. Also, this work points out that in some cases there is no need of extraction of the peroxidase from the hull and instead it can be directly introduced to the reaction medium. U.S. Pat. No. 5,178.762 deals with the use of SBP to treat wastewaters containing aromatic amines, among other compounds, removing the contaminants or converting them to less hazardous or more easily removable forms. This patent also presents the alternative of directly using soybean peroxidase hulls packed in a column where the contaminated water and the hydrogen peroxide are passing over [143].

Removal of Nitroaromatics Nitroaromatics, even when they are phenolic or aniline compounds are not suitable for peroxidase catalysis. However, nitroaromatic compounds can be converted to their corresponding amines which can be oxidize with peroxidase enzymes. Mantha et al. [17] studied the oxidation of nitrobenzene and nitrotoluenes (o-, m- and p-) with a continuous twostage treatment consisting in the zero-valent iron reduction of the nitroaromatic compounds to the corresponding aniline and after that soybean peroxidase treatment in a plug-flow reactor. They optimized different operational parameters such as pH at neutral value, peroxide/substrate molar ratio of 1.5, enzyme concentration (different values varying for the nitroaromatic compound) and alum concentration between 50 and 100 mg/L. The reaction time for the two steps was between 5 and 5.5 hours. Following the same two steps treatment, Patapas et al. [18] published another paper related to the removal of dinitrotoluenes (2,4-dinitrotoluene and 2,6-dinitrotoluene) with ion and peroxidase-catalyzed oxidative polymerization. They used two peroxidases from different sources, Arthoromyces ramosus and soybean peroxidase. They concluded that soybean peroxidase was more resistant to mild acid conditions whereas Arthoromyces ramosus peroxidase was more stable in neutral solutions. Besides, soybean peroxidase was found to have a greater hydrogen peroxide demand, although less amount of enzyme was required for the experiments. So the use of the soybean peroxidase enzyme looks like a suitable alternative biological method to remove these nitroaromatic compounds.

Removal of Benzothiazoles An-Ansari [141] studied the removal of hazardous aqueous pollutants such as aryldiamines, aryldiols, 2-mercaptobenzothiazole and phenol from wastewaters with crude soybean peroxidase, isolated from soybean seed hulls, and in the presence of hydrogen peroxide. Different experiments were carried out in order to optimize pH, hydrogen peroxide/substrate concentration ratio and soybean peroxidase concentration required to reach at least 95% of conversion of these pollutants in synthetic and refinery wastewaters. They concluded that the oxidation with soybean peroxidase was a suitable alternative for the removal of these compounds.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

177

Removal of Paper Dyes Another application of soybean peroxidase enzyme is dye decolorization. Knutson et al. [144] studied the removal of two of the most common paper dyes, the stilbene dye, Direct Yellow 11, and the methine dye, Basazol 46L, with two enzymes, soybean and horseradish peroxidases. Their results demonstrate that these two recalcitrant dyes can be effectively decolorized by enzymatic treatments by horseradish and soybean peroxidase. Soybean peroxidase obtained good removal efficiencies from pH 4.5 to 8.5. Although soybean peroxidase was effective in removing both dyes, SBP degrades quicker Basazol 46L than Direct Yellow 11.

CONCLUSION Soybean peroxidase (SBP) has proven its efficiency in the removal of many different pollutants present in industrial effluents: phenolic compounds, polycyclic aromatic hydrocarbons, aromatic amines, nitroaromatics, benzothiazoles and paper dyes. In addition to the advantages commonly attributed to enzymatic treatments, such as operation within a wide range of conditions, high specificity towards the targeted compounds and minimum environmental impact, peroxidases allow an easy separation of the reaction products resulting from the catalytic process. And, furthermore, SBP might be able to overcome some typical problems associated with enzymatic treatments: the high cost of the treatment and enzyme inactivation due to inappropriate reaction conditions. SBP can be easily extracted from soybean seed hulls, where it is present at high concentrations. And since the seed coat is a byproduct of the soybean food industry, SBP has a high potential for being a cost effective alternative compared to other peroxidase sources. Additionally, its enzymatic activity can be maintained over a wide range of temperature and pH, reducing the risk of enzyme deactivation. The direct use of soybean seed hulls without extraction has been already tested with promising results, and further research in this area, especially regarding the use of real samples of contaminated effluents instead of synthetic ones, can be a first step for the development of cost effective and highly efficient processes for wastewater treatment at industrial scale.

REFERENCES [1] [2] [3]

Bryant, C. W., Avenell, J. J., Barkley, W. A. & Thut, R. N. (1992). The removal of chlorinated organic from conventional pulp and paper wastewater treatment systems. Water Science and Technology, 26, 417-425. Czaplicka, M. (2004). Sources and transformations of chlorophenols in the natural environment. Science of the Total Environment, 322, 21-39. Ahlborg, U. G. & Thunberg, T. M. (1980). Chlorinated phenols: occurrence, toxicity, metabolism, and environmental impact. Critical Reviews in Toxicology, 7, 1-35.

178 [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17]

[18]

[19]

J.L. Gómez, M. Gómez and M.D. Murcia Batoev, V. B., Nimatsyrenova, G. G., Dabalaeva, G. S. & Palitsyna, S. S. (2005). An assessment of contamination of the Selenga River Basin by chlorinated phenols. Chemistry for Sustainable Development, 13, 31-36. Gellman, I. (1988). Environmental effects of paper industry wastewater – an overview. Water Science and Technology, 20, 59-65. Garden, S. (1990). Baseline levels of absorbable organic halogen in treated wastewaters from bleached kraft pulp mill in Ontario. Chemosphere, 20, 1695-1700. Keith, L. H. & Telliard, W. A. (1979). Priority pollutants: a prospective view. Environmental Science and Technology, 13, 416-424. EC Decision 2455/2001/EC of the European Parliament and of the Council of November 20, 2001 establishing the list of priority substances in the field of water policy and amending Directive, 2000/60/EC (L 331 of 15-12-2001). Agency for Toxic Substances and Disease Registry (ATSDR). (1995). Toxicological profile for Polycyclic Aromatic Hydrocarbons (PAHs). Atlanta, GA: U.S. Department of Health and Human Services, Public Health Service. Guerin, W. F. & Jones, G. E. (1988). Mineralization of phenanthrene by a Mycobacterium sp. Applied and Environmental Microbiology, 54, 937-944. Heitkamp, M. A., Freeman, J. P., Miller, D. W. & Cerniglia, C. E. (1988). Pyrene degradation by a Mycobacterium sp.: Identification of ring oxidation and ring fission products. Applied and Environmental Microbiology, 54, 2556-2565. Wammer, K. H. & Peters, C. A. (2005). Polycyclic aromatic hydrocarbon biodegradation rates: A structure-based study. Environmental Science and Technology, 39, 2571-2578. Shengquan, Y., Hui, W., Chaoua, Z. & Fu, H. (2008). Separation of carcinogenic aromatic amines in the food colourants plant wastewater treatment. Desalination, 222, 294-301. Benigni, R. & Passerini, L. (2002). Carcinogenicity of the aromatic amines: from structure–activity relationships to mechanisms of action and risk assessment. Mutation Research, 511, 191-206. Karim, Z. & Husain, Q. (2009). Redox-mediated oxidation and removal of aromatic amines from polluted water by partially purified bitter gourd (Momordica charantia) peroxidase. International Biodeterioration & Biodegradation, 63, 587-593. Agrawall, A. & Tratnyek, P. G. (1996). Reduction of Nitro Aromatic Compounds by Zero-Valent Iron Metal. Environmental Science and Technology, 30, 153-160. Mantha, R., Biswas, N., Taylor, K. E. & Bewtra, J. K. (2002). Removal of Nitroaromatics from Synthetic Wastewater Using Two-Step Zero-Valent Iron Reduction and Peroxidase-Catalyzed Oxidative Polymerization. Water Environment Research, 74, 280-287. Patapas, J., Mousa Al-Ansari, M., Taylor, K. E., Bewtra, J. K. & Biswas, N. (2007). Removal of dinitrotoluenes from water via reduction with iron and peroxidasecatalyzed oxidative polymerization: A comparison between Arthromyces ramosus peroxidase and soybean peroxidase. Chemosphere, 67, 1485-1491. Andreozzi, R., Caprio, V. & Marotta, R. (2001). Oxidation of benzothiazole, 2mercaptobenzothiazole and 2-hydroxybenzothiazole in aqueous solution by means of H2O2/UV or photoassisted Fenton systems. Journal of Chemical Technology and Biotechnology, 76, 196-202.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

179

[20] Valdes, H., Murillo, F. A., Manoli, J. A. & Zaror, C. A. (2008). Heterogeneous catalytic ozonation of benzothiazole aqueous solution promoted by volcanic sand. Journal of Hazardous Materials, 153, 1036-1042. [21] Gaja, M. A. & Knapp, J. S. (1998). Removal of 2-mercaptobenzothiazole by activated sludge: a cautionary note. Water Research, 32, 3786-3789. [22] Sarnalk, S. & Kanekar, P. (1995). Bioremediation of colour of methyl violet and phenol from a dye-industry waste effluent using Pseudomonas spp. Isolated from factory soil. Journal of Applied Bacteriology, 79, 459-469. [23] Knutson, K. P. (2004). Enzymatic Biobleaching of Recalcitrant Paper Dyes. Institute of Paper Science and Technology at Georgia Institute of Technology. [24] World Bank Group. (1995). Dye Manufacturing. Pollution Prevention and Abatement Handbook. [25] Gomez, M., Matafonova, G., Gomez, J. L., Batoev, V. & Christofi, N. (2009). Comparison of alternative treatments for 4-chlorophenol removal from aqueous solutions: Use of free and immobilized soybean peroxidase and KrCl excilamp. Journal of Hazardous Materials, 169, 46-51. [26] Chin, W. C., Mei, L. C., Jen, L. C. & Zong, H. C. (2000). Biodegradation of 2,4,6trichlorophenol in the presence of primary substrate by immobilized pure culture bacteria. Chemosphere, 41, 1873-1879. [27] Ghioureliotis, M. & Nicell, J. A. (1999). Assessment of soluble products of peroxidasecalalyzed polymerization of aqueous phenol. Enzyme and Microbial Technology, 25, 185-193. [28] Gomez, J. L., Bodalo, A., Gomez, E., Bastida, J., Hidalgo, A. M. & Gomez, M. (2008). A covered particle deactivation model and an expanded Dunford mechanism for the kinetic analysis of the immobilized SBP/phenol/hydrogen peroxide system. Chemical Engineering Journal, 138, 460-473. [29] Chibata, I. (1978). Immobilized enzymes: Research and development. New York, USA: John Wiley & Sons Inc. [30] Zaborsky, O. R. (1973). Immobilized Enzymes. Cleveland, Ohio, USA: CRC Press. [31] Arroyo, M. (1998). Inmovilización de enzimas. Fundamentos, métodos y aplicaciones. Ars Pharmaceutica, 39, 23-39. [32] Kennedy, J. F. & Cabral, J. M. S. (1983). Solid Phase Biochemistry. New York, USA: W. H. Scouten, Ed., Wiley Pub. [33] Hamid, M. & Rehman, K. (2009). Potential applications of peroxidases. Food Chemistry, 115, 1177-1186. [34] Ryan, B. J., Carolan, N. & O´Fagain, C. (2006). Horseradish and soybean peroxidases: comparable tools for alternative niches? Trends in Biotechnology, 24, 355-363. [35] Buchanan, I. D. & Han Y. S. (2000). Assessment of the potential of Arthromyces Ramosus peroxidase to remove phenol from industrial wastewaters. Environmental Technology, 21, 545-552. [36] Villalobos, D. A. & Buchanan, I. D. (2002). Removal of aqueous phenol by Arthromyces ramosus peroxidase. Journal of Environmental and Engineering Science, 1, 65-73. [37] Ikehata, K., Buchanan, I. D. & Smith, D. W. (2003). Treatment of oil refinery wastewater using crude Coprinus cinereus peroxidase and hydrogen peroxide. Journal of Environmental Engineering and Science, 2, 463-472.

180

J.L. Gómez, M. Gómez and M.D. Murcia

[38] Masuda, M., Sakurai, A. & Sakakibara, M. (2001). Effect of reaction conditions on phenol removal by polymerization and precipitation using Coprinus cinereus peroxidase. Enzyme and Microbial Technology, 28, 295-300. [39] Kauffmann, C., Petersen, B. R. & Bjerrum M. J. (1999). Enzymatic removal of phenols from aqueous solutions by Coprinus cinereus peroxidase and hydrogen peroxide. Journal of Biotechnology, 73, 71-74. [40] Al-Kassim, L., Taylor, K. E., Nicell, J. A., Bewtra, J. K. & Biswas, N. (1994). Enzymatic removal of selected aromatic contaminants from wastewater by a fungal peroxidase from Coprinus macrorhizus in batch reactors. Journal of Chemical Technology and Biotechnology, 61, 179-182. [41] Al-Kassim, L., Taylor, K. E., Bewtra, J. K. & Biswas, N. (1994). Optimization of phenol removal by a fungal peroxidase from Coprinus macrorhizus using batch, continuous, and discontinuous semibatch reactors. Enzyme and Microbial Technology, 16, 120-124. [42] Ayala, M., Robledo, N. R., Lopez-Munguia, A. & Vazquez-Duhalt, R. (2000). Substrate Specificity and Ionization Potential in Chloroperoxidase-Catalyzed Oxidation of Diesel Fuel. Environmental Science and Technology, 34, 2804-2809. [43] Pickard, M. A., Kadima, T. A. & Carmichael, R. D. (1991). Chloroperoxidase, a peroxidase with potential. Journal of Industrial Microbiology and Biotechnology, 7, 235-241. [44] Casella, L., Poli, S., Gullotti, M., Selvaggini, C., Beringhelli, T. & Marchesini, A. (1994). The chloroperoxidase-catalyzed oxidation of phenols. Mechanisms, selectivity and characterization of enzyme-substrate complexes. Biochemistry, 33, 6377-6386. [45] Aoun, S., Chebli, C. & Baloulene, M. (1998). Noncovalent immobilization of chloroperoxidase into talc: catalytic properties of a new biocatalyst. Enzyme and Microbial Technology, 23, 380-385. [46] Goszczynski, S., Paszczynski, A., Pasti-Grigsby, M. B., Crawford, R. L. & Crawford, D. L. (1994). New Pathway for Degradation of Sulfonated Azo Dyes by Microbial Peroxidases of Phanerochaete chrysosporium and Streptomyces chromofuscust. Journal of Bacteriology, 176, 1339-1347. [47] Michel JR, F. C., Balachandra, S., Grulke, E. A. & Adinarayana, C. (1991). Role of Manganese Peroxidases and Lignin Peroxidases of Phanerochaete chrysosporium in the Decolorization of Kraft Bleach Plant Effluent. Applied and Environmental Microbiology, 57, 2368-2375. [48] Grabski, A. C., Rasmussen, J. K., Coleman, P. L. & Burgess, R. R. (1996). Immobilization of manganese peroxidase from Lentinula edodes on alkylaminated Emphaze™ AB 1 polymer for generation of Mn+3 as an oxidizing agent. Applied Biochemistry and Biotechnology, 60, 1-17. [49] Grabski, A. C., Grimek, H. J. & Burgess, R. R. (2000). Immobilization of manganese peroxidase from Lentinula edodes and its biocatalytic generation of Mn-III-chelate as a chemical oxidant of chlorophenols. Biotechnology and Bioengineering, 60, 204-215. [50] Aitken, M. D. & Irvine, R. L. (1989). Stability testing of ligninase and Mn-peroxidase from Phanerochaete chrysosporium. Biotechnology and Bioengineering, 34, 12511260. [51] Bogan, B. W., Schoenike, B., Lamar, R. T. & Cullen, D. (1996). Manganese peroxidase mRNA and enzyme activity levels during bioremediation of polycyclic aromatic

Soybean, a Peroxidase Source for the Biotreatment of Effluents

[52] [53] [54] [55] [56] [57] [58] [59] [60] [61] [62] [63] [64] [65] [66] [67] [68]

181

hydrocarbon-contaminated soil with Phanerochaete chrysosporium. Applied and Environmental Microbiology, 62, 2381-2386. Cameron, M. D., Timofeevski, S. & Aust, S. D. (2000). Enzymology of Phanerochaete chrysosporium with respect to the degradation of recalcitrant compounds and xenobiotics. Applied Microbiology and Biotechnology, 54, 751-758. Scheibner, K. & Hofrichter, M. (1998). Conversion of aminonitrotoluenes by fungal manganese peroxidase. Journal of Basic Microbiology, 1, 51-59. Geng, Z., Rao, K. J., Bassi, A. S., Gijzen, M. & Krishnamoorthy, N. (2001). Investigation of biocatalytic properties of soybean seed hull peroxidase. Catalysis Today, 64, 233-238. Bakalovic, N., Passardi, F., Ioannidis, V., Cosio, C., Penel, C., Falquet, L. & Dunand, C. (2006). PeroxiBase: A class III plant peroxidase database. Phytochemistry, 67, 534539. Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y. & Matsui, H. (2001). A large family of Class III plant peroxidase. Plant and Cell Physiology, 42, 462-468. Klibanov, A. M., Alberty, B. N., Morris, E. D. & Felshin, L. M. (1980). Enzymatic removal of toxic phenols and anilines from waste waters. Journal of Applied Biochemistry, 2, 414-421. Klibanov, A. M. & Morris, E. D. (1981). Horseradish peroxidase for the removal of carcinogenic aromatic amines from water. Enzyme and Microbial Technology, 3, 119122. Klibanov, A. M. (1982). Enzymatic removal of hazardous pollutants from industrial aqueous effluents. Enzyme Engineering, 6, 319-323. Klibanov, A. M., Tu T. M. & Scott K. P. (1983). Peroxidase-catalyzed removal of phenols from coal-conversion waste waters. Science, 221, 259-260. Cooper, V. A. & Nicell J. A. (1996). Removal of phenols from a foundry wastewater using horseradish peroxidase. Water Research, 30, 954-964. Tong, Z., Quingxiang, Z., Wilson, S. & Min Q. (1999). Study of the removal of 4chlorophenol from wastewater using horseradish peroxidase. Toxicological and Environmental Chemistry, 71, 115-123. Wagner, M. & Nicell J. A. (2001). Treatment of a foul condensate from kraft pulping with horseradish peroxidase and hydrogen peroxide. Water Research, 35, 485-495. Wu, J., Taylor, K. E., Bewtra, J. K. & Biswas N. (1993). Optimization of the reaction conditions for enzymatic removal of phenol from wastewater in the presence of polyethylene glycol. Water Research, 12, 1701-1706. Davidenko, T. I., Oseychuk, O. V., Sevastyanov, O. V. & Romanouskaya, I. I. (2004). Peroxidase oxidation of phenols. Applied biochemistry and Microbiology, 40, 542-546. Tong, Z., Quingxiang, Z., Hui, H., Qin, L. & Yi, Z. (1997). Removal of toxic phenol and 4-chlorophenol from waste water by horseradish peroxidase. Chemosphere, 34, 893-903. Wagner, M. & Nicell J. A. (2003). Impact of the presence of solids on peroxidase catalyzed treatment of aqueous phenol. Journal of Chemical Technology and Biotechnology, 78, 694-702. Nakamoto, S. & Machida, N. (1992). Phenol removal from aqueous solutions by peroxidase-catalyzed reaction using additives. Water Research, 26, 49-54.

182

J.L. Gómez, M. Gómez and M.D. Murcia

[69] Wagner, M. & Nicell, J. A. (2002). Impact of dissolved wastewater constituents on peroxidase-catalyzed treatment of phenol. Journal of Chemical Technology and Biotechnology, 77, 419-428. [70] Nicell, J. A., Saadi, K. W. & Buchanan, I. D. (1995). Phenol polymerization and precipitation by horseradish peroxidase enzyme and an additive. Bioresource and Technology, 54, 5-16. [71] Tatsumi, K., Ichikawa, H. & Wada, S. (1995). Removal of chlorophenols from wastewater by immobilized horseradish peroxidase. Organohalogen Compounds, 24, 37-42. [72] Peralta-Zamora, P., Esposito, E., Pelegrini, R., Groto, R., Reyes, J. & Duran, N. (1998). Effluent treatment of pulp and paper, and textile industries using immobilised horseradish peroxidase. Environmental Technology, 19, 55-63. [73] Hu, L. (1996). Study on the catalytic removal of phenols from aqueous solution by immobilized enzyme. Huanjing Kexue, 17, 57-60. [74] Kim, G. & Moon S. (2005). Degradation of pentachlorophenol by an electroenzymatic method using immobilized peroxidase enzyme. Korean Journal of Chemical Engineering, 22, 52-60. [75] Bodalo, A., Gomez, J. L., Gomez, E., Bastida, J. & Maximo, M. F. (2006). Comparison of commercial peroxidases for removing phenol from water solutions. Chemosphere, 63, 626-632. [76] Nicell, J. A., Bewtra, J. K., Biswas, N., St. Pierre, C. & Taylor, K. E. (1993). Enzyme catalyzed polymerization and precipitation of aromatic compounds from aqueous solution. Canadian Journal of Civil Engineering, 20, 725-735. [77] Buchanan, I. D., Nicell, J. A. & Wagner, M. (1998). Reactor models for horseradish peroxidase-catalyzed aromatic removal. Journal of Environmental Engineering, 124, 794-802. [78] Wu, J., Taylor, K. E., Bewtra, J. K. & Biswas, N. (1999). Kinetic model-aided reactor design for peroxidase-catalyzed removal of phenol in the presence of polyethylene glycol. Journal of Chemical Technology and Biotechnology, 74, 519-526. [79] Lopez-Molina, D., Hiner, A., Tudela, J., Garcia-Canovas, F. & Neptuno, J. (2003). Enzymatic removal of phenols from aqueous solution by artichoke (Cynara acolymus L.) extracts. Enzyme and Microbial Technology, 33, 738-742. [80] Duarte-Vazquez, M. A., Garcia-Almendarez, B. E., Regalado, C. & Whitaker, J. R. (2001). Purification and properties of a neutral peroxidase from turnip (Brassic napus L. var. purple top white globe) roots. Journal of Agriculture and Food Chemistry, 49, 4450-4456. [81] Duarte-Vazquez, M. A., Ortega-Tovar, M. A., Garcia-Almendarez, B. E. & Regalado, C. (2003). Removal of aqueous phenolic compounds from a model system by oxidative polymerization with turnip (Brassica napus L Var purple top white globe) peroxidase. Journal of Chemical Technology and Biotechnology, 78, 42-47. [82] Cochrane, M. P. (1993). Observations of the germ aleurone of barley: Phenol oxidase and peroxidase activity. Annals of Botany, 73, 121-128. [83] Adler, P. R., Arora, R., El Ghaouth, A., Glenn, D. M. & Solar, J. M. (1994). Bioremediation of phenolic compounds from water with plant root surface peroxidases. Journal of Environmental Quality, 23, 1113-1117.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

183

[84] Gillikin, J. W. & Graham J. S. (1991). Purification and developmental analysis of the major anionic peroxidase from the seed coat of Glycine max. Plant Physiology, 96, 214-220. [85] Nissum, M., Feis, A. & Smulevich, G. (1998). Characterization of soybean seed coat peroxidase: resonance Raman evidence for a structure-based classification of plant peroxidases. Biospectroscopy, 4, 355-364. [86] Smulevich, G., Paoli, M., Burke, J. F., Sanders, S. A., Thorneley, R. N. F. & Smith, A. T. (1994). Characterization of recombinant horseradish peroxidase C and three sitedirected mutants, F41V, F41W, and R38K, by resonance Raman spectroscopy. Biochemistry, 33, 7398-7407. [87] Feis, A., Howes, B. D., Indiani, C. & Smulevich, G. (1998). Resonance Raman and electronic absorption spectra of horseradish peroxidase isozyme A2: evidence for a quantum-mixed spin species. Journal of Raman Spectroscopy, 29, 933-938. [88] Flock, C., Bassi, A. & Gijzen M. (1999). Removal of aqueous phenol and 2chlorophenol with purified soybean peroxidase and raw soybean hulls. Journal of Chemical Technology and Biotechnology, 74, 303-309. [89] McEldoon, J. P. & Dordick, J. S. (1996). Unusual thermal stability of soybean peroxidase. Biotechnology Progress, 12, 555-558. [90] Wright, H. & Nicell, J. A. (1999). Characterization of soybean peroxidase for wastewater treatment. Bioresource Technology, 70, 69-79. [91] Amisha, J. K. & Behere, D. V. (2003). Activity, stability and conformational flexibility of seed coat soybean peroxidase. Journal of Inorganic Biochemistry, 94, 236-242. [92] Caza, N., Bewtra, J. K., Biswas, N. & Taylor, K. E. (1999). Removal of phenolic compounds from synthetic wastewater using soybean peroxidase. Water Research, 13, 3012-3018. [93] Kinsley, C. & Nicell, J. A. (2000). Treatment of aqueous phenol with soybean peroxidase in the presence of polyethylene glycol. Bioresource Technology, 73, 139146. [94] Al-Kassim, L., Taylor, K. E., Bewtra, J. K. & Biswas, N. (1993). Aromatics removal from water by Arthromyces ramosus peroxidase. In K. G. Welinder, S. K. Rasmussen, C. Penel, & H. Greppin, (Eds.), Plant Peroxidases: Biochemistry and Physiology, (197200). Universidad of Geneva. [95] Al-Kassim, L., Taylor, K. E., Bewtra, J. K. & Biswas, N. (1993). Evaluation of the removal of aromatic and halogenated unsaturated hydrocarbons from synthetic wastewater by enzyme catalyzed polymerization. Proc. 48th Purdue Industrial Waste Conference, Lewis Publishers, Chelsea, MI. 413-420. [96] Al-Kassim, L., Taylor, K. E., Bewtra, J. K. & Biswas, N. (1995). Optimization and preliminary cost analysis of soybean peroxidase-catalyzed removal of phenols from synthetic and industrial wastewater. Proc. 45th Canadian Chemical Engineering Conference, Quebec. [97] McEldoon, J. P., Pokora, A. R. & Dordick, J. S. (1995). Lignin peroxidase-type activity of soybean peroxidase. Enzyme and Microbial Technology, 17, 359-365.

184

J.L. Gómez, M. Gómez and M.D. Murcia

[98] Nicell, J. A. & Wright, H. (1997). A model of peroxidase activity with inhibition by hydrogen peroxide. Enzyme and Microbial Technology, 21, 302-310. [99] Taylor, K. E., Bewtra, J. K. & Biswas, N. (1998). Enzymatic treatment of phenolic cand other aromatic compounds in wastewaters. Proc. 71st Annu. Conf. & Exposition, Water Environment Federation, Vol. 3. 349-360. [100] Wilberg, K., Assenhaimer, C. & Rubio, J. (2002). Removal of aqueous phenol catalyzed by a low purity soybean peroxidase. Journal of Chemical Technology and Biotechnology, 77, 851-857. [101] Taylor, K. E., Al-Kassim, L., Bewtra, J. K., Biswas, N. & Taylor, J. (1996). Enzyme based wastewater treatment: removal of phenols by oxidative enzymes. In M. MooYoung, W. A. Anderson, & A. M. Chakrabarty, (Eds.), Environmental Biotechnology: Principles and Applications, (524-532). Dordrecht, Kluwer Academic Publishers. [102] Dec, J. & Bollag, J. M. (1994). Use of plant material for the decontamination of water polluted with phenols. Biotechnology and Bioengineering, 44, 1132-1139. [103] Kennedy, K., Alemany, K. & Warith, M. (2002). Optimisation of soybean peroxidase treatment of 2,4-dichlorophenol. Water SA, 28, April 2002. [104] Bodalo, A., Gomez, J. L., Gomez, E., Hidalgo, A. M., Gomez, M. & Yelo, A. M. (2006). Removal of 4-chlorophenol by soybean peroxidase and hydrogen peroxide in a discontinuous tank reactor. Desalination, 195, 51-59. [105] Parra, M., Martinez-Ruiz, J., Tomas V., Martinez-Gutierrez, R., Garcia-Canovas, F. & Tudela, J. (2009). Optimization of the soybean peroxidase catalysed biodegradation of 2,4,6-trichlorophenol. New biotechnology, 255, September 2009. Doi:10.1016/j.nbt. 2009.06.514. [106] Tatsumi, K., Wada, S. & Ichikawa, H. (1996). Removal of chlorophenols from wastewater by immobilized horseradish peroxidase. Biotechnology and Bioengineering, 51, 126-130. [107] Wu, Y., Bewtra, J. K., Biswas, N. & Taylor, K. E. (1993). Removal of phenol derivatives from aqueous solution by enzymatic reaction with additives. Proceedings of the 48th Purdue Industrial Waste Conference 421-431. [108] Wu, Y., Taylor, K. E., Biswas, N. & Bewtra, J. K. (1998). A model for the protective effect of additives on the activity of horseradish peroxidase in the removal of phenol. Enzyme Microbiology and Technology, 22, 15-322. [109] Gomez, J. L., Bodalo, A., Gomez, E., Bastida, J., Hidalgo, A. M. & Gomez, M. (2006). Immobilization of peroxidases on glass beads: an improved alternative for phenol removal. Enzyme and Microbial Technology, 39, 1016-1022. [110] Bodalo, A., Bastida, J., Maximo, M. F., Montiel, M. C., Gomez, M. & Murcia, M. D. (2008). A comparative study of free and immobilized soybean and horseradish peroxidases for 4-chlorophenol removal: protective effects of immobilization. Bioprocess and Biosystems Engineering, 31, 587-593. [111] Bassi, A., Geng, Z. & Gijzen, M. (2004). Enzymatic removal of phenol and chlorophenols using soybean seed hulls. Engineering in Life Sciences, 4, 125-130. [112] Trivedi, U. J., Bassi, A. S. & Zhu J. X. (2006). Investigation of phenol removal using sol-gel/alginate immobilized soybean seed peroxidase. The Canadian Journal of Chemical Engineering, 84, 239-247.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

185

[113] Gacche, R. N., Firdaus, Q. & Sagar A. D. (2003). Soybean (Glycine max L.) seed coat peroxidase immobilized on fibrous aromatic polyamide: A strategy for decreasing phenols from industrial wastewater. Journal of Scientific and Industrial Research, 62, 1090-1093. [114] Magri, M., Miranda, M. & Cascone, O. (2005). Immobilized of soybean seed coat peroxidase on polyaniline: Synthetis optimization and catalytic properties. Biocatalysis and Biotransformation, 23, 339-346. [115] Gomez, J. L., Gomez, E., Bastida, J., Hidalgo, A. M., Gomez, M. & Murcia, M. D. (2008). Experimental behaviour and design model of a continuous tank reactor for removing 4-chlorophenol with soybean peroxidase. Chemical Engineering and Processing, 47, 1786-1792. [116] Trivedi, U. J., Bassi, A. S. & Zhu, J. X. (2006). Continuous enzymatic polymerization of phenol in a liquid-solid circulating fluidized bed. Powder Technology, 169, 61-70. [117] Gomez, J. L., Bodalo, A., Gomez, E., Hidalgo, A. M., Gomez, M. & Murcia, M. D. (2007). Experimental behaviour and design model of a fluidized bed reactor with immobilized peroxidase for phenol removal. Chemical Engineering Journal, 127, 4757. [118] Gomez, J. L., Bodalo, A., Gomez, E., Hidalgo, A. M., Gomez, M. & Murcia, M. D. (2008). A transient design model of a continuous tank reactor for removing phenol with immobilized soybean peroxidase and hydrogen peroxide. Chemical Engineering Journal, 145, 142-148. [119] Murcia, M. D., Gomez, G., Gomez, E., Bodalo, A., Gomez, J. L. & Hidalgo, A. M. (2009). Assessing combination treatment, enzymatic oxidation and ultrafiltration in a membrane bioreactor, for 4-chlorophenol removal: Experimental and modelling. Journal of Membrane Science, 342, 198-207. [120] Gijzen, M., Huystee, R. & Buzzell, R. I. (1993). Soybean seed coat peroxidase. A comparison of high-activity and low-activity and low-activity genotypes. Plant Physiology, 103, 1061-1066. [121] Steevensz, A., Al-Ansari, M. M., Taylor, K. E., Bewtra, J. K. & Biswas, N. (2009). Comparison of soybean peroxidase with laccase in the removal of phenol from synthetic and refinery wastewater samples. Journal of Chemical Technology and Biotechnology, 84, 761-769. [122] Dunford, H. B. (1976). On the function and mechanism of action of peroxidases. Coordination Chemistry Reviews, 9, 187-251. [123] Job, B. & Dunford, H. B. (1976). Substituent effect on the oxidation of phenols and aromatic amines by horseradish peroxidase compound I. European Journal of Biochemistry, 66, 607-614. [124] Adediran, A. & Lambeir, A. (1989). Kinetics of the reaction of compound II of horseradish peroxidase with hydrogen peroxide to form compound III. Journal of Biochemistry, 186, 571-576. [125] Nakajima, R. & Yamazaki, I. (1987). The mechanism of oxyperoxidase formation from ferryl preoxidase and hydrogen peroxide. Journal of Biological Chemistry, 262, 25762581. [126] Arnao, M. B., Acosta, M., del Rio, J. A. del, Varón, R. & García-Cánovas, F. (1990). A kinetic study on the suicide inactivation of peroxidase by hydrogen peroxide. Biochimica et Biophysica Acta, 1041, 43-47.

186

J.L. Gómez, M. Gómez and M.D. Murcia

[127] Buchanan, I. D. & Nicell, J. A. (1997). Model development for horseradish peroxidase catalyzed removal of aqueous phenol. Biotechnology and Bioengineering, 54, 251-261. [128] Baynton, K. J., Bewtra, J. K., Biswas, N. & Taylor, K. E. (1994). Inactivation of horseradish peroxidase by phenol and hydrogen peroxide: a kinetic investigation. Biochimica et Biophysica Acta, 1206, 272-278. [129] Patel, P. K., Mondal, M. S., Modi, S. & Behere, D. V. (1997). Kinetic studies on the oxidation of phenols by the horseradish peroxidase compound II. Biochimica et Biophysica Acta, 1339, 79-87. [130] Nicell, J. A. (1994). Kinetic of horseradish peroxidase-catalyzed polymerization and precipitation of aqueous 4-chlorophenol. Journal of Chemical Technology and Biotechnology, 60, 203-215. [131] Buchanan, I. D. & Nicell, J. A. (1999). A simplified model of peroxidase-catalyzed phenol removal from aqueous solution. Journal of Chemical Technology and Biotechnology, 74, 669-674. [132] Choi, Y. J., Chae, H. J. & Kim, E. Y. (1999). Steady-state oxidation model by horseradish peroxidase for the estimation of the non-inactivation zone in the enzymatic removal of pentachlorophenol. Journal of Bioscience and Bioengineering, 88, 368-373. [133] Gilabert, M. A., Hiner, A. N. P., García-Ruiz, P. A., Tudela, J., García-Molina, F., Acosta, M., García-Cánovas, F. & Rodríguez-López, J. N. Differential substrate behaviour of phenol and aniline derivates during oxidation by horseradish peroxidase: kinetic evidence for two-step mechanism. Biochimica et Biophysica Acta, 1699, 235243. [134] Tong, Z., Qingxiang, Z., Hui, H., Quin, L. & Yin, Z. (1998). Kinetic study on the removal of toxic phenol and chlorophenol from wastewater by horseradish peroxidase. Chemosphere, 37, 1571-1577. [135] Nissum, M., Schiodt, C. B. & Welinder, K. G. (2001). Reactions of soybean peroxidase and hydrogen peroxide pH 2.4-12.0, and veratryl alcohol at pH 2.4. Biochimica et Biophysica Acta, 1545, 339-348. [136] Yu, J., Taylor, K. E., Zou, H., Biswas, N. & Bewtra, J. K. (1994). Phenol conversion and dimeric intermediates in horseradish peroxidase catalyzed phenol removal from water. Environmental Science and Technology, 28, 2154-2160. [137] Gómez, J. L., Bódalo, A., Gómez, E., Hidalgo, A. M. & Gómez, M. (2005). A new method to estimate intrinsic parameters in the Ping-pong bisustrate kinetic: application to the oxipolymerization of phenol. American Journal of Biochemistry and Biotechnology, 1, 115-120. [138] Bodalo, A., Gomez, J. L., Gomez, E., Hidalgo, A. M., Gomez, M. & Yelo, A. M. (2007). Elimination of 4-chlorophenol by soybean peroxidase and hydrogen peroxide: kinetic model and intrinsic parameters. Biochemical Engineering Journal, 34, 242-247. [139] Kraus, J. J., Munir, I. Z., McEldoon, J. P., Clark, D. S. & Dordick, J. S. (1999). Oxidation of Polycyclic Aromatic Hydrocarbons Catalyzed by Soybean Peroxidase. Applied Biochemistry and Biotechnology, 80, 221-230.

Soybean, a Peroxidase Source for the Biotreatment of Effluents

187

[140] Al-Ansari, M. M., Steevensz, A., Al-Aasm, A., Taylor, K. E., Bewtra, J. K. & Biswas. N. (2009). Soybean peroxidase-catalyzed removal of phenylenediamines and benzenediols from water. Enzyme and Microbial Technology, 45, 253-260. [141] Al-Ansari, M. M. (2008). Removal of various aromatic compounds from synthetic and refinery wastewater using soybean peroxidase. Masters Abstracts International, 47, 175. [142] Johnson, M. A., Pokora, A. R. & Cyrus Jr, W. L. (1996). Biocatalytic oxidation using soybean peroxidase. US Patent 5508180. [143] Pokora, A. R. & Johnson, M. A. (1993). Soybean peroxidase treatment of contaminated substances. US Patent 5178762. [144] Knutson, K., Kirzan, S. & Ragauskas, A. (2005). Enzymatic biobleaching of two recalcitrant paper dyes with horseradish and soybean peroxidase. Biotechnology Letters, 27, 753-758.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 6

SOYBEAN PEROXIDASE APPLICATIONS IN WASTEWATER TREATMENT Mohammad Mousa Al-Ansari1*, Beeta Saha2, Samar Mazloum2, K. E. Taylor1, J. K. Bewtra2 and N. Biswas2 1

Department of Chemistry and Biochemistry, University of Windsor, Windsor, ON, Canada N9B 3P4 2 Department of Civil and Environmental Engineering, University of Windsor, Windsor, ON, Canada N9B 3P4

ABSTRACT Soybean peroxidase (SBP) is an oxidoreductase-class enzyme extracted from soybean seed coats (hulls). SBP has been extensively studied in recent years for its role in various biotechnological applications. It has many attractive properties due to its structure, conformational flexibility, activity and stability under various environmental conditions. This review will focus on the application of SBP in industrial waste- and process-water treatment. SBP catalyzes oxidative polymerization of a wide range of hazardous aqueous aromatic pollutants which are present in wastewater streams of various industries such as petroleum refining, coal conversion, wood products and preservation, metal casting, pulp and paper, dyes, adhesives, resins, plastics and textile manufacturing. These pollutants can have adverse health effects on human, animal and aquatic life upon exposure by direct absorption through the skin, ingestion and/or inhalation. Hence, their discharge is regulated. The review will cover pollutants investigated with SBP, advantages of SBP over other enzymes, pretreatment methods to broaden the scope of SBP polymerization, use of additives/surfactants to enhance SBP activity, application of SBP in real industrial wastewater, immobilized SBP and its limitations.

*

Corresponding author: Tel.: 1-519-253-3000 ext. 3544; fax: 1-519-973-7098 Email: [email protected] (M.M. Al-Ansari)

190

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

1. INTRODUCTION Soybean peroxidase (SBP) is a hemoprotein oxidoreductase-class enzyme extracted from the soybean seed coat (hull). The seed coat of the mature soybean is about 4-8 % in mass of the total seed. The seed hull contains a mixture of soluble proteins of different structural characteristics (size and charge) and relative abundance compared to the proteins in the embryo (Dhaubhadel et al., 2005; Gijzen et al., 2001). The proteins identified so far in the seed coat of the mature soybean are (1) peroxidase (Buttery and Buzzell, 1968; Gijzen, 1997), (2) trypsin inhibitors (Kunitz, 1945; Koide and Ikenaka, 1973), (3) hydrophobic protein (Odani et al., 1987; Gijzen et al., 1999), (4) proline-rich proteins (Percy et al., 1999), (5) class I chitinase (Gijzen et al., 2001) and (6) SC24, part of a novel class of plant defense proteins with carboxylate-binding activity that share similar antigenic domains to soybean peroxidase (Dhaubhadel et al., 2005). Large amounts of peroxidase are usually present in the hourglass cells of the subepidermis of soybean seed coat tissue (Gijzen et al., 1993). Peroxidase in seed coat tissue may function in extension polymerization, lignification or suberization of the seed coat and is often induced by wounding or pathogen infection (Gillikin and Graham, 1991; Gijzen et al., 1993; Dhaubhadel et al., 2005). Highest peroxidase activity is in the seed coat of the soybean plant where its greatest expression is controlled by a dominant gene, the Ep locus. The same peroxidase is also found in root and leaf tissue except at lower specific activity (Buttery and Buzzell, 1968; Gijzen et al., 2001). Soybean peroxidase can be used in various biotechnological applications and industries. One of the large potential markets for soybean peroxidase is in polymer and resin manufacture. Peroxidase, in the presence of peroxide, allows the omission of toxic formaldehyde (cross-linking agent) in chemical polymerization; in addition, it is a lower energy input system with higher purity and quality products (Wick, 1996; Lentz and Akridge, 1997; Hutterman et al., 2001; Sessa, 2003; Regalado et al., 2004). Soybean peroxidase is used in the baking industries as a replacement for toxic potassium bromate, which has been banned in all major markets in the world. It is also being used as a replacement for horseradish peroxidase (HRP) in medical and diagnostic assays such as enzyme-linked immunosorbent assays (ELISA) to detect antigens and antibodies due to SBP‘s better overall performance, thermal stability and lower cost (Vierling and Wilcox, 1996; Wick, 1996; Lentz and Akridge, 1997; Sessa, 2003; Regalado et al., 2004). Soybean peroxidase is also used in electrochemical biosensors due to its high catalytic activity and thermostability (Ryan et al., 2006). One of the largest potential markets of soybean peroxidase is in the treatment of contaminants present in industrial wastewater streams, sludge and soils, which is the focus of this chapter.

1.1. Structure of Soybean Peroxidase Soybean seed coat peroxidase (Enzyme Classification 1.11.1.7; Protein Data Base accession number (1FHF)) is an anionic glycoprotein, existing as a single isozyme in the hulls (Henriksen et al., 2001; Ryan et al., 2006; Gillikin and Graham, 1991). The enzyme belongs to the class III secretory plant peroxidases where its classification is based on the amino acid sequence, three-dimensional structure and biological function (Welinder et al., 1992;

Soybean Peroxidase Applications in Wastewater Treatment

191

Dunford, 1999). In general, peroxidases have been classified into three superfamilies: plant, animal and catalase peroxidases. The plant peroxidase superfamily is divided into three families based on their sequence homologies. Class I peroxidases are of prokaryotic origin such as yeast cytochrome c, chloroplast and ascorbate peroxidases. Classes II peroxidases are secreted fungal peroxidases such as lignin, manganese, Coprinus cinereus and Arthromyces ramosus peroxidases. Class III peroxidases are classical secretory plant enzymes such as horseradish, peanut and soybean peroxidases (Dunford, 1999). Soybean peroxidase (molecular weight of 40660 Da), is a highly heterogeneous glycoprotein. The protein contains 17.7-18.2% carbohydrate (molecular weight of 7400 Da). Seven glycosylation sites have been identified with some sites being glycosylated (Henriksen et al., 2001; Ryan et al., 2006; Gray and Montgomery, 2006; Welinder and Larsen, 2004; Gray et al., 1996; Gray and Montgomery, 1997). It also contains two calcium ions, a single tryptophan residue (Trp 117) and four disulfide bridges (located at residues 11-91, 44-49, 97299, 176-208). There are 306 amino acid residues in the protein starting with a pyrrolidine carboxylic acid residue and ending with a serine residue. The secondary structure of the enzyme consists of 13 α-helices and 2 β-sheets (Henriksen et al., 2001; Welinder and Larsen, 2004; Ryan et al., 2006). The active site of the enzyme is Fe(III) protoporphyrin IX which is called a heme (molecular weight of 550 Da). This active site prosthetic group is common for all peroxidases. Ferriprotoporphyrin IX consists of four pyrrole rings joined by methene-bridge (carbon atoms labeled α, β, γ and δ) with iron (III) complex in the center of the molecule (Dunford, 1999) and further substituted as shown in Figure 1.

Figure 1. Structure of ferriprotoporphyrin IX (heme); carbon in blue, iron in gray, nitrogen in yellow, oxygen in red and hydrogen in white; ACDLABS-software (Dunford, 1999)

192

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Figure 2 illustrates six possible ligands for iron coordination in the active site of peroxidases. Four pyrrole nitrogen atoms occupy positions 1-4, also shown in Figure 1. The imidazole side chain of a histidine residue occupies position 5 which is located on the proximal side of the heme. Position 5 plays an important role in the linkage of the heme to the apoprotein. The linkage of the histidine residue to the iron (III) is best described as a covalent bond (linkage can be broken by using acid). Position 6 is located on the distal side of the heme where peroxidase reactions occur. In the native resting enzyme, the iron (III) has fivecoordination while position 6 is vacant. The enzyme can be inhibited by ligands, such as cyanide or azide, which can coordinate with the iron (III) in position 6 (Dunford, 1999).

Figure 2. Imidazole side chain of a histidine residue bonding to the iron atom of the heme; carbon in blue, iron in gray, nitrogen in yellow, oxygen in red and hydrogen in white; ACDLABS-software

Figure 3. SBP structure view; heme group with iron are shown in green, histidine in yellow, arginine in red, cysteine in orange and the remaining amino acid in blue color, the diagram is made using Razmolsoftware using the information from protein data bank (Henriksen et al., 2001)

Soybean Peroxidase Applications in Wastewater Treatment

193

Figure 3 shows the protein structure of soybean peroxidase with the active site and the conserved catalytic residues. The top left picture shows the protoporphyrin IX prosthetic group and the two calcium ions (in green). The top middle picture shows the heme group with the iron (III) in the middle (in green-bright ball). The top right picture shows the histidine amino acid residue side chains present in the active site, where they interact with the heme group (in yellow). The bottom right picture shows the arginine amino acid residue side chain (red), and the bottom middle picture shows the cysteine amino acid residue side chains (orange), which form disulfide-bonds. The bottom right picture shows the alpha-helix and beta-sheet folding. Figure 4 shows a close look at the important amino acid residue side chains in the active site of the enzyme. The imidazole side chain of His 169 (in green) occupies position 5 and is located on the proximal side of the heme. His 42 (in red) is located on the distal side of the heme where it acts as a proton acceptor from hydrogen peroxide. Arg 38 (in yellow) is located on the distal side of the heme where it acts as a charge stabilizer. Arg 175 (in blue; hydrogen bonds to the heme-propionate), Arg 173 (in violet) and Arg 175 (in white gray) were also found to be interacting with the active site. The two calcium ions and the disulfidebonds present increase the protein‘s stability (Dunford, 1999; Henriksen et al., 2001; Everse et al., 1991).

Figure 4. Close look at the heme group and the nearby amino acid residues; the white with the light blue structure are the heme molecules, His 169 in green, Arg 38 in yellow, His 42 in red, Arg 175 in blue, Arg 173 in violet, Arg 175 white/gray and the green line represent the rest of the amino acid residues. The diagram also shows the two calcium ions in red spheres. The diagram is made using ZMM-software using the information from Protein Data Bank (Henriksen et al., 2001)

194

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

1.2. Soybean Peroxidase Biocatalytic Properties Enzymes, in general, are tightly regulated, highly specific and act under mild conditions of pressure, temperature and pH. The active site of an enzyme dictates specificity to one type of chemical group and type of reaction. The substrate that binds to the enzyme interacts in a stereospecific manner (fit) with high affinity. Furthermore, the substrate has to react either by forming or breaking bonds. The active site of the enzyme consists of the catalytic site and the binding site. The catalytic site is where the reaction occurs and the binding site is the area that holds the substrate in a proper conformation to undergo reaction (Fersht, 1977). The catalytic and conformation stability of the peroxidase depends on several structural features in the active site of the enzyme such as the accessibility of the heme active site to hydrogen peroxide and reducing substrates, amino acid environment around the heme, hydrogen bonding network in the active site, electron transfer rate in the heme cavity and the coordination and spin-state of the heme iron (Dunford, 1999; Filizola and Loew, 2000; Henriksen et al., 2001; Kamal and Behere, 2002; Kamal and Behere, 2003). These structural features in the active site of the enzyme can be affected by several environmental factors such as pH, temperature, solvent, etc. (Henriksen et al., 2001; Kamal and Behere, 2002; Kamal and Behere, 2003; Geng et al., 2001). Peroxidases have great diversity of applications due to their wide substrate specificity but a given enzyme‘s environmental stability can limit some peroxidases from large-scale usage. For example, lignin peroxidase from Phanerochaete chrysosporium (LiP) catalyzes the oxidation of veratryl alcohol (3,4-dimethoxybenzyl alcohol) into veratraldehyde in the presence of H2O2 (McEldoon et al., 1995). The limitations of LiP come from the low stability of the enzyme at low pH and higher temperatures. Soybean peroxidase, on the other hand, can catalyze the efficient oxidation of veratryl alcohol (a non-phenolic compound) in such conditions. Thus, SBP at pH 2.4 and 30°C (in the presence of 0.2 M CaCl2) is at least 150fold more stable (as judged by half-life) than LiP while the latter is completely labile at 50°C (McEldoon et al., 1995; Tuisel et al., 1990; Aitken and Irvine, 1989). It is to be noted that when comparing LiP and SBP at the same pH (pH 2.4) and a lower temperature, at 25°C, SBP has a lower catalytic efficiency than LiP due to SBP‘s low affinity for the substrate (Km 15-fold higher) and lower turnover number (95-fold lower). Similar results were observed when the oxidations of methoxybenzenes (non-phenolics) were compared based on the oxidation potential of LiP (1.49 V) and SBP (1.42 V). However, SBP compensates for its low oxidation potential by having high stability at pH 2.4 with temperatures as high as 60°C (McEldoon et al., 1995). Thus, SBP shows greater potential for industrial applications. Horseradish peroxidase (HRP) has also been shown capable of oxidizing veratryl alcohol and methoxybenzenes but its limitation comes from its very low stability at pH 2.4, which is usually the prerequisite for successful oxidation of such compounds (McEldoon et al., 1995). The stability of SBP at low pH also allows the catalysis of halogenation reactions. It catalyzes the efficient bromination of veratryl alcohol and several other organic substrates under acidic conditions (Munir and Dordick, 1999). The use of SBP as a halogenation catalyst provides an environmentally friendly method for replacing the harsh bleach conditions used in chemical halogenations (Munir and Dordick, 1999). SBP has been shown to have a high ‗melting point‘ of 90.5 °C at pH 8 in the presence of 1 mM CaCl2. The melting point of SBP is higher than that of HRP (81.5°C) and Coprinus cinereus peroxidase (CiP; 65°C) when compared under the same conditions (McEldoon and

Soybean Peroxidase Applications in Wastewater Treatment

195

Dordick, 1996). The melting points were determined based on changes in the secondary structure of the enzyme. SBP shows no change in the secondary structure at temperatures below 70 °C. The secondary structure change in the enzyme is believed to result from loss of the heme from the peroxidase to form apo-SBP. The thermal inactivation of SBP is an enthalpically-driven process resulting from the lost bond forces that hold the heme to the active site of the enzyme (McEldoon and Dordick, 1996). The heme loss causes enzyme deactivation and also increases the apo-enzyme‘s sensitivity to thermal denaturation. SBP has been shown to have higher bond strength to its heme group compared to HRP and CiP (McEldoon and Dordick, 1996). The thermal unfolding of SBP has been shown to pursue the following pathway (Kamal and Behere, 2002). The native form of the enzyme begins with losing the heme group due to breakage of a hydrogen bonding network that involves the distal histidine (His 42) to form a stable intermediate. This step is followed by losing the secondary and tertiary structure with immediate release of the heme group from the unfolded polypeptide chain. Comparing SBP and HRP isoenzyme C for their thermal and conformational stabilities with and without heme in the active site, SBP gains ~56% of its thermal and ~80% of its conformational stability when heme is attached while HRP-C gains 46% and 45%, respectively (Kamal and Behere, 2002). SBP thermal (Tm, midpoint of thermal unfolding, is 86°C at pH 7) and conformational stability (43.3 kJ/mol) is higher than HRP-C thermal (74°C at pH 7) and conformational stability (~17.0 kJ/mol) when compared under the same conditions (Tsaprailis et al., 1998; Kamal and Behere, 2002). SBP‘s heme-apoprotein interaction is unique compared to HRPC‘s. The extreme stability of the heme-apoprotein interaction arises due to the interaction between sulfur atom of Met37 and the C8 heme vinyl substituent, resulting in the distinctive thermal stability of SBP (Henriksen et al., 2001; Kamal and Behere, 2002). In addition to the thermal stability of SBP, the catalytic activity (kcat) and catalytic efficiency (kcat /Km) for SBP is higher than HRP-C for the oxidation of ABTS (2,2‘-azinobis(3-ethylbenzothiazoline-6-sulfonate)) by hydrogen peroxide at 25°C over a wide range pH range (3.5-8.0; Kamal and Behere, 2003). The catalytic activity and the conformational stability are highly pH-dependent. SBP possesses its highest catalytic activity and conformational stability in addition to thermostability at pH 5.5 (Kamal and Behere, 2002; Kamal and Behere, 2003). This pH provides the highest conformational flexibility resulting from a relaxation of the rigid β-strand and β-turn structure in addition to a more solventexposed heme active site (δ-meso heme edge; site of electron transfer from a reducing substrate). The highly solvent-exposed heme of SBP compared with other peroxidases is likely a consequence of the rotation of the His42 and the movement of Phe41 in the active site of SBP resulting from a bulky Ile74 (in place of Ala74 in HRP) that causes such rotation of active site residues (Henriksen et al., 2001; Kamal and Behere, 2002; Kamal and Behere, 2003). SBP is also fairly active in the presence of organic solvents such as acetone, acetonitrile, methanol, ethanol and benzene/acetone mixture. SBP exhibited the highest activity in the presence of 16.7% (w/v) ethanol followed by acetone, methanol and acetonitrile. As expected, as the organic solvent concentration increases, the SBP activity decreases (Geng et al., 2001).

196

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

1.3. SBP Extraction, Purification and Activity Measurement Methods 1.3.1. Extraction The dry soybean seed is soaked in water until the seed coat/hull becomes soft and wrinkled (1-2 hr). Crude SBP, SBP with other proteins present from the hulls, can be separated and used before the purification steps. The extraction of the crude SBP can be carried by two similar procedures: (1) soaking the seed hulls in either water or phosphate buffer (pH 6.0-7.0). The mixture is then centrifuged and the supernatant is filtered and stored at 4 oC (Geng et al., 2001; Mantha et al., 2002; Bassi et al., 2004). (2) Crushing the seed coats/hulls into a fine powder in a mortar and pestle with liquid nitrogen and extraction with sodium phosphate, potassium phosphate or Tris buffer, pH 6-7.5, followed by centrifugation and filtration, has also be used, as a prelude to purification (Gillikin and Graham, 1991; Gijzen et al., 1993; Schmitz et al., 1997; Kamal and Behere, 2002). 1.3.2. Purification Purified SBP can be obtained from Crude SBP by a combination of several chromatography methods summarized in Table 1 below. The purity of the protein solution (not the enzyme) is specified by the RZ (Reinheitszahl, the ―purity number‖) value (Kim et al., 2005). The RZ value measures the normalized hemin content of SBP but not the enzyme activity. The RZ value is the ratio of the maximum absorbance of the heme component at 403 nm to that of the aromatic amino acid residues in the protein at 280 nm. Pure SBP has an RZ value in the range 2.6-3.2 at pH 7.4. Table 1. SBP Purification methods Method Ammonium sulfate fractionation, gel filtration on Bio-Gel P-60 column, gradient elution from ion exchange chromatography on DEAE-Sephadex A-50, affinity chromatography on Con ASepharose 4 B, and hydrophobic chromatography on phenylSepharose CL-4B Gradient elution from ion exchange chromatography on DEAESepharose Fast Flow column, affinity chromatography on Con ASepharose, gel filtration on Sephadex G-75 Gel filtration on Superose 12, anion-exchange chromatography on Mono-Q 5/5 Gradient elution from DEAE-cellulose Ammonium sulfate fractionation, gel filtration on SuperdexTM 75 Ammonium sulfate fractionation, Gradient elution from DE-52Sepharose, gel filtration on Sepharose G-100 Q-Sepharose chromatography, Con A-Sepharose chromatography, ammonium sulfate fractionation Gradient elution from DEAE-Sepharose CL-6B Gel filtration on Sephadex G-75, anion-exchange chromatography on Mono-Q 5/5

RZ value 2.6

Paper Sessa and Anderson, 1981

2.8

Gillikin and Graham, 1991

N.D

Gijzen et al., 1993 Gray et al., 1996 Flock et al., 1999 Schmitz et al., 1997 Nissum et al., 2001 Kamal and Behere, 2002 Gray and Montgomery, 2006

2.65 N.D N.D 3.2 2.8-3.0 >2.9

Soybean Peroxidase Applications in Wastewater Treatment

197

1.3.3. Activity SBP activity is assayed spectrophotometrically using various color tests as shown in Table 2. These assays determine the amount of active enzyme (SBP) present in solution. Enzyme activity is measured based on the initial rate of color formation due to SBP reaction with the assay substrates, Table 2. The initial rate is measured by calculating the change of absorbance over time taking into account the dilution factor of reaction and the extinction coefficient of the product. The enzyme activity is reported in U/mL, where 1 unit (U) is usually the amount of enzyme catalysing hydrogen peroxide consumption at 1 μmol.min-1. Table 2. SBP Activity Assays.

Assay 4-aminoantipyrine (4AAP)

Assay Substrates and Conditions phenol, 4AAP, H2O2, sodium phosphate buffer (pH 7.4), 23 oC

Product

Absorbance (wavelength )

Description

Reference Metelitza et al., 1991; Caza et al., 1999; Flock et al., 1999; Wright and Nicell, 1999; Ghioureliotis and Nicell 1999; Kinsley and Nicell, 2000; Wilberg et al., 2002; Mantha et al., 2002; Patapas et al., 2007; Steevensz et al.,2009; Al-Ansari et al., 2009 Chance and Maehly, 1955; Bodalo et al., 2006;

pink quinoneimi ne dye

510 nm

A unit of catalytic activity, U, is 1 micromole of H2O2 converted per minute

One unit will form 1 mg of purpurogallin from pyrogallol in 20 s. This unit is equivalent to ~ 18 micromole units per minute at 25 oC One unit is 1 micromole of chemical change per minute

Pyrogallol

pyrogallol, H2O2, potassium phosphate buffer (pH 6.0), 20 oC

purpurogal lin

420 nm

Guaiacol

guaiacol, H2O2, MES buffer (pH 6.0), 30 oC

orange/ red tetraguaiacol dye

470 nm

ABTS (2,2‘-azinobis (3ethylbenzothiazoline-6sulfonate)) p-Cresol

ABTS, H2O2, potassium phosphate buffer (pH 5.0), 25 oC p-cresol, H2O2, sodium phosphate buffer (pH 7.4), DMF

Oxidized ABTS

405 nm

One unit will oxidize 1.0 micromole of ABTS per minute

fluorescent oligo- and polyphenol

325 nm (excitation) and 402 nm (emission)

The initial rate is measured from the increase in fluorescence of the reaction mixture

Sessa and Anderson, 1981; Gillikin and Graham, 1991; Flock et al., 1999; Geng et al., 2001; Bassi et al., 2004; Zhang et al., 2009 Putter and Becker, 1983; Nakamoto, and Machida, 1992

Karajanagi et al., 2004

198

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

1.4. Peroxidase mechanism The peroxidase reaction cycle is a modified bi-bi ping-pong mechanism (Scheme 1). The native form of the enzyme reduces hydrogen peroxide to water and is converted to Compound I, the active form of the enzyme (Equation 1.1), two electrons above the native form. Compound I is capable of one-electron oxidation of a reducing substrate (AH) such as phenols and aromatic amines, generating a free radical (•A) and is converted to the Compound II form of the enzyme (Equation 1.2). Compound II is capable of one-electron oxidation of another molecule of reducing substrate, generating another free radical and returning the enzyme to its native form (Equation 1.3; Dunford, 1999). Native peroxidase + H2O2 Compound I + AH Compound II + AH

Compound I + H2O

(1.1)

Compound II + •A

(1.2)

Native peroxidase + •A + H2O

(1.3)

1.4.1. Mechanism of compound I formation n the active site of the enzyme, two amino acid residues play a significant role in the transfer of oxygen atom from hydrogen peroxide to iron(III) in the formation of Compound I, histidine and arginine residues on the distal side of the heme (position 6). Distal histidine accepts a proton from the hydrogen peroxide (acid-base catalysis) while distal arginine acts as a charge stabilizer. The distal histidine and arginine feature is conserved through the plant peroxidase superfamily such as in HRP, ARP and SBP (Dunford, 1999). The distal histidine accepts a proton from the oxygen atom of un-ionized hydrogen peroxide. Formation of the Fe-OOH intermediate results from the negative charge on the peroxide and protonation of the proximal histidine that facilitates the electron flow. Heterolytic cleavage of the O-O bond leading to the formation of the ferryl group (Fe =O) is facilitated by the proton transfer from distal histidine to the departing hydroxide. This mechanism was proposed by Poulos and Dawson and was described as an electron push-pull mechanism (Dunford, 1999; Everse et al., 1991). 1.4.2. Reaction of compound I Reducing substrates such as phenols and aromatic amines act as hydrogen donors, in which a proton is accepted by a distal histidine. The electron is transferred simultaneously from the hydroxyl group (of a phenol, for example) to the neutralized porphyrin ring. As a result, Compound II concomitantly with the aromatic radical, •A. It is believed that a hydrogen bond is formed between the acidified distal group and the ferryl oxygen atom of the newly formed Compound II (Dunford, 1999; Everse et al., 1991). 1.4.3. Reaction of compound II The final step in the peroxidase mechanism involves one proton being supplied by the distal histidine residue and the other by the reducing substrate. Electron transfer from the ferryl bond reduces iron (IV) to iron (III). A new bond is formed between the ferryl oxygen and proton from the reducing substrate causing the formation of a radical, •A, that leaves the

Soybean Peroxidase Applications in Wastewater Treatment

199

active site, followed by the formation of a water molecule as a result of proton abstraction from distal histidine (Dunford, 1999; Everse et al., 1991). The enzyme is thus returned to its native state.

2. ENZYMES IN WASTEWATER TREATMENT A peroxidase-based treatment method to remove aromatic compounds from wastewater was first proposed by Klibanov and co-workers in 1980. The method employed the peroxidase from horseradish (HRP), in the presence of hydrogen peroxide, catalyzing the oxidation of over 30 different phenols and aromatic amines (Klibanov et al., 1980). During the same period, Bollag and co-workers started investigating the enzyme laccase catalyzing the oxidation of phenols by oxygen (Bollag et al., 1979; Bollag et al., 1988). Both enzymes will catalyze the oxidization of phenols and aromatic amines into aromatic radicals in the presence of hydrogen peroxide (for peroxidases) or oxygen (for laccases). Those radicals diffuse from the active site of the enzyme into solution where they couple non-enzymatically to form dimers. If the dimers are soluble and still phenolic or anilino, then they become substrates of the enzyme for another enzymatic cycle, forming higher oligomers. The cycle continues until the polymer generated reaches its solubility limit and precipitates out of solution, later to be removed by filtration or sedimentation. Other enzymes, such as Coprinus cinereus peroxidase (CiP; Kauffmann et al., 1999; Sakurai et al., 2003; Ikehata et al., 2003), Coprinus macrorhizus peroxidase (CMP; Al-Kassim et al., 1994), Arthromyces ramosus peroxidase (ARP; Ibrahim et al., 1997; Buchanan and Han, 2000; Ibrahim et al., 2001) and soybean peroxidase (SBP; McEldoon et al., 1995; Caza et al., 1999) were investigated later. This approach allows for the target-compound carbon to be captured in minimally-modified form for further use. For example, the polyphenols are potential adhesive or resin precursors, the polyanilines are conducting polymers. The enzyme-based treatment method has several advantages over other treatment methods as a result of the enzyme‘s specificity for the target pollutant, efficiency in pollutant removal, lower cost and ease of handling and storage. The advantages of enzymatic treatment over conventional biological treatment are the ability of enzyme to remove high concentrations of toxic compounds with no shock loading effects, which usually kill the microbes in biological treatment. In addition, the enzyme treatment operates over wider temperature, pH and salinity ranges. The enzyme can catalyze the removal of a broad range of compounds in the presence of other substances that are usually toxic to microbes. It is also a faster process since no delay occurs for acclimatization of biomass and there is no biomass generation, resulting in reduced sludge volume. Short contact time enables a smaller footprint on the industrial site. Enzyme-based treatment also provides a better defined system with simpler process control. The advantages of enzyme-based treatments method over physical/chemical treatments are their operation under less corrosive conditions, and removal of trace level organic compounds which are not removed by conventional chemical/physical processes. It operates with much lower consumption of oxidants and amounts of adsorbent material for disposal (Nicell, 1991; Nicell et al., 1993).

200

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Scheme 1. Proposed ping-pong mechanism for peroxidases.

3. POLLUTANTS INVESTIGATED WITH SBP Table 3 shows the phenolic and anilino compounds that have been investigated for their removal from synthetic or real industrial wastewater using SBP. Phenol has been used in industry since the 1860s first as an antiseptic and then later in the synthesis of dyes, aspirin and picric acid (explosives). Nowadays, phenol is utilized in the production of phenolic resins that are used in the plastics (such as melamine and bakelite), plywood and metal casting (as a bonding agent), construction, automotive, and appliance industries (Busca et al., 2008; TRI, 2010). Phenolic compounds are also being used in pharmaceutical products, developing agents (in photography, lithography and x-ray films), as intermediates in the production of dyes, antioxidants in rubbers, lubricating oil, as topical antiseptic reagents and antifungal preservatives (Schweigert et al., 2001; TRI 2010). Anilino compounds are commonly used as raw materials for the synthesis of dyes, polyamides and maleimides. They are employed in paints, dyestuffs, coating production, rubber compounds, synthetic fiber preparation, and in the synthesis of fungicides, pigments and corrosion inhibitors. Table 3. Compounds investigated with SBP Compound Phenol

Chlorophenols (all isomers) Cresols (all isomers) 2,4-Dichlorophenol Bisphenol A Phenylenediamines (all isomers) Benzenediols (all isomers) 2-Mercaptobenzothiazole Diaminotoluenes (two isomers) 2,4-Dimethylphenol Aniline Toluidine (all isomers)

Papers Caza et al., 1999; Flock et al., 1999; Wright and Nicell, 1999; Ghioureliotis and Nicell 1999; Kinsley and Nicell, 2000; Wilberg et al., 2002; Bassi et al., 2004; Bodalo et al., 2006; Steevensz et al.,2009 Caza et al., 1999; Flock et al., 1999; Wright and Nicell, 1999; Bassi et al., 2004 Caza et al., 1999; Wright and Nicell, 1999; Steevensz et al.,2009 Caza et al., 1999; Wright and Nicell, 1999; Kennedy et al.,2002 Caza et al., 1999; Al-Ansari et al., 2009 Dubey et al., 1998; Al-Ansari et al., 2009 Al-Ansari, 2008 Patapas et al., 2007 Dutta, 2008 Mantha et al., 2002 Mantha et al., 2002

Soybean Peroxidase Applications in Wastewater Treatment

201

Table 4. Annual disposal of phenols and anilino compounds in USA Compound investigated with SBP Phenol Chlorophenols (Mixed isomers) Cresols (Mixed isomers) 2,4-Dichlorophenol Bisphenol A Phenylenediamines (Mixed isomers) Benzenediols (Mixed isomers, except Resorcinol) 2-Mercaptobenzothiazole Diaminotoluenes (Mixed isomers) 2,4-Dimethylphenol Aniline o-Toluidine

Total, on-site and off-site disposal of United States in 2008 (pounds; US EPA TRI) 3,062,450 70,325 1,047,322 13,547 1,167,801 53,131 1,168,126 188,372 1,114 21,154 922,130 1,753

Table 5. Annual disposal of phenols and anilino compounds that can be investigated with SBP in USA Compound Trichlorophenols 2,4-Dinitrophenol 2-Phenylphenol 3,3'-Dimethylbenzidine 3,3'-Dimethyoxybenzidine 4,4'-Methylenebis (2-chloroaniline) 4-Aminoazobenzene 4-Aminobiphyenyl 4-Dimethylaminoazobenzene 2-phenylphenol 4-Nitrophenol 2-Nitrophenol Diphenylamine Benzidine 5-Nitro-o-Toluidine

Total, on-site and off-site disposal of United State in 2008 (pounds; US EPA TRI) 193 9 8,894 36 29 7911 663 7 9 8894 454 32,817 21,077 16 79

Phenols and anilines have an adverse effect on human health upon direct absorption by the skin, ingestion and inhalation exposure. They can cause severe dermatitis, urticaria, hyperreflexia, hyporeflexia, chemosis, lacrimation, exophthalmos, ophthalmia and even permanent blindness (TOXNET, 2010). They can also cause bronchial asthma, gastritis, hypertension, kidney failure, liver damage, urinary bladder infection, anemia and transudation into serious cavities, dizziness, tremors, coma and death (TOXNET, 2010). These compounds not only have effects on human health but also on animals and aquatic life. Some of these compounds, such as cresols, are considered to be possible human carcinogens. Other compounds, such as catechol and o-phenylenediamine, are classified as animal carcinogens.

202

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Table 4 gives the United States Environmental Protection Agency‘s Toxics Release Inventory (US EPA TRI) of those compounds. These amounts (and those in Tables 5 and 6) do not include air emissions and surface water discharges (US EPA TRI, 2008). The applicability of SBP treatment is not limited to the substrates mentioned in Tables 3 and 4 but also to a broad range of aromatic compounds with the functional groups -OH, -NH2 or -SH. Table 5 illustrates some of the compounds that are being released by industries according to United States Environmental Protection Agency‘s Toxics Release Inventory that are also possible substrates of SBP for treatment. Table 6 lists compounds such as nitroaromatics (NACs) and aromatic hydrocarbons (eg. BTEXs) which could also be removed by SBP after chemical pretreatment. The pretreatment methods are explained below. Nitroaromatics (NACs) are produced on a large scale for use as solvents and in the manufacture of dyes, pesticides, plastics, and explosives (Mantha, et al. 2001). NACs are highly toxic and hazardous, and some of them have been identified as human carcinogens (Higson 1992). The available data for nitrobenzene indicates that acute toxicity to saltwater aquatic life occurs at concentrations as low as 6 mg/L, while, for controlling undesirable taste and odor, the maximum allowable concentration is 30 µg/L (Mantha, et al. 2001). Their impact on the environment is augmented by their discharge in wastewater as well as their application as insecticides and herbicides (Mantha, et al. 2001). Among the NACs, nitrobenzene (NB), dinitrotoluene (mixed isomers) and dinitrobenzene (mixed isomers) are monitored by TRI (Table 6). Table 6. Annual disposal of compounds that can be investigated with SBP after pretreatment in USA Compound Nitrobenzene Dinitrotoluene (Mixed isomers) Dinitrobenzene (Mixed isomers) Benzene Ethylbenzene Toluene Xylene (Mixed isomers) PCBs PAHs

Total, on-site and off-site disposal of United State in 2008 (pounds; US EPA TRI) 459,465 6,789 7,849 596,368 948,138 2,170,431 1,709,785 4,128,512 849,175

―BTEX‖ represents a group of volatile organic compounds (VOCs) comprised of benzene, toluene, ethylbenzene and xylenes. These EPA priority pollutants frequently cooccur at hazardous waste sites and can contaminate air, water, and soil (U.S. Department of Health and Human Services 2004). Contamination occurs as a result of incomplete combustion of fossil fuels, leakage in pipelines and underground storage, oil spills and as byproducts of petroleum refining and other industrial processing (Nadarajah, et al. 2002). Generally, these chemicals are carcinogenic, mutagenic to humans and other animals, and are capable of bio-accumulation in the food chain (U.S. Department of Health and Human Services 2004). The total on- and off-site disposals of these pollutants are monitored by TRI, and their totals for 2008 are listed in Table 6. Polycyclic aromatic hydrocarbon (PAHs; Table

Soybean Peroxidase Applications in Wastewater Treatment

203

6), polychlorinated biphenyls (PCBs; Table 6), polybrominated biphenyls (PBBs), polychlorinated dibenzofurans (PCDFs) and polychlorinated dibenzo-p-dioxins (PCDDs) could also be substrates of SBP after analogous pre-treatment.

4. FACTORS INFLUENCING SBP EFFECTIVENESS IN WASTEWATER TREATMENT 4.1. Optimum pH Optimum pH is defined as the pH at which an enzyme possesses maximum catalytic activity. The pH-dependence of SBP‘s catalytic activity suggests that acid-base catalysis plays a significant role in the enzymatic reaction. There are key amino acid residues at the active site of SBP, which are involved in the catalysis, as noted above. The protonation state of the residues affects the catalytic efficiency. The distal histidine (His42) must be in a deprotonated form in order to act as a catalytic base, while an arginine (Arg38) must be in a protonated form in order to function as a charge stabilizer. Thus, the optimum pH equals a value that optimally satisfies both amino acids‘ ionization state requirements. The pH can also affect the three-dimensional structure of SBP by disturbing the pH-dependent forces that stabilize the protein‘s tertiary structure such as salt bridges and hydrogen bonds. An optimum pH ensures that the enzyme exists in its best conformational state for catalysis (Henriksen et al., 2001; Kamal and Behere, 2002). Table 7. Optimum pH for the removal of the phenolic compounds using SBP Aromatic Compounds Phenol

o-Chlorophenol m-Chlorophenol p-Chlorophenol o-Cresol m-Cresol p-Cresol Bisphenol A 2,4-Dichlorophenol Catechol Resorcinol Hydroquinone 2,4-Dimethylphenol 2-Mercaptobenzothiazole

Optimum pH 7.0 6.0 7.0 6.0 7.5 5.0 8.0 7.0 7.0 7.0 6.5 7.0 8.2 6.5-7.5 7.5-8.25 4.0-6.5 8.0 8.0–9.0

Paper Bodalo et al., 2006 Wright and Nicell, 1999 Bassi et al., 2004 Caza et al., 1999 Caza et al., 1999

Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Kennedy et al.,2002 Al-Ansari et al., 2009

Dutta, 2008 Al-Ansari, 2008

Choice of the optimum pH is based on the highest percent conversion of a substrate by SBP, taking into consideration that at this pH, the substrate has the lowest reactivity to non-

204

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

productive chemical transformations. Optimum pH is usually determined under ‗stringent‘ conditions with respect to SBP concentration (insufficient SBP to effect complete conversion) in order to provide easier discerning of the optimum. Table 8. Optimum pH for the removal of the anilino compounds using SBP Aromatic Compound o-Phenylenediamine m-Phenylenediamine p-Phenylenediamine 2,4-Diaminotoluenes 2,6-Diaminotoluenes Aniline o-Toluidine m- Toluidine p- Toluidine

Optimum pH 4.5-5.2 5.4 5.6 5.2 5.2 5.5-8.0 5.5-8.0 5.5-8.0 5.5-8.0

Paper Al-Ansari et al., 2009

Patapas et al., 2007 Mantha et al., 2002

The optimum pH range for SBP-catalyzed conversion of phenolic compounds (Table 7) was found 6.0-8.2, except for hydroquinone (broad optimum of 4.0-6.5), m-chlorophenol (optimum of pH 5.0) and the thiol aromatic, 2-mercaptobenzothiazole (8.0 to 9.0). Anilino compounds, on the other hand, show mildly acidic pH optima, 4.5-5.6, except for aniline and the toluidines (o-, m- and p-) that show broad pH optima, 5.5-8.0 (Table 8). Several conclusions can be drawn from various pH studies with SBP: (1) the optimum pH does not only depend on the proper ionization of the catalytic residues of SBP in the enzymatic reaction but also on the kind of the aromatic substrate (Caza et al., 1999 ; Al-Ansari et al., 2009). (2) SBP can tolerate an acidic region better than a basic region. This may result from an improper ionization of catalytic residues of the enzyme at higher pH, resulting in SBP denaturation (Kennedy et al., 2002; Patapas et al., 2007; Al-Ansari et al., 2009). (3) As SBP concentrations are increased above the respective stringent conditions to reach 95% conversion of the substrate, the enzyme becomes less sensitive to the pH changes. This can be of a great convenience for the application of SBP in a variety of waste streams, compared to other enzymes that require a specific pH such as laccase, since no prior pH adjustment of a real wastewater might be needed of SBP (Caza et al., 1999; Kennedy et al., 2002; Bodalo et al., 2006; Steevensz et al., 2009).

4.2. Optimum Hydrogen Peroxide-to-Substrate Concentration Ratio According to the peroxidase reaction mechanism, for every mole of hydrogen peroxide being consumed, two moles of the aromatic functional groups are converted to free radicals that couple non-enzymatically to form dimers and, through subsequent enzyme cycles, to form larger polymers. Thus, in the limit of an infinite polymer, a peroxide:phenol stoichiometry of 1.0 would be expected (Yu et al., 1994). The hydrogen peroxide demand for a selection of phenolic and anilino compounds (Table 9) was generally more than what is expected theoretically. This could be explained if a portion of the hydrogen peroxide available for reaction was converted to water molecules by low-level catalase activity of the

Soybean Peroxidase Applications in Wastewater Treatment

205

peroxidase, resulting in an increase in the observed hydrogen peroxide optimum concentration (Dunford, 1999).As the hydrogen peroxide to substrate ratio increased beyond the optimum, phenolic compounds demonstrated a greater decrease in conversion compared to anilino compounds (Patapas et al., 2007; Al-Ansari et al., 2009). Generally, peroxidases get deactivated as hydrogen peroxide concentration increases beyond the optimum. This phenomenon will be explained later in the chapter. Certain compounds, such as bisphenol A, diaminotoluenes and 2-MBT, showed no enzyme deactivation as the concentration of hydrogen peroxide was increased above the optimum (Caza et al., 1999; Patapas et al., 2007; Al-Ansari, 2008).

Table 9. Optimum [H2O2] to [substrate] ratio for the removal of the compounds using SBP Aromatic Compounds (1.0 mM) Phenol o-Chlorophenol m-Chlorophenol p-Chlorophenol o-Cresol m-Cresol p-Cresol Bisphenol A (0.5 mM) 2,4-Dichlorophenol Catechol Resorcinol Hydroquinone 2,4-Dimethylphenol 2-Mercaptobenzothiazole Aniline o-Toluidine m- Toluidine p- Toluidine o-Phenylenediamine m-Phenylenediamine p-Phenylenediamine 2,4-Diaminotoluenes 2,6-Diaminotoluenes

Optimum [H2O2] to [substrate] ratio 1.5 1.2 0.8 0.6 0.8 0.9 1.0 0.9 1.2 0.7 2.5 2.0 1.5 0.9-1.2 0.6 1.5 1.5 1.5 1.5 1.5 2.0 1.5 2.0 3.0

SBP form Crude Medium purity Medium purity

Medium purity

Medium purity Medium purity Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude

Paper Steevensz et al.,2009 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Dutta, 2008 Al-Ansari, 2008 Mantha et al., 2002 Mantha et al., 2002 Mantha et al., 2002 Mantha et al., 2002 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Patapas et al., 2007 Patapas et al., 2007

4.3. Minimum SBP Concentrations Required for the Treatment The cost of enzyme in an enzymatic treatment can be a limiting factor in the application to real wastewater (Steevensz et al., 2009). Therefore, determining the minimum SBP

206

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

concentration needed under otherwise optimum conditions is important (Table 10). The anilino compounds required less SBP than the phenolics for 95% conversion. Table 10. Minimum SBP concentration

Aromatic Compounds (1.0 mM) Phenol o-Chlorophenol m-Chlorophenol p-Chlorophenol o-Cresol m-Cresol p-Cresol Bisphenol A (0.5 mM) 2,4-Dichlorophenol Catechol Resorcinol Hydroquinone 2,4-Dimethylphenol 2-Mercaptobenzothiazole Aniline o-Toluidine m- Toluidine p- Toluidine o-Phenylenediamine m-Phenylenediamine p-Phenylenediamine 2,4-Diaminotoluenes 2,6-Diaminotoluenes

Minimum SBP concentration require for the 95% conversion of the substrate (U/mL) 1.25 0.9 0.23 0.65 0.2 0.6 0.75 0.6 0.9 0.08 0.025 0.2 0.005 0.3 0.9 0.2 0.23 0.10 0.01 0.002 0.01 0.005 0.01 0.1

SBP form Crude Medium purity Medium purity

Medium purity

Medium purity Medium purity Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude Crude

Paper Steevensz et al.,2009 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Caza et al., 1999 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Dutta, 2008 Al-Ansari, 2008 Mantha et al., 2002 Mantha et al., 2002 Mantha et al., 2002 Mantha et al., 2002 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Al-Ansari et al., 2009 Patapas et al., 2007 Patapas et al., 2007

The meta-substituted phenols and anilines exhibit the highest SBP demand when compared to the ortha and para-substituted isomers (except for the toluidines). It has been proposed that radical reactivities play an important role in enzyme deactivation. Phenoxyl radical is more reactive than aniline radical which accounts for the higher SBP requirement for phenolic compounds and the corresponding meta-substituted parent radicals for those compounds are much less stabilized, leading to a higher enzyme requirement than the o- and p-isomers (Al-Ansari et al., 2009).

4.4. Reaction Time Reaction time is one of the main parameters which determine the economics of any reactor. Under the optimum conditions of pH, SBP concentration and hydrogen peroxide

Soybean Peroxidase Applications in Wastewater Treatment

207

concentration, phenolic and anilino compounds required less than 3 h for complete removal (Flock et al., 1999; Wilberg et al., 2002; Mantha et al., 2002; Al-Ansari et al., 2009; Steevensz et al., 2009). SBP has been found to have a higher rate of conversion of phenols compared with laccase; however, SBP is inactivated faster than laccase (Steevensz et al., 2009). Comparing SBP with HRP, SBP is catalytically slower than HRP but SBP is less susceptible to inactivation than HRP (Nicell and Wright, 1997; Badalo et al., 2006).

5. SBP ADVANTAGES SBP is a better alternative for enzymatic treatment than other enzymes for several reasons: (1) SBP is cheaper certainly than HRP and laccase, and possibly the microbial peroxidases, since it is extracted from the soybean seed coats that are themselves a low-value byproduct of the soybean processing industry (Wilberg et al., 2002). In addition, SBP is easy to isolate and it does not require purification since a crude SBP seed-hull extract has been found to be more efficient than the purified one (Flock et al., 1999; as are crude preparations of the other peroxidases cited above). (2) SBP is catalytically active over a broad range of pH, 3.0 to 9.0 (Kamal and Behere, 2002; Wright and Nicell, 1999; Caza et al., 1999; Patapas et al., 2007; Al-Ansari et al., 2009). (3) SBP has a higher thermal stability (being active at 70ºC) than other peroxidases (McEldoon and Dordick, 1996). (4) SBP is less susceptible to irreversible inactivation by hydrogen peroxide compared to HRP and ARP (Wright and Nicell, 1999; Patapas et al., 2007).

6. SBP LIMITATIONS Peroxidase inactivation represents one of the drawbacks in enzyme application. There are three possible pathways by which the enzyme is deactivated. First, permanent inactivation can be due to the free radicals generated during the catalytic process. The free radicals can return to the active site of the enzyme and form a covalent bond that prevents further substrate molecules from accessing the active site due to proximity (Klibanov et al., 1983; Ortiz de Montellano et al., 1988). Second, inactivation can be due to end-product polymers formed during the catalytic process (Nakamoto and Machida, 1992). It has been proposed that the polymeric product particles can adsorb the enzyme and co-precipitate it, resulting in a lower concentration of soluble enzyme. Third, inactivation can be due to excess hydrogen peroxide (Arnao et al., 1990; Baynton et al., 1994; Dunford, 1999). Thus, in the presence of excess hydrogen peroxide or when reducing substrate concentrations are low, Compound II is oxidized to Compound III which is catalytically inactive but its formation does not represent a terminal inactivation since it can slowly decompose back to the native form of the enzyme (Equations 1.4 and 1.5). Compound II + H2O2 Compound III

Compound III + H2O Native peroxidase + O2- + H+

(1.4) (1.5)

208

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Compound III + AH

Compound I + •A

(1.6)

Compound I + H2O2

Native peroxidase + O2 + H2O

(1.7)

Compound I + H2O2

P-670

(1.8)

Compound III can also be reduced though a one-electron reduction to Compound I generating a radical from which the Compound I can be oxidized back to the native enzyme or, though a series of reactions, to the terminally inactive verdohemoprotein referred to as P670 (due to the shift in absorbance from 405 nm to 670 nm) (Equations 1.6-1.8).

7. ENHANCING SBP EFFECTIVENESS This section discuses different approaches that can be utilized in order to improve effectiveness of SBP. These are taken to minimize peroxidase inactivation and increase the catalytic life such as using step addition of hydrogen peroxide and/or SBP, plus the use of polymeric additives or surfactants.

7.1. Step Addition Step feeding of hydrogen peroxide has been used to keep the instantaneous radical concentration low. This approach can reduce the possible chance of SBP inactivation by excessive hydrogen peroxide (Wu et al., 1994; Ibrahim et al., 2001; Kennedy et al., 2002; Bassi et al., 2004). In a 2,4-dichlorophenol reaction, the most effective addition scheme was based on addition of both hydrogen peroxide and SBP in steps (five equal concentrations of SBP and H2O2 over 15 min and 30 min intervals, respectively) rather than single batch addition or step feeding of hydrogen peroxide (Kennedy et al., 2002).

7.2. Additives Additives such as polyethylene glycol (PEG), gelatin and various water-treatment polyelectrolytes have been found effective in reducing SBP inactivation (Wu et al., 1997). Most of the additives studied have been found to be effective in reducing the peroxide inactivation, with PEG being found to be better than other additives in terms of the practical additive dose range. It has no negative effect on the efficiency of the removal reaction, can easily be separated from solution as precipitate with the enzymatic products formed, is nontoxic and cheaper (Nakamoto and Machida, 1992; Harris, 1992; Wu et al., 1997; Wu et al., 1998). The exact mechanism by which PEG protects the enzyme is not fully understood but it is believed to follow the ―sacrificial polymer‖ theory: it either prevents the free radicals generated during the catalytic process from covalently binding to the active site or it prevents adsorption of the enzyme onto the polymeric products (Nakamoto and Machida, 1992). PEG effectiveness in the protection of enzyme has been observed with various peroxidases such as

Soybean Peroxidase Applications in Wastewater Treatment

209

HRP, ARP, SBP and other enzymes such as laccase. PEG protection efficiency varies depending on the concentration and average molecular mass of PEG. PEG of an average molecular mass of 1000 g/mole or less is inefficient in protecting the SBP from inactivation. As the molecular mass increases (above 1500 g/mole) and concentration increases, the efficiency also increases (Kinsley and Nicell, 2000; Kennedy et al., 2002). PEG of molecular mass of 35,000 g/mole was found to be the most effective for the treatment of phenol using SBP. A linear relationship was found between the initial phenol concentrations and the optimal SBP concentration for the 95% conversion (1.35 U/mL/mM without PEG and 0.32 U/mL/mM with PEG35,000). A linear relation was also found between the minimum PEG concentration and the initial phenol concentration (35.2 mg/L/mM). In that case, it was observed that approximately three-quarters of the optimum PEG concentration precipitates with the phenolic polymer solids (Kinsley and Nicell, 2000). Table 11 shows the effect of PEG3350 in reducing the minimum requirement of SBP for the removal of phenolic, thiol and anilino compounds. PEG protection efficiency also depends on the enzyme used in the treatment and the aromatic substrate being treated (Nakamoto and Machida, 1992). PEG3350 showed an insignificant effect on the conversion of aryldiols and aniline compounds as shown in Table 11.

7.3. Surfactants Surfactants such as Tritons (X-100 or X-405), sodium dodecyl sulfate (SDS), Tween 20, NP-20, Span 20, lauryl trimethylammonium bromide (DTAB) and a rhamnolipid have the ability to suppress enzyme deactivation and increase the activity of enzymes such as SBP, HRP, CiP and polyphenol oxidase (Flock et al., 1999; Tonegawa et al., 2003; Jimenez and Garcia-Carmona, 1996; Sakurai et al. 2003; Al-Ansari et al., 2010 submitted for publication). It has been suggested that surfactants prevent the adsorption of the enzyme onto the products and also resolubilize the adsorbed enzyme (Sakurai et al. 2003; Tonegawa et al., 2003). It was also noted that micelle formation did not likely affect the removal of substrates since the effective surfactant concentrations were below the critical micelle concentrations (CMC; Sakurai et al. 2003; Tonegawa et al., 2003; Al-Ansari et al., 2010 submitted for publication).

7.4. Immobilization of SBP In recent years, SBP has been tested for its stability and removal of phenols when it is immobilized on hybrid (silica sol-gel/alginate) particles (Trivedi et al., 2006), aldehyde glass beads (Gomez et al., 2006; Badalo et al., 2008; Gomez et al., 2008; Gomez et al., 2009) and single-walled carbon nanotubes (SWNTs; Karajanagi et al., 2004; Dordick et al., 2007). In a continuous-flow reactor, immobilizing the enzyme on a solid support could provide many advantages such as enzyme reuse, easy separation from the reaction medium, control of product formation and higher enzyme stability (Tatsumi et al., 1996; Siddique et al., 1993; Gomez et al., 2009). Little work has been done on immobilizing SBP. However, various materials have been investigated for HRP immobilization such as glass beads (Tatsumi et al., 1996; Rojas-Melgarejo et al., 2004; Pundir et al., 1999; Azevedo et al., 2004; Singh and Singh, 2002; lai and lin, 2005), polymers (Siddique et al., 1993; Shukla and Devi, 2005;

210

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Fernandes et al., 2003; Fernandes et al., 2004; Caramori and Fernandes, 2004), ion exchange resins (Peralta-Zamora et al., 1998) and magnetite(Tatsumi et al., 1996).

Phenol 0.9 0.6 33 50 o-Chlorophenol 0.23 0.19 17 40 m-Chlorophenol 0.65 0.15 77 75 p-Chlorophenol 0.2 0.15 25 30 o-Cresol 0.6 0.08 87 400 m-Cresol 0.75 0.08 89 150 p-Cresol 0.6 0.4 33 20-40 2,4-Dichlorophenol 0.08 0.04 50 150 Bisphenol A (0.5 mM) 0.9 0.015 98 60 Catechol 0.025 Insignificant Insignificant Resorcinol 0.2 Insignificant Insignificant Hydroquinone 0.005 Insignificant Insignificant 2,4-Dimethylphenol 0.3 0.1 67 45-50 2-Mercapto0.9 0.3 67 50 benzothiazole 2,4-Diaminotoluenes 0.01 Insignificant Insignificant 2,6-Diaminotoluenes 0.1 Insignificant Insignificant o-Phenylenediamine 0.002 Insignificant Insignificant m-Phenylenediamine 0.01 Insignificant Insignificant p-Phenylenediamine 0.005 Insignificant Insignificant * minimum SBPconcentration required for >95% conversion of 1.0 mM substrate.

Paper

Minimum PEG Concentration (mg/L)

PEG effect (%)

Minimum SBP required in the presence of PEG3350 (U/mL)

Minimum SBP required in the absence of PEG (U/mL)

Aromatic Compound (1mM)

Table 11. PEG3350 effect

Caza et al., 1999

Al-Ansari et al., 2009 Dutta, 2008 Al-Ansari, 2008 Patapas et al., 2007 Al-Ansari et al., 2009

8. SBP IN TREATMENT OF INDUSTRIAL WASTEWATER The majority of enzymatic treatment research has been done using synthetic wastewater; little has been done on real industrial wastewater matrices. Previous work with refinery samples has shown the applicability of SBP and laccase in removing 95% of approximately 1.0 mM phenol. (Steevensz et al., 2009). The optimum enzyme concentration for a 3 h reaction period with refinery samples demonstrated a higher SBP demand than for synthetic wastewater. This higher demand could be reduced by pretreatment with hydrogen peroxide in order to reduce enzyme and hydrogen peroxide demands during the enzymatic treatment. Hydrogen peroxide was added to those samples until no further consumption of the oxidant occurred (Steevensz et al., 2009). A recent study has reported the applicability of SBP to remove even higher phenol concentrations. The study shows that more than 95% of 15 mM

Soybean Peroxidase Applications in Wastewater Treatment

211

phenols from coal-tar wastewater was successfully removed (Al-Ansari et al., 2010 submitted for publication).

9. REMOVAL OF POLYMERIC PRODUCTS The enzymatic treatment uses peroxidases in the presence of hydrogen peroxide to form phenoxyl or arylamine radicals. These radicals are coupled to form dimers and then polymers. The dimers and polymers formed can be substrates for the enzyme for subsequent enzymatic cycles as long as they do not exceed their solubility limit. In that case, they precipitate out and can be separated by filtration or sedimentation. It is suspected that color arises from quinonelike products, whether of monomers or polymers remaining in solution. Therefore, removing the colored soluble products is important, especially when applied to real samples. Different flocculation and coagulation agents have been used for such purpose. Hydrolysing coagulants such as aluminum sulfate (alum), poly-aluminum chloride (PAC), ferric sulfate and ferric chloride are used extensively as coagulants in wastewater treatment. They play a fundamental role in removing a wide range of impurities from contaminated water such as colloidal particles, natural organic matter (NOM) and dissolved organic substances (DOC) (Duan and Gregory, 2003; Glaser and Edzwald, 1979; Bolto et al., 1999; Elibeck and Mattock, 1987; Bolto et al., 1996) Previous research has shown that polymeric colored products resulting from the ARP, laccase and SBP-catalyzed polymerization of various phenols could be removed by using alum (Ibrahim et al., 2001; Bollag et al., 1988; Steevensz et al., 2009; Al-Ansari et al., 2009). In aqueous solution, when the aluminum salt is dissolved, the metal ions (Al3+) are hydrolysed to form an aluminum hydroxide gel-like amorphous structure at mildly alkaline pH. The resulting gel-like structure has large surface area and positive charges (Dominquez et al., 2007). The partially negative polymers from the enzymatic reaction can be adsorbed into the gel and be removed with the gel by filtration or sedimentation. Surfactant-mediated separation methods have been used in water treatment as a means of removal of organic species in solution, such as hemimicellar/admicellar systems, micelle enhanced ultrafiltration (MEUF), cloud point separation (phase change) and the most recently, adsorptive micellar flocculation (AMF). AMF has advantages over other methods in terms of cost, lower energy and lower pressure requirements. AMF is a two-step process, by which Al3+ or Fe3+ adsorbs onto an anionic surfactant micelle such as sodium dodecyl sulfate (SDS) (Figure 1.6) or α-olefin sulfonate. Upon binding, Al3+ or Fe3+ neutralizes the electrostatic repulsion between the negatively charged micelles causing the formation of an Al-SDS amorphous aggregate which flocculates and can be easily filtered (Paton and Talens, 1998). Other studies in this lab have used SDS after the enzymatic reaction is completed to remove the polymeric (colored) products. One study reported the removal of the SBPgenerated polymeric products from phenylenediamines with the aid of SDS alone (Al-Ansari et al., 2009). Other studies reported the removal of the polymeric colored products resulting from ARP- and SBP-catalyzed polymerization of diaminotoluenes and laccase-catalyzed polymerization of diphenylamine using SDS with alum via adsorptive micellar flocculation (Patapas, 2007; Saha et al., 2008). It was inferred that the polymer products partitioned into the micelles in both cases. In the case of phenylenediamines‘ polymeric colored products (Al-

212

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

Ansari et al., 2009), the mixed micelle complexes aggregated and settled on their own. In the case of diaminotoluenes‘ and diphenylamine‘s polymeric colored products (Patapas, 2007; Saha et al., 2008), alum was needed to aggregate the micelles (AMF) in order to settle.

10. PRETREATMENT Peroxidase-catalyzed coupling is an effective strategy for removal of phenols and anilines from water. However, nitroaromatics and BTEXs are outside the scope of peroxidase catalysis without appropriate pretreatment.

10.1. Pretreatment of Nitroaromatics Using Zero-Valent Iron A pretreatment method has been proposed for removal of nitoaromatics and azoaromatics using a two-step process. The first step is zero-valent iron reduction of each nitro (or azo-) group on the substrate into an amino group, specifically an anilino group (Equation 1 to 3). The second step is SBP-catalyzed oxidative coupling to completely remove the anilines thus generated in the first step (Mantha et al., 2002; Patapas et al., 2007). R-NO2 + Fe0 + 2H+→ R-NO + Fe2+ + H2O

(Equation 1)

R-NO + Fe0 + 2H+→ R-NHOH + Fe2+

(Equation 2)

R-NHOH+ Fe0 + 2H+→ R-NH2 + Fe2+ + H2O

(Equation 3)

R-NO2 + 3Fe0 + 6H+ → R-NH2 + 3Fe2+ + 2H2O

(net Equation)

Due to the zero-valent iron reaction as the pre-treatment process, the incoming reaction mixture to the enzymatic reaction contains Fe+2 and sodium sulfite. These are known to interfere with enzymatic treatment (Mantha, et al. 2001) and must be removed before using SBP. The reaction mixtures can be aerated to precipitate the divalent iron as Fe+3 and to convert sodium sulfite (Na2SO3) to sodium sulfate (Na2SO4). During this aeration period, volatilization of aminoaromatic from the reaction mixture was negligible (Mantha et al., 2002; Patapas et al., 2007).

10.2. Pretreatment of BTEX’s Using Limited Fenton Reaction BTEXs are outside the scope of peroxidase catalysis as well. If the Fenton reaction is chosen as a pretreatment method, then it must be controlled to cause partial oxidation of the BTEXs (Zeng et al., 2000). Such control could result in generation of the corresponding phenols (Xu, et al. 1995). The hydroxy-aromatics are more water-soluble than the initial aromatics (Zeng, et al. 2000). Thus, the strategy is that a brief chemical oxidation process will

Soybean Peroxidase Applications in Wastewater Treatment

213

convert the BTEXs to the corresponding phenolic compounds which can be removed by enzymatic treatment (Xu, et al. 1995). In Fenton chemistry, the oxidation of Fe(II) to Fe(III) and formation of hydroxyl radical proceeds through a redox cycle, Equations 6-11. Xu et al., 1995, first attempted to remove one of the BTEXs, benzene, by using this two-step method where the Fenton reaction was used as a pre-treatment to convert benzene into phenols, and subsequently their removal by oxidative polymerization using HRP (Xu et al., 1995). The reaction of hydroxyl radical with an aromatic compound is a complex process. Fe2+ + H2O2 → Fe3+ + OH• + OH-

(Equation 6)

Fe3+ + H2O2 → Fe2+ + HO2• + H+

(Equation 7)

OH• + H2O2 → H2O + OH2•

(Equation 8)

OH2• + Fe3+→ Fe2+ + H+ + O2

(Equation 9)

OH2• + Fe2+→ Fe3+ + HO2-

(Equation 10)

Fe2+ + OH• → Fe3+ + HO-

(Equation 11)

The findings of Xu, et al. (1995), inspired our research group to investigate removal of two of the BTEX compounds benzene (Saha, et al. 2010) and toluene (Modaressi, et al. unpublished work) by emplyoing limited Fenton reaction combined with SBP-catalyzed polymerization. We found that SBP was successful in removing the phenolic compounds generated from the limited Fenton reaction on benzene and toluene.

CONCLUSION The potential of soybean peroxidase as a biocatalyst for use in isolation is now extended to the treatment of industrial wastewater. With its availability in enormous quantity from a byproduct of commodity processing of the world‘s largest seed crop, SBP-based treatment of selected aromatics in industrial wastewater provides a cost-effective alternative to conventional biological, chemical and physical treatments. The enzyme is effective as a crude extract and the process leads to the capture of waste-constituent carbon in a re-usable form.

REFERENCES [1] [2]

Aitken, MD; Irvine, RL. Stability testing of ligninase and Mn-peroxidase from Phanerochaete chrysosporium. Biotechnology & Bioengineering, 1989, 34, 1251-1260. Al-Ansari, MM; Modaressi, K; Taylor, KE; Bewtra, JK; Biswas, N. Soybean peroxidase-catalyzed oxidative polymerization of phenols in coal-tar wastewater:

214

[3] [4] [5]

[6] [7] [8] [9] [10]

[11] [12] [13] [14] [15] [16] [17]

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al. Comparison of additives in enhancing the treatment. Submitted to Environmental Engineering Science, 2010. Al-Ansari, MM. Removal of various aromatic compounds from synthetic and refinery wastewater using soybean peroxidase. 2008 (M.Sc. thesis, University of Windsor, Windsor, ON.). Al-Ansari, MM; Steevensz, A; Al-Aasm, N; Taylor, KE; Bewtra, JK; Biswas, N. Soybean peroxidase-catalyzed removal of phenylenediamines and benzenediols from water. Enzyme and Microbial Technology, 2009, 45, 253-260. Al-Kassim, L; Taylor, KE; Nicell, JA; Bewtra, JK; Biswas, N. Enzymatic removal of selected aromatic contaminants from wastewater by a fungal peroxidase from Coprinus macrorhizus in batch reactors. Journal of Chemical Technology and Biotechnology, 1994, 61, 179-182. Arnao, MB; Acosta, M; Del- Rio, JA; Varon, R; Garcia-Canovas, F. A kinetic study on the suicide inactivation of peroxidase by hydrogen peroxide. Biochimica et Biophysica Acta, 1990, 1041, 43-47. Azevedo, AM; Vojinovic, V; Cabral, JMS; Gibson, TD; Fonseca, LP. Operational stability of immobilized horseradish peroxidase in mini-packed bed bioreactors. Journal of Molecular Catalysis B: Enzymatic, 2004, 28, 121-128. Bassi, A; Geng, Z; Gijzen, M. Enzymatic removal of phenol and chlorophenols using soybean seed hulls. Engineering Life Science, 2004, 4, 125- 130. Baynton, KT; Bewtra, JK; Biswas, N; Taylor, KE. Inactivation of horseradish peroxidase by phenol and hydrogen peroxide: a kinetic investigation. Biochimica et Biophysica Acta, 1994, 1206, 272-278. Bodalo, A; Bastida, J; Maximo, MF; Montiel, MC; Gomez, M; Murcia, MD. A comparative study of free and immobilized soybean and horseradish peroxidases for 4chlorophenol removal: protective effects of immobilization. Bioprocess and Biosystems Engineering, 2008, 31, 587-593. Bodalo, A; Gomez, JL; Gomez, E; Bastida, J; Maximo, MF. Comparison of commercial peroxidases for removing phenol from water solutions. Chemosphere, 2006, 63, 626632. Bollag, JM; Shuttleworth, KL; Anderson, DH. Laccase-mediated detoxification of phenolic compounds. Applied and Environmental Microbiology, 1988, 54, 3086-3091. Bollag, JM; Sjoblad, RD; Liu, SY. Characterization of an enzyme from Rhizoctionia praticola which polymerizes phenolic compounds. Canadian Journal of Microbiology, 1979, 24, 229-233. Bolto, B; Abbt-Braun, G; Dixon, D; Eldridge, R; Frimmel, F; Hesse, S; King, S; Toifl, M. Experimental evaluation of cationic polyelectrolytes for removing natural organic matter from water. Water Science Technology, 1999, 40(9), 71-79. Bolto, BA; Dixon, D; Gray, SR. Soluble organic in water and wastewater treatment; Plenum Press Inc., New York, 1996, 9-33. Buchanan, ID; Han, YS. Assessment of the potential of Arthromyces ramosus peroxidase to remove phenol from industrial wastewaters. Environmental Technology, 2000, 21, 545-552. Busca, G; Berardinelli, S; Resini C; Arrighi, L. Technologies for the removal of phenol from fluid streams: a short review of recent developments, Journal of Hazardous Materials, 2008, 160, 265-288.

Soybean Peroxidase Applications in Wastewater Treatment

215

[18] Buttery, BR; Buzzell, RI. Peroxidase activity in the seeds of soybean varieties. Crop Science, 1968, 8, 722-725. [19] Caramori, SS; Fernandes, KF. Covalent immobilisation of horseradish peroxidase onto poly (ethylene terephtalate)-poly (aniline) composite, Process Biochemistry, 2004, 39, 883-888. [20] Caza, N; Bewtra, JK; Biswas, N; Taylor, KE. Removal of phenolic compounds from synthetic wastewater using soybean peroxidase. Water Research, 1999, 33, 3012-3018. [21] Chance, B; Maehly, SK. Assay of catalase and peroxidases. In: Colwick SP, Kaplan NO editors. Methods in Enzymology. New York: Acdemic Press, 1955, 2, 764-775. [22] Dhaubhadel, S; Kuflu, K; Romero, MC; Gijzen, M. A soybean seed protein with carboxylate-binding activity. Journal of Experimental Botany, 2005, 56, 2335-2344. [23] Dominquez, JR.; Gonzalez, T; Garcia, HM.; Sanchez-Lavado, F; Heredia, JB. Aluminum sulfate as coagulant for highly polluted cork processing wastewater: Removal of organic matter. Journal of Hazardous Materials, 2007, 148, 15-21. [24] Dordick, JS; Kane, RS; Asuri, P; Karajanagi, SS. Enhanced stability of proteins immobilized on nanoparticals. PCT International Application, 2007, 33. [25] Duan, J; Gregory, J. Coagulation by hydrolyzing metal salts. Advances in Colloid and Interface Science, 2003, 100-102, 475-502. [26] Dubey, S; Singh, D; Misra, RA. Enzymatic synthesis and various properties of poly(catechol). Enzyme and Microbial Technology, 1988, 23, 432-437. [27] Dunford, HB. Heme Peroxidases. New York: John Wiley & Sons; 1999, 1-36, 270-319, 414-454. [28] Dutta, R. Soybean peroxidase catalyzed polymerization and removal of 2.4dimethylphenol from synthetic wastewater. 2008 (M.A.Sc. thesis, University of Windsor, Windsor, ON.). [29] Elibeck, WJ; Mattock, G. Chemical Process in waste water treatment. New York: John Wiley and Sons Inc.; 1987, 11-39, 232-293. [30] Everse, J; Everse, KE; Grisham, MB. Peroxidases in Chemistry and Biology. Vol. II. Boca Raton FL : CRC Press, Inc., 1991, 1-50, 139-154, 219-238. [31] Fernandes, KF; Lima, CS; Lopes, FM; Collins, CH. Properties of horseradish peroxidase immobilised onto polyaniline. Process Biochemistry, 2004, 39, 957-962. [32] Fernandes, KF; Lima, CS; Pinho, H; Collins, CH. Immobilization of horseradish peroxidase onto polyaniline polymers. Process Biochemistry, 2003, 38, 1379-1384. [33] Fersht, A. Enzyme Structure and Mechanism. 2nd edition. San Francisco: W H Freeman & Co., 1977, 1-271. [34] Filizola, M; Loew, GH. Role of protein environment in horseradish peroxidase compound I formation: Molecular dynamics simulations of horseradish peroxidaseHOOH complex. Journal of the American Chemical Society, 2000, 122, 18-25. [35] Flock, C; Bassi, A; Gijzen, M. Removal of aqueous phenol and 2-chlorophenol with purified soybean peroxidase and raw soybean hulls. Journal of Chemical Technology and Biotechnology, 1999, 74, 303-309. [36] Geng, Z; Rao, J; Bassi, AS; Gijzen, M; Krishnamoorthy, N. Investigation of biocatalytic properties of soybean seed hull peroxidase. Catalysis Today, 2001, 64, 233-238.

216

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

[37] Ghioureliotis, M; Nicell, JA. Assessment of soluble products of peroxidase-catalyzed polymerization of aqueous phenol. Enzyme and Microbial Technology, 1999, 25, 185193. [38] Gijzen, M. A deletion mutation at the ep locus causes low seed coat peroxidase activity in soybean. The Plant Journal, 1997, 12, 991-998. [39] Gijzen, M; Huystee, R; Buzzell, R. Soybean seed coat peroxidase: a comparison of high-activity and low activity genotypes. Plant Physiology, 1993, 103, 1061-1066. [40] Gijzen, M; Kuflu, K; Qutob, D; Chernys, JT. A class I chitinase from soybean seed coat. Journal of Experimental Botany, 2001, 52, 2283-2289. [41] Gijzen, M; Miller, SS; Kuflu, K; Buzzell, RI; Miki, BLA. Hydrophobic protein synthesized in the pod endocarp adheres to the seed surface. Plant Physiology, 1999, 120, 951-959. [42] Gillikin, JW; Graham, JS. Purification and developmental analysis of the major anionic peroxidase from the seed coat of glycine max. Plant Physiology, 1991, 96, 214-220. [43] Glaser, HT; Edzwald, JK. Coagulation and direct filtration of humic substances with polyethyleneimine. Environmental Science and Technology, 1979, 13, 299-305. [44] Gomez, JL; Bodalo, A; Gomez, E; Bastida, J; Hidalgo, AM; Gomez, M. Immobilization of peroxidases on glass beads: an improved alternative for phenol removal. Enzyme and Microbial Technology, 2006, 39, 1016-1022. [45] Gomez, JL; Bodalo, A; Gomez, E; Hidalgo, AM; Gomez, M; Murcia, MD. A transient design model of a continuous tank reactor for removing phenol with immobilized soybean peroxidase and hydrogen peroxide. Chemical Engineering Journal, 2008, 145, 142-148. [46] Gomez, M; Matafonova, G; Gomez, JL; Batoev, V; Christofi, N. Comparison of alternative treatments for 4-chlorophenol removal from aqueous solutions: Use of free and immobilized soybean peroxidase and KrCl excilamp. Journal of Hazardous Materials, 2009, 169, 46-51. [47] Gray, JSS; Montgomery, R. Asymmetric glycosylation of soybean seed coat peroxidase. Carbohydrate Research, 2006, 341, 198-209. [48] Gray, JSS; Montgomery, R. The N-glycosylation sites of soybean seed coat peroxidase, Glycobiology, 1997, 7, 679-685. [49] Gray, JSS; Yang, BY; Hull, SR; Venzke, DP; Montgomery, R. The glycans of soybean peroxidase, Glycobiology,1996,6, 23- 32. [50] Harris, JM. Introduction to biotechnical and biomedical application of poly (Ethylene Glycol). In: JM. Harris, editor. Poly (Ethylene Glycol) Chemistry- Biotechnical and Biomedical Applications. New York: Plenum Press, 1992, 1-14. [51] Henriksen, A; Mirza, O; Indiani, C; Teilum, K; Smulevich, G; Welinder, KG; Gajhede, M. Structure of soybean seed coat peroxidase: a plant peroxidase with unusual stability and haem-apoprotein interactions. Protein Science, 2001, 10, 108-115. [52] Higson, FK. Microbial Degradation of Nitroaromatic Compounds. Advances in Applied Microbiology, 1992, 37, 1-19. [53] Hutterman, A; Mai, C; Kharazipour, A. Modification of lignin for the production of new compound materials. Applied Microbial Biotechnology, 2001, 55, 387-394. [54] Ibrahim, MS; Ali, HI; Taylor, KE; Biswas, N; Bewtra, JK. Enzyme-catalyzed removal of phenol from refinery wastewater: Feasibility studies. Water Environment Research, 2001, 73, 165-172.

Soybean Peroxidase Applications in Wastewater Treatment

217

[55] Ibrahim, MS; Ali, HI; Taylor, KE; Biswas, N; Bewtra, JK. Removal of phenol from industrial wastewaters using Arthromyces ramosus peroxidase in a continuous flow system. Proceedings of the 1997 52nd Purdue Industrial Waste Conference, 1997, 271277. [56] Ikehata, K; Buchanan, ID; Smith, DW. Treatments of oil refinery wastewater using crude Coprinus cinereus peroxidase and hydrogen peroxide. Journal of Environmental Engineering Society, 2003, 2, 463-472. [57] Jiménez, M; García-Carmona, F. The effect of sodium dodecyl sulphate on polyphenol oxidase. Phytochemistry, 1996, 42,1503-1509. [58] Kamal, JK; Behere, DV. Activity, stability and conformational flexibility of seed coat soybean peroxidase. Journal of Inorganic Biochemistry, 2003, 94, 236-242. [59] Kamal, JK; Behere, DV. Thermal and conformational stability of seed coat soybean peroxidase, Biochemistry, 2002, 41, 9034-9042. [60] Karajanagi, SS; Vertegel, AA; Kane, RS; Dordick, JS. Structure and function of enzymes adsorbed onto singlewalled carbon nanotubes, Langmuir, 2004, 20, 1159411599. [61] Kauffmann, C; Petersen, BR; Bjerrum, MJ. Enzymatic removal of phenols from aqueous solutions by Coprinus cinereus peroxidase and hydrogen peroxide. Journal of Biotechnology, 1999, 73, 71-74. [62] Kennedy, K; Alemany, K; Warith, M. Optimisation of soybean peroxidase treatment of 2,4-dichlorophenol. Water SA, 2002, 28, 149-158. [63] Kim, YH; Won, K; Kwon, JM; Jeong, HS; Park, SY; An, ES; Song, BK. Synthesis of polycardanol from a renewable resource using a fungal peroxidase from Coprinus cinereus. Journal of Molecular Catalysis B: Enzymatic, 2005, 34, 33-8. [64] Kinsley, C; Nicell, JA. Treatment of aqueous phenol with soybean peroxidase in the presence of polyethylene glycol. Bioresource Technology, 2000, 73, 139-146. [65] Klibanov, AM; Alberti, BN; Morris, ED; Felshin, LM. Enzymatic removal of toxic phenols and anilines from waste waters. Journal of Applied Biochemistry, 1980, 2, 414421. [66] Koide, T; Ikenaka, T. Studies on soybean trypsin inhibitors. I. Amino acid sequence of the carboxyl-terminal region and the complete amino acid sequence of the soybean trypsin inhibitor. European Journal of Biochemistry, 1973, 32, 417-431. [67] Kunitz, M. Crystallization of a trysin inhibitor from soybean. Science, 1945, 101, 668669. [68] Lai, YC; Lin, SC. Application of immobilized horseradish peroxidase for the removal of p-chlorophenol from aqueous solution. Process Biochemistry, 2005, 40, 1167-1174. [69] Lentz, TD; Akridge, JT. Economic evaluation of alternative supply chains for soybean peroxidase. Journal of Food Distribution Research, 1997, 28, 18-42. [70] Mantha, R; Biswas, N; Taylor, KE; Bewtra, JK. Removal of nitroaromatics from synthetic wastewater using two-step zero-valent iron reduction and peroxidasecatalyzed oxidative polymerization. Water Environment Research, 2002, 74, 280-287. [71] Mantha, R; KE. Taylor, KE; Biswas, N; Bewtra, JK. A continuous system for Fe0 reduction of nitrobenzene in synthetic wastewater. Enviromental Science and Technology, 2001, 35, 3231-3236. [72] McEldoon, JP; Dordick, JS. Unusual thermal stability of soybean peroxidase. Biotechnology Progress, 1996, 12, 555.

