No title

View Online

MyRSC – Online Community

Food & Function Linking the chemistry and physics of food with health and nutrition

Downloaded on 12 April 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90005F

www.rsc.org/foodfunction

Volume 2 | Number 3–4 | April 2011 | Pages 145–214

A professional network for the chemical sciences, hosted by the RSC MyRSC is leading the way in providing an international networking hub for advancing the chemical sciences. Connect, engage and interact with scientists across the globe regardless of location, career stage or interest. • Personalise your profile to reflect your specific interests • Grow your network with people who share common interests, research or workplace • Join groups and communities based in your field • Exchange knowledge and expertise with fellow scientists or to get help and ask questions • Follow blogs and discussion forums - carry on the debate

How to register with MyRSC Go to http://my.rsc.org and click on register, fill out the form. An email will be sent to your specified address, follow the link to activate your MyRSC account. You can find and download our quick start guide at http://my.rsc.org/quickstartguide

http://my.rsc.org Registered Charity Number 207890

ISSN 2042-6496

COVER ARTICLE Pradeep Singh Negi et al. Expression of carotenoid biosynthetic pathway genes and changes in carotenoids during ripening in tomato (Lycopersicon esculentum)

2042-6496(2011)2:3/4;1-8

View Online

Food & Function

International Symposia on Advancing the Chemical Sciences (ISACS)

Challenges in Chemical Biology (ISACS5)

Linking the chemistry and physics of food with health and nutrition

Volume 2 | Number 3–4 | April 2011 | Pages 145–214

Downloaded on 12 April 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90006D

www.rsc.org/foodfunction

26-29 July 2011 z University of Manchester, UK Topical

Speakers include

Gain a state-of-the-art review of current research developments and identify future challenges in a comprehensive plenary programme.

Thomas Steitz, USA (Nobel Laureate) Venki Ramakrishnan, UK (Nobel Laureate) Donna Blackmond, USA Ben Davis, UK Andrew Ellington, USA Hermann Gaub, Germany Reza Ghadiri, USA Nathaneal Gray, USA Andrew Griffiths, France Bartosz A Grzybowski, USA Johan Hofkens, Belgium Philip Holliger, UK Clyde Hutchison, USA Stefan Knapp, UK Stephen Mann, UK David Rees, UK Hugh Rosen, USA William Shih, USA Hiroaki Suga, Japan Erik Winfree, USA

Interactive Network with the editors of Chemical Science and international colleagues and present your research in the poster sessions.

Dynamic Hear from a new generation of exceptional, internationally renowned researchers.

New for 2011 We have a limited number of oral presentation slots available at ISACS5. If you are interested in presenting your work at the meeting, visit the website to submit your abstract for consideration by the conference committee.

About ISACS The International Symposia on Advancing the Chemical Sciences (ISACS) is a significant new global symposia series, supporting the launch of the new RSC flagship journal Chemical Science. Related events include:

Challenges in Renewable Energy (ISACS4) 5-8 July 2011 z Boston, USA z www.rsc.org/isacs4 Challenges in Organic Materials & Supramolecular Chemistry (ISACS6) 2-5 September 2011 z Beijing, China z www.rsc.org/isacs6 Co-sponsored by: RSC Chemical Biology Interface Division

ISSN 2042-6496

Conference Committee Hagan Bayley, UK (Conference Chair) Benjamin Cravatt, USA Thomas Carell, Germany John McCarthy, UK

Sign up for news updates and register at: www.rsc.org/isacs5 Registered Charity Number 207890

COVER ARTICLE Jianshe Chen et al. Development of a simple model device for in vitro gastric digestion investigation

View Online

Food & Function www.rsc.org/foodfunction RSC Publishing is a not-for-profit publisher and a division of the Royal Society of Chemistry. Any surplus made is used to support charitable activities aimed at advancing the chemical sciences. Full details are available from www.rsc.org

IN THIS ISSUE

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

ISSN 2042-6496 CODEN FFOUAI 2(3–4) 145–214 (2011) Cover See Pradeep Singh Negi et al., pp. 168–173. Differential gene expression is responsible for lycopene accumulation in ripening tomatoes. Image reproduced by permission of Pradeep Singh Negi from Food Funct., 2011, 2, 168.

Inside cover See Jianshe Chen et al., pp. 174–182. An SEM image showing the hollowed surface microstructure of a peanut particle after gastric digestion inside a mouse’s stomach. Plant cells are clearly identifiable by the remaining cell walls. Image reproduced by permission of Jianshe Chen from Food Funct., 2011, 2, 174.

REVIEW 153 The potential role of milk-derived peptides in cardiovascular disease Martha Phelan and David Kerins In this review selected biological effects of milk peptides relating to cardiovascular disease are discussed with a view to providing essential information to researchers.

PAPERS 168 Expression of carotenoid biosynthetic pathway genes and changes in carotenoids during ripening in tomato (Lycopersicon esculentum) Kanakapura Krishnamurthy Namitha, Surya Narayana Archana and Pradeep Singh Negi* The lycopene accumulation in Indian tomato cultivar ‘Arka Ahuti’ coincided with the relative expression of the carotenoid biosynthesis pathway genes (shown here is geranylgeranyl pyrophosphate synthase) and the redness ‘a’ value.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 147–152 | 147

View Online

EDITORIAL STAFF Editor Sarah Ruthven Deputy editor Kathleen Too

Linking the chemistry and physics of food with health and nutrition www.rsc.org/foodfunction

Senior publishing editor Gisela Scott

Food & Function provides a dedicated venue for research relating to the chemical and physical properties of food components and their nutritional and health benefits in humans.

Development editor Anna Simpson Publishing editors Mary Badcock, David Barden, Emma Eley, David Parker, Helen Potter, Michael Townsend

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

Food & Function

Publishing assistants Juliet Palmer, Rachel Blakeburn Publisher Emma Wilson For queries about submitted articles please contact Gisela Scott, Senior publishing editor, in the first instance. E-mail [email protected]

EDITORIAL BOARD Editor-in-Chief Professor Gary Williamson, University of Leeds, UK Associate Editors Cesar Fraga, University of Buenos Aires, Argentina & University of California, Davis, USA Steven Feng Chen, The University of Hong Kong, China

For pre-submission queries please contact Sarah Ruthven, Editor. E-mail [email protected] Food & Function (print: ISSN 2042-6496; electronic: ISSN 2042-650X) is published 12 times a year by the Royal Society of Chemistry, Thomas Graham House, Science Park, Milton Road, Cambridge, UK CB4 0WF. All orders, with cheques made payable to the Royal Society of Chemistry, should be sent to RSC Distribution Services, c/o Portland Customer Services, Commerce Way, Colchester, Essex, UK CO2 8HP. Tel +44 (0)1206 226050; E-mail [email protected] 2011 Annual (print + electronic) subscription price: £1260; US$2344. 2011 Annual (electronic) subscription price: £1134; US$2108. Customers in Canada will be subject to a surcharge to cover GST. Customers in the EU subscribing to the electronic version only will be charged VAT. If you take an institutional subscription to any RSC journal you are entitled to free, site-wide web access to that journal. You can arrange access via Internet Protocol (IP) address at www.rsc.org/ip. Customers should make payments by cheque in sterling payable on a UK clearing bank or in US dollars payable on a US clearing bank. Periodicals postage paid at Rahway, NJ, USA and at additional mailing offices. Airfreight and mailing in the USA by Mercury Airfreight International Ltd., 365 Blair Road, Avenel, NJ 07001, USA. US Postmaster: send address changes to Food & Function, c/o Mercury Airfreight International Ltd., 365 Blair Road, Avenel, NJ 07001. All despatches outside the UK by Consolidated Airfreight. Advertisement sales: Tel +44 (0) 1223 432246; Fax +44 (0) 1223 426017; E-mail [email protected] For marketing opportunities relating to this journal, contact [email protected]

Members Aedin Cassidy, University of East Anglia, UK Kevin Croft, University of Western Australia, Australia Eric Decker, University of Massachusetts, USA Alejandro Marangoni, University of Guelph, Canada

Reinhard Miller, Max Planck Institute of Colloids & Interfaces, Germany Paul Moughan, Riddet Institute, Massey University, New Zealand Johan Ubbink, The Mill, Food Concept & Physical Design, Switzerland Fons Voragen, Wageningen, The Netherlands

ADVISORY BOARD Hitoshi Ashida, Kobe University, Japan Junshi Chen, Chinese Centre of Disease Control & Prevention, China E. Allen Foegeding, North Carolina State University, USA Vincenzo Fogliano, University of Napoli Federico II, Italy Mike Gidley, University of Queensland, Australia Chi-Tang Ho, Rutgers University, USA Richard Hurrell, ETH Zurich, Switzerland Peter Lillford, University of York, UK Rui Hai Liu, Cornell University, USA

Julian McClements, University of Massachusetts, USA Clare Mills, Institute of Food Research, UK John A. Milner, National Cancer Institute, National Institutes of Health, USA Brent Murray, University of Leeds, UK Patricia Oteiza, University of California at Davis, USA Augustin Scalbert, INRA, France Helmut Sies, University of Dusseldorf, Germany

Leif Skibsted, University of Copenhagen, Denmark David Stuart, The Hershey Company, USA Arthur Tatham, University of Wales Institute, Cardiff, UK Junji Terao, University of Tokushima, Japan George van Aken, NIZO Food Research, The Netherlands Erik van der Linden, TI Food & Nutrition, The Netherlands Jose Vina, University of Valencia, Spain

INFORMATION FOR AUTHORS Full details on how to submit material for publication in Food & Function are given in the Instructions for Authors (available from http://www.rsc.org/authors). Submissions should be made via the journal’s homepage: http://www.rsc.org/foodfunction. Authors may reproduce/republish portions of their published contribution without seeking permission from the RSC, provided that any such republication is accompanied by an acknowledgement in the form: (Original Citation)–Reproduced by permission of The Royal Society of Chemistry. This journal is © The Royal Society of Chemistry 2011. Apart from fair dealing for the purposes of research or private study for non-commercial purposes, or criticism or review, as permitted under the Copyright, Designs and

Patents Act 1988 and the Copyright and Related Rights Regulation 2003, this publication may only be reproduced, stored or transmitted, in any form or by any means, with the prior permission in writing of the Publishers or in the case of reprographic reproduction in accordance with the terms of licences issued by the Copyright Licensing Agency in the UK. US copyright law is applicable to users in the USA. The Royal Society of Chemistry takes reasonable care in the preparation of this publication but does not accept liability for the consequences of any errors or omissions. ∞ The paper used in this publication meets the  requirements of ANSI/NISO Z39.48–1992 (Permanence of Paper). Royal Society of Chemistry: Registered Charity No. 207890.

View Online

PAPERS 174 Development of a simple model device for in vitro gastric digestion investigation Jianshe Chen,* Vishwajeet Gaikwad, Melvin Holmes, Brent Murray, Malcolm Povey, Ye Wang and Ying Zhang

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

CLSM images of non-roasted and roasted peanut particles after in vitro gastric digestion.

183 Metabolic fate of orally administered enzymatically synthesized glycogen in rats Takashi Furuyashiki,* Hiroki Takata, Iwao Kojima, Takashi Kuriki, Itsuko Fukuda and Hitoshi Ashida Around 20% of enzymatically synthesized glycogen (ESG) was transferred to the cecum in the form of a polymer and assimilated into SCFAs by microbiota, and affected lipid metabolism in rats.

190 Antioxidant and antihepatotoxic effect of Spirulina laxissima against carbon tetrachloride induced hepatotoxicity in rats Gini C. Kuriakose* and Muraleedhara G. Kurup* This study suggests that ethanol extract of Spirulina laxissima can protect the liver against CCl4-induced oxidative damage in rats, and the hepatoprotective effect might be correlated with its antioxidant and radical-scavenging effects.

197 Habitual coffee and tea drinkers experienced increases in blood pressure after consuming low to moderate doses of caffeine; these increases were larger upright than in the supine posture Michael K. McMullen,* Julie M. Whitehouse, Gillian Shine and Anthony Towell Following the consumption of caffeine capsules habitual coffee and tea consumers experienced blood pressure increases which were larger when upright.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 147–152 | 149

View Online

PAPERS 204 Antiproliferative mechanisms of quercetin in rat activated hepatic stellate cells Li-chen Wu,* In-wei Lu, Chi-Fu Chung, Hsing-Yu Wu and Yi-Ting Liu

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

Quercetin induces apoptosis of activated hepatic stellate cells through extrinsic pathway and attenuates their secretion of inflammatory mediators.

150 | Food Funct., 2011, 2, 147–152

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

Make sure you don’t miss out! Number 1 | 2009

Analytical Methods

Quantitative biosciences from nano to macro

Advancing Methods and Applications

www.rsc.org/methods

www.rsc.org/ibiology

Volume 1 | Number 1 | Autumn 2009 | Pages 001–200

Volume 1 | Number 1 | January 2009 | Pages 1–100

Number 1 | 2008

Volume 1 | Number 1 | 2008

www.rsc.org/chemcomm

Number 39 | 21 October 2007 | Pages 3969 – 4060

Metallomics Integrated biometal science www.rsc.org/metallomics

Volume 1 | Number 1 | 2009 | Pages 1–124

Volume 1 | Number 1 | January 2009 | Pages 1–100

Nanoscale

Metallomics

www.rsc.org/nanoscale

ISSN 1359-7345

COMMUNICATION Takahiko Kojima et al. A discrete conglomerate of a distorted Mo(V)-porphyrin with a directly coordinated Keggin-type polyoxometalate

FEATURE ARTICLES Yoshinori Yamanoi and Hiroshi Nishihara Assembly of nanosize metallic particles and molecular wires on electrode surfaces DonnaG.Blackmond and Martin Klussmann Assessing phase behavior models for the evolution of homochirality

1359-7345(2007)39;1-Y

Introducing Professor Mike Doyle ISSN 1757-9694

ISSN 1759-9660

Associate Editor for Organic Chemistry Michael P. (Mike) Doyle is Professor and Chair of the Department of Chemistry and Biochemistry at the University of Maryland, College Park. He has been the recipient of numerous awards, including the George C. Pimentel Award for Chemical Education in 2002 and the Arthur C. Cope Scholar Award in 2006. He has written or coauthored ten books, including Basic Organic Stereochemistry, 20 book chapters, and he is the co-author of more than 270 journal publications. The inventor of chiral dirhodium carboxamidate catalysts known as “Doyle catalysts,” his research is focused on applications with metal carbene transformations, Lewis acid catalyzed reactions, and selective catalytic oxidations.

Submit your work to ChemComm Professor Doyle will be delighted to receive submissions from North America in the field of organic chemistry. Submissions to ChemComm are welcomed via ReSourCe, our homepage for authors and referees.

1756-5901(2009) 1:1;l-m 1754-5692(2008)1:1;1-6

“ChemComm is an outstanding forum for the communication of significant research in the chemical sciences, and I am honoured to be a member of the editorial family. I continue to be amazed with the breadth of exciting chemistry that is being submitted to ChemComm and the high level of professionalism that is found at ChemComm.”

Registered Charity Number 207890

0306-0012(2009)38:1;1-8

ISSN 1756-5901

Pages 1–100

Pages 000–000

www.rsc.org/chemcomm

ISSN 0306-0012

020878

Pages 000–000

Downloaded on 10 May 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90007B

Analytical Methods

Make an impact Chemical Communications

1756-5901(2009) 1:1;l-m 1754-5692(2008)1:1;1-6

You and your colleagues might have been enjoying free access to the first two volumes of these RSC Publishing journals Analytical Methods – linking industry and academia by focusing on the practical value of analytical science for real world applications. www.rsc.org/methods Integrative Biology - publishing novel biological research, based on innovative experimental and theoretical methodologies. www.rsc.org/ibiology Metallomics – interdisciplinary science which provides insight into the role of metals in biological, environmental and clinical systems. www.rsc.org/metallomics Nanoscale – experimental and theoretical work across the breadth of nanoscience and nanotechnology. www.rsc.org/nanoscale

Number 7 | 2007

Want to retain access?

www.rsc.org/ees

Volume 000 Number 00 | Month 2008 | Pages 000–000

Energy & Environmental Science

In 2011 these journals are available by subscription only. If you’d like to retain access, recommend them to your information specialist today – www.rsc.org/libraryrecommendation And the best advocate to prove to you that RSC journals provide essential research is Energy & Environmental Science. Launched in 2008, it’s received its first Impact Factor: a whopping 8.5! www.rsc.org/ees

Pages 0000–0000

ISSN 1754-5692

www.rsc.org/journals Registered Charity Number 207890

Food & Function

C

View Online

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 153

REVIEW

www.rsc.org/foodfunction

The potential role of milk-derived peptides in cardiovascular disease Martha Phelan and David Kerins

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

Received 3rd February 2011, Accepted 15th March 2011 DOI: 10.1039/c1fo10017c Bioactive peptides derived from milk proteins are of particular interest to the food industry due to the potential functional and physiological roles that they demonstrate, particularly in relation to cardiovascular disease (CVD). By 2020 it is estimated that heart disease and stroke will become the leading cause of death and disability worldwide. Acute and chronic cardiovascular events may result from alterations in the activity of the renin-angiotensin aldosterone system and activation of the coagulation cascade and of platelets. Medications that inhibit angiotensin converting enzyme (ACE) are widely prescribed in the treatment and prevention of cardiovascular disease. ACE inhibitory peptides are of particular interest due to the presence of encrypted inhibitory peptide sequences. In particular, Ile-ProPro and Val-Pro-Pro are fore runners in ACE inhibition, and have been incorporated into commercial products. Additionally, studies to identify additional novel peptides with similar bio-activity and the ability to withstand digestion during transit through the gastrointestinal tract are ongoing. The potential sources of such peptides in cheese and other dairy products are discussed. Challenges to the bioavailability of such peptides in the gastro intestinal tract are also reviewed. Activation of platelets and the coagulation cascade play a central role in the progression of cardiovascular disease. Platelets from such patients show spontaneous aggregation and an increased sensitivity to agonists which results in vascular damage and endothelial dysfunction associated with CVD. Peptide sequences exhibiting anti-thrombotic activity have been identified from fermented milk products. Studies on such peptides are reviewed and their effects on platelet function are discussed. Finally the ability of food derived peptides to decrease the formation of blood clots (thrombi) is reviewed. In conclusion, due to the widespread nature of cardiovascular disease, the identification of food derived compounds that exhibit a beneficial effect in such widespread areas of CVD regulation will have strong clinical potential. Due to the perception that food derived products have an acceptable risk profile they have the potential for widespread acceptance by the public. In this review, selected biological effects relating to CVD are discussed with a view to providing essential information to researchers. Food for Health Ireland, University College Cork, Western Road, Cork, Ireland

Martha Phelan received a BSc in Nutritional Science in 2006 and an MSc from University College Cork in 2009. She is currently working for Food for Health Ireland determining how milk bioactives can improve cardiovascular health.

Martha Phelan

This journal is ª The Royal Society of Chemistry 2011

David Kerins is a medical graduate of University College Cork. He completed fellowships in Clinical Pharmacology and in Clinical Cardiology at Vanderbilt University, Nashville TN. He was appointed to the faculty of Vanderbilt University Medical Center and staff physician at Nashville Veterans Affairs in 2003. He was subsequently promoted to become an Associate Professor of Medicine and Chief of the Cardiology Section at Nashville VA. He was David Kerins appointed as Associate Professor of Therapeutics at University College Cork and Consultant Physician at Mercy University Hospital in 2006. He served as Dean of the School of Medicine at UCC from 2007–2010. Food Funct., 2011, 2, 153–167 | 153

View Online

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

1. Introduction Bioactive peptides are described as ‘food components that in addition to their nutritional value, exert a physiological effect in the body’.1 During the last decade, research has focused on bioactive or biogenic substances derived from foods with interest in introducing them as functional food ingredients. Bovine milk naturally contains a selection of bioactivities such as lysozyme, lactoferrin, immunoglobulins, growth factors, and hormones, which are secreted in their active form by the mammary gland.2 Additionally, many bioactivities in milk are encrypted within the primary structure of milk proteins, requiring proteolysis for their release from precursors.3,4 Milk proteins consist of 80% casein and 20% whey. The principal casein fractions found in milk are as1-, as2- b- and k-casein (45.0%, 12.0%, 35.0% and 8.0%, respectively).5,6 The major whey proteins are in order of abundance b-lactoglobulin, a-lactalbumin, bovine serum albumin, immunoglobulins and proteose peptones.7,8 The main milk proteins as1-casein and b-casein have the capacity to liberate about 20 000 peptides each.9 Liberation of peptides may occur in a number of ways: (a) during transit through the gastrointestinal tract while the proteins are exposed to the action of digestive enzymes,10 (b) during microbial fermentation when subjected to proteolytic splitting by the proteolytic system of these microorganisms,3,11 or, (c) during proteolysis by enzymes derived from microorganisms or plants.12 In many studies, combinations of (a), (b) and (c) are used for the generation of biofunctional peptides.13 Once liberated and absorbed these bioactive peptides may exert a physiological effect on the various systems of the body – for example the cardiovascular, digestive, endocrine, immune and nervous systems. Examples of milk derived bioactive peptides include caseinophosphopeptides that have a role in the transport and absorption of minerals,14 glycomacropeptides that bind toxins,15 casoxins and casomorphins that act as opioid antagonists and agonists,16,17 isracidin that has immunomodulatory effects18 and casoplatelin which has antithrombotic effects.19–21 Other activities identified include angiotensin converting enzyme (ACE) inhibition, anticarcinogenic,22 and antitumour effects.23 Peptide activity is based on the inherent amino acid composition and sequence which may vary from two to 20 amino acid residues. These peptides may also have multifunctional properties i.e. specific peptide sequences having two or more different physiological activities.3,24,25 These regions have been considered as ‘strategic zones’ that are partially protected from further proteolytic breakdown.26 Therefore, for the above reasons milk-derived bioactive peptides are considered as prominent candidates for various health promoting functional foods. Cardiovascular diseases (CVDs) are a group of disorders of the heart and blood vessels and include: coronary heart-, cerebrovascular-, peripheral arterial-, rheumatic heart-, and congenital heart-disease. Deep vein thrombosis and pulmonary embolism may also be classified as CVDs. The World Health Organisation estimates that by 2020 heart disease and stroke will have surpassed infectious diseases to become the leading cause of death and disability worldwide.27 Hypertension is one controllable risk factor in the development of CVD.28 There are 2 154 | Food Funct., 2011, 2, 153–167

general classes of hypertension. Primary/essential hypertension which accounts for 95% of cases, for which there is no known cause,29 and secondary hypertension30 which results from several disease states including kidney disease.31 Haemostatsis is the process of arresting the escape of blood by either natural or artificial means. It is an integrated and localized interaction that occurs rapidly and involves four components: the blood vessels, the platelets, the coagulation cascade, and the fibrinolytic system. Thrombosis is a pathological condition in which improper activity of the haemostatic mechanism results in clot or thrombus formation in arteries, veins or the chambers of the heart. Platelet attachment, spreading, and aggregation on extracellular matrices are central events in thrombus formation. Additionally, abnormalities in platelet function may account for the pathogenesis and complications of thrombotic events associated with hypertension.32–34 Fibrinolysis, the process by which fibrin clot is digested to release fibrin degradation products may be suppressed due to high plasma concentrations of plasminogenactivator inhibitor type 1 (PAI-1). This in turn is associated with an increased risk for myocardial infarction.35–38 The anti-hypertensive and anti-thrombotic effects of milkderived bioactive peptides are the focus of this review. Much research has been carried out in these areas and there seems to be an indication of ‘cardiovascular continuum’ i.e. cardiovascular risk factors such as hypertension leading to endothelial damage, coronary artery disease and ultimately heart failure and death.39 Intervention at multiple sites along this continuum is necessary to dissipate the morbidity and mortality resulting from cardiovascular disease. Hence, identification of additional compounds, which could interfere in these processes, is desirable, as some of these selected bioactivities have functional food applications. A continued review of the literature focussing on these areas is therefore beneficial.

2. Platelet function in hypertension Hypertension is a significant health problem worldwide.40 It is one of the major controllable risk factors associated with cardiovascular disease events such as myocardial infarction, heart failure and end-stage diabetes.41–46 The control of blood pressure has been associated with many systems such as the renin angiotensin aldosterone system (RAAS). However, the renin angiotensin system (RAS) is not an exclusive regulator of blood pressure as the neutral endopeptidase system, the endothelinconverting enzyme system and the kinin-nitric oxide systems generate additional vaso-regulatory peptides independent of ACE.47–50 These systems generate a variety of regulatory peptides that collectively modulate blood pressure, fluid and electrolyte balance via membrane bound receptors located on different tissues throughout the body.51 Central to RAS is an exopeptidase, angiotensin-converting enzyme I. ACE ([EC 3.4.15.1], peptidyl-dipeptidase A, peptidyl-dipeptidase I, dipeptidyl carboxypeptidase I (DCP1), peptidyldipeptidase I, kininase II, peptidase P, carboxycathepsin) is responsible for the conversion of angiotensin I, a decapeptide generated by the action of renin on the glycoprotein substrate known as angiotensinogen, to the vasoconstrictor octapeptide angiotensin II. In a separate parallel pathway ACE inactivates the vasodilatory peptide bradykinin.52 This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

Platelets are the smallest formed elements in the blood. They have a mean volume of about seven to nine femtolitre, a discoid shape and lack a nucleus. They are produced by fragmentation of megakaryocytes in the bone marrow, and are released into the circulation. Platelets play a crucial role not only in haemostasis but also in the development of CVD.53,54 Under normal conditions, platelets circulate in the bloodstream without adhering to the endothelium of the vessel wall. However, when the endothelium is damaged, platelets adhere to the subendothelium by binding to exposed extracellular matrix proteins. They become activated, undergo shape change, and aggregate and in the process of haemostasis, a haemostatic plug stabilized by fibrin is formed at the site of vessel injury. This process is aided by glycoproteins (GPs) on their plasma membrane that bind specific adhesive proteins to promote platelet-to-surface interactions (adhesion) and platelet-to-platelet interactions (aggregation). Two adhesion receptors, glycoprotein GPIb-IX-V and GPVI, that bind von Willebrand factor (vWF) and collagen, respectively, are primarily responsible for regulating the initial platelet adhesion and activation in flowing blood.55–60 Following adhesion, rapid signal transduction leads to platelet activation, and a sequence of events including cytoskeletal changes associated with shape change, spreading and secretion, and inside-out activation of integrins that support adhesion and aggregation. The major platelet integrin, aIIbb3 (GPIIb/IIIa), binds vWF or fibrinogen to mediate platelet aggregation under conditions of increased shear.55,61 Platelet activation involving GPIb-IX-V or GPVI also leads to secretion of platelet agonists, such as adenosine diphosphate (ADP), which acts via the G protein-coupled receptors (P2Y1 and P2Y12) to reinforce aIIbb3-dependent platelet aggregation.62,63 The activated platelet aggregate or thrombus in turn accelerates the coagulation cascade, leading to stabilization of the clot by fibrin and aIIbb3-dependent contraction. Activated platelets also express surface P-selectin, a counter receptor for platelet GPIb-IX-V and leukocyte PSGL-1. Adhered activated platelets also interact with circulating leukocytes and facilitate platelet-leukocyte-endothelial cell adhesion. This involves receptors that also regulate thrombosis.64 The interaction of inflammatory leukocytes with the vessel wall in atherothrombosis is promoted by platelets, initiating development of atherosclerotic plaque that may eventually lead to thrombotic events.65–67 Although platelet activation and subsequent aggregation and the renin-angiotension systems are two individual pathways they have overlapping effects on each other. Platelets from hypertensive patients have several morphological and functional abnormalities compared to normal individuals. Hypertensive patients have an increased platelet size.68 In addition they have a higher mean platelet volume (MPV)69–71 and mean platelet mass,69,70 and lower mean platelet granularity (MPG)69 compared to controls. An increased MPV may be a marker of platelet activation,72–74 in addition, lower MPG may be consistent with platelet activation.75 High blood pressure promotes vascular damage and endothelial dysfunction, which enhance platelet activation and adhesion. Endothelial dysfunction is associated with reduced generation of antiplatelet agents such as nitric oxide (NO) and prostacyclin, and exaggerated production of endothelin 1 which enhance platelet activation.76 This journal is ª The Royal Society of Chemistry 2011

In response to hypertension, platelets show a number of responses. Spontaneous aggregation77 and increased sensitivity to agonists68 has been identified in platelets from hypertensive individuals. Activated platelets in turn release different mediators, such as 5-hydroxytryptamine (5-HT or serotonin), ADP, adenosine triphosphate (ATP) and lysophosphatidic acid.78 Some of these agents enhance the intracellular Ca2+ concentration ([Ca2+]i) in vascular smooth muscle cells (VSMC). An increase in cytosolic Ca2+ leads to aggregation, clot formation, and secretion of a variety of vasoactive and proaggregating substances, including thromboxane A2, serotonin and platelet derived growth factor (PDGF).79,80,81,90 Furthermore, the number of platelet a-adrenergic receptors increases in hypertensive persons,82 which may promote catecholamine responses. Catecholamines, the b-adrenoceptor agonist isoprenaline and angiotensin II (Ang II) increase [Ca2+]i and promote contraction of VSMC, platelet activation and aggregation82 which may in turn participate in the genesis and maintenance of hypertension. Angiotensin II has also been shown to increase [Ca2+]i and pH in platelets from hypertensive patients, which may be associated with enhanced platelet aggregation.83 Activated platelets release different growth factors e.g. PDGF and vascular derived growth factor (VEGF) that participate in the development of atherosclerosis by promoting VSMC proliferation.78 Furthermore, platelets from hypertensive individuals release more b-thromboglobulin84 and P-selectin.85 Hypertension is also associated with oxidative stress and reduced antioxidant status.86 Platelets from hypertensive patients, produce more reactive oxygen species (ROS) which enhance platelet activity by reducing the bioavailability of NO, increasing tyrosine phosphorylation, activation of platelet membrane GPIIb/IIIa, and enhancing [Ca2+]i among others cellular effects.87–89 Platelet endothelial NO synthase (eNOS) activity is also reduced90 in patients with hypertension, which reduces NO synthesis. NO is an important vasodilator91 and inhibitor of platelet aggregation,92 secretion,93 adhesion,94 and fibrinogen binding to the platelet GPIIb/IIIa receptor.95,96 Furthermore, NO interferes with Ca2+ mobilization in platelets by reducing both Ca2+ influx across the plasma membrane and Ca2+ release from internal stores.97 Angiotensin II stimulates eNOS and NO release which by a negative feed-back inhibits ACE and decrease the number of Angiotensin II type 1 receptors (AT1).98 Moreover, eNOS can reside in an uncoupled form and produce superoxide (O2
) which account for further NO degradation and enhance platelet activation. Thus, as described different platelet signalling pathways are altered in hypertension and platelets might play a role in hypertension-

Table 1 Products enriched with ACE-inhibitory peptides.51,120–1221 Trade mark

Company

Peptide sequence

Ameal S Biozate Calpis Casine DP C12 peptide Danaten Evolus

Calpis Co, Japan Davisco, USA Calpis Co, Japan Kanebo Ltd., Japan DMV International, Holland Danone, France Valio, Finland

VPPIPP ND VPPIPP FFVAPFEVFGK FFVAPFEVFGK ND VPPIPP

1

ND: not described.

Food Funct., 2011, 2, 153–167 | 155

View Online

associated angiogenesis. By understanding specific molecular mechanisms underlying platelet activation in hypertension, new targets may be identified for interventions to prevent and/or treat hypertension complications associated with platelet hyperactivity.

3. ACE inhibition

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

3.1.

General introduction

Many potent synthetic ACE inhibitors such as captopril, enalapril, lisinopril, and ramipril have been widely used in the clinical treatment of hypertension and heart failure. However, ACE inhibitors can have side effects including hypotension, increased potassium levels, reduced renal function, cough, taste disturbances and skin rashes.99–102 Therefore, interest has increased in identifying foods as natural sources of ACE inhibitors. It has been shown that certain foods reduce or prevent the risk of certain diseases,103,104 one such food is milk. Milk contains natural compounds such as calcium and potassium which have been shown to have a beneficial effect on blood pressure.104 Additionally, it is well recognized that apart from their basic nutritional role many milk proteins contain encrypted peptide sequences within their primary structures capable of modulating specific physiological functions.105 In fact, there are numerous products on the market or under development containing bioactive peptides from milk which have ACE Inhibitor activity (Table 1). Many ACE inhibitory peptides have been isolated from various dairy proteins,106,107 cheese whey,108–110 and fermented milk products.111–113 In addition, many ACE inhibitory peptides have been discovered from enzymatic hydrolysates of casein,12,114–117 and whey protein.109,118 These ACE inhibitors have moderate inhibitory potencies, usually within an IC50 range of 100–500 mmol L
1; however, there are exceptions such as the casokinins as1-casein f(23–27) and b-casein f(177–183) with IC50 values less than 20 mmol L
1.119

3.2.

Renin-angiotensin and Kallikenin-kinin system

The renin angiotensin system (RAS) is a regulator of blood pressure (Fig. 1). The RAS begins with an inactive precursor angiotensinogen. Renin liberates angiotensin-I from angiotensinogen. Angiotensin-I-converting enzyme (ACE) a zinc metallopeptidase exopeptidase removes the C-terminal tripeptide HisLeu from angiotensin I resulting in the formation of angiotensin II. Angiotensin II is a vasoconstrictor, which increases peripheral vascular resistance. In addition, it is involved in the release of sodium retaining steroid, aldosterone which has a role in increasing blood pressure through increased Na+ and water retention. A combination of increased peripheral vascular resistance, Na+, and water retention result in increased blood pressure.123 ACE is a multifunctional enzyme and is also involved in the Kallikrein-kinin system. In the Kallikrein-kinin system, bradykinin is formed through an intermediatory kallidin by the action of kallikrein from kininogen.124 In the Kallikrein-kinin system ACE removes the C-terminal dipeptide from the vasodilator nonapeptide bradykinin resulting in the formation of inactive fragments.125 Bradykinin controls blood pressure by increasing prostaglandin and nitric oxide (NO) synthesis, which results in vasodilation, decreased peripheral vascular resistance and hence a decrease in blood pressure.126 At present targets against the renin-angiotensin system are direct renin inhibitors, ACE inhibitors, angiotensin II receptor blockers (ARB) and aldosterone antagonists (for review see ref. 127). Direct renin inhibitors such as Aliskiren target the RAS by decreasing plasma renin activity and inhibiting the conversion of angiotensinogen to angiotensin I. ACE inhibitors target ACE and inhibit angiotensin II formation, examples include captopril and enalapril. Angiotensin II receptor blockers including losartan and candesartan, block the action of angiotensin II hence preventing angiotensin II from binding to angiotensin II receptors on blood vessels. As a result, blood vessels dilate and blood pressure is reduced. Aldosterone antagonists such as spironolactone

Fig. 1 Renin-angiotensin and Kallikenin-kinin system. ACE: angiotensin converting enzyme, ARB: angiotensin II receptor blockers, ACE I: angiotensin converting enzyme I, NO: nitric oxide.

156 | Food Funct., 2011, 2, 153–167

This journal is ª The Royal Society of Chemistry 2011

View Online

act through competitive binding of receptors at the aldosteronedependent sodium-potassium exchange site in the distal convoluted renal tubule. Spironolactone causes increased amounts of sodium and water to be excreted, while potassium is retained. In the kallikrein-kinin system ACE inhibitors are one current target for control. ACE inhibitors increase bradykinin by inhibiting its degradation to inactive fragments, hence through the action of prostaglandin and NO there is a decrease in blood pressure.128

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

3.3.

Structure of ACE

There are two isoforms of human ACE, somatic (sACE) and germinal/testicular (gACE) forms,129 encoded by a single gene located on chromosome 17 at q23. Human sACE is a type-I membrane bound protein that consists of many domains, a 28residue C-terminal cytosolic domain, a 22-residue hydrophobic transmembrane domain and a 1227-residue extracellular domain that is heavily glycosylated and further divided into a 612residue N-terminal domain, linked by a 15-residue sequence to a 600-residue C-terminal domain.130 The extracellular C-terminal domain and N-terminal domain contain a HEXXH sequence, which serves as the zinc binding ligand.130 In sACE, the C-terminal domain is primarily involved in blood pressure regulation, while the N-terminal domain is involved in the control of hematopoietic stem cell differentiation and proliferation.131–133 Human gACE corresponds to the C-terminal domain of sACE.130,134 ACE inhibitors are thought to be competitive substrates for ACE. ACE-inhibitory peptides usually contain 2–12 amino acids, although active peptides with up to 27 amino acids have been identified.12,135 While the structure activity relationship for food derived ACE inhibitors has not been fully established many things are known. ACE is responsible for the conversion of angiotensin I to the vasoconstrictor octapeptide angiotensin II. The C-domain catalytic site of the somatic form of ACE consists of three subsites, S0 , S10 and S20 . These accommodate the three hydrophobic C-terminal residues of the substrate angiotensin I, i.e., Phe-His-Leu.52,136 Accordingly, the C-terminal of the inhibitory peptides is very important for binding to the ACE enzyme and for their inhibitory activity as ACE cleaves dipeptides from the C-terminal of the substrate peptides.120,123 Evidence has shown that peptides with hydrophobic residues at each of the three C-terminal positions have the highest inhibitory activity120,123 with Tryptophan (Trp), Tyrosine (Tyr), Phenalanine (Phe) and especially Proline (Pro) being most effective at the ultimate C-terminal of ACE-inhibitory peptides.114,137 Otte et al.138 showed that two peptides with the highest ACEInhibitory activity in the thermolytic b-casein hydrolysate had the same C terminal sequence as one of the two well-known antihypertensive peptides, Valine-Proline-Proline (Val-Pro-Pro) and Isoleucine-Proline-Proline (Ile-Pro-Pro).139–142 The Ile-ProPro sequence identified contains three C-terminal hydrophobic amino acid residues, in addition to a proline residue at the ultimate C-terminal, explaining their high ACE-inhibitory activity. A proline residue at the penultimate position is very unfavourable137 whereas it has been found to be present at the antepenultimate position in several inhibitors.143–145 Additonally, Otte et al.138 identified a peptide with a lower ACE-inhibitory This journal is ª The Royal Society of Chemistry 2011

activity f(59–81), and having the C-terminal sequence Glutamine-Threonine-Proline (Glu-Thr-Pro). The hydrophobic nature of these residues and the ultimate position of Pro probably results in good binding to ACE and explains the inhibitory activity of this peptide. Peptides with an aromatic residue at C-terminal position are better inhibitors of ACE than those with a basic one.137 Nevertheless, numerous peptides resulting from specific tryptic activity have been identified and total chymotryptic hydrolysates do not appear to be more active than tryptic ones.146 ACE inhibitor interactions may involve more than the three C-terminal residues. Residues from the N-terminal side of the cleaved bond could interact with critical subsites of ACE.147 N-terminal extension can increase the inhibition potency as shown by Kohmura et al.148 who found that IC50 values decreased upon addition of amino acids to the N terminus (IC50 values: Ile-Tyr-Pro (61 mmol), Leu-Ile-Tyr-Pro (10 mmol), ProLeu-Ile-Tyr-Pro (4.4 mmol), Leu-ProLeu-Pro (720 mmol), HisLeu-Pro-Leu-Pro (41 mmol) and Leu-His-Leu-Pro-Leu-Pro (2.9 mmol)). The ACE inhibitory mechanism is quite complex and relates to the assortment of the inhibitors and the absence of known amino acid sequence recognised by ACE. Peptide conformation is also important when determining activity. The superiority of proline as the C-terminal residue is probably due to a rigid ring structure of this amino acid. It may lock the carboxyl group into a conformation favourable for interaction with the positively charged residue at the active site of the enzyme.149 Research has shown that peptides containing the trans-Pro conformer were better substrates for ACE than those carrying cis-Pro.150,151 G
omez-Ruiz et al.152 showed that the trans-Pro conformer found in the b-casein f(47–51) peptide DKIHP had higher ACE inhibitor activity compared to the cisPro form. The reason for this difference in activity is due to inhibitor structure and interaction with the active site. The change of trans-Pro to its cis-Pro results in the displacement of the CO group of the inhibitor, to the opposite side of the peptide chain, losing its original H-bonding with the enzyme. This leads to the loss of interactions with the active site and in turn to a decrease in binding to the enzyme and inhibitory activity.152 Additionally, Otte et al.138 demonstrated that all of the ACEinhibitory peptides identified from the a-Lactoalbumin (a-la) contained the same sequence at the C-terminal (Proline-Glutamic Acid-Tryptophan; Pro-Glu-Trp). Glutamic acid is a negatively charged amino acid and its presence at the C-terminal would be expected to weaken the binding and thus lower the inhibitory potential of these peptides.123 The combination of two hydrophobic and one negatively charged residues in the peptides from a-La would cause an incorrect orientation of the peptides into the active site with respect to the bond to be cleaved. Since the subsite S10 , normally accommodating the penultimate amino acid residue, is a large subsite containing a glutamic acid and an aspartic acid residue153 it is unlikely that it can accommodate the glutamic acid residue in the a-La derived peptides. A wrong fit into the subsites of the active site of ACE and thus lack of cleavage combined with a high binding affinity could explain the high inhibitory activity of these peptides. Perhaps the C-terminal tryptophan in the peptides from a-La would be oriented into the S10 subsite and proline into the S20 subsite, which is a small hydrophobic subsite with tyrosine and two phenylanaine Food Funct., 2011, 2, 153–167 | 157

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

residues at the bottom.153 This would leave glutamic acid out of the subsites, and probably bound to the Zn2+ atom which is essential for the catalytic action. This arrangement is similar to that seen for the ACE inhibitory drug lisinopril.136,153 In summary, aliphatic (Valine, Isoleucine, Alanine), basic (Arginine) and aromatic residues (Tyrosine, Phenylalanine) are preferred in the penultimate positions, while tyrosine, phenylalanine and tryptophan, proline and aliphatic residues (Isoleucine, Alanine, Leucine and Methionine) are preferred in ultimate positions. The positive charge of Arganine at the C terminus has also been shown to contribute to the ACE-Inhibitory potential of several peptides.144,154,155 Also, a C-terminal Lysine with a positive charge on the Guanidino or 3-amino group contributes substantially to the ACE-inhibitory potential.119,137

3.4.

