CONTRIBUTORS
Numbers in parentheses indicate the pages on which the authors' contributions begin.
Hidetoshi Arakawa (...
13 downloads
470 Views
33MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
CONTRIBUTORS
Numbers in parentheses indicate the pages on which the authors' contributions begin.
Hidetoshi Arakawa (185), School of Pharmaceutical Sciences, Showa Uni-
versity, Tokyo 142, Hatanodai, Shinagawa-ku, Japan Lyle J. Arnold, Jr. (391), Genta, Inc., San Diego, California 92121 Patrick Balaguer (237), INSERM Unit6 58, F-34100 Montpellier, France Alain Baret (261), Laboratoire d'Analysis Mrdicales, Centre de Biologie Mrdicale, F-44007 Nantes, France H. Berna Beverioo ~ (285), Department of Cytochemistry and Cytometry, State University of Leiden, 2300 RA Leiden, The Netherlands Anne-Marie Boussioux (237), INSERM Unit6 58, F-34100 Montepellier, France Irena Bronstein (145,493), TROPIX, Inc., Bedford, Massachusetts 01730 Theodore K. Christopoulos (377), Division of Clinical Chemistry, Department of Chemistry and Biochemistry, University of Windsor, Windsor, Ontario, Canada N9B 3P4 Patrik Dahlrn (331), Wallac Oy, FIN-20101 Turku, Finland Eleftherios P. Diamandis (377), Department of Clinical Biochemistry, Mount Sinai Hospital, and Department of Clinical Biochemistry, University of Toronto, Toronto, Ontario, Canada M5G 1X5 fan Durrant (195), Research and Development, Amersham Laboratories, Amersham International, Amersham, Buckinghamshire HP7911, United Kingdom Parke K. Flick (475), United States Biochemical Corporation Research Center, Amersham Life Sciences, Inc., Cleveland, Ohio 44128 Reinhard Erich Geiger (131), BioAss, D-86911 Giessen, Germany Eva F. Gudgin Dickson (113), Department of Chemistry and Chemical Engineering, Royal Military College of Canada, Kingston, Ontario, Canada K7K 5L0 Pertti Hurskainen (331), Wallac Oy, FIN-20101 Turku, Finland I Present Address: Departmentof Cell Biologyand Genetics, Erasmus University, 3000 DR, Rotterdam, The Netherlands xi
xii
Contributors
Antti litia (331), Department of Biotechnology, University of Turku, FIN20520 Turku, Finland Elena D. Katz (271), Perkin-Elmer Corporation, Norwalk, Connecticut 06859 Christoph Kessler (41), Biochemical Research Center, Department of Advanced Diagnostics, D-82377 Pensberg, Germany Larry J. Kricka (3), Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 Evelyne Lopez (307), CIS Bio International, F-30205 Bagnols sur C/~ze, France Thno Lrvgren (331), Department of Biotechnology, University of Turku, FIN-20520 Turku, Finland Masako Maeda (185), School of Pharmaceutical Sciences, Showa University, Tokyo 142, Hatanodai, Shinagawa-ku, Japan Chris S. Martin (145,493), TROPIX, Inc., Bedford, Massachusetts 01730 Grrard Mathis (307), CIS Bio International, F-30205 Bagnols sur C~ze, France Werner Miska (131), University of Giessen, D-6300 Giessen, Germany Larry E. Morrison (429), Vysis, Incorporated, Downers Grove, Illinois 60515 Owen J. Murphy (145), TROPIX, Inc., Bedford, Massachusetts 01730 Norman C. Nelson (391), Gen-Probe, Inc., San Diego, California 92121 Quan Nguyen (145), Genetic Systems Division, Bio-Rad Laboratories, Hercules, California 94547 Jean-Claude Nicolas (237), INSERM Unit6 58, F-34100 Montepellier, France Alfred Pollak (113), Allelix Biopharmaceuticals, Mississauga, Ontario, Canada L4V 1P1 Odette Prat (307), CIS Bio International, F-30205 Bagnols sur C/~ze, France Ayoub Rashtchian (165), Molecular Biology Research and Development, Life Technologies, Inc., Gaithersburg, Maryland 20877 Mark A. Reynolds (391), Genta, Inc., San Diego, California 92121 B~atrice Trrouanne (237), INSERM Unit6 58, F-34100 Montpellier, France Akio Tsuji (185), School of Pharmaceutical Sciences, Shown University, Tokyo 142, Hatanodai, Shinagawa-ku, Japan Annette Tumolo (145), Genetic Systems Division, Bio-Rad Laboratories, Hercules, California 94547 Peter C. Verlander z (217), Department of Investigative Dermatology, Rockefeller University, New York, New York 10021 2 Present Address: E N Z O Biochem, Syosset, New York 11791
Contributors
Xlll
Marie Agn/~s Villebrun (237), INSERM Unit6 58, F-34100 Montpellier,
France John C. Voyta (145), TROPIX, Inc., Bedford, Massachusetts 01730 John M. Wages (271), Genelabs Technologies, Redwood City, California 94063 Frank Witney (145), Genetic Systems Division, Bio-Rad Laboratories, Hercules, California 94547 Hector E. Wong (113), Department of Chemistry, University of Toronto, Toronto, Ontario, Canada M5S 1A1
PREFACE TO THE FIRST EDITION
Numerous nonisotopic methods have now been developed as replacements for radioactive labels such as phosphorus-32 and iodine- 125 in DNA probe hybridization assays. Most have been developed within the last five years; the range of nonisotopic methods is now so extensive that it is difficult to determine the relative merits and demerits for particular applications. The objective of this book is to bring together descriptions of the principal nonisotopic methods for DNA hybridization assays, together with experimental details of the methods, including labeling and detection of the label. This book contains descriptions of bioluminescent, chemiluminescent, fluorescent, and time-resolved fluorescent detection methods. It covers the following combinations of label and detection reaction: acridinium esters/chemiluminescence; alkaline phosphatase/bioluminescence, colorimetry, chemiluminescence, time-resolved fluorescence; lanthanide chelates/time-resolved fluorescence; glucose-6-phosphate dehydrogenase/bioluminescence; fluorescence/fluorescence; and horseradish peroxidase/enhanced chemiluminescence/colorimetry. Non-separation DNA probe assay strategies based on selective hydrolysis of acridinium esters and energy transfer involving pairs of probes, one labeled with a chemiluminescent molecule and the other labeled with a fluorophore, are also presented. Each chapter has been prepared by the inventor or developer of a particular nonisotopic method and thus provides an expert account of the method. Practical details for a range of applications are presented in step-by-step experimental procedures that provide a valuable source of authoritative information. This book is intended to give research workers and assay developers a single source of information on nonisotopic procedures for DNA hybridization based assays. Larry J. Kricka
PREFACE TO THE SECOND EDITION
Nonisotopic detection methods are an important component of many protein and nucleic acid assay procedures and are slowly replacing the traditional detection methods based on iodine-125 and phosphorus-32. The trend toward nonisotopic methods is being driven by two major factors: the improved sensitivity and analytical convenience (e.g., quick and simple nonseparation assays) of nonisotopic methods and the burdensome regulations that govern the handling and disposal of radioactive materials. The objective of this book is to provide a unified source of information on the principles and practice of nonisotopic detection methods for protein and nucleic acid blotting, and nucleic acid hybridization and sequencing. This new edition of Nonisotopic DNA Probe Techniques has been enlarged and expanded to cover both protein and nucleic acid blotting techniques (Western, Southern, and Northern blotting) and DNA sequencing by nonisotopic methods. The chapters have been revised to include new developments in both nucleic acid and protein applications. New chapters have been added on the application of xanthine oxide, ruthenium tris(bipyridyl), phosphor and europium cryptate labels, new chemiluminescent alkaline phosphatase substrates, and DNA sequencing. Each chapter has been prepared by the inventor or developer of a particular nonisotopic method in order to provide an expert account of the method. Step-by-step protocols and procedures are included in most chapters to facilitate the transfer of these methods into other laboratories. This new edition is intended as a single and authoritative source of information on nonisotopic methods for students, research workers, and assay developers. Larry J. Kricka
xv||
Labels, Labeling, Analytical Strategies, and Applications Larry J. Kricka Department of Pathology and Laboratory Medicine University of Pennsylvania Philadelphia, Pennsylvania 19104
I. Introduction II. Nucleic Acid Hybridization and Blotting A. Labels B. Labeling Procedures C. Detection of Labels and Nucleic Acid Hybridization Assay Sensitivity 1. DetectionTechniques 2. Detectionof Nonisotopic Labels 3. AnalyticalStrategies III. Protein Blotting IV. Patents V. Conclusions References
I. INTRODUCTION Nucleic acid hybridization tests for the detection of specific DNA and RNA sequences and protein blotting assays are now extensively used in research and routine laboratories (Diamandis, 1990; Leary and Ruth, 1989; Matthews and Kricka, 1988; Pollard-Knight, 1991; Rapley and Walker, 1993; Wenham, 1992). These assays have diverse applications in medicine and forensics, and some representative examples of these applications are listed in Table I. Labeled nucleic acid probes are utilized in a variety of assay formats including dot blots, Southern blots (Southern, 1975), Northern blot (Alwine et al., 1977), in situ hybridization, plaque hybridization, and colony hybridization. Western blotting (Burnette, 1981) has become the most prevalent type of protein blotting assay procedure (Table II). An important aspect of these assays is the choice of the substance used to label an assay component and the label detection method. As yet there is no consensus on which substance is the ideal label for detecting Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
4
Larry J. Kricka
Table !
Applications of Probing and Blotting Assays Application Nucleic Acids Arteriosclerosis Cell line authentication Forensics Blood stains Inherited disorders t~l-Antitrypsin deficiency
Becker muscular dystrophy Congenital adrenal hyperplasia Cystic fibrosis Duchenne muscular dystrophy Fragile X syndrome Phenylketonuria Sickle cell anemia Thalassemia Microbiology Chlamydia trachomatis Clostridium dificile E. coli Legionella Listeria m o n o c y t o g e n e s Mycoplasma pneumoniae Neisseria gonorrhoeae
Oncology B C R / a b l gene rearrangement
(chronic myelogenous leukemia) Bladder cancer B/T cell gene rearrangement (lymphoproliferative disease) Gastrointestinal cancer N e u oncogene Papillomavirus (cervical cancer) Parasitology Plasmodium faliciparum
Paternity testing Transplantation HLA typing Virology Cytomegalovirus HBV HCV
Reference Williams (1985) Thacker et al. (1988) Budowle et al. (1990); Cawood (1989); Thornton (1989) Gill et al. (1985) Dawson (1990); Ropers (1987) Andresen et al. (1992); Kalsheker ( 1993); Storstein et al. (1992) Prior (1993) Strachan et al. (1987) Kerem et al. (1989); Riordan et al. (1989) Kunkel et al. (1989) Fujimura (1992) DiLella et al. (1986); Woo et al. (1983) Saiki et al. (1985) Old (1993)
Buck (1989); McGowan (1989); Wolfe (1988) Carpenter et al. (1993) Wren et al. (1990) Miller et al. (1988) Wilkinson et al. (1986) Emond et al. (1993) Dular et al. (1988) Sanchez-Pescador et al. (1988) Knudson (1986) Crisan (1993) Pinkel (1993) Sidransky (1993) Knowles et al. (1987) Chen et al. (1993) Slamon et al. (1987) Carr (1993) McLaughlin et al. (1993) Odelberg et al. (1988) Erlich et al. (1986) Landry (1990) Spector and Spector (1985) Akar et al. (1992) Urdea (1993) (continues)
I. Analytical Strategies and Applications
5
Table ! (Continued)
Reference
Application HIV
Devlin et al. (1993); Findlay (1993); Findlay et al. (1993); Malek et al. (1992); Rapier et al. (1993); Urdea (1993) Flores et al. (1983)
Rotavirus Proteins Inherited disorders Muscular dystrophy (dystrophin) Oncology ras proto-oncogene protein p21 Parasitology
Chamberlain (1993) Jones et al. (1991) Smith and Campbell (1991)
Giardia intestinalis
Toxicology Isometamidium-binding proteins Virology HIV-1 (specific antibodies)
Smith et al. (1991b) Centers for Disease Control (1989)
either nucleic acids or proteins in the various assay formats. The first assays used a radioactive phosphorus-32 label. However, this label has the major disadvantage of a relatively short half-life (14.2 day) (cf. iodine125 used in immunoassay has a half-life of 60 day). Thus nucleic acid hybridization probes have a very short shelf-life. This has placed severe limitations on the routine use and commercialization of probe tests; hence, there are extensive efforts to develop and implement alternatives to the radioactive phosphorus-32 label. Many different substances have been
Table II
Probing and Blotting Assay Procedures Blotting procedures
Sample
Labeled detection reagent
Colony Dot Eastern Northern North-Western Southern Western South-Western
bacteria (nucleic acid or protein) nucleic acid or protein protein a RNA protein DNA Protein protein
nucleic acid or antibody nucleic acid or antibody antibody RNA RNA DNA antibody DNA
a Separated on an isoelectric focusing gel.
6
LarryJ. Kricka
tested as nonisotopic replacements for phosphorus-32, and subsequent chapters of this book provide background and practical details of the application of various nonisotopic labels.
II. N U C L E I C A C I D H Y B R I D I Z A T I O N
AND BLOITING A. Labels The majority of the substances used as labels for nucleic acids have been tested previously in immunoassay. Nonisotopic labels have been the focus of development because of the limitations of radioactive labels such as phosphorus-32 (Kricka, 1985). These limitations are principally (1) a short half-life that restricts the shelf life of labeled probes and hence hybridization assay kits, (2) possible health hazards during preparation and use of the labeled nucleic acid, and (3) disposal of radioactive waste from the assay. The ideal label for a nucleic acid hybridization probe would have the following properties. 1. Easy to attach to a nucleic acid using a simple and reproducible labeling procedure; 2. Stable under nucleic acid hybridization conditions, typically temperatures up to 80~ and exposure to solutions containing detergents and solvents such as formamide; 3. Detectable at very low concentrations using a simple analytical procedure and noncomplex instrumentation; 4. Nonobstructive on the nucleic acid hybridization reaction; 5. Applicable to solution or solid-phase hybridizations. In a solid-phase application, e.g., membrane-based assay, the label must produce a longlived signal (e.g., enzyme label detected chemiluminescently or by timeresolved fluorescence); 6. Nondestructive. The label must be easy to remove for successive reprobing of membranes. Generally, reprobing is not problematic for phosphorus-32 labels, but it is less straightforward for some nonisotopic labels (e.g., insoluble diformazan product of 5-bromo-4-chloro-3-indolylphosphate (BICP)-nitroblue tetrazolium (NBT)-alkaline phosphatase reaction has to be removed from a membrane with hot formamide); 7. Adaptable to nonseparation (homogenous) formats. Hybridization of labeled DNA probe to its complementary DNA sequence should modulate a property of the label so that it is detectable and distinguishable from unhybridized probe;
I. Analytical Strategies and Applications
7
8. Stable during storage, providing longer shelf-life for commercial hybridization assay kits; and 9. Compatible with automated analysis. Widespread and large-scale applications of hybridization assays will lead to the need for automated analyzers. The label and the assay for the label must be compatible with a high throughput analyzer (rapid detection using the minimum number of reagents and analytical steps). None of the labels listed in Table III fulfills all of these criteria and, just as in the case of immunoassays, there is still no agreement on the most appropriate nonisotopic label. Enzymes, such as horseradish peroxidase and alkaline phosphatase, have become particularly popular in recent years as a range of sensitive detection methods has evolved. Alkaline phosphatase, for example, can be detected using chemiluminescent, bioluminescent, and time-resolved fluorescent methods.
B. Labeling Procedures Detection of probe:nucleic acid target hybrids can be accomplished by direct or indirect labeling methods. In the former case, a label is attached directly to the nucleic acid by a covalent bond, or the label intercalates noncovalently between the double strand of the probe : nucleic acid target complex. The latter method, indirect labeling, employs a hapten such as biotin (Wilchek and Bayer, 1990) or phosphotyrosine (Misiura et al., 1990) attached to the nucleic acid probe. The hapten is detected using a labeled specific binding protein (e.g., antibiotin, avidin, or streptavidin) (Table IV). A slightly more complex format uses an intermediate binding protein to bridge between the hapten and the labeled binding protein (Table V). Alternatively, a binding protein specific for double-stranded DNA can be used (e.g., monoclonal anti-dsDNA), and complexes are then detected using a labeled antispecies antibody (Mantero et al., 1991). More complex indirect procedures have been developed to improve assay sensitivity (Wilchek and Bayer, 1990). In one design, a biotin-labeled probe is hybridized to the target DNA, followed by reaction of the biotinylated probe with streptavidin. The remaining binding sites on tetravalent streptavidin are then reacted with a biotinylated poly(alkaline phosphatase) to obtain a cluster of alkaline phosphatase labels around the bound biotinylated probe (Leary et al., 1983). Procedures for the direct labeling of a nucleic acid probe with a hapten or a direct label can be categorized into chemical, enzymatic, and synthetic procedures (Keller and Manak, 1989; Leary and Ruth, 1989; Matthews
8
Larry J. Kricka Table 111
Direct Labels for Nucleic Acid Hybridization Assays Chemiluminescent compounds Acridinium ester Isoluminol Luminol Electrochemiluminescent compounds Ruthenium tris(bipyridyl) Enzymes Alkaline phosphatase Bacterial luciferase Firefly iuciferase Glucose oxidase Glucose-6-phosphate dehydrogenase Hexokinase Horseradish peroxidase Microperoxidase Papain Renilla luciferase Enzyme inhibitors Phosphonic acid Fluorescent compounds Bimane Ethidium Europium(Ill) cryptate Fluorescein La Jolla Blue Methylcoumarin Nitrobenzofuran Pyrene butyrate Rhodamine Terbium chelate Tetramethylrhodamine Texas Red Metal complexes 1,4-Diaminoethane platinum complex Miscellaneous Latex particle PolyAMP Pyrene Phosphors Yttriumoxisulfide (+ europium) Zinc silicate (+ arsenic and manganese) Photoproteins Aequorin Radioluminescent Iodine- 125 Phosphorus-32 Sulfur-35 Tritium
Table IV
Indirect Labels for Nucleic Acid Hybridization Assays Hapten
Binding protein
Biotin
Antibiotin Avidin
Streptavidin Digoxigenin Ethidium Glucosyl
Antidigoxigenin Antiethidium-DNA Concanavilin A
IgG IgG, Fab fragment Lac operon DNA Poly(dA) Poly(dT) Protein A Protein G Sulfone
Antispecies IgG Antispecies IgG Lac repressor protein Poly(dT)-DNA Poly(dA)-DNA IgG IgG Antisulfone Anti-RNA : DNA hybrid Histone
Label Gold colloid Alkaline phosphatase /3-Galactosidase Ferritin Fluorescein Horseradish peroxidase /3-Galactosidase b-Phycoerythrin Alkaline phosphatase /3-Galactosidase Acid phosphatase Glucose oxidase Horseradish peroxidase Horseradish peroxidase Fluorescein Horseradish peroxidase Horseradish peroxidase Horseradish peroxidase Horseradish peroxidase Europium chelate Fluorescein Iodine-125
Table V
Indirect Labels for Nucleic Acid Hybridization Assaysa ,
Label
Binding protein
Biotin
Antibiotin
5-Bromodeoxyuridine
Anti-5-bromodeoxyuridine
DNP Anti-DNP N-2-Acetylaminofluorene m
Phosphotyrosine
Antiphosphotyrosine
Streptavidin
Biotin-IgG
Sulfone
Antisulfone
Antidouble-stranded DNA a That use an intermediate binding protein.
Binding protein-label Antispecies IgG-horseradish peroxidase Protein A-colloidal gold Antispecies IgG-alkaline phosphatase Antispecies IgG-pyruvate kinase Anti-(N-2-guanosinyl) acetylaminofluorene : antispecies IgG-alkaline phosphatase Antispecies IgG-alkaline phosphatase Streptavidin-alkaline phosphatase Antispecies IgG-horseradish peroxidase Antispecies IgG-glucose 6phosphate dehydrogenase Antispecies IgG-alkaline phosphatase
I0
Larry J. Kricka
and Kricka, 1988). One of the goals of a labeling m e t h o d is to confine the label to sites on the nucleic acid that are not involved in the h y d r o g e n bonding n e c e s s a r y for hybrid formation. H o w e v e r , in practice, h y d r o g e n bonding amino groups are used as labeling sites. This is effective only b e c a u s e the labeling density n e c e s s a r y to provide a detectable probe is low (10-30 modified bases/1000 bases); hence, it does not adversely influenced hybrid stability. A nucleic acid probe has a limited range of functional groups suitable for a t t a c h m e n t of a label; these are listed in Table VI. Various e n z y m a t i c
Table Vi
Chemical Labeling of Nucleic Acids Site Adenine 6-Amino Cytosine 4-Amino 5-Carbon 6-Carbon Guanine 7-Amino 8-Carbon
Thymine 5,6-Bond Uracil 5-Carbon 5,6-Bond 3'-End hydroxyl
Reaction Bifunctional coupling reagents (e.g., glutaraldehyde)
Matthews and Kricka (1988)
Bisulfite-catalyzed transamination Thiolation Mercuration Sulfonylation
Draper and Gold (1980); Viscidi
Platination N-acetoxy-N-2-acetylaminofluorene Bromination (Nbromosuccinimide)
van Belkum et al. (1994) Tchen et al. (1984)
Cycloaddition
Cimino et
Mercuration Cycloaddition Oxidation
Hopman et al. (1986) Cimino et al. (1985) Bauman et al. (1981); Broker et al. (1978) Chu et al. (1983); Chu and Orgel (1985) Forster et al. (1985)
5'-End phosphate
Aminoalkylation
Nonspecific
Nitrene CmC, C--H bond insertion Cross-linking (glutaraldehyde)
(UV irradiation) Noncovalent
Reference
Intercalation
et al. (1986)
Malcom and Nicolas (1984) Hopman et al. (1986) Lebacq et al. (1988)
Keller
et al.
al.
(1988) (1985)
AI-Hakim and Hull (1986); Renz (1983); Renz and Kurz (1984); Sodja and Davidson (1978); Syvanen et al. (1985) Czichos et al. (1989); Oser et al. (1990) A1-Hakeem and Sommer (1987)
I. Analytical Strategies and Applications
il
labeling procedures have been developed using deoxyribonuclease-DNA polymerase I (Rigby et al., 1977), terminal transferase (Riley et al., 1986), T 4 polynucleotide kinase (Maxam and Gilbert, 1977), and the Klenow fragment of Escherichia coil DNA (random hexanucleotide priming reaction) (Feinberg and Vogelstein, 1983). Labeled probes can also be made by cloning the probe sequence into an M 13 bacteriophage vector (Hu and Messing, 1982). Polymerase chain reaction (PCR) has also been adapted for labeling, thus allowing simultaneous amplification and labeling (Lion and Haas, 1990; Schowalter and Sommer, 1989). An alternative approach to labeling is to introduce labels or reactive groups for the subsequent attachment of labels during oligomer synthesis (Ruth, 1984; Ruth and Bryan, 1984). Appropriately activated nucleotides can be incorporated either internally (Haralambidis et al., 1987; Ruth et al., 1985) or at the 5'-end (Smith et al., 1985; Sproat et al., 1987). The various types of labeling methods are discussed in detail in Chapter 2.
C. Detection of Labels and Nucleic Acid Hybridization Sensitivity The sensitivity of a nucleic acid hybridization assay is determined primarily by the detection limit of the label. This is owing to the sandwich assay design of a hybridization assay and the high binding constant for complementary nucleic acid interaction; thus, low losses due to hybrid dissociation will be encountered. The amount of a specific target DNA sequence in a cell is very small. For example, a mammalian cell contains approximately 6 pg of DNA, comprising 3 billion base pairs or 3 million kB of DNA sequence (a bacterial cell only contains 0.1 pg of DNA). An assay for a typical 1-kB gene using a 1-kB probe requires a detection limit of 1 attogram of nucleic acid. Table VII compares the detection limits for various direct and indirect labels. Some of the most sensitive detection schemes involve enzyme labels in combination with either a chemiluminescent or bioluminescent reaction. For example, the detection limit for an alkaline phosphatase label using the adamantyl dioxetane phosphate (AMPPD) is 0.001 attomoles (Bronstein et al., 1990). Results of comparative studies to determine the most effective label-detection reaction combination for a hybridization assay can vary considerably. Urdea et al. (1988) compared the detection limits of seven different labels in a sandwich hybridization assay. The lowest detection limits were obtained using phosphorus-32 and horseradish peroxidase (enhanced chemiluminescent end-point). Another study (Balaguer et al., 199 la) compared luminescent (chemiluminescent or bioluminescent) detection of four different streptavidin-enzyme conjugates.
12
Larry J. Kricka
T a b l e VII Detection Limits for Nucleic Acid Labels a
Detection method
CL
Acridinium ester Aequorin Alkaline p h o s p h a t a s e /3-o-Galactosidase Europium chelate Glucose-6-phosphate dehydrogenase Horseradish peroxidase Isoluminol Phosphorus-32 R e n i l l a luciferase Rhodamine Ruthenium tris(bipyridyl) Texas Red Xanthine oxidase
0.5 -0.001 0.03 -0.003 5 1000 . . ~ 5000 . . 20,000 3
BL . . 1 0.01 0.0002 m 0. l 0.4 . . . < 1 . . . . . . .
FL . . 0.006 1 l0 . l0 . . . . . . .
COL
RL
. . . 0.011 m __ m --. . . 100 -. . 50 . . . . . . . . . .
EL
.
.
w
20
D e t e c t i o n limits in a t t o m o l e s . B L , b i o l u m i n e s c e n c e ; C L , c h e m i l u m i n e s c e n c e ; C O L , colorimetry; E L , e l e c t r o c h e m i l u m i n e s c e n c e ; F L , fluorimetry; R L , r a d i o l u m i n e s c e n c e . F r o m Arnold et al. (1989); B a l a g u e r et al. (1989); B l a c k b u r n et al. (1991); B r o n s t e i n and K r i c k a (1989); C o o k and S e l f (1993); D i a m a n d i s (1990); K r i c k a (1991); Smith e t al. (1991a); U r d e a et al. (1988).
a
The following signal:blank ratios were obtained after a 5-min incubation in an assay to detect 1 pg of biotinylated pBR 322 spotted on a membrane: glucose-6-phosphate dehydrogenase, 7.0; alkaline phosphatase, 4.5; xanthine oxidase, 2.8; and peroxidase, 1.8. Other investigators have shown different relative detection limits, and more definitive studies are still needed to clarify which is the most effective label and detection reaction for a particular application (e.g., dot blot, in situ hybridization).
1. Detection Techniques The principal types of detection methods for nonisotopic labels are bioluminescence, chemiluminescence, colorimetry, electrochemiluminescence, fluorescence, time-resolved fluorescence and phosphorescence. For some labels several detection methods are possible; these are summarized in Table VIII. a. Chemiluminescence and Bioluminescence
Chemiluminescence is the emission of light that occurs in certain chemical reactions because of decay of chemiexcited molecules to the electronic ground state. Bioluminescence is the chemiluminescence of nature (e.g., the firefly, Photinus pyralis), which involves luciferin substrates and lucif-
I. Analytical Strategies and Applications
13
Table VIII Assays for Selected Nucleic Acid Probe Direct and Indirect Labels ,
,,
Alkaline phosphatase (AP) Bioluminescent assay firefly luciferin-O-phosphate firefly luciferin
AP ~. firefly luciferin
firefly luciferase + ATP + Mg 2+ -light
Chemiluminescent assay AMPPD
AP ~- light
Time-resolved fluorescent assay salicyl phosphate
AP
salicylic acid
Eu s+ ,. Eu 3+ chelate
Glucose-6-phosphate flehyflrogenase (G6PDH) Bioluminescent assay glucose6-phosphate + N A D P § N A D P H + FMN
G6PDH -.-glucose + N A D P H
NAD(P)H" FMN oxidoreductase~- NADP + flavin mononucleotideH2
FMNH2 + decanal + 02
marine bacterial luciferase ~ light
Horseradish peroxidase (HRP) Chemiluminescent assay luminol + I-I202 +
para-iodophenol HRP ~ light Xanthine oxidase
Chemiluminescent assay xanthine + 02
xanthine oxidase ~, hypoxanthine + H202
H202 + luminol + Fe-EDTA
~ light
erase enzymes, or photoproteins. Both methods are very sensitive (zeptomole amounts, 10-21 moles), rapid, and versatile [adaptable for hybridizations in solution and on membranes and monitoring with charge coupled device (CCD) cameras] (Hooper and Ansorge, 1990; Wick, 1989).
b. Colorimetry Colorimetric assays produce soluble colored products and are relatively insensitive compared to luminescent assays (chemiluminescence, fluorescence, etc). Most attention has focused on reactions to produce insoluble colored products for locating hybrids on solid phases. These have the advantage of a simple visual read-out and a permanent record, especially for membrane-based assays.
14
Larry J. Kricka
c. Electrochemiluminescence
In this process, an electrochemical reaction produces excited-state species that decay to produce a ground state product and light. A disadvantage of this detection reaction is the need for specialized equipment that combines electrochemical-generation and light-detection capabilities. However, an electrochemiluminescence analyzer has now been commercialized (the QPCR System 5000; Perkin-Elmer). d. Fluorescence and Time-Resolved Fluorescence
Fluorescence measurements are capable of detecting single molecules of fluorescein (Mathies and Stryer, 1986). In practice, however, fluorescence is plagued by background signal due to nonspecific fluorescence present in biological samples. Since the background fluoresence tends to be short-lived, it can be avoided by using a long-lived fluorophore (e.g., europium chelate) that is excited by a rapid pulse of excitation light. The fluorescence emission is then measured after the short-lived background has decayed, thus eliminating interference. e. Phosphorescence
Phosphorescence is a long-lived emission from triplet excited states. Inorganic phosphor crystals represent a recent addition to the list of labels for nucleic acids and proteins (Beverloo et al., 1992). Previously, the principal use for this type of compound was in color television screens. The long-lived signal (milliseconds to microseconds) following irradiation with ultraviolet light permits signal acquisition using photographic film or a CCD camera (Seveus et al., 1992). 2. Detection of Nonisotopic Labels Detection methods for the most popular labels are summarized in the following sections, and further information, together with experimental protocols, is provided in other chapters of this book. a. Acridinium Esters
Oxidation of an acridinium ester by a mixture of sodium hydroxide and hydrogen peroxide produces a rapid flash of light. The detection limit for an acridinium ester-labeled probe is 0.5 amol (Arnold et al., 1989; Weeks et al., 1983). This flash reaction kinetics makes application of acridinium ester labels difficult for membrane-based assays. b. Aequorin
Apoaequorin can now be produced by recombinant DNA techniques (Prasher et al., 1985; Stults et al., 1991). It is converted to aequorin (the
1. Analytical Strategies and Applications
15
photoprotein present in the hydrozoan jellyfish Aequorea) by reaction with coelentrazine, and light emission from aequorin is triggered by calcium ions. Light is emitted as a flash (469 nm); hence, this type of label is difficult to configure in membrane-based applications. c. Alkaline Phosphatase
There is now a series of highly sensitive detection methods for alkaline phosphatase labels. The bioluminescent method uses firefly D-luciferinO-phosphate as a substrate. An alkaline phosphatase label dephosphorylates the substrate to liberate D-luciferin, which, unlike the phosphate, is a substrate for the bioluminescent firefly luciferase reaction (Hauber et al., 1989; Miska and Geiger, 1987, 1990), see Chapter 4. Several chemiluminescent assays have also been developed for this enzyme. The most sensitive and widely investigated is based on an adamantyl 1,2-dioxetane aryl phosphate (AMPPD; see Chapter 5). This substance is dephosphorylated to a phenoxide intermediate, which decomposes to form adamantanone and an excited-state aryl ester, which emits light at 477 nm as a protracted glow (> 1 hr) (Bronstein et al., 1990, 1991). Light emission can be enhanced using a variety of compounds including water-soluble polymers {e.g., poly[vinylbenzyl(benzyldimethly ammonium chloride)]} (Bronstein, 1990), and fluoresceinated detergents (e.g., cetyltrimethylammonium bromide) (Schaap et al., 1989). A second generation of dioxetane substrates is now available in which a 5-substituent on the adamantyl ring (e.g., 5-chloro, 5-bromo) prevents aggregation of these molecules (Bronstein et al., 1991), thus reducing reagent background due to thermal degradation. One of the most popular colorimetric methods for alkaline phosphatase is based on the formation of an insoluble purple dye by sequential dephosphorylation and reduction of BCIP (McGadey, 1970). An alternative substrate is naphthol AS-TR phosphate, which in combination with Fast Red RC, reacts with alkaline phosphatase to produce a red precipitate (Chapter 6). A salicyl phosphate substrate has been used in a time-resolved assay for alkaline phosphatase. Enzymatic cleavage of the phosphate group produces salicylic acid, which forms a long-lived fluorescent chelate with a europium or terbium ion (Evangelista et al., 1991). Soluble or insoluble chelates can be produced depending on the substituent on the salicylic acid--a fluoro substituent produces a soluble chelate; a branched-chain alkyl group produces an insoluble chelate (Chapter 3). The proprietary fluorigenic substrate AttoPhos TM (excitation maximum, 440 nm; emission maximum, 550 nm) is another option for detection of alkaline phosphatase. This substrate is superior to methylumbelliferone phosphate and was shown to be 100 times more sensitive in enzyme label
16
LarryJ. Kricka
detection than a colorimetric substrate in an assay for purified plasmid DNA (pSE9 or pBR322; Cano et al., 1992).
d. Europium Chelates Lanthanides, e.g., europium 3§ and terbium 3§ form highly fluorescent chelates with naphthoyltrifluoroacetone or 4,7-bis(chlorosulfophenyl)-l, 10-phenanthronline-2,9-dicarboxylic acid (BCPDA) (Diamandis, 1988; Soini and Lovgren, 1987) (see Chapters 10 and 15). These lanthanide chelates have a long-lived fluorescence (100-1000 us) and are useful as time-resolved fluorescent labels. Sensitivity enhancement via multiple labeling can be achieved by coupling the BCPDA to streptavidin and using the multiple-label streptavidin in conjunction with biotinylated probes (Dahlen, 1987; Oser et al., 1990; Syvanen et al., 1986). e. Fluorescein This fluorophore (fluorescence quantum yield, >0.85; excitation 492 nm; emission 520 nm) has been used effectively in nonseparation energy transfer probe assays with other fluorophore labels and with chemiluminescent labels (isoluminol) (Morrison et al., 1989) (see Chapter 17). f. Glucose-6-Phosphate Dehydrogenase A glucose-6-phosphate dehydrogenase label can be measured via the coupled marine bacterial luciferase NAD(P)H: FMN oxidoreductase reaction (Balaguer et al., 1989) (see Chapter 9). (Table VII). The signal, emitted as a glow, is well suited to membrane-based applications. g. Horseradish Peroxidase The enzyme horseradish peroxidase (HRP) catalyzes the chemiluminescent oxidation of luminol and, in the presence of small amounts of certain phenols (para-iodophenol), naphthols (1-bromo-2-naphthol) and amines (para-anisidine) (enhancers), the analytical features of this reaction are significantly improved (Kricka et al., 1988a; Thorpe and Kricka, 1986). The intensity of the light emission is increased by several orders of magnitude, and background light emission from the luminol-peroxide assay reagent is greatly reduced, which leads to a dramatic increase in the signal: background ratio. The light emission from this reaction is a long-lived glow (>30 min), suitable for membrane-based assays (Durrant, 1990; Durrant et al., 1990; Matthews et al., 1985; Schneppenheim and Rautenberg, 1987) (see Chapter 8). A dioxetane substrate for HRP has been also described (Urdea and Warner, 1990). HRP cleaves a 2-methylnaphthoxy substituent from the dioxetane to produce AMPPD, which is detected via its alkaline phosphatase-catalyzed chemiluminescent decomposition (vide supra).
I. Analytical Strategies and Applications
17
Several substrates that produce insoluble colored products are in use, including 3-amino-9-ethylcarbazole (red product), 4-chloro-l-naphthol (blue product), and 3,3'-diaminobenzidine (brown product). 3,3',5,5'Tetramethybenzidine (TMB) is oxidized by HRP to a semisoluble blue cationic dye, which can be trapped by treating the membrane with dextran sulfate (Sheldon et al., 1987).
h. Luminol and Isoluminol Metal ions and peroxidases (e.g., cobalt, microperoxidase) catalyze the chemiluminescent oxidation of luminol and isoluminol. Labeling is most convenient via the aryl amino group, but the chemiluminescence from the luminol label is reduced 10-fold when this amino group is substituted (Schroeder et al., 1978). In contrast, substitution of the aryl amino group of the less efficient isoluminol (chemiluminescence quantum yield: luminol, 0.01, isoluminol, 0.001) causes a 10-fold increase in the quantum yield. Hence isoluminol and its derivatives have been preferred as labels and applied mainly in conjunction with fluorophores in energy-transfer assays (see Chapter 17). i. Phosphors Protein A can be labeled with stabilized suspensions of a red-emitting yttriumoxisulfide (emission maximum, 620 nm; lifetime, 760/xsec) or a green-emitting zinc silicate phosphor (emission maxium, 522 nm; lifetime, 11 msec). These phosphor protein A conjugates have been tested in Southern and dot blots. Membrane-bound phosphor particles were detected by exposing the membrane to ultraviolet light and detecting the phosphorescent emission on photographic film. In a dot blot assay for lambda DNA, 330 fg was detectable above background (Beverloo et al., 1992). The advantages of the phosphor labels are that the phosphorescent signal is not influenced by the presence of water, pH, or changes in temperature and the range of emission wavelengths permits simultaneous multianalyte assays. j. Renilla Luciferase Recombinant Renilla (sea pansy) luciferase catalyzes the bioluminescent oxidation of coelenterazine. Light is emitted as a glow (at 480 nm) and, in the presence of green fluorescent protein, energy transfer occurs with a shift in light emission to 508 nm (Ward and Cormier, 1978). This enzyme has been used mainly as a secondary label (biotin conjugate) (Stults et al., 1991).
18
Larry J. Kricka
k. Ruthenium Bipyridyl Complexes Ruthenium and osmium complexes, e.g., ruthenium(II) tris(bipyridyl) [(Ru(bpy)32+)], can be used as electrochemiluminescent labels and detected by reaction with tripropylamine radicals (Blackburn et al., 1991; Massey et al., 1987). Ru(bpy)~ + is oxidized at the electrode surface to form Ru(bpy) 3§ which reacts with tripropylamine cation radicals, to produce excited state Ru(bpy) 2+. This species decays to its ground state, and light is emitted at 620 nm. 1. X a n t h i n e Oxidase
Xanthine oxidase catalyzes the luminescent oxidation of luminol. The long-lived light emission (lasting for several days) is enhanced by an ironethylenediaminetetraacetic acid (EDTA) complex via hydroxyl radical production (Balaguer et al., 1991; Baret et al., 1990).
3. Analytical Strategies The extreme sensitivity required for the detection of single copy genes has generated several different analytical strategies that attempt to increase specific signal by amplification of target or probe, or to reduce nonspecific background signal by a background rejection technique. a. A m p l i f y i n g Labels
Amplifying labels initiate cascade reactions, and sensitivity can be further increased by multiple labeling. Those based on the biotin:avidin system are especially effective at increasing detection sensitivity. However, sensitivity can be degraded by background from assay reagents, nonspecific binding of labeled probe, and contaminants. b. Probe Networks Probe networks provide a further method of introducing an amplification factor into a hybridization assay. This assay utilizes three types of probes (Urdea et al., 1987). A set of short primary probes binds to the target, and these are subsequently reacted with a polymerized second probe, which in turn hybridizes with a multiple enzyme-labeled probe. Amplification of 100-fold can be achieved compared to the signal from a single oligomer probe. c. Probe Amplification Probes can be amplified using Q-beta replicase. This is an exponential amplification method for RNA probes based on an RNA-directed RNA polymerase (Q-beta replicase) (Table IX). (Kramer et al., 1992: Lizardi et al., 1988). In this method a RNA probe is hybridized to its target,
N
<
~
.o
<
r;
t~
ell
0
~'< o,...~
t~
c~ 0 0 ..~ ("xl
t:~
9....2 ' ~ "
~
0
~
~
",..~"
'~
""
" ~
~
~
~:~
",..~
e~
~.~
c.,)
x~
C~
cn
I
~,.~
c~
II
0
0
0
~
~s +
II
~
0
,,,u
.o .o
0
20
Larry J. Kricka
isolated as the hybrid, and then denatured. The released RNA probe is amplified a billion-fold in a single step, and then the vast number of probe copies is quantitated in a secondary hybridization step. d. Target Amplification Selective amplification of a DNA target or an RNA target is becoming increasingly popular. A DNA or RNA target can be selectively amplified, thus reducing the requirement for ultrasensitive detection techniques. Several different methods have been developed. The PCR amplifies a DNA target sequence 10 million-fold after 30 cycles (Mullis, 1987; Mullis and Faloona, 1987), and a transcription-based amplification system will produce a 2-5 million-fold amplification of RNA target after 4 cycles (Kwoh et al., 1989). Increasing the amount of analyte reduces the requirement for an ultrasensitive detection technique, but it does add extra steps to the overall analytical procedure. Recent developments have focused on simplification of PCR using either microfabricated devices (Northrup et al., 1993; Wilding and Kricka, 1994) or closed vessel automated systems (Findlay, 1993; Findlay et al., 1993).
e. Background Rejection Background rejection makes use of time-resolved fluorescent labels (terbium and europium chelates) (Syvanen et al., 1986) and substrates (e.g., salicyl phosphate-europium chelate) (Evangelista et al., 1991). These end-points utilize long-lived fluorescent chelates activated by a pulse of excitation light. The fluorescent signal is measured after the short-lived background fluorescence has decayed. Interference can also be minimized by appropriate design of the hybridization assay. Thompson et al. (1989) developed a reversible target capture assay, which uses a 3'poly(dA)-tailed capture probe, a label probe, and an oligo(dT)-labeled paramagnetic particle. The target nucleic acid hybridizes to the probes, and the hybrids are captured via interaction of the dA tail on the capture probe and the dT tail on the paramagnetic particle. The particles are washed, and then the relatively weak bond between the dA and dT tails is disrupted using guanidine thiocyanate. The particles are replaced with fresh particles, and the cycle of capture, washing, and release is repeated. In this way any interferents i n solution or bound to the particles are removed before the measurement step.
f. Nonseparation Assays An assay that can be performed in a nonseparation or homogeneous format has several practical advantages. Lengthy, repetitive, and timeconsuming wash steps are avoided; the assay requires only a single incubation step followed by a signal measurement step; and the assay is amenable to automation.
I. Analytical Strategies and Applications
21
The current range of nonseparation nucleic acid assays is summarized in Table X. The most successful is the hybridization protection assay. This technique exploits the differential hydrolysis of hybridized and nonhybridized acridinium-ester-labeled probes and has been applied to the detection and identification of different infectious organisms (Arnold et al., 1989). An enzyme-channeling strategy has been developed based on a bioluminescent immunoadsorbent (antifluorescein antibody, marine bacterial luciferase, and NAD(P)H:FMN oxidoreductase co-immobilized on Sepharose beads) (Balaguer et al., 1991). Target DNA is reacted with two probes, one labeled with fluorescein and the other with biotin. The bioluminescent immunoadsorbent captures the complexes via reaction of the immobilized antifluorescein antibody with the fluorescein label on the probe. Biotin label on the captured complexes is then reacted with a streptavidin-glucose-6-phosphate dehydrogenase conjugate. The bioluminescent reaction, initiated by reaction of the glucose 6-phosphate label with a mixture of glucose 6-phosphate and NAD, is more efficient for the bound label (efficient channeling of substrates between the coupled enzymes) than for label in solution. Hence, we can distinguish between bound and unbound label without a separation step. Energy transfer assay strategies have been devised based on probes labeled with a donor and an acceptor fluorophore (e.g., fluorescein and
Table X
Nonseparation (Homogeneous) Nucleic Acid Assays Label Acridine Orange/ tetramethylrhodamine Acridinium ester Fluorescein Fluorescein/pyrene sulfonate Fluorescein/ tetramethylrhodamine Fluorescein/Texas Red Glucose-6-phosphate dehydrogenase La Jolla Blue
Principle
Reference
Energy transfer
Cardullo et al. (1988)
Selective hydrolysis Fluorescence polarization Energy transfer
Arnold et al. (1989) Wang et al. (1992) Morrison et al. (1989)
Energy transfer
Cardullo et al. (1988)
Energy transfer Enzyme channeling
Morrison (1987) Balaguer et al. (1991b)
Transient fluorescence polarization Isoluminol/ethidium bromide Energy transfer Isoluminol/ Energy transfer tetramethylrhodamine Ruthenium tris(bipyridyl) Electrode proximity
Devlin et al. (1993) Heller and Morrison (1985) Heller and Morrison (1985) Kenten et al. (1991)
22
Larry J. Kricka
tetramethylrhodamine) (Cardullo et al., 1988) and on probes labeled with a chemiluminescent compound (isoluminol) and a fluorophore (tetramethylrhodamine) (Heller and Morrison, 1985). Modulation of the steady-state fluorescence polarization of a fluorescein-labeled probe when it binds to a target has also been demonstrated as a viable nonseparation assay strategy (cf., fluorescence polarization immunoassays) (Wang et al., 1992). Devlin et al. (1993) described a transient-state polarized fluorescence assay based on a probe labeled with La Jolla Blue. This assay detected 1 fmol of a 382-base RNA transcript from HIV-1 (generated by a 3SR amplification reaction); the sensitivity of this method was comparable to that of conventional heterogeneous assays using isotopic (32p) or nonisotopic (e.g., lanthanide chelates) labels.
g. Imaging, Multiple Labeling, and Matrix Assays A growing trend in nucleic acid detection is toward multiple simultaneous assays in two-dimensional formats. Membranes are the traditional solid support for nucleic acid blotting assays. Signal from bound label, such as an alkaline phosphatase label detected with a chemiluminescent substrate, can be conveniently imaged using charge-coupled device (CCD) cameras (Wick, 1989; Hooper and Ansorge, 1990; Hooper et al., 1993; Rushbrooke et al., 1993). This technique is also applicable to tissue sections probed with lanthanide-chelate-labeled probes (Seveus et al., 1992). A set of probes, each labeled with a different label, provides a means of probing a sample for a range of target sequences. Alkaline phosphatase, glucose-6-phosphate dehydrogenase, horseradish peroxidase, and xanthine oxidase labels were combined in a multiple luminescence procedure for the detection of papillomavirus 11, 16, and 18 in amplified cervical scrapes (Chikhaoui et al., 1992). Combinations of fluorophore labels (Lutz et al., 1992) and combinations of fluorophore labels mixed in different ratios are now widely employed in FISH (fluorescence in situ hybridization) assays in cytogenetics to identify chromosomal abnormalities (Dauwerse et al., 1992; Pinkel, 1993). A combination of 3 labels in different multiple ratios can produce 12 different colors and this permits "painting" of a chromosome (Morrison, 1993). An array or matrix of nucleic acid probes immobilized at discrete locations on the surface of a piece of silicon or glass provides a convenient means of simultaneously probing a sample for the presence of different target sequences (Southern et al., 1992; Beattie et al., 1993; Sheldon et al., 1993). Arrays of probes contained in an array of test wells (100/zm 2) micromachined in a silicon surface have also been constructed. Hybridization is detected by an electronic device fabricated in each well that measures the change in dielectric relaxation frequency due to the presence of the captured target (Beattie et al., 1993).
I. Analytical Strategies and Applications
23
III. PROTEIN BLOTTING Protein blotted onto a membrane can be detected with a variety of stains including Coomassie blue, Amido black, and India ink (Harper et al., 1990). These stains have limited sensitivity and have been largely displaced by specific labeled detection agents (labeled antibody, avidin, streptavidin, protein A). Several of the labels listed in Table III have been tested in protein blotting formats such as Western blotting (Towbin et al., 1979; Burnette, 1981; Gershoni and Palade, 1982,1983; Towbin and Gordon, 1984; Harper et al., 1990). Currently, alkaline phosphatase and peroxidase labels are the most popular of the nonisotopic labels for Western blotting. These labels are detected using chromogenic substrates that produce insoluble colored products or chemiluminescent substrates. Membranes can no longer be considered inert in the context of signal generation. Researchers have shown that the type of membrane has a significant effect on chemiluminescent signal generation from bound alkaline phosphatase labels detected using an adamantyl 1,2-dioxetane aryl phosphate substrate (Bronstein et al., 1992). A nylon membrane acts as an enhancer of the chemiluminescent signal produced in this assay (Tizard et al., 1990). The enhancement arises via partitioning of the dephosphorylated intermediate from the aqueous reaction buffer to more hydrophobic domains on the nylon membrane. Improved resolution of separated protein is a further benefit because the light emitter does not diffuse away.
IV. PATENTS Many aspects of nucleic acid and protein blotting technology (labels, detection of labels, assay formats, amplification, sample treatment) have been patented. Currently, several hundred patents delineate the bounds of this proprietary technology. Table XI provides a brief survey of recent patents and patent applications. The intellectual property for which patent protection has been obtained or is currently being sought is divided into categories representing different aspects of nucleic acid hybridization and protein blotting assays. Some of the earlier patents directed principally to nonisotopic immunoassays have importance for nucleic acid hybridization because broad claims were allowed to ligands, binding partners, and binding assays (Buckler and Schroeder, 1980), thus anticipating the application of nonisotopic labels in nucleic acid hybridization assays. In the past, the patent literature has represented a very specialized area of interest. However, recent developments indicate that a general appreciation of patents and their scope will become increasingly important in view of the trend to the broad enforcement of issued patents (e.g., PCR).
24
Larry J. Kricka
Table XI Selected Patents and Patent Applications Relating to Nucleic Acid and Protein Technology
Technology A. Nucleic acid assays Amplification Target
Probe Assay format Amplifier probes Complementary probes Immobilized probe Immobilized probe-antihybrid Interacting label probes Multiple probes
Devices Liquid-impervious receptacle Porous track Reagent-delivery system Test sheets Forensics Labeling Cationic detergent Functionalized polynucleotide Label and detection system Acridinium ester Agglutination Alkaline phosphatasembacterial bioluminescence Antibody to intercalation complex Antihybrid antibody ATP-encapsulated liposome--bioluminescence Arabinose Avidin-biotin
Patent
Reference
WO 8910979 WO 9001068 WO 8901050 US 4683202 WO 8909835 EP 373960 WO 9002820 WO 9002819
Adler et al. (1989) Berninger (1990) Burg et al. (1989) Mullis (1987) Orgel (1989) Gingeras et al. (1990) Axelrod et al. (1990) Chu et al. (1990)
WO 9013667 WO 8801302 JP 5236998 EP 163220 EP 33%86
Urdea et al. (1990a) Gingeras et al. (1988) Olympus (1993) Carrico (1985) Carrico (1989)
WO 8603227 EP 320308 EP 318245 WO 8903891
Taub (1986) Backman and Wang (1989) Hogan and Milliman (1989) Urdea et al. (1990b)
EP 295069 EP 387696 EP 299359 US 4613566 WO 9213969 EP 530009
Matkovitch (1988) McMahon and Gordon (1990) Korom et al. (1989) Potter (1986) Caskey and Edwards (1992) Jeffreys (1993)
US 4873187 WO 8607361
Taub (1990) Stabinsky (1986)
EP 309230 WO 8705334 EP 386691
Arnold and Nelson (1987) Gefter and Holland (1987) Watanabe and Shibata (1990)
US 4563417
Albarella and Anderson (1986)
EP 209702 EP 144913 US 4704355
Carrico (1987) Albarella et al. (1985) Bernstein (1988)
EP 227459 EP 184701
McCormick (1987) Wong (1986) (continues)
I. Analytical Strategies and Applications
25
Table Xl (Continued)
Technology
Patent
Reference
Benzidine meriquinone Carbonic anhydrase inhibitor Catalase Chelator Dioxetanes
EP 219286 EP 210021 JP 61009300 WO 8702708 US 4978614 WO 8906226 CA2006222 EP 401001 WO 8706706 EP 234938
Bloch et al. (1987) Musso et al. (1987a) Kasahara and Ashihara (1986) Musso et al. (1987b) Bronstein, 1990) Edwards and Bronstein (1989) Akhaven-Tafti and Schaap (1990) Urdea and Warner (1990) Massey et al. (1987) Turner et al. (1987)
EP US EP EP
Heller and Jablonski (1987) Morrison (1989) Morrison (1987) Nicolas et al. (1990)
Electroluminescence Electron transfer (tetrathiafulvalence mediator) Energy transfer
Enzyme--bacterial bioluminescence Fluorescence polarization Fluorescent particles Horseradish peroxidase-chemiluminescence colorimetry HPLC separation Labeled cross-linkers Lanthanides Oxidasesmchemiluminescence Porphyrazine Ruthenium and rhodium chelates Sample preparation Chromatography Polycationic support Sonication Solid supports and separation procedures Electrophoresis Gel exclusion Magnetic particles
Microbeads Nylon (amidinated) Photochemically reactive solid support Solid carriermmicrofiltration Superparamagnetic particles
229943 4822733 232967 362042
EP 382433 WO 932492 US 4598044 US 4729950 WO 9301307 JP 1046650 WO 8502628 WO 8904375 EP 256932 JP 4351961 WO 9005732
Garman and Moore (1990) Brinkley et al. (1993) Kricka et al. (1986) Kricka et al. (1988b) Bobrow and Litt (1993) Toyo Soda (1989) Yabucaki et al. (1985) Musso et al. (1989) Baret (1988) Hitachi (1992) Barton (1990)
WO 8808036 EP 281390 EP 337690
Tedesco and Petersen (1988) Arnold et al. (1988) Li et al. (1989)
EP 244207 EP 278220 WO 9006042 WO 8605815 WO 9222201 EP 304845 EP 221308 EP 130523
Murao and Hosaka (1987) Kuhns (1988) Hornes and Korsnes (1990b) Hill et al. (1986) Shah and Wang (1992) Wang (1989) Carrico and Patterson (1987) Dattagupta and Crothers (1985) Jolley and Ekenberg (1986) Hornes and Korsnes (1990a)
EP 200113 WO9006045
(continues)
26
Larry J. Kricka
Table Xl (Continued)
Patent
Technology Transparent controlled-pore glass particles Waveguide Sequencing
Specific probes Charcot-Marie Tooth disease Di-George syndrome E n t a m o e b a histolytica
Gaucher disease Listeria m o n o c y t o g e n e s Mycobacteria Neisseria gonorrhoeae Neisseria strains
Non-A, non-B hepatitis Papillomavirus Type I diabetes mellitus Yersinia enterocolitica
B. Protein blotting Automation Apparatus Multiple assays Assays HIV-I antibodies HTLV-III Plasmin alpha-2 antiplasmin complexes Retroviral antibodies Reagents 1,2-Dioxetane method HIV antigens HRP substrate HTLV-1 and HTLV-II
Reference
US 4780423
Bluestein et al. (1988)
EP 245206 WO 9305183 WO 9221079
Sutherland et al. (1987) Burgess et al. (1993) Church and Kieffer-Higgins (1992)
WO 9221694 WO 9307293 GB 2223307 WO 9306244 US 7411965 EP 398677 EP 353985 EP 337896
Cadenas et al. (1992) Budarf et al. (1993) Huber et al. (1990) Beutler and Sorge (1993) Datta (1990) Wirth and Patel (1990) Woods et al. (1990) Rossau and Vanheuvers (1989) Mishiro and Nakamura (1990) Lorincz (1990) Owerbach (1990) Shah et al. (1989)
EP US US EP
377303 4908306 4965189 339783
GB 2239092 EP 397129
Kok (1991) Chan et al. (1990)
WO 8900207 WO 8707647 WO 9321532
Dyll et al. (1989) Osther (1987) Binder (1993)
US 5093230
Dyll and Osther (1992)
WO 9303380 DE 3 7 2 4 0 1 6 US 5017471 JP 5240860
Anderson et al. (1993) Soutschekb et al. (1989) Fellman (1991) Fuji Rebio (1993)
V. C O N C L U S I O N S There are continuing developments in labels, detection methods, and assay strategies for nucleic acid probe and protein blotting assays. No single procedure dominates and a diverse range of technologies is in current use. DNA probe assays, particularly for infectious diseases and the detection of genetic abnormalities, are gradually being introduced into routine clinical
I. Analytical Strategies and Applications
27
laboratory practice. Nonisotopic Western blotting is already used routinely as a confirmatory test for patients with positive serum anti-HIV antibody test results. Subsequent chapters present the most important nonisotopic alternatives to the 32p or 125I label for use in nucleic acid probing and sequencing and protein blotting assays.
REFERENCES Adler, K. E., Greene, R. A., and Kasila, P. A. (1989). Enzymatic amplification and detection of nucleic acids. WO Patent 8910979. Akar, A., Bournique, B., and Scholler, R. (1992). Detection of hepatitis B virus DNA in serum by a nonisotopic hybridization technique. Clin. Chem. 38, 1352-1355. Akhavan-Tafti, H., and Schaap, A. P. (1990). New chemiluminescent 1,2-dioxetane compounds. Can. Patent 2006222. Albarella, J. P., and Anderson, L. H. D. (1986). Nucleic acid hybridization assay using antibodies to intercalating complexes with double-stranded nucleic acid. U.S. Patent 4563417. Albarella, J. P., Anderson, L. H. D., and Carrico, R. J. (1985). Determination of polynucleotide sequence in sample by using labeled probe and antihybrid. Eur. Patent 144913. A1-Hakeem, M., and Sommer, S. S. (1987). Terbium identifies double-stranded RNA on gels by quenching the fluorescence of intercalated ethidium bromide. Anal. Biochem. 163, 433-439. AI-Hakim, A. H., and Hull, R. (1986). Studies towards the development of chemically synthesized nonradioactive biotinylated hybridization probes. Nucleic Acids Res. 14, 9965-9976. Alwine, J. C., Kemp, D. J., and Stark, G. R. (1977). Method for the detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl paper and hybridization with DNA probes. Proc. Natl. Acad. Sci. USA 74, 5350-5354. Anderson, L. E., Kobos, R. K., and Polsky, S. E. (1993). Enhancing chemiluminescence of enzyme-triggered 1,2-dioxetanes. WO Patent 9303380. Andresen, B. S., Knudsen, I., Jensen, P. K. A., Rasmussen, K., and Gregersen, N. (1992). Two novel nonradioactive polymerase chain reaction-based assays of dried blood spots, genomic DNA, or whole cells for fast, reliable detection of Z and S mutations in the alpharantitrypsin gene. Clin. Chem. 38, 2100-2107. Arnold, L. J., Jr., and Nelson, N. C. (1987). Homogeneous protection assay. Eur. Patent Appl. 309230. Arnold, L. J., Jr., Nelson, N. C., Reynolds, M. A., and Waldrop, A. A. (1988). Separating polynucleotide from solution by binding to polycationic support. Eur. Patent 281390. Arnold, L. J., Jr., Hammond, P. W., Wiese, W. A., and Nelson, N. C. (1989). Assay formats involving acridinium-ester-labeled DNA probes. Clin. Chem. 35, 1588-1594. Axelrod, V. D., Kramer, F. R., Zardi, P. M., and Mills, D. R. (1990). Oligonucleotidepromoter DNA molecular adduct. WO Patent 9002820. Backman, K. (1992). Ligase chain reaction: Diagnostic technology for the 1990' s and beyond. Clin. Chem. 38, 457-458. Backman, K. C., and Wang, C. N. J. (1989). Detecting target nucleic acid in a sample. Eur. Patent 320308. Balaguer, P., Terouanne, B., Boussioux, A. M., and Nicolas, J. C. (1989). Use of bioluminescence in nucleic acid hybridization reactions. J. Biolumin. Chemilumin. 4, 302-309.
28
Larry J. Kricka
Balaguer, P., Bonafe, N., Terouanne, B., Boussioux, A. M., Baret, A., and Nicolas, J. C. (1991a). Luminescent detection of DNA probes: A comparative study of four luminescent detection systems. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 187-190. Wiley, Chichester, England. Balaguer, P., Terouanne, B., Boussioux, A. M., and Nicolas, J. C. (1991b). Quantification of DNA sequences obtained by polymerase chain reaction using a bioluminescent adsorbent. Anal. Biochem. 195, 105-110. Baret, A. (1988). Signal reagent for chemiluminescent assay. Eur. Patent 256932. Baret, A., Fert, V., and Aumaille, J. (1990). Application of a long-term enhanced xanthine oxidase-induced luminescence in solid-phase immunoassays. Anal. Biochem. 187, 20-26. Barton, J. K. (1990). New transition metal complexes. WO Patent 9005732. Bauman, J. G. J., Wiegent, J., and Van Duijn, P. (1981). Cytochemical hybridization with fluorochrome-labeled RNA. J. Histochem. Cytochem. 29, 227-237. Beattie, K., Eggers, M., and Shumaker, J. (1993). Genosensor technology. Clin. Chem. 39, 719-722. Belkum, A. van, Linkels, E., Jeisma, T., van den Berg, F. M., and Quint, W. (1994). Nonisotopic labeling of DNA by newly developed hapten-containing platinum compounds. BioTechniques 16, 148-153. Berninger, M. (1990). Sequence-specific assay for detection of nucleic acids. WO Patent 9001068. Bernstein, D. (1988). Assay for specific binding pair analyte. U.S. Patent 4704355. Beutler, E., and Sorge, J. A. (1993). Screening method for new Gaucher disease mutation. WO Patent 9306244. Beverloo, H. B., Schadewijk, A. van, Zijlmans, H. J. M. A. A., and Tanke, H. J. (1992). Immunochemical detection of proteins and nucleic acids on filters using small luminescent inorganic crystals as markers. Anal. Biochem. 203, 326-334. Binder, B. (1993). Detection method of plasmin alpha-2 anti-plasmin complexes. WO Patent 9321532. Blackburn, G. F., Shah, H. S., Kenten, J. H., Leland, J., Kamin, R. A., Link, J., Peterman, J., Shah, A., Talley, D. B., Tyagi, S. K., Wilkins, E., Wu, T.-G., and Massey, R. J. (1991). Electrochemiluminescence detection for development of immunoassays and DNAprobe assays for clinical diagnostics. Clin. Chem. 37, 1534-1539. Bloch, W., Sheridan, P. J., and Goodson, R. J. (1987). Composition for visualization of biological materials. Eur. Patent 219286. Bluestein, B. I., Famulare, A. J., and Worthy, T. E. (1989). Fluorescent assay for ligandligand-binding partner complex. U.S. Patent 4780423. Bobrow, M. N., and Litt, G. J. (1993). Chromogenic substrate for improving detection in peroxidase-based assay. WO Patent 9301307. Brinkley, J. M., Haugland, R. P., and Singer, V. L. (1993). Fluorescent polymeric microparticles with long Stokes shift. WO Patent 9323492. Broker, T. R., Angerer, L. M., Yen, P. H., Hershey, N. D., and Davidson, N. (1978). Electron microscopic visualization of tRNA genes with ferritin-avidin : biotin labels. Nucleic Acids Res. 5, 363-384. Bronstein, I. (1990). Method of detecting a substance using enzymatically induced decomposition of dioxetanes. U.S. Patent 4978614. Bronstein, I., and Kricka, L. J. (1989). Clinical applications of luminescent assays for enzymes and enzyme labels. J. Clin. Lab. Anal. 3, 316-322. Bronstein, I., Edwards, B., and Voyta, J. C. (1990). 1,2-Dioxetanes: Novel chemiluminescent enzyme substrates. J. Biolumin. Chemilumin. 4, 99-111. Bronstein, I., Juo, R. R., Voyta, J. C., and Edwards, B. (1991). Novel chemiluminescent adamantyl 1,2-dioxetane enzyme substrates. In "Bioluminescence and Chemilumines-
I. Analytical Strategies and Applications
29
cence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 73-82. Wiley, Chichester, England. Bronstein, I., Voyta, J. C., Murphy, O. J., Bresnick, L., and Kricka, L. J. (1992). Improved chemiluminescent blotting procedure. BioTechniques 12, 748-753. Buck, G. E. (1989). Nonculture methods for detection and identification of microorganisms in clinical specimens. Selected Top. Ped. Pathol. 36, 95-112. Buckler, R. T., and Schroeder, H. R. (1980). Chemiluminescent naphthalene-l,2,-dicarboxylic acid hydrazide-labeled polypeptides and proteins. U.S. Patent 4225485. Budarf, M. L., Driscoll, D. A., and Emanuel, B. S. (1993). Detecting genetic deletions and mutations. WO Patent 9307293. Budowle, B., Baechtel, F. S., Guisti, A. M., and Monson, K. L. (1990). Applying highly polymorphic variable number of tandem repeats loci genetic markers to identity testing. Clin. Biochem. 23, 287-293. Burg, L. J., Pouletty, P., and Broothroyd, J. C. (1989). Amplification of target polynucleotide sequences. WO Patent 8901050. Burgess, K., Civitello, A., Gibbs, R., Metzker, M. L., Raghavachari, R., and Richards, S. (1993). Multiple base addition DNA or RNA sequencing assay. WO Patent 9305183. Burnette, W. N. (1981). "Western blotting": Electroph0retic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112, 195-203. Cano, R. J., Torres, M. J., Klem, R. E., and Palomares, J. C. (1992). DNA hybridization assay using AttoPhos TM,a fluorescent substrate for alkaline phosphatase. BioTechniques 12, 264-268. Cardenas, O. S., De Ocaluna, R. M., Deleon, M., Lupski, J. R., Patel, P. I., Shooter, E. M., Snipes, G. J., Suter, U., Welcher, A., and De Ocaluna, R. M. (1992). Human peripheral myelin protein and nucleic acid sequence. WO Patent 9221694. Cardullo, R. A., Agrawal, S., Flores, C., Zamecnik, P. C., and Wolf, D. E. (1988). Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. USA 85, 8790-8794. Carpenter, W. R., Schutzbank, T. E., Tevere, T. J., Tocyloski, K. R., Dattagupta, N., and Yeung, K. K. (1993). A transcriptionally amplified DNA probe assay with ligatable probes and immunochemical detection. Clin. Chem. 39, 1934-1938. Carr, J. (1993). Human papillomavirus DNA detection and typing. In "Molecular Biology and Pathology" (D. H. Farkas, ed.), pp. 123-147. Academic Press, San Diego. Carrico, R. J. (1985). Determination of specific polynucleotide sequence in test medium by adding immobilized probe containing complementary sequence and detecting duplex formation. Eur. Patent 163220. Carrico, R. J. (1987). Solid-phase hybridization assay using polynucleotide probe and detecting hybridized probe using antihybrid antibodies. Eur. Patent 209702. Carrico, R. J. (1989). Nucleic acid hybridization assay. Eur. Patent 339686. Carrico, R. J., and Patterson, W. L. (1987). Immobilized nucleic acid on nylon support carrying amidine residues. Eur. Patent 221308. Caskey, C. T., and Edwards, A. O. (1992). DNA profiling assay. WO Patent 9213969. Cawood, A. H. (1989). DNA fingerprinting. Clin. Chem. 35, 1832-1837. Centers for Disease Control (1989). Interpretation and use of the Western blot assay for serodiagnosis of human immunodeficiency virus type 1 infections. Morbid. Mortal. Weekly Rep. 38(S-7), 1-7. Chamberlain, J. S. (1993). Molecular genetics of muscular dystrophy. In "Molecular Diagnostics" (R. Rapley and M. R. Walker, eds.), pp. 120-138. Blackwell, Oxford. Chan, E. W., Robey, W. G., Schulze, W., and Ohan, E. W. (1990). New western blot immunoassay. Eur. Patent 397129.
30
Larry J. Kricka
Chen, P.-H., Lin, S.-Y., Wang, C.-K., Chen, Y.-J., Chen, T.-C., and Chang, J.-G. (1993). "Hot spots" mutation analysis of p53 gene in gastrointestinal cancers by amplification of naturally occurring and artificially created restriction sites. Clin. Chem. 39, 2186-2191. Chikhaoui, Y., Balaguer, P., Terouanne, B., Boussioux, A.-M., and Nicolas, J.-C. (1992). A multiple luminescent procedure for the detection of different papillomavirus on dot blots. J. Immunol. Meth. 150, 51-56. Chu, B. C. F., Wahl, G. M., and Orgel, L. E. (1983). Derivatization of unprotected oligonucleotides. Nucleic Acids Res. 11, 6513-6528. Chu, B. C. F., and Orgel, L. E. (1985). Detection of specific DNA sequences with short biotin-labeled probes. D N A 4, 327-331. Chu, B. C., Yoyce, G. F., and Orgel, L. E. (1990). Adduct of linked moieties ofoligonucleotide sequence. WO Patent 9002819. Church, G. M., and Kieffer-Higgins, S. G. (1992). Reactor for modifying molecule attached to solid phase support. WO Patent 9221079. Cimino, G. D., Gamper, H. D., Isaacs, S. T., and Hearst, J. E. (1985). Psoralens as photoactive probes of nucleic acid structure and function: Organic chemistry, photochemistry, and biochemistry. Annu. Rev. Biochem. 54, ll51-1193. Cook, D. B., and Self, C. H. (1993). Determination of one thousandth of an attomole (1 zeptomole) of alkaline phosphatase: Application in an immunoassay for proinsulin. Clin. Chem. 39, 965-971. Crisan, D. (1993). The BCR/abl gene rearrangement in chronic myelogenous leukemia and acute leukemias: Clinical perspectives and quality control. In "Molecular Biology and Pathology" (D. H. Farkas, ed.), pp. 103-121. Academic Press, San Diego. Czichos, J., Kohler, M., Reckmann, B., and Renz, M. (1989). Protein-DNA conjugates produced by UV irradiation and their use as probes for hybridization. Nucleic Acids Res. 17, 1563-1572. Dahlen, P. (1987). Detection of biotinylated DNA probes by using Eua+-labeled streptavidin and time-resolved fluorimetry. Anal. Biochem. 164, 78-83. Dahlen, P., Carlson, J., Liukkonen, L., Lilja, H., Siitari, H., Hurskainen, P., Iita, A., Jeppsson, J.-O., and Lovgren, T. (1993). Europium-labeled oligonucleotides to detect point mutations: Applications to Pl Z alpha~-antitrypsin deficiency. Clin. Chem. 39, 16261631. Datta, A. (1990). Synthetic Listeria monocytogenes oligonucleotide probes. U.S. Patent 7411965. Dattagupta, N., and Crothers, D. (1985). Solid support with photochemically linked nucleic acid. Eur. Patent 130523. Dauwerse, J. G., Wiegant, J., Raap, A. K., Breuning, M. H., and van Ommen, G. J. B. (1992). Multiple colors by fluorescence in situ hybridization using ratio-labelled DNA probes create a molecular karotype. Human Mol. Genet. 1, 593-598. Davini, E., Di Leo, C., Rossodivita, A., and Zappelli, P. (1992). Alkaline phosphatase inhibitors as labels of DNA probes. Genet. Anal. Tech. Appl. 9, 39-47. Dawson, D. B. (1990). Use of nucleic acid probes in genetic tests. Clin. Biochem. 23, 279-285. Devlin, R., Studholme, R. M., Dandliker, W. B., Fahy, E., Blumeyer, K., and Ghosh, S. S. (1993). Homogeneous detection of nucleic acids by transient-state polarized fluorescence. Clin. Chem. 39, 1939-1943. Diamandis, E. P. (1988). Immunoassays with time-resolved fluorescence spectroscopy; principles and applications. Clin. Biochem. 21, 139-150. Diamandis, E. P. (1990). Analytical methodology for immunoassays and DNA hybridization assaysmcurrent status and selected systems. Clin. Chim. Acta 194, 19-50. DiCesare, J., Grossman, B., Katz, E., Picozza, E., Ragusa, R., and Woudenberg, T. (1993).
I. Analytical Strategies and Applications
31
A high-sensitivity electrochemiluminescence-based detection system for automated PCR product quantitation. BioTechniques 15, 152-157. DiLella, A. G., Marvit, J., Lidsky, A. S., Guettler, F., and Woo, S. L. C. (1986). Tight linkage between a splicing mutation and a specific DNA haplotype in phenylketonuria. Nature 322, 799-803. Draper, D. E., and Gold, L. M. (1980). A method for linking fluorescent labels to polynucleotides: Application to studies of ribosome-ribonucleic acid interactions. Biochemistry 19, 1774-1781. Dular, R., Kajioka, R., and Kasatiya, S. (1988). Comparison of Gen-Probe commercial kit and culture technique for the diagnosis of Mycoplasma pneumoniae infection. J. Clin. Microbiol. 26, 2240-2245. Durrant, I. (1990). Light-based detection of biomolecules. Nature 346, 297-298. Durrant, I., Benge, L. C. A., Sturrock, C., Devenish, A. T., Howe, R., Roe, S., Moore, M., Scozzafava, G., Proudfoot, L. M. F., Richardson, T. C., and McFarthing, K. G. (1990). The application of enhanced chemiluminescence to membrane-based nucleic acid detection. BioTechniques 8, 564-570. Dyll, L. M., and Osther, K. B. (1992). Immunoassay for retroviral antibodies. U.S. Patent 5093230. Dyll, L. M., Osther, and Dylt, L. M. (1989). Rapid, sensitive detection of HIV-I antibodies. WO Patent 8900207. Edwards, B., and Bronstein, I. Y. (1989). New cycloalkyl substituted fluorescent chromophore compounds. WO Patent 8906226. Emond, E., Fliss, I., and Pandian, S. (1993). A ribosomal DNA fragment of Listeria monocytogenes and its use as a genus-specific probe in an aqueous-phase hybridization assay. Appl. Environ. Microbiol. 59, 2690-2697. Erlich, H. A., Sheldon, E. L., and Horn, G. (1986). HLA typing using DNA probes. Biotechnology 4, 975-979. Evangelista, R. A., Pollack, A., and Gudgin Templeton, E. F. (1991). Enzyme-amplified lanthanide luminescence for enzyme detection in bioanalytical assays. Anal. Biochem. 197, 213-224. Farkas, D. H. (1993). Specimen procurement, processing, tracking, and testing by the Southern blot. In "Molecular Biology and Pathology" (D. H. Farkas, ed.), pp. 51-75. Academic Press, San Diego. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Fellman, J. H. (1991). Reagent for peroxidase detection and western blot immunoassay. US Patent 5017471. Findlay, J. B., Atwood, S. M., Bergmeyer, L., Chemelli, J., Christy, K., Cummins, T., Donish, W., Ekeze, T., Falvo, J., Patterson, D., Puskas, J., Quenin, J., Shah, J., Sharkey, D., Sutherland, J. W. H., Sutton, R., Warren, H., and Wellman, J. (1993). Automated closed-vessel system for in vitro diagnostics based on polymerase chain reaction. Clin. Chem. 39, 1927-1933. Flores, J., Purcell, R. H., Perez, T., Wyatt, R. G., Boeggeman, E., Sereno, M., White, L., Chanock, R. M., and Kapikian, A. Z. (1983). A dot hybridization assay for detection of rotavirus. Lancet i, 555-559. Forster, A. C., Mclnnes, J. L., Skingle, D. C., and Symons, R. H. (1985). Nonradioactive hybridization probes prepared by the chemical labeling of DNA and RNA with a novel reagent, photobiotin. Nucleic Acids Res. 13, 745-762. Fujimura, F. K. (1992). Screening for genetic diseases with DNA probes. Clin. Chem. 38, 461-462. Fuji Rebio Inc. (1993). Selective detection of HTLV-1 and HTLV-II. Jap. Patent 5240860.
32
Larry J. Kricka
Garman, A. J., and Moore, R. S. (1990). Detecting nucleic acid sequence using fluorescence polarization. Eur. Patent 382433. Gefter, M. L., and Holland, C. A. (1987). Detection of nucleic acid sequences. WO Patent 8705334. Gershoni, J. M., and Palade, G. E. (1982). Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to positively charged membrane filter. Anal. Biochem. 124, 396-405. Gershoni, J. M., and Palade, G. E. (1983). Protein blotting: Principles and applications. Anal. Biochem. 131, 1-15. Gill, P., Jeffreys, A. J., and Werrett, D. J. (1985). Forensic applications of DNA "fingerprints." Nature 318, 577-579. Gingeras, T. R., Ghosh, S. S., Davis, G. R., Kwoh, D. Y., and Musso, G. F. (1988). Nucleic acid probe assay. WO Patent 8801302. Gingeras, T. R., Guatelli, J. C., and Whitfield, K. M. (1990). Amplification of RNA sequences. Eur. Patent 373960. Guatelli, J. C., Whitfield, K. M., Kwoh, D. Y., Barringer, K. J., Richman, D. D., and Gingeras, T. R. (1990). Isothermal in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. USA 87, 1874-1878. Haralambidis, J., Chai, M., and Tregear, G. (1987). Preparation of base-modified nucleosides suitable for nonradioactive label attachment and their incorporation into synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 15, 4857-4876. Harpeer, D. R., Ming-Liu, K., and Kangro, H. O. (1990). Protein blotting: Ten years on. J. Virol. Meth. 30, 25-40. Hauber, R., Miska, W., Schleinkofer, L., and Geiger, R. (1989). New, sensitive, radioactivefree bioluminescence-enhanced detection system in protein blotting and nucleic acid hybridization. J. Biolumin. Chemilumin. 4, 367-372. Heller, M. J., and Jablonski, E. J. (1987). Single-strand polynucleotide sequences fluorescent hybridization assay. Eur. Patent 229943. Heller, M. J., and Morrison, L. E. (1985). Chemiluminescent and fluorescent probes for DNA hybridization systems. In "Rapid Detection and Identification of Infectious Agents" (D. T. Kingsbury and S. Falkow, eds.), pp. 245-256. Academic Press, Orlando, Florida. Hill, H. A. O., Gear, M. J., Williams, S. C., and Green, M. J. (1986). Magnetized nucleic acid sequence comprising single- or double-stranded nucleic acid linked to magnetic or magnetizable substance. WO Patent 8605815. Hitachi Chemical Company (1992). Porphyrazine fluorescent labeling dye for determination of antigens. Jap. Patent 4351961. Hogan, J. J., and Milliman, C. L. (1989). Enhancing nucleic acid hybridization. Eur. Patent 318245. Holland, P. M., Abramson, R. D., Watson, R., Will, S., Saiki, R. K., and Gelfand, D. H. (1992). Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase. Clin. Chem. 38, 462-463. Hopman, A. H. N., Wiegant, J., Tesser, G. I., and Van Duijn, P. (1986). A nonradioactive in situ hybridization method based on mercurated nucleic acid probes and sulfhydrylhapten ligands. Nucleic Acids Res. 14, 6471-6488. Hooper, C. E., and Ansorge, R. E. (1990). Quantitative luminescence imaging in the biosciences using the CCD camera: Analysis of macro and microsamples. Trends Anal. Chem. 9, 269-277. Hooper, C. E., Ansorge, R. E., and Rushbrooke, J. G. (1993). Measurement and analysis of chemiluminescent protein and DNA blots using photon imaging with an intensified CCD camera. In "Bioluminescence and Chemiluminescence: Status Report" (A. Szalay, L. J. Kricka, and P. Stanley, eds.), pp. 23-27. Wiley, Chichester.
I. Analytical Strategies and Applications
33
Hornes, E., and Korsnes, L. (1990a). Novel nucleic acid probes. WO Patent 9006045. Hornes, E., and Korsnes, L. (1990b). Detection and quantitative determination of target RNA or DNA. WO Patent 9006042. Hu, N., and Messing, J. (1982). The making of strand-specific M13 probes. Gene 17, 271-277. Huber, M., Gitler, C., Revel, M., Mirelman, D., Garfinkel, L. I., and Giladi, M. (1990). DNA probes for Entamoeba histolytica detection and differentiation. G. B. Patent 2223307. Jeffreys, A. J. (1993). Characterising genomic DNA test samples. Eur. Patent 530009. Jolley, M. E., and Ekenberg, S. J. (1986). Solid phase nucleic acid hybridization assay involves hybridization whilst solid carrier is suspended for use in DNA or RNA assay. Eur. Patent 200113. Jones, P. L., Greenfield, I. M., Hooper, C. E., Ansorge, R., and Stanley, M. A. (1991). Quantification of levels of mutant ras protein in keratinocytes transfected with activated ras oncogenes. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 175-178. Wiley, Chichester. Kalsheker, N. (1993). The molecular pathology of alpharantitrypsin deficiency: Techniques for the detection of single point mutations of the gene. In "Molecular Diagnostics" (R. Rapley and M. R. Walker, eds.), pp. 169-179. Blackwell, Oxford. Kam, W., Rail, L. B., Smuckler, E. A., Schmid, R., and Rutter, W. J. (1982). Hepatitis B viral DNA in liver and serum of asymptomatic carriers. Pror Natl. Acad. Sci. U.S.A. 79, 7522-7526. Kasahara, Y., and Ashihara, Y. (1986). Heat-resistant enzyme-labeled polynucleotide for polynucleotide determination. Jap. Patent 61009300. Keller, G. H., and Manak, M. M. (1989). "DNA Probes." Stockton Press, New York. Keller, G. H., Cumming, C. U., Huang, D. P., Manak, M. M., and Ting, R. (1988). A chemical method for introducing haptens onto DNA probes. Anal. Biochem. 170, 441-450. Kenten, J. H., Casadei, J., Link, J., Lupold, S., Willey, J., Powell, M., Rees, A., and Massey, R. (1991). Rapid electrochemiluminescence assays of polymerase chain reaction products. Clin. Chem. 37, 1626-1632. Kerem, B.-S., Rommens, J. M., Buchanan, J. A., Markiewicz, D., Cox, T. K., Chakravarti, A., Buchwald, M., Tsui, L.-C. (1989). Identification of the cystic fibrosis gene: Genetic analysis. Science 245, 1073-1080. Knowles, D. M., II, Pellici, P. G., and Dalla-Favera, R. (1987). Immunoglobulin and T cell receptor beta chain gene DNA probes in the diagnosis and classification of human lymphoid neoplasia. Mol. Cell. Probes 1, 15-31. Knudson, A. G. (1986). Genetics of human cancer. Annu. Rev. Genet. 20, 231-251. Kok, L. J. (1991). Automated immunoassays for western blot assays. G.B. Patent 2239092. Korom, G. K., Caplan, D. E., Eng, K. K. M., and Hansa, J. G. (1989). Reagent delivery system for solid-phase assay device. Eur. Patent 299359. Kramer, F. R., Lizardi, P. M., and Tyagi, S. (1992). Qbeta amplification assays. Clin. Chem. 38, 456-457. Kricka, L. J. (1985). "Ligand-Binder Assays." Dekker, New York. Kricka, L. J. (1991). Chemiluminescent and bioluminescent techniques. Clin. Chem. 37, 1472-1481. Kricka, L. J., Stott, R. A. W., and Thorpe, G. H. G. (1988a). Enhanced chemiluminescence enzyme immunoassays. In "Complementary Immunoassays" (W. P. Collins, ed.), pp. 160-179. Wiley, Chichester, England. Kricka, L. J., O'Toole, M., Thorpe, G. H. G. H., and Whitehead, T. P. (1988b). Enhanced chemiluminescent or luminometric assay. U.S. Patent 4729950. Kricka, L. J., Thorpe, G. H. G. H., and Whitehead, T. P. (1986). Enhanced chemilumine-scent or luminometric assay. U.S. Patent 4598044. Kunkel, L. M., Beggs, A. H., and Hoffman, E. P. (1989). Molecular genetics of Duchenne and Becker muscular dystrophy; emphasis on improved diagnosis. Clin. Chem. 35, B21-B24.
34
Larry J. Kricka
Kuhns, M. C. (1988). Target nucleic acid sequences detection. Eur. Patent 278220. Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMichelle, L. J., and Gingeras, T. S. (1989). Transcription-based amplification system detection of amplified human deficiency virus type I with a bead-based sandwich hybridization format. Proc. Natl. Acad. Sci. U.S.A. 86, 1173-1177. Landry, M. L. (1990). Nucleic acid hybridization in viral diagnosis. Clin. Biochem. 23, 267-277. Leary, J. J., Brigati, D. J., and Ward, D. C. (1983). Rapid and sensitive colorimetric method for visualizing biotin-labeled DNA probes hybridized to DNA or RNA on nitrocellulose: Bio-blots. Proc. Natl. Acad. Sci. U.S.A. 80, 4045-4049. Leary, J. J., and Ruth, J. L. (1989). Nonradioactive labeling of nucleic acid probes. In "Nucleic Acid and Monoclonal Antibody Probes" (B. Swaminathan and G. Prakash, eds.), pp. 33-57. Dekker, New York. Lebacq, P., Squalli, D., Duchenne, M., Pouletty, P., and Joannes, M. (1988). A new sensitive nonisotopic method using sulfonated probes to detect picogram quantities of specific DNA sequences on dot blot hybridizations. J. Biochem. Biophys. Methods 15, 255-266. Lee, H. (1993). Infectious disease testing by ligase chain reaction. Clin. Chem. 39, 729-730. Li, M. K., McLaugglin, D., Palome, E., and Kessler, J. (1989). Release of nucleic acid from sample. Eur. Patent 337690. Lion, T., and Haas, O. A. (1990). Nonradioactive labeling of probe with digoxigenin by polymerase chain reaction. Anal. Biochem. 188, 335-337. Lizardi, P. M., Guerra, C. E., Lomeli, H., Tussie-Luna, I., and Kramer, F. R. (1988). Exponential amplification of recombinant RNA hybridization probes. Biotechnology 6, 1197-1202. Lorincz, A. T. (1990). Nucleic acid hybridization probes. U.S. Patent 4908306. Lovell, M. A. (1989). Molecular genetics of leukemia and lymphoma. Clin. Chem. 35, B43-B47. Lutz, S., Welter, C., Zang, K. D., Sietz, G., Blin, N., and Urbschat, K. (1992). A twocolour technique for chromosome in situ hybridization in tissue sections. J. Pathol. 167, 279-282. Malcolm, A. D. B., and Nicolas, J. L. (1984). Method of detecting a polynucleotide sequence and labeled polynucleotides useful therein. WO Patent 8403520. Malek, L., Darasch, S., Davey, C., Henderson, G., Howes, M., Lens, P., and Sooknanan, R. (1992). Application of NASBA TM isothermal nucleic acid amplification method to the diagnosis of HIV-I. Clin. Chem. 38, 458. Mantero, G., Zonaro, A., Albertini, A., Bertolo, P., and Primi, D. (1991). DNA enzyme immunoassay: General method for detecting products of polymerase chain reaction. Clin. Chem. 37, 422-429. Massey, R. J., Powell, M. J., Mied, P. A., Feng, P., Della, C. L., Dressick, W. J., and Poonian, M. S. (1987). Electrochemiluminescent assays and kits using ruthenium and osmium bipyridyl complexes as labels. WO Patent 8706706. Mathies, R. A., and Stryer, L. (1986). Single molecule fluorescence detection: A feasibility study using phycoerythrin. In "Applications of Fluorescence in the Biomedical Sciences" (D. Lansing Taylor, A. S. Waggoner, R. F. Murphy, F. Lanni, and R. R. Birge, eds.), pp. 129-140. Liss, New York. Matkovich, V. I. (1989). Detection of components in liquid sample. Eur. Patent 295069. Matthews, J. A., and Kricka, L. J. (1988). Analytical strategies for the use of DNA probes. Anal. Biochem. 169, 1-25. Matthews, J. A., Batki, A., Hynds, C., and Kricka, L. J. (1985). Enhanced chemiluminescent method for the detection of DNA dot-hybridization assays. Anal. Biochem. 151, 205-209. Maxam, A., and Gilbert, W. (1977). A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74, 560-564.
I. Analytical Strategies and Applications
35
McCormick, R. M. (1987). Arabinonucleic acid probes. Eur. Patent 227459. McGadey, J. (1970). A tetrazolium method for nonspecific alkaline phosphatase. Histochemie 23, 180-184. McGowan, K. L. (1989). Infectious diseases: Diagnosis utilizing DNA probes. Clin. Pediatr. 28, 157-162. McLaughlin, G. L., Subramanian, S., Lepers, J. P., Raharimaalala, L., and Deloron, P. (1993). Evaluation of a nonisotopic DNA assay kit for diagnosing Plasmodium falciparum malaria in Madagascar. Am. J. Trop. Dis. 48, 211-215. McMahon, M. E., and Gordon, J. (1990). Improved reaction kinetics in nucleic acid hybridization using porous chromatographic material as solid support. Eur. Patent 387696. Miller, C. A., Patterson, W. L., Johnson, P. K., Swartzell, C. T., Wogoman, F., Albarella, J. P., and Carrico, R. J. (1988). Detection of bacteria by hybridization of rRNA with DNA-latex and immunodetection of hybrids. J. Clin. Microbiol. 26, 1271-1276. Mishiro, S., and Nakamura, T. (1990). Non-A, non-B hepatitis virus genome RNA. Eur. Patent 377303. Misiura, K., Durrant, I., Evans, M. E., and Gait, M. J. (1990). Biotinyl and phosphotyrinosyl phosphoramidite derivatives useful in the incorporation of multiple reporter groups on synthetic oligonucleotides. Nucleic Acids Res. 18, 4345-4354. Miska, W., and Geiger, R. (1987). Synthesis and characterization of luciferin derivatives for use in bioluminescence-enhanced enzyme immunoassays. New ultrasensitive detection systems for enzyme immunoassays I. J. Clin. Chem. Clin. Biochem. 25, 23-30. Miska, W., and Geiger, R. (1990). Luciferin derivatives in bioluminescence-enhanced enzyme immunoassays. J. Biolumin. Chemilumin. 4, 119-128. Morrison, L. E. (1987). Competitive homogeneous assay. Eur. Patent 232967. Morrison, L. E. (1989). Improved luminescent homogeneous assays. U.S. Patent 4822733. Morrison, L. E. (1993). Chromosome analysis by multicolor in situ hybridization using direct-labeled fluorescent probes. Clin. Chem. 39, 733-734. Morrison, L. E., Halder, T. C., and Stols, L. M. (1989). Solution-phase detection of polynucleotides using interacting fluorescent labels and competitive hybridization. Anal. Biochem. 183, 231-244. Mullis, K. B. (1987). Process for amplifying nucleic acid sequences. U.S. Patent 4683202. Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350. Murao, Y., and Hosaka, S. (1987). Specific binding assay. Eur. Patent 244207. Musso, G. F., Ghosh, G. F., Orgel, L. E., and Wahl, G. M. (1987a). Carbonic anhydrase inhibitor-tagged nucleic acid probes. Eur. Patent 210021. Musso, G. F., Ghosh, G. F., and Gingeras, T. R. (1987b). New nucleic acid probes for hybridization assays. WO Patent 8702708. Musso, G. F., Ghosh, G. F., and Gingeras, T. R. (1989). Lanthanide chelated tagged nucleic acid probes. WO Patent 8904375. Nicolas, J. C., Balaguer, P., Terouanne, B., and Boussioux, A. M. (1990). Specific DNA or RNA sequence assay by bioluminescent reaction. Eur. Patent 362042. Northrup, M. A., Ching, M. T., White, R. M., and Watson, R. T. (1993). DNA amplification with a microfabricated reaction chamber. Proceedings of the 7th International Conference on Solid-State Sensors and Actuators, pp. 924-926. Odelberg, S. J., Demers, D. B., Westin, E. H., and Hossaini, A. A. (1988). Establishing paternity using minisatellite DNA probes when the putative father is unavailable for testing. J. Forens. Sci. 33, 921-928. Old, J. M. (1993). Investigation and diagnosis of haematological defects. In "Molecular Diagnostics" (R. Rapley and M. R. Walker, eds.), pp. 180-194. Blackwell, Oxford. Olympus Optical Company (1993). Detection of nucleic acid in sample with several independent complementary chains. Jap. Patent 5236998.
36
Larry J. Kricka
Orgel, L. E. (1989). Amplification of a target DNA segment of known sequence. WO Patent 8909835. Oser, A., Collasius, M., and Valet, G. (1990). Multiple end labeling of oligonucleotides with terbium chelate-substituted psoralen for time-resolved fluorescence detection. Anal. Biochem. 191, 295-301. Osther, K. B. (1987). Detection of antibodies to HTLV-III. WO Patent 8707647. Owerbach, D. (1990). DQ beta gene oligonucleotide(s) for detection of proclivity in humans for development of type I diabetes mellitus. U.S. Patent 4965189. Pinkel, D. (1993). Analysis of specific genes and entire genomes in human malignancies by fluorescence in situ hybridization. Clin. Chem. 39, 732-733. Pollard-Knight, D. V. (1991). Rapid and sensitive luminescent detection methods for nucleic acid detection. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 83-90. Wiley, Chichester, England. Potter, H. (1986). Simultaneous hybridization assay of multiple RNA or DNA fragments by stacking several test sheets with single probe sheet containing bands of labeled material. U.S. Patent 4613566. Prasher, D., McCann, R. O., and Cormier, M. J. (1985). Cloning and expression of the cDNA for Aequorin, a bioluminescent calcium-binding protein. Biochem. Biophys. Res. Commun. 126, 1259-1268. Prat, O., Lopez, E., and Mathis, G. (1991). Europium(Ill)cryptate: A fluorescent label for the detection of DNA hybrids on solid supports. Anal. Biochem. 195, 283-289. Prior, T. W. (1993). Duchenne and Becker muscular dystrophy: Current diagnostics. In "Molecular Biology and Pathology" (D. H. Farkas, ed.), pp. 187-200. Academic Press, San Diego. Rapier, J. M., Villamarzo, Y., Schochteman, G., Ou, C.-Y., Brakel, C. L., Donegan, J., Malzman, W., Lee, S., Kirtikar, D., and Gatica, D. (1993). Nonradioactive, colorimetric microplate hybridization assay for detecting amplified human immunodeficiency virus DNA. Clin. Chem. 39, 244-247. Rapley, R., and Walker, M. R., eds. (1993). "Molecular Diagnostics." Blackwell, Oxford. Renz, M. (1983). Polynucleotide-histone H-I complexes as probes for blot hybridizations. Eur. J. Mol. Biol. 2, 817-822. Renz, M., and Kurz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Richardson, R. W., and Gumport, R. I. (1983). Biotin and fluorescent labeling of RNA using T 4 RNA ligase. Nucleic Acids Res. 11, 6167-6184. Rigby, P. W. J., Dieckmann, M., Rhodes, C., and Berg, P. (1977). Labeling deoxyribonucleic acid to high specificity by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237-257. Riley, L. K., Marshall, M. E., and Coleman, M. S. (1986). A method for biotinylating oligonucleotide probes for use in molecular hybridizations. D N A 5, 333-337. Riordan, J. R., Rommens, J. M., Kerem, B.-S., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N., Chou, J.-L., Drumm, M. L., Iannuzzi, M. C., Collins, F. C., Tsui, L.-C. (1989). Identification of the cystic fibrosis gene; cloning and characterization of complementary DNA. Science 245, 1066-1073. Ropers, H. H. (1987). Use of DNA probes for diagnosis and prevention of inherited disorders. Eur. J. Clin. Inoest. 17, 475-487. Rossau, R., and Vanheuvers, H. (1989). Hybridization probes for Neisseria strains. Eur. Patent 337896. Rushbrooke, J. G., Hooper, C. E., Ansorge, R. E., and Neale, W. W. (1993). Luminescence imaging in the life sciences using an intensified CCD system. In "Bioluminescence and Chemiluminescence: Status Report" (A. Szalay, L. J. Kricka, and P. Stanley, eds.), pp. 28-32. Wiley, Chichester.
!. Analytical Strategies and Applications
37
Ruth, J. L. (1984). Chemical synthesis of nonradioactively labeled DNA hybridization probes. DNA 3, 123. Ruth, J. L., and Bryan, R. N. (1984). Chemical synthesis of modified oligonucleotides and their utility as nonradioactive hybridization probes. Fed. Proc. 43, 2048. Ruth, J. L., Morgan, C. A., and Pasko, A. (1985). Linker arm nucleotide analogs useful in oligonucleotide synthesis. DNA 4, 93. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnhein, N. (1985). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle-cell anemia. Science 230, 1350-1354. Sanchez-Pescador, R., Stempien, M. S., and Urdea, M. S. (1988). Rapid chemiluminescent nucleic acid assays for the detection of TEm-1 beta-lactamase-mediated penicillin resistance in Neisseria gonorrhoeae. J. Clin. Microbiol. 26, 1934-1938. Schaap, A. P., and Akhaven-Tafti, H. (1990). New chemiluminescent 1,2-dioxetane derivatives. WO Patent 9007511. Schaap, A. P., Akhaven, H., and Romano, L. J. (1989). Chemiluminescent substrates for alkaline phosphatase: Applications to ultrasensitive enzyme-linked immunoassays and DNA probes. Clin. Chem. 35, 1863-1864. Schneppenheim, R., and Rautenberg, P. (1987). A luminescence Western blot with enhanced sensitivity for antibodies to human immunodeficiency virus. Eur. J. Microbiol. 6, 49-51. Schowalter, D. B., and Sommer, S. S. (1989). The generation of radiolabeled DNA and RNA probes with polymerase chain reaction. Anal. Biochem. 177, 90-94. Schroeder, H. R., Boguslaski, R. C., Carrico, R. J., and Buckler, R. T. (1978). Monitoring specific binding reactions with chemiluminescence. Methods Enzymol. 57, 424-445. Seveus, L., Vaisal, M., Syrjanen, S., Sandberg, M., Kuusisito, A., Harju, R., Salo, J., Hemmila, I., Kojola, H., and Soini, El (1992). Time-resolved fluorescence imaging of europium chelate label in immunohistochemistry and in situ hybridization. Cytometry 13, 329-338. Shah, D. O., and Wang, C. J. (1992). Paramagnetic microparticles for biomedical use. WO Patent 9222201. Shah, J. S., Chan, S. W., Pitman, T. B., and Lane, D. J. (1989). Detection of Yersinia enterolitica. Eur. Patent 339783. Sheldon, E., Kellogg, D. E., Levenson, C., Bloch, W., Aldwin, L., Birch, D., Goodson, R., Sheridan, P., Horn, G., Watson, R., and Erlich, H. A. (1987). Nonisotopic M13 probes for detecting the beta-globin gene: Application to diagnosis of sickle-cell anaemia. Clin. Chem. 33, 1368-1371. Sheldon, E. L., Briggs, J., Bryan, R., Cronin, M., Oval, M., McGall, G., Gentalen, E., Miyada, C. G., Masino, R., Modlin, D., Pease, A., Solas, D., and Fodor, S. P. A. (1993). Matrix DNA hybridization. Clin. Chem. 39, 718-719. Sidransky, D. (1993). Gene mutations aid cytologic screening of cancer. Clin. Chem. 39, 708-709. Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. (1987). Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Smith, D. F., Stults, N. L., Rivera, H., Gehle, W. D., Cummings, R. D., and Cormier, M. J. (1991). Application of recombinant bioluminescent proteins in diagnostic assays. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 529-532. Wiley, Chichester. Smith, H. V., and Campbell, A. T. (1991). Detection of surface associated macromolecules on parasites using a biotin-streptavidin enhanced chemiluminescence western blot technique: analysis of trophozoites of Giardia intestinalis. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 321-334. Wiley, Chichester.
38
Larry J. Kricka
Smith, H. V., Mayambo, T. M., Dunlop, E. M., and Holmes, P. H. (1991). Analyses of drug binding to serum macromolecules using a biotin-streptavidin enhanced chemiluminescence western blot technique. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 327-330. Wiley, Chichester. Smith, L. M., Fung, S., Hunkapiller, M. W., Hunkapiller, T. J., and Hood, L. (1985). The synthesis of oligonucleotides containing an aliphatic amino group at the 5'-terminus: Synthesis of fluorescent DNA primers for use in DNA sequence analysis. Nucleic Acids Res. 13, 2399-2412. Sodja, A., and Davidson, N. (1978). Gene mapping and gene enrichment by the avidin-biotin interaction: Use of cytochrome c as a polyamine bridge. Nucleic Acids Res. 5, 385-401. Soini, E., and Lovgren, T. (1987). Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit. Rev. Anal. Chem. 18, 105-154. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Southern, E. M., Maskos, U., and Elder, J. K. (1992). Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: Evaluation using experimental models. Genomics 13, 1008-1017. Soutschekb, E., Motz, M., and Wolf, H. (1989). New DNA containing HIV coding sequences. Ger. Patent 3724016. Spector, S. A., and Spector, D. H. (1985). The use of DNA probes in studies of human cytomegalovirus. Clin. Chem. 31, 1514-1520. Sproat, B. A., Beijer, B., and Rider, P. (1987). The synthesis of protected 5'-amino-2',5'dideoxyribonucleoside 3'-O-phosphoramidites; applications of 5'-amino-oligoribonucleotides. Nucleic Acids Res. 15, 6181-6196. Stabinsky, Y (1986). Preparation of functionalised polynucleotide using synthesis of polynucleotide on a hydroxylamine-linked support-bound carboxyl. WO Patent 8607361. Stanley, C. J., and Johannsson, A. (1988). Device for biochemical assay. WO Patent 8804428. Strachan, T., Sinnott, P. J., Smeaton, I., Dyer, P. A., and Harris, R. (1987). Prenatal diagnosis of congenital hyperplasia. Lancet ii, 1273-1274. Stults, N. L., Stocks, N. A., Cummings, R. D., Cormier, M. J., and Smith, D. F. (1991). Applications of recombinant bioluminescent proteins as probes for proteins and nucleic acids. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 533-536. Wiley, Chichester, England. Sutherland, R. M., Bromley, P., and Gentile, B. (1987). Determining specifically sequenced nucleic acid. Eur. Patent 245206. Syvanen, A.-C., Alanen, M., and Soderlund, H. A. (1985). Complex of single-strand binding protein and MI3 DNA as hybridization probe. Nucleic Acids Res. 13, 2789-2802. Syvanen, A.-C., Tchen, P., Ranki, M., and Soderlund, H. (1986). Time-resolved fluorimetry: A sensitive method to quantify DNA-hybrids. Nucleic Acids Res. 14, 1017-1028. Taub, F. (1986). Assay for nucleic acid sequences especially genetic lesions. WO Patent 8603227. Taub, F. (1990). Conjugation of enzyme and nucleic acid molecule. U.S. Patent 4873187. Tchen, P., Fuchs, R. P. P., Sage, E., and Leng, M. (1984). Chemically modified nucleic acids as immunodetectable probes in hybridization experiments. Proc. Natl. Acad. Sci. U.S.A. 81, 3466-3470. Tedesco, J. L., and Peterson, J. (1988). Isolating DNA and/or RNA from samples containing protein. WO Patent 8808036. Thacker, J., Webb, M. B. T., and Debenham, P. G. (1988). Fingerprinting cell lines; use of human hypervariable DNA probes to characterize mammalian cell cultures. Somatic Cell Mol. Genet. 14, 519-525. Thompson, J. D., Decker, S., Haines, D., Collins, R. S., Feild, M., and Gillespie, D.
I. Analytical Strategies and Applications
39
(1989). Enzymatic amplification of RNA purified from crude cell lysate by reversible target capture. Clin. Chem. 35, 1878-1881. Thornton, J. I. (1989). DNA profiling. Chem. Eng. News Nov 20, 18-30. Thorpe, G. H. G., and Kricka, L. J. (1986). Enhanced chemiluminescent reactions catalyzed by horseradish peroxidase. Methods Enzymol. 133, 331-354. Tizard, R., Cate, R. L., Ramanchanidan, K. L., Voyta, J. C., Murphy, O. J., and Bronstein, I. (1990). Imaging DNA sequences with chemiluminescence. Proc. Natl. Acad. Sci. USA 87, 4514-4518. Towbin, H., and Gordon, J. (1984). Immunoblotting and dot immunobinding--Current status and outlook. J. Immunol. Meth. 72, 313-340. Towbin, H., Staehlin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. Toyo Soda Manufacturing Company (1989). Nucleic acid hybridization assay in biological samples. Jap. Patent 1046650. Turner, A. P. F., Hendry, S. P., and Cardosi, M. F. (1987). Bioelectrochemical electron transfer process. Eur. Patent 234938. Urdea, M. S. (1993). Synthesis and characterization of branched chain DNA (bDNA) for the direct and quantitative detection of CMV, HBV, HCV, and HIV. Clin. Chem. 39, 725-726. Urdea, M. S., and Warner, B. D. (1990). Chemiluminescent doubletriggered 1,2-dioxetanes. Eur. Patent Appl. 401001. Urdea, M. S., Running, J. A., Horn, T., Clyne, J., Ku, L., and Warner, B. D. (1987). A novel method for the rapid detection of specific nucleotide sequences in crude biologic samples without blotting or radioactivity; application to the analysis of hepatitis B virus in human serum. Gene 61, 253-264. Urdea, M. S., Warner, B. D., Running, J. A., Stempien, M., Clyne, J., and Horn, T. (1988). A comparison of nonradioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme-labeled synthetic oligodeoxyribonucleotide probes. Nucleic Acids Res. 16, 4937-4956. Urdea, M. S., Warner, B., Running, J. A., Kolberg, J. A., Clyne, J. M., Sanchez-Pescador, R., and Horn, T. (1990a). Amplified nucleic acid sandwich hybridization assay for hepatitis B virus using amplifier and capture probes. WO Patent 9013667. Urdea, M. S., Warner, B., Running, J. A., Kolberg, J. A., Clyne, J. M., Sanchez-Pescador, R., and Horn, T. (1990b). Nucleic acid multimer for hybridization assays. WO Patent 8903891. Viscidi, R. P., Connelly, C. J., and Yolken, R. H. (1986). Novel chemical method for the preparation of nucleic acids for nonradioactive hybridization. J. Clin. Microbiol. 23, 311-317. Wang, C. G. (1989). Assaying gene expressions. Eur. Patent 304845. Wang, C. J., Ammons, H. C., and Jolley, M. E. (1992). Detection of DNA/RNA by fluorescence polarization. 1410 Patent 9202983. Ward, W. W., and Cormier, M. J. (1978). Energy transfer via protein-protein interaction in Renilla bioluminescence. Photochem. Photobiol. 27, 389-396. Watanabe, H., and Shibata, S. (1990). DNA probe assay with bacterial luciferase system. Eur. Patent 386691. Weeks, I., Beheshti, I., McCapra, F., Campbell, A. K., and Woodhead, J. S. (1983). Acridinium esters as high-specific activity labels in immunoassay. Clin. Chem. 29, 1474-1479. Wenham, P. R. (1992). DNA-based techniques in clinical biochemistry: A beginner's guide to theory and practice. Ann. Clin. Biochem. 29, 598-624.
40
Larry J. Kricka
Wick, R. A. (1989). Photon counting imaging: Applications in biomedical research. BioTechniques 7, 262-268. Wilding, P., Shoffner, M. A., and Kricka, L. J. (1994). PCR in a silicon microstructure. Clin. Chem. 40, 1815-1818. Wilchek, M., and Bayer, E. A. (eds.) (1990). Avidin-biotin technology. Methods in Enzymology, 184, Academic Press, San Diego. Wilkinson, H. W., Sampson, J. S., and Plikaytis, B. B. (1986). Evaluation of a commercial gene probe for identification of Legionella cultures. J. Clin. Microbiol. 23, 217-220. Williams, D. L. (1985). Molecular biology in arteriosclerosis research. Arteriosclerosis 5, 213-227. Wirth, D. F., and Patel, R. J. (1990). Identification of mycobacteria by hybridization using specific nucleic acid sequence. Eur. Patent 398677. Wolfe, H. J. (1988). DNA probes in diagnostic pathology. Am. J. Clin. Pathol. 90, 340-344. Wong, G. (1986). Determination of a ligand using specific binding substance for ligand labeled with avidin and biotin-labeled enzyme. Eur. Patent 184701. Woo, S. L. C., Lidsky, A. S., Guttler, F., Chandra, T., and Robson, K. (1983). Cloned human phenylalanine hydroxylase gene allows prenatal diagnosis and carrier detection of classical phenylketonuria. Nature 306, 151-155. Woods, D., Madonna, J. M., and Mulcahy, L. S. (1990). Nucleic acid probe. Fur. Patent 353985. Wren, B. W., Clayton, C. L., Castledine, N. B., and Tabaqchali, S. (1990). Identification of toxigenic Clostridium dificile strains by using a toxin A gene-specific probe. J. Clin. Microbiol. 28, 1808-1812. Yabucaki, K. K., Isaacs, S. T., and Gamper, H. B. (1985). Probe for specific nucleic acid base sequences in hybridization assay. WO Patent 8502628.
Methods for Nonradioactive Labeling of Nucleic Acids Christoph Kessler Boehringer Mannheim GmbH Biochemical Research Center Department of Advanced Diagnostics D-82377 Penzberg, Germany
I. Overview II. Methods for Enzymatic Labeling A. DNA Labeling Techniques 1. Random-Primed Labeling 2. Nick Translation 3. Polymerase Chain Reaction
B. RNA Labeling Techniques C. Labeling of Oligodeoxynucleotides III. Methods for Chemical Labeling A. Light-Activated Labeling Techniques 1. Labeling with Azide Compounds 2. Labeling with Furocoumarin Compounds
B. Direct Derivatization with Chemical Tags 1. 2. 3. 4.
Noncovalent Labeling with Ethidium Bromide Derivatization with Sulphone Groups Derivatization with Fluorene Derivatives Derivatization with Mercury
C. Derivatization via Activated Linker Arms Carrying Detectable Haptens 1. 2. 3. 4. 5.
Transamination Allylamine Derivatization Bromo Derivatization Thiolation Substitution of Amino Groups with Bifunctional Reagents
D. Chemical Labeling of Oligonucleotides 1. Chemical Labeling during Oligonucleotide Synthesis with AllylamineModified Protected Synthesis Components 2. Chemical 5'-End-Labeling with Activated Ethyl- and Hexyl-Derivatives (Aminolink I/II) 3. Chemical 3'-End-Labeliing by Synthesis with Multifunctional Controlled Pore Glass Carriers (MF-CPG)
Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
41
42
ChristophKessler
IV. Methods for Chemical Labeling of DNA, RNA, and Oligodeoxynucleotides with Marker Enzymes A. Labeling of Oligodeoxynucleotides with Alkaline Phosphatase (SNAP/NICE System) B. Enhanced Chemiluminescence with Horseradish PeroxidaseLabeled Probes (ECL System) V. Overview of Factors Influencing Hybridization A. Rate of Reassociation B. Factors Affecting Stability of Hybrids VI. Overview of Detection Systems A. Detection Reactions B. Detection Formats References
I. O V E R V I E W Increased attempts have been made in the last decade to substitute radioisotopes like [3H], [14C], [32p], [35S]' or [125j] (Maitland et al., 1987) by nonradioactive reporter molecules for the detection of nucleic acids like DNA, RNA, or oligonucleotides (Matthews and Kricka, 1988; Keller and Manak, 1989). The most frequently applied indicator systems are based on hybridization of the nucleic acid target molecules (analytes) with nonradioactively labeled complementary nucleic acids (probes). These probes are coupled with a variety of detector systems either directly by covalent binding or indirectly by additional specific high-affinity interaction. Table I lists currently described nonradioactive nucleic acid labeling and detection systems. Most of the recently developed systems use enzymatic, photochemical, or chemical incorporation of the reporter group detected by optical, luminescence, fluorescence, metal-precipitating or electrochemical indicator systems (Meinkoth and Wahl, 1984; Pereira, 1986; Urdea et al., 1987; Donovan et al., 1987; Viscidi and Yolken, 1987; H6fler, 1987; Moench, 1987; Yolken, 1988; Kessler, 1991, 1992a). In vivo labeling of DNA directly in the cell with the thymidine analog 5-bromo deoxyuridine (BrdU) was also reported (Guesdon, 1992). In the direct systems, the analyte-specific probes are directly and covalently linked with the signal-generating reporter group; thus, the detection of nucleic acids in direct systems consists of hybrid formation between analyte and labeled probe; and signal generation via the covalently coupled reporter group. Frequently used direct reporter groups are fluorescent dyes like fluorescein and rhodamine (Lichter et al., 1990) as well as marker enzymes
%
<
Z
~
~~
_
N
X
<
m
~
X
,
~~ i
X
~
X
~
<<<<~
~
~
X
11
~
~z
0
<
X
0
I~
- ~ ..~ o,,,
X
~,...~
.'0
<
~
X
. ,...~
0
|
~
|
<
0
~
. ,.,.~
0
. ,...~
~,,,.~
. 0,..,,
<
0 ~,...~
<
~~
~.~
~
~.
mmmm<
~
==oo~
~i ~'.~~~-~~ ~
~0,...~
0
. ,,,,~
rJ
X X
+'
~<
~
Z
X
~
X e~
.~
_-b
E
0
X
~
k~
44
.,,,,
N m
II
.,...
I-,
0
0
0 0
r ,,.., 0 0
z
X " u,~ X
~~
0
<~
0
X
+
~
=
~i . o
9
~" ~ . _ _~.
X
~
ell
0
..,
J
X
.
0
r
.o
X
0
<
X X~r~
0
<~
~--~
X
-~.~~'-7.~
r.~
X _..
~
0
-'~
X
0
X
"~~
X
X
0 9" - ~
~-r.
9- -
o
=
~
~
N
< _ = ~
o
oo
o
X
~
~
X
.~
X
|
< = ..~
X
~
~~
X
~
.,..~
..~
~
.,..~
~-~
.,,i
>~
~
X
<
. ,...q
~
~
~.
_
.,.~
. ,...q
~.
~
<
_
<
o
.,-~
,,...,
Z
~
}, ~
9.
,,...,
.~.
oo
o
r
d ca r
ca
a~
~-P,Z
o
45
46
ChristophKessler
like alkaline phosphatase (AP) (Jablonski et al., 1986; Jablonski and Ruth, 1986) or horseradish peroxidase (HRP) (Pollard-Knight et al., 1990). In contrast, the indirect systems first require the modification of the analyte-specific probe by introduction of a particular modification group. This modification group binds through an additional, noncovalent interaction to a universal reporter group; thus, the signal-generating reporter group is linked indirectly to the hybrid by an additional interaction between the modification group and a high-affinity binding partner coupled with the reporter group. The detection of nucleic acids in indirect systems is therefore divided into three reaction steps: hybrid formation between analyte and modified probe; specific noncovalent interaction between the modified probe and the binding partner coupled with the reporter group; and signal generation via the reporter group indirectly bound to the analyte. A variety of interaction pairs between modification group and binding partner have already been realized (Table II). Aside from the well-known systems using a vitamin [e.g., biotin (Langer et al., 1981; Forster et al., 1985; Chu and Orgel, 1985a; Reisfeld et al., 1987)] or a hapten [e.g., digoxigenin (Kessler, 1990, 1991, 1992b; Kessler et al., 1990; Hrltke et al., 1990, 1991; Seibl et al., 1990; Mtihlegger et al., 1990; HOltke and Kessler, 1990; Schmitz et al., 1991], alternative kinds of interaction with the respective modification groups have been established by either the selective binding of heavy metal ions [e.g., mercury (Bauman et al., 1983; Hopman et al., 1986a, 1986b], specific recognition of particular nucleic acid sequences [e.g., promoter or repressor sequences (Paau et al., 1983; Dattagupta et al., 1988)], or nucleic acid conformations [e.g., DNA/RNA hybrids (Van Prooijen-Knegt et al., 1982; Stollar and Rashtchian, 1987; Rashtchian et al., 1987; Coutlee et al., 1989a; 1989b; 1989c)]. Among the indirect systems, only the biotin and digoxigenin systems are characterized by subpicogram sensitivities; also, the fluorescein system has been reported to be of analogous sensitivity (Hrltke et al., 1992a). Even though the biotin system is characterized by high sensitivity and a wide range of applications, the disadvantage of this system is that an endogenous ubiquitous vitamin, vitamin H, is used as modification group (Lardy and Peanasky, 1953; Chaiet and Wolf, 1964; Greene, 1975). This results in higher background reactions especially with biological samples. The digoxigenin system, characterized by analogous sensitivity, circumvents these background side-reactions by using the cardenolide digoxigenin occurring only in Digitalis plants (Pataki et al., 1953; Reichstein and Weiss, 1962; Hegnauer, 1971). Besides various methods for linking fluorescent dyes of marker enzymes directly to nucleic acid probes, a broad repertoire of enzymatic, photochemical, and chemical labeling methods can be applied for introduction
2. Methods for Nonradioactive Labeling of Nucleic Acids
47
of modification groups into nucleic acid probes (Table III). The enzymatic reactions are catalyzed by a number of DNA-dependent DNA (DNAP) or RNA (RNAP) polymerases, RNA-dependent DNA polymerases (RT) or terminal transferases (TdT) (Langer et al., 1981; Ausubel et al., 1987; Kessler et al., 1990; H61tke and Kessler, 1990; Schmitz et al., 1991; H61tke et al., 1992b; Kessler, 1992a; Rashtchian and Mackey, 1992). The photochemical derivatization of nucleic acids can be accomplished using azide-containing compounds by the photochemical dissociation of nitrogen and subsequent reaction of the intermediate resulting nitrene (Forster et al., 1985; M0hlegger et al., 1990; H61tke et al., 1992b; Rashtchian and Mackey, 1992). Chemical modification can be performed by a number of alternative reactions: e.g., sulphite-catalyzed transamination, mercury and bromine derivatization, substitution of amino groups with bifunctional reagents, as well as mercaptane derivatization of amine residues of nucleotide bases (for review see Matthews and Kricka, 1988). Enzymatic labeling reactions are especially useful because they result in highly labeled nucleic acid probes that can be applied for high-sensitivity nucleic acid detection. The most frequently used sites of base modification are the C-5 position of uracil and cytosine, the C-6 of thymine, and the C-8 of guanine and adenine; these positions are not involved in hydrogen bonding. In addition, the N4-position of cytosine and the N6-position of adenine have been used for base modification. However, these sites are involved in hydrogen bonding. Oligonucleotides may also be modified at either the 5'- or 3'terminus; internal labeling at the 2-position of the deoxyribose as well as at the phosphate diester bridge is also possible.
II. METHODS FOR ENZYMATIC LABELING Enzymatic labeling procedures result in probes mediating highly sensitive nucleic acid detection. The various labeling methods comprise labeling of single- or double-stranded DNA, single-stranded RNA, and oligodeoxynucleotides as target molecules (see also Chan and McGee, 1990; PollardKnight, 1990; for actual protocols see Kessler, 1992a). In these enzymatic labeliing procedures, nucleotide analogs modified with particular haptens like biotin, digoxigenin, or fluorescein are used instead of or in combination with their nonmodified counterparts. In case of DNA fragments and oligodeoxynucleotides, hapten-dUTP, haptendCTP or hapten-dATP are applied as modified substrates (Langer et al., 1981; Gebeyhu et al., 1987; H61tke et al., 1992; Rashtchian and Mackey, 1992); for labeling RNA, hapten-UTP or hapten-CTP is used as nucleotide analog (H61tke and Kessler, 1990; 1992b; Rashtchian and Mackey, 1992).
48
N~ m
.4
~a
z
o
.,..,
I,-,
o oo
>
..ag -~,~ ~~,
o~, o,.., >
1.1
o~, >
.<
o,., .,.., 0 o,..,
o.,1 0 e~
o,., o,-,
a:
-.d
A
o,-,
~0 o._, 0
0 o,.,,
ca o ,.,.,
|
.j..,
~.~
.~
N
.-
o,..,
,,..,
A
o
~=.~
A [-
Z~a A =
0
Z. o "~
0
~
.=8 o,-,
....
A
<
o
o
~
~6
I=
A .. O
9 ..
~ A ~
.~
-
~
~
6
m
A
. _
e
O
.o
I
O r.~
O
O
!
Ox
= OZ
"O O
< Z
A~
< Z
<
ox
ox ~
ox
~I
oo
ox ,.in
o.
. .
A
-.~ e~
o
oo ~ ~ OO OO
9
.o
o~
~E
.o
~
~ ~
< Z
9 .~ ~ ~
O
o,_,
~z r~
"6
oo ox
<
O
o,~
i
O
o
Ox
I
b
O
<
O
<
i
49
50
Christoph Kessler
Table !!!
Possible Modes of Modification of Nucleic Acid Probes Reactive groups of binding partner: modifying agent Enzymatic modification dsDNA : M-dNTP/E. coli DNA polymerase I ssDNA : M-dNTP/primer/Klenow polymerase 3'-OH-ssDNA/RNA : M-dNTP, MddNTP/terminal transferase ssRNA : M-dNTP/primer/reverse transcriptase dsDNA transcription unit: M-NTP/ SP6,T7,T3 RNA polymerase
Photochemical modification ss,dsDNA/ss,dsRNA : Mazidobenzoyl/h
dsDNS/dsRNA : M-NS-intercalatora/h
Chemical modification DNA 9 CHO: M-hydrazide DNA 9 Hg 2§ : M-mercaptane
DNA 9 SH :M-amine DNA 9 NH2 :M-amine/SO32Allylamine-oligonucleotide :M-Nhydroxysuccinimide ester 5'-P-Oligonucleotide :M-Nhydroxysuccinimide ester/diaminoethyl, -hexyl 3'-MF-CPG-Oligonucleotide : M-Nhydroxysuccinimide ester a Psoralen, angelicin, acridin, Ethidium.
Reference(s)
Rigby et al. (1977); H61tke et al. (1990, 1992); Rashtchian and Mackey (1992) Langer et al. (1981); Gregersen et al. (1987); H61tke et al. (1990; 1992b); Rashtchian and Mackey (1992) Riley et al. (1986); Pitcher et al. (1987); Schmitz et al. (1991); H61tke et al. (1992b); Rashtchian and Mackey (1992) Vary et al. (1986); Eberle and Seibl (1992) McCracken (1989); Theissen et al. (1989); H61tke and Kessler (1990); H61tke et al. (1992b); Rashtchian and Mackey (1992) Ben-Hut and Song (1984); Forster et al. (1985); Cimino (1985); Miihlegger et al. (1990); H61tke et al. (1992b); Rashtchian and Mackey (1992) Brown et al. (1982); Dattagupta and Crothers (1984); Sheldon et al. (1985, 1987); Dattagupta et al. (1989) Resifeld et al. (1987) Dale et al. (1975); Bergstrom and Ruth (1977); Langer et al. (1981); Ward et al. (1982); Baumann et al. (1983); Hopman et al. (1986a; 1986b) Renz and Kurz (1984); Landes 1985; AlHakim and Hull (1986) Draper and Gold (1980); Viscidi et al. (1986); Gillam and Tenet (1986) Langer et al. (1981); Cook et al. (1988); Urdea et al. (1988) Agrawal et al. (1986)
Kempe et al. (1985); Nelson et al. (1989a; 1989b)
2. Methods for Nonradioactive Labeling of Nucleic Acids
51
Most of the labeling reactions are based on standard reactions (Ausubel et al., 1987; Sambrook et al., 1989a) adapted to modified nucleotides. In the case of DNA, homogeneous labeling can be obtained by random priming with Klenow polymerase, nick translation with Escherichia coli DNA polymerase I or by the polymerase chain reaction with Taq DNA polymerase. In the latter reaction, vector-free double- or single-stranded probes may be synthesized. DNA end-labeling can be achieved by the tailing reaction with terminal transferase preferentially at 3'-protruding ends, by the fill-in reaction with Klenow polymerase at 5'-protruding ends, or a T4 DNA polymerase replacement reaction by sequential action of 3' ~ 5' exonuclease and 5' ~ 3' polymerase at 3'-protruding fragment termini guided by the absence or presence of the respective nucleotides. Starting from RNA as template, labeled DNA probes can be synthesized with viral reverse transcriptase (AMV RT; Mo-MLV RT) by oligodeoxynucleotide-primed RNA-dependent DNA synthesis (reverse transcription) using hapten-modified deoxynucleotides (e.g., bio-dUTP, DIG-dUTP or fluor-dUTP) in addition to nonmodified deoxynucleotides as substrates. RNA can be homogeneously labeled by synthesizing "run-off" transcripts catalyzed by the phage-coded DNA-dependent SP6, T7, or T3 RNA polymerases. The promoter-directed RNA probe synthesis results in vector-free hybridization probes (cf. PCR-generated probes). Oligodeoxynucleotides can be enzymatically 3'-end-labeled by the tailing reaction with terminal transferase; internal enzymatic labeling is obtained with Klenow polymerase starting from short primers that bind to complementary sequences within the 3'-region of the template oligodeoxynucleotide strand.
A. DNA Labeling Techniques In this chapter, the three main labeling reactions will be discussed" random-primed labeling, nick translation, and synthesis of double-or single-stranded probes via PCR. Whereas nick translation is characterized by the exchange of unlabeled nucleotides by labeled nucleotides (replacement synthesis), both random-primed and PCR-mediated probe synthesis result in the new DNA sequences (net synthesis). With PCR, the novel sequences are synthesized in large excess over template DNA by the repeated amplification cycles.
1. Random-PrimedLabeling Besides labeling hybridization probes with radioisotopes, the randomprimed probe synthesis was adapted to a variety of nonradioactive modifi-
52
ChristophKessler
cation groups; e.g., biotin or digoxigenin (Kessler et al., 1990; Seibl et al., 1990). The reaction scheme is outlined in Fig. 1. Random-primed labeling was developed by Feinberg and Vogelstein (1983; 1984); labeling is catalyzed by Klenow polymerase (Pollk), the large fragment of E. coli DNA polymerase I (Poll) obtained by proteolytic subtilisin cleavage of Poll. The Klenow polymerase lacks the 5' ~ 3' exonuclease activity of the holoenzyme but still contains the 5' ~ 3' polymerase as well as the 3' ~ 5' exonuclease proofreading activity. For random priming, linear double-stranded DNA is first denatured (e.g., by heat treatment) and then chilled on ice to stabilize the singlestranded DNA chains. Supercoiled DNA is labeled to a lesser extent because of faster reannealing rates observed with this configuration; thus, circular DNA molecules have to be linearized before the labeling reaction to obtain high labeling densities. A random mixture of hexa-deoxynucleotides are annealed to the denatured single-stranded templates in a statistical manner; these annealed oligonucleotides serves as 3'-OH primers in the subsequent polymerase reaction. The probe synthesis is started by adding Klenow polymerase and all four deoxynucleotides, of which at least one (mostly dTTP or dATP) is replaced by a modified deoxynucleotide (hapten-dUTP or haptendATP). Since the primers have random specificity (random primers) they are able to bind to all possible target sequences; this means that the primers bind to the target molecule in a statistical manner. During the polymerization reaction, Klenow polymerase incorporates not only the nonmodified deoxynucleotides but also the hapten-modified substrates (e.g., bio-dUTP or DIG-dUTP); this results in highly labeled hybridization probes. If vector-free probes are to be synthesized, the vector sequences have to be removed before labeling by restriction enzyme treatment and subsequent fragment separation. During random-primed synthesis, both complementary target strands may act as templates after strand denaturation. Reannealing of both template strands is prevented by fixing the single-stranded configuration by low temperatures and by high primer concentrations. The ratio between primer and template DNA also inversely controls the length of the newly synthesized labeled probe; the higher the primer concentration, the shorter the synthesized probes. The resulting labeled probe is therefore a statistical mixture of individual probe chains complementary to different sequences of the template; in addition, the labeled DNA chains are markedly shorter than those of the input template DNA. Because both DNA strands of the original DNA act as templates, the sequences of the labeled probe chains are at least partially complementary, so that denaturation before hybridization is necessary. Labeling density depends on the ratio between hapten-modified and
2. Methods for Nonradioactive Labeling of Nucleic Acids
53
linearization of double-stranded circular DNA with appropriate restriction enzyme
heat-denaturation, chilling on ice
annealing of random primer
+ dATP, dGTP, dCTP, dTTP
~X~
+ hapten-dUTP and/or hapten-dATP Y + Klenow polymerase
0
CH=
CH=
o -
,i' ,'~ ,i'
~~ ~
o-r-o-r-o-r-o o _
0 _
~ ~ . ~ o X 4 . ~
-
o
o~_~ HO
Fig. 1--Random-primed labeling. (a) reaction scheme" (b) structure of hapten-modified basestabile deoxynucleoside triphosphate (DIG-[ 11]-dUTP).