218

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

[73] McEldoon, JP; Pokora, AR; Dordick, JS. Lignin peroxidase-type activity of soybean peroxidase. Enzyme and Microbial Technology, 1995, 17, 359. [74] Metelitza, DJ; Litvinchuk, AV; Savenkova, MI. Peroxidase catalyzed co-oxidation of halogen-substituted phenols and 4-aminoantypyrine. Journal of Molecular Catalysis, 1991, 67, 401-411. [75] Modaressi, K; Taylor, KE; Bewtra, JK; Biswas, N "A Novel Fenton-Enzymatic Treatment of Toluene and its by-products, Process steps optimization and kinetics." Unpublished Work. [76] Munir, IZ; Dordick, JS. Soybean peroxidase as an effective bromination catalyst. Enzyme and Microbial Technology, 2000, 26, 337-341. [77] Nadarajah, N; Hamme, JV; Pannu, J; Singh, A; Ward O. Enhanced transformation of polycyclic aromatic hydrocarbons using a combined Fenton's reagent, microbial treatment and surfactants. Applied Microbiology and Biotechnology, 2002, 59, 540-544. [78] Nakamoto, S; Machida, N. Phenol removal from aqueous solutions by peroxidasecatalyzed reaction using additives. Water Research, 1992, 26, 49-54. [79] Nicell, JA. Enzyme catalyzed polymerization and precipitation of aromatic compounds from waste water. 1991 (PhD, University of Windsor). [80] Nicell, JA; AI-Kassim, L; Bewtra, JK; Taylor, KE. Wastewater treatment by enzyme catalyzed polymerization and precipitation. Biodeterioration Abstracts, 1993, 7, 1-8. [81] Nicell, JA; Wright, H. A model of peroxidase activity with inhibition by hydrogen peroxide. Enzyme and Microbial Technology, 1997, 21, 302-310. [82] Nissum, M.; Schiødt, CB; Welinder, KG. Reactions of soybean peroxidase and hydrogen peroxide pH 2.4-12.0, and veratryl alcohol at pH 2.4. Biochimica et Biophysica Acta, 2001, 1545, 339-348. [83] Odani, S; Koide, T; Ono, T; Seto, Y; Tanaka, T. Soybean hydrophobic protein: isolation, partial characterization and the complete primary structure. European Journal of Biochemistry, 1987, 162, 485-491. [84] Ortiz de Montellano, PR; David, SK; Ator, MA; Tew, D. Mechanism-based inactivation of horseradish peroxidase by sodium azide. Formation of mesoazidoprotoporphyrin IX. Biochemistry, 1988, 27, 5470–5476. [85] Patapas, J. The removal of dinitrotoluene from wastewater via zero-valent iron reduction and enzyme-catalyzed oxidative polymerization with Arthromyces ramosus peroxidase. 2007 (PhD Dissertation, University of Windsor, Windsor, ON). [86] Patapas, J; Al-Ansari, MM; Taylor, KE; Bewtra, JK; Biswas, N. Removal of dinitrotoluenes from water via reduction with iron and peroxidase-catalyzed oxidative polymerization: A comparison between Arthromyces ramosus peroxidase and soybean peroxidase. Chemosphere, 2007, 67, 1485-1491. [87] Paton, P; Talens, FI. Colloidal flocculation of micellar solutions of anionic surfactant. Journal of Surfactant and Detergents, 1998, 1, 399-402. [88] Peralta-Zamora, P; Esposito, E; Pellegrini, R; Groto, R; Reyes, J; Durán, N. Effluent treatment of pulp and paper, and textile industries using immobilised horseradish peroxidase, Environmental Technology, 1998, 19, 55-63. [89] Percy, JD; Philip, R; Vodkin, LO. A defective seed coat pattern (Net) is correlated with the post-transcriptional abundance of soluble proline-rich cell wall proteins. Plant Molecular Biology, 1999, 40, 603-613.

Soybean Peroxidase Applications in Wastewater Treatment

219

[90] Pundir, CS; Malik, V; Bhargava, AK; Thakur, M; Kalia, V; Singh S; Kuchhal, NK. Studies on horseradish peroxidase immobilized onto arylamine and alkylamine glass. Journal of Chemical Technology and Biotechnology, 1999, 8, 123-126. [91] Putter, J; Becker, R. Peroxidase. Methods of Enzymatic Analysis (3rd edition). In: J; Bergmeyer, M. Grassl, editors. Berlin: Verlag Chemie, 1983, 3, 286-293. [92] Regalado, C; García-Almendárez, BE; Duarte-Vázquez, MA. Biotechnological applications of peroxidases, Phytochemistry Reviews, 2004, 3, 234-256. [93] Rojas-Melgarejo, F; Rodríguez-López, JN; García-Cánovas, F; García-Ruiz, PA. Stability of horseradish peroxidase immobilized on different cinnamic carbohydrate esters. Journal of Chemical Technology and Biotechnology, 2004, 79, 1148-1154. [94] Ryan, B; Carolan, N; O'Fagain, C. Horseradish and soybean peroxidases: comparable tools for alternative niches. Trends in Biotechnology, 2006, 24, 355-363. [95] Saha, B; Biswas, N; Taylor, KE; Bewtra, JK. Removal of Benzene From Wastewater by Soybean Peroxidase-Catalyzed Oxidative Polymerization Following by Limited Fenton Reaction. WEFTEC 2010. New Orleans, Louisiana U.S.A.: Water Environment Fedaration, 2010. [96] Saha, B; Taylor, KE; Bewtra, JK; Biswas, N. Laccase-catalyzed removal of diphenylamine from synthetic wastewater. Water Environment Research, 2008, 80, 2118-2124. [97] Sakurai, A; Masuda, M; Sakakibara, M. Effect of surfactants on phenol removal by the method of polymerization and precipitation catalysed by Coprinus cinereus peroxidase, Journal of Chemical Technology and Biotechnology, 2003, 78, 952-958. [98] Schmitz, N; Gijzen, M; van Huystee, R. Characterization of anionic soybean (Glycine max) seed coat peroxidase. Canadian Journal of Botany, 1997, 75, 1336-1341. [99] Schweigert, N; Alexander, J; Zehnder, J. Chemical properties of catechol and their molecular modes of toxic action in cells from microorganisms to mammals, Environmental Microbiology, 2001, 3(2), 81-89. [100] Sessa, DJ. Processing of soybean hulls to enhance the distribution and extraction of value-added proteins. Journal of the Science of Food and Agriculture, 2003, 84, 75-82. [101] Sessa, DJ; Anderson, RL. Soybean peroxidase: Purification and some properties. Journal of Agricultural and Food Chemistry, 1981, 29, 960-965. [102] Shukla, SP; Devi, S. Covalent coupling of peroxidase to a copolymer of acryalmide (AAm)-2-hydroxyethyl methaacrylate (HEMA) and its use in phenol oxidation. Process Biochemistry, 2005, 40, 147-154. [103] Siddique, MH; St Pierre, C; Biswas, N; Bewtra, JK; Taylor, KE; Al-Kassim, L. Immobilized enzyme catalyzed removal of 4-chlrorphenol from aqueous solution. Water Research, 1993, 27, 883-890 (corrigendum: 1994, 28(2), I). [104] Singh, N; Singh, J. An enzymatic method for removal of phenol from industrial effluent, Preparative Biochemistry and Biotechnology, 2002, 32, 127-133. [105] Steevensz, A; Al-Ansari, MM; Taylor, KE; Bewtra, JK; Biswas, N. Comparison of soybean peroxidase with laccase in the removal of phenol from synthetic and refinery wastewater samples. Journal of Chemical Technology and Biotechnology, 2009, 84, 761-769. [106] Tatsumi, K; Wada, S; Ichikawa, H. Removal of chlorophenols fromwastewater by immobilized horseradish peroxidase. Biotechnology and Engineering, 1996, 51, 126130.

220

Mohammad Mousa Al-Ansaria, Beeta Sahab, Samar Mazloumb et al.

[107] Tonegawa, M; Dec, J; Bollag, JM. Use of additives to enhance the removal of phenols from water treated with horseradish and hydrogen peroxide. Journal of Environmental Quality, 2003, 32, 1222-1227. [108] TOXNET: Toxicology Data Network, Hazardous substance data bank (HSDB). 2010. (http://toxnet.nlm.nih.gov) Accessed April. 2010. [109] Trivedi, UJ; Bassi, AS; Zhu, J. Investigation of phenol removal using sol-gel/alginate immobilized soybean seed hull peroxidase. Canadian Journal of Chemical Engineering, 2006, 84, 239-247. [110] Tsaprailis, G; Chan, DWS; English, AM. Conformational states in denaturants of cytochrome c and horseradish peroxidase examined by fluorescence and circular dichroism. Biochemistry, 1998, 37, 2004-2016. [111] Tuisel, H; Sinclair, R; Bumpus, JA; Ashbaugh, W; Brock, BJ; Aust, SD. Lignin peroxidase H2 from Phanerochaete chrysosporium: Purification, characterization and stability to temperature and pH. Archives of Biochemistry and Biophysics, 1990, 279, 158-166. [112] U.S. Department of Health and Human Services. Interaction Profile for Benzene, Toluene, Ethylbenzene, and Xylenes (BTEX), 2004. [113] U.S. Environmental Protection Agency, Toxics Release Inventory (TRI) data 2008. (http://www.epa.gov/tri) Accessed April. 2010. [114] Vierling, RA; Wilcox, JR; Microplate Assay for soybean seed coat peroxidase activity. Seed Science and Technology, 1996, 24, 485-494. [115] Welinder, KG; Larsen, YB. Covalent structure of soybean seed coat peroxidase, Biochimica et Biophysica Acta, 2004, 1698, 121-126. [116] Welinder, KG. Plant peroxidases: structure- function relationships. In: C; Penel, T; Gaspar, H. Greppin, editors. Plant Peroxidases: Topics and Detailed Literature on Molecular, Biochemical, and Physiological Aspects. Switzerland: University of Geneva, 1992, 1- 24. [117] Wick, CB. Enzymol shows promise of novel peroxidase. Genetic Engineering News, 1996, 16, 1-3. [118] Wilberg, K; Assenhaimer, C; Rubio, J. Removal of aqueous phenol catalyzed by a low purity soybean peroxidase. Journal of Chemical Technology and Biotechnology, 2002, 77, 851-857. [119] Wright, H; Nicell, JA. Characterization of soybean peroxidase for the treatment of aqueous phenols. Bioresource Technology, 1999, 70, 69-79. [120] Wu, J; Bewtra, JK; Biswas, N; Taylor, KE. Effect of H2O2 addition mode on the enzymatic removal of phenol from wastewater in the presence of polyethylene glycol. Canadian Journal of Chemical Engineering, 1994, 72, 881-886. [121] Wu, Y; Taylor, KE; Bewtra, JK; Biswas, N. A model for the protective effect of additives on the activity of horseradish peroxidase in the removal of phenol. Enzyme and Microbial Technology, 1998, 22, 315-322. [122] Wu, Y; Taylor, KE; Biswas, N; Bewtra, JK. Comparison of additives in the removal of phenolic compounds by peroxidase-catalyzed polymerization. Water Research, 1997, 31, 2699-2704. [123] Xu, X; John, VT; McPherson, GL; Grimm, DA; Akkara, JA; Kaplan, DL. A combined chemical-enzymatic method to remove selected aromatics from aqueous streams. Applied Biochemistry and Biotechnology, 1995, 51, 649-660.

Soybean Peroxidase Applications in Wastewater Treatment

221

[124] Yu, J; Taylor, KE; Zou, H; Biswas, N; Bewtra, JK. Phenol conversion and dimeric intermediates in horseradish peroxidase-catalyzed phenol removal from water. Environmental Science and Technology, 1994, 28, 2154-2160. [125] Zeng, Y; Hong, PKA; Wavrek, DA. Integrated chemical-biological treatment of benzo(a)pyrene. Environmental Science and technology, 2000, 34, 854-862. [126] Zhang, W; Dai, X; Zhao, Y; Lu, X; Gao, P. Comparison of the different types of surfactants for the effect on activity and structure of soybean peroxidase. Langmuir, 2009, 25, 2363-2368.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 7

SOYBEAN GERMINATION AND CANCER DISEASE María del Carmen Robles Ramírez, Eva Ramón Gallegos and Rosalva Mora Escobedo* National School of Biological Science, National Polytechnic Institute, Mexico

ABSTRACT Cancer is one of the chronic diseases that has the highest incidence in the world. Extensive epidemiological, in vitro, and animal data suggest that soybean consumption reduces the risk of developing several types of cancer. To date, a number of nutrients and micronutrients with anticancer properties have been identified in soybean, including isoflavones, saponins, inositol hexaphosphate, and biologically active proteins and peptides such as protease inhibitors, lectins, low molecular weight peptides and the most recently discovered peptide lunasin. The anticancer properties of soybean may also be due to its amino acid balance since it has low methionine and high arginine content; both conditions are known to inhibit tumor development. The ability to block DNA damage caused by reactive oxygen species and/or carcinogens is the most direct strategy for preventing the initiation of cancer and for slowing down disease progression; studies have demonstrated the antioxidant capacity of soybeans due to their content of compounds such as isoflavones and other phenolic compounds, phytates, tocopherols, carotenoids, and peptides derived from its hydrolysis. Furthermore, soy may protect against cancer through other different mechanisms including increased cell differentiation, decreased activation of procarcinogens to carcinogens, and regulation of genes involved in signal transduction pathways critical in tumor initiation, promotion and /or progression. Germination is a simple, low-cost process that can improve the nutraceutical properties of plants by modifying metabolite content and generating peptides and amino acids with possible biological activity. A previous study from our laboratory showed that germination could improve the antiproliferative effect of soybean protein on HeLa and C33 cervical cancer cells. In this chapter we will review the different components of soy with anticarcinogenic properties and how they are affected by germination. In addition, *

Corresponding author: E-mail: [email protected]

224

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al. we will explore the possibility of using germination as a means to improve these properties.

INTRODUCTION Cancer is a leading cause of death around the world, and the total number of cases globally is increasing. WHO estimates that 84 million people will die of cancer between 2005 and 2015 without intervention (WHO, 2010). Cancer is a group of diseases characterized by unregulated cell growth and the invasion and the spread of cells from the site of origin to other sites in the body. It develops through a multi-step process that occurs across long periods of time so that it is possible to interfere with its development if detected in time (Pecorino, 2005). The intake of fruits and vegetables as a means of reducing cancer risk is strongly supported by epidemiological studies (Liu, 2003). The incidence of breast, prostate and colon cancer, among others, is lower in Asian countries than in the West. Soybeans have long been a major component of the Eastern diet. Extensive epidemiological, in vitro, and animal data collected over the previous several years suggest that soybean consumption reduces the risk of developing several types of cancer (Fournier et al., 1998; Badger et al., 2005). Soybean is a cheap protein source, with excellent nutritional and physicochemical properties, and also a rich source of phytochemicals with potential health benefits. Different phytochemicals have been identified in soy with anticancer activity including isoflavones, saponins, inositol hexaphosphate, and biologically active proteins and peptides such as protease inhibitors, lectins, low molecular weight peptides and the most recently discovered peptide lunasin (Barac et al., 2005). The anticancer properties of soybean may also be due to its amino acid balance since it has low methionine and high arginine content; both conditions are known to inhibit tumor development (Breillout et al., 1990; Hawrylewicz et al., 1991; Millis et al., 1998; Lind, 2004). Moreover, studies have demonstrated the antioxidant capacity of soy protein hydrolysates, another condition that could prevent cancer (Peña-Ramos and Wiong, 2002; Khalil et al., 2006). Soy may protect against cancer through different mechanisms including increased cell differentiation, decreased activation of procarcinogens to carcinogens, antioxidant activity, and regulation of genes involved in signal transduction pathways critical in tumor initiation, promotion and /or progression (Badger, 2005).

Isoflavones Isoflavones are naturally occurring plant chemicals belonging to the ―phytoestrogen‖ class (phytometabolites with estrogenic activity) that have been proposed as potential alternative therapies for a range of hormone-dependent conditions, including cancer, menopausal symptoms, cardiovascular disease and osteoporosis (Setchell, 1999). In its general structure, isoflavones have two benzene rings (A and B) containing hydroxyl groups, whose number and location vary. The A ring is attached in condensed form to a pyran and the B ring is bound to the pyran in position 3 (Davila et al., 2003) (Figure 1).

Soybean Germination and Cancer Disease

O

HO

OH

O Daidzein

HO

HO

O

225

OH

O Genistein

Figure 1. Phytoestrogens as Daidzein and Genistein

This structure is similar to mammalian estrogens so it is not surprising that isoflavones bind to estrogen receptors, but also, it can have nonclassical actions distinct from their classical genomic actions; these include effects on plasma membranes and on cell signaling pathways. That means at certain concentrations, which may depend on many factors including receptor number, occupancy and competing estrogen concentration, rather than acting as an estrogen, they may antagonize and inhibit estrogen action. For example, the exact effect of phytoestrogens on breast cancer cells and tumors is concentration dependent, where growth is stimulated at low concentrations (0.1–10 µmol/l) and inhibited at high concentrations (20– 100 µmol/l) (Browson et al., 2002). Phytoestrogens may affect cancer progression as a result of their effects on apoptosis, cell cycle progression, growth and differentiation as well as their antioxidant and antiangiogenic effects (Zho et al., 1999; Browson et al., 2002; Georgetti et al., 2006; Russo et al., 2006). Genistein (5, 7, 4‘-trihydroxyisoflavone) and daidzein (7,4‘-dihidroxyisoflavone) (Figure 1) and their respectives glycosides (genistin and dadzin) are the principal isoflavones found in soybeans. Genistein affects cellular function via inhibition of 17β-steroid oxidoreductase (an enzyme necessary for estrogen synthesis) and tyrosine-specific protein kinases (Browson et al., 2002). The protein products of approximately one-half of the known oncogenes have been shown to be either membrane-bound receptors with tyrosine kinase activity or intracellular proteins undergoing or catalyzing tyrosine phosphorylation, suggesting that the anticancer effects of soy could be attributed to genistein (Barnes, 1995). Genistein also modulates the activity of topoisomerase II, an important protein involved in the processes of DNA replication and cell proliferation. It is believed that genistein can bind to and stabilize the topoisomerase-DNA complex, resulting in DNA strand breaks and inducing cell apoptosis (Bandele and Osheroff, 2007). Another study demonstrated that genistein could also reduce the Topo IIα expression at both mRNA and protein levels through the regulation of Sp1 and Sp3 transcription factors in HeLa cells ( Zhou et al., 2009). On the other hand, genistein may inhibit cell growth by modulating transforming growth factor (TGF)β1 signaling pathways. TGF-β1/signaling has been shown to be associated with proapoptotic and antimitotic activities in epithelial tissues (Yu et al., 2005). Genistein dosedependently increased TGF-β1 mRNA expression in mouse colon cancer MC-26 cells. It has been shown that isoflavones can alter the expression of genes involved in cell cycle regulation (Singh et al., 2003; Oki et al., 2004; Zhou et al., 2009). Handayani et al. (2006) studied the effect of soy isoflavones on growth and gene expression profiles of PC-3 human prostate cancer cells. In this study, isoflavones decreased the expression of genes involved in cell proliferation, metastasis and angiogenesis such as IL-8, matrix metalloproteinase 13, folistatin and fibronectin, whereas induced expression of p-21, a major inhibitory protein in

226

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

the cell cycle. Other studies have also demonstrated that soy protein and/or soy phytoestrogens modulate the expression of genes related with angiogenesis, proliferation and metastasis (Zhou et al., 1999; Singh et al., 2006). The antimetastatic effect of isoflavones has been demonstrated in an in vivo model in which dietary isoflavones (genistein + daidzein) reduced pulmonary metastasis of B16BL6 murine melanoma cells in C57BL/6 mice (Li et al., 1999). A recent study investigated the effects of a phytoestrogen-containing standardized soy extract on the growth of nonsmall cell lung cancer xenografts in female athymic mice (Gallo et al., 2008). The treatment reduced tumor volume, proliferation and the expression of phosphorilated protein kinase B (p-Akt) in the treated groups compared with the control, whereas the estrogen receptors ERα and ERβ did not differ among groups. The average daily intake of isoflavones in Western populations is very low (less than 1 mg /d). In Asian countries consumption varies between 20to 50 mg/d of total isoflavones resulting in plasma concentrations of 50–800 ng/ml of daidzein and genistein (Setchell and Cassidy 1999). Because of relatively low concentrations of genistein expected in the blood in populations consuming a soy-rich diet, the significance of the inhibition of cell growth by genistein is restricted to those cell types where its IC50 is below 5 µg/ml. It is also worth noting that the magnitude of the inhibitory effect of genistein on cell growth depends on the cancer cell type. The IC50 reported by different studies for various cancer cell lines varies from 3.7 to more than 100 µM (1 to 27 mg/ml), (Barnes, 1995). Here it is worth mentioning the particular case of breast cancer where concentrations of genistein as low as 200 nM, act as an estrogen agonist promoting the growth of MCF-7 cells of breast cancer in vitro. The genistein also stimulated growth of estrogen-dependent breast tumor in nude mice fed 750 ppm of isoflavone (Allred et al., 2001). Isoflavone contents of soybean varieties range from 1200 to 4200 µg/g. This quantity is reduced in the protein isolates (600–1000 µg/g) and in the concentrates (73 µg/g) because of the processing used during manufacture (Anderson and Wolf, 1995). The bioavailability and pharmacokinetics of isoflavones are influenced mainly by the type of food matrix or form in which they are ingested. A liquid matrix, such as soy milk, yields a faster absorption rate and higher peak plasma concentrations than a solid matrix, whereas aglycones in a fermented food such as tempeh are absorbed more rapidly than glucoside conjugates of textured vegetable protein (Cassidy et al., 2006).

Saponins Soybean saponins are complex compounds consisting of nonpolar triterpenoid alcohol aglycones (sapogenins) linked to one or more polar oligosaccharides (Anderson and Wolf, 1995) (Figure 2). Although saponins of some plants are toxic to experimental animals, soybean saponins were relatively harmless to chickens, rats and mice when fed at a concentration five times higher than that of a normal diet supplemented with soy (Ishaaya, 1969). Because of the metabolism of soybean saponins in gastrointestinal system may influence their biological activity; a metabolic study was carried out using different animal models. After saponin administration, neither saponin nor sapogenin were detected in the blood. However, sapogenins were recovered from the cecum and colon of the animals (Gestetner et

Soybean Germination and Cancer Disease

227

al., 1968). It is likely, therefore, that, in the intestine, saponins bind to the mucosal cell membrane and change its physiology. Rao and Sung (1995) showed that soybean saponins at the concentration of 150-600 ppm had a dose-dependent growth inhibitory effect on human colon carcinoma cells (HCT-15). They also observed, by transmission electron microscopy, a dose-dependent effect of saponin on intracellular morphology of HCT-15. Soybean saponintreated cells formed numerous cytoplasmic vesicles followed by deformation in the plasma and nucleus membrane. These results were confirmed by Ellington et al., (2005) who found that 25-500 ppm of soya saponins significantly reduced viable cell number of HCT-15. Besides, treatment of cells with 25-100 ppm of saponins resulted in transient accumulation of cells in S-phase of the cell cycle that was associated with a significant reduction of cyclindependant kinase-2 (CDK-2) activity. Cells also exhibited an increase in morphologies characteristic of Type 2 non-apoptotic programmed cell death including numerous autophagic vacuoles. These results suggest that saponins actively interact with cell membrane components, resulting in changes in intracellular morphology and cell membrane permeability. MacDonald et al., (2005) investigated the effect of purified soy saponins on cultured human colon tumor cells, Caco-2. Saponins were effective in inhibiting cell proliferation at 20 µg/ml, but only when provided in the aglycone form. Besides, purified saponins had any negative effects on mouse growth, organ weights or intestinal morphology when the diet contained up to 3% saponins by weight. These searchers did not detect saponins in serum or urine of mice confirming the fact that saponins are not absorbed by rats. Soy saponins reduce the risk of colon tumorigenesis possibly by suppressing inflammatory responses. A study using human adenocarcinoma cells (HT-29), found that soy saponins suppressed the degradation of IκBα, while cyclooxygenase-2 (COX-2) and protein kinase C (PKC) expressions were significantly down-regulated, when cells were stimulated for inflammatory responses (Kim et al., 2004). Furthermore, the saponins significantly inhibited the release of proinflammatory mediators such as PGE2, NO, TNFα and monocyte chemotactic protein-1 by peritoneal macrophages also down-regulating the expression of COX-2 and iNOS mRNA/protein levels (Kang et al., 2005). Soy saponins has antimetastatic properties, the treatment of HT-1080 fibrosarcoma cells with soybean saponin inhibited the mRNA expression and reduced the amounts of secreted matrix metalloproteinase (MMP-2 and MMP-9), whereas it increased the amount of secreted tissue inhibitor of metalloproteinase-2 (TIMP-2) dose-dependently (Kanga et al., 2008). However, the protective effects of soy saponins on colon tumor incidence were modest in an animal model probably due to the poor absorption through intestinal mucosa (MacDonald et al., 2007). On the other hand, saponins may act to delay the initiation and progression of cancer due to its ability to bind to bile acids by reducing their availability to form secondary bile acids by the action of intestinal microflora, an event associated with the development of colorectal cancer (Rao and Sung, 1995). Soybeans contain 0.1-0.5% saponins and its concentration is higher in the hypocotyl than in the cotyledons. Saponins apparently complex with proteins and, with the exception of the concentrates extracted with alcohol, they tend to remain with the protein products derived from soybeans. Its concentration in isolated protein is 0.8%. (Anderson and Wolf, 1995).

228

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Figure 2. Saponin structure

Figure 3. Structure of phytic acid and its interaction with proteins and minerals

Phytic Acid Inositol hexaphosphate (IP6) is an essential microconstituent of plant cells, especially abundant in cereals and legumes. Most of the phytic acid is localized in protein bodies of cotyledons where it is distributed between soluble protein-phytate salts and insoluble crystalline globoid inclusions. (Anderson and Wolf, 1995; Singh et al., 2003). It has been regarded as an antinutritional factor due to its ability to complex with pectin and divalent cations such as Ca2+, Fe2+, Zn2+, and Mg2+, hindering mineral metabolism in man and other monogastric animals (Singh et al., 2003). Full-fat flour, which is essentially the cotyledon fraction, contains 1.5-1.8% phytic acid. Values for defatted flours, concentrates, isolates and texturized flours likewise are in the range of 1-2% phytic acid despite considerable additional processing as compared with full-fat flours, which speaks of its

Soybean Germination and Cancer Disease

229

stability (Anderson and Wolf, 1995). Almost all mammalian cells contain IP6 and much smaller amounts of its forms with fewer phosphate groups (IP1-5), which are important for regulating vital cellular functions, such as signal transduction systems, cell proliferation and differentiation. In vivo and in vitro studies suggest a remarkable potential for the use of IP6 in strategies for cancer prevention and treatment (Vucenik and Samsuddin, 2003). In a study by Vucenik et al. (1998), using nude mice implanted with cancer cells, HepG2 human liver, the IP6 inhibited the formation of liver cancer and regresses pre-existing human hepatic cancer xenograft; therefore, it has the potential for clinical use as a preventive and therapeutic agent for hepatocellular carcinoma. In addition to reducing cell proliferation, IP6 increases differentiation of malignant cells often resulting in reversion to normal phenotype (Yang and Shamsuddin, 1995; Shamsuddin et al., 1996). IP6 is rapidly absorbed into the gastrointestinal tract of rat and distributed as inositol and IP 1. In vitro, it is instantly taken by malignant cells undergoing variable dephosphorylation to inositol and IP1-5 (Shamsuddin et al., 1997). Phytases and phosphatases in the diet and in intestinal cells, dephosphorylate IP6 to lower phosphorylated forms. The IP6 causes release of intracellular calcium which in turn induces cell division. Excess IP3 could either enhance the cell division or, via a negative feedback mechanism, common in many biological systems, could inhibit cell division. It is also proposed that IP6 could exert its antiproliferative activity by reducing the availability of divalent cations, important in several enzyme functions. For instance Ca2+ and Zn2+ have been shown to be important in regulation of protein kinase C activity, and Mg2+ can cause a decrease in DNA synthesis and cell proliferation (Shamsuddin et al., 1989). The phosphate grouping in positions 1, 2, and 3 is unique for IP6, providing a specific interaction with iron to completely inhibit its ability to catalyze hydroxyl radical formation, making IP6 a strong antioxidant (Vucenik and Shamsuddin, 2003). It has been also demonstrated that IP6 can inhibit the Akt-NFκB cell survival pathway and cause mitochondrial permeabilization, followed by cytochrome c release, which cause activation of the apoptotic machinery (Ferry et al., 2002). Other study found that 2% IP6 in the drinking water, increase the activity of natural killer cells, and inhibit tumor growth and metastasis in DMH-induced colorectal cancer, in rats (Zhang et al., 2005).

Biologically Active Proteins and Peptides Soybean proteins and the soybean-derived peptides may play an important role in disease prevention and treatment. Food processing and in vivo enzyme digestion of soy proteins may release peptides, which exert diverse biological functions by interacting with cellular receptors, functioning as hormones, regulating enzymes or interfering cell cycles (Wang and Gonzalez de Mejía, 2005). Protease inhibitors, lectins, low molecular weight peptides and the most recently discovered peptide lunasin, are examples of these soy proteins and peptides with biological activity. Bowman Birk inhibitor (BBI) is a peptide of 71 amino acids with molecular weight of approximately 8 kDa and a rigid structure stabilized by 7 disulfide bonds (Figure 4). This peptide is able to inhibit both, trypsin and chymotrypsin enzymes, through two independent active sites, Lis16-Ser17 and Leu43-Ser44, respectively (Barac et al., 2005).

230

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Figure 4. Bowman Birk Inhibitor (BBI)

Ann Kennedy group has widely studied the anticarcinogenic propierties of BBI. BBI have demonstrated to have suppressive effects on the carcinogenic process in a variety of in vivo and in vitro systems, where cancer was induced by different types of carcinogens (including ionizing radiation and chemical carcinogens). It has been proved in different animal species, in many different tissues and organs, involving several different types of tumors, and diverse cell types (Kennedy, 1998). As a result of this evidence, BBI acquired the Investigational New Drug Status from the FDA in 1992 and currently is being evaluated as anticarcinogenic agent in human populations. BBIC (a soybean extract in which BBI has been concentrated) demonstrated clinical activity after oral administration to patients with oral leukoplakia, showing to be an effective non toxic chemopreventive agent (Armstrong et al., 2000 a, b). Selective inhibition of important serine proteases for growth of tumor cells may be a key step in cancer prevention by BBI (Kennedy, 1995; Friedman y Brandon, 2001). A study by Chen et al., (2005) demonstrated that BBI specifically inhibits proteasomal chymotrypsinlike activity. This inhibition is associated with the accumulation of ubiquitinated proteins and the proteasome substrates, p21 and p27, accompanied with down-regulation of cyclins D1 and E, which could arrest the cell cycle at G1/S phase. In this study, BBI inhibited cell growth of MCF7 breast cancer and suppressed the activity of ERK 1/2, a kinase related with extracellular signals. A study with patients enrolled in an oral cancer prevention trial using BBIC as the cancer preventive agent, suggested that BBI may inhibit certain proteolytic activity linked to carcinogenic processes. In addition, BBI can inhibit serine-proteases involved in the cleavage of neu protein on the cell surface, thereby preventing malignant and premalignant cells expressing high levels of neu protein (a condition detected in patients with a variety of cancers) (Wan et al., 1999). However, it is not clear the precise mechanism by which protease inhibitors suppress carcinogenesis. Among the mechanisms suggested is the fact that these agents prevent the release of the superoxide anion radical and hydrogen peroxide from polymorphonuclear leukocytes and other cell types stimulated with tumor-promoting agents. Besides, BBI have potent inhibitory effects on the catalytic activities of major proteases involved on inflammatory processes, such as cathepsin G, elastase, and chymase. Because inflammation is closely associates with carcinogenesis, the antiinflmmatory activity of BBI could be the major mechanism by which it prevents carcinogenesis (Kennedy, 1998). It has also been proposed that protease inhibitors suppress carcinogenesis by affecting the expression of certain proto-oncogenes. For example,

Soybean Germination and Cancer Disease

231

protease inhibitors return the high amounts of c-myc gene expression provoked by carcinogens, to normal amounts of activity in several in vivo systems (Kennedy, 1998). Studies with mice have shown that significant amounts of BBI are absorbed in the digestive tract and distributed in various organs three hours after oral administration (Billings et al., 1992). On the other hand, the direct effect of BBI on the anticarcinogenic activity of soy has been questioned due to this protease inhibitor is poorly absorbed and very sensitive to thermal process. However, autoclaved soy extracts, which are devoid of protease inhibitor activity, are as active as raw extracts in reducing cancer incidence (Clawson, 1996). Protease inhibitors have been associated with pancreatic hyperplasia and hypertrophy, and a suppressive effect on the growth and weight of young animals fed with high levels of soy products. However, when BBI concentrate (BBIC) was tested in animals at doses up 2 orders of magnitude higher than the doses being used in people, it did not lead to pathologic effects in any organ in mice, rats, hamsters or dogs. Doses as high as 1000 mg/kg body weight/day had no treatment-related adverse effects (Kennedy, 1998). The Kunitz trypsin inhibitor (KTI) of soy is a large peptide of 181 amino acid residues with two disulfide bridges and a molecular weight of approximately 21.5 kDa. KTI inhibits only trypsin through Arg 63-Ileu 64 binding site, present in his active site (Barac et al., 2005). Kobayashi et al. (2004) found that KTI, but not BBI, could inhibit HRA human ovarian cancer cell invasiveness at least through suppression of urokinase-type plasminogen activator (uPA) signaling cascade. KTI suppressesed HRA cell invasion by blocking uPA upregulation. In other study KTI also proved to be a potent anti-inflammatory agent through suppression of phosphorylation of three mitogen-activated protein (MAP) kinase pathways, ERK1/2, JNK, and p38, in peritoneal macrophages, leading to the suppression of cytokine expression (Kobayashi et al., 2005). KTI specifically inhibited UV-induced up-regulation of cytokine expression predominantly through suppression of JNK signaling pathway (Kobayashi et al., 2008). Soybean flour contain from 0.11 to 1.96% and from 0.02 to 0.5% of Kunitz and Bowman Birk inhibitors, respectively, whereas soy protein isolate inhibitor contents ranged from 0.05 to 0.36% and from 0.03 to 0.2%, respectively, for KIT and BBI inhibitors (Anderson and Wolf, 1995). Lectins are bioactive proteins found in almost all organisms, including plants, bacteria and viruses. Lectin originating from soybean seed is a tetrameric glycoprotein that recognizes terminal D-galactosyl sugar residues. Molecular weight of tetrameric form is 120 kDa and constitutes 1-2% of the seed protein (Barac et al., 2005). Once ingested lectin tends to bind to intestinal cells, and thus can interfere with intestinal absorption of nutrients. Due to this fact, lectin has been for a long time considered as anti-nutrient (Salunkhe and Desphande, 1991). However, several lectins have been found to possess anticancer properties in vitro, in vivo, and in human case studies; they are used as therapeutic agents, preferentially binding to cancer cell membranes or their receptors, causing cytotoxicity, apoptosis, and inhibition of tumor growth. Lectins can bind to ribosomes and inhibit protein synthesis. They also modify the cell cycle by inducing non-apoptotic G1-phase accumulation mechanisms, G2/M phase cell cycle arrest and apoptosis, and can activate the caspase cascade. Lectins can also downregulate telomerase activity and inhibit angiogenesis (Gonzalez de Mejía and Prisecaru, 2005). The antitumor activities of four plant lectins, including soybean agglutinin, were evaluated on a murine ascitic lymphoma and the effects of lectin treatment on mitogenic response of peripheral blood lymphocytes and macrophage-mediated tumor cell

232

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

lysis were also assessed. All four lectins studied were found to be able to restrict tumor growth and to improve the life expectancy of the host. The response of peripheral blood lymphocytes towards mitogenic stimulation was improved and tumor cytolysis by peritoneal macrophages was noted following lectin treatment (Ganguli and Das, 1994). Lunasin is a novel and promising chemopreventive peptide isolated from soybean cotyledon (Figure 5). It is a 43-amino acid peptide with a carboxyl end of eight aspartic acids residues (D), a cell adhesion motif (RGD) just before the poly D, and a predicted helical region with structural homology to chromatin binding proteins (EKHIMEKIQG) (Galvez and de Lumen, 1999). Fragment 23-32 targets lunasin to the chromatin, the RGD motif (fragment 33-35) is responsible of lunasin internalization into cell nucleus, and poly-aspartyl end (3643) is responsible of its directly binding properties to chromatin (Hernández-Ledesma et al., 2009a). The antimitotic effect of lunasin is attributed to binding of its poly-aspartyl carboxyl end to regions of hypoacetylated chromatin, like that found in centromeres. As a result, the kinetochore complex does not form properly, and the microtubules fail to attach to the centromeres leading to mitotic arrest and eventually to cell death (Galvez and de Lumen, 1999). The elucidation of its mechanism of action showed the internalization of lunasin in the cell through the RGD cell adhesion motif followed by its colocalization with hypoacetylated chromatin. Lunasin binds preferentially to deacetylated histone H4 in vitro; and inhibits histone H3 and H4 acetylation in vivo in the presence of a histone deacetylase inhibitor. Therefore, lunasin selectively induces apoptosis, mostly in cells undergoing transformation, by preventing histone aceylation (Galvez et al., 2001). The affinity of lunasin for deacetylated core histones suggests a role in chromatin modification, a process implicated in cell cycle control and in the role of tumor suppressors in carcinogenesis (Jeong et al.. 2003). Lunasin extracted from liver and blood of rats fed with lunasin-enriched soy also inhibited histone acetylation confirming that the peptide remain intact and in a bioactive form (Jeong et al., 2007). However, purified lunasin is degraded by digestive enzymes. While the pure BBI is stable after simulated intestinal and gastric digestion, purified lunasin from soybean and synthetic lunasin are easily digested after 2 min in both in vitro digestions. In contrast, lunasin from soy protein containing BBI is comparatively stable after digestions. These data suggest that BBI plays a role in protecting lunasin from digestion when soy protein is consumed orally (Park et al., 2007). Using a polyclonal antibody specific to the lunasin carboxyl end epitope, immunoblot analysis showed that lunasin was a major constituent of the soybean Bowman Birk protease inhibitor (BBIC) preparation (de Lumen et al., 2005). It has been demonstrated that lunasin suppresses transformation of mammalian cells induced by viral oncogenes (Lam et al., 2003; Jeong et al., 2003) and by chemical carcinogens (Galvez et al., 2001). Furthermore, the effect of lunasin on cancer prevention has been also demonstrated using an in vivo mouse model in which dermal application of lunasin at 250µg/week reduced skin tumor incidence in SENCAR mice treated with dimetylbenzaanthracen by approximately 70% compared with the untreated control (Galvez et al., 2001). Soy protein concentrate, isolate, and hydrolysate contain 2.81± 0.30, 3.75±0.43, and 4.43±0.59 g/100g flour, respectively, while soy flour and soy flakes contain 1.24±0.22 g lunasin/100g flour (González de Mejía et al., 2004).

Soybean Germination and Cancer Disease

1 SKWQHQQD SCRKQKQG VNLTPC 22

23 EKHIMEKIQG 32

33 RGD35

233

Unk now n function

Targe ts to lunas in to H3- H4 h ys tone s

Inte rnalizes lunas in into ce ll

36 DDDDDDDD 43

Binds to core hys tones

Figure 5. Lunasin sequence and function

US commercially available soy foods, including soy milk, soy-based infant formula, tofu, bean curd, soybean cake, tempeh, natto, miso and su-jae samples, were analyzed for lunasin and BBI. Both peptides were present in most of the products, in varying concentrations, depending mainly on the soybean variety and the manufacturing process. Lunasin and BBI were absent in the fermentation products natto and miso, suggesting that fermentation destroys both peptides (Hernández-Ledesma et al., 2009b).

Amino Acid Balance The study of the potential antitumor activity resulting from the restriction of amino acids in the diet began early in the 1900s but without positive results. However, later studies were conducted using mice fed chemically defined diets in which some essential amino acid was deleted. Tumor growth was significantly reduced in mice fed diets without methionine, valine or isoleucine. Of the three diets, methionine-free diet was the least toxic (Epner, 2001). He et al., (2003) also studied the effect of feeding different formulations of amino acids supplied in enteral nutritional solutions to mice implanted with Walker256 carcinosarcoma cells. They concluded that methionine/valine-depleted amino acid imbalance has stronger inhibitory effects on tumor growth. It has also been studied the effect of the restriction of dietary tyrosine and phenylalanine (amino acids required for the synthesis of melanin) in patients with metastatic melanoma, and the results were promising (Epner, 2001). Mammalian cells can not synthesize methionine from any of the other standard amino acids but can remethylate homocystein to methionine. Normal cells can therefore grow in culture where methionine is replaced by homocystein in the growth medium, and animals fed diets in which methionine has been replaced by homocystein suffer no ill effects and grow normally. In contrast, a wide variety of cancer cell lines are methionine dependent even in the presence of homocystein. Numerous cell culture studies using normal and malignant cell lines demonstrated that methionine restriction suppresses cancer cell growth, with little or no deleterious effect on normal cells (Breillout et al., 1990; Epner, 2001). Breillout et al., (1990) demonstrated in cultured cells that methionine dependency is acquired simultaneously with cell transformation, as observed with HBL 100, a human mammary epithelial cell line that acquired increased malignancy as a function of in vitro passage number, and NIH/3T3 (J10), a mouse fibroblast line transformed by transfection

234

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

with the human HRAS oncogene. Guo et al., (1993), using fresh patient tumors, found that 5 human tumors of 21, including tumors of the colon, breast, prostate, ovarian and melanoma, were methionine dependent. Likewise, the tumors are methionine dependent in vivo. The restriction of methionine in the diet causes regression of a variety of animal tumors and inhibits metastasis in animal models (Breillout et al., 1987; Epner, 2001). Moreover, the restriction of methionine increases the antitumor efficacy of cytotoxic agents in human tumors resistant to drugs (Poirson et al., 2000; Pavillard et al., 2006). The molecular mechanisms for the tumor specific growth inhibitory effects of methionine restriction are related with the specialized functions of methionine. Methionine is the major methyl donor for methylation of DNA, RNA, proteins and other molecules. Several growth inhibitory and pro-apoptotic genes are transcriptionally silenced in tumors as a result of focal DNA hypermethylation. DNA methylation also compacts and stabilizes chromatin structure and decreases its susceptibility to DNA-damaging agents. Inhibition of DNA methylation by methionine restriction may therefore make cancer cell DNA susceptible to damage. Methionine is also required for synthesis of polyamines, which have effects on nuclear structure and cell division and for glutathione homeostasis. Glutathione is a ubiquitous tripeptide that reduces oxidative stress in cells. Many tumors contain elevated levels of glutathione that confer resistance to a variety of chemotherapy drugs. Methionine maintains intracellular glutathione levels by acting as a sulfur donor for synthesis of cysteine (a component of glutathione) (Epner, 2001). Wang et al., (1997) demonstrated that methionine and cystein affect the level of glutathione and the glutathione-related enzymes activities in rat hepatocytes. Therefore, methionine restriction potentially could inhibit tumor growth by inducing oxidative DNA damage in cancer cells. Soybean protein has low methionine content; this condition could improve its antitumoral effect. Hawrylewicz et al., (1991) investigated the effect of feeding soybean protein isolate diet supplemented with 0.7% DLmethionine on mammary tumor progression previously induced with N-nitrosomethylurea. Tumor incidence was 80% in casein control group compared with 42.3% in the group fed with soybean isolate but methionine supplementation increased tumor incidence to 64% although not tumor weight. However, the group fed with soy protein supplemented with methionine had the highest percentages of adenocarcinomas classified as most aggressive. L-Arginine (2-amino-5-guanidino pentanoic acid) is a basic amino acid which carries a positive charge at physiological pH. This is one of the most versatile amino acids from a metabolic and physiological point of view. In addition to participating in the synthesis of proteins and bioactive peptides, arginine participates in the detoxification of ammonia via urea synthesis (Figure 6); hormone liberation, synthesis of pyrimidine bases, and it is the common substrate of two enzymes, arginase and nitric oxide synthase. Arginase converts Larginine to L-ornithine, a pathway that can increase cell proliferation through the polyamine synthesis by ornithine decarboxylase (ODC). Nitric oxide synthase converts L-arginine to citrulline and nitric oxide (NO), a ubiquitous signal transduction molecule, involved in vasodilatation, neurotransmission, antimicrobial and antitumor activity, that has been found to play a significant role in many of the specific events that lead to cancer (Teixeira et al., 2003; Lind, 2004). The nitric oxide molecule is a free radical, which is relevant to understanding its high reactivity. NO freely diffuses through membranes and interacts with specific molecular receptors, often iron, present in certain proteins with heme groups and SH-Fe complex, and can activate or inhibit enzyme systems. This seems to be the case in regulating the activity of ornithine decarboxylase by the NO. The ODC is the key enzyme in the biosynthesis of

Soybean Germination and Cancer Disease

235

polyamines and its inhibition may explain part of the cytostatic effect of NO, as this may decrease the synthesis of polyamines necessary for growth and cell proliferation (Teixeira et al., 2003). Numerous studies have shown that arginine supplementation in pure form or with diet, or the increased expression of NOS, have inhibitory effects on growth, proliferation and metastasis of malignant tumors (Milner and Stepanovich, 1979; Li et al., 1991; Yim et al., 1993; Qingyong et al., 1998; Motoo et al., 2000, Wang et al., 2000; Xie and Huang, 2003; Le et al., 2005). However, the role of NO in tumor biology is extremely complex; it has been showed to have opposite effects in tumor initiation, promotion and progression (Lind, 2004). Impaired NOS II expression during tumor progression may lead to decrease NO production, which may be insufficient to produce significant cytotoxic effects, and the subsequent low level of NO production may cause induction of NO resistance, and the NO-resistant tumor cells may take NO to undergo progression (Xie and Huang, 2003). The net biological effect of NO production is a balancing act that is dependent upon several factors including its concentration, temporal expression, cell source, and target cell (Lind, 2004; Bonavida et al., 2006). Following ingestion, L-arginine is absorbed from the lumen of the small intestine into the enterocytes. Absorption is efficient and occurs by an active transport mechanism specific for cationic amino acids, CAT, which oversees the intracellular availability of arginine for the synthesis of nitric oxide, polyamines and proline. In humans, daily dietary intake of arginine ranges from 1 to 5 g and it is estimated that 30 to 44% enters the systemic circulation; the remaining 56-70% is metabolized in enterocytes or excreted. Dietary contribution in man seems to be, from the quantitative point of view, higher than endogenous synthesis and has a significant impact on plasma and tissular concentrations of arginine and ornithine (Teixeira, 2003). Soy protein is richer in L-arginine than animal protein. The anticancer effect of soy protein may be due, at least in part, to its high content of this amino acid. Alteration of arginine-methionine balance in the diet of rats with Morris hepatoma transplanted subcutaneously inhibited tumor growth without causing cachexia (Millis et al., 1996; Millis et al., 1998). The soybean has a relatively high content of arginine and a low proportion of methionine. ORNITHINE Carbamyl-P

POLYAMINES ODC CO2 Urea

CITRULLINE

UREA CYCLE

NO● + CITRULLINE

ARGININE NOS NADPH

NADP

O2 Aspartate

ARGININOSUCCINATE

CO2

Fumarate

NO˙: nitric oxide; NOS: nitric oxide synthase; ODC: ornithine decarboxilase

Figure 6. Arginine metabolism

236

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al. 100

Mortality (%)

80 60 40 20 0 -20 -40 Arginine concentration (mg/ml) Figure 7. Influence of arginine concentration on cell mortality

To assess the contribution of arginine in soy hydrolysates cytotoxic effect, it was determined the viability of HeLa cells exposed to different concentrations of arginine (from 0.006 to 100 mg/ml). Figure 7 shows that arginine concentrations ranging from 0.006 to 1.56 mg/ ml (0.03 mM to 8.9 mM) stimulated the growth of cancer cells while there was a decrease of viability from the concentration of 3.13 mg/ml (17.9 mM) reaching maximum inhibition of cells growth (91.3%) at a concentration of 100 mg/ml (IC50=26mM). These arginine concentrations are very high if they are compared with the normal plasma arginine concentrations in humans and animals which range from 95 to 250 µM, depending on developmental stage and nutritional status (Wu and Meininger, 2000). Arginine tissue concentration varies between 100 and 1000 µM. Probably, arginine supplied by the soybeans (6-9 g/100g protein) is not enough to cause inhibition of tumor. Average per capita consumption of soy in Asia ranges from 10 to 30 g/day.

Antioxidant Capacity of Soybean The ability to block DNA damage caused by reactive oxygen species and/or carcinogens is the most direct strategy for preventing the initiation of cancer and for slowing down disease progression. It is here that nutrients play an important role. This is accomplished either directly by free radical scavengers, or indirectly by regulating the activity of Phase I and Phase II metabolizing enzymes in the body (Pecorino, 2005). Soybean seeds contain isoflavones and other phenolic compounds such as caffeic acid, chlorogenic acid, p-coumaric acid, ferulic acid, and syringic and vanillic acids, which have antioxidant effects (Pratt et al., 2006; Kim et al., 2006; Fernandez et al., 2008; Slavin et al., 2009). Isoflavones in soy may play a role in the prevention of cancer through their capacity to affect antioxidant or protective phase II enzyme activities. A study evaluated the effects of dietary isoflavone levels on the induction of antioxidant and phase II enzyme activities. Liver glutathione peroxidase and glutathione reductase activities, blood glutathione levels, kidney glutathione S-transferase and colon quinone reductase (QR) activities were greater in rats consuming the high isoflavone diet compared to rats consuming the casein diet (Appelt and

Soybean Germination and Cancer Disease

237

Reicks, 1999). The induction of NQO1 (NADPH quinone oxidoreductase 1) may be one mechanism by which dietary genistein improves the capacity of the liver to detoxify carcinogens. Diets enriched with genistein (2 g/kg) significantly increased both the hepatic mRNA and activity levels of NQO1 (Wiegand et al., 2009). The antioxidant activity of isoflavones has been proved in order to use them in pharmaceutical formulations to protect the skin against free radicals generated by the ultraviolet radiation exposure (Georgetti et al., 2006; Russo et al., 2006). Genistin and daidzin showed a protective effect on DNA damage and exhibited a superoxide dismutaselike effect when these isoflavones were evaluated in cell-free systems on pBR322DNA cleavage induced by hydroxyl radicals generated from UV photolysis of hydrogen peroxide (Russo et al., 2006). It has been reported that hydrolyzed vegetable proteins are themselves the primary antioxidants, and that they act in synergy with phenolic antioxidants (Bishov and Henick, 1975). The antioxidant capacity of soy protein hydrolysates has been demonstrated in various studies (Peña-Ramos and Wiong, 2002; Khalil et al., 2006) in which longer time of hydrolysis resulted in higher antioxidant activity demonstrating that shorter peptides could be the responsible compounds.

Germination Germination can improve legume nutritional quality. This simple, low-cost process produces a natural product, eliminates or inactivates certain antinutritional factors, and increases the digestibility of proteins and starches in legumes. Germination causes changes in secondary metabolite distribution, mobilizes the reserve proteins stored in the cotyledon protein bodies, changes amino acids composition (Davila et al., 2003) and produces intermediate molecular weight peptides (Wilson et al., 1986; Mora-Escobedo et al., 2009). It can therefore improve the nutritional and nutraceutical properties of legumes by modifying metabolite contents and generating peptides and amino acids with possible biological activity (Figure 8).

Figure 8. Seed changes during germination

238

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Germination begins when viable, quiescent seeds imbibe water and, as a result, the conserved biochemical machinery is activated and metabolic processes are triggered. The completion of germination coincides with the initiation of photosynthetic activity, which completely changes the metabolism of the seedling (Besnier, 1989). During the development of the seed on the mother plant, storage molecules, particularly starches, proteins and triglycerides, are laid down in the seed. These reserves are mobilized during germination and seedling growth to supply the energy and metabolic intermediates needed by the seedling prior to the establishment of photosynthetic autotrophism. In the legume seed a relatively large fraction of these reserves, on a weight basis, is composed of storage proteins, the globulins legumin and vicilin. In the soybean these proteins are called glycinin and βconglycinin, respectively (Wilson et al., 1986). Degradation of storage proteins takes place by means of endopeptidases, which break the internal links of the polypeptides, resulting in small peptides, and by exopeptidases, which release amino acids. In turn, small polypeptides are degraded by hydrolases, which also release peptic amino acids. Dry seeds contain small amounts of exopeptidases that initiate protein degradation after hydration, but the activity of these preformed enzymes does not last long. The endopeptidases are not in the dry seeds. They are synthesized about 48 hours after imbibition; only after this synthesis and the subsequent activity of these proteases begins large-scale degradation of proteins, which generally does not occur before the third day and is maximal after the fifth to sixth day of germination (Mossé and Pernollet, 1983; Besnier, 1989). Wilson et al., (1986) examined the degradation of the main reserve globulins of soybean during the first twelve days of germination and seedling growth. Of the three subunits of βconglycinin, the subunits α and α 'are rapidly degraded from the third day of imbibition and disappeared by the sixth day, while the β subunit was hydrolyzed only after the sixth day. At least six polypeptides, ranging from 33 to 24 kDa molecular weight, appeared as apparent degradation products of β-conglycinin. On the other hand, the glycinin acid chains were hydrolyzed rapidly after the third day of germination to form smaller chains of 21.9 kDa. The basic polypeptides of glycinin appear to be unaltered during the first 8 days of growth, but are rapidly degraded thereafter to unidentified products. It was obtained a similar behavior in our laboratory (Mora-Escobedo et al., 2009). Tan-Wilson et al., (1996) studied the N-terminal sequence of three proteolytic intermediate of the degradation of the subunits α and α‘ by the enzyme called Protease C1 during germination. They found that cleavage sites always produce glutamate or aspartate. Consistent with this observation, synthetic poly-L-Glu inhibits the degradation of the subunits α and α 'of β-conglycinin catalyzed by Protease C1, indicating that this is a specific protease for acid amino acids. The degradation of proteins takes place in the protein bodies where they are stored; the protein bodies form vacuoles as they are digested. The amino acids released or synthesized during this process, are used for the synthesis of new proteins in the growing embryo axis (Besnier, 1989). Protease inhibitors are also degraded during germination of soybean by specific proteases synthesized during germination (Papastoitsis and Wilson, 1991). Park et al., (2005) determined by Western blot the content of Bowman-Birk inhibitor in the cotyledons of soybean, germinated for different times. They found that, under light, BBI increases up to 6 days after soaking, starts to decrease thereafter, an disappears completely at 9 days after soaking. In the dark, BBI continues to increase up to 7 days, decreases thereafter, and

Soybean Germination and Cancer Disease

239

disappears at 10 days after soaking. However, other studies report a decrease in the content or the activity of trypsin inhibitors, after 48 hours of germination (Jiménez et al., 1985; Donangelo et al., 1995, Bau et al., 1997; Kahlil et al., 2006, Kumar et al., 2006). Tan-Wilson et al., (1982) reported the decrease of the major BB inhibitor (BB-E) in the cotyledons of soybeans whereas one of three other minor species (BB-D) of this inhibitor augmented up day six. The content of the major Kunitz proteinase inhibitor (K-B) also decreased during germination but much more slowly. Kumar et al., (2006) found a gradual decrease of trypsin inhibitor activity during germination reaching up 62.1 and 68.4 % inhibition in JS80-21 and JS71-05 varieties, respectively, at 35ºC after six days of germination. Lunasin is degraded during germination. Lunasin starts to decrease at 2 days after soaking and disappears completely at 7 days under light and dark conditions (Park et al., 2005). In opposition, Paucar et al., (2010) found that germination of soybean for 42 h at 25 ºC results in an increase of 61.7% of lunasin. However there was a considerable decrease at 32ºC in the same time of germination. They also found that germination contributed to a decrease of 58.7 % in lectin levels in comparison to ungerminated soybean flour. Saponins also suffer great changes during germination. Jyoti et al., (2007) found an increase in saponin content from 2.8 to 8.9% after 4 days of germination. The predominant hydrolytic product of saponin – soysapogenol I – content increased from 1.8 to 7.3% during the course of germination. Shimoyamada and Okubo (1991) also obtained a 15-fold increase in the concentration of soyasaponin I in epicotyl, hypocotyl and radicle in light conditions, and increased 8-fold in dark conditions, after 8 days of germination. The majority of work related to the effect of germination on the total isoflavone content, report an increase between the first and second day of germination followed by a slow decrease thereafter (Schmith and Quirmbach , 2002; Zhu et al., 2005; Lin and Lai, 2006; Paucar-Menacho et al., 2010). However, Park et al., (2005) reported a constant behavior of genistein and daidzein contents up to day 5 of soaking, increasing dramatically at days 6 and 7 and decreasing thereafter, in the dark. Whereas there was only a slight increase after 5 days of germination in light conditions. In this study isoflavones were analyzed in cotyledon protein extracts, while in the other ones genistein and daidzein were determined in the whole sprout. Chiarello et al., (2006) also found no change in total content of isoflavones during the first three days but the germination for 7 days increased the bioavailability of aglycones seven times. Figure 9, shows that protein isolates obtained in our laboratory of soy germinated at different times, retained substantial amounts of genistein, daidzein, total phenolic compounds, and saponins. The content of these compounds increased as the germination time progressed. Total phenolics increased more than 2 fold at 5 days of germination. Genistein was found to increase 2.7 fold and daidzein 3.2 fold, after 2 days of germination. Daizein increased up 7.6 fold after 5 days of germination. On the other hand, saponins increased 2.8 fold after 6 days of germination.

240

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Figure 9. Changes in genistein, daidzein, total phenolic compounds and saponins in protein isolates during germination

Effect of Germination on Anticancer Properties of Soy Protein Park et al., (2005) found that germination has an effect on the capacity of soy protein to inhibit malignant transformation in NIH/3T3 cells. They demonstrated that protein extracts from early soaking times inhibit foci formation more and suppress cell viability less than those from later soaking times. Light and dark conditions had no influence on the bioactivities of protein extracts. The anticancer effect of protein isolated from soybean germinated for different times was proved on HeLa and C-33 cervical cancer cells (Mora-Escobedo et al., 2009). Soybean was germinated for 0-6 days and protein isolated from the seeds. Isolates with and without ethanol-soluble phytochemicals (ESPC) were hydrolyzed with digestive enzymes (pepsin, pancreatin and peptidase) and their effect on growth in HeLa, C-33 and HaCaT (noncancerous human keratinocytes) cells was evaluated. The hydrolysates inhibited growth in the cancer cells in a concentration-dependent manner. The hydrolysate from soy germinated for 2 days with ESPC had the highest cytotoxic effect, with an IC50 of 2.15 mg/ml against HeLa cells and 2.27 mg/ml against C-33 cells. Among the hydrolysates without ESP, that from soy germinated for six days exhibited maximum inhibition (IC50 = 4.01 and 4.47 mg/ml against HeLa and C-33, respectively). The hydrolysates with ESPC had lower inhibitory concentrations (i.e. greater cytotoxicity) than the hydrolysates without ESPC. Apparently, the soy protein acts synergically with the ESPC against cancer cells. On the other hand, hydrolysate cytotoxicity to normal cells was minimum compared to cancer cells.

Soybean Germination and Cancer Disease

241

Our studies have shown that peptides generated during germination can alter cell signaling pathways and cause apoptosis. The treatment of HeLa cells with a peptide fraction from the hydrolysate of soy germinated for 6 days (free of ESPC) decreased the PTTG and TOP2A mRNA expression, causing apoptosis in HeLa cells. PTTG1 (Pituitary tumor transforming gene) and TOP2A (DNA topoisomerase II alpha) are genes whose overexpression has been related with promalignant characteristic in several cancer types and have been considered as therapeutic targets (Chen et al.,1999; Solbach et al., 2005; Panguluri et al., 2008). Recent studies show that down regulation of PTTG in tumor cell lines and tumors in vivo results in suppression of tumor growth (Panguluri et al., 2008). PPTG down regulation sensitizes HeLa cells to undergo apoptosis when the DNA damage is too serious to repair (Lai et al., 2007). We also tested the germinated soy protein in vivo. Protein isolated from soy germinated for 2 and 6 days (with and without ESPC) was fed to nude mice implanted with HeLa cells. Compared with casein-fed controls, the tumor volumes after 5 weeks were reduced by 44.6 % by ungerminated soy protein (SP), 98.8 % by 2 days of germination SP, 97.7 % by 2 days of germination SP without ESPC, 96.2 % by 6 days of germination SP, and 92.7 % by 6 days of germination SP without ESPC. Histologic examination of the tumor tissues showed that consumption of soy products increases both apoptotic and necrotic death.

CONCLUSION Previous results indicate that germination can improve the anticancer properties of soy protein probably due to generation of peptides with biological activity. It is possible that these peptides act in a synergic way with other bioactive phytochemicals such as saponins, phytates, isoflavones, and other phenolic compounds. Further studies are needed in order to find the identity of the anticancer peptides generated during germination and to study the possibility of increasing its content through the modern techniques of breeding and genetic engineering. In addition, pharmacokinetics studies are required in order to know the bioavailability of bioactive molecules and the optimal dose required to have clinical effects. Germinated soy protein isolates could be used as ingredients of functional food.

REFERENCES Allred, C. D., Hu, Y. H., Allred, K. F.,Chang, J. & Helferich, W. G. (2001). Dietary genistin stimulates growth of estrogen-dependent breast cancer tumors similar to that observed with genistein. Carcinogenesis, 22, 1667-1673. Anderson, R. L. & Wolf, W. J. (1995). Compositional changes in trypsin inhibitors, phytic acid, saponins and isoflavones related to soybean processing. J. Nutr., 125, 581S-588S. Appelt, L. C. & Reicks, M. M. (1999). Soy induces phase II enzymes but does not inhibit dimethylbenz[a]anthracen-induced carcinogenesis in female rats. J. Nutr., 129, 18201826.

242

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Armstrong, W. B., Kennedy, A. R., Wan, X. S., Atiba, J., McLaren, C. E. & Meyskens, F. L. (2000). Single-Dose Administration of Bowman-Birk Inhibitor Concentrate in Patients with Oral Leukoplakia. Cancer Epidemiology Biomarkers & Prevention, 9, 43-47. Armstrong, W. B., Kennedy, A. R., Wan, X. S., Taylor, T. H., Nguyen, Q. A., Jensen, J., Thompson, W., Lagerberg, W. & Meyskens, F. L. (2000). Clinical Modulation of Oral Leukoplakia and Protease Activity by Bowman-Birk Inhibitor Concentrate in a Phase IIa Chemoprevention Trial. Clin. Cancer Res., 6, 4684 - 4691. Badger, T. M., Ronis M. J. J., Simmen, R. C. M. & Simmen, F. A. (2005). Soy protein isolate and protection against cancer. J. of the American College of Nutrition, 24, 146S-149S. Bandele, O. J. & Osheroff, N.(2007). Bioflavonoids as poisons of human topoisomerase II alpha and II beta. Biochemestry, 46, 6097-6108. Barac, M. B., Stanojevic, S. P. & Pesic, M. B. (2005). Biolgically active components of soybeans and soy protein products-A review. APTEFF, 36,155-168. Barnes, S. (1995). Effect of genistein on in vitro and in vivo models of cancer. J. Nutr., 125, 777S-781S. Bau, H. M., Villaume, C., Nicolas, J. P. & Méjean, L. (1997). Effect of germination on chemical composition, biochemical constituents and antinutritional factors of soya bean (Glycine max) seeds. J. of the Science of Food and Agriculture, 73, 1-9. Besnier, R. F. (1989). Semillas, Biología y Tecnología. Editorial Mundi-Prensa. Madrid, España. Billings, P. C., St. Clair, W. H., Maki, P. A. & Kennedy, A. R. (1992). Distribution of the Bowman Birk protease inhibitor in mice following oral administration. Cancer Lett., 62, 191-197. Bishov, S. J. & Henick, A. S. (1975). Antioxidant effects of protein hydrolysis in freeze dried model systems. Synergistic action ith a series of phenolic antioxidants. J. Food Sci., 40, 345-348. Bonavida, B., Khineche, S., Huerta-Yepez, S. & Garbán, H. (2006). Therapeutic potential of nitric oxide in cancer. Drug Resistance Updates, 9(3), 157-173. Breillout, F., Antoine, E. & Poupon, M. F. (1990). Methionine dependency of malignant tumors: a possible approach for therapy. J. Natl Cancer Inst., 82, 1628-1632. Breillout, F., Hadida, F., Echinard-Garvin, P, Lascaux, V. y & Poupon, M. F. (1987). Decresed rat rhabdomyosarcoma pulmonary metastasis in response to a low methionne diet. Anticancer Res., 7, 861-868. Brownson, D. M., Azios, N. G., Fuqua, B. K., Dharmawardhane, S. F. & Mabry, T. J. (2002). Flavonoid effects relevant to cancer. J. Nutr., 132, 3482S-3489S. Cassidy, A., Brown, J. E., Hawdon, A., Faunghnan, M. S., King, L. J., Millward, J., Zimmer, L., Wolfe, B. & Setchell, K. D. R. (2006). Factors affecting the bioavailability of soy isoflavones in humans after ingestion of physiologically relevant levels from different soy foods. J. Nutr., 136, 45-51. Chen, G., Templeton, D., Parker, S. & Stacey, D. W. (1999). Ras stimulates DNA topoisomerase IIα through MEK: a link between oncogenic signaling and a therapeutic target. Oncogene, 18, 7149-7160. Chen, Y., Huang, S., Lin-Shiau, S. & Lin, J. (2005). Bowman-Birk inhibitor abates proteasome function and suppresses the proliferation of MCF7 breast cancer cells through accumulation of MAP kinase phosphatase-1. Carcinogenesis, 26(7), 296-1306.

Soybean Germination and Cancer Disease

243

Chiarello M. D., Le Guerroue, J. L., Chagas, C. M. S., Franco, O. L., Bianchini, E. & Joao, M. J. (2006). Influence of heat treatment and grain germination on the isoflavone profile of soy milk. J. Food Biochem., 30, 234-247. Clawson, G. A. (1996). Protease inhibitors and carcinogenesis. A review. Cancer investigation, 14, 597-608. Davila, M., Sangronis, E. & Granito, M. (2003). Leguminosas germinadas o fermentadas: alimentos o ingredientes de alimentos funcionales. Arch. Latinoam. Nutr., 53, 348-354. de Lumen, B.O., Fitch, M., Lim Ch., Reys, I., Vichayavilas, P., Chu, H., Lee, J., Kim, H., Hurwitz, R., Fang, Y. & Jeong, H. J. (2005). Lunasin, a Novel Cancer Preventive Soy Peptide: Bioavailability and Biokinetics in Animals The Second AICR/WCRF International Expert Report: Food, Nutrition, Physical Activity, and Cancer Prevention: a Global Perspective. Martin J. Wiseman. World Cancer Research Fund International, London, UK. J. Nutr., 135, 3037S-3060S. Donangelo, C. M., Trugo, L. C., Trugo, N. M. F. & Eggum, B. O. (1995). Effect of germination of legume seeds on chemical composition and on protein and energy utilizatation in rats. Food Chem., 53, 23-27. Ellington, A. A., Berhow, M. & Singletary, K. W. (2005). Induction of macroautophagy in human colon cancer cells by soybean B-group triterpenoid saponins. Carcinogenesis, 26, 159-167. Epner, D. E. (2001). Can dietary methionine restriction increase the effectiveness of chemotherapy in treatment of advanced cancer? J. Am.Coll. Nutr., 20(5), 443S-449S. Fernandez, R., Frias, J., Zielinski, H., Piskula, M., Koslowska, H. & Vidal-Valverde, C. (2008). Kinetic study of the antioxidant compounds and antioxidant capacity during germination of Vigna radiata cv. emmerald, Glycine max cv. Jutro and Glycine max cv. Merit. Food Chem., 111, 622-630. Ferry, S., Matsuda, M., Yoshida, H. & Hirata, M. (2002). Inositol hexakisphosphate blocks tumor cell growth by activating apoptotic machinery as well as by inhibiting the AktNFκB-mediated cell survival pathway. Carcinogenesis, 23, 2031-2041. Fournier, D. B., Erdman, J. W. & Gordon, G. B. (1998). Soy, its components and cancer prevention: A review of the in vitro, animal and human data. Cancer Epidemiology, Biomarkers and Prevention, 7, 1055-1065. Friedman, M. & Brandon, D. (2001). Nutritional and health benefits of soy proteins. J. Agr. Food Chem., 49, 1069-1086. Gallo, D., Zannoni, G. F., De Estefano, I., Mosca, M., Ferlini, C., Mantuano, E. & Scambia, G. (2008). Soy phytochemicals decrease nonsmall cell lung cancer growth in female athymic mice. J. Nutr., 138, 1360-1364. Gálvez, A. F. & de Lumen B. O. (1999). A soybean cDNA encoding a chromatin-binding peptide inhibits mitosis of mammalian cells. Nature Biotechnology, 17, 495- 500. Gálvez, A. F., Chen, N., Macasieb, J. & de Lumen, B. O. (2001). Chemopreventive property of a soybean peptide (lunasin) that binds to deacetylated histones and inhibits acetylation. Cancer Res., 61, 7473-7478. Ganguli, Ch. & Das, S. (1994). Plant Lectins as Inhibitors of Tumor Growth and Modulators of Host Immune Response. Chemotherapy, 40, 272-278. Georgetti, S. R., Casagrande, R., Moura de Carvalho, F. B., Verri, W. A. & Vieira, M. J. (2006). Evaluation of the antioxidant activity of soybean extract by different in vitro

244

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

methods and investigation of this activity after its incorporation in topical formulations. European J. of Pharmaceutics and Biopharmaceutics, 64, 99-106. Gestetner, B., Birk, Y. & Tencer, Y. (1968). Soybean saponins: fate of ingested soybean saponins and the physiological aspect of their hemolytic activity. J. Agr. Food Chem., 16, 1031-1035. González de Mejía E. & Prisecaru V. I. (2005). Lectins as Bioactive Plant Proteins: A Potential in Cancer Treatment. Critical Reviews in Food Science and Nutrition, 45(6), 425-445. González de Mejía, E., Jeanmenne, T. R., Vasconcez, C., de Lumen, B. O. & Randall, N. (2004). Lunasin concentration in different soybean genotypes, commercial soy protein and isoflavones products. J. Agric. Food Chem., 52, 5882-5887. Guo, H. Y., Herrera, H., Groce, A. & Hoffman, R. M. (1993). Expression of the biochemical defect of methionine dependence in fresh patient tumors in primary histoculture. Cancer Res., 53, 2479-2483. Handayani, R., Rice, L., Cui, Y., Medrano, T. A., Samedi, V. G., Baker, H. V., Szabo, N. J. & Shiverick, K. T. (2006). Soy isoflavones alter expression of genes associated with cancer progression, including interleukin-8, in androgen-independent PC-3 human prostate cancer cells. J. Nutr., 136, 75-82. Hawrylewicz, E. J., Huang, H. H. & Blair, W. H. (1991). Dietary soybean isolate and methionine supplementation affect mammary tumor progression in rats. J. Nutr., 121, 1693-1698. He, Y. Ch., Wang, Y. H., Cao, J., Chen, J. W., Pan, D. Y. & y Zhou, Y. K. (2003). Effect of complex aminoacid imbalance on growth of tumor in tumor-bearing rats. World J. of Gastroenterology, 9, 2772-2775. Hernández-Ledesma, B., Hsieh Ch. & de Lumen, B. O. (2009). Lunasin, a novel seed peptide for cancer prevention. Peptides, 30, 426-430. Hernández-Ledesma, B., Hsieh Ch. & de Lumen, B. O. (2009). Lunasin and Bowman-Birk protease inhibitor (BBI) in US commercial soy foods. Food Chem., 115, 574-580. Ishaaya, I., Birk, Y., Bondi, A. & Tencer, Y. (1969). Soybean saponins IX: Studies of their effect on birds, mammals and cold-blooded organisms. J. Sci. Food Agric., 20, 433436. Jeong, H. J., Jeong, J. B., Kim D. S. & de Lumen, B. B. (2007). Inhibition of core histone acetylation by the cancer preventive peptide lunasin. J. Agric. Food Chem., 55, 632637. Jeong, H., Park, J. H., Lam, Y. & de Lumen, B. O. (2003). Characterization of lunasin isolated from soybean. J. Agr. Food Chem., 51, 7901-7906. Jiménez, M. J., Elias, L. G., Bressani, R., Navarrete, D. A., Gómez, R. & Molina, M. R. (1985). Biochemical and nutritional studies of germinated soybean seeds. Arch. Latinoam. Nutr., 35, 480-90. Jyothi, T. C., Sindhu, K. T. C. & Appu Rao, A. G. (2007). Influence of germination on saponins in soybean and recovery of soysapogenol I. J. of Food Biochem., 31, 1-13. Kang, J., Sung, M., Kawada, T., Yoo, H., Kim, Y., Kim, J. & Yu, R. (2005). Soybean saponins suppress the release of proinflammatory mediators by LPS-stimulated peritoneal macrophages. Cancer Letters, 230(2), 219-227.

Soybean Germination and Cancer Disease

245

Kanga, J., Hanb, I., Sungb, M., Yooc, H., Kimd, Y., Kime J., Kawadaf, T. & Yua, R. (2008). Soybean saponin inhibits tumor cell metastasis by modulating expressions of MMP-2, MMP-9 and TIMP- 2. Cancer Letters, 261, 84-92. Kennedy, A. R. (1995). The evidence for soybean products as cancer preventive agents. J. Nutr., 125, 733S-743S. Kennedy, A. R. (1998). The Bowman-Birk inhibitor from soybeansas an anticarcinogenic agent. Am J Clin Nutr., 68(suppl), 1406S-1412S. Khalil, A. S., Mohamed, S., Taha, F. & Norberdg, E. (2006). Production of functional protein hydrolysates from Egyptian breeds of soybean and lupin seeds. African J. Biotechnol., 5, 907-916. Kim, E., Kim, S., Chung, J., Chim, H., Kim, J. & Cung, L. (2006). Analysis of phenolic compounds and isoflavones in soybean seeds (Glycine max (L.) Merril) and sprouts grown under different conditions. Eur Food Res Technol., 222, 201-208. Kim, H., Yu R., Kim, J., Kim, Y. & Sung M. (2004) Antiproliferative crude soy saponin extract modulates the expression of IκBα, protein kinase C, an cyclooxygenase-2 in human colon cancer cells. Cancer Letters, 210(1), 1-6. Kobayashi, H., Suzuki, M., Kanayama N. & Terao, T. (2004). A soybean Kunitz trypsin inhibitor suppresses ovarian cancer cell invasion by blocking urokinase upregulation. Clinical and Experimental Metastasis, 21,159-166. Kobayashi, H., Yoshida, R., Kanada, Y., Fukuda, Y., Yagyu, T., Inagaki, K., Kondo, T., Kurita, N., Suzuki, M., Kanayama, N. & Terao, T. (2005). Dietary Supplementation of Soybean Kunitz Trypsin Inhibitor Reduces Lipopolysaccharide-Induced Lethality in Mouse Model. Shok, 23, 441-447. Kobayashi, H., Yoshida, R., Kanada, Y., Fukuda,Y., Yagyu, T., Inagaki, K., Kondo, T., Kurita, N., Yamada, Y., Sado, T., Kitanaka T., Suzuki, M., Kanayama, N. & Terao, T. (2008). A soybean Kunitz trypsin inhibitor reduces tumor necrosis factor-α production in ultraviolet-exposed primary human keratinocytes. Experimental Dermatology, 4(10), 765-774. Kumar, V., Rani, A., Pandey, V. & Chauhan, G. (2006). Changes in lipoxygenase isozymes and trypsin inhibitor activity in soybean during germination at different temperatures. Food Chem., 99, 563-568. Lai, Y., Xin, D., Bai, J., Mao, Z. & Na, Y. (2007). The important anti-apoptotic role and its regulation mechanism of PTTG1 in UV-induced apoptosis. J. Biochem. Mol. Biol., 40, 966-972. Lam, Y., Gálvez, A. F. & de Lumen, B. O. (2003). Lunasin suppresses E!A-mediated transformation of mammalian cells but does not inhibit growth of immortalized and established cancer cell lines. Nutr Cancer, 47, 88-94. Le, X., Wei, D., Huang, S., Lancaster, J. & Xie, K. (2005). Nitric oxide synthase II suppresses the growth and metastasis of human cancer regardless of its up-regulation of protumor factors. PNAS, 102, 8758-8763. Li, D., Yee, J. A., McGuire, M. H., Murphy, P. A. & Yan, L. (1999). Soybean isoflavones reduce experimental metastasis in mice. J. Nutr., 129, 1075-1078. Li, L., Kilbourn, R., Adams, J. & Fidler, I. (1991) Role of nitric oxide in lysis of tumor cells by cytokine-activated endothelial cells. Cancer Res., 51, 2531-2535. Lin, P. & Lai, H. (2006). Bioactive compounds in legumes and their germinated products. J. Agric. Food Chem., 54, 3807-3814.

246

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Lind, S. (2004) Arginine and Cancer. J. Nutr., 134, 2837S-2841S. Liu, R. H. (2003). Health benefits of fruit and vegetables are from aditive and synergistic combinations of phytochemicals. Am J Clin Nutr., 78, 517S-520S. MacDonald, R. S., Guo, J., Copeland, J., Browning, J. D., Sleper, D., Rottinghaus, G. E. & Berhow, M. A. (2005). Environmental influences on isoflavones and saponins in soybeans and their role in colon cancer. J. Nutr., 135, 1239-1242. MacDonald, R. S., Przybyszewski, J., Sleper, D. & Berhow, M. (2007). Soy isoflavones and saponins provide modest protection from colon cancer in a mouse model. The FASEB Journal, 21, 853-6. Millis, R. M., Diya C. A., Reynolds, M. E., Dehkordi, O. & Bond, V. (1998). Growth inhibition of subcutaneously transplanted hepatomas without cachexia by alteration of the dietary arginine-methionine balance. Nutrition and Cancer, 31(1), 49-55. Millis, R. M., Diya, C. A. & Reynolds, M. E. (1996). Growth inhibition of subcutaneously transplanted hepatomas by alterations of the dietary arginine-methionine balance. Nutr. Cancer, 25(3), 317-327. Milner, J. A., Stepanovich, L. V. (1979). Inhibitory effect of dietary arginine on growth of Ehrlich ascites tumor cells in mice. J. Nutr., 109, 489-494. Mora-Escobedo, R., Robles-Ramírez, M. C. & Ramón-Gallegos, E. (2009). Effect of protein hydrolysates from germinated soybean on cancerous cells of the human cervix: an in vitro study. Plant Foods Hum. Nutr., 64, 271-278. Mossé, J. & Pernollet, J. C. (1983). Storage proteins of legume seeds. En: Chemistry and Biochemistry of Legumes. Edited by S.K. Arora. Edward Arnold Limited. UK. Motoo,Y.,Taga, K. & Su, S. B. (2000). Arginine induces apoptosis and gene expression of pancreatitis-associated protein in rat pancreatic acinar AR4-2J cells. Pancreas, 20, 6166. Oki, T., Sowa, Y., Hirose, T., Takagaki, N., Horinaka, M., Nakanishi, R., Yasuda, Ch., Kanasawa, M., Satomi, Y., Nishino, H., Miki, T. & Sakai, T.(2004). Genistein induces Gadd45 gene and G2/M cell cycle arrest in the DU145 human prostate cancer cell line. FEBS Letters, 577, 55-59. Panguluri, S. K., Yeakel, C. & Kakar, S. S. (2008). PTTG: an important target gene for ovarian cancer therapy. J. Ovarian Res., 1, 6. Papastoitsis, G. & Wilson, K. A. (1991). Initiation of the degradation of the soybean Kunitz and Bowman-Birk tripsin inhibitors by a cystein protease. Plant Physiol., 96, 10861092. Park, J. H., Jeong, H. J. & de Lumen, B. O. (2005). Contents and bioactivities of lunasin, Bowman-Birk inhibitor, and isoflavones in soybean seed. J. Agric. Food Chem., 53, 7686-7690. Park, J. H., Jeong, H. J. & Lumen, B. O. (2007). In vitro digestibility of the cancer-preventive soy peptides lunasin and BBI. J. Agric. Food Chem., 55, 10703-10706. Paucar-Menacho, L. M., Berhow, M. A., Gontijo, M. J. M., González de Mejía, E. & Chang, Y. K. (2010). Optimization of germination time and temperature on the concentration of bioactive compounds in Brazilian soybean cultivar BRS 133 using response surface methodology. Food Chem., 119, 636-642. Pavillard, V., Nicolaou, A., Double, J. A. & Phillips, R. M. (2006). Methionine dependence of tumors: a biochemical strategy for optimizing paclitaxel chemosensitivity in vitro. Biochem. Pharmacol., 71, 772-778.

Soybean Germination and Cancer Disease

247

Pecorino, L. (2005). Molecular Biology of Cancer. Mechanisms, targets and therapeutics. Oxford University Press. New York, U.S.A. Pena-Ramos, E. A. & Xiong, Y. L. (2002). Antioxidant activity of soy protein hydrolysates in liposomal system. J. Food Sci., 67, 295-301. Poirson-Bichat, F., Bras Goncalves, R. A., Miccoli, L., Dutrillaux, B. & Poupon, M. F. (2000). Methionine depletion enhances the antitumoral efficacy of cytotoxic agents in drug-resistant human tumor xenografts. Clinical Cancer Res., 6, 643-653. Pratt, D. E., Di Pietro, C., Porter, W. L. & Giffee, J. W. (2006). Phenolic antioxidants of soy protein hydrolyzates. J.Food Sci., 47, 24-35. Qingyorng, M., Williamson, K. E., O'Rourke, d. & Brian, J. Rowlands. (1998). The effects of L-Arginine on crypt cell hyperproliferation in colorectal cancer. J. of Surgical Research, 81, 181-188. Rao, A. V. & Sung, M. K. (1995). Saponins as anticarcinogens. J. Nutr., 125, 717S-724S. Russo, A., Cardile, V., Lombardo, L., Vanella, l. & Acquaviva, R. (2006). Genistin inhibits UV light-induced plasmid DNA damage anfd cell growth in human melanoma cells. The J. of Nutr. Biochem., 17, 103-108. Salunkhe, D. K. & Desphande, S. S. (1991). Foods of plant origin: production, technology, and human nutrition. Ed. New York: Van Nostrand Reinhold. Schmith, B. & Quirmbach, M. (2002). Content of selected isoflavones in plants and plant cell cultures of soybean. Current Topics in Phytochemistry, 5, 91-98. Setchell, K. D. R. & Cassidy, A. (1999). Dietary isoflavones: Biological effects and relevance to human health. J. Nutr., 129, 758S-767S. Setchell, K. D. R. & Cassidy, A. (1999). Dietary isoflavones: Biological effects and relevance to human health. J. Nutr., Setchell, K. D. R. y A. Cassidy. Dietary isoflavones: Biological effects and relevance to human health. J. Nutr., 129, 758S-767S, 1999. 129, 758S-767S. Shamsuddin, A. M., Ullah, A. & Chakravarthy, A. K. (1989). Inositol and inositol hexaphosphate suppress cell proliferation and tumor formation in CD-1 mice. Carcinogenesis, 10, 1461-1463. Shamsuddin, A. M., Vucenik, I. & Cole, K. E. (1997). IP6: a novel anti-cancer agent. Life Sci., 61, 343-354. Shamsudding, A. M., Yang, G. Y. & Vucenik, I. (1996). Novel anti-cancer functions of IP6: growth inhibition and differentiation of human mammary cancer cell lines in vitro. Anticancer Res., 16, 3287-92. Shimoyamada, M. & Okubo, K (1991). Variation in saponin contents in germinating soybean seeds and effect of light irradiation. Agric. Biol. Chem., 55, 577-579. Singh, A. V., Franke, A. A., Blackburn, G. L. & Zhou, J. R. (2006). Soy phytochemicals prevent orthotopic growth and metastasis of bladder cancer in mice by alterations of cancer cell proliferation and apoptosis and tumor angiogenesis. Cancer Res., 66, 18518. Singh, B., Bhat, T. K. & Singh, B. (2003). Potential therapeutic applications of some antinutritional plan secondary metabolites. J. Agr. Food Chem., 51, 579-5597. Slavin, M., Cheng, Z., Luther, M., Kenworthy, W. & Yu, L. (2009). Antioxidant properties and phenolic, isoflavone, tocopherol and carotenoid composition of Maryland-grown soybean lines with altered fatty acid profiles. Food Chem., 114, 20-27.

248

María del Carmen Robles Ramírez, Eva Ramón Gallegos et al.

Solbach, C., Roller, M., Peters, S., Nicoletti, M., Kaufmann, M. & Knecht, F. (2005). Pituitary-tumor transforming gene (PTTG): a novel target for anti-tumor therapy. Anticancer Res., 25, 121-125. Tan-Wilson, A. L., Liu, X., Chen, R., Qi, X. & Wilson, K. A. (1996). An acidic aminoacidspecific protease from germinating soybeans. Phytochemistry, 42, 313-319. Tan-Wilson, A. L., Rightmire, B. R. & Wilson, K. A. (1982). Different rates of metabolism of soybean proteinase inhibitors during germination. Plant Physiol., 70, 493-497. Teixeira, D., Santaolaria, L. & Iglesias, E. (2003). La arginina en su contexto metabólico y fisiológico. Acta Bioquím. Clín. Latinoam., 37(2), 165-179. Vucenik I., Zhang, Z. S. & Shamsudding, A. M. (1998). IP6 in treatment of liver cancer. II. Intra-tumoral injection of IP6 regresses pre-existing human liver cancer xenotransplanted in nude mice. Anticancer Res., 18, 4091-4096. Vucenik, I. & Shamsuddin, A. M. (2003). Cancer inhibition by inositol hexaphosphate (IP6) and inositol: from laboratory to clinic. J. Nutr., 133, 3778S-3784S. Wan, X. S., Meyskens, F. L., Armstrong, W. B., Taylor, T. H. & Kennedy, A. R. (1999). Relationship between protease activity and neu oncongene expression in patients with oral leukoplakia treated with the Bowman Birk inhibitor. Cancer Epidem. Biomarkers and Prevention, 8, 601-608. Wang, H., McIntosh, A., Hassinoff, B., Rector, E., Ahmed, N. & Orr, W. (2000). B16 Melanoma cell arrest in the mouse liver induces nitric oxide release and sinusoidal cytotoxic: A natural hepatic defense against metastasis. Cancer Res., 60, 5862-5869. Wang, S. T., Chen, H. W., Sheen, L. Y., y & Li, Ch. K. (1997). Methionine and cysteine affect glutathione level, glutathione-related enzyme activities and the expression of glutation-S- transferase isozymes en rat hepatocytes. J. Nutr., 127, 2135-2141. Wang, W. & González de Mejía, E. (2005). A new frontier in soy bioactive peptides that may prevent age-related chronic diseases. Comprehensive Reviews in Food Science and Food Safety., 4, 63-78. WHO. World health report (2004). statistical anex. Table 2. World Health Organization. Wiegand, H., Wagner, A. E., Boesch-Saadatmandi, C., Kruse, H., Kulling, S. & Rimbach, G. (2009). Effect of dietary genistein on phase II and antioxidant enzymes in rat liver. Cancer Genomics and Proteomics, 6, 85-92. Wilson, K. A., Rightmire, B. R., Chen, J. C. & Tan-Wilson, A. L. (1986). Differential proteolysis of glycinin and β-conglycinin polypeptides during soybean germination and seedling growth. Plant Physiol., 82, 71-76. Wu, Guoyao and Meininger, C. J. (2000). Arginine nutrition and cardiovascular function. J. Nutr., 130, 2626-2629. Xie, K. & Huang, S. (2003). Contribution of nitric oxide-mediated apoptosis to cancer metastasis inefficiency. Free Radic Biol Med., 34, 969-986. Yang, G. Y. & Shamsudding, A. M. (1995). IP6-induced growth inhibition and differentiation of HT-29 human colon cancer cells: involvement of intracellular inositol phosphates. Anticancer Res., 15, 2479-2487. Yim, C., Bastian, N., Smith, J. & Samlowski, W. (1993). Macrophage nitric oxide sythesis delays progression of ultraviolet light-induced murine skin cancers. Cancer Res., 53, 5507-5511.

Soybean Germination and Cancer Disease

249

Yu, Z., Tang, Y., Hu, D. & Li, J. (2005). Inhibitory effect of genistein on mouse colon cancer MC-26 cells involved TGF-β1/Smad pathway. Biochem. and Biophys. Res. Communications, 333, 827-832. Zhang Z., Song, Y. & Wang, X. L. (2005). Inositol hexaphosphate-induced enhancement of natural killer cell activity correlates with suppression of colon carcinogenesis in rats. World J Gastroenterol., 11, 5044-6. Zhou, J., Gugger, E. T., Tanaka, T., Guo, Y., Blackburn, G. L. & Clinton, S. K. (1999). Soybean phytochemicals inhibit the growth of transplantable human prostate carcinoma and tumor angiogenesis in mice. J. of Nutr., 129, 1628-1635. Zhou, N., Yan, Y., Li, W., Wang, Y., Zheng, L., Han, S., Yan, Y. & Li, Y. (2009). Genistein inhibition of topoisomerase IIα expression participated by Sp1 and Sp3 in HeLa cell. Int. J. Mol. Sci., 10, 3255-3268. Zhu, D., Hettiarachchy, N., Ronny, H. & Chen, P. (2005). Isoflavone contents in germinated soybean seeds. Plant Foods for Human Nutrition, 60, 147-151.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 8

GLYPHOSATE INTERACTIONS WITH PHYSIOLOGICAL, MICROBIOLOGICAL, AND NUTRITIONAL PARAMETERS IN GLYPHOSATE-RESISTANT SOYBEANS

1

Luiz Henrique Saes Zobiole1*, Robert John Kremer2 and Rubem Silvério de Oliveira Jr.1

Center for Advanced Studies in Weed Research, Agronomy Department, State University of Maringá, Maringá, Paraná, Brazil 2 United States Department of Agriculture, Agricultural Research Service, Cropping Systems and Water Quality Research Unit, Columbia, MO1, USA

ABSTRACT The crop area planted to conventional soybeans has decreased annually while that planted to glyphosate-resistant (GR) soybean has drastically increased, mainly due to the wide adoption of glyphosate in current weed management systems. With the extensive use of glyphosate, many farmers have noted visual plant injury in GR soybean varieties after glyphosate application. In fact, glyphosate has intensified deficiencies of numerous essential micronutrients and some macronutrients. The typical symptom is known as "yellow flashing" or yellowing of the upper leaves and, in some cases, has been attributed to the accumulation of the primary phytotoxic metabolite aminomethylphosphonic acid (AMPA); other reports suggest the symptom results from direct damage to chlorophyll, since glyphosate is a strong metal chelator which forms insoluble glyphosate-metal complexes, may immobilize essential micronutrients required as components, co-factors or regulators of physiological functions. Although glyphosate affected photosynthesis of some GR soybean cultivars, nutrient uptake from soil is also reduced indirectly through its toxicity to many soil microorganisms responsible for increasing plant availability of nutrients through mineralization, reduction, and symbiosis associations. Several reports show that glyphosate can directly affect the nitrogen fixing symbiont Bradyrhizobium japonicum. *

Corresponding author: E-mail address: [email protected], Tel: +55 44 3261-8940; fax: +55 44 3261-8940

252

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr. Since this microorganism possesses a glyphosate-sensitive EPSP synthase, some intermediate metabolites including shikimic, hydroxybenzoic and protocatechuic acids accumulate, which inhibit growth and induces death at high concentrations, due to inability of the organism to synthesize essential aromatic amino acids. The loss of energy and fixed N2 provided by B. japonicum may be significant factors responsible for reduced growth and yield in GR soybean. Glyphosate and other herbicides can influence nitrogen metabolism through direct effects on the rhizobial symbiont or through indirect effects on the physiology of the host plant. Glyphosate and root exudates released into the rhizosphere from GR soybean also influence microbial populations and/or activity in the rhizosphere. Previous findings that glyphosate and high concentrations of soluble carbohydrates and amino acids exuded from roots of glyphosate-treated GR soybean, suggest that promotion of rhizosphere and root colonization of GR soybean by specific microbial groups (i.e. Fusarium sp.) may be a combination of stimulation by glyphosate released through root exudation and altered physiology leading to exudation into the rhizosphere of high levels of carbohydrates and amino acids Limited data are available regarding effects of glyphosate on GR soybean physiology, especially those related to photosynthesis. This chapter aims to show that some GR soybeans can be extremely affected by glyphosate, not only by reduced photosynthesis but also decreased nutrient uptake, and reduced shoot and root biomass production, as well as by modified interactions with specific microorganisms, which may negatively impact soybean growth and production. Herbicides are advertised heavily in popular magazines, whereas relatively few publications inform farmers about weed management through the integrated use of cover crops, crop rotation, cultivation and other ecologically based tactics. Thus, with increased problems related to glyphosate use in GR soybean, an approach to minimize glyphosate effects based on increased efficiency of glyphosate by treating weed populations only where and when their densities warrant application, could greatly reduce glyphosate use with a likely decrease in glyphosate injury to GR soybean. However, management based on growth stage and weed population density will need to be considered if this strategy is undertaken. On the other hand, a strategy to decrease the use of glyphosate may involve the use of pre-emergent herbicides or the mixture of residual herbicides with glyphosate in burndown management, thus increasing the long-term weed control allowing farmers to spray the lowest glyphosate rate as possible.

1. INTRODUCTION The global cultivation of soybean has increased annually over the last two decades and in fact is one of the major crops cultivated worldwide. Actually, the crop area planted to conventional soybeans has decreased while that planted to glyphosate-resistant (GR) soybean has drastically increased, mainly due to the wide adoption of glyphosate in current weed management systems based on glyphosate-resistant (GR) soybeans. Glyphosate is the most widely used herbicide worldwide (Woodburn, 2000), principally because it is a non-selective and wide spectrum on weed control including grass and broad weeds and also due several glyphosate-resistant crops, among them the GR soybean. The GR cropping system provided a more cost-effective option for farmers, allowing them to spray a broad spectrum of weeds with glyphosate and reducing the need for pre and post emergence herbicides. However, the repetitive and dedicated use of glyphosate within a growing season and over the past decade has resulted in several problems associated with glyphosate

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

253

interactions with plant nutrient availability, indirect effects on rhizosphere microorganisms and plant pathogens, and development of glyphosate-resistant weeds, which have raised serious concerns regarding the sustainability of cropping systems in which glyphosate is the primary weed management strategy (Yamada et al., 2009). Since the introduction of GR crops in the mid- to late-1990s many consequences associated with production of GR crops were soon reported based on field observations of apparent increased disease and nutritional deficiencies relative to conventional or nontransgenic cultivars. A limited number of studies attempted to quantify or repeat anecdotal observations of glyphosate influences on crop-microorganism interactions, yielding variable results. Field studies conducted in Missouri, U.S.A. during 1997–2007 assessed effects of glyphosate applied to GR soybean and maize on root colonization and soil populations of Fusarium and selected rhizosphere bacteria. Frequency of root-colonizing Fusarium increased significantly after glyphosate application during growing seasons in each year at all sites. Roots of GR soybean and maize treated with glyphosate were heavily colonized by Fusarium compared to non-GR or GR cultivars not treated with glyphosate (Kremer and Means, 2009). Despite the widespread adoption of GR technology and the importance of glyphosate in weed control in worldwide cropping systems, little information is available for accurately understanding the effects of glyphosate on overall GR soybean physiology - especially those related to photosynthesis and nutrition - and microbial interactions.

2. INTERACTIONS OF GLYPHOSATE AND PLANT NUTRITION Glyphosate, N-(phosphonomethyl)glycine, is a foliar-applied, non-selective herbicide with a wide spectrum of weed control, which is translocated throughout the plant to activelygrowing tissues where it inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in the shikimate metabolic pathway. This pathway is responsible for the biosynthesis of aromatic amino acids (Jaworski, 1972), plant defense mechanisms, and phenolic compounds (Sprankle et al., 1975; Boocock and Coggins, 1983; Singh et al., 1991; Hernandez et al., 1999). However the first mode of action reported for glyphosate was as a metal chelator, for which it was initially patented (Bromilow et al., 1993), thus it is considered as a strong chelator of metallic cations (Kabachnik et al., 1974; Coutinho and Mazo, 2005). This property may be one of the causes for decreased shoot concentrations of mineral nutrients in GR soybeans (Zobiole et al., 2010), which is correlated with current farmers‘ reports that the initial development of some GR soybean varieties is visually injured after glyphosate application (Zablotowicz and Reddy, 2007). The symptom is known as "yellow flashing" and, in some cases, has been attributed to the accumulation of the primary phytotoxic metabolite aminomethylphosphonic acid (Reddy et al., 2004; Zablotowicz and Reddy, 2007); other reports suggest the symptom results from direct damage to chloroplasts (Campbell et al., 1976; Pihakaski and Pihakaski, 1980; Nilsson, 1985) or chelation of the Mg components of chlorophyll formation or Mn involved in electron transfer during photosynthesis (Beale, 1978; Taiz and Zeiger, 1998).

254

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

Recent studies demonstrate that glyphosate affects mineral nutrition in GR soybeans. Zobiole et al. (2010a) evaluated the mineral status of GR soybeans, at R1 growth stage, in different maturity group cultivars with glyphosate use compared to their near-isogenic nonGR parental lines. They found that, with exception of N, glyphosate significantly reduced the macro- and micronutrients in leaf tissues of GR soybeans, after either sequentially (600 + 600 g a.e ha-1) or single applications (1200 g a.e ha-1), compared to their near-isogenic nontreated non-GR soybean or nontreated GR soybeans (Table 1). In that experiment, glyphosate application also decreased stomatal conductance, chlorophyll concentration, transpiration and photosynthetic rate which contributed in significant decrease in shoot and root biomass production (Zobiole et al., 2010a). These results demonstrated that glyphosate or one of its metabolites apparently remained active in soybean through the R1 growth stage or later, indicated by the decrease in mineral concentrations in leaf tissue. Decreased shoot and root biomass by glyphosate, probably occurred because of additive effects from decreased photosynthetic parameters and lower nutrient concentration (Zobiole et al., 2010a). These findings also are supported by Bott et al. (2008), who noted that the commercial application of glyphosate to a GR soybean cultivar decreased Mn shoot concentrations by 50% and significantly inhibited root biomass, root elongation and lateral root formation. Table 1. Nutrient concentration used to interpret the results of s oybean leaf tissue (diagnostic leaf) collected at R1 growth stage

Nutrient

N P K Ca Mg S Zn Mn Fe Cu B

Zobiole et al. (2010a)*** Non-GR GR without GR GR Sufficiency* Sufficiency** without glyphosate Sequential Single glyphosate application glyphosate glyphosate application application application ------------------------------------------------g kg-1--------------------------------------------------45.0 – 55.0 40.0 – 55.0 32.90 a 32.21 a 31.35 a 30.61 a 2.5 – 5.0 2.5 – 5.0 2.39 a 2.10 b 1.92 c 1.76 c 17.0 – 25.0 17.0 – 25.0 23.18 a 22.05 a 17.35 c 19.67 b 3.5 – 20.0 3.5 – 20.0 13.19 a 11.19 b 10.81 b 10.01 c 2.5 – 10.0 2.5 – 10.0 4.35 a 3.69 b 3.15 c 3.01 c 2.0 – 4.0 2.0 – 4.0 1.80 a 1.62 b 1.49 c 1.46 c ---------------------------------------------mg kg-1-------------------------------------------------20.0 – 50.0 20.0 – 50.0 72.20 a 52.16 b 48.47 b 47.66 b 20.0 – 100.0 20.0 – 100.0 276.95 a 246.60 b 218.0 c 211.60 c 50.0 – 350.0 50.0 – 350.0 93.56 a 99.97 a 83.49 b 85.14 b 6.0 – 14.0 10.0 – 30.0 18.16 a 13.99 a 9.62 b 6.38 b 20.0 – 55.0 20.0 – 55.0 40.08 a 32.08 b 27.25 c 26.93 c

* Oliveira et al. (2007) ** Mills and Jones (1996) *** Modified from Zobiole et al. (2010a) – Data represents the average of three different maturity group cultivars

The sufficiency nutrient level presented by Mills and Jones (1996) and Oliveira et al. (2007) were generated with conventional cultivars (Table 1). However, these values are currently used by agronomists to determine nutrient sufficiency of both GR and conventional

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

255

soybeans. The results presented in Table 1, showed that the average of the non-GR soybean parental lines cultivars generally had higher nutrient concentrations than their respective nearisogenic GR derivatives, independent of glyphosate application. The critical level of a particular nutrient in the plant may be variable depending on the ability to absorb and/or use the nutrient (Fageria, 1987; Muniz et al., 1985; Fonseca et al., 1988, Scherer, 1998). Thus, the decreased concentration of nutrients in shoots indicate that GR soybeans require different fertilizer recommendations than non-GR soybeans, therefore further research should be conducted to develop updated nutrient sufficiency levels for GR and non-GR cultivars, which would likely indicate higher levels of nutrients required for GR cultivars to achieve physiologically sufficiency (Zobiole et al., 2010a).

Figure 1. Photosynthetic rate (A), SPAD units, fluorescence (Fo) and maximal fluorescence (Fm), at R1 growth stage in GR soybean under increasing glyphosate doses in single (solid line) or sequential (dashed line) applications. Each point represents average of four independent replicates. Modified from Zobiole et al. (2010b)

Moreover, Zobiole et al. (2010b) evaluated, at R1 growth stage, the nutrient accumulation and photosynthesis in GR soybean under different glyphosate rates, both in sequential and single application. In this study the treatments under single applications were applied at V4 stage (24 days after emergence, DAE) and for sequential applications at V4 (24 DAE - 50% of dose) and V7 stage (36 DAE - 50% of dose). They found that photosynthetic rate, SPAD and chlorophyll fluorescence were reduced linearly as glyphosate rate increased (Figure 1). As chlorophyll fluorescence is a measure illustrating photosynthetic efficiency of plants, and

256

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

eventually productivity (Maxwell and Johnson, 2000), the data of Figure 1 suggest that glyphosate might reflect changes in organization and function of the thylakoid membrane. The macro and micronutrient accumulation was strongly reduced by increased doses of glyphosate (Figure 2). According to Eker et al. (2006), after glyphosate is absorbed by the plant, the uptake and transport of cationic micronutrients may be inhibited by the formation of poorly soluble glyphosate-metal complexes within plant tissues. Others authors also have pointed out that glyphosate causes lower availability of nutrients for uptake by plants (Franzen et al., 2003; Bott et al., 2008; Johal and Huber, 2009; Zobiole et al., 2010a).

Figure 2. Macronutrient accumulation at R1 growth stage in GR soybean under increasing glyphosate doses in single (solid line) or sequential (dashed line) applications. Each point represents average of four independent replicates. Modified from Zobiole et al. (2010)

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

257

Figure 3. Shoot and root dry weight at R1 growth stage in GR soybean under increasing glyphosate doses in single (solid line) or sequential (dashed line) applications. Each point represents average of four independent replicates. Modified from Zobiole et al. (2010b)

In general, single glyphosate application affected the nutrient accumulation more than sequential application. Regarding stronger effects of single glyphosate application, two aspects need to be considered: the younger plants and higher doses. The data presented here showed that younger plants (V4 growth stage) are more sensitive to glyphosate effects than plants receiving glyphosate at a later growth stage (V7). Because a single application contains the total dose, it differs from sequential application in which the same dose is fragmented (50%-50%), thus, using a single application, the plant has less time to recover from the likely chelating effects of the higher glyphosate rate (Jaworski, 1972; Kabachnik et al., 1974; Madsen et al., 1978; Glass, 1984; Bromilow et al., 1993; Coutinho and Mazo, 2005; Eker et al., 2006; Zobiole et al., 2010a).

258

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

The biomass production of soybean depends on energy supplied by photosynthesis for synthesizing carbon compounds (Shibles and Weber, 1965). Thus, decreases in A, SPAD units, Fo and Fm, and lower nutrient accumulation may have acted together to reduce the shoot and root biomass production in GR soybeans treated with glyphosate (Figure 3). In this research, shoot, root reductions were proportional to glyphosate dose. Further research is required to evaluate the nutrient sufficiency levels for GR and non-GR plant materials, from which it is expected different levels of nutrients will be required for GR cultivars to achieve physiologically sufficiency relative to conventional cultivars.

3. INTERACTIONS OF GLYPHOSATE AND MICROORGANISMS 3.1. Glyphosate Effects on Beneficial and Detrimental Microorganisms Including Phytopathogens in Transgenic Glyphosate-Resistant Cropping Systems Previous studies have revealed the diverse effects of glyphosate on the biology and ecology of rhizosphere microorganisms and on their interactions with susceptible plant roots in the presence of glyphosate that is released into the rhizosphere (Johal and Huber, 2009; Kremer and Means, 2009). Although the interactions suggest a ―secondary mode of action‖ of glyphosate by pre-disposing susceptible plants to microbial infection (Johal and Rahe, 1984), the potential for developing critical pathogen inoculum levels in soils that affect crop health, altering rhizosphere microbial communities involved in nutrient transformations, and shifting the balance of beneficial and detrimental plant-associated microorganisms are legitimate concerns regarding the impact of glyphosate on crop productivity and environmental sustainability. This is especially significant with consideration to the current widespread use of glyphosate in glyphosate-resistant (GR) cropping (―Roundup Ready‖) systems. Following introduction of GR crops in the mid- to late 1990‘s, many consequences associated with the GR trait were soon reported based on field observations of apparent increased disease and nutritional deficiencies relative to conventional or non-transgenic cultivars. A limited number of studies attempted to quantify or repeat anecdotal observations of glyphosate influences on crop-microorganism interactions, yielding variable results. For example, Sanogo et al. (2000) reported that the GR trait increased susceptibility to sudden death syndrome (SDS) in soybean caused by Fusarium solani pv. glycines [recently reclassified as F. virguliforme (Aoki et al., 2003)]. However, subsequent research (Njiti et al., 2003) failed to reproduce SDS in other GR soybean cultivars. Besides potential disease development, an additional consequence of high densities of Fusarium spp. in the rhizosphere is the potential for production of metabolites that disrupt plant root integrity, releasing nutrients, which are available to the fungi. Toxic metabolites, such as zearalenone from Fusarium spp. have been implicated in enhanced exudation of amino acids from roots of several crop plants (Phillips et al., 2004). Corynespora cassiicola may cause severe root rot on GR soybean in proximity to giant ragweed (Ambrosia trifida) treated with glyphosate (Huber et al., 2005). Altered root exudates and/or glyphosate released from roots of dying ragweed plants appeared to modify the rhizosphere environment and predispose adjacent GR soybean roots to severe Corynespora root rot. Research with Sclerotinia sclerotiorum

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

259

(Sclerotinia root rot) was inconsistent in describing a definite relationship between susceptibility and glyphosate use on GR soybean, leading to the conclusion that effects of the GR trait or glyphosate use on disease susceptibility may be cultivar specific (Lee et al., 2002). Disease severity caused by F. oxysporum and Rhizoctonia solani in GR sugarbeet increased with glyphosate application (Larson et al., 2006). Extensive field studies conducted during 1997 through 2008 demonstrated that Fusarium colonization was consistently higher on GR soybean and GR maize treated with glyphosate (Kremer, 2003; Means, 2004; Kremer and Means, 2009). Colonization of roots by Fusarium spp. ranged two to five times higher with glyphosate compared to no herbicide or with a conventional herbicide; non-transgenic (non-GR) cultivars always showed lowest root colonization. The frequency of root-colonizing Fusarium increased significantly within one week after glyphosate application throughout the growing season in each year at several sites representing various soils. Using a selective culture method (Lévesque et al., 1993), Fusarium-like colonies were detected on surface-sterilized soybean root segments indicating colonization or infection of root tissue by the fungi. Taxonomic diagnosis of representative cultures has consistently been distributed as 70% Fusarium oxysporum complex, 18% Fusarium solani complex, and 10% Fusarium equiseti. The predominance of F. oxysporum is a reflection of its widespread endemic nature in soils. Prevailing weather conditions affected the extent of Fusarium colonization of soybean roots observed each year. A greenhouse study with soil at different water contents verified that glyphosate-treated soybean under extreme moisture stress exhibited about 75% reduction in Fusarium colonization of roots of both GR and non-transgenic cultivars (Means and Kremer, 2007). Similarly, moisture stress reduced nitrogen fixation activity in glyphosate-treated GR soybean considerably more than in untreated plants (King et al., 2001). Studies on glyphosate interactions with microbial communities in GR cropping systems reveal that the most pronounced effects are detected with specific genera or species of microorganisms (i.e., Fusarium, Pythium) rather than with broader measurements of soil microbial diversity and functions. In a review on impacts of disturbance on soil microbial communities, Wardle (1995) suggests that measurement of response by functional groupings may be problematic because individual taxonomic species are likely to be more sensitive to disturbance rather than an entire functional group comprised of multiple taxonomic groups. If herbicide application is considered an external ecosystem disturbance, it is not surprising that glyphosate is often reported to have no effect on soil microbial biomass and diversity and broad functional activities such as soil respiration and soil enzymatic activity in GR cropping systems (Liphadzi et al., 2005, 2009; Lupwayi et al., 2007; Means et al., 2007; Hart et al., 2009). Based on numerous studies of Fusarium spp., Powell and Swanton (2008) proposed several possible mechanisms that may be involved in promoting the proliferation of an individual taxonomic group by glyphosate in GR crops. The mechanisms include direct stimulation of fungal growth by glyphosate, indirect stimulation due to alteration of root exudates components, increase in host susceptibility to pathogens, and decrease in effectiveness of pathogen antagonists. Glyphosate and exudate composition and concentration altered by glyphosate released into the rhizosphere from GR soybean may influence microbial populations and/or activity in the rhizosphere. Previous findings that glyphosate and high concentrations of soluble carbohydrates and amino acids exude from roots of glyphosate-treated GR soybean (Kremer et al., 2005), suggested that impacts on root microbial interactions and micronutrient uptake

260

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

might mirror those described for glyphosate interactions in non-transgenic cropping systems. As noted previously, glyphosate in root exudates may not only serve as a nutrient source for fungi but may also stimulate propagule germination and early growth (Krzysko-Lupicka and Orlik, 1997). When root exudation is excessive, as for glyphosate-treated soybean, root infection by soilborne pathogens is enhanced (Nelson, 1990). Also, Griffiths et al. (1999), indicates that as release of substrates comprised of soluble carbohydrates and amino acids increased, the proportion of fungi in the rhizosphere community also increased compared with that of bacteria. Therefore, the structure of the microbial community is not solely governed by composition of exudates but that optimal growth of different microorganisms is also related to quantity of available substrates. Thus glyphosate released into the rhizosphere of GR soybean combined with release of high concentrations of carbohydrates and/or amino acids favor increased growth of Fusarium spp., illustrated by the results from repeated field studies with GR soybean (Kremer, 2003; Means, 2004; Kremer and Means, 2009). Recent studies documenting reduced pseudomonad numbers in GR soybean rhizospheres provide support for an antagonist suppression mechanism by which glyphosate promotes Fusarium spp. in GR crop rhizospheres (Kremer and Means, 2009). The relative proportion of fluorescent pseudomonads detected via selective culture was always higher in conventional soybean rhizosphere relative to the GR soybean treatments. Fluorescent pseudomonads may be reduced by GR soybean due to their reported sensitivity to glyphosate (Schulz et al., 1985) exuded into the rhizosphere or because antagonistic activity is overcome by glyphosate (Wardle and Parkinson, 1992). A negative relationship between population size of fluorescent pseudomonads and Fusarium root colonization further demonstrated that GR soybean and/or glyphosate was involved in shifting the rhizosphere microbial balance. Using bioassays, single cultures of most fluorescent pseudomonads were antagonistic toward Fusarium, some via protease activity. Further examination revealed that an additional antagonism mechanism was related to the Mn-reducing ability of the fluorescent pseudomonads (Kremer and Means, 2009). Glyphosate interactions with other components of the rhizosphere community in GR crops include a proliferation of Mn-oxidizing microorganisms (Johal and Huber, 2009; Kremer and Means, 2009) and Agrobacterium spp. (Kremer and Means, 2009). Manganese is considered a crucial micronutrient in plant disease resistance and pathogen interactions (Thompson and Huber, 2007). Proliferation of Mn-oxidizing microorganisms, causing immobilization of Mn in the rhizosphere of GR plants, confounds the micronutrient deficiency symptoms often observed in these crops (Johal and Huber, 2009). Expression of Mn-transforming bacterial components as a ratio of Mn-reducers to Mn-oxidizers (Rengel, 1997) allowed detection of glyphosate effects on microbial Mn transformation in the rhizosphere. A low ratio of Mn reducers to Mn oxidizers determined for GR soybean treated with glyphosate compared with non-GR soybean suggested soil Mn was immobilized and not available for plant uptake (Kremer and Means, 2009). This occurred despite standard analysis showing the soils were Mn-sufficient. Glyphosate as a major factor in enhancing Mnoxidizing bacteria was further strengthened by results determined for both GR and non-GR soybean with and without non-glyphosate herbicides that were significantly different (higher ratio) from the glyphosate treatment. Although no reports are available for effects of glyphosate on Fe-transforming microorganisms, it is possible that glyphosate reaching the rhizosphere could disrupt Fe transport and reduction by rhizobacteria based on results

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

261

demonstrating inhibition of ferric reductase activity in plant roots by glyphosate (Ozturk et al., 2007). Subsequent studies revealed that many Mn-oxidizing bacteria produced copious amounts of exopolysaccharides (EPS), most frequently associated with cultures from rhizosphere samples of glyphosate –treated GR soybean (Kremer and Means, 2009). A majority of subcultured isolates were phenotypically characterized as Agrobacterium spp., which are resident saprophytic bacteria in the soybean rhizosphere (Kuklinsky-Sobral et al., 2004). The consistent detection of agrobacteria producing excessive amounts of EPS suggested that biofilm formation on the soybean root surface may be related Mn-oxidizing agrobacteria, enhanced in the presence of glyphosate. As members of the alpha -proteobacteria that comprises many Mn-transforming bacteria, agrobacteria are known strong Mn oxidizers (Thompson and Huber, 2007; Johal and Huber, 2009). Agrobacteria also typically form biofilms composed of EPS matrices on the rhizoplane in which many biological functions are mediated (Anand and Mysore, 2006), including biogenic Mn oxidation, demonstrated in biofilm-forming bacteria where Mn oxides are precipitated and retained within the biofilm (Toner et al., 2005). Thus the frequent occurrence of EPS-producing and Mn-oxidizing rhizobacteria (primarily Agrobacterium spp.) in rhizospheres of GR soybean treated with glyphosate suggests that the herbicide alone or in combination with GR soybean enhances or selects this group of bacteria that may detrimentally affect plant growth by immobilizing Mn. Because GR crop cultivars contain the cp4 gene, derived from an Agrobacterium sp., that encodes for the glyphosate-resistant EPSPS (Funke et al., 2006), it is possible that as glyphosate is released through roots of GR crops, genetically similar Agrobacterium spp. in soils may be preferentially selected for colonization of the rhizosphere and rhizoplane. Further, A. radiobacter synthesizes C-P lyase for degradation of organophosphonates including glyphosate (Wackett et al., 1987), suggesting that glyphosate may be a readily available phosphorus source in the rhizosphere. The role of glyphosate in biofilm formation, associated Mn transformation, and as a potential substrate used by rhizosphere bacteria remains to be clarified. Because glyphosate is systemic within both sensitive or susceptible and GR plants, the period of release of glyphosate into the rhizosphere may be considerably longer in GR plants than in sensitive plants (Santos et al., 2005), depending on application rates and frequency. Thus, exposure to glyphosate by rhizosphere microorganisms may be more sustained in GR cropping systems, which may contribute to the consistent changes observed in the rhizosphere microbial community and in specific functions as well as selection for species with resistance to adverse effects of glyphosate. Santos et al. (2005), suggests this scenario to explain the development of Bradyrhizobium strains with tolerance to glyphosate associated with GR soybean.