Source of ACE-inhibitory peptide

Food products containing antihypertensive peptides are highly relevant in the treatment of mild and moderate hypertension since the risk of developing cardiovascular diseases is directly proportional to the level of the blood pressure. When blood pressure is reduced by 5 mmHg the risk is reduced by 16%.51 ACE-inhibitory peptides have been isolated from many fermented milks and dairy commercial products, through the action of lactic acid bacteria (LAB) or their proteinases.12,51,112,113,142,156–162 Strain selection is one of the main factors that influences their release in fermented foods163,164 Among LAB, Lactobacillus helveticus has been shown to exhibit strong proteolytic activity in milk-based media. The proteolytic systems of Lb. helveticus are composed of a cell-envelope proteinase and more than 10 intracellular peptidases.165,166 The cell-envelope proteinase is a key enzyme in the proteolytic system. It catalyzes the initial steps in the degradation of protein into different oligopeptides.167 Intracellular peptideases including endopeptidases, aminopeptidases and X-prolyldipeptidyl aminopeptidase, may then act to form short chain peptides and amino acids.168 Proteinases of lactic acid bacteria may hydrolyze more than 40% of the peptide bonds of as1- and b-caseins, producing oligopeptides of 4 to 40 amino acid residues.169 Two of the most well known ACE inhibitory peptides Val-ProPro and Ile-Pro-Pro were derived from casein in milk fermented with a starter containing Lb. helveticus142 and Saccharomyces cerevisiae.161 Takano,170 reported that these peptides contribute to most of the inhibitory activity in Calpis sour milk. Minervini et al.161 identified additional peptide fractions in bovine milk hydrolysed by Lb. helveticus PR4 with ACE inhibitory activity. These included peptide fractions as1-casein f(24–47), as1-casein f (169–193) and b-casein f(58–76). Additionally, other LAB including Lactocbacillus delbrueckii subsp. bulgaricus SS1, Lactococcus lactis subsp. cremoris FT4, Lactocbacillus acidophilus, Lactobacillus animalis, Lactobacillus casei, bifidobacteria, Lactobacillus jensenii, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus lactic ssp. lactis, Lactococcus raffinolactis, Streptococcus thermophilus, Leuconostoc mesenteroides ssp. cremoris and Enterococcus faecalis,111,161,168,171–176 have been shown to produce ACE-Inhibitory peptides. LAB have been shown to produce ACE-Inhibitory peptides in other milks such as buffalo (b-casein; f58–66), ovine (as1-casein; f1–6, 158 | Food Funct., 2011, 2, 153–167

as2-casein; f182–185, f186–188), and caprine (b-casein f58–65 and as2-casein f182–187).161 ACE inhibitors have also been reported in several cheeses including Cheddar,177 Parmigiano-Reggiano178 and Gouda,111,179 Italico and Gorgonzola180 and ripened or cooked cheeses such as Comt
e.111,181 Many factors determine their presence however. The appearance and subsequent disappearance of ACE-inhibitory peptides is influenced by the degree of proteolysis and ripening. Anti-hypertensive peptides from as-casein found in 6-month-old Parmigiano-Reggiano cheese disappeared following 15 months of ripening.182 Additionally, peptides with ACE-inhibitory activity found in ‘‘Festivo’’ a low-fat cheese after maturation for 13 weeks, decreased when proteolysis exceeded a certain level during storage for 20 weeks.183 Nonetheless, the presence of ACE-inhibitory peptides in several ripened cheeses was reported, with the most potent inhibitory activities detected in short to medium-ripened cheeses such as Gouda.184 Generally, ACE inhibitory peptides identified in cheese correspond to ACE-inhibitory peptide fractions from as-casein and b-casein. Numerous peptides have been identified to date. ACE-inhibitory peptides FFVAPFPEVFGK and FFVAP, which correspond to as1-casein f(23–34), and as1-casein f(23–27) respectively,143 were identified in Crescenza cheese.175 DKIHP a fragment from b-casein was identified in Manchego cheese.185 The antihypertensive peptides b-lactoglobulin f(147–148), lactoferrin f(288–289) and lactoferrin f(319–320) were isolated from mature and vintage Cheddar and Feta cheese, respectively.186 Moreover, ACE inhibitors with the amino acid sequences LTLTDVE corresponding to b-casein f(125–131), YPQRDMPIQ corresponding to b-casein f(180–197), PGPIP corresponding to b-casein f(63–67) and PKHKEMPFPPKYPVEPFT corresponding to b-casein f(104–120)187 were found in enzyme-modified cheese obtained by hydrolysis of pasteurized cheese homogenized with Neutrase and an enzyme preparation from Lactobacillus casei. Two novel ACE-inhibiting peptides PPEIN (k-casein; f156–160) and PLPLL (b-casein; f136–140), were identified in Yak (Bos grunniens) a milk casein derived from Qula, a kind of acid curd cheese after hydrolyses with alcalase.188 Bioactive peptides can be generated not only during the manufacture of cheese, yogurt186 and other dairy products, but also by in vitro hydrolysis of milk proteins using enzymes. Enzymes have been sourced from animals, plants, and microbes including cell-wall proteases from LAB.51,108,116,120,138,189,190 These enzymes include pepsin, trypsin, chymotrypsin, alcalase, proteinase K, actinase E and thermolysin.108,115,147,188,191–193 Examples of such bioactives are the dodecapeptide (C12; as1-casein f23–34) enriched hydrolysate produced by tryptic hydrolysis of casein, and Biozate, a whey protein hydrolysate, for which the enzyme used was not reported.51,120 Additionally, lactokinin (ALPMHIR) derived from a tryptic digest of the whey protein b-lacotglobulin has an ACE-inhibitory activity 100 times lower than captopril.194 Otte et al.138 found that thermolysin was a good enzyme for the release of ACE-inhibitory peptides from both caseins and whey proteins. In the study five bacterial and digestive enzymes were used for the hydrolysis of nine milk protein preparations. The hydrolysate made from purified a-lactalbumin by the action of thermolysin had the highest in vitro ACE inhibitory activity. This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

In the in vitro hydrolysis approach challenges arise however and it is important to choose protein and enzyme combinations that give rise to a high yield of the bioactive peptides, and perhaps to enrich for these. Abubakar et al.108 observed that whey protein hydrolysed by thermolysin and proteinase K resulted in products with higher ACE inhibitory activity compared to actinase K. Da Costa et al.195 and Mullally et al.146 showed that a-chymotrypsin, which preferentially cleaves the C-terminal phenylalanine, tyrosine and tryptophan residues,196 produced hydrolysates with the highest ACE inhibitory activity, followed by Alcalase, which shows low specificity but preferentially cleaves C-terminal hydrophobic residues. In view of the specificity of these enzymes, it is evident that the structural changes in proteins caused by different treatments, aggregate formation by hydrophobic interactions, or the presence of a compact structure with hidden hydrophobic sites, have great impact on their activity. Da Costa et al.195 also showed that hydrolysates obtained with Proteomix had the lowest activity which may be due to the combined action of the main enzymes present, trypsin and a-chymotrypsin, which possibly fail to release peptides with an appropriate structure for inhibiting ACE. When considering ACE inhibitory activity in vitro it is important to consider whether this effect is also seen in vivo. In vitro studies have identified potent milk-derived ACE inhibitory peptides whose activity is not seen once they are tested in vivo.108,111 Abubakar et al.108 reported strong in vitro ACE inhibitory activity and in vivo antihypertensive activity for five short peptides less than six residues in length but no antihypertensive activity in rats by an undecapeptide ACE inhibitor (b-casein; f80–90). The authors concluded that the undecapeptide was probably degraded by digestive enzymes while the short peptides were more resistant to enzyme attack. Additionally, Saito et al.111 showed that two nonapeptides (as1-casein; f1–9 and b-casein; f60–68) failed to show any antihypertensive activity following oral ingestion, although they had potent ACE inhibitory activity. Contrarily, Maeno et al.116 reported that the heptapeptide (b-casein; f169–175; KVLPVQ), which had low in vitro ACE inhibitory activity (1000 mmol L
1) had strong antihypertensive activity in rats. It was found that this peptide is hydrolysed by in vitro digestion with pancreatin and carboxypeptidase A. The hydrolysis treatment led to the release of the C terminal glutamine residue from the heptapeptide producing a hexapeptide with stronger antihypertensive and ACE inhibitory activities (5 mmol L
1). In this specific case, gastrointestinal digestion was beneficial for the release of more potent molecules. Two b-casein peptide fragments of previously identified ACE-inhibitory peptide LLYQQPVLGPVRGPFPIIV,160 have been reported in two Spanish commercially available fermented milks following simulated gastrointestinal digestion.10 Oligopeptide sequences containing encrypted bioactive peptides may also be activated and the potency of these oligopeptides increased, due to in vivo proteinase and peptidase activities. These results suggest that some bioactive peptides may need protection against gastric or intestinal degradation to exert their physiological effects in vivo. Some work on the specificity of enzymes has been carried out to date. The ACE-inhibitory peptide ALPMHIR derived from tryptic digest of whey protein This journal is ª The Royal Society of Chemistry 2011

b-lactoglobulin, is fairly resistant to hydrolysis by pepsin and chymotrypsin.146 Pepsin preferentially cleaves at Phe, Tyr and Leu at C- and N-terminal position of the cleaved bond.197 Roufik et al.198 studied the in vitro digestibility of three bioactive peptides from b-lactoglobulin (b-Lg) containing theoretical cleavage sites for pepsin and chymotrypsin. When incubated with pepsin, b-Lg f(142–148) remained intact whereas b-Lg f(15–20) and f(102–105) were weakly hydrolysed. b-Lg f(9–20), b-Lg f(92–105) and b-Lg f(139–148) contain, respectively, four, eight, and two theoretical cleavage sites for pepsin. The high resistance to pepsin attack of bioactive peptides in this case could be due to their short chains (4–7 amino acid residues). Additionally, pepsin is an endoprotease and the hydrolysis of scissile bonds in short peptides adjacent to N- or C-terminal residues would probably be hindered in part due to the ionized state of the end amino acid groups. In relation to chymotrypsin, only b-Lg f(142–148) was strongly hydrolysed. The degree of hydrolysis was found to be influenced by both the length of the peptide chain and the nature of the peptide. Furthermore, higher degrees of hydrolysis of a b-Lg f(102–105)/f(92–105) mixture were obtained with both enzymes than with each peptide treated separately. In summary, these studies support the view that in vivo analysis is essential to validate the physiological effects of bioactive peptides. In addition, the theoretical specificity of proteases and in vitro digestion experiments cannot be used to safely predict the fate of bioactive peptides during the gastrointestinal process, since the degree of hydrolysis can vary depending on the peptide chain length, the nature of the peptide, and the presence of other peptides in the medium. Short chain peptides may be preserved during the gastrointestinal process whereas long-chain bioactive peptides require protection from gastrointestinal enzymes when orally administered in order to exert their physiological effects in the organism. 3.5.

Preparation of peptides

When developed as food ingredients, the processing of these antihypertensive peptides is vital to their activity. In order to obtain peptides with high activity a number of factors need to be considered. Maximum biological activity and a limitation to the development of bitter flavour may be obtained by appropriate selection of enzymes for proteolysis. Trypsin may be used to improve protein digestibility and to decrease protein allergenicity.146 Consideration of appropriate hydrolysis time is important114,188 as is the use of high pressure and filter sizes. Knudsen et al.199 showed that the use of high pressure to partially unfold whey proteins, before or during proteolysis, might increase the rate of proteolysis and alter the relative proportion of peptides formed. In addition, since the size of most ACEinhibitory peptides is less than 3 kilodaltons (kDa), ultrafiltration with a cut-off of 3 or 5 kDa may be essential.51,114 With a membrane of 1 kDa, some of the active peptides may be lost.191 Heat treatments will have negative effects on the bioavailability of whey peptides, so carefully monitoring during production is important. Moreover, it has been shown that adequate combination of heat treatment, protein source and type of enzyme is of great importance when obtaining high activity hydrolysates. Heat treatments and mechanical damage can drastically reduce the biological activity of food proteins,200 as Food Funct., 2011, 2, 153–167 | 159

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

they may alter the profile of peptides released during gastrointestinal digestion, since enzymes could hydrolyze parts of the protein that were previously inaccessible to enzymatic action.201 Da Costa et al.195 found that the best ACE inhibitors were obtained from isolates previously treated at 65  C, compared to isolates previously treated at 95  C. This difference in activity can be explained by the structural changes induced in the WPI by different heat treatments. Heating at 65  C possibly induces a partially unfolded conformation in whey proteins, known as molten globule state, characterized by exposition of hydrophobic clusters.202 This temperature allows greater access of the enzymes to certain sites previously inaccessible to enzyme action, resulting in peptides different from untreated control, which has a more compact structure that may have hindered enzyme access to the same sites.195 This fact may have special impact on the action of enzymes such as a-chymotrypsin and Alcalase that preferentially cleave peptide bonds involving hydrophobic amino acids. Additionally, when the temperature of the heat treatment exceeds 90  C, the formation of aggregates occurs, mainly due to hydrophobic interaction, resulting in insoluble aggregates of high molecular mass.203 Strain selection is also an important factor to consider. Pihlanto et al.171 found that generally Lactococcus lactis strains did not produce ACE inhibition, whereas almost all of the Lactobacillus strains tested did. Additionally, it is accepted that strong proteolytic activity is required to produce ACE inhibitory and antihypertensive peptides. However, studies have shown that commercial starter strains, with low proteolytic activity, cannot generate ACE inhibitory peptides, although fermented products manufactured using theses strain can act as precursors of active peptides prior to digestion with gastrointestinal enzyme.10,115 As previously mentioned another critical factor in bioactive peptide production is the adequate match of the enzyme and protein sources. In silico calculations using dedicated software may be of value in the initial selection of protein substrate and enzyme combinations.154,204 In order to use protein hydrolysates as a functional ingredient, it is not sufficient for them to have a high ACE inhibitory potential; they must also show an in vivo hypotensive effect. Da Costa et al.195 showed that the whey protein hydrolysate displaying the highest ACE-inhibitory activity, did not reduce arterial blood pressure when orally administered to spontaneous hypertensive rats, whereas hydrolysates showing lower activity, were the only ones to induce a significant arterial blood pressure reduction in the animals. Studies have shown that there are disagreements between peptide bioactivity as determined in vitro and in vivo since ACE inhibitory peptides may not show hypotensive effect or vice versa.205–207 Even when a high ACE inhibitory activity is present, blood pressure reduction may not occur, either because the peptide or hydrolysate active fraction is not absorbed intact, or because it does not reach the target site or organ. Alterations in the activity of these peptides are attributed to gastric and pancreatic enzymes and brush border peptidases. To perform their biological activity, the peptides need to be absorbed efficiently and be resistant to degradation by serum peptidases in order to reach the target organ.51 Several strategies for increasing the bioavailability of ACE-inhibitory peptides have been described.11,154 ACE-inhibitory peptides can be chemically modified to increase their stability by using 160 | Food Funct., 2011, 2, 153–167

techniques such as lipidization, glycosilation, cationization, microencapsulation, or nutrient transport which results in greater permeability, absorption or stability of the peptides.208,209 These strategies have many disadvantages however such as a reduction of membrane permeability, receptor union decline in receptor affinity, greater joining of plasmatic proteins, or more rapid elimination. In addition, genetic engineering techniques allow the synthesis of specific ACE-inhibitory peptides, or the microbial production and delivery of bioactive peptides in situ via the enteric microflora as an alternative approach for delivery of bioactive peptides.11 The use of bioinformatics could hasten the screening for highpotential sources of ACE inhibitory peptides. Databases containing bioactive peptides can be compared to amino acid sequences of proteins of interest.204 Furthermore, it is possible to predict the theoretical release of bioactive peptides using in silico digestion processes. Finally, it is important to study the functional properties of hydrolysates. Peptides produced with different proteolytic enzymes can increase solubility and change gelling properties. Some enzymes can induce gelation following whey protein hydrolysis, whereas others impair gelling properties.210–212 Ferreira et al.213 found that gelation times and the strength of the final gels was highly dependent on the degree of hydrolysis. Smaller peptides liberated by hydrolysis contributed to the inability of whey protein hydrolysates to gel. Therefore, modulation of the gelling properties of whey proteins by enzymatic hydrolysis allows the incorporation of these ingredients, with ACE inhibitory peptides in liquid and semi solid foods with high protein content. Gels confer structure, texture and stability to food products; they also allow the retention of large quantities of water and other small molecules inside the food matrix. 3.6.

Conclusion

Antihypertensive drugs play an important role in blood pressure regulation, however, for many patients targeted blood pressure is not achieved due to reasons such as insufficient medication, true drug resistance and non compliance.127 Therefore there is a market for alternative solutions to the problem. Naturally occurring ACE inhibitory peptides derived from food proteins have been proven to be effective as in vivo antihypertensive agents.214 Although these peptides have been found to be less active than the synthetic ACE inhibitors; they might play an important role as antihypertensive agents as they can be part of the daily diet in the form of functional foods and are perceived as natural and safe by the consumer.215 Many factors need to be considered in the preparation of ACE inhibitory peptides however principles of the techniques are characterised but may need to be fine tuned.

4. Anti-thrombotic effects 4.1.

General introduction

Bi-functional casein peptides have been reported to influence the cardiovascular system due to anti-thrombotic,216 anti-hypertensive,217,218 and anti-obesity effects.219,220 Thrombosis is a pathological condition in which improper activity of the haemostatic mechanism results in clot or thrombus formation in This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

arteries, veins or the chambers of the heart. There are three types of thrombi: the white thrombus, seen in arteries which consist mainly of platelets; the red thrombus, which is composed mainly of fibrin and red cells; and the mixed thrombus, which consists of both platelets and fibrin. Thrombus composition is influenced by the velocity of blood flow at the site of formation. White platelet-rich thrombi are found in high flow systems. The high shear rate in arteries prevents the accumulation of coagulation intermediates, however platelets have the capacity to form thrombi to the area of damage via vWF.221,222 Arterial thrombosis is seen predominantly as myocardial infarction, cerebrovascular arterial thrombosis (both caused by thrombosis in an artery), peripheral arterial thrombosis and ischaemic stroke and is also associated with existing vessel wall disease, i.e., atherosclerosis. Red thrombi form in regions of stasis. On the venous side of circulation, thrombin can accumulate due to the slower flow rate and platelets play only a minor role. The most common forms of venous thrombosis are deep vein thrombosis of the leg and pulmonary embolism, with stasis and abnormalities in blood plasma (hypercoagulability) being the main causes.221 Platelet attachment, spreading, and aggregation on extracellular matrices are central events in thrombus formation. These events can be regulated by a family of platelet adhesive glycoproteins such as fibronectin, vWF and fibrinogen. Fibronectin supports platelet attachment and spreading reactions,223–225 while vWF is important in platelet attachment to and spreading on subendothelial matrices.225–227 Fibrinogen has a bi-functional role, it participates in both platelet aggregation and in fibrin formation.228–230 In platelet aggregation, two binding sites have been identified on the fibrinogen molecule: the C-terminal sequence of the fibrinogen g-chain HHLGGAKQAGDV, f(400– 411) and one (or two) tetrapeptdie sequence(s) (RGDS/F, f(572– 575) or f(95–98)) of fibrinogen a-chain.231 RGDF and the g f(400–411) sequence are both accessible within the fibrinogen molecule and are both implicated in ligand binding and cell-cell interaction.232 These peptides inhibit platelet aggregation and fibrinogen binding to ADP activated platelets.232 Upon platelet activation, the integrin aIIbb3 on the platelet surface interacts with fibrinogen and induces aggregation, a primary event in thrombus formation. Inhibition of platelet aggregation is therefore an essential requirement for effective antithrombotic therapy and vascular reocclusion prevention. A new and promising way of obtaining inhibition of platelet aggregation is hence, to impair the binding of fibrinogen to platelet membrane aIIbb3 which forms the main molecular link between platelets in the aggregate. There are several similarities between human and bovine fibrinogen, which supports the case for identifying natural agents from milk in the treatment of thrombsis. Functional and sequential homologies have been identified between the human fibrinogen g-chain and bovine k-casein or its glycomacropeptide. In fact Jolles et al.233 hypothesized that fibrinogen g-chain and k-casein may have evolved from a common ancestor during the past 450 million years. There are structural and functional similarities between the fibrinogen g-chain C-terminal dodecapeptide f(400–411; 400HHLGGAKQAGDV411), which is involved in binding to platelet receptors, and various peptides from the f (106–116;106MAIPPKKNQ-DK116) region of bovine k-casein, This journal is ª The Royal Society of Chemistry 2011

which are termed casoplatelins.234 Similarities also exist between the fibrinogen a-chain tetrapeptide (RGDX) and human lactoferrin, KRDS (f39–42). Both have a high probability of initiating a b-turn and are highly hydrophobic. The fibrinogen cleavage actions of the blood clotting enzyme thrombin and the k-casein cleavage actions of the milk clotting enzyme chymosin also bear some similarities.26,233 Both the blood and milk clotting processes involve limited proteolysis.234 Thrombin cleaves two R–G bonds to produce fibrin and fibrinopeptides,235 whereas chymosin cleaves a single unique F-M bond to form an insoluble part, para-k-casein (N-terminal moiety of k-casein), and a soluble fraction, the k caseinoglycopeptide (CGP), also called k-casein glycomacropeptide (GMP).236,237 The latter is a hydrophilic glycopeptide of the C-terminal part of cow k-casein f(106–169). It plays a major role in the stabilisation of casein micelles.238 Additionally, short soluble peptides (fibrinopeptides and caseinoglycopeptides) are released during both blood and milk coagulation processes. Although both of the released peptides are highly variable in sequence they maintain a net negative charge, and neither contains cysteine or tryptophan residues. The 1-amino groups of lysine appear to be involved in the polymerisation of both fibrin and casein, and calcium is important in both processes, accelerating the second phase of milk clotting and the aggregation of fibrin monomers. Prosthetic sugar groups do not play an important role in the clotting processes, however they retard the rate of chymosin or thrombin action.239 4.2.

Peptides shown to affect platelet aggregation

Peptides from various sources have been shown to have an effect on platelet aggregation.240 Several peptides derived from k-casein and lactoferrin have been shown to be inhibitors of platelet aggregation and to display anti-thrombotic activity.241,242 The inhibitory effect of human lactoferrin on platelet aggregation was found to be 5 nmol.243 This concentration is not far from the physiological level in blood (1–3 nmol). It is thought that milk protein-derived anti-thrombotic peptides are absorbed into the bloodstream, as two peptides from human and bovine k-caseinoglycopeptide respectively, have been identified in the plasma of five-day-old newborns following ingestion of a cow milk-based formula.216 Peptides exhibiting anti-thrombotic activity have been observed in natural food such as in fermented milk products such as yoghurt (k-casein; f113–116), and water soluble extract of two commercially available Spanish fermented milk drinks (k-casein; f109–111, PPK).10,186 Hence, a milk diet or nutritional supplement could have important antithrombotic properties. Whole k-casein has been shown to inhibit thrombin-induced platelet aggregation and thrombin-induced secretion of serotonin in vitro.244 In contrast para-k-casein was shown to be inactive in all assay systems. Caseinoglycopeptide from bovine, caprine and ovine sources have been shown to inhibit platelet aggregation and hence thrombus formation.233,240,241,245 In fact, the enzymatic hydrolysate of sheep CGP with trypsin and chymotrypsin, was shown to be a better inhibitor of platelet aggregation induced by thrombin and collagen than the entire CGP, suggesting that the liberation of peptides may enhance the effect of inhibition.240 They found that the C-terminal part Food Funct., 2011, 2, 153–167 | 161

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

f(106–171) of sheep k-casein, inhibited thrombin- and collageninduced platelet aggregation in a dose-dependent manner. In 1991, Vu et al.246 cloned and directly expressed a functional human thrombin receptor. Thrombin binds to this receptor and proteolytically generates a neoaminoterminus by cleaving the receptor after the amino acid residue Arg-41. The newly generated N-terminal segment activates the receptor. This sequence SFFLRN, the tethered ligand, is followed by the YEPFWEDEEKNES region interacting with thrombin’s anion-binding exosite. This proposed model by Vu et al.246 predicts that a peptide mimicking this receptor region would bind thrombin and inhibit its function. Sheep CGP and its three inhibitor thrombin-induced platelet aggregation peptides are highly acidic and perhaps mimick this thrombin receptor region. Additionally, L
eonil and Moll
e,242 showed that the pentapeptide f(112–116) strongly inhibited ADP induced platelet aggregation, while the f (113–116) fragment was less active. The reason for the differences in activity relates to the lack of the N-terminal Lys residue.247 Qian et al.240 also studied enzymatic hydrolysates of CGP fractionated by reverse phase high performance liquid chromatography. The three peptides KDQDK f(112–116), TAQVTSTEV f(163–171) and QVTSTEV f(165–171) completely inhibited thrombin-induced platelet aggregation. The two active peptides TAQVTSTEV f(163–171) and QVTSTEV f(165–171) are situated at the C-terminal end of sheep CGP and k-casein. No bovine peptide situated in this area of k-casein has so far been described for inhibiting platelet aggregation. The other peptide KDQDK f(112–116) known as casoplatelin is similar to the corresponding bovine one KNQDK, which is also a platelet aggregation inhibitor.248 The difference between the residues Asp and Asn did not seem to affect the inhibition of platelet aggregation. The peptide KDQDK is a fragment of the main antithrombotic peptide isolated from bovine k-casein corresponding to f(106–116, MAIPPKKNQDK). It is also structurally and functionally very similar to the C-terminal dodecapeptide of human fibrinogen g-chain f(400–411) corresponding to the sequence HHLGGAKQAGDV. The amino acids, Ile108, Lys112 and Asp115 of k-casein are in homologous positions as compared with g-chain sequence of human fibrinogen. These three residues of k-casein are important for inhibition due to the competition between the antithrombotic k-casein peptide and the g-chain for the platelet receptors.249 Jolles et al.233 showed that the natural or synthetic cow k-casein undecapeptide (MAIPPKKNQDK) inhibited both aggregation and ‘I-fibrinogen’ binding to ADP-stimulated human washed platelets, confirming an inhibitory effect on a common pathway and probably on fibrinogen binding to aIIbb3.241 Furthermore, this inhibition was even greater than that induced by the dodecapeptide (IIHLGGAKQAGDV) from human fibrinogen g-chain. As described previously, similarities exist between the fibrinogen a-chain tetrapeptide with the amino acid sequence RGDX, and human lactoferrin with the amino acid sequence KRDS corresponding to lactoferrin f(39–42).239 Qian et al.240 compared the effects of human and sheep lactoferrin and some peptides on platelet function in vitro and found that sheep and human lactoferrins inhibited thrombin-induced platelet aggregation (IC50 5 and 4 mmol, respectively). Investigations into the mechanism of the platelet inhibition by human lactoferrin or by human lactoferrin peptides found that the inhibition mechanism of platelet 162 | Food Funct., 2011, 2, 153–167

aggregation by KRDS did not involve aIIbb3.250 KRDS inhibition of thrombin-induced platelet aggregation has been associated with an inhibition of the release of the dense granule protein serotonin, but RGDS has no effect on the release.244 Synthetic peptides which contain the RGD sequence however, inhibit fibrinogen binding and platelet aggregation.251 Moreover, RGDS has been found to induce detachment of endothelial cells in vitro and serious concerns exist relating to the toxicity of this sequence in vivo, although the sequence KRDS, found in human lactoferrin is not thought to have the potential detrimental effects of RGDX.239 Fiat et al.26 showed that the tripeptide GLF, isolated from human a-lactalbumin f(51–53), specifically inhibits collageninduced human platelet aggregation and serotonin release in a dose-dependent manner.26 When combined with RGD it forms the chimeric peptide RGDGLF which plays the role of ligand sequence for integrin receptors.252 Chabance et al.253 studied the effect of RGDS, GLF, RGDGLF, and the caseinoglycopeptide on platelet in human washed platelets. They showed that RGDS is essential for binding to many integrins, particularly GPIIb/ IIIa, but not to GPIb. GLF was a specific inhibitor of collageninduced human platelet aggregation and probably bound to a collagen platelet receptor. Of the three peptides studied, RGDS was the best inhibitor of platelet aggregate formation induced by collagen or thrombin. GLF was implicated only in collageninduced platelet aggregation. The sequence RGD added on the N-terminal side of GLF removed this specificity, and the chimeric peptide RGDGLF was less inhibiting than GLF. Bovine caseinoglycopeptide inhibited bovine and human thrombin- and collagen-induced platelet aggregation and also inhibited the aggregation of human washed platelets by ristocetin in the presence of human vWF in a dose-dependent manner. In summary, there is an abundance of studies on peptides derived from milk displaying anti-thrombotic effects. Some peptides are currently used therapeutically to treat or prevent thrombosis one such peptide is GMP.244 When given intravenously the recommended adult dose level is 15–30 mg kg
1 twice daily for prophylaxis. For oral administration, an adult dose of 50–100 mg kg
1 twice daily has been recommended.244 Since GMP has no toxic effect, the dose rates can be varied depending on the sensitivity and/or tolerance of the patient. There has been considerable research activity on the antithrombotic action of the RGDX sequences of fibrinogen a-chain. However, the RGDS sequence has been found to induce detachment of endothelial cells in vitro, therefore serious concerns exist about general toxicity from the injection of these sequences in vivo. The related sequence that occurs in human lactoferrin KRDS is not thought to have the potentially detrimental effects of RGDX. KRDS is also antithrombotic, but its mechanism of action and/or its binding site may be different from RGDX. Thus, although it was identified by sequence homology studies between fibrinogen and milk proteins, it has novel antithrombotic activity. All research on this peptide has been based on in vitro and/or in vivo intravenous treatment in animal models. It is therefore not known if KRDS would be effective when administered orally, so more work needs to be done on this peptide before further recommendations are be made. These milk peptides could be considered as possible ingredients in functional foods; however, peptides must be stable to This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

exert activity in vivo. Synthetic linear peptides based on the RGD template have relatively little activity and poor stability in plasma.254 Whereas cyclic RGD peptides are more resistant to enzymatic breakdown and have a higher potency.254,255 RGD peptides can be modified in many ways to improve their activity. For example, integrelin (COR Therapeutics, South San Francisco), a cyclic peptide based on a Lys-Gly-Asp sequence rather than an RGD sequence, may be a more specific inhibitor of glycoprotein IIb/IIIa receptors than RGD-containing peptides.256 Replacement of the Arg group in the RGD sequence with an amidinoor benzamidino-containing group and the use of D-amino acids increase the resistance of these compounds to enzymatic degradation.254 Additionally engineering proteins by grafting RGD and KGD peptides on to micro-proteins EETII (a trypsin inhibitor) and the melanorortin receptor binding domain of the human agouti-related protein AGRP can result in increased inhibition of platelet aggregation through an enhanced inhibition of binding of fibrinogen to its aIIbb3 receptor.257 Hence by considering structural scaffold and neighbouring amino acids during peptide manufacturing, peptides with increased activity may be obtained.258 4.3.

Conclusion

There is evidence of products containing natural compounds on the market. In 2009, Provexis Natural Products Limited submitted an application to EFSA for a food constituent that ‘helps maintain normal platelet aggregation’.261 The food constituent in question was water soluble tomato concentrate (WSTC) in two variant forms WSTC I and its low-sugar derivative WSTC II. Both constituents are derived from ripe tomatoes, Lycopersicon esculentum and intended for use in fruit juices, fruit flavoured drinks and yogurt drinks or, powdered singleserve sachets, tablets, and capsules.262 Substantiation of the claim was based on eight human263–270 and seven non-human studies.268,271–275 A cause and effect relationship was established between the consumption of WSTC and the reduction in platelet aggregation. The health claim on the product ‘water-soluble tomato concentrate (WSTC) I and II helps maintain normal platelet aggregation, which contributes to healthy blood flow’276 was approved by EFSA. Additionally, in order to achieve the claimed affect, 3 g WSTC I or 150 mg WSTC II in up to 250 ml of either fruit juices, flavoured drinks or yogurt drinks (unless heavily pasteurised) or, 3 g WSTC I or 150 mg WSTC II as powder, tablets or easily dissolved capsules with at least 200 ml of liquid should be consumed daily, with a target population of adults between 35 and 70 years of age. Hence, there is potential to develop functional foods with antiplatelet agents as ingredients, as shown by the WSTC extract above. Therapeutic drugs currently play an important role in the regulation of the disease259,260 however; many factors need to be taken into account when assessing the benefits and risks of these anti-platelet treatments. Bleeding is a major risk, as it is an independent predictor of poor prognosis in acute coronary syndrome patients. However, new reversible P2Y12 antagonists offer the potential to discontinue anti-platelet therapy closer to invasive procedures compared with the thienopyridines, thus potentially reducing both procedure-related bleeding rates and duration of exposure to athero-thrombotic risk prior to This journal is ª The Royal Society of Chemistry 2011

procedures.259 Resistance to anti-platelet agents is another topic of concern however; dosage adjustments and the use of newer anti-platelet agents with less variability in patient response may help overcome this resistance.277 Overall, the future of antiplatelet drugs warrants large-scale Phase 3 trials that would provide important information on whether the strategies of achieving higher levels of P2Y12 inhibition and using reversible inhibitors can improve anti-platelet therapy.259 Therefore, identification of further compounds from natural sources including milk could be beneficial and provide possible alternatives to current strategies used to treat the disease.

5. General conclusion The possibility of designing new dairy products with healthpromoting benefits looks promising and offers a perspective for consumers and producers. CVD is a major health problem in both the developed and developing world and identification of any compound that would alter the CV risk in any way would be beneficial. Milk and hydrolysates of milk are an important source of these compounds. Humans are continuously exposed to milk protein hydrolysates without experiencing undesirable effects. The Life Science Research Office of the Federation of American Societies for Experimental Biology (FASEB) concluded that there are no suspicious hazards related to protein hydrolysates as food ingredients for public health aspects.278–280 Furthermore, the FDA lists protein hydrolysates as ‘generally recognized as safe’ (GRAS) under 21CFR 102.22.281 Protein hydrolysates are described as a variable mixture of polypeptides, oligopeptides and amino acids derived from among others casein. Casein hydrolysates have been on the European market as an integral part of fermented milk products and as a source of protein in hypo-allergenic infant formula for more than a decade.282 Hence there is potential for the use of milk peptides as ingredients in functional foods with an aim in reducing CV risk. A review of the literature available to date on ACE inhibitors shows that they are important functional food ingredients. There certainly is a market for them, although there are many restrictions that must be over come in order to introduce them into foods. Recurring issues include the stability of the peptides when ingested, in addition to, a loss in biological activity when studied in vivo. It is essential that effects be seen in vivo, but very few milk peptides displaying activity in vitro retain their activity when tested in vivo.283,284 Specific milk protein hydrolysates or fermented dairy products have shown moderate or significant reduction of blood pressure in human studies however.285–301 It is now being considered a flaw in most research strategies that peptides are first screened in vitro against potential targets and then in vivo to confirm efficacy. Foltz et al.302 believes that it is only valid to propose efficacy when the peptide exhibits reasonable proteolytic stability and physiologically relevant absorption, distribution, metabolism and excretion profiles. In relation to anti-thrombotic effects several peptides have been shown to be inhibitors of platelet aggregation. EFSA have published one claim to date in the area of platelet aggregation. With the identification of a novel compounds and the correct substantiation of claims additional products may be introduced onto the market as an additional strategy to the treatment of the disease. Food Funct., 2011, 2, 153–167 | 163

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

Important future research topics should focus on the bioavailability and safety of bioactive peptides. Furthermore, molecular studies are needed to assess the mechanisms by which bioactive peptides exert their activities. It may be is necessary to employ new nutrigenomic techniques, for example proteomics and metabolomics.303 By developing such novel facilities it will be possible to study the impact of proteins and peptides on the expression of genes and hence optimize the nutritional and health effects of these compounds. Also, bio-safety aspects of novel peptides generated by new technologies have to be considered before entering into proper product formulation and marketing efforts. Further challenges with functional food products containing novel bioactive peptides are associated with regulatory issues if any health-related claims will be attached to the products. Currently, health claim regulations seem to vary greatly in different countries but regional and continental harmonization processes are in progress.

6. References 1 H. Meisel, Austr. J. Dairy Technol., 2001, 56, 83–91. 2 F. L. Schanbacher, R. S. Talhouk and F. A. Murray, Livest. Prod. Sci., 1997, 50, 105–123. 3 M. Gobbetti, L. Stepaniak, M. De Angelis, A. Corsetti and R. Di Cagno, Crit. Rev. Food Sci. Nutr., 2002, 42, 223–239. 4 D. A. Clare and H. E. Swaisgood, J. Dairy Sci., 2000, 83, 1187–1195. 5 P. F. Fox, in Milk Proteins: General and Historical Aspects. Advanced Dairy Chemistry: Proteins, 3rd Edition Part A, ed. P. F. Fox and P. L. H. McSweeney, Kluwer Academic/Plenum Publishers, New York, 2003, vol. 1, pp. 1–48. 6 H. E. Swaisgood, in Advanced Dairy Chemistry: Proteins, 3rd Edition, Part A, ed. P. F. Fox and P. L. H. McSweeney., Kluwer Academic/Plenum Publishers, New York, 2003, vol. 1, pp. 139–201. 7 W. S. Wong, W. M. Camirand and A. E. Pavlath, Crit. Rev. Food Sci. Nutr., 1996, 36, 807–844. 8 A. Kilara and V. R. Harwalkar, in Food Proteins: Properties and Characterization, ed. S. Nakai and H. W. Modler, VCH Publishers Inc., New York, 1996, pp. 121–136. 9 N. Yamamoto and T. Takano, Nahrung, 1999, 43, 159–164. 10 B. Hern€ andez-Ledesma, L. Amigo, M. Ramos and I. Recio, J. Agric. Food Chem., 2004, 52, 1504–1510. 11 M. Hayes, C. Stanton, G. F. Fitzgerald and R. P. Ross, Biotechnol. J., 2007, 2, 435–449. 12 N. Yamamoto, A. Akino and T. Takano, J. Dairy Sci., 1994, 77, 917–922. 13 H. Korhonen and A. Pihlanto, Appl. Biotechnol. Food Sci. Policy, 2003, 1, 133–144. 14 R. J. Fitzgerald, Int. Dairy J., 1998, 8, 451–457. 15 Y. Kawasaki, H. Isoda, M. Tanimoto, S. Dosako, T. Idota and K. Ahiko, Biosci., Biotechnol., Biochem., 1992, 56, 195–198. 16 R. J. Xu, Food Rev. Int., 1998, 14, 1–16. 17 H. Teschemacher, Curr. Pharm. Des., 2003, 9, 1331–1344. 18 E. Lahov and W. Regelson, Food Chem. Toxicol., 1996, 34, 131–145. unther, D. Martin and E. Schlimme, FEBS Lett., 19 H. Meisel, S. G€ 1998, 433, 265–268. 20 J. Dziuba, P. Mimkiewicz and K. Plitnik, Pol. J. Food Nutr. Sci., 1996, 4, 85–96. 21 J. Dziuba, P. Minkiewicz, D. Nalecz and A. Iwaniak, Nahrung, 1999, 43, 190–195. 22 M. Malkoski, S. G. Dashper, N. M. O’Brien-Simpson, G. H. Talbo, M. Macris, K. J. Cross and E. C. Reynolds, Antimicrob. Agents Chemother., 2001, 45, 2309–2315. 23 H. Meisel and R. J. FitzGerald, Curr. Pharm. Des., 2003, 9, 1289–1295. 24 M. Gobetti, F. Minervini and C. G. Rizzello, Int. J. Dairy Technol., 2004, 57, 173–188. 25 H. Meisel, H. Frister and E. Schlimme, Z. Ernaehrungswiss., 1989, 28, 267–278. 26 A. M. Fiat, D. Migliore-Samour, P. Jolles, L. Drouet, C. B. D. Sollier and J. Caen, J. Dairy Sci., 1993, 76, 301–310. 27 C. J. Murray and A. D. Lopez, Lancet, 1997, 349, 1436–1442.