.54
Christoph Kessler
non-modified dNTP; best results in terms of sensitivity of detection of labeled hybrids are obtained if mixtures of unmodified and hapten-modified deoxynucleotides are applied. In the case of digoxigenin incorporation, a mixture of 35% DIG-dUTP and 65% dTTP gives the best results (Hrltke et al., 1990). It should be noted that the optimal ratio is different using different haptens; thus, this ratio has to be determined for every labeling system. Random-primed labeling is very useful for labeling DNA fragments isolated from gels (ng-amounts); however, larger amounts up to several ~g can be labeled with this method because of newly synthesized DNA chains (net synthesis). The incorporation reaches a plateau after 30 to 60 min; during prolonged incubation, the incorporated label remains stable. The sensitivities obtained with probes modified with haptens such as biotin or digoxigenin via random-priming are in the range of 100 fg on blots (Kessler et al., 1990; Hrltke et al., 1990; 1992b; Rashtchian and Mackey, 1992). 2. Nick Translation
Nick translation was first developed for labeling hybridization probes with radioisotopes (Rigby et al., 1977). Subsequently the incorporation of modification groups into DNA by nick translation was reported (e.g., biotin: Langer et al., 1981; Rashtchian and Mackey, 1992; digoxigenin: Hrltke et al., 1990, 1992b). The reaction scheme of nick translation is shown in Fig. 2. Nick translation involves the simultaneous action of pancreatic deoxyribonuclease (DNaseI) and E. coli DNA polymerase I holoenzyme (Kornberg polymerase: Poll) on double-stranded DNA. DNaseI is a doublestrand specific endonuclease hydrolyzing phosphodiester bonds in DNA chains, resulting in short oligonucleotides characterized by 5'-phosphate groups. In the presence of Mg 2§ ions, the action of DNaseI is restricted to the generation of single-stranded nicks because of the independent action of the enzyme on each DNA strand. The rate of introducing nicks into the single-stranded chains depends on the concentration of DNaseI in the incubation mixture. Nick translation requires low concentrations of DNaseI; using these conditions, only a few nicks are introduced in each DNA strand. The generated free phosphorylated 5' ends within the nicks trigger the action of the Poll holoenzyme. Poll is characterized by three independent catalytic activities: 5' ~ 3' polymerase; 5' ~ 3' exonuclease; and 3' ~ 5' exonuclease (proofreading activity). The 5' ~ 3' exonuclease activity of PolI progressively removes deoxynucleotides from the phosphorylated 5' end; the 5' ~ 3' polymerase activity of Poll synchronously adds new deoxynucleoside triphosphates to the opposite free
2. Methodsfor NonradioactiveLabelingof NucleicAcids
1
I
I
I
55
I
I
!
!
I
I
I
!
I
i
!
I
I
i
I
I
I
i
I
I
!
1
! nicking of double-stranded DNA
/
l
with low amounts of DNase I
3' 5'
1
I
F~
|
'1
removal of nucleotide by 5' -~ 3' exonuclease of Pollk t
!
I
5'
l~
i|
<~
3' 5'
1
incorporation of hapten-dUTP and/or hapten-dATP by "T" 5' -~ 3' polymerase of Pollk
I
I
!
l~174
movement of nick
3' 51
movement of nick
3p 5p
J
I
I
I
I
I
I
I
I
i
Fig. 2---Nick translation. 3'-hydroxyl ends of the nick. If nonmodified deoxynucleoside triphosphates and hapten-modified deoxynucleoside triphosphates are in the reaction mixture, the hapten is incorporated during this polymerization reaction. Because Poll acts in a strict template-dependent manner, the nucleotide sequence remains unchanged during nick translation.
56
Christoph Kessler
As a result of the synergistic action of the two Poll activities, the nick moves along the DNA fragment in 5' ~ 3' direction, terminating at the 3' fragment end (nick translation). The net effect is the replacement of unlabeled nucleotides by labeled nucleotides in the double-stranded molecule (replacement synthesis). Because DNaseI acts in a statistical manner, nicks are introduced into both DNA strands; thus, both strands are labeled during nick translation, resulting in nearly fully labeled double-stranded molecules. Therefore, like probes prepared by random-priming, nicktranslated probes have to be denatured before hybridization. A critical parameter of nick translation is the ratio between DNaseI and Poll (Sambrook et al., 1989b). The ratio is not a fixed value but dependent on the amount, length, and configuration of the DNA to be labeled. Therefore the actual amounts of both enzymes needed for optimal nick translation should be determined when different kinds of DNA are used as targets for the labeling reaction. In order to determine the optimal enzyme concentrations, different amounts of both enzymes have to be tested with respect to nick-translation efficiency. The combination of both enzyme concentrations that gives best results is then used for subsequent preparative labeling reactions. Because hapten-modified probes are stable at - 2 0 ~ C for months or even years, large quantities of DNA probes can be synthesized, for comparable and reproducible results. As with random priming, the best labeling density depends on the optimal ratio between hapten-modified and unmodified deoxynucleotides, and this must be determined for every labeling system. Because labeling conditions have to be adapted to the nature of the DNA to be modified, the nick-translation technique is suitable for preparative labeling of DNA probes. The incorporation is optimal after 1 to 2 hr; longer incubation periods result in a slight decrease of the labeling product, caused by the input DNaseI and the exonuclease activities of Poll. The observed sensitivities using nick-translated biotin or digoxigenin probes are in the range of 100 to 500 fg on blots (Leary et al., 1983; Chan et al., 1985; Gebeyehu et al., 1987; H61tke et al., 1990, 1992b; Rashtchian and Mackey, 1992).
3. Polymerase Chain Reaction A powerful technique for labeling vector-flee DNA probes is the polymerase chain reaction (PCR). PCR was developed by Saiki et al. (1985b) and adapted to a variety of applications including amplification, sequencing, cloning, and probe synthesis (for review see Erlich, 1989; Erlich et al., 1989; Innis et al., 1990; Rolfs et al., 1992; White, 1993). Probes can be labeled by modification of either the two primers or the deoxynucleoside triphosphates used for polymerization (Reischl et al., 1993). The reaction scheme of PCR is shown in Fig. 3. The PCR is catalyzed by the thermosta-
2. Methods for Nonradioactive Labeling of Nucleic Acids
57
ble enzyme Taq DNA polymerase isolated from the thermophilic eubacterium Thermus aquaticus. The whole amplification reaction consists of up to 60 sequential temperature cycles and is performed as follows" 1. Denaturation of the target DNA into single strands by heat (90-95 ~ C); 2. Hybridization of two flanking antiparallel primers to the DNA single strands (40-60 ~ C); and a
b I
I
I
I
i
I
I
[
Target
[
l
I
I
I
~
denaturation,
~
primer I
l
1
I
1
l
I
I
I
I
1
1
i
i
I
I
i
i~
~
primer
binding
.w
Cycle
2
denaturation,
-mmmm~
~
primer i i i i i i J i i i ' ' '0
C~cle
I
I
!
I
I
I
sequence
I
jmmm~-
elongation ~
I
I
I
I
I
1
I
I
I
I
I
I
I
r
"~"
I
I
Cycle
r
. . . . .
I
Target
~
I
~
sequence
G~/cle 1
.w
l
I
1
1
1
1
I
~-.
primer
binding
Cycle
AN
2 Jmmmmi
.........
elongation ~
i i i , i i , i i ....
,
1
3-n
;
;
,
,
? ?1 ?I ,
Cycle
,
,
,
,
i
J ~
)2
n
3-n
4, (
Fill. 3--Labeling DNA probes via PCR. (a) modified primers; (b) modified deoxynucleoside triphosphates.
58
Christoph Kessler
3. Copying the two single strands by elongation of the primers using the heat-stable Taq DNA polymerase (70-75 ~ C). Since both single strands are copied simultaneously, the result is an exponential amplification of the target sequence. IfRNA is the starting material, a reverse transcription step has to precede the amplification reaction. In the first labeling approach, nonradioactively labeled PCR probes are generated by the use of 5'-terminal labeled primers. The most commonly employed 5'-terminal labels are biotin and a variety of fluorescent dyes (Chollet and Kawashima, 1985; Smith et al., 1985, 1986, 1987; Adarichev et al., 1987; Brosalina and Grachev, 1986; Ansorge et al., 1986, 1987). It is also possible to label PCR primers directly with marker enzymes, e.g. horseradish peroxidase or alkaline phosphatase (Levenson and Chang, 1990). Using HRP, 1" 1 adducts of enzyme to nucleic acid are formed. In the alternative labeling approach, the modification group is incorporated into the PCR product by modified deoxynucleoside triphosphates, resulting in homogeneously labeled vector-free hybridization probes. This approach has been described for biotin (Lo et al., 1988; Rashtchian and Mackey, 1992) as well as for digoxigenin (Seibl et al., 1990; Reischl et al., 1993). With this alternative approach/~g amounts of vector-free probes can be synthesized in a few hours. In the case of biotin, the optimal ratio between dTTP and bio-dUTP is 3: l, the respective ratio between dTTP and DIG-dUTP is 2:1 (H61tke et al., 1992b). Both labeling procedures can be used to generate probes of cloned inserts in which the sequence of the insert is still unknown. In this case primers directly flanking the cloning site have to be used. Applying biotinor digoxigenin-labeled PCR probes, sub-pg- amounts of target sequences can be detected on blots (Lo et al., 1988; Seibl et al., 1990; Reischl et al., 1993). This method results in probes containing both complementary strands in a labeled form; thus, before labeling, a denaturation step has to be included. In an alternative protocol, defined single-stranded DNA hybridization probes containing up to 5000 nucleotides are synthesized by a run o f f synthesis (St~irzl and Roth, 1990). This method is based on asymmetric PCR cycles using only one PCR primer and cutting the amplified sequence with an appropriate restriction enzyme at a site located at a defined distance from the primer binding site. The resulting hybridization probes are as sensitive as probes obtained by nick translation, but they hybridize in a strand-specific manner. The single-stranded DNA probes can be handled under the same conditions as nick-translated probes and offer the benefits of single-stranded RNA run-off probes and the stability of DNA probes. If the sequence of interest is cloned into a multiple cloning site flanked by two different, antiparallel primer sites [e.g., SP6 and T7 primers in
2. Methods for Nonradioactive Labeling of Nucleic Acids
59
pSPT18/19 (Pfeiffer and Gilbert, 1988)], single-stranded sense and antisense DNA probes can be synthesized using either the SP6 or T7 primer after cutting the insert for asymmetric PCR.
B. RNA Labeling Techniques RNA probes are commonly synthesized with the RNA polymerases from bacteriophages SP6, T7, or T3 by in vitro transcription of DNA, which is cloned into appropriate transcription vectors like the pSPT-vector family containing highly specific SP6-, T7-, or T3-specific promoters in front of a multiple cloning site (Melton et al., 1984; Morris et al., 1986; Krieg and Melton, 1987). Cloning particular DNA fragments in one of these restriction sites results in complete transcription units acting as templates for DNA-dependent RNA synthesis. The reaction scheme of in vitro RNA synthesis is shown in Fig. 4. The RNA polymerase-catalyzed reaction commonly starts by initiation of the transcription reaction with a purine ribonucleoside triphosphate at a fixed position downstream of the promoter sequence (Butler and Chamberlin, 1982). If a modified ribonucleotide is added to the nonmodifled nucleotide mixture, the growing RNA chain is labeled by integration of the modified ribonucleotide. Mostly hapten-labeled CTP or UTP (e.g., bio-CTP; DIG-UTP) is used as labeling reagent (Theissen et al., 1989; Htiltke and Kessler, 1990; Hrltke et al., 1992b; Rashtchian and Mackey, 1992). The transcription reaction is terminated at the end of the linearized transcription unit; thus hapten-modified probe molecules of defined length and sequence are synthesized. The completion of the transcription reaction requires 1-2 hr depending on the desired labeling density; e.g., with digoxigenin, labeling with 35% digoxigenin-modified UTP and 65% UTP reaches an optimum after 2 hr with T7 RNA polymerase. Using 1 /zg template DNA and 1 mM ATP, GTP and CTP each, 0.65 mM UTP and 0.35 mM DIG-UTP in 20/xl transcription buffer including 20 units RNase inhibitor, up to 20/zg labeled transcripts may be obtained. Thus, in vitro labeling with RNA polymerases may be used for preparative RNA probe synthesis. After the transcription reaction, the template DNA can be removed by digestion with RNase-free DNase. The resulting labeled RNA probe contains no vector sequences, so that cross-hybridization caused by unspecific interaction between vector and target sequences is absent during hybrid formation. Although the core region of phage-specific promoters is only 17 nucleotides in length and differs in only a few nucleotides between SP6, T7, and T3 promoters (Pfeiffer and Gilbert, 1988), the promoters are highly specific
60
ChristophKessler insert
RE
promote
linearization of transcription vector, containing phage promotor (s) and cloned insert DNA, with appropriate restriction enzyme
O
+ ATP, CTP, GTP, UTP + hapten-UTP 1 " + SP6 or T7 RNA polymerase
RNA synthesis by
|
in vitro transcription
1
from phage promoter
"run-off' transcripts of defined length
synthesis of up to 20Hg of RNA per Hg template DNA
Fig. 4m"Run-off" RNA synthesis.
for the respective RNA polymerase (Butler and Chamberlin, 1982; Kassavetis et al., 1982). After linearization of the recombinant clone directly downstream of the transcription unit, run-off transcripts of defined length are synthesized. By positioning two promoters of different specificity and
2. Methods for Nonradioactive Labeling of Nucleic Acids
61
polarity at both sides of the transcription unit, transcription of both sense (coding) and antisense (noncoding) RNA can be initiated. The advantages of RNA probes (e.g., single-strandedness, non-selfcomplementarity, defined length, and higher stability of the RNA/DNA hybrids have been widely exploited in different hybridization applications. In most cases radioactively labeled probes have been used and these have all the pitfalls of instability, low resolution, and all the disadvantages of handling isotopes. Applying nonradioactively labeled RNA probes in blot experiments as little as 0.1 pg homologous DNA or RNA can be detected in dot, Southern or Northern blots. This sensitivity is comparable with that obtained with radioactively labeled RNA probes.
C. Labeling of Oligodeoxynucleotides The method of choice for enzymatic labeling of oligodeoxynucleotides is the tailing reaction catalyzed by terminal transferase. This enzymatic approach complements the chemical labeling methods described in the next section (see also Kempe et al., 1985). Synthetic oligonucleotides are currently applied to almost every field of molecular biology as well as in diagnostic and forensic applications. These include hybridization of oligodeoxynucleotides to cloned DNA and genomic digests, screening of gene libraries, restriction-site mapping of cloned DNA, gel-shift assays, and a variety of in situ hybridization approaches. The recently developed S o u t h - W e s t e r n hybridization technique for the isolation of DNA-binding proteins and characterization of the DNA-binding sequences also makes use of synthetic oligodeoxynucleotides (Dooley, 1992). The terminal transferase-catalyzed tailing reaction is based on the property of this enzyme to add deoxy- or dideoxyribonucleotides to 3' ends of DNA in a template-independent manner (Roychoudhury et al., 1979; Tu and Cohen, 1980). Repeated enzymatic addition of a particular nucleotide results in the generation of homopolymeric tails that do not hybridize with the target DNA sequence. The nature of the incorporated nucleotides is dependent only on the nature of the deoxyribonucleoside triphosphates employed. However, the reaction conditions differ for the incorporation of the various nucleotides. In the tailing reaction, the oligodeoxynucleotide is labeled only within the tail sequence; labeling of the probe sequence within the hybridizing region does not occur. The outline of the tailing reaction is shown in Fig. 5. If biotin-labeled deoxynucleotides are used, the best sensitivity is obtained with a 1"2 mixture of bio-dUTP/dUTP (Riley et al., 1986; Keller and Manak, 1989) or nondiluted bio-dCTP (Rashtchian and Manak, 1992);
62
Christoph Kessler Oligonucleotide with specific sequence
5'
+ hapten-ddUTP < ~ + terminal transferase ~
addition of a single hapten-ddUTP nucleotide
3'-OH
dATP + hapten-dUTP < ~ terminal transferase
template independent synthesis of a DNA tail (40 - 50 nucleotides) with several hapten-molecules incorporated
Fig. 5--Enzymatic 3'-end-labeling of oligodeoxynucleotides via the tailing reaction with modified dNTPs or ddNTPs.
if digoxigenin is used as modification, group tailing of oligodeoxynucleotides with a 1 : 10 mixture of DIG-dUTP/dATP results in labeling at every 10-12 nucleotides within a total tail length of 40 to 50 nucleotides. Unspecific cross-hybridization by these DIG-dUMP-labeled oligo(dA) tails is not observed. The addition of fluorescein-labeled ddCMP residues to DNA has also been reported (Trainor and Jensen, 1988). With DIG-labeled 30mers, as low as 50 pg DNA can be detected on blots. Compared with labeled DNA or RNA probes, the reduced sensitivity reflects the reduced length of hybridization region. Labeling of the 3'-end of the same 30mer oligodeoxynucleotide with DIG-2',3'oddUTP results in the incorporation of a single modified nucleotide because of the chain termination reaction. The application of these monolabeled oligodeoxynucleotide probes leads to a sensitivity of 500 pg DNA on blots (Schmitz et al., 1991). Because there is no shift in Tm as compared with the nonmodified oligodeoxynucleotide, the tailing reaction is suitable for labeling not only oligodeoxynucleotides but also short DNA fragments (100-200 bp in length) for which Tm is a critical factor.
III. METHODS FOR CHEMICAL LABELING A variety of chemical procedures for modification of nucleic acids have been described. These chemical labeling procedures can be categorized into light-induced labeling reactions, direct derivatization of nucleic acids with detectable tags, as well as modification of nucleic acids by activated
2. Methods for Nonradioactive Labeling of Nucleic Acids
63
linker molecules. In oligonucleotides these compounds can be labeled either after oligonucleotide synthesis at both 5' or 3' ends, or internally during oligonucleotide synthesis by integration of allylamine-substituted nucleotide compounds and further reaction with N-hydroxysuccinimide esters carrying the modification group.
A. Light-Activated Labeling Techniques Labeling with azido compounds and photoactive furocoumarins lead to covalently linked modification groups. The difference between the types of modification is that with the azide compounds, a random binding with the aromatic ring systems has been observed, whereas with the furocoumarins (e.g., psoralen), distinct cycloaddition reactions with thymine or uridine occur after intercalation.
1. Labeling with Azide Compounds The most commonly used photolabeling reagents are aryl azide compounds. Aryl azides are stable in the dark and can be photoactivated in situ by illumination with UV light (h = 320 nm) to generate highly reactive aryl nitrenes. These bind to the aromatic bases of ribosomal RNA by cross-linking experiments. 3-Nitrophenyl azide compounds substituted at C-4 with a linker molecule carrying the nonradioactive modification group have the advantage that they can be activated with long-wave UV light, avoiding damage of the nucleic acid probe. The resulting modified probes are full-length molecules; thus they can be used both as nonradioactively labeled molecular weight markers and as homogeneously labeled hybridization probes (Forster et al., 1985; Dahlen et al., 1987; Tomlinson et al., 1988; Keller et al., 1989; M0hlegger et al., 1990; H61tke et al., 1992b). The resulting linkages are stable at alkaline pH, elevated temperature, or irradiation with UV light; therefore, no loss of label is observed under Southern blot conditions. Both single- and double-stranded DNA and RNA molecules can be labeled in small or large amounts; the labeling density is in the range of one modification group per 200 to 400 nucleotides. The reaction time for labeling is typically 2 to 3 min. A variety of haptens have been coupled to 3-nitro-aryl azides (Fig. 6). These haptens include biotin (Forster et al., 1985), digoxigenin (Miihlegger et ai., 1990), dinitrophenyl (DNP) (Keller et al., 1989), and ethidium (Albarella and Anderson, 1985; Albarella et al., 1985); most often the photoreactive aryl azide group is coupled with the modification group via a linear spacer 9 to 11 atoms in length.
64
ChristophKessler
OH CH OH Na O
b
HN~NH ~~]~
N3
N~N~N NO2
S 0
Fig. 6reStructure of photoreactive azide compounds. (a) photodigoxigenin"(b) photobiotin. In an alternative approach, azido groups are first coupled to DNA by reacting with p-azidophenyl glyoxal to modify terminal guanosine residues (Heller and Morrison, 1985). These DNA-bound azido groups are used to react with modification groups after UV illumination via nitrene intermediates.
2. Labeling with Furocoumarin Compounds A number of photoreactive substances will intercalate into nucleic acids, and then in a second step, covalently link with flanking bases through a photoreaction. These substances include furocoumarin compounds (psoralen, angelicin), acridine dyes (acridine orange), phenanthrolines (ethidium bromide), phenazines, phenothiazines, and quinones (Ben-Hur and Song, 1984; Dattagupta and Crothers, 1984; Sheldon et al., 1985). The most important intercalating compound is the bifunctional photoreagent psoralen (Cimino et al., 1985), forming either mono- or diadducts with pyrimidine bases of nucleic acids after intercalation and photoactivation (Fig. 7). Structurally, psoralens are tricyclic compounds formed by the linear fusion of a furan ring with a coumarin. The formation of the photoadducts is mediated by either the furan and/or the coumarin heterocycle. The number of adducts is limited and dependent on the geometry of the intercalation complex.
2. Methods for Nonradioactive Labeling of Nucleic Acids
65
H H HsC d R--- N/ ~ ~ n 0 ",~ v
4'
O~ ~
5
4
~ 0 ~ ~-0
OCH3
CHaO~ ~
H
02
I
dR Fig. 7re(a) Structure of 8-methoxypsoralen; (b) structure of the dT-8-MOP-dT-diadduct.
Photoaddition of psoralen to nucleic acids occurs with incident light in the range of k - 320 - 400 nm. Binding of both ends of psoralen (diadduct formation) to opposite strands of a nucleic acid helix results in the formation of a covalent interstrand cross-link. Psoralen reacts primarily with thymine (DNA) and uridine (RNA), whereas cytidine residues undergo only minor reactions. Mono- as well as diadducts are chemically stable; therefore, these adducts can be used under a variety of reaction conditions (elevated temperatures and ionic strengths, absence of presence of divalent cations or organic solvents). Photochemical covalent cycloaddition of psoralen or angelicin has been used to modify nucleic acids with biotin or fluorescein by coupling these nonradioactive haptens with psoralen via a linear linker, similar to those applied with the azide compounds or the modified nucleotides used for enzymatic labeling (Sheldon et al., 1986; Oser et al., 1988; Albarella et al., 1989). Linkage of the haptens is obtained by reaction of 4,5',8trimethylpsoralen at the C-4 position or by reaction of the activated linker derivatized with the nonradioactive hapten with 4'-aminomethyl-4,5',8trimethylpsoralen.
B. Direct Derivatization with Chemical Tags Labeling nucleic acids with directly detectable tags results either in noncovalent binding of the tag (e.g., ethidium bromide reacting with doublestranded RNA) or in covalent bond formation [e.g., sulfonation of C-4 positions of pyrimidines or derivatization of C-8 positions of purines with fluoren derivatives like N-acetoxy-N-2-acetylaminofluorene (AAF) or its 7-iodo derivative (AAIF)].
66
Christoph Kessler
1. Noncovalent Labeling with Ethidium Bromide This labeling system is based on the observation that the lanthanide cation terbium quenches the fluorescence of ethidium bromide by 40-fold when bound to double-stranded RNA (A1-Hakeem and Sommer, 1987). In contrast, quenching of double- or single-stranded DNA is only 2.5-fold, and quenching of single-stranded RNA is less than 5-fold. This selective quenching permits specific detection of double-stranded RNA in yeast or some viruses. Terbium ions exhibit a low level of intrinsic fluorescence in aqueous solution. This is greatly enhanced when it is chelated to organic ligands, such as the aromatic ring systems of the nucleic acid bases, to form charge transfer complexes (Gross and Simpkins, 1981). Ethidium bromide exhibits marked enhancement of fluorescence on intercalation into doublestranded nucleic acids but only weak fluorescence with single strands. Terbium ions selectively quench the fluorescence of the ethidium intercalation complex, particularly with double-stranded RNA. This allows the detection of this particular nucleic acid in agarose gels by selective quenching the orange fluorescence of ethidium bromide. An alternative detection system is based on the recognition of intercalating ethidium bromide by ethidium bromide-specific antibodies (Albarella and Anderson, 1985; Dattagupta et al., 1985).
2. Derivatization with Sulphone Groups With this labeling approach, a sulphone group is introduced as hapten into the nucleic acid by sulphonation (Verdlov et al., 1974). Sulphonation is obtained with a high concentration of sodium bisulphite at position C-6 of cytidine residues. The resulting sulphone derivative is relatively unstable, but can be stabilized by the substitution of the amino group at C-4 of the cytosine base with the nucleophilic reagent methylhydroxylamine. Cytosines are transformed by this reaction into N4-methoxy-5.6 dihydrocytosine-6-sulphonate derivatives. These cytosine derivatives of nucleic acid probes can directly be detected by antisulphone specific antibodies coupled with optical reporter groups (Herzberg, 1984; Nur et al., 1989).
3. Derivatization with Fluorene Derivatives This method is based on the chemical modification of guanine residues in DNA and RNA at position C-8 using N-acetoxy-N-2-acetylaminofluorene (AAF) or its 7-iodo derivative (AAIF) (Tchen et al., 1984). After heat denaturation, a three-fold excess of AAF or AAIF is added to the probe
2. Methods for Nonradioactive Labeling of Nucleic Acids
67
and the reaction proceeds at 37~ C for 2 hr. Cross-linking is avoided by treatment with alkali; unreacted fluorene derivatives are removed by repeated extraction with ethanol. Detection of fluorene-derivatized nucleic acids can be obtained with an enzyme-linked immunosorbent assay (ELISA)-type detection reaction using antifluorene antibodies (Tchen et al., 1984; Landgenet et al., 1984, 1985; Syv~inen et al., 1986b; Cremers et al., 1987).
4. Derivatization with Mercury Cytosine and uracil nucleotides are readily mercurated by heating at 37 to 50~ C with mercuric acetate in buffered aqueous solutions (pH 5.0-8.0) (Dale et al., 1975). Polynucleotides can be mercurated under similar conditions. Cytosine and uracil bases are modified in RNA, whereas only cytosine residues in DNA are substituted. There is little, if any, reaction with adenine, thymine, or guanine bases. The rate of nucleic acid mercuration is influenced by ionic strength; the lower the ionic strength, the faster the reaction. The mild reaction conditions give minimal strand-breakage and do not produce pyrimidine hydrates. The position of mercuration of cytosine and uracil is C-5 (Bergstrom and Ruth, 1977); in uracil, this modification mimics the methyl group of thymine. Although sufficiently stable to permit biochemical studies, the mercury-carbon bond is extremely sensitive to cleavage by electrophiles and reducing agents. Treatment of mercurated polynucleotides with 12, Nbromosuccinimide has been found to generate the corresponding iodinated and brominated nucleic acids rapidly. Therefore, the mercurated, iodinated, or brominated nucleic acids can be either detected directly or further substituted with activated linker arms carrying a detectable hapten such as biotin (Langer et al., 1981; Hopman et al., 1986a, 1986b; Keller et al., 1988).
C. Derivatization via Activated Linker Arms Carrying Detectable Haptens Besides direct modification of nucleic acids with chemical tags and direct detection of these tags, alternative methods are available in which the detectable haptens are introduced into the nucleic acids via an activated linker arm. Primary modification of the nucleic acids is obtained either by transamination, mercuration, bromination, thiolation, or amine substitution with bifunctional reagents, followed by condensation with activated linker arms carrying a detectable hapten.
68
Christoph Kessler 1. T r a n s a m i n a t i o n
Bisulphite catalyzes transamination between cytidine derivatives and primary amines. Aqueous bisulfite causes deamination of cytidine derivatives; however, in the presence of primary amines, it can catalyze transamination to give N4-substituted cytidines with deamination only as a side reaction (Viscidi et al., 1986). If the reaction is performed at neutral pH (pH 7.3), deamination is minimized, although the rate of transamination is reduced in comparison with lower pH. If bifunctional diamines (e.g., ethylenediamine or 1,6-diaminohexane) are used as primary amines, then the amino group not attached to the cytosine residue may act as a recipient for an activated linker carrying a detectable hapten such as biotin or digoxigenin (Graf and Lenz, 1984; Viscidi et al., 1986; Gillam and Tenet, 1986). The linkers can be activated using N-hydroxysuccinimide ester. The overall reaction comprises two parts (Fig. 8): bisulfite-catalyzed transamination with one amino group of diamines; and Reaction of the second free amino group with activated linkers.
NH=
NH:
N
L
NaHSO=
N
O
H=N7 ~ J ~ , 7
O
I
HN~
NH=
N
SO:
O
I
R
I
R
R
bisulfite ;~duct
cytosine
NH:
N4-SU~
cytosine
0
b
HN~NH
HN~..H
O
9
I
o
O I I
R
biotinyt- ( -aminocaproic- N-hydroxysuccinimide ester
HN'~'~'NH
o N 0
I
biotinylatecl cytosine
R
Fill. 8--Chemical DNA labeling by transamination. (a) transamination reaction; (b) reaction with activated hapten (biotin).
2. Methods for Nonradioactive Labeling of Nucleic Acids
69
A one-step modified protocol uses biotin hydrazides for transamination (Reisfeld et al., 1987). In this reaction, the biotin hapten is directly coupled to the cytidine nucleotide; however, the linker region between the nucleotide and biotin is relatively short, leading to reduced sensitivities. Critical in the transamination reaction is that a balance exits between transamination and deamination; the ratio between both reactions is dependent on the pH value of the labeling solution and the pK of the applied diamine. Low pK values like that of ethylenediamine (pK 7.6) favor transamination using a pH value of 7.3 for the transamination reaction. Furthermore, high transamination rates are obtained only after prolonged incubation up to several days at elevated temperatures under a nitrogen atmosphere. In addition, the reactive N-4-position of cytidine is involved in hydrogen bonding, resulting in disturbed hybrid formation and thus low sensitivities. 2. AHylamine Derivatization Derivatization of nucleic acids with mercuric acetate results in mercurated nucleic acids (Dale et al., 1975); predominantly the C-5 positions of uridine and cytidine bases are modified (see also Section Ill,B). These mercurated derivatives can be used to react with allylamine in the presence of palladium catalysts. This reaction results in C-5-allylamin-substituted bases and can be performed either with nucleotides or with polynucleotides. The C-5-allylamine-substituted compounds can react with N-hydroxysuccinimide ester carrying a detectable hapten like biotin or digoxigenin. This condensation reaction results in biotin or digoxigenin haptens coupled to the C-5 position of the cytosine or uridine base via a linear linker (Langer et al., 1981; Hopman et al., 1986a; Mtihlegger et al., 1990). The C-5 position of the pyrimidine bases is not involved in hydrogen bonding; thus the formation of double-stranded hybrids is not disturbed, allowing high sensitivity detection. The length of the linker can be enlarged by introduction of 3,-aminobutyryl and/or e-aminocaproic acid residues as additional linker components, which reduces unspecific interactions between probe and hapten and suppresses steric hindrance effects during hapten detection (Miihlegger et al., 1990). 3. Bromo Derivatization The bases of both DNA and RNA are readily brominated under mild conditions using dilute aqueous bromine or N-bromosuccinimide. Bromination occurs at the C-8 position of purines as well as C-5 of cytosine and (possibly) C-6 of thymine. The brominated intermediates can be detected
70
ChristophKessler
directly (Br-dU) (Traincard et al., 1983; Porstman et al., 1985; Sakamoto et al., 1987) or by reaction with amines such as 1,6-diaminohexan prebound with detectable haptens like DNP via one of the two amino functions (Keller et al., 1988) (Fig. 9). In contrast to the transamination reaction the modified sites are not involved in hydrogen bonding; thus, base pairing is not disturbed. Crosslinking is avoided without using a vast excess of linker arm because only one end of the arm contains a free amino group; the other is pre-attached to the hapten. Furthermore, it is also of advantage that the brominemediated labeling reaction is rapid; it requires only 2 hr, although coupling is at elevated temperatures (50~ C). O
H2N
N
I
R
guanine
I N-brom~~inimide pH 9.6
0 Br
I
R H=N ~
N 50 ~
NO1
/ NO2
O NO2 H=N
N
I
/
NO=
R
Fig. 9nChemical DNA labelingby bromination.
2. Methods for Nonradioactive Labeling of Nucleic Acids
71
4. Thiolation Amino groups of pyrimidine and purine nucleotides can be thiolated by reaction of nucleic acids with thiolating reagents such as N-succinimidyl3-(2-pyridyldithio)propionate (Malcolm and Nicolas, 1984) or N-acetylN-(p-glyoxylbenzoyl)cysteamine (Rabin et al., 1985). The thiol derivatives can react with mercaptanes to form disulfide bridges linking detectable haptens via the disulfide bond to the nucleotide.
5. Substitution of Amino Groups with Bifunctional Reagents Another approach for chemically labeling nucleic acids is the substitution of amino groups of pyrimidines or purines with bifunctional reagents (Landes, 1985). The first reactive group reacts with the amino functions of the nucleotides, and the second reactive group couples basic macromolecules carrying a detectable hapten. A variety of bifunctional cross-linking reagents have been described: glutaraldehyde, 1,2,7,8-diepoxyoctane, bis(succinimidyl)suberate or bis(sulfonosuccinimidyl)suberate. Suitable basic macromolecules include polyethylenimine (A1-Hakim and Hull, 1986), cytochrome C (Sodja and Davidson, 1978), or histon H1 (Renz, 1983), and these are prelabeled with detectable haptens such as biotin via biotin bridges (A1-Hakim and Hull, 1986). In these more complex derivatization reactions, the complete side chain comprises the bivalent cross-linking bridge, the basic macromolecule, the biotin bridge, and biotin as detectable hapten; the derivative is obtained by cross-linking the activated nucleotides with the prelabeled macromolecules (Fig. 10). The long side chain favors high sensitivities, whereas the high molecular mass of the basic macromolecule decreases sensitivity. Polyethylenimine (60 kDa) is superior to histone H1 (23 kDa) or cytochrome C (12.3 kDa). The contrary effects on sensitivity are explained by steric hindrance" the larger the cross-linking reagents, the more basic macromolecules can be linked per unit length of nucleic acid, but the more bulky the basic macromolecules, the fewer molecules can be linked to the DNA.
D. C h e m i c a l Labeling of O l i g o n u c l e o t i d e s Chemical labeling of oligonucleotides can be performed internally or at both termini during chemical oligonucleotide synthesis by the incorporation of allylamine-modified protected synthesis components (Haralambidis et al., 1987; Cook et al., 1988). These allylamine-derivatized oligonucleo-
.
,,1,,, z
.
9
.
9
0 .
~z
I
I
E
o
._~
I
I
,,
C
I
j
--
0
.a: .a: a: @ E qp
C
0
E
s,_.
,E
(0) (0)
.,..,
2@
C
(,.) m
o=~~z__Z z .1-
0
0
. ,,,..q
a
::::I @
I vmnl
0
2. Methodsfor NonradioactiveLabelingof NucleicAcids
73
tides react with N-hydroxysuccinimide esters coupled with the haptens of interest. End-labeling can be obtained at the 5' end by reaction with activated ethyl- or hexyl-derivatives (Agrawal et al., 1986), by direct labeling 5'-phosphorylated oligonucleotides with functionalized hapten derivatives (Kempe et al., 1985), or by end-labeling at the 3'-end by use of multifunctional CPG carriers (MF-CPG: multifunctional controlled pore glass) (Nelson et al., 1989a; 1989b). 5'-End-labeling via NH2- or SH-groups has also been reported (Chollet and Kawashima, 1985; Chu and Orgel, 1985a; Smith et al., 1985; Conolly and Rider, 1985; Ansorge et al., 1986; Wachter et al., 1986; Coull et al., 1986; Connolly, 1987; Tous et al., 1988). Finally, the introduction of suitable marker groups into oligonucleotides via modified phosphodiester linkages is also possible (Asseline et al., 1984; Chu and Orgel, 1985b; Thuong et al., 1987; J~iger et al., 1988; Froehler et al., 1988). The three most important methods for internal or 5'- and 3'-end-labeling are described in more detail in the next sections.
1. Chemical Labeling during Oligonucleotide Synthesis with AHylamine-Modified Protected Synthesis Components This labeling reaction uses allylamine-modified protected synthesis components during oligonucleotide synthesis (5'-dimthoxytrityl-5(3trifluoracetylaminopropenyl)-2'-deoxyuridine-3' N, N-diisopropylaminocyanoethoxyphosphoamidite) (Haralambidis et al., 1987; Cook et al., 1988) (Fig. 11). The required derivatives are available for all nucleotides; pyrimidine bases are modified at the C-5 position, and purine bases are derivatized at C-8. These derivatizations do not interfere with hydrogen bonding; therefore, hybrid formation with the modified probes is not hindered. After incorporation of the allylamine derivatives and removal of the protecting groups, the terminal amino functions can be reacted with activated linker moieties carrying a hapten; e.g., biotin- or digoxigenin-N-hydroxysuccinimide ester. Because integration of allylamine-substituted monomers into the growing oligonucleotide can be obtained at every position, this labeling approach is very flexible. Another advantage is that labeling of oligonucleotides can be performed during routine automated oligonucleotide synthesis.
2. Chemical 5'-End-Labeling with Activated Ethyland Hexyi-Derivatives (Aminolink I/II) As an alternative to the incorporation of allylamine compounds during chemical oligonculeotide synthesis, 5'-terminal phosphate residues
74
Christoph Kessler
oJ...J
DMTrOO~-
O
|174
9k
"-
"
,
allylaminemodified nucleotide
9
1.32 % NH 3 / RT / 30' " 2. 32 % N H 3 / 5 0 ~
~ / N H 2 HO-dN-dN-dN-dU-dN-OH 3' 5'
O //~//~NH~L~[11]-
DIG-[11]-.NHS
DIG
H O - d N - d N - d N - dU - d N - OH 3' 5'
o..ooooooooo.oooooooooooooooo.o....o.,,ooooooooo.ooooo,oooooo.o.ooooo.o
= solid support ~
~
= protected nucleotides for ~ x y n u c l e o t i d e
synthesis
= protected allylamine modified desoxyuridine
dN = desoxynucleotide dU"/~-,'/~"NH2
= allylamine modified desoxyuridine
o
I I
dU/~'//~"NH/~'[
11 ] - DIG
= digoxygenin-modified desoxyuridine
Fig. 1 lmChemical internal labeling of oligodeoxynucleotides.
synthetic oligonucleotides can be labeled with activated ethyl- or hexylderivatives (Agrawal et al., 1986) (Fig. 12). The oligonucleotide reacts with aminolink I (ethyl-) or aminolink II (hexyl-) derivatives after removal of the protection groups, but is still bound to the solid support. Reaction takes place by a oxidative condensation of the 5'-terminal phosphate and the phosphate moiety of the amino-
2. Methodsfor Nonradioactive Labelingof NucleicAcids o
CF3~L~ N, ~ ~ j ~ O - ~ H
~'[oligonucleotide]
- OH
75 1
p .- N Pr2 OCH3
5'
1. Aminolink [1], II / tetrazole 2. J2 / H20 3. 32 % NH3 / RT / 30' 4. 32 % NH3 / 50 ~ / 5 h
3 'HO-
0 II [oligonucleotide]
- O - P - O ~ "~ ~ ~ r
&
~ N H 2 5'
O II
3' H O - [oligonucleotide] - O - P - O - ~ ~L ~ . . ~ - N
;o
DIG-[11]-NHS
O 'J~.. t
- ' j ~ ['I1].DIG5'
Fig. 12~Chemical 5'-end-labeling of oligodeoxynucleotides.
link compound. Liberation from the solid support and removal of the trifluoracetyl protection groups results in a 5'-terminal amino function, and this amino group can react with N-hydroxysuccinimide ester-carrying haptens (e.g., biotin, digoxigenin). These 5'-end-labeled oligonucleotides can hybridize without any interaction with the hybridizing sequence, resulting in good sensitivities.
3. Chemical 3'-End-Labeling by Synthesis with Multifunctional Controlled Pore Glass Carriers (MF-CPG) With this method the functional amino group needed for coupling activated esters is already present in the linker arm introduced into the growing oligonucleotide during oligonucleotide synthesis on the solid support. After normal oligonucleotide synthesis, the oligonucleotide is solubilized from the solid support by hydrolysis of a 3'-terminal carboxyl moiety (Kempe et al., 1985; Nelson et al., 1989a, 1989b) (Fig. 13). The resulting 3'-terminal coupling group contains an amino function, and as with the 5'-end-labeling reaction, condensation of this amino function with biotin- or digoxigenin-O-hydroxysuccinyl esters may occur. Analogous to the 5'-end-labeled oligonucleotides, the 3'-end-labeled oligonucleotides hybridize without interaction with the hybridizing region, again resulting in good sensitivities.
76
Christoph Kessler o 0
3' H O ~ T / ~ . . / .
O .. [oligonucleotides] - OH 5'
ODMTr
~" 2. solubilization from solid support
DIG-['I1]-NHS . . . . . . .
9
NH2
3' H O ' ~ ' ~ O ~ [ o l i g o n u c l e o t i d e s ] HN~[11]i
- OH 5'
DIG
i
o
Fig. 13---Chemical 3'-end-labeling of oligodeoxynucleotides.
IV. METHODS FOR CHEMICAL LABELING OF DNA, RNA, AND OLIGODEOXYNUCLEOTIDES WITH MARKER ENZYMES In addition to the various methods for labeling of nucleic acids with chemcial tags or haptens, a variety of procedures are described for direct covalent chemical coupling of marker enzymes to oligodeoxynucleotide probes. These oligodeoxynucleotide : enzyme conjugates can be directly applied for generation of labeled hybridization complexes without additional binding steps between a modification group and a respective binding component; therefore, these direct detection systems are simpler and more convenient. However, because flexibility of application of directly enzyme-labeled probes is not so high as with indirectly labeled hybridization probes, directly labeled oligonucleotide probes are often used in standardized hybridization approaches; e.g., standardized sequences of midivariant regions applied as fingerprinting probes, labeled universal primers for enzymatic sequencing approaches, or standardized probes for screening routine diagnostic parameters. Direct labeling procedures have been described for coupling the marker enzymes alkaline phosphatase with oligodeoxynucleotides (Jablonski et a l . , 1986; Jablonski and Ruth, 1986) or HRP directly with DNA molecules (Renz and Kurz, 1983; Taub, 1986; Pollard-Knight et al., 1990). Microperoxidase, a heme-carrying oligopeptide, was also used for covalently label-
2. Methods for Nonradioactive Labeling of Nucleic Acids
77
ing DNA with an enzymatic active marker (Heller and Schneider, 1983). With alkaline phosphatase, detection is achieved either with dye substrates [BCIP/NBT; SNAP (small nuclear alkaline phosphatase) probes] or via phosphorylated phenyl dioxetane-mediated chemiluminescence [AMPPD; NICE (nonisotopic chemiluminescent enhanced) probes]. With HRP, chemiluminescent substrates like luminol combined with chemiluminescent enhancers (e.g., p-iodophenol) are responsible for signal generation [ECL (enhanced chemiluminescence) system]. In the following section the only two most commonly applied systems, SNAP and ECL, will be described in more detail (see also Chapter 7).
A. Labeling of Oligodeoxynucleotides with Alkaline Phosphatase (SNAP/ NICE System) Short synthetic oligodeoxynucleotides can be covalently cross-linked to the marker enzyme alkaline phosphatase using the homobifunctional reagent disuccinimyl suberate (Jablonski et al., 1986). Oligodeoxynucleotides in the range of 21 to 26 bases can be labeled by this method. The oligodeoxynucleotides are modified in a first reaction step with a linker arm, which carries a terminal reactive primary amine function. Modification is achieved by introducing a protected linker arm nucleoside 3'-phosphoramidite [5'-O-dimethoxytrityl-5-[N-(7-trifluoracetylaminoheptyl )-3- acrylamido ] -2' - deoxyuridine- 3 '-O-( me th yl-N, N- dii s opropyl )phosphoramidite] (Ruth et al., 1985) directly during automated oligodeoxynucleotide synthesis (Ruth, 1984). The disuccinimidyl suberate cross-linker reacts quantitiatively with the primary amine function of the activated oligodeoxynucleotide and provides a reactive succinimidyl group, approximately 25 /i apart from the nucleotide base. Enzyme coupling is obtained by acylation of enzyme amino groups via the active N-hydroxysuccinimidyl ester. The linking reaction results in defined enzyme : oligodeoxynucleotide complexes consisting of one enzyme label per oligodeoxynucleotide with a mass ratio of protein of DNA of about 20. Gel filtration chromatography and chromatography on DEAE cellulose result in pure oligomer: alkaline phosphatase (AP) conjugates. The marker enzyme retains full enzymatic activity throughout the conjugation and purification process. Applying alkaline phosphatase : oligodeoxynucleotide conjugates as hybridization probes is as specific as with radioactively or hapten-labeled probes. However, the Tm is decreased by approximately 10~ C, indicating a slightly decreased binding energy between enzyme-modified probe and
78
Christoph Kessler
target DNA. In contrast to HRP, AP is stable at elevated hybridization temperatures; e.g., at 50~ C there is only a negligible loss of activity during a 30-min hybridization period. Because AP is also stable against elevated concentrations of detergent, stringency can be controlled not only by temperature and salt concentration but also by the presence of sodium dodecyl sulfate (SDS) (0.5% PVP may also be present in the hybridization mixture). Signal generation can be obtained with a BCIP/NBT subtrate (colorimetric) (SNAP probes: Marich and Ruth, 1992) or AMPPD as substrate (chemiluminescence) (NICE probes). Because of higher concentrations of low-molecular-weight enzyme: oligomer complex as compared with high-molecular-weight enzyme: DNA complexes, short hybridization periods of 15 to 30 min and low nonspecific interactions can be realized. As a result, target DNA can be visualized in the pg range within 4 hr in the colorimetric dye-detection system. Overnight development further enhances visualization, but not sensitivity. With the AMPPD chemiluminescence substrate sub-pg sensitivities are observed within 1 hr on X-ray films after hybridization periods of only 20 min.
B. Enhanced Chemiluminescence with Horseradish Peroxidase-Labeled Probes (ECL System) Direct cross-linking of the reporter enzyme HRP to probe DNA is achieved by coupling a preformed enzyme-polyethyleneimine complex (Renz and Kurz, 1984) and the bifunctional cross-linking reagent glutaraldehyde. For this labeling reaction, denatured DNA is treated with a 50-fold excess (mass ratio) of polyethyleneimine-modified HRP in the presence of 1.25% glutaraldehyde (Pollard-Knight et al., 1990; Durrant, 1992). The labeled probe can be used for hybridization without any further purification. From high-performance liquid chromatography (HPLC) analysis it has been shown that the trimer HRP enzyme complex is preferentially bound to the DNA probes. With this labeling method, DNA probes ranging from 50 to several thousand base pairs (e.g., pBR322 DNA) can be cross-linked with the marker enzyme. Applying these labeled probes in dot blots, the signal intensity is proportional to the probe length. It was shown that approximately one active perixodase molecule is linked every 50 to 100 bp. Therefore, probes smaller than 50 bp (e.g., 20mers) do not react with the labeling components. RNA chains several hundred bases in length can also be labeled with HRP using glutaraldehyde as complexing reagent.
2. Methods for Nonradioactive Labeling of Nucleic Acids
79
The stability of the formed hybrid between the HRP-labeled probe and the target sequence is not changed because of Tm measurements. This is in contrast to the labeling of oligodeoxynucleotides with AP, in which a decrease of about 10~ C is observed; however, in this case the labeling density is significant higher (21-26 bases per enzyme) than that of peroxidase labeling. During hybridization, high concentrations of urea (6 M) have to be used as denaturing agent; hybridization is performed at temperatures not higher than 42~ C because of enzyme instability at higher hybridization temperatures. Thus, the stringency of the hybridization reaction has to be controlled by varying the salt concentration. For detection of labeled hybrid complexes. HRP oxidizes the chemiluminescent substrate luminol in the presence of light-intensifying enhancer compounds like p-iodophenol. Using this mode of detection as little as 1 pg DNA can be detected within less than 1 hr on blue-sensitive X-ray films. Reprobing is possible with HRP-labeled probes for the same or a different sequence without removing the original bound probe; this may be the effect of displacement of the first probe by the second probe (Green and Tibbetts, 1981).
V. OVERVIEW OF FACTORS INFLUENCING HYBRIDIZATION Binding between analyte and modified probe leading to stable hybrid molecules is mediated by specific interaction between complementary purine and pyrimidine bases forming A" T and G" C base pairs. Whereas the specificity of the hybrid formation is influenced primarily by the geometry of the bases responsible for the hydrogen bonds between A and T (2 hydrogen bonds) and G and C (3 hydrogen bonds), the stability of the generated hybrids is a result of the generation of a variable number of hydrogen bonds and of the effect of electrostatic as well as hydrophobic forces. G : C base pairs are more stable than A:T base pairs because between G and C. In contrast, between A and T only two hydrogen bonds are possible. Therefore, G" C-rich sequence are more stable than A:T sequences and thus will have higher Tm. Electrostatic forces are caused predominantly by the phosphate molecules of the nucleic acid backbone; thus, double-stranded sequences are stabilized by increasing ionic strength. The presence of a hydrophilic hydroxyl group at the 2'-position of the ribose also stabilizes the doublestranded structure of nucleic acids. Thus, the T~ of DNA/RNA and RNA/
80
Christoph Kessler
RNA hybrids are significantly higher than those of the respective DNA/ DNA hybrids. Hydrophobic interactions between the staggered bases also contribute to hybrid stability; this explains the destabilizing effect of organic solvents on hybrid formation. Because of the central role of hydrogen bonding in hybrid formation and hybrid stability, the most appropriate sites for base modifications are those not involved in hydrogen bonding (1) C-5 of uracil and cytosine (Langer et al., 1981; Ruth, 1984; Ruth et al., 1985; Jablonski et al., 1986; Jablonski and Ruth, 1986; Haralambidis et al., 1987; Cook et al., 1988). C-5 modification of uracil mimics thymine residues, and this makes these compounds useful as thymine analogs; (2) C-6 of cytidine (Verdlov et al., 1974); and (3) C-8 of guanine and adenine (Reisfeld et al., 1987; Huynh Dinh et al., 1987; Keller et al., 1988). The N4-position of cytosine (Gillam and Tener, 1986; Urdea et al., 1987; Gebeyehu et al., 1987; Urdea et al., 1988) and the Nr-position of adenine (Jablonski and Ruth, 1986) or guanine (Tchen et al., 1984) are involved in hydrogen bonding and therefore less useful (Viscidi et al., 1986; Gebeyehu et al., 1987). Labeling of the probes at the backbone or at the 5'- or at the 3'-end is less critical; in these cases hydrogen bonding as well as base staggering is not directly hindered. The position of probe modification and the distance between the modified atom of the nucleotide and the reporter molecule are both important for the stability of the hybrid molecules. Therefore, both sites should be separated by mostly linear spacer molecules composed of a balanced mixture of hydrophilic and hydrophobic atoms connecting the nucleotides with the modifying group (Forster et al., 1985; M0hlegger et al., 1990).
A. Rate of R e a s s o c i a t i o n The rate of reassociation between analyte and probe nucleic acid depends on probe complexity, i.e., probe length and length and number of unique sequences, as well as probe concentration (Britten and Kohne, 1968). Reassociation rates are defined as Cot values, where Co is the initial DNA concentration [M] and t the incubation time [sec]. The reassociation rate is quantified in terms of Cot~/2 values; these values define when half of the nucleic acid molecules have reassociated. The reassociation rate is inversely proportional to probe complexity. At a given concentration the reassociation rates are therefore inversively proportional to sequence length and the length of the unique sequences within the probe (Davidson and Britten, 1979). Cot analyses are performed in solution using equal concentrations of analyte and probe. Thus, in these studies second-order rates are applied
2. Methods for Nonradioactive Labeling of Nucleic Acids
81
for calculating reaction parameters. Because most hybridizations are performed with analytes immobilized on solid supports, such as nitrocellulose or nylon membranes, only first-order kinetics are used for the calculation of association parameters. With excess probe concentrations--as with most hybridization experim e n t s - t h e hybridization rate is primarily dependent on probe complexity, i.e., probe length and length of unique sequences, and probe concentration. Meinkoth and Wahl (1984) describe the first-order equations for hybridization with single-stranded probes as follows: In2 k x C
m
tl/2 -
k = rate constant for hybrid formation [mol x 1/#nuc x sec] C = probe concentration [M] Within short hybridization periods (<4 hr), double-stranded probes can be handled similarly; with longer hybridization periods (16 hr), the actual probe concentration decreases because of probe reassociation: the rate constant k is dependent on probe complexity (L = probe length; N = length of unique sequences) as well as reaction parameters like temperature, ionic strength, pH value, and viscosity of the incubation mixture. k
=
L~
kn =
N kn = nucleation constant The nucleation constant is 3.5 x 105 for standard hybridization conditions, i.e., Na § concentrations of 0.4 to 1.0 M, pH values between 5 and 9, and temperatures Tm + 25 ~ C (Marmur and Doty, 1959). Under these standard hybridization conditions, the hybridization rate tl/2 [sec] is calculated as follows: N
tl/2
=
For a fragment probe of 500 bp, tl/2 of 6 x 10-10 [M]:
tl/2
=
x In2
3.5 x 105 x L ~ x C is
500 x 0.693 [sec] 3.5 x 105 x 22 x 6 •
calculated for a probe concentration = 7.5
x
103 sec = 20hr
10 -10
For an 25mer oligonucleotide probe, tl/2 calculates to 1 hr. However, this value has to be considered a rough estimate because experimentally obtained tl/2 values fit into the calculated linear relationships in a first approach only (Keller and Manak, 1989).
82
Christoph Kessler
In addition to probe complexity and probe concentration, the reaction parameters temperature, salt concentration, base mismatches, and hybridization accelerators also influence the rate of reassociation (Hames and Higgins, 1985). Reassociation is maximal at about 25~ C below the Tm of the doublestranded nucleic acid (Wetmur and Davidson, 1968; Bonner et al., 1973; Britten et al., 1974). Increasingly salt enhances reassociation rate; at low NaCI concentrations (0.01-0.1 M) a twofold increase in concentration accelerates the rate by 5- to 10-fold or more; the increase continues up to 1.2 M NaCI (Britten et al., 1974). For each 10% base mismatch, the reassociation rate is reduced for about twofold (Bonner et al., 1973). Inert polymers like dextran sulfate or polyethylene glycol (PEG) can be used as accelerators of the hybridization reaction with longer fragment probes (Wahl et al., 1979). The accelerating rates are relatively low with single-stranded probes (threefold); values up to 100-fold are observed, however, with double-stranded probes. Nonpolymeric accelerators include phenol (Kohne et al., 1977) and chaotropic salts, e.g., guanidinum isothiocyanate (Thompson and Gillespie, 1987). These chemicals act as water-exclusion reagents and thus lower the energy difference between single- and double-stranded nucleic acids.
B. Factors Affecting Stability of Hybrids The specificity of hybrid formation is determined by the stringency of the hybridization conditions and the stability of the formed hybrid complexes. Like the reassociation rate, the hybrid stability is directly related to the Tm, which itself is affected by base composition; salt concentration; presence of formamide; fragment length; nature of the nucleic acid within the hybrid (DNA" DNA, RNA" DNA, RNA" RNA); and mismatch formation. For DNA" DNA hybrids, the influence of the first four parameters on Tm is represented by the following equation: [81.5 ~ Tin ~
+ 16.61ogM + 0.41 (% G + C)] - 500 n - 0.61 (%formamide)
M = CNa + [M] n = length of hybridizing sequence With respect to the nature of the formed hybrid, Tm of RNA:RNA hybrids is 10-15 ~ C higher than that of DNA:DNA hybrids. Tm of RNA:DNA hybrids is 20-25 ~ C higher; to lower Tm of these hybrids, formamide is normally applied. Mismatches are less stable than normal base pairing; therefore, the
2. Methodsfor NonradioactiveLabelingof NucleicAcids
83
presence of mismatches also reduce Tm; which decreases for about I~ for every 1% mismatch (Hutton and Wetmur, 1973; Britten et al., 1974). The specificity of hybrid formation is predominantly influenced by the stringency of the final washing steps after hybridization. Stringency is mostly enhanced during the final washing steps by increasing the temperature to only 5-15 ~ C below Tm and lowering the salt concentration from 5• SSC (0.75 M Na § to 0.1 • SSC (0.015 M Na§ This holds true especially for oligonucleotides, for which the washing temperature is usually 5~ C below Tm. However, the optimal washing temperature has to be determined experimentally, and compromise has to be made with respect to the washing conditions in which the probe binds strongly to the analyte and weakly to unspecific heterologous analyte components.
VI. OVERVIEW OF DETECTION SYSTEMS For nonradioactive detection of labeled nucleic acids, a large variety of detection systems are available. These detection approaches can be classified as follows (for actual protocols see Kessler, 1992a): 9 Optical systems; e.g., alkaline phosphatase/BCIP, NBT (Franci and Vidal, 1988, FAST dyes (West et al., 1990), or rainbow multicolor detection (Hrltke et al., 1992a); 9 Chemiluminescent systems; e.g., alkaline phosphatase/Lumiphos | or AMPPD (Schaap et al., 1987; Bronstein et al., 1989a, 1989b; for minireview, see Bronstein and Kricka, 1992) or selective hydrolysis ofacridinium esters (Arnold et al., 1989); 9 Bioluminescence systems; e.g., alkaline phosphatase/o-lucifierin-Ophosphate/luciferase (hauber and Geiger, 1987; Kricka, 1988; Geiger et al. , 1989); 9 Fluorescence systems; e.g., alkaline phosphatase/Attophos TM (Donahue et al., 1991) or fluorescein tags or lanthanide-directed time-resolved fluorescence (Agrawal et al., 1986; Diamandis, 1988; Diamindis et al., 1988, 1989); 9 Metal precipitating systems; e.g., silver-enhanced immunogold (Tomolinson et al., 1988; Gurrin-Reverchon et al., 1989; van de Plas and Leunissen, 1992); and 9 Electrochemical systems; e.g., urease-catalyzed pH shift (McKnabb et al., 1989), or electrochemiluminescence (Blackburn et al., 1991; Kenten, 1992). An overview of the various detection systems is given in Table IV. Dependent on the nature of the reaction fromat, the various systems can
[,,,,
%
<
z
84
9
~oo "~ .=
rO
-~
{#J
<~
,<~
r.~
Ox
z
'~~,~,
~
9 ~~
r,.)
o
,--
[-..,
O0
9
~
m
ca
9. -
~ ~ , ~ ~
Z
r')
~
""
..i
<
[...,
.~
~
9~
-~
~:~-g__~
_ o
m N .r a::
~
"~
~
~,...~.a ~,== ~..,~ 9 ~ ~-_=.~
=
0
-= 0
Ol)
~ 9
,.,
o
...
os
~'~
.~
o~
o
~
~ ~
o
s
o
l-q
o
~
85
c~
r r
i. r
m
9
0 ~J r
0
-
+l
~
i
Z E 0 u
~:~ ~~
~
~
~
..
~
r
,
oo~ ~o ~o
9" ~
r 1. r
z ~
9
r
~h
r r r
0
0
Q
0
2. Methodsfor NonradioactiveLabelingof NucleicAcids
87
be subdivided into matrix-based and soluble systems. In addition, various levels of signal enhancement can be coupled with signal generation: 9 Cross-linking of probes; e.g., Christmas-tree structures (Urdea et al., 1987; Fahrlander and Klausner, 1988); 9 Polymeric binding components; e.g., poly-streptavidin, poly-haptens, PAP- or APAAP-complexes (Mason et al., 1982; Mason 1985); 9 Polyenzymes; e.g., polymeric AP (Ward et al., 1987); 9 Signal cascades; e.g., NAD, NADPH + H + cycles coupled to a redox color reaction (Serf, 1985).
A. Detection Reactions In direct systems the most popular labels are marker enzymes like AP (Jablonski et al., 1986; Jablonski and Ruth, 1986) or HRP (Renz and Kurz, 1984; Taub, 1986; Pollard-Knight, 1990), and fluorescent tags, like fluorescein (~max emission 527 nm), rhodamin 0~maxemission = 622 rim) (Serke and Pachmann, 1988). Whereas the coupled enzymes are often used in blot or soluble formats, the fluoresecent dyes are especially useful for in situ detection in tissue sections for multiplex mapping on metaphase chromosomes (Lichter et al., 1990), or for chromosome paintings or comparative genomic hybridzation (CGH) (Du Manoir et al., 1993). The used techniques an either fluorescence in situ hybridization (FISH) or primed in situ hybridization (PRINS) (Koch, 1992). Recently in situ-PCR protocols also have been reported (Rolfs et al., 1992). In the hybridization protection assay (HPA), a chemiluminescent aeridinium dye is linked to the probe via an alkaline-labile linker (Arnold et al., 1989). Hydrolysis of this linker takes place with single-stranded acridine-modified probes, whereas with the double-stranded hybrids the rate of hydrolysis is strongly reduced (see Chapter 11). This difference in hydrolysis is due to intercalation of the acidinium dye specifically into the double-stranded helix only; this intercation stabilizes the linker alkaline hydrolysis. In the indirect systems, the whole range of detection reactions can be utilized. The binding groups recognizing the modified probes are covalently bound to molecules, which in turn, generate the signal to be measured. In most cases, these conjugated molecules are enzymes that generate a stained, luminescent, or fluorescent reaction product through a coupled, catalytic substrate reaction (for review see Kessler, 1991). The best known marker enzymes are AP from calf intestine (Ishikawa et al., 1983); HRP from horseradish (Wilson and Nakane, 1978); and/3galactosidase from E. coli (fl-Gal) (Inoue et al., 1985). Urease (McKnabb et al., 1989), glucose oxidase (GOD), and microperoxidase are also used but to a lesser extent. ~
88
Christoph Kessler
Depending on the kind of substrate used, the enzymatically catalyzed substrate reactions yield either insoluble precipitates on blots and with in situ approaches, or soluble color products for quantitative measurements, e.g., in microtiter plates. Sensitive substrates resulting in insoluble precipitates include BCIP/nitroblue tetrazolium salt (NBT) for AP (Franci and Vidal, 1988), 3,3',5,5'-tetramethylbenzidine (TMB) for peroxidase (Bos et al., 1981), and 5-bromo-4-chloro-3-indolyl-fl-galactoside (BCIG or Xgal)/NBT for fl-galactosidase (Lojda et al., 1973); the respective soluble substrates are p-nitrophenyl phosphate (p-NPP), 2,2-azino-di-[3-ethylbenzthiazoline sulfate] (ABTS | (Gallati, 1979; Porstmann et al., 1981) and chlorophenolred-fl-o-galactopyranoside (CPRG) (Wallenfels et al., 1960). Increase of sensitivity and speed of detection can be obtained in optical systems by coupling of an enzymatic cascade reaction using the following components (Self, 1985; Johannson et al., 1985; Stanley et al, 1985)" alcohol dehydrogenase (ADH); diaphorase (DP); nicotinamidedinucleotide, oxidated form (NAD); nicotinamide-dinucleotide, reduced form (NADH); and p-iodonitro-tetrazolium purple (INT violet). In the first reaction step, a primary NADP substrate is dephosphorylated to NAD by hybrid-bound alkaline phosphatase. The NAD cofactor activates in a cyclic reaction a coupled secondary redox system that contains the two enzymes ADH and DP. In each cycle the generated NAD is reduced to NADPH + H + by linked oxydation of ethanol to acetaldehyde by ADH; this redox reaction is coupled to a second redox reaction in which NADPH + H § is oxidized to NAD, again linked with the reduction of INT violet to formazan. The intensively stained formazan can be photometrically quantified ( h m a x emission = 465 nm/ EtOH,DMF). Aside from the optical systems, a number of alternative detection systems have been developed based on luminescent or fluorescent substrates. Soluble chemiluminescent substrates are used with AP or/3-Gal by exchanging the optical BCIP/NBT or BCIG/NBT substrates for the corresponding 1,2-dioxetane-luminescence substrates Lumiphos| or AMPGD (Schaap et al., 1987; Voyta et al., 1988; Bronstein and Kricka, 1989; Bronstein and Voyta, 1989; Thorpe and Kricka, 1989; Bronstein et al., 1989a, 1989b; Beck and KOster, 1990). In the AMPPD and AMPGD chemiluminescent systems, enzymatic cleavage of a phosphate (AMPPD) or /3-galactoside (AMPGD) residue forms the unstable AMPD-anion, which decomposes to produce light. The chemiluminescence intensity can be increased by inclusion of the 1,2-dioxetane derivatives in micelles or in covalently linked polymers which, in turn, contain fluorophores such
2. Methods for Nonradioactive Labeling of Nucleic Acids
89
as fluorescein that can be activated by the emitted luminescence light. By selecting suitable fluorophores, a secondary fluorescence signal can be generated as follows: hydroxcoumarin ( h m a x emission -- 467 nm); fluorescein (hmax emission ---- 527 nm); rhodamin (hma x emission = 622 nm). Analogous micelles or chelates are used with time-resolved fluorescence (TRF) where the probes are coupled with divalent lanthanide ions (e.g., Eu 3+ or Tb 3+) complexed by the micelles (Hemmil/i et al., 1984; L6vgen et al., 1985) or chelating agents (Soini and Kojola, 1983; Diamandis, 1988; Evangelista et al., 1988; Oser and Valet, 1988; Diamandis et al., 1988, 1989). In bioluminescence systems, a bioluminescence substrate is released by an initial enzymatic reaction mediated by an hybrid-bound marker enzyme (Miska and Geiger, 1987; Hauber and Geiger, 1987; Gould and Subramani, 1988; Kricka, 1988; Geiger et al., 1989). Using D-luciferin-Ophosphate and alkaline phosphatase, D-luciferin is released by phosphate hydrolysis. D-Luciferin is converted into oxyluciferin, AMP, and PPi in a coupled reaction by the enzyme luciferase from Photinus pyralis in the presence of 02 and ATP. This luciferase-catalyzed oxydation of D-luciferin into oxyluciferin is accompanied by the emission of light ( h m a x emission -600 nm) (for further information on chemiluminescence and bioluminescence, see also Szalay et al., 1993).
B. Detection Formats Detection of nucleic acids by nonradioactively labeled probes can be performed in the solid phase with immobilized analytes or in solution. In the first case, the presence of absence of a particular sequence is recorded, whereas detection in solution allows quantitative measurements. For detection of extracted nucleic acids, a number of blot formats have been established: dot blot, slot blot, Southern blot (DNA analytes), Northern blot (RNA analytes), South-Western blot (protein-binding DNA sequences), genomic blot (analysis of whole genomes). A variety of formats have been described for detection of nucleic acids in situ: colony hybridization (bacterial colonies), plaque hybridization (phage plaques), in situ hybridizations with tissue sections, fixed cells or whole organisms like Drosophila embryo's. Hybridization is also possible with interphase nuclei or metaphase chromosomes (Raap et al., 1992; Lichter and Cremer, 1993). For review see Matthews and Kricka (1988), Wilchek and Bayer (19889), Kessler (1991; 1992a). For quantatitive detection of nucleic acids in diagnostic systems, reac-
90
Christoph Kessler
tion formats such as sandwich (Ranki et al., 1983; Syv/inen et al., 1986a, 1986b; Yehle et al., 1987; Jungell-Nortamo et al., 1988; Nicholls and Malcolm, 1989, Newman et al., 1989), replacement (Vary et al., 1986; Ellwood et al, 1986; Vary, 1987; Collins et al., 1988), or energy-transfer formats (Heller et al., 1982; Cardullo et al., 1988) can be used. Compared with immunological antigen or antibody-detection systems, the nucleic acid-based systems have the following advantages (Zwadyk and Cooksey 1987; Parsons, 1988; Pasternak, 1988; Kohne, 1990): high specificity of analyte recognition (base-pairing); sensitivity because of a prior amplification reaction (analyte amplification); and analyte detection before antigen expression (latency). With the sandwich technique, two probes are used to hybridize with two different regions of the analyte. The first probe is used as capture probe for binding the sandwich complex to a solid support, whereas the second probe is used as a detector probe responsible for signal generation. After removal of free detector and capture probes, the signal generated by complexed detector probe is directly correlated with the amount of analyte. The replacement technique is removal of free detector and capture probes, the signal generated by complexed detector probe is directly correlated with the amount of analyte. The replacement technique is based on the replacement of a prebound labeled oligonucleotide by the analyte from a binding complex; in this reaction format, the amount of released labeled oligonucleotide is a measure of the input analyte. In energy-transfer formats, two probes are bound to the analyte. The first probe is labeled with an energy donor, and the second is labeled with an energy acceptor. Both probes are designed in such a way that when the two probes are bound to the analyte, the energy donor and acceptor moiety are located directly together. Thus energy transfer occurs only when both probes are bound to the analyte. In the unbound state no energy transfer is possible. An example of this format uses probes modified with the chemiluminescent POD-substrate luminol as energy-donor and rhodamine as energy acceptor (see Chapter 12). In nucleic acid detection systems, unlike immunological detection systems analyte amplification steps can be integrated into the reaction format (Table V). A well-established analyte amplification reaction is the PCR; amplification factors 10 6 to 107 can be obtained (Saiki et al., 1985a, 1985b, 1988). By combination of these amplification reactions with nonradioactive labeling and detection systems, the quantitative analysis of single molecules is possible with isolate nucleic acids or in whole cells as analytes (Seibl and Koehler, 1992). This level of sensitivity is unique in bioanalytical indicator systems.
r/?
. 0,...~
. ,...~ i
.,..~
9-~
-
"N
~
.,..
~~
.~
.,..~
9
.ga-~
m
9
oo (~
"~ <
o
.,..~
<
<
,.I
Z
0
.~ ~~~ ~s~
r~
,.:.:,
0
. ,...~
r~
=
~1,
0
~
z
~~~
~~
i
~ o[ ~~
e
r~
.,.
~e~,
~
"
~
0
~1,
~
=
-~~
ell
g~
.9
....
R
o~o~
~-~~'-~'" M
r~
i [-,
9-
iu
0
r~
~N
~" ~ r
;~
"~
~
"~ ~ z z ._~
,, = ,,,,
o
. ,0
i
o= .~ ~
"
~
R~
~ ~ ~ ~ ~
0
~
0
o. ,'~
0
0
.-
o
_
=
~
~-
e~
o u
u
~
~
,.:.r oO
~a
...d
I= 0
0
[..,
Z 0 0
.,..q
+l
...d ~a
< ' ~-6 Z
.~ z
g" ~ . . ~
9~
9~
6g~r, +
L.
=
,
N
0
~, .~.
@<
,.-Z
._~ "~ ~, ZO--
9~ ~ o }e
~
~N
r..)
0
~0
,-.:, t~ o,1
m
0 0
0
2. Methods for Nonradioactive Labeling of Nucleic Acids
93
REFERENCES Adarichev, V. A., Dymshits, G. M., Kalachikov, S. M., Pozdnyakov, P. I., and Salganik, R. I. (1987). Introduction of aliphatic amino groups into DNA and their labeling with fluorochromes in preparation of molecular hybridization probes. Bioorg. Khim. 13, 1066-1069. Agrawal, S., Christodoulou, C., and Gait, M. J. (1986). Efficient methods for attaching nonradioactive labels to the 5' ends of synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 14, 6227-6245. Alexander, A., Fraiser, M., Little, M., Malinowski, D., Nadeau, J., Schram, J., Shank, D., and Walker, T. (1991). Isothermal, in vitro amplification of DNA by a novel restriction enzyme/DNA polymerase system-strand displacement amplification (SDA). The San Diego Conference on Nucleic Acids: The Leading Edge, San Diego, California, Abstract 17. AI-Hakim, A. H., and Hull, R. (1986). Studies towards the development of chemically synthesized non-radioactive biotinylated nucleic acid hybridization probes. Nucleic Acids Res. 14, 9965-9976. AI-Hakeem, M., and Sommer, S. S.(1987). Terbium identifies double-stranded RNA on gels by quenching the fluorescence of intercalated ethidium bromide. Anal. Biochem. 163, 433-439. Albarella, J. P., and Anderson, I. H. (1985). Detection of polynucleotide sequence in medium and when single-stranded nucleic acids are present by using probe, intercalator, and antibody. Eur. Patent Appl. 0146815. Albarella, J. P., and Anderson, L. H. (1985). Nucleic acid hybridization assay employing antibodies to intercalation complexes. Eur. Patent Appl. 146815. Albarella, J. P., DeReimer, L. H. A., and Carrico, R. J. (1985). Hybridization assay employing labeled pairs of hybrid-binding reagents. Eur. Patent Appl. 0144914. Albarella, J. P., DeReimer, L. H. A., and Carrico, R. J. (1985). Hybridization assay with immobilization of hybrids by antibody binding. Eur. Patent Appl. 146039. Albarella, J. P., Minegar, R. L., Patterson, W. L., Dattagupta, N., and Carlson, E. (1989) Monoadduct forming photochemical reagents for labeling nucleic acids for hybridization. Nucleic Acids Res. 17, 4293-4308. Anderson, G. L., and Deinard, A. S. (1974). Nitroblue tetrazolium (NBT) test. Review. Am. J. Med. Technol. 40, 345-353. Ansorge, W., Sproat, B. S., Stegemann, J., and Schwager, C. (1986). A non-radioactive automated method for DNA sequence determination. J. Biochem. Biophys. Methods 13, 315-323. Ansorge, W., Sproat, B., Stegemann, J., Schwager, C., and Zenke, M. (1987). Automated DNA sequencing: Ultrasensitive detection of fluorescent bands during electrophoresis. Nucleic Acids Res. 15, 4593-4603. Arakawa, H., Maeda, M., and Tsuji, A. (1982). Chemiluminescence enzyme immunoassay of 17-hydroxyprogesterone using glucose oxidase and bis(2,4,6-trichlorophenyl)oxalatefluorescent dye system. Chem. Pharm. Bull. 30, 3036-3039. Arnold, L. J., Hammond, P. W., Wiese, W. A., and Nelson, N. C. (1989). Assay formats involving acridinium-ester-labeled DNA probes. Clin. Chem. 35, 1588-1594. Asseline, U., Toulme, F., Thuong, N. T., Delarue, M., Montenay-Garestier, T., and H61~ne, C. (1984). Oligodeoxynucleotides covalently linked to intercalating dyes as base sequencespecific ligands. Influence of dye attachment site. EMBO J. 3, 795-800. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A., Seidman, J. G., and Struhl, K. (1987). "Current Protocols in Molecular Biology." Greene Publishing Associates and Wiley-Interscience, New York.
94
Christoph Kessler
Avrameas, S., Druet, P., Masseyeff, R., and Feldmann, G. (1983). "Immunoenzymatic Techniques." Elsevier Science Publishers, Amsterdam. Baret, A., and Fert, V. (1989). T 4 and ultrasensitive TSH immunoassays using luminescent enhanced xanthine oxidase assay. J. Biolumin. Chemilumin. 4, 149-153. Barringer, K. J., Orgel, L., Wahl, G., and Gingeras, T. R. (1990). Blunt-end and singlestrand ligations by Escherichia coli ligase: Influence on an in vitro amplification scheme. Gene 89, 117-122. Baumann, J. G., Wiegant, J., and van Duijin, P. (1983). The development, using poly(Hg-U) in a model system, of a new method to visualize cytochemical hybridization in fluorescence microscopy. J. Histochem. Cytochem. 31, 571-578. Bayer, E. A., and Wilchek, M. (1980). The use of the avidin-biotin complex as a tool in molecular biology. Methods Biochem. Anal. 26, 1-45. Bayer, E. A., and Wilchek, M. (1990). "Avidin-biotin technology" (M. Wilchek and E. A. Bayer, eds.). In "Methods Enzymology", Vol. 184, pp. 5-13. Academic Press, San Diego. Beck, S., and K6ster, H. (1990). Applications of dioxetane chemiluminescent probes to molecular biology. Anal. Chem. 62, 2258-2270. Ben-Hur, E., and Song, P. S. (1984). The photochemistry and photobiology of furocoumarins (psoralens), Adv. Radiat. Biol. 11, 131-171. Bergstrom, D. E., and Ruth, J. L. (1977). Preparation of carbon-5 mercurated pyrimidine nucleosides. J. Carbohydr. (Nucleosides and Nucleotides) 4, 257-269. Binder, M. (1987). In situ hybridization at the electron microscope level. Scanning Microsc. 1, 331-338. Blackburn, G. F., Shah, H. P., Kenten, J. H., Leland, J., Kamin, R. A., Link, J., Peterman, J., Powell, M. J., Shah, A., Talley, D. B., Tyagi, S. K., Williams, E., Wu, T. G., and Massey, R. J. (1991). Electrochemiluminescence detection for development of immunoassays and DNA probe assays for clinical diagnosis. Clin. Chem. 37, 1534-1539. Bonnet, T. I., Brenner, D. J., Neufeld, B. R., and Britten, R. J. (1973). Reduction in the rate of DNA reassociation by sequence divergence. J. Mol. Biol. 81, 123-135. Bos, E. S., van der Doelen, A. A., can Rooy, N., and Schuurs, A. H. (1981). 3,3',5,5'Tetramethylbenzidine as an Ames test negative chromogen for horseradish peroxidase in enzyme-immunoassay. J. Immunoassay 2, 187-204. Brakel, D. L., and Engelhardt, D. L. (1985). DNA hybridization method using biotin. In "Rapid Detection and Identification of Infectious Agents" (D. T. Kinsbury and S. Falcow, eds.), pp. 235-243. Academic Press, New York. Britten, R. J., Graham, D. E., and Neufeld, B. R. (1974). Analysis of repeating DNA sequences by reassociation. Methods Enzymol. 29, 363-418. Britten, R. J., and Kohne, D. E. (1968). Repeated sequences in DNA. Science 161, 529-540. Bronstein, I., Edwards, B., and Voyta, J. C. (1989a). 1,2-Dioxetanes: Novel chemiluminescent enzyme substrates. Applications to immunoassay. J. Biolumin. Chemilumin. 4, 99-111. Bronstein, I., and Kricka, L. J. (1989). Clinical applications of luminescent assay for enzymes and enzyme labels. J. Clin. Lab. Anal. 3, 316-322. Bronstein I., and Kricka, L. J. (1992) Chemiluminescence: Properties of 1,2-dioxetane chemiluminescence. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 168-175. Springer-Verlag, Berlin/Heidelberg. Bulow, S., and Link, G. (1986). A general and sensitive method for staining DNA and RNA blots. Nucleic Acids Res. 14, 3973. Buonocore, V., Sgambati, O., De Rosa, M., Esposito, E., and Gambacorta, A. (1980). A constitutive fl-galactosidase from the extreme thermoacidophile archaebacterium Caldariella acidophila: Properties of the enzyme in the free state and in immobilized whole cells. J. Appl. Biochem. 2, 390-397.
2. Methods for Nonradioactive Labeling of Nucleic Acids
95
Butler, E. T., and Chamberlin, M. J. (1982). Bacteriophage SP6-specific RNA polymerase. J. Biol. Chem. 257, 5772-5778. Cardullo, R. A., Agrawal, S., Flores, C., Zamecnik, P. C., and Wolf, D. E. (1988). Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. U.S.A. 85, 8790-8794. Chaiet, L., and Wolf, R. J. (1964). The properties of steptavidin, a biotin-binding protein produced by Streptomycetes. Arch. Biochem. Biophys. 106, 1-5. Chan, V. T.-W., Fleming, K. A., and McGee, J. O'D. (1985). Detection of subpicogram quantities of specific DNA sequences on blot hybridization with biotinylated probes. Nucleic Acids Res. 13, 8083-8091. Chan. V. T.-W., and McGee, J. O'D. (1990). Nonradioactive probes: Preparation, characterization, and detection. In "In situ Hybridization. Principles and Practice" (J. M. Polak and J. O'D. McGee, eds.), pp. 59-70. Oxford University Press, Oxford. Chollet, A., and Kawashima, E. H. (1985). Biotin-labeled synthetic oligodeoxyribonucleotides: Chemical synthesis and uses as hybridization probes. Nucleic Acids Res. 13, 1529-1541. Chu, B. C., and Orgel, L. E. (1985a). Detection of specific DNA sequences with short biotin-labeled probes. D N A 4, 327-331. Chu, B. C. F., and Orgel, L. E. (1985b). Nonenzymatic sequence-specific cleavage of singlestranded DNA. Proc. Natl. Acad. Sci. U.S.A. 82, 963-967. Chu, E. C. F., and Orgel, L. E. (1988). Ligation of oligonucleotides to nucleic acids or proteins via disulfide bonds. Nucleic Acids Res. 16, 3671-3691. Chimino, G. D., Gamper, H. B., Isaacs, S. T., and Hearst, J. E. (1985). Psoralens as photoactive probes of nucleic acid structure and function: Organic chemistry photochemistry, and biochemistry. Annu. Rev. Biochem. 54, 1151-1193. Collins, M., Fritsch, E. F., Ellwood, M. S., Diamond, S. E., Williams, J. I., and Brewen, J. G. (1988). A novel diagnostic method based on strand displacement. Mol. Cell. Probes 2, 15-30. Connolly, B. A. (1987). The synthesis of oligonucleotides containing a primary amino group at the 5'-terminus. Nucleic Acids Res. 15, 3131-3139. Connolly, B. A., and Rider, P. (1985). Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol-specific probes. Nucleic Acids Res. 13, 4485-4502. Cook, A. F., Vuocolo, E., and Brakel, C. L. (1988). Synthesis and hybridization of a series of biotinylated oligonucleotides. Nucleic Acids Res. 16, 4077-4095. Cotton, F. A., and LaPrade, M. D. (1968). Stereochemically nonrigid organometallic molecules. XVI. The crystal and molecular structure of p-methyl-Tr-benzoyl-rrcyclopentadienyl-dicarbonylmolybdenum. J. A m . Chem. Soc. 90, 5418-5422. Coull, J. M., Weith, H. L., and Bischoff, R. (1986). A novel method for the introduction of an aliphatic primary amino group at the 5'-terminus of synthetic oligonucleotides. Tetrahedron Lett. 27, 3991-3994. Coutlee, F., Bobo, L., Mayur, K., Yolken, R. H., and Viscidi, R. P. (1989a). Immunodetection of DNA with biotinylated RNA probes: A study of reactivity of a monoclonal antibody to DNA-RNA hybrids. Anal. Biochem. 181, 96-105. Coutlee, F., viscidi, P., and Yolken, H. (1989b). Comparison of colorimetric, fluorescent, and enzymatic amplification substrate systems in an enzyme immunoassay for detection of DNA-RNA hybrids. J. Clin. Microbiol. 27, 1002-1007. Coutlee, F., Yolken, R. H., and Viscidi, R. P. (1989c). Nonisotropic detection of RNA in an enzyme immunoassay using a monoclonal antibody against DNA-RNA hybrids. Anal. Biochem. 181, 153-162. Cremers, A. F., Jansen in de Wal, N., Wiegant, J., Dirks, R. W., Weisbeek, P., Van der
96
Christoph Kessler
Ploeg, M., and Landegent, J. E. (1987). Nonradioactive in situ hybridization. A comparison of several immunocytochemical detection systems using reflection-contrast and electron microscopy. Histochemistry 86, 609-615. Czichos, J., Koehler, M., Reckmann, B., and Renz, M. (1989). Protein-DNA conjugates produced by UV irradiation and their use as probes for hybridization. Nucleic Acids Res. 17, 1563-1572. Dahlen, P., Hurskainen, P., Lovgren, T., and Hyypia, T. (1988). Time-resolved fluorometry for the identification of viral DNA in clinical specimens. J. Clin. Microbiol. 26, 2434-2436. Dahlen, R., Syv~inen, A. C., Hurskainen, P., Kwiatkowski, M., Sund, C., Ylikoski, J., S6derlund, H., and Lovgren, T. (1987). Sensitive detection of genes by sandwich hybridization and time-resolved fluorometry. Mol. Cell. Probes 1, 159-168. Dale, R. M. K., Martin, E., Livingston, D. C., and Ward, D. C. (1975). Direct covalent mercuration of nucleotides and polynucleotides. Biochemistry 14, 2447-2457. Dattagupta, N., and Crothers, D. M. (1984). Labeled nucleic acid probes and adducts for their preparation. Eur. Patent Appl. 0131830. Dattagupta, N., Knowles, W., Marchesi, V. T., and Crothers, D. M. (1984). Nucleic acid-protein conjugate. Eur. Patent Appl. 0154884. Dattagupta, N., Rae, P. M. M., Huguenel, E. D., Carlson, E., Lygla, A., Shapiro, J. A., and Albarella, J. P. (1989). Rapid identification of microorganisms by nucleic acid hybridization after labeling the test sample. Anal. Biochem. 177, 85-89. Dattagupta, N., Rae, P. M. M., Knowles, W. J., and Crothers, D. M. (1985). Nucleic acid detection probe comprises hybridisable single stranded part of nucleic acid connected to non-hybridisable nucleic acid with specific recognition site. Eur. Patent Appl. 0147665. Dattagupta, N., Rae, P. M. M., Knowles, W. J., and Crothers, D. M. (1988). Use of nonhybridizable nucleic acids for the detection of nucleic acid hybridization. US Patent 4724202. Davey, C., and Malek, L. T. (1988). Nucleic acid amplification process. Eur. Patent Appl. 0329822. Davidson, E. H., and Britten, R. J. (1979). Regulation of gene expression: Possible role of repetitive sequences. Science 2,04, 1052-1059. Diamandis, E. P. (1988). Immunoassays with time-resolved fluorescence spectroscopy: Principles and applications (Review). Clin. Biochem. 21, 139-150. Diamandis, E. P., Bhayana, V., Conway, K., Reichstein, E., and Papanastasiou-Diamandis, A. (1988). Time-resolved fluoroimmunoassay of cortisol in serum with a europium chelate as label. Clin. Biochem. 21, 291-296. Diamandis, E. P., and Christopoulos, T. K. (1992). Time-resolved fluorescence. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 188-193. Springer-Verlag, Berlin/Heidelberg. Diamandis, E. P., Morton, R. C., Reichstein, E., and Khosravi, M. J. (1989). Multiple fluorescence labeling with europium chelators. Application to time-resolved fluoroimmunoassays. Anal. Chem. 61, 48-53. Donahue, C., Neece, V., Nycz, C., Weng, J. M. H., Walker, G. T., Vonk, G. P., Jurgensen, S. (1991). The San Diego Conference on Nucleic Acids: The Leading Edge, San Diego, California, Abstract 23. Donovan, R. M., Bush, C. E., Peterson, W. R., Parker, L. H., Cohen, S. H., Jordan, G. W., Vanden Brink, K. M., and Goldstein, E. (1987). Comparison of nonradioactive DNA hybridization probes to detect human immunodeficiency virus nucleic acid. Mol. Cell. Probes 1, 359-366. Dooley, S. (1992). Southwestern Analysis using DIG. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 299-303. Springer-Verlag, Berlin/ Heidelberg.
2. Methods for Nonradioactive Labeling of Nucleic Acids
97
Draper, D. E., and Gold, L. (1980). A method for linking fluorescent labels to polynucleotides: Application to studies of ribosome-ribonucleic acid interactions. Biochemistry 19, 1774-1781. Duck, P., and Bender, R. (1989). Methods for detecting nucleic acid sequences. WO Patent Appl. 8910415. Du Manoir, S., Speicher, M. R., Joos, S., Schr6ck, E., Popp, S., D6hner, H., Kovacs, G., Robert-Nicoud, M., Lichter, P., and Cremer, T. (1993). Detection of complete and partial chromosome gains and losses by comparative genomic in situ hybridization. Hum. Genet. 90, 590-610. Durrant, I. (1992). Direct peroxidase labeling of hybridization probes and chemiluminescence detection. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 127-134. Springer-Verlag, Berlin/Heidelberg. Eberle, J., and Seibl, R. (1992). A new method for measuring reverse transcriptase activity by ELISA. J. Virol. Meth. 40, 347-356. Ellwood, M. S., Collins, M., Fritsch, E. F., Williams, J. I., Diamond, S. E., and Brewen J. G. (1986). Strand displacement applied to assays with nucleic acid probes. Clin. Chem. 32, 1631-1636. Erlich, H. A., Gibbs, R., and Kazazian, H. H. (1989). "Polymerase Chain Reaction." Cold Spring Harbor Laboratory Press, New York. Erlich, H. A. (1989). "PCR Technology. Principles and Applications for DNA Amplification." Stockton Press, New York. Evangelista, R. A., Pollak, A., Allore, B., Templeton, E. F., Morton, R. C., and Diamandis, E. P. (1988). A new europium chelate for protein labeling and time-resolved fluorometric applications. Clin. Biochem. 21, 173-178. Fahrlander, P. D., and Klausner, A. (1988). Amplifying DNA probe signals: A 'Christmas tree' approach. BioTechnology 6, 1165-1168. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. (Addendum). Anal. Biochem. 137, 266-267. Fernley, H. N., and Walker, P. G. (1965). Kinetic behaviour of calf-intestinal alkaline phosphatase with 4-methylumbelliferyl phosphate. Biochem. J. 97, 95-103. Forster, A. C., Mclnnes, J. L., Skingle, D. C., and Symons, R. H. (1985). Nonradioactive hybridization probes prepared by the chemical labeling of DNA and RNA with a novel reagent, photobiotin. Nucleic Acids Res. 13, 745-761. Fox, G. E., Stackebrandt, E., Hespell, R. B., Gibson, J., Maniloff, J., Dyer, T. A., Wolfe, R. S., Balch, W. E., Tanner, R. S., Magrum, L. J., Zablen, L. B., Blakemore, R., Gupta, R., Bonen, L., Lewis, B. J., Stahl, D. A., Luehrsen, K. R., Chen, K. N., and Woese, C. R. (1980). The phylogeny of prokaryotes. Science 25, 457-463. Franci, C., and Vidal, J. (1988). Coupling redox and enzymic reactions improves the sensitivity of the ELISA-spot assay. J. lmmunol. Methods 107, 239-244. Froehler, B., Ng, P., and Matteucci, M. (1988). Phosphoramidate analogues of DNA: Synthesis and thermal stability of heteroduplexes. Nucleic Acids Res. 16, 4831-4839. Gallati, H. (1979). Horseradish peroxidase: A study of the kinetics and the determination of optimal reaction conditions, using hydrogen peroxide and 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) as substrate. J. Clin. Chem. Clin. Biochem. 17, 1-7. Garen, A., and Levinthal, C. (1960). A fine-structure genetic and chemical study of the enzyme alkaline phosphatase of E. coli. I. purification and characterization of alkaline phosphatase. Biochim. Biophys. Acta 38, 470-483. Gebeyehu, G., Rao, P. Y., SooChan, P., Simms, D. A., and Klevan, L. (1987). Novel
98
Christoph Kessler
biotinylated nucleotide analogs for labeling and colorimetric detection of DNA. Nucleic Acids REs. 15, 4513-4534.
Geiger, R., Hauber, R., and Miska, N. (1989). New, bioluminescence-enhanced detection system for use in enzyme activity tests, enzyme immunoassays, protein blotting, and nucleic acid hybridization. Mol. Cell. Probes 3, 309-328. Gillam, I. C. (1987). Nonradioactive probes for specific DNA sequences. Trends Biotech. 5, 332-334. Gillam, I. C., and Tenet, G. M. (1986). N4-(6-aminohexyl)cytidine and -deoxycytidine nucleotides can be used to label DNA. Anal. Biochem. 157, 199-207. Gingeras, T. R., Merten, U., and Kwoh, D. Y. (1988). Transcription-based nucleic acid amplification/detection systems. WO Patent Appl. 8810315. Gould, S. J., and Subramani, S. (1988). Review. Firefly luciferase as a tool in molecular and cell biology. Anal. Biochem. 175, 5-13. Graf, H., and Lenz, H. (1984). Derivatized nucleic acid sequence and its use in detection of nucleic acids. Get. Patent Appl. 3431536. Green, C., and Tibbetts, C. (1981). Reassociation rate limited displacement of DNA strands by branch migration. Nucleic Acids Res. 9, 1905-1918. Greene, N. M. (1975). Avidin. In "Advances in Protein Chemistry" (C. B. Anfinsen and J. T. Edsall, eds.), Vol. 29, pp. 85-113. Academic Press, New York. Gregersen, N., Koch, J., Koelvraa, S., Petersen, K. B., and Bolund, L. (1987). Improved methods for the detection of unique sequences in Southern blots of mammalian DNA by nonradioactive biotinylated DNA hybridization probes. Clin. Chim. Acta 169, 267280. Gross, D. S., and Simpkins, H. (1981). Evidence for two-site binding in the terbium (III)-nucleic acid interaction. J. Biol. Chem. 256, 9593-9598. Guatelli, J. C., Whitfield, K. M., Kwoh, D. Y., Barfinger, K. J., Richman, D. D., and Gingeras, T. R. (1990). Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. U.S.A. 87, 1874-1878. Gurrin-Reverchon, I., Chardonnet, Y., Chignol, M. C., and Thivolet, J. (1989). A comparison of methods for the detection of human papillomavirus DNA by in situ hybridization with biotinylated probes on human carcinoma cell lines: Application to wart sections. J. Immunol. Methods 123, 167-176. Guesdon, J.-L. (1992). In vivo labeling of DNA Probes with 5-BrdU. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 101-109. Springer-Verlag, Berlin/Heidelberg. Hames, B. D., and Higgins, S. J. (1985). "Nucleic Acid Hybridization." IRL Press, Oxford. Haralambidis, J., Chai, M., and Tregear, G. W. (1987). Preparation of base-modified nucleosides suitable for nonradioactive label attachment and their incorporation into synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 15, 4857-4876. Hauber, R., and Geiger, R. (1987). A new, very sensitive, bioluminescence-enhanced detection system for protein blotting. I. Ultrasensitive detection systems for protein blotting and DNA hybridization. J. Clin. Chem. Clin. Biochem. 25, 511-514. Hegnauer, R. (1971). Pflanzenstoffe und Pflanzensystematik. Naturwissenschaften 58, 585-598. Heiles, H. B. J., Genersch, E., Kessler, C., Neumann, R., and Eggers, H. J. (1988). In situ hybridization with digoxigenin-labeled DNA of human papillomaviruses (HPV 16/18) in HeLa and SiHa cells BioTechniques 6, 978-981. Heller, M. J., and Morrison, L. E. (1985). Chemiluminescent and fluorescent probes for DNA hybriditation systems. In "Rapid Detection and Identification of Infectious Agents" (D. T. Kingsbury and S. Falkow, eds.), pp. 245-256. Academic Press, New York. Heller, M. J., Morrison, L. E., Prevatt, W. D., and Akin, C. (1982). Homogeneous nucleic
2. Methods for Nonradioactive Labeling of Nucleic Acids
99
acid hybridization diagnostics by nonradioactive energy transfer. Eur. Patent Appl. 0070685. Heller, M. J., and Schneider, B. L. (1983). Chemiluminescent labeling of nucleic acids using azidophenyl glyoxal. Fed. Proc. 42, 1954. Hemmil/L I., Dakabu, S., Mukkala, V.-M., Siitari, H., and Lrvgren, T. (1984). Europium as a label in time-resolved immunofluoremetric assays. Anal. Biochem. 137, 335-343. Herzberg, M. (1984). Molecular genetic probe, assay technique, and a kit using this molecular genetic probe. Eur. Patent Appl. 0128018. Hrfler, H. (1987). What's new in 'in situ' hybridization. Pathol. Res. Pract. 182, 421-430. H61tke, H.-J., and Kessler, C. (1990). Nonradioactive labeling of RNA transcripts in vitro with the hapten digoxigenin (DIG); hybridization and ELISA-based detection. Nucleic Acids Res. 18, 5843-5851. Hrltke, H. J., Ettl, I., Finken, M., West, S., and Kunz, W. (1992a). Multiple nucleic acid labeling and rainbow detection. Anal. Biochem. 207, 24-31. Hrltke, H. J., Sagner, G., Kessler, C., and Schmitz, G. (1992). Sensitive chemiluminescent detection of digoxigenin-labeled nucleic acids: A fast and simple protocol and its application. BioTechniques, 12, 104-106. H61tke, H.-J., Seibl, R., Burg, J., M0hlegger, K., and Kessler, C. (1990). Non-radioactive labeling and detection of nucleic acids: II. Optimization of the digoxigenin system. Mol. Gen. Hoppe-Seyler 371, 929-938. Hrltke, H.-J., Seibl, R., Schmitz, G. G., Walter, T., ROger, R., Sagner, G., Burg, J., M0hlegger, K., and Kessler, C. (1992b). The digoxigenin:anti-digoxigenin (DIG) system: 3.2 labeling and detection of nucleic acids. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 36-56. Springer-Verlag, Berlin/Heidelberg. Hopman, A. H. N., Wiegant, J., Tesser, G. I., and Van Duijn, P. (1986a). A nonradioactive in situ hybridization method based on mercurated nucleic acid probes and sulfhydrylhapten ligands. Nucleic Acids Res. 14, 6471-6488. Hopman, A. H. N., Wiegant, J., and Van Duijn, P. (1986b). A new hybridocytochemical method based on mercurated nucleic acid probes and sulfhydryl-hapten ligands. I. Stability of the mercurysulfhydryl bond and influence of the ligand structure on immunochemical detection of the hapten. Histochemistry 84, 169-178. Hutton, J. R., and Wetmur, J. G. (1973). Length dependence of the kinetic complexity of mouse satellite DNA. Biochem. Biophys. Res. Commun. 52, 1148-1155. Huynh Dinh, T., Sarfati, S., Igolen, J., and Guesdon, J. L. (1987). Markers for detecting nucleic acids are derived from 2'-desoxy adenosine derivatives. Eur. Patent Appl. 0254646. Hyman, H. C., Yogev, D., and Razin, S. (1987). DNA probes for detection and identification of Mycoplasma pneumoniae and Mycoplasma genitalium. J. Clin. Microbiol. 25, 726-728. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (1990). "PCR Protocols. A Guide to Methods and Applications." Academic Press, New York. Inoue, S., Hashida, S., Tanaka, K., Imigawa, M., and Ishikawa, E. (1985). Preparation of monomeric affinity-purified Fab'-fl-D-galactosidase conjugate for immunoenzymometric assay. Anal. Lett. 18, 1331-1344. Ishikawa, E., Imagawa, M., Hashida, S., Yoshitake, S., Hamaguchi, Y., and Ueno, T. (1983). Enzyme labeling of antibodies and their fragments for enzyme immunoassay and immunohistochemical staining. J. Immunoassay 4, 209-327. Ishikawa, E., Kawai, T., and Miyai, K. (1981). "Enzyme Immunoassay." Igaku-Shoin, Tokyo. Iwai, H., Ishihara, F., and Akihama, S. (1983). A fluorometric rate assay of peroxidase using the homovanillic acid-o-dianisidine-hydrogen peroxide system. Chem. Pharm. Bull. 31, 3579-3582. Jablonski, E., Moomaw, E. W., Tullis, R. H., and Ruth, J. L. (1986). Preparation of oligode-
IO0
Christoph Kessler
oxynucleotide-alkaline phosphatase conjugates and their use as hybridization probes. Nucleic Acids Res. 14, 6115-6128.
Jablonski, E., and Ruth, J. L. (1986). Synthesis of oligonucleotide-enzyme conjugates and their use as hybridization probes. DNA 5, 89. J~iger, A., Levy, M. J., and Hecht, S. M. (1988). Oligonucleotide N-alkylphosphoramidates: Synthesis and binding to polynucleotides. Biochemistry 27, 7237-7246. Johannsson, A., Stanley, C. J., and Self, C. H. (1985). A fast highly sensitive colorimetric enzyme immunoassay system demonstrating benefits of enzyme amplification in clinical 'chemistry. Clin. Chim. Acta 148, 119-124. Josel, H.-P. (1992). Labeling of biomolecules with fluorescein, resorufin, and rhodamine. In "Nonradioactive Labeling and Detection of Biomolecules " (C. Kessler, ed.), pp. 185-188. Springer-Verlag, Berlin/Heidelberg. Joyce, G. F. (1989). Amplification, mutation, and selection of catalytic RNA. Gene 82, 83-87. Jungell-Nortamo, A., Syv~inen, A. C., Luoma, P., and S6dedund, H. (1988). Nucleic acid sandwich hybridization: Enhanced reaction rate with magnetic microparticles as carriers. Mol. Cell Probes 2, 281-288. Kassavetis, G. A., Butler, E. G., Roulland, D., Chamberlin, M. J. (1982). Bacteriophage SP6-specific RNA polymerase. J. Biol. Chem. 257, 5779-5788. Keller, G. H., Cumming, C. U., Huang, D. P., Manak, M. M., and Ting, R. (1988). A chemical method for introducing haptens onto DNA probes. Anal. Biochem. 170, 441-450. Keller, G. H., Huang, D.-P., and Manak, M. M. (1989). Labeling or DNA probes with a photoactivatable hapten. Anal. Biochem. 177, 392-395. Keller, G. H., and Manak, M. M. (1989). "DNA Probes." Stockton Press, New York. Kemeny, D. M., and Challacombe, S. J. (1988). "ELISA and other solid phase immunoassays. Theoretical and practical aspects." John Wiley and Sons, New York. Kempe, T., Sundquist, W. I., Chow, F., and Hu, S. L. (1985). Chemical and enzymatic biotin-labeling of oligonucleotides. Nucleic Acids Res. 13, 45-57. Kessler, C. (1990). Detection of nucleic acids by enzyme-linked immuno-sorbent assay (ELISA) technique: An example for the development of a novel nonradioactive labeling and detection system with high sensitivity. In: "Advances in Mutagenesis Research" (G. Obe, ed.), Vol. 1, pp. 105-152. Springer-Verlag, Berlin/Heidelberg. Kessler, C. (1991). The digoxigenin: antidigoxigenin (DIG) technologyma survey on the concept and realization of a novel bioanalytical indicator system. Mol. Cell. Probes, in press. Kessler, C. (1992a). "Nonradioactive Labeling and Detection of Biomolecules." SpringerVerlag, Berlin/Heidelberg. Kessler, C. (1992b). The digoxigenin: antidigoxigenin (DIG) system. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 35-69. Springer-Verlag, Berlin/Heidelberg. Kessler, C., H61tke, H.-J., Seibl, R., Burg, J., and Muhlegger, K. (1990). Nonradioactive labeling and detection of nucleic acids: I. A novel DNA labeling and detection system based on digoxigenin : antidigoxigenin ELISA principle (digoxigenin system). Mol. Gen. Hoppe-Seyler 371, 917-927. Kenten, J. H. (1992). Electrochemiluminescence: Ruthenium complexes. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 175-179. SpringerVerlag, Berlin/Heidelberg. Koch, J. (1992). Probe labeling and hybridization in one step. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 336-343. Springer-Vedag, Berlin/ Heidelberg.
2. Methods for Nonradioactive Labeling of Nucleic Acids
101
Kohne, D. E. (1990). The use of DNA probes to detect and identify microorganisms. Adv. Exp. Med. Biol. 263, 11-35. Kohne, D. E., Levinson, S. A., and Byers, M. J. (1977). Room temperature method for increasing the rate of DNA reassociation by many thousandfold: The phenol emulsion reassociation technique. Biochemistry 16, 5329-5341. Kricka, L. J. (1988). Review. Clinical and biochemical applications of luciferase and luciferins. Anal. Biochem. 175, 14-21. Krieg, P. A., and Melton, D. A. (1987). In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol. 155, 397-415. Kumar, A., Tchen, P., RouUet, F., and Cohen, J. (1988). Nonradioactive labeling of synthetic oligonucleotide probes with terminal deoxynucleotidyl transferase. Anal. Biochem. 169, 376-382. Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMichelle, L. J., and Gingeras, T. R. (1989). Transcription-based amplification system and detection of amplified human immunodeficiency virus type I with a bead-based sandwich hybridization format. Proc. Natl. Acad. Sci. U.S.A. 86, 1173-1177. Landegent, J. E., Jansen in de Wal, N., Baan, R. A., Hoeijmakers, J. H., and Van der Ploeg, M. (1984). 2-Acetylaminofluorene-modified probes for the indirect hybridocytochemical detection of specific nucleic acid sequences. Exp. Cell. Res. 153, 61-72. Landegent, J. E., Jansen in de Wal, N., Ploem, J. S., and Van der Ploeg, M. (1985). Sensitive detection of hybridocytochemical results by means of reflection-contrast microscopy. J. Histochem. Cytochem. 33, 1241-1246. Landes, G. M. (1985). Labeled DNA. Fur. Patent Appl. 0138357. Langer, P. R., Waldrop, A. A., and Ward, D. C. (1981). Enzymatic synthesis of biotinlabeled polynucleotides: Novel nucleic acid affinity probes. Proc. Natl. Acad. Sci. U.S.A. 78, 6633-6637. Langer-Safer, P. R., Levine, M., and Ward, D. C. (1982). Immunological method for mapping genes on Drosophila polytene chromosomes. Proc. Natl. Acad. Sci. U.S.A. 79, 4381-4385. Lardy, H. A., and Peanasky, R. (1953). Metabolic functions of biotin. Physiol. Rev. 33, 560-565. Lazar, J. G., and Taub, F. E. (1992). A highly sensitive method for detecting peroxidase in in situ hybridization or immunohistochemical assays. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 135-142. Springer-Verlag, Berlin/ Heidelberg. Leary, J. J., Brigati, D. J., and Ward, D. C. (1983). Colorimetric method for visualizing biotin-labeled DNA probes hybridized to DNA or RNA immobilized on nitrocellulose: Bio-blots. Proc. Natl. Acad. Sci. U.S.A. 80, 4045-4049. Levinson, C., and Chang, C.-A. (1990). Nonisotopically labeled probes and primers. In "PCR Protocols. A Guide to Methods and Applications" (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds.), pp. 99-112. Academic Press, New York. Li, H., Gyllensten, U. B., Cui, X., Saiki, R. K., and Erlich, H. A. (1988). Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature (London) 335, 414-417. ! Li, P., Medon, P., Skingle, D. C., Lanser, J. A., and Symons, R. H. (1987). Enzyme-linked synthetic oligonucleotide probes: Nonradioactive detection of Escherichia coli in faecal specimens. Nucleic Acids Res. 15, 5275-5287. Lichter, P., and Cremer, T. (1993). Chromosome analysis by non-isotopic in situ hybridization. In "Human Cytogenetics" (D. E. Rooney and B. H. Czepulkowski, eds.), Vol. I, pp. 157-192. IRL Press, Oxford. Lichter, P., Tang, C. J. C., Call, K., Hermanson, G., Evans, G. A., Housman, D., and
102
Christoph Kessler
Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247, 64-69. Lizardi, P. M., Guerra, C. E., Lomeli, H., Tussie-Luna, I., and Kramer, F. R. (1988). Exponential amplification of recombinant-RNA hybridization probes. Biotechnology 6, 1197-1202. Lo, Y.-M. D., Mehal, W. Z., and Fleming, K. A. (1988). Rapid production of vector-free biotinylated probes using the polymerase chain reaction. Nucleic Acids Res. 16, 8719. Lo, Y.-M. D., Mehal, W. Z., and Fleming, K. A. (1990). Incorporation of biotinylated dUTP. In "PCR Protocols. A Guide to Methods and Applications" (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds.), pp. 113-118. Academic Press, New York. Lojda, Z., Slaby, J., Kraml, J., and Kolinska, J. (1973). Synthetic substrates in the histochemical demonstration of intestinal disaccharidases. Histochemie 34, 361-369. Lovgren, T., Hemmil~i, I., Pettersson, K., and Halonen, P. (1985). Time-resolved fluorometry in immunoassay. In "Alternative Immunoassays" (W. P. Collins, ed.), pp. 203-217. John Wiley and Sons, Chichester, England. Maggio, E. T. (1980). "Enzyme-Immunoassay." CRC Press, Boca Raton, Florida. Maitland, N. J., Cox, M. F., Lynas, C., Prime, S., Crane, I., and Scully, C. (1987). Nucleic acid probes in the study of latent viral disease. J. Oral Pathol. 16, 199-211. Malcolm, A. D. B., and Nicolas, J. L. (1984). Detecting a polynucleotide sequence and labelled polynucleotides useful in this method. WO Patent Appl. 8403520. Malvano, R. (1980). "Immunoenzymatic Assay Techniques." Martinus Nujoff Publishers, The Hague, The Netherlands. Marich, J. E., and Ruth, J. L. (1992). The SNAP system. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 143-I49. Springer-Verlag, Berlin/ Heidelberg. Marmur, J., and Doty, P. (1959). Heterogeneity in DNA. I. Dependence on composition of the configurational stability of deoxyribonucleic acids. Nature 183, 1427-1428. Mason, D. Y. (1985). Immunocytochemical labeling of monoclonal antibodies by the APAAP immunoalkaline phosphatase technique. In "Techniques of Immunocytochemistry" (G. R. Bullock and P. Petrusz, eds.), Vol. 3, pp. 25-42. Academic Press, London. Mason, D. Y., Cordell, J. L., Abdulaziz, Z., Naiem, M., and Bordenave, G. (1982). Preparation of peroxidase-antiperoxidase (PAP) complexes for immunohistological labeling of monoclonal antibodies. J. Histochem. Cytochem. 30, 1114-1122. Matthews, J. A., and Kricka, L. J. (1988). Analytical strategies for the use of DNA probes. Anal. Biochem. 169, 1-25. McCracken, S. (1989). Preparation of RNA transcripts using SP6 RNA polymerase. In "DNA Probes" (G. H. Keller and M. M. Manak, eds.), pp. 119-120. Stockton Press, New York. McKnabb, S., Rupp, R., and Tedesco, J. L. (1989). Measuring contamination DNA in bioreactor-derived monoclonals. BioTechnology 7, 343-347. Meinkoth, J., and Wahl, G. (1984). Hybridization of nucleic acids immobilized on solid supports. Anal. Biochem. 138, 267-284. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12, 7035-7056. Miska, W., and Geiger, R. (1987). I. Synthesis and characterization of luciferin derivatives for use in bioluminescence-enhanced enzyme immunoassays. New ultrasensitive detection systems for enzyme immunoassay. J. Clin. Chem. Clin. Biochem. 25, 23-30. Miska, W., and Geiger, R. (1989). Luciferin derivatives in bioluminescence-enhanced enzyme immunoassays. J. Biolumin. Chemilumin. 4, 119-128.
2. Methods for Nonradioactive Labeling of Nucleic Acids
103
Mock, G. A., PoweU, M. J., and Septak, M. J. (1986). New (poly)-nucleotide labeled with acridine ester or lanthanide useful as analytical agents especially to detect organism gene in rapid diagnosis of infections. Eur. Patent Appl. 0212951. Moench, T. R. (1987). In situ hybridization. Mol. Cell. Probes 1, 195-205. Morris, C. E., Klement, J. F., and McAllister, W. T. (1986). Cloning and expression of the bacteriophage T3 RNA polymerase gene. Gene 41, 193-200. Mtihlegger, K., Huber, E., vonder Eltz, H., Riiger, R., and Kessler, C. (1990). Nonradioactive labeling and detection of nucleic acids: IV. Synthesis and properties of the nucleotide compounds of the digoxigenin system and of photodigoxigenin. Mol. Gen. Hoppe-Seyler 371, 939-951. Murakawa, G. J., Wallace, B. R., Zaia, J. A., and Rossi, J. J. (1987). Method for amplification and detection of RNA sequences. Eur. Patent Appl. 0272098. Nelson, P. S., Frye, R. A., and Liu, E. (1989a). Bifunctional oligonucleotide probes synthetized using a novel CPG support are able to detect single base pair mutations. Nucleic Acids Res. 17, 7187-7194. Nelson, P. S., Sherman-Gold, R., and Leon, R. (1989b). A new and versatile reagent for incorporating multiple primary aliphatic amines into synthetic oligonucleotides. Nucleic Acids Res. 17, 7179-7186. Newman, C. L., Modlin, J., Yolken, R. H., and Viscidi, R. P. (1989). Solution hybridization and enzyme immunoassay for biotinylated DNA-RNA hybrids to detect enteroviral RNA in cell culture. Mol. Cell. Probes 3, 375-382. Nicholls, P. J., and Malcolm, A. D. B. (1989). Nucleic acid analysis by sandwich hybridization. J. Clin. Lab. Anal. 3, 122-135. Nickersen, D. A., Kaiser, R., Lappin, S., Steward, J., Hood, L., and Landgren, U. (1990). Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay. Proc. Natl. Acad. Sci. U.S.A. 87, 8923-8927. Nur, I., and Herzberg, M. (1992). The sulfone system. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 110-115. Springer-Verlag, Berlin/ Heidelberg. Nur, I., Reinhartz, A., Hyman, H. C., Razin, S., and Herzberg, M. (1989). Chemiprobe, a nonradioactive system for labeling nucleic acid. Ann. Biol. Clin. 47, 601-606. Oellerich, M. (1983). Principles of enzyme-immunoassay s. I n " Methods of Enzymatic Analysis" (H. U. Bergmeyer, J. Bergmeyer, and M. Grassl, eds.), Vol. 1, pp. 233-260. Verlag Chemie, Weinheim, Germany. Orgel, L. E. (1989). Ligase-based amplification method. WO Patent Appl. 8909835. Oser, A., Roth, W. K., and Valet, G. (1988). Sensitive nonradioactive dot-blot hybridization using DNA probes labeled with chelate group substituted psoralen and quantitative detection by europium ion fluorescence. Nucleic Acids Res. 16, 1181-1196. Oser, A., and Valet, G. (1988). Improved detection by time-resolved fluorometry of specific DNA immobilized in microtiter wells with europium/metal-chelator labeled DNA probes. Nucleic Acids Res. 16, 8178. Paau, A., Platt, S. G., and Sequeiro, L. (1983). Assay method and probe for polynucleotide sequence. UK Patent 2125964. Parsons, G. (1988). Development of DNA probe-based commercial assay. J. Clin. lmmunoassay 11, 152-160. Pasternak, J. J. (1988). Microbial DNA diagnostic technology. Biotech. Adv. 6, 683-695. Pataki, S., Meyer, K., and Reichstein, T. (1953). Die Konfiguration des Digoxigenins (Teilsynthese des 3fl-, 12a- und des 3fl, 12ct-Dioxyatians~iure-methylesters). Glykoside und Aglycone, 116. Mitteling. Helv. Chim. Acta 36, 1295-1308. Pereira, H. G. (1986). Nonradioactive nucleic acid probes for the diagnosis of virus infections. BioEssays 4, 110-113.
104
Christoph Kessler
Pezzella, M., Pezzella, F., Galli, C., Macchi, B., Verani, P., Sorice, F., and Baroni, C. D. (1987). In situ hybridization of human immunodeficiency virus (HTLV-III) in cryostat sections of lymph nodes of lymphadenopathy syndrome patients. J. Med. Virol. 22, 135-142. Pfeiffer, F., and Gilbert, W. (1988). Vecbase, a cloning vector sequence data base. Protein Seq. Data Analysis 1, 269-280. Pitcher, D. G., Owen, R. J., Dyal, P., and Beck, A. (1987). Synthesis of a biotinylated DNA probe to detect ribosomal RNA cistrons in Providencia stuartii. FEMS Microbiol. Lett. 48, 283-287. Pollard-Knight, D. (1990). Current methods in nonradioactive nucleic acid labeling and detection. Technique 2, 113-132. Pollard-Knight, D., Read, C. A., Downes, M. J., Howard, L. A., Leadbetter, M. R., Pheby, S. A., McNaughton, E., Syms, A., and Brady, M. A. W. (1990). Nonradioactive nucleic acid detection by enhanced chemiluminescence using probes directly labeled with horseradish peroxidase. Anal. Biochem. 185, 84-89. Porstmann, B., Porstmann, T., and Nugel, E. (1981). Comparison of chromogenes for the determination of horseradish peroxidase as a marker in enzyme immunoassay. J. Clin. Chem. Clin. Biochem. 19, 435-439. Porstmann, T., Ternynck, T., and Avrameas, S. (1985). Quantitation of 5-bromo-2deoxyuridine incorporation into DNA: An enzyme immunoassay for the assessment of the lymphoid cell proliferative response. J. Immunol. Methods 82, 169-179. Proverenny, A. M., Podgorodnichenko, V. K., Bryksina, L. E., Monastyrskaya, G. S., and Sverdlov, E. D. (1979). Immunochemical approaches to DNA structure investigationmI. Mol. Immunol. 16, 313-316. Raap, A. K., Wiegant, J., and Lichter, P. (1992). Multiple fluorescence in situ hybridization for molecular cytogenetics. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 343-354. Springer-Vedag, Berlin/Heidelberg. Rabin, B. R., Taylorson, C. J., and Hollaway, M. R. (1985). Assay method using enzyme fragments as labels and new enzyme substrates producing coenzymes or prostetic groups. Eur. Patent Appl. 0156641. Ranki, M., Palva, A., Virtanen, M., Laaksonen, M., and S6dedund, H. (1983). Sandwich hybridization as convenient method for the detection of nucleic acids in crude samples. Gene 21, 77-85. Rashtchian, A., Eldredge, J., Ottaviani, M., Abbott, M., Mock, G., Lovern, D., Klinger, J., and Parsons, G. (1987). Immunological capture of nucleic acid hybrids and application to nonradioactive DNA probe assay. Clin. Chem. 33, 1526-1530. Rashtchian, A., and Mackey, J. (1992). The biotin system: 4.1 Labeling and detection of nucleic acids. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 70-90. Springer-Verlag, Berlin/Heidelberg. Reckmann, B., and Rieke, E. (1987). Verfahren und Mittel zur Bestimmung von Nucleins~uren. Eur. Patent 0286958. Reichstein, T., and Weiss, E. (1962). The sugars of the cardiac glycosides. Ado. Carbohydr. Chem. 17, 65-120. Reischl, U., Rfiger, R, and Kessler, C. (1993). Nonradioactive labeling of polymerase chain reaction products. In "PCR Protocols. Current Methods and Applications" (B. A. White, ed.), pp. 51-62. Humana Press, Totowa, New Jersey. Reisfeld, A., Rothenberg, J. M., Bayer, E. A., and Wilchek, M. (1987). Nonradioactive hybridization probes prepared by the reaction of biotin hydrazide with DNA. Biochem. Biophys. Res. Commun. 142, 519-526. Renz, M. (1983). Polynucleotide-histone H1 complexes as probes for blot hybridization. EMBO J. 2, 817-822.
2. Methods for Nonradioactive Labeling of Nucleic Acids
105
Renz, M., and Kurz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Rigby, P. W. J., Dieckmann, M., Rhodes, C., and Berg, P. (1977). Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237-251. Riley, L. K., Marshall, M. E., and Coleman, M. S. (1986). A method for biotinylating oligonucleotide probes for use in molecular hybridizations. D N A 5, 333-337. Rolfs, A., Schuller, I., Finckh, U., and Weber-Rolfs, I: (1992). "PCR: Clinical Diagnostics and Research." Springer-Verlag, Berlin/Heidelberg. Rossau, R., Heyndrickx, L., and Van Heuverswyn, H. (1988). Nucleotide sequence of a 16S ribosomal RNA gene from Neisseria gonorrhoeae. Nucleic Acids Res. 16, 6227. Rossau, R., van Landschoot, A., Mannheim, W., and De Ley, J. (1986). Intergeneric and intrageneric similarities of ribosomal RNA cistrons of the Neisseriaceae. Int. J. Syst. Bacteriol. 36, 323-332. Rothenberg, J. M., and Wilchek, M. (1988). p-Diazobenzoyl-biocytin: A new biotinylating reagent for DNA. Nucleic Acids Res. 16, 7197. Roychoudhury, R., Tu, C.-P. D., and Wu, R. (1979). Influence of nucleotide sequence adjacent to duplex DNA termini on 3'-terminal labeling by terminal transferase. Nucleic Acids Res. 6, 1323-1333. Ruth, J. L. (1984). Chemical synthesis of nonradioactively-labeled DNA hybridization probes. D N A 3, 123. Ruth, J. L., Morgan, C., and Pasko, A. (1985). Linker arm nucleotide analogs useful in oligonucleotide synthesis. D N A 4, 93. Saiki, R. K., Anaheim, N., and Erlich, H. A. (1985a). A novel method for the detection of polymorphic restriction sites by cleavage of oligonucleotide probes: Application to a sickle-cell anemia. BioTechnology 3, 1008-1012. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., MuUis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Anaheim, N. (1985b). Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350-1354. Sakamoto, H., Traincard, F., Vo-Quang, T., Ternynck, T., Guesdon, J. L., and Avrameas, S. (1987). 5-Bromodeoxyuridine in vivo labeling of MI3 DNA, and its use as a nonradioactive probe for hybridization experiments. Mol. Cell. Probes 1, 109-120. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989a). "Molecular Cloning. A Laboratory Manual" 2nd Ed. Cold Spring Harbor Laboratory Press, New York. Schaap, A. P., Sandison, M. D., and Handley, R. S. (1987). Chemical and enzymatic tiggering of 1,2-dioxetanes. Alkaline phosphatase-catalyzed chemiluminescence from an aryl phosphate-substituted dioxetane. Tetrahedron Lett. 28, 1159-1162. Schmitz, G. G., Walter, T., and Kessler, C. (1991). Nonradioactive labeling of oligonucleotides in vitro with the hapten digoxigenin (DIG) by tailing with terminal transferase. Anal. Biochem. 192, 222-231. Segev, D. (1990). Amplification and detection of target nucleic acid sequencesmfor in vitro diagnosis of infectious disease, genetic disorders, and cellular disorders, e.g., cancer. WO Patent Appl. 9001069. Segev, D., Zehr, S., Lin, P., and Park-Turkel, H. S. (1990). Amplification of nucleic acid sequences by the repair chain reaction (RCR). 5th San Diego Conference on Nucleic Acids, AACC, Abstract Poster 44.
106
Christoph Kessler
Seibl, R., H6ltke, H.-J., ROger, R., Meindl, A., Zachau, H.-G., RaBhofer, G., Roggendorf, M., Wolf, H., Arnold, N., Weinberg J., and Kessler, C. (1990). Nonradioactive labeling and detection of nucleic acids: III. Applications of the digoxigenin system. Mol. Gen. Hoppe-Seyler 371, 939-951. Seibl, R., and Koehler, S. (1992). Quantitative detection of DIG-labeled nucleic acid. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 425-427. Springer-Verlag, Berlin/Heidelberg. Self, C. H. (1985). Enzyme amplification--a general method applied to provide an immunoassisted assay for placental alkaline phosphatase. J. Immunol. Methods 76, 389-393. Serke, S., and Pachmann, K. (1988). An immunocytochemical method for the detection of fluorochrome-labeled DNA probes hybridized in situ with cellular RNA. J. Immunol. Methods 112, 207-211. Sheldon, E., Kellog, D. E., Levenson, C., Bloch, W., Aldwin, L., Birch, D., Goodson, R., Sheridan, P., Horn, G., Watson, R., and Erlich, H. (1987). Nonisotopic M13 probes for detecting the/3-globin gene: Application to diagnosis of sickle cell anemia. Clin. Chem. 33, 1368-1371. Sheldon, E. L., Kellogg, D. E., Watson, R. E., Levinson, C. H., and Erlich, H. A. (1986). Use of nonisotopic MI3 probes for genetic analysis: Application to class II loci. Proc. Natl. Acad. Sci. U.S.A. 83, 9085-9089. Sheldon, E. L., III, Levenson, C. H., Mullis, D. B., and Rapoport, H. (1985). Process for labeling nucleic acids using psoralen derivates. Eur. Patent Appl. 0156287. Smith, L. M., Fung, S., Hunkapiller, M. W., Hunkapiller, T. J., and Hood, L. E. (1985). The synthesis of oligonucleotides containing an aliphatic amino group at the 5' terminus: Synthesis of fluorescent DNA primers for use in DNA sequence analysis. Nucleic Acids Res. 13, 2399-2412. Smith, L. M., Kaiser, R. J., Sanders, J. Z., and Hood, L. E. (1987). The synthesis and use of fluorescent oligonucleotides in DNA sequence analysis. Methods Enzymol. 155, 260-301. Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P., Dodd, C., Connell, C. R., Heiner, C., Kent, S. B. H., Hood, L. E. (1986). Fluorescence detection in automated DNA sequence analysis. Nature 321, 674-679. Sodja, A., and Davidson, N. (1978). Gene mapping and gene enrichment by the avidinbiotin interaction: Use of cytochrome-c as a polyamine bridge. Nucleic Acids Res. 5, 385-401. Soini, E., and Kojola, H. (1983). Time-resolved fluorometer for lanthianide chelatesma new generation of nonisotopic immunoassay. Clin Chem. 29, 65-68. Sproat, B. S., Beijer, B., and Rider, P. (1987). The synthesis of protected 5'-amino-2',5'dideoxyribonucleoside-3'-O-phosphoramidites: Applications of 5'-amino-oligodexyribonucleotides. Nucleic Acids Res. 15, 6181-6196. Stanley, C. J., Johannsson, A., and Self, C. H.'(1985). Enzyme amplification can enhance both the speed and the sensitivity of immunoassays. J. Immunol. Methods 83, 89-95. Stollar, B. D., and Rashtchian, A. (1987). Immunochemical approaches to gene probe assays. Anal. Biochem. 161, 387-394. Stull, T. L., LiPuma, J. J, and Edling, T. D. (1988). A broad spectrm probe for molecular epidemiology of bacteria: Ribosomal RNA. J. Infect. Dis. 157, 280-286. Stiirzl, M., and Roth, W. K. (1990). "Run-off" synthesis and application of defined singlestranded DNA hybridization probes. Anal. Biochem. 185, 164-169. Syv~inen, A. C., Alanen, M., and SOderlund, H. (1985). A complex of single-strand binding protein and MI3 DNA as hybridization probe. Nucleic Acids Res. 13, 2789-2802. Syv~inen, A. C., Laaksonen, M., and S6derlund, H. (1986a). Fast quantification of nucleic acid hybrids by affinity-based hybrid collection. Nucleic Acids Res. 14, 5037-5048.