3.2. Effects of Glyphosate on Bradyrhizobium and Nitrogen Fixation Jaworski (1976) reported growth inhibition of the microsymbiont, Bradyrhizobium japonicum by 92% in broth amended with 1.0 mM glyphosate. This was further confirmed by Moorman et al. (1992) where differential susceptibility of three B. japonicum strains was observed, at intermediate concentrations; however, growth by all strains was completely inhibited at concentrations of 5.0 mM glyphosate with concurrent protocatechuic acid

262

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

accumulation in the two less sensitive strains. Three mechanisms for inhibition of bacterial cell growth by glyphosate have been hypothesized (Fisher et al., 1986): 1) inability to synthesize aromatic amino acids; 2) energy drain resulting from formation of terminal metabolites e.g. 3-deoxy-D-arabino-heptulose-7-phosphate; and 3) toxicity of accumulated intermediates. Subsequent effects of glyphosate on the B. japonicum – soybean symbiosis have only been recently investigated. Metabolic pathways utilized by B. japonicum within nodules of soybean affected by glyphosate are often suppressed (Hernandez et al., 1999). Studies to date have documented that glyphosate systemically translocated to soybean roots may adversely affect numerous processes associated with nitrogen fixation including nitrogenase activity, leghemoglobin content, and nodule development (King et al., 2001; Reddy et al., 2000; de Maria et al., 2006; Reddy and Zablotowicz, 2007; Zablotowicz and Reddy, 2007). The ability of glyphosate to chelate cations may affect nitrogen fixation in GR soybean by immobilizing nickel, which is essential for hydrogenase activity mediated by B. japonicum in the symbiosome morphology within the nodule (Zobiole et al., 2010c). Field and greenhouse studies conducted over multiple years on several GR soybean cultivars found consistent significantly decreased nodulation on GR soybean with or without glyphosate compared with conventional cultivars with non-glyphosate or no herbicides (Dvoranen et al., 2008; Kremer and Means, 2009). Although effects may vary widely among soybean genotypes, previous research has shown that as much as 45% of the most widely-planted GR soybean cultivars grown in Brazil could be negatively affected by glyphosate resulting in reduced nodule dry weight and numbers per plant, under one-time or sequential applications, with single applications resulting in most severe reductions (Oliveira Jr et al., 2008). More studies on the nitrogen fixation process in GR crops are needed in order to more fully understand the effects of glyphosate on nitrogen nutrition in these crops and to determine its prudent use to minimize adverse effects.

3.3. Effects of Glyphosate on Mycorrhizae Limited research has explored mycorrhizal relationships with glyphosate use. Under nontransgenic cropping system, glyphosate applied to weeds did not affect arbuscular mycorrhizal fungal (AMF) infection and colonization of roots of adjacent soybean even though the herbicide was released through weed roots and was transferred to the soybean rhizosphere (Mujica et al., 1999). Root infection and colonization of one GR soybean cultivar by AMF (Glomus intraradices) was not affected by glyphosate applied at the V1 growth stage in a greenhouse study (Powell et al., 2009). A series of greenhouse studies with GR cultivars of cotton, maize, and soybean showed that glyphosate reduced AMF root infection only when soil or rhizosphere microorganisms were disturbed, suggesting that disruption of the microbial community weakens the relationship with AMF causing susceptibility to stress imposed by glyphosate (Savin et al., 2009). Effective AMF associations can greatly reduce infection and disease caused by fungal pathogens including Fusarium spp. (Azcon-Aguilar and Barea, 1996; Filion et al., 2003). Perhaps the AMF association in GR soybean can be improved and aid in suppression of rhizosphere Fusarium. However, research is needed on more crop varieties under field conditions based on previous work showing that AMF dependency and responsivenes of soybean is highly variable among varieties (Khalil et al., 1999).

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

263

3.4. Pleiotropy in Glyphosate-Resistant Crops and Effects on Rhizosphere Microorganisms A consequence of the single-gene insertion of cp4-epsps into GR crops is the expression of ―un-intended‖ or pleiotropic traits might be expressed with or without use of glyphosate, coincident with the expected herbicide resistance trait (Brusetti et al., 2004; Powell, 2007). Pleiotropic effects need to be considered when investigating effects of glyphosate on GR plants in order to definitively demonstrate causes due to the herbicide, the genetic trait, or their combination. The release of high carbohydrate and amino acid concentrations from roots of GR soybean regardless of glyphosate treatment (Kremer et al., 2005) may be a pleiotropic effect. Reports on differences in microbial communities and endophytic rhizobacteria associated with roots of transgenic canola appear to be a consequence of the GR trait alone (Dunfield and Germida, 2003; Siciliano and Germida, 1999; Siciliano et al., 1998). Also, apparent non-effects of GR soybean and GR cotton on root colonization by AMF were reported for plants not treated with glyphosate (Powell et al., 2007; Knox et al., 2008). Thus, balanced studies on GR crops with glyphosate, without glyphosate, and possibly with nonglyphosate herbicides are necessary to understand the complete range of effects on microbial composition, functional activities, and pathogenicity in agroecosystems where glyphosate is part of the management strategy.

4. USE OF RESIDUAL HERBICIDES Intensive glyphosate use is usually correlated to its broad spectrum of weed control and to its systemic mode of action, ultimately providing effective weed control both of annual and perennial weeds. However, it is also known that glyphosate lacks soil residual activity, due to a strong, non-desorbable sorption to soil. This particular soil behavior contributes to multiple post-emergence sequential applications in GR crops. In no-tillage systems, the combined use of glyphosate in burndown and post-emergence applications has resulted in a shift to numerous glyphosate-resistant weed species (Johnson et al., 2009). Using a different approach, tank mixtures of glyphosate with soil residual herbicides may prevent or delay development weed resistance, as well as reduce the number of glyphosate applications in a certain crop that ultimately would help preserve glyphosate as a long lasting tool in agriculture. Benefits provided by soil residual herbicides are usually correlated with the behavior of weed emergence wherein main fluxes are distributed within the first fifteen days after crop emergence (Pereira et al., 2000) and also with the critical period for preventing weed interference in soybeans, which usually ranges from 25 to 45 days after emergence. Provision of such weed-free periods usually demands more than a single glyphosate application and, especially in years when climatologically events lead to a delay in soil cover by the crop canopy. Extensive research has provided evidence that supports the beneficial use of tank mixtures containing both glyphosate and residual herbicides prior to no-tillage soybean sowing. Carvalho et al. (2000) reported that the combination of herbicides that have residual effect on soil with non selective herbicides used in burndown, may be an alternative to reduce

264

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

weed emergence, and may also provide a reduction in the costs of weed control. In addition, tank mixes of glyphosate with residual herbicides may result in less exposure of the operator, less soil compaction and, possibly, better control of weeds at the beginning of crop establishment (Valente and Cavazzana, 2000). In addition, the use of residual herbicides during the initial development of the soybean crop can facilitate post-emergence weed control, even though reduction of emergence as well as the delay of weed emergence is proportional to the use of low glyphosate rates. Chlorimuron-ethyl (10 and 20 g ha-1) applied with glyphosate at burndown, provided a significant residual effect for Bidens pilosa, reducing the weed emergence in soybean (Carvalho & Cavazanna, 2000). Roman (2002) also observed 95% control for Bidens pilosa at 45 days after the application of glyphosate+ chlorimuron-ethyl (720+10 g ha-1) as preplant for soybean. Residual herbicides may also influence the period before the interference of weeds. For treatments with glyphosate this period was considered to be 37 days after sowing (DAS) and 57 DAS with glyphosate+chlorimuron-ethyl. The chlorimuron-ethyl plus glyphosate mixture allowed the crop to coexist longer with weeds before reductions in yield were observed (Carvalho et al., 2009). A tank mixture of glyphosate (560 to 1680 g ha-1) with dimethenamid applied in burndown prior to sowing GR soybeans provided 98% control of Conyza canadensis and 82% for Rumex crispus. All mixtures of glyphosate + dimethenamid provided residual control of Brachiaria platyphylla fluxes that emerged after sowing. Residual control of weeds provided by the addition of dimethenamid to glyphosate improved soybean yields by 500 kg ha-1 (Scott et al., 1998). Knezevic et al. (2002) studying the critical period of weed control found that pre-emergence herbicides as sulfentrazone + chlorimuron and pendimethalin + imazethapyr + imazaquin provided the longest residual control (up to 8 wk). Generally sound strategy for weed control in GR crops would be to apply glyphosate tank mixes with a residual herbicide at the critical time for weed removal. Addition of a residual herbicide would provide adequate weed control for the entire critical period of weed control Werlang (2006) working with weed management during burndown prior to sowing GR soybean concluded that mixtures of carfentrazone + glyphosate increased the rate of kill for Commelina benghalensis, Ipomoea grandifolia, Tridax procumbens and Sida rhombifolia. The mixture of sulfentrazone + glyphosate provided good residual control of C. benghalensis, I. grandifolia, Cenchrus echinatus, Digitaria horizontalis, T. procumbens, Sida rhombifolia and Bidens pilosa up to 20 days after crop emergence, thereby eliminating one application of glyphosate in weed management of GR soybean. However, the ability to reduce or eliminate glyphosate may require more intensive management by farmers. The success of weed management will depend on adjusting the spectrum of control of the residual herbicides with the actual spectrum of weeds present in the field, including the vegetative stage of weeds at the time of application, which may affect the rate of glyphosate required for acceptable control. Environmental conditions at the time of application may also affect the potential for obtaining acceptable weed control with reduced rates of glyphosate. Stress conditions such as cold or short dry periods prior to herbicide spraying can reduce the effectiveness of the herbicide, and therefore require the use of higher rates or repeated application of glyphosate. Farmers who wish to adopt a program of reduced glyphosate rates or single applications need to be aware of these limitations.

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

265

In some cases, even though glyphosate may still be effective for control of weeds in advanced growth stages, the early interference may have already reduced the crop yield potential. Therefore, use of pre-emergent herbicides can be an excellent option to prevent early interference, and in some cases, lower glyphosate rates with single applications could be used. An additional benefit of residual activity of herbicides in soil is delayed emergence of subsequent fluxes of weeds, because glyphosate could be applied to weeds at an early stage of development, increasing the action of glyphosate, based on previous reports that timing of herbicide application can be more important than the rate of herbicide application for adequate weed control (Ateh and Harvey, 1999). This hypothesis is supported by Mulugeta and Boerboom (2000), who reported that weed control and crop yield were influenced more by glyphosate application timing than by the rate applied. In this study, glyphosate was applied at 420, 630, and 840 g a.e. ha-1 at V2, V4, R1, and R4 growth stages. Thus, glyphosate applied at 420 g a.e. ha-1 provided similar weed control and resulting crop yield to the other glyphosate rates. In this case a single glyphosate application (420 g a.e. ha-1) prevented yield loss in narrow-row GR soybeans when growing conditions were favorable.

Figure 1. Current management of weed control in GR soybeans

Figure 2. Strategy applying glyphosate early at V3-V4 growth stage

266

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

Figure 3. Strategy applying glyphosate late at V4-V5 growth stage

Based on previous results reported here, residual herbicides associated with glyphosate as a burndown treatment could provide adequate weed control up to the end of critical period of weed interference. A scheme using strategies to reduce glyphosate rate or number of applications compared with current weed management used by farmers is shown in Figures 1, 2 and 3.

CONCLUSION Glyphosate can affect the nutritional status of GR soybeans. Non glyphosate treated plants also have greater photosynthetic activity. Further experiments should be conducted to evaluate different pre-emergent herbicides associated with glyphosate in burndown management and compare with different times and rates of post-mergence applications of glyphosate in GR soybeans. This is important, in order to evaluate glyphosate effects in weed management and its influence on GR soybean physiology and nutrition, and on associated microbial activities. The basic understanding derived from these studies is essential for developing alternative approaches within the GR soybean production system to overcome the constraints to current soybean productivity and health.

REFERENCES Anand, A. & Mysore, K. (2006). Agrobacterium biology and crown gall disease. In S. Gnanamanickam (Ed). Plant-associated Bacteria, (359-384). Dordrecht, The Netherlands: Springer. Aoki, T., O‘Donnell, K., Homma, Y. & Lattanzi, A. R. (2003). Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex – F. virguliforme in North America and F. tucumaniae in South America. Mycologia, 95, 660-684. Ateh, C. M. & Harvey, R. G. (1999). Annual weed control by glyphosate in glyphosateresistant soybean (Glycine max). Weed Tech, 13, 394-398.

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

267

Azcón-Aguilar, C. & Barea, J. M. (1996). Arbuscular mycorrhizas and biological control of soil-borne plant pathogens-an overview of the mechanisms involved. Mycorrhiza, 6, 7179. Beale, S. I. (1978). δ-Aminolevulinic acid in plants: its biosynthesis, regulation and role in plastid development. Annu Rev Plant Physiol, 29, 95-120. Boocock, M. R. & Coggins, J. R. (1983). Kinetics of 5-enolpyruvylshikimate-3-phosphate synthase inhibition by glyphosate. FEBS Lett, 154, 127-133. Bott, S., Tesfamariam, T., Candan, H., Cakmak, I., Romheld, V. & Neumann, G. (2008). Glyphosate-induced impairment of plant growth and micronutrient status in glyphosateresistant soybean (Glycine max L.). Plant Soil, 312, 185-194. Bromilow, R. H., Chamberlain, K., Tench, A. J. & Williams, R. H. (1993). Phloem translocation of strong acids: Glyphosate, substituted phosphonic, and sulfonic acids in Ricinus communis. L Pestic Sci, 37, 39-47. Brusetti, L., Francia, P., Bertolini, C., Pagliuca, A., Borin, S., Sorlini, C., Abruzzese, A., Sacchi, G., Viti, C., Giovannetti, L., Giuntini, E., Bazzicalupo, M. & Daffonchio, D. (2004). Bacterial communities associated with the rhizosphere of transgenic Bt 176 maize (Zea mays) and its non transgenic counterpart. Plant Soil, 266, 11-21. Campbell, W. F., Evans, J. O. & Reed, S C. (1976). Effect of glyphosate on chloroplast ultrastructure of quackgrass mesophyll cells. Weed Sci., 24, 22-25. Carvalho, F. T., et al. (2000) Eficácia de herbicidas no manejo de Euphorbia heterophylla para o plantio direto de soja. R Bras Herb, 1, 159-165. Carvalho, L. B., Scherer, L. C., Lucio, F. R. & Alves, P. L. C. A. (2009). Efeitos da dessecação com glyphosate e chlorimuron-ethyl na comunidade infestante e na produtividade da soja. Planta Daninha, 27, 1025-1034. Carvalho, F. T. & Cavazzana, M. A. (2000). Eficácia de herbicidas no manejo de plantas daninhas para o plantio direto de soja. R Bras Herb, 1, 167-172. Coutinho, C. F. B. & Mazo, L. H. (2005). Complexos metálicos com o herbicida glyphosate: Revisão. Química Nova, 28, 1038-1045. De Maria, N., Bacerril, L. M., Garcia-Plazaola, J. I., Hernandez, A., De Felipe, M. R. & Fernandez-Pascual, M. (2006). New insights on glyphosate mode of action in nodular metabolism: role of shickimate accumulation. J Agric Food Chem., 54, 2621-2628. Dunfield, K. E. & Germida, J. J. (2003). Seasonal changes in the rhizosphere microbial communities associated with field-grown genetically modified canola (Brassica napus). Appl Environ Microbiol, 69, 7310-7318. Dvoranen, E. C., Oliveira Jr, R. S., Constantin, J. Cavalieri, S. D. & Blainski, E. (2008). Nodulação e crescimento de variedades de soja RR sob aplicação de glyphosate, fluazifop-p-butyl e fomesafen. Planta Daninha, 26, 619-625. Eker, S., Ozturk, L., Yazici, A., Erenoglu, B., Romheld, V. & Cakmak, I. (2006). Foliarapplied glyphosate substantially reduced uptake and transport of iron and manganese in sunflower (Helianthus annuus L.) plants. J Agric Food Chem., 54, 10019-10025. Fageria, N. K. (1987). Variação em diferentes estádios de crescimento do nível critico de fósforo em plantas de arroz. R Bras Cie Solo., 11, 77-80. Filion, M., St-Arnaud, M. & Jabaji-Hare, S. H. (2003). Quantification of Fusarium solani f. sp. phaseoli in mycorrhizal bean plants and surrounding mycorrhizosphere soil using real-time polymerase chain reaction and direct isolations on selective media. Phytopathology, 93, 229-235.

268

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

Fonseca, D. M., Alvares, V. H., Neves, J. C. L., Gomide, J. A., Novais, R. F. & Barros, N. F. (1988). Níveis críticos de fósforo em amostras de solos para o estabelecimento de Andropogon gayanus, Brachiaria decumbens e Hyparrhenia rufa. R Bras Ci Solo, 12, 4958. Franzen, D. W., O‘Barr, J. H. & Zollinger, R. K. (2003). Interaction of a foliar application of iron HEDTA and three postemergence broadleaf herbicides with soybeans stressed from chlorosis. J Plant Nutr, 26, 2365-2374. Funke, T., Han, H., Healy-Fried, M. L., Fischer, M. & Schönbrunn, E. (2006). Molecular basis for the herbicide resistance of Roundup Ready crops. Proc Natl Acad Sci., 103, 13010-13015. Glass, R. L. (1984). Metal complex formation by glyphosate. J Agric Food Chem., 32, 12491253. Griffiths, B. S., Ritz, K., Ebblewhite, N. & Dobson, G. (1999). Soil microbial community structure: effects of substrate loading rates. Soil Biol Biochem, 31, 145-153. Hart, M. M., Powell, J. R., Gulden, R. H., Dunfield, K. E., Pauls, K. P., Swanton, C. J., Klironomos, J. N., Antunes, P. M., Koch, A. M. & Trevors, J. T. (2009). Separating the effect of crop from herbicide on soil microbial communities in glyphosate-resistant corn. Pedobiologia, 52, 253-262. Hernandez, A., Garcia-Plazaola, J. I. & Bacerril, L. M. (1999) Glyphosate effects on phenolic metabolism of nodulated soybean (Glycine max L. Merril). J Agric Food Chem, 47, 2920-2925. Huber, D. M., Cheng, M. & Winsor, B. (2005). Association of severe Corynespora root rot of soybean with glyphosate-killed ragweed. Phytopathology, 95, S45. Jaworski, E. G. (1972). Mode of action of N-phosphonomethyl-glycine inhibition of aromatic amino acid biosynthesis. J Agric Food Chem, 20, 1195-1198. Johal, G. S. & Rahe, J. E. (1984). Effects of soilborne plant-pathogenic fungi on the herbicidal action of glyphosate on bean seedlings. Phytopathology, 74, 950-955. Johal, G. S. & Huber, D. M. (2009). Glyphosate effects on plant disease. Eur J Agron, 31, 144-152. Johnson, W. G., Davis, V. M., Kruger, G. R. & Weller, S. C. (2009) Influence of glyphosateresistant cropping systems on weed species shifts and glyphosate-resistant weed populations. Eur J Agron, 31, 162-172. Kabachnik, M. I., Medved, T. Ya., Dyatolva, N. M. & Rudomino, M. V. (1974). Organophosphorus complexones. Russian Chem Rev, 43, 733-744. King, A. C., Purcell, L. C. & Vories, E. D. (2001) Plant growth and nitrogenase activity of glyphosate-tolerant soybean in response to glyphosate applications. Agron J, 93, 179-186. Knezevic, S. Z., Evans, S. P., Blankenship, E. E., VanAcker, R. C. & Lindquist, J. L. (2002). Critical period of weed control: the concept and data analysis. Weed Sci., 50, 773-786. Knox, O. G. G., Nehl, D. B., Mor, T., Roberts, G. N. & Gupta, V. V. S. R. (2008). Genetically modified cotton has no effect on arbuscular mycorrhizal colonization of roots. Field Crops Res., 109, 57-60. Kremer, R. J. & Means, N. E. (2009). Glyphosate and glyphosate-resistant crop interactions with rhizosphere microorganisms. Eur J Agron, 31, 153-161. Kremer, R. J., Means, N. E. & Kim, S. J. (2005). Glyphosate affects soybean root exudation and rhizosphere microorganisms. Intern J Environ Anal Chem., 85, 1165-1174.

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

269

Krzysko-Lupicka, T. & Orlik, A. (1997). The use of glyphosate as the sole source of phosphorus or carbon for the selection of soil-borne fungal strains capable to degrade this herbicide. Chemosphere, 34, 2601-2605. Kuklinshy-Sobral, J., Welington, L. A., Mendes, R., Pizzirani-Kleiner, A. A. & Azevedo, J. L. (2005). Isolation and characterization of endophytic bacteria from soybean (Glycine max) grown in soil treated with glyphosate herbicide. Plant Soil, 273, 91-99. Larson, R. L., Hill, A. L., Fenwick, A., Kniss, A. R., Hanson, L. E. & Miller, S. D. (2006). Influence of glyphosate on Rhizoctonia and Fusarium root rot in sugar beet. Pest Manag Sci., 62, 1182-1192. Lee, C. D., Penner, D. & Hammerschmidt, R. (2002). Influence of formulated glyphosate and activator adjuvants on Sclerotinia sclerotium in glyphosate-resistant and susceptible Glycine max. Weed Sci., 48, 710-715. Lévesque, C. A., Rahe, J. E. & Eaves, D. M. (1993). Fungal colonization of glyphosatetreated seedlings using a new root plating technique. Mycol Res., 97, 299-306. Liphadzi, K. B., Al-Khatib, K., Bensch, C. N., Stahlman, P. W., Dille, J., Todd, T., Rice, C. W., Horak, M. J. & Head, G. (2005). Soil microbial and nematode communities as affected by glyphosate and tillage practices in a glyphosate-resistant cropping system. Weed Sci, 53, 536-545. Lupwayi, N. Z., Hanson, K. G., Harker, K. N., Clayton, G. W., Blackshaw, R. E., O‘Donovan, J. T., Johnson, E. N., Gan, Y., Irvine, R. B. & Monreal, M. A. (2007). Soil microbial biomass, functional diversity and enzyme activity in glyphosate-resistant wheat-canola rotations under low-disturbance direct seeding and conventional tillage. Soil Biol Biochem, 39, 1418-1427. Madsen, H. E. L., Christensen, H. H. & Gottlieb-Petersen, C. (1978). Stability constants of copper (II), zinc, manganese (II), calcium, and magnesium complexes of N(phosphonomethyl)glycine (glyphosate). Acta Chem Scand, 32a, 79-83. Maxwell, K. & Johnson, G. N. (2000) Chlorophyll fluorescence - A practical guide. J Exp Bot., 51, 659-668. Means, N. E. (2004). Effects of glyphosate and foliar amendments on soil microorganisms in soybean. Ph.D. dissertation. Columbia, MO: University of Missouri. 130. Means, N. E. & Kremer, R. J. (2007). Influence of soil moisture on root colonization of glyphosate-treated soybean by Fusarium species. Comm Soil Sci Plant Anal, 38, 17131720. Means, N. E., Kremer, R. J. & Ramsier, C. (2007). Effects of glyphosate and foliar amendments on activity of microorganisms in the soybean rhizosphere. J Environ Sci Health Part B, 42, 125-132. Mills, H. A. & Jones, J. B. (1996). Plant Analysis Handbook II: a practical sampling, preparation, analysis, and interpretation guide. MicroMacro Publishing, Inc. Athens, GA, USA Moorman, T. B., Becerril, J. M., Lydon, J. & Duke, S. O. (1992) Production of hydroxybenzoic acids by Bradyrhizobium japonicum strains after treatment with glyphosate. J Agric Food Chem., 40, 289-293. Mujica, M. T., Fracchia, S. & Ocampo, J. A. (1999). Influence of the herbicides chlorsulfuron and glyphosate on mycorrhizal soybean intercropped with the weeds Brassica campestris or Sorghum halepense. Symbiosis, 27, 73-81.

270

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

Mulugeta, D. & Boerboom, C. M. (2000). Critical time of weed removal in glyphosate-resistant Glycine max. Weed Sci., 48, 35-42. Muniz, A. S., Novais, R. F., Barros, N. F. & Neves, J. C. L. (1985). Nível crítico de fósforo na parte aérea da soja como variável do fator capacidade de fósforo no solo. R Bras Ci Solo, 9, 237-243. Nelson, E. B. (1990). Exudate molecules initiating fungal responses to seeds and roots. Plant Soil, 129, 61-73. Nilsson, G. (1985) Interactions between glyphosate and metals essential for plant growth. In: E. Grossbard, & D. Atkinson, (Eds). The herbicide glyphosate. (35-47). London: Butterworth. Nitji, V. N., Myers, O., Schroeder, D. & Lightfoot, D. A. (2003). Roundup Ready soybean: glyphosate effects on Fusarium solani root colonization and sudden death syndrome. Agron J, 95, 1140-1145. Oliveira, F. A., Sfredo, G. J., Castro, C. & Klepker, D. (2007). Fertilidade do solo e nutrição da soja. Londrina: Embrapa Soja, Circular Técnica 50. Oliveira Jr, R. S., Dvoranen, E. C., Constantin, J., Cavalieri, S. D. & Blainski, E. (2008). Influência do glyphosate sobre a nodulação e o crescimento de cultivares de soja resistente ao glyphosate. Planta Daninha, 26, 831-843. Ozturk, L., Yazici, A., Eker, S., Gokmen, O., Romheld, V. & Cakman, I. (2008). Glyphosate inhibition of ferric reductase activity in iron deficient sunflower roots. New Phytol, 177, 899-906. Pereira, E. S., Velini, E. D., Carvalho, L. R. & Maimoni-Rodella, R. C. S. (2000). Avaliações qualitativas de plantas daninhas na cultura da soja submetida aos sistemas de plantio direto e convencional. Planta Daninha, 18, 207-216. Phillips, D. A., Fox, T. C., King, M. D., Bhuvaneswari, T. V. & Teuber, L. R. (2004). Microbial products trigger amino acid exudation. Plant Physiol, 136, 2887-2894. Pihakaski, S. & Pihakaski, K. (1980). Effects of glyphosate on ultrastructure and photosynthesis of Pellia epiphylla. Annals Bot, 46, 133-141. Powell, J. R. (2007). Linking soil organisms within food webs to ecosystem functioning and environmental change. Adv Agron, 96, 307-349. Powell, J. R. & Swanton, C. J. (2008). A critique of studies evaluating glyphosate effects on diseases associated with Fusarium spp. Weed Res, 48, 307-318. Powell, J. R., Gulden, R. H., Hart, M. M., Campbell, R. G., Levy-Booth, D. J., Dunfield, K. E., Pauls, K. P., Swanton, C. J., Trevors, J. T. & Klironomas, J. N. (2007). Mycorrhizal and rhizobial colonization of genetically modified and conventional soybeans. Appl Environ Microbiol, 73, 4365-4367. Powell, J. R., Campbell, R. G., Dunfield, K. E., Gulden, R. H., Hart, M. M., Levy-Booth, D. J., Klironomas, J. N., Pauls, K. P., Swanton, C. J., Trevors, J. T. & Antunes, P. M. (2009). Effect of glyphosate on the tripartite symbiosis formed by Glomus intraradices, Bradyrhizobium japonicum, and genetically modified soybean. Appl Soil Ecol., 41, 128136. Reddy, K. N., Rimando, A. M. & Duke, S. O. (2004). Aminomethylphosphonic acid, a metabolite of glyphosate, causes injury in glyphosate-treated, glyphosate-resistant soybean. J Agric Food Chem., 52, 5139-5143. Rengel, Z. (1997). Root exudation and microflora populations in rhizosphere of crop genotypes differing in tolerance to micronutrient deficiency. Plant Soil, 196, 255-260.

Glyphosate Interactions with Physiological, Microbiological, and Nutritional …

271

Roman, E. S. (2002). Eficácia de herbicidas na dessecação e no controle residual de plantas daninhas no sistema desseque e plante. R Bras Herb, 1, 45-49. Santos, J. B., Ferreira, E. A., Kasuya, M. C. M., da Silva, A. A. & Procópio, S. O. (2005). Tolerance of Bradyrhizobium strains to glyphosate formulations. Crop Protect, 24, 543547. Savin, M., Purcell, L., Daigh, A. & Manfredini, A. (2009). Response of mycorrhizal infection to glyphosate applications and P fertilization in glyphosate-tolerant soybean, maize, and cotton. J Plant Nutr, (in review). Scherer, E. E. (1998). Níveis críticos de potássio para a soja em Latossolo húmico de Santa Catarina. R Bras Ci Solo, 22, 57-62. Schulz, A., Krüper, A. & Amrhein, N. (1985). Differential sensitivity of bacterial 5enolpyruvylshikimate-3-phosphate synthases to the herbicide glyphosate. FEMS Microbiol. Letters, 28, 297-301. Scott, R., Shaw, D. R. & Barrentine, W. L. (1998). Glyphosate tank mixtures with SAN 582 for burndown or postemergence applications in glyphosate-tolerant soybean (Glycine max). Weed Technol, 12, 23-26. Shibles, R. M. & Weber, C. R. (1965). Leaf area, solar radiation interception, and dry matter production by various soybean planting patterns. Crop Sci., 6, 575-577. Siciliano, S. D. & Germida, J. J. (1999). Taxonomic diversity of bacteria associated with the roots of field-grown transgenic Brassica napus cv. Quest, compared to the non-transgenic B. napus cv. Excel and B. rapa cv. Parkland. FEMS Microbiol Ecol., 29, 263-272. Siciliano, S. D., Theoret, C. M., de Freitas, J. R., Hucl, P. J. & Germida, J. J. (1998). Differences in the microbial communities associated with the roots of different cultivars of canola and wheat. Can J Microbiol, 44, 844-851. Singh, B. K., Siehl, D. L. & Connelly, J. A. (1991). Shikimate pathway: why does it mean so much to so many? Oxf Surv Plant Mol Cell Biol, 7, 143-185. Sprankle, P., Meggitt, W. F. & Penner, D. (1975) Absorption, action, and translocation of glyphosate. Weed Sci., 23, 235-240. Taiz, L. & Zeiger, E. (1998). Mineral Nutrition. In: Plant Physiology (111-114), Sinauer Associates: Sunderland Thompson, I. A. & Huber, D. M. (2007). Manganese and plant disease. In L., E. W. E. Datnoff, & D. M. Elmer, Huber, (Eds.) Mineral Nutrition and Plant Disease. (139-153). St. Paul, MN: American Phytopathological Society. Toner, B., Fakra, S., Villalobos, M., Warwick, T. & Sposito, G. (2005). Spatially resolved characterization of biogenic manganese oxide production within a bacterial biofilm. Appl Environ Microbiol, 71, 1300-1310. Valente, T. O. & Cavazzana, M. A. (2000). Efeito residual de chlorimuron-ethyl aplicado em mistura com glyphosate na dessecação de plantas daninhas. R Bras Herb, 1, 173-178. Vanlieshout, L. A. & Loux, M. M. (2000). Interactions of glyphosate with residual herbicides in no-till soybean (Glycine max) production. Weed Tech., 14, 480-487. Vidal, R. (2010). Interação negativa entre plantas: inicialismo, alelopatia e competição. Porto Alegre: Evangraf. 132. Wardle, D. A. (1995). Impacts of disturbance on detritus food webs in agroecosystems of contrasting tillage and weed management practices. Adv Ecol Res., 26, 105-185. Wardle, D. A. & Parkinson, D. (1992). The influence of the herbicide glyphosate on interspecific interactions between four soil fungal species. Mycol Res., 96, 180-186.

272

Luiz H. Saes Zobiole, Robert J. Kremer and Rubem S. de Oliveira Jr.

Wackett, L. P., Shames, S. L., Venditit, C. P. & Walsh, C. T. (1987). Bacterial carbonphosphorus lyase: products, rates, and regulation of phosphonic and phosponic acid metabolism. J Bacteriol, 169, 710-717. Werlang, R. C. (2006). Manejo de plantas daninhas com o herbicida sulfentrazone na dessecação em sistemas de produção utilizando soja transgênica em semeadura direta. In: Congresso Brasileiro da Ciência das Plantas Daninhas, 25, Brasília, 2006. Resumos... Brasília, SBCPD/UNB/Embrapa Cerrados, 408 Woodburn, A. T. (2000). Glyphosate: production, pricing and use worldwide. Pest Manage Sci., 56, 309-312. Yamada, T., Kremer, R. J., Castro, P. R. C. & Wood, B. W. (2009). Glyphosate interactions with physiology, nutrition, and diseases of plants: Threat to agricultural sustainability? Europ J Agronomy, 31, 111-113. Zablotowicz, R. M. & Reddy, K. N. (2007). Nitrogenase activity, nitrogen content, and yield responses to glyphosate in glyphosate-resistant soybean. Crop Protec, 26, 370-376. Zobiole, L. H. S., Oliveira Jr, R. S., Huber, D. M., Constantin, J., de Castro, C., Oliveira, F. A. & Oliveira Jr, A. (2010a). Glyphosate reduces shoot concentration of mineral nutrients in glyphosate-resistant soybeans. Plant Soil., 328, 57-69. Zobiole, L. H. S., Oliveira Jr, R. S., Kremer, R. J., Muniz, A. S. & Oliveira, Jr, A. (2010b). Nutrient accumulation and photosynthesis in glyphosate resistant soybeans is reduced under glyphosate use. J Plant Nutr., (in press) Zobiole, L. H. S., Oliveira Jr, R. S., Kremer, R. J., Constantin, J., Yamada, T., Castro, C., Oliveira, F. A. & Oliveira, Jr, A. (2010c) Effect of glyphosate on symbiotic N2 fixation and nickel concentration in glyphosate-resistant soybeans. Appl Soil Ecol., 44, 176-18.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 9

OXIDATIVE STRESS IN SOYBEAN: ROLE OF IRON Andrea Galatro and Susana Puntarulo* Physical Chemistry-PRALIB, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina

1. ABSTRACT Plants are naturally exposed to a variety of environmental and physiological stress situations, such as the oxidative stress associated to growth and development. Soybeans require Fe as a nutrient, in a concentration higher than 10-8 M in solution, to meet their needs. Fe plays critical roles in biological processes, including photosynthesis, respiration and nitrogen assimilation. However, Fe has a dark side because it is toxic to the cell due to its capacity of being an active catalyst for the generation of reactive oxygen radical species that causes lipid peroxidation, DNA strand breaks, oxidation of proteins, and degradation of other biomolecules. Fe homeostasis is maintained by the coordinated regulation of its transport, utilization and storage. Fe traffic has to be strictly controlled, and ferritin is one of the main proteins involved. Moreover, ferritin can prevent Fe toxicity because of its ability to sequester several thousand of Fe atoms in their central cavity in a soluble, non-toxic bio-available form. However, anytime Fe uptake exceeds the metabolic needs of the cell and the storage capacity is overwhelmed, a low molecular weight Fe pool, referred to as the labile iron pool is increased. The Fe in this pool represents the catalytic active Fe, and its size needs to be closely restricted, mostly in chloroplasts and mitochondria since besides being important sites for Fe utilization, they also are specific places for free radical production through the electron transfer chains. The general aspects linked to oxidative metabolism in soybean embryonic axes both, under physiological and stress conditions, will be analyzed mostly in the early stages of growth. Fe function, its cellular distribution, and its participation in free radical reactions leading to cellular damage will be described and also analyzed under Fe overload condition. An integrative overview of these topics will provide information that could be the key to elaborate strategies to improve soybean development, and also human nutrition through bio-fortification strategies. *

Corresponding author: E-mail: [email protected] Fisicoquímica-PRALIB, Facultad de Farmacia y Bioquímica Junín 956, C1113AAD Buenos Aires, Argentina Phone: (54-11) 4964-8244 Ext 101 Fax: (54-11) 4508-3646 Ext 102

274

Andrea Galatro and Susana Puntarulo

Keywords: soybean seeds, oxidative metabolism, iron, ferritin, labile iron pool

2. INTRODUCTION Plants are essential for animal and human nutrition, being responsible for mineral acquisition from the soil and for carbon, sulfur, and nitrogen assimilation. Soybean production has increased between 1964 to 2009 from 29 to 244 million Tons, based on U.S. Deparment of agriculture, Production, Supply, and Distribution, electronic database (at www.fas.usda.gov/psdonline, updated 10 July 2009), being the United States, Brazil, Argentina and China the majors producers of soybean in the world (www.soymeal.org/supplydemand.html). The soybean (Glycine max) is a legume provider of protein and oil. Thus, soybean has several edible (human and animal comsumption in a manifold diversity of products like oils, flour, dietaty suplements, milks and food drinks, textured vegetable protein used to create vegetarian foods, infant foods, and traditional soyfoods) and industrial uses (i.e. oils, adhesives, lubricants, cleaning products, agricultural adjuvants, biodiesel and other alternative fuels, diesel aditives, antibiotics, anti-statics agents, desinfectans, pesticides, paints, animal and human care products).

3. FE DISTRIBUTION IN SOYBEAN PLANTS Between the micronutrients, Fe is required in great quantity and plays a critical role in biological processes such as photosynthesis, respiration, nitrogen assimilation, and DNA and hormone synthesis (Briat, 2006). Due to Fe ability of varying the ligands to which it is coordinated, it has access to a wide range of redox potentials and can participate in many electron transfer reactions, spanning the standard redox potential range (Galatro et al., 2007). Soybeans plants require 10-8 M Fe in solution to meet their needs, but in calcareous soils, total soluble Fe reaches no more than 10-10 M (Briat and Lobréaux, 1997). Although it is abundant in soil, its availability is influenced by the presence of O2 (through insoluble ferric oxides formation), the pH, and the redox potential. Thus, even though Fe2+ is more soluble than Fe3+, for typical soil pH values (6-8), Fe3+ species dominate because Fe2+ is readily oxidized. However, soluble organic ligands produced by the degradation of organic matter or microbial synthesis of siderophores, contribute to increase soluble Fe concentration (Kochian, 2000). Recent advances in Fe acquisition mechanisms in plants were reported by Jeon and Connolly (2009). The solubilization and long-distance allocation of Fe between organs and tissues, as well as its subcellular compartamentalization and remobilization, involve various chelation and oxidation/reduction steps, transport activities and association with soluble proteins (Briat et al., 2007). Transport, sensing and storage mechanism should be finely coordinated to avoid Fe excess and deficiency. Fe storage in plants takes place in the apoplastic space (Briat and Lobréaux, 1997) and the vacuole (Briat and Lobréaux, 1998). Lanquar et al. (2005), identified the vacuole as a major compartment for Fe storage in plant seeds, and showed that retrieval of the Fe stored in vacuoles is an essential step for successful germination in a wide range of environments.

Oxidative Stress in Soybean: Role of Iron

275

Ferritin (Ft) is a storage protein with a structure highly conserved among plants, animal and bacteria, composed by 24 subunits assembled into a spherical shell. Up to 4500 Fe atoms can be stored as an inorganic complex in a no toxic and biologically available form (Harrison and Arosio, 1996). However, its cellular distribution is not identical that in animal cells since animal Ft is a cytosolic protein and plant Ft is found in the plastids (Briat et al., 1995; Andrews et al., 1992). Ft accumulate in non green plastids (protoplastids, etioplasts, and amiloplasts), that are found in specific tissues, such as the shoots, root apex, seeds or nodules (Briat and Lobréaux, 1997), and was detectable in reproductive and storage organs, but not in roots and leaves of pea (Lobréaux and Briat, 1991). However, van der Mark et al. (1982) reported that Ft was detectable in normal green leaves of bean. Petit et al. (2001) reported that Arabidopsis Ft is encoded by four genes named AtFer1-4. AtFer2 is the only gene that is expressed in seeds, whereas AtFer1, AtFer3 and AtFer4 are expressed in vegetative and reproductive tissues. Soybean seed Ft is regarded as a model for studying the structure and function of plant Ft (Sczekan and Joshi, 1987; Laulhere et al., 1988; Proudhon et al.; 1989, Lescure et al., 1990; Ragland et al., 1990; Masuda et al., 2001; Masuda et al., 2003; Dong et al., 2007). According to Masuda et al. (2001) soybean Ft is composed of two subunits of 26.5 and 28 kDa designated as H-1 and H-2, respectively. Four different Ft genes, including SferH-1 and SferH-2, have been reported in soybean. The other two genes are also presumed to encode chloroplasts precursors (i.e., SferH-3 and SferH-4) (Dong et al., 2007). Dong et al. (2007), cloned a novel Ft cDNA, SferH-5, from 7-day-old soybean seedlings. This SferH-5 has 96% identity with SferH-1 reported previously and was able to assemble with H-2, as a functional soybean seed Ft-like complex H-5/H-2 with significant Fe uptake activity and greater Fe storage capacity than previously reported in the recombinant H-1/H-2 complex. These data reveal the potential heterogeneity of the 26.5 kDa subunits of soybean seed Ft. However, future work is necessary to detect its presence and examine whether it is selectively expressed in response to in vivo Fe or other environmental signals. Zancani et al. (2004) presented evidence for the presence of Ft in plant mitochondria from etiolated pea stems and A. thaliana cell cultures. In addition, Zancani et al. (2007) examined the localization of mitochondrial Ft and its involvement in Fe exchange. Ft was found only in mitochondria from young organs, such as roots, etiolated stems and, in a lesser extent in developing leaves. Its presence was not influenced by Fe content in the hydroponic medium of culture, as well as by the induction of senescence through ethylene treatment. However, it was able to sequestrate Fe within its shell playing a key role in Fe buffering through the uptake and release of Fe that could be modulated by ascorbate (AH-) (Zancani et al., 2007). Since plant mitochondria possess an electron transport chain where superoxide anion (O2-) may be generated by univalent reactions at the level of complexes I and III (Braidot et al., 1999), systems have evolved to appropriately scavenge deleterious radical species, or to prevent their formation (Moller, 2001), but sequestration of potential harmful Fe2+ ions has not been described (Zancani et al., 2004). In this context, the main role of Fts could concern Fe sequestration. Over-expression of Ft, in either the cytoplasm or plastids of transgenic tobacco, leads to an illegitimate Fe sequestration that is responsible for the fact that these transgenic plants behaved as suffering Fe deficiency resulting in the activation of Fe transport systems, revealed by an increased root ferric reductase activity and leaf Fe content (van Vuytswinkel et al., 1998). On the other hand, Ravet et al. (2009) presented evidence that Ft do not constitute the major Fe pool either for seedling development in seeds, or for proper functioning of the photosynthetic apparatus in leaves of Arabidopsis. Seed germination also

276

Andrea Galatro and Susana Puntarulo

showed sensitivity to pro-oxidant treatments indicating that Fts are essential to protect cells against oxidative damage. As a consequence, the sequestration of Fe by Fts in chloroplasts and mitochondria, two of the major sites of reactive O2 species (ROS) generation in plant cells, can constitute and additional strategy to prevent damage (Zancani et al., 2004). Up to now, the question of whether mitochondrial localization of Ft is of any physiological relevance for plants remains open, as well as the presence of this mitochondrial Ft in other plant species such as soybean. The labile iron pool (LIP) is defined operationally as a low-molecular-weight pool of weakly chelated Fe, that consists of both forms of ionic Fe (Fe2+ and Fe3+) associated with ligands with low affinity for Fe ions. The proposed low-molecular-weight chelators for Fe are citrate and other organic ions, phosphate, carbohydrates and carboxylates, nucleotides and nucleosides, polypeptides, and phospholipids (Petrat et al., 2002); however, the actual nature of the intracellular ligands participating in LIP formation remains obscure. The LIP represents only a minor fraction of the total cellular Fe (3–5%) (Kakhlon and Cabantchik, 2002). This form of Fe is critical for the oxidative metabolism in the cell since it is capable of converting normal byproducts of cell respiration and photosynthesis, like O2- and hydrogen peroxide (H2O2), into highly damaging hydroxyl radical (OH) that is a extremely reactive molecule causing lipid peroxidation, DNA strands break, oxidation of proteins, and degradation of other biomolecules (Harrison and Arosio, 1996; Galatro et al., 2007).

4. OXIDATIVE AND NITROSATIVE METABOLISM IN SOYBEAN EMBRYONIC AXES Aerobic respiration is a fine balance between the benefits of ATP generation and the risk of producing ROS. ROS can be formed, as a side reaction, in the mitochondrial inner membrane by the direct oxidation of the semi-ubiquinone radical by O2. The rate of these reactions increased exponentially as the ubiquinone pool was reduced, thus, keeping the ubiquinone pool at low steady state redox poise is vital for minimizing these harmful side reactions (Millar and Day, 1997; Skulachev, 1996). The O2 uptake in germinating soybean embryonic axes followed a three phase profile: phase I, defined by an early increase of O2 uptake and weight; phase II, in which weight and O2 uptake were maintained at a constant level, and phase III, characterized by a marked rate of increase in O2 uptake and growth. Data in Table 1 show O2 uptake and growth of soybean embryonic axes (Glycine max L., var Hood) as a function of imbibition time. ROS cellular production from the O2 uptake of soybean embryonic axes could be ascribed to the activity of cytocrome oxidase, alternative oxidase, lipoxygenase, autoxidation of respiratory chain components, and other cytosolic oxidases (Boveris et al., 1978; Rich and Bonner, 1978; Huq and Palmer, 1978). The cyanidesensitive O2 uptake (ascribed to cytochrome oxidase activity), lipoxygenase activity and the alternative pathway accounted for 55-75, 15-35 and 15-18% of total O2 consumption in embryonic axes over the studied period (2 to 30 h of imbibition) (Puntarulo et al., 1987). The alternative pathway did no change in isolated mitochondria over the studied period, thus, this pathway appears as less important that lipoxygenase activity in terms of O2 uptake during early germination of soybean embryonic axes (Puntarulo et al., 1987). Cytochrome oxidase activity markedly increased during the early phase of germination and cyanide-sensitive O2

Oxidative Stress in Soybean: Role of Iron

277

uptake accounted for the main part of total O2 uptake during this phase, indicating that mitochondrial activity is essential for the energy demands during the initial steps of germination. Isolated soybean embryonic axes showed spontaneous chemiluminescence, that increased upon water imbibition showing two phases. The first photoemission burst (2-fold) was observed between 0 and 4 h, and the second phase between 4 and 30 h of imbibition (75%). The first burst was assigned to oxy-radicals mobilized upon water uptake by embryonic axes, and the second phase was identified as due to lipoxygenase activity (Boveris et al., 1984). Although there was not conclusive evidence on the identity of the emitting species, it is clear that the excited states are derived from the radical chain reaction of lipoperoxidation, and that 1 O2 is responsible for the main part of the photoemission, but other species could be involved (Boveris et al., 1984). The presence of OH was detected by an EPR spin trapping technique at room temperature in a Bruker (Karlsruhe, Germany) ECS 106 EPR spectrometer with a cavity ER 4102ST. Axes were homogenized in the presence of 10 mM tetrabutyl ammonia perclorate, and 100 mM 5,5′-dimethyl-1-pyrroline-N-oxide (DMPO) in dimethylsulfoxide, centrifuged for 10 min at 280g at 4ºC, and the supernatant was transferred to a Pasteur pipette for EPR detection of the adduct DMPO-CH3 that is related to OH content in the sample, according to Jacks and Hinojosa (1993). The EPR spectrometer settings were as follows: microwave power 20 mW, modulation amplitude 0.490 G, time constant 655.36 ms, sweep width 100 G, time scan 167.772 s, and modulation frequency 50 kHz. Soybean embryonic axes in the presence of DMPO, generate an EPR signal according to the parameters obtained by computer simulation, characteristics of the DMPO-CH3 spin adduct (aN= 16.1 G and aH= 23.0 G) (Figure 1A). Lipid radicals were detected by an EPR spin trapping technique employing POBN, -(4-pyridyl 1-oxide)-N-t-butyl nitrone as spin trap. Axes were homogenized in the presence of 0.2 ml of 50 mM 2,2´dipiridyl, 0.5 ml of chloroform:methanol 2:1, 0.2 ml of chloroform, 0.15 ml of distilled water, and 50 mM POBN, according to Ghio et al. (1998). Samples were centrifuged at 750g for 5 min and measurements were performed in the chloroform phase at room temperature. The instrument settings were: modulation frequency 50 kHz, microwave power 20 mW, time constant 655.36 ms, time scan 83.886 s, modulation amplitude 1.232 G, and sweep width 100 G. Lipid radicals combined with the spin trap POBN resulted in adducts that gave a characteristic EPR spectrum with hyperfine coupling constants of aN= 15.01 G and aH= 2.46 G (Figure 1B), in agreement with computer spectral simulated signals obtained using those parameters. Both OH and lipid radical content, significantly increased upon the imbibition period (Table 2). Moreover, lipid peroxidation was also assessed as thiobarbituric acid reactive substances (TBARS) content in the embryonic axes employing a fluorescent technique (Boveris and Puntarulo, 1998). Data shown in Table 2 consistently indicate that radical generation and lipid peroxidation increased in soybean embryonic axes upon growth. Moreover, intracellular O2- steady-state concentration in isolated axes, calculated from the rate of O2- production and the activity of superoxide dismutase (SOD) increased from 2 10-8 M to 4 10-8 M between 2 to 6 h of imbibition, declined to 2 10-8 M after 15 h and remained constant up to 30 h of imbibition (Puntarulo et al., 1991).

278

Andrea Galatro and Susana Puntarulo

Figure 1. Radical content in soybean embryonic axes. A. EPR spectra of OH radical: (a) typical EPR signal of DMPO-CH3 (as a marker of OH radical) in soybean embryonic axes incubated during 24 h; (b) basal media in the absence of soybean embryonic axes; (c) computer simulated spectrum of DMPOCH3 adduct (aN= 16.1 G and aH= 23.0 G); (d) computer simulated spectrum of A radical, employing the following spectral parameters: g = 2.005 and aH = 1.8 G, to show that the trace a depends on both  OH and A radical content. B. EPR spectra of lipid radicals: (a) typical EPR signal of soybean embryonic axes incubated during 24 h; (b) spectrum in the absence of soybean embryonic axes; (c) computer simulated EPR spectra using the parameters: aN= 15.01 G and aH= 2.46 G. Results are from experiments carried out in duplicate and replicated with four different preparations

Table 1. Fresh weigh and oxygen uptake in soybean embryonic axes during germination Time (h) 0 2 4 6 15 24 30 40

Fresh weigh1 (mg axis-1) 6.3  0.4 9.9  0.4* 9.7  0.5* 9.8  0.5* 9.9  0.5* 9.9  0.4* 10.8  0.5* 13.8  0.6*

Oxygen uptake2 (l h-1 axis-1) Non determined 3.4  0.3 5.0  0.2** 5.5  0.3** 6.3  0.3** 9.2  0.4** 10.5  0.5** 13.6  0.6**

*significantly different from values obtained in dry embryonic axes, ANOVA, p<0.05. **significantly different from values obtained in embryonic axes after 2 h of imbibition, ANOVA, p<0.05. 1 Taken and modified from Puntarulo et al. (1990). 2 Taken and modified from Puntarulo et al. (1991).

Table 2. Lipid peroxidation and OH content in soybean embryonic axes upon germination Time (h) 6 12 24 48



OH content (pmol axis-1) non-detectable

Lipid radical content (pmol axis-1) non-detectable

21 9  1* 4  1*

21  7 29  6 80  10*

TBARS content (nmol MDA axis-1) 0.7  0.1 0.7  0.1 2.1  0.1* 7.0  0.5*

*significantly different from values obtained after 12 h of imbibition, ANOVA, p<0.05.

Oxidative Stress in Soybean: Role of Iron

279

The intracellular steady-state H2O2 concentration was kept in the range of 0.3 to 0.9 M (with minimal and maximal H2O2 levels at 2 and 6 h, respectively) upon the imbibition period by effect of the regulation exerted by the activity of the enzymes involved in the hydroperoxide metabolism (SOD, catalase, peroxidases). SOD activity was increased from 3 to 19 U axis-1 during the period between 2-30 h of imbibition. Catalase activity remained constant over the initial 15 h (0.7 10-12 mol axis-1), and then increased to 2.25 10-12 mol axis-1 after 30 h of imbibition. The same profile was observed for peroxidase activity showing values of 100 and 300 pmol min-1 axis, at 15 and 30 h of imbibition, respectively. Ascorbate peroxidase activity was maximal at 2 h (8.3 ± 0.4 pmol min-1 axis-1), decreased by 50% after 4 h of incubation, and showed no further changes (Puntarulo et al., 1991). From these data it was concluded that during the early imbibition of soybean embryonic axes, mitochondrial membranes are the most important source of cytosolic O2-. Thus, H2O2 generation is mainly dependent on O2- dismutation, and its consumption is due to the activity of catalase. The tight regulation of both pathways is responsible of maintaining a low H2O2 steady-state concentration over the studied period. In agreement with these observations, Gridol et al. (1994) reported that during early imbibition of soybean seeds (Glycine max L. cv. Weber), SOD activity was increased after 6 h of imbibition, and peroxidase activities, including catalase, were significantly increased after 12 h of imbibition and during germination phase III in embryonic axes. Nitric oxide (NO) is a bioactive molecule established as a key signalling molecule in many species, and involved in several biological processes in plants, such as disease resistance (Delledone et al., 1998), regulation of stomatal closure (Neill et al., 2002a), inhibition of the activity of certain enzymes (Clarke et al., 2000), activation of nitrogenactivated protein (MAP) kinase signalling pathways (Kumar and Klessig, 2000; Pagnussat et al., 2004), modulation of the expression of cell cycle genes (Correa-Aragunde et al., 2006), stimulation of germination (Beligni and Lamatina, 2000; Beligni and Lamatina, 2001, Simontacchi et al., 2004), and expression of defense-related genes and programmed cell death (Carimi et al., 2005). NO was also postulated to mediate the biological effects of primary signaling molecules, such as hormones (Neill et al., 2002b), and it was suggested that it plays a role in senescence (Jasid et al., 2009). NO was detected in soybean embryonic axes from soybean seeds imbibed during 24 h, and it was shown that NO could inhibit ROS production through the interaction with the microsomal mixed–function oxidase activity (Caro and Puntarulo, 1998). Moreover, NO has been suggested to be produced by the activities of the enzymes nitrate reductase (NR) and nitric oxide synthase-like (NOS-like), in soybean embryonic axes (Caro and Puntarulo, 1999). Both, NO content evaluated by EPR, and the activity of the enzymes NR and NOS-like showed a similar profile as function of the imbibition time, with maximal levels at 15-24 h of imbibition. These data strongly suggest that NO is a physiological product during development of soybean embryonic axes at a critical stage of the initiation of germination (Caro and Puntarulo, 1999). Moreover, the increase in NO content preceded the initiation of phase III of development and the sharp increase in O2 consumption. The interaction between these molecules could be responsible of either cellular damage (through the generation of peroxynitrite), or other cellular responses by acting as messengers.

280

Andrea Galatro and Susana Puntarulo Table 3. Fe distribution in soybean embryonic axes upon germination

Total Fe content (nmol Fe mg-1 DW) Ft content (g g-1 DW) Ft-Fe content (Fe atoms molecule-1 Ft) LIP (pmol mg-1 DW)

Imbibition period 24 h 48 h 1.3  0.2 2.7  0.5* 34  11 12  1* 1054  111 567  90* 39  13 150  59*

*significantly different from values obtained after 24 h of imbibition, ANOVA, p<0.05. Taken and modified from Robello et al. (2007).

Table 4. Effect of iron overload on Fe distribution in soybean embryonic axes upon germination

Total Fe content (nmol Fe mg-1 DW) Ft content (g g-1 DW) Ft-Fe content (Fe atoms molecule-1 Ft) LIP (pmol mg-1 DW)

Imbibition period 24 h 48 h 3.9  0.8 4.5  0.4 27  10 13  4 494  103 535  60 72  11 321  66*

*significantly different from values obtained after 24 h of imbibition, ANOVA, p<0.05. Taken and modified from Robello et al. (2007).

5. FE ROLE ON OXIDATIVE METABOLISM IN SOYBEAN EMBRYONIC AXES UPON GROWTH The effect of Fe in the oxidative metabolism of soybean axes upon growth was recently assessed (Robello et al., 2007). Total Fe content was increased by 2-fold in axes incubated for 48 h, as compared to the content in axes incubated for 24 h (Table 3); however, Fe reduction rate was not significantly affected over the same period (15 ± 1 and 23 ± 4 nmol Fe3+ min-1 mg-1 DW for 24 and 48 h, respectively). Nevertheless, both Ft content and the content of Fe atoms per Ft molecule decreased over the 48 h period (Table 3), suggesting that at least a fraction of the incorporated Fe was used to supply Fe to cellular components that depend on Fe to perform their functions. Moreover, it was suggested that the fraction of Fe in the axes available for catalyzing free radical reactions after 48 h could be enhanced, as compared to 24 h of incubation. The LIP, assessed by employing calcein as Fe chelator, was significantly enhanced after 48 h as compared to 24 h of growth (Table 3), showing that the total amount of Fe available for catalysis was indeed increased upon growth of the embryonic axes under physiological conditions. Fe supplementation up to 500 M, did not affect the growth of the embryonic axes (assessed either as fresh weight or dry weight) (Robello et al., 2007). Total Fe content in soybean embryonic axes exposed to 500 M Fe was higher than in axes grown in the absence of supplemented Fe either, after 24 or 48 h of incubation (Table 4). However, Fe reduction rate by soybean embryonic axes was not significantly affected by Fe supplementation (22 ± 2

Oxidative Stress in Soybean: Role of Iron

281

and 21 ± 3 nmol Fe3+ min-1 mg-1 DW, after 24 and 48 h of incubation with 500 M Fe) (Robello et al., 2007). The decrease in the Fe content stored in Ft in embryo axes incubated for 24 h in the presence of 500 M Fe (Table 4), as compared to conditions of non-added Fe, could reflect an early loosing of Ft molecules altered by free radicals, or a reduction of its capacity of binding Fe, or both. In addition, LIP content was significantly increased in axes supplemented Fe as compared to non-supplemented axes (Table 4). At present, the role of Ft as the main Fe storage protein and, thus the most important factor linked to Fe homeostasis when Fe content in the cell is affected, is under discussion. From the studies on Ft role in plant development in Arabidopsis by Ravet et al. (2009) it appears that Ft does not constitute the major Fe storage form, and Fe stored in Ft is not essential for development of the seedling, even under Fe-limiting conditions. These results are consistent with findings showing that vacuolar Fe storage and mobilization is critical for seedling development when Fe is limiting (Lanquar et al., 2005; Kim, 2006). Moreover, Cvitanich et al. (2010) showed that cells surrounding the provascular tissue in P. cossineus and P. vulgaris seeds contain a high concentration of Fe. This cell layer appears to be of key importance for Fe storage in the seed, or for providing Fe to the germinating seedling. The site for Fe storage in seeds may differ between legumes, such pea (in which the amount of Fe stored inside Ft is important in embryo axes), and Arabidopsis (Ravet et al., 2009). These observations are on line with the need of characterizing other compounds, besides Ft, that might be involved in the chelation of Fe in mature soybean seeds, and the fraction of Fe bound by the different chelators, with especial emphasis in assessing the bio-availability of Fe from these sources. The role of other soluble and insoluble Fe storage proteins, the formation and contribution of Fe-nitrosyl complexes, glutathione, NO, etc. should be considered among other non-protein agents, as possible candidates to handle Fe transport and storage under stress conditions. Ascorbyl radical (A) was detected at room temperature in a Brucker (Karlsruhe, Germany) espectrometer ECS 106 with a cavity ER 4102ST. Embryonic axes were homogenized in 1 mM deferoxamine mesylate salt in DMSO and immediately transferred to a Pasteur pipette. Instrument settings were as follows: modulation frequency 50 kHz, microwave power 10 mW, microwave frequency 9.75 GHz, center field 3487 G, time constant 327.68 ms, modulation amplitude 1 G and sweep width 15 G, according to Buettner and Jurkiewicz (1993). Typical spectra obtained from soybean embryonic axes are shown in Figure 2. The content of AH- was measured by reverse phase HPLC with electrochemical detection. Embryonic axes were homogenized in metaphosphoric acid 10% (w/v) according to Kutnink et al. (1987). AH- content was 3.3  0.3 and 0.6  0.1 nmol mg-1 DW after 24 and 48 h of incubation, respectively (Robello et al., 2007). The A/AH- was assessed as an index of oxidative stress in the water soluble medium as previously reported (Kozak et al., 1997; Giordano et al., 2004), and a 14-fold increase was observed after 48 h as compared to the recorded value at 24 h of incubation (Figure 2B). Regarding to the establishment of oxidative stress conditions associated to Fe addition, in contrast with the dramatic effect observed upon growth, the supplementation up to 500 M, did not change A/AH- ratio in soybean embryonic axes because Fe supplementation increased not only A, but also AH- content in the embryonic axes (Robello et al., 2007). By comparing the natural growth condition and the effect of Fe overload, it could be postulated that different mechanisms could be operative.

282

Andrea Galatro and Susana Puntarulo

*significantly different from values at 24 h of incubation time, ANOVA p< 0.05. Taken and modified from Robello et al. (2007). Figure 2. A radical content, and A/AH- ratio during the early stages of germination of soybean embryonic axes. A. EPR spectra of A: (a) computer simulated EPR spectrum (g = 2.005 and aH = 1.8 G) ; (b) DMSO alone; (c) typical EPR spectrum of soybean embryonic axes incubated during 24 h; (d) typical EPR spectrum of soybean embryonic axes incubated during 24 h in the presence of 500 M FeEDTA (1:2). B. A/AH- ratio in soybean embryonic axes imbibed for 24 and 48 h in the absence of added Fe (), and in the presence of 500 M Fe-EDTA (1:2) ()

In spite of the role of Fe as initiator of lipid peroxidation, and the increase on LIP content due to the supplementation with 500 M Fe, it seems that control systems are operative to avoid oxidative stress under excess Fe supply. Neither, the activities of the antioxidant enzymes SOD, catalase and glutathione reductase, nor the glutathione content were significantly affected after Fe exposure in isolated axes incubated 24 h with Fe up to 500 M (Caro and Puntarulo, 1995). Regarding the lipophilic antioxidants, the content of ubiquinol10 was increased in this condition of Fe supplementation (Caro and Puntarulo, 1995), in concordance with the pattern of response observed for the -tocopherol content in the embryonic axes imbibed for 24 h in Fe concentrations up to 500 M (Simontacchi et al., 1993). Overall, increased LIP in the cell would trigger the synthesis of lipid soluble antioxidants under Fe excess to keep ROS at steady state concentrations adequate to avoid oxidative stress and damage. The effect of Fe supplementation was also studied in soybean seedlings (Caro and Puntarulo, 1992). Fe content in root and hypocotyls from 7 day old plants was increased 11and 4-fold, respectively, when Fe concentration in the media increased from 3 to 100 M. However, no effects were observed on the growth (evaluated as fresh weight) either in roots or in the hypocotyls. Fe reduction rate in intact roots, as an estimation of Fe incorporation, was decreased by 60% in roots grown in the presence of 100 and 500 M Fe as compared to non-added Fe. In vitro Fe reduction rate was increased 3- and 6.7-fold in homogenates from roots and hypocotyls respectively, from plants grown under Fe concentrations up to 500 M, as compared to the values from plants grown in 10 M Fe. This response could be due to an

Oxidative Stress in Soybean: Role of Iron

283

increase in the activity of the enzymes involved in the Fe reduction pathway previous to the storage of the Fe excess, to control possible increases in the LIP. The observed decrease in Fe reduction rate in intact roots could be a mechanism triggered to control Fe uptake in response to elevated cellular Fe content (Caro and Puntarulo, 1992). However, in soybean roots from 7 days old plants an increase in TBARS content was observed (0.72 ± 0.04, 2.42 ± 0.38, and 2.45 ± 0.10 nmol MDA mg-1 prot. after exposure to 0, 50 and 100 M Fe, respectively) suggesting Fe involvement in lipid peroxidation in the root (Caro and Puntarulo, 1992). This effect was not observed at early germination stages (24 h), thus other metabolic sources of ROS, as microsomal contribution, could play a role on later seedling development.

6. COMPARISON BETWEEN FE OVERLOAD AND OTHER OXIDATIVE STRESS CONDITIONS IN SOYBEAN Through its growth and development soybean plants are exposed to a variety of situations involving the establishment of oxidative stress conditions such as senescence (Jasid et al., 2009), metal toxicity (Noriega et al., 2007; Balestrasse et al., 2006; Abo et al., 2010), salt stress (Zilli et al., 2008), low temperatures (Tambussi et al., 2004), drought (Zhang et al., 2007), and UV-B radiation (Xu et al., 2008), among others. In the case of the exposure of plants to UV-B, the recorded effects on leaves has been mimicked by free radical generators and prevented by antioxidant feeding (A-H-Mackerness et al., 1998). However, the damaging effectiveness of UV-B, varies both, among species and cultivars of a given specie. Sensitive plants often exhibit reduced growth, photosynthetic activity and flowering. Photosynthetic activity may be reduced by direct effects on photosynthetic enzymes, metabolic pathways or indirectly through effects on photosynthetic pigments or stomatal function (Tevini and Teramura, 2008). A is formed by AH- oxidation and by the interaction with free radicals being a dynamic value that is determined by the relationship between the rates of the generation and decay of this species (Roginski and Stegmann, 1994). Although A has been taken as a sensitive marker of oxidative stress (Buettner and Jurkiewickz, 1993; Heber et al., 1996), the use of this tool seems adequate under situations where the total AH- content is not affected by the experimental condition. When AH- content is altered, the A/AH- ratio is a better index to estimate early oxidative conditions in the hydrophilic medium. The increase in steady state of A could be due to an increased production of active species or to a decrease in the capacity of AH- regeneration (Heber et al., 1996). Beside for studying soybean effect of growth and Fe overload, we have used this technique to evaluate the UV-B effect at cellular and sub-cellular level, employing leaves and chloroplasts from soybean plants. The exposure of soybean leaves to 30 kJ m-2 UV-B increased the A/AH- ratio as early as 24 h post-irradiation, indicating that an oxidative stress condition had been established in the hydrophilic medium. However, a different scenario was observed in chloroplasts since 4 consecutive doses of UVB (30 kJ m-2 UV-B) did not increase the oxidative stress index. In chloroplasts from leaves irradiated with 60 kJ m-2 UV-B, the induced increment in AH- content lead to a decrease in the A/AH- ratio, suggesting that protective mechanisms involving AH-, could take part in the overall response to UV-B radiation in chloroplasts, at least in the water soluble fraction (Table 5).

284

Andrea Galatro and Susana Puntarulo Table 5. Effect of UV-B radiation on A/AH- ratio in leaves and chloroplasts from soybean plants 1

A

Without UV-B exposure Soybean leaves Soybean chloroplasts With UV-B exposure Soybean leaves + 30 kJ m-2 UV-B Soybean chloroplasts + 30 kJ m-2 UV-B Soybean chloroplasts + 60 kJ m-2 UV-B

2

AH-

A/AH(10-3 AU)

51  4 1.0  0.1

0.7  0.1 2.3  0.4

73 0.43

112  12 0.9  0.2 1.1  0.1

0.8  0.2 21 51

140 0.45 0.22

Soybean leaves were irradiated after 7 days of growing, and determinations were performed 24 h post irradiation. Chloroplasts were isolated from plants exposed for 4 days to 30 or 60 kJ m-2 day-1 UVB. Leaves were excised 24 h after UV exposure, and chloroplasts were isolated. 1 (nmol g-1 FW) for leaves, and (pmol mg-1 protein) for chloroplasts. 2 (mol g-1 FW) for leaves, and (nmol mg-1 protein) for chloroplasts. Taken and modified from Galatro et al. (2001), and Kozak et al. (1997).

The magnitude of the oxidative stress associated to growth in the hydrophilic medium could be ascribed as the difference in the A/AH- ratio between 24 and 48 h. Under physiological conditions this difference was of 130 10-3. The increase in the ratio by the exposure to UV-B was of 67 10-3. Thus, it seems that changes in the water-soluble fraction are involved in both conditions. However, the difference in the ratio associated to growth in the presence of Fe overload (82 10-3) was not increased as compared to the obtained value under physiological conditions. This observation suggested that Fe-associated stress was not established in the hydrophilic cellular environment, and future studies will be designed to understand the endogenous mechanisms triggered to prevent oxidative stress-dependent damage.

CONCLUSION Beside the acquisition of basic physiological knowledge, understanding Fe homeostasis and metabolism in plants is critical for the improvement of both, crop yields and human nutrition. The enhancement of Fe concentrations in edible parts of the plant had been aimed to solve malnutrition problems related to Fe deficiency in humans. This objective could be achieved by increasing Fe transport to, or storage in, the edible portions of plants (Jeon and Guerinot, 2009). However, the adequate management of Fe content in plants is a complex goal to reach because Fe excess could be toxic, and the strategies to enhance its concentration have to take into account important side aspects of Fe plant metabolism that, far from being a benefit for plant productivity, could decrease plant survival. Thus, considering the natural storage of Fe in Ft to prevent oxidative stress, there have been some promising reports of Fe fortified crops involving the expression of soybean Ft (Goto et al., 1999; Drakakaki et al., 2005). However, van Wuytswinkel et al. (1998) reported that transgenic tobacco over expressing Ft behaved as a Fe deficient plant since excessive Fe sequestration disturbs the

Oxidative Stress in Soybean: Role of Iron

285

metabolism. To increase the complexity of the subject, the issue of the bio-availability of the Fe stored in Ft has to be considered. There are controversial reports on this point (Bejjani et al., 2007; Lönerdal et al., 2006; Lönerdal, 2009), even though Lönerdall (2009) proposes that to increase the Ft content in soybeans is likely to be a sustainable action to increase Fe absorption in vulnerable situations. Thus, to acquire a deeper knowledge of Fe mechanisms in physiological and Fe-overload conditions occurring in soybean plants could be the key of finding ways to develop field strategies to increase bio-available Fe content in healthy crops.

ACKNOWLEDGMENTS These studies were supported by grants from the University of Buenos Aires, and CONICET. S.P. and A.G. are career investigators from CONICET.

REFERENCES Abo, M; Yonehara, H; Yoshimura, E. Aluminum stress increases carbon-centered radicals in soybean roots. J. Plant Physiol., In Press. A-H-Mackerness, S; Surplus, SL; Jordan, BR; Thomas, B. Effects of suplementary ultraviolet-B radiation on photosynthetic transcripts at different stages of leaf development and light levels in pea (Pisum sativum L.): Role of active oxygen species and antioxidant enzymes. Photochem. Photobiol., 1998, 68, 88-96. Andrews, SC; Arosio, P; Bottke, H; Briat, JF; von Darl, M; Harrison, PM; Laulhere, JP; Levi, S; Lobréaux, S; Yewdall, S. Structure, function and evolution of ferritins. J. Inorg. Biochem., 1992, 47, 161-174. Balestrasse, KB; Noriega, GO; Batlle, A; Tomaro, ML. Heme oxygenase activity and oxidative stress signaling in soybean leaves. Plant Sci., 2006, 170, 339-346. Beligni, MV; Lamatina, L. Nitric oxide stimulates seed germination and de-etiolation, and inhibits hypocotyls elongation, three light-inducible responses in plants. Planta, 2000, 210, 215-221. Beligni, MV; Lamatina, L. Nitric oxide: a non traditional regulator of plant growth. Trends Plant Sci., 2001, 6, 508-509. Bejjani, S; Pullakhandam, R; Punjal, R; Nair, KM. Gastric digestion of pea ferritin and modulation of its iron bioavailability by ascorbic and phytic acids in caco-2 cells. World J. Gastroenterol., 2007, 13, 2083-2088. Boveris, A; Puntarulo, S; Roy, AH; Sanchez, RA. Spontaneous chemiluminiscence of soybean embryonic axes during imbibition. Plant Physiol., 1984, 76, 447-451. Boveris, A; Sánchez, RA; Beconi, MT. Antimycin- and cyanide-resistant respiration and superoxide anion production in fresh and aged potato tuber mitochondria. FEBS Lett., 1978, 92, 333-338. Boveris, AD; Puntarulo S. Free-radical scavenging actions of natural antioxidants. Nutr. Res., 1998, 18, 1545-1557.

286

Andrea Galatro and Susana Puntarulo

Braidot, E; Petrussa, E; Vianello, A; Macri, F. Hydrogen peroxide generation by higher plant mitochondria oxidizing complex I or complex II substrates. FEBS Lett., 1999, 451, 347350. Briat, JF. Cellular and whole organism aspects of iron transport and storage in plants. In: Tamás MJ, Martinoia E, editors. Topics in current genetics, Molecular Biology of metal homeostasis and detoxification, from microbes to man. Sweden: Springer, 2006, 193-213. Briat, JF; Curie, C; Gaymard, F. Iron utilization and metabolism in plants. Curr. Opin. Plant Biol., 2007, 10, 276-282. Briat, JF; Fobis-Loisy, I; Grignon, N; Lobréaux, S; Pascal, N; Savino, G; Thoiron, S; von Wirén, N; van Wuytswinkel, O. Cellular and molecular aspects of iron metabolism in plants. Biol. Cell, 1995, 84, 69-81. Briat, JF; Lobréaux, S. Iron transport and storage in plants. Trends Plant Sci., 1997, 2, 187193. Briat, JF; Lobréaux, S. Iron storage and ferritin in plants. In: Sigel A, Sigel H, editors. Iron transport and Storage in microorganisms, plants and animals. New York: Marcel Dekker Inc., 1998, 563-584. Buettner, GR; Jurkiewicz, BA. Ascorbate free radical as a marker of oxidative stress: An EPR study. Free Radic. Biol. Med., 1993, 14, 49-55. Carimi, F; Zottini, M; Costa, A; Cattelan, I; de Michele, R; Terzi, M; Lo Schiavo, F. NO signaling in cytokinin-induced programmed cell death. Plant Cell Environ., 2005, 28, 1171-1178. Caro, A; Puntarulo, S. Efecto de la disponibilidad de hierro sobre la peroxidación lipídica en ejes y plántulas de soja. An. Acad. Nac. Cs. Ex. Fís. Nat., 1992, 44, 267-271. Caro, A; Puntarulo, S. Effect of iron-stress on antioxidant content of soybean embryonic axes. Plant Physiol., 1995, 14, 131-136. Caro, A; Puntarulo, S. Nitric oxide decreases superoxide anion generation by microsomes from soybean embryonic axes. Physiol. Plant., 1998, 104, 357-364. Caro, A; Puntarulo, S. Nitric oxide generation by soybean embryonic axes. Possible effect on mitochondrial function. Free Rad. Res., 1999, 31, S205-212. Clarke, A; Desikan, R; Hurst, RD; Hancock, JT; Neill, SJ. NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures. Plant J., 2000, 24, 113. Correa-Aragunde, N; Graziano, M; Chevalier, C; Lamattina, L. Nitric Oxide modulates the expression of cell cycle regulatory genes during lateral root formation in tomato. J. Exp. Bot., 2006, 57, 581-588. Cvitanich, C; Przybylowicz, WJ; Urbanski, DF; Jurkiewicz, AM; Mesjasz-Przybylowicz, J; Blair, MW; Astudillo, C; Jensen, EO; Stougaard, J. Iron and ferritin accumulate in separate cellular locations in Phaseolus seeds. BMC Plant Biol., 2010, 10, 26-39. Delledonne, M; Xia, Y; Dixon, RA; Lamb, C. Nitric oxide functions as a signal in plant disease resistance. Nature, 1998, 394, 585-588. Dong, X; Sun, Q; Wei, D; Li, J; Li, J; Tang, B; Jia, Q; Hu, W; Zhao, Y; Hua, ZC. A novel ferritin gene, SferH-5, reveals heterogeneity of the 26.5-kDa subunit of soybean (Glycine max) seed ferritin. FEBS Lett., 2007, 581, 5796-5802. Drakakaki, G; Marcel, S; Glahn, RP; Lund, EK; Pariagh, S; Fischer, R; Christou, P; Stoger, E. Endosperm-specific co-expression of recombinant soybean ferritin and Aspergillus

Oxidative Stress in Soybean: Role of Iron

287

phytase in maize results in significant increases in the levels of bioavailable iron. Plant Mol. Biol., 2005, 69, 869-880. Galatro, A; Simontacchi, M; Puntarulo, S. Free radical generation and antioxidant content in chloroplasts from soybean leaves exposed to ultraviolet-B. Physiol. Plant., 2001, 113, 564-570. Galatro, A; Rousseau, I; Puntarulo, S. Ferritin role in iron toxicity in animals and plants. Curr. Top. Toxicol. Res. Trends, 2007, 4, 65-76. Ghio, AJ; Kadiiska, MB; Xiang, QH; Mason, RP. In vivo evidence of free radical formation after asbestos instillation: an ESR spin trapping investigation. Free Radic. Biol. Med., 1998, 24, 11-17. Giordano, CV; Galatro, A; Puntarulo, S; Ballaré, CL. The inhibitory effects of UV-B radiation (280-315 nm) on Gunnera magellanica growth correlate with increased DNA damage but not with oxidative damage to lipids. Plant Cell Environ., 2004, 27, 14151423. Gridol, X; Lin, WS; Dégousée, N; Yip, SF; Kush, A. Accumulation of reactive oxygen species and oxidation of cytokinin in germinating soybean seeds. Eur. J. Biochem., 1994, 224, 21-28. Goto, F; Yoshihara, T; Shigemoto, N; Toki, S; Takaiwa, F. Iron fortification of rice seed by the soybean ferritin gene. Nat. Biotechnol., 1999, 17, 282-286. Harrison, PM; Arosio, P. The ferritins: molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta, 1996, 1275, 161-203. Heber, U; Miyake, C; Mano, J; Ohno, C; Asada, K. Monodehydroascorbate radical detected by electron paramagnetic resonance spectrometry is a sensitive probe of oxidative stress in intact leaves. Plant Cell Physiol., 1996, 37, 1066-1072. Hug, S; Palmer, JM. Superoxide and hydrogen peroxide production in cyanide resistant Arum maculation mitochondria. Plant Sci. Lett., 1978, 11, 351-358. Jacks, TJ; Hinojosa, O. Superoxide radicals in intact tissues and in dimethyl sulphoxide-based extracts. Phytochemistry, 1993, 33, 563-568. Jasid, S; Galatro, A; Villordo, JJ; Puntarulo, S; Simontacchi, M. Role of nitric oxide in soybean cotyledon senescence. Plant Sci., 2009, 176, 662-668. Jeon, J; Connolly, EL. Iron uptake mechanism in plants: Functions of the FRO family of ferric reductases. Plant Sci., 2009, 176, 709-714. Jeong, J; Guerinot, ML. Homing in iron homeostasis in plants. Trends Plant Sci., 2009, 14, 280-285. Kakhlon, O; Cabantchik, ZI. The labile iron pool: characterization, measurement, and participation in cellular processes. Free Radic. Biol. Med., 2002, 33, 1037-1046. Kim, SA; Punshon, T; Lanzirotti, A; Li, L; Alonso, JM; Ecker, JR; Kaplan, J; Guerinot, ML. Localization of iron in arabidopsis seed requires the vacuolar membrane transporter VIT1. Science, 2006, 314, 295-1298. Kochian, LV. Molecular physiology of mineral nutrient acquisition, transport and utilization. In: Buchanan BB, Gruissem W, Jones RL, editors. Biochemistry and Molecular Biology of Plants. Rockville, Maryland: American Society of Plant Physiologists, 2000, 12041249. Kozak, RG; Malanga, G; Caro, A; Puntarulo, S. Ascorbate free radical content in photosynthetic organisms after exposure to ultraviolet-B. Recent. Res. Devel. in Plant Physiol., 1997, 1, 233-239

288

Andrea Galatro and Susana Puntarulo

Kumar, D; Klessig, DF. Differential induction of tobacco MAP kinases by the defense signals nitric oxide, salicylic acid, ethylene, and jasmonic acid. Mol. Plant Microbe Interact., 2000, 3, 347-351. Kutnink, MA; Hawkes, WC; Schaus, EE; Omaye, ST. An internal standard method for the unattended high-performance liquid chromatographic analysis of ascorbic acid in blood components. Anal. Biochem., 1987, 166, 424-430. Lanquar, V; Lelièvre, F; Bolte, S; Hamès, C; Alcon, C; Neumann, D; Vansuyt, G; Curie, C; Schröder, A; Krämer, U; Barbier-Brygoo, H; Thomine, S. Mobilization of vacuolar iron by AtNRAMP3 and AtNRAMP4 is essential for seed germination on low iron. EMBO J., 2005, 24, 4041-4051. Laulhere, JP; Lescure, AM; Briat, JF. Purification and characterization of ferritins from maize, pea, and soyabean seeds. J. Biol. Chem., 1988, 263, 10289-10294. Lescure, AM; Massenet, O; Briat, JF. Purification and characterization of an iron-induced ferritin from soybean (Glycine max) cell suspensions. Biochem. J., 1990, 272, 147-150. Lobréaux, S; Briat, JF. Ferritin accumulation and degradation in different organs of pea during development. Biochem. J., 1991, 274, 601-606. Lönerdal, B; Bryant, A; Liu, X; Theil, EC. Iron absorption from soybean ferritin in nonanemic women. Am. J. Clin. Nutr., 2006, 83, 103-107. Lönerdal, B. Soybean ferritin: implications for iron status of vegetarians. Am. J. Clin. Nutr., 2009, 89, 1680S-5S. Masuda, T; Goto, F; Yoshihara, T. A novel plant ferritin subnunit from soybean that is related to a mechanism of iron release. J. Biol. Chem., 2001, 276, 19575-19579. Masuda, T; Mikami, B; Goto, F; Yoshihara, T; Utsumi, S. Crystalization and preliminary Xray crystalographic analysys of plant ferritin form Glycine max. Biochim. Biophys. Acta, 2003, 1645, 113-115. Millar, AH; Day, DA. Alternative solutions to radical problems. Trends Plant Sci., 1997, 2, 289-290. Moller, IM. Plan mitochondria and oxidative stress: electron transport, NADPH turnover and metabolism of reactive oxygen species. Annu. Rev. Plant Physiol. Plant Mol. Biol., 2001, 52, 561-591. Neill, SJ; Desikan, R; Clarke, A; Hancock, JT. Nitric oxide is a novel component of abscisic acid signaling in stomatal guard cells. Plant Physiol., 2002a, 128, 13-16. Neill, SJ; Desikan, R; Clarke, A; Hurst, RD; Hancock, JT. Hydrogen peroxide and nitric oxide as signalling molecules in plants. J. Exp. Bot., 2002b, 53, 1237-1247. Noriega, GO; Balestrasse, KB; Batlle, A; Tomaro ML. Cadmium induced oxidative stress in soybean plants also by the accumulation of δ-aminolevulinic acid. Biometals, 2007, 20, 841-851. Pagnussat, CG; Lanteri, ML; Lombardo, MC; Lamatina, L. Nitric oxide mediates the indoleacetic acid activation of a mitogen-activated protein kinase cascade involved in adventitious root formation. Plant Physiol., 2004, 135, 279-286. Petit, JM ; Briat, JF; Lobréaux, S. Structure and differential expression of the four members of the Arabidopsis thaliana ferritin gene family. Biochem. J., 2001, 359, 575-582. Petrat, F; De Groot, H; Sustmann, R; Rauen, U. The chelatable iron pool in living cells: a methodically defined quantity. Biol. Chem., 2002, 383, 489-502. Proudhon, D; Briat, JF; Lescure, AM. Iron induction of ferritins synthesis in soybean cell suspensions. Plant Physiol., 1989, 90, 586-590.

Oxidative Stress in Soybean: Role of Iron

289

Puntarulo, S; Beconi, MT; Sanchez, RA; Boveris, A. Oxidative activities in soybean embryonic axes during germination. Plant Sci., 1987, 52, 33-39. Puntarulo, S; Galleano, M; Sanchez, RA; Boveris, A. Superoxide anion and hydrogen peroxide metabolism in soybean embryonic axes during germination. Biochim. Biophys. Acta, 1991, 1074, 277-283. Puntarulo, S; Simontacchi, M; Boveris, A. Metabolismo oxidativo y de hidroperóxidos en ejes embrionarios de soja. Acad. Nac. Cs. Ex. Fís. Nat., 1990, 5, 159-166. Ragland, M; Briat, JF; Gagnon, J; Laulhere, JP; Massenet, O; Theil, EC. Evidence for conservation of ferritin sequences among plants and animals and for a transit peptide in soybean. J. Biol. Chem., 1990, 265, 18339-18344. Ravet, K; Touraine, B; Boucherez, J; Briat, JF; Gaymard, F; Cellier, F. Ferritins control interaction between iron homeostasis and oxidative stress in Arabidopsis. Plant J., 2009, 57, 400-412. Rich, PR; Bonner, WD. The sites of superoxide anion generation in higher plant mitochondria. Arch. Biochem. Biophys., 1978, 188, 206-213. Robello, E; Galatro, A; Puntarulo, S. Iron role in oxidative metabolism of soybean axes upon growth. Effect of iron overload. Plant Sci., 2007, 172, 939-947. Roginski, VA; Stegmann, HB. Ascorbyl radical as natural indicator of oxidative stress: Quantitative regularities. Free Radic. Biol. Med., 1994, 17, 93-103. Sczekan, SR; Joshi, JG. Isolation and characterization of ferritin from soyabeans (Glycine max). J. Biol. Chem., 1987, 262, 13780-13788. Simontacchi, M; Caro, A; Fraga, CG; Puntarulo, S. Oxidative stress affects -tocopherol content in soybean embryonic axes upon imbibition and following germination. Plant Physiol., 1993, 103, 949-953. Simontacchi, M; Jasid, S; Puntarulo, S. Nitric oxide generation during early germination of sorghum seeds. Plant Sci., 2004, 167, 839-847. Skulachev, VP. Role of uncoupled and non-coupled oxidations in maintenance of safely low levels of oxygen and its one-electron reductans. Q. Rev. Biophys., 1996, 29, 169-202. Tambussi, EA; Bartoli, CG; Guiamet, JJ; Beltrano, J; Araus, JL. Oxidative stress and photodamage at low temperatures in soybean (Glycine max L. merr) leaves. Plant Sci., 2004, 167, 19-26. Tevini, M; Teramura, AH. UV-B effects on terrestrial plants. Photochem. Photobiol. 2008, 50, 479-487. van der Mark, F; van den Briel, ML; van Oers, JWAM; Bienfait, HF. Ferritin in bean leaves with constant and changing iron status. Planta, 1982, 156, 341-344. van Wuytswinkel, O; Vansuyt, G; Grignon, N; Fourcroy, P; Briat, JF. Iron homeostasis alteration in transgenic tobacco overexpressing ferritin. The Plant J., 1998, 17, 93-97. Xu, C; Natarajan, S; Sullivan, JH. Impacts of solar ultraviolet-B radiation on the antioxidant defense system in soybean lines differing in flavonoid contents. Environ. Exp. Bot., 2008, 63, 39-48. Zancani, M; Peresson, C; Biroccio, A; Federici, G; Urbani, A; Murgia, I; Soave, C; Micali, F; Vianello, A; Macri, F. Evidence for the presence of ferritin in plant mitochondria. Eur. J. Biochem., 2004, 271, 3657-3664. Zancani, M; Peresson, C; Patui, S; Tubaru, F; Vianello, A; Macri, F. Mitochondrial ferritin distribution among plant organs and its involvement in ascorbate-mediated iron uptake and release. Plant Sci., 2007, 173, 182-189.

290

Andrea Galatro and Susana Puntarulo

Zhang, M; Duan, L; Tian, X; He, Z; Li, J; Wang, V; Li, Z. Uniconazole-induced tolerance of soybean to water deficit stress in relation to changes in photosynthesis, hormones and antioxidant system. J. Plant Physiol., 2007, 164, 709-717. Zilli, CG; Ballestrasse, KB; Yannarelli, GG; Polizio, AH; Santa-Cruz, DM; Tomaro, ML. Heme oxygenase up-regulation under salt stress protects nitrogen metabolism in nodules of soybean plants. Environ. Exp. Bot., 2008, 64, 83-89.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 10

USING TRANSGENIC STRATEGIES TO OBTAIN SOYBEAN PLANTS EXPRESSING RESISTANCE TO INSECTS Milena Schenkel Homrich*, Maria Helena Bodanese-Zanettini and Luciane M. P. Passaglia Departamento de Genética, Instituto de Biociências, Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil

ABSTRACT Soybean (Glycine max (L.) Merrill) is one of the most important sources of edible oil and protein, resulting in special interest in the genetic improvement of this crop. The velvetbean caterpillar (Anticarsia gemmatalis Hübner) is a major soybean pest. It causes extremely high levels of defoliation when infestation is heavy and can severely damage axillary meristems, with a single caterpillar being able to consume up to 110 cm2 of soybean foliage. Various authors have reported that A. gemmatalis can be controlled by the delta-endotoxin (δ-endotoxin) produced by some strains of Bacillus thuringiensis. Several DNA delivery methods and plant tissues have been used in developing transgenic soybean plants. Such techniques include particle bombardment of shoot meristems, embryogenic suspension cultures, and Agrobacterium tumefaciens-mediated T-DNA delivery into cotyledonary nodes derived from five- to seven-day old seedlings, mature seeds, immature zygotic cotyledons, somatic embryos derived from immature cotyledons or embryogenic suspension cultures. Earlier studies have indicated that soybean regeneration is genotype-specific with differences in their responses to in vitro culture and transformation. There is no efficient transformation system for a wide range of soybean cultivars, which explains why very few reports on genetic transformation of commercial soybean cultivars are available. There are two major routes to improve embryogenic culture-based soybean regeneration and transformation protocols with the goal of increasing the recovery of transgenic fertile lines. One option is to screen large numbers of new soybean cultivars and genotypes for embryogenic potential, while another option is to use existing protocols and cultivars coupled with traditional breeding *

Corresponding author: E-mail: [email protected], [email protected], [email protected]

292

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia programs for introgressing transgenic traits into other genotypes. The Brazilian soybean cultivar IAS5 has commonly been used in genetic improvement programs and is recommended by the Brazilian Agricultural Ministry for commercial growing in the Brazilian states of Goiás, Minas Gerais, Paraná, São Paulo, and Rio Grande do Sul. This cultivar has shown good reliable response in embryogenic systems. In this Chapter will be described the development of transgenic soybean with resistance to A. gemmatalis larvae. Somatic embryos of the IAS5 cultivar growing on semi-solid medium were transformed with a synthetic Bacillus thuringiensis δ-endotoxin crystal protein cry1Ac gene by particle bombardment. The cry1Ac transgene insertion pattern in the transgenic plants was analyzed in the primary transformants. Transmission and expression of the transgene were also characterized in the T1, T2, and T3 generations. No significant yield reduction was observed in transgenic plants. The cytogenetical analysis showed that transgenic plants present normal karyotype (2n=40). The transgenic plants were also evaluated by in vitro and in vivo assays for resistance to A. gemmatalis. Two negative controls (non-transgenic IAS 5 and homozygous gusA isoline) were used. In a detachedleaf bioassay, cry1Ac plants exhibited complete efficacy against A. gemmatalis, whereas negative controls suffered significant damage. Whole plant-feeding assay data confirmed very high protection of cry1Ac plants against velvetbean caterpillar while non-transgenic IAS 5 and homozygous gusA isoline exhibited 56.5 and 71.5% defoliation, respectively. The bioassays indicated that the transgenic plants were highly toxic to A. gemmatalis, offering a potential for effective insect resistance in soybean.

INTRODUCTION Soybean Soybean [Glycine max (L.) Merrill] is an annual diploid (2n = 40), self-fecundating plant species native to China that has been cultivated for commercial purposes in the East for over 5,000 years. In Brazil, soybean culture started in the 1960‘s, and today soybean is one of the most important plant species for the country‘s economy. Nowadays soybean yield figures in South American countries exceed those in the USA. Taken together, soybean producing countries in South America account for 47% of global production. Brazil is the greatest producer in the continent, contributing with 57% of soybean crops, followed by Argentina (40%) and Paraguay (3%) (ERS-USDA, 2008). In recent years the area destined for soybean plantations has increased by 106% in Brazil, by 170% in Argentina, and roughly by 125% in Paraguay and Bolivia. Like most plant species grown as crops and that are part of the current agricultural system, soybean genetic variability is low — a trait that has rendered difficult the attempts at genetic improvement using classical crossing techniques. The supply of genetic resources present in species that have some kinship with soybean is not accessible to the plant, due to the sexual incompatibility in interspecific and intergenetic crossings (Hu and BodaneseZanettini, 1995). Therefore, in vitro genetic manipulation has raised the question as to the possibility that genes derived from species genetically related or not — and even from other organisms — may be used in improvement programs based on the adoption of molecular and gene transfer techniques.

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

293

Genetic Transformation in Plant Species Genetic transformation in plant species is described as the introduction of exogenous DNA in plant cells according to genetic engineering methods. This genetic manipulation procedure aims at the expression of heterologous genes or at the superexpression or suppression of endogenous plant genes. Plants whose genomes have been modified by gene transformation are called transgenic or genetically modified (GM) plants. The central aim of the development of genetically modified plants (GMP) is to increase plant resistance to herbicides and pathogens, as well as to enhance tolerance to abiotic stress factors, improving nutritional quality of the plant product and generating proteins and biopolymers of technical and pharmaceutical interest (Yuan and Kanuf, 1997; Herbers and Sonnenwald, 1999; Groover et al., 1999). Advancements in the use of plant transgenesis have been reported for a large number of species. Such progress entails the adoption of different protocols, which include the genetic transformation mediated by polyethyleneglycol (PEG) and liposomes (known under the heading of chemical methods), microinjection, electroporation and bombardment of particles (called physical methods), as well as the use of viral and/or bacterial vectors, as in agroinfection and the Agrobacterium system (named biological methods). Genetic transformation by particle bombardment (Sanford, 1988), also called particle or projectile acceleration, biolistics or biobalistics, consists of the introduction of DNA in intact cells and tissues by accelerated microprojectiles driven at high speeds. These are able to cross the wall and the membranes of the cell and the nucleus, where DNA fragments are liberated. In this organelle, exogenous DNA may then be integrated to chromosomal DNA through processes of illegitimate or homologous recombination that depends exclusively on cell components (Sanford, 1990). The main advantage of particle bombardment lies in the possibility to transfer genes to any cell or tissue type independently of genotype and without having to consider the compatibility between host and bacterium, as required by the Agrobacterium system. Apart from this, particle bombardment affords the introduction of DNA in plant cells by means of plasmids solely. In the method, plasmids are made to adhere to metal particles called microcarriers. The metals used in the process have to be inert, like gold or tungsten, so as to prevent particles from reacting with DNA or cell components. The DNA-particle complex is accelerated towards the target cells using several different apparatuses and propellants specially devised based on diverse acceleration mechanisms. Finer et al. (1992) developed a particle accelerator called Particle Inflow Gun (PIG). The device‘s success is due to the fact that it uses helium gas at low pressures, which results in less damage to the tissues that are bombarded (Droste et al. 2002). Apart from the gene in question, plant genetic modification efforts as a rule rely on genes called selectable marker genes and reporter genes. Selectable marker genes are able to lend resistance or tolerance to antibiotics and herbicides, allowing the selection of transgenic material. In turn, reporter genes codify proteins whose presence or enzymatic activity are easily detected and measured, which denotes the transgenic status of cells, tissues, and organisms (Walden and Wingender, 1995). The most commonly used reporter gene in the assessment of the transgenic status of cells and tissues is the gene uidA — also called gusA. The cells transformed by this gene are

294

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

visualized in the blue staining that result from the conversion of the substrate 5-bromo-4chloro-3-indolyl-β-D-glucuronic acid into a blue indolic precipitate in an O2 medium. Among the genes capable of lending resistance to antibiotics and that are commonly used in plants are the neomycin-phosphotransferase gene (nptII) — or aminoclycosidephosphotransferase 3‘II gene (atp3‘) — and the hygromycine-phosphotransferase gene (hpt). The nptII gene was originally isolated from the Tn5 transposon of E. coli and lends resistance to neomycin and its structural analogues kanamycin, geneticin (G418), and paromomycin. In turn, the hpt gene, also isolated from E. coli, codifies the enzyme hygromycinephosphotransferase (HPT) and lends resistance to the antibiotic hygromycine (Van Den Elzen et al., 1985).

Somatic Embryogenesis and Genetic Transformation of Soybean Somatic embryogenesis consists of the development of embryos from microspores or somatic tissues, in a process that generates a plant that nevertheless does not involve the fusion of gametes (Williams and Maheswaran, 1986). The process involves a series of morphological changes that are similar, in several aspects, to those associated to the development of zygotic embryos. Although somatic embryogenesis was described long ago and may be considered a routine procedure for other plant species, like Daucus carota for instance (Steward 1958), the first record of the event in soybean was made by Beversdorf and Bingham (1977), when only a few embryos were produced. It was only in 1983 that Christianson et al. (1983) regenerated, for the first time, soybean plants in vitro. Subsequently, several papers have reported the direct or indirect development of somatic embryos based on cotyledons of immature embryos (Lippmann and Lippmann, 1984; Lazzeri et al., 1985; Barwale et al. 1986; among others). Nevertheless, most of these protocols were not very efficient in transforming genes. This limitation may be partly explained in the light of their incapacity to produce a large number of embryos, an obstacle that was overcome with the attempt to use high concentrations of 2,4dichlorophenoxyacetic acid (2,4-D), the growth regulator agent, in the induction and proliferation steps of somatic embryo production. On the other hand, the transformation of somatic embryos originated chimerical plants (Parrott et al., 1989) due to the multicellular nature of primary somatic embryos based on epidermal cells of explants (Finer, 1988). However, this author also showed that the proliferation of secondary somatic embryos occurred from unique cells of primary embryos, and that secondary embryogenesis could be achieved by keeping the tissue in a medium rich in 2,4-D. The unicellular origin of secondary embryos makes this tissue the main target of genetic transformation, ruling out the risk of generating chimeras. Two gene transfer methods have been used in the transformation of different soybean tissues. These methods are (1) particle bombardment, which targets bud meristems (McCabe et al., 1988; Christou et al., 1989) as well as embryogenic suspension cultures (Finer and McMullen, 1991; Stewart et al., 1996), and (2) the Agrobacterium tumefaciens system, which uses cotyledon nodes derived from 5- to 7-day-old plantlets (Hinchee et al., 1988; Donaldson and Simmonds, 2000; Olhoft et al., 2003), mature seeds (Paz et al., 2006), somatic embryos from immature cotyledons (Parrott et al., 1989; Yan et al., 2000) and embryogenic suspension cultures (Trick and Finer, 1998).

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

295

A simple procedure for the establishment and proliferation of somatic embryos obtained from immature cotyledons, which is also faster and less time-consuming than embryogenic suspension cultures, was developed by Santarém et al. (1997) based on a semi-solid medium previously described by Wright et al. (1991). By adopting this procedure, Santarém and Finer (1999) and Droste et al. (2002) produced transgenic soybean plants from cultivars ―Jack‖ and ―IAS 5‖, respectively, expressing the reporter gene gusA. The genetically modified plants thus obtained in both studies were fertile, indicating that the technique offers good promise to recover transgenic soybean plants. Numerous studies have pointed to the fact that soybean regeneration is genotype-specific and that the vast majority of soybean cultivars stand firm against being cultured and genetically transformed in vitro. There is no single efficient transformation system for most soybean cultivars (Trick et al., 1997; Hofmann et al., 2004; Ko et al., 2004). This explains, at least in part, the dearth of publications addressing genetic transformation of commercial soybean cultivars. According to Meurer et al. (2001), there are two ways to optimize the regeneration of embryogenic cultures and soybean transformation protocols: (1) the testing of a large number of new cultivars in order to identify those with embryogenic potential, and (2) the utilization of consolidated protocols for cultivars like ―Jack‖, for instance, which has been the most commonly adopted in studies on soybean genetic transformation in the USA. In this case, the development of genetically modified plants has to be conducted side by side with traditional improvement programs. The aim is the introgression of transgenic traits in other genotypes. This second option was adopted by Stewart et al. (1996) and Yan et al. (2000) to genetically transform soybean, with a view to developing resistance to insects and modifying proteins, respectively. The Brazilian soybean cultivar IAS 5 has often been utilized in genetic improvement programs, and is commonly recommended as cultivar of choice in the states of Rio Grande do Sul, Paraná, São Paulo, Minas Gerais and Goiás (Ministério da Agricultura, Pecuária e Abastecimento, 2007). The cultivar has shown good response in embryogenic systems (Santos et al., 1997; Droste et al., 2001; Droste et al., 2002).

Co-Transformation Genetic co-transformation includes the utilization of two independent transformation cassettes (or plasmids), one of which carries the reporter/selectable marker genes and the other carries the gene in question. The co-transformation system allows segregating the gene of interest from the reporter/selectable marker genes in the progeny of modified plants, as long as these genes have been inserted in non-ligated loci (Ebinuma et al., 2001). Therefore, co-transformation may be seen as a promising strategy for the obtainment of transgenic plants free from selectable marker genes. Most studies on co-transformation have been carried out using the Agrobacterium system. The review published by Ebinuma et al. (2001) reports the successful cotransformation using Agrobacterium in different species and target tissues: tobacco protoplasts, tobacco leaf discs, canola hypocotyl segments, Arabidopsis leaf discs, and rice. According to the authors, although the frequency of co-transformation varied considerably

296

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

(between 10 and 90%), in most studies this frequency was observed to be above the value predicted for independent transformation events. Using direct transfer techniques — mostly protoplast transformation mediated by polyethylene glycol and by particle bombardment — several research groups have reported co-transformation frequencies that ranged from 18 to 88% (Bettany et al., 2002). In soybean, an approximately 25% co-transformation frequency was observed in experiments on particle acceleration or protoplast electroporation, as well as particle acceleration targeted at meristems (Christou et al., 1990). So far there are no published reports on soybean using somatic embryos as co-transformation target.

Bacillus thuringiensis and anticarsia gemmatalis Bacillus thuringiensis (Bt) is an aerobic (or facultative anaerobic), entomopathogenic Gram positive bacterium widely used as biopesticide to control pest insects that attack agriculturally important crops. Similarly to other bacteria the species may remain latent in its endospore form, in adverse scenarios. During the sporulation phase, B. thuringiensis produces proteins that are stored around spores, forming crystals (Peferöen, 1997). These crystals are formed by several Cry proteins, also called δ-endotoxins or Intersticidal crystal proteins (ICPs). These proteins exert specific toxic activity mainly against larvae of lepidopterans, dipterans, and choleopterans (Hongyu et al., 2000). Some models have been proposed in an attempt to shed more light on the action mechanism of Cry proteins. Nowadays, the ―umbrella‖ model is the most widely accepted in the scientific community. The model assumes that δ-endotoxins forming the crystals are soluble protoxins proteolytically converted into small polypeptides in the digestive tract of susceptible insects. During the process one amino-terminal peptide is removed, formed by between 25 and 30 amino acids and of roughly half the amount of the remaining protein, which corresponds to the C-terminus. These small polypeptides associate to specific ligation sites in the apical microvilli of the insect‘s intestine cells, leading to osmotic lysis mediated by the formation of pores on the cell membrane (Schnepf et al., 1998; Bravo et al., 2004). A second action model for Cry proteins was described by Broderick et al. (2006). According to the authors, the lesions caused in the insect‘s intestine due to the action of δendotoxins afford the colonization of the animal‘s hemolymph by the resident enterobacterial microbiota, which would lead to the insect‘s death due to ―generalized infection‖. This is why previous models have suggested that the reason behind the insect‘s death is undernourishment due to the interruption of digestion caused by the lesions. Yet, Broderick et al. (2006) have shown that insects whose digestive tract had been sterilized with antibiotics did not die after ingesting the toxin, and that they were actually capable of regenerating their intestinal epithelium, a process which afforded to resume normal feeding. The velvetbean caterpillar, one of the metamorphosis stages of the moth Anticarsia gemmatalis Hübner, is the most important plague to affect soybean plantations. It occurs mainly in the North and South Americas (Panizzi and Corrêa-Ferreira, 1997; Macrae et al., 2005). The caterpillar causes losses by substantially reducing the size of leaves, promoting a significant decrease in grain yields. One single larva of A. gemmatalis may consume more than 110 cm² of soybean leaves (Walker et al., 2000). Control strategies against the insect have resorted predominantly on chemical insecticides applied as many as three times in a harvest season, leading to considerable harm to the environment and increasing production costs. Apart from this, chemical insecticides cause the mortality of other insects, even of the

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

297

natural enemies that help check pest population growth. Several laboratories around the world are actively searching for alternative methods to control pest insects in efforts focused mainly on environment conservation. Alternatively, biological insecticides have become a natural choice in the so-called ―organic agriculture‖ and in more selective control strategies against insects. Bioinseticides developed against A. gemmatalis based on formulations including B. thuringensis spores have been proved to offer several advantages in comparison to chemical control agents as regards the high specificity and toxicity of the bacterium against certain pest insects. At the same time, the bacterium is atoxic to other insects, plants, and vertebrates (Hongyu et al., 2000). In spite of the fact that these bioinseticides have been used for over 50 years — with clear evidence of being less harmful to the environment as compared to agrochemical insecticides — this class of agricultural chemicals has never been rewarded with an eminent position in the market. This is explained by the problems related to the loss of stability, to the absence of translocation in plants, to the limited action spectrum, and to the fast degradation by ultraviolet light (Navon, 2000). Recently, the introduction of genes codifying δ-endotoxins has been explored in the development of several transgenic plants resistant to insects in different plantations. In 1981, the first gene cry was cloned and expressed in Escherichia coli (Schnepf and Whiteley, 1981). A few years later the first tomato plant carrying Bt genes was produced (Fischhoff et al., 1987). The corn cultivar Maximize™ developed by Novartis, the cotton cultivar Bollgard™ and the potato Newleaf™ from Monsanto were introduced in the North American market in 1995, and are known as Bt-plants (Jounanin et al., 1998). In 2006, 19% and 13% of the area used to grow transgenic crops worldwide (102 million hectares) was taken by Bt cultures and Bt cultures tolerant to herbicides, respectively (James, 2006). Apart from corn, cotton and canola, which are currently being commercialized, other plants expressing one or several Cry proteins used to control lepidopterans and coleopterans are being developed in laboratories or in field tests. Although the commercial cultivation of Bt-soybean plants has not as yet been authorized, several transgenic strains have already been obtained. The insecticide activity of δ-endotoxins of B. thuringiensis in the control of A. gemmatalis larvae has been demonstrated using bioassays with Bt-soybean plants by Stewart et al. (1996), Walker et al. (2000), Macrae et al. (2005) and more recently by Miklos et al. (2007) and Homrich et al. (2008).

Advantages of Plants Modified with B. Thuringiensis Genes Considering the data relative to safety, environmental risks and efficiency in pest control gathered along the 50 years Bacillus thuringiensis has been used as biopesticide, it is possible to affirm that Bt-plants offer harmless and effective insect control (De Maagd et al., 1999). Losses due to the high costs of pesticides amount to billions of dollars worldwide. Therefore, Bt-plants have become a promising alternative in insect control strategies in the light of the need to cut costs, to minimize environmental damage, and to reduce health hazards to agricultural workers. Since the commercial use of Bt-plants was authorized in the USA, farmers have adopted the technology with the aim of effectively increasing production in sustainable agriculture practices (Dunwell, 1999). In this context, apart from the high efficiency in controlling pest insects, the technique offers other benefits, like:

298

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia 1. Less environmental effects against toxins: Bt-plants have demonstrated some advantages over biopesticides, since the efficiency in production of Cry proteins by these plants is not lessened by environmental variables like rain after application, solar radiation, and high temperatures (Betz et al., 2000). Moreover, the recombinant Cry proteins are uniformly stored in plant tissues, a trait which increases the efficiency of the toxic effect against insects as compared to the application (spraying) with Bt spores. 2. More safety in utilization: Several characteristics inherent to Bt-plants afford a degree of safety that can hardly be obtained using chemical insecticides, like the fact that these proteins are not toxic to humans and pets, that they are not stored in fatty tissues, and they do not resist for long in the environment (Siegel, 2001). Another important characteristic of Cry proteins is that they are highly specific towards target insects, and have to be ingested in order to exert the desired effects, since they are inactive by contact (Betz et al. 2000). Apart from this, the exposure of humans and other animals to these proteins is much lower as compared to the levels of exposure to insecticides normally used, because as a rule the amounts of chemical and biological insecticides employed are very high, whereas Cry proteins are produced at low levels inside Bt-plants (even when strong promoter sequences are utilized) (Bishop et al., 1999). 3. Lower quantities of chemical insecticides: In recent years the negative impact of chemical products on the environment has worsened, as observed in the pollution of land and fresh water bodies with these compounds, apart from the accumulation of such compounds in food chains and the ensuing issues concerning public health. The percentage reduction in chemical insecticides usage promoted by the adoption of Btplants varies, depending on the plant culture being considered. In China, for instance, Bt-cotton has afforded a considerable reduction in chemical pesticides, which varied between 60 and 80% (Xia et al., 1999). 4. Increased agricultural yields due to less damage: The protection inherent to Bt-plants has been manifested as higher agricultural productivity. In the past, annual losses in maize plantations in the USA due to damage caused by the beetle L. decemlineata ranged between 33 and 300 million tons a year. Yet, these losses were dramatically reduced with the adoption of Bt-maize, which significantly increased final production numbers of the crop (Betz et al., 2000). In 1997, an boost in yield of approximately 5% in one third of the 30-million-hectare area used in hybrid maize plantations accounted for a profit of US$350 million to North American maize farmers (Peferöen, 1997). 5. Conservation of natural enemies of pest insects: The effects of Bt toxins on the natural enemies of pest insects, whether parasitoids or predators, have been studied in laboratories and in the field. These studies have shown that Bt toxins exert barely any or even no effect on these organisms (Wraight et al., 2000). Natural enemies of pest insects are extremely important, since the secondary pests may become a problem in cases when the population of beneficial insects is reduced due to wide-spectrum chemical insecticides. Xia et al. (1999) reported that the use of Bt-cotton in China determined the reduction in use of chemical insecticides, which led to an increase of 24% in the population of natural enemies of pest insects.

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

299

6. Decrease in fungal diseases as a result of lessened damage: The lesions in several organs of plants caused by insects promote the reduction in grain yield and facilitate fungal infections, especially by the genera Fusarium and Aspergillus (Munkvold and Hellmich, 1999a). Spore germination and proliferation of fungi of the genus Fusarium (F. verticillioides, F. proliferatum, and F. subglutinans) are normally associated to lesions caused by the larvae of Ostrinia nubilalis (Sobek and Munkvold, 1999). The primary importance of these diseases lies in mycotoxins, mainly fumonisins and aflatoxins, produced by fungi that belong to these genera (Munkvold and Hellmich, 1999b). Fumosins may be lethal to horses and swine, though their relevance concerning human health remains controversial. Aflatoxin is acknowledged as an extremely toxic mycotoxin to animals and humans. Yet, Btplants have led to a shortening in the odds of infection by Fusarium and Aspergillus (Betz et al., 2000).