164 | Food Funct., 2011, 2, 153–167

28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71

R. Collins and S. MacMahon, Br. Med. Bull., 1994, 50, 272–298. A. Hata, Life Sci., 1995, 57, 2385–2395. D. L. Cohen and R. R. Townsend, JCOM, 2002, 9, 525–531. C. Allen, M. Palta, T. LeCaire, G. H. Huang, P. Brazy and D. D’Alessio, Ann. Epidemiol., 2002, 12, 498–505. R. Hernandez Hernandez, A. R. Carvajal, J. Guerrero Pajuelo, M. J. Armas de Hernandez, M. C. Armas Padilla, O. Barragan, J. J. Boada Boada and E. Roa, Am. Heart J., 1991, 121, 389–394. G. Andrioli, R. Ortolani, L. Fontana, S. Gaino, P. Bellavite, C. Lechi, P. Minuz, F. Manzato, G. Tridente and A. Lechi, J. Hypertens., 1996, 14, 1215–1221. L. Somova and J. Mufunda, Clin. Exp. Hypertens., 1993, 15, 781–796. J. Heinrich and G. Assmann, J. Cardiovasc. Risk, 1995, 2, 197–205. A. Hamsten, U. de Faire, G. Walldius, G. Dahl
en, A. Szamosi, C. Landou, M. Blomb€ack and B. Wiman, Lancet, 1987, 2, 3–9. T. W. Meade, S. Mellows, M. Brozovic, G. J. Miller, R. R. Chakrabarti, W. R. North, A. P. Haines, Y. Stirling, J. D. Imenson and S. G. Thompson, Lancet, 1986, 2, 533–537. S. G. Thompson, J. Kienast, S. D. M. Pyke, F. Haverkate and J. C. W. van de Loo, N. Engl. J. Med., 1995, 332, 635–641. V. Dzau and E. Braunwal, Am. Heart J., 1991, 121, 1244–1263. P. M. Kearney, M. Whelton, K. Reynolds, P. Muntner, P. K. Whelton and J. He, Lancet, 2005, 365, 217–223. J. E. Dimsdale, O. Kolterman, J. Koda and R. Nelesen, Hypertension, 1996, 27, 1273–1276. L. D
ezsi, Cardiovasc. Res., 2000, 47, 642–644. C. Labinjoh, D. E. Newby, P. Dawson, N. R. Johnston, C. A. Ludlam, N. A. Boon and D. J. Webb, Cardiovasc. Res., 2000, 47, 707–714. S. MacMahon, R. Peto, J. Cutler, R. Collins, P. Sorlie, J. Neaton, R. Abbott, J. Godwin, A. Dyer and J. Stamler, Lancet, 1990, 335, 765–774. J. M. Neutel, D. H. Smith and M. A. Weber, Am. J. Hypertens., 1999, 12, 215–223. A. S. Pachori, M. J. Huentelman, S. C. Francis, C. H. Gelband, M. J. Katovich and M. K. Raizada, Hypertension, 2001, 37, 357–364. R. W. Ehlers and J. F. Riordan, Biochemistry, 1989, 28, 5311–5318. K. Schr€ or, J. Cardio. Pharm., 1992, 20, 568–573. A. Husain, J. Hyper., 1993, 11, 1155–1159. M. A. Weber, Lancet, 2001, 358, 1525–1532. R. J. FitzGerald, B. A. Murray and D. J. Walsh, J. Nutr., 2004, 134, S980–988. D. Coates, Int. J. Biochem. Cell Biol., 2003, 35, 769–773. P. Libby, Circulation, 2001, 104, 365–372. S. R. Steinhubl and D. J. Moliterno, Am. J. Cardiovasc. Drugs, 2005, 5, 399–408. M. H. Kroll, J. D. Hellums, L. V. McIntire, A. I. Schafer and J. L. Moake, Blood, 1996, 88, 1525–1541. B. Nieswandt and S. P. Watson, Blood, 2003, 102, 449–461. S. P. Jackson, W. S. Nesbitt and S. Kulkarni, J. Thromb. Haemostasis, 2003, 1, 1602–1612. R. K. Andrews, E. E. Gardiner, Y. Shen and M. C. Berndt, IUBMB Life, 2004, 56, 13–18. R. W. Farndale, J. J. Sixma, M. J. Barnes and P. G. De Groot, J. Thromb. Haemostasis, 2004, 2, 561–573. M. Gawaz, Cardiovasc. Res., 2004, 61, 498–511. J. P. Xiong, T. Stehle, S. L. Goodman and M. A. Arnaout, Blood, 2003, 102, 1155–1159. A. T. Nurden and P. Nurde, Arterioscler., Thromb., Vasc. Biol., 2003, 23, 158–159. R. T. Dorsam and S. P. Kunapul, J. Clin. Invest., 2004, 113, 341–345. A. S. Weyrich, S. Lindemann and G. A. Zimmerman, J. Thromb. Haemostasis, 2003, 1, 1897–1905. M. Gawaz, Cardiovasc. Res., 2004, 61, 498–511. D. L. Bhatt and E. J. Topol, Nat. Rev. Drug Discovery, 2003, 2, 15–28. S. Massberg, K. Brand, S. Gr€ uner, S. Page, E. M€ uller, I. M€ uller, W. Bergmeier, T. Richter, M. Lorenz, I. Konrad, B. Nieswandt and M. Gawaz, J. Exp. Med., 2002, 196, 887–896. G. Andrioli, R. Ortolani, L. Fontana, S. Gaino, P. Bellavite, C. Lechi, P. Minuz, F. Manzato, G. Tridsente and A. Lechi, J. Hypertens., 1996, 14, 1215–1221. S. K. Nadar, A. D. Blann, S. Kamath, D. G. Beevers and G. Y. H. Lip, J. Am. Coll. Cardiol., 2004, 44, 415–422. S. K. Nadar, G. Y. Lip and A. D. Blann, Thromb. Haemost., 2004, 92, 1342–1348. R. Siebers and T. Maling, J. Hum. Hypertens., 1995, 9, 207.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

72 M. A. Barradas, S. O’Donoghue and D. P. Mikhailidis, In Vivo, 1992, 6, 629–634. 73 P. Stohlawetz, N. Hergovich, G. Stiegler, H. G. Eichler, P. H€ ocker, S. Kapiotis and B. Jilma, Transfusion, 1998, 38, 24–30. 74 I. A. Jagroop, I. Clatworthy, J. Lewin and D. P. Mikhailidis, Platelets, 2000, 11, 28–32. 75 E. S. Chapman, M. Sorette, E. Hetherington, D. Zelmanovic, G. Kling, J. Dugailliez, N. Pujol-Moix and D. Okrongly, Thromb. Haemost., 2003, 89, 1004–1015. 76 S. G. Frangos, V. Gahtan and B. Sumpio, Arch. Surg., 1999, 134, 1142–1149. 77 J. Pechan and A. Okrucka, Cardiology, 1991, 79, 116–119. 78 T. A. Duhamel, Y. J. Xu, A. S. Arneja and N. S. Dhalla, Expert Opin. Ther. Targets, 2007, 11, 1523–1533. 79 D. H. Haynes, Platelets, 1993, 4, 231–242. 80 D. Blockmans, H. Deckmyn and J. Vermylen, Blood Rev., 1995, 9, 143–156. 81 I. Jardin, N. Ben Amor, J. M. Hern
andez-Cruz, G. M. Salido and J. A. Rosado, Arch. Biochem. Biophys., 2007, 465, 16–25. 82 H. Holmsen, Semin. Hematol., 1985, 22, 219–240. 83 R. M. Touyz and E. L. Schiffrin, Hypertension, 1993, 22, 853–862. 84 S. E. Kjeldsen, K. Gjesdal, I. Eide, I. Aakesson, R. Amundsen, O. P. Foss and P. Leren, Acta Med. Scand., 1983, 213, 369–373. 85 S. Nomura, S. Kanazawa and S. Fukuhara, Hypertension, 2002, 16, 539–547. 86 R. Tandon, M. K. Sinha, H. Garg, R. Khanna and H. D. Khanna, Natl. Med. J. India, 2005, 18, 297–299. 87 F. Krotz, H. Y. Sohn and U. Pohl, Arterioscler., Thromb., Vasc. Biol., 2004, 24, 1988–1996. 88 A. J. Begonja, S. Gambaryan, J. Geiger, B. Aktas, M. Pozgajova, B. Nieswandt and U. Walter, Blood, 2005, 106, 2757–2760. 89 A. Camilletti, N. Moretti, G. Giacchetti, E. Faloia, D. Martarelli, F. Mantero and L. Mazzanti, Am. J. Hypertens., 2001, 14, 382–386. 90 S. Chu, G. Zhao and J. Du, Zhonghua Nei Ke Za Zhi, 1997, 36, 584– 586. 91 D. S. Bredt and S. H. Snyder, Annu. Rev. Biochem., 1994, 63, 175–195. 92 H. Azuma, M. Ishikawa and S. Sekizaki, Br. J. Pharmacol., 1986, 88, 411–415. 93 E. H. Lieberman, S. O’Neill and M. E. Mendelsohn, Circ. Res., 1991, 68, 1722–1728. 94 J. M. Sneddon and J. R. Vane, Proc. Natl. Acad. Sci. U. S. A., 1988, 85, 2800–2804. 95 A. Gries, C. Bode, K. Peter, A. Herr, H. B€ ohrer, J. Motsch and E. Martin, Circulation, 1998, 97, 1481–1487. 96 M. E. Mendelsohn, S. O’Neill, D. George and J. Loscalzo, J. Biol. Chem., 1990, 265, 19028–19034. 97 E. S. Trepakova, R. A. Cohen and V. M. Bolotina, Circ. Res., 1999, 84, 201–209. 98 C. Bereczki, S. T
ur, I. N
emeth, E. Sallai, C. Torday, E. Nagy, I. Haszon and F. Papp, Prostaglandins Leukot. Essent., 2000, 62, 293–297. 99 R. P. Ames, Am. J. Cardiol., 1983, 51, 632–638. 100 S. Seseko and Y. Kaneko, Arch. Intern. Med., 1985, 145, 1524. 101 H. Nakamura, Am. J. Cardiol., 1985, 60, 24E–28. 102 A. Agostoni and M. Cicardi, Drug Saf., 2001, 24, 599–606. 103 U. N. Das, Nutrition, 2001, 17, 337–346. 104 S. M. Groziak and G. D. Miller, Br. J. Nutr., 2000, 84, S119–125. 105 M. Phelan, A. Aherne, R. J. FitzGerald and N. M. O’Brien, Int. Dairy J., 2009, 19, 643–654. 106 O. N. Donkor, A. Henrikssonb, T. K. Singhc, T. Vasiljevica and N. P. Shah, Int. Dairy J., 2007, 17, 1321–1331. 107 G. C. Papadimitriou, A. Vafopoulou-Mastrojiannaki, V. S. Silva, A. Gomes, X. F. Malcata and E. Alichanidis, Food Chem., 2007, 105, 647–656. 108 A. Abubakar, T. Saito, H. Kitazawa, Y. Kawai and T. Itoh, J. Dairy Sci., 1998, 81, 3131–3138. 109 L. B. Hern
andez, I. Recio, M. Ramos and L. Amigo, Int. Dairy J., 2002, 12, 805–812. 110 P. Sandrine, D. Pascal, C. C
eline and M. G. Adele, N€ ahrung/Food, 2003, 47, 87–94. 111 T. Saito, T. Nakamura, H. Kitazawa, Y. Kawai and T. Itoh, J. Dairy Sci., 2000, 83, 1434–1440. 112 N. Yamamoto, M. Maeno and T. Takano, J. Dairy Sci., 1999, 82, 1388–1393. 113 D. Pan and Y. Guo, Int. Dairy J., 2010, 20, 472–479.

This journal is ª The Royal Society of Chemistry 2011

114 Z. Jiang, B. Tian, A. Brodkorb and G. Huo, Food Chem., 2010, 123, 779–786. 115 A. P. Pihlanto-lepp€al€a, T. Rokka and H. Korhonen, Int. Dairy J., 1998, 8, 325–331. 116 M. Maeno, N. Yamamoto and T. Takano, J. Dairy Sci., 1996, 79, 1316–1321. 117 S. Mizuno, S. Nishimura, K. Matsuura, T. Gotou and N. Yamamoto, J. Dairy Sci., 2004, 87, 3183–3188. 118 V. Vermeirseen, A. van der Bent, J. Van Camp, A. van Amerongen and W. Verstraete, Biochimie, 2004, 86, 231–239. 119 H. Meisel, Curr. Med. Chem., 2005, 12, 1905–1919. 120 R. L
opez-Fandi~ no, J. Otte and J. Van Camp, Int. Dairy J., 2006, 16, 1277–1293. 121 H. Korhonen and A. Pihlanto, Int. Dairy J., 2006, 16, 945–960. 122 R. Hartmann and H. Meisel, Curr. Opin. Biotechnol., 2007, 18, 163–169. 123 G.-H. Li, G.-W. Le, Y.-H. Shi and S. Shrestha, Nutr. Res., 2004, 24, 469–486. 124 P. Wohlfart, J. Dedio, K. Wirth, B. A. Sch€ olkens and G. Wiemer, J. Pharm. Exp. Ther., 1997, 280, 1109–1116. 125 E. W. Petrillo and M. A. Ondetti, Med. Res. Rev., 1982, 2, 1–41. 126 J. I. Johnson and V. L. Franz, J. Hypertens., 1992, 10, S13–26. 127 K. C. Wu and G. Gerstenblith, J. Cardiovasc. Pharmacol. Ther., 2010, 15, 257–267. 128 H. Y. T. Yang, E. G. Erd€ os and Y. Levin, Biochem. Biophys. Acta, 1970, 214, 374–376. 129 L. S. Zisman, Circulation, 1998, 98, 2788–2790. 130 J. F. Riordan, Genome Biol., 2003, 4, 225. 131 M. C. Araujo, R. L. Melo, M. H. Cesari, M. A. Juliano, L. Juliano and A. K. Carmona, Biochemistry, 2000, 39, 8519–8525. 132 A. Rousseau, A. Michaud, M. T. Chauvet, M. Lenfant and P. Corvol, J. Biol. Chem., 1995, 270, 3656–3661. 133 R. Collins, R. Peto, S. MacMahon, P. Hebert, N. H. Fiebach, K. A. Eberlein, J. Godwin, N. Qizilbash, J. O. Taylor and C. H. Hennekens, Lancet, 1990, 335, 827–838. 134 J. R. Hagaman, J. S. Moyer, E. S. Bachman, M. Sibony, P. L. Magyar, J. E. Welch, O. Smithies, J. H. Krege and D. A. O’Brien, Proc. Natl. Acad. Sci. U. S. A., 1998, 95, 2552– 2557. 135 M. C. Robert, A. Razaname, M. Mutter and M. A. Juillerat, J. Agric. Food Chem., 2004, 52, 6923–6931. 136 K. Brew, Trends Pharmacol. Sci., 2003, 24, 391–394. 137 H. S. Cheung, F. L. Wang, M. A. Ondetti, E. F. Sabo and D. W. Cushman, J. Biol. Chem., 1980, 255, 401–407. 138 J. Otte, S. M. Shalaby, M. Zakora, A. H. Pripp and S. A. ElShabrawy, Int. Dairy J., 2007, 17, 488–503. 139 T. Jauhiainen, M. Collin, M. Narva, Z. J. Cheng, T. Poussa, H. Vapaatalo and R. Korpela, Milchwissenschaft, 2005, 60, 358–363. 140 Y. Nakamura, N. Yamamoto, K. Sakai and T. Takano, J. Dairy Sci., 1995, 78, 1253–1257. 141 L. Seppo, T. Jauhiainen, T. Poussa and R. Korpela, Am. J. Clin. Nutr., 2003, 77, 326–330. 142 M. Sipola, P. Finckenberg, H. Vapaatalo, A. Pihlanto-Lepp€al€a, H. Korhonen, R. Korpela and M. L. Nurminen, Life Sci., 2002, 71, 1245–1253. 143 S. Maruyama, K. Nagakomi, N. Tomizuka and H. Suzuki, Agric. Biol. Chem., 1985, 49, 1405–1409. 144 Y.-K. Kim, D. Yoon, D.-Y. Yu, B. L€ onnerdal and B.-H. Chung, J. Dairy Res., 1999, 66, 431–439. 145 K. Yokoyama, H. Chiba and M. Yoshikawa, Biosci., Biotechnol., Biochem., 1992, 56, 1541–1545. 146 M. M. Mullally, H. Meisel and R. J. Fitzgerald, Int. Dairy J., 1997, 7, 299–303. 147 J. Tauzin, L. Miclo and J.-L. Gaillard, FEBS Letters, 2002, 531, 369– 374. 148 M. Kohmura, N. Nio, K. Kubo, Y. Minoshima, E. Munekata and Y. Ariyoshi, Agric. Biol. Chem., 1989, 53, 2107–2114. 149 D. W. Cushman, H. S. Cheung, E. F. Sabo and M. A. Ondetti, Biochemistry, 1977, 16, 5484–5491. 150 C. A. Dawson, R. D. Bongard, D. A. Rickaby, J. H. Linehan and D. L. Roerig, Am. J. Physiol., 1989, 257, H853–865. 151 M. P. Merker, S. H. Audi, B. M. Brantmeier, K. Nithipatikom, R. S. Goldman, D. L. Roerig and C. A. Dawson, Am. J. Physiol., 1999, 276, L341–350. 152 J. A. G
omez-Ruiz, I. Recio and J. Belloque, J. Agric. Food Chem., 2004, 52, 6315–6319.

Food Funct., 2011, 2, 153–167 | 165

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

153 J. L. Guy, R. M. Jackson, K. R. Acharaya, E. D. Sturrock, N. M. Hooper and A. J. Turner, Biochemistry, 2003, 42, 13185– 13192. 154 V. Vermeirssen, J. Van Camp and W. Verstraete, Br. J. Nutr., 2004, 92, 357–366. 155 Y. Saito, K. Wanezaki, A. Kawato and S. Imayasu, Biosci., Biotechnol., Biochem., 1994, 58, 1767–1771. 156 M. Hayes, C. Stanton, H. Slattery, O. O’Sullivan, C. Hill, G. F. Fitzgerald and R. P. Ross, Appl. Environ. Microbiol., 2007, 73, 4658–4667. 157 P.-L. Leclerc, S. F. Gauthier, H. Bachelard, M. Santure and D. Roy, Int. Dairy J., 2002, 12, 995–1004. 158 A. Pihlanto, Trends Food Sci. Technol., 2001, 11, 347–356. 159 A. Fuglsang, D. Nilsson and N. C. Nyborg, Appl. Environ. Microbiol., 2002, 68, 3566–3569. 160 N. Yamamoto, A. Akino and T. Takano, Biosci., Biotechnol., Biochem., 1994, 58, 776–778. 161 F. Minervini, F. Algaron, C. G. Rizzello, P. F. Fox, V. Monnet and M. Gobbetti, Appl. Environ. Microbiol., 2003, 69, 5297–5305. 162 Y. Nakamura, N. Yamamoto, K. Sakai, A. Okubo, S. Yamazaki and T. Takano, Int. Dairy J., 1995, 78, 777–783. 163 H. Korhonen and A. Pihlanto, Curr. Pharm. Des., 2003, 9, 1297– 1308. 164 T. Takano, Antonie van Leeuwenhoek, 2002, 82, 333–340. 165 F. A. Exterkate, Int. Dairy J., 1995, 5, 995–1018. 166 A. J. Haandrikman, R. Meesters, H. Laan, W. N. Konings, J. Kok and G. Venema, Appl. Environ. Microbiol., 1991, 57, E1899–1904. 167 T. D. Thomas and G. G. Pritchard, FEMS, 1987, 46, E245– 268. 168 M. Hayes, R. P. Ross, G. F. Fitzgerald and C. Stanton, Biotechnol. J., 2007, 2, 426–434. 169 E. R. S. Kunji, I. Mierau, A. Hagting, B. Poolman and N. Konings, Antonie van Leeuwenhoek, 1996, 70, 187–221. 170 T. Takano, Int. Dairy J., 1998, 8, 375–381. 171 A. Pihlanto, T. Virtanen and H. Korhonen, Int. Dairy J., 2010, 20, 3–10. 172 A. Quir
os, M. Ramos, B. Muguerza, M. A. Delgado, M. Miguel, A. Aleixandre and I. Recio, Int. Dairy J., 2007, 17, 33–41. 173 P. F. de Palencia, C. Pelaez, C. Romero and M. C. MartinHernandez, J. Agric. Food Chem., 1997, 45, 3401–3405. 174 M. Gobbetti, P. Ferranti, E. Smacchi, F. Goffredi and F. Addeo, Appl. Environ. Microbiol., 2000, 66, 3898–3904. 175 E. Smacchi and M. Gobbetti, Food Micro., 2000, 17, 129–141. 176 E. L. Ryhanen, A. Pihlanto-Leppala and E. Pahkala, Int. Dairy J., 2001, 11, 441–447. 177 L. Stepaniak, P. F. Fox, T. Sgrhaug and J. Grabskas, J. Agric. Food Chem., 1995, 43, 849–853. 178 M. Kaila, E. Isolauri, E. Soppi, E. Virtanen, S. Laine and H. Arvilommi, Pediatr. Res., 1992, 32, 141–144. 179 H. Meisel, Lifestock Prod. Sci., 1997, 50, 125–138. 180 E. Smacchi and M. Gobbetti, Enzyme Microb. Tech., 1998, 22, 687– 694. 181 F. Roudot-Algaron, D. Le Bars, L. Kerhoas, J. Einhorn and J. C. Gripon, J. Food Sci., 1994, 59, 544–547. 182 F. Addeo, L. Chianese, R. Sacchi, S. S. Musso, P. Ferranti and A. Malorni, J. Dairy Res., 1994, 61, 365–374. 183 T. Rokka, E. L. Swyv€aoja, J. Tuominen and H. Korhonen, Milchwissenschaft, 1997, 52, 675–677. 184 H. Meisel, Biopolymers, 1997, 43, 119–128. 185 J. A. G
omez-Ruiz, M. Ramos and I. Recio, Int. Dairy J., 2002, 12, 697–706. 186 D. A. Dionysius, R. J. Marschke, A. J. Wood, J. Milne, T. R. Beattie, H. Jiang, T. Treloar, P. F. Alewood and P. A. Grieve, Dairy Technol., 2000, 55, 103. 187 S. S. Haileselassie, B. H. Lee and B. F. Gibbs, J. Dairy Sci., 1999, 82, 1612–1617. 188 X.-Y. Mao, J.-R. Ni, W.-L. Sun, P.-P. Hao and L. Fan, Food Chem., 2007, 103, 1282–1287. 189 M. M. Mullally, H. Meisel and R. J. Fitzgerald, FEBS Letters, 1997, 401, 99–101. 190 N. Yamamoto, A. Akino and T. Takano, J. Dairy Sci., 1994, 77, 917–922. 191 A. Pihlanto-Lepp€ al€a, P. Koskinen, K. Piilola, T. Tupasela and H. Korhonen, J. Dairy Res., 2000, 67, 53–64.

166 | Food Funct., 2011, 2, 153–167

192 D. A. van Elswijk, O. Diefenbach, T. Schenk, S. van den Berg, A. Hogenboom, H. Irth and J. van der Greef, J. Chromatogr., A, 2003, 1020, 45–58. 193 S. Sekiya, Y. Kobayashi, E. Kita, Y. Imamura and S. Toyama, J. Jpn. Soc. Food Sci., 1992, 45, 513–517. 194 W. Maes, J. Van Camp, V. Vermeirssen, M. Hemeryck, J. M. Ketelslegers, J. Schrezenmeir, J. Otte, S. M. Shalaby, M. Kakora, A. H. Pripp and S. A. El-Shabrawy, Int. Dairy J., 2007, 17, 488–203. 195 E. L. da Costa, J. A. da Rocha Gontijo and F. M. Netto, Int. Dairy J., 2007, 17, 632–640. 196 J. Adler-Nissen, in Enzymatic hydrolysis of food proteins, Elsevier Applied Science Publishers Ltd. London, UK, 1986, pp. 116–124. 197 B. Keil, in Specificity of proteolysis, Springer-Verlag BerlinHeidelberg, NewYork, 1992, pp. 335. 198 S. Roufik, S. F. Gauthier and S. L. Turgeon, Int. Dairy J., 2006, 16, 294–302. 199 J. C. Knudsen, J. Otte, K. Olsen and L. H. Skibsted, Int. Dairy J., 2002, 12, 791–803. 200 G. W. Smithers, F. J. Ballard, A. D. Copeland, K. J. De Silva, D. A. Dionysius, G. L. Francis, C. Goddard, P. A. Grieve, G. H. McIntosh, I. R. Mitchell, R. J. Pearce and G. O. Regester, Int. Dairy J., 1998, 8, 819–827. 201 H. Korhonen, A. Pihlanto-Lep€al€a, P. Rantam€aki and T. Tupasela, Trends Food Sci. Technol., 1998, 9, 307–319. 202 M. Hirose, Trends Food Sci. Technol., 1993, 4, 48–51. 203 M. A. La Fuente, Y. Hemar, M. Tamehana, P. A. Munro and H. Singh, Int. Dairy J., 2002, 12, 361–369. 204 J. Dziuba, A. Iwaniak and P. Minkiewicz, Polimery, 2003, 48, 50–53. 205 A. Fuglsang, D. Nilsson and N. C. B. Nyborg, J. Enzyme Inhib. Med. Chem., 2003, 18, 407–412. 206 H. Fujita, K. Yokoyama and M. Yoshikawa, J. Food Sci., 2000, 65, 564–569. 207 K. Suetsuna and T. Nakano, J. Nutr. Biochem., 2000, 11, 450–454. 208 K. A. Witt, T. T. Sillespie, T. D. Huber and R. D. Egleton, Peptides, 2001, 22, 2329–2343. 209 C. Adessi and C. Soto, Curr. Med. Chem., 2002, 9, 963–978. 210 D. Doucet, S. F. Gauthier and E. A. Foegeding, J. Food Sci., 2001, 66, 711–715. 211 E. A. Foegeding, J. P. Davis, D. Doucet and M. K. McGuffey, Trends Food Sci. Technol., 2002, 13, 151–159. 212 J. Otte, S. B. Lomholt, R. H. Ipsen and K. B. Qvist, J. Dairy Res., 2000, 67, 597–608. 213 I. M. P. L. V. O. Ferreira, O. Pinho, M. V. Mota, P. Tavares, A. Pereira, M. P. Goncalves, D. Torres, C. Rocha and J. A. Teixeira, Int. Dairy J., 2007, 17, 481–487. 214 Y. Hata, M. Yamamoto, M. Ohni, K. Nakajima, Y. Nakamura and T. Takano, Am. J. Clin. Nutr., 1996, 64, 767–771. 215 J. Wu and X. Ding, Food Res. Int., 2002, 35, 367–375. 216 B. Chabance, P. Jolles, C. Izquierdo, E. Mazoyer, C. Francoual, L. Drouet and A. M. Fiat, Br. J. Nutr., 1995, 73, 583–590. 217 H. Karaki, K. Doi, S. Sugino, H. Uchiwa, R. Sugai, U. Murakami and T. Shizume, Comp. Biochem. Physiol., 1990, 96, 367–371. 218 J.-J. Xu, L.-Q. Qin, P.-Y. Wang, W. Li and C. Chang, Nutrition, 2008, 24, 933–940. 219 A. Aziz and G. H. Anderson, J. Nutr., 2003, 133, 2326–2330. 220 J. Pupovac and G. H. Anderson, J. Nutr., 2002, 132, 2775–2780. 221 R. Virchow, in Phlogose und Thrombose im GefaBsystem; Gesammelte Abhandlungen zur Wissenschaftlichen Medizin., Staatsdruckerei, Frankfurt, 1856. 222 A. Makin, S. H. Silverman and G. Y. H. Lip, Q. J. Med., 2002, 95, 199–210. 223 F. Grinnell, M. Feld and W. Snell, Cell Biol. Int. Rep., 1979, 3, 585– 592. 224 E. I. Chazov, A. V. Alexeev, A. S. Antonov, V. E. Koteleliansky, V. L. Leytin, E. V. Lyubimova, V. J. Lahav and R. O. Hynes, J. Supramol. Struct. Cell. Biochem., 1981, 17, 299–311. 225 W. P. M. Houdijk and J. J. Sixma, Blood, 1985, 65, 598–604. 226 T. Tschoff, H. J. Weiss and H. R. Baumgartner, J. Lab. Clin. Med., 1974, 83, 296–305. 227 R. L. Reddick, T. R. Griggs, M. A. Lam and K. M. Brinkhous, Proc. Natl. Acad. Sci. U. S. A., 1982, 79, 5076–5079. 228 J. Caen and S. Inceman, Nouv. Rev. Fr. Hematol., 1963, 3, 614–615. 229 J. R. McLean, R. E. Maxwell and D. Herder, Nature, 1964, 202, 605–606.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 29 March 2011 on http://pubs.rsc.org | doi:10.1039/C1FO10017C

View Online

230 N. O. Solum and H. Stormorken, Scand. J. Clin. Lab. Invest., 1965, 17, S170–182. 231 E. F. Plow and M. Ginsberg, J. Biol. Chem., 1981, 256, 9477–9482. 232 A. Andrieux, G. Hudry-Clergeon and J. J. Ryckwaert, J. Biol. Chem., 1989, 264, 9258–9265. 233 P. Jolles, M.-H. Loucheux-Lefebvre and A. Henschen, J. Mol. Evol., 1978, 11, 271–277. 234 P. Jolles and A. Henschen, Trends Biochem. Sci., 1982, 7, 325–328. 235 J. Y. Chang, Biochem. J., 1986, 15, 797–802. 236 P. Jolles, C. Alais and J. Jolles, Biochim. Biophys. Acta, 1963, 69, 511–517. 237 J. E. Plowman, L. K. Creamer, M. J. Liddell and J. J. Cross, J. Dairy Res., 1999, 66, 53–63. 238 D. G. Dalgleish, J. Dairy Sci., 1998, 81, 3013–3018. 239 K. J. Rutherfurd and H. S. Gill, Br. J. Nutr., 2000, 84, S99–102. 240 Z.-Y. Qian, P. Jolles, D. Migliore-Samour, F. Schoentgen and A. M. Fiat, Biochim. Biophys. Acta, 1995, 1244, 411–417. 241 P. Joll
es, S. Levy-Toledano, A. M. Fiat, C. Soria, D. Gillessen, A. Thomaidis, F. W. Dunn and J. P. Caen, Eur. J. Biochem., 1986, 158, 379–382. 242 J. L
eonil and D. Moll
e, Biochem. J., 1990, 271, 247–252. 243 B. Leveugle, J. Mazurier, D. Legrand, C. Mazurier, J. Montreuil and G. Spik, Eur. J. Biochem., 1993, 213, 1205–1211. 244 Eur. Pat., 0 397 571. US Pat., 506 3203, 1990. 245 M. A. Manso, C. Escudero, M. Alijo and R. L
opez-Fandi~ no, J. Food Prot., 2002, 65, 1992–1996. 246 T.-K. H. Vu, D. T. Hung, V. I. Wheaton and S. R. Coughlin, Cell, 1991, 64, 1057–1068. 247 J. L. Maubois, J. Leonil, R. Trouve and S. Bouhallab, Lait, 1991, 71, 249–255. 248 J. Caen, P. Jolles, C. Bal dit Sollier, A.-M. Fiat, E. Mazoyer and L. Drouet, Cahiers de Nutrition et de Dietetique, 1992, 27, 33–35. 249 S. Fosset and D. Tome, Bull. IDF, 2000, 353–358, 65–68. 250 E. Mazoyer, S. Levy-Toledano, F. Rendu, L. Hermant, H. Lu, A.M. Fiat, P. Jolles and J. Caen, Eur. J. Biochem., 1990, 194, 43–49. 251 D. M. Haverstick, J. F. Cowan, K. M. Yamada and S. A. Santoro, Blood, 1985, 66, 946–952. 252 H. Anderson, Experientia, 1990, 46, 2–13. 253 B. Chabance, P. Perrotin, R. Guillet, M. Boynard, D. MiglioreSamour, P. Jolles and A.-M. Fiat, Anal. Biochem., 1998, 255, 217–222. 254 D. Cox, T. Aoki, J. Seki, Y. Motoyama and K. Yoshida, Med. Res. Rev., 1994, 14, 195–228. 255 P. L. Barker, S. Bullens, S. Bunting, D. J. Burdick, K. S. Chan, T. Deisher, C. Eigenbrot, T. R. Gadek and R. Gantzos, J. Med. Chem., 1992, 35, 2040–2048. 256 R. M. Scarborough, J. W. Rose, M. A. Hsu, D. R. Philips, V. A. Campbell, L. Nannizzi and I. F. Charo, J. Biol. Chem., 1991, 266, 9359–9362. 257 S. Reiss, M. Sieber, V. Oberle, A. Wentzel, P. Spangenberg, R. Claus, H. Kolmar and W. Losche, Platelets, 2006, 17, 153–157. 258 M. Pfaff, K. Tangemann, B. Muller, M. Gurrath, G. Muller, H. Kessler, R. Timpl and J. Engel, J. Biol. Chem., 1994, 269, 20233–20238. 259 J.-P. Bassand, Eur. Heart J. Suppl., 2008, 10, D3–D11. 260 R. F. Storey, Eur. Heart J. Suppl., 2008, 10, A21–A27. 261 EFSA, 2009, EFSA J., 2009, 1101, pp. 13–15. 262 EFSA, 2010, EFSA J., 2010; 8, p. 1689. 263 S. A. Lazarus, K. Bowen and M. L. Garg, JAMA, 2004, 292, 805– 806. 264 N. O’Kennedy, L. Crosbie, M. van Lieshout, J. I. Broom, D. J. Webb and A. K. Duttaroy, REC No. 02/0269l, 2003. 265 N. O’Kennedy, L. Crosbie, M. van Lieshout, J. I. Broom, D. J. Webb and A. K. Duttaroy, REC No. 03/0177, 2003. 266 N. O’Kennedy, L. Crosbie, V. S. Song, J. I. Broom and A. K. Duttaroy, REC No. 05/S0802/77, 2005. 267 N. O’Kennedy, L. Crosbie, S. Whelan, V. Luther, G. Horgan, J. I. Broom, D. J. Webb and A. K. Duttaroy, Am. J. Clin. Nutr., 2006, 84, 561–569. 268 N. O’Kennedy, L. Crosbie, M. van Lieshout, J. I. Broom, D. J. Webb and A. K. Duttaroy, Am. J. Clin. Nutr., 2006, 84, 570– 579. 269 N. O’Kennedy, L. Crosbie, V. S. Song and J. I. Broom, REC No. 06/ S0802/60, 2006.

This journal is ª The Royal Society of Chemistry 2011

270 N. O’Kennedy, L. Crosbie, A. Greyling, A. de Bree, C. K. Kroner, J. A. Arthur and A. K. Duttaroy, REC No. 07/S0801/13, 2007. 271 A. K. Dutta-Roy, L. Crosbie and M. J. Gordon, Platelets, 2001, 12, 218–227. 272 S. A. Lazarus and M. L. Garg, Asia Pac. J. Clin. Nutr., 2003, 12, S20. 273 J. Yamamoto, T. Taka, K. Yamada, Y. Ijiri, M. Murukami, Y. Hirata, A. Naemura, M. Hashimoto, T. Yamashita, K. Oiwa, J. Seki, H. Suganuma, T. Inakuma and T. Yoshida, Br. J. Nutr., 2003, 90, 1031–1038. 274 V. Song, A. Sneddon, G. Horgan and N. O’Kennedy, Manuscript for submission, 2008. 275 F. Zhang, V. Song, M. Neacsu, L. Crosbie, G. Duncan, G. Horgan, B. de Roos and N. O’Kennedy, unpublished work. 276 EC, 2009, Official J. Eur. Union, OJ L 404, 30.12.2006. Corrigendum OJ L 12, 18.1.2007, p. 3–18. 277 D. Tousoulis, A. Briasoulis, S. S. Dhamrait, C. Antoniades and C. Stefanadis, Heart, 2009, 95, 850–858. 278 FASEB Report, FDA Contract No. 223-75-2004, 1978. 279 FASEB Report, FDA Contract No. 223-75-2004, 1980. 280 FASEB Report, FDA Contract No. 223-78-2100, 1981. 281 Fda Gras Substances (SCOGS) Database 2006. http:// www.ac ce ssdata.fda.gov/ scri pt s/fcn/fcnNavigation.cfm? rpt¼grasListing&displayAll¼true last viewed 21 January 2011. 282 EC Regulation No. 1609/2006, 2006. 283 T. Jauhiainen and R. Korpela, J. Nutr., 2007, 137, S825–829. 284 B. A. Murray and R. J. FitzGerald, Curr. Pharm. Des., 2007, 13, 773–791. 285 K. Aihara, O. Kajimoto, H. Hirata, R. Takahashi and Y. Nakamura, J. Am. Coll. Nutr., 2005, 24, 257–265. 286 T. Jauhiainen, H. Vapaatalo, T. Poussa, S. Kyronpalo, M. Rasmussen and R. Korpela, Am. J. Hypertens., 2005, 18, 1600–1605. 287 S. Mizuno, K. Matsuura, T. Gotou, S. Nishimura, O. Kajimoto, M. Yabune, Y. Kajimoto and N. Yamamoto, Br. J. Nutr., 2005, 94, 84–91. 288 J. Sano, K. Ohki, T. Higuchi, K. Aihara, S. Mizuno, O. Kajimoto, S. Nakagawa, Y. Kajimoto and Y. Nakamura, J. Med. Food, 2005, 8, 423–430. 289 S. Mizushima, K. Ohshige, J. Watanabe, M. Kimura, T. Kadowaki, Y. Nakamura, O. Tochikubo and H. Ueshima, Am. J. Hypertens., 2004, 17, 701–706. 290 J. Tuomilehto, J. Lindstrom, J. Hyyrynen, R. Korpela, M. L. Karhunen, L. Mikkola, T. Jauhianen, L. Seppo and A. Nissinen, J. Hum. Hypertens., 2004, 18, 795–802. 291 L. Seppo, T. Jauhiainen, T. Poussa and R. Korpela, Am. J. Clin. Nutr., 2003, 77, 326–330. 292 L. Seppo, O. Kerojoki, T. Suomalainen and R. Korpela, Milchwissenschaft, 2002, 57, 124–127. 293 Y. Hata, M. Yamamoto, M. Ohni, K. Nakajima, Y. Nakamura and T. Takano, Am. J. Clin. Nutr., 1996, 64, 767–771. 294 M. F. Engberink, E. G. Schouten, F. L. Kok, L. A. J. van Mierlo, I. A. Brouwer and J. M. Geleijnse, Hypertension, 2008, 51, 399–405. 295 K. van der Zander, M. L. Bots, A. A. A. Bak, M. M. G. Koning and P. W. de Leeuw, Am. J. Clin. Nutr., 2008, 88, 1697–1702. 296 K. van der Zander, M. Jakel, V. Bianco and M. M. Koning, J. Hum. Hypertens., 2008, 22, 804–806. 297 P. W. de Leeuw, K. van der Zander, A. A. Kroon, R. M. N. Rennenberg and M. M. Koning, Blood Press., 2009, 18, 44–50. 298 T. Nakamura, J. Mizutani, K. Sasaki, N. Yamamoto and K. Takazawa, J. Med. Food, 2009, 12, 1221–1226. 299 M. Yoshizawa, S. Maeda, A. Miyaki, M. Misono, Y. Choi, N. Shimojo, R. Ajisaka and H. Tanaka, Am. J. Physiol.: Heart Circ. Physiol., 2009, 297, 1899–1902. 300 A. M. Turpeinen, M. Kumpu, M. R€ onnback, L. Seppo, H. Kautiainen, T. Jauhiainen, H. Vapaatalo and R. Korpela, J. Funct. Foods, 2009, 1, 260–265. 301 L. A. J. van Mierlo, M. M. G. Koning, K. van der Zander and R. Draijer, Am. J. Clin. Nutr., 2009, 89, 617–623. 302 M. Foltz, C. P. C. van der Pijl and G. S. M. J. E. Duchateau, J. Nutr., 2010, 140, 117–118. 303 R. O’Donnell, J. W. Holland, H. C. Deeth and P. Alewood, Int. Dairy J., 2004, 14, 1013–1023.

Food Funct., 2011, 2, 153–167 | 167

Food & Function

View Online

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 168

PAPER

www.rsc.org/foodfunction

Expression of carotenoid biosynthetic pathway genes and changes in carotenoids during ripening in tomato (Lycopersicon esculentum) Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

Kanakapura Krishnamurthy Namitha, Surya Narayana Archana and Pradeep Singh Negi* Received 22nd November 2010, Accepted 1st February 2011 DOI: 10.1039/c0fo00169d To study the expression pattern of carotenoid biosynthetic pathway genes, changes in their expression at different stages of maturity in tomato fruit (cv. Arka Ahuti) were investigated. The genes regulating carotenoid production were quantified by a dot blot method using a DIG (dioxigenin) labelling and detection kit. The results revealed that there was an increase in the levels of upstream genes of the carotenoid biosynthetic pathway such as 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), 4-hydroxy-3-methyl-but-2-enyl diphosphate reductase (Lyt B), phytoene synthase (PSY), phytoene desaturase (PDS) and z-carotene desaturase (ZDS) by 2–4 fold at the breaker stage as compared to leaf. The lycopene and b-carotene content was analyzed by HPLC at different stages of maturity. The lycopene (15.33  0.24 mg per 100 g) and b-carotene (10.37  0.46 mg per 100 g) content were found to be highest at 5 days post-breaker and 10 days post-breaker stage, respectively. The lycopene accumulation pattern also coincided with the color values at different stages of maturity. These studies may provide insight into devising gene-based strategies for enhancing carotenoid accumulation in tomato fruits.

1. Introduction Carotenoids are one of the largest group of isoprenoid compounds biosynthesized by all photosynthetic bacteria, cyanobacteria, algae and higher plants. In plant systems, carotenoids play a major role in light harvesting and photoprotection, photomorphogenesis, non-photochemical quenching, lipid peroxidation and serve as precursors for the biosynthesis of the phytohormone abscisic acid (ABA).1,2 In recent years there has been considerable interest in the dietary carotenoids due to their provitamin A activity.3,4 b-Carotene is the most potent dietary precursor of vitamin A, the deficiency of which leads to xerophthalmia, blindness and premature death.5 Vitamin A deficiency has been reported as the most common dietary problem affecting children aged 1–4 years. Other known attributes of carotenoids include their high antioxidant potential and ability to prevent onset of certain cancers.6 Plants preferably synthesize carotenoids via the recently identified 1-deoxy-D-xylulose-5-phosphate (DOXP) pathway (Fig. 1) rather than the mevalonic acid pathway.7,8 Whilst both pathways produce isopentenyl pyrophosphate (IPP), the DOXP pathway is plastidic in nature and leads to the formation of carotenoids, phytol, plastoquinone-9, and diterpenes.9 IPP leads to the formation of geranylgeranyl pyrophosphate (GGPP) which is the precursor for the formation of carotenoids. The

Human Resource Development Department, Central Food Technological Research Institute (CSIR), Mysore, 570 020, India. E-mail: psnegi@ cftri.res.in; Fax: +91-821-2517233; Tel: +91-821-2514310

168 | Food Funct., 2011, 2, 168–173

most important step in the carotenoid biosynthesis pathway is the head-to-head condensation of two GGPP molecules to form a colourless compound phytoene.10,11 This two-step reaction is catalyzed by the enzyme phytoene synthase (PSY). The tomato contains two isoforms of the PSY gene, Psy-1 and Psy-2. The Psy-1 encodes the fruit-ripening-specific isoform, whilst Psy-2 predominates in green tissues, including mature green fruit and has no role in carotenogenesis in ripening fruit.12 The phytoene undergoes a series of four desaturation reactions to form phytofluene, z-carotene, neurosporene and finally lycopene. The four sequential desaturations are catalyzed by two related enzymes in plants; phytoene desaturase (PDS) and z-carotene desaturase (ZDS). A carotenoid isomerase (CRTISO) activity is additionally required to transform the poly cis lycopene (pro-lycopene) to the all trans-isomer. Cyclization of lycopene marks the branching point in the plant carotenoid pathway. Lycopene b-cyclase (LCYB) catalyzes lycopene to produce b-carotene in a two-step reaction that creates one b-ionone ring at each end of the lycopene molecule. In the other branch, d-carotene is produced by the addition of one 3-ring to lycopene in the presence of lycopene 3-cyclase (LCYE).13,14 Xanthophylls are formed by the oxygenation of carotenes, typically by the addition of hydroxyl, epoxy or keto groups. The ripening of tomato (Lycopersicon esculentum) fruit is a highly regulated process, during which co-ordinated genetic and biochemical events take place leading to changes in fruit texture, aroma, color and flavour.15 One of the most important noticeable changes during ripening is the increase in the carotenoid content. This is evident in the form of a change in This journal is ª The Royal Society of Chemistry 2011

View Online

10 days post-breaker (BR 10) and 14 days post-breaker (BR 14)] and the tissues were frozen using liquid nitrogen and stored at 80  C (SOLOW, USA) until further use. 2.2 Transcript analysis of carotenoid biosynthetic genes

Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

Extraction of phagemid DNA from E. coli clones and PCR. From the glycerol stock of E.coli clones harbouring different carotenoid biosynthetic genes shown in Table 1 (kindly provided by Dr Avtar K. Handa, Purdue University, USA), a loopful of culture was inoculated into LB broth with 50 mg mL1 ampicillin and incubated overnight in a shaker incubator (Alpha Scientific, Bangalore, India) at 37  C. Phagemid DNA was extracted from these cultures as described by Sambrook et al.19 The DNA thus obtained was quantified spectrophotometrically and the inserts were confirmed using T3 (50 - ATTAACCCTCACTAAAGGGA-30 ) and T7 (50 - TAATACGACTAACTATAGGGAGA -30 ) primers. The PCR was carried out in a thermal cycler (Master Cycler, Eppendorf, Germany) using Taq DNA polymerase (Bangalore Genei, Bangalore) and the PCR program used was initial denaturation at 94  C for 2 min followed by 30 cycles with 94  C for 30 s, 50  C for 30 s, 72  C for 1 min and final extension of 10 min at 72  C. The amplified PCR products were electrophoresed on a 1% agarose gel.

Fig. 1 Carotenoid biosynthetic pathway in higher plants showing upstream (shaded) and downstream (underline) genes used in our study.

pigmentation due to massive accumulation of lycopene and the disappearance of chlorophyll.16 The genes of lycopene biosynthesis are strongly induced during fruit development,17 while the genes encoding cyclization enzymes are downregulated.18 Therefore, the present study was undertaken to study the gene expression pattern of the complete carotenoid biosynthetic pathway in the Indian cultivar Arka Ahuti and the accumulation pattern of b-carotene and lycopene at various stages of maturity were characterized.

2. Materials and methods 2.1 Plant material Tomato seeds cv. Arka Ahuti was obtained from the Indian Institute of Horticultural Research, Hessarghatta, Bangalore. The tomato plants were grown in the Agri-Horticulture Department of CFTRI. Fruits were harvested at different stages of maturity [green (GR), breaker (BR), 3 days post-breaker (BR 3), 5 days post-breaker (BR 5), 7 days post-breaker (BR 7), This journal is ª The Royal Society of Chemistry 2011

Dot blot preparation, hybridization and analysis. The phagemid DNA (20 ng) was manually spotted onto a positively charged nylon membrane (Roche Diagnostics, Germany), wetted by keeping over a pre-soaked (2x SSC) 3M Whatman filter paper, UV cross linked in a UV crosslinker at 12000 J s1 (UVP, UK) for 2 min, briefly rinsed in sterile Milli-Q water and air-dried. The membrane was stored at 2–8  C until the hybridization experiments were carried out. For the transcript analysis of different carotenoid biosynthetic pathway genes, RNA extraction was carried out using TRI Reagent (Sigma Aldrich, Bangalore, India) from tomato leaf and fruit tissues (pulp with skin) at different stages of maturity following manufacturer’s protocol. Briefly, the tissues (z 50–100 mg) were finely ground in liquid nitrogen and homogenized in 1 mL of TRI reagent. The homogenate was stored at room temperature (RT) for 5 min for complete dissolution of the nucleoprotein complexes. Chloroform (200 mL) was added and shaken vigorously for 15 s; the samples were incubated at RT for 15 min and centrifuged at 10 000 rpm for 15 min at 4  C. The upper aqueous layer was transferred to a fresh Eppendorf tube and RNA was precipitated by adding 500 mL of isopropanol, and then incubated at RT for 10 min. The samples were centrifuged at 10 000 rpm for 10 min at 4  C. The RNA pellet obtained was washed with 75% ethanol by vortexing and centrifuged at 10 000 rpm for 10 min at 4  C. The ethanol was removed and the pellet was briefly air-dried for 3–5 min and solubilized in 50 mL of DEPC (diethyl pyro carbonate) water by heating at 55–60  C for 10 min. The RNA was analyzed by electrophoresis in a 1% agarose–formaldehyde gel and quantified spectrophotometrically. The concentration of RNA (mg mL1) was calculated by multiplying A260 by the dilution factor and extinction co-efficient (1 A260 ¼ 40 mg RNA per mL). A260  dilution factor  40 ¼ mg RNA per mL Food Funct., 2011, 2, 168–173 | 169

View Online

Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

Table 1 Different carotenoid clones used in the study Clone no.