2. Methods for Nonradioactive Labeling of Nucleic Acids
107
Syv~inen, A. C., Tchen, P., Ranki, M., and Srderlund, H. (1986b). Time-resolved fluorometry: A sensitive method to quantify DNA-hybrids. Nucleic Acids Res. 14, 1017-1028. Szalay, A. A., Kricka, L. J., and Stanley, P. (1993). "Bioluminescence and Chemiluminescence." Wiley, Chichester. Takahashi, Y., Arakawa, H., Maeda, M., and Tsuiji, A. (1989). A new biotinylating system for DNA using biotin aminocaproyl hydrazide and glutaraldehyde. Nucleic Acids Res. 17, 4899-4900. Taub, F. (1986). An assay for nucleic acid sequences, particularly genetic lesions. WO Patent Appl. 8603227. Tautz, D., and Pfeifle, C. (1989). A nonradioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98, 81-85. Tchen, P., Fuchs, R. P. P., Sage, E., and Leng, M. (1984). Chemically modified nucleic acids as immunodetectable probes in hybridization experiments. Proc. Natl. Acad. Sci. U.S.A. 81, 3466-3470. Theissen, G., Richter, A., and Lukacs, N. (1989). Degree of biotinylation in nuleic acids estimated by a gel retardation assay. Anal. Biochem. 179, 98-105. Thompson, J., and Gillespie, D. (1987). Molecular hybridization with RNA probes in concentrated solutions of guanidine thiocynate. Anal. Biochem. 163, 281-291. Thorpe, G. H., and Kricka, L. J. (1989). Incorporation of enhanced chemiluminescent reactions into fully automated enzyme immunoassays. J. Biolumin. Chemilumin. 3, 97-100. Thuong, N. T., Asseline, U., Roig, V., Takasugi, M., and H616ne, C. (1987). Oligo(adeoxynucleotide)s covalently linked to intercalating agents: Differential binding to riboand deoxyribopolynucleotides and stability towards nuclease digestion. Proc. Natl. Acad. Sci. U.S.A. 84, 5129-5133. Tomlinson, S., Lyga, A., Huguenel, E., and Dattagupta, N. (1988). Detection ofbiotinylated nucleic acid hybrids by antibody-coated gold colloid. Anal. Biochem. 171, 217-222. Tous, G., Fausnaugh, J., Vieira, P., and Stein, S. (1988). Preparation and chromatographic use of 5'-fluorescent-labeled DNA probes. J. Chromatogr. 444, 67-77. Traincard, F., Ternynck, T., Danchin, A., and Avrameas, S. (1983). An immunoenzymic procedure for the demonstration of nucleic acid molecular hybridization. Ann Immunol. 134, 339-405. Trainor, G. L., and Jensen, M. A. (1988). A procedure for the preparation of fluorescencelabeled DNA with terminal deoxynucleotidyl transferase. Nucleic Acids Res. 16, 11846. Tsuji, A., Maeda, M., Arakawa, H., Shimizu, S., Tanabe, K., and Sudo, Y. (1987). Chemiluminescence enzyme immunoassay using invertase, glucose-6-phosphate dehydrogenase and /3-o-galactosidase as label. In "Bioluminescence and Chemiluminescence" (J. Scholmerich, R. Anderson, A. Kapp, M. Ernst, and W. G. Woods, eds.), pp. 233-235. Wiley Interscience, Chichester, England. Tu, C.-P. D., and Cohen, S. (1980). 3'-End labeling of DNA with [t~-aEp]cordycepin-5'triphosphate. Gene 10, 177-183. Urdea, M. S., Running, J. A., Horn, T., Clyne, J., Ku, L., and Warner, B. D. (1987). A novel method for the rapid detection of specific nucleotide sequences in crude biological samples without blotting or radioactivity; application to the analysis of hepatitis B virus in human serum. Gene 61, 253-264. Urdea, M. S., Warner, B. D., Running, J. A., Stempien, M., Clyne, J., and Horn, T. (1988). A comparison of nonradioisotopic hybridization assay methods using fluorescent, chemiluminescent, and enzyme-labeled synthetic oligodeoxyribonucleotide probes. Nucleic Acids Res. 16, 4937-4956. Van de Plaas, P. F. E. M., and Leunissen, J. L. M. (1992). Colloidal gold as a marker in
108
Christoph Kessler
molecular biology: The use of ultra-small gold probes. In "Nonradioactive Labeling and Detection of Biomolecules" (C. Kessler, ed.), pp. 116-126. Springer-Verlag, Berlin/Heidelberg. Van Prooijen-Knegt, A. C., Van Hoek, J. F., Bauman, J. G., Van Duijn, P., Wool, I. G., and Van der Ploeg, M. (1982). In situ hybridization of DNA sequences in human metaphase chromosomes visualized by an indirect fluorescent immunocytochemical procedure. Exp. Cell Res. 141, 397-407. Vary, C. P. H. (1987). A homogeneous nucleic acid hybridization assay based on strand displacement. Nucleic Acids Res. 15, 6883-6897. Vary, C. P. H., McMahon, F. J., Barbone, F. P., and Diamond, S. E. (1986). Nonisotopic detection methods for strand displacement assays of nucleic acids. Clin. Chem. 32, 1696-1701. Verdlov, E. D., Monastyrskaya, G. S., Guskova, L. I., Levitan, T. L., Sheichenko, V. I., and Budowsky, E. I. (1974). Modification of cytidine residues with a bisulfite-Omethylhydroxylamine mixture. Biochem. Biophys. Acta 340, 153-165. Viscidi, R. P., Connelly, C. J., and Yolken, R. H. (1986). Novel chemical method for the preparation of nucleic acids for nonisotopic hybridization. J. Clin. Microbiol. 23, 311-317. Viscidi, R. P., and Yolken, R. G. (1987). Molecular diagnosis of infectious diseases by nucleic acid hybridization. Mol. Cell. Probes 1, 3-14. Vogt, W. (1978). "Enzymimmunoassay." Georg Thieme Verlag, Stuttgart, Germany. Voyta, J. C., Edwards, B., and Bronstein, I. (1988). Ultrasensitive chemiluminescent detection of alkaline phosphatase activity. Clin. Chem. 34, 1157. Wachter, L., Jablonski, J.-A., and Ramachandran, K. L. (1986). A simple and efficient procedure for the synthesis of 5'-aminoalkyl oligodeoxynucleotides. Nucleic Acids Res. 14, 7985-7994. Wahl, G. M., Stem, M., and Stark, G. R. (1979). Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethyl-paper and rapid hybridization by using dextran sulfate. Proc. Natl. Acad. Sci. U.S.A. 76, 3683-3687. Wallenfels, K., Lehmann, J., and Malhotra, O. P. (1960). Utersuchungen fiber milchzuckerspaltende Enzyme--Die Spezifit~it der fl-Galactosidase von E. coli ML309. Biochem. Z. 333, 209-225. Ward, D. C., Leary, E. H., and Brigati, D. J. (1987). Visualization polymers and their application to diagnostic medicine. U.S. Patent 4687732. Ward, D. C., Waldrop, A. A., and Langer, P. R. (1982). Modified nucleotides and their use. Eur. Patent 0063879. West, S., Schr6der, J., and Kunz, W. (1990). A multiple-staining procedure for the detection of different DNA fragments on a single blot. Anal. Biochem. 190, 254-258. Wetmur, J. G., and Davidson, N. (1968). Kinetics of renaturation of DNA. J. Mol. Biol. 31, 349-370. White, B. A. (1993). "PCR Protocols." Humana Press, Totowa, New Jersey. Wilchek, M., and Bayer, E. (1984). The avidin-biotin complex in immunology. Immunol. Today 5, 39-43. Wilchek, M., and Bayer, E. A. (1988). The avidin-biotin complex in bioanalytical applications. Anal. Biochem. 171, 1-32. Wilson, M. B., and Nakane, P. K. (1978). Recent developments in the periodate method of conjugating horseradish peroxidase (HRPO) to antibodies. In "Immunofluorescence and Related Staining Techniques" (W. Knapp, K. Holubar, and G. Wick, eds.), pp. 215-224. Elsevier/North Holland Biomedical Press, New York. Woodhead, J. L., and Malcolm, A. D. B. (1984). Nonradioactive gene-specific probes. Biochem. Soc. Trans. 12, 279-280.
2. Methods for Nonradioactive Labeling of Nucleic Acids
109
Wu, D. Y., and Wallace, R. B. (1989). The ligation and amplification reaction (LAR)--amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4, 560-569. Yamakawa, K., Oymada, H., and Nakagomi, O. (1989). Identification of rotavirus by dotblot hybridization using an alkaline phosphatase conjugated synthetic oligonucleotide probe. Mol. Cell. Probes 3, 397-401. Yehle, C. O., Patterson, W. L., Boguslawski, S. J., Albarella, J. P., Yip, K. F., and Carrico, R. J. (1987). A solution hybridization assay for ribosomal RNA form bacteria using biotinylated DNA probes and enzyme-labeled antibody to DNA :RNA. Mol. Cell. Probes 1, 177-193. Yolken, R. H. (1988). Nucleic acids or immunoglobulins: Which are the molecular probes of the future? Mol. Cell. Probes 2, 87-96. Zwadyk, P., and Coodsey, R. C. (1987). Nucleic acid probes in clinical microbiology. CRC Crit. Rev. Clin. Lab. Sci. 25, 71-103.
3
Detection of Alkaline Phosphatase by TimeResolved Fluorescence Eva F. Gudgin Dickson Department of Chemistry and Chemical Engineering, Royal Military College of Canada, Kingston, Ontario, Canada K7K 5L0 Hector E. Wong Department of Chemistry, University of Toronto, Toronto, Ontario, Canada M5S 1A1 Alfred Pollak Allelix Biopharmaceuticals, Mississauga, Ontario, Canada L4V 1Pl
I. Introduction II. Materials A. Reagents B. Instrumentation III. Procedures A. Membrane-Based Assays 1. DNA Southern Blot Hybridization Assay 2. DNA Dot Blot Hybridization Assay Protocol 3. Detection Using Digoxigenin-LabeledProbes B. Microwell-Based Assays 1. DNA Microwell Hybridization Assay Protocol References
I. I N T R O D U C T I O N Replacement of radioactive labeling systems with alternative highly sensitive nonisotopic detection systems has become recognized as a priority if nucleic acid hybridization assays are to become a routine laboratory and diagnostic tool. Detection systems that combine the use of an enzyme label and a substrate that is converted to a light-emitting product have the highest potential sensitivities, where such a light-emitting product is typically either fluorescent, bioluminescent, or chemiluminescent (Barnard and Collins, 1987; Gosling, 1990; Jackson and Ekins, 1986; Tijssen, 1985). Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
113
II 4
Eva F. Gudgin Dickson et al.
Fluorescence-based detection systems in general must compensate for the problem of nonspecific background fluorescence, which is present in all biological samples and reduces the practical sensitivity of the system. This problem can be overcome with time-resolved fluorescence detection using lanthanide chelates as the light-emitting species (Diamandis, 1988; Soini, 1984). The lanthanide chelate consists of a lanthanide metal ion ( t y p i c a l l y T b 3+, Eu 3+, o r S m 3+), which is bound to an organic chelator. The chelator contains a number of nucleophilic groups that bind strongly to the lanthanide ion, resulting in complex formation. If, in addition, the chelator contains a UV-absorbing chromophore of the correct structure, optimized for efficient light absorption and subsequent energy transfer to the lanthanide ion, the chelate may be highly luminescent (Soini and Lovgren, 1987). Lanthanide ions themselves, in the absence of a suitable chelator, have only very weak absorption bands in the ultraviolet, and their emission is inefficient and highly quenched by the presence of water molecules in their coordinating sphere. The desirable features of lanthanide chelate compounds that permit efficient elimination of background signals have been extensively described (Diamandis and Christopoulos, 1990; Soini and Lovgren, 1987). Luminescent lanthanide chelates, particularly those involving terbium and europium possess a number of spectroscopic features making them ideal labels for biological assays. They have strong absorption bands in the UV region, characteristic of the organic chelator; subsequent to UV light absorption, the excitation energy can be efficiently transferred to the lanthanide ion. This process will be efficient only when the excited-state energy levels (most probably the first excited triplet level) of the chelator are properly matched to the excited-state levels of the lanthanide ion. The lanthanide ion may then emit the transferred excitation energy as characteristic lanthanide ion luminescence or fluorescence. T b 3+ and E u 3+ emission bands have narrow halfwidths (in the range of 1 to 20 nm) and are highly Stokes shifted, located in the green to red regions of the spectrum. This results in an absence of self-quenching, and easy discrimination between the specific lanthanide ion luminescence, which can be selected with the use of appropriate filters, and the excitation light and the normal nonspecific backgrounds, which have smaller Stokes shifts. In addition, owing to the nature of the electronic transitions involved, europium and terbium chelates have long lifetimes, typically on the order of 100/xsec to 2 msec, permitting the facile use of pulsed excitation time-resolved fluorescence (TRF) detection in order to eliminate both scattered light and normal short-lived fluorescence background emission. Finally, their luminescence yields and lifetimes are largely insensitive to minor variations in their environment, resulting in robust emission properties.
3. Detection of Alkaline Phosphatase by Time-Resolved Fluorescence
II 5
Two different types of time-resolved luminescence detection schemes, in which a lanthanide chelate is used directly as label, are currently available. In one type, a luminescent chelate can itself be used as a labeling agent, usually on a protein such as avidin or an antibody (Canfi et al., 1989; Evangelista et al., 1988). In the second type, the chelate used as the label is not itself luminescent, and the lanthanide ion must be released into a micellar enhancing solution, which contains a number of reagents necessary to observe the luminescence (Hemmila, 1988; Jackson and Ekins, 1986). These methods have some limitations for DNA hybridization applications, in particular with regard to their applicability to membranebased formats. Therefore, in order to achieve an alternative lanthanide-based detection system for this application, enzyme amplification, using alkaline phosphatase as label, has been combined with TRF detection of a lanthanide chelate reagent, giving the method termed enzyme amplified lanthanide luminescence (EALL) (Evangelista et al., 1991). In EALL, a substrate that is incapable of forming a luminescent lanthanide chelate is converted enzymatically into a product that does form such a chelate. In this way, the excellent background rejection allowed by the principle of TRF detection is combined with the signal amplification provided by the use of an enzyme as label. This is performed by designing an enzymatic reaction that modifies either, or preferably both, the spectroscopic properties and chelating abilities of the substrate by the enzymatic reaction. The alteration of these properties on transformation of substrate to product can result in any combination of the following changes: increase in excitation light absorption efficiency, increase in energy transfer efficiency, increase in formation constant of the chelate with the lanthanide ion, or reduction in quenching of the lanthanide ion luminescence by bound water molecules. The net effect of such changes is to ultimately promote formation of a luminescent chelate between the product molecule and the lanthanide ion. With an optimized design of substrate/product pairs, the method is applicable to a wide variety of assay formats, including standard heterogeneous DNA hybridization assays on nylon membranes or polystyrene microwells with the use of alkaline phosphatase (AP) labels either directly or indirectly conjugated to the probe. The same or slightly modified EALL substrates can also be used in microwell immunoassays or other heterogeneous biossays. In addition, they may have potential use in in situ hybridization and other applications that can use AP-labeled probes. Preliminary EALL substrates giving good detectability have also been developed for a variety of other oxidative and hydrolytic enzymes, including/3-galactosidase, xanthine oxidase, glucose oxidase and esterase, showing the versatil-
II 6
Eva F. GudginDicksonet al.
ity of the method for enzyme-based detection formats (Evangelista et al., 1991).
II. MATERIALS A. Reagents The chemical reaction for EALL-based detection of AP labels is illustrated in Fig. 1. The substrates consist of substituted salicyl phosphates; the AP label present on the probe promotes the dephosphorylation of the salicyl phosphate substrate. The product salicylic acid forms a luminescent ternary chelate with TB 3§ and ethylenediaminetetraacetic acid (EDTA) (Hemmila, 1985; Poluektov et al., 1973) at pH 12-13. The substituent has been tailored to provide maximal luminescence of the product chelate while giving the desired solubility of the product molecule on dephosphorylation. For solution-based assays, 5-fluorosalicyl phosphate (FSAP, REALL-S substrate, Kronem Systems Inc., Mississauga, Ontario, Canada) provides good solubility of the product and high luminescence yield of the product chelate. The values for K Mand Vmax for 5-fluorosalicyl phosphate have been determined as 1.2 x l0 -4 M and 0.19/xmol min-l U -l, respectively, in the standard substrate buffer used for DNA hybridization assays (0.1 M Tris, 0.1 M NaCl, l 0 -3 M MgCI2, pH 9.0) (Evangelista et al., 1991). Alternatively, for membrane-based assays such as dot blot or Southern blot assays, a branched alkyl substituted salicyl phosphate (REALL-M substrate, Kronem System Inc., Mississauga, Ontario, Canada) gives a less soluble product in order to provide good localization of signal in the vicinity of the label over a few hours of incubation with enzyme. The detectability of AP using FSAP in solution-based microwell assays with quantitative instrumentation has been found to be 1 amol for 1 to 2 hr incubation and 0.3 amol for overnight incubation with substrate (Evange-
X~
EDTA o-
~
. . . . . o.--:-
-7
ooo
Fig. I--EALL detection of alkaline phosphatase using substituted salicyl phosphate substrates. After dephosphorylation by alkaline phosphatase, the luminescent ternary complex is formed between the product salicylic acid, terbium ion, and EDTA. For membrane applications, the substituent is a branched alkyl group in the 5-position, while for solution applications, the substituent is 5-fluoro.
3. Detection of Alkaline Phosphatase by Time-Resolved Fluorescence
II 7
lista et al., 1991). Substrates with different substituents are under development in order to improve both the detectability and diffusive properties of solution- and membrane-based substrates. In addition, substrates that can be detected with E U 3+ giving a maximum emission band in the red at 615 nm are under development for two-color applications. The substituted salicyl phosphate substrate (XSAP) molecules absorb light only below 300 nm, and do not form luminescent Tb'EDTA complexes under the conditions of the measurement. The product of the enzymatic reaction, XSA, in the presence of Tb:EDTA forms a complex whose excitation maximum is in the vicinity of 320 to 330 nm (Hemmila, 1985, Evangelista et al., 1991). The emission is characteristic of Tb 3§ luminescence, namely a number of narrow bands in the visible (green to red regions), with a main band at 547 nm whose half-bandwidth is approximately 10 nm: the emission lifetime is approximately 1 msec (Evangelista et al., 1991). The optimum conditions for the enzymatic reaction are as follows: 10-3 M substrate at pH 9, in 0.1 M Tris or other amine-containing buffer, 1 m M Mg 2+ . A lower pH can cause spontaneous hydrolysis of the substrate (Bromilow and Kirby, 1972) over prolonged periods, resulting in elevated backgrounds. The enzymatic reaction is typically performed for 2 to 4 hr. Solution-based assays can be left longer; however, membrane-based assays if left for > 4 hr may show loss of resolution of bands or spots due to excessive diffusion of the product of the enzymatic reaction during the incubation with enzyme. The luminescence signal development is performed by adding an equal or slight excess volume of developing solution (Kronem Systems Inc., Mississauga Ontario, Canada; 5X REALL Developing Reagent, 5X REALL Developing Buffer, deionized distilled water 1:1:3 v/v). The luminescence of the product complex is reasonably stable and can be repeatedly measured up to 2 hr after signal development. Always ensure that sufficient developing solution is prepared to develop the entire membrane or microwell assay at once; different preparations may not perform identically.
B. Instrumentation The recommended detection instrumentation for use with EALL is TRF based. The principle of TRF detection and instrumentation is illustrated in Fig. 2. Typical TRF instrumentation used pulsed UV excitation (either from a laser or flashlamp source), visible wavelength emission filters (chosen to transmit selectively the luminescence of the lanthanide ion used as opposed to the background fluorescence and scattered light signals),
I! 8
Eva F. Gudgin Dicksonet al.
Fig. 2re(a) General representation of time-resolved fluorescence instrumentation used for measurement of lanthanide chelate luminescence. Pulsed ultraviolet light excites the sample; emission from the sample is filtered and time-gated to select for lanthanide luminescence, and then detected electronically or photographically. (b) Principle of time-gated detection of lanthanide luminescence. Gating can be accomplished by electronic or mechanical means.
and time-gated detection (which measures only that signal emitted in a window starting several hundred microseconds after the excitation pulse). For use in a wide variety of hybridization assay formats, both membrane and microwell based, the TRP100 time-resolved photographic camera system (Kronem Systems Inc., Mississauga, Ontario, Canada) has been developed, as outlined in Fig. 3. The camera is designed to provide rapid photographic results on high-speed instant film (Polaroid ISO 3000 or 20,000). The pulsed UV source consists of two xenon flashlamps (pulsewidth < 50/~sec). Selection of desired excitation and emission wavelengths is provided by the use of different filter pairs. The filters provided with the instrument give excitation over the range of 320 to 400 nm, and emission detection at wavelengths > 515 nm, suitable for E A L L detection of alkaline phosphatase using R E A L L reagents. Uniform sample illumination results from the use of a reflective tunnel between the lamps and the sample. Time-gating of both the excitation pulse and the emission is provided by the use of a rotating chopper wheel; additional
3. Detectionof Alkaline Phosphataseby Time-ResolvedFluorescence
II 9
Fig. 3mSchematic of TRP100 time-resolved photographic instrument. (1) Polaroid filmback; (2) shutter; (3) camera; (4) flashlamps; (5) rotating chopper wheel; (6,7) excitation filters; (8) emmission filter; (9) filter plate; (10) mirror tunnel; (11) focal plane; (12) sample, e.g., membrane or microplate; (13) sample tray; (14) focusing adjustment. time-gating of the excitation lamps is needed owing to the presence of a long-lived thermal emission in the visible, which could contribute to background signals by reflection off the sample. The lamps are triggered by the rotation of the chopper wheel, and both the delay between excitation and emission, and the emission time window are determined by the selected rotation speed of the chopper, as given in Table I. The time-gated luminescence signal is then repeatedly recorded on the film each time the chopper rotates through one cycle until sufficient signal has been reached. Typical exposure times are in the range of l0 sec to 3 min, allowing for easy reexposure to permit optimization of signal levels on the film. The height is adjusted as necessary so that the top of the sample is located in the focal plane of the instrument. The unit is designed for use with either
120
Eva F. GudginDicksonet al.
Table !
Exposure DelayTime and ExposureWindowSettingson TRP100 Instrument Chopper speed setting
Speed of rotation
Slow Fast
6000 rpm 9000 rpm
Excitation rate 300 Hz 450 Hz
Exposure delay time
Exposure window
440/zsec 290/xsec
4.1 msec 2.8 msec
microplate or membrane formats, with sample sizes of up to 18 x 13 cm 2 accommodated. For microplate solution-based formats, quantitative results can be obtained using either of two commercial TRF microplate readers available (both originally designed for use with direct lanthanide labeling systems in immunoassay applications (Diamandis et al., 1989; Soini and Kojola, 1983), namely the CyberFluor 615 Immunoanalyzer (CyberFluor Inc., Toronto, Canada) and the Arcus (Delfia) 1234 Plate Reader (Pharmacia LKB, Uppsala, Sweden). The CF615 unit is designed for measurement of Eu 3+ luminescence in opaque white polystyrene microwells, exciting from above and reading signal from the surface of the microwell or solution contained therein. It provides no wavelength choice or adjustable time gate, having a nitrogen laser for excitation at 337 nm, and emission detection at 615 _+ 5 nm, with a time gate of approximately 200-600/zsec, pulse repetition rate of 20 Hz, and data collection time/well of 1 sec. Note that terbium emission in the E A L L system is equally well quantitated using these conditions, as Tb 3+ has a minor emission band in the region of 615 nm, in addition to its main emission at 545 nm. The Arcus unit is designed for use with transparent polystyrene microwells, and measures emission in a straight through geometry with excitation filters and three emission filters; the filter combination that provides excitation at >320 nm (excitation filter # l) and emission detection at 615 nm (emission filter # l) gives the best signal to background discrimination and dynamic range. The best choice of time window is approximately 200-400/zsec with a data collection time well of about 1 sec. The two instruments have comparable detection sensitivities with the E A L L detection system using these parameters. The use of quantitative instrumentation improves the detectability of AP by about three to five times over that obtained with the TRP100. A variety of other normal fluorescence instrumentation can be used also without time-resolved detection, by utilizing narrow-band emission detection, which can eliminate a large fraction of the potentially interfering emissions. For example, for photography of membrane-based assays, the Spectroline UV CC-80 lightbox system (Spectronics, Westbury, New
3. Detection of Alkaline Phosphatase by Time-Resolved Fluorescence
121
York) equipped with 312 nm (UV-B) lamps, and Fotodyne UV 300-nm transilluminator (Fotodyne Inc., New Berlin, Wisconsin) have been used, with a Polaroid camera equipped with a 515-nm cutoff or 545-nm (bandpass 10 nm) interference filter. The sensitivity of the normal instrumentation compared to TRF instrumentation is similar in the best case; however, artifacts resulting from green-emitting backgrounds may appear. Extreme care in the handling of the membranes during the assay may reduce the likelihood of such artifacts.
III. PROCEDURES The progress of the enzymatic dephosphorylation reaction can be followed in all cases by viewing the sample in subdued lighting with a hand-held 300 to 320-nm or UV-B lamp; a 300-nm transilluminator may be used also for membranes. Blue fluorescence from the dephosphorylated product will be visible. Samples may be degraded by excessive exposure to UV light, so viewing should be kept brief. Recommended solid supports for use with photography are Nytran nylon membrane (0.45/xm, Schleicher and Schuell, Keene, New Hampshire) or Microlite 1 Removawell opaque white strips (Dynatech, Chantilly, Virgina). Other supports may give less satisfactory results. Alternatively, with TRF plate readers, use microwell strips or plates as recommended by the manufacturer of the instrumentation. Solution formulations are given at the end of this section.
A. Membrane-Based Assays Southern and dot blotting should be performed following standard protocols (Maniatis et al., 1982) for nylon membranes, with appropriate modifications for the use of alkaline phosphatase-labeled probes. The quantities of solutions given in the following protocols are for 100 cm 2 of membrane, and volumes should be scaled accordingly for different membrane areas. Protocols are given for biotinylated, long DNA probes, detected with alkaline phosphatase-labeled streptavidin, or digoxigenin-labeled probes detected with AP-labeled antidigoxigenin, and can be modified for oligonucleotide probes or direct or other indirect labeling systems and conjugates. For photography using the TRP100 camera, membrane formats of a size up to 9 x 13 cm 2are recommended, as they are most conveniently handled and photographed; samples of up to 18 • 13 cm 2 can be photographed in two exposures.
122
Eva F. GudginDicksonet al.
1. DNA Southern Blot Hybridization Assay The protocol for agarose gel electrophoresis and Southern transfer generally follows standard techniques. The loading buffer described below is recommended; the tracking dye should not be run in lanes containing the samples of interest, as the dye may interfere with uniform illumination of the samples during the final photography.
Solution Formulations
Loading buffer Denaturation solution Neutralization solution Transfer buffer 6 x SSC DNA dilution buffer
20 • SSC Prehybridization buffer
Hybridization solution Membrane wash solution 1 Membrane wash solution 2 Membrane wash solution 3 TBS-T20 Blocking solution Alkaline phosphatase-labeled streptavidin solution
Substrate buffer Substrate stock solution
15% Ficoll type 400 in deionized water 1.5 M NaCI, 0.5 M NaOH 1.0 M Tris pH 8.0, 1.5 M NaCI 10 • SSC (0.15 M sodium citrate, 1.5 M NaCI, pH 7.0) 0.09 M sodium citrate, 0.9 M NaCI, pH 7.0 Phosphate buffered saline (1.5 mM NaH2PO4, 8.0 mM K2HPO 4, 137 mM NaCI, 2.5 mM KCI, pH 7.2)containing 2 /zg/ml sheared salmon sperm DNA 0.3 M sodium citrate, 3.0 M NaCI, pH 7.0 6• SSC, 50% formamide, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.5% powdered skim milk, 0.2 mg/ml freshly denatured sheared salmon sperm DNA, 5% polyethyleneglycol 50-200 ng/ml of labeled DNA probe in prehybridization buffer 5 • SSC, 0.5% SDS 0.1• SSC, I%SDS 2 • SSC 0.1 M Tris pH 7.5, 0.15 M NaCI, 0.05% Tween 20 1% BSA in TBS-T20 Working dilution of conjugate in TBST20, for example, 1:6000 dilution of ExtrAvidin streptavidin-alkaline phosphatase conjugate (Sigma), approx. 500 mU/ml 0.1 M Tris pH 9.0, 0.1 M NaC1, 1 mM MgC12 10- 2 M REALL-M in 0.1 M NaOH
3. Detectionof AlkalinePhosphataseby Time-ResolvedFluorescence Substrate solution Developing solution
123
10 x dilution of substrate stock solution in substrate buffer 1 x REALL Developing Reagent, 1 x REALL Developing Buffer in distilled, deionized water
1. The transfer of the DNA from the agarose gel to nylon membrane is performed as follows. Denature the DNA by gently shaking the gel in denaturation solution (2-3 gel volumes) for 30 min at room temperature; repeat this once. Neutralize the gel by gentle shaking in neutralization solution (2-3 gel volumes) for 30 min at room temperature. Check the pH of the gel with pH paper and repeat neutralization step if necessary. Perform the Southern transfer to nylon membrane cut to precisely the size of the gel and prewetted in transfer buffer. Perform the transfer in transfer buffer for 18 hr. Wash the membrane in 6X SSC for 5 min at room temperature, and allow it to dry for 30 min on a sheet of clean blotting paper. Irradiate the membrane with 254 nm UV light for 3 min, or alternately place in a vacuum oven at 80~ for 1 to 2 hr. The membrane can be stored dry at this point. 2. Prehybridize the membrane in a sealed plastic bag for 1 to 2 hr at 42~ in 10 ml prehybridization buffer. Remove the prehybridization buffer and add 5 ml hybridization solution containing 50-200 ng/ml biotinylated long probe. Seal the membrane in a plastic bag and hybridize at 42~ overnight with shaking. Wash the membrane twice in 100 ml membrane wash solution 1 for 5 rain at 65~ once in 100 ml membrane wash solution 2 for 30 min at 65~ (this wash solution temperature can be adjusted for desired level of stringency), and once in 100 ml in membrane wash solution 3 for 5 rain at room temperature. 3. Soak the membrane for 5 min in 100 ml TBS-T20 and then block with 100 ml of blocking solution at 65~ for 1 hr. Incubate the membrane with 50 ml of the alkaline phosphatase-labeled streptavidin solution for l0 min. Remove nonspecifically bound alkaline phosphatase conjugate, by washing twice with 100 ml of TBST20 for 15 min and once with 100 ml substrate buffer for 1 hr. 4. Before adding the substrate solution, lay the membrane (DNA side up) on heavy blotting paper until the membrane is uniformly damp but not wet, to remove excess liquid. Place the membrane inside a development bag (consisting of a 0.4-mm thick transparent polyethylene plastic bag that has been cut open on three sides) leaving a gap of about 1 cm around the edge of the membrane on all four sides. With the top of the bag pulled away, add 1.0 ml of
124
Eva F. GudginDicksonet al.
REALL-M substrate solution in drops over the surface of the membrane. Close the top of the bag gently over the surface of the membrane in order to exclude air bubbles and spread the solution. Using a 10 ml disposable pipet, roll over the top of the bag gently in several directions to ensure even distribution of the substrate. Incubate for 1 to 4 hr in subdued lighting (longer incubations will reduce sharpness of bands without substantially increasing sensitivity). Do not handle the bag during the incubation period, and at no time handle the membrane other than as described below, in order to prevent smearing of the signal. 5. After the desired incubation time has elapsed, turn the development bag containing the membrane face down and gently open the back side of the bag to one side. Cut a piece of heavy blotting paper to a size larger than the membrane and apply it to the back side of the membrane. Remove excess substrate solution and then remove the blotting paper. Add 1.5 ml of developing solution in drops to the back of the membrane around all four sides. Close the bag and gently roll with a pipet. After a few seconds, blot the excess solution from behind the membrane as described above. At this point, seal the bag to prevent leakage of luminescent solution and degradation of the luminescent signal. The membrane is now ready for photography. Photograph the membrane within 2 hr of development. To photograph the membrane in the TRP100, place the membrane in the plastic bag in the sample tray of the TRP100 and clamp in place, and then adjust height of the sample tray as needed to obtain correct focus. Select the correct operating parameters for the TRP100 for use with REALL reagents. Photograph the sample for an exposure time in the range of about 30 sec to 3 min. Typical results of a Southern blotting analysis are presented in Fig. 4.
2. DNA Dot Blot Hybridization Assay Protocol A dot blot DNA hybridization assay can be performed on nylon membranes in a manner similar to that described for Southern blotting above, omitting the Southern transfer procedure. All solution volumes should be scaled as described previously, except for sample DNA. Typical results of a dot blot analysis are presented in Fig. 5.
1. Prepare dilutions of sample DNA in DNA dilution buffer. Denature the sample at 100~ for 10 min and place on ice. Spot samples
126
Eva F. GudginDicksonet al.
1-2. These are identical to steps 1 and 2 of the DNA Dot Blot Hybridization assay except that the hybridization solution contains 50-200 ng/ml denatured digoxigenin-labeled probe prepared by random primed incorporation of digoxigenin-labeled deoxyuridine triphosphate. Wash the membrane twice in 100 ml 2X SSC, 0.1% SDS for 5 min at room temperature, then twice in 100 ml 0.1X SSC, 0.1% SDS for 15 min at 65 to 68~ (this wash solution temperature can be adjusted for desired level of stringency). Soak the membrane for 5 min in 100 ml TBS and then block with 100 ml blocking solution (0.5% blocking reagent, a purified subfraction of dry milk, included in the Genius kit) for 30 min. After blocking, incubate in a 1:5000 dilution of antidigoxigenin Fab fragments conjugated to alkaline phosphatase for 30 min. Remove unbound antibody conjugate by washing the membrane twice for 15 min with 100 ml TBS. Afterwards, incubate the membrane with substrate buffer.
B. Microwell-Based Assays 1. DNA Microwell Hybridization Assay Protocol A number of DNA hybridization assays for use with polystyrene microwells have been reported (Dahlen, 1987; Morrissey and Collins, 1989; Nagata et al., 1985; Dahlen et al., 1987). One recommended protocol for use with REALL detection reagents, which uses biotinylated long probes and alkaline phosphatase-labeled avidin, is given below.
Solution Formulations
Phosphate-buffered saline DNA dilution buffer 2 • immobilization buffer Well wash solution 1 Well wash solution 2 TBS Blocking solution
1.5 mM NaH2PO 4, 8.0 mM K2HPO 4, 137 mM NaCI, 2.5 mM KC1, pH 7.2 phosphate buffered saline containing 2/zg/ml sheared salmon sperm DNA 0.2 M MgCI2 in phosphate buffered saline 2 x SSC, 0.1% SDS 0.1 • SSC, 0.1% SDS 0.1 M Tris pH 7.5, 0.15 M NaC1 0.5% skim milk powder in TBS
3. Detection of Alkaline Phosphatase by Time-Resolved Fluorescence
Alkaline phosphatase-labeled avidin solution
127
working dilution of conjugate in TBS, for example, 1:5000 dilution of avidinalkaline phosphatase (Sigma)
1. Denature the sample containing the target DNA sequence in a volume of 25/zl DNA dilution buffer at 100~ for 10 min and place on ice. Add this volume to the polystyrene microwell followed by an equal volume of 2 x immobilization buffer. Thoroughly agitate the samples, seal, and leave to immobilize overnight at room temperature. Aspirate the wells, allow to dry and irradiate using a 254-nm lamp for 6 min at 1.6 kJ/m 2 to bind the DNA. Samples can be stored dry at this point. 2. Prehybridize the wells for 1 hr at 42~ in 200/xl prehybridization buffer and then aspirate. For hybridization add 100/A hybridization solution containing 50-200 ng/ml freshly denatured biotinylated probe, seal the wells, and shake overnight at 42~ Wash the wells twice with 200/zl well wash solution 1 for 5 min at room temperature, and twice with 200/zl well wash solution 2 for 20 min at 42~ to remove nonspecifically bound probe. 3. Add 200/xl of TBS to the wells for 5 min at room temperature. Block the wells with 200/A/well blocking solution for 30 min at room temperature. Wash the wells once with 200/zl of TBS for 5 min and then incubate with 100/zl alkaline phosphatase-labeled avidin solution for 30 min. Remove nonspecifically bound avidinAP by washing 3 times with 200 ~1 TBS solution for 10 min at room temperature with thorough agitation, or 6 times using an automatic plate washer. 4-5. Wash the wells with 200/xl substrate buffer for 30 min at room temperature. Detect the bound alkaline phosphatase by adding 150/xl REALL-S substrate solution. Incubate for the desired length of time (30 min to overnight) and terminate the reaction by adding 150/.d of developing solution followed by gentle agitation. The wells are then ready for photography. To photograph in the TRP100, place the holder containing the samples in the sample compartment, and adjust the height of the sample tray as needed to obtain correct focus. Select the correct instrument parameters for use with REALL reagents. Photograph the sample for an exposure time in the range of about 5 to 30 sec. For quantitative results, wells can be read on TRF plate readers. Typical results of an assay are illustrated in Fig. 6.
128
Eva F. Gudgin Dickson et al. 1000000
"0
=
:3 0L_ 0
m
.D
100000
10000
m c :3 0
1000
o
100
9
"
. . . . . .
I
10
. . . . . . . .
I
"
"
100
"
. . . .
"1
1000
"
"
"
. . . .
|
10000
pg pBR322 Fig. 6mMicrowell dot blot assay for Hind III-digested pBR322 DNA. REALL-S substrate was incubated overnight, and results were read on CF615 plate reader.
REFERENCES Barnard, G. J. R., and Collins, W. P. (1987). The development of luminescence immunoassays. Med. Lab. Sci. 44, 249-266. Bromilow, R. H., and Kirby, A. J. (1972). Intramolecular general acid catalysis of phosphate monoester hydrolysis. The hydrolysis of salicyl phosphate. J. Chem. Soc. Perkin H 149-155. Canfi, A., Bailey, M. P., and Rocks, B. F. (1989). Multiple labeling of immunoglobulin G, albumin, and testosterone with a fluorescent terbium chelate for fluorescence immunoassays. Analyst 114, 1407-1411. Dahlen, P. (1987). Detection of biotinylated DNA probes by using Eu-labeled streptavidin and time-resolved fluorometry. Anal. Biochem. 164, 78-83. Dahlen, P., Syvanen, A. C., Hurskainen, P., Kwiatkowski, M., Sund, C., Ylikoski, J., Soderlund, H., and Lovgren, T. (1987). Sensitive detection of genes by sandwich hybridization and time-resolved fluorometry. Mol. Cell. Probes 1, 159-168. Diamandis, E. P. (1988). Immunoassays with time-resolved fluorescence spectroscopy: Principles and applications. Clin. Biochem. 21, 139-150. Diamandis, E., and Christopoulos, T. K. (1990). Europium chelate labels in time-resolved fluorescence immunoassays and DNA hybridization assays. Anal. Chem. 62, l149A1157A. Diamandis, E. P., Evangelista, R. A., Pollak, A., Templeton, E. F., and Lowden, J. A. (1989). Time-resolved fluoroimmunoassays with europium chelates as labels. Am. Clin. Lab. Feb., 26-28. Evangelista, R. A., Pollak, A., Allore, B., Templeton, E. F., Morton, R. C., and Diamandis, E. P. (1988). A new europium chelate for protein labeling and time-resolved fluorometric applications. Clin Biochem. 21, 173-178. Evangelista, R. A., Pollak, A., and Templeton, E. F. (1991). Anal. Biochem. 197, 213-224.
3. Detection of Alkaline Phosphatase by Time-Resolved Fluorescence
129
Gosling, J. P. (1990). A decade of development in immunoassay methodology. Clin. Chem. 36, 1408-1427. Hemmila, I. (1985). Time-resolved fluorometric determination of terbium in aqueous solution. Anal. Chem. 57, 1676-1681. Hemmila, I. (1988). Lanthanides as probes for time-resolved fluorometric immunoassays. Scand. J. Clin. Lab. Invest. 48, 389-400. Jackson, T. M., and Ekins, R. P. (1986). Theoretical limitations on immunoassay sensitivity. Current practice and potential advantages of fluorescent Eu 3+ chelates as nonradioisotopic tracers. J. Immunol. Methods 87, 13-20. Maniatis, T., Fritsch, E. F., and Sambrook, J., (1982). "Molecular Cloning. A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Morrissey, D. V., and Collins, M. L. (1989). Nucleic acid hybridization assays employing dA-tailed capture probes. Single capture methods. Mol. Cell. Probes 3, 189-207. Nagata, Y., Yokota, H., Kosuda, O., Yokoo, K., Takemura, K., and Kikuchi, T. (1985). Quantification of picogram levels of specific DNA immobilized in microtiter wells. FEBS Lett. 183, 379-382. Poluektov, N. S., Alakaeva, L. A., and Tishchenko, M. A. (1973). Fluorometric determination of terbium as its complex with salicylic acid and ethylenediaminetetraacetic acid. Zh. Anal. Khim. 28, 1621-1623. Soini, E. (1984). Pulsed light, time-resolved fluorometric immunoassay. In "Monoclonal Antibodies and New Trends in Immunoassays" (C. A. Bizollon, ed.) pp. 197-208. Elsevier Science Publishers, New York. Soini, E., and Kojola, H. (1983). Time-resolved fluorometer for lanthanide chelates--a new generation of nonisotopic immunoassays. Clin. Chem. 29, 65-68. Soini, E., and Lovgren, T. (1987). Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit. Reo. Anal. Chem. 18, 105-154. Tijssen, P. (1985). "Practice and Theory of Enzyme Immunoassays. Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 15." Elsevier, New York.
Detection of Alkaline Phosphatase by Bioluminescence Reinhard Erich Geiger BioAss D-86911 Giessen, Germany
Werner Miska University of Giessen D-6300 Giessen, Germany I. Introduction II. Materials A. Reagents B. Instrumentation III. Procedures A. D o t - S l o t B l o t s - - P r o t e i n Blots 1. Bioluminescence-Enhanced Detection of Immunoblotted Proteins Using a Photographic Film 2. Bioluminescence-Enhanced Detection of Proteins Using a Photon-Counting Camera System (Argus-100) B. D o t - S l o t B l o t s - - N u c l e i c Acid Hybridization 1. Bioluminescence-Enhanced Detection System for DNA Hybridization 2. Bioluminescence-Enhanced Detection of Nucleic Acid Hybridization Using a Photographic Film 3. Bioluminescence-Enhanced Detection of Nucleic Acid Hybridization Using a Photon-Counting Camera System
IV. Conclusions References
I. INTRODUCTION Bioluminescence is a natural phenomenon found in many lower forms of life (DeLuca, 1978; DeLuca and McElroy, 1986; Herring, 1987). Naturally occurring bioluminescent systems differ with regard to the structure and function of enzymes and cofactors as well as in the mechanism of the light-emitting reactions (Burr, 1985; SchOlmerich et al., 1987). Because of its high sensitivity, firefly (Photinus pyralis) bioluminescence had been used for many years for the sensitive determination of adenosine triphosphate (ATP) (Lundin et al., 1976). More recently, further highly sensitive bioluminescent and chemiluminescent methods have become available for Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
131
132
Reinhard ErichGeigerand WernerMiska
many different analytes (Kricka et al., 1984; Wood, 1984; Gould and Subramani, 1988; Kricka, 1988). A new type of highly sensitive enzyme substrate based on luciferin derivatives (Miska and Geiger, 1987) can be used for unmodified enzymes and for enzyme conjugates, applied in enzymatic activity test systems, reporter gene tests, enzyme immunoassays, protein blot analysis, and nucleic acid hybridization tests (Miska and Geiger, 1988; Berger et al., 1988; Geiger, 1990; Hauber et al., 1988a, Hauber et al., 1988b, Hauber et al., 1989a). The test principle of these new substrates is the release of o-luciferin from D-luciferin derivatives by the action of hydrolytic enzymes (Fig. 1). Released o-luciferin can be quantified by a luminometric detection system (Fig. 2). The substrate, o-luciferin-O-phosphate, is not a substrate for the firefly luciferin reaction, and no light emission is observed for concentrations up to 1 mM. The high sensitivity of these bioluminogenic substrates is owing to the combination of the amplification that occurs in the releasing step (e.g., one molecule of alkaline phosphatase can convert 1000 molecules of o-luciferin-O-phosphate to D-luciferin per second) and the very sensitive firefly bioluminescence system (concentrations of 5 • 10-~2 M of o-luciferin can be detected) (Fig. 3) (Miska and Geiger, 1987). Structures and kinetic data of some further luciferin derivatives are summarized in Fig. 4 and Table I.
II. MATERIALS A. Reagents Synthetic D-luciferin (Photinus pyralis) and D-luciferin-O-phosphate and other o-luciferin derivatives can be purchased from Medor GmbH. W-
o
@
~,T.., N~N.~ C-OR Ho~S" "S"
Ho~S"
0
~N~
| Ro~S"
,,,,
-
o c -o.
"S ~
§
0
9N"~I~-OH J +
"S"
Fig. l--Scheme and principle of the test systems. E, enzymes; R, residues (e.g., carboxypeptidase, phosphatases, and others).
4. Detection of Alkaline Phosphatase by Bioluminescence
1) D - Luciferin - 0 -
2) Luciferin
133
alk. phosphatase
phosphate
Luciferin
Luci ferase t j ' M2+" q
+ 02 + ATP
+ P
= Oxyluciferin
+ h.v + A~ + PP
Fig. 2mScheme of bioluminescence reaction using firefly (Photinus pyralis) luciferase.
8036 Herrsching, Germany or Novabiochem AG, CH-4448 Lfiufelfingen, Switzerland. Nitrocellulose filters (BA 85, 0-45 /zm) are products of Schleicher and Schiill (Dassel, Germany). Nitrocellulose purchased from different distributors may contain substances that interfere with firefly luciferase. A reduction in luciferase activity was obtained by adding buffer to the test system in which nitrocellulose was soaked or stored for a short time. The luciferase may be inhibited or may be denaturated by compounds existing in the nitrocellulose sheets, and washing in high-quality water is recommended. In earlier stages of synthesis of D-luciferin-O-phosphate, very small amounts of free D-luciferin could be detected in the preparations by the very sensitive bioluminescence reaction after purification of D-luciferinO-phosphate. These traces of D-luciferin sometimes influence the blank
o -6 ~. 10
E
~-~104
~62 ej
10 I
I
I
10-12
10-11
10-10
I
10-9
I
10-8 (mol/I) luciferin
Fig. 3--Determination of D-luciferin in the luminometric assay. Test conditions (Biolumat, Fa. Berthold Typ 9500 T, Wildbad, FRG; 25~ volume. 0.5 ml, Lundin et al.,1976): 0.4 ml test buffer (30 mM HEPES, 6.6 mM MgC12, 0.66 mM EDTA, 0.1 mM DTT, 5 mM ATP, 1/xg luciferase, pH 7.75) were preincubated at 25~ for 5 min. Then 0.1 ml luciferin solution (standard or incubation mixtures of the enzymatic tests, was added and light impulses measured for 10 sec (peak mode) (Miska and Geiger, 1987).
134
Reinhard Erich Geiger and Werner Miska
A o
o
,,
,i
0 .~
I~~
''Ix ~N--yC-OH
HO-g-O
sP":sJ
It
Nq /N'YC- OCH3
o
C
D
,o, ,HU
0
N~ /N---r,-C-N-C-COOH
0 N HO-I~-O~S 6H
HO
F
0 HITI
-t-C-COOH
o ,i
!
~------~N, 9N'-FC-OH
(C,H2)3
NH I~=NH NH2
Gol- 0 ~A~-----~SY<S3
!
Fig. 4---Structures, molecular weights, and molar absorbtion coefficients of some properties of a-luciferin derivatives. (A) o-Luciferin-O-suiphate [Mr, 360.39; E290, 5690 (1/mol x cm) in water]; (B) o-luciferin methyl ester [Mr, 294.35; E335, 8520 (l/tool x cm)]; (C) o-luciferinO-phosphate [Mr, 359.39; E3j5, 8360 (l/tool x cm) in water]; (D) D-luciferyl-L-phenylalanine [Mr, 402.49; E335, 5770 (l/tool • cm)in waterl; (E) D-luciferin-O-/3-galactoside [Mr, 442.46; E260, 5520 (l/mol x cm) in 0.05 M Tris/HCl, pH 7.5]; (F) a-luciferyl-L-Na-arginine [Mr, 436.52; E335, 5710 (l/tool x cm) in water].
Table ! Kinetic Data for the Hydrolysis of ~-Luciferin Derivatives by Carboxypeptidase N, fl-Galactosidase and Alkaline Phosphatase
[mol/l]
[l/s]
kcat/Km x mmol-1 x s-']
D-luciferin-O-/3-galactoside 2.9 • 10 -6 D-luciferin-O-phosphate 4.3 x 10 -5 D-Luciferyl-N-arginine 0.5 x 10 -4
256 1010 11.8
90.000 23.500 236
kca t
Enzymes /3-Galactosidase Alkaline phosphatase Carboxypeptidase
Substrates
Km
[1
4. Detection of Alkaline Phosphatase by Bioluminescence
135
values. By improving the purification methods, D-luciferin-O-phosphate is now available in a highly purified grade (Miska and Geiger, 1987). After dissolving D-luciferin-O-phosphate in water or 0.05 M ammonium acetate, pH 6.5, aliquots are stored at - 80~ or - 30~ until use. For each experiment, a fresh aliquot is used.
B. Instrumentation Bioluminescence-enhanced detection systems require convenient and reliable light-measuring instruments (luminometers); a wide-range of lumenometers suitable for measuring light emission from tubes or microtite plates are now available. Recently, Hamamatsu Photonics Deutschland GmbH (W-8036 Herrsching, Germany) has produced a very convenient microtiter plate reader for bioluminescent measurements with a parallel measuring mode for rapid and precise measurements. For electronic measurement of emitted photons produced on nitrocellulose sheets a photon-counting camera system (e.g., Argus-100, Hamamatsu Photonics) is recommended. This innovative and precise technique can detect photons within a very short time at an extreme sensitivity (1 photon • cm 3 • sec-1). Photographic film (e.g., Tri-X pan, 380 ASA or Polaroid films for light detection were purchased from Kodak AG and Polaroid GmbH and developed using procedures given by the manufacturers.
III. PROCEDURES A. D o t - S l o t Blots---Protein Blots Our new bioluminescent method was developed first with protein blots; the procedures are described here for completeness. Protein blot analyses are now extensively used for research and for diagnosis of e.g., infectious diseases (Gershoni, 1985). The first practical methods for transfer of proteins from gel electropherograms to cellulose or nitrocellulose were published in 1979 (Towbin et al., 1979; Renart et al., 1979) and since that time there has been an explosive increase in applications of these techniques (Towbin and Gordon, 1984). The principle of two new, ultrasensitive bioluminescence-enhanced detection systems for protein blotting based on firefly D-luciferin-Ophosphate and an alkaline phosphatase label is shown in Fig. 5.
136
Reinhard Erich Geiger and Werner Miska
Fig. 5mScheme of the bioluminescent-enhanced detection system of protein blotting using (a) photographic films or (b) a photon-counting camera system.>--AP, antibody alkaline phosphatase conjugate; Lu-X, o-luciferin-O-phosphate; Lu, o-luciferin; P, oxyluciferin.
iml
1. Bioluminescence-Enhanced Detection of Immunobiotted Proteins Using a Photographic Film 1. Transfer protein to nitrocellulose soaked with phosphate buffer (6.5 mM NaEHPO4, 1.5 mM KHEPO4, 137 mMNaCl, 2.7 mM KCI, pH 8.0) (Bjerrum and Schafer-Nielsen, 1986; Lin and Kasamatsu, 1983). 2. Block the nitrocellulose with 5% (w/v) bovine serum albumin in phosphate buffer for 2 hr at 25~ Incubate the filter in antirabbit IgG alkaline phosphatase conjugate (1:500 dilution) for 5 min at 25~ and then wash it three times in the phosphate buffer. Transfer the membrane to a transparent plastic dish containing approximately 6 ml of the detection solution (40 mM HEPES buffer, 1.6 mM diethanolamine, 6 mM MgCI2, 0.54 mM ethylenediaminetetraacetic acid (EDTA), 3.4 mM DTT, 2.6 mM ATP, 2 mM luciferin-O-phosphate, 0.15 mg luciferase, pH 8.0). 3. Place the dish on a photographic film (in the dark) and expose it for 2 hr. After development (5 min at 25~ in a solution of Kodak HC-110) and fixation of the film, protein-bound antibody can be visualized as dark spots (Fig. 6).
4. Detection of Alkaline Phosphatase by Bioluminescence
137
Fig. 6--Photographic detection of a protein blot on nitrocellulose filter (Hauber and Geiger, 1987). (a) 5 ng; (b) 500 pg; (c) 50 pg; (d) 5 pg rabbit immunoglobulin G.
2. Bioluminescence-Enhanced Detection of Proteins Using a Photon-Counting Camera System (Argus-100) 1. Transfer protein to nitrocellulose as described in the previous section. 2. Block the nitrocellulose with 5% (w/v) bovine serum albumin in phosphate buffer for 2 hr at 25~ Incubate the filter for 5 min at 25~ in phosphate buffer containing antirabbit IgG alkaline phosphate conjugate (1:1000 dilution of conjugate in phosphate buffer), wash it three times with phosphate buffer without conjugate. Dip it into detection solution (40 mM HEPES buffer, 1.6 mM diethanolamine, 6 mM MgC12, 0.54 mM EDTA, 3.4 mM DTT, 2.6 mM ATP, 2 mM luciferin-O-phosphate, 0.08 mg luciferase/3 ml, pH 8.0) for a few seconds. 3. Place the nitrocellulose membrane in a plastic dish and image bound label using a photon-counting camera system (Argus-100) (count and integrate for 5 min). Protein-bound antibodies can be visualized as bright spots using a computer program developed by Hamamatsu Photonics (Fig. 7). The bioluminescent blotting procedure has excellent sensitivity, and spots containing 5 pg protein (corresponding to 30 x 10 -18 mol of rabbit immunoglobin G) can be detected on photographic film. The detection limit can be lowered into the
138
Reinhard Erich Geiger and Werner Miska
Fig. 7---Detection of a protein blot by the use of a photon-counting camera (Argus100; Hauber et al., 1988a). (a) control, no immunoglobulin G applied; (b) 5 fg; (c) 50 fg; (d) 500 fg; (e) 5 pg; (f) 50 pg of rabbit immunoglobulin G.
femtogram range using a photon-counting camera system to detect light emission.
B. D o t - S l o t Blots--Nucleic Acid Hybridization 1. Bioluminescence-Enhanced Detection System for DNA Hybridization Nucleic acid hybridization techniques are now extensively used for the prenatal diagnosis of hereditary disorders, infectious diseases, and in forensic medicine (Blasi, 1987; Viscidi and Yolken, 1987). DNA probes are most commonly labelled with 32p. However, the label presents a hazard to the operator and has a short shelf-life. A number of nonradioactive methods have now become available based on enzymatically or chemically modified nucleotide probes, which can be recognized either by
4. Detectionof AlkalinePhosphataseby Bioluminescence
139
enzyme-labeled antibodies or by biotinylated enzyme avidin/streptavidin complexes (Bayer and Wilchek, 1980; Matthews et al., 1985). Direct labeling of DNA with enzyme labels has also been described (Li et al., 1987; Renz and Kurz, 1984). Bound enzyme activity can be detected by either chromogenic, fluorogenic, and/or chemiluminogenic substrates (Leary et al., 1983; Matthews and Kricka, 1988). We have developed a sensitive bioluminescent assay system for alkaline phosphatase labels in nucleic acid hybridization (Geiger and Miska, 1987; Hauber and Geiger, 1988b; Hauber and Geiger, 1989, Miska and Geiger, 1987) based on firefly luciferin-O-phosphate (Fig. 8). The bioluminescence is detected either photographically or using the photon-counting camera system (Argus100). ii
iii
i
2. Bioluminescence-Enhanced Detection of Nucleic Acid Hybridization Using a Photographic Film 1. Apply pBR322 to nitrocellulose (Southern, 1975), and hybridize the pBR322 with biotinylated pBR322 according to a standard procedure (Schnell et al., 1980). Block the membrane with bovine serum albumin (5%). 2. Incubate the nitrocellulose filter with a streptavidin biotinylated alkaline phosphatase complex, and then wash the filter.
Fig. 8--Scheme of the bioluminescence-enhanceddetection system of DNA hybridization using (a) photographic films or (b) a photon-counting camera system. >--AP, antibody alkaline phosphatase conjugate; -o, sulphonylated probe; Lu-x, luciferin; P, oxyluciferin.
140
Reinhard Erich Geiger and Werner Miska
3. Transfer the filter to a transparent plastic dish containing 6 ml of the detection solution (40 mM HEPES buffer, 1.6 mM diethanolamine, 6 mM MgC12, 0.54 mM EDTA, 3.4 mM DTT, 2.6 m M ATP, 2 mM luciferin-O-phosphate, 0.15 mg luciferase, pH 8.0). Place the dish on a photographic film (in the dark) and expose the film for 2 hr. After development (5 min at 25~ in a solution of Kodak HC-110) and fixation of the film, the hybridized probe can be visualized as dark spots (Fig. 9).
3. Bioluminescence-Enhanced Detection of Nucleic Acid Hybridization Using a Photon-Counting Camera System 1. Hybridize pBR322 bound to nitrocellulose with biotinylated pBR322 as described in the previous section. 2. Incubate the nitrocellulose filter with a streptavidin biotinylated alkaline phosphatase complex, and then wash the filter. 3. Transfer the filter to a plastic dish containing 2-5 ml of the detection solution (41 mM HEPES, 7.8 mM diethanolamine, 5 mM MgCI2, 3.5 mM DTT, 2.6 mM ATP, 0.33 /xM luciferin-
Fig. 9mDetection of nucleic acid hybridization by the use of a photographic film (Hauber and Geiger, 1988b). (1) 600 ng; (2) 300 ng; (3) 150 ng; (4) 75 ng; (5) 38 ng; (6) 19 ng; of pBR322. Hybridization was performed using a biotinylated probe.
4. Detection of Alkaline Phosphatase by Bioluminescence
141
O-phosphate, 0.008 mg luciferase/ml, pH 8.0) for a few seconds, and then transfer it to a clean plastic dish. Image the bound label using a photon-counting camera system (Argus-100).
Hybridized DNA can be visualized as bright spots using a computer program developed by Hamamatsu Photonics (Fig. 10). Similar results can be obtained using a sulfonated pBR322 probe and an alkaline phosphataselabeled antibody directed against the sulfonated nucleotide (Fig. 11). The sulfonated pBR322 was prepared using a Chemiprobe kit (Biozym, Hameln, Germany) following the manufacturer's instructions.
IV. C O N C L U S I O N S The bioluminescent assay for alkaline phosphatase labels based on firefly D-luciferin-O-phosphate is sensitive and versatile. In conjunction with a photon-counting camera (Argus-100), the detection limits can be improved
Fig. 10--Detection of nucleic acid hybridization using a photon-counting camera system (Argus-100; Hauber and Geiger 1989b). (a): (1) 18 ng; (2) 9 ng; (3) 4 ng; (4) 2.25 ng; (5) 1.1 ng; (6) 550 pg. (b): (1) 275 pg; (2) 138 pg; (3) 68 pg; (4) 34 pg; (5) 17 pg, (6) 9 pg of pBR322. (Hybridization was performed using a biotinylated pBR322 probe).
142
Reinhard Erich Geiger and Werner Miska
Fig. l 1--Detection of nucleic acid hybridization using a photon-counting camera system (Argus-100). Row 1: (a) 100 fg; (b) 200 fg; (c) 400 fg; (d) 800 fg; (e) 1.6 pg; (f) 3.2 pg; (g) 6.4 pg; (h) 15 pg of pBR322. Row 2: (h) control (hybridization was performed using a sulfonylated pBR322 probe).
by several orders of magnitude (5 to 10 min counting period) compared to detection using photographic film.
REFERENCES Bayer, E. A., and Wilchek, M. (1980). The use ofavidin-biotin complex as a tool in molecular biology. Methods Biochem. Anal. 26, 1-45. Berger, J., Hauber, J., Hauber, R., Geiger, R., and Cullen, B. R. (1988). Secreted placental alkaline phosphatase: A powerful new qualitative indicator of gene expression in eukaryotic cells. Gene 66, 1-10. Bjierrum, O. J., and Schafer-Nielsen, C. (1986). Buffer systems and transfer parameters for semidry electroblotting with a horizontal apparatus. In "Electrophoresis 1986" M. J. Dunn, ed.) pp. VCH Weinheim Bergstrasse, Germany. Blasi, F. (1987). "Human Genes and Diseases." John Wiley, Chichester, England. Burr, G. J. (1985). "Chemi- and Bioluminescence." Marcel Dekker, New York. DeLuca, M. A. (1978). Bioluminescence and chemiluminescence. Methods Enzymology 57, 653 pp., Academic Press, Orlando. DeLuca, M., and McElroy, W. D. (1986). Bioluminescence and chemiluminescence, Part B. Methods Enzymology, Vol. 133, 649 pp., Academic Press, Orlando. Geiger, R., and Miska, W. (1987). The bioluminescence-enhanced immunoassay. New ultrasensitive detection for enzyme immunoassays. J. Clin. Chem. Clin. Biochem. 25, 31-38. Geiger, E. R. (1990). Bioluminescence enzyme immunoassays. In "Luminescence Immunoassays and Molecular Application" (K. van Dyke and R. van Dyke, eds.), CRC Press, Boca Raton, Florida. Gershoni, J. M. (1985). Protein blotting: Developments and perspectives. TIBS 10, 103-106.
4. Detection of Alkaline Phosphatase by Bioluminescence
143
Gould, S. J., and Subramani, S. (1988). Firefly luciferase as a tool in molecular and cell biology. Anal. Biochem. 175, 5-13. Hauber, R., and Geiger, R. (1987). A new, very sensitive detection system for protein blotting. Ultrasensitive detection systems for blotting and nucleic acid hybridization, I. J. Clin. Chem. Clin. Biochem. 25, 511-514. Hauber, R., Miska, W., Schleinkofer, L., and Geiger, R. (1988a). The application of a photon-counting camera in very sensitive, bioluminescence-enhanced detection system for protein blotting. Ultrasensitive detection systems for protein blotting and nucleic acid hybridization, II. J. Clin. Chem. Clin. Biochem. 26, 147-148. Hauber, R., Miska, W., Schleinkofer, L., and Geiger, R. (1989a). New, sensitive, radioactivefree bioluminescence-enhanced detection system in protein blotting and nucleic acid hybridization. J. Biolumin. Chemilumin. 4, 367-372. Hauber, R., and Geiger, R. (1988a). A sensitive, bioluminescence-enhanced detection method for DNA dot-hybridization. Nucleic Acids Res. 16, 1213. Hauber, R., and Geiger, R. (1988b). The application of a photon-counting camera in a sensitive, bioluminescence-enhanced detection system for nucleic acid hybridization. Ultrasensitive detection systems for protein blotting and nucleic acid hybridization. III. J. Clin. Chem. Clin. Biochem. in press. Herring, P. J. (1987). Systematic distribution of bioluminescence in living organisms. J. Biolumin. Chemilumin, 1, 146-163. Kricka, L. J., Stanley, P. E., Thorpe, G. H. G., and Whitehead, T. P. (1984). "Analytical Applications of Bioluminescence and Chemiluminescence." Academic Press, New York. Kricka, L. J. (1988). Clinical and biochemical applications of luciferase and luciferins. Anal. Biochem. 175, 14-21. Leary, J. J., Brigati, D. J., and Ward, D. C. (1983). Rapid and sensitive colorimetric method for visualizing biotin-labeled DNA probes hybridized to DNA or RNA immobilized on nitrocellulose: Bio-blots. Proc. Natl. Acad. Sci, U.S.A. 80, 4045-4049. Li, P., Medon, P. P., Skingle, D. C., Lanser, J. A., and Symons, R. H. (1987). Enzymelinked synthetic oligonucleotide probes: Non-radioactive detection of enterotoxogenic Escherichia coli in faecal specimens. Nucleic Acids Res. 15, 5275-5287. Lin, W., and Kasamatsu, H. (1983). On the electrotransfer of polypeptides from gel to nitrocellulose membranes. Anal. Biochem. 128, 302-311. Lundin, A., Richardsson, A., and Thorpe, A. (1976). Continuous monitoring of ATPconverting reactions of purified firefly luciferase. Anal. Biochem. 75, 611-620. Matthews, J. A., Batki, A., Hynds, C., and Kricka, L. J. (1985). Enhanced chemiluminescent method for the detection of DNA dot-hybridization assays. Anal. Biochem. 151, 205-209. Matthews, J. A., and Kricka, L. J. (1988). Analytical strategies for the use of DNA probes. Anal. Biochem. 169, 1-25. Miska, W., and Geiger, R. (1987). I. Synthesis and characterization of luciferin derivatives for use in bioluminescence-enhanced enzyme immunoassays. New ultrasensitive detection systems for enzyme immunoassays. J. Clin. Chem. Clin. Biochem. 25, 23-30. Miska, W., and Geiger, R. (1988). A new type of ultrasensitive bioluminogenic enzyme substrates. I. Enzyme substrates with D-Luciferin as leaving group. Biol. Chem. Hoppe Seyler 369, 407-411. Renart, J., Reiser, J., and Stark, G. R. (1979). Transfer of proteins from gels to diazobenzyloxymethyl paper and detection with antisera: A method for studying antibody specificity and antigen structure. Proc. Natl. Acad. Sci. U.S.A. 76, 3116-3120. Renz, M., and Kurz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Schnell, H., Steinmetz, M., Zachau, H. G., and Schechter, I. (1980). An unusual translocation of immunoglobulin gene segments in variants of the mouse myeloma MPC 11. Nature 268, 170-173.
144
Reinhard Erich Geiger and Werner Miska
Sch61merich, J., Andreesen, R., Kapp, A., Ernest, M., and Woods, W. G. (1987). "Bioluminescence and Chemiluminescence, New Perspectives." John Wiley, Chichester, England. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gene electrophoresis. J. Mol. Biol. 98, 503-517. Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76, 4350-4435. Towbin, H., and Gordon, J. (1984). Immunoblotting and dot immunoblotting--current status and outlook. J. Immunol. Methods. 72, 313-340. Viscidi, R. P., and Yolken, R. G. (1987). Molecular diagnosis of infectious diseases by nucleic acid hybridization. Mol. Cell. Probes 1, 3-14. Wood, W. G. (1984). Luminescence immunoassays: Problems and possibilities. J. Clin. Chem. Clin. Biochem. 22, 905-918.
5
D e t e c t i o n of DNA on M e m b r a n e s with Alkaline Phosphatase-Labeled Probes and C h e m i l u m i n e s c e n t CSPD | Substrate Annette Tumolo, Quan N guyen, and Frank Witney Genetic Systems Division Bio-Rad Laboratories Richmond, California 94806 Owen J. Murphy, Chris S. Martin, John C. Voyta, and Irena Bronstein TROPIX, Inc. Bedford, Massachusetts 01730
I. Introduction II. General Southern Blotting Procedure with Chemiluminescence A. Selection and Preparation of Membranes B. Materials C. Hybridization Conditions 1. Biotinylated Oligonucleotide Probes 2. Biotinylated DNA Probes Prepared by Nick Translation or Random Primer Labeling
D. Chemiluminescent Detection of Biotinylated DNA Probes E. Film Exposure and Development F. Reprobing Procedures G. Troubleshooting III. Two-Step Hybridization Southern Blotting Procedure for the Detection of Single-Copy Genes A. Materials B. Hybridization 1. Reagent Preparation 2. Procedures
IV. Troubleshooting and Comments References Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
145
146
Annette Tumolo et al.
I. INTRODUCTION Southern blotting is used for the routine detection and quantitation of nucleic acids in various samples (Southern, 1975). This membrane-based methodology requires a transfer of DNA fragments from a gel followed by hybridization with a labeled probe. Although the most frequently used labels for DNA/RNA detection are radioisotopes such as 32p and 35S, various nonisotopic labels have been described, including fluorophores, metal atoms, enzymes, and others (see Chapter 1). Lately, enzymes have become the labels of choice for nucleic acid detection. The inherent catalytic amplification afforded by the enzyme label, when coupled with luminescent substrates, permits extremely sensitive detection of target DNA or RNA (Bronstein et al., 1990). Alkaline phosphatase has been widely used as a durable label in nucleic acid detection. In particular, the thermal stability of the enzyme precludes degradation of the label during high-temperature hybridizations. The recent development of novel chemiluminescent substrates for alkaline phosphatase simplifies nonisotopic nucleic acid analysis while increasing detection sensitivity (Bronstein et al., 1989a,b, Bronstein and Voyta, 1989; Tizard et al., 1990). One such substrate, disodium 3-(4-methoxyspiro[1,2dioxetane-3,2'-(5'-chloro)tricyclo[3.3.1.13,7]-decan]4-yl)phenyl phosphate (CSPD| functions as a direct substrate for alkaline phosphatase, requiring no additional reagents for chemiluminescent activation (Bronstein et al., 1991). Upon dephosphorylation by the enzyme, CSPD decomposes with concurrent light emission at 475 nm. For CSPD detection of target DNA, a complementary nucleic acid probe is labeled with alkaline phosphatase by one of the techniques described in related chapters. The principles of CSPD chemiluminescent detection of alkaline phosphatase-labeled DNA probes are described in this chapter along with detailed protocols for the chemiluminescent detection of alkaline phosphatase streptavidin : biotin, and covalently labeled nucleic acid probe systems. These methods can be utilized in the detection of DNA in Southern blots, dot blots, colony hybridizations, plaque lifts, and other hybridization assays.
II. GENERAL SOUTHERN BLOq['I'ING PROCEDURE WITH CHEMILUMINESCENCE DNA can be detected in Southern blots with CSPD chemiluminescence using biotinylated DNA probes coupled with streptavidin-labeled alkaline phosphatase. The following sections of this chapter describe the optimized
5. Detection of D N A on Membranes
147
conditions for the detection of hybridized probes that have been biotinylated by various methods.
A. S e l e c t i o n and Preparation of M e m b r a n e s Positively charged nylon membrane is recommended when using biotinylated probes and avidin or streptavidin-alkaline phosphatase conjugates. Tropilon Plus-45 TMmembrane (available from Tropix, Inc., Bedford, Massachusetts) provides optimal results and is highly recommended. Best results are obtained when DNA is fixed to Tropilon membrane by UV irradiation. This may be performed with a shortwave UV (254 nm) mineralight lamp (120 mJ/cm 2 is recommended). Baking (<30 min, 80~ may also be used.
B. Materials 1. Reagents CSPD substrate, supplied as a 25 mM stock solution (Tropix, Inc., Bedford, Massachusetts). Store at 2 to 8~ I-Block reagent supplied as a dry powder (Tropix, Inc., Bedford, Massachusetts). Store at room temperature. AVIDx-AP, streptavidin alkaline phosphatase conjugate (Tropix, Inc., Bedford, Massachusetts). Supplied as a concentrated stock solution. Store at 2 to 8~ DEA, 99% pure diethanolamine (Tropix, Inc., Bedford, Massachusetts). Store at room temperature. Other reagents, such as SDS, PVP, and others should be of the highest purity available. The quality of the water used to prepare buffers should be of the highest possible purity. We recommend using high pressure liquid chromatography (HPLC) grade water or Milli-Q purified water (Millipore, Bedford, Massachusetts).
2. Instrumentation Water bath or oven for hybridizations, UV light source, bag sealer. Optimal results are obtained when sealed bags are used for hybridizations, washes, and blocking.
148
Annette Tumolo et al.
Note: In order to assure low nonspecific backgrounds, all reagents must be kept free from alkaline phosphatase contamination by bacteria.
C. Hybridization Conditions 1. Biotinylated Oiigonucleotide Probes Oligonucleotide probes can be biotinylated using several methods. Oligonucleotides may be synthesized with an amine group attached to the 5' end of the probe and subsequently reacted with NHS-biotin. Alternatively, terminal deoxynucleotidyl transferase can be used to attach one or more biotinylated nucleotides to the 3' end of an existing oligonucleotide probe. The recommended hybridization buffers for oligonucleotide probes are described below.
a. Stock Solutions 20% Sodium dodecyl sulfate (SDS) 0.5 M Disodium phosphate, pH 7.2 9 0.5 M Na2 HPO4" 7H20 9 adjust pH with 85% H 3 P O 4 25 • SSC, pH 7.01 9 3.75 M sodium chloride 9 0.375 M sodium citrate dihydrate 0.2 M Ethylenediaminetetraacetic acid 9 0.2 M EDTA, disodium dihydrate, pH 8.0'
b. Preparation of Solutions for Hybridization and Stringency Washes Blot wetting buffer 9 0.25 M disodium phosphate, dilute 0.5 M disodium phosphate 1:2 Hybridization buffer 9 add 0.2 M EDTA to a final concentration of 1 m M 9 add 20% SDS to a final concentration of 7% 9 add 0.5 M disodium phosphate to a final concentration of 0.25 M Adjust the volume with deionized H 2 0 . c. Stringency Wash Buffers 2 • SSC, 1.0% SDS 9 add 25 • SSC to a final concentration of 2 •
' Adjust pH with HC1 or NaOH and sterile filter (0.45/zm) before use.
5. Detectionof DNA on Membranes 9 add 20% SDS to a final 1 x SSC, 1.0% SDS 9 add 25 • SSC to a final 9 add 20% SDS to a final 1 • SSC 9 add 25 • SSC to a final
149 concentration of 1% concentration of 1 • concentration of 1% concentration of 1 •
Adjust the volume of each buffer with deionized H20.
d. Hybridization and Stringency Wash Conditions
1. Wet membrane in blot wetting buffer. 2. Prehybridize in hybridization buffer (10-100/~1 per cm 2) for 1 hr at 55~ or an appropriate hybridization temperature. Drain buffer. 3. Dilute biotinylated probe (0.1-5.0 pmol/ml) in fresh hybridization buffer and add to membrane (10-100/.d per cm2). Incubate 2 hr at the appropriate temperature. 4. Wash membrane (1 ml per cm 2) 2 • 5 min at room temperature (RT) in 2 • SSC, 1.0% SDS; then 2 • 15 min at the hybridization temperature in 1 • SSC, 1.0% SDS; then 2 • 5 min at room temperature in 1 • SSC. 5. Follow the procedure for chemiluminescent detection of biotinylated DNA. Membranes may be stored for up to 3 days in blocking buffer at 4~ before continuing with the detection protocol.
2. Biotinylated D N A Probes Prepared by Nick Translation or Random Primer Labeling
The following protocol has been developed for the hybridization of biotin-labeled long DNA probes. These probes may be prepared by nick translation, random primer labeling or photoreactive biotinylation procedures to incorporate biotin. Kits that contain all the necessary reagents to produce biotin-labeled probes are available from Tropix. a. S t o c k
Solutions
20% Sodium dodecyl sulfate (SDS) 0.5 M Disodium phosphate, pH 7.2 9 0.5 M Na2 HPO4" 7H20 9 adjust pH with 85% H3PO4 25 x SSC, pH 7.02 2 Adjust pH with HCI or NaOH and sterile filter (0.45 #m) before use.
150
Annette Tumoloet al.
9 3.75 M sodium chloride 9 0.375 M sodium citrate dihydrate 0.2 M Ethylenediaminetetraacetic acid 9 0.2 M EDTA, disodium dihydrate, pH 8.02
b. Preparation of Solutions for Hybridization and Stringency Washes Blot wetting buffer 0.25 M Disodium phosphate; dilute 0.5 M disodium phosphate 1:2 Hybridization buffer 9 add 0.2 M E D T A to a final concentration of 1 m M 9 add 20% SDS to a final concentration of 7% 9 add 0.5 M disodium phosphate to a final concentration of 0.25 M Adjust volume with deionized H20. c. S t r i n g e n c y
Wash Buffers
2 • SSC, I % S D S 9 add 25 x SSC to a 9 add 20% SDS to a 0.1• SSC, I % S D S 9 add 25 • SSC to a 9 add 20% SDS to a 1 x SSC 9 add 25 • SSC to a
final concentration of 2 • final concentration of 1% final concentration of 0.1 • final concentration of 1% final concentration of 1 x
Adjust the volume of each buffer with deionized H20.
d. Hybridization and Stringency Wash Conditions
1. Wet membrane in blot wetting buffer. 2. Prehybridize in hybridization buffer (10-100/zl per cm 2) for 1 hr at 65~ or an appropriate hybridization temperature. Drain buffer. 3. Dilute heat-denatured biotinylated probe (10-100 ng/ml) in fresh hybridization buffer and add to membrane (10-100/zl per cm2). Incubate overnight at 65~ 4. Wash membrane (1 ml per cm 2) 2 • 5 min at room temperature in 2 x SSC, 1.0% SDS; then 2 • 15 min at 65~ in 0.1 • SSC, 1.0% SDS; then 2 • 5 min at RT in 1 • SSC. 5. Follow the procedure for chemiluminescent detection of biotinylated D N A described below. Membranes may be stored for up to 3
5. Detectionof DNA on
Membranes
151
days in blocking buffer at 4~ before continuing with the detection protocol.
Note: Biotinylated probes should not be subjected to alkaline denaturation at elevated temperature since biotin may be cleaved from the probe.
D. Chemiluminescent Detection of Biotinylated DNA The following protocol has been developed for the detection of immobilized biotinylated or hybridized biotinylated DNA on nylon membrane. AVIDx-AP (Tropix, Inc.), a streptavidin alkaline phosphatase conjugate that has been screened for low backgrounds in membrane-based chemiluminescence assays, should be used in the following protocol. All procedures should be performed at room temperature unless stated otherwise.
Solutions Prepare all solutions with filter sterilized, fleshly deionized H20.
a.
10 x Phosphate buffered saline (PBS) 9 add Na2HPO 4 to a final concentration of 0.58 M 9 add N a H z P O 4 9 H20 to a final concentration of 0.1 M 9 add NaC1 to a final concentration of 0.68 M 9 adjust volume using deionized H20. A 1 • PBS solution should have a pH of 7.3 to 7.4 Blocking Buffer 9 add 10 • PBS to a final concentration of 1 • 9 add I-Block Reagent to a final concentration of 0.2% 9 add 20% SDS to a final concentration of 0.5% 9 adjust volume with deionized H20 Suspend I-Block Reagent in 1 • PBS, heat gently and stir at 70~ for 30 min or until solution is clear of particles. Alternatively, the solution may be microwaved (high) for 30 to 60 sec per 100 ml and stirred to dissolve. Add 20% SDS to a final concentration of 0.5% and adjust volume with deionized H20. The solution may remain cloudy. Cool to room temperature before use. Wash buffer 9 add 10 • PBS to a final concentration of 1 • 9 add 20% SDS to a final concentration of 0.5% 9 adjust volume with deionized H20
152
Annette Tumoloet al.
Assay buffer 9 add DEA to a final concentration of 0. l M 9 add MgCI2 to a final concentration of 1 mM 9 Dissolve above components in deionized H20 and adjust pH to 10.0 with HCl. Adjust to final volume. CSPD substrate solution 9 dilute CSPD Stock Solution 1 : 100 in assay buffer. Final concentration is 0.25 mM
b. Membrane Blocking and Chemiluminescent Detection
1. Wash membrane 2 x 5 min in blocking buffer (0.5 ml per cm2). 2. Incubate for 10 min in blocking buffer (1 ml per cm2). 3. Dilute AVIDx-AP conjugate 1:5,000 in conjugate buffer (use 2.0/zl of AVIDx-AP conjugate in 10 ml blocking buffer per 100 cm2). 4. Incubate membrane for 20 min with constant agitation in diluted conjugate solution. 5. Wash 1 • 5 min in blocking buffer (0.5 ml per cm2). 6. Wash 3 x 5 min in wash buffer (1 ml per cm2). 7. Wash filter 2 • 2 min in assay buffer (0.5 ml per cm2). 8. Add CSPD substrate solution to the blot (5 ml per 100 cm2). 9. Slowly shake or agitate the immersed membrane for 5 rain. 10. Drain off excess substrate from the membrane. Do not blot the membrane or allow it to dry at any time. The membrane must remain wet. 11. Seal the membrane in clear plastic (e.g., hybridization bag, report cover, or plastic wrap, etc.). Do not fold or bend the membrane; it should remain flat. Note: Careful handling of blots is very critical. Mishandled blots exhibit high nonspecific background signals. Never touch membranes with ungloved hands.
E. Film Exposure and Development Blots that are sealed in plastic wrap or a hybridization bag may be imaged by placing them in direct contact with standard Kodak XAR X-ray film or Polaroid Instant Photographic Black and White film. Initial exposures
5. Detection of D N A on Membranes
153
of 5 to 60 min are recommended to assess the optimal exposure time for your application. Owing to the kinetics of light emission on nylon membranes, incubation of the plastic wrapped membrane at room temperature for 1 hr to overnight will permit shorter film exposures. Very short film exposures are possible after overnight incubations. Imaging of a small blot up to 7.3 cm • 9.5 cm in size may be performed on Polaroid instant film in a handheld camera luminometer (Tropix Cat. No. ICL-901). Kodak XAR X-ray film will detect the chemiluminescent signal with similar sensitivity.
F. Reprobing Membranes Blots that have remained wet following hybridization may be stripped of hybridized DNA and used for subsequent reprobing after performing the following stripping procedure:
1. Heat buffer containing 0.1 • SSC, 1% SDS to 95~ 2. Pour this solution over the membrane and agitate rapidly for 5 min, and drain buffer. 3. Repeat above two steps, if necessary. 4. Wash 2 x 5 min in 1 x SSC at RT and store air dried or wet, wrapped in plastic wrap at 4~
Successful removal of biotinylated probes and AVIDx-AP conjugate may be confirmed by reincubating the membrane in the presence of CSPD substrate solution as described above. If a detectable light signal is observed, the biotin-labeled probe was not fully stripped, and more rigorous treatment is necessary.
G. Troubleshooting Since CSPD substrate is the most sensitive detector of alkaline phosphatase activity available, it is recommended that only ultrapure water and other reagents free of AP contamination be used. For the detection of DNA with biotinylated probes labeled by nick translation, random primer labeling, or 3' end labeling, Tropix has optimized the above protocols using Tropilon membrane, I-Block reagent, AVIDx-AP conjugate, and CSPD substrate. If other membranes or enzyme conjugates are used, results may vary.
154
Annette Tumolo et al.
If the expected sensitivity is not attained, try the following: 1. For best results, the assay buffers should be prepared daily. 2. To detect lower levels of DNA, increase the film exposure time as much as possible or until background signal obscures the image. 3. Increase the incubation time during the hybridization step to overnight and/or conjugate incubation to 60 min if background signal is sufficiently low. 4. Increase the concentration of labeled DNA and/or AP conjugate in order to increase the signal. This may, however, contribute to increased nonspecific binding. 5. Check that the probe is sufficiently labeled and denatured before use. If the nonspecific background signal is too high (e.g., the film appears overexposed or the image is uneven or spotty) try the following: 1. Splotchy images may result from bacterial contamination of the membrane. Make sure that all buffers are free of contamination before use and that the membrane, blotting paper, and hybridization bags are clean and fingerprint free. 2. Decrease the film exposure time until appropriate resolution is achieved. If the expected sensitivity is not attained, try step 3. 3. If the background signal appears evenly across the membrane but obscures the specific signal, try incubating the membrane in the blocking buffer overnight at 4~ or increasing the number of wash steps after conjugate incubation. 4. In order to reduce nonspecific binding of the AVIDx-AP conjugate, increase the dilution of the conjugate to 1 : 15,000 and spin down any particulate material before use. 5. In order to reduce nonspecific binding of DNA to the membrane, reduce the biotin-labeled probe concentration in the hybridization buffer, or increase the duration of the final two stringency washes. 6. If the background signal is spotty, try precipitating the probe with EtOH before the hybridization. III. T W O - S T E P H Y B R I D I Z A T I O N SOUTHERN BLOTrlNG
PROCEDURE---DETECTION OF SINGLE-COPY GENES Nonisotopic methods employing biotinylated or digoxigenin-labeled probes work very well for plaque and colony-screening applications or for dot blots and Southern blots containing nanogram amounts of target DNA (Kincaid and Nightingale, 1988; Bronstein et al., 1990; Martin et
5. Detection of D N A on Membranes
155
al., 1990). However, two problems associated with these methods make
their application unreliable where picogram levels of detection are required. First, high-sensitivity applications such as Northern blots or genomic Southern blots require that the probe DNA have a high efficiency of label incorporation. Since there is no easy method for monitoring the efficiency of the biotin or digoxigenin incorporation into the probe, users often proceed with a hybridization without knowing whether or not the probe DNA is adequately labeled. Second, the high backgrounds associated with the avidin or antidigoxigenin-alkaline phosphatase conjugates often reduce the signal to noise to an extent that obscures the results. In response to the need for a better nonisotopic methodology for Northern and genomic Southern hybridizations, we developed a two-step hybridization method that eliminates the problems just outlined (Nguyen et al. 1992). The procedure, a variation of the sandwich hybridization method first proposed by Dunn and Hassell (1977) involves a primary hybridization of single-stranded probe that is complementary to the target nucleic acid and contains the universal primer site sequence. This is followed by a secondary hybridization with an oligonucleotide-alkaline phosphate conjugate (UP-AP) that is complementary to the universal primer site (UP site) present in the primary probe. After incubation in the chemiluminescent substrate AMPPD| or CSPD | the blot is exposed to X-ray film or a suitable storage phosphor screen for signal detection (see Fig. 1). The primary probe does not require labeling with biotin or digoxigenin. This eliminates the problems encountered with the use of uncharacterized biotin- or digoxigenin-labeled probes. The single-stranded probe can be made by subcloning the probe insert into a phagemid vector (such as pTZ18U), followed by in vivo synthesis of the probe and UP-sitecontaining single-stranded DNA. Alternatively, the primary probe can be generated by PCR amplification of the probe (from genomic DNA or any vector), followed by solid phase capture of one of the amplicon strands. For this strategy, one of the PCR primers must be labeled with biotin for solid phase capture with streptavidin-coupled magnetic or agarose beads. The other primer must be tailed with the complement to the U P - A P sequence (see Fig. 2). The sequence of the oligonucleotide portion of the U P - A P sequence is 5'-GTA AAA CGA CGG CCA GTG CCA. The secondary probe is the same regardless of the nature of the target gene. Such labeled probes can be synthesized and conjugated in large quantities. Because the secondary probe is a direct oligonucleotide-alkaline phosphatase conjugate, none of the high backgrounds associated with the avidin or antidigoxigenin-alkaline phosphatase conjugates is seen. In practice, we consistently attain picogram levels of detection with very low backgrounds (see Figs. 3, 4, 5, and 6). This method should prove useful and reliable for genomic Southern and Northern applications requiring high sensitivity.
156
Annette Tumolo et al.
1. Immobilize target nucleic acid on nylon membrane. (Northern or genomic Southern blot)
primary I hybridization tl
I
I
I I
2. Hybridize overnight with single-stranded probe containing the universal primer site. Perform post-hybridization washes.
wCuwar ~ i l l
n I
wash block
II
J
J P l secondary hybridization
3. Block membrane with casein. Hybridize 30 minutes with an oligonudeotide alkaline phosphatase conjugate that is complementary to the universal primer site present on the primary probe
,fill|,'-, i
qL
CSPD or AMPPD
4. Chemiluminescent substmte CSPD or AMPPD is activated by alkaline phosphatase for signal generation. Expose to x-ray film or a storage phosphor imaging screen capable of chemiluminescent detection.
I
Li
I
J_i
I
I
I
I
I
I
I
i
Fig. 1--Outline of the two-step hybridization method for chemiluminescent detection of single copy genes.
A. Materials 1. Reagents 10• PBS 6% Casein (Bio-Rad GeneLite kit) Urea (Bio-Rad) 50X Denhardt's Solution SDS (Bio-Rad) Triton X-100 (Bio-Rad) 20X SSC
5. Detection of DNA on Membranes
157
Probe DNA
~ J Region flanking probe
UP-site
/'
1
PCR-amplify the probe with a biotinylated primer flanking one end of the probe, and a UP-site tailed primer flanking the other end.
Ir
6
Solid-phase capture with streptavidincoupled magnetic or agarose beads
Denature with NaOH to release the primary probe
Solid phase captured strand
UP-site containing, single-stranded primary probe
Fig. 2--Schematic of the vector-independent PCR-solid phase capture method of generating single-stranded UP-site-containing primary probes.
25X Diethanolamine (DEA) buffer (Bio-Rad GeneLite kit) Universal primer-alkaline phosphatase conjugate (Bio-Rad GeneLite kit) Deionized distilled H20 (ddH20) Charged nylon membrane (ZetaProbe GT, Bio-Rad) AMPPD, 25 mM (Bio-Rad or Tropix) CSPD substrate, supplied as 25 mM stock (Bio-Rad or Tropix) TM
158
Annette Tumolo et al.
Fig. 3mSingle copy detection of PFGE-sized restriction fragments. (A) Agarose plugs containing 5 x l06 normal human leukocytes/plus were digested overnight with Sfi I. One (1), one-half (2), or one-quarter (3) plugs were separated on a 1% pulsed-field certified agarose (Bio-Rad) gel using a Bio-Rad CHEF Mapper XA pulsed-field electrophoresis system (auto-algorithm mode: 50-1500 kb). Lambda ladders (M) (Bio-Rad) served as DNA size standards from 48.5 to 873 kb. (B) The gel was stained for 30 min in ethidium bromide (1.0 /.~g/ml) and was UV irradiated (60 mJ) in a Bio-Rad GS Gene Linker | to nick the fragments prior to transfer. The DNA was transferred to charged nylon membrane (BioRad ZetaProbe | GT) using standard alkaline transfer methods. The primary hybridization was performed with 50 ng/ml of a single-stranded phagemid vector containing a 1.8-kb portion of a human factor VIII cDNA (pTZFVIII), followed by a secondary hybridization with 1.5 nM UP-AP. The blot was incubated overnight with 0.25 mM AMPPD, and was exposed to X-ray film for 4 hr the next day. TM
Note: It is important to use alkaline phosphatase-free water and reagents. In practice, we use sterile "nanopure" water for all buffers and take reasonable precautions to prevent contamination of the buffers with alkaline phosphatase. The membranes are always handled with gloved hands and forceps, on the outer edges only. 2. Instrumentation Shaking water bath at 37~ heat sealer; UV-crosslinker (Bio-Rad GS Gene Linker| equipment for autoradiography or a chemiluminescent detection-capable storage phosphor imaging system (Bio-Rad GS-250 Molecular Imager TM)
5. Detection of DNA on Membranes
159
Fig. 4--Comparison of signal strength on charged versus neutral nylon membranes. In this experiment, 5/~g Bgl I-digested human genomic DNA was transferred to either (A) neutral nylon (AlphaProbeTM) or (B) charged nylon (ZetaProbe | GT). Primary hybridizations were done with 50 ng/ml single-stranded pTZFVIII. Secondary hybridizations were done with 1.5 nM UP-AP. The blots were incubated in 0.25 mM CSPD and were exposed overnight to X-ray film.
Fig. 5--Effect of UV-cross-linking DNA to membrane on signal strength. Bg/I-digested human genomic DNA was transferred to neutral nylon membrane (Bio-Rad). The blots were either UV-cross-linked (150 mJ, GS Gene Linker | Bio-Rad), or baked for 1 hr at 80~ Primary hybridizations were done with pTZFVIII. Secondary hybridizations were done with UP-AP. Blots were incubated with AMPPD and exposed to X-ray film overnight.
160
Annette Tumolo et al.
Fig. 6---Detection of RNA transcript on a Northern blot. 1 /zg (A), 0.5 /~,g (B), and 0.25/~g (C) of total RNA isolated from Chinese hamster ovary cells was electrophoresed on a 1% agarose/glyoxal gel and transferred to charged nylon (ZetaProbe | GT) by standard capillary methods. The primary hybridization was performed with 50 ng/ml of a singlestranded phagemid vector containing a portion of a human/3-actin sDNA (pTZactin), followed by a secondary hybridization with 1.5 nM UP-AP. The blot was immersed in CSPD and immediately exposed to a Bio-Rad Imaging Screen-CH (chemiluminescent imaging storage phosphor screen) for 30 min.
B. Hybridization Conditions 1. Reagent Preparation 10X PBS 9 add Na2HPO4 to a final concentration of 0.58 M 9 add NaH2PO4 9 H20 to a final concentration of 0.17 M 9 add NaCI to a final concentration of 0.68 M 9 adjust volume with ddH20 9 pH of 1X PBS should be between 7.3 and 7.4 9 autoclave 50X Denhardt's 9 1% Ficoll 9 1% polyvinylpyrrolidone 9 1% bovine serum albumin (Fraction V) 9 adjust volume with ddH20 9 sterile filter and store at - 2 0 ~ 20X SSC 9 add NaCI to a final concentration of 3 M 9 add sodium citrate to a final concentration of 0.3 M 9 adjust pH to 7.0 with a few drops of concentrated acetic acid 9 adjust volume with ddH20 9 autoclave 20% SDS 9 add 200 g SDS to 800 ml autoclaved ddH20, adjust volume to
1000 ml
5. Detection of D N A on Membranes
161
Secondary hybridization buffer 9 add urea to a final concentration of 6 M 9 add 20 • SSC to a final concentration of 2 • 9 add 50 • Denhardt's to a final concentration of 5 • 9 adjust volume with ddH20 1 • DEA buffer 9 dilute 25 • DEA buffer to final concentration of 1 • 9 pH should be 9.8-10.0 9 filter sterilize 9 1 • DEA buffer contains 0.1 M DEA, 1 mM MgCI2, and 0.02% NaN 3
2. Procedures
a. Primary Hybridization 1. Transfer digested genomic DNA to ZetaProbe GT membrane (charged nylon) according to standard Southern capillary transfer methods (Sambrook et al., 1989). Neutral nylon membrane such as AlphaProbe GT may be used, but charged nylon is recommended because of enhanced retention of the transferred nucleic acids (see Fig. 4). UV cross-linking of the DNA to the membrane is also recommended. If neutral nylon is used, UV cross-linking is essential for highest signal strength (see Fig. 5). 2. Hybridize the genomic Southern blot overnight with 2550 ng/ml hybridization buffer of primary probe. Single-stranded primary probe containing the universal primer site can be generated by in vivo synthesis of ssDNA from a suitable probecontaining phagemid vector according to standard published procedures (Sambrook et al., 1989), or by the PCR-solid phase capture strategy outlined in Fig. 2. Hybridization results from probe generated by either method are indistinguishable (data not shown). Any primary hybridization conditions may be chosen, but we recommend 7% SDS, 0.25 M NaPO4 at 65~ overnight (Church and Gilbert, 1984). It is important to use 25-50 ng/ml of primary probe because use of lower concentrations of primary probe results in reduced sensitivity (data not shown). 3. Perform stringency washes. If recommended hybridization conditions were used, wash twice with excess volumes of 5% SDS, 0.04 M NaPO4 for 30 to 60 min at 65~ then twice with 1% SDS, 0.04 M NaPO4 for 30 to 60 min at 65~
162
Annette Tumolo et al.
b. Blocking 1. Rinse membrane once with 1 x PBS for 5 min at RT with gentle shaking. It is convenient to use individual large, disposable weigh boats for the blocking steps, but any clean container is acceptable. Multiple blots may be processed together, but sufficient buffer and blocker must be used to cover the blots and prevent them from sticking together. 2. Block the membrane for 15 min at RT with gentle shaking with 3% casein blocking solution.
c. Secondary Hybridizations 1. Prehybridize the membrane in a heat-sealed plastic bag for 10 to 15 min at 37~ with secondary hybridization buffer. 2. Remove prehybridization buffer and add fresh hybridization buffer with 2.5 to 5 nM universal primer-alkaline phosphatase conjugate. Use between 50 and 75 ~1 hybridization buffer per cm 2 membrane. Minimize the size of the heat-sealed bag. 3. Hybridize for 30 min at 37~ 4. Wash twice with excess volumes of 6 M urea, 1 x SSC, 0.1% SDS for 10 min at 37~ Prewarm buffers. 5. Wash once with 1 x SSC, 0.1% Triton for 5 min at 37~ 6. Wash once with 1 • SSC for 5 min at RT.
d. Signal Detection 1. Rinse membrane twice with 1 • DEA buffer for 5 min at RT. 2. Transfer membrane to heat-sealable bag and add 100/xl per cm 2 of a 1 : 120 dilution of AMPPD or CSPD in 1 x DEA buffer. 3. Remove bubbles, seal, and incubate with gentle shaking or rocking for 30 min at RT. 4. Drain excess fluid from bag, remove bubbles, and reseal. 5. Expose to X-ray film overnight for signal detection (exposure times will be shorter when CSPD is used). Exposures to storage phosphor screens (see Fig. 6) should be performed according to the manufacturer's recommendations. Additional exposures can be made. Signal should last for up to 3 days.
IV. TROUBLESHOOTING AND COMMENTS Primary hybridization conditions may have to be optimized to obtain specific hybridization to the target when probing a genomic Southern blot for the first time (as would be the case with labeled probes). We have
5. Detection of DNA on Membranes
163
found that a primary probe concentration between 25 and 50 ng/ml is necessary for picogram levels of detection. If desired, picogram amounts of double-stranded primary probe DNA may be run alongside the genomic DNA on the gel as a positive control for the hybridization. This doublestranded DNA must be digested with the appropriate restriction endonuclease to release the cloned insert. The cloned insert band serves as the primary hybridization control. The vector band serves as a positive control for the secondary hybridization. Secondary hybridization conditions were developed to eliminate hybridization of the U P - A P directly to human genomic DNA using the U P - A P available from Bio-Rad as part of the GeneLite kit. If a custom oligo-AP conjugate is synthesized, or other genomes are probed, the stringency of the secondary hybridization may need to be optimized. We recommend running a mock primary hybridization without a primary probe, followed by a secondary hybridization with the UP-AP. If hybridization signal is present on an overnight exposure, the stringency should be increased by lowering the NaC1 concentration in the hybridization buffer until no direct hybridization of the U P - A P to genomic DNA occurs. The GeneLite kit contains pTZ18U DNA, which may be used as a positive control for the secondary hybridization. These conditions are recommended to generate the best signal to noise on an overnight exposure. Increasing the secondary probe concentration or the concentration of the chemiluminescent substrate can decrease the exposure times if so desired.
REFERENCES Bronstein, I., Edwards, B., and Voyta, J. C. (1989b). 1,2-Dioxetanes; novel chemiluminescent substrates: Applications to immunoassays. J. Biolumin. Chemilumin. 4, 99-111. Bronstein, I., Juo, R. R., Voyta, J. C., and Edwards, B. (1991). Novel chemiluminescent 1,2-dioxetane enzyme substrates. In "Bioluminescence and Chemiluminescence: Current Status" (P. Stanley and L. J. Kricka, eds.), pp. 73-82. Wiley, Chichester. Bronstein, I., Voyta, J. C., and Edwards, B. (1989a). A comparison of chemiluminescent and colorimetric substrates in a hepatitis B virus DNA hybridization assay. Anal. Biochem. 180, 95-98. Bronstein, I., Voyta, J. C., Lazzari, K. G., Murphy, O., Edwards, B., and Kricka, L. K. (1990). Rapid and sensitive detection of DNA in Southern blots with chemiluminescence. BioTechniques 8, 310-314. Bronstein, I., and Voyta, J. C. (1989). Chemiluminescent detection of herpes simplex virus I DNA in blot and in situ hybridization assays. Clin. Chem. 35, 1856-1857. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl. Acad. Sci. U.S.A. 81, 1991. Dunn, and A. R., Hassell, J. A. (1977). A novel method to map transcripts: Evidence for homology between an adenorirus mRNA and discrete multiple regions of the viral genome. Cell 12, 23-36.
164
Annette Tumolo et al.
Jablonski, E., Moomaw, E. W., Tullis, R. H., and Ruth, J. L. (1986). Preparation of oligodeoxynucleotide-alkaine phosphatase conjugates and their use as hybridization probes. Nucleic Acids Res. 14, 6115-6128. Kincaid, R. L., and Nightingale, M. S. (1988). A rapid nonradioactive procedure for plaque hybridization using biotinylated probes prepared by random primed labeling. BioTechniques 6, 42-49. Martin, R., Hoover, C., Grimme, S., Grogan, C., Holtke, J., and Kessler, C. (1990). A highly sensitive, nonradioactive DNA labeling and detection system. BioTechniques 9~ 762-768. Nguyen, Q., Whitney, F., and Tumolo, A. (1992). A two-step hybridization method for chemiluminescent detection of single copy genes. BioTechniques 13, 16-123. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). Molecular Cloning A Laboratory Manual. Coldspring Harbor Laboratory Press, Cold Spring Harbor, New York. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Tizard, R., Cate, R. L., Ramachandran, K. L., Wysk, M., Voyta, J. C., Murphy, O. J., and Bronstein, I. (1990). Imaging of DNA sequences with chemiluminescence. Proc. Natl. Acad. Sci. U.S.A. 87, 4514-4518.
Detection of Alkaline Phosphatase by Colorimetry Ayoub Rashtchian Molecular Biology Research and Development Life Technologies, Inc. Gaithersburg, Maryland 20877
I. Introduction II. Labeling and Detection Strategies A. Labeling of Nucleic Acid Probes with Biotin B. Colorimetric Detection C. Detection of Nucleic Acids on Membranes III. Hybridization of Biotinylated Probes A. Reagents B. Hybridization Protocol for Nitrocellulose Membranes C. Hybridization Protocol for Nylon Membranes D. Reuse of Hybridization Mixture IV. Detection of Biotinylated Probes A. Reagents B. Procedure V. In Situ Hybridization A. Design and Execution of In Situ Hybridization Experiments 1. 2. 3. 4. 5. 6.
Optimizing Tissue Fixation Slide Preparation Deproteinization Probe Preparation and Hybridization Detection Counterstaining
B. Reagents C. Protocol for DNA Detection D. Detection of RNA Targets VI. Conclusions References
I. INTRODUCTION Nucleic acid hybridization has been one of the most powerful techniques in molecular biology during the past 2 decades. The specificity and quantitative nature of annealing complementary strands of nucleic acids have Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
165
166
Ayoub Rashtchian
been exploited in a variety of ways. The applications of hybridization range from determination of overall similarity between organisms (Brenner, 1989) to determination of a single-base mutation in a given gene. Although nucleic acid hybridizations can be performed in a variety of ways, basically three general techniques are used: (1) solution hybridization; (2) hybridization on membrane filters; and (3) in situ hybridization to cytological preparations. Traditionally most hybridization techniques have used nucleic acid probes labeled with high-energy radioisotopes. Although generally shortlived and hazardous, radioactive labels can be detected in minute quantities and can be quantitated with relative ease by scintillation counting or autoradiographic methods. Although radio-labeled probes continue to be used by many researchers, the short half-life, problems with disposal, safety, and regulatory concerns have resulted in a widespread search for an ideal nonradioactive substitute. Consequently, a large number of nonradioactive labeling methods and appropriate signal-generation systems have been developed (Matthews and Kricka, 1988; see also Chapter 1). The properties of these systems vary greatly with regard to sensitivity of detection as well as the simplicity/complexity and requirements for specialized equipment. These properties, the hybridization format used, and ultimately the nature of the biological/biochemical question(s) being addressed by individual researchers affect the choice of the nonradioactive system.
II. L A B E L I N G AND
DETECTION STRATEGIES The choice of a strategy for nonradioactive labeling of nucleic acid probes is heavily dependent on the type probe being used; however, the labeling strategies can generally be divided into two categories: 1. Indirect primary labels that require secondary recognition after hybridization, such as biotin and other haptens; and 2. Direct primary labels that are covalently attached to the nucleic acid probe and are directly detectable, such as enzymes and fluorophores. A detailed discussion of labeling procedures can be found in Chapter 2 of this volume and basically can be divided into (1) enzymatic and (2) chemical methods. Regardless of the labeling strategy or procedure, alkaline phosphatase-based systems have been the most widely used for indirect detection of hapten-labeled probes (Langer et al., 1981; Leary et al., 1983) as well as direct labeling and detection of nucleic acid probes (Jablonski et al., 1986; Renz and Kurz, 1984).
6. Detection of Alkaline Phosphatase by Colorimetry
167
A. Labeling of Nucleic Acid Probes with Biotin The most common nonradioactive labeling method in recent years has used biotin as a reporter group. In this system, a probe is labeled with biotin and the presence of the labeled probe after hybridization is detected by streptavidin or avidin conjugated to alkaline phosphatase. The method used for labeling of nucleic acid probes is dependent on the type of probe used as well as the intended use of the probe. The most common methods of labeling DNA probes are by nick translation or random primer labeling (Feinberg and Vogelstein, 1983) using a suitable biotinylated nucleoside triphosphate (Gebeyehu et al., 1987; Langer et al., 1981). Both methods are efficient in incorporating biotin-labeled nucleoside triphosphates into DNA. Commerical kits are available for labeling DNA with biotin using these procedures (Life Technologies/BRL, Gaithersburg, Maryland). An alternative method for labeling uses photobiotin. This reagent contains a photoreactive aryl azide group attached to biotin through a charged linker arm. When irradiated with strong visible light in the presence of DNA, photobiotin covalently links biotin groups to the DNA (Forster et al., 1985). The choice of labeling method to be used for preparation of biotinylated probes depends on the specific use of the probe. While all three of the labeling methods mentioned above are suitable for detection of nucleic acids on membrane filters, only methods that yield probes of small size (50-500 bases) are suitable for use in in situ hybridization (Singer et al., 1987). The most widely used method for preparation of labeled probes for in situ is nick translation (Singer et al., 1987). Preparation of probes of optimal size for use in situ requires optimization of the concentration of DNase in the nick translation. A commercial kit specifically developed for preparation of probes suitable for in situ hybridization is available (Life Technologies/BRL, Gaithersburg, MD).
B. Colorimetric Detection There are four main types of detection methods for alkaline phosphatase: colorimetric, chemiluminescent, bioluminescent, and fluorescent. All of these detection methods have served as reliable and sensitive methods for nonradioactive detection of nucleic acid probes as well as solid-phase immunochemical assays (see Chapters 3, 4, and 5). This chapter describes the colorimetric detection methods and their application to a variety of gene detection procedures. Many chromogenic substrates have been developed for detection of
168
Ayoub Rashtchian
alkaline phosphatase. Depending on the specific use and the format of the assay, different substrates can be used. While most enzyme immunoassays use substrates that result in colored soluble substrate, the filterbased assays and the in situ hybridization assays are often performed using substrates that result in a colored precipitate after dephosphorylation. The substrate systems resulting in a colored soluble end product after dephosphorylation are para-nitrophenyl phosphate and the amplified enzyme cascade system based on nicotinamide-adenine dinucleotide phosphate (NADP) (ELISA Amplification System, Life Technologies/BRL; Gaithersburg Maryland). These substrates have been widely used in enzyme immunoassays (Self, 1985; Stanley et al., 1985; Matthews and Kricka, 1988) or solution hybridization assays formatted to resemble immunoassays (Rashtchian et al., 1990). The most widely used colorimetric substrate system for detection of nucleic acids is 5-bromo-4-chloro-3-indolylphosphate (BCIP) (McGadey, 1970). Reaction of this substrate with alkaline phosphatase produces a colored precipitate resulting from dephosphorylation of BCIP and subsequent oxidation with the dye nitroblue tetrazolium (NBT). The insolubility of the dephosphorylated product is ideal for the detection of nucleic acids on membranes and in situ hybridization procedures. For this reason, use of NBT/BCIP has become standard for nonradioactive detection of nucleic acids.
C. D e t e c t i o n of Nucleic Acids on Membranes Membrane hybridization is one of the most important techniques in molecular biology (Maniatis et al., 1982). The initial report of membrane hybridization in its modern form was by Southern (1975), who transferred DNA from agarose gels to nitrocellulose membranes. Since then a wide variety of methods have been developed for transfer of nucleic acids to membrane filters. These include methods for transfer of RNA (Alwine et al., 1977), and transfer of nucleic acids from bacterial colonies and bacteriophage plaques (Grunstein and Hogness, 1975) to membranes for subsequent analysis by hybridization. In addition, a variety of membranes suitable for hybridization have been developed, and have further advanced the technique of membrane hybridization. These include charged and uncharged nylon membranes as well as supported nitrocellulose. Blotting procedures and properties of membranes have been reviewed by Maniatis et al. (1982).
6. Detection of Alkaline Phosphatase by Colorimetry
169
III. HYBRIDIZATION OF BIOTINYLATED PROBES Methods for hybridization of biotinylated DNA probes to membranebound DNA are essentially the same as those with radioisotope-labeled probes. Although the hybridization kinetics of biotinylated and radiolabeled probes are virtually identical (Langer et al., 1981; Leary et al., 1983), the melting temperature (Tm)of biotinylated probes is lower (Leary et al., 1983). The hybridization principles and factors affecting hybridization have been extensively reviewed by Maniatis et al. (1982) and by Meinkoth and Wahl (1984). Leary et al. (1983) have adapted the hybridization technique of Wahl et al. (1979) for use with biotinylated DNA probes. A modification of these procedures is described below for nonradioactive detection using biotinylated probes.
A. Reagents Prehybridization solution
50% formamide 5 • SSC 5 • Denhardt's solution 25 mM sodium phosphate, pH 6.5 0.5 mg/ml freshly denatured herring sperm DNA Hybridization solution
45% formamide 5 • SSC 1 • Denhardt's solution 20 mM sodium phosphate, pH 6.5 0.2 mg/ml freshly denatured sheared herring sperm DNA 5% dextran sulfate 0.1 to 0.5/zg/ml freshly denatured probe DNA 20 • S S C
3 M sodium chloride 0.3 M sodium citrate pH adjusted to 7.0 50 • Denhardt' s Solution
1% (w/v) Ficoll 1% (w/v) polyvinylpyrrolidone 1% (w/v) bovine serum albumin, Fraction V Denatured sheared herring sperm D N A (10 mg/ml)
Dissolve 250 mg herring sperm DNA in 25 ml water and allow to mix gently at 4~ overnight. Bring solution to room temperature and add to
170
Ayoub Rashtchian
50-ml syringe with plunger removed and an 18-gauge needle attached. Insert plunger all the way into syringe to force the DNA through the needle and shear the DNA. Repeat this procedure four times. Transfer the DNA to a glass tube and insert into boiling water bath for 10 min, cool on ice, and repeat. Store DNA in aliquots at -20~
B. Hybridization Protocol for Nitrocellulose Membranes
1. After Southern blotting, bake the filter for 1 to 2 hr at 80~ under vacuum. 2. Soak the filter in 2 x SSC until uniformly hydrated. 3. For prehybridization of the filter, denature the sheared herring sperm DNA by heating in a boiling water bath for 10 min followed by chilling on ice. Add the freshly denatured cartier DNA to the remaining prehybridization solution, mix and place in a hybridization bag along with the filter. Incubate the filter at 42~ in the sealed polypropylene bag with prehybridization solution for 2 to 4 hr. The volume of prehybridization solution used should be at least 20 to 100/zl per cm 2 of the filter. 4. For hybridization, heat-denature the probe and the herring sperm DNA for 10 min in a boiling water bath followed by chilling on ice. Add the denatured DNA to the hybridization solution just before use. Remove the prehybridization solution from the bag, and add the hybridization solution to the filter (20 to 100/zl per cm2), remove air bubbles, and heat-seal bag. At probe concentrations of 100 ng/ml, the filter should be hybridized at 42~ overnight to achieve maximal sensitivity (Langer et al., 1981). 5. The posthybridization washes are performed as follows: 9 Wash filters in 250 ml of 20• SSC/0.1% (w/v) SDS for 3 min at room temperature (20~ Repeat once. 9 Wash filters in 250 ml of 0.2 • SSC/0.1% (w/v) SDS for 3 min at room temperature. Repeat once. 9 Wash filters in 250 ml of 0.16• SSC/0.1% (w/v) SDS for 15 min at 50~ Repeat once. 9 Briefly rinse filters in 2 • SSC at room temperature. At this point the filter is ready for detection of the hybridized probe.
6. Detection of Alkaline Phosphatase by Colorimetry
171
C. Hybridization Protocol for Nylon Membranes The protocol described for the detection of DNA on nitrocellulose filters may also be used on nylon filters, but parameters will vary with the type of membrane being used. We have found that with Biodyne A membranes, the addition of 5% dextran sulfate and 0.5% SDS in both the prehybridization and hybridization solutions decreases background and increases the sensitivity of the detection. Also, increased temperatures are required in the final posthybridization wash (e.g., 65~ Other brands of nylon membranes also give satisfactory results. The sensitivity limits for detection of DNA on nylon membranes are equivalent to those obtained with nitrocellulose membranes, but higher backgrounds are sometimes observed.
D. Reuse of Hybridization Mixture The hybridization mixture containing the biotin-labeled probe may be reused. Store the mixture at +4~ for several days or at -20~ for longer periods. The probe should be denatured by placing the hybridization solution in a boiling water bath and cooling on ice just before use.
IV. DETECTION OF BIOTINYLATED PROBES The colorimetric detection of biotinylated DNA is achieved by reaction of a streptavidin-alkaline phosphatase conjugate with biotinylated DNA and subsequent detection of alkaline phosphatase with the colormetric substrate system, BCIP and NBT. The following procedure is used for detection of biotinylated probe hybridized to DNA on membrane filters such as Southern or dot blots. This procedure is based on use of the BluGene Nonradioactive Detection Systems (Life Technologies/BRL, Gaithersburg, Maryland).
A. Reagents The following reagents are provided with the BluGene Nonradioactive Detection System.
! 72
Ayoub Rashtchian
1. Streptavidin-alkaline phosphatase (SA-AP) conjugate (1 mg/ml) in 3 M NaCI, 1 mM MgCI2, 0.1 mM ZnCI2, 30 mM triethanolamine (pH 7.6); 2. NBT (75 mg/ml) in 70% dimethylformamide; and 3. BCIP at a concentration of 50 mg/ml in dimethyl formamide. The following buffers are required for colorimetric detection using the BluGene Systems and should be prepared by the user before start of the procedure. Buffer 1 Buffer 2 Buffer 3 20 x SSC 5% (w/v) SDS
0.1 M Tris-HCl (pH 7.5), 0.15 M NaCI. 3% (w/v) bovine serum albumin (Fraction V) in Buffer 1 (3 g BSA/100 ml Buffer 1). 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCI, 50 mM MgC12. 3.0 M NaCI, 0.3 M sodium citrate (pH 7.0). SDS, 5 g/100 ml.
B. P r o c e d u r e Caution: Always wear gloves when handling filters and avoid excess pressure on filters. Points of contact will develop higher background color. Always handle the filters at the edges.
1. Wash and/or rehydrate filter for 1 min in Buffer 1. 2. Incubate filter for 1 hr at 65~ in Buffer 2. Note: If the temperature exceeds 65~ the BSA in Buffer 2 might gel. This will not affect the sensitivity of the detection. This incubation may be performed in a sealed hybridization bag, or in a suitable tray. 3. If it is desired to store the filters at this stage, follow steps 4 and 5. Otherwise proceed to step 6. 4. Gently blot filter between two sheets of 3 MM paper and dry the filter in vacuum oven at 80~ for 10 to 20 min. 5. Dried filters may be stored desiccated for months. 6. Thoroughly rehydrate filter in Buffer 2 for 10 min. Drain buffer. 7. In a polypropylene or siliconized glass tube, dilute (immediately before use) an appropriate volume of BRL streptavidin-alkaline phosphatase (SA-AP) conjugate to 1.0 /zg/ml by adding 1 /zl stock (1.0 mg/ml) solution per 1.0 ml of Buffer 1. Prepare approximately 7.0 ml solution per 100-cm z filter. Incubate filter in diluted SA-AP conjugate for 10 min with gentle agitation, occasionally pipetting solution over filters.
6. Detection of Alkaline Phosphatase by Colorimetry
173
8. Decant the conjugate solution and wash filter with Buffer 1 using at least 20- to 40-fold greater volume of Buffer 1 than employed in step 7. Gently agitate filter for 15 min in Buffer 1. Decant solution and repeat this wash one more time. 9. Wash the filter once in Buffer 3 for 10 min. 10. In a polypropylene or glass tube, prepare approximately 7.5 ml of dye solution per 100-cm 2 filter. The dye solution is prepared by adding 33/A NBT solution to 7.5 ml Buffer 3, gently mixing (by inverting the tube) and adding 25/zl BCIP solution, followed by gentle mixing. The dye solution should be freshly prepared just before use. 11. Incubate filter in the dye solution within a sealed hybridization bag or in a fiat dish. Allow color development to proceed in the dark or in low light for 30 min to 3 hr. Maximal color development usually is obtained within 3 hr. Longer incubations may result in increased background. 12. Wash filters in 20 mM Tris (pH 7.5)/0.5 mM Na2EDTA (ethylenediaminetetraacetic acid) to terminate the color development reaction. Filters should be stored dry and should always be protected from strong light. To dry, bake at 80~ in vacuum oven for 1 to 2 min. 13. Nitrocellulose filters cannot be reused because the dyes, NBT and BCIP, appear to bind irreversibly to the nitrocellulose. The dyes can be removed from nylon filters. A procedure for reprobing has been described by Gebeyehu et al. (1987). 14. The bands on the dried nitrocellulose filters may be scanned by laser densitometry; both nylon and nitrocellulose filters may be photographed using a Kodak No. 5 yellow filter, or photocopied. Photocopying may be enhanced by using a yellow or blue transparency (those normally used in overhead projectors) between the filter and the photocopying machine.
V. IN SITU HYBRIDIZATION In situ hybridization has become an important tool in cellular and molecular biology. Conventional filter and solution hybridation methodologies rely on isolation of nucleic acids from a population of cells, thereby averaging the information from each individual cell with the total contribution of all cells. However, in situ hybridization provides a tool for studying the molecular information of individual cells within a tissue or cell popula-
174
Ayoub Rashtchian
tion. This also allows the investigator to correlate the molecular information with the morphological markers in individual cells. In situ hybridization has been used extensively to reveal information regarding expression of particular genes (Lawrence and Singer, 1986), the presence of infectious agents (Hasse, et al. 1984), or the location of particular genes in chromosomes (Lawrence et al., 1990). Both radioactive and nonradioactive probes have been utilized for in situ hybridization, (Singer et al., 1987). Biotinylated probes are the most widely used nonradioactive system. In brief, a biotin-labeled probe is hybridized to target DNA or RNA in cells or tissues in situ on a microscope slide. A signaling group (alkaline phosphatase) covalently attached to streptavidin is then bound to the biotinylated probe. The hybridized probe is detected by incubating the samples with dye substrates for alkaline phosphatase, NBT and BCIP. Formation of a purple signal indicates the location of the hybridized probe.
A. Design and Execution of in Situ Hybridization Experiments The methods described below for use of biotinylated probes and streptavidin-alkaline phosphatase conjugate in in situ hybridization is based on a commercially available kit (in situ Hybridization and Detection System, Life Technologies/BRL, Gaithersburg, Maryland). A variety of factors affect the quality of results in in situ hybridization assays.
1. OptimizingTissue Fixation Selecting appropriate conditions for fixing tissue is essential. A number of fixatives have been used successfully, including cross-linking agents, such as paraformaldehyde and glutaraldehyde, and precipitating agents such as ethanol/acetic acid. None of these agents has proved to be universally acceptable. The fixative that works best varies from tissue to tissue, and must be determined empirically. It is also important to determine the optimal length of the fixation step by investigating several time points for each new sample type. It is important to evaluate retention of cellular morphology and level of hybridization signal for each time point. Several recent reviews on in situ hybridization (Singer et al., 1986, 1987; Smith, 1987) are available, and provide detailed information for optimization of in situ hybridization assays.
6. Detection of Alkaline Phosphatase by Colorimetry
175
2. Slide Preparation Retention of cells on the slides requires pretreating the slides with an appropriate agent for increasing cell adhesion. The pretreatment process is known as subbing the slides. Samples often are lost from unsubbed slides, particularly during the hybridization step. A number of subbing agents have been used successfully, including gelatin, poly-L-lysine, and 3-aminopropyltriethoxysilane (AES) (Aldrich Chemical Company). Treatment of slides with AES, as outlined below, has generally been found satisfactory.
1. 2. 3. 4.
5. 6. 7. 8. 9.
Wash slides in soapy water. Rinse slides thoroughly in tap water. Rinse slides in distilled water. Dry slides in dust-free area. CAUTION: Before proceeding, be sure that slides are completely dry. In a clean, dry staining dish, dip slides in 2% AES in acetone for 2 min. Rinse slides in two changes of distilled water. Dry slides at 37~ for 2 hr. The treated slides can be stored at room temperature. Handle slides only at the comers.
3. Deproteinization The deproteinization step exposes the nucleic acid target molecules for hybridization. The amount of protein that must be removed depends on the tissue involved, the fixative used, and the target chosen (for example, DNA or RNA, nuclear or cytoplasmic). Excessive removal of protein may also release the target nucleic acids from the slide, especially with mRNA targets. Most in situ hybridization protocols use either proteinase K or 0.2 M HCI as deproteinizing agents. In most cases, proteinase K is satisfactory. For all deproteinizing agents, it is essential to run a series of test slides at varying digestion times and concentrations of deproteinizing agent. These slides should be evaluated for retention of morphology and hybridization signal. Since the time of digestion is a crucial factor, the digestion should be stopped promptly by rinsing the slides thoroughly in multiple changes of PBS.
176
Ayoub Rashtchian
4. Probe Preparation and Hybridization A number of schemes have been used for the synthesis of biotinylated probes (Forster et al., 1985; Sheldon et al., 1986; Singer et al., 1987). For a biotinylated probe to be suitable for an in situ hybridization, it must meet the following criteria: (1) The number of biotin groups must give optimal signal without reducing the hybridization rate; (2) The probe must be small, 20 to 500 bases in length; (3) The linker arm between the probe and the biotin groups must be long enough to allow efficient binding of streptavidin. The BioNick Labeling System (Life Technologies/BRL, Gaithersburg, Maryland) has been optimized to meet these criteria. Contaminants and unincorporated dNTPs in the probe preparation can cause high backgrounds. Purification ofbiotinylated probes by gel filtration on Bio-Gel P60 (from Bio-Rad Laboratories) in 10 mM Tris-HCl (pH 7.5), 1 mM EDTA is recommended. For interpretation of results, proper hybridization temperature is critical. If the temperature is too low, the probe will hybridize nonspecifically, which will increase the background. On the other hand, too high hybridization temperatures will decrease the signal, and may cause loss of tissue morphology. Good results generally can be obtained with the recommended hybridization solutions (see below) at 42~ For particular applications, the optimal hybridization temperature may vary from 37~ to 50~
5. Detection Since the in situ methodology described here utilizes alkaline phosphatase as the signaling group, endogenous phosphatase can mask the hybridization signal. Certain tissues are high in endogenous phosphatase activity; it is, therefore, important to measure any endogenous activity with a control slide without the streptavidin-alkaline phosphatase conjugate. Endogenous phosphatase activity is reduced by baking the slide before hybridization (see Protocol for DNA Detection, Section V, C). If any phosphatase remains, it can usually be inhibited by adding 200 /zg/ml levamisole to the alkaline-substrate solution. At that concentration, levamisole is a potent inhibitor of many endogenous alkaline phosphatases, but it has no effect on the streptavidin-alkaline phosphatase conjugate.
6. Counterstaining Slides may be counterstained with nuclear fast red, methyl green, or acridine orange. This allows negative cells to be visualized and aids in identification of particular cell types.
6. Detection of Alkaline Phosphatase by Colorimetry
177
B. Reagents The following reagents are provided with the in situ Hybridization and Detection System (Life Technologies/BRL, Gaithersburg, Maryland). 4• SSC, 0.2 M sodium phosphate (pH 6.5), 2 • Denhardt's solution 20% (w/v) dextran sulfate in for20% Dextran sulfate mamide 50 mg/ml protein in 100 mM TrisBlocking solution HC1 (pH 7.8), 150 mM NaCI 40 /zg/ml in conjugate dilution Streptavidin-alkaline phosphatase buffer conjugate 100 mM Tris-HCl, 150 mM Conjugate dilution buffer MgCI2, 10 mg/ml bovine serum albumin 75 mg/ml NBT in 70% (v/v) diNitroblue tetrazolium (NBT) methylformamide 4-Bromo-5-chloro-3-indolylphosphate 50 mg/ml in 100% dimethylformamide (BCIP) adenovirus type 2-infected HeLa Control slides cells, paraffin-embedded biotinylated adenovirus type 2 Positive control probe DNA in 2 • hybridization buffer
2 x Hybridization buffer
The following reagents or materials are not included and need to be obtained before start of experiments. Treated microscope slides Coplin jars or staining dishes Xylene 2 x SSC (300 mM NaC1, 30 mM sodium citrate, pH 7.0) Phosphate-buffered saline (PBS) (137 mM NaC1, 2.7 mM KC1, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4) 40/zg/ml proteinase K 4% (w/v) paraformaldehyde in PBS 50% (v/v) ethanol 70% (v/v) ethanol 90% (v/v) ethanol 100% ethanol Biotinylated DNA or RNA probe
178
AyoubRashtchian
Heating block set at 100~ Rubber cement Glass coverslips Hybridization oven, adjustable from 37~ to 65~ Tris-buffered saline (TBS) (100 mM Tris base, 150 mM NaCI, pH 7.5) Alakaline substrate buffer (100 mM Tris base, 150 mM NaC12, pH 9.5) Mounting medium
C. Protocol for DNA Detection The protocol has been optimized for the detection of DNA in the positive control slides provided with the in situ hybridization and detection kit. This general method may need further optimization in the pretreatment and hybridization steps.
Pretreatment 1. Label the side of the slide containing the tissue section with a diamond pen or other permanent marker. For the initial experiment, include three control slides. 2. Bake the slides, including the control slides, at 65~ for 1 hr to firmly bind the sections to the slide and to melt the paraffin of paraffin-embedded sections. If sections are not paraffinembedded, go directly to step 4. 3. For the control slides and other paraffin-embedded sections, deparaffinize in two changes of xylene for 5 min each. Immerse slides in two changes of absolute ethanol for 1 min each. Air dry sections for 5 to 10 min. 4. If your tissue contains mRNA complementary to your probe, and hybridization to mRNA is not desired, the RNA may be removed by incubating slides in 40/zg/ml RNase A in 2 x SSC at 37~ for 1 hr. To prevent contamination of glassware with RNase, mark the container used for this step and use it solely for this purpose. Use sufficient RNase A solution to cover the slides. Rinse slides in PBS. 5. Incubate slides in prewarmed 40/zg/ml proteinase K in PBS at 37~ making certain that the slides are completely covered. For the control slides, remove one slide after 5 min incubation, one after 10 min incubation, and one after 20 min incubation. Rinse each slide in PBS immediately after removing it from the proteinase K solution.
6. Detection of Alkaline Phosphatase by Colorimetry
6. Immerse slides in fresh 4% paraformaldehyde in PBS at room temperature for 1 min. Rinse slides in PBS. 7. Dehydrate sections through a graded ethanol series (3 min each in 50%, 70%, 90% and 100% ethanol). Air dry at room temperature for 5 to 10 min.
Hybridization 1. Probe DNA should be precipitated by ethanol and dissolved at twice the desired final concentration in 2 x hybridization buffer. Final probe concentrations should be between 0.1 and 0.5/zg/ml. Mix 25/xl of this solution with 25 ~1 of 20% dextran sulfate solution for each slide to be probed. 2. Add 50/zl of probe solution to the appropriate section and cover with a coverslip. Be careful not to trap bubbles under the coverslip. 3. Denature the target and probe DNA by placing the slides flat on a heating block prewarmed to 100~ Incubate for 5 min. 4. Slides may be hybridized from 3 hr to overnight. For overnight hybridization, seal the slide and coverslip with rubber cement by dripping rubber cement around the edge of the coverslip, being careful not to touch or jar the coverslip. Allow the rubber cement to dry for a few minutes before starting the incubation. Transfer the slides to a humid chamber and incubate at 42~ 5. After hybridization, carefully remove rubber cement with forceps. Remove the coverslips and rinse the slides by immersing them in three changes of 0.2 x SSC, using a minimum of 10 ml per slide. Be careful to avoid damaging the tissue section with the coverslip. 6. Wash the slides two times with 0.2 x SSC, using a minimum of 10 ml per slide at room temperature for 15 rain each.
Detection 1. Place the slides flat in the humid chamber. Cover each section with 100 to 300/zl of blocking solution. Incubate at room temperature for 15 min. 2. Prepare a working conjugate solution by mixing 10 ~1 of streptavidin-alkaline phosphatase conjugate with 90/xl of conjugate dilution buffer for each slide. 3. Remove the blocking solution from each slide by touching absorbent paper to the edge of the slide. 4. Cover each section with 100/zl of working conjugate solution and incubate it in the humid chamber at room temperature for 15 min.
179
180
AyoubRashtchian
NOTE: Do not allow the sections to dry out after adding the conjugate. 5. Wash the slides twice in TBS for 15 min each at room temperature using a mimimum of 10 m| per slide. 6. Wash slides once in alkaline-substrate buffer at room temperature for 5 min using a minimum of l0 ml per slide. 7. Prewarm 50 ml alkaline-substrate buffer to 37~ in a Coplin jar. Just before adding the slides, add 200/~l NBT and 166/.~l BC1P. Mix well. 8. Incubate slides in the NBT/BCIP solution at 37~ until the desired level of signal is achieved (from l0 min to 2 hr). Check the color development periodically by removing a slide from the NBT/BCIP solution, coveting the section and residual solution with a coverslip, and observing the section under the microscope. Be careful not to allow the sections to dry. 9. Stop the color development by rinsing the slides in several changes of deionized water. The sections may be counterstained at this point. 10. Dehydrate the sections through a graded ethanol series (50%, 70%, 90%, 100%) for 1 min in each concentration. Air dry at room temperature. 11. For permanent mounting, use a nonxylene medium such as Crystalmount available from Biomeda Corp. (Foster City, California).
D. Detection of RNA Targets Detection of RNA targets in situ requires optimizing the fixation, pretreatment, and hybridization steps specifically for RNA. Pretreatments that are optimal for exposure of DNA targets may be too harsh and may result in loss of RNA from the sample (Singer et al., 1986). Shortening or eliminating the proteinase K step, using an alternate pretreatment, or using a different fixation method may be necessary for optimal exposure and retention of the RNA target (see Singer et al., 1986, 1987). Steps must be taken to protect the samples from RNases. The following general precautions should be observed when working with RNA. Wear latex gloves at all times, including during preparatory steps, such as preparing solutions and washing glassware. Practice good microbiological technique to prevent microbial contamination of reagents and utensils. Treat solutions used before the hybridization step with 0.1% diethylpyr-
6. Detection of Alkaline Phosphatase by Colorimetry
181
ocarbonate (DEPC). Add the DEPC to the solution and leave at room temperature for 12 hr. Destroy the remaining DEPC by autoclaving for 15 min. Bake glassware at 200~ for 8 hr before using (sterile disposable plasticware is generally RNase-free and can be used without treatment). Proteinase K must be nuclease-free: predigest the proteinase K by incubating at 37~ for 40 min before using.
Hybridization and Detection The hybridization protocol described for DNA targets can be used for RNA targets with the following modifications.
1. Prepare the probe solution by ethanol precipitating and dissolving at 2.5 times the desired final concentration in 2 • hybridization buffer. Final probe concentrations should range from 0.1 to 0.5/zg/ml. Mix 25/xl of this solution with 31/zl of 20% dextran sulfate solution for each slide to be probed. Denature the probe by boiling for 5 to 10 min. Chill on ice. Add 6/zl of 200 mM vanadyl ribonucleoside complex for each slide to be probed. 2. When detecting RNA targets, only the probe must be denatured, and slides are not placed on the 100~ heat block. All other steps in the hybridization and detection are identical to DNA detection.
VI. C O N C L U S I O N S Since nonradioactive methods for the detection of nucleic acids were described, a variety of labeling systems have been developed. Labeling of DNA with biotin still remains to be the major nonradioactive method in the research laboratory. Colorimetric detection of biotin-labeled probes is most often accomplished with use of alkaline phosphatase conjugates with NBT/BC1P. This technology is an effective nonradioactive method for most molecular biology applications. A chemiluminescent method for detection ofbiotinylated probes has been described, and commerical products based on this detection are available (PhotoGene, Life Technologies/ BRL). However, the colorimetric method remains the only nonradioactive detection method suitable for in situ hybridization applications. Considerable progress has been made in sensitivity and simplicity of nonradioactive detection technology, and this trend is expected to continue. These improvements have made nonradioactive detection technology a good substitute for the isotopic detection methods used in research and clinical laboratories.