Chromosomal Stability of Genetically Modified Plants It has been well established that plant cells cultured in vitro may undergo several genetic and chromosomal changes. According to Finer and McMullen (1991), some transgenic plants produced by bombardment of embryogenic suspensions were sterile and exhibited several morphological alterations. Cytological analyses of suspension culture cells of roots of germinated embryos and of To and T1 plants conducted in an attempt to determine the cause of these morphological changes have revealed the existence of several chromosomal aberrations such as deletions, duplications, trisomy and tetraploidy. It has also been shown that soybean genotypes differ in terms of the chances of chromosomal instability induced by the culture of tissues (Singh et al., 1998). Therefore, the chromosomal analysis of plants regenerated in vitro may help eliminate, from the chromosomal perspective, the generation of abnormal genetic material, one of the undesired results of gene transfer experiments.

DEVELOPMENT OF TRANSGENIC SOYBEAN WITH RESISTANCE TO A. GEMMATALIS LARVAE Transgenic soybean plants with resistance to A. gemmatalis larva were developed in the work of Homrich et al. (2008 a). The particle bombardment technique was used to transform somatic embryos of cultivar IAS5 grown on semi-solid medium with a synthetic cry1Ac gene. Somatic embryogenesis was induced, and the somatic embryos were proliferated and maintained as described by Droste et al. (2002). The authors utilized two plant transformation vectors: pGusHyg [a pUC18 derivative plasmid carrying gusA reporter and hygromycin resistance (hpt) genes, both controlled by the Cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (nos) terminator], and pGEM4Zcry1Ac [a pGEM4Z derivative plasmid containing the truncated synthetic cry1Ac gene from Bacillus thuringiensis under control of the 35S promoter and nopaline synthase terminator]. The particle bombardment protocol utilized a Particle Inflow Gun (PIG, Finer et al., 1992). The selection of transformed tissues as well as plant regeneration was conducted as previously described by Droste et al. (2002).

300

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

The selection of transformed tissues was done on D20 medium with hygromycin-B. After selection, hygromycin-resistant embryogenic soybean tissues were visually selected, counted and separately cultured for the establishment and proliferation of lines, corresponding to putative independent transformation events. Nine proliferative lines out of 60 independent pieces of hygromycin-resistant tissues were established. A total of 613 histodifferentiated somatic embryos were obtained. The histodifferentiated embryos were transferred to conversion medium. Thirty well-developed plantlets were transplanted ex vitro. Twenty of these plants reached maturity and flowered but only 14 plants set seeds. All embryos/plants derived from an independent piece of hygromycin-resistant tissue were observed to be clonal embryos/plants. The twenty recovered plants were screened for the presence of the gusA, hpt, and cry1Ac genes by PCR. Eleven plants of the nine independent lines obtained presented the expected 622- and 512-bp fragments for gusA and hpt genes, respectively. The presence of the expected 1845-bp cry1Ac fragment was observed in seven plants. Only two out of those seven transformed T0 plants produced seeds and were analyzed for patterns of integration and inheritance until the T3 generation. Primary regenerants (T0) are the transgenic plants recovered from the explant originally subjected to particle bombardment. T1, T2 and T3 are seed-derived plants obtained from self-pollination of T0, T1 and T2 plants, respectively. So, the genomic DNA of T1, T2 and T3 cry1Ac/gusA-positive plants was digested with KpnI, an enzyme that cuts plasmid pGEM4Z only once, SalI (that does not cleave the transformation plasmid), and with BamHI (which release the 2.1 kb cry1Ac cassette). The detection of a 2.1-kb band in the DNA digested with BamHI in all plants indicated the presence of at least one intact gene copy. The presence of bands larger than 2.1 kb provides evidence of rearrangements of the transgene DNA. Analysis of digests with KpnI revealed three cry1Ac fragments in all plants. Analysis with SalI confirmed the presence of three copies of that gene. Southern blot was also performed on cry1Ac/gusA negative plants in order to determine if transgenes were present. The absence of any hybridization signal indicated that those plants probably had no transgene inserted. All the transgenic plants of the T1, T2 and T3 progenies analyzed showed the same hybridization pattern as the two T0 parental plants, and consequently presented the same copy number. These results indicated that all copies of the gene were inherited as a unit, and that the original transgene integration pattern observed in the primary regenerated plants was stably passed on to all progeny plants. Based on the analysis of the 48 T1 plants, it became apparent that gusA/hpt and cry1Ac were linked at one integration site in the initial T0 plants. The T1 progenies of both T0 plants segregated for fewer cry1Ac/gusA-positive plants than predicted by Mendelian principles for a single dominant locus (3:1). The T2 and T3 families continued to segregate in an exceptional manner, with a vast deficiency of transgenic plants. Moreover, the segregation ratios indicated that T2 plants were uniformly heterozygous for the transformed traits. Transgenes are generally expected to behave as dominant genes and segregate in a 3:1 ratio for transgenic to non-transgenic progeny, when the plant is self-pollinated, because the transgene locus is considered to be hemizygous in the primary (T0) transformant (Campbell et al., 2000). However, transgenic loci introduced into higher plant species frequently display unpredictable patterns of inheritance and expression, which has occurred in around 10% to 50% of some transgenic lines (Yin et al., 2004). Exceptional segregation ratios may result from several factors, including inactivation of transgene expression, insertion leading to a lethal mutation, and poor transgene transmission to the progeny. The inactivation of

A

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

301

expression is frequently observed when transgenes are present in multiple copies and is responsible for abnormal segregation (Yin et al., 2004). However, PCR amplifications performed on T1 and T2 cry1Ac/gusA-negative plants confirmed the absence of transgeneDNA in these plants. Therefore, the inactivation of transgene expression cannot be taken into consideration when to explaining the non-Mendelian segregation observed in Yin et al. (2004). The integration of foreign DNA into the plant genome can produce an insertion mutation in an essential gene. A lethal mutation reflected by the lack of homozygotes can lead to a 2:1 segregation ratio for transgenic and non-transgenic traits in the progeny of a transgenic plant. The 2:1 segregation ratio observed in a T2 progeny of a transformed line of Asparagus officinalis was explained by the absence of homozygotes (Limanton-Grevet and Jullien, 2001). However, the results obtained in that work did not fit even to this 2:1 segregation ratio, suggesting that other factors play a role in the process. In addition, non-Mendelian segregation of transgenes could be explained by the lack of transmittance via one of the gametes. Christou et al. (1989) credited a 1:1 segregation ratio observed in progeny derived from selfing of a transgenic soybean plant to the failure of passing a transgene to the next generation through pollen. To investigate the transgene transmission through the gametes, several of our transgenic plants were reciprocally crossed to untransformed plants. Results showed transgene transmission through male and female gametes, though at a substantially reduced rate. The low number of crosses in which the transformant served as pollen donor did not allow us to conclude unequivocally that the transmission through the male was affected less severely than transmission through the female. A T3 transformant plant that served as the female parent in the backcross set four seeds, which gave raise to four cry1Ac/gusA-positive plants. This result indicated that the T3 transformant plant may be homozygous. To validate our assumption, we tested 20 selfed seeds obtained from that T3 transformant plant. Seeds were germinated on wet filter paper and the seedlings were analyzed for GUS activity and cry1Ac expression. The results confirmed the homozygous condition. Based on this fact, we decided to investigate the possible homozygous state of other T3 transgenic plants. Twenty selfed seeds from each 253 out of the 309 T3 cry1Ac/gusA-positive plants were germinated and the seedlings analyzed as described above. Besides the plant already mentioned, the analysis detected 12 T3 homozygous cry1Ac/gusA-positive plants. Therefore, the possibility of a lethal insertional mutation that would be reflected by the lack of homozygotes was also excluded to explain the observed non-Mendelian segregation. On the other hand, we assumed that the difficulty to obtain homozygous plants in the T2 generation could be explained by the poor transmission of transgenes through male and especially through female gametes. In a second study, Homrich et al. (2008 b) analyzed the agronomic performance of the transgenic homozygous lines and their resistance to A. gemmatalis larvae by detached-leaf and whole plant-feeding bioassays. For the agronomic evaluation, the progenies (=isolines) were obtained from selfpollination of T3 homozygous transgenic plants. Seeds of non-transgenic IAS 5 were used as a control. For the following agronomic traits no variation was observed within and among transgenic isolines and the non-transgenic IAS 5 control: date of emergence (6-7 days), seedling hypocotyl color (light green), flower color (white), pubescence color (grey), growth

302

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

habit (determimed), maturity (155 days), seed tegument color (yellow), seed hilum color (light brown). These traits observed were in accordance with the IAS 5 description. Significant differences were observed for initial development, flowering date, plant height, number of nodes, number of seeds, 100-seed weight, and total grain weight. Ten days after planting the non-transgenic IAS 5, the control was at a more advanced developmental stage than plants of the transgenic isolines. Interestingly, only two transgenic isolines showed late flowering, while the other isolines did not differ from non-transgenic IAS 5 control. Likewise the number of nodes and plant height at maturity of most of the transgenic isolines did not differ from the control in this trait. Concerning the yield evaluation, five transgenic isolines had a significantly lower 100-seed weight, while the other isolines did not differ from the control. However, considering the number of seeds and total grain weight no significant differences were detected among the transgenic isolines and the control. Taking into account all analyzed traits, the presence of the cry1Ac transgene did not affect the development and yield of plants. The agronomic performance of the transgenic isolines was similar to that of the control. Likewise, Miklos et al. (2007) showed no significant differences in agronomic performance (emergence, flowering, plant height, lodging, maturity and yield) of transgenic soybean plants containing a highly expressed cry1A gene. To test the resistance of transgenic plants to A. gemmatalis, two homozygous cry1Ac transgenic isolines were evaluated by in vitro and in vivo assays. A homozygous gusA isoline and non-transgenic IAS 5 plants were used as negative controls. In vitro insecticidal activity of transgenic and control plants toward A. gemmatalis larvae was evaluated using a detached leaf-feeding assay. Leaf samples were infested with 20 neonate A. gemmatalis larvae per plate. After 24 h, the percent foliage consumption was estimated. The number of live and dead larvae was determined 24, 48 and 72 h after infestation. At the end of the experiment, the surviving larvae had their development and weight evaluated. Twenty-four hours after the beginning of the experiment, leaves from the homozygous gusA isoline and from the non-transgenic plants were completely defoliated. In contrast, consumption was significantly reduced in homozygous cry1Ac transgenic leaves. Larvae fed on cry1Ac transgenic leaves showed browning and severe growth retardation in comparison to larvae fed on control leaves. Considering the larval weight on non-transgenic leaves as 100%, weight of the larvae reared on cry1Ac leaves was substantially reduced. The fate of the larvae was monitored for another two days. Seventy-two hours after infestation, larvae reared on cry1Ac leaves exhibited 100% mortality compared with 1.65% of larvae fed on leaves from both the non-transgenic and gusA plants. The whole plant-feeding assay was carried out in a greenhouse. Each plant was infested with 50 velvetbean caterpillar larvae when plants were in the V3 to V4 stages of development. Resistance was evaluated through visual estimates of percent defoliation and the insect survivorship was assessed seven and 14 days after the infestation. The percent defoliation represents the percentage of leaves whose consumed area was higher than 50%. Insect damage in whole plant-feeding assay was similar to the detached leaf-feeding experiments, as control plants suffered a much greater amount of leaf damage than transgenic plants. The percent defoliation of the homozygous gusA isoline and non-transgenic IAS 5 plants 14 days after the infestation was on average 56.5 and 71.5%, respectively. On the other hand almost no damage was observed on cry1Ac transgenic isolines. The results obtained showed that the high level of resistance against velvetbean caterpillar is similar or even higher than that reported by Miklos et al. (2007).

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

303

In addition to these experiments, a cytogenetic analysis was performed in a sample of the transgenic plants obtained. Genetic and chromosomal abnormalities have been reported in plants arising from tissue culture. The change in chromosome number in a variant plant is commonly associated with reduced fertility and with altered genetic ratios in the progeny of self-fertilized plants. Singh et al. (1998) showed that soybean genotypes differ in their susceptibility to chromosomal instability induced by tissue culture. Cytogenetic analysis performed in this study showed that transgenic plants presented normal karyotype (2n=40). In conclusion Homrich et al. (2008 a, b) reported the success in developing soybean IAS5 transgenic plants with a synthetic cry1Ac gene and the agronomic performance of the transgenic isolines. Although the segregation was non-Mendelian in the first generations, the transgenes were stably transmitted and expressed in the progenies. Homozygous transgenic plants were obtained in T3 generation. Taking in account all analyzed agronomic traits the presence of the cry1Ac transgene did not affect the development and yield of plants. The results of in vitro and in vivo bioassays confirmed the resistance of transgenic plants to Anticarsia gemmatalis. Cytogenetical analysis showed that transgenic plants presented normal karyotype (2n=40) with no apparent chromosomal abnormalities.

REFERENCES Barwale, U. B., Kerns, H. R. & Widholm, J. M. (1986). Plant regeneration from callus cultures of several soybean genotypes via embryogenesis and organogenesis. Planta, 167, 473-481. Bettany, A. J. E., Dalton, S. J., Timms, E., Dhanoa, M. S. & Morri, P. (2002). Effect of selectable gene to reporter gene ratio on the frequency of co- transformation and coexpression of uidA and hpt transgenes in protoplast-derived plants of tall fescue. Plant Cell Tissue Organ Cult, 68, 177-186. Betz, F. S., Hammond, B. G. & Funchs, R. L. (2000). Safety and advantages of Bacillus thuringiensis protected plants to control insect pests. Regul Toxicol Pharmacol, 32, 156173. Beversdorf, W. D. & Bingham, E. T. (1977). Degrees of differentiation obtained in tissue cultures of Glycine species. Crop Sci., 17, 307-311. Bishop, A. H., Johnson, C. & Perani, M. (1999). The safety of Bacillus thuringiensis to mammals investigated by oral and subcutaneos dosage. World J Microbiol Biotechnol, 15, 375-380. Bravo, A., Gomez, I., Conde, J., Munoz-Garay, C., Sánchez, J., Zhuang, M., Gill, S. S. & Soberón, M. (2004). Oligomerization triggers differential binding of a pore-forming toxin to a different receptor leading to efficient interaction with membrane microdomains. Biochim Biophys Acta., 1667, 38-46. Broderick, N. A., Raffa, K. F. & Handelsman, J. (2006). Midgut bacteria required for Bacillus thuringiensis insecticidal activity. Proc Natl Acad Sci USA, 103, 15196-15199. Campbell, B. T., Baenziger, P. S., Mitra, A., Sato, S. & Clemente, T. (2000). Inheritance of multiple transgenes in wheat. Crop Sci., 40, 1133-1141. Christianson, M. L., Warnick, D. A. & Carlson, P. S. (1983). A morphogenetically competent soybean suspension culture. Science, 222, 632-634.

304

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

Christou, P., Swain, W. F., Yang, N. S. & McCabe, D. E. (1989). Inheritance and expression of foreign genes in transgenic soybean plants. Genetics, 88, 7500-7504. Christou, P., McCabe, D. E., Martinell, B. J. & Swain, W. F. (1990). Soybean genetic engeneering-commercial products of transgenic plants. Trends Biotechnol, 18, 145-151. De Maagd, R. A., Bosch, D. & Stiekema, W. (1999). Bacillus thuringiensis toxin-mediated insect resistence in plants. Trends Plant Sci., 14, 9-13. Donaldson, P. A. & Simmonds, D. H. (2000) Susceptibility to Agrobacterium tumefaciens and cotyledonary node transformation in short-season soybean. Plant Cell Rep., 19, 478484. Droste, A., Leite, P. C. P., Pasquali, G., Mundstock, E. C. & Bodanese-Zanettini, M. H. (2001). Regeneration of soybean via embryogenic suspension culture. Scientia Agrícola, 58, 753-758. Droste, A., Pasquali, G. & Bodanese-Zanettini, M. H. (2002) Transgenic fertile plants of soybean [Glycine max (L.) Merrill] obtained from bombarded embryogenic tissue. Euphytica, 127, 367-376. Dunwell, J. M. (1999). Transgenic crops: The next generation, or an example of 2020 vision. Ann Bot, 84, 269-277. Ebinuma, H., Sugita, K., Matsunaga, E., Endo, S., Yamada, K. & Komamine, A. (2001). Systems for the removal of a selection marker and their combination with a positive marker. Plant Cell Rep., 20, 383-392. ERS-USDA,Soybeans and Oil Crops, http://www.ers.usda.gov/Briefing/ SoybeansOilCrops (January 18, 2008). Finer, J. J. (1988). Apical proliferation of embryogenic tissue of soybean [Glycine max (L.) Merrill]. Plant Cell Rep., 7, 238-241. Finer, J. J. & McMullen, M. D. (1991). Transformation of soybean via particle bombardment of embryogenic suspension culture tissue. In Vitro Cell Dev Biol Plant, 27, 175-182. Finer, J. J., Vain, P., Jones, M. W. & McMullen, M. D. (1992). Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Rep, 11, 323-328. Fischhoff, D. A., Bowdish, K. S., Perlak, F. J., Marrone, P. G., McCormick, S. M., Niedermeyer, J. G., Dean, D. A., Kusano-Kretzmer, K., Mayer, E. J., Rochester, D. E., Rogers, S. G. & Fraley, R. T. (1987). Insect tolerant transgenic tomato plants. Biotechnology, 5, 807-813. Grover, A., Sahi, C., Sanan, N. & Grover, A. (1999). Taming abiotic stresses in plants through genetic engineering: current strategies and perspective. Plant Sci., 143, 101-111. Herbers, K. & Sonnewald, U. (1999) Production of new/modified proteins in transgenic plants. Curr Opin Biotechnol, 10, 163-168. Hinchee, M. A., Connor-Ward, D. V., Newell, C. A., McDonnell, R. E., Sato, S. J., Gasser, C. S., Fischhoff, D. A., Re, D. B., Fraley, R. T. & Horsch, R. B. (1988). Production of transgenic soybean plants using Agrobacterium-mediated DNA transfer. Biotechnology, 6, 915-922. Hofmann, N., Nelson, R. L. & Korban, S. S. (2004). Influence of media components and pH on somatic embryo induction in three genotypes of soybean. Plant Cell Tissue Organ Cult, 77, 157-163. Homrich, M. S., Passaglia, L. M. P., Pereira, J. F., Bertagnolli, P. F., Pasquali, G., Zaidi, M. A., Altosaar, I. & Bodanese-Zanettini, M. H. (2008 a). ―IAS5‖ transgenic soybean

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

305

[Glycine max (L.) Merrill] plants expressing a modified CRY1AC endotoxin show resistance to Anticarsia gemmatalis. Genet Mol Biol., 31, 522-531. Homrich, M. S., Passaglia, L. M. P., Pereira, J. F., Bertagnolli, P. F., Salvadori, J. R., Nicolau, M., Kaltchuk-Santos, E., Alves, L. B. & Bodanese-Zanettini, M. H. (2008 b). Pesq Agropec Bras., 43, 801-807. Hongyu, Z., Ziniu, Y. & Wangxi, D. (2000). Composition and ecological distribution of Cry protein and their genotypes of Bacillus thuringiensis isolates from warehouses in China. J Invertebr Pathol, 76, 191-197. Hu, C. Y. & Bodanese-Zanettini, M. H. (1995). Embryo culture and embryo rescue for wide cross hybrids. In: Gamborg OL e Phillips (eds) Plant Cell, Tissue and Organ Cultures: Fundamental Methods. Springer, Berlin, 129-141. James, C. (2006). Global status of commercialized biotech/GM crops: 2006. http://www.isaaa.org/resources/publications/briefs/35/executivesummary/default.html Jouanin, L., Bodané-Botino, M., Girard, C., Morrot, G. & Giband, M. (1998). Transgenic plants for insect resistence. Plant Sci., 131, 1-11. Ko, T. S., Nelson, R. L. & Korban, S. S. (2004). Screening multiple soybean cultivars (MG 00 to MG VIII) for somatic embryogenesis following Agrobacterium-mediated transformation of immature cotyledons. Crop Sci., 44, 1825-1831. Lazzeri, P. A., Hildebrand, D. F. & Collins, G. B. (1985). A procedure for plant regeneration from immature cotyledon tissue of soybean. Plant Mol Biol Rep., 3, 160-167. Lippmann, B. & e Lippmann, G. (1984). Introduction of somatic embryos in cotyledonary tissue of soybean, Glycine max L. Merr. Plant Cell Rep., 3, 215-218. Macrae, T. C., Baur, M. E., Boethel, D. J., Fitzpatrick, B. J., Gao, A. G., Gamundi, J. C., Harrison, L. A., Kabuye, V. T., Mcpherson, R. M., Miklos, J. A., Paradise, M. S., Toedebusch, A. S. & Viegas, A. (2005). Laboratory and field evaluations of transgenic soybean exhibiting high-dose expression of a synthetic Bacillus thuringiensis cry1A gene for control of Lepidoptera. J Econ Entomol, 98, 577-587. McCabe, D. E., Swain, W. F., Martinell, B. J. & Christou, P. (1988). Stable transformation of soybean (Glycine max) by particle acceleration. Biotechnology, 6, 923-926. Meurer, C. A., Dinkins, R. D., Redmond, C. T., McAllister, K. P., Tucker, D. T., Walker, D. R., Parrott, W. A., Trick, H. N., Essic, J. S., Frantz, H. M., Finer, J. J. & Collins, G. B. (2001). Embryogenic response of multiple soybean [Glycine max (L.) Merr.] cultivars across three locations. In Vitro Cell Dev Biol Plant, 37, 62-67. Miklos, J. A., Alibhai, M. F., Bledig, S. A., Connor-Ward, D. C., Gao, A. G., Holmes, B. A., Kolacz, K. H., Kabuye, V. T., MacRae, T. C., Paradise, M. S., Toedebusch, A. S. & Harrison, L. A. (2007). Characterization of soybean exhibiting high expression of a synthetic Bacillus thuringiensis cry1A transgene that confers a high degree of resistance to Lepidopteran pests. Crop Sci., 47, 148-157. Munkvold, G. P. & Hellmich, R. L. (1999a). Comparison of fumosin concentrations in kernel of transgenic Bt maize hybrids and non-transgenic hybrids. Plant Dis., 83, 130-138. Munkvold, G. P. & Hellmich, R. L. (1999b). Genetically modified insect resistant corn: implications for disease management. http:// www. apsnet. org/ online/ feature/ BtCorn /Top.html Navon, A. (2000). Bacillus thuringiensis insecticides in crop protection-reality and prospects. Crop Prot, 19, 669-676.

306

M. Schenkel Homrich, M. H. Bodanese-Zanettini and L. M. P. Passaglia

Olhoft, P. M., Flagel, L. E., Donovan, C. M. & Somers, D. A (2003). Efficient soybean transformation using hygromycin B selection in the cotyledonary-node method. Planta, 216, 723-735. Panizzi, A. R. & Corrêa-Ferreira, B. S. (1997). Dynamics in the insect fauna adaptation to soybean in the tropics. Trends Entomol, 1, 71-88. Parrott, W. A., Hoffman, L. M., Hildebrand, D. F., Williams, E. G. & Collins, G. B. (1989). Recovery of primary transformants of soybean. Plant Cell Rep., 7, 615-617. Paz, M. M., Martinez, J. C., Kalvig, A. B., Fonger, T. M. & Wang, K. (2006). Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Plant Cell Rep., 25, 206-213. Peferöen, M. (1997). Progress and prospects for field use of Bt genes in crops. Trends Biotechnol, 15, 173-177. Sanford, J. C. (1988). The biolistic process. Trends Biotechnol, 6, 299-302. Sanford, J. C. (1990). Biolistic plant transformation. Plant Physiol, 79, 206-209. Santarém, E. R., Pelissier, B. & Finer, J. J. (1997). Effect of explant orientation, pH, solidifying agent and wounding on initiation of soybean somatic embryos. In Vitro Cell Dev Biol Plant, 33, 13-19. Santarém, E. R. & Finer, J. J. (1999). Transformation of soybean [Glycine Max (L.)Merrill] using proliferative embryogenic tissue maintained on semi-solid medium. In Vitro Cell Dev Biol Plant, 35, 451-455. Santos, K. G. B., Mundstock, E. & Bodanese-Zanettini, M. H. (1997). Genotype-specific normalization of soybean somatic embryogenesis through the use of an ethylene inhibitor. Plant Cell Rep, 16, 859-864. Schnepf, E. & Whiteley, H. R. (1981). Cloning and expression of the Bacillus thuringiensis crystal protein gene in Escherichia coli. Proc Natl Acad Sci USA, 78, 2893-2897. Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D. R. & Dean, D. H. (1998). Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev, 62, 775-806. Siegel, J. P. (2001). The mammalian safety of Bacillus thuringiensis-based insecticides. J Invertebr Pathol, 77, 13-21. Singh, R. J., Klein, T. M., Mauvais, C. J., Knowlton, S., Hymowitz, T. & Kostow, C. M. (1998). Cytological characterization of transgenic soybean. Theor Appl Genet, 96, 319324. Sobek, E. A. & Munkvold, G. P. (1999). European corn borer (Lepidoptera:Pyralidae) larvae as vectors of Fusarium moniliforme, causing kernel rot and symptomless infection of maize kernels. J Econ Entomol, 92, 503-509. Steward, F. C. (1958). Growth and development of cultivated cells. III. Interpretations of growth from free cell to carrot plant. Am J Bot, 45, 709-713. Stewart, C. N., Adang, M. J., All, J. N., Boerma, H. R., Cardineau, G., Tucker, D. & Parrott, W. A. (1996). Genetic transformation, recovery, and characterization of fertile soybean transgenic for a synthetic Bacillus thuringiensis cry1Ac gene. Plant Physiol, 112, 121129. Trick, H. N., Dinkings, R. D., Santarém, E. R., Samoylov, V., Meurer, C. A., Walker, D. R., Parrott, W. A., Finer, J. J. & Collins, G. B. (1997). Recent advances in soybean transformation. Plant Tissue Cult Biotechnol, 3, 9-24.

Using Transgenic Strategies to Obtain Soybean Plants Expressing Resistance …

307

Trick, H. N. & Finer, J. J. (1998). Sonication-assisted Agrobacterium-mediated transformation of soybean [Glycine max (L.) Merrill] embryogenic suspension culture tissue. Plant Cell Rep, 17, 482-488. Van Den Elzen, P. J. M., Townsend, J., Lee, K. Y. & Bedbrook, J. R. A. (1985). Chimeric hygromycin resistance gene as a selectable marker in plant cells. Plant Mol Biol., 5, 299305. Walden, R. & Wingender, R. (1995). Gene-transfer and plant regeneration techniques. Trends Biotechnol, 13, 324-331. Walker, D. R., All, J. N., McPherson, R. M., Boerma, H. R. & Parrott, W. A. (2000). Field evaluation of soybean engineered with a synthetic cry1Ac transgene for resistance to corn earworm, soybean looper, velvetbean caterpillar (Lepidoptera : Noctuidae), and lesser cornstalk borer (Lepidoptera : Pyralidae). J Econ Entomol, 93, 613-622. Williams, E. S. & Maheswaran, B. (1986). Somatic embryogenesis: factors influencing coordinated behavior of cells as an embryogenic group. Ann Bot, 57, 443-462. Wraight, C. L., Zangerl, A. R., Carroll, M. J. & Berenbaum, M. R. (2000). Absence of toxicity of Bacillus thuringiensis pollen to black swallowtails under field conditions. Proc Natl Acad Sci USA, 97, 7700-7703. Wright, M. S., Launis, K. L., Novitzky, R., Duesiing, J. H. & Harms, C. T. (1991). A simple method for the recovery of multiple fertile plants from individual somatic embryos of soybean [Glycine max (L.) Merrill]. In Vitro Cell Dev Biol Plant, 27, 153-157. Xia, J. Y., Cui, J. J., Ma, L. H., Dong, S. X. & Cui, X. F. (1999). The role of transgenic Bt cotton in integrated insect pest management. Acta Gossypii Sim., 11, 57-64. Yan, B., Reddy, M. S. S., Collins, G. B. & Dinkins, R. D. (2000). Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merrill.] using immature zygotic zygotic cotyledon explants. Plant Cell Rep., 19, 1090-1097. Yin, Z., Plader, W. & e Malepszy, S. (2004). Transgene inheritance in plants. J Appl Genet, 45, 127-144. Yuan, L. & Knauf, V. C. (1997). Modification of plants components. Curr Opin Biotechnol, 8, 227-233.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 11

SOYBEAN OIL DEODORIZER DISTILLATE: AN INTEGRATED ISOLATION AND ANALYSES SYSTEM OF ITS BIOACTIVE COMPOUNDS Setiyo Gunawan1, Novy S. Kasim2 and Yi-Hsu Ju2

1

Department of Chemical Engineering, Institut Teknologi Sepuluh Nopember, Kampus ITS Keputih Sukolilo, Surabaya 60111, Indonesia 2 Department of Chemical Engineering, National Taiwan University of Science and Technology, 43, sec. 4, Keelung Road, Taipei 10607, Taiwan

ABSTRACT Soybean oil is the most consumed vegetable oil in the world, representing 30% of the consumption in the worldwide market. During the production of soybean oil, soybean deodorizer distillate (SODD) is produced as byproduct of a deodorization step. It represent about 3% of refined oil or 0.6% of soybean seed as feed in the refining process. Recent interest in the exploitation of SODD is due to its content of economicallyvaluable bioactive compounds. It has been suggested as an alternative to marine animals as natural source of squalene and as a good raw material for the production of fatty acid steryl esters (FASEs), free phytosterols, and tocopherols. The aim of this chapter is to discuss the isolation and separation techniques, and analysis methods of these bioactive compounds. SODD typically contains high level of free fatty acids (FFAs) and acylglycerols depending on the conditions of the oil refining process, and the efficient elimination of them is crucial for the enrichment of the bioactive compounds. There are several different methodologies for the elimination of FFAs and acylglycerols: hydrolysis, esterification, transesterification, distillation, crystallization, adsorption, and liquid-liquid extraction. The development of new isolation techniques has gained increasing importance in chemical, food, and pharmaceutical industries, due to the imposed environmental regulations and the necessity of minimizing energy requirement. The analysis methods of the bioactive compounds is also a challenging problem. Few analytical techniques are available to provide a detailed analysis. It will be of great importance if a method to identify individual compounds in SODD can be established.

310

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

1. SOYBEAN OIL DEODORIZER DISTILLATE During the processing of soybean oil, substances that usually give a bad taste and/or foul odor (aldehydes and ketones) are mostly removed via deodorization step (steam-stripping distillation), which is the last major step in the vegetable oil refining process. Also removed in this step are tocopherols, free phytosterols, free fatty acids (FFAs), triacylglycerols (TAGs), diacylglycerols (DAGs), monoacylglycerols (MAGs), fatty acid steryl esters (FASEs), hydrocarbons, and oxidized TAGs [1-6]. These hydrocarbons include squalene, aliphatic, steroidal, and sesquiterpene hydrocarbons. The distillate obtained is termed as soybean oil deodorizer distillate (SODD). It represents about 3% of refined soybean oil, 0.6% of soybean seed as feed in the refining process [7], or 0.15-0.45% of the oil to be deodorized [8]. Table 1 shows a typical composition of SODD obtained from two different refining processes of soybean oil. Samples 1-11 and 12-13 are typical SODD obtained from chemical and physical refining processes, respectively. SODD typically contains high level of FFAs and acylglycerols (TAGs, DAGs, and MAGs) depending on conditions of the oil refining process. FFAs contents in SODD obtained from chemical refining (20-50%) are lower than that of physical refining (>50%). Moreover, the contents of acylglycerols vary between 0 and 25% according to the refining process. Therefore, the efficient elimination of FFAs and acylglycerols is crucial for the isolation of the bioactive compounds. The technical literature contains information on the elimination of them, including hydrolysis, esterification, transesterification, molecular distillation, crystallization, adsorption, and liquid-liquid extraction, has been investigated. De Greyt et al. [9] declared that the distillates obtained from chemical refining have a higher level of unsaponifiables, such as tocopherols, phytosterols, and squalene, ranging between 25 and 33%. Moreover, a typical composition of bioactive compounds in SODD, such as tocopherols, free phytosterols, FASEs, and squalene, can be seen in Table 1. In addition, the price of SODD is based on its tocopherols and free phytosterols contents. This is because tocopherols and free phytosterols are major compounds, which is normally between 60% and 90% of the total of bioactive compounds in SODD.

2. BIOACTIVE COMPOUNDS Soybean oil deodorizer distillate (SODD) has been suggested as an alternative to marine animals as natural source of squalene [14] and as a good raw material for the production of fatty acid steryl esters (FASEs) [11,15], tocopherols [16-21], free phytosterols [10,22] and fatty acids [12,23]. Some countries permit the use of SODD as an animal feed extender [24], but others it is prohibited because of the concentration of pesticides in the SODD. Moreover, there are many other substances not yet identified and worth of investigating in addition for isolating and purifying bioactive compounds. In this section, the structure and application of bioactive compounds will be discussed.

Soybean Oil Deodorizer Distillate

311

2.1. Tocopherols Tocopherols are methylated phenols which reveal vitamin E activity. They are one of the best natural antioxidant compounds in term of its high radical scavenging activity. They are also useful in lowering deoxyribonucleic acid (DNA) damage, diminishing lipid peroxidation, inhibiting malignant transformation in vitro, and lowering risk of certain types of cancer and degenerative diseases, such as ischemic heart disease [25-30]. Table 1. Typical compositions of SODD obtained from refining processes of soybean oils No

Tocopherols

Chemical refining 1. 23.62 N.A a 2. N.A N.A 3. 33.00 9.07 4. 32.00 11.63 5. 30.10 17.1 6. 45.00 20.00 7. 2.70 N.A 8. 45.38 23.30 9. 46.46 17.80 10. 40.80 17.41 11. 41.63 10.37

Free phytosterols

12.74 10.20 16.48 18.01 10.40 15.00 49.70 6.40 7.73 4.81 14.89

11.39 11.20 17.06 18.81 10.30 20.00 18.80 5.36 6.20 6.09 11.25

N.A N.A 2.59 2.33 12.80 N.A N.A 3.91 1.80 3.37 4.12

Physical refining 12. 73.80 7.67 13. 57.80 N.A

7.51 8.97

6.32 N.A

4.45 N.A

a

b

FFAs

Acylglycerols

FASEs

Others b

Ref.

2.62 1.90 1.28 2.09 N.A N.A 3.10 1.83 1.80 1.79 2.05

N.A N.A 20.52 15.13 19.30 N.A N.A 15.23 18.18 25.25 15.69

[4] [10] [6] [6] [11] [12] [13] [14] [15] [15]

0.65 N.A

N.A N.A

[6] [16]

Squalene

[15]

Not available Hydrocarbons, aldehydes, ketones, pesticides, herbicides, breakdown product of tocopherols and phytosterols.

Tocopherols α-Tocopherol (5,7,8-Trimethyltocol) β-Tocopherol (5,8-Dimethyltocol) γ-Tocopherol (7,8-Dimethyltocol) δ-Tocopherol (8-Monomethyltocol) Figure 1. Structures and methyl positions of tocopherols

R1 CH3 CH3 H H

R2 CH3 H CH3 H

312

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju Table 2. Typical compositions of the tocopherols isomers found in SODD

a

No αβγSODD obtained from chemical refining 1. 0.68 0.18 7.16 2. 0.82 0.52 10.73 3. 0.81 0.36 11.26 4. 0.90 N.Da 5.81 SODD obtained from physical refining 5. 0.54 0 4.96 6. 2.91 0.14 4.66 Not detected

δ-

Ref.

4.73 4.41 5.59 2.41

[4] [6] [6] [32]

2.01 1.25

[6] [16]

Table 3. Boiling points of tocopherols as function of pressure Pressure, mmHg 1 2 3 4

Tocopherols boiling points, °C ~ 232 ~ 243 ~ 254 ~ 277

The structures of tocopherols isomers are shown in Figure 1 [31]. The number and position of the methyl substituents in the chromanol nucleus give rise to the α-, β-, γ-, and δhomologues. The synthetic form of tocopherols is labeled ‗d,l‘ while theirs natural form is labeled ‗d‘. Tocopherols found in SODD are d-α-, d-β-, d-γ-, and d-δ- tocopherols. It is widely known that d-γ-tocopherol is the major form present in SODD, however d-β-tocopherol amount is quite low as shown in Table 2. Boiling point is one of the important propreties during the isolation and purification of tocopherols. Their boiling points are shown in Table 3 [12].

2.2. Free Phytosterols Free phytosterols are a kind of sterol compounds derived from plants (phytosterols). Their -OH group does not bind to other compounds, known as free form. Free phytosterols nomenclature is confusing. This is because two main nomenclature currently utilized follow the international union of pure and applied chemistry and international union of biochemistry and molecular biology (IUPAC-IUB) recomendations of 1976 and 1989 [33,34]. In this capther, the IUPAC-IUB recomendation of 1976 is used (Figure 2). It shows that free phytosterols have OH group at carbon 3β and a double bond between carbons 5 and 6 inside the ring system, known as ‖ Δ5 sterols‖.

Soybean Oil Deodorizer Distillate

313

Figure 2. Structures of free phytosterols isomers found in SODD

Table 4. Typical compositions of the free phytosterols isomers found in SODD

a

No β-sitosterol campsterol stigmasterol SODD obtained from chemical refining 1. 0.00 2.13 3.88 2. N.Da 5.06 4.10 3. N.D 5.66 4.81 4. N.D 2.57 2.19 SODD obtained from physical refining 5. N.D 1.91 4.96

Not detected.

brassicasterol

Ref.

5.38 7.90 8.34 4.99

[4] [6] [6] [32]

2.01

[6]

Table 5. Boiling points of free phytosterols as function of pressure Pressure, mmHg 1 2 3 4

Free phytosterols boiling points, °C ~ 243 ~ 246 ~ 263 ~ 271

During the last 20 years, there has been unprecendented escalation of research interest in phytosterols. Free phytosterols are effective in lowering low density lipoprotein serum cholesterol (LDL-C), as long as they are formulated and delivered in a ―bioavailable‖

314

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

physical state. Stigmasterol is used in manufacturing progesterone and corticoids. Sitosterol is used to produce estrogens, contraceptives, diuretics, and male hormones [35]. The composition of free phytosterols in SODD is frequently a mixture of β-sitosterol, campsterol, stigmasterol, and minor constituent of brassicasterol as shown in Table 4. Free phytosterols boiling points are shown in Table 5 [12].

2.3. FASEs FASEs are one of the conjugated phytosterols, in which the 3β-OH group of free phytosterols (such as β-sitosterol, campsterol, and stigmasterol) is covalently bound with a fatty acid (such as stearic, oleic, linoleic and linolenic acid). FASEs have gained much attention in recent years as nutraceuticals for their blood cholesterol lowering efficacy [36,37]. Because they are more effective at lowering serum cholesterol levels than that of free phytosterols. Therefore due to theirs high solubility in oils (TAGs), they are comercially added into several functional food, such as salad oils, margarine, cooking oils and beverages [11,37]. Naturally occuring FASEs in SODD first characterized by Gunawan et al. [38]. There are 12 compounds of FASEs in SODD as shown in Table 6. Sitosteryl esters (including palmitate, stearate, oleate, linoleat, and linoleat sitosterols esters) are the most abundant among the FASEs in SODD. Their structures are shown in Figure 3. Palmitate and stearate, oleate, -linoleate sitosteryl esters represent 13% and 34% of the total FASEs, respectively. FASEs with palmitate are 29% of the total FASEs in SODD, respectively. Although there are still lots of controversy on the possible health effects of trans fatty acids (TFAs), most health organizations advice not to increase current allowed average intake of trans fatty acids [39-41]. Since naturally FASEs are derived from SODD, the possibility of carryover of TFAs should be considered. Table 7 shows the fatty acids profile of FASEs isolated from SODD. The fatty acids profile of FASEs is 31.74% palmitate acid (C16:0), 9.99% stearic acid (C18:0), 0.46% elaidic acid (C18:1 trans-9), 27.51% oleic acid (C18:1 cis9), 0.19% linoleaidic acid (C18:2 cis-9, trans-12), and 29.19% linoleic acid (C18:2 cis-9, cis12). Total trans isomers of fatty acids are 0.65% of the total fatty acids. Table 6. Composition of FASEs in SODDa

a

FASEs types Palmitate campesteryl ester Palmitate stigmasteryl ester Palmitate sitosteryl ester Stearate, oleate, linoleate campesteryl esters Stearate, oleate, linoeate stigmasteryl esters Stearate, oleate, linoleate sitosteryl esters Total

Average of three independent experiments.

Weight % 0.39 0.26 0.54 0.87 0.67 1.41 4.12

Soybean Oil Deodorizer Distillate

315

Figure 3. Structures of palmitate, stearate, oleate, and linoleic sitosteryl esters

Table 7. Composition of fatty acids in FASEs obtained from SODDa Fatty acid types Palmitate acid (C16:0) stearic acid (C18:0) elaidic acid (C18:1 trans-9) oleic acid (C18:1 cis-9) linoleaidic acid (C18:2 trans-9, trans-12) linoleaidic acid (C18:2 cis-9, trans-12) linoleic acid (C18:2 cis-9, cis-12) a

b

2.4. Squalene

Average of three independent experiments. Not detected

Weight % 31.74 9.99 0.46 27.51 NDb 0.19 29.19

Squalene is a linear hydrocarbon that consists of six-isoprene units and possesses sixdouble bond in the trans configuration. It has been used in applications, such as natural moisturizer in cosmetic and biochemical precusor in the synthesis of sterols [42]. The structure of squalene is shown in Figure 4.

316

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

Figure 4. Structure of squalene

Naturally squalene is commonly found in the liver of sharks and other fishes. Due to enviromental concerns including the protection of marine life, the extraction of squalene from SODD has become more promising.

3. ISOLATION AND PURIFICATION OF BIOACTIVE COMPOUNDS There is a growing trend of consumer preferences for natural products. Recent interest in the exploitation of SODD is due to its content of economically-valuable bioactive compounds. Moreover, the development of new isolation techniques of these bioactive compounds, has gained increasing importance in chemical, food, and pharmaceutical industries, due to the imposed environmental regulations and the necessity of minimizing energy requirement. Numerous methods have been purposed for treating SODD. Table 8 shows common methods introduced by researchers for isolating bioactive compounds in vegetable oil deodorizer distillate. SODD, SuODD, RODD, OODD and PFAD represent soybean, sunflower, rapeseed, olive oil deodorizer distillate and palm fatty acid distillate, respectively. In many of these methods, a first essential step involves the elimination of FFAs and acylglycerols. This is because SODD typically contains high level of FFAs and acylglycerols. Methods employing saponification and acid esterification step introduce processing complexity that involve the use of alkaline and strong mineral acids, respectively, which can cause degradation of the bioactive compounds. Moreover, the denaturation of bioactive compounds can be supressed by involving enzymatic reactions. However, the cost is expensive due to enzyme stabilty and reuseability. Methods employing extractive steps are risk contamination by residual solvent and expensive. Nowdays, molecular distillation is by far the preferred step to isolate both sensitive and high molecular weight compounds from SODD. However, it requires a relative high vacuum and multiple steps in order to isolate the bioactive compounds. Adsorption is an energy efficient process and competitive with distillation for bulk separation when relative volatility is less than about 1.25 [43]. Due to disposal as well as economic considerations, regeneration of adsorbents is more favorable. Table 8 shows also that only a few literatures studied an integrated isolation of the desired compounds while others investigated the isolation of one, two or three bioactive compounds. Tocopherols and free phytosterols are among the compounds of nutritional interest that are isolated and purified from SODD. Moreover, these methods are protected by patent and their technical details are scarce.

Soybean Oil Deodorizer Distillate

317

Table 8. Concise summary of isolation and purification of bioactive compounds Desired products Tocotrienols

Starting materials PFAD

Tocotrienols Tocopherols Tocopherols Tocopherols Tocopherols

PFAD SODD SODD SODD SODD

Tocopherols Tocopherols Tocopherols

Free phytosterols

SODD SODD Deodorizer Distillate Deodorizer Distillate SODD

FASEs

SODD

FASEs

SODD

Squalene Squalene

OODD SODD

Tocopherols, free phytosterols Tocopherols, free phytosterols Tocopherols free phytosterols Tocopherols, free phytosterols as FASEs Tocopherols, FASEs Tocopherols, free phytosterols, squalene

Tocopherols

Procedures

References [29]

Deodorizer distillate Deodorizer Distillate SuODD

FFAs stripping, Molecular distillation, saponification, and solvent wintering Neutralization, batch adsorption on silica Saponification, esterification Supercritical CO2 extraction Molecular distillation Saponification, acidulation, molecular distillation Molecular distillation, enzymatic reactions Low pressure column chromatography Path distillation, saponification, and solvent extraction Lipase-catalyzed esterification, path distillation acid catalyzed esterification, distillation, water washing, crystallization Molecular distillation, lipase-catalyzed hydrolysis Modified soxhlet extraction, Modified silica gel column chromatography, binary solvent extractions Supercritical CO2 extraction Modified soxhlet extraction, Modified silica gel column chromatography Esterification, molecular distillation, transesterification, and ion exchange Acid-catalyzed esterification, solvent extraction Enzymatic reactions, fractional distillation

SODD

Molecular distillation, enzymatic reactions

[18,22]

SODD Deodorizer Distillate

Enzymatic reactions Crystallization

[54] [55]

[44] [45] [13,20,21,46,47] [19] [16] [17] [48] [49] [4] [50] [11] [15] [51] [14] [10] [52] [53]

An integrated isolation and purification of all bioactive compounds include squalene, FASEs, tocopherols, and free phytosterols from SODD will describe in this chapter as shown in Figure 5. The process is first applied in laboratory scale by Yi-Hsu Ju and his research group. The first step is to separate SODD into two fractions based on differences in the polarity of the constituent compounds. A modified soxhlet extraction is applied on SODD to obtain one fraction enriched with squalene and FASEs in a fraction rich with hydrocarbon (non polar lipid fraction, NPLF), while tocopherols and free phytosterols in another fraction rich in FFAs and acylglycerols (polar lipid fraction, PLF). A modified silica gel column chromatography is used to isolate squalene and FASEs from NPLF in the second step. In the third step, FASEs contents in the fraction obtained from modified silica gel column chromatography were be further increased by binary solvent extraction. Another lipid

318

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

fraction, PLF is subjected to cold saponification for isolating tocopherols and free phytosterols. The final separation of tocopherols and free phytosterols is carried out by using crystallization.

3.1. Modified Soxhlet Extraction A classical soxhlet extractor is a piece of laboratory apparatus invented in 1879 by Franz von Soxhlet [56] (Figure 6). It was originally designed for the extraction of lipids from solid material. Typically, a classical soxhlet extractor is required where the desired compound has only a limited solubility in a solvent, such as hexane, and the impurity is insoluble in that solvent. Unlike classical soxhlet extractor, in modified soxhlet extractor, the extractor is equipped with a jacket to control the temperature of extraction chamber as shown in Figure 7. The temperature of extraction chamber can be controlled at low (such as -6 °C) and high temperature (such as 65 °C which is near boiling point of hexane as the solvent). The basic principle of separation in this new design can be understood in terms of coating and selective desorption process. There are two common adsorbent types in this process, silica gel and alumina. Silica gel is the best choice because it is allowing higher sample loading, is less likely to promote unwanted reactions of the sample during separation and is available in a wide range of useful forms [57]. The coating occurs when SODD accumulates on the surface of adsorbents such as silica gel (a polar adsorbent), forming a thin film. Furthermore, the selective desorption happens when some compounds in SODD that are coated on the surface of silica gel dissolve in hexane. Although modified soxhlet extractor requires relative large amount of organic solvents that are flammable and environmentally unfriendly, the solvent can be recovered easily. SODD

Modified soxhlet extraction

NPLF

PLF

Modified silica gel column chromatography

Hydrocarbons

Squalene

FASEs, Impurities

Washing fraction

Unsaponifiable matters

Binary solvent extraction

FASEs

Impurities

Cold saponification

Saponifiable matters

Crystallization

Tocopherols

Free phytosterols

Figure 5. An integrated isolation and purification of squalene, FASEs, tocopherols, and free phytosterols from SODD

Soybean Oil Deodorizer Distillate

Figure 6. A shematic drawing of the classical soxhlet extractor

Figure 7. A shematic drawing of the modified soxhlet extractor

319

320

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju Table 9. The effects of the SODD to silica gel mass ratio on the composition of NPLF at the extraction temperature of -6 oCa,b

SODD to Silica gel mass ratio

NPLF to Extraction SODD mass time (h) ratio

Compounds Squalene FASEs

FFAs

TAGs Tocopherols

SODD composition as starting material

1.83

3.91

45.38

18.45

1:3

28.84

11

6.29 (100)

12.34 (94.32)

33.99 (20.41)

2.33 2.50 (5.89) (9.83)

0.39 (2.09)

42.16 (75.91)

1:4

20.17

19

9.56 (100)

5.09 (21.50)

22.81 (10.60)

0.57 4.57 (0.49) (16.32)

0 (0)

57.40 (75.45)

1:5

18.44

23

9.66 (100)

2.01 (9.93)

19.79 (8.04)

0.16 2.80 (0.28) (7.19)

0.06 (0.20)

65.52 (65.88)

1:6

18.33

50

9.90 (100)

3.07 (15.04)

28.73 (11.51)

0.46 7.53 (0.47) (19.40)

0.38 (1.23)

49.92 (50.82)

a

6.40

Free Othersc Phytosterols 5.36 15.23

Each value represents the mean of three independent experiments. Values reported as content (wt. %), with recoveries (%) in parenthese. c Hydrocarbons, aldehydes, ketones, pesticides, herbicides, and the breakdown products of tocopherols and free phytosterols.

b

The effects of parameters on the separation, such as SODD to silica gel mass ratio, the extraction time, and the temperature of extraction were first investigated by Gunawan et al. [14]. They suggest that under the following operation conditions: SODD to silica gel mass ratio of 1:3, extraction temperature of -6 °C, and extraction time of 11 h, the modified soxhlet extraction could yield a 3.4 and 3.3 fold increase in squalene and FASEs contents in NPLF as shown in Table 9 and a 1.3 fold increase in tocopherols content and 1.4 fold increase in free phytosterols content in PLF. Modified soxhlet extraction is a time- and cost-effective method for isolating NPLF and PLF from SODD. However, it might be difficult to be scaled up to industrial grade instrument. Therefore, a stirred batch-wise silica gel adsorption-desorption vessel has been proposed. Fabian et al. [58] reported that the performance given by this batch vessel is comparable with that given by modified soxhlet extraction. Moreover, by optimizing operation conditiond, such as extraction temperature or silica gel to SODD mass ratio, it is possible to use the regenerated silica gel. Silica gel can be reused 4 times in total and it is performing as good as the fresh one.

3.2. Modified Silica Gel Column Chromatography In the second step, a modified version of the classical silica gel column chromatography equipped with a jacket, a three-way valve to control the flow rate of eluent and a condenser system has been developed and applied on NPLF. A schematic drawing of the modified column chromatography is shown in Figure 8. This new design can be functioned as either soxhlet extractor or column chromatography by setting the three-way valve. The siphon arm for operation in soxhlet extraction mode is closed by three-way valve as shown in Figure 8.

Soybean Oil Deodorizer Distillate

321

Another, ethyl alcohol is used as the refrigerant, which is circulated in the jacket to control the column (packing region) temperature. Although a heater is placed in the bottom part, a uniform temperature in the silica gel packing is achieved by mantaining the mobile phase volume at constant value. Gunawan et al. [59] reported that the modified column chromatography process is feasible from economic point of view as compare to classical silica gel column chromatography because it significantly reduces the amount of solvent and time required to achieve the same degree of separation. This new design is capable to isolate or recover squalene and FASEs from NPLF by 84.53-96.25% (98.11-99.49% purity) and 93.52-100% (75.51-84.47% purity, respectively.

3.3. Water-Acetone Extraction Furthermore, water-acetone extraction is applied on FASEs-rich fraction obtained by modified silica gel column chromatography. Acetone is used mainly as a solvent and intermediate in chemical production. There are also food uses as an extraction solvent for fats and oils, and as a precipitate agent in sugar and starch purification. The current interest in acetone comes from the fact that acetone was dropped from the list of toxic chemicals. No evidence is available that suggest acetone is carcinogenic in humans or animals [60].

Figure 8. A shematic drawing of the modified silica gel column chromatography

322

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

Acetone was utilized to measure phospholipids contents in vegetable oils by using nephelometric method [61] and to enrich phospholipids contents in commercial soybean lecithin [62]. In another study, acetone crystallization followed by filtration was used to determine wax esters contents in vegetable oils [63,64]. This method is more accurate when applied to oils rich in crystallizable wax esters, such as crude sunflower oil or rice bran oil [65]. It was reported that water to acetone volume ratio more than 30:70 did not result in a good separation [15]. Three FASEs fractions could be obtained in defferents purities, i.e. 96.55% (23.20% recovery), 86.82% (56.16% recovery), and 70.78% (15.32% recovery), by using mixed solvents with water to acetone volume ratios of 0:100, 10:90, and 20:80, respectively.

3.4. Cold Saponification PLF is a promising starting material for obtaining tocopherols and free phytosterols. However, it is rich in FFAs and acylglycerols. Separation methods such as molecular distillation and supercritical CO2 normally require multiple steps in order to eliminate FFAs. Martins et al. [16] used a five-stage molecular distillation in order to reduce FFAs content from 57.80% in SODD to 1% in the distillate. Methods such as solvent extraction, low temperature crystallization, enzymatic esterification to transform FFAs into fatty acid methyl esters (FAMEs), and cold saponification have been tested for their effectiveness in removing FFAs. It was found that except cold saponification, all methods tested failed to reduce FFAs contents to less than 2% (Novi et al (2010). In addition, it is easier and more economical for later purification step. The effects of parameters on the composition of unsaponifiable matters, such as temperature, ascorbic acid amount, alkali amount, and time, were first investigated by Kasim et al. [32]. The total contents of tocopherols and free phytosterols in the final product (unsaponifiable matters) is about 95% under optimum conditions (2 h, 10 mL KOH, 40 oC, 0.1 g ascorbic acid). This value drops to 75–80% if harsher conditions (e.g. 2 h, at 40 oC, 50 mL KOH, and no ascorbic acid added into the reaction) were used.

3.5. Crystallization A simple method, by combining modified soxhlet extraction, cold saponification, and crystallization methods for obtaining tocopherols and free phytosterols from SODD has been invented [32]. Crystallization is the oldest units operation in the chemical engineering sense. This method exploits the difference of melting points between tocopherols and free phytosterols, and the fact that free phytosterols are able to form crystall at their melting points, while tocopherols are not. The final product (a fine crystall of free phytosterols and a viscous yellow liquid of tocopherols) can be obtained under optimized operation conditions, which are acetone to methanol volume ratio of 20/80, initial temperature of 20 °C and drecreased to -20 °C at rate 10 °C/h, and solvent mixture to unsapofiable matters ratio of 50/1 (v/w).

Soybean Oil Deodorizer Distillate

323

Table 10. Summary of most analytical techniques used in identification and quantification of compounds in deodorizer distillate Targeted compounds Tocopherols, free phytosterols Tocopherols FFAs FFAs FFAs

Techniques

Analysis

References

GC

Packed glass column

[66]

GC Preparative TLC

Capillary GC on polar column mobile phase = hexane/diethyl ether/acetic acid (60:40:0.5 v/v/v) Mobile phase = n-hexane/ethyl acetate/acetic acid (85:15:1 v/v/v) AOCS Official Method Ca 5a-40. Sample was dissolved in ethyl alcohol at 60oC and FFAs contained in the sample were neutralized with sodium hydroxide solution. The sample mass and the volume of sodium hydroxide used were used to calculate the contents of FFAs. Capillary DB-5 fused silica column (30 m, 0.1 mm, I.d. 0.25 mm, J&W Scientific), Oven temperature program = 70 to 350oC. Carrier gas was nitrogen. FID detector = 350oC, Split mode Injection technique (1:100) at 300oC. Capillary column DB-1ht (5 m, 0.1 mm, I.d. 0.25 mm, J&W Scientific, Folsom, CA), Oven temperature program = 120 to 280oC at 15 oC/min and to 370 at 10oC/min (3 min hold). FID detector = 390oC, Injector = 370oC. Capillary column Chrompack WCOT TAP (25 m, 0.25 mm, I.d. 0.25 mm, Varian Inc., Palo Alto, CA), Oven temperature Program = 80 (1 min hold) to 150oC at 15 oC/min and to 350 at 20oC/min. Carrier gas was Helium at 90 psig. FID detector = 370oC, Splitless injection technique, Injector = 370oC. Eluant = hexane/diethyl ether (95:5)

[67] [4]

Capillary column CP-Sil 8 CB (15 m, 0.1 mm, i.d. 0.25 mm, Chrompack, Middelburg, The Netherlands). Oven temperature Program = 60 to 140oC at 30oC/min and to 340 at 15oC/min (15 min hold). Carrier gas was Helium at 41.3 kPa. FID detector = 360oC, On column injection technique. Capillary column DB-5 (10 m, 0.1 mm, i.d. 0.25 mm, J&W Scientific, Folsom, CA), Oven temperature Program = 190 to 290oC at 10oC/min and to 320 at 5 oC/min (3 min hold). FID detector = 320oC, Injector = 250oC.

[6]

TLC/FID Analyzer Titration as oleic acid

FFAs, acylglycerols, squalene, FASEs, free phytosterols and tocopherols

GC

FFAs, acylglycerols, squalene, FASEs, free phytosterols and tocopherols

GC

FFAs, acylglycerols, squalene, FASEs, free phytosterols and tocopherols

GC

Acylglycerols, squalene, FASEs, free phytosterols and tocopherols acylglycerols, squalene, FASEs, free phytosterols and tocopherols

Flash Column Chromatography

Acylglycerols, squalene, FASEs, free phytosterols and tocopherols

GC

GC

[17] [6,16,51]

[13]

[11,22]

[68]

[51]

[17,18]

324

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

4. ANALYSIS METHODS OF BIOACTIVE COMPOUNDS Due to economic considerations, the analysis of compounds present in deodorizer distillate is a challenging problem. Several analytical techniques are available to provide a detailed analysis of one or more compounds in deodorizer distillates. A summary of most analytical techniques used in identification and quantification of compounds in deodorizer distillate is given in Table 10.

4.1. Liquid Chromatography Liquid-solid chromatography is the oldest of the various liquid chromatography methods. Despite the fact that high-performance liquid chromatography (HPLC) operation leads to better separation and analysis, thin-layer chromatography (TLC) and classical column chromatography are still widely practiced because of their convenience. However, TLC and classical column chromatography are laborious, time consuming [42], and requiring the use of large amount of organic solvents [69].

Figure 9. TLC analysis of SODD, developed in (A) mixture of solvent (hexane/ethyl acetate/acetic acid = 90/10/1 v/v/v) and (B) 100 % n-hexane as the mobile phase. The spots marked with numbers were identified as: (1a) aliphatic hydrocarbons; (1b) steroidal hydrocarbons; (1c) sesquiterpenes hydrocarbons; (1d) squalene; (2) FASEs; (3) TAGs; (4) tocopherols; (5) DAGs; (6) FFAs; and (7) free phytosterols

Soybean Oil Deodorizer Distillate

325

Moreover, compared to classical column chromatography, a disadvantage of TLC is the limited possibility of understanding quantitative analysis since exhaustive recovery of the separate spot is not sufficiently precise [42]. However, the advantages of TLC are that the procedure is more rapid, and the possibility of using specific reagents to immediately reveal the nature of the separated compound. TLC has been used as a reliable tool to visualize the whole pattern of SODD by using different visualization agents, and solvent systems (Figure 9). However, iodine vapor and ultraviolet light 254/366 nm, visualization agents, are not suitable for FASEs identification because FASEs spot did not appear. This may be because FASEs in SODD contains few double bonds. Therefore, FASEs spot was detected by spraying with a fresh solution of ferric chloride as described elsewhere [70]. It can be seen that TLC showed the identification of hydrocarbons, FASEs, TAGs, tocopherols, DAGs, FFAs, and free phytosterols in SODD (Figure 9A). It also allows to identify the present of aliphatic hydrocarbons, steroidal hydrocarbons, sesquiterpene hydrocarbons, and squalene by changing the mobile phase system from mixture of solvent (hexane/ethyl acetate/acetic acid = 90/10/1 v/v/v) to 100 % n-hexane (Figure 9B).

4.1. Gas Chromatography Deodorizer distillates are commonly analyzed by capillary gas chromatography (GC) as well as by high-performance liquid chromatography (HPLC) method. A general advantage of HPLC compared to capillary GC is that derivatization and silylation (in order to increase the volatility of the compounds) is not necessary. However, the application of HPLC is limited by the lack of detection and separation of all compounds in SODD under similar conditions [71]. For example, if data on FFAs, tocopherols, free phytosterols, and acylglycerols are required, it is possible to determine them in the same analysis by GC under similar conditions [6,72]. Therefore, capillary GC is the most applied technique in the analysis of deodorizer distillate. A convenient way to describe and catalog analytical procedures that have been proposed for analyzing deodorizer distillate is to divide the procedure to two groups: indirect [66,73] and direct analysis [6,67,72]. In indirect analysis, enrichment or separation, such as saponification, column chromatography, and solid phase extraction (SPE), of the sample prior to analysis is important. In this procedure, saponification may cause degradation of tocopherols which have to be taken into account during quantification. None of the previous analysis methods has proved satisfactory. Upon the optimization of the methods, the separation of several critical pairs was observed, such as co-elution of linoleic and oleic acids [6,66,67,72,73], β- and - tocopherols, brassicasterol and tocopherols [6,72,73,74], individual FASEs [6,66,67,72,73,74], and acyglycerols [66,67,74]. A baseline separation of the different compounds present in the deodorizer distillate is influenced by sample derivatization, GC column type, and GC temperature profile. A large number of reagents are used to prepare derivatives for GC, but most of the derivatization reactions fit into one of three categories: acylation, alkylation, or silylation. Silylation derivatization has been widely used to detect and measure many compounds in the deodorizer distillate. The trimethylsilyl (TMS) group, Si(CH3)3, is the most popular and versatile silyl group for GC analysis. TMS derivatization enables better GC separations and application of special detection techniques. TMS silylating reagents and derivatives react with active

326

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

hydrogen atoms. The silylated derivative thus is more volatile, and more stable. Detection is enhanced. Silyl reagents are influenced by both the solvent system and the addition of a catalyst. A catalyst (e.g., trimethylchlorosilane or pyridine) increases the reactivity of the reagent. Silyl reagents generally are moisture sensitive, and should be stored in tightly sealed containers. Consequently, TMS derivatives should not be analyzed on polyethylene glycol phases or other stationary phases that have these functional groups.

Figure 10. GC chromatogram profile of SODD

Figure 11. Enlargement of the region of tocopherols and free phytosterols

Recently, a direct analysis method without sample derivatization and silylation, for the identification and quantification of different compounds present in SODD, such as FFAs, squalene, tocopherols, free phytosterols, FASEs, and acylglycerols, by optimization of temperature and linear velocity profile within reasoable analysis time has been purposed as shown in Figure 10 and 11. In addition, pretreatment step prior to analysis for eliminating TAGs (such as saponification, transesterification, solid phase extraction (SPE), and silica gel column chromatography) is not necessary due to new high-temperature capillary column GC.

Soybean Oil Deodorizer Distillate

327

CONCLUSIONS Most of the methods that have been developed for isolating bioactive compounds from SODD, show promising results. However, no economical study has been assessed and no comparison between the methods has been made. It will be of great importance if a GC method to identify each compound in SODD including their isomers, by optimizing temperature profile, and GC column type in reasonable analysis time can be established.

LIST OF ABBREVIATIONS AOCS CODD DAGs DDT DNA FAMEs FASEs FFAs GC HPLC HPSEC IUB IUPAC LDLs MAGs NPLF OODD PAHs PFAD PLF RODD SODD SPE SuODD TAGs TFAs TMCS TLC

American oil chemists‘ society Corn oil deodorizer distillate Diacylglycerols Dichloro-Diphenyl-Trichloroethane Deoxyribonucleic acid Fatty acid methyl esters Fatty acid steryl esters Free fatty acids Gas Chromatography high-performance liquid chromatography High-performance size-exclusion chromatography International union of biochemistry and molecular biology International union of pure and applied chemistry Low density lipoproteins Monoacylglycerols Non polar lipids fraction Olive oil deodorizer distillate Polycyclic aromatic hydrocarbons Palm fatty acid distillate Polar lipids fraction Rapeseed oil deodorizer distillate Soybean Oil Deodorizer Distillate Solid phase extraction Sunflower oil deodorizer distillate Triacylglycerols Trans fatty acids Trimethylchlorosilane Thin-layer chromatography

ACKNOWLEDGMENT This work was supported by a grant (NSC94-2214-E011-004) provided by National Science Council of Taiwan.

328

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17]

Newkirk, D. R. (1982). Studies on Vegetable Oil Deodorization Distillates with Respect to Lipid and Pesticide Content, The American University: Columbia, U.S. Helme, J. P. (1984). Soybean Oil Refining. [Accessed May 30, 2005]. Available from: www.asa-europe.org/pdf/oilref.pdf. Erickson, D. R. & Wiedermann, L. H. (1989). Soybean Oil Modern Processing and Utilization. [Accessed May 30, 2005]. Available from:, www.asa-europe.org/ pdf/sboprocess.pdf. Ramamurthi, S. & Mc Curdy, A. R. (1993). Enzymatic pretreatment of deodororizer distillate for concentration of sterols and tocopherols. J. Am Oil Chem. Soc., 70, 287295. Aparicio, R. & Ruiz, R. A. (2000). Authentication of vegetable oils by chromatographic techniques. J. Chromatogr. A, 881, 93-104. Verleyen, T., Verhe, R., Garcia, L., Dewettinck, K., Huyghebaert, A. & De Greyt, W. F. (2001). Gas chromatographic characterization of vegetable oil deodorization distillate. J. Chromatogr. A, 921, 277-285. Bohra, J. M. (2002). Green Productivity Implementation in The Edible Oil Industry in India, [Accessed May 30, 2005]. Available from: www.apo-tokyo.org/gp/manila_ conf02/resource_papers/narrative/bohra.pdf. Zhou, W. W., Qin, D. H. & Qian, J. Q. (2009). Optimisation of enzymatic pretreatment of soybean oil deodoriser distillate for concentration of tocopherols, Int. J. Food Sci. Tech., 44, 1429-1437. De Greyt, W. F. & Kellens, M. (2000). Refining Practice, in Edible Oil Refining, edited by W. Hamm, & R. J. Hamilton, Sheffield Academic Press: Sheffield, U. K., 79-128. Fizet, C. (1996). Process for tocopherols and sterols from natural sources. U.S. Patent 5, 487, 817. Hirota, Y., Nagao, T., Watanabe, Y., Suenaga, M., Nakai, S., Kitano, M., Sugihara, A. & Shimada, Y. (2003). Purification of steryl esters from soybean oil deodorizer distillate. J. Am. Oil Chem. Soc., 80, 341-346. Copeland, D. & Belcher, M. (2004). Methods for treating deodorizer distillate. U.S. Patent, 6, 750,359. Gast, K., Jungfer, M., Saure, C. & Brunner, G. (2005). Purification of tocochromanols from edible oil. J. Supercrit. Fluids, 34, 17-25. Gunawan, S., Kasim, N. S. & Ju, Y. H. (2008a). Separation and purification of squalene from soybean oil deodorizer distillate. Sep. Purif. Technol., 60, 128-135. Gunawan, S., Fabian, C. & Ju, Y. H. (2008b). Isolation and purification of fatty acid steryl esters from soybean oil deodorizer distillate. Ind. Eng. Chem. Res., 47, 70137018. Martins, P. F., Batistella, C. B., Maciel-Filho, R. & Wolf-Maciel, M. R. (2006). Comparison of two different startegies for tocopherols enrichment using a molecular distillation process. Ind. Eng. Chem. Res., 45, 753-758. Shimada, Y., Nakai, S., Suenaga, M., Sugihara, A., Kitano, M. & Tominaga, Y. (2000). Facile purification of tocopherols from soybean oil deodorizer distillate in high yield using lipase. J. Am. Oil Chem. Soc., 77, 1009-1013.

Soybean Oil Deodorizer Distillate

329

[18] Watanabe, Y., Hirota, Y., Nagao, T., Kitano, M. & Shimada, Y. (2004). Purification of tocopherols and phytosterols by two-step in situ enzymatic reaction. J. Am. Oil Chem. Soc., 81, 339-345. [19] Martins P. F., Ito, V. M., Batistella, C. B. & Maciel, M. R. W. (2005). Free fatty acid separation from vegetable oil deodorizer distillate using molecular distillation process. Sep. Purif. Technol., 48, 78-84. [20] Mendes, M. F., Pessoa, F. L. P. & Uller, A. M. C. (2002). An economic evaluation based on experimental study of the vitamin E concentration present in deodorizer distillate of soybean oil using supercritical CO2. J. Supercrit. Fluids, 23, 257-265. [21] Mendes, M. F., Pessoa, F. L. P., Coelho, G. V. & Uller, A. M. C. (2005). Recovery of the high aggregated compounds present in the deodorizer distillate of the vegetable oils using supercritical fluids. J. Supercrit. Fluids, 34, 157-162. [22] Nagao, T., Kobayashi, T., Hirota, Y., Kitano, M., Kishimoto, N., Fujita, T., Watanabe, Y. & Shimada, Y. (2005). Improvement of a process for purification of tocopherols and sterols from soybean oil deodorizer distillate. J. Mol. Catal. B-Enzym., 37, 56-62. [23] Winters, R. L. (1986). in Proceeding: World Conference on Emerging Technologies in the Fats and Oils Industry, American Oil Chemist Society: Champaign, IL, 186. [24] Borher, J. R. Z., Goncalves, L. A. G. & de Felicio, P. E. (2002). - and -Tocopherol levels in nelore steer blood plasma after a single oral treatment of soybean oil deodorizer distillate (SODD). Meat Sci., 61, 301-306. [25] Traber, M. G., edited by Shils, M. E., Olson J. A., Shike M. & Ross A. C. 10th edition (1999). Vitamin E in Modern Nutrition in Health and Disease, Williams and Wilkins, Baltimore, 347-362. [26] Farrel, P. & Roberts, R. edited by M. E., Shils, J. A., Olson, M. Shike, & A. C. Ross, 8th Ed. (1994). Vitamin E in Modern Nutrition in Health and Disease; Lea and Febiger, Philadelphia, PA, 326-341. [27] Sies, H. & Sathl, W. (1995). Vitamins E and C, β-Carotene and other carotenoids as antioxidants. Am. J. Clin. Nutr., 62, 1315S-1321S. [28] Mu, L. & Feng, S. S. (2003). A Novel controlled release formulation for the anticancer drug paclitaxel (Taxol): PLGA nanoparticles containing vitamin E TPGS. J. Controlled Release, 86, 33-48. [29] Jacobs, L. (2005). Process for the production of tocotrienols. U.S. Patent 6, 838,104. [30] Lee, S. H., Zhang, Z. & Feng, S. S. (2007). Nanoparticles of poly(lactide)-tocopheryl polyethylene glycol succinate (PLA-TPGS) copolymers for protein drug delivery. Biomaterials, 28, 2041-2050. [31] IUPAC-IUB (International Union of Pure and Applied Chemistry and International Union of Biochemistry and Molecular Biology, IUPAC-IUB Joint Commission on Biochemical Nomenclature), The Nomenclature of Tocopherols and Related Compounds (recommendations 1982). Arch. Biochem. Biophy. 218, 347-348 (1982), Eur. J. Biochem, 123, 473-475 (1982). Mol. Cell. Biochem, 49, 183-185 (1982). Pure Appl. Chem., 54, 1507-1510 (1982). [Accessed April 7, 2008] Available from: (http://www.chem.qmul.ac.uk/iupac/misc/noGreek/toc.html) [32] Kasim, N. S., Gunawan, S. & Ju, Y. H. (2010). A simple two-step method for isolating tocopherols and free phytosterols from soybean oil deodorizer distillate. J. Sep. Science., Accepted, in press.

330

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

[33] IUPAC-IUB (International Union of Pure and Applied Chemistry and International Union of Biochemistry and Molecular Biology, IUPAC-IUB Joint Commission on Biochemical Nomenclature), The Nomenclature of Lipids (recommendations 1976), Eur. J. Biochem, 79, 11-21 (1977); Hoppe-Seylers Z. Physiol. Chem., 358, 617-631 (1977). Lipid. 12, 455-468, (1977). Mol. Cell. Biochem, 17, 157-171, (1977). Chem. Phys. Lipids, 21, 159-173, (1978). J. Lipid Res., 19, 114-128, (1978). Biochem. J, 171, 21-35, (1978). [Accessed April 7, 2008] Available from: (http://www.chem. qmul.ac.uk/iupac/lipid/). [34] IUPAC-IUB (International Union of Pure and Applied Chemistry and International Union of Biochemistry and Molecular Biology, IUPAC-IUB Joint Commission on Biochemical Nomenclature), The Nomenclature of Steroids (recommendations 1989), Pure Appl. Chem., 61, 1783-1822, (1989). Eur. J. Biochem., 186, 429-458, (1989). [Accessed April 7, 2008] Available from: (http://www.chem.qmul.ac.uk/iupac/steroid/). [35] Moreau, R. A., Whitaker, B. D. & Hicks, K. B. (2002). Phytosterols, phytostanols, and their conjugates in foods: Structural diversity, quantitative analysis, and healthpromoting uses. Prog. Lipid Res., 41, 457-500. [36] Piironen, V., Lindsay, D., Miettinen, T. A., Toivo, J. & Lampi, A. M. (2000). Plant sterols: Biosynthesis, biological function and their importance to human nutrition. J. Sci. Food Agric., 80, 939-966. [37] Moreau, R. A., edited by P. C. Dutta, (2004). Plant Sterols in Functional Food, in Phytosterols as Functional Food Components and Nutraceuticals; Marcel Dekker Inc.: New York, 317-345. [38] Gunawan, S., Melwita, E. & Ju, Y. H. (2010). Analysis of trans-cis fatty acids in Fatty acid steryl esters isoltated from soybean oil deodorizer distillate. Food Chem., 121, 752-757. [39] Mensink, R. P. & Katan, M. B. (1990). Effect of dietary trans fatty acids on highdensity and low-density lipoprotein cholesterol levels in healthy subjects. N. Engl. J. Med., 323, 439-445. [40] Willet, W. C., Stampfer, J. M. & Manson, J. E. (1993). Intake of trans fatty acids and risk of coronary heart disease among woman. Lancet, 341, 581-586. [41] Judd, J. T., Clevidence, B. A. & Meusing, R. A. (1994). Dietary trans fatty acids: effect on plasma lipids and lipoprotein of healthy men and women. Am. J. Clin. Nutr., 59, 861-868. [42] Moreda, W., Perez-Camino, M. C. & Cert, A. (2001). Gas and liquid chromatography of hydrocarbons in edible vegetable oils. J. Chromatogr. A., 936, 159-171. [43] Ruthven, D. M. (1984). Principles of Adsorption and Adsorption Process, John Wiley and Sons Inc., New York. [44] Chu, B. S., Baharin, B. S., Che Man, Y. B. & Quek, S. Y. (2004). Separation of vitamin E from palm fatty acid distillate using silica: I Equilibrium of batch adsorption. J. Food Eng., 62, 97-103. [45] Nagesha, G., Manohar, B. & Sankar, K. U. (2003). Enrichment of tocopherols in modified soy deodorizer distillate using supercritical carbon dioxide extraction. Eur. Food Res. Technol., 217, 427-433. [46] Lee, H., Chung, B. H. & Park, Y. H. (1991). Concentration of tocopherols from soybean sludge by supercritical carbon dioxide. J. Am. Oil Chem. Soc., 68, 571-573.

Soybean Oil Deodorizer Distillate

331

[47] Chang, C., Chang, Y. F., Lee, H. Z., Lin, J. Q. & Yang, P. W. (2000). Supercritical carbon dioxide extraction of high-value substances from sunflower oil deodorizer distillate. Ind. Eng. Chem. Res., 39, 4521-4525. [48] Wen-Wu Zhou, De-Huai Qin & Jun-Qing Qian, Optimisation of enzymatic pretreatment of soybean oil deodoriser distillate for concentration of tocopherols, Int J Food Sci Tech., 2009, 44, 1429-1437 [49] Hickman, K. C. D. (1944). Purification of sludges, scums and the like to prepare relatively purified tocopherols. U.S. Patent, 2, 349,270. [50] Arumughan, C., Sobankumar, D. R., Sundaresan, A., Sadasivan, S., Yohesh, K. & Rajam, L. (2009). Process for the preparation of high purity phytosterols, (2005) U.S. Patent 7, 632, 530. [51] Bondioli, P., Carlo M., Armando L., Enzo F. & Muller, A. (1993). Squalene recovery from olive oil deodorizer distillate. J. Am. Oil Chem. Soc., 70, 763-766. [52] Brown, W. & Smith, F. E. (1964). Process for separating tocopherols and sterols from deodorizer sludge and the like. U.S. Patent, 3, 153,055. [53] Ghosh, S. & Bhattacharyya, D. K. (1996). Isolation of tocopherols and sterols concentrate from sunflower oil deodorizer distillate. J. Am. Oil Chem. Soc., 73, 12711274. [54] Torres, C. F., Vazquez, G. T. L., Señorans, F. J. & Reglero, G. (2008). Stepwise Esterification of Phytosterols with Conjugated Linoleic Acid Catalyzed by Candida rugosa Lipase in Solvent-free Medium. J. Biosci. Bioeng., 106, 559-562. [55] Lin, K. M. & Koseoglu, S. S. (2003). Separation of sterols from Deodorizer Distillate by Crystallization, J. Food Lipids, 10, 107-127 [56] Soxhlet, F. (1879). Die gewichtsanalytische Bestimmung des Milchfettes, Polytechnisches J. (Dingler's) 232, 461. [57] Snyder, L. R. & Kirkland, J. J. (1979). Introduction to Modern Liquid Chromatography, 2nd edition, John Wiley and Sons Inc., New York, U.S.A. 321. [58] Fabian, C., Gunawan, S., Kasim, N. S., Chiang, C. L., & Ju. Y. H. (2009). Separation of non polar lipid from soybean oil deodorizer distillate by stirred batch-wise silica gel adsorption-desorption. Sep. Sci. Technol., 44, 1-17. [59] Gunawan, S., Ismadji, S. & Ju, Y. H. (2008c). Design and operation of a modified silica gel column chromatography. J. Chin. Inst. Chem. Eng., 39, 625-633 [60] U.S. EPA (U.S. Environmental Protection Agency). (2003). Toxicological review of acetone in support of summary information on Integrated Risk Information System (IRIS). National Center for Environmental Assessment, Washington, D.C. EPA/635/R03/004. [Accessed January 31, 2008] Available from: http://www.epa.gov/ncea/iris. [61] AOCS Official Method Ca 19-86. D. Firestone,5th ed., (1997) Phospholipids in Vegetable Oils Nephelometric Method, Official Methods and Recommended Practices of the AOCS, American Oil Chemists’ Society, Champaign, IL, U.S.A. [62] Vandana, V., Karuna, M. S. L., Vijayalakshmi, P. & Prasad, R. B. N. (2001). A Simple Method to Enrich Phospholipid Content in Commercial Soybean Lecithin, J Am. Oil. Chem. Soc., 78, 555-556. [63] De, B. K. & Bhattacharyya, D. K. (1998). Physical Refining of Rice Bran Oil in Relation to Degumming and Dewaxing, J. Am. Oil Chem. Soc., 75, 1683-1686.

332

Setiyo Gunawan, Novy S. Kasim and Yi-Hsu Ju

[64] Rajam, L., Soban Kumar, D. R., Sundaresan, A. & Arumughan, C. (2005). A Novel Process for Physically Refining Rice Bran Oil Through Simultaneous Degumming and Dewaxing, J. Am. Oil Chem. Soc., 82, 213-220. [65] Vali, S. R., Ju, Y. H., Kaimal, T. N. B. & Chern, Y. T. (2005). A Process for the Preparation of Food Grade Rice Bran Wax and the Determination of Its Composition, J Am. Oil. Chem. Soc., 82, 57-64. [66] AOCS Official Method Ce 3-74, D. Firestone, 5th Ed. (1997). Tocopherols and Sterols in Soya Residue by GLC, Official Methods and Recommended Practices of the AOCS, American Oil Chemists‘ Society: Champaign, IL, U.S.A. [67] AOCS Official Method Ce 7-87, D. Firestone, 5th Ed. (1997). Tocopherols (total) in deodorizer distillate, Official Methods and Recommended Practices of the AOCS, American Oil Chemists‘ Society: Champaign, IL, U.S.A. [68] Moreira, E. A. & Baltanas, M. A. (2004). Recovery of phytosterols from sunflower oil deodorizer distillates. J. Am. Oil Chem. Soc., 81, 339-345. [69] Lacaze, J. P. C. L., Lesley, A., Stobo, Elizabeth, A. T. & Michael, A. Q. (2007). Solidphase Extraction and Liquid Chromatography-mass Spectrometry for The Determination of Free Fatty Acids in Shellfish, J. Chromatogr. A, 1145, 51-57. [70] Fried, B. (1996). Lipids in Handbook of thin-layer chromatography, edited by J. Sherma and B. Fried, Marcel Dekker Press, New York, 704-705. [71] Slover, H. T., Thompson, R. H. J. R. & Merola, G. V. (1983). Determination of tocopherols and sterols by capillary gas chromatography. J. Am. Oil Chem. Soc., 60, 1524-1528. [72] Dowd, M. K. (1998). Gas chromatographic characterization of soapstocks from vegetable oil refining. J. Chromatogr. A, 816, 185-193. [73] Ruiz-Méndev, M. V. & Dobarganes, M. C. (2007). Combination of chromatographic techniques for the analysis of complex deodorizer distillates from an edible oil refining process. Food Chem., 103, 1502-1507. [74] Dumont, M. J. & Narine, S. S. (2007). Characterization of flax and soybean soapstocks, and soybean deodorizer distillate by GC-FID. J. Am. Oil Chem. Soc., 84, 1101-1105. [75] cotyledon explants. Plant Cell Rep., 19, 1090-1097. [76] Yin, Z., Plader, W. & e Malepszy, S. (2004). Transgene inheritance in plants. J Appl Genet, 45, 127-144. [77] Yuan, L. & Knauf, V. C. (1997). Modification of plants components. Curr Opin Biotechnol, 8, 227-233.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 12

BIOFILM FORMED ON THE SOYBEAN CURD RESIDUE IS ASSOCIATED WITH EFFICIENT PRODUCTION OF A LIPOPEPTIDE BY BACILLUS SUBTILIS Makoto Shoda* and Shinji Mizumoto Chemical Resources Laboratory, Tokyo Institute of Technology, Yokohama, Japan

ABSTRACT We previously showed that the soybean curd residue has efficient nutrients for higher production of a lipopeptide antibiotic, iturin A in solid-state fermentation (SSF) of Bacillus subtilis, and this cultured solid can be applied to soil to control plant diseases. The high production of iturin A in SSF may be due to biofilm formation of B. subtilis on the surface of the soybean curd residue. In order to prove this speculation, B. subtilis was grown both in an artificial air membrane surface (AMS) reactor where a biofilm was formed on the membrane and by liquid submerged cultivation (SmF) in suspended culture by using the same nutrients. The iturin A production in AMS reactor was significantly higher than that in SmF and the iturin A productivity of each cell in AMS reactor was more enhanced than that in SmF. The cells from both cultures were analyzed by 2-dimensional electrophoreses and proteome analysis. As the cells were under local nutrient depletion in biofilm, some proteins associated with nutritional depletion and biofilm formation such as alkyl hydroperoxide reductases (AhpC and AhpF), 2-oxoglutarate dehydrogenase, and translocation-dependent spore component (TasA) proteins were specifically or strongly expressed in the cells in the ASM reactor. Moreover, the genes responsible for iturin A production (ituB and degQ) were highly transcribed by the cells in the AMS reactor. These results suggest that typical characteristics of biofilm formed on the soybean curd residue triggered the high iturin A production in biofilm by B. subtilis via elevated expression of specific genes.

*

Corresponding author: E-mail: [email protected], Chemical Resources Laboratory, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama, 226-8503, Japan.

334

Makoto Shoda and Shinji Mizumoto

INTRODUCTION B. subtilis has been exploited for production of various kinds of beneficial microbial metabolites including enzymes, fermented foods, and biosurfactants [41, 47, 60, 64], as well as several antibiotics with a variety of structures, especially peptides that are either ribosomally or non-ribosomally synthesized [27, 37, 51]. We previously isolated several strains of B. subtilis and the strains and their derivatives could suppress 26 types of plant pathogen in vitro [39] and a fungal disease in vivo [3] by producing the lipopeptide antibiotics iturin A, surfactin and plipastatin [3, 18, 56, 57]. The suppressive effect of one of the isolates, B. subtilis RB14, was mainly associated with the cyclolipopeptide antibiotic iturin A, which contains seven -amino acids and one -amino acid. The suppressive activity of iturin A against plant pathogens is significantly stronger than that of surfactin [3]. A soybean curd residue,okara is a byproduct of tofu manufacturing. Approximately 700,000 tons of okara were produced in Japan annually and most okara is incinerated as an industrial waste. We re-utilized okara as a solid substrate of solid-state fermentation (SSF). SSF of B. subtilis RB14-CS, a derivative of the original strain RB14 and a sole producer of iturin A, has been carried out using the soybean curd residue and the production of iturin A in SSF was 3-fold higher than that in submerged fermentation (SmF)[28]. The higher iturin A production by strain RB14-CS in SSF may be due to biofilm formation on the surface of the soybean curd residue, okara. In natural environments, most bacterial cells grow in the situation of adhering to surfaces or interfaces, in the form of multicellular aggregates embedded in matrices commonly referred to as biofilms [7]. Biofilms provide several benefits to their member cells, such as protection from environmental insults and assaults (13). Recently, Bacillus sp., including B. subtilis, has become a model organism for the study of biofilm formation by Gram-positive bacteria and these studies have shown that different genes are transcribed by biofilm-associated phases [6, 29, 38, 42, 43, 48, 61]. The production of poly-γ-DL-glutamic acid by B. subtilis that is an extracellular polymer and contributes to formation of three-dimensional architecture of biofilm matrix, is dependent on degQ [49]. This gene is a pleiotropic regulatory gene that controls the production of degradative enzymes, such as intracellular proteases and several secreted enzymes, including levansucrase, alkaline proteases and metalloproteases, α-amylase, β-glucanase, and xylanase [31]. We previously reported that introduction of degQ into B. subtilis RM/iS2, a derivative of standard strain 168 carrying a complete iturin A operon and the 4‘-phosphopantethienyl transferase sfp, increases iturin A production 6- to 8-fold, indicating that degQ is also responsible for the high level of iturin A production by B. subtilis [59]. In this study, in order to clarify the relationship between the higher iturin A production by strain RB14-CS in SSF using soybean curd residue and biofilm formation, we used an airmembrane surface (AMS) bioreactor, where the cells grow as a biofilm on the surface of a semi-permeable membrane and receive nutrients from the liquid medium below the membrane [65]. By comparing the cells from AMS reactor and submerged fermentation (SmF), the biochemical and genetic differences were investigated.

Biofilm Formed on the Soybean Curd Residue Is Associated…

335

MATERIALS AND METHODS Strains. B. subtilis RB14-CS was used as a sole producer of the antifungal iturin A [28]. The characteristics of strain RB14-CS were described in the previous paper [28]. Preparation of seed culture.The L medium used for the growth of strain RB14-CS contains 10 g of Polypepton (Nippon Pharmaceutical, Co., Tokyo, Japan), 5 g of yeast extract and 5 g of NaCl (per liter) (pH 7.0). The number 3S (no. 3S) medium, containing 30 g of Polypepton S (Nippon Pharmaceutical, Co., Tokyo, Japan), 10 g of glucose, 1 g of KH2PO4, 0.5 g of MgSO4･7H2O (per liter) (pH 6.8) was used for the growth of the bacterium and iturin A production both by SSF using the AMS and by SmF using a flask. Solid-state fermentation (SSF) and submerged fermentation (SmF) using soybean curd residue, okara as a substrate. For SSF, fifteen grams of okara were placed in a 100-ml Erlenmeyer flask and autoclaved twice at 120°C for 20 min with an interval of 8–12 h to kill spore-forming microorganisms inhabiting the material. For SmF, the okara suspension medium was prepared by homogenizing 8 g of okara in 20 ml distilled water at 11,000 rpm for 1 min using a homogenizer (type ACE, Nihonseiki, Tokyo, Japan) and the medium suspension was transferred to a 200-mL Erlenmeyer flask and autoclaved twice. Okara in SSF and okara suspension in SmF were mixed with 25 mg of glucose, 0.67 mg of KH2PO4, and 2.5 mg of MgSO4･7H2O per g okara. The total volume of SmF was adjusted to 40 ml by adding sterile distilled water. To prepare a seed for SSF and SmF, pre-culture grown in L medium was inoculated into 100 mL of number 3S (no. 3S) medium and incubated at 30°C for 24 h in a shaking flask at 120 strokes per minute (spm). 0.2 mL of the pre-culture was added per gram of okara for both SSF and SmF. After mixing the okara with a stainless steel spatula, SSF was carried out statically in a water incubator at 28°C. SmF was carried out with shaking at 120 spm and 28°C. Extraction and quantitation of iturin A from SSF and SmF. For the extraction of iturin A from SSF, 45 mL of methanol was added to the whole fermented solid product in the flask, and the mixture was shaken at 150 spm for 1 h. For the extraction of iturin A from SmF culture, 200 μL of culture broth were suspended in 800 μL of an extraction solution consisting of (1:1 (vol/vol)) acetonitrile-distilled water in a microtube, and shaken for 20 min. Then, these two extracts were centrifuged at 18,000 ×g for 10 min at 4°C, and filtered through a 0.2-m pore polytetrafluoroethylene (PTFE) membrane (JP020; Advantec Ltd., Tokyo, Japan). The filtrates were applied to reversed-phase high-performance liquid chromatography (HPLC) with a column (Chromolith performance RP-18e 100-4.6, Merck KGaA, Germany). The HPLC system (LC-800 system, JASCO Co., Ltd., Tokyo, Japan) was operated at a flow rate of 2.0 mL min-1 with (35:65 (vol/vol)) acetonitrile-10 mM ammonium acetate as the eluent [3]. The concentration of iturin A was determined using authentic iturin as a standard (Sigma, St. Louis, MO (USA)).

336

Makoto Shoda and Shinji Mizumoto

Figure 1. Experimental procedures for submerged fermentation (SmF) and biofilm fermentation (Biofilm) using the same liquid no. 3S medium and B subtilis RB14-CS

Biofilm fermentation in the AMS reactor and submerged fermentation using no. 3S medium. A pre-culture grown in L medium after 16 h cultivation at 120 spm at 30°C was used as a seed for biofilm fermentation in an AMS reactor and for SmF. Some modifications were made to the AMS reactor described by Yan et al. [65]. The procedures of two experimental reactors are shown in Figure 1. Cellulose ester membranes (diameter, 47 mm; pore size, 0.2 μm; Toyo Roshi Co., Tokyo, Japan) were autoclaved at 121°C for 20 min and dried in the oven dryer at 70°C for at least 2 days. Fresh no. 3S medium (8.8 mL) was added to a sterile Petri dish (diameter, 35 mm; height, 9 mm; Becton Dickinson), and the dish was covered with the membrane. In this system, the membrane was in contact with the medium on one side and with air on the other side and was held in place by surface tension. The liquid medium below the membrane was referred as spent medium. Eighty-eight μL of pre-culture (1 %) was inoculated and spread on the membrane surface. The Petri dish with the inoculated membrane was placed in a sterilized deep glass Petri dish (diameter, 100 mm; height, 20 mm) to maintain sterility and incubated at 28°C in an incubator. For SmF, 40 mL of no. 3S medium was inoculated with 400 μL of RB14-CS pre-culture in a 200 mL Erlenmeyer flask and shaken at 120 spm and 28°C. Scanning electron microscopy (SEM). After a 2-day incubation, okara culture from SSF and biofilm from the AMS reactor were collected, fixed with 2.5 % glutaraldehyde, and dehydrated in ethanol. The samples were then observed with a scanning electron microscope (S-5200; Hitachi, Tokyo, Japan).

Biofilm Formed on the Soybean Curd Residue Is Associated…

337

Determination of growth and iturin A production in the AMS reactor and SmF. For the extraction of iturin A from the AMS reactor, the whole membrane covered with biofilm and the spent medium were mixed with an extraction solution of (1:1 (vol/vol)) acetonitrile10 mM ammonium acetate and homogenized with a handy micro homogenizer (Physcotron NS-310E; Niti-on Co., Chiba, Japan). For SmF, the same volume of culture broth with that of the spend medium in AMS reactor was mixed with extraction solution. Sample preparation and HPLC analysis for measurement of the iturin A concentration were carried out as described above. The samples prepared for determination of the iturin A concentration were also used for measurement of the glucose concentration, which was measured by HPLC with an ODS column (Shodex NH2P-50 4E, Showa Denko, Tokyo, Japan). The system was operated at a flow rate of 1.0 mL/min with (3:1 (vol/vol)) acetonitrile/ultra pure water as an eluent and at a column temperature of 40°C. The elution was monitored with a differential refractive index detector (RID-300; Jasco, Tokyo, Japan). For the determination of the cell number, cell suspensions were prepared as described above except that extraction solution was not added. For the samples taken at or after 24 h, cell suspensions of biofilm were mildly sonicated by five 60-sec pulses using a sonicator at 10 W (Model 5201; Ohtake, Tokyo, Japan) to disrupt the extracellular matrix, which can cause the difficulties in correctly determining the viable cell and spore numbers in the biofilm. Then, the sonicated mixture was serially diluted and spread onto L-agar plates (L medium containing 20 g/L agar). After 18 h at 37°C, the number of colonies was determined and expressed as colony forming units (CFU). The suspension was also heated at 80C for 15 min and spread onto L agar plates, and the number of colonies including only spores was expressed as CFU. The cell number after five cycles of mild sonication at 60 sec was three times higher than no sonication was performed and it did not change after more than six cycles of sonication (data not shown). The intensity level of sonication was not lethal to the cells because the suspended cell number in samples from SmF was almost the same with and without mild-sonication (data not shown). Biofilm and spent media from the AMS reactor and 8.8 mL of culture broth from SmF were collected in centrifuge tubes. Samples were homogenized with a handy micro homogenizer (Physcotron NS-310E; Niti-on, Chiba, Japan) and centrifuged at 12,000 ×g for 20 min at 4°C. After the precipitate was washed with cold distilled water, precipitates were dried at 105°C for 24 h, and the weights of dried biomass were measured. Whole-cell protein extraction for proteome analysis. Both of biofilm on the membrane and spent media from the AMS reactor and approximately 10 mL of culture broth from SmF were collected in centrifuge tubes. Samples were homogenized with a handy micro homogenizer. The cell suspensions were centrifuged at 12,000 ×g at 4°C for 20 min, and the precipitates were transferred into microtubes and washed twice with buffer A consisting of 2 mM ethylene diamine tetra acetic acid (EDTA), 2 mM dithiothreitol (DTT), and 25 mM TrisHCl (pH 8.0). After resuspension in 400 μL of buffer A, the cells were disrupted by sonication with three 80-s pulses at 40 W with a sonicator (Model 5201; Ohtake, Tokyo, Japan). Then, 400 μL of solubilization solution consisting of 8 M urea, 2 M thiourea, 2% (vol/vol) Triton X-100, and 15 mM DTT was added to the sample, and the mixture was centrifuged at 18,000 ×g for 10 min at 4°C. The protein extracts were then concentrated as described by Wassel and Flugge [62].

338

Makoto Shoda and Shinji Mizumoto

Two-dimensional electrophoresis. The protein content of each extract was determined by the Bradford method [5] with a Protein Assay Kit II (Bio-Rad, Tokyo, Japan) using bovine serum albumin as a standard. Rehydration solution (8 M urea, 2 M thiourea, 2 % (vol/vol) Triton X-100, 12 μL/mL DeStreak reagent (GE Healthcare, Uppsala, Sweden), and 0.5 % (vol/vol) Pharmalyte 3-10 (GE Healthcare) ) was added to each extract to adjust the protein content to 1 μg/μL. For isoelectric focusing, pH 4-7 immobilized pH gradient (IPG) gel strips (11 cm; GE Healthcare) were rehydrated overnight in 200 μL of protein solution in an Immobiline DryStrip Reswelling Tray (GE Healthcare). Gels were focused by a three-phase program using a Multiphor II; 300 V for 4 h, followed by a linear gradient from 300 V to 3,500 V for 5 h, and finally 3,500 V for 7 h. After placing the IPG gels in equilibration buffer A (50 mM Tris-HCl, pH 6.8, containing 6 M urea, 1.5 M thiourea, 30% (vol/vol) glycerol, and 1 % (vol/vol) sodium dodecyl sulfate (SDS), and 0.25% (vol/vol) DTT) for 10 min followed by buffer B (50 mM Tris/HCl, pH 6.8, containing 6 M urea, 1.5 M thiourea, 30 % (vol/vol) glycerol, 1 % SDS, 4.5% (vol/vol) iodoacetamide, and a trace of bromophenol blue) for 10 min, the isoelectric focusing gels were embedded in a 8% to 18% (wt/vol) gradient polyacrylamide separating gel. Electrophoresis was performed at 20 mA for 35 min and then 50 mA for 75 min at a constant temperature of 15°C. After electrophoresis, proteins were visualized by staining in 0.5% (vol/vol) Coomassie brilliant blue R250 solution for 1 h and destained in 50% (vol/vol) methanol, with 10% (vol/vol) acetic acid. M. W. Marker ―Daiichi‖･II (Daiichi Pure Chemicals, Tokyo, Japan) was used as a molecular mass marker. Analysis of proteome patterns. Whole-cell protein extracts prepared from SmF and biofilm fermentation in AMS reactor were analyzed on at least two separate occasions by electrophoresis. Gel images were resized, matched, and compared by using PDQuest 2-D Gel analysis software (Version 6.1; Bio-Rad, Tokyo, Japan). N-terminal amino acid sequencing and protein identifications. Two-dimensional electrophoresis was performed as described above and then the proreins were electrophoretically transferred to a commercial membrane (Immobilon-P; Millipore, Tokyo, Japan) using a horizontal blotting apparatus (ATTO Co., Tokyo, Japan). The regions of the membrane containing protein spots of interest were cut out and amino acid sequencing analysis was performed using an amino acid sequencing apparatus (PPSQ-21; Shimadzu, Kyoto, Japan) according to the standard method [14]. Searches for homologous amino acid sequences were performed in the B. subtilis database BSORF (http://bacillus.genome.jp/) and the nonredundant database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) using BLASTP. RNA isolation and real time RT-PCR. Cell suspension (300-500 μL) prepared as described above and 600-1000 μL of RNA protect bacteria reagent (Qiagen, Tokyo, Japan) were mixed in a microtube and the following RNA stabilization was performed according to manufacturer‘s standard protocols. For RNA extraction, an RNeasy mini kit (Qiagen) and an RNase-free DNase set (Qiagen) were used. Cell pellets obtained by centrifugation from the AMS reactor and from SmF were resuspended in 200 μL of 15 mg/mL lysozyme in TE buffer (pH 8.0) and incubated for 10 min. The suspension was mixed with 10 μL of 10 % (vol/vol) SDS, incubated for 5 min, and

Biofilm Formed on the Soybean Curd Residue Is Associated…

339

mixed with 0.7 mL of RLT buffer provided in the RNeasy mini kit. The lysate was centrifuged at 18,000 ×g for 2 min, and the supernatant was treated following the protocol provided with the RNeasy mini kit. The isolated RNA was further treated with RNase-free DNase I (Takara, Tokyo, Japan) to remove contaminating DNA. After removal of DNase I by phenol/chloroform extraction, the integrity of the RNA samples was monitored by gel electrophoresis and the measurement of absorbance at 260 nm(A260) and 280 nm (A280). The RNA (1 μg) was used for cDNA synthesis. Complementary DNA was synthesized using Superscript III (Invitrogen, Tokyo, Japan) and random octomer primers, according to the manufacturer‘s instructions, in a final volume of 20 μL. Real-time RT-PCR was performed using SYBR Green master mix (Toyobo, Tokyo, Japan) and an ABI PRISM 5700 sequence detection system according to the manufacturer‘s instructions (Applied Biosystems, CA, USA). The following primers (all 5‘ to 3‘) were used: for ituB (ituB-F, GGACAGAGCAGAGTATAAAGC; ituB-R, GCGATTTCTTCATTCTGTGCC), for degQ (degQ-F, CAGATCAAATACCTAGGACTCG; degQ-R, CATTGCATAATTGTATTT ATCGAGTTG), and for 16S ribosomal RNA (16SrRNA-F, CGTAGAGATGT GGAGGAACACC; 16SrRNA-R, CCCAACATCTCACGACACGAGC). PCR conditions were as follows: 94°C for 2 min and 40 cycles of 94°C for 30 sec, 59°C for 1 min and 72°C for 30 sec in 20 μL volumes. Since all of the amplified fragments used to generate data points had melting curves identical to those of the positive controls and formed single bands of the expected sizes on an agarose gel, we confirmed that the measured increase in fluorescence was due to amplification of only the specific targeted gene fragments. Relative RNA equivalents for each sample were obtained by standardization of 16S ribosomal RNA levels. Values reported are the average under the basal conditions (i.e., samples from biofilm fermentation after 24 h).

RESULTS Comparison of iturin A production between SSF and SmF using soybean curd residue, okara as a substrate. Figure 2 shows the iturin A production in SSF and in SmF using the same amounts of okara and nutrients. In SSF, okara was used as a solid substrate and in SmF, okara was used as a suspension. The concentrations of iturin A in the two systems are expressed as mg/g initial wet okara. The maximum concentration of iturin A in SSF per weight of initial wet okara was 30 % higher than that in SmF. Growth and iturin A production by biofilm fermentation in an AMS reactor and in SmF using no. 3S liquid medium. Biofilm fermentation was carried out in the AMS reactor using no. 3S medium as a model of SSF (see Figure 1). RB14-CS formed a biofilm with a complex architecture on the membrane at 28C. It was confirmed that no cells existed in the spent medium, which is the liquid phase below the semi-permeable membrane, because no colonies were detected when the spent medium was incubated on the L agar plate. In parallel, SmF was carried out using no. 3S medium in a 200-ml Erlenmeyer flask at a shaking speed of 120 spm and at 28C. Iturin A production and growth in the two systems for 96 h are shown in Figures 3A and 3B, respectively. Figures 3C and 3D show the results after 48 h cultivation.

340

Makoto Shoda and Shinji Mizumoto

Figure 2. Changes in iturin A concentration when B. subtilis RB14-CS is grown by solid-state fermentation (SSF) (solid circles) and by submerged fermentation (SmF) (open circles) using soybean curd residue okara as substrate

Figure 3. Changes in growth of RB14-CS, and the concentrations of iturin A and glucose in biofilm fermentation in an AMS reactor and in SmF using no. 3S medium. (A) Concentration of iturin A at 96 h; (B) Concentration of dry biomass weight at 96 h; (C) Concentration of iturin A (circles) and glucose (triangles) at 48 h; (D) Viable cell number (squares) and spore number (diamonds) for 48 h. Solid symbols, biofilm fermentation; open symbols, SmF

Biofilm Formed on the Soybean Curd Residue Is Associated…

341

Iturin A production started in both systems after 12 h of incubation. Iturin A production by biofilm fermentation was higher than by SmF during all operation time (Figures 3A, and 3C). The concentration of iturin A produced by biofilm fermentation increased continuously up to 48 h. The spore number also increased in a similar manner. However, the iturin A production in SmF leveled off after 28 h of cultivation, when the quick sporulation caused the majority of viable cells to become spores. After 48 h, the iturin A concentrations in the two systems did not change. The change in numbers of viable cells including vegetative cells and spores were similarly increased and maintained at approximately 2-3 ×109 CFU/mL (Figure 3D) in both systems. However, in biofilm fermentation, sporulation was initiated earlier than in SmF where enough glucose was remained, and the number of spores increased continuously until 48 h of incubation. In SmF, spore number increased rapidly after 24 h and all cells became spores after 36 h. (Figure 3D). The biomass including the dry weights of cells and insoluble substances of okara reflected the growth of cells indirectly but the growth and maximum value of the biomass were almost the same in both systems (Figure 3B). The biomass decreased after 3 days probably due to degradation of the extracellular matrix or cell lysis which may occur when the nutritions in the biofilm were exhausted [1, 61] or solubilization of solid part of okara. In SmF, glucose was consumed rapidly and exhausted after 16 h. In contrast, the concentration of glucose in biofilm fermentation decreased at a much slower rate and was almost exhausted after 48 h (Figure 3C). This suggests that the glucose supply to the cells in biofilm fermentation is limited by natural diffusion, in contrast to the free supply by forced mixing in SmF. The supply of other nutrients may be controlled in similar ways. Iturin A production was evaluated by three parameters as shown in Table 1. According to all three parameters, iturin production by biofilm fermentation was significantly higher than by SmF. Iturin A production per maximum viable cell number by biofilm fermentation was two-fold higher than by SmF and iturin A production per maximum biomass was 80 % higher by biofilm fermentation than by SmF. Proteome analysis and identification of differentially expressed proteins. To characterize the differences in protein expression between the biofilm fermentation and SmF systems, two-dimensional electrophoresis of whole-cell protein extracts was performed after 12 h and 24 h as shown in Figure 4. The patterns in both systems were almost similar for cells after 24 and 36 h (data not shown). More than 300 distinct protein spots were observed with highly reproducible locations. By matching and comparing the patterns, 7 protein spots, whose expression was reproducibly specific to or enhanced in biofilm fermentation, were detected. Then, N-terminal amino acid sequencing for these proteins was conducted and the results are summarized in Table 2. Table 1. Comparison of iturin A production between biofilm fermentation and SmF

Per volume Per maximum viable cell number Per maximum biomass weight

SmF 349 (mg/L) 8.2 (μg/(108×CFU)) 62 (μg/mg)

Biofilm 614 (mg/L) 16.6 (μg/(108×CFU)) 113 (μg/mg)

Biofilm/SmF 1.76 (-) 2.02 (-) 1.82 (-)

Table 2. The proteins specific or enhanced in biofilm fermentation identified from two-dimensional electrophoresis gels of whole-cell protein extracts of B. subtilis RB14-CS Spot

This work Expression characteristics in biofilm fermentation

Database Sequence

Sequence

Gene

1

Specific at 12 and enhanced at 24 and 36 h

MLIGKEVLPF

LIGKEVLPF

ahpC

2

Specific at 12 and enhanced at 24 and 36 h

MLIGKEVLPF

LIGKEVLPF

ahpC

3

Specific at 12 and enhanced at 24 and 36 h

MVLDANIKAQ

MVLDANIKAQ

ahpF

4

Enhanced at 12 h

VLGPVVDVR

VLGPVVDVR

atpD

5

Enhanced at 12 h

VLHKKSGKG

VLHKKSGKG

tufA

6

Enhanced at 12 h

AFNDVKSTDA

AFNDIKSKDA

tasA

7

Specific at 12 and enhanced at 24 and 36 h

KRLVEVQQT

KRLVEVQQT

odhB

Protein identity Alkyl hydroperoxide reductase small subunit Alkyl hydroperoxide reductase small subunit Alkyl hydroperoxide reductase large subunit

Size (kDa)

Identity (%) pI

20

4.28

90 [9/10]

20

4.28

90 [9/10]

55

4.70

100 [10/10]

ATPase beta chain

51

4.61

Elongation factor Tu

43

4.72

28

5.44

80 [8/10]

46

4.86

100 [9/9]

Translocationdependent spore component 2-Oxoglutarate dehydrogenase

100 [9/9] 100 [9/9]

Biofilm Formed on the Soybean Curd Residue Is Associated…

343

Figure 4. Two-dimensional electrophoresis profiles of whole-cell protein extracts obtained from B. subtilis RB14-CS. Profiles of cells at 12 h (A, B) and 24 h (C, D) from SmF (A, C) and biofilm fermentation in the AMS reactor (B, D). Unique protein spots are indicated by arrows. The pI values are plotted on the horizontal axes, and the molecular masses (MW) are plotted on the vertical axes

In biofilm fermentation, protein spots 1-3 were detected after12 h of incubation and the levels were higher in biofilm fermentation than in SmF at 24 h (Figures 4B and 4C). Spots 1 and 2 had the same molecular masses, but their pI values were different. As the amino acid sequences derived from the two protein gel spots were identical to those of a single protein, alkyl hydroperoxide reductase small subunit (AhpC), these spots may represent different posttranscriptionally modified versions of the same protein. The amino acid sequence derived from protein spot 3 was determined to be that of alkyl hydroperoxide reductase large subunit (AhpF). The levels of protein spots 4-6 were higher in biofilm fermentation than in SmF at 12 h, but almost the same at 24 h. The amino acid sequence derived from protein spot 4 corresponded to ATP synthase beta chain (AtpD), which is a key enzyme in bacterial energy metabolism and produces ATP from ADP [45]. The amino acid sequence derived from protein spot 5 corresponded to the sequence of the elongation factor Tu (TufA), which is a member of the GTPase family that has a function as molecular switches in various pathways. In prokaryotic cells, elongation factor Tu plays a central role in the elongation cycle of protein synthesis by forming a high-affinity complex with aminoacyl-tRNA and mediates its binding to the A site of the ribosome [24]. Expression of AtpD (spot 4) and TufA (spot 5) that play pivotal roles in energy metabolism and protein synthesis, respectively, is reduced by stringent response when amino acids and glucose were starved [4, 16, 20]. The low expression of these two proteins at 12 h in SmF suggests that the cells in SmF suffered from a shortage of amino acids or glucose. The N-terminal sequence of protein spot 6 was 80 % identical to that of a translocationdependent spore component (TasA). The 80 % homology seemed to be insufficient to identify this protein as TasA, but the sequence obtained in this work (AFNDVKSTDA) was located in the same locus of the N-terminus of mature TasA after processing with signal peptidase (AFNDIKSKD) [52]. Moreover, the molecular mass and pI in the database were consistent with those estimated from the gels. Considering these results and homology, it is concluded that protein spot 6 is TasA. The level of protein spot 7 was specifically found at 12 h in

344

Makoto Shoda and Shinji Mizumoto

biofilm fermentation and higher in biofilm fermentation than in SmF at 24 h. The amino acid sequence derived from protein spot 7 corresponded to 2-oxoglutarate dehydrogenase (OdhB). Although the sequence (KRLVEVQQT) was 100 % identical with that in the database, it is located far from the N-terminus of the full-length OdhB sequence (residues 201- 417), and the molecular mass and pI in the database were different from those estimated from the gel. Therefore, it is not clear whether this protein is OdhB or not. Real-time RT-PCR. The expression of ituB and degQ by real-time RT-PCR is shown in Figure 5. The transcription of ituB, a member of the itu operon, which encodes the enzyme complex catalyzing the synthesis of antibiotic iturin A [58], was higher in biofilm fermentation than in SmF from 12 to 48 h. Transcription of degQ was also higher in biofilm fermentation from 24 to 48 h of incubation. Furthermore, these two genes were scarcely transcribed after 30 h in SmF, indicating that the higher production of iturin A in biofilm fermentation is due to difference at the level of transcription. Scanning electron microscopy Scanning electron micrographs of the cells from solidstate fermentation(SmF) on okara and a biofilm from the AMS reactor are shown in Figure 6, indicating a similar biofilm formation in the two systems.