EST ID

NCBI GI

Genes

Upstream genes cTOF13G5

EST472325

5059159

cTOA23B1

EST544380

15679907

cLEG44J6

EST441030

10943130

cTOB1O5

EST296226

6528386

cLEG9L24

EST399227

643093

cLEG31P23 cLES9I16 cTOA27N22 Downstream genes cLES3N4 cLEC71N1 cTOD10L9 cTOD9L3 cTOF1J5 cTOF17I10 cLEG71H1

EST411956 EST260738 EST545748

10804314 19286 6470254

1-Deoxy-D-xylulose-5-phosphate synthase (DXS) 1-Deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) 4-Hydroxy-3-methyl-but-2-enyl diphosphate reductase (Lyt B) Isopentenyl pyrophosphate isomerase (IPI) Geranylgeranyl pyrophosphate synthase (GGPS) Phytoene synthase (PSY) Phytoene desaturase (PDS) z-Carotene desaturase (ZDS)

EST258963 EST533455 EST355779 EST355566 EST468977 EST473193 EST589157

3005982 1006672 5870597 1772984 24636984 8249884 2769641

The cDNA probe was prepared from the extracted RNA from tissues at different stages of maturity. The reaction mixture consisted of 10 mg of RNA, 1 mL oligo dT (10 mM) primer and DEPC water to make up the volume to 20 mL. The contents were incubated at 70  C for 10 min and cooled in ice immediately. To this, a mixture containing 5 assay buffer for reverse transcriptase, DTT (0.1M), 10 mM dNTP mix (containing DIG labelled UTP) and M-MuLV (Moloney murine leukaemia virus) reverse transcriptase (20 U) was added and incubated at 37  C for 1 h in a water bath (Julabo, Bangalore). The reaction was stopped by heating at 70  C for 15 min followed by cooling on ice. Hybridization and detection was done using a DIG DNA labelling and detection kit (Roche Diagnostics, Germany). Briefly, the membrane (7  7 cm) was hybridized for 30 min at 62  C using 5 mL of pre-heated DIG Easy hybridization solution. The DIG labelled cDNA probe was denatured by heating in boiling water for 5 min and rapidly cooled on ice. The denatured probe was mixed with 3.5 mL of DIG Easy hybridization solution and hybridized with the membrane at 62  C overnight with gentle shaking. Stringency washes and detection were carried out following the manufacturer’s instructions. The blots were scanned using an HP ScanJet 8250 scanner and stored in JPEG format at 200 dpi resolution. The image was quantified by Adobe-Photoshop software.20 2.3 Extraction of carotenoids and HPLC analysis Tomato fruit (pulp with skin) tissues (z 250 mg) at different stages of maturity were ground in liquid nitrogen. Carotenoids were extracted using 1 mL of hexane : acetone : methanol (2 : 1 : 1 v : v : v) along with Sudan I as internal standard.21 Samples were vortexed thoroughly and centrifuged at 10 000 rpm for 5 min at 4  C. The supernatant was collected in a fresh Eppendorf tube, dried in N2 gas and redissolved in 200 mL of the 170 | Food Funct., 2011, 2, 168–173

Lycopene 3 cyclase (LCY E) Lycopene b cyclase (LCY B) b-Carotene hydroxylase (CrtR-B) Zeaxanthin epoxidase (ZEP I) Violaxanthin de-epoxidase (VDE I) Neoxanthin synthase (NXS) 9-cis-Epoxycarotenoid dioxygenase (VP-14)

mobile phase. All the extractions were carried out in dim light conditions. The extracts were subjected to HPLC analysis in an Agilent 1100 liquid chromatograph instrument using ODS-P column (Inertsil 4.6  250 mm, 5 mm). The mobile phase consisted of methanol : tetrahydrofuran (95 : 5 v : v) with a flow rate of 1 mL min1. Detection was done at 450 nm using a UV detector and the column temperature was maintained at 30  C. The amount of sample injected was 20 mL and the analysis was carried out thrice for each sample. 2.4 Colour measurement The colour of tomato fruits at different stages of maturity were measured using Hunter Lab Labscan XE colour measuring system (Hunter Associates Laboratory Inc, Raton, Virginia, USA). The readings were recorded in terms of L, a and b values. The L (lightness value) ranges from 0 (black) to 100 (white). The a (negative value for green to positive value for red) and b (negative value for blue to positive value for yellow) axes have no specific numerical limits. 2.5 Statistical analysis Analysis of variance was done with a completely randomized experiment with three replications and means were compared using Duncan’s multiple range test (DMRT).22

3. Results and discussion 3.1 Transcript analysis of various carotenoid biosynthetic genes The expression pattern of the upstream genes (genes responsible for lycopene accumulation) such as DXS (1-deoxy-D-xylulose-5phosphate synthase), DXR (1-deoxy-D-xylulose-5-phosphate reductoisomerase), Lyt B (4-hydroxy-3-methyl-but-2-enyl diphosphate reductase), IPI (isopentenyl pyrophosphate isomerase), GGPS (geranylgeranyl pyrophosphate synthase), PSY, This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

View Online

PDS and ZDS as well as downstream genes (genes responsible for converting lycopene to xanthophylls) such as LCY E, LCY B, Crt RB (b-carotene hydroxylase), ZEP I (zeaxanthin epoxidase), VDE I (violaxanthin de-epoxidase), NXS (neoxanthin synthase) and VP 14 (9-cis-epoxycarotenoid dioxygenase) of the carotenoid biosynthetic pathway was studied using cDNA probe synthesized from different maturity stage RNA. At the breaker stage, relative expressions of almost all upstream genes of carotenoid biosynthetic pathway increased significantly. At the ‘breaker’ stage of ripening, the color changes from green to pink because of the accumulation of lycopene, resulting from increased synthesis of carotenoid enzymes. The upstream genes of isoprenoid pathway such as DXS, GGPS and IPI showed a 1–2 fold increase, whereas, DXR, LYT B, PSY, PDS and ZDS genes increased 2–3 fold (Fig. 2). Similarly, the expression levels of LCY B and LCY E showed an increase of 1– 2 fold and xanthophyll biosynthetic genes Crt RB, ZEP I, NXS and VP 14 increased by 2–3 fold (Fig. 3). Higher levels of gene expression of the central isoprenoid pathway during early fruit development in tomatoes has been reported.23,24 The mRNA levels for the enzymes PSY and PDS that produce lycopene increase 10–20 fold at the breaker stage of ripening, but the mRNAs of both lycopene cyclases, LCY B and LCY E disappear.17,18,25 Studies have revealed that the increase in PSY and PDS expression during the breaker stage is due to transcriptional regulation.25 The highest accumulation of lycopene was observed at the 5 day post-breaker stage. Even though, the levels of upstream genes such as DXS, IPI, GGPS and PDS were high, increased levels of downstream genes LCY B, LCY E and NXS were also observed, which may be responsible for degradation of lycopene in subsequent stages. Similarly, at the BR 10 stage, highest levels of b-carotene accumulation coincided with the higher expression of xanthophyll biosynthetic genes such as Crt RB, ZEP I, NXS along with LCY E. This may be the probable reason for the decrease in the lycopene content leading to its conversion to other carotenoids. The increasing level of expression of carotenogenic genes DXS, PSY, PDS, ZDS, CRTISO, LCY B, LCY E and CHY B (b-carotene hydroxylase) has been observed during petal development of chrysanthemum also.26 We observed a differential expression of carotenoid biosynthetic pathway genes in tomato fruits during ripening. Transcriptional upregulation of carotenoid biosynthesis during maturity have been shown in tomato,27,28 tobacco,29 daffodil,30 marigold31 and Gentia lutea.32 Regulation at the enzymatic level

Fig. 2 Gene expression pattern of upstream genes of carotenogenic pathway in tomato tissues at different stages of maturity.

This journal is ª The Royal Society of Chemistry 2011

Fig. 3 Gene expression pattern of downstream genes of carotenogenic pathway in tomato tissues at different stages of maturity.

is predicted to account for the higher concentration of lycopene in fruits of the tomato mutants old-gold13 and old-gold-crimson.33 The hypothesis that differential gene expression is the major reason for the accumulation of lycopene is further corroborated by the accumulation of d-carotene in the fruits of the delta mutant, which results from increased transcription of CrtL-e (LCY E),28 and by the synthesis of b-carotene in fruits of the beta mutant, which is caused by the upregulation of a second lycopene b-cyclase gene, Cyc-b.13 A similar upregulation of carotenoid gene expression during fruit development has been found in bell pepper,34–37 melon38 and Satsuma mandarin (Citrus unshiu Marc).39 In our study also, increased transcription levels of GGPS, PDS and ZDS may be responsible for lycopene accumulation at the early stages of ripening (up to BR 5) and increased expression levels of downstream enzymes (Fig. 3) in later stages may lead to the formation of b-b-, b-3-carotenoids and xanthophylls to a lesser extent. The lycopene accumulation in autumn olive fruit also coincided with upregulation of upstream genes GGPS, PSY, PDS and ZDS and downregulation of LCY B and BCH (bcarotene hydroxylase) genes.40 3.2.

Lycopene and b-carotene content

Based on the HPLC chromatograms, the lycopene content showed a gradual increase from the green stage up to the 5 day post-breaker stage and the b-carotene up to the 10 day postbreaker stage (Table 2). The lycopene content (15.33  0.24 mg per 100 g) was found to be highest at the BR 5 stage and highest b-carotene content (10.37  0.46 mg per 100 g) was observed at the BR 10 stage. A decrease in the lycopene content was observed in the fully ripe stage. The lycopene accumulation in tomatoes which accounted for 90–95% of the total carotenoids was found to vary from 9.1–12.4 mg per 100 g in different cultivars under varying growth conditions.41 Brandt et al.42 studied the lycopene content in tomato Daniella F1 variety at three different stages of ripening and found the highest lycopene content to be 10.3  1.6 mg per 100 g in green house grown tomatoes and 6.8  0.8 mg per 100 g in open field grown tomatoes at the fully ripe stage. Similarly, in Pitanga (Eugenia uniflora L.) cultivar, the lycopene content was found to be 3.35 mg per 100 g in partially ripe and 7.11 mg per 100 g in ripe fruits.43 Food Funct., 2011, 2, 168–173 | 171

View Online

Table 2 Lycopene and b-carotene content at different stages of maturity in tomato Tomato tissues

Lycopene (mg per 100 g)

b-Carotene (mg per 100 g)

Green (GR) Breaker (BR) 3 days post-breaker (BR 3) 5 days post-breaker (BR 5) 7 days post-breaker (BR 7) 10 days post-breaker (BR 10) 14 days post-breaker (BR 14)

1.42  0.14e 2.76  0.82e 12.70  0.87b 15.33  0.24a 11.97  0.74bc 11.42  0.75c 9.58  0.80d

0.46  0.13e 3.47  0.93d 4.12  0.98d 5.90  0.84c 7.57  0.66b 10.37  0.46a 8.12  0.96b

Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

Values are mean  SD of 3 replications. Values in each column followed by same letter are not significantly different (p # 0.05).

In tomatoes the content of b-carotene has been shown to increase from the green (0.33 mg per 100 g) stage to the fully ripe stage (3.68 mg per 100 g at 24 days post-breaker).16 In our study also, we have found that content of b-carotene increased from 0.46  0.13 mg per 100 g at the green stage to 10.37  0.46 mg per 100 g at 10 days post-breaker. Studies on the carotenoid composition of other fruit also showed that b-carotene concentration increased as the fruit ripens. The concentration of bcarotene was found to be 0.54 and 1.2 mg per 100 g in partially ripe and 1.24 and 3.81 mg per 100 g in fully ripe fruits of two varieties of acerola.44 The accumulation of carotenoids is dependent on the regulation of different carotenogenic enzymes. Apart from this, sequestration of carotenoids in non-photosynthetic tissues has been well established in the accumulation of carotenoids.45,46 It has also been reported by Cunningham et al.,47 that the proportions of cyclic carotenoids may be controlled by the substrate specificity of b- and 3-cyclases. 3.3.

showed a typical sigmoid curve where there is no noticeable change when fruits are still green (green to breaker stage) and increases as the colour changes from light red to fully red stage. These results are similar to the one observed by Lopez Camelo and Gomez.48 The positive ‘b’ value indicates a yellow color and it remained almost constant throughout ripening. The fact that the change in ‘b’ value is negligible has been shown by other studies also.48,49 The ‘L’ value is a measure of the lightness of the tomato fruit, which decreases during ripening indicating darkening of fruits (Fig. 4).

4. Conclusion The present study shows the differential expression pattern of the complete carotenoid biosynthetic pathway genes for tomato cv. Arka Ahuti. The expression pattern coincided with the accumulation of the major carotenoid pigment, lycopene. The complete gene expression analysis of the present study may provide insight into devising strategies for enhancing carotenoid accumulation in tomato fruits.

Colour measurement

The L, a and b values of tomato fruit at different stages of maturity are shown in Fig. 4. The negative ‘a’ value indicates the intensity of green colour and positive value indicates red colour. The green stage of the tomato fruit showed a more negative value due to the green colour. The breaker stage showed a less negative value due to a color change from green to pink. The remaining stages showed positive values for ‘a’ with the highest being at the 5 day post-breaker stage, which is indicative of the highest lycopene accumulation at this stage (Table 2). Thus, the ‘a’ value

Fig. 4 Color values of tomato at different stages of maturity.

172 | Food Funct., 2011, 2, 168–173

Acknowledgements We thank Dr V. Prakash, Director, CFTRI and Dr M. C. Varadaraj for constant support and encouragement. We thank Dr Avtar K. Handa, Purdue University, for the generous gift of the carotenoid clones. KKN acknowledges CSIR, India, for the financial support in the form of a Senior Research Fellowship. PSN acknowledges the financial support by DST, New Delhi.

References 1 D. DellaPenna and B. J. Pogson, Vitamin Synthesis in Plants: Tocopherols and Carotenoids, Annu. Rev. Plant Biol., 2006, 57, 711–738. 2 E. Grotewald, The Genetics and Biochemistry of Floral Pigments, Annu. Rev. Plant Biol., 2006, 57, 761–780. 3 D. DellaPenna, Nutritional genomics: manipulating plant micronutrients to improve human health, Science, 1999, 285, 375–379. 4 J. Hirschberg, Production of high value compounds: carotenoids and vitamin E, Curr. Opin. Biotechnol., 1999, 10, 186–192. 5 S. T. Mayne, b-Carotene, carotenoids and disease prevention in humans, FASEB J., 1996, 10, 690–701. 6 E. Giovannucci, Tomatoes, tomato-based products, lycopene, and cancer: Review of the epidemiologic literature, J. Natl. Cancer Inst., 1999, 91, 317–331. 7 G. Britton, Overview of carotenoid biosynthesis, in Carotenoids, vol. 3. ed. G. Britton, S. Liaaen-Jensen, and H. Pfander, Birkhauser Verlag, Basel, Switzerland, 1998, pp. 13–147. 8 J. Hirschberg, Molecular biology of carotenoid biosynthesis, in Carotenoids, vol. 3. ed. G. Britton, S. Liaaen-Jensen, and H. Pfander, Birkhauser Verlag, Basel, Switzerland, 1998, pp. 149–194.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 18 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00169D

View Online

9 H. K. Lichtenthaler, The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol., 1999, 50, 47–65. 10 F. X. Cunningham Jr and E. Gantt, Genes and enzymes of carotenoid biosynthesis in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol., 1998, 49, 557–583. 11 J. Hirschberg, Carotenoid biosynthesis in flowering plants, Curr. Opin. Plant Biol., 2001, 4, 210–218. 12 P. D. Fraser, J. W. Kiano, M. R. Truesdale, W. Schuch and P. M. Bramley, Phytoene synthase-2 enzymes activity in tomato does not contribute to carotenoid synthesis in ripening fruit, Plant Mol. Biol., 1999, 40, 687–698. 13 G. Ronen, L. Carmel-Goren, D. Zamir and J. Hirschberg, An alternative pathway to b-carotene formation in plant chromoplasts discovered by map-based cloning of beta and old-gold color mutations in tomato, Proc. Natl. Acad. Sci., 2000, 97, 11102–11107. 14 F. X. Cunningham and E. Gantt, One ring or two? Determination of ring number in carotenoids by lycopene epsilon-cyclases, Proc. Natl. Acad. Sci., 2001, 98, 2905–2910. 15 P. D. Fraser, E. M. A. Enfissi, J. M. Halket, M. R. Truesdale, D. Yu, C. Gerrish and P. M. Bramley, Manipulation of phytoene levels in tomato fruit: Effects on Isoprenoids, plastids and intermediary metabolism, Plant Cell, 2007, 19, 3194–3211. 16 P. D. Fraser, M. R. Truesdale, C. R. Bird, W. Schuch and P. M. Bramley, Carotenoid biosynthesis during tomato fruit development, Plant Physiol., 1994, 105, 405–413. 17 G. Giuliano, G. E. Bartley and P. A. Scolnik, Regulation of carotenoid biosynthesis during tomato fruit development, Plant Cell, 1993, 5, 379–387. 18 R. Pecker, F. X. GubbayCunningham Jr and J. Hirschberg, Cloning and characterisation of the cDNA for lycopene b-cyclase from tomato reveals a decrease in its expression during tomato ripening, Plant Mol. Biol., 1996, 30, 806–819. 19 J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning - A Laboratory Manual; Cold Spring harbour Laboratory Press, 1989, Vol. 3, pp 16.1–18.88. 20 N. Luhtala and R. Parker, LSM1 over-expression in Saccharomyces cerevisiae depletes U6 snRNA levels, Nucl. Acids Res., 2009, 3(7), 5529–5536. 21 F. Xu, Q. P. Yuan and H. R. Dong, Determination of lycopene and bcarotene by high-performance liquid chromatography using Sudan I as internal standard, J. Chromatogr. B, 2006, 838, 44–49. 22 K. A. Gomez and A. A. Gomez, Statistical procedures for agricultural research. 2nd Ed. John Wiley and Sons, Inc: Singapore, 1984, pp 1– 680. 23 L. M. Lois, M. Rodriguez-Concepcion, F. Gallego, N. Campos and A. Boronat, Carotenoid biosynthesis during tomato fruit development: regulatory role of 1-deoxy-D-xylulose 5-phosphate synthase, Plant J., 2000, 22, 503–516. 24 E. M. Josse, A. J. Simkin, J. Gaffe, A. M. Laboure, M. Kuntz and P. Carol, A plastid terminal oxidase associated with carotenoid desaturation during chromoplast differentiation, Plant Physiol., 2000, 123, 1427–1436. 25 P. M. Bramley, Regulation of carotenoid formation during tomato fruit ripening and development, J. Exptl. Bot., 2002, 53, 2107–2113. 26 S. Kishimoto and A. Ohmiya, Regulation of carotenoid biosynthesis in petals and leaves of chrysanthemum (Chrysanthemum morifolium), Physiol. Plant., 2006, 128, 436–447. 27 P. M. Bramley, The regulation and genetic manipulation of carotenoid biosynthesis in tomato fruit, Pure Appl. Chem., 1997, 69, 2159–2162. 28 G. Ronen, M. Cohen, D. Zamir and J. Hirschberg, Regulation of carotenoid biosynthesis during tomato fruit development: expression of the gene for lycopene epsilon cyclase is down regulated during ripening and is elevated in the mutant delta, Plant J., 1999, 1(7), 341–351. 29 V. Mann, M. Harker, I. Pecker and J. Hirschberg, Metabolic engineering of astaxanthin production in tobacco flowers, Nat. Biotechnol., 2000, 18, 888–892. 30 M. Schledz, S. Al-Babili, J. von Lintig, H. Haubruck, S. Rabbani, H. Kleinig and P. Beyer, Phytoene synthase from Narcissus pseudonarcissus: functional expression galactolipid requirement,

This journal is ª The Royal Society of Chemistry 2011

31 32 33

34

35

36

37

38 39

40

41 42 43 44 45

46

47

48 49

topological distribution in chromoplasts and induction during flowering, Plant J., 1996, 10, 781–792. C. P. Moehs, L. Tian, K. W. Osteryoung and D. DellaPenna, Analysis of carotenoid biosynthetic gene expression during marigold petal development, Plant Mol. Biol., 2001, 45, 281–293. C. Zhu, S. Yamamura, H. Koiwa, M. Nishihara and G. Sandmann, cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea, Plant Mol. Biol., 2002, 48, 277–285. P. M. Bramley, The genetic enhancement of phytochemicals: the case of carotenoids. In: Phytochemical Functional Foods, ed. I. Johnson and G. Williamson, Woodhead Publishing Ltd, Cambridge, 2003, pp 253–279. R. Kuntz, S. Romer, P. Hugueney, J. H. Weil, R. Schantz and B. Camara, Identification of a cDNA for the plastid-located geranylgeranyl pyrophosphate synthase from Capsicum annuum: correlative increase in enzyme activity and transcript level during fruit ripening, Plant J., 1992, 2, 25–34. F. Bouvier, A. d’Harlingue, P. Hugueney, E. Marin, A. Marion-Poll and B. Camara, Xanthophyll biosynthesis- cloning, expression, functional reconstitution and regulation of beta-cyclohexenyl carotenoid epoxidase from pepper (Capsicum annum), J. Biol. Chem., 1996, 271, 28861–28867. F. Bouvier, A. d’Harlingue, C. Suire, R. A. Backhaus and B. Camara, Dedicated roles of plastid transketolases during the early onset of isoprenoid biogenesis in pepper fruits, Plant Physiol., 1998, 117, 1423–1431. P. Hugueney, F. Bouvier, A. Badillo, J. Quennemet, A. d’Harlingue and B. Camara, Developmental and stress regulation of gene expression for plastid and cytosolic isoprenoid pathways in pepper fruits, Plant Physiol., 1996, 111, 619–626. Aggelis, I. John, Z. Karvouni and D. Grierson, Characterization of two cDNA clones for mRNAs expressed during ripening of melon (Cucumis melo L) fruits, Plant Mol. Biol., 1997, 33, 313–322. Y. Ikoma, A. Komatsu, M. Kita, K. Ogawa, M. Omura, M. Yano and T. Moriguchi, Expression of a phytoene synthase gene and characteristic carotenoid accumulation during citrus fruit development, Physiol. Plant., 2001, 111, 232–238. X. Guo, L. Yang, H. Hu and L. Yang, Cloning and Expression Analysis of Carotenogenic Genes during Ripening of Autumn Olive Fruit (Elaeagnus umbellata), J. Agric. Food Chem., 2009, 57, 5334– 5339. Sass-Kiss, J. Kiss, P. Milotay, M. M. Kerek and M. Toth-Markus, Differences in anthocyanin and carotenoid content of fruits and vegetables, Food Res. Intl., 2005, 38, 1023–1029. S. Brandt, A. Lugasi, E. Bama, J. Hovari, Z. Pek and L. Helyes, Effect of growing methods and conditions on the lycopene content of tomato fruits, Acta Alimentaria, 2003, 32, 269–273. O. M. Porcu and D. B. Rodriguez-Amaya, Variation in the carotenoid composition of the lycopene-rich Brazilian fruit Eugenia uniflora L, Plant Foods Hum. Nutr., 2008, 63, 195–199. O. M. Porcu and D. B. Rodriguez-Amaya, Variation in the carotenoid composition of acerola and its processed products, J. Sci. Food Agric., 2006, 86, 1916–1920. J. Deruere, S. Romer, A. d’Harlingue, R. A. Backhaus, M. Kuntz and B. Camara, Fibril assembly and carotenoid overaccumulation in chromoplasts: a model for supramolecular lipoprotein structures, Plant Cell, 1994, 6, 119–133. M. Vishnevetsky, M. Ovadis, A. Zuker and A. Vainstein, Molecular mechanism under lying carotenogenesis in the chromoplast: multilevel regulation of carotenoid associated genes, Plant J., 1999, 20, 423–431. F. X. Cunningham Jr, B. Pogson, Z. Sun, K. A. McDonald, D. DellaPenna and E. Gantt, Functional analysis of the b- and 3lycopene cyclase enzymes of Arabidopsis reveals a mechanism for control of cyclic carotenoid formation, Plant Cell, 1996, 8, 1613–1626. F. Lopez Camelo and P. A. Gomez, Comparison of color indexes for tomato ripening, Hortic. Bras., 2004, 22, 534–537. R. Arias, T.-C. Lee, L. Logendra and H. Janes, Correlation of lycopene measured by HPLC with the L*, a*, b* color readings of a hydroponic tomato and the relationship of maturity with color and lycopene content, J. Agric. Food Chem., 2000, 48, 1697– 1702.

Food Funct., 2011, 2, 168–173 | 173

Food & Function

View Online

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 174

PAPER

www.rsc.org/foodfunction

Development of a simple model device for in vitro gastric digestion investigation

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

Jianshe Chen,* Vishwajeet Gaikwad, Melvin Holmes, Brent Murray, Malcolm Povey, Ye Wang and Ying Zhang Received 26th October 2010, Accepted 24th February 2011 DOI: 10.1039/c0fo00159g There have been some reports in the literature of model gastric digestion systems to mimic the dynamic physiological processes within the gastrointestinal tract. However, such devices often require the specification of many control parameters making routine digestion tests unfeasible. This paper introduces a simple in vitro digestion device, comprising of a water-jacketed glass vessel into which a spherical Teflon probe of variable diameter can be inserted. The probe is controlled by a texture analyser to simulate the kinetics of a food digestion process. Using this device under well controlled hydrodynamic flow and biochemical conditions key digestion parameters such as pH, food particle size, protein release, lipid release, cloudiness, etc, can be determined. Feasibility tests of the model device have been conducted using roasted and non-roasted peanuts particles. The status of peanut digestion was examined by the changes in particle size distribution and the mean particle size. Significant differences of surface microstructure have also been observed for peanut particles after the digestion. The influence of parameters such as food to gastric juice ratio, the probe speed and pepsin concentration have been examined in this work. Initial results confirm that all these factors influence the kinetic process of gastric digestion considerably and should be well regulated in any in vitro digestion investigations. We propose that the model device has the advantages of easy control and operation and furthermore could be an ideal tool for routine in vitro gastric digestion studies.

Introduction Knowledge of food disintegration in the human stomach is essential for assessing the bioavailability of nutrients and understanding the controlling mechanisms of gastric emptying. Recently, studies of human digestion behaviour and the impacts of food properties (textural, microstructural, as well as chemical and compositional) have been of great interest to food scientists and nutritionists.1,2 Various approaches, including in vivo and in vitro methods, have been employed for such investigations. Most gastric digestion studies in the past were conducted with a focus on either clinical or medical purposes, but increasing research has been carried out by food scientists in order to gain understanding of the role of food microstructural properties in the physiology of human digestion and nutrition. For example, understanding the influences of food structuring in gastric digestion;3 understanding release and bioavailability of allergenic substances from food microstructure;4 establishing processing conditions at the manufacturing stage to promote optimised and/ or controlled release of macronutrients;5 strategies for controlled gastric emptying as solutions to stomach disorders, obesity, and diabetes;6 understanding lipid digestion and postprandial satiety;7,8 aiding clinical studies through design of specific food School of Food Science, University of Leeds, Leeds, LS2 9JT, UK. E-mail: [email protected]; Fax: +44 113 3432982; Tel: +44 113 3432748

174 | Food Funct., 2011, 2, 174–182

microstructure.9,10 More detailed discussion on food digestion and gastric emptying can be found in some recent review articles.2,11 It should be noted that the material inside the stomach has already been orally processed and its properties differ hugely from that before being eaten.12 In clinical terminology, the mixed mass of orally processed food and gastric juice is called chyme. However, the term ‘food’ is still commonly used in literature in relation to gastric digestion and, for convenience, this term will also be adopted in this paper. Studies in medicine, pharmacy, and clinical nutrition have demonstrated that disintegration of food and drugs inside the stomach is a highly complicated process. Food is broken down into small particulates and molecules due to both physical forces and chemical reactions.13,14 Physical forces include mechanical and hydrodynamic actions present in the stomach, resulting from the muscle contraction and peristaltic movement of the stomach wall. Stomach contractions generate a fluid flow of the gastric contents that causes a shearing effect on the food surface.15 The composition, rheology, and rate of gastric secretions is influenced by the food composition and regulated by complex hormonal signalling.2 Gastric juice is secreted from glands lining the stomach, containing gastric acid (HCl) and digestive enzymes. The presence of HCl assists acid denaturation of digested food and activates pepsin. In the fasted state, intragastric pH in healthy subjects is in the range 1.3–2.5, while eating can increase the pH up to 7.5.16 The intake of food and the increase in pH This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

triggers a release of gastric juice. The pH can start to decrease within 20 min after ingesting a meal and recover to its natural value about two hours after meal consumption.17 Gastric juice contains 0.8–1 mg mL1 pepsin,18,19 a key ingredient that degrades food proteins into peptides. The gastric juice penetrates the food matrix and assists in digestion, but how the acidity and enzymes of the gastric juice affect disintegration of food is not fully understood. Apart from the gastric juice, the mechanical action and hydrodynamic flow created by the contraction waves of the stomach muscles also play a critical role in gastric digestion. The muscles of the stomach wall produce a regular patterned contraction in response to food intake. The contraction starts at the upper part of the stomach wall at a frequency of around 3 cycles per minutes. This contraction wave propagates towards the stomach antrum and pylorus at an average of 2.5 mm s1.20 The continuous contraction forces the stomach contents to move towards the lower exit (pyloric sphincter). However, the small opening of the sphincter limits the discharge of the stomach contents into the duodenum and pressure builds up in the pylorus/antrum region. This pressure build up helps to enhance the grinding down of the food particles but more importantly also forces a retropulsive flow back to the higher gastric contents. Combined propulsive and retropulsive flow leads to mixing, shearing and surface erosion to food particles. The pattern of stomach flow has been re-constructed based on computer simulations. Fig. 1 shows a simulated velocity spectrum inside the stomach.21 There is a minimal flow at the upper part of the stomach, particularly in fundus region, and increased flow towards the lower end of stomach. The maximum speed could be as high as 7.5 mm s1. Even though this velocity spectrum has not

Fig. 1 Predicted gastric flow velocity vectors from computer simulations. Two basic antral flow patterns are produced by the propagating antrum contraction waves, retropulsive jet-like motions in the most highly occluded region, and recirculating eddy flow between pairs of antrum contraction waves. The strongest fluid motions are in the antrum region, while the fundus of the upper stomach serves as the storage space with minimal fluid movement (from ref. 21 (Pal et al., 2004), with permission).

This journal is ª The Royal Society of Chemistry 2011

received any experimental confirmation, it provides valuable details of the hydrodynamic nature of stomach flow and is useful guidance for the experimental design of in vitro gastric digestion studies.

Current approaches for in vitro digestion studies The complex anatomy of the stomach, its regulated motility and contraction patterns, hormonal and interdigestive electrical signalling and juice secretions will all influence the disintegration process of the food it contains and the gastric emptying. Such a complexity makes it extremely difficult to mimic stomach conditions in an in vitro environment for systematic and reproducible studies. In vivo studies on stomach digestion have the benefit of being directly relevant to stomach physiology, gastric motility, accommodation, emptying, and intragastric disintegration of food. Techniques and equipment used for in vivo gastric digestion studies include breathing tests, scintigraphy, ultrasonography, and magnetic resonance imaging (MRI).2,22,23 More on in vivo gastric digestion studies can be read in a recent review by Golding and Wooster.11 One major difficulty of in vivo digestion studies is the involvement of human subjects and the associated ethical issues, which make such approaches less favourable for routine gastric digestion analysis. In vitro methods which simulate digestion of food and drugs are being extensively used at present because they are relatively straightforward, rapid, safe, and more importantly do not have the ethical restrictions of in vivo methods. These methods either simulate digestion and absorption processes (for bioavailability) or disintegration processes only (for bioaccessibility). Gastrointestinal models (GIMs) which simulate the GI digestion process under laboratory conditions can be categorized into two broad categories: static models, wherein the digesta remains largely immobile and physical processes such as hydration, mixing, shear, etc are ignored, and dynamic models which also mimic the physical and mechanical processes and temporal changes that occur in in vivo conditions (Parada & Aguilera, 2007; Kong & Singh, 2008a).2,4 A number of in vitro model systems have been reported in the literature to simulate the human GI tract for different purposes, including for gastric dissolution of drugs,24,25 nutrition availability,26 contaminant absorption,27 and disintegration kinetics of various foods.2 Some GI models were developed to assess specifically the effects of food microstructure on the bioavailability of nutrients. For example, Krul et al. used a dynamic GI model to determine the antimutagenic activity of black and green tea extracts.28 Their apparatus involved a water jacketed vessel lined with flexible interior walls. Hoebler et al. designed an in vitro digestive system which partially simulated masticatory action and physical and chemical processes in the stomach in order to understand the kinetics of carbohydrate and protein digestion.26 Chu & Beauchemin investigated the bioaccessibility of nutrients release from foods into artificial gastrointestinal fluids (saliva, gastric juice, and intestinal juice) using a flow injection and coupled plasma mass spectrometry.29 GI models have also been used for prescreening mycotoxins as an alternative to animal studies.30 With a focus on the nutrients absorption in small intestine, colleagues in Birmingham developed a simple experiment rig simulating segmentation motion occurring in Food Funct., 2011, 2, 174–182 | 175

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

small intestine.31 A test on glucose absorption revealed profound importance of the viscosity of the lumen on the mass transfer and absorption of nutrient compounds. More recently, a sophisticated digestion device, Human Gastric Simulator (HGS), has been developed in UC Davis. The device is capable to simulate the continuous peristaltic movement of stomach walls, with similar amplitude and frequency of contraction forces as reported in vivo.32 Satisfactory results have been obtained on the feasibility tests on the digestion of rice and apple samples. A commercial dynamic GI tract model, the TNO intestinal model (TIM), has been recently available. This apparatus has a control over many in vivo physiological conditions and peristaltic movements.33,34 Dynamic Digestion Model is another commercially available digestion device developed by Institute of Food Research in Norwich.35 Both models have gained a wide use in pharmacological and food testing for humans. The great advantage of these models is the capability in establishing in vitroin vivo (IVIVC) correlations for drug dissolution and absorption studies.2 This can be attributed to its high efficacy in simulating peristaltic movement in the GI tract, its on-line control features, as well as the controlled use of enzymes and appropriate adjustment of the pH.36 However, the device is not a routine tool due to its complexity.37 Also, the model cannot quantitatively reproduce the fluid mechanics and mechanical forces involved in in vivo food disintegration.2 In addition, the model is a multi-stage design and not cheap to run. Consequently, further development of in vitro models which are capable of incorporating a complete description of the hydrodynamic flow and physical forces but that are simple in design remains a high priority. In using in vitro methodologies to replace in vivo studies of gastric digestion, various assumptions have to be introduced. Certain compromises also have to be made in order to obtain the advantages of simplicity and controllability. In this study, the experimental design was formulated based on the following assumptions. 1. Food gastric disintegration and digestion is a dynamic process. The kinetics of digestion is regulated collectively by gastric biochemical actions, hydrodynamic flow conditions and mechanical forces. 2. Gastric digestion is influenced strongly by food–gastric interactions. Under well controlled biochemical and hydrodynamic conditions, the material properties of the food would be the dominating factor in influencing the kinetics of the digestion process. 3. The disintegration modes of foods probably include both breakage (fragmentation) and surface erosion (wear and dissolution). The main aim of this study was to test the feasibility of an in vitro digestion model for routine studies of food gastric digestion. The principal considerations of the design were the controllability of digestion conditions, easy operation, and reliable monitoring and recording of some key digestion indices. Controlling parameters included the chemical/biochemical environment (temperature and gastric juice composition) and the dynamic environment (extent and speed of fluid flow). The pH, particle size, texture, protein release and degradation, lipid release, cloudiness of gastric juice were the primary parameters of monitoring, though only the results of pH change and particle size variation are reported in this paper. 176 | Food Funct., 2011, 2, 174–182

Materials and methods Red skin peanuts purchased from a local supermarket (Morrisons Supermarket PLC, Leeds, UK) were used for this feasibility study. Peanuts were used both raw (unroasted) and roasted to compare the effects of roasting on the digestion process. Roasted peanuts were prepared in AEG Micromat microwave oven (Type E EH 8108, Germany) at level 2 for 2 min (100 g each time). The peanuts were subsequently peeled and milled in a food processor to produce particulate samples required for analysis. Vibration dry sieving was used to separate particles based on difference in particle size. Endecotts vibration sieving set (BS4100, Endecotts, London, England) was used for this purpose. Selection of sample size was based on literature values reported by Jalabert-Malbos et al.38 They indicated that after oral mastication and before being swallowed over 90% of peanut particles were smaller than 2mm; the median particle size (the size at the 50% of cumulative weight fraction) was 0.82 mm. To facilitate convenient sample handling, particles in the size range of 1 mm–1.4 mm in diameter (particles which collected on a sieve with a size of 1 mm, but that passed through a 1.4 mm sieve) were selected for analysis. However, some variations in initial particle size were observed due to the lack of control of size reduction and sieving. Therefore, in order to minimize experimental error, a batch of peanut particles was obtained each time for a set of experiments. Simulated gastric juice was prepared with pepsin from porcine gastric mucosa (1 g dm3), mucin from porcine stomach, Type III, (1.5 g dm3), and NaCl (8.775 g dm3), and pH 1.3 to 1.5, adjusted using 2 M HCl.2,27 All chemicals were purchased from Sigma-Aldrich, Inc. (U.K). The in vitro digesting device The in vitro digestion device consists essentially of a jacketed glass vessel and a spherical Teflon probe. Fig. 2 illustrates the key features of the design. The internal diameter of the vessel is 40 mm and the internal height is 140 mm. The bottom part of the vessel is a hemisphere with a radius of 20 mm, which gives vessel a net total volume of 168 ml. The hemispherical bottom design was to avoid any fluid stagnation zones and to ensure a continuous fluid flow. The spherical Teflon probe of 28 mm in diameter was attached to the load cell of the Texture Analyser (Stable Microsystems, Surrey, UK) via a thin rod adaptor made of stainless steel and surrounded by a sheath of Teflon. The probe can be moved up and down under the control of the Texture Analyser. The guiding principal was that probe movement relative to the wall of the vessel creates a similar flow pattern to that of the contraction waves of the stomach wall (see Fig. 1).21 The maximum flow speed of the cell content occurs at the narrowest gap between the probe surface and the glass wall and can be easily calculated based on the volume conservation principle when the probe oscillates vertically up or downwards, as follows, vmax ¼ 

r20

r2b  vb  r2b

(1)

where vmax is the maximum flow speed within the gap, vb is the moving speed of the probe ball, r0 is the internal radius of the glass vessel, and rb is the radius of the probe ball. The negative sign establishes that the fluid flow is always in the opposite This journal is ª The Royal Society of Chemistry 2011

View Online

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

two indices was made based on the best data fitting of closest residual and weighted residual values, as recommended by Malvern. Volume average particle size, d43, was used for the characterisation of size change and is defined by the following equation. P 4 ni d (2) d43 ¼ P i3 ni di

Fig. 2 Illustrative diagram of the digestive cell (a). A spherical probe made of Teflon (b) is attached to the load cell of a texture analyser (c) and moved up and down at a controlled speed and distance. A water circulation (d) was connected to maintain a body temperature.

direction to that of the moving probe. For example, for the probe ball of diameter 28 mm moving at 20 mm s1, a fluid flow with a maximum speed of 19.2 mm s1 will be created. Simulated gastric juice (100 mL) was loaded inside the vessel chamber. The chamber was maintained at 37  C via a water circulation bath. The vessel was sealed to prevent moisture loss by a Teflon lid which had a small opening in the centre allowing free vertical movement for the probe shaft. The stepper motor has an operational range of 0.01 to 40 mm s1, which is wide enough to create hugely different flow in the fluid contents. The probe movement was adjusted so that at its lowest point there was a clearance of 5 mm between the probe and interior base of the vessel. The distance of probe travel was set to 60 mm, which gave a similar clearance between the surface of the fluid and the top of the probe when it reached its top position. The digestion test was set by the number of cycles of probe movements, which determined the total digestion time. At the completion of each test, the pH of the gastric content was measured by dipping a pH electrode into the cell. After that, the content was neutralised immediately with 2 M NaOH. This neutralisation was essential to terminate any enzymatic and acidic reactions. Pepsin is most active at low pHs (around 2–4), but loss its functionalities at neutral pH conditions.36 Fluid samples were then taken for particle size measurements after neutralisation. Particle size analysis Size distributions of peanut particles before and after digestion tests were monitored using a Malvern Mastersizer Hydro2000G (Malvern Instruments, UK), capable of covering a size range from 0.01 mm to 2000 mm. The refractive index (RI) of peanut was set at 1.55 and absorption index was set at zero. There are no literature values for these optical properties. The choice of the This journal is ª The Royal Society of Chemistry 2011

where ni is the number of particles with a diameter of di. A TCS SP2 confocal laser scanning microscope (CLSM) (Leica Microsystems) in fluorescence mode was used for imaging surface microstructure of peanut samples. To avoid particle movement so that smooth surface laser-scanning can be conducted, peanut particles were immobilized on the microwell stage of a gelatin gel made of 5 g gelatin in 50 ml distilled water. The samples were then covered with glass cover slips and examined. The samples were illuminated with a 488 nm line from an argon (Ar/HeNe) laser through an RSP500 dichroic filter, using a HCPL FLUOTAR 10x 0.3 Dry lens. The samples exhibited autofluorescence, hence no dye staining was required. All digestion experiments were conducted with at least three repeats. Particle size distribution of each digested sample was measured twice to make sure measurement reproducibility. The average particle size shown in graphs was the mean of at least of six measurements. Standard deviations were calculated and given in graphs where appropriate. Fluid flow simulations In this section, given the relative simplicity of the digestion device we illustrate how the system is amenable to mathematical modelling. To accurately evaluate the fluid and particle motions during gastric mixing requires the simultaneous solution of the interactions between the fluid and the particulate matter. This has been successfully undertaken by Pal et al. (2004) using the Lattice Boltzmann method although other discrete methods may also be employed, e.g. Discrete Element Methods (DEM).40 These studies indicate that many particle-fluid interactions may be addressed e.g. buoyancy. Pal et al. (2004) also addressed the gastric muscle contractile behaviour. In this study we seek only to model the fluid flow conditions to enable appropriate selection of fluid characteristics e.g. viscosity. In this sense we are modelling the continuum limit of small particles within the fluid. To investigate the fluid flow and pressures generated within the device during the mixing cycle we established a mathematical model using the precise geometric dimensions and operating velocities and travel of the gastric device and the physical parameters of typical gastric fluids. The general description of the equations of motion for an incompressible fluid is supplied by the well known Navier–Stokes and continuity equations as shown in eqn (3) and eqn (4):41,42      vu (3) r þ u,Vu  V,  pI þ h Vu þ ðVuÞT ¼ F vt V$u ¼ 0

(4)

Here u is the velocity vector of the fluid, r is the density, I is the unit diagonal matrix, h is the viscosity and F is the volume Food Funct., 2011, 2, 174–182 | 177

View Online

force. These equations were solved using the commercially available solver COMSOL Multiphysics (COMSOL, Inc., www.comsol.com Version 3.5a, Stockholm, Sweden). Due to the oscillatory motion of the probe, the model utilised a movingmesh geometry to accurately map the probe position and the corresponding velocity field of the fluid.

Results and discussion

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

Mixing tests The device was first tested for its efficiency of mixing. Plastic beads of two different colours (Gutermann Rocailles 9/0, 2 mm in diameter, purchased from Hobbycraft shop in Leeds) were used for this purpose. Beads density (not measured) is significantly higher than that of water and naturally settle down to the bottom of the vessel. Fig. 3 shows the images taken after sequential mixing with the probe moving at 10 mm s1. It can be seen that, within only about 6 cycles (i.e. a total of 72 s), the two types of beads were effectively completely mixed up with the two types coloured beads homogeneously distributed. This efficient mixing was achieved by the pushing and shearing actions created by the probe movement. This suggests that every part of the content (or each individual granular particle) was subject to a continuous mechanical action and that there were no stagnation zones in the system. Fluid flow simulations The simplicity of the digestion device has a unique convenience for mathematical modelling to simulate the fluid flow and pressures generated within the device where we may prescribe viscous fluids comparable with gastric conditions. To demonstrate this advantage, Fig. 4 shows the velocity profiles as solved using the moving mesh (ALE) facility of COMSOL Multiphysics at 0.5 s intervals. For illustrative purposes model parameters were r ¼ 1000 kg m3, h ¼ 0.0151 Pa s, and the vertical velocity of the probe was modelled as sinusoidal function vy ¼ 20sin(2pt) [mm s1]. The probe radius used for simulation was 16 mm, slightly higher than that of the probe for digestion experiments. The

Fig. 3 Sequential mixing patterns of beads a) through to f) for six mixing cycles. The probe is programmed for an oscillation of 60 mm in distance at a travel velocity of 10 mm s1 and each cycle takes 12 s. Two equal portions of differently coloured beads became uniformly mixed after only six cycles of probe movement.