182
Ayoub Rashtchian
ACKNOWLEDGMENTS I would like to thank all my colleagues, especially Lenny Klevan, Dave Carlson, Mary Gaskill, and Gulilat Gebeyehu. I thank Jesse Mackey for constructive suggestions about the manuscript and Kathleen Blair for typing the manuscript.
REFERENCES Alwine, J. D., Kemp, D. J., and Stark, G. R. (1977). Methods for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl paper and hybridization with DNA probes. Proc. Natl. Acad. Sci. U.S.A. 74, 5350-5354. Brenner, D. J. (1989). DNA hybridization for characterization, classification and identification of bacteria. In (B. Swaminathon and G. Prakash, (eds.). pp. 75-104. II Nucleic Acid and Monoclonal Antibody Probes, Applications in Diagnostic Microbiology. ~l Marcel Dekker, New York. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. (Addendum Anal. Biochem. 137, 266-267. Forster, A. C., Mclnnes, J. L., Skingle, D. C., and Symona, R. H. (1985). Non-radioactive hybridization probes prepared by the chemical labeling of DNA and RNA with a novel reagent, photobiotin. Nucleic Acids Res. 13, 745-761. Gebeyehu, G., Rao, P. Y., SooChan, P., Simms, D. A., and Klevan, L. (1987). Novel biotinylated nucleotide--analogs for labelling and calorimetric detection of DNA. Nucleic Acids Res. 15, 4513-4534. Grunstein, M., and Hogness, D. (1975). A method for the isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad. Sci. U.S.A. 72, 3961-3966. Hasse, A. T., Brakic, M., Stowring, L., and Blum, H. (1984). Detection of viral nucleic acids by in situ hybridization. Methods Virol. 7, 189-226. Jablonski, E., Moomaw, E. W., Tullis, R. H., and Ruth, J. L. (1986). Preparation of oligodeoxynucleotide-alkaline phosphatase conjugates and their use as hybridization probes. Nucleic Acids Res. 14, 6114-6128. Langer, P., Waldrop, A., and Ward S. (1981). Enzymatic synthesis of biotin-labeled polynucleotides: Novel nucleic acid affinity probes. Proc. Natl. Acad. Sci. U.S.A. 18, 6633-6637. Lawrence, J. B., Singer, R. H., and McNeil, J. A. (1990). Interphase and metaphase resolution of different distances within the human dystrophin gene. Science 249, 928-932. Lawrence, J. B., and Singer, R. H. (1986). lntracellular localization of messenger RNA for cytoskeletal proteins. Cells 45, 407-415. Leary, J. J., Brigati, D. J., and Ward, D. C. (1983). Rapid and sensitive colorimetric method for visualizing biotin-labeled DNA probes hybridized to DNA or RNA immobilized on nitrocellulose: Bio-blots. Proc. Natl. Acad. Sci. U.S.A. 80, 4045-4049. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Matthews, J. A., and Kricka, L. J. (1988). Analytical strategies for the use of DNA probes. Anal. Biochem. 169, 1-25. McGadley, J. (1970). A tetrazolium method for non-specific alkaline phosphatase. Histochemie 23, 180-184. Meinkoth, J., and Wahl, G. (1984). Hybridization of nucleic acids immobilized on solid supports. Biochemistry 138, 267-284.
6. Detection of Alkaline Phosphatase by Colorimetry
183
Rashtchian, A., Schuster, D., Buchman, G., Berninger, M., and Temple, G. F. (1990). A non-radioactive sandwich hybridization assay using paramagnetic microbeads and unlabeled RNA probes. Abstracts o f 6th International Congress on Rapid Methods and Automation in Microbiology and Immunology. Helsinki, Finland. Renz, M., and Kurz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Self, C. H. (1985). Enzyme amplification, a general method applied to provide an immunoassisted assay for placental alkaline phosphatase. J. Immunol. Methods. 76, 389-393. Sheldon, E. L., Kellogg, D. E., Watson, R., Levenson, C. H., and Erlich, H. A. (1986). Use of nonisotopic M13 probes for genetic analysis: Application to HLA Class II loci. Proc. Natl. Acad. Sci. U.S.A. 83, 9085-9089. Singer, R. H., Lawrence, J. B., and Rashtchian, R. N. (1987). Toward a rapid and sensitive in situ hybridization methodology using isotopic and nonisotopic probes. In l~ In Situ Hybridization: Application to the Central Nervous System ~l (K. Valentino, J. Eberwine, and J. Barchas, eds.), pp. 71-96. Oxford University Press, New York. Singer, R. H., Lawrence, J. B., and Villnave, C. (1986). Optimization of in situ hybridization using isotopic and non-isotopic detection methods. BioTechniques 4, 230-250. Smith, G. H., (1987). In situ detection of transcription in transfected cells using biotinlabeled molecular probes. Methods Enzymol., 151, 530-539. Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Stanley, C. J., Johannson, A., and Self, C. H. (1985). Enzyme amplification can enhance both the speed and the sensitivity of immunoassays. J. Immunol. Methods. 83, 89-95. Wahl, G. M., Stern, M., and Stark, G. R. (1979). Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethyl paper and rapid hybridization by using dextran sulfate. Proc. Natl. Acad. Sci. U.S.A. 76, 3683-3687.
Detection of Alkaline Phosphatase by Chemiluminescence Using NADP, Ascorbate, and lndolyl Phosphates Akio Tsuji, Masako Maeda, and Hidetoshi A r a k a w a School of Pharmaceutical Sciences Showa University Hatanodai, Shinagawa-ku, Tokyo 142, Japan
I. Introduction A. Chemiluminescent Assay of Alkaline Phosphatase Using NADP § B. Chemiluminescent Assay of Alkaline Phosphatase Using Ascorbic Acid 2-O-Phosphate C. Chemiluminescent Assay of Alkaline Phosphate Using Indolyl Phosphate II. Materials A. Reagents B. Instrumentation III. Procedures A. Chemiluminescent Assay of Alkaline Phosphatase 1. Method Using NADP§ as Substrate 2. Method Using Ascorbic Acid 2-O-Phosphate as Substrate 3. Two-Step Method Using 5-Bromo-4-chloro-indolyl 4. Phosphate as Substrate One-Step Method Using 5-Bromo-4-chloro-indolyl Phosphate as Substrate B. Preparation of Biotinylated DNA C. DNA Probe Assay IV. Discussion References
I. I N T R O D U C T I O N A sensitive assay of enzyme activity is very important for developing more sensitive enzyme immunoassays (EIA) and nonisotopic DNA probe assays using an enzyme as a label. Recently, highly sensitive chemilumiNonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
185
186
Akio Tsuji et al.
nescent (CL) and bioluminescent (BL) methods have become available for detecting alkaline phosphatase (ALP) labels used in EIA. The CL and BL assays use an adamantyl-1,2-dioxetane phosphate (Schaap et al., 1987; Bronstein et al., 1989) and firefly D-luciferin-O-phosphate (Miska et al., 1989), respectively, as substrate. This chapter describes three chemiluminescent (CL) assays of alkaline phosphatase (ALP) using NADP § ascorbic acid 2-O-phosphate, and indolyl phosphate as substrates, as well as their applications to enzyme immunoassays (EIA) and DNA probe assays.
A. Chemiluminescent Assay of Alkaline Phosphatase Using NADP + Bioluminescent methods are widely used for the assay of NADH and NADPH. Although the BL method is highly sensitive, the enzymes bacterial luciferase and FMN oxidoreductase are too unstable and expensive for routine assays. We have developed a highly sensitive CL method for NADH and NADPH detection based on a CL reaction using an electron mediator and the isoluminol microperoxidase system (Tanabe et al., 1987). Although the sensitivity of this method is superior to that of UV and fluorescent methods, it is not as sensitive as the B L method. To increase the sensitivity of this CL method it was coupled to the enzyme cycling reaction of NAD+/NADH (Kato et al., 1973; Tsuji et al., 1989). NADH amplified by the enzyme cycling reaction is measured by the CL method described already. Analogously, a CL method for the assay of ALP using NADP § as substrate has been developed (Maeda et al., 1989) and improved (Kawamoto et al., 1991). The detection limit of this method is 3.6 • 10 -20 mol/assay.
B. Chemiluminescent Assay of Alkaline Phosphatase Using Ascorbic Acid 2-O-Phosphate Lucigenin is one of the classical organic CL reagents; CL is produced by addition of either H20 2 or organic reducing compounds to an alkaline solution. As shown in Table I, the CL intensity depends on the reducing agent. These results suggest that an a-hydroxycarbonyl group is essential for the CL reaction of lucigenin with reducing compounds. There are marked differences in the CL intensity of lucigenin with various reducing sugars (Maeda et al., 1986; Veazey and Nieman, 1979; Veazey et al.,
7. Detection of ALP by ChemiluminescenceUsing NADP, Ascorbate, and Indolyl Phosphates
187
Table I Relative Chemiluminescenceof Various Compounds with Lucigenin Compound
CL intensity
Compound
CL intensity
Glucose Galactose Fructose Cortisol 11-Deoxycortisol
1.0 0.5 20.3 1300 1250
Tetrahydrocortisol Glyceraldehyde Glycolaldehyde Ascorbic acid Sorbitol
1210 192 108 737 0
1984). We presume that these differences arise from different rates of 1,2enediol formation which is oxidized by lucigenin in a subsequent reaction step. Based on these results, we selected glucose-1-phosphate, galactose1-phosphate, fructose-l,6-diphosphate, and ascorbic acid 2-O-phosphate as substrates for the CL assay of ALP (Maeda et al., 1991). The principle of the CL assay for ALP is shown in Fig. 1. Glucose, galactose, fructose, or ascorbic acid produced on dephosphorylation reacts with lucigenin in alkaline medium to emit light. The assay using ascorbic acid 2-O-phosphate was 10 times more sensitive and had a lower background than the other substrates. Therefore, ascorbic acid is used as the substrate for the CL assay of ALP. The detection limit of this method is 4 • 10 -2~ mol/assay.
~H2OH H~OH
~H2OH
V O .,,~0 ,.
Alkalinephosphatase
o
'
I
OH
Ascorbiacid c 2-O-phosphate
CH 3 Lucigenin
H(~OH I
OH
Ascorbiacid c
CH 3
ella
+ I Light I o Fig. 1---Principle of the chemiluminescent assay of alkaline phosphatase using ascorbic acid 2-O-phosphate as substrate.
188
Akio Tsuji et al.
C. Chemiluminescent Assay of Alkaline Phosphatase Using Indolyl Phosphate Indolyl derivatives are chromogenic substrates that have been used for the histochemical demonstration of endogenous enzymes. Several enzymes (ALP, fl-o-galactosidase, fl-glucosidase, esterase, and sulfatase) localized in tissue can be determined utilizing appropriate indolyl derivatives as substrates. The principle of this method is that the indolyl derivative produces an unstable intermediate indolyl by enzymatic hydrolysis, which results in the precipitation of an indigoid dye by aerobic oxidation (Holt, 1954). Recently, this method was enhanced by the use of a coupled reaction in which a nitro tetrazolium salt is reduced to a formazan dye. The enhanced methods for ALP and/3-galactosidase are used in nonisotopic hybridization assays (Leafy et al., 1983) and enzyme-linked immunoassay for antigens in cells (Nibbering et al., 1986). However, these colorimetric assays of the enzymes immobilized on cellulose or in cells are not quantitative and are not sensitive. Cotson and Holt (1958) reported that aerobic oxidation of indolyls to indigo dyes was a free radical reaction involving the intermediate formation of leucoindigo, in which approximately one hydrogen peroxide molecule is formed for every molecule of indolyl oxidized. Therefore, we devised a CL assay of various enzymes using the CL reaction of luminol after enzymatic hydrolysis of indolyl derivatives. The CL reaction of this system is shown in Fig. 2. The detection limits of ALP, fl-o-galactosidase, and fl-glucosidase are 1 • 10-19, 1 • 10-19, and 5 • 10 -16 mol/assay, respectively.
CI
CI
Br..
--O--R
Enzyme
= H202 -I.-Br
H
0 C~C--C
~~J~-N
H
H Br-t-R-OH
/ ~
0
Cl
m-POD H202 -Jr-
Isoluminol
=
Chemiluminescence
R : Phosphate(BCIP) for Alkaline phosphatase R : B-D-Galactopyranoside(X-gal) for 8-D-Galactosidase R " B-O-Glucopyranoside for B-Glucosidase
Fig. 2---Principle of the chemiluminescent assay system for various enzymes using indolyl derivatives as substrates. R: phosphate for ALP, fl-o-galactopyranoside for fl-Ogalactosidase, and fl-o-glucopyranoside for fl-D-glucosidase.
7. Detection of ALP by ChemiluminescenceUsing NADP, Ascorbate, and Indolyl Phosphates
189
II. MATERIALS A. R e a g e n t s Lucigenin and isoluminol are obtained from Tokyo Chemical Industry Co. (Tokyo, Japan). NADP § , ALP, alcohol dehydrogenase, malate dehydrogenase, and glutamic-oxaloacetic transaminase are purchased from Boehringer-Yamanouchi Co. (Tokyo, Japan). Microperoxidase (m-POD), Ficoll (Type 400), and dextran sulfate (MW : 5000) are obtained from Sigma Chemical Co. (St. Louis, Missouri, USA). Ascorbic acid 2-O-phosphate, glutaraldehyde, polyvinylpyrrolidone (PVP), and bovine serum albumin (BSA) are available from Wako Pure Chemical Co. (Osaka, Japan). 5Bromo-4-chloro-3-indolyl phosphate (BCIP), 5-bromo-4-chloro-3-indolyl fl-D-galactoside (BCI-Gal), 5-bromo-4-chloro-3-indolyl fl-D-glucoside (BCIG), and 3-indolyl phosphate disodium salt are also available from Wako Pure Chemical Co. Biotin hydrazide and avidin conjugate are available from Bio-Yeda Ltd. (Rehout, Israel) and biotin-X-hydrazide from Calbiochem Co. (La Jolla, California, USA). 1-Methoxy-5-methylphenazinium methylsulfate (1-MPMS) and all other chemicals are analytical reagent grade.
B. I n s t r u m e n t a t i o n The Luminescence Reader BLR-301 (Aloka Co., Tokyo, Japan) is used for single channel measurement of CL. The Lumino Reader MLR-100 (Corona Electric Co., Tokyo, Japan) is used for measuring light emitted from microtiter plates (MTP). Photon imaging detection is performed using a Hamamatsu Photonics ARGUS-50/MP (Hamamatsu Photonics Co., Hamamatsu, Japan).
III. PROCEDURES A. C h e m i l u m i n e s c e n t A s s a y of Alkaline P h o s p h a t a s e iiiiii
i
1. Method Using NADP § as Substrate 1. Add 10 /xl 0.1 mM NADP + solution (50 mM diethanolamine buffer, pH 9.5) to the assay tube containing 5/xl ALP solution (0.05 M PBS containing 0.1% BSA, pH 9.5).
190
Akio Tsuji et al.
2. Incubate the sample solution at 37~ for 60 min. 3. Add 100/xl enzyme solution (0.08 mg/ml alcohol dehydrogenase, 0.375% ethanol, and 1.25 x 10- 5M 1-MPMS in 25 m M phosphate buffer, pH 7.0). 4. Incubate at room temperature for 20 min. 5. Stop the reaction by adding 20/xl 0.2 M H2SO 4. 6. Transfer 100/zl reaction solution to another tube containing 200/xl CL reagent solution (1 9 1, v/v mixture of 2.4 x 10 - 4 Misoluminol solution and 1 • 10 -6 M m-POD in carbonate buffer, pH 9.5). 7. Using a luminometer, measure the CL intensity for 6 sec after a 15-sec delay.
2. Method Using Ascorbic Acid 2-O-Phosphate as Substrate 1. Mix 50/xl ALP solution and 50/zl 1 • 10 -20 M ascorbic acid 2O-phosphate solution in 0.1 M Tris buffer (pH 9.8). 2. Incubate the sample at room temperature for 60 min. 3. Add 500/zl 6 • 10 -4 % lucigenin solution in 0.1 M KOH containing 1 • 10- 3 M Triton X- 100. 4. Using a luminometer, measure the CL intensity for l0 sec after a 15-sec delay.
3. Two-Step Method Using 5-Bromo-4-chloroindolyi Phosphate as Substrate 1. Add 100/xl 0.38 mM BCIP solution (or 0.2 mM IP) in 0.1 M TrisHCI buffer (pH 9.5) containing 0.1% BSA and 0.1 M MgCI2 to 10/zl ALP solution. 2. Incubate the sample at 37~ for 15 min-2hr. 3. Add 500/xl CL reagent solution (1.2 x 10 -4 M isoluminol and 5 x 10 -7 M microperoxidase in 0.4 M carbonate buffer, pH 9.5). 4. Measure the CL intensity for 6 sec after a delay of 15 sec.
4. One-Step Method Using 5-Bromo-4-chloroindolyl Phosphate as Substrate 1. Add 200 ~1 CL assay mixture (0.19 mM BCIP or 0.2 mM IP, 2.5 x 10 -4 M isoluminol, 5 U/ml HRP, 0.1% BSA, and 0.1 M MgCI2 in 0.1 M Tris-HCl buffer, pH 9.5) to 10 ~1 ALP solution. 2. Measure the CL intensity using an MTP-Reader (Hamamatsu Photonics). II
Ill
I I
7. Detection of ALP by ChemiluminescenceUsing NADP, Ascorbate, and Indolyl Phosphates
B. Preparation of Biotinylated DNA
1. Dilute the sample of DNA to be labeled to 1/zg/~l. 2. Boil double-stranded DNA for 5 min. The water bath should be boiling vigorously. 3. Cool on ice for 5 min. 4. Add 12.5/zl biotin hydrazide (or biotin-X-hydrazide) solution (10 mg/ml in H20) and 15/.d 5% glutaraldehyde solution to 25 ~1 heat-denatured DNA solution. 5. Incubate the sample at 37~ for 10 min. 6. Add 5.83 ~1 3 M sodium acetate solution and 146/zl cold ethanol to the reaction mixture. 7. Cool at -20~ overnight. 8. Centrifuge the labeled DNA for 5 min. 9. Wash the precipitate with 500/xl 80% ethanol. 10. Dry the precipitate in vacuum for 2 hr.
C. DNA Probe Assay
1. Denature the DNA solution at 95~ for 5 min. 2. Dilute the DNA solution with 0.1 M MgC12-phosphate buffer. 3. Incubate 200 ~l diluted DNA solution in a microtiter plate well at 4~ overnight. 4. Prehybridize with 200 /xl prehybridization solution (4 • SSC; 0.06% PVP, Ficoll, and BSA; calf thymus DNA, 50/xg/ml) at 65~ overnight. 5. Hybridize with 200~1 hybridization solution (10% dextran sulfate, 1/xl/ml biotinylated DNA probe) at 65~ overnight. 6. Wash with 250/zl 2 • SSC at 65~ for 30 min and 250/xl PBS (3 times). 7. Add ALP-labeled avidin solution (• 20,000) diluted with PBS and incubate at room temperature for 2 hr. 8. Wash with 250/xl PBS. 9. Measure the ALP-avidin bound to the hybridized DNA using the CL assay for ALP (see previous sections).
191
192
Akio Tsuji et al.
IV. DISCUSSION Various nonisotopic DNA probes for hybridization assays have been reported (Matthews et al., 1985). Among them, the biotin-labeled DNA probe is the most suitable one because of its stability, sensitivity, and detectability. In general, biotin-labeled probes have been prepared by the enzymatic incorporation of biotin derivatives of dUTP and UTP into DNA, or by photochemical reaction with a photoactivatable derivative of biotin, N-(4-azido-2-nitrophenyl)-N'-(N-d-biotinyl-3-aminopropyl)-N'methyl-l,3-propanediamine (photobiotin). The reagent is commercially available as an assay kit. However, the enzymatic labeling procedure requires different protocols and enzymes for different types of nucleic acids. Photobiotin must be protected from light before the coupling reaction. A chemical method for introduction of biotin into DNA based on the interaction of biotin hydrazide with unpaired cytosine residues has been developed (Reisfeld et al., 1987). Although the sensitivity of the biotinylated probe prepared by this method is as high as that of any of the previously designed probes, the labeling procedure is not simple because of the long labeling reaction time, the need for strict adjustment of pH, and the dialysis step for purification. Therefore, a simple, rapid, and inexpensive method for preparing a DNA probe is required for routine diagnostic nucleic acid hybridization assays. In a preliminary experiment, DNA probe was reacted with biotin-Nhydroxysuccinimide ester and caproylamido biotin-N-hydroxysuccinimide ester. A highly active DNA probe could not be obtained with these esters. The coupling reaction between nucleic acid amino groups and active esters of biotin derivatives seems to be very poor. We used biotin hydrazide derivatives as the hapten and glutaraldehyde as the coupling reagent (Arakawa et al., 1989). The biotin-labeled DNA prepared by this procedure is sensitive and does not inhibit the annealing between probe and complementary DNA. The hybridized biotin-labeled DNA probe could be detected using avidin-enzyme conjugates. Although the detection limits of hybridization assays using radioisotopes as the label reach attomole levels of DNA, a lengthy autoradiographic step is needed. HRP- and ALP-labeled probes can be detected by colorimetric methods, but the sensitivities are inferior to those of the radiometric method. Recently, CL assays have been used for hybridization assays using HRP and ALP as label; attomole detection limits attained are comparable to that of the radiometric method. The detection limits of the present hybridization assay using ALP as label also reached the attomole level using NADP § and BCIP. A comparison of the sensitivities of these methods are shown in Table II.
7. Detection of ALP by ChemiluminescenceUsing NADP, Ascorbate, and Indolyl Phosphates
193
Table 11
Detection Limits of Hybridized h Phage DNA Probes
Colorimetric Chemiluminescent
Labeled enzyme a
Substrate b
HRP ALP ALP ALP
H202/ABTS p-NP NADP + BCIP
Detection limit (mol) 250 pg 50 pg 1 pg 1 pg
(7.5 x 10-18) (15 • 10-19) (3 x 10-20) (3 x 10-20)
a HRP, Horseradish peroxidase; ALP, alkaline phosphate. b ABTS, 2,2'-Azino-di(3-ethylbenzthiazoline sulfate); p-NP, p-nitrophenyl phosphate; BCIP, 5-bromo-4-chloro-3-indolyl phosphate.
Photographic detection has often been used for blotting assays using either HRP (enhanced CL detection) or ALP (AMPPD substrate). The CL assay of ALP using the one-step method described here is suitable for photographic detection. ALP-catalyzed chemiluminescence from BCIP using the one-step method is constant for a prolonged period of time. Although this method is less sensitive (1/100) than the two-step method, 7 • 10-18 mol ALP could be detected using a photon counting and imaging camera system (Argus 50/MP, Hamamatsu Photonics Co.) Ascorbic acid 2-O-phosphate can also be used for DNA probe assays because the CL of lucigenin with ascorbic acid is long-lived.
REFERENCES Arakawa, H., Maeda, M., Tsuji, A., and Takahashi, T. (1989). Highly sensitive biotinlabelled hybridization probe. Chem. Pharm. Bull. 37, 1831-1833. Bronstein, I., Edwards, B., and Voyta, J. C. (1989). 1,2-Dioxetanes" Novel chemiluminescent enzyme substrates. Applications to immunoassays. J. Biolumin. Chemilumin. 4, 99-111. Cotson, S., and Holt, S. J. (1958). Studies in enzyme cytochemistry. IV Kinetics of aerial oxidation of indoxyl and some of its halogen derivatives. Proc. R. Soc. London B 148, 506-519. Holt, S. J. (1954). A new approach to the cytochemical localization of enzyme. Proc. R. Soc. London B 142, 160-169. Kato, T., Berger, S., Carter, J. A., and Lowry, O. H. (1973). An enzyme cycling method for NAD with malic and alcohol dehydrogenase. Anal. Biochem. 53, 86-97. Kawamoto, M., Arakawa, H., Maeda, M., and Tsuji, A. (1991). Sensitive chemiluminescence assay of NADH using enzyme cycling and its applications. B U N S K A K (J. Anal. Chem. Japan) 40, 537-542. Leafy, J. J., Brigati, D. J., and Ward, D. C. (1983). Rapid and sensitive colorimetric method for visualising biotin-labeled DNA probe hybridized to DNA or RNA immobilized on nitrocellulose; Bio-blots. Proc. Natl. Acad. Sci. USA 80, 4045-4049. Maeda, M., and Tsuji, A. (1986). Chemiluminescence flow injection analysis of biological compounds based on the reaction with lucigenin. Anal. Sci. 2, 183-186.
194
Akio Tsuji et al.
Maeda, M., Arakawa, H., and Tsuji, A. (1989). Chemiluminescent assay of various enzyme activities and its application to enzyme immunoassays. J. Biolumin. Chemilumin. 4, 140-148. Maeda, M., Tsuji, A., Yang, K. H., and Kamada, S. (1991). Chemiluminescent assay of alkaline phosphatase using ascorbic acid 2-O-phosphate as substrate and its application to chemiluminescent enzyme immunoassays. In"Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 117-122. Wiley, Chichester. Matthews, J. A., Batki, A., Hynds, C., and Kricka, L. J. (1985). Enhanced chemiluminescent method for the detection of DNA dot-hybridization assays. Anal. Biochem. 151, 205-209. Miska, W., and Geiger, R. (1989). Luciferin derivatives in bioluminescence--Enzyme immunoassays. J. Biolumin. Chernilumin. 4, 119-128. Nibbering, P. H., Marijnen, J. G., Raap, A. K., and Van Furth, R. (1986). Quantitative study of enzyme immunocytochemical reactions performed with enzyme conjugate immobilized on nitrocellulose. Histochemistry 84, 538-543. Reisfeld, A., Rothenberg, J. M., Bayer, E. A., and Wilchek, M. (1987). Nonradioactive hybridization probes prepared by the reaction of biotin hybridized with DNA. Biochem. Biophys. Res. Commun. 142, 519-526. Schaap, A. P., Sandison, M. D., and Handley, R. S. (1987). Chemical and enzymatic triggering of 1,2-dioxetanes. 3. Alkaline phosphatase-catalyzed chemiluminescence from an aryl phosphate-substituted dioxetane. Tetrahedron Lett. 28, 1159-1162. Tanabe, H., Kawasaki, H., Maeda, M., and Tsuji, A. (1987). Chemiluminescence assay for NADH and it application to determination of biological substances using 1-methoxy-5methylphenazinium methylsulfate and isoluminol. B U N S K A K (J. Anal. Chem. Japan) 36, 82-86. Tsuji, A., Maeda, M., and Arakawa, H. (1989). Chemiluminescent assay of co-factors. J. Biolumin. Chernilumin. 4, 454-462. Veazey, R. L., and Nieman, T. A. (1979). Chemiluminescent determination of clinically important organic reductants. Anal. Chem. 51, 2092-2096. Veazey, R. L., Nekiman, H., and Nieman, T. A. (1984). Chemiluminescent reaction of lucigenin with reducing sugars. Talanta 31, 603-606.
D e t e c t i o n of H o r s e r a d i s h P e r o x i d a s e by E n h a n c e d Che milu m i n e s ce nce I an Durr ant Research and Development Amersham International Amersham Laboratories Amersham, Buckinghamshire HP7911, United Kingdom
I. Introduction A. Labeling and Hybridization of Nucleic Acid Probes 1. Long Probes 2. Oligonucleotide Probes
B. Immunochemical Techniques C. Detection II. Materials A. Reagents B. Instrumentation III. Procedures A. Long Probes 1. Labeling 2. Hybridization 3. Stringency Washes
B. Oligonucleotides 1. Labeling 2. Hybridization 3. Stringency Washes
C. Western Blots 1. Antibody Development
D. Detection E. Application Guide 1. Long Probes 2. Oligonucleotides 3. Western Blots
F. Conclusion References I. I N T R O D U C T I O N This chapter describes the use of horseradish peroxidase (HRP)-catalyzed chemiluminescence as a detection procedure for molecular biology (Anon, 1990). To fully understand and capitalize on the advantages this detection Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
195
196
lan Durrant
method can offer, it is necessary also to consider the ways HRP could be introduced into any experimental system. The labeling of nucleic acid probes with haptens such as digoxigenin, biotin, and more recently fluorescein (Cunningham, 1991) has been reviewed extensively (Pollard-Knight, 1990); actual labeling procedures will be discussed only briefly. After hybridization, these molecules are detected by use of immunochemical techniques. A system will be described using fluorescein as a label and a final detection step involving an HRP anti-fluorescein conjugate that can in turn be detected using enhanced chemiluminescence. An alternative procedure to reach this HRP-enhanced chemiluminescence end point involves the direct labeling of nucleic acid probes with HRP; this procedure will be described here. The enhanced chemiluminescence detection reaction will be discussed in detail, the procedure being equally applicable to the detection of (1) directly labeled probes, (2) anti-hapten-HRP conjugates, and (3) antibody-HRP conjugates, as in Western blotting. Nucleic acid probes can be divided into two broad classes: oligonucleotides (usually <50 bases in length) and long probes (>50 bases, but optimally >300 bases). Long probes can be prepared from single-stranded or double-stranded DNA or RNA. The two classes of probe (oligonucleotide and long) require different labeling strategies and will be dealt with separately for the labeling and hybridization procedures.
A. Labeling and Hybridization of Nucleic Acid Probes 1. Long Probes The direct labeling of long probes, based on the method first described by Renz (Renz and Kurz, 1984), involves the labeling of single-stranded DNA (or RNA) with positive-charge-modified HRP (Fig. 1). The derivatized HRP is prepared by cross-linking it to polyethyleneimine (PEI) via the cross-linking agent para-benzoquinone (PBQ) (Pollard-Knight et al., 1990). The positive charges on the HRP complex interact electrostatically with the negative charges on the DNA phosphate backbone. This situation is then stabilized by the formation of covalent bonds through the action of glutaraldehyde (a short-range cross-linking agent). The cross links are probably introduced between amino groups on PEI and the bases of the nucleic acid. The probes generated have approximately one complex/50 bases; since each complex consists of one, two, or three HRP molecules, the average distribution of HRP is approximately one every 30 bases. This level of attachment is similar to the optimum spacing of hapten
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
Doublestranded DNAprobe
0
197
0 0
I Boil,snap cool Negatively-charged denaturedprobe
0
Horseradish peroxidase
I para-benzoquinone. Polyethyleneimine.
+ +
--...2-----2' ' 2 ~ -
++
+
+ Peroxidaseboundto probe
+ +
electrostatically
Glutaraldehyde
0
Peroxldase bound to probe
covalently
Fig. 1--Outline of the procedures for the preparation of HRP-labeled probes.
nucleotides and does not significantly affect the melting temperature (Tm) or the hybridization stringency associated with a particular probe. Indirect labeling methods utilize enzyme-catalyzed DNA synthesis reactions leading to the incorporation of hapten-, for example fluorescein, tagged nucleotides into the probe sequence (Harvey et al., 1993). The labeling method most commonly used is that based on random primer extension, but nick translation and PCR can also be used if desired (Harvey and Ellis, 1992). For probes labeled directly with HRP, one of the major factors to influence the hybridization and post-hybridization conditions is the need to maintain enzyme activity. Hybridizations with hapten-labeled probes are typically performed at 65~ or at 42~ using 50% formamide as a denaturant to reduce the Tm of hybrids, in standardized hybridization buffers (Harvey and Reeve, 1993). However, incubation at 65~ destroys HRP activity and 50% formamide was found to denature HRP during simulated hybridization incubations. A buffer has been developed based on 6 M urea as an alternative to formamide (Hutton, 1977). The Tm of a typical long probe will be reduced to around 67~ in this buffer. It is calculated that the optimum rate of hybridization occurs at a temperature 25~ lower than the Tm (Britten and Davidson, 1985); for the urea based buffer this optimum temperature is 42~ At this temperature the enzyme remains largely intact even during an overnight incubation. The stability
198
lan Durrant
of the enzyme is aided by the inclusion of a protein stabilizing agent in the buffer. Additional buffer contents include a rate enhancer (volume excluding agent) and a proteinaceous membrane blocking agent (especially important for blocking the binding of HRP to nylon membranes). The user defines the level of sodium chloride required to control the stringency of individual hybridizations. The stringency of the system is best controlled, however, during the post-hybridization wash steps. Note that the temperature of these washes, as for the hybridizations, should not exceed 42~ Consequently, urea is also included in the wash buffer and the stringency is controlled by alteration of the sodium chloride concentration. Fluorescein-labeled probes can generally be used with the standard hybridization and stringency conditions usually associated with radiolabeled probes. Both types of probe are equally applicable to hybridizations on both nylon and nitrocellulose membranes. The sensitivity achievable is higher on nylon due to the increased target retention properties of this type of membrane.
2. Oligonucleotide Probes To label an oligonucleotide with HRP it is first necessary to synthesize an oligonucleotide derivatized with a chemically reactive group. The most convenient method is to introduce a thiol group at the 5' end of the oligonucleotide (Connolly, 1985). The enzyme, in turn, is derivatized at a surface amine group using a bifunctional cross-linking agent. The free end of this agent reacts specifically with free thiol groups. The reaction is further simplified by presentation of the derivatized enzyme in a freezedried format. The enzyme is redissolved in the thiol-linked oligonucleotide so there is a 5 : 1 molar ratio of HRP to oligonucleotide. This ratio ensures a coupling efficiency of greater than 90% based on the oligonucleotide (Fowler et al., 1990). The free enzyme does not interfere with subsequent hybridizations. The maintenance of enzyme activity during hybridization is an important consideration.However, since oligonucleotide probes can be added at a greater molar concentration than long probes, hybridization times can be reduced to as little as 1 hr. The hybridization is performed at 42~ but the buffer is of a much more routine formulation than required for long probes. The stringency is controlled during the post-hybridization washes using any of the standard techniques such as altering the sodium chloride concentration and/or changing the temperature of the wash. The Tm of an oligonucleotide labeled with HRP is not significantly different from that of the unlabeled sequence (Fowler et al., 1990). On a smaller scale, and utilizing probes that are already synthesized, oligonucleotide probes can be tailed at the 3' end using fluorescein-dUTP
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
199
and terminal transferase (Chadwick and Durrant, 1993). The reaction is optimized to produce only a short tail (typically 4-10 bases in length) to get best signal without compromising the stringency control. The same conditions for hybridization and stringency apply to these probes as to HRP-labeled probes, and the presence of the short tail does not affect the hybridization parameters of the probe.
B. Immunochemical Techniques Labeling antibodies with HRP has been reviewed in detail elsewhere (Hashida et al., 1984). The detection of antibodies labeled with HRP on Western blots using the enhanced chemiluminescence reaction represents what is likely to be the most sensitive and rapid technique currently available (Heinicke et al., 1992; Meier et al., 1992). Streptavidin-HRP conjugates may also be used. The level of sensitivity achievable reveals target antigens that other systems may not detect; also, target antigens can be detected in far smaller amounts of material than was previously possible. Western blots are usually performed on nitrocellulose membranes or PVDF membranes. It is important to spend time optimizing the conditions when beginning to use enhanced chemiluminescence for Western blots. The sensitivity improvement over traditional techniques can be so dramatic that frequently the primary and secondary antibody dilutions must be increased significantly to avoid overloading the subsequent detection procedures. Results can frequently be obtained as quickly as 1 min after the beginning of signal detection.
C. Detection The HRP-catalyzed oxidation of luminol to produce light is used as a generic system for the detection of (1) HRP-labeled nucleic acid probes (Durrant, 1990), (2) fluorescein-labeled nucleic acid probes (Stone and Durrant, 1991), (3) antigens in immunoassays (Thorpe and Kricka, 1989), and (4) antigens on Western blots using HRP-linked antibodies or streptavidin as end points (Simmonds et al., 1991). Oxidative degradation of various compounds leading to the emission of light has been reported for many years. The luminol reaction was one of the first of these to be described (Roswell and White, 1978). Clearly HRP could be used to drive this reaction by linking the oxidation to the action of HRP on peroxide (Schroeder et al., 1978). However, the light output from this reaction was low and was maintained for only a very short period. This feature made this reaction unsuitable for general application. In 1983, Whitehead et al. (1983) re-
200
lan Durrant
ported that certain compounds could enhance the level and duration of light output, and that this improved system could be used to monitor immunoassays. This work stimulated interest on the mechanism of HRP-catalyzed degradation of luminol and searches were undertaken for improved enhancer molecules. A variety of such compounds have been identified, the most successful of which are based on substituted phenol structures (Thorpe et al., 1985). These molecules are capable of stimulating the light output by > 1000-fold and of maintaining a significant level of light output for a number of hours. The mechanism of the unenhanced reaction is generally accepted to follow the pathway illustrated in Fig. 2 (Thorpe and Kricka, 1987). Basically, the Fe(III) ion of the heme group at the center of HRP is oxidized by the degradation of peroxide to form HRP-I [Fe(V)]. The catalyst is re-formed in a two-step process with an electron gained at each stage. These electrons are donated by luminol, and a luminol radical is formed at each stage. In this cycle the rate-limiting step is the final one leading to the re-formation of the original enzyme. Consequently, the light output is low and quickly dies away because of the loss of active HRP and competing non-light-producing reactions. In the enhanced reaction, the proposed scheme shows the enhancer as a much more active electron donor, thus removing the rate-limiting step (Hodgson and Jones, 1989). The enhancer radical interacts with luminol to form luminol radicals so
a
2H202
HRP
~
Luminol~.,~ radical . ~
Lu inol b
2H20 + 02
~
~
Compound T
Luminol
Compound ~ ]~ Luminol radical
Luminol radical
l
.
Lurninol endoperoxide
= 3-aminophthalate dianion + N 2
1
3-arninophthalate dianion + LIGHT
Fig. 2---Proposed reaction scheme for the luminol-based enhanced chemiluminescent detection of horseradish peroxidase.
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
201
that the light-producing pathway from luminol is precisely the same for the enhanced and unenhanced reactions. This suggestion is confirmed by the fact that the quantum efficiency of the reaction is unchanged (the quantity of light emitted for each luminol degraded) and that the emission spectrum is identical in both cases (Thorpe and Kricka, 1986). The luminol radical undergoes a series of as-yet-undefined reactions that culminate in the formation of luminol endoperoxide. This compound degrades to release nitrogen and form a chemically excited form of 3-aminophthlate dianion. As this dianion falls back to the ground state, light is emitted. In practice the peroxide is supplied as a peracid salt which must be kept separate from the enhancer/luminol mixture until immediately prior to use to avoid gradual chemical degradation of the substrates. Individually, the two substrate formulations can be stored at 4~ for up to 9 mo. In solution, the light output peaks within 1 min and then remains relatively steady for up to 20 min (Thorpe and Kricka, 1987), making it extremely convenient for immunoassay end point determinations. On membranes, the light output increases rapidly over the first 2-3 min and finally peaks around 10-15 min after exposure of the substrates to HRP (Stone and Durrant, 1990). The light level decays with a half-life of approximately 1 hr. After 4-5 hr, the light level falls beyond detection limits. The cause of the decay in light output is uncertain but is most likely attributable to gradual loss of enzyme function due to a build-up of free radical damage. The quantity of light available during the first 2 hr gives a sensitivity of detection suitable for standard molecular biology applications (Durrant et al., 1990). For Western blots, typical exposure times may be only 110 min; high levels of nucleic acid target can be detected in 10-30 min whereas low target levels may require exposure times of up to 60 min. The loss of detectable signal after 4-5 hr simplifies the task of reprobing nucleic acid blots. There is no need to strip the previous probe from the membrane before rehybridizing with another probe (or even the same probe) (Durrant et al., 1990). During enhanced chemiluminescence detection, the first probe will not be visualized since the enzyme label has been inactivated by the first detection process. For Western blots, redetection with a second antibody can be done relatively quickly (the first signal may still be detectable). If the position of this signal interferes with the detection of subsequent antigens, it is possible to remove the first antibody system without damaging the target proteins (Kaufmann et al., 1987). The light output from the luminol reaction has a maximum wavelength of 428 nm, making it ideal for capture on standard X-ray film, which is designed to detect the blue light emitted by intensifying screens. Consequently, the system is characterized by producing a hard copy of the result, which can be quantified by densitometry.
202
lan Durrant
II. MATERIALS A. Reagents The ECL gene detection system (Amersham; RPN3000/3001) contains the labeling reagent for the introduction of HRP onto long probes, hybridization buffer, and ECL detection reagents. The ECL 5'-thiol oligolabeling system (Amersham; RPN211 l) contains the derivatized freeze-dried HRP. A thiol modifier reagent, for the derivatization of oligonucleotides, is also available from Amersham (RPN 2112); similar compounds are available elsewhere (for example, Clontech and Cruachem). ECL random prime (Amersham; RPN3040/3041) is used to produce fluorescein-labeled DNA probes and ECL 3'-oligolabeling system (Amersham; RPN2130) catalyzes the production of fluorescein-tailed oligonucleotide probes. The ECL detection reagents are available separately (RPN 2105) for use with the above labeling systems, in conjunction with Western blotting protocols (RPN 2106/8/9), or for immunoassay detection (RPN 190). The direct labeling systems and the detection reagents are shipped at ambient temperature; these labeling and detection reagents, for whichever application, are stored at 4~ The systems for introducing fluoresceinlabeled nucleotides are shipped on dry ice and are stored at -20~ The special hybridization buffer for directly labeled long probes is best stored aliquotted at -20~ The user must add the desired quantity of NaCl (typically 0.5 M) and membrane-blocking agent (for nylon blots) (Amersham; RPN3023). The luminol used in preparation of the ECL detection reagents can be obtained commercially, but is specially purified for optimum results (Stott and Kricka, 1987). The ECL systems have been optimized for use on Hybond TM membranes (Amersham), particularly Hybond-N § (nylon) and Hybond-ECL (nitrocellulose), but are compatible with some of the nylon and nitrocellulose membranes available from other sources. The capture of the light emitted by the enhanced chemiluminescence reaction is most conveniently performed on X-ray film. The best results will be obtained with Hyperfilm~-ECL (Amersham), but it is possible to use Hyperfilm-MP or Kodak-AR films. Blue tinted films may not yield the maximum sensitivity of the system. SaranWrap TM, a product of the Dow Chemical Company, is used to wrap membranes during exposure so the detection reagents do not contact the film. This type of cling wrap is especially suited for use in molecular biology because of its ability to transmit light (including UV light). Other
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
203
cling wrap materials may be usable but would require testing. SaranWrap is often available from local distributers.
B. Instrumentation As stated previously, it is best to capture the light emitted by the enhanced chemiluminescence reaction on X-ray film. The recommended films can all be processed manually or, more conveniently, using a commercial Xray film processing machine. It is also possible to obtain images on a number of other systems. Polaroid film can be used in the format of a camera luminometer; this is particularly suitable for the detection of Western blots with a high level of signal. Camera luminometers are available from a number of sources (for example, Amersham; RPN2069). Alternatively, a CCD camera can be used; this cooled charge-coupled device collects, records, and quantifies emitted photons. A number of such cameras, in a variety of formats, are available commercially. These machines may not be dedicated to the detection of large blots and will therefore require some adaptation by the user (Boniszewski et al., 1990). The thiol-linked oligonucleotides can be synthesized on any of the commercially available DNA synthesis machines (for example those supplied by Applied Biosystems or Pharmacia). The thiol modifier reagent can be used in conjunction with the standard small scale synthesis program installed on such machines.
III. PROCEDURES The labeling and hybridization conditions associated with either long probes or oligonucleotide probes require different technologies; these methods will be dealt with individually. The procedures described here can be used for all the applications for which the probes are suitable; specific application-dependent variations will be discussed separately. This section deals in most detail with the HRP-labeled probes; the procedures for producing fluorescein-labeled probes are reviewed elsewhere (Harvey et al., 1993) and are more like those traditionally performed with radiolabeled probes. The hybridization and stringency wash procedures are also directed toward HRP-labeled probes but the general principles can also be applied to the fluorescein systems.
204
lan Durrant
A. Long P r o b e s
1. Labeling 1. Dilute the sample of nucleic acid to be labeled to 10 ng//xl in sterile, distilled water. To obtain efficient labeling, the monovalent cation concentration should be less than 10 mM. Proceed to step 4 for single-stranded DNA or RNA samples. 2. Boil double-stranded DNA for 5 min. The boiling water bath should be vigorously boiling throughout; 95~ is not adequate to ensure complete denaturation, neither is the use of a heating block. 3. Cool on ice for 5 min. 4. Add an equal volume of labeling reagent. Mix gently by drawing up and down in the pipet tip. 5. Add a volume of 1.5% (v/v) glutaraldehyde equivalent to that of the labeling reagent used in the previous step. 6. Incubate for 10 min at 37~ 7. Store the labeled probe on ice if it is to be used immediately. Store in 50% glycerol at -20~ for long-term storage (up to 12 mo). Do not boil labeled probes before use.
2. Hybridization 1. Place blots in 0.25 ml hybridization buffer/cm 2 of membrane. Remember to include NaCI (0.5 M is suitable for most applications and gives the maximum rate of hybridization) and blocking agent (for nylon membranes) in the hybridization buffer. Lower volumes can be used, particularly for hybridizations in bags or ovens, or when a number of filters are hybridized together. The basic criterion is that each blot should move freely within the buffer. 2. Prehybridize for a minimum of 15 min at 42~ in a shaking water bath. 3. Add labeled probe to the prehybridization buffer at a final concentration of 10 ng/ml (nylon) or 20 ng/ml (nitrocellulose). Avoid placing the probe directly onto the filter. 4. Incubate overnight at 42~ in a shaking water bath.
3. Stringency Washes 1. Place filters into 2 ml primary wash buffer/cm z of membrane. Incubate in a shaking water bath at 42~ for 20 min. Primary
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
2. 3. 4. 5.
wash buffer controls the stringency. The basic recipe is 6 M urea, 0.5 • SSC, 0.4% SDS, and will be suitable for most applications; the SSC concentration can be altered to vary the stringency. Replace the wash solution with fresh buffer and repeat the wash step. Place filters in an excess volume of 2 • SSC and incubate at room temperature, with agitation, for 5 min. Replace the solution with fresh 2 • SSC and repeat the wash step. Blots can be stored in this buffer for up to 60 min before proceeding to the detection steps. For longer storage wrap the blots, still damp, in SaranWrap and store at 4~
B. Oligonucleotides
1. Labeling 1. Desalt 5 ~g (100/zl) thiol-linked oligonucleotide on a spin column (or similar) to remove the dithiothreitol present in the oligonucleotide storage buffer. Use the desalted oligonucleotide within 5 min to avoid dimerization of the thiol groups. 2. Add all 5 /zg thiol-linked oligonucleotide to a tube containing derivatized, freeze-dried HRP. Redissolve the enzyme, and mix the reactants, by gently pipetting up and down in the pipet tip. 3. Incubate for 1 hr at room temperature or overnight at 4~ 4. Dilute the labeled probe to an appropriate working concentration (for example, 10 ng//.d) in 0.1 M sodium phosphate (pH 7.0) and store on ice for immediate use. For long-term storage, add an equal volume of glycerol and place at -20~ (for up to 9 mo).
2. Hybridization 1. Place blots in hybridization buffer (0.25 ml/cm 2 of membrane). 2. Prehybridize for a minimum of 15 min at 42~ in a shaking water bath. 3. Add labeled probe to the prehybridization solution to a final concentration of 20 ng/ml. Avoid placing the probe directly onto the membrane. 4. Hybridize for 1 hr at 42~ in a shaking water bath.
205
206
lan Durrant
3. Stringency Washes 1. Place blots in primary wash buffer (2 ml/cm 2 of membrane). Primary wash buffer controls the stringency and consists of a selected level of SSC and 0.1% SDS. Incubate at the required stringency for 15 min in a shaking water bath. The precise conditions for the stringency washes will be dictated by the Tm of the probe and the presence or absence of sequences closely related to the specific target. 2. Replace the solution with fresh buffer and repeat the wash step. 3. Rinse in 2 • SSC (2 ml/cm 2 of membrane) for 5 min at room temperature, with agitation. 4. Proceed to detection steps.
C. W e s t e r n Blots This procedure is specifically for Western blotting applications. However the general principles can also be applied to the detection of fluoresceinlabeled hybridized probes (Durrant and Chadwick, 1993; Harvey and Reeve, 1993).
1. Antibody Development 1. Block the blotted membrane (typically nitrocellulose) in 5% dried milk in phosphate buffered saline-Tween20 solution (PBS-T) for 1 hr at room temperature or overnight at 4~ 2. Rinse the membrane twice briefly in PBS-T. 3. Wash the membrane in a fresh aliquot of PBS-T for 15 min at room temperature, with agitation. 4. Wash the membrane, twice, for 5 min at room temperature with fresh PBS-T solution. 5. Incubate in primary antibody, diluted as appropriate in PBS, for 1 hr at room temperature, with gentle agitation. 6. Wash the membrane as detailed in steps 2-4. 7. Incubate in secondary antibody (typically an HRP conjugate), diluted as appropiate in PBS, for 1 hr at room temperature, with gentle agitation. 8. Wash the membrane as detailed in steps 2-4.
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
207
D. Detection The detection procedure described in this section is equally applicable to the detection of HRP-labeled nucleic acid probes and HRP-labeled antibodies for Western blots and for fluorescein-labeled nucleic acid probe detection. Read through this section carefully before starting. It is necessary to work quickly once the blots have been exposed to the detection reagents. The use of a dark room is required beyond step 6. Do not let the blots dry out at any stage.
1. Mix equal volumes of the two detection reagents (one containing the peracid salt and the other containing the luminol-enhancer system). Usually the substrate is prepared fresh each time. However, the mixed working substrate is stable at 4~ for at least 48 hr. 2. Drain the membrane after the final wash step. Lay the filters out on a clean surface, DNA/protein side up. 3. Cover with the freshly mixed ECL detection reagent (0.125 ml/ cm 2 of membrane). Leave for precisely 1 min at room temperature. 4. Drain the blots and place DNA/protein side down onto a clean sheet of SaranWrap. Wrap the blots, gently smoothing out air pockets. Ensure that the detection reagent cannot come into contact with the X-ray film. 5. Place the wrapped blots DNA/protein side up in a film cassette. 6. Switch off the light. 7. Place a piece of X-ray film onto the blots and close the cassette. 8. Remove the film after 1 min and replace with a second piece of film. Begin timer. 9. Develop first film and, on the basis of the signal and background, decide on the exposure time required for the second (or subsequent) film.
E. Applications Guide 1. Long Probes Directly labeled long probes yield an absolute sensitivity of approximately 1 x 10-~8 mol. This is sufficient to detect a single-copy gene in a
208
lan Durrant
loading of 2/xg of a human genomic DNA restriction enzyme digest (Durrant et al., 1990). The best results are obtained for all applications (Table I), but particularly for genomic systems, with probes derived from DNA inserts that have been excised and purified away from the vector. It is also possible to label probes within agarose gel slices provided that the gel consists of less than 0.7% agarose. Nylon membrane retains target better and is less prone to physical damage than nitrocellulose; nylon blots can be reprobed at least 8 times (Fig. 3) without significant loss in sensitivity. In applications in which significantly higher target levels are available, for instance in the detection of colonies and plaques or DNA amplification products (Sorg et al., 1990), it may be possible to reduce the probe concentration to as low as 2 ng/ml and to shorten the hybridization time to as little as 2 hr. This system is particularly suited to colony and plaque screening. The results can be timed to give a clear distinction between positive and negative signal. The presence of a limited level of signal on the negative colonies aids in orientation of the filter with the original bacterial sample. For colonies, it is important that the colonies are not too large and that the cellular debris is removed from the filter. After fixation of the colonies to the filter, the cell debris is removed by vigorous rinsing of the membrane in 2 x SSC or by gentle rubbing of the wet filter. Failure to follow these suggestions can lead to difficulty in distinguishing positive and negative signal, especially if the exposure time is not kept to a minimum. In general, the system performs well, as described, for all the major applications with stringency controlled during the post-hybridization washes. However, certain fingerprint probes are directed toward target sequences that are repeated throughout the genome. The stringency of the hybridization may need to be increased with these probes by decreas-
Table ! Suitability of Enhanced Chemiluminescence for Detection of Nucleic Acid Probes Technique
L o n g probes
Oligonucleotides
D o t / s l o t blot N o r t h e r n blot S o u t h e r n blot S e q u e n c i n g gel C o l o n y screen Plaque s c r e e n R F L P analysis PCR products
+ + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + +
8. Detectionof HorseradishPeroxidaseby EnhancedChemiluminescence
209
Fig. 3--Enhanced chemiluminescent detection of a human single-copy gene sequence I. A 1.5-kb region of the human N-ras proto-oncogene labeled with HRP was hybridized to EcoRI-restricted human genomic DNA blotted on Hybond-N + [gel loadings of (a) 2/~g, (b) 5/~g, and (c) l0/~g]. This represents the eighth reprobingof the filter. Probe concentration, 10 ng/ml; exposure time, 30 min on Hyperfilm-MP.
ing the NaCl concentration (to as low as 0.05 M), to avoid nonspecific binding of the probes. Random prime-labeled probes can also be used for all applications but are more suited, perhaps, to the high-sensitivity work of single-copy gene detection than are the directly labeled probes. In general, the sensitivity achievable with the fluorescein systems is 4- to 5-fold better than that of the direct HRP-labeled probes (Fig. 4).
2. Oligonucleotides For both HRP- and fluorescein-tailed oligonucleotide probes, stringency control is the feature that will require the most optimization by the user. Typically, hybridizations will be performed at 42~ For experimental systems in which closely related target sequences are not present, the required stringency may be achieved using a primary wash of 3 x SSC, 0.1% SDS at 42~ However, in situations where discrimination between
210
lan Durrant
Fig. 4---Enhanced chemiluminescent detection of a human single-copy gene sequence II. A linearized 4.5-kb plasmid containing a 1.5-kb region of the human N-ras proto-oncogene was used as template for the random prime labeling reaction to incorporate fluoresceindUTP. The probe was hybridized to EcoRI-restricted human genomic DNA blotted on Hybond-N + [gel loadings of (a) 0.5 /,Lg, (b) 1 /zg, and (c) 2 /xg]. Probe concentration, l0 ng/ml; exposure time, 60 min on Hyperfilm-MP.
perfectly matched and mismatched sequences is required, the Tm of the oligonucleotide should be calculated and washes should be performed about 3-5~ below this value (Fig. 5; Fowler et al., 1990); 0.1% SDS should be included in all stringency wash buffers. The NaCI concentration and the temperature of the wash are the two principal methods of controlling stringency. With HRP-labelled probes, it must be remembered that the enzyme label will not survive long exposures to high temperature. Consequently, if using high temperature washes up to a maximum of 60~ the incubation time should be reduced to only 5 min. The probe concentration can be reduced to 5 ng/ml for high target applications such as colony and plaque blotting but, as highlighted for long probes, it is vital that the cellular debris is removed, particularly for colony screening. The systems have also been used successfully using fingerprint probes and to detect the products of DNA amplification reactions. The fluorescein-labeled oligonucleotide probes offer almost the same performance as the HRP-labeled probes, with possibly slightly higher sensitivity. The stringency is well controlled with the HRP probes, as demonstrated, but the fine control that may be required for such applica-
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
211
Fig. 5 m E n h a n c e d chemiluminescent detection of HRP-linked oligonucleotides. A 16-base probe labeled with HRP was hybridized to target derived from in vitro mutagenesis experiments and dot blotted on Hybond-N + (loadings of 40, 20, 10, 4, 2, 1, and 0.2 pg based on the level of the 16-base target). The target sequence was perfectly matched with the probe for blots a and c but contains one nucleotide different from the probe for blots b and d. Stringency washes were performed in 3 • SSC, 0.1% SDS at 42~ for blots a and b and in the same buffer at 53~ for blots c and d. Probe concentration, 20 ng/ml; exposure time 30 min on Hyperfilm-MP.
tions as HLA typing is perhaps more easily attained with the tailed probes (Fig. 6). 3. Western Blots
Due to the extremely high sensitivity and rapidity of result for the Western system (Table II), it is often necessary to re-evaluate the optimum antibody dilution. A significant savings in usage of expensive primary antibody is often discovered. In addition, exposure times are sometimes extremely short and the initial 1-min exposure recommended may be too long. To overcome this, dilute the antibodies 10-fold or more and reduce the exposure time to less than 1 min. If problems persist, leave blots, after draining the detection reagent off, wrapped in SaranWrap for 1015 min prior to positioning the first film. This will allow some of the light to decay. Filters can be redetected with, or without, removal of the first antibody; this is particularly useful for gaining as much information as possible from rare samples, for example, human protein samples. Blots can be stripped by incubation in 60 mM Tris-HC1, 2% SDS, 100 mM 2-
212
lan Durrant
Fig. 6 m H L A typing using enhanced chemiluminescent detection and sequence-specific oligonucleotide probes. Probes tailed with fluorescein-dUTP; clinical DNA samples amplified by PCR at the HLA-DR locus. Loading of approximately 1 ng amplified material onto Hybond-N +. Hybridization, 42~ probe concentration, 10 ng/ml; stringency washes, 47~ or 52~ as required for the probe sequences in I x SSC, 0.1% SDS; exposure time, 10 min on Hyperfilm-MP.
Table !1 Comparison of Western Blot Detection Systems
Light Parameter Sensitivity (dot blots) Minimum detection time Antibodyconjugate concentration Ability to reprobe blots
Color
ECL
DAB
Activity
125I
NBT/BCIP
< 1 pg
10 pg
1 pg
1-10 ng
30 sec-10 min
20 min-1 hr
20 min-1 hr
Overnight
1:1000-1:100000
1:1000-1:5000
1 : 1000-1:5000
1:500-1 : 1000
Yes
No
No
Yes
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
213
Fig. 7--Reprobing Western blots using enhanced chemiluminescent detection. Rat brain homogenate (lanes 2 and 3) and biotinylated protein molecular weight markers (lane 1) were separated by electrophoresis through a 12% polyacrylamide gel (containing SDS) and were blotted into Hybond-ECL nitrocellulose membrane. (a) Blot detected with anti-tubulin monoclonal antibody; (b) same blot re-detected, after stripping, with anti-actin monoclonal antibody. Primary antibodies were revealed with sheep anti-mouse Ig-HRP conjugate; biotinylated markers were revealed with streptavidin-HRP conjugate; HRP was detected with ECL detection reagents. Exposure time, 30 sec on Hyperfilm-ECL.
mercaptoethanol for 30 min at 50~ (Bayliss and Davidson, 1991). This treatment does not affect the target material (Fig. 7). F. C o n c l u s i o n The luminol-based enhanced chemiluminescence detection system is universally applicable in molecular biology and immunology. It is a rapid system that has the sensitivity required to cover all the major applications
2 !4
lan Durrant
of interest, producing a hard copy of the result. Although this procedure may not be a replacement for radioactivity in all applications, at least in terms of sensitivity enhanced chemiluminescence can offer a viable alternative for users performing routine applications and for those without the facilities required to handle radiolabeled compounds.
REFERENCES Anonymous (1990). "ECL Technical Manual." Amersham International, Amersham, UK. Bayliss, M. T., and Davidson, C. (1991). Structural changes in human articular cartilage proteoglycans. Life Sci. 5, 7-8. Boniszewski, Z. A. M., Comley, J. S., Hughes, B., and Read, C. A. (1990). The use of charge-coupled devices in the quantitative evaluation of images, on photographic film or membranes, obtained following electrophoretic separation of DNA fragments. Electrophoresis 11, 432-440. Britten, R. J., and Davidson, E. H. (1985). Hybridization strategy. In "Nucleic Acid Hybridization: A Practical Approach" (B. D. Hames and S. J. Higgins, eds.), pp. 3-15. IRL Press, Oxford. Chadwick, P. M. E., and Durrant, I. (1993). Labeling of oligonucleotides with fluorescein. In "Protocols for Nucleic Acid Analysis by Nonradioactive Probes" (P. G. Isaac, ed.), pp. 101-106. Humana Press, Totowa, New Jersey. Connolly, B. A. (1985). Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes. Nucleic Acids Res. 13, 4485-4502. Cunningham, M. W. (1991). Nucleic acid detection with light. Life Sci. 6, 1-5. Durrant, I., Benge, L. C. A., Sturrock, C., Devenish, A. T., Howe, R., Roe, S., Moore, M., Scozzafava, G., Proudfoot, L. M. F., and McFarthing, K. G. (1990). The application of enhanced chemiluminescence to membrane-based nucleic acid detection. BioTechniques 8, 564-570. Durrant, I., and Chadwick, P. M. E. (1993). Hybridization of fluorescein-labeled oligonucleotide probes and enhanced chemiluminescence. In "Protocols for Nucleic Acid Analysis by Nonradioactive Probes" (P. G. Isaac, ed.), pp. 141-148. Humana Press, Totowa, New Jersey. Fowler, S. J., Harding, E. R., and Evans, M. R. (1990). Labeling of oligonucleotides with horseradish peroxidase and detection using enhanced chemiluminescence. Technique 2, 261-267. Harvey, B., and Ellis, P. (1992). Non-radioactive labeling of DNA probes during PCR. Life Sci. 9, 3-4. Harvey, B. M., and Reeve, C. B. (1993). Hybridization and detection of fluorescein-labeled DNA probes using enhanced chemiluminescence. In "Protocols for Nucleic Acid Analysis by Nonradioactive Probes" (P. G. Isaac, ed.), pp. 135-140. Humana Press, Totowa, New Jersey. Harvey, B. M., Reeve, C. B., and Cunningham, M. W. (1993). Random prime labeling of DNA probes with fluorescein-ll-dUTP. In "Protocols for Nucleic Acid Analysis by Nonradioactive Probes" (P. G. Isaac, ed.), pp. 93-100. Humana Press, Totowa, New Jersey. Hashida, S., Imagawa, M., lnoue, S., Ruan, K., and lshikawa, E. (1984). More useful maleimide compounds for the conjugation of Fab' to horseradish peroxidase through thiol groups in the hinge. J. Appl. Biochem. 6, 56-63.
8. Detection of Horseradish Peroxidase by Enhanced Chemiluminescence
215
Heinicke, E., Kumar, U., and Munox, D. G. (1992). Quantitative dot-blot assay for proteins using enhanced chemiluminescence. J. Immunol. Meth. 152, 227-236. Hodgson, M., and Jones, P. (1989). Enhanced chemiluminescence in the peroxidase-luminol-H202 system: Anomolous reactivity of enhancer phenols with enzyme intermediates. J. Biolumin. Chemilumin. 3, 21-25. Hutton, J. R. (1977). Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. Nucleic Acids Res. 4, 3537-3555. Meier, T., Arni, S., Malarkannan, S., Poinvelet, M., and Hoessli, D. (1992). Immunodetection of biotinylated lymphocyte-surface proteins by chemiluminescence: A nonradioactive method for cell-surface protein analysis. Anal. Biochem. 204, 220-226. Pollard-Knight, D. (1990). Current methods in nonradioactive nucleic acid labeling and detection. Technique 2, 1-20. Pollard-Knight, D., Read, C. A., Downes, M. J., Howard, L. A., Leadbetter, M. R., Pheby, S. A., McNaughton, E., Syms, A., and Brady, M. A. W. (1990). Nonradioactive nucleic acid detection by enhanced chemiluminescence using probes directly labeled with horseradish peroxidase. Anal. Biochem. 185, 84-89. Roswell, D. F., and White, E. H. (1978). The chemiluminescence of luminol and related hydrazides. Methods Enzymol. 57, 409-423. Schroeder, H. R., Boguslaski, R. C., Carrico, R. J., and Buckler, R. T. (1978). Monitoring specific protein-binding reactions with chemiluminescence. Methods Enzymol. 57, 424-445. Sorg, R., Enczmann, J., Sorg, U., Kogler, G., Schneider, E. M., and Wernet, P. (1990). Specific non-radioactive detection ofPCR-amplified HIV-sequences with enhanced chemiluminescence labeling (ECL)mAn alternative to conventional hybridization with radioactive isotopes. Life Sci. 2, 3-4. Stone, T., and Durrant, I. (1990). Light output capacity of the ECL-system. Highlights 1, 3. Amersham, UK. Stott, R. A. W., and Kricka, L. J. (1987). Purification of luminol for use in enhanced chemiluminescence immunoassay. In "Bioluminescence and Chemiluminescence: New Perspectives" (J. Scholmerich, R. Andreesen, A. Kapp, M. Ernst, and W. G. Woods, eds.), pp. 237-240. Wiley, New York. Thorpe, G. H. G., and Kricka, L. J. (1986). Enhanced chemiluminescent reactions catalyzed by horseradish peroxidase. Methods Enzymol. 133, 331-353. Thorpe, G. H. G., and Kricka, L. J. (1987). Enhanced chemiluminescent assays for horseradish peroxidase: Characteristics and applications. In "Bioluminescence and Chemiluminescence: New Perspectives" (J. Scholmerich, R. Andreesen, A. Kapp, M. Ernst, and W. G. Woods, eds.), pp. 199-208. Wiley, New York. Thorpe, G. H. G., and Kricka, L. J. (1989). Incorporation of enhanced chemiluminescent reactions into fully automated enzyme' immunoassays. J. Biolumin. Chemilumin. 3, 97-100. Thorpe, G. H. G., Kricka, L. J., Moseley, S. B., and Whitehead, T. P. (1985). Phenols as enhancers of chemiluminescent horseradish peroxidase-luminol-hydrogen peroxide reaction: Application in luminescence monitored enzyme immunoassays. Clin. Chem. 31, 1335-1341. Whitehead, T. P., Thorpe, G. H. G., Carter, T. J., Groucutt, C., and Kricka, L. J. (1983). Enhanced luminescence procedure for sensitive determination of peroxidase-labeled conjugates in immunoassay. Nature (London) 305, 158-159.
9
Detection of Horseradish Peroxidase by Colorimetry Peter C. Verlander Department of Investigative Dermatology Rockefeller University New York, New York 10021
I. Introduction A. Historical Overview 1. In situ Hybridizations 2. Sandwich Hybridizations 3. Membrane Hybridizations
B. Substrates 1. Insoluble Products 2. Soluble Products
II. Materials III. Procedures A. In Situ Hybridizations 1. AEC Detection 2. DAB Detection
B. Microtiter Plate Assays 1. TMB Detection 2. OPD Detection
C. Membrane Hybridizations 1. AEC Detection 2. TMB Detection
IV. Conclusions References
I. I N T R O D U C T I O N
A. Historical Overview Horseradish peroxidase (HRP) has been used extensively as a colorimetric marker in biological studies. A hemoprotein with a molecular weight of 40,000, HRP is an ideal detection reagent because of its stability, high turnover rate, and the availability of a wide assortment of colorimetric Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
217
2!8
Peter C. Verlander
substrates. Although radioactive techniques are generally more sensitive, the sensitivity of peroxidase detection systems is adequate for many applications, and speed and safety considerations make peroxidase detection preferable to radioactive techniques. HRP was originally used as a direct cytochemical marker for tracing protein uptake in animal tissues (Straus, 1964a,b), but development of immunological techniques and the ability to cross-link enzymes to antibodies (Avrameas, 1969) led to the more widespread use of peroxidase as an indicator for a variety of immunoassays, including western blots (Burnette, 1981) and enzyme-linked immunosorbent assays (ELISA) (Engvall and Perlman, 1972; Van Weemen and Schuurs, 1971). The use of HRP as a colorimetric detection marker was later adapted to nucleic acid probe technology, with many of the assays directly derived from analogous immunoassays. The most commonly employed method takes advantage of the affinity of avidin and streptavidin for biotin (Langer et al., 1981 ; Bayer and Wilchek, 1990). After hybridization ofa biotinylated DNA probe to target, detection is achieved either by sequential washes with streptavidin (or avidin) and biotinylated peroxidase, or by a single wash with a preformed complex consisting of either streptavidin or avidin bound to biotinylated peroxidase (Fig. 1). Use of a streptavidin-peroxidase complex is generally preferable because of the speed of performing a single wash, and because it is usually more sensitive than sequential washes. Other methods have included the direct cross-linking of peroxidase to oligonucleotide probes (Renz and Kurz, 1984), as well as immunologic detection of sulfonated probes (Morimoto et al., 1987) or bromodeoxyuridine-labeled probes (Kitazawa et al., 1989; Jirikowski et al., 1989). Immunologic detection can be accomplished either through use of biotinylated antibodies or through use of peroxidase directly coupled to antibodies. These detection techniques have been incorporated into a number of DNA probe assays, including in situ hybridizations, sandwich hybridization assays, and membrane hybridizations. 1. In Situ
Hybridizations
Horseradish peroxidase detection of nucleic acid probes has been most commonly and successfully applied to in situ hybridizations (Brigati et al., 1983; Singer and Ward, 1982). Enzymatic detection is far more rapid than isotopic detection, with signal development in minutes rather than days, and amplification techniques have been described that rival the sensitivity of radioactive probes (Denijn et al., 1990). Amplification usually involves the sequential application of antibodies in order to increase the ultimate number of binding sites for the streptavidin-peroxidase complex.
9. Detectionof Horseradish Peroxidase by Colorimetry
219
Fig. l--Detection of nucleic acid probes with horseradish peroxidase. (A) Hybridization with a biotinylated probe, followed by sequential washes with streptavidin and biotinylated peroxidase. (B) Hybridization with a biotinylated probe, followed by a single wash with a preformed complex of streptavidin and biotinylated peroxidase. (C) Hybridization with a biotinylated probe, followed by detection with antibiotin antibodies coupled to peroxidase. This technique also applies to detection of probes modified in other ways, such as by sulfonation. (D) Hybridization with a probe that is directly coupled to peroxidase.
Sensitivities sufficient to detect and localize m R N A in tissue sections have been claimed (Denijn et al., 1990), while detection of 20 to 50 copies per cell are routine. Peroxidase has provided a convenient and sensitive m a r k e r for the detection of viral and bacterial infections in tissue samples, and has b e e n used for a variety of clinical diagnostic tests. Peroxidase detection has also b e e n used for genetic testing applications, such as Y c h r o m o s o m e aneuploidy ( G u t t e n b a c h and Schmid, 1990).
220
Peter C. Verlander
2. Sandwich Hybridizations Sandwich assays are particularly well suited to peroxidase detection. These assays generally include a capture probe that is bound to a fixed matrix, such as nitrocellulose membranes (Dunn and Hassell, 1977; Ranki et al., 1983), microtiter wells (Dahlen et al., 1987; Keller et al., 1989), or beads (Langdale and Malcolm, 1985; Polsky-Cynkin et al., 1985). The target nucleic acid molecule hybridizes to the capture probe and is thereby bound to the matrix, while a second probe that is either directly or indirectly labeled with peroxidase hybridizes to an adjacent sequence on the target (Fig. 2). These techniques are particularly useful for the detection of polymerase chain reaction (PCR)-amplified nucleic acids, and have been used in assays for human immunodeficiency virus (HIV) (Kemp et al., 1990; Keller et al., 1989), fl-thalassemia (Saiki et al., 1988, 1989), and sickle-cell anemia (Saiki et al., 1988) among others. Peroxidase detection is useful for these types of assays because of the high turnover rate of the enzyme, and because of the availability of a number of sensitive substrates for soluble assays.
Fig. 2--Sandwich assays. The target hybridizes to an immobilized probe and is captured to the solid matrix. A biotinylated probe hybridizes to adjacent sequences on the target and is detected by streptavidin-HRP.
9. Detectionof HorseradishPeroxidaseby Colorimetry
221
3. Membrane Hybridizations Peroxidase detection is perhaps less well suited to membrane hybridization techniques. The sensitivity of peroxidase detection does not match that of radioactive systems, although detection of subpicogram bands on Southern hybridizations have been claimed (Sheldon et al., 1986, 1987). The lower stability of peroxidase as compared to alkaline phosphatase limits the stringency of the wash conditions that can be used in reducing nonspecific background. Even with these limitations, peroxidase detection has been used in a variety of membrane-based assays (Saiki et al., 1988, 1989). For example, sandwich assays have been developed that use a membrane-bound capture probe for characterizing polymorphisms at the histocompatibility locus in humans (Bugawan et al., 1990).
B. Substrates A wide assortment of substrates is available for peroxidase assays, generating both soluble and insoluble products. Choice of a substrate is primarily based on the format of the assay and the sensitivity of the substrate, but other factors such as the stabilities of the substrate and the product, and the relative health risks of the substrates are also important considerations.
1. Insoluble Products The substrates that generate insoluble products, appropriate for in situ hybridizations and membrane hybridizations, include 3-amino-9ethylcarbazole (AEC), 3,3'-diaminobenzidine (DAB), and 4-chloro-1naphthol. AEC and DAB are the most commonly used substrates because of their sensitivity. Techniques that claim very high sensitivities have been described for the use of 3,3',5,5'-tetramethylbenzidine (TMB) in precipitable assays (Sheldon et al., 1986; McKimm-Breschkin, 1990), but this is less common. Initial studies using peroxidase as a colorimetric indicator employed benzidine as the substrate; unfortunately, the blue precipitate formed had a tendency to fade with time. Use of AEC as a substrate had the advantage of generating a stable, water-insoluble reaction product (Graham et al., 1964). The red product generated by the oxidation of AEC is soluble in organic solvents, and this can be a problem in fixing slides from in situ hybridizations. Other drawbacks to the use of AEC include the difficulty of photographing the red product and the fact that AEC is toxic and is a suspected carcinogen. DAB is a derivation of benzidine that overcomes the stability problems
222
Peter C. Verlander
of the benzidine reaction product (Graham and Karnovsky, 1966). DAB is a very sensitive substrate with rapid development times, and the sensitivity of DAB can be improved further by using metal co-factors (Hsu and Soban, 1982). Some reports have found DAB to be a more sensitive substrate than AEC, but this may be owing to the better contrast provided by the darker precipitate as compared to the red product of AEC. Drawbacks to the use of DAB include (1) stock solutions must be prepared fresh; (2) the reaction can be difficult to control, creating background problems; and (3) DAB is very toxic and is a known carcinogen. Chloronaphthol gives a blue-black oxidation product that, like AEC, is soluble in organic solvents (Nakane, 1968). Although less sensitive than DAB, chloronaphthol can be easier to use because of its slower development time, and is an acceptable substitute for DAB if high background is a problem (Harlow and Lane, 1988). However, the sensitivity of AEC and DAB make them the preferred substrates for assays requiring an insoluble product. Table I summarizes the characteristics of the substrates that generate insoluble products with peroxidase. 2. Soluble Products
3,3',5,5'-Tetramethylbenzidine (TMB; Holland et al., 1974; Hardy and Heimer, 1977), o-phenylenediamine (OPD; Voller et al., 1979), and 2,2'azinobis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS; Porstmann et al., 1981) are all acceptable substrates for soluble peroxidase assays, such as
Table I Substrates Generating Water-lnsoluble Products
Substrate
Product
3-Amino-9-ethylcarbazole (AEC)
Red; soluble in organic solvents
3,3'-Diaminobenzidine (DAB)
Brown
DAB/metal
Grey-black
4-Chloro- l-naphthol
Blue-black; soluble in organic solvents
3,3 ',5,5 '-Tetramethylbenzidine (TMB)
Blue; difficult to stabilize product
Comments Hazardous. Prepare 20 mg/ ml stock solution in DMF and store at 4~ Hazardous. Prepare solution just before use Hazardous. Prepare solution just before use Hazardous. Prepare 30 mg/ ml stock solution in absolute ethanol and store at -20~ Nonhazardous. Prepare 5 mg/ml stock solution in DMF or DMSO and store at 4~
Fig. 3 AEC detection of biotinylated probes in an in situ hybridization. A biopsy specimen hybridized with probes for human papillomavirus types 16 and 18. Deep reddish-brown color indicates a positive reaction. The tissue section was counterstained with hematoxylin and viewed at 64x. Courtesy of ENZO Biochem.
~2
9
E
o...,
9
9
=
9
.,.
[-
~ 0
.~
..,
~
~q
~
,~
,CD
.~
.~
L~
9. Detection of Horseradish Peroxidase by Colorimetry
223
microtiter plate assays. TMB is the most sensitive substrate for soluble assays; it also has the advantage of being the safest substrate (Bos, 1981). It is oxidized more rapidly with less catalytic inactivation of the enzyme than other substrates (Sheldon et al., 1986). TMB is oxidized by peroxidase to form a blue product that is changed to yellow on addition of sulfuric acid to stop the reaction. Either OPD, which yields a brown reaction product, or ABTS, which yields a green reaction product, can be used if the high sensitivity of the TMB reaction leads to high background levels. Both ABTS and OPD have the disadvantage of being light sensitive and of posing a greater health hazard than does TMB. Table II summarizes the characteristics of the substrates that generate soluble products.
II. MATERIALS Most of the equipment required for these techniques is commonly available in modern laboratories. The in situ hybridizations described require a conventional light microscope, and the microtiter plate assays require a microtiter plate spectrophotometer for reading results. Peroxidase substrates are available from a variety of suppliers including Aldrich, Boehringer-Mannheim, and Sigma. Dimethyl formamide (DMF; Fluka) should be deionized and stored in aliquots at -20~ Stock solutions of AEC and TMB can be prepared in DMF and stored at 4~ Hydrogen peroxide (30% Sigma) can be stored at 4~ for up to 1 mo, or at -20~ for longer periods. Streptavidin-HRP detection complex (DETEK I-hrp) is available from ENZO Biochem, New York. The dilutions given in the following protocols are based on the recommendations of the manufacturer and may need to be adjusted to accommodate variations in experimental conditions.
Table !I Substrates Generating Water-Soluble Products ,,
Amax
Comments
2,2'-Azinobis (3-ethylbenzthiazoline- Green 6-sulfonic acid) (ABTS) o-Phenylenediamine (OPD) Brown
410 nm 650 nm 492 nm
3,3',5,5'-Tetramethylbenzidine (TMB)
450 nm
Prepare solution just before use Prepare solution just before use Prepare 5 mg/ml stock solution in DMF or DMSO and store at 4~
Substrate
Product
Yellow
224
Peter C. Verlander
III. PROCEDURES A. In Situ Hybridizations Streptavidin-HRP complex can be used for enzymatic detection of hybridized biotinylated DNA in fixed cells and tissues. Standard procedures for in situ hybridization are compatible with the use of biotinylated probes and streptavidin-HRP complex (Brigati et al., 1983; Burns et al., 1988). Frozen or paraffin-embedded tissue sections or cells can be used, but paraffin-embedded sections must be deparaffinized through xylene and graded alcohols.
1. AEC Detection Reagents Streptavidin-HRP complex 3-Amino-9-ethylcarbazole, 20 mg/ml in DMF 1% H202 (prepared fresh from 30% stock) 0.1 M sodium acetate, pH 4.9
Complex dilution buffer
Wash buffer Substrate mixture
1 • PBS, 1% BSA, 5 mM ethylenediaminetetraacetic acid (EDTA) (1 x PBS is 130 mM sodium chloride, 10 mM sodium phosphate, pH 7.2) 1 x PBS, 5 mM EDTA 25 /xl 1% H202 + 20 /zl AEC + 1 ml 0.1M sodium acetate, pH 4.9
The AEC stock solution can be stored at 4~ prepare and store this solution in a glass vial and protect from light. The substrate mixture should also be prepared in a glass tube and can be stored at 0 to 8~ in the dark for up to 1 week. The solution will darken with time, but will still perform as required.
Procedure 1. Dilute streptavidin-HRP complex 1:250 in complex dilution buffer. 2. Apply 100-200/zl of diluted complex to slide that has been hybridized and washed. 3. Incubate the slide at room temperature for 10 to 20 min. (For tissue sections, use 500/xl diluted complex, and incubate at 37~ for 15 min).
9. Detectionof Horseradish Peroxidase by Colorimetry
225
4. Rinse the slide with a steady stream of wash buffer from a squeeze bottle for 10 sec, taking care not to squeeze the solution directly onto the specimen. Tap excess moisture off the slide. 5. Add 300-400 /~1 of the substrate mixture to the specimen and incubate at room temperature for 10 to 15 min. (For tissue sections, incubate at 37~ for 15 to 30 min. 6. Rinse the slide as in step 4. 7. Soak the slide for 1 min in each of three Coplin jars filled with wash buffer at room temperature. At this point, the slide is ready for viewing. Mount a coverslip on the slide, using water as the mounting medium. Do not use organic mounting agents, as the red precipitate in soluble in organic solvents. View at 40 to 400x magnification; light to brick-red deposits in the cells indicate positive reactivity (Fig. 3). Slides can be counterstained with 2% naphthol blue-black in water or with hematoxylin, if desired. Be careful to avoid heavy counterstaining, or positive results can be obscured.
a. P o t e n t i a l P r o b l e m s
Do not allow the slides to dry out during the detection procedure, or nonspecific background signal may arise. Also, be sure to wash the slides well before and after application of the detection complex, as insufficient washing can also lead to elevated background. Problems with insufficient signal are rare and can usually be traced to the slide preparation and hybridization steps. Be sure to completely denature double-stranded DNA probes, or low signal may result. Insufficient protease treatment of the slide before hybridization can also lead to low signals by preventing access of the probe and detection reagents to the target DNA. 2. D A B Detection
Reagents Streptavidin-HRP complex Diaminobenzidine tetrahydrochloride 1% H202 (prepared fresh from 30% stock) Complex dilution buffer
Wash buffer Dye solution Substrate mixture
1 x PBS, 1% BSA, 5 mM EDTA (1 x PBS is 130 mM sodium chloride, 10 mM sodium phosphate, pH 7.2) 1 x PBS, 5 mM EDTA 500/zg/ml DAB in 1 x PBS 25/zl 1% H202 + 2.5 ml dye solution
Fig. 3 (see also color p l a t e ) B A E C detection of biotinylated probes in an in situ hybridization. A biopsy specimen hybridized with probes for human papillomavirus types 16 and 18. Deep reddish-brown color indicates a positive reaction. The tissue section was counterstained with hematoxylin and viewed at 64 • Courtesy of ENZO Biochem.
9. Detection of Horseradish Peroxidase by Colorimetry
227
The DAB stock solution and the substrate mixture are unstable and should be prepared just before use.
Procedure 1. Dilute streptavidin-HRP complex 1:250 in complex dilution buffer. 2. Apply 100-200/xl diluted complex to slide that has been hybridized and washed. 3. Incubate the slide at room temperature for 10 to 20 min. (For tissue sections, use 500 ~1 diluted complex, and incubate at 37~ for 15 min). 4. Rinse the slide with a steady stream of wash buffer from a squeeze bottle for 10 sec, taking care not to squeeze the solution directly onto the specimen. Tap excess moisture off the slide. 5. Add 300-400 /xl of the substrate mixture to the specimen and incubate at room temperature for 2 to 10 min. 6. Rinse the slide as in step 4. 7. Soak the slide for 1 min in each of three Coplin jars filled with wash buffer at room temperature.
At this point, the slide is ready for viewing. Mount a coverslip on the slide and view at 40 to 400• magnification; dark rust deposits in the cells indicate positive reactivity. As with AEC detection, slides can be counterstained with 2% naphthol blue-black in water if desired. Be careful to avoid heavy couterstaining, or positive results can be obscured.
B. Microtiter Plate Assays A variety of microtiter plate assays have been developed for use with colorimetric detection systems, most involving detection of PCR-amplified DNA. The assays generally differ in the method of capturing the hybridized target in microtiter wells; some of the approaches include covalent crosslinking of a capture probe to the wells, capture by specific DNA-binding proteins, and capture by antisulfonated DNA antibodies. The various protocols use standard hybridization conditions, which will not be described here.
228
Peter C. Verlander
1. TMB Detection
Reagents Streptavidin-HRP complex 5 mg/ml TMB in 100% dimethylformamide 3% H202 (prepared fresh from 30% stock) Citrate-phosphate buffer Wash buffer Complex dilution buffer Substrate mixture Stop buffer
0.2 M Na2HPO4, 0.1 M citric acid, pH 5.3 1 x PBS, 0.1% Triton X- 100 1 x PBS, 0.1% Triton X-100, 1% bovine serum albumin (BSA) 100/~15 mg/ml TMB + 1 ml citrate-phosphate buffer + 33/xl 3% H202 2 M H2SO 4
Procedure 1. Following hybridization, wash three times with wash buffer. 2. Dilute streptavidin-HRP complex 1"250 in complex dilution buffer. 3. Add 50/xl diluted complex to each well; seal wells and incubate at 37~ for 30 min. 4. Wash wells as in step 1. 5. Combine 100/zl 5 mg/ml TMB with 10 ml citrate-phosphate buffer and 33/zl 3% H202; add 100/~1 of this substrate mixture to each well. 6. Incubate 30 min at room temperature. Blue reaction product should develop. 7. Stop the reaction by addition of 100/zl of stop buffer. Blue product should turn yellow. 8. Read OD450 with a microtiter plate spectrophotometer.
a. P o t e n t i a l P r o b l e m s
The major problem to contend with is high background levels. These problems can usually be traced to inadequate removal of excess probe or streptavidin-peroxidase complex. The level of background can vary depending on the microtiter plates used, the quality of the probe and the detection complex, and the conditions used to block nonspecific binding. While the conditions given should be sufficient to eliminate background in most cases, some experimentation may be necessary to optimize the conditions for a particular application. Other detergents, such as Tween20, and blocking reagents, such as nonfat dry milk, have been used in
9. Detection of Horseradish Peroxidase by Colorimetry
229
place of Triton X-100 and BSA in other laboratories (Kemp et al., 1990). If high background levels continue to be a problem, OPD can be used as a substrate in place of TMB.
2. OPD Detection Reagents Streptavidin-HRP complex o-Phenylene diamine tablets (Sigma) 3% H202 (prepared fresh from 30% stock)
Citrate-phosphate buffer Wash buffer Complex dilution buffer Stop buffer
0.2 M NazHPO4, 0.1 M citric acid, pH 5.3 1 x PBS, 0.1% Triton X- 100 1 x PBS, 0.1% Triton X-100, 1% BSA 2 M H2SO 4
Procedure 1. Following hybridization, wash three times with wash buffer. 2. Dilute streptavidin-HRP complex 1:250 in complex dilution buffer. 3. Add 50/xl diluted complex to each well; seal wells and incubate at 37~ for 30 min. 4. Wash wells as in step 1. 5. Dissolve 20.0 mg OPD in 10 ml citrate-phosphate buffer, and add 83/xl 3% H202. Add 100/xl of this to each well. 6. Incubate 30 min in the dark at room temperature. Brown reaction product should develop. 7. Stop the reaction by addition of 100 ~1 of 2 M H2SO 4. 8. Read OD492 with a microtiter plate spectrophotometer.
C. Membrane Hybridizations As mentioned earlier, colorimetric peroxidase detection techniques are generally not particularly useful for membrane applications such as Southern blots because of the lack of sensitivity of the technique, although the use of TMB as a substrate reportedly greatly increases the sensitivity (Sheldon et al., 1986; McKimm-Breschkin, 1990). Even so, peroxidase detection has been used with blot hybridization of PCR-amplified material, as well as for sandwich assays with a membrane matrix. Also, the combina-
230
Peter C. Verlander
tion of different detection systems can be applied to mapping fragments, generating two colors on a single blot (Fig. 4). 1. AEC Detection
Reagents Streptavidin-HRP complex 3-Amino-9-ethylcarbazole, 20 mg/ml in DMF 1% H20 2 (prepared fresh from 30% stock) 0.1 M Sodium acetate, pH 4.9 20 x SSC 10 x PBS Blocking buffer Complex dilution buffer High-salt washing buffer
Predetection buffer Substrate mixture
3.0 M sodium chloride, 0.3 M sodium citrate 1.3 M sodium chloride, 0.1 M sodium phosphate, pH 7.2 1 x PBS, 2% BSA, 0.1% Triton X-100, 5 mM EDTA 1 x PBS, 1% BSA, 5 mM EDTA 10 mM potassium phosphate, pH 6.5, 0.5 M sodium chloride, 0.05% Triton X-100, 0.1% BSA, 1 mM EDTA 2 • SSC, 0.1% BSA, 0.05% Triton X-100, 1 mM EDTA 20 /.1,1 20 mg/ml AEC stock solution + 1 ml 0.1 M sodium acetate pH 4.9 + 25 /xl 1% H202
Procedure 1. After stringency washes, rinse the filter twice at room temperature in 0.2• to 2• SSC to remove SDS. 2. Transfer the filter to a heat-sealing bag and add ---0.1 ml blocking buffer per cm 2 membrane. Seal and incubate at room temperature for 15 min. 3. Dilute streptavidin-HRP complex 1:250 in complex dilution buffer. 4. Remove blocking buffer from bag, and replace with diluted detection complex. Use 0.012 ml/cm 2, and seal after removing bubbles. Incubate at room temperature for 30 to 60 min. 5. Remove the filter from the bag, transfer to a dish with high-salt washing buffer, and gently agitate for 5 min. Repeat three times. 6. Wash the filter twice the gentle agitation in predetection buffer for 5 min each. 7. Transfer the filter to a clean dish containing freshly prepared
0
<.~
~'Z~ " ~ ~
~~
~ .~
o~
~
~'~'~ ~
~ ~'~ ,~'~
232
Peter C. Verlander
substrate mixture. Develop filter face up for up to 1 hr at room temperature. Color development is usually evident within 10 min. 8. Remove the filter, rinse with 1 x PBS, and allow to dry. Nylon membranes are preferable to nitrocellulose, as the color is retained on nylon, whereas the signal fades on nitrocellulose. However, the addition of water will restore the color to a nitrocellulose filter. As for microtiter plate assays, a variety of blocking agents can be used and should be tested with a given membrane if high background is a problem.
2. TMB Detection
The following protocol is adapted from Sheldon et al., 1986, and is claimed to be sufficiently sensitive to detect restriction fragment length polymerphisms (RFLPs) in the human genome. Since the oxidation product of TMB is normally water soluble, the problem is to stabilize the signal; this is accomplished by the inclusion of dextran sulfate, which is thought to capture the blue product. Even so, the stability of the signal is not particularly good, and the developed filter can not be stored for long periods.
Reagents Streptavidin-HRP complex 5 mg/ml TMB in 100% dimethylformamide 3% H202 (prepared fresh from 30% stock) Complex dilution buffer
Wash buffer Substrate mixture
5% Triton X-100, 2.7 mM KCI, 237 mM NaCI, 1.5 mM KH2PO4, 8 mM Na2PO4, pH 7.4 1% dextran sulfate, 0.15 M 1,1-diethylurea in complex dilution buffer 0.1 mg/ml TMB, 5% ethanol, 10 mM sodium citrate, 10 mM sodium citrate, 10 mM EDTA, pH 5.0
Procedure 1. After probe removal, rinse in complex dilution buffer. 2. Dilute streptavidin-HRP complex 1:250 in complex dilution buffer.
9. Detection of Horseradish Peroxidase by Colorimetry
233
3. Transfer the filter to a heat-sealing bag and add diluted detection complex. Use 0.012 ml/cm 2, and seal after removing bubbles. Incubate at room temperature for 40 min. 4. Wash five times for 5 min each in wash buffer to remove unbound detection complex. 5. Rinse in substrate mixture. 6. Incubate in the same buffer with the addition of H202 to 0.0014% for 30 to 60 min at room temperature. Read the results immediately. 7. Rinse four times in water, 30 to 60 min per rinse.
IV. C O N C L U S I O N S Colorimetric detection of HRP provides a rapid and convenient method for detection of DNA probes in a variety of assay formats. Although the sensitivity of other detection methods may sometimes be superior, peroxidase detection is sufficiently sensitive for many applications, and the speed of the reaction makes peroxidase detection the method of choice in many cases.
ACKNOWLEDGMENTS The author would like to thank Dr. Barbara Thalenfeld for supplying illustrations. Special thanks go to Dr. James Donegan for many helpful suggestions.
REFERENCES Avrameas, S. (1969). Coupling of enzymes to proteins with glutaraldehyde. Use of the conjugates for the detection of antigens and antibodies. Immunochemistry 6, 43-52. Bayer, E. A., and Wilchek, M. (1990). Biotin-binding proteins: Overview and prospects. Methods Enzymol. 184, 49-67. Bos, E. S., van der Doelen, A. A., van Rooy, N., and Schuurs, A. H. (1981). 3,3',5,5'Tetramethylbenzidine as an Ames test negative chromogen for horseradish peroxidase in enzyme-immunoassay. J. Immunoassay 2, 187-204. Brigata, D. J., Myerson, D., Leary, J. J., Spalholz, B., Travis, S. Z., Fong, C. K. Y., Hsiung, G. D., and Ward, D. C. (1983). Detection of viral genomes in cultured cells and paraffin-embedded tissue sections using biotin-labeled hybridization probes. Virology, 126, 32-50. Bugawen, T. L., Begovich, A. B., and Erlich, H. A. (1990). Rapid HLA-DPB typing using
234
Peter C. Verlander
enzymatically amplified DNA and nonradioactive sequence-specific oligonucleotide probes. Immunogenet. 32, 231-241. Burnette, W. N. (1991). Western blotting: Electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112, 195-204. Burns, J., Graham, A. K., and McGee, J. O'D. (1988). Nonisotopic detection of in situ nucleic acid in cervix: An updated protocol. J. Clin. Pathol. 41, 897-899. Dahlen, P., Syvanen, A. C., Hurskainen, P., Kwiatkowski, M., Sund, C., Ylikoski, J., Soderlund, H., and Lovgren, T. (1987). Sensitive detection of genes by sandwich hybridization and time-resolved fluorometry. Mol. Cell. Probes 1, 159-168. Denijn, M., De-Weger, R. A., Berends, M. J., Compier-Spies, P. I., Jansz, H., Van-Unnik, J. A., and Lips, C. J. (1990). Detection of calcitonin-encoding mRNA by radioactive and nonradioactive in situ hybridization: Improved colorimetric detection and cellular localization of mRNA in thyroid sections. J. Histochem. Cytochem. 38, 351-358. Dunn, A. R., and Hassell, J. A. (1977). A novel method to map transcripts: Evidence for homology between an adenovirus mRNA and discrete multiple regions of the viral genome. Cell 12, 23-36. Engvall, E., and Perlmann, P. (1972). Enzyme-linked immunosorbent assay (ELISA) quantitative assay of immunoglobulin G. Immunochemistry 8, 871-879. Graham, R. C., Jr., Lundholm, U., and Karnovsky, M. J. (1964). Cytochemical demonstration of peroxidase activity with 3-amino-9-ethylcarbazole. J. Histochem. Cytochem. 13, 150-152. Graham, R. C., Jr., and Karnovsky, M. J. (1966). The early stages of absorption of injected horseradish peroxidase in the proximal tubules of mouse kidney ultrastructural cytochemistry by a new technology. J. Histochem. Cytochem. 14, 291-302. Guttenbach, M., and Schmid, M. (1990). Determination of Y chromosome aneuploidy in human sperm nuclei by nonradioactive in situ hybridization. Am. J. Hum. Genet. 46, 553-558. Hardy, H., and Heimer, L. (1977). A safer and more sensitive substitute for diaminobenzidine in the light microscopic demonstration of retrograde and anterograde axonal transport of HRP. Neurosci. Lett. 5, 235-240. Harlow, E., and Lane, D. (1988). "Antibodies: A Laboratory Manual." Cold Spring Harbor Laboratories, New York. Holland, V. R., Saunders, B. C., Rose, F., and Walpole, A. L. (1974). Safer substitute for benzidine in detection of blood. Tetrahedron 30, 3299-3302. Hsu, U.-M., and Soban, E. (1982). Color modification of diaminobenzidine (DAB) precipitation by metallic ions and its application for double immunohistochemistry. J. Histochem. Cytochem. 30, 1079-1082. Jirikowski, G. F., Ramalho-Ortigao, J. F., Lindl, T., and Seliger, H. (1989). Immunocytochemistry of 5-bromo-2'-deoxyuridine labeled oligonucleotide probes. A novel technique for in situ hybridization. Histochemistry 91, 51-53. Keller, G. H., Huang, D. P., and Manak, M. M. (1989). A sensitive nonisotopic hybridization assay for HIV-1 DNA. Anal. Biochem. 177, 27-32. Kemp, D. J., Smith, D. B., Foote, S. J., Samaras, N., and Peterson, M. G. (1989). Colorimetric detection of specific DNA segments amplified by polymerase chain reactions. Proc. Natl. Acad. Sci. U.S.A. 86, 2423-2427. Kemp, D. J., Churchill, M. J., Smith, D. B., Biggs, B. A., Foote, S. J., Peterson, M. G., Samaras, N., Deacon, N. J., and Doherty, R. (1990). Simplified colorimetric analysis of polymerase chain reactions: Detection of HIV sequences in AIDS patients. Gene 94, 223-228. Kitazawa, S., Takenaka, A., Abe, N., Maeda, S., Horio, M., and Sugiyama, T. (1989).
9. Detection of Horseradish Peroxidase by Colorimetry
235
In situ DNA-RNA hybridization using in oioo bromodeoxyuridine-labeled DNA probe. Histochemistry 92, 195-9.
Langdale, J. A., and Malcolm, A. D. B. (1985). A rapid method of gene detection using DNA bound to Sephacryl. Gene 36, 201-210. Langer-Safer, P. R., Levine, M., and Ward, D. C. (1982). Immunological method for mapping genes on Drosophila polytene chromosomes. Proc. Natl. Acad. Sci. U. S. A. 79, 4381-4385. Langer, P. R., Waldrop, A. A., and Ward, D. C. (1981). Enzymatic synthesis of biotinlabeled polynucleotides: Novel nucleic acid affinity probes. Proc. Natl. Acad. Sci. U.S.A. 75, 6633-6637. Lee, J. J., Warburton, D., and Robertson, E. J. (1990). Cytogenetic methods for the mouse: Preparation of chromosomes, karyotyping, and in situ hybridization. Anal. Biochem. 189, 1-17. McKimm-Breschkin, J. L. (1990). The use of tetramethylbenzidine for solid-phase immunoassays. J. Immunol. Methods 135, 277-280. Morimoto, H., Monden, T., Shimano, T., Higashiyama, M., Tomita, N., Murotani, M., Matsuura, N., Okuda, H., and Mori, T. (1987). Use of sulfonated probes for in situ detection of amylase mRNA in formalin-fixed paraffin sections of human pancreas and submaxillary gland. Lab. Invest. 57, 737-741. Nakane, P. K. (1968). Simultaneous localization of multiple tissue antigens using the peroxidase-labeled antibody method: A study of pituitary glands of the rat. J. Histochem. Cytochem. 16, 557-560. Polsky-Cynkin, R., Parsons, G. H., Allerdt, L, Landes, G., Davis, G., and Raschtchian, A. (1985). Use of DNA immobolized on plastic and agarose supports to detect DNA by sandwich hybridization. Clin. Chem. 31, 1438-1443. Porstmann, B., Porstmann, T., and Nugel, E. (1981). Comparison of chromogens for the determination of horseradish peroxidase as a marker for enzyme immunoassay. J. Clin. Chem. Clin. Biochem. 19, 435-439. Ranki, M., Palva, A., Virtanen, M., Laaksonen, M., and Soderlund, H. (1983). Sandwich hybridization as a convenient method for the detection of nucleic acids in crude samples. Gene 21, 77-85. Renz, M., and Kurz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Saiki, R. K., Chang, C. A., Levenson, C. H., Warren, T. C., Boehm, C. D., Kazazian, H. H., Jr., and Erlich, H. A. (1988). Diagnosis of sickle-ceU anemia and beta-thalassemia with enzymatically amplified DNA and nonradioactive allele-specific oligonucleotide probes. N. Engl. J. Med. 319, 537-541. Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989). Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc. Natl. Acad. Sci. U.S.A. 86, 6230-6234. Sheldon, E. L., Kellogg, D. E., Watson, R., Levenson, C. H., and Erlich, H. A. (1986). Use of nonisotopic M13 probes for genetic analysis: Application to HLA class II loci. Proc. Natl. Acad. Sci. U.S.A. 83, 9085-9089. Sheldon, E., Kellogg, D. E., Levenson, C., Bloch, W., Aldwin, L., Birch, D., Goodson, R., Sheridan, P., Horn, G., and Watson, R. (1987). Nonisotopic M13 probes for detecting the beta-globin gene: Application to diagnosis of sickle-cell anemia. Clin. Chem. 33, 1368-1371. Singer, R. H., and Ward, D. C. (1982). Actin gene expression visualized in chicken muscle tissue culture by using in situ hybridization with a biotinated nucleotide analog. Proc. Natl. Acad. Sci. U.S.A. 79, 7331-7335. Straus, W. (1964a). Factors affecting the cytochemical reaction of peroxidase with benzidine and the stability of the blue reaction product. J. Histochem. Cytochem. 12, 462-469.
236
Peter C. Verlander
Straus, W. (1964b). Factors affecting the state of injected horseradish peroxidase in animal tissues and procedures for the study of phagosomes and phago-lysosomes. J. Histochem. Cytochem. 12, 470-480. Van Weeman, B. K., and Schuurs, A. H. W. M. (1971). Immunoassay using antigen-enzyme conjugates. FEBS Lett. 15, 232-236. Voller, A., Bidwell, D., and Bartlett, A. (1976). Microplate enzyme immunoassays for the immunodiagnosis of virus infections. In "Manual of Clinical Immunology" (Rose, N. R., and Friedman, H.) pp. 506-512. American Society for Microbiology.
10
Detection of Glucose 6Phosphate Dehydrogenase by Bioluminescence Jean-Claude Nicolas, Patrick Balaguer, B~atrice T~rouanne, Marie Agn~s Villebrun, and Anne-Marie Boussioux INSERM Unit6 58 F-34100 Montpellier, France
I. Introduction II. Materials A. Reagents 1. 2. 3. 4. 5.
Buffers Labeled Probes Enzyme Conjugates DNA Amplification Bioluminescent Adsorbent
B. Instrumentation III. Procedures A. Dot Blot Hybridization 1. Biotin-Labeled DNA Probe 2. Enzyme-Labeled Oligonucleotides
B. Reverse Dot Blot Hybridization C. Sandwich Hybridization D. DNA Strand-Exchange Assay 1. Quantitative Analysis of PCR Sequences 2. Qualitative Analysis of PCR Sequences
IV. Conclusions References
I. I N T R O D U C T I O N Nucleic acid hybridization has become a fundamental technique in biochemistry and molecular biology for detecting specific DNA sequences. Sensitive detection of the hybrid has been obtained using probes labeled with radioisotopes such as 32p, which unfortunately has a short halflife and is not well suited to routine application. Other labels have been developed for this purpose, such as enzymatic incorporation of biotinylNonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
237
238
Jean-ClaudeNicolaset al.
ated (Langer et al., 1981; Lo et al., 1988) or digoxigenin analogs (Lion and Haas, 1990) or chemical coupling of haptens (Lebacq et al., 1988; Hopman et al., 1987), biotin (Reisfeld et al., 1987; Forster et al., 1985) or enzymes (Renz and Kurtz, 1984; Saiki et al., 1988; Urdea et al., 1989). We used glucose-6-phosphate dehydrogenase (G6PDH) as a bioluminescent label in nucleic acid hybridization reactions, because this enzyme can be detected at the attomole level and has already been used successfully for bioluminescent immunoassays (T~rouanne et al., 1986). G6PDH is coupled with streptavidin or oligonucleotides, and detection is carried out using a bioluminescent chain reaction catalyzed by flavine mononucleotide (FMN) oxidoreductase and luciferase for Vibrio harveyi. Dot blot analysis on nitrocellulose filters can be performed using biotin as a label, and streptavidin-G6PDH to reveal labeled samples. Light emission is detected using photographic films or a photon-counting camera, which can provide a quantitative analysis. Some steps of this hybridization procedure can be eliminated by direct enzyme labeling of oligonucleotides; using luminescence as a detection system, several probes can be detected on the same filter. We have used this strategy for the rapid identification of papillomaviruses after polymerase chain reaction (PCR). Several papillomavirus-specific DNA sequences can be amplified using general oligonucleotide primers (Resnick et al., 1990; Van den Brule et al., 1990), and identified by hybridization with specific oligonucleotide probes. These DNA probes can be labeled with different enzymes; using luminescence reagents, it is possible to detect on the same dot these oligonucleotides labeled with peroxidase, alkaline phosphatase, or G6PDH. The papillomavirus type is rapidly identified by sequential revelation of each enzyme activity. This technique can also be used for identification of different mutations or polymorphism in DNA sequences. However, if the number of variants is too high, as is the case for human leukocyte antigen (HLA) typing, identification can readily accomplished by reverse hybridization (Saiki et al., 1989) between sequence-specific oligonucleotide probes immobilized on the filter and biotinylated amplified DNA samples. This prOcess can be used to screen a sample for all known allelic variants at an amplified locus. Oligonucleotide probes are elongated by chemical synthesis rather than enzymatically, and elongation with 20 nucleotides is sufficient to immobilize probes on Hybond-C-Extra (Amersham). DNA amplification is carried out with biotin-dUTP (uridine 5'-triphosphate (Lo et al., 1988) instead of biotinylated primers, and biotinylated PCR-amplified sequences are detected using streptavidin G6PDH and a bioluminescent reaction. For clinical analysis the nitrocellulose filter format is inconvenient. We thus developed a rapid bioluminescent assay, which can be performed in tubes using an oligonucleotide immobilized on Sepharose, and another
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
239
labeled with G6PDH. This procedure has been optimized to obtain high specificity, and it can be adapted for screening of numerous samples to identify pathogenic agents. Homogeneous systems using fluorescence energy have been described to quantify PCR sequences by hybridization in solution (Morrison et al., 1989). In order to improve sensitivity, we have developed a sensitive bioluminescent assay to monitor hybridization occurring in solution. DNA sequences are synthesized with two different labels (biotin and fluorescein) carried on the 5' end of each strand. These molecules are captured on a bioluminescent adsorbent comprising antifluorescein antibodies, FMN oxidoreductase, and luciferase coimmobilized on Sepharose. StreptavidinG6PDH is involved in an enzyme-channeling reaction and used to quantify biotinylated DNA sequences retained on the immunoadsorbent. This method can be used to quantify DNA sequences obtained after the amplification reaction. In certain conditions, the exchange of DNA strands between a double-labeled probe and a homologous target is specific enough to detect the presence of a single mutation in a 150-base pair sequence. It can also be applied to screen a great number of samples and used to identify sequences that are slightly different from reference probes. We used this technique for HLA typing, studying apolipoprotein polymorphism, and identifying different homologous viruses.
II. MATERIALS A. Reagents Dithiothreitol (DTT), decanal, S-acetyl mercapto-succinic anhydride (SAMSA), fluorescein isothiocyanate (FITC), gelatin, polyvinyl pyrolidone, and bovine serum albumin are obtained from Sigma Chemical Co., (St. Louis, Missouri). Ficoll, Sephadex G 50 Medium, CNBr-activated Sepharose 4B and Sephadex G25 PD 10 columns are purchased from Pharmacia LKB Biotechnology, Inc. (Piscataway, New Jersey). Glucose 6phosphate (G6P), glucose 6-phosphate dehydrogenase (G6PDH) from Leuconostoc mesenteroides (EC 1-1-1-49) (500 IU/mg at 25~ nicotinamide adenine dinucleotide (NAD), flavine mononucleotide (FMN) and biotinyl e-amino caproic acid N-hydroxy succinimide ester (biotin x NHS) are obtained from Boehringer. Para-nitro blue tetrazolium (pNBT), phenazine methoxy sulfate (PMS) and bromo-chloro-indolyl phosphate (BCIP) are Aldrich Chemical Co., (Milwaukee, Wisconsin) products. Succinimidyl 4-(N-maleimido-methyl) cyclohexane-l-carboxylate (SMCC) are from Pierce Chemical Co. (Rockford, Illinois). FMN oxidoreductase and luciferase are purified from Vibrio harveyi
240
Jean-Claude Nicolaset al.
according to the method described by Jablonski and DeLuca (Jablonski and De Luca, 1977). Enzymes are kept at -20~ in 20% glycerol. Luciferase and FMN oxidoreductase of P h o t o b a c t e r i u m f i s c h e r i can also be used to detect NAD(P)H and are available from Boehringer. Nitrocellulose filters (BA 83) are from Schleicher and Schuell, and Hybond C extra from Amersham (Little Chalfort, UK). Polaroid photographic films (20,000 ASA) are used for detection of bioluminescent reactions.
1. Buffers
9 1 • SSC buffer: 150 m M NaC1, 15 m M Na3 citrate, pH 6.8 9 1 • FPGe solution: 0.02% gelatin, 0.02% polyvinlypyrolidone, 0.02% Ficoll. 9 1 • hybridization buffer: 2 • SSC, 5 • FPGe, 25 m M KH2PO4, pH 7, 2.5 mM EDTA, salmon sperm DNA (0.2 mg/ml). 9 Washing buffer: Tris-HCl 100 mM, pH 7.5, NaC1 150 mM, Tween80 0.2% 9 Blocking buffer: washing buffer and 3% gelatin. 9 Incubation buffer: Tris-HC1 100 mM, pH 7.5, MgCI2 10 mM. 9 Bioluminescent reagent for filter hybridization: incubation buffer plus 10 -3 M NAD, 3 x 10 -3 M G6P, 10 -5 M FMN, 6 x 10 -5 M decanal, 50/zg/ml luciferase, 5 mlU/ml FMN oxidoreductase and I g/liter BSA. 9 Bioluminescent reagent for channeling reactions on Sepharose" 10 -3 M NAD, 3 • 10 -3 M G6P, 3 • 10 -3 M sodium pyruvate, 10 -5 M FMN, 6 • 10 -5 M decanal and 30 mlU/ml LDH in 0.1 M phosphate buffer, 0.15 M NaCI, and 1 g/liter BSA.
2. Labeled Probes
a. Labeling of Plasmids Plasmids are labeled with biotin dUTP by nick translation (BRL Kit). Biotin dUTP is used at a final concentration of 20/zM in the absence of dTTP. 1. Add to an Eppendorf tube: 9 5/zl dATP, dCTP, dGTP 0.2 mM in Tris-HCl 500 mM, pH 7.5, MgCI2 9 50 mM, 2-mercaptoethanol 100 mM, and BSA 100/xg/ml 9 1/xg DNA in 2/xl H20
10. Detectionof Glucose 6-Phosphate Dehydrogenaseby Bioluminescence
9 2.5/xl biotin-11-dUTP 0.4 mM, or digoxigenin dUTP 0.06 m M plus 0.14 m M dTTP 9 5/xl DNA polymerase 0.4 IU/ml, plus DNA nuclease 1 40 pg/ml 9 36.5/xl H 2 0 2. Centrifuge the tube and incubate for 2 hr at 15~ 3. Stop the reaction by adding 5 /zl EDTA 0.1 mM and 1.25 /zl SDS 1%. In these conditions the average length of fragments is 500 pb, and 10 to 20% of thymidine is replaced by biotin-11-dUTP.
b. Labeling of Oligonucleotides Oligonucleotides are enzymatically labeled with biotin-dUTP or dUTP digoxigenin using the deoxynucleotide terminal transferase.
Enzymatic Labeling 1. Add to an Eppendorf tube: 9 1/zl oligonucleotide 0.2 mM 9 2/xl potassium cacodylate 1 M, Tris base 250 mM, adjusted to pH 7.6 COC12 10 m M and DTE 2 m M 9 5/xl biotin-11-dUTP 0.4 mM 9 4/zl terminal transferase 25 IU//xl 9 8/zl water 2. Incubate for 2 hr at 37~ 3. Stop by heating 10 min at 95~ Two to four labeled molecules are incorporated per mole of oligonucleotide. Labeled oligonucleotides are recovered by gel filtration on a Sephadex G 25 column equilibrated with 0.1% SDS. Oligonucleotides with an amino group at the 5' end are coupled to biotin N-hydroxysuccinimide ester or fluorescein isothiocyanate.
Chemical Labeling 1. Add 500 /xl of a freshly prepared solution of N-biotinyl-6aminocaproic N-hydroxysuccinimide ester (10 mg/ml in DMF) or FITC (15 mg/ml in acetone) to 100 nanomoles oligonucleotides in 500/xl carbonate/bicarbonate 0.2 M, pH 9.5. 2. Incubate overnight at room temperature. 3. Remove excess reagent from the labeled oligonucleotides on a Sephadex G 25 PD 10 column, in 20 m M Tris-HC1 buffer, pH 8. A final purification can be done by high-pressure liquid chromatography (HPLC) on a C8 reverse phase column. To immobilize oligonucleotides on nitrocellulose filters, 20-mer tail of polyadenosine deoxynucleotides is added to the oligonucleotide during chemical synthesis.
241
242
Jean-ClaudeNicolaset al.
3. E n z y m e Conjugates
Measurement of GrPDH activity 1. In a spectrophotometer cuvette, add 910 /zl Tris-HC1 pH, 8, 0.05 M, MgClz 3 10 -3 M, 60/zl NAD, 0.1 M, 30/xl G6P, 0.3 M, and 10/xl enzyme solution. 2. Measure the absorbance increase at 340 nm for 1 min.
Incorporation of maleimide groups into G6PDH 1. Incubate 1.5 mg G6PDH in 500/zl of 0.1 M sodium phosphate, pH 7.5, containing 10 -4 M NADP, and 3 x 10 -3 M G6P with 25/xl of SMCC (10 -2 M in DMF) for 45 rain at room temperature. 2. Purify the modified enzyme on Sephadex G25 (PD 10) using 20 m M sodium phosphate, pH 6.4, containing 5 x 10 -3 M EDTA, and collect fractions having the highest activity. 3. Use immediately after preparation.
Preparation of thiolated streptavidin 1. Dissolve 1 mg streptavidin in 300 /xl 0.1 M sodium phosphate buffer, pH 7.5, and incubate with 6/zl of SAMSA (10 -1 M in acetonitrile) for 1 hr. 2. Add 30/xl hydroxylamine (1 M, pH 7.5) and 5/zl of DTT (0.1 M) and incubate for 20 min. 3. Purify thiolated streptavidin by gel filtration on Sephadex G 25 (PD 10) in 20 mM sodium phosphate, pH 6.4, containing 5 x 10 -3 M EDTA. 4. Collect the most concentrated fractions and add immediately after preparation to the modified G6PDH.
Preparation of streptavidin-G6PDH conjugate 1. 2. 3. 4.
Mix thiolated streptavidin and maleimide G6PDH fractions. Concentrate the mixture using an Amicon 30 to 100 to 200/zl. Incubate for 18 hours in the dark at room temperature. Purify the conjugate by FPLC on Superose 12 in 0.1 M sodium phosphate, pH 7.4, containing 2 x 10 -3 M 2-mercapto-ethanol a n d 2 • 10 - 3 M E D T A . 5. Store the conjugate fractions in 1% BSA and 20% glycerol at - 20oc.
G6PDH modified with SMCC incorporates five maleimide groups, and streptavidin modified with SAMSA incorporates at least three thiol groups. SMCC produces the weakest inhibition of G6PDH, but inhibits the binding of biotin to streptavidin. SAMSA is the best reagent for streptavidin since it results in less than 10% inhibition of biotin binding.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
243
The reaction of thiolated streptavidin with maleimido-G6PDH produces conjugates in good yield: 60% of the G6PDH activity is bound to streptavidin. Separation by fast purification by liquid chromatography (FPLC) on Superose 12 shows a high-molecular-weight fraction well separated from the free enzyme (Fig. 1). Fraction I gives the best results for detection on a filter, and fraction II gives lowest background when used for hybridization in solution.
Preparation of enzyme oligonucleotide conjugates Oligonucleotides with a thiol group at the 5' end are synthesized directly using a C6 thiol modifier from Clontech. After deprotection, oligonucleotides are incubated in 10-2 M DTT for 30 min, and excess reducing agent is eliminated by chromatography on a G25 column equilibrated with 20 mM sodium phosphate, pH 6.4, containing 5 x 10- 3 M EDTA. 1. Mix thiolated oligonucleotide and maleimide-modified G6PDH fractions. 2. Evaporate to 100/zl under vacuum at room temperature. 3. Incubate overnight. 4. Purify by FPLC on an anion exchange column (DEAE Spherodex). 5. Store fractions at -20~ in 1% BSA and 20% glycerol.
1000
-
-~ 8 0
8O0
I
60 6OO
II
4OO
20
200
0
0 10
12
14
16
18
20
22
24
26
28
30
Fractions
Fig. 1--Profiles of the reaction products of maleimide-G6PDH eluted from Superose 12 with thiolated streptavidin. Open circles (O) indicate G6PDH activity and closed circles (@) absorbance at 280 nm.
244
Jean-Claude Nicolas et al.
The reaction of thiolated oligonucleotides and maleimide G6PDH produces conjugates with a yield of 30 to 60%. The conjugate elutes from DEAE Spherodex column at 0.35 M NaCl and is well separated from free enzyme or oligonucleotides (Fig. 2).
4. DNA Amplification Symmetric DNA amplification is performed (Saiki et al., 1988) in a 100-/zl reaction mix containing 2/zg DNA, 0.2 mM dATP, dCTP, dGTP, dTTP, 0.5/zM of each primer in 1 • reaction buffer (10 mM Tris-HC1 pH 9, 50 mM KCI, 1.5 mM MgCI2. and 0.1 g/liter gelatin, Triton 0.1%). Samples are heated for 1 min at 95~ to denature the DNA. Two units of Taq polymerase (Promega) is added to each sample, which is incubated at 55~ for 1 min (annealing) and 2 min at 72~ for primer elongation. Further rounds, including 1-min denaturation, 1-min annealing and 2-min synthesis, are continued for 30 cycles. Asymmetric PCR is performed with a 10-nM concentration of the limiting primer. Labeling of DNA sequences during the amplification process is performed at a final concentration of 100/.~M for biotin-dUTP and l 0 / x M for dTTP. The incubation time for primer extension is extended to 3 min. Double labeling by biotin and FITC of a specific DNA sequence is done using two labeled primers. Primers are purified on a C8 reverse phase by
1000 [-
G6PDH 0.28 M NaC1
t
100
G6PDH-OLIGO 0.35 M NaCI
600
60
400
. - " "
40
200
[
[0
0 10
15
20
25
30
35
40
Fractions
Fig. 2 - - D E A E Spherodex profiles of the reaction products of maleimide-G6PDH with a thiolated oligonucleotide. Open circles (O) indicate G6PDH activity and closed circles (@) absorbance at 280 nm.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
245
HPLC. The amplified material (10 x 10/xl) is electrophoresed in a 12% polyacrylamide gel and the double-labeled sequence is extracted as described by Maniatis et al., (1982). The slices are crushed in 1 ml elution buffer (0.5 M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, pH 8, 0.1% SDS), and the acrylamide gel is discarded after centrifugation.
5. Bioluminescent Adsorbent
Oligonucleotide Adsorbent Bioluminescent adsorbents are prepared by coupling luciferase, FMN oxido-reductase and 5' amino oligonucleotide to Sepharose 4B. 1. Wash CNBr-activated Sepharose (1 g) with 200 ml 10 -3 M HCI. 2. Suspend Sepharose in 4 ml 0.1 M potassium pyrophosphate buffer, pH 8.2, containing 3 mg luciferase, 1 IU FMN oxidoreductase, and 0.1 mg 5' amino oligonucleotide. 3. Shake the suspension gently for 2 hr at room temperature and then overnight at 4~ 4. Wash the Sepharose with 0.1 M phosphate buffer, pH 7.2, and incubate with the same buffer containing 10 -3 M DTT under gentle shaking at room temperature. This buffer is changed three times, and the immunoadsorbent is stored at 4~ in 0.1 M phosphate buffer, pH 7.2, 10 - 3 M DTT, and 0.1% NAN3.
Antifluorescein Adsorbent Mouse anti-FITC monoclonal antibodies are precipitated from ascitic fluid using 50% ammonium sulfate, and the immunoglobulin solution is chromatographed on DEAE trisacryl M. The luciferase oxidoreductase enzyme system is coimmobilized on Sepharose 4B with an anti-FITC y-globulin antibody according to the following protocol: 1. Wash CNBr-activated Sepharose 4B (1 g) with 200 ml 10 -3 M HC1. 2. Suspend Sepharose in 5 ml 0.1 M potassium pyrophosphate buffer, pH 8.2, containing 5 mg luciferase, 1 IU oxidoreductase and 2 mg antibody. Shake the suspension gently for 2 hr at room temperature and then overnight at 4~ 3. Wash the Sepharose with 200 ml 0.1 M phosphate buffer, pH 7.2, and incubate with the same buffer containing 10-3 M DTT under
246
Jean-Claude Nicolas et
al.
gentle shaking at room temperature. This buffer is changed three times and the immunoadsorbent is stored at 4~ in 0.1 M phosphate buffer, pH 7.2, 10 -3 M DTT and 0.1% NaN 3.
B. I n s t r u m e n t a t i o n Oligonucleotides are made on an Applied Biosystem synthesizer model 391 using the phosphoramidite procedure. Hybridizations are performed in plastic bags and incubated under gentle shaking on a rotating shaker. PCR reactions are done with a Techne or MJ Research thermocycler. The latter instrument is also used for hybridizations in solution that require precise decreases of incubation temperatures. Light emission is visualized using a video camera system (Argus 100) that allows direct quantification of photon emission. Accurate photon counts for each spot can be performed; they show a good linear relationship between counts and amounts of target DNA. The photon-counting system provides higher sensitivity than photographic films and is limited only by background emission due to nonspecific adsorption of the label on the filter. Light emitted from bioluminescent adsorbent contained in polypropylene tubes is measured with an automated luminometer (LKB 1251).
III. PROCEDURES A. Dot Blot H y b r i d i z a t i o n 1. Biotin-Labeled DNA Probe Dot-blot hybridization is performed with biotinylated probes, which are detected using a streptavidin-G6PDH conjugate. Bound conjugate is detected by either a colorimetric or a bioluminescent assay (photographic detection). Bioluminescence is rapid and provides multiple exposure for single dot blots, which is valuable for identification of allele variations or mutations.
1. 2. 3. 4.
Denature DNA samples in H 2 0 at 98~ for 10 min. Cool on ice for 5 min. Add an equal volume of cold 20 x SCC. Apply 1/zl of sample onto a nitrocellulose filter.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
247
5. Dry at room temperature. 6. Bake at 90~ for 1 hr in an oven. 7. Place the filter in a plastic bag, add 1 ml of 1 x hybridization buffer per 5 cm 2 of filter, and incubate at 65~ overnight. 8. Change hybridization buffer. 9. Add denatured labeled probe (final concentration 100 ng/ml). 10. Incubate at 65~ overnight. 11. Wash the filter with 0.2 x SSC 0.2% Tween 80, twice at room temperature and twice at 65~ (10 min per wash). 12. Incubate in blocking buffer for 1 hr at 65~ 13. Incubate with blocking buffer containing 1 /zg/ml streptavidin-G6PDH at 37~ for 15 min. 14. Rinse with washing buffer three times under gentle shaking (10 min per wash). 15. Rinse with incubation buffer and blot the membranes to remove excess buffer.
Colorimetric Detection of G6PDH 1. Put the filter into a bag with 3 • 10-3 M NAD, 3 • 10-3 M G6P, 0.33 mg/ml pNBT, 0.02 mg/ml PMS in 50 mM Tris-HC1, pH 7.5, 150 m M NaC1, 10 mM MgCI2. 2. Incubate 3-10 hr and then wash the filter with water and dry. Serial dilutions of h DNA nick-translated with biotin-11-dUTP spotted onto nitrocellulose and detected by streptavidin-alkaline phosphatase or by steptavidin-G6PDH show similar detection limits for the two labels, but color development is faster with alkaline phosphatase than G6PDH (1 hr instead of 3 hr).
Bioluminescent Detection 1. Place the filter on a polyethylene sheet and add the bioluminescent reagent (10/zl/cm2). Cover the membrane with a second polyethylene sheet. Spread the reagent and remove air bubbles and excess of reagent. 2. Seal the edge and place in contact with photographic film or under a video camera.
Using highly sensitive polaroid film, DNA-bound G6PDH is rapidly detected. After 30 min, the sensitivity is similar to that of alkaline phosphatase detected by colorimetry, and since the nitrocellulose filter is not stained, it can be reused. Filters are reused bioluminescent detection after removing the bound probe by heating at 100~ for 15 min in 0.1 • SSC, 0.1% SDS. The filter is then successfully rehybridized to a second probe.
248
Jean-Claude Nicolas et al.
When the filter is to be reused, Hybond-C extra is chosen as the membrane, since it is stronger than nitrocellulose. Nylon filters result in excessively high background with G6PDH. Photographic detection is useful for studying the relative intensity of various spots. Since the film is highly sensitive, the exposure range is narrow, and contrast is very high. These properties are used to detect base mutations in human genomic DNA from several donors. We spotted four different HLA-DQfl sequences obtained after PCR amplification of human DNA and hybridized with a specific 17-mer oligodeoxynucleotide. The 4 DNA samples show 0, 1, 2, and 3 base mismatches with the oligodeoxynucleotide. Photographic detection of a few minutes reveals only DNA with 0 base mismatch (Fig. 3).
2. Enzyme-Labeled Oligonucleotides
1. 2. 3. 4. 5. 6. 7.
Denature DNA samples in H 2 0 at 98~ for l0 min. Cool on ice for 5 min. Add an equal volume of cold 20 x SCC. Apply 1/zl of sample onto a nitrocellulose filter. Dry at room temperature. Bake at 90~ for 1 hr in an oven. Place the filter in a plastic bag, add 1 ml 1 x hybridization buffer per 5 c m 2 of filter and incubate at 37~ for 1 hr. 8. Change hybridization buffer.
Fig. 3--PCR-amplified sequences of human DNA were hybridized with an oligonucleotide tailed with biotin dUTP. Polaroid film (20,000 ASA) were exposed for l, 6, and 30 min.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
249
9. Add specific labeled oligonucleotides (final concentration:
10 ng/ml). 10. Incubate at 37~ 1 hr. 11. Wash the filter with 0.2 • SSC 0.2% Tween-80, twice at room temperature and twice at 37~ (10 rain per wash). 12. Rinse with G6PDH incubation buffer and blot the membranes to remove excess buffer. 13. Place the filter on a polyethylene sheet and add the bioluminescent reagent (10/~l/cm2). Cover the membrane with a second polyethylene sheet. Spread the reagent and remove air bubbles and excess reagent. 14. Seal the edge and place in contact with photographic film or under a video camera and expose 1 to 10 min. 15. Rinse with peroxidase or alkaline phosphatase incubation buffer, blot the membranes to remove excess buffer, and repeat steps 13 and 14 with the corresponding luminescent reagent. Peroxidase is detected with the ECL reagent from Amersham and alkaline phosphatase with adamantyl dioxetane phosphate (AMPPD) (Photogene from Gibco BRL). Since AMPPD remains adsorbed on nitrocellulose, alkaline phosphatase detection must be performed last.
Using general primers it is possible to amplify several homologous human papillomaviruses (HPVs). Cells obtained from cervix scrapes are lyzed in boiling water, and 10/xl of the supernatant is amplified. After PCR, several labeled probes can be used for identification. The multidetection system avoids having to perform several hybridizations; moreover, the competition between the probes imporoves specificity of the hybridization reaction. Using oligonucleotide probes labeled with alkaline phosphatase, G6PDH, or peroxidase and a luminescent assay reagent, it is possible to identify papillomavirus 18, 16 and 11, or 6. From the same blot, different viruses are identified, and quantitative results are obtained as shown in Table I.
B. Reverse Dot Blot Hybridization Amplification is performed in the presence of 100/zM dUTP biotin and 20/xm dTTP. Amplified sequences are heat denatured and diluted 100fold in 1 • hybridization buffer.
250
Jean-Claude Nicolas et al. Table I Luminescence Values after Successive Detection of Enzyme-Labeled Oligonucleotidesa
Samples
G6PDH HPV 16 (23-mer)
Peroxidase HPV 11 (20-mer)
Phosphatase HPV 18 (20-mer)
1 2 3 4 Mix HPV (10 pg)
152,000 0 75,000 0 180,000
0 248,000 35,000 0 355,000
0 0 0 36,000 62,000
a Amplified sequences (1 /xl) are spotted on nitrocellulose filter and hybridized with the oligonucleotide mix. Background values for each detection system are subtracted. Counts from HPV references are not identical since hybridization yields and sensitivity of detection systems are different.
1. Apply 1/xl of each oligonucleotide (10 ng//zl in 10 x SSC) on a nitrocellulose filter. 2. Dry at room temperature. 3. Bake at 90~ for 1 hr in an oven. 4. Place the filter in a plastic bag, add 1 ml 1 x hybridization buffer per 5 cm 2 filter and incubate at 65~ overnight. 5. Add denatured labeled sample (final concentration: 100 ng/ml). 6. Incubate at 55~ overnight. 7. Wash the filter with 0.2 x SSC 0.2% Tween-80, twice at room temperature and twice at 55~ (10 min per wash). 8. Incubate in blocking buffer for 1 hr at 55~ 9. Incubate with blocking buffer containing 1 /zg/ml streptavidinG6PDH at 37~ for 15 min. 10. Rinse with washing buffer three times under gentle shaking (10 min per wash). 1 I. Rinse with incubation buffer and blot the membranes to remove excess buffer. 12. Place the filter on a polyethylene sheet and add the bioluminescent reagent (10/zl/cm2). Cover the membrane with a second polyethylene sheet. Spread the reagent and remove air bubbles and excess reagent. 13. Seal the edge and place in contact with photographic film or under a video camera.