DISCUSSION B. subtilis RB14-CS produced higher amount of antibiotic iturin A in SSF using a solid material of soybean curd residue, okara than in SmF using suspended okara as nutrients. A previous study [28] also showed higher iturin A production by SSF on okara than by SmF in no. 3S medium, which is an efficient liquid medium for iturin A production. Thus, it appears that the higher production by SSF is independent of the medium compositions as long as the carbon or nitrogen contents are similar between the two systems. We used the AMS reactor in this study that had the following features; (i) growth of the bacterium as a biofilm on the surface of the membrane is similar to SSF in that cells grow on the surface of a solid substrate, (ii) the same medium as used for SmF is available, and (iii) cells are easily recovered from the membrane without contaminating the solid substrate. Thus, the biofilm formed in the AMS reactor can be used as a model biofilm system for SSF to elucidate higher production of iturin A in SSF. At nearly the same viable cell numbers in the AMS and SmF cultures, iturin A productions per volume of medium and per weight of biomass were higher in biofilm fermentation than in SmF (Table 1). Therefore, this higher level of iturin A production by the biofilm was not due to an increase in cell number, but rather an increase in the production per cell. This means that the cells in the form of biofilm have a higher activity for production of iturin A than suspended cells, when the same nutrients are provided. Because glucose of carbon and energy sources of B. subtilis [54] was exhausted earlier by SmF than by biofilm fermentation (Figure 3C), it appears that glucose depletion results in lower production of iturin A by SmF. On the other hand, the glucose consumption rate was apparently lower in biofilm fermentation than in SmF, and residual glucose remained in the spent medium (Figures 3C). However, sporulation, which is mainly triggered by depletion of

Biofilm Formed on the Soybean Curd Residue Is Associated…

345

nutrients [15], occurred earlier in biofilm fermentation than in SmF during 12–24 h (Figure 3D). During this period, iturin A production also occurred more rapidly in biofilm fermentation than in SmF (Figure 3A). This suggests that some cells in the biofilm suffer from a local shortage of nutrients because of slow mass transfer through the membrane and the accumulated cells and partial depletion of nutrients which occurred in biofilm were associated with the higher iturin A production in biofilm fermentation. Proteome analysis represented some specific characteristics of the cells in biofilms. Comparison of proteomes from the cells grown for 12 h revealed that proteins related to the stringent response (TufA and AtpD) were repressed in SmF (Figure 4, Table 2). This indicates that the cells in SmF were starved for amino acids or carbon sources. This was not observed in cells in the biofilm. However, in biofilm fermentation, proteins (AhpCF and OdhB) that are induced by starvation and stresses were expressed at a higher level, indicating that the cells also suffered from a shortage of nutrients, presumably due to the heterogeneity of the cells in biofilm structure. AhpC and AhpF are the two subunits of the same alkyl hydroperoxide reductase, and are encoded by the ahpC and ahpF genes, which are adjacent to each other and are most likely cotranscribed [2, 9]. Alkyl hydroperoxide reductase is the best characterized bacterial enzyme involved in the metabolism of organic peroxide, and it detoxifies alkyl hydroperoxides, which are oxidizing agents generated in vivo under aerobic conditions that damage DNA [19]. Transcription of ahp is induced by salt stress and heat stress, nutrient starvation, and H2O2 [9]. The 2-oxoglutarate dehydrogenase multienzyme complex, of which OdhB is a component, catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl coenzyme A, which is a reaction in the citric acid cycle [10]. Transcription of the odhAB operon is strongly repressed by the presence of glucose in the medium [44]. In SSF and AmF, nutrient depletion occurred, but the genes or proteins induced by nutrient depletion were not the same. This reflects the biochemical differences in the two systems. Among differentially expressed proteins, the most intriguing is TasA, which is a major matrix in a major component of the B. subtilis biofilm matrix along with exopolysaccharides encoded by the eps operon and that expression of TasA is essential for formation of normal biofilm architecture [8]. The early accumulation of TasA in biofilm in the AMS reactor suggests that the cells adapt to growth on a solid surface by producing extracellular matrix components. The master regulator SinR represses the expression of the eps and yqxM-sipW-tasA operons, thereby controlling the synthesis of the major components of the biofilm matrix [8, 11, 23]. The gene sinI, a direct antagonist of sinR, is positively regulated by the sporulation regulatory proteins Spo0A and σH [17, 46], and SinR-mediated repression of genes involved in biofilm formation is modulated by Spo0A [23]. Additionally, transcription of tasA is positively regulated by spo0A [53]. These findings indicate that production of TasA is related to sporulation. Thus, the early sporulation in biofilm fermentation observed here (Figure 4D) agrees with the high expression of TasA at 12 h as a typical characteristic of biofilms. Expression of itu operon was higher and longer in biofilm fermentation than in SmF. This was also true for degQ, a gene that is essential for higher production of iturin A in SmF [59] (Figure 5). The degQ gene is also responsible for the production of a matrix component of B. subtilis biofilm, poly-γ-DL-glutamic acid [49], and it is positively regulated by two twocomponent regulatory systems, namely the ComP-ComA and the DegS-DegU systems [31]. The ComQXPA signaling pathway, which includes the ComP-ComA system, is a major

346

Makoto Shoda and Shinji Mizumoto

quorum response pathway in B. subtilis, that regulates gene expression in response to fluctuations in cell density [12]. ComQXPA regulates the transcription of genes including srfA [33, 34], rapACEF [21, 22, 26, 32], and degQ [31]. From the apparent volume of biofilm formed on the surface of the membrane, we estimated that the cell density in the biofilm is at least 8-fold higher than that in SmF (data not shown). Therefore, it is certain that regulation by ComQXPA occurred preferentially in biofilm fermentation. DegS-DegU is a two-component system that regulates many cellular processes including extracellular protease production, competence development and motility [36]. Phosphorylated DegU (DegU-P) stimulates transcription of aprE and nprE, which encode the major extracellular proteases, and inhibit expression or the activity of an alternative sigma factor SigD [35, 55]. Regulation of gene expression via DegS-DegU is affected by salt stress [25, 50]. Biofilm may form a gradient of organic and inorganic ions existing at the solid surface, and the various exopolymers excreted by bacteria could concentrate ionic molecules from the bulk phase as the biofilm develops [40]. These effects cause cells in biofilms to encounter higher salt stress (osmolarity) than cells in the liquid phase. During biofilm formation by Escherichia coli, the intracellular concentration of potassium ions is 1.6-fold higher in cells in the biofilm than in cells in liquid phase [40]. Therefore, it is possible that degQ was enhanced by salt stress via DegS-DegU in biofilm fermentation and that expression of AhpCF, which is known to be induced by salt stress was increased [2]. The expression of degQ was induced by limitation of carbon, nitrogen, and phosphate [31] and was strongly repressed by glucose [30, 66]. As mentioned above, in biofilm fermentation, cells are likely to encounter a long-term local depletion of nutrients including glucose due to limitation of diffusion, even though nutrients still remain in the water phase. This suggests that a slower supply of nutrients to cells prolongs the exposure of cells to nutrient limitation in biofilm fermentation, and contributes to the higher iturin A production via increased expression of degQ.

Figure 5. Expression of ituB (A) and degQ (B) in biofilm fermentation in the AMS reactor and SmF as determined by real-time RT-PCR. Symbols: solid symbols, biofilm fermentation; open symbols, SmF

Biofilm Formed on the Soybean Curd Residue Is Associated…

347

Figure 6. Scanning electron micrographs of the surface of SSF using okara as a solid nutrient (A) and the biofilm in the AMS reactor (B). The specimens were photographed at a magnification 10,000. White bars represent 5 μm

348

Makoto Shoda and Shinji Mizumoto

Consequently, our results showed that the higher production of iturin A by B. subtilis RB14-CS in biofilm fermentation, is triggered by typical characteristics of biofilm, namely a high cell density, high salinity, and/or prolonged period of local limitation of nutrients, via elevated expression of degQ and itu operon.

ACKNOWLEDGMENTS We thank Dr. M. Yoshida of Chemical Resources Laboratory and Dr. H. Handa, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology for cooperation in use of analytical tools.

REFERENCES [1]

Allison, D. G., Ruiz, B., SanJose, C., Jape, A. & Gilbert, P. (1998). Extracellular products as mediators of the formation and detachment of Pseudomonas fluorescens biofilms. FEMS Microbiol. Lett, 167, 179-184. [2] Antelmann, H., Engelmann, S., Schmid, R. & Hecker, M. (1996). General and oxidative stress responses in Bacillus subtilis: Cloning, expression and mutation of the alkyl hydroperoxide reductase operon. J. Bacteriol, 178, 6571-6578. [3] Asaka, O. & Shoda, M. (1996). Biocontrol of Rhizoctonia solani damping-off of tomato with Bacillus subtilis RB14. Appl. Environ. Microbiol, 62, 4081-4085. [4] Bernhardt, J., Weibezahn, J., Scharf, C. & Hecker, M. (2003). Bacillus subtilis during feast and famine: visualization of the overall regulation of protein synthesis during glucose starvation by proteome analysis. Genome Res., 13, 224-237. [5] Bradford, M. M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248-254. [6] Branda, S. S., Gonzalez-Pastor, J. E., Ben-Yehuda, S., Losick, R. & Kolter, R. (2001). Fruiting body formation by Bacillus subtilis. Proc. Natl. Acad. Sci. USA, 98, 1162111626. [7] Branda, S. S., Vik, A., Friedman, L. & Kolter, R. (2005). Biofilms: the matrix revisited. Trends Microbiol, 13, 20-26. [8] Branda, S. S., Chu, F., Kearns, D. B., Losick, R. & Kolter, R. (2006). A major protein component of the Bacillus subtilis biofilm matrix. Mol. Microbiol., 59, 1229-1238. [9] Bsat, N., Chen, L. & Helmann, J. D. (1996). Mutation of the Bacillus subtilis alkyl hydroperoxide reductase (ahpCF) operon reveals compensatory interactions among hydrogen peroxide stress genes. J. Bacteriol, 178, 6579-6586. [10] Carlsson, P. & Hederstedt, L. (1989). Genetic characterization of Bacillus subtilis odhA and odhB, encoding 2-oxoglutarate dehydrogenase and dihydrolipoamide transsuccinylase, respectively. J. Bacteriol, 171, 3667-3672. [11] Chu, F., Kearns, D. B., Branda, S. S., Kolter, R. & Losick, R. (2006). Targets of the master regulator of biofilm formation in Bacillus subtilis. Mol. Microbiol, 59,12161228.

Biofilm Formed on the Soybean Curd Residue Is Associated…

349

[12] Comella, N. & Grossman, A. D. (2005). Conservation of genes and processes controlled by the quorum response in bacteria: characterization of genes controlled by the quorum-sensing transcription factor ComA in Bacillus subtilis. Mol. Microbiol, 57, 1159-1174. [13] Davey, M. E. & O‘Toole, G. A. (2000). Microbial biofilms: from ecology to molecular genetics. Microbiol. Mol. Biol. Rev., 64, 847-867. [14] Edman, P. (1949). A method for the determination of the amino acid sequence in peptides, Arch. Biochem. Biophys., 11, 475-476. [15] Errington, J. (2003). Regulation of endospore formation in Bacillus subtilis. Nat. Rev. Microbiol., 1, 117-126. [16] Eymann, C., Homuth, G., Scharf, C. C. & Hecker, M. (2002). Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J. Bacteriol, 184, 2500-2520. [17] Gaur, N. K., Cabane, K. & Smith, I. (1988). Structure and expression of the Bacillus subtilis sin operon. J. Bacteriol, 170, 1046-1053. [18] Hiraoka, H., Ano, T. & Shoda, M. (1992). Characterization of Bacillus subtilis RB14, coproducer of peptide antibiotics iturin A and surfactin. J. Gen. Appl. Microbiol, 38, 635-640. [19] Imlay, J. A. & Linn, S. (1988). DNA damage and oxygen radical toxicity. Science, 240, 1302-1309. [20] Inaoka, T., Takahashi, K., Ohnishi-Kameyama, M., Yoshida, M. & Ochi, K. (2003). Guanine nucleotides guanosine 5‘-diphosphate 3‘-diphosphate and GTP co-operatively regulate the production of an antibiotic bacilysin in Bacillus subtilis. J. Biol. Chem., 278, 2169-2176. [21] Jarmer, H., Larsen, T. S., Krogh, A., Saxild, H. H., Brunak, S. & Knudsen, S. (2001). Sigma-A recognition sites in the Bacillus subtilis genome. Microbiology, 147, 24172424. [22] Jiang, M., Grau, R. & Perego, M. (2000). Differential processing of propeptide inhibitors of Rap phosphatases in Bacillus subtilis. J. Bacteriol, 182, 303-310. [23] Kearns, D. B., Chu, F., Branda, S. S., Kolter, R. & Losick, R. (2005). A master regulator for biofilm formation by Bacillus subtilis. Mol. Microbiol, 55, 739-749. [24] Krasny, L., Mesters, J. R., Tieleman, L. N., Kraal, B., Fucik, V., Hilgenfeld, R. & Jonak, J. (1998). Structure and expression of elongation factor Tu from Bacillus stearothermophilus. J. Mol. Biol., 283, 371-381. [25] Kunst, F. & Rapoport, G. (1995). Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J. Bacteriol, 177, 2403-2407. [26] Lazazzera, B. A., Kurtser, I. G., McQuade, R. S. & Grossman, A. D. ((1999)). An autoregulatory circuit affecting peptide signaling in Bacillus subtilis. J. Bacteriol. 181,5193-5200. [27] Leclere, V., Bechet, M., Adam, A., Guez, J. S., Wathelet, B., Ongena, M., Thonart, P., Gancel, F., Chollet-Imbert, M. & Jacques, P. (2005). Mycosubtilin overproduction by Bacillus subtilis BBG100 enhances the organism‘s antagonistic and biocontrol activities. Appl. Environ. Microbiol., 71, 4577-4584. [28] Mizumoto, S., Hirai, M. & Shoda, M. (2006). Production of lipopeptide antibiotic iturin A using soybean curd residue cultivated with Bacillus subtilis in solid-state fermentation. Appl. Microbiol. Biotechnol, 72, 869-875.

350

Makoto Shoda and Shinji Mizumoto

[29] Morikawa, M. (2006). Beneficial biofilm formation by industrial bacteria Bacillus subtilis and related species. J. Biosci. Bioeng., 101, 1-8. [30] Msadek, T., Kunst, F., Henner, D., Klier, A., Rapoport, G. & Dedonder, R. (1990). Signal transduction pathway controlling synthesis of a class of degradative enzymes in Bacillus subtilis, expression of the regulatory genes and analysis of mutations in degS and degU. J. Bacteriol. 172, 824-834. [31] Msadek, T., Kunst, F., Klier, A. & Rapoport, G. (1991). DegS-DegU and ComP-ComA modulator-effector pairs control expression of the Bacillus subtilis pleiotropic regulatory gene degQ. J. Bacteriol, 173, 2366-2377. [32] Mueller, J. P., Bukusoglu, G. & Sonenshein, A. L. (1992). Transcriptional regulation of Bacillus subtilis glucose starvation-inducible genes: control of gsiA by the ComPComA signal transduction system. J. Bacteriol, 174, 4361-4373. [33] Nakano, M. M., Xia, L. & Zuber, P. (1991). Transcription initiation region of the srfA operon, which is controlled by the ComP-ComA signal transduction system in Bacillus subtilis. J. Bacteriol, 173, 5487-5493. [34] Nakano, M. M. & Zuber, P. (1993). Mutational analysis of the regulatory region of the srfA operon in Bacillus subtilis. J. Bacteriol, 175, 3188-3191. [35] Ogura, M. & Tanaka, T. (1996). Transcription of Bacillus subtilis degR is σD dependent and suppressed by multicopy proB through σD. J. Bacteriol, 178, 216-222. [36] Ogura, M., Yamaguchi, H., Yoshida, K., Fujita, Y. & Tanaka, T. (2001). DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons, an approach to comprehensive analysis of B. subtilis two-component regulatory systems. Nucleic Acids Res., 29, 3804-3817. [37] Ongena, M., Jacques, P., Toure, Y., Destain, J., Jabrane, A. & Thonart, P. (2005). Involvement of fengycin-type lipopeptides in the multifaceted biocontrol potential of Bacillus subtilis. Appl. Microbiol. Biotechnol, 69, 29-38. [38] Oosthuizen, M. C., Steyn, B., Theron, J., Cosette, P., Lindsay, D., von Holy, A. & Brozel, S. (2002). Proteomic analysis reveals differential protein expression by Bacillus cereus during biofilm formation. Appl. Environ. Microbiol, 68, 2770-2780. [39] Phae, C. G., Shoda, M. & Kubota, H. (1990). Suppressive effect of Bacillus subtilis and its products to phytopathogenic microorganisms. J. Ferment. Bioeng, 69, 1-7. [40] Prigent-combaret, C., Vidal, O., Dorel, C. & Lejeune, P. (1999). Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli. J. Bacteriol, 181, 5993-6002. [41] Qiu, D., Fujita, K., Sakuma, Y., Tanaka, T., Ohashi, Y., Ohshima, H., Tomita, M. & Itaya, M. 2004. Comparative analysis of physical maps of four Bacillus subtilis (natto) genomes. Appl. Environ. Microbiol, 70, 6247-6256. [42] Ren, D., Bedzyk, L. A., Setlow, P., Thomas, S. M., Ye, R. W. & Wood, T. K. (2004). Gene expression in Bacillus subtilis surface biofilms with and without sporulation and the importance of yveR for biofilm maintenance. Biotechnol. Bioeng, 86, 344-364. [43] Resch, A., Rosenstein, R., Nerz, C. & Gotz, F. (2005). Differential gene expression profiling of Staphylococcus aureus cultivated under biofilm and planktonic conditions. Appl. Environ. Microbiol, 71, 2663-2676. [44] Resnekov, O., Melin, L., Carlsson, P., Mannerlov, M., von Gabain, A. & Hederstedt, L. (1992). Organization and regulation of the Bacillus subtilis odhAB operon, which

Biofilm Formed on the Soybean Curd Residue Is Associated…

[45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60]

351

encodes two of the subenzymes of the 2-oxoglutarate dehydrogenase complex. Mol. Gen. Genet, 234, 285-296. Santana, M., Ionescu, M., Vertes, A. & Longin, R. (1994). Bacillus subtilis F0F1 ATPase: DNA sequence of the atp operon and characterization of atp mutants. J. Bacteriol, 176, 6802-6811. Shafikhani, S. H., Mandic-Mulec, I., Strauch, M. A., Smith, I. & Leighton, T. (2002). Postexponential regulation of sin operon expression in Bacillus subtilis. J. Bacteriol, 184, 564-571. Singh, P. & Cameotra, S. S. (2004). Potential applications of microbial surfactants in biomedical sciences. Trends Biotechnol, 22, 143-146. Stanley, N. R., Britton, R. A., Grossman, A. D. & Lazazzera, B. A. (2003). Identification of catabolite repression as a physiological regulator of biofilm formation by Bacillus subtilis by use of DNA microarrays. J. Bacteriol, 185, 1951-1957. Stanley, N. R. & Lazazzera, B. A. (2005). Defining the genetic differences between wild and domestic strains of Bacillus subtilis that affect poly-γ-DL-glutamic acid production and biofilm formation. Mol. Microbiol, 57, 1143-1158. Steil, L., Hoffman, T., Budde, I., Volker, U. & Bremer, E. (2003). Genome-wide transcriptional profiling analysis of adaptation of Bacillus subtilis to high salinity. J. Bacteriol, 185, 6358-6370. Stein, T. (2005). Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol. Microbiol, 56, 845-857. Stover, A. & Driks, A. (1999). Secretion, localization, and antibacterial activity of TasA, a Bacillus subtilis spore-associated protein. J. Bacteriol, 181, 1664-1672. Stover, A. & Driks, A. (1999). Regulation of synthesis of the Bacillus subtilis transition-phase, spore-associated antibacterial protein TasA. J. Bacteriol, 181, 54765481. Stulke, J. & Hillen, W. (2000). Regulation of carbon catabolism in Bacillus species. Annu. Rev. Microbiol., 54, 849-880. Tokunaga, T., Rashid, M. H., Kuroda, A. & Sekiguchi, J. (1994). Effect of degS-degU mutations on the expression of sigD, encoding an alternative sigma factor, and autolysin operon of Bacillus subtilis. J. Bacteriol, 176, 5177-5180. Tsuge, K., Ano T. & Shoda, M. (1996). Isolation of a gene essential for biosynthesis of the lipopeptide antibiotics plipastatin B1 and surfactin in Bacillus subtilis YB8. Arch. Microbiol, 165, 43-251. Tsuge, K., Ano, T., Hirai, M., Nakamura Y. & Shoda, M. (1999). The Genes, degQ, pps and lpa-8 (sfp) are Responsible for Conversion of Bacillus subtilis Strain 168 to Plipastatin Production. Antimicro. Agents Chemother, 43, 2183-2192. Tsuge, K., Akiyama, T. & Shoda, M. (2001). Cloning, sequencing, and characterization of the iturin A operon. J. Bacteriol, 183, 6265-6273. Tsuge, K., Inoue, S., Ano, T., Itaya, M. & Shoda, M. (2005). Horizontal transfer of iturin A operon, itu, to Bacillus subtilis 168 and conversion into an iturin A producer. Antimicrob. Agents. Chemother, 49, 4641-4648. Tsukamoto, Y., Kasai, M. & Kakuda, H. (2001). Construction of Bacillus subtilis (natto) with high productivity of vitamin K2 (menaquinone-7) by analog resistance. Biosci. Biotechnol. Biochem, 65, 2007-2015.

352

Makoto Shoda and Shinji Mizumoto

[61] Waite, R. D., Papakonstantinopoulou, A., Littler, E. & Curtis, M. A. (2005). Transcriptome analysis of Pseudomonas aeruginosa growth: comparison of gene expression in planktonic cultures and developing and mature biofilms. J. Bacteriol, 187, 6571-6576. [62] Wassel, D. & Flugge, U. I. (1984). A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem., 138, 141-143. [63] Watnick, P. & Kolter, R. (2000). Biofilm, city of microbes. J. Bacteriol, 182, 26752679. [64] Westers, L., Westers, H. & Quax, W. J. (2004). Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism. Biochim. Biophys. Acta, 1694, 299-310. [65] Yan, L., Boyd, K. G., Adams, D. R. & Burgess, J. G. (2003). Biofilm-specific crossspecies induction of antimicrobial compounds in Bacilli. Appl. Environ. Microbiol, 69, 3719-3727. [66] Yang, M., Ferrari, E., Chen, E. & Henner, D. J. (1986). Identification of the pleiotropic sacQ gene of Bacillus subtilis. J. Bacteriol, 166, 113-119.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 13

EXTRACTION AND CHARACTERIZATION OF SOYBEAN PROTEINS Savithiry S. Natarajan 1* and Devanand L. Luthria 2 1

US Department of Agriculture, Agricultural Research Service USDA-ARS, Soybean Genomics and Improvement Laboratory, 2 Food Composition and Methods Development Laboratory, Beltsville, MD, USA

ABSTRACT Proteins play an important role in many biological processes. We compare commonly deployed methods used for extraction of soybean proteins. In addition, we also discuss separation and identification of different classes of soy proteins (storage, allergens, and anti-nutritional) using current proteomic technologies. Soybean proteins are used in human food in a variety of forms such as baby formula and protein isolate concentrate because of unique physiochemical properties. Soybean storage proteins are grouped into two types, beta-conglycinin and glycinin based on their sedimentation coefficients. Three allergen proteins, Gly m Bd 60K, Gly m Bd 30K, and Gly m Bd 28K represent the major seed allergens. In addition to the above two protein classes, several proteins in soybean seeds are considered to be anti-nutritional (Kunitz trypsin inhibitor and lectins). Protein extraction was carried out by different methods and separation of proteins was achieved by two-dimensional polyacrylamide gel electrophoresis (2DPAGE). Individual proteins were characterized by matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) coupled with liquid chromatography mass spectrometry (LC-MS/MS) analysis of tryptic fragments. The application of these proteomic tools can be extended to the analysis of proteins separated using different matrices.

*

Corresponding author: Email: [email protected], Soybean Genomics and Improvement Laboratory, PSI-ARS-USDA, 10300 Baltimore Avenue, Beltsville, MD 20705 Phone Number: 301-504-5258 Fax Number: 301-504-5728.

354

Savithiry S. Natarajan and Devanand L. Luthria

1. INTRODUCTION 1.1. Soybean Proteins Soybean seeds contain abundant storage proteins namely, β-conglycinin and glycinin. The less abundant proteins include β-amylase, cytochrome c, lectin, lipoxygenase, urease, Kunitz Trypsin Inhibitor (KTI) and the Bowman Birk Inhibitor (BBI) of chymotrypsin and trypsin (Liener, 1994; Friedman and Brandon, 2001). Soybean storage proteins account for ~ 70-80% of total seed proteins and are deposited in specialized membrane-bound organelles called protein bodies. Several reviews describe the various soybean seed proteins and the comprehensive studies that have been conducted to identify these proteins and understand their functions (Beachy et al. 1983; Mityko et al. 1990; Warner and Wemmer, 1991; Nielsen et al. 1995; Maruyama et al. 2001; Adachi et al. 2003; Fehr et al. 2003; Poysa et al. 2006). Soybean storage proteins are grouped into two types, β-conglycinin and Glycinin, based on sedimentation coefficients. β-conglycinin, a 7S globulin, is a trimeric glycoprotein consisting of three types of non-identical but homologous polypeptide subunits: α, α′ and β, in seven different combinations with the molecular weight of 180 kDa (Thanh and Shibasaki, 1976; Koshiyama, 1983). A multigene family of about 20 genes encodes these subunits and as a result the amino acid sequence of each constituent subunit varies among cultivars (Thanh and Shibasaki, 1976; Maruyama et al. 2001). Glycinin, a hexameric 11S globulin (360 kDa), consists of acidic (A) and basic (B) polypeptides, (Nielson, 1985; Wright, 1987; Nielson et al. 1989; Renkema et al. 2001). Glycinin is encoded by five non-allelic genes, Gy1, Gy2, Gy3, Gy4 and Gy5, which code for five precursor protein molecules, G1, G2, G3, G4 and G5, respectively (Nielsen et al. 1989; Renkema et al. 2001). Based on physical properties, these five subunits are classified into two distinct major groups; group I consists of G1 (A1aBx), G2 (A2B1a), and G3 (A1aB1b) proteins and group II contains G4 (A5A4B3) and G5 (A3B4) subunits. There is 82-86% amino acid sequence homology within the subunit groups and 42-45% between the groups (Fukuda et al. 2005; Prak et al. 2005). The group I subunits contain more methionine residues than group II. This is an important feature for plant breeders desiring to increase the methionine content in soybean seeds to improve their nutritional quality (Cho et al. 1989; Utsumi et al. 1997). Recently, Beillinson et al. (2002) identified and mapped an additional two genes in soybean variety Resnik, glycinin pseudogene, gy6, and another functional gene, Gy7. Heterogeneity in glycinin subunits, due to deletions of the G4 and G5 genes, has been reported among Japanese soybean varieties (Yagasaki et al. 1997). Takahashi et al. (2003) also reported cultivars lacking α, or α and α′ or β subunits of β-conglycinin in Japanese soybean germplasm collections. The author reported that soybeans lacking glycinin and βconglycinin subunits grow and reproduce normally and concluded that it is possible to genetically alter the protein composition in order to obtain value-added soybeans. Natarajan et al. (2006a, 2007b) reported variation of glycinin and β-conglycinin subunits among 16 soybean genotypes including wild and cultivated genotypes. In addition to the β-conglycinin and glycinin storage proteins, 2S proteins have also been widely investigated and characterized (Baur et al. 1996). These anti-nutritional proteins consist primarily of protease inhibitors, of which Kunitz trypsin inhibitor (Mr 21.5 kDa) and

Extraction and Characterization of Soybean Proteins

355

Bowman-Birk inhibitor (BBI) (Mr 8 kDa) are well studied (Liener, 1979; Laskowski and Kato, 1980). Kunitz trypsin inhibitor (KTI) is an abundant protein, which can inhibit trypsin, an important animal digestive enzyme. KTIs have been characterized as food allergens in humans and have 32% sequence homology with a rye grass pollen allergen (Burks et al. 1994). The genes encoding KTI1 and KTI2 have nearly identical nucleotide sequences, while the KTI3 gene has diverged about 20% (Jofuku and Goldberg, 1989). BBIs are cys-rich protease inhibitors with molecular masses of about 8–16 kDa. These protease inhibitors are double-headed with two reactive sites in a single inhibitor molecule. BBIs have been identified in the Fabaceae including soybean (G. max) and lima beans (Phaseolus lunatus), and are encoded by a family of related genes (Qu et al. 2003). In addition to anti-nutritional proteins, soybeans also contain allergen proteins, Gly m Bd 60K, Gly m Bd 30K and Gly m Bd 28K (Ogawa et al. 2000). Gly m Bd 60K consists of αsubunit of β-conglycinin, G2 subunits and acidic G1 polypeptides (Ogawa et al. 1995;Beardslee et al. 2000). The Gly m Bd 30 K (P34) protein was first identified by Kalinski et al. (1992) from fractionated soybean oil body membrane. It was later renamed Gly m 1 by Hessing et al. (1996). Kalinski et al. (1990) reported that P34 was encoded by more than one gene. Gly m bd 28 K is another major soybean glycoprotein allergen and has sequence similarity to members of the cupin protein family, which contains several plant allergens. Cupin domains are generally more resistant to proteolytic digestion and are stable to a number of physical and chemical denaturants (Tsuji et al. 1995).

1.2. Proteomics In order to investigate the roles of different proteins, it is essential to extract, separate, isolate, and characterize proteins using modern proteomic tools. Proteomic technologies are powerful tools for accurately examining alterations in protein profiles caused by mutations, the introduction or silencing of genes or responses to various stress stimuli and changes occurring in protein composition among genotypes and during seed development (Gorg et al. 2000; Dubey and Grover, 2001). Proteomic studies have been used in other plant materials including Arabidopsis seeds (Gallardo et al. 2001), maize root and leaves (Chang et al. 2000, Porubleva et al. 2001), barrel medic roots and leaves (Mathesius et al. 2002; Watson et al. 2003), rice (Komatsu et al. 2003). Recently proteomics tools have been used to test and detect unintended effects in genetically modified plants (Lehesranta et al. 2005; Ruebelt et al. 2006). Proteomics combines advanced separation techniques such as 2D gel electrophoresis (2D-PAGE), identification techniques such as mass spectrometry (MS) and bioinformatics tools to characterize proteins in complex biological mixtures. 2D-PAGE systems are a combination of two different types of separation. In the first dimension, the proteins are separated on the basis of protein isoelectric point by IEF. In the second dimension, the focused proteins are further separated by electrophoresis based on the molecular weight. 2DPAGE is widely used and it allows separation of several hundred distinct protein spots from plants and mature soybean seed during development and germination (Flengsrud and Kobro, 1989; Gorg et al. 1992; Takahashi et al. 2003; Herman et al. 2003; Mooney et al. 2004; Fukuda et al. 2005; Hajduch et al. 2005; Natarajan et al. 2006a, 2006b). The methods available for protein identification have changed dramatically in the past several years. Separation of proteins by 2D-PAGE has been practiced and refined over several

356

Savithiry S. Natarajan and Devanand L. Luthria

decades (O‘Farrell, 1975). 2D-PAGE technology utilizing commercially available immobilized pH gradient (IPG) strip has overcome the former limitations of mobile carrier ampholytes with respect to reproducibility, handling, resolution and separation of very acidic and /or basic proteins (Görg et al. 2004). The traditional technique of Edman degradation has been replaced by tandem mass spectrometry method (Hunt et al. 1986; Karas and Hillenkamp, 1988). Further advances in 2D methodologies include improved sample preparation and application to the IPG strips thus allowing more proteins to be arrayed in submicrogram quantities (Herbert, 1999; Görg et al. 2000). Proteins can be identified by comparison of peptide masses generated following limited proteolysis (peptide mass fingerprinting) with known proteins, and sequence information can be obtained using collision induced dissociation. These techniques are dependent on pre-existing databases with annotated protein sequences from the specie of choice or closely related species to obtain statistically accurate protein identifications. Recent advances in MS and the establishment of protein databases have substantially increased the accuracy of protein profile characterization from complex protein mixtures and offer high-throughput analysis.

2. MATERIALS For experiments performed in our laboratory, soybean seeds [Glycine max (L.) Merr were obtained from the U.S. Department of Agriculture soybean germplasm collection, Urbana, Illinois. Seeds were stored at -80 oC until used. Soybean seeds were powdered in liquid nitrogen using a mortar and pestle. Chemicals for electrophoresis including acrylamide, bisacrylamide, sodium dodecyl sulfate (SDS), tetramethylethylenediamine (TEMED), ammonium persulfate, thiourea, dithiothreitol (DTT), 3-[(3-cholamidopropyl) dimethylamonio]-1-propanesulfonate (CHAPS) and immobilized pH gradient (IPG) strips were purchased from GE Healthcare (Piscataway, NJ, USA). Urea and ampholytes (pH 4.0– 7.0 and 3.0-10.0) were purchased from Bio-Rad Laboratories (Hercules, CA). Tris-HCl (pH 8.8), 2-mercaptoethanol, trichloroacetic acid (TCA) and glycerol were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). α-Cyanohydroxycinnamic acid (CHCA) matrix was purchased from Bruker Daltonics (Billerica, MA, USA). Water from a Millipore Milli-RO4 reverse osmosis system (Millipore, Newbedford, MA, USA) was used for making all solutions.

3. METHODS 3.1. Protein Extraction Methods Generally, extraction of proteins begins with cell lysis or disruption of subcellular components followed by release of proteins into buffer. Cell lysis can be achieved by freeze thawing, detergent lysis, sonication, grinding with liquid nitrogen, using high pressure French press, homogenization with glass beads, or nitrogen cavitation. Buffers commonly used for protein solublization generally include a chaotrope such as Urea/thiourea, which efficiently disrupt hydrogen bonds leading to protein unfolding, nonionic detergents such as, NP-40,

Extraction and Characterization of Soybean Proteins

357

Triton x-100, dodecyl maltoside and/ or zwitterionic detergents such as CHAPS, and sulfobetaines (eg. SB 3-10, asp 14), reducing agents include DTT, TBP, TCEP, and protease inhibitors (Rabilloud et al. 1997). Use of protease inhibitors and removal of interfering substances may be required to prevent protein degradation and separation (Simpson, 2003; Gorg et al. 2004). In addition, use of high molecular weight PVP may be required to reduce degradation of proteins. In some cases, proteins may need to be further concentrated. This is often accomplished using acetone, TCA or ammonium sulfate precipitation. Prior to 2D analysis, proteins are solubilized in a lysis solution typically containing urea, CHAPS, DTT, and ampholytes (Usuda and Shimogawara, 1995; Tsugita et al. 1996; Taylor et al. 2000). Examples of procedures for protein extraction are summarized in Table 1. To extract wheat leaf protein, Zivy et al. (1983) used Tris-HCl buffer with reducing agents, followed by precipitation with cold acetone. Ostergaard et al. (2004) and Wong et al. (2004) used the same buffer with addition of CaCl2 for extracting barley proteins. Vensel et al. (2005) used KCl buffer with Tris buffer to extract wheat protein from endosperm. Maruyama et al. (2003) used Tris-HCl extraction buffer with different concentration of all reagents. In all the above methods, the protein was precipitated with cold acetone and resuspended in lysis buffer after extraction. The lysis buffer usually contains urea, CHAPS, DTT, and ampholytes. Interestingly, Des Francs et al. (1985) reported the effect of different protein extraction procedures, including the use of proteinase inhibitors. The authors could identify degradation products of ribulose bisphosphate carboxylase/oxygenase in wheat leaf proteins using 2D analysis. A second type of protein extraction procedure that has been used successfully for seeds and woody tissues utilizes phenol extraction followed by precipitation using cold ammonium acetate with methanol, acetone, and ethanol (Hurkman and Tanaka, 1986). Mijnsbrugge et al. (2000) modified the original phenol method to study wood development at the protein levels in a woody angiosperm, poplar. The authors used different stem tissues of poplar and compared protein pattern and concluded that the phenol extraction yielded high quality protein extracts from wood. Similar protein extraction results from olive leaves were obtained by Wang et al. 2003. Schuster and Davies, 1983 reported that phenol-based method reduces proteolysis during extraction. Carpentier et al. (2005) and Mooney et al. (2004) also used the phenol method with some modifications to extract proteins from potato, apple, banana leaves and soybean seeds. Direct precipitation of protein from powdered tissues using TCA/acetone has been used successfully to extract proteins from soybean seeds, roots, pods, and leaves, (Cascardo et al. 2001) as well as from soybean, Arabidopsis, and rice tissues (Gegenheimer, 1990; Tsugita et al. 1996; Gorg et al. 2004; Ndimba et al. 2005; Chen and Harmon, 2006; Song et al. 2006; Wang et al. 2006; Zarkadas et al. 2007). Xu et al. (2006) used this method in our laboratory to investigate the impact of solar ultraviolet-B (UV-B) radiation on the soybean leaf proteome and resolved 300 protein spots. Combination TCA acetone and phenol extraction procedures have been used scussessfully in different parts of plant tissues. Koistinen et al. (2002) reported combination of TCA-acetone and phenol was efficient in extracting birch and potato proteins. Lehesranta et al. (2005) used a modified two-step precipitation/extraction method with combination of Tris-HCl buffer extraction and precipitation with TCA/acetone and again extraction with phenol and precipitation with ammonium acetate in methanol to extract potato tuber proteins. The author compared 2D protein pattern from transgenic potato with control and identified

358

Savithiry S. Natarajan and Devanand L. Luthria

many proteins, which were involved in disease and defense responses, glycolytic pathway, and sugar metabolism. Saravanan and Rose, (2004) compared two TCA based methods with a phenol method and concluded that the phenol method was the method of choice for recalcitrant plant tissue. Recently, Wang et al. (2006) reported that a TCA method combined with phenol is efficient for extracting leaf proteins from bamboo, lemon, olive, redwood and from apple, pear, banana, grape, tomato and orange fruits. The authors used TCA-acetone method followed by basic methanol and acetone wash steps and subsequent extraction of proteins into a phenol/ SDS mixture. The authors suggest this method efficiently removes high levels of polyphenols, and is useful for fruit samples which have high sugar, acidity, and pigments. In a recent study, Wang et al. (2007) compared four methods, TCA, E-TCA, phenol extraction, and a modified phenol extraction called the BPP (Borax/polyvinylpolypyrrolidone/phenol) method to extract Salicornia europaea proteins. The BPP method yielded the largest number of distinct proteins on 2D-gels, improving protein identification by subsequent MS analysis. Since halophytes have high concentrations of salt ions in their cells, the author reported that this method allows simultaneous separation of salt and proteins in the samples by partitioning them into different phases. Urea/thiourea solubilization methods have also been successful. Berkelman et al. (1998) and Herman et al. (2003) used urea or urea/thiourea solubilization in extracting soybean seed proteins. Ruebelt et al. (2006) and Kang et al. (2007) used the same method to extract Arabidopsis seed and rice leaf samples with different concentration of reagents and added additionally Triton X-100, 2-propanol and protease inhibitor cocktail in the extraction buffer. In our laboratory, we compared four different solubilization methods (thiourea/urea, urea, modified TCA/acetone and phenol) for extraction of proteins from soybean seeds and subsequent analysis by 2D-PAGE (Natarajan et al. 2005). Thiourea/urea solubilization and the modified TCA/acetone method resolved more protein spots than urea solubilization or phenol extraction (Natarajan et al. 2005, Table 1). Furthermore, resolution was poor and spots were diffuse in the high molecular weight region, particularly in the pH 4.0 to 7.0 range with the urea and phenol methods. While overall protein separation was similar in the thiourea/urea and TCA/acetone methods, low molecular weight proteins were more consistently resolved with the TCA/acetone method. Using the optimal trichloroacetic acid (TCA)/acetone precipitation/followed by solubilization in urea, we were able to identify more than ninety-five protein spots from different classes of proteins (storage, allergen, and antinutritional) by MS analysis (Natarajan et al. 2005; 2006a, 2006b, 2007a, 2007b).

3.2. Protein Quantification Accurate quantification of proteins is important to obtain uniform and readily comparable 2D gels. In our laboratory, protein concentrations are usually determined by the Bradford method (1976) using a commercial dye reagent (Bio-Rad). Alternatively, a modified Lowry method (1951) could be used, which contains SDS in the reagent buffer to minimize solubility problems. Initial precipitation in 10% (w/v) TCA helps to eliminate many potential interfering substances (Nerurkar et al. 1981). Amounts of protein that can be separated by 2DPAGE depend on the pH range and size of the IPG strips. Typically, we obtained maximum

Extraction and Characterization of Soybean Proteins

359

separation of proteins in 2D-PAGE when we used 100 µg of soybean seed protein in 13cm strips (Natarajan et al. 2005). Table 1. Protein extraction methods for 2D gel electrophoresis Serial# 1

2

3

4

5

6

Extraction Procedure 100 mg of wheat leaf pieces were crushed in a mortar cooled by liquid nitrogen. The powder was re-suspended in 2 ml of TrisHC1at pH 8.7 with dithiothreitol, ascorbic acid, EDTA Na2, MgCI2 and insoluble polyvinylpyrrolidone. This sample was centrifuged with the pellet drawn off after each centrifugation. Cold acetone with mercaptoethanol was added to precipitate the proteins. After centrifugation, the pellet was air-dried and resuspended in O‘Farrell lysis buffer (O‘Farrell, 1975) for 2D analysis. Protein was extracted by vortexing 100 mg of seed powder with lysis solution [urea, CHAPS, ampholytes] and sonicated at room temperature. The extract was centrifuged and the supernatant was further cleaned using a 2D clean-up kit according to the manufacturer‘s instructions (GE Healthcare, Piscataway, NJ) and an aliquot was used to determine the concentration of protein. Plant tissues were crushed in liquid nitrogen and 2 g of the powder were homogenized with trichloroacetic acid in acetone containing mercaptoethanol. Total protein was precipitated, centrifuged and washed with acetone containing mercaptoethanol. The pellet was dried and 30 mg of the acetone dry powder was re-suspended in lysis buffer (urea, Triton X-100, mercaptoethanol, ampholines, PMSF) followed by ultrasonication on ice. Cell debris was removed by centrifugation and protein concentration was determined Soybean seeds were frozen in liquid nitrogen, ground into a fine powder, defatted twice with hexane, and vacuum-dried. Protein was extracted by vortexing 100 mg of seed powder with extraction buffer [CHAPS, urea, thiourea, dithiothreitol, and ampholytes] for 5 min at room temperature. The extract was centrifuged and the supernatant was collected for 2 D analysis. The soybean powder was extracted by the addition of 2.5 ml of Tris -HCl (pH 8.8) buffered phenol and 2.5 ml of extraction media (TrisHCl pH 8.8, EDTA, mercaptoethanol, and sucrose). The extract was vortexed, sonicated, and centrifuged. The phenol phase was transferred to another tube and proteins were precipitated by cold ammonium acetate in 100% methanol. The precipitate was collected by centrifugation and the pellet was washed with ammonium acetate in methanol, acetone and ethanol. The pellet was re-suspended in extraction solution [urea, thiourea, CHAPS, Triton X-100, DTT, ampholytes]. The samples were incubated with agitation and the extract was used for 2D analysis. 1 g of frozen lyophilized tissue powders of Salicornia europaea was resuspended in extraction buffer of Tris (pH 8.0) containing EDTA, borax, vitamin C, PVPP, Triton X-100, mercaptoethanol and sucrose. After votexing, 2 volumes of Tris-saturated Phenol (pH 8.0) were added and vortexed for 10 min. After centrifugation, the upper phase was transferred to a new centrifuge tube and equal volume of extraction buffer was added and the step was repeated. Proteins were precipitated by sulfate saturated-methanol, and incubating for at least 6 h. After centrifugation, the protein pellet was re-suspended and rinsed with methanol, acetone, and the pellet was air-dried and dissolved in lysis buffer (urea, CHAPS, DTT, IPG buffer) for 2D analysis.

Method Tris HCl / acetone

Reference Zivy et al. 1983

Urea solubilization buffer

Berkelman et al. 1998

TCA / acetone

Cascardo et al. 2001

Thiourea / urea solubilization buffer

Herman et al. 2003

Phenol extraction buffer

Natarajan et al. 2005

BPP method (Borax / PVPP / Phenol)

Wang et al. 2007

360

Savithiry S. Natarajan and Devanand L. Luthria

3.3. First Dimension Separation (Isoelectric Focussing, IEF) In the 2D technology originally described by O‘Farrell in 1975, pH gradients were generated using carrior ampholytes in tube/rod gels for the first dimension. The resulting poor resolution, separation and reproducibility have been overcome by the introduction of immobilized pH gradients (IPG) for the first dimension (Righetti and Macelloni, 1982; Gorg et al. 1988). IPGs are based on the use of the bifunctional immobiline reagents with a series of 10 chemically well-defined acrylamide derivatives (Weiss and Gorg, 2007). Advances in IPG technology and other improvements using powerful reagents for solubilization of proteins and the development of dedicated high voltage electrophoresis instruments by several manufacturers have improved the reproducibility of the first dimension separation of proteins (Rabilloud et al. 1997; Gorg et al. 2004). Commercial IPG strips are readily available in linear and nonlinear gradients, multiple narrow pH ranges and in sizes from 7 to 24 cm (Görg et al. 2004), facilitating separations for different purposes including protein isolation, identification and western blot analysis (Magni et al. 2005). In our laboratory, first dimension separation of soybean proteins was carried out in a IPGphor system (GE Healthcare, Piscataway, NJ) 13 cm linear IPG strips in ranges of pH 4-7 and 6-11. IPG strips were dehydrated with 250µl rehydration buffer (8M urea, 2% CHAPS, 0.5% ampholytes, 0.002% bromophenol blue) containing the appropriate amount of protein before isoelectric focussing. Recommended protein amounts range between 50 and 100 ug for analytical gels (Weiss and Gorg, 2007). We used 100ug protein for our soybean seed proteins (Natarajan et al. 2005). The voltage settings for isoelectric focusing were 500 V for 1 hr, 1000 V for 1 hr, and 8000 V to a total 14.5 kVh, according to manufacturer recommendations. The focused strips were either immediately run on a second dimension SDS gel or stored at -80°C.

3.4. Second Dimension Séparation (SDS-PAGE) Prior to running on the second dimensional SDS PAGE, the IPG strips were equilibrated with buffer 1 (50mM Tris-HCl pH 8.8, 6M urea, 30% glycerol, 2% SDS, 0.002% bromophenol blue, 1% DTT) followed by buffer 2 (same buffer without DTT, but containing 2.5% iodoacetamide to alkylate the free thiol group of cysteines). for 15 min each to allow the separated proteins to fully interact with SDS. We used vertical 12% polyacrylamide gels (18 × 16 cm) in a tris-glycine buffer system as described by Laemmli (1970) and a Hoefer SE 600 Ruby electrophoresis unit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer‘s recommendations. In our laboratory, the gels were fixed overnight in 50% ethanol and 10% acetic acid, and washed 3 x 30 min with distilled water. Many methods have been developed to fix and detect separated proteins in acrylamide gels, and the selection of method is dependent on the experimental purpose. Widely used stains include anionic dyes such as Coomassie Blue -R250/G250 (Neuhoff et al. 1988), fluorescent dyes (Yan et al. 2000a), silver stain (Yan et al. 2000b) and radioactive isotopes, coupled with laser scanning densitometry, fluorescence imaging or autoradiography/fluorography/phosphor-imaging (Görg et al. 2004). The 2D-PAGE gels were stained with Colloidal Coomassie Blue G-250 as described by Newsholme et al. (2000). Initially the gels were pretreated for 1 hour in 34% methanol, 17% ammonium sulfate and 3% phosphoric acid and then stained in the same solution containing

Extraction and Characterization of Soybean Proteins

361

Coomassie Blue G-250 (0.066%) for 2 days. This stain has found widespread use for the detection of proteins, due to its low cost, ease of use and compatibility with mass spectrometry (Görg et al. 2004). Stained gels were stored in 20% ammonium sulfate solution and scanned using laser densitometry (PDSI, GE Healthcare). Typically, triplicate samples were used for soybean seed protein extraction and 2D-PAGE.

3.5. 2D Image Analysis To evaluate the 2D gel patterns, computerized image analysis systems are typically used (Dowsey et al. 2003). Several devices including modified document scanners, laser densitometers, CCD cameras, and fluorescent and phosphor images are currently available to capture gel images in a digital format (Gorg et al. 2004). Several 2D analysis software systems are commercially available to analyze saved images including Z3 (Compugen); Melanie III (Genebio and Bio-Rad); PDQuest 2D gel analysis software (Lehesranta et al. 2005; Ruebelt et al. 2006); Phoretix 2D software marketed as Imagemaster 2D (Hajduch et al. 2005), HT analyzer (Genomic solutions), and Phoretix 2D Advance (Mooney et al. 2004; Zarkadas et al. 2007). We use PDQuest ImageQuant™ for Windows™ NT software (GE Healthcare) for 2D spot analysis. Automatic algorithms calculate quantitative statistics, including spot volume, pixel area, mean pixel intensity, standard deviation and background values which are recorded in a spreadsheet format. We have also used Progenesis Samespots (Nonlinear Dynamics Group, UK, http://www.samespots.com) for automatic gel quality analysis, image alignment, spot detection and matching across all gels in the experiment, background subtraction and normalization. Gels can be easily arranged into experimental groups and protein spots of interest can be ranked by their statistical significance ANOVA and T-test or fold change.

3.6. In-Gel Digestion and Protein Identification To identify protein spots in 2D gels by mass spectrometry (MS) protein spots were manually excised from stained gels and washed with distilled water to remove ammonium sulfate and then with 50% acetonitrile containing 25 mM ammonium bicarbonate to de-stain the gel plug. The gel plug was dehydrated with 100% acetonitrile, dried under vacuum, and then re-swollen in 20 l of 10g/ml trypsin (modified porcine trypsin, sequencing grade, Promega, Madison, WI) in 25 mM ammonium bicarbonate. Additional ammonium bicarbonate (20 l) was added to maintain hydration of the gel plug. Digestion was performed overnight at 37°C. The resulting tryptic fragments were extracted in 50% acetonitrile and 5% trifluoroacetic acid with sonication. The extract was dried and dissolved in 50% acetonitrile containing 0.1% trifluoroacetic acid. The ability to analyze and identify digested protein spots by MS required development of soft ionization techniques to enable these large biopolymers to be vaporized into the gas phase. Currently, the most widely used ionization methods were Matrix Assisted Laser Desorption Ionization (MALDI) (Karas and Hillenkamp, 1988) and Electrospray Ionization (ESI) (Fenn et al. 1989). Protein samples for MALDI-TOF-MS

362

Savithiry S. Natarajan and Devanand L. Luthria

(Applied Biosystems, Framingham, MA) are prepared using dried droplet method (Karas and Hillenkemp, 1988) with α-cyanohydroxycinnamic acid (CHCA) matrix. Spectra were calibrated using the trypsin autolysis peaks at m/z 842.51 and 2,211.10 as internal standards. A LC-MS (Thermo Finnigan LCQ Deca XP plus Ion Trap) mass spectrometer was also used to analyze proteins that were not positively identified by MALDITOF-MS mass spectrometry in our laboratory. Peptides were separated on a reverse phase column using a 30 min gradient of 5% to 60% acetonitrile in water with 0.1 % formic acid. The instrument was operated with a duty cycle that acquires MS/MS spectra on the three most abundant ions identified by a survey scan from 300-2000 Da. Dynamic exclusion was employed to prevent the continuous analysis of the same ions. The raw data was processed by Sequest to generate DTA files for database searching. The merge pl script from Matrix Science (Boston, MA) was used to convert multiple Sequest DTA files into a single mascot generic file suitable for searching in Mascot.

Figure1. A proteomic comparison of the storage proteins of wild and cultivated soybean seeds. The first dimension was run using a pH gradients 4-7 and 6-11. The second dimension was a 12% SDS-PAGE. A, β-conglycinin; B1, Acidic polypeptides of glycinin; B2, Basic polypeptides of glycinin; C1, Allergen Gly m Bd 60K; C2, Allergen Gly m Bd 30K; C3, Allergen Gly m Bd 28K; D1, Antinutritional proteins-KTI; D2, Anti-nutritional proteins-Lectin

Extraction and Characterization of Soybean Proteins

363

4. CURRENT RESEARCH ON SOYBEAN PROTEINS We successfully used narrow width gradients in high and low pH ranges and standard loading and running conditions to separate of soybean seed proteins, and characterize the separated spots using MALDI-TOF-MS and LC/MS/MS (Natarajan et al. 2005; Xu et al. 2006). Several proteins have been identified and characterized by their isoelectric point, apparent molecular weight and relative abundance of subunits. We used isoelectric focusing gels in pH 4-7 and 6-11 (Figure 1) ranges to separate most of the soybean storage, allergen and anti-nutritional proteins. Proteins were analyzed by MALDI-TOF-MS, LC-MS and identified by searches of the NCBI non-redundant database. This database provides theoretical isoelectric point (pI) and molecular weight (Mr), protein identity, number of peptides matched, percent sequence coverage, MOWSE score, expect value, and NCBI database accession number of the best match and database that yielded identification. Figure 1 shows all proteins separated and identified in our laboratory (Natarajan et al. 2006a, 2007). Area A shows some of the protein spots of β-conglycinin. Glycinin major acidic subunits were resolved in area B1 (Figure 1 a, pH 4-7), and the basic polypeptides were separated in area B2 (Figure 1b, p H 6-11). Majority of the proteins were identified in our laboratory and natural variation of these storage proteins were reported (Natarajan et al. 2006a and 2006b). Area C was identified as allergen proteins; CI was Gly m bd 60 K allergens, which include the G2 glycinin acidic and basic polypeptides, and area C2 and C3 are Gly m bd 30 k and Gly m bd 28 k allergens. Area D1 was identified as Kunitz trpsin inhibitor anti-nutritional proteins, and area D2 was identified as lectins another group of anti-nutritional proteins. Lectin accounts about 10% of total protein in legumes (Barnett et al. 1987). In addition we used pH range 3-10 to separate and identify 71 unique soybean leaf proteins (Xu et al. 2006). Using similar approaches, Hajduch and coworkers identified 216 unique non-redundant proteins in the developing soybean seed (Hajduch et al. 2005). Use of narrow range pH gradients enhances the separation of proteins with similar electrophoretic mobilities; however, it is also clear from our work that fractionation of proteins prior to 2D analysis will be required to probe deeper into the soybean proteome (Mooney et al. 2004).

5. SUMMARY Current tools utilized for separation and identification of proteins isolated from soybeans have been reviewed. Various extraction procedures and the importance of 2D-PAGE for separating different proteins are described. Issues and challenges for preparing samples for protein isolation and characterizations are discussed. In addition, applications of protein digestion and structural analysis by mass spectrometry are described. Developments of proteomics tools are vital to create an accurate database of relative quantities of identifiable proteins from various organs, developmental stages, environmental and varietals differences. This database will enable researchers and producers to evaluate the variation in proteins in new soybean hybrids developed through conventional breeding or new biotech approaches.

364

Savithiry S. Natarajan and Devanand L. Luthria

REFERENCES Adachi, M., Kanamori, J., Masuda, T., Yagasaki, K., Kitamura, K. & Mikami, B. (2003). Crystal structure of soybean 11S globulin: glycinin A3B4 homohexamer. Proc. Natl. Acad. Sci., 100, 7395-7400. Baur, X., Pau, M., Czuppon, A. & Fruhmann, G. (1996). Characterization of soybean allergens causing sensitization of occupationally exposed bakers. Allergy, 51, 326-330. Beachy, R. N., Doyle, J. J., Ladin, B. F. & Schuler, M. A. (1983). Structure and expression of the genes encoding the soybean 7S seed storage proteins. Natl. Adv. Sci. Inst. Ser., 63, 101-112. Beardslee, T. A., Zeece, M. G., Sarath, G. & Markwell, J. P. (2000). Soybean glycinin G1 acidic chain shares IgE epitopes with peanut allergen Ara h3. Int Arch Allergy Immunol, 123, 299-307. Beilinson, V., Chen, Z., Shoemaker, R. C., Fischer, R. L., Goldberg, R. B. & Nielsen, N. C. (2002). Genomic organization of glycinin genes in soybean. Theor Appl Genet, 104, 1132-1140. Berkelman, T., Stenstedt, T., Bjellqvist, B., Laird, N., McDowell, M., Olsson, I. & Westermeier, R. (1998). 2D electrophoresis using immobilized pH gradients. Handbooks from Amersham Biosciences., 26-30. Barnett, D. & Howden M. E. (1987). Lectins and the radioallergosorbent test. J. Allergy Clin. Immunol, 80, 558-561. Bradford, M. M. (1976). Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein- dye binding. Anal. Biochem, 72, 248-254. Burks, A. W., Cockrell, G., Cannaughton, C., Guin, J., Allen, W. & Helm, R. M. (1994). Identification of peanut agglutinin and soybean trypsin inhibitor as minor legume allergens. Int. Arch. Allergy Immunol, 105, 143-149. Carpentier, S. C., Witters, E., Laukens, K., Deckers, P., Swennen, R. & Panis, B. (2005). Preparation of protein extracts from recalcitrant plant tissues: An evaluation of different methods for two-dimensional gel electrophoresis analysis. Proteomics, 5, 2497-2507. Cascardo, J. C. M., Buzeli, R. A. A., Almeida, R. S., Otoni, W. C. & Fontes, E. P. B. (2001). Differential expression of the soybean BiP gene family. Plant Science, 160, 273-281.81. Chang, W. P., Huang, L. H., Shen, M., Webster, C., Burlingame, A. L. & Roberts, K. M. J. (2000). Patterns of protein synthesis and tolerance of anoxia in root tips of maize seedlings acclimated to a low-oxygen environment, and identification of proteins by mass spectrometry. Plant Physiol, 122, 295-318. Chen, S. & Harmon, A. C. (2006). Advances in plant proteomics. Proteomics, 6, 5504-5516. Cho, T. J., Davies, C. S. & Nielsen, N. C. (1989). Inheritance and organization of glycinin genes in soybean. Plant Cell, 1, 329-337. Des Francs, C. C., Thiellement, H. & de Vienne, D. (1985). Analysis of leaf proteins by twodimensional gel electrophoresis: Protease action as exemplified by ribulose bisphosphate carboxylase/ oxygenase degradation and procedure to avoid proteolysis during extraction. Plant Physiol, 78, 178-182. Dubey, H. & Grover, A. (2001). Current initiatives in proteomics research: The plant perspective. Current Sci., 80, 262-269.

Extraction and Characterization of Soybean Proteins

365

Dowsey, A. W., Dunn, M. J. & Yang, G. Z. (2003). The role of bioinformatics in twodimensional gel electrophoresis. Proteomics, 3, 1567-1596. Eng, J., McCormack, A. L. & Yates, J. R. (1994). An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein databases. J. Amer. Soc. Mass. Spectrum., 5, 976-989. Fenn, J. B., Mann, M., Meng, C. K., Wong, S. F. & Whitehouse, C. M. (1989). Electrospray ionization for mass spectrometry of large biomolecules. Science, 246, 64-71. Fehr, W. R., Hoeck, J. A., Johnson, S. L., Murphy, J. D., Nott, P. A. & Padilla, G. I. (2003). Genotype and environmental influence on protein components of soybean. Crop Science, 43, 511-514. Flengsrud, R. & Kobro, G. (1989). A method for two-dimensional electrophoresis of proteins from green plant tissues. Anal. Biochem, 177, 33-36. Friedman, M. & Brandon, D. L. (2001). Nutritional and health benefits of soy proteins, 49, 1069-1086. Fukuda, T., Maruyama, N., Kanazawa, A., Abe, J., Shimamoto, Y. & Hiemori, M. (2005). Molecular analysis and physicochemical properties of electrophoretic variants of wild soybean Glycine soja storage proteins. J. Agri.c Food Chem., 53, 3658-3665. Gallardo, K., Job, C., Groot, S. P. C., Puype, M., Demol, H., Vandekerckhove, J. & Job D. (2001). Proteomic analysis of Arabidopsis thaliana seed germination and priming. Plant Physiology, 126, 835-849. Gegenheimer, P. (1990). Preparation of extracts from plants. Methods in Enzymology, 182, 174-193. Gorg, A., Postel, W., Domscheit, A. & Gunther, S. (1988). Two-dimensional electrophoresis with immobilized pH gradients of leaf proteins from barley (Hordeum vulgare): Method, reproducibility and genetic aspects. Electrophoresis, 9, 681-692. Gorg, A., Postel, W. & Weiss, W. (1992). Detection of polypeptides and amylase isoenzyme modifications related to malting quality during malting process of barley by twodimensional electrophoresis and isoelectric focusing with immobilized pH gradients. Electrophoresis, 13, 759-77. Gorg, A., Obermaier, C., Boguth, G., Harder, A., Scheibe, B., Wildgrube,r R. & Weiss W. (2000). The current state of two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis, 21, 1037-1053. Gorg, A., Weiss, W. & Dunn, M. J. (2004). Current two-dimensional electrophoresis technology for proteomics. Proteomics, 4, 3665-3685. Hajduch, M., Ganapathy, A., Stein, J. W. & Thelen, J. J. (2005). A systematic proteomic study of seed filling in soybean. Establishment of high-resolution two-dimensional reference maps, expression profiles, and an interactive proteome database. Plant Physiol., 137, 1349-1419. Herbert, B. (1999). Advances in protein solubilization for two-dimensional electrophoresis. Electrophoresis, 20, 660-663. Herman, E. M., Helm, R. M., Jung, R. & Kinney, A. J. (2003). Genetic modification removes an immunodominant allergen from soybean. Plant Physiol, 132, 36-43. Hessing, M., Bleeker, H., Tsuji, H., Ogawa, T. & Vlooswijk, R. A. A. (1996). Comparison of human IgE- binding soybean allergenic protein Gly m 1 with the antigenicity profiles of calf anti-soya protein sera. Food and Agri Immunol, 8, 51-58.

366

Savithiry S. Natarajan and Devanand L. Luthria

Hunt, D. F., Yates, III J. R., Shabanowitz, J., Winston, S. & Hauer, C. R. (1986). Protein sequencing by tandem mass spectrometry. Proc. Natl. Acad. Sci. USA, 83, 6233-6237. Hurkman, W. J. & Tanaka, C. K. (1986). Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant Physiol, 81, 802-806. Jofuku, K. D. & Goldberg, R. B. (1989). Kunitz trypsin inhibitor genes are differentially expressed during the soybean life cycle and in transformed tobacco plants. Plant Cell, 1, 1079-1093. Kalinski, A., Weisemann, J. M., Matthews, B. F. & Herman, E. M. (1990). Molecular cloning of a protein associated with soybean seed oil bodies that is similar to thiol proteases of the papain family. J. Biol. Chem., 265, 13843-13848. Kalinski, A., Melroy, D. L., Dwivedi, R. S. & Herman, E. M. (1992). Soybean vacuolar protein (P34) related to thiol proteases is synthesized as a glycoprotein precursor during seed maturation. J. Biol. Chem., 267, 12068-12076. Kang, S. G. Matin, M. N. Bae, H. & Natarajan, S. S. (2007). Proteome analysis and characterization of phenotypes of lesion mimic mutant spotted leaf 6 in rice. Proteomics, 7, 2447-2458. Karas, M. & Hillenkamp, F. (1988). Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem., 60, 2299-301. Koistinen, K. M., Hassinen, V. H.,. Gynther, P. A. M , Lehesranta, S. J., Keinänen, S. I., Kokko, H. I., Oksanen, E. J., Tervahauta, A. I., Auriola, S. & Kärenlampi, S. O. (2002). Birch PR-10 is induced by factors causing oxidative stress but appears not to confer tolerance to these agents. New Phytologist, 155, 381-391. Komatsu, S., Konishi, H., Shen, S. & Yang, G. (2003). Rice proteomics. A step towards functional analysis of the rice genome. Molecular and Cellular Proteomics, 2, 2-10. Koshiyama, I. (1983). Storage proteins of soybean, In: Seed Proteins: Biochemistry, Genetics, Nutritive Value eds. By W. Gottschalk, & H. P. Muller, Kluwer Academic Publishers, The Hague, The Netherlands. 427-450. Lammelli, U. K. (1970). Cleavage of structural proteins during assembly of the head of bateriophage T4. Nature, 227, 680-685. Laskowski, M. Jr. & Kato, I. (1980). Protein inhibitors of proteinases. Annu. Rev. Biochem. 49, 593-626. Lehesranta, S. J., Davies, H. V., Shepherd, L. V. T., Nunan, N., McNicol, J. W., Auriola, S., Koistinen, K. M., Suomalainen, S., Kokko H. I. & Kärenlampi S. O. (2005). Comparison of tuber proteomes of potato varieties, landraces, and genetically modified lines. Plant Physiology, 138, 1690-1699. Liener, I. E. (1979). Significance of humans of biologically active factors in soybeans and other food legumes. J. Amer. Oil. Chem. Soc., 56, 121-129. Liener, I. E. (1994). Implication of anti-nutritional components in soybean foods. Crit. Rev. Food. Sci. Nutri., 34, 31-67. Lowry, O. H., Ronserough, N. J., Farr, A. L. & Randell, R. J. (1951). Protein measurement with the folin phenol reagent. J.Biol.Chem., 193, 265-275. Maruyama, N., Adachi, M., Takahashi, K., Yagasaki, K., Kohna, M., Takenaks, Y., Okuda, E., Nakagawa, S., Mikami, B. & Utsumi, S. (2001). Crystal structures of recombinant and native soybean β-conglycinin β homotrimers. Eur. J. Biochem., 268, 3595-3607.

Extraction and Characterization of Soybean Proteins

367

Maruyama, N., Fukuda, T., Saka,S., Inui, N., Kotoh, J., Miyagawa, M., Hayashi, M., Sawada, M., Moriyama, T. & Utsumi, S. (2003). Molecular and structural analysis of electrophoretic variants of soybean seed storage proteins. Phytochemistry, 64, 701-708. Magni, C., Ballabio, C., Restani, P., Sironi, E., Scarafoni, A., Poiesi, C. & Duranti, M. (2005). Two-dimensional electrophoresis and western-blotting analyses with anti Ara h 3 basic subunit IgG evidence the cross-reacting polypeptides of Arachis hypogaea, Glycine max, and Lupinus albus seed proteomes. J. Agri.c Food Chem., 53, 2275-81. Mathesius, U., Imin, N., Chen, H., Djordjevic, M. A., Weinman, J. J., Natera, S. H. A., Morris, A. C., Kerim, T., Paul, S., Menzel, C., Weiller, G. F. & Rolfe, B. G. (2002). Evaluation of proteome reference maps for cross-species identification of proteins by peptide mass fingerprinting. Proteomics, 2, 1288-1303. Mijinsbrugge, K. V., Meyermans, H., Van Mantagu, M., Bauw, G. & Boerjan, W. (2000). Wood formation in poplar: identification, characterization, and seasonal variation of xylem proteins. Planta, 210, 589-598. Mityko, J., Batkai, J. & Hoddos-Kotvics, G. (1990). Trypsin inhibitor content in different varieties and mutants of soybean. Acta. Agron. Hungarica, 39, 401-405. Mooney, B. P., Krishnan, H. B. & Thelen, J. J. (2004). High-throughput peptide mass fingerprinting of soybean seed proteins, Automated workflow and utility of UniGene expressed sequence tag databases for protein identification. Phytochemistry, 65, 1733-44. Natarajan, S. S., Xu, C., Caperna, T. J. & Garrett, W. M. (2005). Comparison of protein solubilization methods suitable for proteomic analysis of soybean seed proteins. Anal. Biochem, 342, 214-220. Natarajan, S. S., Xu, C., Bae, H., Caperna, T. J. & Garrett, W. M. (2006a). Characterization of storage proteins in wild (Glycine soja) and cultivated (Glycine max) soybean seeds using proteomics analysis. J. Agri. Food Chem., 54, 3114-3120. Natarajan, S. S., Xu, C., Bae, H., Caperna, T. J. & Garrett, W. M. (2006b). Proteomic analysis of allergen and anti-nutritional proteins in wild and cultivated soybean. J. Plant Biochem. Biotech, 15, 103-108. Natarajan, S. S., Xu, C., Bae, H., Cregan, P., Caperna, T. J., Bailey, B. A., Garrett, W. M. & Luthria, D. (2007a). Glycinin subunit characterization among soybean cultivars using proteomics and genomics. Plant Physiol. Biochem., 45, 436-444. Natarajan, S. S., Xu, C., Bae, H. & Bailey, B. A. (2007b). Proteomic and genomic characterization of Kunitz trypsin inhibitors in wild and cultivated soybean genotypes. J. Plant. Physiol, 164, 756-763. Ndimba, B. K., Chivasa, S., Simon, W. J. & Slabas, A. R. (2005). Identification of Arabidopsis salt and osmotic stress responsive proteins using two-dimensional difference gel electrophoresis and mass spectrometry. Proteomics, 5, 4185-4196. Nerurkar, L. S., Marino, P. A. & Adams, D. O. (1981). Quantification of selected intracellular and secreted hydrolases of macrophages. In: Manual of Macrophage Methodology. Neuhoff, V., Arold, N., Taube, N. & Ehrhardt, W. (1988). Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis, 9, 255-262. Nielsen, N. C. (1985). The structure and complexity of the 11S polypeptides in soybeans. J. Am. Oil. Chem. Soc., 62, 1680-1686.

368

Savithiry S. Natarajan and Devanand L. Luthria

Nielsen, N. C., Dickinson, C. D., Cho, T. J., Thanh, V. H., Scallon, B. J., Fischer, R. L., Sims, T. L., Drews, G. N. & Goldberg, R. B. (1989). Characterization of the glycinin gene family in soybean. Plant Cell, 1, 313-328. Nielsen, N. C., Jung, R., Nam, Y. M., Beaman, T. W., Oliveira, L. O. & Bassuner, R. (1995). Synthesis and assembly of 11S globulins. J. Plant. Physiol, 145, 641-647. Newsholme, S. J., Maleeft, B. F., Steiner, S., Anderson, N. L. & Schwartz, L. W. (2000). Two-dimensional electrophoresis of liver proteins: Characterization of a drug-induced hepatomegaly in rats. Electrophoresis, 21, 2122-2128. O‘Farrell, P. H. (1975). High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem., 250, 4007-4021. Ogawa, T., Bando, N., Tsuji, H., Nishikawa, K. & Kitamura, K. (1995). Alpha subunit of beta-conglycinin, an allergenic protein recognized by IgE antibodies of soybean-sensitive patients with atopic dermatitis. Biosci. Biotechnol. Biochem., 59, 831-833. Ogawa, T., Samoto, M. & Takahashi, K. (2000). Soybean allergens and hypoallergenic soybean products. J. Nutr. Sci. Vitaninol, 46, 271-279. Ostergaard, O., Finnie, C., Laugesen, S., Roepstorff, P. & Svensson, B. (2004). Proteome analysis of barley seeds: Identification of major proteins from two-dimensional gels (pI 4-7). Proteomics, 4, 2437-2447. Perkins, D.N ., Pappinl, D. J. C., Creasy, D. M. & Cottrell, J. S. (1999). Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis, 20, 3551-3567. Porubleva, L., Velden, K. V., Kothari, S., Olive, D. J. & Chitnis, P. R. (2001). The proteome of maize leaves: Use of gene sequences and expressed sequence tag data for identification of proteins with peptide mass fingerprints. Electrophoresis, 22, 1724-1738. Poysa, V., Woodrow, L. & Yu, K. (2006). Effect of soy protein subunit composition on tofu quality. Food Research International, 39, 309-317. Prak, K., Nakatani, K., Katsube, T., Adachi, M., Maruyama, N. & Utsumi, S. (2005). Structure-function relationships of soybean proglycinins at subunit levels. J. Agric. Food Chem., 53, 3650-3657. Qu, L. J., Chen, Jun., Liu, M., Pan, N., Okamoto, H., Lin, Z., Li, C., Li, D., Wang, J., Zhu G., Zhao, X., Chen, X., Gu, H. & Chen, Z. (2003). Molecular cloning and functional analysis of a novel type of Bowman-Birk inhibitor gene family in rice. Plant Physiol, 133, 560570. Rabilloud, T., Adessi, C., Giraudel, A. & Lunardi, J. (1997). Improvement of the solubilization of proteins in two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis, 18, 307-316. Righetti, P. G. & Macelloni, C. (1982). New polyacrylamide matrices for drift-free isoelectric focusing. J. Biochem. Biophys. Methods, 6, 1-15. Renkema, J. M. S., Knabben, J. H. M. & Vliet, T. (2001). Gel formation by beta-conglycinin and glycinin and their mixtures. Food Hydrocolloids, 15, 407-414. Ruebelt, M. C., Lipp, M., Reynolds, T. L., Schmuke, J. J., Astwood, J. D., DellaPenna, D., Engel, K. H. & Jany, K. D. (2006). Application of two-dimensional gel electrophoresis to interrogate alterations in the proteome of genetically modified crops. 3. Assessing unintended effects. J. Agric. Food Chem., 54, 2169-2177. Saravanan, R. S. & Rose, J. K. (2004). A critical evaluation of sample extraction techniques for enhanced proteomic analysis of recalcitrant plant tissues. Proteomics, 4, 2522-2532.

Extraction and Characterization of Soybean Proteins

369

Schuster, A. M. & Davies, E. (1983). Ribonucleic-acid and protein metabolism in pea epicotyls.1. the aging process. Plant Physiol, 73, 809-816. Simpson, R. J. (2003). Preparative two-dimensional gel electrophoresis with immobilized pH gradients. In , Proteins and proteomics: A laboratory manual (Eds.) J., Inglis, J. Argentine, & M. Zierler, Oxford University Press, New York, 143-218. Song, J., Braun, G., Bevis, E. & Doncaster, K. (2006). A simple protocol for protein extraction of recalcitrant fruit tissues suitable for 2-DE and MS analysis. Electrophoresis, 27, 3144-3151. Taylor, R. S., Wu, C. C., Hays, L. G., Eng, J. K., Yates, J. R. I. & Howell, K. E. (2000). Proteomics of rat liver golgi complex: Minor proteins are identified through sequential fractionation. Electrophoresis, 21, 3441-3450. Takahashi, M., Uematsu, Y., Kashiwaba, K., Yagasaki, K., Hajika, M., Matsunaga, R., Komatsu, K. & Ishimoto, M. (2003). Accumulation of high levels of free amino acids in soybean seeds through integration of mutations conferring seed protein deficiency. Planta, 217, 577-586. Thanh, V. H. & Shibasaki, K. (1976). Heterogeneity of beta-conglycinin. Biochim. Biophys Acta, 181, 404-409. Tsugita, A., Kamo, M., Kawakami, T. & Ohki, Y. (1996). Two-dimensional electrophoresis of plant proteins and standardization of gel patterns. Electrophoresis, 17, 855-865. Tsuji, H. N., Okada, R., Yamanishi, N., Bando, M., Kimono. & Ogawa T. (1995). Measurement of Gly m Bd 30K, a major soybean allergen, in soybean products by a sandwich enzyme-linked immunosorbent assay. Biosci. Biotech. Biochem, 59, 150-151. Usuda, H. & Shimogawara, K. (1995). Phosphate deficiency in maize. Changes in the twodimensional electrophoretic patterns of soluble proteins from second leaf blades associated with induced senescence. Plant Cell Physiol, 36, 1149-1155. Utsumi, S., Matsumura, Y. & Mori, T. (1997). Structure-function relationships of soy proteins, In: Food proteins and their applications, (Eds.) S. Damodaran, & A. Paraf, Marcel Dekker, New York. 257-291. Vensel, W. H., Tanaka, C. K., Cai, N., Wong, J. H., Buchanan, B. B. & Hurkman, W. J. (2005). Developmental changes in the metabolic protein profiles of wheat endosperm. Proteomics, 5, 1594-1611. Wang, W., Scali, M. & Vignani, R., et al. (2003). Protein extraction for two-dimensional electrophoresis from olive leaf, a plant tissue containing high levels of interfering compounds. Electrophoresis, 24, 2369-2375. Wang, W., Vignani, R., Scali, M. & Cresti, M. (2006). A universal and rapid protocol for protein extraction from recalcitrant plant tissues for proteomic analysis. Electrophoresis, 27, 2782-2786. Wang, X. , Li, X., Deng, X., Han, H., Shi, W. & Li, Y. (2007). A protein extraction method compatible with proteomic analysis for the euhalophyte Salicornia europaea. Electrophoresis, 28, 3976-3987. Warner, M. H. & Wemmer, D. E. (1991). 1H Assignments and secondary structure determination of the soybean trypsin/chymotrypsin Bowman-Birk inhibitors. Biochemistry, 30, 3356-3364. Watson, B. S., Asrivatham, V. S., Wang, L. & Sumner, L. W. (2003). Mapping the proteome of Barrel Medic. Plant Physiol, 131, 1104-1123.

370

Savithiry S. Natarajan and Devanand L. Luthria

Weiss, W. & Gorg, A. (2007). Two-dimensional electrophoresis for plant proteomics: Methods in Molecular Biology, vol. 355, (Eds) H., Thiellement, M., Zivy, C. Damerval, & V. Méchin © Humana Press Inc., Totowa, NJ. Wong, J. H., Cai, N. & Balmer. Y. et al. (2004). Thioredoxin targets of developing wheat seeds identified by complementary proteomic approaches. Phytochemistry, 65, 16291640. Wright, D. J. (1987). The seed globulins. In: Developments in Food proteins 5. (Eds.) B. J. F. Hudson, Elsevier Applied Science, London and New York, 81-157. Xu, C., Garrett, W. M., Sullivan, J., Caperna, T. J. & Natarajan, S. (2006). Separation and identification of soybean leaf proteins by two dimensional gel electrophoresis and mass spectrometry. Phytochemistry, 67, 2431-2440. Yagasaki, K. Takagi, T., Sakai, M. & Kitamura, K. (1997). Biochemical characterization of soybean protein consisting of different subunits of glycinin. J. Agric. Food Chem., 45, 656-660. Yan, J. X., Harry, R. A., Spibey, C. & Dunn, M. J. (2000a). Post-electrophoresis staining of proteins by two dimensional gel electrophoresis using SYPRO dyes. Electrophoresis, 21, 3657-3665. Yan, J. X., Walt, R., Berkelman, T., Harry, R. A., Westbrook, J. A., Wheller, C. H. & Dunn, M. J. (2000b). A modified silver staining protocol for visualization of proteins compatible with matrix-assisted laser desorption /ionization and electrospray ionizationmass-spectrometry. Electrophoresis, 21, 3666-3672. Yates, J. R. (1993). Mass spectrometry and the age of the proteome. Journal of mass spectrometry, 33, 1-19. Zarkadas, C. G., Gagnon, C., Gleddie, S., Khanizadeh, S., Cober, E. R. & Guillemette, R. J. D. (2007). Assessment of the protein quality of fourteen soybean [Glycine max (L.) cultivars using amino acid analysis, and two-dimensional gel electrophoresis. Food Research International, 40, 128-146. Zivy, M., Thiellement, D., Vienne, De. & Hofmann, J. P. (1983). Study on nuclear and cytoplasmic genome expression in wheat by two-dimensional gel electrophoresis. Theor Appl Genet, 66, 1-7.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 14

SOYBEAN OIL IN HEALTH AND DISEASE Cristina M. Sena* and Raquel M. Seiça Faculty of Medicine, University of Coimbra, Portugal

ABSTRACT This review provides a scientific assessment of current knowledge of health effects of soybean oil (SO). SO is one of the few non-fish sources of omega-3 fatty acids and the primary commercial source of vitamin E in the U.S. diet. SO contains high levels of polyunsaturated fatty acids (PUFAs, 61 %), including the two essential fatty acids, linoleic and linolenic, that are not produced in the body. Linoleic and linolenic acids helps the body's absorption of vital nutrients and are required for human health. The PUFAs positively affect overall cardiovascular health, including reducing blood pressure and preventing heart disease. Epidemiological evidence has suggested an inverse relationship between the consumption of diets high in vegetable fat and cardiovascular risk factors such a blood pressure, although clinical findings have been inconclusive. In an experimental animal model of diabetes, SO has been described to ameliorate lipid profile and improved glycemic control. Soybean oil contains natural antioxidants which remain in the oil even after extraction. Soybean oil also contains lecithin which lowers blood levels of cholesterol. As a result, the replacement of saturated fats with reasonable amounts of polyunsaturated fats, such as those found in soybean oil, may be useful in the dietary guidelines but the health claims remain controversial.

INTRODUCTION Soybean oil (SO) is the most readily available and one of the lowest-cost vegetable oils in the world (Markley, 1951; United Soybean Board, 2008). It accounts for about 30% of the world's vegetable oil market (Rebetzke et al. 1998).

*

Corresponding author: Email: csena @ ci.uc.pt, Physiology, Sub-unidade 1, Pólo III Faculty of Medicine, University of Coimbra Azinhaga de Santa Comba, Celas 3000-504 Coimbra Telephone: +351-239-480013 Fax: +351-239-480034.

372

Cristina M. Sena and Raquel M. Seiça

Soybean oil does not contain much saturated fat. Like all other oils from vegetable origin, soybean oil contains no cholesterol. Saturated fat and cholesterol cause heart diseases and are mainly found in products from animal origin. Unrefined soybean oil is one of the richest sources of lecithin (3 %). Soybean oil also contains natural antioxidants which remain in the oil even after extraction. These antioxidants help to prevent the oxidative rancidity.

Food Use of Soybean Oil Soybean oil is used by the food industry in a variety of food products. The balanced fatty acid profile and neutral flavor make soybean oil a favorite for commercial salad dressings and light frying applications. So it is also one of the major cooking oils around in the world. The high smoke point of soybean oil allows it to be used as frying oil. Soybean oil is often hydrogenated to increase its shelf life or to produce a more solid product. In this process, unhealthy trans-fats are produced which may raise blood cholesterol levels and increase the risk of heart disease. Food manufacturers are now trying to remove trans-fats from their product. For this purpose, they are breeding new varieties of soybeans containing oil that does not need to be hydrogenated.

Composition Soybean oil is a triglyceride derived from soybean rich in C-18 unsaturated components, namely linoleic and oleic acids. SO is low in saturated fat (15%), contains no trans-fat and is high in monounsaturated fat (24 %) and polyunsaturated fat (60 %; Perkins, 1995; Table 1). The fatty acid constituents of soybean oil are mainly oleic (C18:1), linoleic (C18:2) and linolenic (C18:3) acids. Though the relative distribution of fatty acids is largely dependent on the seed type and its genetic makeup, soybean oil typically contains the composition shown in Table 1. SO offers one of the few non-fish sources rich in omega-3 fatty acids essential for various body functions. It is the principal source of omega-3 fatty acids in the U.S. diet, and the primary commercial source of vitamin E as well (Huth, 1995). SO contains high amounts of tocopherols, coenzyme Q (Carpenter, 1979; Eitenmiller, 1997; Sena et al., 2008b) and other antioxidants such as bioflavonoids and aromatic compounds (Lee et al., 2000; Cabrini et al., 2001). Soybean oil is also a dietary source of vitamin K (Booth and Centurelli, 1999). Soybean oil to be used for human consumption needs to pass through a series of processing treatment steps that include the refining, the bleaching and the deodorization steps. The deodorization step produces a residue that is rich in vitamin E, hydrocarbons and sterols, principally campesterol, stigmasterol and  -sitosterol (Careri et al., 2001). Soybean oil also has phospholipids which are generally separated out in the refining process creating the by-product lecithin. Soy lecithin is a valuable by-product of soybean oil processing. Lecithin acts as an emulsifier, making it possible to produce stable blends of fats and water in foods. Lecithin also lowers blood levels of cholesterol (Jimenez et al., 1990; Spilburg et al., 2003).

Soybean Oil in Health and Disease

373

Table 1. Fatty acid composition (%) of soybean oil

Ohara N. et al. 2008

Fatty acid 14:0 16:0 18:0 18:1 18:2 18:3 20:0 20:1 22:0

Myristic acid Palmitic acid Stearic acid Oleic acid Linoleic acid Linolenic acid Arachidic acid Eicosaenoic acid Behenic acid

Soybean oil 0.1 10.5 3.6 23.2 54.5 7.2 0.3 0.2 0.4

Omega-3 and Omega-6 Fatty Acids Soybean oil is one of the few non-fish sources of omega-3 polyunsaturated fatty acids, which have various physiological benefits including cardioprotective effects. While fish oil is the preferred source of omega-3s because of the bioavailability of eicosapentaenoic (EPA) and docosahexaenoic acid (DHA), the -linolenic acid (ALA) in soybean oil is the principal source of omega-3s in the American diet. Dietary omega-3 polyunsaturated fatty acids have a proven role in reducing the risk of cardiovascular disease and precursor disease states such as metabolic syndrome (Calder, 2006; Psota et al., 2006; Mozaffarian, 2008). Containing about 50 percent of omega-6 fatty acids, soybean oil is one of the most concentrated sources of this polyunsaturated fat. Omega-6 fatty acids, found naturally in soybean oil, may also decrease the risk of heart disease (Willett, 2007; Harris et al., 2009). Whereas omega-6 fatty acids generally exert their cardioprotective effects through changes in lipids and lipoproteins, omega-3 fatty acids contribute benefits through their anti-arrhythmic, anti-inflammatory, and anti-thrombotic effects (Wijendran et al., 2004) Furthermore, linoleic acid is needed for normal immune response and essential fatty acid deficiency impairs B and T cell-mediated responses. SO can provide adequate linoleic acid for the maintenance of the immune response although it has been previously reported that soybean oil (in which the ratio of n-3 to n-6 is 1:7) cannot reverse IL-1-induced inflammatory changes (Meydani et al., 1991; Song et al., 2004). Linoleic acid is the metabolic precursor of arachidonic acid (and eicosanoids derived from arachidonic acid), and some concern has been raised that dietary linoleic acid could increase arachidonic acid content and eicosanoid formation in the body and thereby promote cancers, cardiovascular disease, inflammation, and related disorders (Schaefer et al., 2007; Chiu et al., 2009). Arachidonic acid has also been shown to increase aromatase activity, thus increasing circulating estrogen (Richards et al., 2002). Excess linoleic acid has supported tumor growth in animals, an effect not verified by data from diverse human studies of risk, incidence, or progression of cancers of the breast and colon (Meydani et al., 1991; Sakaguchi et al., 1984; Rao et al., 2001). A balance between omega-3 and omega-6 fatty acid intakes is very important because these fatty acids compete for the same enzyme systems involved in elongation and

374

Cristina M. Sena and Raquel M. Seiça

desaturation to synthesize the longer-chain, more unsaturated, and more biologically active fatty acids (Brenna et al., 2009; Russo, 2009). They also compete for cyclooxygenases and lipoxygenases involved in the production of prostaglandins and leukotrienes that mediate a range of cell functions important to cardiovascular function, including vasodilation and vasoconstriction, cellular adhesion processes, inflammatory responses, and platelet aggregation (Chan et al., 1993; Wijendran et al., 2004). Competition between omega-3 and omega-6 fatty acids for cyclooxygenases and lipoxygenases will therefore determine the physiologic effects that will dominate. It has been previously recommended an optimal ratio of omega-6 to omega-3 ratio of two to one (2.3:1) or lower (Simopoulos, 2002).

Cardiovascular Disease It has been previously described that soy protein intake significantly decreased LDLcholesterol levels and has the potential to reduce risk for coronary heart disease by 18 to 28 percent (Anderson, 1995). Furthermore, dietary soybean has positive effects on lipid and glucose levels and cardiovascular risk markers (Hermansen et al., 2001; Omoni and Aluko, 2005; Retelny et al., 2008; Torre-Villalvazo et al., 2009). But the positive effect of the soybean on heart health is not solely due to the protein and its related compounds; the fats that are found naturally in the soybean also can contribute to a reduction in cholesterol levels. It is understood now that oils that are high in unsaturated fatty acids, such as soybean oil, tend to decrease total serum cholesterol levels. Soybean oil contains about 50 percent linoleic acid and about 8 percent linolenic acid (table 1). Both seem to have cardioprotective effects as discussed above. ALA has been the subject of numerous studies that link its consumption with a decreased incidence of heart disease and cancer (Zhao et al., 2004). A recent report has shown that rapid declines in the rate of mortality from coronary heart disease in Eastern Europe are associated with increased consumption of linolenic acid (Zatonski et al., 2008). Moreover, it has recently been shown that the replacement of partially hydrogenated vegetable oils with soybean oil would substantially lower coronary heart disease risk (Mozaffarian and Clarke, 2009). Researchers are currently developing soybeans with increased amounts of stearidonic acid, EPA and DHA omega-3 fatty acids to meet the growing demand for healthier ingredients (Harris et al., 2008; Hunter et al., 2010). Based on cohort studies, it is known that vegetable oils are generally considered better alternatives than animal fats. In addition to effects on total cholesterol/HDL-cholesterol (KrisEtherton et al., 1993), ApoB/ApoAI, Lp(a) and C reactive protein (CRP), cis unsaturated fats in vegetable oils may have beneficial effects on other pathways related to cardiovascular risk, such as insulin sensitivity (Summers et al., 2002; Mostad et al., 2006; Paniagua et al., 2007) and endothelial function (Perez-Jimenez et al., 1999; Nicholls et al., 2006), in comparison with animal fats. Due to its content in omega-3 fatty acids (ALA), it may further contribute to the lowering of coronary heart disease risk independently of effects on blood lipids, lipoproteins or CRP (Mozaffarian, 2005). Although other studies have reported that SO has an acute detrimental effect over the endothelial function in healthy young subjects (RuedaClausen et al., 2007). We have also described that although SO decreased plasma levels of cholesterol (total and non-HDL) and triglycerides, it had no effect on endothelial dysfunction observed in an aged animal model of type 2 diabetes with hyperlipidemia (Sena et al., 2008a).

Soybean Oil in Health and Disease

375

Supplementation with soybean oil caused moderate effects on blood pressure and glomerular protection in hypertensive rats when compared to other oils (Aguila et al., 2005). A recent study reported a downregulation of adiponectin expression by dietary enrichment with soybean oil that may contribute to the development of insulin resistance and atherosclerosis (Bueno et al., 2008).

Vitamin E and phytosterols in soybean oil Soybean oil is the primary commercial source of alpha-tocopherol, also known as vitamin E. Vitamin E is the body‘s primary lipid-soluble antioxidant defense against free radical induced cell damage, which has been linked to a number of cancers, heart disease, cataracts, premature aging and arthritis (Tucker & Townsend, 2005; Basu et al., 2007; Galli & Azzi, 2010). Soybean oil contains a number of phytosterols including ß-sitosterol, campesterol and stigmasterol (Careri et al., 2001). Phytosterols are plant steroid-like compounds similar to cholesterol and characterized by anti-carcinogenic and cholesterol-lowering properties (Weingärtner et al., 2009). In particular, ß-sitosterol and its hydrogenated and esterified derivatives, known as sitostanol esters, have been shown to reduce serum cholesterol and LDL cholesterol by up to 10 percent without decreasing levels of the beneficial HDL cholesterol. It has been previously described that SO, containing only 27% campesterol, produced an increase in serum campesterol of 9.5 nmol/ml in 6 weeks (Clifton et al., 2008). These sterols are able to reduce serum LDL and probably account for the beneficial effects described in the literature. Soybean oil provides 327 mg of phytosterols per 100 grams and is a common source of phytosterol preparations. A number of margarines, spreads and salad dressing products containing ß-sitosterol or sitostanol esters are being marketed as cholesterollowering products. Consumption of plant sterol esters reduces plasma LDL cholesterol concentration by inhibiting intestinal cholesterol absorption (Rasmussen et al., 2006 Carr et al., 2009). However, recently released guidelines are more critical of food supplementation with phytosterols and draw attention to significant safety issues. Clearly, there is no data available indicating that functional foods supplemented with phytosterols reduce cardiovascular events. Prospective clinical studies testing relevant clinical endpoints are needed before a diet supplementation with plant sterol esters can be recommended (Weingärtner et al., 2009). Monosaturated fatty acids Lipids based on soybean oil are traditionally used as nutritional support for surgical or critical patients (Calder, 2003; Nishimura et al., 2005). The soybean oil lipid emulsions were developed in efforts to provide essential fatty acids and non-glucose energy (Ohkawa et al., 2008). However, some concerned has been raised due to the high polyunsaturated fatty acid content. Polyunsaturated fatty acids are particularly susceptible to lipid peroxidation, are proinflammatory, and have been associated with negative effects on the immune and hepatobiliary systems (Stanley, 2007). It has recently been suggested that using lipid emulsions containing a high content of monounsaturated fatty acids (80% olive oil and 20% soybean oil) may have favorable effects on lipid peroxidation and oxidative stress, immune and inflammatory responses, and hepatobiliary function relative to other lipid emulsions (Pontes-Arruda, 2009).

376

Cristina M. Sena and Raquel M. Seiça

Diabetes and Insulin Secretion We have previously shown that after 8 weeks of treatment with soybean oil, young GotoKakizaki (GK) rats had a significant decrease in glycated haemoglobin accompanied by a significantly decrement in fasting blood glucose levels (Sena et al., 2008b). The improved diabetic profile is probably due to the soybean oil antioxidant composition, namely tocopherol and coenzyme Q. Moreover, it has recently been described that dietary phytoestrogens activate AMP-activated protein kinase with an improvement in lipid and glucose metabolism (Cederroth et al., 2008), thus other constituents may be involved. It has also been shown by Zhang and co-workers (2007) that a post-weaning isocaloric hypersoybean oil versus a hypercarbohydrate diet reduced body weight, body fat content, as well as blood lipid, glucose, insulin and leptin levels in male Wistar rats. Furthermore, another study (Naziroglu and Brandsch, 2006) showed that the excretion of triacylglycerol and cholesterol in feces were higher in soybean-oil treated Sprague-Dawley rats. There are also descriptions of anti-inflammatory effects for soybean oil (Wohlers et al., 2003; Wohlers et al., 2005). In 90% of pancreatectomized diabetic rats fermented, unsalted soybeans seem to improve the diabetic profile of these rats by enhancing insulin secretion through the enhancement of insulin/IGF-1 signaling in the pancreatic islets, when compared to cooked soybeans (Kwon et al., 2007). An increased consumption of n-3 PUFA, coupled with a reduced intake of saturated fat has been suggested to reduce the risk of conversion from impaired glucose tolerance to type 2 diabetes in overweight patients (Nettleton & Katz, 2005). However, there is controversial evidence regarding the effects of soybean (oil, diet, protein) treatment. Previous observations have showed that soya-containing diets were associated with reduced insulin release on glucose challenge and anti-diabetic outcomes (Rees et al. 2006b; Kwon et al., 2010). Some studies with normal rats on a SO diet reported an increase in body weight and fat gain as well as an impairment of glucose tolerance (Stark et al., 2000) and insulin resistance (Pellizzon et al., 2002; Jen et al., 2003). However, a rise of glucose-stimulated insulin secretion was also observed (Picinato et al., 1998). We have previously investigated the effect of sub-chronic (7 days) SO treatment on the insulin secretion and fatty acid composition of islets of Langerhans obtained from GK rats, a model of type 2 diabetes, and normal Wistar rats (Nunes et al., 2007). We showed that in normal Wistar rats, SO treatment induces insulin resistance and islet insulin secretion failure, which is in accordance with previous studies (Pellizzon et al., 2002; Jen et al., 2003; Xiao et al., 2006). Soybean-treated diabetic rats presented an increase in plasma non-fasting free fatty acids, an exacerbation of islet insulin secretion impairment and a significant decrease in the monounsaturated palmitoleic acid. Altogether our results show that SO treatment results in a decrease of insulin secretion and alterations on fatty acid composition in normal and diabetic islets, suggesting that SO could have a deleterious effect on β-cell function and insulin sensitivity (Nunes et al., 2007). It has also been shown that the amount of protein and the type of oil used in the maternal diet interact to produce long-lasting changes in the insulin axis of the offspring. These results suggest that this ratio of n-3 to n-6 PUFA in the maternal diet modifies the programming of the insulin axis during fetal development (Maloney et al., 2007).

Soybean Oil in Health and Disease

377

Cancer Epidemiological studies, animal experiments and human trials have demonstrated an inverse association between diets containing high amounts of soybean products and low cancer incidence and mortality rates, particularly breast, colon and prostate cancer (Barns et al., 1990; Fournier et al., 1998). Although the specific components that are responsible for this chemopreventive activity remain to be identified, several constituents isolated from soybeans have demonstrated biological activities that are consistent with efficacy in cancer prevention (Messina and Flickinger, 2002; Isanga and Zhang, 2008). Many researchers have described that isoflavones have anti-carcinogenic effects mainly attributed to their long-term estrogenic effects and their antioxidant activity (McCue and Shetty, 2004; MacDonald et al., 2005). These natural products demonstrate numerous biological activities, interact with various enzymes and receptor systems of pharmacological significance, and have potential applications in both cancer therapy and in cancer chemoprevention. Flavonoid natural products demonstrate anti-viral, anti-inflammatory, antiallergic, anti-mutagenic and anti-carcinogenic activities (Shao et al., 1998; McCue and Shetty, 2004). Soybean contains high levels of phytoestrogens. Among them, genistein is recognized as an antioxidant and cell-cycle inhibitor. In experiments on human prostate cancer cells, genistein has been shown to inhibit cell proliferation. In addition, genistein has been shown to inhibit angiogenesis, or new tumor vessel growth, thereby slowing the progression of existing cancer (Montironi et al., 1999; Bylund et al., 2000). However, timing and length of consumption of genistein as well as gender- and colon site-specific activity may result in beneficial or detrimental effects. However, soy itself enhances COX-2 and reduces Bax, but only in females. This suggests detrimental activity of an unknown component of soy triggered by a high-estrogen background (Bises et al., 2007). Phytosterols are characterized by an anti-carcinogenic effect (Sakamoto et al., 2009). βSitosterol and campesterol are the predominant phytosterols in blood. Researchers in Uruguay who conducted a small case cohort study suggested an association between dietary sterol intake and decreased risk for the development of gastrointestinal cancers (De Stefani et al., 2000); while a subsequent large-scale study from the Netherlands reported that high dietary intake of plant sterols was not associated with a lower risk of colon and rectal cancers (Normén et al., 2000). It has recently been reported that -sitosterol enhances tamoxifen effectiveness on breast cancer cells by affecting ceramide metabolism (Awad et al., 2008). Despite the discrepancies, phytosterols seem to act through multiple mechanisms of action, including inhibition of carcinogen production, cancer-cell growth, angiogenesis, invasion and metastasis, and through the promotion of apoptosis of cancerous cells (Sakamoto et al., 2009). Phytosterol consumption may also increase the activity of antioxidant enzymes and thereby reduce oxidative stress (Woyengo et al., 2009). The fatty acid profile of soybean oil is suggestive of an unfavorable impact on breast cancer risk, but it must be combined with more direct evidence since different combinations of the same fatty acids can have different effects. Animal models of chemically-induced colonic carcinogenesis have shown that the type of fat is important. Polyunsaturated vegetable oils rich in ω-6 fatty acids have a promotional role whereas fish oil rich in ω-3 fatty acids has no promotional effect and may even inhibit tumor formation (Ma et al., 1996). The protective effect on breast cancer risk of omega-3 fatty acids depends in part on the relative

378

Cristina M. Sena and Raquel M. Seiça

level of omega-6 fatty acids (Maillard et al., 2002), with a recommended omega-6 to omega-3 ratio of two to one (2:1) or lower. Lower ratios increase endogenous conversion of ALA to EPA and DHA (Hunter et al., 2010). However, the ratio of omega-6 to omega-3 fatty acids in soybean oil is 7:1. There are only a few studies evaluating the impact of soybean oil on breast cancer. Soybean oil is often used to compare with other oils. In one of these studies, researchers found that the incidence of carcinogen-induced mammary tumors was higher in rats on a diet supplemented with 10% soybean oil than those on a 10% perilla oil diet (Hirose et al., 1990). It has been previously shown that soybean oil did not affect the growth of human breast cancer and liver cancer cell lines when compared with fish oil (Ueda et al., 2008). Population studies specifically examining the impact of soybean oil on the risk of breast cancer are also relatively rare. Asian studies have focused on the carcinogenic effects of the fumes and smoke generated by cooking oils. Soybean oil has been found to form 4-hydroxy2-trans-nonenal, a mutagenic and cytotoxic product of the peroxidation of linoleic acid, when heated to 365 ºF, suggesting that soybean oil should not be used for deep frying (Chen et al., 2001). The study found that soybean oil generated a greater amount of carcinogenic polycyclic aromatic hydrocarbons in the smoke during heating than canola oil or sunflower oil. Breathing fumes and smoke from cooking soybean oil has been found to be associated with higher risk of lung cancer in several Chinese studies (Chen et al., 2001). US researchers examined the association between the type of fat used in cooking and the risk of breast cancer and found that women cooking primarily with vegetable/corn oil (both rich in linoleic acid) had a 30% higher risk of breast cancer than women normally using olive/canola oil (both rich in oleic acid). The authors conclude that a low-fat diet may play a role in breast cancer prevention. They further speculate that monounsaturated trans-fats may have driven the discrepant associations between types of fat and breast cancer (Wang et al., 2008). It has recently been reported that high fat diets and high trans-monounsaturated fatty acids are associated with an increased breast cancer risk in women (Schulz et al., 2008; Chajès et al., 2008).

CONCLUSION The increasing use of vegetable oils, including corn oil, and soybeans has markedly changed the PUFA composition of human diets in the past 100 years (Simopoulos, 1999). Soybean oil consumption can interfere with warfarin (coumadin) and other bloodthinning therapy due to its content in vitamin K (Booth and Centurelli, 1999). Partially-hydrogenated soybean oil, found in many processed foods and restaurant meals, is to be avoided. Hydrogenation increases hardness and stabilizes fats, increasing product shelf life and decreasing refrigeration requirements. Partial hydrogenation results in the formation of trans-fatty acids, which are known to increase LDL cholesterol and lower HDL cholesterol, thereby increasing cardiovascular disease risk factors. Consumption of trans-fatty acids was also found to be associated with increased breast cancer risk. The top priorities for soybean oil modifications include the reduction of saturated fats (<7%) and linolenic acids (<3%) and the increment in oleic (> 50%) and stearic acids (>50

Soybean Oil in Health and Disease

379

%). These can be achieved by genetic manipulation and can overcome some of the major problems previously described for the oil (Skeaff, 2009) Furthermore, since that tocopherols and phytosterols have significant health effects through controlling serum cholesterol levels and reducing the risk of cancer, a higher amount of these compounds in vegetable soybean oil could be achieved by genetic manipulation (Wilson, 1991). Altogether, these changes can promote more nutritious vegetable-type soybean oil and its incorporation into human diets could reduce the risk of cardiovascular heart diseases and cancer.

REFERENCES Aguila, M. B., Pinheiro, A. R., Aquino, J. C. F., Gomes, A. P. & Mandarim-de-Lacerda, C. A. (2005). Different edible oil beneficial effects (canola oil, fish oil, palm oil, olive oil, and soybean oil) on spontaneously hypertensive rat glomerular enlargement and glomeruli number. Prostaglandins & Other Lipid Mediators, 76, 74-85. Anderson, J. W, Johnstone, B. M. & Cook-Newell, M. E. (1995). Meta-analysis of the effects of soy protein intake on serum lipids. New England Journal of Medicine, 333, 276-282. Awad, A. B., Barta, S. L., Fink, C. S. & Bradford, P. G. (2008). beta-Sitosterol enhances tamoxifen effectiveness on breast cancer cells by affecting ceramide metabolism. Molecular Nutrition & Food Research, 52, 419-426. Barnes, S., Grubbs, C., Setchell, K. D. & Carlson, J. (1990). Soybeans inhibit mammary tumors in models of breast cancer. Progress in Clinical & Biological Research, 347, 239253. Basu, A., Grossie, B., Bennett, M., Mills, N. & Imrhan, V. (2007). Alpha-tocopheryl succinate (a-TOS) modulates human prostate LNCaP xenograft growth and gene expression in BALB/c nude mice fed two levels of dietary soybean oil. European Journal of Nutrition, 46, 34-43. Bises, G., Bajna, E., Manhardt, T., Gerdenitsch, W., Kallay, E. & Cross, H. S. (2007). Gender-specific modulation of markers for pre-malignancy by nutritional soy and calcium in the mouse colon. Journal of Nutrition, 137, 211S-215S. Booth, S. L. & Centurelli, M. A. (1999). Vitamin K: a practical guide to the dietary management of patients on warfarin. Nutrition Research, 57, 288-296. Brenna, J. T., Salem, N., Sinclair, A. J. & Cunnane, S. C. (2009). -Linolenic acid supplementation and conversion to n-3 long-chain polyunsaturated fatty acids in humans. Prostaglandins, Leukotrienes and Essential Fatty Acids, 80, 85-91. Bueno, A. A., Oyama, L. M., De Oliveira, C., Pisani, L. P., Ribeiro, E. B., Silveira, V. L. F. & Oller Do Nascimento, C. M. (2008). Effects of different fatty acids and dietary lipids on adiponectin gene expression in 3T3-L1 cells and C57BL/6J mice adipose tissue. Pflugers Archiv European Journal of Physiology, 455, 701-709. Bylund, A., Zhang, J. X., Bergh, A., Damber, J. E., Widmark, A., Johansson, A., Adlercreutz, H., Aman, P., Shepherd, M. J. & Hallmans, G. (2000). Rye bean and soy protein delay growth and increase apoptosis of human LNCaP prostate adenocarcinoma in nude mice. Prostate, 42, 304-314.

380

Cristina M. Sena and Raquel M. Seiça

Cabrini, L., Barzanti, V., Cipollone, M., Fiorentini, D., Grossi, G., Tolomelli, B., Zambonin, L. & Landi, L. (2001). Antioxidants and total peroxyl radical-trapping ability of olive and seed oils. Journal of Agricultural and Food Chemistry, 49, 6026-6032. Calder, P. C. (2003). Long-chain n-3 fatty acids and inflammation: potential application in surgical and trauma patients. Brazilian Journal of Medical and Biological Research, 36, 433-446. Calder, P. C. (2006). Polyunsaturated fatty acids and inflammation. Prostaglandins, Leukotrienes and Essential Fatty Acids, 75, 197-202. Careri M., Elviri L. & Mangia A. (2001). Liquid Chromatography-UV Determination and Liquid Chromatography atmospheric Pressure Chemical Ionization Mass Spectrometric Characterization of Sitosterol and Stigmasterol in Soybean Oil. Journal of Chromatography A, 935, 249-257. Carpenter, A. P. (1979). Determination of Tocopherols in Vegetable Oils. Journal of the American Oil Chemists Society, 56, 668-671. Carr, T. P., Krogstrand, K. L. S., Schlegel, V. L. & Fernandez M. L. (2009). StearateEnriched Plant Sterol Esters Lower Serum LDL Cholesterol Concentration in Normoand Hypercholesterolemic Adults. Journal of Nutrition, 139, 1445-1450. Cederroth, C. R., Vinciguerra, M., Gjinovci, A., Kühne, F., Klein, M., Cederroth, M., Caille, D., Suter, M., Neumann, D., James, R. W., Doerge, D. R., Wallimann, T., Meda, P., Foti, M., Rohner-Jeanrenaud, F., Vassalli, J. D. & Nef, S. (2008). Dietary phytoestrogens activate AMP-activated protein kinase with improvement in lipid and glucose metabolism. Diabetes, 57, 1176-1185. Chajès, V., Thiébaut, A. C., Rotival, M., Gauthier, E., Maillard, V., Boutron-Ruault, M. C., Joulin, V., Lenoir, G. M. & Clavel-Chapelon, F. (2008). Association between serum trans-monounsaturated fatty acids and breast cancer risk in the E3N-EPIC Study. American Journal of Epidemiology, 167, 1312-1320. Chan, J. K., McDonald, B. E., Gerrard, J. M., Bruce, V. M., Weaver, B. J. & Holub, B. J. (1993). Effect of dietary alpha-linolenic acid and its ratio to linoleic acid on platelet and plasma fatty acids and thrombogenesis. Lipids, 28, 811-817. Chen, B. H. & Chen, Y. C. (2001) Formation of Polycyclic Aromatic Hydrocarbons in the Smoke from Heated Model Lipids and Food Lipids. Journal of Agricultural and Food Chemistry, 49, 5238-5243. Chiu, W. C., Wang, Y. C., Chien, Y. W., Hou, Y. C., Hu, Y. M. & Yeh, S. L. (2009). Effects of dietary fish oil supplementation on cellular adhesion molecule expression and tissue myeloperoxidase activity in hypercholesterolemic mice with sepsis. Journal of Nutrition Biochemistry, 20, 254-260. Clifton, P. M., Mano, M., Duchateau, G. S. M. J. E., van der Knaap, H. C. M. & Trautwein, E. A. (2008). Dose-response effects of different plant sterol sources in fat spreads on serum lipids and C-reactive protein and on the kinetic behavior of serum plant sterols. European Journal of Clinical Nutrition, 62, 968-977. De Stefani, E., Boffetta, P., Ronco, A. L., Brennan, P., Deneo-Pellegrini, H., Carzoglio, J. C. & Mendilaharsu, M. (2000). Plant Sterols and Risk of Stomach Cancer: A Case-Control Study in Uruguay. Nutrition Cancer, 37, 140-144. Eitenmiller, R. R. (1997). Vitamin E Content of Fats and Oils – Nutritional Implications. Food Technology, 51, 78-81.

Soybean Oil in Health and Disease

381

Fournier, D. B., Erdman, J. W. & Gordon, G. B. (1998). Soy, its components, and cancer prevention: A review of the in vitro, animal and human data. Cancer Epidemiological Biomarkers Preview, 7, 1055-1065. Galli, F. & Azzi, A. (2010). Present trends in vitamin E research. Biofactors, 36, 33-42. Harris, W. S., Lemke, S. L., Hansen, S. N., Goldstein, D. A., DiRienzo, M. A., Su, H., Nemeth, M. A., Taylor, M. L., Ahmed, G. & George, C. (2008). Stearidonic acidenriched soybean oil increased the omega-3 index, an emerging cardiovascular risk marker. Lipids, 43, 805-811. Harris, W. S., Mozaffarian, D., Rimm, E., Kris-Etherton, P., Rudel, L. L., Appel, L. J., Engler, M. M., Engler, M. B. & Sacks, F. (2009). Omega-6 Fatty Acids and Risk for Cardiovascular Disease. Circulation, 119, 902-907. Hermansen, K., Sondergaard, M., Hoie, L., Carstensen, M. & Brock, B. (2001). Beneficial effects of soy-based dietary supplement on lipid levels and cardiovascular risk markers in type 2 diabetic subjects. Diabetes Care, 24, 228-233. Hirose, M., Masuda, A., Ito, N., Kamano, K. & Okuyama, H. (1990). Effect of dietary perilla oil, soybean oil and safflower oil on 7,12-dimethylbenzanthracene (DMBA) and 1, 2dimethylhydrazine (DMH)-induced mammary gland and colon carcinogenesis in female SD rats. Carcinogenesis, 11, 731-735. Hunter, J. E., Zhang, J. & Kris-Etherton, P. M. (2010). Cardiovascular disease risk of dietary stearic acid compared with trans, other saturated, and unsaturated fatty acids: a systematic review. American Journal of Clinical Nutrition, 91, 46-63. Huth, P. J. (1995). Nutritional aspects of soybean oil and protein. In: Erickson DR, ed. Practical handbook of soybean processing. Champaign, IL: AOCS Press and the United Soybean Board, 1995, 460-482. Isanga, J. & Zhang, G. N. (2008). Soybean bioactive components and their implications to health. Food Reviews International, 24, 252-276. Jen, K. L. C., Buison, A., Pellizzon, M., Ordiz, F. Jr., Santa Ana, L. & Brown, J. (2003). Differential effects of fatty acids and exercise on body weight regulation and metabolism in female Wistar rats. Experimental Biology and Medicine, 228, 843-849. Jimenez, M. A., Scarino, M. L., Vignolini, F. & Mengheri, E. (1990). Evidence that polyunsaturated lecithin induces a reduction in plasma cholesterol level and favorable changes in lipoprotein composition in hypercholesterolemic rats. Journal of Nutrition, 120, 659-667. Kris-Etherton, P. M., Derr, J., Mitchell, D. C., Mustad, V. A., Russell, M. E., McDonnell, E. T., Salabsky, D. & Pearson, T. A. (1993). The role of fatty acid saturation on plasma lipids, lipoproteins, and apolipoproteins: I. Effects of whole food diets high in cocoa butter, olive oil, soybean oil, dairy butter, and milk chocolate on the plasma lipids of young men. Metabolism, 42, 121-129. Kwon, D. Y., Daily, J. W. 3rd., Kim, H. J. & Park, S. (2010). Anti-diabetic effects of fermented soybean products on type 2 diabetes. Nutrition Research, 30, 1-13. Kwon, D. Y., Jang, J. S., Hong, S. M., Lee, J. E., Sung, S. R., Park, H. R. & Park, S. (2007). Long-term consumption of fermented soybean-derived Chungkookjang enhances insulinotropic action unlike soybeans in 90% pancreatectomized diabetic rats. European Journal of Nutrition, 46, 44-52. Lee, K. G., Mitchell, A. & Shibamoto, T. (2000). Antioxidative activities of aroma extracts isolated from natural plants. Biofactors, 13, 173-178.

382

Cristina M. Sena and Raquel M. Seiça

Ma, Q., Hoper, M., Halliday, I. & Rowlands, B. J. (1996). Diet and experimental colorectal cancer. Nutrition Research, 16, 413-426. MacDonald, R. S., Guo, J., Copeland, J., Browning, J. D. Jr., Sleper, D., Rottinghaus, G. E. & Berhow, M. A. (2005). Environmental influences on isoflavones and saponins in soybeans and their role in colon cancer. Journal of Nutrition, 135, 1239-1242. Maillard, V., Bougnoux, P., Ferrari, P., Jourdan, M. L., Pinault, M., Lavillonnière, F., Body, G., Le Floch, O. & Chajès, V. (2002). N-3 and N-6 fatty acids in breast adipose tissue and relative risk of breast cancer in a case-control study in Tours, France. International Journal of Cancer, 98, 78-83. Markley, K. S. (1951). Soybean and Soybean Products, Vol. 2, Interscience: New York, 1951. McCue, P. & Shetty, K. (2004). Health benefits of soy isoflavonoids and strategies for enhancement. Critical Reviews of Food Science and Nutrition, 44, 361-367. Messina, M. & Flickinger, B. (2002). Hypothesized anti-cancer effects of soy: Evidence points to isoflavones as the primary anticarcinogens. Pharmaceutical Biology, 40, 6-23. Meydani, S. N., Lichtenstein, A. H., White, P. J., Goodnight, S. H., Elson, C. E., Eoods, M., Gorbach S. L. & Schaefer, E. J. (1991). Food use and health effects of soybean and sunflower oils. Journal of the American College of Nutrition, 10, 406-428. Montironi, R., Mazzucchelli, R., Marshall, J. R. & Bartels, P. H. (1999). Prostate cancer prevention: review of target populations, pathological biomarkers, and chemopreventive agents. Journal of Clinical Pathology, 52, 793-803. Mozaffarian, D. & Clarke, R. (2009). Quantitative effects on cardiovascular risk factors and coronary heart disease risk of replacing partially hydrogenated vegetable oils with other fats and oils. European Journal of Clinical Nutrition, 63, S22-S33. Mozaffarian, D. (2005). Does alpha-linolenic acid intake reduce the risk of coronary heart disease? A review of the evidence. Alternative Therapies in Health and Medicine, 11, 2430. Mozaffarian, D. (2008). Fish and n-3 fatty acids for the prevention of fatal coronary heart disease and sudden cardiac death. American Journal of Clinical Nutrition, 87, 1991S1996S. Naziroglu, M. & Brandsch, C. (2006). Dietary hydrogenated soybean oil affects lipid and vitamin E metabolism in rats. Journal of Nutritional Science and Vitaminology (Tokyo), 52, 83-88. Nettleton, J. A. & Katz, R. (2005). n-3 long-chain polyunsaturated fatty acids in type 2 diabetes: a review. Journal of the American Dietetic Association, 105, 428-440. Nicholls, S. J., Lundman, P., Harmer, J. A., Cutri, B., Griffiths, K. A., Rye, K. A., Barter, P. J. & Celermajer, D. S. (2006). Consumption of saturated fat impairs the antiinflammatory properties of high-density lipoproteins and endothelial function. Journal of the American College of Cardiology, 48, 715-720. Nishimura, M., Yamauchi, A., Yamaguchi, M., Ueda, N. & Naito, S. (2005). Soybean oil in total parenteral nutrition maintains albumin and antioxidant enzyme mRNA levels. Biological & Pharmaceutical Bulletin, 28, 1265-1269. Normén, A. L., Brants, H. A., Voorrips, L. E., Andersson, H. A., van den Brandt, P. A. & Goldbohm, R. A. (2000). Plant sterol intakes and colorectal cancer risk in the Netherlands Cohort Study on Diet and Cancer. American Journal of Clinical Nutrition, 74, 141-148.