178 | Food Funct., 2011, 2, 174–182

Fig. 4 Velocity fields and vectors at t ¼ 0.5, 1, 1.5, 2 and 2.5 s a) through to e) of the gastric digester as modelled using a fluid dynamics model. Mathematical model using a moving mesh domain in COMSOL Multiphysics exploiting the radial symmetry of the system. Here a 16 mm spherical Teflon probe has been modelled. Note that the maximal velocities are attained at mid-points of the motion cycle.

velocity fields solved using the COMSOL model clearly demonstrate that retropulsive flow is generated and which produce velocities in the range 0–56 mm s1. In prescribing different operating conditions and physical parameters upon the system we may simulate a variety of gastric test scenarios (e.g. assess the effect of temperature by selecting appropriate dynamic viscosities). The changes of pH and the importance of food to gastric juice ratio Two separate digestion tests were first performed with two different ratios of peanut particles to gastric juice. In the first test, 5 g of milled peanut particles were loaded into the vessel containing 100 ml gastric juice. This gave a weight ratio of sample to gastric juice of 1 : 20. It was observed that, the particles quickly sank to the bottom of the vessel. The probe was capable to touching and pushing particles at its lowest position during the test. In the second test, 12.5 g of peanut particles were loaded in the vessel, giving sample to gastric juice ratio of 1 : 8. Due to the thicker layer of sedimented particles, the probe achieved good contact with the particles promoting motion within the gastric juice. Recording the pH during the digestion tests showed a continuous increase of the pH (see Fig. 5). It appeared that the extent of pH increase depended highly on the amount of food. For experiments with only 5 g peanut particles (food to gastric juice ratio 1 : 20), the final pH was close to 3 after one hour digestion. But for systems containing 12.5 g peanut particles (food to gastric juice ratio 1 : 8), the pH was $ 4.5 after the same period of digestion. It was also observed that the rate of pH change was the most dramatic at the early stage of digestion. For food to gastric juice ratio 1 : 20, the pH changed rapidly in the first 20 min and then remained little changed afterwards. At the higher food to gastric juice ratio 1 : 8, the pH changed quickly in the first half hour, but very limited change occurred during the This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

Fig. 5 Recorded pH changes of the various systems as a function of digestion time (in a total volume of 100 ml simulated gastric juice A: 5 g non-roasted peanut, 1–1.4 mm; B: 5 g roasted peanut, 1–1.4 mm; C: 12.5 g non-roasted peanut, 1–1.4 mm; D: 12.5 g roasted peanut, 1–1.4 mm). All pH measurements were repeated and in very good reproducibility.

remaining part of digestion period. The initially rapid increase in pH suggests quick consumption of acid in the digestion process. However, the relatively steady pH in the later part of the test does not necessarily imply a slowing down of digestion. Separate studies conducted have shown continuous protein release from peanut particles even though pH remained little changed in the later stages of the digestion test (data not shown). The immediate increase in pH indicates swift digestion action once peanuts particles are exposed to the gastric environment. In this investigation, only dry peanut particles were used (i.e. no salivary fluid was involved) and their addition to the gastric juice should not lead to any dilution effect. However, in in vivo stomach digestion, a significant increase of pH to close to neutral values has been reported after meal consumption, probably due to both the digestion process and the dilution of the gastric juice. About 20 min after meal ingestion, the pH starts to decrease again because of the continuous secretion of gastric juice. It appeared that roasting and particle size had a limited effect on pH change, (see Fig. 5). However, the food to gastric ratio seems to be a very important controlling parameter, influencing not only the rate of pH change but also more importantly the final pH of digestion. At a ratio of 1 : 20, the final pH reached about 3, but with a ratio of 1 : 8, final pH could reach >4.5. At the >4 pH value, the enzymatic activities of pepsin could be significantly weakened, though binding of pepsin with substrate has been confirmed as still possible at pH 5.39 In view of the above results a ratio of 1 : 20 was applied in the following digestion tests. Effect of changes of peanut particle size Changes of particle size have been used as the principal parameter to monitor the digestion process. Particle size distribution and mean particle size of peanut granules were measured before digestion and after a set period of digestion. Fig. 6 shows examples of particle size distributions of non-roasted peanut particles before the digestion and after being digested for 1 h. Even though peanut particles were collected through sieve sizes between 1 mm and 1.4 mm, it was observed that the real particle size range was much wider, with some particles smaller than This journal is ª The Royal Society of Chemistry 2011

Fig. 6 Example of particle size distributions of non-roasted peanut particles before and after 60 min in vitro digestion at a pepsin concentration of 1 g dm3.

10 mm and some as large as 2 mm. There are a few possible reasons for such wide particle size distributions. Firstly, artefacts from Mastersizer measurements could be a cause, due to the approximate setting of optical parameters for peanut particles. Secondly, it was observed that there was a strong tendency for adhesion among peanut particles as a result of oil release from the damaged plant cells. Formation of particle clusters was also inevitable during size reduction and sieving, where small particles stick together in the presence of small amounts of oil and fail to pass through the set sieve. Despite this, Fig. 6 shows a clear shift towards smaller particle size after one hour digestion. The mean particle size d43 decreased from 0.50 mm before the digestion to 0.38 mm after the digestion period. For roasted peanuts, more limited particle sticking was noticed after size reduction. Therefore, single peak size distributions were observed for such systems. The size change as a function of digestion time has been monitored for particles of both roasted and non-roasted peanuts. It was observed that non-roasted peanut particles remained little changed in particle size during the first half hour of digestion (Fig. 7a) but started to decrease in size afterwards, with around 25% reduction in mean particle size (d43) after one hour in vitro digestion (Fig. 7c). For particles of roasted peanuts, the size varied in a very different pattern. The roasted particles showed a fast increase in size during the first half hour of digestion and then a gradual decrease in size over the remaining digestion process (Fig. 7b and 7d). An increase in d43 as high as 45% was observed after 30 min digestion and a longer time period for size reduction to take place. Only after approximately 1.5 h was a smaller mean particle size observed taking about 3 h to achieve a 25% decrease in d43. The above results suggest that size increase and decrease could occur simultaneously during gastric digestion of peanut particles. We speculate that the observed particle size changes are attributable to two simultaneous mechanisms. Particle size decrease during digestion is fully expected because of gastric actions (mechanical, chemical, and biochemical). However, initial particle size increase is also not at all surprising. This is because dry solid particles are still capable of absorbing moisture from the gastric juice and expand. Separate examinations of the mechanical strength of the peanut particles before and after digestion showed significant hardness decrease after the digestion Food Funct., 2011, 2, 174–182 | 179

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

Fig. 7 Particle size changes of roasted and non-roasted peanuts as a function of digestion time (a and c: non-roasted peanut particles; b and d: roasted peanut particles).

(data not shown) clear evidence of moisture intake and particle softening. It should be noted that such moisture intake is a diffusion process regulated by the effective diffusion coefficient. In theory, the rate of moisture diffusion and rate of particle size expansion can be experimentally determined and quantified. It is therefore practically possible to establish the kinetics of the gastric digestion of peanut particles based on such measurements although this has not yet been attempted from these initial results. It should be noted that the deviation shown in Fig. 7 is sometimes quite significant. There could be two possible sources of experimental errors: the digestion experiment itself and the particle size characterisation. In order to make sure that correct conclusion can be made, a number of repeats (at least three repeats for each digestion experiment) for each test. Even though deviation is not negligible, the overall trend and pattern of peanut digestion were also obvious. The effects of roasting on digestion have also been confirmed by their very different surface microstructures. Fig. 8 shows CLSM surface images of peanut particles before and after one hour digestion for both non-roasted and roasted peanuts. Before digestion, both types of peanuts showed naturally fractured surfaces with no particular morphological features. But after the digestion, individual plant walls were unmistakably identifiable. For non-roasted peanut particles, their surfaces appeared to be much smoother after the digestion process. Each plant cell appeared to contain abundance of tightly packed granules. However, for roasted peanuts the digestion led to a completely different surface microstructure. Individual plant cells were still clearly identifiable, but particle surfaces were much more hollowed out with very few granules observable at the surface. Not surprisingly, the (cellulose) plant cell wall appeared to be much more resistant to gastric digestion than its (protein) contents. However, after the release of the cell contents, the cell wall becomes fully exposed and it is envisaged that it may be stripped away by the combined hydrodynamic and mechanical action. There is no clear evidence to suggest that the peanut particles break up into smaller sizes during digestion. It is therefore reasonable to suggest that surface erosion plays a dominant role in peanut digestion. 180 | Food Funct., 2011, 2, 174–182

Fig. 8 Surface microstructure as observed by CLSM of peanut particles before and after in vitro digestion, a) non-roasted peanut particle before digestion, b) roasted peanut particle before digestion, c) non-roasted peanut particle after 60 min digestion, d) roasted peanut particle after 60 min digestion.

It should be noted that the velocity profiles applied here were somewhat different from that predicted by Pal et al.21 We have no evidence yet which velocity profile or hydrodynamic flow was most closely correlated to the real hydrodynamic condition in stomach. However, the current experimental set up is flexible enough to cover a much wider range of hydrodynamic conditions. Tests of controllable parameters of in vitro gastric digestion Two controlling parameters have been tested at this feasibility stage: the speed of probe moving and the concentration of pepsin. The former was to test for the effect of mixing and hydrodynamic flow and the latter was for the effect of enzymatic reactions. Fig. 9 shows the mean particle size changes after one hour digestion for non-roasted peanuts when the probe was set at speeds of 6, 12, 18 and 24 mm s1. The mean particle size before digestion is also given for reference. It is seen that speed of probe of movement is a very important factor influencing digestion. A low probe speed has little effect on peanut digestion. There was no significant change in mean particle size for speeds at 6 and 12 mm s1. However, when the probe moved at speeds higher than 18 mm s1, significant particle change was observed. There seems to be a step change at probe speed of 18 mm s1. However, the exact reason of the change is yet not known. But one may speculate that increased flow dynamic and surface movement are the possible causes. At 18 mm s1, the maximum fluid flow between the gap was calculated to be around 19.2 mm s1, much higher than that (7.5 mm s1) predicted by Pal et al.21 The large discrepancy between the maximum fluid flow speed in this experimental set up and the predicted value by Pal et al.21 is probably not at all surprising. The predicted value was a result of This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

activity, mechanical (and acidic) actions alone cause little break down (via surface erosion) of peanut particles. It is likely that the slight particle size increase is again caused by moisture intake which possibly could offset size reduction due to surface erosion. However, in the presence of increased pepsin concentrations (1.0 g l1, and 3.2 g l1), the peanut particles showed a significant decrease in mean particle size after one hour digestion. There seems little doubt that the observed size decrease can be attributed to the increased availability of pepsin and enhanced enzymatic activity. Since the in vivo profiles of gastric composition are not readily available, pepsin concentration is one of the main parameters that should be properly regulated in any experimental set up of in vitro gastric digestion. Fig. 9 Effect of probe speed on the digestion kinetics of non-roasted peanut particles. The mean particle size was measured after one hour in vitro digestion. Speed zero means a stationary system with no probe movement at all.

computer modelling of an irregular geometry and it should be noted that the Pal simulation has so far received no experimental proof. We propose that the speed of probe movement could be used as a control parameter and that this could provide valuable insight into the effects of hydrodynamic flow and mechanical mixing on the kinetics of gastric digestion. With the given simplicity of the device, the flow dynamics can be easily characterised with the help of COMSOL simulation, as has been demonstrated in previous sections. Three different levels of pepsin concentration (0, 1.0 g L1, and 3.2 g L1) have been examined. Pepsin is a member of the proteinases group naturally secreted in human stomach and is the enzyme(s) responsible attacking and degrading proteins. Therefore, the availability of an appropriate amount of pepsin is essential for gastric digestion of protein-containing foods.18 Varying pepsin concentration could lead to a changed rate of digestion. Fig. 10 shows the effect of gastric composition on the particle size change of non-roasted peanut particles after one hour digestion. Results were the average of at least three experiments. Deviations between experiments had been observed. However, the overall trend was clearly evident. It was observed that without pepsin there was a small increase in particle size after one hour digestion. This suggests that without enzymatic

Summary In this work, the design principles and experimental set up of a simple model device for in vitro gastric digestion have been discussed. Initial feasibility tests suggest that the device is reliable and easy to use. Experimental conditions were also easily controllable and adjustable. Using the example of peanut particles, both roasted and non-roasted, we have demonstrated that changes in pH, particle size, and surface microstructure can be monitored and be used as useful indices for the characterisation and quantification of digestion processes. Parameters that influence gastric digestion (such as digestion time, pepsin concentration, food to gastric juice ratio, shearing and hydrodynamic flow, etc) can be easily controlled for this experimental set up and effects of these factors on peanut digestion have been demonstrated. We propose that this model device could be an ideal tool for routine investigations of in vitro food gastric digestion.

Acknowledgements Authors would like to thank Prof. Eric Dickinson and Dr Rammile Ettelaie for useful discussions on gastric digestion.

References 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Fig. 10 The mean particle size of non-roasted peanut particles before and after 1 h digestion in simulated gastric juices containing no pepsin concentrations of 1 g l1, and 3.2 g l1.

This journal is ª The Royal Society of Chemistry 2011

15

B. O. Schneeman, Br. J. Nutr., 2007, 88, S159–S163. F. Kong and R. P. Singh, J. Food Sci., 2008, 73, R67–R80. I. Norton, S. Moore and P. Fryer, Obes. Rev., 2007, 8, 83–88. J. Parada and J. M. Aguilera, Journal of Food Science, 200, 72, 21–32. I. Norton, P. Fryer and S. Moore, AIChE J., 2006, 52, 1632–1640. C. K. Rayner, M. Samsom, K. L. Jones and M. Horowitz, Diabetes Care, 2001, 24, 371–381. J. Maldonado-Valderrama, A. P. Gunning, M. J. Ridout, P. J. Wilde and V. J. Morris, Eur. Phys. J. E, 2009, 30, 165–174. L. Marciani, R. Faulks, M. S. J. Wickham, D. Bush, B. Pick, J. Wright, E. F. Cox, A. Fillery-Travis, P. A. Gowland and R. C. Spiller, Br. J. Nutr., 2009, 101, 919–928. C. J. Kenyon, F. Brown, G. R. McClelland and I. R. Wilding, Pharmacol. Res., 1998, 15, 417–422. T. Sanz and H. Luyten, Food Hydrocoll., 2006, 20, 703–711. M. Golding and T. Wooster, Curr. Opin. Colloid Interface Sci., 2010, 15, 90–101. J. Chen, Food Hydrocoll., 2009, 23, 1–25. J. L. Urbain, J. A. Siegel, N. D. Charkes, A. H. Maurer, L. S. Malmud and R. S. Fisher, European Journal of Nuclear Medicine and Molecular Imaging, 1989, 15, 254–259. L. Marciani, P. A. Gowland, R. C. Spiller, P. Manoj, R. J. Moore, P. Young and A. J. Fillery-Travis, Am. J. Physiol.—Gastrointestinal Liver Physiol., 2001, 280, G1227–G1233. A. Pal, B. Abrahamsson, W. Schwizer, G. S. Hebbard and J. G. Brasseur, Gastroenterology, 2003, 124, A673–A674.

Food Funct., 2011, 2, 174–182 | 181

Downloaded on 12 April 2011 Published on 14 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00159G

View Online

16 F. Kong and R. P. Singh, Food Biophys., 2009, 4, 180–190. 17 J. R. Malagelada, G. F. Longstreth, W. H. J. Summerskill and V. L. W. Go, Gastroenterology, 1976, 70, 203–210. 18 J. Tang, in Handbook of Proteolytic Enzymes, ed. A. J. Barrett , N. D. Rawlins and J. F. Woessner, London, Academic Press, 2002, pp. 805– 820. 19 M. Vertzoni, J. Dressman, J. Butler, J. Hempenstall and C. Reppas, Eur. J. Pharm. Biopharm., 2005, 60, 413–417. 20 M. A. Kwiatek, A. Steingoetter, A. Pal, D. Menne, J. G. Brasseur, G. Hebbard, P. Boesiger, M. Thumshirn, M. Fried and W. Schwizer, J. Magn. Reson. Imaging, 2006, 24, 1101–1109. 21 A. Pal, K. Indireshkumar, W. Schwizer, B. Abrahamsson, M. Fried and J. G. Brasseur, Proc. R. Soc. London, Ser. B, 2004, 271, 2587– 2594. 22 L. Marciani, P. A. Gowland, R. C. Spiller, P. Manoj, R. J. Moore, P. Young, S. Al-Sahab, D. Bush, J. Wright and A. J. Fillery-Travis, J. Nutr., 2000, 130, 122–127. 23 K. Schulze, Neurogastroenterol. Motil., 2006, 18, 172–183. 24 S. Aoki, K. Uesugi, K. Tatsuishi, H. Ozawa and M. Kayano, Int. J. Pharm. Med., 1992, 85, 65–73. 25 S. Aoki, H. Ando, K. Tatsuishi, K. Uesugi and H. Ozawa, Int. J. Pharm., 1993, 95, 67–75. 26 C. Hoebler, G. Lecannu, C. Belleville, M. F. Devaux, Y. Popineau and J. L. Barry, Int. J. Food Sci. Nutr., 2002, 53, 389–402. 27 A. G. Oomen, C. J. M. Rompelberg, M. A. Bruil, C. J. G. Dobbe, D. P. K. H. Pereboom and A. J. A. M. Sips, Arch. Environ. Contam. Toxicol., 2003, 44, 281–287.

182 | Food Funct., 2011, 2, 174–182

28 C. Krul, A. Luiten-Schuite, A. Tenfelde, B. van Ommen, H. Verhagen and R. Havenaar, Mutation Res., 2001, 474, 71–85. 29 M. Chu and D. Beauchemin, J. Anal. At. Spectrom., 2004, 19, 1213– 1216. 30 G. Avantaggiato, R. Havenaar and A. Visconti, Food Chem. Toxicol., 2003, 41, 1283–1290. 31 A. Tharakan, I. T. Norton, P. J. Fryer and S. Bakalis, J. Food Sci., 2010, 75, 339–346. 32 F. Kong and R. P. Singh, J. Food Sci., 2010, 75, E627–E635. 33 S. Blanquet, E. Zeijdner, E. Beyssac, J.-P. Meunier, S. Denis, R. Havenaar and M. Alric, Pharmacol. Res., 2004, 21, 585–91. 34 C. Mitea, R. Havenaar, J. Wouter Drijfhout, L. Edens, L. Dekking and F. Koning, Gut, 2008, 57, 25–32. 35 M. Wickham, Plant Bioscience Ltd, Norwich Research Institute, World Intellectual Property Organization, WO 2007/010238. 36 S. Souliman, S. Blanquet, E. Beyssac and J. M. A. Cardot, Eur. J. Pharm. Sci., 2006, 27, 72–79. 37 J. Y. Yoo and X. D. Chen, Int. J. Food Eng., 2006, 2(4), article 4. 38 M. L. Jalabert-Malbos, A. Mishellany-Dutour, A. Woda and M. A. Peyron, Food Qual. Preference, 2007, 18, 803–812. 39 N. B. Roberts, Aliment. Pharmacol. Ther., 2006, 24, 2–9. 40 H. P. Zhu, Z. Y. Zhou, R. Y. Yang and A. B. Yu, Chem. Eng. Sci., 2007, 62. 41 L. D. Landau and E. M. Lifshitz, Fluid Mechanics, Pergamon, London, 1959. 42 D. J. Tritton, Physical Fluid Dynamics, Clarendon Press, Oxford, 2nd edn, 1988, pp. 52–60.

This journal is ª The Royal Society of Chemistry 2011

Food & Function

View Online

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 183

PAPER

www.rsc.org/foodfunction

Metabolic fate of orally administered enzymatically synthesized glycogen in rats

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

Takashi Furuyashiki,*a Hiroki Takata,a Iwao Kojima,a Takashi Kuriki,a Itsuko Fukudab and Hitoshi Ashidabc Received 26th November 2010, Accepted 27th December 2010 DOI: 10.1039/c0fo00171f We developed a new process for enzymatically synthesized glycogen (ESG), which is equivalent in physicochemical properties to natural-source glycogen (NSG) except its resistant property to degradation by a-amylase in vitro. In this study the metabolic fates of orally administered ESG in rats were investigated by a single oral administration test and a 2 week ingestion test. The glycemic index of ESG was 79. After the 2 week ingestion of ESG, the cecal content and production of short chain fatty acids were significantly increased, the pH value of cecal content was lowered, and the counts of Bifidobacterium and Lactobacillus in feces were significantly increased. Additionally, plasma levels of triacylglycerol and total cholesterol were significantly reduced by ESG. In contrast, NSG did not affect these parameters at all. The results collectively suggest that around 20% of orally administered ESG was transferred to the cecum in the form of polymer and assimilated into short chain fatty acids by microbiota and the polymer affected lipid metabolism.

Introduction Glycogen, which is a highly branched a-D-glucan containing a1,4 and a-1,6 linkages, is a major storage form of glucose found in many organisms ranging from bacteria to primates. Many researchers have studied the metabolism and intracellular functions of glycogen in the liver and muscles. However, except for some reports on the immunomodulatory effects of glycogen,1–3 few studies have investigated the effects of orally administered glycogen. Among common foods, shellfish and animal livers are known to be rich in glycogen. In addition, phytoglycogen, a glycogen-like polysaccharide, has also been isolated from several higher plants.4 Our group recently developed an in vitro method to synthesize glycogen from starch using isoamylase (EC 3.2.1.68), branching enzyme (EC 2.4.1.18), and amylomaltase (EC 2.4.1.25).5 The enzymatically synthesized glycogen (ESG) is equivalent to natural-source glycogen (NSG) in structural parameters, physicochemical properties, and molecular shape.5,6 In an in vitro test, a Institute of Health Sciences, Ezaki Glico Co., Ltd., 4-6-5, Utajima, Nishiyodogawa-ku, Osaka, Japan 555-8502. E-mail: furuyashiki-takashi@ glico.co.jp; [email protected]; [email protected]; [email protected] b Research Center for Food Safety and Security, Graduate School of Agricultural Science, Kobe University, 1-1 Rokkodai-cho, Nada-ku, Kobe, Hyogo, Japan 657-8501. E-mail: [email protected]; [email protected] c Department of Agrobioscience, Graduate School of Agricultural Science, Kobe University, 1-1 Rokkodai-cho, Nada-ku, Kobe, Hyogo, Japan 6578501

This journal is ª The Royal Society of Chemistry 2011

treatment of ESGs with excess a-amylase resulted in the formation of high molecular weight resistant fractions (>1000 kDa) in a roughly 40% yield even after prolonged reaction. However, the content and size of the resistant fractions of NSGs were found to vary: 1 of 6 NSGs possessed high molecular weight resistant fractions, as do ESGs, but the others showed only small resistant fractions (<10 kDa) such as branched oligosaccharides.7 Evaluation of ESG by the AOAC method 2002-02 revealed that it contains about 20% of dietary fiber content.7 Dietary fiber is defined as carbohydrate polymers that are neither digested nor absorbed in the small intestine, and which have beneficial physiological effects in humans. The benefits of dietary fiber ingestion are well studied and many effects have been clarified: some soluble dietary fibers reduce plasma cholesterol levels, especially LDL cholesterol, while insoluble dietary fibers are known to increase the bulk of feces.8,9 Dietary fibers such as oligofructose, inulin, and resistant starch have been reported to function as prebiotics, which increase intestinal bifidobacteria in animals and humans.10–12 Moreover, it has been suggested that appropriate consumption of dietary fiber reduces the risk of some diseases, including cardiovascular diseases, colorectal cancer, and diabetes mellitus.13–15 In this study, the metabolic fate of orally administered ESG and the effects of ESG ingestion on intestinal fermentation and lipid metabolism were investigated in rats. In order to elucidate the role of the molecular size of digestion-resistant fractions, the effect of ingestion of NSG from mussel, which had the smallest resistant fractions among the 6 types of NSG tested previously in vitro, were also studied. Food Funct., 2011, 2, 183–189 | 183

View Online

Table 2 Composition of the experimental diets (g per 100 g)

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

Materials and methods Chemicals

Diet group

ESG was synthesized in our laboratory using previously described methods.5 NSG from mussel was obtained from Laboratories Serobiologique (France). The molecular weight and in vitro digestibility of ESG and NSG reported previously are summarized in Table 1. Standards of acetic, propionic, and butyric acids for gas/liquid chromatography (GLC) were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). a-Amylase, isoamylase, and glucoamylase were obtained from Sigma Chemical Co. (St. Louis, MO, USA), Hayashibara Biochemical Laboratories (Okayama, Japan), and TOYOBO Co. Ltd. (Osaka, Japan), respectively. All other chemicals were analytical grade and were obtained from Wako Pure Chemical Industries.

Control

High ESG

Low ESG

63 — 20 5 5 5 2 377

— 63 20 5 5 5 2 377

47.2 15.8 20 5 5 5 2 377

Animal experiments All animal experiments were approved by the Institutional Animal Care and Use Committee of Ezaki Glico Co., Ltd., and performed in accordance with Guidelines for Proper Conduct of Animal Experiments (Science Council of Japan). Six-week-old male Sprague Dawley (SD) rats were purchased from Japan SLC, Inc. (Shizuoka, Japan) and provided with commercially available standard chow and tap water in the same housing for 1 week to allow acclimatization to the environment before starting the experiments. All animal experiments were performed in a temperature-controlled room (23  1  C) with a 12 h light and 12 h dark cycle. Experiment 1: for the single oral administration test, 14 rats were divided into 2 groups of 7 rats each with approximately equal body weights. After the rats were fasted for 18 h, glucose or ESG were administered to the rats at a dosage of 2 g per kg body weight by gavage. Blood samples were collected from the tail vein before and 10, 20, 30, and 60 min after the administration of glucose or ESG; these samples were centrifuged (900  g, 5 min), and plasma samples were obtained for the measurement of blood glucose and insulin levels. Plasma glucose and insulin levels were measured using commercial kits purchased from Wako and Shibayagi Co. Ltd. (Gunma, Japan), respectively. Experiment 2: for the 2 week ingestion test, 21 rats were divided into 3 groups of 7 rats each with approximately equal average body weights. The rats were housed in plastic cages and fed the control, high, or low ESG diets as shown in Table 2 for 2 weeks. During the feeding period, body weight and food intake were measured every 2–3 days. A few fresh fecal pellets excreted Table 1 Comparison of initial and a-amylase digest’s Mw and dietary fiber content between ESG and NSGa Mw of 24 h a-amylase digests (%) Initial Mw ESG NSG from musselb a

>10 kDa

7000 38.2 kDa 5100 N.D. kDa

1–10 kDa

<1 kDa

Dietary fiber content (%)

N.D.*

61.8

22.1

43.3

56.6

<0.2

N.D.: Not detected. b Data from ref. 7.

184 | Food Funct., 2011, 2, 183–189

a-Corn starch ESG Casein Cellulose Corn oil Mineral mixa Vitamin mixa Calorie (kcal per 100 g)

a Mineral mix and vitamin mix were the AIN93 composition obtained from Oriental Yeast Co., Ltd. (Tokyo, Japan).

on day 10 were used for analyzing fecal microbiota and all feces excreted on days 11 and 12 were collected to determine a-glucan content. At the end of the 2 week feeding, the rats were euthanized under anesthesia without fasting; subsequently, their livers were removed and weighed, and the epididymal fat and cecal contents were collected. Experiment 3: to compared ESG and NSG, we substituted NSG from mussel for ESG in the high ESG group diet (Table 2). Twenty one rats were divided into 3 groups of 7 rats each with approximately equal average body weights, then rats were fed control, high ESG or high NSG diets for 2 weeks under the same conditions as Experiment 2. Experiment 4: to evaluate the effect of ESG on plasma lipids, 14 rats were divided into 2 groups of 7 rats. The rats were housed in plastic cages and fed with the control or high ESG diets as shown in Table 2 for 2 weeks. After 6 h of fasting, rats were euthanized under anesthesia, blood samples were collected from the heart, and plasma concentrations of triacylglycerol, total cholesterol, HDL cholesterol, and non-esterified fatty acids (NEFA) were measured using the relevant commercial kits purchased from Wako.

Glucose and a-glucan analyses The fecal samples and cecal contents were lyophilized and crushed, and 100–200 mg of these samples were dissolved in phosphate-buffered saline (PBS) and homogenized. The homogenate was centrifuged (900  g, 10 min), and the glucose concentration in the supernatant was determined. To determine the a-glucan concentration in terms of glucose residues, a 200 ml aliquot of the supernatant was incubated with a-amylase (200 mU) and isoamylase (30 U) for 2 h at 37  C in 0.2 M acetic buffer (pH 5.5), and subsequently with glucoamylase (20 U) for 16 h at 37  C. It has been shown that successive treatment by 3 types of enzymes converts glycogen to glucose quantitatively.7 The glucose concentration in the reaction mixture was determined and the a-glucan concentration was calculated by subtracting the glucose concentration of the untreated supernatant from that of the reaction mixture. The excretion rate of a-glucan in the feces was estimated by the following calculation: (total amount of daily feces)  (fecal concentration of a-glucan)/(total daily intake of a-glucan). This journal is ª The Royal Society of Chemistry 2011

View Online

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

Short-chain fatty acid (SCFA) analysis For measurement of the cecal concentration of SCFAs, samples were prepared for GLC analysis according to the method of Chen and Lifschitz16 with slight modification. Briefly, 1 g of cecal content was homogenized in 5 ml of distilled deionized water, and the pH of this solution was measured. The homogenates were acidified to pH 2.0 with 2 N H2SO4 and centrifuged (6000  g, 15 min, 4  C); the supernatant was filtered through a microconcentrator (Vivascience AG, Hannover, Germany) with a 5000 Da molecular-mass cut-off membrane by centrifugation (8000  g, 1 h, 4  C). To measure the SCFA concentration, 2 ml of the filtrate was injected into a GLC (Shimadzu GC-2014, Shimadzu Co., Kyoto, Japan) equipped with a flame ionization detector and a Thermon-3000 glass column packed with Chromosorb W (Shimadzu Co., Kyoto, Japan). Nitrogen was used as the carrier gas at a flow rate of 50 ml min1. The analysis conditions were as follows: the injection port and the detector were maintained at 250  C, temperature of the column oven was maintained at 130  C for 13 min, and then at 240  C for 6 min to remove other organic compounds. Measurement of fecal microbiota To assess the effect of ESG on fecal microbiota, 1 g of fresh feces collected on day 10 was diluted 10-fold with PBS containing 0.1% (w/v) purified agar and 0.05% (w/v) cysteine-HCl. Then, Bifidobacterium, Bacteroidaceae, Enterobacteriaceae, Streptococcus, Staphylococcus, and Lactobacillus were cultured in their respective selective media and the colonies were counted, as described by Ikeda et al.17 Statistical analysis All data are presented as the mean  SD. The relationships between pairs of data sets; i.e., plasma glucose after the single oral administration test and the effects of ESG ingestion on plasma lipids, were analyzed by Student’s t-test. The other effects of ESG ingestion were evaluated by one-way ANOVA and subsequently by a post-hoc Fisher’s protected least significant difference test, using Stat View software (Abacus Concepts, Berkeley, CA). p values of <0.05 were considered to be statistically significant.

Fig. 1 Plasma glucose and insulin concentration in glucose-treated and ESG-treated rats. Rats were administered glucose (control) or ESG at a dosage of 2 g per kg body weight. Before administration and then at 10, 20, 30, and 60 min after, blood samples were collected and centrifuged to obtain plasma. Concentrations of glucose (A) and insulin (C) were determined. Closed circles and squares indicate control and ESG-treated rats, respectively. The glycemic index was calculated and is shown in B. Values are mean  S.D.; n ¼ 7. Asterisks indicate significant difference from the control group: *p < 0.05.

was no significant difference between the control and ESGtreated groups (Fig. 1C). The AUC of insulin level was also not changed.

Effects of 2 week ingestion of ESG

Results Single oral administration test ESG or glucose was administered to rats at a dosage of 2 g per kg body weight, and plasma glucose and insulin levels were determined at the indicated intervals (Fig. 1). Although plasma glucose levels increased immediately after administration in both groups, glucose levels in the ESG-treated group were significantly lower than those in the control group at 20 and 30 min after administration (p ¼ 0.043 and 0.031, respectively) as shown in Fig. 1A. The glycemic index was calculated from the area under the curve (AUC) of plasma glucose level. The glycemic index of ESG was 79.0 and significantly lower than that of glucose (p ¼ 0.046) (Fig. 1B). The changes in the plasma insulin level were similar to those in the plasma glucose level, but there This journal is ª The Royal Society of Chemistry 2011

As shown in Table 3, after the 2 week ingestion test, the body weight gain in the high ESG group was significantly lower than that in the control group (p ¼ 0.043). Food intake in the high ESG group was slightly lower than that in the control group, but the difference was not statistically significant. The epididymal fat weight of the high ESG group was significantly reduced to 81.6% of that of the control group (p ¼ 0.031). However, there was no significant change in the liver weight in any group (Table 3). The quantity of cecal content increased significantly in the high ESG group compared with the control (p < 0.0001) (Fig. 2A); the cecal content of the low ESG group was 127% of that of the control group, but this change was not statistically significant. The pH of cecal content in both high ESG (7.27) and low ESG groups (7.61) was significantly lower (p < 0.0001 and p ¼ 0.0008, respectively) than that in the control group (8.14) (Fig. 2B). Food Funct., 2011, 2, 183–189 | 185

View Online

Table 3 Effects of ESG on body weight gain, food intake, and organ weightsa,b Diet group

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

Body weight gain (g) Food intake (g day1/7 rats) Organ weight (% of body weight) Liver Epididymal fat

Control

High ESG

Low ESG

95.4  8.4b 109  10

85.1  9.6a 103  12

96.7  8.5b 111  9

4.06  0.38 1.41  0.25b

4.12  0.25 1.15  0.17a

4.20  0.38 1.42  0.20b

a Values are mean  S D; n ¼ 7. b The means in each row with different superscript letters are significantly different (p < 0.05).

Fig. 2 Weight and pH value of cecal content were altered by ESG ingestion. Rats were fed high or low ESG diets for 2 weeks. The cecal content was weighed (A) and pH (B) measured, as described in the materials and methods section. Values are mean  S.D.; n ¼ 7. Bars with different letters are significantly different from each other (p < 0.05).

It is recognized that changes in fermentation often result in increases in short-chain fatty acids (SCFAs). To clarify this point, the concentrations of acetate, propionate, and butyrate in the cecal contents were determined by GLC analysis (Fig. 3). In the high ESG group, the amounts of acetate, propionate, and butyrate were significantly increased to 269% (p ¼ 0.0002), 516% (p < 0.0001), and 766% (p ¼ 0.0006), respectively, of those in the control group, and the total amount of SCFAs was 350% (p < 0.0001) of that in the control group. Although the increases in acetate, propionate, and butyrate levels in the low ESG group were not significantly increased compared to those in the control group, the total amount of SCFAs was significantly (p ¼ 0.031) increased to 186% of the control group. All the above results strongly suggested that indigestible fractions of ESG were transferred to the cecum and assimilated by enteric bacteria. To examine this possibility, the concentrations of a-glucan and glucose in the cecal content and fecal samples were measured. As shown in Table 5, the concentration of a-glucan in the cecal content was significantly increased (more than 10-fold) in the high ESG group as compared to that in the control group (p ¼ 0.0093), while the increase in the low ESG group (more than 2.6-fold) was not significant (p ¼ 0.62) when compared to that in the control group. However, glucose concentrations in the cecal content of the high ESG (9.1 mg per g content) and low ESG groups (9.6 mg per g content) were significantly higher (p ¼ 0.030 and p ¼ 0.021, respectively) than that of the control group (3.6 mg per g content). The concentrations of a-glucan and glucose in the feces of the high ESG group were significantly increased to 878% and 244%, respectively, as compared to those in the control group. The amounts of excreted a-glucan in the feces of the control, high ESG and low ESG groups were estimated to be 0.06%, 0.48% and 0.13% of the carbohydrate intake, respectively.

Since these changes suggested modification of the fermentation in the cecum by ESG ingestion, the major fecal microbes were analyzed (Table 4). Although there were no changes in the counts of Bacteroidaceae, Enterobacteriaceae, Streptococcus or Staphylococcus, the viable counts of Bifidobacterium and Lactbacillus in the high ESG group were significantly increased compared to the control group (p < 0.0001 and p ¼ 0.0065).

Table 4 Effects of ESG on fecal populations of Bifidobacterium, Bacteroidaceae, Enterobacteriaceae, Streptococcus, Staphylococcus, and Lactobacillusa,b Diet group Control

Bifidobacterium Bacteroidaceae Enterobacteriaceae Streptococcus Staphylococcus Lactobacillus

High ESG

log10 per g wet feces 10.7  0.25b 7.1  0.66a 9.5  0.48 9.7  0.52 6.8  0.66 6.4  0.43 7.4  0.71 6.7  0.57 6.0  0.44 4.4  0.92 a 9.1  0.45b 7.6  0.43

Low ESG 7.8  9.5  6.4  7.1  5.9  8.4 

1.30a 0.21 0.43 0.45 0.60 0.43a

a Values are mean  S D; n ¼ 7. b The means in each row with different superscript letters are significantly different (p < 0.05).

186 | Food Funct., 2011, 2, 183–189

Fig. 3 The amounts of cecal SCFAs were increased by ESG ingestion. Rats were fed high or low ESG diets for 2 weeks. The amounts of the SCFAs, acetate, propionate, and butyrate in the cecal content were measured with GLC as described in the materials and methods section. The total SCFA amount is the sum of the amounts of these 3 acids. Values are mean  S.D.; n ¼ 7. Bars with different letters are significantly different from each other (p < 0.05).

This journal is ª The Royal Society of Chemistry 2011

View Online

Table 5 a-Glucan and glucose concentrations in cecal content and fecesa,b

Table 6 Effects of ESG and NSG on SCFA production, a-glucan concentration in the cecum, and epididymal fat weighta,b

Diet group Control

Diet group High ESG

Low ESG

a-Glucan Glucose

mg per g cecal content 8.0  7.8b 0.77  0.50a 3.6  2.4a 9.1  5.0b

2.0  1.9a 9.6  5.7b

a-Glucan Glucose

mg per g feces 2.7  1.7a 3.6  3.0a

7.2  2.5a 2.8  2.1a

23.7  12.6b 8.8  1.0b

Values are mean  S D; n ¼ 7. b The means in each row with different superscript letters are significantly different (p < 0.05).

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

a

Comparison of ESG and NSG from mussel As summarized in Table 1, an in vitro digestion test revealed that the molecular size of the resistant fractions produced by aamylase degradation of NSG from mussel was much smaller than that from ESG. Additionally, NSG from mussel was degraded most easily by a-amylase in 6 types of NSG tested in the previous in vitro study.7 To investigate the participation of the molecular size of the resistant fractions in the fiber-like effects, we substituted NSG for ESG in the high ESG group (Table 2), and rats were fed control, high ESG or high NSG diets for 2 weeks under the same conditions as previously. After the 2 week feeding, increased amount and reduced pH value of the cecal content of the ESG group were again observed, but the values for the NSG group were similar to those of the control group (Fig. 4A, B). Additionally, SCFA production, a-glucan concentration in the cecum, and epididymal fat weight were not altered in the NSG group as compared to the corresponding values in the control group (Table 6). Plasma lipid profiles Finally, the effects of ESG on plasma lipids profile were evaluated. As shown in Table 7, plasma triacylglycerol and total

Cecal SCFA production (mmol per cecum) Acetate Propionate Butyrate Cecal a-glucan (mg per g cecal content) Epididymal fat (g)

Control

ESG

NSG

48.2  24.1a 16.0  6.2a 10.1  4.6a 0.54  0.16a

230.1  139.2b 80.4  43.6b 62.0  29.0b 5.42  7.12b

38.1  11.4a 14.5  3.5a 14.5  3.5a 0.28  0.20a

1.6  0.2a

1.1  0.1b

1.6  0.3a

a Values are mean  S D; n ¼ 7. b The means in each row with different superscript letters are significantly different (p < 0.05).

Table 7 Effect of glycogen on blood lipid levelsa,b Diet group

Triacylglycerol (mg dL1) Cholesterol Total (mg dL1) HDL (mg dL1) HDL/total ratio (%) NEFA (mEq L1)

Control

High ESG

86.2  15.7

51.8  11.7**

62.2  5.5 42.1  3.1 67.8  3.0 0.68  0.19

47.2  34.2  72.5  0.53 

4.2** 3.3** 2.8* 0.12

a Values are mean  S D; n ¼ 7. b Mean values were significantly different from those of control group by Student’s t-test (* p < 0.05, ** p < 0.01).

cholesterol concentrations in the high ESG group were significantly reduced (p ¼ 0.008 and 0.0007, respectively) to 51.8 and 47.2 mg dL1 as compared to the control group (86.2 and 62.2 mg dL1), after a 2 week ingestion of experimental diets. Although the concentration of plasma HDL-cholesterol was also significantly (p ¼ 0.002) reduced in the high ESG group, the ratio of HDL/total cholesterol in the high ESG group was significantly higher than that in the control group (p ¼ 0.022). The concentration of NEFA was not significantly reduced by ESG.

Discussion

Fig. 4 Weight and pH value of cecal content were altered by ESG but not NSG ingestion. Rats were fed ESG or NSG diets for 2 weeks. The cecal content was weighed (A) and pH was measured (B), as described in the materials and methods section. Values are mean  S.D.; n ¼ 7. Bars with different letters are significantly different from each other (p < 0.05).