I 0. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
251
Reverse dot blots are particularly valuable for assays in which the number of potential sequences to be analyzed exceeds the number of samples, as for HLA typing. Chemical tailing (20 bases) of oligonucleotides seems to be sufficient to immobilize probes on the filter. Luminescent detection allows better quantification and faster detection than colorimetric detection, and the filters can be reused for other assays.
C. Sandwich Hybridization Amplified DNA sequences are commonly detected using oligonucleotide probes by conventional filter hybridization, but for rapid analysis a simplified format is suitable. We have developed a rapid sandwich hybridization technique using a channeling enzymatic reaction on a bioluminescent support and a small amount of labeled oligonucleotide. When hybridization is performed in solution, reannealling of the double-strand DNA target leads to a strand-displacement reaction, reducing the hybridization yield with oligonucleotide probes. To solve this problem, an asymmetric PCR protocol can be used to produce single-strand DNA. We described a rapid and sensitive assay of viral DNA that does not require denaturation and separation steps. Hybridization is performed at 37~ using two different oligonucleotides, one labeled with G6PDH and the other immobilized on bioluminescent Sepharose (luciferase and oxido-reductase immobilized on Sepharose). The enzyme bound to the hybrid is detected by a channeling reaction that leads to light emission. This process does not require any separation step since the unbound enzyme does not lead to light emission. In the supernatant the unbound label produces NADH, which is oxidized by lactate dehydrogenase-pyruvate. In the solid phase, NADH, formed by the G6PDH-oligonucleotide bound to the target, is oxidized by FMN oxidoreductase and FMN. The immobilized luciferase oxidizes FMNH2 in the presence of an aldehyde and oxygen and emits light (Fig. 4). Thus without any separation step, the photons count is related to the amount of bound label.
Hybridization and Detection Procedure 1. Asymmetric amplification (30 cycles) is performed on 0.1 to 1 ~g DNA using an oligonucleotide primer ratio of 50 in order to obtain a single-strand DNA complementary to the oligonucleotides used for capture and detection. 2. Incubate 10 ~1 of the amplification medium with 20 femtomoles
252
Jean-Claude Nicolas et al.
Fig. 4--Principle of the bioluminescent DNA assay. The hybrid was captured by oligonucleotide immobilized on Sepharose. Luminescent signal is proportional to NADH produced by the hybridized probe.
G6PDH oligonucleotide and 2 mg bioluminescent Sepharose oligonucleotide for 2 hr at 37~ under gentle shaking. 3. Add 1 ml bioluminescent reagent containing 10 -3 M NAD, 3 • 10 -3 M G6P, 3 x 10 -3 M sodium pyruvate, 10-SM FMN, 6 x l0 -5 M decanal and 30 mIU/ml lactate dehydrogenase (LDH) in 0.1 M phosphate buffer, 0.15 M NaCl, and 1 gaiter BSA. 4. After a few minutes measure the luminescence (10 sec intervals).
Hybridization of double-strand DNA in solution is limited by the competition reaction between the complementary target strand and the probe. Thus, asymmetric amplification is recommended for routine analysis since it produces the best hybridization yield and a greater signal variation with different amounts of target (Fig. 5). Even at 37~ the method is very specific; the labeled oligonucleotide does not bind to nonspecific amplified DNA or sequences showing 3 base mismatches with the G6PDH probe. This is probably related to the low concentration of probe and target and to the bulky substitution produced by enzyme labeling or immobilization, which can affect the hybridization rate or stability of the hybrid. Oligonucleotide lengths must be chosen according their stability at the concentration used (14 to 20 bases depending on the G - C content). The small size and the low probe concentration allows us to use a bioluminescent channeling reaction that was initially described for immunoassays (Trrouanne et al., 1986); thus, no separation step is required. The detection limit of the bioluminescent assay is 20 attomoles of singlestrand DNA (107 molecules). It is possible to detect less than 100 viral bodies from 2/xg total DNA coupled to symmetric PCR, and using asymmetric amplification, the detection limit is 1000 copies. This method can be automated for rapid and specific identification of PCR-amplified products.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Biohminescence
253
100001 8000A O
6000
4000
2000
0 lxl01
lxl02
lxl03
lxl04
lxl05
lxl06
lxl07
lxl08
Copies / ~tg DNA Fig. 5--Bioluminescent quantitation of DNA sequences. DNA from HeLa cell was diluted in human DNA, and 2/zg of the mix was amplified. (A) symmetric amplification and denaturation, (@) asymmetric amplification, (O) nonspecific sequence.
D. DNA Strand-Exchange Assay Double-labeled sequences synthesized by PCR with biotinylated and FITC oligonucleotide primers are used as DNA probes. These probes are denatured and hybridized in solution in the presence of DNA sequences to be studied (homologous, different in size or sequence). The remaining reformed double-labeled hybrid is captured with a bioluminescent immunosorbent and detected with a streptavidin-G6PDH conjugate (Fig. 6). A similar method, using fluorescence and energy transfer, has been described for quantitative analysis of PCR sequences (Morrison et al., 1989), and we have modified the hybridization procedure in order to identify single base mutations or deletions. In equilibrium conditions, homology in sequence and in size between probes and targets is necessary to achieve complete disappearance of the signal. This new bioluminescent assay can be used for a rapid and nonradioactive analysis of sequences obtained by PCR.
254
Jean-Claude Nicolas et al.
Fig. 6mPrinciple of the DNA strand-exchange assay. The double-labeled hybrid is measured using a bioluminescent immunosorbent.
10. Detection of Glucose 6-Phosphate Dehydrogenase by Bioluminescence
255
1. Quantitative Analysis of PCR Sequences a. Quantitation of Double-Labeled Probes Concentrations of double-labeled probes are determined by a sandwich assay. A standard curve is obtained using a known concentration of a synthetic double strand (a 20-mer biotinylated oligonucleotide hybridized with its 20-mer complementary oligonucleotide labeled with FITC). All dilutions and incubations are carried out in buffer A: 0.01 M Tris HCP, pH 9 with 0.5 M NaCI, 0.5% gelatin, and denatured sonicated salmon sperm DNA (10/zg/ml).
1. Incubate 50 /xl biotin-fluorescein probe dilutions ( 1 0 -9 t o 10-12 M) with 50/xl bioluminescent anti-FiTC adsorbent (1 g wet adsorbent suspended in 20 ml buffer A) and 50/zl streptavidinG6PDH (2 mlU/ml) at room temperature for 2 hr under constant shaking. 2. Add the luminescent reagent: 10-3 M NAD, 3 x 10-3 M G6P, 3 x 10 - 3 M sodium pyruvate, 10-5 M FMN, 6 x 10-5 M decanal, and 30 mlU/ml LDH in 0.1 M phosphate buffer, 0.15 M NaC1, and 1 g/liter BSA. 3. Measure photon counts for 10 sec. Figure 7 shows a typical standard curve obtained with a doublelabeled hybrid. 100 -
-
10000
80
8000
60
6000
,~ O
40
4000
20
2000
0
|
1
, I
,I
I
I
I
I
I
I
10
'
'
~
'
'
'
'
~
0
100
femtomoles Fig. 7 m S t a n d a r d curves using a bioluminescent immunosorbent. (O) Luminescence values for increasing amounts of double-labeled hybrid. (@) Reannealling percentage as a function of nonlabeled target amounts added to 10 femtomoles of double-labeled probe.
256
Jean-Claude Nicolas et al.
b. Quantitation of Unlabeled Amplified Sequences 1. Add 1 to 10/.d unlabeled sequences obtained by amplification with 10 femtomoles of the homologous sequence labeled with biotin and FITC in 100/zl buffer A. Complete with amplification buffer, since small amounts of detergent (Triton • are contained in this buffer and can lead to some inhibition of the bioluminescent reaction. 2. Incubate for 10 min at 98~ cool rapidly to 60~ and incubate for 2 hr. 3. Centrifuge the samples and add 50/zl of the medium to luminometer tubes with 50/zl streptavidin-G6PDH and 50/xl bioluminescent adsorbent and incubate as described above.
A standard curve must be edited using known amounts of target DNA (Fig. 7). Luminescence values obtained for biological samples are plotted on this curve to determine DNA sequence concentrations. If sequences are identical and if the probe concentration [P] is known, the target concentration [T] can be determined from the equation: [T] = [P] • (1 - R p ) l R p ) where Rp is the reannealling percentage of the probe. In competitive assays the measurement range of the concentration is more restricted than in the sandwich assay. The advantage of the competitive assay is its more precise estimation of target amounts, since reannealling of the DNA target does not lead to underestimation, as does the sandwich assay.
c. Quantitative Analysis of RNA by RT-PCR The development of sensitive techniques for detection and quantification of mRNA is therefore'important to the cell biologist. Expression of eukaryotic mRNA has traditionally been studied using the Northern blot technique, but this method requires microgram quantities of RNA. Several strategies adapting RT-PCR to make it quantitative have been developed (Dukas et al., 1993; Dupl~m et al., 1993). We have shown that products of the polymerase chain reaction can be accurately quantified by competitive hybridization. We extend this method to the measurement of copy number of mRNA by performing reverse transcription before amplification.
1. Incubate total cellular RNA (0.2-0.4/xg) for 1 hr at 37~ in 25 #.1,1 of a reaction mixture containing 200 U Moloney murine leukemia
10. Detectionof Glucose6-Phosphate Dehydrogenaseby Bioluminescence
2. 3. 4. 5.
257
virus reverse transcriptase (BRL) and RT buffer [50 m M Tris HC1, pH 8.3, 3 m M MgC12, 75 m M KC1, 0.5 m M dATP, dGTP, dCTP, dTTP, 10 m M DTT, 20 U RNasin ribonuclease inhibitor (Promega) and 0.25 ~g random primers). Incubate 5 min at 98~ to inactivate reverse transcriptase. Purify cDNA by phenol extraction and resuspend in 100 ~1 water. Add 2.5/~1 cDNA solution to PCR buffer and perform PCR. Quantify PCR products as described in Section III,D,l,b.
Several RT-PCR experiments were performed on U 937 cell mRNA. The competitive hybridization assay was used to quantify PCR products after 18-32 amplification cycles. As shown in Fig. 8, amplification was exponential between 22 and 26 cycles for glucocorticoid receptor and clos mRNA between 18 and 24 cycles for GAPDH. To measure variation of c-fos and glucocorticoid mRNA level in U 937 cells, amplifications (24 cycles) were performed in separate tubes and PCR products were quantified by competitive assay. 2. Qualitative Analysis o f P C R S e q u e n c e s
If rehybridization is performed in conditions that hinder the formation of heteroduplex, hybridization occurs only between fully complementary sequences. 100 f -~
1o
0
E 0
E Q ix_
1
0.1 18
20
22
24
26
28
30
32
Cycle number
Fig. 8---cDNAreverse transcripts of U 937 cell (2.5/~1)were amplifiedby PCR and quantified by competitive hybridization assay. ~, Amplified products of glyceraldehyde 3 phosphate dehydrogenase cDNA; C), c-fos oncogene cDNA; @, glucocorticoid receptor cDNA.
Jean-Claude Nicolas
258
et
al.
1. Add 1/,1,1 unlabeled sequences obtained by amplification with 10 femtomoles of sequence labeled by biotin and FITC in 100/xl buffer A. 2. Incubate for 10 min at 98~ and then slowly decrease the incubation temperature (1 ~ per 3 min) to 60~ 3. Centrifuge the samples and add 50 /zl of the incubation medium to luminometer tubes with 50/zl streptavidin--G6PDH and 50 /xl bioluminescent adsorbent, and proceed as described above.
These hybridization conditions reduce the formation of heteroduplex. If luminescence values are identical to those obtained using a constant incubation temperature of 60~ this indicates that labeled and nonlabeled sequences are identical. On the contrary, if the sequence differs from the unlabeled sequence by a single base pair, the signal is greater, as shown in Table II. The analysis of a polymorphic part of apolipoprotein A2 gene showing a single mismatch reveals very significant differences between the procedures used during hybridization assays.
Table !! Double-Labeled Probe Percentages Obtained after Hybridization under Various Conditions ,,,
Gradient of temperature
Fixed temperature
Incubation conditions ~ DNA
Probe 1 (%)
Probe 2 (%)
Probe 1 (%)
Probe 2 (%)
1 2 3 4 5 6
6 7 6 40 38 14
41 42 39 8 5 16
5 6 4 8 3 7
4 6 5 6 4 8
a Amplified sequences (1 /~1) are incubated with 0.1 gl of doublelabeled probe. Probe 1 and 2 are 105-bp sequences that differ by a single bp in position 72. PCR sequences of DNA 1, 2, 3 are identical to probe 1. D N A 4 and 5 are identical to probe 2, and DNA 6 is heterozygous and shares both sequences.
10. Detection of Glucose 6-Phosphate Dehydrogenaseby Bioluminescence
259
IV. C O N C L U S I O N S Like alkaline phosphatase or peroxidase, glucose-6-phosphate dehydrogenase can be used to detect DNA probe on filters. We have developed various dot blot procedures to identify known DNA sequences. Glucose 6-phosphatase dehydrogenase shows the same sensitivity as alkaline phosphase, and luminescent reagent is commercially available. Only small amounts of reagents are required to soak the nitrocellulose filter; thus, this detection method is not expensive. It can be used at the same time as other detection systems, and several probes hybridized on the same sample can be detected successively. Direct labeling of oligonucleotides by enzymes provides a rapid method for screening PCR-amplified products, but for routine analysis in clinical laboratories, the filter hybridization procedure is difficult to automate, and hybridization in solution is the preferred format. G6PDH can be used either for sandwich or DNA strand-exchange assays and to identify and quantify PCR products. Whereas the methods are straightforward and do not require any separation steps, the specificity is excellent. Sandwich assays can be used when asymmetric PCR is performed for rapid quantitation of viruses in biological samples. The DNA strand-exchange assay is a new method that allows good sequence quantification and is more precise than sandwich assays, but the measurement range is more limited. This method is very specific and, if the reaction is performed in conditions that favor the formation of homoduplex, a single base mismatch can be identified even in a long 200-bp sequence. This method can be used to compare PCR sequences to reference sequences and can be a method for rapid screening of allele variations or single base mutations.
REFERENCES Dukas, K., Sarfati, P., Vaysse, N., and Pradayrol, L. (1993). Quantitation of changes in the expression of multiple genes by simultaneous polymerase chain reaction. Anal. Biochem. 215, 66-72. Dupl~a, C., Couffinhal, T., Labat, L., Moreau, C., Daniel Lamazi~re, J. M., and Bonnet, J. (1993). Quantitative analysis of polymerase chain reaction products using biotinylated dUTP incorporation. Anal. Biochem. 212, 229-236. Forster, A. C., McInnes, J. L., Skingle, D. C., and Symons, R. H. (1985). Nonradioactive hybridization probes prepared by the chemical labeling of DNA and RNA with a novel reagent, photobiotin. Nucleic Acids Res. 13, 745-761. Hopman, A. H. N., Wiegant, J., and Van Dujin, P. (1987). Mercurated nucleic acids probes, a new principle for nonradioactive in situ hybridization. Exp. Cell. Res. 169, 357-368. Jablonski, E., and DeLuca, M. (1977). Purification and properties of the NADH- and NADPH-specific FMN oxidoreductase from Beneckea harveyi. Biochemistry 16, 2932.
260
Jean-Claude Nicolas et al.
Langer, P. R., Waldrop, A. A., and Ward, D. C. (1981). Enzymatic synthesis of biotinlabeled polynucleotides: Novel nucleic acid affinity probes. Proc. Natl. Acad. Sci. U.S.A. 78, 6633--6637. Lebacq, P., Squalli, D., Duchenne, M., Pouletty, P., and Joannes, M. (1988). A new sensitive nonisotopic method using sulfonated probes to detect picogram quantities of specific DNA sequences on blot hybridizations. J. Biochem. Biophys. Methods. 15, 255-266. Lion, T., and Haas, O. A. (1990). Nonradioactive labeling of probe with digoxigenin by polymerase chain reaction. Anal. Biochem. 188, 335-337. Lo, Y-M. D., Mehla, W. Z., and Fleming, K. A. (1988). Rapid production of vector-free biotinylated probes using the polymerase chain reaction. Nucleic Acids Res. 16, 8719. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). "Molecular Cloning. A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Morrison, L. E., Halder, T. C., and Stols, L. M. (1989). Solution-phase detection of polynucleotides using interacting fluorescent labels and competitive hybridization. Anal. Biochem. 183, 231-244. Reisfeld, A., Rothenberg, J. M., Bayer, E. A., and Wiichek, M. (1987). Nonradioactive hybridization probes prepared by the reaction of biotin hydrazide with DNA. Biochem. Biophys. Res. Commun. 142, 519-526. Renz, M., and Kurtz, C. (1984). A colorimetric method for DNA hybridization. Nucleic Acids Res. 12, 3435-3444. Resnick, R. M., Cornelissen, M. T. E., Wright, D. K., Eichinger, G. H., Jan ter Schegget, H. S. F., and Manos, M. (1990). Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers. J. Natl. Cancer. Inst. 82, 1477-1484. Saiki, R. K., Gelfand, D. H., Stofffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-494. Saiki, R. K., Chang, C-A., Levenson, C. H., Warren, T. C., Boehm, C. D., Kazazian, H. H., and Erlich, H. A. (1988). Diagnosis of sickle-cell anemia and b-thalassemia with enzymatically amplified DNA and nonradioactive allele-specific oligonucleotide probes. N. Engl. J. Med. 319, 537-541. Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989). Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotides probes. Proc. Natl. Acad. Sci. U.S.A. 86, 6230-6234. T6rouanne, B., Carrie, M. L., Nicolas, J. C., and Crastes de Paulet, A. (1986). Bioluminescent immunoabsorbent for rapid immunoassays. Anal. Biochem. 154, 118--125. Urdea, M. S., Kolberg, J., Clyne, J., Running, J. A., Besemer, D., Warner, B., and SanchezPescador, R. (1989). Application of a rapid nonradioisotopic nucleic acid analysis system to the detection of sexually transmitted disease-causing organisms and their associated antimicrobial resistances. Clin. Chem. 35, 1571-1575. Van den Brule, A. J. C., Snijders, P. J. F., and Gordijn, R. L. J., Bleker, O. P., Meijer, C. J. L. M., and Walboomers, J. M. M. (1990). General primer-mediated polymerase chain reaction permits the detection of sequenced and still unsequenced human papillomavirus genotypes in cervical scrapes and carcinomas. Int. J. Cancer 45, 644--649.
11
Detection of Xanthine Oxidase by Enhanced Chemiluminescence Alain Baret Centre de Biologie M6dicale F-44007 Nantes Cedex 01, France
I. Introduction II. Materials A. Reagents B. Instrumentation III. Procedures A. Protein Blotting B. Nucleic Acid Blotting of Biotinylated DNA 1. Direct Analysis 2. Nucleic Acid Hybridization IV. Conclusions References
I. I N T R O D U C T I O N This chapter describes the application of xanthine oxidase (XO) labels, detected by a chemiluminescent assay, to the analysis of specific sequences of proteins or nucleic acids immobilized on a membrane (nylon, nitrocellulose) support. XO is a very efficient and well-documented producer of oxygen-derived free radicals (Bors et al., 1980) that can participate in the reactions leading to the oxidation of luminol (Hodgson et al., 1973; Wilhelm et al., 1986). The resulting light emission is dramatically enhanced using an optimized reagent consisting of an alkaline borate buffer (pH 10.3) containing hypoxanthine, luminol, an iron-EDTA complex, and sodium perborate (Baret et al., 1990). The mechanism of the reaction (Fig. 1) is consistent with an O2-driven Fenton reaction, leading in a recurring cycle to the generation of a flux of OH (Haber-Weiss reaction). This latter species, in conjunction with an excess of 02, can oxidize luminol with high efficiency, thus leading Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
261
262
Alain Baret 02
Perborate
_. H ~ ~ HzO2 UA 11:&1 ~ EDTA-Fe2+ \ 1
HX / IV ~ EDTAFe3+ 0z
UA
OH"
o;..~ ~
|
LOOH
l
Aminophthalate +LIGHT
Fig. 1--Mechanism of xanthine oxidase-dependent enhanced light emission. (1) XOdependent 02 production. (2) Production of H202 from perborate. (3) Production of H202 by spontaneous O~ dismutation. (4) O~-driven Fenton reaction. (5) Luminol oxidation. HX, Hypoxanthine; UA, uric acid; LH2, luminol; LH, luminol radical; LOOH, luminol endoperoxide.
to the emission of a stable light output. Each of the components of the signal reagent contributes to the optimization of the light emission. The iron-EDTA complex is the catalyst of the Haber-Weiss reaction, whereas free iron is without effect. The production of O H is related to the presence of H202, which is available from the decomposition of sodium perborate and the spontaneous dismutation of 02 produced during the XO reaction. The presence of a low dose of sodium perborate leads to the early availability of H 2 0 2, resulting in an optimal luminescent signal a few minutes after the reaction is triggered. The resulting XO assay can be readily applied to various competitive or immunometric solid-phase immunoassays (Baret et al., 1989; F e r t e t al., 1990) and to quantitative PCR assays (Whitby et al., 1993) with the characteristics of 1. high sensitivity (1.0 attomole XO) related to the specific enhancement of the iron complex,
II. Detection of Xanthine Oxidase by Enhanced Chemiluminescence
263
2. long-term luminescent signal (several days), 3. stable and ready-to-use luminescent reagent, and 4. stability and ease of preparation of XO conjugates (Fert et al., 1990). We describe protocols suitable for the detection of membrane-bound nucleic acids and proteins using XO-streptavidin or XO-anti-Ig conjugates.
II. MATERIALS A. Reagents The signal reagent consists of 0.2 M borate buffer, pH 10.3, containing 1 mM hypoxanthine, 25 /xM luminol, 20 /zM sodium perborate, and 15.6/xM EDTA-Fe 3§ complex (molar ratio EDTA/Fe = 2). The complex is previously prepared as a 16000-fold concentrated form by diluting a stock solution of FeC13 (7.76 M) in a solution of Na-EDTA (250 mM) in water. After a delay of 5 days, the resulting signal reagent can be kept for at least 6 mo in this optimized ready-to-use form in the dark at 4~ without significant loss of activity. XO-streptavidin and IgG-XO conjugates are prepared using a heterobifunctional maleimide derivative, as previously described (Fert et al., 1990). Purified XO (cow's milk; specific activity 1.23 U/mg) is purchased from Biozyme (Gwent, Great Britain) as an ammonium sulfate suspension. Streptavidin is purchased from Sigma (St. Louis, Missouri) and goat antispecies-specific IgGs are from Jackson Laboratories (West Grove, PA). Several types of support can be used including nitrocellulose (Bio-Rad Laboratories, Richmond, California) and positively charged or neutral nylon (Biodyne A and B; Immunodyne, Pall, Portsmouth, Great Britain) membranes. Higher sensitivity is obtained using nylon membranes, but the nonspecific fixation of the conjugate or nucleic probes may be higher.
B. Instrumentation As can other long-term luminescent systems, enhanced XO luminescence can be detected using three different systems. Advantages and pitfalls of each alternative have already been discussed (Stanley, 1992a,b; Bronstein, 1994). 1. For membrane-bottomed microtiter plates, a wide variety of luminometers adapted to this format are now available. 2. Photon-counting cameras connected to an image processing device are the most appropriate instruments in term of practicality and sensitivity.
264
Alain Baret
3. The cheapest alternative is represented by light-sensitive films (Hyperfilm, Amersham). Measurement of the intensity of the signal is not possible and it is necessary to adapt the exposure time empirically.
III. PROCEDURES A. Protein Blotting The use of the luminescent XO system in protein blotting has already been described (Baret et al., 1991; Jansen et al., 1991). Figures 2-4 show some further examples of applications performed using XO-anti-Ig or X O - S A conjugates and photographic film or a CCD camera as the detector. Protein blotting is generally performed on nitrocellulose membranes, although a nylon support may also be employed.
1. Perform dots (slots) or transfer proteins onto nitrocellulose or nylon membrane (Biodyne A or B, Immunodyne) using a conventional procedure. 2. Dry the blotted membrane for a minimum of 30 min at ambient temperature. 3. Block the membrane with incubating buffer consisting of PBS containing 0.1% Tween 20 (nitrocellulose) or 0.5% Tween 20 and 1% BSA (nylon) for 30 min at room temperature.
Fig. 2mPhotographic detection of a protein blot on various membranes: A, nitrocellulose; B, Immunodyne; C, Biodyne A; D, Biodyne B. Monoclonal mouse IgG (a, 1.0 ng; b, 100 pg; c, 10 pg; d, 1.0 pg; e, 0.1 pg) was blotted and then incubated with anti-mouse IgG-XO conjugate (1.0/.tg/ml) for 1.0 hr. Exposure time: 1.0 hr.
II. Detection of Xanthine Oxidase by Enhanced Chemiluminescence
265
Fig. 3mPhotographic detection of a protein Western blot on a nitrocellulose filter. Various doses of human transferrin (holoform: A, l0 ng; B, 1.0 ng; C, 100 pg) were electrophoresed (PAGE) and then electrotransferred to a nitrocellulose membrane. The membrane was incubated in rabbit anti-human transferrin IgG and then in goat anti-rabbit IgG-XO conjugate (0.5/xg/ml) for 1.0 hr. Exposure time: 20 min.
4. Incubate the membrane in specific primary antibody, appropriately diluted in the respective incubating buffers for nitrocellulose and nylon membranes, under gentle agitation. 5. Wash the membranes 3 x 5 min in an excess of the appropriate incubating buffer (3.0 ml/cm 2) under gentle agitation. 6. Incubate in XO conjugate, appropriately diluted in the incubating buffer, for 30 min (XO-streptavidin conjugate) or 30-60 min (XO-anti-Ig conjugate) at room temperature under gentle agitation.
Fig. 4---Detection of human anti-HIV 1 antibodies on nitrocellulose membranes using a CCD camera (Image Research Ltd). Western blotted HIV1 antigens (Diagnostic Pasteur) were incubated with 5 or 20 /zl serum diluted in 2 ml PBS containing 0.1% Tween 20 and then with anti-human IgG-XO conjugate (0.2/zg/ml) for 1.0 hr. Exposure time: 20 min. (a) 20-/xl positive control; (b) 5-/zl positive control; (c) 20-/zl negative control.
266
Alain Baret
7. Wash the membranes 3 • 5 min in 0.025 M borate buffer, pH 8.0, containing 0.05% BSA, 0.001% Tween 80, and 0.05% sodium azide. 8. Drain excess washing buffer and immerse membranes in signal reagent (1.0 ml/cm 2) for 5-30 min. Immersion time is not critical. 9. Drain excess signal reagent and wrap the nitrocellulose membrane (protein side up) in a polyester bag. Expose to a light-sensitive film inside an autoradiography cassette (exposure time: 10 min to 6 hr, according to the required sensitivity), or expose imagebound label using a CCD camera.
B. N u c l e i c Acid Blotting The potential use of the enhanced luminescent XO system in nucleic acid blotting has been evaluated previously (Nicolas et al., 1991). Figure 5 shows the outline of the different procedures using the X O - S A conjugate for the analysis of biotinylated DNAs (i.e., biotinylated PCR products; Fig. 6) and of hybridized biotinylated DNA probes (Fig. 7).
1. Direct Analysis of Biotinylated DNA 1. Perform dot blots or transfer biotinylated DNAs, after electrophoretic separation, onto nylon or nitrocellulose membranes (Biodyne A or B, Pall) 2. Dry the blotted membranes for a minimum of 30 min at ambient temperature. 3. Block the membranes for 30 min at room temperature with incubating buffer (3 ml/cm 2) consisting of PBS containing 1% BSA and 0.5% Tween 20 (nylon) or 0.1% Tween 20 (nitrocellulose). 4. Incubate in X O - S A conjugate appropriately diluted in the appropriate incubating buffer for 30 min at room temperature under gentle agitation. 5. Wash the membrane 3 x 5 min in an excess of washing buffer (0.025 M borate, 0.05% BSA, 0.001% Tween 20, 0.05% sodium azide, pH 8.0) under gentle agitation. 6. Drain excess signal reagent and wrap the nitrocellulose membrane (nucleic acid side up) in a polyester bag. Expose to a light-sensitive film inside an autoradiography cassette (exposure time: 10 min to 6 hr, according to the required sensitivity) or expose imagebound label using a CCD camera.
II. Detection of Xanthine Oxidase by Enhanced Chemiluminescence
267
DETECTION AFTER HYBRIDIZATION
DIRECT DETECTION OF BIOTINYLATED D N A
BLOTS
ELECTROPHORESIS
ELECTROPHORESIS
TRANSFER
TRANSFER ii
if
V UV FIXATION
UV FIXATION
PREHYBRIDIZATION HYBRIDIZATION (B iotinyla~d probe) STRINGENCY WASUES SATU~TION 30' INCUB~ATION IN XO-SA CONJUGATE WAS~ING SIGNA~REAGENT EXPOSURE (camera, Photographic film) Fig. 5---Outline of the procedures employing XO-SA conjugates for the detection ofbiotinylated DNAs and hybridized DNA probes.
Fig. 6mDetection of 5' biotinylated PCR-amplified probe on nitrocellulose membrane using XO-SA conjugate and a photon-counting camera (Argus 100/CI, Hamamatsu). (a) 10 ng; (b) 1.0 ng; (c) 100 pg; (d) 10 pg" (e) 1.0 pg.
268
Alain Baret
Fig. 7mDetection of hybrid with biotinylated oligonucleotides. HLA DQ/B typing and XO-SA conjugate on nitrocellulose membrane using a photon-counting camera (Argus 100/ CL, Hamamatsu).
2. Nucleic Acid Hybridization 1. Perform dot blots or DNA transfers after electrophoretic separation on nylon or nitrocellulose membranes (Biodyne A or B, Pall) 2. Prehybridize in bags containing 0.30 ml hybridization buffer/cm 2 membrane for a minimum of 30 min at the optimal hybridization temperature. The composition of the hybridization buffer is SSPE at the selected level, 5X Denhardt's solution, 0.1% SDS, and 0-30% formamide. 3. Add biotinylated probe (0.2 ml/cm 2 membrane) at a final concentration of 20 ng/ml. Hybridize 1 hr to overnight at the optimal hybridization temperature. 4. Perform two washes using appropriate buffers, consisting of selected levels of SSPE and 0.1% SDS. 5. Proceed to previously described steps 3-6.
IV. C O N C L U S I O N S Xanthine oxidase can be used as a universal tracer in blotting applications in immunology and molecular biology. It offers a viable alternative, in routine and research applications, to other isotopic and nonisotopic labels. As for other luminescent systems, a photon-counting camera is advantageous (sensitivity, quantification of the signal, measurement time, dynamic range), but the use of photographic films leads to satisfactory qualitative results in most applications.
I!. Detection of Xanthine Oxidase by Enhanced Chemiluminescence
269
REFERENCES Baret, A., and Fert, V. (1989). T4 and TSH ultrasensitive immunoassays using luminescent enhanced xanthine oxidase assay. J. Biolumin. Chemilumin. 4, 149-153. Baret, A., Fert, V., and Aumaille, J. (1990). Application of a long term enhanced xanthine oxidase induced luminescence in solid-phase immunoassays. Anal. Biochem. 187, 20-26. Baret, A., Nicolas, J. C., and Perot, C. (1991). Long term enhanced xanthine oxidase system in protein blotting. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 191-194. Wiley, Chichester. Bors, W., Saran, M., and Czapski, C. (1980). The nature of intermediates during biological oxygen activation. In "Developments in Biochemistry" (W. H. Bannister and J. V. Bannister, eds.), Vol. llB, pp. 1-31. Elsevier North Holland, New York. Bronstein, I., Fortun, J., Stanley, P. E., Stewart, G. S. A. B., and Kricka, L. J. (1994). Chemiluminescent and bioluminescent reporter gene assays. Anal. Biochem. 219, 169-181. Fert, V., and Baret, A. (1990). Preparation and characterization of xanthine oxidase-antibody and -hapten conjugates for use in sensitive chemiluminescent immunoassays. J. Immunol. Methods 131, 237-247. Hodgson, E. K., and Fridovich, I. (1973). The mechanism of the activity-dependent luminescence of xanthine oxidase. Anal. Biochem. Biophys. 172, 202-205. Jansen, E. M. J. M., Laan, C. A., Van Den Berg, R. H., and Reinerink, E. J. M. (1991). Chemiluminescence detection of cytochrome P 450 isoenzymes on Western blots with different enzyme systems. Anal. Chim. Acta 255, 359-362. Stanley, P. E. (1992). Survey of more than 90 commercially available luminometers and imaging devices for low light measurements of chemiluminescence and bioluminescence, including instruments for manual, automatic and specialized operation, for HPLC, LC, GLC and microtiter plates. Part 1: Description. J. Biolumin. Chemilumin. 7, 77-108. Stanley, P. E. (1992). A survey of more than 90 commercially available luminometers and imaging devices for low light measurements of chemiluminescence and bioluminescence, including instruments for manual, automatic and specialized operation, for HPLC, LC, GLC, and microtiter plates. Part 2: Photography. J. Biolumin. Chemilumin. 7, 157-169. Whitby, K., Garson, J., and Baret, A. (1993). A microtiter format quantitative PCR assay for HCV RNA employing xanthine oxidase generated chemiluminescence. Federation o f European Microbiological Societies Symposium on Hepatitis C and Its Infection. June 25-July 1, 1993, Istanbul. Abstract p. 137. Wilhem, J., and Vilim, V. (1986). Variables in xanthine oxidase initiated luminol chemiluminescence measurements in biological systems. Anal. Biochem. 158, 201-210.
El e ctro ch e m i l u m i n e s c e nt Detection of PeR-Derived Nucleic Acids Elena D. Katz Perkin-Elmer Corporation Norwalk, Connecticut 06859
John M.
Wages1 Genelabs Technologies Redwood City, California 94063
I. Introduction II. Materials A. Reagents 1. 2. 3. 4. 5. 6.
External RT-PCR Standard Internal RT-PCR Standard PCR Master Mix PCR Buffer II Hybridization Probes Magnetic Beads
B. Instrumentation III. Procedures A. PCR Amplification B. Probe Hybridization and Bead Capture C. Automated Measurements with the QPCR System 5000 IV. Examples V. Troubleshooting A. General Guidelines for Establishing High-Performance Quantitative PCR B. Other Troubleshooting Guidelines References
I. INTRODUCTION A number of nonisotopic nucleic acid detection methods that utilize colorimetric, fluorescent, chemiluminescent, and electrochemiluminescent labels have recently been developed (Leland and Powell, 1990; Vlieger et al., 1992; Whetsell et al., 1992). Use of an electrochemiluminescent label, tris (2,2'-bipyridine) ruthenium (II) chelate (TBR), in conjunction with a specifically designed detection system has been shown to provide sensitive and precise PCR product detection (Blackburn et al., 1991; DiCesare et i All experimental results were obtained at SRA Technologies, Inc., Rockville, MD 20850. Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
271
272
Elena D. Katzand John M. Wages
al., 1993;Amplifications, 1993; Nill et al., 1994a,b; Robertson et al., 1994).
The chemiluminescent-active species, TBR, and a reactant, tripropylamine, are employed in the electrochemiluminescence process. The chemiluminescent reactions that occur in an electrochemical cell are initiated electrically by applying the voltage to the electrochemical cell electrode. As a result, two reactions, TBR and tripropylamine oxidations, take place simultaneously. On collision of the oxidized TPA with the oxidized TBR molecule, the TBR molecule is converted to an excited state that relaxes back to the ground state, emitting light at 620 nm. The emitted light is detected by an instrument developed to automate the electrochemiluminescence process (DiCesare et al., 1993). The intensity of the emitted light is directly proportional to the TBR concentration on the electrode. Consequently, the emitted light intensity will be proportional to the concentration of amplified DNA that contains the incorporated TBR label. The TBR label has the advantage of high stability; consequently, it can be incorporated during oligonucleotide synthesis. For PCR product detection, the TBR label can then be employed as part of a specific oligonucleotide probe to carry out hybridization subsequent to PCR amplification. Since TBR is thermostable, the TBR-labeled oligonucleotide can also be employed as a PCR primer directly incorporated during PCR amplification (Van Houten et al., 1993; Nill et al., 1994a,b; Robertson et al., 1994). To maximize the sensitivity of an electrochemiluminescence assay, target DNA is amplified with two primers, one of which is biotinylated. After biotinylated PCR product is hybridized to a specific TBR-labeled probe, the hybrid is captured by magnetic beads coated with streptavidin (SA) groups. The TBR-labeled DNA hybrid bound to the SA beads is transferred to the instrument and collected on an electrode that is magnetized. Use of the electrochemiluminescent-based assay for sensitive and precise PCR product quantitation will be discussed in this chapter in detail.
II. MATERIALS A. Reagents 1. External RT-PCR Standard
An RNA transcript is prepared from a clone of the gag region of HIV1 by T7 RNA polymerase from pDAB72, which was obtained through the AIDS Research and Reference Reagent Program (Division of AIDS, NIAID, NIH) from Dr. Susan Erickson-Viitanen (Erickson-Viitanen et
12. ElectrochemiluminescentDetection of PCR-Derived Nucleic Acids
273
al., 1989). A 136-bp HIV-1 fragment, amplified with GAG-3 and 5'-biotinGAG-6 primers, is used as HIV wild-type RNA. The primer sequences are as given by Michael et al. (1992). For transcript serial dilutions, a solution of 2.5% NP-40 (Sigma Chemical Company, St. Louis, Missouri), 2 mM dithiothreitol (DDT), 1 U//xl rRNasin (Promega, Madison, Wisconsin) was used.
2. Internal RT-PCR Standard
An internal standard is prepared by 5' add-on PCR of primer GAG-3, primer 5'-biotin-GAG-6, and T7 RNA polymerase promoter sequences to the PCR MIMICS TM template (Clontech, Palo Alto, California). In addition to containing an HIV-unrelated sequence, the internal control is designed to be 172 nucleotides in length, compared with the 136-nucleotide HIV wild-type RNA. This approximately 30% longer template can easily be resolved after 40 cycles of PCR by either gel electrophoresis or anionexchange HPLC (Katz et al., 1990). Following 5' add-on PCR, the resulting template is transcribed with a high-yield in vitro transcription kit (MegaScript TM T7; Ambion, Austin, Texas). Purity of the resulting RNA can be checked by agarose gel electrophoresis. Concentration is determined by measurements of UV absorbance at 260 nm. 3. PCR Master Mix
The composition of PCR master mix is 10 mM Tris-Cl, pH 8.3, 50 mM KCI, 2.0 mM MgC12, 0.2/xM each of GAG-3 and 5'-biotin-GAG-6 primers, 200/zM each of dATP, TTP, dCTP, and dGTP (U.S. Biochemical, Cleveland; Ohio), and 5 U per reaction of AmpliTaq | DNA polymerase (PerkinElmer Corporation, Applied Biosystems Division, Foster City, California). 4. PCR Buffer II
The electrochemiluminescent assay is performed in GeneAmp | 1 x PCR buffer II (10 mM Tris-C1, pH 8.3, 50 mM KC1) (Perkin-Elmer). 5. Hybridization Probes
Biotinylated primers and TBR-labeled probes can be obtained from Perkin-Elmer or Baron Biologicals (Milford, Connecticut). Two hybridization probes, XMZ-1 and GPR-5, are synthesized with the TBR label incorporated at the 5' end (X = TBR):
274
XMZ-1: GPR-5:
Elena D. Katz and John M. Wages
5'-X-GCCTAGCCCTACAGATTCCAAGTTTTATCG 5'-X-ATGAGAGAACCAAGGGGAAGTGACATAGCA
Biotinylated primers and TBR-labeled probes can also be synthesized in house using biotin and TBR phosphoramidites (Perkin-Elmer, Applied Biosystems). The primers and probes should be purified using a highresolution technique such as polyacrylamide gel electrophoresis or HPLC.
6. Magnetic Beads To capture biotinylated PCR product, magnetic polystyrene beads 4.5/~m in diameter, derivatized with streptavidin are used (QPCR TM Streptavidin Beads, Perkin-Elmer).
B. I n s t r u m e n t a t i o n Amplifications are performed using a GeneAmp TM PCR System 9600 (Perkin-Elmer). Automated electrochemiluminescence measurements are performed using a QPCR TM System 5000 (Perkin-Elmer). The instrument, details of which are given elsewhere (DiCesare et al., 1993), incorporates the electrochemical flow cell in which the chemiluminescent reactions take place on the surface of the working electrode. The instrument also incorporates the magnetic arm that is situated in proximity to the working electrode to collect DNA hybrid bound to the magnetic beads. This allows unhybridized TBR-labeled probe to be washed away while maximizing a luminescent signal of the emitted light, which is measured by a photomultiplier tube. Denaturation (95~ and hybridization (typically 55-60~ can be performed in any suitably heat-stable vessel, including microcentrifuge tubes or 96-well plates, although 0.5-ml GeneAmp or 0.2-ml MicroAmp TM reaction tubes (Perkin-Elmer) used with a GeneAmp PCR System are recommended for precise temperature control. The 96-well array permits the use of multichannel pipettors or automated laboratory workstations for liquid volume transfer for efficient high-throughput applications. In the current QPCR System 5000 instrument, an additional step is required to transfer the hybridization reactions from the 96-weU tray or plate to the QPCR sample tubes, for placement into the 50-tube carousel. For high-throughput assays, it should be feasible to use variable-spacing multichannel pipettors (Matrix Technologies, Lowell, Massachusetts) or laboratory robotic workstations (BiomekTM, Beckman Instruments, Fullerton, California) to automate the sample transfer.
12. Electrochemiluminescent Detection of PCR-Derived Nucleic Acids
275
III. PROCEDURES A. PCR Amplification Reverse transcription is performed with 40 U MMLV-RT (Gibco/BRL, Grand Island, NY) per 20-/zl reaction and 20 pmol 5'-biotin-GAG-6 (antisense) primer. Reverse transcription is performed for 15 min at 42~ followed by 5 min at 99~ to inactivate reverse transcriptase and cooling to 4~ Thermal cycling is then performed (GeneAmp PCR System 9600, Perkin-Elmer): hold at 95~ 5 min 10 cycles of 94~ 15 sec; 56~ 30 sec; 72~ 30 sec 20 cycles of 92~ 15 sec; 56~ 30 sec; 72~ 30 sec hold at 72~ Terminating the reaction at 72~ is particularly important in reactions using uracil-N-glycosylase (UNG; AmpErase TM, Perkin-Elmer) for PCR product carryover prevention (Longo et al., 1990), since UNG activity is slowly recovered at temperatures below 55~
B. Probe Hybridization and Bead Capture A general protocol for probe hybridization and bead capture is recommended.
1. Prepare hybridization mix (use 0.5-ml GeneAmp or 0.2-ml MicroAmp reaction tubes, depending on which GeneAmp PCR System is used). 9 take 2/zl PCR sample 9 add 10 pmol TBR probe 9 add 1 • PCR Buffer II (no Mg 2§ to 50/xl total volume 2. Prepare "negative" hybridization mix 9 take 2/~1 negative PCR sample 9 add 10 pmol TBR probe 9 add 1 • PCR Buffer II (no Mg 2§ to 50/xl total volume 3. Hybridization and bead capture (done in a thermal cycler, this protocol can be used regardless of the cycler type). 9 denature at 95~ for 3 min 9 anneal at 60~ for 3 min 9 add SA-coated beads (20/zl of 2/zg//zl beads) and incubate at 55~ for 30 min (resuspend the beads 2-3 times during incubation)
276
Elena D. Katzand John M. Wages
4. Resuspend the beads and transfer the entire volume of the suspension of DNA hybrid bound to the beads into the QPCR sample tubes, add 330/xl QPCR assay buffer (Perkin-Elmer), and place in the carousel. A single measurement will be performed on each tube. (Remember to place a tube with 1 ml assay buffer in position B of the carousel for automatic background subtraction.) Note: For better precision, use master mixes and run the sensitivity and linearity test, making luminosity measurements in duplicates. For example, double the volumes of the hybridization mix and beads, add assay buffer up to 750/zl, and make duplicate measurements from a single QPCR sample tube.
C. Automated Measurement with the QPCR System 5000 Hybridization products are transferred into 12 • 75 mm QPCR sample tubes, which are then loaded into the 50-tube instrument carousel. In the QPCR System 5000, an electrode contained in an electrochemical flow cell is conditioned through aspirations of QPCR cell cleaner (PerkinElmer) and QPCR assay buffer. A suspension of DNA hybrid bound to SA-coated magnetic beads is then aspirated by the sampling probe. In the flow cell, the magnetic beads are captured on the surface of the electrode by the magnetic field of the magnet arm located underneath the electrode. The electrode is then washed using assay buffer to remove unhybridized TBR-labeled probe. A voltage is then applied to the electrode, which results in oxidation of TBR 2+ to TBR 3§ Reaction of TBR 3§ with tripropylamine (TPA) in the assay buffer then results in reduction to TBR 2§ in an electronic excited state, from which it decays to the ground state with the emission of a photon. This emitted light is detected by a photomultiplier tube appropriately situated with respect to the electrode. A unique feature of this assay is the cyclic reaction of TBR with TPA, which results in the emission and detection of multiple photons per probe during a single measurement of electrochemiluminescence. The entire electrochemical reaction sequence is automated and invisible to the user, who only needs to load the sample tubes into the instrument carousel. Data output is provided as a printed hard copy or a spreadsheetcompatible file.
IV. EXAMPLES PCR proceeds through three distinct phases: (1) exponentially through a defined concentration range, (b) linearly as amplification efficiency begins
12. ElectrochemiluminescentDetection of PCR-Derived Nucleic Acids
277
to be reduced through product reannealing or reagent limitations, and then (3) into saturation, where increased thermal cycling does not produce increased product yield. The QPCR System 5000 is useful for both PCR detection, in which cycling is typically performed to saturation to ensure single-copy detection, and quantitative PCR, in which cycling is preferably limited to the exponential phase of amplification. During the exponential phase, a change in PCR product accumulation is directly proportional to a change in initial copy number. Failure to observe this correspondence between PCR product concentration and initial copy number indicates that amplification efficiency is characteristic of postexponential phase PCR. Target quantification in the PCR exponential range is highly advantageous since it permits as little as a 2-fold change in the initial copy number to be detected easily. Figure 1 shows the results of PCR amplification spanning both exponential and postexponential phases. The biotinylated 136-bp HIV fragment of the RNA transcript was amplified for 30 cycles over a range of 3 to 1,000,000 starting copy numbers. The PCR product was hybridized to the specific TBR probe (XMZ-1), captured by the SA beads, and analyzed by the QPCR System 5000. Points in Fig. 1 represent an average of 3 PCR amplifications, the highest deviation being within _+10%. Exponential
lO"0
-~ 103 E ._1
"
1021
1011 lo 0
i
i
i
i'111
i
T i l l
--
i
!
]
ill]ll_
i
i
i i ii
1r
i
I
i i
I
'
RNA Copy Number
Fig. I--HIV-1 RNA PCR standard curve. A 136-bp wild-type RNA was amplified for 30 cycles as described in text. For the ECL detection assay using the QPCR System 5000, PCR product (5/zl) was mixed with 35/~l of 1X PCR buffer II (magnesium chloride should not be included in the hybridization buffer because of the possibility of degradation of PCR products by the 5'-exonuclease activity of Taq DNA polymerase, although this has not been observed by the authors) and 10/zl containing 30 pmol TBR-labeled probe GPR-5. Incubation at 95~ for 5 min was followed by 20 min at 55~ Approximately 5 min into the hybridization, 30/xl of 2 mg/ml QPCR streptavidin beads (Perkin-Elmer, Applied Biosystems) was added. Following hybridization, assay buffer was added to 1 ml total volume to make electrochemiluminescent measurement in triplicates from a single QPCR sample tube.
278
Elena D. Katz and John M. Wages
amplification is obtained from 3 to 1000 copies, as indicated by a slope approaching 1.00 for this range of input copy number. Internal standards are commonly employed in PCR assays as a means of correcting for variation in amplification efficiency. Most reports have described internal standards that differ sufficiently in size from the wildtype sequence to permit size fractionation by electrophoresis (Gilliland et al., 1990). An attractive alternative for high-throughput PCR assays is to design an internal standard of the same or similar size, containing not only the identical primer sequence as the wild-type for equivalent amplification efficiency but also an unrelated sequence to permit hybridization-based differentiation. To explore the feasibility of quantitative PCR performed with internal standards, an internal standard was prepared as described earlier. Two templates that yield two PCR products, the 136-bp fragment derived from the wild-type RNA and the 172-bp fragment from the internal standard, were co-amplified using the protocol given in Section III,A. Aliquots of each PCR product were separately hybridized to the wild-type (GPR-5) and internal standard (XMZ-1) probes by the method just described. In each run, a calibration curve consisting of a dilution series of known concentrations of standard wild-type and internal standard products was also run. The concentrations of both PCR products were determined by anion-exchange HPLC (Wages et al., in press). An example of a calibration curve generated for the wild-type RNA target is shown in Fig. 2. The calibration curve permitted calculation of molar product concentration from luminosity values, to correct for differences in hybridization efficiencies of the two probes. Due to the exceptional reproducibility of this assay, it should not be necessary to construct a calibration curve for each run, provided the same protocol and reagents are used and instrument performance is monitored from time to time with appropriate standards (QPCR Bead Standards, Perkin-Elmer). Figure 3 shows data from an internal standard-based PCR. A known a m o u n t (10 4 copies) of wild-type RNA transcript was co-amplified with a dilution series of internal-standard RNA transcript. All luminosity values are expressed in terms of molar concentrations, calculated from the calibration curve included in each run of the QPCR System 5000. The values of the ratio of the molar concentrations of the internal standard RNA to the wild-type RNA are plotted against the values of the internal standard RNA copy number. Unlike the data shown in Fig. 1, a value of the slope of 0.86 is obtained for the PCR co-amplification, which indicates that the PCR efficiency was not as good as the PCR of the wild-type RNA alone. Nevertheless, Fig. 3 demonstrates that, from the point of intercept (equal to 0.85), the predicted copy number in the reaction, which should contain approximately 10,000 copies (based on OD measurement
12. Ehctrochemihminescent Detection of PCR-Derived Nucleic Acids
279
10000_ -
i
o
._~ =~ 1000
I00
.
0.1
.
.
.
.
.
.
.
.
1
.
.
.
.
.
,,,
10
PCR Product Concentration (fmol//~i)
Fig. 2--HIV-1 RNA ECL calibration curve. Amplified HIV-1 136-bp PCR product was quantified by HPLC as described by Wages et al., in press). The product was serially diluted, hybridized to the TBR-labeled GPR-5 probe, and measured by the QPCR System 5000, as described in Fig. 1.
10
9
.-.
m
t
)oi
I
0.01
,-
0.001
I
I 0.0001
.....................
10
~ ............. I
!
i
|
i r,,|l
!
100 1000 10000 100000 RNA Internal Standard Copy Number
!
!
, ||z|
IO00000
Fig. 3mQuantitative internal-standard PCR. Each serially diluted sample of 172-bp internal standard RNA was co-amplified for 30 cycles with 104 copies of 136-bp wild-type RNA using the amplification protocol described in text. The QPCR System 5000 was used for the ECL detection as described in Fig. 1. Molar concentrations values were calculated from the intercept and slope values obtained in Fig. 2.
280
Elena D. Katz and John M. Wages
at 260 nm prior to dilution), is approximately 12,000, which is a good agreement. Figure 3 also demonstrates that no significant competition between the two amplicons is observed due to independent amplification of the two templates under conditions of reagent excess and low product concentration.
V. TROUBLESHOOTING A. General Guidelines for Establishing High-Performance Quantitative PCR To quantify specific gene sequences using the QPCR System 5000, the effect of PCR variables on PCR amplification may first need to be addressed. Efficient primer binding should be confirmed by an independent detection method such as ethidium bromide-stained gel electrophoresis or HPLC. Experiments should be designed to distinguish between potential problems that may occur during each of the three stages of a PCR-based experiment" sample preparation (DNA or RNA extraction), PCR amplification, and PCR product detection. Experimental results that fail to distinguish between these three potential sources of variation may be inconclusive. In validating any PCR product analysis method, sample preparation and PCR amplification should be eliminated as sources of variation. The most straightforward means of this validation is to prepare a large quantity of PCR product. Many reactions using the same starting template concentration should be amplified, and the resulting products pooled and assayed by several detection techniques for comparison purposes. The pooled PCR product should be chloroform extracted to deactivate Taq DNA polymerase and UNG if used in the amplifications. Alternatively, a synthetic oligonucleotide probe may be used as the standard, although this possibility has the disadvantage of being unlike the true sample, which is a double-standard PCR product. After establishing which candidate detection technique has the requisite sensitivity, specificity, precision, and accuracy, PCR variation should then be minimized by systematically testing amplification conditions using a single pooled extracted nucleic acid. Quantitative assay development with the QPCR System 5000 should include experiments carefully designed to differentiate between variation arising from the three fundamental components of PCR assays: sample preparation, DNA amplification, and PCR product analysis.
12. Electrochemiluminescent Detection of PCR-Derived Nucleic Acids
281
B. Other Troubleshooting Guidelines In performing the assay described in this chapter, the following guidelines may provide solutions to commonly encountered problems. 1. Some oligonucleotide synthesis lots may contain incomplete synthesis products, or may be incompletely labeled with biotin or TBR. To circumvent such problems, particularly when an assay is first being characterized, both primers and probe should be purified, preferably by a highresolution method such as polyacrylamide gel electrophoresis or HPLC. Primers should be purified to ensure that all PCR product is biotinylated; probes should be purified to ensure that all hybridizing probe is labeled with TBR. 2. High concentrations of biotinylated primer interfere with capture of biotinylated PCR product (Wages et al., 1993). PCR primers are typically 20-30 bases in length and for efficient priming are used in large excess at a low micromolar level. Therefore biotinylated primers are captured by the beads more efficiently than PCR product, whose concentration is typically less than 50 nM even in postexponential reactions (Bloch, 1991). For best results, primer concentration should be reduced. With purified PCR primers, reducing primer concentration to 0 . 2 - 0 . 5 / z M should not have any detrimental effect on exponential-phase PCR amplification. 3. For high-concentration PCR products, rapid re-annealing of the double-stranded product may reduce hybridization efficiency, particularly in the case of long PCR products. In general, as high a TBR-labeled probe concentration as possible should be used without increasing background. Dilutions of TBR-labeled probe may be prepared and tested to determine an optimal concentration. In such an experiment, the diagnostic parameter is the ratio of signals between a positive and a negative reaction (ideally, a reaction prepared from the same master mix containing identical primer concentration and DNA template, but that has not been PCR amplified). The goal of the experiment is to maximize this "signal-to-noise ratio." 4. As is done for a Southern blot hybridization, an appropriate hybridization temperature must be chosen for the particular oligonucleotide probe that is used. Although 60~may work well for most probes, hybridization obviously depends on the Tm of the probe that is used and should be adjusted accordingly. Guidelines for membrane-based hybridization may not yield best results with solution hybridization. Empirical testing of several sequence-predicted hybridization temperatures is recommended. 5. Exceptionally low tube-to-tube variation is expected in the QPCR assay (e.g., -+3.5%; Wages et al., 1993), which almost certainly makes PCR product analysis the least variable part of the overall PCR method.
282
Elena D. Katz and John M. Wages
If significantly higher variation (e.g., >5% among replicate hybridization reactions) is observed, experiments should be designed to dissociate this from variation in the PCR amplification or earlier stages of the assay (e.g., DNA extraction). Standard pools of PCR products are useful for this purpose. 6. Negative control reactions that appear negative by methods of lower sensitivity (e.g., gel electrophoresis with ethidium staining) but appear positive by the QPCR System 5000 assay should be suspected of being contaminated with amplifiable DNA that has been PCR amplified to a low level that is difficult to detect with less sensitive methods. To determine the true assay background, replicate reactions containing the DNA template to be amplified or no DNA template should be prepared. A portion of the reactions should be assayed prior to thermal cycling. In this way, the assay background is determined and dissociated from PCR contamination artifacts. PCR contamination should be eliminated through one of the many techniques for PCR product carryover prevention that have been described in the literature (Longo et al., 1990).
REFERENCES Amplifications 10, 1993.
Blackburn, G. F., Shah, H. P., Kenten, J. H., Leland, J., Kamin, R. A., Link, J., Peterman, J., Powell, M. J., Shah, A., Talley, D. B., Tyagi, S. K., Wilkins, E., Wu, T. G., and Massey, R. J. (1991). Electrochemiluminescence detection for development of immunoassays and DNA probe assays for clinical diagnostics. Clin. Chem. 37, 1534-1539. Bloch, W. (1991). A biochemical perspective of the polymerase chain reaction. Biochemistry 30, 2735-2747. DiCesare, J., Grossman, B., Katz, E., Picozza, E., Ragusa, R., and Woudenberg, T. (1993). A high-sensitivity electrochemiluminescence-based detection system for automated PCR product quantitation. BioTechniques, 15, 152-156. Erickson-Viitanen, S., Manfredi, J., Viitanen, P., Tribe, D. E., Tritch, R., Hutchison, C. A., III, Loeb, D. D., and Swanstrom, R. (1989). Cleavage of HIV-1 gag polyprotein synthesized in vitro: Sequential cleavage by the viral protease. AIDS Res. Hum. Retrooiruses 5, 577-591. Gilliland, G., Perrin, S., Blanchard, K., and Bunn, H. (1990). Analysis of cytokine mRNA and DNA: Detection and quantitation by competitive polymerase chain reaction. Proc. Natl. Acad. Sci. U.S.A. 87, 2725. Katz, E. D., Haft, L. A., and Eksteen, R. (1990). Rapid separation, quantitation and purification of products of polymerase chain reaction by liquid chromatography. J. Chromatogr. 512, 433-444. Leland, J. K., and Powell, M. J. (1990). Electrogenerated chemiluminescence: An oxidativereduction type ECL reaction sequence using tripropyl amine. J. Electrochem. Soc. 137, 3127-3131. Longo, M., Berninger, M. C., and Hartley, J. L. (1990). Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93, 125-128. Michael, N. L., Vahey, M., Burke, D. S., and Redfield, R. R. (1992). Viral DNA and mRNA
12. ElectrochemiluminescentDetection of PCR-Derived Nucleic Acids
283
expression correlate with the stage of human immunodeficiency virus (HIV) Type 1 infection in humans: Evidence for viral replication in all stages of HIV disease. J. Virol. 66, 310-316. Nill, N. R., Oberyszyn, T. M., Oberyszyn, A. S., Bljur, G. N., Ross, M. S., Ruberg, R. L., and Robertson, F. M. (1994a). Alterations in cytokine gene expression in acute wounds covered with occlusive dressings. Presented at the 4th Annual Wound Healing Society Meeting. May 1994, San Francisco, California. Nill, N. R., Oberyszyn, T. M., Oberyszyn, A. S., Bljur, G. N., Ross, M. S., Boros, L. G., and Robertson, F. M. (1994b). Differential modulation of pulmonary IL-la gene expression by pentoxifylline in response to endotoxin in C3H/HeN endotoxin sensitive and C3H/ HeJ endotoxin resistant mice. Presented at the 17th Annual Conference on Shock. June 1994, Big Sky, Montana. Robertson, F. M., Bljur, G. N., Oberyszyn, A. S., Nill, M. R., Boros, L. G., Spencer, W. J., Sabourin, C. L. K., and Oberyszyn, T. M. (1994). Interleukin-la in murine multistage skin carcinogenesis. In "Skin Cancer: Mechanisms and Human Relevance" (H. Muktar, ed.). CRC Press, Boca Raton, Florida. Van Houten, B., Chandrasekhar, D., and Huang, W. (1993). Mapping DNA lesions at the gene level using quantitative PCR methodology. Amplifications 10, 10-17. Vlieger, A. M., Medenblik, A. M. J. C., van Gijlswijk, R. P. M., Tanke, H. J., van der Ploeg, M., Gratama, J. W., and Raap, A. K. (1992). Quantitation of polymerase chain reaction products by hybridization-based assays with fluorescent, colorimetric, or chemiluminescent detection. Anal. Biochem. 205, 1-7. Wages, J. M., Dolenga, L., and Fowler, A. K. (1993). Electrochemiluminescent detection and quantitation of PCR-amplified DNA. Amplifications. 10, 1-6. Wages, J. M., Zhao, X., and Katz, E. D. (1995). In "PCR Strategies" (M. Innis, D. Gelfand, and J. J. Sninsky, eds.). Academic Press, New York (in press). Whetsell, A. J., Drew, J. B., Milman, G., Hoff, R., Dragon, E. A., Adler, K., Hui, J., Otto, P., Gupta, P., Farzadegan, H., and Wolinsky, S. M. (1992). Comparison of three nonradioisotopic polymerase chain reaction-based methods for detection of human immunodeficiency virus type 1. J. Clin. Microbiol. 30, 845-853.
13
Detection of Phosphors by Phosphorescence H. Berna Beverloo Department of Cytochemistry and Cytometry, State University of Leiden, 2300 RA Leiden, The Netherlands
I. Introduction A. Luminescent Labels for Time-Resolved Detection B. Phosphors II. Materials A. Reagents B. Instrumentation 1. Photographic Recording
III. Procedures A. Grinding of Phosphor Particles B. Preparation of the Phosphor Conjugates by Physical Adsorption C. Choice of Solid Support D. Detection of Proteins on Filters 1. Immobilization of Proteins on Solid Support 2. Detection of Proteins Spotted on Solid Support 3. Immunochemical Amplification of the Signal
E. Western Blotting 1. Detection of the Blotted Proteins
F. Detection of Nucleic Acids on Filters 1. Immobilization of DNA on Solid Support 2. Detection of Haptenized DNA Spotted on Solid Support 3. Detection of Double-Haptenized DNA
G. Hybridization on Filter H. Southern Blotting References
I. I N T R O D U C T I O N Immunoassays and nucleic acid hybridization assays have become valuable techniques in genetics, molecular biology, biochemistry, and diagNonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
285
286
H. Berna Beverloo
nostic medicine. These methods are often based on radioisotope labels. Although these labels offer excellent detection sensitivity, they are potentially hazardous, have limited shelf half-times, and require special working conditions. In addition, visualization of low amounts of radiolabel on film may require very long exposure times. Therefore, alternative nonisotopic detection methods have been developed and investigated. Methods using enzyme labels such as alkaline phosphatase and horseradish peroxidase are generally considered sensitive, because more than one chromophore can be generated from the substrate by the enzyme. Detection of more than one antigen, however, is difficult because of considerable spectral overlap of the different absorbing end-products. Furthermore, quantification of the colored end-product by measuring light absorption is a rather insensitive technique (Gosling, 1990). Another alternative is offered by chemiluminescence- or bioluminescence-based assays. Examples are luciferase/luciferin (Hauber and Geiger, 1988), horseradish peroxidase/luminol (Pollard-Knight et al., 1990), and alkaline phosphatase/AMPPD (Bronstein et al., 1989). These systems, however, are also not optimally suited to multianalyte assays since the emission of the different luminophores is in the same (blue) part of the spectrum. Furthermore, prolonged integration of chemiluminescence is not always feasible, because of the limited duration of the light emitting reaction (<1 hr). Luminescence-based assays are particularly sensitive in combination with sensitive detection devices such as silicon-intensified target (SIT) cameras or charge-coupled device (CCD) cameras with a computer for processing and analysis of the signal. These systems are ideally suited to simultaneous detection of multiple targets, since in most cases the spectra of the fluorophores can be separated adequately on the basis of differences in excitation and emission properties. However, these assays are rarely applied to the detection of macromolecules on filters. These assays lack sensitivity because of high nonspecific reaction of the label with the filter due to the hydrophobic nature of the label (Urdea et al., 1988) and show significant fading on excitation, which hampers prolonged integration of the emission. Theoretically, fluorescent detection of enzyme labels would combine the advantages of both enzyme- and fluorescence-based assays. Fluorescent substrates are not frequently applied on filters and blots, mainly because of bad localization properties of the fluorescent end-product. In practice, the theoretical sensitivity of fluorescent labels is unachievable because of confounding nonspecific fluorescence, in general referred to as background, due to fluorescence of the solid support, fluorescence of components present in the biological sample, and unwanted excitation light.
13. Detection of Phosphors by Phosphorescence
287
A. Luminescent Labels for Time-Resolved Detection Dyes with relatively long lifetime luminescence (up to seconds) provide a means to discriminate between specific label and background fluorescence, since autofluorescence generally is a relatively rapid process with fluorescence decay times in the range of l-100 nsec. The slowly decaying luminescence signals can be distinguished from faster decaying luminescence using a pulsed excitation light source and selective gating of the emission signals, in practice by synchronous chopping of the emission light (Fig. 1). This process is called time-resolved fluorometry. Interference due to background fluorescence of the immediate type is suppressed in this way. The specific luminescence attributable to the label is collected during the gated detection period, when interfering autofluorescence is absent. The use of these dyes in combination with sensitive detection devices that allow integration of the luminescence signal theoretically provides an extreme sensitivity, either in a macroscopic or microscopic set-up, because of the virtual absence of background fluorescence. A considerable number of dyes are potentially suited to time-resolved fluorometry. These dyes must possess an electronic transition from excited state to ground state that is forbidden, from which the molecule relaxes under radiation of light. Best suited to this purpose are metal complexes, mainly those containing aromatic ligands (Balzani and Ballardini, 1990).
T(t) 1
i
I
I
delaytime
_1_
samplewindow
_1
time (~s)
Fig. l--Detection principle of time-resolved fluorescence. (A) Excitation pulse; (B) short decay background fluorescence" (C) slowly decaying luminescence of label.
288
H. Berna Beverloo
Examples of delayed luminescent or phosphorescent labels are the lanthanide chelates (Leif et al., 1977; Soini and Hemmil/a, 1979; Oser et al., 1988; Oser and Valet, 1988; Evangelista et al., 1988; Diamandis, 1990), the lanthanide cryptates (Lehn, 1978; Blasse et al., 1988; Prat et al., 1991), and the luminescent inorganic phosphors (Tanke et al., 1986; Beverloo et al., 1990,1992a,b,1993). A general problem in many lanthanide assays is the fact that the lanthanide ion, frequently used as the luminophor, is virtually nonfluorescent under aqueous conditions. Thus the lanthanide must be dissociated from the binding site and encapsulated in trapping water-excluding agents (e.g., /3-diketones; Hemmilfi, 1988; Oser et al., 1988). Alternative lanthanide chelates have been developed that are fluorescent both in aqueous solution and on a solid support (Evangelista et al., 1988; Diamandis, 1990). In the delayed luminescent cryptates, the luminescent ion is included in a cavity formed by a macropolycyclic ligand, providing efficient shielding from quenching by other substances such as water molecules. A third method of forming luminescent lanthanide chelates is the use of enzyme-amplified lanthanide luminescence assays, in which an enzyme converts the substrate into a chelate capable of forming a luminescent chelate with a lanthanide ion (Evangelista et al., 1991; Gudgin Templeton et al., 1991). Another detection method is the use of luminescence of small inorganic particles (0.1-0.3/zm), known as phosphors, to which immunoreactive macromolecules such as immunoglobulins, protein A, and avidin have been physically adsorbed (Tanke et al., 1986; Beverloo et al., 1990).
B. Phosphors Luminescent inorganic crystals, mostly called phosphors, are used in numerous applications. In addition to application in cathode ray tubes, phosphors are used in fluorescent lamps, color television screens, Xray screens, scintillation counters, and fluorescent screens of electron microscopes. Phosphors show luminescence on excitation with electrons, ions of moderate velocity, or photons with an energy ranging from gamma rays to the near infrared (Butler, 1980; DeLuca, 1980). Generally inorganic crystalline phosphors are built up from a host material, an inorganic lattice, and relatively small amounts of foreign ions that give rise to centers that can be excited to luminescence called activator centers (Fig. 2). The activator, A, is not an integral part of the lattice but has replaced part of its original structure. Activators consist of positively charged (rare earth and transition) metal ions such as europium, terbium, and manganese. Phosphors do not luminesce without an activator. The short hand notation for phosphors is often given by first indicating the
13. Detection of Phosphors by Phosphorescence eXCs
heat
ems
289 exc a
ern a
heat
Fig. 2mSchematic representation of luminescence in phosphors. Sensitizer S and activator A are incorporated in a host lattice. Excitation (exc) and emission (em) are indicated. The activator can also be excited by energy transfer from S to A.
host, followed by the incorporated activator(s). An example is the red component in color television screens, yttrium oxysulfide activated with europium(Ill), which is denoted as Y202S" Eu 3+. The activator that causes the desired emission may absorb excitation energy poorly. Then excitation may take place via a sensitizer, S, which efficiently absorbs the radiation. One of the possible ways for the excited sensitizer S to return to the ground state is energy transfer to A, which then can emit its luminescence (Fig. 2). The host lattice, but also other foreign ions which may also be activators, can act as the sensitizer (Blasse, 1979). Phosphors are produced by firing the constituent elements of the material, the activator, and a flux that promotes crystallization at high temperatures under controlled conditions (atmosphere, temperature, and time) (Yacobi and Holt, 1990). The activator concentration ranges from 0.5 to 20% (Butler, 1980). The emission color is dependent on the activator (and co-activators) present in the host, for example, zinc sulfide. In color television screens, ZnS : Ag is used as the blue component and ZnS : Cu,AI as the green component. The composition of the host material is also important; for instance, in ZnCdS the color varies with the Cd content. Basically, the two types of phosphors are the semiconductor phosphor and the characteristic phosphor. Characteristic phosphors are phosphors activated with rare earth ions. In these phosphors, the emission originates from electron transitions between the levels of the activator atom. The phosphor emission spectrum is highly determined by the pattern of these energy levels of the activator center, resulting in very sharp emission bands and large Stokes shifts. These sharp emission bands can be spectrally separated easily, making these phosphors very suitable for simultaneous labeling studies of more than one antigen.
290
H. Berna Beverloo
For labeling purpose, primarily characteristic phosphors are used: the red luminescent yttrium oxysulfide activated with europium, Y202S" E u 3 + (emission maximum at 620 nm, lifetime of 760/xsec) on excitation with ultraviolet light (254 or 360 nm); the blue luminescent Y202S : T b 3+ (emission maximum at 490 nm, half-time of 500/~sec on excitation with UV light of 254 nm); and the green luminescent component zinc silicate activated with arsenic and manganese ( Z n S i O 4 : Mn2+,As; emission maximum 522 nm, lifetime of 11 msec upon excitation with UV light of 254 nm) (Beverloo et al., 1992a). This type of time-resolved label has two major advantages: (1) its luminescence quantum efficiency is not sensitive to environmental influences such as the presence of water molecules and changes in pH or temperature and (2) its luminescence can be rapidly and easily visualized, since phosphors do not exhibit fading, permitting prolonged integration times. Moreover, their emission colors range from blue to far red, with decay times ranging from microseconds to seconds, facilitating simultaneous detection of multiple targets. Phosphor conjugates are stable and provide sensitive detection of macromolecules immobilized on filters with minimal investment in specialized equipment. The ultimate detection limit of proteins using phosphor conjugates, including an immunochemical amplification step, was found to be 10 fg. The detection limit of nucleic acids was 300 fg for the demonstration of dot-spotted nucleic acid and 10 pg in hybridization formats with haptenmodified probes. The sensitivity was, in all cases, as good as or better than that of methods using alkaline phosphatase detected using NBT/ BCIP, europium chelates (Hurskainen et al., 1991), cryptates (Prat et al., 1991), or the technique combining enzymes and europium chelates (Evangelista et al., 1991; Gudgin Templeton et al., 1991). Although immunophosphors provide very good sensitivity, their application to the detection of macromolecules immobilized on solid support is hampered by their size. Steric hindrance may give rise to problems in terms of accessibility of the target, since 0.1-0.3 /zm large, irregularly shaped particles do not easily penetrate into the pores of the membrane. Therefore binding of the phosphor particles seems to be primarily at the surface, and the amount of labeling seems to be physically limited by particle size. Thus, only a fraction of the (blotted) macromolecules is accessible for the phosphor conjugates. Despite this, a detection sensitivity is obtained that is at least as good as that achieved with immunoenzymatic staining with alkaline phosphatase detected using NBT/BCIP. The use of smaller, more regularly shaped, particles could overcome this problem. Immunophosphors are applicable to the sensitive and rapid detection of dot-spotted proteins and nucleic acids on filters with minimal investment
13. Detection of Phosphors by Phosphorescence
291
in specialized equipment. Moreover, the detection of macromolecules on Western and Southern blots with these reagents is also feasible (Beverloo et al., 1992b). Quantification or automated detection of very small amounts of proteins and nucleic acid hybrids will be possible when the luminescence is recorded by a CCD camera. The availability of red, green, and blue luminescent inorganic crystals allows the simultaneous detection of multiple antigens (Beverloo et al., 1992a). If these emission properties are combined with differences in lifetime per color, then the detection of nine different antigens is, in principle, achievable.
II. MATERIALS A. Reagents Starting materials for the preparation of phosphor conjugates are inorganic phosphors with an average size of 6/xm. Large suppliers of phosphors are RCA and Riedel de Haen (local supplier). The phosphors in this study were kindly provided by Nederlandse Philips Bedrijven B.V., Technology Centre Display Components (Eindhoven, The Netherlands). They were ground by ball milling, in the presence of polycarboxylic acids (Additol XW 330; Hoechst, Frankfurt, Germany). These negatively charged polycarboxylic acids are used to stabilize the phosphor particles and prevent them from aggregating. The stabilized phosphor particles can be obtained through Molecular Probes (Eugene, Oregon). For optimal conditions for sensitive detection of proteins and nucleic acids, several things have to be kept in mind. First, the macromolecule concentration conjugated to the phosphor particles is an important factor. In general, 50-100/zg macromolecules per ml phosphor suspension must be coupled before labeling of the target is observed. Higher macromolecule concentrations result in a decreased stability of the phosphor conjugates and in an augmented background on the filter. Further, the buffers in which the phosphor conjugates are used influence the labeling intensity and the background on the filter caused by the antibodies used or by nonspecific reaction of the phosphor conjugates. HEPES-buffered medium was found optimally suited, although acceptable results were obtained with borate buffers. The use of citrate buffers should be avoided because of the destabilizing effects of the citrate on the polycarboxylic acids stabilizers. Double and triple charged ions such as phosphate ions are additional factors that influence the stability of the phosphor suspension, probably also by their affect on the carboxylic acid layer. Acetylated BSA (Aurion, Wageningen, The Netherlands), 0.1% in HBS, pH 7.4, is optimally suited as a blocking medium for immunochemical
292
H. Berna Beverloo
detection of proteins and nucleic acids. Its function is twofold. The increased negative charge of acetylated BSA relative to normal BSA reduces the amount of potential positively charged binding sites for the negatively charged phosphor conjugates. It also prevents background caused by hydrophobic forces by shielding the hydrophobic binding sites present on membranes. Gelatin or cold-water fish gelatin causes a persistant nonspecific staining because of the positive charge of the gelatin molecules.
B. Instrumentation 1. Photographic Recording Once the filters are air dried, after incubation with the phosphor conjugates, they can be photographed as many times and for as long as preferred. For photographic recording, the filters are obliquely illuminated with a UV lamp emitting 254 nm light (Fig. 3). Pictures are taken with a Polaroidtype Landcamera on standard black and white film (type 667, ISO 3000; Polaroid, Maarssenbroek, The Netherlands). The camera is placed 13 cm above the filters to be photographed. This distance is dependent on the lens used in the camera. If the red luminescent yttrium oxysulfide activated with europium is used as label, a long-wave pass, LP 610, is used in front of the camera lens to select the red emission of the phosphor. Exposure times vary from l0 to 60 min, depending on the amount of labeling. The fight exposure time is determined by trial and error. Photographic detection of double-haptenized DNA in two colors can be performed with the same type of camera using a type 669 color film (ISO 80) or with a CU5-AF9 camera (Polaroid) using a type 339 color film (ISO 640). Photographic detection with the type 339 color film of double-
Fig. 3mSchematic representation of the photographic recording of the luminescence from phosphor conjugates.
13. Detection of Phosphors by Phosphorescence
293
Fig. 4--Immunochemical detection of dot-spotted mouse Ig spotted in amounts ranging from 100 ng to l0 fg (100, 10, 1 ng, 100, 10, 1 pg, 100, l0 fg). Labeling procedure for strip A: biotinylated goat anti-mouse Ig followed by red luminescent avidin d phosphor conjugates (100/~g/ml). Specific staining was observed for amounts as low as 100 pg. Control experiments (strip B) consisted of nonbiotinylated goat anti-mouse Ig, followed by avidin d phosphor conjugates. Strip C and D: similar to strip A and B, but the results were visualized using avidin d alkaline phosphatase and NBT/BCIP. Labeling procedure for immunochemical amplification (strip A'): as described earlier, followed by biotinylated goat anti-avidin d antibodies and incubation with avidin d phosphor conjugates (100 /~g/ml). The minimal detectable amount of protein is 100 fg. Strip B' represents the negative control. Strip C' and D': similar to strip A' and B', but developed using avidin d alkaline phosphatase and NBT/BCIP. Strip E and E' represent the immunochemical detection of dot-spotted mouse Ig, ranging from 100 ng (top) to 1 fg (bottom) using protein A phosphor conjugates. Labeling procedure for strip E: goat anti-mouse Ig followed by protein A phosphor conjugates (100/~g/ml). Specific staining was observed for amounts as low as 1 pg. Labeling procedure for immunochemical amplification for strip E': as described for strip E, followed by goat anti-mouse Ig and incubation with protein A phosphor conjugate. Minimal detectable amount was 1 fg (Adapted from Anal Biochem).
haptenized DNA in two colors can best be performed sequentially, to deal with the decreased sensitivity of this type of film for red light. Therefore the film is first exposed to red light using the long-wave pass LP 610, followed by an exposure to green and red light using the long-wave pass LP 515. Recently a time-resolved detection device became available (Evangelista et al., 1991). The Kronem TRP 100 system (Kronem Systems Inc., Toronto, Canada) provides excitation in the UV range (UG5 filter, 260 nm and 360 nm) and measurement of emission >515 nm. The time delay and gate are adjustable. Use of this system enables the suppression of fast decaying background fluorescence, resulting in visualization of the label luminescence only. The luminescence is registered by a Polaroid camera using the same type of film just described. Using this time-resolved detection device, exposure times are greatly reduced, ranging from several
294
H. Berna Beverloo
seconds to some minutes, but the minimum detectable amount of label is unchanged. One reason for this observation can be that the autofluorescence of the filter incorporates a delayed luminescent component. Another possibility is that there is nonspecific binding of the phosphor particles to the membrane, causing an overall background that is not detectable under continuous excitation. However, suppression of nonspecific background fluorescence by six orders of magnitude was observed when immunophosphors were used for time-resolved measurements in immunocytochemical detection of membrane antigens (Beverloo et al., 1993).
III. PROCEDURES A. Grinding of Phosphor Particles The inorganic phosphors are ground to an average size of 0.1-0.3/xm by ball milling, in the presence of polycarboxylic acids (Additol XW 330). During the grinding procedure, the Brownian motion, the color of the suspension, and the size of the phosphor particles must be carefully controlled. The phosphor particles are stabilized by the carboxylic acid layer. At high pH, at which the ball milling takes place, the carboxylic groups are not protonated and possess a strong negative charge. This negative charge repels the phosphor particles, resulting in a Brownian motion of the particles. If the particles do not show this motion, the pH must be adjusted or more carboxylic acid must be added. Also, the color of the suspension is an indication of stability of the phosphor suspension. Best results are obtained when the color is white. When the color has changed to gray, in general the grinding procedure was continued too long and no well-stabilized phosphor particles can be obtained. In general, their size is too large and they tend to sediment very quickly. The particle size is controlled by microscopic observation. The shape of the particles is very diverse. Grinding is continued until the particles are approximately equal in size, indicating that the starting material is no longer present.
Grinding Procedure 1. Fill a beaker with glass beads with a diameter of 850-1230/zm (Ballotine, lead glass; local supplier). 2. Add distilled water until beads are just submerged. 3. Add the phosphor cautiously, to avoid pulverization, to a final concentration of 0.8% (w/v). 4. Stir the beads with a mechanical stirrer until the suspension is homogeneous.
13. Detection of Phosphors by Phosphorescence
5. Add the stabilizing agent. For the conjugates described here, normally 5% Additol XW-330 is used. 6. If necessary, adjust the pH to 9.0 with 0.1 M NaOH. 7. Grind the suspension with the mechanical stirrer until the desired particle size is obtained, usually after 24 hr. 8. Decant the suspension. 9. Rinse the glass beads until the desired end concentration of 0.8% (w/v) is reached. 10. Store the suspension at 4~ The suspension can also be stored at -20~ or at lower temperature. Best results in terms of extended storage, however, have been obtained when the suspension was stored at 4~
B. Preparation of the Phosphor Conjugates by Physical Adsorption
1. Wash the suspended phosphor particles (0.4% w/v) twice with HEPES-buffered saline [HBS: 10 m M H E P E S (Serva, Germany), 135 mM NaC1, pH 7.4]. 2. Sonicate on ice for 30 sec at 60 W (Branson sonifier B-12 equipped with microtip; Danbury, Connecticut) to resuspend the pellet. 3. Add the desired proteins to the phosphor suspension (0.4% phosphor particles w/v per ml suspension). For protein A phosphor conjugates, 100/zg of protein A (Pharmacia, Uppsala, Sweden) per ml of phosphor suspension is added. For avidin d phosphor conjugates, 100/zg avidin d (Vector Labs, Burlingame, California) per ml phosphor suspension is added. Immunoglobulin phosphor conjugates usually contain 50/zg Ig/ml phosphor suspension. 4. Sonicate for 30 sec at 60 W on ice. 5. Agitate the suspension for 2 hr at room temperature or overnight at 4~ 6. To remove unadsorbed proteins, wash the suspension with HBS, pH 7.4 by centrifugation in a table centrifuge at 4000 rpm for 15 min at room temperature (large volumes) or for 4 min in an eppendorf centrifuge (small volumes). Repeat this twice. 7. Wash the conjugates twice in 0.1% BSA/HBS, pH 7.4 (BSA, purity 98-99%; Sigma). 8. Suspend the conjugates in 0.1% BSA/HBS, pH 7.4 by sonication. 9. Store the conjugates at 4~
295
H. Berna Beverloo
296
C. C h o i c e o f S o l i d S u p p o r t Since phosphor particles have a net negative charge, the use of positively charged membranes should be avoided. For example, the use of HighbondN § results in a strong nonspecific background caused by bound phosphor particles. Furthermore, the use of nylon membranes, neutral as well as positively charged, should also be avoided. Best results for DNA applications are obtained when nitrocellulose (Schleicher and Schuell, 0.45/xm, type BA 85) is used. This type of nitrocellulose is also suited for the detection of proteins. A good alternative is Hybond-C super (Amersham, 0.45/zm), which has the same properties as the nitrocellulose filters but has the strength of the Hybond filters.
D. D e t e c t i o n o f P r o t e i n s o n F i l t e r s
1. Immobilization of Proteins on Solid Support 1. Dilute target 2. Spot 1 /zl of and Schuell, 3. Allow to air til use.
proteins in 0.1% BSA/HBS, pH 7.4. each dilution onto nitrocellulose filters (Schleicher BA-85, pore diameter 0.45/xm). dry and store the filters at room temperature un-
2. Detection of Proteins Spotted on Filter All incubations described except the incubation with the immunophosphor conjugates were performed while shaking gently on a rotating platform at room temperature. All antibodies were diluted and incubated in 0.1% acetylated BSA/HBS, pH 7.4.
1. Preincubate the filters with the proteins in 0.1% acetylated BSA/ HBS, pH 7.4 for 30 min. 2. Incubate the filter with diluted (biotinylated) goat anti-protein antibodies (depending on the phosphor conjugate to be used) in 0.1% acetylated BSA/HBS, pH 7.4 for 1 hr in a sealed plastic bag. 3. Rinse the filters in HBS for 5 min. Repeat this twice. 4. Preincubate the filters in 0.1% acetylated BSA/HBS, pH 7.4 for 30 min.
13. Detection of Phosphors by Phosphorescence
297
5. Cover a flat surface with a droplet of water. Stretch a piece of parafilm on this surface. 6. Place the wet filters on top of the parafilm. 7. Incubate the wet filters with a 1 : 100 dilution of the corresponding phosphor conjugate at room temperature in a moist chamber for 1 hr. Generally 100/xl is sufficient to cover an area of 1 cm 2. Drying the filters during incubation should be avoided because it causes nonspecific binding of the phosphor conjugate. Generally this binding is very difficult to remove. 8. Rinse the filters 5 min in HBS; repeat twice. 9. Allow the filters to air dry. 10. Photograph the incubated filters. Stained filters can be stored at room temperature. They can be rephotographed often, since the phosphor conjugates show no significant bleaching and can be stored for prolonged periods of time.
3. Immunochemical Amplification of the Signal The signal obtained using phosphor conjugates can be enhanced by using antibodies directed against the protein/antibody present on the surface of the phosphor bound immunochemically to the target protein. Two variations can be used, one based on the use of biotinylated goat anti-avidin antibodies and the other on goat anti-mouse antibodies.
1. After completion of the steps described in Section III,D,2, preincubate the filters with 0.1% acetylated BSA/HBS, pH 7.4 for 30 min. 2. In an incubation with avidin phosphor conjugates, incubate with biotinylated goat anti-avidin (Vector) antibodies. In an incubation with protein A phosphor conjugates, incubate with goat antimouse antibodies. Dilute the antibodies in 0.1% acetylated BSA/ HBS, pH 7.4 and incubate in a sealed plastic bag for 30 min at room temperature. 3. Wash 5 min with HBS, pH 7.4; repeat twice. 4. Preincubate with 0.1% acetylated BSA/HBS, pH 7.4 for 30 min. 5. Incubate the filters (this is the second time) with the phosphor conjugate (dilution 1 : 100) for 1 hr as described in Section III,D,2, steps 5-7. 6. Wash the filters 5 min in HBS; repeat twice.
298
H. Berna Beverloo
7. Allow the filters to air dry. 8. Photograph the filters.
E. W e s t e r n B l o t t i n g Western blotting is performed according to standard procedures (Maniatis et al., 1982). The general procedure for electrophoresis and electroblotting (mini-V 8.10; BRL, Gaithersburg, Maryland) follows.
1. Denature proteins for 3 min at 100~ in SDS loading buffer (50 mM Tris 9 HCI, pH 6.8,100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue, 10% glycerol). 2. Load them onto an 8% SDS-polyacrylamide gel, appropriate for electrophoresis and electroblotting. 3. Electrophorese for 1 hr at 200 V at 4~ 4. Soak the gel and membranes in transfer buffer (25 mM Tris 9 HCI, pH 8.3, 192 mM glycine, 10% methanol) for 20 min. 5. Transfer the proteins to the membranes by electrophoretic transfer for 30 min at 150 V at 4~ 6. Air dry the filters.
1. Detection of the Blotted Proteins 1. Preincubate the filters with the proteins in 0.1% acetylated BSA for 30 min. 2. Incubate the filter with diluted anti-protein antibodies in 0.1% acetylated BSA/HBS, pH 7.4 for 1 hr in a sealed plastic bag. 3. Rinse the filters in HBS for 5 rain; repeat twice. 4. Preincubate the filters in 0.1% acetylated BSA/HBS, pH 7.4 for 30 min. 5. Incubate the filter with diluted antibodies directed against the antibodies used in step 2 in 0.1% acetylated BSA/HBS, pH 7.4 for 1 hr in a sealed plastic bag. 6. Rinse the filters in HBS for 5 min; repeat twice. 7. Preincubate the filters in 0.1% acetylated BSA/HBS, pH 7.4 for 30 min. 8. Cover a flat surface with a droplet of water. Stretch a piece of parafilm on this surface. 9. Place the wet filters on top of the parafilm. 10. Incubate the wet filters with a 1 : 100 dilution of the appropriate
13. Detection of Phosphors by Phosphorescence
299
Fig. 5--Specific immunochemical detection of the Western-blotted mouse anti-CD4 Ig with
protein A phosphor conjugates (lanes 6-10) in a three-step labeling procedure: goat antimouse followed by rabbit anti-goat antibodies and protein A phosphor conjugate (100/zg/ ml). Lanes 1-5 were incubated with biotinylated goat anti-mouse Ig and visualized with protein A alkaline phosphatase and NBT/BCIP. Lanes 1 and 6 contained only 1/zg mouse Ig. Lanes 2-5 and 7-10 contained diluted mouse Ig (from left to right: 1 ng, l0 ng, 100 ng, 1/zg) in the presence of 1/~l fetal calf serum (FCS), corresponding to approximately 70/zg protein. The detection of 1 ng mouse monoclonal antibodies is not influenced by a large excess of FCS (Adapted from Anal Biochem).
p h o s p h o r conjugate at r o o m t e m p e r a t u r e in a moist c h a m b e r for 1 hr. Generally 100/zl is sufficient to cover an area of 1 cm 2. Drying the filters during incubation should be avoided. 11. Rinse the filters 5 min in H B S ; repeat twice. 12. Allow the filters to air dry. 13. Photograph the incubated filters.
F. Detection of Nucleic Acids on Solid Support Several protocols can be followed for the detection of nucleic acids. In general, the immunological detection of the hapten-modified probe is perf o r m e d in 0.1% acetylated B S A / H B S , as described in Section III,D,2. A n o t h e r possibility is the use of Tris buffers containing a blocking reagent (Boehringer, G e r m a n y ) . This protocol is described in Section H.
1. Immobilization of D N A on Solid Support 1. Pre-wet nitrocellulose filters (Schleicher and Schuell, pore diameter 0.45 ~ m ) in 0.4 M NaC1.
300
H. Berna Beverloo
2. Allow to air dry. 3. Denature target DNA (2 min, 100~ and dilute in HBS containing 10 ng//~l salmon sperm DNA. 4. Spot 1/~1 desired dilution on filter. 5. Air dry and bake for 2 hr at 80~
2. Detection of Haptenized DNA Spotted on Solid Support 1. Dilute haptenized target DNA in desired dilutions in HBS containing 10 ng//xl salmon sperm DNA. 2. For immunochemical detection of the hapten, follow the labeling procedure described in Section III,D,2. Except for the incubation with the immunophosphor conjugates, all incubations are performed while shaking gently on a rotating platform at room temperature. All antibodies were diluted and incubated in 0.1% acetylated BSA/HBS, pH 7.4.
3. Detection of Double-Haptenized DNA 1. Double-haptenized DNA (50 pg per spot) is immobilized on the filter as described earlier. 2. Wet the filters briefly in HBS. 3. Preincubate the filters with 0.1% acetylated BSA/HBS, pH 7.4 for 30 min.
AB
C lOO
@
33
@
10
@
D
I 0.3 PG
....... -.,
Fig. 6---Visualization of a dot-spotted digoxigenin-modified h DNA probe. Labeling procedure for strip A: mouse anti-digoxigenin, goat anti-mouse Ig followed by protein A phosphor conjugate (100 ttg/ml). Spots contain, from top to bottom, a threefold dilution series ranging from 100 pg to 0.3 pg. Strip B represents the control experiment in which the mouse antidigoxigenin Ig were omitted. Strips C and D represent the same procedure with alkaline phosphatase and NBT/BCIP (Adapted from Anal Biochem).
13. Detection of Phosphors by Phosphorescence
301
Fig. 7mSpecific immunochemical labeling of digoxigenin-modified ~ DNA probe hybridized to dot-spotted sonified ~, DNA. Target DNA was spotted in threefold dilution (from top to bottom) ranging from 1000 pg to 1 pg. Labeling procedure for strip A: mouse anti-digoxigenin, goat anti-mouse Ig followed by protein A phosphor conjugates (100/~g/ml). Negative control consisted of hybridization with a chemiprobe-modified ~, DNA probe (strip B). Strips C and D represent the same procedure with a corresponding alkaline phosphatase conjugate and NBT/BCIP. Using hybridization procedures l0 pg nonlabeled DNA could be detected (Adapted from Anal Biochem).
4. Incubate with goat anti-biotin antibodies (1 : 100) in a sealed plastic bag for 60 min. 5. Wash the filters in HBS for 5 min; repeat twice. 6. Preincubate with 0.1% acetylated BSA/HBS for 30 min. 7. Incubate the filters with the red or green luminescent protein A phosphor conjugate (1: 100) for 60 min. 8. Wash the filters in HBS for 5 min; repeat twice. 9. Incubate the filters with 0.1% acetylated BSA and 2% normal sheep serum in HBS for 30 min. 10. Demonstrate the digoxigenin label by an incubation with the green or red luminescent sheep anti-digoxigenin phosphor conjugate diluted 1:100 in 0.1% acetylated BSA/2% normal sheep serum/HBS for 60 min. 11. Wash the filters for 5 min in HBS; repeat twice. 12. Allow to air dry. 13. Photograph the filters.
G. Hybridization on Filter
1. Wet the filters with bound DNA in HBS. 2. Prehybridize with hybridization mixture (0.6 M NaCI, 50 mM
302
H. BernaBeverloo
3.
4.
5. 6. 7.
HEPES, pH 7.4, 10• Denhardt's solution, 10 mM EDTA, 0.1% NP40, containing 50/zg/ml salmon sperm DNA) in a sealed plastic bag in a water bath for 1 hr at 65~ (1 • Denhardt's: 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% BSA in water). Hybridize the filters overnight at 65~ with a previously denatured (2 min, 100~ hapten-modified probe in hybridization mixture. Typical probe concentrations are 150 ng/ml mixture. Rinse the filters twice in rinsing buffer (0.3 M NaCI, 25 mM HEPES, pH 7.4, 5 mM EDTA, 0.1% NP40) for 10 min at 65~ in a sealed plastic bag in a water bath. Wash 2 • 5 min in HBS at room temperature. Preincubate the filters with 0.1% acetylated BSA/HBS, pH 7.4 for 30 min. For immunochemical detection of the hapten-modified probe, follow the procedure described in Section III,D,2.
H. Southern Blotting Capillary transfer of macromolecules was performed under nondenaturing conditions in 1.5 M NaCl or 20x SSC. The haptenized probe can be detected using two protocols: the standard protocol using acetylated BSA/ HBS or another using Tris containing a blocking reagent. In the protocol given here, the latter procedure is described, but the first gives similar results. Agarose gels give best results with respect to nonspecific background caused by the phosphor particles. The size of the phosphor particles is an important factor in detecting transferred macromolecules on filters. During the blotting procedure, the macromolecules are transferred into or even through the filters. Because of the relatively large size of the particles, detection of blotted macromolecules at first yields low labeling results. Better results are obtained when the back side, instead of the front side, of the membrane is hybridized. The macromolecules migrate through the filter, or even to the Whatmann paper. Therefore two consecutive membranes can be applied during the blotting procedure. Best labeling results are obtained when the back side of the first membrane and the front side of the second membrane are hybridized.
1. Load the samples onto an agarose gel and electrophorese. 2. Denature the DNA by soaking the gel in 0.4 M NaOH, 0.6 M NaC1 for 20 min at room temperature.
13. Detection of Phosphors by Phosphorescence
654
303
321
Fig. 8mVisualization of Southern blotted HindlII/EcoRI digested h DNA by hybridization with biotin-labeled h DNA probes. Immunochemical labeling procedure: mouse anti-biotin, goat anti-mouse Ig followed by protein A phosphor conjugate (100 /zg/ml) or with the corresponding alkaline phosphatase conjugate and NBT/BCIP. Lane 1 contained 1000 ng DNA; lane 2, 300 ng; lane 3, 100 ng; lane 4, 30 ng; lane 5, 10 ng; lane 6, 3 ng. Exposure time: 1 hr (Adapted from Anal Biochem).
3. Neutralize the gel by washing 2 • 10 min with 50 mM HEPES, 0.6 M NaC1, pH 7.2 or 0.5 M Tris-HC1, pH 7.4, 0.6 M NaCI. 4. Rinse once with 1.5 M NaCI. 5. Transfer the DNA to the nitrocellulose filters by capillary transfer with 1.5 M NaC1 or 20• SSC overnight. 6. Rinse the filters in 1 M NaC1. 7. Allow the filters to air dry and bake for 2 hr at 80~ 8. Hybridize the blots as described in Section III,G, when the immunological detection is performed in acetylated BSA/HBS. Otherwise: 9. Wet the filters in 0.1 M Tris-HC1, pH 7.4, 0.15 M NaC1. 10. Prehybridize with hybridization mixture [4 • SSPE, 10 • Denhardt's, 0.5% blocking reagent (Boehringer, Germany), 0.5% SDS, containing 50/~g/ml salmon sperm DNA and 50 /~g/ml yeast tRNA] in a sealed plastic bag in a water bath for 1 hr at 65~ 11. Hybridize the filters overnight at 65~ with a previously denatured (2 min, 100~ hapten-modified probe in hybridization mixture. Typical probe concentrations are 150 ng/ml mixture. 12. Rinse the filters twice in rinsing buffer (2• SSC, 0.5% SDS) for 10 min at 65~ in a sealed plastic bag in a water bath. 13. Wash 1 • 15 min in 0.5• SSC, 0.1% SDS at 65~ 14. Wash 2 • 5 min in 0.1 M Tris-HC1, pH 7.4, 0.15 M NaC1 (TN).
304
H. Berna Beverloo
15. Preincubate the filters with 0.25% blocking reagent/0.1 M TrisHCI, pH 7.4, 0.15 M NaCI (BB) for 30 min. 16. Incubate the filters with mouse anti-digoxigenin antibodies or mouse anti-biotin antibodies, diluted in B B, for 60 min. 17. Rinse 3 • 5 min each in TN. 18. Preincubate the filters in B B for 30 min. 19. Incubate the filters with goat anti-mouse antibodies (depending on the phosphor conjugate used, use biotinylated antibodies if avidin conjugates are used), diluted in BB, for 60 min. 20. Rinse 3 • 5 min in TN. 21. Preincubate the filters in B B for 30 min. 22. Apply the phosphor conjugates as described in Section III,D,2, step 7 for 1 hr. Do not use the B B or TN buffers; instead use 0.1% acetylated BSA/HBS, pH 7.4. 23. Rinse the filters 3 • 5 min in HBS. 24. Allow to air dry. 25. Photograph the incubated filters.
ACKNOWLEDGMENTS Research described in this paper was carried out at the Department of Cytochemistry and Cytometry, State University of Leiden, The Netherlands in cooperation with Philips (Eindhoven, The Netherlands) with financial support by the Council for Medical Research (NWO-GMW Grant No. 900-534-059), the Netherlands Organization for Scientific Research (NWO-PGS Grant No. 90-129-90), and by Biores BV (Zeist, The Netherlands).
REFERENCES Balzani, V., and Ballardini, R. (1990). New trends in the design of luminescent metal complexes. Photochem. Photobiol. 52, 409-416. Beverloo, H. B., van Schadewijk, A., van Gelderen-Boele, S., and Tanke, H. J. (1990). Inorganic phosphors as new luminescent labels for immunocytochemistry and timeresolved microscopy. Cytometry 11, 784-792. Beverloo, H. B., van Schadewijk, A., Bonnet, J., van der Geest, R., Runia, R., Verwoerd, N. P., Vrolijk, J., Ploem, J. S., and Tanke, H. J. (1992a). Preparation and microscopic visualization of multicolor luminescent immunophosphors. Cytometry 13, 561-570. Beverloo, H. B., van Schadewijk, A., Zijlmans, H. J. M. A. A., and Tanke, H. J. (1992b). Immunochemical detection of proteins and nucleic acids on filters using small luminescent inorganic crystals as markers. Anal. Biochem. 203, 326-334. Beverloo, H. B., van Schadewijk, A., Zijlmans, H. J. M. A. A., Verwoerd, N. P., Bonnet, J., Vrolijk, J., and Tanke, H. J. (1993). A comparison of the detection sensitivity of lymphocyte membrane antigens using fluorescein and phosphor immunoconjugates. J. Histochem. Cytochem. 41, 719-725.
13. Detection of Phosphors by Phosphorescence
305
Blasse, G. (1979). Chemistry and physics of R-activated phosphors. In "Handbook on the Physics and Chemistry of Rare Earths" (K. A. Gschneider and L. Eyring, eds.), Vol. IV. North-Holland, Inc., Amsterdam. Blasse, G., Dirksen, G. J., Van der Voort, D., Sabbatini, N., Perathoner, S., Lehn, J-M., and Alpha, B. (1988). [EuCbpy.bpy.bpy] 3+ cryptate; Luminescence and conformation. Chem. Phys. Lett. 146, 347-351. Bronstein, I., Voyta, J. C., and Edwards, B. (1989). A comparison of chemiluminescent and colorimetric substrates in a hepatitus B virus DNA hybridization assay. Anal. Biochem. 180, 95-98. Butler, K. H. (1980). "Fluorescent Lamp Phosphors." Pennsylvania State University Press, University Park. DeLuca, J. A. (1980). An introduction to luminescence in inorganic solids. J. Chem. Educ. 58, 541-545. Diamandis, E. P. (1990). Analytical methodology for immunoassays and DNA hybridization assaysmcurrent status and selected systems--Critical review. Clin. Chim. Acta 194, 19-50. Evangelista, R. A., Pollak, A., and Gudgin Templeton, E. F. (1991). Enzyme-amplified lanthanide luminescence for enzyme detection in bioanalytical assays. Anal. Biochem. 197, 213-224. Evangelista, R. A., Pollak, A., Allore, B., Templeton, E. F., Morton, R. C., and Diamandis, E. P. (1988). A new europium chelate for protein labeling and time-resolved fluorometric applications. Clin. Biochem. 21, 173-178. Gosling, J. P. (1990). A decade of development in immunoassay methodology. Clin. Chem. 36, 1408-1427. Gudgin Templeton, E. F., Wong, H. E., Evangelista, R. A., Granger, T., and Pollak, A. (1991). Time-resolved fluorescence detection of enzyme-amplified lanthanide luminescence for nucleic acid hybridizations assays. Clin. Chem. 37, 1506-1512. Hauber, R., and Geiger, R. (1988). A sensitive, bioluminescent-enhanced detection method for DNA dot-hybridization. Nucleic Acids Res. 16, 1213. Hemmil~i, I. (1988). Lanthanides as probes for time-resolved fluorometric immunoassays. Scand. J. Clin. Lab. Invest. 48, 389-400. Hemmil~i, I., Dakubu, S., Mukkala, V-M., Siitari, H., and L6vgren, T. (1984). Europium as a label in time-resolved immunofluorometric assays. Anal. Biochem. 137, 335-343. Hurskainen, P., Dahl6n, P., Ylikoski, J., Kwiatkowski, M., Siitari, H., and L6vgren, T. (1991). Preparation of europium labeled DNA probes and their properties. Nucleic Acids Res. 19, 1057-1061. Lehn, J-M. (1978). Cryptates: The chemistry of macropolycyclic inclusion complexes. Acc. Chem. Res. U, 49-57. Leif, R. C., Thomas, R. A., Yopp, T. A., Watson, B. D., Guarino, V. R., Hindman, D. H. K., Lefkove, N., and Vallerino, L. M. (1977). Development of instrumentation and fluorochromes for automated multiparameter analysis of cells. Clin. Chem. 23, 1492-1498. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Nederlof, P. M., van der Flier, S., Vrolijk, J., Tanke, H. J., and Raap, A. K. (1992). Fluorescence ratio measurements of double-labeled probes for multiple in situ hybridization by digital imaging microscopy. Cytometry 13, 839-845. Oser, A., Roth, W. K., and Valet, G. (1988). Sensitive non-radioactive dot-blot hybridization using DNA probes labelled with chelate group substituted psoralen and quantitative detection by europium ion fluorescence. Nucleic Acids Res. 16, 1181-1196. Oser, A., and Valet, G. (1988). Improved detection by time-resolved fluorometry of specific DNA-immobilized in microtiter wells with europium/metal-chelator labelled DNA probes. Nucleic Acids Res. 16, 8178.
306
H. Berna Beverloo
Pollard-Knight, D., Read, CI A., Downes, M. J., Howard, L. A., Leadbetter, M. R., Pheby, S. A., McNaughton, E., Syms, A., and Brady, M. A. W. (1990). Nonradioactive nucleic acid detection by enhanced chemiluminescence using probes directly labeled with horseradish peroxidase. Anal. Biochem. 185, 84-89. Prat, O., Lopez, E., and Mathis, G. (1991). Europium(Ill) cryptate a fluorescent label for the detection of DNA hybrids on solid support. Anal. Biochem. 195, 283-289. Soini, E., and Hemmil/i, I. (1979). Fluoroimmunoassay: present status and key problems. Clin. Chem. 25, 353-361. Soini, E., and Kojola, H. (1983). Time-resolved fluorometry for lanthanide chelatesmA new generation of nonisotopic immunoassays. Clin. Chem. 29, 65-68. Tanke, H. J., Slats, J. C. M., and Ploem, J. S. (1986). Labeled macromolecules: A process for their preparation and their use for immunological or immunocytochemical assays. International Patent W0/8502187.
Urdea, M. S., Warner, B. D., Running, J. A., Stempien, M., Clyne, J., and Horn, T. (1988). A comparison of non-radioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme labeled synthetic oligodeoxyribonucleotide probes. Nucleic Acids Res. 16, 4937-4956. Yacobi, B. G., and Holt, D. B. (1990). "Cathodoluminescence Microscopy of Inorganic Solids." Plenum Press, New York.
14
Detection of Europium Cryptates by Time-Resolved Fluorescence Odette Prat, Evelyne Lopez, and G~rard M athis CIS Bio International F-30205 Bagnols sur C6ze, France
I. Introduction II. Materials A. Reagents 1. Protein Labeling 2. DNA Labeling 3. Preparation of Solid Supports
B. Instrumentation III. Procedures A. Support and Detection Wavelength Optimization B. Membrane-Based Assays 1. Dot Blot Hybridization 2. Fluorometric Detection
C. Microtiter-Plate-Based Assays 1. DNA Samples 2. In Vitro Amplification Using Nested Primers
3. Europium Cryptate Detection of PCR Products
References
I. INTRODUCTION Nucleic acid hybridization techniques have become increasingly important in many fields, particularly forensic science, and the diagnosis of infectious diseases and genetic disorders. In most cases, hybridization probes have been labeled with radioisotopes such as 32p and 125I, yielding highly sensitive detection systems. However, the use of radionuclides has several drawbacks making them clearly unsuitable for use in large-scale routine diagnosis; these include limited shelf-life, waste disposal problems, and other difficulties related to automation. Many different nonisotopic methods are currently in use, for example colorimetry, chemiluminescence and bioluminescence, electrochemiluminescence, fluorescence and time-resolved fluorescence.
Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
307
308
Odette Prat et al.
Among the nonisotopic labels, fluorophores are interesting because most possess the unique properties of: 9 direct measurability in liquid or solid phases 9 nondestructive measurement 9 adaptability to homogeneous formats However, the natural fluorescence of different supports and components in biological samples reduces the effective sensitivity of this detection method (Hemmil~i, 1985). The problems can be minimized by using long-lived fluorophores and time-resolved detection for background reduction (Weider, 1978; Marshall et al., 1981). The use of long-lived rare earth chelates as fluorescent labels is now well established (Soini and Lrvgren, 1987; Diamandis, 1988). Ideally, to be considered suitable for biological systems, rare earth chelate labels must have thermodynamic and kinetic stability, complexation selectivity, high fluorescent yield, and the ability to be bound in a fluorescent form to biomolecules (Soini and Hemil~i, 1979). In practice, these requirements are not entirely fulfilled by the known chelates. There are two different approaches in devising analytical assays using these chelates. In the first approach (Soini and Lrvgren, 1987), E u 3+ is used as the label and is carried by the antibody or the DNA probe through the reaction by an EDTA or DTPA derivative. The formation of the highly fluorescent complex is achieved after the reaction by the addition of an excess of a suitable ligand plus a synergistic agent in a detergent solution (enhancement solution). This approach has been used successfully but has two main limitations: 9 vulnerability to E u 3+ contamination (Diamandis, 1988); 9 nonavailability of the fluorescent signal directly bound to the antibody or the probe These limitations make this system poorly adaptable to dot blot hybridizations and unsuitable for applications in which both localization and quantification are needed (Christopoulos et al., 1991; L6vgren et al., 1992). The second approach involves the use of the chelator as a label. The fluorescent complex is formed through the use of e x c e s s E u 3+ (Evangelista et al., 1988); hence this system is not affected by Eu 3§ contamination. The main limitation of this approach is the poor sensitivity of the fluorescent E u 3§ complex, which can be partly overcome by using a biotinylated antibody or probe and adding different types of streptavidin-based carriers (Diamandis, 1991). These limitations of existing chelates continue to stimulate the synthesis of new rare earth complexes (Hale and Solas, 1985; Toner, 1990; Mukkala et al., 1992). Given the state of the art, our reasoning in the search for new rare earth
14. Detectionof EuropiumCryptatesby Time-ResolvedFluorescence
309
chelates was based on the premise that the most important criterion for such a complex should be its kinetic stability rather than its thermodynamic behavior in biological media. The complex could be synthesized in organic media, but once formed it should have a very low dissociation rate in aqueous solutions (Mathis and Lehn, 1984). This requirement was fulfilled by rare earth cryptates (Gansow et al., 1977; Lehn, 1978). Research was initiated to identify organic donor moieties with absorption and emission levels suitable for an efficient intramolecular energy transfer to the complexed rare earth ion (Rodriguez et al., 1984; Alpha, 1987; Alpha et al., 1988; Lehn et al., 1990; Lehn and Roth, 1991). E u 3+ trisbipyridine cryptate is formed by the inclusion of a luminescent E u 3+ ion in the cavity of a macropolycyclic ligand containing bipyridine groups as light absorbers (Alpha et al., 1987). Because of its cage structure and the incorporation of the bipyridine units, the complex has high kinetic stability and selectivity in biological media, an efficient intramolecular energy transfer, and protection of the central ion against water deactivation. The quantum yield and the fluorescence lifetime in phosphate buffer are 10% and 0.56 msec, respectively (Sabbatini et al., 1992). The presence of two NH 2 groups on Eu 3+ trisbipyridine diamine cryptate (Fig. l) allows the use of well-known heterobifunctional reagents for coupling to antigens and antibodies (Lehn et al., 1987; Prat et al., 1991; Lopez et al., 1993). We envision chemically incorporating this label directly into DNA probes, as described for other labels in Chapter 2. The main photophysical properties of the photoactive cryptate are conserved after conjugation (Mathis, 1993). Our experience has been that such conjugates show very high stability (longer than 1 yr) at 4~ even
NH2 I C2H4 NH
o--~
NH2 I C2H4 NH
~:o
Fig. lmMolecular structure of trisbipyridine (Eu3+) cryptate diamine.
310
Odette Prat et al.
when in a ready-to-use state. To demonstrate the applicability of this new rare earth cryptate to the field of DNA probe technology, we will discuss two assay formats. The first is based on a dot blot hybridization with a DNA or oligonucleotide probe (Prat et al., 1991). This work demonstrates the ability of europium cryptate to measure DNA on a solid phase quantitatively and compares it to a common enzymatic method that is only semi-quantitative. Using the polymerase chain reaction (PCR) (Saiki et al., 1985), low abundance targets can be amplified; in most cases, very high label sensitivity is no longer a prerequisite in the development of a new nonisotopic methodology. The second format demonstrates the use of europium cryptate in the detection of PCR products in reference to an isotopic detection method (Lopez et al., 1993). This procedure is based on a modified form of PCR technology using two rounds of amplification (Amplicis | Cis Biointernational, Gif-sur-Yvette, France). In conjunction with europium cryptate detection, this technology is a step toward full automation for DNA mass screening in routine medical diagnosis. Other types of assay formats in which direct detection or quantification on solid supports is needed could also be developed with europium cryptate, including Western, Southern, and Northern blots, fluorescencebased DNA sequencing and in situ detection. The most important advantage that clearly separates europium cryptate from the other two types of chelates is its ability to be bound directly to a biomolecule in a fluorescent form. Further, this unique property allowed the development of very sensitive homogeneous fluoroimmunoassays based on energy transfer and time-resolved detection (Mathis et al., 1990; Mathis, 1993). Homogeneous methods using energy transfer have already been demonstrated in DNA assays (Morrisson et al., 1989). We believe that the majority of the drawbacks encountered in previous homogeneous methods for DNA analysis could be overcome through development of a method similar to that which we developed for immunoassays. Such a system is equally well adapted to highly automated analysis for both nucleic acid-based assays and immunoassays.
II. MATERIALS A. Reagents Calf thymus DNA, herring sperm DNA, pBR 322 DNA, M13 DNA, bovine serum albumin fraction V (BSA), streptavidin (SA), streptavidin-alkaline phosphatase conjugate, E c o RI, and biotin-16-dUTP are supplied by Boehringer-Mannheim (Mannheim, Germany).
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
311
N-Succinimidyl-3-(2-pyridyldithio)-propionate (SPDP) and sulfosuccinimidyl-4-(N-maleimidomethyl)-cyclohexane- 1-carboxylate (sulfoSMCC) are from Pierce (Rockford, Illinois). Nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) are purchased from Bethesda Research Laboratories (Life Technologies/BRL, Gaithersburg, Maryland). Dithiothreitol (DTT) and anti-dinitrophenyl monoclonal IgG antibody are from Sigma Chemical (St. Louis, Missouri). Taq DNA polymerase and the DNA thermal cycler are from Perkin Elmer Cetus (Emeryville, California). Chromatography columns Mono Q HR 5/5, G 25 superfine, HR 10/10 and HR 10/30, and dNTP are purchased from Pharmacia (Uppsala, Sweden). Microtiter plates (white, Microlite) are from Dynatech Laboratories (Chantilly, Virginia). The nitrocellulose membrane is Transblot (0.45/zm) from Bio-Rad (Hercules, California). Centricon-30 microconcentrators are from Amicon (Beverly, Massachusetts). Europium trisbipyridine diamine cryptate is prepared according to published methods (Mathis et al., 1984; Lehn et al., 1987) and purified by reverse-phase chromatography.
1. Protein Labeling Europium cryptate buffer: 20 mM sodium phosphate, pH 7.0 Protein buffer: 150 mM sodium phosphate, pH 6.5, 5 mM EDTA The maleimide reaction with protein sulfhydryl groups (Gosh et al., 1990) is used to synthesize the europium cryptate protein conjugates in a three-step process (Prat et al., 1991). Labeled streptavidin or anti-DNP antibody for hybridization assays on membrane and for the detection of PCR products on microtiter plates is prepared as follows:
a. Preparation of Europium Cryptate-Maleimide 1. Dissolve 1 mg europium trisbipyridine diamine cryptate trichloride (MW = 1004) in 1 ml europium cryptate buffer. The cryptate is entirely soluble in this buffer. 2. Prepare a 30 mM solution of sulfo-SMCC (MW = 436) in europium cryptate buffer. The half-life of sulfo-SMCC is approximately 2 hr in this buffer. Therefore, a fresh solution must be prepared for each coupling, and used immediately. 3. Add 66/~1 (2/~mol) cross-linker solution to the europium cryptate solution to obtain 2 mol sulfo-SMCC/mol europium cryptate. 4. Incubate at room temperature for 30 min in the dark on a roller shaker.
312
Odette Prat et al.
5. Centrifuge the reaction mixture for 5 min at 3000 g to remove the slight precipitate. 6. Load the clear supernatant on an anion exchange column (MonoQ, HR 5/5; Pharmacia) connected to an FPLC system (Pharmacia). 7. Elute the modified cryptate using a buffer containing 20 mM sodium phosphate, pH 7.0, and 10% dimethylformamide (v/v). 8. Adjust the flow-rate to 1 ml/min, monitor the absorbance at 305 nm, and collect 1-ml fractions. 9. The second fraction contains the europium cryptate-maleimide. 10. Store the europium cryptate-maleimide at 4~ until use. Prepare new cryptate-maleimide each time protein labeling is performed. Do not store maleimide derivatives for longer than 24 hr. The reaction of europium cryptate with sulfo-SMCC produces a maleimide derivative with a 66% yield, as analyzed by UV spectrometry.
b. Preparation of Protein SH The same process is used for streptavidin or anti-DNP antibody. 1. Dialyse 2 mg anti-DNP antibody overnight at 4~ against protein buffer to change the buffer and to remove the manufacturer's preservatives. For streptavidin coupling, dissolve 10 mg lyophilized streptavidin in 1 ml protein buffer. 2. Prepare a fresh 30 mM solution of SPDP (MW = 312) in absolute ethanol. 3. Add 5/xl or 25/xl freshly prepared SPDP solution, respectively, to the dialysed antibody or to the streptavidin solution prepared in step 1. Stir for 30 min at room temperature. 4. Equilibrate a desalting column (Fast Flow, HR 10/10, G25 superfine; Pharmacia) with protein buffer. 5. Elute the modified protein using protein buffer as elution solvent with a 2 ml/min flow rate. Monitor the absorbance at 280 nm. 6. Collect the fraction corresponding to the first elution peak. 7. Concentrate the SPDP-derivatized protein to a final volume of 500/zl using a Centricon-30 microcentrator. 8. Prepare a fresh 200 mM solution of dithiothreitol in protein buffer. 9. Reduce the disulfide bonds by mixing the 500/.d microconcentrated protein with 25/zl DTT solution. Incubate at room temperature for 15 min, without shaking. 10. Remove excess DTT by gel filtration. Perform this chromatography as detailed in steps 4-6. Use the protein-SH immediately for the subsequent reaction.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
313
Thiolated proteins are recovered with a 60% yield, as determined by UV analysis.
c. Reduction of Protein SH Groups with Europium Cryptate-Maleimide 1. Mix 5 mg streptavidin-SH and 1.7 mg europium cryptate-maleimide or 1.5 mg anti-DNP-SH antibody and 0.2 mg europium cryptate-maleimide (20-fold molar excess) in their respective buffers. 2. Incubate overnight at 4~ on a roller shaker. 3. Eliminate the slight precipitate by centrifugation. Concentrate the reaction mixture in a Centricon-30 microconcentrator to obtain a final volume of 500/A. 4. Purify the conjugate by gel chromatography on an HR 10/30 column (Sephadex G 25 superfine; Pharmacia). Use 50 mM sodium phosphate, pH 7.4, 150 m M NaC1 as elution buffer with a 2 ml/min flow rate. 5. Collect 500-/zl fractions. 6. Monitor the absorbance of the fractions at 280 nm and possibly at 305 nm (absorption maxima for proteins and europium cryptate, respectively), and the fluorescence at 620 nm. 7. Identify the first peak with 280-nm absorbance and 620-nm fluorescence. Pool the fractions containing the modified protein. A typical elution profile is shown in Fig. 2. 8. Dilute the labeled proteins to 1 mg/ml for streptavidin-europium cryptate and 0.1 mg/ml for anti-DNP antibody-europium cryptate in 50 mM sodium phosphate, pH 7.4, 150 mM NaC1. 9. Add BSA to a final concentration of 1 g/liter. 10. Store the conjugates at 4~ for streptavidin-europium cryptate or -20~ for anti-DNP antibody-europium cryptate. These conjugates are stable for at least 12 mo.
The respective concentrations of proteins and europium cryptate are calculated with the following equations, assuming that the molar extinction coefficient of each moiety is unchanged in the conjugate (Table I): A280 = Ep 280 x A305 = Ep 305 x
[P] + E~: 280
X
[K]
[P] + EK 305 X [K]
where absorbance of the conjugate at 280 nm absorbance of the conjugate at 305 nm Ep = molar extinction coefficient of the coupled protein at the studied wavelength A280 -
A 3 0 5 "--
314
Odette Prat et al.
Absorbance at 280 nm
/'1, ~
0.4_
8000
II I
I
I I
I
I
I
I
_ 6000
I
I
I
I
I
I
I
I
I
I
I i
I I
0.2_
_
I
I
0.3_
0.1
Fluorescence at 620 nm
,lli I
t
I
/f
t
I
/
~,
/
.
.,
~
~
"x
/
\~
'
~
'
\
I
0
5
110
_ 2000
"\
,"
i J ~ i.
/1 0
I
_ 4000
ll5
I
I
20
25
ELUTION VOLUME (ml) Fig. 2 - - G e l filtration profile of the purification of a streptavidin-europium cryptate conjugate using a Sephadex G 25 HR l0 • 30 column. The absorbance of the fractions is monitored at 280 nm and the fluorescence at 620 nm. Fractions (7-11 ml) containing the europium cryptate-labeled protein are pooled.
EK = molar extinction coefficient of europium cryptate at the studied wavelength [P] = molar concentration of the protein in the final conjugate [K] = molar concentration of europium cryptate in the final conjugate The optical pathlength is 1 cm. The labeling ratio ([K]/[P]) is roughly equivalent to 4 mol europium cryptate/mol streptavidin and 8 mol europium cryptate/mol anti-DNP antibody. Table ! Molar Extinction Coefficients~ b
Streptavidin Anti-DNP antibody Europium cryptate
280 nm
305 nm
1.4 • 105 2.1 x 105 7.8 • 103
8.7 • 103 Negligible 2.5 • 104
Units are M-1 c m - l . b Measurement buffer: 50 mM sodium phosphate, pH 7.4, 150 m M NaCI. a
14. Detection of EuropiumCryptates by Time-Resolved Fluorescence
315
This coupling method with heterobifunctional cross-linkers results in a protein conjugate in which the properties of both moieties (affinity of the proteins and fluorescence features of the labels) are retained. Specifically, the emission profile of europium cryptate does not change; the major emission peak remains at 618 nm. The fluorescence lifetime is calculated according to Hieftje and Vogelstein (1981). The pattern of fluorescence deactivation is monoexponential, providing europium cryptate-protein conjugates with a lifetime of 650/zsec with minimal variation among batches (_ 3%). In the same buffer (50 mM sodium phosphate, pH 7.4, 150 mM NaCI, BSA 1 g/liter), the fluorescence lifetime of europium cryptate is 610/~sec.
2. DNA Labeling a. L o n g Probes
The probe may be prepared by nick translation using Biotin-16-dUTP as the modified nucleotide. The nick translation kit available from BRL contains all the reagents (except modified nucleotide) and instructions necessary to produce biotin-labeled probes. Purified linearized pBR 322 plasmid is biotinylated according to the manufacturer's protocol and purified by ethanol precipitation, then by ultrafiltration in a Centricon-30 microconcentrator. Store the probe in distilled water as a 10 ng//xl solution at -20~ b. Oligonucleotides
Synthesis of oligonucleotides is performed by phosphoramidite chemistry with an automated DNA synthesizer (Model 381A from Applied Biosystems) according to Caruthers et al. (1987). Oligonucleotides can be biotinylated using several methods. Some are aminoalkylated at the 5' end following described procedures (Chollet and Kawashima, 1985) and purified by polyacrylamide gel electrophoresis. Others are biotinylated according to Roget et al. (1989). Incorporation of DNP at the 5' end of internal primers is carried out as described by Sauvaigo et al. (1990). One mole of label is incorporated per oligonucleotide. Store oligonucleotides in distilled water at 10 pmol//zl at -20~
3. Preparation of Solid Supports
a. Nitrocellulose Membranes
Hydration buffer: 2x SSC (1 x SSC: 0.15 M NaC1, 0.015 M trisodium citrate, pH 7.0)
316
Odette Prat et al. 1. Mark the untreated nitrocellulose membrane with a special metal stamp reproducing the geometry of a microtiter plate. Stamped areas where the dots must be applied are thus spaced in the same way as the microtiter wells. This procedure allows greater standardization of epifluorescence measurement on the solid support. 2. Cut the premarked membrane into 1 x 5 cm strips (approximately half a microtiter strip). 3. Soak the strips in distilled water, then 2• SSC for 2 min until uniformly hydrated. 4. Dry the filters for 10 min at 37~ 5. Denature the target DNA (in this case pBR 322 or M13) in distilled water by heating the solution at 100~ for 5 min, then quench at 0~ 6. Dilute this DNA solution with the same volume of 12x SSC; then make 2-fold serial dilutions in 6• SSC. 7. Spot 2-/xl dots of each solution on premarked areas of the membrane. 8. Bake the filters at 80~ for 2 hr; then store at room temperature until use. b. Polystyrene Microtiter Plates
Coating buffer: 50 mM sodium phosphate, pH 7.4 Saturation buffer: 20/xg/ml denatured sonicated herring sperm DNA in 50 mM sodium phosphate, pH 7.4, 1% BSA (w/v) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.
Prepare a 20/xg/ml solution of BSA-biotin in coating buffer. Dispense 300/zl/well and cover with adhesive tape. Incubate overnight at room temperature. Discard the BSA-biotin solution using a vacuum line. Prepare a solution of streptavidin (30/zg/ml) in coating buffer. Dispense 300/xl/well of the streptavidin solution. Incubate for 2 hr at room temperature. Remove the coating solution and block the remaining active sites on the polystyrene surface using saturation buffer (300/zl/well). Incubate overnight at 45~ Discard the saturation buffer and wash the plates twice for 10 min at room temperature with 300/xl coating buffer. Dry microtiter plates under reduced pressure for 2 hr at 37~ Cover with adhesive tape and store dry at 4~ The streptavidincoated plates are stable for at least 6 mo.
The binding capacity of this solid support is determined using a double-labeled DNA (32p, biotin) (Lopez, 1992). The coating proce-
14. Detection of EuropiumCryptates by Time-Resolved Fluorescence
317
dure described here allows the capture of 1 pmol biotinylated DNA per well.
B. Instrumentation Europium fluorescence is usually detected at 620 nm with a time-resolved fluorometer. For liquid phase measurements of europium cryptate solutions, Arcus 1230 from Wallace OY (Turku, Finland) can be used. The Cyberfluor 615 Analyzer (Cyberfluor, Inc., Toronto, Canada) is suitable for use in a wide variety of hybridization assay formats, both membraneand microwell-based. In-house time-resolved fluorescence prototypes [collaboration between CIS Biointernational and Packard Instruments, Co. (Downer's Grove, Illinois) are used. The apparatus is designed for the measurement of europium fluorescence on a solid phase or in a liquid with opaque microwells. Measurements are based on epifluorescence. Excitation is from above, and the emitted signal from the surface of the solid support or from the solution is collected through optical lenses on a photomultiplier equipped with a photon counter (Fig. 3). The excitation source is either a Xenon flash lamp with a wide-band UV optical filter (UG II from Schott) or nitrogen pulsed laser (337 nm, 20 Hz). Emission light is selected through a continuous interference filter or directly with a narrow-band 700-nm filter. The optimal delay before counting is 0.2 msec and counting time is 0.4 msec per cycle. A microtiter plate holder is moved under the optical reader head by two perpendicular stepper motors, allowing the beam to be centered on each dot or well. Membranes are placed on the microtiter plate holder for fluorometric analysis.
III. PROCEDURES A. Support and Detection Wavelength Optimization The maximum fluorescence emission of europium cryptate is at 620 nm. Since supports may contain substances that interfere with the fluorescence of the label, several types of membrane were investigated to minimize the intrinsic fluorescence of the support at this wavelength. We found that at 620 nm, nylon membranes give a background that is two to four
318
Odette Prat et al.
STEPPING M 0)/0 R
~
P
CONTINUOUS
/400 nm
X,(_.,/
700nm / INTERFERENCE .
,,
/
FILTER LITS
FLASH
LAMP
FILTER
CHROIC MIRROR
o o/ Fig. 3.--Simplified optical diagram of the in-house time-resolved fluorometer. UV excitation is made with a flash lamp (or a nitrogen laser). Emission wavelength is scanned with a continuous interferential filter, allowing spectrum analysis. The microtiter plate or membrane holder is positioned under the optical pathway by two perpendicular stepper motors.
times stronger, depending on the manufacturer, than that of nitrocellulose. Of course, the higher the background, the lower the signal-to-noise ratio. Whenever sensitivity is necessary, the use of nitrocellulose is recommended for dot analysis. Although nitrocellulose is the best type of membrane, it still generates some noise at 620 nm. By scanning the fluorescence background of nitrocellulose with the in-house fluorometer between 500 nm and 700 nm, background appears to be minimal at 700 nm (Fig. 4). Fortunately, europium cryptate has a significant emission peak at this wavelength. Performing analysis at 700 nm instead of 620 nm provides a twofold improvement in the signal-to-noise ratio. For microtiter plates, the most satisfactory results were obtained with white Microlite plates from Dynatech; 700 nm is also the best analysis wavelength.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
30000-
25000_
1 (Eu)-cryptate 2 Background ..........