Soybean Oil in Health and Disease

383

Nunes, E., Peixoto, F., Louro, T., Sena, C. M., Santos, M. S., Matafome, P., Moreira, P. I. & Seiça, R. (2007). Soybean oil treatment impairs glucose-stimulated insulin secretion and changes fatty acid composition of normal and diabetic islets. Acta Diabetologia, 44, 121130. Ohara, N., Kasama, K., Naito, Y., Nagata, T., Saito, Y., Kuwagata, M. & Okuyama, H. (2008). Different effects of 26-week dietary intake of rapeseed oil and soybean oil on plasma lipid levels, glucose-6-phosphate dehydrogenase activity and cyclooxygenase-2 expression in spontaneously hypertensive rats. Food and Chemical Toxicology, 46, 25732579. Ohkawa, H., Fukuwa, C., Matsuzawa-Nagata, N., Yokogawa, K., Omura, K. & Miyamoto, K. (2008). Soybean fat supplementation controls insulin resistance caused by fat-free total parenteral nutrition. Journal of Pharmacy and Pharmacology, 60, 461-465. Omoni, A. O. & Aluko, R. E. (2005). Soybean foods and their benefits: potential mechanisms of action. Nutrition Reviews, 63, 272-283. Paniagua, J. A., de la Sacristana, A. G., Sanchez, E., Romero, I., Vidal-Puig, A. , Berral, F. J., Escribano, A., Moyano, M. J., Peréz-Martinez, P., López-Miranda, J. & Pérez-Jiménez, F. (2007). A MUFA-rich diet improves postprandial glucose, lipid and GLP-1 responses in insulin-resistant subjects. Journal of the American College of Nutrition, 26, 434-444. Pellizzon, M., Buison, A., Ordiz, F. Jr., Santana Ana, L. & Jen, K. L. (2002). Effects of dietary fatty acids and exercise on body weight regulation and metabolism in rats. Obesity Research, 10, 947-955. Pérez-Jiménez, F., Castro, P., López-Miranda, J., Paz-Rojas, E., Blanco, A., López-Segura, F., Velasco, F., Marín, C., Fuentes, F. & Ordovás, J. M. (1999). Circulating levels of endothelial function are modulated by dietary monounsaturated fat. Atherosclerosis, 145, 351-358. Perkins, F. G. (1995). Composition of soybeans and soybean products. In: D. R. Erikson, ed. Practical handbook of soybean processing and utilization. Champaign, IL: AOSC Press and United Soybean Board, 22-3. Picinato, M. C., Curi, R., Machado, U. F. & Carpinelli, A. R. (1998). Soybean- and olive-oilsenriched diets increase insulin secretion to glucose stimulus in isolated pancreatic rat islets. Physiology & Behavior, 65, 289-294. Pontes-Arruda, A. (2009). Biological benefits of an oleic acid–rich lipid emulsion for parenteral nutrition. Clinical Nutrition Supplements, 4, 19-23 Psota, T. L., Gebauer, S. K. & Kris-Etherton, P. (2006). Dietary Omega-3 Fatty Acid Intake and Cardiovascular Risk. American Journal of Cardiology, 98, 3i-18i. Rao, C. V., Hirose, Y., Indranie, C. & Reddy, B. S. (2001). Modulation of experimental colon tumorigenesis by types and amounts of dietary fatty acids. Cancer Research, 61, 19271933. Rasmussen, H. E., Guderian, D. M. Jr., Wray, C. A., Dussault, P. H., Schlegel, V. L. & Carr, T. P. (2006). Reduction in Cholesterol Absorption Is Enhanced by Stearate-Enriched Plant Sterol Esters in Hamsters. Journal of Nutrition, 136, 2722-2727. Rebetzke, G. J., Burton, J. W., Carter, T. E. Jr., & Wilson, R. F. (1998). Genetic variation for modifiers controlling reduced saturated fatty acid content in soybean. Crop Science, 38, 303-308. Retelny, V. S., Neuendorf, A. & Roth, J. L. (2008). Nutrition protocols for the prevention of cardiovascular disease. Nutrition in Clinical Practice, 23, 468-476.

384

Cristina M. Sena and Raquel M. Seiça

Richards, J. A., Petrel, T. A. & Brueggemeier, R. W. (2002). Signaling pathways regulating aromatase and cyclooxygenases in normal and malignant breast cells. The Journal of Steroid Biochemistry and Molecular Biology, 80, 203-212. Rueda-Clausen, C. F., Silva, F. A., Lindarte, M. A., Villa-Roel, C., Gomez, E., Gutierrez, R., Cure-Cure, C. & López-Jaramillo, P. (2007). Olive, soybean and palm oils intake have a similar acute detrimental effect over the endothelial function in healthy young subjects. Nutrition, Metabolism and Cardiovascular Diseases, 17, 50-57. Russo, G. L. (2009). Dietary n-6 and n-3 polyunsaturated fatty acids: from biochemistry to clinical implications in cardiovascular prevention. Biochemical Pharmacology, 77, 937946. Sakaguchi, M., Hiramatsu, Y., Takada, H., Yamamura, M., Hioki, K., Saito, K. & Yamamoto, M. (1984). Effect of dietary unsaturated and saturated fats on azoxymethane-induced colon carcinogenesis in rats. Cancer Research, 44, 1472-1477. Sakamoto, T., Horiguchi, H., Oguma, E. & Kayama, F. (2009). Effects of diverse dietary phytoestrogens on cell growth, cell cycle and apoptosis in estrogen-receptor-positive breast cancer cells. Journal Nutrition Biochemistry, doi:10.1016/j.jnutbio.2009.06.010. Schaefer, M. B., Ott, J., Mohr, A., Bi, M. H., Grosz, A., Weissmann, N., Ishii, S., Grimminger, F., Seeger, W. & Mayer, K. (2007). Immunomodulation by n-3- versus n-6rich lipid emulsions in murine acute lung injury - Role of platelet-activating factor receptor. Critical Care Medicine, 35, 544-554. Schulz, M., Hoffmann, K., Weikert, C., Nöthlings, U., Schulze, M. B. & Boeing, H. (2008). Identification of a dietary pattern characterized by high-fat food choices associated with increased risk of breast cancer: the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. British Journal of Nutrition, 100, 942-946. Sena, C. M., Nunes, E., Louro, T., Proença, T., Fernandes, R., Boarder, M. R. & Seiça, R. M. (2008a). Effects of alpha-lipoic acid on endothelial function in aged diabetic and high-fat fed rats. British Journal of Pharmacology, 153, 894-906. Sena, C. M., Proença, T., Nunes, E., Santos, M. S. & Seiça, R. M. (2008b). The effect of soybean oil on glycaemic control in Goto-kakizaki rats, an animal model of type 2 diabetes. Medicinal Chemistry, 4, 293-297. Shao, Z. M., Alpaugh, M. L., Fontana, J. A. & Barsky, S. H. (1998). Genistein exerts multiple suppressive effects similarly in estrogen receptor-positive and -negative human breast carcinoma cell lines characterized by P21/WAF1/CIP1 induction, G2/M arrest, and apoptosis. Journal of Cellular Biochemistry, 69, 44-54. Simopoulos, A. P. (1999). Essential fatty acids in health and chronic disease. American Journal of Clinical Nutrition, 70, 560S-569S. Simopoulos, A. P. (2002). The importance of the ratio of omega-6/omega-3 essential fatty acids, Biomedicine & Pharmacotherapy, 56, 365-379. Skeaff, C. M. (2009) Feasibility of recommending certain replacement or alternative fats. European Journal of Clinical Nutrition, 63, S34-S49. Song, C., Leonard, B. E. & Horrobin, D. F. (2004). Dietary Ethyl-eicosapentaenoic Acid but not Soybean Oil Reverses Central Interleukin-1-induced Changes in Behavior, Corticosterone and Immune Response in Rats. Stress, 7, 43-54. Speek, A. J., Schrijver, J. & Schreurs, W. H. P. (1985). Vitamin E Composition of Some Seed Oils as Determined by HPLC with Fluorometric Detection. Journal of Food Science, 50, 121-124.

Soybean Oil in Health and Disease

385

Spilburg, C. A., Goldberg, A. C., McGill, J. B., Stenson, W. F., Racette, S. B., Bateman, J., McPherson, T. B. & Ostlund, R. E. Jr. (2003). Fat-free foods supplemented with soy stanol-lecithin powder reduce cholesterol absorption and LDL cholesterol. Journal of the American Dietetic Association, 103, 577-581. Stanley, J. C. (2007). Should we be concerned about the dietary n-6:n-3 polyunsaturated fatty acid ratio? Lipid Technology, 19, 112-113. Stark, A. H., Timar, B. & Madar, Z. (2000) Adaptation of Sprague Dawley rats to long-term feeding of high fat or high fructose diets. European Journal of Nutrition, 39, 229-234. Summers, L. K., Fielding, B. A., Bradshaw, H. A., Ilic, V., Beysen, C., Clark, M. L., Moore, N. R. & Frayn, K. N. (2002). Substituting dietary saturated fat with polyunsaturated fat changes abdominal fat distribution and improves insulin sensitivity. Diabetologia, 45, 369-377. Torre-Villalvazo, I., Gonzalez, F., Aguilar-Salinas, C. A., Tovar, A. R. & Torres, N. (2009). Dietary soy protein reduces cardiac lipid accumulation and the ceramide concentration in high-fat diet-fed rats and ob/ob mice. Journal of Nutrition, 139, 2237-2243. Tucker, J. M. & Townsend, D. M. (2005). Alpha-tocopherol: roles in prevention and therapy of human disease. Biomedicine & Pharmacotherapy, 59, 380-387. Ueda, K., Asai, Y., Yoshimura, Y. & Iwakawa, S. (2008). Effect of oil-in-water lipid emulsions prepared with fish oil or soybean oil on the growth of MCF-7 cells and HepG2 cells. Journal of Pharmacy and Pharmacology, 60, 1069-1075. United Soybean Board. (2008). Soy-Based Paint and Coating, Technical Fact Sheet. Wang, J., John, E. M., Horn-Ross, P. L. & Ingles, S. A. (2008). Dietary fat, cooking fat, and breast cancer risk in a multi-ethnic population. Nutrition Cancer, 60, 492-504. Weingärtner, O., Böhm, M. & Laufs, U. (2009). Controversial role of plant sterol esters in the management of hypercholesterolaemia. European Heart Journal, 30, 404-409. Wijendran, V. & Hayes K. C. (2004). Dietary n-6 and n-3 fatty acid balance and cardiovascular health. Annual Review of Nutrition, 24, 597-615. Willett, W. C. (2007). The role of dietary n–6 fatty acids in the prevention of cardiovascular disease. Journal of Cardiovascular Medicine, 8, S42-S45. Wilson, R. F. (1991). Advances in the genetic alteration of soybean oil composition. 38-52. In R. F. Wilson, (ed.) Designing value-added soybeans for markets of the future. Am. Oil Chem. Soc., Champaign, IL. Wohlers, M., Nascimento, C. M., Xavier R. A. & Ribeiro Silveira, V. L. (2003). Participation of corticosteroids and effects of indomethacin on the acute inflammatory response of rats fed n-6 or n-3 polyunsaturated fatty acid-rich diets. Inflammation, 27, 1-7. Wohlers, M., Xavier R. A., Oyama, L. M., Ribeiro, E. B., do Nascimento, C. M., Casarini, D. E. & Silveira, V. L. (2005). Effect of fish or soybean oil-rich diets on bradykinin, kallikrein, nitric oxide, leptin, corticosterone and macrophages in carrageenan stimulated rats. Inflammation, 29, 81-89. Woyengo, T. A., Ramprasath, V. R. & Jones, P. J. (2009). Anti-cancer effects of phytosterols. European Journal of Clinical Nutrition, 63, 813-820. Xiao, C., Giacca, A., Carpentier, A. & Lewis, G. F. (2006). Differential effects of monounsaturated, polyunsaturated and saturated fat ingestion on glucose-stimulated insulin secretion, sensitivity and clearance in overweight and obese, non-diabetic humans. Diabetologia, 49, 1371-1379.

386

Cristina M. Sena and Raquel M. Seiça

Zatonski, W., Campos, H. & Willett, W. (2008). Rapid declines in coronary heart disease mortality in Eastern Europe are associated with increased consumption of oils rich in alpha-linolenic acid. European Journal of Epidemiology, 23, 3-10. Zhang, X. H., Hua, J. Z., Wang, S. R. & Sun, C. H. (2007). Post-weaning isocaloric hypersoybean oil versus a hyper-carbohydrate diet reduces obesity in adult rats induced by a high-fat diet. Asia Pacific Journal of Clinical Nutrition, 16 (Suppl 1), 368-373. Zhao, G., Etherton, T. D., Martin, K. R., West, S. G., Gillies, P. J. & Kris-Etherton, P. M. (2004). Dietary alpha-linolenic acid reduces inflammatory and lipid cardiovascular risk factors in hypercholesterolemic men and women. Journal of Nutrition, 134, 2991-2997.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 15

THE USE OF SOYBEAN PEPTONE IN BACTERIAL CULTIVATIONS FOR VACCINE PRODUCTION M.W. Wilwert 1, J.C. Parizoto 2, M.R. Silva 1, S.M.F. Albani 1, M.M. Machado.3, G.S. Azarias 3, A.J. Silva 3, A.C.L. Horta 3, J. Cabrera-Crespo 1, T.C. Zangirolami, 3 and M. Takagi 1* 1

Universidade Federal de São Carlos – Araras, Brazil 2 Instituto Butantan – Centro de Biotecnologia – Laboratório de Fermentação, Brazil 3 Universidade Federal de São Carlos – Departamento de Engenharia Química, Brazil

ABSTRACT The use of microbial and cell culture nutrient media based on hydrolyzed soybean meals has been increasing continuously, mainly for the production of human and animal pharmaceutical products, due to the risks related to the transmission of the prion diseases. Two kinds of bacteria have been studied: Haemophilus influenzae b (Hib), a bacterium that causes meningitides in children less than two years old, and Erysipelothrix rhusiopathiae (Erhu), the causative agent of swine erysipelas, a disease responsible for great worldwide losses in swine culture. The focuses of these projects are to develop vaccines based on polysaccharide against Hib and inactivated cells suspensions containing the protein SpaA, the main antigenic agent against Erhu infections, respectively. Several kinds of peptones, from animal and vegetal origin, were tested and the results concerning cells, polysaccharide or protein production were compared. For H. influenzae b cultivations, the following nutrients were used: i) from vegetal origin: Bacto Soytone (BD), HiSoy (Kerry), Soy peptone (Sigma); ii) from animal origin: Bacto casamino acids (BD) and casein acid hydrolysate (Sigma). Usually, E. *

Corresponding author: E-mail: [email protected]: Av. Vital Brasil, 1500 Instituto Butantan – Centro de Biotecnologia – Laboratório de Fermentação Butantã - São Paulo – Brazil CEP- 05503-900.

388

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al. rhusiopathiae is cultivated in complex media from animal origin. Two types of soybean peptones were tested: Bacto Soytone (BD) and soy peptone (Acumedia) as well as corn steep liquor (Milhocina from Corn Products, Brazil). The results for H. influenzae b showed that the peptone from vegetal origin promoted a 2~2.5 times better growth than that from animal origin. The best one was Bacto Soytone from BD, leading to OD540nm= 6.0 in shake flask and 16 in biorreactor. The production of polysaccharide was 296 mg/L in shake flask and 600 mg/L in bioreactor. Concerning E. rhusiopathiae, when cultivated in shaker flasks, an increase of 50% in biomass yield on glucose consumed and of 10% in the maximum specific growth rates (max) were observed with vegetal peptones. For E. rhusiopathiae bioreactor cultivation with animal peptone, a maximum OD420nm of 7.8 and max of 0.5 h-1 were achieved. However, these values were significantly higher, reaching 35 for OD420nm and 1 h-1 for max, with soybean peptone. The expression of SpaA was favored with soybeans peptone as nitrogen source as well. Production of vaccines usually involves cultivation of fastidious microorganisms in complex animal media. The results confirm that the soybean peptones can successfully replace the peptones from animal origin with improvements in biomass formation, growth rate, antigenic protein expression and yield of polysaccharide.

INTRODUCTION Infectious diseases caused by a microorganism, virus or some parasites are the major causes of death and disability for human beings and livestock causing social and economic losses for millions of people worldwide. Over 9.5 million people die each year due to infectious diseases, mainly those living in developing countries. In the veterinary field, infectious diseases are responsible for huge economic losses, amounting almost to US$ 40 billion from 2000 to 2006 [1, 2, 3,4]. The most efficient prevention against these diseases are vaccines that contain inactivated or attenuated pathogenic organisms, purified proteins or polysaccharides produced by the specific microorganism [5,6 ,7 ,8]. The introduction of the massive vaccination campaigns worldwide reduced clearly the mortality cases of several infectious diseases, which decreased from almost 1.6 million deaths, in the beginning of the last century, to about 7,000 in 2000, a reduction of more than 99%. This approach has also been verified in the veterinary field, where vaccination programs have been implemented for the prevention of animal illnesses with economic impact, generating sales in vaccines of US$ 2,420 million in 2000 [9]. Traditional vaccines are manufactured with bovine-derived material to grow microorganisms that, in most cases, are fastidious and require special nutrients. However, the recent discovery of prions as infectious agents has modified the current concepts regarding feeding and use of tissues of animal origin for human and animal consumption, even for vaccines manufacture [10,11 ,12]. Prions have caused diseases in a wide variety of other animals, including scrapie in sheep and bovine spongiform encephalopathy in cows (BSE or mad cow disease). These diseases are known as transmissible spongiform encelophalothies (TSE) and include Creutzfeldt-Jacob disease (CJD), Kuru and Gerstmann-Sträussler-Scheinker (GSS) [13,14 ,15]. In all of them, the nervous system is progressively degraded until death. In the mid 1980s appeared the major outbreak of mad cow disease in the United Kingdom, and this problem spread to other European countries. By early 1996, there was

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

389

scientific evidence that BSE had crossed the species barrier to humans. A new variant form of Creutzfeldt-Jacob disease (vCJD) was identified in patients with brain degeneration, and it was linked to the consumption of meat from contaminated cows with BSE. Public consensus became concerned with the consumption of meat and the use of products of bovine origin. The recent WHO guidelines (2003) recommend, when feasible, that tissues, muscle or blood of ruminant origin should be avoided in the preparation of biological and pharmaceutical products [16, 17,18] We have been working with two different bacteria, Haemophilus influenzae b and Erysipelothrix rhusiopathiae, that cause human and veterinary diseases, respectively. Haemophilus influenzae type b (Hib), a Gram negative cocobacilus bacterium, is responsible for causing meningitides in children less than two years old. The capsular polysaccharide is the main virulence factor of this microorganism, and the vaccine is formulated with purified polysaccharide (PRP) as antigen conjugated chemically to a career protein [19,20]. Haemophilus influenzae b usually grows well in rich media such as Brain Heart Infusion (BHI) [21,22]. A defined medium also has been described for the growth of Haemophilus influenzae since supplemented with growth factors NAD and Hemin and used to delineate metabolite capabilities [23,24]. However, the use of defined media is not feasible for industrial purposes due to low biomass and consequently low PRP production yields. Merrit et al. described a Hib-cultivation process using casamino acids and yeast extract as nitrogen sources and hemin and nicotinamide adenine dinucleotide (NAD) as growth factors in large scale [25]. Carty et al. described a medium containing soy peptone and yeast extract (MP) supplemented with growth factors, which is used by the pharmaceutical companies to produce a vaccine against Hib [26, 27,28]. Historically, soybean peptone has been used by pharmaceutical companies since the beginning of the vaccine production against Hib in 1985, before the outbreaks of BSE [17,18]. Erysipelothrix rhusiopathiae is a Gram-positive and facultative anaerobic rod that causes erysipelas besides many other illnesses, such as sheep polyarthritis and human erysipeloid [29]. Swine erysipelas is among the diseases that cause great worldwide losses in swine culture, and it has been combated by the use of vaccines containing attenuated live microorganisms (Japan) or inactivated microorganisms (other countries) [30]. The main antigenic agent is a protein of 64–69 kDa or its degraded form of ~47 kDa (designated SpaA), found in the bacteria surface, attached by interactions with choline residues of the teichoic and lipoteichoic acids present in the cell wall and also released to the culture medium supernatant [31]. Studies demonstrated that antigen production is not only associated with the strain but also with the cultivation conditions used for its production [32,33]. So far, no studies with animal-free media have been reported for E. rhusiopathiae. Early experiments with E. rhusiopathiae were conducted with brain heart infusion supplemented with animal serum (BHIS), which was later successfully replaced by proteose peptone (enzymatic digestion of meat) and yeast extract in the so-called Feist medium, in its original or modified formulation [34]. Groschup and Timoney (1990), Zarkasie et al. (1996) and Silva et al. (2008) were the last studies found in the literature regarding media composition for E. rhusiopathie cultivation [33,34,35]. Among them, only Silva et al. (2008) conducted their experiments using aerated stirred tank bioreactors. The earlier studies were performed in incubators with the use of flasks, agitated or not, and, therefore, without

390

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

adequate control of important variables for cell growth as well as product formation, such as pH and dissolved oxygen concentration. Furthermore, all the mentioned studies were carried out using proteose peptone [33]. In order to produce vaccine for human and animal uses, the improvement and the adequate medium used is indispensable. In this chapter different complex media, from animal or vegetal origin, were used in the cultivations of pathogenic bacteria H. influenzae b and E. rhusiopathiae and the best media to enhance capsular polysaccharide and SpaA synthesis was identified.

MATERIAL AND METHODS Strain: Haemophilus influenzae type b GB 3291 strain was kindly provided by the Center for Disease Control and Prevention (Atlanta, GA, USA) and processed as described in [36]. Erysipelothrix rhusiopathiae NCTC 11004 was used in this research. The working seed was prepared as described in Silva et al. (2008) and stored at - 70 oC [33] Media culture: Haemophilus influenzae b: Medium described by Takagi et al. [Error! Bookmark not defined.36] was used in this experiment with different peptones for replacing Bacto Soytone (Difco) in the composition as follows: 1) Bacto Soytone (BD), 2) HSoy (Kerry), 3) Soy peptone (Sigma); 5) Bacto casamino acids (BD) and 6) Casein acid hydrolysate (Sigma). Erysipelothrix rhusiopathiae: Media culture used were composed by: yeast extract (7.5 g/L); arginine (0.75 g/L) Tween 80 (0.75 v/v); glucose (9.0 g/L); Na3PO4.12H2O (76.02 g/L) [33,34]. Four different nitrogen sources were compared: 2 soy peptones (Bacto Soytone from DB and Soy peptone from Acumedia); Peptone N2 (from BD) and corn steep liquor (Milhocina, from Corn Products, Brazil). The concentration of the nitrogen source was kept at 7.5 g/L in all experiments. The pH was adjusted to 8.0 and the media was sterilized by filtration. Shake flasks cultures. Haemophilus influenzae b: The inoculum was prepared according to Takagi et al. (2003) and the amount of bacterium suspension required to achieve OD540nm of 0.1 was transferred to a flask containing 50 ml of the culture medium previously filtrated in 0.22m. The experiments were run at 37oC, 300 rpm (Innova 44 – Incubator shake series New Brunswick Sci. Co. Inc., USA) and samples were collected each hour to follow cellular growth at OD540 nm and at 8, 10 and 12 hours of cultivation to measure polysaccharide production. Erysipelothrix rhusiopathiae: Inoculum was prepared as described at Silva et al. (2008) [33]. When an optical density (OD420nm) of 1.5 was reached, 30 mL of cell suspension was used to inoculate 300 mL of the desired culture media, and incubated at 37°C and 200 rpm. Samples were taken at 1 hour intervals to follow cell growth and for glucose and metabolites analysis. At the end of each cultivation, cells were used for antigen extraction. Bioreactor cultivation. Haemophilus influenzae: The experiments were carried out in biorreactor Bioflo 2000 (New Brunswick Sci. Co. Inc., USA) with 7 liters nominal capacity containing 5 liter of medium [36] at 37°C, pH controlled at 7.5; pO2 controlled at 30% of air saturation; and the exhausted gases (CO2 and O2) were measured with a gas analyzer

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

391

(Sick/Maihak S.710, Germany). These parameters were monitored and acquired by Labview 7.1 system (National Instruments, USA). Samples were collected in regular intervals in order to follow cell growth through optical density measurement (DO540nm) and further polysaccharide determination. Erysipelothrix rhusiopathiae: The experiments were carried out in a 5.0 L bioreactor model Bioflo II (New Brunswick Sci. Co. Inc., USA) equipped a mass flow controller (GFC Aalborg, USA) employed to supply air to the bioreactor. Dissolved O2 concentration was kept at 30% of saturation by changing the agitation speed (100–700 rpm) and the total gas flow rate was kept between 1 and 2 L/min. The pH was set at 8.0 and controlled by addition of NaOH 25% (v/v) and H3PO4 10% (v/v) solutions. All the instruments were controlled via a compact field point 2020 (cFP-2020, National Instruments), using a supervisory system set up in Labview 8.0 environment (National Instruments). Inoculum preparation followed the same procedure used for shake flask experiments. After reaching an OD420nm of 1.5, 300 mL of inoculum was transferred to the bioreactor containing 3.2 L of medium.

Analytical Methods Determination of cell concentration. Cell concentration was followed through the measurement of culture broth absorbance at 540 nm (Haemophilus influenzae); 420 nm (Erysipelothrix rhusiopathiae) and by dry cell weight determination. Determination of polysaccharide. All samples were exhaustively dialyzed against water before polysaccharide measurement. Polysaccharide was measured by using Bial`s method [37]. Determination of substrate and metabolite concentrations. These analyses were performed by HPLC using an Aminex HPX-87H column (Bio-Rad) and a 5 mM sulfuric acid solution at a flow rate of 0.6 mL.min−1 as mobile phase. The temperature was 50°C. Organic acids were detected at 210 nm (Waters 486 UV-detector), while ethanol was measured with a refraction index detector (Waters 410). Glucose concentration was also determined by an enzymatic commercial kit (Laborlab) containing glucose oxidase. Antigen extraction and SDS-PAGE analysis. Samples of 150 to 200 mL collected during all batch cultures at a measured OD420nm were first of all centrifuged at 10,000×g, 4°C for 20 min and the cell pellet was resuspended in 0.9 % NaCl containing 0.3% formalin (v/v), in a volume 3 times smaller than the original sample volume, and left for 24 hours at 4 oC and 100 rpm to inactivate the cell suspension [35]. After inactivation, the cells were separated by centrifugation at the same conditions, washed with saline and resuspended in a 0.9% NaCl and 2% choline chlorine solution (w/v) in a volume ten times smaller than the original sample volume, and left overnight under mild agitation at 4°C. Subsequently, the solutions were filtered in a 0.22 μm membrane and concentrated tenfold by ultrafiltration (Amicon Ultra system – Millipore, 30 kDa NMWL) [31]. The samples were then analyzed by 15% polyacrylamide gel electrophoresis under denaturing conditions [38].

392

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

Maximum specific growth rate, initial glucose uptake rate and cell mass yield coefficient. For all batch cultures, the maximum specific growth rate (μmax) and the cell mass yield coefficient (YXS) were calculated using the data from exponential growth phase according to equations 1 and 2, respectively.

 OD    max  t ln  OD0 

(Eq. 1)

Cx  Cx0  Yx / s  (Cs0  Cs)

(Eq. 2)

where: OD is the optical density at 420 nm; Cx is the biomass concentration; Cs is the glucose concentration and Cs0 is its initial concentration. The initial glucose uptake rate was estimated from data collected within 3–4 hours from the onset of the experiments by plotting the consumed glucose concentration as function of time and taking the slope.

RESULTS AND DISCUSSION The use of microbial and cell culture nutrient media based on hydrolyzed soybean meals poses as a very promising alternative. About 225.6 million tons of soybeans are produced every year in the whole world, making soybean by-products, such as flour and protein meal easily available. Different kinds of soy peptones have already been used for the cultivation of several microorganisms because they have high amino acid and carbohydrates contents [39]. In order to manufacture vaccine against Hib, Haemophilus influenzae b was, traditionally, cultivated in a complex medium based on soybean peptone, more specifically Bacto Soytone from Difco, even before the outbreak of BSE in 1996 [40]. According to Gray et al. (2008) the differences in the soy peptone production processes, which may change according to the manufacturer, can influence the cell growth [39]. Based on this argument, shake flask experiments, where Haemophilus influenzae b was grown in a different sort of soybean peptones (Bacto Soytone from BD, HSoy from Kerry and Soy peptone from Sigma), and peptones from animal origin (Bacto casamino acids from BD and casein acid hydrolysate from Sigma) were performed in order to compare cell growth and polysaccharide yield. Figure 1 shows the cell growth and polysaccharide production profiles on different peptones. Peptones from animal origin (Bacto casamino acid – BD and casein acid hydrolysates from Sigma) presented the lowest growth, reaching OD540nm around 2.5 in the end of 12 hour of cultivation and polysaccharide production were around 130 and 220 mg PRP/L, respectively. An intermediate growth was observed in media containing soybean peptones from Sigma and Kerry, with a maximum OD540nm of 4.5 and polysaccharide close to 200 mg PRP/L after 9 hours of incubation. The highest OD540 nm of 6.0 and polysaccharide of 300 mg PRP/L were achieved with soybean peptone from BD.

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

393

Figure 1. Cell growth (A) and PRP production (B) in shake flask cultures of Haemophilus influenzae b with different peptones

Bacto Soytone from BD resulted in cell growth and polysaccharide higher than other ones. Soybean peptone from Sigma presented vigorous growth but intermediate production of polysaccharide. According to the results from shake flasks, both soybean peptones from BD and Sigma suppliers were chosen for further studies as batch cultivations with glucose pulses carried out in bioreactors. Figure 2 shows that the biomass concentration of 3.6 g DCW/L (OD540nm= 6.0) was achieved and the polysaccharide production was around 400 mg PRP/L in the culture performed with soybean peptone from Sigma. On the other hand, for the culture with soybean peptone from BD, the biomass concentration reached 4.7 g DCW/L (OD540nm =16) and a polysaccharide production of 600 mg PRP/L was achieved. These values are, respectively, 23% and 33% superior to those attained in the experiment with soybean peptone from Sigma. Polysaccharide concentration obtained by Takagi et al (2006) using soybean peptone from Difco in a similar bioreactor experiment was also around 600 mg PRP/L within 12 hours of cultivation, almost the same volumetric production of polysaccharide obtained with soybean peptone from BD [36]. According to the BD Technical Manual, Bacto soytone contain around 30% of total carbohydrates which can result in higher cell growth and polysaccharide concentration than other peptones [40]. Gray et al. (2008) pointed out that differences in the soy peptones commercially available arise from the plant state at the harvest to process operation conditions such as temperature and the length of enzymatic digestion. In addition, unit operations as filtration, centrifugation and drying must be standardized. The authors also stressed that sterilization procedures employed during media preparation can affect peptones performance [39].

394

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

Figure 2. Kinetics profile of Haemophilus influenzae b bioreactor cultivation with Bacto soytone - BD and soybean peptone from Sigma. A) Cell growth and B) Polysaccharide production

E. rhusiopathiae cultivation media evolved from the one based on BHIS (brain and heart infusion plus serum) to the one proposed by Feist [34], in which BHIS was replaced by peptone derived from meat. Although good growth and effective bacterins are produced using Feist medium, it does not comply anymore with the WHO guidelines for biological and pharmaceutical products (2003) [16] concerning the usage of animal free components as precaution against prions related problems. Furthermore, certified meat derived peptone is six-fold more expensive than soy peptone [40], leading to higher production costs. For all these reasons, cheaper alternative nitrogen sources from vegetal origin, such as soy peptones and corn steep liquor, were studied in batch cultivations of E. rhusiopathiae. Screening experiments were performed in shake flasks and the main results are gathered in Table 1. Cell growth was observed in all conditions. However, maximum specific growth rates and biomass yields were higher for soy peptone containing media. It is also interesting to notice that glucose was more intensely consumed when meat-derived peptone was present as nitrogen source. Soy peptones contain up to 30% (w/w) of carbohydrates [40], which can be preferentially assimilated by the microorganism causing a lower uptake of glucose. Lactic acid was the main metabolite accumulated in media supplemented with meat-derived peptone or corn steep liquor, while acetic acid was the main metabolite formed in soy peptones media.

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

395

Table 1. Growth rate, glucose uptake rate and biomass yield for different nitrogen sources in E. rhusiopathiae shake flask experiments

µmax (h-1) rSmax (g.L-1.h-1) YXS (gDCW.gglucose-1)

Peptone N2 BD 0.29±0.01 0.65±0.05 0.24±0.01

Corn Steep Liquor 0.26±0.01 0.19±0.01 0.29±0.02

Bacto Soytone BD 0.35±0.04 0.35±0.07 0.44±0.04

Soy peptone (Acumedia) 0.34±0.02 0.34±0.02 0.49±0.02

rSin – initial glucose uptake rate; µmax – maximum specific growth rate; YXS - biomass yield on glucose consumed.

Figure 3. Electrophoresis of concentrated extracts containing the antigen in choline solution for all studied nitrogen sources. The samples were: Lane 1, sample from proteose peptone no. 2 medium; Lane 2, sample from corn steep liquor medium; Lane 3, sample from Bacto Soytone (BD) medium, Lane 4, sample from soy peptone (Acumedia) medium; Lane 5, purified rSpaA 47 kDa standard. Optical densities of all original samples set to 1

Similar levels of protein expression were observed in all cultures (Figure 3). Both nondegraded (67 kDa) and degraded (47 kDa) forms of antigenic protein SpaA were present in all samples applied to the electrophoresis gels. The thick bands observed in layer 2 are due to the other proteins originally present in corn steep liquor, which have molecular mass in the same range as SpaA. Based on the results from the screening experiments, Bacto soytone from BD was selected as nitrogen source for further studies conducted in the bioreactor. The time profiles for glucose uptake, biomass formation and metabolite production are shown in Figure 4 for the standard medium, containing meat-derived peptone (Peptone N2) and for the proposed medium, with Bacto Soytone. The biomass concentration profiles depicted in Figure 4A show clearly the fast growth and intense biomass formation that took place using Bacto Soytone as the nitrogen source. As expected, glucose was also quickly consumed to match the growth requirements (Figure 4A). Concerning metabolite formation (Figure 4B), as mentioned previously for shake flask experiments, when Peptone N2 is replaced by Bacto Soytone, acetic acid became the most produced metabolite, reaching almost 4 g/L in only 6 h of cultivation. Lactic acid formation also was faster than acetic acid formation in the first 3 hours of cultivation, and its maximum concentration reached 2.5 g/L just before glucose was depleted. After that, lactic acid was quickly re-assimilated by the cells. For the cultivation

396

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

having Peptone N2 as nitrogen source, lactic acid accumulated to about 3.5 g/L, while acetic acid concentration remained below 1 g/L throughout the experiment. The values of the main kinetic parameters, which were calculated from the data shown in Figure 4A, are given in Table 2. The more suitable cultivation conditions available in the bioreactor (control of dissolved oxygen concentration and pH) resulted in very good values for maximum specific growth rate and biomass yield. In fact, these high values only could be reached because E. rhusiopathiae is using Bacto Soytone nutrients, besides glucose, for growth and biomass formation. The values of the yield coefficients of lactic and acetic acid formation on glucose (Table 2) confirm that the lactic acid was really intensely produced in the beginning of the cultivation, regardless the nitrogen source present in the medium. On the other hand, only in the presence of Soytone, a significant production of acetic acid throughout the cultivation was observed.

(B)

(A)

12

4 10

3.5

Biomass_Soytone Glucose_Soytone Glucose_Peptone

6

6

4 4

Metabolites Concentrations (gL -1)

8

Biomass_Peptone 8

Glucose Concentration (gL-1)

Biomass Concentration (gDCWL -1)

10

3 2.5 Lactic Acid_Peptone

2

Acetic Acid_Peptone Lactic Acid_Soytone

1.5

Acetic Acid_Soytone

Série5 1

2

2

0.5 0

0 0

2

4

6

Time (h)

8

10

12

0

0

2

4

6

Time (h)

8

10

12

Figure 4. Biomass formation and glucose consumption (A); lactic and acetic acid accumulation (B) for bioreactor batch cultures with two different nitrogen sources

Table 2. Maximum specific growth rate, biomass and organic acids yields for different nitrogen sources in E. rhusiopathiae bioreactor batch cultivations; µmax – maximum specific growth rate; YXS - biomass yield on glucose consumed; YAcS – acetic acid yield on glucose consumed; YLacS – lactic acid yield on glucose consumed µmax (h-1) YXS (gDCW.gglucose-1) YAcS (gacetate.gglucose-1) YLacS (glactate.gglucose-1)

ND – non determined

Peptone N2 –BD 0.51±0.02 0.23±0.01 ND 0.46±0.03

Bacto Soytone BD 1.14±0.03 0.95±0.04 0.30±0.02 0.43±0.04

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

397

Figure 5. Electrophoresis of concentrated extracts containing the antigen in choline solution for Bacto soytone (A) and proteose peptone (B) as nitrogen sources. The samples were A: Lane 1, sample from 3.7 h of cultivation (OD420nm ~ 3.7); Lane 2, sample from 4.7 h of cultivation, OD420nm ~ 30; Lane 3, purified rSpaA 47 kDa standard; B: Lane 1, molecular mass standards (Benchmark Protein Ladder– Invitrogen); Lane 2, sample from 9 h of cultivation, OD420nm ~ 4

Protein expression at the end of the bioreactor experiments with both nitrogen sources was also assessed by SDS PAGE (Figure 5). The figure shows that protein expression follows the increase in biomass concentration and consequently more protein was extracted from the sample collected at the end of the cultivation with Bacto Soytone. From the results discussed previously it is clear that the presence of soy peptone, specifically Bacto Soytone, in the culture media improved growth and product formation for both H. influenzae and E. rhusiopathiae. These results are in accordance with similar studies reported in the literature. Gray et al. (2008) investigated the effects of peptones from different sources and suppliers on the growth of many microorganisms, including E. coli, S. enterica and S. typhimurium, among other 3 bacterial species. They concluded that the inclusion of soy peptones in the media contributed to increase the growth rate for all studied microorganisms [39]. According to the same authors, soy peptones are rich in a great diversity of nutrients, which can be more easily degraded and assimilated by the cells. Fang and collaborators (2006) also studied the growth of Clostridium tetani employing an animalnutrient-free culture medium aiming at the production of tetanus toxoid. The formulation containing soy peptone as nitrogen source led to the same yield observed with the conventional media, containing BHI and casein [41]. In the studies carried out by Liu et al. (2005), the natokinase activity obtained at Bacillus natto cultivations in different media was higher for the medium containing soy peptone (Bacto Soytone) than for those with casein, ammonia or soy meal [42].

CONCLUSION Improving media composition is a need for researchers working on vaccine production and development of new pharmaceutical products. The goal is not only to obtain higher titers and productivities or to have an economic impact, but also to guarantee product quality and compliance to WHO recommendations and governmental agency regulations. Changes in media formulation for vaccine production are quite difficult because vaccines are usually

398

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

produced by incubation of pathogenic, fastidious microorganisms in complex media containing nutrients from animal origin. However, the results showed that Bacto soytone from BD is the best complex animal-free nutrient for E. rhusiopathiae and H. influenzae b growth. Bacto soytone contains, besides 30% in total carbohydrates, minerals such as magnesium, phosphate, calcium in higher concentrations than other common nitrogen sources, which may contribute in the highlighted cell growth. Additionally, Bacto soytone is appropriate to be used for pharmaceutical products manufacture.

ACKNOWLEDGMENTS We gratefully acknowledge financial support from São Paulo Research Foundation (FAPESP) - São Paulo, Brazil (grant process nº 2007/50082-2) and Butantan Foundation. We also thank Mr. Lourivaldo Inácio de Souza and Ms. Inês do Amaral Maurelli for technical assistance.

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13]

World Health Organization. (2008). WHO global burden of disease: 2004 update. Available from: www. who. int/ healthinfo/ global_ burden_ disease/ 2004_ report_ update/en/index.html UNAIDS, World Health Organization. (2008). Report on the Global AIDS Epidemic. Available from: www. unaids. org/ en/ KnowledgeCentre/ HIVData/ GlobalReport/ 2008/ 2008_Global_report.asp Breman, J., Alilio, M. & Mills, A. (2004). Conquering the intolerable burden of malaria: what's new, what's needed: a summary. Am.J.Trop.Med. Hyg., 71, 1-15. Bio Economic Research Associates (Bio-era) home Page (www.bio-era.net), accessed in april 2010. Kuo, J. S. C (1984). Combined Haemophilus influenzae and diphtheria, pertussis, tetanus vaccine. European Patent EP0101562A2. Finn, C. W. J. (1993). PRP overproducing Haemophilus influenzae strain. Eurpean Patent EP 0546349A2. Gu, Xin-Xing; Tsai, Chao-Ming., Lim, D. J. & Robbins, J. B. (2001). Conjugate vaccine for nontypeable Haemophilus influenzae. United State Patent. US6,207,157B1. Conjugate and Polysaccharide Vaccines, Plenary Review. Gerecke, U. (2002). Veterinary Vaccines. PJB Publications Ltd., London, UK. Lupi, O. (2003). Prionic disease: evaluation of the risks involved in using products of bovine origin. An.Bras. Dermatol., 78(1), 7-18. Jayme, D. W. & Smith, S. R. (2000). Media formulation options and manufacturing process controls to safeguard against introduction of animal origin contaminants in animal cell culture. Cytotechnol., 33, 27-36. Prusiner, S. B. (1991). Molecular Biology of Prion Diseases. Sci., 252, 1515-1522. Haiwood, A. M. (1997). Transmissible spongiform encephalothies. E. Eng. J. Med., 337, 1821-8.

The Use of Soybean Peptone in Bacterial Cultivations for Vaccine Production

399

[14] Creutzfeldt, H. G. (1920). Uber eine eigenartige herdformige Erkrankung dês Zentralnervensystems. Z. Gesamte Neurol Psychiatr, 57, 1-18. [15] Jakob A. (1921). Über eigenartige Erkrankungen des Zentralnervensystems mit bemerkeswertem anatomichen Befunde (Spastische pseudoskleroseEncephalomyelopathie mit desseminierten Degenetarions-herden). Z. Gesamte Neurol Psychiatr., 64, 147-228. [16] World Health Organization (WHO). (2003). Guidelines on Transmissible Spongiform Encephalopathies in relation to Biological and Pharmaceutical Products. [17] Sogal, A. & Tofe, A. J. (1999). Risk Assessment of Bovine Sponjform Encephalopathy Transmission Through Bone Graft Material Derived From Bovine Bone Used For Dental Applications. J Periodontol, 70(9), 1053-1063. [18] World Health Organization. (2006). WHO Guidelines on Tissue Infection Distribution in Transmissible Spongiform Encephalopathies. [19] Norden, C. W. (1982). Haemophilus influenzae type b, in Bacterial infections of humans. Evans AS and Feldman HA. Plenum, New York, 259-273. [20] Crisel, R. M., Baker, R. S. & Dorman, D. E. (1975). Capsular polymer of Haemophilus influenzae, type b. I–Structural characterization of the capsular polymer of strain Eagan. J. Biol. Chem., 250, 4926-4930. [21] Schell, R. F., LeFrock, J. L., Babu, J. P. & Robinson, D. B. (1979). Recovery Of Haemophilus Influenzae From Twenty-Three Blood Culture Media. J. Clin. Microbiol, 9, 84-87. [22] Brinkley, A. W. & Huber, T. W. (1978). Method For Evaluating Broth Culture Media: Application To Haemophilus. J. Clin. Microbiol, 8, 520-524. [23] Colemann, N. H., Daynes, D. A., Jarisch, J. & Smith, A. L. (2003). Chemically Defined Media for Growth of Haemophilus influenzae strains. J. Clin. Microbiol, 41(9), 44084410. [24] Herriot, R. M., Meyer, E. Y., Vogt, M. & Modan, M. (1970). Defined medium for growth of Haemophilus influenzae. J.Bacteriol., 101(2), 513-516. [25] Merrit, J., Allard, G., O`Toole, L., Swartz, R. & Licari, P. (2000). Development and scale-up of a fed-batch process for the production of capsular polysaccharide from Haemophilus influenzae, J Biotechnol, 81, 189-197. [26] Carty, C. E., Mancinelli, R., Hagopian, A., Kovach, F. X., Rodriguez, E., Burke, P., Dunn, N. R., Mcaleer, W. L., Maigetter, R. Z. & Kniskern, P. (1985). Fermentation Studies with Haemophilus influenzae. Dev. Industr. Microbiol, 26, 763-767. [27] Hilleman, M. R., Tai, J. Y., Tolman, R. L., Vella, P. P. M. R., Tai, J. Y., Tolman, R. L. & Vella, P. (1984). Coupled Haemophilus influenzae type b vaccine. United States Patent 4. 459.286. [28] Kuo, J. S. C. (1980). Isolation and purification of polyribosyl ribitol phosphate from Haemophilus influenzae type b. United States Patent No. 4.220.717. [29] Wood, R. L. (1992). Erysipelas. In: Leman AD et al (ed) Disease of swine. Iowa State University Press, Iowa. 475-486. [30] Makino, S., Yamamoto, K., Murakami, S., Shirahata, T., Uemera, K., Sawada, T., Wakamoto, H. & Morita, H. (1998). Properties of repeat domain found in a novel protective antigen, SpaA, of Erysipelothrix rhusiopathiae. Microb Pathog, 25, 101-109.

400

M.W. Wilwert, J.C. Parizoto, M.R. Silva et al.

[31] Makino, S. I., Yamamoto, K., Asakura H., Shirahata T (2000). Surface antigen, SpaA, of Erysipelothrix rhusiopathiae binds to Gram-positive bacterial cell surfaces. FEMS Microbiol Lett. 186, 313–317. [32] Kitajima T., Oishi E., Amimoto K., Ui S., Nakamura H., Oda K., Katayama S., Izumida A., Shimizu Y. (2000). Quantitative diversity of 67 kDa protective antigen among serovar two strains of Erysipelothrix rhusiopathiae and its implication in protective immune response. J. Vet. Med. Sci. 62, 1073–1077. [33] Silva, A.J., Neto, A.B., Cilento, M.C., Giordano, R.C., Zangirolami, T.C. (2008). Bioreactor aeration conditions modulate growth and antigen expression during Erysipelothrix rhusiopathiae cultivation. Appl Microbiol Biotechnol. 79, 23–31. [34] Groschup MH., Timoney JF (1990). Modified Feist broth as a serumfree alternative for enhanced production of protective antigen of Erysipelothrix rhusiopathiae. J Clin Microbiol. 28, 2573–2575. [35] Zarkasie K., Sawada T., Yoshida T., Takahashi I., Takahashi T (1996). Growth ability and immunological properties of Erysipelothrix rhusiopathiae. J. Vet. Med. Sci. 58, 87– 90. [36] Takagi M., Cabrera-Crespo J., Baruque-Ramos J., Raw I., Zangirolami TC and Tanizaki MM. (2003)., Characterization of polysaccharide production of Haemophilus influenzae type b and its relationship to bacterial cell growth. Appl. Biochem. Biotechnol. 110:91–100. [37] Ashwell G. Colorimetric analysis of sugar; Meth.Enz. Vol. III. [38] Laemmli UK (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. [39] Gray, V. L., Muller, C. T., Watkins, I. D., Lloyd, D. (2008). Peptones From Diverse Sources: Pivotal Determinants Of Bacterial Growth Dynamics. J. Appl.Microbiol. 104, 554–565. [40] BD Bionutrients Technical Manual: BD Biosciences – Adv.Bioprocess. 3Ed. 2007. [41] Fang, A., Gerson, D. F., Demain, A. L. (2006). Menstrum For Culture Preservation And Medium For Seed Preparation In A Tetanus Toxin Production process containing no animal or dairy products. Lett. Appl. Microbiol. 43, 360-363. [42] Liu, M.A. (1995). Overview of DNA vaccines. Ann.N.Y.Acad.Sci.. 772, 15-20.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 16

IN VITRO INHIBITORY ACTIVITY ON ANGIOTENSINCONVERTING ENZYME OF OKARA PROTEIN HYDROLYSATES PRODUCED WITH PEPSIN

1

Antonio Jiménez-Escrig1, Manuel Alaiz2, Javier Vioque2 and Pilar Rupérez1 Department of Metabolism and Nutrition, Instituto del Frío IF-ICTAN, Consejo Superior de Investigaciones Científicas (CSIC), José Antonio Novais 10, Ciudad Universitaria, ES-28040 Madrid, Spain 2 Department of Physiology and Technology of Plant Products, Instituto de la Grasa, Consejo Superior de Investigaciones Científicas (CSIC), Padre García Tejero 4, ES-41012 Sevilla, Spain

ABSTRACT Okara, a major by-product of the soymilk industry, is rich in proteins. Our previous studies have shown that okara under physiological conditions may release potential bioactive peptides. Specifically, okara protein isolate has been digested sequentially with pepsin (60 min) and pancreatin (195 min) and the okara protein hydrolysates (OPHs) obtained at the end (255 min) of the in vitro digestion have been fractionated by ultrafiltration, characterized in terms of amino acids and Molecular Weight (MW) distribution, and tested for angiotensin-converting enzyme inhibition (ACE-I) and multifunctional antioxidant activities [1]. As a result, a bioactive peptide from soybean lipoxygenase-1 with a calculated mass of 751.48 Da has been identified in the < 1 kDa ultrafiltrated (UF) fraction. On this frame, the ACE-I activity of the OPHs released during the first phase (pepsin) of the sequential in vitro digestion is the subject of this chapter. Further work focusing on the 60-min OPH released at the end of pepsin digestion is also described. Results indicated that pepsin digestion released OPHs showing relatively high inhibitory activity against ACE. The highest inhibition was exerted by the 5 min-OPH, showing an IC50 value of 1.523 ± 0.005 μg protein/μL. After ultra-filtration partitioning of the 60-min OPH, the effect of amino acid content and MW of UF fractions on ACE-I activity was discussed. The UF fraction containing the lower MW peptides showed the higher hydrophobic amino acid content and ACE-I activity.

402

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al. Concluding, the consumption of okara protein might exert health benefits on the basis of the bioavailability of the peptides released by pepsin. Further research on animal model is necessary to verify the tested potential ACE-I activity of these peptides released by in vitro pepsin digestion.

Keywords: okara, soybean by-product, functional food, pepsin digestion, protein hydrolysates, ultra-filtration, angiotensin-converting enzyme.

INTRODUCTION Epidemiological studies have shown that consumption of fruits and vegetables is associated with reduced risk of chronic diseases. In consequence, an increased consumption of products from vegetable origin has been recommended [2,3]. Okara is a by-product from the soymilk and tofu industry. Raw okara also called soy pulp, is a white yellowish material consisting of the insoluble parts of soybean seed remaining in the filter sack when pureed soybean seeds are filtered in the production of soymilk. This by-product has been used in the vegetarian diets of Western countries since the 20th century [4]. Characterization of okara, including the protein [(24.5-37.5 g/100 g dry matter (d.m.)], oil (9.3-22.3 g/100 g d.m.), dietary fibre (14.5-55.4 g/100 g d.m.), isoflavones (0.14 g/100 g d.m.), and mineral composition, along with un-specified monosaccharides, and oligosaccharides can be found in the literature [4-8]. Due to this peculiar composition, okara might have a potential use in the food industry as a functional ingredient. Under this aspect, a 4-weeks in vivo study of rats fed deffated okara has been recently assessed by Rupérez‘s group [9]. In summary, several health parameters in the serum and the caecal compartments have been found, showing for the first time that a dietary fiber concentrate from a soybean by-product protects the gut environment in terms of antioxidant status and prebiotic effect. It is proposed that this protection effect could be partly due to the peptides released in the gut by the intestinal microbiota. Hypertension is a worldwide problem of epidemic proportions (15-20% of adults) [10]. Heart diseases, such as arteriosclerosis, coronary heart disease, stroke, peripheral arterial disease, and heart failure, may be caused by hypertension or high blood pressure greater than 140 mm Hg systolic and/or 90 mm Hg diastolic pressure [11]. The angiotensin-converting enzyme (ACE, dipeptidyl carboxypeptidase, EC 3.4.15.1) plays and important role in regulating blood pressure. ACE catalyzes in the renin-angiotensin system the conversion of the inactive decapeptide angiotensin I to the potent vasoconstrictor, the octapeptide angiotensin II, by hydrolytic removal of the histidyl-leucine group from the C-terminal. In addition ACE degrades and inactivate bradykinin, a vasoactive nonapeptide with antihypertensive properties [12]. Peptides from different sources, assayed in vitro or in vivo, have exerted low-pressure action through the ACE inhibitory mechanism [13,14]. Thus, ACE inhibitory peptides derived from food proteins may play an indispensable role in prophylaxis and prevention of hypertension [10]. Although in general ACE-inhibitory peptides are less active than synthetic drugs such as captopril, their significance, however, lies in the fact that they are contained in food taken daily and met the need for naturalness and safety, apart from the use of these synthetic drugs implies certain side-effects such as headache [10].

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara…

403

An important task for the production of functional foods containing bioactive peptides is to enhance their bioavailability [13]. As other authors state, digestion by gastrointestinal enzymes can be used as a production process for ACE inhibitory peptides, with the advantage that the peptides released will resist the physiological digestion after oral intake [15]. Recent research has reported soybean peptides that inhibit ACE in chemical assays and in rat model [11]. Also we suggested that under simulated physiological conditions okara may release potential bioactive peptides [1]. Specifically, a protein concentrate from okara is obtained by precipitation, followed by an enzymatic hydrolysis [(pepsin (pH 2, 60 min) plus pancreatin (pH 7.5, 195 min)] to release potential bioactive peptides. The OPH obtained at the end of physiological digestion is further ultrafiltered In the < 1 kDa molecular weight cut-off ultrafraction the amino acid sequence, Thr-Ille-Ille-Pro-Lys-Pro-Val, of a peptide from soybean lipoxygenase-1 with a calculated mass of 751.48 Da was identified using LC-ESI-MS/MS techniques. The antioxidant and ACE-I power attributed to this identified peptide is based on the fragment sequence. The hydrophobic amino acids present in this peptide, particularly Val at terminal position, could likely be associated with the relatively high health-promoting attributes tested. Thus, in our opinion, despite the need for further research the identified peptide could be considered a suitable natural antioxidant and ACE-inhibitor. At this point, the in vitro ACE-I activity of the OPHs released during the first phase (pepsin) of the physiological sequential digestion described above is the subject of this chapter. Further work focusing on the ultrafiltration of the 60-min OPH released at the end of pepsin digestion is also described.

MATERIALS AND METHODS Materials Okara was provided as a fresh by-product from soybean (Glycine max (L.) Merr.) by Toofu-Ya S.L., a local food processing industry (Arganda del Rey, Madrid, Spain). This product has been previously processed and analyzed for composition [6,8,9]. The resulting deffated lyophilized product which presented a protein content of 32.08  0.13% was used to obtain the isolated protein from okara [1].

Isolation of Okara Protein As described previously [1], okara proteins were extracted in duplicate from the deffated okara by mixing 25 g with distilled water at 10% ratio (w:v), and adjusted to pH 8.3 with NaOH. After the mixture was stirred for 30 min, it was centrifuged (12000 x g, 15 min). The extracted protein in the supernatant was precipitated by adjusting the pH to an isolectric point of 4.5 and recovered by centrifugation (12000 x g, 30 min). This process was sequentially repeated twice more, using the residue fraction after the first centrifugation in each previous extraction process.

404

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al.

Preparation of Okara Protein Hydrolysates Okara protein hydrolysates (OPH) were prepared according to Megías et al. procedure [16] with some modifications [1]. Briefly, okara protein isolate was hydrolysed by sequential treatment with pepsin (60 min) and pancreatin (195 min) in a glass vessel. Hydrolysis parameters used were as follows: protein isolate:water, 5% (w/v); enzyme/substrate ratio, 1:20 (w:w); temperature, 37 °C; pH 2 (pepsin) and pH 7.5 (pancreatin). In this chapter we will focus on okara protein hydrolysates released by pepsin digestion for 60 min. Thus, the first digestion step, aliquots were taken at different time intervals (min) of pepsin digestion (0, 5, 10, 20, 30, 45, 60) and heated (80 ºC, 10 min) to inactivate enzymes. Afterwards the OPHs were recovered by centrifugation (12000 x g, 30 min). Aliquots containing OPH were used for monitoring angiotensin converting enzyme inhibition (ACE-I) at different time intervals during pepsin in vitro digestion. On the basis of the relatively high degree of hydrolysis (DH) in the pepsin digestion [1] the last aliquot at 60 min (60-min OPH) was selected for further characterization by ultrafiltration. Amino acid composition of 60-min OPH and its UF fractions along with deffated okara sample were determined. Total protein content of OPH aliquots obtained by pepsin hydrolysis and ultrafiltered fractions of the 60-min OPH aliquot was determined by CHNS-932 Lab Leco Protein Analyzer using 6.25 as nitrogen conversion factor.

Preparation of ACE ACE was prepared according to Hayakari et al. [17] with modifications [1,18]. Porcine lungs purchased in a local market were used as the starting material. One gram of tissue sample was diced and homogenized in 5 mL of ice-cold 10 mM potassium phosphate buffer, 0.1 mM sucrose, pH 8.3, adding 5 µL of 0.1 mM phenylmethylsulfonyl fluoride (PMSF). The homogenate was centrifuged (5000 x g, 10 min), and the resulting supernatant was used as the source of ACE. This supernatant possessed a specific activity around 20 U/mg protein.

ACE-Inhibition ACE-I assay was carried out by following published procedures with some modifications [1,19,20]. Sample or water (control and blank) (15 µL), sodium phosphate buffer (pH 8.3) [(110 µL) containing 10 mM HHL, 0.3 M sodium chloride, and 0.2 M dipotassium hydrogen phosphate and ACE extract [(30 µL) 10 µg/µL protein)] were incubated at 37 °C for 80 min. In the case of blank, ACE extract was added after the stopping solution. To stop the reaction 1 M hydrochloric acid (110 µL) was added and vortexed, then ethyl acetate (1 mL) was added, and the mixture was vortexed and centrifuged (1500 x g, 10 min). After centrifugation, 750 µL of the top layer (containing hippuric acid extracted into ethyl acetate) was taken, and ethyl acetate was evaporated off using a thermo-block at 95 ºC. The residual hippuric acid was redissolved in water (1 mL) prior to measurement of the absorbance at 228 nm in a Beckman DU-340 spectrophotometer. The % ACE-I was defined as the percentage of ACE activity inhibited by a specific amount of peptide, and was calculated as follows: (Abs228 nm Control – Abs228 nm Sample)/(Abs228 nm Control – Abs228 nm Blank) x 100 = % Inhibition. The activity of

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara…

405

inhibition was related to the content of protein in each pepsin OPH tested. When the inhibitory concentration 50% (IC50) was used, it was calculated as the concentration of peptide in µg/µL required to inhibit ACE activity by 50%. Results were reported as means of duplicate measurement  standard deviation.

Amino Acid Analysis Deffated okara, the OPH selected at the end of pepsin digestion process (60-min OPH), and the UF fractions obtained from the 60-min OPH, were treated as follows to evaluate their amino acid composition. Each sample was treated with 4 mL of 6 M HCl (20 h, 110 °C) for hydrolysis (1.5 mg/mL final concentration). Amino acid was determined by HPLC (NovaPack C-18, 300 mm x 3.9 mm i.d., 4 µm, Waters) of the derivatives obtained by reaction with diethyl ethoxymethylenemalonate, according to the procedure previously published [1,21].

Fractionation of Peptides by Ultrafiltration On the basis of the relatively high DH on the pepsin digestion step [1], the 60-min OPH aliquot taken at the end of the pepsin in vitro digestion, was subjected to further characterization by ultrafiltration (1:10, OPH:water). Four UF fractions were obtained using sequentially different membranes of 5, 3, and 1 kDa molecular weight cut-off (MWCO) (44.5 mm ultracel regenerated cellulose, Millipore). After each ultrafiltration the retentate was recovered and permeate was further processed with the next smaller MWCO membrane. These four UF fractions collected were named > 5 kDa MWCO, 3-5 kDa MWCO, and 1-3 kDa MWCO, which indicates the fractions non-passing through membranes of 5, 3, and 1, respectively, and the < 1 kDa MWCO which indicates the permeate from the 1 kDa membrane. The ultrafiltration was conducted using an ultrafiltration unit (Amicon, Millipore Corporation, model 8050, Beverly, MA) under the conditions at 1 bar air pressure [1].

Statistical Analysis Results are expressed as mean values  standard deviation. Comparison of means of two measurements are performed by one-way analysis of variance (ANOVA). Differences of P < 0.05 are considered to be significant (Statgraphic 5.1).

RESULTS AND DISCUSSION ACE-I Activity of Okara Protein Hydrolysates During in Vitro Pepsin Digestion Okara is a by-product consisting of the insoluble parts of soybean seed. Soybean proteins comprise a mixture of proteins, including seed storage proteins (-conglycinin, glycinin, and

406

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al.

albumin), enzymes (lipoxygenase, chalcone synthase, catalase and urease), enzyme inhibitors (Bowman-Birk inhibitor and Kunitz protease inhibitors), glycosylated proteins (lectin), and peptides (lunasin) [22]. In the screening of peptides with health-promoting attributes the gastrointestinal (GI) enzyme digestion is of major importance. On the one hand, certain ACE inhibitory peptides failed to show in vivo hypotensive activity after oral administration, due to the fact that they are hydrolysed in the GI tract [23], on the other hand, bioavailability of bioactive peptides is needed to exert their effects [15]. Apart from that, during hydrolysis ACE inhibitory peptides are continuously formed and degraded [24]. Thus, with the purpose of evaluating the potential release of ACE-inhibitory peptides from okara protein, firstly, we have emulated the GI digestion (pepsin plus pancreatin) and secondly, we have taken sequential aliquots during the in vitro digestion process [1]. In this chapter we will focus on the pepsin digestion, specifically the ACE-I activities of okara protein hydrolysates (OPH) released by pepsin digestion during 60 min (Figure 1). During pepsin hydrolysis, at the beginning of the digestion ACE-I values reached two maxima at 5 and 10 min (0.45  0.006 ACE-I%/g protein, and 0.38  0.006%/g protein, respectively). The subsequent decrease at 20 min of digestion was 28.73%, and at the end of the pepsin digestion the decrease was about 39.76%, (in all cases regarding the first maximum). These results indicated that OPH showed more inhibition activity against ACE at the beginning of pepsin digestion (0-10 min). According to these results, it is described a maximum of ACE-I at the beginning of physiological hydrolysis in soy [11], and sunflower protein digestion [16]. Moreover, in a rodent model it is shown that the in vitro pepsin digest on spinach leaf protein is more effective than the pepsin-pancreatin digest at the same dosage of 0.5 g/kg after oral administration to spontaneously hypertensive rats [25]. The OPH with the highest ACE-I activity during the time course of hydrolysis (at 5 min) has an IC50 value of 1.52  0.005 µg protein/µL. This dose-response curve follows a logarithmic relation y = 34.608Ln(x) + 35.43 (Figure 2). The IC50 value at 5-min OPH found in this study was slightly higher, but comparable to that found by other authors in soybean under near-physiological hydrolysis treatments. I.e., IC50 value is 0.48 µg/µL for soybean protein hydrolysed (pepsin, 37 ºC, 12 h) [26], 0.28 µg/µL for soy protein hydrolysates (pepsin-pancreatin, 37 ºC, 3h) [11], or in the range 0.24-1.2 µg/µL in anion exchange column chromatography of soy peptides (pepsin, 37 ºC, 24 h) [27]. Most of the reported peptides exhibiting ACE-I activity are of low molecular weight (generally < 12 amino acids). Therefore, a selection of active peptides can be achieved by ultrafiltration [24]. Thus, on the basis of the relatively high DH tested [1], the final pepsin hydrolysate (60-min OPH) was subjected to ultrafiltration to assess the partitioning of active compounds through MWCO membranes. The amino acid composition (Table 1), and the ACE-I activities (Table 2) were assayed in UF peptide fractions from the 60-min OPH, released at the end of the pepsin digestion step.

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara…

407

Figure 1. Time Course (min) of the pepsin hydrolysis of okara protein isolate versus ACE-inhibition (ACE-I) of the hydrolysates

Figure 2. Dose-response curve of the okara protein hydrolysate (OPH) at 5 min. 5-min OPH showed the highest angiotensin-converting enzyme inhibition (ACE-I) activity during time course of pepsin hydrolysis

Amino Acid Profiles of Ultrafiltered Peptides In comparison to the starting 60-min OPH the < 1 kDa fraction has the most different amino acid profile and the > 5 kDa fraction the most similar amino acid profile (Table 1). Among 15 amino acids analyzed, on the basis of significant difference between the UF

408

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al.

fractions and the original 60-min OPH tested, Ala, Phe, and Val contents were less affected by the ultrafiltration process, whereas Asx, Ser, Gly, Thr, Arg, Tyr, Ileu, and Lys, were affected in a medium grade, and Glx, His, Pro, and Leu were highly affected. Apart from that, an increasing trend in hydrophobic amino acids (Ala, Val, Ileu, Leu, Phe) and a decreasing trend in certain hydrophilic amino acids (mainly Asx, Glx, and Lys) were made evident as the MW decreased. Accordingly, it is described in soy protein hydrolysates that Glx, His and Lys, show a decreasing trend through a sequential fractionation of commercial soy protein hydrolysates by ultrafiltration [28]. In addition, as in the present study, these authors also report the lower MW fraction (< 1 kDa) as that fraction with the highest changes in amino acid profile, in comparison to the starting material. Moreover, this study describes that the 510 kDa fraction contains the highest level of Glx, but the lowest levels of the three most hydrophobic amino acids (Leu, Phe, and Trp) among the UF fractions tested, whereas the hydrophobic amino acids increase as the MW decreases, except for Pro. Accordingly, in our study the > 5 kDa fraction showed the highest content in Glx and the lowest content in Leu and Phe and in total hydrophobic amino acid content. Similar features, in terms of polar amino acid characteristics and individual amino acid contents in the different ultrafiltered (UF) fractions, are found at the end of digestion in the pepsin plus pancreatin 255-min OPH in the isolated protein from okara [1]. Table 1. Amino acid profiles of deffated okara, 60-min OPH and its fractions following to sequential ultrafiltration through 5, 3, and 1 kDa MWCO membranes (percent composition)* 60-min OPH

> 5 kDa

3-5 kDa

1-3 kDa

< 1 kDa

Asx Glx Ser His Gly Thr Arg Ala Pro Tyr Val Ileu Leu Phe Lys

Deffated okara 14.1 ± 0.56a 19.4 ± 0.02a 5.97 ± 0.04a 2.61 ± 0.18a 5.18 ± 0.09a 4.80 ± 0.22a 7.46 ± 0.32a 4.68 ± 0.04a 3.17 ± 0.31a 3.28 ± 0.25a 4.63 ± 0.08a 3.95 ± 0.07a 7.64 ± 0.04a 4.81 ± 0.16a 6.32 ± 0.06a

15.2 ± 0.99a 22.1 ± 0.77b 6.23 ± 0.27a 2.90 ± 0.09a 5.31 ± 0.48b 4.30 ± 0.22b 8.16 ± 0.50b 4.61 ± 0.33a 2.65 ± 0.21b 3.70 ± 0.17a 4.95 ± 0.39a 4.29 ± 0.22a 7.66 ± 0.24a 4.83 ± 0.38a 6.34 ± 0.17a

12.4 ± 0.16b 21.2 ± 0.60c 6.40 ± 0.02a 3.56 ± 0.01b 5.27 ± 0.02c 4.31 ± 0.03b 8.83 ± 0.05b 4.35 ± 0.03a 1.58 ± 0.10c 3.23 ± 0.04a 4.62 ± 0.00a 4.00 ± 0.01a 7.16 ± 0.07b 4.67 ± 0.03a 7.31 ± 0.05b

14.3 ± 1.16a 16.8 ± 0.73d 5.31 ± 0.18b 1.63 ± 0.31c 4.68 ± 0.37a 3.75 ± 0.13c 6.22 ± 0.71c 4.52 ± 0.50a 6.08 ± 0.43d 3.03 ± 0.30a 5.01 ± 0.48a 6.05 ± 0.36b 8.54 ± 0.75c 5.47 ± 0.53a 4.63 ± 0.30c

9.80 ± 0.90c 15.0 ± 0.81e 7.66 ± 0.71c 3.31 ± 0.27b 6.29 ± 0.91e 5.79 ± 0.55d 8.94 ± 0.27b 4.65 ± 0.46a 0.71 ± 0.11e 5.14 ± 0.41b 5.17 ± 0.56a 4.54 ± 0.46a 9.00 ± 0.46c 6.84 ± 0.62b 6.25 ± 0.36a

7.53 ± 0.26d 14.5 ± 0.18e 7.58 ± 0.02c 2.12 ± 0.01d 5.79 ± 0.00b 4.95 ± 0.01a 7.17 ± 0.04a 6.49 ± 0.02b 0.61 ± 0.07e 5.00 ± 0.01b 6.47 ± 0.11b 5.35 ± 0.06c 11.3 ± 0.02d 8.80 ± 0.09c 5.06 ± 0.02c

TH

28.60±0.32a

28.99±0.39a

26.38±0.11b

35.67±0.76c

31.01±0.61d

39.02±0.10e

*OPH = Okara Protein Hydrolysate; 60-min OPH = Okara Protein Hydrolysate obtained after digestion with pepsin; MWCO = Molecular weight cut-off. Values are expressed as the mean value  standard deviation of two independent determinations. TH = Total Hydrophobic Amino Acids = Ala, Pro, Val, Ileu, Leu, Phe. Column wise values of same superscript letter indicate no significant difference (P < 0.05) among amino acids.

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara…

409

Table 2. Angiotensin-converting enzyme inhibition (ACE-I) activity of 60-min OPH and its fractions following to sequential ultrafiltration through 5, 3, and 1 kDa MWCO membranes* Okara protein hydrolysates 60-min OPH > 5 kDa 3-5 kDa 1-3 kDa < 1 kDa

Angiotensin-Converting Enzyme Inhibition Activity 0.33 ± 0.08 0.32 ± 0.02 0.26 ± 0.01 0.15 ± 0.00 4.87 ± 0.71

*ACE-I = Inhibition %/g protein; OPH = Okara Protein Hydrolysate; 60-min OPH = OPH obtained after digestion with pepsin; MWCO = Molecular weight cut-off

ACE-I Activity of Ultrafiltered Peptides Except for the < 1 kDa MWCO fraction, the UF fractions showed lower ACE-I activities than the original 60-min OPH (Table 2), as it is found i.e. in potato protein hydrolysates subjected to ultrafiltration [14]. The UF fraction lower than 1 kDa MWCO showed the highest ACE-I activity (ten-fold the original 60-min OPH) indicating that the most potent ACE-I compounds were mainly partitioned into that fraction, which is consistent with previous studies that also describe peptides, released under physiological conditions from soy isolated protein, having low molecular masses with ACE inhibitory activity [11]. When the amino acid content was taken into account (Table 1), the present results showed that after ultrafiltration, the hydrophobic amino acid content in the fractions containing the peptides with lower MWCO, < 1 kDa MWCO, 1-3 kDa MWCO, and < 3-5 kDa MWCO UF fractions, was significantly higher than those in the rest of UF fractions tested and in 60-min OPH. The most ACE-I effective fraction (< 1 kDa) had lower content of amino acids Asx, Glx, and His but higher content of the hydrophobic amino acids Ala, Val, Ile, Leu, and Phe, than the original 60-min OPH, and the other UF fractions tested. In the case of Ile, its content in 1kDa fraction was higher than in the other UF fractions and the original 60-min OPH, except for the 3-5 kDa MWCO fraction. Accordingly, it is reported that peptides with hydrophobic and aromatic amino acids at the C-terminal are among the most favorable for strong competitive binding to ACE [11]. Moreover, Val and Leu are considered the two most frequently found hydrophobic amino acids in ACE inhibitory soy peptides [11]. Regarding ACE-I, the role of Phe in peptides remains controversial, since it is described the lack of influence of this amino acid in the soy protein hydrolysates obtained under physiological conditions [11]. If we consider individual amino acid content in UF fractions and in 60 min-OPH, a significant correlation was found between ACE-I and individual amino acid content in the case of the hydrophobic amino acid Ala (P < 0.0017).

410

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al.

CONCLUSION The physiological enzyme pepsin used to digest in vitro okara protein, released potentially bioactive peptides with relatively high ACE inhibition activity. The ACE-I activity tested might be related to both the hydrophobic amino acid content and the low-molecular weight of peptides on the OPH. Therefore, on the basis of the bioavailability of these peptides, okara protein, a by-product from the soymilk industry, might be used as a functional food ingredient with health-promoting effects. Further research on animal model is necessary to verify the potential ACE-I activity tested of these peptides released by in vitro pepsin digestion.

ACKNOWLEDGMENTS The Spanish Ministry of Science and Innovation through Projects AGL2008-0998 and AGL2007-63580, and the European Union through FEDER funds supported this research. Thanks are given to M. Takazumi from Toofu-Ya S.L. for the okara provided. AJ-E acknowledges Professor F. Millán for the opportunity and facilities given during his short-term scientific mission to learn the methodology of bioactive peptides at the Department of Physiology and Technology of Plant Products, Instituto de la Grasa, CSIC.

ABBREVIATIONS USED 60-min ACE ACE-I Ala ANOVA Arg Asx dm DH GI Glx Gly His HHL IC50, Ile Leu Lys MW MWCO

OPH okara protein hydrolysate at the end (60 min) of the pepsin step digestion angiotensin-converting enzyme angiotensin-converting enzyme inhibition alanine one-way analysis of variance arginine asparagine plus aspartic acid dry matter degree of hydrolysis gastrointestinal glutamine plus glutamic acid glycine histidine hippuryl-L-histidyl-L-leucine concentration of peptide (µg/µL) required to inhibit ACE activity by 50% isoleucine leucine lysine molecular weight molecular weight cut-off

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara… OPH Phe PMSF Pro Ser Thr TNBS Trp Tyr UF Val

411

okara protein hydrolysate phenylalanine phenylmethylsulfonyl fluoride proline serine threonine trinitrobenzenesulfonic acid tryptophan tyrosine ultrafiltered valine

REFERENCES [1]

Jiménez-Escrig, A., Alaiz, M., Vioque, J. & Rupérez, P. (2010). Health-promoting activities of ultra-filtered okara protein hydrolysates released by in vitro gastrointestinal digestion: Identification of active peptide from soybean lipoxygenase. Eur. Food Res. Technol., 230(4), 655-663. [2] Kris-Etherton, P. M., Hecker, K. D., Bonanome, A., Coval, S. M., Binkoski, A. E. & Hilpert, K. F., et al. (2002). Bioactive compounds in foods: Their role in the prevention of cardiovascular disease and cancer. Am. J. Med., 113(9S2),71S-88S. [3] Willett, W. C. (1994). Diet and health: What should we eat? Science, 264(5158), 532537. [4] O'Toole, D. K. (1999). Characteristics and use of okara, the soybean residue from soy milk production - A review. J. Agric. Food Chem., 47(2), 363-371. [5] Van der Riet, W. B., Wight, A. W., Cilliers, J. J. L. & Datel, J. M. (1989). Food chemical investigation of tofu and its byproduct okara. Food Chem., 34(3), 193-202. [6] Espinosa-Martos, I. & Rupérez, P. (2009). Indigestible fraction of okara from soybean: composition, physicochemical properties and in vitro fermentability by pure cultures of Lactobacillus acidophilus and Bifidobacterium bifidum. Eur. Food Res. Technol., 228(5), 685-693. [7] Surel, O. & Couplet, B. (2005). Influence of the dehydration process on active compounds of okara during its fractionation. J. Sci. Food Agric., 85(8), 1343-1349. [8] Préstamo, G., Rupérez, P., Espinosa-Martos, I., Villanueva, M. J. & Lasunción, M. A. (2007). The effects of okara on rat growth, cecal fermentation, and serum lipids. Eur. Food Res. Technol., 225(5-6), 925-928. [9] Jiménez-Escrig, A., Tenorio, M. D., Espinosa-Martos, I. & Rupérez, P. (2008). Healthpromoting effects of a dietary fiber concentrate from the soybean byproduct okara in rats. J. Agric. Food Chem., 56(16), 7495-7501. [10] Wu, J. & Ding, X. (2001). Hypotensive and physiological effect of angiotensin converting enzyme inhibitory peptides derived from soy protein on spontaneously hypertensive rats. J. Agric. Food Chem., 49(1), 501-506.

412

Antonio Jiménez-Escrig, Manuel Alaiz, Javier Vioque et al.

[11] Lo, W. M. Y. & Li-Chan, E. C. Y. (2005). Angiotensin I converting enzyme inhibitory peptides from in vitro pepsin-pancreatin digestion of soy protein. J. Agric. Food Chem., 53(9), 3369-3376. [12] Ondetti, M. A. & Cushman, D. W. (1982). Enzymes of the renin-angiotensin system and their inhibitors. Annu. Rev. Biochem., 51, 283-308. [13] Hartmann, R. & Meisel, H. (2007). Food-derived peptides with biological activity: from research to food applications. Curr. Opin. Biotechnol., 18(2), 163-169. [14] Pihlanto, A., Akkanen, S. & Korhonen, H. J. (2008). ACE-inhibitory and antioxidant properties of potato (Solanum tuberosum). Food Chem., 109(1), 104-112. [15] Vermeirssen, V., Van Camp, J., Devos, L. & Verstraete, W. (2003). Release of angiotensin I converting enzyme (ACE) inhibitory activity during in vitro gastrointestinal digestion: From batch experiment to semicontinuous model. J. Agric. Food Chem., 51(19), 5680-5687. [16] Megías, C., Yust, M. M., Pedroche, J., Lquari, H., Girón-Calle, J., Alaiz, M., Millán, F. & Vioque, J. (2004). Purification of an ACE inhibitory peptide after hydrolysis of sunflower (Helianthus annuus L.) protein isolates. J. Agric. Food Chem., 52(7), 19281932. [17] Hayakari, M., Kondo, Y. & Izumi, H. (1978). A rapid and simple spectrophotometric assay of angiotensin-converting enzyme. Anal. Biochem., 84(2), 361-369. [18] Megías, C., Pedroche, J., Yust, M. M., Alaiz, M., Girón-Calle, J., Millán, F. & Vioque, J. (2006). Immobilization of angiotensin-converting enzyme on glyoxyl-agarose. J. Agric. Food Chem., 54(13), 4641-4645. [19] Cushman, D. W., Cheung, H. S., Sabo, E. F. & Ondotti, M. A. (1978). Design of new antihypertensive drugs: Potent and specific inhibitors of angiotensin-converting enzyme. Prog. Cardiovasc. Dis., 21(3), 176-182. [20] Alcaide-Hidalgo, J. M., Pueyo, E., Polo, M. C. & Martínez-Rodríguez, A. J. (2007). Bioactive peptides released from Saccharomyces cerevisiae under accelerated autolysis in a wine model system. J. Food Sci., 72(7), M276-M279. [21] Alaiz, M., Navarro, J. L., Giron, J. & Vioque, J. (1992). Amino acid analysis of highperformance liquid chromatography after derivatization with diethyl ethoxymethylenemalonate. J. Chromatogr., 591(1-2), 181-186. [22] Wang, W., Rupasinghe, S. G., Schuler, M. A. & De Mejia, E. G. (2008). Identification and characterization of topoisomerase II inhibitory peptides from soy protein hydrolysates. J. Agric. Food Chem., 56(15), 6267-6277. [23] Wu, J. & Ding, X. (2002). Characterization of inhibition and stability of soy-proteinderived angiotensin I-converting enzyme inhibitory peptides. Food Res. Int., 35(4), 367-375. [24] Van der Ven, C., Gruppen, H., De Bont, D. B. A. & Voragen, A. G. J. (2002). Optimisation of the angiotensin converting enzyme inhibition by whey protein hydrolysates using response surface methodology. Int. Dairy J., 12(10), 813-820. [25] Yang, Y., Marczak, E. D., Usui, H., Kawamura, Y. & Yoshikawa, M. (2004). Antihypertensive Properties of Spinach Leaf Protein Digests. J. Agric. Food Chem., 52(8), 2223-2225. [26] Chen, J., Yang, S., Suetsuna, K. & Chao, J. C. (2004). Soybean protein-derived hydrolysate affects blood pressure in spontaneously hypertensive rats. J. Food Biochem., 28(1), 61-73.

In Vitro Inhibitory Activity on Angiotensin-Converting Enzyme of Okara…

413

[27] Chen, J., Okada, T., Muramoto, K., Suetsuna, K. & Yang, S. (2002). Identification of angiotensin I-converting enzyme inhibitory peptides derived from the peptic digest of soybean protein. J. Food. Biochem, 26(6), 543-554. [28] Cho, M. J., Unklesbay, N., Hsieh, F. & Clarke, A. D. (2004). Hydrophobicity of bitter peptides from soy protein hydrolysates. J. Agric. Food Chem., 52(19), 5895-5901.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 17

USE OF SOY PEPTONES FOR STREPTOCOCCUS PNEUMONIAE CULTIVATION FOR VACCINE PRODUCTION C. Liberman, D. Kolling, R. S. Sari, M. Takagi, J. Cabrera Crespo, M. E. Sbrogio Almeida, J. G. C. Pradella, L. C. C. Leite and V. M. Gonçalves Laboratório de Bioprocessos, Centro de Biotecnologia, Instituto Butantan, São Paulo SP, Brazil

ABSTRACT S. pneumoniae is a pathogen that affects the human respiratory tract, causing otitis media, sinusitis, pneumonia, meningitis and sepsis. Pneumococcus is a fastidious anaerobic fermentative microorganism that produces mainly lactate. S. pneumoniae isolation and cultivation is commonly done using animal-sourced media, such as Brain and Heart Infusion, Todd-Hewitt, hydrolyzed casein derivates, etc., frequently supplemented with whole blood or serum. Although these media are appropriate for clinical diagnosis, they are unsuitable for vaccine production process, since they may cause prion related diseases. Hence, regulatory authorities such as FDA and WHO recommend replace all animal source medium whenever possible. In order to replace Todd-Hewitt (THY) and acid hydrolyzed casein (AHC) media, enzymatically hydrolyzed soybean meal (EHS) had been tested for pneumococcal vaccine production. The microorganism was cultivated in static flasks using three different media THY, AHC and EHS and in 10L-bioreactors using AHC or EHS media. In flasks, the biomass was 1.7 times higher in AHC and 2.3 times higher in EHS than in THY. In pH-controlled bioreactors, the biomass production using EHS was 2.5 times higher than that using AHC medium. Further improvement was obtained performing fed-batch culture using concentrated EHS in the feeding medium. The fed-batch strategy increased the biomass production twice when compared to the simple batch cultivation. This soy based medium was shown to be satisfactory for this fastidious bacterium and met the requirements for human vaccine production.

416

C. Liberman, D. Kolling, R. S. Sari et al.

INTRODUCTION S. pneumoniae is a pathogen that affects the human respiratory tract, causing otitis media, sinusitis, pneumonia, meningitis and sepsis. In industrialized countries, the annual incidence of invasive pneumococcal disease is 8-34 cases/100,000 inhabitants, most of them occurs in children under 2 years old and elderly over 65 (WHO, 2008). Although there are no data on the incidence of pneumococcal disease in Brazil, the frequency of hospitalization due to pneumonias was 2,500 cases/100,000 inhabitants, and the mortality rate from respiratory disease reached 25 cases/100,000 inhabitants in children under 5 years old, most of them caused by S. pneumoniae (Bricks and Berezin, 2006). In addition, the annual risk rate of community-acquired pneumonia was estimated at 566 cases/100,000 children under 5 years old (Andrade et al, 2004). Currently, there are two kinds of commercial vaccines against S. pneumoniae; both are based on the protection given by the capsular polysaccharide (PS): the 23-valent polysaccharide vaccine, which is composed by purified polysaccharides from 23 different serotypes and recommended for adult population only; the conjugate vaccines, which are composed by polysaccharides from 7 to 13 different serotypes covalently linked to carrier proteins and the sole that are effective in children under 2 years old. Since there are more than 90 known serotypes of S. pneumoniae, each one with a different capsular polysaccharide, the current vaccines present irregular coverage around the world. For instance, the serotypes coverage projected for the pneumococcal conjugate vaccines are relatively low in Brazilian children under 5 years old: 58.4%, 59.3% and 72% for 7-, 10- or 13-valent vaccines, respectively (Franco et al, 2010). This low coverage has been correlated with serotype replacement, i.e., while the incidence of vaccine serotypes diminishes in the population, the incidence of non-vaccine serotypes rises. Besides, the prices of conjugate vaccines have been an obstacle for their adoption in mass immunization programs. In order to solve the problems of serotype replacement, vaccine coverage and vaccination costs, protein-based vaccines (Tai, 2006) and a whole-cell inactivated vaccine (Malley, 2010) are being proposed. Pneumococcus is a fastidious anaerobic fermentative microorganism that produces mainly lactate. S. pneumoniae isolation and cultivation is commonly done using animalsourced media, such as Brain and Heart Infusion (Kanclerski and Mollby, 1987), ToddHewitt (Malley et al, 2001), hydrolyzed casein derivates (Rane and Subbarow, 1940; Adams and Roe, 1945; Hoeprich, 1955; Weiser et al, 2001), frequently supplemented with whole blood or serum. Although these media are appropriate for clinical diagnosis and laboratory studies, the use of animal derived materials for vaccine production is surrounded by questions about the risks of transmission of spongiform encephalopathy (Mackay and Kriz, 2010). Transmissible spongiform encephalopathies (TSE) are chronic, progressive and fatal neurodegenerative disorders of both animals and humans, which are caused by a prion protein that requires long incubation periods for development of the disease (Collinge, 2001). Animal TSEs include the sheep disease, scrapie, and the cow disease, bovine spongiform encephalopathy (BSE). Human TSEs include Creutzfeldt-Jakob disease (CJD), Kuru, and Gerstmann-Straussler-Scheinker syndrome. In 1995, a variant form of CJD (vCJD) was described and associated to the transmission of BSE to humans (Tan et al, 1999). This has

Use of Soy Peptones for Streptococcus Pneumoniae Cultivation …

417

caused significant concern about the potential transmission of BSE to man not only by food but also via pharmaceutical products (CDC, 2000). Although no evidence exists that cases of vCJD are related to the use of vaccines, there are recommendations from WHO that vaccine manufacturers should avoid whenever possible the use of materials from animal origin. If it is not feasible to replace those materials, they must be obtained from negligible TSE-risk herds, i.e., all the animal alive at the moment of certifications have never been exposed to any source of infection and have no epidemiological link with TSE cases (Mackay and Kriz, 2010; WHO, 2003). In the literature, there are few works on S. pneumoniae cultivation in bench scale aiming vaccine production. Most of them use casein-based medium for capsular polysaccharide production (Yavordios and Cousin, 1983; Kim et al, 1996; Suarez et al, 2001; Sheng-De et al, 2009; Massaldi et al, 2010), including one patent from Institut Mérieux, at present SanofiAventis (Institut Mérieux, 1980). Our laboratory has developed cultivation processes for capsular PS production from Haemophilus influenzae type b (Takagi et al, 2003 and 2006) and S. pneumoniae serotypes 23F (Gonçalves et al, 2002 and 2006) and 6B (Gonçalves et al, 2007) and for pneumococcal whole-cell vaccine production (Liberman et al, 2008). The cultivation of H. influenzae for the production of the vaccine antigen, namely the capsular PS polyribosylribitol phosphate is traditionally done using enzymatically hydrolyzed soybean meal, EHS (Carty et al, 1985; Hilleman et al, 1984; Marburg et al, 1989). However, when EHS was tested in flasks for pneumococcal polysaccharide 23F production, an increase in biomass was observed, but the polysaccharide formation was lower than that obtained using acid hydrolyzed casein, AHC (Gonçalves et al, 2002). On the other hand, for pneumococcal whole-cell vaccine production, where the biomass is the product of interest, the use of EHS greatly increased the cell concentration in comparison to AHC (Liberman et al, 2008). Further improvement was obtained through a fed-batch culture, where concentrated EHS medium was fed into the reactor at a constant flow rate after an initial batch phase (Kolling et al, manuscript in preparation).

MATERIALS AND METHODS Culture Media For flask cultivation of S. pneumoniae serotype 23F, four different media were employed, their composition was the same shown on Table 1, except for glucose concentration that was 6.25 g/L or 18.75 g/L in each medium containing either 20 g/L AHC or 20 g/L EHS. For flask cultivation of non-encapsulated S. pneumoniae, three media were tested: Todd-Hewitt supplemented with 0.5% yeast extract, AHC and EHS20 (Table 1). The composition of all media used for bioreactor cultivation is shown on Table 1. Todd–Hewitt, yeast extract, AHC (Casamino acids), and EHS (Soytone) were supplied by BD-Difco, USA. All other chemicals were of analytical grade.

418

C. Liberman, D. Kolling, R. S. Sari et al. Table 1. Media composition in g/L for S. pneumoniae cultivation

acid hydrolyzed casein enzymatically hydrolyzed soy glucose yeast extract Complementary components

AHC 20

batch EHS5

EHS20

4X EHS5

feeding 4X EHS20

10X EHS20

5

20

20

80

200

20 20 20 80 80 200 20 20 20 80 80 200 5.0 g/L K2HPO4, 1.0 g/L NaHCO3, 0.625 g/L L-glutamine, 0.10 g/L asparagine, 0.01g/L choline, 0.10 mL/L thioglycolic acid, 0.50 g/L MgSO4.7H2O, 5.0 mg/L FeSO4.7H2O, 0.8 mg/L ZnSO4.7H2O, 0.36 mg/L MnSO4.H2O

All media were adjusted to pH 7.5 and sterilized by filtration in 0.22 m.

Microorganisms The strain St 99/95 of S. pneumoniae serotype 23F is a clinical isolate supplied by the Instituto Adolfo Lutz, Seção de Bacteriologia, SP, Brazil. Two different non-encapsulated strains of S. pneumoniae were used: Rx1 lytA- kanR and Rx1 PdT lytA- kanR; both are Rx1 derived from D39 serotype 2 strains with loss of encapsulation and have identical growth profiles in all media used in this study. They only differ in the activity of the pneumolysin, in the Rx1 PdT lytA- kanR strain the pneumolysin gene was replaced by a detoxified mutant PdT. These strains were obtained by insertionduplication mutagenesis of the chromosomal autolysin gene (lytA) where the kanamycin resistance gene (kanR) was used to select the mutants with the disrupted lytA gene, as described in detail by Lu et al (2010). These strains were kindly supplied by Dr. Malley (Division of Infectious Diseases, Harvard School of Public Health, Boston, USA).

Flask Cultivation For S. pneumoniae serotype 23F, frozen stock culture (1 ml) was used to inoculate four chocolate agar (Gibco, USA) tubes. The tubes were incubated at 36 °C and 3% CO2 for 16 h and two precultures were static-cultivated in Hoeprich‘s medium (Hoeprich, 1955) at 36 °C before inoculating 300-ml flasks containing 100 ml of medium to obtain an initial optical density (OD) of 0.1 at 600 nm. The flasks were incubated at 36 °C and 3% CO2 for 12 h. The non-encapsulated pneumococcal strains were grown in static flasks at 36 °C and 3% CO2. For the pre-culture, 50 mL AHC, EHS or THY medium was inoculated with 100 l frozen stock cultures and incubated at 36 °C and 3% CO2 for 11 h. The culture was transferred to tubes containing 50 ml of AHC, EHS or THY medium in order to obtain an initial OD of 0.1. The tubes were incubated at 36 °C and 3% CO2. Samples were collected in

Use of Soy Peptones for Streptococcus Pneumoniae Cultivation …

419

1-h interval up to the beginning of the exponential phase, and after this phase in intervals of 30 min, in order to monitor OD and pH.

Batch Cultivation in Bioreactors The non-encapsulated strains were cultured in 5 or 10 L bioreactors (BioFlo 2000, New Brunswick, USA) with AHC- or EHS-based medium (Table 1). Frozen stock culture (100 l) was used to inoculate 500 mL of the medium and the cell suspension was incubated at 36 °C and 3% CO2 for 11 h. This pre-culture was inoculated into the bioreactor in order to obtain an initial OD of 0.1. Batch cultures were carried out in at 36 °C, 150 rpm, 0.5 L/min N2, and 0.1 bar. When AHC-based medium was employed, the culture was performed with or without pH control. All cultures with EHS medium were carried out with pH control. The pH was controlled at 7.0 by addition of 5 M NaOH. Polypropylene glycol was used as an antifoam agent. Samples were harvested for analyses.

Fed-Batch Cultivation in Bioreactors The non-encapsulated strains were also cultured in 10-L bioreactors (BioFlo 2000, New Brunswick, USA) using four conditions for fed-batch cultivation. In this operation mode of the bioreactor, concentrated medium was added into the reactor at a constant flow rate after an initial batch. The batch and concentrated feeding media as well as the start of feeding and the feeding flow rate are shown on Table 2. The inoculum was prepared in static flasks as described above for simple batch and the fed-batch essays were carried out in the same conditions described for simple batch, except the stirring rate that was 200 rpm to guarantee the appropriate mixing of the feeding medium.

Analytical Methods The cell concentration was measured by OD, which was correlated to dry cell weight, according to the calibration curve prepared as previously described [3]. Hence, it was calculated that one unit of OD corresponds to 0.45 g/L of dry cell weight (DCW). Table 2. Fed-batch conditions for non-encapsulated S. pneumoniae cultivation condition

batch medium*

feeding medium*

1 2 3 4

EHS 5 EHS 5 EHS 20 EHS 20

4X EHS 5 4X EHS 5 4X EHS 20 10X EHS 20

*Composition is shown on Table 1

OD at start of feeding 4.0 4.0 4.0 6.0

feeding flow rate (L/h) 0.40 0.50 0.72 0.20

420

C. Liberman, D. Kolling, R. S. Sari et al.

After centrifugation of samples at 12,000 g for 10 min, the supernatant was used to determine the concentration of organic acids and carbohydrates by high-performance liquid chromatography (HPLC, Shimadzu), using an Aminex HPX 87H column (300 x 7.8 mm, BioRad) at 60 °C with 5 mM H2SO4 as mobile phase at flow rate of 0.6 mL/min. Carbohydrates were detected by Refractive Index Detector (RID), and organic acids by UV at 210 nm. The total PS 23F concentration was determined from the whole culture (cell-bound plus soluble) by the following procedure: samples were treated with 1% sodium deoxycholate to achieve cellular lysis and centrifuged at 17,696 g for 1 h to remove cellular debris. The supernatant was then diafiltered and concentrated by tangential filtration in a hollow-fiber membrane of 100 kDa cut-off (Amicon, USA). The concentration of PS 23F was determined as rhamnose (Dische and Shettles, 1948) after extensive dialysis against distilled water. According to the PS formula (Richards and Perry, 1988), the rhamnose concentration was multiplied by 2.3 to obtain the PS concentration.

RESULTS AND DISCUSSION S. pneumoniae serotype 23F was cultivated in flasks using either AHC or EHS at two glucose concentration in order to verify both: if the EHS could replace the AHC as nitrogen source in the medium and if the glucose concentration could influence the capsular PS production. It can be observed on Table 3 that the biomass increased when EHS was used in presence of 18.75 g/L glucose, but not with 6.25 g/L glucose. On the other hand, the capsular PS production was higher using AHC whatever the glucose concentration. Also, the final pH was lower using EHS in flasks, probably due to the presence of carbohydrates in EHS composition (approx. 300 mg/g, BD Bionutrients Technical Manual). Table 3. Comparison of acid hydrolyzed casein and enzymatically hydrolyzed soybean meal based media with different glucose concentrations for polysaccharide and biomass production by S. pneumoniae serotype 23F in flasks Medium composition

1

Hydrolyzed (20 g/L) casein

Glucose (g/L) 6.25

2

casein

3

soy

6.25

4

soy

18.75

18.75

biomassa (gCDW/L) 1.15 1.27 1.03 1.07 1.03 1.14 1.31 1.21

total PSb (mg/L)

167 174 213 210 90 106 167 168

PS/biomass (mgPS/gCDW) 145 137 207 196 87 93 127 139

final pH

4.90 4.89 4.79 4.80 4.76 4.74 4.64 4.64

Results of two independent essays. a – CDW, cell dry weight; b – cell-bound plus free polysaccharide

Use of Soy Peptones for Streptococcus Pneumoniae Cultivation …

421

Since AHC seemed to be better for PS production in flasks, it was employed for bioreactor cultivation of different pneumococcal serotypes and it was also tested for the whole-cell vaccine production in order to replace the THY, which is not allowed for industrial vaccine production. It can be seen in Figure 1 that the biomass increased from OD 1.5 to OD 2.5 using AHC medium instead of THY in flask cultivation. In bioreactor, it was obtained the same OD as in flask when the pH was not controlled, i.e., flask and bioreactor cultures were done in the same conditions (Figure 1). In pH-controlled reactor, the biomass reached OD 3.5 using AHC medium, the same OD as in flask using EHS medium, but the biomass production using EHS was 2.5 times higher than that using AHC medium in bioreactor with pH control (Figure 1). The hydrolyzed soybean meal concentration of EHS based medium was reduced from 20 g/L to 5 g/L to facilitate the design of fed-batch conditions, in which a concentrated medium was required for feeding. The growth profile, organic acids production and glucose consumption were similar to that obtained using 20 g/L hydrolyzed soybean meal in batch, but the final OD was lower using 5 g/L. When the fed-batch was performed with 5 g/L EHS based medium, the growth phase was extended and the final OD reached 10.4 (Figure 2). Therefore the biomass in fed-batch was higher than the one achieved in 20 g/L EHS simple batch, where the final OD reached 8.9 (Figure 1). The lactic acid production was associated to bacterial growth profile; therefore both curves were well coincident during the exponential growth phase in all conditions tested (Figure 2). flask 10

reactor AHC without pH control AHC pH 7.0 EHS pH 7.0

THY AHC EHS

9 8

OD 600nm

7 6 5 4 3 2 1 0 0

1

2

3

4

time (h)

5

6

7

0

1

2

3

4

5

6

7

time (h)

Figure 1. Growth profile of non-encapsulated S. pneumoniae in flasks and bioreactor simple batch cultures using different media and influence of pH control on biomass production. Stars: THY – ToddHewitt supplemented with 0.5% yeast extract in flask; open triangles: AHC – acid hydrolyzed casein (20 g/L) based medium without pH control in flask or reactor; closed triangles: AHC – acid hydrolyzed casein (20 g/L) based medium in pH-controlled reactor; closed circles: EHS – enzymatically hydrolyzed soybean meal (20 g/L) based medium in flask; open circles: EHS – enzymatically hydrolyzed soybean meal based medium (20 g/L) in pH-controlled reactor

422

C. Liberman, D. Kolling, R. S. Sari et al. batch EHS 5 g/L batch EHS 20 g/L fed-batch EHS 5 g/L

12 25

10

20

glucose (g/L)

OD 600nm

8 6 4 2

10 5

0 -1

15

0

1

2

3

4

5

6

7

8

-1

time (h)

30

0

1

2

25

3

4

5

6

7

8

6

7

8

time (h)

10 8

acetate (g/L)

lactate (g/L)

20 15 10 5

6 4 2

0 0 -1

0

1

2

3

4

time (h)

5

6

7

8

0

1

2

3

4

5

time(h)

Figure 2. Comparison of batch and fed-batch cultures of non-encapsulated S. pneumoniae in 10 L pHcontrolled bioreactors using enzymatically hydrolyzed soybean meal (EHS) based medium. Open circles: batch culture using 20 g/L EHS; squares: batch culture using 5 g/L EHS; stars: fed-batch culture using 5g/L EHS for the initial batch and feeding with 4-fold concentrated medium at 0.4 L/h (Table 2, condition 1)

Four different fed-batch conditions were compared (Table 2), aiming to identify in which condition the biomass production would be maximized, while minimizing the medium consumption. Although small increases on biomass were obtained using either higher feeding flow rate or higher EHS concentration in the feeding medium, the final OD did not change much (Figure 3). The lactic and acetic acids production was higher using 20g/L EHS based medium for the initial batch (Figure 3). The glucose consumption profile was not significantly affected by any of tested conditions, except for a small glucose accumulation when the 200g/L feeding medium (10X EHS 20) was added (Figure 3). As a consequence of the small differences in the final biomass, a cost-benefit analysis was done to check the best condition for vaccine production (Table 4). Hence, the fed-batch with 5g/L EHS and feeding flow rate 0.5 L/h spent almost the same amount of EHS than the simple batch, but produced 190% more biomass, increasing the yield coefficient from 0.10 to 0.17 (Table 4). However, to increase from OD 9.5 to 10.0, five times more EHS was spent, and from OD 9.5 to 11.5, four times more EHS was needed, diminishing the yield coefficient from 0.17 to 0.03 and 0.05, respectively (Table 4). In comparison to simple batch, the fedbatch strategy with 5 g/L EHS allowed maximizing the biomass yield and saving hydrolyzed soybean meal.

Use of Soy Peptones for Streptococcus Pneumoniae Cultivation … EHS 5 g/L feeding 0.4 L/h 4X EHS 5 EHS 5 g/L feeding 0.5 L/h 4X EHS 5 EHS 20 g/L feeding 0.72 L/h 4X EHS 20 EHS 20 g/L feeding 0.2 L/h 10X EHS 20

25

12

20

Glucose (g/L)

OD 600nm

16 14 10 8 6 4

423

15 10 5

2 0

0 0 1 2 3 4 5 6 7 8 9 10 11 12

0 1 2 3 4 5 6 7 8 9 10 11 12

time (h)

time (h)

10

60 8

Acetic acid (g/L)

Lactic acid (g/L)

50 40 30 20 10 0

6 4 2 0

0 1 2 3 4 5 6 7 8 9 10 11 12

0 1 2 3 4 5 6 7 8 9 10 11 12

time (h)

time (h)

Figure 3. Fed-batch cultures of non-encapsulated S. pneumoniae in 10 L pH-controlled reactors with 5 or 20 g/L enzymatically hydrolyzed soybean meal (EHS) based medium under different feeding conditions. Squares: initial batch with 5 g/L EHS and feeding with concentrated medium 4X EHS 5 at 0.4 L/h (Table 2, condition 1); open circles: the same as before, but feeding at 0.5 L/h (Table 2, condition 2); open triangles: initial batch with EHS 20 g/L and feeding with concentrated medium 4X EHS 20 at 0.72 L/h (Table 2, condition 3); closed triangles: initial batch with EHS 20 g/L and feeding with concentrated medium 10X EHS 20 at 0.2 L/h (Table 2, condition 4)

Table 4. Comparison of different culture conditions for production of inactivated whole-cell vaccine: relationship between enzymatically hydrolyzed soybean meal in the medium and biomass production. Condition

EHSa (g)

OD at harvesting

simple batch 50 5.0 EHS 5 g/L simple batch 200 6.5 EHS 20 g/L fed-batch EHS 56 9.0 5 g/L fed-batch EHS 57 9.5 5 g/L fed-batch EHS 287 10.0 20 g/L fed-batch EHS 227 11.5 20 g/L a EHS – enzymatically hydrolyzed soybean harvesting/EHS amount

Feeding Flow Rate (L/h) -

0.10

Biomass increase (%) 100

EHS relative amount (%) 100

-

0.03

130

400

0.4

0.16

180

112

0.5

0.17

190

114

0.72

0.03

200

574

0.20

0.05

230

454

meal;

b

Yield coefficientb

The yield coefficient was calculated as OD at

424

C. Liberman, D. Kolling, R. S. Sari et al.

Even though preliminary studies in flasks for PS production did not show any benefit of AHC replacement by EHS, it would be worth to evaluate the use of soy based medium for PS production in pH-controlled bioreactor, because if the biomass increases as it was observed for non-encapsulated S. pneumoniae, an augment of PS production would be expected as well. Moreover, the replacement of casein by soybean in the culture medium would decrease the vaccine production costs, inasmuch as hydrolyzed casein is about 2.5 times more expensive than hydrolyzed soybean meal. The use of soy based medium for vaccine production is very promising in view of the fact that it fulfills the regulatory requirements for biological products and allows vigorous bacterial growth, whereas reduces the vaccine production costs.

ACKNOWLEDGMENTS We are very grateful to Dr. Richard Malley for supplying the strains and to PATH for providing support for this project and to São Paulo Research Foundation (FAPESP, 08/10364-1) for financial support.

REFERENCES Adams, M. H. & Roe, A. S. (1945). A partially defined medium for cultivation of pneumococcus. J Bacteriol, 49, 401-9. Andrade, A. L., Silva, S. A., Martelli, C. M., Oliveira, R. M., Morais Neto, O. L., Siqueira Júnior, J. B., Melo, L. K. & Di Fábio, J. L. (2004). Population-based surveillance of pediatric pneumonia: use of spatial analysis in an urban area of Central Brazil. Cad Saude Publica, 20, 411-21. Bricks, L. F. & Berezin, E. (2006). Impact of pneumococcal conjugate vaccine on the prevention of invasive pneumococcal diseases. J Pediatr (Rio J), 82, S67-74. Carty, C. E., Mancinelli, R., Hagopian, A., Kovach, F. X., Rodriguez, E., Burke, P., Dunn, N. R., McAleer, W. L., Maigetter, R. Z. & Kniskern, P. (1985). Fermentation studies with Haemophilus influenzae. Dev Indust Microbiol, 26, 763-7 Centers for Disease Control and Prevention, CDC, (2000). Public health service recommendations for the use of vaccines manufactured with bovine-derived materials. Morb Mortal Wkly Rep, 49, 1137-8. Collinge, J. (2001). Prion diseases of humans and animals: their causes and molecular basis. Annu Rev Neurosci, 24, 519-50. Dische, Z. & Shettles, L. B. A. (1948). A specific color reaction of methylpentoses and a spectrophotometric micromethod for their determination. J Biol Chem, 75, 595-603. Franco, C. M., Andrade, A. L., Andrade, J. G., Almeida e Silva, S., Oliveira, C. R., Pimenta, F. C., Lamaro-Cardoso, J., Brandão, A. P., Almeida, S. C., Calix, J. J., Nahm, M. H. & de Cunto Brandileone, M. C. (2010). Survey of nonsusceptible nasopharyngeal Streptococcus pneumoniae isolates in children attending day-care centers in Brazil Pediatr Infect Dis J, 29, 77-9.

Use of Soy Peptones for Streptococcus Pneumoniae Cultivation …

425

Gonçalves, V. M., Zangirolami, T. C., Giordano, R. L. C., Raw, I., Tanizaki, M. M. & Giordano, R. C. (2002). Optimization of medium and cultivation conditions for capsular polysaccharide production by Streptococcus pneumoniae serotype 23F. Appl Microbiol Biotechnol, 59, 713-7. Gonçalves, V. M., Takagi, M., Carneiro, S. M., Giordano, R. C. & Tanizaki, M. M. (2006). Introduction of air in the anaerobic culture of Streptococcus pneumoniae serotype 23F induces the release of capsular polysaccharide from bacterial surface into the cultivation medium. J Appl Microbiol, 101, 1009-14. Gonçalves, V. M., Takagi, M., Carmo, T. S., Lima, R. B., Albani, S. M. F., Pinto, J. V., Zangirolami, T. C., Giordano, R. C., Tanizaki, M. M. & Cabrera-Crespo, J. (2007). Simple and efficient method of bacterial polysaccharides purification for vaccines production using hydrolytic enzymes and tangential flow ultrafiltration. Communicating Current Research and Educational Topics and Trends in Applied Microbiology. A. Méndez-Vilas, (Ed.) FORMATEX, Badajoz, Spain, 450-7. Hilleman, M. R., Tai, J. Y. & Tolamn, R. L. (1984). Coupled Haemophilus influenzae type b vaccine. US Patent, 4, 459 286. Hoeprich, P. D. (1955). Carbon-14 labeling of Diplococcus pneumoniae. J Bacteriol, 69, 6828. Institut Mérieux, (1980). Procédé de purification de polyosides de Streptococcus pneumoniae et vacin a base de polyosides ainsi purifiés. Brevet Belge, 80, 26320. Kanclerski, K. & Mollby, R. (1987). Production and purification of Streptococcus pneumoniae hemolysin (pneumolysin). J Clin Microbiol, 25, 222-5. Kim, S. N., Min, K. K., Choi, I. H., Kim, S. W., Pyo, S. N. & Rhee, D. K. (1996a) Optimization of culture conditions for production of pneumococcal capsular polysaccharide type IV. Arch Pharm Res, 19, 173-7. Kim, S. N., Min, K. K., Kim, S. H., Choi, I. H., Lee, S. H., Pyo, S. N. & Rhee, D. K. (1996b). Optimization of culture conditions for production of pneumococcal capsular polysaccharide type I. J Microbiol (Korea Republic), 34, 179-183. Kolling, D., Liberman, C., Sari, R. S., Leite, L. C. C., Pradella, J. G. C., Gonçalves, V. M. Improvement of the production process of non-encapsulated Streptococcus pneumoniae inactivated cellular vaccine. Manuscript in preparation Liberman, C., Takagi, M., Cabrera-Crespo, J., Sbrogio-Almeida, M. E., Dias, W. O. Leite, L. C. C. & Gonçalves, V. M. (2008). Pneumococcal whole-cell vaccine: optimization of cell growth of unencapsulated Streptococcus pneumoniae in bioreactor using animal-free medium. J Ind Microbiol Biotecnhol, 35, 1441-5. Lu, Y. J., Yadav, P., Clements, J. D., Forte, S., Srivastava, A., Thompson, C. M., Seid, R., Look, J., Alderson, M., Tate, A., Maisonneuve, J. F., Robertson, G., Anderson, P. W. & Malley, R. (2010). Options for inactivation, adjuvant, and route of administration of a killed unencapsulated pneumococcal whole-cell vaccine. Clin Vaccine Immunol, doi:10.1128/CVI.00036-10 [Epub ahead of print] Mackay, D. & Kriz, N. (2010). Current challenges in viral safety and extraneous agent testing. Biologicals, 38, 335-7. Malley, R., Lipsitch, M., Stack, A., Saladino, R., Fleisher, G., Pelton, S., Thompson, C., Briles, D. & Anderson, P. (2001). Intranasal immunization with killed unencapsulated whole cells prevents colonization and invasive disease by capsulated pneumococci. Infect Immun, 69, 4870-3.

426

C. Liberman, D. Kolling, R. S. Sari et al.

Malley, R. (2010). Antibody and cell-mediated immunity to Streptococcus pneumoniae: implications for vaccine development. J Mol Med, 88, 135-42. Marburg, S., Kniskern, P. J. & Tolman, R. L. (1989). Covalently-modified bacterial polysaccharides, stable covalent conjugates of such polysaccharides and immunogenic proteins with bigeneric spacers and methods of preparing such polysaccharides and conjugates and of confirming covalency. US Patent, 4, 882 317. Massaldi, H., Bessio, M. I., Suarez, N., Texeira, E., Rossi, S. & Ferreira, F. (2010). Features of bacterial growth and polysaccharide production of Streptococcus pneumoniae serotype 14. Biotechnol Appl Biochem, 55, 37-43. Rane, L. & Subbarow, Y. (1940). Nutritional requirements of the pneumococcus. I. Growth factors for types I, II, V, VII, VIII. J Bacteriol, 40, 695-704. Richards, J. C. & Perry, M. B. (1988). Structure of the specific capsular polysaccharide of Streptococcus pneumoniae 23F (American type 23). Biochem Cell Biol., 66, 758-71. Sheng-De, J., Kim, Y. M., Kang, H. K., Jung, S. J. & Kim, D. (2009). Optimization of capsular polysaccharide Production by Streptococcus pneumoniae type 3. J Microbiol Biotechnol, 19, 1374-8. Suarez, N., Fraguas, L. F., Texeira, E., Massaldi, H., Batista-Viera, F. & Ferreira, F. (2001). Production of capsular polysaccharide of Streptococcus pneumoniae type 14 and its purification by affinity chromatography. Appl Environ Microbiol, 67, 969-71. Tai, S. S. (2006). Streptococcus pneumoniae protein vaccine candidates: properties, activities and animal studies. Critical Reviews in Microbiology, 32, 139-53. Takagi, M., Cabrera-Crespo, J., Baruque-Ramos, J., Zangirolami, T. C., Raw, I. & Tanizaki, M. M. (2003). Characterization of polysaccharide production of Haemophilus influenzae type b and its relationship to bacterial cell growth. Appl Biochem Biotechnol, 110, 91100. Takagi, M., Cabrera-Crespo, J., Zangirolami, T. C., Raw, I. & Tanizaki, M. M. (2006). Improved cultivation conditions for polysaccharide production by H. influenzae type b. J Chem Technol Biotechnol, 81, 182-8. Tan, L., Williams, M. A., Khan, M. K., Champion, H. C. & Nielsen, N. H. (1999). Risk of transmission of bovine spongiform encephalopathy to humans in the United States. Report of the Council on Scientific Affairs. JAMA, 281, 2330-9. Weiser, J. N., Bae, D., Epino, H., Gordon, S. B., Kapoor, M. & Zenewicz, L. A. (2001). Changes in availability of oxygen accentuate differences in capsular polysaccharide expression by phenotypic variants and clinical isolates of Streptococcus pneumoniae. Infect Immun, 69, 5430-9. World Health Organization, (2008). 23-valent pneumococcal polysaccharide vaccine. WHO position paper. Weekly epidemiological record, 83, 373-84. World Health Organization, (2003). Guidelines on transmissible spongiform encephalopathies in relation to biological and pharmaceutical products. Geneva, WHO/BCT/QSD/03.01 Yavordios, D. & Cousin, M. (1983). Procédé d‘obtention de polyosides capsulaires, polyosides capsulaires ainsi obtenus et leur application à la préparation de vaccins. European Patent, 0 071515 A1.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 18

PRODUCTION AND CONSUMPTION OF GREEN VEGETABLE SOYBEANS “EDAMAME” Yoshihiko Takahashi and Takuji Ohyama* Graduate School of Science and Technology, and Faculty of Agriculture, Niigata University, Ikarashi, Nishiku, Niigata, Japan

ABSTRACT The ―edamame‖ is a kind of soy food popular in Japan, and it is classified as a vegetable and not a grain crop as in the case of mature soybean seeds. Traditionally, the edamames were sold as a bunch of stems with pods in Japan. ―Eda‖ means stems, and ―Mame‖ means beans. The immature pods are boiled in salt water, and served after cooling. Edamames are usually taken as a snack or a relish with beer in Japan. It contains various nutrients, such as proteins, lipids, carbohydrates and minerals at similar levels to mature soybean seeds based on dry weight. In addition, edamames contain higher concentrations of vitamin A, C, K and folic acid than mature soybean seeds. There are many local varieties of Edamame soybean in Japan, and the cultivars for grain soybean are usually not delicious to eat as edamames. The flavor is excellent in edamame varieties but not in grain soybeans. Edamame varieties have a sweet taste and distinctive good flavor and aroma. The higher concentrations of sugars (e.g., sucrose) and free amino acids (e.g., alanine) are related to the good taste. The variety, cultivation methods and the stages of plants at harvest are very important factors for good quality. The bunch of stems with pods, or separated fresh pods in a plastic bag are marketed from early summer to late autumn in Japan. The market prices of the edamames mostly depend on the freshness, taste, brand name and seasons. The edamame plants are cultivated in the greenhouse, or in a tunnel of double plastic sheets to keep them warm and harvest in the late spring and early summer (May to June) with a high price. Then soybean plants are cultivated in open fields and harvested from July to November. The freshness is very important for the taste of edamames; therefore, many farmers harvest the edamame plants at midnight or early morning and market them on the same day. The wrapping technology and the transportation system were improved and the market distribution of the fresh edamames has expanded in recent years. In addition to fresh edamames, the *

Corresponding author: E mail: [email protected], Fax; +25-262-6643

428

Yoshihiko Takahashi and Takuji Ohyama import of frozen cooked edamames from foreign countries is increasing, and people can eat edamames all year around.