This journal is ª The Royal Society of Chemistry 2011

In the present study, the metabolic fate of orally administered ESG in rats was investigated. The glycemic index of ESG was found to be 79, which was consistent with the dietary fiber content (Table 1) determined by the AOAC method.7 In vivo, in addition to pancreatic a-amylase, maltase, isomaltase and glucoamylase acting in the intestinal surface18 can work to degrade glycogen, and we concluded that the combination of these digestive enzymes degraded approximately 80% of the glucosyl moieties of ESG to glucose. The molecular character of the remaining 20% of ESG remains to be studied. In vitro study using pancreatic a-amylase revealed that around 40% of ESG remained as a resistant fraction (a-macrodextrin) with a high Food Funct., 2011, 2, 183–189 | 187

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

View Online

molecular weight (>1000 kDa) (Table 1).7 We hypothesized that the in vivo remnant from ESG has a similar structure to the in vitro a-macrodextrin, a highly branched polymer. Various changes, such as the quantity and pH of cecum contents and the microbiota in feces, strongly indicated that the polymers were transferred to the cecum and assimilated to SCFAs by microbiota, especially Bifidobacterium and Lactobacillus. Only a negligible amount (<0.5% of ingestion) was excreted in feces. We also carried out oral administration tests with NSG from mussel, which displayed the smallest molecular of a-amylase resistant fractions in an in vitro study.7 The quantity and pH of cecal contents were not altered after the rats ingested a diet containing 63% NSG from mussel for 2 weeks; and the amounts of a-glucan in the cecum was not increased (Table 6). Our previous study showed that the physicochemical properties of ESGs were equivalent to NSGs, but the fine structures of ESGs and NSGs were slightly different. In short, in the ESG molecule, the a-1,6-branch linkages were more regularly distributed than those in the NSG molecules.7 Consequently, most of spans between the branches in ESG molecules should be 1 or 2 glucose units, which can not be attacked by a-amylase.7 On the other hand, the spans in NSG molecules should be varied (0–4 units), and some parts with relatively long spans could be degraded. Thus, the difference should be related to the different resistant properties of ESGs and NSGs. However, the in vitro study showed that at least 1 out of 6 types of NSG possessed high molecular weight resistant fractions.7 It is possible that such NSGs having high resistance to a-amylase would be similarly metabolized in gut with ESG and affect lipid metabolism. We surmise that the molecular size of the resistant fractions of NSGs could be affected by the physiological conditions of organisms, such as their nutritional status; therefore, studies of the effects of ingestion of NSG with high molecular weight resistant fractions should be of great interest. In this study, it was demonstrated that ESG ingestion affected lipid metabolism by decreasing plasma triacylglycerol, total cholesterol, and body fat accumulation, and increasing the HDL/ total cholesterol ratio. These effects of ESG appeared to be similar to those of dietary fiber. However, the effects of fiber are known to be varied. Soluble fibers, pectin, guar gum, oat gum, and psyllium, reduced cholesterol concentrations in serum and liver, but did not change triacylglycerol concentration in cholesterol-fed SD rats.19 Epidemiological studies and dietary intervention studies have revealed that appropriate soluble dietary fiber lowers total and LDL cholesterol concentration without affecting HDL and triacylglycerol.8,13,20,21 However, a study in rodents revealed that resistant starch decreases both total serum cholesterol and triacylglycerol, with reduction of epididymal fat pad weight.22 Potato pulp, which is rich in resistant starch, also lowers serum cholesterol and triacylglycerol levels.23 Inulin and inulin-type fructans reduce plasma cholesterol as well as triacylglycerol levels through the downregulation of hepatic lipogenesis.24 In addition, Keenan et al.25 reported that consumption of a large amount of resistant starch reduced abdominal fat accumulation in rats. The mechanism underlying these effects of dietary fibers on lipid metabolism may be at least partly related to their viscosity and/or colonic fermentation. Thus, differences in colonic fermentation should contribute to 188 | Food Funct., 2011, 2, 183–189

different effects on lipid metabolism. Among the natural watersoluble fibers, resistant starch, inulin and inulin-type fructans have been recognized as major prebiotics,10–12 which are defined as nondigestible food ingredients that beneficially affect the host by selectively stimulating the growth and/or the activity of one or a few bacteria such as Bifidobacterium in the colon.26 In the present study, it was suggested that ESG ingestion increased intestinal Bifidobacterium and Lactobacillus. The effects of ESG on lipid metabolism and on the microbiota appeared to be similar to those of resistant starch, inulin and inulin-type fructans. Most studies evaluating the effects of dietary fiber on lipid metabolism have used diets containing 5%–10% dietary fiber. In this study, we used 63% and 17.8% ESG in the diet. Assuming that 20% of ESG could have a dietary-fiber like effect, these amounts could correspond to 12% and 3.5%, respectively, and were thus comparable with the amounts of dietary fiber in the previous studies. Interestingly, NSG from mussel did not affect lipid metabolism at all after a 2 week ingestion (data not shown). Thus, it was considered that the high molecular weight resistant fractions of ESG critically contribute to the observed effects on lipid metabolism. This study demonstrated that ESG ingestion greatly increased SCFA production in the cecum. Acetate, a principal SCFA in the colon, has been reported to have favorable effects on energy metabolism.27–29 Acetate serves as a lipogenic substrate when incorporated into hepatocytes, whereas propionate is a competitive inhibitor of the transport of acetate into hepatocytes.30 With respect to cholesterol metabolism, propionate inhibits cholesterol synthesis, while acetate is the primary substrate for cholesterol synthesis.31 Thus, the increased ratio of propionate/ acetate in the gut is likely to reduce the plasma triacylglycerol and cholesterol concentrations. It was reported that the molar proportion of cecal SCFA concentrations in rats fed a 65% cornstarch diet for 15 days is in the order of acetate > propionate > butyrate with an approximate molar ratio of 65 : 25 : 10.32 In this study, although the relative cecal concentrations of acetate, propionate, and butyrate in the control group were about 70 : 20 : 10, those in the high ESG group and low ESG group were about 48 : 26 : 26 and 60 : 18 : 22, respectively. Hence, we suggest that not only the increased SCFA quantities, but also the change in the ratios of individual SCFAs contribute to the effects on lipid metabolism. A recent report revealed that SCFAs stimulate leptin production in adipocytes through the G protein-coupled receptor GPR41, and propionate administration increases plasma leptin level in mice.33 Leptin is a well-known secretory hormone in adipose tissue, with anti-obesity properties; it is known to be related to the negative control of energy intake and the positive control of energy consumption.34 Although total SCFA production in the cecum was increased by more than 3fold after ESG ingestion, the food intake was not affected in this study. In contrast, in our following study, plasma leptin concentration decreased slightly after ESG ingestion (unpublished data). This discrepancy can be explained on the basis of the reduction in the weight of subcutaneous adipose tissue that secretes leptin.34 Otherwise, acetate and propionate are reported to stimulate adipogenesis in adipocyte-like cell, 3T3-L1 cells.35 Further studies are warranted to clarify the mechanism of the anti-obesity effect of ESG. This journal is ª The Royal Society of Chemistry 2011

View Online

Abbreviations

Downloaded on 12 April 2011 Published on 26 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00171F

ESG NSG AUC GLC SCFA NEFA

Enzymatically synthesized glycogen Natural-source glycogen Area under the curve Gas/liquid chromatography Short-chain fatty acid Non-esterified fatty acids

Acknowledgements This work was supported in part by Special Coordination Funds for Promoting Science and Technology, Creation of Innovation Centers for Advanced Interdisciplinary Research Areas (Innovative Bioproduction Kobe), MEXT, Japan.

References 1 K. Ryoyama, Y. Kidachi, H. Yamaguchi, H. Kajiura and H. Takata, Anti-tumor activity of an enzymatically synthesized alpha-1,6 branched alpha-1,4-glucan, glycogen, Biosci., Biotechnol., Biochem., 2004, 68, 2332–2340. 2 R. Kakutani, Y. Adachi, H. Kajiura, H. Takata, T. Kuriki and N. Ohno, Relationship between structure and immunostimulating activity of enzymatically synthesized glycogen, Carbohydr. Res., 2007, 342, 2371–2379. 3 Y. Takaya, H. Uchisawa, H. Ichinohe, J. Sasaki, K. Ishida and H. Matsue, Antitumor glycogen from scallops and the interrelationship of structure and antitumor activity, J. Mar. Biotechnol., 1998, 6, 208–213. 4 D. J. Manners, Recent developments in our understanding of glycogen structure, Carbohydr. Polym., 1991, 16, 37–82. 5 H. Kajiura, R. Kakutani, T. Akiyama, H. Takata and T. Kuriki, A novel enzymatic process for glycogen production, Biocatal. Biotransform., 2008, 26, 133–140. 6 H. Kajiura, H. Takata, T. Kuriki and S. Kitamura, Structure and solution properties of enzymatically synthesized glycogen, Carbohydr. Res., 2010, 345, 817–824. 7 H. Takata, H. Kajiura, T. Furuyashiki, R. Kakutani and T. Kuriki, Fine structural properties of natural and synthetic glycogens, Carbohydr. Res., 2009, 344, 654–659. 8 E. Theuwissen and R. P. Mensink, Water-soluble dietary fibers and cardiovascular disease, Physiol. Behav., 2008, 94, 285–292. 9 D. P. Burkitt, A. R. Walker and N. S. Painter, Effect of dietary fibre on stools and the transit-times, and its role in the causation of disease, Lancet, 1972, 2, 1408–1412. 10 J. M. Campbell, G. C. Fahey Jr and B. W. Wolf, Selected indigestible oligosaccharides affect large bowel mass, cecal and fecal short-chain fatty acids, pH and microflora in rats, J. Nutr., 1997, 127, 130–136. 11 G. R. Gibson, E. R. Beatty, X. Wang and J. H. Cummings, Selective stimulation of bifidobacteria in the human colon by oligofructose and inulin, Gastroenterology, 1995, 108, 975–982. 12 O. Murphy, Non-polyol low-digestible carbohydrates: food applications and functional benefits, Br. J. Nutr., 2001, 85, 47–53. 13 J. Mann, Dietary carbohydrate: relationship to cardiovascular disease and disorders of carbohydrate metabolism, Eur. J. Clin. Nutr., 2007, 61, 100–111. 14 T. J. Key and E. A. Spencer, Carbohydrates and cancer: an overview of the epidemiological evidence, Eur. J. Clin. Nutr., 2007, 61, 112–121. 15 M. O. Weickert and A. F. Pfeiffer, Metabolic effects of dietary fiber consumption and prevention of diabetes, J. Nutr., 2008, 138, 439–442.

This journal is ª The Royal Society of Chemistry 2011

16 H. M. Chen and C. H. Lifschitz, Preparation of fecal samples for assay of volatile fatty acids by gas-liquid chromatography and highperformance liquid chromatography, Clin. Chem., 1989, 35, 74–76. 17 N. Ikeda, Y. Saito, J. Shimizu, A. Ochi, J. Mizutani and J. Watabe, Variations in concentrations of bacterial metabolites, enzyme activities, moisture, pH and bacterial composition between and within individuals in faeces of seven healthy adults, J. Appl. Bacteriol., 1994, 77, 185–194. 18 G. M. Gray, Starch digestion and absorption in nonruminants, J. Nutr., 1992, 122, 172–177. 19 J. W. Anderson, A. E. Jones and S. Riddell-Mason, Ten different dietary fibers have significantly different effects on serum and liver lipids of cholesterol-fed rats, J. Nutr., 1994, 124, 78–83. 20 J. W. Anderson and T. J. Hanna, Impact of nondigestible carbohydrates on serum lipoproteins and risk for cardiovascular disease, J. Nutr., 1999, 129, 1457S–1466. 21 A. T. Erkkila and A. H. Lichtenstein, Fiber and cardiovascular disease risk: how strong is the evidence?, J. Cardiovasc. Nurs., 2006, 21, 3–8. 22 E. A. de Deckere, W. J. Kloots and J. M. van Amelsvoort, Resistant starch decreases serum total cholesterol and triacylglycerol concentrations in rats, J. Nutr., 1993, 123, 2142–2151. 23 N. Hashimoto, Y. Ito, K. H. Han, K. Shimada, M. Sekikawa, D. L. Topping, A. R. Bird, T. Noda, H. Chiji and M. Fukushima, Potato pulps lowered the serum cholesterol and triglyceride levels in rats, J. Nutr. Sci. Vitaminol., 2006, 52, 445–450. 24 M. Beylot, Effects of inulin-type fructans on lipid metabolism in man and in animal models, Br. J. Nutr., 2005, 93, 163–168. 25 M. J. Keenan, J. Zhou, K. L. McCutcheon, A. M. Raggio, H. G. Bateman, E. Todd, C. K. Jones, R. T. Tulley, S. Melton, R. J. Martin and M. Hegsted, Effects of resistant starch, a nondigestible fermentable fiber, on reducing body fat, Obesity, 2006, 14, 1523–1534. 26 G. R. Gibson and M. B. Roberfroid, Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics, J. Nutr., 1995, 125, 1401–1412. 27 H. Yamashita, K. Fujisawa, E. Ito, S. Idei, N. Kawaguchi, M. Kimoto, M. Hiemori and H. Tsuji, Improvement of obesity and glucose tolerance by acetate in Type 2 diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) rats, Biosci., Biotechnol., Biochem., 2007, 71, 1236–1243. 28 T. Fushimi, K. Tayama, M. Fukaya, K. Kitakoshi, N. Nakai, Y. Tsukamoto and Y. Sato, Acetic acid feeding enhances glycogen repletion in liver and skeletal muscle of rats, J. Nutr., 2001, 131, 1973–1977. 29 S. Sakakibara, T. Yamauchi, Y. Oshima, Y. Tsukamoto and T. Kadowaki, Acetic acid activates hepatic AMPK and reduces hyperglycemia in diabetic KK-A(y) mice, Biochem. Biophys. Res. Commun., 2006, 344, 597–604. 30 N. M. Delzenne and C. M. Williams, Prebiotics and lipid metabolism, Curr. Opin. Lipidol., 2002, 13, 61–67. 31 J. M. Wong, R. de Souza, C. W. Kendall, A. Emam and D. J. Jenkins, Colonic health: fermentation and short chain fatty acids, J. Clin. Gastroenterol., 2006, 40, 235–243. 32 T. Morita, S. Kasaoka, A. Ohhashi, M. Ikai, Y. Numasaki and S. Kiriyama, Resistant proteins alter cecal short-chain fatty acid profiles in rats fed high amylose cornstarch, J. Nutr., 1998, 128, 1156–1164. 33 Y. Xiong, N. Miyamoto, K. Shibata, M. A. Valasek, T. Motoike, R. M. Kedzierski and M. Yanagisawa, Short-chain fatty acids stimulate leptin production in adipocytes through the G proteincoupled receptor GPR41, Proc. Natl. Acad. Sci. U. S. A., 2004, 101, 1045–1050. 34 J. M. Friedman and J. L. Halaas, Leptin and the regulation of body weight in mammals, Nature, 1998, 395, 763–770. 35 Y. H. Hong, Y. Nishimura, D. Hishikawa, H. Tsuzuki, H. Miyahara, C. Gotoh, K. C. Choi, D. D. Feng, C. Chen, H. G. Lee, K. Katoh, S. G. Roh and S. Sasaki, Acetate and propionate short chain fatty acids stimulate adipogenesis via GPCR43, Endocrinology, 2005, 146, 5092–5099.

Food Funct., 2011, 2, 183–189 | 189

View Online

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 190

PAPER

www.rsc.org/foodfunction

Antioxidant and antihepatotoxic effect of Spirulina laxissima against carbon tetrachloride induced hepatotoxicity in rats

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

Gini C. Kuriakose†*a and Muraleedhara G. Kurup*b Received 5th November 2010, Accepted 10th January 2011 DOI: 10.1039/c0fo00163e The vast biodiversity of nature provides bioactive compounds that may be useful in the fight against chronic diseases. This study was designed to investigate the protective effects of the ethanol extract of Spirulina laxissima West (Pseudanabaenaceae) (EESL) against carbon tetrachloride (CCl4) induced hepatotoxicities in rats. Male albino rats of Sprague-Dawley strain were treated orally with the ethanol extract of S. laxissima (50, 100 mg kg1 body wt.) 1 h before each CCl4 administration. The ethanol extract of S. laxissima showed the maximum antioxidant property in vitro. There were statistically significant losses in the activities of antioxidant enzymes and an increase in TBARS and liver function marker enzymes in the serum of the CCl4-treated group compared with the control group. However, all the tested groups were able to counteract these effects. The antioxidant activity of the extracts might be attributable to its proton-donating ability, as evidenced by DPPH. In the present study, the decline in the level of antioxidant observed in CCl4-treated rats is a clear manifestation of excessive formation of radicals and activation of the lipid peroxidation system resulting in tissue damage. The significant increases in the concentration of antioxidant enzymes in tissues of animals treated with CCl4 + EESL indicate the antioxidant effect of EESL. This study suggests that EESL can protect the liver against CCl4-induced oxidative damage in rats, and the hepatoprotective effect might be correlated with its antioxidant and radical-scavenging effects.

Introduction Liver disease remains a serious health problem, and is caused by drugs, chemicals, and alcohol. The liver plays an essential role in metabolism of drugs and xenobiotics, and in maintaining biological equilibrium. The role played by this organ in the removal of substances from the portal circulation makes it the first in line to be subject to attack by foreign materials. Despite the tremendous strides in modern medicine, there is hardly any drug that stimulates liver function, offers protection to the liver from damage, or helps regeneration of hepatic cells.1 Natural drugs are frequently considered to be less toxic and free from side-effects than synthetic drugs. The search for crude drugs of plant origin with antioxidant activity has become a central focus for study of hepatoprotection today. Focusing our attention on natural and bioavailable sources of antioxidants, we undertook to investigate the antioxidant properties of the cyanophyte Spirulina laxissima West (Pseudanabaenaceae), a unicellular blue-green alga and that is consumed as a nutrient-dense food source and for its health-enhancing

a Department of Applied Biochemistry, Mahatma Gandhi University, Kottayam, Kerala, India. E-mail: [email protected] b Department of Biochemistry, Kerala University, Palayam Campus, Thiruvananthapuram, 695035, Kerala, India. E-mail: [email protected]; Tel: +91 471 2443456 † Present address: Department of Biochemistry, Indian Institute of Science, Bangalore, 560012, India.

190 | Food Funct., 2011, 2, 190–196

properties. Spirulina is an important source of the blue photosynthetic pigment phycocyanin (PC), which has been described as a strong antioxidant2 and anti-inflammatory3 natural compound, as evidenced by in vitro and in vivo studies on PC from the cyanophyte Spirulina platensis Geitler (Pseudanabaenaceae). PC is a water-soluble phycobiliprotein composed of a and h subunit polypeptides which associate into ah monomers4 in turn, have a high affinity to assemble together to form (ah)3 trimers and finally (ah)6 hexamers. The a and h subunits are constituted of a protein backbone to which linear tetrapyrrole chromophores are covalently bound.5 The chromophore, named phycocyanobilin, is similar in chemical structure to bilirubin, and like the latter acts as a powerful scavenger of reactive oxygen species.6 Carbon tetrachloride (CCl4), a potent hepatotoxic agent, is biotransformed to a trichloromethyl radical by the cytochrome P450 system in liver microsomes, and consequently causes lipid peroxidation of membranes that leads to liver injury.7 The present study was designed to evaluate the putative antioxidant action of ethanol extract of S. laxissima in an experimental model of CCl4-induced hepatotoxicity in albino rats.

Materials and methods Cyanobacteria The cyanobacterial strain Spirulina laxissima West (Family: Pseudanabaenaceae, Order: Oscillatoriales) procured from This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

View Online

NCCUBGA, IARI, New Delhi, India, was used for the experiments. A stock culture of the strain was maintained in our laboratory by using BG-11 medium.8 Cyanobacteria (50 ml) from a mid-log-phase growth culture was dispersed aseptically into cotton-plugged 1000 ml sterilized conical flasks. These were maintained at 25  2  C under 24 h light in an illuminated chamber at 2.5 kilolux.

recorded and % inhibition was calculated using the formula given below

Preparation of the extract of S. laxissima

Experimental design

Extraction from S. laxissima was carried out according to the procedure of Ferrigni.9 The cyanobacterial culture was grown up to the mid-log phase (10–14 days old) and then it was harvested by filtration, removing the medium through a coarse filter paper. Then the harvested cyanobacterial mass was washed twice with distilled water to completely remove the culture medium. Approximately 8–10 ml water was used for every 1 g culture harvested. The harvested S. laxissima was dried at 45–50  C for 48 h. The dried material took the form of granules, and this was macerated in liquid nitrogen in a pestle and mortar until a fine powder was obtained. The powdered material was mixed with petroleum ether and sonicated to break open the cell walls (25 g powder was mixed with 62.5 ml of solvent). Then it was placed on a shaker platform for 24 h for cold extraction. The filtrate was collected by centrifugation and the material obtained was repeatedly cold-extracted with solvents of increasing polarity (chloroform, ethanol, methanol and distilled water). The filtrate was evaporated by rotary evaporator at temperature 30–35  C and the mass obtained was dissolved in distilled water and employed for further experiments. The cold-extraction procedure was repeated four times. The extracts were preserved in vials at 20  C. A maximum dose of 100 mg of extract per kg body weight was used for treatment in experiments. Higher doses such as 250 mg per kg body weight showed almost the same results (data not given), so the lower concentration was selected for the study.

Hepatoprotective activity against the CCl4-induced chronic toxicity was determined by the method of Jose and Kuttan.11 The animals were divided into five groups of eight animals each and treated as follows: Group I – Vehicle Group II – CCl4 in paraffin oil (1 : 5 v/v, 1.5 ml kg1 body weight, i.p.) Group III – Ethanol extract (oral) of S. laxissima (50 mg kg1 body weight) + CCl4 in paraffin oil Group IV – Ethanol extract (oral) of S. laxissima (100 mg kg1 body weight) + CCl4 in paraffin oil Group V – Silymarin (oral) (100 mg kg1 body weight) + CCl4 in paraffin oil Animals in Groups II, III and IV and V were treated with CCl4 three times a week for five weeks (total 15 doses). Groups III, IV and V were treated orally with ethanol extract of S. laxissima (50, 100 mg) and silymarin respectively one hour before each CCl4 administration. The group treated with the vehicle was kept as normal. Group II, treated with CCl4 alone, was kept as an untreated control. Twenty-four hours after the last dose of CCl4, the animals were sacrificed by decapitation, and the blood was collected by cutting the jugular vein. A portion of the liver was used for histopathological analysis. The liver in each case was dissected out, the blood blotted off, and washed in cold saline. The serum was separated from the blood, and the serum and liver samples were stored at 80  C until analysis.

Experimental animals

Determination of the levels of liver function marker enzymes in serum

Male albino rats of the Sprague-Dawley strain weighing between 120–150 g were purchased from the Small Animal Breeding Section of Kerala Agriculture University, Mannuthy, Trichur, Kerala, India. The animals were maintained in an animal house with standard facilities having CPCEA approval (No. 732). The animals were housed in polypropylene cages and maintained at 25  2  C under 12 h light–dark cycle. They were fed with Amrut Laboratory Animal Feed, manufactured by Nav, Maharashtra Chakan Oil Mills Ltd, Pune. Water was provided ad libitum. The animals were acclimatized for one week under laboratory conditions. All the pharmacological experimental protocols were approved by the institutional animal ethics committee (Mahatma Gandhi University, Kerala, India). DPPH radical-scavenging activity Reduction of 2,20 -diphenyl-1-picrylhydrazyl radical (DPPH) to diphenylpicryl hydrazine by EESL was measured spectrophotometrically at 517 nm.10 L-Ascorbic acid was used as a reference compound, and data were expressed as the percent decrease in the absorbance compared to the control. The optical density was This journal is ª The Royal Society of Chemistry 2011

Inhibition of DPPH activity ¼ [(A  B)/A]  100% where A ¼ optical density of the blank and B ¼ optical density of the sample.

The level of alanine aminotransferase and aspartate aminotransferase,12 g-glutamyl transpeptidase13 and alkaline phosphatase14 were measured using a standard assay procedure. Preparation of liver supernates Prior to biochemical analysis, each liver sample (100 mg ml1 buffer) was homogenized in 50 mM phosphate buffer (pH 7.0); the homogenate was then centrifuged at 10 000 rpm for 15 min and the supernatant obtained was used for biochemical analysis. All liver parameters were expressed as activity per mg protein. The protein concentration in each fraction was determined by the method of Lowry15 using crystalline bovine serum albumin as a standard. Determination of lipid peroxidation The mean thiobarbituric acid reactive substances (TBARS) (mmol mg1 protein), a measure of lipid peroxidation, was assayed in the form of thiobarbituric acid reacting substances by Food Funct., 2011, 2, 190–196 | 191

View Online

the method of Nichans and Samuelson,16 and conjugate dienes (CDs) were assayed by the method of Beuje and Aust.17 Quantitative analysis of enzyme activities Activities of superoxide dismutase,18 catalase,19 reduced glutathione,20 glutathione peroxidase,21 and glutathione transferase22 were assayed by the standard protocols.

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

Determination of protein and bilirubin The protein content (g per 100 ml serum) and bilirubin (mg per 100 ml serum) content in the serum were evaluated by using the standard procedure of Lowry15 and Malloy & Evelyn23 respectively. Lipid profile of liver The concentrations of total lipids,24 phospholipids,25 triglycerides26 and cholesterol27 were measured in liver (mg per 100 g tissue) by the standard procedures. Histopathological examination of liver Conventional techniques of paraffin wax sectioning and haematoxylin–eosin staining were used for histological studies. Slices of fresh liver tissue were cut and fixed in buffered neutral formalin fixative for 24 h. Following fixation, the tissues were washed and processed through an ascending series of alcohol solutions (30, 50, 70, 90 and 100%), cleared in methyl salicylate and infiltrated with wax at 57  C. The tissues thus cleared were embedded in paraffin. Sections of 6–8 mm thickness were cut, stained by aqueous haematoxylin and alcoholic eosin, and examined by bright-field microscopy at a magnification of 400. Statistical analysis The results are presented as the mean of 8 animals in each group  SD. The data were obtained by one-way ANOVA followed by Dunnett’s t-test. The level of significance was set at P < 0.01.

Results The antioxidant activity of different extracts of S. laxissima was evaluated by their DPPH radical-scavenging capacity. Fig. 1 shows the percent of DPPH radical-scavenging capacity with Lascorbic acid as a reference. The experimental data reveal that all of these extracts at various levels are likely to have radicalscavenging capacity. From Fig. 1, we observe that a dose– response relationship is found; the activity increased as the concentration increased for each extract. Among the three extracts used in the experiment, 30 mg mL1 of ethanol extract was the strongest, with 77.78%, then 30 mg mL1 of methanol extract with 65.09% and 30 mg mL1 of water extract with 62.39% DPPH radical-scavenging activity. The percent inhibition of DPPH radical-scavenging activity of L-ascorbic acid was found to be 84%. A significant increase in the activity of the serum enzymes AST, ALT, GGT and ALP was observed in rats receiving CCl4 in the vehicle (Group II) when compared to normal (Group I) rats administered with the vehicle alone (Table 1). However, the 192 | Food Funct., 2011, 2, 190–196

Fig. 1 Percent DPPH radical-scavenging capacity of different extracts of S. laxissima (ethanol extract (EESL), methanol extract (MESF) and water extract (WESF)).

activities of these serum enzymes were significantly (P < 0.01) lower in rats treated with the EESL (Group III and IV) than in Group II rats. The protection offered by silymarin was found to be higher. A marked increase in the mean TBARS and CD level was found in the liver of Group II (CCl4-exposed) rats relative to normal (Group I) rats (Table 2); this increase was statistically significant (P < 0.01). Treatment with EESL in Group IV rats was found to result in a significant (P < 0.01) lowering of the mean TBARS and CD concentration, presumably by limiting lipid peroxidation in the hepatic tissue. CCl4 administration in Group II rats resulted in a marked decrease (relative to normal) in the level of reduced glutathione in the liver (Table 2); this decrease was statistically significant (P < 0.01). Treatment with EESL and silymarin resulted in a significantly higher concentration of GSH (P < 0.01) than that in Group II. The concentrations of total proteins and bilirubin in serum are given in the Table 3. A marked elevation in the concentration of bilirubin and decreases in protein content was observed in the CCl4-treated rats compared to normal animals (P < 0.01). In rats that received EESL at a dose of 100 mg kg1 body weight, the concentrations of bilirubin and total protein were maintained at near-normal levels. Table 4 shows the concentrations of total lipids, phospholipids, cholesterol, and triglycerides in the liver. Significant increase (P < 0.01) in the lipid profile was observed in CCl4intoxicated rats. Co-administration of EESL significantly prevented the CCl4-induced alterations in the lipid profile. A significant decrease in antioxidant enzymes like CAT, SOD, GPX and GST activity was observed in the liver of CCl4administered (Group II) rats when compared to normal (Group I) rats that had received the vehicle alone (Table 5). Treatment with the EESL appeared to exert a beneficial effect, since the activities of these enzymes were significantly (P < 0.01) higher in the livers of Group III and IV rats than in Group II rats. When compared to the histoarchitecture of the livers of Group I (normal) animals (Fig. 2A), liver cells of Group II rats (exposed to CCl4) revealed extensive damage, characterized by the disruption of the lattice nature of the hepatocyte, damaged cell membranes, degenerated nuclei, a disintegrated central vein and damaged hepatic sinusoids (Fig. 2B). In Group IV rats (exposed This journal is ª The Royal Society of Chemistry 2011

View Online

Table 1 Effect of the ethanol extract of S. laxissima on the activities of liver function marker enzymes in serum.a Group

AST (U/L serum)

ALT (U/L serum)

ALP (U/L serum)

GGT (U/L serum)

I – Normal II – CCl4 + LP III – CCl4 + EESL (50 mg) IV – CCl4 + EESL (100 mg) V – CCl4 + silymarin

38.36  7.09 137.61  11.54* 90.32  10.58† 43.44  12.94† 39.38  11.24†

29.60  8.35 178.38  9.09* 86.19  12.45† 34.15  9.22† 30.17  10.68†

89.61  12.98 196.92  13.92* 114.69  7.87† 93.97  9.16† 91.62  6.83†

3.94  0.96 9.64  0.34* 7.34  1.87† 4.29  1.24† 3.90  0.08†

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

a Values are mean  SD of 8 animals in each group. Statistical analysis: ANOVA followed by Dunnett’s t-test. P < 0.01 as compared with Group I (*), Group II (†).

Table 2 Effect of ethanol extract of S. laxissima on antioxidant status of liver in rats.a Group

TBARS (mM per 100 g tissue)

CD (mM per 100 g tissue)

GSH (mM per 100 g tissue)

I – Normal II – CCl4 + LP III – CCl4 + EESL (50 mg) IV – CCl4 + EESL (100 mg) V – CCl4 + silymarin

1.39  0.65 1.68  0.56* 1.53  0.87† 1.43  0.66† 1.40  0.17†

62.24  10.19 80.40  15.54* 67.14  12.53† 64.02  9.46† 62.56  7.07†

0.94  0.45  0.76  0.88  0.90 

0.02 0.04* 0.14† 3.29† 0.16†

a Values are mean  SD of 8 animals in each group. Statistical analysis: ANOVA followed by Dunnett’s t-test. P < 0.01 as compared with Group I (*), Group II (†).

Table 3 Effect of ethanol extract of S. laxissima on protein and bilirubin in serum of rats with CCl4-induced hepatotoxicity.a Group

Protein (g per 100 ml serum)

Bilirubin (mg per 100 ml serum)

I – Normal II – CCl4 + LP III – CCl4 + EESL (50 mg) IV – CCl4 +EESL (100 mg) V – CCl4 + silymarin

8.65  6.98  7.11  8.55  8.59 

1.71  0.09 2.48  0.14* 2.02  0.54† 1.79  0.18† 1.74  0.20†

2.56 1.15* 1.87† 1.32† 0.16†

a Values are mean  SD of 8 animals in each group. Statistical analysis: ANOVA followed by Dunnett’s t-test. P < 0.01 as compared with Group I (*), Group II (†). b c

Table 4 Effect of ethanol extract of S. laxissima on the activity of lipid profile of liver of rats on CCl4-induced hepatotoxicity.a Group

Total lipids (mg per 100 g tissue)

Phospholipids (mg per 100 g tissue)

Cholesterol (mg per 100 g tissue)

Triglycerides (mg per 100 g tissue)

I – Normal II – CCl4 + LP III – CCl4 + EESL (50 mg) IV – CCl4 + EESL (100 mg) V – CCl4 + silymarin

4375.88  12.01 5685.72  15.29* 5259.89  13.52† 4797.71  9.73† 4590.45  12.44†

2254.64  9.01 3017.41  13.01* 2765.26  11.45† 2420.44  10.12† 2311.69  13.58†

565.35  784.92  654.36  571.80  569.76 

447.44  561.23  470.96  456.64  451.82 

3.16 4.24* 10.45† 11.25† 12.38†

9.24 6.96* 9.63† 14.34† 10.67†

Values are mean  SD of 8 animals in each group. Statistical analysis ANOVA followed by Dunnett t-test. P < 0.01 as compared with Group I (*), Group II (†). a

to CCl4 + EESL (100 mg)), only minimal disruption of the hepatic cellular structure was observed (Fig. 2C). Liver section of rats treated with CCl4 and silymarin (Group V) showed minimal inflammatory cellular infiltration (Fig. 2D).

Discussion Phycocyanin (PC) is a water-soluble, highly fluorescent protein derived from cyanobacteria (blue-green algae) used in food coloring,28 cosmetics29 and biomedical research.30 Recently, it This journal is ª The Royal Society of Chemistry 2011

has been demonstrated that PC from Spirulina platensis has significant antioxidant and radical-scavenging properties both in vivo and in vitro models,31 and is a potential therapeutic agent in diseases induced by oxidative stress. In this work, we focused our attention on the edible microalga S. laxissima, in which PC represents around 15% of dry weight. In particular, we tested the efficacy of different extracts of S. laxissima against the oxidative damage induced by DPPH. As compared with the commercial antioxidants, the ethanol extract of S. laxissima showed comparable scavenging activity on DPPH. It was, however, Food Funct., 2011, 2, 190–196 | 193

View Online

Table 5 Effect of ethanol extract of S. laxissima on activity of antioxidant enzymes in liver.a Group

SOD (U per mg protein)

CAT (U per mg protein)

GPX (U per mg protein)

GST (U per mg protein)

I – Normal II – CCl4 + LP III – CCl4 + EESL 50 mg IV – CCl4 + EESL 100 mg V – CCl4 + silymarin

5.33  1.03 4.14  1.49* 4.48  1.78† 5.16  0.41† 5.30  1.19†

2.93  0.09 0.54  0.38* 1.99  0.69† 2.78  0.17† 2.80  0.05†

165.96  142.12  155.49  163.95  164.84 

0.34  0.24  0.27  0.31  0.33 

10.12 7.09* 12.09† 11.43† 5.95†

0.17 0.04* 0.19† 0.04† 0.09†

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

a Values are mean  SD of 8 animals in each group. Statistical analysis ANOVA followed by Dunnett’s t-test. P < 0.01 as compared with Group I (*), Group II (†).

evident that extracts of S. laxissima did show antioxidant activity in vitro. The antioxidant activity of the extracts might be attributed to its proton-donating ability, as evidenced through DPPH. Spirulina species have been used as food for thousands of years. Among blue-green algae, many species have documented biomodulatory effects. Many medicinal properties have been attributed to Spirulina species, including reduction in body weight,32 reduction of cholesterol,33 increased activity of lipase,34 reduction of glucose levels,35 modulation of carcinogen metabolic enzymes,36 modulation of lead toxicity37 and radical-scavenging action.38 Carbon tetrachloride (CCl4) is a well-known hepatotoxic agent. The changes associated with CCl4-induced liver damage are similar to those of acute viral hepatitis.39 CCl4-induced liver damage is a classic model used for the screening of hepatoprotective drugs. The basis of its hepatotoxicity lies in its biotransformation by the cytochrome P450 system to two radicals. The first metabolite, a trichloromethyl radical, forms covalent adducts with lipids and proteins; it can interact with O2 to form a second metabolite, a trichloromethyl peroxyl radical, or can remove hydrogen atoms to form chloroform. This sequence of events leads to lipid peroxidation of membranes and consequent liver injury. In response to this hepatocellular injury, ‘‘activated’’ hepatic Kupfer cells release increased quantities of active oxygen species and other bioactive agents.40 Since radicals play such an important role in CCl4-induced hepatotoxicity, it seems logical that compounds that neutralize such radicals may have a hepatoprotective effect. Indeed, various natural products have been reported to protect against CCl4induced hepatotoxicity.41 Ample experimental and epidemiological studies support the involvement of oxidative stress in the pathogenesis and progression of several chronic diseases. In the present study it was found that EESL could effectively scavenge the radicals in a dose-dependent manner. It has been reported that CCl4 caused significant increase in hepatic lipid peroxidation due to radical injury in cirrhotic livers of rats.42 In the present study, elevated levels of TBARS and CD observed in CCl4treated rats indicate excessive formation of radicals and activation of the lipid peroxidation system, resulting in hepatic damage. The significant decline in the concentration of these constituents in the livers of rats treated with CCl4 + EESL indicates the anti-lipid-peroxidative effect of S. laxissima. The antioxidant properties of Nostoc sphaeroides K€ utzing (Nostocaceae) and Aulosira fertilisima Ghose (Nostocaceae) on CCl4-induced hepatic damage in rats had been reported earlier from our laboratory.43 It has been reported that C-phycocyanin 194 | Food Funct., 2011, 2, 190–196

from Spirulina platensis effectively inhibited CCl4-induced lipid peroxidation in rat liver in vivo.44 GSH is a major non-protein thiol in living organisms which plays a central role in coordinating the body’s antioxidant defense processes.45 Decline in the GSH content in the liver of CCl4-intoxicated rats, and its subsequent return towards the near-normality in the group administered with CCl4 + EESL, also reveal the anti-lipid-peroxidative effect of S. laxissima. Estimating the activities of serum marker enzymes such as AST, ALT, ALP and GGT, can enable assessment of liver function. When the liver cell plasma membrane is damaged, a variety of enzymes normally located in the cytosol are released into the bloodstream. Their amount in the serum is a useful quantitative marker of the extent and type of hepatocellular damage.46 The normalization of the above enzyme levels seen in rats treated with the cyanobacterial formulation (100 mg kg1 body weight) indicates the possibility of EESL being able to inhibit liver cell injury and reducing the leakage of the above enzymes in to the blood. It has been reported that serum transaminases return to normal levels with the healing of liver parenchyma and regeneration of liver cells.47 It was also reported that the alcohol extract of Spirulina maxima Geitler (Pseudanabaenaceae) inhibited lipid peroxidation more significantly than the chemical antioxidants like a-tocopherol and b-carotene.48 Phycocyanin significantly reduced the hepatotoxicity caused by CCl4, which induces the formation of radicals. The hepatoprotective effect of phycocyanin was therefore attributed to the inhibition of reactions involved in the formation of reactive metabolites, and possibly due to its radical-scavenging activity.49 The site-specific oxidative damage of some of the susceptible amino acids of protein is now regarded as the major cause of metabolic dysfunction during pathogenesis. The capacity of liver synthesize albumins is adversely affected by hepatotoxins.50 Administration of hepatotoxins like CCl4 causes depression in protein biosynthesis, which is due to the disruption and disassociation of polyribosomes from the endoplasmic reticulum. The lowered levels of total proteins recorded in the serum of CCl4treated rats can be attributed to these features. Attainment of near-normality in protein content of serum in rats treated with CCl4 + LP + EESL further confirmed the anti-hepatotoxic effect of S. laxissima. The body has an effective mechanism to prevent and neutralize radical-induced damage. This is accomplished by a set of endogenous antioxidant enzymes, such as SOD, CAT, GPX and GST. When the balance between ROS production and antioxidant defenses is lost, oxidative stress results, which through a series of events deregulates the cellular functions, leading to This journal is ª The Royal Society of Chemistry 2011

View Online

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

activation of lipid peroxidation system, resulting in tissue damage. The significant increases in the concentration of these constituents in liver tissues of animals treated with CCl4 + EESL indicate the antioxidant effect of EESL. It was reported that Dunaliella salina Teodoresco (Dunaliellaceae), a green marine alga, has the ability to protect against oxidative stress in vivo using animal models.52 It has been established that carotenoids from microalgae exert their action against CCl4 liver injury by lipid peroxidation, either through decreased production of radical derivatives or due to the antioxidant activity of the protective agent itself.53 The antioxidant activity of Laminaria japonica Areschoug (Laminariaceae) and Ecklonia stolonifera Okamura (Lessoniaceae) against CCl4-induced hepatotoxicity has been reported.54 During attack by toxins, the lipid profile of serum and tissues increases. CCl4-poisoned rats appear to have a deranged hepatic triglyceride secretory mechanism. Accumulation of triglycerides in the liver during CCl4 poisoning results not from a defect in the release of triglycerides into plasma, but perhaps from an increase in hepatic synthesis of triglycerides.55 Treatment of rats with CCl4 induces centrilobular necrosis, which results in the accumulation of fat in the liver. Fat from the peripheral adipose tissue is translocated to the liver and kidney, leading to its accumulation during toxicity. CCl4 also interferes with hepatic phospholipid synthesis. Intoxication of experimental animals with CCl4 altered the membrane structure and function, as shown by the increases in cholesterol and phospholipid concentrations, and hence an increased cholesterol-to-phospholipid ratio.56 Pretreatment of experimental animals with EESL extract prevented the alterations of membrane fluidity, with a decrease in the cholesterol-to-phospholipid ratio, which was elevated by animals treated just with CCl4 alone. Thus S. laxissima plays a role in peroxidation by inhibiting the radical attack on biomembranes. It has been reported that C-phycocyanin from Spirulina platensis effectively inhibits marked CCl4-induced changes in the lipid profile of the rat liver.57

Conclusion

Fig. 2 Photomicrographs of liver sections of rats stained with haematoxylin and eosin (200X). A: Normal rat showing a central vein surrounded by normal hepatocytes. B: CCl4-treated rats showing a dilated central vein and hepatocytes with fatty change and ballooning degeneration. C: CCl4 + S. laxissima (100 mg kg1 body weight) treated rats showing the central vein and normal hepatocytes with occasional hepatocytes showing fatty change and ballooning degeneration. D: Liver section of rats treated with CCl4 and silymarin showing minimal inflammatory cellular infiltration, and near-normal liver architecture.

various pathological conditions.51 Any compound, natural or synthetic, with antioxidant properties may contribute towards the partial or total alleviation of this type of damage. In the present study, decline in the level of antioxidant enzymes like SOD, CAT, GPX and GST observed in CCl4-treated rats is a clear manifestation of the excessive formation of radicals and This journal is ª The Royal Society of Chemistry 2011

The present study demonstrates the hepatoprotective and antioxidant properties of the ethanol extract of S. laxissima (EESL). The hepatoprotective effect of EESL may be due to the presence of phycocyanin pigment. In this regard, it is relevant to point out that phycocyanins have been suggested to act as antioxidants and exert their antioxidant activity by scavenging lipid peroxidation. Thus a plausible mechanism of the hepatoprotective effect of EESL may be due to its antioxidant effect. Further studies are needed to identify and isolate the active principles of EESL, which could offer antioxidant and hepatoprotective properties.

Acknowledgements We owe our thanks to Professor Ramesh, Department of Statistics, Rubber Research Institute, Kottayam, India, for giving valuable support for statistical analysis. Financial assistance from the University Grant Commission, India, is acknowledged. Food Funct., 2011, 2, 190–196 | 195

View Online

Downloaded on 12 April 2011 Published on 01 February 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00163E

References 1 E. Porchezhian and S. H. Ansari, Phytomedicine, 2005, 12, 62–64. 2 V. B. Bhat and K. M. Madyastha, Biochem. Biophys. Res. Commun., 2000, 275, 20–25. 3 C. M. Reddy, V. B. Bhat, G. Kiranmai, M. N. Reddy, P. Reddanna and K. M. Madyastha, Biochem. Biophys. Res. Commun., 2000, 277, 599–603. 4 A. N. Glazer, Methods Enzymol., 1988, 167, 291–303. 5 A. K. Padyana, V. B. Bhat, K. M. Madyastha, K. R. Rajashankar and S. Ramakumar, Biochem. Biophys. Res. Commun., 2001, 282, 893–898. 6 R. Stocker, A. F. McDonagh, A. N. Glazer and B. N. Ames, Methods Enzymol., 1990, 186, 301–309. 7 R. O. Recknagel, E. A. Glende, J. A. Dolak and R. L. Waller, Pharmacol. Ther., 1989, 43, 139–154. 8 R. Y. Stainer, R. Kunisawa, M. Mandel and B. Cohen, Bacteriol. Rev., 1971, 5, 171–176. 9 N. R. Ferrigni, J. E. Putnam, B. Anderson and L. B. Jacobson, J. Nat. Prod., 1982, 45, 679–686. 10 A. K. Ratty, J. Sunamoto and N. P. Das, Biochem. Pharmacol., 1988, 37, 989–995. 11 J. K. Jose and R. Kuttan, J. Ethnopharmacol., 2000, 72, 135–140. 12 A. F. Mohum and J. Y. Cook, J. Clin. Pathol., 1957, 10, 394–398. 13 A. H. Gowenlock, Varley’s Practical Clinical Biochemistry, London, United Kingdom, 1988, pp. 518–526. 14 H. Varley, Practical Clinical Biochemistry, CBS, New Delhi, India, 1988, pp. 453–457. 15 O. H. Lowry, N. J. Roesbrough, A. L. Farr and R. J. Randall, J. Biol. Chem., 1951, 193, 265–269. 16 W. G. Nichans and B. Samuelson, Eur. J. Biochem., 1968, 6, 126–133. 17 J. A. Beuje and S. D. Aust, Antioxidants, in Methods in Enzymology, ed. S. P. Clowick and N. O. Kaplan, Academic Press, New York, 1978, pp. 302–305. 18 P. Kakkar, B. Das and D. N. Vishwanath, Indian J. Biochem. Biophys., 1984, 21, 130–138. 19 A. L. Calibrone, Handbook of Methods for Oxygen Radical Research, Florida, USA, 1985, pp. 283–287. 20 E. Bentler and B. M. Kelly, Experientia, 1963, 19, 96–101. 21 J. R. Rotruck, A. Pope and H. E. Ganther, Science, 1973, 17, 486–490. 22 E. Beutler, Red Cell Metabolism: A Manual of Biochemical Methods, Gruene FP Stratton, New York, 1986, pp. 57–59. 23 H. J. Malloy and K. A. Evelyn, J. Biol. Chem., 1937, 119, 481–496. 24 J. Folch, M. Lees and S. G. Solane, J Biol Chem., 1957, 226, 497–509. 25 H. V. Connerty, A. R. Briggs and E. H Eaton, Clin. Chem., 1961, 7, 37–53. 26 E. V. Handel and D. B. Zilversmith, Serum triglycerides micro method, in Gradwohl’s clinical laboratory methods and diagnosis, ed. S. Frankel, S. Reitman and A. C. Sonnenwirth, The Mosby Co., Saint Louis, USA, 1963pp. 263–267. 27 A. Zlatkis, B. Zak and G. J. Boyle, J. Lab. Clin. Med., 1953, 41, 486–494.