319
A
O3 Z uJ O Z uJ O
20000_
co 15000_ LLI CC
o J
u. 10000_
5000_
500
I
I
I
550
600
650
70(
WAVELENGTH (nm)
Fig. 4---Spectral analysis of fluorescence after a hybridization experiment on nitrocellulose membrane of (1) biotinylated pBR 322 hybrid detected with europium cryptate conjugate and (2) no DNA target submitted to europium cryptate conjugate (background mainly due to nitrocellulose). Spectra were recorded with the in-house fluorometer and a continuous emission filter between 500 nm and 700 nm. The signal to noise ratio is higher (1.7 x ) at 700 nm than at 620 nm, the usual wavelength for europium fluorescence analysis.
B. M e m b r a n e - B a s e d
Assays
DNA is hybridized with complementary biotinylated probes and incubated with the streptavidin-europium cryptate conjugate. Bound conjugate is detected by time-resolved fluorometry. An enzymatic detection with streptavidin-alkaline phosphatase conjugate is used as a reference method. Stock solutions (stored in aliquots at -20~ 9 10% Sodium dodecylsulfate (SDS) 9 1 M Sodium phosphate buffer, pH 7.2 9 20• SSC (1 • SSC = 0.15 M NaCI, 0.015 M trisodium citrate, pH 7.0) 9 4 M Sodium chloride 9 100 • Denhardt's solution (! • Denhardt's solution = 0.02% Ficoll, 0.02% polyvinyl pyrrolidone and 0.02% BSA in water) Buffers: 9 Prehybridization buffer: 4 x SSC, 10 • Denhardt's, 0.1% SDS, 50 mM sodium phosphate, pH 7.4, 0.1 mg/ml fragmented and denatured herring sperm DNA
320
Odette Prat et al.
9 Hybridization buffer: 2 x SSC, 5 • Denhardt's, 0.05% SDS, 25 mM sodium phosphate, pH 7.4, 0.05 mg/ml fragmented and denatured herring sperm DNA. Hybridization buffer is obtained by mixing one volume of denatured DNA probe with one volume of prehybridization buffer. 9 Blocking buffer: 0.1 M Tris-HCl, pH 7.4, 0.5 M NaCI, 3% BSA (w/v) 9 Incubation buffer: 0.1 M Tris-HCl, pH 7.4, 0.5 M NaCI, 0.05% Triton X-100 (v/v)
1. Dot Blot Hybridization 1. Place each filter strip with bound DNA in a sealed plastic bag containing 0.5 ml prehybridization buffer, to saturate filter sites. 2. For long probes, incubate the filters at 65~ for 4 hr in a shaking water bath. For oligonucleotide probes, incubate the filters for only 1 hr at 40~ 3. Open the bag and discard the solution. Replace it with 0.5 ml hybridization mixture obtained by mixing one volume of denatured biotinylated probe and one volume of prehybridization buffer. The final concentration of biotinylated probe is 150 ng/ml for short probes and 250 ng/ml for long probes. 4. For long probes, incubate overnight at 65~ For short probes, incubate for only 2 hr at 30~ 5. Wash the filter strips as follows (to be performed at 65~ for long probes or at room temperature for short probes): 9 9 9 9
twice with 200 ml 2 x SSC, 0.1% SDS for 15 min twice with 200 ml 1 x SSC, 0.1% SDS for 15 min once with 200 ml 0.5 x SSC, 0.1% SDS for 15 min final wash with 200 ml 2 x SSC for 15 min at room temperature, regardless of the length of the probe
2. Fluorometric Detection 1. Presaturate the filters in a bag at 65~ for 1 hr with 1 ml blocking buffer (for oligonucleotides, presaturate at room temperature). 2. Replace the blocking buffer with 1 ml per bag of streptavidineuropium cryptate conjugate at l0/~g/ml in incubation buffer; incubate for l0 min at room temperature. 3. Wash the filters twice with 200 ml incubation buffer for 20 min at room temperature, with gentle shaking. Perform a final wash in 0.1 M sodium phosphate, pH 7.4, 0.1 M NaC1 for l0 min at room temperature.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
321
4. Dry the strips for 5 min in an oven at 80~ 5. Lay the filter spots-side up on a microplate holder and measure fluorescence at 700 nm with a spectrofluorometer, as described in Section II,B.
This method allows direct quantification of a specific DNA target on a filter by comparison with a standard curve (Prat et al., 1991). Figure 5 shows results obtained with a long probe (pBR 322) and a short probe (17-mer oligonucleotide complementary to M 13). The detection limit is determined as the mean of the background value + 2 z standard deviation. In the case of the nick-translated probe, the lowest detectable amount of pBR 322 DNA is 10 pg or 2 x 10-~8 mol. In the case of a 5' end-monolabeled oligoprobe, the detection limit of phage M13 DNA is 1 ng or 2 x 10-16 mol. The two orders of magnitude difference between the detection limits in the two examples is due to the difference in labeling between the probes. A long probe provides a good amplification of the signal by the incorporation of approximately 100 biotin moieties per probe whereas an oligonucleotide probe is labeled with only one biotin molecule. An enzymatic detection is chosen as a reference. For this colorimetric detection, the Blue Gene Nonradioactive Detection System from BRL, which provides all the necessary reagents, is used. The reporter molecule is a streptavidin-alkaline phosphatase conjugate and the substrate system is composed of BCIP and NBT. For details, see Rashtchian (1992). As shown in Fig. 6, enzymatic detection limits are identical to those of fluorometric detection, the latter method being simpler, quantitative, and more easily automated.
C. Microtiter-Plate-Based Assays The in vitro amplification of target DNA sequences by PCR (Saiki et al., 1988) circumvents the problem of sensitivity. Currently, attempts to find suitable PCR-based formats for mass screening are gaining in importance. To prevent nontargeted products, and to increase the specificity and efficiency of the PCR reaction, the Amplicis | methodology, based on a 200fold dilution step in a nested PCR procedure, is used (Sauvaigo et al., 1991). The Amplicis | technique (Fig. 7) produces double-labeled DNA duplexes. The biotin end allows affinity-based capture on streptavidin-coated supports and the DNP group is used as a reporter for europium cryptate detection (Lopez et al., 1993).
322
Odette Prat et al. 35000
A
pBR322 DNA
30000
Z
25000
O
z 20000 o O 1500O
10000
5000
I
I
0
30000
I
100
I
I
200 300 400 PICOGRAMS OF TARGET DNNDOT
B
M13 DNA Control DNA
.
.
500
.
.
.
.
.
25000
~20000 Z w Z
15000 o J
10000
5000
I
0
!
5
I
I
I
10 15 20 NANOGRAMS OF TARGET DNNDOT
25
Fig. 5mStandard curves obtained after hybridization of DNA with biotinylated probe and detection with streptavidin-europium cryptate conjugate. Time resolved fluorescence is detected on dots at 700 nm. The results are the mean value of triplicates. Background is not subtracted. (A) 10-500 pg pBR 322 DNA hybridized with a nick-translated probe. Negative control (100 ng human placenta DNA) - 2,790 fluorescent units (FU). Background (no fixed DNA) = 2,522 FU. (B) 1-25 ng M13 DNA hybridized with a biotinylated oligonucleotide (17-met). Negative control (100 ng calf thymus DNA) = 3,518 FU. Background (no fixed DNA) = 3,491 FU.
Fig. 6---Colorimetric detection of dot blots with the Blue Gene detection kit (BRL). (A) pBR 322 hybridized with a nick-translated probe. Negative control: 100 ng sonicated and denatured human placenta DNA. (B) M13 hybridized with a biotinylated oligonucleotide. Negative control: 100 ng sonicated and denatured calf thymus DNA. Amounts of target are indicated on the left for each dot.
a
. . . . . . , - . .
DNAsample b .~ PCRI .~. Dilutionstep
.~ PCR II A W
A V
,L Capture Solid phase
A V
Fluorescent detection
Fig. 7---Detection of PCR products using europium cryptate. After standard amplification with the outer primers (a,b), the PCR products are diluted and a second amplification with the inner (modified) primers (c,d) is performed. The DNA duplexes are immobilized by their biotin-labeled end (O) onto a streptavidin (SA)-coated microtiter plate. The detection is carried out by the DNP (O)-labeled end using an anti-DNP antibody coupled to europium cryptate (K).
Odette Prat et al.
324
uffer$
Taq buffer: 10 mM Tris-HCl, pH 8.3, 50 mM KCI, 1.5 mM MgCI 2, 0.01% gelatin (w/v) Saturation buffer: 50 mM sodium phosphate, pH 7.4, 150 mM NaC1, 3% BSA (w/v) Capture buffer: 100 mM Tris-HCl, pH 7.4, 150 mM NaCI Detection buffer: 100 mM Tris-HCl, pH 7.4, 0.5 M NaCI, 1% BSA (w/v) Washing buffer: 100 mM Tris-HCl, pH 7.4, 0.5 M NaCI, 1% BSA (w/v), 0.05% Triton X-100 (v/v)
1. DNA Samples Prepare DNA from culture cells or clinical samples by the standard procedure: proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation (Sambrook et al., 1989). Store the purified DNA in distilled water at -20~ until use.
2. In Vitro Amplification Using Nested Primers
1. Prepare the PCR reaction in a 25-/zl reaction mix containing 1/zg extracted genomic DNA (in this case, cervical smears) or 10 ng cultured cell DNA (Caski DNA), 5 nmol of each deoxynucleotide triphosphate, 6.25 pmol of each external primer, and Taq buffer. 2. Cover the mixture with 100/zl mineral oil. 3. Denature the DNA by heating this mixture at 95~ for 5 min in an automated heat-block (DNA Thermal Cycler, Perkin Elmer Cetus). 4. Add 1.5 U Taq DNA polymerase (AmpliTaq, Perkin Elmer Cetus). 5. Perform 30 cycles of amplification: denature at 94~ for 1.5 min, anneal at 55~ for 1.5 min, then extend at 72~ for 2 min. 6. At the end of the last cycle, carry out a final extension step at 72~ for 8 min. 7. Perform a 200-fold dilution of this PCR I product in deionized sterile water. 8. Add 2/zl of this dilution to 23/zl of a solution containing 2.5 pmol of each labeled internal primer, 1.25 U Taq DNA polymerase, and the other reagents described in step 1. 9. Transfer the mixture to the DNA thermal cycler; then amplify for 15 cycles using the temperature and duration parameters described in steps 5-6.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
325
To avoid false positive results, perform positive and negative controis each time a new sample is to be analyzed. The usual wellknown PCR-related precautions should be taken as well (Kwok and Higuchi, 1989).
3. Europium Cryptate Detection of PCR Products
a. Capture of amplified DNA 1. Bring the microtiter wells from 4~ to room temperature. 2. Add 300 /xl saturation buffer /well and incubate at 37~ for 30 min. 3. Discard this solution and add 5/zl nested PCR product and sufficient capture buffer for a final volume of 300/zl. 4. Allow the binding to proceed for 1 hr at 37~ with gentle shaking. 5. Discard the solutions and wash the wells twice with 300/xl capture buffer at room temperature, for 5 min each time.
b. Europium cryptate detection 1. Prepare a 1/zg/ml solution anti-DNP antibody-europium cryptate conjugate in detection buffer. 2. Dispense 300/zl/well of this fluorescent antibody solution. Incubate at 37~ for 2 hr. 3. Remove solution by aspiration. 4. Wash the wells twice with washing buffer, 10 min each time, at room temperature. 5. Turn over and blot the microtiter plates for 10 min. 6. Measure the fluorescence emission of the europium cryptate directly from the solid support at 700 nm. Use the protocol described in Section II,B for solid support detection. The measurement can also be performed in liquid phase after releasing the europium cryptate by digestion of the protein conjugate with proteinase K. These reading conditions do not improve the assay (data not shown). The complete reading of 969 microtiter wells takes only a few minutes.
The binding capacity of the support is limited to 1 pmol biotinylated DNA (see Section II,A,3,b). The PCR II reaction is performed with 2.5 pmol biotinylated primers. Therefore only a fraction of biotinylated products contained in the 25-/xl mixture can be captured on the microtiter wells. The fluorescence emission of the labeled DNA segments collected
326
Odette Prat et al. Table !1 Effect of PCR II Product Volume on Time-Resolved Fluorescent Signals"
Samples b
PCR II DNA products (/,d)
Fluorescence intensity (FU)
CV (%)
5 0.5 1 2.5 5 10
1,300 8,968 12,682 26,560 52,252 51,960
10.9 6.8 7.2 3.9 2.7 1.4
Control Caski DNA
" After affinity-based capture on streptavidin-coated microtiter wells, DNA segments are detected with 1 /xg/ml TBP (europium cryptate)-anti-DNP antibody and directly measured on the prototype. b PCR is carried out on 10 ng Caski DNA; 1 /zg human placenta is used as control.
by affinity on the microtiter wells is proportional to the volume of PCR II products up to a volume of 5/zl (see Table II). Moreover, the detection by europium cryptate conjugate provides CV values <13%. The europium cryptate label has been used in an Amplicis | methodology to detect human papillomavirus type-16 in culture cells. See Table III for typical results. To determine the detection level, several dilutions of Caski DNA (500 HPV-16/celI) are amplified according to the previously described methodology. As few as 10 copies of HPV can be detected. This detection limit is the same as previously reported with other nonisotopic methods (Ting and Manos, 1990; Paper et al., 1991). The presence of HPV-16 DNA in clinical cervical smears is analyzed by both europium cryptate and 125I detection. Here, a ~25I-labeled primer (Sauvaigo et al., 1990) is used instead of a DNP primer in the PCR II
Table ill Europium Cryptate Detection of HPV-16 in Caski Cell DNA o
Background C_ b C +c
Fluorescence intensity (FU)
CV (%)
1,120 1,280 55,584
9.8 12.2 2.5 ,,,
" Results are mean values based on four determinations. b Negative control: 1 /~g calf thymus DNA. r 10 ng Caski cell DNA.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
327
r 60000 I..... Z UJ
z
40000
O ._1
20000
UJ 0 0') UJ n"
LL
I1. ~
U
,
U HUH
40000C-
C+
a
bc
d
e f g
h i j k I m
n
Fig. 8---HPV-16 detection in clinical samples by europium cryptate (A) or 1251(B). In this
experiment, 1 /zg extracted DNA from normal tissues (a-e) or premalignant lesions (f-n) is analyzed. The cut-off value (---) between HPV-16-negative and HPV-16-positive samples is determined as the mean value of three replicative HPV-16-negative controls + 5 SD. C + (positive control): 10 ng Caski DNA; C_ (negative control): 1/zg calf thymus DNA.
reaction. The bound radioactivity is then directly measured on the solid support. The ratio between results for the positive control and negative control is in the same range for the fluorescent and the reference isotopic method: 43.4 and 44, respectively. The results (Fig. 8) demonstrate a good correlation between the two detection systems. The Amplicis | methodology combined with the solid-phase hybridization step and the europium cryptate allows a direct, quantitative, long-term, and safe measurement of PCR products.
REFERENCES Alpha, B. (1987). "Cryptates Photoactifs de Lanthanides: De Nouveaux Marqueurs Luminescents." Ph.D. Thesis. Universit6 Louis Pasteur, Strasbourg. Alpha, B., Lehn, J. M., and Mathis, G. (1987). Energy transfer luminescence of Eu(III) and Tb(III) cryptates of macrobicyclic polypyridine ligands. Angew. Chem. Int. Ed. Engl. 26, 266-267. Alpha, B., Anklam, E., Deschenaux, R., Lehn, J. M., and Pietrasckiewicz, M. (1988). Synthesis and characterisation of the sodium or lithium cryptates of macrobicyclic ligands incorporating pyridine, bipyridine. Heir. Chim. Acta 71, 1042-1052. Caruthers, M. H., Barone, A. D., Beaucage, S. L., Doddo, D. R., Fisher, E. F., Mc Bride, L. J., Matteuci, M., Stabinsky, Z., and Tang, J. Y. (1987). Chemical synthesis of deoxynucleotides by the phosphoramidite method. Methods Enzymol. 154, 287-313.
328
Odette Prat et al.
Chollet, A., and Kawashima, E. H. (1985). Biotin-labeled synthetic oligodeoxyribonucleotides: Chemical synthesis and uses as hybridization probes. Nucleic Acids Res. 13, 1529-1541. Christopoulos, T. K., Diamandis, E. P., and Wilson G. (1991). Quantification of nucleic acids on nitrocellulose membranes with time resolved fluorometry. Nucleic Acids Res. 19, 6015-6019. Diamandis, E. P. (1988). Immunoassays with time-resolved fluorescence spectroscopy: Principles and applications. Clin. Chem. 21, 139-150. Diamandis, E. P. (1991). Multiple labeling and time resolvable fluorophores. Clin. Chem. 37, 1486-1491. Evangelista, R. A., Pollak, A., Allore, B., Templeton, E., Morton, R. C., and Diamandis, E. P. (1988). A new europium chelate for protein labeling and time-resolved fluorometric applications. Clin. Biochem. 21, 73-78. Gansow, O. A., Kausar, A. R., Triplett, K. M., Weaver, M. J., and Yee, E. L. (1977). Synthesis and chemical properties of lanthanide cryptates. J. Am. Chem. Soc. 99, 7087-7089. Gosh, S. D., Kao, P. M., Mc Cue, A., and Chapelle, M. L. (1990). Use of maleimide-thiol coupling chemistry for efficient synthesis of oligonucleotide-enzyme conjugate hybridization probe. Bioconjugate Chem. 1, 71-76. Hale, R. L., and Solas, D. W. (1985). Substituted pyridine derivatives. Patent EP 195413. Hemmil~., I. (1985). Fluoroimmunoassays and immunofluorometric assays (review). Clin. Chem. 31, 359-370. Hieftje, G. M., and Vogelstein, E. E. (1981). In "Modern Fluorescence Spectroscopy" (E. L. Wehry, ed.), Vol. 4, Chap. 2, p 38. Plenum Press, New York. Kwok, S., and Higuchi, R. (1989). Avoiding false positives with PCR. Nature (London) 339, 237-238. Lehn, J. M. (1978). Cryptates: The chemistry of macropolycyclic inclusion complexes. Acc. Chem. Res. 11, 49-57. Lehn, J. M., Mathis, G., Alpha, B., Deschenaux, R., and Jolu, E. J. P. (1987). Rare earth cryptates, process for obtaining them, intermediate synthesis products and use as fluorescent markers. Patent WO 89 05813. Lehn, J. M., Pietrasckiewicz, M., and Karpuik, J. (1990). Synthesis and properties of acyclic and cryptate Eu(III) complexes incorporating the 3,3'biisoquinoline N,N'dioxide unit. Helu. Chim. Acta 73, 106-111. Lehn, J. M., and Roth, C. O. (1991). Synthesis and properties of sodium and europium (III) cryptates incorporating the 2,2'-bipyridine, 1,1 '-dioxide and 3,3'-biisoquinoline-2,2'dioxide units. Heir. Chim. Acta 74, 572-578. Lopez, E. (1992). "Cryptate d'Europium (III) Trisbipyridine et D6tection d'Acides Nucl6iques Cibles par Fluorescence en Temps R6solu." Ph.D. Thesis. Universit~ de Montpellier, France. Lopez, E., Chypre, C., Alpha, B., and Mathis, G. (1993). Europium (III) trisbipyridine cryptate label for time-resolved fluorescence detection of polymerase chain reaction products fixed on a solid support. Clin. Chem. 39, 196-201. L6vgren, T., Hurskainen, P., and Dahl6n, P. (1992). Detection of lanthanide chelates by time resolved fluorescence. In "Nonisotopic DNA Probe Techniques" (L. J. Kricka, ed.), pp. 227-261. Academic Press, San Diego. Marshall, N. J., Dakubu, S., Jackson, T., and Ekins, R. P. (1981). Pulsed light, time-resolved fluoroimmunoassay. In "Monoclonal Antibodies and Development in Immunoassay" (E. Albertini and R. Ekins, eds.), pp. 101-108. Elsevier North Holland Biomedical Press, Amsterdam. Mathis, G. (1993). Rare earth cryptates and homogeneous fluoroimmunoassays with human sera. Clin. Chem. 39, 1953-1959.
14. Detection of Europium Cryptates by Time-Resolved Fluorescence
329
Mathis, G., Dumont, C., Aspe, D., Foyentin, M., Jolu, E. J. P., and Nuti, D. (1990). Method for amplifying a signal emitted by a luminescent compound. Patent WO 92 01225. Mathis, G., and Lehn, J. M. (1984). Macropolycyclic rare earth complexes and application as fluorescent tracers. Patent EP 180492. Morrisson, L. E., Halder, T. C., and Stols, L. M. (1989). Solution-phase detection of polynucleotides using interacting fluorescent labels and competitive hybridization. Anal. Biochem. 183, 231-244. Mukkala, V. M., Sund, C., Kwiatkowski, M., Pasanen, P., H6gberg, M., Kankare, J., and Takalo, H. (1992). New heteroaromatic complexing agents and luminescence of their Eu (III) and Tb (III) chelates. Helo. Chim. Acta 75, 1621-1632. Paper, T., and Friedman, M., and Nur, I. (1991). Use of sulfonated primers to detect and type papillomavirus in cell cultures and cervical biopsies. Gene 103, 155-161. Prat, O., Lopez, E., and Mathis, G. (1991). Europium (III) cryptate: A fluorescent label for the detection of DNA hybrids on solid support. Anal. Biochem. 195, 283-289. Rashtchian, A. (1992). Detection of alkaline phosphatase by colorimetry. In "Nonisotopic DNA Probe Techniques" (L. J. Kricka, ed.), pp. 147-165. Academic Press, San Diego. Roget, A., Bazin, H., and Teoule, R. (1989). Synthesis and use of labelled nucleoside phosphoramidite building blocks bearing a reporter group: biotinyl, dinitrophenyl, pyrenyl and dansyl. Nucleic Acids Res. 17, 7643-7651. Rodriguez, J. C., Alpha, B., Plancherel, D., and Lehn, J. M. (1984). Photoactive cryptands. Heir Chim. Acta. 76, 2264-2269. Sabbatini, N., Guardigli, M., Lehn, J. M., and Mathis, G. (1992). Luminescence oflanthanide cryptates: Effects of phosphate and iodide anions. J. All. Comp. 180, 363-367. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. T., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Sai'ki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989). Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc. Natl. Acad. Sci. U.S.A. 86, 6230-6234. Sambrook, J., Fritsh, E. F., and Maniatis, T. (1989). "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sauvaigo, S., Fouqur, B., Roget, A., Livache, T., Bazin, H., Chypre, C., and Teoule, R. (1990). Fast solid support detection of PCR amplified viral DNA sequences using radioiodinated or hapten labelled primers. Nucleic Acids Res. 18, 3175-3183. Soini, E., and Hemmil~i, I. (1979). Fluoroimmunoassay: present status and key problems (review). Clin. Chem. 25, 353-361. Soini, E., and Lrvgren, T. (1987). Time-resolved fluorescence of lanthanide probes and applications in biotechnology. Crit. Rev. Anal. Chem. 18, 105-154. Ting, Y., and Manos, M. (1990). Detection and typing of genital human papillomavirus. In "PCR Protocols" (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds.), p. 123. Academic Press, San Diego. Toner, J. L. (1990). Lanthanide chelates as luminescent probes. In "Inclusion Phenomena and Molecular Recognition" (J. Atwood, ed.), pp. 185-197. Plenum Press, New York. Wieder, I. (1978). Background rejection in fluorescent immunoassay. In "Immunofluorescence and Related Staining Techniques" (W. Knapp, K. Hobular, and G. Wick, eds.), Proc. VI Int. Conf. Immunofluorescence and Related Staining Techniques, pp. 67-80. Elsevier Biomedical Press, Amsterdam.
15
Detection of Lanthanide Chelates by Time-Resolved Fluorescence Timo Ltivgren and Antti Iiti~i Department of Biotechnology University of Turku Fin-20520 Turku, Finland Pertti Hurskainen and Patrik Dahl~n Wallac Oy Fin-20101 Turku, Finland
I. Introduction II. Indirect Labeling A. Materials 1. Reagents 2. Instrumentation
B. Procedures 1. Sandwich Hybridization on Microtitration Plates 2. Useful Hints
III. Chemical Europium Labeling of DNA Probes A. Materials 1. Reagents 2. Component Preparation 3. Instrumentation
B. Procedures 1. Sandwich Hybridization 2. Solution Hybridization 3. Useful Hints
IV. Enzymatic Europium Labeling of DNA Probes A. Materials 1. Reagents 2. Component Preparation 3. Instrumentation
B. Procedures 1. Hybridizations
V. Europium-Labeled Oligonucleotides A. Materials 1. Reagents 2. Component Preparation 3. Instrumentation Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
331
332
Timo Ltivgrenet al.
B. Procedures 1. Detection of Specific DNA Using PCR and Europium-Labeled Oligonucleotide Probes in an in Solution Hybridization Assay 2. Useful Hints VI. Detection of Mutations Using Lanthanide-Labeled Oligonucleotides A. Materials 1. Reagents 2. Instrumentation B. Procedures 1. Restriction Enzyme Digestion of DNA Amplified with Lanthanide-Labeled Primers 2. Allele-Specific Amplification Combined with Hybridization 3. Allele-Specific Solution Hybridization 4. Modified Dot Blot Method 5. Useful Hints References
I. INTRODUCTION The use of fluorescent labels has previously been limited by the high background fluorescence always present in the measurements. This sensitivity limitation has been overcome by the use of time-resolved fluorometry and labels with a long fluorescent decay time. In time-resolved fluorometry, the lifetime of the emission that occurs after a pulsed light excitation is followed at a certain wavelength. The actual measurement starts after the background fluorescence has decayed, which provides a substantial increase in sensitivity. The principle of the measurement is outlined in Fig. 1. The applications of time-resolved fluorescence of lanthanide labels in biotechnology has been extensively reviewed elsewhere (Soini and Lrvgren, 1987). The high specific activity of europium chelates, when measured by timeresolved fluorometry, provides a sensitivity that gives the label technology great potential in both immunoassays (Ltivgren and Pettersson, 1990) and nucleic acid hybridizations. This chapter focuses on the recent status of time-resolved fluorometry and europium fluorescence when applied in various nucleic acid hybridization assays in our laboratory.
II. INDIRECT LABELING The most widely used nonradioactive DNA markers today are indirect labels, i.e., the DNA probe can be modified with a marker that in turn
15. Lanthanide Chelates/Time-Resolved Fluorescence
333
Excitation )t =340nm
es,eoce
~Long-lived
0
Delay time 400
Counting 800 time Time Us
I!
~N~
1000 New cycle
Fig. 1--Schematic presentation of the operation of a pulsed-light source time-resolved fluorometer. For the measurement of europium using the DELFIA Enhancement Solution, the cycle time is 1 msec; a pulsed excitation occurs at the beginning of each cycle. The delay time after the pulsed excitation is 400/zsec; the actual counting time within the cycle has the same duration. The total measurement time is 1 sec.
can be detected by a secondary detection system. The biotin-streptavidin affinity pair is most commonly used, but hapten-antibody systems are also available for the indirect nonradioactive labeling of DNA. The advantage of the biotin-streptavidin system lies with the high affinity of biotin for streptavidin (dissociation constant kd = 10-~5 M). The fact that streptavidin can bind four biotin molecules has made it possible to amplify the signal from the biotin molecule quite easily by making sandwich detection systems (Leary et al., 1983). A wide variety of methods for the biotinylation of DNA have been developed. The biotin molecule can be incorporated into DNA probes either enzymatically (Langer et al., 1981; Takahashi et al., 1989) or chemically (Forster et al., 1985; Viscidi et al., 1986; Sheldon et al., 1986; Reisfeld et al., 1987). When detecting a biotinlabeled probe, the detection procedure usually involves the use of enzymeconjugated streptavidin, and thus the final step is an enzymatic reaction resulting in a colorimetric, chemiluminescent, or fluorescent end product. We have used europium-labeled (Eu-labeled) streptavidin and timeresolved fluorometry for the detection of biotinylated DNA probes (Dah16n, 1987; Dahlrn et al., 1987). In addition, an antibody labeled with Eu has been used for the detection of hapten-labeled DNA probes (Syv~inen et al., 1986). The use of time-resolved fluorometry in the detection of these non-radioactive probes provides a sensitive and simple detection method. The principle of using Eu-labeled streptavidin in the detection
334
Timo L/ivgren et al.
of biotinylated DNA probes is shown in Fig. 2. Since the Eu fluorescence is read in solution after an enhancement step (Hemmili et al., 1984), optimal results are obtained when a plastic surface, ideally a microtitration plate, is used as a solid support in the hybridization assay. Europium-labeled streptavidin was applied for the detection of biotinylated probes in both dot-blot and sandwich hybridization assays (Dahlrn, 1987; Dahlrn et al., 1987). Viral DNA (adenovirus type 2) was detected by attaching the target DNA onto microtitration wells before the hybridization reaction. The detection limit was 10 pg of target DNA added to the well, and quantitative results were obtained (Dahlrn, 1987). In this method the target DNA must be extensively purified before immobilization onto the solid support, and the coating of the target is an overnight procedure. The limitations inherent in the direct hybridization format on plastic surfaces are omitted in sandwich hybridization. The/3-1actamase gene was detected by this assay (Dahlrn et al., 1987). The detection limit was 4 • 105 molecules or 1.9 pg of target DNA. The performance of the test was simple and rapid, and quantitative results were obtained.
A
B ~ §
b
b §
§ m m
I
i b
b
b
b
b
~,[----]_____._.__
i Eu 3§
Eu3§
Eu 3§
i
Eu3§
@
Fig. 2--(A) Dot blot hybridization. The sample DNA is immobilized on a solid support. A biotinylated DNA probe is allowed to hybridize to its target sequences. The bound biotinprobe is detected by Eu-labeled streptavidin. The Eu-fluorescence is developed by adding Enhancement solution. (B) Sandwich hybridization. The sample is added simultaneously with the biotinylated DNA probe to the hybridization reaction. The captive probe, which has been attached to the solid support before the assay, and the biotinylated probe will hybridize to the target DNA. The bound biotin-probe is detected by using Eu-labeled streptavidin as above.
15. Lanthanide Chelates/Time-Resolved Fluorescence
335
A. Materials 1. Reagents All reagents used should be of highest possible purity. Use nucleasefree compounds whenever available. The DNA probes needed can be prepared following the strategy outlined in previous publications (Ranki et al., 1983; Dahlrn et al., 1987). Eu-labeled streptavidin was from Wallac Oy, (1244-360) and lysozyme was from Boehringer-Mannheim (Cat No. 107,255). a. S o l u t i o n s
Coating buffer
Hybridization buffer
Hybridization wash solution
Other solutions
20 mM tris(hydroxymethyl)aminomethane (Tris)-HCl buffer, pH 7.5, containing 100 mM MgC12 and 150 mM NaC1. 20 mM Tris-HCl, pH 7.5, containing 0.9 M NaC1, 90 mM Na-citrate, 50% formamide, 0.1% bovine serum albumin (BSA), 0.1% Ficoll, 0.1% polyvinyl pyrrolidone (PVP), 0.5% sodium dodecyl sulphate (SDS), 100 /xg/ml denatured and sheared herring sperm DNA, and 3% polyethylene glycol (PEG). 10 mM Tris-HC1, pH 7.5, containing 0.1% SDS, 50/zM ethylenediaminetetraacetic acid (EDTA), and 50 mM NaC1. 3 M NaOH, 0.1 M NaOH, 3 M HAc, 0.1 M HOAc, 10% SDS, 0.5 M TrisHC1, pH 7.5, and 10 mM Tris-HC1, pH 7.5, containing 1 mM EDTA, DELFIA ~ Assay Buffer (Wallac Oy, Cat. No. 1244106), DELFIA Wash Concentrate (Wallac Oy, Cat. No. 1244-500), DELFIA Enhancement Solution (Wallac Oy, Cat. No. 1244-105).
b. Biotinylation Reagents Several commercial kits are available for labeling of DNA probes with biotin, e.g., Bio-Nick, BRL Cat No. 8247SA. Please note that singlestranded DNA probes are biotinylated using either random priming or chemical labeling procedures.
i D E L F I A is a registered trade mark of Wallac Oy, Finland.
336
Timo L6vgren et al.
2. Instrumentation
a. Time-Resolved Fluorometer A TR-fluorometer is available from Wallac Oy, the DELFIA Research Fluorometer (Cat. No. 1234-001). The operational principle of this TRfluorometer is described in Fig. 1. b. Other Laboratory Equipment Microtitration plates and equipment for handling of the microtitration plates, specially designed for the TR-fluorometry technology, are available from Wallac Oy. Microtitration Plate (Cat. No. 1244-550), DELFIA Plateshake (Cat No. 1296-001), DELFIA Platewash (Cat. No. 1296-024), DELFIA Plate Dispense (Cat. No. 1296-043).
B. P r o c e d u r e s 1. Sandwich Hybridization on Microtitration Plates
The principle of sandwich hybridization is outlined in Fig. 2. Two DNA probes (a capture and a detector probe) complementary to two adjacent regions of the target DNA are needed. The capture probe is immobilized onto a solid support before the assay. In the hybridization reaction the target DNA, when present in the sample, forms a bridge between the two probes, and the detector probe is captured onto the solid support. The presence of the detector probe can be determined and thus also the presence of target DNA. When a biotinylated detector probe is used, it can be detected using Eu-labeled streptavidin.
o
a. Coating of the Solid Support Linearize the capture probe (single-stranded) before attaching it to the solid support. Boil the capture probe in 0.1 M NaOH at 100~ for 10 min. Neutralize the probe solution with an equal volume 0.1 M HOAc and dilute the capture probe in the coating buffer to a concentration of 250 ng/ml. Pipette 200/xl of the coating solution containing the capture probe into the wells of microtitration plates. Use Wallac microtitration plates, since these are of high binding quality, which ensures efficient binding of the DNA. If desired several probes can be used as capture probes simultaneously in one well. The amount of capture probe can be varied to determine the optimal coating concentration for any particular probe.
15. Lanthanide Chelates/Time-Resolved Fluorescence
337
3. Incubate the strips overnight at room temperature (RT). Aspirate the wells, air dry the strips under a hood for 3 hr. Dry DNAcoated microtitration strips covered with adhesion tape are stable when stored at 4~ for at least 3 mo.
b. Sample Pretreatment The samples added to the hybridization reaction can be relatively crude and yet they will not cause background problems. The sample pretreatment protocol given here is for bacterial cells (up to 5 x 106 cells can be used). 1. Pellet the cells by brief centrifugation (1000 z g, 4 min). Suspend the cells in 10 /xl 10 m M Tris-HC1, pH 7.5, containing 1 m M EDTA. 2. Lyse the cells by adding 2/xl lysozyme (10 mg/ml); incubate for 30 min at 37~ Add 2/xl 10% SDS and 2/zl 3 M NaOH; boil the cell samples for 10 min at 100~ Quickly cool on ice. Add 2/xl 3 M HOAc and 4/xl 0.5 M Tris-HC1, pH 7.5.
c. The Hybridization Reaction 1. Prehybridize the microtitration strips coated with the capture probe using 200/xl hybridization buffer at 42~ for 1 hr, then aspirate the strips. 2. Boil the biotinylated DNA probe at 100~ for 10 min to ensure proper denaturation. Cool the probe on ice. Add the probe to fresh hybridization buffer at a probe concentration of 400 ng/ml. 3. Pipette 100/xl of this probe-containing hybridization buffer to each well. Add 10-20/xl of the lysed cell samples to individual wells. Include wells with similarly treated proper positive and negative DNA controls. The hybridization reaction is allowed to proceed overnight at 42~ 4. Aspirate the wells and wash them by incubating with 200/zl of the hybridization wash solution at 65~ for 5 min. Repeat the washing step three times. Finally, rinse the wells at RT with the DELFIA Assay Buffer.
d. Incubation with EU-Labeled Streptavidin 1. Dilute the Eu-labeled streptavidin in DELFIA Assay Buffer to a concentration of 1 /xg/ml. Pipette 100/zl of the dilution to the wells and incubate with continuous shaking at RT for 1 hr. 2. Wash the strips with DELFIA wash solution (made from the DELFIA wash concentrate) six times, using the plate washer.
338
Timo Ltivgren et al.
e. Fluorescence Measurement 1. D i s p e n s e 2 0 0 / x l E n h a n c e m e n t S o l u t i o n t o t h e w e l l s . 2. S h a k e at R T f o r 5 m i n , a n d m e a s u r e t h e r e s u l t i n g f l u o r e s c e n c e using the DELFIA
Research Fluorometer. See Table I for typical
results.
2. U s e f u l H i n t s
a. Sample Pretreatment I t is i m p o r t a n t t o e n s u r e t h e p r o p e r n e u t r a l i z a t i o n o f t h e s a m p l e s o l u t i o n . This can be checked by spotting 0.5/zl of sample solution on a pH paper.
Table I Detection of the fl-Lactamase Genea Controls b Copy number
Fluorescence (cps)
0 5 x 105 5 x 106 5 • 107
2300 _+ 130 3000_ 150 7100 ___280 31000 ___ 1100 Fluorescence
Strains
(cps)
(+/- )
IHE 11045 IHE 11065 IHE 11039 IHE 11104 IHE 11071 KS 71 IHE 11002 IHE 12131 IHE 11020 IHE 11239 IHE 11051 IHE 11046 IHE 11026 IHE 11072
2657 2563 2527 2477 2559 2677 2515 2561 6357 33637 7795 24048 45016 58200
+ + + + + +
a From colonies, (n = 30 ofEscherichia coli strains by sandwich hybridization and Eu3+-labeled streptavidin (Dahl6n et al., 1987). The mean of the background + 3 SD (2700 cps) was used as the cutoff value. b Pure plasmid pBR 322 DNA samples
15. Lanthanide Chelates/Time-Resolved Fluorescence
339
Where the samples contain precipitated material, this may cause increased background signals. A precipitate can be avoided by decreasing the amount of cells used in the test, by prolonging the lysozyme incubation time, or by centrifuging the samples after pretreatment and carefully taking only the supernatant for the hybridization test. If other than bacterial cells are to be analyzed, the protocol given can be modified by including Proteinase K and 0.5% SDS rather than lysozyme. It is also possible to use alkaline denaturation alone. A 300 mM NaOH solution containing 1.9% SDS is used when boiling the cells for 15 min at 100~ The samples are neutralized using an equal volume of 300 mM HOAc.
b. Coating of the Capture DNA It has been reported that UV light improves the binding of DNA to plastic surfaces (Dahl6n, 1987). UV light does not improve binding to the microtitration plates used here, but with other plastic qualities, the use of UV light is often necessary. Several captive probes may be used simultaneously. These may represent probes from other adjacent regions or may be probes that capture both polarities of the target DNA. Optimization of the amount of any particular capture probe is necessary. The quality of the capture probe is important. The probe should be linearized, but not too sheared. If a suitable restriction site is available in the vector, it is recommended that the probes be linearized by specific cleavage using restriction enzymes. Another aspect is the presence of possible homologous regions with the detector probe. The vector and probing sequences must under no circumstances be homologous within the pair of capture and detector probes. Possible contaminating sequences may also give rise to a hybridization reaction directly between the detector probe and the solid phase capture probe. c. Hybridization Reaction The stringency of the hybridization reaction can be controlled by the amount of formamide added, the temperature used, etc. The kinetics by which the hybridization proceeds can be improved by including more PEG, or by increasing the amount of probe. The stringency of the washes can be adjusted by altering washing temperatures or the salt concentration. Temperatures above 75~ should be avoided, since the strips can be physically damaged. d. The Detection Step The optimal concentration of Eu-labeled streptavidin is 0.2-2/xg/ml. It is recommended that the Enhancement Solution be dispensed using a dedicated dispenser to avoid any contamination with Eu from pipettes.
340
Timo Lsvgren et al.
III. CHEMICAL EUROPIUM LABELING OF DNA PROBES Labeling of DNA probes with stable Eu chelates allows the development of simple and sensitive DNA hybridization assays employing time-resolved fluorometry. The sensitivity of Eu-labeled DNA probes depends on the labeling degree and hybridization efficiency of the labeled probe. Thus the Eu-labeling chemistry should allow the incorporation of a large number of Eu chelates to DNA without sacrificing its hybridization properties. To overcome the chemical inertness of DNA, a two-phase approach is used to label DNA chemically with Eu chelates (Hurskainen et al., 1991). First, DNA is transaminated to introduce primary aliphatic amino groups into DNA (Fig. 3). Cytosine bases undergo a transamination reaction in the presence of sodium bisulfite and an amine (Shapiro and Weisgras, 1970). By using a diamine such as ethylenediamine, free aliphatic amino groups are incorporated into single-stranded DNA (Viscidi et al., 1986). Subsequently the amino-modified DNA is reacted with an isothiocyanate derivative of the Eu chelate (Hurskainen et al., 1991). The Eu-labeling process including purifications is a multistep procedure but, on the other hand, large amounts of DNA can be labeled. The transamination reaction is a very efficient method of modifying DNA, and allows the Eu labeling of practically all deoxycytidine residues. However, Eu labeling affects DNA by lowering the thermal stability and hybridization efficiency (Hurskainen et al., 1991). The incorporation of 4 to 8 Eu chelates per 100 bases is the optimum degree of labeling that makes sensitive and specific hybridization assays possible. Eu-labeled
B NH2
%1 --
? NHCH2CH2NH2
12 ~" NHCH2EHzNHCNH-Ligand-Eu' 9
H2NCH2CH2NH2 NaHSO3
~~
SCN-Ligand-Eu3~ ~ _ ~
Fig. 3--Chemical labeling of DNA with a europium chelate. In the first reaction the cytosine bases in DNA are transaminated in the presence of sodium bisultite and ethylenediamine. In the second reaction the modified DNA is reacted with an isothiocyanate derivative of the europium chelate.
15. Lanthanide Chelates/Time-Resolved Fluorescence
341
DNA probes are directly detectable, making the detection step simple and time saving compared to the detection of biotinylated and haptenlabeled probes. In addition, interpretation of numerical results obtained with Eu-labeled probes is simple. Eu-labeled DNA probes have been used in the detection of adenovirus DNA in clinical specimens (Dahl6n et al., 1988). After pretreatment, specimens were fixed to a nitrocellulose filter and hybridized against Eu-labeled adenovirus DNA. Simple and sensitive sandwich (Ranki et al., 1983) and solution hybridization assays (Syvhnen et al., 1986) with Eu-DNA probes have also been made in microtitration wells for the detection of cytomegalovirus and human papillomavirus (Huhtam~ki et al., in preparation). The detection limit in these assays has been 5 x 105 molecules of target DNA.
A. Materials 1. Reagents The following reagents were used: sodium metabisulfite (Aldrich, Cat. No. 25555-6), ethylenediamine (Aldrich, Cat. No. E2626-6), hydroquinone (Aldrich, Cat. No. H1790-2), Eu chelate of 4-[2-(4-isothiocyanatophenyl)ethyl]-2,6-bis(carboxymethyl)aminoethyl]pyridine (Wallar Oy), photobiotin (long arm) (Vector, Cat. No. SP-1020), streptavidin (Porton Products, United Kingdom). a. Solutions
Sample pretreatment solution: 2% SDS in 0.3 M NaOH. Neutralization solution" 0.3 M HOAr in 0.1 M Tris-HCl pH 8.5. DNA coating buffer: 20 mM Tris-HC1, pH 7.5, containing 100 mM MgC12 and 150 mM NaC1. 2 x Sandwich hybridization solution: 140 mM HEPES, pH 8.0, containing 0.1% SDS, 1.7 M NaC1, 7 • Denhardt' s solution, 200/~g/ml herring sperm DNA, 200 /~g/ml sodium polyacrylate (average MW 90,000), 0.2 mM EDTA, and 3% PEG. Incubate the solution at 40 to 50~ for 30 min and filter through a sterile membrane (0.45/~m). Store the solution at RT. Coating buffer for biotinylated protein: 50 mM K2HPO4, pH 9.0, containing 0.05% Na-azide and 0.9% NaC1. 2 • Solution hybridization mixture: 140 mMHEPES, pH 8,0, containing 0.1% SDS, 1.7 M NaC1, 7 x Denhardt's solution, 150/~g/ml herring sperm DNA, 0.2 mM EDTA, and 3% PEG. Filter the solution through a sterile membrane (0.45/~m) and store at RT. Hybridization wash solution" 10 mM Tris-HC1, pH 8.5, containing 0.1% SDS, 0.05 mM EDTA, and 50 mM NaCI.
342
Timo Lsvgrenet al.
Other solutions: Assay Buffer (Wallac Oy, Cat. No. 1244-106), DELFIA Wash Concentrate (Wallac Oy, Cat. No. 1244-500), Enhancement Solution (Wallac Oy, Cat. No. 1244-105).
2. Component Preparation
a. Coating of D N A on the Solid Support See the procedure in Section II,B,1.
b. Biotinylation of Protein (IgM) 1. Add a 50-fold molar excess of biotin-amidocaproate N-hydroxysuccinimide ester in 200/zl dry N,N-dimethylformamide to 10 mg of IgM in 1 ml 50 mM sodium carbonate pH 9.0 and incubate for 3 hr. 2. Remove the unreacted biotin by running the reaction mixture twice on PD-10 columns (Pharmacia) using 20 mM pH 7.5, containing 0.05% Na-azide and 0.9% NaCI as eluent. Store the biotinylated protein at 4~
c. Coating of Biotinylated Protein 1. Use microtitration plates of high-binding quality (Wallac Oy, Cat. No. 1244-550). Dilute the biotinylated IgM in the coating buffer (200 ng/ml) and pipette 200/zl to each microtitration well. Cover the plate with adhesive tape and incubate at 42~ overnight. 2. Wash the plate with DELFIA Wash Solution three times. 3. Prepare a 1 /zg/ml solution of streptavidin in DELFIA Assay Buffer and add 200/zl/well. Incubate at RT for 3 hr. Wash the microtitration plate four times with DELFIA Wash Solution. Store the coated plate at 4~ covered with adhesive tape.
d. Photobiotinylation of DNA Follow the manufacturer's (Vector) instructions. e. Eu Labeling of D N A 1. Prepare the transamination solution just before use. Dissolve 475 mg sodium metabisulfite in 1 ml water in a glass tube. Place the tube on ice and add 1 ml ethylenediamine. Titrate the solution to pH 6-6.2 by cautiously adding 2.1-2.3 ml concentrated HCI. Add 50/~1 hydroquinone (500 mM in ethanol), and adjust the final volume to 5 ml with water. Keep the transamination solution at 40 to 50~ to prevent precipitation.
15. Lanthanide Chelates/Time-Resolved Fluorescence
2. Transaminate naturally single-stranded DNA (e.g., M13 DNA) as follows. Add nine volumes of transamination solution (450/zl) to 50/zg DNA (1/zg//xl) in an Eppendorf tube. Vortex carefully and incubate in a water bath set to 42~ for 1 hr 45 min. 3. After the reaction, place the tube on ice and add 28/zl 6 M NaOH to stop the transamination reaction. Dialyze the reaction mixture overnight at RT against four exchanges of water. If a precipitate is formed in the dialysis tube, add 250 /zl 6 M NaOH/liter of dialysis solution to dissolve the precipitate. 4. After dialysis, concentrate the solution to about 300/zl in a vacuum centrifuge and precipitate the DNA with ethanol. Dissolve the DNA in 100/zl of 0.1 M Na2CO 3, pH 9.8, containing 0.1 mM EDTA. 5. Start the Eu-labeling process of double-stranded DNA (e.g., plasmid DNA) by denaturing (98~ 10 min). Then add nine volumes of transamination solution (450/zl) to the cooled DNA solution (50/zg, 1/xg//zl). Vortex the reaction mixture well and incubate at 98~ for 5 min. Plasmid DNA requires denaturing conditions during transamination because it tends to renature at 42~ Stop the reaction and purify the transaminated DNA as above. 6. Add the transaminated DNA in 100/xl 0.1 M Na2CO3, pH 9.8, containing 0.1 mM EDTA to a small test tube containing 1 mg of an isothiocyanate derivative of the EU chelate. After dissolving the chelate, incubate at RT overnight. 7. Purify the Eu-labeled DNA probe on a Sephacryl S-400 column (47 • 0.7 cm) equilibrated and eluted with 10 mM Tris-HC1, pH 8.5, containing 0.1 M NaC1. The labeled DNA is eluted in the void volume and is well separated from the unreacted chelate. Follow the chromatography spectrophotometrically and measure, in addition, the Eu content in each fraction (1 ml) by diluting aliquots (e.g., 1:1000) in 200/zl Enhancement Solution. Pool the fractions containing Eu-labeled DNA, m e a s u r e A260 and determine the Eu concentration against a n EuC13 standard solution. The contribution of the Eu chelate to the measured A260 is A260 correction = 0.0166 x [Eu] where Eu concentration is in/zmoles/liter. Correct the obtained A260 value and use it to calculate the DNA concentration. An OD260 -- 1 of naturally single-stranded DNA is equivalent to a concentration of 37/xg/ml, and OD260 = 1 of plasmid DNA is equivalent to 40/xg/ml after Eu labeling. Subsequently, calculate the concentration of nucleotides by dividing the DNA concentration with the average molecular weight of nucleotide residue in
343
344
Timo L6vgrenet al. DNA (330 g/mole). The labeling degree is obtained using the following formula: Labeling degree (%) =
Eu concentration (/zM) x 100 nucleotide concentration (~M)
The procedure typically gives labeling degrees between 6 and 8%. The yield of DNA varies between 40 and 70%.
The stability of the Eu-labeled DNA probe is improved with EDTA. Adjust the EDTA concentration to be 12-fold compared to the Eu concentration. Eu-labeled DNA probes are stable for at least 18 months at 4~ or - 20~
3. Instrumentation See Section II,A,2.
B. P r o c e d u r e s 1. Sandwich Hybridization The principles of sandwich hybridization have been described in Section II.
a. Sample Pretreatment Crude samples can be analyzed with Eu-labeled DNA probes in sandwich hybridization assays. The following pretreatment protocol is suitable, e.g., for cervical scrapes. 1. The cells from the spatula or cytobrush are suspended in phosphate-buffered saline (PBS) and briefly centrifuged (5 min, 1000 • g). Suspend the pelleted cells in 25 /zl PBS, add 25/zl 0.3 M NaOH containing 2% SDS, and boil for 12 min. 2. After cooling on ice and spinning down, neutralize the samples with 25/xl 0.3 M acetic acid in 0.1 M Tris-HCl, pH 8.5. Check that pH is 7-8.5 by applying 0.5/zl of the neutralized sample on an indicator paper. b. Hybridization Reaction The sandwich hybridization can be done either at 42~ in the presence of formamide or at 65~ without formamide. The problem
15. Lanthanide Chelates/Time-Resolved Fluorescence
345
in the hybridization at 42~ is the fact that only small sample volumes (lO-20/zl) can be used in the total hybridization volume of 200 tzl. On the other hand, sample volumes of 50/A or more are possible when hybridization is performed at 65~ 1. In order to minimize the nonspecific binding of probe DNA, prehybridize the microtitration wells with 200/zl of 1 x hybridization solution per well at 65~ for at least 30 rain. If the Eu-labeled DNA probe is double stranded, denature it by boiling for 10 min, and cool on ice. 2. Add the single-stranded or denatured probe in 25 /zl to each 100/zl of the 2 x hybridization solution. The optimal concentration of Eu-labeled DNA probes during hybridization is 200400 ng/ml. Stop the prehybridization by aspirating the wells, and add 125/zl of hybridization solution containing Eu-labeled DNA probe to the wells. 3. Pipette the pretreated samples (75/zl) into the wells. Cover the wells carefully with adhesive tape, and place the microtitration plate in a humidified box at 65~ for overnight hybridization. 4. Wash the wells three times with 250/zl hybridization wash solution at 50~ for 20 min. Finally rinse the wells three times with 250/zl of the same solution at RT. c. Fluorescence M e a s u r e m e n t
1. Add 200/zl of Enhancement Solution to the microtitration wells. 2. Shake the wells (position "slow" in the DELFIA Plateshake) at RT for 25 rain, and measure fluorescence in a time-resolved fluorometer.
2. Solution Hybridization In solution hybridization assays, one probe is labeled with an affinity label and the other probe, with a detectable label (Syv/inen et al., 1986). The target DNA forms a bridge between the two labeled probes (Fig. 4). The affinity-labeled probe facilitates the collection of formed hybrids onto the solid phase, and subsequently the hybridized probe labeled with a detectable marker can be measured. We have used a Eu chelate as the detectable marker, biotin as the affinity label, and streptavidin-coated microtitration wells as the solid phase. Solution hybridization combines the high specificity and easy sample pretreatment of sandwich hybridization with the rapid reaction rate of a solution phase reaction.
346
Timo L6vgren et al.
affinity probe
detectable probe
target DNA
+
+ Collection of hybrids
I'-"9
- ."
Fig. 4--Schematic presentation of the solution hybridization. First two different probes, one labeled with an affinity label (e.g., biotin) and the other labeled with a detectable label (e.g., europium), hybridize with the target DNA in solution. In the next step, the formed hybrids are collected onto an affinity (e.g., streptavidin) matrix.
a. Sample Pretreatment Crude samples can also be analyzed in solution hybridization assays as in sandwich hybridization (see Section III,B,1).
b. Hybridization Reaction The optimal amount for Eu-labeled probes is around 2 x 109 molecules and for photobiotinylated probes 2-3 x 109 molecules per reaction.
1. Add the single-stranded and denatured probes in 25/xl to each 100 /zl 2 x solution hybridization mixture. Combine in 1.5 ml Eppendorf tubes pretreated samples (75/xl) and 125/zl solution hybridization mixture containing the probes. 2. Vortex and hybridize at 65~ for 3 hr. Transfer the content from the hybridization tubes to individual microtitration wells coated with biotinylated IgM and saturated with streptavidin. Incubate at RT or 37~ for 2 to 3 hr. (This two-step hybridization assay can also be performed in one step. Combine the samples and hybridization solution containing the probes in microtitration wells. Cover the wells carefully with adhesive tape, and incubate at 65~ in a humidified box overnight). 3. Wash the wells twice for 5 min at 50~ with 250/zl of the hybridization wash solution. Additionally, rinse the wells four times with 250/xl of the same wash solution at RT.
15. Lanthanide Chelates/Time-Resolved Fluorescence
347
c. Fluorescence Measurement
1. Add 200 /xl Enhancement Solution to microtitration wells and shake for 25 rain. 2. Measure the fluorescence in a time-resolved fluorometer. See Table II for typical results achieved in the detection of HPV 16 DNA (Huhtam~iki et al., manuscript in preparation).
3. Useful Hints a. Eu Labeling
The Eu chelate used for DNA labeling is an isothiocyanate analog, which requires that the transaminated DNA to be labeled with the Eu chelate must be absolutely free from other compounds able to react with isothiocyanate (such as Tris and other amino group-containing reagents). Special care should be taken to avoid contamination of the laboratory with Eu during the labeling procedure. If possible, the Eu-labeling reaction should be done in a laboratory where hybridization tests are not performed. b. Hybridization Procedures The Eu chelate for DNA labeling is nonfluorescent and requires the use of Enhancement Solution in the measurement. In practice, Eu-labeled DNA probes are not suitable for in situ and Southern hybridizations. Moreover, Eu-labeled probes are not well suited for dot blot hybridizations on filters, because each dot has to be measured separately in Enhancement Table II Detection of H P V 16 DNA Using Solution Hybridization a HPV 16 DNA molecules
Fluorescence (cps)
(%)
0
968 3299 22403 171840 458544
16.7 7.1 9.5 7.8 8.4
10 6 10 7
108 109
CV
Three nonoverlapping fragments of HPV 16 DNA were used as probes. Two fragments cloned in M 13 DNA were Eu-labeled and one fragment cloned in pBR 322 was biotinylated. Hybridization was performed using the one-step procedure in microtitration wells. The results are mean values based on four determinations. a
348
Timo L/~vgrenet al.
Solution. Whenever possible, use microtitration plates as the solid-phase matrix.
IV. ENZYMATIC EUROPIUM LABELING OF DNA PROBES The first efficient in vitro method for labeling DNA was nick translation (Rigby et al., 1977), which requires the action of two enzymes, namely DNA polymerase and deoxyribonuclease. In the presence of all four deoxynucleotide triphosphates, one or more of which carry a label, these enzymes incorporate the labeled nucleotide into double-stranded DNA. A more recently introduced alternative method for the enzymatic labeling of DNA is random priming (Feinberg and Vogelstein, 1983). A set of random oligonucleotides, usually hexanucleotides, is allowed to anneal with single-stranded DNA. The annealed oligonucleotides serve as primers for the Klenow fragment of DNA polymerase I, which in the presence of all dNTPs, synthesizes a DNA strand complementary to single-stranded DNA. If one or more of the four dNTPs are labeled, the newly synthesized DNA strand becomes labeled. Random priming is the labeling method for single-stranded DNA (e.g., M13 DNA) but also for double-stranded DNA, which has to be denatured before the labeling reaction. A Eu-labeled 2'-deoxycytidine 5'-triphosphate (Eu-dCTP) (Fig. 5) has been synthesized to be used for the enzymatic labeling of DNA. Eu-dCTP is a substrate for the holoenzyme and the Klenow fragment of DNA polymerase I. The reaction rates of nick translation and random priming are somewhat slower when dCTP is replaced by Eu-dCTP. However, Eulabeled DNA probes of high specific activity can be obtained with both of the enzymatic procedures. The properties and use of enzymatically Eu-labeled DNA probes are identical to those of chemically labeled ones.
1-12)6N H - L i g a n d - E u 3 §
J-N OH Fig. 5--Eu-labeled dCTP for enzymatic labeling of DNA.
15. Lanthanide Chelates/Time-Resolved Fluorescence
349
A. Materials 1. Reagents DNA polymerase I from Escherichia coli (several suppliers, e.g., BRL, Pharmacia-LKB Biotechnology) Deoxyribonuclease I from bovine pancreas (several suppliers, e.g., Pharmacia-LKB Biotechnology) Eu-dCTP (Wallac Oy) Oligolabeling kit (Pharmacia-LKB Biotechnology, Cat. No. 27-9250-01) BSA, DNase free (Pharmacia-LKB Biotechnology, Cat. No. 27-8915-01) a. Solutions
10x nick translation buffer: 0.5 M Tris-HCl, pH 7.5, containing 0.1 M MgC12, 1 mM dithiothreitol, and 500/xg/ml DNase-free BSA. Deoxynucleotide triphosphate solution: dATP, dCTP, dGTP, and dTTP, 125/xM of each in 50 mM Tris-HC1, pH 7.5. Eu-dCTP solution: 0.5 mM Eu-dCTP in 50 mM Tris-HCl, pH 7.5. Deoxyribonuclease I stock solution: 1 mg/ml solution of deoxyribonuclease I in 0.15 M NaC1, containing 50% glycerol. Divide the solution into small aliquots. Store all the above solutions at -20~
2. Component Preparation
a. Nick Translation Using E u - d C T P 1. Keep all the necessary solutions on ice after thawing. Make a proper dilution of DNase I stock solution (1 : 1000-1 : 10,000) in water. The exact amount of DNase I to be added must be estimated for each batch of enzyme. Make the following solution in an Eppendorf tube placed on ice:
10 x nick translation buffer dNTP solution Eu-dCTP DNA DNA polymerase I (2.5 U//xl) DNase I Add water to 50/xl
5/zl 8/zl 4/zl 0.5-2/.,g 2/zl to be estimated
2. Vortex and spin down briefly. Incubate the reaction mixture in a water bath at 15~ Allow the reaction to proceed for 3 hr and
350
TimoLsvgrenet al. purify the Eu-labeled DNA immediately by gel filtration (e.g., Pharmacia NICK column) using 50 mM Tris-HC1, pH 8.5, containing 0.1 M NaCI as eluent. Do not stop the reaction by adding EDTA, because Eu may dissociate from labeled DNA. Store Eulabeled DNA probe at -20~
b. Random-Priming Reaction Random-priming labeling kits from several manufacturers have been tested with Eu-dCTP. The best results have been achieved with Pharmacia's random priming system (Oligolabeling Kit). The kit contains all components except dCTP and Eu-dCTP. 1. Use 1 nmole of dCTP and 2 nmoles Eu-dCTP in a 50/zl reaction volume. Up to 1/xg DNA can be labeled, and the optimum reaction time is 1.5-2 hr at 37~ 2. Purify the labeled probe immediately by gel filtration (e.g., Pharmacia NICK column) using 50 mM Tris-HCl, pH 8.5, containing 0.1 M NaC1. Do not stop the reaction by adding EDTA because Eu may dissociate from labeled DNA. Store the Eu-labeled DNA at -20~
3. Instrumentation See Section II.
B. Procedures 1. Hybridizations Enzymatically Eu-labeled DNA probes behave like chemically labeled ones. Suitable hybridization procedures for Eu-labeled DNA probes have been described in the section on chemical Eu labeling of DNA probes.
V. EUROPIUM-LABELED OLIGONUCLEOTIDES Short synthetic pieces of DNA, oligonucleotides, can be used as specific hybridization probes. Indeed, the use of oligonucleotides as probes has significantly increased over the last few years. This is mainly owing to the breakthrough of in v i t r o DNA amplification methods. In particular the polymerase chain reaction (PCR) has become popular. Target sequences
15. Lanthanide Chelates/Time-Resolved Fluorescence
351
can be amplified up to 108 times or even more before detection by hybridization. This facilitates the use of synthetic oligonucleotide DNA probes, previously limited in use because of their lack of sensitivity. The advantages of oligonucleotides include no need for denaturation, rapid hybridization kinetics, and high specificity. Indeed, short oligonucleotides (shorter than 20 bases) are able to detect even single point mutations (Wallace et al., 1979; Ikuta et al., 1987). In addition, these probes can be produced in large quantities under well-controlled conditions in an oligonucleotide synthesizer. Several methods for labeling oligonucleotides with Eu chelates have been developed (Sund et al., 1988). The preferred method is to incorporate primary amino groups into the oligonucleotide during synthesis. By using an amino-modified building block, such as the diaminohexane-modified deoxycytidine phosphoramidite, the functionalized base can be introduced at any position during the synthesis. It is possible to introduce up to 50 modified bases to the 5' end of the oligonucleotide, although a tail of 15 to 25 modified nucleotides is generally used. An Eu chelate containing isothiocyanate as the reactive group is reacted with the primary amino groups after deprotection and purification of the oligonucleotidecontaining modified bases. We have successfully labeled a single oligonucleotide with 35 Eu chelates, even though 15 to 20 Eu chelates are sufficient for a very good sensitivity. The melting temperature (Tm) and the hybridization kinetics are not significantly affected by the labeling procedure. The sensitivity that can be achieved in a hybridization test, using oligonucleotides labeled with Eu, is 4 x 10 6 t o 1 • 10 7 molecules of target DNA depending on the hybridization format, degree of labeling, etc. This sensitivity is at least comparable to that achieved with 32p-labeled probes. An important feature of the Eu-labeled oligonucleotides is the possibility to quantitate the amount of target DNA detected. Eu-labeled oligonucleotides have been used as hybridization probes for the detection of DNA immobilized on a solid support, as well as in a rapid solution hybridization test (Sund et al., 1988; Dahlrn et al., 1991b). In a model study, Eu-labeled oligonucleotides have been applied to the detection of h phage DNA immobilized in microtitration wells. The detection sensitivity in this direct hybridization test was 4 x 10 6 target molecules or 200 pg (Sund et al., 1988). In this hybridization format, however, the target DNA is immobilized onto a plastic surface in an overnight coating procedure. This is impractical and time-consuming, and therefore other hybridization formats are needed. When detecting in vitro amplified nucleic acid sequences it is possible to use a rapid in solution hybridization test, in which two probes complementary to the amplified DNA are allowed to hybridize simultaneously
352
Timo L/~vgrenet al.
with the amplified target sequence. One of the probes is labeled with Eu chelates, and the other is labeled with biotin. The formed hybrid is collected onto streptavidin-coated strips employing affinity-based collection. The assay principle is outlined in Fig. 6. The sensitivity of the test is 10 7 target molecules. This methodology has been successfully applied to a wide range of analytes, human immunodeficiency virus (HIV)-I (Dahlrn et al., 1991b), HIV-2 and human T-cell leukemia virus (HTLV)-I and II (Iiti~i et al., 1992a). The use of PCR and a time-resolved, fluorescencebased hybridization test makes it possible to detect as few as five copies of proviral target DNA. It is, in addition, possible to quantitate the amount of target DNA originally present in the sample using a 100-1000-fold linear concentration range. Figure 7 describes schematically the design strategy of the amplifiable/ detectable region, primers and probes. The nucleic acid sequences to be amplified should be 100-150 bp long. Generally accepted guidelines for the rationale of choosing the amplifiable sequence, designing the primers, etc., for the PCR should be followed (McInnis et al., 1990). The amplified region must be long enough for two oligonucleotides to hybridize, and the hybridizing sequences should be conserved to ensure proper detection
Fig. 6--Schematic presentation of PCR amplification and a solution hybridization assay employing labeled oligonucleotides. The cells are lysed, and the PCR is performed on the crude sample. Two probes, one biotinylated and the other labeled with Eu complementary to the amplified fragment, are hybridized to the same target. The hybrids are subsequently collected onto streptavidin-coated microtitration wells. The bound europium dissociated with the Enhancement Solution is measured in a time-resolved fluorometer.
15. Lanthanide Chelates/Time-Resolved Fluorescence 1.
353
3.
(X-Eu)15_25
I
3'5'
5'
X- biotin
I I
I
3'5'
3' T
17-23 mer
J
2 5-30 met
18-30 met
. I !
3'
5' / T
17-23 mer
J 100 -150 bp
Fig. 7--Typical design of amplifiable region of primers and probes. 1, sense primer; 2, antisense primer; 3, europium-labeled sense probe; and 4, biotin-labeled sense probe.
of the target DNA. In order to avoid strand displacement, fragments longer than 200 bp should not be used. The probes should be designed to have approximately the s a m e T m t o ensure maximal hybridization kinetics of both probes. Moreover, the Eu-labeled oligonucleotides have been used as 5' primers in a PCR reaction (Dahl6n et al., 1991a). The 3' primer was labeled with biotin, thus allowing direct collection of the amplified double-stranded, Eu-labeled target DNA. Sufficient specificity was achieved by using a nested primer approach. The region of interest was first amplified with a pair of outer unlabeled primers, and then a second amplification round was performed using an inner labeled pair of primers.
A. Materials 1. Reagents The equipment and reagents necessary for oligonucleotide synthesis using the phosphoramidite chemistry are available from many suppliers. Instructions for use of these reagents should be carefully followed.
2. Component Preparation a. Preparation of Eu-Labeled Oligonucleotides: Reagents and Materials Oligonucleotide synthesizer, with option to use additional phosphoramidites (for instance the Gene Assembler Plus, Pharmacia-LKB Biotechnology, Cat. No. 80-2081-10).
TimoL/ivgrenet al.
354
Standard reagents for oligonucleotide synthesis, including the phosphoramidites (A,T,G,C), tetrazole, acetonitrile, etc. These are available from several suppliers (Pharmacia-LKB Biotechnology, Applied Biosystems, Clontech, Sigma, etc.) For a complete list of reagents and suppliers, see the manual of the oligonucleotide synthesizer. Amino-modified phosphoramidite, 5'-O-dimethoxytrityl-N4-(trifluoroacetylamidohexyl)-deoxycytidine-3'-O-(/3-cyanoethyl-diisopropylamino)phosphoramidite (modC). Europium chelate of 4-[2-(4-isothiocyanatophenyl)ethyl]-2,6-bis[N,Nbis(carboxymethyl)aminoethyl]pyridine. The chelate will become commercially available from Wallac Oy. Gel electrophoresis, standard reagents for urea PAGE are available from a number of suppliers (USB, BRL, Hoefer Scientific, etc.). See Sambrook et al., 1989, for complete listing of the necessary reagents. NAP-5 and NAP-10 columns (Pharmacia-LKB Biotechnology) or a gel filtration column (1 x 50 cm) packed with Sephadex G-50 DNA Grade (Pharmacia-LKB Biotechnology).
Solutions 1 M Na2CO 3, 10 mM Tris-HC1, pH 7.5, containing 50/zM EDTA. b. Procedure for the Preparation of Eu-Labeled O ligonucleotides The synthetic route for the preparation of Eu-labeled oligonucleotides is outlined in Fig. 8. The oligonucleotide synthesizer is programmed and used according to the instructions of the manufacturer. Program the machine to synthesize an oligonucleotide starting with the probing sequence at the 3' end, and continue with 10 to 30 modC at the 5' end.
1. Dissolve the modC in dry acetonitrile to a final concentration of 0.1 M. Attach the modC solution to the synthesizer at the appropriate site. Upon complete synthesis, the deprotection is done in concentrated ammonia overnight at 55~ according to standard procedures (instruction manual of the synthesizer). 2. Purify the oligonucleotide containing the tail of modC's on the 5' end by urea polyacrylamide gel electrophoresis (PAGE), and subsequently elute the product according to standard procedures (see Sambrook et al., 1989). Change the buffer of the eluted oligonucleotide to H20 by using NAP-5/NAP-10 columns. The amount of pure oligonucleotide is determined by absorbance measurement at 260 nm, 1 OD260 = 33/zg/ml. 3. Dry 1.5-10 nmole of the oligonucleotide in H20 in a Speed-Vac
o
-~
I
o
O\.o
~~- ~-o" ~o
\
()
6
f
f
\
kj
~IIIU
o=
0
0 ~)
kJ
o
I
J
0
Q;
.,..q
.o
0
i
~ = o -=
.,.q
t.~ .,i 0
-----
~.~
~
0
~
p,
0
.,-~
~=~~
0 J::
i-~ =~
C~
356
Timo Lsvgrenet al. centrifuge (Savant). Redissolve the oligonucleotide in 50/zl H20. Adjust the pH to 9.5 by adding 2.5/zl 1 M NaECO 3. 4. Dissolve about 0.5-4/zmole Eu chelate in 100/xl H20. Quantitate by making serial dilutions (1 : 100, 1 : 10, etc.) into 1 ml Enhancement Solution, and measure the fluorescence in a time-resolved fluorometer against a 1 nM Eu standard. The exact concentration of Eu chelate is calculated using the formula: Eu chelate (nM) = y " z x where y = fluorescence in cps of Eu chelate containing sample x = fluorescence in cps of the 1 nM Eu standard z = dilution factor Add to the oligonucleotide solution a molar excess of the Eu chelate based on the following formula: Eu chelate excess (nmole) = A x B x 10 where A - nmoles of oligonucleotide B - number of modC per oligonucleotide 5. Incubate the reaction mixture overnight at 4~ and purify the Eu-labeled oligonucleotide by gel filtration. When less than 200 nmole of Eu chelate is used in the labeling reaction (see formula 2), the labeled oligonucleotide can be rapidly purified over a NAP-5 and NAP-10 column, respectively. When larger amounts of oligonucleotide are labeled, a bigger column is required for the purification (1 • 50 cm, Sephadex G-50 column). Elution is carried out in l0 m M Tris-HC|, pH 7.5, containing 50/xM EDTA. It is recommended that absorbance be recorded at 260 nm and the Eu profile be determined by diluting 1/xl aliquots of each fraction into 1 ml Enhancement Solution and measuring Eu content in a time-resolved fluorometer. Identify the first peak based on the UV and Eu profile, and pool the fractions containing the Eu-labeled oligonucleotide. A typical elution profile is shown in Fig. 9. The final product is analyzed spectrophotometrically to determine the amount of oligonucleotide recovered. The Eu content of the pooled fraction is measured and the Eu/oligonucleotide ratio is obtained, as follows: Calculate the total amount of Eu chelate (in nmole) in the pooled fractions by the following formula: EUToT (nmole) = [Eu] x V
x
10 -3
where V = the volume of the pooled fractions in ml. [Eu] = nM
15. Lanthanide Chelates/Time-Resolved Fluorescence
357
0.5
% ..-.. /"
\\
I
0 ~D <
9
_
\
l
13. U
10 ,~ (.3 r-
\
/
\
.
U fJ3 Q~ tO :3 U_
\
0.25 I
I/I
\\
. \
/.,.;
\ '
9 9
\
5
9 " ~ 1 4~9
g ' .....,
0
2
4,
6
. . . .
8
. . . . . . . . . . . . .
10
12
14
16
18
20
22
24
Fraction number
Fill. 9 - - G e l filtration profile on the purification of an Eu-labeled oligonucleotide (containing 30 modC's at the 5' end) from free Eu-chelate using a Sephadex G-50 (1 x 50 cm) column. The absorbance at 260 nm (---) and the Eu content of the fractions ( - - - - - - - ) was followed. Fractions (6 and 7) containing the Eu-labeled oligonucleotide were pooled.
6. Record the absorbance at 260 nm using the elution buffer as reference. Typical UV-spectra are shown in Fig. 10. The Eu chelate absorbs at 260 nm; thus, absorbance measured at 260 nm for the oligonucleotide cannot be used for the estimation of the amount of oligonucleotide recovered. The oligonucleotide concentration is given by: C =
A260
\--'~- X
0.83
x
33
C = concentration of oligonucleotide in/zg/ml. Eu =/.r The amount of oligonucleotide (nmole) is calculated according to the following formula: C x V x 1000 OligonucleotideToT (nmole) = MW where C = concentration of oligonucleotide in/zg/ml V = volume of the pooled fractions in ml MW = molecular weight of the oligonucleotide (length x 330 g/mol)
358
Timo Ltivgren et al.
(3)
.
9
.
o-
"
. . . . .
" 9 o
L) C O .C) t_ O 03
<
/
/
N
\
I
220
"
\
/
2z.0
I
I
260
280
". 9
300
Wavelength { rim} Fig. 10--Typical absorbance spectra of an oligonucleotide before modification (---), after the addition of 25 modC's ( - - - - - - ) , and after Eu labeling of the modified oligonucleotide
(.... ).
The Eu" oligonucleotide ratio is obtained from the formula: Eu: oligonucleotide =
EUToT (nmole) OligonucleotideToT (nmole)
7. To obtain a usable concentration of the probe, dilute part of the Eu-labeled oligonucleotide in the elution buffer to a concentration of 1/zg/ml and store at 4~ The solution is stable for 6 months. The stock solution is stored at -20~ and is stable for at least one year.
c. Preparation of Biotinylated Oligonucleotides Reagents and materials Biotinamidocaproate N-hydroxysuccinimide ester, Act-biotin (Sigma Cat No. B 2643) or other equivalent amino reactive biotin derivative. 10 m M Tris-HCl, pH 7.5, containing 1 mM EDTA. NAP-5 and NAP-10 columns (Pharmacia). The oligonucleotide synthesis, deprotection, and purification is done as previously, except that in the actual synthesis modC is inserted at the 3' end as the first nucleotide immediately after the base on the support (see Fig. 7).
15. Lanthanide Chelates/Time-Resolved Fluorescence
359
1. Five nmole of the oligonucleotide in H20 containing a single modC at the 3' end is dried in a Speed-Vac centrifuge. Dissolve the oligonucleotide in 50/xl H20 and add 2.5/zl 1 M Na2CO3. Then a 50 molar excess of act-biotin (0.11 mg) is added dissolved in dry N,N-dimethylformamide. Incubate at RT for 3 hr. 2. Purify the biotinylated oligonucleotide by gel filtration on NAP5 and NAP-10 columns using 10 mM Tris-HC1, pH 7.5, containing 1 mM EDTA as eluent. Measure the recovery of the oligonucleotide spectrophotometrically at 260 nm, using the elution buffer as the reference (1 OD260 = 33/zg/ml). Dilute part of the biotinylated oligonucleotide to a concentration of 1/zg/ml in 10 mM Tris-HC1, pH 7.5, containing 50/xM EDTA. The diluted probe solution is stable for 6 months when stored at 4~ The stock solution is stable for 1 year when stored at -20~
d. PCR Reagents Primer-mix: 3/xM of each primer in 10 mM Tris-HC1, pH 7.5 containing 1 mM EDTA (see Fig. 7). Taq DNA polymerase: a 0.5 U//zl stock solution (Perkin-Elmer Cetus, Stratagene, Boehringer-Mannheim, Amersham, etc.) 2 x PCR-buff er 20 mM Tris-HC1, pH 8.4, containing 5 mM MgC12, 400 /xM dNTP, 0.4 mg/ml gelatin and 100 mM NaC1. Note: The PCR-buffer given here is only an example of a typical buffer
composition. Mineral oil
e. Coating of the Solid Phase with Biotinylated BSA Reagents and materials DELFIA Assay Buffer (Wallac Oy, Cat. No. 1244-106) Streptavidin (Porton Products, BRL, Amersham, etc.) Microtitration Plate (Wallac Oy, Cat. No. 1244-550) DELFIA Wash Concentrate (Wallac Oy, Cat. No. 1244-500). Coating buffer 50 mM K2HPO4, pH 9.0, containing 0.05% Na-azide and 0.9% NaCI.
360
TimoL6vgrenet al.
Biotinylated BSA 1. Dissolve 10 mg BSA in 1 ml 50 mM Na2CO3. Add a 50-molar excess of biotin-amidocaproate N-hydroxysuccinimide ester in 200/zl dry N,N-dimethylformamide. Incubate at RT for 3 hr. 2. Purify the biotinylated BSA twice on PD-10 columns (PharmaciaLKB Biotechnology) using 20 mM HEPES, pH 7.5, containing 0.05% Na-azide and 0.9% NaCI as the eluent. Coating procedure 3. Dilute the biotinylated BSA (bio-BSA) in the coating buffer to a concentration of 500 ng/ml. Dispense 200/zl/well in the microtitration plate. Incubate the plate at RT overnight covered with adhesion tape. Wash the plate with DELFIA Wash Solution three times. 4. Dilute the streptavidin in DELFIA Assay Buffer to a concentration of 2/xg/ml. Dispense 200/zl/well in the microtitration plate coated with bio-BSA. Incubate at RT for 3 hr. Wash the plate with DELFIA Wash Solution four times. The streptavidin-coated plates are stable for at least 6 months when stored at 4~ covered with adhesion tape.
f. Solution Hybridization Reagents Eu-labeled oligonucleotide probe, a 1-/zg/ml probe solution (see preceding sections). Biotinylated oligonucleotide probe, a 1-/zg/ml probe solution (see preceding sections). Streptavidin-coated microtitration plates (see above). 2 x hybridization buffer 100 mM HEPES, pH 7.5, containing 0.1% Tween-20, 200/xM EDTA and 1 M NaCI. 3. Instrumentation See the section on Indirect labeling.
B. Procedures 1. Detection of Specific DNA Using PCR and Europium-Labeled Oligonucleotide Probes in an in Solution Hybridization Assay a. Sample Pretreatment Several rapid sample pretreatment methods intended to be used with PCR protocols have been described in the literature (Kawasaki, 1990;
15. Lanthanide Chelates/Time-Resolved Fluorescence
361
Witt and Erickson, 1989). The sample pretreatment is very dependent on the nature of the sample to be examined. In many cases boiling at 100~ for 10 to 20 min in water is sufficient to lyse the cells and liberate the DNA from the nucleus. If more drastic methods are required, boil in 0.01 to 0.1 M NaOH. Ensure proper neutralization on completion, using an equimolar amount of HOAc supplemented with 50 mM Tris-HC1, pH 8.4. More sophisticated sample pretreatment methods include use of Proteinase K and/or SDS, etc. However, with these there is a risk of inactivation of the Taq polymerase. b. P C R Many protocols for the PCR have been described for a wide variety of analytes (see McInnes et al., 1990). The PCR solution can be set up according to the following scheme.
1. Mix 10 /zl 3 /zM primer-mix, 10/zl 0.5 U//zl Taq polymerase, 50/zl 2 x PCR-buffer, and 30/zl sample. Cover the reaction solution with 100/zl of mineral oil. 2. Perform the PCR in an automated heat-block using a suitable temperature profile for 30 cycles or less, depending on the amount of starting template DNA. Always include proper positive and negative controls. c. Hybridization Test 1. Denature 10/xl of the amplified DNA solution by boiling at 100~ for 10 min. Rapidly cool the denatured samples on ice. 2. Add 100/xl 1 x hybridization buffer containing the Eu-labeled and biotinylated oligonucleotide probes, at 10 ng/ml each. Include as negative controls H20 and 100 ng of unspecific DNA (such as herring sperm DNA). 3. Hybridize at 40 to 60~ for 30 to 60 min, depending on the length of the hybridizing sequences of the probes. 4. Transfer 100/zl of the hybridization reaction mixture to individual streptavidin-coated wells in the microtitration plate. Add 100/zl/ well of the DELFIA Assay Buffer. Incubate with continuous shaking on a DELFIA Plateshake at RT for 1 hr. Wash the strips 6 times with the DELFIA Platewash using DELFIA Wash Solution. 5. Dispense 200/zl of Enhancement Solution to each well. Incubate with continuous shaking in a DELFIA Plateshake for 25 min at RT. Measure the resulting Eu fluorescence in a time-resolved fluorometer. See Table III for typical results.
362
Timo Lsvgren et al. Table !!! Detection of HIV-2 Proviral DNA from MOLT 4 Genomic DNA~
Template DNAb molecules
Fluorescence c (cps)
CV (%)
0 1 2 5 10 50 100 500
959 8098 11363 30540 67613 204492 358491 527811
22 30 45 22 31 7 1 12
,
Primers were used from the LTR region of HIV2. A 168-bp fragment was PCR amplified for 30 cycles using MOLT 4 genomic DNA as template. The solution hybridization test was performed using a Eu-labeled oligonucleotide. b Purified MOLT 4 DNA was used in the PCR that was run in triplicates. c The hybridization assay was performed in a single reaction, and the signal is the mean of three individual PCR runs. a
2. U s e f u l Hints
a. Preparation of the Probes It is not r e c o m m e n d e d that the tail of m o d C be more than 30 m o d C units long, since the solubility of the oligonucleotide containing a longer tail d e c r e a s e s . The yield of a 60-mer is usually good, but longer oligonucleotides are more difficult to produce; the purification of longer oligonucleotides is more complex. Use ordinarily 15-25 m o d C ' s incorporated at the 5' end. The biotinylated probe m a y be c h e c k e d by H P L C for the p r e s e n c e of biotin (see Agrawal e t al., 1986). The biotinylation reaction should be at least 9 0 - 9 5 % efficient. U n r e a c t e d act-biotin must be carefully r e m o v e d by gel filtration. If u n r e a c t e d act-biotin is present, it will drastically lower the signal level achieved in the hybridization test, since the free biotin will effectively bind to the streptavidin on the solid support. See Section II,B,3 on chemical Eu labeling of D N A probes.
b. P C R Avoid extensive cycling of the PCR; 30 cycles is sufficient for detection of a few molecules of target D N A . In most applications 20 to 25 cycles
15. Lanthanide Chelates/Time-Resolved Fluorescence
363
of PCR will provide detectable amounts of amplified DNA. The linearity of the overall assay is strongly dependent on the number of cycles used in the PCR versus the amount of starting material. Since the PCR amplification produces double-stranded DNA, there will be a competition in the hybridization reaction between the two oligonucleotides and the complementary strand for hybridization to the target sequence. This is reflected in the linearity of the assay. By running on asymmetric PCR, the target DNA will be almost exclusively single stranded (Gyllensten and Erlich, 1988), thus improving the linearity of the assay. c. The H y b r i d i z a t i o n Test
Usable concentrations of biotinylated and Eu-labeled oligonucleotide probes are 2 to 20 ng/ml. The biotin-binding capacity of the solid support limits the amount of biotinylated oligonucleotide that can be used in the hybridization reaction. Unspecific binding of Eu-labeled oligonucleotide to the solid support can often be decreased by lowering the concentration of labeled probe. The time required for reaching maximal hybridization is dependent on the length of the probing sequence of the oligonucleotides. Short oligonucleotides (18-mers) hybridize rapidly (15 min), whereas longer (30-mers) require at least 2 hr for complete hybridization. The procedure can be simplified by combining the hybridization and collection reaction, but longer reaction times (2-6 hr) are required. A low-salt stringent wash solution (50 mM HEPES, pH 7.5, containing 15 mM NaC1 and 50/zM EDTA) and elevated temperature can also be used to increase the specificity.
VI. D E T E C T I O N O F M U T A T I O N S USING LANTHANIDE-LABELED OLIGONUCLEOTIDES Gel electrophoresis and membrane hybridization are conventional methods of detecting mutations (Garbutt et al., 1985; Sheldon et al., 1987). However, use of these methods in a clinical routine laboratory, where large numbers of samples are analyzed, is not practical. This situation has led to the development of more easy to use methods for this purpose (Landegren et al., 1988; Syv/~nen et al., 1994). The application of oligonucleotides for detecting genetic diseases increased after the invention of DNA amplification methods, which can be used to amplify DNA fragments containing the mutation site for analysis;
364
Timo L/~vgren et al.
alternatively, reactions can be designed to amplify one of the mutated or normal alleles specifically. Oligonucleotides labeled with lanthanide chelates have been used as primers in DNA amplification. The amplification products can be analyzed for the presence or absence of a restriction site altered by a mutation (Dahlrn et al., 1991b). The conventional laborious detection of the digested products on an agarose gel can be avoided by using microtitration plates as the solid support. PCR reactions can be designed to amplify specific alleles in the sample DNA (Newton et al., 1989; Wu et al., 1989). Eu-labeled oligonucleotide probes have been used to detect target sequences amplified with primers specific for normal or mutant cystic fibrosis (AF508) alleles (Iiti~i et al., 1992b). The method requires amplification of the sample DNA in two separate reactions. A biotinylated primer was used to capture the amplification product (after denaturation) onto streptavidin-coated microtitration wells (Fig. ll). In solution hybridization, high specificity is achieved using two oligonucleotide probes that hybridize adjacently to the target DNA. The hybridizaLYSISOF CELLS ~ ( ~
.= ~ l
ALLELESPECIFICAMPLIFICATIONS ~
.= Normalspecific ---GAA
Normal Sample
Del specificprimers51.: e-tio~3' n
ACC .
Normal DNA
.
.
.
.
~ --B
Fluorescence(cps x 1000)
.
.
-
GAA ACC
--
~p_..~--B
~,
B
DETECTIONOF THE PCR PRODUCT ooo
Amplificatiin level...106
O Developmentand measurement of the fluorescence
No amplification
-il E3| Solution hybridization and collectionof the formedhybrids
Fig. I 1---Principle of the dual label assay. DNA is liberated from the dried blood spots by boiling in alkaline solution and is amplified using primers around the mutation region. Different alleles are detected from the amplified DNA in a solution hybridization using Euand Sm-labeled allele-specific probes. After stringent washes, the bound metal(s) are liberated from the probes into DELFIA | enhancement solution, where they form highly fluorescent complexes. The sample can be defined as homozygous normal, a carrier, or a homozygous mutant based on the fluorescence emission.
15. Lanthanide Chelates/Time-Resolved Fluorescence
365
tion is fast because the reaction is performed in solution. Eu-labeled oligonucleotides can be used for the detection of specific alleles by using biotinylated capture probes (Norgaard-Pedersen et al., 1993) or labeled detector probes overlapping the mutation site (Dahl6n et al., 1993). Furthermore, multiple alleles can be detected in a single hybridization reaction by utilizing oligonucleotide probes labeled with different lanthanides (Iitifi et al., 1992c; Fig. 12). Modified dot blot methods based on lanthanide-labeled probes have been designed to detect mitochondrial mutations (Huoponen et al., 1994) and for mutations associated with medium-chain acyl-CoA dehydrogenase
I
SAMPLETREATMENTL AND AMPLIFICATION tllJllllilllillllllll IIIllllllillllllllllll
Illlimillllllliiiil IIIIIIIll'lllllllilllll I!11111111111111111111
DENATURATIONAND/ADDITIONOFPROBES ,~Eu...Eu
HYBRIDIZATIONAND t STRINGENTWASHES ......
NORMAL Eu ..Eu ~
CARRIER F
'~'
Eu..Eu~
[/
1 MUTANT
I
Sm .Sm~
" ~'~
ENHANCEMENT[SOLUTION ~
e
"--I
,
@eli@ ,
MEASUREMENTOFFLUORESCENCE Fig. 12--Design of an allele-specific amplification assay for detection of the most common mutation causing cystic fibrosis. Two allele-specific amplification reactions are run and analyzed in a hybridization reaction utilizing an oligonucleotide labeled with Eu chelates.
366
Timo L/ivgrenet al.
deficiency (Iiti/i e t a l . , 1994). In this assay format, the amplified target DNA is captured onto the surface of a microtitration well using the biotin-streptavidin system, after which the DNA is denatured using alkaline solution. The mutation is then detected by hybridization with probes labeled with lanthanide chelates. In this way, the competition of the complementary target DNA strand with the hybridizing oligonucleotides can be avoided. In addition, probe sequences from either target DNA strand can be used to avoid undesired formation of the most stable mismatches (Fig. 13). Amplification of a carder sample DNA with biotinylated primers
V Collection of the biotinylated target DNA and denaturation using mild NaOH solution
~,~
M
Solution hybridization with normal and mutant probes and stringent washes Eul4N
Eu14M
Enhancement addition and measurement
.,~_xr,,.~
Fill. 13mModified dot blot method for detection of point mutations from amplified DNA using short oligonucleotide probes. M, Mutant target DNA; N, normal target DNA; Eul4N, 14-base oligonucleotide probe specific for normal allele; Eul4M, 14-base oligonucleotide probe specific for mutant allele.
15. Lanthanide Chelates/Time-Resolved Fluorescence
367
Lanthanide-labeled oligonucleotides have also been used in the detection of mutations by way ofligating two adjacently hybridizing oligonucleotide probes (Samiotaki et al., 1994). In this assay, high specificity is achieved by combining hybridization specificity with the specificity of a ligation reaction.
A. M a t e r i a l s 1. Reagents DELFIA | assay buffer is used as collection buffer: 25 m M Tris-HCl (pH 7.75), 15 m M NaC1, 0.0005% Tween-40, 0.25% BSA, 0.025% bovine globulin, l0/~M DTPA, and 0.025% sodium azide DELFIA | wash solution: 5 m M Tris-HC1, pH 7.8, 150 mM NaC1, 0.1% Germal II, 0.0005% Tween 20 DELFIA | assay buffer supplemented with 0.5 M NaC1 is used as hybridization buffer Streptavidin-coated microtitration plates with two different binding capacities are available from Wallac Oy: low capacity plates for solution hybridization (preparation described in previous section) and high capacity plates for use in the modified dot blot method. Higher capacity is needed, because of the large excess of free biotinylated primer in the amplification mixture.
2. Instrumentation Time-resolved fluorometer: The principle of TR fluorescence measurement and the instrument is described in an earlier section. DELFIA | plate shaker and plate washer, described in an earlier section.
B. P r o c e d u r e s 1. Restriction Enzyme Digestion of an Amplification Product
a. Sample Preparation The following protocol has been used for whole blood (EDTA), dried blood spots or saliva.
1. Take 3/~1 blood (EDTA), 3/~1 saliva, or a 3-mm disk from a dried blood spot into an Eppendorf tube.
368
Timo L/ivgrenet al.
2. Add 50 /zl 10 m M NaOH containing 1% Nonidet P-40 to the sample and incubate the tube for 10-30 min in boiling water. 3. Spin the boiled sample and add 50/zl 10 mM CH3COOH containing 100 m M Tris, pH 8.4 to neutralize the sample. 4. Centrifuge the sample for 10 min in an Eppendorf centrifuge and take a 3- to 20-/zl sample from the supernatant into the amplification reaction.
b. Amplification of the Mutation Region Amplification of the mutation region is performed using a "nested primers" approach according to standard protocols. Primers used in the first stage of the amplification reaction are unlabeled. For the second stage of the amplification, primers labeled with Eu and biotin are used (Dahlrn et al., 1991a). Amplification can also be performed directly with labeled primers, but part of the specificity is lost in the process. This is crucial, especially if a low concentration of target DNA is used. 1. Perform the first stage of amplification in a 50-/zl reaction volume using unlabeled outer primers (0.1 /xM), 1 U Taq polymerase, and 25-30 amplification cycles. 2. Add 50/xl fresh amplification mixture containing 1 U Taq polymerase and 0.1/~M biotinylated and Eu-labeled inner primers. Use 5-10 amplification cycles.
c. Restriction Enzyme Digestion in Microtitration Wells 1. For collection of the labeled amplification product to the microtitration wells, add 200/~1 collection buffer to the wells coated with streptavidin. Add 3-5/~1 (low-capacity plates) or 5-20/~1 (plates with high binding capacity) of amplification reaction into the wells and incubate at room temperature for 1 hr. 2. Wash the plates six times at room temperature using DELFIA | washing solution and the automated plate washer. 3. Add 200/zl buffer appropriate for the enzyme used (see instructions of the enzyme manufacturer) into the wells, with 1-10 U restriction enzyme. The digestion reaction should be incubated at a temperature recommended by the enzyme manufacturer for at least 1 hr. 4. Wash the plates six times using DELFIA | wash solution and the automated plate washer.
15. Lanthanide Chelates/Time-Resolved Fluorescence
369
5. Add 200/xl enhancement solution to the wells and incubate at room temperature for 30 min. 6. Read the fluorescence in a time-resolved fluorometer.
2. AHele-Specific Amplification In this method, two similar primers are designed that are complementary to the mutation region but have different sequences at the 3' end. One of the primers forms a fully matching hybrid with the normal DNA, but has a mismatch at the 3' end relative to the mutated sequence. This mismatch prevents the polymerase from amplifying the mismatch-forming allele. The second primer forms a fully matched hybrid with the mutated DNA. At the other end of the amplification product, a common primer matching both alleles is used. This common primer is biotinylated in our example (Fig. 12). In some cases it is necessary to introduce additional mutations near the 3' end of the specific primer to ensure allele specificity (Gregersen et al., 1991; Tsai et al., 1993), since all mismatches do not equally prevent amplification (Huang et al., 1992).
a. Allele-Specific Amplification 1. The sample pretreatment method described for the restriction enzyme digestion method can also be used for this application. 2. Prepare two amplification reactions for each sample tested. Use the common biotinylated amplification primer in both of the reactions and one of the allele-specific primers in each of the reactions. Otherwise the amplification is performed according to standard protocols.
b. Detection of the Amplified Product Using Hybridization with Eu-Labeled Probe 1. Hybridization solution: Add Eu-labeled oligonucleotide to the hybridization buffer to a final concentration of 20 ng/ml. The amount of solution needed per sample is 400/~1. 2. Denaturation of the amplification product: Boil the amplification tubes for 5 min and cool them immediately by placing them on ice. Alternatively, the amplification apparatus can be programmed to incubate tubes at 100~ for 10 min, after which the heating block is rapidly cooled to 4~ 3. Pipet aliquots of 3-5/~1 denatured PCR products into streptavidincoated (low-capacity) microtitration wells.
370
Timo L6vgren et al.
4. Add 200/xl hybridization solution per well to the samples and cover the plates with tape to prevent evaporation. Incubate the plates at a proper hybridization temperature for 2 hr. 5. Wash the plates six times using the automated plate washer and DELFIA| wash solution. 6. Add 200/xl enhancement solution to each well and shake the plates at room temperature in a plate shaker for 30 min. 7. Measure the fluorescence using a time-resolved fiuorometer.
3. Allele-Specific Solution Hybridization The instructions for design of the amplification/solution hybridization region described in the previous section should be followed. In addition, either the capture probe (biotinylated) or the signal probe (Eu-labeled) should hybridize to the mutation region. In our example, allele-specific biotinylated probes are used. It is also advantageous to place the mutation site in the middle of the allele-specific probe. Other rules concerning the design of allele-specific hybridization probes should also be followed (Thein et al., 1987).
a. Amplification of the Mutation-Containing Region 1. The sample pretreatment method described for the restriction enzyme digestion method can also be used for this application. 2. Denature the amplification product as described earlier for the allele-specific amplification method. 3. Pipet 10/~1 denatured amplification product from every sample into each of four streptavidin-coated (low-capacity) microtitration wells. 4. Add 100/~1 hybridization solution specific for the normal allele to two of the wells and 100/~1 hybridization solution specific for the mutant allele to the other two wells. Cover the plates with tape to prevent evaporation. 5. Incubate the plates at optimal hybridization temperature for 2 hr. 6. Wash the plates at optimal hybrid washing temperature by immersing the wash solution bottle of the automated plate washer in a heated water bath. 7. Add 200/~1 enhancement solution to each well and shake the plates at room temperature in a plate shaker for 30 min. 8. Measure the fluorescence using a time-resolved fluorometer.
15. Lanthanide Chelates/Time-Resolved Fluorescence
371
4. Modified Dot Blot Method
In the amplification reaction, the complexity of the target DNA decreased drastically, making it possible to use very short oligonucleotides during the allele-specific hybridization. Even point mutations can be detected reliably using oligonucleotides 12-14 bases long. The hybridization efficiency of oligonucleotides is decreased when shorter probes are used. By using 20-base hybridization probes, approximately 1 x 107 target molecules can be detected in the solution hybridization; if 12-base probes are used in the modified dot blot method, the sensitivity of the hybridization reaction is approximately 1 x 109 target molecules. This sensitivity can be achieved in the modified dot blot method because the complementary strand of the target DNA is not competing with the hybridization probes during the hybridization reaction (Fig. 13). The simple hybridization design involving only one hybridization probe also improves the sensitivity (see also Section VI,B,5,d).
a. Amplification of the Target DNA for Analysis 1. The sample pretreatment method described for the restriction enzyme digestion method can also be used for this application. 2. Amplify the region containing the mutation by using a biotinylated primer or biotinylated primers.
b. Performing Dot Blot Hybridization in Microtitration Wells 1. Add 75/.r collection buffer to streptavidin-coated (high binding capacity) microtitration wells. 2. Pipet 20/~1 reaction mixture containing the amplified target into four microtitration wells and incubate at room temperature with shaking for 1 hr. 3. Prepare two hybridization solutions with one probe in each solution, specific either for the normal or for the mutant allele. Probes are used at a concentration of 10 ng/ml; 400 ~1 of each solution is needed per sample. 4. Denaturation of the amplification product: Add 200/~1 50 mM NaOH to each microtitration well and shake the plates for 5 min at room temperature. 5. Wash the wells using an automated plate washer and DELFIA | wash solution. 6. Add 200/xl normal specific hybridization solution to the first two wells and 200/xl hybridization solution specific for the mutant allele to the other two wells. Cover the plates with tape and incubate them at optimal hybridization temperature for 2 hr.
372
Timo LSvgren et al.
7. Wash the plates at an optimal hybrid washing temperature by immersing the wash solution bottle of an automated plate washer in a heated water bath. 8. Add 200 /xl enhancement solution to each well and shake the plates at room temperature in a plate shaker for 30 min. 9. Measure the fluorescence using a time-resolved fluorometer.
5. Useful Hints
a. D N A Amplification All the standard precautions to avoid contamination of the amplification reactions by the amplification products from previous amplification reactions should be followed (Kwok et al., 1989). Blood with heparin as the anticoagulant should not be used for the amplification reaction, since heparin is an efficient inhibitor of Taq polymerase. b. Controls In each assay, it is useful to use separate control samples to control the function of the amplification and hybridization reactions. When both mutant and normal alleles are detected, the method contains internal controls for the amplification reaction, since signal must be obtained with one or both hybridization probes from each sample. In addition, samples with known mutated/normal alleles can be used to control the function of the amplification reaction. Oligonucleotides containing hybridization sequences for the probes can be used to control the function of the allelespecific hybridization. To avoid contamination problems during the amplification reaction, these hybridization control sequences should not contain regions specific for the amplification primers.
c. Optimization of the Hybridization Reaction For each probe set used, it is necessary to optimize the hybridization temperatures to achieve the needed hybridization signal. Hybrid washing temperatures should be studied to achieve the specificity needed. In addition, the kinetics of different reaction steps should be followed to establish correct incubation times. The biotin binding capacity of streptavidin-coated plates can vary among different plate types and production batches. Thus it is important to optimize separately the amount of biotinylated probe or biotinylated amplification product used for each plate type. Also, any free biotin contaminating the hybridization probes or primers can cause problems. d. Design of the Modified Dot Blot Method All mutations do not destabilize the DNA double strand to the same
15. Lanthanide Chelates/Time-Resolved Fluorescence
373
extent (Cotton et al., 1989). Weakly destabilizing mismatches can be avoided by choosing probe sequences from the right target DNA strand. In some cases it is necessary to choose hybridization probes for the normal and mutant alleles from opposite target DNA strands. Use of two biotinylated primers during the amplification reaction (Iiti~i et al., 1994) makes this possible, since both target DNA strands cannot be collected in the microtitration wells (Fig. 13).
A
100000 9OO0O
hybridizationcontrols
Mutant samples
8OOO0
• PCR controls
~. 7oooo |
9 Samples
(
Carrier samples
i" x%
~E 30000 (l~
20000
10000
I)'@@
Normal samples
.
LICF
,
0
. ' ~ * * ~ ~ ,~**~."
9
2[][]0(]0 400000
6000[~
8000[~
-" I
I
I0000(~
1200000
Normal probe (CPS)
B
1CXX~ Normal samples
I
i i
1000 'I~ '~
='..
= ='b=
====
%===.=.P
~."
===.i'
Carrier samples
lO0 9
RE
In
lEE
immimm
lib
9
9 9
El
9
9
10 Mutant samples
vc 9
0.1
I
9 I
9 I
9 I
9 I
9
9
9 I
I
i
9 I
9
9 I
i
IE I
I
I
I
Sample numl~r Fig. 14--Results from the mutation detection can be conveniently presented as (A) blotting signal obtained with the mutant probe against the signal obtained with the normal probe or (B) the ratio of the signals to the sample number on a logarithmic graph.
374
Timo L6vgren et al.
Results from hybridization reactions can be conveniently presented as a blotting signal obtained with the normal probe compared with the signal obtained with the mutant probe (Fig. 14A), or as the ratio of these two signals on a logarithmic scale (Fig. 14B).
ACKNOWLEDGMENTS We are grateful to Mrs. Leena Huhtam~iki for performing the HPV-16 assays, and to Dr. Veli-Matti Mukkala for synthesizing the modC. The secretarial assistance of Mrs. Teija Ristel~i in the preparation of the manuscript is appreciated.
REFERENCES Agrawal, S., Christodoulou, C., and Gait, M. J. (1986). Efficient methods for attaching nonradioactive labels to the 5' ends of synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 14, 6227-6245. Conner, B. J., Reyes, A. A., Morin, C., Itakura, K., Teplitz, R. L., and Wallace, R. B. (1983). Detection of sickle-cell/3S-globin allele by hybridization with synthetic oligonucleotides. Proc. Natl. Acad. Sci. U.S.A. 80, 278-282. Cotton, R. G. H. (1989). Detection of single base changes in nucleic acids. Biochem. J. 263, 1-10. Dahl6n, P. (1987). Detection of biotinylated DNA probes by using Eu-labeled streptavidin and time-resolved fluorometry. Anal. Biochem. 164, 78-83. Dahl6n, P., Syviinen, A-C., Hurskainen, P., Kwiatkowski, M., Sund, C., Ylikoski, J., S6derlund, H., and LOvgren, T. (1987). Sensitive detection of genes by sandwich hybridization and time-resolved fluorometry. Mol. Cell. Probes 1, 159-168. Dahl~n, P., Hurskainen, P., L(Jvgren, T., and Hyypiii, T. (1988). Time-resolved fluorometry for the identification of viral DNA in clinical specimens. J. Clin. Microbiol. 26, 2434-2436. Dahl6n, P., Iitiii, A., Mukkala, V-M., Hurskainen, P., and Kwiatkowski, M. (1991a). The use of europium (Eu 3§ primers in PCR amplification of specific target DNA. Mol. Cell. Probes 5, 143-149. Dahl6n, P., Iitiii, A., Skagius, G., Frostell, A., Nunn, M., and Kwiatkowski, M. (1991b). Detection of HIV-l using the polymerase chain reaction and a time-resolved fluorescence based hybridization assay. J. Clin. Microbiol. 29, 798-804. Dahl6n, P., Iitiii, A., Mukkala, V-M., Hurskainen, P., and Kwiatkowski, M. (1991c). The use of europium (Eu 3§) labeled primers in PCR amplification of specific target DNA. Mol. Cell. Probes 5, 143-149. Dahl6n, P., Carlson, J., Liukkonen, L., Lilja, H., Siitari, H., Hurskainen, P., Iitiii, A., Jeppsson, J.-O., and LOvgren, T. (1993). Europium-labeled oligonucleotides to detect point mutations: Application to Pl Z a-l-antitrypsin deficiency. Clin. Chem. 31, 1203-1206. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Forster, A. C., McInnes, J. L., Skingle, D. C., and Symons, R. H. (1985). Nonradioactive hybridization probes prepared by the chemical labeling of DNA and RNA with a novel reagent, photobiotin. Nucleic Acids Res. 13, 745-761. Garbutt, G. J., Wilson, J. T., Schuster, G. S., Leafy, J. J., and Ward, D. C. (1985). Use of biotinylated probes for detecting sickle cell anemia. Clin. Chem. 31, 1203-1206. Gregersen, N., Blakemore, A. I. F., Winter, V., Andresen, B., Kr S., Bolund, L.,
15. Lanthanide Chelates/Time-Resolved Fluorescence
375
Curtis, D., and Engel, P. C. (1991). Specific diagnosis of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in dried blood spots by a polymerase chain reactio (PCR) assay detecting a point-mutation (G985) in the MCAD gene. Clin. Chim. Acta 203, 23-24. Gyllensten, U. B., and Erlich, H. A. (1988). Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc. Natl. Acad. Sci. U.S.A. 85, 7652-7656. Hemmil~i, I., Dakubu, S., Mukkala, V-M., Siitari, H., and Lfvgren, T. (1984). Europium as a label in time-resolved immunofluorometric assays. Anal. Biochem. 137, 335-343. Huang, M-M., Arnheim, N., and Goodman, M. F. (1992). Extension of base mispairs by Taq DNA polymerase: Implications for single nucleotide discrimination in PCR. Nucleic Acids Res. 20, 4567-4573. Huoponen, L., Juvonen, V., Iiti~i, A., Dahl6n, P., Siitari, H., Aula, P., Nikoskelainen, E. K., Savontaus, M-L. (1994). Time-resolved fluorometry in the diagnosis of Leber hereditary optic neuroetinopathy. Human Mutation 3, 29-36. Hurskainen, P., Dahl6n, P., Ylikoski, J., Kwiatkowski, M., Siitari, H., and Lfvgren, T. (1991). Preparation of europium-labeled DNA probes and their properties. Nucleic Acids Res. 19, 1057-1061. Iiti~i, A., Dahl6n, P., Nunn, M., Mukkala, V-M., and Siitari, H. (1992a). Detection of amplified HTLV-I/-II viral sequences using time-resolved fluorometry. Anal. Biochem. 202, 76-81. Iiti~i, A., Liukkonen, L., and Siitari, H. (1992b). Simultaneous detection of two cystic fibrosis alleles using dual-label time-resolved fluorometry. Mol. Cell. Probes 6, 505-512. Iiti~i, A., Hegdall, E., Dahl6n, P., Hurskainen, P., Vuust, J., and Siitari, H. (1992c). Detection of mutation AF508 in the cystic fibrosis gene using allele-specific PCR primers and timeresolved fluorometry. PCR Methods Appl. 2, 157-162. Iiti~i, A., Mikola, M., Gregersen, N., Hurskainen, P., and L6vgren, T. (1994). Detection of a point mutation using short oligonucleotide probes in allele-specific hybridization. BioTechniques 17, 566-573. Ikuta, S., Takagi, K., Wallace, R. B., and Itakura, K. (1987). Dissociation kinetics of 19 base paired oligonucleotide-DNA duplexes containing different single mismatched base pairs. Nucleic Acids Res. 15, 797-811. Kawasaki, E. S. (1990). Sample preparation from blood, cells and other fluids. In "PCR Protocols. A Guide to Methods and Applications" (M. A. Mclnnis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds.), pp. 146-152. Academic Press, San Diego. Kwok, S., and Higuchi, R. (1989). Avoiding false positives with PCR. Nature 339, 237. Landegren, U., Kaiser, R., Caskey, C. T., and Hood, L. (1988). DNA diagnostics--Molecular techniques and automation. Science 242, 229-237. Langer, P. R., Waldrop, A. A., and Ward, D. C. (1981). Enzymatic synthesis of biotinlabeled polynucleotides: Novel nucleic acid affinity probes. Proc. Natl. Acad. Sci. U.S.A. 78, 6633-6637. Leary, J. J., Brigati, D. J., and Ward, D. C. (1983). Rapid and sensitive colorimetric method for visualizing biotin-labeled DNA probes hybridized to DNA or RNA immobilized on nitrocellulose: Bio-blots. Proc. Natl. Acad. Sci. U.S.A. 80, 4045-4049. L6vgren, T., and Pettersson, K. (1990). Time-resolved fluoroimmunoassay, advantages and limitations. In "Luminescence Immunoassay and Molecular Applications" (K. Van Dyke and R. Van Dyke, eds.), pp. 233-250. CRC Press, Boca Raton, Florida. Mclnnis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds.) (1990). "PCR Protocols. A Guide to Methods and Applications." Academic Press, San Diego. Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J., Summres, C., Kalsheker, N., Smith, J. C., and Markham, A. F. (1989). Analysis of any point mutation in DNA: The amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503-2515. Nergaard-Pedersen, B., Hegdall, E., Iitifi., A., Arends, J., Dahl6n, P., and Vuust, J. (1993).
376
Timo L/ivgren et al.
Immunoreactive trypsin and a comparison of two AF508 mutation analyses in newborn screening for cystic fibrosis: An anonymous pilot study in Denmark. Screening 2, 1-11. Ranki, M., Palva, A., Virtanen, M., Laaksonen, M., and Srderlund, H. (1983). Sandwich hybridization as a convenient method for the detection of nucleic acids in crude samples. Gene 21, 77-85. Reisfeld, A., Rothenberg, J. M., Bayer, E. A., and Wilchek, M. (1987). Nonradioactive hybridization probes prepared by the reaction of biotin hydrazide with DNA. Biochem. Biophys. Res. Commun. 142, 519-526. Rigby, P. W. J., Dieckmann, M., Rhodes, C., and Berg, P. (1977). Labeling deoxyribonucleic acid to high specific activity in oitro by nick translation with DNA polymerase I. J. Mol. Biol. 113, 237-251. Sambrook, J., Fritsch, E. F., and Maniatis, T. (eds.) (1989). "Molecular Cloning. A Laboratory Manual." 2nd Ed. Cold Spring Harbor University Press, Cold Spring Harbor, New York. Samiaotaki, M., Kwiatkowski, M., Parik, J., and Landegren, U. (1994). Dual-color detection of DNA sequence variants by ligase-mediated analysis. Genomics 20, 238-242. Shapiro, R., and Weisgras, J. M. (1970). Bisulfite-catalyzed transamination of cytosine and cytidine. Biochem. Biophys. Res. Commun. 40, 839-843. Sheldon, E. L., Kellogg, D. E., Watson, R., Levenson, C. H., and Erlich, H. A. (1986). Use of nonisotopic MI3 probes for genetic analysis: Application to HLA class II loci. Proc. Natl. Acad. Sci. U.S.A. 83, 9085-9089. Sheldon, E., Kellogg, D. E., Levenson, C., Bloch, W., Aldwin, L., Birch, D., Goodson, R., Sheridan, P., Horn, G., Watson, R., and Erlich, H. (1987). Nonisotopic MI3 probes for detecting the beta-globin gene: Application to diagnosis of sickle cell anemia. Clin. Chem. 33, 1368-1371. Soini, E., and Lrvgren, T. (1987). Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit. Rev. Anal. Chem. 18, 105-154. Sund, C., Ylikoski, J., Hurskainen, P., and Kwiatkowski, M. (1988). Construction of europium (Eu 3+)-labeled oligo DNA hybridization probes. Nucleosides Nucleotides 7, 655-659. Syv/~nen, A. C., Laaksonen, M., and S6derlund, H. (1986). Fast quantification of nucleic acid hybrids by affinity hybrid collection. Nucleic Acids Res. 14, 5037-5048. Syv/inen A-C., and Landegren U. (1994). Detection of point mutations by solid-phase methods. Hum. Mutat. 3, 172-179. Syv/inen, A. C., Tchen, P., Ranki, M., and S6derlund, H. (1986). Time-resolved fluorometry: a sensitive method to quantify DNA-hybrids. Nucleic Acids Res. 14, 1017-1028. Takahashi, T., Mitsuda, T., and Okuda, K. (1989). An alternative nonradioactive method for labeling DNA using biotin. Anal. Biochem. 179, 77-85. Thein, S. L., and Wallace, B. (1987). The use of synthetic oligonucleotides as specific hybridization probes in the diagnosis of genetic disorders. In "Human Genetic Diseases. A Practical Approach" (K. E. Davies, ed.), pp. 33-50. IRL Press, Oxford. Tsai, M. Y., Schwichtenberg, K., and Tuchman, M. (1993). Laboratory diagnosis of mediumchain acyl-coenzyme. A dehydrogenase deficiency by the amplification refractory mutation system. Clin. Chem. 39, 280-283. Viscidi, R. P., Connelly, C. J., and Yolken, R. H. (1986). Novel chemical method for the preparation of nucleic acids for nonisotopic hybridization. J. Clin. Microbiol. 23, 311-317. Wallace, R. B., Shaffer, J., Murphy, R. F., Bonner, J., Hirose, T., and ltakura, K. (1979). Hybridization of synthetic oligonucleotides to ~X 174 DNA: The effect of single base pair mismatch. Nucleic Acids Res. 6, 3543-3557. Witt, M., and Erickson, R. P. (1989). A rapid method for detection of Y-chromosomal DNA from dried blood specimens by the polymerase chain reaction. Hum. Genet. 82, 271-274. Wu, D. Y., Ugozzoli, L., Pal, B. K., and Wallace, R. B. (1989). Allele-specific enzymatic amplification of/3-globin genomic DNA for diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. U.S.A. 86, 2757-2760.
16
Detection of Lanthanide Chelates and Multiple Labeling Strategies Based on Time-Resolved Fluorescence Eleftherios P. Diamandis Department of Clinical Biochemistry Mount Sinai Hospital and Department of Clinical Biochemistry University of Toronto Toronto, Ontario, Canada M5G 1X5 Theodore K. Christopoulos Division of Clinical Chemistry Department of Chemistry and Biochemistry University of Windsor Windsor, Ontario, Canada N9B 3P4
I. Introduction II. Materials A. Reagents 1. Streptavidin-Based Macromolecular Complex 2. Solutions
B. Instrumentation III. Procedures A. Detection of Biotinylated Nucleic Acids B. Southern Transfer of Biotinylated Markers C. DNA Probe Hybridization Experiments D. Quantification of Polymerase Chain Reaction Products in Agarose Gels E. Other Applications References
I. INTRODUCTION The diagnosis of genetic, infectious, malignant, and other diseases will, in the future, partially be carried out on a large scale by using molecular biology techniques. This kind of diagnosis is still not very widely used for a number of different reasons, one of which is the (until recently) limited Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
377
378
Eleftherios P. Diamandis and Theodore K.
Christopoulos
availability of nonisotopic techniques for nucleic acid hybridization. The major detection systems for nucleic acid hybridization are still based on the radionuclides 32p, 358, and 3H. These radionuclides, although possessing some important favorable characteristics (e.g., very low detectability), have a number of serious disadvantages (i.e., danger of health hazards, limited shelf-life, difficulty in waste disposal, and requirements for special licensed laboratory facilities. These problems associated with the radionuclides make them clearly unsuitable for use in large-scale routine clinical diagnosis (Diamandis, 1990). In the field of immunological assays, a number of successful nonisotopic methodologies have been introduced (Ngo, 1988; Diamandis and Christopoulos, 1990). Many of these are now being tried for nucleic acid hybridization and are described in other chapters of this volume. Although many of these methodologies are not as sensitive as those using radionuclides, they still have many applications because often, extreme sensitivity is not needed or, it is possible, using the polymerase chain reaction (PCR), to amplify the target of interest before the final detection step. Time-resolved fluorometry with lanthanide chelates as labels is now an established technique in nonisotopic immunoassay (Diamandis, 1988; Soini and Lovgren, 1987). During the last 10 years, two different assay designs have evolved and are described in detail elsewhere (Diamandis, 1988). In these assay designs, the label can either be E u 3+ o r a Eu 3+ chelator. A fluorescent europium chelate can then be formed by adding either suitable organic chelators (the DELFIA system, LKB-Pharmacia), o r E u 3+ (the FIAgen system, CyberFluor, Inc., Toronto, Ontario, Canada), respectively. The fluorescent europium chelates (and some other lanthanide chelates) possess certain advantages, in comparison to conventional fluorescent labels like fluorescein (i.e., large Stokes shifts, narrow emission bands, and long fluorescence lifetimes). The fluorescence lifetime of most conventional fluorophores is approximately 100 nsec or less; the lifetime of lanthanide chelates, on the other hand, is 100-1000/zsec. A pulsed light source and a time-gated fluorometer can be used to measure the fluorescence of these compounds in a window of 200 to 600/zsec after each excitation. This method decreases the background interference from the short-lived fluorescence of natural materials in the sample (cuvettes, optics, etc.). Commercially available instruments for time-resolved fluorescence immunoassays have been described (Diamandis, 1988; Soini and Kojola, 1983). The chelates used in the DELFIA system are complexes of the type Eu(NTA)3(TOPO)2 , where NTA is naphthoyltrifluoroacetone and TOPO is trioctylphosphine oxide. The E u 3+ label is introduced into antibodies or streptavidin (SA) by using a strong E u 3+ chelator of the ethylenediaminetetraacetic acid (EDTA) type. Release of E u 3+ and recom-
16. LanthanideChelatesand MultipleLabelingStrategies
379
plexing with NTA and TOPO can be achieved by lowering the pH to approximately 3.0. DELFIA is well established in the field of nonisotopic immunoassay; it is characterized by high sensitivity and broad dynamic range. It has been criticized because of its vulnerability to Eu 3+ contamination effects (Diamandis, 1988). The Eu 3+ label can be measured down to 10-13 moles/1 using time-resolved fluorescence and 10-17 10-18 moles per cuvette (---6 • 106 - 6 x 105 molecules) can be detected routinely. Analytes can also be measured down to these levels. The newly developed FIAgen system uses the europium chelater, 4,7-bis(chlorosulfophenyl)1,10-phenanthroline-2,9-dicarboxylic acid (BCPDA) as label (Evangelista et al., 1988); it does not suffer from any Eu 3+ contamination effects. This system works best when biotinylated antibodies are used with BCPDAlabeled SA. Three SA preparations achieve different detection limits; (1) SA directly labeled with BCPDA (SA[BCPDA]~4) moles with detection limits of l0 -l~ to 10 -11 moles/1 (Diamandis and Morton, 1988); (2) SA covalently linked to thyroglobulin (TG) carrying 160 BCPDA molecules (SA[TG][BCPDA]160) with detection limits of 10-12 moles/1 (Diamandis et al., 1989); and (3) the preparation under (2) has been activated by an empirical process and is suitable for assays with detection limits of l 0 -12 t o 10 -13 moles/1 or less (Morton and Diamandis, 1990). This reagent will be briefly described later in the text. The best detection limit achieved with the latter reagent for a model a-fetoprotein assay was ---300,000 molecules per cuvette (5/zl sample volume) (Christopoulos et al., 1990). DNA hybridization assays using the principles of the immunological version of DELFIA have been described (Dahlen, 1987; Sund et al., 1988; Syvanen et al., 1986; Oser et al., 1990). This assay works well in applications in which the spatial distribution of DNA bands on solid supports is not studied (e.g., in dot blot hybridizations). However, it is unsuitable for Southern, Western, and Northern types of analysis, because the spatial distribution of Eu 3+ in the bands is lost during the extraction procedure necessary for fluorescence enhancement (Soini et al., 1990). Thus, other principles involving stable fluorescent europium or terbium chelates have been investigated (Soini et al., 1990; Hemmila and Batsman, 1988; Oser et al., 1990). In this chapter, we describe some applications of a newly developed SA-based reagent labeled with the europium chelate of BCPDA (Morton and Diamandis, 1990) for DNA hybridization and other assays. This reagent is highly fluorescent and can stain biotinylated DNA separated on solid supports. Although not described in this chapter, preliminary experiments with other types of assays (Western, Northern, dot-slot blot, etc.) show that the new reagent can find application in any assay design that involves a biotinylated moiety. _
_
380
Eleftherios P. Diamandis and Theodore K. Christopoulos
II. MATERIALS A. R e a g e n t s Biotinylated DNA molecular weight markers (HindlII lambda DNA digests) were obtained from Vector Laboratories, Burlingame, California, as a 50-/zg/ml solution. Purified linearized plasmid pBR 328 and its digestion fragments were obtained from Boehringer-Mannheim, Indianapolis, Indiana as part of their DNA Labeling and Detection Kit, Nonradioactive. The Prime-it Random Primer Kit supplemented with Bio-11-dUTP/dTTP mix was obtained from Stratagene, La Jolla, California. Supported nitrocellulose (Hybond-C-Extra) and nylon membranes (Hybond-N) were obtained from Amersham International, Buckinghamshire, United Kingdom. Sonicated salmon sperm DNA (10 mg/ml) was obtained from Sigma Chemical Co., St. Louis, Missouri. The DNA template for PCR experiments was a pUC19 plasmid containing a cytomegalovirus insert of 2260 bp. This plasmid, when amplified with the primers shown here, gives a PCR product of 362 bp. The sequences of the primers are: 5'-GGCAGCTATCGTGACTGGA-3' 5'-NH2-GATCCGACGACCCATTGTCTAAG-3'
1. Streptavidin-Based Macromolecular Complex The SA-based macromolecular complex (SBMC) was prepared as previously described (Morton and Diamandis, 1990). Because of the involved preparation of this reagent and the commercial unavailability of BCPDA, it is advised that this reagent be purchased from CyberFluor, Inc., as a stock solution of 15 mg/1 SA. The SBMC is diluted 50-fold, just before use, in a tracer diluent [also available from CyberFluor, Inc., or prepared as described elsewhere (Morton and Diamandis, 1990)]. A schematic diagram describing the formation and the possible structure of the SBMC is shown in Fig. 1. It is postulated that this is a complex containing (1) SA covalently linked to BCPDA-labeled bovine TG; (2) BCPDA-labeled bovine TG, and (3) Eu 3+ noncovalently bound to BCPDA, acting as a bridge between components (1) and (2). The molar ratio of components (1), (2), and (3) is approximately 1:2.3:480.
2. Solutions Forty x tris acetate EDTA (TAE) buffer was prepared by dissolving (per liter) 193.6 g tris(hydroxymethyl)aminomethane (Tris) base, 108.9 g sodium acetate -3 H20, 15.2 g Na2 EDTA, and adjusting the pH to 7.2
16. Lanthanide Chelates and Multiple Labeling Strategies
381
L E.3+..H 6 50o C
,--"
. . - - . . . . . . ~3-+ - - - . . Eu3+ 3+'--,
,""
:'3
!~+,,~
Eu3+
E~3+- E~3 T,',,
+~,3+ Eu +
""l
3 "
r~ + ;
MacromolecuTar Complex
Fig. l--Schematic representation of the proposed mechanism of formation of the streptavidin-based macromolecular complex where--O, BCPDA; SA, streptavidin; and TG, thyroglobulin. SA-TG conjugates aggregate with BCPDA-labeled TG in the presence of Eu 3+, at 50~ to form the macromolecular complex. For more information, see text and also Morton and Diamandis (1990). [Reprinted with permission from Morton and Diamandis (1990).]
with acetic acid. The gel loading buffer was prepared by mixing 5 ml glycerol, 250/~l 50• TAE buffer, 1 ml saturated bromophenol blue solution, 1 ml of a 10% suspension of xylene cyanol, and adjusting the volume to l0 ml with water. Tris EDTA (TE) buffer is a l0 mM Tris, 0.1 mM EDTA solution of pH 7.80. The DNA denaturation buffer (Southern A solution) was prepared by mixing 300 ml 5 M NaCl, 50 ml 10 M NaOH, and 650 ml n20. The neutralization buffer was a 5 M ammonium acetate solution. Membrane-blocking solution was a 6% (w/v) bovine serum albumin (BSA) solution in a 50 mM Tris buffer, pH 7.80. The wash solution was a l0 m M Tris buffer, pH 7.80, containing 0.05% Tween-20 and 9 g/ liter NaC1. Southern B solution was prepared by dissolving 77 g ammonium acetate and 0.8 g NaOH in 1 liter water. Twenty • saline sodium phosphate EDTA (SSPE) solution contains (per liter) 174 g NaC1, 27.6 g NaH2PO4"H20, 7.4 g EDTA, and the pH adjusted to 7.4 with l0 M NaOH. One hundred • Denhardt's solution is
382
Eleftherios P. Diamandis and Theodore K. Christopoulos
2% polyvinylpyrrolidone, 2% BSA, and 2% Ficoll. Twenty • standard saline citrate (SSC) solution contains (per liter) 175.3 g NaC1, 88.2 g trisodium citrate.2H20, and the pH was adjusted to 7.0 with 10 M HCI.
B. Instrumentation For scanning of nitrocellulose or nylon membranes to locate and quantify fluorescent spots or bands, we used the CyberFluor 615 Immunoanalyzer equipped with a special software described elsewhere (Christopoulos and Diamandis, 1991). Instrument and software are available from CyberFluor Inc. (Toronto, Canada). For visual membrane observation, we used a Fotodyne standard UV transilluminator. For regular photography of the membranes under UV illumination, we used a Polaroid camera with instant film, in a manner identical to photography of ethidium bromide-stained gels. Exposure time was 13 sec. Color photography under UV illumination is also possible. All hybridizations were performed in a Robbins Scientific hybridization incubator.
III. PROCEDURES
A. Detection of Biotinylated Nucleic Acids 1. Serially diluted twofold at a time in TE buffer, containing 400/~g/ml salmon sperm DNA. Add in Eppendorf microcentrifuge tubes 10/zl diluted biotinylated DNA and 10/zl DNA denaturation buffer and incubate for 10 min at room temperature (RT). 2. Add 20/zl neutralization buffer, mix and immediately spot 1 /xl on prewetted (50 mM Tris, pH 7.40) nitrocellulose or nylon strips. Bake the strips in a vacuum oven for 1 hr at 60~ 3. Transfer the strips in a 6% BSA blocking solution and incubate with rotary mixing for 1 hr to overnight. Visualize the biotinylated nucleic acids by incubating them for 3 hr at RT with rotary mixing in a 50-fold diluted SA-based macromolecular complex (SBMC) solution. 4. After incubation, wash the strips x 3 with 200 ml wash solution each time and then incubate in the wash solution with rotary mixing for 1 hr or longer. Dry the strips with a hair dryer. 5. Detect or quantify bound DNA as follows" (a) UV transillumination (spotted side down)" detection limit >_ 400 pg.
16. Lanthanide Chelates and Multiple Labeling Strategies
383
(b) Photograph with a regular Polaroid camera and instant film in a manner similar to that of photographing ethidium bromidestained agarose gels. Optimal exposure time is --~13 s e c u a t least 100 pg DNA can be visualized on 1/~1 spots. (c) Scan with the CyberFluor 615 Immunoanalyzer, working in the scanning mode, with use of a special softwarem--~ 10 pg of DNA can be quantified. Some results are shown in Fig. 2. Nylon membranes give signals similar to those of nitrocellulose, but the background signal is ---10fold higher (2000 versus 20,000 arbitrary fluorescence units).
B. Southern Transfer of Biotinylated Markers 1. Separate various amounts of biotinylated HindIII-digested lambda DNA molecular weight markers on 0.8% agarose minigels using TAE buffer (loadings, l0/zl sample per lane). Mix samples l:l with gel loading buffer before application. Electrophorese for 2 to 3 hr at 60V. 2. Immerse the gel in 500 ml Southern A solution for 30 min. Repeat this step once more. Immerse the gel in Southern B solution for 30 min and repeat the step once more. 3. Perform the Southern transfer of the markers to nitrocellulose exactly as described by Davis et al. (1986) using Southern B solution and overnight incubation. Bake the membrane for 2 hr at 80~ block and stain with the SBMC, and wash exactly as described under detection of biotinylated nucleic acids. Some typical results are shown in Fig. 3. Four ng or more of total biotinylated DNA markers can be detected by the instrument. The bands obtained are identical to those obtained by using SA-alkaline phosphatase and the colorimetric (5-bromo-4-chloro-3-indolyl phosphate)-(nitroblue tetrazolium) (BCIP-NBT) reagent.
C. DNA Probe Hybridization Experiments 1. Load the intact, linearized plasmid pBR 328 and its digestion fragments on 0.8% agarose gels and separate by electrophresis as previously described. 2. Transfer the separated fragments to nitrocellulose by the Southern method and bake as described.