1. HISTORY OF EDAMAMES (GREEN VEGETABLE SOYBEANS) From a long time ago, Japanese people traditionally have eaten boiled immature soybean seeds as a vegetable or a refreshment. Generally, matured soybean seeds are used for processed foods, such as ―tofu‖ (bean curd), ―natto‖ (fermented soybean seed by Bacillus natto), ―miso‖ (fermented soybean paste), ―shoyu‖ (soy sauce), etc., as well as boiled beans. On the other hand, immature green soybean seeds in the pods are boiled in hot salty water (about 40g/L), and those beans are called edamames (green vegetable soybeans) in Japan. ―Edamame‖ was recorded in the old Japanese book of laws and regulations "Engishiki (927 AD)". The origin of current soybean varieties is assumed to be located in northeast China. However, the wild species of soybean grows naturally in the East Asian region including Japan. Therefore, it is postulated that the soybean has been cultivated in wide regions in East Asia, and the custom of cooking immature soybean pods as ―edamames‖ might have developed in the soybean cultivation regions widely Although Japanese people favor the edamames very much, the Chinese people also eat the edamames mixed with various dishes. Even so, the cooking method of how to boil it and the cultivars are a little bit different compared with Japanese edamames. The edamame is a vegetable, and it is impossible to preserve for a long term under natural conditions. The fresh edamames just after harvest is most delicious, but if edamames are kept under natural conditions in summer, the taste will decrease rapidly in several hours. Fresh edamames can be stored in a refligerator for a few days. A long time ago, farmers cultivated edamames in a small nearby field around their house and/or the levees of paddy fields, and it was mostly self-consumed by their family. Therefore, a lot of regional cultivars of edamames have been maintained locally until now. The meaning of the edamame is ―Beans attached to the stems‖. The boiled edamame was sold by the road as a fast food in the Edo era (1603-1868 AD). A large amount of edamames is consumed in Japan, especially in Niigata Prefecture. In Niigata Prefecture, a paddy field rice production is the principal agriculture (about 90% of the agricultural area), and there are a lot of levees 10-20 cm high to keep water around the paddy fields. The edamames have been said to have the alias "Aze-mame" (Aze means a levee and mame means a bean). In the olden days, some soybean plants were used for edamames, and the remainder were ripened into full maturity, and they were used for the material of a homemade miso in each farmer's house. The edamames (soybean) is a plant that needs a lot of moisture, and it becomes weak by the damage from a drought stress. On the other hand, soybean growth is severely depressed by flooding. Therefore, the moisture condition of levees around the paddy fields is appropriate for the cultivation of edamame soybean. The production of edamames is very important for farmers in Niigata, because the price is relatively high compared with the other crops. Fresh edamames are sold as a bunch of stems with pods or packed in a plastic bag (Figure 1A,B). Recently many frozen pre-cocked edamames packed in a plastic bag have become available all year around (Figure 1C).

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

429

A. Edamames attached to the stems in a plastic film B. Edamames attached to the stems. C. Frozen boiled Edamames. Figure 1. Edamames in markets

2. PRODUCTION OF EDAMAMES IN JAPAN Figure 2 shows the map of edamame production in Japan. Figure 3 shows the area and yield of edamame production in each prefecture. The main production regions of edamames are located in East Japan, especially in a Kanto region (Chiba, Saitama, Gunma, Kanagawa,Tokyo, Ibaragi prefectures), Yamagata Prefecture, and Niigata Prefecture. About 77,000 t has been domestically produced annually in Japan (Ministry of Agriculture, Forestry and Fisheries of Japan, 2009). Recently, the production per area has increased in the Kanto region, especially in Chiba Prefecture and Saitama Prefecture, because the farmers in the Kanto region cultivate edamames by advanced management, and they sell the edamame in the metropolitan area market adjacent to Tokyo. The market evaluation of edamames produced in this region is high and known as a famous brand. On the other hand, edamames production is not high, and consumption is also comparatively low in the western area of Japan, especially in Kansai and Kyushu reagions. The import of the frozen cooked edamames increases from foreign countries (Figure 1C) (Ministry of Agriculture, Forestry and Fisheries of Japan, 2009). People can eat the frozen edamames only by defrosting naturally or in a microwave oven. The imported edamames from Thailand and Taiwan has increased recently (Figure 4). This is because the trading companies of Japan ask the foreign farmers to produce the favorite edamame cultivars for the Japanese. In addition, the development of the freezing technique is one of the factors for increasing the import of the frozen edamames.

430

Yoshihiko Takahashi and Takuji Ohyama

Figure 2. Edamame production map in Japan

Figure 3. Edamame production area and yield in each prefecture of Japan

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

431

(Agriculture ＆ Livestock Industries Corporation Japan) Figure 4. Changes in the amount of imported frozen edamames in Japan (2007-2009)

3. MARKET CIRCULATION AND COMMODITY FORMS Various cultivars or brands of edamames are planted for successive harvests and supply. Figure 5 shows the example of the edamame cultivation table in Shindori Farm of Niigata University. Seven cultivars were planted and harvested 11 times separately. For example, early season cultivar ―Green 75‖ is seeded on 21th April and harvested on 9th and 10th July. The traditional cultivar ―Sakanamame‖ is planted on 14th and 16th July, and harvested on 29th September. The cultivation period of the edamames extends for five months and edamames are available for three months in this farm. Some edamame farmers in Niigata prefecture are transplanting the seedlings of edamames in a double greenhouse in winter (February and March) and harvest in May and June.

Figure 5. A work calendar of edamames cultivation in Shindori Farm of Niigata Univ. (2009)

432

Yoshihiko Takahashi and Takuji Ohyama

Figure 6. Changes in amount of market circulation and price of edamames in Japan (2008)

Left: Green type, Right: Brown type (Chamame). Figure 7. Difference in color type of edamame varieties

A lot of edamames are provided in market from June to September as shown in Figure 1A,B. The market price is high during spring and early summer (Figure 6). The farmer would like to harvest as early as possible. Figure 7 shows the green type edamames and brown type edamames ―Chamame‖ (brown edamames). The pods and the seed coat shows brown color a little bit. The brown type edamames has more flavor, aroma and sweetness than green type ones. Therefore, the price is generally higher. Figure 1 shows the main commodity forms of edamames in a market or a grocery store in Japan. The extremely early variety circulated in May and June is often sold with the stems. The price is sometimes $10 per a bunch (about 250 g FW of pods). In addition, the fresh edamames are sold in the bag of the plastic film. The frozen edamames are boiled and wrapped in the local factory overseas, and exported to Japan. Edamames are already boiled in the factory before packing, so people can eat without cooking. Besides, Edamame can be used for mixing foods or used as a material of cake or soup by grinding boiled edamames.

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

A. Fresh edamame pods and salt. B. Boiling with salty water. C. Draining of water. D. Cooling with fan. E. Served in a dish. F. Boiled Edamames. Figure 8. Cooking of edamames

Figure 9. Edamames and beer are summer tastes in Japan.

433

434

Yoshihiko Takahashi and Takuji Ohyama

4. COOKING OF EDAMAMES There are many methods to cook edamames for the best taste, flavor and texture. It is important to use a large amount of water for boiling edamames. The boiling time is very important. If it is too short, the edamames are hard and taste raw. On the other hand, if edamames are boiled for a long time, the texture becomes too soft and flavor will be lost. An example of cooking edamames is as follows (Figure 8): Materials: (Figure 8A) Fresh edamame (green vegetable soybeans) pods; 250g, Salt; 30-45g (2 or 3 Table spoon), Water; 1-1.5 L. You can change the volume of water and weight of salt as you prefer. Cooking: Step 1; Wash the 250 g of fresh pods with a tap water, and drain excess water with a basket. Step 2; Mix and rub the pods with 15 g (1 tablespoon) of salt and keep them for 10–30 min. This will promote salty taste and good green color of the pods after boiling. Step 3 (Figure 8B); Boil the 1–1.5 L of water in a pan with 15–30g (1–2 tablespoons) of salt. Put the edamames in and boil for 4–5 minutes. The time depends on the varieties and freshness. So please make sure to eat one before you stop boiling. Step 4 (Figure 8C); Water is drained quickly through the basket. Step 5 (Figure 8D); Cool the boiled edamames quickly with a fan or in a refrigerator. Do not wash with water, because the flavors will decrease. Step 6 (Figure 8E): Serve in a dish. Add some salt if you like salty taste. Only seeds in the pods are edible. You can pick a pod of edamame and bite it, and seeds in the pod will enter into your mouth, then discard the empty pod (Figure 8F). Recently, the consumption of edamames has increased especially as a relish of the beer in Japan. Figure 9 shows the edamames and the bottle of beer brewed in cooperation with Faculty of Agriculture, Niigata University.

5. NUTRITION OF EDAMAMES Table 1 shows the comparison of concentration of various nutrients among edamames and other legume vegetables, snap peas and green peas, and mature soybean seeds (Standard Tables of Food Composition in Japan, 2009). Edamames have a lot of calories, proteins, and lipids compared with snap peas and green peas. Moreover, edamames contain a lot of minerals compared with snap peas and green peas. The edamames contain almost the same amount of protein and the lipid compared with the soybean, when they are compared by the dry weight bases (Table 1). However, the edamames contain the vitamin groups, especially Vitamin A, C, K and folic acid much more abundantly than the mature soybean (Table 1). Because of a high temperature and high humidity in the summer of Japan, the edamame is a good food to keep healthy.

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

435

Table 1. Concentration of nutrients in legume vegetables and soybean. (per 100g)1)

Energy (kcal) Water (g) Protein (g) Lipid (g) Carbohydrate(g) Ash (g) Minerals Na (mg) K (mg) Ca (mg) Mg (mg) P (mg) Fe (mg) Zn (mg) Cu (mg) Mn (mg) Vitamine A (g)* E (mg) K (g) B1 (mg) B2 (mg) Niacin (mg) B6 (mg) B12 (g) Folic acid (g) Pantothenic acid (mg) C (mg)

Edamame (Raw) 135 71.7 11.7 6.2 8.8 1.6

Snap peas (Raw pod) 43 86.6 2.9 0.1 9.9 0.5

Green Peas 93 76.5 6.9 0.4 15.3 0.9

Soybean (matured) 417 12.5 35.3 19 28.2 5

Edamame (Dry)*** 477 0 41.3 21.9 31 5.65

Soybean (Dry)*** 475.38 0 40.242 21.66 32.148 5.7

1 590 58 62 170 2.7 1.4 0.41 0.71

1 160 32 21 62 0.6 0.4 0.08 0.22

1 340 23 37 120 1.7 1.2 0.19 0.48

1 1900 240 220 580 9.4 3.2 0.98 1.9

3.53 2083 205 219 600 9.53 4.94 1.45 2.51

1.14 2166 273.6 250.8 661.2 10.716 3.648 1.1172 2.166

22 0.8 30 0.31 0.15 1.6 0.15 0 320 0.53

34 0.4 33 0.13 0.09 0.7 0.09 0 53 0.22

35 0.1 27 0.39 0.16 2.7 0.15 0 76 0.63

1 1.8 18 0.83 0.3 2.2 0.53 0 230 1.52

77.7 2.82 106 1.09 0.53 5.65 0.53 0 1130 1.87

1.14 2.052 20.52 0.9462 0.342 2.508 0.6042 0 262.2 1.7328

27

43

19

Tr.**

95.3

0

From "2009 All Guide Standard Tables of Food Composition in Japan, Fifth revised and enlarged edition" *: Value of vitamine A indicate retinol equivalent. **Tr. : Trace amount. *** Calculated based on dry weight.

6. IMPORTANT POINTS OF CULTIVATION AND FERTILIZATION OF EDAMAME The nutrition demands of the grain soybeans and the edamame soybeans is basically the same (Iwata and Utada, 1968). The amount of applied compound fertilizer for the edamame seedings after the middle of May is small (as well as the soybean). However, a large amount of fertilizer is applied for the early varieties, because the amounts of nitrogen mineralized from soil and that fixed by root nodules are relatively low under low temperature (Table 2).

436

Yoshihiko Takahashi and Takuji Ohyama Table 2. Outline of fertilizer application of edamame and soybean* (kg/a) Seeding time

Edamame of early variety Kurosaki chamame Soybean

Compost Slaked lime

3/20-4/20

200

12

Compound fertilizer N P2O5 K2O 1.1 2.1 2.1

4/20-5/10 5/155/20-6/20

200 200 100-150

12 12 10

0.5 0-0.2 0.15-0.25

1.5 0.6-1.2 0.6-0.8

*Standard application of Niigata Prefecture. **Popular traditional cultivar with rich flavor in Niigata Pref.

1.5 0.6-1.2 0.6-0.8

Topdressing(to furrow) N K2O 0.8 0.8 -

-

The cultivation techniques for the grain soybeans and the edamame soybeans are mostly common, and there are three important points. The first point is to obtain good germination of seeds and the early-initial growth. Transplanting of seedlings is the easy way to promote the early-growth. In addition, the mulching with a vinyl film improves the early-growth by the rising of the soil temperature, especially for the direct sowing of seeds into soil. The second point is to obtain vigorous N2 fixation activity by root nodules at about the flowering time. Usually, the pod setting rate of edamames is only by about 30-40% of the total number of flowers setting. Especially, a lot of flowers and young pods fall, when the nitrogen nutrition is insufficient or the water stress occurs at the flowering time. The form of nitrogen available is mainly nitrate ion in upland conditions supplied from the soil as well as from the fertilizers. The nitrate ions are absorbed by the roots and it is primarily transported to the leaf blades. Then, the nitrogen is re-translocated to each organ, especially pods and seeds after changing to the amino acids in the leaf blades. The fixed N2 by the root nodules moves in the forms of ureides (allantoin and allantoic acid) and directly transported to the pods and leaves (Ohyama, 1984). However, the root nodule activity is depressed by the application of a large amount of nitrogen fertilizer. Because the N2 fixation activity cannot be expected in the early season cultivation of edamames, a large amount of N fertilizer is generally supplied for them. The last point is to maintain the nitrogen nutrition after flowering stage just before harvest. When the nitrogen deficiency occurs at the harvest time of edamames, the pod color becomes light and yellow, and the market price will decrease. Moreover, the sugar accumulation in edamames decreases due to the decrease in the photosynthetic activity of the leaves, and the taste will become worse. The nitrogen topdressing at about 7 days before harvest has been used as a practical method to improve nitrogen nutrition.

7. PALATABILITY OF EDAMAMES AND FERTILIZATION A constant high yield of the edamames is necessary for supporting the income of farmers. On the other hand, the high quality with an excellent taste and flavor is more important than the yield itself. The edamames are sold as bundled main stems with the pods or as packed pods in a plastic bag. The farmers prefer the "small size plants" from the advantage of good appearance for the market, when they sell the bunch of edamame stems (Figure 10). The planting density is higher than grain soybeans. However, the taste might decrease when the vegetative growth is severely restricted. Leaf blades are source organs, and sugar and amino

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

437

acids produced in leaves are transported to the pods and seeds. In small-size plants, the size of source organ may be insufficient for supporting the pod filling. At 35-40 days after flowering (DAF), edamames are harvested. It is about R5-R5.5 stage (Fehr 1971). The soybean seeds are the maximum in sweetness, taste and flavor at this time (30-40 DAF). The harvest stage has been selected for the edamame cultivars. Masuda reported that the accumulation of sugar in edamames reached the maximum on the 35th days after flowering, and it decreased thereafter (Masuda, 1991) . The similar result was obtained by our investigations (Figure 11). The best timing of edamame is very short period about 3-5 days, and farmers check the the harvest date from the thickness of seeds. The thickness is usually about 80% of full-size (R5 stage). When the color of leaves will become yellow by the decline of the N2 fixing and/or the nitrogen nutrition from soil at the harvesting time, the nitrogen topdressing of N (3-5kg/10a) about seven days before harvest is effective. However, the fertilized nitrogen is absorbed only within 10% of the amount of the topdressing nitrogen fertilizer.

Figure 10. Edamame soybean harvested on 17 May

Figure 11. Changes in the concentration of free sugar (white bar) and amino acids (black bar) in edamames after flowering (cv. Kinshu, 1997) . DAF; days after flowering

438

Yoshihiko Takahashi and Takuji Ohyama

7. INTRODUCTION OF THE YIELD INCREASE AND TASTE IMPROVING TECHNIQUE OF EDAMAMES Various methods of fertilizer application for soybean cultivation have been developed so far (Takahashi et al. 2000, National Agriculture and Food Research Organization, 2009). On the other hand, the fertilizer experiments for edamames are scarce. As for edamames cultivation, each farmer has improved the cultivation technique personally. Exchanges of the information are relatively small in number. There are a lot of alluvial clayey soils in the plains in Japan especially in Niigata Prefecture. The soil physical property is good for paddy rice but defective as for the cultivation of vegetables. A large amount of rice hulls is generated from the paddy fields as by-product. Authors examined how to improve the soil physical property of a converted paddy field by using the paddy rice hulls to improve drainage and aeration for upland crops. The decomposition of rice hulls is slow and remains for a long time in the soil. As for rice hulls, the ratio of the C/N is very high (70–80), and the nitrogen starvation occurs in the 1st or 2nd years after the rice hulls are incorporated into the soil. The application of rice husk together with nitrogen fertilizers has been carried out to improve the soil physical property and to prevent the nitrogen starvation. The experiment was carried out in the converted paddy field of Niigata Prefectural Research Institute of Agriculture in 1997. The field was the first year after the conversion from a paddy rice field. The application treatments of rice hulls at 2 t/10a and at 4 t/10a were set with the control treatment (0 t/10a). Based on the result (Figure 12), the fertilizer nitrogen immobilization was about 1mg/100g (dry soil) for 1 t/10a of rice hulls application at the first year of rice hulls application. It became half about 0.5mg/100g (dry soil) at 2nd year. Nitrogen immobilization effect with the rice hull disappeared for 3rd year after application (Figure 12).

Upland condition, 30℃4W incubation. Bar represent SD. (Rice hull treatment was executed in 1997) Figure 12. N mineralization amount from soil by rice hull application (1997)

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

439

The problems of nitrogen immobilization could be solved by increasing the rates of fertilizer nitrogen. Basically, a basal dressing of fertilizer N of 2kgN/10a is recommended for edamames production. The edamame growth has been improved by increasing the fertilizer N rate further by 3kg in addition to the basal dressing N (totally 5 kgN/10a) in the first and 2nd year after the rice hull application. The soil sample in the stand condition was collected at the flowering time and the concentrations of nitrate N and ammonia N were analyzed. This field was the first year of the upland field converted from a paddy field. There was a lot of nitrate N in the control plot, but a lot of ammonia N remained in the rice hull treatments. Nitrification of fertilizer N was suppressed by rice hull treatment during the early growth of edamames. Because the basal dressing nitrogen was immobilized by application of rice hulls, the vegetative growth of edamame soybeans tended to be retarded. However, a high relatively ureide content (RU%) in xylem sap of edamames was observed in the rice hulls treatments (Figure 13). It is concluded that the rice hulls application was effective for the N2 fixation activity of the root nodules (Figure 13).

RU-N: Relative ureide N amount in xylem sap at flowering stage. Figure 13. Rice hulls application and root nodule activity

Figure 14. Rice hulls application and yield of edamames

440

Yoshihiko Takahashi and Takuji Ohyama

Root nodule activity was expressed by relative ureide-N % in xylem sap of edamame. Figure 15. Relationship between root nodule activity and pods / node at flowering time of edamame (Examination, 1997-1999)

As a last result, the yield of edamames tended to increase by the rice hulls treatment (Figure 14). The rice hulls treatment increased the number of pods par each node, and the commercialization rate as well. There was the positive correlation, between the number of pods at each node and the nitrogen nutrition at the flowering time. When the nutrient condition of this time is sufficient, the flowers and young pods abscission can be minimized. In our previous study, there was a positive correlation between the number of pods par nodes and N2 fixation activity of the root nodules (relative ureide-N % in xylem sap) at the flowering time (Figure 15). In the experiment in 1997, the content of sugar became the highest in each treatment on the 25 August, at 33 DAF, and it decreased on September 3 at harvest time as edamames. There were no differences of the content of the free amino acid in each treatment. Table 3 shows the content of the sucrose of the crushed edamame beans with a mixer and the food taste examination was done for the edamames harvested in 1998. The sensory test of edamames taste was higher in the order of rice hulls and nitrogen fertilizer applicaitons; 2t+N5kg > control > rice hull 2t+N2kg > rice hull 4t+N2kg. The content of the sugar decreased more than the control plot in equal and rice hulls 2t+N2kg treatment and rice hulls 4t+N2kg in the control plot and rice hulls 2t+N5kg treatment, and the total evaluation of taste examination tended to agree with sweetness (sugar concentration). The development of the fertilizer technologies with slow release nitrogen fertilizer has advanced in Japan, and it is widespread as the labor saving cultivation technology. Authors have been examining the use of slow release fertilizers for the edamame cultivation. The edamames are usually grown with ridge setting up and mulching with a plastic film. When top dressing time, farmers sprayed the urea liquid to the passage between ridges. In this case, the fertilizer is placed to the site where the roots are hardly distributed. Therefore, this fertilization is not effective, and there are problems in economically and environmentally. To solve this problem, the sigmoid type of controlled release N fertilizer (CUS) was used as the topdressing at the basal dressing. The nitrogen elution from fertilizer particles was controlled,

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

441

and after some period, the fertilizer N begins to release at the topdressing time (Figure 16). The fertilizer type is selected by the soil temperature during growing period and the growth characteristic of the cultivar of crops. Nitrogen releasing pattern of this fertilizer can be presumed by inserting soil temperature to the predictive formula. For instance, the type of the sigmoid fertilizer was suitable on the sigmoidal 60th when a cultivar ―Shinkohirakata Chamame" was grown in Niigata. In addition, the recovery rate of fertilizer N can be expected to increase, because the fertilizer N exists in the site where the roots grow with high density. Figure 17 shows that the yield increase of edamame by treatment of sigmoid 40th or 60th types. It was found that the concentration of free amino acids was 1.6-1.7 mmol/g, 1.51.7 and 2.1-2.2 mmol/g in the control, topdressing and CUS treatment, respectively. The higher the concentration, the better the taste quality in the seeds. Table 3. Results of sensory test and sugar content in edamame. (1998) cv.Shinkohirakatachamame

Rice hulls kg/m2 0 2 4 2

Fertilizer N g/m2 2 2 2 5

Sensory evaluation Externals Appearance Aroma ---Control--0 -0.38** 0.19 -0.33* 0.17 -0.05

Sweetness

Umami

Total

-0.24 -0.60** 0.24

-0.38 -0.52* 0.14

-0.29 -0.48* 0.29

Sensory evaluation was relative value compared with control seeds. -3: very bad, -2: bad, -1 slightly bad, 0: same, +1 slightly good, +2: good, +3: very good. *:Statistically significcant at 5% level, **: Statistically significant at 1% level.

(Coated urea, diameter is 2-3mm). A: White particles: coated urea before releasing urea inside. B: Transparent particles: coat after releasing urea. Figure 16. Controlled release N fertilizer

Sugar mg/gFM 38.3 29.1 35.1 38.6

442

Yoshihiko Takahashi and Takuji Ohyama

Control: N fertilization in hill was applied before 7days at harvest time. Non-topdressing: Top dressing of N fertilizer was not applied. CUS 40 or 60: Sigmoidal type of coated urea 40 days or 60 days was applied as basal dressing. Figure 17. Effect using controlled release N fertilizer (CUS) for yield of edamame (1997)

CONCLUSION The edamame is a kind of soy food, and it is classified as a vegetable. The circulation system and the wrapping technology improved and the market distribution of the fresh vegetable has expanded in recent years. In addition, the import from foreign countries of cooked frozen edamames has increased. However, the market prices of the edamames, mostly dependent on the freshness and high quality (external appearance and taste), has risen. For marketing demands, the farmers work harvesting edamames from midnight to early morning every day during the harvest period. Research themes of the edamames will become the improvement of efficient cultivation techniques and increase of palatability by breeding and cultivation techniques.

REFERENCES [1] [2] [3]

Fehr, W. R., Caviness, C. E., Burmood, D. T. & Pennington, J. S. (1971). Stages development description for soybean Glycine max (L.) Merrill. Crop Science, 11, 929931. Iwata, M. & Utada, A. (1968). Effect of nitrogen supplied in various growth stages on the growth and yield of several vegetable, J. of the Japanese Society for Horticulture Science, 37, 57-66. Masuda, R. (1991). Quality requirement and improvement of vegetable soybean; in Proceedings of a Workshop Held at Kenting, Taiwan, Asian Vegetable Research and

Production and Consumption of Green Vegetable Soybeans ―Edamame‖

[4] [5]

[6]

443

Development Center, Publlication, 53-601. Ministry of Agriculture, Forestry and Fisheries of Japan: Agriculture, forestry and fisheries statics of Japan 2009. National Agriculture and Food Research Organization: http://narc.naro.affrc.go.jp/ inada/snay/2009/vege-pamphl.pdf Ohyama, T. (1984). Comparative Studies on the Distribution of Nitrogen in Soybean Plants Supplied with N2 and NO3 at the Pod Filling Stage Ⅱ. Assimilation and Transport of Nitrogenous Constituents. Soil Sci. Plant Nutr., 30, 219-229. Takahashi, Y., Sato, T., Hoshino, T., Tsuchida, T. & Ohyama, T. (2000). Effect of rice hull application for growth, yield and quality of vegetable soybean in rotated upland field from paddy rice field. Japan Soil Sci. and Plant Nutr., 71, 801-808.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 19

SOYBEAN AS A MODEL TO STUDY DEFENSIVE RESPONSES ENHANCED BY FUNGAL ELICITORS, NITRIC OXIDE AND ELEVATED CO2

1

Marcia Regina Braga1*, Kelly Simões1, Sonia Machado de Campos Dietrich1, Luzia Valentina Modolo2 and Ana Paula de Faria2 Núcleo de Pesquisa em Fisiologia e Bioquímica, Instituto de Botânica, CP 3005, 01031-970, São Paulo, SP, Brazil 2 Grupo de Estudos em Bioquímica de Plantas (GEBioPlan), Departamento de Botânica, ICB, Universidade Federal de Minas Gerais, 31270-901, Belo Horizonte, MG, Brazil

ABSTRACT Soybean, Glycine max (L.) Merr., is one of the major world crops, occupying large acreages of land. Soybeans are grown in most countries and have become essential due to a multitude of food products they provide, which include oil and high-protein defatted meal. In recent years, soybeans have also been under intensive study because of their multiple health-enhancing properties. Although soybean breeding programs have developed varieties with improved yields, quality and disease resistance, every year substantial losses in soybean production still occur due to pathogen attack. Therefore, the understanding of defensive responses of soybean to pathogens is important not only to increase crop yield, but also to predict the consequences of climate changes on agricultural ecosystems. Much research on soybean defensive responses has been done using modifications of the classical cut-cotyledon assay. As soybean cotyledons have simple architecture and cellular uniformity, and show very sharp and localized responses to incompatible isolates of pathogens or to endogenous/exogenous signaling molecules, they represent a nearly ideal model to study these responses under variable environmental conditions. Our group has been successfully using this assay to screen highly defensive soybean cultivars, to characterize phytoalexin-inducing molecules (elicitors) derived *

Corresponding author: Email: [email protected]

446

Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich et al. from microbes and plants, to evaluate the role of nitric oxide in defensive isoflavonoid metabolism, and to analyze the effects of elevated CO2 atmospheres on soybean responses to elicitors.

Keywords- enriched-CO2 atmospheres, glyceollins, nitric oxide, plant defenses, phytoalexins.

INTRODUCTION Soybean [Glycine max (L.) Merrill] is one of the major world crops, holding a prominent position in the Brazilian economy by the extension of the cultivated area and volume of grain production. This status was achieved due to the potential of the grains as a source of raw material for several products and to the availability of varieties with improved productivity and resistance to diseases (Martins et al., 2002). The bulk of the soybean crop is grown for oil production, with the remaining high-protein defatted soy meal used as livestock feed. A small percentage of soybeans are used directly for human consumption. Furthermore, soybeans produce isoflavones, metabolites that are claimed to prevent heart diseases, proliferation of breast and prostate cancer cells, and alleviate menopausal and osteoporosis symptoms (Isanga & Zhang, 2008). Among the main factors that limit soybean productivity in Brazil are the diseases caused by pathogens and pests. Every year significant yield losses of soybean have been attributed to frogeye leaf spot, stem canker, powdery mildew and Asian rust diseases (Embrapa, 2000; Furtado et al., 2009). Therefore, a better understanding of the defensive responses of soybean to diseases is important to increase crop yields. The production of phytoalexins, induced low-molecular-weight secondary metabolites with antimicrobial activity, enable plants to prevent pathogen replication (recently reviewed by Braga, 2008; de Fátima & Modolo, 2008). The pterocarpan glyceollins are the main phytoalexins of soybean and their accumulation is a major defense mechanism providing resistance to soybean tissues against pathogens. Daidzein, the immediate antimicrobial precursor of glyceollins, and genistein occur in soybean tissues as pre-formed glucoconjugates that are promptly hydrolyzed during plant-pathogen interaction (Paxton, 1995). They are partly biosynthesized through the phenylpropanoid pathway according to Figure 1. The cut-cotyledon assay, an easy-to-handle method, is widely employed for the study of phytoalexin accumulation in soybean under biotic or abiotic stresses (e.g., Frank & Paxton, 1971; Ayers et al., 1976; Hahn et al., 1981; Graham & Graham, 1991; Modolo et al., 2002; Braga et al., 2006). Soybean cotyledons are largely composed of tightly aligned columns of mesophyll parenchyma cells of very uniform dimension, attributes that make them nearly an ideal system to study cellular responses and cell-to-cell communication under varying conditions (Graham & Graham, 1991). In the cut-cotyledon assay (as described by Ayers et al. 1976), the non-penetrable surface of soybean cotyledons is sliced off to facilitate the application of biotic and abiotic elicitor molecules. Much of our research on the defensive responses of Brazilian soybean cultivars has been done using modifications of the classical cut-cotyledon assay.

Soybean as a Model to Study Defensive Responses Enhanced by Fungal Elicitors … 447

Figure 1. Schematic representation of the biosynthetic pathway of soybean phytoalexins. The symbol indicates reactions of multiple steps; CHR, chalcone reductase; CHS, chalcone synthase; G2DT, dimethylallyl diphosphate:(-)-glycinol 2-dimethylallytransferase; G4DT, dimethylallyl diphosphate:(-)-glycinol 4-dimethylallytransferase; PAL, phenylalanine ammonia lyase; P450, cytochrome P450 with cyclase activity; P6aH, pterocarpan 6a-hydroxylase

FUNGAL ELICITORS The term ―elicitor‖ was originally used to refer to molecules and other stimuli that induce the synthesis and accumulation of phytoalexins in plant cells (Keen, 1975), but was lately

448

Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich et al.

extended to encompass molecules that stimulate any of a number of defensive responses in plants (Hahn, 1996). The soybean cotyledon assay has been extensively used to detect phytoalexin-inducing activity in pathogenic and saprophytic microorganisms and to purify elicitors extracted from these organisms (Hahn & Albersheim, 1978; Costa & Dietrich, 1996; Hahn, 1996: Liu et al., 2005). The classic heptaglucoside elicitor from Phytophtora megasperma Drechs. var. sojae Hildeb. was isolated and characterized using this assay. The use of various heptaglucoside derivatives allowed the identification of the structural requirements for effective induction of phytoalexin in soybean (Sharp et al., 1984). The specific binding site for the heptaglucoside was demonstrated in soybean membranes (Cheong & Hahn, 1991) and later a protein with high affinity for this elicitor was purified and its gene cloned (Umemoto et al., 1997). Twelve out of 23 fungal species isolated from the leaves of a tropical Brazilian Rubiaceae were shown to induce glyceollin production in soybean cotyledons (Cordeiro Neto & Dietrich, 1992). A comparison between the phytoalexin-inducing capacity of spores of a saprobiont (Penicillium steckii Zaleski) and a pathogen to cultivated species (Colletrotrichum gloesporieoides (Penz.) Sacc.), which occur naturally on those Rubiaceae, showed that their eliciting capacity was approximately the same and not related to pathogenicity (Costa & Dietrich, 1996). This methodology was also used by our group to assess differential production of phytoalexins in fifteen soybean cultivars treated with cell wall-derived elicitor molecules from the saprobiont fungus Mucor ramosissimus Samutsevitsch (Pelicice et al., 2000). Seven of these cultivars have shown high phytoalexin production and two displayed no phytoalexin response under the experimental conditions used. Among the responsive cultivars, the phenylpropanoid HPLC profiles showed the presence of the same compounds although with variations in the relative proportions of glyceollins and their precursors. Using this assay we characterized the elicitor from M. ramosissimus (Simões et al., 2005) and compared its activity with the -glucan elicitor isolated from Phytophthora sojae, the most active elicitor described so far (Hahn, 1996). Biochemical analyses suggested that fragments of mucoran-type polysaccharides, mostly composed of mannose, glucose, galactose, and glucuronic acid, are the phytoalexin elicitors present in the spores of the saprobe M. ramosissimus. Our results indicated for the first time that soybean cotyledon tissues can recognize fragments of glucuronic-acid heteropolymers as phytoalexin elicitors (Simões et al., 2005). Endopolygalacturonases isolated from this saprobiont also displayed phytoalexin-eliciting activity on soybean cotyledons via hydrolysis of different pectic substrates obtained from cell walls of a native tropical Rubiaceae (Marques et al., 2006). Plantlet hypocotyls, whole seeds or cell suspension cultures of soybean were used as alternative biological systems to study respectively the involvement of active oxidative burst triggered by fungal elicitors (Goméz et al., 1994), the differences in the susceptibility of soy cultivars to pathogens and saprobionts (Garcéz et al., 2000) and the transcriptional changes in the expression of enzymes devoted to phytoalexins production (Delledonne et al., 1998), among others.

Soybean as a Model to Study Defensive Responses Enhanced by Fungal Elicitors … 449

NITRIC OXIDE SIGNALING AND PHYTOALEXIN ACCUMULATION Oxidative burst and phytoalexin production are some of the earliest events triggered in plant cells in response to pathogen attack. The high amounts of reactive oxygen (1O2, ●O2-, H2O2, etc) and nitrogen (●NO, ●NO2, ONOO-, etc) species produced by plant tissues lead to cell signaling and hypersensitive response, where plant cells surrounding the infection site die (Salgado et al., 2010). The production of ●NO, a gaseous molecule that easily diffuses into cell membrane, is intriguing plant biologists due to the multitude of its roles in plant-pathogen interaction, including phytolexin production. The first evidence of expression induction of PAL (phenylalanine ammonia-lyase) and CHS (chalcone synthase) genes by ●NO was observed in soybean cell suspensions challenged with the avirulent bacteria Pseudomonas syringae pv. glycinea (Delledonne et al., 1998). Dramatic increase in the transcript levels of PAL and CHS was detected in the first three hours of plant cell-pathogen interaction. The addition of the ●NO scavenger carboxy-PTIO prevented the accumulation of PAL and CHS transcripts stimulated in these cell suspensions by the exogenous ●NO donor sodium nitroprusside (SNP) (Delledonne et al., 1998). By using the cut-cotyledon assay, we reported the glyceollin accumulation in soybean after exposure either to the fungus Diaporthe phaseolorum f. sp. meridionalis (Dpm) elicitor or SNP (Modolo et al., 2002). Potassium ferricyanide, a structural analog of SNP devoid of the NO moiety, failed to induce glyceollin production in soybean cotyledons. Cotyledon elicitation with Dpm extract induced maximal accumulation of daidzein and genistein within 12 h of treatment, a condition in which glyceollins started to be formed. Accumulation of glyceollins dramatically increased after 20 h of Dpm elicitation, while the production of its immediate precursor daizein dropped. SNP treatment triggered a much earlier accumulation of daidzein and genistein, but glyceollin production was about 2.5-fold lower than that in Dpm-elicited cotyledons. The daidzein levels in cotyledon exudates were high even 20 h post SNP treatment. Additionally, production of a greater variety of metabolites was induced by the Dpm elicitor than did SNP. These findings suggested that signaling molecules other than ●NO are likely required for the transcriptional induction of enzymes involved in later reactions of glyceollins production pathway. As observed for the other analyzed metabolites, SNPtreatment triggered the accumulation of much higher levels of the flavone luteolin whereas Dpm extract efficiently induced the production of the flavone apigenin that did not occur by treatment with SNP. Furthermore, the elicitation with Dpm extract induced a Ca2+-dependent mammalian nitric oxide sintase (NOS)-like enzyme activity whose highest catalysis rate preceded the maximal accumulation of daidzein. NG-Nitro-L- arginine(L-NAME) or aminoguanidine (AMG), mammalian NOS inhibitors, partly prevented phytoalexins formation in Dpm-treated cotyledons indicating that other ●NO sources might be contributing to this response (Modolo et al., 2002). Suita et al. (2009) have used soybean cell suspensions under abiotic stress (light exposure) to investigate the role of cyclic GMP (cGMP) on the transcription of genes that encode enzymes of flavonoid/pterocarpan pathway. The treatment of soybean cells with the membrane-permeable cGMP analog 8-Br-cGMP led to a rapid and massive accumulation of the following transcripts: PAL, C4H (cinnamate 4-hydroxylase), 4CL (p-coumarate:CoA ligase), CHS, CHR (chalcone reductase), CHI (chalcone isomerase), IFS (2hydroxyisoflavanone synthase) and HIDH (2-hydroxyisoflavanone dehydratase). These

450

Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich et al.

transcripts also accumulated in soybean cells in response to SNP. The NO-triggered induction of these genes was abolished by the guanylyl cyclase inhibitor 6-anilino-5,8quinolinedion. The cGMP levels in soybean cells transiently increased after incubation with SNP (Suita et al., 2009). These results suggest that NO acts upstream of cGMP by inducing a guanylate cyclase-like activity similarly to the observed in animal cells and Nicotiana tobacco-tobacco mosaic virus interaction (Durner et al., 1998). Although the authors did not investigate the variation in glyceollins levels, SNP-treated soybean cotyledons accumulated daizdein and genistein corroborating our results (Modolo et al. 2002). cGMP was found to be a second messenger of NO signaling pathway for phytoalexin production in plant tissues challenged with pathogens (reviewed by Modolo, 2010).

ELEVATED CO2 ATMOSPHERES AND PHYTOALEXIN RESPONSE CO2-enriched atmospheres have been shown to increase photosynthetic carbon gain and growth in many plant species, including soybean (Ainsworth et al., 2002). Carbon excess leads to changes in the production of plant defensive secondary chemicals, which in turn may modify the plant responses to herbivores and pathogens (Hartley et al., 2000, Chakraborty & Datta, 2003). However, information about the influence of CO2-enriched environment on plant resistance to pathogens is still limited. Higher carbohydrate availability in host tissues can enhance plant resistance due to an increase in production of defensive compounds (Hibberd et al., 1996) but can concomitantly provide a better substrate for fungal growth. In addition, high CO2 can also influence sporulation, spread, and aggressiveness of fungal pathogens (Chakraborty & Datta, 2003; Mitchell et al., 2003). Studies have shown that phenylpropanoid metabolism can be highly influenced by elevated CO2 conditions and flavonoids have been shown to increase in soybean in response to a metabolic excess of carbon (Kim et al., 2005). In a study using the cut-cotyledon assay, we observed remarkable differences in phytoalexin production between soybean cultivars susceptible and resistant to stem canker disease in response to Dpm elicitor when the plants were previously exposed to a CO2enriched atmosphere (720 μmol mol−1) in open top chambers. High levels of CO2 caused significant improvement of glyceollin production only in the resistant soybean cultivar. This increase was not observed for daidzein content, suggesting that the increased carbon supply specifically affected the biosynthetic steps leading to the conversion of this precursor into glyceollins rather than stimulating the whole phenylpropanoid pathway (Figure 1) (Braga et al., 2006). These findings corroborate the assumption that exposure to enriched-CO2 atmospheres can change inducible defensive responses in soybean against pathogens. These changes occurred in specific metabolites and depended on the cultivar resistance patterns. Increased atmospheric pollutants including CO2 and NO have a large impact on vegetation, with detrimental or beneficial influences on plant growth and metabolism. We recently reported the impact of higher levels of atmospheric CO2 on NO- or fungal elicitorinduced phytoalexin production (Kretzschmar et al., 2009). Cotyledons from plants maintained under CO2-enriched atmosphere (720 μmol mol−1) exhibited doubled PAL activity after treatment with SNP or fungal elicitor. Conversely, treatment of cotyledons with SNP, but not with fungal elicitor, stimulated by 3-fold the activity of -glucosidases involved in the

Soybean as a Model to Study Defensive Responses Enhanced by Fungal Elicitors … 451 conversion of daidzein 7-O-glucoside or genistein 7-O-glucoside into their corresponding aglycones. Thus, NO not only induces the transcription of isoflavone genes in elicited soybean (Modolo et. al., 2002), but also stimulates the activity of enzymes involved in the mobilization of isoflavone glucosides, increasing the levels of daidzein (glyceollins‘ precursor) and genistein, an antimicrobial compound (Kretzschmar et al., 2009). The activity of flavanone-3-hydroxylase (F-3H) was stimulated by both SNP and fungal elicitor, resulting in accumulation of apigenin. CO2 altered the time-course of glyceollin accumulation shifting the maximal production from 20 h (Modolo et. al., 2002) to 12 h post-fungal elicitation (Kretzschmar et al., 2009). Moreover, an expressive production of glyceollins in cotyledons exposed to SNP was induced by high CO2 atmosphere whereas minute amounts of this pterocarpan were detected in SNP-treated cotyledons under normal CO2 level (380 μmol mol−1). This strongly suggests that the growth of soybean under CO2-enriched atmosphere, as predicted for the next several decades, affect the accumulation of antimicrobial flavonoids in response to NO donor or fungal elicitor.

CONCLUSION Much was learned from studies performed around the world with soybean cotyledons and cell suspensions in the last four decades. Such studies brought a large contribution to the understanding of multiple aspects of plant-pathogen interactions, notably recognition of abiotic and biotic eliciting molecules and their structures, signal transduction mechanisms, phytoalexin biosynthetic pathways, among others. Our contribution to this field includes the knowledge about the eliciting capacity of fungi naturally occurring on the leaf surface of wild tropical plants, occurrence of novel eliciting structures, the role of ●NO on plant responses to pathogen attack, and the defensive responses of soybean cultivars under increased CO2 atmospheres predicted to occur in the next decades. The data presented here, besides demonstrating the importance of soybean for research that greatly contribute to understanding and minimizing the effect of biotic and abiotic factors, will be valuable for a rational intervention in a secondary metabolism pathway in soybean and other cultures.

ACKNOWLEDGMENTS This work was financially supported by the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP 05/04139-7). Thanks are also due to Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq for the researcher fellowships to M.R. Braga and S.M.C. Dietrich, to FAPESP for a post-doctoral fellowship to K. Simões and FAPEMIG for supporting L.V. Modolo.

452

Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich et al.

REFERENCES Ainsworth, E. A., Davey, P. A., Bernacchi, C. J., Dermody, O. C., Heaton, E. A., Moore, D. J., Morgan, P. B., Naidu, S. L., Yoora, H. S., Zhu, X. G., Curts, P. S. & Long, S. P. (2002). A meta-analysis of elevated [CO2] effects on soybean (Glycine max) physiology and yield. Global Change Biology, 8, 695-709. Ayers, A. R., Ebel, J., Finelli, F., Berger, N. & Albersheim, P. (1976). Host-pathogen interactions: quantitative assays of elicitor activity and characterization of elicitor present in extracellular medium of cultures of Phytophthora megasperma var. sojae. Plant Physiology, 57, 751-759. Braga, M. R. (2008). Fitoalexinas. In S. F. Pascholatti, B. Leite, J. R. Starglin & P. Cia. (Orgs.), Interação Planta-Patógeno: Fisiologia, Bioquímica e Biologia Molecular. (1 ed., 305-346). Piracicaba, SP: FEALQ. Braga, M. R., Aidar, M. P. M., Marabesi, M. A. & Godoy, J. R. L. (2006). Effects of elevated CO2 on the phytoalexin production of two soybean cultivars differing in the resistance to stem canker disease. Environmental and Experimental Botany, 58, 85-92. Chakraborty, S. & Datta, S. (2003). How will plant pathogens adapt to host plant resistance at elevated CO2 under a changing climate? New Phytologist, 159, 733-742. Cheong, J. J. & Hahn, M. G. (1991). A specific, high-affinity binding site for the hepta glucoside elicitor exists in soybean membranes. The Plant Cell, 3, 137-147. Cordeiro Neto, F. & Dietrich, S. M. C. (1992). Phytoalexin induction by leaf-surface fungi of tropical Rubiaceae. Ciência e Cultura, 44, 342-344. Costa, A. P. P. & Dietrich, S. M. C. (1996). Phytoalexin eliciting activity in phytopathogenic and saprophytic fungi - a comparison. Ciência e Cultura, 48, 275-278. de Fátima, Â. & Modolo, L. V. (2008). What chemical weapons do plants use to fight against pathogens? In G. P., Rao, Y., Zhao, V. V. Radchuk, & S. K. Bhatnagar, (Eds.), Advances in Plant Biotechnology (179-204). Huston, TX: Studium Press LLC. Delledone, M., Xia, Y., Dixon, R. A. & Lamb, C. (1998). Nitric oxide functions as a signal in plant disease resistance. Nature, 394, 585-588. Durner, J., Wendehenne, D. & Klessig, D. F. (1998). Defense gene induction in tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose. Proceedings of the National Academy of Sciences USA, 95, 10328-10333. Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA). (2000). Doenças e medidas de controle. In EMBRAPA, Recomendações técnicas para a cultura da soja na região central do Brasil 2000/2001 (171-219). Londrina, PR: Embrapa Soja, Fundação MT. Frank, J. A. & Paxton, J. D. (1971). An inducer of soybean phytoalexin and its role in the resistance of soybeans to Phytophthora rot. Phytopathology, 61, 954-956. Furtado, G. Q., Alves, S. A. M., Godoy, C. V., Salatino, M. L. F. & Júnior, N. S. M. (2009). Influence of light and leaf epicuticular wax layer on Phakopsora pachyrhizi infection in soybean. Tropical Plant Pathology, 34, 306-312. Garcéz, W. S., Martins, D., Garcez. F. R., Marques, M. R., Pereira, A. A. P., Oliveira. L. A., Rondon, J. N. & Peruca, A. D. (2000). Effect of spores of saprophytic fungi on phytoalexin accumulation in seeds of frog-eye spot and canker-resistant an susceptible soybean (Glycine max L.) cultivars. Journal of Agricultural and Food Chemistry, 48, 3662-3665.

Soybean as a Model to Study Defensive Responses Enhanced by Fungal Elicitors … 453 Goméz, L. D., Braga, M. R. & Dietrich, S. M. C. (1994). Involvement of active oxygen species and peroxidases in phytoalexin production induced in soybean hypocotyls by an elicitor from a saprophytic fungus. Ciência e Cultura, 46, 153-156. Graham, T. L. & Graham, M. Y. (1991). Glyceollin elicitors induce major but distinctly different shifts in isoflavonoid metabolism in proximal and distal soybean cell populations. Mo1ecular Plant Microbe Interaction, 4, 60-68. Hahn, M. G. (1996). Microbial elicitors and their receptors in plants. Annual Review of Phytopathology, 34, 387-412. Hahn, M. G. & Albersheim, P. (1978). Host-pathogen interactions. XIV. Isolation and partial characterization of an elicitor from yeast extract. Plant Physiology, 62, 107-111. Hahn, M. G., Darvill, A. G. & Albersheim, P. (1981). Host-pathogens interactions. XIX. The endogenous elicitor, a fragment of a plant cell wall polysaccharide that elicits phytoalexin accumulation in soybeans. Plant Physiology, 68, 1161-1169. Hartley, S. E., Jones, C. G. & Couper G. C. (2000). Biosynthesis of plant phenolic compounds in elevated atmospheric CO2. Global Change Biology, 6, 497-506. Hibberd, J. M., Whitbread, R. & Farrar, J. F. (1996). Effect of elevated concentrations of CO2 on infection of barley by Erysiphe graminis. Physiological and Molecular Plant Pathology, 48, 37-53. Isanga, J. & Zhang, G. N. (2008). Soybean bioactive components and their implications to health - A review. Food Reviews International, 24, 252-276. Keen, N. T. (1975). Specific elicitors of plant phytoalexin production: determinants of race specificity in pathogenesis. Science, 187, 74-75. Kim, S. H., Jung, W. S., Ahn, J. K., Kim, J. A. & Chung, lii. M. (2005). Quantitative analysis of the isoflavone content and biological growth of soybean (Glycine max L.) at elevated temperature, CO2 level and N application. Journal of the Science of Food and Agriculture, 85, 2557-2566. Kretzschmar, F. S., Aidar, M. P. M., Salgado, I. & Braga, M. R. (2009). Elevated CO2 atmosphere enhances production of defense-related flavonoids in soybean elicited by NO and a fungal elicitor. Environmental and Experimental Botany, 65, 319-329. Liu, H., Huang, C., Dong, W., Du, Y., Bai, X. & Li, X. (2005). Biodegradation of xanthan by newly isolated Cellulomonas sp. LX, releasing e elicitor-active xantho-oligosaccharidesinduced phytoalexin synthesis in soybean cotyledons. Process Biochemistry, 40, 37013706. Martins, C. A. O., Sediyama, C. S., Oliveira, A. G. A., Reis, M. S., Rocha, V. S., Moreira, M. A. & Gomes, J. L. L. (2002). Resistance to stem canker, frogeye leaf spot and powdery mildew of soybean lines lacking lipoxigenases in the seeds. Scientia Agricola, 59, 701705. Marques, M. R., Buckeridge, M. S., Braga, M. R. & Dietrich, S. M. C. (2006). Characterization of an extracellular endopolygalacturonase from the saprobe Mucor ramosissimus Samutsevitsch and its action as trigger of defensive response in tropical plants. Mycopathologia, 162, 337-346. Mitchell, C. E., Reich, P. B., Tilman, D. & Groth, J. V. (2003). Effects of elevated CO2, nitrogen deposition, and decreased species diversity on foliar fungal plant disease. Global Change Biology, 9, 438-451.

454

Marcia Regina Braga, Kelly Simões, Sonia Machado de Campos Dietrich et al.

Modolo, L. V. (2010). Effective plant protection weapons against pathogens require NO bullets. In S., Hayat, M., Mori, J. Pichtel, & A. Ahmad, (Orgs.), Nitric oxide in Plant Physiology (103-111). Weinheim: Wiley-VCH. Modolo, L. V., Cunha, F. Q., Braga, M. R. & Salgado, I. (2002). Nitric oxide synthasemediated phytoalexin accumulation in soybean cotyledons in response to the Diaporthe phaseolorum f. sp. meridionalis elicitor. Plant Physiology, 130, 1288-1297. Paxton, J. D. (1995). Soybean phytoalexin: elicitation, nature, mode of action and role. In M. Daniel, & P. P. Purkayastha, (Eds.), Handbook of Phytoalexin Metabolism and Action (69-83). New York, NY: Marcel Dekker. Pelicice, F. M., Dietrich, S. M. C. & Braga, M. R. (2000). Phytoalexin response of fifteen Brazilian soybean cultivars. Revista Brasileira de Fisiologia Vegetal, 12, 45-53. Salgado, I., Oliveira, H. C. & Braga, M. R. (2010). Nitrate reductase-deficient plants: A model to study nitric oxide production and signaling in plant defense response. In S. Hayat, M. Mori, J. Pichtel, & A. Ahmad. (Orgs.), Nitric Oxide in Plant Physiology (89101). Weinheim: Wiley-VCH. Sharp, J. K., McNeil, M. & Albersheim, P. (1984). The primary structures of one elicitoractive and seven elicitor-inactive hexa(ß-D-glucopyranosyl)-D-glucitols isolated from the mycelial walls of Phytophthora megasperma f. sp. glycinera. Journal of Biological Chemistry, 259, 11321-11336. Simões, K., Dietrich, S. M. C., Hahn, M. G. & Braga, M. R. (2005). Purification and characterization of a phytoalexin elicitor from spores of the saprobe Mucor ramosissimus. Revista Brasileira de Botânica, 28, 735-744. Suita, K., Kiryu, T., Sawada, M., Mitsui, M., Nakagawa, M., Kanamaru, K. & Yamagata, H. (2009). Cyclic GMP acts as a common regulator for the transcriptional activation of the flavonoid biosynthetic pathway in soybean. Planta, 229, 403-413. Umemoto, N., Kakitani, M., Iwamatsu, A., Yoshikawa, M., Yamaoka, N. & Ishida, I. (1997). The structure and function of a soybean β-glucan-elicitor-binding protein. Proceedings of the National Academy of Sciences USA, 94, 1029-1034.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 20

APPLICATIONS OF SOYBEAN PEROXIDASE IN ANALYTICAL SCIENCE 1

Shuang Han1,3, Lihong Shi2 and Guobao Xu1* State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, 5625 Renmin Street, Changchun, Jilin 130022, P. R. China 2 College of Chemistry and Life Science, Zhejiang Normal University, Jinhua 321004, China 3 Graduate University of the Chinese Academy of Sciences, Beijing 100864, P. R. China

ABSTRACT Soybean peroxidase (SBP) belongs to class III of the plant peroxidase superfamily that also includes barley peroxidase, peanut peroxidase, and widely studied horseradish peroxidase (HRP). There is increasing interest in SBP as an alternative to HRP for analytical applications because of its conformational stability and good stability at high temperature and in acidic media. In this review, the applications of SBP in analytical science are demonstrated, such as the applications in chemiluminescence immunoassays, colorimetric immunoassays, rapid chemiluminescent detection, identification, and enumeration of microorganisms using SBP-labelled peptide nucleic acid probe, DNA probe assays, direct electrochemistry of SBP, as well as electrochemical biosensors for the determination of hydrogen peroxide, organic peroxide, phenol, glucose, and lactate.

1. INTRODUCTION Peroxidase is a class of oxidoreductase produced by microorganism or plant. They can catalyze substrate oxidation with hydrogen peroxide as an electron acceptor. Peroxidase mainly exists in peroxisome of cells with a ferriprotoporphyrin IX prosthetic group located at the active site, and can catalyze oxidation reaction of hydrogen peroxide and phenolic or

456

Shuang Han, Lihong Shi and Guobao Xu

amine compounds, with dual role of elimination toxicity of them. Both HRP and SBP are members of class III plant peroxidase superfamily [1, 2]. HRP is a ‗traditional‘ enzyme, whereas SBP emerged in the 1990s. Recently there is increasing interest in SBP, as it is more stable and able to transform the substrates more efficiently [3, 4]. SBP is a 306-amino acid containing glycoprotein with a molecular mass of ∼40 kDa. It has similar overall structure to HRP with a degree of sequence homology of 57%. The common features between SBP and HRP include a ferriprotoporphyrin IX prosthetic group located at the active site, catalytic mechanism, conserved catalytic residues, four disulfide bridges, two Ca2+ binding sites located distal and proximal to heme, eight glycans, and a single tryptophan [5]. Noteworthily, SBP has some advantages compared with HRP in terms of catalytic activity and stability [6], which can both be exploited in biosensors. Compare with HRP, the purified SBP could hold its prosthetic group tightly at pH 3.0, while HRP lost the heme group after placing in pH 3.0 solutions for 30 min [7]. SBP is less susceptible to heme loss and permanent inactivation by hydrogen peroxide. It can maintain its biocatalytic activity in a broad pH range 2–10 [8], at high temperature (≤60 °C) [9, 10] and in a variety of organic solvents [11]. Furthermore, SBP is more economical for practical applications because it can be isolated readily from the seed coats of soybean. The isoelectric point of SBP is 4.1 but HRP is 9.0 [8]. SBP is now the only commercially available enzyme of these anionic peroxidases. Hence, it particularly shows great promise for biocatalytical and biosensing application. SBP-based sensors have been developed for determination of hydrogen peroxide, organic peroxide, and phenols. When combined SBP with glucose oxidase or lactate oxidase, the biosensors were exploited for quantifying glucose and lactate. SBP has also been used as label in immunoassays, DNA probe assays, and peptide nucleic acid probe assays. In this review, we summarize the applications of SBP in analytical science, such as the applications in electrochemical biosensors, chemiluminescent sensors, DNA probe assays, and so on.

2. ELECTROCHEMICAL SENSOR The determination of hydrogen peroxide is very important in pharmaceutical, clinical, chemical, industrial, food, environmental, biological, and other fields. Many methods, such as colorimetry, chemiluminescence, electrochemiluminescence, UV-vis spectrophotometry, and electrochemical sensors, have been developed. Among these techniques, peroxidase-based electrochemical biosensors attract considerable attention because of their operation simplicity, high sensitivity, and suitability for online detection [12]. HRP is used in most hydrogen peroxide biosensors. These biosensors are usually operated in neutral media at low temperature. However, many industrial processes involved biocatalysis at high temperature or weakly acidic samples. Therefore, it is important to develop biosensors that can be operated at high temperatures or in an acidity medium.

2.1. Enhancing Thermostability of SBP Heller‘s group has first reported a SBP-based electrochemical biosensor [13]. They crosslinked and electrically "wired'' SBP through a redox-conducting hydrogel to a glassy carbon

Applications of Soybean Peroxidase in Analytical Science

457

electrode. The hydrogel was synthesized by partially complexing the pyridine nitrogens of poly(4-vinylpyridine) with Os(bpy)2Cl+/2+ and then partially quaternizing these with 2bromoethylamine. Compared with wired HRP-based biosensor, the SBP-based biosensor was very stable at high temperatures. It lost only 1.7%/h of its sensitivity at 65°C, and had a 4 h operational half-life at 75°C. In contrast, the wired HRP-based biosensor decayed at a rate of 50%/h. The study is also a classical example of using redox mediators shuttling electrons between the active site of SBP and the electrode surface. Most of enzyme electrodes have not shown satisfactory stability at 37°C. Since the SBPbased biosensor mentioned above only loses 0.1%/h of its current at 45°C, Heller‘s group constructed a thermostable SBP-based glucose and lactate sensors with a four-layer structure [14]. The first layer consists of SBP immobilized in a redox polymer mentioned above. The second is a layer of cellulose acetate controlling hydrogen peroxide transport. The third is an immobilized glucose oxidase or lactate oxidase layer, where glucose or lactate reacted with oxygen to produce hydrogen peroxide. The fourth is a glucose or lactate transport controlling layer of cellulose acetate. This novel electrode was insensitive to applied potential between 0.2 and +0.3 V (vs SCE), oxygen and salt concentration, angular velocity, and interferants (e.g. urate, ascorbate, and acetaminophen). The glucose electrodes loaded with 52 μg glucose oxidase maintained 100% of its initial current density for over 100 h, lost only 10% after 200 h, and lost within 25% after 280 h at 37°C. The lactate sensor with 160 μg lactate oxidase demonstrated no loss of current density at low lactate concentrations and a loss of only 10% at lactate concentrations greater than 5 mM after 160 h of continuous operation. To further enhance enzyme stability, Guto et al. have cross-linked HRP, SBP, and myoglobin into poly(L-lysine) films attached to oxidized carbon electrodes or carboxylated silica surfaces [15]. These cross-linked films were stable for up to 9 h at 90 °C. HRP-poly(L-lysine) is 3 times more active than SBP-poly(L-lysine) at 25 °C, and the latter is slightly more active at 90°C.

2.2. Application of SBP in Acidic Media In some cases, for example fermentation process, samples containing hydrogen peroxide are acidic. Therefore, it is important to develop sensors with good stability in acidic media. Dong‘s group constructed a biosensor by immobilizing SBP in a sol-gel thin film using methylene blue as a mediator [16]. The sensor exhibited a fast response, high sensitivity, good thermostability, and long-term stability. However, this biosensor exhibited large noise and small response when the pH was lower than 4.0. To further expand the operating pH, they immobilized SBP into a self-gelatinizable grafting copolymer of polyvinyl alcohol with 4vinylpyridine [7]. SBP maintained its bioactivity down to a pH of 3.0. Spectrophotometric results illustrate that SBP can hold on its prosthetic group firmly at pH 3.0, while the porphyrin group of HRP falls off the active center at the same condition.

2.3. Determination of Phenols Lindgren et al. described the determination of phenolic compounds in flow injection mode with various peroxidases [17]. Phenolic compounds can be oxidized in the presence of

458

Shuang Han, Lihong Shi and Guobao Xu

hydrogen peroxide at peroxidase modified electrodes. The SBP modified electrode was found to exhibit better responses than the HRP modified electrode for most of phenolic compounds. The phenol biosensor based on soybean seed hull extracts containing SBP was also reported in 1999 [18]. The advantages of this sensor are straightforward and inexpensive electrode preparation, as well as three weeks of operating life. The biosensor showed a linear response up to 500 μM phenol. Because of the low activity of enzyme extracts, the biosensor is less sensitive than other previously reported sensors based on purified SBP [17] or HRP [19] or on crude extracts of sweet potato [20] with detection limits in the micromolar range. Many sensors can only determine individual phenols and pesticides, while some samples usually consist of different compounds mixture. This problem has been solved by designing amperometric screen-printed biosensor arrays consisting of a reference electrode surrounded by eight radially distributed working electrodes [21]. Cholinesterases, tyrosinase, peroxidases (SBP, soybean, and HRP, horseradish), and cellobiose dehydrogenase were combined on the same array with glutaraldehyde as crosslinker for detection of acetylthiocholine, monophenol, hydrogen peroxide, and cellobiose, respectively. The relative standard deviations for different enzyme substrates were less than 7%. The detection limits for pesticides and phenols were in the nanomolar and micromolar ranges, respectively.

2.4. Direct Electrochemistry of SBP Chemical modification of enzyme with electron-relay groups represents another attractive route for facilitating the electron transfer between enzyme redox centers and electrode surfaces. In 2007 Carolan et al. described covalent attachment of ferrocene carboxylic acid to aminated SBP via a carbodiimide-mediated reaction [22]. Ferrocene attachment significantly increased the rate of heterogeneous electron transfer between the electrode and the active site of SBP by >10-fold. The sensitivity of steady-state current response of ferrocene-SBP biosensor is about 3.5 times larger than that of the native SBP sensor. Zhang et al. reported the direct electrochemistry and electrocatalysis of SBP by immobilizing SBP in lipid films [23]. In this procedure, dimyristoylphosphatidylcholine vesicles were dispersed by sonication. Then dimyristoylphosphatidylcholine vesicle dispersion containing SBP was dropped evenly onto a pyrolytic graphite electrode and was left to dry overnight. The modified electrodes showed reversible FeIII/FeII voltammetry and catalytic current for hydrogen peroxide and oxygen. The efficient direct electron transfer to SBP was also achieved by immobilizing SBP on single-walled carbon nanohorns (SWCNHs) [5]. Cyclic voltammogram shows a pair of reversible redox peaks in pH 5.0 phosphate buffer solution. The formal potential is 0.24 V. This biosensor exhibited a high sensitivity (16.625 μA/mM), a wide linear range from 0.02 mM to 1.2 mM with a detection limit of 0.5 μM, good fabrication reproducibility and excellent stability.

3. CHEMILUMINESCENCE IMMUNOASSAYS The HRP is widely used in chemiluminescence immunoassay as a label. Luminol is the most commonly used peroxidase substrate in chemiluminescence assays. Because HRP is a

Applications of Soybean Peroxidase in Analytical Science

459

poor catalyst in luminol oxidation, 4-iodophenol is frequently used as enhancers to increase chemiluminescence intensity up to 1000-fold over the unenhanced reactions [24, 25]. A drawback of HRP as a label in chemiluminescence enzyme immunoassay is the relatively quick decay of the chemiluminescence signal because of HRP inactivation as a result of the interaction of the enzyme and radical products of substrate oxidation [26]. To overcome the problem, Sakharov‘s group has investigated luminol chemiluminescence in the presence of SBP [26]. In contrast to HRP, SBP can efficiently catalyze the chemiluminescence reaction between luminal and hydrogen peroxide in the absence of any enhancer. It catalyzes oxidation of its substrates according to the ―ping-pong‖ mechanism: SBP+H2O2  SBP-I + H2O SBP-I + A  SBP-II + A SBP-II + A  SBP + A + H2O Where SBP-I and SBP-II indicate SBP intermediate compounds, and A and A are luminol and its radical product of one electron oxidation, respectively. A is then converted into an aminophthalate ion in an excited state, which emits light when returning to the ground state. In comparison with HRP-based chemiluminescence, SBP-based chemiluminescence shows some interesting features. First, the chemiluminescence signal in the SBP-catalyzed reaction changed little with time, which is beneficial to improve reproducibility. Second, the presence of p-iodophenol in the reaction medium affects slightly the efficiency of SBP catalysis. Third, the use of SBP as a catalyst of luminol oxidation allows using peroxide solutions at higher concentrations than for other peroxidases. Fourth, the use of SBP as a catalyst of luminol oxidation allows using concentrated buffers. Finally, the detection limit value for SBP (0.3 pM) is less than those reported previously for HRP (1 pM ). Because of its promising features, SBP-based chemiluminescence was used to develop chemiluminescent enzyme-linked immunosorbent assay for the determination of mouse IgG [27]. By comparison, the chemiluminescence intensity decayed with a significantly lower rate using SBP label, and the assay using SBP label exhibits higher sensitivity and broader linear range for the determination of mouse IgG. The observation of the wider linear range for determination of mouse IgG is attributed to the higher stability of SBP. The higher sensitivity of the SBP-based immunoassay is ascribed to good catalytic capability of SBP. The SBPbased chemiluminescence immunoassay have also been successfully used for the determination of sulfamethoxypyridazine in spiked milk samples that were pretreated with trichloroacetic acid followed by the 100-fold dilution with 0.1% Triton X-100 in PBS [28]. To improve the performance of SBP-based chemiluminescence, the effect of some enhancers on SBP-based chemiluminescence has been investigated [29]. 0.75 mM 3-(100Phenothiazinyl)propane-1-sulfonate (SPTZ) was found to be able to increase chemiluminescence intensity by 37.5 times. Under optimal condition, the lower detection limit of SBP using SPTZ as an enhancer was 0.18 pM which is better than that of HRP-based system (1.1 pM). The lower detection limit of SBP was further improved to 0.03 pM by the addition of a secondary enhancer, 4-morpholinopyridine (MORP). Moreover, chemi-

460

Shuang Han, Lihong Shi and Guobao Xu

luminescence signal shows favorable long-term stability. The combination of SBP with SPTZ and MORP as enhancers holds promise for the development of ultrasensitive chemiluminescence enzyme immunoassays.

4. COLORIMETRIC IMMUNOASSAYS Sulfamides are actively used as antibacterials for therapy and prevention, especially in veterinary. One of the most widely used sulfamide is sulfamethoxipyridazine. Residual amounts of SMP in foodstuff may cause serious problems in on human health, such as allergies, toxic effects, and bacterial resistances. Therefore, a strict control of SMP residue is required. Chromatography assay is the main tool for controlling SMP, but it requires expensive equipment, high-quality personnel, and time-consuming operation when assaying serial samples. Consequently, peroxidase-based immunoassays have been actively developed. Because of its favorable features, SBP has recently been used as a new label for the development of colorimetric SMP immunoassay [30]. It can catalyze the reaction between 2,2-azino-bis(3-ethylbenzthiazolin-6-sulfonate) (ABTS) and hydrogen peroxide, which allows colorimetric determination of sulfamethoxipyridazine. The working range of sulfamethoxipyridazine assay amounted to 1.3 ng/ml – 63.0 ng/ml with a detection limit and IC 50 (the concentration causing 50% binding inhibition) of 0.4 ng/ml and 4.8 ng/ml, respectively. The sensitivity surpasses the maximum permissible concentration of SMP in foodstuff by several orders of magnitude. Additionally, the dilution of samples in combination with supplementation of the working solution with 0.15% casein effectively prevents the milk matrix effect on the detection.

5. RAPID CHEMILUMINESCENT DETECTION, IDENTIFICATION, AND ENUMERATION OF MICROORGANISMS USING SBP-LABELLED PNA PROBE Membrane filtration followed by growth on culture media to form visible colonies is a standard method for the detection of micro-organisms in filterable samples. Filters are typically incubated for at least 18 h before colonies are visible, and additional analysis to identify micro-organisms is required. The need for rapid detection, identification, and enumeration of micro-organisms has promoted the development of rapid membrane filtration assays. Biochemical methods provide both rapid detection and enumeration of microorganisms, but can not identify the micro-organisms. On the other hand, molecular amplification methods such as PCR can provide simultaneous detection and identification but lack the ability to enumerate. None of these methods are able to provide detection, identification and enumeration of an organism in the same test. Ribosomal RNA (rRNA) is universal elements of cells and is highly conserved between closely related species. rRNAs are present at a high copy number in bacteria, and thus have been popular targets of choice for oligonucleotide probe assays. This enables bacterial identification to be performed by a single definitive test rather than by a series of assays. However, it is often difficult to design DNA probes hybridizing efficiently within a given

Applications of Soybean Peroxidase in Analytical Science

461

stretch of the rRNA dictated by the nucleotide differences found between closely-related species, since the highly stable secondary structures in the rRNA results in poor accessibility of DNA probes to the rRNA targets, and the capability of DNA probes to distinguish single nucleotide changes are often limited. Peptide nucleic acid (PNA) consists of a non-charged polyamide backbone to which the different nucleobases are attached. Due to their uncharged neutral backbone, PNA probes have improved hybridization characteristics over oligonucleotides, such as faster hybridization kinetics, higher target specificity, significant increase in Tm values for the PNA/NA complexes, and stable PNA/NA hybrid even at low salt concentrations. Based on the remarkable features of PNA, Stender et al. have developed a new PNAbased chemiluminescent in situ hybridization method [31]. This method allows rapid and simultaneous detection, identification, and enumeration of P. aeruginosa in bottled water within one working day for the first time. In this method, Filtration was used to concentrate, isolate and separate individual microorganisms onto a membrane filter. The membrane was then placed on a culture medium and incubated appropriately. Long before colonies were visible, the incubation was terminated and hybridization was performed with a SBP-labelled PNA probe complementary to a species-specific rRNA sequence. Excess probe was removed by washing the membrane filter and the remaining hybridized SBP-labelled PNA probe was utilized to catalyze a chemiluminescence reaction. Microcolonies were observed as small light dots on the film, thereby providing a rapid and simultaneous detection, identification and enumeration of the specific micro-organisms. The light spots can be captured by using film or a digital camera system, making the assay adaptable to different types of laboratory facilities for a variety of microbiology applications. The method has also been used for rapid detection, identification, and enumeration of many other microorganisms [32–35]. The PNA-based chemiluminescent in situ hybridization method has also been smartly combined with ATP-dependent bioluminescence method [35]. Both methods are applied to the same membrane filter following a short incubation time and both methods provide results in the form of spots of light. The ATP-dependent bioluminescence method and the PNAbased chemiluminescent in situ hybridization method are used total count determination and specific identification of an indicator microorganism, respectively. This combination is particularly useful in process and quality control of non-sterile products to rapidly provide total counts as well as presence/absence of specific indicators and/or pathogens in non-sterile, filterable samples.

6. DNA PROBE ASSAYS Enzyme-labels have long been used in electrochemical enzyme-linked immunoassays as a means of amplifying the electrochemical signal for bioaffinity interactions. Similarly, enzyme labels can be applied to electrochemical DNA assays for hybridization detection by labeling the target DNA sequence (simple assay) or reporter DNA probe (sandwich assay) with a redox-active enzyme. Generally, hybridization is indicated by the enzyme-catalyzed electro-oxidation/reduction of a substrate to an electrochemically detectable product. The catalytic process transfers a large number of electrons to the electrode for each hybridization event that occurs, thereby generating an amplified electrochemical signal. Caruana and Heller

462

Shuang Han, Lihong Shi and Guobao Xu

used this approach to detect a single base mismatch in an 18-base oligonucleotide at elevated temperatures using SBP [36]. The probe DNA was immobilized onto a polyacrylamide based electron-conducting redox hydrogel on a carbon electrode. The target DNA is labeled with SBP. Hybridization establishes electrical contact between SBP and electrodes through the mediating redox polymer, resulting in the reduction of hydrogen peroxide to water. Performing such measurements at higher temperatures again allows the determination of mismatched sequences.

CONCLUSION It is now well recognized that peroxidases are widely studied and play an important role in determination of various analytes in clinical diagnoses, food industry, toxic compound monitoring, and many other environments. SBP is a promising peroxidase for analytical applications because of its improved bioactivity and stability at high temperature and in acid medium. SBP would also benefit the biosensor field by permitting more rapid electron transfer due to the lack of protein glycosylation. Improvement of SBP by rational mutation and‗focussed‘ directed evolution will widen its applications and expand its roles as key biotechnological tools in the future. Thus, it will own a great commercial prospect.

ACKNOWLEDGMENT This work is kindly supported by the National Natural Science Foundation of China (No. 20505016 & 20875086), the Ministry of Science and technology of the People‘s Republic of China (No.2006BAE03B08), and the Department of Sciences & Technology of Jilin Province (20070108 and 20082104).

REFERENCES [1] [2] [3] [4] [5]

Duroux, L; Welinder, KG. J. Mol. Evol., 2003, 57, 397-S407. Welinder, KG. Curr. Opin. Struct. Biol., 1992, 2, 388-393. Sakharov, IY. Biokhimiya, 2004, 69, 1013-1020. Gazaryan, IG; Khushpul‘yan, DM; Tishkov, VI. Usp. Biol. Khim., 2006, 46, 303-322. Shi, LH; Liu, XQ; Niu, WX; Li, HJ; Han, S; Chen, JA; Xu, GB. Biosens. Bioelectron, 2008, 24, 1159-1163. [6] Kamal, JK; Behere, DV. J. Inorg. Biochem., 2003, 94, 236-242. [7] Wang, BQ; Li, B; Cheng, GJ; Dong, S. J. Electroanalysis, 2001, 13, 555-558. [8] Ryan, BJ; Carolan, N; Ó‘Fágáin, C. Trends Biotechnol, 2006, 24, 355-363. [9] McEldoon, JP; Pokora, AR; Dordick, JS. Enzyme Microb. Technol., 1995, 17, 359-365. [10] Kamal, JKA; Behere, DV. Biochemistry, 2002, 41, 9034-9042. [11] Blinkovsky, AM; McEldoon, JP; Arnold, JM; Dordick, JS. Appl. Biochem. Biotechnol, 1994, 49, 153-164. [12] Ferapontova, EE. Electroanalysis, 2004, 16, 1101-1112.

Applications of Soybean Peroxidase in Analytical Science [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36]

463

Vreeke, MS; Yong, KT; Heller, A. Anal. Chem., 1995, 67, 4247-4249. Kenausis, G; Chen, Q; Heller, A. Anal. Chem., 1997, 69, 1054-1060. Guto, PM; Kumar, CV; Rusling, JF. J. Phys. Chem., B, 2007, 111, 9125-9131. Wang, BQ; Li, B; Wang, ZX; Xu, GB; Wang, Q; Dong, S. J. Anal. Chem., 1999, 71, 1935-1939. Lindgren, A; Emneus, J; Ruzgas, T; Gorton, L; Marko-Varga, G. Anal. Chim. Acta, 1997, 347, 51-62. Bassi, AS; McGrath, C. J. Agric. Food Chem., 1999, 47, 322-326. Ruzgas, T; Emneus, E; Gorton, L; Marko-Varga, G. Anal. Chim. Acta, 1995, 311, 245253. Vieira, ID; Fatibello, O. Anal. Lett, 1997, 30, 895-907. Solná, R; Dock, E; Christenson, A; Winther-Nielsen, M; Carlsson, C; Emnéus, J; Ruzgas, T; Skládal, P. Anal. Chim. Acta, 2005, 528, 9-19. Carolan, N; Forster, RJ; Ó‘Fágáin, C. Bioconjugate Chem., 2007, 18, 524-529. Zhang, Z; Chouchane, S; Magliozzo, RS; Rusling, JF. Anal. Chem., 2002, 74, 163-170. Marzocchi, E; Grilli, S; della Ciana, L; Prodi, L; Mirasoli, M; Roda, A. Anal. Biochem., 2008, 377, 189-194. Marquette, CA; Blum, L. J. Anal. Bioanal. Chem., 2006, 385, 546-554. Alpeeva, IS; Sakharov, IY. J. Agric. Food Chem., 2005, 53, 5784-5788. Sakharov, IY; Alpeeva, IS; Efremov, EE. J. Agric. Food Chem., -1587. Sakharov, IY; Berlina, AN; Zherdev, AV; Dzantiev, BB. J. Agric. Food Chem., 2010, 58, 3284-3289. Vdovenko, MM; Ciana, LD; Sakharov, IY. Anal. Biochem., 2009, 392, 54-58. Berlina, AN; Zherdev, AV; Dzantiev, BB; Sakharov, IY. Appl. Biochem. Micro., 2007, 43, 550-555. Stender, H; Broomer, A; Oliveira, K; Perry-O‘Keefe, H; Hyldig-Nielsen, JJ; Sage, A; Young, B; Coull, J. J. Microbiol. Meth, 2000, 42, 245-253. Stender, H; Broomer, AJ; Oliveira, K; Perry-O‘Keefe, H; Hyldig-Nielsen, JJ; Sage, A; Coull, J. Appl. Environ. Microbiol., 2001, 67, 142-147. Perry-O‘Keefe, H; Stender, H; Broomer, A; Oliveira, K; Coull, J; Hyldig-Nielsen, JJ. J. Appl. Microbiol., 2001, 90, 180-189. Esiobu, N; Mohammed, R; Echeverry, A; Green, M; Bonilla, T; Hartz, A; McCorquodale, D; Rogerson, A. J. Microbiol. Meth, 2004, 57, 157-162. Stender, H; Sage, A; Oliveira, K; Broomer, AJ; Young, B; Coull, J. J. Microbiol. Meth, 2001, 46, 69-75. Caruana, DJ; Heller, A. J. Am. Chem. Soc., 1999, 121, 769-774.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 21

SOYBEAN NUTRITION: PROTEIN AND ISOFLAVONES

1

Savithiry S. Natarajan1*, Devanand L. Luthria2# and Ronita Ghatak2 Soybean Genomics and Improvement Laboratory, Plant Sciences Institute. 2 Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, ARS, USDA, Beltsville, MD, USA

ABSTRACT Soybeans and soy products provide an excellent source of multiple macro and micronutrients. The objective of this communication was to provide a brief overview of soybean storage proteins composition and its uses in different food preparation. In addition, we briefly summarize our knowledge of isoflavones compounds in soybean and their health benefits as it relates to cancer and bone health as described in recent peerreviewed publications.

1. INTRODUCTION Soybean Glycine max (L.) Merr. is the world‘s leading oilseed crop and a primary source of protein feed supplement for livestock. The mature soybean seed contains approximately 38% protein, 30% carbohydrates (~ 15% soluble carbohydrates including sucrose, stachyose, raffinose and ~ 15% insoluble carbohydrates in the form of dietary fibers), 18 % oil and 14% moisture, ash and other nutrients such as minerals, vitamins, amino acids and isoflavones [1]. Soybeans and soy products are increasingly consumed by humans for their purported health benefits, which include reduced risk of some cancers, improved cardiovascular disease risk *

Corresponding author: Email: [email protected], Soybean Genomics and Improvement Laboratory, Plant Sciences Institute ARS, USDA, Beltsville, MD 20705-3000 Tel. # 301-504 5258 Fax # 301-504-5728

466

Savithiry S. Natarajan, Devanand L. Luthria and Ronita Ghatak

factors, and enhanced bone health due to the presence of secondary metabolites such as isoflavones [2-8]. In this chapter we discuss nutritional and health benefits of three important soybean ingredients namely, oil, protein and isoflavones.

2. SOYBEAN PROTEINS Soybean storage proteins can be categorized into three groups, [2S (α-conglycinin), 7S (β-conglycinin), and 11S (glycinin)] based on their sedimentation properties. The 2S group comprises trypsin inhibitors such as Kunitz Trypsin Inhibitor (KTI) and the Bowman Birk Inhibitor (BBI). The two other major storage protein groups, 7S and 11S (β-conglycinin and glycinin), account for approximately 70-80% of the total soybean proteins in seeds. These proteins are responsible for the nutritional and physicochemical properties of soybeans and their primary and crystal structures have been studied extensively [9-12]. β -conglycinin is a trimeric glycoprotein comprising of subunits, α, α´, and β. Glycinin is a hexamer consisting of five known subunits (G1, G2, G3, G4 and G5) with two additional genes gy6, which is a peudogene, and gy7, which is expressed at very low levels relative to others. Various subunits of glycinin are considered to play different important roles in tofu gel formation [13]. Fukushima (1991) reported that the presence of a higher number of G4 subunits was closely related to gel formation rate and transparency, whereas the presence of more G5 subunits was related to gel hardness [14]. Soybean proteins have been used for several decades as ingredients for their functional properties in a variety of food preparations such as tofu, soymilk, soy sauce, miso, and natto. The functional properties of soybean ingredients added to foods were reported by Kinsella [15] which includes solubility, water absorption and binding, greater viscosity, gel forming and elasticity property, cohesion-adhesion, emulsification, flavor-binding, fat absorbtion, and aeration-foaming in whipped products. In addition to the protein, the oil extracted from soybeans is used to manufacture cooking oil, margarine, and shortening. The defatted cake is used for the preparation of multiple soy protein enriched food products such as soy flour, soy concentrates and soy isolates. These soy protein products are used as meat imitations for vegetarian foods, protein drinks, protein enriched baked foods, soup bases and gravies.

3. SOY ISOFLAVONES Isoflavones are diphenolic phytoestrogens occuring as glucosides or aglycones that are found at relatively high concentration in soybeans and soybean foods. The major aglycon isoflavones found in soybeans are genistein, diadzein, and glycetein. These isoflavones are non nutritive substances, but they possess health benefits. Sugar and/or acid conjugates of isoflavones have also been identified in soybeans [16]. The existence of multiple forms of isoflavones results in significant challenges for optimization of extraction and analysis procedures that have been summarized in our recent review [17]. The composition of isoflavones varies with the cultivars‘ growing condition and extraction methodology. A typical composition of isoflavones in processed soybean meal samples is as follows: daidzein (13.9mg/kg), daidzin (141.1 mg/kg), acetyl daidzin (91.2 mg/kg), malonyl daidzin (477.8

Soybean Nutrition: Protein and Isoflavones

467

mg/kg), glycitin (49.1 mg/kg), malonyl glycitin (82.8 mg/kg), genistein (16.7 mg/kg), genistin (210.4 mg/kg), acetyl genistin (28.3 mg/kg), malonyl genistin (864.4 mg/kg) [18]. Isoflavones have been reported to have several health benefits. Cancer development is a dynamic and long-term process that involves many complex factors through critical steps of initiation, promotion, and progression leading to an uncontrolled growth of cancerous cells throughout the body. Barnes (1995) did a comparative literature study to examine the effects of genistein on in vivo and in vitro models of cancer [19]. He found that intake of soy foods containing genistein significantly reduced risk of mammary, liver, colon, prostrate, bladder, skin and stomach cancers in animal models. Sarkar et al., (2003) reviewed epidemiological studies of soybean foods on cancer prevention [20]. They found that there was a significant difference in cancer incidence among different ethnic groups. The incidences of breast and prostate cancers are much higher in the United States and European countries compared with Asian countries such as Japan and China. They concluded that one of the major differences in diet between these populations is that the Japanese and the Chinese consume a traditional diet high in soy product and this may have contributed to a lowr incidence of these cancers. Goodman et al., (1997) found that in a case-control study among the multi-ethnic population of Hawaii, high consumption of soy products and other legumes was associated with a decreased risk of endometrial cancer [21]. Zheng et al., (1999) collected overnight urine samples from 60 incident breast cancer cases in a large population-based case-control study conducted in Shanghai [22]. They found that excretion of all major isoflavonoids was 50-65% lower in the cancer cases than in cancer free controls, and they hypothesized that high intake of soy foods may reduce the risk of breast cancer. Anna et al., (2010) found that soy extract, compared to individual soy isoflavones, was a more potent chemo-preventive agent on prostate cancer cells [23]. Butler et al., (2010) determined that a diet consisting primarily of vegetables, fruit, and soy had an early-acting protective effect on breast carcinogenesis [24]. Shimazu et al., (2010) found an inverse association between isoflavone intake and risk of lung cancer in non smokers in a population-based prospective cohort study [25]. Shu et al., (2009) conducted the Shanghai Breast Cancer Survival Study to evaluate the association of soy food intake after diagnosis of breast cancer with total mortality and cancer recurrence [26]. They concluded that among women with breast cancer, soy food consumption was significantly associated with decreased risk of death and recurrence of cancer. Positive association between consumption of soy foods and prevention of prostate cancer is reviewed by Hwang et al., [27]. Byun et al., (2010) observed that consumption of yellow and black soybeans, and sword beans had a significant protective effect on bone loss in OVX rats by inhibiting bone turnover and preventing bone resorption [28]. Wong et al., (2009) tested the effect of a diet supplemented with isoflavones on bone health in a multicenter, randomized, double-blind, placebo-controlled 24-mo trial in postmenopausal women [29]. They found that daily supplementation with soy hypocotyl isoflavones reduced whole-body bone loss but does not slow bone loss at common fracture sites in healthy postmenopausal women. Kenny et al., (2009) studied the long-term effect of dietary soy protein and/or soy isoflavone consumption on skeletal health in late postmenopausal women [30]. Unlike others, they found that soy protein and isoflavones (either alone or together) did not affect bone mass density. Mathew et al., (2007) found that long-term equol consumption, like genistein and daidzein, in the ovariectomized rat, provides bone sparing effects [31].

468

Savithiry S. Natarajan, Devanand L. Luthria and Ronita Ghatak

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20]

World Initiative for soy in human helath (WISHH). www. wishh. org/ aboutsoy/ composition.html. Caragay, AB. Cancer preventive foods and ingredients, Food Tech., 1992, 46, 65-68. Anderson, JJB; Garner, SC. Phytoestrogens and human function, Nutr Today, 1997, 32, 232-239. Koratkar, R; Rao, AV. Effect of soyabean saponins on azoxymethane-induced preneoplastic lesions in the colon of mice, Nutr and Cancer, 1997, 27, 206-209. Hasler,v Functional Foods: Their role in disease prevention and health promotion, Food Technology, 1998, 52, 63-70. Kennedy, AR. The Bowman-Birk inhibitor from soybeans as an anticarcinogenic agent, Am J Clin Nutr., 1998, 68, 1406S-1412S. Messina, M. Soy phytoestrogens (isoflavones), and breast cancer, Am J Clin Nutr., 1999, 70, 574-575. Munro, IC; Harwood, M; Hlywka, JJ; Stephen, AM; Doull, J; Flamm, WG; Adlercreutz, H. Soy isoflavones: A safety review, Nutr Rev., 2003, 61, 1-33. Thanh, VH; Shibasaki, K. Major proteins of soybean seeds: a straight forward fractionation and their characterization, J Agric Food Chem., 1976, 24, 1117-1121. Adachi, M; Takenaka, Y; Gidamis, AB; Mikami, B; Utsumi, S. Crystal structures of soybean proglycinin A1aB1b homotrimer, J Mol Biology, 2001, 305, 291-305. Maruyama, N; Adachi, M; Takahashi, K; Yagasaki, K; Kohna, M; Takenaks, Y; Okuda, E; Nakagawa, S; Mikami, B; Utsumi, S. Crystal structures of recombinant and native soybean β-conglycinin β homotrimers, Eur J Biochem, 2001, 268, 3595-3607. Adachi, M; Kanamori, J; Masuda, T; Yagasaki, K; Kitamura, K; Mikami, B. Crystal structure of soybean 11S globulin: glycinin A3B4 homohexamer, Proc Natl Acad Sci USA, 2003, 100, 7395-7400. Saio, K; Kamiya, M; Watanabe, T. Food processing characteristics of soybean 11S and 7S proteins, Part I. Effect of difference of protein components among soybean varieties on formation of tofu-gel, Agri. Biol. Chem., 1969, 33, 1304-1308. Fukushima, D. Structures of plant storage proteins and their functions, Food Rev. Int., 1991, 7, 353-381. Kinsella, JE. Functional properties of soy proteins. J. Am. Oil Chem. Soc., 1979, 56, 242-258. Luthria, DL; Diswas, R; Natarajan, SS. Comparison of extraction procedures and techniques for the assay of isoflavones from soybean. Food Chem., 2007, 105, 325333. Luthria, DL; Natarajan, SS. Influence of Sample Preparation on the Assay of Isoflavones. Planta Medica, 2009, 75, 704-710. Wilson Seed Composition. RF. In HR; Boerma, JE. Specht, (eds) Soybeans: Improvement, production and uses. 3rd ed. Agronomy.No. ASA, CSSA and SSAA, Madison, WI. 1-22 2004, 621-677. Barnes, S. Effect of genistein on in vitro and in vivo models of cancer. J Nutr., 1995, 125, 777S-783S. Sarkar, FH; Li, Y. Soy Isoflavones and cancer. Cancer Invest, 2003, 21, 744-757.

Soybean Nutrition: Protein and Isoflavones

469

[21] Goodman, MT; Wilkens, LR; Hankin, JH; Lyu, LC; Wu, AH; Kolonel, LN. Association of soy and fiber consumption with the risk of endometrial cancer. Am J Epidemiol, 1997, 146, 294-306. [22] Zheng, W; Dai, Q; Custer, LJ; Shu, X; Wen, W; Jin, F; Franke, A. Urinary excretion of isoflavonoids and risk of breast cancer. Cancer Epideniol Biomarkers Prev., 1999, 8, 35-40. [23] Anna, H; Tammy, MB; Helferich, WG; Doerge, DR; Ho, E. Differential effects of whole soy extract and soy isoflavones on apoptosis in prostate cancer cells. Exp. Biol., Med, 2010, 235, 90-97. [24] Butler, LM; Wu, AH; Wang, R; Koh, WP; Yuan, JM; Yu, MC. A vegetable fruit soy dietary pattern protects against breast cancer and postmenopausal singapore chinese women. Am J Clin Nutr., 2010, 91, 1013-1019. [25] Shimazu, T; Inuone, M; Sasazuki, S; Iwasaki, M; Sawade, N; Yamaji T; Tshugane, S. Isoflavone intake and risk of lung cancer: a prospective cohort study in Japan. Am J. Clin Nutr., 2010, 91, 722-728. [26] Shu, XO; Zheng, Y; Cai, H; Gu, K; Chen, Z; Zheng, W; Lu, W. Soy food intake and breast canc er survival. JAMA, 2009, 302, 2437-2443. [27] Hwang, YW; Kim, SY; H Jee S; Kim, YN; Nam, CM. Soy food consumption and risk of prostate cancer: Nutrition and cancer, 2009, 61, 598-606. [28] Byun, JS; S Lee, S. Effect os soybeans and sword beans on bone metabolism in a rat model of osteoporosis. Annal Nutr metabol, 2010, 56, 106-112 [29] Wong, WW; Lewis, RD; Steinberg, FM; Murray, MJ; Cramer, Amato, MA; Young, RL; Barnes, S; Ellis, KJ; Shypailo, RJ; Fraley, JK; Konzelmann, KL; Fischer, JG; Smith, EO. Soy Isoflavone supplementation and bone mineral density inmenopausal women: a 2 y multicenter clinical trial. Am J Clin Nutr., 2009, 90, 1433-1439. [30] Kenny, AM; Mangano, KM; Abourizk, RH; Bruno, RS; Anamani, DE; Kleppinger, A; Walsh, SJ; Prestwood, KM; Kerstetter, JE; Soy proteins and isoflavones affect bone minedral density in older women: a randomised controlled trial. Am J Clin Nutr., 2009, 90, 234-242. [31] Mathew, J; Mardon, J; Fokialakis, N; Puel, C; kati-Coulibaly, Mitakou, S; BennetauPelissero, S. Lamothe, CV; Davicco, MJ; Lebecque, P; Horcajada, MN; Coxam, V. Modulation of soy isoflavones bioavailability and subsequent effects on bone health in ovariectomized rats; the case for equol. Osteoporosis Int., 2007, 18, 671- 679.

In: Soybeans: Cultivation, Uses and Nutrition Editor: Jason E. Maxwell

ISBN: 978-1-61761-762-1 © 2011 Nova Science Publishers, Inc.

Chapter 22

NUTRITIONAL ENHANCEMENT OF SOYBEAN MEAL AND HULL VIA ENZYMATIC AND MICROBIAL BIOCONVERSION Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani* Department of Grain Science and Industry, Kansas State University, Kansas, USA

ABSTRACT Soybean meal (SBM) and soybean hull (SBH) are generated after recovery of soybean oil from soybean processing. The protein content of SBM can be as high as 53.5 to 56.2% moisture-free basis (mfb). Soybean meal also has a favorable amino acid composition compared with other plant proteins. Because of its high protein content, SBM is primarily used as a commercial animal feed product. Soybean hull contains about 85.7% carbohydrates, 9% protein, 4.3% ash, and 1% lipids and is used as a fiber supplement in animal feed. Despite the recognized value of SBM and SBH, these components have some inherent disadvantages. The dietary energy value of uncooked SBM is relatively low because of antinutrional factors such as proteinase inhibitors and phytate. Oligosaccharides in the carbohydrate fraction, particularly raffinose and stachyose, could lead to flatulence and abdominal discomfort. Further, the widespread availability of distiller grains due to increaseed ethanol production from corn and other cereal grains has saturated the high-protein animal feed market. Microbial bioprocessing of SBM and SBH, along with protein enhancement and removal of antinutritional factors, will result in an enhanced sulfur amino acid profile and additional nutrients, such as vitamin B12. This chapter focuses on SBM and SBH conversion to premium animal feed products and reviews the latest developments in nutritional enhancement via enzymatic and microbial bioconversion.

* Corresponding Author, Tel: +1-785-532-5012; Fax: +1-785-532-7193; e-mail: [email protected], Bioprocessing and Industrial Value-Added Program, Grain Science and Industry Department, Kansas State University, Manhattan, Kansas 66506

472

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

INTRODUCTION Soybeans are the second most planted field crop in the United States after corn: 77.5 million acres were planted in 2009, and the resulting SBM production reached 235,000 short tons. The farm value of U.S. soybean production in 2008-09 was $29.6 billion, the second highest value among U.S.-produced crops, trailing only corn. Soybean meal is the most valuable component obtained from processing soybeans, accounting for 50 to 75% of the value depending on relative prices of soybean oil and meal. And SBM is, by far, the world's most important protein feed, accounting for more than two thirds of world supplies [http://www.ers.usda.gov/Briefing/SoybeansOilCrops/]. According to the American Soybean Association, poultry use accounted for 48% of soybean use by livestock in 2008, followed by swine (26%), beef (12%), dairy (9%), pet food (2%), and others (3%). Soybean meal is used extensively for livestock feed because it contains high-quality protein with an amino acid composition complementary to corn protein. Furthermore, it is relatively inexpensive compared with other protein sources used for livestock. Soybean hull is usually mixed with SBM for feed. Although feeding SBM and SBH have some advantages, the detrimental factors that could have negative effects on livestock or the environment cannot be neglected. These factors include trypsin inhibitors, soybean allergy factors, environmental contamination from phosphorous over excretion, and oligosaccharides. Various methods have been implemented to eliminate these negative factors. Heating was effective for trypsin inhibitor and lectin inactivation; treatment at 121ºC for 15 min was sufficient to reduce more than 90% of these activities and provide protein solubility over 80% [Machado et al., 2008]. But heat has no effect on the other problems. Enzyme and fermentation treatment can remove certain anti-nutritional factors and enhance the nutritional value of SBM and SBH. The history of feed enzymes can be traced back to 1925, but significant use of enzymes began in the late 1980s after the practice was commercialized [Brufau et al., 2006]. The animal feed enzyme industry is currently worth $280 million/yr and is expected to be worth $375 million in 2012, a compound average annual growth rate of 6% [http://www.allaboutfeed.net/news/global-enzyme-market-to-hit-$2.7b-in-2012-id1367.html]. The acceptance of exogenous enzymes by pig and poultry producers over the last two decades has been a remarkable development. Fermented SBM and SBH have also been used to replace unfermented components in feed, and positive effects have been realized with livestock.

PROCESSES TO PRODUCE SOYBEAN MEAL AND HULL Soybean meal and hull are left over after oil extraction processing of soybeans (Figure 1). This extraction process uses one of two methods, solvent extraction or mechanical extraction (extruder/expeller). Solvent extraction is the most common procedure in the United States; it has an oil extraction efficiency of 99% and is capable of handling large volumes of soybeans [Bargale et al., 1999]. Mechanical extraction supplies a niche market because it has the potential to produce SBM that is free of any chemical residues; this procedure has an oil extraction efficiency of less than 70% [Bargale et al., 1999]. Grieshop [2003] analyzed SBM samples from nine commercial solvent extraction processing plants and one mechanical

Nutritional Enhancement of Soybean Meal and Hull …

473

extraction processing plant in the United States and found that residual fat content of SBM was as high as 7.0% from mechanical extraction but only 0.8 to 2.3% from solvent extraction. Grieshop [2003] also showed that SBM obtained from solvent extraction had higher crude protein content, amino acids content, and protein solubility than that from mechanical extraction. Wang [2001], however, showed that protein solubilities in potassium hydroxide were similar for mechanical and solvent extracted meal. The difference in these results might be due to different mechanical extraction processing conditions. Small changes in mechanical extraction heating conditions may result in a SBM that is more digestible when fed to pigs or poultry.

Figure 1. Overall scheme for processing soybeans into oil, flakes, and derived products (protein content based on dry basis)

474

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

In mechanical extraction processing, variables such as temperature and length of time in the extruder can have a substantial impact on the nutritional value of the resultant SBM. KarrLilienthal [2005b] found that increasing the length of time that soybeans spent in the extractor from 45 to 90 min resulted in lower phytate phosphorus and increased phosphorus bioavailability from 34% to 56%. However, this increase came at the expense of available lysine status; the SBM extracted for 90 min contained less total lysine and less digestible lysine than the SBM extracted for 45 min (traditional extraction time). Research has also shown substantial differences in amino acid composition and protein quality of SBM produced at different temperatures [Karr-Lilienthal et al., 2006]. Soybean meal extruded at 121 and 135 ºC was underprocessed as evidenced by high urease activity and lower amino acid digestibility. Soybean meal extruded at 150 and 160 ºC had higher amino acid digestibility and lower urease activity, which indicates adequate processing. Large variation exists in the nutritional quality of mechanically extracted SBM currently available in the marketplace. Optimal processing temperatures should be >135 ºC, and temperatures as high as 160 ºC do not result in overprocessing. Zhang et al. [1993] noted similar feed efficiency values when chicks were fed SBM extruded at 138 or 154 °C compared to solvent extraction SBM. Woodworth [2001] noted higher crude protein digestibilities for pigs fed diets containing mechanically extracted SBM with (86.2%) or without (85.4%) hulls than for pigs fed solvent extracted SBM without hulls (83.2%). In addition, pigs fed mechanically extracted SBM had higher digestibilities of arginine, isoleucine, leucine, lysine, phenylalanine, and valine than pigs fed solvent extracted SBM [Woodworth et al., 2001]. This indicates that there is potential for properly processed mechanically extracted SBM to be of equal or greater value in poultry diets than solvent extracted SBM. Differences in post extraction conditions also influence the quality of soybean meal from solvent extraction. Grieshop [2003] noted large differences in amino acid concentrations among SBM from soybeans that had similar amino acid concentrations. This indicates that differences in processing conditions post-extraction among plants had a significant effect on SBM amino acid composition and that this effect was greater than the effect of environmental conditions. Soybean processing plant post-extraction conditions should be defined and adjusted to optimize the nutritional value of the resultant SBM.

SOYBEAN MEAL AND HULL NUTRITION The protein content of SBM can be as high as 53.5 to 56.2% dwb [Grieshop et al., 2003], more than any other cereal and other legume species. Soybean meal is an excellent source of essential amino acids for swine. True ileal digestibility coefficients for most amino acids in SBM are higher than those of other plant protein sources. Soybean meal is a rich source of lysine, the first limiting amino acid in most cereal grains and, therefore, in most commercial livestock formulations. The high lysine content enables SBM to be a good complement to cereal grains, such as corn, wheat, barley, and grain sorghum. The lysine requirement of livestock is met without feeding large amounts of nonessential nitrogen, thereby reducing the nitrogen load on the environment. In addition, soybean meal is an excellent source of tryptophan, threonine, and isoleucine, which could provide sufficient levels of these limiting

Nutritional Enhancement of Soybean Meal and Hull …

475

amino acids in various cereal grain-based diets. The sulfur amino acids are relatively low in SBM with methionine as the only limiting amino acid. As a percentage of total protein, cereal grains are relatively high in sulfur amino acids; therefore, soybean meal is an excellent choice as a protein complement for cereal grain-based diets. Dry soybean hulls contain about 85.7% carbohydrates, 9% protein, 4.3% ash, and 1% lipids [Liu, 1997]. Soybean hull is usually blended with SBM to make a meal containing a minimum of 44% protein. Soybean hull carbohydrates are mainly composed of alphacellulose and hemicelluloses; because they are low in lignin, these carbohydrates are easily digested by ruminant animals. In fact, they are so highly digested that their digestible energy content is essentially equal to that of grains. In addition, when used in high forage diets, soybean hulls eliminate the risk of acidosis [Liu, 1997].

DISADVANTAGES FOR SOYBEAN MEAL AND HULL USED FOR FEEDS Despite the advantages of high protein content and balanced amino acids, soybeans also contain certain anti-nutritional components [Liu, 1997], including proteinase inhibitors, lectins, allergens, and phytate. Proteinase inhibitors constitute around 6% of soybean protein [Friedman et al., 2001]. Two protein proteinase inhibitors have been isolated from soybeans. The Kunitz trypsin inhibitor has a specificity directed primarily toward trypsin and a molecular weight of about 21.5 kDa. The Bowman-Birk (BB) inhibitor is capable of inhibiting both trypsin and chymotrypsin at independent active sites and has a molecular weight of 7.8 kDa [Hocine et al., 2007]. In addition to protein protease inhibitors, soybeans contain trace amounts of free fatty acids and their acyl CoA esters, which have been reported to inhibit trypsin. Trypsin and chymotrypsin, the two major proteolytic enzymes produced in the pancreas, belong to the serine protease class. Their inhibitors would influence the hydrolysis of soybean protein. Fortunately, the Kunitz trypsin inhibitor and Bowman-Birk (BB) inhibitor are thermally labile. Toasting or extrusion cooking after soybeans are defatted and processed into flakes can inactivate these two inhibitors. Non-protein trypsin inhibitors lack specificity and are very susceptible to cation suppression; therefore, their physiological significance is assumed to be negligible. Lectins are glycoproteins that possess at least one noncatalytic domain that binds reversibly to specific monosaccharide or oligosaccharide receptors on cells without altering the receptor covalent structure [Peumans et al., 1995]. When lectins are ingested by animals, they can survive intestinal digestion and bind to enterocytes on the brush border membrane in the gut. Upon binding, lectins may cause anti-nutritional effects such as disruption of the intestinal microvilli, shortening or blunting of villi, impairment of nutrient digestion and absorption, increased endogenous nitrogen loss, bacterial proliferation, and increased intestinal weight and size [Pusztai, 1993]. These effects culminate in reduced nutrient assimilation by animals. Growth performance of chicks fed lectin-free soybeans was greater than that of chicks fed raw conventional soybeans [Douglas et al., 1999]. Like the trypsin inhibitors, soybean lectin is readily denatured and its function destroyed by moist heat treatment; its inactivation closely parallels the inactivation of trypsin inhibitors in soybeans. Soybean lectin present at levels up to 0.024% of the diet did not cause antinutritional effect in

476

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

turkey poults up to 2 weeks of age, and the 0.048% soybean lectin levels gave inconsistent results for feed efficiency and brush border enzyme levels [Fasina et al., 2004]. Soybeans have been recognized by Food and Drug Administration as one of the ―big 8‖ food allergens. The two main types of storage proteins in soybeans are beta-conglycinin and glycinin. Together they account for 65 to 80% of the total seed protein [Liu, 1997], and they are potential diagnostic markers for severe allergic reactions to soybean [Holzhauser et al., 2009]. Sun [2008a] found that glycinin stimulated local and systemic immune responses in allergic piglets and had negative effects on piglet performance. The severity of the immune reactions depends on the dose of glycinin; higher doses cause more severe symptoms. Guo [2007] investigated the effects of purified beta-conglycinin on the growth and immune responses of rats and showed that purified beta-conglycinin possesses intrinsic immunestimulating capacity and can induce an allergic reaction. Phytate is the principle source of phosphorous in soybeans. Its content in soybean meal is around 3% as analyzed with the fourier transform infrared spectroscopy method [Isiguro et al., 2005]. Phosphorus in phytate form is, in general, not bioavailable to non-ruminant animals because they lack phytase, the digestive enzyme required to release phosphorus from the phytate molecule. Phytic acid could form protein-phytate or protein-phytate-protein complexes; these have more resistance to protein digestion by proteolytic enzymes; thus, utilization of dietary protein can be reduced. Also, phytic acid has a strong binding affinity to important minerals such as calcium, magnesium, iron, and zinc. When a mineral binds to phytic acid, it becomes insoluble, precipitates, and is not absorbable in the intestines. The unabsorbed phytate passes through the gastrointestinal tract, elevating the amount of phosphorus in the manure. Excess phosphorus excretion can lead to environmental problems such as eutrophication. With the pressure on the swine industry to reduce the environmental impact of pork production, it is important to use feed ingredients that can minimize this influence. Another issue with SBM and SBH is their carbohydrates, which include monosaccharides, oligosaccharides, storage polysaccharides, and non-storage polysaccharides. Soybean carbohydrates make up approximately 40% of SBM dry matter and 87% SBH dry matter [Karr-Lilienthal et al., 2005a]. Monosaccharides are nonstructural carbohydrates. The monosaccharides include galactose, glucose, fructose, and sucrose. The primary sugar is sucrose, which is present at concentrations ranging from 4.24% to 7.34% of SBM dry matter [Karr-Lilienthal et al., 2005a]. The primary oligosaccharides found in SBM are the galactooligosacchrides (GOS). The GOS found in the highest concentration in SBM is stachyose, followed by raffinose and verbascose. When processed into SBM, the GOS are not removed or destroyed. Therefore, in SBM, GOS generally represent approximately 4 to 6% of dry matter, but could be as high as 8% of dry matter. In SBM produced at 10 commercial processing plants in the United States, concentrations of stachyose, raffinose, and verbascose ranged from 41.0 to 57.2, 4.3 to 9.8, and 1.6 to 2.4 mg/g dry matter, respectively [Grieshop et al., 2003]. Only low concentrations of storage polysaccharides are present in SBM. The primary storage polysaccharide is starch, which generally comprises less than 1% of the soybean seed. Non-storage polysaccharides belong to the structural carbohydrate category and account for approximately half of the soybean carbohydrates [Karr-Lilienthal et al., 2005a]. The structural carbohydrates can be divided into cotyledon meal and hull polysaccharides. The primary cotyledon meal polysaccharides are arabinogalactans and an

Nutritional Enhancement of Soybean Meal and Hull …

477

acidic polysaccharide similar to pectin, whereas the hull contains 30% pectin, 50% hemicelluloses, and 20% cellulose [Karr-Lilienthal et al., 2005a]. Monosaccharides and starch are 100% digestible by non-ruminants. Oligosaccharides are considered indigestible in non-ruminants‘ small intestines because these animals lack alphagalactosidase, the enzyme responsible for cleaving the alpha-1, 6 linkages present in GOS. Galacto-oligosacchrides are digested to some extent in the small intestine (76 to 88% for stachyose, 31 to 65% for raffinose, and 32 to 55% for verbascose) [Karr-Lilienthal et al., 2005a] through fermentation by bacterial populations. Fermentation of GOS results in the production of carbon dioxide and hydrogen, potentially resulting in increased flatulence. Carbon dioxide and hydrogen can cause flatulence, nausea, and discomfort in swine [Krause et al., 1994]. Weanling pigs fed a GOS-free diet supplemented with 2% stachyose or fed a diet containing SBM had increased incidence of diarrhea compared with pigs fed a control diet [Zhang et al., 2003]. Additionally, fermentation of GOS has been implicated to have negative effects on nutrient digestibilities and energy availability of SBM. Persons [2000] found that roosters fed SBM with low oligosaccharide concentrations had higher total net metabolizable energy values (2931 kcal/kg DM) than those fed conventional SBM (2739 kcal/kg DM). Limited data are available on the fermentation of soybean structural polysaccharides and their potential effects on nutrient digestion. Gdala [1997] reported that the digestibilities of xylose, arabinose, and uronic acids in a cereal/SBM diet were 3.1 ± 3.5, 6.8 ± 2.6, and 2.7 ± 3.3 (expressed as percentage of intake), respectively, in the small intestine of 8- to 12-weekold piglets. The fiber in SBH is poorly fermented and may be of limited value to nonruminant animals. Additionally, soybean polysaccharides may have an impact on digestibilities of other nutrients in the diet. Ileal dry matter and gross energy digestibilities decreased linearly when pigs were fed a semi-purified diet containing SBM with 0, 3, 6, or 9% SBH added [Dilger et al., 2004]. This result is due to the complex structure of soybean polysaccharides, which prevents the enzyme from functioning on nutrients such as protein. Breaking down the polysaccharides would not only improve SBM nutritional significance as an energy source but also increase the possibility for endo-enzymes to work more efficiently.

ENZYME BIOCONVERSION OF CARBOHYDRATES IN SOYBEAN MEAL AND HULL The main focus of enzyme applications was the inclusion of nonstarch polysaccharidedegrading enzymes and phytase. Owing to the impact of anti-nutritional components and indigestible carbohydrates present in SBM and SBH, enzyme addition has greatly enhanced the nutritional value of SBM and SBH diets. Today, phytase is probably the enzyme most familiar to monogastric nutritionists. The current pressure to reduce environmental phosphorus pollution in both Europe and the United States has created a market opportunity for exogenous phytases. Consequently, phytase enzyme preparations have became important feed additives with a wide range of applications in swine and poultry production. Phytase hydrolyzes phytic acid to inositol and phosphate anions, thereby eliminating the metal-chelating properties of phytic acid. For a thorough review of the benefits of phytase,

478

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

see Singh [2008]. Adding microbial phytase to plant-derived feed ingredients fed to poultry improved growth performance, feed intake, and feed efficiency [Singh et al., 2002; Ravindran et al., 2000] and retention of phosphorus, calcium, zinc, and copper [Hill et al., 2009; Chu et al., 2009]. Schlegel [2010] confirmed that phytase was efficient in increasing digestive soluble zinc and improving zinc status in piglets. Akinmusire [2009] concluded that phytase supplementation improved apparent total tract P digestibility for SBM; digestibility values ranged from 34.3 to 38.6% without phytase and from 68 to 71% with supplemental phytase. The true P digestibility estimates were 40.9% for soybean meal without phytase and 70.8% for SBM with added phytase. With the addition of phytase, there is no need to add inorganic phosphorous, which should reduce overall feed formulation cost. This is discussed later in this chapter. Insoluble protein-phytate complexes are formed at low pH, the condition found in the stomach of monogastric animals. Pepsin degrades protein from such complexes slower than it degrades soluble protein, which may slightly reduce protein digestibility. Dietary phytase supplementation prevents the formation of protein-phytate complexes or aids in dissolving them faster. Therefore, phytase may improve protein digestibility [Kies et al., 2006]. Phytase supplementation can also increase the apparent metabolizable energy and ileal digestibility of protein and amino acids [Liu, N., et al, 2007], although there are controversial results on this subject due to the assay methods used [Nitrayová et al., 2009]. Higher retention of nutrients ultimately reduces environmental pollution [Singh et al., 2002; Hill et al., 2009; Chu et al., 2009]. Environmental P pollution is a major concern and is being increasingly incorporated into legislation designed to curb losses of P in effluent from pig and poultry production units. Jendza [2009] found that adding phytase at 1000 units/kg to a corn-soybean meal-based P-deficient diet basal diet containing no added inorganic P reduced the daily excretion of water-soluble P in starter, grower, and finisher pigs by 42, 34, and 30%, respectively, compared with a basal diet with added dicalcium phosphate. Addition of phytase could reduce the overall formulated feed cost. Phosphorus is an expensive item in poultry feed, and global P reserves are not renewable. Replacement of inorganic sources of phosphorus by phytase enzymes for better feed efficiency lead to more economic poultry production. Vinil [2000] reported that addition of phytase at 25 g/100 kg in corn-soybean-wheat bran-based diets without dicalcium phosphate reduced the feed cost in the order of one Indian rupee ($ 0.02) per kg, which subsequently resulted in the production of broiler meat at lower cost. An increase of 9.47% in net income was reported when dicalcium phosphate from broiler diets was replaced with phytase at 300 g/ton of feed [Kundu et al., 2000]. Various kinds of carbohydrase have been used to solve problems caused by carbohydrates. Xylanase, glucanase, cellulase, hemicellulase, pectinase, galactanase, mannanse, and polygalacturonase have all been tried. Both positive and negative results have been obtained and published in the literature. Vahjen [2005] concluded that methylation of soybean carbohydrates to a high degree hindered the degree of breakdown by polygalacturonase. Galactanase had the ability to hydrolyze soy polysaccharides, but its residual activity in the intestine was poor. In vivo experiments showed that addition of multiple enzymes (galactanase and mannanse) did not enhance the body weight gain of broiler chickens and that enzyme activity decreased gradually from stomach to caecum. Saleh [2003] conducted an in vitro experiment and found that cellulase, xylanase, glucanase, and hemicellulase tended to improve crude protein digestibility, with hemicellulase having the

Nutritional Enhancement of Soybean Meal and Hull …

479

most significant effect. Cowieson [2010] found that xylanase and glucanase could improve the feed conversion ratio and ileal nutrient digestibility. The combination of the two enzymes resulted in greater benefits than either enzyme alone. Pectinase significantly improved dry matter digestibility. The combination of cellulase, pectinase, xylanase, glucanase, hemicellulase, and phytase could improve the dry matter digestibility, but this has not been confirmed in an in vivo experiment. The complex structure of soybean polysaccharides increases the difficulty of finding promising enzymes with in vivo stability. To date, the proper enzyme system has yet to be developed. Carbohydrases can also be combined with other enzyme activities, such as phytase and protease, in feed trials. Xylanase, amylase, protease, and phytase were used successfully in a strategically formulated, low nutrient density diet to achieve performance equal to that of a nutritionally adequate diet fed to birds. This result suggests the possibility of a nutritionally and economically viable alternative for feed cost reduction [Cowieson et al., 2006]. Starch and protein are physically encapsulated in cells or, more generally, associated with a fiber matrix, and would normally escape digestion. Addition of suitable exogenous enzymes would increase the nutrient efficiency and may reduce feed costs.