196 | Food Funct., 2011, 2, 190–196

28 A. Yoshida, Y. Takagaki and T. Nishimune, Biosci., Biotechnol., Biochem., 1996, 60, 57–60. 29 Z. Cohen, Products from microalgae, in Handbook of Microalgal Mass Culture, ed. A. Richmond, CRC Press, Boca Raton, USA, 1986, pp. 421–425. 30 A. N. Glazer and L. Stryer, Methods Enzymol., 1990, 184, 188–194. 31 C. Romay and R. Gonzalez, J. Pharm. Pharmacol., 2000, 52, 367–372. 32 E. Becker and B. Jakover, Nutr. Rep. Int., 1986, 33, 565–574. 33 K. G. Hori, G. Ishibashi and M. H. Luan, Plant Foods Hum. Nutr., 1994, 45, 63–70. 34 K. Iwata and T. Inayama, J. Nutr. Sci. Vitaminol., 1999, 36, 165–171. 35 Y. Takai and Y. Hosoyamada, J. Jpn. Soc. Nutr. Food Sci., 1991, 44, 273–277. 36 A. Mittal and P. V. Kumar, Phytother. Res., 1999, 13, 111–114. 37 D. Shastri, M. Kumar and A. Kumar, Phytother. Res., 1999, 13, 258–260. 38 V. B. Bhat and K. M. Madyastha, Biochem. Biophys. Res. Commun., 2001, 285, 262–266. 39 A. E. Eisisi, D. L. Earnest and I. G. Sipes, Toxicol. Appl. Pharmacol., 2003, 119, 295–301. 40 G. Hsiao, M. Y. Shen, K. H. Lin, M. H. Lan and J. R. Sheu, J. Agric. Food Chem., 2004, 51, 3302–3308. 41 A. S. Girish, W. G. Sudhir and D. K. Avinash, J. Ethnopharmacol., 2004, 90, 229–235. 42 K. Vivek, K. K. Pillai, S. Z. Hussain and D. K. Balani, Indian J. Pharmacol., 1994, 26, 26–31. 43 K. C. Gini and K. G. Muraleedhara, Indian J. Exp. Biol., 2008, 46, 52–56. 44 B. Serena, R. Sara, B. Francesca, F. Sonia and P. Silvia, J. Chromatogr., B: Anal. Technol. Biomed. Life Sci., 2006, 833, 12–17. 45 R. Ferrari, C. Ceconi, S. Curello and A. Cargnoni, Cardiovasc. Pharmacol. Ther., 1991, 52, 77–82. 46 K.-T. Ha, S.-J. Yoon, D.-Y. Choi and D.-W. Kim, J. Ethnopharmacol., 2005, 96, 529–534. 47 T. Rajmohan and L. L. Anthony, Indian J. Biochem. Biophys., 2003, 40, 354–359. 48 M. S. Miranda, R. G. Cintra, S. M. Barros and J. Mancini-Filho, Braz. J. Med. Biol. Res., 1998, 31, 1075–1081. 49 B. B. Vadiraja, N. W. Gaikwad and K. M. Madyastha, Biochem. Biophys. Res. Commun., 1998, 249, 428–431. 50 B. Uday, D. Dipak, E. Banerjee and K. Ranjith, Curr. Sci., 1999, 5, 658–662. 51 J. A. Castro, G. C. Ferrya, C. R. Castro and J. R. Gillette, Biochem. Pharmacol., 1974, 23, 295–301. 52 K. N. Chidambara, J. Rajesha, S. M. Mahadeva and G. A. Ravishankar, J. Med. Food, 2005, 8, 523–527. 53 C. Kerfeld, Photosynth. Res., 2004, 81, 215–219. 54 X. Zhao, C.-H. Xue, Z.-J. Li, Y.-P. Cai and H.-Y. Liu, J. Appl. Phycol., 2004, 16, 111–115. 55 N. F. Kushnerobn, S. E. Fomenko, M. I. Polozhentseva and A. E. Bulanov, Vopr. Med. Khim., 1995, 41, 20–23. 56 R. A. Cooper, J. R. Durocher and M. H. Leslie, J. Clin. Invest., 1997, 60, 115–21. 57 J. E. Pinero, B. P. Bermejo and A. M. Villardel, Il Pharmaco., 2001, 56, 497–503.

This journal is ª The Royal Society of Chemistry 2011

View Online

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 197

PAPER

www.rsc.org/foodfunction

Habitual coffee and tea drinkers experienced increases in blood pressure after consuming low to moderate doses of caffeine; these increases were larger upright than in the supine posture†‡x Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

Michael K. McMullen,{*a Julie M. Whitehouse,b Gillian Shinec and Anthony Towelld Received 9th November 2010, Accepted 22nd February 2011 DOI: 10.1039/c0fo00166j Caffeine users have been encouraged to consume caffeine regularly to maintain their caffeine tolerance and so avoid caffeine’s acute pressor effects. In controlled conditions complete caffeine tolerance to intervention doses of 250 mg develops rapidly following several days of caffeine ingestion, nevertheless, complete tolerance is not evident for lower intervention doses. Similarly complete caffeine tolerance to 250 mg intervention doses has been demonstrated in habitual coffee and tea drinkers’ but for lower intervention doses complete tolerance is not evident. This study investigated a group of habitual caffeine users following their self-determined consumption pattern involving two to six servings daily. Cardiovascular responses following the ingestion of low to moderate amounts caffeine (67, 133 and 200 mg) were compared with placebo in a double-blind, randomised design without caffeine abstinence. Pre-intervention and post-intervention (30 and 60 min) 90 s continuous cardiovascular recordings were obtained with the Finometer in both the supine and upright postures. Participants were 12 healthy habitual coffee and tea drinkers (10 female, mean age 36). Doses of 67 and 133 mg increased systolic pressure in both postures while in the upright posture diastolic pressure and aortic impedance increased while arterial compliance decreased. These vascular changes were larger upright than supine for 133 mg caffeine. Additionally 67 mg caffeine increased dp/dt and indexed peripheral resistance in the upright posture. For 200 mg caffeine there was complete caffeine tolerance. Cardiovascular responses to caffeine appear to be associated with the size of the intervention dose. Habitual tea and coffee drinking does not generate complete tolerance to caffeine as has been previously suggested. Both the type and the extent of caffeine induced cardiovascular changes were influenced by posture.

Introduction Caffeine is a widely used behavioural stimulant1,2 consumed primarily in the beverages tea, coffee, and caffeinated softdrinks.3,4 It is also present in a wide range of pharmaceuticals.5 Caffeine stimulates the cerebral cortex in doses up to 200 mg with

a School of Life Sciences, University of Westminster, 115 New Cavendish Street, London, W1W 6UW, UK b Principal Lecturer, School of Life Sciences, University of Westminster, 115 New Cavendish Street, London, W1W 6UW, UK c Principal Lecturer, School of Life Sciences, University of Westminster, 115 New Cavendish Street, London, W1W 6UW, UK d Professor, Department of Psychology, University of Westminster, 309 Regent Street, London, W1B 2UW, UK † Trial registration, ISRCTN11339389, http://www.controlled-trials. com/ISRCTN11339389/mcmullen ‡ Sources of support/funding: no funding or sponsoring was involved in this study. x Potential conflicts of interest: none { Current address: Box 65, 760 40 Vaddo, Sweden. E-mail: research@ micmcmullen.se; Fax: +46 176 52467; Tel: +46 706227384.

This journal is ª The Royal Society of Chemistry 2011

larger doses affecting also the medulla where neurons controlling cardiovascular and respiratory activity are located.4 Studies have shown that with daily use caffeine’s pressor effect on blood pressure diminishes or disappears within several days, a process referred to as tolerance.6 Tolerance is short-lived and may be lost after a period of 12 to 24 h abstinence.7 When studies relating to caffeine tolerance are scrutinized the phenomenon of tolerance appears to be dependent on the size of the intervention dose and it remains to be established if complete tolerance exists for habitual coffee and tea drinkers outside of controlled laboratory studies. This study investigates whether or not habitual coffee and tea drinkers experience acute cardiovascular responses following the ingestion of low and moderate doses of caffeine (67, 133 and 200 mg) while engaging in their self-determined consumption pattern. Caffeine consumption In the USA approximately 90% of adults are daily caffeine consumers and the average daily intake is estimated at 192 mg.8 Similarly in the UK an estimated 91% of adults consume Food Funct., 2011, 2, 197–203 | 197

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

View Online

a minimum of 40 mg caffeine per day and the average adult daily intake is estimated at 240 mg.9 Most caffeine is derived from the beverages tea and coffee though there is a wide variation in caffeine levels per serving depending on raw material, type of preparation and personal preferences. The average and range of caffeine levels (excluding decaffeinated preparations) per serving are: tea 40 (1 to 90) mg, instant coffee 54 (21 to 120) mg and ground coffee 105 (15 to 254) mg.10 Plant derived caffeine is widely used by the beverage industry for the production of colas (30 to 50 mg caffeine per serving) and energy drinks (50 to 500 mg caffeine per serving).11 The use of caffeine in pharmacological preparations is extensive with doses of 50 to 200 mg being used to reduce fatigue, increase alertness and delay the onset of sleep.5 It is also present in products generally not associated with central stimulation including allergy preparations, analgesics, antacids, cold medications, headache and weight reduction preparations.4 Moderate daily caffeine consumption of up to 400 mg is not associated with toxicity, cardiovascular effects or behavioural changes.7

respectively. Although caffeine users have been recommended ‘‘to consume it on a regular basis to minimize any effects it may have on blood pressure’’24 there is a lack of evidence to support the viewpoint that regular consumption of the beverages coffee and tea produces complete tolerance across the range of caffeine doses to which consumers are exposed both in beverages and pharmaceuticals.

Pharmacology

Methods

The daily consumption of caffeine worldwide ranges from 80 to 400 mg per adult. Caffeine usage at these levels produces blood plasma concentrations of 5 to 20 mM which are sufficient to block the tonic activation of the adenosine receptors A1 and A2A2 while doses in the range of 2 to 3 mg kg1 (130 to 195 mg for a 65kg person) are sufficient to fully block adenosine receptors in the vascular system.12 Caffeine is rapidly and completely absorbed from the gastrointestinal tract with the rate of absorption (99%) similar across the range of caffeine doses used in clinical experiments.13 Caffeine is distributed throughout the body’s tissues including the central nervous system with peak plasma levels occurring 15 to 60 min after ingestion.4,14 Caffeine blocks the activity of the neurotransmitter adenosine with the doseresponse function following a standard log dose-response curve.2 In the peripheral blood circulation where adenosine acts as a vasodilator the blocking of adenosine receptors by caffeine causes blood pressure increases.15,16 Studies on non-caffeine users and caffeine abstainers ingesting caffeine at doses of 250 mg report increases in systolic pressure of 5 to 15 mmHg and diastolic pressure of 5 to 10 mmHg with the effect more pronounced in smokers, the elderly and hypertensives.7

Participants and location

Caffeine tolerance In controlled laboratory testing 250 mg caffeine produced a marked pressor effect (10/6 mmHg) following caffeine abstinence, yet complete tolerance to this intervention developed after several days of ingesting 250 mg caffeine three times a day.17 However, similar studies with both smaller conditioning doses (3  1.75 mg kg1 (z 3  115 mg)18 and 3  150 mg19) and smaller intervention doses (150 mg and 1.75 mg kg1 respectively) have reported blood pressure increases of 6/5 and 6/7 mmHg respectively after a period of conditioning. In studies with habitual coffee and tea drinkers’ complete tolerance was exhibited to large intervention doses of $250 mg20–22 but not to the smaller intervention doses of 1.5 mg kg1 (z95 mg)22 and 125 mg,23 were blood increased by 10/5 and 0/5 mmHg 198 | Food Funct., 2011, 2, 197–203

Aims This study aims to investigate whether habitual tea and coffee drinkers experience acute cardiovascular responses in the hour following ingestion of caffeine at levels of 67, 133 and 200 mg or approximately 1, 2 and 3 mg/kg. These levels are representative of caffeine levels found in both caffeinated beverages and pharmaceutical formulations and are therefore the dosages relevant to public health issues. Additionally cardiovascular recordings were obtained in the supine and upright postures to ascertain if responses to caffeine were influenced by posture.

This investigation conforms to the principles outlined by the Declaration of Helsinki and was approved by the University of Westminster Ethics Committee (03/04-08). Written informed consent was obtained from the participants who were healthy volunteers recruited from the staff and students of the University of Westminster, London. All participants were selected as habitual coffee and tea drinkers and agreed to continue their normal usage during the study. Habitual tea/coffee drinking was defined in accordance with previous studies involving habitual users25–29 as consuming between two and six servings of either tea and/or coffee daily. Hypertensives (systolic pressure >140 mm Hg or diastolic pressure >90 mm Hg), smokers, pregnant women and those on prescribed medication were excluded from the study. Caffeine dosage The interventions were either a placebo capsule or caffeine capsules at the levels of 67, 133 and 200 mg. It was estimated that the 67 mg dose would be approximately the equivalent of 1 mg kg1, the 133 mg dose the equivalent of 2 mg kg1 and the 200 mg dose the equivalent of 3 mg/kg. The capsules were identical and contained varying combinations of caffeine and microcrystalline cellulose together as well as magnesium stearate. Design and procedure Participants were tested with each of the intervention doses on four separate occasions in a randomised, double blind design. Finometer recordings were obtained pre-intervention and postintervention at both 30 and 60 min. Each recording segment commenced with a five minute relaxation period in the supine posture after which 90 s Finometer recordings were obtained first in the supine posture and later standing. To avoid orthostatic influences, the standing posture recording started 90 s after the participant began to change posture. Each participant was This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

View Online

required to attend all sessions at a similar time of the day so as to minimise circadian rhythm influences.30 Prior to an experimental session participants were required to abstain from food and drink (excluding water) for two hours. The commonly used procedure of requiring participant caffeine abstinence (usually overnight) was specifically avoided for three reasons: firstly it may produce confounding effects due to varying degrees of caffeine withdrawal which occur 12 to 24 h after the last intake of caffeine,3,4 secondly participants may avoid caffeine products for a longer period of time than requested and lose their caffeine tolerance i.e. super-compliance24 and thirdly it was intended to test participants in a naturalistic setting where each individual followed their own preferred consumption pattern rather following an imposed intake schedule. Participants were tested without any attempt to control caffeine intake other than to maintain their normal consumption which was verbally confirmed at the beginning of each test session.

Initially 14 participants were recruited. One participant failed to complete all four sessions due to time commitments and one further participant was excluded from the analysis because of heart irregularities during the placebo session. None of the participants spontaneously reported any discomfort or problems arising during or after experimental sessions. The 12 analysed participants (10 female) had a mean (standard deviation, range) age of 36 (7.8, 25 to 57) years, mean weight of 61 (6.4, 49 to 79) kg, mean height (1.66, 1.53 to 1.79) m and mean BMI of 22 (0.9, 19 to 26) kg m2. As the mean participant weight was 61 kg the caffeine doses of 67, 133 and 200 mg were approximately equivalent to 1.1, 2.2 and 3.3 mg kg1. The values of the cardiovascular parameter measurements are presented in Table 1.

Cardiovascular measurement

Cardiac parameters

The Finometer (FMS, Finapres Measurement Systems, Amsterdam, The Netherlands) finger pulse contour recordings together with the accompanying Modelflow software provide the parameters: heart rate, ejection time, dp/dt (contraction force), DPTI/SPTI (the cardiac oxygen supply: demand ratio (the Buckberg index)), stroke volume, cardiac output, systolic,diastolic and mean blood pressure, peripheral resistance, arterial compliance and aortic impedance. Additionally the body surface area adjusted values (Dubois and Dubois formula): indexed stroke volume, indexed cardiac output (cardiac index) and indexed peripheral resistance values are provided.31–37 The following parameters are reported: heart rate, ejection time, dp/ dt, DPTI/SPTI, cardiac index, systolic pressure, diastolic pressure, arterial compliance, aortic impedance and indexed peripheral resistance.

The dp/dt omnibus F was significant for all conditions F(3,33) ¼ 3.627, p ¼ 0.023. Dp/dt increased in the upright posture for 67 mg by 161 mmHg/s (F(1,11) ¼ 5.848, p ¼ 0.034). There were no changes in heart rate, ejection time, DPTI/SPTI or the cardiac index.

Baroreflex sensitivity measurement Assessment of the spontaneous baroreflex sensitivity was calculated from the Finometer recordings using the validated time-domain xBRS program with standard settings (p ¼ 0.01).38

Data analysis and statistics Measurements from the 30 and 60 min recordings were averaged39 to produce a single post-ingestion measures. Planned contrasts, comparing measures from each caffeine condition with measures from the placebo condition, were analysed with repeated measures 2  2 (pre/post  placebo/caffeine) ANOVA for each posture using SPSS v15 (Chicago, USA). A 2  2  2 (pre/post  placebo/caffeine  supine/posture) repeated measures ANOVA was used to assess whether the cardiovascular responses to caffeine were influenced by posture. The significance level was set at p <0.05 and the number of planned contrasts was equal to the number of degrees of freedom. Omnibus F values are also reported when significant. This journal is ª The Royal Society of Chemistry 2011

Results Participant characteristics

Vascular parameters The systolic pressure omnibus F was significant for all conditions F(3,33) ¼ 4.876, p ¼ 0.006, and upright F(3,33) ¼ 5.332, p ¼ 0.004. Systolic pressure increased in the supine posture for 67 mg by 5.8 mmHg (F(1,11) ¼ 4.892, p ¼ 0.049) and for 133 mg by 6.0 mmHg (F(1,11) ¼ 6.299, p ¼ 0.029). Systolic pressure increased in the upright position for 67 mg by 10.0 mmHg (F(1,11) ¼ 8.223, p ¼ 0.015) and for 133 mg by 12.7 mmHg (F(1,11) ¼ 17.246, p ¼ 0.002). The diastolic pressure omnibus F was significant for all conditions F(3,33) ¼ 4.285, p ¼ 0.012, and upright F(3,33) ¼ 3.806, p ¼ 0.019. Diastolic pressure increased in the upright posture for 67 mg by 6.4 mmHg (F(1,11) ¼ 5.591, p ¼ 0.038) and for 133 mg by 8.6 mmHg (F(1,11) ¼ 14.953, p ¼ 0.003). The arterial compliance omnibus F was significant for all conditions F(3,33) ¼ 3.063, p ¼ 0.042, and upright F(3,33) ¼ 4.197, p ¼ 0.013. Arterial compliance decreased in the upright posture for 67 mg by 0.20 MU (F(1,11) ¼ 10.214, p ¼ 0.009) and for 133 mg by 0.23 MU (F(1,11) ¼ 120.968, p ¼ 0.001). The aortic impedance omnibus F was significant in upright conditions F(3,33) ¼ 5.118, p ¼ 0.005. Aortic impedance increased in the upright posture for 67 mg by 2.6 mMU (F(1,11) ¼ 5.591, p ¼ 0.038) dose and for 133 mg by 3.8 mMU (F(1,11) ¼ 14.953, p ¼ 0.003). Indexed peripheral resistance increased in the upright posture for 67 mg by 0.13 MU/m2 (F(1,11) ¼ 5.134, p ¼ 0.045.

Baroreflex sensitivity There was no change in spontaneous baroreflex sensitivity. Food Funct., 2011, 2, 197–203 | 199

View Online

Table 1 Cardiovascular parameter measures in the pre-ingestion and post-ingestion phases for both postures.a Supine Posture Parameter

Caffeine

Pre-ingestion Mean  SD

Post-ingestion Mean  SD

Pre-ingestion Mean  SD

Post-ingestion Mean  SD

HR (bpm)

placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg placebo 67 mg 133 mg 200 mg

67.3  8.7 67.0  10.5 65.2  9.4 66.9  9.6 332  20 335  13 339  14 335  18 942  257 900  260 889  258 979  264 145  23 148  43 148  31 144  25 3.4  0.6 3.5  0.8 3.2  0.7 3.5  0.5 116.2  11.7 115.2  10.4 115.3  10.3 120.6  12.1 68.1  6.6 67.0  5.3 66.7  5.8 69.8  6.4 2.01  0.35 2.04  0.38 2.06  0.42 1.98  0.37 63.0  8.1 63.0  8.0 62.8  8.4 63.3  8.0 0.58  0.15 0.61  0.12 0.62  0.20 0.58  0.11 19.4  11.6 16.2  8.5 17.3  8.6 16.9  9.2

63.3  10.5 62.3  12.1 60.5  10.0 61.3  9.8 342  17 339  18 346  18 340  16 1003  242 1056  267 1030  222 1093  226 152  33 161  39 160  34 161  32 3.3  0.8 3.2  0.9 3.2  0.6 3.2  0.5 119.3  6.8 124.1  9.4* 124.4  8.5* 126.1  9.8 67.5  6.8 68.1  6.6 69.9  4.5 71.1  3.7 2.03  0.30 1.92  0.41 1.97  0.34 1.94  0.35 62.8  7.7 63.1  7.6 63.4  8.1 63.5  7.9 0.61  0.17 0.67  0.17 0.64  0.11 0.65  0.11 23.3  14.7 20.2  9.6 22.1  10.7 22.7  10.5

85.2  11.3 83.6  10.7 82.9  13.0 81.2  7.4 265  19 267  21 271  24 273  20 1220  348 1112  212 1102  268 1124  208 149  18 152  23 153  26 152  18 2.8  0.7 3.0  0.8 2.7  0.6 3.0  0.5 133.5  14.1 127.6  9.1 126.9  11.1 127.5  10.2 86.4  8.7 81.9  6.7 81.4  7.7 81.1  5.5 1.52  0.28 1.65  0.33 1.67  033 1.67  0.28 68.6  8.1 66.7  8.1 66.5  8.4 66.3  7.6 0.86  0.26 0.77  0.19 0.83  0.21 0.74  0.13 7.3  3.5 6.9  2.7 6.9  3.4 7.5  3.5

79.9  10.3 76.2  9.0 75.0  10.6 77.4  10.9 275  20 281  18 283  20 275  23 1188  296 1241  258* 1205  291 1155  217 154  19 161  24 164  24 163  22 2.8  0.6 2.7  0.8 2.6  0.6 2.8  0.6 131.5  11.8 135.6  10.1* 137.6  14.1** 132.7  10.7 82.9  8.4 84.7  6.0* 86.5  8.2** 83.5  8.2 1.61  0.27 1.54  0.34** 1.61  0.29** 1.62  0.30 67.0  7.5 67.8  8.3* 68.7  8.7** 67.2  8.6 0.84  0.19 0.89  0.23* 0.94  0.19 0.87  0.19 8.3  3.6 8.4  3.4 9.0  3.3 9.6  4.0

ET (ms)

dp/dt (mmHg/s)

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

Upright Posture

DPTI/SPTI (%)

CO (l min1)

SP (mmHg)

DP (mmHg)

AC (MU)

AI (mMU)

PRI (MU/m2)

BRS (ms/mmHg)

a HR: heart rate, DPTI/SPTI: the cardiac oxygen supply: demand ratio, CI: cardiac index, SP: systolic pressure, DP: diastolic pressure, AC: arterial compliance, AI: aortic impedance; PRI: indexed total peripheral resistance, BRS: spontaneous baroreflex sensitivity, SD: standard deviation, bpm: beats per minute, MU ¼ medical unit ¼ mmHg.s/ml, * p < 0.05, ** p < 0.01.

Posture For 133 mg the systolic pressure (F(1,11) ¼ 11.080, p ¼ 0.007), diastolic pressure (F(1,11) ¼ 6.171, p ¼ 0.030), arterial compliance (F(1,11) ¼ 5.935, p ¼ 0.033) and aortic impedance (F(1,11) ¼ 8.254, p ¼ 0.015) changes were larger in the upright than the supine posture. For the 67 mg dose aortic impedance (F(1,11) ¼ 14.467, p ¼ 0.003) changes were also larger upright.

Discussion The principal finding of this study was that the habitual drinkers of tea and coffee experienced acute blood pressure increases 200 | Food Funct., 2011, 2, 197–203

following the ingestion of 67 and 133 mg whereas they exhibited complete caffeine tolerance following the 200 mg intervention. These increases in blood pressure resulted predominantly from vasoconstriction in the arterial structures rather than from vasoconstriction in the resistance vessels or changes in cardiac output. An additional key finding was that posture can influence both the type and the extent of the cardiovascular responses to caffeine ingestion. Both diastolic pressure and arterial compliance increased only in the upright posture while the pharmacological effects of caffeine on systolic pressure, diastolic pressure, arterial compliance and aortic impedance were all more pronounced in the upright than the supine posture. This result suggests that the tonus of the vascular system, which is greater in This journal is ª The Royal Society of Chemistry 2011

View Online

the upright than the supine posture, modulates caffeine’s pharmacodynamics. Furthermore the study found that 67 mg caffeine increased dp/dt and peripheral resistance in the upright posture suggesting that low levels of caffeine may modulate autonomic outflow.

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

Blood pressure responses to caffeine Caffeine levels in the range of 30 to 150 mg per serving are present in the beverages coffee and tea as well as carbonated beverages and pharmaceutical products.4 Caffeine induced maximal blood pressure increases occur approximately 60 min after intake for both non-users40 and overnight abstaining nonusers.41 This study’s findings indicate that habitual coffee and tea drinkers, consuming two to six servings daily, as well as nondrinkers (i.e. nearly everyone) can be expected to experience transient blood pressure increases within half an hour to an hour of consuming products containing roughly 67 mg to 133 mg caffeine. These blood pressure increases may corrupt blood pressure measurements either undertaken in clinical patients or collected in epidemiological research. Notably smokers, the elderly, hypertensives and the caffeine-naive experience greater pressor effects from caffeine ingestion.7 It has been recommended that clinical blood pressure measurements should be adjusted to account for recent caffeine intake;42 however, this approach is problematical due to the inconsistent levels of caffeine present in coffee and tea (see Introduction) as well as the risk that testees unknowingly consume caffeine in pharmaceutical preparations. Consequently we suggest that where accurate blood pressure measurements are critical measurements could be obtained after at least two hours of fasting or before breakfast.

The vascular effects of caffeine Blood pressure, rather than being directly regulated, is determined by a mixture of cardiac activity and vascular tonus following feedback from the baroreceptors. The cardiac parameters include heart rate, dp/dt, stroke volume, cardiac output (heart rate x stroke volume) while the vascular parameters include arterial compliance and peripheral resistance. In this study the increases in blood pressure resulted primarily from a decreased arterial compliance. In the upright posture the decreases in arterial compliance were highly significant for both the 67 (p ¼ 0.009) and 133 (p ¼ 0.001) mg interventions and close to significant in the supine posture: p ¼ 0.062 and p ¼ 0.057 respectively. Heart parameters were unchanged except for a relativity small increase in dp/dt (p ¼ 0.034) for 67 mg upright which was accompanied by a relatively small increased indexed peripheral resistance (p ¼ 0.045). These relatively small changes may have resulted from either local effects in both structures or from increases in sympathetic outflow.2 In other studies a similar finding, increased aortic stiffness, has been reported following caffeine intake for both normotensives and treated hypertensives.21,41,43 Subsequently it has been suggested that measures of brachial blood pressure may not accurately represent the cardiovascular responses to caffeine intake and that measure of aorta/arteries are appropriate.21 The results of this study indicate that the inclusion of arterial/aortic measurements adds This journal is ª The Royal Society of Chemistry 2011

important useful information to studies investigating responses to cardiovascular agents. The biphasic response The finding that for habitual coffee and tea drinkers the lower doses of 67 and 133 mg increase blood pressure, indicating a lack of complete tolerance, but not higher dose of 200 mg follows a pattern that is consistent with previous research but that has not previously been noted in the literature. This pattern of blood pressure increases is similar to the results from other studies using an intervention dose of low (<100 mg or < 1.6 mg(kg) to moderate (100 to 200 mg) caffeine levels where blood pressure increases were reported18,19 and other studies using high (200 to 300 mg) or very high ($300 mg) intervention doses which reported complete tolerance.17,20,21,26,27 The present findings present a similar pattern to another study using the multiple intervention doses of 1.5, 3 and 6 mg kg1 (for a 65 kg person this equates to 95, 190 and 380 mg respectively). Complete tolerance was reported at the highest dose while increases of z 10/5 and z 8/4 mm/Hg were reported for the 1.5 and 3.0 mg kg1 respectively. The observed pattern of blood pressure changes in response to caffeine is a biphasic response which is in stark contrast to the anticipated standard log dose-response curve.2 The biphasic response indicates that at the lower doses caffeine’s pressor effect is active while at the higher dose some other mechanism reduces the pressor effect resulting in the phenomenon of tolerance. As caffeine’s pressor effect is not fully active at the lower doses of 67 and 133 mg the mechanism responsible for caffeine tolerance at higher doses is unlikely to be an increased number of adenosine receptors, a conclusion which is consistent with pharmacological reviews.2 It has been demonstrated that the baroreflex system develops tolerance with continuous caffeine usage44 however there were no changes noted in spontaneous baroreflex sensitivity for any the doses. Furthermore there no changes in either heart rate or cardiac output so there is no evidence that the baroreflex system was involved in producing tolerance at the 200 mg dose. Other actions of caffeine, including adrenal activation,12 inhibition of phosphodiesterases, blockade of GABA receptors and the release of intracellular calcium,2 have only been reported at doses much greater than 200 mg. A possible mechanism to account for the biphasic response is that higher doses of caffeine simultaneously produce vasodilation. Caffeine doses of 300 mg have been shown to produce acute forearm blood flow vasodilation in response to acetylcholine leading the authors to suggest that acute administration of caffeine augments endothelium-dependent vasodilation through an increase in nitric oxide production’’.45 However, as yet caffeine has not been shown to effect basal nitric oxide release in the vasculature.46 Thus on the basis of current knowledge the observed biphasic response remains unexplained as is the phenomenon of tolerance itself. Posture Posture affected both the type and the extent of the vascular responses but had virtually no effect on the cardiac responses. Compared to supine measures arterial compliance decreased 20% and indexed peripheral resistance increased 35% in the upright Food Funct., 2011, 2, 197–203 | 201

View Online

posture. We postulate that the reason why the pharmacological effects of caffeine on systolic pressure, diastolic pressure, arterial compliance and aortic impedance were all more pronounced in the upright than the supine posture was that the endothelium was sensitised by the increased tonus of the vascular system making it more susceptible to caffeine’s pressor effects. The effect of posture on pharmacodynamics is unclear but this study’s findings indicate that posture has a major influence on the pharmacodynamics of caffeine and perhaps other cardiovascular drugs.

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

Implications for public health This study indicates that caffeine users may experience clinically important blood pressure increases resulting from their normal regular consumption of caffeine. While this finding is relevant to the accuracy of blood measurements which is the basis of hypertension treatments47 it does not indicate that the consumption of either caffeine or caffeine containing beverages has a negative impact on health. In fact there is large amount of research indication that habitual coffee and caffeine consumption does not increase cardiovascular risk.7,48–51 The changes in aortic impedance occurring at both 67 and 133 mg in the upright posture raise the possibility that caffeine present in both energy drinks and some sport supplements may have a negative impact on physically active consumers. In particular if these caffeine induced increases in aortic impedance were amplified with physical activity then extra demands would be placed on the heart. These finding also indicate that aortic/ arterial measures have role to play when assessing the pharmacological impact of drugs on the cardiovascular system. Limitations and robustness of the present study This study did not include a period of caffeine abstinence and without testing the participants in abstinence conditions it is unclear whether the participants exhibited partial tolerance or not to the 67 and 133 mg doses. However, our aim was to investigate if blood pressure increases occurred rather than to assess the degree of tolerance developed by habitual coffee and tea consumption. Also no attempt was made to regulate or monitor consumption levels prior to a test session. There were several reasons for this: 1. caffeine levels vary enormously10 as noted in the Introduction and therefore calculations of individual intake based on averages are inherently accurate; 2. caffeine consumers seem to titrate their caffeine intake and so increase beverage intake when they are caffeine deprived;52 3. the requirement for experimental participants to record their caffeine consumption may modify their consumption pattern; 4. there is a risk that when monitoring caffeine consumption the interpretation of the study’s results will be based on this potentially imperfect system e.g. questionnaires are less accurate than diaries in establishing recording the consumption of caffeinated beverages.53 Errors in monitoring may lead to an erroneous data interpretation. As increases in blood pressure have been reported to be inversely proportional to serum caffeine levels19,46 it may be the participants had lower caffeine plasma levels prior to the 67 and 202 | Food Funct., 2011, 2, 197–203

133mg test sessions than prior to the 200 mg session. Consequently we cannot exclude the possibility that variable caffeine intake leading to reduced plasma levels prior testing is responsible for the pattern of blood pressure responses. This factor could have been controlled if we had undertaken caffeine salivary testing prior to each test session. The major strengths of the present study are that the same participants were tested over a range of caffeine levels. Additionally participants were tested at two post-ingestion intervals and in two postures. Furthermore the measurements were derived from 90 s continuously recorded segments which included between 80 and 120 individual measurements.

Conclusion The results of this study indicate that the habitual coffee and tea drinkers can experience blood pressure increases when consuming caffeine at the doses found in the commonly consumed beverages tea, coffee, cola soft-drinks and energydrinks as well as in many pharmaceuticals. Consequently it can be anticipated that many people will experience increases of blood pressure, which are larger in the upright posture, in the hour after consuming products containing caffeine whether they are habitual caffeine users or not. Accordingly care should be taken in clinical assessments of blood pressure to exclude the presence of caffeine induced blood pressure changes. Currently the impact of caffeine on blood pressure is underestimated in the literature and caffeine usage does not feature in hypertension discussions.54 Tolerance to caffeine’s pressor effect appears to be dependent on the size of the intervention dose and there is at best only partial tolerance to caffeine at the levels commonly consumed.

Acknowledgements Caffeine capsules were donated by Dr Brian Whitton of Whitehorse Nutriceuticals.

References 1 A. Nehlig, J.-L. Daval and G. Debry, Brain Res. Rev., 1992, 17, 139– 170. 2 J. W. Daly and B. B. Fredholm, Drug Alcohol Depend., 1998, 51, 199– 206. 3 J. E. James, Psychosom. Med., 2004, 66, 63–71. 4 K. L. Durrant, Journal of the American Pharmaceutical Association, 2002, 42, 625–637. 5 S. C. Sweetman, ed., Martindale. The complete drug reference, Pharaceutical Press, London, UK, 2002. 6 P. J. Green, R. Kirby and J. Suls, Annals of Behavioral Medicine, 1996, 18, 201–216. 7 P. Nawrot, S. Jordan, J. Eastwood, J. Rotstein, A. Hugenholtz and M. Feeley, Food Addit. Contam., 2003, 20, 1–30. 8 C. D. Frary, R. K. Johnson and M. Q. Wang, J. Am. Diet. Assoc., 2005, 105, 110–113. 9 S. V. Heatherley, E. L. Mullings, M. A. Tidbury and P. J. Rogers, Appetite, 2006, 47, 266–266. 10 Food Standard Agency, Survey of Caffeine Levels in Hot Beverages, United Kingdom, 2004. 11 C. J. Reissig, E. C. Strain and R. R. Griffiths, Drug Alcohol Depend., 2009, 99, 1–10. 12 M. al’Absi and W. R. Lovallo, ed., Caffeine’s Effects on the Human Stress Axis, CRC Press, Boca Raton, USA, 2004. 13 M. Bonati, R. Latini, F. Galletti, J. Young, G. Tognoni and S. Garattini, Clin. Pharmacol. Ther., 1982, 32, 98–106.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 17 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00166J

View Online

14 A. Smith, Food Chem. Toxicol., 2002, 40, 1243–1255. 15 N. P. Riksen, G. A. Rongen, D. Yellon and P. Smits, Eur. J. Pharmacol., 2008, 585, 220–227. 16 P. Smits, P. Boekema, R. Deabreu, T. Thien and A. Vantlaar, J. Cardiovasc. Pharmacol., 1987, 10, 136–143. 17 D. Robertson, D. Wade, R. Workman, R. L. Woosley and J. A. Oates, J. Clin. Invest., 1981, 67, 1111–1117. 18 J. E. James, J Cardiovasc Risk, 1994, 1, 159–164. 19 I. B. Goldstein, D. Shapiro, K. K. Hui and J. L. Yu, Psychosom. Med., 1990, 52, 337–345. 20 R. Haigh, G. Harper, M. Fotherby, J. Hurd, I. Macdonald and J. Potter, Eur. J. Clin. Pharmacol., 1993, 44, 549–553. 21 W. S. Waring, J. Goudsmit, J. Marwick, D. J. Webb and S. R. J. Maxwell, American Journal of Hypertension, 2003, 16, 919– 924. 22 M. Hasenfratz and K. Battig, Psychopharmacology, 1994, 114, 281– 287. 23 J. D. Lane and D. C. Manus, Psychosom. Med., 1989, 51, 373–380. 24 M. G. Myers, Hypertension, 2004, 43, 724–725. 25 P. J. Rogers, J. E. Smith, S. V. Heatherley and C. W. Pleydell-Pearce, Psychopharmacology, 2008, 195, 569–577. 26 R. J. Barry, A. R. Clarke, S. J. Johnstone and J. A. Rushby, Biol. Psychol., 2008, 77, 304–316. 27 R. J. Barry, J. A. Rushby, M. J. Wallace, A. R. Clarke, S. J. Johnstone and I. Zlojutro, Clin. Neurophysiol., 2005, 116, 2693–2700. 28 P. J. Durlach, R. Edmunds, L. Howard and S. P. Tipper, Nutr. Neurosci., 2002, 5, 433–442. 29 P. T. Quinlan, J. Lane and L. Aspinall, Psychopharmacology, 1997, 134, 164–173. 30 G. Mancia, A. Ferrari, L. Gregorini, G. Parati, G. Pomidossi, G. Bertinieri, G. Grassi, M. di Rienzo, A. Pedotti and A. Zanchetti, Circ Res, 1983, 53, 96–104. 31 J. J. van Lieshout and K. H. Wesseling, Br. J. Anaesth., 2001, 86, 467– 468. 32 G. J. Langewouters, J. J. Settels, R. Roelandt and K. H. Wesseling, J. Med. Eng. Technol., 1998, 22, 37–43. 33 I. Guelen, B. E. Westerhof, G. L. van der Sar, G. A. van Montfrans, F. Kiemeneij, K. H. Wesseling and W. J. W. Bos, Blood Press. Mon., 2003, 8, 27–30. 34 I. Guelen, F. U. S. Mattace-Raso, N. M. van Popele, B. E. Westerhof, A. Hofman, J. C. M. Witteman and W. J. W. Bos, J. Hypertens., 2008, 26, 1237–1243. 35 I. Guelen, B. E. Westerhof, G. L. van der Sar, G. A. van Montfrans, F. Kiemeneij, K. H. Wesseling and W. J. W. Bos, J. Hypertens., 2008, 26, 1321–1327.

This journal is ª The Royal Society of Chemistry 2011

36 J. J. van Lieshout, K. Toska, E. J. van Lieshout, M. Eriksen, L. Walloe and K. H. Wesseling, Eur. J. Appl. Physiol., 2003, 90, 131–137. 37 M. P. M. Harms, K. H. Wesseling, F. Pott, M. Jenstrup, J. von Goudoever, N. H. Secher and J. J. van Lieshout, Clin. Sci., 1999, 97, 291–301. 38 B. E. Westerhof, J. Gisolf, W. J. Stok, K. H. Wesseling and J. M. Karemaker, J. Hypertens., 2004, 22, 1371–1380. 39 J. N. S. Matthews, D. G. Altman, M. J. Campbell and P. Royston, Br. Med. J., 1990, 300, 230–235. 40 D. Robertson, J. C. Frolich, R. K. Carr, J. T. Watson, J. W. Hollifield, D. G. Shand and J. A. Oates, N. Engl. J. Med., 1978, 298, 181–186. 41 C. Vlachopoulos, K. Hirata and M. F. O’Rourke, J. Hypertens., 2003, 21, 563–570. 42 J. R. Mort and H. R. Kruse, Ann. Pharmacother., 2008, 42, 105–110. 43 C. Vlachopoulos, K. Hirata, C. Stefanadis, P. Toutouzas and M. F. O’Rourke, Am. J. Hypertens., 2003, 16, 63–66. 44 R. Mosqueda-Garcia, T. Ching-Jiunn, M. Appalsamy and D. Robertson, Eur. J. Pharmacol., 1989, 174, 119–122. 45 T. Umemura, K. Ueda, K. Nishioka, T. Hidaka, H. Takemoto, S. Nakamura, D. Jitsuiki, J. Soga, C. Goto, K. Chayama, M. Yoshizumi and Y. Higashi, Am. J. Cardiol., 2006, 98, 1538– 1541. 46 N. P. Riksen, P. Smits and G. A. Rongen, in Methylxanthines, ed. B. B. Fredholm, Springer-Verlag, Berlin Heidelberg, 2011, vol. 200, pp. 413–437. 47 T. G. Pickering, J. E. Hall, L. J. Appel, B. E. Falkner, J. Graves, M. N. Hill, D. W. Jones, T. Kurtz, S. G. Sheps and E. J. Roccella, Hypertension, 2005, 45, 142–161. 48 J. A. Greenberg, G. Chow and R. C. Ziegelstein, Am. J. Cardiol., 2008, 102, 1502–1508. 49 E. Lopez-Garcia, R. M. van Dam, W. C. Willett, E. B. Rimm, J. E. Manson, M. J. Stampfer, K. M. Rexrode and F. B. Hu, Circulation, 2006, 113, 2045–2053. 50 J. N. Wu, S. C. Ho, C. Zhou, W. H. Ling, W. Q. Chen, C. L. Wang and Y. M. Chen, Int. J. Cardiol., 2009, 137, 216–225. 51 L. Frost and P. Vestergaard, Am. J. Clin. Nutr., 2005, 81, 578–582. 52 L. D. Stafford and M. R. Yeornans, Behav. Pharmacol., 2005, 16, 559–571. 53 R. A. Knibbe and Y. T. de Haan, in Nicotine, Caffeine and Social Drinking, ed. J. Snel and M. M. Lorist, Harwood Academic Publishers, Amsterdam, 1998, ch. 11, pp. 229–243. 54 L. J. Appel, M. W. Brands, S. R. Daniels, N. Karanja, P. J. Elmer and F. M. Sacks, Hypertension, 2006, 47, 296–308.