384
Eleftherios P. Diamandisand Theodore K. Christopoulos
Fig. 2mDetection of biotinylated lambda DNA on spots with SBMC (1/zl/spot) (A) photograph of the spots under UV transillumination; (B) scanning of the spots with the modified 615 Immunoanalyzer (200 measurement points); (C) scanning of positions C1-C4 of (B) to improve resolution; and (D) double logarithmic plot of fluorescence versus amount of biotinylated DNA spotted. Biotinylated DNA spotted (pg/1/.d) was 50(1); 100(2); 200(3); 400(4); 800(5); 1600(6); 3200(7); 6400(8). 3. P r e h y b r i d i z e the m e m b r a n e at 65~ in 20 ml p r e h y b r i d i z a t i o n b u f f e r (5 x S S P E , 5 • D e n h a r d t ' s , 0.1% s o d i u m d o d e c y l s u l f a t e (SDS), 100 tzg/ml s a l m o n s p e r m D N A ) for 2 hr to o v e r n i g h t , in
16. Lanthanide Chelates and Multiple Labeling Strategies
385
Fig. 3--Transfer of biotinylated DNA markers from agarose to nitrocellulose and staining with SBMC. (A) Amount of DNA loaded on a 1% agarose gel was (in ng): 500(1); 250(2); 125(3); 62(4); 31(5); 16(6); 8(7); 4(8). (B) Amount of DNA loaded on a 0.7% agarose gel was 250 ng. (C) and (D) represent instrument scans (200 points) of A (250 ng lane) and B, respectively. The length of the fragments (kb) are 23.1 (1); 9.4 (b); 6.7 (c); 4.4 (d); 2.3 (e); 2.0 (f); 0.56 (g).
the hybridization chamber. Use 20 ml of the hybridization buffer (exactly as the prehybridization buffer but with 1 x Denhardt's) at 65~ overnight. 4. Biotinylate the probe, 200 ng of intact linearized pBR 328, with the random primer method following the instructions of the Primeit kit. Boil the biotinylated probe for 5 min before adding it to the hybridization buffer at a concentration of 10 ng/ml. 5. After hybridization, wash the membranes as follows: (a) three times with 200 ml each 2• SSC, 0.1% at RT. Soaking time is 5 min with vigorous shaking.
386
Eieftherios P. Diamandis and Theodore K. Christopoulos
(b) three times as above, but with 0.2x SSC, 0.1% SDS. (c) two times with 0.2x SSC, 0.1% SDS as 65~ 15 min each. 6. After blocking with 6% BSA, stain the membranes with the SBMC and wash exactly as described under detection of biotinylated nucleic acids. Some typical results are shown in Fig. 4. Sharp hybridization bands at the expected molecular weights are seen even with loadings of 5 ng total DNA.
D. Quantification of Polymerase Chain Reaction Products in Agarose Gels 1. Label the 5'-amino-containing primers with BCPDA (Chan et al., 1993): Prepare a 2 mg/ml solution of the primer in l0 mM borate buffer, pH 9.1. To this solution, add a 10-fold molar excess of a freshly prepared ethanolic solution of BCPDA and incubate for 2 hr at room temperature. Purify the labeled primer using a PDl0 disposable gel filtration column (Pharmacia) and a 0.1 M bicarbonate solution as the equilibration and elution buffer. Test the fractions by taking absorbance measurements at 260 and 325 nm (where BCPDA absorbs). 2. A typical polymerase chain reaction is carried out as follows: Pipet 90/xl buffer containing l0 mM Tris, pH 8.3, 50 mM KCI, 0.5/xg of each primer, 0.2 mM deoxynucleotides, and 2.5 U Taq DNA polymerase. Add 10/zl sample. Preheat the PCR mixture at 94~ for 6 min before adding the primers. The cycling is (1) denaturation for 1 min at 94~ (2) annealing at 55~ for 2 min, (3) extension for 2 min at 72~ Perform 30 cycles. 3. Load the PCR product (a volume between 1 and 25/zl) onto a 2% low melting point agarose gel. After electrophoresis, immerse the gel in a solution containing l0 -4 M EuCl3 in l0 -2 M HCI, for 30 min at room temperature. Wash the gel twice with distilled water and then scan with the time-resolved fluorometric scanner described earlier. Figure 5 shows the relationship between the peak fluorescence and the amount of the DNA template.
Fig. 4--(A) Hybridization experiments after Southern blotting, of various amounts of enzyme-digested (lanes 2-6) or undigested (lane l) linearized plasmid pBR 328 from 0.8% agarose gels. The probe was biotinylated linearized pBR 328 plasmid. The total amount of DNA (in ng) in lanes, was 160(1); 5(2); 10(3); 20(4); 40(5); 80(6). The length of each fragment is (in base pairs)4907 (a); 2176(b); 1766(c); 1230(d); 1033(e); 653(f); 517(g). (B) Time-resolved fluorometric scanning of lane 6 (700 points) indicating the seven bands. (C) as in (B) but for lane 1.
388
Eleftherios P. Diamandis and Theodore K. Christopoulos
10000
B
C
~, 1000 t~
.o v 0 c-
100. o :3
u_
10 0.001 0.01
0.1
1
10
100
Amount of Target Plasmid (ng)
Fig. 5--A 2% agarose gel, containing PCR products was stained with Eu 3+ and scanned with a time-resolved fluorometer. The fluorescence of each lane (peak height) was then plotted against the amount of the DNA template.
E. Other Applications The above DNA hybridization experiments are the first reported so far with use of the SBMC and BCPDA (Christopoulos and Diamandis, 1991; Chan et al., 1993). Preliminary experiments involving dot immunodetection on nitrocellulose of a variety of antigens (c~-fetoprotein, ferritin, carcinoembryonic antigen, growth hormone, mouse IgG) gave satisfactory results. It is anticipated that the principle of detecting biotinylated moieties with SBMC and time-resolved fluorometry will also find other applications involving the techniques of Western and Northern blots. Furthermore, the system is now under evaluation for applications involving PCR amplification and DNA sequencing, immunohistochemistry, and flow cytometry. In comparison to other isotopic and nonisotopic methodologies, the system described has the following advantages and disadvantages. Sensitivity is not so good as that of some other recent nonisotopic methodologies (Bronstein and McGrath, 1989; Pollard-Knight et al., 1990; see also Chapter 5 of this book) and currently, the detection of single-copy genes on Southern blots is not possible. Despite this limitation, the proposed nonisotopic method uses extremely stable reagents (SBMC is stable for over
16. Lanthanide Chelates and Multiple Labeling Strategies
389
1 yr), and does not need autoradiography or enzyme substrates. The signal on nitrocellulose is stable for months to years, and is visible on UV illuminators with the possibility of instant photography. With use of the high-resolution scanning time-resolved fluorometer, the system can quantify the fluorescent bands. Additionally, this system is more sensitive and has a much wider range of applications than other time-resolved fluorometric methods based o n E u 3+ labeling and extraction. Work is now in progress to improve the sensitivity of this system so that is can detect single-copy genes on Southern blots from 10/zg of total genomic DNA. REFERENCES Bronstein, I., and McGrath, P. (1989). Chemiluminescence lights up. Nature (London) 338, 599-600. Chan, A., Diamandis, E. P., and Krajden, M. (1993). Quantification of polymerase chain reaction products in agarose gels with a fluorescent europium chelate as label and timeresolved fluorescence spectroscopy. Anal. Chem. 65, 158-163. Christopoulos, T. K., and Diamandis, E. P. (1991). Quantification of nucleic acids on nitrocellulose membranes with time-resolved fluorometry. Nucleic Acids Res. 19, 6015-6019. Christopoulos, T. K., Lianidou, E. S., and Diamandis, E. P. (1990). Ultrasensitive timeresolved fluorescence and method for a-fetoprotein. Clin. Chem. 36, 1497-1502. Dahlen, P. (1987). Detection of biotinylated DNA probes by using Eu3+-labeled streptavidin and time-resolved fluorometry. Anal. Biochem. 164, 78-83. Davis, L. G., Dibner, M. D., and Battey, J. F. (1986). "Basic Methods in Molecular Biology." Elsevier, New York. Diamandis, E. P. (1990). Analytical methodology for immunoassays and DNA hybridization assays--Current status and selected systems--Critical review. Clin. Chim. 194, 19-50. Diamandis, E. P. (1988). Immunoassays with time-resolved fluorescence spectroscopy: Principles and applications. Clin. Biochem. 21, 139-150. Diamandis, E. P., and Christopoulos, T. K. (1990). Europium chelate labels in time-resolved fluorescence immunoassays and DNA hybridization assays. Anal. Chem. 62, 1149A-1157A. Diamandis, E. P., and Morton, R. C. (1988). Time-resolved fluorescence using a europium chelate of 4, 7-bis (chlorosulfophenyl)-l, 10 phenanthroline-2,9-dicarboxylic acid (BCPDA). Labeling procedures and applications in immunoassays. J. Immunol. Methods 112, 43-52. Diamandis, E. P., Morton, R. C., Reichstein, E., and Khosravi, M. J. (1989). Multiple fluorescence labeling with europium chelators. Application to time-resolved fluoroimmunoassays. Anal. Chem. 61, 48-53. Evangelista, R. A., Pollak, A., Allore, B., Templeton, E. F., Morton, R. C., and Diamandis, E. P. (1988). A new europium chelate for protein labeling and time-resolved fluorometric applications. Clin. Biochem. 21, 173-178. Hemmila, I., and Batsman, A. (1988). Time-resolved immunofluorometry of hCG. Clin. Chem. 34, 1163-1164. Morton, R. C., and Diamandis, E. P. (1990). Streptavidin-based macromolecular complex labeled with a europium chelator suitable for time-resolved fluorescence immunoassay applications. Anal. Chem. 62, 1841-1845.
390
Eleftherios P. Diamandis and Theodore K. Christopoulos
Ngo, T. T. (1988). "Nonisotopic Immunoassay." Plenum Press, New York. Oser, A., Callasius, M., and Valet, G. (1990). Multiple end labeling of oligonucleotides with terbium chelate-substituted psoralen for time-resolved fluorescence detection. Anal. Biochem. 191, 295-301. Oser, A., Roth, W. K., and Valet, G. (1988). Sensitive nonradioactive dot-blot hybridization using DNA probes labeled with chelate group-substituted psoralen and quantitative detection by europium ion fluorescence. Nucleic Acids Res. 16, 1181-1196. Pollard-Knight, D., Simmons, A. C., Schaap, A. P., Akhavan, H., and Brady, M. A. W. (1990). Nonradioactive DNA detection on Southern blots by enzymatically triggered chemiluminescence. Anal. Biochem. 185, 353-358. Soini, E., Hemmila, I., and Dahlen, P. (1990). Time-resolved fluorescence in biospecific assays. Ann. Biol. Clin. 48, 567-571. Soini, E., and Kojola, H. (1983). Time-resolved fluorometer for lanthanide chelatesma new generation of nonisotopic immunoassays. Clin. Chem. 29, 65-68. Soini, E., and Lovgren, T. (1987). Time-resolved fluorescence of lanthanide probes and applications in biotechnology. CRC Crit. Rev. Anal. Chem. 18, 105-154. Sund, C., Ylikoski, J., Hurskainen, P., and Kwaitkowski, M. (1988). Construction of europium (Eu 3§ oligo DNA hybridization probes. Nucleosides Nucleotides 7, 655-659. Syvanen, A. C., Tehen, P., Ranki, M., and Soderlund, H. (1986). Time-resolved fluorometry: A sensitive method to quantify DNA hybrids. Nucleic Acids Res. 14, 1017-1028.
Detection of Acridinium Esters by Chemiluminescence Norman C. Nelson Gen-Probe, Inc. San Diego, California 92121 Mark A. Reynolds and Lyle J. Arnold, Jr. Genta, Inc. San Diego, California 92121
I. Introduction A. Background B. Principle of the Method C. Advantages of the Method D. Limitations of the Method E. Applications of the Method II. Materials A. Reagents 1. 2. 3. 4.
Preparation of Acridinium Ester-Labeled DNA Probe (AE-Probe) Determination of Differential Hydrolysis Kinetics of AE-Probe AE-Probe Assays General
B. Instrumentation 1. Luminometer 2. DNA Synthesizer 3. High-Performance Liquid Chromatograph
III. Procedures A. Preparation of an Acridinium Ester-Labeled DNA Probe (AEProbe) B. Determination of the Differential Hydrolysis Kinetics of an AEProbe C. AE-Probe Assay Formats 1. General HPA Protocol 2. HPA Protocol for the Detection of Products from in Vitro Amplification Techniques 3. Differential Hydrolysis + Magnetic Separation Protocol
D. General Procedural Notes/Troubleshooting References
Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
391
392
NormanC. Nelsonet al.
I. INTRODUCTION A. Background Chemiluminescence--the generation of light via a chemical reaction--has gained widespread use as a detection mode over the last several years (Weeks et al., 1986; McCapra and Beheshti, 1985; Hastings, 1987). Advantages of chemiluminescent labels include high sensitivity; ease of use, handling, and disposal; precise control of detection (the reaction chemistry is typically very simple yet very specific); a wide range of detection methods (from photographic film to sophisticated instrumentation); and long shelf-lives. Chemiluminescence detection has been utilized in a variety of formats, including immunodiagnostics (Berry et al., 1988; Bronstein et al., 1989; Weeks et al., 1983b) and DNA probe-based assays (Arnold et al., 1989; Bronstein et al., 1990; Daly et al., 1991; Dhingra et al., 1991; Granato and Franz, 1989; Granato and Franz, 1990; Harper and Johnson, 1990; Heiter and Bourbeau 1993; Jonas et al., 1993; Lewis et al., 1990; Littig and Nieman, 1992; Ou et al., 1990; Sanchez-Pescador et al., 1988; Schaap et al., 1989; Stockman et al., 1993; Tenover et al., 1990; Urdea et al., 1988; Warren et al., 1992). Recently the acridinium ester (AE) depicted in Fig. 1 was developed for use as a chemiluminescent label in bioassays (Weeks et al., 1983a). The AE molecule reacts rapidly (typically 1 to 5 sec) with hydrogen peroxide under alkaline conditions (Fig. 2) to produce light at 430 nm (McCapra, 1970, 1973; McCapra and Perring, 1985). These rapid reaction kinetics permit detection over a very short time frame, thereby minimizing background noise and improving overall sensitivity. Detection in a standard luminometer (see Section II,B) exhibits a linear response over an AE concentration range of more than 4 orders of magnitude, with a detection limit of approximately 5 x 10 -19 mole (Arnold et al., 1989). Some other important reactions of the AE molecule are shown in Fig. 3. Hydroxide ion can catalyze the hydrolysis of the ester bond, rendering the AE permanently nonchemiluminescent. This property is utilized in an AE assay format, as described in Section I,B. Under the proper conditions hydroxide ion can also react with the carbon in the acridinium ring (C-9) that reacts with hydrogen peroxide (see Fig. 3), resulting in what is referred to as the carbinol or p s e u d o - b a s e form of the AE (Weeks et al., 1983a). This form is nonchemiluminescent since the hydroxide ion blocks reaction with peroxide. This inhibition can be easily reversed by incubation in acid, which rapidly reverts the hydroxic adduct, restoring the AE to its chemiluminescent form. Other nucleophiles can form adducts with the AE (Hammond et al., 1991), and they also block chemiluminescence in
17. Acridinium Esters/Chemiluminescence
393
a reversible manner. Adduct formation can also protect the AE against ester hydrolysis under certain conditions (Hammond et al., 1991). The AE reagent shown in Fig. 1 can be covalently attached to primary amine-containing compounds via specific reaction of the N-hydroxysuccinimide (NHS) ester of the AE with the primary amine of the compound. DNA probes can therefore be directly labeled with AE by first incorporating a primary amine into the DNA, then reacting this amine with the NHSAE (see Section III,A). Direct labels of this kind are simpler to use than indirect labels (those attached through an avidin/biotin interaction, for example), since the capping, binding of the label, washing, and substrate addition steps associated with indirect labels are unnecessary.
B. Principle of the Method First, a chemiluminescent AE is attached directly to a synthetic oligonucleotide probe complementary to the target nucleic acid. An AE-labeled probe (AE-probe) displays the same chemiluminescence characteristics
cM3 Methyl Acridinium Ring
o~~O -- Phenyl Ester
m
Propionate Linker-arm
I
N-hydroxysuccinimide ester
Fig. l m T h e structure of the N-hydroxysuccinimide ester of the N-methyl acridinium ester.
394
Norman C. Nelson et al.
(reaction kinetics, specific activity, and sensitivity of detection) as the free label, demonstrating that the detection properties of the label are not compromised by attachment to oligonucleotides. This is in part owing to the cleavage of the light-emitting species (namely, the acridinium ring) from the oligonucleotide during the chemiluminescence reaction (see Fig. 2), thus minimizing intramolecular quenching (Weeks et al., 1983a). Furthermore, an AE-probe displays hybridization characteristics (rate and extent of hybridization, thermal stability, and specificity) essentially equivalent to its 32p counterpart, demonstrating that attachment of the AE label also does not compromise hybridization performance of the probe.
i" 3
i ~3 H00-
~
~
I
Reaction
Kinetics
i
H
i
H
+ O Time of Reaction (Seconds)
+
CO 2
Fig. 2--The N-methyl acridinium ester reacts with the hydroperoxy anion (H00-) through the pathway shown above to produce light. The inset depicts the rapid kinetics of this reaction. The NHS phenyl ester (see Fig. 1) is represented as R.
17. Acridinium Esters/Chemiluminescence
395
The AE-probe can then be used in a variety of simple and rapid assay formats to directly detect target nucleic acid. All these formats utilize insolution hybridization, which offers significant advantages (see Section I,C) over the more common solid-phase hybridization techniques (Keller and Manak, 1989). Various methods of separating hybridized from unhybridized AE-probe after the in-solution hybridization step have also been developed. In one approach (Arnold et al., 1989), cationic submicronsized magnetic microspheres are used to specifically capture the hybridized AEprobe from solution. After the spheres are magnetically collected on the side of the tube, the solution, which contains unhybridized AE-probe, is removed, the spheres are washed, and the chemiluminescence associated with hybrid is detected. In another approach, discrimination between hybridized and unhybridized AE-probe is performed completely in-solution, thus eliminating the need for any physical separation steps. This method is based on chemical hydrolysis of the ester bond of the AE molecule, cleavage of which renders the AE permanently nonchemiluminescent (see Section I,A and Fig. 3). Conditions have been developed under which the hydrolysis of this ester bond is rapid for unhybridized AE-probe but slow for hybridized AEprobe. Therefore, after hybridization of the AE-probe with its target nucleic acid (under conditions that do not promote ester hydrolysis), the reaction conditions are adjusted so that the chemiluminescence associated with unhybridized AE-probe is rapidly reduced to low levels, whereas the chemiluminescence associated with hybridized AE-probe is minimally affected. Following this differential hydrolysis process, any remaining chemiluminescence is a direct measure of the amount of target nucleic acid present. An example of this differential hydrolysis process is shown in Fig. 4, which depicts the loss of chemiluminescence due to ester hydrolysis as a function of time. From linear regression analysis, hydrolysis half-lives were determined to be 50.5 and 0.72 min for hybridized and unhybridized AE-probe, respectively. The theoretical percentage of remaining chemiluminescent label after a given hydrolysis time can be calculated using the equation (0.5) n X
100 = percentage remaining chemiluminescence
(1)
where n is the ratio of elapsed time to the half-life of chemiluminescence loss (i.e., how many half-lives have transpired during a given incubation time). Using the half-life values given above, the calculated values for percentage remaining chemiluminescence after 15-min differential hydrolysis step would be 81% for hybridized probe and 0.00005% for unhybridized probe. This represents greater than a one million-fold discrimination between hybridized and unhybridized AE-probe, achieved in 15 min with
396
Norman C. Nelsonet al.
~I-I3
~H3 I
I
OR
/x
CH31§
i H3
0
No Light
+ c o2 +
Fill. 3raThe N-methyl acridinium ester (AE) reacts with hydroxide to form the reversible C-9 carbinol adduct (upper left) or to hydrolyze the ester bond, yielding the nonchemiluminescent acridinium carboxylic acid (lower left). Acridinium ester can also react with other nucleophiles (represented as X-) to form reversible adducts as the C-9 position (upper right). As shown in Fig. 2, reaction with alkaline peroxide produces light (lower right).
the addition of a single reagent and without any physical separation. In practical use, background levels of 0.00005% have not yet been achieved because the rate of AE hydrolysis plateaus before reaching these levels. Nevertheless, background levels of 0.002% have been achieved in a homogeneous format, which is still a significant signal-to-noise discrimination. A homogeneous assay format for the detection of target nucleic acids based on this differential hydrolysis process has been developed. This format, referred to as the hybridization protection assay, or H P A (Arnold et al., 1989; Nelson and Kacian, 1990; Nelson et al., 1990), consists of the following three basic steps (Fig. 5): 1. H y b r i d i z a t i o n . AE-probe is added to a solution containing the target nucleic acid, and the mixture is incubated. The length of time required
17. Acridinium Esters/ Chemiluminescence
(~)
397
O Hybrid
2.0
0
Control
A
N 1.0
E g o.o _o -1.0
100
50 TIME
(~ 0
150
(min)
2.5
rl All time points 9 1.4 mln time points 1.5
E 0.5
4).5 0
2
4
6
8
10
TIME (min) Q
Re uression Analysis Hybrid
y
Control y
=
-
1 . 9 7 5 6 - 5.9,551 e-3x
R2= 0 . 9 9 2
2.1072 - 0.41533x
R 2-- 1 . 0 0 0
Fig. 4---(A) Ester hydrolysis kinetics of hybridized and unhybridized acridinium esterlabeled DNA probe (AE-probe) are shown as loss of chemiluminescence versus time. (13) An expanded view of the hydrolysis curve for the unhybridized AE-probe. The hydrolysis rate begins to slow at between 4 and 5 min of incubation, and plateaus at about l0 min. Additionally, the rate of the hydrolysis between 0 and 1 min of incubation is variable since the contents of the tube are going from room temperature to 60~ during that interval. Therefore, the rate of hydrolysis is measured between 1 and 4 min of incubation, during which interval the hydrolysis rate is constant. (C) The equations generated from linear regression analyses for the hybridized and unhybridized AE-probe are given along with the R E values for each fit.
for this step is dependent on many factors, including temperature, buffer and salt conditions, kinetics of the particular probe used and concentration of the hybridizing nucleic acid strands. At 60~ hybridization times longer than 1 hr are uncommon, and times of 10 to 15 min are routine.
o
0~
_= e m
o m
0~
o m
omm
1
~ ~
Q~IZi(IIE[E[XLI
o-
.~ O-
+
1
0
m
0 0 .,-i
9
~
..-
o
o
o o
o
17. Acridinium Esters/Chemiluminescence
399
2. Differential hydrolysis. An alkaline differential hydrolysis buffer is added to the hybridization reaction, thereby effecting hydrolysis of AE associated with unhybridized probe. This step is very rapid (typically 6 to 12 min at 60~ 3. Detection. The assay tubes are placed directly into a luminometer, and chemiluminescence is measured automatically. This process takes only 5 to 10 sec per sample. The limit of sensitivity of the HPA format is approximately 6 x 10 -17 moles (Arnold et al., 1989), detection is quantitative and linear over a wide range of target nucleic acid concentrations, and the assay is rapid and easy to perform. In yet another approach, the differential hydrolysis process is combined with separation using cationic magnetic beads, thereby achieving even greater discrimination between hybridized and unhybridized AE-probe. In this format, backgrounds as low as 0.0002% are achieved, and assay sensitivity is approximately 6 • 10-18 moles (Arnold et al., 1989). This format is also very rapid and easy to perform because of the simplicity of the magnetic separation step. Some properties of the AE detection system (both the unconjugated AE and the AE-probe assay formats) are listed in Table I.
C. Advantages of the Method There are several advantages to using the chemiluminescent AE as a detection label, including high inherent sensitivity, low quenching, simplicity, ease of handling and disposal, precise chemical control, and a long shelf-life. Furthermore, these properties are not adversely affected by attachment of the AE to oligonucleotide probes, nor are the hybridization characteristics of the oligonucleotide probe compromised. There are also
Table ! Selected Properties of the Acridinium-Ester Detection System
AE-probe assay formats Parameter
AE alone
HPA
DH + separation
Sensitivity Quantitation Specific activity Linear dynamic range Time to result
5 • 10 -19 moles Objective 1 • 108 RLU/pmol - 104 2-5 sec
6 • 10 -17 moles Objective 1 • 108 RLU/pmol 104 20-75 min
6 • 10 -18 moles Objective 1 • 108 RLU/pmol ---104 50-110 min
,,
400
NormanC. Nelsonet al.
several advantages to the AE-probe assay formats presented here, including the following: 1. In-solution approach. Advantages of the in-solution approach include availability of all the target molecules (in target immobilization procedures, only a portion of the molecules are available for hybridization), faster hybridization kinetics, better quantitation, fewer steps and less complexity, and faster time-to-result. 2. Sensitivity. The assays are sensitive. This is in part owing to the high specific activity and inherent low background characteristics of the detection system as well as the low background levels achieved with the assay formats described. 3. Specificity. The assays retain the high specificity inherent in DNA probe-based formats. Furthermore, the differential hydrolysis assays described here afford an additional level of specificity not possible with other assay/detection systems. This is because the stability of the AE label in the hybridized form of the AE probe is very sensitive to duplex structure. Even small perturbations in structure, such as those caused by single base mismatches, can lead to large increases in the AE hydrolysis rate. Therefore, differential hydrolysis characteristics can be used to discriminate between nucleic acids with only small sequence differences (even a single base change), even when overall hybridization characteristics cannot. An example of this has been described previously (Arnold et al., 1989; Nelson et al., 1990); two nucleic acid targets that differed by only a single base were assayed using a single AE-probe perfectly complementary to one of the targets. Using a standard solid-phase separation method, no significant difference in hybridization was seen between the two targets. However, the differential hydrolysis method in an HPA format clearly discriminated between the two targets. 4. Simplicity. The assays are very easy to perform (there are only three basic steps; see Section I,B) and the time-to-result is very short. Assays utilizing the HPA format are typically complete in 30 to 60 min, of which only abot, t 5 min is hands-on time. Also, the entire assay is performed in a single tube, which is simply placed in an automatic luminometer for detection. Furthermore, direct labels are simpler to use than indirect labels since the capping, binding of the label, washing, and substrate addition steps associated with indirect labels are unnecessary. 5. Quantitation. The assays are quantitative with a linear response over several orders of magnitude of target concentration (the limit of the linearity is typically the luminometer and not the assay itself). 6. Precision. The assay is reliable and reproducible. 7. Versatility. The assay can be used for the detection of both DNA and RNA targets. Several of the formats developed to date target ribo-
17. Acridinium Esters/Chemiluminescence
401
somal RNA (rRNA), which provides the further benefits of natural target amplification (there are approximately 10,000 rRNA copies per bacterial cell) and improved specificity (Enns, 1988; Kohne, 1986; Woese, 1987). 8. Clinical compatibility. The AE-probe retains its chemiluminescence and hybridization characteristics in the presence of relatively large amounts of clinical specimen material, a feature that allows the methods described here to be utilized for direct specimen testing in clinical diagnostic assays.
D. Limitations of the Method Limitations of the AE-probe system that should be kept in mind when considering potential applications are as follows: 1. The ester bond of the AE is inherently unstable (this property is the basis for the differential hydrolysis process), and therefore AE-probes can be used only within certain pH and temperature ranges. For example, the AE will not withstand incubation at 95~ and therefore cannot be incorporated during polymerase chain reaction (PCR) amplification (although it can be readily used for the detection of the products from in vitro amplification procedures; see Sections I, E and Ill,C). Also, AEprobes cannot be run under standard polyacrylamide gel electrophoresis conditions (although other types or conditions of electrophoresis are feasible). 2. The AE will react with alkaline peroxide to produce light only once. Therefore, samples cannot be re-read for chemiluminescence. 3. Some target nucleic acid samples may contain inherent chemiluminescence. If these levels are high enough, sensitivity of the HPA format will be decreased owing to increased background. In these cases additional steps to eliminate the sample chemiluminescence are necessary.
E. Applications of the Method The AE-probe method can be used for the in-solution detection of virtually any target nucleic acid, provided the target possesses a hybridizable probe region (the sequence must be known) and is available in sufficient quantity to be within the sensitivity range of the assay. One of the earliest reported uses of this method (Arnold et al., 1989) was the detection and quantitation of purified ribosomal RNA (rRNA). More recently, applications ranging from single mismatch discrimination (Nelson et al., 1990) and detection
402
Norman C. Nelson et al.
of amplified human immunodeficiency virus (HIV) DNA (Ou et al., 1990) to the detection of nucleic acids from clinically relevant pathogens (see the following) have been reported. Potential applications include the detection and identification of a wide variety of pathogens and other microorganisms in medicine, dentistry and veterinary; forensic science; therapeutic drug monitoring; genetic screening (including disease susceptibility) and typing; food science; the petroleum industry; and environmental testing; as well as a wide spectrum of basic research applications involving nucleic acids. A particularly useful application of the HPA format is the detection of products from target amplification reactions such as the PCR (Mullis and Faloona, 1987; Nelson and McDonough, 1994), and the transcription amplification system, or TAS (Kwoh et al., 1989). The HPA format retains the distinct advantage of specific probe hybridization to unequivocally identify the amplified sequence. Methods that assay simply for extension of primers, such as gel electrophoresis followed by ethidium bromide staining, are equivocal since nontarget species of similar size can be produced with some frequency (Innis and Gelfand, 1990). Detection of HIV DNA (Kacian et al., 1990; McDonough et al., 1989; Ou et al., 1990), the Philadelphia chromosome (Arnold et al., 1989; Dhingra et al., 1991), hepatitis B virus (HBV) DNA (Kacian et al., 1990), the genes that code for the rRNA of Neisseria gonorrhoeae (Gregg et al., 1990) and Chlamydia trachomatis (Kranig-Brown et al., 1990), and Mycobacteriurn tuberculosis RNA (Jonas et al., 1993) using this procedure have been reported. Test kits utilizing this detection approach are commercially available (GenProbe, San Diego). Another useful application of the AE-probe system is the detection and identification of pathogenic organisms in the clinical laboratory. Diagnostic assays for a variety of organisms have been reported, including test for Chlamydia trachomatis (Harper and Johnson, 1990; LeBar et al., 1987; Warren et al., 1993; Woods et al., 1990; Yang et al., 1991), Neisseria gonorrhoeae (Hale et al., 1993; Lewis et al., 1990; Granato and Franz, 1989; Granato and Franz, 1990; Harper and Johnson, 1990; Vlaspolder et al., 1993), Mycobacterium tuberculosis (Jonas et al., 1993), Escherichia coli (Davis and Fuller, 1991; Watson et al., 1990), Streptococcus agalactiae, Haemophilus influenzae, Enterococcus species (Daly et al., 1991), Streptococcus pneumonia (Denys and Carey, 1992), Streptococcus pharyngitis (Heiter and Bourbeau, 1993), Histoplasma capsulatum (Stockman et al., 1993; Sandin et al., 1993) and Campylobacter species (PopovicUroic et al., 1991; Tenover et al., 1990). Kits for the detection of a variety of pathogenic organisms both directly in clinical specimen material and as culture confirmation assays are commercially available (Gen-Probe, San Diego).
17. Acridinium Esters/Chemiluminescence
403
II. MATERIALS A. R e a g e n t s 1. Preparation of Acridinium Ester-Labeled DNA Probe (AE-Probe) The N-hydroxysuccinimide (NHS) ester of AE is synthesized as described by Weeks and co-workers (Weeks et al., 1983a). The dimethylsulfoxide (DMSO) used in the preparation of the stock solution of the AE used in the labeling reaction must be completely free of water (otherwise the NHS ester will be hydrolyzed, rendering the labeling reagent inactive). Therefore, DMSO is purchased as reagent grade (Aldrich, Wisconsin), distilled and stored over molecular sieves (activated, Type4A, 8-12 mesh; J. T. Baker). There is also DMSO added to the labeling reaction mixture in addition to that added as the AE labeling reagent (see Section Ill,A). This DMSO does not have to be perfectly dry, since it is mixed with water. Therefore, for this particular use, reagent grade DMSO (Aldrich) is adequate (although it certainly does not hurt if the dry DMSO is used). Ethanol used in nucleic acid precipitations is 200 proof from Quantum Chemical Corporation. For small quantities of DNA (less than about 10 /zg), a carrier should be used in the ethanol precipitation steps to maximize recovery. Glycogen (Sigma) is used as the carrier in the procedures given here. High-pressure liquid chromatography (HPLC) buffer compositions are as follows: Buffer A, 20 mM sodium acetate (pH 5.5), 20% (v/v) acetonitrile; Buffer B, 20 mM sodium acetate (pH 5.5), 20% (v/v) acetonitrile, 1M LiC1; all reagents used in the preparation of these buffers must be HPLC grade (Fisher Scientific or equivalent). After preparation, both of these buffers must be filtered through a 0.45/zm Nylon-66 filter (Rainin); a vacuum filtration apparatus designed for this purpose is useful (also available from Rainin). The column used is a Nucleogen-DEAE 60-7 ionexchange column (also available from Rainin). See Section II,B below for a discussion of HPLC instrumentation. For all other chemicals, reagent grade is adequate (Fisher Scientific or equivalent).
2. Determination of Differential Hydrolysis Kinetics of AE-Probe Lithium succinate, ethylenediaminetetraacetic acid (EDTA), ethylene glycol bis(~-aminoethyl ether) N,N'-tetraacetic acid (EGTA), sodium tetraborate (or boric acid), lithium lauryl sulfate and Triton X-100 are reagent grade (Fisher Scientific or equivalent). The borate buffer may be made
404
NormanC. Nelsonet al.
as 0.15 M tetraborate or 0.6 M boric acid (titrated to the correct pH with NaOH). The solubility of sodium tetraborate is approximately 0.2 M at pH 8. Hybridizations are performed in 1.5-ml screw-capped microcentrifuge tubes (Eppendorf); AE hydrolysis and chemiluminescence measurements are performed in 12 x 75 mm polystyrene tubes (Sarstedt, West Germany).
3. AE-Probe Assays The formamide used in the differential hydrolysis + separation protocol is from Fluka; the magnetic microspheres are from Advanced Magnetics, Inc. (Cambridge, Massachusetts). The magnetic separation solution is made by adding a small volume of a concentrated stock solution of magnetic microspheres in water to 0.4 M phosphate buffer, pH 6.0 (1 to 50/zl of magnetic spheres per ml of buffer is used, depending on the amount of spheres required for a given application); this solution must be used within 8 hr of preparation. Reagents used in these assays that are also used in the determination of the differential hydrolysis kinetics are described in Section II,A,2; all other reagents used are reagent grade (Fisher Scientific or equivalent). The magnetic particles can be separated from solution with virtually any magnet of adequate strength. Racks that hold the 12 x 75 mm assay tubes and that have built-in magnets are particularly convenient. Racks that are compatible with the assays described here are commercially available (Coming; Gen-Probe).
4. General Chemiluminescence measurements are performed in 12 x 75 mm polystyrene tubes (Sarstedt, West Germany). Some lots of tubes possess chemiluminescent contamination; several empty tubes of each lot should therefore be read in the luminometer. Tubes should always be blotted with a mildly damp tissue or paper towel before chemiluminescence measurement to remove any static charge from the tubes (this charge can lead to errantly high readings). The tissue or towel should not be t o o wet, as this can potentially damage the interior of the luminometer. Blotting before reading will also remove any contamination that may be present on the outside of the tube, thus protecting the luminometer from contamination and/or damage. The reagents required for the chemiluminescence reaction of AE are base and peroxide. Reagent grade NaOH and hydrogen peroxide (supplied as a 30% solution; Fisher Scientific) are used for this purpose. Typically, an automatic two-injection protocol is used on the luminometer to inject these reagents (see Section II,B), the first injection containing 0.1% perox-
17. Acridinium Esters/Chemiluminescence
405
ide and the second injection containing 1 M NaOH. Hydrogen peroxide is very stable at acidic pH and unstable at basic pH. Therefore if the 0.1% peroxide solution is acidified (1 mM nitric acid), it will be stable at room temperature for weeks to months. In some assay modes, the peroxide solution contains a higher concentration of acid (e.g., 0.4 M nitric acid) in order to reverse carbinol formation of the AE (see Section Ill,B). This solution is also stable over extended periods. On occasion, the peroxide and the base are mixed and injected as a single reagent. The peroxide is stable in this basic reagent for only about 10 hr at room temperature; this reagent must therefore be prepared fresh daily. Standard pipettors (Gilson Pipetman) are used in these protocols; standard vortex mixers are purchased from Fisher Scientific; samples are evaporated in a Savant Speed-Vac rotary/vacuum drying apparatus.
B. Instrumentation 1. Luminometer The reaction of the AE with alkaline peroxide to produce chemiluminescence is very rapid (see Section I,A and Fig. 2). Therefore a luminometer that automatically injects the alkaline peroxide into the sample and immediately measures the chemiluminescence is required for accurate detection of the AE described here. Furthermore, the assay protocols described here are based on a 12 x 75 mm reaction tube, and the luminometer selected must therefore be able to accommodate such tubes. Luminometers that fulfill both these requirements are commercially available from Gen-Probe, Berthold (Germany), and Turner. A luminometer that is capable of automatically injecting the alkaline peroxide but is based on a microtiter well format is available from Dynatech. All procedures described here were developed using a LEADER I or a LEADER 50 luminometer (Gen-Probe).
2. DNA Synthesizer Any DNA synthesizer capable of standard phosphoramidite solid-phase chemistry is appropriate for synthesis of the DNA probes. All procedures described here were developed using a Biosearch Model 8750 or an ABI Model 380A synthesizer.
3. High-Performance Liquid Chromatograph Any of a number of instruments currently available would be appropriate for the chromatography described herein. The instrument must be capable
406
NormanC. Nelsonet al.
of performing automatic gradient elution and must be equipped with a detector capable of measurement at 260 nm; a dual-wavelength detector capable of measurement at 260 and 325 nm is preferable. The chromatography described here was performed on a Beckman System Gold HPLC.
III. PROCEDURES A. Preparation of an Acridinium EsterLabeled DNA Probe (AE-Probe) An oligomer of virtually any sequence can be labeled, and selection of this sequence is obviously dependent on the target nucleic acid to be detected. The oligonucleotide is synthesized using standard phosphoramidite solid-phase chemistry (Caruthers et al., 1987) on a commercially available automated DNA synthesizer. A primary amine is introduced into the oligomer during synthesis using the nonnucleotide-based linkerarm chemistry described previously (Arnold et al., 1988). This chemistry allows incorporation of the linker-arm at any position in the growing oligonucleotide chain, including the 3' terminus, the 5' terminus, or at any position within the oligonucleotide sequence. The resulting primary amine-containing oligomer is purified using standard polyacrylamide gel electrophoresis and desalting techniques (water is the final solvent). Labeling of this oligomer with AE-NHS proceeds as follows:
1. Evaporate to dryness the oligomer to be labeled in a 1.5-ml screwcapped microcentrifuge tube using a Savant Speed-Vac drying apparatus. 2. After drying, add to the tube 8/~l of 0.125 M HEPES buffer (pH 8.0)/50% DMSO and 2/xl of 25 mM AE-NHS in DMSO. Cap the tube, gently mix the contents, and then incubate for 20 min at 37~ 3. Add an additional 3/zl 25 mM AE-NHS in DMSO, mix gently, then add 2/zl 0.1 M HEPES buffer (pH 8.0). Recap, mix gently, and then incubate an additional 20 min at 37~ 4. Quench the reaction by adding 5 /xl 0.125 M lysine in 0.1 M HEPES buffer (pH 8.0)/50% DMSO. Mix gently. 5. Add 30/xl M sodium acetate buffer (pH 5.0), 245/zl water, and 5 /zl glycogen (40 mg/ml); vortex to mix. Add 640 /xl chilled (-20~ absolute ethanol; cap tube, and vortex to mix. Incubate on dry ice for 5 to 10 min, then centrifuge at 15,000 rpm using
17. Acridinium Esters/Chemiluminescence
the standard head in a refrigerated microcentrifuge (Tomy or Eppendorf). 6. Carefully aspirate the supernatant, making sure not to disturb the pellet. Resuspend the pellet in 20 ~1 0.1 M sodium acetate (pH 5.0) containing 0.1% SDS. The labeled oligomer (AE-probe) is then purified by gradient elution ion-exchange high-performance liquid chromatography (IEHPLC) using a 4.0 • 125 mm Nucleogen-DEAE 60-7 column as follows: 1. Pre-equilibrate the IE column in 60% Buffer A, 40% Buffer B at a flow rate of 1 ml/min. 2. To the 20 /zl resuspended AE-probe pellet from step 6 of the labeling reaction, add 190/xl of the pre-equilibration buffer (i.e., 60% Buffer A, 40% Buffer B). Vortex to mix. 3. Load 100/zl of the AE-probe sample into a 100-/xl injection loop. 4. Inject the AE-probe onto the IE column equilibrated as described in step 1. Elute the AE-probe using a linear gradient from 40 to 70% Buffer B in 30 min at a flow rate of 1 ml/min; monitor absorbance at 260 nm as well as 325 nm (if possible); collect 0.5-ml fractions. 5. If absorbance at 325 nm is not monitored, or the amount of AEprobe being purified is too small to give a discernable absorbance at this wavelength, measure the chemiluminescence of each fraction as follows: Pipette 2 tzl of each fraction into corresponding 12 • 75 mm polystyrene tubes containing 100/xl 0.1% SDS; vortex to mix. Measure the chemiluminescence of each tube with the automatic injection of 200 txl 0.4 M HNO3, 0.1% H20 2, then 200 /zl 1 M NaOH, followed by measurement of signal for 5 sec. Plot chemiluminescence (measured as relative light units, or RLU) versus fraction number. The fractions may need to be diluted if the chemiluminescence contained in 2/zl is too high for the luminometer to measure. If so, dilute in 0.1% sodium dodecyl sulfate (SDS) and vortex thoroughly to ensure a homogeneous sample. 6. Precipitate fractions containing the purified oligomer (see Fig. 6) as follows: Add 5/xl glycogen (40 mg/ml) and 1 ml chilled (-20~ absolute ethanol; cap the tube, and vortex to mix. Incubate on dry ice for 5 to 10 min, then centrifuge at 15,000 rpm using the standard head in a refrigerated microcentrifuge (Tomy or Eppendorf). 7. Carefully aspirate the supernatant, making sure not to disturb the pellet. Resuspend the pellet in 20 /zl 0.1 M sodium acetate (pH 5.0) containing 0.1% SDS.
407
408
Norman C. Nelson et al. b
o t,q
a t_ o t~ ,O
!
0
15
30
Time (rain)
Fill. 6---A DNA probe was labeled with acridinium ester (AE) and purified by ion-exchange HPLC, as described in the text. The resulting chromatogram is shown. Peak a represents unlabeled probe" peak b represents AE-labeled probe" and peak c represents AE-probe that has undergone ester hydrolysis (see Fig. 3).
Purification of an AE-labeled 26-mer is shown in Fig. 6. The specific activity of the AE-labeled probe is determined as follows" 1. Perform serial dilutions of the AE-probe stock in 0.1 M sodium acetate (pH 5.0) containing 0.1% SDS; the final measurement of chemiluminescence should be in the 50,000 to 250,000 RLU range. 2. Pipet 10/zl of the final dilution of AE-probe into 200/zl 5% Triton X-100 (3 to 5 replicates is recommended). Measure the chemiluminescence of each tube with the automatic injection of 200 /zl 0.4 M HNO3, 0.1% H202, then 200/xl of 1 M NaOH, followed by measurement of signal for 5 sec. Based on the dilution factor from (1), calculate the RLU//zl of the stock AE-probe. 3. Measure the absorbance at 260 nm of AE-probe in 0.1 M sodium acetate (pH 5.0) containing 0.1% SDS; the final measurement should be in the 0.2 to 1.0 optical density (OD) range (depending on the amount of probe labeled, dilutions may or may not be necessary to achieve this concentration). 4. Calculate the concentration of DNA probe in the stock solution. Since the AE as well as the oligomer contributes to the OD at 260 nm, first calculate the contribution of the oligomer to the OD reading. The extinction coefficient of the oligomer is roughly 10,000 M -1 times the number of nucleotides in the oligomer (the
17. AcridiniumEsters/Chemiluminescence
409
exact extinction coefficients for each base can be used if desired). The extinction coefficient of the AE is 78,800 M -~. The total extinction coefficient of a 20-mer, for example would be [10,000 M -~ x 20] + 78,800 M -~ = 278,800M -1 The contribution from the oligomer will therefore be 200,000 M-1/278,800 M -1 = 71.7% For an AE-labeled 20-mer, the OD reading will have to be multiplied by .717 to calculate the OD reading of the oligomer. To calculate the concentration of the oligomer from the OD, the following two conversions must be used" 1 0 D unit x 40/xg of DNA (approximate value; other values may be used if preferred), and molecular weight of an oligomer = 330 g/mol nucleotide x the number of nucleotides For example, if the OD/ml reading of the AE-labeled 20-mer is 1.0, the concentration is calculated as follows" MW of oligo = 330/xg//xmol nucleotide x 20 nucleotides = 6600/xg//xmol (2) 1 0 D / m l x .717 = 0.717 OD/ml (contribution from the oligomer
(3)
0.717 OD/ml x 40/zg/OD = 28.68/~g/ml
(4)
28.68/xg/ml x 1/xmol/6600/zg = 4.35 nmol/ml = 4.35 pmol//xl
(5)
[Note: this value will have to be multiplied by the dilution factor if any dilutions of the stock AE-probe were made.] 5. Determine the specific activity based on the results of 1 through 4 above" (RLU//xl)(pmol//xl) = specific activity in RLU/pmol
(6)
Specific activities of AE-labeled probes are typically in the range of 0.5 to 1.0 x 108 RLU/pmol.
Procedural Notes~Troubleshooting 1. Oligomers as long as 40 bases can be purified using the IE-HPLC protocol given. For oligomers longer than 40 bases, alternative ionexchange columns can be utilized (data not shown). Also, reverse-phase
410
Norman C. Nelson et al.
chromatography is an excellent alternative for the purification of AElabeled oligomers of a wide variety of sizes (Arnold and Nelson, 1993). 2. HPLC resolution can be somewhat improved by extending the duration of the gradient. Additionally, the initial buffer conditions should be slightly adjusted for different length oligomers to optimize elution time--a lower percentage Buffer B for shorter oligomers and a higher percentage B for longer oligomers. The exact conditions can be determined empirically. 3. Absorbance at 325 nm is used to monitor the AE without any interference from the DNA. 4. Various amounts of oligomer can be labeled using this protocol. Approximately 10 nmol can be labeled using the volumes described above; proportionally larger amounts of oligomer can be labeled using proportionally larger amounts of each reagent (the limiting factor is solubility of the AE-probe). 5. An acceptable alternative to the labeling protocol described above is as follows: to the dried oligomer, add 15/zl of a mixture containing 0.1 M HEPES buffer (pH 8.0), 60% DMSO, and 5 mM AE; mix gently; incubate 90 min at 30~ 6. Be extremely careful when using the stock solution of AE not to contaminate your buffers, pipettors, workspace, etc. (a 1/zl aliquot of the 25 mM stock contains approximately 10~1 RLU of chemiluminescence). 7. After precipitation of the AE-probe, be careful to remove as much of the ethanol as possible. However,avoid drying in the Speed-Vac (or other similar drying device) as this can lead to breakdown of the AE on the oligomer. 8. If labeling efficiency is poor, the AE-NHS may be hydrolyzed (this reagent is very water sensitive, and once it is broken down, it will no longer react with the primary amine or the oligomer). Prepare a fresh stock of the AE-NHS in freshly distilled DMSO and repeat the procedure. 9. If peak " c " in the HPLC chromatogram (hydrolyzed AE-probe; see Fig. 6) is large, the pH of the reaction mixture may be incorrect. Measure the pH of the existing HEPES buffer as well as a mock reaction cocktail, and/or prepare fresh buffer and repeat the procedure. 10. If the labeling reaction did not proceed to a high extent (peak " a " high and peaks " b " and " c " low; see Fig. 6), the pH of the reaction mixture may be incorrect. Measure the pH of the existing HEPES buffer as well as a mock reaction cocktail, and/or prepare fresh buffer and repeat the procedure. Alternatively, the NHS ester of the AE labeling reagent may be hydrolyzed, in which case the labeling procedure should be repeated using a freshly prepared stock AE-NHS. 11. Mixing HEPES and DMSO produces heat; therefore, these reagents should be pre-mixed and allowed to cool before adding the AE-NHS labeling reagent.
17. Acridinium Esters/Chemiluminescence
411
12. See Section III,D, Procedural Notes/Troubleshooting, General, for tips that are applicable to all AE-based procedures.
B. Determination of the Differential Hydrolysis Kinetics of an AE-Probe Once an oligomer is labeled and purified, the AE hydrolysis kinetics of the hybridized and unhybridized oligomer are measured during the protocol given. These data are then utilized to evaluate the differential hydrolysis performance characteristics of an AE-probe and to determine optimal hydrolysis times to be used in an assay.
1. In 1.5-ml microcentrifuge tubes, prepare three 30 /xl reaction mixtures to contain the following: Hybrid--0.1 M lithium succinate buffer, pH 5.2, 2 mM EDTA, 2 mM (EGTA), 10% (w/v) lithium lauryl sulfate, 0.1 pmol AE-probe, and 0.5-1.0 pmol of the target nucleic acid (i.e., nucleic acid complementary to the AE-probe); Control (i.e., unhybridized AE-probe)--same as Hybrid, except containing no target nucleic acid; Blankmsame as Control except containing no AE-probe. Incubate all three reactions in a water bath 30 min at 60~ 2. Remove reactions from water bath, add 270 /xl 0.1 M lithium succinate buffer, pH 5.2, 2 mM EGTA, 10% (w/v) lithium lauryl sulfate to each, and vortex thoroughly. 3. To measure the AE hydrolysis rate for hybridized AE-probe, pipette 10-/zl aliquots of the diluted Hybrid reaction into each of seven 12 • 75 mm assay tubes. Add 100/zl 0.15 M sodium tetraborate buffer, pH 7.6, 5% (v/v) Triton X-100 to each tube, and vortex each 3 sec. Measure the chemiluminescence of two of the replicate tubes immediately (see detection protocol in step 5); these will be the t i m e z e r o values. Cover the remaining five replicates and place them in a water bath at 60~ remove a single tube at 5, 10, 15, 20, and 30 min. Immediately after removal from the water bath, place each tube in an ice/water slurry for 15 sec, remove to room temperature and let stand for 30 sec, then measure the chemiluminescence as described in step 5. 4. To measure the AE hydroloysis rate for unhybridized AE-probe, the protocol in step 3 is repeated with the Control reaction from step 1, with the exception that tubes are removed from the water bath at l, 2, 3, 4, and 5 min. The Blank reaction is also an-
412
NormanC. Nelsonet al.
.
~
alyzed in this manner (to be run concurrently with the Control analysis). Detect chemiluminescence in a luminometer by the automatic injection of 200/xl 0.4 M HNO3, 0.1% H20 2, then 200/zl of 1 M NaOH, followed by measurement of signal for 5 sec. Remember to blot the tubes with a moist tissue or paper towel before measuring the chemiluminescence (see Section II,A,4). Analyze the data as follows: First, subtract the average Blank value from each Hybrid and Control value. Then plot the data for Hybrid and Control as the log of the percentage of time zero chemiluminescence versus time. Finally, determine the slopes of the linear portions of the hydrolysis curves (and therefore the rates of AE hydrolysis), using standard linear regression analysis.
An example of the data generated using this protocol is given in Fig. 4. From the slope of the line the haft-life of hydrolysis can be calculated (half-life in min = 0.3 log units per half-life divided by the slope in log units per min), and the ratio of the hybrid to control half-lives determined. This differential hydrolysis ratio (or DH ratio) is a useful parameter for describing AE-probe performance. Obviously the higher the DH ratio, the higher the discriminating power achieved in an HPA format. Procedural N o t e s / T r o u b l e s h o o t i n g
1. Acid reversion is used in this protocol to revert any pseudo-base that formed during the DH step. If acid reversion is not used, the protocol becomes a measurement of the c o m b i n e d rates of ester hydrolysis and pseudo-base formation. 2. In one variation of the method for determining AE hydrolysis rate, the acid hydrolysis is achieved via the manual addition of an acid/peroxide solution to the reaction mixture prior to placement in the luminometer for chemiluminescence measurement. This stops the hydrolysis reaction at any given time, and circumvents the need to place the samples on ice. The procedure is run essentially as described earlier, with the following modifications" For the time zero samples, after addition of the sample (hybrid, control, or blank), 200/zl 0.4 M HNOs, 0.1% H202 is added to the tubes, followed by addition of 100/zl sodium tetraborate buffer. The chemiluminescence is measured in the luminometer by the automatic injection of 200/xl 1 M NaOH, followed by a 5-sec read. For the hydrolysis time points, after addition of the sample (hybrid, control, or blank), 100/zl sodium tetrabolate buffer is added, the tubes are placed in the water bath at 60~ and then at various time points 200/xl 0.4 M HNO3, 0.1 cribH202is added and the chemiluminescence is measured, as described.
17. Acridinium Esters/Chemiluminescence
413
The tubes can be read immediately, or they can sit for hours or even days, since the AE is stable in the acid. 3. Since hydrolysis rate is temperature sensitive, it is very important that the temperature used in this procedure be accurately maintained during the hydrolysis time course. It is also very important that the temperature be very consistent from tube to tube. For these reasons a circulating water bath is recommended for this procedure. 4. It is'very important that half-lives of hydrolysis be calculated from the linear portions of the kinetic curves. Small differences in slope can lead to relatively large differences in half-lives and DH ratios. Values for R z in the regression analysis of 0.98 or greater are recommended. Errant values for half-life of hydrolysis are particularly likely in the Control since hydrolysis rates are much faster in this case. More data points in the early portion of the curve are useful in improving accuracy. In the first 15 to 30 sec, the contents of the tubes are coming to temperature, and therefore data points at 30 sec and beyond are typically more significant. 5. The Blank reaction is necessary to factor out chemiluminescence inherent in the reagents. This is especially important for the later time points of the Control sample. The lower of this amount of chemiluminescence, the more accurate the analysis; therefore, care in preparing reagents without introducing contaminating chemiluminescence is very important. 6. Hydrolysis-rate analysis is used to determine optimal differential hydrolysis time in a full assay format. This is described in Section III,C under Procedural Notes/Troubleshooting for general HPA protocol. 7. For the Hybrid sample, the y-intercept of the line determined using regression analysis represents the percentage hybridization of the AEprobe being tested. In most cases the extent of hybridization will be approximately 100% (the reaction is performed in target excess), and the y-intercept will be 2 (i.e., the log of 100%). In some cases, however, the extent will not be 100%. In these cases the hydrolysis curve will be biphasic~an initial rapid phase representing hydrolysis of the unhybridized AE-probe, and a second, slow phase representing the hydrolysis of the remaining hybridized AE-probe. Back extrapolation of the slow phase to the y axis is then used to determine the percentage of AE-probe that is hybridized. 8. The DH characteristics of an AE-probe can also be determined at different pH values using basically the same protocol given. However, hydrolysis rates will be faster at higher pH and slower at lower pH, and the time points must be chosen accordingly. It is difficult to measure accurately ester hydrolysis rates at 60~ for unhybridized AE probes at pH higher than about 8.5 since hydrolysis is so rapid at these pH values. Preheating the hydrolysis buffer and using very short intervals between time points helps the accuracy of the analysis in these cases.
414
Norman C. Nelson et al.
9. If the data points to use for the regression analysis are unclear, or if the R 2 value is less than 0.98, the analysis should be repeated. 10. If necessary or desired, more data points can be collected than recommended. 11. A small square of standard laboratory label tape (Time tape, VWR Scientific) pressed snugly onto the assay tubes is an ideal covering during incubation at 60~ 12. See Section Ill,D, Procedural Notes/Troubleshooting, General, for tips that are applicable to all AE-based procedures.
C. AE-Probe Assay Formats The Hybridization Protection Assay can be formatted in a number of ways depending on the exact application. However, each format contains the same three basic steps: hybridization, differential hydrolysis, and detection. There are also quite a large number of ways a sample can be prepared for assay depending on the type of sample and the form and concentration of the target nucleic acid(s). If rRNA is to be assayed from a clinical specimen suspected of containing an infectious microorganism, the organism must be lysed and free rRNA released into solution. If PCR-amplified DNA is to be assayed, the sample must first be denatured since the product of the reaction is double-stranded. If single-stranded nucleic acid is to be quantified after a purification procedure, a sample need simply be pipetted into the assay tube. It is beyond the scope of this chapter to describe all the possible methods by which a sample of nucleic acid can be prepared for assay using the HPA protocol. The general requirement is that the target be available for hybridization in solution at a concentration within the sensitivity limit of the assay. Furthermore, it is preferred that the target nucleic acid be contained in a relatively small volume so the components in the sample mixture will not contribute significantly to the final hybridization conditions.
1. General H P A Protocol
1. Hybridization. In a 12 x 75 mm assay tube, prepare a 100 /zl hybridization reaction containing 0.1 M lithium succinate buffer, pH 5.0, 2 mM EDTA, 2 mM EGTA, 10% (w/v) lithium lauryl sulfate, 0.1 pmol AE-probe and the nucleic acid target to be detected. Also prepare negative controls (all components except the target nucleic acid) and positive controls (all components including a known amount of target nucleic acid; this can be a
17. Acridinium Esters/Chemiluminescence
415
purified and quantitated sample of the target, a synthetic complement to the AE-probe, etc.). Vortex to mix; cover; incubate 5 to 60 min at 60~ 2. Differential hydrolysis. Add 300/zl 0.15 M sodium tetraborate buffer, pH 7.6, 5% (v/v) Triton X-100. Vortex 3 sec; cover; incubate at 60~ for 10 min. 3. Detection. Immediately after removal from the water bath, place the tubes in an ice/water slurry for 15 sec, remove to room temperature and let stand for 30 sec, then measure the chemiluminescence in a luminometer by the automatic injection of 200 /xl 5 m M HNO 3, 0.1% H202, then 200/zl of 1 M NaOH, followed by measurement of signal for 5 sec. Remember to blot the tubes with a moist tissue or paper towel before measuring the chemiluminescence (see Section II,A,4).
As mentioned in Section I, this procedure has been used for the detection of a wide variety of target nucleic acids. As little as 6 x 10 -17 moles of target can be detected, and chemiluminescence response is linear over three to four orders of magnitude. This basic format can be applied to the assay of almost any nucleic acid if, as mentioned above, the target is available for hybridization in solution at a concentration within the sensitivity of the assay. This general procedure can also be varied somewhat.
Procedural Notes~Troubleshooting 1. Incubation time for step 1 is dependent on the hybridization kinetics of the particular probe used. These kinetics can be measured and the hybridization time determined accordingly. This can most easily be done in the assay format described previously by setting up replicate hybridization reactions, incubating them all at 60~ and assaying tubes (steps 2 and 3) at various time points. We have found that, under the conditions described above, hybridization is essentially complete for most AE-probes in 10 to 15 min. 2. The amount of probe used in an assay can be varied; a higher probe concentration will accelerate hybridization, but it will also increase background signal at the end of the assay, whereas a lower probe concentration will lower background signal but potentially lower hybrid signal due to slower hybridization kinetics. 3. The pH of hybridization is mildly acidic to protect the AE from hydrolysis. A range of pH 4.7 to pH 5.5 is acceptable, with pH 4.8 to pH 5.0 optimal. 4. The lithium lauryl sulfate contained in the hybridization mixture can range from 2 to 10% (10% is best).
416
Norman C. Nelson et al.
5. Differential hydrolysis (DH) time is a critical factor in assay design. The optimal time for the DH step can be determined by measuring the AE hydrolysis kinetics of the AE-probe used in the assay as described in Section III,B. The point at which the AE hydrolysis rate of the unhybridized probe reaches a plateau (see Fig. 4) is the key factor in determining the DH time. For example, the optimal DH time for the AE-probe used for the hydrolysis rate study depicted in Fig. 4 is 10 min (under the conditions used in that experiment). After the ester hydrolysis ofunhybridized AE-probe plateaus, reduction of signal from unhybridized AE-probe (i.e., background) is minimal, whereas signal from hybridized AE-probe is slowly but continually declining. Therefore assay sensitivity will slowly decrease beyond this point. It should be kept in mind, however, that the AE hydrolysis is rate and therefore the DH time is condition dependent (pH, temperature, etc.) and must therefore be measured for each condition used. Ideally, optimal DH time should be determined in the exact assay format to be used. 6. An assay temperature of 60~ was chosen to give optimal performance of the system in regard to multiple factors, including hybridization kinetics, specificity of reaction, stability of the AE, and differential hydrolysis characteristics. However, other temperatures can be used if the particular application warrants the change. At temperatures lower than 60~ hybridization times as well as differential hydrolysis times will have to be increased (if the pH is constant). Hybridization kinetics and differential hydrolysis rates should be measured, and the appropriate incubation time selected accordingly. 7. Since the ester hydrolysis rate is directly proportional to the pH of the solution, the differential hydrolysis time can be manipulated by the pH of the differential hydrolysis buffer. A range of pH from 7.5 to 8.5 yields convenient differential hydrolysis times (6 to 12 min) at 60~ Other pH values can be used if desired, especially if alternate temperatures are also used (for example, a higher pH may be used at a lower temperature in order to keep the duration of the differential hydrolysis step relatively short). Maintaining an accurate pH during the differential hydrolysis step is obviously very important. The composition of the hydrolysis buffer is designed to maintain an accurate pH, but the samples must be thoroughly mixed after addition of this buffer to assume proper and consistent performance. 8. Since this assay is completely homogeneous, all of the liquid that is put into the tube during the course of the assay remains in the tube during the detection step. Since there is a volume limitation in the luminometer (beyond a certain volume efficiency of capture of chemiluminescent signal rapidly diminishes), there is also a volume limitation for the assay itself.
17. Acridinium Esters/Chemiluminescence
417
For the 12 x 75 mm tube format, a typical volume maximum is 800/zl (this depends on the exact luminometer being used). A typical injection volume for a luminometer is 200/zl. Therefore, if a two-injection regimen is being used for chemiluminescence detection, the volume maximum for all the steps of the assay before detection is 400/zl. If the peroxide and base are added in the same injection, the assay volume can be increased to 600 ~1. One disadvantage of this approach is that the peroxide is stable in the base only for about 10 hr. A single-injection regimen also precludes an acid reversion step as described in Section II,B, although acid reversion is not typically used in the HPA format (see following sections). 9. Acid reversion is typically not used in the HPA format. This is because a portion of the background component in the assay is in the pseudo-base form, and acid reversion would revert this component and thus raise backgrounds. Hybridized AE-probe, on the other hand, does not require acid reversion to recover all available chemiluminescence. Therefore maximal signal-to-noise ratios can be achieved using a detection regimen without acid reversion. 10. Double-stranded target nucleic acid must be denatured before hybridization with the AE-probe. This is typically accomplished by a short incubation period at 95~ (see HPA Protocol for the Detection of Products from in vitro Amplification Techniques). 11. A small square of standard laboratory label tape (Time tape, VWR Scientific) pressed snugly onto the assay tubes is an ideal covering during incubation at 60~ 12. Possible explanations of high background signals include the following: 9 The pH of the differential hydrolysis step may be too low. This can result if the pH of the differential hydrolysis buffer is errantly low, but can also result if the sample being assayed contains buffer components or is acidic such that the borate in the DH buffer is insufficient to maintain the proper pH. If this is the case, lower sample volumes should be used, or the sample should be neutralized, semipurified, other buffer concentrations selected, etc., before being assayed. 9 The sample may not be mixed thoroughly after addition of the DH buffer (the solution is fairly viscous because of the high detergent concentrations), leading to an inconsistent pH throughout the mixture. 9 The temperature of hydrolysis may be incorrect. For example, when racks of tubes are assayed, the centrally located tubes may not come to the proper temperature during the incubation period. 9 The AE-probe may have been splashed up the sides of the tube during one of the steps before the hydrolysis step. This material may be high enough that it does not come into contact with the hydrolysis buffer and
418
Norman C. Nelson et al.
therefore remains unhydrolyzed, but low enough that it comes into contact with the detection reagents and therefore contributes to the final chemiluminescent signal. Special care in pipetting and mixing will help to eliminate this problem. 9 The sample may contain components that reduce the rate of AE hydrolysis of the unhybridized probe. The most likely candidates in this regard are strongly nucleophilic compounds that can form adducts with the AE, thus protecting it from hydrolysis (see Fig. 3 and Section I,A). For example, certain buffers and reducing agents, such as Tris and dithiothreitol (DTT), will form adducts at millimolar concentrations at basic pH. Solutions to this problem include lower sample volumes per assay, prepurification of the target nucleic acid and avoiding use of such components in sample preparation. Another approach is to react such components with compounds that render them inert, as described by Hammond and co-workers for the reversion of adduct formation in AE (Hammond et al., 1991). 9 Samples to be tested, especially those that are biological in nature, may exhibit inherent chemiluminescence, which can lead to elevated background values. The best way to examine this parameter for a given sample type is to perform the assay normally with the exception that AE-probe is omitted. 13. Possible explanations of low hybridization signals include the following: 9 The pH of the differential hydrolysis step may be too high. This can result if the pH of the differential hydrolysis buffer is errantly high, but can also result in the sample being assayed contains buffer components or is basic such that the borate in the DH buffer is insufficient to maintain the proper pH. If this is the case, lower sample volumes should be used, or the sample should be neutralized, semipurified, other buffer concentrations selected, etc., before being assayed. 9 The AE-probe may not have hybridized to the target nucleic acid completely. If this is suspected, retest the hybridization kinetics under the exact assay conditions that resulted in low signals. 9 The temperature of hydrolysis may be incorrect. Low signal is indicative of too high a temperature. 9 The melting temperature (Tm) of the AE-probe may be too near the operating temperature. The T m of the AE-probe should be determined under the exact assay conditions (probe concentration, salt concentration, etc.). 9 The target nucleic acid may not be available for hybridization with the AE-probe. The sample may need to be denatured before hybridization (see HPA Protocol for the Detection of Products from In Vitro Amplification Techniques).
17. AcridiniumEsters/Chemiluminescence
419
9 The sample may contain components that alter the normal structure of duplex DNA. This can have a negative effect on the protection of the AE since this protection is very structure dependent. Examples of such compounds include polyamines and strong intercalating compounds. Solutions to this problem include lower sample volumes per assay, prepurification of the target nucleic acid, and avoiding use of such components in sample preparation. 2. HPA Protocol for the Detection of Products from in Vitro Amplification Techniques A typical protocol follows for the assay of a target amplification reaction such as PCR and TAS (see Section I,E). A denaturation step is often required, and a convenient sample size at this step is 50/zl. However, it is not typically necessary to assay 50/zl directly from the amplification reaction, and in fact 50/zl may be too much to assay (see Procedural Notes/Troubleshooting for the general HPA protocol described). In this case the sample (5 to l0/zl of the amplification reaction, for example) should be diluted with the appropriate amount of water to bring the volume to 50/~1. This dilution will also help prevent the strands from reannealing after denaturation. For convenience the AE-probe is typically premixed into a 2X hybridization buffer such that 50/zl contains the proper amount of AE-probe to be used per assay. Therefore, addition of 50/A of this AE-probe reagent to 50 /zl of the sample yields an ideal hybridization mixture.
1. Denaturation. Pipette 50/xL of sample to be tested into a 12 • 75 mm assay tube; cover. Incubate at 95~ min to denature the target nucleic acid (this step can be omitted if the target is single stranded). After 5 min immediately place the tubes into an ice/ water slurry. 2. Hybridization. Cool the tubes in the ice/water slurry for 1 min, then pipet 50/zl prepared AE-probe reagent [0.2 M lithium succinate buffer, pH 5.0, 4 mM EDTA, 4 mM EGTA, 17% (w/v) lithium lauryl sulfate and 0.1 pmol AE-probe] into each tube. Vortex to mix; cover; incubate the tubes in a water bath at 60~ for 10 min. 3. Differential hydrolysis. Remove the tubes from the water bath, add 300/xl 0.15 M sodium tetraborate buffer, pH 8.5, 5% (v/v) Triton X-100. Vortex 3 sec; cover; incubate at 60~ for 6 to 7 min. 4. Detection. Immediately after removal from the water bath, place the tubes in an ice/water slurry for 15 sec, remove to room temper-
420
NormanC. Nelsonet al. ature, and let stand for 30 sec, then measure the chemiluminescence in a luminometer by the automatic injection of 200 /zl 5 mM HNO3, 0.1% H20 2, then 200/xl of 1 M NaOH, followed by measurement of signal for 5 sec. Remember to blot the tubes with a moist tissue of paper towel before measuring the chemiluminescence (see Section II,A,4).
As mentioned in Section I,E, this protocol can be used for the detection of a variety of amplification products. In one application an overlapping pair of AE-probes is used to detect specific sequences within the gag gene of human immunodeficiency virus-1 (HIV-1) amplified by PCR. Ou and co-workers (Ou et al., 1990) have reported the detection of HIV-1 proviral DNA amplified in the presence of cell lysate. They were able to detect as little as 4 copies of HIV DNA, and the assay was linearly quantitative over about 3 orders of magnitude. They also compared the HPA format with an isotopic method utilizing a 32p-labeled probe and found the HPA method to be at least as sensitive as the 32p-method. (The isotopic method consisted of solution hybridization, restriction enzyme digestion, gel electrophoresis, and autoradiography.) In another application the HPA format is used to detect the presence of the Philadelphia chromosome (Adams, 1985), the chromosomal translocation product associated with chronic myelogenous leukemia (CML). In one report (Dhinga et al., 1991), chimeric mRNA was amplified using PCR and detected using the HPA format described. Samples from 60 different patients were analyzed, and the HPA format gave equivalent results to standard Southern analysis of the PCR reactions, in a fraction of the time. The HPA format also gave complete correlation with the results of karyotype or Southern blot analysis of genomic DNA. The HPA format has also been used to detect amplified nucleic acid from Mycobacterium tuberculosis ( Jonas et al., 1993), hepatitis B virus (Kacian et al., 1990), the genes that code for the rRNA of Neisseria gonorrhoeae (Gegg et al., 1990) and Chlamydia trachomatis (Kranig-Brown et al., 1990), the 7.5 kb cryptic plasmid of Chlamydia trachomatis known as pCHL 1, the HIV-1 envelope region, and the HIV2 viral protein x and LTR regions. Procedural Notes~ Troubleshooting 1. The procedural notes and troubleshooting guidelines given for the general HPA protocol apply to this protocol as well. 2. Never include the AE-probe in the denaturation step, as it will be hydrolyzed. Make sure the sample is cooled to 70~ or below before adding the AE-probe (using the protocol described, the temperature will be well below 70~
17. Acridinium Esters/Chemiluminescence
421
3. The denaturation protocol can also be used for double-stranded nucleic acid targets other than those from amplification reactions. 4. See Section Ill,D, Procedural Notes/Troubleshooting, General, for tips that are applicable to all AE-based procedures.
3. Differential Hydrolysis + Magnetic Separation Protocol Following is a protocol that combines the differential hydrolysis process with a magnetic separation step to further reduce backgrounds. The protocol given is one variation on this theme, and represents only one particular way this general procedure can be performed.
1. Hybridization. In a 12 x 75 mm assay tube, prepare a 200 /zl hybridization reaction containing 0.1 M lithium succinate buffer, pH 5.0, 2 mM EDTA, 2 mM EGTA, 10% (w/v) lithium lauryl sulfate, 0.1 pmol AE-probe, and the nucleic acid target to be detected. Vortex to mix; cover; incubate 10 to 60 min at 60~ 2. Differential hydrolysis. Add 1 ml 0.15 M sodium tetraborate buffer, pH 7.6, 5% (w/v) Triton X-100. Vortex 3 sec; cover; incubate at 60~ for 10 min. 3. Magnetic separation. Add 1 ml 0.4 M sodium phosphate buffer, pH 6.0 containing 0.1 to 5 mg of magnetic amine microspheres (see Section II,A,3). Vortex thoroughly; cover; incubate 5 min at 60~ Place tubes in a magnetic separation unit (see Section II,A,3) at room temperature and allow the microspheres to be separated from the solution (about 5 min). With the tubes still in the magnetic separation unit, decant the supernatant and blot the tops of the tubes. Wash the spheres one to three times by removing the tubes from the rack, adding 1 ml 0.2 M phosphate buffer, pH 6.0, vortexing, placing the tubes back into the magnetic rack for 5 min and decanting the supernatant. 4. Elution of AE-probe from magnetic microspheres. After the last wash from step 3 is decanted and the tubes are carefully blotted, remove the tubes from the magnetic separation unit and add 300/zl of a solution containing 0.2 M sodium phosphate buffer, pH 6.0, and 50% (v/v) formamide to each tube. Vortex thoroughly; cover. Incubate the tubes'at 60~ for 5 min, place tubes in magnetic separation unit (see Section II,A,3) at room temperature, and allow the microspheres to be separated from the solution (about 5 min). Transfer the supernatant (which now contains the AE-probe) to a new 12 • 75 mm assay tube.
422
Norman C. Nelson et al.
5. Detection. Detect chemiluminescence in a luminometer by the automatic injection of 200 /zl 0.4 M H N O 3, 0 . 1 % H202, then 200/xl 1 M NaOH, followed by measurement of signal for 5 sec. Remember to blot the tubes with a moist tissue or paper towel before measuring the chemiluminescence (see Section II,A,4).
The limit of sensitivity of this procedure is as low as 6 x 10-~8 moles of target, and chemiluminescence response is linear over four or more orders of magnitude (the limiting factor in range of linearity is usually the luminometer and not the assay itself). As mentioned, there are alternate protocols to perform a differential hydrolysis + separation assay. For example, a clinical diagnostic assay (PACE 2, Gen-Probe) utilizes a differential hydrolysis + separation protocol that includes only one wash step and omits the elution step (chemiluminescence is measured in the presence of the magnetic microspheres) (Vlaspolder et al., 1993; Yang et al., 1991).
Procedural Notes~Troubleshooting 1. The procedural notes and troubleshooting guidelines given for the general HPA protocol apply to this protocol as well. 2. In high enough concentrations, the magnetic spheres will quench the chemiluminescence from the AE-probe. That is why the AE-probe is eluted from the spheres before the detection step. 3. The elution step melts the hybrid and elutes the free AE-probe from the spheres. Since it is no longer protected by the duplex, the AE can now once again hydrolyze fairly rapidly. Therefore the 60~ portion of the elution step should be no longer than the recommended 5 min, and the samples should be measured for chemiluminescence as soon as they are transferred to new assay tubes. 4. Acid reversion is used in the detection step in this particular protocol since the AE is detected as unhybridized AE-probe and not hybridized AE-probe. 5. Freezing of the magnetic microspheres can lead to clumping of the spheres, which leads to low capture efficiency and errantly low assay readings. Therefore do not freeze this reagent. 6. See Section Ill,D, Procedural Notes/Troubleshooting, General, for tips that are applicable to all AE-based procedures.
D. General Procedural Notes/Troubleshooting Following are some procedural notes and troubleshooting tips that are generally applicable to handling AE and AE-labeled DNA probes. Some
17. Acridinium Esters/Chemiluminescence
423
of these suggestions have been repeated in selected sections for emphasis. 9 The AE is a hydrophobic molecule, and as such has a propensity to stick to surfaces such as test tube walls and pipet tips. For this reason the AE must always be handled in solutions that contain agents that disrupt hydrophobic interactions and keep the AE in solution. Detergents and organic solvents fulfill this criterion very well. For example, lauryl sulfate, DMSO, or acetonitrile are commonly used to keep the AE in solution. Never try to transfer AE from water, as you will invariably leave some behind. 9 For optimal storage stability, AE-probes should be stored in a pH 5 buffer (sodium acetate, lithium succinate, etc.) with a small amount of detergent (e.g., 0.1% SDS) present to keep the AE in solution (see 1 above). In this form the AE-probe is stable for months at -20~ and years at -70~ However, multiple freeze-thawing cycles will reduce the shelflife of AE-probes, which should therefore be stored in small aliquots. 9 When thawing aliquots of AE-probe, the solution must be heated to 45 to 60~ for about 1 min and then vortexed to thoroughly resolubilize the AE. If this is not done, poor recoveries of AE-probe from the stock tube(s) can result. Solutions with high concentrations of detergents may have to be heated for 2 to 3 min in order to fully solubilize all components. For example, AE-probe in 2X hybridization buffer (see Section Ill,C) can form a gel when stored in the cold. Using the reagent like this can result in improper delivery of AE-probe and hybridization buffer, leading to errantly low hybridized values. This gel can be easily redissolved by heating at 60~ for 2 min, followed by thorough vortexing. 9 Due to t h e " sticky" nature of the AE and the relatively high viscosity of many of the solutions used in the AE protocols, all pipetting steps should be done very slowly and carefully. Pipet tips should just barely pierce the surface of the liquid that is being pipetted from or to, since a relatively large amount of AE will otherwise stick to the outside of the tip. All AE solutions should be delivered as close to the bottom of the tube into which you are pipetting as possible. A fresh disposable pipette tip should be used for each sample and positive and negative controls to avoid carryover. Repeating pipettors may be used for the addition of the AE-probe in hybridization buffer (including the aliquots used in determination of the AE hydrolysis kinetics), differential hydrolysis buffer, and the separation and wash solutions in the differential hydrolysis + separation format. When using these devices, make sure the liquid is dispensed with a smooth, gentle delivery to avoid splashing of reagent and sample already present onto the sides of the tube. 9 Chemiluminescence is typically expressed as relative light unit (RLU).
424
Norman C. Nelson et al.
9 Be careful not to contaminate reagents, pipettors, workspace, etc., as any contaminating chemiluminescence can lead to errant results. Be especially careful when using the stock solution of AE, since a 1-/zl aliquot of the 25 mM stock contains approximately 1011 RLU of chemiluminescence. The use of disposable polystyrene or polypropylene labware is strongly recommended for reagent preparation. 9 Before insertion into the luminometer, tubes should be gently blotted with a lightly dampened tissue or paper towel. This removes any residue from the outside of the tubes (thus keeping the luminometer free of contamination and protecting against instrument damage due to moisture buildup in the measurement chamber, etc.) and also reduces static charge (a build-up of this charge can lead to errant readings). 9 Any AE-probe that becomes deposited on the sides or the rim of an assay tube may not come into proper contact with the hydrolysis buffer, which will lead to high background values. This can be avoided by always pipetting to the bottom of the tube and avoiding touching the sides and the rim of the tube. Thorough vortexing of the tubes after the addition of the hydrolysis buffer will also minimize this problem. 9 Temperature is a very important parameter in AE-probe assays. Specificity of hybridization is temperature dependent, and AE hydrolysis rate is very temperature dependent. Therefore hybridization and differential hydrolysis temperatures should be accurately maintained to within a degree of the desired operating temperature. A consistent temperature from tube to tube and a rapid equilibration of the sample tubes to the correct temperature is also important. For these reasons, incubation in a circulating water bath is the recommended procedure, although a noncirculating water bath or a heating block can be used if they fulfill the requirements just described. 9 Nucleophilic compounds can form adducts with the AE (Hammond et al., 1991; see also Fig. 3 and Sections I,A and Ill,C). If formed during the differential hydrolysis step, the AE hydrolysis rate of unhybridized AE-probe may be reduced, leading to elevated negative control values.
REFERENCES Adams, J. M. (1985). Oncogene activation by fusion of chromosomes in leukemia. Nature (London) 315, 542-543. Arnold, L. J., Jr., Bhatt, R. S., and Reynolds, M. A. (1988). Nonnucleotide linking reagents for nucleotide probes. WO Patent 8803173. Arnold, L. J., Jr., Hammond, P. W., Wiese, W. A., and Nelson, N. C. (1989). Assay formats involving acridinium-ester-labeled DNA probes. Clin. Chem. 35, 1588-1594.
17. Acridinium Esters/Chemiluminescence
425
Arnold, L. J., Jr., and Nelson, N. C. (1993). Acridinium ester labelling and purification of nucleotide probes. U.S. Patent 5,185,439. Berry, D. J., Clark, P. M. S., and Price, C. P. (1988). A laboratory and clinical evaluation of an immunochemiluminometric assay of thyrotropin in serum. Clin. Chem. 34, 2087-2090. Bronstein, I., Voyta, J. C., Thorpe, G. H. G., Kricka, L. J., and Armstrong, G. (1989). Chemiluminescent assay for alkaline phosphotase: Application in an ultrasensitive enzyme immunoassay for thyrotropin. Clin. Chem. 35, 1441-1446. Bronstein, I., Voyta, J. C., Lazzari, K. G., Murphy, O., Edwards, B., and Kricka, L. J. (1990). Rapid and sensitive detection of DNA in Southern blots with chemiluminescence BioTechniques 8, 310-314. Caruthers, M.H., Barone, A. D., Beaucage, S. L., D. R., Fisher, E. F., McBride, L. J., Matteuci, M., Stabinsky, Z., and Tang, J.-Y. (1987). Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. Methods Enzymol. 154, 287-313. Daly, J. A., Clifton, N. L., Seskin, K. C., and Gooch, W. M., III (1991). Use of rapid, nonradioactive DNA probes in culture confirmation tests to detect Streptococcus agalactiae, Haemophilus influenzae, and Enterococcus ssp. from pediatric patients with significant infections. J. Clin. Microbiol. 29, 80-82. Davis, T. E., and Fuller, D. D. (1991). Direct identification of bacterial isolates in blood cultures by using a DNA probe. J. Clin. Microbiol. 29, 2193-2196. Denys, G. A., and Carey, R. B. (1992). Identification of Streptococcus pneumoniae with a DNA probe. J. Clin. Microbiol. 311, 2725-2727. Dhingra, K., Talpaz, M., Riggs, M. G., Eastman, P. S., Zipf, T., Ku, S., and Kurzrock, R. (1991). Hybridization protection assay: A rapid, sensitive, and specific method for detection of Philadelphia chromosome-positive leukemias. Blood 77, 238-242. Enns, R. K. (1988). DNA probes: An overview and comparison with current methods. Lab. Med. 19, 295-300. Gegg, C., Kranig-Brown, D., Hussain, J., McDonough, S., Kohne, D., and Shaw, S. (1990). A clinical evaluation of a new DNA probe test for Neisseria gonorrhoeae that included analysis of specimens producing results discrepant with culture. Abstracts of the 90th Annual Meeting of the American Chemical Society for Microbiology, Anaheim, California, p. 356. Granato, P. A., and Franz, M. R. (1989). Evaluation of a prototype DNA probe test for the nonculture diagnosis of Gonorrhea. J. Clin. Microbiol. 27, 632-635. Granato, P. A., and Franz, M. R. (1990). Use of the Gen-Probe PACE system for the detection of Neisseria gonorrhoeae in urogenital samples. Diagn. Microbiol. Infect. Dis. 13, 217-221. Hale, Y. M., Melton, M. E., Lewis, J. S., and Willis, D. E. (1993). Evaluation of the PACE 2 Neisseria gonorrhoeae assay by three public health laboratories. J. Clin. Microbiol. 31, 451-453. Hammond, P. W., Wiese, W. A., Waldrop, A. A., III, Nelson, N. C., and Arnold, L. J., Jr. (1991). Nucleophilic addition to the 9 position of9-phenylcarboxylate- 10-methylacridinium protects against hydrolysis of the ester. J. Biolumin. Chemilumin. 6, 35-43. Harper, M., and Johnson, R. (1990). The predictive value of culture for the diagnosis of gonorrhea and chlamydia infections. Clin. Microbiol. Newsletter 12, 54-56. Hastings, J. G. M. (1987). Luminescence in clinical microbiology. In "Bioluminescence and Chemiluminescence, New Perspectives" (J. Scholmerich, R. Andreesen, A. Kapp, M. Ernst, and W. G. Woods, eds.), pp. 453-462. John Wiley and Sons, Chichester, England. Heiter, B. J., and Bourbeau, P. P. (1993). Comparison of the Gen-Probe group A Streptococcus direct test with culture and a rapid streptococcal antigen detection assay for diagnosis of streptococcal pharyngitis. J. Clin. Microbiol. 31, 2070-2073. Innis, M. A., and Gelfand, D. H. (1990). Optimization of PCRs. In "PCR Protocols"
426
Norman C. Nelson et al.
(M. A. lnnes, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds.), pp. 3-12. Academic Press, San Diego, California. Jonas, V., Alden, M. J., Curry, J. I., Kamisango, K., Knott, C. A., Lankford, R., Wolfe, J. M., and Moore, D. F. (1993). Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by amplification of rRNA. J. Clin. Microbiol. 31, 2410-2416. Kacian, D. L., Lawrence, T., Sanders, M., Putnam, J., Majilessi, M., McDonough, S. H., and Ryder, T. (1990). A rapid and sensitive chemiluminescent DNA probe system (HPA) for detection of amplified HIV and HBV DNA. Abstracts of Biochemische Analytik 90, Munich, Germany. Keller, G. H., and Manak, M. M. (1989). "DNA Probes." Stockton Press, New York. Kohne, D. E. (1986). Application of DNA probe tests to the diagnosis of infectious disease. Am. Clin. Prod. Reo. November, 20-29. Kranig-Brown, D., Gegg, C., Hussain, J., Johnson, R., and Shaw, S. (1990). Use of PCR amplification and unlabeled probe competition for analysis of specimens producing results discrepant with culture in an evaluation of a DNA probe test for Chlamydia trachomatis. Abstracts of the 90th Annual Meeting of the American Chemical Society for Microbiology, Anaheim, California, p. 356. Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMichele, L. J., and Gingeras, T. R. (1989). Transcription-based amplification system and detection of amplified human immunodeficiency virus type I with a bead-based sandwich hybridization format. Proc. Natl. Acad. Sci. U.S.A. 86, 1173-1177. LeBar, W., Herschman, B., Jemal, C., and Pierzchala, J. (1989). Comparison of a DNA probe, monoclonal antibody enzyme immunoassay, and cell culture for the detection of Chlamydia trachomatis. J. Clin. Microbiol. 27, 826-828. Lewis, J. S., Kranig-Brown, D., and Trainor, D. A. (1990). DNA probe confirmatory test for Neisseria gonorrhoeae. J. Clin. Microbiol. 28, 2349-2350. Littig, J. S., and Nieman, T. A. (1992). Quantitation of acridinium esters using electrogenerated chemiluminescence and flow injection. Anal. Chem. 64, 1140-1144. McCapra, F. (1970). Chemiluminescence of organic compounds. Pure Appl. Chem. 24, 611-629. McCapra, F. (1973). Chemiluminescent reactions of acridines. Chem. Heterocycl Compounds 9, 615-630. McCapra, F., and Beheshti, I. (1985). Selected chemical reactions that produce light. In "Bioluminescence and Chemiluminescence: Instruments and Applications" (K. van Dyke, ed.), Vol. I, pp. 9-42. CRC Press, Boca Raton, Florida. McCapra, F., and Perring, K. D. (1985). General organic chemiluminescence. In "Chemiluminescence and Bioluminescence" (J. G. Burr, ed.), pp. 259-320. Marcel Dekker, New York. McDonough, S. H., Ryder, T. B., Cabanas, D. K., Yang, Y. Y., Majilessi, M., Harper, M. E., and Kacian, D. L. (1989). Rapid and sensitive detection of amplified DNA by a chemiluminescent DNA probe system (HPA). Abstracts of the Twenty-Ninth Interscience Conference on Antimicrobial Agents and Chemotherapy, Houston, Texas, p. 301. Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in oitro via a polymerase catalyzed chain reaction. Methods Enzymol. 155, 335-350. Nelson, N. C., Hammond, P. W., Wiese, W. A., and Arnold, L. J., Jr. (1990). Homogeneous and heterogeneous chemiluminescent DNA probe-based assay formats for the rapid and sensitive detection of target nucleic acids. In "Luminescence Immunoassay and Molecular Applications" (K. van Dyke, ed.), pp. 293-309. CRC Press, Boca Raton, Florida. Nelson, N. C., and Kacian, D. L. (1990). Chemiluminescent DNA probes: A comparison
17. Acridinium Esters/Chemiluminescence
427
of the acridinium ester and dioxetane detection systems and their use in clinical diagnostic assays. Clin. Chim. Acta. 194, 73-90. Nelson, N. C., and McDonough, S. H. (1994). Application of the hybridization protection assay (HPA) to PCR. In "The Polymerase Chain Reaction" (K. B. Mullis, F. Ferre, and R. A. Gibbs, eds.), pp. 151-163. Birkhauser, Boston, Massachusetts. Ou, C., McDonough, S. H., Cabanas, D., Ryder, T., Harper, M., Moore, J., and Schochetman, G. (1990). Rapid and quantitative detection of enzymatically amplified HIV-1 DNA using chemiluminescent oligonucleotide probes. AIDS Res. Hum. Retrooiruses 6, 1323-2329. Popovic-Uroic, T., Patton, C. M., Wachsmuth, I. K., and Roeder, P. (1991). Evaluation of an oligonucleotide probe for the identification of Campylobacter species. Lab. Med. 22, 533-539. Sanchez-Pescador, R., Stempien, M. D., and Urdea, M. S. (1988). Rapid chemiluminescent nucleic acid assays for detection of TEM-1/3-1actamase-mediated penicillin resistance in Neisseria gonorrhoeae and other bacteria. J. Clin. Microbiol. 26, 1934-1938. Sandin, R. L., Isada, C. M., Hall, G. S., Tomford, J. W., Rutherford, I., Rogers, A. L., and Washington, J. A. (1993). Aberrant Histoplasma capsulatum confirmation of identity by a chemiluminescent-labeled DNA probe. Diagn. Microbiol. Infect. Dis. 17, 235-238. Schaap, A. P., Akhavan, H., and Romano, L. J. (1989). Chemiluminescent substrates for alkaline phosphatase. Application to ultrasensitive enzyme-linked immunoassays and DNA probes. Clin. Chem. 35, 1863-1864. Stockman, L., Clark, K. A., Hunt, J. M., and Roberts, G. D. (1993). Evaluation of commercially available acridinium ester-labeled chemiluminescent DNA probes for culture identification of Blastomyces dermatitidis, Coccidioides immitis, Cryptococcus neoformans, and Histoplasma capsulatum. J. Clin. Microbiol. 31, 845-850. Tenover, F. C., Carlson, L., Barbagallo, S., and Nachamkin, I. (1990). DNA probe culture confirmation assay for identification of thermophilic Campylobacter species. J. Clin. Microbiol. 28, 1284-1287. Urdea, M. S., Warner, B. D., Running, J. S., Stempien, M., Clyne, J., and Horn, T. (1988). A comparison on nonradioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme-labeled synthetic oligodeoxyribonucleotide probes. Nucleic Acids Res. 16, 4937-4956. Vlaspolder, F., Mutsaers, J. A. E. M., Blog, F., and Notowicz, A. (1993). Value of a DNA probe assay (Gen-Probe) compared with that of culture for diagnosis of gonococcal infection. J. Clin. Microbiol. 31, 107-110. Warren, R., Dwyer, B., Plackett, M., Pettit, K., Rizvi, N., and Baker, A. (1993). Comparative evaluation of detection assays for Chlamydia trachomatis. J. Clin. Microbiol. 31, 1663-1666. Watson, M., Zepeda-Bakan, M., Smith, K., Alden, M., Stolzenbach, F., Johnson, R. (1990). Evaluation of a DNA probe assay for screening urinary tract infections. Abstracts of the 90th Annual Meeting of the American Chemical Society for Microbiology, Anaheim, California, p. 392. Weeks, I., Beheshti, I., McCapra, F., Campbell, A. K., and Woodhead, J. S. (1983a). Acridinium esters as high-specific-activity labels in immunoassay. Clin. Chem. 29, 1474-1479. Weeks, I., Campbell, A. K., and Woodhead, J. S. (1983b). Two-site immunochemical assay for human alpha-fetoprotein. Clin. Chem. 29, 1480-1483. Weeks, I., Sturgess, M., Brown, R. C., and Woodhead, J. S. (1986). Immunoassays using acridinium esters. Methods Enzymol. 133, 366-386. Woese, C. R. (1987). Bacterial evolution. Microbiol. Rev. 51, 221-271.
428
Norman C. Nelson et al.
Woods, G. L., Young, A., Scott, J. C., Jr., Blair, T. M. H., and Johnson, A. M. (1990). Evaluation of a nonisotopic probe for detection of Chlamydia trachomatis in endocervical specimens. J. Clin. Microbiol. 28, 370-372. Yang, L. I., Panke, E. S., Leist, P. A., Fry, R. J., and Lee, R. F. (1991). Detection of Chlamydia trachomatis endocervical infection in asymptomatic and symptomatic women: Comparison of deoxyribonucleic acid probe test with tissue culture. Am. J. Obstet. Gynecol. 165, 1444-1453.
18
Detection of Energy Transfer and Fluorescence Quenching Larry E. Morrison Vysis, Incorporated Downers Grove, Illinois 60515
I. Introduction A. DNA Assay Formats Using Energy Transfer and Fluorescence Quenching B. A Molecular View of Fluorescence Quenching and Energy Transfer C. Comparison of Assay Formats D. Applications and Limitations II. Materials A. Reagents 1. 5'-Terminal-Labeled DNA 2. 3'-Terminal-Labeled DNA
B. Instrumentation 1. Fluorometers 2. Luminometers
III. Procedures A. Light-Emission Measurements 1. Static Fluorescence Measurements 2. Kinetic Fluorescence Measurements 3. Chemiluminescence Measurements
B. Reagent Characterization 1. Composition and Concentration of Labeled Probes 2. Titration of Labeled Probes 3. Determination of Hybridization Conditions
C. Nonamplified DNA Hybridization Assays 1. Competitive Hybridization Assay 2. Noncompetitive Hybridization Assay
D. Amplified DNA Hybridization Assays References
Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
429
430
Larry E. Morrison
I. I N T R O D U C T I O N
A. DNA Assay Formats Using Energy Transfer and Fluorescence Quenching Methods of detecting DNA l by energy transfer and fluorescence quenching were the first homogeneous sequence-specific methods described, and subsequently few additional homogeneous approaches have been developed. In general, energy transfer and fluorescence-quenching methods rely on the distance dependence of intermolecular quenching interactions between a luminescent label attached to one DNA probe and a second label attached to a second DNA probe. Hybridization of complementary DNA strands serves to bring two probes together, whereupon interaction between the two labels results in a detectable change in the luminescence properties of one or both labels. The presence of the DNA analyte is thereby detected without the need to physically separate probes bound to the analyte from probes free in the solution. Like its predecessor, the energy transfer-based immunoassay (Ullman et al., 1976), the hybridization assay provides a route to rapid and simple bioanalyses. The three original hybridization formats that employ energy transfer or fluorescence quenching are shown in Fig. 1. The DNA probes are shown as short DNA strands to which the labels F and Q are attached. The DNA analyte, otherwise called the target DNA, is shown as the longer unlabeled DNA strand. Part A of Fig. 1 depicts the format first described (Heller et al., 1983), in which the sequences of two DNA probes are selected, such that they will hybridize to contiguous regions of the target DNA. The probe hybridizing toward the 5'-terminus of the target DNA is labeled near its 5'-terminus, whereas the other probe is labeled near its 3'-terminus. This arrangement provides for close placement of the two labels on hybridization to the target DNA. 1 While the work here primarily describes probes composed of DNA used to detect DNA analytes, in principle, the probes could be composed of RNA, and either probe used to detect either RNA or DNA.
Fig. 1--Schematic representations of label interactions in energy transfer and fluorescencequenching hybridization assay formats. Parts A, B, and C show the various species present in the noncompetitive-assay format, the competitive-assay format, and the intercalatorassay format, respectively. F represents the label excited by light absorption or chemical reaction. Q represents the label that interacts with F at short separation distances to quench the emission of F. Arrows indicate light emission from individual labels or energy transfer between labels. Arrows are labeled to indicate energy characteristic of F emission (ho~) or Q emission (hv2). Q may be emissive or nonemissive and may facilitate the loss of energy from excited F labels without energy transfer to Q.
Noncompetitive Format
~ oc
3'
ToA
,C4-t.~ I"A 9 T
~. ~-.~ "~Q~i~
~
1
o~~ A Competitive Format
~
cQ
4
t%
F
F
T
Q
~ 'r
.o~
!
3' 3'
B
5'
Intercalator Format
F o
J
/ C
5'
~
432
Larry E. Morrison
The label F is a luminescent compound that can be excited either by chemical reaction, producing chemiluminescence, or by light absorption, producing fluorescence. The label Q can interact with F to alter its light emission, usually resulting in the decreased emission efficiency of F. This phenomenon is called quenching. A special type of quenching involves the transfer of the excitation energy from F to Q. This special case is referred to loosely as energy transfer. If Q is also fluorescent, light emission from Q can accompany energy transfer. The distance dependence of the quenching of F by Q depends on the particular quenching mechanism involved, but in general, the probes are present at low enough concentrations that the average distance of separation in solution is far greater than that required to observe detectable quenching. Once the probes are hybridized to contiguous regions on the target DNA, however, the labels are close enough to produce appreciable interaction. The presence of target DNA, therefore, is detected as the quenching of F, which is sometimes accompanied by enhanced light emission from Q. The energy-transfer concept was first demonstrated using two oligomers of thymidine, one containing a 5'-isoluminol label and the other containing a 3'-tetramethylrhodamine label (Heller and Morrison, 1985). Polydeoxyadenylic acid served as the target DNA, and initiation of the chemiluminescent isoluminol reaction resulted in a 24% increase in emission at the red end of the spectrum, where rhodamine fluoresces, relative to red emission in the absence of the polydeoxyadenylic acid. A later demonstration used DNA oligomers with terminal labels of fluorescein and tetramethylrhodamine (Cardullo et al., 1988). Fluorescence of the fluorescein label was reduced 71% on addition of the target DNA oligomer. In a more recent variation on this format, a strong metal chelator was attached to the 5' terminus of one DNA oligomer, and a weaker fluorescent chelator was attached to the 3' terminus of the second DNA oligomer (Oser and Valet, 1990). The strong chelator allowed a lanthanide ion to be bound to the first probe, which served as the energy acceptor of the 3'-fluorescent chelator when both probes were bound to neighboring positions on the target DNA. This arrangement ensures close proximity of the energy donor and acceptor since the energy donor actually binds the energy acceptor. Care must be taken, however, in selecting the energy donating chelator to ensure its binding to the lanthanide ion in the presence of target DNA while minimizing association of the two probes via chelation in the absence of the target. The second assay format is depicted in Fig. 1B and employs complementary DNA probes matching the nucleotide sequence of a selected region within the target DNA (Morrison, 1987). This type of assay is referred to as a competitive assay since probe strands compete with target strands for hybridization. As in the noncompetitive format described in Fig. 1A,
18. Energy Transfer and FluorescenceQuenching
433
one probe is labeled on its 3'-terminus, and the other probe is labeled on its 5'-terminus. When the probes hybridize to one another, the quenching interaction is favored, whereas an insignificant amount of interaction occurs when the probes are separated. The detection of target DNA is achieved by denaturing target and probe DNA together and then allowing the DNA strands to rehybridize. The more target strands present, the larger the number of probe strands that hybridize to target strands, and the smaller the number of F and Q labels placed next to one another by probe-to-probe hybridization. The presence of target DNA, therefore, is detected as increased emission from F, due to reduced quenching, and decreased emission from Q, due to decreased energy transfer. The competitive assay was demonstrated using complementary probes labeled with a variety of fluorescent labels that interact on hybridization to provide fluorescence quenching or energy transfer (Morrison, 1987; Morrison et al., 1989). DNA oligomers as well as restriction fragments of natural DNA were labeled to serve as probe strands. DNA hybridization assays were performed on samples containing targets of synthetic DNA oligomers or plasmid DNA. In addition, an amplified version of the assay was demonstrated using the polymerase chain reaction, (PCR) (Morrison et al., 1989). Energy transfer has also been demonstrated between a ruthenium II complex on the 5' terminus of one probe and an organic fluorophore on the 3' terminus of a complementary probe (Bannwarth and Mfiller, 1991). A third assay format, depicted in Fig. 1C, uses only one labeled probe and a dye that binds preferentially to double-stranded DNA (Heller and Morrison, 1985). This dye may intercalate between the base pairs or may bind to the outside of the helix and serves as the quencher Q. In the absence of hybridization Q does not bind to the single-stranded probe, and F is unaffected by Q. In the presence of the target DNA, the probe hybridizes to the target and Q binds to the resulting double helical region, thereby placing Q near F and allowing energy transfer or fluorescence quenching. This concept was first demonstrated using an isoluminol-labeled oligomer of adenosine and the double-strand-specific intercalator, ethidium bromide (Heller and Morrison, 1985). Energy transfer between the chemiluminescent product of isoluminol oxidation and intercalated ethidium bromide was observed, in the presence of polyuridylic acid, as increased emission at 600 nm, where the ethidium bromide fluoresces. The correspondence between changes in the fluorescence intensity at 600 nm and the absorbance hypochromicity of the RNA, as the RNA was denatured by heating, confirmed that energy transfer was a direct result of hybridization. A similar experiment was reported later in which the DNA-binding dye, acridine orange, was used as a fluorescent energy donor to a tetra-
434
Larry E. Morrison
methylrhodamine label attached to a DNA oligomer (Cardullo et al., 1988). Again, absorbance hypochromicity measurements were correlated with energy transfer, which was observed this time as both quenching of the acridine orange fluorescence and enhancement of the rhodamine emission. The intercalator assay format is the least sensitive of the three formats. One reason for this is that any intercalator that binds nonspecifically to single-stranded DNA probe produces label interactions falsely indicative of hybridization between probe and target. In addition, problems result from the relatively high concentration of DNA-binding dye that must be used in order to ensure sufficient binding of the dye to the polynucleotide. Even if the unbound dye is only weakly fluorescent, the high concentration of the dye can result in high levels of background emission relative to the emission from the dye involved in the quenching interaction. A new variation on the energy transfer and fluorescence quenching assay formats was recently described that combines enzymatic degradation and DNA hybridization (Lee et al., 1993). In this assay, a DNA oligomer complementary to a target DNA sequence is labeled on its 5' terminus and at an internal position with donor and acceptor fluorophores so energy transfer between labels occurs in the intact oligomer. When included in a nick translation or polymerase chain reaction with a primer that hybridizes to the same target on the 5' side of the labeled oligomer, the 5'-to3' nuclease activity of the polymerase degrades the labeled oligomer, thereby separating the two fluorophores and reducing energy transfer. If perfect base pairing between the labeled oligomer and target is not achieved in the region between the two labels, the efficiency of polymerase cleavage is reduced, thereby allowing this assay to detect small lesions in the target DNA. As evidence, the 3-bp deletion in the mutant human cystic fibrosis gene could be distinguished from the normal gene by this technique. In addition to providing the basis for DNA hybridization assays, hybridization-induced energy transfer and fluorescence quenching have been used in physical studies of DNA structure and the hybridization process. Enthalpy and entropy changes associated with DNA oligomer hybridization have been measured, as have rates of oligomer association and dissociation using 3'- and 5'-labeled complementary oligomers (Morrison and Stols, 1989,1993) and 5'-labeled complementary oligomers (Clegg et al., 1993). In a study of hybridization kinetics, active displacement of a hybridized DNA strand by a circular synthetic DNA oligomer was established by monitoring fluorescence changes associated with separating 3'- and 5'-labeled complementary DNA oligomers (Perkins et al., 1993). Distance relationships in double-helical structures have also been measured using energy transfer between two fluorescent labels attached to DNA oligomers (Cardullo et al., 1988; Cooper and Hagerman, 1990; Ozaki and McLaughlin, 1992; Clegg et al., 1993).
18. Energy Transfer and FluorescenceQuenching
435
B. A Molecular View of Fluorescence Quenching and Energy Transfer Fluorescence quenching and energy transfer involve processes that remove energy from an electronically excited luminescent molecule, thereby returning that molecule to its ground electronic state without the emission of light. These processes may best be understood with reference to the simplified energy level diagram shown in Fig. 2. Horizontal lines represent energy levels, and the vertical distance is a measure of the relative energy of each level. Hypothetical energy levels for F and Q are shown in the left and right portions of the figure, respectively. Energy levels are labeled as either single states, S, or triplet states, T, with subscripts numbered 0, l, or 2, representing the ground state, first excited electronic state, or second excited electronic state. Normally a molecule resides in its lowest, or ground, electronic state, So. However, the molecule may be excited to one of its higher energy levels by any of a number of processes, including light absorption and chemical reaction. The excitation of F is represented in Fig. 2 by the arrows pointing upward from the ground state. Once excited, the molecule has a number of routes available to lose the excess energy and return to its ground state. These routes are marked by arrows pointing downward from the excited states S1 and $2. Molecules excited
$2
ket
$1
S 1. ml,
k
kf
kic
k q [Q]
So
So
F
Q
Fig. 2--Energy level diagrams for F and Q labels describing the possible paths for quenching of F or energy transfer from F to Q. Horizontal lines represent energy levels that increase in energy in the vertical direction. Vertical lines represent transitions between energy levels, where straight lines represent transitions involving photons and curving lines represent nonradiative transitions. Only electronic energy levels are included for simplicity. Further explanation is provided in the text.
436
Larry E. Morrison
into their second or higher excited states are rapidly de-excited by nonradiative internal conversion processes to the first excited state, S1. Internal conversion from S~ to So, labeled in Fig. 2 with the first order rate constant, kic, can also be rapid but in luminescent molecules is slow enough that de-excitation by light emission is competitive. Light emission from S1 is called fluorescence and is governed by the first-order rate constant, kf, used to label this path in Fig. 2. Typically kf is on the order of l0 s to 109 sec -1. Fluorescence competes not only with internal conversion but also with intersystem crossing to the triplet state, labeled kis. Light emission from the triplet state, called phosphorescence, is possible; however, the first-order rate constant governing this process, kp, is small (typically 1-10 6 sec -1), and other nonradiative processes generally predominate in solutions at room temperature. The efficiency of fluorescent light emission is denoted by the quantum yield, ~, which is the number of fluorescent photons emitted divided by the number of molecules excited, either by light absorption or chemical reaction. In the absence of other molecular species, ~ is determined by the rates of the various processes involved in removing energy from S1, according to Eq. l: r
= kf/(kf +
kic + kis)
(1)
The quantum yield approaches the maximum value of 1 when the rates of intersystem crossing and internal conversion are small compared to the rate of fluorescence. If additional molecular species are introduced that may collide with the luminescent molecule, new avenues for deexcitation are introduced. These molecules function as quenchers of the luminescent molecule if the product of quencher concentration, [Q], and the bimolecular quenching rate constant, kq, is significant relative to the sum of the de-excitation rate constants in the absence of quencher. The quantum yield is then determined according to Eq. 2: 9 q = kf/(kf +
kic + ki~ + [Q]kq)
(2)
where ~q refers to the quantum yield in the presence of quencher. This form of quenching is referred to as dynamic quenching. Collisions between molecules can result in the conversion of the electronic energy into vibrational and kinetic energy, and distortions of the electronic levels due to collision can enhance intersystem crossing to weakly emitting or nonemitting triplet states, particularly when heavy atoms are involved. Examples of collisional quenchers are molecular oxygen and molecules containing bromine and iodine. Another form of quenching, static quenching, results from the formation of non-emissive complexes between the luminescent molecule and the quencher. As such, static quenching does not compete for de-excitation
18. Energy Transfer and FluorescenceQuenching
437
of S1, but instead reduces the fluorescence intensity by reducing the concentration of the free luminescent molecule. Dynamic and static quenching can be distinguished by the effect of increasing viscosity on the rate of Sl de-excitation, which remains unchanged for static quenching and is decreased for dynamic quenching owing to the reduced rate of diffusion. Another process that removes excited states is chemical reaction of the excited state. An example of this is electron transfer between a molecule in its excited state and a second molecule in its ground state. More detailed information on fluorescence quenching can be found elsewhere (Eftink and Camillo, 1981; Lakowicz, 1983). One of the better understood quenching processes is long-range energy transfer, also referred to as dipole-coupled and F6rster energy transfer. Long-range energy transfer does not require contact between F and Q, but instead can occur at separation distances greater than 100 ,~. In this process, de-excitation of F, the energy donor, occurs simultaneous with excitation of Q, the energy acceptor. Photons of light are not involved, and the energy transfer may be compared to that between a radio transmitter and a receiving antenna. The primary requirement for such a transfer is that the energy lost by de-excitation of the energy donor, S1-S0, be matched by the energy required for going from the ground state to an excited state of the energy acceptor. Another way of saying this is that the absorption spectrum of Q must overlap the emission spectrum of F. An example of spectral overlap is shown in Fig. 3, where the fluorescence excitation and emission spectra of fluorescein-labeled DNA and tetramethylrhodamine-labeled DNA are plotted together. The emission spectrum
Fig. 3---Corrected fluorescence excitation and emission spectra of fluorescein- and tetramethylrhodamine-labeled DNA probes indicating the region of spectral overlap (intersection of diagonal lines and shading) between the emission spectrum offluorescein and the excitation spectrum of tetramethylrhodamine.
438
Larry E. Morrison
of the energy donor fluorescein and the excitation spectrum of the energy acceptor tetramethylrhodamine are marked with diagonal lines and shading, respectively, to emphasize the relevant region of spectral overlap at their intersection. Returning to Fig. 2, energy transfer is depicted as the additional deexcitation pathway leading from the S~ level of F to the S~ level of Q, marked with the first-order rate constant for energy transfer, k~t. Actually the energy transfer can excite Q to $2 or higher levels as long as the energy difference between the higher level and So of Q is the same as that between S1 and So of F. Once excited, the acceptor can undergo de-excitation by the emissive and nonemissive processes described above for F. With a knowledge of the emission and excitation spectra, and several other spectral properties, ket can be calculated using the relationship derived by F6rster (Ffrster, 1959; Conrad and Brand, 1968): ket-- 8.79 x 10-25K2(I)DkDq~-4R-6J
(3)
where K is an orientation factor, ~D is the donor fluorescence quantum yield, kD is the first-order rate constant for de-excitation of the donor in the absence of energy transfer, r~ is the refractive index of the medium, R is the distance separating the energy donor and acceptor in centimeters, and J is an integral expression describing the degree of spectral overlap and given by Eq. 4: j =
foo 0
FD(h)eA(h)X4dX
(4)
FD(h) is the normalized emission spectrum of the energy donor (integrated intensity = 1) and eA(h) is the spectrum of the acceptor's molar extinction coefficients for absorption, both expressed as functions of the wavelength, h. The orientation factor relates to the relative orientation of the donor emission dipole and acceptor absorption dipole, and can be difficult to determine. In the absence of other information, the value of r 2 = 2/3 for randomly oriented donor and acceptor molecules in solution is often assumed. The important feature to note in Eq. 3 is the strong dependence of the energy-transfer rate on the separation distance. The inverse sixth power relationship dictates that small changes in the donor-acceptor separation distance will make large changes in the rate of energy transfer. The critical separation distance, R0, is defined as the distance at which the rate of energy transfer is equal to the rate of de-excitation in the absence of energy transfer, and is calculated according to Eq. 5: R0 = (8.79 x 10-25K2tI)D~-4J) 1/6
(5)
To observe significant amounts of energy transfer, the distance separating the donor and acceptor molecules should be on the order of R0 or
18. Energy Transfer and Fluorescence Quenching
439
smaller. For good donor-acceptor pairs, R 0 values of 30 to 60 ,~ are common. For example, the value of R0 calculated for the fluorescein/ tetramethylrhodamine donor-acceptor pair is about 50/~ (Ullman et al., 1976). According to the above discussion, a homogeneous binding assay based on energy transfer must bring the labeled portions of the reagents within about 30 to 60 ,~ of one another in response to the analyte. This is achieved in immunoassays by random labeling of antibody reagents via the amino groups of lysines on the antibody surfaces. Since the antibodies are large, about 115/k in length, the degree of acceptor labeling must be high enough to guarantee that some labels are within 30 to 60/~ of the antibody-binding site, or labeled portions of a neighboring antibody bound to the same polyvalent antigen. A number of acceptor labels placed at a relatively long distance from the donor label can provide a result similar to that of one acceptor placed close to the donor label. The situation is different for DNA hybridization assays because there are no convenient functionalities, such as amino groups, on which to attach luminescent labels. Also, random multiple labeling would serve only to produce large luminescence backgrounds in the noncompetitive hybridization format, shown in Fig. 1A, since the linear nature of the hybrids permits label interactions only near the adjacent termini of the two probes. Random labeling might be effective in the competitive hybridization format, pictured in Fig. 1B, but the high labeling level required to ensure a high degree of label interaction would alter the stability of the hybridized complex. Specific terminal labeling of probes allows the labels to be placed at locations that maximize the interactions between the labels. In fact, assays based on dynamic and static quenching are feasible since the labels may be brought close enough to allow collisional contact. For common luminescent compounds, contact requires center-to-center separations of about 5 to 10/~. The length of the DNA double helix is 34/~ per single turn of 10 base pairs, in the most common B form of DNA. Labels placed within 9 to 18 base pairs, therefore, should show appreciable energy transfer, whereas labels placed within 1 to 3 base pairs of each other can additionally collide with one another. The length and rigidity of the chemical linkage between the DNA and the label also affect the separation distance and the ability of the labels to contact one another. Because energy-transfer and contact-quenching processes have different distance criteria, considerable control of the quenching process is possible. For example, it was shown that energy transfer is maximized when fluorescein and Texas Red labels, attached to two different nucleotides on the same strand of DNA, are separated by five intervening nucleotides in double-stranded hybrids (Heller and Jablonski, 1987). As the separation distance was increased beyond five intervening nucleotides,
440
Larry E. Morrison
energy transfer decreased, as expected; however, energy transfer also decreased as the separation distance was decreased. The latter decrease can be explained by the dominance of static and dynamic forms of quenching when the separation distances become small enough to allow contact between the labels. This is supported by the fact that opposing terminal labels on complementary DNA strands usually show strong quenching of one label with no corresponding increase in the emission of the second label (Morrison, 1987; Morrison et al., 1989). Even label pairs of fluorescein and tetramethylrhodamine displayed strong quenching of fluorescein emission with little or no increase in rhodamine emission. Energy transfer was favored, though, for one label pair examined: a 5'-pyrenesulfonate label opposed by a 3'-fluorescein label. The optimal separation distance for energy transfer, therefore, will depend on the particular label pair, since the type and strength of the short-range quenching interactions will be different. These short-range interactions are difficult to predict and must be determined empirically. In general, labels should be adjacent to one another or oppose one another to maximize dynamic and static quenching, and be separated by several nucleotides to optimize energy transfer.
C. Comparison of Assay Formats The noncompetitive and competitive assay formats pictured in Figs. 1A and B have received the most attention and will be compared here in greater detail. These two assays are alike in their dependence on label interactions, but differ in several fundamental aspects. The noncompetitive format directly measures the presence of target DNA through the hybridization of both probes to the target. The extent of energy transfer or contact quenching is proportional to the target concentration with one interaction occurring per target. As the target concentration approaches that of the probes, however, the increase becomes less than expected and even begins to decrease as the target concentration exceeds that of the probes. Excess target serves to separate probes as the likelihood of probes hybridizing to different target strands increases. This produces a peak in the response of the signal to the target concentration, similar to those observed for sandwich-type immunoassays. Performing the assay at two different sample dilutions identifies whether the target concentration is above or below the maximal response. The competitive assay format indirectly detects the target since the label interaction is determined instead by probe-to-probe association. Four different equilibria are coupled together as probe-to-probe hybridization competes with probe-to-target hybridization:
18. Energy Transfer and Fluorescence Quenching
441
K~
K2 P1 + P2---> P ] " P2 K4 T2 + P1 ~ T2" P1
T1 + T2---> T I " T2
Ks T1 + P2---'> T1 9 P2
where Z 1 and T 2 are the complementary target strands, P1 and P2 are the complementary probe strands, and K~ through K 4 are equilibrium constants. The four competing equilibria provide for a nonlinear relationship between label interaction and target concentration according to Eq. 6 (Morrison et al., 1989): [T 1 9 P2]/[P1
9 P2]o =
1 -
[PI"
P2]/[P1
"
P2]o
= [TI" T2]0/([P1" P2]0 + [TI" T2]0)
(6)
where [T 1 9 T2] 0 and [P1 " P2]0 are the initial concentrations of target and probe, respectively, before their denaturation at the beginning of the assay. If the label F is attached to P2 and the label Q, attached to P1, then the emission from F is greatest in the complex T1 9 P2 where Q is not present, and least in the complex P~ 9 P2. An expression similar to Eq. 6 holds when the target is a single-stranded polynucleotide, such as RNA (Morrison et al., 1989). Strictly speaking, Eq. 6 only holds when the equilibria constants K~ through K 4 are large and K1KE/KaK4 = 1. The first condition is generally true, but even though K1KE/KaK4 is rarely l, the relationship accurately describes the experimental observations. Figure 4 shows typical fluorescence changes associated with assays
100
,~
80
9 o
60
40 ,T
20 0 -11.5
-10.5
-9.5
-8.5
-7.5
Log [(target DNA), M]
Fig. 4mCompetitive hybridizations of samples containing either 1 nM (circles) or 0.1 nM (squares) complementary DNA probes and various concentrations of double-stranded target DNA in 1 M NaC1, l0 mM tris(hydroxymethyl)aminomethane, pH 8.0, containing 10/~g DNA/ml at 40~ The probes were fluorescein-(ethylenediamine)d(AGATTAGCAGGTTTCCCACC) and d(GGTGGGAAACCTGCTAATCT) (aminohexylaminoadenosine)-pyrenebutyrate and the target DNA was equimolar amounts of d(AGATTAGCAGGTTTCCCACC) and d(GGTGGGAAACCTGCTAATCT). Solid lines represent the theoretical relationships derived from Eq. 6. From Morrison et al. (1989) (Fig. 5, p. 240).
442
Larry E. Morrison
at two different probe concentrations and a number of different target concentrations. The solid curves were calculated using Eq. 6 and fit the data well. It may be noted that the useful assay range covers about a twoorder-of-magnitude change in target concentration with a midpoint equal to the initial probe concentration. Lower detection limits are obtained by reducing the amount of probe in the assay. Although the competitive assay format is nonlinear with target concentration, the relationship between the detected signal and target concentration is well defined and the signal does not decrease at high target concentration. Some examples of label quenching and enhancement observed in both hybridization formats are listed in Table I. It may be seen that large emission changes can be detected using either format with several different label combinations. The largest signal changes so far reported were achieved using the competitive format with labels placed at the 5'-terminus of one probe and the 3'-terminus of the other probe. In this situation deexcitation of F is usually dominated by static and dynamic quenching. The last entry in Table I shows the exception, in which energy transfer was detected with labels attached to the neighboring terminal positions. Significant emission changes were also reported when labels were placed on the 5'-termini of complementary 8 nucleotide long oligomers (eighth entry in table, Cardullo et al., 1988). With 5'-labeling of both probes, however, interaction between labels is greatly reduced as the lengths of the probes increase, making this method of probe attachment ineffective for practical hybridization assays. It may be noted that energy transfer has one advantage over other quenching mechanisms in that energy transfer provides a check for unexpected interactions between sample impurities and labeled probes. Quenching of the donor label must be accompanied by a corresponding increase in emission from the acceptor label if no other quenching processes are involved. If only quenching is monitored in an assay, then false positives or false negatives in noncompetitive or competitive assay formats, respectively, result from the presence of unforeseen sample impurities that quench the donor emission. The presence of such impurities would lead to nonproportionate donor and acceptor emission changes if energy transfer were monitored, and the assay result could be discounted. On the other side, it is often difficult to measure increases in acceptor emission because of background acceptor emission resulting from the direct absorption of external light intended for excitation of the fluorescent donor label. A method of overcoming the problem of direct acceptor excitation was demonstrated in an immunoassay using time-resolved detection and the combination of a short-lifetime acceptor label and a longlifetime donor label (Morrison, 1988). If it were established that quenching impurities would not be present, then assays based on any of the quenching mechanisms would be suitable.
<
e~
Z
e~
0
..1
-o= o Z
~ .~
~
~
~
~ .~ ~ ~ ~ ~
~
.., ~. .~ =. ~ ~ ~
o ~
,~
9 ,,,,4
~ ~g 0 0
0
9
m
~o
o,.~
,=.,
r,r = =
0
0
Z
o,.,~ i
8 r,#2
~-~ ,.~ ~
0 0
.,-4
g
0
0
~
~.0
~~
.~.oZ
444
Larry E. Morrison
A better method for removing background acceptor emission is to use a chemiluminescent donor. This eliminates the external excitation light source, leaving energy transfer as the sole means to excite the acceptor label. Applications of a chemiluminescent donor in DNA hybridization assays were only reported once (Heller and Morrison, 1985). The relatively small amount of attention paid to chemical excitation is attributable in part to the greater difficulty in controlling chemiluminescent reactions to provide reproducible light intensities, and in part to the limited number of suitable chemiluminescent compounds that are amenable to conjugation. The conjugation of chemiluminescence catalysts, such as peroxidase, to probes would greatly increase the light intensity and provide another avenue for chemical attachment. However, if the chemiluminescent intermediate produced by the catalyst does not remain bound to the catalyst, then diffusion away from the probe before light emission destroys the distance relationship required for energy transfer. A catalyst such as luciferase should not suffer from this problem, and the newer highly purified preparations of luciferase may be suitable for energy transfer assays.
D. Applications and Limitations The noncompetitive and competitive fluorescence-quenching and energytransfer formats share a number of advantages and disadvantages that are fundamental to homogeneous assays. The primary advantage of homogeneous assays is their simplicity, which generally leads to rapid assays using fewer reagents and requiting fewer manipulations. Since the assay is performed in a single phase, no immobilized reagents are required, and no washing of solid immobilization supports or formation and separation of precipitates is necessary. Homogeneous assays also eliminate background problems due to nonspecific adsorption of labeled reagents to solid immobilization supports. Homogeneous assays, however, are generally less sensitive than heterogeneous assays. Even though nonspecific adsorption is eliminated in homogeneous assays, background signals arise from the fact that the measurable properties of the labels are only partially modified as a result of the specific binding reaction, whether it is antibody-antigen binding or DNA hybridization. This leads to the limitation that a large excess of reagents over analyte cannot be used. Taken together with the fact that the probe concentrations must be kept high enough to allow binding between reagents and analytes within a reasonable incubation time, the minimal amount of detectable target is relatively high. For example, in the competitive hybridization assay format, if 90% quenching can be achieved when the two probes are hybridized to one
18. Energy Transfer and FluorescenceQuenching
445
another in the absence of target DNA, then the concentration of target DNA required to increase light emission by an amount equal to that of the background level is about one tenth that of the probe concentration. If 99% quenching could be achieved in the absence of target DNA, then target at 1/100 of the probe concentrations would provide signal equivalent to the background unquenched emission. Reducing the detection limit, therefore, requires lowering the probe concentration and/or finding labels that provide more efficient quenching. Reduction of the probe concentration can be taken only so far without drastically increasing the assay time. This can be seen in the times required for 50% hybridization, tl/2, for the first pair of complementary oligomers listed in Table II. The concentration dependence of the hybridization time is consistent with that of a bimolecular reaction. Consequently, the tl/2 is expected to be 2 hr for a 10-pM probe concentration, and about 1 d for a 1-pM probe concentration. Heterogeneous assays can use a large excess of probe over target since the excess probe is removed by washing. The high probe concentrations counteract the fact that reaction rates involving surface-immobilized species are inherently slower than purely solution-phase reactions. Nonspe-
T a b l e 11
Hybridization Characteristics of Labeled Oligomers in I M NaCI, pH 8.0 Hybridization tl/2 Oligomera F-AGATTAGCAGGTTTCCCACC P-TCTAATCGTCCAAAGGGTGG
F-TTGGTGATCC S-AACCACTAGG
Oligomer concentration (nM)
tl/2 (s)
10
12
1
74
0.1
850
10 1
0.1 F-AGATTAGCAGGTTTCCCACC S-TCTAATCGTCCAAAGGGTGG
Tm (~
10
34
Temperature (~
40 40 40
18
16
10
25
11 8
34 44
28 22 64
1
62
0.1
59
The sequence of the first oligomer in each pair is listed 5'-to-3'. The complementary oligomer sequence is listed in reverse. F, fluorescein isothiocyanate; S, sulforhodamine 101 (Texas Red); P, pyrenebutyrate.
a
446
Larry E. Morrison
cific adsorption increases at higher reagent concentrations, but if time is taken to wash the solid immobilization supports stringently, nonspecific adsorption can be reduced to low levels. The extra manipulations and time required for stringent washing of immobilization supports can be offset by the homogeneous techniques only if hybridization times are kept short, thereby limiting probe concentrations to about 0.1 nM or higher and limiting detectable concentrations of target DNA to about 10 pM, or about 1 fmol target in a 100-/zl sample. A 10-pM level of detection would be satisfactory for many applications in immunoassays. Therapeutic drug monitoring, for example, requires only the detection of micromolar amounts of material. The situation for DNA analyses is different, and there are few instances where 1 fmol of DNA is of diagnostic value. For clinical analyses, detection requirements below 1 amol DNA are common. Fortunately there are polynucleotide amplification systems available that multiply the amount of target DNA using polymerase enzymes. The PCR is the best known and most studied of the amplification systems and is capable of producing well over a million copies of each target DNA strand originally present in a sample (Mullis and Faloona, 1987). More important to the present discussion, PCR is a homogeneous technique that still requires a means of detecting the amplified polynucleotide. Reverting to a heterogeneous technique for detecting the PCR-amplified DNA would introduce additional manipulations and defeat the simplicity inherent in the PCR technique. Coupling PCR with a homogeneous detection technique allows for a completely homogeneous assay having the advantages of both high sensitivity and simplicity. This was demonstrated by the combination of a competitive fluorescencequenching assay with PCR amplification to detect a region within ~,-DNA (Morrison et al., 1989). Following 25 cycles of PCR, the midpoint of the quenching response corresponded to 96,000 molecules of original ~,-DNA, thereby providing subattomole detection. The total assay time was less than 4 hr, which includes the 3.5 hr required for the PCR amplification. The amplified fluorescence-quenching assay is schematically represented in Fig. 5. In summary, homogeneous assays using fluorescence quenching and energy transfer offer the advantages of speed and simplicity but provide inadequate detection levels for most clinical analyses. In light of these properties, the quenching assays appear particularly well suited for coupling with homogeneous amplification techniques that increase the amount of target sequences but still require a means for convenient detection. The following sections provide detailed experimental methods and procedures for the preparation, testing, and use of labeled probes in energy transfer and fluorescence-quenching DNA hybridization assays.
Fig. 5---Schematic representation of the PCR-amplified energy transfer or fluorescencequenching assay. Cross-hatching indicates the region within the target DNA that matches the sequence of the complementary labeled probes used for detection. Shading indicates the regions to which the two PCR primers hybridize during the PCR cycles of target amplification. In this example, the probes are 20 nucleotides long, and each primer is 25 nucleotides long. PCR is initiated by mixing the sample containing the target DNA with both primers, heat-stable DNA polymerase, and the four deoxynucleotide triphosphates, and heating the solution to 94~ to denature the target DNA. Repeated cycles of cooling and heating produce double-stranded copies of the target DNA, which include the central 20-base pair target sequence and the two flanking primer sequences (70 base pairs total). For simplicity, only the 70-base pair amplified section of the target DNA is shown in the amplification cycle since this predominates after several amplification cycles. Polymerase-catalyzed extension of the primers, during the 72~ incubation in the amplification cycle, produces two of these 70-base pair sections for every one present at the beginning of the cycle (only one is shown). Specific detection of the amplified DNA is achieved by adding the complementary labeled probe DNA, heating to 94~ to denature both probe and target DNA, cooling to promote competitive hybridization, and measuring the amount of quenching and/or enhancement of the labels F and Q, respectively.