FERMENTATION TO ENHANCE THE VALUE OF SOYBEAN MEAL AND HULL Aspergillus has the ability to produce enzymes such as hemicelluloses, hydrolases, pectinases, lipases, and tannases. Thus, it has been used extensively to improve agricultural by-products through its action on substrates such as nonstarch polysaccharides and proteins. Bacillus fermentation is characterized by extensive hydrolysis of protein to amino acids and peptides. The two kinds of microorganisms are commonly used for SBM fermentation for feed usage, and fermented SBM has shown various advantages compared with unfermented SBM. Fermentation has been shown to increase the protein content of SBM [Chen et al., 2010, Hong et al., 2004]. The increase may be due to carbohydrate being used for microbial growth during fermentation. Research in our lab confirmed the increase in protein content (Tables 1 and 2). The large molecular weight protein fractions (such as glycinin and beta-conglycinin) could lead to hypersensitivity. Degradation of these fractions could remove the allergenic compounds in the gut. Also, newly weaned pigs with limited stomach acid and enzymatic secretions in the small intestine can have difficulty digesting proteins with complex structures and large molecular weights [Kim, 2010]. Fermentation could decrease protein peptide size, increase the small protein fractions, and enhance protein digestibility [Chen et al., 2010; Hong et al., 2004; Feng et al., 2006]. Usually peptides having 10 or fewer amino acids will dissolve in Trichloroacetic acid (TCA) [Low, 1980]. Chen [2010] showed that after two-stage fermentation with Aspergillus and Bacillus, TCA-soluble protein content was significantly higher than that for unfermented SBM. Trypsin inhibitor adversely affects protein digestion in animals. Hong [2004] mentioned that diets with a trypsin inhibitor concentration of 0.77 mg/g and less did not reduce the growth of pigs. And, his research showed that after fermentation with Aspergillus oryzae GB107, the trypsin inhibitor activity in SBM was reduced from 2.70 mg/g to 0.42 mg/g. In the in

480

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

vivo experiment of Feng [2006], the activities of total protease and trypsin at the duodenum and jejunum of piglets fed with fermented SBM increased because of the inactivation of trypsin inhibitor. Table 1. Fermentation of soybean meal and hull using Bacillus spp. microbial culture Sample

Crude Protein % Protein Increase % 46.88 —

Crude Fiber % Ash % 4.19 7.46

10.6

Soybean Hull Control***

57.48 12.06

—

4.43 50.8

8.36 6.21

Soybean Hull****

18.49

6.43

32.46

6.67

Soybean Meal Control* Soybean Meal**

* 15 g soy meal + 4.8 g ammonium sulphate + 0.3 g potassium phosphate in 100 ml H2O, pH 6.5 ** soy meal after 48 hours of fermentation using Bacillus spp. innoculum *** 15 g soy hull + 4.8 g ammonium sulphate + 0.3 g potassium phosphate in 100 ml H2O, pH 6.5 **** soy hull after 48 hours of fermentation using Bacillus spp. innoculum

Table 2. Fermentation of soybean meal and hull using Aspergillus oryzae microbial culture Sample Soybean Meal Control* Soybean Meal** Soybean Hull Control*** Soybean Hull****

Crude Protein % 45.81 55.74 12.06 17.31

Protein Increase % — 9.93 — 5.25

Crude Fiber % 3.74 5.28 32.97 29.12

Ash % 7.36 8.29 6.16 6.46

* 15 g soy meal + 4.8 g ammonium sulphate + 0.3 g potassium phosphate in 100 ml H2O, pH 6.5 ** soy meal after 96 hours of fermentation using Aspergillus oryzae innoculum *** 15 g soy hull + 4.8 g ammonium sulphate + 0.3 g potassium phosphate in 100 ml H2O, pH 6.5 **** soy hull after 96 hours of fermentation using Aspergillus oryzae innoculum

Also, Aspergillus produces alpha-galactosidase, which could degrade oligosaccharides in SBM and SBH. Results in our lab demonstrated that fermentation with Aspergillus oryzae or Bacillus spp. could obviously decrease oligosaccharides content. This is in agreement with the results of Chen [2010]. Because the phosphorous in soybean is in the form of phytate phosphorous, which is hard to digest, fermentation could increase inorganic phosphorous content in SBM [Feng et al., 2007b]. In vitro experiments showed that after fermentation, protein content and digestibility could be increased and nutritional inhibitors could be eliminated. The in vivo experiment confirmed the results by showing that feeding piglets fermented SBM significantly increased average daily gain and average daily feed intake and improved feed conversion efficiency compared with feeding piglets unfermented SBM [Feng et al., 2007b; Min et al., 2009]. With regard to the soybean allergy, Liu, X. [2007] showed that fermentation of SBM decreased the immune response to soybean protein in piglets; the level of serum IgG decreased 27.2%. Antigenic soybean proteins in the diet of early weaned pigs provoke a transient hypersensitivity associated with morphological changes including villi atrophy and crypt hyperplasia in the small intestine [Dreau et al., 1999]. All of these morphological changes can

Nutritional Enhancement of Soybean Meal and Hull …

481

cause a malabsorption syndrome [Gu et al., 2004; Sun et al., 2008a], growth depression, and diarrhea [Dreau et al., 1994; Sun et al., 2008b]. Feng [2007a] investigated differences of the villi condition in pigs fed SBM and fermented SBM by using scanning electron microscopy and found that piglets fed SBM had shorter, disordered, and broader villi, whereas piglets fed fermented SBM had long, round, regular, and tapering villi that could better digest and absorb nutrients. Lack of inorganic phosphorous inhibits poultry growth. Thus, inorganic phosphorous is commonly supplied to SBM-based diets. But supplementation with inorganic phosphorus increases animal feed costs. Fermentation of SBM increased phosphorus availability [Kim, et al., 2009; Matsui et al., 1996] and zinc availability [Hirabayashi et al., 1998a] and reduced phosphorus excretion without affecting growth of chicks. Using fermented SBM as substitute for regular SBM saved 0.2% of dietary inorganic phosphorous [Hirabayashi et al., 1998b]. In the poultry industry, supplementation of probiotics has recently attracted interest from the point of poultry health. Antibiotics are widely used to prevent poultry pathogens and disease so as to improve meat and egg production. Overuse of antibiotics is a concern for human health. It is necessary to develop alternative practices that use beneficial microorganisms to replace routine feeding of antibiotics. Fermented feed contains live microbes that function as a probiotic supplement that beneficially affects the host animal by improving its intestinal microbial balance [Song et al., 2010] and is recommended as an effective alternative to antibiotics. Xia [2010] showed that replacing 30% of the SBM with fermented protein feed in basal diets significantly decreased the number of Escherichia. coli and diarrhea rate of broiler chickens without detrimentally affecting growth and nutrient digestibility while decreasing feed cost. Research has also shown other benefits of supplementation. Natto (a fermented soybean food in Japan) components such as isoflavones act as female hormones with estrogen-like functions and could decrease meat cholesterol levels in female broilers [Fujiwara et al., 2008]. Kishida [2006] reported that dietary isoflavone-rich fermented soybean extracts decreased serum cholesterol concentrations in female rats.

CONCLUSION Soybean meal and hull are widely used in livestock feed because of their high protein content and balanced amino acids. However, anti-nutritional factors such as phytic acid, trypsin inhibitors, oligosaccharides, soybean allergens, and the encapsulation effect of carbohydrates decrease the nutritional value of SBM and SBH. Enzyme addition and fermentation could solve many of these problems. Carbohydrase and phytase have already been commercialized, and their use has increased dramatically in recent years. Microorganisms that have a certain enzyme production capacity could greatly enhance the nutritional contribution from SBM and SBH, as well as work as a probiotic addition to enhance the health condition of livestock. Also, soybean meal and hull have become increasingly popular in aquaculture, and future research efforts could focus on enhancing the nutritional value of SBM and SBH via enzymatic and fermentation methods to meet needs of this area.

482

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

ACKNOWLEDGMENTS The authors are grateful to the Kansas Soybean Commission and the Kansas State University Department of Grain Science and Industry for funding this project. This book chapter is contribution no. 11-005-B from the Kansas Agricultural Experiment Station, Manhattan, KS 66506.

REFERENCES Akinmusire A. S., & Adeola, O. (2009). True digestibility of phosphorus in canola and soybean meals for growing pigs: influence of microbial phytase. Journal of Animal Science, 87, 977-983. Bargale, P. C., Ford, R. J., Sosulski, F. W., Wulsohn, D. et al. (1999). Mechanical oil expression from extruded soybean samples. Journal of the American Oil Chemists’ Society, 76, 223-229. Brufau, J., Francesch, M., & P´ erez-Vendrell, A. M. (2006). The use of enzymes to improve cereal diets for animal feeding. Journal of the Science of Food and Agriculture, 86, 17051713. Chen, C. C., Shih, Y. C., Chiou, P. W. S., et al. (2010). Evaluating nutritional quality of single stage-and two stage-fermented soybean meal. Asian-Australasian Journal of Animal Science, 23(5), 598-606. Chu, G. M., Komori, M., Hattori, R., et al. (2009). Dietary phytase increases the true absorption and endogenous fecal excretion of zinc in growing pigs given a corn-soybean meal based diet. Animal Science Journal, 80, 46-51. Cowieson, A. J., Bedford, M. R., & Ravindran, V. (2010). Interactions between xylanase and glucanase in maize-soy-based diets for broilers. British Poultry Science, 51(2), 246-257. Cowieson, A. J., Singh, D. N., & Adeola, O. (2006). Prediction of ingredient quality and the effect of a combination of xylanase, amylase, protease and phytase in the diets of broiler chicks. 1. Growth performance and digestible nutrient intake. British Poultry Science, 47(4), 477-489. Dilger, R. N., Ssands, J. S., Ragland, D. et al. (2004). Digestibility of nitrogen and amino acids in soybean meal with added soyhulls. Journal of Animal Science, 82, 715-724. Douglas, M. W., Parsons C. M., & Hymowitz, T. (1999). Nutritional evaluation of lectin-free soybeans for poultry. Poultry Science, 78, 91-95. Dreau, D., & Lalles, J. P., (1999). Contribution to the study of gut hypersensitivity reactions to soybean proteins in preruminant calves and early-weaned piglets. Livestock Production Science, 60, 209–218. Dreau, D., Lalles, J. P., Philouzerome, V. et al. (1994). Local and systemic immune-responses to soybean protein ingestion in early-weaned pigs. Journal of Aanimal Science, 72, 2090– 2098. Fasina Y. O., Garlich J. D., Classen H. L. et al. (2004). Response of turkey poults to soybean lectin levels typically encountered in commercial diets. 1. Effect on growth and nutrient digestibility. Poultry Science, 83, 1559-1571.

Nutritional Enhancement of Soybean Meal and Hull …

483

Feng, J., Liu, X., Xu, Z. R., et al. (2006). The effect of Aspergillus oryzae fermented soybean meal on growth performance, digestibility of dietary components and activities of intestinal enzymes in weaned piglets. Animal Feed Science and Technology, 134, 295303. Feng, J., Liu, X., Xu, Z. R., et al. (2007a). Effect of fermented soybean meal on intestinal morphology and digestive enzyme activities in weaned piglets. Digestive Diseases and Sciences, 52, 1845-1850. Feng, J., Liu, X., Xu, Z. R., et al. (2007b). Effects of Aspergillus oryzae 3.402 fermented soybean meal on growth performance and plasma biochemical parameters in broilers. Animal Feed Science and Technology, 134, 235-242. Friedman, M., & Brandon, D. L. (2001). Nutritional and health benefits of soy proteins. Journal of Agricultural and Food Chemistry, 49 (3), 1069-1086. Fujiwara, K., Miyaguchi, Y., Feng, X. H., et al. (2008). Effect of fermented soybean, ―Natto‖ on the production and qualities of chicken meat. Asian-Australasian Journal of Animal Science, 21 (12), 1766-1772. Gdala, J. J., Johanse, H. N., Bach-Knudsen, K. E. et al. (1997). The digestibility of carbohydrates, protein and fat in the small and large intestine of piglets fed nonsupplemented and enzyme supplemented diets. Animal Feed Science and Technology, 65, 15-33. Grieshop, C. M., Kadzere, C. T., Clapper, G. M. et al. (2003). Chemical and nutritional characteristics of United States soybeans and soybean meals. Journal of Agricultural and Food Chemistry, 51, 7684-7691. Guo, P., Piao, X., Ou, D. et al. (2007). Characterization of the antigenic specificity of soybean protein b-conglycinin and its effects on growth and immune function in rats. Archives of Animal Nutrition, 61 (3), 189 – 200. Gu, X., & Li, D., (2004). Effect of dietary crude protein level on villous morphology, immune status and histochemistry parameters of digestive tract in weaning piglets. Animal Feed Science and Technology, 114, 113–126. Hirabayashi M., Matsui T. & Yano H. (1998a). Fermentation of soybean meal with Aspergillus usamii improves zinc availability in rats. Biological Trace Element Research, 61 (2), 227-234. Hirabayashi, M., Matsui, T., Yano, H. et al. (1998b). Fermentation of soybean meal with Aspergillus usamii reduces phosphorus excretion in chicks. Poultry Science, 77, 552-556. Hill, B. E., Sutton, A. L., & Richert, B. T. (2009). Effects of low-phytic acid corn, low-phytic acid soybean meal, and phytase on nutrient digestibility and excretion in growing pigs. Journal of Animal Science, 87, 1518-1527. Hocine, L. L., & Boye, J. I. (2007). Allergenicity of soybean: new developments in identification of allergenic proteins, cross-reactivities and hypoallergenization technologies. Critical Reviews in Food Science and Nutrition, 47, 127-143. Hong, K. J., Lee, C. H., & Kim, S. W. (2004). Aspergillus oryzae GB-107 Fermentation Improves Nutritional Quality of Food Soybeans and Feed Soybean Meals. Journal of Medical Food, 7 (4), 430-435. Holzhauser, T., Wackermann, O., Ballmer-Weber, B. K. et al. (2009). Soybean (Glycine max) allergy in Europe: Gly m5 (Beta-conglycinin) and Gly m6 (glycinin) are potential diagnostic markers for severe allergic reactions to soy. Journal of Allergy and Clinical Immunology, 123, 452-458.

484

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

Isiguro, T., Ono, T., Nakasato, K. et al. (2005). Rapid Measurement of Phytate in Soy Products by Mid-infrared Spectroscopy. Journal of food science, 70 (1), 63-66. Jendza J.A., & Adeola, O. (2009). Water-soluble phosphorus excretion in pigs fed diets supplemented with microbial phytase. Animal Science Journal, 80, 296-304. Karr-Lilienthal, L. K., Bauer, L. L., Utterback, P. L. et al. 2006. Chemical composition and nutritional quality of soybean meals prepared by extruder/expeller processing for use in poultry diets. Journal of Agricultural and Food Chemistry, 54, 8108-8114. Karr-Lilienthal L. K., Kadzere C. T., Grieshop C. M. et al. (2005a). Chemical and nutritional properties of soybean carbohydrates as related to nonruminants: a review. Livestock Production Science, 97, 1-12. Karr-Lilienthal, L. K., Utterback, P. L., Martinez, C. et al. (2005b). Relative bioavailability of phosphorus and true amino acid digestibility by poultry as affected by soybean extraction time and use of low-phytate soybeans. Poultry Science, 84, 1555-1561. Kies, A. K., Jonege, L. H. D., & Kemme, P. A., et al. (2006). Interaction between protein, phytate, and microbial phytase. In vitro studies. Journal of Agricultural and Food Chemistry, 54, 1753-1758. Kim, S. W. (2010). Bio-fermentation technology to improve efficiency of swine nutrition. Asian-Australasian Journal of Animal Science, 23 (6), 825-832. Kim, S. S., Galaz, G. B., Pham M. A. et al. (2009). Effects of dietary supplementation of a meju, fermented soybean meal, and Aspergillus oryzae for Juvenile Parrot Fish (Oplegnathus fasciatus). Asian-Australasian Journal of Animal Science, 22 (6), 849-856. Kishida, T., Mizushige, T., Nagamoto, M. et al. (2006). Lowering effect of an isoflavone-rich fermented soybean extract on the serum cholesterol concentrations in female rats, with or without ovariectomy, but not in male rats. Bioscience, Biotechnology, and Biochemistry, 70, 1547-1556. Krause, D. O., Easter, R. A., Mackie, R. I. (1994). Fermentation of stachyose and raffinose by hindgut bacteria of the weanling pig. Letters in Applied Microbiology, 18, 349-352. Kundu, B., Biswas, P., Rajendran, D. et al. (2000). Effect of supplementation of phytase enzyme and gradual replacement of dicalcium phosphate on the performance of commercial broker chicken. In: Proceedings of III Biennial conference of Animal Nutrition Association, Hisar, India. Abst. No.128. Liu K. (1997). Soybeans: Chemistry, technology, and utilization (first edition). Newyork: International Thomson. Liu, N., Liu, G. H., Li, F. D. et al. (2007). Efficacy of Phytases on Egg Production and Nutrient Digestibility in Layers Fed Reduced Phosphorus Diets, 86, 2337-2342. Liu, X., Feng, J., Xu, Z. et al. (2007). The effects of fermented soybean meal on growth performance and immune characteristics in weaned piglets. Turkish Journal of Veterinary and Animal Sciences, 31 (5), 341-345. Low, A. G. (1980). Nutrient absorption in pigs. Journal of the Science of Food and Agriculture, 31, 1087-1130. Machado F. P. P., Queiroz J. H., Oliveira M. G. A. et al. (2008). Effects of heating on protein quality of soybean flour devoid of Kunitz inhibitor and lectin. Food Chemistry, 107, 649655. Matsui T., Hirabayashi M., Iwama Y. et al. (1996). Fermentation of soya-bean meal with Aspergillus usami improves phosphorus availability in chicks. Animal feed science and technology, 60 (1-2), 131-136.

Nutritional Enhancement of Soybean Meal and Hull …

485

Min, B. J., Cho, J. H., Chen, Y. J. et al. (2009). Effects of fermented soy protein on growth performance and blood protein contents in nursery pigs. Asian-Australasian Journal of Animal Science, 22 (7), 1038-1042. Nitrayová, S., Patráš, P., Brestenský, M. et al. (2009). Effect of microbial phytase and diet fermentation on ileal and total tract digestibility of nutrients and energy in growing pigs. Czech Journal of Animal Science, 4, 163–174. Parsons, C. M., Yhang, Y., & Araba, M., 2000. Nutritional evaluation of soybean meals varying in oligosaccharides content. Poultry Science, 79, 1127-1131. Peumans, W. J., & Van Damme, E. J. M. (1995). Lectins as plant defense proteins. Plant Physiology, 109, 347–352. Pusztai, A. (1993). Dietary lectins are metabolic signals for the gut and modulate immune and hormone functions. European Journal of Clinical Nutrition, 47, 691–699. Ravindran, V., Carbahug, S., Ravindran, G. et al. (2000). Response of broiler chickens to microbial phytase supplementation as influenced by dietary phytic acid and non-phytate phosphorous levels. II. Effects on apparent metabolisable energy, nutrient digestibility and nutrient retention. British Poultry Science, 41, 193-200. Saleh, F., Ohtsuka, A., Tanaka, T. et al. (2003). Effect of enzymes of microbial origin on in vitro digestibilities of dry matter and crude protein in soybean meal. Animal Science Journal, 74, 23-29. Schlegel, P., Nys, Y., & Jondreville, C. (2010). Zinc availability and digestive zinc solubility in piglets and broilers fed diets varying in their phytate contents, phytase activity and supplemented zinc source. Animal, 4(2), 200-209. Song, Y. S., Perez, V. G., Pettigrew, J. E. et al. (2010). Fermentation of soybean meal and its inclusion in diets for newly weaned pigs reduced diarrhea and measures of immunoreactivity in the plasma. Animal Feed Science and Technology. Sun, P., Li, D. F., Dong, B. et al. (2008a). Effects of soybean glycinin on performance and immune function in early weaned pigs. Archives of Animal Nutrition, 62, 313–321. Sun, P., Li, D. F., Li, Z. J. et al. (2008b). Effects of glycinin on IgE-mediated increase of mast cell numbers and histamine release in the small intestine. The Journal of Nutritional Biochemistry, 19, 627–633. Singh, P. K. (2008). Significance of phytic acid and supplemental phytase in chicken nutrition: a review. World’s Poultry Science Journal, 64, 553-580. Singh, P. K., & Khatta, V. K. (2002). Phytase supplementation for economic and eco-friendly broiler production. Journal of Eco- Physiolog, 5 (3/4), 117-121. Vahjen W., Busch T., Simon O. (2005). Study on the use of soya been polysaccharide degrading enzymes in broiler nutrition. Animal Feed Science and Technology, 120, 259276. Vinil, S. P., Kadirvelan, C., Thirumalai, S. et al. (2000).The role of phytase and other enzymes in augmenting the bioavailability of nutrients in broilers. Proceedings of XX Annual conference of Indian Poultry Science Association, Chennai, India. Abst. No. PPN. 97. Wang T., & Johnson, L. A. (2001). Survey of soybean oil and meal qualities produced by different process. Journal of The American Oil Chemists’ Society, 78 (3), 311-318. Woodworth, J. C., Tokach, M. D., Goodband, R. D. et al. (2001). Apparent ileal digestibility of amino acids and the digestible and metabolizable energy content of dry extruded-

486

Liyan Chen, Yixing Zhang, Ronald L. Madl and Praveen V. Vadlani

expelled soybean meal and its effects on growth performance of pigs. Journal of Animal Science, 79, 1280-1287. Xia, S., Wang, C., Yan, X. et al. (2010). Effects of substitution of fermented protein feed for soybean meal on performance, nutrient digestibility and intestinal microflora of broiler chickens. Chinese Journal of Animal Nutrition, 22 (2), 352-357. Zhang, Y., Parsons, C. M., Weingartner, K. E. et al. (1993). Effects of extrusion and expelling on the nutritional quality of concentional and Kunitz trypsin inhibitor-free soybeans. Poultry Science, 72, 2299-2308. Zhang, L. Y., Li D. F., Qiao, S. Y. et al. (2003). Effects of stachyose on performance, diarrhoea incidence and intestinal bacteria in weanling pigs. Archives of Animal Nutrition, 57, 1-10.

INDEX A abatement, 69 absorption spectra, 183 abstraction, 198 accelerator, 293 accessibility, 194, 463 acclimatization, 131, 199 accounting, 81, 474 acetaminophen, 459 acetic acid, 288, 323, 324, 325, 337, 338, 360, 396, 397, 398, 424 acetone, 163, 195, 321, 322, 331, 357, 358, 359 acetonitrile, 163, 195, 335, 337, 361, 362 acetylation, 232, 243, 244 acidity, 86, 358, 458 acidosis, 477 active oxygen, 92, 102, 285, 455 active site, 191, 192, 193, 194, 195, 198, 199, 202, 207, 208, 229, 231, 457, 459, 460, 477 active transport, 235 activity level, 180, 237 acute lung injury, 386 acylation, 325 adaptability, 17, 123 adaptation, 6, 306, 351 additives, xiii, 159, 161, 163, 164, 181, 184, 189, 208, 214, 218, 220, 221 adenine, 391 adenocarcinoma, 227, 381 adhesion, 232, 376, 382, 468 adhesives, xiii, 162, 189, 274 adiponectin, 377, 381 adipose, 132, 381, 384 adipose tissue, 381, 384 adjustment, 51, 204 ADP, 343, 454

adsorption, xii, xvi, 155, 160, 170, 208, 209, 309, 310, 317, 320, 331 aerobic bacteria, 151 aflatoxin, 61 agar, 21, 151, 337, 339, 420 aggressiveness, 452 aging process, 58, 369 agonist, 226 agriculture, 31, 50, 263, 274, 297, 430 AIDS, 400 air emissions, 201 alanine, xix, 131, 412, 429 albumin, 54, 384, 408 aldehydes, 310, 311, 320 alfalfa, 149 alkaline hydrolysis, 136 alkylation, 325 allele, 27, 28, 40, 41 allergens, xvii, 61, 71, 116, 133, 136, 141, 143, 148, 353, 355, 364, 365, 369, 477, 478, 483 allergic reaction, 11, 478, 485 allergy, 474, 482, 485 alpha-fetoprotein, 149 alpha-tocopherol, 377 ALS, 27 alternative feed ingredients, xi, 125, 126, 127, 152 alternative treatments, 179, 216 alters, 12 American Heart Association, 56 amines, xii, 155, 156, 158, 160, 161, 175, 176, 177, 178, 181, 185, 197, 198, 199, 458 ammonia, 234, 277, 399, 441, 449, 451 ammonium, 196, 335, 337, 356, 357, 359, 360, 361, 482 amplitude, 277, 281 amylase, 99, 334, 354, 366, 481, 484 androgen, 244 anemia, 54, 80, 201

488

Index

angiogenesis, 225, 231, 247, 249, 379 angiosperm, 357 angiotensin converting enzyme, 406, 413, 414 angiotensin II, 119, 404 aniline, 175, 176, 186, 204, 206, 209, 215 ANOVA, 278, 280, 282, 361, 407, 412 anoxia, 365 antagonism, 260 anti-apoptotic role, 245 antibiotic, xvi, 294, 333, 334, 344, 349 antibody, 142, 232 anti-cancer, 46, 47, 247 anticancer activity, 224 anticancer drug, 329 antigen, 47, 141, 149, 391, 392, 397, 399, 401, 402, 419 antigenicity, 141, 366 antihypertensive drugs, 414 antioxidant, xiii, xviii, 47, 48, 76, 136, 223, 224, 225, 229, 236, 237, 243, 248, 282, 283, 285, 286, 287, 289, 290, 311, 377, 378, 379, 384, 403, 404, 405, 414 antitumor, 72, 231, 233, 234 apex, 275 apoptosis, 132, 144, 225, 231, 232, 241, 245, 246, 247, 248, 379, 381, 386, 471 aquaculture, xi, xii, 125, 126, 127, 483 aquatic life, xiii, 189, 202 aqueous solutions, 179, 180, 181, 216, 217, 218 Arabidopsis thaliana, 13, 34, 37, 286, 288, 366 Argentina, 3, 32, 78, 80, 81, 273, 274, 292 arginine, xiii, 69, 192, 193, 198, 203, 223, 224, 234, 235, 236, 246, 392, 412, 451, 476 aromatic amines, xii, 155, 156, 158, 160, 161, 175, 177, 178, 181, 185, 197, 198, 199 aromatic compounds, 157, 161, 162, 169, 175, 182, 184, 187, 199, 201, 214, 218, 374 aromatic hydrocarbons, 157, 158, 201, 327 aromatic rings, 157 aromatics, xii, 155, 156, 213, 221 arrest, 230, 231, 232, 246, 248, 386 arteriosclerosis, 404 asbestos, 287 ascites, 246 ascorbic acid, 288, 322, 359 Asia, ix, 11, 43, 44, 62, 80, 236, 388, 430 Asian countries, ix, 43, 55, 94, 224, 226, 469 Asian culture, ix, 43 aspartate, 238 Aspergillus orzae, x, 44 assessment, xvii, 36, 71, 178, 293, 373 assimilation, xi, xiv, 12, 23, 125, 273, 274, 477 atherosclerosis, 92, 116, 117, 377

atmosphere, 452, 455 atoms, xv, 157, 191, 273, 275, 280, 326 atopic dermatitis, 369 ATP, 276, 343, 463 atrophy, 482 autooxidation, 45

B bacillus, 84, 338 Bacillus natto, x, 44, 111, 112, 113, 114, 116, 399, 430 Bacillus subtilis, xvi, 111, 333, 348, 349, 350, 351, 352 backcross, 3, 301 bacteria, xi, xvii, 21, 47, 61, 79, 80, 81, 84, 88, 90, 95, 99, 111, 135, 138, 139, 150, 179, 231, 253, 260, 261, 269, 271, 275, 296, 303, 334, 338, 346, 349, 350, 389, 391, 392, 451, 462, 486, 488 bacterial strains, 139 bacteriophage, 402 bacterium, xvii, xix, 293, 296, 297, 335, 344, 389, 391, 392, 417 balance sheet, 80 barriers, 3 base catalysis, 198, 202 basic research, 69 beef, 50, 52, 53, 59, 71, 78, 80, 92, 93, 107, 474 beer, xix, 429, 435, 436 Beijing, 457 Belgium, 148 beneficial effect, 46, 51, 56, 59, 117, 376, 377, 381 benefits, xviii, xx, 3, 11, 12, 19, 28, 45, 48, 49, 55, 56, 60, 73, 76, 243, 246, 276, 334, 366, 375, 384, 385, 404, 467, 468, 479, 481, 483, 485 benign, 53 benzene, 157, 158, 187, 195, 202, 213, 214, 224 benzo(a)pyrene, 221 benzothiazoles, 156, 158, 177 beverages, 49, 50, 55, 70, 77, 120, 314 bicarbonate, 361 bile, 47, 101, 118, 131, 132, 147, 153, 227 bile acids, 47, 118, 227 bioaccumulation, 157, 158 bioassay, xvi, 76, 292 bioavailability, xviii, 52, 56, 72, 73, 77, 226, 239, 241, 242, 285, 375, 404, 405, 408, 412, 471, 476, 486, 487 biocatalysts, 166, 167 biochemistry, ix, 2, 181, 312, 327, 386 bioconversion, xxi, 473 biodegradability, 157 biodegradation, 164, 178, 184

Index biodiesel, 26, 27, 33, 274 biofilm, xvi, xvii, 261, 271, 333, 334, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351 bioflavonoids, 374 bioinformatics, 355, 365 biological activity, xiii, 159, 223, 226, 229, 237, 241, 414 biological control, 267 biological processes, xiv, xvii, 273, 274, 279, 353 biological systems, 229, 450 bioluminescence, 463 biomarkers, 384 biomass, xiv, xviii, xix, 18, 199, 252, 254, 258, 259, 269, 337, 340, 341, 344, 390, 391, 394, 395, 396, 397, 398, 399, 417, 419, 422, 423, 424, 425, 426 biomolecules, 276 biopolymers, 293, 361 bioremediation, xii, 155, 156, 167, 180 biosensors, xx, 190, 457, 458 biosynthesis, 6, 23, 34, 68, 69, 74, 234, 253, 267, 268, 351 biosynthetic pathways, 453 biotechnology, 11, 26, 28, 29, 70, 184 biotic, 2, 46, 70, 448, 453 birds, 244, 481 birth weight, 51 bisphenol, 163, 172, 204 bladder cancer, 247 bleaching, 62, 374 blends, 60, 374 blindness, 201 blood plasma, 137, 329 blood pressure, xvii, 55, 56, 92, 119, 373, 377, 404, 414 blood vessels, 92 body composition, 128, 151 body fat, 118, 119, 122, 378 body fluid, 157 body weight, 59, 60, 140, 231, 378, 383, 385, 480 Bolivia, 292 bonding, 192, 194, 195, 200 bonds, 138, 193, 194, 229 bone, xx, 116, 467, 469, 471 bone mass, 469 bone resorption, 469 bones, 92 bradykinin, 387, 404 brain, 80, 390, 391, 396 Brazil, xviii, 1, 17, 21, 81, 100, 251, 262, 274, 291, 292, 389, 392, 400, 417, 418, 420, 426, 447, 448 breakdown, 311, 320, 480

489

breast cancer, 85, 225, 226, 230, 241, 242, 379, 380, 381, 382, 384, 386, 387, 469, 470, 471 breast carcinoma, 73, 386 breast milk, 73 breathing, 157 breeding, ix, xv, xx, 2, 7, 8, 11, 12, 13, 15, 24, 25, 26, 27, 28, 29, 31, 38, 45, 54, 241, 291, 364, 374, 444, 447 bromination, 194, 218 bronchial asthma, 201 by-products, 202, 218, 394, 481

C C reactive protein, 376 Ca2+, 71, 140, 228, 229, 451, 458 cachexia, 235, 246 caecum, 134, 480 calcium, 25, 36, 45, 63, 73, 84, 105, 116, 145, 147, 152, 191, 192, 193, 229, 269, 381, 400, 478, 480 calibration, 421 caloric intake, 59 calorie, 48, 52 Cambodia, 80 campaigns, 390 cancer, xiii, xx, 46, 47, 70, 71, 73, 74, 75, 76, 77, 80, 85, 102, 150, 223, 224, 225, 226, 227, 229, 230, 231, 232, 233, 234, 236, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 311, 376, 379, 380, 381, 382, 383, 384, 386, 387, 413, 448, 467, 469, 470, 471 cancer cells, 229, 234, 236, 240, 469 cancer death, 102 cancer progression, 225, 244 cancerous cells, 246, 379, 469 candidates, 281, 428 capillary, 325, 327, 332 capsule, 120 carbohydrate, xx, 49, 51, 60, 80, 82, 135, 191, 219, 263, 388, 452, 473, 478, 481 carbohydrates, ix, xiv, xix, xx, 1, 2, 8, 12, 23, 38, 45, 55, 70, 80, 84, 90, 100, 139, 144, 145, 146, 150, 252, 259, 276, 394, 395, 396, 400, 422, 429, 467, 473, 477, 478, 479, 480, 483, 485, 486 carbon, xii, 12, 19, 69, 84, 155, 191, 192, 199, 209, 213, 217, 258, 269, 272, 274, 285, 312, 331, 344, 345, 346, 351, 452, 458, 459, 460, 464, 479 carbon atoms, 191 carbon dioxide, 69, 331, 479 carbon nanotubes, 209, 217 carbon-centered radicals, 285 carboxyl, 232 carcinogen, 158, 379, 380

490

Index

carcinogenesis, 46, 72, 77, 230, 232, 241, 243, 379, 469 carcinoma, 227, 386 cardiovascular disease, 72, 118, 122, 224, 375, 380, 385, 387, 413, 467 cardiovascular function, 248, 376 cardiovascular risk, xvii, 71, 373, 376, 383, 384, 388 carotenoids, xiii, 223, 329 casein, xviii, xix, 51, 52, 54, 56, 60, 118, 129, 137, 147, 150, 153, 234, 236, 241, 389, 394, 399, 417, 418, 419, 420, 422, 423, 426, 462 casting, xiii, 189, 200 catabolism, 68, 351 catalysis, 176, 194, 202, 212, 213, 280, 451, 461 catalyst, xv, 156, 165, 167, 194, 218, 273, 326, 461 catalytic activity, 162, 163, 190, 195, 197, 202, 458 catalytic properties, 162, 180, 185 category a, 478 catfish, xi, 126, 129, 131, 146, 150, 152, 153 cathepsin G, 230 cation, 19, 140, 477 CD8+, 130, 142 cDNA, 243, 275, 339 cecum, 226 cell culture, xvii, 233, 247, 275, 389, 394, 400 cell cycle, 225, 227, 229, 230, 231, 232, 246, 279, 286, 386 cell death, 132, 227, 232, 279, 286 cell differentiation, xiii, 223, 224 cell invasion, 231, 245 cell invasiveness, 231 cell line, 73, 226, 233, 241, 245, 246, 247, 380, 386 cell lines, 226, 233, 241, 245, 247, 380, 386 cell membranes, 136, 158, 231 cell signaling, 225, 241, 451 cell surface, 230, 402 cellular regulation, 287 cellulose, 2, 138, 148, 159, 196, 459, 477, 478 Central Europe, 41 cervical cancer, xiii, 223, 240 cervix, 246 cheese, x, 44, 66, 103, 110, 111 chemical, xii, 23, 28, 62, 87, 91, 124, 155, 158, 163, 167, 180, 190, 193, 194, 197, 199, 201, 203, 213, 230, 232, 242, 243, 293, 296, 298, 310, 312, 313, 321, 322, 355, 405, 413, 454, 474 chemicals, 157, 158, 202, 224, 297, 419 chemiluminescence, xx, 277, 457, 458, 460, 461, 463 chemoprevention, 379 chemopreventive agents, 384 chemosis, 201 chemotherapy, 234, 243 chicken, 52, 80, 92, 93, 120, 485, 486, 487

China, ix, 3, 43, 44, 55, 80, 81, 85, 100, 103, 112, 274, 292, 298, 305, 430, 457, 464, 469 chitinase, 190, 216 chlorine, 157, 393 chloroform, 277, 339 chlorophyll, xiv, 38, 251, 253, 254, 255 chloroplast, 68, 191, 267 cholesterol, xvii, 45, 47, 48, 50, 55, 56, 60, 76, 101, 109, 117, 118, 120, 123, 129, 132, 136, 149, 152, 313, 314, 330, 373, 374, 376, 377, 378, 380, 381, 383, 387, 483, 486 choline, 391, 393, 397, 399 chromatographic technique, 328, 332 chromatography, 65, 117, 196, 317, 320, 321, 324, 325, 327, 328, 331, 332, 408, 428 chromosomal abnormalities, 303 chromosomal instability, 299, 303 chromosome, 303 chronic diseases, xiii, 39, 223, 248, 404 chymotrypsin, 46, 61, 64, 73, 133, 134, 229, 230, 354, 370, 477 circulation, 235, 434, 444 citrulline, 234 civilization, 45 classes, xvii, 45, 161, 353, 358 classification, 159, 183, 190 cleaning, 274 cleavage, 51, 62, 198, 230, 237, 238, 362 climate, xx, 447, 454 climate change, xx, 447 clinical diagnosis, xix, 417, 418 clinical trials, 117 cloning, 367, 369 closure, 279 CMC, 209 CO2, xx, 317, 322, 329, 392, 420, 421, 447, 448, 452, 453, 454, 455 coal, xiii, 157, 158, 181, 189, 211, 214 coal tar, 157 coatings, xii, 155 cocoa, 383 cocoa butter, 383 codon, 12 coenzyme, 345, 374, 378 colon, 47, 58, 76, 77, 80, 150, 224, 225, 226, 227, 234, 236, 243, 245, 246, 248, 249, 375, 379, 381, 383, 384, 385, 386, 469, 470 colonization, xiv, 252, 253, 259, 260, 261, 262, 263, 268, 269, 270, 296, 427 colorectal cancer, 227, 229, 247, 384 coma, 201 commodity, 213, 434 communication, xx, 448, 467

Index community, 260, 296, 418 compatibility, 293, 361 complexity, 54, 65, 171, 285, 316, 368 compliance, 399 compression, 105 computation, 171 computed tomography, 119 concordance, 282 conductance, 254 conference, 42, 486, 487 configuration, 161, 167, 168, 174, 175, 315 consensus, 390 conservation, 289, 297 consumers, 28, 29, 48, 49, 70, 90, 100 consumption, xiii, xvi, xvii, xviii, 2, 11, 49, 52, 55, 58, 61, 62, 70, 71, 73, 74, 76, 80, 86, 103, 108, 117, 119, 120, 131, 150, 170, 172, 173, 175, 196, 199, 211, 223, 224, 226, 236, 241, 276, 279, 302, 309, 344, 373, 374, 376, 378, 379, 380, 383, 388, 390, 398, 404, 423, 424, 431, 436, 448, 469, 471 consumption rates, 131 contact time, 199 contaminated water, 176, 211 contamination, 61, 113, 157, 178, 316 contraceptives, 314 contradiction, 135 control group, 131, 142, 234 convergence, 171 cooking, x, xi, 44, 49, 64, 79, 86, 92, 93, 94, 103, 110, 111, 148, 314, 374, 380, 387, 430, 434, 436, 468, 477 cooling, xix, 63, 429 coordination, 191, 194 copolymer, 219, 459 copolymers, 329 copper, 36, 269, 480 coronary heart disease, 26, 45, 70, 122, 330, 376, 384, 388, 404 correlation, 4, 7, 8, 9, 10, 12, 15, 22, 23, 24, 29, 57, 138, 411, 442 correlation coefficient, 10 correlations, 22 corrosion, 158, 200 corticosteroids, 387 cost, xi, xii, xiii, 11, 24, 49, 60, 69, 73, 125, 126, 156, 162, 164, 167, 177, 183, 190, 199, 205, 211, 213, 223, 237, 252, 316, 320, 361, 373, 424, 480, 481, 483 cost-benefit analysis, 424 cotton, 107, 262, 263, 268, 271, 297, 298, 307 cotyledon, xx, 14, 39, 52, 63, 64, 82, 228, 232, 237, 239, 287, 294, 305, 307, 332, 447, 448, 450, 451, 452, 478

491

coupling constants, 277 covalency, 428 covalent bond, 160, 192, 207 covalent bonding, 160 covering, 174 cracks, 22, 107 Creutzfeldt-Jakob disease, 418 critical period, 263, 264, 266 crop production, 36, 80 crop rotations, 31 crops, xi, xiv, xx, 2, 28, 30, 67, 80, 81, 89, 125, 140, 252, 253, 258, 259, 260, 261, 262, 263, 264, 268, 284, 292, 296, 297, 304, 305, 306, 369, 430, 440, 443, 447, 448, 474 crown, 266 CRP, 376 crude oil, 6, 28, 157 crystal structure, 468 crystalline, 228 crystallization, xvi, 309, 310, 317, 318, 322 crystals, 296 cultivation, xiv, xvi, xviii, xix, 28, 67, 108, 111, 252, 297, 333, 336, 339, 341, 390, 391, 392, 394, 395, 396, 397, 398, 399, 402, 417, 418, 419, 420, 421, 423, 426, 427, 428, 429, 430, 433, 438, 440, 442, 444 cultivation conditions, 391, 398, 427, 428 cultural differences, 55 culture, ix, xv, xvi, xvii, xix, 43, 68, 153, 179, 233, 259, 260, 275, 291, 292, 298, 299, 303, 304, 305, 307, 333, 335, 336, 337, 389, 391, 392, 393, 395, 399, 417, 419, 420, 421, 422, 424, 425, 426, 427, 462, 463, 482 culture conditions, 425, 427 culture media, 392, 399, 462 customers, 49 cyanide, 192, 276, 285, 287 cycles, 173, 204, 211, 337, 339 cyclins, 230 cyclooxygenase, 227, 245, 385 cysteine, xi, 11, 12, 37, 77, 79, 81, 82, 192, 193, 234, 248, 362 cystine, 45, 50 cytochrome, 191, 220, 229, 276, 354, 449 cytokines, 130 cytoplasm, 132, 140, 275 cytotoxic agents, 234, 247 cytotoxicity, 231, 240

D damping, 20, 348 data analysis, 268

492

Index

database, 181, 274, 338, 343, 362, 364, 366 deaths, 390 decay, 22, 35, 36, 38, 283, 461 decomposition, 157, 440 defense mechanisms, 143, 151, 253 deficiencies, xiii, 17, 251 deficiency, 13, 14, 18, 40, 54, 83, 146, 260, 270, 274, 275, 284, 300, 370, 375, 438 deficit, 17, 290 deformation, 227 degenerate, 113 degradation, xv, 23, 65, 66, 92, 94, 95, 100, 136, 178, 181, 227, 238, 246, 261, 273, 274, 276, 288, 297, 316, 325, 341, 356, 357, 365 dehydration, 10, 413 Delta, 5, 9, 25 denaturation, 63, 104, 195, 204, 316 deoxyribonucleic acid, 311 Department of Agriculture, 50, 78, 251, 353, 356 Department of Health and Human Services, 157, 178, 202, 220 dephosphorylation, 229 deposition, 6, 7, 15, 73, 455 depression, 63, 131, 482 deregulation, 27 derivatives, 66, 165, 166, 184, 255, 325, 326, 334, 360, 377, 407, 450 dermatitis, 201 desiccation, 10, 37 desorption, xvii, 14, 318, 320, 331, 353, 367, 371 destruction, 60 detachment, 348 detection, xx, 146, 260, 261, 277, 281, 300, 325, 339, 361, 457, 458, 460, 461, 462, 463 detection system, 339 detection techniques, 325 detergents, 61, 65, 167, 352, 356 detoxification, 214, 234, 286 developing countries, 80, 126, 156, 390 diabetes, xvii, 80, 373 diagnostic markers, 478, 485 dialysis, 422 diamonds, 340 diarrhea, xi, 8, 125, 479, 483, 487 diastolic pressure, 404 dibenzo-p-dioxins, 202 diet, xvii, 19, 45, 47, 49, 50, 52, 53, 54, 55, 56, 57, 58, 60, 62, 65, 69, 70, 73, 77, 80, 120, 126, 127, 128, 129, 130, 131, 135, 136, 137, 138, 139, 140, 142, 143, 145, 147, 148, 152, 153, 224, 226, 227, 229, 233, 234, 235, 236, 242, 373, 374, 375, 377, 378, 380, 385, 387, 388, 469, 477, 479, 480, 481, 482, 484, 487

dietary fat, 385 dietary fiber, 46, 51, 55, 75, 101, 404, 413, 467 dietary intake, 46, 77, 235, 379, 385 dietary supplementation, 76, 486 differential equations, 171 diffusion, 341, 346 digestibility, xi, 51, 55, 56, 58, 63, 69, 71, 77, 78, 125, 128, 129, 134, 138, 139, 140, 142, 146, 147, 148, 150, 152, 153, 237, 246, 476, 480, 481, 482, 483, 484, 485, 486, 487, 488 digestion, xi, xviii, 51, 53, 57, 69, 71, 77, 118, 125, 136, 139, 144, 229, 232, 285, 296, 355, 364, 391, 395, 403, 404, 405, 406, 407, 408, 410, 411, 412, 413, 414, 477, 478, 479, 481 digestive enzymes, 131, 134, 138, 232, 240 dimethylformamide, 175 dimethylsulfoxide, 277 diploid, 292 direct measure, 57 disability, 390 discharges, 156, 201 disclosure, 32 discomfort, xxi, 473, 479 discs, 295 disease progression, xiii, 223, 236 dispersion, 460 dissociation, 135, 356 dissolved oxygen, 391, 398 distillation, xvi, 309, 310, 316, 317, 322, 329 distilled water, 277, 335, 337, 360, 361, 405, 422 divergence, 39 diversity, 65, 139, 194, 259, 269, 271, 274, 330, 399, 402, 455 DMF, 197 DNA, xiii, xv, xx, 14, 37, 61, 67, 68, 73, 223, 225, 229, 234, 236, 237, 241, 242, 247, 273, 274, 276, 287, 291, 293, 300, 301, 304, 311, 327, 339, 345, 349, 350, 351, 402, 457, 458, 462, 463 DNA damage, xiii, 223, 234, 236, 237, 241, 247, 287, 349 DNA strand breaks, xv, 225, 273 DNase, 338 DOC, 211 docosahexaenoic acid, 29, 375 dominance, 40 dosage, 303, 408 double bonds, 72, 325 down-regulation, 132, 230 drainage, 440 drawing, 319, 320, 321 drinking water, 229 drought, 16, 17, 21, 22, 25, 32, 39, 40, 46, 69, 283, 430

Index drug delivery, 329 drugs, 234, 404 dry matter, 109, 128, 129, 138, 139, 142, 271, 404, 412, 478, 479, 481, 487 drying, ix, 43, 72, 136, 395 duodenum, 481 dyes, xii, xiii, 155, 156, 157, 158, 159, 161, 177, 187, 189, 200, 201, 360, 371

E Early Soybean Production System (ESPS), 3 East Asia, x, 79, 80, 81, 430 Easter, 486 Eastern Europe, 376, 388 ecology, 258, 349 economic evaluation, 329 economic growth, 126 economic losses, 390 ecosystem, 259, 270 Edamame, vi, xix, 429, 430, 432, 434, 437, 438, 439 editors, 215, 219, 220, 286, 287 effluents, xii, 155, 156, 157, 162, 167, 175, 177, 181, 219, 480 egg, 54, 58, 115, 483 eicosapentaenoic acid, 29 electrocatalysis, 460 electrochemistry, xx, 457, 460 electrodes, 459, 460, 464 electron, xv, 160, 170, 194, 195, 197, 198, 208, 253, 273, 274, 275, 287, 288, 289, 336, 344, 347, 457, 460, 461, 464 electron microscopy, 336, 344 electron paramagnetic resonance, 287 electrons, 197, 459, 463 electrophoresis, xvii, 14, 338, 339, 341, 342, 343, 353, 355, 356, 359, 360, 365, 366, 367, 368, 369, 370, 371, 393, 397 electroporation, 68, 293, 296 ELISA, 190 elongation, 254, 285, 343, 349, 375 elucidation, 232 embryogenesis, 294, 299, 303, 305, 306, 307 emission, 197 emulsions, 377, 386, 387 encapsulation, 160, 420, 483 encephalopathy, 390, 418, 428 encoding, 12, 13, 243, 348, 351, 355, 365 endocrine, 144, 146 endogenous mechanisms, 284 endosperm, 357, 370 endothelial cells, 245 endothelial dysfunction, 376

493

endotoxins, 296, 297 enemies, 297, 298 energy, xiv, xvi, xx, 8, 69, 70, 73, 78, 100, 122, 123, 128, 129, 148, 152, 160, 190, 211, 238, 243, 252, 258, 262, 277, 309, 316, 343, 344, 377, 473, 477, 479, 480, 487 energy density, 70 energy efficiency, 8 engineering, 12, 67, 68, 70, 72, 241, 293, 304, 322 enlargement, 60, 381 enteritis, 130, 138, 142, 144, 148 entrapment, 163 environmental change, 270 environmental conditions, xiii, xx, 2, 12, 15, 20, 24, 25, 45, 189, 447, 476 environmental contamination, 474 environmental effects, 28, 39, 298 environmental factors, 4, 13, 194 environmental impact, xii, 155, 156, 160, 177, 478 environmental influences, 128 Environmental Protection Agency (EPA), 29, 157, 158, 200, 201, 202, 331, 375, 376, 380 environmental regulations, xvi, 309, 316 environmental sustainability, 258 enzymatic activity, xii, 156, 162, 163, 177, 259, 293 enzyme immobilization, 161, 167 enzyme immunoassay, 461, 462 enzyme inhibitors, 123, 408 enzyme-linked immunoassay, 463 enzyme-linked immunosorbent assay, 190, 370, 461 enzymes, xi, xii, xiii, 6, 23, 31, 40, 60, 68, 69, 90, 99, 113, 116, 119, 125, 132, 133, 135, 138, 152, 155, 156, 160, 164, 165, 166, 167, 168, 176, 177, 179, 184, 189, 191, 199, 204, 207, 209, 217, 229, 234, 236, 238, 241, 248, 279, 282, 283, 285, 334, 350, 379, 405, 406, 408, 427, 450, 451, 453, 474, 479, 480, 481, 484, 485, 487 epicotyl, 239 epidemic, 404 epidermis, 190 epithelia, 136 epithelial cells, 118, 131 epithelium, 135, 136, 140, 145, 296 EPR, 277, 278, 279, 282, 286 equilibrium, 59 equipment, 462 erysipelas, xvii, 389, 391 Erysipelothrix rhusiopathiae, xvii, 389, 391, 392, 393, 401, 402 ESI, 361, 405 ESR, 287 essential fatty acids, xvii, 373, 377, 386 ester, 314, 336

494

Index

estrogen, 85, 101, 225, 226, 241, 375, 379, 386, 483 ethanol, xxi, 63, 99, 100, 131, 163, 195, 240, 336, 357, 359, 360, 393, 473 ethnic groups, 469 ethyl acetate, 323, 324, 325, 406 ethyl alcohol, 321, 323 ethylene, 215, 275, 288, 306, 337 European Parliament, 178 European Union (EU), 94, 412 exclusion, 327, 362 excretion, 47, 69, 70, 74, 101, 118, 138, 378, 469, 471, 474, 478, 480, 483, 484, 485, 486 exercise, 383, 385 exophthalmos, 201 exopolysaccharides, 261, 345 experimental condition, 166, 173, 283, 450 exploitation, xvi, 309, 316 explosives, 200, 201 exports, 94 exposure, xiii, 20, 23, 157, 189, 201, 237, 261, 264, 282, 283, 284, 287, 298, 346, 451, 452 expressed sequence tag, 368, 369 extinction, 196 extracellular matrix, 337, 341, 345 extraction, xii, xvi, xvii, 63, 65, 66, 80, 104, 126, 130, 137, 156, 162, 167, 176, 177, 195, 219, 309, 310, 316, 317, 318, 320, 321, 322, 325, 327, 331, 335, 337, 338, 353, 356, 357, 358, 359, 361, 364, 365, 369, 370, 373, 374, 392, 393, 405, 468, 470, 474, 475, 476, 486 extrusion, 64, 148, 153, 477, 488 exudate, 259

F fabrication, 460 factories, 94 famine, 348 farmers, xiii, xiv, xix, 17, 251, 252, 253, 264, 266, 297, 298, 429, 430, 431, 433, 438, 439, 442, 444 fast food, 430 fasting, 128, 378 fat, ix, x, xi, xvii, 12, 19, 26, 27, 29, 43, 45, 46, 49, 50, 52, 55, 60, 61, 62, 64, 65, 66, 79, 80, 81, 109, 119, 122, 125, 127, 128, 129, 130, 131, 132, 135, 142, 143, 147, 150, 152, 228, 373, 374, 378, 379, 380, 382, 385, 386, 387, 388, 468, 475, 485 fatty acids, ix, xvi, xvii, 1, 2, 4, 6, 7, 16, 17, 19, 21, 23, 25, 26, 28, 29, 32, 71, 72, 127, 134, 309, 310, 314, 315, 327, 330, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 386, 387, 477 fauna, 306 FDA, xix, 49, 61, 117, 119, 230, 417

feces, 58, 69, 118, 132, 136 feed additives, 479 feedstuffs, 126, 140 fermentation, x, xvi, 44, 53, 63, 66, 69, 84, 85, 87, 88, 89, 94, 95, 98, 99, 101, 102, 112, 114, 115, 116, 139, 150, 233, 333, 334, 335, 336, 338, 339, 340, 341, 342, 343, 344, 345, 346, 348, 349, 413, 459, 474, 479, 481, 482, 483, 486, 487 fermentation technology, 486 ferritin, xv, 132, 273, 274, 285, 286, 287, 288, 289, 290 fertility, 31, 137, 303 fertilization, 31, 39, 271, 442, 444 fertilizers, 438, 440, 442 fetal development, 378 fiber, xx, 47, 49, 50, 51, 52, 55, 72, 77, 117, 133, 422, 471, 473, 479, 481 fiber content, 51 fibers, 138 fibrosarcoma, 78, 227 field tests, 297 films, 200, 459, 460 filtration, xviii, 89, 90, 107, 196, 199, 211, 216, 322, 392, 395, 403, 404, 420, 422, 462 financial support, 400, 426 fingerprints, 369 first dimension, 355, 360, 363 first generation, 303 fish, x, xi, xii, xvii, 29, 54, 60, 79, 80, 85, 92, 93, 94, 102, 103, 125, 126, 127, 128, 129, 131, 132, 133, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 373, 374, 375, 379, 380, 381, 382, 387 fish oil, xi, 29, 125, 126, 375, 379, 380, 381, 382, 387 fisheries, xi, 125, 126, 445 fission, 178 fixation, 159, 262, 272, 438, 441, 442 flatulence, xx, 8, 473, 479 flavonoids, 73, 85, 452, 453, 455 flavor, x, xix, 8, 23, 41, 44, 45, 70, 72, 80, 85, 86, 87, 90, 92, 95, 99, 103, 429, 434, 436, 438, 439, 468 flavour, 374 flexibility, xiii, 183, 189, 195, 217 flight, xvii, 14, 353 flocculation, 211, 218 flooding, 430 flour, ix, 23, 43, 47, 52, 54, 55, 60, 62, 63, 64, 66, 74, 142, 228, 231, 232, 239, 274, 394, 468, 486 fluctuations, 346 fluid, 20, 215 fluidized bed, 165, 166, 168, 174, 185

Index fluorescence, 197, 220, 255, 269, 339, 360 folacin, 45 folic acid, xix, 91, 101, 429, 436 Food and Agriculture Organization of the United Nations (FAO), xi, 125 food industry, xii, 48, 156, 162, 177, 374, 404, 464 food intake, 469, 471 food processing industry, 405 food production, ix, 43, 122 food products, ix, xx, 26, 43, 49, 120, 374, 447, 468 foodborne illness, 116 Ford, 484 formaldehyde, 162, 190 formula, xvii, 51, 53, 59, 63, 72, 73, 77, 233, 353, 422, 443 fragments, xvii, 118, 293, 300, 339, 353, 361, 362, 450 France, 147, 152, 384 free radicals, xii, 155, 161, 204, 207, 208, 237, 281, 283 freedom, 24 freezing, 20, 431 freshwater, 132 frost, 22 fructose, 2, 8, 387, 478 fruits, 60, 149, 224, 358, 404 functional analysis, 367, 369 functional food, 412 funding, 484 fungal infection, 22, 299 fungi, x, 21, 22, 39, 44, 88, 89, 95, 99, 111, 161, 258, 259, 260, 268, 299, 453, 454 fungus, 23, 25, 161, 450, 451, 455 furunculosis, 148 fusion, 294

G gametogenesis, 144 garbage, 157 gastritis, 201 gastrointestinal tract, 53, 127, 136, 141, 146, 152, 229, 478 gel, xvii, 14, 165, 166, 196, 211, 317, 318, 320, 321, 327, 331, 338, 339, 343, 344, 353, 355, 359, 360, 361, 365, 366, 368, 369, 370, 371, 393, 468, 470 gel formation, 468 gelation, 70 gene expression, 130, 225, 231, 246, 346, 350, 352, 381 gene pool, ix, 1 gene promoter, 13 gene transfer, 68, 292, 294, 299

495

genes, xiii, xvii, 4, 9, 12, 13, 14, 26, 27, 30, 33, 35, 68, 72, 83, 123, 223, 224, 225, 234, 241, 244, 275, 279, 286, 292, 293, 294, 295, 297, 299, 300, 304, 306, 333, 334, 344, 345, 346, 348, 349, 350, 354, 355, 365, 366, 451, 453, 468 genetic alteration, 387 genetic resources, 35, 292 genetics, 18, 286, 349 genome, 39, 301, 338, 349, 367, 371 genomics, 37, 349, 368 genotype, ix, xv, 1, 4, 7, 8, 12, 15, 17, 23, 25, 27, 34, 37, 67, 68, 291, 293, 295 Georgia, 179 Germany, 277, 281, 335, 392 germination, ix, xiii, 1, 2, 10, 20, 21, 22, 23, 24, 25, 32, 33, 35, 36, 37, 39, 40, 100, 223, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 248, 260, 274, 275, 276, 278, 279, 280, 282, 283, 285, 288, 289, 299, 355, 366, 438 gestational age, 50 gill, 136 ginger, 93, 103, 110 gland, 383 glucose, xviii, xx, 2, 8, 46, 51, 66, 75, 90, 94, 99, 100, 135, 143, 144, 335, 337, 340, 341, 343, 344, 345, 346, 348, 350, 376, 377, 378, 382, 385, 387, 390, 392, 393, 394, 395, 396, 397, 398, 419, 420, 422, 423, 424, 450, 457, 458, 459, 478 glucose oxidase, 393, 458, 459 glucose tolerance, 378 glucosidases, 136, 452 glucoside, 66, 226, 453, 454 glutamate, 91, 238 glutamic acid, 103, 334, 345, 351, 362, 412 glutathione, 234, 236, 248, 281, 282 glycans, 216, 458 glycerol, 338, 356, 360 glycine, 17, 34, 36, 216, 253, 268, 269, 360, 412 Glycine soja, 44, 366, 368 glycol, 163, 164, 170, 172, 175, 181, 182, 183, 208, 217, 220, 296, 326, 329, 421 glycoproteins, 477 glycoside, 72 glycosylation, 150, 191, 216, 464 glyphosate, xiii, xiv, 17, 18, 19, 30, 32, 33, 34, 35, 36, 38, 42, 67, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272 glyphosate-resistant (GR), xiii, 251, 252, 258 goiter, 141 granules, 132 grass, 129, 145, 252, 355 grasses, 60

496

Index

grouping, 229 growth arrest, 128 growth factor, 391 growth rate, xviii, 28, 49, 390, 393, 398, 399, 474 growth temperature, 6, 31, 33 guard cell, 288 guidelines, xvii, 50, 61, 78, 373, 377, 391, 396

H half-life, 175, 194, 459 halogen, 178, 218 halogenation, 194 hardness, 108, 380, 468 harmful effects, 157 harvesting, 22, 425, 439, 444 Hawaii, 469 hazardous waste, 202 Health and Human Services, 202 health effects, xiii, xvii, 71, 75, 143, 189, 314, 373, 381, 384 heart attack, 80 heart disease, xvii, 85, 117, 311, 373, 374, 375, 376, 377, 381, 448 heart failure, 404 heat shock protein, 132, 147 heavy metals, 168 height, 8, 25, 302, 336 helium, 293 hemagglutinins, 135 heme, 54, 72, 75, 160, 191, 192, 193, 194, 195, 196, 198, 234, 458 hemicellulose, 2 hepatocellular carcinoma, 229 hepatocytes, 132, 234, 248 hepatoma, 235 hepatomegaly, 368 herbicide, 17, 28, 67, 69, 252, 253, 259, 261, 262, 263, 264, 265, 268, 269, 270, 271 heterogeneity, 275, 286, 345 hexane, xi, 125, 127, 318, 323, 324, 325, 359 high blood pressure, 80, 404 high fat, 6, 46, 380, 387 histamine, 141, 151, 487 histidine, 50, 191, 192, 195, 198, 203, 412 histochemistry, 485 histology, 127, 131, 144, 145, 146, 147 histone, 232, 244 histone deacetylase, 232 histones, 232, 243 HIV, 47, 48 homeostasis, xv, 234, 273, 281, 284, 286, 287, 289 hospitalization, 418

host, xiv, 41, 127, 232, 252, 259, 293, 352, 452, 454, 483 human health, xi, xvii, 19, 29, 61, 79, 80, 201, 247, 299, 373, 462, 483 human milk, 51, 53, 59, 73 human subjects, 53, 72 Hunter, 376, 380, 383 hybrid, 165, 166, 209, 298, 463 hybridization, 300, 463 hydrocarbons, 183, 310, 324, 325, 330, 374 hydrogen, xii, xx, 155, 158, 160, 162, 164, 165, 166, 167, 169, 170, 171, 172, 173, 174, 175, 176, 179, 180, 181, 184, 185, 186, 191, 192, 193, 194, 195, 196, 197, 198, 199, 203, 204, 206, 207, 208, 211, 214, 216, 217, 218, 220, 230, 237, 276, 287, 289, 326, 348, 356, 406, 457, 458, 459, 460, 461, 462, 464, 479 hydrogenase, 262 hydrogenation, 26, 29, 380 hydrolysis, xiii, xvi, 23, 58, 62, 63, 64, 65, 66, 87, 141, 223, 237, 242, 309, 310, 317, 405, 406, 407, 408, 409, 412, 414, 450, 477, 481 hydrolytic stability, 165 hydroperoxides, 345 hydroquinone, 204 hydroxide, 198, 211, 323, 475 hydroxyl, 47, 65, 66, 198, 213, 224, 229, 237, 276 hydroxyl groups, 224 hypercholesterolemia, 118 hyperlipidemia, 118, 376 hyperplasia, 46, 61, 231, 482 hypersensitivity, 30, 130, 141, 142, 481, 482, 484 hypertension, 80, 201, 404 hypertrophy, 46, 60, 133, 140, 231 hypocotyl, 20, 64, 65, 66, 227, 239, 295, 301, 469 hyporeflexia, 201 hypotensive, 408 hypothesis, 77, 118, 265

I IL-8, 225 ileostomy, 53, 76 ileum, 58, 118 image analysis, 361 imbibition, 20, 21, 30, 33, 37, 42, 238, 276, 277, 278, 279, 280, 285, 289 immobilization, 34, 160, 164, 165, 167, 180, 184, 210, 214, 260, 440, 441 immobilized enzymes, 164, 165, 166 immune function, xi, 125, 485, 487 immune reaction, 478 immune response, 132, 141, 144, 375, 402, 478, 482

Index immune system, 127 immunity, 428 immunization, 418, 427 immunoelectrophoresis, 64 immunoglobulin, 130 immunoreactivity, 487 impurities, 211 in situ hybridization, 463 in vivo, xvi, 46, 146, 226, 229, 230, 231, 232, 234, 241, 242, 275, 292, 302, 303, 334, 345, 404, 408, 469, 470, 481, 482 incidence, xiii, 22, 34, 46, 131, 140, 223, 224, 227, 231, 232, 234, 375, 376, 379, 380, 418, 469, 479, 488 incompatibility, 292 incomplete combustion, 202 incubation period, 90, 92, 94, 120, 418 incubation time, 282, 463 incubator, 335 independent variable, 7 India, 43, 80, 81, 86, 90, 100, 328, 486, 487 indirect effect, xiv, 252, 253 Indonesia, 80, 309 inducer, 454 induction, 14, 235, 236, 275, 288, 289, 294, 304, 352, 386, 450, 451, 452, 454 industrial processing, 45, 202 industrialization, xii, 155 industrialized countries, 418 infants, 11, 30, 50, 58, 59, 72, 77 inflammation, 130, 131, 132, 135, 141, 142, 143, 230, 375, 382 inflammatory cells, 130 inflammatory mediators, 130, 152 inflammatory responses, 132, 135, 137, 138, 143, 227, 376, 377 infrared spectroscopy, 478 ingestion, xiii, 51, 133, 141, 158, 189, 201, 235, 242, 387, 484 inheritance, 35, 68, 300, 307, 332 inhibition, xviii, 20, 34, 61, 64, 120, 133, 136, 141, 165, 184, 218, 225, 226, 230, 231, 235, 236, 239, 240, 246, 247, 248, 249, 261, 267, 268, 270, 279, 379, 403, 406, 407, 408, 409, 411, 412, 414, 462 inhibitor, xvii, 11, 35, 44, 46, 48, 61, 63, 73, 76, 77, 78, 134, 143, 153, 172, 217, 227, 229, 231, 232, 238, 239, 242, 244, 245, 246, 248, 306, 353, 354, 358, 364, 365, 366, 368, 369, 379, 405, 408, 452, 470, 474, 477, 481, 486, 488 initiation, xiii, 12, 15, 223, 224, 227, 235, 236, 238, 279, 306, 350, 469 inoculation, 111 inoculum, 77, 258, 392, 393, 421

497

inositol, xiii, 47, 76, 78, 140, 223, 224, 229, 247, 248, 479 insecticide, 297 insects, 295, 296, 297, 298, 299 insertion, xvi, 263, 292, 300, 301, 420 insulin, 376, 377, 378, 385, 387 insulin resistance, 377, 378, 385 insulin sensitivity, 376, 378, 387 integration, 40, 300, 301, 370 interaction effect, 4 interaction effects, 4 interference, 139, 263, 264, 265, 266 interleukin-8, 244 internalization, 232 intervention, 224, 453 intestinal tract, 70, 118, 151 intestine, xi, 51, 84, 125, 127, 128, 130, 131, 132, 134, 135, 136, 138, 139, 140, 141, 142, 144, 146, 148, 151, 152, 227, 296, 479, 480 investments, 127 iodine, 325 ion exchangers, 138 ionization, xvii, 14, 203, 204, 353, 361, 365, 367, 371 ionizing radiation, 230 ions, 191, 192, 193, 275, 276, 346, 358, 362, 438 Iowa, 15, 20, 27, 29, 32, 33, 74, 153, 401 Ireland, 65, 74 iris, 331 iron, xv, 32, 33, 45, 47, 71, 72, 74, 75, 77, 84, 92, 103, 110, 144, 157, 176, 178, 191, 192, 194, 198, 212, 217, 218, 229, 234, 267, 268, 270, 273, 274, 276, 280, 285, 286, 287, 288, 289, 290, 478 iron transport, 286 irradiation, 85, 247, 283, 284 isoflavone, 34, 35, 46, 66, 117, 118, 138, 226, 236, 239, 243, 247, 453, 455, 469, 483, 486 isoflavones, ix, xiii, xx, 1, 2, 25, 45, 46, 56, 62, 66, 71, 72, 74, 77, 78, 85, 92, 116, 117, 120, 137, 223, 224, 225, 226, 236, 237, 239, 241, 242, 244, 245, 246, 247, 379, 384, 404, 448, 467, 468, 469, 470, 471, 483 isoflavonoid, xx, 74, 448, 455 isoflavonoids, xi, 47, 71, 76, 79, 81, 85, 137, 384, 469, 471 isolation, xvi, xix, 24, 65, 69, 213, 218, 309, 310, 312, 316, 317, 318, 338, 360, 364, 417, 418 isoleucine, 50, 69, 233, 412, 476 isomers, 200, 202, 206, 312, 313, 314, 327 isoprene, 315 isotope, 77 isozyme, 35, 183, 190, 245, 248 Italy, 73

498

Index

J Japan, x, xix, 45, 67, 75, 76, 79, 80, 81, 82, 85, 86, 87, 91, 94, 95, 100, 101, 103, 108, 109, 110, 111, 112, 114, 116, 117, 119, 120, 121, 122, 123, 124, 144, 333, 334, 335, 336, 337, 338, 339, 391, 429, 430, 431, 432, 433, 434, 435, 436, 437, 440, 442, 445, 469, 471, 483 jejunum, 482 Jordan, 285

K karyotype, xvi, 292, 303 keratinocytes, 240, 245 ketones, 310, 311, 320 kidney, 130, 135, 140, 143, 201, 236 kidney failure, 201 kill, 22, 199, 264, 335 kinase activity, 225 kinetic constants, 172 kinetic model, 169, 170, 171, 172, 173, 174, 186 kinetic parameters, 171, 173, 398 kinetic studies, 172 kinetics, 161, 172, 173, 174, 175, 218, 463 kinetochore, 232 Korea, 45, 80, 427

L labeling, 32, 74, 117, 122, 427, 463 lactic acid, 95, 99, 138, 397, 398, 423 lactose, 50, 55 lakes, 157 Laos, 80 large intestine, 80, 138, 485 larva, 296, 299 LDL, 55, 56, 117, 118, 313, 376, 377, 380, 382, 387 lead, xi, xx, 2, 24, 125, 126, 127, 128, 161, 166, 231, 234, 235, 263, 283, 296, 301, 451, 473, 478, 480, 481 leakage, 20, 202 lecithin, xvii, 55, 123, 322, 373, 374, 383, 387 legislation, 480 legume, 47, 50, 55, 60, 141, 148, 237, 238, 243, 246, 274, 365, 436, 437, 476 lending, 294 Lepidoptera, 305, 306, 307 leptin, 378, 387 lesions, 141, 296, 299, 470 leucine, 50, 131, 133, 404, 412, 476 leukoplakia, 230, 248

leukotrienes, 376 levees, 430 liberation, 234 life cycle, 366 life expectancy, 232 lifetime, 164 light conditions, 46, 239 lignans, 45, 47, 76 lignin, 23, 144, 159, 161, 191, 194, 217, 477 linear dependence, 172 linoleic acid, 2, 16, 22, 26, 27, 34, 84, 85, 314, 315, 375, 376, 382 lipases, 481 lipid metabolism, 75, 118, 122 lipid peroxidation, xv, 273, 276, 277, 282, 283, 311, 377 lipids, xi, xix, xx, 23, 28, 40, 45, 61, 63, 79, 80, 81, 82, 84, 121, 287, 318, 327, 330, 352, 375, 376, 381, 382, 383, 413, 429, 436, 473, 477 lipoproteins, 327, 375, 376, 383, 384 liposomes, 293 liquid chromatography, xvii, 65, 74, 324, 325, 327, 330, 335, 353, 414, 422 liquid phase, 339, 346 lithography, 200 liver, 118, 129, 132, 133, 147, 158, 201, 229, 232, 237, 248, 316, 368, 370, 380, 469 liver cancer, 229, 248, 380 liver damage, 133, 158, 201 livestock, xi, 79, 81, 82, 390, 448, 467, 474, 476, 483 localization, 74, 275, 351 locus, 11, 15, 28, 35, 190, 216, 300, 343 Louisiana, 219 low risk, 76 low temperatures, 283, 289 low-density lipoprotein, 117, 330 LSD, 19 lubricants, 61, 274 lubricating oil, 200 lumen, 235 lung cancer, 226, 243, 380, 469, 471 lymphocytes, 48, 130, 231 lymphoma, 231 lysine, 50, 68, 73, 83, 123, 153, 412, 459, 476 lysis, 232, 245, 296, 341, 356, 357, 359, 422 lysozyme, 148, 338

M machinery, 229, 238, 243 macronutrients, xiii, 45, 129, 150, 251 macrophages, 130, 227, 231, 232, 244, 368, 387 mad cow disease, 390

Index magnesium, 36, 45, 73, 103, 105, 146, 147, 152, 269, 400, 478 magnitude, 226, 231, 284 Maillard reaction, 90 majority, 49, 69, 210, 239, 261, 295, 341 malabsorption, 50, 72, 482 malaria, 400 malignancy, 233 malignant cells, 229 malignant tumors, 235, 242 malnutrition, 50, 73, 80, 284 management, ix, xiii, xiv, 1, 12, 16, 17, 23, 33, 38, 251, 252, 253, 263, 264, 265, 266, 271, 284, 305, 307, 381, 387, 431 manganese, 32, 34, 36, 41, 161, 180, 181, 191, 267, 269, 271 manipulation, 67, 292, 293, 381 manufacturing, xii, xiii, 28, 61, 143, 155, 158, 159, 189, 233, 314, 334, 400 manure, 478 mapping, 146 margarine, x, 27, 44, 314, 468 marker genes, 293, 295 market economics, 69 marketing, 29, 444 marketplace, 476 Maryland, 247, 287 mass loss, 23 mass spectrometry, xvii, 14, 353, 355, 356, 361, 362, 364, 365, 366, 368, 369, 371 mast cells, 130, 141, 142, 149 matrix, xvii, 14, 165, 225, 226, 227, 334, 345, 348, 353, 356, 362, 371, 462, 481 matrix metalloproteinase, 225, 227 Maturity, 5, 9, 25 maximum specific growth rate, xviii, 390, 393, 396, 397, 398 meat, x, 44, 49, 52, 54, 55, 60, 61, 70, 76, 77, 78, 80, 85, 92, 93, 94, 103, 109, 117, 122, 390, 391, 396, 397, 468, 480, 483, 485 mechanical properties, 165 media, xviii, xix, xx, 49, 166, 169, 267, 278, 282, 304, 337, 359, 389, 390, 391, 392, 394, 395, 396, 399, 417, 418, 419, 420, 421, 422, 423, 457, 458, 459 medium composition, 344 MEK, 242 melanin, 233 melanoma, 226, 233, 247 membrane permeability, 23, 227 membranes, 20, 23, 132, 136, 142, 147, 166, 234, 279, 293, 336, 407, 408, 410, 411, 450, 454 meningitis, xix, 417, 418

499

menopause, 92 meristem, 68 MES, 197 mesophyll, 267, 448 messengers, 279 meta-analysis, 117, 454 metabolic intermediates, 238 metabolic pathways, 283 metabolic syndrome, 118, 119, 122, 375 metabolism, xiv, xv, xx, 16, 23, 30, 32, 46, 47, 75, 76, 117, 118, 123, 136, 147, 177, 226, 228, 235, 238, 248, 252, 267, 268, 272, 273, 274, 276, 279, 280, 284, 286, 288, 289, 290, 343, 345, 358, 369, 378, 379, 381, 382, 383, 384, 385, 448, 452, 453, 455, 471 metabolites, xiv, 14, 18, 118, 141, 247, 252, 254, 258, 262, 334, 392, 448, 451, 452, 467 metabolizing, 132, 236 metal complexes, 18, 256 metal ion, 47, 211 metal ions, 47, 211 metal salts, 215 metalloproteinase, 227 metals, 270, 293 metamorphosis, 296 metastasis, 225, 229, 234, 235, 242, 245, 247, 248, 379 methanol, 163, 175, 195, 277, 322, 335, 338, 357, 359, 360 methodology, 173, 246, 412, 414, 450, 468 methylation, 234, 480 methylene blue, 459 Mexico, 223 Mg2+, 131, 140, 228, 229 mice, 46, 64, 76, 77, 101, 118, 122, 226, 227, 229, 231, 232, 233, 241, 242, 243, 245, 246, 247, 248, 249, 381, 382, 387, 470 microbial communities, 258, 259, 263, 267, 268, 271 microbial community, 260, 261, 262, 268 microinjection, 293 micronutrients, xiii, xx, 18, 19, 45, 223, 251, 254, 256, 274, 467 microorganism, xii, xiv, xix, 155, 252, 253, 258, 390, 391, 396, 417, 418, 457, 463 microscope, 336 microsomes, 286 milligrams, 59 Missouri, 22 mitochondria, xv, 20, 273, 275, 276, 285, 286, 287, 288, 289, 290 mitogen, 231, 288 mitosis, 243 mixing, 62, 95, 98, 115, 174, 335, 341, 405, 421, 434

500

Index

MMP, 227, 245 model system, 67, 182, 242, 414 modelling, 185 models, 46, 170, 171, 182, 234, 242, 296, 379, 381, 469, 470 moisture, xx, 20, 21, 23, 24, 35, 41, 89, 117, 259, 269, 326, 430, 467, 473 molar ratios, 73, 170 molasses, 130, 136, 148 mole, 204, 209 molecular biology, 312, 327 molecular mass, 209, 338, 343, 355, 362, 367, 397, 399, 411, 458 molecular weight, xii, xiii, xv, 62, 91, 134, 155, 157, 161, 162, 163, 191, 223, 224, 229, 231, 237, 238, 273, 316, 354, 355, 357, 358, 364, 405, 407, 408, 412, 477, 481 molecules, xx, 65, 161, 193, 204, 207, 234, 238, 241, 270, 279, 281, 288, 346, 354, 447, 448, 449, 450, 451, 453 monolayer, 165 monomers, 138, 172, 211 monosaccharide, 99, 477 monounsaturated fatty acids, 26, 377, 380, 382 morphology, 140, 147, 148, 150, 153, 227, 262, 485 mortality rate, 379, 418 mosaic, 21, 39, 299, 452 motif, 232 MP, ix, 1, 391 mRNA, 14, 31, 34, 130, 142, 149, 180, 225, 227, 237, 241, 384 Mucor ramosissimus, 450, 455, 456 mucosa, xi, 125, 143, 144, 148, 227 mung bean, 47 mutagen, 157 mutagenesis, 27, 28, 45, 420 mutant, 28, 33, 39, 367, 420 mutation, 27, 28, 74, 216, 300, 301, 348, 464 mutations, 26, 37, 40, 350, 351, 355, 370 Myanmar, 80 mycotoxins, 299 myoglobin, 459

N Na2SO4, 212 NaCl, 91, 101, 109, 116, 335, 393 NAD, 391 nanohorns, 460 nanoparticles, 329 naphthalene, 158 natural enemies, 297, 298 natural food, 48, 49

natural killer cell, 47, 71, 229, 249 natural resources, xii, 155, 159 nausea, 479 necrosis, 131 negative consequences, xi, 126, 127 negative effects, 8, 128, 133, 139, 227, 377, 474, 478, 479 negative relation, 5, 9, 13, 14, 24, 260 nematode, 269 nerve, 158 nervous system, 136, 390 Netherlands, 266, 323, 367, 379, 384 neurodegenerative disorders, 418 neurotransmission, 234 New England, 381 next generation, 301, 304 NH2, 158, 201, 212 niacin, 45, 101 niche market, 474 nickel, 262, 272 nicotinamide, 391 nitric oxide, xx, 234, 235, 242, 245, 248, 279, 286, 287, 288, 387, 448, 451, 454, 456 nitric oxide synthase, 234, 279 nitroaromatics, 156, 177, 201, 212, 217 nitrobenzene, 158, 176, 201, 218 nitrogen, xiv, xviii, 13, 14, 16, 30, 39, 42, 50, 57, 58, 60, 69, 87, 123, 138, 151, 191, 192, 196, 251, 259, 262, 272, 273, 274, 279, 290, 323, 344, 346, 356, 359, 390, 391, 392, 396, 397, 398, 399, 400, 406, 422, 437, 438, 439, 440, 441, 442, 444, 451, 455, 476, 477, 484 nitrogen fixation, 259, 262 nitrogenase, 35, 262, 268 nodes, xv, 14, 291, 294, 302, 442 nodules, 38, 262, 275, 290, 437, 438, 441, 442 North America, 11, 94, 100, 266, 297, 298 Norway, 125, 144 nuclei, 132 nucleic acid, xx, 457, 458, 463 nucleotides, 276, 349 nucleus, 132, 170, 227, 232, 293, 312 null, 11, 12, 13 nutraceutical, xiii, 49, 71, 223, 237 nutrient media, xvii, 389, 394 nutrients, xi, xiii, xiv, xvi, xvii, xviii, xix, xxi, 16, 18, 20, 23, 30, 52, 59, 63, 91, 101, 109, 115, 116, 125, 126, 132, 138, 139, 144, 149, 150, 223, 231, 236, 251, 253, 255, 256, 258, 272, 333, 334, 339, 341, 344, 345, 346, 348, 373, 389, 390, 398, 399, 400, 429, 436, 437, 467, 473, 479, 480, 483, 487 nutrition, ix, xi, xv, 1, 16, 29, 31, 32, 33, 36, 41, 48, 50, 54, 55, 58, 59, 60, 71, 76, 77, 79, 80, 83, 127,

Index 133, 147, 247, 248, 253, 254, 262, 266, 272, 273, 274, 284, 330, 385, 437, 438, 439, 442, 486, 487 nutritional deficiencies, 253, 258 nutritional status, 18, 50, 236, 266

O obesity, 119, 388 ODS, 337 oleic acid, 2, 6, 7, 16, 18, 20, 25, 26, 27, 28, 29, 31, 84, 314, 315 oligomers, 162, 173, 199 oligosaccharide, 128, 135, 477, 479 olive oil, 26, 29, 316, 331, 377, 381, 383 omega-3, xvii, 19, 39, 127, 373, 374, 375, 376, 379, 383, 386 omission, 190 oncogenes, 46, 77, 225, 232 operating range, 164 operations, 395 operon, 334, 344, 345, 348, 349, 350, 351 opportunities, 11, 29, 60 optical density, 392, 394, 420 optimization, 67, 161, 185, 218, 325, 327, 427, 468 organ, 46, 227, 231, 438, 439 organelles, 354 organic chemicals, 158 organic compounds, 138, 158, 168, 199, 202 organic matter, 16, 31, 211, 214, 215, 274 organic solvents, 163, 195, 318, 324, 458 organism, xiv, 64, 252, 286, 334, 349, 352, 462 osmosis, 356 osmotic pressure, 139 osteoporosis, 56, 70, 85, 92, 116, 117, 224, 448, 471 otitis media, xix, 417, 418 ovarian cancer, 231, 245, 246 ovariectomy, 486 overproduction, 349 overweight, 378, 387 oxidation, xii, xv, 23, 51, 55, 56, 155, 156, 159, 160, 166, 167, 169, 170, 171, 172, 175, 176, 178, 180, 181, 185, 186, 187, 194, 195, 197, 199, 213, 218, 261, 273, 274, 276, 283, 287, 362, 457, 461, 463 oxidation products, 170 oxidation rate, 172 oxidative damage, 276, 287 oxidative stress, xiv, 234, 273, 281, 282, 283, 284, 285, 286, 287, 288, 289, 348, 367, 377, 379 oxygen, 99, 191, 192, 198, 199, 278, 289, 349, 365, 428, 459, 460 ozonation, 179 ozone, 159

501

P Pacific, 388 paclitaxel, 246, 329 paints, x, xii, 44, 155, 200, 274 palm oil, 381, 386 pancreas, 60, 132, 134, 477 pancreatic cancer, 46 pancreatitis, 246 pantothenic acid, 91, 153 Paraguay, 292 parallel, 339 parasites, 390 parenchyma, 448 particle bombardment, xv, 67, 291, 293, 294, 296, 299, 300, 304 pasteurization, 90 pasture, x, 44 patents, 175 pathogenesis, 130, 142, 455 pathogens, xx, 22, 26, 253, 259, 260, 262, 267, 293, 334, 447, 448, 450, 452, 454, 455, 456, 463, 483 pathways, xiii, 132, 170, 207, 223, 224, 225, 231, 241, 262, 279, 343, 376, 386 PCBs, 202 PCP, 171 PCR, 300, 301, 338, 339, 344, 346, 462 PCT, 215 pepsin, xviii, 62, 140, 240, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 414 peptidase, 240, 343 peptides, xiii, xviii, 11, 51, 71, 75, 77, 90, 91, 99, 100, 117, 118, 119, 120, 122, 123, 124, 143, 223, 224, 229, 233, 234, 237, 238, 241, 246, 248, 334, 349, 362, 364, 365, 403, 404, 405, 408, 411, 412, 413, 414, 415, 481 peripheral blood, 231 permeability, 136, 137, 142, 146, 148 peroxidation, 277, 278, 377, 380 peroxide, xx, 159, 162, 169, 170, 172, 173, 175, 176, 190, 198, 199, 204, 207, 208, 211, 286, 288, 345, 457, 458, 459, 460, 461 peroxynitrite, 279 pertussis, 400 pesticide, 147 pests, 298, 303, 305, 448 PET, 90 petroleum, xiii, 157, 189, 202 pharmaceuticals, xii, 155, 158 pharmacokinetics, 226, 241 phenol, xx, 23, 162, 163, 164, 165, 166, 167, 168, 170, 171, 172, 173, 174, 175, 176, 179, 180, 181, 182, 183, 184, 185, 186, 197, 198, 200, 204, 209,

502

Index

210, 214, 215, 216, 217, 219, 220, 221, 339, 357, 358, 359, 367, 457, 460 phenol oxidation, 171, 172, 219 phenolic resins, 162, 200 phenotype, 74, 229 phenotypes, 144, 367 phenylalanine, 50, 233, 413, 449, 451, 476 Philippines, 80 phosphates, 248 phospholipids, 23, 123, 276, 322, 374 phosphorous, 474, 478, 480, 482, 483, 487 phosphorus, 45, 70, 75, 140, 149, 152, 153, 261, 269, 272, 476, 478, 479, 480, 483, 484, 485, 486 phosphorylation, 40, 225, 231 photocatalysis, 159 photoemission, 277 photographs, 121 photolysis, 159, 237 photosynthesis, xiv, 42, 251, 252, 253, 255, 258, 270, 272, 273, 274, 276, 290 physical properties, 354 physical treatments, 213 physicochemical properties, 224, 366, 413, 468 physiology, ix, xiv, 2, 18, 20, 36, 127, 138, 151, 227, 252, 253, 266, 272, 287, 454 phytohaemagglutinin, 143 phytosterols, xvi, 46, 47, 56, 309, 310, 311, 312, 313, 314, 316, 317, 318, 320, 322, 323, 324, 325, 326, 327, 329, 330, 331, 332, 377, 379, 381, 387 pigs, 60, 75, 78, 146, 153, 475, 476, 479, 480, 481, 482, 484, 485, 486, 487, 488 placebo, 469 plant sterols, 379, 382 plasma levels, 376 plasma membrane, 20, 225 plasmid, 247, 299, 300 plasminogen, 231 plastics, xiii, 157, 158, 189, 200, 201 plastid, 267 platelet aggregation, 376 platform, 49 PM, 285, 287, 465 PNA, 462, 463 pneumococcus, 426, 428 pneumonia, xix, 417, 418, 426 point mutation, 12, 42 point of origin, 44 polarity, 317 pollen, 301, 307, 355 pollination, 300, 301 pollutants, xii, xiii, 155, 156, 157, 158, 159, 161, 162, 176, 177, 181, 189, 202, 452 pollution, 298, 479, 480

polyacrylamide, xvii, 14, 338, 353, 360, 368, 369, 393, 464 polyamides, 200 polybrominated biphenyls, 202 polychlorinated dibenzofurans, 202 polycyclic aromatic hydrocarbon, xii, 155, 156, 175, 177, 181, 218, 380 polymer, 167, 170, 172, 180, 190, 199, 204, 208, 209, 212, 334, 401, 459, 464 polymerase, 267 polymerase chain reaction, 267 polymeric products, 175, 208, 212 polymerization, xii, xiii, 155, 170, 175, 176, 178, 179, 180, 182, 183, 185, 186, 189, 190, 211, 212, 213, 214, 215, 216, 217, 218, 219, 221 polymers, xii, 155, 164, 165, 172, 174, 175, 199, 204, 207, 210, 211, 215 polypeptide, 13, 195, 354 polyphenols, 199, 358 polysaccharide, xviii, 389, 390, 391, 392, 393, 394, 395, 401, 402, 418, 419, 422, 427, 428, 455, 478, 487 polyunsaturated fat, xvii, 19, 26, 45, 46, 50, 117, 373, 374, 375, 377, 381, 384, 386, 387 polyunsaturated fatty acids, xvii, 19, 26, 373, 375, 381, 384, 386 polyvinyl alcohol, 459 population density, xiv, 252 population growth, 297 population size, 260 Portugal, 373 positive correlation, 8, 16, 22, 23, 442 positive relationship, 5, 8, 9 potassium, 14, 84, 190, 196, 197, 346, 406, 475, 482 potato, 21, 285, 297, 357, 367, 411, 414, 460 poultry, 11, 54, 69, 139, 474, 475, 476, 479, 480, 483, 484, 486 poverty, 80 p-Phenylenediamine, 203, 205, 206, 210 precipitation, 33, 160, 161, 170, 180, 182, 186, 218, 219, 357, 358, 405 premature infant, 50, 76 preparation, 53, 62, 65, 232, 331, 337, 356, 391, 393, 395, 468 prevention, 24, 47, 49, 71, 119, 120, 229, 230, 232, 236, 243, 244, 379, 380, 383, 384, 385, 386, 387, 390, 404, 413, 426, 462, 469, 470 primary antioxidants, 237 primate, 60 priming, 366 prions, 390, 396 probability, 5, 362 probe, xx, 287, 364, 457, 458, 462, 463

Index probiotic, 483 process control, 51, 199, 400 producers, 17, 48, 49, 90, 111, 112, 126, 274, 364, 474 production costs, 17, 126, 296, 396, 426 progesterone, 314 programming, 378 pro-inflammatory, 377 project, 426, 484 prokaryotic cell, 343 proliferation, 68, 84, 144, 225, 226, 227, 229, 234, 235, 242, 247, 259, 260, 294, 295, 299, 300, 304, 379, 448, 477 promoter, 13, 68, 298, 299 propane, 461 prophylaxis, 404 prostaglandins, 376 prostate cancer, 225, 244, 246, 379, 448, 469, 471 prostate carcinoma, 249 protease inhibitors, xiii, 46, 56, 60, 61, 71, 134, 223, 224, 230, 354, 357, 408, 477 protective coating, 162 protective mechanisms, 283 protein family, 355 protein hydrolysates, xviii, 119, 224, 237, 245, 246, 247, 403, 404, 406, 408, 410, 411, 413, 414, 415 protein kinase C, 227, 229, 245 protein kinases, 225 protein sequence, 356, 362 protein structure, 192 protein synthesis, 58, 231, 343, 348, 365 proteinase, xx, 77, 133, 134, 141, 143, 144, 148, 239, 248, 357, 473, 477 proteolysis, 113, 248, 356, 357, 365 proteolytic enzyme, 51, 62, 114, 119, 123, 146, 477, 478 proteome, xvi, 38, 333, 337, 338, 348, 349, 357, 364, 366, 368, 369, 370, 371 proteomics, 355, 364, 365, 366, 367, 368, 369, 370 proto-oncogene, 230 pseudogene, 354 Pseudomonas aeruginosa, 352 PTFE, 335 public health, 298 publishing, 165 Puerto Rico, 6 pulp, xiii, 177, 178, 182, 189, 219, 404 pure water, 337 purification, 162, 167, 175, 195, 207, 312, 317, 318, 321, 322, 328, 329, 401, 427, 428 purity, 184, 190, 196, 205, 206, 220, 321, 331 PVP, 357 pyrimidine, 234

503

pyrolytic graphite, 460

Q qualitative differences, 127 quality control, 463 quality improvement, ix, 2 quinone, 211, 236

R race, 455 radiation, 159, 237, 271, 283, 284, 285, 287, 289, 298, 357 radical formation, 229, 287 radical mechanism, 175 radical reactions, xv, 273, 280 radicals, 47, 170, 172, 173, 199, 206, 207, 211, 237, 277, 278, 287 radicle, 239 radioactive isotopes, 360 rainfall, 25 Raman spectroscopy, 183 rancid, 23 rating scale, 58 raw materials, 200 reaction mechanism, 175, 204 reaction medium, 164, 173, 174, 176, 210, 461 reaction rate, 160, 169, 171, 172, 173, 174 reaction time, 172, 176 reactions, 30, 66, 141, 156, 160, 164, 170, 192, 194, 208, 274, 275, 276, 316, 317, 318, 325, 449, 451, 461, 484 reactive oxygen, xiii, xv, 223, 236, 273, 287, 288, 451 reactive sites, 355 reactivity, 11, 144, 203, 234, 326 reagents, 166, 200, 325, 326, 357, 358, 360 real time, 338 reality, 67, 305 receptors, 85, 130, 135, 150, 225, 226, 229, 231, 234, 455, 477 recessive allele, 6, 28 recognition, 349, 453 recombination, 45, 68, 293 recommendations, 40, 50, 255, 330, 360, 399, 419, 426 recurrence, 469 recycling, xii, 155, 159 red blood cells, 54 refraction index, 393 refractive index, 337

504

Index

regenerated cellulose, 407 regeneration, xv, 67, 68, 168, 283, 291, 295, 299, 303, 305, 307, 316 Registry, 178 regression, 4, 130, 144, 234 regulatory requirements, 426 rehydration, 360 relative prices, 474 relaxation, 195 relevance, 247, 276, 299 renin, 404, 414 repair, 132, 241 reparation, 200 replication, 225, 448 reporter genes, 293 repression, 14, 345, 351 reproduction, 144, 147 requirements, xix, 20, 49, 50, 58, 59, 69, 397, 417, 428, 450 researchers, 7, 8, 10, 46, 47, 54, 164, 316, 364, 379, 380, 399 reserves, 238, 480 residues, 61, 80, 104, 105, 107, 135, 191, 192, 193, 195, 196, 198, 202, 204, 231, 232, 344, 354, 391, 458, 474 resins, x, xii, xiii, 44, 155, 157, 158, 162, 189, 200, 210 resistance, xv, xx, 23, 25, 28, 37, 67, 69, 126, 144, 148, 234, 235, 260, 261, 263, 268, 279, 286, 292, 293, 294, 295, 299, 301, 302, 303, 305, 307, 351, 420, 447, 448, 452, 454, 478 resolution, 356, 358, 360, 366, 368 resources, 35, 126, 292, 305 respiration, xiv, 259, 273, 274, 276, 285 retail, 48, 49, 70 retardation, 302 retinol, 437 rhamnolipid, 209 riboflavin, 45 ribose, 454 ribosomal RNA, 339 ribosome, 343 rice field, 440, 445 rice husk, 440 rings, 191, 224 risk assessment, 178 risk factors, 380, 467 risks, xvii, 40, 49, 73, 297, 389, 400, 418 RNA, 30, 61, 130, 234, 338, 339, 462 room temperature, 163, 277, 281, 359 rotations, 35, 269 rubber, 158, 200 rubber compounds, 200

S salinity, 149, 199, 348, 351 salmon, xi, 93, 102, 125, 128, 130, 131, 132, 135, 136, 138, 139, 140, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152 salts, 38, 64, 131, 140, 153, 168, 228 saltwater, 202 saponin, 65, 101, 104, 142, 148, 151, 152, 226, 227, 239, 245, 247 saponins, xii, xiii, 46, 47, 56, 62, 64, 65, 72, 75, 76, 117, 126, 133, 135, 136, 142, 143, 146, 147, 148, 149, 223, 224, 226, 227, 239, 240, 241, 243, 244, 246, 384, 470 saturated fat, xvii, 2, 6, 16, 19, 26, 27, 28, 29, 45, 50, 56, 84, 117, 373, 374, 378, 380, 384, 385, 386, 387 saturated fatty acids, 2, 16, 26, 27, 28, 45, 50 saturation, 383, 392 scaling, 166 scanning electron microscopy, 483 scavengers, 236 secretion, 134, 146, 378, 385, 387 sedimentation, xvii, 199, 211, 353, 354, 468 seeding, 25, 269 seedling development, 275, 281, 283 seedlings, xv, 2, 25, 268, 269, 275, 282, 291, 301, 365, 433, 438 segregation, 29, 78, 300, 301, 303 selectable marker genes, 293, 295 selectivity, 180 semi-permeable membrane, 334, 339 senescence, 275, 279, 283, 287, 370 sensing, 274, 349, 350 sensitivity, 27, 36, 138, 149, 195, 260, 271, 276, 368, 387, 458, 459, 460, 461, 462 sensitization, 141, 364 sensors, 17, 458, 459, 460 sepsis, xix, 382, 417, 418 sequencing, 338, 341, 351, 361, 366 serine, 75, 130, 191, 230, 413, 477 serum, xix, 46, 51, 53, 71, 76, 117, 118, 121, 122, 227, 313, 314, 338, 376, 377, 381, 382, 391, 396, 404, 413, 417, 418, 482, 483, 486 serum albumin, 51, 338 serum ferritin, 71 sex, 133, 149, 152 sex steroid, 149, 152 sheep, 390, 391, 418 shelf life, 374, 380 shoot, xiv, xv, 18, 67, 252, 253, 254, 258, 272, 291 shortening, x, 44, 130, 131, 299, 468, 477

Index signal transduction, xiii, 223, 224, 229, 234, 350, 453 signaling pathway, 225, 231, 345, 452 signalling, 279, 288 signals, 230, 275, 277, 288, 487 signs, 133, 143, 146 silane, 165 silica, 165, 166, 209, 317, 318, 320, 321, 323, 327, 331, 459 silk, 107 silver, 360, 371 simulation, 277 simulations, 215 sinusitis, xix, 417, 418 siphon, 320 skin, xiii, 111, 157, 158, 189, 201, 232, 237, 248, 469 skin cancer, 248 sludge, 179, 190, 199, 331 small intestine, 69, 139, 235, 479, 481, 482, 487 SNP, 451, 452 sodium, 50, 87, 94, 95, 138, 140, 164, 175, 196, 197, 209, 211, 212, 217, 218, 323, 338, 356, 406, 422, 451 sodium dodecyl sulfate (SDS), 209, 211, 338, 356 sodium hydroxide, 87, 323 software, 191, 192, 193, 338, 361 sol-gel, 168, 184, 209, 220, 459 solid matrix, 226 solid phase, 325, 327 solid waste, 163 solidification, 103, 108 solubility, 62, 65, 70, 117, 118, 123, 157, 161, 199, 211, 314, 318, 358, 468, 474, 475, 487 solvents, 158, 201, 322 sorption, 263 Southeast Asia, 86 Southern blot, 68, 300 soy bean, 74 soy-based formula, 11, 51, 54, 58 soybean meal, x, xi, xii, xvii, xix, 11, 44, 58, 64, 69, 73, 75, 78, 125, 126, 127, 128, 129, 130, 131, 132, 133, 135, 136, 137, 138, 139, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 389, 394, 417, 419, 422, 423, 424, 425, 426, 468, 476, 478, 480, 482, 483, 484, 485, 486, 487, 488 soymilk, ix, xviii, 2, 8, 12, 13, 35, 37, 43, 64, 65, 80, 85, 103, 104, 105, 107, 108, 111, 120, 403, 404, 412, 468 Spain, 155, 403, 405, 427 species, xi, xiii, xv, 20, 44, 45, 60, 63, 67, 92, 102, 103, 125, 126, 127, 128, 129, 133, 138, 139, 142, 143, 144, 161, 169, 171, 174, 183, 211, 223, 230,

505

236, 239, 259, 261, 263, 266, 268, 269, 271, 273, 274, 275, 277, 279, 283, 285, 287, 288, 292, 293, 294, 295, 296, 300, 303, 350, 351, 352, 356, 368, 390, 399, 430, 450, 451, 452, 455, 462, 463, 476 specifications, 61 spectrophotometry, 458 speculation, xvi, 333 sperm, 137 spin, 183, 194, 277, 287 spore, xvii, 114, 333, 335, 337, 340, 341, 342, 343, 351 Sprague-Dawley rats, 378 sprouting, x, 43 stabilization, 338 standard deviation, 361, 407, 410, 460 standardization, 339, 370 starch, 2, 50, 51, 82, 89, 98, 99, 127, 138, 139, 143, 148, 321, 478, 479 starch polysaccharides, 138, 139, 148 stars, 424 starvation, 345, 348, 350, 440 states, xv, 20, 22, 220, 277, 292, 295, 375 statistics, 111, 361 steel, 107, 157, 335 sterile, 299, 335, 336, 463 steroids, 118, 137 sterols, 312, 315, 328, 329, 330, 331, 332, 374, 377 stimulus, 385 stoichiometry, 170, 204 stomach, 51, 61, 102, 139, 469, 480, 481 storage, xv, xvii, xx, 2, 12, 13, 14, 21, 22, 31, 33, 34, 37, 39, 46, 61, 63, 69, 81, 82, 83, 111, 140, 199, 202, 238, 273, 274, 281, 283, 284, 286, 287, 353, 354, 358, 363, 364, 365, 366, 367, 368, 408, 467, 468, 470, 478 stress factors, 69, 133, 293 stroke, 404 stroma, 130 structural characteristics, 190 structural protein, 132, 367, 402 subacute, 130 submucosa, 130, 135 substitutes, 103 substitution, 40, 144, 152, 488 substitutions, 50 substrates, 158, 164, 165, 168, 170, 172, 173, 194, 196, 198, 199, 201, 202, 209, 211, 230, 260, 286, 450, 458, 460, 461, 481 subtraction, 361 sucrose, x, xix, 2, 8, 9, 10, 44, 46, 84, 139, 359, 406, 429, 442, 467, 478 sugar beet, 269 suicide, 185, 214

506

Index

sulfate, 13, 14, 34, 63, 105, 196, 211, 212, 215, 357, 359, 360, 361 sulfur, xi, xxi, 11, 12, 13, 14, 33, 35, 37, 39, 45, 50, 58, 79, 81, 82, 195, 234, 274, 473, 476 sulfuric acid, 393 suppliers, 395, 399 supply chain, 217 suppression, 71, 73, 231, 241, 249, 260, 262, 293, 477 surface area, 166, 211 surface tension, 336 surfactant, 175, 209, 211, 218 surveillance, 426 survival, 10, 229, 243, 284, 471 susceptibility, xi, 67, 126, 127, 234, 258, 259, 261, 262, 303, 450 suspensions, xviii, 288, 289, 299, 337, 389, 451, 453 sustainability, 126, 127, 253, 272 Sweden, 286, 338 Switzerland, 220 SWNTs, 209 symbiosis, xiv, 251, 262, 270 symptoms, 17, 20, 21, 22, 56, 85, 109, 224, 260, 448, 478 syndrome, 20, 119, 122, 258, 266, 270, 418, 482 synthesis, 12, 31, 58, 70, 118, 162, 200, 215, 225, 229, 233, 234, 235, 238, 274, 282, 289, 315, 339, 344, 345, 349, 350, 351, 392, 449, 455 synthetic fiber, 200 systemic immune response, 478

T T cell, 130, 142, 375 tactics, xiv, 252 Taiwan, 309, 328, 431, 444 talc, 180 tamoxifen, 379, 381 tannins, 58 tar, 157, 211, 214 target, 26, 46, 67, 69, 199, 235, 242, 246, 248, 293, 294, 295, 296, 298, 384, 463 target population, 384 TBP, 357 technical assistance, 400 technologies, 355, 442 technology, xix, 28, 31, 67, 253, 297, 356, 360, 366, 429, 444, 464 temperature, xii, xx, 3, 4, 5, 6, 7, 8, 9, 15, 17, 20, 21, 22, 23, 25, 27, 29, 32, 34, 35, 38, 40, 41, 42, 46, 94, 98, 99, 105, 107, 110, 111, 113, 156, 157, 160, 161, 163, 166, 177, 193, 194, 199, 220, 246, 277, 318, 320, 321, 322, 323, 325, 327, 337, 338,

393, 395, 406, 436, 437, 438, 443, 455, 457, 458, 464, 475 testing, 27, 28, 35, 67, 180, 214, 295, 377, 427 testosterone, 137 tetanus, 399, 400 Tetanus, 402 textile, xiii, 157, 158, 182, 189, 219 textiles, 158 texture, x, 44, 103, 107, 108, 111, 124, 436 TGF, 149, 225, 249 Thailand, 80, 431 therapeutic agents, 231 therapeutic targets, 241 therapeutics, 247 therapy, 242, 246, 248, 379, 380, 387, 462 thermal stability, 163, 183, 190, 195, 207, 218 thermostability, 156, 162, 190, 195, 459 thiamin, 45 thinning, 380 threonine, 50, 413, 476 threshold level, 76 thyroid, 140, 141 TIMP, 227, 245 tissue, 14, 18, 19, 23, 57, 67, 68, 73, 130, 135, 137, 140, 142, 143, 147, 148, 151, 190, 227, 236, 254, 259, 281, 293, 294, 300, 303, 304, 305, 306, 307, 358, 359, 370, 382, 406 tobacco, 275, 284, 288, 289, 295, 366, 452, 454 tocopherols, xiii, xvi, 223, 309, 310, 311, 312, 317, 318, 320, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 374, 381 tofu, ix, 2, 8, 11, 12, 13, 31, 35, 37, 38, 43, 47, 55, 62, 65, 66, 92, 93, 103, 104, 107, 108, 109, 110, 111, 117, 122, 233, 334, 369, 404, 413, 430, 468, 470 toluene, 158, 202, 213 total cholesterol, 117, 376 total parenteral nutrition, 384, 385 total product, 86, 87 toxic effect, 156, 298, 462 toxicity, xii, xiv, xv, 155, 157, 159, 162, 177, 201, 251, 262, 273, 283, 287, 297, 307, 349, 458 toxin, 296, 303, 304 traits, xv, 2, 3, 4, 6, 8, 11, 13, 28, 29, 36, 38, 41, 45, 67, 69, 263, 292, 295, 300, 301, 302, 303 transcription, 13, 147, 225, 344, 345, 346, 349, 451, 453 transcription factors, 225 transcripts, 30, 285, 451 transduction, 350 transesterification, xvi, 309, 310, 317, 327 transfection, 233

Index transformation, xv, 67, 68, 75, 169, 218, 232, 233, 240, 245, 260, 261, 291, 293, 294, 295, 296, 299, 300, 303, 304, 305, 306, 307, 311 transformations, 177, 203, 258 transforming growth factor, 225 transgene, xvi, 292, 300, 301, 302, 303, 305, 307 translocation, xvi, 267, 271, 297, 333, 343 transmission, xvii, 227, 300, 301, 389, 418, 428 transmission electron microscopy, 227 transpiration, 254 transport, xv, 18, 32, 127, 132, 135, 136, 149, 167, 256, 260, 267, 273, 274, 275, 281, 284, 286, 287, 288, 459 transportation, xix, 429 trauma, 382 treatment methods, 199 trial, 118, 129, 142, 230, 469, 471 trifluoroacetic acid, 361 triggers, 303 triglycerides, 117, 238, 376 trisomy, 299 trypsin, xvii, 11, 35, 44, 46, 58, 61, 62, 63, 73, 74, 76, 92, 101, 117, 130, 132, 133, 134, 135, 140, 141, 143, 145, 148, 149, 150, 153, 190, 217, 229, 231, 239, 241, 245, 353, 354, 361, 362, 365, 366, 368, 370, 468, 474, 477, 481, 483, 488 tryptic fragments, xvii, 353, 361 tryptophan, 50, 69, 191, 413, 458, 476 tumor, xiii, 47, 71, 73, 109, 223, 224, 226, 227, 229, 230, 231, 232, 233, 234, 235, 236, 241, 243, 244, 245, 246, 247, 248, 249 tumorigenesis, 227, 385 tungsten, 293 Turkey, 30 turnover, 51, 132, 194, 288, 469 type 2 diabetes, 376, 378, 383, 384, 386 tyrosine, 50, 225, 233, 413

U ultrastructure, 42, 267, 270 United Kingdom (UK), 152, 243, 246, 361, 390, 400, 402 United Nations, xi, 125 urea, 14, 69, 234, 337, 338, 357, 358, 359, 360, 442, 443, 444 urinary bladder, 201 urine, 227, 469 urokinase, 231, 245 urticaria, 201 Uruguay, 379, 382 USDA, 1, 13, 35, 46, 50, 78, 292, 304, 353, 467

507

UV, 159, 178, 231, 237, 245, 247, 283, 284, 287, 289, 357, 382, 393, 422, 458

V vaccine, xix, 145, 146, 391, 392, 394, 399, 400, 401, 417, 418, 419, 423, 424, 425, 426, 427, 428 vacuole, 131, 274 vacuum, 159, 316, 359, 361 valine, 50, 69, 233, 413, 476 vapor, 325 variables, 4, 23, 298, 391, 475 variations, 38, 66, 450 varieties, xiii, xix, xx, 12, 13, 17, 27, 28, 29, 63, 66, 73, 151, 226, 251, 253, 262, 354, 368, 374, 429, 430, 436, 447, 448, 470 vasoconstriction, 376 vasodilation, 376 vegetable oil, x, xvi, 29, 44, 309, 310, 316, 322, 328, 329, 330, 332, 373, 376, 379, 380, 384 vegetables, x, 47, 60, 79, 80, 85, 92, 93, 100, 102, 103, 105, 107, 110, 224, 246, 404, 436, 437, 440, 469 Vegetables, 92, 102 vegetation, 452 velocity, 327, 459 vertebrae, 147, 297 vesicle, 460 Vietnam, 80 viruses, 21, 231 viscosity, 70, 468 visualization, 325, 348, 371 vitamin A, xix, 429 vitamin B1, xxi, 91, 473 vitamin B12, xxi, 473 vitamin B2, 101 vitamin C, 54, 91, 101, 359 vitamin E, xvii, 100, 311, 329, 331, 373, 374, 377, 383, 384, 386 vitamin K, 351, 374, 380 vitamins, xi, 46, 49, 50, 59, 79, 80, 81, 84, 467 volatilization, 212 vulcanization, 158

W Washington, 74, 77, 78, 331 waste, xiii, 69, 119, 163, 164, 179, 181, 189, 204, 213, 215, 217, 218, 334 wastewater, xii, xiii, 155, 156, 157, 158, 160, 161, 162, 163, 164, 168, 175, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 189, 190, 199, 200,

508

Index

202, 204, 205, 210, 211, 213, 214, 215, 217, 218, 219, 220 water, xiii, 10, 12, 16, 17, 20, 35, 36, 62, 65, 66, 70, 82, 89, 90, 92, 95, 98, 99, 100, 103, 104, 105, 106, 107, 110, 111, 113, 114, 117, 136, 138, 157, 158, 164, 178, 182, 183, 184, 189, 195, 197, 198, 201, 204, 211, 214, 218, 220, 238, 259, 277, 281, 283, 290, 298, 317, 322, 335, 346, 362, 374, 387, 393, 406, 430, 436, 438, 463, 468 weight gain, 51, 53, 56, 73, 128, 129 weight reduction, 62 welfare, xii, 126 Western blot, 238, 360 Western countries, 404 Wisconsin, 86 withdrawal, 130

X xenografts, 226, 247

xylem, 368, 441, 442

Y yeast, 90, 95, 98, 99, 191, 335, 391, 392, 419, 420, 423, 455 Yellow River Valley, 44 yield, ix, x, xiv, xvi, xviii, 1, 3, 7, 11, 16, 17, 21, 22, 25, 26, 27, 28, 34, 36, 38, 40, 42, 44, 51, 53, 67, 81, 252, 264, 265, 272, 292, 298, 299, 302, 303, 320, 329, 390, 393, 397, 398, 399, 424, 425, 431, 432, 438, 441, 442, 443, 444, 445, 448

Z zinc, 25, 36, 45, 53, 64, 71, 73, 74, 76, 77, 269, 478, 480, 483, 484, 485, 487