Food Funct., 2011, 2, 197–203 | 203

View Online

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 204

PAPER

www.rsc.org/foodfunction

Antiproliferative mechanisms of quercetin in rat activated hepatic stellate cells Li-chen Wu,*ab In-wei Lu,a Chi-Fu Chung,b Hsing-Yu Wub and Yi-Ting Liub

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

Received 26th October 2010, Accepted 2nd March 2011 DOI: 10.1039/c0fo00158a Quercetin, rich in fruits and vegetables, has been used as a nutritional supplement because of its antiinflammatory and antioxidative properties. Its positive effects on anti-hepatic fibrosis have also been suggested. However the anti-hepatofibrotic mechanisms upon which quercetin acts have yet to be well characterized. In the present study, we investigated the anti-proliferative effect of quercetin on activated hepatic stellate cells (aHSCs), the central role of hepatofibrosis, and evaluated the proteins involved in growth inhibition by a 2D gel electrophoretic analysis. Activated HSCs were isolated from Sprague Dawley rats and were spontaneously activated in vitro. Quercetin restrained the proliferation of aHSCs rather than quiescent HSCs and heptotcytes by inducing a G1 arrest as examined by cell cycle analysis and evidenced by increased levels of p53, p21CIP1/WAF1, as well as p27KIP1, and decreased abundance of cyclins (D1, D2, A, E). An apoptosis through extrinsic pathway as demonstrated by elevated expression of Fas/Fas ligand (FasL), annexin V labeling, chromatin condensation, sub-G1 fraction (7.39%), caspase-3 activity, was also observed. The 2D electrophoresis analysis revealed that quercetin negatively regulated protein molecules associated with metabolism (a-enolase, phosphoglycerate kinase), survival, cytokinesis (tubulin), and protein folding (protein disulfide isomerase A3) leading to cell growth retardation. Furthermore, quercetin might restrain HSC activation through reducing the levels of inflammatory cytokines (CXCL10, Midkine). Taken together, quercetin exerted diverse mechanisms to inhibit the growth of aHSCs. Proper consumption of quercetin could be beneficial to control the progression of heptofibrosis.

Introduction Quercetin, a flavonol distributed widely in foods such as citrus fruits, onions and buckwheat, is claimed to be associated with several health benefits, including cardiovascular disease prevention, anti-ulcer, anti-viral, anti-cancer and anti-inflammatory activity.1 This flavonol has been determined to be safe to humans and is classified as IARC group 3, inadequate evidence of carcinogenicity in humans. Obtaining sufficient amounts of quercetin is usually achieved by consumption of dietary supplements that contain higher amounts of quercetin than would typically be found in food sources. The dose of quercetin and rutin (quercetin-3-rutinoside) in dietary supplements is approximately 1200–1500 mg per day (400–500 mg, 3 times a day),2 which could cover the biopreventative doses at 500 and 730 mg per day for sarcoidosis (for 4 successive days)3 and hypertension (for 28 successive days),4 respectively. In addition, an animal study suggested that the consumption of approximately 600 mg of quercetin and rutin potentially reduced precancerous lesions in the large intestine.2 a Department of Applied Chemistry, National Chi Nan University, Puli, Nantou, 545, Taiwan. E-mail: [email protected]; Fax: +886-492917956; Tel: +886-49-2910960 b Graduate Institute of Biomedicine and Biomedical technology, National Chi Nan University, Puli, Nantou, 545, Taiwan

204 | Food Funct., 2011, 2, 204–212

Significant recovery of hepatofibrosis through treatment with quercetin has also been indicated. A study revealed that consumption of quercetin at 70 mg kg1 for 8 weeks significantly reduced CCl4-induced liver fibrosis.5 It was also reported that quercetin behaves as a potent aHSC (activated hepatic stellate cells) inactivator as evidenced by the significant reduction of TGF-b expression after quercetin administration to dimethylnitrosamine-induced liver damage.6 Additionally, quercetin has been noted to inhibit aHSCs proliferation in vitro through its interaction with PDGF receptors/receptor tyrosine kinase and the downstream MAPK pathway.7 HSCs, the core of hepatofibrosis, transform from their quiescent phenotype to activated states (myofibroblast-like cells) under the effects of fibrogenic stimuli to perpetuate fibrosis through the amplification of the extracellular matrix (ECM). Reduced levels of aHSCs were usually observed during the resolution of hepatofibrosis in acute human liver injuries due to their eradication by NK cells,8 the proceeding of apoptosis through enhanced expression of CD95L (Fas ligand) and p53,9 and the restrained TIMP-1 expression.10 Accordingly, the induction of growth inhibition or cell death of aHSCs becomes a potential strategy to treat hepatofibrosis. The search for novel compounds to ameliorate hepatofibrosis is essential in treating liver diseases, and thus the discovery of the underlying mechanisms appears equally critical. The efficacy of This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

View Online

quercetin on hepatofibrosis has been indicated; however the associated mechanisms of quercetin-induced antiproliferative effect on aHSCs are not well-characterized. In the present study, we investigated the factors that contributed to this effect. The cell cycle analysis and apoptotic-associated protein molecules were examined to reveal possible mechanisms. The protein profiles of quercetin-treated aHSCs were also analyzed to explore more factors related to the induced cell growth retardation and bioactivities modulated by quercetin. Results show that quercetin restrains aHSC proliferation by arresting cell cycle at G1 phase and enhancing Fas/FasL expression to lead to apoptosis through extrinsic pathway. Additionally, quercetin modulated several bioactivities including metabolism, cytokinesis, protein folding, oxido-reduction, and inflammation. Taken together, our findings suggested that quercetin acts as a multiple-function modulator that not only regulates the growth of aHSCs, but also mediates the inflammatory responses to reduce the progression of hepatofibrosis.

5  104 cells/well). After stabilization for 12 h, aHSCs were cocultured without or with a series of quercetin (25, 50, 75 and 100 mM) for 24 h. The control group is vehicle-treated (dimethyl sulfoxide, DMSO) cells. The results were measured at absorbance 570 nm and expressed as a percentage (%) of the control. The anti-proliferative effect was measured using BrdU kit (Roche Diagnostic, Germany). Activated stellate cells (1  104 cells/well) were cultured in 96-well plates for 12 h, followed by the treatment of quercetin at 25, 50, 75, and 100 mM for 24 h. Cells were labeled with 10 mM BrdU for another 2 h. The absorbance of the samples was measured with ELISA reader at 450 nm. For cell morphology monitoring, aHSCs were plated in 6-well plates at a cell density of 2  105 cells/well. After stabilization for 12 h, the medium were changed to fresh conditioned medium containing 75 mM quercetin for 24 h. The morphologic changes in aHSCs were observed with a phase-contrast microscope (Olympus, Tokyo, Japan). Apoptosis

Materials and methods Chemicals and reagents Dulbecco’s modified Eagle medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin and trypsin-EDTA were purchased from Hyclone Inc. (Logam, UT, USA). Quercetin, DMSO, MTT, DTT, and propidium iodide were from Sigma (St. louis, MO, USA). Culture plates were from NUNC (Roskidle, Denmark). Annexin V-FITC apoptosis detection kit I, anti-Fas and anti-Fas ligand (FasL) were purchased from BD Biosciences (San Jose, CA, USA). Anti-b-actin, anti-cyclin D1, anti-cyclin D2, anti-a-tubulin, anti-b-tubulin, anti-a-enolase, anti-Prx-V, anti-p-IkBa, anti-nuclear factor kB (anti-NFkB, p65) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Protein assay kit was from Bio-Rad protein assay (Hercules, CA, USA). Caspase-3 colorimetric assay kit was from R&D system (Minneapolis, MN, USA). Nuclear extraction kit was from Panomic (Fermont, CA, USA). Primary hepatic and hepatic stellate cells isolation and culture Primary hepatic cells were prepared as described by Seglen (1976).11 Hepatic stellate cells (HSCs) were prepared from Sprague Dawley rat liver as described by Kawada et al.7 The liver was perfused, digested with pronase and collagenase, and then excised. After further digestion with pronase and collagenase, the resulting suspension was filtered and centrifuged on a 11% (v/v) Nycodenz cushion (Sigma, St. Louis, MO, USA), which produced a stellate cell-enriched fraction in the upper whitish layer. These cells were cultured in DMEM supplemented with 10% FBS and antibiotics (70 mg L1 penicillin and 100 mg L1 streptomycin) at 37  C with a humidified atmosphere of 5% CO2. HSCs were activated for 6 passages and used throughout the study.

Cell cycle and sub-G1 analysis by flow cytometer. Activated HSCs were plated in 6-well plates 2  105 cells/well). Cells were serum-starved (0.5% FBS) for 24 h prior to the addition of quercetin at 75 mM for 24 h. Cells were collected by trypsinization after 0, 6, 12 and 24 h, and fixed with 1 mL 75% (v/v) alcohol for 13 h at 4  C Cells were kept on ice until analysis. Sub-G1 analysis was analyzed using a Becton-Dickinson FACScan flow cytometer. Cell cycle was analyzed using the ModTit LT3.0 software program. Annexin V staining. The apoptosis of cells were analyzed with Annexin V-FITC apoptosis detection kit I. Activated HSCs were plate in 6-well plates 2  105 cells/well) and treated with different concentrations of quercetin (10, 30, 50 and 75 mM). Cells were analyzed using the Becton-Dickinson FACScan and CellQuest software program. DAPI staining. Activated HSCs were cultured in 6-well dishes (2  105 cells/well) and treated with 75 mM quercetin for 24 h. Cells were initially fixed with 3.7% (v/v) paraformaldehyde for 10 min, followed by repeated washes with PBS. After incubation with 0.2% (v/v) Triton X-100 for 5 min, cells were then washed again and stained with DAPI for 5 min. The chromatin changes were monitored by fluorescence microscopy. Caspase-3 activity assay. Activated HSCs were cultured in 15 cm dishes (2  106 cells/dish), and treated with quercetin (75 mM) for 24, 36, 48, and 72 h. Cells were firstly collected after being washed with PBS. The supernatant was then removed, and the cell pellets were lysed by lysis buffer (25 mL/106 cells). The caspase-3 activity was determined by following the manufacturer’s instructions. Two-dimensional (2D) gel electrophoresis

Cell viability, proliferation and cell morphology monitoring Cell viability was detected by the MTT assay (3,4,5-dimethylthiazol-2-yl-2,5-diphenyl- tetrazolium bromide, MTT; 5 mg mL1 in PBS). Activated HSCs were previously plated in 12-well plates This journal is ª The Royal Society of Chemistry 2011

Protein extraction. HSCs were plated in 15 cm dishes (7.5  106 cells/dish), and treated with 75 mM quercetin for 24 h. Cells were collected and lysed in lysis buffer with freeze-thaw. Cell lysates were then centrifuged (12 000  g) for 15 min at 4  C. The Food Funct., 2011, 2, 204–212 | 205

View Online

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

cytosolic proteins in the supernatant were collected and dialyzed to remove salts. The protein was stored at 80  C until use. Protein concentration was determined by the Bio-Rad protein assay kit (Hercules, CA, USA). 2D electrophoresis. Isoelectric focusing (IEF) was carried out on an Ettan IPGphor isoelectric focusing system (Pharmacia Biotech, Uppsala, Sweden) by using 18-cm IPG strips (pI 3–10). Protein (350 mg) was added to rehydration solution (8 mmol L1 urea, 4% (v/v) CHAPS, 2% (v/v) IPG buffer, 0.002% (v/v) bromophenol blue). The strips were rehydrated with samples at 30 V for 12 h. IEF was initially performed at 100 V for 1 h, followed by linearly voltage change to 500 V for 1 h. Afterwards, voltage was held sequentially at 1000 V for 1.5 h, 5000 V for 1.5 h, and 8000 V for 3 h. The IPG gel strip was incubated in the first equilibration solution containing 1% (v/v) DTT, followed by the second equilibration solution containing 2.5% (v/v) iodoacetamide before the second-dimensional electrophoresis, which was carried out at 30 V for 4 h. Proteins were observed by staining with colloidal Coomassie Blue.

Immunoblot analysis aHSCs were cultured in 10-cm dishes (2  106 cells/dish) with medium containing 75 mM quercetin for 24 h. Cells were lysed in RIPA buffer (50 mmol L1 Tris-HCl, pH 7.4, 150 mmol L1 NaCl, 1% (v/v) NP-40, 5 mmol L1 EDTA, 1 mmol L1 DTT, 1 mmol L1 Na3VO4 amd 1 mmol L1 PMSF) and centrifuged at 12 000  g for 15 min at 4  C. The cytosolic proteins in supernatant were collected and their concentrations were determined before SDS-PAGE separation. Proteins were then transferred onto a PVDF membrane for immunoblotting. Protein blots were exposed to X-ray film (Amersham Pharmacia Biotech, Uppsala, Sweden) by ECL detection reagents. Statistical analysis Data were presented as mean  standard deviation. Statistical significance was analyzed by one-way ANOVA. Values of P < 0.05 were considered significant.

Results Computer analysis. Protein spots were quantified using the ImageMaster 2D Platinum V 5.0 software (Amersham Pharmacia Biotech). Gel spots that significantly differed from their counter spots were highlighted and checked manually to eliminate any artifacts due to gel distortions, abnormal staining or inappropriately matched or badly detected spots. In-gel digestion. In-gel digestion was modified from previous studies.12 Briefly, the 2D gel spots were excised, and the coomassie stain was removed by 50 mM NH4HCO3 in 50% (v/v) acetonitrile, and dehydrated with acetonitrile. Gels were digested with trypsin and 0.1% n-octyl-glucopyranoside in 50 mmol L1 NH4HCO3. The solution was dried and then resuspended in 5 mL of 0.1% (v/v) trifluoroacetic acid (TFA) for MALDI-TOF analysis with a-cyano-4-hydroxy-trans-cinnamic acid (CHCA) as matrix solution. The isolated protein spots were identified by matching the obtained peptide mass data to the protein database, MASCOT (http://www.matrixscience.com) software program. Reverse transcription polymerase chain reaction (RT-PCR) analysis Total cellular RNA was prepared from 6  106 cells/sample according to the manufacturer’s instructions provided for Trizol reagents (Invitrogen, Carlsbad, CA, USA). The RT-PCR reaction was conducted with 500 ng of total RNA, reverse transcriptase (Super Script III, Invitrogen), and oligo dT18 primers. The primers used for specific genes were listed as following; protein disulfide-isomerase A3 (PDIA3): forward primer 50 -GATGGTGGCAAAG- ACATTCC-30 and reverse primer 50 -CACGGCCACCTTCATACTTC-30 ; cytokine B10 (CXCL-10): forward primer 50 -GCATCGACTTCCATGAACAGAC-30 and reverse primer 50 -TAGGTTCCTGTGAGTATTCTGAGTTATG-30 ; Midkine: forward primer 50 -GTTGCCCTCTTGGCTGTCAC-30 and reverse primer 50 -TGGTCTCCTGGCA- CTGGGCA-30 ; GADPH: forward primer 50 -AGCCCAGAACATCATCCCTGC-30 and reverse primer 50 -TAGCCCAGGATGCCCTTTAGT-30 . 206 | Food Funct., 2011, 2, 204–212

Anti-proliferative effect and morphological alterations of quercetin on rat hepatic cells (HCs) and activated quiescent hepatic stellate cells (aHSCs and qHSCs) The anti-proliferative effect of quercetin on rat HCs, qHSCs and aHSCs is revealed in Fig. 1A, B. Several concentrations of quercetin (0, 25, 50, 75, and 100 mM) were co-cultured with HCs, qHSCs, and aHSCs for 24 h. Significant (P < 0.01) growth inhibitory effects on aHSC appeared dose-dependently, and reached 61.0% at 75 mM, whereas no significant inhibition was shown at the same quercetin level for HCs (91.0%) and qHSCs (95.3%) (Fig. 1A). Additionally, as shown in Fig. 1B, quercetin dose-dependently suppressed the BrdU incorporation, indicating that quercetin is a potential growth inhibitor for aHSCs. Moreover, blebbed aHSCs increased upon increasing the quercetin concentration (at 75mM), indicating that quercetin is cytotoxic toward rat aHSCs (Fig. 2B). According to the cytotoxicity results of these cell types, quercetin level at 75 mM was selected for the following study. Furthermore, based on the results demonstrated in Fig. 1A, B, the growth inhibitory effect of quercetin was found specifically on aHSCs, but not significantly in normal hepatocytes and quiescent HSCs. Therefore normal hepatocytes and quiescent HSCs were excluded from the follow-up studies; only the aHSC was subjected to the investigation of mechanism of action at the molecular level on quercetin-induced cell death. Quercetin arrests the cell cycle in aHSCs at G1 stage We further examined the cell cycle profile of aHSCs to delineate quercetin-induced anti-proliferative effect. The cell cycle profiles were determined at different time points (0, 6, 12, and 24 h) after quercetin treatment. Cells were synchronized by serum starvation in a medium containing 0.5% serum. After incubation for 24 h, cells re-entered the cell cycle through an exchange of 5% FBS medium in the presence or absence of quercetin at 75 mM. The percentage of DNA contents at G1 phase were 87.0% and 72.5% with and without quercetin-treatment for 24 h, respectively (Table 1), indicating an arrest at G1 phase. This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

View Online

Fig. 1 Effects of cell viability and antiproliferation of quercetin on primary cells. Cell viability of qHSC( ), aHSCs (-) and hepatic cells (,) (A); Antiproliferative effect of aHSCs (-) (B). Cells were cultured with quercetin at 25, 50, 75, and 100 mM for 24 h. Data were expressed at mean  SD from three different experiments. The asterisk (*) indicates a significant difference from the control group (*, P < 0.05; **, P < 0.01).

Quercetin induces HSC apoptosis Apoptotic analysis was performed to delineate quercetin-induced cell death (Fig. 2A–C). Results of annexin V staining showed that significant fluorescent intensity (P < 0.01) showed in a dosedependent manner ranging from 15% to 58% upon increasing quercetin concentration (from 10 to 75 mM) in quercetin-treated aHSCs (Fig. 2A). Additionally, chromatin condensation and cell blebbing also increased as revealed by DAPI staining (Fig. 2B). The induced apoptosis was further characterized by the existence of sub-G1 phase (Fig. 2C, 7.39% at 24 h, 75 mM quercetin); elevated caspase-3 activity (Fig. 3A, a 1.5-fold increase, with quercetin vs. without, 0.37 vs. 0.25 a.u., respectively, 75 mM, 24 h, P < 0.05). Moreover, treating with caspase inhibitor, z-VAD-fmk, protected aHSCs from death dose-dependently (Fig. 3B). To further explore molecules associating with quercetininduced apoptosis, investigation on the expression of cell cycle-, apoptosis pathway-, and cell survival-related molecules was performed. Results of immunoblot analysis (Fig. 4A, B) reveals that quercetin (75 mM, 24 h) significantly elevated the abundance of cell cycle regulatory proteins p27KIP1, p21CIP1/WAF1, and p53, but suppressed the expression of cyclins D1, D2, A, and E, insinuating a classic G1 arrest. The up-regulation of apoptosisassociated molecules such as cytochrome c, Fas, and FasL This journal is ª The Royal Society of Chemistry 2011

Fig. 2 Determination of quercetin induced apoptosis. Activated HSCs (2  105 cells/well in 6-well plate) were incubated with 10, 30, 50, 75 mM of quercetin for 24 h. Cells were then harvested and incubated with FITCconjugated annexin-V and propidium iodide (PI). FITC-positive/PInegative cells were measured by flow cytometry (A). HSCs were stained with DAPI (magnification, 200) after co-incubation with or without 75 mM quercetin for 24 h. Arrows indicate the condensation of chromatin (B). A sub-G1 peak appeared in 48 h with (right) or without (left) 75 mM quercetin treated histogram (C). The distribution of cells in DNA content was determined by ModFit LT 3.0 software. Data was expressed at mean  SD from three different experiments. The asterisk (*) indicates a significant difference from control group (*, P < 0.05; **, P < 0.01).

suggested the involvement of extrinsic apoptotic pathway. Moreover, the suppressed survival signals including phosphorylated Akt (p-Akt; Fig. 4A), phosphorylated IkBa (p-IkBa) (Fig. 7A) and nuclear NFkB (Fig. 7A) proteins, accompanied with the induced apoptosis. The hindered nuclear entry of NFkB was further examined by analyzing the nuclear NFkB proteinDNA binding activity. As seen in Fig. 5, the binding activity significantly (P < 0.05) decreased with the treatment (75 mM), suggesting a decreased abundance of nuclear NFkB proteins. Food Funct., 2011, 2, 204–212 | 207

View Online

Table 1 Cell cycle analysis. Activated HSCs were plated in 6-well plates 2  105 cells/well). Cells were serum-starved for 24 h prior to the addition of quercetin (75 mM). DNA content was analyzed using a FACScan flow cytometer. Cell cycle was analyzed using the ModTit LT3.0 software program Control

Quercetin

Time (h) G0/G1 (%) S (%) G2/M (%) G0/G1 (%) S (%) G2/M (%) 90.9 88.3 83.2 72.5

4.2 6.2 7.5 19.3

4.9 5.5 9.3 7.6

89.3 86.4 87.3 87.0

4.2 5.5 7.9 4.8

6.5 8.1 4.8 8.2

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

0 6 12 24

Fig. 4 Regulation of cell cycle- and apoptotic pathway-associated proteins by quercetin. Activated HSCs were treated with or without quercetin (75 mM) for 24 h. Cell cycle-associated-, survival- (A), and apoptotic pathway-associated proteins (B) were determined. The levels of proteins were analyzed by immunoblot analysis. The asterisk (*) indicates a significant difference from control group (**, P < 0.01).

Fig. 3 Quercetin-induced caspase-dependent cell death in activated HSCs. Activated HSCs were co-cultured with (,) or without (-) 75 mM quercetin for 24, 36, 48, and 72 h. Caspase activity was evaluated (A). Cells were co-cultured with quercetin (75, 150, 200, and 300 mM) and with (,) or without (-) z-VAD-fmk (50 mM) for 24 h (B). Cell viability was determined. The asterisk (*) indicates a significant difference between treated and untreated groups (*, P < 0.05; **, P < 0.01).

Identification of proteins modulated by quercetin and associated with quercetin-induced antiproliferative effect on aHSCs A 2D gel electrophoresis analysis was performed to study the proteins that were regulated by quercetin and were associated with quercetin-induced antiproliferative effect (Fig. 6). Extracts of aHSCs were loaded onto an 18 cm IPG strip (pH 3–10) and then run on a second-dimension SDS-PAGE apparatus (12%). 208 | Food Funct., 2011, 2, 204–212

Fig. 5 Decrease of nuclear NFkB—DNA binding activity by quercetin treatment in activated HSCs. Cultures were treated with 75 mM for 24 h. Activated NFkB p65 DNA binding activity was determined by enzymelinked immunosorbent assay according to the manufacturer’s instructions. Data were mean  SD of triplicates. The asterisk (*) indicates a significant difference from control group (*, P < 0.05).

Proteins were visualized using colloidal Coomassie Blue. After computer analysis of the protein profiles of quercetin-treated (75 mM, 24 h) and untreated groups, a total of 512 spots were detected. Among them, 74 spots were regulated by quercetin, and 10 spots were identified by MS analysis and fingerprint matching This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

View Online

Fig. 6 Two-dimensional electrophoresis of proteins from cellular fractions of activated HSCs. Isoelectric focusing was performed using immobilized pH gradients (IPG) 3–10. A total of 350 mg protein was applied per IPG gel. HSCs were derived from normal liver and were cultured for 9 days (in vitro activation, control). The procedures are referred to in ‘‘Materials and methods’’. Activated HSCs were treated with 75 mM quercetin for 24 h. The changes of down- and up-regulated proteins were displayed. The pointed spots were identified by MS analysis and peptide fingerprinting. Each result was from one of three different experiments with similar pattern.

(Fig. 6, Table 2). The down-regulated proteins included a-enolase, protein disulfide isomerase A3 (PDIA3), a-smooth muscle actin (a-SMA), tropomyosin 4, midkine (MK), cytokine B10 (CXCL-10), tubulin, and phosphoglycerate kinase (PGK). The up-regulated proteins were peroxiredoxin-V (Prx-V) and NFkB inhibitor (IkB). Some of these spots might be used as biomarkers for hepatofibrosis.

nuclear NFkB and p-IkBa) or RT-PCR (CXCL-10, PDIA3, and MK). Fig. 7A, B reveals that quercetin significantly inhibited the expression of a-enolase and tubulin a/b, whereas it enhanced the expression of Prx-V at protein level. It also decreased the expression of CXCL-10, PDIA3, and MK. Additionally, the abundance of pIkBa and nuclear NFkB were negatively modulated.

Validation of identified proteins

Discussion

The identified proteins from 2D gel electrophoresis analysis were validated by immunoblotting (a-enolase, Prx-V, tubulin a/b,

In the present study, we further characterized the molecules regulated by quercetin and the elements associated with

Table 2 Identification of quercetin-regulated proteins from activated HSCs No.

Accession No.

Name

Function

Coverage (%)

Matches

1 2

P04764 P11598

Glycolysis Protein folding

32% 23%

10 12

3 4 5 6

P68136 P09495 Q9R1S9 P48973

Contractile Contractile Inflammation Inflammation

29% 36% 55% 78%

10 11 5 5

7 8 9 10

P04691 P16617 Q9R063 Q8R2H1

a-Enolase Protein disulfide-isomerase A3 precursor (PDIA3) a-Smooth muscle actin (a-SMA) Tropomyosin a 4 chain Midkine precursor (MK) Small inducible cytokine B10 (CXCL-10) Tubulin b chain Phosphoglycerate kinase (PGK) Peroxiredoxin-V (Prx-V) NFkB inhibitor-like protein (IkB)

Cytokinesis Glycolysis Oxidoreduction NFkB inhibitor

21% 36% 50% 24%

6 11 8 5

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 204–212 | 209

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

View Online

Fig. 7 Validation of 2D electrophoresis analysis by immunoblot analysis or by RT-PCR (A). Activated HSCs were treated with or without quercetin (75 mM) for 24 h. Procedures of immunoblot analysis and RT-PCR were described in the section of Materials and Methods. The levels of immunoblot analysis and RT-PCR products were quantified by densitometer (B). The asterisk (*) indicates a significant difference from control group (*, P < 0.05; **, P < 0.01).

quercetin-induced antiproliferative and apoptotic effects on rat aHSCs. Quercetin significantly restricted the growth of rat aHSCs (Fig. 1), as consistent with a previous study,7 and showed no significant cytotoxicity on HCs and qHSCs. The examination of quercetin-induced mechanism of action on these two cell types at the molecular level is thus excluded. The antiproliferative effect induced by quercetin could be partly resulted from a cell cycle arrest at G1 phase with a suppressed expression of cyclins D1/D2, which guard the early G1 stage; and E/A, which guard the late G1 stage; as well as the activation of p27KIP1, p53 and its downstream effector p21CIP1/WAF1. In addition, we also found that the enhanced expression of extrinsic apoptotic pathway factors, Fas and FasL, might be responsible for quercetin-induced apoptosis. Cell-type-dependent cell cycle arrest induced by quercetin has been suggested such as the G1 phase13 and the G2/M phase.14 Interestingly, some cells, for example, lymphoblastic leukemia cells (HSB-2), are resistant to quercetin.15 It is known that antimitogenic signals (e.g. transforming growth factor-b and IL-6) mobilize nuclear p27KIP1 to disturb the function of cyclin E-cdk2 complex.16 This prevents the activation of S-phase specific transcription factor, such as E2F, and results in cell growth inhibition. The loss of this regulatory mechanism may lead to hyperproliferative disorders which are commonly 210 | Food Funct., 2011, 2, 204–212

seen in cancer cells. Generally, aHSCs constantly expressed TGF-b receptor (TGF-b-R) to receive the signals from TGF-b, unlike hepatocytes, which express TGF-b-R dependent on local environmental stimuli.17 The secretion of substantial amount of TGF-b to sustain the production of ECM is a feature of aHSCs. However, higher levels of TGF-b might probably lead to marked hypo-proliferation. Presumably, aHSCs prevent TGF-b-induced cell growth inhibition through the activation of PI3K-Akt pathway.18 In the present study, we revealed that quercetin was able to inactivate Akt phosphorylation and hence increase the abundance of p27KIP1 leading to a G1 phase cell cycle arrest. The toxicity of oxidized quercetin could possibly be associated with the induced apoptosis. It is indicated that the apoptosis of human chronic myeloid (K562) leukemia cells was linked to a similar toxicity.15 Quercetin is one of the most prominent antioxidants used commonly to scavenge free radicals, and it may become toxic after oxidation.19 In an antioxidant network,20 oxidized quercetin can be recycled through interactions with other antioxidants, such as ascorbic acid or glutathione (GSH). Nevertheless, the oxidized form of quercetin, ortho-quinone (Q), reacts preferably with thiol groups, rather than with ascorbic acid, to form adducts with GSH such as 6-GSQ or 8-GSQ19 and protein thiols.21 The presence of toxic quercetin-thiol adducts could interfere with enzyme activity such as quercetin-mediated arylation of glutathione-S-transferase-P1-1 at cysteine4722 or remove GSH from the antioxidant networks, leading to growth inhibition or cell death. Therefore, we suspected that the toxic adducts may be involved partially in the apoptotic effect. To further investigate proteins regulated by quercetin, a 2D electrophoresis study was performed. This analysis revealed that proteins involved in metabolism, cytokinesis, protein folding, oxido-reduction, inflammation, and cell survivability were regulated. In the aspect of metabolism, the expression of glycolytic proteins, such as a-enolase and phosphoglycerate kinase (PGK), was down-regulated (Table 2). Quercetin has been reported to inhibit glycolysis and gluconeogenesis in rat liver via the reduction of oxidative phosphorylation, the inhibition of Na+/K+-ATPase activity, and the suppressed expression of glucokinase and glucose 6-phosphatase.23 The decreased level of a-enolase and PGK caused by quercetin could also be another mechanism to hinder glycolysis. Besides that, elevated PGK levels have been reported in aHSCs.24 Therefore, quercetin could be used to limit the activation of HSCs. The results of 2D gel electrophoresis might reveal the link between glycolysis and apoptosis, which agreed with a previous finding that the two independent systems, glycolysis and apoptosis, maneuver an enzyme complex containing an apoptosis inducer (BAD) and a glycolytic protein (glucokinase) to modulate cell survival through maintaining glucose homeostasis.25 As mentioned above, oxidized quercetin could render cytotoxicity leading to cell death. The 2D gel analysis indicated that a cellular defensive mechanism was activated by promoting the expression of an oxido-reduction enzyme, peroxiredoxin-V (Prx-V), an ubiquitously expressed enzyme which possesses peroxynitrite reductase activity and antioxidant activity equivalent to that of catalase,26 to neutralize the oxidative stress resulted from oxidized quercetin. Similar to the oxidized quercetin that inactivates enzyme activity causing cell death, decreased expression of enzymes that This journal is ª The Royal Society of Chemistry 2011

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

View Online

catalyzes protein folding may also lead to cell growth inhibition or death. Our data suggested that a decreased expression of PDIA3, a nucleus- and ER-located enzyme responsible for the catalyzation of protein folding through the formation and breakage of disulfide bonds between cysteine residues, might result in the loss of normal protein functions leading to cell growth inhibition and cell death. Moreover, proteins involved in cytokinesis could be another factor in contributing to cell growth inhibition or cell death. The down-regulated expression of cytokinesis proteins, tublin a/b and tropomyosin 4, has been linked to restrained cell growth.27 Tubulin a/b constitutes microtubules to perform several cellular processes including mitosis, cytokinesis, and vesicular transport. The lack of tubulins could likely interfere with various cellular activities. In addition to tubulin, tropomyosin is also involved in cytokinesis. Tropomyosin, an actin-binding protein regulating actin mechanics, participates not only in cytokinesis, but also in cell contraction. Quercetin could likely regulate these two cytoskeleton proteins to inhibit cell growth or cell contraction to reduce portal hypertention caused by vasoactive substances.28 The regulation of cellular survival signaling was also observed by 2D gel analysis. The regulation of IkB and NFkB is critical to the viability of aHSCs. Activation of NFkB enhances the survival of stellate cells in the presence of apoptotic stimuli.29 NFkB usually binds with IkB in the cytoplasm prior to its activation. Once IkB is phosphorylated (p-IkB) by IkB kinase (IKK) and degraded by proteasome, NFkB enters the nucleus to regulate a number of genes, including the inhibitors of the caspase cascade.30 Our 2D electrophoresis results revealed an increased IkB level after quercetin treatment, indicating a likely restrained dissociation of NFkB from IkB. This could probably result in impeded NFkB nuclear translocation and reduced phosphorylation of IkB. The above hypothesis was confirmed by immunoblot analysis in which the levels of p-IkB and nuclear NFkB were significantly reduced after quercetin treatment. It was also noted that the activity of nuclear NFkB was suppressed. These results suggested that quercetin could possibly down-regulate the activation of NFkB, thereby resulting in subsequent cell death. Finally, quercetin may act as an inflammatory modulator. This flavonol was able to down-regulate CXCL-10 and midkine (MK). CXCL-10 is expressed by inflammatory cells, hepatocytes, and non-parenchymal intrahepatic cell populations.31 This chemokine functions as a potent interferon-g inducible chemoattractant of neutrophils and T-cells. Increased CXCL-10 level has been observed in human hepatitis C-associated cirrhosis32 and in liver transplant organ acceptance.33 Similar to CXCL-10, the pleiotropic growth factor MK is also associated with inflammatory responses and is active in cell proliferation, migration, and angiogenesis.34 Elevated levels of hepatic inflammation may substantially result in the activation of HSCs leading to hepatofibrosis.35 The down-regulation of inflammatory mediators, CXCL-10 and MK, could thus possibly lessen the degree of inflammation and reduce the activation of HSCs, thereby delaying the progress of hepatofibrosis.

Conclusion Taking dietary nutritional supplements on a regular basis to achieve beneficial effects on health has become common This journal is ª The Royal Society of Chemistry 2011

nowadays. Quercetin, a bioactive compound in the supplement, has gained attention for years because of its effectiveness on several bioactivities. Herein, we revealed that this flavonol may exert several mechanisms to induce the antiproliferative effect on aHSCs, a central role of hepatofibrosis, but not HCs and qHSCs. The progression of hepatofibrosis is likely to be limited by quercetin due to the reduced level of aHSCs either by restrained growth or by induction of apoptosis. Accordingly, it could be concluded that proper consumption of quercetin might be helpful to control the progression of hepatofibrosis.

Acknowledgements This work was supported by NSC96-2627-M-260-002, NSC972113-M-260-006-MY2, Taiwan National Science Council; TCVGH-NCNU 977902, TCVGH-NCNU 987901, TCVGHNCNU 987904, Taichung Veterans General Hospital and National Chi-Nan University.

References 1 A. W. Boots, G. R. Haenen and A. Bast, Eur. J. Pharmacol., 2008, 585, 325–337. 2 S. R. Volate, D. M. Davenport, S. J. Muga and M. J. Wargovich, Carcinogenesis, 2005, 26, 1450–1456. 3 A. W. Boots, M. Drent, E. L. Swennen, H. J. Moonen, A. Bast and G. R. Haenen, Respir. Med., 2009, 103, 364–372. 4 R. L. Edwards, T. Lyon, S. E. Litwin, A. Rabovsky, J. D. Symons and T. Jalili, J. Nutr., 2007, 137, 2405–2411. 5 A. G. L opez-Reyes, N. Arroyo-Curras, B. G. Cano, V. J. Lara-Dıaz, G. E. Guajardo-Salinas, J. F. Islas, V. Morales-Oyarvide, L. A. Morales-Garza, F. J. Galvez-Gastelum, G. Grijalva and J. E. Moreno-Cuevas, Ann. Hepatol., 2008, 7, 130–135. 6 E. S. Lee, H. E. Lee, J. Y. Shin, S. Yoon and J. O. Moon, J. Pharm. Pharmacol., 2003, 55, 1169–1174. 7 N. Kawada, S. Seki, M. Inoue and T. Kuroki, Hepatology, 1998, 27, 1265–1274. 8 W. I. Jeong, O. Park, S. Radaeva and B. Gao, Hepatology, 2006, 44, 1441–1451. 9 I. Aprigliano, J. Dudas, G. Ramadori and B. Saile, Liver Int., 2008, 28, 546–557. 10 F. R. Murphy, R. Issa, X. Zhou, S. Ratnarajah, H. Nagase, M. J. Arthur, C. Benyon and J. P. Iredale, J. Biol. Chem., 2002, 277, 11069–11076. 11 P. O. Seglen, 1976, Cell Biol., vol. 13, pp. 29–83, Academic Press, New York. 12 H. I. Field, D. Feny€ o and R. C. Beavis, Prot. Clin. Appl., 2002, 2, 36– 47. 13 M. Yoshida, M. Yamamoto and T. Nikaido, Cancer Res., 1992, 52, 6676–6681. 14 S. U. Mertens-Talcott, S. T. Talcott and S. S. Percival, J. Nutr., 2003, 133, 2669–2674. 15 F. Brisdelli, C. Coccia, B. Cinque, M. G. Cifone and A. Bozzi, Mol. Cell. Biochem., 2007, 296, 137–149. 16 M. Adachi, Y. Osawa, H. Uchinami, T. Kitamura, D. Accili and D. A. Brenner, Free Radical Bio. Med., 2007, 132, 1434–1446. 17 M. Date, K. Matsuzaki, M. Matsushita, Y. Tahashi, F. Furukawa and K. Inoue, Gut, 2000, 46, 719–724. 18 S. Reif, A. Lang, J. N. Lindquist, Y. Yata, E. Gabele, A. Scanga, D. A. Brenner and R. A. Rippe, J. Biol. Chem., 2003, 278, 8083–8090. 19 A. Bast and G. R. Haenen, Environ. Toxicol. Pharmacol., 2002, 11, 251–258. 20 A. Meister, J. Biol. Chem., 1994, 269, 9397–9400. 21 G. C. Yen, P. D. Duh, H. L. Tsai and S. L. Huang, Biosci., Biotechnol., Biochem., 2003, 67, 1215–1222. 22 J. J. van Zanden, O. Ben Hamman, M. L. van Iersel, S. Boeren, N. H. Cnubben, M. Lo Bello, J. Vervoort, P. J. van Bladeren and I. M. Rietjens, Chem.-Biol. Interact., 2003, 145, 139–148. 23 F. R. Gasparin, F. L. Spitzner, E. L. Ishii-Iwamoto, A. Bracht and J. Constantin, Xenobiotica, 2003, 33, 903–911.

Food Funct., 2011, 2, 204–212 | 211

View Online

30 B. Saile, N. Matthes, H. El Armouche, K. Neubauer and G. Ramadori, Eur. J. Cell Biol., 2001, 80, 554–561. 31 Y. Zhai, B. Qiao, F. Gao, X. Shen, A. Vardanian, R. W. Busuttil and J. W. Kupiec-Weglinski, Hepatology, 2008, 47, 199–206. 32 M. T. Liu, H. S. Keirstead and T. E. Lane, J. Immunol., 2001, 167, 4091–4097. 33 S. Goddard, A. Williams, C. Morland, S. Qin, R. Gladue, S. G. Hubscher and D. H. Adams, Transplantation, 2001, 72, 1957– 1967. 34 E. H. van der Horst, B. T. Frank, L. Chinn, A. Coxon, S. Li, F. Polesso, A. Slavin, A. Ruefli-Brasse and H. Wesche, Neoplasia., 2008, 10, 340–347. 35 F. Marra, J. Hepatol., 1999, 31, 1106–1119.

Downloaded on 12 April 2011 Published on 21 March 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00158A

24 D. B. Kristensen, N. Kawada, K. Imamura, Y. Miyamoto, C. Tateno, S. Seki, T. Kuroki and K. Yoshizato, Hepatology, 2000, 32, 268–277. 25 N. N. Danial, C. F. Gramm, L. Scorrano, C. Y. Zhang, S. Krauss, A. M. Ranger, S. R. Datta, M. E. Greenberg, L. J. Licklider, B. B. Lowell, S. P. Gygi and S. J. Korsmeyer, Nature, 2003, 424, 952–6. 26 B. Knoops, A. Clippe, C. Bogard, K. Arsalane, R. Wattiez, C. Hermans, E. Duconseille, P. Falmagne and A. Bernard, J. Biol. Chem., 1999, 274, 30451–30458. 27 R. A. Janssen and J. W. Mier, Mol. Biol. Cell, 1997, 8, 897–908. 28 H. Reynaert, M. G. Thompson, T. Thomas and A. Geerts, Gut, 2002, 50, 571–581. 29 M. R. Watson, K. Wallace, R. G. Gieling, D. M. Manas, E. Jaffray, R. T. Hay, D. A. Mann and F. Oakley, J. Hepatol., 2008, 48, 589–597.

212 | Food Funct., 2011, 2, 204–212

This journal is ª The Royal Society of Chemistry 2011

View Online

International Symposia on Advancing the Chemical Sciences (ISACS)

Downloaded on 12 April 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90008K

Challenges in Chemical Biology (ISACS5) 26-29 July 2011 l University of Manchester, UK Topical

Speakers include

Gain a state-of-the-art review of current research developments and identify future challenges in a comprehensive plenary programme.

Thomas Steitz, USA (Nobel Laureate) Venki Ramakrishnan, UK (Nobel Laureate) Donna Blackmond, USA Ben Davis, UK Andrew Ellington, USA Hermann Gaub, Germany Reza Ghadiri, USA Nathaneal Gray, USA Andrew Griffiths, France Bartosz A Grzybowski, USA Johan Hofkens, Belgium Philip Holliger, UK Clyde Hutchison, USA Stefan Knapp, UK Stephen Mann, UK David Rees, UK Hugh Rosen, USA William Shih, USA Hiroaki Suga, Japan Erik Winfree, USA

Interactive Network with the editors of Chemical Science and international colleagues and present your research in the poster sessions.

Dynamic Hear from a new generation of exceptional, internationally renowned researchers.

New for 2011 We have a limited number of oral presentation slots available at ISACS5. If you are interested in presenting your work at the meeting, visit the website to submit your abstract for consideration by the conference committee.

About ISACS The International Symposia on Advancing the Chemical Sciences (ISACS) is a significant new global symposia series, supporting the launch of the new RSC flagship journal Chemical Science. Related events include:

Challenges in Renewable Energy (ISACS4) 5-8 July 2011 l Boston, USA l www.rsc.org/isacs4 Challenges in Organic Materials & Supramolecular Chemistry (ISACS6) 2-5 September 2011 l Beijing, China l www.rsc.org/isacs6 Co-sponsored by: RSC Chemical Biology Interface Division

Conference Committee Hagan Bayley, UK (Conference Chair) Benjamin Cravatt, USA Thomas Carell, Germany John McCarthy, UK

Sign up for news updates and register at: www.rsc.org/isacs5 Registered Charity Number 207890

MyRSC – Online Community View Online

Food & Function Linking the chemistry and physics of food with health and nutrition

Downloaded on 12 April 2011 Published on 08 April 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90008K

www.rsc.org/foodfunction

Volume 2 | Number 3–4 | April 2011 | Pages 145–214

A professional network for the chemical sciences, hosted by the RSC MyRSC is leading the way in providing an international networking hub for advancing the chemical sciences. Connect, engage and interact with scientists across the globe regardless of location, career stage or interest. • Personalise your profile to reflect your specific interests • Grow your network with people who share common interests, research or workplace • Join groups and communities based in your field • Exchange knowledge and expertise with fellow scientists or to get help and ask questions • Follow blogs and discussion forums - carry on the debate

How to register with MyRSC Go to http://my.rsc.org and click on register, fill out the form. An email will be sent to your specified address, follow the link to activate your MyRSC account. You can find and download our quick start guide at http://my.rsc.org/quickstartguide

http://my.rsc.org Registered Charity Number 207890

ISSN 2042-6496

COVER ARTICLE Pradeep Singh Negi et al. Expression of carotenoid biosynthetic pathway genes and changes in carotenoids during ripening in tomato (Lycopersicon esculentum)

2042-6496(2011)2:3/4;1-8