448
Larry E. Morrison
II. MATERIALS A. Reagents Both the noncompetitive and competitive fluorescence-quenching and energy-transfer hybridization assays require the selective attachment of two labels to DNA strands. A number of different labeling chemistries are now available for solid-phase DNA synthesis that permit label attachment at either terminal position or at selectable internal positions of DNA oligomers (Heller and Jablonski, 1987; Cardullo et al., 1988; Telser et al., 1989a,b; Beaucage and Iyer, 1993). DNA oligomers containing such selective modifications can be obtained from companies specializing in custom DNA synthesis. Methods also exist for labeling polynucleotides from natural sources or unmodified synthetic oligomers. These include" (1) periodate oxidation of a 3'-terminal ribonucleotide, followed by reaction with an amine-containing label (Heller and Morrison, 1985); (2) enzymatic addition of a 3'-aliphatic amine-containing nucleotide using terminal deoxynucleotidyl transferase, followed by reaction with an amine-reactive label (Morrison, 1987; Morrison et al., 1989); and (3) condensation of an aliphatic diamine with the 5'-phosphate of a DNA strand, followed by reaction with an amine-reactive label (Morrison, 1987; Morrison et al., 1989). Some common labels compatible with the aforementioned labeling procedures are pictured in Fig. 6. The chemiluminescent labeling compound aminobutylethylisoluminol (ABEI; Sigma Chemical Company, St. Louis, Missouri) contains an aliphatic amine that will couple with the periodateoxidized ribonucleotides. The chemiluminescent properties of this and other amine-containing luminol derivatives have been compared (Schroeder and Yeager, 1978). The other labels pictured in Fig. 6 are fluorescent compounds, which can be coupled with DNA-containing aliphatic amine substituents. Common amine-reactive functionalities include isothiocyanates, N-hydroxysuccinimidyl esters, and sulfonic acid chlorides. Amine-containing luminol derivatives have also been converted to amine-reactive isothiocyanates (Patel et al., 1983). The following protocols describe 5'- and 3'-labeling of DNA using the condensation of ethylenediamine with 5'-phosphorylated DNA and the enzymatic incorporation of a 3'-amine-containing nucleotide. These reactions were selected since both can be performed easily in any biochemistry laboratory without the use of a DNA synthesizer, and both can be applied to synthetic DNA as well as DNA isolated from natural sources. Each terminal labeling procedure is performed in two parts, as depicted in Fig. 7, involving (1) modification of the DNA to provide aliphatic amine substituents, and (2) reaction of the amine-modified DNA with amine-
18. Energy Transfer and Fluorescence Quenching
449
O O (CH2)~C-ON O-"
O NH
H2N(CH2)4_ NH CH2 O CH3 N-(4-aminobutyl)-N-ethylisoluminol (ABEl)
N-hydroxysuccinimidyl I-pyrenebutyrate Me2N. , ~
,~/COOH N=C=S Fluoresceinisothiocyanate (FITC)
~
~
NMe2 /COO
S=C=N Tetramethylrhodamineisothiocyanate (TRITC)
SO2CI
~ 1-Pyrenesulfonicacid chloride
SO3
SO2CI TexasRed
Fig. 6mChemical structures of some common chemiluminescent and fluorescent labeling compounds used in energy-transfer and fluorescence-quenching assays (Texas Red is the trademark of Molecular Probes, Inc. for the sulfonic acid chloride derivative of sulforhodamine 101).
reactive fluorophores. The procedure for 5'-labeling also includes steps for phosphorylation of the DNA, if needed. 1. 5'-Terminal-Labeled DNA
a. 5'-Phosphorylation 1. Combine the following in a microcentrifuge tube" 10 nmol DNA strands (based upon 5'-OH termini) 2, 100/xl of 5X kinase buffer 2 Ten nmol DNA strands corresponds to 3.5 n/xg of DNA, where n is the number of nucleotides per strand. Ten nmol DNA strands also corresponds to 0.1 n OD units of singlestranded DNA or 0.07 n OD units of double-stranded DNA.
c,, , , - - .
I
0
.-
/
1,/ /
iX
0"~.
,
0
! .I,./oi
0
\
/
el
7T
/ !
=.\
/ \7,-
=- /
~.,0/
~/~
zz
-.__,4-
no
O0
0=o,. ~"
I
zz
/
/
o,.
@ ..l \ o --0 #
zz
-><'- / /
0~
/
/
a,. # i"t
il /
n
0
~
~. ~ ' ~ ~
N ~ " ~
-: i-:=
~
9- ~ . ~
"l=l I:%~= ~
9
~.~~
==~
~.,
I::I
o
a el=-'
.,,-,
18. Energy Transfer and FluorescenceQuenching
2. 3.
4.
5.
451
(5X kinase buffer = 300 mM Tris(hydroxymethyl)aminomethane (Sigma), 75 mM fl-mercaptoethanol, 50 mM MgC12, pH 7.8), 20/zl 5 mM adenosine triphosphate (ATP) (100 nmol; Pharmacia LKB Biotechnology, Inc., Piscataway, New Jersey), 100 units T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, Massachusetts), and demineralized water to a final volume of 500 ~1. Place the tube in a 37~ water bath. Add an additional 20/zl 5 mM ATP every 10 min for 40 min, and add an additional 100 units T4 polynucleotide kinase after 30 min of reaction. Isolate the phosphorylated DNA by gel permeation chromatography using a prepacked Sephadex G-25 column, such as a NAP 10 column (Pharmacia LKB Biotechnology, Inc.), preequilibrated in demineralized water. Apply the reaction mixture to the column and elute with demineralized water. Collect the phosphorylated DNA in the column void volume. Reduce the volume of the phosphorylated DNA to 500/xl in a centrifugal evaporator (Savant Instruments, Farmingdale, New York).
b. 5'-Animation (adapted from Chu et ai., 1983) 1. Prepare the ethylenediamine/carbodiimide solution just before use as follows: add 0.98 g 2[N-morpholino]ethanesulfonic acid (MES; Sigma) and 830 /~1 ethylenediamine (Aldrich Chemical Co., Milwaukee, Wisconsin) to 15 ml demineralized water, titrate the solution to pH 6.0 with 6 M HC1, dilute the solution to a final volume of 25 ml, and add 1 g 1-ethyl-3-(dimethylaminopropyl) carbodiimide (Sigma). 2. Add 500/~1 of the ethylenediamine/carbodiimide solution to the 500/zl phosphorylated DNA. 3. Allow the solution to react overnight (approximately 18 hr), with stirring, at room temperature. 4. Isolate the 5'-aminated DNA using gel permeation chromatography according to step 4 in the 5'-phosphorylation procedure. 5. Dry the 5'-aminated DNA sample in a centrifugal evaporator. c. Fluorophore Conjugation An amine-reactive label is attached by adding the reactive label, dissolved in an organic solvent, to the aminated DNA in an aqueous buffer suited to the coupling reaction. Good results can be obtained by following several general guidelines. For isothiocyanate and sulfonic acid chloride
452
Larry E. Morrison
label derivatives, a suitable buffer is 50 mM NazB407 at pH 9.3. For Nhydroxysuccinimide esters, a suitable buffer is 0.2 M 3-[N-morpholino]propanesulfonic acid (MOPS; Sigma) at pH 7.4. N-Hydroxysuccinimidyl pyrenebutyrate, however, reacts well in the Na2B407 buffer. Organic solvents capable of solubilizing different reactive fluorophores are acetone for N-hydroxysuccinimidyl pyrenebutyrate, dimethyl sulfoxide for fluorescein isothiocyanate, and dimethylformamide for Texas Red. Isothiocyanates are added in 50-fold molar excess to amine-modified termini, and sulfonic acid chloride and N-hydroxysuccinimidyl ester derivatives are added in a 100- to 200-fold excess to amine-modified termini. The amount of aqueous buffer present should be high enough that the organic solvent does not constitute more than 20% of the final reaction volume. Labeling reagents and labeled probes are sensitive to photodestruction and should be protected from prolonged exposure to light by covering containers with aluminum foil and reducing the room lights when coveting is not possible. The fluorophores shown in Fig. 6 and those used to label the probes listed in Tables I through III were obtained from Molecular Probes, Inc., Eugene, Oregon.
1. Dissolve the 10 nmol aminated DNA in 0.6 to 1.0 ml of the labeling buffer (see preceding sections). 2. Dissolve the amine-reactive labeling compound in the solubilizing solvent at a concentration of 0.01 M. 3. For isothiocyanate-derivatized labels, add 50 /A 0.01 M fluorophore solution to the aminated DNA solution. For Nhydroxysuccinimidyl and sulfonic acid chloride-derivatized labels, add 150/A of the fluorophore solution to the aminated DNA solution. 4. Allow the reaction to stir overnight (approximately 15 hr) at room temperature. 5. Filter the reaction solution through a small syringe-loaded filter with 0.2- to 0.45-/~m pore size (e.g., Acrodiscs from Gelman Sciences, Ann Arbor, Michigan). 6. Isolate the labeled DNA from the bulk of the labeling compound using gel permeation chromatography as described in step 4 of the 5'-phosphorylation procedure. The sample should be dried in a centrifugal evaporator and stored at -20~
d. Purification At this point the labeled DNA is sometimes pure enough to use in the quenching assays. Often, however, aggregates of the labeling material
18. Energy Transfer and FluorescenceQuenching
453
elute with the void volume of the small pre-packed columns, and further purification is advised. Complete removal of the unreacted labeling compound can be achieved by performing gel permeation chromatography using a larger column (1 cm diameter • 28 cm length) packed with Sephadex G-25. If medium- or high-pressure chromatography is used (i.e., FPLC and HPLC), the unlabeled DNA can be separated from the labeled DNA as well. Good separations are obtained on an FPLC system (Pharmacia LKB, Inc.) using a linear acetonitrile gradient between 0 and 50% acetonitrile (starting buffer, 10 mM tetraethylammonium acetate (TEAA); final buffer, 50:50 acetonitrile : l0 mM TEAA). The flow rate is 2 ml/min, and the gradient is increased at a rate between 0.5 and 1% acetonitrile/min. Material purified using these elution buffers is obtained free of the volatile buffer salts on drying. Store the dried DNA at -20~ 2. 3'-Terminal-Labeled D N A a. 3 ' - A m i n a t i o n
The following procedure uses terminal deoxynucleotidyl transferasecatalyzed addition of 8-(6-aminohexyl)aminoadenosine to the 3'-termini of DNA strands. Only a small excess of ribonucleotide triphosphate to 3'-termini is used in order to avoid the addition of two or three ribonucleotides. The same procedure also works well with amine-modified dideoxynucleotide triphosphates, in which case the addition of only one nucleotide is assured.
1. Combine the following in a microcentrifuge tube: l0 nmol DNA strands (based upon 3'-termini), 4.7 /~l 3.2 mM 8-(6-aminohexyl)aminoadenosine triphosphate (Sigma Chemical Co.; 1.5 mol triphosphate/mol 3'-termini), 18/~l 1 M potassium cacodylate at pH 7.0, 15/~l l0 m M COC12, 30 ~1 of a 500/~g bovine serum albumin/ml solution (nuclease free, Bethesda Research Laboratories, Gaithersburg, Maryland), 6 /~l 15 mM dithiothreitol, 620 units terminal deoxynucleotidyl transferase (Supertechs, Bethesda, Maryland), and demineralized water to a final volume of 150/xl. 2. Incubate the tube in a 37~ water bath for 5 hr. 3. Isolate the DNA as described in steps 4 and 5 of the 5'-amination procedure. At this point the fluorophore attachment and purification procedures are identical to those for 5'-labeling.
454
Larry E. Morrison
B. I n s t r u m e n t a t i o n The fluorescence-quenching and energy-transfer hybridization assays require instrumentation for detecting the light emitted by one or both luminescent labels. Any fluorometer can be used to perform assays using fluorescent labels, ranging from simple filter fluorometers to photoncounting spectrofluorometers. For chemical excitation, a luminometer or scintillation counter is used to detect the light emission. The complexity of the instrumentation increases if automated reagent delivery and temperature control are incorporated, and if monitoring of the light emission throughout hybridization is desired.
1. Fluorometers Fluorometers can be obtained in a variety of configurations, any of which is suitable for monitoring hybridization assays based on fluorescence quenching. Filter fluorometers rely on optical filters to select the wavelengths of light used to excite the fluorophores and to isolate the wavelengths of light emitted by the fluorophore. The simple design of a filter fluorometer allows high efficiency of light collection and low instrument cost. Filter fluorometers can be constructed from basic building blocks of a light source, sample compartment, and detector with associated light collection and focusing lenses. Spectrofluorometers use monochromators for selecting excitation and emitted light. The added expense of monochromators is not necessary for performing fluorescence-quenching assays; however, they are necessary when spectral characterization of the labeled reagents is desired. Energy-transfer assays can be monitored by using a single-channel instrument (one-emission detector), by measuring emission from only one of the labels, or by changing optical filters or monochromator settings to sequentially measure the emissions from both the donor and acceptor labels. Single-channel fluorometers are available from several companies, including Perkin-Elmer (Norwalk, Connecticut), Spex Instruments (Edison, New Jersey), and SLM-AMINCO Instruments (Rochester, New York). Energy-transfer analyses are faster if a dual-channel instrument is used, in which two detectors are placed each at 90~ to the excitation light path. Fluorometers and sample compartments of this design are available from SLM-AMINCO Instruments, Spex Instruments, and I.S.S. (Urbana, Illinois). Temperature control, automatic reagent injection, and time-based measurement capabilities are attractive features if kinetic or thermodynamic analyses are desired. Kinetic measurements can be used to determine the equilibration times required for complete hybridization of probes and target. They also provide the initial and final intensities of label emission
18. Energy Transfer and FluorescenceQuenching
455
from which the net fluorescence change is calculated. The net fluorescence change is less sensitive to fluorescent impurities in a sample, since fluorescence that is unchanged over the course of the hybridization is subtracted. A thermostated sample holder is required for kinetic analyses, because the rates of hybridization are temperature dependent, and the optimal rates are obtained at different temperatures for different length strands of DNA. Another advantage the thermostated sample holder provides is the ability to record fluorescence melting curves. Melting curves recorded on complementary labeled probes or between probes and target DNA are useful for demonstrating that the labeled probes are performing properly and for determining the temperature range in which the assays should be performed. It is difficult to find all of the above features in a single commercial fluorometer, and modifications may be necessary. I have modified an SLM-AMINCO Instruments model 4800 spectrofluorometer for the purposes of conducting automated fluorescence-quenching and energytransfer assays, in either a static or kinetic mode (Morrison et al., 1989), and for performing thermodynamic and kinetic analyses of labeled probes (Morrison and Stols, 1989,1993). The fluorometer layout is pictured in Fig. 8. The basic SLM-AMINCO sample compartment (A in Fig. 8) has two detection channels in a T format (180~ to each other and 90~from each to the excitation beam) and a third channel for monitoring the intensity of the excitation light. To increase sensitivity, the standard analog detectors were replaced with photon-counting detectors, consisting of two Hamamatsu (Middleton, New Jersey) R928 photomultiplier tubes in thermoelectric cooled housings (Model TE-177RE, Products for Research, Inc. Danvers, Massachusetts; H and I in Fig. 8). Two channels of photon-counting electronics consist of EG & G ORTEC (Oak Ridge, Tennessee) preamplifiers, amplifier/discriminators, and counter/timers. Photons emitted from the fluorophores are collected, filtered, and focused onto the photomultiplier tubes, where they are counted and the tallies are transferred to a Hewlett Packard (Palo Alto, California) Model 9836 computer over an IEEE 488 interface. The computer also records the relative intensity of the excitation beam detected at the reference photomultiplier tube (J) and normalizes the detected fluorescence by the reference value, in order to correct for fluctuations in the intensity of the excitation lamp (P). A digital buffer (home-built), analog-to-digital converter, and digital-to-analog converter interfaced to the computer allow the computer to input the reference signal, control a Hamilton Micro Lab P Syringe Dispenser (Reno, Nevada) for injection of probes, and control the temperature of a Haake (Saddlebrook, New Jersey) Model A81 refrigerated water bath, which circulates water through the thermostated sample holder within the sample compartment. The actual temperature within the sample cell is measured with a Yellow Springs Instruments (Yellow Springs, Ohio) precision
456
Larry E. Morrison
N
J
Fig. 8--Schematic drawing of a multichannel SLM model 4800 spectrofluorometer modified for photon counting. Key to the simultaneous detection of donor and acceptor emission is the SLM T-format sample compartment (A) providing detection of light emitted from a sample (B) in two directions normal to the path of the excitation light. The compartment also includes a beam splitter (E) for diverting a fraction of the excitation light to a detector (J) enabling correction of fluorescence intensities for variations in the intensity of the excitation light source (P). Other components include the excitation monochromator (N), the emission monochromator (K), the emission photomultiplier detectors, housed in thermoelectric cooled housings (H and I), emissions filters (C and D) used in the absence of emission monochromators, and an optics module (L) housing optional equipment such as an electronically driven mechanical shutter (M) for protecting the sample from extended exposure between automated fluorescence measurements and allowing the alternate recording of light and dark measurements.
t h e r m i s t o r and Keithly (Cleveland, Ohio) Model 179-20A Digital Multimeter e q u i p p e d with an I E E E 488 interface.
2. L u m i n o m e t e r s A n u m b e r of c o m m e r c i a l l u m i n o m e t e r s are available that contain a single p h o t o m u l t i p l i e r d e t e c t o r and are suitable for monitoring chemilumin e s c e n c e in a q u e n c h i n g - b a s e d hybridization assay. Such l u m i n o m e t e r s are available, for e x a m p l e , from Los A l a m o s Diagnostics, Inc. (Los A l a m o s , N e w Mexico), Berthold Analytical, Inc. ( N a s h u a , N e w H a m p shire), P h a r m a c i a L K B , Inc., and T u r n e r Designs (Mountain View, California). S o m e l u m i n o m e t e r m o d e l s a c c e p t optical filters, providing the potential for m e a s u r i n g the e m i s s i o n from two labels sequentially. Only one c o m m e r c i a l l u m i n o m e t e r (Turner Designs) has two d e t e c t i o n chan-
18. Energy Transfer and Fluorescence Quenching
457
nels, which allows the simultaneous monitoring of donor and acceptor label emission. The dual-channel luminometer accepts filters and uses a signal-chopping technique, which approaches the sensitivity of photon counting. Luminometers are less complicated than fluorometers and can be constructed fairly easily. The luminometer is essentially a light-tight enclosure containing a sample holder and a detector, and may optionally contain focusing optics. Two designs the author has built provide dual-channel detection with filtering capabilities and temperature control. The first design uses two lenses to collect light from the sample in each of two directions and to focus the light onto two photomultiplier detectors. The lenses allow the detectors and sample cell to be separated from each other, providing room for filter holders and large auxiliary components that might be used from time to time in specialized applications. Reagents are injected through a light-tight septum in the sample compartment lid or through a small-diameter teflon tube passing through the side of the sample compartment. Because the light is focused on the detector, either the large cathode end-on photomultiplier tubes or the smaller cathode side-on tubes may be used. Cooled and shuttered photomultiplier housings and photon-counting electronics are identical to those used on the photon-counting fluorometer. The second design is more compact, owing to the removal of the focusing optics, and is pictured in Fig. 9. The small thermostated sample compartment (A) is required for high-efficiency light collection, as are the large cathode photomultiplier detectors (F). The optical filters are sandwiched between the sample compartment and detectors, fitting within impressions (E) in either side of the sample cell holder (B). The sample holder is designed so that raising the holder is required to open the sample compartment lid (C). Raising the holder in this manner serves to shutter the detectors, providing a convenient means for their protection. Reagents are injected through a rubber septum (H) in the sample compartment lid positioned directly above the sample. Both luminometers have been automated with computer-controlled reagent dispensers and data-acquisition electronics, similar to the modified fluorometer. Since chemiluminescence does not provide an instantaneous response, like fluorescence, automated recording of melting curves and hybridization kinetics is not possible. However, light emission from a chemiluminescent reaction can be complex, and important information is obtained by monitoring the rate of light emission over the course of the chemiluminescence reaction. For example, inhibitors in the samples can cause the peaks of the chemiluminescence to occur at different times relative to time of reagent injection. Acquiring data continuously following reagent injection will determine whether such inhibitors are present and provide the peak emission intensity regardless of the delay.
458
Larry E. Morrison
i
A
Fill. 9--Schematic drawing of a dual-channel photon-counting luminometer. Components include a sample compartment (A), 3.6 cm in width, a sample holder (B) with impressions to hold two emission filters (E) and a septum port (H) to permit light-tight reagent delivery to the sample, and photomultipler detectors (F) housed within thermoelectric cooled housings (G) with the photocathodes placed 5 cm from the center of the sample cuvette (D). The sample holder also serves as a shutter to protect the photomultiplier tubes. In order to access the sample cuvette within the sample compartment, the sample holder must be raised high enough to allow rotation of the sample holder lid (C). In this position, light entering the sample holder is prevented from reaching the photomultiplier tubes.
III. PROCEDURES Energy-transfer and fluorescence-quenching techniques are best applied to homogeneous solutions and, therefore, will probably find little application to the more familiar heterogeneous methods of DNA analysis in use today. These common methods, including the various blotting techniques, affinity-based separations of DNA, and DNA-sequencing methods, employ solid immobilized supports or gel matrices for separation of DNA species. When solid supports are used, a single labeled probe is sufficient and is easily removed by washing procedures. Also, fluorescence measurements are made more difficult on solid supports, such as nitrocellulose filters, owing to the large amount of light scattering and impurity fluorescence at the surface of the solid support. An exception is the detection of specific DNA sequences within gel bands. Light scattering and impurities would be lower than those on membrane filters, and detection would be
18. Energy Transfer and Fluorescence Quenching
459
rapid since the unbound probe would not have to diffuse out of the gel before measurements could be made. This application, however, is untested at this time. The following procedures describe how energy-transfer and fluorescence-quenching methods are used in place of blots and other heterogeneous methods to detect DNA free in solution without the need for immobilization. Procedures are included for the direct detection of DNA as well as for the detection of enzymatically amplified DNA. Procedures for characterizing the labeled reagents and for performing the light-emission measurements are also included.
A. Light-Emission Measurements Light-intensity measurements are common to all forms of the energytransfer and fluorescence-quenching assays. One of the most important variables in measuring light is the selection of optical filters and/or monochromator settings. The only instance in which light filtering is not required is when the label L is chemically excited and Q is either nonemissive or emits at wavelengths beyond the sensitivity of the detector being used. Table III provides the excitation and emission maxima for a number of fluorescent labels, along with other pertinent spectral information. The literature should be consulted for labels not included in this list. It is good practice to record the excitation and emission spectra of new labels after attachment to DNA probes since spectral shifts may occur relative to the Table 111 Spectral Characteristics of Labels Commonly Used in Energy-Transfer and Fluorescence-Quenching Hybridization Assays
=,
Label a
Excitation maximum b (nm)
Emission maximum b (nm)
(M-lcm-1)
(M-lcm-l)
FITC Tx Rd PYB TRITC ABE1
494 596 350 558 (chemical)
520 606 378 581 420
68,000 110,000 27,000 88,000 54,000
13,000 21,000 10,000 33,000 12,000
8Xmax, label
b
8260, label c
See Table I for key to label abbreviations. b Except for ABEI, the label spectral values were determined using labels conjugated to DNA. r Label extinction coefficients at 260 nm were estimated by first determining the ratio of the unconjugated label absorbance at 260 nm to its absorbance at the long wavelength maximum. The ratio was then multiplied by eXrnax,label"
a
460
Larry E. Morrison
unconjugated dyes. Usually the spectral shifts will amount to only several nanometers; however, large changes in the quantum yield of a label are not uncommon on conjugation. Excitation monochromator settings or filters are selected to pass as much light within the excitation region of F as possible without passing light in the wavelength range transmitted by the emission monochromators or filters. The emission monochromator settings or filters are selected to pass as much light within the emission band of F (quenching assays) or Q (energy transfer assays) while excluding the excitation light. 1. Static Fluorescence Measurements
1. Select appropriate monochromator settings and/or filters from the values given in Table III. 2. Place the sample in a quartz cuvette (glass is acceptable if all wavelengths involved are in the visible portion of the spectrum), and place the cuvette in the fluorometer. Allow the sample to equilibrate to the temperature of the thermostated sample holder. Room temperature is acceptable where this does not interfere with hybridization. 3. Record the signal produced by the emission detector(s), S~m. Simultaneously record the signal produced by the reference detector, Sref, if the fluorometer is equipped with a reference detector that monitors the intensity of the excitation light. 4. Repeat steps 2 and 3 for a similar sample for which the probe containing the label F has been deleted. This provides the background fluorescence, Sbkg , and the associated reference signal, Sref, bkg"
5. Calculate the net fluorescence signal for each emission band monitored, corrected for lamp intensity, according to Eq. 7" (7)
Sem, net -- Sem/Sref - Sbkg/Sref, bkg
Set the reference signals equal to 1 in the above equation if the fluorometer does not have a reference detector. I
III
II
IIIIIII
Quenching or enhancement of fluorescence can be calculated as the percentage decrease or increase of the maximum fluorescence change, %Afmax, according to Eq. 8" ~
- 100(S~
n e t - Sem, net)/(S~
n e t - S~em, net)
(8)
18. Energy Transfer and Fluorescence Quenching
461
This requires measuring the fluorescence of samples in which the two extremes in fluorescence are obtained, that is, in one sample in which the interaction between the labels is absent, providing SOem, net, and in a second sample in which the interaction is maximal, providing S~ net- The samples used to determine S~ net and S~ ' net are different, depending on the assay format 9 For the competitive assay format, SOem, net is measured using a sample in which both probes are present together with a 100-fold or larger target excess. S~em,net is measured using a sample containing both probes and no target 9 For the noncompetitive assay format, SOem, net is measured as in the competitive assay format, but can additionally be measured using a sample containing both probes and no target. S~em,net is measured on samples containing both probes and a target concentration equal to that of the probe containing the label F.
2. Kinetic Fluorescence Measurements
Kinetic fluorescence measurements are made in the same manner as static measurements except that the fluorescence is monitored continuously after initiation of the hybridization. Often hybridization is initiated by injecting the denatured DNA solution into a cuvette in the fluorometer sample holder, which is maintained at some temperature below the melting temperatures of target/probe and probe/probe double-stranded complexes. Continuous fluorescence measurements are obtained by several methods, including (1) manually recording Sem at regular intervals; (2) connecting a strip chart recorder(s) to the amplified output of the analog photomultiplier detector(s) and continuously recording the analog signal versus time; and (3) acquiring and storing Sem at regular intervals with a computer. Subsequent data processing is easiest using the latter method. An example of computer-acquired kinetic data is shown in Fig. 10. These data were recorded during competitive hybridizations between fixed amounts of DNA probes (F, Fluorescein) and various amounts of target DNA (Escherichia coli plasmid). At the low probe concentrations used in these assays, the background fluorescence was large and the sampleto-sample variation in the background fluorescence was significant. To correct for this background variation, each data set was offset by a different intensity value to equalize the initial Sem of each data set. Before equalization of the initial Sem values, the final values of the fluorescein emission intensities could not be correlated with the target DNA concentrations. Following the offset procedure, the final fluorescence values decreased with decreasing target concentration, as expected in a competitive hybridization assay, and a sample containing 4 pM target DNA was distinguishable from the sample containing no target DNA.
462
Larry E. Morrison 12.5 ,-
,
,
11.6 ~-'~~...~.
t._
~N OE e- ..~
(DO
oo (~
. 2 nM
10-.7 ',,
__4,,.
.1 rim
98
L
On _~0
II
,,_.,
89 8.0 0.0
4pM/~ No t a r g e t / i
I..
1 .2
1
I
2.4
!
,
3.6
t
-~ t
4.8
i
6.0
Time (hr)
Fig. 10--Competitive hybridization assay for E. coli enterotoxin gene. Five complementary pairs of labeled probes were used simultaneously to increase sensitivity at a concentration of 20 pM per pair. Each strand was labeled with both a 5'-fluorescein and a 3'-pyrenebutyrate. Samples consisted of the E. coli enterotoxin gene fragment and 10/~g k DNA/ml. Samples were heated in a boiling water bath for l0 min, after which time the probe pairs were added and heating continued for another 2 min. The samples were then diluted with buffer to a final concentration of I M NaCl, l0 mM EDTA, and l0 mM tris(hydroxymethyl)aminomethane, pH 8.0. Fluorescence was monitored using photon counting over 2-sec intervals separated by 5 sec for 6 hr following dilution of the denatured probe and target solution. The fluorometer sample compartment was maintained at 42~ throughout the experiment. The data were smoothed by averaging each time point with the five time points on either side (11 points total, approximately l min time resolution). From Morrison et al. (1989) (Fig. 6, p. 240).
3. Chemiluminescence Measurements
Chemiluminescent reactions are initiated by the addition of a chemical coreagent or catalyst. I shall describe here only the luminol reaction since it has proved useful in energy-transfer assays. Other chemiluminescent compounds can be used with the limitation that they be attached to the DNA probe by a linkage that remains intact at the time of light emission. Likewise, the chemiluminescent or bioluminescent catalyst can be conjugated to the DNA only if the chemiluminescent compound remains associated with the catalyst at the time of light emission. Under conditions amenable to DNA hybridization, the luminol reaction requires an oxidant and a catalyst for appreciable rates of light emission. A number of oxidant/catalyst combinations have been examined, and the most sensitive include hydrogen peroxide as the oxidant and microperoxidase as the catalyst (Schroeder and Yeager, 1978). Solution pH values near 7 are acceptable; however, higher rates of light emission are obtained at higher pH values, such as pH 8, where double-stranded DNA is still stable.
18. EnergyTransfer and FluorescenceQuenching
463
1. If the luminometer accepts emission filters, select the filter from the information provided in Table III. 2. Prepare a l0 ~g/ml solution of microperoxidase (MP-1 l, Sigma) in the luminescence reaction buffer (e.g., 25 mM sodium phosphate, 100 m M NaC1, pH 7.2). 3. Prepare the sample in the luminescence reaction buffer and add l0 /~1 of the l0 /~g/ml microperoxidase solution per ml of the reaction buffer. 4. Place the sample in a cuvette or glass tube appropriate for the luminometer and allow the sample to equilibrate to the temperature of the thermostated sample holder. Room temperature is acceptable if it does not interfere with hybridization. 5. Prepare a 400-fold dilution of 30% H202 using demineralized water. 6. Inject 100/~1 of the diluted H202 solution per 1 ml of sample to initiate chemiluminescence. 7. Measure the signal(s) produced by the emission detector(s) at regular intervals as the chemiluminescence increases and then begins to decrease. 8. Repeat steps 2 through 6 for a background sample in which the luminol-labeled probe is omitted, measuring chemiluminescence over the same period as for the other sample. 9. Determine the value of the maximum signal produced by the first sample and the time at which the maximum occurred. Subtract the signal recorded on the background sample at the same reaction time from the first sample to obtain the net signal, Sem, net" The percentage quenching and enhancement are calculated using Eq. (8) where S~ net and S~em,n e t are obtained using the same sample compositions described in the section on static fluorescence measurements.
B. Reagent Characterization Some degree of labeled probe characterization should be performed before using the newly labeled probes in a hybridization assay. The minimum characterization includes a determination of the probe concentration and the labeling percentage, both of which can be determined from an absorbance spectrum. When probes of a new length or containing a new label are first prepared, further characterization may be necessary to
464
Larry E. Morrison
determine the temperature range in which the probes hybridize best and to determine whether the new label's emission properties are adequate.
1. Composition and Concentration of Labeled Probes The concentration of probe is determined from the probe absorbance at 260 nm, A260, after subtracting the absorbance contribution of the label. This is done by recording the A260 and the absorbance at the long wavelength maximum of the label, Axmax,and solving the following two simultaneous equations: A260 = e260,label [label] + /3260, DNA [probe]
(9)
Axmax = 8Xmax, label [label] + 8Xmax, DNA [probe]
(10)
and
where 8260,label is the absorbance extinction coefficient ( M -1 c m - l ) of the label at 260 nm, e260,DNA is the absorbance extinction coefficient of the DNA strand at 260 nm, eXmax,~abe~is the absorbance extinction coefficient of the label at the long wavelength maximum of the label, eXmax,DNA is the absorbance extinction coefficient of the DNA strand at the long wavelength maximum of the label, [label] is the concentration (M) of the label attached to the DNA strand, and [probe] is the concentration of the DNA strand (M) composing the DNA probe. For labels absorbing in the visible portion of the spectrum, eXmax,DNA is negligible and [probe] can be calculated according to Eq. 11" [probe] = {A260 - (8260, label/eXmax, label)Axmax}/S260, DNA
(1 1)
e260, DNA can be approximated by a value of 10,000n M -~ cm -~, where n is the number of nucleotides in each probe strand. Extinction coefficients of oligomers can be calculated within 10% certainty using tables of values for nearest neighbor interactions (Borer, 1976). Some experimentally determined values of e260, label and 8max,label are provided in Table III for several common labels. The concentration of conjugated label is likewise calculated from the simultaneous solution of Eqs. 9 and 10. For labels absorbing in the visible portion of the spectrum, the calculation reduces to [label] = A~,max/~:xmax' label
(12)
The probe composition, determined as the percentage of probe labeled, is then calculated as 100[label]/[probe]. The Q-labeled probe should be labeled as close to 100% as possible to obtain maximal quenching or energy transfer. The F-labeled probe should be labeledas close to 100% as possible to obtain the maximal fluorescence intensity.
18. Energy Transfer and FluorescenceQuenching
465
2. Titration of Labeled Probes
Probe concentrations determined by the above procedure may be in error as much as 12%, 16%, and 17% for 20-, 12-, and 10-nucleotide long oligomers, respectively (Morrison et al., 1989), leading to even greater uncertainty in the relative concentrations of two probes used together in an assay. The proportions in which labeled probes should be combined in a hybridization assay can be determined better by titrating one probe with the other. For titrating complementary probes, use the following procedure.
1. Prepare solutions containing the probe labeled with F at a fixed concentration and the probe labeled with Q at concentrations ranging between 0 and 5 times the fixed probe concentration. 2. Allow the probes sufficient time to hybridize. 3. Measure the amount of light emitted by one or both labels. 4. Plot the amount of emitted light versus the ratio of the two probes [(Q-labeled probe)/(F-labeled probe)]. 5. Fit the data points recorded on samples with excess F-labeled probe with one straight line and fit the data points recorded on samples with excess Q-labeled probe with a second straight line. 6. Determine the point of equivalence as the intersection of the two straight lines. 7. Recalculate the concentration of the Q-labeled probe by dividing the previously estimated Q-labeled probe concentration by the ratio of the two probes at the equivalence point. If it is believed that the initial estimate of the Q-labeled probe concentration is the more reliable value, then recalculate the concentration of the F-labeled probe as the product of the previously estimated Flabeled probe concentration and the ratio of the two probes at the equivalence point.
An example of the equivalence point determination is shown in Fig. 11. Below the equivalence point, the light emission should decrease linearly with increasing probe ratio, and above the equivalence point, the light emission should be invariant. For probes used in the noncompetitive assay format, the above procedure can be used, except that several titrations of the F-labeled probe with the Q-labeled noncomplementary probe are performed, each titration using a different target DNA concentration that brackets the estimated F-probe concentration. Several data sets similar to those in Fig. 11 are generated with the one displaying the lowest light
466
Larry E. Morrison 10 )
9-~ ffl
8
9~ "~
6
'I
~149 9149176 9176
o
. . . . . . . . - : - - t ..... 9 . . . . . . .
2
,.o
o~
U.
o
0'.4 0.'8 '1'.2 1.'8 2.0 [lOmer-Sulforhodamine 101J [Fluorescein- 10mer]
Fig. l 1--Titration o f 5 ' - f l u o r e s c e i n - T T G G T G A T C C with 3'-sulforhodamine 101 ( T e x a s Red)-labeled complementary oligomer to determine the equivalence point. A fixed concentration of the fluorescein-labeled oligomer was mixed with increasing amounts of the sulforhodamine 101-labeled complement and the relative fluorescein emission intensity plotted versus the ratio of the two labeled oligomers. The linear decrease in fluoroscein emission with increasing concentration of the sulforhodamine-labeled complement below the equivalence point is fit with a straight line, as is the constant fluorescence measured above the equivalence point9 The intersection provides the optimal concentration ratio for use in competitive hybridization assays. The equivalence point o f 0.82 indicated in this plot is within the predicted uncertainty in the ratio of the two oligomer concentrations of the expected value o f 1.0. The buffer contained 1 M N a C l a n d l0 m M T r i s at pH 8.0.
intensity in the horizontal region of the data (high probe ratio) indicating equivalence between the target and the F-labeled probe concentration. The equivalence point in this data set is used to recalculate the probe concentrations relative to one another. 3. Determination of Hybridization Conditions Hybridizations should be performed at a temperature low enough to afford nearly complete association between the probe and target DNA strands, but high enough to provide rapid hybridization. Likewise, the length of the hybridization period should be long enough to ensure nearly complete hybridization. This requires on the order of about 10-tl/2. The optimal hybridization temperatures and times are strongly dependent on the composition and concentration of the DNA probe as well as the solution ionic strength. Several relationships have been derived for predicting the T m values (the temperature at which 50% of the possible base pairs are formed) and the hybridization rates of polynucleotides. These relationships and several rules of thumb for hybridization conditions have been reviewed (Wahl et al., 1987). For short oligomers a temperature about 5~ below the T m is optimal for hybridization, whereas a tempera-
18. Energy Transfer and FluorescenceQuenching
467
ture between 18 and 32~ below the T m is optimal for high-molecularweight DNA. Labeling of the DNA probes can alter their hybridization characteristics, and a more accurate determination of the T m and hybridization rate may be desired. The T m c a n be measured by recording the fluorescence of a solution containing the probes and buffer salts at the concentrations intended for the hybridization assay. The target is omitted for complementary probes (competitive assay format) and included at a concentration equal to the F-labeled probe for noncomplementary probes (noncompetitive assay format). The temperature of the solution is increased slowly to allow equilibration of the DNA strands and the fluorescence recorded at fixed temperature increments (Morrison et al., 1989). Plotting the fluorescence of F and/or Q, where applicable, provides the melting curve with midpoint equal to Tm. Hybridization rates can be measured using the same sample compositions as used for the T m measurements. Hybridization is initiated by either combining the complementary probes or rapidly cooling the complete hybridization mixture from a temperature well above the T m t o the hybridization temperature. Some T m and tl/2 values measured in my laboratory are listed in Table II and may be used as a first approximation for the T m and tl/2 values of oligomers of similar length in 1 M NaC1.
C. Nonamplified DNA Hybridization Assays Hybridization assays can be performed once the probe stock concentrations have been determined and the T m and t~/2 values have been measured or estimated for the probes under the conditions selected for the assay. The level of fluorescent impurities should be carefully controlled by pretreatment of the samples (e.g., spun column purification or ethanol precipitation) and by using high-purity-buffer components. Particularly important is the use of high-purity NaC1, such as J. T. Baker (Phillipsburg, New Jersey) Ultrex grade or Johnson Matthey Puratonic grade distributed by Alfa Products (Danvers, Massachusetts).
1. CompetitiveHybridizationAssay 1. Prepare a stock solution of 1:1 complementary labeled probes in water at a concentration 12 times greater than the final concentration desired in the assay.
468
Larry E. Morrison
2. Combine 50/xl of the sample with 10/xl of the 1"1 probe solution and 60/.d buffer containing 2 M NaCI, 1 mM EDTA, 4-20/xg/ ml carrier DNA (e.g., h-DNA), and 20 mM NaH2PO4 at pH 8.0 in a 500-/zl conical plastic tube. 3. Place the tube in a boiling water bath for 2 min. 4. Immediately place the tube in a water bath or thermostated sample holder at the hybridization temperature and begin timing. 5. Measure the amount of emission from either or both labels periodically over the incubation period (kinetic measurement) or when the incubation period is complete (static measurement). 6. Calculate the %Afmax for each sample using Eq. 8. Calculate the target DNA concentration according to Eq. 13" [Tl'T2]o = (100 -
~
(13)
Note that the two labeled probe reagents may be added separately to the sample and the denaturation step (step 3) omitted if the target polynucleotide is already in single-stranded form, as is the case when the target polynucleotide is RNA.
2. Noncompetitive Hybridization Assay The noncompetitive hybridization is performed by exactly the same procedure as the competitive assay, except that the labeled complementary probes are replaced by the two labeled probes that hybridize to contiguous sequences on the target polynucleotide.
D. Amplified DNA Hybridization Assays The amplification example provided below uses PCR to amplify doublestranded DNA targets. A number of experimental parameters may be varied in the amplification steps, and other sources should be consulted in determining primer oligonucleotide lengths, temperatures, the number of amplification cycles, etc. (Mullis and Faloona, 1987). Primers that exactly flank the sequence recognized by the labeled probes provide the shortest amplified DNA possible, thereby minimizing the consumption of PCR reagents and reducing possible problems associated with strand displacement. The length of the amplified DNA is the sum of the two primer lengths and the probe length. The following PCR protocol is adapted from the Perkin-Elmer Cetus GeneAMP Amplification Reagent Kit (Norwalk, Connecticut) and is combined with the competitive fluorescencequenching assay (Morrison et al., 1989).
18. EnergyTransfer and FluorescenceQuenching
469
1. Mix the following together in a 500-/~1 conical plastic tube: 10/~l 10x PCR reaction buffer (500 m M KC1, 15 m M MgC12, 0.1% (w/v) gelatin, and 100 m M t r i s ( h y d r o x y m e t h y l ) a m i n o m e t h a n e at pH 8.3), 16/~l d N T P solution (1.25 m M each of dATP, dTTP, dCTP, and dGTP neutralized to pH 7 with NaOH), 5/~l primer solution (20 /~M of each of the two primers in demineralized water), 68/~1 or less sample D N A , demineralized water to a final volume of 100/~l, and 0.5/~1 Taq Polymerase (5 units//~l, PerkinElmer Cetus). 2. Incubate the sample at the following temperatures and times using a programmable temperature block (Perkin-Elmer Cetus D N A Thermal Cycler) or three water baths: 1 min at 94~ 2 min at 37~ and 3 min at 72~ 3. Repeat step 2 for the desired number of amplification cycles (e.g., 25 cycles). 4. Complete the amplification with a 7-min incubation at 72~ 5. Proceed with the nonamplified detection procedure using 50/~l of the PCR reaction solution as the sample.
120 c~
i
i
i
i
i
i
i
100
t--
~"
80
o
60
~Q
40 20
eQ 0
o
.
&O
U..
~
0
-20 2.5
!
I
3.5
I
I
4.5
I
I
5.5
t
6.5
Log (molecules), DNA)
12--Detection ofPCR-amplifiedDNA by competitive hybridization with labeled probes. Samples containing various amounts of ~, DNA were carried through 25 cycles of PCR, and half of each sample (50/~l) was denatured with 1 nM each of fluoroscein-(ethylenediamine)GATCCCACCTCATTTTCATG and CATGAAAATGAGGTGGGATC(aminohexylaminoadenosine)-pyrenebutyrate in a final volume of 120/~l. Fluorescence was recorded after 15 min of reassociation at 40~ Fluorescence is plotted as %Afmax= % fluorescence change, and the solid line was calculated using Eq. (13) with [T1.T2]0 = 751,000[~, DNA]. The abscissa displays the number of ~,DNA molecules present in each 50/~l of sample before PCR amplification. Different plotting symbols represent data from experiments performed on different days. From Morrison et al. (1989) (Fig. 7, p. 241). Fig.
470
Larry E. Morrison
An example of the data obtained from amplified hybridization assays detected by fluorescence quenching is shown in Fig. 12. Application of Eq. 13 to the PCR-amplified data determines the amount of amplified DNA present in the sample. The amount of DNA present in the original sample before amplification can only be estimated since the amount of amplification will vary from sample to sample and is dependent on a number of factors, including the original amount of target DNA present in the sample and the number of PCR cycles performed. Amplification can be estimated by repeating the assay using known amounts of the target DNA. The data plotted in Fig. 12 were obtained using known quantities of DNA target at the start of the PCR reactions; an amplification factor of 750,000 was obtained after 25 cycles of PCR (Morrison et al., 1989).
REFERENCES Bannwarth, W., and Mailer, F. (1991). Energy transfer from a lumazine (=pteridine2,4(lH,3H)-dione) chromophore to bathophenanthroline-ruthenium(II) complexes during hybridization processes of DNA. Heir. Chim. Acta 74, 2000-2008. Beaucage, S. L., and Iyer, R. P. (1993). The functionalization of oligonucleotides via phosphoramidite derivatives. Tetrahedron 49, 1925-1963. Borer, P. N. (1976). Measured and calculated extinction coefficients at 260 rim, 25~ and neutral pH for single-strand RNA and DNA. In "Handbook of Biochemistry and Molecular Biology" (G. D. Fasman, ed.), 3rd Ed., Vol. I, p. 589. CRC Press Cleveland, Ohio. Cardullo, R. A., Agrawal, S., Flores, C., Zamecnik, C., and Wolf, D. E. (1988). Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. U.S.A. 85, 8790-8794. Chu, B. C. F., Wahl, G. M., and Orgel, L. E. (1983). Derivatization of unprotected polynucleotides. Nucleic Acids Res. 11, 6513-6529. Clegg, R. M., Murchie, A. I. H., Zechel, A., and Lilley, D. M. J. (1993). Observing the helical geometry of double-stranded DNA in solution by fluorescence resonance energy transfer. Proc. Natl. Acad. Sci. U.S.A. 90, 2994-2998. Conrad, R. H., and Brand, L. (1968). Intramolecular transfer of excitation from tryptophan to l-dimethylaminonaphthalene-5-sulfonamide in a series of model compounds. Biochemistry 7, 777-787. Cooper, J. P., and Hagerman, P. J. (1990). Analysis of fluorescence energy transfer in duplex and branched DNA molecules. Biochem. 29, 9261-9268. Eftink, M. R., and Camillo, G. A. (1981). Fluorescence quenching studies with proteins. Anal. Biochem. 114, 199-227. F6rster, T. (1959). Transfer mechanisms of electronic excitation. Disc. Faraday Soc. 27, 7-17. HeUer, M. J., and Jablonski, E. J. (1987). Fluorescent Strokes shift probes for polynucleotide hybridization assays. European Patent Application 229 943. Heller, M. J., and Morrison, L. E. (1985). Chemiluminescent and fluorescent probes for DNA hybridization systems. In "Rapid Detection and Identification of Infectious Agents" (D. T. Kingsbury and S. Falkow, eds.), pp. 245-256. Academic Press, Orlando, Florida. Heller, M. J., Morrison, L. E., Prevatt, W. D., and Akin, Cavit (1983). Light-emitting polynucleotide hybridization diagnostic method. European Patent Application 070 685.
18. Energy Transfer and FluorescenceQuenching
471
Lakowicz, J. R. (1983). "Principles of Fluorescence Spectroscopy." Plenum Press, New York. Lee, L. G., Connell, C. R., and Bloch, W. (1993). Allelic discrimination by nick-translation PCR with fluorogenic probes. Nucleic Acids Res. 21, 3761-3766. Morrison, L. E. (1987). Competitive homogeneous assay. European Patent Application 232 967. Morrison, L. E. (1988). Time-resolved detection of energy transfer: Theory and application to immunoassays. Anal. Biochem. 174, 101-120. Morrison, L. E., and Stols, L. M. (1989). The application of fluorophore-labeled DNA to the study of hybridization kinetics and thermodynamics. Biophys. J. 55, 419a. Morrison, L. E., and Stols, L. M. (1993). Sensitive fluorescence-based thermodynamic and kinetic measurements of DNA hybridization in solution. Biochem. 32, 3095-3104. Morrison, L. E., Halder, T. C., and Stols, L. M. (1989). Solution-phase detection of polynucleotides using interacting fluorescent labels and competitive hybridization. Anal. Biochem. 183, 231-244. Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in vitro viaa polymerasecatalyzed chain reaction. Methods Enzymol. 155, 335-350. Oser, A., and Valet, G. (1990). Nonradioactive assay of DNA hybridization by DNAtemplate-mediated formation of a ternary TblII complex in pure liquid phase. Angew. Chem. Int. Ed. Engl. 29, 1167-1169. Ozaki, H., and McLaughlin, L. W. (1992). The estimation of distances between specific backbone-labeled sites in DNA using fluorescence resonance energy transfer. Nucleic Acids Res. 20, 5205-5214. Patel, A., Davies, C. J., Campbell, A. K., and McCapra, F. (1983). Chemiluminescence energy transfer: A new technique applicable to the study of ligand-ligand interactions in living systems. Anal. Biochem. 129, 162-169. Perkins, T. A., Goodman, J. L., and Kool, E. T. (1993). Accelerated displacement of duplex DNA strands by a synthetic circular oligodeoxynucleotide. J. Chem. Soc. Chem. Commun. 215-216. Schroeder, H. R., and Yeager, F. M. (1978). Chemiluminescence yields and detection limits of some isoluminol derivatives in various oxidation systems. Anal. Chem. 50, 1114-1120. Telser, J., Cruickshank, K. A., Morrison, L. E., and Netzel, T. L. (1989a). Synthesis and characterization of DNA oligomers and duplexes containing covalently attached molecular labels: Comparison of biotin, fluorescein, and pyrene labels by thermodynamic and optical spectroscopic measurements. J. Am. Chem. Soc. 111, 6966-6976. Telser, J., Cruickshank, K. A., Morrison, L. E., Netzel, T. L., and Chan, C. (1989b). DNA duplexes covalently labeled at two sites: Synthesis and characterization by steady-state and time-resolved optical spectroscopies. J. Am. Chem. Soc. 111, 7226-7232. Ullman, E. F., Schwarzberg, M., and Rubenstein, K. E. (1976). Fluorescent excitation transfer immunoassay. J. Biol. Chem. 251, 4172-4178. Wahl, G. M., Berger, S. L., and Kimmel, A. R. (1987). Molecular hybridization of immobilized nucleic acids: Theoretical concepts and practical considerations. Methods Enzymol. 152, 399-407.
19
DNA Sequencing by Nonisotopic Methods Parke K. Flick United States Biochemical Corporation Research Center Amersham Life Sciences, Inc. Cleveland, Ohio 44128
I. Introduction II. Automated Fluorescent Detection of DNA Sequences III. Manual Nonisotopic Detection of DNA Sequences A. Chemiluminescent Sequencing Using Biotin-Labeled Primers B. Chemiluminescent Sequencing Using Biotin-Labeled Nucleotides C. Direct Blotting of DNA Sequencing Fragments for Nonisotopic Detection D. Color Detection of DNA Sequences E. Other Haptens for Labeling F. Staining Methods IV. Future Developments in Nonisotopic DNA Sequencing V. Conclusions References
I. INTRODUCTION The determination of DNA sequences using the chain-termination method developed by Sanger et al. (1977) is a well-established and universal technique in molecular biology. Sequencing by this method requires a DNA polymerase that catalyzes the primer-dependent synthesis of DNA on the template being sequenced. Synthesis is initiated at a unique site determined by the primer sequence. Four separate reactions are typically carfled out, each in the presence of one of the four dideoxynucleoside triphosphates. Each reaction produces a nested set of DNA fragments all terminated with the same dideoxynucleotide at the proper positions in the sequence. The products of the four reactions are separated in four adjacent lanes of a denaturing polyacrylamide gel to give a "ladder" of fragments, each of which differs from the next in the ladder by a single nucleotide. The sequence of the primer-containing strand (complementary to the template) can be read in order from the gel ladder of fragments starting at the bottom and proceeding to the top, calling each base by the particular Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
475
476
Parke K. Flick
dideoxynucleotide used to generate each fragment. Sequences can be read up to the point at which the DNA fragments are no longer resolved by the electrophoresis gel. Most current DNA sequencing is performed on double-stranded templates, including plasmids, cosmids, and PCR products. Detection of DNA fragments in sequencing ladders traditionally has been accomplished by incorporating radiolabeled deoxynucleotides (35S-, 32p_, or 33p_labeled) (Biggin et al., 1983; Sanger et al., 1977; Zagursky et al., 1991) into the newly synthesized DNA and performing autoradiography on the dried gel following electrophoresis. Although radioisotopic labeling affords high sensitivity, sharp bands (especially with 35S), excellent resolution, and low background, the use of these labels requires special handling, safety precautions, licenses, and procedures for the disposal of radioactive waste. Expenses associated with the use of radioisotopes continue to rise. In addition, radioactive sequencing does not easily lend itself to the high sample throughput required for large-scale sequencing projects. To overcome the disadvantages of radioisotopic detection of DNA sequences, alternative nonisotopic methods have been developed that rely on the incorporation of nucleotide derivatives into the DNA fragments generated during the sequencing process and their subsequent detection. Such derivatives may be incorporated into the sequencing primer by de n o v o synthesis or into the newly synthesized DNA chains by the DNA polymerase used for carrying out the sequencing reactions. Several detection formats, both manual and automated, may be employed after the sequence fragments have been generated and separated on a polyacrylamide gel, depending on the particular labeling moiety chosen. For example, if the DNA is labeled with one or more fluorescent dyes, detection may be performed using a laser to excite the fluorophore and appropriate detectors to register fluorescence and record the output. Instruments exist to carry out this analysis automatically. If labeling is performed with a hapten-linked primer or nucleotide, enzyme-linked antibodies or binding proteins may be bound to the sequence fragments immobilized on a membrane. Various substrates for these enzymes, which yield either color or chemiluminescence, may then be used to generate the detection signal. This chapter reviews current nonisotopic DNA sequencing methods, with primary emphasis on manual detection, and provides insight into possible future directions.
II. AUTOMATED FLUORESCENT DETECTION OF DNA SEQUENCES In 1986 the development of an automated DNA sequenator based on the use of fluorescence-labeled oligonucleotide primers was reported (Smith
19. DNA Sequencing by Nonisotopic Methods
477
et al., 1986). A different fluorophore was used for each of the reactions
specific for A, C, G, and T (Fig. 1). These labeled primers were shown to prime DNA sequencing reactions efficiently. The fluorescent moieties were located at the 5' end of the oligonucleotide primers and were found not to interfere with hybridization to the template DNA. Products of sequencing reactions carried out with these labeled primers were coelectrophoresed down the same gel tube. An argon-ion laser was used to excite the dye-labeled DNA fragments in the tube. Using appropriate filters, separate fluorescences from the different dyes could be detected, thereby providing sequence information after appropriate data analysis was performed. These investigators were able to resolve peaks with good signal-to-noise some 400 bases into the sequence. At about the same time, Ansorge et al. (1986) reported a fluorescent sequencing system based on a single primer conjugated with tetramethylrhodamine. Since the same primer was used in all four sequencing reactions, the products had to be separated in four separate lanes and detected by laser-excited fluorescence. Resolutions of 250-300 bases were obtainable with this system. Prober et al. (1987) developed a DNA sequencing system based on the
(CHa)2N ~
+ N(CHa)2
~
~ COOH R
R
Fluorescein
Tetramethylrhodamine
R N/ NO2
~ ' SO3H R
7-Nitrobenz-2-oxa-1,3-diazole (NBD)
Texas Red
Fig. lmChemical structures of four fluorescent dyes used to label oligonucleotide primers for DNA sequencing (Smith et al., 1986). R represents the site of attachment of the oligonucleotide to the dye.
478
Parke K. Flick
use of a set of four chain-terminating dideoxynucleotides, each coupled to a different succinylfluorescein dye and distinguishable by fluorescence emission. The dyes were attached via a propargyl amine linkage to the 5 position in the pyrimidines (C and T) and to the 7 position of the 7deazapurines (A and G). These dye-labeled terminators were used in sequencing reactions with avian myeloblastosis virus reverse transcriptase to produce a complete set of fluorescence-tagged fragments in a single reaction mixture. The terminators were also substrates for modified T7 DNA polymerase (Tabor and Richardson, 1987), although they could not be used with the Klenow fragment of DNA polymerase I from E s c h e r i c h i a coli. The fragments were resolved by gel electrophoresis in one sequencing lane and detected by a scanning fluorescence detection system with computer-based automatic sequence identification. This methodology avoids the necessity of synthesizing a different dye-labeled oligonucleotide for each set of sequencing reactions. Fluorescence-labeled chain terminators afford complete flexibility of sequencing strategy and allow the reactions to take place in one vessel. Moreover, only true dideoxynucleotide terminations result in detectable fluorescent bands. Any chain termination artifacts, such as polymerase pausing in regions of secondary structure, which would be detected in labeled primer sequencing would not be detected in this system since these products would not be fluorescent. These methods have been commercialized by Applied Biosystems, Pharmacia, and DuPont, respectively, in the form of automated instruments utilizing slab gels and laser-based detection (note: the DuPont instrument is no longer on the market). Other companies have since introduced similar machines. These instruments have been marketed in the $75,000-100,000 range and have found important applications in largescale DNA sequencing projects. More recently, capillary gel electrophoresis has been successfully applied to the detection of fluorescence-labeled DNA sequences (Cohen et al., 1990; Drossman et al., 1990; Luckey et al., 1990; Swerdlow and Gesteland, 1990; Swerdlow et al., 1991; Huang et al., 1992). These gels can be run at very high field strengths, resulting in more rapid separation of fragments. Sequencing rates as high as 1000 bases per hour have been achieved (Swerdlow et al., 1991), as high as that obtainable with a 24-lane slab gel. Further work to optimize conditions for capillary gel sequencing is needed to make it practical for large-scale sequencing projects.
III. MANUAL NONISOTOPIC DETECTION OF DNA SEQUENCES Although the automated methods just described afford sensitive, accurate, and rapid sequencing of DNA, they involve a considerable initial invest-
19. DNA Sequencing by Nonisotopic Methods
479
ment in equipment beyond the reach of most individual laboratories. Since most sequencing with radioisotopes is performed manually, reliable methods for nonisotopic sequencing utilizing familiar equipment and techniques must be available for most investigators to be able to use them to full advantage. Ideally, one would like only to substitute a nonradioactive label for a radioactive one and keep all remaining steps of the sequencing protocol the same. Although this has not been possible up to now, a number of successful experimental approaches have been developed for manual nonisotopic sequencing and are described in detail in the following sections.
A. Chemiluminescent Sequencing Using Biotin-Labeled Primers A sensitive and convenient method of nonisotopic DNA sequencing takes advantage of the very high affinity of the bacterial protein streptavidin for biotin (Beck et al., 1989). Oligonucleotide sequencing primers are typically 15-30 bases in length and may be labeled at their 5' ends with one or more biotin residues (Fig. 2). This may be accomplished during primer synthesis on a DNA synthesizer by using a phosphoramidite reagent containing biotin (Agrawal et al., 1986). Alternatively, the primer may be synthesized with an amino group at the 5' end (Coull et al., 1986). In a subsequent step, the amine-linked oligonucleotide is reacted with an activated biotin compound, such as biotin-N-hydroxysuccinimide ester, to yield the final biotinylated sequencing primer. Generally speaking, at least a 6-atom spacer should be provided between the biotin residue and the 5'-most nucleotide to facilitate later detection. Pre-existing oligonucleotides may be conveniently labeled with biotin at the 5' end using Method III shown in Fig. 2. This method is now contained in a commercial product (Oligonucleotide Biotin Labeling Kit, United States Biochemical Corporation, Cleveland, Ohio). Biotinylated primers function well in DNA sequencing reactions performed with modified T7 DNA polymerase (Sequenase | Version 2.0 T7 DNA Polymerase, United States Biochemical Corporation) and other DNA polymerases [e.g., Klenow fragment of E. coli DNA polymerase I, Thermus aquaticus (Taq) polymerase, B. stearothermophilus DNA polymerase] currently employed in DNA sequencing (Nash and Flick, 1992; Sequenase ImagesTM Protocol Book, 1993). Reaction products from the four dideoxynucleotide termination reactions are separated on a standard 4-8% polyacrylamide, 7 M urea gel. At this stage the procedure diverges from that of isotopic sequencing. Detection of signal from the biotinylated fragments requires that they first be transferred out of the gel and onto a sheet of nylon membrane. This may be readily performed by simple capil-
480
Parke K. Flick I.
Amino Unker 5'
3'
H2N~
O
-
O. O -.-- Oligonucleotide I o
- OH
+
Biotin-NHS Ester
[
5'
3'
Biotin ~ V ^V ' ^"
^o-"
o P - o tid..~..uonuc.eo.....e ~li, i
OH
I
o
II.
Biotin Phosphoramidite
Bi~
" ~ ~ ~ o _ ~
_ N/LI
CNCI.I=CH20
~--
5 I
A
Biotin
A V
III.
3'
r , OH 0,, V
O - - P - - o --Oligonucleotide
-- OH
Direct Ollgonucleotlde Labeling 5' HO
3' OH
T4 Polynucleotide Kinase + ATP'~
5 I
s II -o-P-O i o
3 I
w
o II ICH2 - C- NH(CH2)eNH - Biotin
OH
O
=
5
N
S - CH2 - C- NH(CH2)eNH- Biotin
3 I
I
o-P-O I o_
OH
Flit. 2--Methods for labeling oligonucleotides with biotin. Methods I and II require d e n o v o synthesis of the complete oligonucleotides, whereas method III can be performed directly on a presynthesized oligonucleotide.
lary blotting in which the membrane is placed over the sequencing gel (still resting on one of the glass sandwich plates), along with weights, and allowed to sit on the bench top for 1 hr, or by removing the gel from the plate (see Chapter 20). A proportion of the DNA sufficient for subsequent
19. DNA Sequencingby Nonisotopic Methods
481
detection is transferred from the gel during this time. Membrane transfer may also be performed using electroblotting which accelerates the process considerably. Following transfer, the membrane is allowed to dry at room temperature. At this point the DNA may be UV cross-linked or baked onto the membrane, although in our laboratories we have found that this step is unnecessary. The dry membrane is placed in a plastic hybridization bag and, following treatment with a blocking solution, is reacted with a streptavidin-alkaline phosphatase conjugate or free streptavidin and biotinylated alkaline phosphatase, which bind to the biotinylated DNA fragments. After additional washing steps, the membrane is ready for the final detection step. Detection of the biotin-labeled DNA fragments on the membrane may be performed using one of several substrates for alkaline phosphatase which produce a colored product visible on the membrane or react to yield chemiluminescence that can be detected on X-ray film. The latter method offers the advantage that hard-copy data are produced that are exactly analogous in form to radioisotopic data. As such, chemiluminescent detection has assumed a larger and larger role in recent years for the detection of biotinylated DNA. Commonly used chemiluminescent substrates for alkaline phosphatase are the dioxetane derivatives AMPPD | Lumigen PPD | CSPD TM and commercial formulations such as Lumi-Phos | 530 or 480 (Schaap et al., 1989; Bronstein et al., 1990,1991). These substrates, when dephosphorylated by alkaline phosphatase, decompose to emit light at a wavelength of 460-480 nm or 530 nm (in LumiPhos | 530) which can be readily detected with standard X-ray film. The kinetics of light emission from these dioxetanes are such that multiple exposures may be made to adjust the quality of the results. Light emission rises over a 2-hr period following the start of the reaction to a final steadystate value which remains high for 1-2 days. The user can therefore work within a relatively wide time frame with only one application of this substrate. The dioxetane derivative CSPD TM has been reported to exhibit more rapid kinetics of light emission and better band resolution than AMPPD | and has been shown to be useful in DNA sequence detection (Martin et al., 1991; Olesen et al., 1993). Lumi-Phos | 530 is applied to the membrane contained within a plastic hybridization bag. An initial exposure to X-ray film may be made before steady-state light emission is reached. This typically requires 60-90 min for a satisfactorily strong signal. Alternatively, the membrane may be stored at room temperature for several hours to allow the light emission to reach steady state. The required exposure at this point is much shorter, typically only 10-20 min. Prolonged storage (longer than overnight) leads to very diffuse bands on the film. This can be minimized by storage at 4~ but this is not recommended for longer than 1 day.
482
Parke K. Flick
A summary of the chemiluminescent sequencing method using biotinylated primers is presented in Fig. 3. Sequences may be obtained by this procedure from the standard amounts of template DNA (either single- or double-stranded) and primer DNA used in isotopic sequencing (0.51 pmol each). The method is capable of detecting 0.1-1 fmol DNA in a band, and the quality of the results compares favorably with 32p isotopic sequencing, although bands are not as sharp as those resulting from 35S or 33p sequencing (Figs. 4 and 5). One of the primary advantages of nonisotopic DNA sequencing by the preceding method is the stability of the biotinylated primers. Primers may be stored at -20~ for at least 1 yr and thawed and refrozen multiple times without diminution of sequence quality. On the other hand, use of labeled primers requires that they be synthesized for each sequence analysis, necessitating a rather laborious and expensive synthetic regimen.
B. Chemiluminescent Sequencing Using Biotin-Labeled Nucleotides To circumvent the need to synthesize biotinylated primers for DNA sequencing continually, a method for labeling and detection using biotinylated nucleotides has been developed (Sequenase Images ~MProtocol Book, 1993). It is not feasible simply to include a biotinylated nucleotide in the standard labeling step of the sequencing reactions, because fragments would be produced containing variable numbers of biotin residues. Since the added mass of biotin retards the migration of DNA fragments in the gel and the retardation is proportional to the number of biotin residues present, multiple bands would be present for each termination. This would result in an unreadable sequencing ladder. If a way existed to label each sequence fragment with a single biotinylated nucleotide, the gel migration would be a function only of fragment length and a readable ladder would result. This, of course, is the case when biotinylated primers are used. Successful sequencing with biotinylated nucleotides has been achieved by performing a defined, limiting extension of only one or a few nucleotides during the labeling step. Careful selection of a sequencing primer and omission of at least one deoxynucleotide will produce such a limited extension. Either Biotin-14-dCTP, Biotin-14-dATP, or Biotin-ll-dUTP may be used as the source of biotin label. Figure 6 illustrates the use of biotin nucleotide labeling for nonisotopic sequencing with chemiluminescent detection. The detection steps are exactly as described for primer labeling.
19. DNA Sequencingby Nonisotopic Methods
483
Fig. 3mNonisotopic DNA sequencing using biotinylated primers with chemiluminescent detection. (A) Sequencing reactions; (B) membrane transfer and detection.
484
Parke K. Flick
Fig. 4mPortion of the sequence of the single-stranded template, M 13mpl8, generated using a biotinylated universal -40 sequencing primer (anneals to the template with its 5' end located 40 bases upstream from the start of the multiple cloning site; sequence: 5'GTTITCCCAGTCACGAC-3') and chemiluminescent detection. The exposure time was 30 min at steady state. The portion of the sequence shown extends from 12 to 75 bases from the 3' end of the sequencing primer. In this experiment, the sequence could be read to beyond 200 nucleotides from the 3' end of the primer.
C. Direct Blotting of DNA Sequencing Fragments for Nonisotopic Detection T h e m a n u a l m e t h o d s j u s t d e s c r i b e d r e q u i r e that D N A f r a g m e n t s be b l o t t e d o n t o a n y l o n m e m b r a n e after s e p a r a t i o n in a d e n a t u r i n g p o l y a c r y l a m i d e gel. This step is u n n e c e s s a r y in isotopic s e q u e n c i n g a n d clearly r e p r e s e n t s
Fig. 5mSequence of the double-stranded plasmid, pBluescript | SK (Stratagene, La JoUa, California) generated using a biotinylated M13 reverse primer (sequence: 5'TTCACACAGGAAACAG-3') and chemiluminescent detection. The template was prepared for sequencing using a standard protocol (Sequenase Images'M Protocol Book). The exposure time was 30 min at steady state. Numbers shown are bases from the 3' end of the primer.
Fig. 6---Portion of the sequence of Ml3mpl8 single-stranded DNA generated from an unlabeled -69 primer (sequence: 5'-GCAAGGCGATTAAGTTGGGT-3') using a biotinylated nucleotide in the labeling step. The first three nucleotides added to this primer in an initial extension are AAC. Hence, a labeling step was performed with only dATP and biotin-14-
19. DNA Sequencingby NonisotopicMethods
487
added time and manipulation for the user. Beck and Pohl (1984) described a sequencing process by which DNA fragments were completely electrophoresed through a relatively short gel matrix and then immobilized when they reached the end of the gel onto a membrane moving constantly along the lower gel surface. Since the fragments all pass through the same length of gel, the spacing between adjacent bands is nearly constant over a large range, making it possible to read longer sequences in a single run. Improvements have been made in this process (Pohl and Beck, 1987; Richterich et al., 1989) and commercial instruments are now available. A schematic of one such device from Hoefer Scientific Instruments is given in Fig. 7. This machine uses a microprocessor-controlled stepping motor to move the membrane strip continuously beneath the gel as the fragments are electrophoresed through it. The tension on the carrier belt must be maintained to ensure tight contact between the lower gel surface and the nylon membrane. The speed of movement of the membrane may be adjusted for optimal resolution of fragments. A complete separation and membrane transfer using a 30-cm long gel requires about 8 hr. The membrane may then be processed as described and the fragments detected with chemiluminescence or by color. Many factors influence the quality of results obtained with direct blotting electrophoresis devices. One of the most important is the nature of the contact between the gel and the moving membrane. Irregularities in the polyacrylamide gel at the bottom surface, gas bubbles between this surface and the membrane, or insufficient contact between the membrane surface and the gel will result in poor transfer of DNA. During electrophoresis, Joule-heating of the gel matrix can result in expansion at the point of contact with the membrane and cause band-broadening in the detected sequence. Considerable attention must be paid to the bottom of the gel during casting. It must be flat and even. Thinner gels, although more challenging to pour, tend to give better results because the bands are narrower. If these factors are kept in mind, direct blotting electrophoresis can produce high quality sequencing results and allow the reading, in single runs, of longer sequences than those obtainable with the manual blotting method. Direct blotting electrophoresis lends itself well to the technique of multiplexing, developed by Church and Kieffer-Higgins (1988), in which a
dCTP present to limit extensions to these three bases and to incorporate a single biotinylated C residue. This was followed by a standard dideoxynucleotide termination step. Since the biotinylated nucleotide from the labeling step is highlydiluted in the termination reactions, it does not produce any additional detectable labeled fragments at this step. Chemiluminescent detection of the sequence fragments was performed using Lumi-Phos| 530 chemiluminescent substrate. Numbers shown are bases from the 3' end of the primer.
488
Parke K. Flick
Gel Sandwich Membrane
Motor-Driven
_l
Pulley
.....
Transport
Belt
i
Gei.Me/mbrane ~
LowerBuffer
Contact
Chamber
_ 9
Fig. 7nDirect blotting electrophoresis. Schematic diagram of a direct blotting instrument showing the 30-cm long gel compartment and transport belt for moving the membrane beneath the gel.
number of different DNAs can be sequenced in the same lanes of a gel because they each have unique sequence "tags" attached (Lakey et al., 1993; Richterich and Church, 1993). The tags are detected and the sequence thereby revealed by blotting the sequencing gel onto a membrane and hybridizing with a specific tag probe. Detection may be performed nonisotopically, as described. After analysis, the probe is simply stripped off and the blot rehybridized with a different tag probe to reveal another sequence. The blotting part of the procedure may be conveniently accomplished using direct blotting electrophoresis.
D. Color Detection of DNA Sequences Substrates for alkaline phosphatase that produce a color can be used to detect DNA sequences on membranes. Color detection is convenient, since a darkroom and film are unnecessary. However, the sensitivity is usually somewhat less than that of chemiluminescent detection, although bands tend to be sharper. The standard NBT/BCIP (nitroblue tetrazolium/ 5-bromo-4-chloro-3-indolyl phosphate) colorimetric substrate for alkaline phosphatase has been used successfully (Richterich et al., 1989) as it has been for biotin-labeled probes (Rashtchian, 1992), although the color produced fades over time. Other stains based on Fast Blue B (VisiblotTM, United States Biochemical) yield longer-lasting patterns on membranes. Such blots have been stored in our laboratories in plastic bags for 1 yr with little fading of the blue color.
19. DNA Sequencing by Nonisotopic Methods
489
E. Other Haptens for Labeling Labeling of primers and/or nucleotides for nonisotopic DNA sequencing is not limited to biotin. Other haptens such as digoxigenin (Genius Nonradioactive DNA Sequencing Kit, Boehringer-Mannheim) (Holtke et al., 1992), DNP, and fluorescein (Olesen et al., 1993) have been used to prepare labeled primers for subsequent detection with antibody-alkaline phosphatase conjugates. The steps in the detection process are exactly analogous to those used with biotin-labeled primers. TM
F. Staining Methods Direct staining of DNA sequencing gels would seem an almost ideal solution to the nonisotopic detection problem, avoiding the expensive and tedious necessity of transfer to membrane and enzymatic amplification of the signal. However, the staining of femtomole quantities of DNA is no mean task. Intercalating dyes such as ethidium bromide lack the required sensitivity for single-stranded DNA. Loading up to 10 times as much DNA sample onto the gel still does not solve the problem; only the larger fragments at the top of the gel are detectable. A protocol has been devised to permit the silver staining of DNA sequencing gels (Silver SequenceTM, Promega, Madison, Wisconsin). This method requires a carefully controlled staining step with silver nitrate/ formaldehyde solution, a short (20-sec) rinsing step, and a low temperature (10-12~ development step. Care is needed to visualize bands corresponding to short DNA fragments and the protocol must be followed exactly to avoid undesirable background. Although the process shows promise, further work is necessary to render silver staining a robust and user-friendly method for DNA sequence detection.
IV. FUTURE DEVELOPMENTS IN NONISOTOPIC DNA SEQUENCING Current manual methods for nonisotopic DNA sequencing generally rely on a blotting process that requires relatively expensive reagents and timeconsuming manipulations. Ideally, a nonradioactive method should require little more hands-on work than radioactive methods and should produce the same or greater sensitivity in the same or a shorter time frame. Future work in this field is very likely to focus on in-gel detection methodology. New fluorescent materials exhibiting longer-wavelength excitation and emission will make direct detection easier and more af-
490
Parke K. Flick
fordable. The cost of equipment should continue to fall as capillary electrophoresis assumes a more important role in automated detection. New or modified DNA polymerases with properties more suited to incorporation of nonisotopic labels will also aid the development of the field. A further stimulus will be provided by the growing use of DNA sequencing for diagnostic purposes, particularly genetic diseases and cancer.
V. C O N C L U S I O N S Nonisotopic DNA sequencing can now be conducted using both automated and manual methods. Automated methods employ laser-excited fluorescence emission from dye-labeled primers or dye-labeled dideoxynucleotide terminators with computer analysis of the data and have become popular in high-throughput laboratories. Most successful manual methods rely on membrane transfer of biotin- or other hapten-labeled DNA sequence fragments, and either chemiluminescent or color detection. These methods afford sensitivity equal to that of radioactive methods without the associated hazards and expense. Read lengths per run are as great as or greater than those obtained using isotopes, and the same amounts of starting template and primer may be used. Future work in the field will focus on new and better labels and on the development of less expensive and more user-friendly techniques.
REFERENCES Agrawal, S., Christodoulou, C., and Gait, M. J. (1986). Efficient methods for attaching nonradioactive labels to the 5' ends of synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 14, 6227-6245. Ansorge, W., Sproat, B. S., Stegemann, J., and Schwager, C. (1986). A non-radioactive automated method for DNA sequence determination. J. Biochem. Biophys. Meth. 13, 315-323. Beck, S., and Pohl, F. M. (1984). DNA sequencing with direct blotting electrophoresis. EMBO J. 3, 2905-2909. Beck, S., O'Keefe, T., Coull, J. M., and Koster, H. (1989). Chemiluminescent detection of DNA: Application for DNA sequencing and hybridization. Nucleic Acids Res. 17, 5115-5123. Biggin, M. D., Gibson, T. J., and Hong, G. F. (1983). Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80, 3963-3965. Bronstein, I., Edwards, B., and Voyta, J. C. (1989). 1,2-Dioxetanes: Novel chemiluminescent enzyme substrates. Applications in immunoassays. J. Biolumin. Chemilumin. 4, 99-111. Bronstein, I., Voyta, J. C., Lazzari, K. G., Murphy, O., Edwards, B., and Kricka, L. J. (1990). Improved chemiluminescent detection of alkaline phosphatase. BioTechniques 9, 160-161. Bronstein, I., Juo, R. R., Voyta, J. C., and Edwards, B. (1991). Novel chemiluminescent
19. DNA Sequencing by Nonisotopic Methods
491
adamantyl 1,2-dioxetane enzyme substrates. In "Bioluminescence and Chemiluminescence: Current Status" (P. E. Stanley and L. J. Kricka, eds.), pp. 73-82. Wiley, Chichester. Church, G. M., and Kieffer-Higgins, S. (1988). Multiplex DNA sequencing. Science 240, 185-188. Cohen, A. S., Najarian, D. R., and Karger, B. L. (1990). Separation and analysis of DNA sequence reaction products by capillary gel electrophoresis. J. Chromatography 516, 49-60. Coull, J. M., Weith, H. L., and Bischoff, R. (1986). A novel method for the introduction of an aliphatic primary amino group at the 5' terminus of synthetic oligonucleotides. Tetrahedron Lett. 27, 3991-3994. Drossman, H., Luckey, J. A., Kostichka, A. J., D'Cunha, J., and Smith, L. M. (1990). High speed separations of DNA sequencing reactions by capillary electrophoresis. Anal. Chem. 62, 900-903. Holtke, H. J., Sanger, G., Kessler, C., and Scmitz, G. (1992). Sensitive chemiluminescent detection of digoxigenin-labeled nucleic acids: A fast simple protocol and its applications. BioTechniques 12, 104-113. Huang, X. C., Quesada, M. A., and Mathies, R. A. (1992). DNA sequencing using capillary array electrophoresis. Anal. Chem. 64, 2149-2154. Luckey, J. A., Drossman, H., Kostichka, A. J., Mead, D. A., D'Cunha, J., Norris, T. B., and Smith, L. M. (1990). High speed DNA sequencing by capillary electrophoresis. Nucleic Acids Res. 18, 4417-4421. Martin, C., Bresnick, L., Juo, R.-R., Voyta, J. C., and Bronstein, I. (1991). Improved chemiluminescent DNA sequencing. BioTechniques 11, 110-113. Nash, B. W., and Flick, P. K. (1992). Non-Isotopic DNA sequencing. USB Comments 19, 69-76. Olesen, C. E. M., Martin, C. S., and Bronstein, I. (1993). Chemiluminescent sequencing with multiplex labeling. BioTechniques 15, 480-485. Pohl, F. M., and Beck, S. (1987). Direct transfer electrophoresis used for DNA sequencing. Methods Enzymol. 155, 250-259. Prober, J. M., Trainor, G. L., Dam, R. J., Hobbs, F. W., Robertson, C. W., Zagursky, R. J., Cocuzza, A. J., Jensen, M. A., and Baumeister, K. (1987). A system for rapid DNA sequencing with fluorescent chain-terminating dideoxynucleotides. Science 238, 336-341. Rashtchian, A. (1992). Detection of alkaline phosphatase by colorimetry. In "Nonisotopic DNA Probe Techniques" (L. J. Kricka, ed.), pp. 147-165. Academic Press, San Diego. Richterich, P., and Church, G. M. (1993). DNA sequencing with direct transfer electrophoresis and non-radioactive detection. Methods Enzymol. 218, 187-223. Richterich, P., Heller, C., Wurst, H., and Pohl, F. M. (1989). DNA Sequencing with direct blotting electrophoresis and colorimetric detection. BioTechniques 7, 52-59. Sanger, F., Miklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Schaap, A. P., Sandison, M. D., and Handley, R. S. (1987). Chemical and enzymatic triggering of 1,2-dioxetanes. 3. Alkaline phosphatase-catalyzed chemiluminescence from an aryl phosphate-substituted dioxetane. Tetrahedron Lett. 28, 1159-1162. Schaap, A. P., Akhaven, H., and Romano, L. J. (1989). Clin. Chem. 35, 1863-1864. Sequenase Images Protocol Book (1993). United States Biochemical Corporation, Cleveland, Ohio. Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P., Dodd, C., Connell, C. R., Heiner, C., Kent, S. B. H., and Hood, L. E. (1986). Fluorescence detection in automated DNA sequence analysis. Nature 321, 674-679. Swerdlow, H., and Gesteland, R. (1990). Capillary gel electrophoresis for rapid, high resolution DNA sequencing. Nucleic Acids Res. 18, 1415-1419. TM
492
Parke K. Flick
Swerdlow, H., Zhang, J. Z., Chen, D. Y., Harke, H. R., Grey, R., Wu, S., Dovichi, N. J., and Fuller, C. (1991). Three DNA sequencing methods using capillary gel electrophoresis and laser-induced fluorescence. Anal. Chem. 63, 2835-2841. Tabor, S., and Richardson, C. (1987). DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84, 4767-4771. Zagursky, R. J., Conway, P. S., and Kashdan, M. A. (1991). Use of 33p for Sanger DNA sequencing. BioTechniques 11, 36-38.
Chemiluminescent DNA Sequencing with 1,2-Dioxetanes
20
Chris S. Martin and Irena Bronstein TROPIX, Inc. Bedford, Massachusetts 01730
I. Introduction II. Chemiluminescent DNA Sequencing Procedure Using Biotinylated Primers A. Materials B. Solutions 1. Bst Polymerase DNA Sequencing Reactions 2. Chemiluminescent Detection
C. Protocols 1. 2. 3. 4. 5. 6.
DNA Sequencing Reactions Gel Electrophoresis DNA Transfer to Membrane UV Cross-Linking DNA Chemiluminescent Detection Film Exposure and Development
III. Detection of Biotinylated DNA Sequencing Reactions with Streptavidin and Biotinylated Alkaline Phosphatase A. Solutions B. Protocol IV, Chemiluminescent DNA Sequencing with Hapten-Labeled Primers and Detection with Antibody-Alkaline Phosphatase Conjugates A. Protocol B. Solutions V. Instrumentation VI. Troubleshooting A. High Background B. Poor Band Resolution C. Low Signal VII. Conclusions References
Nonisotopic Probing, Blotting, and Sequencing Copyright 9 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
493
494
Chris S. Martin and lrena Bronstein
I. I N T R O D U C T I O N Chemiluminescent detection of biomolecules with 1,2-dioxetane substrates has become increasingly popular because of the high sensitivity achieved and the elimination of concerns associated with the use and disposal of radioisotopes. Chemiluminescent systems for Southern blotting and DNA sequencing are based on detection of light generated after dephosphorylation of a 1,2-dioxetane substrate by alkaline phosphatase. Enzymatic dephosphorylation of the 1,2-dioxetane CSPD| [disodium 3(4-methoxyspiro [ 1,2-dioxetane-3,2'-(5 '-chloro) tricyclo [3.3.1.13,7] decan]4-yl)phenyl phosphate] results in a strongly electron-releasing destabilized dioxetane anion, which fragments further with the emission of light (Bronstein et al., 1991; Martin et al., 1991; Fig. 1). The dephosphorylated dioxetane anion has a half-life of approximately 40 min on nylon membrane and the emission maximum is 460 nm. The relatively long half-life of the anion on nylon membrane results in a delay before maximum light emission. Signal is generated for 1-2 days, permitting multiple film exposures. Although other luminescent systems have also been used for the detection of nucleic acids, most of these have not been investigated for DNA sequencing applications. A luminescent detection method for nucleic acids based on the activation of luminol with antibody-horseradish peroxidase conjugates (Matthews et al., 1985; Pollard-Knight et al., 1990) has been used for DNA sequencing by Richterich and Church (1993). Manual DNA sequencing with chemiluminescent detection can be performed by using biotinylated or hapten-labeled primers in standard dideoxynucleotide sequencing reactions. Sequencing reaction protocols for Sequenase | T7, DNA polymerase I Klenow fragment, and Taq DNA polymerases can be utilized. Reaction products are separated by denaturing gel electrophoresis, are transferred to a nylon membrane, and are detected by binding streptavidin-alkaline phosphatase or a haptenspecific alkaline phosphatase conjugate followed by incubation with a 1,2-dioxetane substrate. The emitted light signal is imaged on standard
0-0 CI
0-0
I OPOa= CSPD
HPO4-
~"'H , O"
CS'Danion
0
o,
h!
Fill. 1--Pathway of decomposition of CSPD chemiluminescent substrate.
20. ChemiluminescentDNA Sequencingwith 1,2-Dioxetanes
495
X-ray film, producing high-resolution DNA sequence ladders. Chemiluminescent DNA sequencing kits incorporating nonisotopically labeled primers and chemiluminescent detection reagents are commercially available (see Table I). Standard dideoxynucleotide sequencing with biotinylated primers and chemiluminescent detection using 1,2-dioxetane alkaline phosphatase substrates is described by Beck et al. (1989); Creasey et al. (1991), and Martin et al. (1991). The detection of digoxigenin-labeled DNA sequencing reactions with antidigoxigenin-alkaline phosphatase conjugate is described by HOltke et al. (1992) and Olesen et al. (1993). The use of fluorescein and DNP-labeled primers and detection with antibody-alkaline phosphatase conjugates is described by Olesen et al. (1993). DNA sequencing reactions can also be detected on nylon membrane by the hybridization of nonisotopically labeled probes followed by chemiluminescent detection using methTable !
Suppliers of Nonisotopic DNA Sequencing Reaction Kits, ChemiluminescentDetection Kits, Reagents, and Supplies Product Biotin DNA sequencing reaction kit Digoxigenin DNA sequencing reaction kit Bst Polymerase Biotin DNA sequencing chemiluminescent detection kit Digoxigenin chemiluminescent detection kit Chemiluminescent 1,2-dioxetane substrate CSPDb Lumigen-PPD c Membrane blocking reagent I-Block Genius Blocking Agent Streptavidin-alkaline phosphatase conjugate Antibody-alklaine phosphatase conjugate anti-digoxigenin anti-fluorescein anti-DNP Large heat-sealable bags Nylon membrane
Supplier a MI, NEB, TR, USB BM BR, EP MI, NEB, TR, USB BM TR LU, MI, NEB TR BM GB, ST, TR, USB BM DK, DP, ST DK NEB, MI, TR, USB AM, GB, MI, MSI, NEB, PA, ST, TR, USB
a Abbreviations: AM, Amersham; BM, Boehringer Mannheim; BR, Bio-Rad; DP, Dupont; DK, DAKO; EP, Epicentre; GB, Gibco/BRL; LU, Lumigen; MI, Millipore; MSI, Micron Separations, Inc.; NEB, New England Biolabs; PA, Pall Corp., PR, Promega; ST, Stratagene; TR, Tropix; USB, U.S. Biochemical. b Disodium 3-(4-methoxyspiro[ 1,2-dioxetane-3,2'-(5-chloro)tricyclo[3.3.1.13,7]decan]-4-yl)phenyl phosphate. c 4-Methoxy-4-(3-phosphate phenyl)-spiro-(1,2-dioxetane-3,2'-adamantane), disodium salt.
496
Chris S. Martin and Irena Bronstein
odology similar to genomic sequencing procedures as originally described for 32p-labeled probes by Church and Gilbert (1984). These probes can be labeled with biotin (Creasey et al., 1991) or alkaline phosphatase directly (Tizard et al., 1990; Karger et al., 1992,1993). Multiplex sequencing (Church and Kieffer-Higgins, 1988), which involves the sequential detection of overlapping sets of DNA reactions on one membrane by the successive hybridization of sequence-specific probes, has been performed with chemiluminescence (Creasey et al., 1991; Lakey et al., 1992). A multiplex labeling procedure can also be used with chemiluminescent detection (Olesen et al., 1993; Richterich and Church, 1993). With this method, overlapping sets of DNA sequencing reactions, performed with primers labeled with different haptens (biotin, DNP, digoxigenin, fluorescein) at their 5' end, are detected sequentially using hapten-specific alkaline phosphatase conjugates.
II. CHEMILUMINESCENT DNA SEQUENCING PROCEDURE USING BIOTINYLATED PRIMERS The detection protocol is summarized in Fig. 2.
A. Materials DNA sequencing reaction kit or components DNA transfer 9 filter paper (Whatman 3MM or equivalent) 9 nylon membrane UV cross-linking 9 UV light source or 9 UV cross-linking apparatus Chemiluminescent detection 9 purified casein or membrane-blocking reagent (Table I) 9 streptavidin-alkaline phosphatase conjugate (Table I) 9 diethanolamine (99%) 9 dioxetane chemiluminescent substrate (100 x concentrate; see Table I) 9 large heat-sealable bags (approximately 40 x 53 cm) Film exposure 9 plastic wrap (thick SaranWrap is best) or Mylar film 9 X-ray film
20. ChemiluminescentDNA Sequencing with 1,2-Dioxetanes
497
Perform DNA sequencing reactions with biotinylated primers Separate DNA fragments on denaturing polyacrylamide gels
Transfer DNA fragments from gel to membrane (30-60 minutes) Crosslink DNA to membrane by UV irradiation (5 minutes) Incubate membrane with blocking solution (10 minutes) Incubate membrane with alkaline phosphatase conjugate (20 minutes)
Wash membrane with blocking solution (5 minutes) Wash membrane with wash buffer (3 X 10 minutes)
1
Wash membrane with substrate buffer (2 X 1 minute)
Incubate membrane with chemiluminescent substrate (5 minutes)
Expose membrane to X-ray film (60 minutes)
Fig. 2--Chemiluminescent detection protocol for biotinylated DNA sequence.
B. Solutions 1. Bst Polymerase DNA Sequencing Reactions
These solutions are contained in the Tropix SEQ-LightTM DNA sequencing reaction kit. 5'-Biotinylated DNA sequencing primer Bst polymerase: 1U//xl in 20 mM KPO4, pH 6.8, 10 mM/3-mercaptoetha-
nol, 50% glycerol Bst 5x reaction buffer: 100 mM Tris, pH 8.5, 100 mM MgC12 Bst end-labeled primer termination mixes
498
Chris S. Martin and Irena Bronstein
9 A m 4 g m M dATP, 80 /xM dCTP, 80 /zM dGTP, 80 /xM dTTP, 200/xM ddATP 9 C - - 8 0 / z M dATP, 4/zM dCTP, 80/xM dGTP, 80/zM dTTP, 100/xM ddCTP 9 G - 8 0 / z M dATP, 80/zM dCTP, 4/zM dGTP, 80 ~ M dTTP, 60/zM ddGTP 9 T-80/xM dATP, 80/zM dCTP, 80/xM dGTP, 4/xM dTTP, 225/xM ddTTP 20• Chase solution: 10 mM each dATP, dCTP, dGTP, dTTP Stop solution: 95% deionized formamide, 10 mM EDTA, 0.1% xylene cyanol FF, 0.1% bromophenol blue
2. Chemiluminescent Detection 10x Phosphate buffered saline (PBS): 0.58 M Na2HPO 4, 0.17 M NaHEPO 4, 0.69 M NaCl, pH 7.2 Blocking buffer: 0.2% purified casein or membrane-blocking reagent, 0.5% SDS, 1• PBS. Make blocking buffer by first preparing 1 x PBS solution. Add blocking reagent and heat to 70~ with constant stirring; then add SDS. Do not boil. Conjugate solution" Dilute streptavidin-alkaline phosphatase in blocking buffer, typically 1:5000. Follow manufacturer's recommendations. Wash buffer: 0.5% SDS, 1 x PBS Assay buffer: 0.1 M diethanolamine, 1 mM MgCI2, pH 10.0. For the preparation of assay buffer, dissolve DEA in deionized H20, adjust pH to 10.0 with concentrated HCI, then add MgCI2. Dioxetane substrate solution" Dilute concentrated (100x) dioxetane 1:100 in assay buffer
Note: Sodium azide at 0.02% may be added to the blocking, wash, and assay buffers if longer term storage is anticipated.
C. P r o t o c o l s 1. DNA Sequencing Reactions The products of the DNA sequencing reactions are labeled with biotin using biotin labeled oligonucleotide primers. Any DNA sequencing reaction protocol can be utilized that calls for 5' end-labeled primers. Procedures for the use of Bst polymerase from Bacillus stearothermophilus and Sequenase | T7 polymerase are described here. An alternative labeling
20. ChemiluminescentDNA Sequencing with 1,2-Dioxetanes
499
system based on the incorporation of biotinylated nucleotides during the extension reactions is possible. This system is available in kit form from United States Biochemical Corporation (Cleveland, Ohio).
For each DNA template: 1. Mix together in a microcentrifuge tube: 1/xg single-stranded DNA (approximately 0.5 pmol) or 1-3/zg denatured double-stranded DNA template 0.5 pmol biotinylated DNA sequencing primer 2 tzl 5 • Bst reaction buffer Add deionized H20 to 11/zl. 2. Heat to 70~ cool slowly to 30~ over a 30-min period.
Note: This step is optional for most single-stranded templates. Sufficient primer annealing occurs at the 65~ reaction temperature. 3. Aliquot 2/xl of each termination mix (A, C, G, T) into four separate tubes or microtiter plate wells and label them A, C, G, and T. 4. Add 1/.d Bst enzyme to the cooled template mixture. Pre-warm the tubes or plate containing the termination mixes to 65~ 5. Add 2.5/xl enzyme/template mixture to each of the termination mixes and incubate at 65~ for 5 min. 6. During the elongation-termination reaction (step 5), dilute the 20• chase solution 1:20 with deionized H20; 8/xl diluted chase solution are needed per reaction set. Add 2 ~1 1 • chase solution to each tube or well and incubate at 65~ for 5 min. 7. Add 4/xl stop solution to each tube or well. Reactions may be stored at -20~ for future use. 8. Immediately before loading on the gel, heat reactions at 80~ for 2 min and place on ice. Load 2-3/zl per lane.
2. Gel Electrophoresis Use standard procedures for set-up, loading, and electrophoresis of 8 M urea 0.2-0.4 mm thick polyacrylamide DNA sequencing gels. Labeled DNA must be transferred from the gel to nylon membrane to perform chemiluminescent detection. The width of the gel used must be less than 30 cm to accommodate the average width of commercially available nylon membranes. Alternatively, several pieces of membrane may be placed on
500
Chris S. Martin and Irena Bronstein
the gel side by side. See also the description of direct transfer electrophoresis (DTE) in Section V. 3. D N A Transfer to Membrane
DNA transfer from the sequencing gel to nylon membrane is accomplished by capillary transfer. Alternatively, an electrotransfer apparatus can be used (see Section V for information). Fixing the gels or removing the urea is unnecessary. The capillary transfer method described here permits a transfer of approximately 20-30% of the DNA, which is sufficient for chemiluminescent detection.
Cut three pieces of filter paper to the size of the gel or slightly larger as well as a piece of nylon membrane that will cover the desired region of the gel. 1. Disassemble the gel apparatus and separate the glass plates. 2. Remove the gel from the glass plate by placing a dry piece of filter paper on the gel, gently rubbing the paper, and then carefully lifting the gel up by peeling back the paper. Place the paper with the gel attached on the glass plate gel-side up. 3. Wet the nylon membrane thoroughly with 1 x TBE buffer, either by immersion or by squirting it with buffer from a squeeze bottle. 4. Carefully place the wet membrane on the gel. Remove any air bubbles by carefully rolling a pipet or smooth rod over the membrane. 5. Place two pieces of dry Whatman paper on top of the membrane; add another glass plate, and approximately 2-4 kg weight on top. Allow the transfer to proceed for 1 hr. 6. Separate the gel membrane sandwich. Carefully peel the membrane from the gel. Slightly wetting one corner of the membrane with TBE buffer may aid in the separation. Mark the side of the membrane that was in contact with the gel as the DNA side. Place the membrane on a clean piece of filter paper and allow it to dry (approximately 10 min).
The efficiency of DNA transfer to nylon membrane is highly dependent on the method and the type of membrane utilized. Capillary transfer is more efficient with positively charged nylon than with neutral nylon membrane. However, the use of neutral nylon normally results in lower background with antibody-based detections, as described in Section IV.
20. ChemiluminescentDNA Sequencing with 1,2-Dioxetanes
501
Slightly sharper band resolution is exhibited when the gel is removed from the glass plate prior to setting up the transfer as opposed to placing the membrane directly on the gel without removal from the plate. An alternative to horizontal transfer is direct transfer electrophoresis (DTE), as described in Section V. Highly efficient DNA transfer is achieved with this apparatus, as is greater resolution of high molecular weight fragments.
4. UV Cross-Linking DNA Following the transfer step, DNA is immobilized to the membrane by UV irradiation. This can be accomplished with a hand-held UV lamp, a UV transilluminator, or a UV cross-linking apparatus. A total UV exposure of 120 mJ is recommended (e.g., 1.2 mW/cm 2 • 100 sec = 120 mJ/cm2). We have not observed a decrease in the chemiluminescent signal intensity from UV irradiation when using biotinylated primers and therefore recommend UV cross-linking if the membrane has not been previously tested for DNA retention. With most UV sources, irradiation times of 1-10 min are adequate. Handheld lamps can be used to expose the entire membrane by clamping the UV source to a support and exposing individual portions of the membrane consecutively. If necessary, the optimun irradiation time for a particular UV light source can be calibrated by performing control experiments in which a number of membrane strips containing biotinylated DNA are exposed. Subsequently, the detection protocol is performed and the results are examined. Alternatively, baking at 80~ for 1 hr may be done to immobilize the DNA with most nylon membranes (consult manufacturer's instructions). Following UV cross-linking or baking, proceed to the detection protocol or store the membrane dry between two pieces of plastic wrap at 4~ Although overexposure to UV light does not interfere with detection of biotinylated DNA, it will interfere with the ability to hybridize probes to bound DNA. Procedures involving multiplex sequencing and detection of DNA sequences with oligonucleotide-alkaline phosphatase conjugates do require DNA hybridization, and it is important to cross-link the DNA to the membrane with the optimum UV dose. Although fixing the DNA fragments to nylon membrane prior to chemiluminescent detection is necessary with most membranes, strongly positively charged nylon membranes such as Biodyne B (Pall Corp., Glen Cove, New York) do not require UV cross-linking. However, other positively charged membranes, such as MSI MagnaCharge, appear to lose a slight amount of DNA during detection when UV cross-linking has not been performed. Without UV cross-linking, neutral nylon membranes consistently lose DNA during detection.
502
Chris S. Martin and Irena Bronstein
5. Chemiluminescent Detection The chemiluminescent detection procedure is performed by binding streptavidin-alkaline phosphatase to the biotinylated DNA, washing off the excess, and then incubating with chemiluminescent substrate (Fig. 3). Detection can also be performed with an alternative protocol utilizing free streptavidin and biotinylated alkaline phosphatase (see Section III). Chemiluminescent detection of sequencing reactions labeled with other haptens can be performed using hapten-specific antibody-alkaline phos-
Fig. 3---Chemiluminescentdetection of DNA sequence generated from a biotinylated reverse primer using NaOH-denatured double-stranded plasmid as template. Fragments were separated on a 6% polyacrylamide urea gel, transferred to nylon membrane by passive capillary action, and detected with streptavidin alkaline phosphatase and CSPD substrate. Exposure time is 30 min, 120 min after substrate addition.
20. ChemilurninescentDNA Sequencing with 1,2-Dioxetanes
503
phatase conjugates (see Section IV). Chemiluminescent detection is most easily performed in large plastic heat-sealable bags. Trays can be used, but larger solution volumes are usually necessary. Alternatively, a roller bottle apparatus (as described in Section V) can be used. Bags should be sealed close to the membrane with enough space at one end to permit resealing or folding. Large bag sealers aid in uniform sealing and are available from the source listed in Table II. Avoid folding the membrane by adding solutions slowly and not using excessive volumes of solutions. Manual agitation by rubbing or rocking the bag will facilitate uniform distribution of the solution across the membrane when small volumes of solutions are added. The use of blocking agents and conjugates specifically optimized for chemiluminescent detection on nylon membranes is highly recommended. See Table I for suggested sources.
All recommendations for reagent volumes in the following protocol apply to a single membrane (1000-1200 cm2). All steps should be performed at room temperature with moderate shaking. 1. 2. 4. 5. 6. 7. 8. 9.
Place the membrane in a bag or container. Add 500 ml blocking buffer and incubate for 10 min. Incubate for 20 min in 200 ml conjugate solution. Wash 1 x 5 min in 500 ml blocking buffer. Wash 3 x 10 min in 500 ml wash buffer. Wash 2 x 1 min in 500 ml assay buffer. Add 50 ml dioxetane substrate solution and incubate for 5 min. Drain excess substrate solution from bag. The membrane may be left in the plastic bag after removal of the substrate solution and then exposed to film. However, nonuniform bag sealing may cause wrinkles which will prevent even contact between the membrane and film, resulting in blurry regions or dark lines. Cutting away
Table !! |nstruments and Suppliers
Instrument
Supplier
Large bag sealer (24-in; 60-cm) Horizontal electroblotter Panther HEP-3 TE 90 Direct transfer electrophoresis apparatus; Two-Step Rotating bottle apparatus" Navigator Automated blot development apparatus" PR 1000
National Bag Company, Inc. OWL Scientific Plastics, Inc. Hoefer Scientific Instruments Hoefer Scientific Instruments BIOCOMP Instruments, Inc. Hoefer Scientific Instruments
504
Chris S. Martin and Irena Bronstein
the sealed edges of the bag may result in a smoother surface for film exposure. Alternatively, the membrane can be placed between two pieces of plastic wrap. Thicker plastic wrap is recommended since it will wrinkle less. Two pieces of Mylar film, similar to the material used in report covers, work very well, but may be difficult to find in the fight size. Thick plastic sheets or previously used X-ray film may be used as a support for the membrane with a layer of plastic wrap placed over the membrane. This technique results in fewer wrinkles than two pieces of plastic wrap.
6. Film Exposure and Development Wrapped membranes are imaged by being placed in direct contact with Kodak XAR-5 X-ray film, or the equivalent, at room temperature. An initial 60-min exposure is normally adequate. Additional shorter or longer exposures can be performed to optimize signal intensity and resolution. Excess solution should be squeezed out of the sealed membrane by firm pressure with a paper towel. Exposures are best performed in hard-sided cassettes with a clamping mechanism to ensure even contact of the film with the wrapped membrane. Because of the kinetics of light emission of 1,2-dioxetane substrates on nylon membrane, the film exposure time required will decrease with time over a 6- to 8-hr period after substrate incubation. However, delaying film exposure some period after substrate addition is unnecessary. Generally, an initial 60-min film exposure will be approximately two-fold lighter than a subsequent 60-min exposure performed immediately after the first. Film exposures obtained the next day may exhibit more diffuse bands depending on the specific dioxetane substrate and membrane used. After 2-3 days, the signal will disappear from the high signal areas of the membrane because of substrate depletion.
III. D E T E C T I O N O F B I O T I N Y I A T E D DNA SEQUENCING REACTIONS WITH S T R E P T A V I D I N AND B I O T I N Y L A T E D ALKALINE P H O S P H A T A S E An alternative method for binding alkaline phosphatase to biotinylated DNA can be performed by taking advantage of the multiple biotin binding sites of streptavidin. Free streptavidin is bound to the biotin-labeled DNA;
20. ChemiluminescentDNA Sequencing with 1,2-Dioxetanes
505
incubation with biotinylated alkaline phosphatase then links the enzyme label to the DNA through a streptavidin bridge. The following protocol can be substituted for the blocking conjugate incubation, and washing steps in the basic chemiluminescent detection protocol. DNA sequencing reactions, electrophoresis, DNA transfer, UV cross-linking, and chemiluminescent substrate incubation steps remain the same. This procedure generates chemiluminescent signal intensities similar to those obtained with streptavidin-alkaline phosphatase conjugates. The following solution volumes apply to one 1000-cm2 membrane. Biotinylated alkaline phosphatase and streptavidin that have been tested for chemiluminescent detection, available from NEB and Millipore, are highly recommended.
A. Solutions Blocking solution: 5% SDS, 17 mM Na2HPO4, 8 mM NaH2PO4, pH 7.2 Streptavidin solution: Dilute streptavidin to 1 mg/ml in 6.8 mM Na2HPO 4, 3.2 mM NaH2PO4, pH 7.2, 150 mM NaC1, 0.05% sodium azide, pH 7.2 Wash solution I: Dilute blocking solution 1:10 with H20 Biotinylated alkaline phosphatase solution: Dilute biotinylated alkaline phosphatase to 0.5/xg/ml in blocking solution Wash solution II: Dilute 10• stock (100 mM Tris-HC1, 100 mM NaC1, 10 mM MgC12, pH 9.5) 1:10 with H20
B. Protocol
1. 2. 4. 5. 6.
Place the membrane in a bag or container. Add 100 ml blocking solution and incubate for 5 min. Incubate for 5 min in 50 ml streptavidin solution. Wash 2 x 5 min in 500 ml wash solution I. Incubate for 5 min in 50 ml biotinylated alkaline phosphatase solution. 7. Wash 2 x 5 min in 500 ml wash solution II. 8. Wash 1 • 5 min in 500 ml assay buffer. 9. Incubate with 50 ml dioxetane substrate solution and continue with standard protocol (Section II).
506
Chris S. Martin and Irena Bronstein
IV. CHEMILUMINESCENT DNA S E Q U E N C I N G W I T H HAPTENLABELED P R I M E R S AND D E T E C T I O N WITH ANTIBODY-ALKALINE PHOSPHATASE CONJUGATES As an alternative to biotin, other haptens such as digoxigenin, fluorescein, and 2,4-dinitrophenyl (DNP) may be used to label the products of the DNA sequencing reactions by incorporating primers labeled with these haptens (see Hrltke et al., 1992; Richterich and Church, 1993, Olensen et al., 1993). Primers 5' end-labeled with the appropriate haptens are utilized in DNA sequencing reactions. Gel electrophoresis, DNA transfer, and UV cross-linking procedures are identical (Fig. 4). Superior quality antibody-enzyme conjugates that have been tested for blotting applications are highly recommended (see Table I for suppliers). Nonspecific background levels can be higher with antibody detections when using some nylon membranes. Pall Biodyne A, Tropix, Amersham Hybond-N, and Boehringer Mannheim nylon membranes are recommended for this protocol.
A. Protocol Use the chemiluminescent detection procedure described in the Section II protocol, but substitute the solutions given in Section IV,B.
B. Solutions Blocking buffer: 0.2% casein or membrane-blocking reagent, 0.1% Tween 20 | 1• PBS Wash buffer: 0.3% Tween-20, 1 • PBS Conjugate solution: Dilute antibody conjugates (i.e., anti-digoxigenin, anti-fluorescein, or anti-DNP alkaline phosphatase) in blocking buffer, typically 1:2,500-1:10,000. Follow conjugate manufacturer's recommendations for the appropriate dilution.
V. INSTRUMENTATION Table II lists instruments that can be used for DNA sequencing with chemiluminescent detection and a source of large (24-in) bag sealers. Large format electroblotters are used to transfer DNA from sequencing gels to
20. ChemiluminescentDNA Sequencingwith 1,2-Dioxetanes
507
Fig. 4---Chemiluminescent detection of DNA sequence generated from a fluorescein-labeled -20 primer using M13 single-stranded DNA as template. Fragments were separated on a 6% polyacrylamide urea gel, transferred to nylon membrane by passive capillary action, and detected with anti-fluorescein-alkaline phosphatase and CSPD substrate. Exposure time is 60 min, 120 min after substrate addition. nylon membranes. These instruments can transfer D N A to the m e m b r a n e more efficiently than the capillary method. As an alternative to standard gel electrophoresis and horizontal D N A transfer, a direct transfer electrophoresis (DTE) instrument is commercially available. It is a modification of the original design of Pohl and Beck (1987) and performs simultaneous electrophoretic separation and transfer to nylon m e m b r a n e by depositing the D N A fragments onto a membrane that is moved slowly along the bottom of the electrophoresis plates (Fig. 5). A large-format rotating bottle apparatus can be used to perform the chemiluminescent detection steps.
508
Chris S. Martin and Irena Bronstein
Alternatively, an automated system is available that may be programmed to pump detection reagents into and out of the rotating bottle. Both these instruments utilize large bottles to accommodate full-sized sequencing gel blots without overlap.
VI. T R O U B L E S H O O T I N G The information presented in this section applies to procedures that are unique to chemiluminescent DNA sequencing. General troubleshooting information on DNA sequencing reactions and gel electrophoresis is available in standard laboratory molecular biology manuals.
A. High Background For best results all buffers, particularly the blocking and assay buffers, should be prepared daily. It is important that ultrapure deionized water and other reagents free of alkaline phosphatase contamination are used. Ensure that the membrane is well agitated in the plastic bag, that is, increase the shaker speed, increase the volume of liquid, and remove any air bubbles. Splotchy images may result from bacterial or alkaline phosphatase contamination of the membrane. Ensure that the membrane, blotting paper, and hybridization bags are clean and fingerprint free. Use powder-free gloves. Avoid cross-contamination of the wash solutions by the conjugate solution, that is, cover solutions during storage, wash the funnel used for liquid transfers, and clean the outside of the bag after each solution addition. Increasing the incubation time with blocking buffer or increasing the number of washes after the enzyme conjugate incubation may also decrease background. Reducing the incubation time with the alkaline phosphatase conjugate or increasing the dilution of the conjugate can be effective in decreasing the background. Spots or lines may be caused by mechanical damage to the membrane.
B. Poor Band Resolution Film exposures performed shortly after substrate addition exhibit the best resolution. The membrane may not be in good contact with the gel during the
m N 7 i~ i
w
m
/= 8
m
S
z=-,-_-
m
mill
m
-.-g~111 _--Z
_--7..
m
Ill
f
.
mema,
am,,_ m m
S
S mmJ,m, 8
i, J
Fig. 5--Chemiluminescent detection of DNA sequence generated from a biotinylated - 2 0 primer using M13 single-stranded DNA as template. Fragments were separated by direct transfer electrophoresis (DTE) on a Betagen Auto Trans 350 instrument. Detection was performed with streptavidin alkaline phosphatase and CSPD substrate. Exposure time is 60 min, 60 min after substrate addition.
510
Chris S. Martin and Irena Bronstein
transfer. Carefully press membrane onto the gel with a pipet. Add a heavier weight during the capillary transfer procedure. The X-ray film may not be in good contact with the membrane. Reseal the membrane with plastic wrap and avoid wrinkles. Use an exposure cassette with clamps.
C. Low Signal Assay buffer must be adjusted to pH 10. Inefficient DNA transfer may result in a faint signal. Review the transfer procedure, and repeat the experiment. When using the capillary transfer method, it is very important to have the gel sandwich on an absolutely flat surface. Increasing the amount of weight used will sometimes provide a more uniform transfer. Low intensity signal from the low molecular weight fragments is normal and more pronounced when using neutral nylon membranes.
Vll.
CONCLUSIONS
Chemiluminescent DNA sequencing with 1,2-dioxetanes provides a simple manual method for generating high-quality sequence data without the use of radioisotopic labels. The technique is sensitive and flexible. The data generated are visualized on X-ray film and are similar to those achieved with radioisotopic detection. Band resolution is the same or better than 3zp detection methods. Because of the short film exposure times, chemiluminescent DNA sequencing can be performed in one 7- to 10-hr period: gel preparation and DNA sequencing reactions (1 hr), gel running (3 hr), DNA transfer (1 hr), drying and UV cross-linking (0.5 hr), detection (1.5 hr), film exposure (1 hr). It is advisable to reserve time at the end of the day to perform any necessary additional film exposures. Alternatively, the procedure may be easily performed over 2 or more days or blocks of time. Biotinylated DNA sequencing reactions are stable at -20~ for long periods of time. After electrophoresis and DNA transfer, the nylon membrane may be stored dry between layers of plastic wrap for several weeks at 4~ UV crosslinking can be performed before or after storage. Any of the chemiluminescent detection steps except the substrate incubation can be increased to permit a break. Long incubations in substrate solution can result in signal "bleeding" from the bands. The period of time suggested for each chemiluminescent detection step may be shortened, generally with satisfactory
20. ChemiluminescentDNA Sequencing with 1,2-Dioxetanes
511
results. If higher background or lower signal is observed, return to the standard procedure. The 1,2-dioxetane chemiluminescent detection system is highly adaptable, as demonstrated by the wide variety of DNA sequencing applications performed with the system. Simple adaptations of the protocol described here can be used to perform techniques that require high-resolution gels, including primer extensions, DNA footprinting, and the detection of PCRamplified simple-sequence-repeat alleles.
REFERENCES Beck, S., O'Keeffe, T., Coull, J. M., and Koster, H. (1989). Chemiluminescent detection of DNA: Application for DNA sequencing and hybridization. Nucleic Acids Res. 17, 5115-5123. Bronstein, I., Juo, R.-R., Voyta, J. C., and Edwards, B. (1991). Novel chemiluminescent adamantyl 1,2-dioxetane enzyme substrates. In "Bioluminescence and Chemiluminescence: Current Status" (P. Stanley and L. J. Kricka, eds.), pp. 73-82. Wiley, Chichester. Church, G. M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl. Acad. Sci. U.S.A. 81, 1991-1995. Church, G. M., and Kieffer-Higgins, S. (1988). Multiplex DNA sequencing. Science 240, 185-188. Creasey, A., D'Angio, L., Jr., Dunne, T. S., Kissinger, C., O'Keeffe, T., Perry-O'Keeffe, H., Moran, L. S., Roskey, M., Schildkraut, I., Sears, L. E., and Slatko, B. (1991). Application of a novel chemiluminescence-based DNA detection method to single-vector and multiplex DNA sequencing. BioTechniques 11, 102-109. H61tke, H. J., Sanger, G., Kessler, C., and Schmitz, G. (1992). Sensitive chemiluminescent detection of digoxigenin-labeled nucleic acids: A fast simple protocol and its applications. BioTechniques 12, 104-113. Karger, A. E., Weiss, R., and Gesteland, R. F. (1992). Electronic chemiluminescence imaging of DNA sequencing blots using a charge-coupled device camera. Nucleic Acids Res. 20, 6657-6665. Karger, A. E. Weiss, R., and Gesteland, R. F. (1993). A line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots. Anal. Chem. 65, 1785-1793. Lakey, N. D., and Ghazizadeh, H., Jaehn, L., Richterich, P., Robinson, K., and Church, G. (1993). Automated multiplex sequencing ofE. coli genomic DNA. Genome Sci. Technol. 1, 41. Martin, C., Bresnick, L., Juo, R.-R., Voyta, J. C., and Bronstein, I. (1991). Improved chemiluminescent DNA sequencing. BioTechniques 11, 102-109. Mathews, J. A., Batki, A., Hynds, C., and Kricka, L. J. (1985). Enhanced chemiluminescent method for the detection of DNA dot-hybridisation assays. Anal. Biochem. 151, 205-209. Olesen, C. E. M., Martin, C. S., and Bronstein, I. (1993). Chemiluminescent DNA sequencing with multiplex labeling. BioTechniques 15, 480-485. Pohl, F. M., and Beck, S. (1987). Direct transfer electrophoresis used for DNA sequencing. Methods Enzymol. 155, 250-259. Pollard-Knight, D., Read, C. A., Downes, M. J., Howard, L. A., Leadbetter, L. A., Pheby, S. A., McNaughton, E., Syms, A., and Brady, M. A. W. (1990). Nonradioactive nucleic
512
Chris S. Martin and Irena Bronstein
acid detection by enhanced chemiluminescence using probes directly labeled with horseradish peroxidase. Anal. Biochem. 185, 84-89. Richterich, P., and Church, G. M. (1993). DNA sequencing with direct transfer electrophoresis and non-radioactive detection. Methods Enzymol. 218, 187-223. Tizard, R., Cate, R. L., Ramachandran, K. L., Wysk, M., Voyta, J. C., Murphy, O. J., and Bronstein, I. (1990). Imaging of DNA sequences with chemiluminescence. Proc. Natl. Acad. Sci. U.S.A. 87, 4514-4518.
INDEX
ABE1, s e e Amino-butyl-ethyl-isoluminol ABTS, s e e 2,2'-Azinobis(3ethylbenzthiazoline-6-sulfonic acid) Acridine orange, 21 Acridinium esters, 14, 391-428 differential hydrolysis, 396, 397 labeling, 403,406-411 properties, 399 Adamantyl-l,2-dioxetanes, 145-164, 155, 157, 158, 481,494 AEC, s e e 3-Amino-9-ethylcarbazole Aequorin, 14 Alkaline phosphatase, 15 assay bioluminescent, 131-144 chemiluminescent, 145-164, 185-194 colorimetric, 165-183 fluorescent, 113-129 avidin conjugate, 126 detection limits, 12 label, 77-78 streptavidin conjugates, 122, 151 Alkylsalicyl phosphate, 116 Allele-specific amplification, 365, 369 Allylamine, labeling, 69, 73 Amination, DNA, 451,453 Amino-butyl-ethyl-isoluminol, 443,449, 459 3-Amino-9-ethylcarbazole, 221,230 Aminolink I/II, 73-74 Amplification, 18-20 DNA, 19, 244-245, 256-257, 272-276, 321,323, 324, 361,386, 419, 447, 469 amplification labels, 18 probes, 18-19
AMPPD, 155, 157, 158, 481 Analytical strategies, 18-22 Angelicin, 44 Anti-CD4, 299 Anti-HIV, 265 Arakawa, H., 185-194 Arcus 1234, 120, 317 Argus 50/MP, 189 Argus 100, 135 Arnold, L. J., Jr., 391-428 Ascorbic acid 2-O-phosphate, 186-187, 190 ATP, 131 Avidin conjugates, 126, 297 2,2'-Azinobis(3-ethylbenzthiazoline-6sulfonic acid), 222, 223
Background rejection, 20 Bacterial luciferase, 239 Balaguer, P., 237-260 Baret, A., 261-269 BCIG, 188 BCIP, s e e 5-Bromo-4-chloroindolyl phosphate Beverloo, H. B., 285-306 Bifunctional coupling reagents, 71 Bioluminescence, 12-13 Bioluminescence-enhanced detection, 136-141 Bioluminescent assay adsorbent, 245-246 alkaline phosphatase, 131-144 dot blot, 246 reverse dot blot, 249 sandwich hybridization, 251 strand exchange, 253 Biotin labeling, 43, 45, 167, 191 Biotinylated probes, 148-151, 167 513
514 Blotting assays, 4-5 procedures, 5 Blue Gene, 323 Boussioux, A. -M., 237-260 5-Bromo-4-chloroindolyl phosphate, 168, 188-190 Bronstein, I., 145-164, 493-512 Bst polymerase, 497-498
Camera luminometer, 203 CCD camera, 203 imaging, 265 Chemical labeling, 10, 44, 62-76 Chemiluminescence, 8, 12-13,391-428, 432 Chemiluminescent assay alkaline phosphatase, 145-164, 185-194 peroxidase, 195-215 4-Chloro- 1-naphthol, 221 Christopoulos, T. K., 377-390 Coimmobilised enzymes, 21,245 Colony blotting, 5 hybridization, 208 Colorimetric assay alkaline phosphatase, 165-183 peroxidase, 217-236 Controlled-pore glass, 75 Coupling reagents; bifunctional, 71 CSPD, 145-164, 481,494 CyberFluor 615, 120, 317
DAB, s e e 3,3'-Diamino benzidine Dahlen, P., 331-376 DELFIA, 336 Detection, s e e also specific t e c h n i q u e s formats, 89-92 limits, 12, 212 systems, 12-22, 83-92 Diamandis, E. P., 377-390 3,3'-Diaminobenzidine, 221 Diazobiotin, 45 Digoxigenin, 125 1,2-Dioxetanes, 493-512 DNA 3'-amination, 453 5'-amination, 451
Index amplification, 19, 244-245,256-257, 272-276, 321,323,324, 361,386, 419, 447, 469 biotinylated, 191 homogenous assay, 20-22 labeling, 7-11, 41-109, 196-198 lambda, 193,301,303,383,384 5'-phosphorylation, 449-451 strand-exchange, 253-254 UV cross-linking, 147, 501 DNA hybridization assay, labels, 8, 9, 11-22, 83-92 DNA polymerase 1,478, 494 DNA sequencing, 475-492, 493-512 automated, 476-478 biotin-labeled primers, 479-482, 496-504 chemiluminescent, 482, 488 colorimetric, 488 fluorescent, 476-478 ladder, 475,476 manual, 478-479 Dotblot, 5, 125, 135-138, 208, 246-249, 266, 320, 334, 366 Dot-spots, 293 Dual label assay, 364 Durrant, I., 195-215
EALL, s e e Enzyme amplified lanthanide luminescence Eastern blot, 5 ECL, s e e Enhanced chemiluminescence Electrochemiluminescence, 14, 271-283 ELISA, 218 3'-End labeling, 75,453 5'-End labeling, 73,451 Energy level diagram, 435 Energy transfer, 429-471 Enhanced chemiluminescence, 78-79, 195-215 mechanism, 200 Enhancers, 79, 200 Enzymatic labeling, 45, 49-62, 348-359 Enzyme amplified lanthanide luminescence, 115 Enzyme labels, 76-79 Ethidium bromide, 66 Europium, labeling, 311-317, 340-344, 347, 348-359 Europium cnelate, 16
Index
515
Europium cryptate, 307-329 Europium-dCTP, 349
Fenton reaction, 261,262 Firefly luciferase, 13, 131, 133 Flick, P. K., 475-492 Fluorene, 66-67 Fluorescein, 16, 477 labels, 202 Fluorescein isothiocyanate, 449, 459 Fluorescence, 8, 14, 85,307-329, 331-376, 377-390, 429-471 energy transfer, 429-471 quenching, 429-471 Fluorescent assay, alkaline phosphatase, 113-129 Fluorometers, 118, 119, 454-457 5-Fluorosalicyl phosphate, 116 Furocoumarin, 64-65
Geiger, R. E., 131-144 GeneAmp PCR System 9600, 274 Glucose-6-phosphate dehydrogenase, 16, 237-260 streptavidin conjugate, 242 Gudgin Dickson, E. F., 113-129 I-ll Haber-Weiss reaction, 261 HIV-1,277, 279 HLA typing, 211,212 Homogeneous DNA assay, 20-22 Horseradish peroxidase, 16 chemiluminescent assay, 195-215 colorimetric assay, 217-236 ECL, 195-215 labels, 78-79 positive-charge modified, 196 streptavidin conjugate, 227 HPLC, 405-406 HPV, 16, 326 Hurskainen, P., 331-376 Hybridization hybrid stability, 79-80 reassociation rate, 80-82 sensitivity, 11-22 Hybridization protection assay, 398
IgG, 137, 293 Imaging, 22, 265 Immobilized enzymes, 245 In situ hybridization, 173-178, 218-219, 224-227 p-lodophenol, 79 Isoluminol, 17 K Katz, E. D., 271-283 Kessler, C., 41-109 Klenow fragment, 478, 494 Kodak-XAR, 152 Kricka, L. J., 3-40 L Labeling, 7-11 acridinium esters, 403,406-411 allylamine, 69, 73 azide compounds, 63-64 biotin, 43, 45, 167, 191 bromo derivatives, 69-70 chemical, 10, 44, 62-76 DNA, 7-11, 41-109, 196-198 3'-End, 75, 453 5'-End, 73,451 enzymatic, 45, 49-62, 348-359 ethidium bromide, 66 europium, 311-317, 340-344, 347, 348-359 fluorene, 66-67 furocoumarin, 64-65 horseradish peroxidase, 78-79 mercury, 67 nick-translation, 54-56, 349 oligonucleotides, 61-62, 198-199, 205-206, 241 PCR, 56-59 plasmids, 240-241 random-primed, 51-54, 149 RNA, 59-61 sulfone groups, 66 thiolation, 71 transamination, 68-69 Labels alkaline phosphatase, 77-78 amplification, 18 chemiluminescent, 8, 391-428, 432
516 detection, 11-22 direct, 8 electrochemiluminescent, 271-283 enzyme, 8, 113-129, 131-144, 145-164, 165-183, 185-194, 195-215, 217-236, 237-260, 261-269 fluorescent, 8, 85,307-329, 331-376, 377-390, 429-471 indirect, 9 multiple, 22 phosphorescent, 285-306 radioluminescent, 8 13-Lactamase gene, 338 La Jolla Blue, 21 h phage DNA, 193,301,303,383, 384 Lanthanide, 307-332 Lanthanide chelates, 331-376, 377-390 LCR, 19 LEADER I luminometer, 405 LEADER 50 luminometer, 405 Ligase chain reaction, 19 Linker arms, 67-71 Long probes, 196-198, 204-205, 315 Lopez, E., 307-329 Lovgren, T., 331-376 Luciferase firefly, 13, 131, 133 marine bacterial, 239 Renilla, 17 Luciferin, 13, 133 D-Luciferin-O-galactoside, 134 D-Luciferin methyl ester, 134 D-Luciferin-O-phosphate, 131-144 D-Luciferin-O-sulfate, 134 D-Luciferyl-L-N-a-arginine, 134 D-Luciferyl-L-phenylalanine, 134 Lucigenin, 186, 187 Luminol, 17, 199-201 Luminometer, 456-458 LEADER I, 405 LEADER 50, 405 Lumi-Phos 480, 481,530 M
M 13, 8, 485,486, 507, 509 Maeda, M., 185-194 Magnetic particles, 274 separation, 272, 421 Martin, C. S., 145-164, 493-512 Mathis, G., 307-329
Index Matrix assays, 22 Membranes, 315 reprobing, 153 selection, 296 Mercuration, 44, 67 Microwell assays, 126-127, 227-229, 321-327 Miska, W., 131-144 Morrison, L. E., 429-471 Multianalyte assays, 291,289 Murphy, O. J., 145-164 Mutations, detection, 363
NADP, 186, 189-191 NADPH:FMN oxidoreductase, immobilized, 21 Naphthoyltrifluoroacetone, 378 NASBA, 19 NBT, 168, 177 Nelson, N. C., 391-428 Ngyuen, Q., 145-164 NICE, 77-78 Nick translation, 54-56, 349 Nicolas, J.-C., 237-260 7-Nitrobenz-2-oxa- 1,3-diazole, 477 Nitrocellulose, 170, 315 Nonseparation assays, 20-22 Northern blot, 3, 5, 160, 208 North-Western blot, 5 N-ras proto-oncogene, 209 Nucleic acid binding partner, 47-48 biotinylation, 43, 167 chemical labeling, 10 labeling, 7-11, 41-109, 198-199, 205-206, 241,403 labels, 6-9 mercuration, 44 sulfonation, 43 thiolation, 50 transamination, 340 Nucleic acid hybridization applications, 4-5 detection systems 43-45 devices, 24 labeling enzymatic, 49-62 nick-translation, 54-56, 349 PCR, 56-59
Index procedures, 5 random-primed, 51-54, 149 Nucleic acid sequence-based amplification, 19 Nylon blotting membrane, 171
Oligonucleotide probes biotinylated, 148-151 europium labeled, 350-363 labeling, 61-62, 198-199, 205-206, 241 OPD, see o-Phenylenediamine
Papillomavirus, 226 Patents, 23-26 pBluescript SK, 485 PCR, 19, 244-245,273,323,361,386, 419, 447, 469 nested, 321,324 RT-, 256-257, 272-276 Peroxidase, see Horseradish peroxidase o-Phenylenediamine, 222, 223 Phosphorescence, 14, 285-306 Phosphors, 17, 285-306 avidin, 297 characterization, 289 conjugates, 295 semiconductor, 289 32phosphorus, 8 Photinus pyralis, 131 P h o t o b a c t e r i u m fischeri, 240
Photobiotin, 342 Photodigoxigenin, 44 PhotoDNP, 44 Photographic detection, 119, 135, 136, 139-140, 152-153,203,292-294 Photon counting camera, 135, 137-140 Plaque hybridization, 208 Plasmids labeling, 240-241 pBR322, 124, 125, 127, 139-141 pBR328, 383 Polaroid Type 612 film, Pollak, A., 113-129 Polyadenylation, 48 Poly-dT tail, 48 Prat, O., 307-329
517 Probes amplification, 18-19 networks, 18 Protein A conjugates, 299 Protein blotting, 23 Pyrene, 443,449, 459
QPCR 5000, 274 Q-B replicase, amplification assay, 19
Radioluminescence, 8 Random-primed labeling, 51-54, 149 Rashtchian, A., 165-183 REALL-M, 123 REALL-S, 127 Renilla luciferase, 17 Reprobing, 153,213 Restriction enzymes, 367 Reverse dot-blot, 249-251 Reynolds, M. A., 391-428 RFLP analysis, 208 RNA labeling, 59-61 RT-PCR, 256-257, 272-276 Ruthenium(II) tris(bipyridyl), 18, 271-283
Salicyl phosphates, 13, 116, 117 Sandwich hybridization, 220, 251-252, 336-339, 344 SBMC, see Streptavidin-based macromolecular complexes Self-sustained sequence replication assay (3SR), 19 Sequenase T7, 479, 494 Single copy gene, 154-163 Slot blot, 135-138, 208 SNAP probes, 77-78 Southern blot, 3, 5, 121-124, 146-163, 208, 266, 302-304, 383, 386 South-Western blot, 5 Streptavidin-based macromolecular complexes, 380-382 Streptavidin conjugates alkaline phosphatase, 122, 151 europium labeled, 311-315, 337, 380-382
518 G6PDH, 242 peroxidase, 227 Sulfonation, 43 Sulfones, 9, 66
Taq DNA polymerase, 479, 494 Target amplification, 19, 20 TAS, see Transcription amplification system T7 DNA polymerase, 478 Terouanne, B., 237-260 3,3',5,5 '-Tetramethylbenzidine (TMB), 221,223,232 Tetramethylrhodamine, 443,477 Tetramethylrhodamine isothiocyanate, 449, 459 Texas Red, 443,449, 459, 477 Thiolation, 50, 71 Thyroglobulin, 381 Time-resolved fluorescence, 14, 113-129, 287, 307-329, 331-376, 377-390 TMB, see 3,3',5,5',-Tetramethylbenzidine Transamination, 68-69, 340 Transcription amplification system, 19, 419 Tripropylamine, 272 Tropilon, 147 TRP 100, 119, 293 Tsuji, A., 185-194 Tumulo, A., 145-164
Index
UV cross-linking, 147, 501
Verlander, P. C., 217-236 Vibrio haroeyi, 238 Villebrun, M. A., 237-260 Visiblot, 488 Voyta, J. C., 145-164 W Wages, J. M., 271-283 Western blot, 3, 5,206, 207-209, 265, 298-299 detection limits, 212 Witney, F., 145-164 Wong, H. E., 113-129 X Xanthine oxidase, 18, 261-269 X-ray film, 152, 162, 207, 263 u Yttrium oxisulfide, 289 Z Zinc silicate, 289